U.S. patent application number 16/232463 was filed with the patent office on 2019-04-25 for human ctla-4 antibodies and their uses.
The applicant listed for this patent is E.R. Squibb & Sons, L.L.C.. Invention is credited to Yashwant M. Deo, Edward L. Halk, Tibor P. Keler, Alan J. Korman, Nils Lonberg.
Application Number | 20190119384 16/232463 |
Document ID | / |
Family ID | 46278118 |
Filed Date | 2019-04-25 |
View All Diagrams
United States Patent
Application |
20190119384 |
Kind Code |
A1 |
Korman; Alan J. ; et
al. |
April 25, 2019 |
HUMAN CTLA-4 ANTIBODIES AND THEIR USES
Abstract
The presently subject matter provides novel human sequence
antibodies against human CTLA-4 and methods of treating human
diseases, infections and other conditions using these
antibodies.
Inventors: |
Korman; Alan J.; (Piedmont,
CA) ; Halk; Edward L.; (Sunnyvale, CA) ;
Lonberg; Nils; (Woodside, CA) ; Deo; Yashwant M.;
(Point Vedra Beach, FL) ; Keler; Tibor P.;
(Pipersville, PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
E.R. Squibb & Sons, L.L.C. |
Princeton |
NJ |
US |
|
|
Family ID: |
46278118 |
Appl. No.: |
16/232463 |
Filed: |
December 26, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15163332 |
May 24, 2016 |
|
|
|
16232463 |
|
|
|
|
14263207 |
Apr 28, 2014 |
|
|
|
15163332 |
|
|
|
|
13666672 |
Nov 1, 2012 |
8784815 |
|
|
14263207 |
|
|
|
|
13198263 |
Aug 4, 2011 |
8318916 |
|
|
13666672 |
|
|
|
|
12564756 |
Sep 22, 2009 |
8017114 |
|
|
13198263 |
|
|
|
|
09948939 |
Sep 7, 2001 |
7605238 |
|
|
12564756 |
|
|
|
|
09644668 |
Aug 24, 2000 |
6984720 |
|
|
09948939 |
|
|
|
|
60150452 |
Aug 24, 1999 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2267/0325 20130101;
C07K 2317/732 20130101; A01K 2207/15 20130101; Y02A 50/30 20180101;
A01K 2267/0381 20130101; Y02A 50/41 20180101; A01K 2217/05
20130101; A01K 2267/01 20130101; A61K 2039/505 20130101; C07K
2317/565 20130101; A01K 2217/072 20130101; A61P 35/04 20180101;
C07K 2317/92 20130101; Y02A 50/487 20180101; Y02A 50/386 20180101;
Y02A 50/407 20180101; A01K 67/0276 20130101; C07K 2317/21 20130101;
Y02A 50/466 20180101; A01K 67/0275 20130101; C07K 2317/56 20130101;
Y02A 50/412 20180101; A61K 39/3955 20130101; C07K 16/2818 20130101;
C07K 2317/76 20130101; A01K 2267/025 20130101; Y02A 50/489
20180101; A01K 2217/00 20130101; A01K 2227/105 20130101; C07K
2319/00 20130101; A01K 67/0278 20130101; A01K 2217/075 20130101;
C12N 15/8509 20130101; A01K 2267/03 20130101; C07K 2317/33
20130101 |
International
Class: |
C07K 16/28 20060101
C07K016/28; A01K 67/027 20060101 A01K067/027; C12N 15/85 20060101
C12N015/85; A61K 39/395 20060101 A61K039/395 |
Claims
1. A monoclonal antibody or antigen-binding portion thereof,
comprising a heavy chain variable region that comprises CDR1, CDR2,
and CDR3 domains; and a light chain variable region that comprises
CDR1, CDR2, and CDR3 domains, wherein the heavy chain variable
region and light chain variable region CDR3 domains are selected
from the group consisting of: (a) a heavy chain variable region
CDR3 comprising amino acids having the sequence set forth in SEQ ID
NO:37; and a light chain variable region CDR3 comprising amino
acids having the sequence set forth in SEQ ID NO:35; and (b) a
heavy chain variable region CDR3 comprising amino acids having the
sequence set forth in SEQ ID NO:38; and a light chain variable
region CDR3 comprising amino acids having the sequence set forth in
SEQ ID NO:36; and wherein the antibody or antigen-binding portion
thereof binds to human CTLA-4 with a binding affinity of about
10.sup.8 M.sup.-1 or greater.
2. The antibody or antigen-binding portion thereof of claim 1,
wherein the heavy chain variable region and light chain variable
region CDR2 domains are selected from the group consisting of: (a)
a heavy chain variable region CDR2 comprising amino acids having
the sequence set forth in SEQ ID No:32; and a light chain variable
region CDR2 comprising amino acids having the sequence set forth in
SEQ ID NO:29; (b) a heavy chain variable region CDR2 comprising
amino acids having the sequence set forth in SEQ ID NO:33; and a
light chain variable region CDR2 comprising amino acids having the
sequence set forth in SEQ ID NO:30; and (c) a heavy chain variable
region CDR2 comprising amino acids having the sequence set forth in
SEQ ID NO:34; and a light chain variable region CDR2 comprising
amino acids having the sequence set forth in SEQ ID NO:31.
3. The antibody or antigen-binding portion thereof of claim 2,
wherein the heavy chain variable region and light chain variable
region CDR1 domains are selected from the group consisting of: (a)
a heavy chain variable region CDR1 comprising amino acids having
the sequence set forth in SEQ ID NO:27; and a light chain variable
region CDR1 comprising amino acids having the sequence set forth in
SEQ ID NO:24; (b) a heavy chain variable region CDR1 comprising
amino acids having the sequence set forth in SEQ ID NO:27; and a
light chain variable region CDR1 comprising amino acids having the
sequence set forth in SEQ ID NO:25; and (c) a heavy chain variable
region CDR1 comprising amino acids having the sequence set forth in
SEQ ID NO:28; and a light chain variable region CDR1 comprising
amino acids having the sequence set forth in SEQ ID NO:26.
4. A monoclonal antibody or an antigen-binding portion thereof that
specifically binds to human CTLA-4 and comprises a heavy chain
variable region and a light chain variable region, wherein the
heavy chain variable region comprises amino acids having a sequence
selected from the group consisting of SEQ ID NOs:17, 19 and 23.
5. A monoclonal antibody or an antigen-binding portion thereof that
specifically binds to human CTLA-4 and comprises a heavy chain
variable region and a light chain variable region, wherein the
light chain variable region comprises amino acids having a sequence
selected from the group consisting of SEQ ID NOs:7, 9 and 13.
6. A monoclonal antibody or antigen-binding portion thereof that
specifically binds to human CTLA-4 and comprises a heavy chain
variable region comprising CDR1, CDR2, and CDR3; and a light chain
variable region comprising CDR1, CDR2, and CDR3, wherein the heavy
chain CDR1, CDR2, and CDR3 are selected from the group consisting
of: (a) a heavy chain CDR1 comprising amino acids having the
sequence set forth in SEQ ID NO:27, a heavy chain CDR2 comprising
amino acids having the sequence set forth in SEQ ID NO:32, and a
heavy chain CDR3 comprising amino acids having the sequence set
forth in SEQ ID NO:37; (b) a heavy chain CDR1 comprising amino
acids having the sequence set forth in SEQ ID NO:27, a heavy chain
CDR2 comprising amino acids having the sequence set forth in SEQ ID
NO:33, and a heavy chain CDR3 comprising amino acids having the
sequence set forth in SEQ ID NO:37; and (c) a heavy chain CDR1
comprising amino acids having the sequence set forth in SEQ ID
NO:28, a heavy chain CDR2 comprising amino acids having the
sequence set forth in SEQ ID NO:34, and a heavy chain CDR3
comprising amino acids having the sequence set forth in SEQ ID
NO:38.
7. A monoclonal antibody or antigen-binding portion thereof that
specifically binds to CTLA-4 and comprises a heavy chain variable
region that comprises CDR1, CDR2, and CDR3, and a light chain
variable region that comprises CDR1, CDR2, and CDR3, wherein the
light chain CDR1, CDR2, and CDR3 are selected from the group
consisting of: (a) a light chain CDR1 comprising amino acids having
the sequence set forth in SEQ ID NO:24, a light chain CDR2
comprising amino acids having the sequence set forth in SEQ ID
NO:29, and a light chain CDR3 comprising amino acids having the
sequence set forth in SEQ ID NO:35; (b) a light chain CDR1
comprising amino acids having the sequence set forth in SEQ ID
NO:25, a light chain CDR2 comprising amino acids having the
sequence set forth in SEQ ID NO:30, and a light chain CDR3
comprising amino acids having the sequence set forth in SEQ ID
NO:35; and (c) a light chain CDR1 comprising amino acids having the
sequence set forth in SEQ ID NO:26, a light chain CDR2 comprising
amino acids having the sequence set forth in SEQ ID NO:31, and a
light chain CDR3 comprising amino acids having the sequence set
forth in SEQ ID NO:36.
8. An isolated nucleic acid encoding a heavy chain variable region
and/or a light chain variable region of the monoclonal antibody or
antigen-binding portion thereof of claim 1.
9. A host cell expressing a polypeptide encoded by the nucleic acid
of claim 8.
10. A transgenic mouse comprising the host cell of claim 9, wherein
the mouse expresses a polypeptide encoded by the nucleic acid.
11. A hybridoma prepared from the transgenic mouse of claim 10,
wherein the hybridoma produces a polypeptide encoded by the nucleic
acid.
12. A hybridoma secreting a monoclonal antibody or antigen-binding
portion thereof, wherein the antibody or antigen-binding portion
thereof comprises a heavy chain variable region that comprises
CDR1, CDR2, and CDR3 domains; and a light chain variable region
that comprises CDR1, CDR2, and CDR3 domains, wherein the heavy
chain variable region and light chain variable region CDR3 domains
are selected from the group consisting of: (a) a heavy chain
variable region CDR3 comprising amino acids having the sequence set
forth in SEQ ID NO:37; and a light chain variable region CDR3
comprising amino acids having the sequence set forth in SEQ ID
NO:35; and (b) a heavy chain variable region CDR3 comprising amino
acids having the sequence set forth in SEQ ID NO:38; and a light
chain variable region CDR3 comprising amino acids having the
sequence set forth in SEQ ID NO:36; and wherein the antibody or
antigen-binding portion thereof binds to human CTLA-4 with a
binding affinity of about 10.sup.8 M.sup.-1 or greater.
13. A method for increasing an immune response to an antigen in a
subject, which method comprising administering to the subject the
antibody or antigen-binding portion thereof of claim 1.
14. A method for treating cancer in a subject, which method
comprising administering to the subject the antibody or
antigen-binding portion thereof of claim 1.
Description
REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. patent
application Ser. No. 15/163,332 filed May 24, 2016, which is a
divisional of U.S. patent application Ser. No. 14/263,207, filed
Apr. 28, 2014, which is a continuation of U.S. patent application
Ser. No. 13/666,672, filed Nov. 1, 2012, issued as U.S. Pat. No.
8,784,815, which is a continuation of U.S. patent application Ser.
No. 13/198,263, filed Aug. 4, 2011, issued as U.S. Pat. No.
8,318,916, which is a divisional of U.S. patent application Ser.
No. 12/564,756, filed Sep. 22, 2009, issued as U.S. Pat. No.
8,017,114, which is a continuation of U.S. patent application Ser.
No. 09/948,939, filed Sep. 7, 2001, issued as U.S. Pat. No.
7,605,238, which is a continuation-in-part of U.S. patent
application Ser. No. 09/644,668, filed Aug. 24, 2000, issued as
U.S. Pat. No. 6,984,720, which claims priority to U.S. provisional
patent application Ser. No. 60/150,452, filed Aug. 24, 1999, the
contents of each of which are incorporated by reference in their
entirety, and to each of which priority is claimed.
SEQUENCE LISTING
[0002] The specification further incorporates by references the
Sequence Listing submitted via EFS on May 24, 2016. The Sequence
Listing text file, identified as 0773750969CONseqlist.txt, is
43,441 bytes and was created on May 23, 2016. The Sequence Listing,
electronically filed, does not extend beyond the scope of the
specification and does not contain new matter.
FIELD OF THE INVENTION
[0003] The present invention relates generally to molecular
immunology and the treatment of human diseases. In particular, it
relates to novel human sequence antibodies against human CTLA-4 and
methods of treating human diseases and infections using these
antibodies.
BACKGROUND OF THE INVENTION
[0004] The vertebrate immune system requires multiple signals to
achieve optimal immune activation; see, e.g., Janeway, Cold Spring
Harbor Symp. Quant. Biol. 54:1-14 (1989); Paul William E., ed.
Raven Press, N.Y., Fundamental Immunology, 4th edition (1998),
particularly chapters 12 and 13, pages 411 to 478. Interactions
between T lymphocytes (T cells) and antigen presenting cells (APC)
are essential to the immune response. Levels of many cohesive
molecules found on T cells and APC's increase during an immune
response (Springer et al., A. Rev. Immunol. 5:223-252 (1987); Shaw
and Shimuzu, Current Opinion in Immunology, Eds. Kindt and Long,
1:92-97 (1988)); and Hemler, Immunology Today 9:109-113 (1988)).
Increased levels of these molecules may help explain why activated
APC's are more effective at stimulating antigen-specific T cell
proliferation than are resting APC's (Kaiuchi et al., J. Immunol.
131:109-114 (1983); Kreiger et al., J. Immunol. 135:2937-2945
(1985); McKenzie, J. Immunol. 141:2907-2911 (1988); and Hawrylowicz
and Unanue, J. Immunol. 141:4083-4088 (1988)).
[0005] T cell immune response is a complex process that involves
cell-cell interactions (Springer et al., A. Rev. Immunol. 5:223-252
(1987)), particularly between T and accessory cells such as APC's,
and production of soluble immune mediators (cytokines or
lymphokines) (Dinarello (1987) New Engl. Jour. Med 317:940-945;
Sallusto (1997) J. Exp. Med. 179:1109-1118). This response is
regulated by several T-cell surface receptors, including the T-cell
receptor complex (Weiss (1986) Ann. Rev. Immunol. 4:593-619) and
other "accessory" surface molecules (Allison (1994) Curr. Opin.
Immunol. 6:414-419; Springer (1987) supra). Many of these accessory
molecules are naturally occurring cell surface differentiation (CD)
antigens defined by the reactivity of monoclonal antibodies on the
surface of cells (McMichael, Ed., Leukocyte Typing III, Oxford
Univ. Press, Oxford, N.Y. (1987)).
[0006] Early studies suggested that B lymphocyte activation
requires two signals (Bretscher (1970) Science 169:1042-1049) and
now it is believed that all lymphocytes require two signals for
their optimal activation, an antigen specific or clonal signal, as
well as a second, antigen non-specific signal. (Janeway, supra).
Freeman (1989) J. Immunol. 143:2714-2722) isolated and sequenced a
cDNA clone encoding a B cell activation antigen recognized by MAb
B7 (Freeman (1987) J. Immunol. 138:3260). COS cells transfected
with this cDNA have been shown to stain by both labeled MAb B7 and
MAb BB-1 (Clark (1986) Human Immunol. 16:100-113; Yokochi (1981) J.
Immunol. 128:823; Freeman et al., (1989) supra; Freeman et al.
(1987), supra). In addition, expression of this antigen has been
detected on cells of other lineages, such as monocytes (Freeman et
al., supra).
[0007] T helper cell (Th) antigenic response requires signals
provided by APC's. The first signal is initiated by interaction of
the T cell receptor complex (Weiss, J. Clin. Invest. 86:1015
(1990)) with antigen presented in the context of class II major
histocompatibility complex (MHC) molecules on the APC (Allen,
Immunol. Today 8:270 (1987)). This antigen-specific signal is not
sufficient to generate a full response, and in the absence of a
second signal may actually lead to clonal inactivation or anergy
(Schwartz, Science 248:1349 (1990)). The requirement for a second
"costimulatory" signal provided by the MHC has been demonstrated in
a number of experimental systems (Schwartz, supra; Weaver and
Unanue, Immunol. Today 11:49 (1990)). The molecular nature of this
second signal is not completely understood, although it is clear in
some cases that both soluble molecules such as interleukin (IL)-1
(Weaver and Unanue, supra) and membrane receptors involved in
intercellular adhesion (Springer, Nature 346:425 (1990)) can
provide costimulatory signals.
[0008] CD28 antigen, a homodimeric glycoprotein of the
immunoglobulin superfamily (Aruffo and Seed, Proc. Natl. Acad. Sci.
84:8573-8577 (1987)), is an accessory molecule found on most mature
human T cells (Damle et al., J. Immunol. 131:2296-2300 (1983)).
Current evidence suggests that this molecule functions in an
alternative T cell activation pathway distinct from that initiated
by the T-cell receptor complex (June et al., Mol. Cell. Biol.
7:4472-4481 (1987)). Monoclonal antibodies (MAbs) reactive with
CD28 antigen can augment T cell responses initiated by various
polyclonal stimuli (reviewed by June et al., supra). These
stimulatory effects may result from MAb-induced cytokine production
(Thompson et al., Proc. Natl. Acad. Sci 86:1333-1337 (1989); and
Lindsten et al., Science 244:339-343 (1989)) as a consequence of
increased mRNA stabilization (Lindsten et al. (1989), supra).
Anti-CD28 mAbs can also have inhibitory effects, i.e., they can
block autologous mixed lymphocyte reactions (Damle et al., Proc.
Natl. Acad. Sci. 78:5096-6001 (1981)) and activation of
antigen-specific T cell clones (Lesslauer et al., Eur. J. Immunol.
16:1289-1296 (1986)). Some studies have indicated that CD28 is a
counter-receptor for the B cell activation antigen, B7/BB-1
(Linsley et al., Proc. Natl. Acad. Sci. USA 87:5031-5035 (1990)).
The B7/BB-1 antigen is hereafter referred to as the "B7 antigen".
The B7 ligands are also members of the immunoglobulin superfamily
but have, in contrast to CD28, two Ig domains in their
extracellular region, an N-terminal variable (V)-like domain
followed by a constant (C)-like domain.
[0009] Delivery of a non-specific costimulatory signal to the T
cell requires at least two homologous B7 family members found on
APC's, B7-1 (also called B7, B7.1, or CD80) and B7-2 (also called
B7.2 or CD86), both of which can deliver costimulatory signals to T
cells via CD28. Costimulation through CD28 promotes T cell
activation.
[0010] Using genetic fusions of the extracellular portions of B7
antigen and CD28 receptor, and Immunoglobulin (Ig) C.gamma.1
(constant region heavy chains), interactions between CD28 and B7
antigen have been characterized (Linsley et al., J. Exp. Med.
173:721-730 (1991)). Immobilized B7Ig fusion protein, as well as B7
positive CHO cells, have been shown to costimulate T cell
proliferation.
[0011] T cell stimulation with B7 positive CHO cells also
specifically stimulates increased levels of transcripts for IL-2.
Additional studies have shown that anti-CD28 MAb inhibited IL-2
production induced in certain T cell leukemia cell lines by
cellular interactions with a B cell leukemia line (Kohno et al.,
Cell. Immunol. 131-1-10 (1990)).
[0012] CD28 has a single extracellular variable region (V)-like
domain (Aruffo and Seed, supra). A homologous molecule, CTLA-4 has
been identified by differential screening of a murine cytolytic-T
cell cDNA library (Brunet (1987) Nature 328:267-270).
[0013] CTLA-4 is a T cell surface molecule that was originally
identified by differential screening of a murine cytolytic T cell
cDNA library (Brunet et al., Nature 328:267-270(1987)). CTLA-4 is
also a member of the immunoglobulin (Ig) superfamily; CTLA-4
comprises a single extracellular Ig domain. CTLA-4 transcripts have
been found in T cell populations having cytotoxic activity,
suggesting that CTLA-4 might function in the cytolytic response
(Brunet et al., supra; Brunet et al., Immunol. Rev. 103-21-36
(1988)). Researchers have reported the cloning and mapping of a
gene for the human counterpart of CTLA-4 (Dariavach et al., Eur. J.
Immunol. 18:1901-1905 (1988)) to the same chromosomal region
(2q33-34) as CD28 (Lafage-Pochitaloff et al., Immunogenetics
31:198-201 (1990)). Sequence comparison between this human CTLA-4
DNA and that encoding CD28 proteins reveals significant homology of
sequence, with the greatest degree of homology in the juxtamembrane
and cytoplasmic regions (Brunet et al., 1988, supra; Dariavach et
al., 1988, supra).
[0014] Some studies have suggested that CTLA-4 has an analogous
function as a secondary costimulator (Linsley et al., J Exp. Med.
176:1595-1604 (1992); Wu et al., J Exp. Med. 185:1327-1335 (1997)
Lindsley, P. et al. U.S. Pat. Nos. 5,977,318; 5,968,510; 5,885,796;
and 5,885,579). However, others have reported that CTLA-4 has an
opposing role as a dampener of T cell activation (Krummel (1995) J.
Exp. Med. 182:459-465); Krummel et al., Int'l Immunol.
8:519-523(1996); Chambers et al., Immunity. 7:885-895(1997)). It
has been reported that CTLA-4 deficient mice suffer from massive
lymphoproliferation (Chambers et al., supra). It has been reported
that CTLA-4 blockade augments T cell responses in vitro (Walunas et
al., Immunity. 1:405-413 (1994)) and in vivo (Kearney (1995) J.
Immunol. 155:1032-1036), exacerbates antitumor immunity (Leach
(1996) Science. 271:1734-1736), and enhances an induced autoimmune
disease (Luhder (1998) J Exp. Med. 187:427-432). It has also been
reported that CTLA-4 has an alternative or additional impact on the
initial character of the T cell immune response (Chambers (1997)
Curr. Opin. Immunol. 9:396-404; Bluestone (1997) J. Immunol.
158:1989-1993; Thompson (1997) Immunity 7:445-450). This is
consistent with the observation that some autoimmune patients have
autoantibodies to CTLA-4. It is possible that CTLA-4 blocking
antibodies have a pathogenic role in these patients (Matsui (1999)
J. Immunol. 162:4328-4335).
[0015] Non-human CTLA-4 antibodies have be used in the various
studies discussed above. However, one of the major impediments
facing the development of in vivo therapeutic and diagnostic
applications for antibodies in humans is the intrinsic
immunogenicity of non-human immunoglobulins. For example, when
immunocompetent human patients are administered therapeutic doses
of rodent monoclonal antibodies, the patients produce antibodies
against the rodent immunoglobulin sequences; these human anti-mouse
antibodies (HAMA) neutralize the therapeutic antibodies and can
cause acute toxicity. These and other deficiencies in the previous
antibodies are overcome by the provision of human antibodies to
CTLA-4 by the present invention.
SUMMARY OF THE INVENTION
[0016] The present invention provides a human sequence antibody
that specifically binds to human CTLA-4 and a human sequence
antibody that specifically binds to human CTLA-4 which is
substantially free of non-immunoglobulin associated human
proteins.
[0017] In a related aspect, the invention also provides a
therapeutically-effective human sequence antibody that specifically
binds to human CTLA-4. In some embodiments, the
therapeutically-effective human sequence antibody binds to CTLA-4
on the cell surface of normal human T cells. In other embodiments,
the T cell subpopulations marked by CD antigens CD4, CD8, CD25, and
CD69 remain stable during and subsequent to the administration of
the therapeutically-effective human sequence antibody. In other
embodiments, the therapeutically-effective human sequence antibody
binds CTLA-4 on the cell surface of normal human T cells. In other
embodiments, the human sequence antibody is well-tolerated in a
patient.
[0018] Also provided is a composition of polyclonal antibodies
comprising a plurality of human sequence antibodies that
specifically bind to human CTLA-4. The composition of polyclonal
antibodies can comprise at least about 2, 5, 10, 50, 100, 500 or
1000 different human sequence antibodies that specifically bind to
human CTLA-4.
[0019] The invention also provides human sequence antibodies that
specifically bind to human CTLA-4 and which block binding of human
CTLA-4 to human B7 or do not block binding of human CTLA-4 to human
B7.
[0020] The invention also provides human sequence antibodies that
bind to human CTLA-4 with an equilibrium association constant (Ka)
of at least 10.sup.8 M.sup.-1. Also provided are human sequence
antibodies that bind to human CTLA-4 with an equilibrium
association constant (Ka) of at least 10.sup.9M.sup.-1.
[0021] The invention also provides human sequence antibodies that
specifically bind to human CTLA-4 that block binding of human
CTLA-4 to human B7 by at least about 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, 99%, or 100%.
[0022] The invention also provides human sequence antibodies that
specifically bind to human CTLA-4 having an antibody heavy chain of
either IgG or IgM. The IgG antibody heavy chain can be IgG1, IgG2,
IgG3 or IgG4. The invention also provides human sequence antibodies
wherein the antibody light chain is a kappa light chain. The human
sequence antibody can be encoded by human IgG heavy chain and human
kappa light chain nucleic acids that comprise nucleotide sequences
in their variable regions as set forth in SEQ ID NO:2 through SEQ
ID NO:23, respectively.
[0023] The invention also provides a human sequence antibody
wherein the human sequence antibody is encoded by human IgG heavy
chain and human kappa light chain nucleic acids that comprise
nucleotide sequences in their variable regions as set forth in SEQ
ID NO:16 and SEQ ID NO:6, respectively.
[0024] The invention also provides a human sequence antibody
wherein the human sequence antibody is encoded by human IgG heavy
chain and human kappa light chain nucleic acids that comprise
nucleotide sequences in their variable regions as set forth in SEQ
ID NO:18 and SEQ ID NO:8, respectively.
[0025] The invention also provides a human sequence antibody
wherein the human sequence antibody is encoded by human IgG heavy
chain and human kappa light chain nucleic acids that comprise
nucleotide sequences in their variable regions as set forth in SEQ
ID NO:22 and SEQ ID NO:12, respectively.
[0026] The invention also provides a human sequence antibody
wherein the human sequence antibody is encoded by heavy chain and
light chain variable region amino acid sequences as set for the in
SEQ ID NO:17 and SEQ ID NO:7, respectively.
[0027] The invention provides a human sequence antibody wherein the
human sequence antibody is encoded by heavy chain and light chain
variable region amino acid sequences as set for the in SEQ ID NO:19
and SEQ ID NO:9, respectively.
[0028] The invention also provides a human sequence antibody
wherein the human sequence antibody is encoded by heavy chain and
light chain variable region amino acid sequences as set for the in
SEQ ID NO:23 and SEQ ID NO:13, respectively.
[0029] The invention provides a human sequence antibody wherein the
human sequence antibody is encoded by human IgG heavy chain and
human kappa light chain nucleic acids comprising variable heavy and
light chain sequences from V gene segments VH 3-30.3 and VK A-27,
respectively.
[0030] The invention also provides a human sequence antibody
wherein the human sequence antibody is encoded by human IgG heavy
chain and human kappa light chain nucleic acids comprising variable
heavy and light chain sequences from V gene segments VH 3-33 and VK
L-15, respectively.
[0031] Some human sequence antibodies of the invention comprise
heavy chain CDR1, CDR2, and CDR3 sequences, SYTMH (SEQ ID NO:27),
FISYDGNNKYYADSVKG (SEQ ID NO:32) and TGWLGPFDY (SEQ ID NO:37),
respectively, and light chain CDR1, CDR2, and CDR3 sequences,
RASQSVGSSYLA (SEQ ID NO:24), GAFSRAT (SEQ ID NO:29), and QQYGSSPWT
(SEQ ID NO:35), respectively.
[0032] Some human sequence antibodies of the invention comprise
heavy chain CDR1, CDR2, and CDR3 sequences, SYTMH (SEQ ID NO:27),
FISYDGSNKHYADSVKG (SEQ ID NO:33) and TGWLGPFDY (SEQ ID NO:37),
respectively, and light chain CDR1, CDR2, and CDR3 sequences,
RASQSVSSSFLA (SEQ ID NO:25), GASSRAT (SEQ ID NO:30), and QQYGSSPWT
(SEQ ID NO:35), respectively.
[0033] Other human sequence antibodies of the invention comprise
heavy chain CDR1, CDR2, and CDR3 sequences, SYGMH (SEQ ID NO:28),
VIWYDGSNKYYADSVKG (SEQ ID NO:34) and APNYIGAFDV (SEQ ID NO:38),
respectively, and light chain CDR1, CDR2, and CDR3 sequences,
RASQGISSWLA (SEQ ID NO:26), AASSLQS (SEQ ID NO:31), and QQYNSYPPT
(SEQ ID NO:36), respectively.
[0034] The invention also provides human sequence antibodies that
specifically bind to human CTLA-4, wherein said human sequence
antibody is produced by a transgenic non-human animal. The
transgenic non-human animal can be a mouse.
[0035] The invention also provides a human sequence antibody that
specifically bind to human CTLA-4 that is a Fab fragment.
[0036] The invention provides a polyvalent complex comprising at
least two human sequence antibodies each of which specifically
binds to human CTLA-4. The two different antibodies can be linked
to each other covalently or non-covalently.
[0037] The invention provides a nucleic acid encoding a heavy chain
of a human sequence antibody. The nucleic acid can comprise a
nucleotide sequence as set forth in SEQ ID NO:1.
[0038] The invention provides a transgenic non-human animal having
a genome comprising a human sequence heavy chain transgene and a
human sequence light chain transgene, which animal has been
immunized with a human CTLA-4, or a fragment or an analog thereof,
whereby the animal expresses human sequence antibodies to the human
CTLA-4. The transgenic non-human animal can be a transgenic mouse.
The transgenic mouse can comprise HCo7 or HCo12.
[0039] The invention provides a hybridoma cell line comprising a B
cell obtained from a transgenic non-human animal having a genome
comprising a human sequence heavy chain transgene and a human
sequence light chain transgene, wherein the hybridoma produces a
human sequence antibody that specifically binds to human CTLA-4. In
a related embodiment, the hybridoma secretes a human sequence
antibody that specifically binds human CTLA-4 or binding fragment
thereof, wherein the antibody is selected from the group consisting
of: a human sequence antibody comprising heavy chain heavy chain
CDR1, CDR2, and CDR3 sequences, SYTMH (SEQ ID NO:27),
FISYDGNNKYYADSVKG (SEQ ID NO:32) and TGWLGPFDY (SEQ ID NO:37),
respectively, and light chain CDR1, CDR2, and CDR3 sequences,
RASQSVGSSYLA (SEQ ID NO:24), GAFSRAT (SEQ ID NO:29), and QQYGSSPWT
(SEQ ID NO:35), respectively, and heavy chain and light chain
variable region amino acid sequences as set forth in SEQ ID NO:17
and SEQ ID NO:7, respectively; a human sequence antibody comprising
heavy chain CDR1, CDR2, and CDR3 sequences, SYTMH (SEQ ID NO:27),
FISYDGSNKHYADSVKG (SEQ ID NO:33) and TGWLGPFDY (SEQ ID NO:37),
respectively, and light chain CDR1, CDR2, and CDR3 sequences,
RASQSVSSSFLA (SEQ ID NO:25), GASSRAT (SEQ ID NO:30), and QQYGSSPWT
(SEQ ID NO:35), respectively, and heavy chain and light chain
variable region amino acid sequences as set forth in SEQ ID NO:19
and SEQ ID NO:9, respectively; or a human sequence antibody of
claim 1, comprising heavy chain CDR1, CDR2, and CDR3 sequences,
SYGMH (SEQ ID NO:28), VIWYDGSNKYYADSVKG (SEQ ID NO:34) and
APNYIGAFDV (SEQ ID NO:38), respectively, and light chain CDR1,
CDR2, and CDR3 sequences, RASQGISSWLA (SEQ ID NO:26), AASSLQS (SEQ
ID NO:31), and QQYNSYPPT (SEQ ID NO:36), respectively, and heavy
chain and light chain variable region amino acid sequences as set
forth in SEQ ID NO:23 and SEQ ID NO:13, respectively.
[0040] The invention provides a pharmaceutical composition
comprising a human sequence antibody that specifically binds to
human CTLA-4 and a pharmaceutically acceptable carrier. The
pharmaceutical composition can further comprise an agent effective
to induce an immune response against a target antigen. Also
provided are chemotherapeutic agents. In addition, antibodies to
immunosuppressive molecules are also provided.
[0041] The invention provides a method for inducing, augmenting or
prolonging an immune response to an antigen in a patient,
comprising administering to the patient an effective dosage of a
human sequence antibody that specifically binds to human CTLA-4,
wherein the antibody blocks binding of human CTLA-4 to human B7.
The antigen can be a tumor antigen, or the antigen can be from a
pathogen. The tumor antigen can also be telomerase. The pathogen
can be a virus, a bacterium, a fungus or a parasite. The pathogen
can also be an HIV. This method can further comprise administering
the antigen, or a fragment or an analog thereof, to the patient,
whereby the antigen in combination with the human sequence antibody
induces, augments or prolongs the immune response. The antigen can
be a tumor antigen or a component of an amyloid formation in the
patient, such as a patient suffering from Alzheimer's disease and
the antigen is AB peptide. This method can further comprise
administering a cytokine to the patient.
[0042] The invention provides a method of suppressing an immune
response in a patient, comprising administering to the patient an
effective dosage of a polyvalent preparation comprising at least
two human sequence antibodies to human CTLA-4 linked to each other.
The invention also provides a method of suppressing an immune
response in a patient, comprising administering to the patient an
effective dosage of a polyclonal preparation comprising at least
two human sequence antibodies to human CTLA-4.
[0043] The present invention further provides isolated or
recombinant human sequence antibodies and human monoclonal
antibodies which specifically bind to human CTLA-4, as well as
compositions containing one or a combination of such antibodies.
Some of the human sequence antibodies of the invention are
characterized by binding to human CTLA-4 with high affinity, and/or
by blocking the interaction of human CTLA-4 with its ligand, the
human B7-1 and B7-2 molecules. Accordingly, the human sequence
antibodies and the human monoclonal antibodies of the invention can
be used as diagnostic or therapeutic agents in vivo and in
vitro.
[0044] The human sequence antibodies of the invention can encompass
various antibody isotypes, or mixtures thereof, such as IgG1, IgG2,
IgG3, IgG4, IgM, IgA1, IgA2, IgAsec, IgD, and IgE. Typically, they
include IgG1 (e.g., IgG1k) and IgM isotypes. The human sequence
antibodies can be full-length (e.g., an IgG1 or IgG4 antibody) or
can include only an antigen-binding portion (e.g., a Fab, F(ab')2,
Fv or a single chain Fv fragment). Some human sequence antibodies
are recombinant human sequence antibodies. Some human sequence
antibodies are produced by a hybridoma which includes a B cell
obtained from a transgenic non-human animal, e.g., a transgenic
mouse, having a genome comprising a human heavy chain transgene and
a human light chain transgene. The hybridoma can be made by, e.g.,
fusing the B cell to an immortalized cell. Some human sequence
antibodies of the invention are produced by hybridomas referred to
as 4C8, 4E10, 4E10.5, 5A8, 5C4, 5C4.1.3, 5D7, 5D7.1, 5E10, 5E10.12,
5G1, 5G1.4, 6A10, 6C9, 6C9.6, 6D9, 6D9.7, 6G4, 7E4, 7E4.4, 7E6,
7H8, 8E8, 8E8.4, 8F8, 8F8.19, 8H1, 9810, 9A10.1, 9B9, 9C1, 9G5,
105B, 10B5.8, 10B9, 10B9.2, 10D1, 10D1.3, 10E11, 10E4, 10E4.5,
11B4, 11D10, 11E4, 11E4.1, 11E8, 11F10, 11F11, 11F9, 11G1, 11G1.5,
1C7, 1H8.8, 2A7, 2A7.6, 2E2, 2E2.7, 2E7, 2E7.2, 2G1, 2G1.2, 3C12,
3E10, 3E10.5, 3E6, 3E6.0, 3F10, 4A1, 4B6 and 4B6.12. Suffixes after
the decimal point indicate different clonal isolates of the same
hybridoma cell lines.
[0045] Some human sequence anti-CTLA-4 antibodies of the present
invention can be characterized by one or more of the following
properties: a) specificity for human CTLA-4 (specifically binding
to human CTLA-4); b) a binding affinity to human CTLA-4 with an
equilibrium association constant (K.sub.a) of at least about
10.sup.7M.sup.-1, or about 10.sup.9 M.sup.-1, or about 10.sup.10
M.sup.-1 to 10.sup.11 M.sup.-1 or higher; c) a kinetic association
constant (k.sub.a) of at least about 10.sup.3, about 10.sup.4, or
about 10.sup.5 m.sup.-1s.sup.-1; and/or, d) a kinetic
disassociation constant (k.sub.d) of at least about 10.sup.3, about
10.sup.4, or about 10.sup.5 m.sup.-1s.sup.-1.
[0046] In another aspect, the invention provides nucleic acid
molecules encoding the human sequence antibodies, or
antigen-binding portions, of the invention. Accordingly,
recombinant expression vectors that include the antibody-encoding
nucleic acids of the invention, and host cells transfected with
such vectors, are also encompassed by the invention, as are methods
of making the antibodies of the invention by culturing these host
cells.
[0047] In yet another aspect, the invention provides isolated
B-cells from a transgenic non-human animal, e.g., a transgenic
mouse, which are capable of expressing various isotypes (e.g., IgG,
IgA and/or IgM) of human monoclonal antibodies that specifically
bind to human CTLA-4. The isolated B cells can be obtained from a
transgenic non-human animal, e.g., a transgenic mouse, which has
been immunized with a purified or enriched preparation of human
CTLA-4 antigen (or antigenic fragment thereof) and/or cells
expressing human CTLA-4. The transgenic non-human animal, e.g., a
transgenic mouse, can have a genome comprising a human heavy chain
transgene and a human light chain transgene. The isolated B-cells
can be immortalized to provide a source (e.g., a hybridoma) of
human monoclonal antibodies to human CTLA-4.
[0048] Accordingly, the present invention also provides a hybridoma
capable of producing human monoclonal antibodies that specifically
bind to human CTLA-4. The hybridoma can include a B cell obtained
from a transgenic non-human animal, e.g., a transgenic mouse,
having a genome comprising a human heavy chain transgene and a
human light chain transgene fused to an immortalized cell. The
transgenic non-human animal can be immunized with a purified or
enriched preparation of human CTLA-4 antigen and/or cells
expressing human CTLA-4 to generate antibody-producing
hybridomas.
[0049] In yet another aspect, the invention provides a transgenic
non-human animal, such as a transgenic mouse, which express human
monoclonal antibodies (also referred to herein as a
"HuMAb-Mouse.TM.") that specifically bind to human CTLA-4. The
transgenic non-human animal can be a transgenic mouse having a
genome comprising a human heavy chain transgene and a human light
chain transgene. The transgenic non-human animal can be immunized
with a purified or enriched preparation of CTLA-4 antigen (or
antigenic fragment thereof) and/or cells expressing the human
CTLA-4. The transgenic non-human animal, e.g., the transgenic
mouse, can be capable of producing multiple isotypes of human
monoclonal antibodies to human CTLA-4 (e.g., IgG, IgA and/or IgM)
by undergoing V-D-J recombination and isotype switching. Isotype
switching may occur by, e.g., classical or non-classical isotype
switching.
[0050] In another aspect, the present invention provides methods
for producing human sequence antibodies and human sequence
monoclonal antibodies that specifically react with human CTLA-4.
Some methods of the invention include immunizing a transgenic
non-human animal, e.g., a transgenic mouse, having a genome
comprising a human heavy chain transgene and a human light chain
transgene, with a purified or enriched preparation of human CTLA-4
antigen and/or cells expressing human CTLA-4. B cells (e.g.,
splenic B cells) of the animal can then be obtained and fused with
myeloma cells to form immortal, hybridoma cells that secrete human
monoclonal antibodies against human CTLA-4.
[0051] Anti-human CTLA-4 human monoclonal antibodies of the
invention, or antigen binding portions thereof (e.g., Fab), can be
derivatized or linked to another functional molecule, e.g., another
peptide or protein (e.g., an Fab' fragment). For example, an
antibody or antigen-binding portion of the invention can be
functionally linked (e.g., by chemical coupling, genetic fusion,
noncovalent association or otherwise) to one or more other
molecular entities. For example, the human sequence anti-CTLA-4
antibody, or antigen binding fragment thereof, can be conjugated to
a therapeutic moiety, e.g., a cytotoxic drug, an enzymatically
active toxin, or a fragment thereof, a radioisotope, or a small
molecule anti-cancer drug. The antibodies of the invention can also
be conjugated to cytotoxic pharmaceuticals, e.g., radiolabeled with
a cytotoxic agents, such as, e.g., .sup.131I (e.g., Shen (1997)
Cancer 80(12 Suppl):2553-2557), copper-67 (e.g., Deshpande (1988)
J. Nucl. Med. 29:217-225) or, e.g., conjugation to the ribosome
inactivating protein gelonin (e.g., Boyle (1996) J. of Immunol.
18:221-230).
[0052] In another aspect, the present invention provides
compositions, e.g., pharmaceutical and diagnostic compositions,
comprising a pharmaceutically acceptable carrier and at least one
human monoclonal antibody of the invention, or an antigen-binding
portion thereof, which specifically binds to human CTLA-4. Some
compositions comprise a combination of the human sequence
antibodies or antigen-binding portions thereof, preferably each of
which binds to a distinct epitope. Compositions, e.g.,
pharmaceutical compositions, comprising a combination of at least
one human sequence antibodies or at least one human monoclonal
antibody of the invention, or antigen-binding portions thereof, and
at least one bispecific or multispecific molecule of the invention,
are also within the scope of the invention.
[0053] For in vivo methods, the antibody, or antigen-binding
portion thereof (or a bispecific or multispecific molecule of the
invention), can be administered to a human subject suffering from a
T-cell-related disease, or a disease that can be ameliorated or
prevented by augmenting or suppressing or prolonging an immune
response.
[0054] Human sequence monoclonal antibody and human sequence
antibody compositions of the invention also can be administered in
combination with other known therapies, e.g., an anti-cancer
therapy. Accordingly, the invention provides a method for treating
cancer in a subject comprising administering a therapeutically
effective amount of a pharmaceutical composition of a human
sequence antibody together with a pharmaceutical carrier to the
subject. Some such methods include a vaccine. Some such vaccines
include a tumor cell vaccine, a GM-CSF-modified tumor cell vaccine,
or an antigen-loaded dendritic cell vaccine. In some such methods,
the cancer is prostate cancer, melanoma, or epithelial cancer.
[0055] Human sequence antibodies to human CTLA-4 can be used in
methods of treatment requiring either stimulation of immune
responses or suppression. The former indication is treated using
antibodies that block binding of human CTLA-4 to human B7. Diseases
amenable to treatment by stimulation, augmentation of prolonging of
immune responses including cancer, including cancers of the
prostate, kidney or colon, pathogenic infections, diseases
associated with auto-antigens, e.g., amyloidogenic diseases,
including Alzheimer's disease, and diseases with inflammatory or
allergic components. Immunosuppression is achieved using a
polyvalent preparation comprising at least two different antibodies
to human CTLA-4 that are linked to each other. Diseases amenable to
treatment include graft versus host disease, host versus graft
disease, autoimmune diseases and inflammation.
[0056] In yet another aspect, the present invention provides a
method for detecting in vitro or in vivo the presence of human
CTLA-4 antigen in a sample, e.g., for diagnosing a human
CTLA-4-related disease. In some methods, this is achieved by
contacting a sample to be tested, along with a control sample, with
a human sequence antibody or a human monoclonal antibody of the
invention, or an antigen-binding portion thereof (or a bispecific
or multispecific molecule), under conditions that allow for
formation of a complex between the antibody and human CTLA-4.
Complex formation is then detected (e.g., using an ELISA) in both
samples, and any statistically significant difference in the
formation of complexes between the samples is indicative the
presence of human CTLA-4 antigen in the test sample.
[0057] A further understanding of the nature and advantages of the
present invention may be realized by reference to the remaining
portions of the specification, the figures and claims.
[0058] All publications, figures, GenBank Accession references
(sequences), ATCC Deposits, patents and patent applications cited
herein are hereby expressly incorporated by reference for all
purposes to the same extent as if each was so individually
denoted.
BRIEF DESCRIPTION OF THE DRAWINGS
[0059] FIG. 1 shows schematics illustrating the targeted insertion
of a neo cassette into the Sma I site of the .mu.1 exon. FIG. 1A)
Schematic diagram of the genomic structure of the .mu. locus. The
filled boxes represent the .mu. exons; FIG. 1B) Schematic diagram
of the CmD targeting vector. The dotted lines denotes those genomic
sequences included in the construct. Plasmid sequences are not
shown; FIG. 1C) Schematic diagram of the targeted .mu. locus in
which the neo cassette has been inserted into .mu.1. The box at the
lower right shows those RFLP's diagnostic of homologous
recombination between the targeting construct and the .mu. locus.
The RFLP's were detected by Southern blot hybridization using probe
A, the 915 bp Sac I fragment is shown in FIG. 1C.
[0060] FIGS. 2A-B both show the results of experiments
demonstrating that soluble human sequence antibodies against human
CTLA-4 inhibit the binding of recombinant soluble human CTLA-4 to
cells expressing mouse B7.1, as described in detail, below.
[0061] FIG. 3 shows the results of a competitive binding assay to
identify human sequence antibodies of the invention that recognize
non-overlapping epitopes on human CTLA-4, as described in detail,
below.
[0062] FIGS. 4A-B show preliminary nucleotide sequence data for the
heavy (FIG. 4A; SEQ ID NO:2) and light chain (FIG. 4B; SEQ ID NO:4)
fragment of the anti-CTLA-4 antibody 10D1.3.
[0063] FIG. 5 shows the nucleotide sequences of the light chain
variable Regions (V.sub.K) of Anti-Human CTLA-4 Antibodies. The
anti-CTLA-4 antibodies 10D1 (SEQ ID NO:6) and 4B6 (SEQ ID NO:8)
derived from the V.sub.K A-27 germline sequence (SEQ ID NO:4) are
depicted at the top of the Figure. The anti-CTLA-4 antibody 1E2
(SEQ ID NO:12) derived from the V.sub.K L-15 germline sequence (SEQ
ID NO:10) is shown at the bottom of the Figure. The V.sub.K
sequences of three anti-CTLA-4 antibodies are aligned with their
germline encoded V.sub.K gene sequences. The complementary
determining residues (CDR) are labeled. Dashes denote sequence
identity.
[0064] FIG. 6 shows the nucleotide sequences of the heavy chain
variable Regions (V.sub.H) of Anti-Human CTLA-4 Antibodies. The
anti-CTLA-4 antibodies 10D1 (SEQ ID NO:16) and 4B6 (SEQ ID NO:18)
derived from the V.sub.H 3-30.3 germline sequence (SEQ ID NO:14)
are depicted at the top of the Figure. The anti-CTLA-4 antibody 1E2
(SEQ ID NO:22) derived from the V.sub.H 3-33 germline sequence (SEQ
ID NO:20) is shown at the bottom of the Figure. The V.sub.H
sequences of three anti-CTLA-4 antibodies are aligned with their
germline encoded sequences. The complementary determining residues
(CDR) are labeled. Dashes denote sequence identity.
[0065] FIG. 7 shows the predicted amino acid sequences of the light
chain Variable Regions of Anti-Human CTLA-4 Antibodies. The
predicted amino acid V.sub.K sequences of the anti-CTLA-4
antibodies described in FIG. 5 are shown. The anti-CTLA-4
antibodies 10D1 (SEQ ID NO:7) and 4B6 (SEQ ID NO:9) derived from
the V.sub.K A-27 germline sequence (SEQ ID NO:5) are depicted at
the top of the Figure. The anti-CTLA-4 antibody 1E2 (SEQ ID NO:13)
derived from the V.sub.K L-15 germline sequence (SEQ ID NO:11) is
shown at the bottom of the Figure.
[0066] FIG. 8 shows the predicted amino acid sequences of the heavy
chain Variable Regions of Anti-Human CTLA-4 Antibodies. The
predicted amino acid V.sub.H sequences of the anti-CTLA-4
antibodies described in FIG. 6 are shown. The anti-CTLA-4
antibodies 10D1 (SEQ ID NO:17) and 4B6 (SEQ ID NO:19) derived from
the V.sub.H 3-30.3 germline sequence (SEQ ID NO:15) are depicted at
the top of the Figure. The anti-CTLA-4 antibody 1E2 (SEQ ID NO:23)
derived from the V.sub.H 3-33 germline sequence (SEQ ID NO:21) is
shown at the bottom of the Figure.
[0067] FIG. 9 shows the results of binding experiments of MAb 10D1
to recombinant human CTLA-4 by ELISA. MAb 10D1 binds with
dose-dependent and saturating kinetics to purified recombinant
CTLA-4.
[0068] FIG. 10 shows the binding of 10D1 to a CTLA4-expressing
T-cell line. These data show that MAb 10D1 binds with
dose-dependent and saturating kinetics to cells expressing
CTLA-4.
[0069] FIG. 11 shows inhibition of binding of human B7.2 Ig to
CTLA4-expressing T-cells. These data show that MAb 10D1 can
efficiently block B7.2 binding to CTLA-4 as compared to a control
human MAb.
[0070] FIG. 12 shows the results for blocking CTLA4-FITC binding to
murine B7.1-expressing cells. These data show that MAb 10D1 can
efficiently block CTLA-4 binding to B7.1 as compared to a control
human MAb.
[0071] FIGS. 13A-G show competitive ELISAs of anti-CTLA-4 human
MAbs demonstrating epitope group classifications. FIG. 13(A) shows
results of antibody 9A5 competitive ELISA. FIG. 13(B) shows results
of antibody 3A4 competitive ELISA. FIG. 13(C) shows results of
antibody 5A8 competitive ELISA. FIG. 13(D) shows results of
antibody 10D1.3 competitive ELISA. FIG. 13(E) shows results of
antibody 4B6.12 competitive ELISA. FIG. 13(F) shows results of
antibody 147 competitive ELISA. FIG. 13(G) shows results of
antibody BNI 3.1 competitive ELISA.
[0072] FIGS. 14A-B show CTLA-4 expression on PHA-stimulated
T-cells. Activated T cells express low but detectable levels of
CTLA-4 at the cell surface, as shown in FIG. 14B, and control T
cells do not (FIG. 14A).
[0073] FIG. 15 shows the results of MAb 10D1 in Complement
Dependent Lysis of Activated T Cells. No lysis of PHA-activated T
cells is observed.
[0074] FIG. 16 shows the results of MAb 10D1 in Antibody-Dependent
Lysis of Activated T Cells. No lysis of PHA-activated T cells is
observed with 10D1 and mononuclear cells.
[0075] FIGS. 17A-D show anti-10D1 IgM and IgG responses in
cynomolgus monkeys injected with 10D1 antibody. FIGS. 17A and 17C
show anti-10D1 IgM response. FIGS. 17B and 17D show anti-10D1 IgG
response. No significant antibody response to 10D1 is observed.
[0076] FIG. 18 shows prostate specific antigen (PSA) levels in
ng/ml in two human patients at various time points after infusion
of an anti-CTLA4 antibody at day 0.
[0077] FIGS. 19A-B show the plasma levels of anti-HbsAg antibody in
primates treated with either a HbsAg vaccine in combination with
the anti-CTLA4 antibody 10D1 or the vaccine in combination with a
control IgG1 antibody.
[0078] FIG. 20 shows the level of antibody responses to a melanoma
cell vaccine in primates treated with either the vaccine alone
(open circles) or with the vaccine in combination with the
anti-CTLA4 antibody 10D1 (closed circles).
[0079] FIG. 21 shows antigen-specific T cell proliferation in a
primate vaccinated with a melanoma cell vaccine in combination with
the anti-CTLA4 antibody 10D1.
DETAILED DESCRIPTION
[0080] The present invention provides novel antibody-based
therapies for treating and diagnosing diseases characterized by
expression, particularly over-expression, or activation of,
particularly overactivation, of human CTLA-4 and/or related
molecules. Therapies of the invention employ human sequence
antibodies, human sequence monoclonal antibodies, or
antigen-binding portions thereof, which bind to an epitope present
on human CTLA-4. These human sequence anti-CTLA-4 antibodies can
act as functional antagonists (e.g., inhibiting the ability of
CTLA-4 to bind ligand or to activate the cell, e.g., by inhibiting
its ability to transmit a signal to the cell) or agonists (e.g., to
simulate the effect of ligand).
[0081] The human sequence antibodies of the invention can be
produced in a non-human transgenic animal, e.g., a transgenic
mouse, capable of producing multiple isotypes of human (e.g.,
monoclonal or polyclonal) antibodies to human CTLA-4 (e.g., IgG,
IgA and/or IgE) by undergoing V-D-J recombination and isotype
switching. Accordingly, various aspects of the invention include
antibodies and antibody fragments, and pharmaceutical compositions
thereof, as well as non-human transgenic animals, and B-cells and
hybridomas for making such monoclonal antibodies. Methods of using
the antibodies of the invention to detect a cell expressing human
CTLA-4 or a related, cross-reactive growth factor receptor, or to
inhibit growth, differentiation and/or motility of a cell
expressing human CTLA-4, either in vitro or in vivo, are also
encompassed by the invention.
[0082] Except when noted, the terms "patient" or "subject" are used
interchangeably and refer to mammals such as human patients and
non-human primates, as well as experimental animals such as
rabbits, rats, and mice, and other animals.
[0083] The term "treating" includes the administration of the
compounds or agents of the present invention to prevent or delay
the onset of the symptoms, complications, or biochemical indicia of
a disease, alleviating the symptoms or arresting or inhibiting
further development of the disease, condition, or disorder (e.g.,
autoimmune disease). Treatment may be prophylactic (to prevent or
delay the onset of the disease, or to prevent the manifestation of
clinical or subclinical symptoms thereof) or therapeutic
suppression or alleviation of symptoms after the manifestation of
the disease.
[0084] In general, the phrase "well tolerated" refers to the
absence of adverse changes in health status that occur as a result
of the treatment and would affect treatment decisions.
[0085] The term "lymphocyte" as used herein has the normal meaning
in the art, and refers to any of the mononuclear, nonphagocytic
leukocytes, found in the blood, lymph, and lymphoid tissues, i.e.,
B and T lymphocytes.
[0086] The phrase "subpopulations of T lymphocytes" or "T cell
subset(s)" refers to T lymphocytes or T cells characterized by the
expression of particular cell surface markers (see Barclay, A. N.
et al. (eds.), 1997, The Leukocyte Antigen Facts Book, 2nd.
edition, Academic Press, London, United Kingdom). The term "stable"
in reference to T cells refers to the fact that the frequency or
percentage of a T cell subset does not change over the course or
duration of the administration of an agent.
[0087] The terms "cytotoxic T lymphocyte-associated antigen-4,"
"CTLA-4," "CTLA4," "CTLA-4 antigen" and "CD152" (see, e.g., Murata
(1999) Am. J. Pathol. 155:453-460) are used interchangeably, and
include variants, isoforms, species homologs of human CTLA-4, and
analogs having at least one common epitope with CTLA-4 (see, e.g.,
Balzano (1992) Int. J. Cancer Suppl. 7:28-32).
[0088] The complete cDNA sequence of human CTLA-4 has the Genbank
accession number L15006. The region of amino acids 1-37 is the
leader peptide; 38-161 is the extracellular V-like domain; 162-187
is the transmembrane domain; and 188-223 is the cytoplasmic domain.
Variants of the nucleotide sequence have been reported, including a
G to A transition at position 49, a C to T transition at position
272, and an A to G transition at position 439. The complete DNA
sequence of mouse CTLA-4 has the EMBL accession number X05719
(Brunet et al. (1987) Nature 328:267-270). The region of amino
acids 1-35 is the leader peptide.
[0089] The complete DNA sequence of human B7-1 (CD80) has the
Genbank accession number X60958; the accession number for the mouse
sequence is X60958; the accession number for the rat sequence is
U05593. The complete cDNA sequence of human B7-2 (CD86) has the
Genbank accession number L25259; the accession number for the mouse
sequence is L25606.
[0090] The genes encoding CD28 have been extensively characterized.
The chicken mRNA sequence has the Genbank accession number X67915.
The rat mRNA sequence has the Genbank accession number X55288. The
human mRNA sequence has the Genbank accession number J02988. The
mouse mRNA sequence has the Genbank accession number M34536.
[0091] The term "epitope" means a protein determinant capable of
specific binding to an antibody. Epitopes usually consist of
chemically active surface groupings of molecules such as amino
acids or sugar side chains and usually have specific three
dimensional structural characteristics, as well as specific charge
characteristics. Conformational and nonconformational epitopes are
distinguished in that the binding to the former but not the latter
is lost in the presence of denaturing solvents.
[0092] An intact "antibody" comprises at least two heavy (H) chains
and two light (L) chains inter-connected by disulfide bonds. Each
heavy chain is comprised of a heavy chain variable region
(abbreviated herein as HCVR or VH) and a heavy chain constant
region. The heavy chain constant region is comprised of three
domains, CH1, CH2 and CH3. Each light chain is comprised of a light
chain variable region (abbreviated herein as LCVR or VL) and a
light chain constant region. The light chain constant region is
comprised of one domain, CL. The VH and VL regions can be further
subdivided into regions of hypervariability, termed complementarity
determining regions (CDR), interspersed with regions that are more
conserved, termed framework regions (FR). Each VH and VL is
composed of three CDRs and four FRs, arranged from amino-terminus
to carboxyl-terminus in the following order: FR1, CDR1, FR2, CDR2,
FR3, CDR3, FR4. The variable regions of the heavy and light chains
contain a binding domain that interacts with an antigen. The
constant regions of the antibodies may mediate the binding of the
immunoglobulin to host tissues or factors, including various cells
of the immune system (e.g., effector cells) and the first component
(Clq) of the classical complement system. The term antibody
includes antigen-binding portions of an intact antibody that retain
capacity to bind CTLA-4. Examples of binding include (i) a Fab
fragment, a monovalent fragment consisting of the VL, VH, CL and
CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment
comprising two Fab fragments linked by a disulfide bridge at the
hinge region; (iii) a Fd fragment consisting of the VH and CH1
domains; (iv) a Fv fragment consisting of the VL and VH domains of
a single arm of an antibody, (v) a dAb fragment (Ward et al.,
(1989) Nature 341:544-546), which consists of a VH domain; and (vi)
an isolated complementarity determining region (CDR). Furthermore,
although the two domains of the Fv fragment, VL and VH, are coded
for by separate genes, they can be joined, using recombinant
methods, by a synthetic linker that enables them to be made as a
single protein chain in which the VL and VH regions pair to form
monovalent molecules (known as single chain Fv (scFv); See, e.g.,
Bird et al. (1988) Science 242:423-426; and Huston et al. (1988)
Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single chain
antibodies are included by reference to the term "antibody"
Fragments can be prepared by recombinant techniques or enzymatic or
chemical cleavage of intact antibodies.
[0093] A bispecific antibody has two different binding
specificities, see. e.g., U.S. Pat. Nos. 5,922,845 and 5,837,243;
Zeilder (1999) J. Immunol. 163:1246-1252; Somasundaram (1999) Hum.
Antibodies 9:47-54; Keler (1997) Cancer Res. 57:4008-4014. For
example, the invention provides bispecific antibodies having one
binding site for a cell surface antigen, such as human CTLA-4, and
a second binding site for an Fc receptor on the surface of an
effector cell. The invention also provides multispecific
antibodies, which have at least three binding sites. The term
"bispecific antibodies" further includes diabodies. Diabodies are
bivalent, bispecific antibodies in which the VH and VL domains are
expressed on a single polypeptide chain, but using a linker that is
too short to allow for pairing between the two domains on the same
chain, thereby forcing the domains to pair with complementary
domains of another chain and creating two antigen binding sites
(See, e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA
90:6444-6448; Poljak, R. J., et al. (1994) Structure
2:1121-1123).
[0094] The term "human sequence antibody" includes antibodies
having variable and constant regions (if present) derived from
human germline immunoglobulin sequences. The human sequence
antibodies of the invention may include amino acid residues not
encoded by human germline immunoglobulin sequences (e.g., mutations
introduced by random or site-specific mutagenesis in vitro or by
somatic mutation in vivo). However, the term "human sequence
antibody", as used herein, is not intended to include antibodies in
which CDR sequences derived from the germline of another mammalian
species, such as a mouse, have been grafted onto human framework
sequences (i.e., humanized antibodies).
[0095] The terms "monoclonal antibody" or "monoclonal antibody
composition" refer to a preparation of antibody molecules of single
molecular composition. A monoclonal antibody composition displays a
single binding specificity and affinity for a particular epitope.
Accordingly, the term "human monoclonal antibody" refers to
antibodies displaying a single binding specificity which have
variable and constant regions (if present) derived from human
germline immunoglobulin sequences. In one embodiment, the human
monoclonal antibodies are produced by a hybridoma which includes a
B cell obtained from a transgenic non-human animal, e.g., a
transgenic mouse, having a genome comprising a human heavy chain
transgene and a light chain transgene fused to an immortalized
cell.
[0096] The term "diclonal antibody" refers to a preparation of at
least two antibodies to human CTLA-4. Typically, the different
antibodies bind different epitopes.
[0097] The term "oligoclonal antibody" refers to a preparation of 3
to 100 different antibodies to human CTLA-4. Typically, the
antibodies in such a preparation bind to a range of different
epitopes.
[0098] The term "polyclonal antibody" refers to a preparation of
more than 1 (two or more) different antibodies to human CTLA-4.
Such a preparation includes antibodies binding to a range of
different epitopes.
[0099] The invention provides human sequence antibodies to human
CTLA-4 which block or antagonize signals transduced by the human
CTLA-4 receptor. Some of these antibodies can bind to an epitope on
human CTLA-4 so as to inhibit CTLA-4 from interacting with a human
B7 counterreceptor. Because interaction of human CTLA-4 with human
B7 transduces a signal leading to inactivation of T-cells bearing
the human CTLA-4 receptor, antagonism of the interaction
effectively induces, augments or prolongs the activation of T cells
bearing the human CTLA-4 receptor, thereby prolonging or augmenting
an immune response. A "blocking antibody" refers to an antibody
that reduces the binding of soluble human CTLA-4 to cell-expressed
human B7 ligand by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 99% or 99.9% under conditions in which the ratio of antibody
combining site to human CTLA-4 ligand binding site is greater than
1:1 and the concentration of antibody is greater than 10.sup.-8
M.
[0100] Other antibody preparations, sometimes referred to as
multivalent preparations, bind to human CTLA-4 in such a manner as
to crosslink multiple human CTLA-4 receptors on the same cell.
Cross-linking of receptor has the same or similar effect to binding
of human CTLA-4 to human B7. Thus, cross-linking of receptors
effectively agonizes the human CTLA-4 response resulting in
immunosuppression.
[0101] Cross-linking can also be accomplished by combining soluble
divalent antibodies having different epitope specificities. These
polyclonal antibody preparations comprise at least two pairs of
heavy and light chains binding to different epitopes on human
CTLA-4 such that an immunosuppressing signal can be transduced as a
result of human CTLA-4 crosslinking.
[0102] The term "recombinant human antibody" includes all human
sequence antibodies of the invention that are prepared, expressed,
created or isolated by recombinant means, such as antibodies
isolated from an animal (e.g., a mouse) that is transgenic for
human immunoglobulin genes (described further in Section I, below);
antibodies expressed using a recombinant expression vector
transfected into a host cell, antibodies isolated from a
recombinant, combinatorial human antibody library, or antibodies
prepared, expressed, created or isolated by any other means that
involves splicing of human immunoglobulin gene sequences to other
DNA sequences. Such recombinant human antibodies have variable and
constant regions (if present) derived from human germline
immunoglobulin sequences. Such antibodies can, however, be
subjected to in vitro mutagenesis (or, when an animal transgenic
for human Ig sequences is used, in vivo somatic mutagenesis) and
thus the amino acid sequences of the VH and VL regions of the
recombinant antibodies are sequences that, while derived from and
related to human germline VH and VL sequences, may not naturally
exist within the human antibody germline repertoire in vivo.
[0103] A "heterologous antibody" is defined in relation to the
transgenic non-human organism producing such an antibody. This term
refers to an antibody having an amino acid sequence or an encoding
nucleic acid sequence corresponding to that found in an organism
not consisting of the transgenic non-human animal, and generally
from a species other than that of the transgenic non-human
animal.
[0104] A "heterohybrid antibody" refers to an antibody having a
light and heavy chains of different organismal origins. For
example, an antibody having a human heavy chain associated with a
murine light chain is a heterohybrid antibody. Examples of
heterohybrid antibodies include chimeric and humanized antibodies,
discussed supra.
[0105] The term "substantially pure" or "isolated" means an object
species (e.g., an antibody of the invention) has been identified
and separated and/or recovered from a component of its natural
environment such that the object species is the predominant species
present (i.e., on a molar basis it is more abundant than any other
individual species in the composition); a "substantially pure" or
"isolated" composition also means where the object species
comprises at least about 50 percent (on a molar basis) of all
macromolecular species present. A substantially pure or isolated
composition can also comprise more than about 80 to 90 percent by
weight of all macromolecular species present in the composition. An
isolated object species (e.g., antibodies of the invention) can
also be purified to essential homogeneity (contaminant species
cannot be detected in the composition by conventional detection
methods) wherein the composition consists essentially of
derivatives of a single macromolecular species. An isolated
antibody to human CTLA-4 can be substantially free of other
antibodies that lack binding to human CTLA-4 and bind to a
different antigen. An isolated antibody that specifically binds to
an epitope, isoform or variant of human CTLA-4 may, however, have
cross-reactivity to other related antigens, e.g., from other
species (e.g., CTLA-4 species homologs). Moreover, an isolated
antibody of the invention be substantially free of other cellular
material (e.g., non-immunoglobulin associated proteins) and/or
chemicals.
[0106] "Specific binding" refers to antibody binding to a
predetermined antigen. The phrase "specifically (or selectively)
binds" to an antibody refers to a binding reaction that is
determinative of the presence of the protein in a heterogeneous
population of proteins and other biologics. Typically, the antibody
binds with an association constant (K.sub.a) of at least about
1.times.10.sup.6 M.sup.-1 or 10.sup.7 M.sup.-1, or about 10.sup.8
M.sup.-1 to 10.sup.9M.sup.-1, or about 10.sup.10 M.sup.-1 to
10.sup.11 M.sup.-1 or higher, and binds to the predetermined
antigen with an affinity that is at least two-fold greater than its
affinity for binding to a non-specific antigen (e.g., BSA, casein)
other than the predetermined antigen or a closely-related antigen.
The phrases "an antibody recognizing an antigen" and "an antibody
specific for an antigen" are used interchangeably herein with the
term "an antibody which binds specifically to an antigen".
[0107] The phrase "specifically bind(s)" or "bind(s) specifically"
when referring to a peptide refers to a peptide molecule which has
intermediate or high binding affinity, exclusively or
predominately, to a target molecule. The phrases "specifically
binds to" refers to a binding reaction which is determinative of
the presence of a target protein in the presence of a heterogeneous
population of proteins and other biologics. Thus, under designated
assay conditions, the specified binding moieties bind
preferentially to a particular target protein and do not bind in a
significant amount to other components present in a test sample.
Specific binding to a target protein under such conditions may
require a binding moiety that is selected for its specificity for a
particular target antigen. A variety of assay formats may be used
to select ligands that are specifically reactive with a particular
protein. For example, solid-phase ELISA immunoassays,
immunoprecipitation, Biacore and Western blot are used to identify
peptides that specifically react with CTLA-4. Typically a specific
or selective reaction will be at least twice background signal or
noise and more typically more than 10 times background.
[0108] The term "high affinity" for an IgG antibody refers to an
equilibrium association constant (K.sub.a) of at least about
10.sup.7M.sup.-1, at least about 10.sup.8M.sup.-1, at least about
10.sup.9M.sup.-1, at least about 10.sup.10 M.sup.-1, at least about
10.sup.11M.sup.-1, or at least about 10.sup.12M.sup.-1 or greater,
e.g., up to 10.sup.13M.sup.-1 or 10.sup.14M.sup.-1 or greater.
However, "high affinity" binding can vary for other antibody
isotypes.
[0109] The term "K.sub.a", as used herein, is intended to refer to
the equilibrium association constant of a particular
antibody-antigen interaction. This constant has units of 1/M.
[0110] The term "K.sub.d", as used herein, is intended to refer to
the equilibrium dissociation constant of a particular
antibody-antigen interaction. This constant has units of M.
[0111] The term "k.sub.a", as used herein, is intended to refer to
the kinetic association constant of a particular antibody-antigen
interaction. This constant has units of 1/Ms
[0112] The term "k.sub.d", as used herein, is intended to refer to
the kinetic dissociation constant of a particular antibody-antigen
interaction. This constant has units of 1/s.
[0113] "Particular antibody-antigen interactions" refers to the
experimental conditions under which the equilibrium and kinetic
constants are measured.
[0114] "Isotype" refers to the antibody class (e.g., IgM or IgG1)
that is encoded by heavy chain constant region genes.
[0115] "Isotype switching" refers to the phenomenon by which the
class, or isotype, of an antibody changes from one Ig class to one
of the other Ig classes.
[0116] "Nonswitched isotype" refers to the isotypic class of heavy
chain that is produced when no isotype switching has taken place;
the CH gene encoding the nonswitched isotype is typically the first
CH gene immediately downstream from the functionally rearranged VDJ
gene. Isotype switching has been classified as classical or
non-classical isotype switching. Classical isotype switching occurs
by recombination events which involve at least one switch sequence
region in the transgene. Non-classical isotype switching may occur
by, for example, homologous recombination between human
.sigma..sub..mu. and human .SIGMA..sub..mu. (.delta.-associated
deletion). Alternative non-classical switching mechanisms, such as
intertransgene and/or interchromosomal recombination, among others,
may occur and effectuate isotype switching.
[0117] The term "switch sequence" refers to those DNA sequences
responsible for switch recombination. A "switch donor" sequence,
typically a .mu. switch region, are 5' (i.e., upstream) of the
construct region to be deleted during the switch recombination. The
"switch acceptor" region are between the construct region to be
deleted and the replacement constant region (e.g., .gamma.,
.epsilon., etc.). As there is no specific site where recombination
always occurs, the final gene sequence is not typically predictable
from the construct.
[0118] "Glycosylation pattern" is defined as the pattern of
carbohydrate units that are covalently attached to a protein, more
specifically to an immunoglobulin protein. A glycosylation pattern
of a heterologous antibody can be characterized as being
substantially similar to glycosylation patterns which occur
naturally on antibodies produced by the species of the non-human
transgenic animal, when one of ordinary skill in the art would
recognize the glycosylation pattern of the heterologous antibody as
being more similar to said pattern of glycosylation in the species
of the non-human transgenic animal than to the species from which
the CH genes of the transgene were derived.
[0119] The term "naturally-occurring" as applied to an object
refers to the fact that an object can be found in nature. For
example, a polypeptide or polynucleotide sequence that is present
in an organism (including viruses) that can be isolated from a
source in nature and which has not been intentionally modified by
man in the laboratory is naturally-occurring.
[0120] The term "rearranged" refers to a configuration of a heavy
chain or light chain immunoglobulin locus wherein a V segment is
positioned immediately adjacent to a D-J or J segment in a
conformation encoding essentially a complete VH or VL domain,
respectively. A rearranged immunoglobulin gene locus can be
identified by comparison to germline DNA; a rearranged locus has at
least one recombined heptamer/nonamer homology element.
[0121] The term "unrearranged" or "germline configuration" in
reference to a V segment refers to the configuration wherein the V
segment is not recombined so as to be immediately adjacent to a D
or J segment.
[0122] The term "nucleic acid" is intended to include DNA molecules
and RNA molecules. A nucleic acid can be single-stranded or
double-stranded.
[0123] The term "isolated nucleic acid" in reference to nucleic
acids encoding antibodies or antibody portions (e.g., VH, VL, CDR3)
that bind to CTLA-4, is intended to refer to a nucleic acid in
which the nucleotide sequences encoding the antibody or antibody
portion are free of other nucleotide sequences encoding antibodies
or antibody portions that bind antigens other than CTLA-4, which
other sequences may naturally flank the nucleic acid in human
genomic DNA. SEQ ID NOs: 4-23 comprise the nucleotide and amino
acid sequences comprising the heavy chain (VH) and light chain (VL)
variable regions of the 10D1, 4B6 and 1E2 human anti-CTLA-4
monoclonal antibodies of the invention.
[0124] The term "substantially identical," in the context of two
nucleic acids or polypeptides refers to two or more sequences or
subsequences that have at least about 80%, about 90, about 95% or
higher nucleotide or amino acid residue identity, when compared and
aligned for maximum correspondence, as measured using the following
sequence comparison method and/or by visual inspection. For
example, the invention provides nucleic acids having sequences that
are substantially identical to SEQ ID NO:1, SEQ ID NO:2. Such
"substantially identical" sequences are typically considered to be
homologous. The "substantial identity" can exist over a region of
sequence that is at least about 50 residues in length, over a
region of at least about 100 residues, or over a region at least
about 150 residues, or over the full length of the two sequences to
be compared. As described below, any two antibody sequences can
only be aligned in one way, by using the numbering scheme in Kabat.
Therefore, for antibodies, percent identity has a unique and
well-defined meaning.
[0125] Amino acids from the variable regions of the mature heavy
and light chains of immunoglobulins are designated Hx and Lx
respectively, where x is a number designating the position of an
amino acid according to the scheme of Kabat, Sequences of Proteins
of Immunological Interest (National Institutes of Health, Bethesda,
Md., 1987 and 1991). Kabat lists many amino acid sequences for
antibodies for each subgroup, and lists the most commonly occurring
amino acid for each residue position in that subgroup to generate a
consensus sequence. Kabat uses a method for assigning a residue
number to each amino acid in a listed sequence, and this method for
assigning residue numbers has become standard in the field. Kabat's
scheme is extendible to other antibodies not included in his
compendium by aligning the antibody in question with one of the
consensus sequences in Kabat by reference to conserved amino acids.
The use of the Kabat numbering system readily identifies amino
acids at equivalent positions in different antibodies. For example,
an amino acid at the L50 position of a human antibody occupies the
equivalent position to an amino acid position L50 of a mouse
antibody. Likewise, nucleic acids encoding antibody chains are
aligned when the amino acid sequences encoded by the respective
nucleic acids are aligned according to the Kabat numbering
convention.
[0126] The phrase "selectively (or specifically) hybridizes to"
refers to the binding, duplexing, or hybridizing of a molecule to a
particular nucleotide sequence under stringent hybridization
conditions when that sequence is present in a complex mixture
(e.g., total cellular or library DNA or RNA), wherein the
particular nucleotide sequence is detected at least at about 10
times background. In one embodiment, a nucleic acid can be
determined to be within the scope of the invention (e.g., is
substantially identical to SEQ ID NO:1 or SEQ ID NO:2) by its
ability to hybridize under stringent conditions to a nucleic acid
otherwise determined to be within the scope of the invention (such
as the exemplary sequences described herein).
[0127] The phrase "stringent hybridization conditions" refers to
conditions under which a probe will hybridize to its target
subsequence, typically in a complex mixture of nucleic acid, but
not to other sequences in significant amounts (a positive signal
(e.g., identification of a nucleic acid of the invention) is about
10 times background hybridization). Stringent conditions are
sequence-dependent and will be different in different
circumstances. Longer sequences hybridize specifically at higher
temperatures. An extensive guide to the hybridization of nucleic
acids is found An extensive guide to the hybridization of nucleic
acids is found in e.g., Sambrook, ed., MOLECULAR CLONING: A
LABORATORY MANUAL (2ND ED.), Vols. 1-3, Cold Spring Harbor
Laboratory, (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY,
Ausubel, ed. John Wiley & Sons, Inc., New York (1997);
LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY:
HYBRIDIZATION WITH NUCLEIC ACID PROBES, Part I. Theory and Nucleic
Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).
[0128] Generally, stringent conditions are selected to be about
5-10.degree. C. lower than the thermal melting point (T.sub.m) for
the specific sequence at a defined ionic strength pH. The T.sub.m
is the temperature (under defined ionic strength, pH, and nucleic
concentration) at which 50% of the probes complementary to the
target hybridize to the target sequence at equilibrium (as the
target sequences are present in excess, at T.sub.m, 50% of the
probes are occupied at equilibrium). Stringent conditions will be
those in which the salt concentration is less than about 1.0 M
sodium ion, typically about 0.01 to 1.0 M sodium ion concentration
(or other salts) at pH 7.0 to 8.3 and the temperature is at least
about 30.degree. C. for short probes (e.g., 10 to 50 nucleotides)
and at least about 60.degree. C. for long probes (e.g., greater
than 50 nucleotides). Stringent conditions may also be achieved
with the addition of destabilizing agents such as formamide as
described in Sambrook (cited below). For high stringency
hybridization, a positive signal is at least two times background,
preferably 10 times background hybridization. Exemplary high
stringency or stringent hybridization conditions include: 50%
formamide, 5.times.SSC and 1% SDS incubated at 42.degree. C. or
5.times.SSC and 1% SDS incubated at 65.degree. C., with a wash in
0.2.times.SSC and 0.1% SDS at 65.degree. C. For selective or
specific hybridization, a positive signal (e.g., identification of
a nucleic acid of the invention) is about 10 times background
hybridization. Stringent hybridization conditions that are used to
identify nucleic acids within the scope of the invention include,
e.g., hybridization in a buffer comprising 50% formamide,
5.times.SSC, and 1% SDS at 42.degree. C., or hybridization in a
buffer comprising 5.times.SSC and 1% SDS at 65.degree. C., both
with a wash of 0.2.times.SSC and 0.1% SDS at 65.degree. C. In the
present invention, genomic DNA or cDNA comprising nucleic acids of
the invention can be identified in standard Southern blots under
stringent conditions using the nucleic acid sequences disclosed
here. Additional stringent conditions for such hybridizations (to
identify nucleic acids within the scope of the invention) are those
which include a hybridization in a buffer of 40% formamide, 1 M
NaCl, 1% SDS at 37.degree. C.
[0129] However, the selection of a hybridization format is not
critical--it is the stringency of the wash conditions that set
forth the conditions which determine whether a nucleic acid is
within the scope of the invention. Wash conditions used to identify
nucleic acids within the scope of the invention include, e.g.: a
salt concentration of about 0.02 molar at pH 7 and a temperature of
at least about 50.degree. C. or about 55.degree. C. to about
60.degree. C.; or, a salt concentration of about 0.15 M NaCl at
72.degree. C. for about 15 minutes; or, a salt concentration of
about 0.2.times.SSC at a temperature of at least about 50.degree.
C. or about 55.degree. C. to about 60.degree. C. for about 15 to
about 20 minutes; or, the hybridization complex is washed twice
with a solution with a salt concentration of about 2.times.SSC
containing 0.1% SDS at room temperature for 15 minutes and then
washed twice by 0.1.times.SSC containing 0.1% SDS at 68.degree. C.
for 15 minutes; or, equivalent conditions. See Sambrook, Tijssen
and Ausubel for a description of SSC buffer and equivalent
conditions.
[0130] The nucleic acids of the invention be present in whole
cells, in a cell lysate, or in a partially purified or
substantially pure form. A nucleic acid is "isolated" or "rendered
substantially pure" when purified away from other cellular
components or other contaminants, e.g., other cellular nucleic
acids or proteins, by standard techniques, including alkaline/SDS
treatment, CsCl banding, column chromatography, agarose gel
electrophoresis and others well known in the art. see, e.g.,
Sambrook, Tijssen and Ausubel. The nucleic acid sequences of the
invention and other nucleic acids used to practice this invention,
whether RNA, cDNA, genomic DNA, or hybrids thereof, may be isolated
from a variety of sources, genetically engineered, amplified,
and/or expressed recombinantly. Any recombinant expression system
can be used, including, in addition to bacterial, e.g., yeast,
insect or mammalian systems. Alternatively, these nucleic acids can
be chemically synthesized in vitro. Techniques for the manipulation
of nucleic acids, such as, e.g., subcloning into expression
vectors, labeling probes, sequencing, and hybridization are well
described in the scientific and patent literature, see, e.g.,
Sambrook, Tijssen and Ausubel. Nucleic acids can be analyzed and
quantified by any of a number of general means well known to those
of skill in the art. These include, e.g., analytical biochemical
methods such as NMR, spectrophotometry, radiography,
electrophoresis, capillary electrophoresis, high performance liquid
chromatography (HPLC), thin layer chromatography (TLC), and
hyperdiffusion chromatography, various immunological methods, such
as fluid or gel precipitin reactions, immunodiffusion (single or
double), immunoelectrophoresis, radioimmunoassays (RIAs),
enzyme-linked immunosorbent assays (ELISAs), immuno-fluorescent
assays, Southern analysis, Northern analysis, dot-blot analysis,
gel electrophoresis (e.g., SDS-PAGE), RT-PCR, quantitative PCR,
other nucleic acid or target or signal amplification methods,
radiolabeling, scintillation counting, and affinity
chromatography.
[0131] The nucleic acid compositions of the present invention,
while often in a native sequence (except for modified restriction
sites and the like), from either cDNA, genomic or mixtures may be
mutated, thereof in accordance with standard techniques to provide
gene sequences. For coding sequences, these mutations, may affect
amino acid sequence as desired. In particular, DNA sequences
substantially homologous to or derived from native V, D, J,
constant, switches and other such sequences described herein are
contemplated (where "derived" indicates that a sequence is
identical or modified from another sequence).
[0132] A nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
instance, a promoter or enhancer is operably linked to a coding
sequence if it affects the transcription of the sequence. With
respect to transcription regulatory sequences, operably linked
means that the DNA sequences being linked are contiguous and, where
necessary to join two protein coding regions, contiguous and in
reading frame. For switch sequences, operably linked indicates that
the sequences are capable of effecting switch recombination.
[0133] The term "vector" is intended to refer to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. One type of vector is a "plasmid", which refers to
a circular double stranded DNA loop into which additional DNA
segments may be ligated. Another type of vector is a viral vector,
wherein additional DNA segments may be ligated into the viral
genome. Certain vectors are capable of autonomous replication in a
host cell into which they are introduced (e.g., bacterial vectors
having a bacterial origin of replication and episomal mammalian
vectors). Other vectors (e.g., non-episomal mammalian vectors) can
be integrated into the genome of a host cell upon introduction into
the host cell, and thereby are replicated along with the host
genome. Moreover, certain vectors are capable of directing the
expression of genes to which they are operatively linked. Such
vectors are referred to herein as "recombinant expression vectors"
(or simply, "expression vectors"). In general, expression vectors
of utility in recombinant DNA techniques are often in the form of
plasmids. In the present specification, "plasmid" and "vector" may
be used interchangeably as the plasmid is the most commonly used
form of vector. However, the invention is intended to include such
other forms of expression vectors, such as viral vectors (e.g.,
replication defective retroviruses, adenoviruses and
adeno-associated viruses), which serve equivalent functions.
[0134] The term "recombinant host cell" (or simply "host cell")
refers to a cell into which a recombinant expression vector has
been introduced. It should be understood that such terms are
intended to refer not only to the particular subject cell but to
the progeny of such a cell. Because certain modifications may occur
in succeeding generations due to either mutation or environmental
influences, such progeny may not, in fact, be identical to the
parent cell, but are still included within the scope of the term
"host cell" as used herein.
[0135] The term "minilocus transgene" refers to a transgene that
comprises a portion of the genomic immunoglobulin locus having at
least one internal (i.e., not at a terminus of the portion)
deletion of a non-essential DNA portion (e.g., intervening
sequence; intron or portion thereof) as compared to the
naturally-occurring germline Ig locus.
[0136] A "label" is a composition detectable by spectroscopic,
photochemical, biochemical, immunochemical, or chemical means. For
example, useful labels include .sup.32P, fluorescent dyes,
electron-dense reagents, enzymes (e.g., as commonly used in an
ELISA), biotin, digoxigenin, or haptens and proteins for which
antisera or monoclonal antibodies are available (e.g., the
polypeptides of the invention can be made detectable, e.g., by
incorporating a radiolabel into the peptide, and used to detect
antibodies specifically reactive with the peptide).
[0137] The term "sorting" in the context of cells as used herein to
refers to both physical sorting of the cells, as can be
accomplished using, e.g., a fluorescence activated cell sorter, as
well as to analysis of cells based on expression of cell surface
markers, e.g., FACS analysis in the absence of sorting.
[0138] The phrase "immune cell response" refers to the response of
immune system cells to external or internal stimuli (e.g., antigen,
cytokines, chemokines, and other cells) producing biochemical
changes in the immune cells that result in immune cell migration,
killing of target cells, phagocytosis, production of antibodies,
other soluble effectors of the immune response, and the like.
[0139] The terms "T lymphocyte response" and "T lymphocyte
activity" are used here interchangeably to refer to the component
of immune response dependent on T lymphocytes (i.e., the
proliferation and/or differentiation of T lymphocytes into helper,
cytotoxic killer, or suppressor T lymphocytes, the provision of
signals by helper T lymphocytes to B lymphocytes that cause or
prevent antibody production, the killing of specific target cells
by cytotoxic T lymphocytes, and the release of soluble factors such
as cytokines that modulate the function of other immune cells).
[0140] The term "immune response" refers to the concerted action of
lymphocytes, antigen presenting cells, phagocytic cells,
granulocytes, and soluble macromolecules produced by the above
cells or the liver (including antibodies, cytokines, and
complement) that results in selective damage to, destruction of, or
elimination from the human body of invading pathogens, cells or
tissues infected with pathogens, cancerous cells, or, in cases of
autoimmunity or pathological inflammation, normal human cells or
tissues.
[0141] Components of an immune response may be detected in vitro by
various methods that are well known to those of ordinary skill in
the art. For example, (1) cytotoxic T lymphocytes can be incubated
with radioactively labeled target cells and the lysis of these
target cells detected by the release of radioactivity, (2) helper T
lymphocytes can be incubated with antigens and antigen presenting
cells and the synthesis and secretion of cytokines measured by
standard methods (Windhagen A; et al., 1995, Immunity 2(4):
373-80), (3) antigen presenting cells can be incubated with whole
protein antigen and the presentation of that antigen on MHC
detected by either T lymphocyte activation assays or biophysical
methods (Harding et al., 1989, Proc. Natl. Acad. Sci., 86: 4230-4),
(4) mast cells can be incubated with reagents that cross-link their
Fc-epsilon receptors and histamine release measured by enzyme
immunoassay (Siraganian, et al., 1983, TIPS 4: 432-437).
[0142] Similarly, products of an immune response in either a model
organism (e.g., mouse) or a human patient can also be detected by
various methods that are well known to those of ordinary skill in
the art. For example, (1) the production of antibodies in response
to vaccination can be readily detected by standard methods
currently used in clinical laboratories, e.g., an ELISA; (2) the
migration of immune cells to sites of inflammation can be detected
by scratching the surface of skin and placing a sterile container
to capture the migrating cells over scratch site (Peters et al.,
1988, Blood 72: 1310-5); (3) the proliferation of peripheral blood
mononuclear cells in response to mitogens or mixed lymphocyte
reaction can be measured using .sup.3H-thymidine; (4) the
phagocitic capacity of granulocytes, macrophages, and other
phagocytes in PBMCs can be measured by placing PMBCs in wells
together with labeled particles (Peters et al., 1988); and (5) the
differentation of immune system cells can be measured by labeling
PBMCs with antibodies to CD molecules such as CD4 and CD8 and
measuring the fraction of the PBMCs expressing these markers.
[0143] As used herein, the phrase "signal transduction pathway" or
"signal transduction event" refers to at least one biochemical
reaction, but more commonly a series of biochemical reactions,
which result from interaction of a cell with a stimulatory compound
or agent. Thus, the interaction of a stimulatory compound with a
cell generates a "signal" that is transmitted through the signal
transduction pathway, ultimately resulting in a cellular response,
e.g., an immune response described above.
[0144] A signal transduction pathway refers to the biochemical
relationship between a variety of signal transduction molecules
that play a role in the transmission of a signal from one portion
of a cell to another portion of a cell. Signal transduction
molecules of the present invention include, for example, MAb 147.1
of the invention. As used herein, the phrase "cell surface
receptor" includes molecules and complexes of molecules capable of
receiving a signal and the transmission of such a signal across the
plasma membrane of a cell. An example of a "cell surface receptor"
of the present invention is the T cell receptor (TCR) or the B7
ligands of CTLA-4.
[0145] A signal transduction pathway in a cell can be initiated by
interaction of a cell with a stimulator that is inside or outside
of the cell. If an exterior (i.e., outside of the cell) stimulator
(e.g., an MHC-antigen complex on an antigen presenting cell)
interacts with a cell surface receptor (e.g., a T cell receptor), a
signal transduction pathway can transmit a signal across the cell's
membrane, through the cytoplasm of the cell, and in some instances
into the nucleus. If an interior (e.g., inside the cell) stimulator
interacts with an intracellular signal transduction molecule, a
signal transduction pathway can result in transmission of a signal
through the cell's cytoplasm, and in some instances into the cell's
nucleus.
[0146] Signal transduction can occur through, e.g., the
phosphorylation of a molecule; non-covalent allosteric
interactions; complexing of molecules; the conformational change of
a molecule; calcium release; inositol phosphate production;
proteolytic cleavage; cyclic nucleotide production and
diacylglyceride production. Typically, signal transduction occurs
through phosphorylating a signal transduction molecule.
[0147] The term "nonspecific T cell activation" refers to the
stimulation of T cells independent of their antigenic
specificity.
Production of Human Antibodies to CTLA-4
[0148] The monoclonal antibodies (mAbs) and the human sequence
antibodies of the invention can be produced by a variety of
techniques, including conventional monoclonal antibody methodology
e.g., the standard somatic cell hybridization technique of Kohler
and Milstein, Nature 256: 495 (1975). Any technique for producing
monoclonal antibody can be employed e.g., viral or oncogenic
transformation of B lymphocytes. One animal system for preparing
hybridomas is the murine system. Hybridoma production in the mouse
is a very well-established procedure. Immunization protocols and
techniques for isolation of immunized splenocytes for fusion are
known in the art. Fusion partners (e.g., murine myeloma cells) and
fusion procedures are also known (see, e.g., Harlow and Lane
(1988), Antibodies, A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor New York).
[0149] Human monoclonal antibodies and human sequence antibodies
directed against human CTLA-4 can be generated using transgenic
mice carrying a human immune system rather than the mouse system.
These transgenic mice, also referred to herein as
"HuMAb-Mouse.TM.", contain a human immunoglobulin gene miniloci
that encodes unrearranged human heavy (.mu. and .gamma.) and
.kappa. light chain immunoglobulin sequences, together with
targeted mutations that inactivate the endogenous .mu. and .kappa.
chain loci (Lonberg, N. et al. (1994) Nature 368(6474): 856-859 and
U.S. Pat. No. 5,770,429). Accordingly, the mice exhibit reduced
expression of mouse IgM or .kappa., and in response to
immunization, the introduced human heavy and light chain transgenes
undergo class switching and somatic mutation to generate high
affinity human IgG.kappa. monoclonal (Lonberg, N. et al. (1994),
supra; reviewed in Lonberg, N. (1994) Handbook of Experimental
Pharmacology 113:49-101; Lonberg, N. and Huszar, D. (1995) Intern.
Rev. Immunol. Vol. 13: 65-93, and Harding, F. and Lonberg, N.
(1995) Ann. N.Y. Acad. Sci 764:536-546). The preparation of
transgenic mice is described in detail Section II below and in
Taylor, L. et al. (1992) Nucleic Acids Research 20:6287-6295; Chen,
J. et al. (1993) International Immunology 5: 647-656; Tuaillon et
al. (1993) Proc. Natl. Acad. Sci USA 90:3720-3724; Choi et al.
(1993) Nature Genetics 4:117-123; Chen, J. et al. (1993) EMBO J.
12: 821-830; Tuaillon et al. (1994) J. Immunol. 152:2912-2920;
Lonberg et al., (1994) Nature 368(6474): 856-859; Lonberg, N.
(1994) Handbook of Experimental Pharmacology 113:49-101; Taylor, L.
et al. (1994) International Immunology 6: 579-591; Lonberg, N. and
Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13: 65-93; Harding, F.
and Lonberg, N. (1995) Ann. N.Y. Acad. Sci 764:536-546; Fishwild,
D. et al. (1996) Nature Biotechnology 14: 845-851. See further,
U.S. Pat. Nos. 5,625,126 and 5,770,429, both to Lonberg and Kay,
and GenPharm International; U.S. Pat. No. 5,545,807 to Surani et
al.; International Publication Nos. WO 98/24884, published on Jun.
11, 1998; WO 94/25585, published Nov. 10, 1994; WO 93/1227,
published Jun. 24, 1993; WO 92/22645, published Dec. 23, 1992; WO
92/03918, published Mar. 19, 1992. Alternatively, the CMD and HCo12
transgenes, described in Examples 1 and 2, below, can be used to
generate human anti-CTLA-4 antibodies.
[0150] Detailed procedures to generate fully human monoclonal
antibodies to CTLA-4 are described in the Examples below.
Cumulative experience with various antigens has shown that the
transgenic mice respond when initially immunized intraperitoneally
(IP) with antigen in complete Freund's adjuvant, followed by every
other week IP immunizations (up to a total of 6) with antigen in
incomplete Freund's adjuvant. However, adjuvants other than
Freund's are also found to be effective. In addition, whole cells
in the absence of adjuvant are found to be highly immunogenic. The
immune response can be monitored over the course of the
immunization protocol with plasma samples being obtained by
retroorbital bleeds. The plasma can be screened by ELISA (as
described below), and mice with sufficient titers of anti-CTLA-4
human immunoglobulin can be used for fusions. Mice can be boosted
intravenously with antigen 3 days before sacrifice and removal of
the spleen. It is expected that 2-3 fusions for each immunization
may need to be performed. Between 6 and 24 mice are typically
immunized for each antigen. Usually both HCo7 and HCo12 strains are
used. In addition, both HCo7 and HCo12 transgene can be bred
together into a single mouse having two different human heavy chain
transgenes.
[0151] To purify human anti-CTLA-4 antibodies, selected hybridomas
can be grown in two-liter spinner-flasks for monoclonal antibody
purification. Supernatants can be filtered and concentrated before
affinity chromatography with protein A-sepharose (Pharmacia,
Piscataway, N.J.). Eluted IgG can be checked by gel electrophoresis
and high performance liquid chromatography to ensure purity. The
buffer solution can be exchanged into PBS, and the concentration
can be determined by OD280 using 1.43 extinction coefficient. The
monoclonal antibodies can be aliquoted and stored at -80.degree.
C.
[0152] To determine if the selected human anti-CTLA-4 monoclonal
antibodies bind to unique epitopes, each antibody can be
biotinylated using commercially available reagents (Pierce,
Rockford, Ill.). Competition studies using unlabeled monoclonal
antibodies and biotinylated monoclonal antibodies can be performed
using CTLA-4 coated-ELISA plates as described above. Biotinylated
MAb binding can be detected with a strep-avidin-alkaline
phosphatase probe.
[0153] To determine the isotype of purified antibodies, isotype
ELISAs can be performed. Wells of microtiter plates can be coated
with 1 .mu.g/ml of anti-human IgG overnight at 4.degree. C. After
blocking with 1% BSA, the plates are reacted with 1 .mu.g/ml or
less of monoclonal antibodies or purified isotype controls, at
ambient temperature for one to two hours. The wells can then be
reacted with either human IgG1 or human IgM-specific alkaline
phosphatase-conjugated probes. Plates are developed and analyzed as
described above.
[0154] To demonstrate binding of monoclonal antibodies to live
cells expressing the CTLA-4, flow cytometry can be used. Briefly,
cell lines expressing CTLA-4 (grown under standard growth
conditions) are mixed with various concentrations of monoclonal
antibodies in PBS containing 0.1% BSA and 10% fetal calf serum, and
incubated at 37.degree. C. for 1 hour. After washing, the cells are
reacted with Fluorescein-labeled anti-human IgG antibody under the
same conditions as the primary antibody staining. The samples can
be analyzed by FACScan instrument using light and side scatter
properties to gate on single cells. An alternative assay using
fluorescence microscopy may be used (in addition to or instead of)
the flow cytometry assay. Cells can be stained exactly as described
above and examined by fluorescence microscopy. This method allows
visualization of individual cells, but may have diminished
sensitivity depending on the density of the antigen.
[0155] Anti-CTLA-4 human IgGs can be further tested for reactivity
with CTLA-4 antigen by Western blotting. Briefly, cell extracts
from cells expressing CTLA-4 can be prepared and subjected to
sodium dodecyl sulfate polyacrylamide gel electrophoresis. After
electrophoresis, the separated antigens are transferred to
nitrocellulose membranes, blocked with 10% fetal calf serum, and
probed with the monoclonal antibodies to be tested. Human IgG
binding can be detected using anti-human IgG alkaline phosphatase
and developed with BCIP/NBT substrate tablets (Sigma Chem. Co., St.
Louis, Mo.).
Production of Transgenic Non-Human Animals that Generate Human
Monoclonal Anti-CTLA-4 Antibodies
[0156] The present invention also provides transgenic non-human
animals, e.g., a transgenic mice, which are capable of expressing
human monoclonal antibodies that specifically bind to CTLA-4. High
affinity human sequence antibodies are also provided. Some
transgenic non-human animals, e.g., the transgenic mice, have a
genome comprising a human heavy chain transgene and a light chain
transgene. Some transgenic non-human animals are immunized with a
purified or enriched preparation of CTLA-4 antigen and/or cells
expressing CTLA-4. Some transgenic non-human animals are capable of
producing multiple isotypes of human monoclonal antibodies to
CTLA-4 (e.g., IgG, IgA and/or IgE) by undergoing V-D-J
recombination and isotype switching. Isotype switching may occur
by, e.g., classical or non-classical isotype switching.
[0157] The design of a transgenic non-human animal that responds to
foreign antigen stimulation with a heterologous antibody
repertoire, requires that the heterologous immunoglobulin
transgenes contained within the transgenic animal function
correctly throughout the pathway of B-cell development. In some
mice, correct function of a heterologous heavy chain transgene
includes isotype switching. Accordingly, the transgenes of the
invention are constructed so as to produce isotype switching and
one or more of the following: (1) high level and cell-type specific
expression, (2) functional gene rearrangement, (3) activation of
and response to allelic exclusion, (4) expression of a sufficient
primary repertoire, (5) signal transduction, (6) somatic
hypermutation, and (7) domination of the transgene antibody locus
during the immune response.
[0158] Not all of the foregoing criteria need be met. For example,
in transgenic animal in which the endogenous immunoglobulin loci of
the transgenic animals are functionally disrupted, the transgene
need not activate allelic exclusion. Further, in transgenic animals
in which the transgene comprises a functionally rearranged heavy
and/or light chain immunoglobulin gene, the second criteria of
functional gene rearrangement is unnecessary, at least for that
transgene which is already rearranged. For background on molecular
immunology, See, e.g., Fundamental Immunology, 4th edition (1998),
Paul, William E., ed. Lippencott-Raven Press, N.Y.
[0159] Some transgenic non-human animals used to generate the human
monoclonal antibodies of the invention contain rearranged,
unrearranged or a combination of rearranged and unrearranged
heterologous immunoglobulin heavy and light chain transgenes in the
germline of the transgenic animal. Each of the heavy chain
transgenes comprises at least one CH gene. In addition, the heavy
chain transgene can contain functional isotype switch sequences,
which are capable of supporting isotype switching of a heterologous
transgene encoding multiple CH genes in the B-cells of the
transgenic animal. Such switch sequences can be those which occur
naturally in the germline immunoglobulin locus from the species
that serves as the source of the transgene CH genes, or such switch
sequences can be derived from those which occur in the species that
is to receive the transgene construct (the transgenic animal). For
example, a human transgene construct that is used to produce a
transgenic mouse may produce a higher frequency of isotype
switching events if it incorporates switch sequences similar to
those that occur naturally in the mouse heavy chain locus, as
presumably the mouse switch sequences are optimized to function
with the mouse switch recombinase enzyme system, whereas the human
switch sequences are not. Switch sequences can be isolated and
cloned by conventional cloning methods, or can be synthesized de
novo from overlapping synthetic oligonucleotides designed on the
basis of published sequence information relating to immunoglobulin
switch region sequences (Mills et al., Nucl. Acids Res.
15:7305-7316 (1991); Sideras et al., Intl. Immunol. 1:631-642
(1989).
[0160] For each of the foregoing transgenic animals, functionally
rearranged heterologous heavy and light chain immunoglobulin
transgenes are found in a significant fraction of the B-cells of
the transgenic animal (at least 10 percent).
[0161] The transgenes used to generate the transgenic animals of
the invention include a heavy chain transgene comprising DNA
encoding at least one variable gene segment, one diversity gene
segment, one joining gene segment and at least one constant region
gene segment. The immunoglobulin light chain transgene comprises
DNA encoding at least one variable gene segment, one joining gene
segment and at least one constant region gene segment. The gene
segments encoding the light and heavy chain gene segments are
heterologous to the transgenic non-human animal in that they are
derived from, or correspond to, DNA encoding immunoglobulin heavy
and light chain gene segments from a species not consisting of the
transgenic non-human animal. In one aspect of the invention, the
transgene is constructed such that the individual gene segments are
unrearranged, i.e., not rearranged so as to encode a functional
immunoglobulin light or heavy chain. Such unrearranged transgenes
support recombination of the V, D, and J gene segments (functional
rearrangement) and preferably support incorporation of all or a
portion of a D region gene segment in the resultant rearranged
immunoglobulin heavy chain within the transgenic non-human animal
when exposed to CTLA-4 antigen.
[0162] Such transgenes typically comprise a substantial portion of
the C, D, and J segments as well as a subset of the V gene
segments. In such transgene constructs, the various regulatory
sequences, e.g. promoters, enhancers, class switch regions,
splice-donor and splice-acceptor sequences for RNA processing,
recombination signals and the like, comprise corresponding
sequences derived from the heterologous DNA. Such regulatory
sequences may be incorporated into the transgene from the same or a
related species of the non-human animal used in the invention. For
example, human immunoglobulin gene segments may be combined in a
transgene with a rodent immunoglobulin enhancer sequence for use in
a transgenic mouse. Alternatively, synthetic regulatory sequences
may be incorporated into the transgene, wherein such synthetic
regulatory sequences are not homologous to a functional DNA
sequence that is known to occur naturally in the genomes of
mammals. Synthetic regulatory sequences are designed according to
consensus rules, such as, for example, those specifying the
permissible sequences of a splice-acceptor site or a
promoter/enhancer motif. The transgene may comprise a
minilocus.
[0163] Some transgenic animals used to generate human antibodies to
CTLA-4 contain at least one, typically 2-10, and sometimes 25-50 or
more copies of the transgene described in Example 37 of U.S. Pat.
No. 5,770,429, or the transgene described in Example 2 below (e.g.,
HCo12), at least one copy of a light chain transgene described in
Examples 38 of U.S. Pat. No. 5,770,429, two copies of the Cmu
deletion described in Example 1 below, and two copies of the Jkappa
deletion described in Example 9 of U.S. Pat. No. 5,770,429. The
resultant animals are injected with antigens and used for
production of human monoclonal antibodies against these
antigens.
[0164] Some transgenic animals exhibit immunoglobulin production
with a significant repertoire, ideally substantially similar to
that of a native mouse. Thus, for example, animals in which the
endogenous Ig genes have been inactivated, the total immunoglobulin
levels range from about 0.1 to about 10 mg/ml of serum.
[0165] The immunoglobulins expressed by the transgenic mice
typically recognize about one-half or more of highly antigenic
proteins, e.g., staphylococcus protein A. Typically, the
immunoglobulins exhibit an association constant for preselected
antigens of at least about 10.sup.7M.sup.-1, 10.sup.8M.sup.-1,
10.sup.9M.sup.-1, 10.sup.10M.sup.-1, 10.sup.11M.sup.-1,
10.sup.12M.sup.-1, 10.sup.13M.sup.-1, or greater.
[0166] The transgenic mice of the present invention can be
immunized with a purified or enriched preparation of human CTLA-4
antigen (or antigenic fragment thereof) and/or cells expressing
human CTLA-4 as described previously. The mice produce B cells that
undergo class-switching via intratransgene switch recombination
(cis-switching) and express immunoglobulins reactive with CTLA-4.
The immunoglobulins can be human sequence antibodies, wherein the
heavy and light chain polypeptides are encoded by human transgene
sequences, which may include sequences derived by somatic mutation
and V region recombinatorial joints, as well as germline-encoded
sequences; these human sequence immunoglobulins can be referred to
as being substantially identical to a polypeptide sequence encoded
by a human VL or VH gene segment and a human JL or JH segment, even
though other non-germline sequences may be present as a result of
somatic mutation and differential V-J and V-D-J recombination
joints. With respect to such human sequence antibodies, the
variable regions of each chain are typically at least 80 percent
encoded by human germline V, J, and, in the case of heavy chains,
D, gene segments; frequently at least 85 percent of the variable
regions are encoded by human germline sequences present on the
transgene; often 90 or 95 percent or more of the variable region
sequences are encoded by human germline sequences present on the
transgene. However, since non-germline sequences are introduced by
somatic mutation and VJ and VDJ joining, the human sequence
antibodies frequently have some variable region sequences (and less
frequently constant region sequences) which are not encoded by
human V, D, or J gene segments as found in the human transgene(s)
in the germline of the mice. Typically, such non-germline sequences
(or individual nucleotide positions) cluster in or near CDRs, or in
regions where somatic mutations are known to cluster.
[0167] The human sequence antibodies which bind to the
predetermined antigen can result from isotype switching, such that
human antibodies comprising a human sequence .gamma. chain (such as
.gamma.1, .gamma.2, .gamma.3, or .gamma.4) and a human sequence
light chain (such as kappa or lambda) are produced. Such
isotype-switched human sequence antibodies often contain one or
more somatic mutation(s), typically in the variable region and
often in or within about 10 residues of a CDR) as a result of
affinity maturation and selection of B cells by antigen,
particularly subsequent to secondary (or subsequent) antigen
challenge. Some high affinity human sequence antibodies have
equilibrium association constants of at least about
1.times.10.sup.7 M.sup.-1, or at least about 1.times.10.sup.8
M.sup.-1, or more than about 1.times.10.sup.9 M.sup.-1, or
5.times.10.sup.9 M.sup.-1 to 1.times.10.sup.11 M.sup.-1 or
greater.
[0168] Another aspect of the invention pertains to the B cells from
such mice which can be used to generate hybridomas expressing human
monoclonal antibodies which bind with high affinity (e.g., having
association constant of greater than 10.sup.7M.sup.-1) to CTLA-4.
These hybridomas are used to generate a composition comprising an
immunoglobulin having an association constant (Ka) of at least
10.sup.7 M.sup.-1 for binding CTLA-4. Such immunoglobulin contains
a human sequence light chain composed of a light chain variable
region having a polypeptide sequence which is substantially
identical to a polypeptide sequence encoded by a human Vk or
V.lamda. gene segment and a human Jk or J.lamda., segment, and a
light chain constant region having a polypeptide sequence which is
substantially identical to a polypeptide sequence encoded by a
human Ck or C.lamda. gene segment. It also contains a human
sequence heavy chain composed of a heavy chain variable region
having a polypeptide sequence which is substantially identical to a
polypeptide sequence encoded by a human VH gene segment, optionally
a D region, and a human JH segment, and a constant region having a
polypeptide sequence which is substantially identical to a
polypeptide sequence encoded by a human CH gene segment.
[0169] The invention also provides human monoclonal antibodies and
human sequence antibodies to human CTLA-4 derivatized or linked to
another functional molecule, e.g., another peptide or protein
(e.g., a cytokine, a cytotoxic agent, an immune stimulatory or
inhibitory agent, a Fab' fragment, and the like, as discussed
above) to generate a bispecific or multispecific molecule which
binds to multiple binding sites or target epitopes. For example, an
antibody or antigen-binding portion of the invention can be
functionally linked (e.g., by chemical coupling, genetic fusion,
noncovalent association or otherwise) to one or more other binding
molecules, such as another antibody, antibody fragment, peptide or
binding mimetic.
[0170] Accordingly, the present invention includes bispecific and
multispecific composition comprising at least one human sequence
antibody or antigen binding fragment with a first binding
specificity for human CTLA-4 and a second binding specificity for a
second target epitope. The second target epitope can be an Fc
receptor, e.g., human Fc.gamma.RI or a human Fc.gamma. receptor.
Therefore, the invention includes bispecific and multispecific
molecules capable of binding both to Fc.gamma.R1, Fc.gamma.R or
Fc.epsilon.R expressing effector cells (e.g., monocytes,
macrophages or polymorphonuclear cells (PMNs)), and to target cells
expressing human CTLA-4. These multi-specific (e.g., bispecific or
multispecific) molecules target human CTLA-4 expressing cells to
effector cells, and trigger Fc receptor-mediated effector cell
activities, such as phagocytosis of a human CTLA-4-expressing
cells, antibody dependent cell-mediated cytotoxicity (ADCC),
cytokine release, or generation of superoxide anion.
[0171] The bispecific and multispecific molecules of the invention
can comprise a binding specificity at least one antibody, or an
antibody fragment thereof, including, e.g., an Fab, Fab',
F(ab').sub.2, Fv, or a single chain Fv. The antibody may also be a
light chain or heavy chain dimer, or any minimal fragment thereof
such as a Fv or a single chain construct as described in, e.g,
Ladner et al. U.S. Pat. No. 4,946,778. Bispecific and multispecific
molecules of the invention can comprise a binding specificity for
an Fc.gamma.R or an Fc.gamma.R present on the surface of an
effector cell, and a second binding specificity for a target cell
antigen, e.g., human CTLA-4.
[0172] The binding specificity for an Fc receptor is provided by a
monoclonal antibody, the binding of which is not blocked by human
immunoglobulin G (IgG). As used herein, the term "IgG receptor"
refers to any of the eight .gamma.-chain genes located on
chromosome 1. These genes encode a total of twelve transmembrane or
soluble receptor isoforms which are grouped into three Fc.gamma.
receptor classes: Fc.gamma.RI (CD64), Fc.gamma.RII (CD32), and
Fc.gamma.RIII (CD16). For example, the Fc.gamma. receptor can be a
human high affinity Fc.gamma.RI. The human Fc.gamma.RI is a 72 kDa
molecule, which shows high affinity for monomeric IgG (10.sup.8 to
10.sup.9M.sup.-1).
[0173] The production and characterization of these preferred
monoclonal antibodies are described by Fanger et al. in PCT
application WO 88/00052 and in U.S. Pat. No. 4,954,617. These
antibodies bind to an epitope of Fc.gamma.RI, Fc.gamma.RII or
Fc.gamma.RIII at a site which is distinct from the Fc.gamma.
binding site of the receptor and, thus, their binding is not
blocked substantially by physiological levels of IgG. Specific
anti-Fc.gamma.RI antibodies useful in this invention are MAb 22,
MAb 32, MAb 44, MAb 62 and MAb 197. The hybridoma producing MAb 32
is available from the American Type Culture Collection, ATCC
Accession No. HB9469. Anti-Fc.gamma.RI MAb 22, F(ab').sub.2
fragments of MAb 22, and can be obtained from Medarex, Inc.
(Annandale, N.J.). In other embodiments, the anti-Fc .gamma.
receptor antibody is a humanized form of monoclonal antibody 22
(H22). The production and characterization of the H22 antibody is
described in Graziano (1995) J. Immunol 155:4996-5002 and
PCT/US93/10384. The H22 antibody producing cell line was deposited
at the American Type Culture Collection on Nov. 4, 1992 under the
designation HA022CL1 and has the accession no. CRL 11177.
[0174] The binding specificity for an Fc receptor can also be
provided by an antibody that binds to a human IgA receptor, e.g.,
an Fc-alpha receptor (Fc.alpha.R (CD89)). Preferably, the antibody
binds to a human IgA receptor at a site that is not blocked by
endogenous IgA. The term "IgA receptor" is intended to include the
gene product of one .alpha.-gene (Fc.alpha.RI) located on
chromosome 19. This gene is known to encode several alternatively
spliced transmembrane isoforms of 55 to 110 kDa. Fc.alpha.RI (CD89)
is constitutively expressed on monocytes/macrophages, eosinophilic
and neutrophilic granulocytes, but not on non-effector cell
populations. Fc.alpha.RI has medium affinity
(.apprxeq.5.times.10.sup.7M.sup.-1) for both IgA1 and IgA2, which
is increased upon exposure to cytokines such as G-CSF or GM-CSF
(Morton (1996) Critical Reviews in Immunology 16:423-440). Four
Fc.alpha.RI-specific monoclonal antibodies, identified as A3, A59,
A62 and A77, which bind Fc.alpha.RI outside the IgA ligand binding
domain, have been described by, e.g, Monteiro (1992) J. Immunol.
148:1764.
[0175] Bispecific and multispecific molecules of the invention can
further comprise a binding specificity which recognizes, e.g.,
binds to, a target cell antigen, e.g. human CTLA-4. The binding
specificity is provided by a human sequence antibody or a human
monoclonal antibody of the present invention.
[0176] An "effector cell specific antibody" as used herein refers
to an antibody or functional antibody fragment that binds the Fc
receptor of effector cells. Preferred antibodies for use in the
subject invention bind the Fc receptor of effector cells at a site
which is not bound by endogenous immunoglobulin.
[0177] As used herein, the term "effector cell" refers to an immune
cell which is involved in the effector phase of an immune response,
as opposed to the cognitive and activation phases of an immune
response. Exemplary immune cells include a cell of a myeloid or
lymphoid origin, e.g., lymphocytes (e.g., B cells and T cells
including cytolytic T cells (CTLs)), killer cells, natural killer
cells, macrophages, monocytes, eosinophils, neutrophils,
polymorphonuclear cells, granulocytes, mast cells, and basophils.
Effector cells express specific Fc receptors and carry out specific
immune functions. An effector cell can induce antibody-dependent
cell-mediated cytotoxicity (ADCC), e.g., a neutrophil capable of
inducing ADCC. For example, monocytes, macrophages, neutrophils,
eosinophils, and lymphocytes which express Fc.alpha.R are involved
in specific killing of target cells and presenting antigens to
other components of the immune system, or binding to cells that
present antigens. An effector cell can also phagocytose a target
antigen, target cell, or microorganism.
[0178] The expression of a particular FcR on an effector cell can
be regulated by humoral factors such as cytokines. For example,
expression of Fc.gamma.RI has been found to be up-regulated by
interferon gamma (IFN-.gamma.). This enhanced expression increases
cytotoxic activity (including, e.g., phagocytosis) by
Fc.gamma.RI-bearing cells against target cells.
[0179] "Target cell" shall mean any undesirable cell in a subject
(e.g., a human or animal) that can be targeted by a composition
(e.g., a human sequence antibody or a human monoclonal antibody of
the invention, a bispecific or a multispecific molecule of the
invention). The target cell can be a cell expressing or
overexpressing human CTLA-4. Cells expressing human CTLA-4 can
include tumor cells, e.g. lymphomas.
[0180] In addition to human sequence antibodies and human
monoclonal antibodies of the invention, other antibodies can be
also be employed in the bispecific or multispecific molecules of
the invention, including, e.g., murine, chimeric and humanized
monoclonal antibodies.
[0181] Chimeric mouse-human monoclonal antibodies (i.e., chimeric
antibodies) can be produced by recombinant DNA techniques known in
the art. For example, a gene encoding the Fc constant region of a
murine (or other species) monoclonal antibody molecule is digested
with restriction enzymes to remove the region encoding the murine
Fc, and the equivalent portion of a gene encoding a human Fc
constant region is substituted. (See, e.g., Robinson et al.,
International Patent Publication PCT/US86/02269; Akira, et al.,
European Patent Application 184,187; Taniguchi, M., European Patent
Application 171,496; Morrison et al., European Patent Application
173,494; Neuberger et al., International Application WO 86/01533;
Cabilly et al. U.S. Pat. No. 4,816,567; Cabilly et al., European
Patent Application 125,023; Better (1988) Science 240:1041-1043;
Liu (1987) PNAS 84:3439-3443; Liu (1987) J. Immunol. 139:3521-3526;
Sun (1987) PNAS 84:214-218; Nishimura (1987) Canc. Res.
47:999-1005; Wood (1985) Nature 314:446-449; Shaw (1988) J. Natl.
Cancer Inst. 80:1553-1559).
[0182] The chimeric antibody can be further humanized by replacing
sequences of the Fv variable region which are not directly involved
in antigen binding with equivalent sequences from human Fv variable
regions. General reviews of humanized chimeric antibodies are
provided by Morrison (1985) Science 229:1202-1207 and by Oi (1986)
BioTechniques 4:214. Those methods include isolating, manipulating,
and expressing the nucleic acid sequences that encode all or part
of immunoglobulin Fv variable regions from at least one of a heavy
or light chain. Sources of such nucleic acid are well known to
those skilled in the art and, for example, may be obtained from
7E3, an anti-GPII.sub.bIII.sub.a antibody producing hybridoma. The
recombinant DNA encoding the chimeric antibody, or fragment
thereof, can then be cloned into an appropriate expression vector.
Suitable humanized antibodies can alternatively be produced by CDR
substitution U.S. Pat. No. 5,225,539; Jones (1986) Nature
321:552-525; Verhoeyan et al. 1988 Science 239:1534; and Beidler
(1988) J. Immunol. 141:4053-4060.
[0183] All of the CDRs of a particular human antibody may be
replaced with at least a portion of a non-human CDR or only some of
the CDRs may be replaced with non-human CDRs. It is only necessary
to replace the number of CDRs required for binding of the humanized
antibody to the Fc receptor. An antibody can be humanized by any
method, which is capable of replacing at least a portion of a CDR
of a human antibody with a CDR derived from a non-human antibody.
Winter describes a method which may be used to prepare the
humanized antibodies of the present invention, see UK Patent
Application GB 2188638A, filed on Mar. 26, 1987. The human CDRs may
be replaced with non-human CDRs using oligonucleotide site-directed
mutagenesis as described in, e.g., WO 94/10332 entitled, Humanized
Antibodies to Fc Receptors for Immunoglobulin G on Human
Mononuclear Phagocytes.
[0184] Chimeric and humanized antibodies in which specific amino
acids have been substituted, deleted or added are also within the
scope of the invention. For example, humanized antibodies can have
amino acid substitutions in the framework region, such as to
improve binding to the antigen. In a humanized antibody having
mouse CDRs, amino acids located in the human framework region can
be replaced with the amino acids located at the corresponding
positions in the mouse antibody. Such substitutions are known to
improve binding of humanized antibodies to the antigen in some
instances. Antibodies in which amino acids have been added,
deleted, or substituted are referred to herein as modified
antibodies or altered antibodies.
[0185] Bispecific and multispecific molecules of the invention can
further include a third binding specificity, in addition to an
anti-Fc binding specificity and an anti-human CTLA-4 binding
specificity. The third binding specificity can be an
anti-enhancement factor (EF) portion, e.g., a molecule which binds
to a surface protein involved in cytotoxic activity and thereby
increases the immune response against the target cell. The
"anti-enhancement factor portion" can be an antibody, functional
antibody fragment or a ligand that binds to a given molecule, e.g.,
an antigen or a receptor, and thereby results in an enhancement of
the effect of the binding determinants for the Fc receptor or
target cell antigen. The "anti-enhancement factor portion" can bind
an Fc receptor or a target cell antigen. Alternatively, the
anti-enhancement factor portion can bind to an entity that is
different from the entity to which the first and second binding
specificities bind. For example, the anti-enhancement factor
portion can bind a cytotoxic T-cell via, e.g., CD2, CD3, CD8, CD28,
CD4, CD40, ICAM-1 or other immune cell molecules that are involved
in an increased immune response against the target cell.
[0186] Bispecific and multispecific molecules of the present
invention can be made using chemical techniques (see, e.g., Kranz
(1981) Proc. Natl. Acad. Sci. USA 78:5807), "polydoma" techniques
(see, e.g., U.S. Pat. No. 4,474,893), or recombinant DNA
techniques. Bispecific and multispecific molecules of the present
invention can also be prepared by conjugating the constituent
binding specificities, e.g., the anti-FcR and anti-human CTLA-4
binding specificities, using methods known in the art and as
described herein. For example, each binding specificity of the
bispecific and multispecific molecule can be generated separately
and then conjugated to one another. When the binding specificities
are proteins or peptides, a variety of coupling or cross-linking
agents can be used for covalent conjugation. Examples of
cross-linking agents include protein A, carbodiimide,
N-succinimidyl-S-acetyl-thioacetate (SATA),
N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), and
sulfosuccinimidyl 4-(N-maleimidomethyl) cyclohaxane-1-carboxylate
(sulfo-SMCC) (see, e.g., Karpovsky (1984) J. Exp. Med. 160:1686;
Liu (1985) Proc. Natl. Acad. Sci. USA 82:8648). Other methods
include those described by Paulus (Behring Ins. Mitt. (1985) No.
78, 118-132; Brennan (1985) Science 229:81-83), Glennie (1987) J.
Immunol. 139: 2367-2375). Other conjugating agents are SATA and
sulfo-SMCC, both available from Pierce Chemical Co. (Rockford,
Ill.).
[0187] When the binding specificities are antibodies (e.g., two
humanized antibodies), they can be conjugated via sulfhydryl
bonding of the C-terminus hinge regions of the two heavy chains.
The hinge region can be modified to contain an odd number of
sulfhydryl residues, e.g., one, prior to conjugation.
[0188] Alternatively, both binding specificities can be encoded in
the same vector and expressed and assembled in the same host cell.
This method is particularly useful where the bispecific and
multispecific molecule is a MAb.times.MAb, MAb.times.Fab,
Fab.times.F(ab').sub.2 or ligand.times.Fab fusion protein. A
bispecific and multispecific molecule of the invention, e.g., a
bispecific molecule can be a single chain molecule, such as a
single chain bispecific antibody, a single chain bispecific
molecule comprising one single chain antibody and a binding
determinant, or a single chain bispecific molecule comprising two
binding determinants. Bispecific and multispecific molecules can
also be single chain molecules or may comprise at least two single
chain molecules. Methods for preparing bi- and multispecific
molecules are described for example in U.S. Pat. Nos. 5,260,203;
5,455,030; 4,881,175; 5,132,405; 5,091,513; 5,476,786; 5,013,653;
5,258,498; and 5,482,858.
[0189] Binding of the bispecific and multispecific molecules to
their specific targets can be confirmed by enzyme-linked
immunosorbent assay (ELISA), a radioimmunoassay (RIA), or a Western
Blot Assay. Each of these assays generally detects the presence of
protein-antibody complexes of particular interest by employing a
labeled reagent (e.g., an antibody) specific for the complex of
interest. For example, the FcR-antibody complexes can be detected
using e.g., an enzyme-linked antibody or antibody fragment which
recognizes and specifically binds to the antibody-FcR complexes.
Alternatively, the complexes can be detected using any of a variety
of other immunoassays. For example, the antibody can be
radioactively labeled and used in a radioimmunoassay (RIA) (see,
for example, Weintraub, B., Principles of Radioimmunoassays,
Seventh Training Course on Radioligand Assay Techniques, The
Endocrine Society, March, 1986, which is incorporated by reference
herein). The radioactive isotope can be detected by such means as
the use of a .gamma. counter or a scintillation counter or by
autoradiography.
[0190] Also included in the invention are modified antibodies. The
term "modified antibody" includes antibodies, such as monoclonal
antibodies, chimeric antibodies, and humanized antibodies which
have been modified by, e.g., deleting, adding, or substituting
portions of the antibody. For example, an antibody can be modified
by deleting the constant region and replacing it with a constant
region meant to increase half-life, e.g., serum half-life,
stability or affinity of the antibody.
[0191] The antibody conjugates of the invention can be used to
modify a given biological response or create a biological response
(e.g., to recruit effector cells). The drug moiety is not to be
construed as limited to classical chemical therapeutic agents. For
example, the drug moiety may be a protein or polypeptide possessing
a desired biological activity. Such proteins may include, for
example, an enzymatically active toxin, or active fragment thereof,
such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin;
a protein such as tumor necrosis factor or interferon-alpha; or,
biological response modifiers such as, for example, lymphokines,
interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6
("IL-6"), granulocyte macrophage colony stimulating factor
("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or
other growth factors.
[0192] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev., 62:119-58 (1982).
Pharmaceutical Compositions
[0193] The invention provides pharmaceutical compositions
comprising one or a combination of human monoclonal antibodies
and/or human sequence antibodies (intact or binding fragments)
formulated together with a pharmaceutically acceptable carrier.
Some compositions include a combination of multiple (e.g., two or
more) isolated human antibodies and/or human sequence antibody or
antigen-binding portions thereof of the invention. In some
compositions, each of the antibodies or antigen-binding portions
thereof of the composition is a monoclonal antibody or a human
sequence antibody that binds to a distinct, pre-selected epitope of
human CTLA-4.
[0194] A. Effective Dosages
[0195] Dosage regimens are adjusted to provide the optimum desired
response (e.g., a therapeutic response). For example, a single
bolus may be administered, several divided doses may be
administered over time or the dose may be proportionally reduced or
increased as indicated by the exigencies of the therapeutic
situation. It is especially advantageous to formulate parenteral
compositions in dosage unit form for ease of administration and
uniformity of dosage. Dosage unit form as used herein refers to
physically discrete units suited as unitary dosages for the
subjects to be treated; each unit contains a predetermined quantity
of active compound calculated to produce the desired therapeutic
effect in association with the required pharmaceutical carrier. The
specification for the dosage unit forms of the invention are
dictated by and directly dependent on (a) the unique
characteristics of the active compound and the particular
therapeutic effect to be achieved, and (b) the limitations inherent
in the art of compounding such an active compound for the treatment
of sensitivity in individuals.
[0196] Examples of pharmaceutically-acceptable antioxidants
include: (1) water soluble antioxidants, such as ascorbic acid,
cysteine hydrochloride, sodium bisulfate, sodium metabisulfite,
sodium sulfite and the like; (2) oil-soluble antioxidants, such as
ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated
hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol,
and the like; and (3) metal chelating agents, such as citric acid,
ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid,
phosphoric acid, and the like.
[0197] Regardless of the route of administration selected, the
compounds of the present invention, which may be used in a suitable
hydrated form, and/or the pharmaceutical compositions of the
present invention, are formulated into pharmaceutically acceptable
dosage forms by conventional methods known to those of skill in the
art.
[0198] Actual dosage levels of the active ingredients in the
pharmaceutical compositions of the present invention can be varied
so as to obtain an amount of the active ingredient which is
effective to achieve the desired therapeutic response for a
particular patient, composition, and mode of administration,
without being toxic to the patient. The selected dosage level
depends upon a variety of pharmacokinetic factors including the
activity of the particular compositions of the present invention
employed, or the ester, salt or amide thereof, the route of
administration, the time of administration, the rate of excretion
of the particular compound being employed, the duration of the
treatment, other drugs, compounds and/or materials used in
combination with the particular compositions employed, the age,
sex, weight, condition, general health and prior medical history of
the patient being treated, and like factors.
[0199] A physician or veterinarian can start doses of the compounds
of the invention employed in the pharmaceutical composition at
levels lower than that required to achieve the desired therapeutic
effect and gradually increase the dosage until the desired effect
is achieved. In general, a suitable daily dose of a compositions of
the invention is that amount of the compound which is the lowest
dose effective to produce a therapeutic effect. Such an effective
dose generally depends upon the factors described above. It is
preferred that administration be intravenous, intramuscular,
intraperitoneal, or subcutaneous, or administered proximal to the
site of the target. If desired, the effective daily dose of a
therapeutic compositions can be administered as two, three, four,
five, six or more sub-doses administered separately at appropriate
intervals throughout the day, optionally, in unit dosage forms.
While it is possible for a compound of the present invention to be
administered alone, it is preferable to administer the compound as
a pharmaceutical formulation (composition).
[0200] Effective doses of the compositions of the present
invention, for the treatment of immune-related conditions and
diseases described herein vary depending upon many different
factors, including means of administration, target site,
physiological state of the patient, whether the patient is human or
an animal, other medications administered, and whether treatment is
prophylactic or therapeutic. Treatment dosages need to be titrated
to optimize safety and efficacy.
[0201] For administration with an antibody, the dosage ranges from
about 0.0001 to 100 mg/kg, and more usually 0.01 to 5 mg/kg, of the
host body weight. For example dosages can be 1 mg/kg body weight or
10 mg/kg body weight or within the range of 1-10 mg/kg. An
exemplary treatment regime entails administration once per every
two weeks or once a month or once every 3 to 6 months. In some
methods, two or more monoclonal antibodies with different binding
specificities are administered simultaneously, in which case the
dosage of each antibody administered falls within the ranges
indicated. Antibody is usually administered on multiple occasions.
Intervals between single dosages can be weekly, monthly or yearly.
Intervals can also be irregular as indicated by measuring blood
levels of antibody to CTLA-4 in the patient. In some methods,
dosage is adjusted to achieve a plasma antibody concentration of
1-1000 .mu.g/ml and in some methods 25-300 .mu.g/ml. Alternatively,
antibody can be administered as a sustained release formulation, in
which case less frequent administration is required. Dosage and
frequency vary depending on the half-life of the antibody in the
patient. In general, human antibodies show the longest half life,
followed by humanized antibodies, chimeric antibodies, and nonhuman
antibodies. The dosage and frequency of administration can vary
depending on whether the treatment is prophylactic or therapeutic.
In prophylactic applications, a relatively low dosage is
administered at relatively infrequent intervals over a long period
of time. Some patients continue to receive treatment for the rest
of their lives. In therapeutic applications, a relatively high
dosage at relatively short intervals is sometimes required until
progression of the disease is reduced or terminated, and preferably
until the patient shows partial or complete amelioration of
symptoms of disease. Thereafter, the patent can be administered a
prophylactic regime.
[0202] Doses for nucleic acids encoding immunogens range from about
10 ng to 1 g, 100 ng to 100 mg, 1 .mu.g to 10 mg, or 30-300 .mu.g
DNA per patient. Doses for infectious viral vectors vary from
10-100, or more, virions per dose.
[0203] Some human sequence antibodies and human monoclonal
antibodies of the invention can be formulated to ensure proper
distribution in vivo. For example, the blood-brain barrier (BBB)
excludes many highly hydrophilic compounds. To ensure that the
therapeutic compounds of the invention cross the BBB (if desired),
they can be formulated, for example, in liposomes. For methods of
manufacturing liposomes, See, e.g., U.S. Pat. Nos. 4,522,811;
5,374,548; and 5,399,331. The liposomes may comprise one or more
moieties which are selectively transported into specific cells or
organs, thus enhance targeted drug delivery (See, e.g., V.V. Ranade
(1989) J. Clin. Pharmacol. 29:685). Exemplary targeting moieties
include folate or biotin (See, e.g., U.S. Pat. No. 5,416,016 to Low
et al.); mannosides (Umezawa et al., (1988) Biochem. Biophys. Res.
Commun. 153:1038); antibodies (P. G. Bloeman et al. (1995) FEBS
Lett. 357:140; M. Owais et al. (1995) Antimicrob. Agents Chemother.
39:180); surfactant protein A receptor (Briscoe et al. (1995) Am.
J. Physiol. 1233:134), different species of which may comprise the
formulations of the inventions, as well as components of the
invented molecules; p120 (Schreier et al. (1994) J. Biol. Chem.
269:9090); See also K. Keinanen; M. L. Laukkanen (1994) FEBS Lett.
346:123; J. J. Killion; I. J. Fidler (1994) Immunomethods 4:273. In
some methods, the therapeutic compounds of the invention are
formulated in liposomes; in a more preferred embodiment, the
liposomes include a targeting moiety. In some methods, the
therapeutic compounds in the liposomes are delivered by bolus
injection to a site proximal to the tumor or infection. The
composition should be fluid to the extent that easy syringability
exists. It should be stable under the conditions of manufacture and
storage and should be preserved against the contaminating action of
microorganisms such as bacteria and fungi.
[0204] For therapeutic applications, the pharmaceutical
compositions are administered to a patient suffering from
established disease in an amount sufficient to arrest or inhibit
further development or reverse or eliminate, the disease, its
symptoms or biochemical markers. For prophylactic applications, the
pharmaceutical compositions are administered to a patient
susceptible or at risk of a disease in an amount sufficient to
delay, inhibit or prevent development of the disease, its symptoms
and biochemical markers. An amount adequate to accomplish this is
defined as a "therapeutically-" or "prophylactically-effective
dose." Dosage depends on the disease being treated, the subject's
size, the severity of the subject's symptoms, and the particular
composition or route of administration selected. Specifically, in
treatment of tumors, a "therapeutically effective dosage" can
inhibit tumor growth by at least about 20%, or at least about 40%,
or at least about 60%, or at least about 80% relative to untreated
subjects. The ability of a compound to inhibit cancer can be
evaluated in an animal model system predictive of efficacy in human
tumors. Alternatively, this property of a composition can be
evaluated by examining the ability of the compound to inhibit by
conventional assays in vitro. A therapeutically effective amount of
a therapeutic compound can decrease tumor size, or otherwise
ameliorate symptoms in a subject.
[0205] The composition should be sterile and fluid to the extent
that the composition is deliverable by syringe. In addition to
water, the carrier can be an isotonic buffered saline solution,
ethanol, polyol (for example, glycerol, propylene glycol, and
liquid polyetheylene glycol, and the like), and suitable mixtures
thereof. Proper fluidity can be maintained, for example, by use of
coating such as lecithin, by maintenance of required particle size
in the case of dispersion and by use of surfactants. In many cases,
it is preferable to include isotonic agents, for example, sugars,
polyalcohols such as mannitol or sorbitol, and sodium chloride in
the composition. Long-term absorption of the injectable
compositions can be brought about by including in the composition
an agent which delays absorption, for example, aluminum
monostearate or gelatin.
[0206] When the active compound is suitably protected, as described
above, the compound may be orally administered, for example, with
an inert diluent or an assimilable edible carrier.
[0207] B. Routes of Administration
[0208] Pharmaceutical compositions of the invention also can be
administered in combination therapy, i.e., combined with other
agents. For example, in treatment of cancer, the combination
therapy can include a composition of the present invention with at
least one anti-tumor agent or other conventional therapy, such as
radiation treatment.
[0209] Pharmaceutically acceptable carriers includes solvents,
dispersion media, coatings, antibacterial and antifungal agents,
isotonic and absorption delaying agents, and the like that are
physiologically compatible. The carrier can be suitable for
intravenous, intramuscular, subcutaneous, parenteral, spinal or
epidermal administration (e.g., by injection or infusion).
Depending on the route of administration, the active compound,
i.e., antibody, bispecific and multispecific molecule, may be
coated in a material to protect the compound from the action of
acids and other natural conditions that may inactivate the
compound.
[0210] A "pharmaceutically acceptable salt" refers to a salt that
retains the desired biological activity of the parent compound and
does not impart any undesired toxicological effects (See, e.g.,
Berge, S. M., et al. (1977) J. Pharm. Sci. 66:1-19). Examples of
such salts include acid addition salts and base addition salts.
Acid addition salts include those derived from nontoxic inorganic
acids, such as hydrochloric, nitric, phosphoric, sulfuric,
hydrobromic, hydroiodic, phosphorous and the like, as well as from
nontoxic organic acids such as aliphatic mono- and dicarboxylic
acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids,
aromatic acids, aliphatic and aromatic sulfonic acids and the like.
Base addition salts include those derived from alkaline earth
metals, such as sodium, potassium, magnesium, calcium and the like,
as well as from nontoxic organic amines, such as
N,N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine,
choline, diethanolamine, ethylenediamine, procaine and the
like.
[0211] A composition of the present invention can be administered
by a variety of methods known in the art. The route and/or mode of
administration vary depending upon the desired results. The active
compounds can be prepared with carriers that protect the compound
against rapid release, such as a controlled release formulation,
including implants, transdermal patches, and microencapsulated
delivery systems. Biodegradable, biocompatible polymers can be
used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic
acid, collagen, polyorthoesters, and polylactic acid. Many methods
for the preparation of such formulations are described by e.g.,
Sustained and Controlled Release Drug Delivery Systems, J. R.
Robinson, ed., Marcel Dekker, Inc., New York, 1978. Pharmaceutical
compositions are preferably manufactured under GMP conditions.
[0212] To administer a compound of the invention by certain routes
of administration, it may be necessary to coat the compound with,
or co-administer the compound with, a material to prevent its
inactivation. For example, the compound may be administered to a
subject in an appropriate carrier, for example, liposomes, or a
diluent. Pharmaceutically acceptable diluents include saline and
aqueous buffer solutions. Liposomes include water-in-oil-in-water
CGF emulsions as well as conventional liposomes (Strejan et al.
(1984) J. Neuroimmunol. 7:27).
[0213] Pharmaceutically acceptable carriers include sterile aqueous
solutions or dispersions and sterile powders for the extemporaneous
preparation of sterile injectable solutions or dispersion. The use
of such media and agents for pharmaceutically active substances is
known in the art. Except insofar as any conventional media or agent
is incompatible with the active compound, use thereof in the
pharmaceutical compositions of the invention is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0214] Therapeutic compositions typically must be sterile,
substantially isotonic, and stable under the conditions of
manufacture and storage. The composition can be formulated as a
solution, microemulsion, liposome, or other ordered structure
suitable to high drug concentration. The carrier can be a solvent
or dispersion medium containing, for example, water, ethanol,
polyol (for example, glycerol, propylene glycol, and liquid
polyethylene glycol, and the like), and suitable mixtures thereof.
The proper fluidity can be maintained, for example, by the use of a
coating such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants. In many cases, it is preferable to include isotonic
agents, for example, sugars, polyalcohols such as mannitol,
sorbitol, or sodium chloride in the composition. Prolonged
absorption of the injectable compositions can be brought about by
including in the composition an agent that delays absorption, for
example, monostearate salts and gelatin.
[0215] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by sterilization
microfiltration. Generally, dispersions are prepared by
incorporating the active compound into a sterile vehicle that
contains a basic dispersion medium and the required other
ingredients from those enumerated above. In the case of sterile
powders for the preparation of sterile injectable solutions, the
preferred methods of preparation are vacuum drying and
freeze-drying (lyophilization) that yield a powder of the active
ingredient plus any additional desired ingredient from a previously
sterile-filtered solution thereof. Therapeutic compositions can
also be administered with medical devices known in the art. For
example, in a preferred embodiment, a therapeutic composition of
the invention can be administered with a needleless hypodermic
injection device, such as the devices disclosed in, e.g., U.S. Pat.
Nos. 5,399,163, 5,383,851, 5,312,335, 5,064,413, 4,941,880,
4,790,824, or 4,596,556. Examples of implants and modules useful in
the present invention include: U.S. Pat. No. 4,487,603, which
discloses an implantable micro-infusion pump for dispensing
medication at a controlled rate; U.S. Pat. No. 4,486,194, which
discloses a therapeutic device for administering medicants through
the skin; U.S. Pat. No. 4,447,233, which discloses a medication
infusion pump for delivering medication at a precise infusion rate;
U.S. Pat. No. 4,447,224, which discloses a variable flow
implantable infusion apparatus for continuous drug delivery; U.S.
Pat. No. 4,439,196, which discloses an osmotic drug delivery system
having multi-chamber compartments; and U.S. Pat. No. 4,475,196,
which discloses an osmotic drug delivery system. Many other such
implants, delivery systems, and modules are known.
[0216] C. Formulation
[0217] For the therapeutic compositions, formulations of the
present invention include those suitable for oral, nasal, topical
(including buccal and sublingual), rectal, vaginal and/or
parenteral administration. The formulations can conveniently be
presented in unit dosage form and may be prepared by any methods
known in the art of pharmacy. The amount of active ingredient which
can be combined with a carrier material to produce a single dosage
form vary depending upon the subject being treated, and the
particular mode of administration. The amount of active ingredient
which can be combined with a carrier material to produce a single
dosage form generally be that amount of the composition which
produces a therapeutic effect. Generally, out of one hundred
percent, this amount range from about 0.01 percent to about
ninety-nine percent of active ingredient, from about 0.1 percent to
about 70 percent, or from about 1 percent to about 30 percent.
[0218] Formulations of the present invention which are suitable for
vaginal administration also include pessaries, tampons, creams,
gels, pastes, foams or spray formulations containing such carriers
as are known in the art to be appropriate. Dosage forms for the
topical or transdermal administration of compositions of this
invention include powders, sprays, ointments, pastes, creams,
lotions, gels, solutions, patches and inhalants. The active
compound may be mixed under sterile conditions with a
pharmaceutically acceptable carrier, and with any preservatives,
buffers, or propellants which may be required.
[0219] The phrases "parenteral administration" and "administered
parenterally" mean modes of administration other than enteral and
topical administration, usually by injection, and includes, without
limitation, intravenous, intramuscular, intraarterial, intrathecal,
intracapsular, intraorbital, intracardiac, intradermal,
intraperitoneal, transtracheal, subcutaneous, subcuticular,
intraarticular, subcapsular, subarachnoid, intraspinal, epidural
and intrasternal injection and infusion.
[0220] Examples of suitable aqueous and nonaqueous carriers which
may be employed in the pharmaceutical compositions of the invention
include water, ethanol, polyols (such as glycerol, propylene
glycol, polyethylene glycol, and the like), and suitable mixtures
thereof, vegetable oils, such as olive oil, and injectable organic
esters, such as ethyl oleate. Proper fluidity can be maintained,
for example, by the use of coating materials, such as lecithin, by
the maintenance of the required particle size in the case of
dispersions, and by the use of surfactants.
[0221] These compositions may also contain adjuvants such as
preservatives, wetting agents, emulsifying agents and dispersing
agents. Prevention of presence of microorganisms may be ensured
both by sterilization procedures, supra, and by the inclusion of
various antibacterial and antifungal agents, for example, paraben,
chlorobutanol, phenol sorbic acid, and the like. It may also be
desirable to include isotonic agents, such as sugars, sodium
chloride, and the like into the compositions. In addition,
prolonged absorption of the injectable pharmaceutical form may be
brought about by the inclusion of agents which delay absorption
such as aluminum monostearate and gelatin.
[0222] When the compounds of the present invention are administered
as pharmaceuticals, to humans and animals, they can be given alone
or as a pharmaceutical composition containing, for example, 0.01 to
99.5% (or 0.1 to 90%) of active ingredient in combination with a
pharmaceutically acceptable carrier.
[0223] The pharmaceutical compositions are generally formulated as
sterile, substantially isotonic and in full compliance with all
Good Manufacturing Practice (GMP) regulations of the U.S. Food and
Drug Administration.
[0224] Methods and Uses of the Invention
[0225] A. Methods
[0226] The compositions (e.g., human sequence antibodies and human
monoclonal antibodies to human CTLA-4 and derivatives/conjugates
thereof) of the present invention have in vitro and in vivo
diagnostic and therapeutic utilities. For example, these molecules
can be administered to cells in culture, e.g. in vitro or ex vivo,
or in a subject, e.g., in vivo, to treat, prevent or diagnose a
variety of disorders. The term "subject" includes human and
non-human animals. Non-human animals includes all vertebrates,
e.g., mammals and non-mammals, such as non-human primates, sheep,
dog, cow, chickens, amphibians, and reptiles. The methods are
particularly suitable for treating human patients having a disorder
that can be treated by augmenting or reducing the T-cell mediated
immune response.
[0227] When antibodies to CTLA-4 are administered together with
another agent, the two can be administered in either order or
simultaneously. The methods can be used to treat any kind of cancer
including melanoma, colon cancer, prostate cancer, and renal
cancer.
[0228] For example, latex microspheres coated with anti-CTLA-4 (to
increase the valency of the antibody) can inhibit T cell
proliferation and activation. Agents having the same antibody
combining site may act as a CTLA-4 antagonist when presented as an
Fab or a soluble IgG, and a CTLA-4 agonist when highly
cross-linked. Thus multivalent forms of anti-CTLA-4 antibodies are
useful therapeutic agents for down-modulating immune responses.
[0229] In addition to linking to latex microspheres or other
insoluble particles, the antibodies can be cross-linked to each
other or genetically engineered to form multimers. Cross-linking
can be by direct chemical linkage, or by indirect linkage such as
an antibody-biotin-avidin complex. Cross-linking can be covalent,
where chemical linking groups are employed, or non-covalent, where
protein-protein or other protein-ligand interactions are employed.
Genetic engineering approaches for linking include, e.g., the
re-expression of the variable regions of high-affinity IgG
antibodies in IgM expression vectors or any protein moiety (e.g.,
polylysine, and the like). Converting a high affinity IgG antibody
to an IgM antibody can create a decavalent complex with very high
avidity. IgA.sub.2 expression vectors may also be used to produce
multivalent antibody complexes. IgA.sub.2 can form polymers
together with J chain and secretory component. IgA.sub.2 may have
the added advantage that it can be additionally crosslinked by the
IgA receptor CD89, which is expressed on neutrophils, macrophages,
and monocytes.
[0230] Agonism can also be obtained using some preparations of
polyclonal antibodies to CTLA-4 comprising antibodies to at least
two non-overlapping epitopes on CTLA-4. One antibody in such a
preparation containing two binding sites can bind to two molecules
of CTLA-4 to form a small cluster. A second antibody possessing
different binding sites can then link (aggregate) these small
clusters to form large clusters, thereby forming a complex of
CTLA-4 (on the cell surface) that can transduce a signal to the T
cell to inhibit, reduce or prevent activation of the T-cell bearing
(expressing) CTLA-4. Thus, some preparations of polyclonal
antibodies show similar agonism to the polyvalent preparations
described above.
[0231] Therefore, polyvalent or polyclonal preparations of anti
CTLA-4 antibodies are useful for agonizing the CTLA-4 receptor,
thereby suppressing immune responses otherwise mediated by T cells
bearing the CTLA-4 receptor. Some examples of diseases that can be
treated using such polyvalent or polyclonal preparations of
antibodies induce autoimmune disease, transplant rejection, and
inflammation.
[0232] B. Uses
[0233] 1. Activating Immune Responses
[0234] a. Cancer
[0235] Some therapeutic methods treat patients with cancer.
Blockade of CTLA-4 by antibodies can enhance the immune response to
cancerous cells in the patient. Optionally, antibodies to CTLA-4
can be combined with an immunogenic agent, such as cancerous cells,
purified tumor antigens (including recombinant proteins, peptides,
and carbohydrate molecules), cells, and cells transfected with
genes encoding immune stimulating cytokines and cell surface
antigens such as B7 (see, e.g., Hurwitz, A. et al. (1998) Proc.
Natl. Acad. Sci U.S.A. 95, 10067-10071).
[0236] In murine experimental systems, implantation of some tumors
followed by the administration of anti-CTLA-4 antibodies can result
in the rejection of tumors. In some cases tumor rejection of
established tumors occurs; in other cases the growth of the tumor
is slowed by the use of anti-CTLA-4 antibodies. In general CTLA-4
blockade is effective against immunogenic tumors. Operationally
this is defined as those tumors for which vaccination using the
tumor itself can lead to immunity to tumor challenge. In humans,
some tumors have been shown to be immunogenic such as melanomas. It
is anticipated that by raising the threshold of T cell activation
by CTLA-4 blockade, we may expect to activate tumor responses in
the host.
[0237] CTLA-4 blockade is most effective when combined with a
vaccination protocol. Many experimental strategies for vaccination
against tumors have been devised (see Rosenberg, S., 2000,
Development of Cancer Vaccines, ASCO Educational Book Spring:
60-62; Logothetis, C., 2000, ASCO Educational Book Spring: 300-302;
Khayat, D. 2000, ASCO Educational Book Spring: 414-428; Foon, K.
2000, ASCO Educational Book Spring: 730-738; see also Restifo, N.
and Sznol, M., Cancer Vaccines, Ch. 61, pp. 3023-3043 in DeVita, V.
et al. (eds.), 1997, Cancer: Principles and Practice of Oncology,
Fifth Edition). In one of these strategies, a vaccine is prepared
using autologous or allogeneic tumor cells. These cellular vaccines
have been shown to be most effective when the tumor cells are
transduced to express GM-CSF. GM-CSF has been shown to be a potent
activator of antigen presentation for tumor vaccination (Dranoff et
al. (1993) Proc. Natl. Acad. Sci U.S.A. 90 (80: 3539-43).
[0238] Anti-CTLA-4 blockade together with the use of GMCSF-modified
tumor cell vaccines has been shown to be effective in a number of
experimental tumor models such as mammary carcinoma (Hurwitz et al.
(1998) supra), primary prostate cancer (Hurwitz A. et al. (2000)
Cancer Research 60 (9): 2444-8) and melanoma (van Elsas, A et al.
(1999) J. Exp. Med. 190: 355-66). In these instances,
non-immunogenic tumors, such as the B16 melanoma, have been
rendered susceptible to destruction by the immune system. The tumor
cell vaccine may also be modified to express other immune
activators such as IL2, and costimulatory molecules, among
others.
[0239] The study of gene expression and large scale gene expression
patterns in various tumors has led to the definition of so called
tumor specific antigens (Rosenberg, SA (1999) Immunity 10: 281-7).
In many cases, these tumor specific antigens are differentiation
antigens expressed in the tumors and in the cell from which the
tumor arose, for example melanocyte antigens gp 100, MAGE antigens,
Trp-2. More importantly, many of these antigens can be shown to be
the targets of tumor specific T cells found in the host. CTLA-4
blockade may be used in conjunction with a collection of
recombinant proteins and/or peptides expressed in a tumor in order
to generate an immune response to these proteins. These proteins
are normally viewed by the immune system as self antigens and are
therefore tolerant to them. The tumor antigen may also include the
protein telomerase, which is required for the synthesis of
telomeres of chromosomes and which is expressed in more than 85% of
human cancers and in only a limited number of somatic tissues (Kim,
N et al. (1994) Science 266, 2011-2013). (These somatic tissues may
be protected from immune attack by various means). Tumor antigen
may also be "neo-antigens" expressed in cancer cells because of
somatic mutations that alter protein sequence or create fusion
proteins between two unrelated sequences (ie. bcr-abl in the
Philadelphia chromosome), or idiotype from B cell tumors. Other
tumor vaccines may include the proteins from viruses implicated in
human cancers such a Human Papilloma Viruses (HPV), Hepatitis
Viruses (HBV and HCV) and Kaposi's Herpes Sarcoma Virus (KHSV).
Another form of tumor specific antigen which may be used in
conjunction with CTLA-4 blockade is purified heat shock proteins
(HSP) isolated from the tumor tissue itself. These heat shock
proteins contain fragments of proteins from the tumor cells and
these HSPs are highly efficient at delivery to antigen presenting
cells for eliciting tumor immunity (Suot, R & Srivastava, P
(1995) Science 269: 1585-1588; Tamura, Y. et al. (1997) Science
278: 117-120.
[0240] Dendritic cells (DC) are potent antigen presenting cells
that can be used to prime antigen-specific responses. DC's can be
produced ex vivo and loaded with various protein and peptide
antigens as well as tumor cell extracts (Nestle, F. et al. (1998)
Nature Medicine 4: 328-332). DCs may also be transduced by genetic
means to express these tumor antigens as well. DCs have also been
fused directly to tumor cells for the purposes of immunization
(Kugler, A. et al. (2000) Nature Medicine 6:332-336). As a method
of vaccination, DC immunization may be effectively combined with
CTLA-4 blockade to activate more potent anti-tumor responses.
[0241] CTLA-4 blockade may also be combined with standard cancer
treatments. CTLA-4 blockade may be effectively combined with
chemotherapeutic regimes. In these instances, it may be possible to
reduce the dose of chemotherapeutic reagent administered (Mokyr, M.
et al. (1998) Cancer Research 58: 5301-5304). The scientific
rationale behind the combined use of CTLA-4 blockade and
chemotherapy is that cell death, that is a consequence of the
cytotoxic action of most chemotherapeutic compounds, should result
in increased levels of tumor antigen in the antigen presentation
pathway. Other combination therapies that may result in synergy
with CTLA-4 blockade through cell death are radiation, surgery, and
hormone deprivation (Kwon, E. et al. (1999) Proc. Natl. Acad. Sci
U.S.A. 96 (26): 15074-9. Each of these protocols creates a source
of tumor antigen in the host. Angiogenesis inhibitors may also be
combined with CTLA-4 blockade. Inhibition of angiogenesis leads to
tumor cell death which may feed tumor antigen into host antigen
presentation pathways.
[0242] CTLA-4 blocking antibodies can also be used in combination
with bispecific antibodies that target Fc alpha or Fc gamma
receptor-expressing effectors cells to tumor cells (see, e.g., U.S.
Pat. Nos. 5,922,845 and 5,837,243). Bispecific antibodies can be
used to target two separate antigens. For example anti-Fc
receptor/anti tumor antigen (i.e., Her-2/neu) bispecific antibodies
have been used to target macrophages to sites of tumor. This
targeting may more effectively activate tumor specific responses.
The T cell arm of these responses would by augmented by the use of
CTLA-4 blockade. Alternatively, antigen may be delivered directly
to DCs by the use of bispecific antibodies which bind to tumor
antigen and a dendritic cell specific cell surface marker.
[0243] Tumors evade host immune surveillance by a large variety of
mechanisms. Many of these mechanisms may be overcome by the
inactivation of proteins which are expressed by the tumors and
which are immunosuppressive. These include among others Tgf.beta.
(Kehrl, J. et al. (1986) J. Exp. Med. 163: 1037-1050), IL-10
(Howard, M. & O'Garra, A. (1992) Immunology Today 13: 198-200),
and Fas ligand (Hahne, M. et al. (1996) Science 274: 1363-1365).
Antibodies to each of these entities may be used in combination
with anti-CTLA-4 to counteract the effects of the immunosuppressive
agent and favor tumor immune responses by the host.
[0244] Other antibodies which may be used to activate host immune
responsiveness can be used in combination with anti-CTLA-4. These
include molecules on the surface of dendritic cells which activate
DC function and antigen presentation. Anti-CD40 antibodies are able
to substitute effectively for T cell helper activity (Ridge, J. et
al. (1998) Nature 393: 474-478). and can be used in conjuction with
CTLA-4 antibodies (Ito, N. et al. (2000) Immunobiology 201 (5)
527-40). Activating antibodies to T cell costimulatory molecules
such as OX-40 (Weinberg, A. et al. (2000) J Immunol 164:
2160-2169), 4-1BB (Melero, I. et al. (1997) Nature Medicine 3:
682-685 (1997), and ICOS (Hutloff, A. et al. (1999) Nature 397:
262-266) may also provide for increased levels of T cell
activation.
[0245] Bone marrow transplantation is currently being used to treat
a variety of tumors of hematopoietic origin. While graft versus
host disease is a consequence of this treatment, therapeutic
benefit may be obtained from graft vs. tumor responses. CTLA-4
blockade can be used to increase the effectiveness of the donor
engrafted tumor specific T cells (Blazar, B. et al. (1999)J Immunol
162: 6368-6377).
[0246] There are also several experimental treatment protocols that
involve ex vivo activation and expansion of antigen specific T
cells and adoptive transfer of these cells into recipients in order
to antigen-specific T cells against tumor (Greenberg, R. &
Riddell, S. (1999) 285: 546-51). These methods may also be used to
activate T cell responses to infectious agents such as CMV (see
below). Ex vivo activation in the presence of anti-CTLA-4
antibodies may be expected to increase the frequency and activity
of the adoptively transferred T cells.
[0247] b. Infectious Diseases
[0248] Other methods of the invention are used to treat patients
that have been exposed to particular toxins or pathogens. Similar
to its application to tumors as discussed above, antibody mediated
CTLA-4 blockade can be used alone, or as an adjuvant, in
combination with vaccines, to stimulate the immune response to
pathogens, toxins, and self-antigens. CTLA-4 blockade has been
shown to be effective in the acute phase of infections of
Nippostrongylus brasiliensis (McCoy, K. et al. (1997) 186(2);
183-187) and Leishmania donovani (Murphy, M. et al. (1998) J.
Immunol. 161:4153-4160). Examples of pathogens for which this
therapeutic approach may be particularly useful, include pathogens
for which there is currently no effective vaccine, or pathogens for
which conventional vaccines are less than completely effective.
These include, but are not limited to HIV, Hepatitis (A, B, &
C), Influenza, Herpes, Giardia, Malaria, Leishmania, Staphylococcus
Aureus, Pseudomonas aeruginosa. CTLA-4 blockade is particularly
useful against established infections by agents such as HIV that
present altered antigens over the course of the infections. These
novel epitopes are recognized as foreign at the time of anti-human
CTLA-4 administration, thus provoking a strong T cell response that
is not dampened by negative signals through CTLA-4.
[0249] Some examples of pathogenic viruses causing infections
treatable by methods of the invention include hepatitis (A, B, or
C), herpes virus (e.g., VZV, HSV-1, HAV-6, HSV-II, and CMV, Epstein
Barr virus), adenovirus, influenza virus, flaviviruses, echovirus,
rhinovirus, coxsackie virus, cornovirus, respiratory syncytial
virus, mumps virus, rotavirus, measles virus, rubella virus,
parvovirus, vaccinia virus, HTLV virus, dengue virus,
papillomavirus, molluscum virus, poliovirus, rabies virus, JC virus
and arboviral encephalitis virus.
[0250] Some examples of pathogenic bacteria causing infections
treatable by methods of the invention include chlamydia,
rickettsial bacteria, mycobacteria, staphylococci, streptococci,
pneumonococci, meningococci and conococci, klebsiella, proteus,
serratia, pseudomonas, legionella, diphtheria, salmonella, bacilli,
cholera, tetanus, botulism, anthrax, plague, leptospirosis, and
Lymes disease bacteria.
[0251] Some examples of pathogenic fungi causing infections
treatable by methods of the invention include Candida (albicans,
krusei, glabrata, tropicalis, etc.), Cryptococcus neoformans,
Aspergillus (fumigatus, niger, etc.), Genus Mucorales (Mucor,
Absidia, Rhizophus), Sporothrix schenkii, Blastomyces dermatitides,
Paracoccidioides brasiliensis, Coccidioides immitis and Histoplasma
capsulatum.
[0252] Some examples of pathogenic parasites causing infections
treatable by methods of the invention include Entamoeba
histolytica, Balantidium coli, Naegleria fowleri, Acanthamoeba sp.,
Giardia lambia, Cryptosporidium sp., Pneumocystis carinii,
Plasmodium vivax, Babesia micron, Trypanosoma brucei, Trypanosoma
cruzi, Leishmania donovani, Toxoplasma gondi, Nippostrongylus
brasiliensis.
[0253] In all of the above methods, a CTLA-4 blockade can be
combined with other forms of immunotherapy such as cytokine
treatment (e.g. interferons, GM-CSF, GCSF, IL-2), or bispecific
antibody therapy, which provides for enhanced presentation of tumor
antigens (see, e.g., Holliger (1993) Proc. Natl. Acad. Sci. USA
90:6444-6448; Poljak (1994) Structure 2:1121-1123).
[0254] c. Promoting Beneficial "Autoimmune" Reactions for the
Treatment of Disease and Therapeutic Intervention.
[0255] The ability of anti-CTLA-4 antibodies to provoke and amplify
autoimmune responses has been documented in a number of
experimental systems (EAE--Experimental Autoimmune
Encephalomyelitis, a murine model for MS (Perrin, P. et al. (1996)J
Immunol 157 (4): 1333-1336); diabetes (Luhder, F. et al. (1998)
supra). Indeed, induction of anti-tumor responses using tumor cell
and peptide vaccines reveals that many anti-tumor responses involve
anti-self reactivities (depigmentation observed in anti-CTLA-4+
GM-CSF modified B16 melanoma in van Elsas et al. supra;
depigmentation in Trp-2 vaccinated mice (Overwijk, W. et al. (1999)
Proc. Natl. Acad. Sci. U.S.A. 96: 2982-2987); autoimmune
prostatitis evoked by TRAMP tumor cell vaccines (Hurwitz, A. (2000)
supra), melanoma peptide antigen vaccination and vitilago observed
in human clinical trials (Rosenberg, S A and White, D E (1996) J
Immunother Emphasis Tumor Immunol 19 (1): 81-4).
[0256] Therefore, it is possible to consider using anti-CTLA-4
blockade in conjunction with various self proteins in order to
devise vaccination protocols to efficiently generate immune
responses against these self proteins for disease treatment. For
example, Alzheimers disease involves inappropriate accumulation of
AP peptide in amyloid deposits in the brain; antibody responses
against amyloid are able to clear these amyloid deposits (Schenk et
al., (1999) Nature 400: 173-177).
[0257] Other self proteins may also be used as targets such as IgE
for the treatment of allergy and asthma, and TNF for rhematoid
arthritis. Finally, antibody responses to various hormones may be
induced by the use of anti-CTLA-4 antibody. Neutralizing antibody
responses to reproductive hormones may be used for contraception.
Neutralizing antibody response to hormones and other soluble
factors that are required for the growth of particular tumors may
also be considered as possible vaccination targets.
[0258] Analogous methods as described above for the use of
anti-CTLA-4 antibody can be used for induction of therapeutic
autoimmune responses to treat patients having an inappropriate
accumulation of other self-antigens, such as amyloid deposits,
including A.beta. in Alzheimer's disease, cytokines such as
TNF.alpha., and IgE.
[0259] 2. Inactivating Immune Responses
[0260] Disorders caused by immune responses are called
hypersensitivity disease. Diseases caused by failure of
self-tolerance and subsequent immune responses against self, or
autologous, antigens are called autoimmune diseases.
Hypersensitivity diseases can also result from uncontrolled or
excessive responses against foreign antigens, such as microbes.
[0261] Although soluble antibodies to human CTLA-4 have been shown
to promote the expansion and activation of T cells (i.e., where
CTLA-4 function (e.g., binding to ligand) is inhibited; in this
scenario the antibodies are antagonists to CTLA-4 function),
increasing the valency of these same antibodies produces the
opposite effect (where now, in contrast, the antibodies are acting
as agonists of CTLA-4 to suppress the immune response) (see, e.g.,
Krummel and Allison, 1996, J. Exp. Med. 183, 2533-2540). For the
purposes of inactivating antigen specific T cell responses, such as
those that are the targets of pathogenic autoreactive T cells, the
target antigen which is specific for these T cells (ie. antigen
and/or MHC/antigen complexes) must be administered with the
polyvalent form of anti-CTLA-4 antibody.
[0262] a. Inflammation
[0263] Inflammation represents the consequence of capillary
dilation with accumulation of fluid and migration of phagocytic
leukocytes, such as granulocytes and monocytes. Inflammation is
important in defending a host against a variety of infections but
can also have undesirable consequences in inflammatory disorders,
such as anaphylactic shock, arthritis, gout and
ischemia-reperfusion. Activated T-cells have an important
modulatory role in inflammation, releasing interferon .gamma. and
colony stimulating factors that in turn activate phagocytic
leukocytes. The activated phagocytic leukocytes are induced to
express a number of specific cells surface molecules termed homing
receptors, which serve to attach the phagocytes to target
endothelial cells. Inflammatory responses can be reduced or
eliminated by treatment with the therapeutic agents of the present
invention. For example, polyvalent preparations of antibodies
against CTLA-4 block activation of activated T-cells, thereby
preventing these cells from releasing molecules required for
activation of phagocytic cell types
[0264] b. Autoimmune Diseases
[0265] A further situation in which immune suppression is desirable
is in treatment of autoimmune diseases such as insulin-dependent
diabetes mellitus, multiple sclerosis, stiff man syndrome,
rheumatoid arthritis, myasthenia gravis and lupus erythematosus. In
these diseases, the body develops a cellular and/or humoral immune
response against one of its own antigens leading to destruction of
that antigen, and potentially crippling and/or fatal consequences.
Activated T-cells are believed to play a major role in many
autoimmune diseases such as diabetes mellitus. Autoimmune diseases
are treated by administering one of the therapeutic agents of the
invention that inhibits activation of T cells. Optionally, the
autoantigen, or a fragment thereof, against which the autoimmune
disease is targeted can be administered shortly before,
concurrently with, or shortly after the immunosuppressive agent. In
this manner, tolerance can be induced to the autoantigen under
cover of the suppressive treatment, thereby obviating the need for
continued immunosuppression. See, e.g., Cobbold et al., WO 90/15152
(1990).
[0266] c. Graft Versus Host Disease
[0267] A related use for the therapeutic agents of the present
invention is in modulating the immune response involved in "graft
versus host" disease (GVHD). GVHD is a potentially fatal disease
that occurs when immunologically competent cells are transferred to
an allogeneic recipient. In this situation, the donor's
immunocompetent cells may attack tissues in the recipient. Tissues
of the skin, gut epithelia and liver are frequent targets and may
be destroyed during the course of GVHD. The disease presents an
especially severe problem when immune tissue is being transplanted,
such as in bone marrow transplantation; but less severe GVHD has
also been reported in other cases as well, including heart and
liver transplants. The therapeutic agents of the present invention
are used to inhibit activation of donor leukocytes, thereby
inhibiting their ability to lyse target cells in the host.
[0268] d. Transplant Rejection
[0269] Over recent years there has been a considerable improvement
in the efficiency of surgical techniques for transplanting tissues
and organs such as skin, kidney, liver, heart, lung, pancreas and
bone marrow. Perhaps the principal outstanding problem is the lack
of satisfactory agents for inducing immune-tolerance in the
recipient to the transplanted allograft or organ. When allogeneic
cells or organs are transplanted into a host (i.e., the donor and
donee are different individual from the same species), the host
immune system is likely to mount an immune response to foreign
antigens in the transplant (host-versus-graft disease) leading to
destruction of the transplanted tissue. CD8.sup.+ cells, CD4.sup.+
cells and monocytes are all involved in the rejection of transplant
tissues. The therapeutic agents of the present invention are useful
to inhibit T-cell mediated alloantigen-induced immune responses in
the donee thereby preventing such cells from participating in the
destruction of the transplanted tissue or organ.
[0270] B. Methods for Detecting/Measuring the Presence of CTLA-4 in
a Sample
[0271] The invention further provides methods for detecting the
presence of human CTLA-4 antigen in a sample, or measuring the
amount of human CTLA-4 antigen, comprising contacting the sample,
and a control sample, with a human monoclonal antibody, or an
antigen binding portion thereof, which specifically binds to human
CTLA-4, under conditions that allow for formation of a complex
between the antibody or portion thereof and human CTLA-4. The
formation of a complex is then detected, wherein a difference
complex formation between the sample compared to the control sample
is indicative the presence of human CTLA-4 antigen in the
sample.
[0272] C. Kits
[0273] Also within the scope of the invention are kits comprising
the compositions (e.g., human sequence antibodies, human
antibodies, multispecific and bispecific molecules) of the
invention and instructions for use. The kit can further contain a
least one additional reagent, or one or more additional human
antibodies of the invention (e.g., a human antibody having a
complementary activity which binds to an epitope in CTLA-4 antigen
distinct from the first human antibody). Kits typically include a
label indicating the intended use of the contents of the kit. The
term label includes any writing, or recorded material supplied on
or with the kit, or which otherwise accompanies the kit.
EXAMPLES
Example 1. Generation of Cmu Targeted Mice
[0274] Construction of a CMD Targeting Vector.
[0275] The plasmid pICEmu contains an EcoRI/XhoI fragment of the
murine Ig heavy chain locus, spanning the mu gene, that was
obtained from a Balb/C genomic lambda phage library (Marcu et al.
Cell 22: 187, 1980). This genomic fragment was subcloned into the
XhorEcoRI sites of the plasmid pICEMI9H (Marsh et al.; Gene 32,
481-485, 1984). The heavy chain sequences included in pICEmu extend
downstream of the EcoRI site located just 3' of the mu intronic
enhancer, to the XhoI site located approximately 1 kb downstream of
the last transmembrane exon of the mu gene; however, much of the mu
switch repeat region has been deleted by passage in E. coli.
[0276] The targeting vector was constructed as follows (see FIG.
1). A 1.3 kb HindIII/SmaI fragment was excised from pICEmu and
subcloned into HindIII/SmaI digested pBluescript (Stratagene, La
Jolla, Calif.). This pICEmu fragment extends from the HindIII site
located approximately 1 kb 5' of Cmu1 to the SmaI site located
within Cmu1. The resulting plasmid was digested with SmaI/SpeI and
the approximately 4 kb SmaI/XbaI fragment from pICEmu, extending
from the Sma I site in Cmu1 3' to the XbaI site located just
downstream of the last Cmu exon, was inserted. The resulting
plasmid, pTAR1, was linearized at the SmaI site, and a neo
expression cassette inserted. This cassette consists of the neo
gene under the transcriptional control of the mouse
phosphoglycerate kinase (pgk) promoter (XbaI/TaqI fragment; Adra et
al. (1987) Gene 60: 65-74) and containing the pgk polyadenylation
site (PvuII/HindIII fragment; Boer et al. (1990) Biochemical
Genetics 28: 299-308). This cassette was obtained from the plasmid
pKJ1 (described by Tybulewicz et al. (1991) Cell 65: 1153-1163)
from which the neo cassette was excised as an EcoRI/HindIII
fragment and subcloned into EcoRI/HindIII digested pGEM-7Zf (+) to
generate pGEM-7 (KJ1). The neo cassette was excised from pGEM-7
(KJ1) by EcoRI/SalI digestion, blunt ended and subcloned into the
SmaI site of the plasmid pTAR1, in the opposite orientation of the
genomic Cmu sequences. The resulting plasmid was linearized with
Not I, and a herpes simplex virus thymidine kinase (tk) cassette
was inserted to allow for enrichment of ES clones bearing
homologous recombinants, as described by Mansour et al. (1988)
Nature 336: 348-352. This cassette consists of the coding sequences
of the tk gene bracketed by the mouse pgk promoter and
polyadenylation site, as described by Tybulewicz et al. (1991) Cell
65: 1153-1163. The resulting CMD targeting vector contains a total
of approximately 5.3 kb of homology to the heavy chain locus and is
designed to generate a mutant mu gene into which has been inserted
a neo expression cassette in the unique SmaI site of the first Cmu
exon. The targeting vector was linearized with PvuI, which cuts
within plasmid sequences, prior to electroporation into ES
cells.
[0277] Generation and Analysis of Targeted ES Cells.
[0278] AB-1 ES cells (McMahon, A. P. and Bradley, A., (1990) Cell
62: 1073-1085) were grown on mitotically inactive SNL76/7 cell
feeder layers (ibid.) essentially as described (Robertson, E. J.
(1987) in Teratocarcinomas and Embryonic Stem Cells: a Practical
Approach (E. J. Robertson, ed.) Oxford: IRL Press, p. 71-112). The
linearized CMD targeting vector was electroporated into AB-1 cells
by the methods described Hasty et al. (Hasty, P. R. et al. (1991)
Nature 350: 243-246). Electroporated cells were plated into 100 mm
dishes at a density of 1-2.times.106 cells/dish. After 24 hours,
G418 (200 micrograms/ml of active component) and FIAU (5.times.10-7
M) were added to the medium, and drug-resistant clones were allowed
to develop over 8-9 days. Clones were picked, trypsinized, divided
into two portions, and further expanded. Half of the cells derived
from each clone were then frozen and the other half analyzed for
homologous recombination between vector and target sequences.
[0279] DNA analysis was carried out by Southern blot hybridization.
DNA was isolated from the clones as described Laird et al. (Laird,
P. W. et al., (1991) Nucleic Acids Res. 19: 4293). Isolated genomic
DNA was digested with SpeI and probed with a 915 bp SacI fragment,
probe A (FIG. 1), which hybridizes to a sequence between the mu
intronic enhancer and the mu switch region. Probe A detects a 9.9
kb SpeI fragment from the wild type locus, and a diagnostic 7.6 kb
band from a mu locus which has homologously recombined with the CMD
targeting vector (the neo expression cassette contains a SpeI
site). Of 1132 G418 and FIAU resistant clones screened by Southern
blot analysis, 3 displayed the 7.6 kb Spe I band indicative of
homologous recombination at the mu locus. These 3 clones were
further digested with the enzymes BglI, BstXI, and EcoRI to verify
that the vector integrated homologously into the mu gene. When
hybridized with probe A, Southern blots of wild type DNA digested
with BglI, BstXI, or EcoRI produce fragments of 15.7, 7.3, and 12.5
kb, respectively, whereas the presence of a targeted mu allele is
indicated by fragments of 7.7, 6.6, and 14.3 kb, respectively. All
3 positive clones detected by the SpeI digest showed the expected
BglI, BstXI, and EcoRI restriction fragments diagnostic of
insertion of the neo cassette into the Cmu1 exon.
[0280] Generation of Mice Bearing the Mutated Mu Gene.
[0281] The three targeted ES clones, designated number 264, 272,
and 408, were thawed and injected into C57BL/6J blastocysts as
described by Bradley (Bradley, A. (1987) in Teratocarcinomas and
Embryonic Stem Cells: a Practical Approach. (E. J. Robertson, ed.)
Oxford: IRL Press, p. 113-151). Injected blastocysts were
transferred into the uteri of pseudopregnant females to generate
chimeric mice representing a mixture of cells derived from the
input ES cells and the host blastocyst. The extent of ES cell
contribution to the chimera can be visually estimated by the amount
of agouti coat coloration, derived from the ES cell line, on the
black C57BL/6J background. Clones 272 and 408 produced only low
percentage chimeras (i.e. low percentage of agouti pigmentation)
but clone 264 produced high percentage male chimeras. These
chimeras were bred with C57BL/6J females and agouti offspring were
generated, indicative of germline transmission of the ES cell
genome. Screening for the targeted mu gene was carried out by
Southern blot analysis of BglI digested DNA from tail biopsies (as
described above for analysis of ES cell DNA). Approximately 50% of
the agouti offspring showed a hybridizing BglI band of 7.7 kb in
addition to the wild type band of 15.7 kb, demonstrating a germline
transmission of the targeted mu gene.
[0282] Analysis of Transgenic Mice for Functional Inactivation of
Mu Gene.
[0283] To determine whether the insertion of the neo cassette into
Cmu1 has inactivated the Ig heavy chain gene, a clone 264 chimera
was bred with a mouse homozygous for the JHD mutation, which
inactivates heavy chain expression as a result of deletion of the
JH gene segments (Chen et al., (1993) Immunol. 5: 647-656). Four
agouti offspring were generated. Serum was obtained from these
animals at the age of 1 month and assayed by ELISA for the presence
of murine IgM. Two of the four offspring were completely lacking
IgM (Table 1). Genotyping of the four animals by Southern blot
analysis of DNA from tail biopsies by BglI digestion and
hybridization with probe A (FIG. 1), and by StuI digestion and
hybridization with a 475 bp EcoRI/StuI fragment (ibid.)
demonstrated that the animals which fail to express serum IgM are
those in which one allele of the heavy chain locus carries the JHD
mutation, the other allele the Cmu1 mutation. Mice heterozygous for
the RID mutation display wild type levels of serum Ig. These data
demonstrate that the Cmu1 mutation inactivates expression of the mu
gene.
TABLE-US-00001 TABLE 1 Table 1. Level of serum IgM, detected by
ELISA, for mice carrying both the CMD and JHD mutations (CMD/JHD),
for mice heterozygous for the JHD mutation (+/JHD), for wild type
(129Sv .times. C57BL/6J)F1 mice (+/+), and for B cell deficient
mice homozygous for the JHD mutation (JHD/JHD). Serum IgM Mouse
(micrograms/ml) Ig H chain genotype 42 <0.002 CMD/JHD 43 196
+/JHD 44 <0.002 CMD/JHD 45 174 +/JHD 129 .times. BL6 F1 153 +/+
JHD <0.002 JHD/JHD
Example 2. Generation of HCo12 Transgenic Mice
The HCo12 Human Heavy Chain Transgene.
[0284] The HCo12 transgene was generated by coinjection of the 80
kb insert of pHC2 (Taylor et al., 1994, Int. Immunol., 6: 579-591)
and the 25 kb insert of pVx6. The plasmid pVx6 was constructed as
described below.
[0285] An 8.5 kb HindIII/SalI DNA fragment, comprising the germline
human VH1-18 (DP-14) gene together with approximately 2.5 kb of 5'
flanking, and 5 kb of 3' flanking genomic sequence was subcloned
into the plasmid vector pSP72 (Promega, Madison, Wis.) to generate
the plasmid p343.7.16. A 7 kb BamHI/HindIII DNA fragment,
comprising the germline human VH5-51 (DP-73) gene together with
approximately 5 kb of 5' flanking and 1 kb of 3' flanking genomic
sequence, was cloned into the pBR322 based plasmid cloning vector
pGP1f (Taylor et al. 1992, Nucleic Acids Res. 20: 6287-6295), to
generate the plasmid p251f. A new cloning vector derived from
pGP1f, pGP1k (Seq. ID #1), was digested with EcoRV/BamHI, and
ligated to a 10 kb EcoRV/BamHI DNA fragment, comprising the
germline human VH3-23 (DP47) gene together with approximately 4 kb
of 5' flanking and 5 kb of 3' flanking genomic sequence. The
resulting plasmid, p112.2RR.7, was digested with BamHI/SalI and
ligated with the 7 kb purified BamHI/SalI insert of p251f. The
resulting plasmid, pVx4, was digested with XhoI and ligated with
the 8.5 kb XhoI/SalI insert of p343.7.16. A clone was obtained with
the VH1-18 gene in the same orientation as the other two V genes.
This clone, designated pVx6, was then digested with NotI and the
purified 26 kb insert coinjected--together with the purified 80 kb
NotI insert of pHC2 at a 1:1 molar ratio--into the pronuclei of
one-half day (C57BL/6J.times.DBA/2J)F2 embryos as described by
Hogan et al. (B. Hogan et al., Manipulating the Mouse Embryo, A
Laboratory Manual, 2nd edition, 1994, Cold Spring Harbor Laboratory
Press, Plainview N.Y.). Three independent lines of transgenic mice
comprising sequences from both Vx6 and HC2 were established from
mice that developed from the injected embryos. These lines are
designated (HCo12)14881, (HCo12)15083, and (HCo12)15087. Each of
the three lines were then bred with mice comprising the CMD
mutation described in Example 1, the JKD mutation (Chen et al.
1993, EMBO J. 12: 811-820), and the (KCo5)9272 transgene (Fishwild
et al. 1996, Nature Biotechnology 14: 845-851). The resulting mice
express human heavy and kappa light chain transgenes in a
background homozygous for disruption of the endogenous mouse heavy
and kappa light chain loci.
Example 3. Generation of Human IgG Kappa Anti-Human CTLA-4
Monoclonal Antibodies
[0286] Cell Based Antigen
[0287] A DNA segment encoding a fusion protein comprising sequences
from the human CTLA-4 and the murine CD3zeta genes was constructed
by PCR amplification of cDNA clones together with bridging
synthetic oligonucleotides. The encoded fusion protein contains the
following sequences: i. human CTLA-4 encoding amino acids 1-190
(containing the signal peptide, the extracellular domain of human
CTLA-4 and the entirety of the presumed transmembrane sequence of
human CTLA-4) and ii. murine CD3zeta from amino acid 52 to the
carboxy terminus (Weissman et al. (1988) Science 239: 1018-1021).
The amplified PCR product was cloned into a plasmid vector and the
DNA sequence was determined. The cloned insert was then subcloned
into the vector pBABE (which contains a gene encoding for puromycin
resistance (Morganstern, J P and Land, H Nucl. Acids Res. 18:
3587-96 (1990)) to create pBABE-huCTLA-4/CD3z. pBABE-huCTLA-4/CD3z
was transfected into the retroviral packaging line, .psi.-2, and a
pool of puromycin resistant cells were selected. These cells were
co-cultured with the murine T cell hybridoma BW5147 (ATCC #TIB-47).
After 2 days of co-culture the non-adherent BW5147 cells were
removed and selected for resistance to puromycin. The puromycin
resistant cell pool was subcloned by limiting dilution and tested
for surface expression of human CTLA-4 by FACS. A clone expressing
high levels of human CTLA-4 at the cell surface was selected.
[0288] Soluble Antigen
[0289] Recombinant CTLA-4 fusion protein comprising the
extracellular domain of human CTLA-4 was purchased from R&D
Systems (Cat. #325-CT-200). Extracellular CTLA-4 fragment was
prepared by proteolytic cleavage of the CTLA-4 fusion protein at a
Factor Xa protease cleavage site located after the C-terminus of
the CTLA-4 extracellular domain. Fusion protein was treated with
Factor Xa at a ratio of 50:1 of fusion protein to Factor Xa, and
the CTLA-4 fragment was isolated by passage over protein
G-Sepharose and Mono Q HPLC. Fractions were tested for the presence
of human CTLA-4 dimer were by SDS-PAGE and by binding to cells
expressing mouse B7 molecules (LtkmB7.1: mouse Ltk(-) cells
transfected with a mouse B7.1 cDNA clone expression vector).
Positive fractions were pooled and dialyzed into PBS buffer.
[0290] Transgenic Mice
[0291] Two different strains of mice were used to generate CTLA-4
reactive monoclonal antibodies. Strain ((CMD)++; (JKD)++;
(HCo7)11952+/++; (KCoS)9272+/++), and strain ((CMD)++; (JKD)++;
(HCo12)15087+/++; (KCoS)9272+/++). Each of these strains are
homozygous for disruptions of the endogenous heavy chain (CMD) and
kappa light chain (JKD) loci. Both strains also comprise a human
kappa light chain transgene (KCoS), with individual animals either
hemizygous or homozygous for insertion #11952. The two strains
differ in the human heavy chain transgene used. Mice were
hemizygous or homozygous for either the HCo7 or the HCo12
transgene. The CMD mutation is described above in Example 1. The
generation of (HCo12)15087 mice is described in Example 2. The JKD
mutation (Chen et al. 1993, EMBO 1 12: 811-820) and the (KCoS)9272
(Fishwild et al. 1996, Nature Biotechnology 14: 845-851) and
(HCo7)11952 mice, are described in U.S. Pat. No. 5,770,429 (Lonberg
& Kay, 6/23/98).
[0292] Immunization
[0293] Transgenic mice were initially immunized i.p. with
1-3.times.10.sup.7 cells in PBS, or with 10-50 ug soluble fusion
protein in adjuvant (either complete Freund's or Ribi). Immunized
mice were subsequently boosted every 2 to 4 weeks i.p. with
1-3.times.10.sup.7 cells in PBS. Animals were kept on protocol for
2 to 5 months. Prior to fusion, animals were boosted i.v. on days
-3 and -2 with approximately 10.sup.6 cells, or with 10-20 ug
soluble antigen (fusion protein or fusion protein and extracellular
fragment). Some animals also received fusion protein i.v. on day
-4. Successful fusions resulting in CTLA-4 reactive IgG kappa
monoclonal antibodies were obtained from mice immunized by a
variety of different protocols, including cells only, soluble
antigen only, and cell immunizations followed by soluble antigen
given i.v. prior to fusion.
[0294] Fusions
[0295] Spleen cells were fused to mouse myeloma cells (line P3 X63
Ag8.6.53, ATCC CRL 1580, or SP2/0-Ag14, ATCC CRL 1581) by standard
procedures (Harlow and Lane, 1988, Antibodies, A Laboratory Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor N.Y.;
Kennett et al. 1980, Monoclonal Antibodies, Hybridomas: A New
Dimension in Biological Analysis. Plenum, New York; Oi and
Hertzenberg, 1980, Immunoglobulin Producing Hybrid Cell Lines, in
Selected Methods In Cellular Immunology, ed. Mishell and Shiigi,
pp. 357-372. Freeman, San Francisco; Halk, 1984, Methods in
Enzymology: Plant Molecular Biology, ed. Weissbach and Weissbach,
pp. 766-780, Academic Press, Orlando, Fla.). Cells were cultured in
DMEM, 10% FBS, OPI (Sigma 0-5003), BME (Gibco 21985-023), 3% Origen
Hybridoma Cloning Factor (Igen IG50-0615), and 5% P388d1 (ATCC TIB
63) conditioned media. HAT or HT supplement was added to the medium
during initial growth and selection.
[0296] Hybridoma Screening
[0297] To identify hybridomas secreting human IgG kappa antibodies,
ELISA plates (Nunc MaxiSorp) were coated overnight at 4.degree. C.
with 100 ul/well goat anti-human Fcgamma specific antibody (Jackson
Immuno Research #109-006-098) at 1 ug/ml in PBS. Plates were washed
and blocked with 100 ul/well PBS-Tween containing 1% BSA. Fifty ul
cell culture supernatant was added followed by a 1-2 hour
incubation. Plates were washed and then incubated for one hour with
100 ul/well goat anti-Kappa light chain conjugated to alkaline
phosphatase or horseradish peroxidase (Sigma #A-3813, or #A-7164).
Plates were washed three times in PBS-Tween between each step. An
analogous assay was used to identify hybridomas that secrete human
antibodies reactive with human CTLA-4. This assay was identical
except that the ELISA plates were coated with recombinant CTLA-4
fusion protein instead of goat anti-human Fcgamma antibody.
[0298] Characterization of Monoclonal Antibodies
[0299] Seventy two hybridomas that were shown by ELISA to secrete
human IgG kappa binding to human CTLA-4 were subcloned. Forty seven
of these subclones were tested to determine if the secreted human
antibodies bind to CTLA-4 expressing cells, and if the antibodies
inhibit soluble CTLA-4 from binding to cells expressing B7. Binding
was determined by flow cytometry. To measure inhibition, 50
microliters of each supernatant was incubated with 10.sup.5
LtkmB7.1 cells and 25 ng recombinant CTLA-4 fusion protein. Mean
channel fluorescence was then determined by flow cytometry. FIG. 2
shows inhibition of soluble CTLA-4 binding to cells expressing
B7.1. Mean channel fluorescence (MCF) of LtkmB7.1 cells stained
with recombinant human CTLA-4 fusion protein was determined in the
presence of hybridoma supernatant. Hybridomas that secrete blocking
antibodies resulted in lower MCF values. BNI3.1 (Cat.#34580D,
Pharmingen, San Diego, Calif.) was used as a positive control mouse
monoclonal antibody that blocks CTLA-4/B7 binding.
[0300] Approximately 40% of the hybridomas appear to strongly
inhibit CTLA-4 binding to the B7 ligand.
[0301] Antibodies from clones 10D1.3, 4B6.12, and 11E8, were then
assayed by BIAcore (Biacore AB, Uppsala, Sweden) to determine
binding kinetics. Purified recombinant CTLA-4 extracellular
fragment was coupled to the CMS sensor chip @ 1200 RU. Binding was
measured by adding antibody at concentrations of 0.25, 0.5, 1, 2.5,
and 5 ug/ml at a flow rate of 5 ul/min. The binding curves were fit
to a Langmuir binding model using BIAevaluation software (Biacore
AB, Uppsala, Sweden). Antibodies were purified by protein--A
Sepharose chromatography. Determined on and off rates are shown in
Table 2:
TABLE-US-00002 TABLE 2 Table 2. Kinetics of binding of human IgG
kappa antibodies to recombinant CTLA-4 immobilized on a surface.
Hybridoma ka (1/Ms) kd (1/s) Ka (1/M) 10D1.3 4.1 .times. 10.sup.5
1.0 .times. 10.sup.-4 4 .times. 10.sup.9 4B6.12 5.1 .times.
10.sup.5 1.3 .times. 10.sup.-4 4 .times. 10.sup.9 11E8 4.3 .times.
10.sup.5 1.8 .times. 10.sup.-4 2 .times. 10.sup.9
[0302] Serial dilutions of 10 different human IgG kappa anti-human
CTLA-4 monoclonal antibodies (3A4, 9A5, 2E2, 2E7, 4B6, 4E10, 5C4,
5G1, 11E8, and 11G1) were added to microtiter wells coated with
recombinant CTLA-4 fusion protein. After a 2 hour incubation,
biotinylated antibody 11E8 was added to each well at a
concentration of 0.1 ug/ml. The samples were incubated for 30
minutes, washed, and bound antibody detected with alkaline
phosphatase/streptavidin conjugate. The titrations are shown in
FIG. 3. Antibody 11E8 binding was blocked by itself and 7 of the
other human antibodies. However, binding was not blocked by
antibodies 3A4 or 9A5. Reciprocal binding experiments showed that
11E8 binding did not block either 3A4 or 9A5 binding to CTLA-4.
[0303] DNA Sequence
[0304] RNA was extracted from approximately 2.times.10.sup.6 cells
of each subcloned hybridoma cell line and used to synthesize cDNA
using reagents and protocols from Invitrogen (Micro-FastTrack and
cDNA Cycle: Cat. #L1310-01, and #K1520-02, Invitrogen, Carlsbad,
Calif.). Human immunoglobulin heavy and kappa light chain V region
fragments were amplified by PCR using pfu polymerase (Stratagene,
La Jolla, Calif.), degenerate FR1 primers and unique constant
region primers. The resulting PCR fragments were cloned into the
pCR-Blunt vector (Invitrogen, Carlsbad, Calif.) and the sequence of
the insert determined. The preliminary sequences for the heavy and
light chain fragment of hybridoma 10D1.3 are shown in FIG. 4. The
determined sequences for the heavy and light chain fragment of
hybridoma 10D1.3 are shown in FIG. 5 through FIG. 8.
TABLE-US-00003 TABLE 3 CDR sequences of light and heavy chains for
MAbs 10D1, 4B6, and 1E2. SEQ ID SEQ ID SEQ ID Chain HuMAb CDR1 NO:
CDR2 NO: CDR3 NO: Light 10D1 RASQSVGSSYLA 24 GAFSRAT 29 QQYGSSPWT
35 Chain 4B6 RASQSVSSSFLA 25 GASSRAT 30 QQYGSSPWT 35 1E2
RASQGISSWLA 26 AASSLQS 31 QQYNSYPPT 36 Heavy 10D1 SYTMH 27
FISYDGNNKYYADSVKG 32 TGWLGPFDY 37 Chain 4B6 SYTMH 27
FISYDGSNKHYADSVKG 33 TGWLGPFDY 37 1E2 SYGMH 28 VIWYDGSNKYYADSVKG 34
APNYIGAFDV 38
Example 4. Use of Partial Antibody Sequences to Express Intact
Antibodies
[0305] Antibodies interact with target antigens predominantly
through amino acid residues that are located in the six heavy and
light chain complimentarily determining regions (CDR's). For this
reason, the amino acid sequences within CDR's are more diverse
between individual antibodies than sequences outside of CDR's.
Because CDR sequences are responsible for most antibody-antigen
interactions, it is possible to express recombinant antibodies that
mimic the properties of specific naturally occurring antibodies by
constructing expression vectors that include CDR sequences from the
specific naturally occurring antibody grafted onto framework
sequences from a different antibody with different properties
(Jones et al. 1986, Nature 321, 522-525). Such framework sequences
can be obtained from public DNA databases that include germline
antibody gene sequences. These germline sequences will differ from
mature antibody gene sequences because they will not include
completely assembled variable genes, which are formed by V(D)J
joining during B cell maturation. Germline gene sequences will also
differ from the sequence of a high affinity secondary repertoire
antibody at individual nucleotides because of somatic mutations.
However, somatic mutations are not distributed evenly across the
variable region. For example, somatic mutations are relatively
infrequent in the amino-terminal portion of framework region 1 and
in the carboxy-terminal portion of framework region 4. Furthermore,
many somatic mutations do not significantly alter the binding
properties of the antibody. For this reason, it is not necessary to
obtain the entire DNA sequence of a particular antibody in order to
recreate an intact recombinant antibody having binding properties
similar to those of the original antibody (see PCT/US99/05535 filed
on Mar. 12, 1999, which is herein incorporated by reference for all
purposes). Partial heavy and light chain sequence spanning the CDR
regions is typically sufficient for this purpose. The partial
sequence is used to determine which germline variable and joining
gene segments contributed to the recombined antibody variable
genes. The germline sequence is then used to fill in missing
portions of the variable region. Heavy and light chain leader
sequences are cleaved during protein maturation and do not
contribute to the properties of the final antibody. For this reason
it is not necessary to use the corresponding germline leader
sequence for expression constructs. To add missing sequences,
cloned cDNA sequences can be combined with synthetic
oligonucleotides by ligation or PCR amplification. Alternatively,
the entire variable region can be synthesized as a set of short,
overlapping, oligonucleotides and combined by PCR amplification to
create an entirely synthetic variable region clone. This process
has certain advantages such as elimination or inclusion of
particular restriction sites, or optimization of particular
codons.
[0306] The nucleotide sequences of heavy and light chain
transcripts from a hybridomas are used to design an overlapping set
of synthetic oligonucleotides to create synthetic V sequences with
identical amino acid coding capacities as the natural sequences.
The synthetic heavy and kappa light chain sequences can differ from
the natural sequences in three ways: strings of repeated nucleotide
bases are interrupted to facilitate oligonucleotide synthesis and
PCR amplification; optimal translation initiation sites are
incorporated according to Kozak's rules (Kozak, 1991, J. Biol.
Chem. 266, 19867-19870); and, HindIII sites are engineered upstream
of the translation initiation sites.
[0307] For both the heavy and light chain variable regions, the
optimized coding, and corresponding non-coding, strand sequences
are broken down into 30-50 nucleotide segments such that the breaks
between nucleotides for the coding strand sequence occur at
approximately the midpoint of the corresponding non-coding
oligonucleotide. Thus, for each chain, the oligonucleotides can be
assemble into overlapping double stranded sets that completely span
the desired sequence. These oligonucleotides are combined into
pools that span segments of 150-400 nucleotides. The pools are then
used as templates to produce PCR amplification products of 150-400
nucleotides. Typically, a single variable region oligonucleotide
set will be broken down into two pools which are separately
amplified to generate two overlapping PCR products. These
overlapping products are then combined by PCR amplification to form
the complete variable region. It may also be desirable to include
an overlapping fragment of the heavy or light chain constant region
(including the BbsI site of the kappa light chain, or the AgeI site
if the gamma heavy chain) in the PCR amplification to generate
fragments that can easily be cloned into the expression vector
constructs.
[0308] The reconstructed heavy and light chain variable regions are
then combined with cloned promoter, translation initiation,
constant region, 3' untranslated, polyadenylation, and
transcription termination, sequences to form expression vector
constructs. The heavy and light chain expression constructs can be
combined into a single vector, co-transfected, serially
transfected, or separately transfected into host cells which are
then fused to form a host cell expressing both chains.
[0309] Plasmids for use in construction of expression vectors for
human IgGk are described below. The plasmids were constructed so
that PCR amplified V heavy and V kappa light chain cDNA sequences
could be used to reconstruct complete heavy and light chain
minigenes. These plasmids can be used to express completely human,
or chimeric IgG1k or IgG4k antibodies. Similar plasmids can be
constructed for expression of other heavy chain isotypes, or for
expression of antibodies comprising lambda light chains.
[0310] The kappa light chain plasmid, pCK7-96 (SEQ ID NO:39),
includes the kappa constant region and polyadenylation site, such
that kappa sequences amplified with 5' primers that include HindIII
sites upstream of the initiator methionine can be digested with
HindIII and BbsI, and cloned into pCK7-96 digested with HindIII and
BbsI to reconstruct a complete light chain coding sequence together
with a polyadenylation site. This cassette can be isolated as a
HindIII/NotI fragment and ligated to transcription promoter
sequences to create a functional minigene for transfection into
cells.
[0311] The gamma1 heavy chain plasmid, pCG7-96 (SEQ ID NO:40),
includes the human gamma1 constant region and polyadenylation site,
such that gamma sequences amplified with 5' primers that include
HindIII sites upstream of the initiator methionine can be digested
with HindIII and AgeI, and cloned into pCG7-96 digested with
HindIII and AgeI to reconstruct a complete gamma1 heavy chain
coding sequence together with a polyadenylation site. This cassette
can be isolated as a HindIII/SalI fragment and ligated to
transcription promoter sequences to create a functional minigene
for transfection into cells.
[0312] The gamma4 heavy chain plasmid, pG4HE (SEQ ID NO:41),
includes the human gamma4 constant region and polyadenylation site,
such that gamma sequences amplified with 5' primers that include
HindIII sites upstream of the initiator methionine can be digested
with HindIII and AgeI, and cloned into pG4HE digested with HindIII
and AgeI to reconstruct a complete gamma4 heavy chain coding
sequence together with a polyadenylation site. This cassette can be
isolated as a HindIII/EcoRI fragment and ligated to transcription
promoter sequences to create a functional minigene for transfection
into cells.
[0313] A number of different promoters (including but not limited
to CMV, ubiquitin, SRalpha, and beta-actin) can be used to express
the reconstructed heavy and light chain genes. For example the
vector pCDNA3.1+(Invitrogen, Carlsbad, Calif.), can be cleaved with
HindIII and either NotI, XhoI, or EcoRI, for ligation with either
the kappa, gamma1, or gamma4 cassettes described above, to form
expression vectors that can be directly transfected into mammalian
cells.
Example 5. 10D.1 Binding to CTLA-4
[0314] A. 10D1 Binding to Purified Recombinant Human CTLA-4
[0315] Binding of 10D1 to purified recombinant human CTLA-4 was
shown by ELISA using standard methods and procedures (FIG. 9 and
FIG. 10). Microtiter plates coated with purified CTLA-4 were
incubated with varying concentration of 10D1, and then developed
with goat anti-human IgG F(ab').sub.2 conjugated to alkaline
phosphatase. The data demonstrate dose-dependent binding of 10D1
that is well fit to a 4-parameter curve (correlation coefficient is
-1.0). The half-maximal binding at 15 ng/ml reflects the high
binding capacity of 10D1 to CTLA-4. Saturation of binding was
observed at approximately 0.1 .mu.g/ml.
[0316] B. 10D.1 Binding to CTLA-4 Expressed on the Plasma Membrane
of T-Cells
[0317] In order to demonstrate binding of 10D1 to CTLA-4 expressed
on the plasma membrane of T-cells, the results in FIG. 10 from a
flow cytometric assay are shown. The flow cytometric assay was used
with a T-cell line transfected to express high levels of human
CTLA-4 (designated 58.alpha..beta.CTLA-4/CD3zeta cells). Varying
concentrations of fluoresceinated 10D1 (10D1-FITC) were incubated
with 58.alpha..beta.CTLA-4 cells. The cell associated fluorescence
was determined by flow cytometry. As seen with the purified CTLA4,
10D1 bound to CTLA4-expressing cells in a dose-dependent manner
that was well fit to a 4-paramater equation (correlation
coefficient is -0.999). The half-maximal binding was 190 ng/ml, and
saturation was achieved at 2 .mu.g/ml. 10D1 did not bind to any
CTLA4-negative cell lines tested, including SKBR-3, BT474 and
MCF10A breast epithelial tumors and L540 Hodgkin's tumor cells, nor
did it bind to cells expressing murine CTLA-4. These data indicate
the specificity of 10D1 for human CTLA. However, 10D1 was shown to
cross-react with macaque CTLA-4 (see below).
[0318] C. Cross-Reactivity of 10D1 with Normal Human Tissues
[0319] In this study, a fluoresceinated form of the test article
(10D1-FITC) was used to evaluate binding. The objective of the
study was to evaluate potential cross-reactivity of 10D1-FITC with
cryosections of normal human tissues. No unanticipated
cross-reactivity was observed.
[0320] The study was conducted in accordance with the Food and Drug
Administration's Good Laboratory Practice (GLP) Regulations (21 CFR
Part 58). The human tissue panel included all the tissue on the
"suggested list of human tissues to be used for immunohistochemical
investigations of cross reactivity` in Annex II of the EC CPMP
Guideline 111/5271/94, "Production and quality control of
monoclonal antibodies" and all the tissues recommended in the 1997
US FDA/CBER "Points to Consider in the Manufacture and Testing of
Monclonal Antibody Products for Human Use".
[0321] Using an indirect immunoperoxidase method, 10D1-FITC
specifically stained positive control, human CTLA4-expressing,
58.alpha..beta.CTLA4CD3zeta cells as well as positive control
lymphocytes in human tonsil. 10D1-FITC reactivity was moderate to
intense and two concentrations of antibody were examined (10
.mu.g/ml and 2.5 .mu.g/ml). In both positive control
58.alpha..beta.CTLA4CD3zeta and positive control human tonsillar
lymphocytes, 10D1-FITC specifically stained discrete, round,
granules at membrane and in the cytoplasm immediately below the
membrane. Reactivity was observed with occasional follicular,
interfollicular, and subepithelial lymphocytes. Less than 1-2% of
all tonsillar lymphocytes were reactive with 10D1-FITC.
[0322] 10D1-FITC did not react with negative control human brain
(cerebellum). An isotype-matched negative control antibody
(HulgG1-k-FITC) did not specifically bind to either the positive
control human CTLA4-expressing 58.alpha..beta.CTLA4CD3zeta or human
tonsil; nor did it bind specifically to negative control human
brain (cerebellum).
[0323] To determine cross-reactivity, 10D1-FITC was applied to a
panel of normal human tissues at two concentrations (10 .mu.g/ml
and 2.5 .mu.g/ml). Specific 10D1-FITC reactivity was observed for
lymphocytes in the tonsil (3/3 donors), submucosal lymphoid nodule
in the colon (gastrointestinal tract-colon [1/3 donors]), and blood
smears (2/3 donors).
[0324] Immunoreactive cells were identified as lymphocytes based on
typical morphology (round molecular cells with large nucleus:
cytoplasm ratio and scant cytoplasm, lack of dendritic processes,
10-15 .mu.m in diameter) and location within the tissues (e.g.,
typical location within lymphoid tissues). In the tonsils from all
three donors (test tissues), lymphocytes, 10D1-FITC specifically
stained discrete, round, granules at membrane and in the cytoplasm
immediately below the membrane. Reactivity was observed with
occasional follicular, interfollicular and subepithelial
lymphocytes. Less than 1-2% of all tonsillar lymphcytes were
reactive with 10D1-FITC.
[0325] In 1/3 donors examined, 10D1-FITC also specifically stained
discrete granules in occasional follicular and interfollicular
lymphocytes located in submucosal lymphoid nodules in the colon
(gastrointestinal tract-colon [large intestine]). Again, discrete
membrane granules were stained.
[0326] In peripheral blood smears from two of the three donors
examined, 10D1-FITC specifically stained discrete granules
approximately 1 .mu.m in diameter associated with the membrane of
rare lymphocytes. The granules were arranged in a ring or in a
curved pattern. Less than 1-2% of all peripheral blood leukocytes
were reactive with 10D1-FITC.
TABLE-US-00004 TABLE 4 Cross-Reactivity of MAb 10D1 With Normal
Human Tissues Negative Control Test Article Antibody 10D1-FITC
HulgG1-k- 10 2.5 FITC 2.5 Assay .beta..sub.2- Tissue .mu.g/ml
.mu.g/ml 10 .mu.g/ml .mu.g/ml Control * microglobulin Positive
Control 3-4+ 2-4+ Neg Neg Neg Pos 58.alpha..beta.CTLA4CD3zeta cells
Positive Control 2-3+ 2-3+ Neg Neg Neg Pos Lymphocytes in human
tonsil Negative Control Human Neg Neg Neg Neg Neg Pos
brain-cerebellum Adrenal Neg Neg Neg Neg Neg Pos Blood Pos
Neutrophils Neg Neg Neg Neg Neg Pos Lymphocytes 2+ Neg Neg Neg Neg
Pos (rare) Eosinophils Neg Neg Neg Neg Neg Pos Monocytes Neg Neg
Neg Neg Neg Pos Platelets Neg Neg Neg Neg Neg Pos Blood Vessel
(endothelium) Detailed under individual tissues Examined in all
tissues Bone Marrow Neg Neg Neg Neg Neg Pos Brain-Cerebellum Neg
Neg Neg Neg Neg Pos Brain-Cerebrum (cortex) Neg Neg Neg Neg Neg Pos
Breast (mammary gland) Neg Neg Neg Neg Neg Pos Eye Neg Neg Neg Neg
Neg Pos Gastrointestinal Tract-Colon 2-3+ 2-3+ Neg Neg Neg Pos
(large intestine) Submucosal lymphoid nodule (occasional follicular
and interfollicular lymphocytes) Gastrointestinal Tract-Colon Neg
Neg Neg Neg Neg Pos (large intestine) Other elements
Gastrointestinal Tract- Neg Neg Neg Neg Neg Pos Esophagus
Gastrointestinal Tract- Neg Neg Neg Neg Neg Pos Small intestine
Gastrointestinal Neg Neg Neg Neg Neg Pos Tract-Stomach Heart Neg
Neg Neg Neg Neg Pos Kidney (glomerulus, tubule) Neg Neg Neg Neg Neg
Pos Liver Neg Neg Neg Neg Neg Pos Lung Neg Neg Neg Neg Neg Pos
Lymph Node Neg Neg Neg Neg Neg Pos Ovary Neg Neg Neg Neg Neg Pos
Fallopian Tube (oviduct) Neg Neg Neg Neg Neg Pos Pancreas Neg Neg
Neg Neg Neg Pos Parathyroid Neg Neg Neg Neg Neg Pos Peripheral
Nerve Neg Neg Neg Neg Neg Pos Pituitary Neg Neg Neg Neg Neg Pos
Placenta Neg Neg Neg Neg Neg Pos Prostate Neg Neg Neg Neg Neg Pos
Salivary Gland Neg Neg Neg Neg Neg Pos Skin Neg Neg Neg Neg Neg Pos
Spinal Cord Neg Neg Neg Neg Neg Pos Spleen Neg Neg Neg Neg Neg Pos
Striated (Skeletal) Muscle Neg Neg Neg Neg Neg Pos Testis Neg Neg
Neg Neg Neg Pos Thymus Neg Neg Neg Neg Neg Pos Thyroid Neg Neg Neg
Neg Neg Pos Tonsil Lymphocytes 2+ 1-2+ Neg Neg Neg Pos (occasional
follicular, interfollicular and subepithelial lymphocytes) Tonsil
Other elements Neg Neg Neg Neg Neg Pos Ureter Neg Neg Neg Neg Neg
Pos Urinary Bladder Neg Neg Neg Neg Neg Pos Uterus-Body
(endometrium) Neg Neg Neg Neg Neg Pos Uterus-Cervix Neg Neg Neg Neg
Neg Pos * omission of test antibody
[0327] D. Specific Reactivity of 10D.1 with Macaque CTLA-4
[0328] Specific reactivity with macaque CTLA-4 was demonstrated
using T-cells transfected to express the macaque CTLA-4 at high
levels (Table 5). These data suggest that the CTLA-4 epitope for
10D1 is conserved between macaque and humans, therefore macaque is
a good model to evaluate in vivo safety of anti-CTLA4 HuMAb
10D1.
TABLE-US-00005 TABLE 5 reactivity of reactivity of Species isotype
control (MFI) 10D1 (MFI) human CTLA4 3 662 macaque CTLA4 4 606
murine CTLA4 5 5 (negative control)
[0329] MAb 10D1 (10 .mu.g/ml) was incubated with cell lines
expressing recombinant CTLA-4 from various species, and detected by
FITC-anti human IgG. The cell-associated fluorescence was
determined by FACScan and reported as mean fluorescence intensity
(MFI). These data show that MAb 10D1 reacts well with macaque and
human CTLA-4, but not with murine CTLA-4.
Example 6. 10D1 Blocking of CTLA-4 to B7 Ligands
[0330] In order to show that 10D1 binding to CTLA-4 blocks the
interaction of CTLA-4 with CTLA-4 ligands, B7.1 and B7.2,
competition assays were performed by flow cytometry (FIG. 11 and
FIG. 12). As shown in FIG. 11, FITC-labeled human B7.2-Ig fusion
protein was incubated with 58.alpha..beta.CTLA4 T-cells and various
concentrations of 10D1 MAb. In FIG. 12, FITC-labeled CTLA4-Ig
fusion protein was incubated with murine B7.1 transfected cells and
various concentrations of 10D1 MAb.
[0331] The competition assays demonstrate the ability of 10D1 to
efficiently inhibit CTLA4-B7 interactions at low concentrations
(1-10 .mu.g/ml). The effective concentration would likely be much
lower under physiological conditions, which would have far lower
concentrations of CTLA-4 and B7 molecules. Similar data was
obtained using biotinylated reagents in ELISA assays.
[0332] These in vitro studies demonstrate that MAb 10D1 binds human
CTLA-4 with high affinity and specificity and that binding of 10D1
abrogates interaction between B7 co-stimulatory molecules and
CTLA-4. These data for 10D1 are consistent with the in vitro
activity profiles for anti-murine CTLA-4 antibodies that have
demonstrated efficacy in murine tumor models.
Example 7. Epitope Mapping of 10D.1
[0333] Competitive ELISAs were done with biotin labeled and
unlabeled antibodies to determine CTLA-4 epitope specificity. Four
anti-CTLA-4 epitope binding groups were identified among the human
antibodies, and an additional two epitopes were defined by the
commercial murine monclonal antibodies BNI3 (Pharmingen, San Diego,
Ca), and 8H5 (Ancell Corp. Bayport, Mn). FIGS. 3, and 13A-13G show
results of competitive binding assays that demonstrate differential
competition among the antibodies for binding to CTLA-4. These
results are summarized in Table 6.
[0334] Antibodies in anti-CTLA-4 epitope binding groups 4a and 4b
have similar binding characteristics, and additionally are strong
blockers of CTLA-4-Ig binding to cell surface expressed B7.1 (Table
6). For example, FIG. 3 shows results with biotin labeled 11E8
antibody and 10 unlabeled antibodies (3A4, 9A5, 2E2, 2E7, 4B6,
4E10, 5C4, 5G1, 11E8 and 11G1). Antibody 11E8 binding was blocked
by itself and 7 of the other human antibodies in epitope groups 4a
and 4b. However, binding of 11E8 was not blocked by antibodies 3A4
or 9A5(epitope groups 1 and 2). Reciprocal binding experiments
showed that 11E8 binding did not block either 9A5 or 3A4 binding to
CTLA-4 (FIGS. 13A and 13B). Similar results are shown for epitope
group 4a antibodies 10D1 and murine antibody 147 (FIGS. 13D and
13F). Antibodies in epitope group 4b (FIG. 13E) are similar to
group 4a antibodies with the exception that the epitope 4b
antibodies compete with epitope group 2 antibodies in reciprocal
binding experiments (FIG. 13B). Human antibodies that belong to
epitope groups 3, 4a and 4b are effective blockers of CTLA-4/B7.1
binding (FIG. 3, and Table 6).
TABLE-US-00006 TABLE 6 CTLA-4 MABs: Epitope and CTLA-4/B7.1
Blocking Properties Blocks Mono- binding of clonal CTLA-4-Ig to
Epi- Anti- Competition for CTLA-4 B7.1 on Ltk tope body Binding
mB7.1 1 9A5 No competition from groups 3, No 4a, 4b, 5, and 6 Weak
Compe- tition form group 2 2 3A4 One way competition from No groups
1, 4b, 5 and 6 1E2 No competition with 4a. Weak competition form
group 3 3 5A8 Competes with 4a and 4b. Some Yes competition with 2.
No competition form 1 and 5 .sup. 4a 10D1 Cross competes with all
members Yes of 4b. 147* Competition from 6 (non-reciprocal) 11E8 No
competition with 1, 2, and 5. 11G1 Weak competition with 3. 4E10
5C4 3F10 4b 4B6 Cross competes with all members Yes of 4a 4A1
Competes with 2 2E2 Weak competition with 3. 2E7 No competition
with 1, and 5. 2G1 Competition from 6 (non-reciprocal) 5 BNI3**
Competes with 6, no competition Yes with groups 1 to 4 6 8H5***
Competes with 5, no competition Yes with groups 1 to 4 Competition
with group 3 not tested *Murine monoclonal antibody **Available
from Pharmingen, BNI3 Catalog # 34580 D, San Diego CA. ***Available
from Ancell, ANC 152.2/8H5 Catalog # 359-020, Ancell Corp. Bayport,
Mn.
Example 8. 10D1 Binds to Human Activated T Cells
[0335] The ability of 10D1 antibody to bind to CTLA-4 expressed by
normal human T cells was investigated by flow cytometric analysis
of resting and activated T cells (FIG. 14). Freshly isolated human
peripheral blood mononuclear cells at 2.times.10.sup.6/ml were
incubated in the presence or absence of 2 ug/ml of the T-cell
mitogen, phytohemagglutinin (PHA). After four days incubation, the
cells were washed and stained with the following antibodies: 1) no
antibody; 2) HuIgG1-FITC, a human IgG1 anti EGF receptor antibody;
3) 10D1-FITC, human IgG1 antiCTLA-4 antibody; and 4) 147-FITC-mouse
anti-human CTLA-4 antibody. After incubation for 1 hr, cells were
washed and stained with rabbit anti-FITC IgG followed by goat
anti-rabbit-PE. Analysis was performed on lymphocytes gated by
forward versus side scatter. As shown in FIG. 14, resting
lymphocytes do not bind 10D1 antibody, while PHA-activated T cells
express low levels of CTLA-4 at the cell surface
Example 9. 10D1 does not Mediate Complement-Dependent or
Antibody-Dependent Lysis of Activated T-Cells
[0336] The ability of MAb 10D1 to mediate complement-dependent
cellular cytotoxicity (CDCC) or antibody-dependent cellular
cytotoxicity (ADCC) of CTLA-4 expressing cells was
investigated.
[0337] For CDCC experiments, rabbit serum was used as a source of
compliment, in order to provide optimal conditions for CDCC. Rabbit
complement has been shown to be more effective in mediating CDCC
with human IgG.sub.1 than human complement (Jurianz, Maslak et al.
1999). PHA-stimulated T-cells were labeled with .sup.51Cr and
incubated with various concentrations of anti-CTLA4 MAb 10D1 or
anti-CD3 MAb with or without rabbit serum as a source of
complement. After a 1 hour incubation, the .sup.51Cr released by
dying cells was determined using a gamma counter. Target cells
incubated with 2% SDS served as 100% lysis controls. The
anti-CTLA-4 MAb 10D1 did not mediate CDCC of the activated T-cells
(FIG. 15). Under the same conditions, the murine IgG2.sub.a
anti-CD3 MAb led to significant CDCC. Both murine IgG2.sub.a and
human IgG.sub.1 efficiently fix rabbit complement; therefore these
differences most likely reflect the greatly reduced expression of
CTLA-4 as compared to CD3 on activated T-cells.
[0338] Similarly, no ADCC activity was observed for MAb 10D1 using
autologous mononuclear cells as effector cells (FIG. 16).
PHA-stimulated T-cells were labeled with .sup.51Cr and incubated
with various concentrations of anti-CTLA4 MAb 10D1 or anti-CD3 MAb
and fresh autologous mononuclear cells. The effector to target cell
ratio was 100:1. After a 4 hour incubation, the .sup.51Cr released
by dying cells was determined using a gamma counter. Target cells
incubated with 2% SDS served as 100% lysis controls. Although the
anti-CD3 MAb is a murine IgG2a, which can mediate efficient ADCC
with human effector cells, only low levels of ADCC were observed.
These data are consistent with the requirement of high levels of
antigen expression on the surface of target cells for efficient
ADCC. Since MAb 10D1 is a human IgG.sub.1, an isotype generally
capable of mediating CDCC and ADCC, the lack of these activities is
likely due to the very low expression of CTLA-4 on activated
T-cells. Furthermore, the observation of increased numbers of
activated T-cells in the primate toxicology studies (see below) is
consistent with the lack of ADCC and CDCC activity of activated
T-cells by MAb 10D1 in vivo.
Example 10. 10D1 Preclinical Toxicity Studies in Cynomolgus
Monkeys
[0339] Two independent toxicology studies of 10D1 antibody and
macaques were performed. A total of eight monkeys were analyzed.
Four monkeys (two males and two females) tolerated three bolus i.v.
doses of 3 mg/Kg human anti-CTLA4, and four monkeys (two males and
two females) tolerated three bolus i.v. doses of 10 mg/Kg human
anti-CTLA4 without significant clinical, immunotoxicology, or
histopathological findings.
[0340] A. 10D1 Primate Toxicology Study (3.0 mg/Kg)
[0341] To investigate the effects of 10D1 in vivo, a primate
toxicology study was performed with two macaques. In a multiple
dose toxicity study of MAb 10D1, this antibody was administered via
intravenous injection of macaques. The objective of this study was
to determine the tolerability of MAb 10D1 in two monkeys given at a
dose and schedule compatible with efficacious treatment in a murine
tumor regression model and proposed dose in human clinical studies.
Two female cynomolgus monkeys (Macaca fascicilaris) were treated
with three intravenous bolus doses of 3.0 mg/Kg 10D1 on days 1, 4,
and 7 to evaluate safety and T-cell activation in these animals.
The animals were observed for any adverse reactions, weight
loss/gain, and morbidity and mortality up to 14 days post
administration of the first dose. Seven days after the last dose
the animals were sacrificed and necropsied to examine their organs
individually. Blood samples were collected before each dose and
before necropsy for examination of T-cell populations and
expression of activation markers by flow cytometry. Plasma was also
collected from blood samples to determine 10D1 antibody levels and
anti-10D1 antibody responses by ELISA.
[0342] The animals tolerated three doses of antibody 10D1 without
any clinical symptoms during the treatment course. The weight of
these animals did not change significantly. No gross findings were
documented on 47 organs/tissues examined at necropsy for either
animal.
[0343] Histopathology studies were performed at Redfield
laboratories, Redfield, Ark. The results from these studies
indicated that multiple doses of MAb 10D1 did not produce acute
toxicity in any of the organs and tissues examined.
[0344] Pharmacokinetic analysis revealed the presence of
significant levels (up to 97.3 .mu.g/ml) of 10D1 MAb in the plasma
of both monkeys (see Table 7). Plasma levels of 10D1 were
determined by a competition assay with FITC-10D1 using flow
cytometry and 58.alpha..beta.CTLA-4 T-cells.
TABLE-US-00007 TABLE 7 10D1 plasma levels Time point Monkey #1
Monkey #2 Pre-1.sup.st dose 0.0 (.mu.g/ml plasma) 0.0 (.mu.g/ml
plasma) Day 4, pre-2.sup.nd dose 17.4 (.mu.g/ml plasma) 43.6
(.mu.g/ml plasma) Day 7, pre-3.sup.rd dose 83.6 (.mu.g/ml plasma)
97.3 (.mu.g/ml plasma) Day 14 90.2 (.mu.g/ml plasma) 70.9 (.mu.g/ml
plasma)
[0345] Evaluation of the anti-10D1-antibody response was performed
by ELISA. No significant anti-10D1 response was observed in either
animal during the course of study (FIG. 17). Microtiter plates were
coated with 10D1 MAb (for IgM assay) or 10D1 F(ab').sub.2 (for IgG
assay). Dilutions of plasma samples from various time points were
incubated with the plates, and anti-10D1 antibodies were detected
with either anti-IgM or IgG Fc-specific alkaline phosphatase
reagents. IgM anti-10D1 antibodies appear to have developed by day
14, however, the titers are very low. IgM anti-10D1 ant5ibodies
appear to have developed by day 14, however, the titers are very
low. These data demonstrate that the monkeys did not develop
anti-10D1 antibody responses after 3 doses of the antibody.
[0346] These data demonstrate that the animals did not develop a
significant antibody response against MAb 10D1 during the course of
this study.
[0347] Immunotoxicology was investigated by flow cytometric
analysis of lymphocyte populations during the course of the study.
The lymphocyte subsets examined included CD3 as a marker for total
T-cells and CD20 as a marker for total B-cells. T-cells, were
further subdivided for expression of CD4 (helper T-cell marker) and
CD8 (cytotoxic T-cell marker), as well as for activtion markers
CD25, CD29, CD69 and HLA-DR. No remarkable changes in T-cell
populations or expression of activation markers was noted. The
results are summarized in Table 8 below.
TABLE-US-00008 TABLE 8 Flow cytometric analysis of lymphocyte
populations Time point Monkey #1 Monkey #2 Pre-1.sup.st dose % CD3
= 61, % CD20 = 16 % CD3 = 54, % CD20 = 22 % CD4 = 43, % CD8 = 50 %
CD4 = 59, % CD8 = 36 % CD25 .ltoreq. 1, % CD29 = 41 % CD25 .ltoreq.
1, % CD29 = 29 % CD69 =< 1, % HLA-DR = 4 % CD69 .ltoreq. 1, %
HLA-DR = 1 Day 4, pre-2.sup.nd dose % CD3 = 58, % CD20 = 13 % CD3 =
56, % CD20 = 16 % CD4 = 38, % CD8 = 52 % CD4 = 62, % CD8 = 37 %
CD25 .ltoreq. 1, % CD29 = 52 % CD25 .ltoreq. 1, % CD29 = 36 % CD69
.ltoreq. 1, % HLA-DR = 2 % CD69 .ltoreq. 1, % HLA-DR .ltoreq. 1 Day
7, pre-3.sup.rd dose % CD3 = 59, % CD20 = 15 % CD3 = 51, % CD20 =
17 % CD4 = 47, % CD8 = 59 % CD4 = 51, % CD8 = 39 % CD25 = 2, % CD29
= 44 % CD25 = 1, % CD29 = 39 % CD69 = 1, % HLA-DR = 4 % CD69 = 1, %
HLA-DR = 2 Day 14 % CD3= 64, % CD20 = 14 % CD3 = 59, % CD20 = 20 %
CD4 = 49, % CD8 = 44 % CD4 = 60, % CD8 = 35 % CD25 = 1, % CD29 = 44
% CD25 .ltoreq. 1, % CD29 = 34 % CD69 .ltoreq. 1, % HLA-DR = 15 %
CD69 .ltoreq. 1, % HLA-DR = 1
[0348] Heparinized blood samples were analyzed fresh by flow
cytometry using FITC- or PE-labeled anti-lymphocyte reagents. % CD3
and % CD20 are based on a lymphocyte gate. The additional T-cell
markers and activation markers are all based on CD3-positive cells.
These data indicate that multiple doses of MAb 10D1 does not have a
significant effect on B and T-cell populations or T-cell activation
markers.
[0349] B. 10D1 Primate Toxicology Study (3.0 and 10.0 mg/Kg)
[0350] Six cynomolgus monkeys (four males and two females),
experimentally non-naive and weighing 2.4 to 3.8 kg at the outset
of the study, were assigned to treatment groups as shown in Table 9
below.
TABLE-US-00009 TABLE 9 Number of Dose Level Dose Vol. Dose Solution
Group No. Males/Females (mg/kg) (ml/kg) Conc. mg/ml) 1 2/0 3 0.6
5.0 2 2/2 10 2.0 5.0
[0351] Each animal received a dose of human anti-CTLA4 (5 mg/ml
concentration) by intravenous injection (i.e., "slow-push" bolus
injection) every three days for one week (i.e., on Days 1, 4 and
7). Detailed clinical observations were conducted at least twice
daily ("cageside observations"), and a thorough physical
examination was performed on each animal prior to the study and on
Day 12. Body weights were measured weekly (prestudy and Days 7 and
14), and ophthalmoscopic examination was conducted on all animals
prior to the study and on Day 12. Blood samples for evaluation of
serum chemistry, hematology and coagulation parameters were
collected from all animals prestudy and on Day 14. Additional
samples for selected hematology parameters (total and differential
white blood cells only) were collected prior to dosing on each
dosing day (Days 1, 4, and 7). Urine samples for standard
urinalysis were obtained by drainage from specially designed
cage-pans prior to dosing and on Day 13. Blood samples were also
collected prior to each dose (Days 1, 4 and 7) and prior to
termination (Day 14) for various analyses conducted by Medarex.
These included analysis of test article concentration
(pharmacokinetics), determination of the presence of antibodies to
the test article, and flow cytometry analysis. All animals were
euthanized on Day 14, at which time, a complete gross necropsy was
conducted, major organs were weighed, and a standard complete set
of tissues was collected from each animal and processed for
examination by light microscopy.
[0352] Intravenous administration of human anti-CTLA4 at dose
levels of 3 mg/kg and 10 mg/kg given every three days for a total
of three doses was very well tolerated by cynomolgus monkeys. There
were no clinical signs of toxicity from the cageside observations
and physical examinations, and no effects on body weight, ocular
examination findings, clinical pathology parameters, gross necropsy
findings, organ weights or tissue histomorphology.
[0353] The results of the analysis of test article concentration in
serum samples (i.e., trough levels measured in samples obtained
prior to dosing on Days 4 and 7, and prior to necropsy on Day 14)
indicated dose-dependent exposure to the test article. On Day 7,
predose mean concentrations were approximately 84 and 240 .mu.g/ml
for the 3- and 10-mg/kg dose groups, respectively.
[0354] A potential for accumulation of the test article in serum
with the every-three-day dosing schedule in monkeys was evident
from the difference between the Day 4 and Day 7 trough levels
(i.e., means concentrations on Day 7 were approximately twice as
high as on Day 4), as well as from the high residual levels on Day
14 (one week after the last dose), which were similar to the Day 7
trough levels. Evidence of antibody formation against the test
article was detected in two of the six study animals (one from
Group 1 and another from Group 2). In the former case, it appeared
that the antibody response might have affected the clearance of the
test article from circulation. Flow cytometric analysis of
lymphocyte subsets revealed a modest increase in total CD3-positive
cells between Days 1 and Day 14, which correlated with an increase
in CD3/CD4-positive cells, and a respective decrease in
CD3/CD8-positive cells (Group 2 only). The percentage of CD3 cells
expressing CD29 and HLA-DR moderately increased over the course of
the study, which was consistent with previous findings that
anti-CTLA4 antibodies can enhance antigen-specific T-cells.
[0355] In conclusion, apart from the minor changes in circulating
lymphocyte subpopulations, the highest dose level tested in this
study (i.e., three doses of 10 mg/kg given at three-day intervals)
was an absolute no-effect dose level in cynomolgus monkeys.
Example 11. A Phase I Human Clinical Trial of MAb 10D1 in Prostate
Cancer (MDXCTLA4-01) and Melanoma (MDXCTLA4-02)
[0356] MDXCTLA4-01 is an open-label study of anti-cytotoxic
T-lymphocyte-associated antigen-4 (anti-CTLA-4) monoclonal antibody
10D1 (MAb 10D1) in patients with progressive, metastatic,
hormone-refractory prostate cancer. Treatment is a single dose of
MAb 10D1 that is administered intravenously, as an infusion, at a
dosage of 3.0 mg/Kg.
[0357] The objectives of this trial are to determine if i.
administration of MAb 10D1 causes nonspecific T-cell activation,
ii. to establish a safety/tolerability profile for MAb 10D1 in
these patients and, iii. to determine the pharmacokinetic profile
of MAb 10D1 and assess the development of a host immune response to
MAb 10D1. In addition the study will attempt to identify
preliminary evidence of efficacy. The study is a multicenter,
open-label study of a single dose of MAb 10D1 in 14 subjects. The
study consists of four phases: Screening, Infusion, Post-infusion,
and Follow-up (see Table 10 below).
TABLE-US-00010 TABLE 10 Phase Screen Infusion Post-infusion
Follow-up Time days -30 to 130 145 160 190 250 370 24 48 72 day day
day day monthly -14 to 0 min min min min min min hrs hrs hrs 7 14
21 28
[0358] Patients with histologic diagnosis of primary adenocarcinoma
of the prostate, and progressive metastatic carcinoma of the
prostate after androgen deprivation and at least one systemic
non-hormonal manipulation, are being screened for participation in
this study. Subjects must have progressive measurable disease,
progressive PSA, PSA>5 ng/ml, testosterone<50 ng/dl, primary
gonadal androgen suppression, life expectancy>12 weeks, and
Karnofsky Performance Status.gtoreq.60%.
[0359] Subjects undergo physical examination, ECG, chest
radiography, diagnostic imaging, and blood sampling for
hematological, biochemical, and immune function assessments, and
have vital signs monitored. Monthly telephone interviews are used
to collect and record information on a subset of adverse events,
including autoimmune adverse events after disease progression,
until six months after treatment. PSA (decline, duration of
decline, progression, time to progression) and disease response
(complete, partial, stable, progressive) are monitored. Plasma
concentrations of MAb 10D1 are being assessed immediately prior to,
during, and up to two months after, infusion.
[0360] Data from four prostate cancer subjects that have been
treated are shown in Table 11. No adverse events have been
recorded. For all of the subjects treated, MAb 10D1 appears to be
well tolerated.
[0361] Because of the importance of monitoring the immune status of
patients in the trial and the specific goal of monitoring
generalized effects on T cell activation by anti-CTLA-4 antibody,
the entry criteria in this study included minimum levels of CD4 and
CD8 T cells of .gtoreq.500/ml and .gtoreq.500/ml respectively.
However, it was observed during the initial accrual in the study
that prostate cancer patients have significantly reduced T cell
numbers although CD4 and CD8 T cells are clearly present. Many
patients were initially rejected based on the above entry criteria
(see Table 11). The apparent reduced T cell counts observed is a
previously undocumented observation in prostate cancer patients
that may have relevance in treatments involving cancer vaccination
in these patients. Subsequent to these observations, the entry
criteria were amended to include patients having CD4 and CD8 count
of .gtoreq.300/ml and .gtoreq.200/ml respectively.
[0362] In order to evaluate whether administration of MAb 10D1 can
induce undesirable non-specific T cell activation, peripheral blood
lymphocytes from the prostate cancer subjects were analyzed by flow
cytometry for each of the following markers: CD4, CD8, CD25, CD44,
CD69 and HLA-DR. Blood samples were taken at time points indicated
in Table 10. No significant change in the frequency of any of these
markers was observed during the course of the treatment for each of
the prostate cancer subjects treated thus far. An example of this
analysis is shown in Table 12 which shows the frequency of CD4,
CD25, CD69-positive cells and CD8, CD25, CD69-positive cells at
times prior to, during, and subsequent to MAb 10D1 administration
in two of the subjects. These data demonstrate that MAb 10D1 does
not result in non-specific T cell activation.
TABLE-US-00011 TABLE 11 Study No. MDXCTLA4-01 Selected Lab Values
Summary Screen Subject Amendment PSA Platelets WBC Neuts Lymphs
Monos Eos CD4/ CD8/ ESR Hgb Hcrit no. no. Initials # Day Data ng/ml
.times.10.sup.3/u1 .times.10.sup.3/u1 % .times.10.sup.3/u1 %
.times.10.sup.3/u1 % .times.10.sup.3/u1 % .times.10.sup.3/u1 ul ul
mm/hr g/dl % 02001 001 JGR Scr 144.80 263 8.12 73.00 5.90 18.00
1.47 5.60 0.46 1.80 0.15 670 367 71 10.4 30 02001 001 JGR 0 185.20
267 6.74 66.00 3.79 22.00 1.32 6.60 0.38 3 10 0.18 704 376 10.6 32
02001 001 JGR 1 259 6.31 69.00 4.38 20.00 1.29 8.70 0 55 0.90 0.00
A A 9.5 30 02001 001 JGR 2 240 6.59 70.00 4.66 19.00 1.31 6.70 0.44
1 80 0.12 556 303 9.5 28 02001 001 JGR 3 270 6.53 71.00 4 63 21.00
1.36 5.50 0.36 2.20 0.14 608 254 9.3 28 02001 001 JGR 7 257.40 299
6.70 68.00 4.56 23.00 1.53 6.00 0.40 2.50 0.17 A A 9.5 28 02001 001
JGR 14 332.30 308 6.87 71 90 7.94 21.20 1.39 5.21 0.36 1.90 0.13 A
A 8.8 25 02001 001 JGR 21 286 9.72 74.00 7.20 19.70 1.91 4.80 0.46
1.00 0.10 A A 9.1 28 02001 001 JGR 28 351.00 304 5.38 63.00 3.40
26.00 1.44 5.80 0.31 2.90 0.16 8.7 25 01002 JWF Scr 28.30 271 11.60
75.40 8.75 13.60 1.58 5.70 0.66 4.60 0.53 399 189 41 13.9 37 01003
MZB Scr 12.70 178 5.49 69.00 3.79 19.60 1.08 6.30 0.35 2.70 0.24
325 168 19 12 7 36 01004 TEQ Scr 1459 00 264 6.26 75.10 4.70 14.40
0.90 7.70 0.48 2.40 0.15 365 129 61 12.8 36 01005 WMN Scr 192 40
212 6.86 73.70 5.05 17.40 1.20 6.20 0.43 2.20 0.15 483 217 01006
MRS Scr 4503.00 140 7.55 76.70 5.79 15.90 1.20 6.20 0.47 0.80 0.06
319 363 83 01007 TAB Scr 1394.00 205 5.78 73.00 4.24 13.00 0.76 6
50 0.37 6.00 0.35 376 127 14.1 43 01008 CHB Scr 70.70 229 4.67
54.00 2.56 32.00 1.52 8.30 0 39 3.40 0.16 461 499 15.6 45 01009 003
RAB Scr 238.60 144 3 70 78.00 2.88 14 00 0 55 5.40 0.20 1 20 0.04
211 162 43 9.8 30 01009 003 RAB 0 336.90 123 3.92 68.00 2.67 21.00
0.83 8.70 0.34 1.50 0.06 374 188 10.9 31 01009 003 RAB 1 122 3.35
71.00 2.38 22.00 0.74 4.00 0.14 1.80 0.06 307 192 11 3 32 01009 003
RAB 2 109 4 05 74.00 2 99 19 00 0.77 4.80 0.20 1.20 0.05 328 220
11.3 33 01009 003 RAB 3 114 3.79 70.00 2.67 21.00 0.81 6.20 0 23
1.30 0.05 313 266 10 9 31 01009 003 RAB 7 249 30 69 3.38 75.00 2.54
17.00 0.60 5.60 0 19 0.70 0.02 244 161 10.4 30 01009 003 RAB 14
269.80 101 3.68 69.00 2.54 21.20 0.78 8.50 0.31 1.00 0.04 308 173
8.8 25 01009 003 RAB 21 122 4 82 78.00 3.76 13.20 0.64 7.70 0 37
0.60 0.03 218 195 7.4 20 01012 004 CEH Scr 112.90 172 5 85 64.00
3.74 28.00 1.69 5.60 0.33 1.00 0.06 746 461 10 13.2 40 01012 004
CEH 1 642 475 01012 004 CEH 2 150 4.82 67 70 3.26 26.40 1.28 4.60
0.22 1.10 0.05 552 380 122 36 01012 004 CEH 3 147 4.36 63.70 2.78
29.30 1.28 5.10 0.22 1.30 0 06 544 441 13.1 37 01012 004 CEH 7
190.00 159 4 95 58.60 2 90 32 70 1.61 5 90 0.29 2 50 0 12 842 506
12.6 35 01012 004 CEH 14 207.60 199 5.64 63.10 3.55 29 30 1.65 5.70
0 32 1.60 0.09 13 5 38 01013 KJF Scr 49.10 228 8 53 65.00 5.62
26.00 2.23 5.30 0 46 2.30 0.20 1213 398 13.4 37 02014 002 L-S Scr
12.70 222 5.65 53 00 3.01 34.00 1.92 7 40 0.42 3.90 0 22 721 439 13
6 40 02014 002 L-S 0 27.50 217 5 88 57.00 3 36 32 00 1.88 8.60 0.50
1 50 0.09 676 389 13.5 38 02014 002 L-S 1 226 5.74 55.00 3.19 35 00
2 04 7.00 0.40 1 40 0 08 632 405 13.6 38 02014 002 L-S 2 223 5.59
55.00 3 09 32 00 1.84 9.80 0.55 1.40 0.08 590 339 13 5 39 02014 002
L-S 3 219 4.89 54.00 2.66 34.00 1.68 7.50 0.37 2 70 0.13 529 358
13.2 37 01016 Ineligible G-F Scr 4856.00 106 7.31 86.00 6.29 5.00
0.33 6.80 0.49 1.90 0.14 576 7 10.3 31 normal range low 150 3 80
40.50 1.96 15 40 0.80 2.60 0 12 404 220 high 7.00 10.70 75 00 7.23
48.50 3.00 10.00 0.92 6.80 0.67 1612 1128 30
TABLE-US-00012 TABLE 12 Flow cytometric analysis of T cell
activation markers in prostate cancer subjects treated with 3.0
mg/Kg MAb 10D1. Patient Number Time Point CD(4 + 25 + 69) % CD (8 +
25 + 69) % 3 Screen 1.7 0.8 3 -30 MIN 2.6 0.8 (Pre-Infusion) 3 40
MIN 2.5 0.7 3 130 MIN 1.9 0.9 3 145 MIN 1.7 0.5 3 160 MIN 1.7 1 3
190 MIN 1.5 1.5 3 250 MIN 2.1 1.2 3 370 MIN 1.3 0.9 3 24 HR 1.6 1.6
3 48 HR 2.7 3 3 72 HR 0.9 0.5 3 Day 7 0.9 0.1 3 Day 14 0.4 0.5 3
Day 21 2.3 1.9 4 Screen 1.4 0.8 4 -30 MIN 0.5 0.3 (Pre-Infusion) 4
40 MIN 0.3 0.1 4 130 MIN 0.3 0.1 4 145 MIN 0.4 0.2 4 160 MIN 0.2
0.2 4 190 MIN 0.8 0.3 4 250 MIN 0.1 0 4 370 MIN 0.3 0.1 4 24 HR 0.2
0.3 4 48 HR 0.4 0.6 4 72 HR 0.8 0.3 4 Day 7 1 0.7 4 Day 14 1.1
0.8
[0363] A second clinical trial (MDXCTLA4-02) using MAb 10D1 in
subjects with Stage IV malignant melanoma has also been initiated.
A single dose of MAb 10D1 will be administered intravenously, as an
infusion, at a dosage of 3.0 mg/Kg. This study also consists of
four phases (Screening, Infusion, Post-Infusion and Follow-up) as
described in Table 9, above.
[0364] The goals of this study are as those regarding the
above-described study in prostate cancers as well as to
specifically establish a safety/tolerability profile for MAb 10D1
in patients with Stage IV malignant melanoma. One patient has been
treated in this study (see Table 13). As in the prostate cancer
study, MAb 10D1 appears to be well tolerated. Flow cytometric
analysis of T cell activation markers in this subject, analogous to
that performed for the prostate tumor trial, also showed no
evidence of non-specific T cell activation.
TABLE-US-00013 TABLE 13 Study No. MDXCTLA4-02 Selected Lab Values
Summary Screen Subject Amendment Platelets WBC Neuts Lymphs Monos
no no. Intials # Day Date .times.10.sup.3/u1 .times.10.sup.3/u1 %
.times.10.sup.3/u1 % .times.10.sup.3/u1 % .times.10.sup.3/u1 02001
001 SAH 0 Scr 216 6.28 56.60 3.52 35.60 2.23 5.90 0.37 02001 001
SAH 0 230 5.58 59.70 3.33 32.30 1.80 5.70 0.32 02001 001 SAH 0 202
5.12 61.80 3.16 30.20 1.55 5.00 0.26 normal low 150 3.80 40.50 1.96
15.40 0.80 2.60 0.12 range high 10.70 75.00 7.23 48.50 3.00 10.10
0.92 Screen Subject Amendment Eos CD4/ CD8/ ESR Hgh Hcrit no no.
Intials # Day Date % .times.10.sup.3/u1 u1 u1 mm/hr g/dl % 02001
001 SAH 0 Scr 1.80 0.11 1189 631 14.4 39 02001 001 SAH 0 0 1.80
0.10 1039 500 14.9 43 02001 001 SAH 0 1 2.30 0.12 957 407 13.4 37
normal low 404 220 range high 0.80 0.57 1612 1129 30
[0365] Ongoing results from the MDXCTLA4-01 and MDXCTLA4-02
clinical trials have demonstrated that the infusions are tolerable
with only minor reactions. Prolonged plasma half-life of the
antibody was seen, with the antibody remaining in the plasma for
approximately 3 to 4 months. Clear evidence of immune effects was
observed without overt non-specific T cell activation. Symptomatic
relief and reductions in prostate specific antigen (PSA) levels
have been observed in prostate cancer patients treated with the
anti-CTLA-4 antibody. Representative results for reductions in PSA
levels are shown in FIG. 18, which shows PSA levels (in ng/ml) in
two patients (one represented by the closed circles, the other by
the open circles) at various time points after infusion of 3 mg/kg
anti-CTLA-4 antibody at day 0. The results demonstrate that PSA
levels decreased after infusion of the antibody and remained
suppressed for approximately 3-4 months after treatment,
correlating with the presence of the anti-CTLA-4 antibody in the
plasma. Other examples of immune effects observed included
immune-mediated rash and pruritis, transient seroconversion to
positive autoantibodies, melanin pigment changes in melanoma
patients and inflammatory reactions at tumor sites. Except for the
rash and pruritis, all potentially adverse immune effects were
subclinical. In summary, the ongoing results from human clinical
trials with anti-CTLA-4 antibody treatment demonstrate that the
antibody is well-tolerated and stimulates immune effects in
recipients.
Example 12: Anti-CTLA-4 Treatment Enhances Antibody Responses to a
Hepatitis B Surface Antigen (HBsAg) Vaccine
[0366] The ability of a human anti-CTLA-4 antibody of the invention
to enhance antibody responses to a hepatitis B surface antigen
(HBsAg) vaccine was examined in cynomolgus monkeys. Test groups of
four monkeys each (two males, two females) were treated with either
1) the HBsAg vaccine in combination with a control IgG1 antibody (a
humanized anti-RSV antibody, Synagis.TM., commercially available
from MedImmune) or 2) the HbsAg vaccine in combination with the
anti-CTLA-4 antibody 10D1. The anti-CTLA-4 antibody or control IgG1
were administered intravenously at a dosage of 10 mg/kg in a volume
of 2.0 ml/kg. The HBsAg vaccine (Engerix-B.TM., commercially
available from GlaxoSmithKline) was administered intramuscularly at
a dosage of 10 .mu.g in a volume of 0.5 ml. The anti-CTLA-4 or
control IgG1 antibody was administered on days 1 and 29, whereas
the HBsAg vaccine was administered on days 2 and 30. Plasma levels
of anti-HBsAg antibody were measured on days 1, 51 and 64 using a
radioimmunoassay kit (commercially available from Abbott). Results
presented represent the mean of the four animals in each group,
+/-SE. The results are shown in the bar graphs of FIG. 19, wherein
Group 1 was treated with vaccine and control IgG1 and Group 2 was
treated with vaccine and anti-CTLA-4. The left bar for each group
represents day 1, the middle bar represents day 51 and the right
bar represents day 64. Use of the anti-CTLA-4 antibody in
combination with the vaccine led to a significantly greater
anti-HBsAg antibody response than use of the vaccine with a control
IgG1. These results demonstrate that a human anti-CTLA-4 antibody
of the invention is capable of enhancing antibody responses to a
viral antigen vaccine in vivo in primates.
Example 13: Anti-CTLA-4 Treatment Enhances Antibody and T Cell
Responses to a Melanoma Cell Vaccine
[0367] The ability of a human anti-CTLA-4 antibody of the invention
to enhance antibody and T cell responses to a melanoma cell vaccine
was examined in cynomolgus monkeys. Test groups of six monkeys each
(three males, three females) were treated with either 1) a melanoma
cell vaccine alone (SK-mel-3, a human melanoma tumor cell line
transfected to express GM-CSF) or 2) both SK-mel-3 and the
anti-CTLA-4 antibody 10D1. The antibody was administered
intravenously at a dosage of 10 mg/kg in a volume of 1.3 ml/kg. The
SK-mel-3 cells were administered subcutaneously in a fixed amount
(5.times.10.sup.6 cells/animal at 0.5 ml/animal). The appropriate
antibody and/or vaccine were administered on days 0, 28, 56 and 84.
Antibody responses to the melanoma cell vaccine were assessed on
days 13, 41, 69 and 97. The results are shown in the graph of FIG.
20, in which a 1/1000 dilution of plasma was examined. Results
presented represent the mean of the six animals in each group,
+/-SE. Results from the animals treated with the vaccine alone are
depicted with the open circles, whereas results from animals
treated with both the anti-CTLA-4 antibody and the vaccine are
depicted with closed circles. Use of the anti-CTLA-4 antibody in
combination with the vaccine led to a significantly greater
antibody response against the melanoma cells than use of the
vaccine alone. These results demonstrate that a human anti-CTLA-4
antibody of the invention is capable of enhancing antibody
responses to a tumor cell vaccine in vivo in primates.
[0368] The effect of anti-CTLA-4 treatment on antigen-specific T
cell proliferation was also examined. Prior to vaccination of the
animals, blood was drawn and monocytes from the animals were
differentiated in vitro into dendritic cells (DC) to provide a
population of autologous dendritic cells for use in T cell
proliferation studies. A portion of theses autologous DCs were
incubated with the SK-mel-3 cells to provide a population of
autologous DCs that had been pulsed with melanoma antigens. At
various time points after vaccination, polymorphonuclear cells
(PMNC) were obtained from the animals and incubated in vitro either
1) alone (as a negative control), 2) with Staphylococcus
enterotoxin B (SEB, a non-specific activator of certain T cell
populations, as a positive control), 3) with autologous dendritic
cells or 4) with autologous dendritic cells that had been pulsed
with melanoma antigens. T cell proliferation was assessed using a
quantitative flow cytometry assay that allowed for a quantitative
measure of the total number of T cells per well (through the use of
an anti-CD3 antibody), as well as the number of CD8.sup.- vs.
CD8.sup.+ cells (through the use of an anti-CD8 antibody). The
results from an animal treated with SK-mel-3 in combination with
anti-CTLA-4, assessed at day 41 after vaccination, are summarized
in FIG. 21, wherein T cell proliferation is expressed as a
stimulation index relative to the number of control unstimulated
cells (set at a stimulation index of one). As illustrated in FIG.
21, stimulation with the non-specific activator SEB increased the
stimulation index at least 5 fold in both CD8.sup.+ and CD8.sup.-
cells, whereas incubation with autologous dendritic cells alone
increased the stimulation index only very slightly. Incubation with
autologous dendritic cells pulsed with melanoma cell antigens also
increased the stimulation index at least 5 fold in both CD8.sup.+
and CD8.sup.- cells (the latter essentially corresponding to the
CD4.sup.+ T cell population), thereby indicating that vaccination
with the melanoma cell vaccine in combination with anti-CTLA-4
results in antigen-specific T cell proliferation of both CD8.sup.+
and CD4.sup.+ T cells.
[0369] Further evidence of antigen-specific T cell proliferation
was obtained from delayed type hypersensitivity (DTH) experiments.
Animals treated with either the melanoma vaccine alone or with the
melanoma vaccine in combination with the anti-CTLA-4 antibody were
tested for a DTH reaction to either SK-mel-3 or to a saline control
using standard DTH assay methods. The results demonstrated that 3
of 6 of the animals treated with the combination of the vaccine and
the anti-CTLA-4 antibody exhibited a specific DTH response to the
SK-mel-3 cells, whereas only one of the 6 animals treated with the
vaccine alone exhibited a specific DTH response to the SK-mel-3
cells. These results further demonstrate the ability of anti-CTLA-4
antibody treatment to enhance antigen-specific T cell responses in
vivo in primates.
[0370] Although the foregoing invention has been described in
detail for purposes of clarity of understanding, it will be obvious
that certain modifications may be practiced within the scope of the
appended claims. All publications and patent documents cited herein
are hereby incorporated by reference in their entirety for all
purposes to the same extent as if each were so individually
denoted.
TABLE-US-00014 APPENDIX SEQUENCE LISTING SEQ ID NO: 1 pGP1k
AATTAGCGGC CGCTGTCGAC AAGCTTCGAA TTCAGTATCG ATGTGGGGTA 50
CCTACTGTCC CGGGATTGCG GATCCGCGAT GATATCGTTG ATCCTCGAGT 100
GCGGCCGCAG TATGCAAAAA AAAGCCCGCT CATTAGGCGG GCTCTTGGCA 150
GAACATATCC ATCGCGTCCG CCATCTCCAG CAGCCGCACG CGGCGCATCT 200
CGGGCAGCGT TGGGTCCTGG CCACGGGTGC GCATGATCGT GCTCCTGTCG 250
TTGAGGACCC GGCTAGGCTG GCGGGGTTGC CTTACTGGTT AGCAGAATGA 300
ATCACCGATA CGCGAGCGAA CGTGAAGCGA CTGCTGCTGC AAAACGTCTG 350
CGACCTGAGC AACAACATGA ATGGTCTTCG GTTTCCGTGT TTCGTAAAGT 400
CTGGAAACGC GGAAGTCAGC GCCCTGCACC ATTATGTTCC GGATCTGCAT 450
CGCAGGATGC TGCTGGCTAC CCTGTGGAAC ACCTACATCT GTATTAACGA 500
AGCGCTGGCA TTGACCCTGA GTGATTTTTC TCTGGTCCCG CCGCATCCAT 550
ACCGCCAGTT GTTTACCCTC ACAACGTTCC AGTAACCGGG CATGTTCATC 600
ATCAGTAACC CGTATCGTGA GCATCCTCTC TCGTTTCATC GGTATCATTA 650
CCCCCATGAA CAGAAATTCC CCCTTACACG GAGGCATCAA GTGACCAAAC 700
AGGAAAAAAC CGCCCTTAAC ATGGCCCGCT TTATCAGAAG CCAGACATTA 750
ACGCTTCTGG AGAAACTCAA CGAGCTGGAC GCGGATGAAC AGGCAGACAT 800
CTGTGAATCG CTTCACGACC ACGCTGATGA GCTTTACCGC AGCTGCCTCG 850
CGCGTTTCGG TGATGACGGT GAAAACCTCT GACACATGCA GCTCCCGGAG 900
ACGGTCACAG CTTGTCTGTA AGCGGATGCC GGGAGCAGAC AAGCCCGTCA 950
GGGCGCGTCA GCGGGTGTTG GCGGGTGTCG GGGCGCAGCC ATGACCCAGT 1000
CACGTAGCGA TAGCGGAGTG TATACTGGCT TAACTATGCG GCATCAGAGC 1050
AGATTGTACT GAGAGTGCAC CATATGCGGT GTGAAATACC GCACAGATGC 1100
GTAAGGAGAA AATACCGCAT CAGGCGCTCT TCCGCTTCCT CGCTCACTGA 1150
CTCGCTGCGC TCGGTCGTTC GGCTGCGGCG AGCGGTATCA GCTCACTCAA 1200
AGGCGGTAAT ACGGTTATCC ACAGAATCAG GGGATAACGC AGGAAAGAAC 1250
ATGTGAGCAA AAGGCCAGCA AAAGGCCAGG AACCGTAAAA AGGCCGCGTT 1300
GCTGGCGTTT TTCCATAGGC TCCGCCCCCC TGACGAGCAT CACAAAAATC 1350
GACGCTCAAG TCAGAGGTGG CGAAACCCGA CAGGACTATA AAGATACCAG 1400
GCGTTTCCCC CTGGAAGCTC CCTCGTGCGC TCTCCTGTTC CGACCCTGCC 1450
GCTTACCGGA TACCTGTCCG CCTTTCTCCC TTCGGGAAGC GTGGCGCTTT 1500
CTCATAGCTC ACGCTGTAGG TATCTCAGTT CGGTGTAGGT CGTTCGCTCC 1550
AAGCTGGGCT GTGTGCACGA ACCCCCCGTT CAGCCCGACC GCTGCGCCTT 1600
ATCCGGTAAC TATCGTCTTG AGTCCAACCC GGTAAGACAC GACTTATCGC 1650
CACTGGCAGC AGCCAGGCGC GCCTTGGCCT AAGAGGCCAC TGGTAACAGG 1700
ATTAGCAGAG CGAGGTATGT AGGCGGTGCT ACAGAGTTCT TGAAGTGGTG 1750
GCCTAACTAC GGCTACACTA GAAGGACAGT ATTTGGTATC TGCGCTCTGC 1800
TGAAGCCAGT TACCTTCGGA AAAAGAGTTG GTAGCTCTTG ATCCGGCAAA 1850
CAAACCACCG CTGGTAGCGG TGGTTTTTTT GTTTGCAAGC AGCAGATTAC 1900
GCGCAGAAAA AAAGGATCTC AAGAAGATCC TTTGATCTTT TCTACGGGGT 1950
CTGACGCTCA GTGGAACGAA AACTCACGTT AAGGGATTTT GGTCATGAGA 2000
TTATCAAAAA GGATCTTCAC CTAGATCCTT TTAAATTAAA AATGAAGTTT 2050
TAAATCAATC TAAAGTATAT ATGAGTAAAC TTGGTCTGAC AGTTACCAAT 2100
GCTTAATCAG TGAGGCACCT ATCTCAGCGA TCTGTCTATT TCGTTCATCC 2150
ATAGTTGCCT GACTCCCCGT CGTGTAGATA ACTACGATAC GGGAGGGCTT 2200
ACCATCTGGC CCCAGTGCTG CAATGATACC GCGAGACCCA CGCTCACCGG 2250
CTCCAGATTT ATCAGCAATA AACCAGCCAG CCGGAAGGGC CGAGCGCAGA 2300
AGTGGTCCTG CAACTTTATC CGCCTCCATC CAGTCTATTA ATTGTTGCCG 2350
GGAAGCTAGA GTAAGTAGTT CGCCAGTTAA TAGTTTGCGC AACGTTGTTG 2400
CCATTGCTGC AGGCATCGTG GTGTCACGCT CGTCGTTTGG TATGGCTTCA 2450
TTCAGCTCCG GTTCCCAACG ATCAAGGCGA GTTACATGAT CCCCCATGTT 2500
GTGCAAAAAA GCGGTTAGCT CCTTCGGTCC TCCGATCGTT GTCAGAAGTA 2550
AGTTGGCCGC AGTGTTATCA CTCATGGTTA TGGCAGCACT GCATAATTCT 2600
CTTACTGTCA TGCCATCCGT AAGATGCTTT TCTGTGACTG GTGAGTACTC 2650
AACCAAGTCA TTCTGAGAAT AGTGTATGCG GCGACCGAGT TGCTCTTGCC 2700
CGGCGTCAAC ACGGGATAAT ACCGCGCCAC ATAGCAGAAC TTTAAAAGTG 2750
CTCATCATTG GAAAACGTTC TTCGGGGCGA AAACTCTCAA GGATCTTACC 2800
GCTGTTGAGA TCCAGTTCGA TGTAACCCAC TCGTGCACCC AACTGATCTT 2850
CAGCATCTTT TACTTTCACC AGCGTTTCTG GGTGAGCAAA AACAGGAAGG 2900
CAAAATGCCG CAAAAAAGGG AATAAGGGCG ACACGGAAAT GTTGAATACT 2950
CATACTCTTC CTTTTTCAAT ATTATTGAAG CATTTATCAG GGTTATTGTC 3000
TCATGAGCGG ATACATATTT GAATGTATTT AGAAAAATAA ACAAATAGGG 3050
GTTCCGCGCA CATTTCCCCG AAAAGTGCCA CCTGACGTCT AAGAAACCAT 3100
TATTATCATG ACATTAACCT ATAAAAATAG GCGTATCACG AGGCCCTTTC 3150
GTCTTCAAG 3159 pCK7-96 (SEQ ID NO: 39)
TCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCA
AAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAA
AAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCAC
AAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA
AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGC
TGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCG
GTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGT
GCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGT
GGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCT
ACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATC
TTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCT
GACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCC
TGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCG
CGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGT
GGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCA
GTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCT
TCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTG
CATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTC
TGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGC
AGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTG
AGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT
GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTC
ATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAA
TGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAA
ACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGT
GATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGG
AGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCA
GAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGC
ATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTA
CGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGA
CGTTGTAAAACGACGGCCAGTGCCAAGCTAGCGGCCGCGGTCCAACCACCAATCTCAAAGCTTGGTACCCGG
GAGCCTGTTATCCCAGCACAGTCCTGGAAGAGGCACAGGGGAAATAAAAGCGGACGGAGGCTTTCCTTGACT
CAGCCGCTGCCTGGTCTTCTTCAGACCTGTTCTGAATTCTAAACTCTGAGGGGGTCGGATGACGTGGCCATT
CTTTGCCTAAAGCATTGAGTTTACTGCAAGGTCAGAAAAGCATGCAAAGCCCTCAGAATGGCTGCAAAGAGC
TCCAACAAAACAATTTAGAACTTTATTAAGGAATAGGGGGAAGCTAGGAAGAAACTCAAAACATCAAGATTT
TAAATACGCTTCTTGGTCTCCTTGCTATAATTATCTGGGATAAGCATGCTGTTTTCTGTCTGTCCCTAACAT
GCCCTGTGATTATCCGCAAACAACACACCCAAGGGCAGAACTTTGTTACTTAAACACCATCCTGTTTGCTTC
TTTCCTCAGGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAA
CTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACG
CCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCA
GCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCC
TGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAGAGGGAGAAGTGCCCCCACCTGCTCCTCA
GTTCCAGCCTGACCCCCTCCCATCCTTTGGCCTCTGACCCTTTTTCCACAGGGGACCTACCCCTATTGCGGT
CCTCCAGCTCATCTTTCACCTCACCCCCCTCCTCCTCCTTGGCTTTAATTATGCTAATGTTGGAGGAGAATG
AATAAATAAAGTGAATCTTTGCACCTGTGGTTTCTCTCTTTCCTCAATTTAATAATTATTATCTGTTGTTTA
CCAACTACTCAATTTCTCTTATAAGGGACTAAATATGTAGTCATCCTAAGGCGCATAACCATTTATAAAAAT
CATCCTTCATTCTATTTTACCCTATCATCCTCTGCAAGACAGTCCTCCCTCAAACCCACAAGCCTTCTGTCC
TCACAGTCCCCTGGGCCATGGATCCTCACATCCCAATCCGCGGCCGCAATTCGTAATCATGGTCATAGCTGT
TTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCT
GGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACC
TGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGC
pCG7-96 (SEQ ID NO: 40)
GAACTCGAGCAGCTGAAGCTTTCTGGGGCAGGCCAGGCCTGACCTTGGCTTTGGGGCAGGGAGGGGGCTAAG
GTGAGGCAGGTGGCGCCAGCCAGGTGCACACCCAATGCCCATGAGCCCAGACACTGGACGCTGAACCTCGCG
GACAGTTAAGAACCCAGGGGCCTCTGCGCCCTGGGCCCAGCTCTGTCCCACACCGCGGTCACATGGCACCAC
CTCTCTTGCAGCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGG
CACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGC
CCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGT
GACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAA
GGTGGACAAGAAAGTTGGTGAGAGGCCAGCACAGGGAGGGAGGGTGTCTGCTGGAAGCCAGGCTCAGCGCTC
CTGCCTGGACGCATCCCGGCTATGCAGCCCCAGTCCAGGGCAGCAAGGCAGGCCCCGTCTGCCTCTTCACCC
GGAGGCCTCTGCCCGCCCCACTCATGCTCAGGGAGAGGGTCTTCTGGCTTTTTCCCCAGGCTCTGGGCAGGC
ACAGGCTAGGTGCCCCTAACCCAGGCCCTGCACACAAAGGGGCAGGTGCTGGGCTCAGACCTGCCAAGAGCC
ATATCCGGGAGGACCCTGCCCCTGACCTAAGCCCACCCCAAAGGCCAAACTCTCCACTCCCTCAGCTCGGAC
ACCTTCTCTCCTCCCAGATTCCAGTAACTCCCAATCTTCTCTCTGCAGAGCCCAAATCTTGTGACAAAACTC
ACACATGCCCACCGTGCCCAGGTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTA
GAGTAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTGACACGTCCACCTCCATCTCTTCCTCAGCACCT
GAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACC
CCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGAC
GGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGC
GTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTC
CCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGTGGGACCCGTGGGGTGCGAGGGCCACATGGACAG
AGGCCGGCTCGGCCCACCCTCTGCCCTGAGAGTGACCGCTGTACCAACCTCTGTCCCTACAGGGCAGCCCCG
AGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCT
GGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAA
GACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAG
GTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAG
CCTCTCCCTGTCTCCGGGTAAATGAGTGCGACGGCCGGCAAGCCCCCGCTCCCCGGGCTCTCGCGGTCGCAC
GAGGATGCTTGGCACGTACCCCCTGTACATACTTCCCGGGCGCCCAGCATGGAAATAAAGCACCCAGCGCTG
CCCTGGGCCCCTGCGAGACTGTGATGGTTCTTTCCACGGGTCAGGCCGAGTCTGAGGCCTGAGTGGCATGAG
GGAGGCAGAGCGGGTCCCACTGTCCCCACACTGGCCCAGGCTGTGCAGGTGTGCCTGGGCCCCCTAGGGTGG
GGCTCAGCCAGGGGCTGCCCTCGGCAGGGTGGGGGATTTGCCAGCGTGGCCCTCCCTCCAGCAGCACCTGCC
CTGGGCTGGGCCACGGGAAGCCCTAGGAGCCCCTGGGGACAGACACACAGCCCCTGCCTCTGTAGGAGACTG
TCCTGTTCTGTGAGCGCCCCTGTCCTCCCGACCTCCATGCCCACTCGGGGGCATGCCTGCAGGTCGACTCTA
GAGGATCCCCGGGTACCGAGCTCGAATTCATCGATGATATCAGATCTGCCGGTCTCCCTATAGTGAGTCGTA
TTAATTTCGATAAGCCAGGTTAACCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATT
GGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCT
CACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGC
CAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAG
CATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCC
CCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCT
TCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAG
CTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCC
AACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTA
GGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGC
GCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGT
AGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATC
TTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAA
AGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACT
TGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATA
GTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATG
ATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGC
AGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGT
TCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGT
ATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCG
GTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCA
GCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAG
TCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCA
CATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCG
CTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGC
GTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGA
ATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATA
TTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
TAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGT
TTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGAT
GCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCG
GCATCAGAGCAGATTGTACTGAGAGTGCACCATATGGACATATTGTCGTTAGAACGCGGCTACAATTAATAC
ATAACCTTATGTATCATACACATACGATTTAGGTGACACTATA pG4HE (SEQ ID NO: 41)
GAACTCGAGCAGCTGAAGCTTTCTGGGGCAGGCCGGGCCTGACTTTGGCTGGGGGCAGGGAGGGGGCTAAGG
TGACGCAGGTGGCGCCAGCCAGGTGCACACCCAATGCCCATGAGCCCAGACACTGGACCCTGCATGGACCAT
CGCGGATAGACAAGAACCGAGGGGCCTCTGCGCCCTGGGCCCAGCTCTGTCCCACACCGCGGTCACATGGCA
CCACCTCTCTTGCAGCTTCCACCAAGGGCCCATCCGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCG
AGAGCACAGCCGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAG
GCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCG
TGGTGACCGTGCCCTCCAGCAGCTTGGGCACGAAGACCTACACCTGCAACGTAGATCACAAGCCCAGCAACA
CCAAGGTGGACAAGAGAGTTGGTGAGAGGCCAGCACAGGGAGGGAGGGTGTCTGCTGGAAGCCAGGCTCAGC
CCTCCTGCCTGGACGCACCCCGGCTGTGCAGCCCCAGCCCAGGGCAGCAAGGCATGCCCCATCTGTCTCCTC
ACCCGGAGGCCTCTGACCACCCCACTCATGCTCAGGGAGAGGGTCTTCTGGATTTTTCCACCAGGCTCCGGG
CAGCCACAGGCTGGATGCCCCTACCCCAGGCCCTGCGCATACAGGGGCAGGTGCTGCGCTCAGACCTGCCAA
GAGCCATATCCGGGAGGACCCTGCCCCTGACCTAAGCCCACCCCAAAGGCCAAACTCTCCACTCCCTCAGCT
CAGACACCTTCTCTCCTCCCAGATCTGAGTAACTCCCAATCTTCTCTCTGCAGAGTCCAAATATGGTCCCCC
ATGCCCATCATGCCCAGGTAAGCCAACCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTAGAGT
AGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTGACGCATCCACCTCCATCTCTTCCTCAGCACCTGAGT
TCCTGGGGGGACCATCAGTCTTCCTGTTCCCCCCAAAACCCAAGGACACTCTCATGATCTCCCGGACCCCTG
AGGTCACGTGCGTGGTGGTGGACGTGAGCCAGGAAGACCCCGAGGTCCAGTTCAACTGGTACGTGGATGGCG
TGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTTCAACAGCACGTACCGTGTGGTCAGCGTCC
TCACCGTCCTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGGCCTCCCGT
CCTCCATCGAGAAAACCATCTCCAAAGCCAAAGGTGGGACCCACGGGGTGCGAGGGCCACATGGACAGAGGT
CAGCTCGGCCCACCCTCTGCCCTGGGAGTGACCGCTGTGCCAACCTCTGTCCCTACAGGGCAGCCCCGAGAG
CCACAGGTGTACACCCTGCCCCCATCCCAGGAGGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTC
AAAGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACC
ACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAGGCTAACCGTGGACAAGAGCAGGTGG
CAGGAGGGGAATGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACACAGAAGAGCCTC
TCCCTGTCTCTGGGTAAATGAGTGCCAGGGCCGGCAAGCCCCCGCTCCCCGGGCTCTCGGGGTCGCGCGAGG
ATGCTTGGCACGTACCCCGTCTACATACTTCCCAGGCACCCAGCATGGAAATAAAGCACCCACCACTGCCCT
GGGCCCCTGTGAGACTGTGATGGTTCTTTCCACGGGTCAGGCCGAGTCTGAGGCCTGAGTGACATGAGGGAG
GCAGAGCGGGTCCCACTGTCCCCACACTGGCCCAGGCTGTGCAGGTGTGCCTGGGCCACCTAGGGTGGGGCT
CAGCCAGGGGCTGCCCTCGGCAGGGTGGGGGATTTGCCAGCGTGGCCCTCCCTCCAGCAGCAGCTGCCCTGG
GCTGGGCCACGGGAAGCCCTAGGAGCCCCTGGGGACAGACACACAGCCCCTGCCTCTGTAGGAGACTGTCCT
GTCCTGTGAGCGCCCTGTCCTCCGACCCCCCATGCCCACTCGGGGGGATCCCCGGGTACCGAGCTCGAATTC
ATCGATGATATCAGATCTGCCGGTCTCCCTATAGTGAGTCGTATTAATTTCGATAAGCCAGGTTAACCTGCA
TTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGA
CTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCAC
AGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGC
CGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAG
GTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGT
TCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTC
ACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCA
GCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACT
GGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG
GCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAA
AAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA
GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAA
CGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTA
AAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAG
TGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAAC
TACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCC
AGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTC
CATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGT
TGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACG
ATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGT
CAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCC
ATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACC
GAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCAT
TGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCAC
TCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCA
AAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTA
TTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAAT
AGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAAC
CTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACA
CATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGC
GTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCA
CCATATGGACATATTGTCGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACGATT
TAGGTGACACTATA 10D1 VH (SEQ ID NO: 16) CAGGTGCAGC TGGTGGAGTC
TGGGGGAGGC GTGGTCCAGC CTGGGAGGTC 50 CCTGAGACTC TCCTGTGCAG
CCTCTGGATT CACCTTCAGT AGCTATACTA 100 TGCACTGGGT CCGCCAGGCT
CCAGGCAAGG GGCTGGAGTG GGTGACATTT 150 ATATCATATG ATGGAAACAA
TAAATACTAC GCAGACTCCG TGAAGGGCCG 200 ATTCACCATC TCCAGAGACA
ATTCCAAGAA CACGCTGTAT CTGCAAATGA 250 ACAGCCTGAG AGCTGAGGAC
ACGGCTATAT ATTACTGTGC GAGGACCGGC 300 TGGCTGGGGC CCTTTGACTA
CTGGGGCCAG GGAACCCTGG TCACCGTCTC 350 CTCAG 10D1 VK (SEQ ID NO: 6)
GAAATTGTGT TGACGCAGTC TCCAGGCACC CTGTCTTTGT CTCCAGGGGA 50
AAGAGCCACC CTCTCCTGCA GGGCCAGTCA GAGTGTTGGC AGCAGCTACT 100
TAGCCTGGTA CCAGCAGAAA CCTGGCCAGG CTCCCAGGCT CCTCATCTAT 150
GGTGCATTCA GCAGGGCCAC TGGCATCCCA GACAGGTTCA GTGGCAGTGG 200
GTCTGGGACA GACTTCACTC TCACCATCAG CAGACTGGAG CCTGAAGATT 250
TTGCAGTGTA TTACTGTCAG CAGTATGGTA GCTCACCGTG GACGTTCGGC 300
CAAGGGACCA AGGTGGAAAT CAAAC 325 4B6 VH (SEQ ID NO: 18) CAGGTGCAGC
TGGTGGAGTC TGGGGGAGGC GTGGTCCAGC CTGGGAGGTC 50 CCTGAGACTC
TCCTGTGCAG CCTCTGGATT CACCTTCAGT AGCTATACTA 100 TGCACTGGGT
CCGCCAGGCT CCAGGCAAGG GGCTGGAGTG GGTGACATTT 150 ATATCATATG
ATGGAAGCAA TAAACACTAC GCAGACTCCG TGAAGGGCCG 200 ATTCACCGTC
TCCAGAGACA ATTCCAAGAA CACGCTGTAT CTGCAAATGA 250 ACAGCCTGAG
AGCTGAGGAC ACGGCTATAT ATTACTGTGC GAGGACCGGC 300 TGGCTGGGGC
CCTTTGACTA CTGGGGCCAG GGAACCCTGG TCACCGTCTC 350 CTCAG 4B6 VK (SEQ
ID NO: 8) GAAATTGTGT TGACGCAGTC TCCAGGCACC CTGTCTTTGT CTCCAGGGGA 50
AAGAGCCACC CTCTCCTGCA GGGCCAGTCA GAGTGTTAGC AGCAGCTTCT 100
TAGCCTGGTA CCAGCAGAAA CCTGGCCAGG CTCCCAGGCT CCTCATCTAT 150
GGTGCATCCA GCAGGGCCAC TGGCATCCCA GACAGGTTCA GTGGCAGTGG 200
GTCTGGGACA GACTTCACTC TCACCATCAG CAGACTGGAG CCTGAAGATT 250
TTGCAGTGTA TTACTGTCAG CAGTATGGTA GCTCACCGTG GACGTTCGGC 300
CAAGGGACCA AGGTGGAAAT CAAAC 325 1E2 VH (SEQ ID NO: 22) CAGGTGCAGC
TGGTGGAGTC TGGGGGAGGC GTGGTCCAGC CTGGGAGGTC 50 CCTGAGACTC
TCCTGTGCAG CGTCTGGATT CACCTTCAGT AGCTATGGCA 100 TGCACTGGGT
CCGCCAGGCT CCAGGCAAGG GGCTGGAGTG GGTGGCAGTT 150 ATATGGTATG
ATGGAAGTAA TAAATACTAT GCAGACTCCG TGAAGGGCCG 200 ATTCACCATC
TCCAGAGACA ATTCCAAGAA CACGCTGTAT CTGCAAATGA 250 ACAGCCTGAG
AGCCGAGGAC ACGGCTGTGT TTTACTGTGC GAGAGCTCCC 300 AATTATATTG
GTGCTTTTGA TGTCTGGGGC CAAGGGACAA TGGTCACCGT 350 CTCTTCAG 1E2 VK
(SEQ ID NO: 12) GACATCCAGA TGACCCAGTC TCCATCCTCA CTGTCTGCAT
CTGTAGGAGA 50 CAGAGTCACC ATCACTTGTC GGGCGAGTCA GGGTATTAGC
AGCTGGTTAG 100 CCTGGTATCA GCAGAAACCA GAGAAAGCCC CTAAGTCCCT
GATCTATGCT 150 GCATCCAGTT TGCAAAGTGG GGTCCCATCA AGGTTCAGCG
GCAGTGGATC 200 TGGGACAGAT TTCACTCTCA CCATCAGCAG CCTGCAGCCT
GAAGATTTTG 250 CAACTTATTA CTGCCAACAG TATAATAGTT ACCCTCCGAC
GTTCGGCCAA 300 GGGACCAAGG TGGAAATCAA AC 322
Sequence CWU 1
1
4113159DNAArtificial SequenceDescription of Artificial
Sequencecloning vector pGP1k 1aattagcggc cgctgtcgac aagcttcgaa
ttcagtatcg atgtggggta cctactgtcc 60cgggattgcg gatccgcgat gatatcgttg
atcctcgagt gcggccgcag tatgcaaaaa 120aaagcccgct cattaggcgg
gctcttggca gaacatatcc atcgcgtccg ccatctccag 180cagccgcacg
cggcgcatct cgggcagcgt tgggtcctgg ccacgggtgc gcatgatcgt
240gctcctgtcg ttgaggaccc ggctaggctg gcggggttgc cttactggtt
agcagaatga 300atcaccgata cgcgagcgaa cgtgaagcga ctgctgctgc
aaaacgtctg cgacctgagc 360aacaacatga atggtcttcg gtttccgtgt
ttcgtaaagt ctggaaacgc ggaagtcagc 420gccctgcacc attatgttcc
ggatctgcat cgcaggatgc tgctggctac cctgtggaac 480acctacatct
gtattaacga agcgctggca ttgaccctga gtgatttttc tctggtcccg
540ccgcatccat accgccagtt gtttaccctc acaacgttcc agtaaccggg
catgttcatc 600atcagtaacc cgtatcgtga gcatcctctc tcgtttcatc
ggtatcatta cccccatgaa 660cagaaattcc cccttacacg gaggcatcaa
gtgaccaaac aggaaaaaac cgcccttaac 720atggcccgct ttatcagaag
ccagacatta acgcttctgg agaaactcaa cgagctggac 780gcggatgaac
aggcagacat ctgtgaatcg cttcacgacc acgctgatga gctttaccgc
840agctgcctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca
gctcccggag 900acggtcacag cttgtctgta agcggatgcc gggagcagac
aagcccgtca gggcgcgtca 960gcgggtgttg gcgggtgtcg gggcgcagcc
atgacccagt cacgtagcga tagcggagtg 1020tatactggct taactatgcg
gcatcagagc agattgtact gagagtgcac catatgcggt 1080gtgaaatacc
gcacagatgc gtaaggagaa aataccgcat caggcgctct tccgcttcct
1140cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca
gctcactcaa 1200aggcggtaat acggttatcc acagaatcag gggataacgc
aggaaagaac atgtgagcaa 1260aaggccagca aaaggccagg aaccgtaaaa
aggccgcgtt gctggcgttt ttccataggc 1320tccgcccccc tgacgagcat
cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 1380caggactata
aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc
1440cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc
gtggcgcttt 1500ctcatagctc acgctgtagg tatctcagtt cggtgtaggt
cgttcgctcc aagctgggct 1560gtgtgcacga accccccgtt cagcccgacc
gctgcgcctt atccggtaac tatcgtcttg 1620agtccaaccc ggtaagacac
gacttatcgc cactggcagc agccaggcgc gccttggcct 1680aagaggccac
tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
1740tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc
tgcgctctgc 1800tgaagccagt taccttcgga aaaagagttg gtagctcttg
atccggcaaa caaaccaccg 1860ctggtagcgg tggttttttt gtttgcaagc
agcagattac gcgcagaaaa aaaggatctc 1920aagaagatcc tttgatcttt
tctacggggt ctgacgctca gtggaacgaa aactcacgtt 1980aagggatttt
ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa
2040aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac
agttaccaat 2100gcttaatcag tgaggcacct atctcagcga tctgtctatt
tcgttcatcc atagttgcct 2160gactccccgt cgtgtagata actacgatac
gggagggctt accatctggc cccagtgctg 2220caatgatacc gcgagaccca
cgctcaccgg ctccagattt atcagcaata aaccagccag 2280ccggaagggc
cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta
2340attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc
aacgttgttg 2400ccattgctgc aggcatcgtg gtgtcacgct cgtcgtttgg
tatggcttca ttcagctccg 2460gttcccaacg atcaaggcga gttacatgat
cccccatgtt gtgcaaaaaa gcggttagct 2520ccttcggtcc tccgatcgtt
gtcagaagta agttggccgc agtgttatca ctcatggtta 2580tggcagcact
gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg
2640gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt
tgctcttgcc 2700cggcgtcaac acgggataat accgcgccac atagcagaac
tttaaaagtg ctcatcattg 2760gaaaacgttc ttcggggcga aaactctcaa
ggatcttacc gctgttgaga tccagttcga 2820tgtaacccac tcgtgcaccc
aactgatctt cagcatcttt tactttcacc agcgtttctg 2880ggtgagcaaa
aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat
2940gttgaatact catactcttc ctttttcaat attattgaag catttatcag
ggttattgtc 3000tcatgagcgg atacatattt gaatgtattt agaaaaataa
acaaataggg gttccgcgca 3060catttccccg aaaagtgcca cctgacgtct
aagaaaccat tattatcatg acattaacct 3120ataaaaatag gcgtatcacg
aggccctttc gtcttcaag 31592349DNAHomo sapienspreliminary sequence
for heavy chain fragment 10D1.3 2tgggggaggc gtggtccagc ctgggaggtc
cctgagactc tcctgtgcag cctctggatt 60caccttcagt agctatacta tgcactgggt
ccgccaggct ccaggcaagg ggctggagtg 120ggtgacattt atatcatatg
atggaaacaa taaatactac gcagactccg tgaagggccg 180attcaccatc
tccagagaca attccaagaa cacgctgtat ctgcaaatga acagcctgag
240agctgaggac acggctatat attactgtgc gaggaccggc tggctggggc
cctttgacta 300ctggggccag ggaaccctgg tcaccgtctc ctcagcctcc accaagggc
3493321DNAHomo sapienspreliminary sequence for light chain fragment
10D1.3 3ctccaggcac cctgtctttg tctccagggg aaagagccac cctctcctgc
agggccagtc 60agagtgttgg cagcagctac ttagcctggt accagcagaa acctggccag
gctcccaggc 120tcctcatcta tggtgcattc agcagggcca ctggcatccc
agacaggttc agtggcagtg 180ggtctgggac agacttcact ctcaccatca
gcagactgga gcctgaagat tttgcagtgt 240attactgtca gcagtatggt
agctcaccgt ggacgttcgg ccaagggacc aaggtggaaa 300tcaaacgaac
tgtggctgca c 3214287DNAHomo sapiensVk A-27 germline sequence
4gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc
60ctctcctgca gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa
120cctggccagg ctcccaggct cctcatctat ggtgcatcca gcagggccac
tggcatccca 180gacaggttca gtggcagtgg gtctgggaca gacttcactc
tcaccatcag cagactggag 240cctgaagatt ttgcagtgta ttactgtcag
cagtatggta gctcacc 287595PRTHomo sapienslight chain variable region
predicted sequence for Vk A-27 germline 5Glu Ile Val Leu Thr Gln
Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu
Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser 20 25 30Tyr Leu Ala Trp
Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45Ile Tyr Gly
Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu65 70 75
80Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser 85 90
956325DNAHomo sapienslight chain variable region (Vk), 10D1 from Vk
A-27 6gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga
aagagccacc 60ctctcctgca gggccagtca gagtgttggc agcagctact tagcctggta
ccagcagaaa 120cctggccagg ctcccaggct cctcatctat ggtgcattca
gcagggccac tggcatccca 180gacaggttca gtggcagtgg gtctgggaca
gacttcactc tcaccatcag cagactggag 240cctgaagatt ttgcagtgta
ttactgtcag cagtatggta gctcaccgtg gacgttcggc 300caagggacca
aggtggaaat caaac 3257108PRTHomo sapienslight chain variagle region
predicted sequence for 10D1 from Vk A-27 7Glu Ile Val Leu Thr Gln
Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu
Ser Cys Arg Ala Ser Gln Ser Val Gly Ser Ser 20 25 30Tyr Leu Ala Trp
Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45Ile Tyr Gly
Ala Phe Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu65 70 75
80Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro
85 90 95Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100
1058325DNAHomo sapienslight chain variable region (Vk) 4B6 from Vk
A-27 8gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga
aagagccacc 60ctctcctgca gggccagtca gagtgttagc agcagcttct tagcctggta
ccagcagaaa 120cctggccagg ctcccaggct cctcatctat ggtgcatcca
gcagggccac tggcatccca 180gacaggttca gtggcagtgg gtctgggaca
gacttcactc tcaccatcag cagactggag 240cctgaagatt ttgcagtgta
ttactgtcag cagtatggta gctcaccgtg gacgttcggc 300caagggacca
aggtggaaat caaac 3259108PRTHomo sapienslight chain variable region
predicted sequence for 4B6 from Vk A-27 9Glu Ile Val Leu Thr Gln
Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu
Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser 20 25 30Phe Leu Ala Trp
Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45Ile Tyr Gly
Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu65 70 75
80Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro
85 90 95Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100
10510287DNAHomo sapiensVk L-15 germline sequence 10gacatccaga
tgacccagtc tccatcctca ctgtctgcat ctgtaggaga cagagtcacc 60atcacttgtc
gggcgagtca gggtattagc agctggttag cctggtatca gcagaaacca
120gagaaagccc ctaagtccct gatctatgct gcatccagtt tgcaaagtgg
ggtcccatca 180aggttcagcg gcagtggatc tgggacagat ttcactctca
ccatcagcag cctgcagcct 240gaagattttg caacttatta ctgccaacag
tataatagtt accctcc 2871194PRTHomo sapienslight chain variable
region predicted sequence for Vk L-15 germline 11Asp Ile Gln Met
Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp 20 25 30Leu Ala
Trp Tyr Gln Gln Lys Pro Glu Lys Ala Pro Lys Ser Leu Ile 35 40 45Tyr
Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Ser Tyr 85
9012322DNAHomo sapienslight chain variable region Vk 1E2 from Vk
L-15 12gacatccaga tgacccagtc tccatcctca ctgtctgcat ctgtaggaga
cagagtcacc 60atcacttgtc gggcgagtca gggtattagc agctggttag cctggtatca
gcagaaacca 120gagaaagccc ctaagtccct gatctatgct gcatccagtt
tgcaaagtgg ggtcccatca 180aggttcagcg gcagtggatc tgggacagat
ttcactctca ccatcagcag cctgcagcct 240gaagattttg caacttatta
ctgccaacag tataatagtt accctccgac gttcggccaa 300gggaccaagg
tggaaatcaa ac 32213107PRTHomo sapienslight chain variable region
predicted sequence for 1E2 from Vk L-15 13Asp Ile Gln Met Thr Gln
Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile
Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp 20 25 30Leu Ala Trp Tyr
Gln Gln Lys Pro Glu Lys Ala Pro Lys Ser Leu Ile 35 40 45Tyr Ala Ala
Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75
80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Ser Tyr Pro Pro
85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100
10514294DNAHomo sapiensVH 3-30.3 germline sequence 14caggtgcagc
tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag
cctctggatt caccttcagt agctatgcta tgcactgggt ccgccaggct
120ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagcaa
taaatactac 180gcagactccg tgaagggccg attcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agctgaggac
acggctgtgt attactgtgc gaga 2941598PRTHomo sapiensheavy chain
variable region predicted sequence for VH 3-30.3 germline 15Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25
30Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser
Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala
Val Tyr Tyr Cys 85 90 95Ala Arg16355DNAHomo sapiensheavy chain
variable region VH 10D1 from VH 3-30.3 16caggtgcagc tggtggagtc
tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cctctggatt
caccttcagt agctatacta tgcactgggt ccgccaggct 120ccaggcaagg
ggctggagtg ggtgacattt atatcatatg atggaaacaa taaatactac
180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa
cacgctgtat 240ctgcaaatga acagcctgag agctgaggac acggctatat
attactgtgc gaggaccggc 300tggctggggc cctttgacta ctggggccag
ggaaccctgg tcaccgtctc ctcag 35517118PRTHomo sapiensheavy chain
variable region predicted sequence for 10D1 from VH 3-30.3 17Gln
Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10
15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30Thr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Thr Phe Ile Ser Tyr Asp Gly Asn Asn Lys Tyr Tyr Ala Asp
Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Ile Tyr Tyr Cys 85 90 95Ala Arg Thr Gly Trp Leu Gly Pro Phe Asp
Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser
11518355DNAHomo sapiensheavy chain variable region VH 4B6 from VH
3-30.3 18caggtgcagc tggtggagtc tgggggaggc gtggtccagc ctgggaggtc
cctgagactc 60tcctgtgcag cctctggatt caccttcagt agctatacta tgcactgggt
ccgccaggct 120ccaggcaagg ggctggagtg ggtgacattt atatcatatg
atggaagcaa taaacactac 180gcagactccg tgaagggccg attcaccgtc
tccagagaca attccaagaa cacgctgtat 240ctgcaaatga acagcctgag
agctgaggac acggctatat attactgtgc gaggaccggc 300tggctggggc
cctttgacta ctggggccag ggaaccctgg tcaccgtctc ctcag 35519118PRTHomo
sapiensheavy chain variable region predicted sequence for 4B6 from
VH 3-30.3 19Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro
Gly Arg1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Ser Ser Tyr 20 25 30Thr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45Thr Phe Ile Ser Tyr Asp Gly Ser Asn Lys His
Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Val Ser Arg Asp Asn
Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Ile Tyr Tyr Cys 85 90 95Ala Arg Thr Gly Trp Leu Gly
Pro Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser
Ser 11520296DNAHomo sapiensVH 3-33 germline sequence 20caggtgcagc
tggtggagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag
cgtctggatt caccttcagt agctatggca tgcactgggt ccgccaggct
120ccaggcaagg ggctggagtg ggtggcagtt atatggtatg atggaagtaa
taaatactat 180gcagactccg tgaagggccg attcaccatc tccagagaca
attccaagaa cacgctgtat 240ctgcaaatga acagcctgag agccgaggac
acggctgtgt attactgtgc gagaga 2962198PRTHomo sapiensheavy chain
variable region predicted sequence for VH 3-33 germline 21Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25
30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Ala Val Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser
Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala
Val Tyr Tyr Cys 85 90 95Ala Arg22358DNAHomo sapiensheavy chain
variable region VH 1E2 from VH 3-33 22caggtgcagc tggtggagtc
tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60tcctgtgcag cgtctggatt
caccttcagt agctatggca tgcactgggt ccgccaggct 120ccaggcaagg
ggctggagtg ggtggcagtt atatggtatg atggaagtaa taaatactat
180gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa
cacgctgtat 240ctgcaaatga acagcctgag agccgaggac acggctgtgt
tttactgtgc gagagctccc 300aattatattg gtgcttttga tgtctggggc
caagggacaa tggtcaccgt ctcttcag 35823119PRTHomo sapiensheavy chain
variable region predicted sequence for 1E2 from VH 3-33 23Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg1 5 10 15Ser
Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25
30Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45Ala Val Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser
Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Phe Tyr Cys 85 90 95Ala Arg Ala Pro Asn Tyr Ile Gly Ala Phe
Asp Val Trp Gly Gln Gly 100 105 110Thr Met Val Thr Val Ser Ser
1152412PRTHomo sapienslight chain CDR1 (HuMab 10D1) 24Arg Ala Ser
Gln Ser Val Gly Ser Ser Tyr Leu Ala1 5 102512PRTHomo sapienslight
chain CDR1 (HuMab 4B6) 25Arg Ala Ser Gln Ser Val Ser Ser Ser Phe
Leu Ala1 5 102611PRTHomo sapienslight chain CDR1 (HuMab 1E2) 26Arg
Ala Ser Gln Gly Ile Ser Ser Trp Leu Ala1 5 10275PRTHomo
sapiensheavy chain CDR1 (HuMab 10D1, 4B6) 27Ser Tyr Thr Met His1
5285PRTHomo sapiensheavy chain CDR1 (HuMab 1E2) 28Ser Tyr Gly Met
His1 5297PRTHomo sapienslight chain CDR2 (HuMab 10D1) 29Gly Ala Phe
Ser Arg Ala Thr1 5307PRTHomo sapienslight chain CDR2 (HuMab 4B6)
30Gly Ala Ser Ser Arg Ala Thr1 5317PRTHomo sapienslight chain CDR2
(HuMab 1E2) 31Ala Ala Ser Ser Leu Gln Ser1 53217PRTHomo
sapiensheavy chain CDR2 (HuMab 10D1) 32Phe Ile Ser Tyr Asp Gly Asn
Asn Lys Tyr Tyr Ala Asp Ser Val Lys1 5 10 15Gly3317PRTHomo
sapiensheavy chain CDR2 (HuMab 4B6) 33Phe Ile Ser Tyr Asp Gly Ser
Asn Lys His Tyr Ala Asp Ser Val Lys1 5 10 15Gly3417PRTHomo
sapiensheavy chain CDR2 (HuMab 1E2) 34Val Ile Trp Tyr Asp Gly Ser
Asn Lys Tyr Tyr Ala Asp Ser Val Lys1 5 10 15Gly359PRTHomo
sapienslight chain CDR3 (HuMab 10D1, 4B6) 35Gln Gln Tyr Gly Ser Ser
Pro Trp Thr1 5369PRTHomo sapienslight chain CDR3 (HuMab 1E2) 36Gln
Gln Tyr Asn Ser Tyr Pro Pro Thr1 5379PRTHomo sapiensheavy chain
CDR3 (HuMab 10D1, 4B6) 37Thr Gly Trp Leu Gly Pro Phe Asp Tyr1
53810PRTHomo sapiensheavy chain CDR3 (MuMab 1E2) 38Ala Pro Asn Tyr
Ile Gly Ala Phe Asp Val1 5 10393881DNAArtificial
SequenceDescription of Artificial Sequence kappa light chain
plasmid pCK7-96 39tcttccgctt cctcgctcac tgactcgctg cgctcggtcg
ttcggctgcg gcgagcggta 60tcagctcact caaaggcggt aatacggtta tccacagaat
caggggataa cgcaggaaag 120aacatgtgag caaaaggcca gcaaaaggcc
aggaaccgta aaaaggccgc gttgctggcg 180tttttccata ggctccgccc
ccctgacgag catcacaaaa atcgacgctc aagtcagagg 240tggcgaaacc
cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg
300cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct
cccttcggga 360agcgtggcgc tttctcatag ctcacgctgt aggtatctca
gttcggtgta ggtcgttcgc 420tccaagctgg gctgtgtgca cgaacccccc
gttcagcccg accgctgcgc cttatccggt 480aactatcgtc ttgagtccaa
cccggtaaga cacgacttat cgccactggc agcagccact 540ggtaacagga
ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg
600cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct
gaagccagtt 660accttcggaa aaagagttgg tagctcttga tccggcaaac
aaaccaccgc tggtagcggt 720ggtttttttg tttgcaagca gcagattacg
cgcagaaaaa aaggatctca agaagatcct 780ttgatctttt ctacggggtc
tgacgctcag tggaacgaaa actcacgtta agggattttg 840gtcatgagat
tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt
900aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg
cttaatcagt 960gaggcaccta tctcagcgat ctgtctattt cgttcatcca
tagttgcctg actccccgtc 1020gtgtagataa ctacgatacg ggagggctta
ccatctggcc ccagtgctgc aatgataccg 1080cgagacccac gctcaccggc
tccagattta tcagcaataa accagccagc cggaagggcc 1140gagcgcagaa
gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg
1200gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc
cattgctaca 1260ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat
tcagctccgg ttcccaacga 1320tcaaggcgag ttacatgatc ccccatgttg
tgcaaaaaag cggttagctc cttcggtcct 1380ccgatcgttg tcagaagtaa
gttggccgca gtgttatcac tcatggttat ggcagcactg 1440cataattctc
ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca
1500accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc
ggcgtcaata 1560cgggataata ccgcgccaca tagcagaact ttaaaagtgc
tcatcattgg aaaacgttct 1620tcggggcgaa aactctcaag gatcttaccg
ctgttgagat ccagttcgat gtaacccact 1680cgtgcaccca actgatcttc
agcatctttt actttcacca gcgtttctgg gtgagcaaaa 1740acaggaaggc
aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc
1800atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct
catgagcgga 1860tacatatttg aatgtattta gaaaaataaa caaatagggg
ttccgcgcac atttccccga 1920aaagtgccac ctgacgtcta agaaaccatt
attatcatga cattaaccta taaaaatagg 1980cgtatcacga ggccctttcg
tctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac 2040atgcagctcc
cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc
2100cgtcagggcg cgtcagcggg tgttggcggg tgtcggggct ggcttaacta
tgcggcatca 2160gagcagattg tactgagagt gcaccatatg cggtgtgaaa
taccgcacag atgcgtaagg 2220agaaaatacc gcatcaggcg ccattcgcca
ttcaggctgc gcaactgttg ggaagggcga 2280tcggtgcggg cctcttcgct
attacgccag ctggcgaaag ggggatgtgc tgcaaggcga 2340ttaagttggg
taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc
2400aagctagcgg ccgcggtcca accaccaatc tcaaagcttg gtacccggga
gcctgttatc 2460ccagcacagt cctggaagag gcacagggga aataaaagcg
gacggaggct ttccttgact 2520cagccgctgc ctggtcttct tcagacctgt
tctgaattct aaactctgag ggggtcggat 2580gacgtggcca ttctttgcct
aaagcattga gtttactgca aggtcagaaa agcatgcaaa 2640gccctcagaa
tggctgcaaa gagctccaac aaaacaattt agaactttat taaggaatag
2700ggggaagcta ggaagaaact caaaacatca agattttaaa tacgcttctt
ggtctccttg 2760ctataattat ctgggataag catgctgttt tctgtctgtc
cctaacatgc cctgtgatta 2820tccgcaaaca acacacccaa gggcagaact
ttgttactta aacaccatcc tgtttgcttc 2880tttcctcagg aactgtggct
gcaccatctg tcttcatctt cccgccatct gatgagcagt 2940tgaaatctgg
aactgcctct gttgtgtgcc tgctgaataa cttctatccc agagaggcca
3000aagtacagtg gaaggtggat aacgccctcc aatcgggtaa ctcccaggag
agtgtcacag 3060agcaggacag caaggacagc acctacagcc tcagcagcac
cctgacgctg agcaaagcag 3120actacgagaa acacaaagtc tacgcctgcg
aagtcaccca tcagggcctg agctcgcccg 3180tcacaaagag cttcaacagg
ggagagtgtt agagggagaa gtgcccccac ctgctcctca 3240gttccagcct
gaccccctcc catcctttgg cctctgaccc tttttccaca ggggacctac
3300ccctattgcg gtcctccagc tcatctttca cctcaccccc ctcctcctcc
ttggctttaa 3360ttatgctaat gttggaggag aatgaataaa taaagtgaat
ctttgcacct gtggtttctc 3420tctttcctca atttaataat tattatctgt
tgtttaccaa ctactcaatt tctcttataa 3480gggactaaat atgtagtcat
cctaaggcgc ataaccattt ataaaaatca tccttcattc 3540tattttaccc
tatcatcctc tgcaagacag tcctccctca aacccacaag ccttctgtcc
3600tcacagtccc ctgggccatg gatcctcaca tcccaatccg cggccgcaat
tcgtaatcat 3660ggtcatagct gtttcctgtg tgaaattgtt atccgctcac
aattccacac aacatacgag 3720ccggaagcat aaagtgtaaa gcctggggtg
cctaatgagt gagctaactc acattaattg 3780cgttgcgctc actgcccgct
ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa 3840tcggccaacg
cgcggggaga ggcggtttgc gtattgggcg c 3881404723DNAArtificial
SequenceDescription of Artificial Sequencegamma1 heavy chain
plasmid pCG7-96 40gaactcgagc agctgaagct ttctggggca ggccaggcct
gaccttggct ttggggcagg 60gagggggcta aggtgaggca ggtggcgcca gccaggtgca
cacccaatgc ccatgagccc 120agacactgga cgctgaacct cgcggacagt
taagaaccca ggggcctctg cgccctgggc 180ccagctctgt cccacaccgc
ggtcacatgg caccacctct cttgcagcct ccaccaaggg 240cccatcggtc
ttccccctgg caccctcctc caagagcacc tctgggggca cagcggccct
300gggctgcctg gtcaaggact acttccccga accggtgacg gtgtcgtgga
actcaggcgc 360cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag
tcctcaggac tctactccct 420cagcagcgtg gtgaccgtgc cctccagcag
cttgggcacc cagacctaca tctgcaacgt 480gaatcacaag cccagcaaca
ccaaggtgga caagaaagtt ggtgagaggc cagcacaggg 540agggagggtg
tctgctggaa gccaggctca gcgctcctgc ctggacgcat cccggctatg
600cagccccagt ccagggcagc aaggcaggcc ccgtctgcct cttcacccgg
aggcctctgc 660ccgccccact catgctcagg gagagggtct tctggctttt
tccccaggct ctgggcaggc 720acaggctagg tgcccctaac ccaggccctg
cacacaaagg ggcaggtgct gggctcagac 780ctgccaagag ccatatccgg
gaggaccctg cccctgacct aagcccaccc caaaggccaa 840actctccact
ccctcagctc ggacaccttc tctcctccca gattccagta actcccaatc
900ttctctctgc agagcccaaa tcttgtgaca aaactcacac atgcccaccg
tgcccaggta 960agccagccca ggcctcgccc tccagctcaa ggcgggacag
gtgccctaga gtagcctgca 1020tccagggaca ggccccagcc gggtgctgac
acgtccacct ccatctcttc ctcagcacct 1080gaactcctgg ggggaccgtc
agtcttcctc ttccccccaa aacccaagga caccctcatg 1140atctcccgga
cccctgaggt cacatgcgtg gtggtggacg tgagccacga agaccctgag
1200gtcaagttca actggtacgt ggacggcgtg gaggtgcata atgccaagac
aaagccgcgg 1260gaggagcagt acaacagcac gtaccgtgtg gtcagcgtcc
tcaccgtcct gcaccaggac 1320tggctgaatg gcaaggagta caagtgcaag
gtctccaaca aagccctccc agcccccatc 1380gagaaaacca tctccaaagc
caaaggtggg acccgtgggg tgcgagggcc acatggacag 1440aggccggctc
ggcccaccct ctgccctgag agtgaccgct gtaccaacct ctgtccctac
1500agggcagccc cgagaaccac aggtgtacac cctgccccca tcccgggatg
agctgaccaa 1560gaaccaggtc agcctgacct gcctggtcaa aggcttctat
cccagcgaca tcgccgtgga 1620gtgggagagc aatgggcagc cggagaacaa
ctacaagacc acgcctcccg tgctggactc 1680cgacggctcc ttcttcctct
acagcaagct caccgtggac aagagcaggt ggcagcaggg 1740gaacgtcttc
tcatgctccg tgatgcatga ggctctgcac aaccactaca cgcagaagag
1800cctctccctg tctccgggta aatgagtgcg acggccggca agcccccgct
ccccgggctc 1860tcgcggtcgc acgaggatgc ttggcacgta ccccctgtac
atacttcccg ggcgcccagc 1920atggaaataa agcacccagc gctgccctgg
gcccctgcga gactgtgatg gttctttcca 1980cgggtcaggc cgagtctgag
gcctgagtgg catgagggag gcagagcggg tcccactgtc 2040cccacactgg
cccaggctgt gcaggtgtgc ctgggccccc tagggtgggg ctcagccagg
2100ggctgccctc ggcagggtgg gggatttgcc agcgtggccc tccctccagc
agcacctgcc 2160ctgggctggg ccacgggaag ccctaggagc ccctggggac
agacacacag cccctgcctc 2220tgtaggagac tgtcctgttc tgtgagcgcc
cctgtcctcc cgacctccat gcccactcgg 2280gggcatgcct gcaggtcgac
tctagaggat ccccgggtac cgagctcgaa ttcatcgatg 2340atatcagatc
tgccggtctc cctatagtga gtcgtattaa tttcgataag ccaggttaac
2400ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg
gcgctcttcc 2460gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc
tgcggcgagc ggtatcagct 2520cactcaaagg cggtaatacg gttatccaca
gaatcagggg ataacgcagg aaagaacatg 2580tgagcaaaag gccagcaaaa
ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc 2640cataggctcc
gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga
2700aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct
cgtgcgctct 2760cctgttccga ccctgccgct taccggatac ctgtccgcct
ttctcccttc gggaagcgtg 2820gcgctttctc aatgctcacg ctgtaggtat
ctcagttcgg tgtaggtcgt tcgctccaag 2880ctgggctgtg tgcacgaacc
ccccgttcag cccgaccgct gcgccttatc cggtaactat 2940cgtcttgagt
ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac
3000aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg
gtggcctaac 3060tacggctaca ctagaaggac agtatttggt atctgcgctc
tgctgaagcc agttaccttc 3120ggaaaaagag ttggtagctc ttgatccggc
aaacaaacca ccgctggtag cggtggtttt 3180tttgtttgca agcagcagat
tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc 3240ttttctacgg
ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg
3300agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag
ttttaaatca 3360atctaaagta tatatgagta aacttggtct gacagttacc
aatgcttaat cagtgaggca 3420cctatctcag cgatctgtct atttcgttca
tccatagttg cctgactccc cgtcgtgtag 3480ataactacga tacgggaggg
cttaccatct ggccccagtg ctgcaatgat accgcgagac 3540ccacgctcac
cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc
3600agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg
ccgggaagct 3660agagtaagta gttcgccagt taatagtttg cgcaacgttg
ttgccattgc tacaggcatc 3720gtggtgtcac gctcgtcgtt tggtatggct
tcattcagct ccggttccca acgatcaagg 3780cgagttacat gatcccccat
gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc 3840gttgtcagaa
gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat
3900tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta
ctcaaccaag 3960tcattctgag aatagtgtat gcggcgaccg agttgctctt
gcccggcgtc aatacgggat 4020aataccgcgc cacatagcag aactttaaaa
gtgctcatca ttggaaaacg ttcttcgggg 4080cgaaaactct caaggatctt
accgctgttg agatccagtt cgatgtaacc cactcgtgca 4140cccaactgat
cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga
4200aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat
actcatactc 4260ttcctttttc aatattattg aagcatttat cagggttatt
gtctcatgag cggatacata 4320tttgaatgta tttagaaaaa taaacaaata
ggggttccgc gcacatttcc ccgaaaagtg 4380ccacctgacg tctaagaaac
cattattatc atgacattaa cctataaaaa taggcgtatc 4440acgaggccct
ttcgtctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag
4500ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca
agcccgtcag 4560ggcgcgtcag cgggtgttgg cgggtgtcgg ggctggctta
actatgcggc atcagagcag 4620attgtactga gagtgcacca tatggacata
ttgtcgttag aacgcggcta caattaatac 4680ataaccttat gtatcataca
catacgattt aggtgacact ata 4723414694DNAArtificial
SequenceDescription of Artificial Sequencegamma4 heavy chain
plasmid pG4HE 41gaactcgagc agctgaagct ttctggggca ggccgggcct
gactttggct gggggcaggg 60agggggctaa ggtgacgcag gtggcgccag ccaggtgcac
acccaatgcc catgagccca 120gacactggac cctgcatgga ccatcgcgga
tagacaagaa ccgaggggcc tctgcgccct 180gggcccagct ctgtcccaca
ccgcggtcac atggcaccac ctctcttgca gcttccacca 240agggcccatc
cgtcttcccc ctggcgccct gctccaggag cacctccgag agcacagccg
300ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg
tggaactcag 360gcgccctgac cagcggcgtg cacaccttcc cggctgtcct
acagtcctca ggactctact 420ccctcagcag cgtggtgacc gtgccctcca
gcagcttggg cacgaagacc tacacctgca 480acgtagatca caagcccagc
aacaccaagg tggacaagag agttggtgag aggccagcac 540agggagggag
ggtgtctgct ggaagccagg ctcagccctc ctgcctggac gcaccccggc
600tgtgcagccc cagcccaggg cagcaaggca tgccccatct gtctcctcac
ccggaggcct 660ctgaccaccc cactcatgct cagggagagg gtcttctgga
tttttccacc aggctccggg 720cagccacagg ctggatgccc ctaccccagg
ccctgcgcat acaggggcag gtgctgcgct 780cagacctgcc aagagccata
tccgggagga ccctgcccct gacctaagcc caccccaaag 840gccaaactct
ccactccctc agctcagaca ccttctctcc tcccagatct gagtaactcc
900caatcttctc tctgcagagt ccaaatatgg tcccccatgc ccatcatgcc
caggtaagcc 960aacccaggcc tcgccctcca gctcaaggcg ggacaggtgc
cctagagtag cctgcatcca 1020gggacaggcc ccagccgggt gctgacgcat
ccacctccat ctcttcctca gcacctgagt 1080tcctgggggg accatcagtc
ttcctgttcc ccccaaaacc caaggacact ctcatgatct 1140cccggacccc
tgaggtcacg tgcgtggtgg tggacgtgag ccaggaagac cccgaggtcc
1200agttcaactg gtacgtggat ggcgtggagg tgcataatgc caagacaaag
ccgcgggagg 1260agcagttcaa cagcacgtac cgtgtggtca gcgtcctcac
cgtcctgcac caggactggc 1320tgaacggcaa ggagtacaag tgcaaggtct
ccaacaaagg cctcccgtcc tccatcgaga 1380aaaccatctc caaagccaaa
ggtgggaccc acggggtgcg agggccacat ggacagaggt 1440cagctcggcc
caccctctgc cctgggagtg accgctgtgc caacctctgt ccctacaggg
1500cagccccgag agccacaggt gtacaccctg cccccatccc aggaggagat
gaccaagaac 1560caggtcagcc tgacctgcct ggtcaaaggc ttctacccca
gcgacatcgc cgtggagtgg 1620gagagcaatg ggcagccgga gaacaactac
aagaccacgc ctcccgtgct ggactccgac 1680ggctccttct tcctctacag
caggctaacc gtggacaaga gcaggtggca ggaggggaat 1740gtcttctcat
gctccgtgat gcatgaggct ctgcacaacc actacacaca gaagagcctc
1800tccctgtctc tgggtaaatg agtgccaggg ccggcaagcc cccgctcccc
gggctctcgg 1860ggtcgcgcga ggatgcttgg cacgtacccc gtctacatac
ttcccaggca cccagcatgg 1920aaataaagca cccaccactg ccctgggccc
ctgtgagact gtgatggttc tttccacggg 1980tcaggccgag tctgaggcct
gagtgacatg agggaggcag agcgggtccc actgtcccca 2040cactggccca
ggctgtgcag gtgtgcctgg gccacctagg gtggggctca gccaggggct
2100gccctcggca gggtggggga tttgccagcg tggccctccc tccagcagca
gctgccctgg 2160gctgggccac gggaagccct aggagcccct ggggacagac
acacagcccc tgcctctgta 2220ggagactgtc ctgtcctgtg agcgccctgt
cctccgaccc cccatgccca ctcgggggga 2280tccccgggta ccgagctcga
attcatcgat gatatcagat ctgccggtct ccctatagtg 2340agtcgtatta
atttcgataa gccaggttaa cctgcattaa tgaatcggcc aacgcgcggg
2400gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact
cgctgcgctc 2460ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag
gcggtaatac ggttatccac 2520agaatcaggg gataacgcag gaaagaacat
gtgagcaaaa ggccagcaaa aggccaggaa 2580ccgtaaaaag gccgcgttgc
tggcgttttt ccataggctc cgcccccctg acgagcatca 2640caaaaatcga
cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc
2700gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc
ttaccggata 2760cctgtccgcc tttctccctt cgggaagcgt ggcgctttct
caatgctcac gctgtaggta 2820tctcagttcg gtgtaggtcg ttcgctccaa
gctgggctgt gtgcacgaac cccccgttca 2880gcccgaccgc tgcgccttat
ccggtaacta tcgtcttgag tccaacccgg taagacacga 2940cttatcgcca
ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg
3000tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga
cagtatttgg 3060tatctgcgct ctgctgaagc cagttacctt cggaaaaaga
gttggtagct cttgatccgg 3120caaacaaacc accgctggta gcggtggttt
ttttgtttgc aagcagcaga ttacgcgcag 3180aaaaaaagga tctcaagaag
atcctttgat cttttctacg gggtctgacg ctcagtggaa 3240cgaaaactca
cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat
3300ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt
aaacttggtc 3360tgacagttac caatgcttaa tcagtgaggc acctatctca
gcgatctgtc tatttcgttc 3420atccatagtt gcctgactcc ccgtcgtgta
gataactacg atacgggagg gcttaccatc 3480tggccccagt gctgcaatga
taccgcgaga cccacgctca ccggctccag atttatcagc 3540aataaaccag
ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc
3600catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag
ttaatagttt 3660gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca
cgctcgtcgt ttggtatggc 3720ttcattcagc tccggttccc aacgatcaag
gcgagttaca tgatccccca tgttgtgcaa 3780aaaagcggtt agctccttcg
gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 3840atcactcatg
gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg
3900cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta
tgcggcgacc 3960gagttgctct tgcccggcgt caatacggga taataccgcg
ccacatagca gaactttaaa 4020agtgctcatc attggaaaac gttcttcggg
gcgaaaactc tcaaggatct taccgctgtt 4080gagatccagt tcgatgtaac
ccactcgtgc acccaactga tcttcagcat cttttacttt 4140caccagcgtt
tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag
4200ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt
gaagcattta 4260tcagggttat tgtctcatga gcggatacat atttgaatgt
atttagaaaa ataaacaaat 4320aggggttccg cgcacatttc cccgaaaagt
gccacctgac gtctaagaaa ccattattat 4380catgacatta acctataaaa
ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg 4440tgatgacggt
gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta
4500agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg
gcgggtgtcg 4560gggctggctt aactatgcgg catcagagca gattgtactg
agagtgcacc atatggacat 4620attgtcgtta gaacgcggct acaattaata
cataacctta tgtatcatac acatacgatt 4680taggtgacac tata 4694
* * * * *