U.S. patent application number 15/985282 was filed with the patent office on 2019-04-11 for chemical ligation dependent probe amplification (clpa).
The applicant listed for this patent is DXTERITY DIAGNOSTICS INCORPORATED. Invention is credited to Robert Terbrueggen.
Application Number | 20190106739 15/985282 |
Document ID | / |
Family ID | 42828614 |
Filed Date | 2019-04-11 |
![](/patent/app/20190106739/US20190106739A1-20190411-C00001.png)
![](/patent/app/20190106739/US20190106739A1-20190411-D00000.png)
![](/patent/app/20190106739/US20190106739A1-20190411-D00001.png)
![](/patent/app/20190106739/US20190106739A1-20190411-D00002.png)
![](/patent/app/20190106739/US20190106739A1-20190411-D00003.png)
![](/patent/app/20190106739/US20190106739A1-20190411-D00004.png)
![](/patent/app/20190106739/US20190106739A1-20190411-D00005.png)
![](/patent/app/20190106739/US20190106739A1-20190411-D00006.png)
![](/patent/app/20190106739/US20190106739A1-20190411-D00007.png)
![](/patent/app/20190106739/US20190106739A1-20190411-D00008.png)
United States Patent
Application |
20190106739 |
Kind Code |
A1 |
Terbrueggen; Robert |
April 11, 2019 |
CHEMICAL LIGATION DEPENDENT PROBE AMPLIFICATION (CLPA)
Abstract
The present invention provides compositions, apparatuses and
methods for detecting one or more nucleic acid targets present in a
sample. Methods of the invention include utilizing two or more
oligonucleotide probes that reversibly bind a target nucleic acid
in close proximity to each other and possess complementary reactive
ligation moieties. When such probes have bound to the target in the
proper orientation, they are able to undergo a spontaneous chemical
ligation reaction that yields a ligated oligonucleotide product. In
one aspect, the ligation product is of variable length that
correlates with a particular target. Following chemical ligation,
the probes may be amplified and detected by capillary
electrophoresis or microarray analysis.
Inventors: |
Terbrueggen; Robert;
(Manhattan Beach, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
DXTERITY DIAGNOSTICS INCORPORATED |
Rancho Dominguez |
CA |
US |
|
|
Family ID: |
42828614 |
Appl. No.: |
15/985282 |
Filed: |
May 21, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12798108 |
Mar 29, 2010 |
9976177 |
|
|
15985282 |
|
|
|
|
61165839 |
Apr 1, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6855 20130101;
C12Q 1/6862 20130101; C12Q 2525/155 20130101; C12Q 1/6855 20130101;
C12Q 2525/204 20130101; C12Q 2525/155 20130101; C12Q 2525/204
20130101; C12Q 2523/109 20130101; C12Q 2523/109 20130101; C12Q
2525/15 20130101; C12Q 1/6862 20130101 |
International
Class: |
C12Q 1/6855 20060101
C12Q001/6855; C12Q 1/6862 20060101 C12Q001/6862 |
Claims
1. A method for detecting in a sample, comprising a plurality of
sample nucleic acids of different sequence, the presence of at
least one specific target nucleic acid sequence comprising a first
and a second target domain, the domains located essentially
adjacent to one another, comprising the steps of: a) contacting the
sample nucleic acids with a plurality of different probes sets,
each probe set comprising i. a first ligation probe comprising: 1)
a first probe domain substantially complementary to said first
target domain; and 2) a first non-complementary region being
essentially non-complementary to the said target nucleic acid 3) a
5'-ligation moiety; and ii. second ligation probe comprising: 1) a
second probe domain substantially complementary to said second
target domain; 2) a second non-complementary region, being
essentially non-complementary to the said target nucleic acid 3) a
3' ligation moiety; wherein at least one of said ligation probe
comprises a variable spacer sequence; and b) ligating said first
and second ligation probes in the absence of a ligase enzyme to
form a ligation product; c) amplifying said ligation product; and
d) detecting the presence of said ligation product.
2. A method of claim 1 wherein said target sequence is RNA and/or
DNA.
3. A method of claim 1 wherein said target sequence comprises
unpurified RNA
4. The method of claim 1 wherein said sample is derived from a
mammalian body selected from the group consisting of blood, urine,
saliva and feces.
5.-7. (canceled)
8. A method as in claim 1 wherein said step of detection is by mass
spectrometry.
9. The method of claim 1 wherein said 5' ligation moiety on said
first ligation probe is DAB SYL moiety and said 3' ligation moiety
on said second ligation probe is 3-phophorothioate moiety.
10. A method as in claim 1 wherein said first and second ligation
probes each further comprising a universal primer sequence for
amplification of said ligation product.
11. The method of claim 10 wherein one of the universal primers
that binds said primer sequence contains a detectable label.
12. (canceled)
13. (canceled)
14. A method for detecting in a sample, comprising a plurality of
sample nucleic acids of different sequence, the presence of at
least one specific target nucleic acid sequence comprising a first
and a second target domain, the domains located essentially
adjacent to one another, comprising the steps of: a) Contacting the
sample nucleic acids with a plurality of different probes sets,
each probe set comprising i) a first ligation probe comprising: 1)
a first probe domain substantially complementary to said first
target domain; and 2) a first non-complementary region being
essentially non-complementary to the said target nucleic acid 3) a
5'-ligation moiety; and ii) second ligation probe comprising: 1) a
second probe domain substantially complementary to said second
target domain; 2) a second non-complementary region, being
essentially non-complementary to the said target nucleic acid; and
3) a 3' ligation moiety; wherein at least one of said first and
second ligation probes further comprises an anchor sequence b)
capturing said ligation product on a microarray substrate
comprising a capture probe substantially complementary to said
anchor sequence; and c) detecting the presence of said ligated
product.
15. A method as in claim 14 wherein said first and second ligation
probes each further comprising a universal primer sequence for
amplification of said ligation product wherein one of the universal
primers that binds said primer sequence contains a detectable label
wherein said detectable label is selected from the group consisting
of a fluorescent label, an electrochemical label and a magnetic
label.
16. A method for detecting in a sample, comprising a plurality of
sample nucleic acids of different sequence, the presence of at
least one specific target nucleic acid sequence comprising a first
and a second target domain, and a third domain located between the
first and second domains, the domains located essentially adjacent
to one another, comprising the steps of: b) contacting the sample
nucleic acids with a plurality of different probes sets, each probe
set comprising i. a first ligation probe comprising: 1) a first
probe domain substantially complementary to said first target
domain; and 2) a first non-complementary region being essentially
non-complementary to the said target nucleic acid 3) a 5'-ligation
moiety; and ii. second ligation probe comprising: 1) a second probe
domain substantially complementary to said second target domain; 2)
a second non-complementary region, being essentially
non-complementary to the said target nucleic acid 3) a 3' ligation
moiety; iii. a third ligation probe comprising 1) a third probe
domain substantially complementary to the said third target domain
2) a 3' and a 5' ligation moiety; b) ligating said first ligation
probe, said second ligation probe, and said third ligation probe in
the absence of a ligase enzyme to form a ligation product; c)
amplifying said ligation product; and c) detecting the presence of
said ligated product.
17. A method of claim 16 wherein said target sequence is RNA and/or
DNA.
18. The method of claim 16 wherein said sample is derived from a
mammalian body selected from the group consisting of blood, urine,
saliva and feces.
19.22. (canceled)
23. A method as in claim 16 wherein said first and second ligation
probes each further comprising a universal primer sequence for
amplification of said ligation product.
24. The method of claim 16 wherein one of the universal primers
that binds said primer sequence contains a detectable label.
25.-31. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Continuation of U.S. patent
application Ser. No. 12/798,108 filed Mar. 29, 2010, which claims
priority from U.S. Provisional Application No. 61/165,839, filed
Apr. 1, 2009, the disclosures of which are incorporated by this
reference as though set forth fully herein.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0002] The sequence listing contained in the file named
068433-5002-US01_ST25", created on May 21, 2018, and having a size
of 8.77 kilobytes, has been submitted electronically herewith via
EFS-Web, and the contents of the txt file are hereby incorporated
by reference in their entirety.
FIELD OF THE INVENTION
[0003] This invention relates to compositions and methods for
detecting nucleic acids in a sample using chemical ligation.
BACKGROUND OF THE INVENTION
[0004] This invention relates to compositions, apparatus and
methods for detecting one or more nucleic acid targets present in a
sample. The detection of specific nucleic acids is an important
tool for diagnostic medicine and molecular biology research.
[0005] Gene probe assays currently play roles in identifying
infectious organisms such as bacteria and viruses, in probing the
expression of normal and mutant genes and identifying genes
associated with disease or injury, such as oncogenes, in typing
tissue for compatibility preceding tissue transplantation, in
matching tissue or blood samples for forensic medicine, for
responding to emergency response situations like a nuclear incident
or pandemic flu outbreak, in determining disease prognosis or
causation, and for exploring homology among genes from different
species.
[0006] Ideally, a gene probe assay should be sensitive, specific
and easily automatable (for a review, see Nickerson, Current
Opinion in Biotechnology (1993) 4:48-51.) The requirement for
sensitivity (i.e. low detection limits) has been greatly alleviated
by the development of the polymerase chain reaction (PCR) and other
amplification technologies which allow researchers to exponentially
amplify a specific nucleic acid sequence before analysis (for a
review, see Abramson et al., Current Opinion in Biotechnology,
(1993) 4:41-47). For example, multiplex PCR amplification of SNP
loci with subsequent hybridization to oligonucleotide arrays has
been shown to be an accurate and reliable method of simultaneously
genotyping hundreds of SNPs (see Wang et al., Science, (1998)
280:1077; see also Schafer et al., Nature Biotechnology,
(1989)16:33-39).
[0007] Specificity also remains a problem in many currently
available gene probe assays. The extent of molecular
complementarity between probe and target defines the specificity of
the interaction. Variations in composition and concentrations of
probes, targets and salts in the hybridization reaction as well as
the reaction temperature, and length of the probe may all alter the
specificity of the probe/target interaction.
[0008] It may be possible under some circumstances to distinguish
targets with perfect complementarity from targets with mismatches,
although this is generally very difficult using traditional
technology, since small variations in the reaction conditions will
alter the hybridization. Newer techniques with the necessary
specificity for mismatch detection include probe digestion assays
in which mismatches create sites for probe cleavage, and DNA
ligation assays where single point mismatches prevent ligation.
[0009] A variety of enzymatic and non-enzymatic methods are
available for detecting sequence variations. Examples of enzyme
based methods include Invader.TM., oligonucleotide ligation assay
(OLA) single base extension methods, allelic PCR, and competitive
probe analysis (e.g. competitive sequencing by hybridization).
Enzymatic DNA ligation reactions are well known in the art
(Landegren, Bioessays (1993) 15(11):761-5; Pritchard et al.,
Nucleic Acids Res. (1997) 25(17):3403-7; Wu et al., Genomics,
(1989) 4(4):560-9) and have been used extensively in SNP detection,
enzymatic amplification reactions and DNA repair.
[0010] A number of non-enzymatic or template mediated chemical
ligation methods have been developed that can be used to detect
sequence variations. These include chemical ligation methods that
utilize coupling reagents, such as N-cyanoimidazole, cyanogen
bromide, and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide
hydrochloride. See Metelev, V. G., et al., Nucleosides &
Nucleotides (1999) 18:2711; Luebke, K. J., and Dervan, P. B. J. Am.
Chem. Soc. (1989) 111:8733; and Shabarova, Z. A., et al., Nucleic
Acids Research (1991)19:4247, each of which is incorporated herein
by reference in its entirety.
[0011] Kool (U.S. Pat. No 7,033,753), which is incorporated herein
by reference in its entirety describes the use of chemical ligation
and fluorescence resonance energy transfer (FRET) to detect genetic
polymorphisms. The readout in this process is based on the solution
phase change in fluorescent intensity.
[0012] Terbrueggen (U.S. Patent application 60/746,897) which is
incorporated herein by reference in its entirety describes the use
of chemical ligation methods, compositions and reagents for the
detection of nucleic acids via microarray detection.
[0013] Other chemical ligation methods react a 5'-tosylate or
5'-iodo group with a 3'-phosphorothioate group, resulting in a DNA
structure with a sulfur replacing one of the bridging
phosphodiester oxygen atoms. See Gryanov, S. M., and Letsinger, R.
L., Nucleic Acids Research (1993) 21:1403; Xu, Y. and Kool, E. T.
Tetrahedron Letters (1997) 38:5595; and Xu, Y. and Kool, E. T.,
Nucleic Acids Research (1999) 27:875, each of which is herein
incorporated by reference in its entirety.
[0014] Some of the advantages of using non-enzymatic approaches for
nucleic acid target detection include lower sensitivity to
non-natural DNA analog structures, ability to use RNA target
sequences, lower cost and greater robustness under varied
conditions. Letsinger et al (U.S. Pat. No. 5,780,613, herein
incorporated by reference in its entirety) have previously
described an irreversible, nonenzymatic, covalent autoligation of
adjacent, template-bound oligonucleotides wherein one
oligonucleotide has a 5' displaceable group and the other
oligonucleotide has a 3' thiophosphoryl group.
[0015] PCT applications WO 95/15971, PCT/US96/09769,
PCT/US97/09739, PCT US99/01705, WO96/40712 and WO98/20162, all of
which are expressly incorporated herein by reference in their
entirety, describe novel compositions comprising nucleic acids
containing electron transfer moieties, including electrodes, which
allow for novel detection methods of nucleic acid
hybridization.
[0016] One technology that has gained increased prominence involves
the use of DNA arrays (Marshall et al., Nat Biotechnol. (1998)
16(1):27-31), especially for applications involving simultaneous
measurement of numerous nucleic acid targets. DNA arrays are most
often used for gene expression monitoring where the relative
concentration of 1 to 100,000 nucleic acids targets (mRNA) is
measured simultaneously. DNA arrays are small devices in which
nucleic acid anchor probes are attached to a surface in a pattern
that is distinct and known at the time of manufacture (Marshall et
al., Nat Biotechnol. (1998) 16(1):27-31) or can be accurately
deciphered at a later time such as is the case for bead arrays
(Steemers et al., Nat Biotechnol. (2000) 18(1):91-4; and Yang et
al., Genome Res. (2001) 11(11):1888-98.). After a series of
upstream processing steps, the sample of interest is brought into
contact with the DNA array, the nucleic acid targets in the sample
hybridize to anchor oligonucleotides on the surface, and the
identity and often concentration of the target nucleic acids in the
sample are determined.
[0017] Many of the nucleic acid detection methods in current use
have characteristics and/or limitations that hinder their broad
applicability. For example, in the case of DNA microarrays, prior
to bringing a sample into contact with the microarray, there are
usually a series of processing steps that must be performed on the
sample. While these steps vary depending upon the manufacturer of
the array and/or the technology that is used to read the array
(fluorescence, electrochemistry, chemiluminescence,
magnetoresistance, cantilever deflection, surface plasmon
resonance), these processing steps usually fall into some general
categories: Nucleic acid isolation and purification, enzymatic
amplification, detectable label incorporation, and clean up
post-amplification. Other common steps are sample concentration,
amplified target fragmentation so as to reduce the average size of
the nucleic acid target, and exonuclease digestion to convert PCR
amplified targets to a single stranded species.
[0018] The requirement of many upstream processing steps prior to
contacting the DNA array with the sample can significantly increase
the time and cost of detecting a nucleic acid target(s) by these
methods. It can also have significant implications on the quality
of the data obtained. For instance, some amplification procedures
are very sensitive to target degradation and perform poorly if the
input nucleic acid material is not well preserved (Foss et al.,
Diagn Mol Pathol. (1994) 3(3):148-55). Technologies that can
eliminate or reduce the number and/or complexity of the upstream
processing steps could significantly reduce the cost and improve
the quality of results obtained from a DNA array test. One method
for reducing upstream processing steps involves using ligation
reactions to increase signal strength and improve specificity.
[0019] There remains a need for methods and compositions for
efficient and specific nucleic acid detection. Accordingly, the
present invention provides methods and compositions for
non-enzymatic chemical ligation reactions which provides very rapid
target detection and greatly simplified processes of detecting and
measuring nucleic acid targets.
SUMMARY OF THE INVENTION
[0020] Accordingly, in one aspect, the invention relates to a
method comprising providing a ligation substrate comprising a
target nucleic acid sequence comprising at least a first target
domain and a second target domain, and a first and second ligation
probe. The ligation probes may comprise a stuffer sequence of
variable length and/or sequence. The first ligation probe comprises
a first probe domain substantially complementary to the first
target domain, and a 5'-ligation moiety. The second ligation probe
comprises a second probe domain substantially complementary to the
second target domain, and a 3' ligation moiety. Optionally, the
first target domain and the second target domain are separated by
at least one nucleotide. Optionally, at least one of the first and
said second ligation probes comprises an anchor sequence and/or a
label, including a label probe binding sequence. The first and
second ligation probes are ligated in the absence of exogeneously
added ligase enzyme to form a ligation product. The ligated product
may optionally be captured on a substrate comprising a capture
probe substantially complementary to said anchor sequence and
detected. The ligation product may be amplified and detected by
capillary electrophoresis, microarray analysis, or any other
suitable method.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1. Schematic representation of one embodiment of
CLPA-CE assay.
[0022] FIG. 2. Schematic representation of one embodiment of
CLPA-MDM assay.
[0023] FIG. 3. Schematic representation showing one embodiment of
the 2-probe and the 3-probe CLPA reaction.
[0024] FIG. 4. Schematic Representation of a DNA synthesis resin
that can be used to manufacture DNA with a 3'-DABSYL leaving
group
[0025] FIG. 5. Schematic Representation on the process flow for one
embodiment of the CLPA-CE assay
[0026] FIG. 6. Schematic chart showing probe design for CLPA assay
in which is incorporated a size-variant stuffer sequence.
[0027] FIG. 7. Electrophoretic separation profile on sample
analyzed by CLPA-CE.
[0028] FIG. 8. Linear relationship between target concentration and
peak height in CLPA-CE analysis.
DETAILED DESCRIPTION OF THE INVENTION
[0029] The practice of the present invention may employ, unless
otherwise indicated, conventional techniques and descriptions of
organic chemistry, polymer technology, molecular biology (including
recombinant techniques), cell biology, biochemistry, and
immunology, which are within the skill of the art. Such
conventional techniques include polymer array synthesis,
hybridization, ligation, and detection of hybridization using a
label. Specific illustrations of suitable techniques can be had by
reference to the example herein below. However, other equivalent
conventional procedures can also be used. Such conventional
techniques and descriptions can be found in standard laboratory
manuals such as Genome Analysis: A Laboratory Manual Series (Vols.
I-IV), Using Antibodies: A Laboratory Manual, Cells: A Laboratory
Manual, PCR Primer: A Laboratory Manual, and Molecular Cloning: A
Laboratory Manual (all from Cold Spring Harbor Laboratory Press),
Stryer, L. (1995) Biochemistry (4th Ed.) Freeman, New York, Gait,
"Oligonucleotide Synthesis: A Practical Approach" 1984, IRL Press,
London, Nelson and Cox (2000), Lehninger, Principles of
Biochemistry 3rd Ed., W. H. Freeman Pub., New York, N.Y. and Berg
et al. (2002) Biochemistry, 5.sup.th Ed., W. H. Freeman Pub., New
York, N.Y., all of which are hereby incorporated in their entirety
by reference for all purposes. Furthermore, all references cited in
this application are herein incorporated in their entirety by
reference for all purposes.
Overview
[0030] The invention provides compositions, apparatus and methods
for the detection of one or more nucleic acid targets in a sample
including DNA and RNA targets. Moreover, the sample need not be
purified. Indeed, one aspect of the invention relates to analyzing
impure samples including body samples such as, but not limited to,
whole blood. The invention provides methods utilizing two or more
oligonucleotide probes that reversibly bind a target nucleic acid
in close proximity to each other and possess complementary reactive
ligation moieties (it should be noted, as is further described
herein, that the reactive moieties are referred to herein as
"ligation moieties"). When the probes have bound the target in the
proper orientation, they are able to undergo a spontaneous chemical
ligation reaction that yields a ligated oligonucleotide product.
Following ligation, a new product is generated that can be
amplified by an enzymatic or chemical reaction. In the preferred
embodiment, the chemical ligation reaction joins two probes that
have PCR primer sites on them, e.g. universal PCR primers.
Additionally, in one embodiment of the invention, one or both
ligation probes contain a stuffer sequence, or variable spacer
sequence, which is designed to have differing lengths for each
probe set (i.e. each target sequence) thereby resulting in a
ligation product having a target-specific length. Following
ligation a defined length oligonucleotide can now be exponentially
amplified by PCR. In accordance with one aspect of the invention,
the probes can possess detectable labels (fluorescent labels,
electrochemical labels, magnetic beads, nanoparticles, biotin) to
aid in the identification, purification, quantification or
detection of the ligated oligonucleotide product. The probes may
also optionally include in their structure: anchoring
oligonucleotide sequences designed for subsequent capture on a
solid support (microarrays, microbeads, nanoparticles), molecule
handles that promote the concentration or manipulation of the
ligated product (magnetic particles, oligonucleotide coding
sequences), and promoter sequences to facilitate subsequent
secondary amplification of the ligated product via an enzyme like a
DNA or RNA polymerase. The ligation reactions of the invention
proceed rapidly, are specific for the target(s) of interest, and
can produce multiple copies of the ligated product for each
target(s), resulting in an amplification (sometimes referred to
herein as "product turnover") of the detectable signal. The
ligation reactions of the invention do not require the presence of
exogeneously added ligases, nor additional enzymes, although some
secondary reactions may rely on the use of enzymes such as
polymerases, as described below. Ligation chemistries can be chosen
from many of the previously described chemical moieties. Preferred
chemistries are ones that can be easily incorporated into routine
manufacture techniques, are stable during storage, and demonstrate
a large preference for target specific ligation when incorporated
into a properly designed ligation probe set. Additionally, for
embodiments which involve subsequent amplification by an enzyme,
ligation chemistries and probe designs (including unnatural
nucleotide analogs) that result in a ligation product that can be
efficiently processed by an enzyme are preferred. Amplification of
the target may also include turnover of the ligation product, in
which the ligation product has a lower or comparable affinity for
the template or target nucleic acid than do the separate ligation
probes. Thus, upon ligation of the hybridized probes, the ligation
product is released from the target, freeing the target to serve as
a template for a new ligation reaction.
[0031] In one embodiment, the ligation reactions of the invention
include transfer reactions. In this embodiment, the probes
hybridize to the target sequence, but rather than oligonucleotide
probes being ligated together to form a ligation product, a nucleic
acid-directed transfer of a molecular entity (including reporter
molecules such as fluorophores, quenchers, etc) from one
oligonucleotide probe to other occurs. This transfer reaction is
analogous to a ligation reaction, however instead of joining of two
or more probes, one of the probes is ligated to the transfer
molecule and the other probe is the "leaving group" of the chemical
reaction. We use the term "transfer" reaction so as to distinguish
between the different nature of the resulting final product.
Importantly, similar to the ligation reaction, the transfer
reaction is facilitated by the proximal binding of the transfer
probes onto a nucleic acid target, such that significant signal is
detected only if the probes have hybridized to the target nucleic
acid in close enough proximity to one another (e.g., at adjacent
sites) for the transfer reaction to take place.
[0032] Samples
[0033] Accordingly, in one aspect the present invention provides
compositions and methods for detecting the presence or absence of
target sequences in samples. As will be appreciated by those in the
art, the sample solution may comprise any number of things,
including, but not limited to, bodily fluids (including, but not
limited to, blood, urine, serum, lymph, saliva, anal and vaginal
secretions, perspiration and semen, of virtually any organism, with
mammalian samples being preferred and human samples being
particularly preferred); environmental samples (including, but not
limited to, air, agricultural, water and soil samples); plant
materials; biological warfare agent samples; research samples (for
example, the sample may be the product of an amplification
reaction, for example general amplification of genomic DNA);
purified samples, such as purified genomic DNA, RNA, proteins,
etc.; raw samples (bacteria, virus, genomic DNA, etc.); as will be
appreciated by those in the art, virtually any experimental
manipulation may have been done on the sample. Some embodiments
utilize siRNA and microRNA as target sequences (Zhang et al., J
Cell Physiol. (2007) 210(2):279-89; Osada et al., Carcinogenesis.
(2007) 28(1):2-12; and Mattes et al., Am J Respir Cell Mol Biol.
(2007) 36(1):8-12, each of which is incorporated herein by
reference in its entirety).
[0034] Some embodiments of the invention utilize nucleic acid
samples from stored (e.g. frozen and/or archived) or fresh tissues.
Paraffin-embedded samples are of particular use in many
embodiments, as these samples can be very useful, due to the
presence of additional data associated with the samples, such as
diagnosis and prognosis. Fixed and paraffin-embedded tissue samples
as described herein refers to storable or archival tissue samples.
Most patient-derived pathological samples are routinely fixed and
paraffin-embedded to allow for histological analysis and subsequent
archival storage. Such samples are often not useful for traditional
methods of nucleic acid detection, because such studies require a
high integrity of the nucleic acid sample so that an accurate
measure of nucleic acid expression can be made. Often, gene
expression studies in paraffin-embedded samples are limited to
qualitative monitoring by using immunohistochemical staining to
monitor protein expression levels.
[0035] Methods and compositions of the present invention are useful
in detection of nucleic acids from paraffin-embedded samples,
because the process of fixing and embedding in paraffin often
results in degradation of the samples' nucleic acids. The present
invention is able to amplify and detect even degraded samples, such
as those found in paraffin-embedded samples.
[0036] A number of techniques exist for the purification of nucleic
acids from fixed paraffin-embedded samples as described in WO
2007/133703 the entire contents of which is herein incorporated by
reference.
[0037] In a preferred embodiment, the target analytes are nucleic
acids. By "nucleic acid" or "oligonucleotide" or grammatical
equivalents herein means at least two nucleotides covalently linked
together. A nucleic acid of the present invention will generally
contain phosphodiester bonds (for example in the case of the target
sequences), although in some cases, as outlined below, nucleic acid
analogs are included that may have alternate backbones
(particularly for use with the ligation probes), comprising, for
example, phosphoramide (Beaucage et al., Tetrahedron (1993)
49(10):1925 and references therein; Letsinger, J. Org. Chem. (1970)
35:3800; Sprinzl et al., Eur. J. Biochem. (1977) 81:579; Letsinger
et al., Nucl. Acids Res. (1986) 14:3487; Sawai et al, Chem. Lett.
(1984) 805; Letsinger et al., J. Am. Chem. Soc. (1988) 110:4470;
and Pauwels et al., Chemica Scripta (1986) 26:141),
phosphorothioate (Mag et al., Nucleic Acids Res. (1991) 19:1437;
and U.S. Pat. No. 5,644,048), phosphorodithioate (Briu et al., J.
Am. Chem. Soc. (1989) 111:2321, O-methylphophoroamidite linkages
(see Eckstein, Oligonucleotides and Analogues: A Practical
Approach, Oxford University Press), and peptide nucleic acid
backbones and linkages (see Egholm, J. Am. Chem. Soc.
(1992)114:1895; Meier et al., Chem. Int. Ed. Engl. (1992) 31:1008;
Nielsen, Nature, (1993) 365:566; Carlsson et al., Nature (1996)
380:207, all of which are incorporated herein by reference in their
entirety). Other analog nucleic acids include those with bicyclic
structures including locked nucleic acids, Koshkin et al., J. Am.
Chem. Soc. (1998) 120:13252 3); positive backbones (Denpcy et al.,
Proc. Natl. Acad. Sci. USA (1995) 92:6097; non-ionic backbones
(U.S. Pat. Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141 and
4,469,863; Kiedrowshi et al., Angew. Chem. Intl. Ed. English (1991)
30:423; Letsinger et al., J. Am. Chem. Soc. (1988) 110:4470;
Letsinger et al., Nucleoside & Nucleotide (1994) 13:1597;
Chapters 2 and 3, ASC Symposium Series 580, Ed. Y. S. Sanghui and
P. Dan Cook; Mesmaeker et al., Bioorganic & Medicinal Chem.
Lett. (1994) 4:395 ; Jeffs et al., J. Biomolecular NMR (1994)
34:17; Xu et al., Tetrahedron Lett. (1996) 37:743) and non-ribose
backbones, including those described in U.S. Pat. Nos. 5,235,033
and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, Ed.
Y. S. Sanghui and P. Dan Cook. Nucleic acids containing one or more
carbocyclic sugars are also included within the definition of
nucleic acids (see Jenkins et al., Chem. Soc. Rev. (1995) pp
169-176). Several nucleic acid analogs are described in Rawls, C
& E News Jun. 2, 1997 page 35. All of these references are
herein expressly incorporated by reference. These modifications of
the ribose-phosphate backbone may be done to facilitate the
addition of labels or other moieties, to increase or decrease the
stability and half-life of such molecules in physiological
environments, etc.
[0038] As will be appreciated by those in the art, all of these
nucleic acid analogs may find use in the present invention. In
addition, mixtures of naturally occurring nucleic acids and analogs
can be made; for example, at the site of a ligation moiety, an
analog structure may be used. Alternatively, mixtures of different
nucleic acid analogs, and mixtures of naturally occurring nucleic
acids and analogs may be made.
[0039] Nucleic acid analogue may include, for example, peptide
nucleic acid (PNA, WO 92/20702, incorporated herein by reference in
its entirety) and Locked Nucleic Acid (LNA, Koshkin A A et al.
Tetrahedron (1998) 54:3607-3630., Koshkin A A et al. J. Am. Chem.
Soc. (1998) 120:13252-13253., Wahlestedt C et al. PNAS (2000)
97:5633-5638, each of which is incorporated herein by reference in
its entirety). In some applications analogue backbones of this type
may exhibit improved hybridization kinetics, improved thermal
stability and improved sensitivity to mismatch sequences.
[0040] The nucleic acids may be single stranded or double stranded,
as specified, or contain portions of both double stranded or single
stranded sequences. The nucleic acid may be DNA, both genomic and
cDNA, RNA or a hybrid, where the nucleic acid contains any
combination of deoxyribo- and ribo-nucleotides, and any combination
of bases, including naturally occurring nucleobases (uracil,
adenine, thymine, cytosine, guanine) and non-naturally occurring
nucleobases (inosine, xathanine hypoxathanine, isocytosine,
isoguanine, 5-methylcytosine, pseudoisocytosine, 2-thiouracil and
2-thiothymine, 2-aminopurine, N9-(2-amino-6-chloropurine),
N9-(2,6-diaminopurine), hypoxanthine, N9-(7-deaza-guanine),
N9-(7-deaza-8-aza-guanine) and N8-(7-deaza-8-aza-adenine).
5-propynyl-uracil, 2-thio-5-propynyl-uracil) etc. As used herein,
the term "nucleobase" includes both "nucleosides" and
"nucleotides", and monomers of nucleic acid analogs. Thus, for
example, the individual units of a peptide nucleic acid, each
containing a base, are referred to herein as a nucleobase.
[0041] In one aspect, ligation probes of the invention are any
polymeric species that is capable of interacting with a nucleic
acid target(s) in a sequence specific manner and possess chemical
moieties allowing the probes to undergo a spontaneous chemical
ligation reaction with another polymeric species possessing
complementary chemical moieties. In one embodiment, the
oligonucleotide probes can be DNA, RNA, PNA, LNA, modified versions
of the aforementioned and/or any hybrids of the same (e.g. DNA/RNA
hybrids, DNA/LNA hybrids, DNA/PNA hybrids). In a preferred
embodiment, the oligonucleotide probes are DNA or RNA
oligonucleotides.
[0042] Nucleic acid samples (e.g. target sequences) that do not
exist in a single-stranded state in the region of the target
sequence(s) are generally rendered single-stranded in such
region(s) prior to detection or hybridization. Generally, nucleic
acid samples can be rendered single-stranded in the region of the
target sequence using heat denaturation. For polynucleotides
obtained via amplification, methods suitable for generating
single-stranded amplification products are preferred. Non-limiting
examples of amplification processes suitable for generating
single-stranded amplification product polynucleotides include, but
are not limited to, T7 RNA polymerase run-off transcription, RCA,
Asymmetric PCR (Bachmann et al., Nucleic Acid Res. (1990) 18:1309),
and Asynchronous PCR (WO 01/94638). Commonly known methods for
rendering regions of double-stranded polynucleotides single
stranded, such as the use of PNA openers (U.S. Pat. No. 6,265,166),
may also be used to generate single-stranded target sequences on a
polynucleotide.
[0043] In one aspect, the invention provides methods of detecting
target sequences. By "target sequence" or "target nucleic acid" or
grammatical equivalents herein means a nucleic acid sequence on a
single strand of nucleic acid. The target sequence may be a portion
of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including
mRNA, MicroRNA and rRNA, or others. As is outlined herein, the
target sequence may be a target sequence from a sample, or a
secondary target such as a product of an amplification reaction,
etc. It may be any length, with the understanding that longer
sequences are more specific. As will be appreciated by those in the
art, the complementary target sequence may take many forms. For
example, it may be contained within a larger nucleic acid sequence,
i.e. all or part of a gene or mRNA, a restriction fragment of a
plasmid or genomic DNA, among others.
[0044] In some embodiments, the target sequence is comprised of
different types of target domain. For example, a first target
domain of the sample target sequence may hybridize to a first
ligation probe, and a second target domain in the target sequence
may hybridize to a second ligation probe. Other target domains may
hybridize to a capture probe on a substrate such as an array, or a
label probe, etc..
[0045] The target domains may be adjacent or separated as
indicated, as is more fully described below. In some cases, when
detection is based on ligation and the application requires
amplification of signal, the ligation probes may utilize linkers
and be separated by one or more nucleobases of the target sequence
to confer hybridization instability on the ligated product. In
other applications, for example in single nucleotide polymorphism
(SNP) detection, or in transfer reactions, the ligation probes may
hybridize to adjacent nucleobases of the target sequence. Unless
specified, the terms "first" and "second" are not meant to confer
an orientation of the sequences with respect to the 5'-3'
orientation of the target sequence. For example, assuming a 5'-3'
orientation of the complementary target sequence, the first target
domain may be located either 5' to the second domain, or 3' to the
second domain. For ease of reference and not to be limiting, these
domains are sometimes referred to as "upstream" and "downstream",
with the normal convention being the target sequence being
displayed in a 5' to 3' orientation
[0046] The probes are designed such that when the probes bind to a
part of the target polynucleotide in close spatial proximity, a
chemical ligation reaction occurs between the probes. In general,
the probes comprise chemically reactive moieties (herein generally
referred to as "ligation moieties") and bind to the target
polynucleotide in a particular orientation, such that the
chemically reactive moieties come into close spatial proximity,
thus resulting in a spontaneous ligation reaction.
[0047] Probe Components
[0048] In one embodiment, the invention provides sets of ligation
probes, usually a first and a second ligation probe, although as is
described herein some embodiments utilize more than two. In
addition, as noted herein, in some cases a transfer reaction is
done rather than ligation; "ligation probes" includes "transfer
probes". Each ligation probe comprises a nucleic acid portion,
sometimes referred to herein as a "probe domain" that is
substantially complementary to one of the target domains. Probes of
the present invention are designed to be complementary to a target
sequence such that hybridization of the target sequence and the
probes of the present invention occurs. As outlined herein, this
complementarity need not be perfect; there may be any number of
base pair mismatches which will interfere with hybridization
between the target sequence and the probes of the present
invention. However, if the number of mutations is so great that no
hybridization can occur under even the least stringent of
hybridization conditions, the sequence is not a complementary
sequence. Thus, by "substantially complementary" herein is meant
that the probes are sufficiently complementary to the target
sequences to hybridize under normal reaction conditions.
"Identical" sequences are those that over the length of the shorter
sequence of nucleobases, perfect complementarity exists.
[0049] In one aspect of the invention, the length of the probe is
designed to vary with the length of the target sequence, the
specificity required, the reaction (e.g. ligation or transfer) and
the hybridization and wash conditions. Generally, in this aspect
ligation probes range from about 5 to about 150 nucleobases, with
from about 15 to about 100 being preferred and from about 25 to
about 75 being especially preferred. In general, these lengths
apply equally to ligation and transfer probes.
[0050] In another embodiment of the invention, referred to herein
as "CLPA-CE" which is described more fully below, probe length is
designed to vary for each target of interest thereby generating
ligation products that can be identified and analyzed based on
length variance.
[0051] A variety of hybridization conditions may be used in the
present invention, including high, moderate and low stringency
conditions; see for example Maniatis et al., Molecular Cloning: A
Laboratory Manual, 2d Edition, 1989, and Ausubel, et al, Short
Protocols in Molecular Biology, herein incorporated by reference.
The hybridization conditions may also vary when a non-ionic
backbone, e.g. PNA is used, as is known in the art.
Ligation Moieties
[0052] In addition to ligation domains, the ligation probes of the
invention have ligation moieties. Accordingly, in one aspect, the
invention relates to methods of chemical ligation that include the
binding of at least a first and a second ligation probe to the
target nucleic acid to form a "ligation substrate" under conditions
such that the ligation moieties of the first and second ligation
probes are able to spontaneously react, ligating the probes
together, in the absence of exogenous ligase; that is, no exogenous
ligase is added to the reaction. In the case of the transfer
reaction, this may be referred to as either a "ligation substrate"
or a "transfer substrate". By "ligation substrate" herein is meant
a substrate for chemical ligation comprising at least one target
nucleic acid sequence and two or more ligation probes. Similarly,
included within the definition of "ligation substrate" is a
"transfer substrate", comprising at least one target nucleic acid
sequence and two or more transfer probes.
[0053] In some embodiments of the invention, for example when
additional specificity is desired, more than two ligation probes
can be used. In this embodiment, the "middle" ligation probe(s) can
also be adjacent or separated by one or more nucleobases of the
target sequence. In a preferred embodiment, the ligation reaction
does not require the presence of a ligase enzyme and occurs
spontaneously between the bound probes in the absence of any
addition (e.g. exogeneous) ligase.
[0054] Oligonucleotide probes of the invention are designed to be
specific for the polynucleotide target. These probes bind to the
target in close spatial proximity to each other and are oriented in
such a manner that the chemically reactive moieties are in close
spatial proximity. In one aspect, two or more probes are designed
to bind near adjacent sites on a target polynucleotide. In a
preferred embodiment, two probes bind to the target such that the
ligation moiety at the 5' end of one oligonucleotide probe is able
to interact with the ligation moiety at the 3' end of the other
probe.
[0055] Chemical ligation can, under appropriate conditions, occur
spontaneously without the addition of any additional activating
reagents or stimuli. Alternatively, "activating" agents or external
stimuli can be used to promote the chemical ligation reaction.
Examples of activating agents include, without limitation,
carbodiimide, cyanogen bromide (BrCN), imidazole,
1-methylimidazole/carbodiimide/cystamine, N-cyanoimidazole,
dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP) and
other reducing agents as well as external stimuli like ultraviolet
light, heat and/or pressure changes.
[0056] As is outlined herein, the ligation moieties of the
invention may take a variety of configurations, depending on a
number of factors. Most of the chemistries depicted herein are used
in phosphoramidite reactions that generally progress in a 3' to 5'
direction. That is, the resin contains chemistry allowing
attachment of phosphoramidites at the 5' end of the molecule.
However, as is known in the art, phosphoramidites can be used to
progress in the 5' to 3' direction; thus, the invention includes
moieties with opposite orientation to those outlined herein.
[0057] Each set of ligation probes (or transfer probes) contains a
set of a first ligation moiety and a second ligation moiety. The
identification of these ligation moiety pairs depends on the
chemistry of the ligation to be used. In addition, as described
herein, linkers (including but not limited to destabilization
linkers) may be present between the probe domain and the ligation
moiety of one or both ligation probes. In general, for ease of
discussion, the description herein may use the terms "upstream" and
"downstream" ligation probes, although this is not meant to be
limiting.
[0058] Halo Leaving Group Chemistry
[0059] In one embodiment of the invention, the chemistry is based
on 5' halogen leaving group technology such as is generally
described in Gryanov, S. M., and Letsinger, R. L., (1993) Nucleic
Acids Research, 21:1403; Xu, Y. and Kool, E. T. (1997) Tetrahedron
Letters, 38:5595; Xu, Y. and Kool, E. T., (1999) Nucleic Acids
Research, 27:875; Arar et al., (1995), BioConj. Chem., 6:573; Kool,
E. T. et. al, (2001) Nature Biotechnol 19:148; Kool, E. T. et. al.,
(1995) Nucleic Acids Res, 23 (17):3547; Letsinger et al., U.S. Pat.
No. 5,476,930; Shouten et al., U.S. Pat. No. 6,955,901; Andersen et
al., U.S. Pat. No. 7,153,658, all of which are expressly
incorporated by reference herein. In this embodiment, the first
ligation probe includes at its 5' end a nucleoside having a 5'
leaving group, and the second ligation probe includes at its 3' end
a nucleoside having 3' nucleophilic group such as a 3'
thiophosphoryl. The 5' leaving group can include many common
leaving groups know to those skilled in the art including, for
example the halo-species (I, Br, Cl) and groups such as those
described by Abe and Kool, J. Am. Chem. Soc. (2004)
126:13980-13986, which is incorporated herein by reference in its
entirety. In a more preferred embodiment of this aspect of the
invention, the first ligation probe has a 5' leaving group attached
through a flexible linker and a downstream oligonucleotide which
has a 3' thiophosphoryl group. This configuration leads to a
significant increase in the rate of reaction and results in
multiple copies of ligated product being produced for every
target.
[0060] The "upstream" oligonucleotide, defined in relation to the
5' to 3' direction of the polynucleotide template as the
oligonucleotide that binds on the "upstream" side (i.e., the left,
or 5' side) of the template includes, as its 5' end, a 5'-leaving
group. Any leaving group capable of participating in an S.sub.N2
reaction involving sulfur, selenium, or tellurium as the
nucleophile can be utilized. The leaving group is an atom or group
attached to carbon such that on nucleophilic attack of the carbon
atom by the nucleophile (sulfur, selenium or tellurium) of the
modified phosphoryl group, the leaving group leaves as an anion.
Suitable leaving groups include, but are not limited to a halide,
such as iodide, bromide or chloride, a tosylate, benzenesulfonate
or p-nitrophenylester, as well as RSO.sub.3 where R is phenyl or
phenyl substituted with one to five atoms or groups comprising F,
Cl, Br, I, alkyl (C1 to C6), nitro, cyano, sulfonyl and carbonyl,
or R is alkyl with one to six carbons. The leaving group is
preferably an iodide, and the nucleoside at the 5' end of the
upstream oligonucleotide is, in the case of DNA, a
5'-deoxy-5'-iodo-2'-deoxynucleoside. Examples of suitable
5'-deoxy-5'-iodo-2'-deoxynucleosides include, but are not limited
to, 5'-deoxy-5'-iodothymidine (5'-I-T),
5'-deoxy-5'-iodo-2'-deoxycytidine (5'-I-dC),
5'-deoxy-5'-iodo-2'-deoxyadenosine (5'-I-dA),
5'-deoxy-5'-iodo-3-deaza-2'-deoxyadenosine (5'-I-3-deaza-dA),
5'-deoxy-5'-iodo-2'-deoxyguanosine (5'-I-dG) and
5'-deoxy-5'-iodo-3-deaza-2'-deoxyguanosine (5'-I-3-deaza-dG), and
the phosphoroamidite derivatives thereof (see FIG. 2). In the case
of RNA oligonucleotides, analogous examples of suitable
5'-deoxy-5'-iodonucleosides include, but are not limited to,
5'-deoxy-5'-iodouracil (5'-I-U), 5'-deoxy-5'-iodocytidine (5'-I-C),
5'-deoxy-5'-iodoadenosine (5'-I-A),
5'-deoxy-5'-iodo-3-deazaadenosine (5'-I-3-deaza-A),
5'-deoxy-5'-iodoguanosine (5'-I-G) and
5'-deoxy-5'-iodo-3-deazaguanosine (5'-I-3-deaza-G), and the
phosphoroamidite derivatives thereofIn a preferred embodiment, an
upstream ligation probe contains 2'-deoxyribonucleotides except
that the modified nucleotide on the 5' end, which comprises the 5'
leaving group, is a ribonucleotide. This embodiment of the upstream
nucleotide is advantageous because the bond between the penultimate
2'-deoxyribonucleotide and the terminal 5' ribonucleotide is
susceptible to cleavage using base. This allows for potential reuse
of an oligonucleotide probe that is, for example, bound to a solid
support, as described in more detail below. In reference to the
CLPA assay, which is described more fully below, the 5' leaving
group of the "upstream" probe is most preferably DAB SYL.
[0061] The "downstream" oligonucleotide, which binds to the
polynucleotide template "downstream" of, i.e., 3' to, the upstream
oligonucleotide, includes, as its 3' end, a nucleoside having
linked to its 3' hydroxyl a phosphorothioate group (i.e., a
"3'-phosphorothioate group"), a phosphoroselenoate group (i.e., a
"3'-phosphoroselenoate group), or a phosphorotelluroate group
(i.e., a "3'-phosphorotelluroate group"). The chemistries used for
autoligation are thus sulfur-mediated, selenium-mediated, or
tellurium mediated. Self-ligation yields a ligation product
containing a 5' bridging phosphorothioester
(--O--P(O)(O.sup.-)-S-), phosphoroselenoester
(--O--P(O)(O.sup.-)-Se-) or phosphorotelluroester
(--O--P(O)(O.sup.-)-Te-), as dictated by the group comprising the
3' end of the downstream oligonucleotide. This non-natural, achiral
bridging diester is positioned between two adjacent nucleotides and
takes the place of a naturally occurring 5' bridging
phosphodiester. Surprisingly, the selenium-mediated ligation is 3
to 4 times faster than the sulfur-mediated ligation, and the
selenium-containing ligation product was very stable, despite the
lower bond strength of the Se--P bond. Further, the bridging
phosphoroselenoester, as well as the bridging
phosphorotelluroester, are expected to be cleavable selectively by
silver or mercuric ions under very mild conditions (see Mag et al.,
Nucleic Acids Res. (1991) 19:1437 1441).
[0062] In one embodiment, a downstream oligonucleotide contains
2'-deoxyribonucleotides except that the modified nucleotide on the
3' end, which comprises the 3' phosphorothioate,
phosphoroselenoate, or phosphorotelluroate, is a ribonucleotide.
This embodiment of the upstream nucleotide is advantageous because
the bond between the penultimate 2'-deoxyribonucleotide and the
terminal ribonucleotide is susceptible to cleavage using base,
allowing for potential reuse of an oligonucleotide probe that is,
for example, bound to a solid support. In reference to the CLPA
assay, as described more fully below, the "downstream" probe most
preferably includes at its 3' end 3'-phosphorothioate.
[0063] It should be noted that the "upstream" and "downstream"
oligonucleotides can, optionally, constitute the two ends of a
single oligonucleotide, in which event ligation yields a circular
ligation product. The binding regions on the 5' and 3' ends of the
linear precursor oligonucleotide must be linked by a number of
intervening nucleotides sufficient to allow binding of the 5' and
3' binding regions to the polynucleotide target.
[0064] Compositions provided by the invention include a
5'-deoxy-5-'iodo-2'-deoxynucleoside, for example a
5'-deoxy-5'-iodothymidine (5'-I-T),
5'-deoxy-5'-iodo-2'-deoxycytidine (5'-I-dC),
5'-deoxy-5'-iodo-2'-deoxyadenosine (5'-I-dA),
5'-deoxy-5'-iodo-3-deaza-2'-deoxyadenosine (5'-I-3-deaza-dA),
5'-deoxy-5'-iodo-2'-deoxyguanosine (5'-I-dG) and
5'-deoxy-5'-iodo-3-deaza-2'-deoxyguanosine (5'-I-3-deaza-dG), and
the phosphoroamidite derivatives thereof, as well as an
oligonucleotide comprising, as its 5' end, a
5'-deoxy-5'-iodo-2'-deoxynucleoside of the invention. Compositions
provided by the invention further include a
5'-deoxy-5'-iodonucleoside such as 5'-deoxy-5'-iodouracil (5'-I-U),
5'-deoxy-5'-iodocytidine (5'-I-C), 5'-deoxy-5'-iodoadenosine
(5'-1-A), 5'-deoxy-5'-iodo-3-deazaadenosine (5'-I-3-deaza-A),
5'-deoxy-5'-iodoguanosine (5'-I-G) and
5'-deoxy-5'-iodo-3-deazaguanosine (5'-I-3-deaza-G), and the
phosphoroamidite derivatives thereof, as well as an oligonucleotide
comprising, as its 5' end, a 5'-deoxy-5'-iodonucleoside of the
invention. Also included in the invention is a nucleoside
comprising a 3'-phosphoroselenoate group or a
3'-phosphorotelluroate group, and an oligonucleotide comprising as
its 3' end a nucleoside comprising a 3'-phosphoroselenoate group or
a 3'-phosphorotelluroate group. Oligonucleotides containing either
or both of these classes of modified nucleosides are also included
in the invention, as are methods of making the various nucleosides
and oligonucleotides. Oligonucleotides that are modified at either
or both of the 5' or 3' ends in accordance with the invention
optionally, but need not, include a detectable label, preferably a
radiolabel, a fluorescence energy donor or acceptor group, an
excimer label, or any combination thereof.
[0065] In addition, in some cases, substituent groups may also be
protecting groups (sometimes referred to herein as "PG"). Suitable
protecting groups will depend on the atom to be protected and the
conditions to which the moiety will be exposed. A wide variety of
protecting groups are known; for example, DMT is frequently used as
a protecting group in phosphoramidite chemistry (as depicted in the
figures; however, DMT may be replaced by other protecting groups in
these embodiments. A wide variety of protecting groups are
suitable; see for example, Greene's Protective Groups in Organic
Synthesis, herein incorporated by reference for protecting groups
and associated chemistry.
[0066] By "alkyl group" or grammatical equivalents herein is meant
a straight or branched chain alkyl group, with straight chain alkyl
groups being preferred. If branched, it may be branched at one or
more positions, and unless specified, at any position. The alkyl
group may range from about 1 to about 30 carbon atoms (C1-C30),
with a preferred embodiment utilizing from about 1 to about 20
carbon atoms (C1-C20), with about C1 through about C12 to about C15
being preferred, and C1 to C5 being particularly preferred,
although in some embodiments the alkyl group may be much larger.
Also included within the definition of an alkyl group are
cycloalkyl groups such as C5 and C6 rings, and heterocyclic rings
with nitrogen, oxygen, sulfur or phosphorus. Alkyl also includes
heteroalkyl, with heteroatoms of sulfur, oxygen, nitrogen, and
silicone being preferred. Alkyl includes substituted alkyl groups.
By "substituted alkyl group" herein is meant an alkyl group further
comprising one or more substitution moieties "R", as defined
above.
[0067] By "amino groups" or grammatical equivalents herein is meant
NH.sub.2, --NHR and --NR.sub.2 groups, with R being as defined
herein. In some embodiments, for example in the case of the peptide
ligation reactions, primary and secondary amines find particular
use, with primary amines generally showing faster reaction
rates.
[0068] By "nitro group" herein is meant an --NO.sub.2 group.
[0069] By "sulfur containing moieties" herein is meant compounds
containing sulfur atoms, including but not limited to, thia-, thio-
and sulfo-compounds, thiols (--SH and --SR), and sulfides
(--RSR--). A particular type of sulfur containing moiety is a
thioester (--(CO)--S--), usually found as a substituted thioester
(--(CO)--SR). By "phosphorus containing moieties" herein is meant
compounds containing phosphorus, including, but not limited to,
phosphines and phosphates. By "silicon containing moieties" herein
is meant compounds containing silicon.
[0070] By "ether" herein is meant an --O--R group. Preferred ethers
include alkoxy groups, with --O--(CH.sub.2).sub.2 CH.sub.3 and
--O--(CH.sub.2).sub.4 CH.sub.3 being preferred.
[0071] By "ester" herein is meant a --COOR group.
[0072] By "halogen" herein is meant bromine, iodine, chlorine, or
fluorine. Preferred substituted alkyls are partially or fully
halogenated alkyls such as CF.sub.3, etc.
[0073] By "aldehyde" herein is meant --RCOH groups.
[0074] By "alcohol" herein is meant --OH groups, and alkyl alcohols
--ROH.
[0075] By "amido" herein is meant --RCONH-- or RCONR-- groups.
[0076] By "ethylene glycol" herein is meant a
--(O--CH.sub.2--CH.sub.2).sub.n-- group, although each carbon atom
of the ethylene group may also be singly or doubly substituted,
i.e. --(--CR.sub.2--CR.sub.2).sub.n--, with R as described above.
Ethylene glycol derivatives with other heteroatoms in place of
oxygen (i.e. --(N--CH.sub.2--CH.sub.2).sub.n-- or
--(S--CH.sub.2--CH.sub.2).sub.n--, or with substitution groups) are
also preferred.
[0077] Additionally, in some embodiments, the R group may be a
functional group, including quenchers, destabilization moieties and
fluorophores (as defined below). Fluorophores of particular use in
this embodiment include, but are not limited to Fluorescein and its
derivatizes, TAMRA (Tetramethyl-6-carboxyrhodamine), Alexa dyes,
and Cyanine dyes (e.g. Cy3 and Cy5).
[0078] Quencher moieties or molecules are known in the art, and are
generally aromatic, multiring compounds that can deactivate the
excited state of another molecule. Fluorophore-quencher pairs are
well known in the art. Suitable quencher moieties include, but are
not limited to Dabcyl (Dimethylamini(azobenzene) sulfonyl) Dabcyl
(Dimethylamino(azobenzene)carbonyl), Eclipse Quenchers (Glen
Research Catalog) and blackhole Quenchers (BHQ-1, BHQ-2 and BHQ-3)
from Biosearch Technologies.
[0079] Suitable destabilization moieties are discussed below and
include, but are not limited to molecule entities that result in a
decrease in the overall binding energy of an oligonucleotide to its
target site. Potential examples include, but are not limited to
alkyl chains, charged complexes, and ring structures.
[0080] Nucleophile Ligation Moieties
[0081] In this embodiment, the other ligation probe comprises a
ligation moiety comprising a nucleophile such as an amine. Ligation
moieties comprising both a thiol and an amine find particular use
in certain reactions. In general, the nucleophile ligation moieites
can include a wide variety of potential amino, thiol compounds as
long as the nucleophile ligation moiety contains a thiol group that
is proximal to a primary or secondary amino and the relative
positioning is such that at least a 5 or 6 member ring transition
state can be achieve during the S to N acyl shift.
[0082] Accordingly, nucleophile ligation molecules that comprise 1,
2 or 1, 3 amine thiol groups find particular use. Primary amines
find use in some embodiments when reaction time is important, as
the reaction time is generally faster for primary than secondary
amines, although secondary amines find use in acyl transferase
reactions that contribute to destabilization as discussed below.
The carbons between the amino and thiol groups can be substituted
with non-hydrogen R groups, although generally only one
non-hydrogen R group per carbon is utilized. Additionally, adjacent
R groups (depicted as R' and R'' in Figure *CC) may be joined
together to form cyclic structures, including substituted and
unsubstituted cycloalkyl and aryl groups, including
heterocycloalkyl and heteroaryl and the substituted and
unsubstituted derivatives thereof. In the case where a 1,2 amino
thiol group is used and adjacent R groups are attached, it is
generally preferred that the adjacent R groups form cycloalkyl
groups (including heterocycloalkyl and substituted derivatives
thereof) rather than aryl groups.
[0083] In this embodiment, for the generation of the 4 sigma bond
contraction of the chain for destabilization, the replacement
ligation moiety relies on an acyl transferase reaction.
[0084] Linkers
[0085] In many embodiments, linkers (sometimes shown herein as "L"
or "-(linker).sub.n--), (where n is zero or one) may optionally be
included at a variety of positions within the ligation probe(s).
Suitable linkers include alkyl and aryl groups, including
heteroalkyl and heteroaryl, and substituted derivatives of these.
In some instances, for example when Native Peptide Ligation
reactions are done, the linkers may be amino acid based and/or
contain amide linkages. As described herein, some linkers allow the
ligation probes to be separated by one or more nucleobases, forming
abasic sites within the ligation product, which serve as
destabilization moieties, as described below.
[0086] Destabilization Moieties
[0087] In accordance with one aspect of the invention, it is
desirable to produce multiple copies of ligated product for each
target molecule without the aid of an enzyme. One way to achieve
this goal involves the ligated product disassociating from the
target following the chemical ligation reaction to allow a new
probe set to bind to the target. To increase ligation product
turnover, probe designs, instrumentation, and chemical ligation
reaction chemistries that increase product disassociation from the
target molecule are desirable.
[0088] Previous work has shown one way to achieve product
disassociation and increase product turnover is to "heat cycle" the
reaction mixture. Heat cycling is the process of varying the
temperature of a reaction so as to facilitate a desired outcome.
Most often heat cycling takes the form of briefly raising the
temperature of the reaction mixture so that the reaction
temperature is above the melting temperature of the ligated product
for a brief period of time causing the product to disassociate from
the target. Upon cooling, a new set of probes is able to bind the
target, and undergo another ligation reaction. This heat cycling
procedure has been practiced extensively for enzymatic reactions
like PCR.
[0089] While heat cycling is one way to achieve product turnover,
it is possible to design probes such that there is significant
product turnover without heat cycling. Probe designs and ligation
chemistries that help to lower the melting temperature of the
ligated product increase product turnover by decreasing product
inhibition of the reaction cycle.
[0090] Accordingly, in one aspect, the probes are designed to
include elements (e.g. destabilization moieties), which, upon
ligation of the probes, serve to destabilize the hybridization of
the ligation product to the target sequence. As a result, the
ligated substrate disassociates after ligation, resulting in a
turnover of the ligation product, e.g. the ligation product
comprising the two ligation probes dehybridizes from the target
sequence, freeing the target sequence for hybridization to another
probe set.
[0091] In addition, increasing the concentration of the free (e.g.
unhybridized) ligation probes can also help drive the equilibrium
towards release of the ligation product (or transfer product) from
the target sequence. Accordingly, some embodiments of the invention
use concentrations of probes that are 1,000,000 fold higher than
that of the target while in other embodiments the probes are 10,000
to 100 fold higher than that of the target. As will be appreciated
by those skilled in the art, increasing the concentration of free
probes can be used by itself or with any embodiment outlined herein
to achieve product turnover (e.g. amplification). While increasing
the probe concentration can result in increased product turnover,
it can also lead to significant off target reactions such as probe
hydrolysis and non-target mediated ligation.
[0092] In one aspect, probe elements include structures which lower
the melting temperature of the ligated product. In some
embodiments, probe elements are designed to hybridize to
non-adjacent target nucleobases, e.g. there is a "gap" between the
two hybridized but unligated probes. In general, this is done by
using one or two linkers between the probe domain and the ligation
moiety. That is, there may be a linker between the first probe
domain and the first ligation moiety, one between the second probe
domain and the second ligation moiety, or both. In some
embodiments, the gap comprises a single nucleobase, although more
can also be utilized as desired. As will be appreciated by those
skilled in the art, there may be a tradeoff between reaction
kinetics and length of the linkers; if the length of the linker(s)
are so long that contact resulting in ligation is kinetically
disfavored, shorter linkers may be desired. However, in some cases,
when kinetics are not important, the length of the gap and the
resulting linkers may be longer, to allow spanning gaps of 1 to 10
nucleobases. Generally, in this embodiment, what is important is
that the length of the linker(s) roughly corresponds to the number
of nucleobases in the gap.
[0093] In another aspect of this embodiment of the invention, the
formation of abasic sites in a ligation product as compared to the
target sequence serves to destabilize the duplex. For example, Abe
and Kool (J. Am. Chem. Soc. (2004) 126:13980-13986) compared the
turnover when two different 8-mer oligonucleotide probes (Bu42 and
DT40) were ligated with the same 7-mer probe (Thio 4). When Thio4
is ligated with DT40, a continuous 15-mer oligonucleotide probe
with a nearly native DNA structure is formed that should be
perfectly matched with the DNA target. However, when Thio4 is
ligated with Bu42, a 15-mer oligonucleotide probe is formed, but
when the probe is bound to the target, it has an abasic site in the
middle that is spanned by an alkane linker. Comparison of the
melting temperature (Tm) of these two probes when bound to the
target shows approximately a 12.degree. C. difference in melting
temperature (58.5 for Bu42 versus 70.7.degree. C. for DT40). This
12.degree. C. difference in melting temperature led to roughly a
10-fold increase in product turnover (91.6- Bu42 versus 8.2 DT40)
at 25.degree. C. when the probe sets (10,000-fold excess, 10 .mu.M
conc) were present in large excess compared to the target (1 nM).
Similarly, Dose et al (Dose 2006) showed how a 4.degree. C.
decrease in Tm for two identical sequences, chemically ligated PNA
probes (53.degree. C. versus 57.degree. C.) results in
approximately a 4-fold increase in product turnover.
[0094] Recent work has demonstrated the use of chemical ligation
based Quenched Auto-Ligation (QUAL) probes to monitor RNA
expression and detect single base mismatches inside bacterial and
human cells (WO 2004/0101011 herein incorporated by reference).
[0095] In one embodiment, destabilization moieties are based on the
removal of stabilization moieties. That is, if a ligation probe
contains a moiety that stabilizes its hybridization to the target,
upon ligation and release of the stabilization moiety, there is a
drop in the stability of the ligation product. Accordingly, one
general scheme for reducing product inhibition is to develop probes
that release a molecular entity like a minor groove binding
molecule during the course of the initial chemical ligation
reaction or following a secondary reaction post ligation. Depending
on the oligonucleotide sequence, minor groove binders like the
dihydropyrroloindole tripeptide (DPI.sub.3) described by Kutyavin
(Kutyavin 1997 and Kutyavin 2000) can increase the Tm of a duplex
nucleic acid by up to 40.degree. C. when conjugated to the end of
an oligonucleotide probe. In contrast, the unattached version of
the DPI.sub.3 only increases the Tm of the same duplex by 2.degree.
C. or so. Thus, minor groove binders can be used to produce probe
sets with enhanced binding strengths, however if the minor groove
binder is released during the course of the reaction, the binding
enhancement is loss and the ligated product will display a
decreased Tm relative to probes in which the minor groove binder is
still attached.
[0096] Suitable minor groove binding molecules include, but are not
limited to, dihydropyrroloindole tripeptide (DPI.sub.3), distamycin
A, and pyrrole-imidazole polyamides (Gottesfeld, J. M., et al., J.
Mol. Biol. (2001) 309:615-629.
[0097] In addition to minor groove binding molecules tethered
intercalators and related molecules can also significantly increase
the melting temperature of oligonucleotide duplexes, and this
stabilization is significantly less in the untethered state.
(Dogan, et al., J. Am. Chem Soc. (2004) 126:4762-4763 and
Narayanan, et al., Nucleic Acids Research, (2004)
32:2901-2911).
[0098] Similarly, as will be appreciated by those in the art,
probes with attached oligonucleotide fragments (DNA, PNA, LNA, etc)
capable of triple helix formation, can serve as stabilization
moieties that upon release, results in a decrease of stabilization
of the ligation product to the target sequence (Pooga, M, et al.,
Biomolecular Engineering (2001) 17:183-192.
[0099] Another general scheme for decreasing product inhibition by
lowering the binding strength of the ligated product is to
incorporate abasic sites at the point of ligation. This approach
has been previously demonstrated by Abe (J. Am. Chem. Soc. (2004)
126:13980-13986), however it is also possible to design secondary
probe rearrangements to further amplify the decrease in Tm via
straining the alignment between the ligated probes and the target.
For example, Dose et al. (Org. Letters (2005) 7:20 4365-4368)
showed how a rearrangement post-ligation that changed the spacing
between PNA bases from the ideal 12 sigma bonds to 13 resulted in a
lowering of the Tm by 4.degree. C. Larger rearrangements and
secondary reactions that interfere with the binding of the product
to the target or result in the loss of oligonucleotide bases can
further decrease the Tm.
[0100] The present invention provides methods and compositions for
a ligation reaction that results in a chain contraction of up to 4
sigma bonds during the rearrangement, which should have a
significant effect on the Tm post-rearrangement compared to the 1
base expansion using the chemistry described by Dose. This
chemistry is based on the acyl transfer auxiliary that has been
described previously (Offer et al., J Am Chem Soc. (2002)
124(17):4642-6). Following completion of the chain contraction, a
free-thiol is generated that is capable of undergoing another
reaction either with a separate molecule or with itself. For
example, this thiol could react with an internal thioester to
severely kink the oligonucleotide and thus further decrease the
ligation product's ability to bind to the target.
[0101] Thus, in this embodiment, ligation reactions that release
functional groups that will undergo a second reaction with the
ligation product can reduce stabilization of the hybrid of the
ligation product and the target sequence.
[0102] Additional Functionalities of Ligation Probes
[0103] In addition to the target domains, ligation moieties, and
optional linkers, one or more of the ligation probes of the
invention can have additional functionalities, including, but not
limited to, promoter and primer sequences (or complements thereof,
depending on the assay), labels including label probe binding
sequences and anchor sequences. Additional functionalities
including variable spacer sequences (also referred to as stuffer
sequences) are described hereinbelow with reference to the CLPA
assay.
[0104] In one aspect of the invention, the upstream oligonucleotide
probe can have a promoter site or primer binding site for a
subsequent enzymatic amplification reaction. In one embodiment, the
upstream probe contains the promoter sequence for a RNA polymerase,
e.g. T7, SP6 or T3. In another embodiment, both the upstream and
down stream oligonucleotides contain primer binding sequences.
Promoter and primer binding sequences are designed so as to not
interact with the nucleic acid targets to any appreciable extent.
In a preferred embodiment, when detecting multiple targets
simultaneously, all of the oligonucleotide probe sets in the
reaction are designed to contain identical promoter or primer pair
binding sites such that following ligation and purification, if
appropriate, all of the ligated products can be amplified
simultaneously using the same enzyme and/or same primers.
[0105] In one embodiment, one or more of the ligation probes
comprise a promoter sequence. In embodiments that employ a promoter
sequence, the promoter sequence or its complement will be of
sufficient length to permit an appropriate polymerase to interact
with it. Detailed descriptions of sequences that are sufficiently
long for polymerase interaction can be found in, among other
places, Sambrook and Russell. In certain embodiments, amplification
methods comprise at least one cycle of amplification, for example,
but not limited to, the sequential procedures of: interaction of a
polymerase with a promoter; synthesizing a strand of nucleotides in
a template-dependent manner using a polymerase; and denaturing the
newly-formed nucleic acid duplex to separate the strands.
[0106] In another embodiment, one or both of the ligation probes
comprise a primer sequence. As outlined below, the ligation
products of the present invention may be used in additional
reactions such as enzymatic amplification reactions. In one
embodiment, the ligation probes include primer sequences designed
to allow an additional level of amplification. As used herein, the
term "primer" refers to nucleotide sequence, whether occurring
naturally as in a purified restriction digest or produced
synthetically, which is capable of acting as a point of initiation
of nucleic acid sequence synthesis when placed under conditions in
which synthesis of a primer extension product which is
complementary to a nucleic acid strand is induced, i.e. in the
presence of different nucleotide triphosphates and a polymerase in
an appropriate buffer ("buffer" includes pH, ionic strength,
cofactors etc.) and at a suitable temperature. One or more of the
nucleotides of the primer can be modified, for instance by addition
of a methyl group, a biotin or digoxigenin moiety, a fluorescent
tag or by using radioactive nucleotides. A primer sequence need not
reflect the exact sequence of the template. For example, a
non-complementary nucleotide fragment may be attached to the 5' end
of the primer, with the remainder of the primer sequence being
substantially complementary to the target strand.
[0107] By using several priming sequences and primers, a first
ligation product can serve as the template for additional ligation
products. These primer sequences may serve as priming sites for PCR
reactions, which can be used to amplify the ligation products. In
addition to PCR reactions, other methods of amplification can
utilize the priming sequences, including but not limited to ligase
chain reactions, InvaderTM, positional amplification by nick
translation (NICK), primer extension/nick translation, and other
methods known in the art. As used herein, "amplification" refers to
an increase in the number of copies of a particular nucleic acid.
Copies of a particular nucleic acid made in vitro in an
amplification reaction are called "amplicons" or "amplification
products".
[0108] Amplification may also occur through a second ligation
reaction, in which the primer sites serve as hybridization sites
for a new set of ligation probes which may or may not comprise
sequences that are identical to the first set of ligation probes
that produced the original ligation products. The target sequence
is thus exponentially amplified through amplification of ligation
products in subsequent cycles of amplification.
[0109] In another embodiment of this aspect of the invention, the
primer sequences are used for nested ligation reactions. In such
nested ligation reactions, a first ligation reaction is
accomplished using methods described herein such that the ligation
product can be captured, for example by using biotinylated primers
to the desired strand and capture on beads (particularly magnetic
beads) coated with streptavidin. After the ligation products are
captured, a second ligation reaction is accomplished by
hybridization of ligation probes to primer sequences within a
section of the ligation product which is spatially removed from
(i.e., downstream from) the end of the ligation product which is
attached to the capture bead, probe, etc. At least one of the
primer sequences for the secondary ligation reaction will be
located within the region of the ligation product complementary to
the ligation probe which is not the ligation probe that included
the anchor or capture sequence. The ligation products from this
second ligation reaction will thus necessarily only result from
those sequences successfully formed from the first chemical
ligation, thus removing any "false positives" from the
amplification reaction. In another embodiment, the primer sequences
used in the secondary reaction may be primer sites for other types
of amplification reactions, such as PCR.
[0110] In one embodiment, one or more of the ligation probes
comprise an anchor sequence. By "anchor sequence" herein is meant a
component of a ligation probe that allows the attachment of a
ligation product to a support for the purposes of detection.
Suitable means for detection include a support having attached
thereto an appropriate capture moiety. Generally, such an
attachment will occur via hybridization of the anchor sequence with
a capture probe, which is substantially complementary to the anchor
sequence.
[0111] In one embodiment of this aspect of the invention, the
upstream oligonucleotide is designed to have an additional
nucleotide segment that does not bind to the target of interest,
but is to be used to subsequently capture the ligated product on a
suitable solid support or device of some sort. In a preferred
embodiment of this aspect of the invention, the downstream
oligonucleotide has a detectable label attached to it, such that
following ligation, the resulting product will contain a capture
sequence for a solid support at its 3' end and a detectable label
at its 5' end, and only ligated products will contain both the
capture sequence and the label.
[0112] In another aspect of the invention pertaining to multiplex
target detection, each upstream probe of a probe set may be
designed to have a unique sequence at is 3' end that corresponds to
a different position on a DNA array. Each downstream probe of a
probe set may optionally contain a detectable label that is
identical to the other down stream probes, but a unique target
binding sequence that corresponds to its respective targets.
Following hybridization with the DNA array, only ligated probes
that have both an address sequence (upstream probe) and a label
(downstream probe) will be observable.
[0113] In another aspect of the invention, the detectable label can
be attached to the upstream probe and the capture sequence can be a
part of the downstream probe, such that the ligated products will
have the detectable label more towards the 3' end and the capture
sequence towards the 5' end of the ligated product. The exact
configuration is best determined via consideration of the ease of
synthesis as well as the characteristics of the devices to be used
to subsequently detect the ligated reaction product.
[0114] The anchor sequence may have both nucleic and non-nucleic
acid portions. Thus, for example, flexible linkers such as alkyl
groups, including polyethylene glycol linkers, may be used to
provide space between the nucleic acid portion of the anchor
sequence and the support surface. This may be particularly useful
when the ligation products are large.
[0115] In addition, in some cases, sets of anchor sequences that
correspond to the capture probes of "universal arrays" can be used.
As is known in the art, arrays can be made with synthetic generic
sequences as capture probes, that are designed to non-complementary
to the target sequences of the sample being analyzed but to
complementary to the array binding sequences of the ligation probe
sets. These "universal arrays" can be used for multiple types of
samples and diagnostics tests because same array binding sequences
of the probes can be reused/paired with different target
recognition sequences.
[0116] In one embodiment, one or more of the ligation probes
comprise a label. By "label" or "labeled" herein is meant that a
compound has at least one element, isotope or chemical compound
attached to enable the detection of the compound, e.g. renders a
ligation probe or ligation or transfer product detectable using
known detection methods, e.g., electronic, spectroscopic,
photochemical, or electrochemiluminescent methods.. In general,
labels fall into three classes: a) isotopic labels, which may be
radioactive or heavy isotopes; b) magnetic, electrical, thermal;
and c) colored or luminescent dyes; although labels include enzymes
and particles such as magnetic particles as well. The dyes may be
chromophores or phosphors but are preferably fluorescent dyes,
which due to their strong signals provide a good signal-to-noise
ratio. Suitable dyes for use in the invention include, but are not
limited to, fluorescent lanthanide complexes, including those of
Europium and Terbium, fluorescein, fluorescein isothiocyanate,
carboxyfluorescein (FAM), dichlorotriazinylamine fluorescein,
rhodamine, tetramethylrhodamine, umbelliferone, eosin, erythrosin,
coumarin, methyl-coumarins, pyrene, Malacite green, Cy3, Cy5,
stilbene, Lucifer Yellow, Cascade Blue.TM., Texas Red, alexa dyes,
dansyl chloride, phycoerythin, green fluorescent protein and its
wavelength shifted variants, bodipy, and others known in the art
such as those described in Haugland, Molecular Probes Handbook,
(Eugene, Oreg.) 6th Edition; The Synthegen catalog (Houston, Tex.),
Lakowicz, Principles of Fluorescence Spectroscopy, 2nd Ed., Plenum
Press New York (1999), and others described in the 6th Edition of
the Molecular Probes Handbook by Richard P. Haugland, herein
expressly incorporated by reference. Additional labels include
nanocrystals or Q-dots as described in U.S. Ser. No. 09/315,584,
herein expressly incorporated by reference.
[0117] In a preferred embodiment, the label is a secondary label
that part of a binding partner pair. For example, the label may be
a hapten or antigen, which will bind its binding partner. In a
preferred embodiment, the binding partner can be attached to a
solid support to allow separation of extended and non-extended
primers. For example, suitable binding partner pairs include, but
are not limited to: antigens (such as proteins (including
peptides)) and antibodies (including fragments thereof (FAbs,
etc.)); proteins and small molecules, including
biotin/streptavidin; enzymes and substrates or inhibitors; other
protein--protein interacting pairs; receptor-ligands; and
carbohydrates and their binding partners. Nucleic acid--nucleic
acid binding protein pairs are also useful. In general, the smaller
of the pair is attached to the NTP for incorporation into the
primer. Preferred binding partner pairs include, but are not
limited to, biotin (or imino-biotin) and streptavidin, digeoxinin
and Abs, and Prolinx.TM. reagents.
In a preferred embodiment, the binding partner pair comprises
biotin or imino-biotin and streptavidin. Imino-biotin is
particularly preferred as imino-biotin disassociates from
streptavidin in pH 4.0 buffer while biotin requires harsh
denaturants (e.g. 6 M guanidinium HCl, pH 1.5 or 90% formamide at
95.degree. C.).
[0118] In a preferred embodiment, the binding partner pair
comprises a primary detection label (for example, attached to a
ligation probe) and an antibody that will specifically bind to the
primary detection label. By "specifically bind" herein is meant
that the partners bind with specificity sufficient to differentiate
between the pair and other components or contaminants of the
system. The binding should be sufficient to remain bound under the
conditions of the assay, including wash steps to remove
non-specific binding. In some embodiments, the dissociation
constants of the pair will be less than about 10.sup.-4 to
10.sup.-6 M.sup.-1, with less than about 10.sup.-5 to 10.sup.-9
M.sup.-1 being preferred and 10.sup.-9 M.sup.-1 being particularly
preferred.
[0119] In a preferred embodiment, the secondary label is a
chemically modifiable moiety. In this embodiment, labels comprising
reactive functional groups are incorporated into the nucleic acid.
The functional group can then be subsequently labeled with a
primary label. Suitable functional groups include, but are not
limited to, amino groups, carboxy groups, maleimide groups, oxo
groups and thiol groups, with amino groups and thiol groups being
particularly preferred. For example, primary labels containing
amino groups can be attached to secondary labels comprising amino
groups, for example using linkers as are known in the art; for
example, homo-or hetero-bifunctional linkers as are well known (see
1994 Pierce Chemical Company catalog, technical section on
cross-linkers, pages 155 200, incorporated herein by
reference).
[0120] In this embodiment, the label may also be a label probe
binding sequence or complement thereof. By "label probe" herein is
meant a nucleic acid that is substantially complementary to the
binding sequence and is labeled, generally directly.
Synthetic Methods
[0121] The compositions of the invention are generally made using
known synthetic techniques. In general, methodologies based on
standard phosphoramidite chemistries find particular use in one
aspect of the present invention, although as is appreciated by
those skilled in the art, a wide variety of nucleic acid synthetic
reactions are known.
[0122] Methods of making probes having halo leaving groups is known
in the art; see for example Abe et al., Proc Natl Acad Sci USA
(2006)103(2):263-8; Silverman et al., Nucleic Acids Res. (2005)
33(15):4978-86; Cuppolletti et al., Bioconjug Chem. (2005)
16(3):528-34; Sando et al., J Am Chem Soc. (2004) 4;126(4):1081-7;
Sando et al., Nucleic Acids Res Suppl. (2002) 2:121-2; Sando et
al., J Am Chem Soc. (2002) 124(10):2096-7; Xu et al., Nat
Biotechnol. (2001) 19(2):148-52; Xu et al., Nucleic Acids Res.
(1998) 26(13):3159-64; Moran et al., Proc Natl Acad Sci USA (1997)
94(20):10506-11; Kool, U.S. Pat. No. 7,033,753; Kool, U.S. Pat. No.
6,670,193; Kool, U.S. Pat. No. 6,479,650; Kool, U.S. Pat. No.
6,218,108; Kool, U.S. Pat. No. 6,140,480; Kool, U.S. Pat. No.
6,077,668; Kool, U.S. Pat. No. 5,808,036; Kool, U.S. Pat. No.
5,714,320; Kool, U.S. Pat. No. 5,683,874; Kool, U.S. Pat. No.
5,674,683; and Kool, U.S. Pat. No. 5,514,546, each of which is
incorporated herein by reference in its entirety.
[0123] Additional components such as labels, primer sequences,
promoter sequences, etc. are generally incorporated as is known in
the art. The spacing of the addition of fluorophores and quenchers
is well known as well.
Secondary Reactions
[0124] Prior to detecting the ligation or transfer reaction
product, there may be additional amplification reactions. Secondary
amplification reactions can be used to increase the signal for
detection of the target sequence; e.g. by increasing the number of
ligated products produced per copy of target. In one embodiment,
any number of standard amplification reactions can be performed on
the ligation product, including, but not limited to, strand
displacement amplification (SDA), nucleic acid sequence based
amplification (NASBA), ligation amplification and the polymerase
chain reaction (PCR); including a number of variations of PCR,
including "quantitative competitive PCR" or "QC-PCR", "arbitrarily
primed PCR" or "AP-PCR", "immuno-PCR", "Alu-PCR", "PCR single
strand conformational polymorphism" or "PCR-SSCP", "reverse
transcriptase PCR" or "RT-PCR", "biotin capture PCR", "vectorette
PCR". "panhandle PCR", and "PCR select cDNA subtraction", among
others. In one embodiment, the amplification technique is not PCR.
According to certain embodiments, one may use ligation techniques
such as gap-filling ligation, including, without limitation,
gap-filling OLA and LCR, bridging oligonucleotide ligation,
FEN-LCR, and correction ligation. Descriptions of these techniques
can be found, among other places, in U.S. Pat. No. 5,185,243,
published European Patent Applications EP 320308 and EP 439182,
published PCT Patent Application WO 90/01069, published PCT Patent
Application WO 02/02823, and U.S. patent application Ser. No.
09/898,323.
[0125] In addition to standard enzymatic amplification reactions,
it is possible to design probe schemes where the ligated product
that is initially produced can itself be the target of a secondary
chemical ligation reaction.
[0126] Furthermore, "preamplification reactions" can be done on
starting sample nucleic acids to generate more target sequences for
the chemical reaction ligation. For example, whole genome
amplification can be done.
Assays
[0127] As will be appreciated by those skilled in the art, assays
utilizing methods and compositions of the invention can take on a
wide variety of configurations, depending on the desired
application, and can include in situ assays (similar to FISH),
solution based assays (e.g. transfer/removal of fluorophores and/or
quenchers), and heterogeneous assays (e.g. utilizing solid supports
for manipulation, removal and/or detection, such as the use of high
density arrays). In addition, assays can include additional
reactions, such as pre-amplification of target sequences and
secondary amplification reactions after ligation has occurred, as
is outlined herein.
[0128] Assays pertaining to this aspect of the invention, as
described herein, may rely on increases in a signal, e.g. the
generation of fluorescence or chemiluminescence. However, as will
be appreciated by those in the art, assays that rely on decreases
in such signals are also possible.
[0129] In one embodiment, assay reactions are performed "in situ"
(also referred to in various assay formats as "in vitro" and/or "ex
vivo" depending on the sample), similar to FISH reactions. Since no
exogeneous enzymes need be added, reagents can be added to cells
(living, electroporated, fixed, etc.) such as histological samples
for the determination of the presence of target sequences,
particularly those associated with disease states or other
pathologies.
[0130] In addition, "in vitro" assays can be done where target
sequences are extracted from samples. Samples can be processed
(e.g. for paraffin embedded samples, the sample can be prepared),
the reagents added and the reaction allowed to proceed, with
detection following as is done in the art.
[0131] In one embodiment, ligated products are detected using solid
supports. For example, the ligated products are attached to beads,
using either anchor probe/capture probe hybridization or other
binding techniques, such as the use of a binding partner pair (e.g.
biotin and streptavidin). In one embodiment, a transfer reaction
results in a biotin moiety being transferred from the first
ligation probe to a second ligation probe comprising a label. Beads
comprising streptavidin are contacted with the sample, and the
beads are examined for the presence of the label, for example using
FACS technologies.
[0132] In other embodiments, ligated products are detected using
heterogeneous assays. That is, the reaction is done in solution and
the product is added to a solid support, such as an array or beads.
Generally, one ligation probe comprises an anchor sequence or a
binding pair partner (e.g. biotin, haptens, etc.) and the other
comprises a label (e.g. a fluorophore, a label probe binding
sequence, etc.). The ligated product is added to the solid support,
and the support optionally washed. In this embodiment, only the
ligated product will be captured and be labeled.
[0133] In another aspect of the invention, one of oligonucleotide
probes has an attached magnetic bead or some other label (biotin)
that allows for easy manipulation of the ligated product. The
magnetic bead or label can be attached to either the upstream or
the downstream probe using any number of configurations as outlined
herein.
[0134] As described herein, secondary reactions can also be done,
where additional functional moieties (e.g. anchor sequences,
primers, labels, etc.) are added. Similarly, secondary
amplification reactions can be done as described herein.
[0135] Detection systems are known in the art, and include optical
assays (including fluorescence and chemiluminescent assays),
enzymatic assays, radiolabelling, surface plasmon resonance,
magnetoresistance, cantilever deflection, surface plasmon
resonance, etc. In some embodiments, the ligated product can be
used in additional assay technologies, for example, as described in
2006/0068378, hereby incorporated by reference, the ligated product
can serve as a linker between light scattering particles such as
colloids, resulting in a color change in the presence of the
ligated product.
[0136] In some embodiments, the detection system can be included
within the sample collection tube; for example, blood collection
devices can have assays incorporated into the tubes or device to
allow detection of pathogens or diseases.
Solid Supports
[0137] As outlined above, the assays can be run in a variety of
ways. In assays that utilize detection on solid supports, there are
a variety of solid supports, including arrays, that find use in the
invention.
[0138] In some embodiments, solid supports such as beads find use
in the present invention. For example, binding partner pairs (one
on the ligated product and one on the bead) can be used as outlined
above to remove non-ligated reactants. In this embodiment, magnetic
beads are particularly preferred.
[0139] In some embodiments of the invention, capture probes are
attached to solid supports for detection. For example, capture
probes can be attached to beads for subsequent analysis using any
suitable technique, e.g. FACS. Similarly, bead arrays as described
below may be used.
[0140] In one embodiment, the present invention provides arrays,
each array location comprising at a minimum a covalently attached
nucleic acid probe, generally referred to as a "capture probe". By
"array" herein is meant a plurality of nucleic acid probes in an
array format; the size of the array will depend on the composition
and end use of the array. Arrays containing from about 2 different
capture ligands to many thousands can be made. Generally, for
electrode-based assays, the array will comprise from two to as many
as 100,000 or more, depending on the size of the electrodes, as
well as the end use of the array. Preferred ranges are from about 2
to about 10,000, with from about 5 to about 1000 being preferred,
and from about 10 to about 100 being particularly preferred. In
some embodiments, the compositions of the invention may not be in
array format; that is, for some embodiments, compositions
comprising a single capture probe may be made as well. In addition,
in some arrays, multiple substrates may be used, either of
different or identical compositions. Thus, for example, large
arrays may comprise a plurality of smaller substrates. Nucleic acid
arrays are known in the art, and can be classified in a number of
ways; both ordered arrays (e.g. the ability to resolve chemistries
at discrete sites), and random arrays (e.g. bead arrays) are
included. Ordered arrays include, but are not limited to, those
made using photolithography techniques (e.g. Affymetrix
GeneChip.RTM.), spotting techniques (Synteni and others), printing
techniques (Hewlett Packard and Rosetta), electrode arrays, three
dimensional "gel pad" arrays and liquid arrays.
[0141] In a preferred embodiment, the arrays are present on a
substrate. By "substrate" or "solid support" or other grammatical
equivalents herein is meant any material that can be modified to
contain discrete individual sites appropriate for the attachment or
association of nucleic acids. The substrate can comprise a wide
variety of materials, as will be appreciated by those skilled in
the art, including, but not limited to glass, plastics, polymers,
metals, metalloids, ceramics, and organics. When the solid support
is a bead, a wide variety of substrates are possible, including but
not limited to magnetic materials, glass, silicon, dextrans, and
plastics.
Hardware
[0142] Microfluidics
[0143] In another aspect of the invention, a fluidic device similar
to those described by Liu (2006) is used to automate the
methodology described in this invention. See for example U.S. Pat.
No. 6,942,771, herein incorporated by reference for components
including but not limited to cartridges, devices, pumps, wells,
reaction chambers, and detection chambers. The fluidic device may
also include zones for capture of magnetic particles, separation
filters and resins, including membranes for cell separation
(i.e.Leukotrap.TM. from Pall). The device may include detection
chambers for in-cartridge imaging of fluorescence signal generated
during Real-Time PCR amplification (i.e. SYBR green, Taqman,
Molecular Beacons), as well as capillary electrophoresis channels
for on-device separation and detection of reactions products
(amplicons and ligation products). In a preferred embodiment, the
capillary electrophoresis channel can be molded in a plastic
substrate and filled with a sieving polymer matrix (POP-7.TM. from
Applied Biosystems). Channels containing non-sieving matrix can
also be used with properly designed probe sets.
[0144] In a preferred embodiment, the devices of the invention
comprise liquid handling components, including components for
loading and unloading fluids at each station or sets of stations.
The liquid handling systems can include robotic systems comprising
any number of components. In addition, any or all of the steps
outlined herein may be automated; thus, for example, the systems
may be completely or partially automated.
[0145] As will be appreciated by those in the art, there are a wide
variety of components which can be used, including, but not limited
to, one or more robotic arms; plate handlers for the positioning of
microplates; holders with cartridges and/or caps; automated lid or
cap handlers to remove and replace lids for wells on non-cross
contamination plates; tip assemblies for sample distribution with
disposable tips; washable tip assemblies for sample distribution;
96 well loading blocks; cooled reagent racks; microtitler plate
pipette positions (optionally cooled); stacking towers for plates
and tips; and computer systems.
[0146] Fully robotic or microfluidic systems include automated
liquid-, particle-, cell- and organism-handling including high
throughput pipetting to perform all steps of screening
applications. This includes liquid, particle, cell, and organism
manipulations such as aspiration, dispensing, mixing, diluting,
washing, accurate volumetric transfers; retrieving, and discarding
of pipet tips; and repetitive pipetting of identical volumes for
multiple deliveries from a single sample aspiration. These
manipulations are cross-contamination-free liquid, particle, cell,
and organism transfers. This instrument performs automated
replication of microplate samples to filters, membranes, and/or
daughter plates, high-density transfers, full-plate serial
dilutions, and high capacity operation.
[0147] In a preferred embodiment, chemically derivatized particles,
plates, cartridges, tubes, magnetic particles, or other solid phase
matrix with specificity to the assay components are used. The
binding surfaces of microplates, tubes or any solid phase matrices
include non-polar surfaces, highly polar surfaces, modified dextran
coating to promote covalent binding, antibody coating, affinity
media to bind fusion proteins or peptides, surface-fixed proteins
such as recombinant protein A or G, nucleotide resins or coatings,
and other affinity matrix are useful in this invention.
[0148] In a preferred embodiment, platforms for multi-well plates,
multi-tubes, holders, cartridges, minitubes, deep-well plates,
microfuge tubes, cryovials, square well plates, filters, chips,
optic fibers, beads, and other solid-phase matrices or platform
with various volumes are accommodated on an upgradable modular
platform for additional capacity. This modular platform includes a
variable speed orbital shaker, and multi-position work decks for
source samples, sample and reagent dilution, assay plates, sample
and reagent reservoirs, pipette tips, and an active wash
station.
[0149] In a preferred embodiment, thermocycler and thermoregulating
systems are used for stabilizing the temperature of heat exchangers
such as controlled blocks or platforms to provide accurate
temperature control of incubating samples from 0 .degree. C. to 100
.degree. C.; this is in addition to or in place of the station
thermocontrollers.
[0150] In a preferred embodiment, interchangeable pipet heads
(single or multi-channel) with single or multiple magnetic probes,
affinity probes, or pipetters robotically manipulate the liquid,
particles, cells, and organisms. Multi-well or multi-tube magnetic
separators or platforms manipulate liquid, particles, cells, and
organisms in single or multiple sample formats.
[0151] In some embodiments, the instrumentation will include a
detector, which can be a wide variety of different detectors,
depending on the labels and assay. In a preferred embodiment,
useful detectors include a microscope(s) with multiple channels of
fluorescence; plate readers to provide fluorescent, electrochemical
and/or electrical impedance analyzers, ultraviolet and visible
spectrophotometric detection with single and dual wavelength
endpoint and kinetics capability, fluroescence resonance energy
transfer (FRET), luminescence, quenching, two-photon excitation,
and intensity redistribution; CCD cameras to capture and transform
data and images into quantifiable formats; capillary
electrophoresis systems, mass spectrometers and a computer
workstation.
[0152] These instruments can fit in a sterile laminar flow or fume
hood, or are enclosed, self-contained systems, for cell culture
growth and transformation in multi-well plates or tubes and for
hazardous operations. The living cells may be grown under
controlled growth conditions, with controls for temperature,
humidity, and gas for time series of the live cell assays.
Automated transformation of cells and automated colony pickers may
facilitate rapid screening of desired cells.
[0153] Flow cytometry or capillary electrophoresis formats can be
used for individual capture of magnetic and other beads, particles,
cells, and organisms.
[0154] The flexible hardware and software allow instrument
adaptability for multiple applications. The software program
modules allow creation, modification, and running of methods. The
system diagnostic modules allow instrument alignment, correct
connections, and motor operations. The customized tools, labware,
and liquid, particle, cell and organism transfer patterns allow
different applications to be performed. The database allows method
and parameter storage. Robotic and computer interfaces allow
communication between instruments.
[0155] In a preferred embodiment, the robotic apparatus includes a
central processing unit which communicates with a memory and a set
of input/output devices (e.g., keyboard, mouse, monitor, printer,
etc.) through a bus. Again, as outlined below, this may be in
addition to or in place of the CPU for the multiplexing devices of
the invention. The general interaction between a central processing
unit, a memory, input/output devices, and a bus is known in the
art. Thus, a variety of different procedures, depending on the
experiments to be run, are stored in the CPU memory.
[0156] These robotic fluid handling systems can utilize any number
of different reagents, including buffers, reagents, samples,
washes, assay components such as label probes, etc.
Kits
[0157] In another aspect of the invention, a kit for the routine
detection of a predetermined set of nucleic acid targets is
produced that utilizes probes, techniques, methods, and a chemical
ligation reaction as described herein as part of the detection
process. The kit can comprise probes, target sequences,
instructions, buffers, and/or other assay components.
Chemical Ligation Dependent Probe Amplification (CLPA)
[0158] In another embodiment, the invention relates to chemical
ligation dependent probe amplification (CLPA) technology. CLPA is
based on the chemical ligation of target specific oligonucleotide
probes to form a ligation product. This ligation product
subsequently serves as a template for an enzymatic amplification
reaction to produce amplicons which are subsequently analyzed using
any suitable means. CLPA can be used for a variety of purposes
including but not limited to analysis of complex gene signature
patterns. Unlike other techniques such as DASL (Bibikova, M., et
al., American Journal of Pathology, (2004), 165:5, 1799-1807) and
MLPA (Schouten, U.S. Pat. No. 6,955,901) which utilize an enzymatic
ligation reaction, CLPA uses a chemical ligation reaction.
[0159] In one embodiment, the CLPA assay comprises the use of
oligonucleotide probe pairs that incorporate reactive moieties that
can self-ligate when properly positioned on a target sequence. In a
preferred embodiment, a 3'-phosphorothioate moiety on one probe
reacts with a 5'-DABSYL leaving group on the other probe (See
Scheme 1 and FIG. 6).
##STR00001##
[0160] The 5'-DABSYL group reacts about four times faster than
other moieties, e.g. iodine, and also simplifies purification of
the probes during synthesis.
[0161] CLPA has several distinct advantages over other
sequence-based hybridization techniques. First, CLPA can be applied
directly to RNA analysis without the need to make a DNA copy
beforehand. Second, CLPA is relatively insensitive to sample
contaminants and can be applied directly to impure samples
including body samples such as blood, urine, saliva and feces.
Third, CLPA involves fewer steps than other known methods, thereby
reducing the time required to gain a result. Moreover, CLPA probes
can be stored dry, and properly designed systems will spontaneously
react to join two or more oligonucleotides in the presence of a
complementary target sequence. Chemical ligation reactions show
excellent sequence selectivity and can be used to discriminate
single nucleotide polymorphisms.
[0162] Significantly, unlike enzymatic ligation methods, CLPA shows
nearly identical reactivity on DNA and RNA targets which, as
described more fully below, renders CLPA more efficient that other
known systems, and expands the scope of applications to which CLPA
can be utilized.
[0163] Advantageously, the CLPA assay reduces the number of steps
required to achieve a result, which provides the potential to
achieve results in significantly shorter time periods. For example,
the general process flow for a standard reverse transcriptase (RT)-
multiplex ligase-dependent probe ligation (MLPA) involves the
following steps:
[0164] 1. Isolate total RNA.
[0165] 2. Use Reverse Transcriptase to make cDNA copy.
[0166] 3. Hybridize MLPA probe sets to the cDNA target
overnight.
[0167] 4. Add DNA Ligase to join target-bound probes.
[0168] 5. Amplify ligated probes, e.g. PCR amplification using Taq
polymerase and fluorescently labeled PCR primers.
[0169] 6. Analyze the sample, for example, by CE.
[0170] Unlike standard RT-MLPA, CLPA enables analysis to be carried
out directly on cell and blood lysates and on RNA targets. Thus,
unlike a RT-MLPA, CLPA avoids the necessity of having to isolate
the RNA, and then perform reverse transcription to make a cDNA copy
prior to ligation. This shortens the time for achieving a result
and provides a means to achieve faster analysis.
[0171] A further advantage of CLPA is that incorporation of a
capture moiety on one probe enables a rapid and specific method for
purification of the resulting ligation product from the crude
sample free of all impurities and non-target nucleic acid
materials, as described below for a biotin-labeled probe. This
capability is particularly advantageous in applications where the
target nucleic acid is found in the presence of a large excess of
non-target nucleic acid, such as in detection of infectious agents
(bacteria, fungi, viruses). In this case, the presence of large
amounts of host nucleic acid requires use of a high-capacity
extraction method, which in turn can result in inefficient
amplification of the target nucleic acid due to large amounts of
non-target nucleic acid and/or carry-over of inhibitory
contaminants.
[0172] In another embodiment of this aspect of the invention,
faster reaction times are further facilitated by driving the
hybridization reaction with higher probe concentrations. Thus, for
example, input probe sets may be incorporated in the CLPA reaction
at relatively high concentrations, for example, approximately
100-fold higher than those typically used in an MLPA reaction.
Elevating the probe concentration significantly reduces the time
required for the hybridization step, typically from overnight to
between about 15 minutes to about 1 hour.
[0173] When higher probe concentrations are used it is generally
preferred to incorporate a purification step prior to
amplification, especially for high multiplex analysis (e.g. greater
than about 5 targets). In one embodiment of this aspect of this
invention, a solid support based capture methodology can be
employed including membrane capture, magnetic bead capture and/or
particle capture. In a preferred embodiment, a biotin/streptavidin
magnetic bead purification protocol is employed after ligation and
prior to enzymatic amplification. In some instances, the magnetic
particles can be directly added to the amplification master mix
without interfering with the subsequent amplification reaction. In
other instances, it is preferable to release the captured
oligonucleotide from the beads and the released oligonucleotide
solution is subsequently amplified without the capture particle or
surface being present.
[0174] In a preferred embodiment, CLPA involves hybridization of a
set of probes to a nucleic acid target sequences such that the
probes can undergo self-ligation without addition of a ligase.
After a ligation product is produced, amplification is generally
preferred to facilitate detection and analysis of the product. For
this purpose, probes are preferably designed to incorporate PCR
primers such as, e.g. universal PCR primers. In a preferred
embodiment, the universal primers are not added until after the
ligation portion of the reaction is complete, and the primers are
added after surface capture purification along with the polymerase,
often as part of a PCR master mix.
[0175] The CLPA probes possess reactive moieties positioned such
that when the CLPA probes are bound to the nucleic acid target, the
reactive moieties are in close spatial orientation and able to
undergo a ligation reaction without the addition of enzyme. In a
preferred embodiment, the chemical ligation moieties are chosen so
as to yield a ligated reaction product that can be efficiently
amplified by the amplification enzyme which is often a DNA
polymerase. Without being bound by theory, chemical ligation
chemistries and probe set designs that produce reaction products
that more closely resemble substrates that are known as being able
to be amplified by DNA and RNA polymerases are more likely to yield
efficient probe sets that can be used in the CLPA assay. Especially
preferred reaction chemistries are chemical moieties that yield
reaction products that closely resemble native DNA such as
illustrated in Scheme 1 involving a reaction between a
3'-phosphorothioate and a 5' DABSYL leaving group. In another
preferred embodiment, probes sets comprise a 3'-diphosphorothioate
(Miller, G. P. et al, Bioorganic and Medicinal Chemistry, (2008)
16:56-64) and a 5'-DABSYL leaving group.
[0176] The CLPA probes also incorporate a stuffer sequence (also
referred to herein as a variable spacer sequence) to adjust the
length of the ligation product. As described further below, length
variation provides a convenient means to facilitate analysis of
ligation product(s). The stuffer can be located on either probe,
though for convenience it is generally incorporated on the S probe
(3'-phosphorothioate probe).
[0177] In one embodiment of this aspect of the invention, CLPA-CE,
the stuffer sequence is varied in length in order to produce one or
more variable length ligation products which provide the basis for
detection and identification of specific target sequences based on
length variation. In a preferred embodiment, variable length
ligation products are analyzed by capillary electrophoresis (CE).
Generally stuffer sequences are included such that the length of
different ligation products varies in a range of at least 1 base
pair to about 10 base pairs; preferably from 1 base pair to 4 base
pairs. In a preferred embodiment, the length of the different
ligation products vary from approximately 80 bp to about 400 bp;
preferably in a range of about 100 bp to about 300 bp; more
preferably in a range of about 100 bp to about 200 bp
[0178] In another embodiment, CLPA probes may also contain other
optional element(s) to facilitate analysis and detection of a
ligated product. For example, it is preferred that one of the
probes for use in an embodiment herein referred to as CLPA-MDM
incorporate an array binding sequence to bind to an appropriate
capture sequence on a microarray platform. For CLPA-MDM, the
different CLPA reaction products are not separated by size
differences but by the differences in the array binding sequence.
In this embodiment, the sequence of the array binding sequence is
varied so that each CLPA probe will bind to a unique site on a DNA
microarray. The length of the array binding sequence in CLPA-MDM
usually varies from 15 to 150 bases, more specifically from 20 to
80 bases, and most specifically from 25 to 50 bases. In some
embodiments, CLPA probes preferably also include other elements to
facilitate purification and/or analysis including but not limited
to labels such as fluorescent labels and hapten moieties such as,
for example, biotin for purifying or detecting ligation product(s).
For example, probes and/or ligation product(s) that incorporate
biotin can be purified on any suitable avidin/streptavidin platform
including beads. While biotin/avidin capture systems are preferred,
other hapten systems (e.g. Digoxigenin (DIG) labeling) can be used,
as can hybridization/oligonucleotide capture.
Hybridization/oligonucleotide capture is a preferred method when it
it desirable to release the capture product from the beads at a
later stage. In addition to magnetic beads, anti-hapten labeled
supports (filter paper, porous filters, surface capture) can be
used.
[0179] CLPA probe-labeling can be on either probe, either at the
end or internally. Preferably biotin is incorporated at the 5' end
on the phosphorothioate (S-probe).
[0180] CLPA probes are generally incorporated in a reaction at a
concentration of 250 nanomolar (nM) to 0.01 pM (picomolar) for each
probe. Generally, the concentration is between about 1 nM to about
1 pM. Factors to consider when choosing probe concentration include
the particular assay and the target being analyzed. The S-or
phosphorothioate or Nucleophile probe and L- or leaving group or
DABSYL containing probes are incorporated at a concentration that
equals or exceeds the concentration of the target. Total
concentration of S- and L-probes can reach as high as 10 micromolar
(uM). As a non-limiting example, 1 nM for each S and L
probe.times.250 CLPA probe pairs would equal 500 nm (1 nm per
probe.times.2 probes per pair.times.250 targets) at 10 nM for each
probe would mean a total concentration of 5 uM.
[0181] The target concentration usually ranges from about 10
micrograms of total RNA to about 10 nanograms, but it can be a
little as a single copy of a gene.
[0182] In a preferred embodiment of CLPA technology, a CLPA probe
set consists of 2 oligonucleotide probes with complementary
reactive groups (FIGS. 1 and 2). In another embodiment, the CLPA
probe set may consist of 3 or more probes that bind adjacent to
each other on a target. In a preferred embodiment of the 3-probe
CLPA reaction, the outer probes are designed to contain the
enzymatic amplification primer binding sites, and the inner probe
is designed to span the region of the target between the other
probes. In a more preferred embodiment, the outer probes have
non-complementary reactive groups such that they are unable to
react with each other in the absence of the internal (middle) probe
(FIG. 3). In some instances, both outer probes may have similar
reactive moieties except that one group is at the 5' end of one
probe and the 3'-end of the other probe, and the L-probe
chemistries may also be similar to each other except for
positioning on the probe. As is known to one who is skilled in the
art, different chemical reagents and processes may be needed to
manufacture the probes for the 3-probe CLPA reaction compared to
the probes for the 2-probe CLPA system.
[0183] In a preferred embodiment of the 3-probe CLPA system, one
outer probe contains a 3' phosphorothioate (3' S-probe), the other
outer probe contains a 5'-phosphorothioate (5'-S-probe) and the
center probe contains both a 3'- and a 5'-DABSYL leaving group. The
manufacture of a 5'-DABSYL leaving group probes has been reported
previously (Sando et al, J. Am. Chem. Soc., (2002), 124(10)
2096-2097). We recently developed a new DNA synthesis reagent that
allows for the routine incorporation of a 3'-DABSYL leaving group
(FIG. 4).
CLPA-CE
[0184] In one embodiment, CLPA ligation product(s) are detected by
size differentiation capillary electrophoresis (CE) on a sieving
matrix, or by slab gel electophoresis. A schematic representation
for CLPA-CE is provided in FIG. 1. In this example, analysis is
performed directly on a blood sample following cell lysis by any
appropriate means including chemically, mechanically or
osmotically, and addition of appropriately designed probes. In a
preferred embodiment, chemical lysis of the cells is used. FIG. 6
provides a general schematic representation of the design of a
probe set for CLPA-CE analysis. In this example the S probe is
designed to include a universal PCR primer for subsequent
amplification of ligation product(s); a stuffer sequence which is
designed with a length that correlates with a specific target; and
a target binding sequence. Likewise, the L-probe includes a target
binding sequence and universal primer. The probes are usually
labeled with a flurophore (FAM, Cy3, Cy5, etc), however they can
also be detected without fluorescence labeling. The labeling is
done by using a fluorescently labeled PCR primer.
[0185] In this example of CLPA-CE probes, the S probe also includes
a biotin moiety at the 5' end to facilitate purification and
removal of unligated probe. Following amplification of ligated
product(s), each having a unique length, the reaction mixture is
separated by CE, or other suitable size separation technique. The
peak height or intensity of each product is a reflection of target
sequence expression, i.e. level of target in the sample. (FIG. 1
and FIG. 7).
CLPA-MDM
[0186] In another embodiment of this aspect of the invention, CLPA
ligation products are analyzed/detected by microarray analysis
(CLPA-MDM). A schematic representation of CLPA-MDM is provided in
FIG. 2. CLPA-MDM differs from CLPA-CE in at least the following
respects. First, the probe sets differ in design. For example, a
general representation of a CLPA- MDM probe set is depicted in FIG.
2. As with CLPA-CE probes, CLPA-MDM probe sets can include
universal primers for amplification of ligation product(s). They
also include target specific sequences, as well as ligation
moieties for enzyme-independent ligation. Additionally, CLPA-MDM
probes also may include a stuffer sequence, however the purpose of
this stuffer sequence is to adjust the size of the CLPA-MDM to the
same length in an effort to standardize enzymatic amplification
efficiency. Normalization of amplicon size is not a requirement but
a preferred embodiment. A second difference between the design of
CLPA-CE and CLPA-MDM probe sets is that the latter include a unique
array binding sequence for use with an appropriate microarray
platform.
[0187] In respect of the CLPA-MDM aspect of the invention, a
microarray binding site (ABS sequence) is incorporated into the
probe designs for use with a "universal" microarray platform for
the detection. Similar to the CLPA-CE system, probes are preferably
labeled with a fluorophore, for example by using a fluorescently
labeled PCR primer. Alternatively, for example, a sandwich assay
labeling technique can be used for the final read-out. Sandwich
assays involve designing the probes with a common (generic) label
binding site (LBS) in place or in addition to the stuffer sequence
and using a secondary probe that will bind to this site during the
array hybridization step. This methodology is particularly useful
when it is desirable to label the arrays with a chemiluminescent
system like a horse radish peroxidase (HRP) labeled
oligonucleotide, or with an electrochemical detection system.
Generally, planar microarrays are employed (e.g. microarrays
spotted on glass slides or circuit board) for the read-out.
However, bead microarrays such as those available from Luminex and
Illumina can also be used (e.g. Luminex xMAP/xtag).
EXAMPLE 1
Quantitative Multiplex Detection of 5 Targets
[0188] Multiplex CLPA reactions were performed using five (5) DNA
target mimics (corresponding to portions of the MOAP1 (SEQ ID
NO:5), PCNA (SEQ ID NO:9), DDB2 (SEQ ID NO:12), BBC3 (SEQ ID NO:16)
and BAX (SEQ ID NO:19) genes) combined in one reaction in the
presence of their respective CLPA probes (Table 1) (S and L probes
at 1 nM each). The target mimics were pooled in different
concentration as shown in Table 2. The target mimics, S probes and
L probes were incubated in PCR buffer (1.times. PCR buffer is 1.5
mM MgCL2, 50 mM KCl, 10 mM Tris-HCl pH8.3) for 1 hour at 50 C. A 1
ul aliquot of each reaction mixture was used as template for PCR
amplification using Dynamo SYBR green PCR mix in the presence of
Universal Primers (SEQ ID NOS 1 and 2, 300 nM). The samples were
PCR cycled for 27 cycles (95 C 15 min followed by 27 cycles of 95 C
(10 s), 60 C (24 s), 72 C (10 s). After PCR amplification, the
samples were denatured and injected into an ABI 3130 DNA sequencer
(capillary electrophoresis instrument). The CE trace from the ABI
for the 3 samples as well as a plot of the peak versus target mimic
concentration of PCNA is shown in FIG. 7 and a plot of the linear
response of the signal of PCNA as a function on input concentration
is shown in FIG. 8.
TABLE-US-00001 TABLE 1 Probe and target sequence information. SEQ
Amplicon ID Name Sequence Detail Size 1 Forward PCR Primer
FAM-GGGTTCCCTAAGGGTTGGA 2 Reverse PCR Primer
GTGCCAGCAAGATCCAATCTAGA 3 MOAP1-L
LTACATCCTTCCTAGTCAATTACACTCTAGATTGGA 47 TCTTGCTGGCAC 4 MOAP1-S
5'-Biotin- 41 GGGTTCCCTAAGGGTTGGATAGGTAAAT GGCAGTGTAGAACS Ligated
MOAP1 Amplicon 88 5 MOAP1-Target
GTGTAATTGACTAGGAAGGATGTAGTTCTACACTG mimic CCATTTACCTA 6 MOAP1-RNA
Target GUGUAAUUGACUAGGAAGGAUGUAGUUCUACAC mimic UGCCAUUUACCUA 7
PCNA-L LTGGTTTGGTGCTTCAAATACTCTCTAGATTGGATC 45 TTGCTGGCAC 8 PCNA-S
Biotin- 63 GGGTTCCCTAAGGGTTGGATCGAGTCTACAGATCC
CCAACTTTCATAGTCTGAAACTTTCTCCS Ligated PCNA Amplicon 108 9
PCNA-Target Mimic AGTATTTGAAGCACCAAACCAGGAGAAAGTTTCA GACTATGA 10
DDB2-L LTAGCAGACACATCCAGGCTCTAGATTGGATCTTG 51 CTGGCAC 11 DDB2-S
Biotin- 49 GGGTTCCCTAAGGGTTGGATCGAGTCTACTCCAAC
TTTGACCACCATTCGGCTACS Ligated DDB2 Amplicon 96 12 DDB2-Target Mimic
GCCTGGATGTGTCTGCTAGTAGCCGAATGGTGGTC A 13 DDB2-RNA Target
GCCUGGAUGUGUCUGCUAGUAGCCGAAUGGUGG Mimic UCA 14 BBC3-L
LTCCGAGATTTCCCCCTCTAGATTGGATCTTGCTGG 38 CAC 15 BBC3-S Biotin- 37
GGGTTCCCTAAGGGTTGGATCCCAGACTCCTCCCT CTS Ligated BBC3 Amplicon 75 16
BBC3-Target Mimic GGG GGA AAT CTC GGA AGA GGG AGG AGT CTG GG 17
BAX-L LTCACGGTCTGCCACGCTCTAGATTGGATCTTGCTG 39 GCAC 18 BAX-S
Biotin-GGGTTCCCTAAGGGTTGGA TGA GTC TAC 53 ATGA TC CT
TCCCGCCACAAAGATGGS Ligated BAX Amplicon 92 19 BAX-Target Mimic
CGTGGCAGACCGTGACCATCTTTGTGGCGGGA 20 3-phosphorothioate Biotin- 51
GAPDH GGGTTCCCTAAGGGTTGGACGGACGCCTGCTTCAC CACCTTCTTGATGTCAS 21
Middle 2L probe LTCATATTTGGCAGGTTTTTCTAGACGGCAGGTL 32 GAPDH 22
5'-phosphorothioate SCAGGTCCACCACTGACACGTTGGCAGTTCTAGAT 50 GAPDH
TGGATCTTGCTGGCAC Ligated 3-probe amplicon 133 24 GAPDH Target ACT
GCC AAC GTG TCA GTG GTG GAC CTG ACC Mimic TGC CGT CTA GAA AAA CCT
GCC AAA TAT GAT GAC ATC AAG AAG GTG GTG AAG CAG GCG TC 25 GAPDH 3-L
LTTTTCTAGACGGCAGGTCAGGTCCACCAGATGAT
CGACGAGACACTCTCGCCATCTAGATTGGATCTTG CTGGCAC 26 GAPDH 3-S
GGGTTCCCTAAGGGTTGGACGGACCAACTCCTCGC
CATATCATCTGTACACCTTCTTGATGTCATCATATT TGGCAGGTS 27 GAPDH-3-FAM/BHQ-1
(FAM)ccaactcctcgccatatcatctgtacaccttc Taqman Probe ttg(BHQ-1) 28
GAPDH 4-L LTGCTGATGATCTTGAGGCTGTTGTCATACTGATG
ATCGACGAGACACTCTCGCCATCTAGATTGGATCT TGCTGGCAC 29 GAPDH-4-S
GGGTTCCCTAAGGGTTGGACGATGGAGTTGATGCT
GACGGAAGTCATAGTAAGCAGTTGGTGGTGCAGG AGGCATS 30 GAPDH-4-QUASAR
(Quasar 670)tgctgacggaagtcatagtaagca 670/BHQ-2 Taqman gttggt(BHQ-2)
Probe 31 PCNA 2-L LTCCTTGAGTGCCTCCAACACCTTCTTGAGGATGAT
CGACGAGACACTCTCGCCATCTAGATTGGATCTTG CTGGCAC 32 PCNA 2-S
GGGTTCCCTAAGGGTTGGACGGTACAACAAGACCC
AGCTGACGACTCTTAATATCCCAGCAGGCCTCGTT GATGAGGS 33 PCNA 2-Cal Fluor
(CAL Red 610)ctgacgactcttaatatcccagc Orange 560/BHQ-1
aggcctcgtt(BHQ-2) 34 DDB2-2-L LTTAGTTCCAAGATAACCTTGGTTCCAGGCTGATG
ATCGACGAGACACTCTCGCCATCTAGATTGGATCT TGCTGGCAC 35 DDB2-2-S
BiotinGGGTTCCCTAAGGGTTGGACGTTAGACGCCA
ATAGGAGTTTCACTGGTGGCTACCACCCACTGAGA GGAGAAAAGTCATS 36 DDB2-2-(CAL
Fluor (Cal Orange 560)cgccaataggagtttcact Orange 560/BHQ-1
ggtggctacca(BHQ-2) L = DABSYL ligation moiety S = phosphorothiate
moiety
TABLE-US-00002 TABLE 2 Sample Concentrations Sample Target Mimic
Concentrations 1 All Target mimics at 10 pM final Concentration 2
MOAP1, DDB2 and BBC3 at 10 pM, PCNA at 5 pM and BAX at 2 pM 3
MOAP1, DDB2 and BBC3 at 10 pM, PCNA at 1 pM and BAX at 0.5 pM
EXAMPLE 2
CLPA Reactions Using MOAP1 and DDB2 DNA and RNA Target Mimics
[0189] Reactions were prepared in duplicate as presented in Table 3
using DNA or RNA target mimics for the MOAP1 and DDB2 genes and
CLPA probes sets designed to target the sequences. The probe
numbers refer to the SEQ ID NOs in Table 1. The reagents were added
in the concentrations and volumes shown in Table 4. The respective
S-probe, L-probe and target mimic were heated to 50.degree. C. for
60 minutes in a 0.2 mL PCR tube, after which 2.5 .mu.l of the CLPA
reaction was used as template in a real-time PCR reaction with 40
amplification cycles. Real-time PCR data was averaged for the
duplicate samples and is presented in Table 3 (Ct value column).
Minimal differences in Ct value between RNA and DNA target mimics
were observed indicating similar probe ligation efficiency on RNA
and DNA substrates.
TABLE-US-00003 TABLE 3 CLPA Probe Sets. L-Probe S-Probe Target
Mimic (1 nM) (1 nM) (10 pM) Ct Sample Identifier SEQ ID NO SEQ ID
NO SEQ ID NO value 1 MOAP-1 3 4 5 19.5 DNA 2 MOAP-1 3 4 6 20 RNA 3
DDB2 10 11 12 21 DNA 4 DDB2 10 11 13 21 RNA
TABLE-US-00004 TABLE 4 Reagent table-Example 1 1X PCR Buffer
Buffer* 12.5 ul S-Probe (1 nM) & L-Probe (1 nM) 2.5 ul each
Target Mimic (100 pM) 2.5 ul Water 5.0 ul Heat at 50 C. for 1 hour
*1X PCR buffer is 1.5 mM MgCL2, 50 mM KCl, 10 mM Tris-HCl pH
8.3
EXAMPLE 3
Direct Analysis of DDB2 RNA Transcripts in Lysis Buffer and Lysed
Blood
[0190] DDB2 messenger RNA (mRNA) was prepared using a in-vitro
transcription kit from Ambion and a cDNA vector plasmid from
Origene (SC122547). The concentration of mRNA was determined using
PicoGreen RNA assay kit from invitrogen. The DDB2 probe sets (Table
5) were tested with different concentrations of DDB2 mRNA
transcript spiked into either water or whole blood. The reactions
mixture components are listed in Table 5. Samples 1-4 consisted of
DDB2 transcript at 10 ng, 1 ng, 0.1 ng and 0.01 ng in water, and
samples 5-8 consisted of the same concentration range spiked into
whole blood. Similar reactions protocols were followed with the
exception of adding Proteinase K to the blood samples so as to
reduce protein coagulation. The procedure is as follows: The
reagents were added in the concentrations and volumes in Table 5.
The S-probes, mRNA transcript, Guanidine hydrochloride lysis buffer
and either water (samples 1-4) or whole blood (samples 5-8) were
heated to 80.degree. C. for 5 minutes and then they were moved to a
55.degree. C. heat block. The L-probe, wash buffer, streptavidin
beads and proteinase K were added, and the reaction was incubated
at 55.degree. C. for 60 minutes. The samples were removed from the
heat block and the magnetic beads were captured using a dynal MPC
96S magnetic capture plate. The supernatant was removed and the
beads were washed 3 times with wash buffer. DyNamo SYBR green PCR
master mix (25 ul, 1.times.) and universal primers (SEQ ID NOS 1
and 2, 300 nM) were added to the beads and samples were heat cycled
using a Stratagene MX4000 realtime PCR instrument for 30 cycles
(95.degree. C. for 15 minutes, 30 cycles 95.degree. C. (10 s),
60.degree. C(24 s), 72.degree. C(10 s)). The Ct values were
recorded and the amplified samples were injected into an Agilent
Bioanalyzer 2100 so as to verify the length of the amplicons. All
amplicons showed the correct size (.about.96 bp) and the
performance was comparable for the blood and water samples
demonstrating the ability to directly analyze RNA in lysed blood.
The results are summarizes in Table 7 below.
TABLE-US-00005 TABLE 5 CLPA Probe Sets. Sample Identifier L-Probe
(1 nM) S-Probe (1 nM) RNA Transcript 1-8 DDB2 SEQ ID NO: SEQ ID NO:
Origene Plasmid 10 11 SC122547
TABLE-US-00006 TABLE 6 DDB2 reaction mixture. Samples 1-4 5-8 GuHCL
Lysis Buffer (2X) 12.5 .mu.l 12.5 .mu.l S-Probe (5 nM) 1 .mu.l 1
.mu.l RNA Transcript (10 ng/ul to 1 .mu.l 1 .mu.l 0.01 ng/ul) Whole
Blood 0 .mu.l 12.5 .mu.l Water 12.5 ul 0 .mu.l Heat 80.degree. C.
for 5 min, chill on ice Wash Buffer 20 .mu.l 15 .mu.l L-Probe (5
nM) 1 .mu.l 1 .mu.l Dynal M-270 Beads 2 .mu.l 2 .mu.l Proteinase K
(10 mg/ml) 0 .mu.l 5 .mu.l Total 50 .mu.l 50 .mu.l Incubate
55.degree. C. for 60 min. a) GuHCL lysis buffer (1X) is 3M GUHCL,
20 mM EDTA, 5 mM DTT, 1.5% Triton, 30 mM Tris pH 7.2). b) Wash
Buffer is 100 mM Tris (pH 7.4), 0.01% Triton.
TABLE-US-00007 TABLE 7 Summary results of water versus blood Assay
DDB2 Conc Ct value Sample 1 10 ng 13.5 Water 2 1 ng 17 Water 3 0.1
ng 20.2 Water 4 0.01 ng 24 Water 5 10 ng 13.5 Blood 6 1 ng 16 Blood
7 0.1 ng 19.2 Blood 8 0.01 ng 23.5 Blood
EXAMPLE 4
3-probe CLPA-CE assay
[0191] Reactions were prepared in duplicate as presented in Table 8
using DNA target mimic probe SEQ ID NO 23 and the 3-probe CLPA
probe set (SEQ ID NOS 20, 21 and 22). The probe numbers refer to
the SEQ ID NOS in Table 1. The reagents were added in the
concentrations and volumes in Table 9. The S-probes, L-probe and
target mimics were heated to 50.degree. C. for 60 minutes in a 0.2
mL PCR tube, after which 2.5 .mu.l of the CLPA reaction was used as
template in a Dynamo SYBR green PCR reaction with 25 amplification
cycles. Real-time PCR data was averaged for the duplicate samples
and is presented in Table 8 (Ct value column). A 1 .mu.l sample of
each reaction was then analyzed via Agilent Bioanalyzer 2100 to
determine the size of the reaction product.
TABLE-US-00008 TABLE 8 CLPA Probe Sets. 3'-S 2L- 5'-S Target probe
Probe Probe Mimic Ampli- Sam- Identi- SEQ SEQ SEQ SEQ con Ct ples
fier ID NO ID NO ID NO ID NO size value 1&2 GAPDH 20 21 22 23
About 16.3 135 bp 3&4 Negative 20 21 22 23 None No ob- CT
served Probes at 1 nM concentration; target mimic at 10 pM
concentration.
TABLE-US-00009 TABLE 9 Reagent table-Example 1 1X PCR Buffer
Buffer* 12.5 .mu.l 3 and 5' S-Probe (10 nM) & 2L-Probe (10 nM)
2.5 .mu.l each Target Mimic (1 nM) 2.5 .mu.l Water 2.5 .mu.l Heat
at 50 C. for 1 hour *1X PCR buffer is 1.5 mM MgCL2, 50 mM KCl, 10
mM Tris-HCl pH 8.3
EXAMPLE 5
Multiplex Real-Time CLPA Detection of mRNA
[0192] In a 0.2 ml PCR tube was added 4 sets of CLPA reagents that
were engineered to possess unique binding sites for different color
dual labeled probes. The reactions were prepared as indicated in
Table 10 and Table 11. The CLPA probes sets and dual labeled probes
correspond to SEQ ID NOS 25 through 36 in Table 1. The S and
run-off transcript mRNA (GAPDH, PCNA and DDB2) were added to
2.times. lysis buffer (GuHCL lysis buffer (1.times.) is 3M GUHCL,
20 mM EDTA, 5 mM DTT, 1.5% Triton, 30 mM Tris pH 7.2) and heated to
80.degree. C. for 5 min. The samples were cooled on ice and
streptavidin coated magnetic beads (DYNAL M-270) and L-probe were
added. The samples were heated at 50.degree. C. for 1 hour. The
magnetic beads were captured on a DYNAL MPC plate and washed twice
with wash buffer. The beads were recaptured and dynamo PCR 1.times.
mastermix was added with the 4 different dual labeled probes and
universal PCR primers (25 ul total volume). The samples were heat
cycled using a Stratagene MX4000 realtime PCR instrument for 30
cycles (95.degree. C. for 15 minutes, 30 cycles 95.degree. C. (10
s), 60.degree. C. (24 s), 72.degree. C. (10 s)) with proper filters
for monitoring the fluorescence in the FAM, Cal Fluor orange 560,
Cal Fluor Red 610, and Quasar 670 channels. The Ct values observed
for each channel were recorded and are indicated in Table 10.
TABLE-US-00010 TABLE 10 Multiplex reagents used in Example 5. S
Probes L Probes (25 pM) (25 pM) Ct(FAM)- Ct(560)- Ct(610)- Ct(670)-
Samples SEQ ID NOs SEQ ID NOs Targets GAPDH3 DDB2 PCNA GAPDH4 1
& 2 26, 29, 25, 28, 250 ng yeast tRNA; 25.5 24.5 24.8 25.8 32,
35 31, 34 40 pg GAPDH(Origene SC118869), 40 pg PCNA (SC118528), 40
pg DDB2 (SC122547) mRNA 3 & 4 26, 29, 25, 28, 250 ng yeast tRNA
No Ct No Ct No Ct No Ct 32, 35 31, 34 (negative) 5 & 6 26, 29,
25, 28, 250 ng yeast tRNA; 22.1 24.5 22.1 22.2 32, 35 31, 34 40 pg
GAPDH(Origene SC118869), 40 pg PCNA (SC118528), 40 pg DDB2
(SC122547) mRNA 7 & 8 26, 29, 25, 28, 250 ng yeast tRNA No Ct
No Ct No Ct No Ct 32, 35 31, 34 (negative)
TABLE-US-00011 TABLE 11 Additional reagents used in Example 5.
GuHCL Lysis Buffer (2X) 12.5 .mu.l S-Probes (0.25 nM Stock of each)
5 .mu.l mRNAs (250 ng tRNA +/- mRNAs) 5 .mu.l Water 2.5 .mu.l Heat
80.degree. C. for 5 min, chill on ice Water 18 .mu.l L-Probes (0.25
nm stock of each) 5 .mu.l Beads 2 .mu.l Total 50 .mu.l Incubate
50.degree. C. 1 Hour
Sequence CWU 1
1
35119DNAArtificial SequenceDescription of Artificial primer
sequence synthetic 1gggttcccta agggttgga 19223DNAArtificial
SequenceDescription of Artificial primer sequence synthetic
2gtgccagcaa gatccaatct aga 23347DNAArtificial SequenceDescription
of Artificial probe sequence synthetic 3tacatccttc ctagtcaatt
acactctaga ttggatcttg ctggcac 47441DNAArtificial
SequenceDescription of Artificial sequence syntheticprobe
4gggttcccta agggttggat aggtaaatgg cagtgtagaa c 41546DNAArtificial
SequenceDescription of Artificial sequence syntheticoligonucleotide
5gtgtaattga ctaggaagga tgtagttcta cactgccatt taccta
46646RNAArtificial SequenceDescription of Artificial sequence
synthetic oligonucleotide 6guguaauuga cuaggaagga uguaguucua
cacugccauu uaccua 46745DNAArtificial SequenceDescription of
Artificial sequence syntheticprobe 7tggtttggtg cttcaaatac
tctctagatt ggatcttgct ggcac 45863DNAArtificial SequenceDescription
of Artificial sequence synthetic probe 8gggttcccta agggttggat
cgagtctaca gatccccaac tttcatagtc tgaaactttc 60tcc
63942DNAArtificial SequenceDescription of Artificial Sequence
syntheticoligonucleotide 9agtatttgaa gcaccaaacc aggagaaagt
ttcagactat ga 421041DNAArtificial SequenceDescription of Artificial
Sequence syntheticprobe 10tagcagacac atccaggctc tagattggat
cttgctggca c 411155DNAArtificial SequenceDescription of Artificial
Sequence synthetic probe 11gggttcccta agggttggat cgagtctact
ccaactttga ccaccattcg gctac 551236DNAArtificial SequenceDescription
of Artificial Sequence syntheticoligonucleotide 12gcctggatgt
gtctgctagt agccgaatgg tggtca 361336RNAArtificial
SequenceDescription of Artificial Sequence synthetic
oligonucleotide 13gccuggaugu gucugcuagu agccgaaugg ugguca
361438DNAArtificial SequenceDescription of Artificial probe
sequence synthetic 14tccgagattt ccccctctag attggatctt gctggcac
381537DNAArtificial SequenceDescription of Artificial probe
sequence synthetic 15gggttcccta agggttggat cccagactcc tccctct
371632DNAArtificial SequenceDescription of Artificial
oligonucleotide sequence synthetic 16gggggaaatc tcggaagagg
gaggagtctg gg 321739DNAArtificial SequenceDescription of Artificial
probe sequence synthetic 17tcacggtctg ccacgctcta gattggatct
tgctggcac 391853DNAArtificial SequenceDescription of Artificial
probe sequence synthetic 18gggttcccta agggttggat gagtctacat
gatccttccc gccacaaaga tgg 531932DNAArtificial SequenceDescription
of Artificial Sequence syntheticoligonucleotide 19cgtggcagac
cgtgaccatc tttgtggcgg ga 322051DNAArtificial SequenceDescription of
Artificial Sequence synthetic probe 20gggttcccta agggttggac
ggacgcctgc ttcaccacct tcttgatgtc a 512132DNAArtificial
SequenceDescription of Artificial Sequence synthetic probe
21tcatatttgg caggtttttc tagacggcag gt 322250DNAArtificial
SequenceDescription of Artificial Sequence synthetic probe
22caggtccacc actgacacgt tggcagttct agattggatc ttgctggcac
502389DNAArtificial SequenceDescription of Artificial sequence
synthetic oligonucleotide 23actgccaacg tgtcagtggt ggacctgacc
tgccgtctag aaaaacctgc caaatatgat 60gacatcaaga aggtggtgaa gcaggcgtc
892476DNAArtificial SequenceDescription of Artificial sequence
syntheticprobe 24ttttctagac ggcaggtcag gtccaccaga tgatcgacga
gacactctcg ccatctagat 60tggatcttgc tggcac 762579DNAArtificial
SequenceDescription of Artificial sequence synthetic probe
25gggttcccta agggttggac ggaccaactc ctcgccatat catctgtaca ccttcttgat
60gtcatcatat ttggcaggt 792635DNAArtificial SequenceDescription of
Artificial sequence syntheticprobe 26ccaactcctc gccatatcat
ctgtacacct tcttg 352778DNAArtificial SequenceDescription of
Artificial sequence synthetic probe 27tgctgatgat cttgaggctg
ttgtcatact gatgatcgac gagacactct cgccatctag 60attggatctt gctggcac
782875DNAArtificial SequenceDescription of Artificial Sequence
synthetic probe 28gggttcccta agggttggac gatggagttg atgctgacgg
aagtcatagt aagcagttgg 60tggtgcagga ggcat 752930DNAArtificial
SequenceDescription of Artificial Sequence syntheticprobe
29tgctgacgga agtcatagta agcagttggt 303077DNAArtificial
SequenceDescription of Artificial Sequence syntheticprobe
30tccttgagtg cctccaacac cttcttgagg atgatcgacg agacactctc gccatctaga
60ttggatcttg ctggcac 773177DNAArtificial SequenceDescription of
Artificial Sequence synthetic probe 31gggttcccta agggttggac
ggtacaacaa gacccagctg acgactctta atatcccagc 60aggcctcgtt gatgagg
773233DNAArtificial SequenceDescription of Artificial Sequence
syntheticprobe 32ctgacgactc ttaatatccc agcaggcctc gtt
333378DNAArtificial SequenceDescription of Artificial Sequence
syntheticprobe 33ttagttccaa gataaccttg gttccaggct gatgatcgac
gagacactct cgccatctag 60attggatctt gctggcac 783479DNAArtificial
SequenceDescription of Artificial Sequence syntheticprobe
34gggttcccta agggttggac gttagacgcc aataggagtt tcactggtgg ctaccaccca
60ctgagaggag aaaagtcat 793530DNAArtificial SequenceDescription of
Artificial Sequence syntheticprobe 35cgccaatagg agtttcactg
gtggctacca 30
* * * * *