U.S. patent application number 16/192661 was filed with the patent office on 2019-04-18 for treatment of primary ciliary dyskinesia with synthetic messenger rna.
The applicant listed for this patent is TranscripTx, Inc.. Invention is credited to Mirko Hennig, Daniella Ishimaru, David J. Lockhart, Brandon Wustman.
Application Number | 20190111074 16/192661 |
Document ID | / |
Family ID | 60411943 |
Filed Date | 2019-04-18 |
![](/patent/app/20190111074/US20190111074A1-20190418-C00001.png)
![](/patent/app/20190111074/US20190111074A1-20190418-C00002.png)
![](/patent/app/20190111074/US20190111074A1-20190418-C00003.png)
![](/patent/app/20190111074/US20190111074A1-20190418-C00004.png)
![](/patent/app/20190111074/US20190111074A1-20190418-D00000.png)
![](/patent/app/20190111074/US20190111074A1-20190418-D00001.png)
![](/patent/app/20190111074/US20190111074A1-20190418-D00002.png)
![](/patent/app/20190111074/US20190111074A1-20190418-D00003.png)
![](/patent/app/20190111074/US20190111074A1-20190418-D00004.png)
![](/patent/app/20190111074/US20190111074A1-20190418-D00005.png)
![](/patent/app/20190111074/US20190111074A1-20190418-D00006.png)
View All Diagrams
United States Patent
Application |
20190111074 |
Kind Code |
A1 |
Lockhart; David J. ; et
al. |
April 18, 2019 |
TREATMENT OF PRIMARY CILIARY DYSKINESIA WITH SYNTHETIC MESSENGER
RNA
Abstract
Polynucleotides encoding peptides, proteins, enzymes, and
functional fragments thereof are disclosed. The polynucleotides of
the disclosure can be effectively delivered to an organ, such as
the lung, and expressed within cells of the organ. The
polyribonucleotides of the disclosure can be used to treat a
disease or condition associated with cilia maintenance and
function, impaired function of the axoneme, such as DNAI1 or
DNAH5.
Inventors: |
Lockhart; David J.; (Emerald
Hills, CA) ; Wustman; Brandon; (San Diego, CA)
; Hennig; Mirko; (Sunnyvale, CA) ; Ishimaru;
Daniella; (Sunnyvale, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
TranscripTx, Inc. |
Sunnyvale |
CA |
US |
|
|
Family ID: |
60411943 |
Appl. No.: |
16/192661 |
Filed: |
November 15, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/US2017/034723 |
May 26, 2017 |
|
|
|
16192661 |
|
|
|
|
62342784 |
May 27, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 48/0041 20130101;
A61K 48/005 20130101; A61K 31/7105 20130101; A61K 31/7115 20130101;
C12N 15/113 20130101; A61K 9/1271 20130101; A61P 11/00 20180101;
A61P 11/06 20180101; A61K 47/6925 20170801 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; A61P 11/06 20060101 A61P011/06; C12N 15/113 20060101
C12N015/113; A61K 9/127 20060101 A61K009/127; A61K 31/7115 20060101
A61K031/7115 |
Claims
1. A method comprising administering to a subject a
therapeutically-effective amount of a polynucleotide that is at
least 70% homologous to nucleic acids 1-1,000 of SEQ ID NO: 15,
which polynucleotide includes codons that provide for heterologous
or enhanced expression of the dynein axonemal intermediate chain 1
protein within ciliated cells of a subject having or at risk of
having primary ciliary dyskinesia.
2. The method of claim 1, wherein said subject is a human.
3. The method of claim 1, wherein said ciliated cells are ciliated
epithelial cells.
4. The method of claim 3, wherein said ciliated epithelial cells
are ciliated airway epithelial cells.
5. The method of claim 3, wherein said ciliated epithelial cells
are undifferentiated.
6. The method of claim 3, wherein said ciliated epithelial cells
are differentiated.
7. The method of claim 1, wherein said subject is a human.
8. The method of claim 1, wherein said polynucleotide is at least
80% homologous to nucleic acids 1-1,000 of SEQ ID NO: 15.
9. The method of claim 1, wherein said polynucleotide is an
mRNA.
10. The method of claim 1, wherein fewer than 15% of nucleotides
within said polynucleotide are nucleotide analogues.
11. The method of claim 1, wherein substantially all nucleotides
replacing uracil within said polynucleotide are nucleotide
analogues.
12. The method of claim 1, wherein said polynucleotide comprises
1-methylpseudouridine.
13. The method of claim 1, wherein said polynucleotide is
formulated for administration to said subject in a formulation
comprising a cationic lipid, a fusogenic lipid, a cholesterol and a
polyethylene glycol (PEG) lipid.
14. The method of claim 1, wherein said polynucleotide is
formulated for administration to said subject in a formulation
using a cationic lipid or a cationic polymer.
15. The method of claim 1, wherein said polynucleotide is
formulated for administration to said subject in a formulation
using a nanoparticle or nanocapsule.
16. The method of claim 1, wherein said polynucleotide further
comprises a 3' or 5' noncoding region, wherein said 3' or 5'
noncoding region enhances the expression of said dynein axonemal
intermediate chain 1 polypeptide within cells of said subject.
17. The method of claim 16, wherein said polynucleotide further
comprises a 5' cap structure.
18. The method of claim 16, wherein said 3' noncoding region
comprises a poly adenosine tail.
19. The method of claim 18, wherein said poly adenosine tail
improves the half-life of said dynein axonemal intermediate chain 1
polypeptide.
20. The method of claim 18, wherein a length of said poly adenosine
tail is at most 200 adenosines.
Description
CROSS-REFERENCE
[0001] This application is a continuation of International
Application No. PCT/US2017/034723, filed May 26, 2017, which claims
priority to U.S. Provisional Patent Application Ser. No.
62/342,784, filed on May 27, 2016, which are incorporated herein by
reference in their entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Nov. 15, 2018, is named 47784_712_302_SL.txt and is 51,062 bytes
in size.
BACKGROUND
[0003] Messenger RNAs (mRNA) are polymers containing a number of
linked nucleotides, each composed of a sugar, a phosphate, and a
base. Each mRNA polymer stores genetic information along the
nucleotide chain. Messenger RNA polymers carry the genetic
information from the DNA in the nucleus of the cell to the
cytoplasm where proteins are made. Each triplet of nucleotides in
the mRNA is called a codon, and each codon specifies the identity
of an amino acid in the translated protein.
[0004] A cell can also take up and translate an exogenous RNA, but
many factors influence efficient uptake and translation. For
instance, the immune system recognizes many exogenous RNAs as
foreign and triggers a response that is aimed at inactivating the
RNAs.
SUMMARY
[0005] The present disclosure provides polyribonucleotides, and
compositions comprising the same, that can encode a protein of
choice. In some cases, the disclosure provides a method for
treating a subject having or at risk of having primary ciliary
dyskinesia, the method comprising administrating to the subject a
composition that comprises a nucleic acid construct that encodes
dynein axonemal intermediate chain 1 protein or a variant thereof,
which nucleic acid construct includes codons that provide for
heterologous or enhanced expression of the dynein axonemal
intermediate chain 1 protein or a variant thereof within cells of
the subject, thereby treating the subject having or at risk of
having primary ciliary dyskinesia. The nucleic acid construct can
be, for example a complementary deoxyribonucleic acid DNA template.
The nucleic acid construct may encode dynein axonemal intermediate
chain 1 protein or a variant thereof at a level that is increased
by a factor of at least about 1.5, at least about 5, or another
suitable amount as compared to levels within cells exposed to a
composition comprising a nucleic acid construct that does not
include the codons encoding dynein axonemal intermediate chain 1
protein or a variant thereof. In some instances, the codons of the
construct are at least 70% homologous to a mammalian, such as a
human, dynein axonemal intermediate chain 1 mRNA.
[0006] In some cases, the construct comprises a 5' and/or 3'
untranslated region (UTR) flanking the codon sequence which encodes
the dynein axonemal intermediate chain 1, wherein the untranslated
region(s) enhance(s) the expression of the protein within cells of
the subject. The 3' noncoding region may comprise a 3'-cap
independent translation enhancer (3'-CITEs). In some instances, the
3' noncoding region may also comprise at least one intermediate
sequence region between the codon sequence and either the 3'
noncoding region or the 5' noncoding region or a 3'-stem loop
region derived from the nucleotide sequence of a histone protein.
In some cases, the codon sequence comprises an open reading frame
(ORF). The 3' noncoding region flanking the codon sequence (e.g.,
ORF) may comprise a poly adenosine tail, wherein the number of
adenosines in the poly adenosine tail improves the translation
efficiency and increases the half-life of the dynein axonemal
intermediate chain 1 mRNA. In some cases, the length of the poly
adenosine tail is at most 200 adenosines. The poly adenosine tail
may comprise a percentage of chemically modified nucleotides. In
some instances, fewer than 20% of the nucleotides in the poly
adenosine tail are chemically modified. In some instances, fewer
than 30% of the nucleotides encoding dynein axonemal intermediate
chain 1 in a construct are chemically modified nucleotides. In the
instances where the nucleotides comprise a chemically modified
nucleotide, the chemically modified nucleotide can be selected from
the group consisting of pseudouridine, 1-methylpseudouridine,
2-thiouridine, 5-iodouridine, 5-methyluridine, 5-methylcytidine,
and 5-iodocytidine. In some cases, the chemically modified
nucleotide is 1-methylpseudouridine. In some cases, the modified
nucleotide is pseudouridine. In other cases, the modified
nucleotides are a combination of 1-methylpseudouridine and
pseudouridine. In addition to the composition comprising a
polyribonucleotide for treating a subject having or at risk of
having primary ciliary dyskinesia, in some cases, the present
disclosure further provides a composition comprising at least one
additional nucleic acid construct that encodes a protein selected
from the group consisting of: armadillo repeat containing 4
(ARMC4), chromosome 21 open reading frame 59 (C21orf59),
coiled-coil domain containing 103 (CCDC103), coiled-coil domain
containing 114 (CCDC114), coiled-coil domain containing 39
(CCDC39), coiled-coil domain containing 40 (CCDC40), coiled-coil
domain containing 65 (CCDC65), cyclin O (CCNO), dynein (axonemal)
assembly factor 1 (DNAAF1), dynein (axonemal) assembly factor 2
(DNAAF2), dynein (axonemal) assembly factor 3 (DNAAF3), dynein
(axonemal) assembly factor 5 (DNAAF5), dynein axonemal heavy chain
11 (DNAH11), dynein axonemal heavy chain 5 (DNAH5), dynein axonemal
heavy chain 6 (DNAH6), dynein axonemal heavy chain 8 (DNAH8),
dynein axonemal intermediate chain 2 (DNAI2), dynein axonemal light
chain 1 (DNAL1), dynein regulatory complex subunit 1 (DRC1),
dyslexia susceptibility 1 candidate 1 (DYX1C1), growth arrest
specific 8 (GASB), axonemal central pair apparatus protein (HYDIN),
leucine rich repeat containing 6 (LRRC6), NME/NM23 family member 8
(NME8), oral-facial-digital syndrome 1 (OFD1), retinitis pigmentosa
GTPase regulator (RPGR), radial spoke head 1 homolog
(Chlamydomonas) (RSPH1), radial spoke head 4 homolog A
(Chlamydomonas) (RSPH4A), radial spoke head 9 homolog
(Chlamydomonas) (RSPH9), sperm associated antigen 1 (SPAG1), and
zinc finger MYND-type containing 10 (ZMYND10).
[0007] The disclosure provides a composition comprising a nucleic
acid construct encoding dynein axonemal intermediate chain 1, which
nucleic acid construct includes codons that provide for
heterologous or enhanced expression of the dynein axonemal
intermediate chain 1 protein or a variant thereof within cells of a
subject having or at risk of having primary ciliary dyskinesia. The
compositions described herein may comprise a ratio of moles of
amine groups of cationic polymers to moles of phosphate groups of
the modified polyribonucleotide of at least about 4. In some cases,
the composition is formulated in a nanoparticle or nanocapsule. In
other cases, the composition is formulated in a cationic lipid,
cationic polymer, or nanoemulsion. The composition may be
formulated for administration to a subject. The nucleic acid
constructs in the composition may include codons that provide for
heterologous or enhanced expression of the dynein axonemal
intermediate chain 1 protein or a variant thereof within cells of a
subject having or at risk of having primary ciliary dyskinesia. In
some cases, fewer than 30% of the ribonucleotides encoding dynein
axonemal intermediate chain 1 are chemically modified nucleotides.
In some instances, the codons of the construct are at least 70%
homologous to a mammalian, such as a human, dynein axonemal
intermediate chain 1 mRNA. In some cases, the construct comprises a
5' or 3' noncoding region flanking the codon sequence which encodes
the dynein axonemal intermediate chain 1, wherein the noncoding
region enhances the expression of the protein within cells the
subject. In other cases, the construct comprises a 3' noncoding
region flanking the codon sequence which encodes the dynein
axonemal intermediate chain 1, wherein the 3' noncoding region
comprises a 3'-cap independent translation enhancer (3'-CITEs). The
3' noncoding region may comprise a 3'-stem loop region derived from
the nucleotide sequence of a histone protein. The 3' noncoding
region may comprise a 3'-triple helical structure derived from the
nucleotide sequence of metastasis-associated lung adenocarcinoma
transcript 1 (MALAT1). The 3' noncoding region flanking the codon
sequence may comprise a poly adenosine tail, wherein the number of
adenosines in the poly adenosine tail improves the translation
efficiency of the dynein axonemal intermediate chain 1 protein. In
some cases, the number of adenosines in the poly adenosine tail
improves the half-life of the dynein axonemal intermediate chain 1
protein. In some cases, the length of the poly adenosine tail is at
most 200 adenosines. In some instances, a percentage of the poly
adenosine tail comprises modified nucleotides. In some instances,
fewer than 20% of the adenosines in the poly(A)tail are modified.
In some cases, the construct comprises a percentage of chemically
modified nucleotides. In some instances, fewer than 30% of the
nucleotides encoding dynein axonemal intermediate chain 1 are
chemically modified. When chemically modified nucleotides are
present, they may be selected from the group consisting of
pseudouridine, 1-methylpseudouridine, 5-methoxyuridine,
2-thiouridine, 5-iodouridine, 5-methyluridine, 5-methylcytidine,
2''-amino-2''-deoxycytidine, 2''-fluoro-2''-deoxycytidine, and
5-iodocytidine. In some cases, the chemically modified nucleotide
is pseudouridine or 1-methyl pseudouridine. In some instances, the
composition further comprises at least one additional nucleic acid
construct. The at least one additional nucleic acid construct
encodes a protein selected from the group consisting of: armadillo
repeat containing 4 (ARMC4), chromosome 21 open reading frame 59
(C21orf59), coiled-coil domain containing 103 (CCDC103),
coiled-coil domain containing 114 (CCDC114), coiled-coil domain
containing 39 (CCDC39), coiled-coil domain containing 40 (CCDC40),
coiled-coil domain containing 65 (CCDC65), cyclin O (CCNO), dynein
(axonemal) assembly factor 1 (DNAAF1), dynein (axonemal) assembly
factor 2 (DNAAF2), dynein (axonemal) assembly factor 3 (DNAAF3),
dynein (axonemal) assembly factor 5 (DNAAF5), dynein axonemal heavy
chain 11 (DNAH11), dynein axonemal heavy chain 5 (DNAH5), dynein
axonemal heavy chain 6 (DNAH6), dynein axonemal heavy chain 8
(DNAH8), dynein axonemal intermediate chain 2 (DNAI2), dynein
axonemal light chain 1 (DNAL1), dynein regulatory complex subunit 1
(DRC1), dyslexia susceptibility 1 candidate 1 (DYX1C1), growth
arrest specific 8 (GASB), axonemal central pair apparatus protein
(HYDIN), leucine rich repeat containing 6 (LRRC6), NME/NM23 family
member 8 (NME8), oral-facial-digital syndrome 1 (OFD1), retinitis
pigmentosa GTPase regulator (RPGR), radial spoke head 1 homolog
(Chlamydomonas) (RSPH1), radial spoke head 4 homolog A
(Chlamydomonas) (RSPH4A), radial spoke head 9 homolog
(Chlamydomonas) (RSPH9), sperm associated antigen 1(SPAG1), and
zinc finger MYND-type containing 10 (ZMYND10).
[0008] The present disclosure also provides a nucleic acid
construct, a vector, or an isolated nucleic acid that is/are
formulated for administration to a subject. In some cases, the
formulation includes a therapeutically effective amount of the
nucleic acid construct encoding dynein axonemal intermediate chain
1. The nucleic acid construct can be a cDNA construct that encodes
dynein axonemal intermediate chain 1 protein or a variant thereof,
or any one of the aforementioned additional nucleic acid
constructs. In some cases, the present disclosure provides a
composition comprising a nucleic acid construct encoding dynein
axonemal intermediate chain 1, wherein the nucleic acid construct
comprises any one of SEQ ID NOs 14-16. In some cases, the present
disclosure provides a composition comprising a nucleic acid
construct encoding dynein axonemal heavy chain 5, wherein the
nucleic acid construct comprises any one of SEQ ID NOs 17-18.
[0009] Additional aspects and advantages of the present disclosure
will become readily apparent to those skilled in this art from the
following detailed description, wherein only illustrative
embodiments of the present disclosure are shown and described. As
will be realized, the present disclosure is capable of other and
different embodiments, and its several details are capable of
modifications in various obvious respects, all without departing
from the disclosure. Accordingly, the drawings and description are
to be regarded as illustrative in nature, and not as
restrictive.
INCORPORATION BY REFERENCE
[0010] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings of which:
[0012] FIG. 1 is an agarose gel illustrating the production of
capped and uncapped DNAI1 RNA.
[0013] FIG. 2 is a western blot illustrating the translations of
DNAI1 mRNA in HEK-293 cells at 6 hours, 24 hours, and 48 hours
post-transfection.
[0014] FIG. 3 illustrates fragment analyzer data of a
posttranscriptionally poly-adenylated RNA transcript encoding
dynein axonemal intermediate chain 1 (DNAI1).
[0015] FIG. 4 illustrates fragment analyzer data of a
posttranscriptionally poly-adenylated RNA transcript encoding
dynein axonemal intermediate chain 1 (DNAI1).
[0016] FIG. 5 illustrates PAGE data of the size of poly adenylated
tail of the plasmid encoding dynein axonemal intermediate chain 1
(DNAI1).
[0017] FIG. 6 illustrates the fragment analyzer data of an in vitro
transcribed DNAI1 mRNA comprising the unmodified nucleotides.
[0018] FIG. 7 illustrates fragment analyzer data of an in vitro
transcribed DNAI1 mRNA comprising 50% pseudouridine (.PSI.).
[0019] FIG. 8 illustrates fragment analyzer data of an in vitro
transcribed DNAI1 mRNA comprising 100% pseudouridine (.PSI.).
[0020] FIG. 9 illustrates fragment analyzer data of an in vitro
transcribed DNAI1 mRNA comprising 100% 1-methylpseudouridine that
was post-transcriptionally poly adenylated.
[0021] FIG. 10 illustrates double-stranded RNA content as detected
by dot-blot.
[0022] FIG. 11 illustrates the HPLC-based nucleotide composition
analysis of an in vitro transcribed nucleic acid construct that
encodes dynein axonemal intermediate chain 1, transcribed with
unmodified nucleotides.
[0023] FIG. 12 illustrates the HPLC-based nucleotide composition
analysis of an in vitro transcribed nucleic acid construct that
encodes dynein axonemal intermediate chain 1, transcribed with 50%
.PSI..
[0024] FIG. 13 illustrates the HPLC-based nucleotide composition
analysis of an in vitro transcribed nucleic acid construct that
encodes dynein axonemal intermediate chain 1, transcribed with 100%
.PSI..
[0025] FIG. 14 is a graph illustrating the relative expression
levels of DNAI1 protein in HEK-293, A549, and MLE-15 cells.
[0026] FIG. 15 illustrates the induction of IL-6 in A549 cells
transfected with the DNAI1 mRNA variants.
[0027] FIG. 16 illustrates the induction of IL-6 in A549 cells
transfected with the DNAI1 mRNA variants.
[0028] FIG. 17 is a graph illustrating the relative expression of
DNAI1 protein in HEK-293, A549, and MLE-15 cells.
[0029] FIG. 18 illustrates induction of IL-6 in A549 cells by DNAI1
transcripts.
[0030] FIG. 19 illustrates induction of IL-6 in A549 cells by DNAI1
transcripts.
[0031] FIG. 20 illustrates cell viability of A549 cells after
transfection with various amounts of each DNAI1 mRNA measured using
the CellTiter-Glo assay.
[0032] FIG. 21 illustrates cell viability of A549 cells after
transfection with various amounts of each DNAI1 mRNA measured using
the CellTiter-Glo assay.
[0033] FIG. 22 illustrates induction of IP-10 in HepG2 cells by
DNAI1 transcripts.
[0034] FIG. 23 illustrates cell viability of HepG2 cells after
transfection with various amounts of each DNAI1 mRNA measured using
the CellTiter-Glo assay.
[0035] FIG. 24 illustrates the peak expression of dynein axonemal
intermediate chain 1 (DNAI1) protein or other controls in HEK-293
cells.
[0036] FIG. 25 expression of DNAI1 in fully differentiated human
airway epithelial cells.
[0037] FIGS. 26A-26B illustrate an overall quality improvement in
DNAI1 expressing a polyribonucleotide of SEQ ID NO 15 (B) as
compared to a polyribonucleotide of SEQ ID NO 14 (A).
[0038] FIG. 27 illustrates an overall improvement in translation
efficiency in A549 cells of a polyribonucleotide of SEQ ID NO 15
(B) as compared to a polyribonucleotide of SEQ ID NO 14 (A).
[0039] FIG. 28 illustrates an analysis of double-stranded RNA
content of a polyribonucleotide of SEQ ID NO 15 as compared to
known concentrations of known concentrations of poly-IC.
[0040] FIGS. 29A-29D illustrate HPLC-purification of unmodified and
100% m.sup.1.PSI.-containing DNAI1 mRNA.
[0041] FIGS. 30A-30E illustrate example translation activity and
immunogenicity for fractions enriched in full-length, unmodified
mRNA transcripts in A549 cells using HPLC-purification.
DETAILED DESCRIPTION
[0042] While various embodiments of the invention have been shown
and described herein, it will be obvious to those skilled in the
art that such embodiments are provided by way of example only.
Numerous variations, changes, and substitutions may occur to those
skilled in the art without departing from the invention. It should
be understood that various alternatives to the embodiments of the
invention described herein may be employed.
[0043] The term "subject," as used herein generally refers to a
human. In some instances, a subject can also be an animal, such as
a mouse, a rat, a guinea pig, a dog, a cat, a horse, a rabbit, and
various other animals. A subject can be of any age, for example, a
subject can be an infant, a toddler, a child, a pre-adolescent, an
adolescent, an adult, or an elderly individual.
[0044] The term "disease," as used herein, generally refers to an
abnormal physiological condition that affects part or all of a
subject, such as an illness (e.g., primary ciliary dyskinesia) or
another abnormality that causes defects in the action of cilia in,
for example, the lining the respiratory tract (lower and upper,
sinuses, Eustachian tube, middle ear), in a variety of lung cells,
in the fallopian tube, or flagella of sperm cells.
[0045] The term "polynucleotide" or "nucleic acid" as used herein
refers to a polymeric form of nucleotides of any length, either
ribonucleotides or deoxyribonucleotides, that comprise purine and
pyrimidine bases, purine and pyrimidine analogues, chemically or
biochemically modified, natural or non-natural, or derivatized
nucleotide bases. Polynucleotides include sequences of
deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or DNA copies
of ribonucleic acid (cDNA), all of which can be recombinantly
produced, artificially synthesized, or isolated and purified from
natural sources. The polynucleotides and nucleic acids may exist as
single-stranded or double-stranded. The backbone of the
polynucleotide can comprise sugars and phosphate groups, as may
typically be found in RNA or DNA, or analogues or substituted sugar
or phosphate groups. A polynucleotide may comprise naturally
occurring or non-naturally occurring nucleotides, such as
methylated nucleotides and nucleotide analogues (or analogs).
[0046] The term "polyribonucleotide," as used herein, generally
refers to polynucleotide polymers that comprise ribonucleic acids.
The term also refers to polynucleotide polymers that comprise
chemically modified ribonucleotides. A polyribonucleotide can be
formed of D-ribose sugars, which can be found in nature.
[0047] The term "polypeptides," as used herein, generally refers to
polymer chains comprised of amino acid residue monomers which are
joined together through amide bonds (peptide bonds). A polypeptide
can be a chain of at least three amino acids, a protein, a
recombinant protein, an antigen, an epitope, an enzyme, a receptor,
or a structure analogue or combinations thereof. As used herein,
the abbreviations for the L-enantiomeric amino acids that form a
polypeptide are as follows: alanine (A, Ala); arginine (R, Arg);
asparagine (N, Asn); aspartic acid (D, Asp); cysteine (C, Cys);
glutamic acid (E, Glu); glutamine (Q, Gln); glycine (G, Gly);
histidine (H, His); isoleucine (I, Ile); leucine (L, Leu); lysine
(K, Lys); methionine (M, Met); phenylalanine (F, Phe); proline (P,
Pro); serine (S, Ser); threonine (T, Thr); tryptophan (W, Trp);
tyrosine (Y, Tyr); valine (V, Val). X or Xaa can indicate any amino
acid.
[0048] The term "engineered," as used herein, generally refers to
polynucleotides, vectors, and nucleic acid constructs that have
been genetically designed and manipulated to provide a
polynucleotide intracellularly. An engineered polynucleotide can be
partially or fully synthesized in vitro. An engineered
polynucleotide can also be cloned. An engineered polyribonucleotide
can contain one or more base or sugar analogues, such as
ribonucleotides not naturally-found in messenger RNAs. An
engineered polyribonucleotide can contain nucleotide analogues that
exist in transfer RNAs (tRNAs), ribosomal RNAs (rRNAs), guide RNAs
(gRNAs), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA),
SmY RNA, spliced leader RNA (SL RNA), CRISPR RNA, long noncoding
RNA (lncRNA), microRNA (miRNA), or another suitable RNA.
OVERVIEW
[0049] The present disclosure provides compositions and methods for
the treatment of conditions associated with cilia maintenance and
function, with nucleic acids encoding a protein or protein
fragment(s). Numerous eukaryotic cells carry appendages, which are
often referred to as cilia or flagella, whose inner core comprises
a cytoskeletal structure called the axoneme. The axoneme can
function as the skeleton of cellular cytoskeletal structures, both
giving support to the structure and, in some instances, causing it
to bend. Usually, the internal structure of the axoneme is common
to both cilia and flagella. Cilia are often found in the linings of
the airway, the reproductive system, and other organs and tissues.
Flagella are tail-like structures that, similarly to cilia, can
propel cells forward, such as sperm cells.
[0050] Without properly functioning cilia in the airway, bacteria
can remain in the respiratory tract and cause infection. In the
respiratory tract, cilia move back and forth in a coordinated way
to move mucus towards the throat. This movement of mucus helps to
eliminate fluid, bacteria, and particles from the lungs. Many
infants afflicted with cilia and flagella malfunction experience
breathing problems at birth, which suggests that cilia play an
important role in clearing fetal fluid from the lungs. Beginning in
early childhood, subjects afflicted with cilia malfunction can
develop frequent respiratory tract infections.
[0051] Primary ciliary dyskinesia is a condition characterized by
chronic respiratory tract infections, abnormally positioned
internal organs, and the inability to have children (infertility).
The signs and symptoms of this condition are caused by abnormal
cilia and flagella. Subjects afflicted with primary ciliary
dyskinesia often have year-round nasal congestion and a chronic
cough. Chronic respiratory tract infections can result in a
condition called bronchiectasis, which damages the passages, called
bronchi, leading from the windpipe to the lungs and can cause
life-threatening breathing problems.
[0052] In some instances, a nucleic acid construct, vector, or
composition of the disclosure comprises one or more nucleotide
sequences that encode dynein axonemal intermediate chain 1 protein
or a variant thereof, and the sequences provide for heterologous or
enhanced expression of the dynein axonemal intermediate chain 1
protein or a variant thereof within cells of a subject. In some
instances, the nucleic acid construct, vector, or composition also
comprises the genetic code of 5' untranslated regions (UTRs) and 3'
UTRs of SEQ ID NOs 1-9, as shown below.
TABLE-US-00001 TABLE 1 UTR DNA sequence (from 5' to 3')
.alpha.-globin 5'
GGGAGACATAAACCCTGGCGCGCTCGCGGCCCGGCACTCTTCTGGTCCCC UTR
ACAGACTCAGAGAGAAGCCACC (SEQ ID NO: 1) (HBA1) .alpha.-globin 5'
GGGAGACATAAACCCTGGCGCGCTCGCGGGCCGGCACTCTTCTGGTCCCC UTR
ACAGACTCAGAGAGAAGCCACC (SEQ ID NO: 2) (HBA2) .alpha.-globin 5'
GGGAGACTCTTCTGGTCCCCACAGACTCAGAGAGAACGCCACC UTR (SEQ ID NO: 3) IRES
of GTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACC EMCV 5'-
TGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAA UTR
AGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAG
CTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAAC
CCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGA
TACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAG
TTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTG
AAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCG
GTGCACATGCTTTACGTGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCC
CCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATG GCCACAACC (SEQ
ID NO: 4) IRES of AAATAACAAATCTCAACACAACATATACAAAACAAACGAATCTCAAGCA
TEV 5'- ATCAAGCATTCTACTTCTATTGCAGCAATTTAAATCATTTCTTTTAAAGCA UTR
AAAGCAATTTTCTGAAAATTTTCACCATTTACGAACGATAGCA (SEQ ID NO: 5) ssRNA1
GGGAGACAAGAGAGAAAAGAAGAGCAAGAAGAAATATAAGAGCCACC 5'UTR (SEQ ID NO:
6) ssRNA2 GGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGCAATCCGGTAC 5'UTR
TGTTGGTAAAGCCACC (SEQ ID NO: 7) ssRNA 3 +
GGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTTCCTTTCCGGGCC native 5'
GGCTGGGCGCGCCGAAGCGCCTGCGCCTTGGCTGCTGGTCGGTTGCTGGG UTR
TAACCGCGTCAGGGAGTTGGATTCTATCCTGCAAGGGCACGGGGACCCAC
AACGACGGCTGTCCCTAAAGAACCGTTGCGACTGGTAACTGAAGTGGAA
GAGAGTCCAGATTTCTTGTGTGTGGTCAAGGAGACGGACAAACTTTTTGT
CTTCAGACGAGGGAGCGTTTTGTAGGCTCTCCAGGGGTTGAG (SEQ ID NO: 8) TMV 3'-
GGATTGTGTCCGTAATCACACGTGGTGCGTACGATAACGCATAGTGTTTT UTR
TCCCTCCACTTAAATCGAAGGGTTGTGTCTTGGATCGCGCGGGTCAAATG
TATATGGTTCATATACATCCGCAGGCACGTAATAAAGCGAGGGGTTCGAA
TCCCCCCGTTACCCCCGGTAGGGGCCCATTGTCTTC (SEQ ID NO: 9) MALAT1
TCAGTAGGGTCATGAAGGTTTTTCTTTTCCTGAGAAAACAACACGTATTGT 3'-UTR
TTTCTCAGGTTTTGCTTTTTGGCCTTTTTCTAGCTTAAAAAAAAAAAAAGC AAAATTGTCTTC
(SEQ ID NO: 10) NEAT2 3'-
TCAGTAGGGTTGTAAAGGTTTTTCTTTTCCTGAGAAAACAACCTTTTGTTT UTR
TCTCAGGTTTTGCTTTTTGGCCTTTCCCTAGCTTTAAAAAAAAAAAAGCAA AATTGTCTTC (SEQ
ID NO: 11) histone
GAAGTGGCGGTTCGGCCGGAGGTTCCATCGTATCCAAAAGGCTCTTTTCA cluster 2,
GAGCCACCCATTGTCTTC (SEQ ID NO: 12) H3c 3'-UTR Native 3'
GGGGCTGGCCTCAGTCTCTGTCCCATCGCTTGAATACAGTACTCCTAGGG UTR
CTTGACCCTGGTACCCAGCCCAGCCTTAGCACCCAGCATGTGACCCCACT
CCTGATCAGGTCCCAGCATCTTCCCTTCTTGTTCTGTTCCTTAAGGTCCCA
GCACCTTACCCCAGGACTTGGTCTTCAACCACCATTACCCCTCTAACTTTG
CACAAATAAACCTGTGTAGAAACCCACCCCAAAAAAA (SEQ ID NO: 13)
Primary Ciliary Dyskinesia, Related Conditions and Treatments
Thereof
[0053] The methods, constructs, and compositions of this disclosure
provide a method to treat primary ciliary dyskinesia (PCD), also
known as immotile ciliary syndrome or Kartagener syndrome. PCD is
typically considered to be a rare, ciliopathic, autosomal recessive
genetic disorder that often causes defects in the action of cilia
lining the respiratory tract (lower and upper, sinuses, Eustachian
tube, middle ear) and fallopian tube, as well as in the flagella of
sperm cells.
[0054] Some individuals with primary ciliary dyskinesia have
abnormally placed organs within their chest and abdomen. These
abnormalities arise early in embryonic development when the
differences between the left and right sides of the body are
established. About 50 percent of people with primary ciliary
dyskinesia have a mirror-image reversal of their internal organs
(situs inversus totalis). For example, in these individuals the
heart is on the right side of the body instead of on the left. When
someone afflicted with primary ciliary dyskinesia has situs
inversus totalis, they are often said to have Kartagener
syndrome.
[0055] Approximately 12 percent of people with primary ciliary
dyskinesia have a condition known as heterotaxy syndrome or situs
ambiguus, which is characterized by abnormalities of the heart,
liver, intestines, or spleen. These organs may be structurally
abnormal or improperly positioned. In addition, affected
individuals may lack a spleen (asplenia) or have multiple spleens
(polysplenia). Heterotaxy syndrome results from problems
establishing the left and right sides of the body during embryonic
development. The severity of heterotaxy varies widely among
affected individuals.
[0056] Primary ciliary dyskinesia can also lead to infertility.
Vigorous movements of the flagella are can be needed to propel the
sperm cells forward to the female egg cell. Because the sperm of
subjects afflicted with primary ciliary dyskinesia does not move
properly, males with primary ciliary dyskinesia are usually unable
to father children. Infertility occurs in some affected females and
it is usually associated with abnormal cilia in the fallopian
tubes.
[0057] Another feature of primary ciliary dyskinesia is recurrent
ear infections (otitis media), especially in young children. Otitis
media can lead to permanent hearing loss if untreated. The ear
infections are likely related to abnormal cilia within the inner
ear.
[0058] Rarely, individuals with primary ciliary dyskinesia have an
accumulation of fluid in the brain (hydrocephalus), likely due to
abnormal cilia in the brain.
[0059] The polyribonucleotides of the disclosure can be used, for
example, to treat a subject having or at risk of having primary
ciliary dyskinesia or any other condition associated with a defect
or malfunction of a gene whose function is linked to cilia
maintenance and function. Non limiting examples of genes that have
been associated with primary ciliary dyskinesia include: armadillo
repeat containing 4 (ARMC4), chromosome 21 open reading frame 59
(C21orf59), coiled-coil domain containing 103 (CCDC103),
coiled-coil domain containing 114 (CCDC114), coiled-coil domain
containing 39 (CCDC39), coiled-coil domain containing 40 (CCDC40),
coiled-coil domain containing 65 (CCDC65), cyclin O (CCNO), dynein
(axonemal) assembly factor 1 (DNAAF1), dynein (axonemal) assembly
factor 2 (DNAAF2), dynein (axonemal) assembly factor 3 (DNAAF3),
dynein (axonemal) assembly factor 5 (DNAAF5), dynein axonemal heavy
chain 11 (DNAH11), dynein axonemal heavy chain 5 (DNAH5), dynein
axonemal heavy chain 6 (DNAH6), dynein axonemal heavy chain 8
(DNAH8), dynein axonemal intermediate chain 2 (DNAI2), dynein
axonemal light chain 1 (DNAL1), dynein regulatory complex subunit 1
(DRC1), dyslexia susceptibility 1 candidate 1 (DYX1C1), growth
arrest specific 8 (GASB), axonemal central pair apparatus protein
(HYDIN), leucine rich repeat containing 6 (LRRC6), NME/NM23 family
member 8 (NME8), oral-facial-digital syndrome 1 (OFD1), retinitis
pigmentosa GTPase regulator (RPGR), radial spoke head 1 homolog
(Chlamydomonas) (RSPH1), radial spoke head 4 homolog A
(Chlamydomonas) (RSPH4A), radial spoke head 9 homolog
(Chlamydomonas) (RSPH9), sperm associated antigen 1(SPAG1), and
zinc finger MYND-type containing 10 (ZMYND10).
[0060] In some cases, the composition comprises a nucleic acid
construct encoding dynein axonemal intermediate chain 1 (DNAI1),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having primary ciliary dyskinesia. The DNAI1 gene can provide
instructions for making a protein that is part of a group (complex)
of proteins called dynein. This complex functions within the cilia.
Coordinated back and forth movement of cilia can move the cell or
the fluid surrounding the cell and dynein produces the force needed
for cilia to move. Within the core of cilia (the axoneme), dynein
complexes are part of structures known as inner dynein arms (IDAs)
and outer dynein arms (ODAs) depending on their location.
Coordinated movement of the dynein arms causes the entire axoneme
to bend back and forth. IDAs and ODAs have different combinations
of protein components (subunits) that are classified by weight as
heavy, intermediate, or light chains. The DNAI1 gene provides
instructions for making intermediate chain 1, which is found in
ODAs. Other subunits can be produced from different genes
administered to the subject in the same or in a separate
composition. Alternatively, other subunits can be produced by a
single nucleic acid construct that encodes a functional component
of an inner dynein arm or an outer dynein arm.
[0061] At least 21 mutations in the DNAI1 gene have been found to
cause primary ciliary dyskinesia, which is a condition
characterized by respiratory tract infections, abnormal organ
placement, and an inability to have children (infertility). DNAI1
gene mutations result in an absent or abnormal intermediate chain
1. Without a normal version of this subunit, the ODAs cannot form
properly and may be shortened or absent. As a result, cilia cannot
produce the force needed to bend back and forth. Defective cilia
lead to the features of primary ciliary dyskinesia. In some cases,
the disclosure provides a nucleic acid that is engineered to
replace or to supplement the function of the endogenous DNAI1
protein comprising the IVS1+2_3insT (219+3insT) mutation. In some
cases, the disclosure provides a nucleic acid that is engineered to
replace or to supplement the function of the endogenous DNAI1
protein comprising the A538T mutation, the second most common.
[0062] In some cases, the composition comprises a nucleic acid
construct encoding dynein axonemal intermediate chain 2 (DNAI2),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having primary ciliary dyskinesia. The DNAI2 gene is part of the
dynein complex of respiratory cilia and sperm flagella. Mutations
in this gene are associated with primary ciliary dyskinesia type 9,
a disorder characterized by abnormalities of motile cilia,
respiratory infections leading to chronic inflammation and
bronchiectasis, and abnormalities in sperm tails.
[0063] In some cases, the composition comprises a nucleic acid
construct encoding armadillo repeat containing 4 (ARMC4), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the ARMC4 gene
comprises ten Armadillo repeat motifs (ARMs) and one HEAT repeat,
and has been shown to localize to the ciliary axonemes and at the
ciliary base of respiratory cells. Mutations in the ARMC4 gene can
cause partial outer dynein arm (ODA) defects in respiratory
cilia.
[0064] In some cases, the composition comprises a nucleic acid
construct encoding chromosome 21 open reading frame 59 (C21orf59),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having of primary ciliary dyskinesia. The protein encoded by the
C21orf59 gene can play a critical role in dynein arm assembly and
motile cilia function. Mutations in this gene can result in primary
ciliary dyskinesia.
[0065] In some cases, the composition comprises a nucleic acid
construct encoding coiled-coil domain containing 103 (CCDC103), and
upon translation within the cells of a subject the construct yields
a polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the CCDC103 gene
can function as a dynein-attachment factor required for cilia
motility.
[0066] In some cases, the composition comprises a nucleic acid
construct encoding coiled-coil domain containing 114 (CCDC114), and
upon translation within the cells of a subject the construct yields
a polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the CCDC114 gene
can function as a component of the outer dynein arm docking complex
in cilia cells. Mutations in this gene can cause primary ciliary
dyskinesia 20.
[0067] In some cases, the composition comprises a nucleic acid
construct encoding coiled-coil domain containing 39 (CCDC39), and
upon translation within the cells of a subject the construct yields
a polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the CCDC39 gene
can function as the assembly of dynein regulatory and inner dynein
arm complexes, which regulate ciliary beat. Defects in this gene
are a cause of primary ciliary dyskinesia type 14 (CCDC39).
[0068] In some cases, the composition comprises a nucleic acid
construct encoding coiled-coil domain containing 40 (CCDC40), and
upon translation within the cells of a subject the construct yields
a polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the CCDC40 gene
can function together with CCDC39 to form a molecular ruler that
determines the 96 nanometer (nm) repeat length and arrangements of
components in cilia and flagella (by similarity). CCDC40 may not be
required for outer dynein arm complexes assembly, but it may be
required for axonemal recruitment of CCDC39. In some cases, CCD40
and CCD39 can be produced from different genes administered to the
subject in the same or in a separate composition. Alternatively,
CCD40 and CCD39 can be produced by a single nucleic acid construct
that encodes a functional component of an inner dynein arm or an
outer dynein arm. Defects in the CCD40 gene are a cause of primary
ciliary dyskinesia type 14 (CILD14).
[0069] In some cases, the composition comprises a nucleic acid
construct encoding coiled-coil domain containing 65 (CCDC65), and
upon translation within the cells of a subject the construct yields
a polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the CCDC65 gene
can function as a sperm cell protein. CCDC65 has been shown to be
highly expressed in adult testis, spermatocytes and spermatids. The
protein plays a critical role in the assembly of the nexin-dynein
regulatory complex. Mutations in this gene have been associated
with primary ciliary dyskinesia type 27.
[0070] In some cases, the composition comprises a nucleic acid
construct encoding cyclin O (CCNO), and upon translation within the
cells of a subject the construct yields a polypeptide that treats a
subject having or at risk of having of primary ciliary
dyskinesia.
[0071] In some cases, the composition comprises a nucleic acid
construct encoding dynein (axonemal) assembly factor 1 (DNAAF1),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having of primary ciliary dyskinesia. The protein encoded by the
DNAAF1 gene is thought to be cilium-specific and it can be required
for the stability of the ciliary architecture. Mutations in this
gene have been associated with primary ciliary dyskinesia type
13.
[0072] In some cases, the composition comprises a nucleic acid
construct encoding dynein (axonemal) assembly factor 2 (DNAAF2),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having of primary ciliary dyskinesia. The protein encoded by the
DNAAF2 gene can be involved in the preassembly of dynein arm
complexes which power cilia. Mutations in this gene have been
associated with primary ciliary dyskinesia type 10 (CILD10).
[0073] In some cases, the composition comprises a nucleic acid
construct encoding dynein (axonemal) assembly factor 3 (DNAAF3),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having of primary ciliary dyskinesia. The protein encoded by the
DNAAF3 gene can be required for the assembly of axonemal inner and
outer dynein arms and it can play a role in assembling dynein
complexes for transport into cilia. Mutations in this gene have
been associated with primary ciliary dyskinesia type 2 (CILD2).
[0074] In some cases, the composition comprises a nucleic acid
construct encoding dynein (axonemal) assembly factor 5 (DNAAF5),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having of primary ciliary dyskinesia. The protein encoded by the
DNAAF5 gene is thought to be required for the preassembly or
stability of axonemal dynein arms, and is found only in organisms
with motile cilia and flagella. Mutations in this gene have been
associated with primary ciliary dyskinesia-18.
[0075] In some cases, the composition comprises a nucleic acid
construct encoding dynein axonemal heavy chain 11 (DNAH11), and
upon translation within the cells of a subject the construct yields
a polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the DNAH11 gene
can produce a ciliary outer dynein arm protein. DNAH11 is thought
to be a microtubule-dependent motor ATPase involved in the movement
of respiratory cilia. Mutations in this gene have been associated
with primary ciliary dyskinesia type 7 (CILD7) and heterotaxy
syndrome.
[0076] In some cases, the composition comprises a nucleic acid
construct encoding dynein axonemal heavy chain 5 (DNAH5), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having
primary ciliary dyskinesia. The DNAH5 gene can provide instructions
for making a protein that is part of a group (complex) of proteins
called dynein. Coordinated back and forth movement of cilia can
move the cell or the fluid surrounding the cell. Dynein can produce
the force needed for cilia to move. More than 80 mutations of the
DNAH5 have been associated with primary ciliary dyskinesia.
Mutations in this gene have been associated with primary ciliary
dyskinesia and heterotaxy syndrome.
[0077] In some cases, the composition comprises a nucleic acid
construct encoding dynein axonemal heavy chain 6 (DNAH6), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having
primary ciliary dyskinesia.
[0078] In some cases, the composition comprises a nucleic acid
construct encoding dynein axonemal heavy chain 8 (DNAH8), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the DNAH8 gene
can function as a force generating protein of respiratory cilia.
DNAH8 can produce force towards the minus ends of microtubules.
Dynein has ATPase activity; the force-producing power stroke is
thought to occur on release of ADP. DNAH8 can be involved in sperm
motility and in sperm flagellar assembly. DNAH8 is also known as
ATPase and hdhc9.
[0079] In some cases, the composition comprises a nucleic acid
construct encoding dynein axonemal light chain 1 (DNAL1), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the DNAL1 gene
can function as a force generating protein of respiratory cilia.
DNAL1 can function as a component of the outer dynein arms complex.
This complex acts as the molecular motor that provides the force to
move cilia in an ATP-dependent manner. Mutations in this gene have
been associated with primary ciliary dyskinesia type 16
(CILD16).
[0080] In some cases, the composition comprises a nucleic acid
construct encoding dynein regulatory complex subunit 1 (DRC1), and
upon translation within the cells of a subject the construct yields
a polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the DRC1 gene
can function as a force generating protein of respiratory cilia.
DRC1 can encode a central component of the nexin-dynein complex
(N-DRC), which regulates the assembly of ciliary dynein. Mutations
in this gene have been associated with primary ciliary dyskinesia
type 21 (CILD21).
[0081] In some cases, the composition comprises a nucleic acid
construct encoding dyslexia susceptibility 1 candidate 1 (DYX1C1),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having of primary ciliary dyskinesia. The protein encoded by the
DYX1C1 gene can function as a force generating protein of
respiratory cilia. DYX1C1 can encode a tetratricopeptide repeat
domain-containing protein. The encoded protein can interact with
estrogen receptors and the heat shock proteins, Hsp70 and Hsp90.
Mutations in this gene are also associated with deficits in reading
and spelling, and a chromosomal translocation involving this gene
is associated with a susceptibility to developmental dyslexia.
[0082] In some cases, the composition comprises a nucleic acid
construct encoding growth arrest specific 8 (GASB), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia.
[0083] In some cases, the composition comprises a nucleic acid
construct encoding axonemal central pair apparatus protein (HYDIN),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having of primary ciliary dyskinesia. The protein encoded by the
HYDIN gene can function in cilia motility. Mutations in this gene
have been associated with primary ciliary dyskinesia type 5
(CILD5).
[0084] In some cases, the composition comprises a nucleic acid
construct encoding leucine rich repeat containing 6 (LRRC6), and
upon translation within the cells of a subject the construct yields
a polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the LRRC6 gene
contains several leucine-rich repeat domains and appears to be
involved in the motility of cilia. Mutations in this gene have been
associated with primary ciliary dyskinesia type 19 (CILD19).
[0085] In some cases, the composition comprises a nucleic acid
construct encoding NME/NM23 family member 8 (NME8), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the NME8 gene
can function as a force generating protein of respiratory cilia.
The NME8 protein comprises an N-terminal thioredoxin domain and
three C-terminal nucleoside diphosphate kinase (NDK) domains.
Mutations in this gene have been associated with primary ciliary
dyskinesia type 6 (CILD6).
[0086] In some cases, the composition comprises a nucleic acid
construct encoding oral-facial-digital syndrome 1 (OFD1), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The function of the protein produced by
the OFD1 gene is not well understood, but it may play a role play a
critical role in the early development of many parts of the body,
including the brain, face, limbs, and kidneys. About 100 mutations
in the OFD1 gene have been found in people with oral-facial-digital
syndrome type I, which is the most common form of the disorder.
Mutations in this gene have been associated with primary ciliary
dyskinesia and Joubert syndrome.
[0087] In some cases, the composition comprises a nucleic acid
construct encoding retinitis pigmentosa GTPase regulator (RPGR),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having of primary ciliary dyskinesia. The protein encoded by the
RPGR gene can be important for normal vision and for the function
of the cilia. Mutations in this gene have been associated with
primary ciliary dyskinesia, X-linked retinitis pigmentosa,
progressive vision loss, chronic respiratory and sinus infections,
recurrent ear infections (otitis media), and hearing loss.
[0088] In some cases, the composition comprises a nucleic acid
construct encoding radial spoke head 1 homolog (RSPH1), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the RSPH1 gene
may play an important role in male meiosis and in the building of
the axonemal central pair and radial spokes. Mutations in this gene
have been associated with primary ciliary dyskinesia type 24
(CILD24).
[0089] In some cases, the composition comprises a nucleic acid
construct encoding radial spoke head 4 homolog A (RSPH4A), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the RSPH4A gene
may be a component the radial spoke head. Mutations in this gene
have been associated with primary ciliary dyskinesia type 11
(CILD11).
[0090] In some cases, the composition comprises a nucleic acid
construct encoding radial spoke head 9 homolog (RSPH9), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the RSPH9 gene
may be a component the radial spoke head in motile cilia and
flagella. Mutations in this gene have been associated with primary
ciliary dyskinesia type 12 (CILD12).
[0091] In some cases, the composition comprises a nucleic acid
construct encoding sperm associated antigen 1 (SPAG1), and upon
translation within the cells of a subject the construct yields a
polypeptide that treats a subject having or at risk of having of
primary ciliary dyskinesia. The protein encoded by the SPAG1 gene
may play a role in the cytoplasmic assembly of the ciliary dynein
arms. Mutations in this gene have been associated with primary
ciliary dyskinesia type 28 (CILD28).
[0092] In some cases, the composition comprises a nucleic acid
construct encoding zinc finger MYND-type containing 10 (ZMYND10),
and upon translation within the cells of a subject the construct
yields a polypeptide that treats a subject having or at risk of
having of primary ciliary dyskinesia. The protein encoded by the
ZMYND10 can function in axonemal assembly of inner and outer dynein
arms (IDA and ODA, respectively) for proper axoneme building for
cilia motility. Mutations in this gene have been associated with
primary ciliary dyskinesia type 22 (CILD22).
[0093] The treatment may comprise treating a subject (e.g., a
patient with a disease and/or a lab animal with a condition). In
some cases, the condition is primary ciliary dyskinesia (PCD) or
Kartagener syndrome. In some cases, the condition is broadly
associated with defects in one or more proteins that function
within cell structures known as cilia. In some cases, the subject
is a human. Treatment may be provided to the subject before
clinical onset of disease. Treatment may be provided to the subject
after clinical onset of disease. Treatment may be provided to the
subject on or after 1 minute, 5 minutes, 10 minutes, 30 minutes, 1
hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 1 day,
1 week, 6 months, 12 months, or 2 years after clinical onset of the
disease. Treatment may be provided to the subject for a time period
that is greater than or equal to 1 minute, 10 minutes, 30 minutes,
1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 1
day, 1 week, 1 month, 6 months, 12 months, 2 years or more after
clinical onset of the disease. Treatment may be provided to the
subject for a time period that is less than or equal to 2 years, 12
months, 6 months, 1 month, 1 week, 1 day, 12 hours, 6 hours, 5
hours, 4 hours, 3 hours, 2 hours, 1 hour, 30 minutes, 10 minutes,
or 1 minute after clinical onset of the disease. Treatment may also
include treating a human in a clinical trial.
[0094] Compositions containing the engineered polyribonucleotides
described herein can be administered for prophylactic and/or
therapeutic treatments. In therapeutic applications, the nucleic
acid constructs or vectors can be administered to a subject already
suffering from a disease, such as a primary ciliary dyskinesia, in
the amount sufficient to provide the amount of the encoded
polypeptide that cures or at least improves the symptoms of the
disease. Nucleic acid constructs, vectors, engineered
polyribonucleotides, or compositions can also be administered to
lessen a likelihood of developing, contracting, or worsening a
disease. Amounts effective for this use can vary based on the
severity and course of the disease or condition, the efficiency of
transfection of a nucleic acid construct(s), vector(s), engineered
polyribonucleotide(s), or composition(s), the affinity of an
encoded polypeptide to a target molecule, previous therapy, the
subject's health status, weight, response to the drugs, and the
judgment of the treating physician.
[0095] In some cases, a polynucleotide of the disclosure can encode
a polypeptide that is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%
homologous to a protein associated with primary ciliary dyskinesia,
such as armadillo repeat containing 4 (ARMC4), chromosome 21 open
reading frame 59 (C21orf59), coiled-coil domain containing 103
(CCDC103), coiled-coil domain containing 114 (CCDC114), coiled-coil
domain containing 39 (CCDC39), coiled-coil domain containing 40
(CCDC40), coiled-coil domain containing 65 (CCDC65), cyclin O
(CCNO), dynein (axonemal) assembly factor 1 (DNAAF1), dynein
(axonemal) assembly factor 2 (DNAAF2), dynein (axonemal) assembly
factor 3 (DNAAF3), dynein (axonemal) assembly factor 5 (DNAAF5),
dynein axonemal heavy chain 11 (DNAH11), dynein axonemal heavy
chain 5 (DNAH5), dynein axonemal heavy chain 6 (DNAH6), dynein
axonemal heavy chain 8 (DNAH8), dynein axonemal intermediate chain
2 (DNAI2), dynein axonemal light chain 1 (DNAL1), dynein regulatory
complex subunit 1 (DRC1), dyslexia susceptibility 1 candidate 1
(DYX1C1), growth arrest specific 8 (GASB), axonemal central pair
apparatus protein (HYDIN), leucine rich repeat containing 6
(LRRC6), NME/NM23 family member 8 (NME8), oral-facial-digital
syndrome 1 (OFD1), retinitis pigmentosa GTPase regulator (RPGR),
radial spoke head 1 homolog (Chlamydomonas) (RSPH1), radial spoke
head 4 homolog A (Chlamydomonas) (RSPH4A), radial spoke head 9
homolog (Chlamydomonas) (RSPH9), sperm associated antigen 1(SPAG1),
and zinc finger MYND-type containing 10 (ZMYND10).
[0096] Multiple nucleic acid constructs, vectors, engineered
polyribonucleotides, or compositions can be administered in any
order or simultaneously. The nucleic acid constructs, vectors,
engineered polyribonucleotides, or compositions can be packed
together or separately, in a single package comprising
polyribonucleotides that target the same target molecule or in a
plurality of packages. One or all of the nucleic acid constructs,
vectors, engineered polyribonucleotides, or compositions can be
given in multiple doses. If not simultaneous, the timing between
the multiple doses may vary.
[0097] The nucleic acid constructs, vectors, engineered
polyribonucleotides, or compositions can be administered to a
subject as soon as possible after the onset of the symptoms. A
nucleic acid construct(s), a vector(s), engineered
polyribonucleotide(s), or compositions can be administered as soon
as is practical after the onset of a disease or condition is
detected or suspected, and for a length of time necessary for the
treatment of the disease, such as, for example, for about 1 month,
for about 6 months, for about 12 months, for about 18 months, for
about 24 months, or any appropriate length of time. The length of
treatment can vary for each subject.
Altered Nucleotide Usage in Coding Regions to Increase mRNA
Stability for Transcript Therapy
[0098] Hydrolysis of oligonucleotides suggests that the reactivity
of the phosphodiester bond linking two ribonucleotides in
single-stranded (ss)RNA depends on the nature of those nucleotides.
At pH 8.5, dinucleotide cleavage susceptibility when embedded in
ssRNA dodecamers may vary by an order of magnitude. Under near
physiological conditions, hydrolysis of RNA usually involves an
S.sub.N2-type attack by the 2'-oxygen nucleophile on the adjacent
phosphorus target center on the opposing side of the 5'-oxyanion
leaving group, yielding two RNA fragments with 2',3'-cyclic
phosphate and 5'-hydroxyl termini. More reactive scissile
phosphodiester bonds may include 5'-UpA-3' (R.sub.1=U.sub.1,
R.sub.2=A) and 5'-CpA-3' (R.sub.1=C, R.sub.2=A) because the
backbone at these steps can most easily adopt the "in-line"
conformation that is required for S.sub.N2-type nucleophilic attack
by the 2'-OH on the adjacent phosphodiester linkage. In addition,
interferon-regulated dsRNA-activated antiviral pathways produce
2'-5' oligoadenylates which bind to ankyrin repeats leading to
activation of RNase L endoribonuclease. RNase L cleaves ssRNA
efficiently at UA and UU dinucleotides. Lastly, U-rich sequences
are potent activators of RNA sensors including Toll-like receptor 7
and 8 and RIG-I making global uridine content reduction a
potentially attractive approach to reduce immunogenicity of
therapeutic mRNAs.
[0099] Altered nucleotide usage schemes aiming to reduce the number
of more reactive 5'-U(U/A)-3' dinucleotides within codons as well
as across codons of modified mRNAs partially alleviate limitations
imposed by the inherent chemical instability of RNA. At the same
time, lowering the U-content in RNA transcripts renders them less
immunogenic. The present disclosure relates to RNA transcripts
comprising altered open reading frames (ORF). In particular, a
method comprising a substantial reduction of 5'-U(U/A)-3'
dinucleotides within protein coding regions leading to stabilized
therapeutic mRNAs is proposed.
TABLE-US-00002 TABLE 2 Construct DNA sequence (from 5' to 3') DNAI1
ATGATCCCAGCAAGCGCCAAGGCACCACACAAGCAGCCCCACAAGCAGA GeneScript
GCATCTCCATCGGCAGGGGCACAAGGAAGAGGGACGAGGATAGCGGAAC Codon
CGAAGTGGGAGAGGGAACAGACGAGTGGGCACAGTCCAAGGCAACCGTG
CGCCCACCTGACCAGCTGGAGCTGACAGATGCCGAGCTGAAGGAGGAGT
TCACCAGGATCCTGACAGCCAACAATCCACACGCCCCCCAGAACATCGTG
CGCTACTCTTTCAAGGAGGGCACATATAAGCCAATCGGCTTTGTGAACCA
GCTGGCCGTGCACTATACCCAAGTGGGCAATCTGATCCCCAAGGACTCCG
ATGAGGGCCGGAGACAGCACTACAGGGACGAGCTGGTGGCAGGATCCCA
GGAGTCTGTGAAAGTGATCTCTGAGACCGGCAATCTGGAGGAGGACGAG
GAGCCAAAGGAGCTGGAGACCGAGCCAGGAAGCCAGACAGATGTGCCTG
CAGCAGGAGCAGCAGAGAAGGTGACCGAGGAGGAGCTGATGACACCTAA
GCAGCCAAAGGAGCGGAAGCTGACCAACCAGTTCAATTTTTCCGAGAGA
GCCTCTCAGACATACAACAATCCAGTGCGGGACAGAGAGTGCCAGACCG
AGCCACCCCCTAGAACCAACTTTTCCGCCACAGCCAATCAGTGGGAGATC
TACGATGCCTATGTGGAGGAGCTGGAGAAGCAGGAGAAGACCAAGGAGA
AGGAGAAGGCCAAGACACCCGTGGCCAAGAAGTCCGGCAAGATGGCCAT
GCGGAAGCTGACCAGCATGGAGTCCCAGACAGACGATCTGATCAAGCTG
TCTCAGGCCGCCAAGATCATGGAGAGAATGGTGAACCAGAATACCTATG
ACGATATCGCCCAGGACTTCAAGTACTATGACGATGCAGCAGACGAGTAC
AGGGATCAAGTGGGCACACTGCTGCCTCTGTGGAAGTTTCAGAACGATAA
GGCCAAGAGGCTGAGCGTGACCGCCCTGTGCTGGAATCCAAAGTACAGG
GACCTGTTCGCAGTGGGATACGGATCTTATGACTTCATGAAGCAGAGCAG
AGGCATGCTGCTGCTGTATTCCCTGAAGAACCCCTCTTTCCCTGAGTACAT
GTTTAGCTCCAATTCCGGCGTGATGTGCCTGGACATCCACGTGGATCACC
CCTACCTGGTGGCCGTGGGCCACTATGACGGCAACGTGGCCATCTACAAT
CTGAAGAAGCCTCACTCTCAGCCCAGCTTCTGTTCTAGCGCCAAGAGCGG
CAAGCACTCCGATCCCGTGTGGCAGGTGAAGTGGCAGAAGGACGATATG
GACCAGAACCTGAATTTCTTTTCCGTGTCCTCTGATGGCAGGATCGTGTCT
TGGACCCTGGTGAAGCGCAAGCTGGTGCACATCGACGTGATCAAGCTGA
AGGTGGAGGGCAGCACCACAGAGGTGCCAGAGGGACTGCAGCTGCACCC
AGTGGGATGCGGCACAGCCTTCGACTTTCACAAGGAGATCGATTATATGT
TCCTGGTGGGCACCGAGGAGGGCAAGATCTACAAGTGTTCTAAGAGCTAT
AGCTCCCAGTTTCTGGACACATATGATGCCCACAACATGAGCGTGGATAC
CGTGTCCTGGAATCCTTACCACACAAAGGTGTTCATGAGCTGCTCTAGCG
ACTGGACCGTGAAGATCTGGGATCACACCATCAAGACACCTATGTTTATC
TATGACCTGAACTCCGCCGTGGGCGATGTGGCATGGGCACCATACTCCTC
TACAGTGTTCGCAGCAGTGACCACAGACGGCAAGGCACACATCTTTGATC
TGGCCATCAACAAGTACGAGGCCATCTGTAATCAGCCCGTGGCCGCCAAG
AAGAACAGGCTGACCCACGTGCAGTTCAATCTGATCCACCCTATCATCAT
CGTGGGCGACGATCGGGGCCACATCATCTCTCTGAAGCTGAGCCCCAACC
TGAGAAAGATGCCTAAGGAGAAGAAGGGACAGGAGGTGCAGAAGGGAC
CAGCAGTGGAGATCGCAAAGCTGGACAAGCTGCTGAATCTGGTGCGCGA
GGTGAAGATCAAGACCTGA (SEQ ID NO: 14) DNAI1
ATGATCCCAGCAAGCGCCAAGGCACCACACAAGCAGCCCCACAAGCAGA Altered
GCATCAGCATCGGCAGGGGCACAAGGAAGAGGGACGAGGACAGCGGAA Nucleotide
CCGAAGTGGGAGAGGGAACAGACGAGTGGGCACAGAGCAAGGCAACCG Usage 1
TGCGCCCACCCGACCAGCTGGAGCTGACAGACGCCGAGCTGAAGGAGGA
GTTCACCAGGATCCTGACAGCCAACAACCCACACGCCCCCCAGAACATCG
TGCGCTACAGCTTCAAGGAGGGCACATACAAGCCAATCGGCTTCGTGAAC
CAGCTGGCCGTGCACTACACCCAAGTGGGCAACCTGATCCCCAAGGACA
GCGACGAGGGCCGGAGACAGCACTACAGGGACGAGCTGGTGGCAGGAA
GCCAGGAGAGCGTGAAAGTGATCAGCGAGACCGGCAACCTGGAGGAGGA
CGAGGAGCCAAAGGAGCTGGAGACCGAGCCAGGAAGCCAGACAGACGT
GCCCGCAGCAGGAGCAGCAGAGAAGGTGACCGAGGAGGAGCTGATGAC
ACCCAAGCAGCCAAAGGAGCGGAAGCTGACCAACCAGTTCAACTTCAGC
GAGAGAGCCAGCCAGACATACAACAACCCAGTGCGGGACAGAGAGTGCC
AGACCGAGCCACCCCCCAGAACCAACTTCAGCGCCACAGCCAACCAGTG
GGAGATCTACGACGCCTACGTGGAGGAGCTGGAGAAGCAGGAGAAGACC
AAGGAGAAGGAGAAGGCCAAGACACCCGTGGCCAAGAAGAGCGGCAAG
ATGGCCATGCGGAAGCTGACCAGCATGGAGAGCCAGACAGACGACCTGA
TCAAGCTGAGCCAGGCCGCCAAGATCATGGAGAGAATGGTGAACCAGAA
CACCTACGACGACATCGCCCAGGACTTCAAGTACTACGACGACGCAGCA
GACGAGTACAGGGACCAAGTGGGCACACTGCTGCCCCTGTGGAAGTTCC
AGAACGACAAGGCCAAGAGGCTGAGCGTGACCGCCCTGTGCTGGAACCC
AAAGTACAGGGACCTGTTCGCAGTGGGATACGGAAGCTACGACTTCATG
AAGCAGAGCAGAGGCATGCTGCTGCTGTACAGCCTGAAGAACCCCAGCT
TCCCCGAGTACATGTTCAGCAGCAACAGCGGCGTGATGTGCCTGGACATC
CACGTGGACCACCCCTACCTGGTGGCCGTGGGCCACTACGACGGCAACGT
GGCCATCTACAACCTGAAGAAGCCCCACAGCCAGCCCAGCTTCTGCAGCA
GCGCCAAGAGCGGCAAGCACAGCGACCCCGTGTGGCAGGTGAAGTGGCA
GAAGGACGACATGGACCAGAACCTGAACTTCTTCAGCGTGAGCAGCGAC
GGCAGGATCGTGAGCTGGACCCTGGTGAAGCGCAAGCTGGTGCACATCG
ACGTGATCAAGCTGAAGGTGGAGGGCAGCACCACAGAGGTGCCAGAGGG
ACTGCAGCTGCACCCAGTGGGATGCGGCACAGCCTTCGACTTCCACAAGG
AGATCGACTACATGTTCCTGGTGGGCACCGAGGAGGGCAAGATCTACAA
GTGCAGCAAGAGCTACAGCAGCCAGTTCCTGGACACATACGACGCCCAC
AACATGAGCGTGGACACCGTGAGCTGGAACCCCTACCACACAAAGGTGT
TCATGAGCTGCAGCAGCGACTGGACCGTGAAGATCTGGGACCACACCATC
AAGACACCCATGTTCATCTACGACCTGAACAGCGCCGTGGGCGACGTGGC
ATGGGCACCATACAGCAGCACAGTGTTCGCAGCAGTGACCACAGACGGC
AAGGCACACATCTTCGACCTGGCCATCAACAAGTACGAGGCCATCTGCAA
CCAGCCCGTGGCCGCCAAGAAGAACAGGCTGACCCACGTGCAGTTCAAC
CTGATCCACCCCATCATCATCGTGGGCGACGACCGGGGCCACATCATCAG
CCTGAAGCTGAGCCCCAACCTGAGAAAGATGCCCAAGGAGAAGAAGGGA
CAGGAGGTGCAGAAGGGACCAGCAGTGGAGATCGCAAAGCTGGACAAGC
TGCTGAACCTGGTGCGCGAGGTGAAGATCAAGACCTGA (SEQ ID NO: 15) DNAI1
ATGATCCCAGCAAGCGCCAAGGCACCACACAAGCAGCCCCACAAGCAGA Altered
GCATCTCCATCGGCAGGGGCACAAGGAAGAGGGACGAGGACAGCGGAAC Nucleotide
CGAAGTGGGAGAGGGAACAGACGAGTGGGCACAGTCCAAGGCAACCGTG Usage 2
CGCCCACCTGACCAGCTGGAGCTGACAGATGCCGAGCTGAAGGAGGAGT
TCACCAGGATCCTGACAGCCAACAATCCACACGCCCCCCAGAACATCGTG
CGCTACAGCTTCAAGGAGGGCACATACAAGCCAATCGGCTTCGTGAACCA
GCTGGCCGTGCACTACACCCAAGTGGGCAATCTGATCCCCAAGGACTCCG
ATGAGGGCCGGAGACAGCACTACAGGGACGAGCTGGTGGCAGGATCCCA
GGAGTCTGTGAAAGTGATCTCTGAGACCGGCAATCTGGAGGAGGACGAG
GAGCCAAAGGAGCTGGAGACCGAGCCAGGAAGCCAGACAGATGTGCCTG
CAGCAGGAGCAGCAGAGAAGGTGACCGAGGAGGAGCTGATGACACCCA
AGCAGCCAAAGGAGCGGAAGCTGACCAACCAGTTCAACTTCTCCGAGAG
AGCCTCTCAGACATACAACAATCCAGTGCGGGACAGAGAGTGCCAGACC
GAGCCACCCCCCAGAACCAACTTCTCCGCCACAGCCAATCAGTGGGAGAT
CTACGATGCCTACGTGGAGGAGCTGGAGAAGCAGGAGAAGACCAAGGAG
AAGGAGAAGGCCAAGACACCCGTGGCCAAGAAGTCCGGCAAGATGGCCA
TGCGGAAGCTGACCAGCATGGAGTCCCAGACAGACGATCTGATCAAGCT
GTCTCAGGCCGCCAAGATCATGGAGAGAATGGTGAACCAGAACACCTAC
GACGACATCGCCCAGGACTTCAAGTACTACGACGATGCAGCAGACGAGT
ACAGGGATCAAGTGGGCACACTGCTGCCTCTGTGGAAGTTCCAGAACGAC
AAGGCCAAGAGGCTGAGCGTGACCGCCCTGTGCTGGAATCCAAAGTACA
GGGACCTGTTCGCAGTGGGATACGGAAGCTACGACTTCATGAAGCAGAG
CAGAGGCATGCTGCTGCTGTACTCCCTGAAGAACCCCAGCTTCCCTGAGT
ACATGTTCAGCTCCAACTCCGGCGTGATGTGCCTGGACATCCACGTGGAT
CACCCCTACCTGGTGGCCGTGGGCCACTACGACGGCAACGTGGCCATCTA
CAATCTGAAGAAGCCTCACTCTCAGCCCAGCTTCTGCAGCAGCGCCAAGA
GCGGCAAGCACTCCGATCCCGTGTGGCAGGTGAAGTGGCAGAAGGACGA
CATGGACCAGAACCTGAACTTCTTCTCCGTGTCCTCTGATGGCAGGATCG
TGAGCTGGACCCTGGTGAAGCGCAAGCTGGTGCACATCGACGTGATCAA
GCTGAAGGTGGAGGGCAGCACCACAGAGGTGCCAGAGGGACTGCAGCTG
CACCCAGTGGGATGCGGCACAGCCTTCGACTTCCACAAGGAGATCGACTA
CATGTTCCTGGTGGGCACCGAGGAGGGCAAGATCTACAAGTGCAGCAAG
AGCTACAGCTCCCAGTTCCTGGACACATACGATGCCCACAACATGAGCGT
GGACACCGTGTCCTGGAATCCCTACCACACAAAGGTGTTCATGAGCTGCA
GCAGCGACTGGACCGTGAAGATCTGGGATCACACCATCAAGACACCCAT
GTTCATCTACGACCTGAACTCCGCCGTGGGCGATGTGGCATGGGCACCAT
ACTCCAGCACAGTGTTCGCAGCAGTGACCACAGACGGCAAGGCACACAT
CTTCGATCTGGCCATCAACAAGTACGAGGCCATCTGCAATCAGCCCGTGG
CCGCCAAGAAGAACAGGCTGACCCACGTGCAGTTCAATCTGATCCACCCC
ATCATCATCGTGGGCGACGATCGGGGCCACATCATCTCTCTGAAGCTGAG
CCCCAACCTGAGAAAGATGCCCAAGGAGAAGAAGGGACAGGAGGTGCA
GAAGGGACCAGCAGTGGAGATCGCAAAGCTGGACAAGCTGCTGAATCTG
GTGCGCGAGGTGAAGATCAAGACCTGA (SEQ ID NO: 16) DNAH5
ATGTTCAGAATCGGCAGACGGCAGCTGTGGAAGCACAGCGTGACCAGAG Altered
TGCTGACCCAGCGGCTGAAGGGCGAGAAAGAGGCCAAGAGAGCCCTGCT Nucleotide
GGACGCCCGGCACAAcTACCTGTTCGCCATCGTGGCCAGCTGCCTGGACC Usage 1
TGAACAAGACCGAGGTGGAAGACGCCATCCTGGAAGGCAACCAGATCGA
GCGGATCGACCAGCTGTTCGCCGTGGGCGGACTGCGGCACCTGATGTTCT
ACTACCAAGACGTGGAAGAGGCCGAGACAGGCCAGCTGGGAAGCCTGGG
CGGAGTGAACCTGGTGAGCGGCAAGATCAAGAAACCCAAGGTGTTCGTG
ACCGAGGGCAACGACGTGGCCCTGACAGGCGTGTGCGTGTTCTTCATCAG
AACCGACCCCAGCAAGGCCATCACCCCCGACAACATCCACCAGGAAGTG
AGCTTCAACATGCTGGACGCCGCCGACGGCGGCCTGCTGAACAGCGTGCG
GAGACTGCTGAGCGACATCTTCATCCCCGCCCTGAGAGCCACAAGCCACG
GCTGGGGAGAGCTGGAAGGACTGCAGGACGCCGCCAACATCCGGCAGGA
ATTCCTGAGCAGCCTGGAAGGATTCGTGAACGTGCTGAGCGGCGCCCAGG
AAAGCCTGAAAGAAAAAGTGAACCTGCGGAAGTGCGACATCCTGGAACT
GAAAACCCTGAAAGAGCCCACCGACTACCTGACCCTGGCCAACAACCCC
GAGACACTGGGCAAGATCGAGGACTGCATGAAAGTGTGGATCAAGCAGA
CCGAACAGGTGCTGGCCGAGAACAACCAGCTGCTGAAAGAAGCCGACGA
CGTGGGCCCAAGAGCCGAGCTGGAACACTGGAAGAAGCGGCTGAGCAAG
TTCAACTACCTGCTGGAACAGCTGAAGAGCCCCGACGTGAAGGCCGTGCT
GGCCGTGCTGGCAGCCGCCAAGAGCAAACTGCTGAAAACCTGGCGCGAG
ATGGACATCCGGATCACCGACGCCACCAACGAGGCCAAGGACAACGTGA
AGTACCTGTACACCCTGGAAAAGTGCTGCGACCCCCTGTACAGCAGCGAC
CCCCTGAGCATGATGGACGCCATCCCCACCCTGATCAACGCCATCAAGAT
GATCTACAGCATCAGCCACTACTACAACACCAGCGAGAAGATCACCAGC
CTGTTCGTGAAAGTGACCAACCAGATCATCAGCGCCTGCAAGGCCTACAT
CACCAACAACGGCACCGCCAGCATCTGGAACCAGCCCCAGGACGTGGTG
GAAGAGAAGATCCTGAGCGCCATCAAGCTGAAGCAGGAATACCAGCTGT
GCTTCCACAAGACCAAGCAGAAGCTGAAACAGAACCCCAACGCCAAGCA
GTTCGACTTCAGCGAGATGTACATCTTCGGCAAGTTCGAGACATTCCACC
GGCGGCTGGCCAAGATCATCGACATCTTCACCACCCTGAAAACATACAGC
GTGCTGCAGGACAGCACCATCGAGGGCCTGGAAGACATGGCCACCAAGT
ACCAGGGCATCGTGGCCACCATCAAGAAGAAAGAGTACAACTTCCTGGA
CCAGCGCAAGATGGACTTCGACCAGGACTACGAGGAATTCTGCAAGCAG
ACAAACGACCTGCACAACGAGCTGCGCAAGTTCATGGACGTGACCTTCGC
CAAGATCCAGAACACCAACCAGGCCCTGCGGATGCTGAAGAAGTTCGAG
AGACTGAACATCCCCAACCTGGGCATCGACGACAAGTACCAGCTGATCCT
GGAAAACTACGGCGCCGACATCGACATGATCAGCAAGCTGTACACAAAG
CAGAAGTACGACCCCCCCCTGGCCCGGAACCAGCCCCCCATCGCCGGCAA
AATCCTGTGGGCCAGACAGCTGTTCCACCGGATCCAGCAGCCCATGCAGC
TGTTCCAGCAGCACCCCGCCGTGCTGAGCACAGCCGAGGCCAAACCCATC
ATCCGGAGCTACAACCGGATGGCCAAGGTGCTGCTGGAATTCGAGGTGCT
GTTCCACCGGGCCTGGCTGCGGCAGATCGAAGAGATCCACGTGGGACTG
GAAGCCAGCCTGCTCGTGAAGGCCCCCGGAACCGGCGAGCTGTTCGTGA
ACTTCGACCCCCAGATCCTGATCCTGTTCCGGGAAACCGAGTGCATGGCC
CAGATGGGGCTGGAAGTGAGCCCCCTGGCCACCAGCCTGTTCCAGAAGC
GGGACCGGTACAAGCGGAACTTCAGCAACATGAAGATGATGCTGGCCGA
GTACCAGCGCGTGAAGAGCAAGATCCCCGCCGCCATCGAGCAGCTGATC
GTGCCCCACCTGGCCAAAGTGGACGAGGCCCTGCAGCCAGGACTGGCCG
CCCTGACATGGACCAGCCTGAACATCGAGGCCTACCTGGAAAACACATTC
GCCAAAATCAAGGACCTGGAACTGCTGCTGGACCGCGTGAACGACCTGA
TCGAGTTCCGGATCGACGCCATCCTGGAAGAGATGAGCAGCACCCCCCTG
TGCCAGCTGCCCCAGGAAGAACCCCTGACCTGCGAAGAGTTCCTGCAGAT
GACCAAGGACCTGTGCGTGAACGGCGCCCAGATCCTGCACTTCAAGAGC
AGCCTGGTGGAAGAAGCCGTGAACGAGCTCGTGAACATGCTGCTGGACG
TGGAAGTGCTGAGCGAGGAAGAGAGCGAGAAGATCAGCAACGAGAACA
GCGTGAACTACAAGAACGAGAGCAGCGCCAAGCGGGAAGAGGGCAACTT
CGACACCCTGACCAGCAGCATCAACGCCAGAGCCAACGCCCTGCTGCTGA
CCACCGTGACCCGGAAGAAAAAAGAAACCGAGATGCTGGGCGAAGAGGC
CAGAGAGCTGCTGAGCCACTTCAACCACCAGAACATGGACGCCCTGCTGA
AAGTGACACGGAACACCCTGGAAGCCATCCGGAAGCGGATCCACAGCAG
CCACACCATCAACTTCCGGGACAGCAACAGCGCCAGCAACATGAAGCAG
AACAGCCTGCCCATCTTCCGGGCCAGCGTGACACTGGCCATCCCCAACAT
CGTGATGGCCCCCGCCCTGGAAGACGTGCAGCAGACACTGAACAAGGCC
GTGGAATGCATCATCAGCGTGCCCAAGGGCGTGCGGCAGTGGAGCAGCG
AACTGCTGAGCAAGAAGAAGATCCAGGAACGGAAAATGGCCGCCCTGCA
GAGCAACGAGGACAGCGACAGCGACGTGGAAATGGGCGAGAACGAGCT
GCAGGACACACTGGAAATCGCCAGCGTGAACCTGCCCATCCCCGTGCAG
ACCAAGAACTACTACAAGAACGTGAGCGAAAACAAAGAAATCGTGAAGC
TGGTGAGCGTGCTGAGCACCATCATCAACAGCACCAAGAAAGAAGTGAT
CACCAGCATGGACTGCTTCAAGCGGTACAACCACATCTGGCAGAAGGGC
AAAGAAGAGGCCATCAAGACCTTCATCACCCAGAGCCCCCTGCTGAGCG
AGTTCGAGAGCCAGATCCTGTACTTCCAGAACCTGGAACAGGAAATCAAC
GCCGAGCCCGAGTACGTGTGCGTGGGCAGCATCGCCCTGTACACCGCCGA
CCTGAAGTTCGCCCTGACCGCCGAGACAAAGGCCTGGATGGTCGTGATCG
GCCGGCACTGCAACAAAAAGTACAGAAGCGAGATGGAAAACATCTTCAT
GCTGATCGAGGAATTCAACAAGAAACTGAACCGGCCCATCAAGGACCTG
GACGACATCAGAATCGCCATGGCCGCACTGAAAGAGATCAGAGAGGAAC
AGATCAGCATCGACTTCCAAGTGGGCCCCATCGAGGAAAGCTACGCCCTG
CTGAACAGATACGGACTGCTGATCGCCCGGGAAGAGATCGACAAGGTGG
ACACCCTGCACTACGCCTGGGAGAAGCTGCTGGCCAGAGCCGGCGAGGT
GCAGAACAAACTGGTGAGCCTGCAGCCCAGCTTCAAGAAAGAACTGATC
AGCGCCGTGGAAGTGTTCCTGCAGGACTGCCACCAGTTCTACCTGGACTA
CGACCTGAACGGCCCCATGGCCAGCGGCCTGAAACCCCAGGAAGCCAGC
GACCGGCTGATCATGTTCCAGAACCAGTTCGACAACATCTACCGGAAGTA
CATCACCTACACAGGCGGCGAGGAACTGTTCGGCCTGCCCGCCACACAGT
ACCCCCAGCTGCTGGAAATCAAGAAGCAGCTGAACCTGCTGCAGAAGAT
CTACACCCTGTACAACAGCGTGATCGAGACAGTGAACAGCTACTACGACA
TCCTGTGGAGCGAAGTGAACATCGAGAAGATCAACAACGAACTGCTGGA
ATTCCAGAACCGGTGCCGGAAGCTGCCCAGAGCACTGAAGGACTGGCAG
GCCTTCCTGGACCTGAAGAAAATCATCGACGACTTCAGCGAGTGCTGCCC
CCTGCTGGAGTACATGGCCAGCAAGGCCATGATGGAACGGCACTGGGAG
AGAATCACCACACTGACCGGCCACAGCCTGGACGTGGGCAACGAGAGCT
TCAAGCTGCGGAACATCATGGAAGCCCCACTGCTGAAGTACAAAGAGGA
AATCGAGGACATCTGCATCAGCGCCGTGAAAGAGCGGGACATCGAGCAG
AAACTGAAACAAGTGATCAACGAGTGGGACAACAAGACCTTCACCTTCG
GCAGCTTCAAGACCAGAGGCGAGCTGCTGCTGCGGGGCGACAGCACCAG
CGAGATCATCGCCAACATGGAAGACAGCCTGATGCTGCTGGGCAGCCTGC
TGAGCAACCGGTACAACATGCCCTTCAAGGCCCAGATCCAGAAATGGGT
GCAGTACCTGAGCAACAGCACCGACATCATCGAGAGCTGGATGACCGTG
CAGAACCTGTGGATCTACCTGGAAGCCGTGTTCGTGGGCGGCGACATCGC
CAAGCAGCTGCCCAAAGAGGCCAAGCGGTTCAGCAACATCGACAAGAGC
TGGGTCAAGATCATGACCAGAGCCCACGAGGTGCCCAGCGTGGTGCAGT
GCTGCGTGGGCGACGAAACACTGGGACAGCTGCTGCCCCACCTGCTGGAC
CAGCTGGAAATCTGCCAGAAGAGCCTGACCGGCTACCTGGAAAAGAAAC
GGCTGTGCTTCCCCCGGTTCTTCTTCGTGAGCGACCCCGCCCTGCTGGAAA
TCCTGGGCCAGGCCAGCGACAGCCACACAATCCAGGCCCACCTGCTGAAC
GTGTTCGACAACATCAAGAGCGTGAAGTTCCACGAGAAAATCTACGACC
GGATCCTGAGCATCAGCAGCCAGGAAGGCGAGACAATCGAGCTGGACAA
GCCCGTGATGGCCGAGGGAAACGTGGAAGTGTGGCTGAACAGCCTGCTG
GAAGAGAGCCAGAGCAGCCTGCACCTCGTGATCAGACAGGCCGCCGCCA
ACATCCAGGAAACCGGCTTCCAGCTGACCGAGTTCCTGAGCAGCTTCCCA
GCACAAGTGGGACTGCTGGGCATCCAGATGATCTGGACCAGAGACAGCG
AAGAGGCCCTGAGAAACGCCAAGTTCGACAAGAAAATCATGCAGAAAAC
AAACCAGGCATTCCTGGAACTGCTGAACACCCTGATCGACGTGACCACCC
GGGACCTGAGCAGCACCGAGAGAGTGAAGTACGAGACACTGATCACCAT
CCACGTGCACCAGCGGGACATCTTCGACGACCTGTGCCACATGCACATCA
AGAGCCCCATGGACTTCGAGTGGCTGAAGCAGTGCAGGTTCTACTTCAAC
GAGGACAGCGACAAGATGATGATCCACATCACCGACGTGGCCTTCATCTA
CCAGAACGAGTTCCTGGGCTGCACCGACCGCCTCGTGATCACCCCCCTGA
CCGACCGGTGCTACATCACACTGGCCCAGGCACTGGGCATGAGCATGGG
AGGCGCACCAGCAGGACCCGCCGGCACAGGCAAGACCGAAACCACCAAG
GACATGGGACGCTGCCTGGGCAAATACGTGGTGGTGTTCAACTGCAGCGA
CCAGATGGACTTCCGGGGCCTGGGCCGGATCTTCAAGGGCCTGGCACAGA
GCGGAAGCTGGGGCTGCTTCGACGAGTTCAACAGAATCGACCTGCCCGTG
CTGAGCGTGGCCGCACAGCAGATCAGCATCATCCTGACATGCAAAAAAG
AGCACAAGAAGAGCTTCATCTTCACCGACGGCGACAACGTGACCATGAA
CCCCGAGTTCGGCCTGTTCCTGACAATGAACCCCGGCTACGCCGGACGGC
AGGAACTGCCCGAGAACCTGAAGATCAACTTCCGGAGCGTGGCCATGAT
GGTGCCCGACCGGCAGATCATCATCAGAGTGAAACTGGCCAGCTGCGGCT
TCATCGACAACGTGGTGCTGGCCCGGAAGTTCTTCACACTGTACAAGCTG
TGCGAAGAACAGCTGAGCAAACAGGTGCACTACGACTTCGGCCTGAGGA
ACATCCTGAGCGTGCTGAGAACCCTGGGAGCCGCCAAGCGGGCCAACCC
CATGGACACCGAGAGCACAATCGTGATGCGGGTGCTGCGGGACATGAAC
CTGAGCAAGCTGATCGACGAGGACGAGCCCCTGTTCCTGAGCCTGATCGA
GGACCTGTTCCCCAACATCCTGCTGGACAAGGCCGGCTACCCCGAACTGG
AAGCCGCCATCAGCAGACAGGTGGAAGAGGCCGGCCTGATCAACCACCC
CCCCTGGAAACTGAAAGTGATCCAGCTGTTCGAGACACAGCGCGTGCGGC
ACGGCATGATGACACTGGGACCCAGCGGAGCCGGCAAGACCACCTGCAT
CCACACACTGATGCGGGCCATGACCGACTGCGGCAAGCCCCACCGCGAG ATGCGGATGAAC
CCCAAGGCCATCACCGCCCCCCAGATGTTCGGCAGACTGGACGTGGCCAC
CAACGACTGGACCGACGGCATCTTCAGCACCCTGTGGCGCAAGACCCTGC
GGGCCAAGAAGGGCGAGCACATCTGGATCATCCTGGACGGCCCCGTGGA
CGCCATCTGGATCGAGAACCTGAACAGCGTGCTGGACGACAACAAGACA
CTGACCCTGGCCAACGGCGACCGGATCCCCATGGCCCCCAACTGCAAGAT
CATCTTCGAGCCCCACAACATCGACAACGCCAGCCCCGCCACCGTGAGCA
GAAACGGCATGGTGTTCATGAGCAGCAGCATCCTGGACTGGAGCCCCATC
CTGGAAGGCTTCCTGAAGAAGCGGAGCCCCCAGGAAGCCGAGATCCTGA
GACAGCTGTACACCGAGAGCTTCCCCGACCTGTACCGGTTCTGCATCCAG
AACCTGGAGTACAAGATGGAAGTGCTGGAAGCCTTCGTGATCACCCAGA
GCATCAACATGCTGCAGGGCCTGATCCCCCTGAAAGAACAGGGCGGAGA
AGTGAGCCAGGCCCACCTGGGCAGACTGTTCGTGTTCGCCCTGCTGTGGA
GCGCCGGCGCCGCCCTGGAACTGGACGGAAGGCGGAGACTGGAACTGTG
GCTGCGGAGCAGACCCACCGGCACCCTGGAACTGCCCCCACCAGCCGGA
CCCGGCGACACCGCCTTCGACTACTACGTGGCCCCCGACGGCACCTGGAC
CCACTGGAACACCCGGACCCAGGAATACCTGTACCCCAGCGACACCACCC
CCGAGTACGGCAGCATCCTGGTGCCCAACGTGGACAACGTGCGGACCGA
CTTCCTGATCCAGACAATCGCCAAGCAGGGAAAGGCCGTGCTGCTGATCG
GCGAGCAGGGCACAGCCAAGACCGTGATCATCAAGGGCTTCATGAGCAA
GTACGACCCCGAGTGCCACATGATCAAGAGCCTGAACTTCAGCAGCGCCA
CCACCCCACTGATGTTCCAGCGGACCATCGAGAGCTACGTGGACAAGCGG
ATGGGCACCACCTACGGCCCCCCAGCCGGCAAGAAAATGACCGTGTTCAT
CGACGACGTGAACATGCCCATCATCAACGAGTGGGGCGACCAAGTGACC
AACGAGATCGTGCGGCAGCTGATGGAACAGAACGGCTTCTACAACCTGG
AAAAGCCCGGCGAGTTCACCAGCATCGTGGACATCCAGTTCCTGGCCGCC
ATGATCCACCCCGGCGGCGGAAGAAACGACATCCCCCAGCGGCTGAAGC
GGCAGTTCAGCATCTTCAACTGCACCCTGCCCAGCGAGGCCAGCGTGGAC
AAGATCTTCGGCGTGATCGGCGTGGGCCACTACTGCACCCAGAGAGGCTT
CAGCGAGGAAGTGCGGGACAGCGTGACCAAGCTGGTGCCCCTGACAAGA
CGGCTGTGGCAGATGACCAAGATCAAGATGCTGCCCACCCCCGCCAAGTT
CCACTACGTGTTCAACCTGCGGGACCTGAGCAGAGTGTGGCAGGGAATGC
TGAACACCACCAGCGAAGTGATCAAAGAGCCCAACGACCTGCTGAAGCT
GTGGAAGCACGAGTGCAAGAGAGTGATCGCCGACCGGTTCACCGTGAGC
AGCGACGTGACATGGTTCGACAAGGCCCTGGTGAGCCTGGTGGAAGAGG
AATTCGGCGAAGAGAAGAAACTGCTGGTGGACTGCGGCATCGACACCTA
CTTCGTGGACTTCCTGCGCGACGCCCCCGAAGCCGCCGGCGAGACAAGCG
AAGAGGCCGACGCCGAGACACCCAAGATCTACGAGCCCATCGAGAGCTT
CAGCCACCTGAAAGAAAGGCTGAACATGTTCCTGCAGCTGTACAACGAG
AGCATCCGGGGAGCCGGCATGGACATGGTGTTCTTCGCCGACGCCATGGT
GCACCTCGTGAAGATCAGCAGAGTGATCCGGACCCCCCAGGGCAACGCC
CTGCTCGTGGGAGTGGGAGGCAGCGGCAAGCAGAGCCTGACCAGACTGG
CCAGCTTCATCGCCGGCTACGTGAGCTTCCAGATCACCCTGACCCGGAGC
TACAACACCAGCAACCTGATGGAAGACCTGAAGGTGCTGTACCGGACAG
CCGGCCAGCAGGGGAAGGGCATCACCTTCATCTTCACCGACAACGAGATC
AAGGACGAGAGCTTCCTGGAGTACATGAACAACGTGCTGAGCAGCGGCG
AGGTGAGCAACCTGTTCGCCCGGGACGAGATCGACGAGATCAACAGCGA
CCTGGCCAGCGTGATGAAGAAAGAATTCCCCCGGTGCCTGCCCACAAACG
AGAACCTGCACGACTACTTCATGAGCAGAGTGCGGCAGAACCTGCACATC
GTGCTGTGCTTCAGCCCCGTGGGCGAGAAGTTCAGAAACCGGGCCCTGAA
GTTCCCCGCCCTGATCAGCGGCTGCACCATCGACTGGTTCAGCCGGTGGC
CCAAGGACGCCCTGGTGGCCGTGAGCGAGCACTTCCTGACCAGCTACGAC
ATCGACTGCAGCCTGGAAATCAAGAAAGAGGTGGTGCAGTGCATGGGCA
GCTTCCAGGACGGCGTGGCCGAGAAATGCGTGGACTACTTCCAGCGGTTC
CGGCGGAGCACCCACGTGACCCCCAAGAGCTACCTGAGCTTCATCCAGGG
CTACAAGTTCATCTACGGCGAGAAGCACGTGGAAGTGCGCACACTGGCC
AACCGGATGAACACCGGCCTGGAAAAACTGAAAGAGGCCAGCGAGAGCG
TGGCCGCCCTGAGCAAAGAACTGGAAGCCAAAGAAAAAGAACTGCAGGT
GGCCAACGACAAGGCCGACATGGTGCTGAAAGAAGTGACCATGAAGGCC
CAGGCCGCCGAGAAAGTGAAAGCCGAGGTGCAGAAAGTGAAGGACCGG
GCCCAGGCCATCGTGGACAGCATCAGCAAGGACAAGGCCATCGCCGAGG
AAAAGCTGGAAGCAGCCAAGCCCGCCCTGGAAGAGGCAGAAGCCGCCCT
GCAGACCATCCGGCCCAGCGACATCGCCACAGTGCGGACCCTGGGAAGG
CCCCCCCACCTGATCATGCGGATCATGGACTGCGTGCTGCTGCTGTTCCA
GAGAAAGGTGAGCGCCGTGAAGATCGACCTGGAAAAAAGCTGCACCATG
CCCAGCTGGCAGGAAAGCCTGAAGCTGATGACCGCCGGCAACTTCCTGCA
GAACCTGCAGCAGTTCCCCAAGGACACCATCAACGAGGAAGTGATCGAG
TTCCTGAGCCCCTACTTCGAGATGCCCGACTACAACATCGAAACCGCCAA
ACGCGTGTGCGGCAACGTGGCCGGACTGTGCAGCTGGACCAAGGCCATG
GCCAGCTTCTTCAGCATCAACAAAGAGGTGCTGCCCCTGAAGGCCAACCT
GGTGGTGCAGGAAAACCGGCACCTGCTGGCCATGCAGGACCTGCAGAAA
GCCCAGGCCGAGCTGGACGACAAGCAGGCCGAGCTGGACGTGGTGCAGG
CCGAGTACGAGCAGGCCATGACCGAGAAGCAGACCCTGCTGGAAGACGC
AGAGCGGTGCAGACACAAGATGCAGACCGCCAGCACCCTGATCAGCGGA
CTGGCCGGCGAAAAAGAGCGGTGGACCGAGCAGAGCCAGGAATTCGCCG
CCCAGACCAAGCGGCTCGTGGGAGACGTGCTGCTGGCCACCGCCTTCCTG
AGCTACAGCGGCCCCTTCAACCAGGAATTCAGGGACCTGCTGCTGAACGA
CTGGCGGAAAGAGATGAAGGCCAGAAAGATCCCCTTCGGCAAGAACCTG
AACCTGAGCGAGATGCTGATCGACGCCCCCACCATCAGCGAGTGGAACCT
GCAGGGACTGCCCAACGACGACCTGAGCATCCAGAACGGAATCATCGTG
ACCAAAGCCAGCAGATACCCCCTGCTGATCGACCCCCAGACACAGGGCA
AGATCTGGATCAAGAACAAAGAGAGCCGGAACGAGCTGCAGATCACCAG
CCTGAACCACAAGTACTTCCGGAACCACCTGGAAGACAGCCTGAGCCTGG
GCAGGCCACTGCTGATCGAGGACGTGGGCGAGGAACTGGACCCAGCCCT
GGACAACGTGCTGGAACGGAACTTCATCAAGACCGGCAGCACCTTCAAA
GTGAAAGTGGGCGACAAAGAAGTGGACGTGCTGGACGGCTTCCGGCTGT
ACATCACCACCAAGCTGCCCAACCCCGCCTACACCCCCGAGATCAGCGCC
CGGACCAGCATCATCGACTTCACCGTGACAATGAAGGGACTGGAAGACC
AGCTGCTGGGACGCGTGATCCTGACAGAGAAGCAGGAACTGGAAAAAGA
ACGGACCCACCTGATGGAAGACGTGACCGCCAACAAGCGGCGGATGAAG
GAACTGGAAGACAACCTGCTGTACAGGCTGACCAGCACCCAGGGCAGCC
TGGTGGAAGACGAGAGCCTGATCGTGGTGCTGAGCAACACCAAGCGGAC
CGCAGAGGAAGTGACCCAGAAGCTGGAAATCAGCGCCGAGACAGAGGTG
CAGATCAACAGCGCCAGAGAAGAGTACCGGCCCGTGGCCACCCGGGGAA
GCATCCTGTACTTCCTGATCACCGAGATGCGGCTCGTGAACGAGATGTAC
CAGACCAGCCTGCGGCAGTTCCTGGGCCTGTTCGACCTGAGCCTGGCCAG
AAGCGTGAAGAGCCCCATCACCAGCAAGAGAATCGCCAACATCATCGAG
CACATGACCTACGAGGTGTACAAATACGCCGCCAGAGGCCTGTACGAGG
AACACAAGTTCCTGTTCACACTGCTGCTGACCCTGAAGATCGACATCCAG
CGGAACAGAGTGAAGCACGAAGAGTTCCTGACACTGATCAAGGGGGGAG
CCAGCCTGGACCTGAAGGCCTGCCCCCCCAAGCCCAGCAAGTGGATCCTG
GACATCACCTGGCTGAACCTGGTGGAACTGAGCAAGCTGAGACAGTTCA
GCGACGTGCTGGACCAGATCAGCCGCAACGAGAAGATGTGGAAGATCTG
GTTCGACAAAGAGAACCCCGAGGAAGAACCCCTGCCCAACGCCTACGAC
AAGAGCCTGGACTGCTTCCGGCGGCTGCTGCTGATCAGAAGCTGGTGCCC
CGACCGGACAATCGCCCAGGCCCGCAAGTACATCGTGGACAGCATGGGA
GAGAAGTACGCCGAGGGCGTGATCCTGGACCTGGAAAAGACCTGGGAGG
AAAGCGACCCCAGAACCCCCCTGATCTGCCTGCTGAGCATGGGCAGCGAC
CCCACCGACAGCATCATCGCCCTGGGCAAGAGACTGAAGATCGAGACAA
GATACGTGAGCATGGGCCAGGGCCAGGAAGTGCACGCCAGAAAGCTGCT
GCAGCAGACCATGGCCAACGGCGGCTGGGCCCTGCTGCAGAACTGCCAC
CTGGGGCTGGACTTCATGGACGAACTGATGGACATCATCATCGAGACAGA
GCTGGTGCACGACGCCTTCAGACTGTGGATGACCACCGAGGCCCACAAGC
AGTTCCCCATCACCCTGCTGCAGATGAGCATCAAGTTCGCCAACGACCCC
CCCCAGGGACTGAGAGCCGGCCTGAAGAGAACCTACAGCGGCGTGAGCC
AGGACCTGCTGGACGTGAGCAGCGGCAGCCAGTGGAAGCCCATGCTGTA
CGCCGTGGCATTCCTGCACAGCACCGTGCAGGAACGGCGGAAGTTCGGC
GCCCTGGGATGGAACATCCCCTACGAGTTCAACCAGGCCGACTTCAACGC
CACCGTGCAGTTCATCCAGAACCACCTGGACGACATGGACGTGAAGAAA
GGGGTGAGCTGGACAACCATCCGGTACATGATCGGAGAGATCCAGTACG
GCGGCAGAGTGACCGACGACTACGACAAGAGGCTGCTGAACACCTTCGC
CAAAGTGTGGTTCAGCGAGAACATGTTCGGCCCCGACTTCAGCTTCTACC
AGGGCTACAACATCCCCAAGTGCAGCACCGTGGACAACTACCTGCAGTAC
ATCCAGAGCCTGCCCGCCTACGACAGCCCCGAGGTGTTCGGACTGCACCC
CAACGCCGACATCACCTACCAGAGCAAACTGGCCAAGGACGTGCTGGAC
ACCATCCTGGGCATCCAGCCCAAGGACACCAGCGGCGGAGGCGACGAAA
CCCGGGAAGCAGTGGTGGCCAGACTGGCCGACGACATGCTGGAAAAGCT
GCCCCCCGACTACGTGCCCTTCGAAGTGAAAGAACGCCTGCAGAAGATG
GGCCCCTTCCAGCCCATGAACATCTTCCTGAGGCAGGAAATCGACCGGAT
GCAGCGGGTGCTGAGCCTCGTGCGGAGCACACTGACCGAGCTGAAACTG
GCCATCGACGGCACCATCATCATGAGCGAGAACCTGCGGGACGCACTGG
ACTGCATGTTCGACGCCAGAATCCCCGCATGGTGGAAAAAGGCCAGCTG
GATCAGCAGCACCCTGGGCTTCTGGTTCACCGAACTGATCGAGAGAAACA
GCCAGTTCACCAGCTGGGTGTTCAACGGCAGACCCCACTGCTTCTGGATG
ACCGGCTTCTTCAACCCACAAGGCTTCCTGACAGCAATGCGCCAGGAAAT
CACCAGAGCCAACAAGGGCTGGGCCCTGGACAACATGGTGCTGTGCAAC
GAAGTGACCAAGTGGATGAAGGACGACATCAGCGCCCCCCCCACAGAGG
GCGTGTACGTGTACGGCCTGTACCTGGAAGGCGCCGGATGGGACAAGAG
AAACATGAAGCTGATCGAGAGCAAGCCCAAGGTGCTGTTCGAGCTGATG
CCCGTGATCAGGATCTACGCCGAGAACAACACCCTGAGGGACCCCCGGTT
CTACAGCTGCCCCATCTACAAGAAACCCGTGCGCACCGACCTGAACTACA
TCGCCGCCGTGGACCTGAGGACAGCCCAGACACCCGAGCACTGGGTGCT
GAGAGGCGTGGCACTGCTGTGCGACGTGAAGTGA (SEQ ID NO: 17) DNAH5
ATGTTCAGAATCGGCAGACGGCAGCTGTGGAAGCACAGCGTGACCAGAG Altered
TGCTGACCCAGCGGCTGAAGGGCGAGAAAGAGGCCAAGAGAGCCCTGCT Nucleotide
GGACGCCCGGCACAATTACCTGTTTGCCATCGTGGCCAGCTGCCTGGACC Usage 2
TGAACAAGACCGAGGTGGAAGATGCCATCCTGGAAGGCAACCAGATCGA
GCGGATCGACCAGCTGTTTGCCGTGGGCGGACTGCGGCACCTGATGTTCT
ATTATCAAGACGTGGAAGAGGCCGAGACAGGCCAGCTGGGATCTCTGGG
CGGAGTGAATCTGGTGTCCGGCAAGATCAAGAAACCCAAGGTGTTCGTG
ACCGAGGGCAACGACGTGGCCCTGACAGGCGTGTGCGTGTTCTTCATCAG
AACCGACCCCAGCAAGGCCATCACCCCCGACAACATCCACCAGGAAGTG
TCCTTCAACATGCTGGATGCCGCCGATGGCGGCCTGCTGAATTCTGTGCG
GAGACTGCTGAGCGACATCTTCATCCCCGCCCTGAGAGCCACATCTCACG
GCTGGGGAGAGCTGGAAGGACTGCAGGACGCCGCCAATATCCGGCAGGA
ATTTCTGAGCAGCCTGGAAGGATTCGTGAACGTGCTGTCTGGCGCCCAGG
AAAGCCTGAAAGAAAAAGTGAACCTGCGGAAGTGCGATATCCTGGAACT
GAAAACCCTGAAAGAGCCCACCGACTACCTGACCCTGGCCAACAACCCT
GAGACACTGGGCAAGATCGAGGACTGCATGAAAGTGTGGATCAAGCAGA
CCGAACAGGTGCTGGCCGAGAACAACCAGCTGCTGAAAGAAGCCGACGA
CGTGGGCCCAAGAGCCGAGCTGGAACACTGGAAGAAGCGGCTGAGCAAG
TTCAACTACCTGCTGGAACAGCTGAAGTCCCCCGACGTGAAGGCCGTGCT
GGCTGTGCTGGCAGCCGCCAAGAGCAAACTGCTGAAAACCTGGCGCGAG
ATGGACATCCGGATCACCGACGCCACCAACGAGGCCAAGGACAACGTGA
AGTACCTGTACACCCTGGAAAAGTGCTGCGACCCCCTGTACAGCAGCGAC
CCTCTGAGCATGATGGACGCCATCCCTACCCTGATCAACGCCATCAAGAT
GATCTACAGCATCAGCCACTACTACAACACCAGCGAGAAGATCACCAGC
CTGTTCGTGAAAGTGACCAATCAGATCATCAGCGCCTGCAAGGCCTACAT
CACCAACAACGGCACCGCCAGCATCTGGAACCAGCCCCAGGATGTGGTG
GAAGAGAAGATCCTGTCTGCCATCAAGCTGAAGCAGGAATACCAGCTGT
GTTTTCACAAGACCAAGCAGAAGCTGAAACAGAACCCCAACGCCAAGCA
GTTCGACTTCAGCGAGATGTATATCTTCGGCAAGTTCGAGACATTCCACC
GGCGGCTGGCCAAGATCATCGACATCTTTACCACCCTGAAAACATACAGC
GTGCTGCAGGACAGCACCATCGAGGGCCTGGAAGATATGGCCACCAAGT
ACCAGGGCATTGTGGCCACCATCAAGAAGAAAGAGTACAACTTCCTGGA
CCAGCGCAAGATGGACTTCGACCAGGACTACGAGGAATTCTGCAAGCAG
ACAAACGACCTGCACAACGAGCTGCGCAAGTTTATGGACGTGACCTTCGC
CAAGATCCAGAACACCAACCAGGCCCTGCGGATGCTGAAGAAGTTTGAG
AGACTGAACATCCCCAACCTGGGCATCGACGATAAGTACCAGCTGATCCT
GGAAAACTACGGCGCCGACATCGACATGATCAGCAAGCTGTACACAAAG
CAGAAGTACGACCCCCCCCTGGCCCGGAATCAGCCTCCTATCGCCGGCAA
AATCCTGTGGGCTAGACAGCTGTTTCACCGGATCCAGCAGCCCATGCAGC
TGTTCCAGCAGCACCCTGCCGTGCTGAGCACAGCCGAGGCCAAACCCATC
ATCCGGTCCTACAACCGGATGGCCAAGGTGCTGCTGGAATTCGAGGTGCT
GTTCCACCGGGCCTGGCTGCGGCAGATCGAAGAGATTCACGTGGGACTGG
AAGCCAGCCTGCTCGTGAAGGCTCCTGGAACCGGCGAGCTGTTTGTGAAC
TTCGACCCCCAGATCCTGATCCTGTTCCGGGAAACCGAGTGCATGGCCCA
GATGGGGCTGGAAGTGTCTCCTCTGGCCACCTCCCTGTTCCAGAAGCGGG
ACCGGTACAAGCGGAACTTCAGCAACATGAAGATGATGCTGGCTGAGTA
CCAGCGCGTGAAGTCCAAGATCCCCGCTGCCATCGAGCAGCTGATCGTGC
CTCACCTGGCCAAAGTGGACGAGGCCCTGCAGCCAGGACTGGCCGCTCTG
ACATGGACCAGCCTGAACATCGAGGCCTATCTGGAAAACACATTCGCCAA
AATCAAGGATCTGGAACTGCTGCTGGACCGCGTGAACGACCTGATCGAGT
TCCGGATCGACGCCATTCTGGAAGAGATGTCCAGCACCCCCCTGTGTCAG
CTGCCCCAGGAAGAACCCCTGACCTGCGAAGAGTTCCTGCAGATGACCAA
GGACCTGTGCGTGAACGGCGCCCAGATTCTGCACTTCAAGTCCAGCCTGG
TGGAAGAAGCCGTGAACGAGCTCGTGAATATGCTGCTGGATGTGGAAGT
GCTGAGCGAGGAAGAGTCCGAGAAGATCTCCAACGAGAACAGCGTGAAC
TACAAGAACGAGTCCAGCGCCAAGCGGGAAGAGGGCAACTTCGACACCC
TGACCAGCTCCATCAATGCCAGAGCCAACGCCCTGCTGCTGACCACCGTG
ACCCGGAAGAAAAAAGAAACCGAGATGCTGGGCGAAGAGGCTAGAGAG
CTGCTGTCCCACTTCAACCACCAGAACATGGATGCCCTGCTGAAAGTGAC
ACGGAATACCCTGGAAGCCATCCGGAAGCGGATCCACAGCAGCCACACC
ATCAACTTCCGGGACAGCAACAGCGCCAGCAATATGAAGCAGAACAGCC
TGCCCATCTTCCGGGCCTCCGTGACACTGGCCATCCCCAATATCGTGATG
GCCCCTGCTCTGGAAGATGTGCAGCAGACACTGAACAAGGCCGTGGAAT
GCATCATCTCCGTGCCCAAGGGCGTGCGGCAGTGGTCTAGCGAACTGCTG
TCCAAGAAGAAGATCCAGGAACGGAAAATGGCCGCCCTGCAGTCTAACG
AGGACAGCGACTCCGACGTGGAAATGGGCGAGAATGAGCTGCAGGATAC
ACTGGAAATCGCCTCTGTGAATCTGCCCATCCCCGTGCAGACCAAGAACT
ACTATAAGAACGTGTCCGAAAACAAAGAAATCGTGAAGCTGGTGTCTGT
GCTGTCCACCATCATCAACAGCACCAAGAAAGAAGTGATCACCTCCATGG
ACTGCTTCAAGCGGTACAACCACATCTGGCAGAAGGGCAAAGAAGAGGC
CATTAAGACCTTCATCACCCAGAGCCCCCTGCTGTCCGAGTTCGAGTCTC
AGATCCTGTACTTCCAGAACCTGGAACAGGAAATCAACGCCGAGCCCGA
GTACGTGTGTGTGGGCTCTATCGCCCTGTATACCGCCGACCTGAAGTTCG
CCCTGACCGCCGAGACAAAGGCCTGGATGGTCGTGATCGGCCGGCACTGC
AACAAAAAGTACAGATCCGAGATGGAAAACATCTTTATGCTGATTGAGG
AATTCAACAAGAAACTGAACCGGCCCATTAAGGACCTGGACGACATCAG
AATCGCCATGGCCGCACTGAAAGAGATCAGAGAGGAACAGATCAGCATC
GACTTCCAAGTGGGCCCCATCGAGGAAAGCTACGCTCTGCTGAACAGATA
CGGACTGCTGATCGCCCGGGAAGAGATCGACAAGGTGGACACCCTGCAC
TACGCCTGGGAGAAGCTGCTGGCTAGAGCCGGCGAGGTGCAGAACAAAC
TGGTGTCTCTGCAGCCCAGCTTTAAGAAAGAACTGATCTCCGCCGTGGAA
GTGTTTCTGCAGGACTGCCACCAGTTCTACCTGGACTACGACCTGAACGG
CCCCATGGCCTCTGGCCTGAAACCTCAGGAAGCCTCCGACCGGCTGATTA
TGTTTCAGAACCAGTTCGACAATATCTACCGGAAGTACATCACCTACACA
GGCGGCGAGGAACTGTTCGGCCTGCCTGCCACACAGTACCCCCAGCTGCT
GGAAATCAAGAAGCAGCTGAACCTGCTGCAGAAGATCTACACCCTGTAC
AACTCCGTGATCGAGACAGTGAACAGCTACTACGACATCCTGTGGAGCGA
AGTGAACATTGAGAAGATTAACAATGAACTGCTGGAATTTCAGAACCGGT
GCCGGAAGCTGCCCAGAGCACTGAAGGATTGGCAGGCCTTTCTGGATCTG
AAGAAAATCATCGACGACTTCTCCGAGTGCTGCCCTCTGCTGGAGTACAT
GGCCTCCAAGGCCATGATGGAACGGCACTGGGAGAGAATCACCACACTG
ACCGGCCACAGCCTGGACGTGGGCAACGAGAGCTTCAAGCTGCGGAACA
TCATGGAAGCCCCACTGCTGAAGTACAAAGAGGAAATCGAGGACATCTG
TATCAGCGCCGTGAAAGAGCGGGATATCGAGCAGAAACTGAAACAAGTG
ATCAACGAGTGGGACAACAAGACCTTTACCTTCGGCAGCTTCAAGACCAG
AGGCGAGCTGCTGCTGCGGGGCGATAGCACCTCTGAGATCATTGCCAACA
TGGAAGATAGCCTGATGCTGCTGGGCTCCCTGCTGAGCAACCGGTATAAC
ATGCCCTTCAAGGCTCAGATTCAGAAATGGGTGCAGTACCTGAGCAACTC
CACCGACATCATCGAGTCCTGGATGACCGTGCAGAACCTGTGGATCTACC
TGGAAGCCGTGTTCGTGGGCGGCGACATTGCCAAGCAGCTGCCCAAAGA
GGCTAAGCGGTTCTCCAACATCGACAAGAGCTGGGTCAAGATCATGACCA
GAGCCCACGAGGTGCCCAGCGTGGTGCAGTGCTGTGTGGGCGACGAAAC
ACTGGGACAGCTGCTGCCTCATCTGCTGGACCAGCTGGAAATCTGCCAGA
AGTCCCTGACCGGCTACCTGGAAAAGAAACGGCTGTGTTTCCCCCGGTTC
TTCTTCGTGTCCGACCCCGCCCTGCTGGAAATTCTGGGCCAGGCCAGCGA
CTCACACACAATTCAGGCCCATCTGCTGAATGTGTTCGATAACATCAAGA
GCGTGAAGTTCCACGAGAAAATCTACGACCGGATCCTGAGCATCAGCTCC
CAGGAAGGCGAGACAATCGAGCTGGACAAGCCTGTGATGGCCGAGGGAA
ACGTGGAAGTGTGGCTGAACAGCCTGCTGGAAGAGTCCCAGAGCAGCCT
GCACCTCGTGATCAGACAGGCCGCTGCCAACATCCAGGAAACCGGCTTTC
AGCTGACCGAGTTCCTGTCCAGCTTCCCAGCACAAGTGGGACTGCTGGGC
ATCCAGATGATTTGGACCAGAGACTCCGAAGAGGCCCTGAGAAACGCCA
AGTTCGATAAGAAAATTATGCAGAAAACAAATCAGGCATTTCTGGAACTG
CTGAACACCCTGATCGACGTGACCACCCGGGACCTGAGCAGCACCGAGA
GAGTGAAGTACGAGACACTGATCACCATCCACGTGCACCAGCGGGACAT
CTTCGACGACCTGTGCCACATGCACATCAAGTCTCCCATGGATTTCGAGT
GGCTGAAGCAGTGCAGGTTCTACTTCAACGAGGACTCCGACAAGATGATG
ATCCACATCACCGATGTGGCCTTTATCTATCAGAATGAGTTCCTGGGCTGT
ACCGATCGCCTCGTGATTACCCCCCTGACCGACCGGTGTTACATCACACT
GGCCCAGGCACTGGGCATGTCTATGGGAGGCGCACCAGCAGGACCTGCC
GGCACAGGCAAGACCGAAACCACCAAGGACATGGGACGCTGCCTGGGCA
AATACGTGGTGGTGTTCAACTGCAGCGACCAGATGGATTTCCGGGGCCTG
GGCCGGATCTTTAAGGGCCTGGCACAGAGCGGAAGCTGGGGCTGCTTCG
ACGAGTTCAACAGAATCGACCTGCCCGTGCTGTCCGTGGCCGCACAGCAG
ATCTCCATCATCCTGACATGCAAAAAAGAGCACAAGAAGTCCTTCATCTT
CACCGACGGCGACAATGTGACCATGAACCCCGAGTTTGGCCTGTTCCTGA
CAATGAACCCTGGCTACGCCGGACGGCAGGAACTGCCCGAGAACCTGAA
GATCAACTTTCGGAGTGTGGCTATGATGGTGCCCGACCGGCAGATCATTA
TCAGAGTGAAACTGGCCTCCTGCGGCTTCATCGACAACGTGGTGCTGGCT
CGGAAGTTCTTCACACTGTACAAGCTGTGCGAAGAACAGCTGAGTAAACA
GGTGCACTACGACTTCGGCCTGAGGAACATCCTGAGCGTGCTGAGAACTC
TGGGAGCCGCTAAGCGGGCCAACCCCATGGATACCGAGAGCACAATCGT
GATGCGGGTGCTGCGGGACATGAACCTGTCCAAGCTGATCGATGAGGAC
GAGCCCCTGTTTCTGTCTCTGATCGAGGATCTGTTTCCCAACATTCTGCTG
GATAAGGCCGGCTACCCCGAACTGGAAGCTGCTATCAGCAGACAGGTGG
AAGAGGCTGGCCTGATCAACCACCCCCCCTGGAAACTGAAAGTGATCCA
GCTGTTCGAGACACAGCGCGTGCGGCACGGCATGATGACACTGGGACCT
AGCGGAGCCGGCAAGACCACCTGTATCCACACACTGATGCGGGCCATGA
CCGATTGCGGCAAGCCCCACCGCGAGATGCGGATGAAC
CCCAAGGCCATTACCGCCCCTCAGATGTTCGGCAGACTGGACGTGGCCAC
CAACGACTGGACCGACGGCATCTTCAGCACCCTGTGGCGCAAGACCCTGC
GGGCCAAGAAGGGCGAGCACATCTGGATCATCCTGGACGGCCCCGTGGA
CGCCATCTGGATTGAGAACCTGAACAGCGTGCTGGACGACAACAAGACA
CTGACCCTGGCCAACGGCGACCGGATCCCCATGGCCCCCAACTGCAAGAT
CATCTTCGAGCCCCACAACATCGACAACGCCAGCCCTGCCACCGTGTCCA
GAAACGGCATGGTGTTCATGAGCAGCAGCATCCTGGATTGGAGCCCTATC
CTGGAAGGCTTCCTGAAGAAGCGGAGCCCCCAGGAAGCCGAGATCCTGA
GACAGCTGTACACCGAGAGCTTCCCCGACCTGTACCGGTTCTGCATCCAG
AATCTGGAGTACAAGATGGAAGTGCTGGAAGCCTTTGTGATCACCCAGAG
CATCAACATGCTGCAGGGCCTGATCCCCCTGAAAGAACAGGGCGGAGAA
GTGTCCCAGGCCCACCTGGGCAGACTGTTCGTGTTTGCCCTGCTGTGGAG
CGCTGGCGCCGCTCTGGAACTGGATGGAAGGCGGAGACTGGAACTGTGG
CTGCGGAGCAGACCTACCGGCACCCTGGAACTGCCTCCACCAGCTGGACC
TGGCGACACCGCCTTCGATTACTACGTGGCCCCTGACGGCACCTGGACCC
ACTGGAATACCCGGACCCAGGAATACCTGTACCCCAGCGACACCACCCCC
GAGTACGGCTCTATCCTGGTGCCCAACGTGGACAACGTGCGGACCGACTT
CCTGATCCAGACAATCGCCAAGCAGGGAAAGGCCGTGCTGCTGATCGGC
GAGCAGGGCACAGCCAAGACCGTGATCATCAAGGGCTTTATGTCTAAGTA
CGACCCCGAGTGCCACATGATCAAGAGCCTGAACTTCAGCTCCGCCACCA
CCCCACTGATGTTCCAGCGGACCATCGAGAGCTATGTGGACAAGCGGATG
GGCACCACCTACGGCCCTCCAGCCGGCAAGAAAATGACCGTGTTCATCGA
CGACGTGAACATGCCCATCATCAACGAGTGGGGCGACCAAGTGACCAAC
GAGATCGTGCGGCAGCTGATGGAACAGAACGGCTTCTACAACCTGGAAA
AGCCCGGCGAGTTCACCTCTATCGTGGACATCCAGTTTCTGGCCGCCATG
ATCCACCCTGGCGGCGGAAGAAACGACATCCCCCAGCGGCTGAAGCGGC
AGTTCAGCATCTTCAACTGCACCCTGCCCAGCGAGGCCAGCGTGGACAAG
ATCTTTGGCGTGATCGGCGTGGGCCACTACTGCACCCAGAGAGGCTTCAG
CGAGGAAGTGCGGGACAGCGTGACCAAGCTGGTGCCTCTGACAAGACGG
CTGTGGCAGATGACCAAGATCAAGATGCTGCCCACCCCCGCCAAGTTCCA
CTACGTGTTCAACCTGCGGGACCTGAGCAGAGTGTGGCAGGGAATGCTGA
ACACCACCAGCGAAGTGATCAAAGAGCCCAACGACCTGCTGAAGCTGTG
GAAGCACGAGTGCAAGAGAGTGATCGCCGACCGGTTCACCGTGTCTAGC
GACGTGACATGGTTCGACAAGGCCCTGGTGTCCCTGGTGGAAGAGGAATT
CGGCGAAGAGAAGAAACTGCTGGTGGACTGCGGCATCGATACCTACTTC
GTGGACTTCCTGCGCGACGCCCCTGAAGCCGCTGGCGAGACAAGTGAAG
AGGCCGACGCCGAGACACCCAAGATCTACGAGCCCATCGAGTCCTTCAGC
CATCTGAAAGAAAGGCTGAATATGTTCCTGCAGCTGTATAACGAGTCCAT
CCGGGGAGCCGGCATGGATATGGTGTTCTTTGCCGACGCCATGGTGCACC
TCGTGAAGATCAGCAGAGTGATCCGGACCCCCCAGGGCAACGCTCTGCTC
GTGGGAGTGGGAGGCTCTGGCAAGCAGAGCCTGACCAGACTGGCCAGCT
TTATCGCCGGCTACGTGTCCTTCCAGATCACCCTGACCCGGTCCTACAACA
CCAGCAACCTGATGGAAGATCTGAAGGTGCTGTACCGGACAGCCGGCCA
GCAGGGGAAGGGCATCACCTTCATCTTCACCGACAATGAGATCAAGGAC
GAGTCTTTCCTGGAGTATATGAACAATGTGCTGAGCAGCGGCGAGGTGTC
CAACCTGTTCGCCCGGGACGAGATCGACGAGATTAACAGCGACCTGGCCT
CCGTGATGAAGAAAGAATTCCCCCGGTGCCTGCCCACAAACGAGAACCT
GCACGACTACTTCATGTCCAGAGTGCGGCAGAATCTGCACATCGTGCTGT
GCTTCAGCCCCGTGGGCGAGAAGTTCAGAAACCGGGCCCTGAAGTTCCCC
GCCCTGATCAGCGGCTGCACCATCGACTGGTTCAGCCGGTGGCCTAAGGA
TGCCCTGGTGGCCGTGTCCGAGCACTTTCTGACCAGCTACGACATCGACT
GCAGCCTGGAAATCAAGAAAGAGGTGGTGCAGTGCATGGGCAGCTTCCA
GGACGGCGTGGCCGAGAAATGCGTGGACTACTTCCAGCGGTTCCGGCGG
AGCACCCACGTGACCCCTAAGAGCTACCTGAGCTTCATCCAGGGCTACAA
GTTCATCTACGGCGAGAAGCACGTGGAAGTGCGCACACTGGCCAACCGG
ATGAACACCGGCCTGGAAAAACTGAAAGAGGCCTCCGAGAGCGTGGCCG
CCCTGAGCAAAGAACTGGAAGCCAAAGAAAAAGAACTGCAGGTGGCCAA
CGATAAGGCCGACATGGTGCTGAAAGAAGTGACCATGAAGGCCCAGGCC
GCCGAGAAAGTGAAAGCCGAGGTGCAGAAAGTGAAGGACCGGGCCCAG
GCCATCGTGGACTCCATCAGCAAGGACAAGGCCATTGCCGAGGAAAAGC
TGGAAGCAGCCAAGCCCGCCCTGGAAGAGGCAGAAGCTGCTCTGCAGAC
CATCCGGCCCTCCGATATTGCCACAGTGCGGACCCTGGGAAGGCCCCCTC
ACCTGATCATGCGGATCATGGACTGTGTGCTGCTGCTGTTCCAGAGAAAG
GTGTCCGCCGTGAAGATCGACCTGGAAAAATCCTGCACCATGCCTAGCTG
GCAGGAATCCCTGAAGCTGATGACCGCCGGCAACTTCCTGCAGAACCTGC
AGCAGTTCCCCAAGGACACCATCAATGAGGAAGTGATCGAGTTCCTGAGC
CCCTACTTCGAGATGCCCGACTACAATATCGAAACCGCCAAACGCGTGTG
CGGCAACGTGGCCGGACTGTGCTCTTGGACCAAGGCTATGGCTAGCTTCT
TTAGCATTAACAAAGAGGTGCTGCCTCTGAAGGCCAACCTGGTGGTGCAG
GAAAACCGGCATCTGCTGGCCATGCAGGACCTGCAGAAAGCCCAGGCCG
AGCTGGACGATAAGCAGGCTGAGCTGGATGTGGTGCAGGCCGAGTACGA
GCAGGCCATGACCGAGAAGCAGACCCTGCTGGAAGATGCAGAGCGGTGC
AGACACAAGATGCAGACCGCCAGCACCCTGATCTCTGGACTGGCCGGCG
AAAAAGAGCGGTGGACCGAGCAGTCCCAGGAATTCGCCGCCCAGACCAA
GCGGCTCGTGGGAGATGTGCTGCTGGCCACCGCCTTTCTGAGCTACAGCG
GCCCCTTCAATCAGGAATTCAGGGACCTGCTGCTGAACGACTGGCGGAAA
GAGATGAAGGCCAGAAAGATCCCCTTCGGCAAGAATCTGAACCTGAGCG
AGATGCTGATCGACGCCCCCACCATCTCCGAGTGGAATCTGCAGGGACTG
CCCAACGATGACCTGTCCATCCAGAACGGAATCATCGTGACCAAAGCCTC
CAGATACCCCCTGCTGATTGACCCCCAGACACAGGGCAAGATTTGGATCA
AGAACAAAGAGAGCCGGAACGAGCTGCAGATCACCAGCCTGAACCACAA
GTACTTCCGGAACCACCTGGAAGATAGCCTGAGCCTGGGCAGGCCACTGC
TGATCGAGGATGTGGGCGAGGAACTGGACCCAGCCCTGGATAACGTGCT
GGAACGGAACTTCATCAAGACCGGCTCCACCTTCAAAGTGAAAGTGGGC
GACAAAGAAGTGGACGTGCTGGATGGCTTCCGGCTGTACATCACCACCAA
GCTGCCTAACCCCGCCTACACCCCTGAGATCAGCGCCCGGACCAGCATCA
TCGACTTCACCGTGACAATGAAGGGACTGGAAGATCAGCTGCTGGGACG
CGTGATCCTGACAGAGAAGCAGGAACTGGAAAAAGAACGGACCCATCTG
ATGGAAGATGTGACCGCCAACAAGCGGCGGATGAAGGAACTGGAAGATA
ACCTGCTGTACAGGCTGACCAGCACCCAGGGCAGTCTGGTGGAAGATGA
GAGCCTGATCGTGGTGCTGTCCAACACCAAGCGGACCGCAGAGGAAGTG
ACCCAGAAGCTGGAAATCAGCGCCGAGACAGAGGTGCAGATCAACAGCG
CCAGAGAAGAGTACCGGCCTGTGGCCACCCGGGGATCCATCCTGTACTTT
CTGATCACCGAGATGCGGCTCGTGAACGAGATGTACCAGACCAGCCTGCG
GCAGTTCCTGGGCCTGTTCGATCTGTCCCTGGCCAGAAGCGTGAAGTCCC
CCATCACCAGCAAGAGAATCGCCAACATCATCGAGCACATGACCTACGA
GGTGTACAAATACGCCGCCAGAGGCCTGTACGAGGAACACAAGTTTCTGT
TCACACTGCTGCTGACCCTGAAGATCGATATCCAGCGGAACAGAGTGAAG
CACGAAGAGTTTCTGACACTGATCAAGGGGGGAGCCTCCCTGGACCTGAA
GGCCTGTCCTCCCAAGCCCAGCAAGTGGATCCTGGACATCACCTGGCTGA
ATCTGGTGGAACTGAGCAAGCTGAGACAGTTCTCCGATGTGCTGGACCAG
ATCAGCCGCAACGAGAAGATGTGGAAGATTTGGTTTGACAAAGAGAACC
CCGAGGAAGAACCCCTGCCTAACGCCTACGATAAGAGCCTGGACTGCTTC
CGGCGGCTGCTGCTGATTAGAAGCTGGTGTCCCGACCGGACAATCGCCCA
GGCCCGCAAGTACATCGTGGATAGCATGGGAGAGAAGTACGCCGAGGGC
GTGATCCTGGACCTGGAAAAGACCTGGGAGGAAAGCGACCCCAGAACCC
CCCTGATCTGCCTGCTGAGCATGGGCTCCGACCCCACCGACAGCATTATC
GCCCTGGGCAAGAGACTGAAGATTGAGACAAGATACGTGTCCATGGGCC
AGGGCCAGGAAGTGCACGCTAGAAAGCTGCTGCAGCAGACTATGGCCAA
TGGCGGCTGGGCCCTGCTGCAGAATTGTCACCTGGGGCTGGACTTCATGG
ACGAACTGATGGACATCATCATTGAGACAGAGCTGGTGCACGACGCCTTC
AGACTGTGGATGACCACCGAGGCCCATAAGCAGTTTCCCATTACCCTGCT
GCAGATGAGCATCAAGTTCGCCAACGACCCCCCTCAGGGACTGAGAGCC
GGCCTGAAGAGAACCTACTCCGGCGTGTCACAGGATCTGCTGGACGTGTC
CTCTGGCAGCCAGTGGAAGCCTATGCTGTACGCCGTGGCATTCCTGCACA
GCACCGTGCAGGAACGGCGGAAGTTTGGCGCCCTGGGATGGAACATCCC
CTACGAGTTTAACCAGGCCGACTTCAACGCCACTGTGCAGTTTATCCAGA
ACCATCTGGACGACATGGACGTGAAGAAAGGGGTGTCCTGGACAACCAT
CCGGTACATGATCGGAGAGATCCAGTACGGCGGCAGAGTGACCGACGAC
TACGACAAGAGGCTGCTGAATACCTTCGCCAAAGTGTGGTTCTCCGAGAA
CATGTTTGGCCCCGACTTCAGCTTTTACCAGGGCTATAACATCCCCAAGTG
CTCCACCGTGGATAACTACCTGCAGTACATCCAGAGCCTGCCCGCCTACG
ACAGCCCTGAGGTGTTCGGACTGCACCCCAACGCCGATATCACCTACCAG
AGCAAACTGGCCAAGGATGTGCTGGATACCATCCTGGGCATCCAGCCCAA
GGATACCAGTGGCGGAGGCGACGAAACCCGGGAAGCAGTGGTGGCTAGA
CTGGCCGACGACATGCTGGAAAAGCTGCCCCCCGACTACGTGCCCTTTGA
AGTGAAAGAACGCCTGCAGAAGATGGGCCCCTTCCAGCCTATGAACATCT
TCCTGAGGCAGGAAATCGACCGGATGCAGCGGGTGCTGTCTCTCGTGCGG
AGCACACTGACCGAGCTGAAACTGGCTATCGACGGCACCATCATCATGAG
CGAGAATCTGCGGGATGCACTGGACTGCATGTTCGACGCCAGAATCCCCG
CATGGTGGAAAAAGGCCAGCTGGATCAGCTCTACCCTGGGCTTCTGGTTC
ACCGAACTGATCGAGAGAAACAGCCAGTTTACCAGCTGGGTGTTCAACG
GCAGACCTCACTGCTTCTGGATGACCGGCTTCTTCAATCCACAAGGCTTTC
TGACAGCAATGCGCCAGGAAATCACCAGAGCCAACAAGGGCTGGGCTCT
GGACAATATGGTGCTGTGTAACGAAGTGACTAAGTGGATGAAGGACGAC
ATCAGCGCCCCTCCCACAGAGGGCGTGTACGTGTACGGCCTGTACCTGGA
AGGCGCCGGATGGGACAAGAGAAACATGAAGCTGATCGAGAGCAAGCCC
AAGGTGCTGTTCGAGCTGATGCCCGTGATCAGGATCTATGCCGAGAACAA
CACCCTGAGGGACCCCCGGTTCTACAGCTGCCCCATCTACAAGAAACCCG
TGCGCACCGACCTGAACTATATCGCCGCCGTGGACCTGAGGACAGCCCAG
ACACCTGAGCATTGGGTGCTGAGAGGCGTGGCACTGCTGTGCGACGTGAA GTGA (SEQ ID NO:
18)
Nucleic Acid Constructs, Vectors, and Engineered
Polyribonucleotides
[0100] The present disclosure provides nucleic acid molecules, such
as polynucleotides, which encode one or more polypeptides of
interest. The term nucleic acid includes any compound and/or
substance that comprise a polymer of nucleotides. Nucleotide
polymers that contain greater than 50% of ribose bases or
ribonucleotide analogues are referred to as polyribonucleotides.
Nucleotide polymers may use altered nucleotide usage that encode a
protein or functional fragment thereof, such as DNAI1 or DNAH5. The
sequence of the engineered polynucleotides can be derived from, for
example, DNA, RNA, mRNA transcripts, genomic DNA, mitochondrial
DNA, mitochondrial RNA, or another suitable nucleic acid that
comprises the genetic information of a gene of interest. The
nucleic acid constructs, vectors, engineered polyribonucleotides,
or compositions can be derived from nucleic acids carrying mutated
genes and polymorphisms.
[0101] In addition to the four canonical ribonucleotides, namely,
adenosine, guanosine, cytidine and uridine, several cellular RNAs
also contain a number of structurally diverse ribonucleotides.
About a hundred structurally different nucleotides or nucleotide
analogues have been identified in transfer RNAs (tRNAs), ribosomal
RNAs (rRNAs), messenger RNAs (mRNAs) and small nuclear RNAs
(snRNAs). In tRNAs, some nucleotides can be important determinants
of the specificity and efficiency of aminoacylation and codon
recognition. Such structurally diverse ribonucleotides can be a
modified ribonucleotide or a nucleotide analogue. In some cases, a
polynucleotide of the disclosure is engineered to comprise a
ribonucleotide analogue.
[0102] In some cases, a nucleic acid construct, a vector, or a
polynucleotide is engineered to contain the four classical
ribonucleotides and can be modified post-transcriptionally, after
being administered to a subject. For instance, in some cases the
disclosure provides a composition, vector, or a nucleic acid
construct comprising a nucleic acid construct encoding dynein
axonemal intermediate chain 1, wherein fewer than 30% of the
nucleic acids encoding dynein axonemal intermediate chain 1 are
nucleotide analogues. In other cases, fewer than 27.5%, fewer than
25%, fewer than 22.5%, fewer than 20%, fewer than 17.5%, fewer than
15%, fewer than 12.5%, fewer than 10%, fewer than 7.5%, fewer than
5%, or fewer than 2.5% of the nucleotides encoding dynein axonemal
intermediate chain 1 are nucleotide analogues.
[0103] Exemplary nucleic acids that can form a polynucleotide of
the disclosure include, but are not limited to, ribonucleic acids
(RNAs), deoxyribonucleic acids (DNAs), or hybrids thereof.
Exemplary modified nucleotides that can form at least a fraction of
a polynucleotide of the disclosure include, but are not limited to,
pseudouridine (T) and 1-methylpseudouridine (m.sup.1.PSI.).
[0104] A chemical modification can be located on one or more
nucleoside(s) or the backbone of the nucleic acid molecule. They
can be located on both a nucleoside and a backbone linkage. A
modification can be engineered into a polynucleotide in vitro.
Modified ribonucleotides and nucleic acid analogues can also be
introduced post-transcriptionally by covalent modification of the
classical ribonucleotides.
[0105] A nucleic acid construct, a vector, or an engineered
polyribonucleotide of the disclosure can comprise purine and
pyrimidine analogues. In some cases, a polyribonucleotide of the
disclosure comprises a modified pyrimidine, such as a modified
uridine. In some cases a uridine analogue is selected from
pseudouridine (.PSI.), 1-methylpseudouridine (m.sup.1.PSI.),
2-thiouridine (s.sup.2U), 5-methyluridine (m.sup.5U),
5-methoxyuridine (mo.sup.5U), 4-thiouridine (s.sup.4U),
5-bromouridine (Br.sup.5U), 2'O-methyluridine (U2'm),
2'-amino-2'-deoxyuridine (U2'NH.sub.2), 2'-azido-2'-deoxyuridine
(U2'N.sub.3), and 2'-fluoro-2'-deoxyuridine (U2F).
[0106] In some instances, the nucleic acid construct(s), vector(s),
engineered polyribonucleotide(s), or composition(s) encodes dynein
axonemal intermediate chain 1 protein or a variant thereof at a
level that is increased by a factor of at least about 1.5 as
compared to levels within cells exposed to a composition comprising
a nucleic acid construct that does not include the codons encoding
dynein axonemal intermediate chain 1 protein or a variant thereof.
In some cases, the factor is at least about 1.1, at least about
1.2, at least about 1.3, at least about 1.4, at least about 1.5, at
least about 2, at least about 3, at least about 4, at least about
5, at least about 10, at least about 20, at least about 30, at
least about 40, at least about 50, at least about 60, at least
about 70, at least about 80, at least about 90, or at least about
100.
[0107] A polyribonucleotide can have the same or a mixture of
different nucleotide analogues or modified nucleotides. The
nucleotide analogues or modified nucleotides can have structural
changes that are naturally or not naturally occurring in messenger
RNA. A mixture of various analogues or modified nucleotides can be
used. For example one or more analogues within a polynucleotide can
have natural modifications, while another part has modifications
that are not naturally found in mRNA. Additionally, some analogues
or modified ribonucleotides can have a base modification, while
other modified ribonucleotides have a sugar modification. In the
same way, it is possible that all modifications are base
modifications or all modifications are sugar modifications or any
suitable mixture thereof.
[0108] A nucleotide analogue or modified nucleotide can be selected
from the group comprising pyridin-4-one ribonucleoside,
5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine,
4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine,
3-methyluridine, 5-carboxymethyl-uridine,
1-carboxymethyl-pseudouridine, 5-propynyl-uridine,
1-propynyl-pseudouridine, 5-taurinomethyluridine,
1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine,
1-taurinomethyl-4-thio-uridine, 5-methyl-uridine,
1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine,
2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine,
2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine,
dihydropseudouridine, 2-thio-dihydrouridine,
2-thio-dihydropseudouridine, 2-methoxyuridine,
2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine,
4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine,
3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine,
N4-methylcytidine, 5-hydroxymethylcytidine,
1-methyl-pseudoisocytidine, pyrrolo-cytidine,
pyrrolo-pseudoisocytidine, 2-thio-cytidine,
2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine,
4-thio-1-methyl-pseudoisocytidine,
4-thio-1-methyl-1-deaza-pseudoisocytidine,
1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine,
5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine,
2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine,
4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine,
2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine,
7-deaza-8-aza-adenine, 7-deaza-2-aminopurine,
7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine,
7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine,
N6-methyladenosine, N6-isopentenyladenosine,
N6-(cis-hydroxyisopentenyl)adenosine,
2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine,
N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine,
2-methylthio-N6-threonyl carbamoyladenosine,
N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine,
2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine,
7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine,
6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine,
7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine,
6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine,
N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine,
1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and
N2,N2-dimethyl-6-thio-guanosine.
[0109] In some cases, at least about 5% of the nucleic acid
construct(s), a vector(s), engineered polyribonucleotide(s), or
compositions includes non-naturally occurring (e.g., modified,
analogues, or engineered) uridine, adenosine, guanine, or cytosine,
such as the nucleotides described herein. In some cases, 100% of
the modified nucleotides in the composition are either
1-methylpseudouridine or pseudouridine. In some cases, at least
about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95% of the nucleic acid construct(s), a
vector(s), engineered polyribonucleotide(s), or compositions
includes non-naturally occurring uracil, adenine, guanine, or
cytosine. In some cases, at most about 99%, 95%, 90%, 85%, 80%,
75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%,
10%, 5%, 1%, of the nucleic acid construct(s), a vector(s),
engineered polyribonucleotide(s), or compositions includes
non-naturally occurring uracil, adenine, guanine, or cytosine.
[0110] A nucleic acid construct(s), a vector(s), or an engineered
polyribonucleotide(s) of the disclosure can comprise one or more
promoter sequences and any associated regulatory sequences. A
promoter sequence and/or an associated regulatory sequence can
comprise any number of modified or unmodified nucleotides, and any
number of nucleic acid analogues. Promoter sequences and/or any
associated regulatory sequences can comprise, for example, at least
2 bases or base pairs, 3 bases or base pairs, 4 bases or base
pairs, 5 bases or base pairs, 6 bases or base pairs, 7 bases or
base pairs, 8 bases or base pairs, 9 bases or base pairs, 10 bases
or base pairs, 11 bases or base pairs, 12 bases or base pairs, 13
bases or base pairs, 14 bases or base pairs, 15 bases or base
pairs, 16 bases or base pairs, 17 bases or base pairs, 18 bases or
base pairs, 19 bases or base pairs, 20 bases or base pairs, 21
bases or base pairs, 22 bases or base pairs, 23 bases or base
pairs, 24 bases or base pairs, 25 bases or base pairs, 26 bases or
base pairs, 27 bases or base pairs, 28 bases or base pairs, 29
bases or base pairs, 30 bases or base pairs, 35 bases or base
pairs, 40 bases or base pairs, 50 bases or base pairs, 75 bases or
base pairs, 100 bases or base pairs, 150 bases or base pairs, 200
bases or base pairs, 300 bases or base pairs, 400 bases or base
pairs, 500 bases or base pairs, 600 bases or base pairs, 700 bases
or base pairs, 800 bases or base pairs, 900 bases or base pairs,
1000 bases or base pairs, 2000 bases or base pairs, 3000 bases or
base pairs, 4000 bases or base pairs, 5000 bases or base pairs, at
least 10000 bases or base pairs or more. A promoter sequence and/or
an associated regulatory sequence can comprise any number of
modified or unmodified nucleotides, for example, at most 10000
bases or base pairs, 5000 bases or base pairs, 4000 bases or base
pairs, 3000 bases or base pairs, 2000 bases or base pairs, 1000
bases or base pairs, 900 bases or base pairs, 800 bases or base
pairs, 700 bases or base pairs, 600 bases or base pairs, 500 bases
or base pairs, 400 bases or base pairs, 300 bases or base pairs,
200 bases or base pairs, 100 bases or base pairs, 75 bases or base
pairs, 50 bases or base pairs, 40 bases or base pairs, 35 bases or
base pairs, 30 bases or base pairs, 29 bases or base pairs, 28
bases or base pairs, 27 bases or base pairs, 26 bases or base
pairs, 25 bases or base pairs, 24 bases or base pairs, 23 bases or
base pairs, 22 bases or base pairs, 21 bases or base pairs, 20
bases or base pairs, 19 bases or base pairs, 18 bases or base
pairs, 17 bases or base pairs, 16 bases or base pairs, 15 bases or
base pairs, 14 bases or base pairs, 13 bases or base pairs, 12
bases or base pairs, 11 bases or base pairs, 10 bases or base
pairs, 9 bases or base pairs, 8 bases or base pairs, 7 bases or
base pairs, 6 bases or base pairs, 5 bases or base pairs, 4 bases
or base pairs, 3 bases or base pairs or 2 bases or base pairs.
[0111] In some cases, less than all of the nucleotides in the
promoter sequence or associated regulatory region are nucleotide
analogues or modified nucleotides. For instance, in some cases,
less than or equal to 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%,
55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of the
nucleotides in a promoter or associated regulatory region. In some
cases, all of the nucleotides in a promoter or associated
regulatory region are nucleic acid analogues or modified
nucleotides.
[0112] A nucleic acid construct(s), a vector(s), an engineered
polyribonucleotide(s), or compositions of the disclosure can
comprise an engineered 5' cap structure, or a 5'-cap can be added
to a polyribonucleotide intracellularly. The 5'cap structure of an
mRNA can be involved in binding to the mRNA Cap Binding Protein
(CBP), which is responsible for mRNA stability in the cell and
translation competency through the association of CBP with poly(A)
binding protein to form the mature pseudo-circular mRNA species.
The 5'cap structure can also be involved in nuclear export,
increases in mRNA stability, and in assisting the removal of 5'
proximal introns during mRNA splicing.
[0113] A nucleic acid construct(s), a vector(s), or an engineered
polyribonucleotide(s) can be 5'-end capped generating a
5'-GpppN-3'-triphosphate linkage between a terminal guanosine cap
residue and the 5'-terminal transcribed sense nucleotide of the
mRNA molecule. The cap-structure can comprise a modified or
unmodified 7-methylguanosine linked to the first nucleotide via a
5'-5' triphosphate bridge. This 5'-guanylate cap can then be
methylated to generate an N7-methyl-guanylate residue (Cap-0
structure). The ribose sugars of the terminal and/or anteterminal
transcribed nucleotides of the 5' end of the mRNA may optionally
also be 2'-O-methylated (Cap-1 structure). 5'-decapping through
hydrolysis and cleavage of the guanylate cap structure may target a
nucleic acid molecule, such as an mRNA molecule, for
degradation.
[0114] In some cases, a cap can comprise further modifications,
including the methylation of the 2' hydroxy-groups of the first 2
ribose sugars of the 5' end of the mRNA. For instance, an
eukaryotic cap-1 has a methylated 2'-hydroxy group on the first
ribose sugar, while a cap-2 has methylated 2'-hydroxy groups on the
first two ribose sugars. The 5' cap can be chemically similar to
the 3' end of an RNA molecule (the 5' carbon of the cap ribose is
bonded, and the free 3'-hydroxyls on both 5'- and 3'-ends of the
capped transcripts. Such double modification can provide
significant resistance to 5' exonucleases. Non-limiting examples of
5' cap structures that can be used with an engineered
polyribonucleotide include, but are not limited to,
m.sup.7G(5')ppp(5')N(Cap-0), m.sup.7G(5')ppp(5')N1mpNp (Cap-1), and
m.sup.7G(5')-ppp(5)N1mpN2mp (Cap-2).
[0115] Modifications to the modified mRNA of the present disclosure
may generate a non-hydrolyzable cap structure preventing decapping
and thus increasing mRNA half-life while facilitating efficient
translation. Because cap structure hydrolysis requires cleavage of
5'-ppp-5'triphosphate linkages, modified nucleotides may be used
during the capping reaction. For example, a Vaccinia Capping Enzyme
from New England Biolabs (Ipswich, Mass.) may be used with
guanosine .alpha.-thiophosphate nucleotides according to the
manufacturer's instructions to create a phosphorothioate linkage in
the 5'-ppp-5' cap. Additional modified guanosine nucleotides may be
used such as .alpha.-methyl-phosphonate and seleno-phosphate
nucleotides. Additional modifications include, but are not limited
to, 2'-O-methylation of the ribose sugars of 5'-terminal and/or
5'-anteterminal nucleotides of the mRNA on the 2'-hydroxyl group of
the sugar ring. Multiple distinct 5'-cap structures can be used to
generate the 5'-cap of a polyribonucleotide.
[0116] The modified mRNA may be capped post-transcriptionally.
According to the present disclosure, 5' terminal caps may include
endogenous caps or cap analogues. According to the present
disclosure, a 5' terminal cap may comprise a guanine analogue.
Useful guanine analogues include, but are not limited to, inosine,
N1-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine,
8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and
2-azido-guanosine.
[0117] Further, a nucleic acid construct(s), a vector(s), or an
engineered polyribonucleotide(s) can contain one or more internal
ribosome entry site(s) (IRES). IRES sequences can initiate protein
synthesis in absence of the 5' cap structure. An IRES sequence can
also be the sole ribosome binding site, or it can serve as one of
multiple ribosome binding sites of an mRNA. Engineered
polyribonucleotides containing more than one functional ribosome
binding site can encode several peptides or polypeptides that are
translated by the ribosomes ("polycistronic or multicistronic
polynucleotides"). An engineered polynucleotide described here can
comprise at least 1 IRES sequence, two IRES sequences, three IRES
sequences, four IRES sequences, five IRES sequences, six IRES
sequences, seven IRES sequences, eight IRES sequences, nine IRES
sequences, ten IRES sequences, or another suitable number are
present in an engineered polyribonucleotide. Examples of IRES
sequences that can be used according to the present disclosure
include without limitation, those from tobacco etch virus (TEV),
picornaviruses (e.g., FMDV), pest viruses (CFFV), polio viruses
(PV), encephalomyocarditis viruses (EMCV), foot-and-mouth disease
viruses (FMDV), hepatitis C viruses (HCV), classical swine fever
viruses (CSFV), murine leukemia virus (MLV), simian immune
deficiency viruses (SIV) or cricket paralysis viruses (CrPV). An
IRES sequence can be derived, for example, from commercially
available vectors such as the IRES sequences available from
Clontech.TM., GeneCopoeia.TM., or Sigma-Aldrich.TM.. IRES sequences
can be, for example, at least 150 bases or base pairs, 200 bases or
base pairs, 300 bases or base pairs, 400 bases or base pairs, 500
bases or base pairs, 600 bases or base pairs, 700 bases or base
pairs, 800 bases or base pairs, 900 bases or base pairs, 1000 bases
or base pairs, 2000 bases or base pairs, 3000 bases or base pairs,
4000 bases or base pairs, 5000 bases or base pairs, or 10000 bases
or base pairs. IRES sequences can at most 10000 bases or base
pairs, 5000 bases or base pairs, 4000 bases or base pairs, 3000
bases or base pairs, 2000 bases or base pairs, 1000 bases or base
pairs, 900 bases or base pairs, 800 bases or base pairs, 700 bases
or base pairs, 600 bases or base pairs, 500 bases or base pairs,
400 bases or base pairs, 300 bases or base pairs, 200 bases or base
pairs, 100 bases or base pairs, 50 bases or base pairs, or 10 bases
or base pairs.
[0118] A nucleic acid construct(s), a vector(s), or an engineered
polyribonucleotide(s) of the disclosure can comprise one or more
untranslated regions. An untranslated region can comprise any
number of modified or unmodified nucleotides. Untranslated regions
(UTRs) of a gene are transcribed but not translated into a
polypeptide. In some cases, an untranslated sequence can increase
the stability of the nucleic acid molecule and the efficiency of
translation. The regulatory features of a UTR can be incorporated
into the modified mRNA molecules of the present disclosure, for
instance, to increase the stability of the molecule. The specific
features can also be incorporated to ensure controlled
down-regulation of the transcript in case they are misdirected to
undesired organs sites. Some 5' UTRs play roles in translation
initiation. A 5' UTR can comprise a Kozak sequence which is
involved in the process by which the ribosome initiates translation
of many genes. Kozak sequences can have the consensus GCC(R)CCAUGG,
where R is a purine (adenine or guanine) that is located three
bases upstream of the start codon (AUG). 5' UTRs may form secondary
structures which are involved in binding of translation elongation
factor. In some cases, one can increase the stability and protein
production of the engineered polynucleotide molecules of the
disclosure, by engineering the features typically found in
abundantly expressed genes of specific target organs. For example,
introduction of 5'UTR of liver-expressed mRNA, such as albumin,
serum amyloid A, Apolipoprotein AB/E, transferrin, alpha
fetoprotein, erythropoietin, or Factor VIII, can be used to
increase expression of an engineered polynucleotide in a liver.
Likewise, use of 5' UTR from muscle proteins (MyoD, Myosin,
Myoglobin, Myogenin, Herculin), for endothelial cells (Tie-1,
CD36), for myeloid cells (C/EBP, AML1, G-CSF, GM-CSF, CD1 lb, MSR,
Fr-1, i-NOS), for leukocytes (CD45, CD18), for adipose tissue
(CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells
(SP-A/B/C/D) can be used to increase expression of an engineered
polynucleotide in a desired cell or tissue.
[0119] Other non-UTR sequences can be incorporated into the 5' (or
3' UTR) UTRs of the polyribonucleotides of the present disclosure.
The 5' and/or 3' UTRs can provide stability and/or translation
efficiency of polyribonucleotides. For example, introns or portions
of intron sequences can be incorporated into the flanking regions
of an engineered polyribonucleotide. Incorporation of intronic
sequences can also increase the rate of translation of the
polyribonucleotide.
[0120] 3' UTRs may have stretches of Adenosines and Uridines
embedded therein. These AU rich signatures are particularly
prevalent in genes with high rates of turnover. Based on their
sequence features and functional properties, the AU rich elements
(AREs) can be separated into classes: Class I AREs contain several
dispersed copies of an AUUUA motif within U-rich regions. C-Myc and
MyoD contain class I AREs. Class II AREs possess two or more
overlapping UUAUUUA(U/A)(U/A) nonamers. Molecules containing this
type of AREs include GM-CSF and TNF-.alpha.. Class III ARES are
less well defined. These U rich regions do not contain an AUUUA
motif c-Jun and Myogenin are two well-studied examples of this
class. Proteins binding to the AREs may destabilize the messenger,
whereas members of the ELAV family, such as HuR, may increase the
stability of mRNA. HuR may bind to AREs of all the three classes.
Engineering the HuR specific binding sites into the 3' UTR of
nucleic acid molecules can lead to HuR binding and thus,
stabilization of the message in vivo.
[0121] Engineering of 3' UTR AU rich elements (AREs) can be used to
modulate the stability of an engineered polyribonucleotide. One or
more copies of an ARE can be engineered into a polyribonucleotide
to modulate the stability of a polyribonucleotide. AREs can be
identified, removed or mutated to increase the intracellular
stability and thus increase translation and production of the
resultant protein. Transfection experiments can be conducted in
relevant cell lines, using engineered polyribonucleotides and
protein production can be assayed at various time points
post-transfection. For example, cells can be transfected with
different ARE-engineering molecules and by using an ELISA kit to
the relevant protein and assaying protein produced at 6 hours, 12
hours, 24 hours, 48 hours, and 7 days post-transfection.
[0122] An untranslated region can comprise any number of
nucleotides. An untranslated region can comprise a length of about
1 to about 10 bases or base pairs, about 10 to about 20 bases or
base pairs, about 20 to about 50 bases or base pairs, about 50 to
about 100 bases or base pairs, about 100 to about 500 bases or base
pairs, about 500 to about 1000 bases or base pairs, about 1000 to
about 2000 bases or base pairs, about 2000 to about 3000 bases or
base pairs, about 3000 to about 4000 bases or base pairs, about
4000 to about 5000 bases or base pairs, about 5000 to about 6000
bases or base pairs, about 6000 to about 7000 bases or base pairs,
about 7000 to about 8000 bases or base pairs, about 8000 to about
9000 bases or base pairs, or about 9000 to about 10000 bases or
base pairs in length. An untranslated region can comprise a length
of for example, at least 1 base or base pair, 2 bases or base
pairs, 3 bases or base pairs, 4 bases or base pairs, 5 bases or
base pairs, 6 bases or base pairs, 7 bases or base pairs, 8 bases
or base pairs, 9 bases or base pairs, 10 bases or base pairs, 20
bases or base pairs, 30 bases or base pairs, 40 bases or base
pairs, 50 bases or base pairs, 60 bases or base pairs, 70 bases or
base pairs, 80 bases or base pairs, 90 bases or base pairs, 100
bases or base pairs, 200 bases or base pairs, 300 bases or base
pairs, 400 bases or base pairs, 500 bases or base pairs, 600 bases
or base pairs, 700 bases or base pairs, 800 bases or base pairs,
900 bases or base pairs, 1000 bases or base pairs, 2000 bases or
base pairs, 3000 bases or base pairs, 4000 bases or base pairs,
5000 bases or base pairs, 6000 bases or base pairs, 7000 bases or
base pairs, 8000 bases or base pairs, 9000 bases or base pairs, or
10000 bases or base pairs in length.
[0123] An engineered polyribonucleotide of the disclosure can
comprise one or more introns. An intron can comprise any number of
modified or unmodified nucleotides. An intron can comprise, for
example, at least 1 base or base pair, 50 bases or base pairs, 100
bases or base pairs, 150 bases or base pairs, 200 bases or base
pairs, 300 bases or base pairs, 400 bases or base pairs, 500 bases
or base pairs, 600 bases or base pairs, 700 bases or base pairs,
800 bases or base pairs, 900 bases or base pairs, 1000 bases or
base pairs, 2000 bases or base pairs, 3000 bases or base pairs,
4000 bases or base pairs, or 5000 bases or base pairs. In some
cases, an intron can comprise, for example, at most 10000 bases or
base pairs, 5000 bases or base pairs, 4000 bases or base pairs,
3000 bases or base pairs, 2000 bases or base pairs, 1000 bases or
base pairs, 900 bases or base pairs, 800 bases or base pairs, 700
bases or base pairs, 600 bases or base pairs, 500 bases or base
pairs, 400 bases or base pairs, 300 bases or base pairs, 200 bases
or base pairs, or 100 bases or base pairs.
[0124] In some cases, a percentage of the nucleotides in an intron
are modified. For instance, in some cases, fewer than 99%, 95%,
90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%,
25%, 20%, 15%, 10%, 5% or 1% of the nucleotides in an intron are
modified. In some cases, all of the nucleotides in an intron are
modified.
[0125] An engineered polyribonucleotide of the disclosure can
comprise a polyA sequence. A polyA sequence (e.g., polyA tail) can
comprise any number of nucleotides. A polyA sequence can comprise a
length of about 1 to about 10 bases or base pairs, about 10 to
about 20 bases or base pairs, about 20 to about 50 bases or base
pairs, about 50 to about 100 bases or base pairs, about 100 to
about 500 bases or base pairs, about 500 to about 1000 bases or
base pairs, about 1000 to about 2000 bases or base pairs, about
2000 to about 3000 bases or base pairs, about 3000 to about 4000
bases or base pairs, about 4000 to about 5000 bases or base pairs,
about 5000 to about 6000 bases or base pairs, about 6000 to about
7000 bases or base pairs, about 7000 to about 8000 bases or base
pairs, about 8000 to about 9000 bases or base pairs, or about 9000
to about 10000 bases or base pairs in length. In some examples, a
polyA sequence is at least about 100, 110, 120, 130, 140, 150, 160,
170, 180, 190, or 200 nucleotides in length. A polyA sequence can
comprise a length of for example, at least 1 base or base pair, 2
bases or base pairs, 3 bases or base pairs, 4 bases or base pairs,
5 bases or base pairs, 6 bases or base pairs, 7 bases or base
pairs, 8 bases or base pairs, 9 bases or base pairs, 10 bases or
base pairs, 20 bases or base pairs, 30 bases or base pairs, 40
bases or base pairs, 50 bases or base pairs, 60 bases or base
pairs, 70 bases or base pairs, 80 bases or base pairs, 90 bases or
base pairs, 100 bases or base pairs, 200 bases or base pairs, 300
bases or base pairs, 400 bases or base pairs, 500 bases or base
pairs, 600 bases or base pairs, 700 bases or base pairs, 800 bases
or base pairs, 900 bases or base pairs, 1000 bases or base pairs,
2000 bases or base pairs, 3000 bases or base pairs, 4000 bases or
base pairs, 5000 bases or base pairs, 6000 bases or base pairs,
7000 bases or base pairs, 8000 bases or base pairs, 9000 bases or
base pairs, or 10000 bases or base pairs in length. A polyA
sequence can comprise a length of at most 100 bases or base pairs,
90 bases or base pairs, 80 bases or base pairs, 70 bases or base
pairs, 60 bases or base pairs, 50 bases or base pairs, 40 bases or
base pairs, 30 bases or base pairs, 20 bases or base pairs, 10
bases or base pairs, or 5 bases or base pairs.
[0126] In some cases, a percentage of the nucleotides in a poly-A
sequence are modified. For instance, in some cases, fewer than 99%,
95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%,
30%, 25%, 20%, 15%, 10%, 5% or 1% of the nucleotides in a poly-A
sequence are modified. In some cases, all of the nucleotides in a
poly-A are modified.
[0127] A linker sequence can comprise any number of nucleotides. A
linker can be attached to the modified nucleobase at an N-3 or C-5
position. The linker attached to the nucleobase can be diethylene
glycol, dipropylene glycol, triethylene glycol, tripropylene
glycol, tetraethylene glycol, tetraethylene glycol, divalent alkyl,
alkenyl, alkynyl moiety, ester, amide, or an ether moiety. A linker
sequence can comprise a length of about 1 to about 10 bases or base
pairs, about 10 to about 20 bases or base pairs, about 20 to about
50 bases or base pairs, about 50 to about 100 bases or base pairs,
about 100 to about 500 bases or base pairs, about 500 to about 1000
bases or base pairs, about 1000 to about 2000 bases or base pairs,
about 2000 to about 3000 bases or base pairs, about 3000 to about
4000 bases or base pairs, about 4000 to about 5000 bases or base
pairs, about 5000 to about 6000 bases or base pairs, about 6000 to
about 7000 bases or base pairs, about 7000 to about 8000 bases or
base pairs, about 8000 to about 9000 bases or base pairs, or about
9000 to about 10000 bases or base pairs in length. A linker
sequence can comprise a length of for example, at least 1 base or
base pair, 2 bases or base pairs, 3 bases or base pairs, 4 bases or
base pairs, 5 bases or base pairs, 6 bases or base pairs, 7 bases
or base pairs, 8 bases or base pairs, 9 bases or base pairs, 10
bases or base pairs, 20 bases or base pairs, 30 bases or base
pairs, 40 bases or base pairs, 50 bases or base pairs, 60 bases or
base pairs, 70 bases or base pairs, 80 bases or base pairs, 90
bases or base pairs, 100 bases or base pairs, 200 bases or base
pairs, 300 bases or base pairs, 400 bases or base pairs, 500 bases
or base pairs, 600 bases or base pairs, 700 bases or base pairs,
800 bases or base pairs, 900 bases or base pairs, 1000 bases or
base pairs, 2000 bases or base pairs, 3000 bases or base pairs,
4000 bases or base pairs, 5000 bases or base pairs, 6000 bases or
base pairs, 7000 bases or base pairs, 8000 bases or base pairs,
9000 bases or base pairs, or at least 10000 bases or base pairs in
length. A linker at most 10000 bases or base pairs, 5000 bases or
base pairs, 4000 bases or base pairs, 3000 bases or base pairs,
2000 bases or base pairs, 1000 bases or base pairs, 900 bases or
base pairs, 800 bases or base pairs, 700 bases or base pairs, 600
bases or base pairs, 500 bases or base pairs, 400 bases or base
pairs, 300 bases or base pairs, 200 bases or base pairs, or 100
bases or base pairs in length.
[0128] In some cases, a percentage of the nucleotides in a linker
sequence are modified. For instance, in some cases, fewer than 99%,
95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%,
30%, 25%, 20%, 15%, 10%, 5% or 1% of the nucleotides in a linker
sequence are modified. In some cases, all of the nucleotides in a
linker sequence are modified.
[0129] In some cases, a nucleic acid construct(s), a vector(s), or
an engineered polyribonucleotide(s) can include at least one stop
codon before the 3'untranslated region (UTR). In some cases, a
nucleic acid construct(s), a vector(s), or an engineered
polyribonucleotide(s) includes multiple stop codons. The stop codon
can be selected from TGA, TAA and TAG. The stop codon may be
modified or unmodified. In some cases, the nucleic acid
construct(s), vector(s), or engineered polyribonucleotide(s)
includes the stop codon TGA and one additional stop codon. In some
cases, the nucleic acid construct(s), vector(s), or engineered
polyribonucleotide(s) includes the addition of the TAA stop
codon.
Encoded Polypeptides
[0130] In some cases, the disclosure provides a method for treating
a subject having or at risk of having primary ciliary dyskinesia,
the method comprising administrating to the subject a composition
that comprises a nucleic acid construct that encodes dynein
axonemal intermediate chain 1 protein (DNAI1), armadillo repeat
containing 4 (ARMC4), chromosome 21 open reading frame 59
(C21orf59), coiled-coil domain containing 103 (CCDC103),
coiled-coil domain containing 114 (CCDC114), coiled-coil domain
containing 39 (CCDC39), coiled-coil domain containing 40 (CCDC40),
coiled-coil domain containing 65 (CCDC65), dynein (axonemal)
assembly factor 1 (DNAAF1), dynein (axonemal) assembly factor 2
(DNAAF2), dynein (axonemal) assembly factor 3 (DNAAF3), dynein
(axonemal) assembly factor 5 (DNAAF5), dynein axonemal heavy chain
11 (DNAH11), dynein axonemal heavy chain 5 (DNAH5), dynein axonemal
heavy chain 8 (DNAH8), dynein axonemal intermediate chain 2
(DNAI2), dynein axonemal light chain 1 (DNAL1), dynein regulatory
complex subunit 1 (DRC1), dyslexia susceptibility 1 candidate 1
(DYX1C1), axonemal central pair apparatus protein (HYDIN), leucine
rich repeat containing 6 (LRRC6), NME/NM23 family member 8 (NME8),
oral-facial-digital syndrome 1 (OFD1), retinitis pigmentosa GTPase
regulator (RPGR), radial spoke head 1 homolog (Chlamydomonas)
(RSPH1), radial spoke head 4 homolog A (Chlamydomonas) (RSPH4A),
radial spoke head 9 homolog (Chlamydomonas) (RSPH9), sperm
associated antigen 1(SPAG1), and zinc finger MYND-type containing
10 (ZMYND10), or a variant of any of the aforementioned, which
nucleic acid construct includes codons that provide for
heterologous or enhanced expression of said protein(s) or a variant
thereof within cells of the subject, thereby treating the subject
having or at risk of having primary ciliary dyskinesia.
[0131] The encoded polypeptides are polymer chains comprised of
amino acid residue monomers which are joined together through amide
bonds (peptide bonds). The amino acids may be of the L-optical
isomer, the D-optical isomer or a combination thereof. A
polypeptide can be a chain of at least three amino acids,
peptide-mimetics, a protein, a recombinant protein, an antibody
(monoclonal or polyclonal), an antigen, an epitope, an enzyme, a
receptor, a vitamin, or a structure analogue or combinations
thereof. A polyribonucleotide that is translated within a subject's
body can generate an ample supply of specific peptides or proteins
within a cell, a tissue, or across many cells and tissues of a
subject. In some cases, a polyribonucleotide can be translated in
vivo within the cytosol of a specific target cell(s) type or target
tissue. In some cases, a polyribonucleotide can be translated in
vivo to provide a protein whose gene has been associated with
primary ciliary dyskinesia, a functional fragment thereof, or a
protein that is at least 70% homologous to a human DNAI1 or a human
DNAH5 protein. In some cases, a polyribonucleotide can be
translated in vivo in various non-target cell types or target
tissue(s). Non-limiting examples of cells that be target or
non-target cells include: a) skin cells, e.g.: keratinocytes,
melanocytes, urothelial cells; b) neural cells, e.g.: neurons,
Schwann cells, oligodentrocytes, astrocytes; c) liver cells, e.g.:
hepatocytes; d) intestinal cells, e.g.: goblet cell, enterocytes;
e) blood cells; e.g.: lymphoid or myeloid cells; and f) germ cells;
e.g.: sperm and eggs. Non-limiting examples of tissues include
connective tissue, muscle tissue, nervous tissue, or epithelial
tissue. In some cases, a target cell or a target tissue is a
cancerous cell, tissue, or organ.
[0132] A polynucleotide sequence can be derived from one or more
species. For example, a polynucleotide sequence can be derived from
a human (Homo sapiens), a mouse (e.g., Mus musculus), a rat (e.g.,
Rattus norvegicus or Rattus rattus), a microorganism (e.g.,
Chlamydomonas genus), or any other suitable creature. A
polynucleotide sequence can be a chimeric combination of the
sequence of one or more species.
[0133] In some cases, the endogenous translational machinery can
add a post-translational modification to the encoded peptide. A
post-translational modification can involve the addition of
hydrophobic groups that can target the polypeptide for membrane
localization, the addition of cofactors for increased enzymatic
activity, or the addition of smaller chemical groups. The encoded
polypeptide can also be post-translationally modified to receive
the addition of other peptides or protein moieties. For instance,
ubiquitination can lead to the covalent linkage of ubiquitin to the
encoded polypeptide, SUMOylation can lead to the covalent linkage
of SUMO (Small Ubiquitin-related MOdifier) to the encoded
polypeptide, ISGylation can lead to the covalent linkage of ISG15
(Interferon-Stimulate Gene 15).
[0134] In some cases, the encoded polypeptide can be
post-translationally modified to undergo other types of structural
changes. For instance, the encoded polypeptide can be
proteolytically cleaved, and one or more proteolytic fragments can
modulate the activity of an intracellular pathway. The encoded
polypeptide can be folded intracellularly. In some cases, the
encoded polypeptide is folded in the presence of co-factors and
molecular chaperones. A folded polypeptide can have a secondary
structure and a tertiary structure. A folded polypeptide can
associate with other folded peptides to form a quaternary
structure. A folded-peptide can form a functional multi-subunit
complex, such as an antibody molecule, which has a tetrameric
quaternary structure. Various polypeptides that form classes or
isotypes of antibodies can be expressed from a
polyribonucleotide.
[0135] The encoded polypeptide can be post-translationally modified
to change the chemical nature of the encoded amino acids. For
instance, the encoded polypeptide can undergo post-translational
citrullination or deimination, the conversion of arginine to
citrulline. The encoded polypeptide can undergo post-translation
deamidation; the conversion of glutamine to glutamic acid or
asparagine to aspartic acid. The encoded polypeptide can undergo
elimination, the conversion of an alkene by beta-elimination of
phosphothreonine and phosphoserine, or dehydration of threonine and
serine, as well as by decarboxylation of cysteine. The encoded
peptide can also undergo carbamylation, the conversion of lysine to
homocitrulline. An encoded peptide can also undergo racemization,
for example, racemization of proline by prolyl isomerase or
racemization of serine by protein-serine epimerase. In some cases,
an encoded peptide can undergo serine, threonine, and tyrosine
phosphorylation.
[0136] The activity of a plurality of biomolecules can be modulated
by a molecule encoded by a polyribonucleotide. Non-limiting
examples of molecules whose activities can be modulated by an
encoded polynucleotide include: amino acids, peptides,
peptide-mimetics, proteins, recombinant proteins antibodies
(monoclonal or polyclonal), antibody fragments, antigens, epitopes,
carbohydrates, lipids, fatty acids, enzymes, natural products,
nucleic acids (including DNA, RNA, nucleosides, nucleotides,
structure analogues or combinations thereof), nutrients, receptors,
and vitamins.
[0137] Non-limiting examples of nucleotide sequences that can be a
part of a polynucleotide of the disclosure are disclosed in TABLE
3.
TABLE-US-00003 TABLE 3 Name Sequence dynein axonemal intermediate
chain 1 (DNAI1) SEQ ID NOs: 14-16 dynein axonemal heavy chain 5
(DNAH5) SEQ ID NOs: 17-18
[0138] A polypeptide sequence can be engineered to have a desired
altered codon usage, such as the altered codon usage of SEQ ID NOs
15-16 or the altered codon usage of SEQ ID NOs 17-18. Computer
software can be used, for example, to generate the codon usage of
SEQ ID NO 14. A polypeptide sequence can share a % homology to an
amino acid sequence of an endogenous polypeptide. A polypeptide
sequence can share at most 10% homology, at most 20% homology, at
most 30% homology, at most 40% homology, at most 50% homology, at
most 60% homology, at most 70% homology, at most 80% homology, at
most 90% homology, or at most 99% homology with an amino acid
sequence of an endogenous polypeptide. Various methods and software
programs can be used to determine the homology between two or more
peptides, such as NCBI BLAST, Clustal W, MAFFT, Clustal Omega,
AlignMe, Praline, or another suitable method or algorithm.
Immunogenicity
[0139] Many pharmaceutical agents, including compositions
comprising molecules of various sizes (polynucleotides, proteins,
or enzymes) can trigger an immune response when administered to a
subject. In many cases, the immune system recognizes the
composition as a foreign body and neutralizes its pharmaceutical
action. A polyribonucleotide and a composition of the present
disclosure can have low immunogenicity or be non-immunogenic,
thereby triggering a small response by the immune system, or not
triggering any immune response at all.
[0140] The immunogenicity can also be determined by measurement of,
for example, the TNF-.alpha. and IL-8 levels and the binding
capacity to TLR-3, TLR-7, TLR-8 and helicase RIG-1. In order
thereby to establish whether a polyribonucleotide has a desired low
immunogenicity, the quantity of one or more of the factors can be
measured after administration of the polyribonucleotide to a
subject. The immunogenicity of a polypeptide can be determined in
relation to an increase in the number of white blood cells upon
administration of the polypeptide to the subject. In some cases,
upon administration of the composition to the subject, the subject
exhibits an increase in the number of white blood cells that is
less than 90%, less than 80%, less than 70%, less than 60%, less
than 50%, less than 40%, less than 30%, less than 20%, or less than
10%. A polyribonucleotide of the disclosure can trigger minimum or
insignificant inflammatory or immunological reactions.
[0141] For the determination of the immunogenicity of a
polyribonucleotide, various methods can be used. A very suitable
method is the determination of inflammatory markers in cells or a
simple white cell blood count, as a reaction to the administration
of the polyribonucleotide. Such a method is described in the
examples. Cytokines which are associated with inflammation, such
as, for example TNF-.alpha., IFN-.alpha., IFN-.beta., IP-10, IL-8,
IL-6, and/or IL-12, can be measured. The expression of dendritic
cell activation markers can also be used for the estimation of
immunogenicity. A further indication of an immunological reaction
can be the detection of binding to the Toll-like receptors TLR-3,
TLR-7 and TLR-8 and to helicase RIG-1.
[0142] The immunogenicity of a polyribonucleotide can be determined
as an overall increase in the level of inflammatory marker or white
blood cell count as compared to a level prior to the administration
of the polyribonucleotide. For instance, an engineered
polyribonucleotide that is unmodified or modified can be
administered to cells, or to a subject, and the secretion of
inflammatory markers in a defined time interval as a reaction to
the administration of the polyribonucleotide can be measured.
Compositions
[0143] In some cases, the disclosure provides a composition
comprising a nucleic acid construct encoding dynein axonemal
intermediate chain 1, wherein the nucleic acid construct comprises
a complementary deoxyribonucleic acid encoding dynein axonemal
intermediate chain 1, which composition is formulated for
administration to a subject. In some cases, the disclosure provides
a composition comprising a nucleic acid construct encoding dynein
axonemal intermediate chain 1, which nucleic acid construct
includes codons that provide for heterologous or enhanced
expression of the dynein axonemal intermediate chain 1 protein or a
variant thereof within cells of a subject having or at risk of
having primary ciliary dyskinesia. In some cases, the disclosure
provides a composition comprising a nucleic acid construct encoding
dynein axonemal intermediate chain 1, wherein fewer than 30% of the
nucleic acids encoding dynein axonemal intermediate chain 1 are
nucleic acid analogues, such as pseudouridine or 1-methyl
pseudouridine. In some cases, the coding sequence of these
constructs is engineered to have an altered nucleotide usage in the
protein coding regions to increase its stability.
[0144] In some cases, the codons of the construct are at least 70%
homologous to a mammalian or to a human dynein axonemal
intermediate chain 1 protein. The construct may also comprise a 3'
or 5' noncoding region flanking the codon sequence which encodes a
protein of interest, such as dynein axonemal intermediate chain 1,
wherein the noncoding region enhances the expression of the protein
within cells the subject. The 3' noncoding region flanking the
codon can comprise a 3'-cap independent translation enhancer
(3'-CITEs) or a 3'-stem loop region derived from the nucleotide
sequence of a histone protein or a 3'-triple helical structure
derived from the nucleotide sequence of metastasis-associated lung
adenocarcinoma transcript 1 (MALAT1). The 3' noncoding region
flanking the codon can comprise a poly adenosine tail, wherein the
number of adenosines in the poly adenosine tail improves the
translation efficiency or the half-life of the protein of interest,
such as dynein axonemal intermediate chain 1 protein. In some
cases, the length of the poly adenosine tail is at most 200
adenosines. In some cases, a percentage of the poly adenosine tail
comprises nucleic acid analogues. Fewer than 50%, 40%, 30%, 20%,
10%, or 5% of the nucleic acids in the poly adenosine tail can be
nucleic acid analogues.
[0145] When the composition comprises a percentage of nucleotide
analogues the nucleotide analogues can be selected from the group
consisting of pseudouridine, 1-methylpseudouridine, 2-thiouridine,
5-methyluridine, 5-methoxyuridine, 5-methylcytidine,
2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, and. In some
cases, the nucleic acid analogue is pseudouridine or
1-methylpseudouridine. In some cases, the nucleic acid analogue is
5-methoxyuridine.
[0146] In some cases, the composition comprises a nucleic acid
encoding dynein axonemal intermediate chain 1 and/or nucleic acid
analogues. Optionally, the composition can further comprise at
least one additional nucleic acid construct. The at least one
additional nucleic acid construct may encode a protein selected
from the group consisting of: armadillo repeat containing 4
(ARMC4), chromosome 21 open reading frame 59 (C21orf59),
coiled-coil domain containing 103 (CCDC103), coiled-coil domain
containing 114 (CCDC114), coiled-coil domain containing 39
(CCDC39), coiled-coil domain containing 40 (CCDC40), coiled-coil
domain containing 65 (CCDC65), dynein (axonemal) assembly factor 1
(DNAAF1), dynein (axonemal) assembly factor 2 (DNAAF2), dynein
(axonemal) assembly factor 3 (DNAAF3), dynein (axonemal) assembly
factor 5 (DNAAF5), dynein axonemal heavy chain 11 (DNAH11), dynein
axonemal heavy chain 5 (DNAH5), dynein axonemal heavy chain 8
(DNAH8), dynein axonemal intermediate chain 2 (DNAI2), dynein
axonemal light chain 1 (DNAL1), dynein regulatory complex subunit 1
(DRC1), dyslexia susceptibility 1 candidate 1 (DYX1C1), axonemal
central pair apparatus protein (HYDIN), leucine rich repeat
containing 6 (LRRC6), NME/NM23 family member 8 (NME8),
oral-facial-digital syndrome 1 (OFD1), retinitis pigmentosa GTPase
regulator (RPGR), radial spoke head 1 homolog (Chlamydomonas)
(RSPH1), radial spoke head 4 homolog A (Chlamydomonas) (RSPH4A),
radial spoke head 9 homolog (Chlamydomonas) (RSPH9), sperm
associated antigen 1(SPAG1), and zinc finger MYND-type containing
10 (ZMYND10).
[0147] The compositions may comprise engineered
polyribonucleotides, vectors, or nucleic acid constructs. "Naked"
polynucleotide compositions can be successfully administered to a
subject, and uptaken by a subject's cell, without the aid of
carriers, stabilizers, diluents, dispersing agents, suspending
agents, thickening agents, and/or excipients (Wolff et al. 1990,
Science, 247, 1465-1468). However, in many instances, encapsulation
of polynucleotides with formulations that can increase the
endocytotic uptake can increase the effectiveness of a composition
of the disclosure. To overcome this challenge, in some cases, the
composition comprises a nucleic acid construct, a vector, or an
isolated nucleic acid encoding dynein axonemal intermediate chain
1, wherein the nucleic acid construct comprises a complementary
deoxyribonucleic acid encoding dynein axonemal intermediate chain
1, which composition is formulated for administration to a
subject.
[0148] Another technical challenge underlying the delivery of
polyribonucleotides to multicellular organisms is to identify a
composition that provides a high efficiency delivery of
polyribonucleotides that are translated within a cell or a tissue
of a subject. It has been recognized that administration of naked
nucleic acids may be highly inefficient and may not provide a
suitable approach for administration of a polynucleotide to a
multicellular organism.
[0149] To solve this challenge, a composition comprising an
engineered polyribonucleotide can be encapsulated or formulated
with a pharmaceutical carrier. The formulation may be, but is not
limited to, nanoparticles, poly(lactic-co-glycolic acid) (PLGA)
microspheres, lipidoids, lipoplex, liposome, polymers,
carbohydrates (including simple sugars), cationic lipids, fibrin
gel, fibrin hydrogel, fibrin glue, fibrin sealant, fibrinogen,
thrombin, rapidly eliminated lipid nanoparticles (reLNPs) and
combinations thereof. A composition comprising an engineered
polyribonucleotide disclosed herein can comprise from about 1% to
about 99% weight by volume of a carrier system. The amount of
carrier present in a carrier system is based upon several different
factors or choices made by the formulator, for example, the final
concentration of the polyribonucleotide and the amount of
solubilizing agent. Various carriers have been shown useful in
delivery of different classes of therapeutic agents. Among these
carriers, biodegradable nanoparticles formulated from biocompatible
polymers poly(D,L-lactide-co-glycolide) (PLGA) and polylactide
(PLA) have shown the potential for sustained intracellular delivery
of different therapeutic agents.
[0150] The loading weight percent of the engineered polynucleotide
in a composition may be at least 0.05%, 0.1%, 0.2%, 0.3%, 0.4%,
0.5%, 1%, 2%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. The encapsulation
efficiency of the modified mRNA in the PLGA microsphere may be at
least 50%, at least 70%, at least 90%, at least 95%, at least 96%,
at least 97%, at least 98%, or at least 99%.
[0151] The present disclosure describes nanoparticles, oligomers,
polymers or lipidoids comprising oligo(alkylene amines) containing
alternating, non-identical alkylene amine units which are useful
for delivering a polynucleotide, in some cases an engineered
polyribonucleotides, into a cell or into a tissue. A composition
disclosed herein can be stable for at least about 1 minute, 5
minutes, 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours,
5 hours, 6 hours, 12 hours, 1 day, 2 days, 3 days, 4 days, 5 days,
6 days, 7 days, 8 days, 9 days, 10 days, 2 weeks, 4 weeks, 6 weeks,
8 weeks, 10 weeks, 12 weeks, 3 months, 4 months, 5 months, 6
months, 7 months, 8 months, 9 months, 10 months, 11 months, or one
year. A formulation disclosed herein can be stable, for example, at
a temperature of at least about 0.degree. C., 5.degree. C.,
10.degree. C., 15.degree. C., 20.degree. C., 25.degree. C.,
30.degree. C., 35.degree. C., 40.degree. C., 45.degree. C.,
50.degree. C., 60.degree. C., 70.degree. C., or 80.degree. C. A
composition of the disclosure can have a desired density. The
density of a composition can improve a property of the composition,
such as the rheology of the composition.
Nanoparticles
[0152] The present disclosure also provides nanoparticle based
formulations of nucleic acid constructs, engineered
polyribonucleotides, or vectors that are able to translocate
following administration to a subject. In some instances, the
administration is pulmonary and the engineered polyribonucleotides
can move intact either actively or passively from the site of
administration to the systemic blood supply and subsequently to be
deposited in different cells or tissues, such as, e.g., the breast.
This translocation of the nanoparticle comprising an engineered
polyribonucleotide encoding a therapeutic protein, such as, e.g.,
dynein axonemal intermediate chain 1 (DNAI1), armadillo repeat
containing 4 (ARMC4), chromosome 21 open reading frame 59
(C21orf59), coiled-coil domain containing 103 (CCDC103),
coiled-coil domain containing 114 (CCDC114), coiled-coil domain
containing 39 (CCDC39), coiled-coil domain containing 40 (CCDC40),
coiled-coil domain containing 65 (CCDC65), cyclin O (CCNO), dynein
(axonemal) assembly factor 1 (DNAAF1), dynein (axonemal) assembly
factor 2 (DNAAF2), dynein (axonemal) assembly factor 3 (DNAAF3),
dynein (axonemal) assembly factor 5 (DNAAF5), dynein axonemal heavy
chain 11 (DNAH11), dynein axonemal heavy chain 5 (DNAH5), dynein
axonemal heavy chain 6 (DNAH6), dynein axonemal heavy chain 8
(DNAH8), dynein axonemal intermediate chain 2 (DNAI2), dynein
axonemal light chain 1 (DNAL1), dynein regulatory complex subunit 1
(DRC1), dyslexia susceptibility 1 candidate 1 (DYX1C1), growth
arrest specific 8 (GASB), axonemal central pair apparatus protein
(HYDIN), leucine rich repeat containing 6 (LRRC6), NME/NM23 family
member 8 (NME8), oral-facial-digital syndrome 1 (OFD1), retinitis
pigmentosa GTPase regulator (RPGR), radial spoke head 1 homolog
(Chlamydomonas) (RSPH1), radial spoke head 4 homolog A
(Chlamydomonas) (RSPH4A), radial spoke head 9 homolog
(Chlamydomonas) (RSPH9), sperm associated antigen 1(SPAG1), and
zinc finger MYND-type containing 10 (ZMYND10) or a functional
fragment thereof, constitutes non-invasive systemic delivery of an
active pharmaceutical ingredient beyond the lung to result in the
production of a functional protein to systemically accessible
non-lung cells or tissues.
[0153] A nanoparticle can be a particle of particle size from about
10 nanometers (nm) to 5000 nm, 10 nm to 1000 nm, or 60 nm to 500
nm, or 70 nm to 300 nm. In some examples, a nanoparticle has a
particle size from about 60 nm to 225 nm. The nanoparticle can
include an encapsulating agent (e.g., coating) that encapsulates
one or more polyribonucleotides, which may be engineered
polyribonucleotides. The nanoparticle can include engineered and/or
naturally occurring polyribonucleotides. The encapsulating agent
can be a polymeric material, such as PEI or PEG.
[0154] A lipidoid or lipid nanoparticle which may be used as a
delivery agent may include a lipid which may be selected from the
group consisting of C12-200, MD1, 98N12-5, DLin-DMA, DLin-K-DMA,
DLin-KC2-DMA, DLin-MC3-DMA, PLGA, PEG, PEG-DMG, PEGylated lipids
and analogues thereof. A suitable nanoparticle can comprise one or
more lipids in various ratios. For example, a composition of the
disclosure can comprise a 40:30:25:5 ratio of
C12-200:DOPE:Cholesterol:DMG-PEG2000 or a 40:20:35:5 ratio of
HGT5001:DOPE:Cholesterol: DMG-PEG2000. A nanoparticle can include
at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 lipids or another suitable
number of lipids. A nanoparticle can be formed of any suitable
ratio of lipids selected from the group consisting of C12-200, MD1,
98N12-5, DLin-DMA, DLin-K-DMA, DLin-KC2-DMA, DLin-MC3-DMA, PLGA,
PEG, PEG-DMG.
[0155] The mean size of the nanoparticle formulation may comprise
the modified mRNA between 60 nanometers (nm) and 225 nm. The
polydispersity index PDI of the nanoparticle formulation comprising
the modified mRNA can be between 0.03 and 0.15. The zeta potential
of the nanoparticle formulation may be from -10 to +10 at a pH of
7.4. The formulations of modified mRNA may comprise a fusogenic
lipid, cholesterol and a PEG lipid. The formulation may have a
molar ratio 50:10:38.5:1.5-3.0 (cationic lipid:fusogenic lipid:
cholesterol: polyethylene glycol (PEG) lipid). The PEG lipid may be
selected from, but is not limited to PEG-c-DOMG, PEG-DMG. The
fusogenic lipid may be DSPC. A lipid nanoparticle of the present
disclosure can be formulated in a sealant such as, but not limited
to, a fibrin sealant.
Oligo(Alkylene Amine Groups)
[0156] It has also been recognized that although encapsulation of
polynucleotides with some formulations can increase the endocytotic
uptake of a composition, the polynucleotide that is taken up by a
cell may not be effectively translated within the cell. Some
formulations may be effectively used for plasmid DNA and/or siRNA
delivery, while not practical for use in the delivery of
polyribonucleotides. The present disclosure provides formulations
that can be employed for effective delivery and translation of
polyribonucleotide compositions to a subject.
[0157] A composition of the disclosure can be designed to provide a
polyribonucleotide that is effectively translated within a cell. A
composition of the disclosure can comprise an arrangement of
alkylene amine units of alternating length in groups of three or
more units and containing an ethyleneamine unit in compositions for
transfecting a cell with any polynucleotide, such as an engineered
polyribonucleotide. A composition of the disclosure can provide a
more efficacious delivery of a polyribonucleotide to a cell than
analogous arrangements of alkylene amine units of non-alternating
length.
[0158] Oligomers, polymers or lipidoids can be provided which share
a common structural entity which is illustrated in formula (I):
##STR00001##
[0159] A composition of the disclosure can comprise an
oligo(alkylene amine) that is selected from:
[0160] a) an oligomer or polymer comprising a plurality of groups
of formula (II) as a side chain and/or as a terminal group:
##STR00002##
wherein the variables a, b, p, m, n, and R.sup.2 to R.sup.6 are
defined as follows, independently for each group of formula (II) in
a plurality of such groups: [0161] a is 1 and b is an integer of 2
to 4; or a is an integer of 2 to 4 and b is 1, [0162] p is 1 or 2,
[0163] m is 1 or 2; n is 0 or 1 and m+n is .gtoreq.2; and [0164]
R.sup.2 to R.sup.5 are, independently of each other, selected from
hydrogen; a group --CH.sub.2--CH(OH)--R.sup.7,
--CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7, or
--CH.sub.2--R.sup.7 wherein R.sup.7 is selected from C3-C18 alkyl
or C3-C18 alkenyl having one C--C double bond; a protecting group
for an amino group; and a poly(ethylene glycol) chain; [0165]
R.sup.6 is selected from hydrogen; a group
--CH.sub.2--CH(OH)--R.sup.7, --CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7, or
--CH.sub.2--R.sup.7 wherein R.sup.7 is selected from C3-C18 alkyl
or C3-C18 alkenyl having one C--C double bond; a protecting group
for an amino group; --C(NH)--NH; a poly(ethylene glycol) chain; and
a receptor ligand, and wherein one or more of the nitrogen atoms
indicated in formula (II) may be protonated to provide a cationic
group of formula (II).
[0166] b) an oligomer or polymer comprising a plurality of groups
of formula (III) as repeating units:
##STR00003##
wherein the variables a, b, p, m, n, and R.sup.2 to R.sup.5 are
defined as follows, independently for each group of formula (III)
in a plurality of such groups: [0167] a is 1 and b is an integer of
2 to 4; or a is an integer of 2 to 4 and b is 1, [0168] p is 1 or
2, [0169] m is 1 or 2; n is 0 or 1 and m+n is .gtoreq.2; and [0170]
R.sup.2 to R.sup.5 are, independently of each other, selected from
hydrogen; a group --CH.sub.2--CH(OH)--R.sup.7,
--CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7, --CH.sub.2--R.sup.7
or --CH.sub.2-- wherein R.sup.7 is selected from C3-C18 alkyl or
C3-C18 alkenyl having one C--C double bond; a protecting group for
an amino group; and a poly(ethylene glycol) chain; and wherein one
or more of the nitrogen atoms indicated in formula (III) may be
protonated to provide a cationic group of formula (III).
[0171] c) a lipidoid having the structure of formula (IV):
##STR00004##
wherein the variables a, b, p, m, n, and R.sup.2 to R.sup.6 are
defined as follows: [0172] a is 1 and b is an integer of 2 to 4; or
a is an integer of 2 to 4 and b is 1, [0173] p is 1 or 2, [0174] m
is 1 or 2; n is 0 or 1 and m+n is .gtoreq.2; and [0175] R.sup.2 to
R.sup.6 are, independently of each other, selected from hydrogen; a
group --CH.sub.2--CH(OH)--R.sup.7, --CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7, or
--CH.sub.2--R.sup.7 wherein R.sup.7 is selected from C3-C18 alkyl
or C3-C18 alkenyl having one C--C double bond; a protecting group
for an amino group; and a poly(ethylene glycol) chain; and a
receptor ligand; provided that at least two residues among R.sup.1
to R.sup.6 are a group --CH.sub.2--CH(OH)--R.sup.7,
--CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7, or
--CH.sub.2--R.sup.7 wherein R.sup.7 is selected from C3-C18 alkyl
or C3-C18 alkenyl having one C.dbd.C double bond; and wherein one
or more of the nitrogen atoms indicated in formula (IV) may be
protonated to provide a cationic group of formula (IV).
[0176] Non-limiting examples of alkenyl and alkenylene groups
include straight, branched, and cyclic alkenyl groups. The olefin
or olefins of an alkenyl group can be, for example, E, Z, cis,
trans, terminal, or exo-methylene. An alkenylene group can be, for
example, a C.sub.2, C.sub.3, C.sub.4, C.sub.5, C.sub.6, C.sub.7,
C.sub.8, C.sub.9, C.sub.10, C.sub.11, C.sub.12, C.sub.13, C.sub.14,
C.sub.15, C.sub.16, C.sub.17, C.sub.18, C.sub.19, C.sub.20,
C.sub.21, C.sub.22, C.sub.23, C.sub.24, C.sub.25, C.sub.26,
C.sub.27, C.sub.28, C.sub.29, C.sub.30, C.sub.31, C.sub.32,
C.sub.33, C.sub.34, C.sub.35, C.sub.36, C.sub.37, C.sub.38,
C.sub.39, C.sub.40, C.sub.41, C.sub.42, C.sub.43, C.sub.44,
C.sub.45, C.sub.46, C.sub.47, C.sub.48, C.sub.49, or C.sub.50 group
that is substituted or unsubstituted.
[0177] The oligo(alkylene amine) structures of formulae (II), (III)
and (IV) are characterized in that they can combine shorter (also
referred to for illustration as "S") ethylene amine units (i.e., a
or b is 1) with longer (also referred to for illustration as "L")
alkylene amine units (i.e., the other one of a or b is an integer
of 2 to 4) in an alternating manner. Such an arrangement of the
protonatable units can provide advantages in terms of the
suitability of the resulting group to provide a vehicle for
delivering polyribonucleotides into a cell.
[0178] A composition of the disclosure can comprise a plurality of
oligo(alkylene amine) groups of formula (II) as a side chain or as
a terminal group:
--NR.sup.2{CH.sub.2--(CH.sub.2).sub.a--NR.sup.3--[CH.sub.2--(CH.sub.2).s-
ub.b--NR.sup.4].sub.p}.sub.m--[CH.sub.2--(CH.sub.2).sub.a--NR.sup.5].sub.n-
--R.sup.6 (II),
wherein the variables a, b, p, m, n, and R.sup.2 to R.sup.6 are
defined as follows, independently for each group of formula (II) in
a plurality of such groups: [0179] a is 1 and b is an integer of 2
to 4; or a is an integer of 2 to 4 and b is 1, [0180] p is 1 or 2,
[0181] m is 1 or 2; n is 0 or 1 and m+n is .gtoreq.2; and [0182]
R.sup.2 to R.sup.5 are, independently of each other, selected from
hydrogen; a group --CH.sub.2--CH(OH)--R.sup.7,
--CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7, or
--CH.sub.2--R.sup.7 wherein R.sup.7 is selected from C3-C18 alkyl
or C3-C18 alkenyl having one C.dbd.C double bond; a protecting
group for an amino group; --C(NH)--NH.sub.2--; and a poly(ethylene
glycol) chain; [0183] R.sup.6 is selected from hydrogen; a group
--CH.sub.2--CH(OH)--R.sup.7, --CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7, or
--CH.sub.2--R.sup.7 wherein R.sup.7 is selected from C3-C16 alkyl
or C3-C16 alkenyl having one C--C double bond; a protecting group
for an amino group; --C(NH)--NH; a poly(ethylene glycol) chain; and
a receptor ligand.
[0184] In some cases, R.sup.2 to R.sup.5 are hydrogen and R.sup.6
is selected from hydrogen, a protecting group for an amino group;
--C(NH)--NH.sub.2 and a poly(ethylene glycol) chain. In some cases,
R.sup.2 to R.sup.6 are hydrogen. In some cases, R.sup.7 is selected
from C8-C18 alkyl or C8-C18 alkenyl having one C--C double bond, or
from C8-C12 alkyl or C8-C12 alkenyl having one C--C double bond, or
from C10-C12 alkyl or C10-C12 alkenyl having one C--C double bond.
A composition of the disclosure can comprise one, or multiple
alkylene groups of formulas (II)-(IV).
[0185] In some cases, the oligomers or polymers which can be used
in the compositions in accordance with the present disclosure
comprise a plurality of oligo (alkylene amine) groups of formula
(III) as repeating units:
NR.sup.2{CH.sub.2--(CH.sub.2).sub.a--NR.sup.3--[CH.sub.2--(CH.sub.2).sub-
.b--NR.sup.4].sub.p}.sub.m--[CH.sub.2--(CH.sub.2).sub.a--NR.sup.5].sub.n--
(III)
wherein the variables a, b, p, m, n, and R.sup.2 to R.sup.5 are
defined as follows, independently for each group of formula (III)
in a plurality of such groups: [0186] a is 1 and b is an integer of
2 to 4; or a is an integer of 2 to 4 and b is 1, [0187] p is 1 or
2, [0188] m is 1 or 2; n is 0 or 1 and m+n is .gtoreq.2; and [0189]
R.sup.2 to R.sup.5 are, independently of each other, selected from
hydrogen; a group --CH.sub.2--CH(OH)--R.sup.7,
--CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7, --CH.sub.2--R.sup.7
or --CH.sub.2-- wherein R.sup.7 is selected from C3-C18 alkyl or
C3-C18 alkenyl having one C--C double bond; a protecting group for
an amino group; --C(NH)--NH.sub.2; a poly(ethylene glycol) chain;
and endosomal escape effector and a receptor ligand. In some cases,
R.sup.2 to R.sup.5 are hydrogen. In some cases, R.sup.7 is selected
from C8-C18 alkyl or C8-C18 alkenyl having one C--C. R.sup.7 may be
selected from C8-C12 alkyl or C8-C12 alkenyl having one C--C. As an
alternative, R.sup.7 may be selected from C10-C12 alkyl or C10-C12
alkenyl having one C--C.
[0190] One or more of the nitrogen atoms indicated in formula (III)
may be protonated to provide a cationic group of formula (III).
[0191] Optionally, the oligomers or polymers which comprise a
plurality of groups of formula (III) as repeating units can
comprise, in addition, one or more oligo(alkylene amine) group(s)
of formula (II) as a side chain and/or as a terminal group.
[0192] In a plurality of groups of formula (III) as repeating
units, two, three or more of the groups of formula (III) can be
contained in the oligomers or polymers. Generally, substances
comprising 2 to 9 repeating units are referred to herein as
oligomers, those comprising 10 and more repeating units as
polymers. Thus, in the polymers containing a plurality of groups of
formula (III) as repeating units, 10 or more groups of formula
(III) may be present. It will be understood that the groups of
formula (III) can have the same structure within a polymer or
oligomer, or can have two or more different structures within the
scope of formula (III). In some cases, the oligomers or polymers
containing a plurality of groups of formula (III) as repeating
units can be provided in the form of a library of sequence defined
polymers which are prepared from different groups of formula (III)
in a controlled, stepwise polymerization.
[0193] In line with formulae (II) and (III) above, an alkylene
amine unit may be repeated once in an alternating chain such that
oligo(alkylene amine) moieties of the type --S-L-L-S-- or
-L-S--S-L- may result, wherein S represents a shorter ethylene
amine unit, and L represents a longer alkylene amine unit. In some
cases, groups of formula (II) and (III) are those wherein no
repetition occurs, i.e., wherein p is 1, such that the shorter or
longer units do not appear in pairs. The group of formula (II) can
be an oligo(alkylene amine) group of formula (IIa) and the group of
formula (III) can be an oligo(alkylene amine) group of (IIIa):
--NR.sup.2{CH.sub.2--(CH.sub.2).sub.a--NR.sup.3--CH.sub.2--(CH.sub.2).su-
b.b--NR.sup.4}.sub.m--[CH2-(CH.sub.2).sub.a--NR.sup.5].sub.n--R.sup.6
(IIa),
wherein a, b, m, n, and R.sup.2 to R.sup.6 are defined as in
formula (II), and wherein one or more of the nitrogen atoms
indicated in formula (IIa) may be protonated to provide a cationic
oligomer or polymer structure;
--NR.sup.2{CH.sub.2--(CH.sub.2).sub.a--NR.sup.3--CH.sub.2--(CH.sub.2).su-
b.b--NR.sup.4}.sub.m--[CH.sub.2--NR.sup.5].sub.n (IIIa),
wherein a, b, m, n, and R.sup.2 to R.sup.5 are defined as in
formula (III), and wherein one or more of the nitrogen atoms
indicated in formula (Ilia) can be protonated to provide a cationic
oligomer or polymer structure.
[0194] Moreover, in some cases, the oligo(alkylene amine) group of
formulae (II) and (III) can have an n of 1. In some cases, m is 1
and n is 1. In some cases, the group of formula (II) is an
oligo(alkylene amine) group of formula (IIb), and the group of
formula (III) is an oligo(alkylene amine) group of formula
(IIIb):
--NR.sup.2--CH.sub.2--(CH.sub.2).sub.a--NR.sup.3--CH.sub.2--(CH.sub.2).s-
ub.b--NR.sup.4--CH.sub.2--(CH.sub.2).sub.a--(NR.sup.5)--R.sup.6
(IIb),
wherein a, b, and R.sup.2 to R.sup.6 are defined as in formula
(II), and wherein one or more of the nitrogen atoms indicated in
formula (IIb) can be protonated to provide a cationic oligomer or
polymer structure;
--NR.sup.2--CH.sub.2--(CH.sub.2).sub.a--NR.sup.3--CH.sub.2--(CH.sub.2).s-
ub.b--NR.sup.4--CH.sub.2--(CH.sub.2).sub.a--NR.sup.5-- (IIIb),
wherein a, b, and R.sup.2 to R.sup.5 are defined as in formula
(III) and wherein one or more of the nitrogen atoms indicated in
formula (IIIb) can be protonated to provide a cationic oligomer or
polymer structure.
[0195] With respect to the length of the alkylene amine units in
the oligo(alkylene amine) groups of formula (II), (IIa), (IIb) and
(III), (IIIa), (IIIb), one of the alternating units can be an
ethylene amine unit (i.e., either a or b is 1). The other
alternating unit can be a propylene amine unit, a butylene amine
unit or a pentylene amine unit (i.e., the other one of a or b can
be an integer from 2 to 4. In some cases, the other of a orb can be
2 or 3, and in some cases, a is 1 and b is 2, or a is 2 and b is 1.
In some cases, an oligo(alkylene amine) group of formula (IIc) is
employed instead of or in addition to group (II), and/or an
oligo(alkylene amine) group of formula (IIIc) is employed instead
of or in addition to group (III). The formulae of group (IIc) and
group (IIIc) are as follows:
--NR.sup.2--CH.sub.2--CH.sub.2--NR.sup.3--CH.sub.2--CH.sub.2--CH.sub.2---
NR.sup.4--CH.sub.2--CH.sub.2--NR.sup.5--R.sup.6 (IIc),
[0196] wherein R.sup.2 to R.sup.6 are as defined in formula (II),
and wherein R.sup.2 to R.sup.6 are hydrogen, and wherein one or
more of the nitrogen atoms indicated in formula (IIc) can be
protonated to provide a cationic oligomer or polymer structure;
--NR.sup.2--CH.sub.2--CH.sub.2--NR.sup.3--CH.sub.2--CH.sub.2--CH.sub.2---
NR.sup.4--CH.sub.2--CH.sub.2--NR.sup.5-- (IIIc),
[0197] wherein R.sup.2 to R.sup.5 are as defined in formula (III),
and wherein one or more of the nitrogen atoms indicated in formula
(IIIc) can be protonated to provide a cationic oligomer or polymer
structure.
[0198] In some cases, the groups R.sup.2 to R.sup.6 in formula
(II), (IIa), (IIb) and (IIc) or the groups R.sup.2 to R.sup.5 in
formula (III), (IIIa), (IIIb) and (IIIc) can be protecting group
for an amino group. Non-limiting examples of protecting groups
include t-butoxycarbonyl (Boc), 9-fluorenylmethoxycarbonyl (Fmoc),
or carbobenzyloxy (Cbz).
[0199] In some cases, the groups R.sup.1 to R.sup.6 in formula
(II), (IIa), (IIb) and (IIIc) or the groups R.sup.2 to R.sup.5 in
formula (III), (IIIa), (IIIb) and (IIIc) are a receptor ligand,
such as the receptor ligands described in Philipp and Wagner in
"Gene and Cell Therapy--Therapeutic Mechanisms and Strategy", 3rd
Edition, Chapter 15, CRC Press, Taylor & Francis Group LLC,
Boca Raton 2009. Examples of receptor ligands that target the lung
tissue are described in Pfeifer et al. 2010, Ther. Deliv. 1 (1):
133-48. Receptor ligands can include synthetic cyclic or linear
peptides such as derived from screening peptide libraries for
binding to a particular cell surface structure or particular cell
type, cyclic or linear RGD peptides, synthetic or natural
carbohydrates such as sialic acid, galactose or mannose or
synthetic ligands derived from reacting a carbohydrate for example
with a peptide, antibodies specifically recognizing cell surface
structures, folic acid, epidermal growth factor and peptides
derived thereof, transferrin, anti-transferrin receptor antibodies,
nanobodies and antibody fragments, approved drugs that may bind to
cell surface molecules (e.g., cell surface receptors), etc.
[0200] As far as any of the groups R.sup.1 to R.sup.6 in formula
(II), (IIa), (IIb) and (IIc) or the groups R.sup.2 to R.sup.5 in
formula (III), (IIIa), (IIIb) and (IIIc) are a poly(ethylene
glycol) chain, the molecular weight of the poly(ethylene glycol)
chain can be from about 100 g/mol to 20,000 g/mol, from about 1,000
g/mol to 10,000 g/mol or from about 1,000 g/mol to 5,000 g/mol.
[0201] In some cases, group (II) can be an oligo(alkylene amine)
group of formula (IM):
--NH--CH.sub.2--CH.sub.2--NH--CH.sub.2--CH.sub.2--CH.sub.2--NH--CH.sub.2-
--CH.sub.2--NH--H (IId),
[0202] wherein one or more of the nitrogen atoms indicated in
formula (IM) may be protonated to provide a cationic polymer or
dendrimer structure. In some cases, group (III) is an
oligo(alkylene amine) group of formula (IIId):
--NH--CH.sub.2--CH.sub.2--NH--CH.sub.2--CH.sub.2--CH.sub.2--NH--CH.sub.2-
--CH.sub.2--NH-- (IIId)
[0203] wherein one or more of the nitrogen atoms indicated in
formula (IIId) may be protonated to provide a cationic polymer or
dendrimer structure.
Lipidoids
[0204] An engineered polyribonucleotide can be encapsulated in a
lipidoid formulation. A lipidoid formulation can be any material
that has characteristics of a lipid, such as fats, waxes, sterols,
fat-soluble vitamins (such as vitamins A, D, E, and K),
monoglycerides, diglycerides, triglycerides, phospholipids, and
others. For example, a lipid or lipidoid formulation can include
lipids such as cholesterol, DOPE, DOPC or DSPC which are referred
to as helper lipids in the scientific literature, and/or PEGylated
lipids or any other lipid useful for preparing lipoplexes. The
formulation comprising the engineered polyribonucleotide may be a
nanoparticle which may comprise at least one lipid. A lipidoid
formulation can be a lipid nanoparticle. The lipid may be selected
from, but is not limited to, DOPE, DOPC, DSPC, cholesterol,
DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA,
DODMA, PLGA, PEG, PEG-DMG and PEGylated lipids. In another aspect,
the lipid may be a cationic lipid such as, but not limited to,
DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA and DODMA.
[0205] The composition containing a lipidoid may be about 40-60%
lipidoid, about 40-60% cholesterol, and about 5-20% PEG-lipid (in
percent by weight, based on the total weight of the composition).
The composition containing a lipidoid may be about 50-60% lipidoid,
about 40-50% cholesterol, and about 5-10% PEG-lipid. The
composition containing a lipidoid may be about 50-75% lipidoid,
about 20-40% cholesterol, and about 1-10% PEG-lipid. The
composition containing a lipidoid may be about 60-70% lipidoid,
about 25-35% cholesterol, and about 5-10% PEG-lipid. The
composition may be provided with techniques described in, for
example, Akinc et al, 2007, Nat Biotech, 26, 561-569; Akinc et al,
2009, Mol Ther, 17, 872-9; Love et al, 2010, PNAS, 107, 1864-9;
U.S. Pat. No. 8,450,298, 02006/138380). RNA/lipidoid complexes may
form particles that are useful in the delivery of RNA, such as
single-stranded RNAs or mRNAs, into cells.
[0206] A composition of the disclosure cab be an engineered
polyribonucleotide encapsulated by a lipidoid of formula (IV)
R.sup.1--NR.sup.2{CH.sub.2--(CH.sub.2).sub.a--NR.sup.3--[CH.sub.2--(CH.s-
ub.2).sub.b--NR.sup.4].sub.p}.sub.m--[CH.sub.2--(CH.sub.2).sub.a--NR.sup.5-
].sub.n--R.sup.6 (IV),
[0207] wherein the variables a, b, p, m, n and R1 to R6 are defined
as follows: [0208] a is 1 and b is an integer of 2 to 4; or a is an
integer of 2 to 4 and b is 1, [0209] p is 1 or 2, [0210] m is 1 or
2; n is 0 or 1 and m+n is .gtoreq.2; and [0211] R.sup.1 to R.sup.6
are independently of each other selected from hydrogen; a group
--CH.sub.2--CH(OH)--R.sup.7, --CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7 or --CH.sub.2--R.sup.7
wherein R.sup.7 is selected from C3-C18 alkyl or C3-C18 alkenyl
having one C--C double bond; a protecting group for an amino group;
--C(NH)--NH.sub.2; a poly(ethylene glycol) chain; and a receptor
ligand; provided that at least two residues among R.sup.1 to
R.sup.6 are a group --CH.sub.2--CH(OH)--R.sup.7,
--CH(R.sup.7)--CH.sub.2--OH,
--CH.sub.2--CH.sub.2--(C.dbd.O)--O--R.sup.7,
--CH.sub.2--CH.sub.2--(C.dbd.O)--NH--R.sup.7 or --CH.sub.2--R.sup.7
wherein R.sup.7 is selected from C3-C18 alkyl or C3-C18 alkenyl
having one C--C double bond.
[0212] In some cases, R.sup.1 to R.sup.6 are independently selected
from hydrogen; a group --CH.sub.2--C(OH)H--R.sup.7 or
--CH(R.sup.7)--CH.sub.2--OH, wherein R.sup.7 is selected from
C3-C18 alkyl or C3-C18 alkenyl having one C--C double bond; a
protecting group for an amino group; and a poly(ethylene glycol)
chain; provided that at least two residues among R.sup.1 to R.sup.6
are a group --CH2-C(OH)H--R.sup.7 or --CH(R.sup.7)--CH.sub.2--OH,
wherein R.sup.7 is selected from C3-C18 alkyl or C3-C18 alkenyl
having one C--C double bond. In some cases, R.sup.1 to R.sup.6 are
independently selected from hydrogen; and a group
--CH.sub.2--CH(OH)--R.sup.7 or --CH(R.sup.7)--CH.sub.2--OH wherein
R.sup.7 is selected from C3-C16 alkyl or C3-C16 alkenyl having one
C--C double bond; provided that at least two residues among R.sup.1
to R.sup.6 are a group --CH.sub.2--CH(OH)--R.sup.7 or
--CH(R.sup.7)--CH.sub.2--OH, wherein R.sup.7 is selected from
C3-C18 alkyl or C3-C18 alkenyl having one C--C double bond. In some
cases, R.sup.1 and R.sup.6 are independently selected from
hydrogen; and a group --CH.sub.2--CH(OH)--R.sup.7 or
--CH(R.sup.7)--CH2-OH wherein R.sup.7 is selected from C3-C18 alkyl
or C3-C18 alkenyl having one C--C double bond; and R.sup.2 to
R.sup.5 are all a group --CH2-CH(OH)--R.sup.7 or
--CH(R.sup.7)--CH.sub.2--OH wherein R.sup.7 is selected from C3-C18
alkyl or C3-C18 alkenyl having one C--C double bond. In some cases,
R.sup.7 is selected from C8-C16 alkyl or C8-C18 alkenyl having one
C--C double bond, or from C8-C12 alkyl or C8-C12 alkenyl having one
C--C double bond, or from C10-C12 alkyl or C10-C12 alkenyl having
one C--C double bond.
[0213] One or more of the nitrogen atoms indicated in formula (IV)
may be protonated to provide a cationic lipidoid of formula
(IV).
[0214] In line with formula (IV) above, an alkylene amine unit may
be repeated once in an alternating chain such that oligo(alkylene
amine) moieties of the type --S-L-L-S-- or -L-S--S-L- may result,
wherein S represents a shorter ethylene amine unit, and L
represents a longer alkylene amine unit. In some cases, a lipidoid
of formula (IV) is one wherein no repetition occurs, i.e., wherein
p is 1, such that the shorter or longer units do not appear in
pairs. The lipidoid of formula (IV) can be a lipidoid of (IVa):
R.sup.1--NR.sup.2{CH.sub.2--(CH.sub.2).sub.a--NR.sup.3--CH.sub.2--(CH.su-
b.2).sub.b--NR}.sub.m--[CH.sub.2--(CH.sub.2).sub.a--NR.sup.5].sub.n--R.sup-
.6 (IVa),
[0215] wherein a, b, m, n, and R.sup.1 to R.sup.6 are defined as in
formula (IV) and wherein one or more of the nitrogen atoms
indicated in formula (IVa) may be protonated to provide a cationic
lipidoid;
[0216] In some cases, the lipidoid is a lipidoid of formula (IV).
In some cases `n` is 1 in a lipidoid of formula (IV). In some
cases, `m` is 1 and n is 1 in a lipidoid of formula (IV). In some
cases, the lipidoid of formula (IV) is a lipidoid of formula
(IVb):
R--NR.sup.2--CH.sub.2--(CH.sub.2).sub.a--NR.sup.3--CH.sub.2--(CH.sub.2).-
sub.b--NR.sup.4--CH.sub.2--(CH.sub.2).sub.a--NR.sup.5--R.sup.6
(IVb),
[0217] wherein a, b, and R.sup.1 to R.sup.6 are defined as in
formula (IV) wherein one or more of the nitrogen atoms indicated in
formula (IVb) may be protonated to provide a cationic lipidoid.
[0218] As regards the length of the alkylene amine units in the
lipidoid of formula (IV), (IVa) and (IVb), it will be understood
that one of the alternating units needs to be an ethylene amine
unit (i.e., either a or b is 1). The other alternating unit can be
a propylene amine unit, a butylene amine unit, a pentylene amine
unit, or another suitable unit (i.e., the other one of a or b is an
integer of 2 to 4. In some cases, a lipidoid of formula (IV) is a
lipidoid of formula (IVc):
R.sup.1--NR.sup.2--CH.sub.2--CH.sub.2--NR.sup.3--CH.sub.2--CH.sub.2--CH.-
sub.2--NR.sup.4--CH.sub.2--CH.sub.2--NR.sup.5--R.sup.S (IVc)
[0219] wherein R.sup.1 to R.sup.6 are as defined in formula (IV)
and wherein one or more of the nitrogen atoms indicated in formula
(IVc) can be protonated to provide a cationic lipidoid;
[0220] In some cases, the groups R.sup.1 to R.sup.6 in formula
(IV), (IVa), (IVb) and (IVc) are a protecting group for an amino
group. Non-limiting examples of protecting groups include
t-butoxycarbonyl (Boc), 9-fluorenylmethoxycarbonyl (Fmoc), or
carbobenzyloxy (Cbz).
[0221] As far as the groups R.sup.1 to R.sup.6 in formula (IV),
(IVa), (IVb) and (IVc) are a receptor ligand, such as the receptor
ligands described in Philipp and Wagner in "Gene and Cell
Therapy--Therapeutic Mechanisms and Strategy", 3rd Edition, Chapter
15, CRC Press, Taylor & Francis Group LLC, Boca Raton 2009.
Examples of receptor ligands that target the lung tissue are
described in Pfeifer et al. 2010, Ther. Deliv. 1 (1): 133-48.
Receptor ligands can include synthetic cyclic or linear peptides
such as derived from screening peptide libraries for binding to a
particular cell surface structure or particular cell type, cyclic
or linear RGD peptides, synthetic or natural carbohydrates such as
sialic acid, galactose or mannose or synthetic ligands derived from
reacting a carbohydrate for example with a peptide, antibodies
specifically recognizing cell surface structures, folic acid,
epidermal growth factor and peptides derived thereof, transferrin,
anti-transferrin receptor antibodies, nanobodies and antibody
fragments, approved drugs that may bind to cell surface molecules
(e.g., cell surface receptors), etc.
[0222] As far as the groups R.sup.1 to R.sup.6 in formula (IV),
(IVa), (IVb) and (IVc) are a poly(ethylene glycol) chain, the
molecular weight of the poly(ethylene glycol) chain can be from
about 100 g/mol to 20,000 g/mol, from about 1,000 g/mol to 10,000
g/mol or from about 1,000 g/mol to 5,000 g/mol. In some cases, a
molecular weight of the PEG chain can provide a composition with a
desired density.
[0223] Multiple lipidoid molecules can be associated with an
engineered polyribonucleotide. For example, a composition can
comprise 1 engineered polyribonucleotide to 100 lipidoid molecules,
1 engineered polyribonucleotide to 1,000 lipidoid molecules, 10
engineered polyribonucleotide to 1,000 lipidoid molecules, or 100
engineered polyribonucleotide to 10,000 lipidoid molecules. The
complex of engineered polyribonucleotide and lipidoid can form a
particle. The diameter of the particles may range, e.g., from 10
nanometers to 1,200 nanometers. In some cases the diameter of the
particles ranges from 10 nanometers to 500 nanometers. In some
cases, the diameters of the particles are from 20 nanometers to 150
nanometers.
Administration to a Subject
[0224] Further described herein are methods for the administration
of a polynucleotide (e.g., polyribonucleotide, nucleic acid
construct, or vector) to a subject. The polyribonucleotide can be
provided to the subject via a delivery agent, such as a particle or
capsule with an encapsulating agent that encapsulates the
polyribonucleotide. The delivery agent can be a therapeutic agent.
The subject can be a human, such as a human afflicted with a
disease or condition (e.g., primary ciliary dyskinesia (PCD),
Kartagener Syndrome or cancer). The delivery agent can be
administered to the subject (e.g., self-administration or
administration by a third party, such as a healthcare provider) at
a given dosage, and the dosage can be increased with time,
decreased with time, or kept constant. The dosage can be changed
based on a progression or regression of a disease in the subject,
such as a rare disease or a cancer.
[0225] A polyribonucleotide of the disclosure can be formulated
with one or more pharmaceutically acceptable carrier(s) to be
administered to a subject. In some cases, the polyribonucleotide
can be formulated for targeted delivery to a target cell or cell
population. In some cases, the polyribonucleotide can be formulated
for untargeted delivery to a cell or cell population. The encoded
polypeptide product of the polyribonucleotide is then transcribed
and it accumulates within the recipient cell.
[0226] A composition can be a combination of any engineered
polyribonucleotide described herein with other chemical components,
such as carriers, stabilizers, diluents, dispersing agents,
suspending agents, thickening agents, and/or excipients. The
composition facilitates administration of the compound to an
organism. Pharmaceutical compositions can be administered in
therapeutically-effective amounts as pharmaceutical compositions by
various forms and routes including, for example, intravenous,
subcutaneous, intramuscular, oral, rectal, aerosol, parenteral,
ophthalmic, pulmonary, transdermal, vaginal, otic, nasal, and
topical administration.
[0227] A composition can be administered in a local or systemic
manner, for example, via injection of the compound directly into an
organ, optionally in a depot or sustained release formulation.
Pharmaceutical compositions can be provided in the form of a rapid
release formulation, in the form of an extended release
formulation, or in the form of an intermediate release formulation.
A rapid release form can provide an immediate release. An extended
release formulation can provide a controlled release or a sustained
delayed release.
[0228] For administration by inhalation, the active compounds can
be in a form as an aerosol, a mist, a vapor, a spray, or a powder.
Pharmaceutical compositions are conveniently delivered in the form
of an aerosol spray presentation from pressurized packs or a
nebulizer, with the use of a suitable propellant, for example,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol, the dosage unit can be
determined by providing a valve to deliver a metered amount.
Capsules and cartridges of, for example, gelatin for use in an
inhaler or insufflator can be formulated containing a powder mix of
the compounds and a suitable powder base such as lactose or
starch.
[0229] The eye comprises several structurally and functionally
distinct vascular beds that supply ocular components critical to
the maintenance of vision. These beds include the retinal and
choroidal vasculatures, which supply the inner and outer portions
of the retina, respectively, and the limbal vasculature located at
the periphery of the cornea.
[0230] A pharmaceutical composition comprising an engineered
polyribonucleotide can be administered to the eye via any suitable
form or route including, for example, topical, oral, systemic,
intravitreal, intracameral, subconjunctival, subtenon, retrobulbar,
intraocular, posterior juxtascleral, periocular, subretinal, and
suprachoroidal administration. The compositions can be administered
by injecting the formulation in any part of the eye including
anterior chamber, posterior chamber, vitreous chamber
(intravitreal), retina proper, and/or subretinal space. The
compositions can also be delivered via a non-invasive method.
Non-invasive modes of administering the formulation can include
using a needleless injection device. Multiple administration routes
can be employed for efficient delivery of the pharmaceutical
compositions.
[0231] An engineered polynucleotide of the disclosure can be
delivered to any suitable ocular cell including for example,
endothelial cells such as vascular endothelial cells, cells of the
retina such as retinal pigment epithelium (RPE), corneal cells,
fibroblasts, astrocytes, glial cells, pericytes, iris epithelial
cells, cells of neural origin, ciliary epithelial cells, mueller
cells, muscle cells surrounding and attached to the eye such as
cells of the lateral rectus muscle, orbital fat cells, cells of the
sclera and episclera, cells of the trabecular meshwork, and
connective tissue cells.
[0232] A composition that is disclosed herein, upon administration
to a subject, can have a transfection efficiency of at least about
80%, 90%, or 95% by the cell of the subject. In some cases, the
transfection efficiency of an encapsulated composition, upon
administration to a subject, is at least about 50%, 60%, 70%, 80%,
90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%,
190%, 200%, 225%, 250%, 275%, 300%, 325%, 350%, 375%, 400%, 450%,
or 500% relative to an unencapsulated polyribonucleotide. In some
situations, transfection efficiency of a composition comprising a
modified polyribonucleotide (in some cases also comprising an
unmodified polyribonucleotide), upon administration to a subject,
is at least about 50%, 60%, 70%, 80%, 90%, 95%, 100%, 110%, 120%,
130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 225%, 250%, 275%,
300%, 325%, 350%, 375%, 400%, 450%, or 500% relative to composition
solely containing an unmodified polyribonucleotide. The
transfection efficiency of a composition can be increased by
addition of a carrier, such as a cell penetrating peptide or a
cationic coating to the outer layer of the composition. The
transfection efficiency of a composition can be modulated by the
density of a composition.
[0233] Methods for the preparation of compositions comprising the
engineered polyribonucleotides described herein include formulating
the compounds with one or more inert, pharmaceutically-acceptable
excipients or carriers to form a solid, semi-solid, or liquid
composition. Solid compositions include, for example, powders,
tablets, dispersible granules, capsules, cachets, and
suppositories. Liquid compositions include, for example, solutions
in which a compound is dissolved, emulsions comprising a compound,
or a solution containing liposomes, micelles, or nanoparticles
comprising a compound as disclosed herein. Semi-solid compositions
include, for example, gels, suspensions and creams. The
compositions can be in liquid solutions or suspensions, solid forms
suitable for solution or suspension in a liquid prior to use, or as
emulsions. These compositions can also contain minor amounts of
nontoxic, auxiliary substances, such as wetting or emulsifying
agents, pH buffering agents, and other pharmaceutically-acceptable
additives.
[0234] Non-limiting examples of pharmaceutically-acceptable
excipients can be found, for example, in Remington: The Science and
Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing
Company, 1995); Hoover, John E., Remington's Pharmaceutical
Sciences, Mack Publishing Co., Easton, Pa. 1975; Liberman, H. A.
and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker,
New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug
Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins
1999), each of which is incorporated by reference in its
entirety.
[0235] A composition comprising a polynucleotide (e.g.,
polyribonucleotide) can be provided in various dosages. A dose of a
polynucleotide, or a polyribonucleotide, can be from about 1 .mu.g
to about 1000 .mu.g, about 1 .mu.g to about 500 .mu.g, about 1
.mu.g to about 1000 .mu.g, about 10 .mu.g to about 500 .mu.g, about
20 .mu.g to about 500 .mu.g, about 25 .mu.g to about 500 .mu.g,
about 30 .mu.g to about 500 .mu.g, about 40 .mu.g to about 500
.mu.g, about 50 .mu.g to about 500 .mu.g, about 10 .mu.g to about
250 .mu.g, about 20 .mu.g to about 250 .mu.g, about 30 .mu.g to
about 250 .mu.g, about 40 .mu.g to about 250 .mu.g, about 50 .mu.g
to about 250 .mu.g, about 1 .mu.g to about 200 .mu.g, about 10
.mu.g to about 200 .mu.g, about 20 .mu.g to about 200 .mu.g, about
30 .mu.g to about 200 .mu.g, about 40 .mu.g to about 200 .mu.g,
about 50 .mu.g to about 200 .mu.g, about 25 .mu.g to about 50
.mu.g, about 25 .mu.g to about 100 .mu.g, about 25 .mu.g to about
150 .mu.g, about 25 .mu.g to about 200 .mu.g, about 25 .mu.g to
about 250 .mu.g, about 25 .mu.g to about 300 .mu.g, about 25 .mu.g
to about 350 .mu.g, about 25 .mu.g to about 400 .mu.g, about 25
.mu.g to about 450 .mu.g, about 25 .mu.g to about 500 .mu.g, about
50 .mu.g to about 750 .mu.g, or about 25 .mu.g to about 1000 .mu.g
of the engineered polyribonucleotide. In some cases, a dose of a
polynucleotide is about 1 mg to about 100 mg, about 1 mg to about
50 mg, about 10 mg to about 50 mg, about 20 mg to about 50 mg,
about 25 mg to about 50 mg, about 30 mg to about 50 mg, about 40 mg
to about 50 mg, about 50 mg to about 100 mg, about 1 mg to about 25
mg, about 2 mg to about 25 mg, about 3 mg to about 25 mg, about 4
mg to about 25 mg, about 5 mg to about 25 mg, about 1 mg to about
20 mg, about 1 mg to about 20 mg, about 2 mg to about 20 mg, about
3 mg to about 20 mg, about 4 mg to about 20 mg, or about 5 mg to
about 20 mg of an engineered polyribonucleotide.
[0236] The percentage of a polyribonucleotide in a formulation
(e.g., within an encapsulated agent) can be greater than or equal
to 0.25% polyribonucleotide, 0.5% polyribonucleotide, 0.75%
polyribonucleotide, 1% polyribonucleotide, 1.25%
polyribonucleotide, 1.5% polyribonucleotide, 1.75%
polyribonucleotide, 2% polyribonucleotide, 2.25%
polyribonucleotide, 2.5% polyribonucleotide, 2.75%
polyribonucleotide, 3% polyribonucleotide, 3.25%
polyribonucleotide, 3.5% polyribonucleotide, 3.75%
polyribonucleotide, 4% polyribonucleotide, 4.25%
polyribonucleotide, 4.5% polyribonucleotide, 4.75%
polyribonucleotide, 5% polyribonucleotide, 5.25%
polyribonucleotide, 5.5% polyribonucleotide, 5.75%
polyribonucleotide, 6% polyribonucleotide, 6.25%
polyribonucleotide, 6.5% polyribonucleotide, 6.75%
polyribonucleotide, 7% polyribonucleotide, 7.25%
polyribonucleotide, 7.5% polyribonucleotide, 7.75%
polyribonucleotide, 8% polyribonucleotide, 8.25%
polyribonucleotide, 8.5% polyribonucleotide, 8.75%
polyribonucleotide, 9% polyribonucleotide, 9.25%
polyribonucleotide, 9.5% polyribonucleotide, 9.75%
polyribonucleotide, 10% polyribonucleotide, 10.25%
polyribonucleotide, 10.5% polyribonucleotide, 10.75%
polyribonucleotide, 11% polyribonucleotide, 11.25%
polyribonucleotide, 11.5% polyribonucleotide, 11.75%
polyribonucleotide, 12% polyribonucleotide, 12.25%
polyribonucleotide, 12.5% polyribonucleotide, 12.75%
polyribonucleotide, 13% polyribonucleotide, 13.25%
polyribonucleotide, 13.5% polyribonucleotide, 13.75%
polyribonucleotide, 14% polyribonucleotide, 14.25%
polyribonucleotide, 14.5% polyribonucleotide, 14.75%
polyribonucleotide, 15% polyribonucleotide, 15.25%
polyribonucleotide, 15.5% polyribonucleotide, 15.75%
polyribonucleotide, 16% polyribonucleotide, 16.25%
polyribonucleotide, 16.5% polyribonucleotide, 16.75%
polyribonucleotide, 17% polyribonucleotide, 17.25%
polyribonucleotide, 17.5% polyribonucleotide, 17.75%
polyribonucleotide, 18% polyribonucleotide, 18.25%
polyribonucleotide, 18.5% polyribonucleotide, 18.75%
polyribonucleotide, 19% polyribonucleotide, 19.25%
polyribonucleotide, 19.5% polyribonucleotide, 19.75%
polyribonucleotide, 20% polyribonucleotide, 20.5%
polyribonucleotide, 21% polyribonucleotide, 21.5%
polyribonucleotide, 22% polyribonucleotide, 22.5%
polyribonucleotide, 23% polyribonucleotide, 23.5%
polyribonucleotide, 24% polyribonucleotide, 24.5%
polyribonucleotide, or 25% polyribonucleotide by weight.
Alternatively, the percentage of the polyribonucleotide in the
formulation (e.g., within an encapsulated agent) can be less than
about 25% polyribonucleotide, 24.5% polyribonucleotide, 24%
polyribonucleotide, 23.5% polyribonucleotide, 23%
polyribonucleotide, 22.5% polyribonucleotide, 22%
polyribonucleotide, 21.5% polyribonucleotide, 21%
polyribonucleotide, 20.5% polyribonucleotide, 20%
polyribonucleotide, 19.5% polyribonucleotide, 19%
polyribonucleotide, 18.5% polyribonucleotide, 18%
polyribonucleotide, 17.5% polyribonucleotide, 17%
polyribonucleotide, 16.5% polyribonucleotide, 16%
polyribonucleotide, 15.5% polyribonucleotide, 15%
polyribonucleotide, 14.5% polyribonucleotide, 14%
polyribonucleotide, 13.5% polyribonucleotide, 13%
polyribonucleotide, 12.5% polyribonucleotide, 12%
polyribonucleotide, 11.5% polyribonucleotide, 11%
polyribonucleotide, 10.5% polyribonucleotide, 10%
polyribonucleotide, 9.5% polyribonucleotide, 9% polyribonucleotide,
8.5% polyribonucleotide, 8% polyribonucleotide, 7.5%
polyribonucleotide, 7% polyribonucleotide, 6.5% polyribonucleotide,
6% polyribonucleotide, 5.5% polyribonucleotide, 5%
polyribonucleotide, 4.5% polyribonucleotide, 4% polyribonucleotide,
3.5% polyribonucleotide, 3% polyribonucleotide, 2.5%
polyribonucleotide, 2% polyribonucleotide, 1.5% polyribonucleotide,
1% polyribonucleotide, 0.5% polyribonucleotide, or 0.1%
polyribonucleotide.
[0237] In some cases, an encapsulated composition of the disclosure
can produce a plasma, serum or blood concentration of the
polyribonucleotide, pharmaceutical carrier, encapsulating agent, or
polymeric material (e.g.: polyethylene glycol or polyethylenimine)
in a subject within about 1 second to about 30 minutes, about 1
second to 20 minutes, about 1 second to 10 minutes, about 1 second
to 5 minutes, about 1 second to 2 minutes, about 1 second to 1
minute, about 1 second to about 30 seconds, about 30 seconds to 30
minutes, about 30 seconds to 20 minutes, about 30 seconds to 10
minutes, about 30 seconds to 5 minutes, about 30 seconds to 2
minutes, about 30 seconds to about 1 minute, about 1 minute to
about 30 minutes, about 1 minute to about 25 minutes, about 1
minute to about 20 minutes, about 1 minute to about 15 minutes,
about 1 minute to about 10 minutes, about 5 minutes to about 30
minutes, about 5 minutes to about 25 minutes, about 5 minutes to
about 20 minutes, about 5 minutes to about 15 minutes, about 5
minutes to about 10 minutes, about 10 minutes to about 30 minutes,
about 10 minutes to about 25 minutes, about 10 minutes to about 20
minutes, or about 10 minutes to about 15 minutes of use of the
device. The plasma, serum or blood concentration of the
polyribonucleotide, pharmaceutical carrier, encapsulating agent, or
polymeric material (e.g.: polyethylene glycol or polyethylenimine)
concentration can be a peak concentration or an average
concentration.
EXAMPLES
Example 1: Production of DNAI1 RNA Comprising
[0238] This experiment demonstrates the production of a DNAI1
complementary deoxyribonucleic acid construct.
[0239] Methods: DNAI1 was synthesized at GenScript. pUC57/DNAI1 was
digested with HindIII and EcoRI HF restriction enzymes. Moreover, a
digested pVAX120 vector and DNAI1 cDNA were gel purified and
ligated (the ORF for DNAI1 is codon optimized). Standard in vitro
translation procedure was used for RNA production utilizing
unmodified nucleotides. Capping reaction was carried out using
Vaccinia Virus capping system and cap 2'-O-methyl transferase. FIG.
1 is an agarose gel illustrating the production of capped and
uncapped DNAI1 RNA. Note that in this experiment, the DNAI1 cDNA
was ligated into pVAX120 to provide a construct that comprises a
poly(A) tail.
Example 2: Expression of DNAI Ribonucleic Acid in Mammalian
Cells
[0240] This experiment demonstrates the expression (translation) of
DNAI1 in HEK-293 cells. FIG. 2 is a western blot illustrating the
translations of DNAI1 mRNA in 293 cells at 6 hours, 24 hours, and
48 hours post-transfection. For this experiment, 5.times.10.sup.5
293 cells/well in a 6 well plate were transfected with 2.5 .mu.g of
DNAI1 RNA using 3.75 .mu.l messenger max transfection reagent. 6,
24, and 48 hours post transfection, cells were scraped from the
wells, pelleted, and the pellet was lysed in RIPA buffer. The blot
was probed with anti-DNAI1 ab166912 from Abcam. A C-terminal FLAG
tagged DNAI1 plasmid DNA was transfected as a control, and the
difference in MW between the plasmid and mRNA is likely due to the
FLAG tag in the pENTRY vector.
Example 3: Formulation of a Composition Comprising an Engineered
Polyribonucleotide for the Treatment of Human Subjects Afflicted
with Primary Ciliary Dyskinesia
[0241] Compositions are formulated as follows:
[0242] A nucleic acid construct encoding the DNAI1 gene sequence,
NCBI Reference Sequence: NM_012144, is prepared as described in
Example 1. Branched polyethylenimine is purchased from Sigma
Aldrich.TM.. Linear in vivo-jetPEI.RTM. (polyethylenimine) is
purchased from Polyplus Transfection.RTM. (Illkirch, France) and
used without further purification. Following the manufacturer
protocol, jetPEI is diluted in 5% glucose (final concentration)
using the sterile 10% glucose solution provided by the manufacturer
and HPLC-grade water purchased from Sigma-Aldrich (St. Louis, Mo.).
After diluting the nucleic acid construct in 5% glucose (final
concentration), the RNA and jetPEI solutions are combined/mixed at
a ratio of 1:1 with a final N/P ratio of 8. The mRNA is then
administered by intranasal instillation. Alternatively, the nucleic
acid construct could also be formulated for administration by
nebulizing or sniffing with a lipoplex formulation.
Example 4: Effects of Posttranscriptional Polyadenylation Reaction
Times on RNA Quality
[0243] The effect of the post-transcriptional polyadenylation
reaction times on RNA quality was tested. Post in vitro
transcription (IVT) poly-adenylation reaction times are typically
60-90 minutes long and usually provide polyA lengths that are at
most about .about.200 As. Because mRNA is susceptible to
hydrolysis, it often degrades over time during the
posttranscriptional poly-adenylation reaction. To maintain an
optimal length for the DNAI1 poly A tail and to maximize RNA
quality, a nucleic acid construct that encodes dynein axonemal
intermediate chain 1 protein or a variant thereof with a poly A
tail already included in the template was constructed.
[0244] A summary of the nucleic acid constructs encoding the DNAI1
gene sequence both with and without a poly-A sequence that were
used to generate DNAI1 mRNAs are shown below:
TABLE-US-00004 TABLE 4 Nucleic acid constructs encoding the DNAI1
Enzyme for Codon- Nucleotide Poly(A) gene sequence Vector
Linearization optimized composition post-IVT DNAI1 pCMV6Entry Pme I
No unmodified yes DNAI1 pVAX NotI Yes, unmodified No, Poly(A)
sequence (SEQ ID NO: 14) GenScript in template
[0245] FIG. 3 illustrates fragment analyzer data to determine the
length of DNAI1 mRNAs produced from the DNAI1-pCMV6Entry plasmid
that were post-transcriptionally polyadenylated with reaction times
from 0 to 60 min. This demonstrates increasing transcripts lengths
with longer polyadenylation reaction times. FIG. 4 illustrates
fragment analyzer data to examine the quality of these DNAI1 mRNAs
that were post-transcriptionally poly adenylated with reaction
times from 0 to 60 min. These results indicate that the RNA
undergoes degradation as the poly-adenylation reaction proceeds as
demonstrated by the reduction in % peak and increase in pre-peak
smear % with longer reaction times. FIG. 5 illustrates the length
of the poly-A sequence in the DNAI1-pVAX plasmid template as
determined by 8% PAGE.
Example 5: RNA Production and Quality Control In Vitro
[0246] The following experiment was conducted to compare the effect
of incorporating specific chemically-modified nucleotides, in
varying ratios, on translation efficiency in different cell types
and immunogenicity.
[0247] The experiments involved: 1) in vitro transcription of
nucleic acid constructs; 2) in vitro capping of the nucleic acid
constructs; 3) analysis of the integrity of the transcribed RNAs;
4) immuno-Dot-Blot Assay for dsRNAs; and 5) analysis of the
nucleotide composition of the transcribed RNAs. General protocols
for in vitro transcription (IVT) and capping of the RNAs were
followed with a few modifications. IVT reactions for nucleic acid
constructs encoding the DNAI1 gene were performed at 37.degree. C.
lasted for 6 h in the presence of 20 mM MgCl.sub.2 and 7.5 mM of
each ribonucleotide.
[0248] TABLE 5 illustrates various specific chemically-modified
nucleotides that were transcribed in vitro from a nucleic acid
construct that encodes dynein axonemal intermediate chain 1.
TABLE-US-00005 TABLE 5 Modified nucleotide composition of in vitro
Vector Sample transcription reaction 5' Cap backbone 5' UTR 3' UTR
2 DNAI1-RNA- Unmodified Yes pVAX vector vector 002.2a (SEQ ID NO:
14) 3 DNAI1-RNA- 50% .PSI. Yes pVAX vector vector 003.2a (SEQ ID
NO: 14) 4 DNAI1-RNA- 100% .PSI. Yes pVAX vector vector 004.2a (SEQ
ID NO: 14) 5 DNAI1-RNA- 100% m1.PSI. Yes pVAX vector vector 037.1a
(SEQ ID NO: 14)
[0249] Results:
[0250] UV Measurements
TABLE-US-00006 TABLE 6 Modified nucleotide composition of in vitro
Sample transcription reaction mg/mL 260/280 2 DNAI1-RNA-002.2a
unmodified 0.944 2.22 3 DNAI1-RNA-003.2a 50% .PSI. 0.971 2.16 4
DNAI1-RNA-004.2a 100% .PSI. 0.940 2.13 5 DNAI1-RNA-037.1a 100%
m1.PSI. 1.092 1.94
[0251] Template Poly(A) Length--Fragment Analyzer
[0252] Analysis of poly(A) tail length of the DNAI1 nucleic acid
construct (SEQ ID NO: 5) used as a template for in vitro
transcription indicated that the number of A residues was
maintained in comparison to the original cloning vector
(pVAX-A120). The initial vector contained 120 adenosine
nucleotides, while a band between 100 and 150 bp was detected on
this nucleic acid construct (FIG. 5). Templates were digested with
Eco RI and Not I to remove the poly(A) fragment: 12 non-poly(A)
nucleotides are expected to be part of the fragment.
G*AATTCtgcag--poly(A)--GC*GGCCGC=12 nt plus the poly(A) in the
EcoRI/NotI generated fragment.
[0253] RNA Smear Analysis--Fragment Analyzer
[0254] For all transcripts generated for DNAI1 a peak around 2,000
nt was detected. Evaluation of the in vitro generated transcript on
a Fragment Analyzer indicated that capped transcripts maintained
good integrity: limited detection of smear content (an indicator of
RNA degradation and/or hydrolysis) was observed in repeated
experiments. Briefly, 2 .mu.L of 200 ng/.mu.L samples were analyzed
on a Fragment Analyzer (DNF-471 Standard Sensitivity RNA Analysis
Kit (15 nt Lower Marker). Data analysis was conducted using PROSize
2.0 software. The sizing accuracy is approximately within .+-.5%;
the sizing precision is approximately within 5% CV, the
quantification accuracy is approximately within .+-.20%; and the
quantification precision is approximately 10% CV. FIG. 6
illustrates the fragment analyzer data for the in vitro reaction
comprising the canonical nucleotides only, namely: adenosine
5'-triphosphate, guanosine 5'-triphosphate, cytidine
5'-triphosphate, and uridine 5'-triphosphate. FIG. 7 illustrates
the fragment analyzer data for the in vitro reaction comprising
50%/50% mixtures of pseudouridine and uridine 5'-triphosphate. FIG.
8 illustrates the fragment analyzer data for the in vitro reaction
comprising 100% pseudouridine 5'-triphosphate. FIG. 9 illustrates
the fragment analyzer data for the in vitro reaction comprising
100% 1-methyl-pseudouridine 5'-triphosphate. TABLE 7 summarizes the
results of the RNA smear analysis.
TABLE-US-00007 TABLE 7 % smear % smear % full- Sample pre-peak
post-peak length Length DNAI1-RNA-002.2a 24.9 3.9 71.2 2366
DNAI1-RNA-003.2a 18.5 2.5 79.0 2338 DNAI1-RNA-004.2a 16.4 3.0 80.6
2298 DNAI1-RNA-037.1a 17.7 0.4 81.9 2338
[0255] Double-stranded RNA content as detected by dot-blot showed
reactivity with J2 antibody. FIG. 10 illustrates double-stranded
RNA content, as detected by dot-blot analysis, of in vitro
transcribed RNAs from a nucleic acid construct that encodes dynein
axonemal intermediate chain 1 as well as the double-stranded RNA
content of DNAI1 constructs transcribed with the various specific
modifications shown on TABLE 5.
[0256] Nucleoside Composition Analysis
[0257] TABLES 8-10 illustrate the nucleotide composition analysis
of in vitro transcribed RNAs from a nucleic acid construct that
encodes dynein axonemal intermediate chain 1. The various specific
nucleotide modifications are shown on TABLE 5. FIGS. 11-13
illustrate the corresponding HPLC chromatograms of individual
ribonucleotides obtained after nuclease digestion of the
transcripts and subsequent dephosphorylation.
[0258] TABLE 8 illustrates the nucleotide composition analysis of
in vitro transcribed RNA from a nucleic acid construct that encodes
dynein axonemal intermediate chain 1, transcribed with unmodified
nucleotides. FIG. 11 illustrates the corresponding HPLC
chromatogram.
TABLE-US-00008 TABLE 8 Nucleotide composition (unmodified) %
abundance exp. [theoretical] A 28.9 [27.3] C 26.9 [26.5] G 26.6
[28.9] U 17.7 [17.3]
[0259] TABLE 9 illustrates the nucleotide composition analysis of
in vitro transcribed RNA from a nucleic acid construct that encodes
dynein axonemal intermediate chain 1, transcribed with 50%
pseudouridine. FIG. 12 illustrates the corresponding HPLC
chromatogram. The retention time for the hydrophobic
1-methyl-pseudouridine using identical reverse-phase HPLC
conditions averages ca. 9.5 minutes and is well separated from all
other ribonucleotides investigated (data not shown).
TABLE-US-00009 TABLE 9 Nucleotide composition % abundance exp. A
28.2 C 27.0 G 26.9 U 8.1 .PSI. 9.7 (.sub..epsilon.262) * *
concentration estimated using empirical absorption coefficient
ratio of .epsilon..sub.262/.epsilon..sub.260 = 1.001 (.PSI.)
[0260] TABLE 10 illustrates the nucleotide composition analysis of
in vitro transcribed RNA from a nucleic acid construct that encodes
dynein axonemal intermediate chain 1, transcribed with 100%
pseudouridine. FIG. 13 illustrates the corresponding HPLC
chromatogram.
TABLE-US-00010 TABLE 10 Nucleotide composition % abundance exp. A
28.8 C 26.5 G 26.9 .PSI. 17.8 (.sub..epsilon.262) * * concentration
estimated using empirical absorption coefficient ratio of
.epsilon..sub.262/.epsilon..sub.260 = 1.001 (.PSI.)
Example 6: Translation Efficiency
[0261] The translation efficiency of the aforementioned DNAI1
transcripts was assessed in three cell lines: 1) HEK-293 human
embryonic kidney cells; 2) A549 adenocarcinomic human alveolar
basal epithelial cells; and 3) MLE-15 murine lung epithelial cells.
Each cell line was transfected in triplicate with each DNAI1
transcript and the resulting cell extracts were analyzed for DNAI1
protein expression with western blotting. Briefly, either
1.times.10.sup.6 (HEK-293, MLE-15) or 2.times.10.sup.6 (A549) cells
per well were plated 18 hours before transfection in 6-well plates.
Cells were transfected with about 100 ng of each RNA using
MessengerMax transfection reagent at a RNA:MessengerMax ratio of
1:37.5. Cells were harvested at 6 hours post-transfection and whole
cell extracts were prepared in RIPA buffer (50 mM Tris-HCl pH 8,
150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.5% Sodium taurocholate).
3.5 .mu.g of total protein from each extract was prepared in
1.times.LDS sample buffer containing 2.5% beta-mercaptoethanol and
loaded on a 4-12% Bis-Tris SDS-PAGE gel. The gel was then run for
30 min. at 30 V constant voltage followed by 1 hour at 150 V. The
proteins were transferred to PVDF membrane for 1 hour at 25 V in
1.times.NuPAGE transfer buffer containing 10% methanol. Following
the transfer, DNAI1 protein was detected by western blot using an
anti-DNAI1 antibody and developed using an alkaline phosphatase
chemiluminescent substrate. The western blot values were normalized
using Sypro Ruby total protein staining as a loading control and
are expressed as relative expression to unmodified RNA. Each data
point is the mean.+-.standard deviation of three biological
(transfection) replicates.
[0262] FIGS. 14, 15, and 16 illustrate the expression of DNAI1
protein in HEK-293, A549, and MLE-15 cells respectively. DNAI1 was
expressed as a 699 amino acid, 79.3 kDa protein. The pseudouridine
(T) containing transcripts express well in all three cell types,
with expression levels at or above the unmodified RNA. Similarly,
the 1-methylpseudouridine (m.sup.1.PSI.)-containing transcript
produced expression levels at or above the unmodified RNA in A549
and MLE15 cells (Expression in HEK-293 cells was not tested for
this transcript). Importantly, the expression levels of each
transcript and their relative rankings were similar in each cell
line, indicating that there were no cell-type specific effects on
DNAI1 translation. FIG. 17 is a graph illustrating the relative
expression of DNAI1 protein in HEK-293, A549, and MLE-15 cells.
Western blot signal values were normalized using total protein
staining and are plotted as the mean expression .+-.std. dev.
relative to the unmodified DNAI1 mRNA.
[0263] TABLE 11 is a summary of the relative expression of DNAI1
protein in each of the aforementioned cell lines.
TABLE-US-00011 TABLE 11 Modified HEK-293 Cells A549 Cells MLE15
Cells Nucleotide Relative Expression Relative Expression Relative
Expression Sample Composition (% .+-. Std. Dev). (% .+-. Std. Dev).
(% .+-. Std. Dev). DNAI1-RNA-002.2a Unmodified 100 .+-. 9.57 100
.+-. 11.09 100 .+-. 5.35 DNAI1-RNA-003.2a 50% .PSI. 152.21 .+-.
31.21 120.36 .+-. 12.40 125.18 .+-. 35.84 DNAI1-RNA-004.2a 100%
.PSI. 97.52 .+-. 23.12 127.57 .+-. 12.90 100.26 .+-. 15.71
DNAI1-RNA-037.3a 100% m1.PSI. n.d. 126 .+-. 3 164 .+-. 17
Example 7: Immunogenicity of Nucleic Acid Constructs Encoding Human
DNAI1 In Vitro
[0264] The immunogenicity of the aforementioned transcripts was
tested in two cell lines namely, A549 adenocarcinomic human
alveolar basal epithelial cells and HepG2 human liver carcinoma
cells, by measuring cytokine production. Production of IL-6 in
response to the transcripts was measured in A549 cells, while
production of IP-10 was measured in HepG2 cells. Each cell line was
transfected in triplicate with a titration of each RNA. Briefly,
either 20,000 (A549) or 40,000 (HepG2) cells per well were plated
24 hours prior to transfection in 96 well plates. The cells were
then transfected with a titration of each transcript: From 250 ng
to 7 ng per well for unmodified, 50% .PSI., and 100% .PSI.
transcripts; and from 1000 ng to 32 ng per well for the 100%
m1.PSI. mRNA using MessengerMax reagent at a RNA:MessengerMax ratio
of 1:1.5.
[0265] Culture supernatants were harvested at 18 hours
post-transfection. Cell viability was measured immediately
following supernatant removal using the CellTiter-Glo assay kit
(Promega) which measures ATP levels as an indication of
metabolically active cells. For IL-6 detection, A549 cell culture
supernatants were diluted 1:20 in assay buffer and IL-6 levels were
measured using the IL-6 High Sensitivity Human ELISA kit (Abcam
ab46042). IP-10 was detected in undiluted HepG2 cell culture
supernatants using the Human IP-10 ELISA Kit SimpleStep (Abcam
ab173194).
[0266] FIGS. 18 and 19 illustrate the induction of IL-6 in A549
cells treated with the DNAI1 transcripts. For the assay shown in
FIG. 18, cells were exposed to the RNA-MessengerMax complexes for
18 hrs, while for the assay shown in FIG. 19 the RNA-MessengerMax
complexes were removed at 2 hrs post-transfection. In both cases
the cell culture supernatants were harvested at 18 hrs for
detection of IL-6 by ELISA. FIGS. 20 and 21 illustrate cell
viability for the assay shown in FIGS. 18 and 19 as measured using
the CellTiter-Glo assay. FIG. 22 illustrates induction of IP-10 in
HepG2 cells by DNAI1 transcripts. For this assay, cells were
exposed to the RNA-MessengerMax complexes for 18 hrs. IP-10
expression induced by various amounts of each DNAI1 mRNA was then
measured by ELISA. FIG. 23 illustrates cell viability for the assay
shown in FIG. 22 as measured using the CellTiter-Glo assay.
Example 8: Translation of DNAI1 mRNA in HEK293 Cells
[0267] FIG. 24 illustrates the peak expression of a nucleic acid
encoding dynein axonemal intermediate chain 1 (DNAI1), or nucleic
acid controls, in HEK293 cells. As shown in FIG. 24, in HEK293
cells, translation of DNAI1 nucleic acid construct in HEK293 cells
peaks at 6 hours but is still present at 48 hours.
Example 9: Expression of DNAI1 Protein in Undifferentiated and
Fully-Differentiated Human Airway Epithelial Cells (HAECs) and
Mouse Tracheal Epithelial Cells (MTECs) Following Administration of
Lipoplex-Formulated 100% m1.PSI.-Containing DNAI1 mRNA
[0268] Expression of DNAI1 protein in primary human airway
epithelial cells and mouse tracheal epithelial cells following
treatment with lipoplex-formulated DNAI1-HA mRNA was assessed by
western blot. The 100% m1.PSI.-containing transcript used for this
experiment was produced from a DNAI1 alternate codon usage template
(SEQ ID NO 15) that contains an HA epitope tag. Primary human
epithelial cells were maintained in submerged liquid culture for
undifferentiated cultures or maintained at an air-liquid interface
and allowed to differentiate for .about.3 weeks into
fully-differentiated ciliated epithelia. Next 12 or 24 .mu.g of
lipoplex-formulated DNAI1-HA mRNA was applied to the apical side of
the fully-differentiated cultures or directly to the
undifferentiated liquid cultures. Cells were treated either once or
once per day for two consecutive days. Cells were then harvested at
24 or 48 hrs after the final treatment and whole cell extracts were
prepared in RIPA buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 1%
Triton X-100, 0.1% SDS, 0.5% Sodium taurocholate). Total protein
from each extract was separated on a 4-12% Bis-Tris SDS-PAGE gel
and transferred to PVDF membrane. DNAI1-HA protein was detected by
western blot using an anti-HA antibody and developed using an
enhanced chemiluminescent substrate. As shown in FIG. 25, DNAI1-HA
protein was expressed at high levels in both the undifferentiated
and fully-differentiated, ciliated human airway epithelial cells
and in mouse tracheal epithelial cells.
Example 10: Altered Nucleotide Usage in Coding Regions Increases
mRNA Stability for Transcript Therapy
[0269] Altered nucleotide usage schemes aiming to reduce the number
of more reactive dinucleotides within codons as well as across
codons of modified mRNAs partially alleviate limitations imposed by
the inherent chemical instability of RNA. At the same time,
lowering the U-content in RNA transcripts renders them less
immunogenic. Traditional codon optimization (CO) can be performed
prior to (+) removal of reactive dinucleotide and (+) U-reduction
in general yielding ORFs that are termed CO++.
[0270] FIGS. 26A-26B illustrate an overall quality improvement in
DNAI1 expressing a polyribonucleotide of SEQ ID NO 15 (B) as
compared to a polyribonucleotide of SEQ ID NO 14 (A). The overall
quality improvement is judged by the increasing main RNA peak % of
the fragment analyzer traces in the polyribonucleotide engineered
with the altered codon usage strategy. Furthermore, DNAI1 mRNA
featuring the CO++-optimized open reading frame, i.e., altered
codon usage, show an improvement in translation efficiency in
transfected A549 cells when compared with transcripts that have
been traditionally optimized (CO) (see FIG. 27). Here,
1.25.times.10.sup.6 cells per well were plated 18 hours before
transfection in 6-well plates. Cells were transfected with about
100 ng of each RNA using MessengerMax transfection reagent at a
RNA:MessengerMax ratio of 1:12 and harvested 6 h post transfection.
Western blotting using an anti-DNAI1 antibody revealed DNAI1
protein expression as a 699 amino acid, 79.3 kDa protein. Relative
translation efficiencies are indicated as the mean of three
biological (transfection) replicates.
[0271] Altered reactivity with J2 antibody sensing double-stranded
RNA content was observed as shown in FIG. 28. Based on comparison
with known concentrations of poly-IC, the dsRNA content of
DNAI1-coding mRNA featuring the CO++ ORF averaged 39 ng while RNAs
with a CO ORF were estimated to contain 68 ng of dsRNA contaminants
when 200 ng of in vitro transcribed mRNA were dotted.
Example 11: HPLC-Purification of Unmodified and 100%
m.sup.1.PSI.-Containing DNAI1 mRNA
[0272] Reverse phase high-performance liquid chromatography (HPLC)
of DNAI1 mRNA was employed to purify full-length RNA and remove
contaminants such as long dsRNA generated during the in vitro
transcription using T7 RNA polymerase. Fractionation and
purification results obtained using a non-porous RNASep C18 semi
prep (100 mm.times.21.2 mm, column volume (CV) ca. 2.4 mL) column
together with mobile phases containing triethylammonium acetate
(TEAA) as an ion-pairing agent and increasing Acetonitrile content
are shown in FIGS. 29A-29D. Judged by fragment analyzer evaluation
of purified fractions, an overall quality improvement and
full-length RNA enrichment using semi-prep RNASep column was
observed. This quality improvement was achieved for both,
unmodified (A, B) and 100% m.sup.1.PSI.-containing DNAI1 mRNA
species (C, D).
[0273] As shown in FIGS. 30A-30E, a moderate improvement of
translation activity was observed for fractions enriched in
full-length, unmodified mRNA transcripts in A549 cells (A and B).
Here, 1.times.10.sup.6 A549 cells per well were plated 18 hours
before transfection in 6-well plates. Cells were transfected with
about 100 ng of each RNA using MessengerMax transfection reagent at
a RNA:MessengerMax ratio of 1:12 and harvested 6 h post
transfection. Western blotting using a 1:2000 rabbit-anti-DNAI1
(AbCam ab166912, rabbit monoclonal to recombinant DNAI1
fragmentanti-DNAI1) antibody revealed DNAI1 protein expression as a
699 amino acid, 79.3 kDa protein (C). Relative translation
efficiencies are indicated as the mean.+-.standard deviation of
three biological (transfection) replicates.
[0274] Importantly, HPLC readily removes late-eluting dot-blot
reactive species at semi-prep scale. Detectable double-stranded RNA
content reacting with J2 antibody was observed exclusively within
the late-eluting fraction F7 and the unpurified control transcript
while undetectable in all other HPLC-purified DNAI1 mRNA fractions
F1 through F6 (D). The immunogenicity of unmodified, HPLC-purified
transcripts was further tested in A549 cells by monitoring
production of IL-6 in response to the transfected mRNA. Each cell
line was transfected in triplicate with a titration of each RNA.
Briefly, 20,000 cells per well were plated 18 hours prior to
transfection in 96 well plates. The cells were then transfected
with a titration of each transcript, from 250 ng to 7 ng per well,
using MessengerMax reagent at a RNA:MessengerMax ration of 1:1.5. A
reduction of IL-6 response was observed for the HPLC-purified
fraction F3 producing the highest relative DNAI1 protein level
(unpurified reference DNAI1 mRNA: (727+/-109 pg/mL)>F3 (73+/-30
pg/mL) for cells transfected with 125 ng RNA) (E).
[0275] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. It is not intended that the invention be limited by
the specific examples provided within the specification. While the
invention has been described with reference to the aforementioned
specification, the descriptions and illustrations of the
embodiments herein are not meant to be construed in a limiting
sense. Numerous variations, changes, and substitutions will now
occur to those skilled in the art without departing from the
invention. Furthermore, it shall be understood that all aspects of
the invention are not limited to the specific depictions,
configurations or relative proportions set forth herein which
depend upon a variety of conditions and variables. It should be
understood that various alternatives to the embodiments of the
invention described herein may be employed in practicing the
invention. It is therefore contemplated that the invention shall
also cover any such alternatives, modifications, variations or
equivalents. It is intended that the following claims define the
scope of the invention and that methods and structures within the
scope of these claims and their equivalents be covered thereby.
Sequence CWU 1
1
20172DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1gggagacata aaccctggcg cgctcgcggc
ccggcactct tctggtcccc acagactcag 60agagaagcca cc 72272DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 2gggagacata aaccctggcg cgctcgcggg ccggcactct
tctggtcccc acagactcag 60agagaagcca cc 72343DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 3gggagactct tctggtcccc acagactcag agagaacgcc acc
434511DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 4gttattttcc accatattgc cgtcttttgg
caatgtgagg gcccggaaac ctggccctgt 60cttcttgacg agcattccta ggggtctttc
ccctctcgcc aaaggaatgc aaggtctgtt 120gaatgtcgtg aaggaagcag
ttcctctgga agcttcttga agacaaacaa cgtctgtagc 180gaccctttgc
aggcagcgga accccccacc tggcgacagg tgcctctgcg gccaaaagcc
240acgtgtataa gatacacctg caaaggcggc acaaccccag tgccacgttg
tgagttggat 300agttgtggaa agagtcaaat ggctctcctc aagcgtattc
aacaaggggc tgaaggatgc 360ccagaaggta ccccattgta tgggatctga
tctggggcct cggtgcacat gctttacgtg 420tgtttagtcg aggttaaaaa
acgtctaggc cccccgaacc acggggacgt ggttttcctt 480tgaaaaacac
gatgataata tggccacaac c 5115143DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 5aaataacaaa tctcaacaca
acatatacaa aacaaacgaa tctcaagcaa tcaagcattc 60tacttctatt gcagcaattt
aaatcatttc ttttaaagca aaagcaattt tctgaaaatt 120ttcaccattt
acgaacgata gca 143647DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 6gggagacaag
agagaaaaga agagcaagaa gaaatataag agccacc 47766DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 7gggagaccca agctggctag cgtttaaact taagcttggc
aatccggtac tgttggtaaa 60gccacc 668291DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
8gggagaccca agctggctag cgtttaaact taagctttcc tttccgggcc ggctgggcgc
60gccgaagcgc ctgcgccttg gctgctggtc ggttgctggg taaccgcgtc agggagttgg
120attctatcct gcaagggcac ggggacccac aacgacggct gtccctaaag
aaccgttgcg 180actggtaact gaagtggaag agagtccaga tttcttgtgt
gtggtcaagg agacggacaa 240actttttgtc ttcagacgag ggagcgtttt
gtaggctctc caggggttga g 2919186DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 9ggattgtgtc cgtaatcaca
cgtggtgcgt acgataacgc atagtgtttt tccctccact 60taaatcgaag ggttgtgtct
tggatcgcgc gggtcaaatg tatatggttc atatacatcc 120gcaggcacgt
aataaagcga ggggttcgaa tccccccgtt acccccggta ggggcccatt 180gtcttc
18610114DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 10tcagtagggt catgaaggtt tttcttttcc
tgagaaaaca acacgtattg ttttctcagg 60ttttgctttt tggccttttt ctagcttaaa
aaaaaaaaaa gcaaaattgt cttc 11411112DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
11tcagtagggt tgtaaaggtt tttcttttcc tgagaaaaca accttttgtt ttctcaggtt
60ttgctttttg gcctttccct agctttaaaa aaaaaaaagc aaaattgtct tc
1121268DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 12gaagtggcgg ttcggccgga ggttccatcg
tatccaaaag gctcttttca gagccaccca 60ttgtcttc 6813239DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
13ggggctggcc tcagtctctg tcccatcgct tgaatacagt actcctaggg cttgaccctg
60gtacccagcc cagccttagc acccagcatg tgaccccact cctgatcagg tcccagcatc
120ttcccttctt gttctgttcc ttaaggtccc agcaccttac cccaggactt
ggtcttcaac 180caccattacc cctctaactt tgcacaaata aacctgtgta
gaaacccacc ccaaaaaaa 239142100DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 14atgatcccag
caagcgccaa ggcaccacac aagcagcccc acaagcagag catctccatc 60ggcaggggca
caaggaagag ggacgaggat agcggaaccg aagtgggaga gggaacagac
120gagtgggcac agtccaaggc aaccgtgcgc ccacctgacc agctggagct
gacagatgcc 180gagctgaagg aggagttcac caggatcctg acagccaaca
atccacacgc cccccagaac 240atcgtgcgct actctttcaa ggagggcaca
tataagccaa tcggctttgt gaaccagctg 300gccgtgcact atacccaagt
gggcaatctg atccccaagg actccgatga gggccggaga 360cagcactaca
gggacgagct ggtggcagga tcccaggagt ctgtgaaagt gatctctgag
420accggcaatc tggaggagga cgaggagcca aaggagctgg agaccgagcc
aggaagccag 480acagatgtgc ctgcagcagg agcagcagag aaggtgaccg
aggaggagct gatgacacct 540aagcagccaa aggagcggaa gctgaccaac
cagttcaatt tttccgagag agcctctcag 600acatacaaca atccagtgcg
ggacagagag tgccagaccg agccaccccc tagaaccaac 660ttttccgcca
cagccaatca gtgggagatc tacgatgcct atgtggagga gctggagaag
720caggagaaga ccaaggagaa ggagaaggcc aagacacccg tggccaagaa
gtccggcaag 780atggccatgc ggaagctgac cagcatggag tcccagacag
acgatctgat caagctgtct 840caggccgcca agatcatgga gagaatggtg
aaccagaata cctatgacga tatcgcccag 900gacttcaagt actatgacga
tgcagcagac gagtacaggg atcaagtggg cacactgctg 960cctctgtgga
agtttcagaa cgataaggcc aagaggctga gcgtgaccgc cctgtgctgg
1020aatccaaagt acagggacct gttcgcagtg ggatacggat cttatgactt
catgaagcag 1080agcagaggca tgctgctgct gtattccctg aagaacccct
ctttccctga gtacatgttt 1140agctccaatt ccggcgtgat gtgcctggac
atccacgtgg atcaccccta cctggtggcc 1200gtgggccact atgacggcaa
cgtggccatc tacaatctga agaagcctca ctctcagccc 1260agcttctgtt
ctagcgccaa gagcggcaag cactccgatc ccgtgtggca ggtgaagtgg
1320cagaaggacg atatggacca gaacctgaat ttcttttccg tgtcctctga
tggcaggatc 1380gtgtcttgga ccctggtgaa gcgcaagctg gtgcacatcg
acgtgatcaa gctgaaggtg 1440gagggcagca ccacagaggt gccagaggga
ctgcagctgc acccagtggg atgcggcaca 1500gccttcgact ttcacaagga
gatcgattat atgttcctgg tgggcaccga ggagggcaag 1560atctacaagt
gttctaagag ctatagctcc cagtttctgg acacatatga tgcccacaac
1620atgagcgtgg ataccgtgtc ctggaatcct taccacacaa aggtgttcat
gagctgctct 1680agcgactgga ccgtgaagat ctgggatcac accatcaaga
cacctatgtt tatctatgac 1740ctgaactccg ccgtgggcga tgtggcatgg
gcaccatact cctctacagt gttcgcagca 1800gtgaccacag acggcaaggc
acacatcttt gatctggcca tcaacaagta cgaggccatc 1860tgtaatcagc
ccgtggccgc caagaagaac aggctgaccc acgtgcagtt caatctgatc
1920caccctatca tcatcgtggg cgacgatcgg ggccacatca tctctctgaa
gctgagcccc 1980aacctgagaa agatgcctaa ggagaagaag ggacaggagg
tgcagaaggg accagcagtg 2040gagatcgcaa agctggacaa gctgctgaat
ctggtgcgcg aggtgaagat caagacctga 2100152100DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
15atgatcccag caagcgccaa ggcaccacac aagcagcccc acaagcagag catcagcatc
60ggcaggggca caaggaagag ggacgaggac agcggaaccg aagtgggaga gggaacagac
120gagtgggcac agagcaaggc aaccgtgcgc ccacccgacc agctggagct
gacagacgcc 180gagctgaagg aggagttcac caggatcctg acagccaaca
acccacacgc cccccagaac 240atcgtgcgct acagcttcaa ggagggcaca
tacaagccaa tcggcttcgt gaaccagctg 300gccgtgcact acacccaagt
gggcaacctg atccccaagg acagcgacga gggccggaga 360cagcactaca
gggacgagct ggtggcagga agccaggaga gcgtgaaagt gatcagcgag
420accggcaacc tggaggagga cgaggagcca aaggagctgg agaccgagcc
aggaagccag 480acagacgtgc ccgcagcagg agcagcagag aaggtgaccg
aggaggagct gatgacaccc 540aagcagccaa aggagcggaa gctgaccaac
cagttcaact tcagcgagag agccagccag 600acatacaaca acccagtgcg
ggacagagag tgccagaccg agccaccccc cagaaccaac 660ttcagcgcca
cagccaacca gtgggagatc tacgacgcct acgtggagga gctggagaag
720caggagaaga ccaaggagaa ggagaaggcc aagacacccg tggccaagaa
gagcggcaag 780atggccatgc ggaagctgac cagcatggag agccagacag
acgacctgat caagctgagc 840caggccgcca agatcatgga gagaatggtg
aaccagaaca cctacgacga catcgcccag 900gacttcaagt actacgacga
cgcagcagac gagtacaggg accaagtggg cacactgctg 960cccctgtgga
agttccagaa cgacaaggcc aagaggctga gcgtgaccgc cctgtgctgg
1020aacccaaagt acagggacct gttcgcagtg ggatacggaa gctacgactt
catgaagcag 1080agcagaggca tgctgctgct gtacagcctg aagaacccca
gcttccccga gtacatgttc 1140agcagcaaca gcggcgtgat gtgcctggac
atccacgtgg accaccccta cctggtggcc 1200gtgggccact acgacggcaa
cgtggccatc tacaacctga agaagcccca cagccagccc 1260agcttctgca
gcagcgccaa gagcggcaag cacagcgacc ccgtgtggca ggtgaagtgg
1320cagaaggacg acatggacca gaacctgaac ttcttcagcg tgagcagcga
cggcaggatc 1380gtgagctgga ccctggtgaa gcgcaagctg gtgcacatcg
acgtgatcaa gctgaaggtg 1440gagggcagca ccacagaggt gccagaggga
ctgcagctgc acccagtggg atgcggcaca 1500gccttcgact tccacaagga
gatcgactac atgttcctgg tgggcaccga ggagggcaag 1560atctacaagt
gcagcaagag ctacagcagc cagttcctgg acacatacga cgcccacaac
1620atgagcgtgg acaccgtgag ctggaacccc taccacacaa aggtgttcat
gagctgcagc 1680agcgactgga ccgtgaagat ctgggaccac accatcaaga
cacccatgtt catctacgac 1740ctgaacagcg ccgtgggcga cgtggcatgg
gcaccataca gcagcacagt gttcgcagca 1800gtgaccacag acggcaaggc
acacatcttc gacctggcca tcaacaagta cgaggccatc 1860tgcaaccagc
ccgtggccgc caagaagaac aggctgaccc acgtgcagtt caacctgatc
1920caccccatca tcatcgtggg cgacgaccgg ggccacatca tcagcctgaa
gctgagcccc 1980aacctgagaa agatgcccaa ggagaagaag ggacaggagg
tgcagaaggg accagcagtg 2040gagatcgcaa agctggacaa gctgctgaac
ctggtgcgcg aggtgaagat caagacctga 2100162100DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
16atgatcccag caagcgccaa ggcaccacac aagcagcccc acaagcagag catctccatc
60ggcaggggca caaggaagag ggacgaggac agcggaaccg aagtgggaga gggaacagac
120gagtgggcac agtccaaggc aaccgtgcgc ccacctgacc agctggagct
gacagatgcc 180gagctgaagg aggagttcac caggatcctg acagccaaca
atccacacgc cccccagaac 240atcgtgcgct acagcttcaa ggagggcaca
tacaagccaa tcggcttcgt gaaccagctg 300gccgtgcact acacccaagt
gggcaatctg atccccaagg actccgatga gggccggaga 360cagcactaca
gggacgagct ggtggcagga tcccaggagt ctgtgaaagt gatctctgag
420accggcaatc tggaggagga cgaggagcca aaggagctgg agaccgagcc
aggaagccag 480acagatgtgc ctgcagcagg agcagcagag aaggtgaccg
aggaggagct gatgacaccc 540aagcagccaa aggagcggaa gctgaccaac
cagttcaact tctccgagag agcctctcag 600acatacaaca atccagtgcg
ggacagagag tgccagaccg agccaccccc cagaaccaac 660ttctccgcca
cagccaatca gtgggagatc tacgatgcct acgtggagga gctggagaag
720caggagaaga ccaaggagaa ggagaaggcc aagacacccg tggccaagaa
gtccggcaag 780atggccatgc ggaagctgac cagcatggag tcccagacag
acgatctgat caagctgtct 840caggccgcca agatcatgga gagaatggtg
aaccagaaca cctacgacga catcgcccag 900gacttcaagt actacgacga
tgcagcagac gagtacaggg atcaagtggg cacactgctg 960cctctgtgga
agttccagaa cgacaaggcc aagaggctga gcgtgaccgc cctgtgctgg
1020aatccaaagt acagggacct gttcgcagtg ggatacggaa gctacgactt
catgaagcag 1080agcagaggca tgctgctgct gtactccctg aagaacccca
gcttccctga gtacatgttc 1140agctccaact ccggcgtgat gtgcctggac
atccacgtgg atcaccccta cctggtggcc 1200gtgggccact acgacggcaa
cgtggccatc tacaatctga agaagcctca ctctcagccc 1260agcttctgca
gcagcgccaa gagcggcaag cactccgatc ccgtgtggca ggtgaagtgg
1320cagaaggacg acatggacca gaacctgaac ttcttctccg tgtcctctga
tggcaggatc 1380gtgagctgga ccctggtgaa gcgcaagctg gtgcacatcg
acgtgatcaa gctgaaggtg 1440gagggcagca ccacagaggt gccagaggga
ctgcagctgc acccagtggg atgcggcaca 1500gccttcgact tccacaagga
gatcgactac atgttcctgg tgggcaccga ggagggcaag 1560atctacaagt
gcagcaagag ctacagctcc cagttcctgg acacatacga tgcccacaac
1620atgagcgtgg acaccgtgtc ctggaatccc taccacacaa aggtgttcat
gagctgcagc 1680agcgactgga ccgtgaagat ctgggatcac accatcaaga
cacccatgtt catctacgac 1740ctgaactccg ccgtgggcga tgtggcatgg
gcaccatact ccagcacagt gttcgcagca 1800gtgaccacag acggcaaggc
acacatcttc gatctggcca tcaacaagta cgaggccatc 1860tgcaatcagc
ccgtggccgc caagaagaac aggctgaccc acgtgcagtt caatctgatc
1920caccccatca tcatcgtggg cgacgatcgg ggccacatca tctctctgaa
gctgagcccc 1980aacctgagaa agatgcccaa ggagaagaag ggacaggagg
tgcagaaggg accagcagtg 2040gagatcgcaa agctggacaa gctgctgaat
ctggtgcgcg aggtgaagat caagacctga 21001713875DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
17atgttcagaa tcggcagacg gcagctgtgg aagcacagcg tgaccagagt gctgacccag
60cggctgaagg gcgagaaaga ggccaagaga gccctgctgg acgcccggca caactacctg
120ttcgccatcg tggccagctg cctggacctg aacaagaccg aggtggaaga
cgccatcctg 180gaaggcaacc agatcgagcg gatcgaccag ctgttcgccg
tgggcggact gcggcacctg 240atgttctact accaagacgt ggaagaggcc
gagacaggcc agctgggaag cctgggcgga 300gtgaacctgg tgagcggcaa
gatcaagaaa cccaaggtgt tcgtgaccga gggcaacgac 360gtggccctga
caggcgtgtg cgtgttcttc atcagaaccg accccagcaa ggccatcacc
420cccgacaaca tccaccagga agtgagcttc aacatgctgg acgccgccga
cggcggcctg 480ctgaacagcg tgcggagact gctgagcgac atcttcatcc
ccgccctgag agccacaagc 540cacggctggg gagagctgga aggactgcag
gacgccgcca acatccggca ggaattcctg 600agcagcctgg aaggattcgt
gaacgtgctg agcggcgccc aggaaagcct gaaagaaaaa 660gtgaacctgc
ggaagtgcga catcctggaa ctgaaaaccc tgaaagagcc caccgactac
720ctgaccctgg ccaacaaccc cgagacactg ggcaagatcg aggactgcat
gaaagtgtgg 780atcaagcaga ccgaacaggt gctggccgag aacaaccagc
tgctgaaaga agccgacgac 840gtgggcccaa gagccgagct ggaacactgg
aagaagcggc tgagcaagtt caactacctg 900ctggaacagc tgaagagccc
cgacgtgaag gccgtgctgg ccgtgctggc agccgccaag 960agcaaactgc
tgaaaacctg gcgcgagatg gacatccgga tcaccgacgc caccaacgag
1020gccaaggaca acgtgaagta cctgtacacc ctggaaaagt gctgcgaccc
cctgtacagc 1080agcgaccccc tgagcatgat ggacgccatc cccaccctga
tcaacgccat caagatgatc 1140tacagcatca gccactacta caacaccagc
gagaagatca ccagcctgtt cgtgaaagtg 1200accaaccaga tcatcagcgc
ctgcaaggcc tacatcacca acaacggcac cgccagcatc 1260tggaaccagc
cccaggacgt ggtggaagag aagatcctga gcgccatcaa gctgaagcag
1320gaataccagc tgtgcttcca caagaccaag cagaagctga aacagaaccc
caacgccaag 1380cagttcgact tcagcgagat gtacatcttc ggcaagttcg
agacattcca ccggcggctg 1440gccaagatca tcgacatctt caccaccctg
aaaacataca gcgtgctgca ggacagcacc 1500atcgagggcc tggaagacat
ggccaccaag taccagggca tcgtggccac catcaagaag 1560aaagagtaca
acttcctgga ccagcgcaag atggacttcg accaggacta cgaggaattc
1620tgcaagcaga caaacgacct gcacaacgag ctgcgcaagt tcatggacgt
gaccttcgcc 1680aagatccaga acaccaacca ggccctgcgg atgctgaaga
agttcgagag actgaacatc 1740cccaacctgg gcatcgacga caagtaccag
ctgatcctgg aaaactacgg cgccgacatc 1800gacatgatca gcaagctgta
cacaaagcag aagtacgacc cccccctggc ccggaaccag 1860ccccccatcg
ccggcaaaat cctgtgggcc agacagctgt tccaccggat ccagcagccc
1920atgcagctgt tccagcagca ccccgccgtg ctgagcacag ccgaggccaa
acccatcatc 1980cggagctaca accggatggc caaggtgctg ctggaattcg
aggtgctgtt ccaccgggcc 2040tggctgcggc agatcgaaga gatccacgtg
ggactggaag ccagcctgct cgtgaaggcc 2100cccggaaccg gcgagctgtt
cgtgaacttc gacccccaga tcctgatcct gttccgggaa 2160accgagtgca
tggcccagat ggggctggaa gtgagccccc tggccaccag cctgttccag
2220aagcgggacc ggtacaagcg gaacttcagc aacatgaaga tgatgctggc
cgagtaccag 2280cgcgtgaaga gcaagatccc cgccgccatc gagcagctga
tcgtgcccca cctggccaaa 2340gtggacgagg ccctgcagcc aggactggcc
gccctgacat ggaccagcct gaacatcgag 2400gcctacctgg aaaacacatt
cgccaaaatc aaggacctgg aactgctgct ggaccgcgtg 2460aacgacctga
tcgagttccg gatcgacgcc atcctggaag agatgagcag cacccccctg
2520tgccagctgc cccaggaaga acccctgacc tgcgaagagt tcctgcagat
gaccaaggac 2580ctgtgcgtga acggcgccca gatcctgcac ttcaagagca
gcctggtgga agaagccgtg 2640aacgagctcg tgaacatgct gctggacgtg
gaagtgctga gcgaggaaga gagcgagaag 2700atcagcaacg agaacagcgt
gaactacaag aacgagagca gcgccaagcg ggaagagggc 2760aacttcgaca
ccctgaccag cagcatcaac gccagagcca acgccctgct gctgaccacc
2820gtgacccgga agaaaaaaga aaccgagatg ctgggcgaag aggccagaga
gctgctgagc 2880cacttcaacc accagaacat ggacgccctg ctgaaagtga
cacggaacac cctggaagcc 2940atccggaagc ggatccacag cagccacacc
atcaacttcc gggacagcaa cagcgccagc 3000aacatgaagc agaacagcct
gcccatcttc cgggccagcg tgacactggc catccccaac 3060atcgtgatgg
cccccgccct ggaagacgtg cagcagacac tgaacaaggc cgtggaatgc
3120atcatcagcg tgcccaaggg cgtgcggcag tggagcagcg aactgctgag
caagaagaag 3180atccaggaac ggaaaatggc cgccctgcag agcaacgagg
acagcgacag cgacgtggaa 3240atgggcgaga acgagctgca ggacacactg
gaaatcgcca gcgtgaacct gcccatcccc 3300gtgcagacca agaactacta
caagaacgtg agcgaaaaca aagaaatcgt gaagctggtg 3360agcgtgctga
gcaccatcat caacagcacc aagaaagaag tgatcaccag catggactgc
3420ttcaagcggt acaaccacat ctggcagaag ggcaaagaag aggccatcaa
gaccttcatc 3480acccagagcc ccctgctgag cgagttcgag agccagatcc
tgtacttcca gaacctggaa 3540caggaaatca acgccgagcc cgagtacgtg
tgcgtgggca gcatcgccct gtacaccgcc 3600gacctgaagt tcgccctgac
cgccgagaca aaggcctgga tggtcgtgat cggccggcac 3660tgcaacaaaa
agtacagaag cgagatggaa aacatcttca tgctgatcga ggaattcaac
3720aagaaactga accggcccat caaggacctg gacgacatca gaatcgccat
ggccgcactg 3780aaagagatca gagaggaaca gatcagcatc gacttccaag
tgggccccat cgaggaaagc 3840tacgccctgc tgaacagata cggactgctg
atcgcccggg aagagatcga caaggtggac 3900accctgcact acgcctggga
gaagctgctg gccagagccg gcgaggtgca gaacaaactg 3960gtgagcctgc
agcccagctt caagaaagaa ctgatcagcg ccgtggaagt gttcctgcag
4020gactgccacc agttctacct ggactacgac ctgaacggcc ccatggccag
cggcctgaaa 4080ccccaggaag ccagcgaccg gctgatcatg ttccagaacc
agttcgacaa catctaccgg 4140aagtacatca cctacacagg cggcgaggaa
ctgttcggcc tgcccgccac acagtacccc 4200cagctgctgg aaatcaagaa
gcagctgaac ctgctgcaga agatctacac cctgtacaac 4260agcgtgatcg
agacagtgaa cagctactac gacatcctgt ggagcgaagt gaacatcgag
4320aagatcaaca acgaactgct ggaattccag aaccggtgcc ggaagctgcc
cagagcactg 4380aaggactggc aggccttcct ggacctgaag aaaatcatcg
acgacttcag cgagtgctgc 4440cccctgctgg agtacatggc cagcaaggcc
atgatggaac ggcactggga gagaatcacc 4500acactgaccg gccacagcct
ggacgtgggc aacgagagct tcaagctgcg gaacatcatg 4560gaagccccac
tgctgaagta caaagaggaa atcgaggaca tctgcatcag cgccgtgaaa
4620gagcgggaca tcgagcagaa actgaaacaa gtgatcaacg agtgggacaa
caagaccttc 4680accttcggca gcttcaagac cagaggcgag ctgctgctgc
ggggcgacag caccagcgag 4740atcatcgcca acatggaaga cagcctgatg
ctgctgggca gcctgctgag caaccggtac 4800aacatgccct tcaaggccca
gatccagaaa tgggtgcagt acctgagcaa cagcaccgac 4860atcatcgaga
gctggatgac cgtgcagaac ctgtggatct acctggaagc cgtgttcgtg
4920ggcggcgaca tcgccaagca gctgcccaaa gaggccaagc ggttcagcaa
catcgacaag 4980agctgggtca agatcatgac cagagcccac
gaggtgccca gcgtggtgca gtgctgcgtg 5040ggcgacgaaa cactgggaca
gctgctgccc cacctgctgg accagctgga aatctgccag 5100aagagcctga
ccggctacct ggaaaagaaa cggctgtgct tcccccggtt cttcttcgtg
5160agcgaccccg ccctgctgga aatcctgggc caggccagcg acagccacac
aatccaggcc 5220cacctgctga acgtgttcga caacatcaag agcgtgaagt
tccacgagaa aatctacgac 5280cggatcctga gcatcagcag ccaggaaggc
gagacaatcg agctggacaa gcccgtgatg 5340gccgagggaa acgtggaagt
gtggctgaac agcctgctgg aagagagcca gagcagcctg 5400cacctcgtga
tcagacaggc cgccgccaac atccaggaaa ccggcttcca gctgaccgag
5460ttcctgagca gcttcccagc acaagtggga ctgctgggca tccagatgat
ctggaccaga 5520gacagcgaag aggccctgag aaacgccaag ttcgacaaga
aaatcatgca gaaaacaaac 5580caggcattcc tggaactgct gaacaccctg
atcgacgtga ccacccggga cctgagcagc 5640accgagagag tgaagtacga
gacactgatc accatccacg tgcaccagcg ggacatcttc 5700gacgacctgt
gccacatgca catcaagagc cccatggact tcgagtggct gaagcagtgc
5760aggttctact tcaacgagga cagcgacaag atgatgatcc acatcaccga
cgtggccttc 5820atctaccaga acgagttcct gggctgcacc gaccgcctcg
tgatcacccc cctgaccgac 5880cggtgctaca tcacactggc ccaggcactg
ggcatgagca tgggaggcgc accagcagga 5940cccgccggca caggcaagac
cgaaaccacc aaggacatgg gacgctgcct gggcaaatac 6000gtggtggtgt
tcaactgcag cgaccagatg gacttccggg gcctgggccg gatcttcaag
6060ggcctggcac agagcggaag ctggggctgc ttcgacgagt tcaacagaat
cgacctgccc 6120gtgctgagcg tggccgcaca gcagatcagc atcatcctga
catgcaaaaa agagcacaag 6180aagagcttca tcttcaccga cggcgacaac
gtgaccatga accccgagtt cggcctgttc 6240ctgacaatga accccggcta
cgccggacgg caggaactgc ccgagaacct gaagatcaac 6300ttccggagcg
tggccatgat ggtgcccgac cggcagatca tcatcagagt gaaactggcc
6360agctgcggct tcatcgacaa cgtggtgctg gcccggaagt tcttcacact
gtacaagctg 6420tgcgaagaac agctgagcaa acaggtgcac tacgacttcg
gcctgaggaa catcctgagc 6480gtgctgagaa ccctgggagc cgccaagcgg
gccaacccca tggacaccga gagcacaatc 6540gtgatgcggg tgctgcggga
catgaacctg agcaagctga tcgacgagga cgagcccctg 6600ttcctgagcc
tgatcgagga cctgttcccc aacatcctgc tggacaaggc cggctacccc
6660gaactggaag ccgccatcag cagacaggtg gaagaggccg gcctgatcaa
ccaccccccc 6720tggaaactga aagtgatcca gctgttcgag acacagcgcg
tgcggcacgg catgatgaca 6780ctgggaccca gcggagccgg caagaccacc
tgcatccaca cactgatgcg ggccatgacc 6840gactgcggca agccccaccg
cgagatgcgg atgaacccca aggccatcac cgccccccag 6900atgttcggca
gactggacgt ggccaccaac gactggaccg acggcatctt cagcaccctg
6960tggcgcaaga ccctgcgggc caagaagggc gagcacatct ggatcatcct
ggacggcccc 7020gtggacgcca tctggatcga gaacctgaac agcgtgctgg
acgacaacaa gacactgacc 7080ctggccaacg gcgaccggat ccccatggcc
cccaactgca agatcatctt cgagccccac 7140aacatcgaca acgccagccc
cgccaccgtg agcagaaacg gcatggtgtt catgagcagc 7200agcatcctgg
actggagccc catcctggaa ggcttcctga agaagcggag cccccaggaa
7260gccgagatcc tgagacagct gtacaccgag agcttccccg acctgtaccg
gttctgcatc 7320cagaacctgg agtacaagat ggaagtgctg gaagccttcg
tgatcaccca gagcatcaac 7380atgctgcagg gcctgatccc cctgaaagaa
cagggcggag aagtgagcca ggcccacctg 7440ggcagactgt tcgtgttcgc
cctgctgtgg agcgccggcg ccgccctgga actggacgga 7500aggcggagac
tggaactgtg gctgcggagc agacccaccg gcaccctgga actgccccca
7560ccagccggac ccggcgacac cgccttcgac tactacgtgg cccccgacgg
cacctggacc 7620cactggaaca cccggaccca ggaatacctg taccccagcg
acaccacccc cgagtacggc 7680agcatcctgg tgcccaacgt ggacaacgtg
cggaccgact tcctgatcca gacaatcgcc 7740aagcagggaa aggccgtgct
gctgatcggc gagcagggca cagccaagac cgtgatcatc 7800aagggcttca
tgagcaagta cgaccccgag tgccacatga tcaagagcct gaacttcagc
7860agcgccacca ccccactgat gttccagcgg accatcgaga gctacgtgga
caagcggatg 7920ggcaccacct acggcccccc agccggcaag aaaatgaccg
tgttcatcga cgacgtgaac 7980atgcccatca tcaacgagtg gggcgaccaa
gtgaccaacg agatcgtgcg gcagctgatg 8040gaacagaacg gcttctacaa
cctggaaaag cccggcgagt tcaccagcat cgtggacatc 8100cagttcctgg
ccgccatgat ccaccccggc ggcggaagaa acgacatccc ccagcggctg
8160aagcggcagt tcagcatctt caactgcacc ctgcccagcg aggccagcgt
ggacaagatc 8220ttcggcgtga tcggcgtggg ccactactgc acccagagag
gcttcagcga ggaagtgcgg 8280gacagcgtga ccaagctggt gcccctgaca
agacggctgt ggcagatgac caagatcaag 8340atgctgccca cccccgccaa
gttccactac gtgttcaacc tgcgggacct gagcagagtg 8400tggcagggaa
tgctgaacac caccagcgaa gtgatcaaag agcccaacga cctgctgaag
8460ctgtggaagc acgagtgcaa gagagtgatc gccgaccggt tcaccgtgag
cagcgacgtg 8520acatggttcg acaaggccct ggtgagcctg gtggaagagg
aattcggcga agagaagaaa 8580ctgctggtgg actgcggcat cgacacctac
ttcgtggact tcctgcgcga cgcccccgaa 8640gccgccggcg agacaagcga
agaggccgac gccgagacac ccaagatcta cgagcccatc 8700gagagcttca
gccacctgaa agaaaggctg aacatgttcc tgcagctgta caacgagagc
8760atccggggag ccggcatgga catggtgttc ttcgccgacg ccatggtgca
cctcgtgaag 8820atcagcagag tgatccggac cccccagggc aacgccctgc
tcgtgggagt gggaggcagc 8880ggcaagcaga gcctgaccag actggccagc
ttcatcgccg gctacgtgag cttccagatc 8940accctgaccc ggagctacaa
caccagcaac ctgatggaag acctgaaggt gctgtaccgg 9000acagccggcc
agcaggggaa gggcatcacc ttcatcttca ccgacaacga gatcaaggac
9060gagagcttcc tggagtacat gaacaacgtg ctgagcagcg gcgaggtgag
caacctgttc 9120gcccgggacg agatcgacga gatcaacagc gacctggcca
gcgtgatgaa gaaagaattc 9180ccccggtgcc tgcccacaaa cgagaacctg
cacgactact tcatgagcag agtgcggcag 9240aacctgcaca tcgtgctgtg
cttcagcccc gtgggcgaga agttcagaaa ccgggccctg 9300aagttccccg
ccctgatcag cggctgcacc atcgactggt tcagccggtg gcccaaggac
9360gccctggtgg ccgtgagcga gcacttcctg accagctacg acatcgactg
cagcctggaa 9420atcaagaaag aggtggtgca gtgcatgggc agcttccagg
acggcgtggc cgagaaatgc 9480gtggactact tccagcggtt ccggcggagc
acccacgtga cccccaagag ctacctgagc 9540ttcatccagg gctacaagtt
catctacggc gagaagcacg tggaagtgcg cacactggcc 9600aaccggatga
acaccggcct ggaaaaactg aaagaggcca gcgagagcgt ggccgccctg
9660agcaaagaac tggaagccaa agaaaaagaa ctgcaggtgg ccaacgacaa
ggccgacatg 9720gtgctgaaag aagtgaccat gaaggcccag gccgccgaga
aagtgaaagc cgaggtgcag 9780aaagtgaagg accgggccca ggccatcgtg
gacagcatca gcaaggacaa ggccatcgcc 9840gaggaaaagc tggaagcagc
caagcccgcc ctggaagagg cagaagccgc cctgcagacc 9900atccggccca
gcgacatcgc cacagtgcgg accctgggaa ggccccccca cctgatcatg
9960cggatcatgg actgcgtgct gctgctgttc cagagaaagg tgagcgccgt
gaagatcgac 10020ctggaaaaaa gctgcaccat gcccagctgg caggaaagcc
tgaagctgat gaccgccggc 10080aacttcctgc agaacctgca gcagttcccc
aaggacacca tcaacgagga agtgatcgag 10140ttcctgagcc cctacttcga
gatgcccgac tacaacatcg aaaccgccaa acgcgtgtgc 10200ggcaacgtgg
ccggactgtg cagctggacc aaggccatgg ccagcttctt cagcatcaac
10260aaagaggtgc tgcccctgaa ggccaacctg gtggtgcagg aaaaccggca
cctgctggcc 10320atgcaggacc tgcagaaagc ccaggccgag ctggacgaca
agcaggccga gctggacgtg 10380gtgcaggccg agtacgagca ggccatgacc
gagaagcaga ccctgctgga agacgcagag 10440cggtgcagac acaagatgca
gaccgccagc accctgatca gcggactggc cggcgaaaaa 10500gagcggtgga
ccgagcagag ccaggaattc gccgcccaga ccaagcggct cgtgggagac
10560gtgctgctgg ccaccgcctt cctgagctac agcggcccct tcaaccagga
attcagggac 10620ctgctgctga acgactggcg gaaagagatg aaggccagaa
agatcccctt cggcaagaac 10680ctgaacctga gcgagatgct gatcgacgcc
cccaccatca gcgagtggaa cctgcaggga 10740ctgcccaacg acgacctgag
catccagaac ggaatcatcg tgaccaaagc cagcagatac 10800cccctgctga
tcgaccccca gacacagggc aagatctgga tcaagaacaa agagagccgg
10860aacgagctgc agatcaccag cctgaaccac aagtacttcc ggaaccacct
ggaagacagc 10920ctgagcctgg gcaggccact gctgatcgag gacgtgggcg
aggaactgga cccagccctg 10980gacaacgtgc tggaacggaa cttcatcaag
accggcagca ccttcaaagt gaaagtgggc 11040gacaaagaag tggacgtgct
ggacggcttc cggctgtaca tcaccaccaa gctgcccaac 11100cccgcctaca
cccccgagat cagcgcccgg accagcatca tcgacttcac cgtgacaatg
11160aagggactgg aagaccagct gctgggacgc gtgatcctga cagagaagca
ggaactggaa 11220aaagaacgga cccacctgat ggaagacgtg accgccaaca
agcggcggat gaaggaactg 11280gaagacaacc tgctgtacag gctgaccagc
acccagggca gcctggtgga agacgagagc 11340ctgatcgtgg tgctgagcaa
caccaagcgg accgcagagg aagtgaccca gaagctggaa 11400atcagcgccg
agacagaggt gcagatcaac agcgccagag aagagtaccg gcccgtggcc
11460acccggggaa gcatcctgta cttcctgatc accgagatgc ggctcgtgaa
cgagatgtac 11520cagaccagcc tgcggcagtt cctgggcctg ttcgacctga
gcctggccag aagcgtgaag 11580agccccatca ccagcaagag aatcgccaac
atcatcgagc acatgaccta cgaggtgtac 11640aaatacgccg ccagaggcct
gtacgaggaa cacaagttcc tgttcacact gctgctgacc 11700ctgaagatcg
acatccagcg gaacagagtg aagcacgaag agttcctgac actgatcaag
11760gggggagcca gcctggacct gaaggcctgc ccccccaagc ccagcaagtg
gatcctggac 11820atcacctggc tgaacctggt ggaactgagc aagctgagac
agttcagcga cgtgctggac 11880cagatcagcc gcaacgagaa gatgtggaag
atctggttcg acaaagagaa ccccgaggaa 11940gaacccctgc ccaacgccta
cgacaagagc ctggactgct tccggcggct gctgctgatc 12000agaagctggt
gccccgaccg gacaatcgcc caggcccgca agtacatcgt ggacagcatg
12060ggagagaagt acgccgaggg cgtgatcctg gacctggaaa agacctggga
ggaaagcgac 12120cccagaaccc ccctgatctg cctgctgagc atgggcagcg
accccaccga cagcatcatc 12180gccctgggca agagactgaa gatcgagaca
agatacgtga gcatgggcca gggccaggaa 12240gtgcacgcca gaaagctgct
gcagcagacc atggccaacg gcggctgggc cctgctgcag 12300aactgccacc
tggggctgga cttcatggac gaactgatgg acatcatcat cgagacagag
12360ctggtgcacg acgccttcag actgtggatg accaccgagg cccacaagca
gttccccatc 12420accctgctgc agatgagcat caagttcgcc aacgaccccc
cccagggact gagagccggc 12480ctgaagagaa cctacagcgg cgtgagccag
gacctgctgg acgtgagcag cggcagccag 12540tggaagccca tgctgtacgc
cgtggcattc ctgcacagca ccgtgcagga acggcggaag 12600ttcggcgccc
tgggatggaa catcccctac gagttcaacc aggccgactt caacgccacc
12660gtgcagttca tccagaacca cctggacgac atggacgtga agaaaggggt
gagctggaca 12720accatccggt acatgatcgg agagatccag tacggcggca
gagtgaccga cgactacgac 12780aagaggctgc tgaacacctt cgccaaagtg
tggttcagcg agaacatgtt cggccccgac 12840ttcagcttct accagggcta
caacatcccc aagtgcagca ccgtggacaa ctacctgcag 12900tacatccaga
gcctgcccgc ctacgacagc cccgaggtgt tcggactgca ccccaacgcc
12960gacatcacct accagagcaa actggccaag gacgtgctgg acaccatcct
gggcatccag 13020cccaaggaca ccagcggcgg aggcgacgaa acccgggaag
cagtggtggc cagactggcc 13080gacgacatgc tggaaaagct gccccccgac
tacgtgccct tcgaagtgaa agaacgcctg 13140cagaagatgg gccccttcca
gcccatgaac atcttcctga ggcaggaaat cgaccggatg 13200cagcgggtgc
tgagcctcgt gcggagcaca ctgaccgagc tgaaactggc catcgacggc
13260accatcatca tgagcgagaa cctgcgggac gcactggact gcatgttcga
cgccagaatc 13320cccgcatggt ggaaaaaggc cagctggatc agcagcaccc
tgggcttctg gttcaccgaa 13380ctgatcgaga gaaacagcca gttcaccagc
tgggtgttca acggcagacc ccactgcttc 13440tggatgaccg gcttcttcaa
cccacaaggc ttcctgacag caatgcgcca ggaaatcacc 13500agagccaaca
agggctgggc cctggacaac atggtgctgt gcaacgaagt gaccaagtgg
13560atgaaggacg acatcagcgc cccccccaca gagggcgtgt acgtgtacgg
cctgtacctg 13620gaaggcgccg gatgggacaa gagaaacatg aagctgatcg
agagcaagcc caaggtgctg 13680ttcgagctga tgcccgtgat caggatctac
gccgagaaca acaccctgag ggacccccgg 13740ttctacagct gccccatcta
caagaaaccc gtgcgcaccg acctgaacta catcgccgcc 13800gtggacctga
ggacagccca gacacccgag cactgggtgc tgagaggcgt ggcactgctg
13860tgcgacgtga agtga 138751813875DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 18atgttcagaa
tcggcagacg gcagctgtgg aagcacagcg tgaccagagt gctgacccag 60cggctgaagg
gcgagaaaga ggccaagaga gccctgctgg acgcccggca caattacctg
120tttgccatcg tggccagctg cctggacctg aacaagaccg aggtggaaga
tgccatcctg 180gaaggcaacc agatcgagcg gatcgaccag ctgtttgccg
tgggcggact gcggcacctg 240atgttctatt atcaagacgt ggaagaggcc
gagacaggcc agctgggatc tctgggcgga 300gtgaatctgg tgtccggcaa
gatcaagaaa cccaaggtgt tcgtgaccga gggcaacgac 360gtggccctga
caggcgtgtg cgtgttcttc atcagaaccg accccagcaa ggccatcacc
420cccgacaaca tccaccagga agtgtccttc aacatgctgg atgccgccga
tggcggcctg 480ctgaattctg tgcggagact gctgagcgac atcttcatcc
ccgccctgag agccacatct 540cacggctggg gagagctgga aggactgcag
gacgccgcca atatccggca ggaatttctg 600agcagcctgg aaggattcgt
gaacgtgctg tctggcgccc aggaaagcct gaaagaaaaa 660gtgaacctgc
ggaagtgcga tatcctggaa ctgaaaaccc tgaaagagcc caccgactac
720ctgaccctgg ccaacaaccc tgagacactg ggcaagatcg aggactgcat
gaaagtgtgg 780atcaagcaga ccgaacaggt gctggccgag aacaaccagc
tgctgaaaga agccgacgac 840gtgggcccaa gagccgagct ggaacactgg
aagaagcggc tgagcaagtt caactacctg 900ctggaacagc tgaagtcccc
cgacgtgaag gccgtgctgg ctgtgctggc agccgccaag 960agcaaactgc
tgaaaacctg gcgcgagatg gacatccgga tcaccgacgc caccaacgag
1020gccaaggaca acgtgaagta cctgtacacc ctggaaaagt gctgcgaccc
cctgtacagc 1080agcgaccctc tgagcatgat ggacgccatc cctaccctga
tcaacgccat caagatgatc 1140tacagcatca gccactacta caacaccagc
gagaagatca ccagcctgtt cgtgaaagtg 1200accaatcaga tcatcagcgc
ctgcaaggcc tacatcacca acaacggcac cgccagcatc 1260tggaaccagc
cccaggatgt ggtggaagag aagatcctgt ctgccatcaa gctgaagcag
1320gaataccagc tgtgttttca caagaccaag cagaagctga aacagaaccc
caacgccaag 1380cagttcgact tcagcgagat gtatatcttc ggcaagttcg
agacattcca ccggcggctg 1440gccaagatca tcgacatctt taccaccctg
aaaacataca gcgtgctgca ggacagcacc 1500atcgagggcc tggaagatat
ggccaccaag taccagggca ttgtggccac catcaagaag 1560aaagagtaca
acttcctgga ccagcgcaag atggacttcg accaggacta cgaggaattc
1620tgcaagcaga caaacgacct gcacaacgag ctgcgcaagt ttatggacgt
gaccttcgcc 1680aagatccaga acaccaacca ggccctgcgg atgctgaaga
agtttgagag actgaacatc 1740cccaacctgg gcatcgacga taagtaccag
ctgatcctgg aaaactacgg cgccgacatc 1800gacatgatca gcaagctgta
cacaaagcag aagtacgacc cccccctggc ccggaatcag 1860cctcctatcg
ccggcaaaat cctgtgggct agacagctgt ttcaccggat ccagcagccc
1920atgcagctgt tccagcagca ccctgccgtg ctgagcacag ccgaggccaa
acccatcatc 1980cggtcctaca accggatggc caaggtgctg ctggaattcg
aggtgctgtt ccaccgggcc 2040tggctgcggc agatcgaaga gattcacgtg
ggactggaag ccagcctgct cgtgaaggct 2100cctggaaccg gcgagctgtt
tgtgaacttc gacccccaga tcctgatcct gttccgggaa 2160accgagtgca
tggcccagat ggggctggaa gtgtctcctc tggccacctc cctgttccag
2220aagcgggacc ggtacaagcg gaacttcagc aacatgaaga tgatgctggc
tgagtaccag 2280cgcgtgaagt ccaagatccc cgctgccatc gagcagctga
tcgtgcctca cctggccaaa 2340gtggacgagg ccctgcagcc aggactggcc
gctctgacat ggaccagcct gaacatcgag 2400gcctatctgg aaaacacatt
cgccaaaatc aaggatctgg aactgctgct ggaccgcgtg 2460aacgacctga
tcgagttccg gatcgacgcc attctggaag agatgtccag cacccccctg
2520tgtcagctgc cccaggaaga acccctgacc tgcgaagagt tcctgcagat
gaccaaggac 2580ctgtgcgtga acggcgccca gattctgcac ttcaagtcca
gcctggtgga agaagccgtg 2640aacgagctcg tgaatatgct gctggatgtg
gaagtgctga gcgaggaaga gtccgagaag 2700atctccaacg agaacagcgt
gaactacaag aacgagtcca gcgccaagcg ggaagagggc 2760aacttcgaca
ccctgaccag ctccatcaat gccagagcca acgccctgct gctgaccacc
2820gtgacccgga agaaaaaaga aaccgagatg ctgggcgaag aggctagaga
gctgctgtcc 2880cacttcaacc accagaacat ggatgccctg ctgaaagtga
cacggaatac cctggaagcc 2940atccggaagc ggatccacag cagccacacc
atcaacttcc gggacagcaa cagcgccagc 3000aatatgaagc agaacagcct
gcccatcttc cgggcctccg tgacactggc catccccaat 3060atcgtgatgg
cccctgctct ggaagatgtg cagcagacac tgaacaaggc cgtggaatgc
3120atcatctccg tgcccaaggg cgtgcggcag tggtctagcg aactgctgtc
caagaagaag 3180atccaggaac ggaaaatggc cgccctgcag tctaacgagg
acagcgactc cgacgtggaa 3240atgggcgaga atgagctgca ggatacactg
gaaatcgcct ctgtgaatct gcccatcccc 3300gtgcagacca agaactacta
taagaacgtg tccgaaaaca aagaaatcgt gaagctggtg 3360tctgtgctgt
ccaccatcat caacagcacc aagaaagaag tgatcacctc catggactgc
3420ttcaagcggt acaaccacat ctggcagaag ggcaaagaag aggccattaa
gaccttcatc 3480acccagagcc ccctgctgtc cgagttcgag tctcagatcc
tgtacttcca gaacctggaa 3540caggaaatca acgccgagcc cgagtacgtg
tgtgtgggct ctatcgccct gtataccgcc 3600gacctgaagt tcgccctgac
cgccgagaca aaggcctgga tggtcgtgat cggccggcac 3660tgcaacaaaa
agtacagatc cgagatggaa aacatcttta tgctgattga ggaattcaac
3720aagaaactga accggcccat taaggacctg gacgacatca gaatcgccat
ggccgcactg 3780aaagagatca gagaggaaca gatcagcatc gacttccaag
tgggccccat cgaggaaagc 3840tacgctctgc tgaacagata cggactgctg
atcgcccggg aagagatcga caaggtggac 3900accctgcact acgcctggga
gaagctgctg gctagagccg gcgaggtgca gaacaaactg 3960gtgtctctgc
agcccagctt taagaaagaa ctgatctccg ccgtggaagt gtttctgcag
4020gactgccacc agttctacct ggactacgac ctgaacggcc ccatggcctc
tggcctgaaa 4080cctcaggaag cctccgaccg gctgattatg tttcagaacc
agttcgacaa tatctaccgg 4140aagtacatca cctacacagg cggcgaggaa
ctgttcggcc tgcctgccac acagtacccc 4200cagctgctgg aaatcaagaa
gcagctgaac ctgctgcaga agatctacac cctgtacaac 4260tccgtgatcg
agacagtgaa cagctactac gacatcctgt ggagcgaagt gaacattgag
4320aagattaaca atgaactgct ggaatttcag aaccggtgcc ggaagctgcc
cagagcactg 4380aaggattggc aggcctttct ggatctgaag aaaatcatcg
acgacttctc cgagtgctgc 4440cctctgctgg agtacatggc ctccaaggcc
atgatggaac ggcactggga gagaatcacc 4500acactgaccg gccacagcct
ggacgtgggc aacgagagct tcaagctgcg gaacatcatg 4560gaagccccac
tgctgaagta caaagaggaa atcgaggaca tctgtatcag cgccgtgaaa
4620gagcgggata tcgagcagaa actgaaacaa gtgatcaacg agtgggacaa
caagaccttt 4680accttcggca gcttcaagac cagaggcgag ctgctgctgc
ggggcgatag cacctctgag 4740atcattgcca acatggaaga tagcctgatg
ctgctgggct ccctgctgag caaccggtat 4800aacatgccct tcaaggctca
gattcagaaa tgggtgcagt acctgagcaa ctccaccgac 4860atcatcgagt
cctggatgac cgtgcagaac ctgtggatct acctggaagc cgtgttcgtg
4920ggcggcgaca ttgccaagca gctgcccaaa gaggctaagc ggttctccaa
catcgacaag 4980agctgggtca agatcatgac cagagcccac gaggtgccca
gcgtggtgca gtgctgtgtg 5040ggcgacgaaa cactgggaca gctgctgcct
catctgctgg accagctgga aatctgccag 5100aagtccctga ccggctacct
ggaaaagaaa cggctgtgtt tcccccggtt cttcttcgtg 5160tccgaccccg
ccctgctgga aattctgggc caggccagcg actcacacac aattcaggcc
5220catctgctga atgtgttcga taacatcaag agcgtgaagt tccacgagaa
aatctacgac 5280cggatcctga gcatcagctc ccaggaaggc gagacaatcg
agctggacaa gcctgtgatg 5340gccgagggaa acgtggaagt gtggctgaac
agcctgctgg aagagtccca gagcagcctg 5400cacctcgtga tcagacaggc
cgctgccaac atccaggaaa ccggctttca gctgaccgag 5460ttcctgtcca
gcttcccagc acaagtggga ctgctgggca tccagatgat ttggaccaga
5520gactccgaag aggccctgag aaacgccaag ttcgataaga aaattatgca
gaaaacaaat 5580caggcatttc tggaactgct gaacaccctg atcgacgtga
ccacccggga cctgagcagc 5640accgagagag tgaagtacga gacactgatc
accatccacg tgcaccagcg ggacatcttc 5700gacgacctgt gccacatgca
catcaagtct cccatggatt tcgagtggct gaagcagtgc 5760aggttctact
tcaacgagga ctccgacaag atgatgatcc acatcaccga tgtggccttt
5820atctatcaga atgagttcct gggctgtacc gatcgcctcg tgattacccc
cctgaccgac 5880cggtgttaca tcacactggc ccaggcactg ggcatgtcta
tgggaggcgc accagcagga 5940cctgccggca caggcaagac cgaaaccacc
aaggacatgg gacgctgcct gggcaaatac 6000gtggtggtgt tcaactgcag
cgaccagatg gatttccggg gcctgggccg gatctttaag
6060ggcctggcac agagcggaag ctggggctgc ttcgacgagt tcaacagaat
cgacctgccc 6120gtgctgtccg tggccgcaca gcagatctcc atcatcctga
catgcaaaaa agagcacaag 6180aagtccttca tcttcaccga cggcgacaat
gtgaccatga accccgagtt tggcctgttc 6240ctgacaatga accctggcta
cgccggacgg caggaactgc ccgagaacct gaagatcaac 6300tttcggagtg
tggctatgat ggtgcccgac cggcagatca ttatcagagt gaaactggcc
6360tcctgcggct tcatcgacaa cgtggtgctg gctcggaagt tcttcacact
gtacaagctg 6420tgcgaagaac agctgagtaa acaggtgcac tacgacttcg
gcctgaggaa catcctgagc 6480gtgctgagaa ctctgggagc cgctaagcgg
gccaacccca tggataccga gagcacaatc 6540gtgatgcggg tgctgcggga
catgaacctg tccaagctga tcgatgagga cgagcccctg 6600tttctgtctc
tgatcgagga tctgtttccc aacattctgc tggataaggc cggctacccc
6660gaactggaag ctgctatcag cagacaggtg gaagaggctg gcctgatcaa
ccaccccccc 6720tggaaactga aagtgatcca gctgttcgag acacagcgcg
tgcggcacgg catgatgaca 6780ctgggaccta gcggagccgg caagaccacc
tgtatccaca cactgatgcg ggccatgacc 6840gattgcggca agccccaccg
cgagatgcgg atgaacccca aggccattac cgcccctcag 6900atgttcggca
gactggacgt ggccaccaac gactggaccg acggcatctt cagcaccctg
6960tggcgcaaga ccctgcgggc caagaagggc gagcacatct ggatcatcct
ggacggcccc 7020gtggacgcca tctggattga gaacctgaac agcgtgctgg
acgacaacaa gacactgacc 7080ctggccaacg gcgaccggat ccccatggcc
cccaactgca agatcatctt cgagccccac 7140aacatcgaca acgccagccc
tgccaccgtg tccagaaacg gcatggtgtt catgagcagc 7200agcatcctgg
attggagccc tatcctggaa ggcttcctga agaagcggag cccccaggaa
7260gccgagatcc tgagacagct gtacaccgag agcttccccg acctgtaccg
gttctgcatc 7320cagaatctgg agtacaagat ggaagtgctg gaagcctttg
tgatcaccca gagcatcaac 7380atgctgcagg gcctgatccc cctgaaagaa
cagggcggag aagtgtccca ggcccacctg 7440ggcagactgt tcgtgtttgc
cctgctgtgg agcgctggcg ccgctctgga actggatgga 7500aggcggagac
tggaactgtg gctgcggagc agacctaccg gcaccctgga actgcctcca
7560ccagctggac ctggcgacac cgccttcgat tactacgtgg cccctgacgg
cacctggacc 7620cactggaata cccggaccca ggaatacctg taccccagcg
acaccacccc cgagtacggc 7680tctatcctgg tgcccaacgt ggacaacgtg
cggaccgact tcctgatcca gacaatcgcc 7740aagcagggaa aggccgtgct
gctgatcggc gagcagggca cagccaagac cgtgatcatc 7800aagggcttta
tgtctaagta cgaccccgag tgccacatga tcaagagcct gaacttcagc
7860tccgccacca ccccactgat gttccagcgg accatcgaga gctatgtgga
caagcggatg 7920ggcaccacct acggccctcc agccggcaag aaaatgaccg
tgttcatcga cgacgtgaac 7980atgcccatca tcaacgagtg gggcgaccaa
gtgaccaacg agatcgtgcg gcagctgatg 8040gaacagaacg gcttctacaa
cctggaaaag cccggcgagt tcacctctat cgtggacatc 8100cagtttctgg
ccgccatgat ccaccctggc ggcggaagaa acgacatccc ccagcggctg
8160aagcggcagt tcagcatctt caactgcacc ctgcccagcg aggccagcgt
ggacaagatc 8220tttggcgtga tcggcgtggg ccactactgc acccagagag
gcttcagcga ggaagtgcgg 8280gacagcgtga ccaagctggt gcctctgaca
agacggctgt ggcagatgac caagatcaag 8340atgctgccca cccccgccaa
gttccactac gtgttcaacc tgcgggacct gagcagagtg 8400tggcagggaa
tgctgaacac caccagcgaa gtgatcaaag agcccaacga cctgctgaag
8460ctgtggaagc acgagtgcaa gagagtgatc gccgaccggt tcaccgtgtc
tagcgacgtg 8520acatggttcg acaaggccct ggtgtccctg gtggaagagg
aattcggcga agagaagaaa 8580ctgctggtgg actgcggcat cgatacctac
ttcgtggact tcctgcgcga cgcccctgaa 8640gccgctggcg agacaagtga
agaggccgac gccgagacac ccaagatcta cgagcccatc 8700gagtccttca
gccatctgaa agaaaggctg aatatgttcc tgcagctgta taacgagtcc
8760atccggggag ccggcatgga tatggtgttc tttgccgacg ccatggtgca
cctcgtgaag 8820atcagcagag tgatccggac cccccagggc aacgctctgc
tcgtgggagt gggaggctct 8880ggcaagcaga gcctgaccag actggccagc
tttatcgccg gctacgtgtc cttccagatc 8940accctgaccc ggtcctacaa
caccagcaac ctgatggaag atctgaaggt gctgtaccgg 9000acagccggcc
agcaggggaa gggcatcacc ttcatcttca ccgacaatga gatcaaggac
9060gagtctttcc tggagtatat gaacaatgtg ctgagcagcg gcgaggtgtc
caacctgttc 9120gcccgggacg agatcgacga gattaacagc gacctggcct
ccgtgatgaa gaaagaattc 9180ccccggtgcc tgcccacaaa cgagaacctg
cacgactact tcatgtccag agtgcggcag 9240aatctgcaca tcgtgctgtg
cttcagcccc gtgggcgaga agttcagaaa ccgggccctg 9300aagttccccg
ccctgatcag cggctgcacc atcgactggt tcagccggtg gcctaaggat
9360gccctggtgg ccgtgtccga gcactttctg accagctacg acatcgactg
cagcctggaa 9420atcaagaaag aggtggtgca gtgcatgggc agcttccagg
acggcgtggc cgagaaatgc 9480gtggactact tccagcggtt ccggcggagc
acccacgtga cccctaagag ctacctgagc 9540ttcatccagg gctacaagtt
catctacggc gagaagcacg tggaagtgcg cacactggcc 9600aaccggatga
acaccggcct ggaaaaactg aaagaggcct ccgagagcgt ggccgccctg
9660agcaaagaac tggaagccaa agaaaaagaa ctgcaggtgg ccaacgataa
ggccgacatg 9720gtgctgaaag aagtgaccat gaaggcccag gccgccgaga
aagtgaaagc cgaggtgcag 9780aaagtgaagg accgggccca ggccatcgtg
gactccatca gcaaggacaa ggccattgcc 9840gaggaaaagc tggaagcagc
caagcccgcc ctggaagagg cagaagctgc tctgcagacc 9900atccggccct
ccgatattgc cacagtgcgg accctgggaa ggccccctca cctgatcatg
9960cggatcatgg actgtgtgct gctgctgttc cagagaaagg tgtccgccgt
gaagatcgac 10020ctggaaaaat cctgcaccat gcctagctgg caggaatccc
tgaagctgat gaccgccggc 10080aacttcctgc agaacctgca gcagttcccc
aaggacacca tcaatgagga agtgatcgag 10140ttcctgagcc cctacttcga
gatgcccgac tacaatatcg aaaccgccaa acgcgtgtgc 10200ggcaacgtgg
ccggactgtg ctcttggacc aaggctatgg ctagcttctt tagcattaac
10260aaagaggtgc tgcctctgaa ggccaacctg gtggtgcagg aaaaccggca
tctgctggcc 10320atgcaggacc tgcagaaagc ccaggccgag ctggacgata
agcaggctga gctggatgtg 10380gtgcaggccg agtacgagca ggccatgacc
gagaagcaga ccctgctgga agatgcagag 10440cggtgcagac acaagatgca
gaccgccagc accctgatct ctggactggc cggcgaaaaa 10500gagcggtgga
ccgagcagtc ccaggaattc gccgcccaga ccaagcggct cgtgggagat
10560gtgctgctgg ccaccgcctt tctgagctac agcggcccct tcaatcagga
attcagggac 10620ctgctgctga acgactggcg gaaagagatg aaggccagaa
agatcccctt cggcaagaat 10680ctgaacctga gcgagatgct gatcgacgcc
cccaccatct ccgagtggaa tctgcaggga 10740ctgcccaacg atgacctgtc
catccagaac ggaatcatcg tgaccaaagc ctccagatac 10800cccctgctga
ttgaccccca gacacagggc aagatttgga tcaagaacaa agagagccgg
10860aacgagctgc agatcaccag cctgaaccac aagtacttcc ggaaccacct
ggaagatagc 10920ctgagcctgg gcaggccact gctgatcgag gatgtgggcg
aggaactgga cccagccctg 10980gataacgtgc tggaacggaa cttcatcaag
accggctcca ccttcaaagt gaaagtgggc 11040gacaaagaag tggacgtgct
ggatggcttc cggctgtaca tcaccaccaa gctgcctaac 11100cccgcctaca
cccctgagat cagcgcccgg accagcatca tcgacttcac cgtgacaatg
11160aagggactgg aagatcagct gctgggacgc gtgatcctga cagagaagca
ggaactggaa 11220aaagaacgga cccatctgat ggaagatgtg accgccaaca
agcggcggat gaaggaactg 11280gaagataacc tgctgtacag gctgaccagc
acccagggca gtctggtgga agatgagagc 11340ctgatcgtgg tgctgtccaa
caccaagcgg accgcagagg aagtgaccca gaagctggaa 11400atcagcgccg
agacagaggt gcagatcaac agcgccagag aagagtaccg gcctgtggcc
11460acccggggat ccatcctgta ctttctgatc accgagatgc ggctcgtgaa
cgagatgtac 11520cagaccagcc tgcggcagtt cctgggcctg ttcgatctgt
ccctggccag aagcgtgaag 11580tcccccatca ccagcaagag aatcgccaac
atcatcgagc acatgaccta cgaggtgtac 11640aaatacgccg ccagaggcct
gtacgaggaa cacaagtttc tgttcacact gctgctgacc 11700ctgaagatcg
atatccagcg gaacagagtg aagcacgaag agtttctgac actgatcaag
11760gggggagcct ccctggacct gaaggcctgt cctcccaagc ccagcaagtg
gatcctggac 11820atcacctggc tgaatctggt ggaactgagc aagctgagac
agttctccga tgtgctggac 11880cagatcagcc gcaacgagaa gatgtggaag
atttggtttg acaaagagaa ccccgaggaa 11940gaacccctgc ctaacgccta
cgataagagc ctggactgct tccggcggct gctgctgatt 12000agaagctggt
gtcccgaccg gacaatcgcc caggcccgca agtacatcgt ggatagcatg
12060ggagagaagt acgccgaggg cgtgatcctg gacctggaaa agacctggga
ggaaagcgac 12120cccagaaccc ccctgatctg cctgctgagc atgggctccg
accccaccga cagcattatc 12180gccctgggca agagactgaa gattgagaca
agatacgtgt ccatgggcca gggccaggaa 12240gtgcacgcta gaaagctgct
gcagcagact atggccaatg gcggctgggc cctgctgcag 12300aattgtcacc
tggggctgga cttcatggac gaactgatgg acatcatcat tgagacagag
12360ctggtgcacg acgccttcag actgtggatg accaccgagg cccataagca
gtttcccatt 12420accctgctgc agatgagcat caagttcgcc aacgaccccc
ctcagggact gagagccggc 12480ctgaagagaa cctactccgg cgtgtcacag
gatctgctgg acgtgtcctc tggcagccag 12540tggaagccta tgctgtacgc
cgtggcattc ctgcacagca ccgtgcagga acggcggaag 12600tttggcgccc
tgggatggaa catcccctac gagtttaacc aggccgactt caacgccact
12660gtgcagttta tccagaacca tctggacgac atggacgtga agaaaggggt
gtcctggaca 12720accatccggt acatgatcgg agagatccag tacggcggca
gagtgaccga cgactacgac 12780aagaggctgc tgaatacctt cgccaaagtg
tggttctccg agaacatgtt tggccccgac 12840ttcagctttt accagggcta
taacatcccc aagtgctcca ccgtggataa ctacctgcag 12900tacatccaga
gcctgcccgc ctacgacagc cctgaggtgt tcggactgca ccccaacgcc
12960gatatcacct accagagcaa actggccaag gatgtgctgg ataccatcct
gggcatccag 13020cccaaggata ccagtggcgg aggcgacgaa acccgggaag
cagtggtggc tagactggcc 13080gacgacatgc tggaaaagct gccccccgac
tacgtgccct ttgaagtgaa agaacgcctg 13140cagaagatgg gccccttcca
gcctatgaac atcttcctga ggcaggaaat cgaccggatg 13200cagcgggtgc
tgtctctcgt gcggagcaca ctgaccgagc tgaaactggc tatcgacggc
13260accatcatca tgagcgagaa tctgcgggat gcactggact gcatgttcga
cgccagaatc 13320cccgcatggt ggaaaaaggc cagctggatc agctctaccc
tgggcttctg gttcaccgaa 13380ctgatcgaga gaaacagcca gtttaccagc
tgggtgttca acggcagacc tcactgcttc 13440tggatgaccg gcttcttcaa
tccacaaggc tttctgacag caatgcgcca ggaaatcacc 13500agagccaaca
agggctgggc tctggacaat atggtgctgt gtaacgaagt gactaagtgg
13560atgaaggacg acatcagcgc ccctcccaca gagggcgtgt acgtgtacgg
cctgtacctg 13620gaaggcgccg gatgggacaa gagaaacatg aagctgatcg
agagcaagcc caaggtgctg 13680ttcgagctga tgcccgtgat caggatctat
gccgagaaca acaccctgag ggacccccgg 13740ttctacagct gccccatcta
caagaaaccc gtgcgcaccg acctgaacta tatcgccgcc 13800gtggacctga
ggacagccca gacacctgag cattgggtgc tgagaggcgt ggcactgctg
13860tgcgacgtga agtga 138751910RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 19gccrccaugg
102011DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 20gaattctgca g 11
* * * * *