U.S. patent application number 16/162161 was filed with the patent office on 2019-03-21 for massively parallel single cell analysis.
The applicant listed for this patent is Becton, Dickinson and Company. Invention is credited to Geoffrey Richard Facer, Christina Fan, Stephen P.A. Fodor, Glenn Fu, Julie Wilhelmy.
Application Number | 20190085412 16/162161 |
Document ID | / |
Family ID | 51519182 |
Filed Date | 2019-03-21 |
![](/patent/app/20190085412/US20190085412A1-20190321-D00001.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00002.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00003.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00004.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00005.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00006.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00007.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00008.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00009.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00010.png)
![](/patent/app/20190085412/US20190085412A1-20190321-D00011.png)
View All Diagrams
United States Patent
Application |
20190085412 |
Kind Code |
A1 |
Fan; Christina ; et
al. |
March 21, 2019 |
MASSIVELY PARALLEL SINGLE CELL ANALYSIS
Abstract
The disclosure provides for methods, compositions, and kits for
multiplex nucleic acid analysis of single cells. The methods,
compositions and systems may be used for massively parallel single
cell sequencing. The methods, compositions and systems may be used
to analyze thousands of cells concurrently. The thousands of cells
may comprise a mixed population of cells (e.g., cells of different
types or subtypes, different sizes).
Inventors: |
Fan; Christina; (San Jose,
CA) ; Fodor; Stephen P.A.; (Palo Alto, CA) ;
Fu; Glenn; (Dublin, CA) ; Facer; Geoffrey
Richard; (Redwood City, CA) ; Wilhelmy; Julie;
(Santa Cruz, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Becton, Dickinson and Company |
Franklin Lakes |
NJ |
US |
|
|
Family ID: |
51519182 |
Appl. No.: |
16/162161 |
Filed: |
October 16, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15459977 |
Mar 15, 2017 |
|
|
|
16162161 |
|
|
|
|
14872377 |
Oct 1, 2015 |
9637799 |
|
|
15459977 |
|
|
|
|
14472363 |
Aug 28, 2014 |
9567645 |
|
|
14872377 |
|
|
|
|
62012237 |
Jun 13, 2014 |
|
|
|
61952036 |
Mar 12, 2014 |
|
|
|
61871232 |
Aug 28, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6888 20130101;
C12Q 1/6876 20130101; C12Q 1/6881 20130101; C12Q 2600/158 20130101;
C12Q 2600/16 20130101; C12Q 1/6874 20130101; C12N 15/1093 20130101;
C12Q 1/6874 20130101; C12Q 2563/159 20130101; C12Q 2563/185
20130101 |
International
Class: |
C12Q 1/6888 20060101
C12Q001/6888; C12Q 1/6876 20060101 C12Q001/6876; C12Q 1/6881
20060101 C12Q001/6881; C12Q 1/6874 20060101 C12Q001/6874 |
Claims
1. A method comprising: introducing a single bead and a single cell
into a partition, wherein said single bead comprises a plurality of
oligonucleotides, wherein each of said plurality of
oligonucleotides comprises an identical cellular label sequence, a
molecular label sequence, and a target-binding region, wherein the
cellular label sequence comprises 4-300 nucleotides, wherein the
molecular label sequence comprises 4-300 nucleotides, and wherein
at least 100 of said plurality of oligonucleotides comprise
different molecular label sequences.
2. The method of claim 1, wherein the partition is a well or a
droplet.
3. The method of claim 1, comprising lysing said single cell after
introducing said single bead and said single cell into said
partition.
4. The method of claim 1, comprising lysing said single cell before
introducing said single bead and said single cell into said
partition.
5. The method of claim 1, comprising attaching target molecules
associated with said single cell to said plurality of
oligonucleotides.
6. The method of claim 5, wherein said attaching comprises
hybridizing the target molecules to the target-binding regions of
said plurality of oligonucleotides.
7. The method of claim 5, wherein said target molecules comprise
nucleic acid molecules.
8. The method of claim 7, wherein said attaching comprises
performing a nucleic acid extension reaction on the target
molecules attached to said plurality of oligonucleotides.
9. The method of claim 8, wherein the nucleic acid extension
reaction comprises a reverse transcription reaction.
10. The method of claim 8, wherein the nucleic acid extension
reaction is performed using a reverse transcriptase, a DNA
polymerase, or a combination thereof.
11. The method of claim 5, wherein said target molecules comprise a
messenger ribonucleic acid (mRNA) molecule.
12. The method of claim 5, wherein said target molecules comprise a
deoxyribonucleic acid (DNA) molecule.
13. The method of claim 5, wherein said target molecules comprise a
sample tag oligonucleotide.
14. The method of claim 13, wherein the sample tag oligonucleotide
is 25-300 nucleotides in length.
15. The method of claim 1, wherein the molecular label sequence is
4-30 nucleotides in length.
16. The method of claim 1, wherein the cellular label sequence is
4-30 nucleotides in length.
17. The method of claim 1, wherein at least 10,000 of said
plurality of oligonucleotides comprise different molecular label
sequences.
18. The method of claim 1, wherein about 1,000,000 of said
plurality of oligonucleotides comprise different molecular label
sequences.
19. The method of claim 13, comprising labeling the sample tag
oligonucleotide using an oligonucleotide of said plurality of
oligonucleotides.
20. The method of claim 1, comprising labeling target molecules
associated with said single cell using said plurality of
oligonucleotides.
21. The method of claim 20, wherein labeling target molecules
comprises stochastically labeling the target molecules associated
with said single cell using said plurality of oligonucleotides.
22. The method of claim 5, wherein a target molecule of said target
molecules is associated with said single cell via a peptide.
23. The method of claim 22, wherein the peptide comprises an
antibody.
24. The method of claim 22, comprising contacting the peptide with
said single cell, whereby the peptide binds to said single
cell.
25. The method of claim 1, wherein said target-binding region
comprises a sequence selected from the group consisting of an
oligo-dT sequence, a gene-specific sequence, a target-specific
sequence, a multimer sequence, a random multimer sequence, and a
complement thereof.
26. The method of claim 1, wherein said single bead comprises
silica gel, Wang resin, Merrifield resin, polydimethylsiloxane
(PDMS), polystyrene, glass, controlled pore glass, polypropylene,
agarose, gelatin, hydrogel, a paramagnetic material, ceramic,
plastic, glass, methylstyrene, acrylic polymer, titanium, latex,
Sephadex, Sepharose, cellulose, nylon, silicone, or a combination
thereof.
27. The method of claim 1, wherein said single bead is a hydrogel
bead, a magnetic bead, or a combination thereof.
28. The method of claim 23, comprising estimating the number of
said target molecules.
29. The method of claim 28, wherein said estimating comprises
counting the number of unique molecular label sequences associated
with a distinct target molecule of said target molecules associated
with said single cell.
30. The method of claim 13, comprising determining an origin of
said single cell based on the sequence of the sample tag
oligonucleotide, or a portion thereof.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. patent
application Ser. No. 15/459,977, filed on Mar. 15, 2017, which is a
continuation of U.S. patent application Ser. No. 14/872,377, filed
on Oct. 1, 2015, now U.S. Patent No. 9,637,799, which is a
continuation of U.S. patent application Ser. No. 14/472,363, filed
on Aug. 28, 2014, now U.S. Pat. No. 9,567,645, which claims the
benefit of U.S. Provisional Application No. 62/012,237, filed on
Jun. 13, 2014, U.S. Provisional Application No. 61/952,036, filed
on Mar. 12, 2014, and U.S. Provisional Application No. 61/871,232,
filed on Aug. 28, 2013. All of the aforementioned priority
applications are incorporated herein by reference in their
entireties.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Oct. 16, 2018, is named Sequence_Listing_BDCRI_006C9.txt and is
206 kilobytes in size.
BACKGROUND
[0003] Multicellular masses, such as tissues and tumors, may
comprise a heterogeneous cellular milieu. These complex cellular
environments may often display multiple phenoytpes, which may be
indicative of multiple genotypes. Distilling multicellular
complexity down to single cell variability is an important facet of
understanding multicellular heterogeneity. This understanding may
be important in the development of therapeutic regimens to combat
diseases with multiple resistance genotypes.
SUMMARY OF THE INVENTION
[0004] One aspect provided is a method, comprising obtaining a
sample comprising a plurality of cells; labeling at least a portion
of two or more polynucleotide molecules, complements thereof, or
reaction products therefrom, from a first cell of the plurality and
a second cell of the plurality with a first same cell label
specific to the first cell and a second same cell label specific to
the second cell; and a molecular label specific to each of the two
or more polynucleotide molecules, complements thereof, or reaction
products therefrom, wherein each molecular label of the two or more
polynucleotide molecules, complements thereof, or reaction products
therefrom, from the first cell are unique with respect to each
other, and wherein each molecular label of the two or more
polynucleotide molecules, complements thereof, or reaction products
therefrom, from the second cell are unique with respect to each
other. In some embodiments, the method further comprises sequencing
the at least a portion of two or more polynucleotide molecules,
complements thereof, or reaction products therefrom. In some
embodiments, the method further comprises analyzing sequence data
from the sequencing to identify a number of individual molecules of
the polynucleotides in a specific one of the cells. In some
embodiments, the cells are cancer cells. In some embodiments, the
cells are infected with viral polynucleotides. In some embodiments,
the cells are bacteria or fungi. In some embodiments, the
sequencing comprises sequencing with read lengths of at least 100
bases. In some embodiments, the sequencing comprises sequencing
with read lengths of at least 500 bases. In some embodiments, the
polynucleotide molecules are mRNAs or micro RNAs, and the
complements thereof and reaction products thereof are complements
of and reaction products therefrom the mRNAs or micro RNAs. In some
embodiments, the molecular labels are on a bead. In some
embodiments, the label specific to an individual cell is on a bead.
In some embodiments, the label specific to an individual cell and
the molecular labels are on beads. In some embodiments, the method
is performed at least in part in an emulsion. In some embodiments,
the method is performed at least in part in a well or microwell of
an array. In some embodiments, the presence of a polynucleotide
that is associated with a disease or condition is detected. In some
embodiments, the disease or condition is a cancer. In some
embodiments, at least a portion of a microRNA, complement thereof,
or reaction product therefrom is detected. In some embodiments, the
disease or condition is a viral infection. In some embodiments, the
viral infection is from an enveloped virus. In some embodiments,
the viral infection is from a non-enveloped virus. In some
embodiments, the virus contains viral DNA that is double stranded.
In some embodiments, the virus contains viral DNA that is single
stranded. In some embodiments, the virus is selected from the group
consisting of a pox virus, a herpes virus, a vericella zoster
virus, a cytomegalovirus, an Epstein-Barr virus, a hepadnavirus, a
papovavirus, polyomavirus, and any combination thereof. In some
embodiments, the first cell is from a person not having a disease
or condition and the second cell is from a person having the
disease or condition. In some embodiments, the persons are
different. In some embodiments, the persons are the same but cells
are taken at different time points. In some embodiments, the first
cell is from a person having the disease or condition and the
second cell is from the same person. In some embodiments, the cells
in the sample comprise cells from a tissue or organ. In some
embodiments, the cells in the sample comprise cells from a thymus,
white blood cells, red blood cells, liver cells, spleen cells, lung
cells, heart cells, brain cells, skin cells, pancreas cells,
stomach cells, cells from the oral cavity, cells from the nasal
cavity, colon cells, small intestine cells, kidney cells, cells
from a gland, brain cells, neural cells, glial cells, eye cells,
reproductive organ cells, bladder cells, gamete cells, human cells,
fetal cells, amniotic cells, or any combination thereof.
[0005] One aspect provided is a solid support comprising a
plurality of oligonucleotides each comprising a cellular label and
a molecular label, wherein each cellular label of the plurality of
oligonucleotides are the same, and each molecular label of the
plurality of oligonucleotides are different; and wherein the solid
support is a bead, the cellular label is specific to the solid
support, the solid support, when placed at the center of a three
dimensional Cartesian coordinate system, has oligonucleotides
extending into at least seven of eight octants, or any combination
thereof. In some embodiments, the plurality of oligonucleotides
further comprises at least one of a sample label; a universal
label; and a target nucleic acid binding region. In some
embodiments, the solid support comprises the target nucleic acid
binding region, wherein the target nucleic acid binding region
comprises a sequence selected from the group consisting of a
gene-specific sequence, an oligo-dT sequence, a random multimer,
and any combination thereof. In some embodiments, the solid support
further comprises a target nucleic acid or complement thereof. In
some embodiments, the solid support comprises a plurality of target
nucleic acids or complements thereof comprising from about 0.01% to
about 100% of transcripts of a transcriptome of an organism or
complements thereof, or from about 0.01% to about 100% of genes of
a genome of an organism or complements thereof. In some
embodiments, the cellular labels of the plurality of
oligonucleotides comprise a first random sequence connected to a
second random sequence by a first label linking sequence; and the
molecular labels of the plurality of oligonucleotides comprise
random sequences. In some embodiments, the solid support is
selected from the group consisting of a polydimethylsiloxane (PDMS)
solid support, a polystyrene solid support, a glass solid support,
a polypropylene solid support, an agarose solid support, a gelatin
solid support, a magnetic solid support, a pluronic solid support,
and any combination thereof. In some embodiments, the plurality of
oligonucleotides comprise a linker comprising a linker functional
group, and the solid support comprises a solid support functional
group; wherein the solid support functional group and linker
functional group connect to each other. In some embodiments, the
linker functional group and the solid support functional group are
individually selected from the group consisting of C6, biotin,
streptavidin, primary amine(s), aldehyde(s), ketone(s), and any
combination thereof. In some embodiments, molecular labels of the
plurality of oligonucleotides comprise at least 15 nucleotides.
[0006] One aspect provided is a kit comprising any of the solid
supports described herein, and instructions for use. In some
embodiments, the kit further comprises a well. In some embodiments,
the well is comprised in an array. In some embodiments, the well is
a microwell. In some embodiments, the kit further comprises a
buffer. In some embodiments, the kit is contained in a package. In
some embodiments, the package is a box. In some embodiments, the
package or box has a volume of 2 cubic feet or less. In some
embodiments, the package or box has a volume of 1 cubic foot or
less.
[0007] One aspect provided is an emulsion comprising any of the
solid supports described herein.
[0008] One aspect provided is a composition comprising a well and
any of the solid supports described herein.
[0009] One aspect provided is a composition comprising a cell and
any of the solid supports described herein.
[0010] In some embodiments, the emulsion or composition further
comprises a cell. In some embodiments, the cell is a single cell.
In some embodiments, the well is a microwell. In some embodiments,
the microwell has a volume ranging from about 1,000 .mu.m.sup.3 to
about 120,000 .mu.m.sup.3.
[0011] One aspect provided is a method, comprising contacting a
sample with any solid support disclosed herein, hybridizing a
target nucleic acid from the sample to an oligonucleotide of the
plurality of oligonucleotides. In some embodiments, the method
further comprises amplifying the target nucleic acid or complement
thereof. In some embodiments, the method further comprises
sequencing the target nucleic acid or complement thereof, wherein
the sequencing comprises sequencing the molecular label of the
oligonucleotide to which the target nucleic acid or complement
thereof is bound. In some embodiments, the method further comprises
determining an amount of the target nucleic acid or complement
thereof, wherein the determining comprises quantifying levels of
the target nucleic acid or complement thereof; counting a number of
sequences comprising the same molecular label; or a combination
thereof. In some embodiments, the method does not comprise aligning
any same molecular labels or any same cellular labels. In some
embodiments, the amplifying comprises reverse transcribing the
target nucleic acid. In some embodiments, the amplifying employs a
method selected from the group consisting of: PCR, nested PCR,
quantitative PCR, real time PCR, digital PCR, and any combination
thereof. In some embodiments, the amplifying is performed directly
on the solid support; on a template transcribed from the solid
support; or a combination thereof. In some embodiments, the sample
comprises a cell. In some embodiments, the cell is a single cell.
In some embodiments, the contacting occurs in a well. In some
embodiments, the well is a microwell and is contained in an array
of microwells.
[0012] One aspect provided is a device, comprising a plurality of
microwells, wherein each microwell of the plurality of microwells
has a volume ranging from about 1,000 .mu.m.sup.3 to about 120,000
.mu.m.sup.3. In some embodiments, each microwell of the plurality
of microwells has a volume of about 20,000 .mu.m.sup.3. In some
embodiments, the plurality of microwells comprises from about 96 to
about 200,000 microwells. In some embodiments, the microwells are
comprised in a layer of a material. In some embodiments, at least
about 10% of the microwells further comprise a cell. In some
embodiments, the device further comprises any of the solid supports
described herein.
[0013] One aspect provided is an apparatus comprising any of the
devices described herein, and a liquid handler. In some
embodiments, the liquid handler delivers liquid to the plurality of
microwells in about one second. In some embodiments, the liquid
handler delivers liquid to the plurality of microwells from a
single input port. In some embodiments, the apparatus further
comprises a magnet. In some embodiments, the apparatus further
comprises at least one of: an inlet port, an outlet port, a pump, a
valve, a vent, a reservoir, a sample collection chamber, a
temperature control apparatus, or any combination thereof. In some
embodiments, the apparatus comprises the sample collection chamber,
wherein the sample collection chamber is removable from the
apparatus. In some embodiments, the apparatus further comprises an
optical imager. In some embodiments, the optical imager produces an
output signal which is used to control the liquid handler. In some
embodiments, the apparatus further comprises a thermal cycling
mechanism configured to perform a polymerase chain reaction (PCR)
amplification of oligonucleotides.
[0014] One aspect provided is a method of producing a clinical
diagnostic test result, comprising producing the clinical
diagnostic test result with any device or apparatus described
herein; any solid support described herein; any method described
herein; or any combination thereof. In some embodiments, the
clinical diagnostic test result is transmitted via a communication
medium.
[0015] One aspect provided is a method of making any of the solid
supports described herein, comprising attaching to a solid support:
a first polynucleotide comprising a first portion of the cellular
label, and a first linker; andcontacting a second polynucleotide
comprising a second portion of the cellular label, a sequence
complementary to the first liker, and the molecular label. In some
embodiments, the third polynucleotide further comprises a target
nucleic acid binding region.
[0016] In some embodiments, an emulsion, microwell, or well
contains only one cell. In some embodiments, from 1 to 2,000,000
emulsions, microwells, or wells each contain only one cell. In some
embodiments, the method comprises distributing at most one cell
into each emulsion, microwell, or well. In some embodiments, a
single solid support and a single cell are distributed to an
emulsion, microwell, or well. In some embodiments, from 1 to
2,000,000 emulsions, microwells, or wells each have distributed
thereto one cell and one solid support. In some embodiments, the
method comprises distributing at most one solid support per
emulsion, microwell, or well. In some embodiments, the method
comprises distributing one solid support and one cell to each of
from 1 to 2,000,000 microwells, emulsions, or wells. In some
embodiments, cell distribution is random or non-random. In some
embodiments, cell distribution is stochastic. In some embodiments,
a cell is distributed by a cell sorter. In some embodiments, a cell
is distributed by contacting one or more wells, microwells, or
emulsions with a dilute solution of cells diluted so that at most
one cell is distributed to the one or more wells, microwells, or
emulsions.
[0017] In some embodiments, the target specific regions, target
specific regions of the plurality of oligonucleotides, or the
target specific region of the two or more polynucleotide molecules,
comprise sequences complementary to two or more targets of a target
panel. In some embodiments, the two or more targets of the target
panel are biomarkers. In some embodiments, the biomarkers are
biomarkers for a disease or condition. In some embodiments, the
disease or condition is a cancer, an infection, a viral infection,
an inflammatory disease, a neurodegenerative disease, a fungal
disease, a bacterial infection, or any combination thereof. In some
embodiments, the panel comprises from: 2-50,000, 2-40,000,
2-30,000, 2-20,000, 2-10,000, 2-9000, 2-8,000, 2-7,000, 2-6,000,
2-5,000, 2-1,000, 2-800, 2-700, 2-600, 2-500, 2-400, 2-300, 2-200,
2-100, 2-75, 2-50, 2-40, 2-30, 2-20, 2-10, or 2-5 biomarkers.
INCORPORATION BY REFERENCE
[0018] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings of which:
[0020] FIG. 1 depicts an exemplary solid support conjugated with an
exemplary oligonucleotide. FIG. 1 discloses "dT(17)V" as SEQ ID NO:
829.
[0021] FIG. 2A-C depicts an exemplary workflow for synthesizing
oligonucleotide coupled beads using split-pool synthesis.
[0022] FIG. 3 depicts an exemplary oligonucleotide coupled bead.
FIG. 3 discloses "dT(17)V" as SEQ ID NO: 829.
[0023] FIG. 4 illustrates an exemplary embodiment of a microwell
array.
[0024] FIG. 5 depicts an exemplary distribution of solid supports
in a microwell array.
[0025] FIG. 6A-C show exemplary distribution cells onto microwell
arrays. FIG. 6A shows the distribution of K562 cells (large cell
size). FIG. 6B shows the distribution of Ramos cells (small cell
size). FIG. 6C shows the distribution of Ramos cells and
oligonucleotide coupled beads onto microwell arrays, with solid
arrows pointing to the Ramos cells and dashed arrows pointing to
the oligonucleotide coupled beads.
[0026] FIG. 7 shows exemplary statistics of the microwell volume,
solid support volume, and amount of biological material obtained
from lysis.
[0027] FIG. 8A-C illustrates an exemplary embodiment of bead cap
sealing. FIG. 8A-B show images of a microarray well with cells and
oligonucleotide beads distributed into wells of a microarray well
and with larger sephadex beads used to seal the wells. Dotted
arrows point to the cells, dashed arrows point to the
oligonucleotide coupled beads and the solid arrows point to the
sephadex beads. FIG. 8C depicts a schematic of the cell and
oligonucleotide bead (e.g., oligobead) deposited within a well with
a sephadex bead used to seal the well.
[0028] FIG. 9 depicts a bar graph comparing amplification
efficiency of GAPDH and RPL19 amplified from microwells and tubes.
The grey bars represent data from the microwell. The white bars
represent data from the tube.
[0029] FIG. 10 depicts an agarose gel comparing amplification
specificity of three different genes directly on a solid
support.
[0030] FIG. 11A-I show graphical representations of the sequencing
results.
[0031] FIG. 12A-C show a histogram of the sequencing results for
the K562-only sample, Ramos-only sample, and K562+Ramos mixture
sample, respectively.
[0032] FIG. 12D-E shows a graph of the copy number for genes listed
in Table 3 for the Ramos-only cell sample and K562-only cell
sample, respectively.
[0033] FIG. 12F-I show the copy number for individual genes.
[0034] FIG. 12J-M show graphs of the number of unique molecules per
gene (y-axis) for the beads with the 100 unique barcode
combinations.
[0035] FIG. 12N-O show enlarged graphs of two beads that depict the
general pattern of gene expression profiles for the two cell
types.
[0036] FIG. 12P shows a scatter plot of results based on principal
component analysis of gene expression profile of 768 beads with
>30 molecules per bead from the K562+Ramos mixture sample.
[0037] FIG. 12Q-R show histograms of the copy number per amplicon
per bead for the K562-like cells (beads on the left of the first
principal component based on FIG. 12P) and Ramos-like cells (beads
on the right of the first principal component based on FIG. 12P),
respectively.
[0038] FIG. 12S-T show the copy number per bead or single cell of
the individual genes for the K562-like cells (beads on the left of
the first principal component based on FIG. 12P) and Ramos-like
cells (beads on the right of the first principal component based on
FIG. 12P), respectively.
[0039] FIG. 13A depicts general gene expression patterns for the
mouse and Ramos cells.
[0040] FIG. 13B-C show scatter plots of results based on principal
component analysis of gene expression profile of the high density
sample and low density sample, respectively.
[0041] FIG. 13D-E depict graphs of the read per barcode (bc)
combination (y-axis) versus the unique barcode combination, sorted
by the total number of molecules per bc combination (x-axis) for
Ramos-like cells and mouse-like cells from the high density sample,
respectively.
[0042] FIG. 13F-G depict graphs of the number of molecules per
barcode (bc) combination (y-axis) versus the unique barcode
combination, sorted by the total number of molecules per bc
combination (x-axis) for Ramos-like cells and mouse-like cells from
the high density sample, respectively.
[0043] FIG. 13H-I depict graphs of the read per barcode (bc)
combination (y-axis) versus the unique barcode combination, sorted
by the total number of molecules per barcode combination (x-axis)
for Ramos-like cells and mouse-like cells from the low density
sample, respectively.
[0044] FIG. 13J-K depict graphs of the number of molecules per
barcode combination (y-axis) versus the unique barcode combination,
sorted by the total number of molecules per barcode combination
(x-axis) for Ramos-like cells and mouse-like cells from the low
density sample, respectively.
[0045] FIG. 14 shows a graph depicting the genes on the X-axis and
the log 10 of the number of reads.
[0046] FIG. 15A shows a graph of the distribution of genes detected
per three-part cell label (e.g., cell barcode). FIG. 15B shows a
graph of the distribution of unique molecules detected per bead
(expressing the gene panel).
[0047] FIG. 16 depicts the cell clusters based on the genes
associated with a cell barcode.
[0048] FIG. 17A-D show the analysis of monocyte specific markers.
FIG. 17E shows the cell cluster depicted in FIG. 16.
[0049] FIG. 18A-B show the analysis of the T cell specific markers.
FIG. 18C shows the cell cluster depicted in FIG. 16.
[0050] FIG. 19A-B show the analysis of the CD8+ T cell specific
markers. FIG. 19C shows the cell cluster depicted in FIG. 16.
[0051] FIG. 20A shows the analysis of CD4+ T cell specific markers.
FIG. 20B shows the cell cluster depicted in FIG. 16.
[0052] FIG. 21A-D show the analysis of Natural Killer (NK) cell
specific markers. FIG. 21E shows the cell cluster depicted in FIG.
16.
[0053] FIG. 22A-E show the analysis of B cell specific markers.
FIG. 22F shows the cell cluster depicted in FIG. 16.
[0054] FIG. 23A-F show the analysis of Toll-like receptors.
Toll-like receptors are mainly expressed by monocytes and some B
cells. FIG. 23G shows the cell cluster depicted in FIG. 16.
[0055] FIG. 24 depicts a graph of the genes versus the log 10 of
the number of reads.
[0056] FIG. 25A-D shows graphs of the molecular barcode versus the
number of reads or log 10 of the number of reads for two genes.
[0057] FIG. 26A shows a graph of the number of genes in the panel
expressed per cell barcode versus the number of unique cell
barcodes/single cell. FIG. 26B shows a histogram of the number of
unique molecules detected per bead versus frequency of the number
of cells per unique cell barcode carrying a given number of
molecules. FIG. 26C shows a histogram of the number of unique GAPDH
molecules detected per bead versus frequency of the number of
cells/unique cell barcode carrying a given number of molecules.
[0058] FIG. 27 shows a scatterplot of the 856 cells.
[0059] FIG. 28 shows a heat map of expression of the top 100 (in
terms of the total number of molecules detected).
[0060] FIG. 29 shows a workflow for Example 12.
[0061] FIG. 30 shows a workflow for Example 13. FIG. 30 discloses
"dT(17)V" as SEQ ID NO: 829 and "AAAAAAAAAA" as SEQ ID NO: 830.
[0062] FIG. 31A-C. Clustering of single cells in controlled
mixtures containing two distinct cell types. FIG. 31A. Clustering
of a 1:1 mixture of K562 and Ramos cells by principal component
analysis of the expression of 12 genes. The biplot shows two
distinct clusters, with one cluster expressing Ramos specific genes
and the other expressing K562 specific genes. FIG. 31B. Principal
component analysis of a mixture containing a small percentage of
Ramos cells in a background of primary B cells from a healthy
individual using a panel of 111 genes. The color of each data point
indicates the total number of unique transcript molecules detected
across the entire gene panel. A set of 18 cells (circled) out of
1198 cells displays a distinct gene expression profile and with
much higher transcription levels. FIG. 31C. Heatmap showing
expression level of each gene in the top 100 cells in the sample of
FIG. 31B, ranked by the total number of transcript molecules
detected in the gene panel. Genes are ordered via hierarchical
clustering in terms of correlation. The top 18 cells, indicated by
the horizontal red bar, expressed preferentially a set of genes
known to be associated with follicular lymphoma, as indicated by
the vertical red bar.
[0063] FIG. 31D. PCA analysis of primary B cells with spiked in
Ramos cells. Color of each data point (single cell) indicates the
log of the number of transcript molecules each cell carries for the
particular gene. Top 7 rows: Genes that are preferentially
expressed by the subset of 18 cells that are likely Ramos cells.
First row genes (from left to right) include GAPDH, TCL1A, MKI67
and BCL6. Second row genes (from left to right) include MYC, CCND3,
CD81 and GNAI2. Third row of genes (from left to right) include
IGBP1, CD20, BLNK and DOCKS. Fourth row of genes (from left to
right) include IRF4, CD22, IGHM and AURKB. Fifth row of genes (from
left to right) include CD38, CD10, LEFT and AICDA. Sixth row of
genes (from left to right) include CD40, CD27, IL4R and PRKCD.
Seventh row of genes (from left to right) include RGS1, MCL1, CD79a
and HLA-DRA. Last row: Genes that are expressed preferentially by a
subset of primary B cells but not especially enriched in those 18
cells. Genes in the last row (from left to right) include IL6,
CD23a, CCR7 and CXCR5.
[0064] FIG. 32 Expression of GAPDH. Color indicates natural log of
the number of unique transcript molecules observed per cell.
[0065] FIG. 33A-F shows the principal component analysis (PCA) for
monocyte associated genes. FIG. 33A shows the PCA for CD16. FIG.
33B shows the PCA for CCRvarA. FIG. 33C shows the PCA for CD14.
FIG. 33D shows the PCA for S100A12. FIG. 33E shows the PCA for
CD209. FIG. 33F shows the PCA for IFNGR1.
[0066] FIG. 34A-B shows the principal component analysis (PCA) for
pan-T cell markers (CD3). FIG. 34A shows the PCA for CD3D and FIG.
34B shows the PCA for CD3E.
[0067] FIG. 35A-E shows the principal component analysis (PCA) for
CD8 T cell associated genes. FIG. 35A shows the PCA for CD8A. FIG.
35B shows the PCA for EOMES. FIG. 35C shows the PCA for CD8B. FIG.
35D shows the PCA for PRF1. FIG. 35E shows the PCA for RUNX3.
[0068] FIG. 36A-C shows the principal component analysis (PCA) for
CD4 T cell associated genes. FIG. 36A shows the PCA for CD4. FIG.
36B shows the PCA for CCR7. FIG. 36C shows the PCA for CD62L.
[0069] FIG. 37A-F shows the principal component analysis (PCA) for
B cell associated genes. FIG. 37A shows the PCA for CD20. FIG. 37B
shows the PCA for IGHD. FIG. 37C shows the PCA for PAX5. FIG. 37D
shows the PCA for TCL1A. FIG. 37E shows the PCA for IGHM. FIG. 37F
shows the PCA for CD24.
[0070] FIG. 38A-C shows the principal component analysis (PCA) for
Natural Killer cell associated genes. FIG. 38A shows the PCA for
KIR2DS5. FIG. 38B shows the PCA for CD16. FIG. 38C shows the PCA
for CD62L.
[0071] FIG. 39 Simultaneous identification of major cell types in a
human PBMC sample (632 cells) by PCA analysis of 81 genes assayed
by CytoSeq Cells with highly correlated expression profile are
coded with similar color.
[0072] FIG. 40A-B Correlation analysis of single cell gene
expression profile of PBMC sample. 40A. A matrix showing the
pairwise correlation coefficient across 632 cells in the sample.
The cells are ordered such that those with highly correlated gene
expression profile are grouped together. FIG. 40B. Heatmap showing
the expression of each gene by each cell. The cells (columns) are
ordered in the same manner as the correlation matrix above. The
genes (rows) are ordered such that genes that share highly similar
expression pattern across the cells are grouped together. The cell
type of each cluster of cells may be identified by the group of
genes the cells co-expressed. Within each major cell cluster, there
is substantial degree of heterogeneity in terms of gene
expression.
[0073] FIG. 41 data represents that of 731 cells from a replicate
experiment of PBMC sample from the same donor. Cells with similar
gene expression profile (based on hierarchical clustering using
correlation coefficient) are plotted with similar color.
[0074] FIG. 42 shows a heat map demonstrating the correlation in
gene expression profile between genes.
[0075] FIG. 43 Description of CytoSeq. FIG. 43A. Experimental
procedure for CytoSeq. FIG. 43B. Structure of oligonucleotides
attached to beads.
[0076] FIGS. 44A-C illustrate dissecting sub-populations of CD3+ T
cells. FIG. 44A. PCA of Donor 1 unstimulated sample reveals two
major branches of cells. The expression level (log of unique
transcript molecule) of a particular gene within each cell is
indicated with color. Helper T cell associated cytokine and
effector genes are enriched in cells in the lower branch, while
cytotoxic T cell associated genes are enriched in the upper branch.
Shown here are representative genes. First row shows helper T cell
related genes and include (from left to right) CD4, SELL and CCR7.
Second row shows cytotoxic T cell related genes and include (from
left to right) CD8A, NKG2D and EOMES. FIG. 44B. PCA of Donor 1
anti-CD3/anti-CD28 stimulated sample showing enrichment of
expression of indicated genes to one of the two main branches
representing helper and cytotoxic T cells. These genes are present
at low amounts in the unstimulated sample. First two rows show
genes that are known to be associated with activated T cells and
include (from left to right) in the first row IRF4, CD69 and MYC
and in the second row GAPDH, TNF and IFNG. The third row shows
genes that are known to be associated with activated helper T cells
and include (from left to right) IL2, LTA and CD40LG. The fourth
row shows genes that are known to be associated with activated
cytotoxic T cells and include (from left to right) CCL4, CCL3 and
GZMB. FIG. 44C. Number of cells that contribute to the overall
expression level of genes that exhibit large fold-changes when
comparing stimulated over unstimulated samples in aggregate data.
For several cytokines (red arrows), the contribution from only a
small number of cells is responsible for large overall gene
expression change in the entire population.
[0077] FIGS. 45A-C illustrate PCA plots of T cell samples that have
undergone stimulation with anti-CD28/anti-CD3 beads in the two
donors, and the corresponding unstimulated samples, with emphasis
on the expression of genes that clearly show preferential
expression in either helper or cytotoxic subsets in the
unstimulated samples. The color of each data point (single cell)
indicates log(number of unique transcript molecule) per cell for
the indicated gene. For each pair of stimulated and unstimulated
graphs in each donor, the color range is adjusted to be the same.
FIG. 45A. Genes that are known to be associated with both helper
and cytotoxic T cells. FIG. 45B. Genes that are known to be
associated with cytotoxic T cells. FIG. 45C. Genes that are known
to be associated with helper T cells.
[0078] FIG. 46A-D PCA plots of T cell samples that have undergone
stimulation with anti-CD28/anti-CD3 beads in the two donors, and
the corresponding unstimulated samples, with emphasis on the
expression of genes that are expressed in the stimulated samples
but at low or undetectable level in the unstimulated samples. The
color of each data point (single cell) indicates log(number of
unique transcript molecule) per cell for the indicated gene. For
each pair of stimulated and unstimulated graphs in each donor, the
color range is adjusted to be the same. 46A and 46D. Genes that are
expressed by both branches of cells upon activation. 46B. Genes
that are expressed preferentially by cells in the upper branch upon
activation. These genes are known to be associated with activated
cytotoxic T cells. 46C. Genes that are expressed preferentially by
cells in the lower branch upon activation. These genes are known to
be associated with activated helper T cells.
[0079] FIG. 47 Clustering of data from Donor 1's unstimulated CD3+
T cells shows separations of CD4 and CD8 cells, as well as a group
of cells that express Granzyme K and Granzyme A but little CD8.
Top: Heatmap showing correlation between each pair of cells. Cells
that are highly correlated are grouped together. Bottom: Heatmap
showing the level of expression of each gene of each cell. Cells
and genes are ordered via bidirectional hierarchical
clustering.
[0080] FIG. 48. Similar to FIG. 47, but showing data from
anti-CD3/anti-CD28 stimulated CD3+ T cell sample of Donor 1. Top:
Heatmap showing correlation between each pair of cells. Cells that
are highly correlated are grouped together. Bottom: Heatmap showing
the level of expression of each gene of each cell. Cells and genes
are ordered via bidirectional hierarchical clustering.
[0081] FIG. 49A-C In donor 1, large overall fold change was
observed for various cytokines in the antiCD28/antiCD3 stimulated
sample, as compared to the unstimulated one. FIGS. A-B: The large
fold changes of these cytokines were mostly contributed by only a
few single cells (dots that are enclosed with squares or circles).
A number of these cytokines were contributed by the same small
number of cells. FIG. 49C: The co-expression patterns of these
cytokines coincide with the signature cytokine combination for the
Th2 and Th17 subsets of helper T cells.
[0082] FIG. 50A-B. Dissecting sub-populations of CD8+ T cells. FIG.
50A. Clustering of CytoSeq data defines two major groups of CD8+
cells--one group expresses genes shared by central memory/naive
cells, and the other group expresses genes shared by effector
memory/effector cells. Shown here is data of Donor 2's unstimulated
sample. Top: Heatmap showing correlation between each pair of
cells. Bottom: Heatmap showing the level of expression of each gene
in each cell. Cells and genes are ordered via bidirectional
hierarchical clustering. FIG. 50B. Identification of rare antigen
specific T cell by expression of gamma interferon (IFNG) in CD8+ T
cells from two donors after stimulation with CMV peptide pool. Each
cell is plotted on the 2D principal component space. Cells
expressing IFNG (circled) are usually among those with the most
total detected transcripts in the panel (indicated by the color).
In donor 2, the top expressing cell (square) does not produce IFNG
but expresses cytokines IL6 and IL1B. Number next to each circle
indicates the rank in descending order the number of total unique
transcript molecules detected for that cell.
[0083] FIG. 51. Similar to FIG. 50A except the data here represents
that of Donor 2 CMV stimulated sample. A. Clustering of CytoSeq
data defines two major groups of CD8+ cells--one group expresses
genes shared by central memory/naive cells, and the other group
expresses genes shared by effector memory/effector cells. Shown
here is data of Donor 2's unstimulated sample. Top: Heatmap showing
correlation between each pair of cells. Bottom: Heatmap showing the
level of expression of each gene in each cell. Cells and genes are
ordered via bidirectional hierarchical clustering.
[0084] FIGS. 52A-F illustrate data plotted in principal component
space. Color indicates log(number of unique transcript molecules
detected) for the particular gene. FIG. 52A. Genes that appear to
be expressed by a larger proportion of cells upon stimulation by
CMV peptide pool. FIG. 52B. Genes that are enriched in one branch
of cells. These genes are also known to be associated with naive
and central memory CD8+ T cells. FIG. 52C. Genes that are enriched
in the other branch of cells. These genes are known to be
associated with effector and effector memory CD8+ T cells. FIG.
52D. Granzyme K expressing cells occupy a region between the
naive/central memory and effector/effector memory cells on the PC
space. FIG. 52E. HLA-DRA expressing cells constitute a special
subset. FIG. 52F. Genes that are expressed in both branches of
cells.
[0085] FIG. 53. Same as FIG. 50B, except the data represents those
of the unstimulated controls. None of the cells in Donor 1's sample
expressed IFNG, while one cell in Donor 2's sample expressed IFNG
yet with overall low expression across the entire gene panel (rank
1069). Color scale is adjusted to match that of the respective
graph for the stimulated sample.
[0086] FIG. 54. Heatmaps showing the heterogeneous expression of
the gene panel in cells that express gamma interferon (IFNG) in CMV
stimulated CD8+ T cells of Donors 1 and 2. Also shown is the cell
that carries most total transcripts detected in Donor 2. This
particular cell does not express IFNG but expresses strongly IL6,
IL1B and CCL4. The cells and genes are ordered by bidirectional
hierarchical clustering based on correlation. Cell ID refers to the
rank in total number of detected transcripts of the gene panel, and
are indicated in the PCA plots in FIG. 50.
[0087] FIG. 55. Amplification scheme. The first PCR amplifies
molecules attached to the bead using a gene specific primer and a
primer against the universal Illumina sequencing primer 1 sequence.
The second PCR amplifies the first PCR products using a nested gene
specific primer flanked by Illumina sequencing primer 2 sequence,
and a primer against the universal Illumina sequencing primer 1
sequence. The third PCR adds P5 and P7 and sample index to turn PCR
products into Illumina sequencing library. 150 bp.times.2
sequencing reveals the cell label and molecule label on read 1, the
gene on read 2, and the sample index on index 1 read.
[0088] FIG. 56 depicts a schematic of a workflow for analyzing
molecules from a sample. FIG. 56 discloses
"AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA" as SEQ ID NO: 831.
[0089] FIG. 57 depicts a schematic of a workflow for analyzing
molecules from a sample.
[0090] FIG. 58A-B depict agarose gels of PCR products.
[0091] FIG. 59 depicts a plot of sequencing reads for a plurality
of genes.
[0092] FIG. 60A-D depicts plots of the reads observed per label
detected (RPLD) for Lys, Phe, Thr, and Dap spike-in controls,
respectively. FIG. 60E depicts a plot of Reads versus Input.
[0093] FIG. 61 depicts a plot of the reads observed per label
detected (RPLD) for various genes.
[0094] FIG. 62 depicts a plot of the reads observed per label
detected (RPLD) for various genes.
[0095] FIG. 63 depicts a plot of total reads (labels) versus rpld
for various genes.
[0096] FIG. 64 depicts a plot of RPKM for undetected genes.
[0097] FIG. 65 depicts a schematic for the synthesis of molecular
barcodes. FIG. 65 discloses "1001" as SEQ ID NO: 832 and "1003" as
SEQ ID NO: 833 and "1005" as SEQ ID NOS 832 and 833, respectively,
in order of appearance.
[0098] FIG. 66A-C depict schematics for the synthesis of molecular
barcodes. FIG. 66A discloses "1121" as SEQ ID NO: 834, "1127" as
SEQ ID NO: 835, "1128" as SEQ ID NO: 836 and "1129" as SEQ ID NO:
837. FIG. 66B discloses "1150" as SEQ ID NO: 838, "1159" as SEQ ID
NO: 839 and "1158" as SEQ ID NO: 840. FIG. 66C discloses "1170" as
SEQ ID NO: 841, "1176" as SEQ ID NO: 842 and "1177" as SEQ ID NO:
843.
[0099] FIG. 67 shows a schematic of a workflow for stochastically
labeling nucleic acids. FIG. 67 discloses
"AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA" as SEQ ID NO: 831.
[0100] FIG. 68 is a schematic of a workflow for stochastically
labeling nucleic acids. FIG. 68 discloses
"AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA" as SEQ ID NO: 831.
[0101] FIG. 69 illustrates a mechanical fixture within which
microwell array substrates may be clamped, thereby forming a
reaction chamber or well into which samples and reagents may be
pipetted for performing multiplexed, single cell stochastic
labeling/molecular indexing experiments. Upper: exploded view
showing the upper and lower parts of the fixture and an elastomeric
gasket for forming a leak-proof seal with the microwell array
substrate. Lower: exploded side-view of the fixture.
[0102] FIG. 70 illustrates a mechanical fixture which creates two
reaction chambers or wells when a microwell array substrate is
clamped within the fixture.
[0103] FIG. 71 illustrates two examples of elastomeric (e.g.,
polydimethylsiloxane) gaskets for use with the mechanical fixtures
illustrated in FIGS. 69 and 70. The elastomeric gaskets provide for
a leak-proof seal with the microwell array substrate to create a
reagent well around the microwell array. The gaskets may contain
one (upper), two (lower), or more openings for creating reagent
wells.
[0104] FIG. 72 depicts one embodiment of a cartridge within which a
microwell array is packaged. Left: An exploded view of the
cartridge illustrating (from bottom to top) the microwell array
substrate, a gasket that defines the flow cell or array chamber, a
reagent and/or waste reservoir component for defining compartments
to contain pre-loaded assay reagents or store spent reagents, and a
cover for sealing the reagent and waste reservoirs and defining the
sample inlet and outlet ports. Right: An assembled view of one
embodiment of the cartridge design illustrating relief for bringing
an external magnet into close proximity with the microwell
array.
[0105] FIG. 73 depicts one embodiment of a cartridge designed to
include onboard assay reagents with the packaged microwell
array.
[0106] FIG. 74 provides a schematic illustration of an instrument
system for performing multiplexed, single cell stochastic
labeling/molecular indexing assay. The instrument system may
provide a variety of control and analysis capabilities, and may be
packaged as individual modules or as a fully integrated system.
Microwell arrays may be integrated with flow cells that are either
a fixed component of the system or are removable, or may be
packaged within removable cartridges that further comprise
pre-loaded assay reagent reservoirs and other functionality.
[0107] FIG. 75 illustrates one embodiment of the process steps to
be performed by an automated system for performing multiplexed,
single cell stochastic labeling/molecular indexing assays.
[0108] FIG. 76 illustrates one embodiment of a computer system or
processor for providing instrument control and data analysis
capabilities for the assay system presently disclosed.
[0109] FIG. 77 shows a block diagram illustrating one example of a
computer system architecture that can be used in connection with
example embodiments of the assay systems of the present
disclosure.
[0110] FIG. 78 depicts a diagram showing a network with a plurality
of computer systems, cell phones, personal data assistants, and
Network Attached Storage (NAS), that can be used with example
embodiments of the assay systems of the present disclosure.
[0111] FIG. 79 depicts a block diagram of a multiprocessor computer
system that can be used with example embodiments of the assay
systems of the present disclosure.
[0112] FIG. 80 depicts a diagram of analysis of a test sample and
communication of test result obtained from the test sample via a
communication media.
DETAILED DESCRIPTION
[0113] Disclosed herein are methods, kits, and compositions for
analyzing molecules in a plurality of samples. Generally, the
methods, kits, and compositions comprise (a) stochastically
labeling molecules in two or more samples with molecular barcodes
to produce labeled molecules; and (b) detecting the labeled
molecules. The molecular barcodes may comprise one or more target
specific regions, label regions, sample index regions, universal
PCR regions, adaptors, linkers, or a combination thereof. The
labeled molecules may comprise a) a molecule region; b) a sample
index region; and c) a label region. The molecule region may
comprise at least a portion of the molecule from the molecular
barcode was originally attached to. The molecule region may
comprise a fragment of the molecule from the molecular barcode was
originally attached to. The sample index region may be used to
determine the source of the molecule region. The sample index
region may be used to determine from which sample the molecule
region originated from. The sample index region may be used to
differentiate molecule regions from two or more different samples.
The label region may be used to confer a unique identity to
identical molecule regions originating from the same source. The
label region may be used to confer a unique identity to identical
molecule regions originating from the same sample.
[0114] The method for analyzing molecules in a plurality of samples
may comprise: a) producing a plurality of sample-tagged nucleic
acids by: i) contacting a first sample comprising a plurality of
nucleic acids with a plurality of first sample tags to produce a
plurality of first sample-tagged nucleic acids; and ii) contacting
a second sample comprising a plurality of nucleic acids with a
plurality of second sample tags to produce a plurality of second
sample-tagged nucleic acids, wherein the plurality of second sample
tags are different from the first sample tags; b) contacting the
plurality of sample-tagged nucleic acids with a plurality of
molecular identifier labels to produce a plurality of labeled
nucleic acids; and c) detecting at least a portion of the labeled
nucleic acids, thereby determining a count of a plurality of
nucleic acids in a plurality of samples. The plurality of samples
may comprise a single cell.
[0115] Alternatively, the method for analyzing molecules in a
plurality of samples may comprise: a) producing a plurality of
labeled nucleic acids comprising: i) contacting a first sample with
a first plurality of sample tags, wherein the first plurality of
sample tags comprises identical nucleic acid sequences; ii)
contacting the first sample with a first plurality of molecular
identifier labels may comprise different nucleic acid sequences,
wherein contacting the first sample with the first plurality of
sample tags or first plurality of molecular identifier labels
occurs simultaneously or sequentially to produce a plurality of
first-labeled nucleic acids; iii) contacting a second sample with a
second plurality of sample tags, wherein the second plurality of
sample tags may comprise identical nucleic acid sequences; iv)
contacting the second sample with a second plurality of molecular
identifier labels may comprise different nucleic acid sequences,
wherein contacting the second sample with the second plurality of
sample tags or second plurality of molecular identifier labels
occurs simultaneously or sequentially to produce a plurality of
second-labeled nucleic acids, wherein the plurality of labeled
nucleic acids may comprise the plurality of first-labeled nucleic
acids and the second-labeled nucleic acids; and b) determining a
number of different labeled nucleic acids, thereby determining a
count of a plurality of nucleic acids in a plurality of
samples.
[0116] The method for analyzing molecules in a plurality of samples
may comprise: a) contacting a plurality of samples may comprise two
or more different nucleic acids with a plurality of sample tags and
a plurality of molecular identifier labels to produce a plurality
of labeled nucleic acids, wherein: i) the plurality of labeled
nucleic acids may comprise two or more nucleic acids attached to
two or more sample tags and two or more molecular identifier
labels; ii) the sample tags attached to nucleic acids from a first
sample of the plurality of samples are different from the sample
tags attached to nucleic acid molecules from a second sample of the
plurality of samples; and iii) two or more identical nucleic acids
in the same sample are attached to two or more different molecular
identifier labels; and b) detecting at least a portion of the
labeled nucleic acids, thereby determining a count of two or more
different nucleic acids in the plurality of samples.
[0117] FIG. 56 depicts an exemplary workflow for the quantification
of RNA molecules in a sample. As shown in Step 1 of FIG. 56, RNA
molecules (110) may be reverse transcribed to produce cDNA
molecules (105) by the stochastic hybridization of a set of
molecular identifier labels (115) to the polyA tail region of the
RNA molecules. The molecular identifier labels (115) may comprise
an oligodT region (120), label region (125), and universal PCR
region (130). The set of molecular identifier labels may contain
960 different types of label regions. As shown in Step 2 of FIG.
56, the labeled cDNA molecules (170) may be purified to remove
excess molecular identifier labels (115). Purification may comprise
Ampure bead purification. As shown in Step 3 of FIG. 56, the
labeled cDNA molecules (170) may be amplified to produce a labeled
amplicon (180). Amplification may comprise multiplex PCR
amplification. Amplification may comprise a multiplex PCR
amplification with 96 multiplex primers in a single reaction
volume. Amplification may comprise a custom primer (135) and a
universal primer (140). The custom primer (135) may hybridize to a
region within the cDNA (105) portion of the labeled cDNA molecule
(170). The universal primer (140) may hybridize to the universal
PCR region (130) of the labeled cDNA molecule (170). As shown in
Step 4, the labeled amplicons (180) may be further amplified by
nested PCR. The nested PCR may comprise multiplex PCR with 96
multiplex primers in a single reaction volume. Nested PCR may
comprise a custom primer (145) and a universal primer (140). The
custom primer (135) may hybridize to a region within the cDNA (105)
portion of the labeled amplicon (180). The universal primer (140)
may hybridize to the universal PCR region (130) of the labeled
amplicon (180). As shown in Step 5, one or more adaptors (150, 155)
may be attached to the labeled amplicon (180) to produce an
adaptor-labeled amplicon (190). The one or more adaptors may be
attached to the labeled amplicon (180) via ligation. As shown in
Step 6, the one or more adaptors (150, 155) may be used to conduct
one or more additional assays on the adaptor-labeled amplicon
(190). The one or more adaptors (150, 155) may be hybridized to one
or more primers (160, 165). The one or more primers (160, 165) be
PCR amplification primers. The one or more primers (160, 165) may
be sequencing primers. The one or more adaptors (150, 155) may be
used for further amplification of the adaptor-labeled amplicons.
The one or more adaptors (150, 155) may be used for sequencing the
adaptor-labeled amplicon.
[0118] FIG. 57 depicts an exemplary schematic of a workflow for
analyzing nucleic acids from two or more samples. As shown in FIG.
57, a method for analyzing nucleic acids from two or more samples
may comprise selecting two or more genes for analysis and designing
custom primers based on the selected genes (210). The method may
further comprise supplementing one or more samples comprising
nucleic acids (e.g., RNA) with one or more spike-in controls (220).
The nucleic acids in the sample may be amplified by multiplex
RT-PCR (230) with molecular barcodes (or sample tags or molecular
identifier labels) and the custom primers to produce labeled
amplicons. The labeled amplicons may further treated with one or
more sequencing adaptors to produce adaptor labeled amplicons
(240). The adaptor labeled amplicons can be analyzed (250). As
shown in FIG. 57, analysis of the labeled amplicons (250) may
comprise one or more of (1) detection of a universal PCR primer
seq, polyA and/or molecular barcode (or sample tag, molecular
identifier label); (2) map read on the end of the adaptor labeled
amplicons (e.g., 96 genes and spike-in controls) that is not
attached to the adaptor and/or barcode (e.g., molecular barcode,
sample tag, molecular identifier label); and (3) count and/or
summarize the number of different adaptor labeled amplicons.
[0119] FIG. 67 shows a schematic of a workflow for stochastically
labeling nucleic acids with molecular barcodes (1220). As shown in
step 1 of FIG. 67, RNA molecules may be stochastically labeled with
a set of molecular barcodes (1220). The molecular barcodes (1220)
may comprise a target binding region (1221), label region (1222),
sample index region (1223) and universal PCR region (1224). In some
instances, the target binding region comprises an oligodT sequence
that hybridizes to a polyA sequence in the RNA molecules. The label
region (1222) may contain a unique sequence that may be used to
distinguish two or more different molecular barcodes. When the
molecular barcode hybridizes to an RNA molecule, the label region
may be used to confer a unique identity to identical RNA molecules.
The sample index region (1223) may be identical for a set of
molecular barcodes. The sample index region (1223) may be used to
distinguish labeled nucleic acids from different samples. The
universal PCR region (1224) may serve as a primer binding site for
amplification of the labeled molecules. Once the RNA molecules are
labeled with the molecular barcodes, the RNA molecules may be
reverse transcribed to produce labeled cDNA molecules (1230)
containing a cDNA copy of the RNA molecule (1210) and the molecular
barcode (1220).
[0120] As shown in Step 2 of FIG. 67, excess oligos (e.g.,
molecular barcodes) may be removed by Ampure bead purification. As
shown in Step 3 of FIG. 67, the labeled cDNA molecules may be
amplified by multiplex PCR. Multiplex PCR of the labeled cDNA
molecules may be performed by using a first set of forward primers
(F1, 1235 in FIG. 67) and universal primers (1240) in a single
reaction volume to produce labeled amplicons (1245). As shown in
Step 4 of FIG. 67, the labeled amplicons may be further amplified
by multiplex PCR using nested primers. Nested primer amplification
of the labeled amplicons may be performed by using a second set of
forward primers (F2, 1250 in FIG. 67) and universal primers (1240)
in a single reaction volume to produce labeled nested PCR
amplicons. In some instances, the F2 primers (1250) contain an
adaptor (1251) and a target binding region (1252). The target
binding region (1252) of the F2 primers may hybridize to the
labeled amplicons and may prime amplification of the labeled
amplicons. The adaptor (1251) and the universal PCR region (1224)
of the nested PCR amplicons may be used in the sequencing of the
labeled nested PCR amplicons. The amplicons may be sequenced by
MiSeq. Alternatively, the amplicons may be sequenced by HiSeq.
[0121] FIG. 68 shows a schematic of a workflow for stochastically
labeling nucleic acids. As shown in Step 1 of FIG. 68, RNA
molecules (1305) may be stochastically labeled with a set molecular
barcodes (1320). The molecular barcodes may comprise a target
binding region (1321), label region (1322), and universal PCR
region (1323). Once the molecular barcodes are attached to the RNA
molecules, the RNA molecules (1305) may be reverse transcribed to
produce labeled cDNA molecules (1325) comprising a cDNA copy of the
RNA molecule (1310) and the molecular barcode (1320). As shown in
Step 2 of FIG. 68, the labeled cDNA molecules may be purified by
Ampure bead purification to remove excess oligos (e.g., molecular
barcodes). As shown in Step 3 of FIG. 68, the labeled amplicons may
be amplified by multiplex PCR. Multiplex PCR of the labeled cDNA
molecules may be performed by using a first set of forward primers
(F1, 1330 in FIG. 68) and universal primers (1335) in a single
reaction volume to produce labeled amplicons (1360). As shown in
Step 4 of FIG. 67, the labeled amplicons may be further amplified
by multiplex PCR using nested primers. Nested primer amplification
of the labeled amplicons may be performed by using a second set of
forward primers (F2, 1340 in FIG. 68) and sample index primers
(1350) in a single reaction volume to produce labeled nested PCR
amplicons. In some instances, the F2 primers (1340) contain an
adaptor (1341) and a target binding region (1342). The target
binding region (1342) of the F2 primers may hybridize to the
labeled amplicons and may prime amplification of the labeled
amplicons. The sample index primers (1350) may comprise a universal
primer region (1351), sample index region (1352), and adaptor
region (1353). As shown in Step 4 of FIG. 68, the universal primer
region (1351) of the sample index primer may hybridize to the
universal PCR region of the labeled amplicons. The sample index
region (1352) of the sample index primer may be used to distinguish
two or more samples. The adaptor regions (1341, 1353) may be used
to sequence the labeled nested PCR amplicons. The amplicons may be
sequenced by MiSeq. Alternatively, the amplicons may be sequenced
by HiSeq.
[0122] Further disclosed herein are methods of producing one or
more libraries. The one or more libraries may comprise a plurality
of labeled molecules. The one or more libraries may comprise a
plurality of labeled amplicons. The one or more libraries may
comprise a plurality of enriched molecules or a derivative thereof
(e.g., labeled molecules, labeled amplicons). Generally, the method
of producing one or more libraries comprises (a) stochastically
labeling a plurality of molecules from two or more samples to
produce a plurality of labeled molecules, wherein the labeled
molecules comprise a molecule region, a sample index region, and
label region; and (b) producing one or more libraries from the
plurality of labeled molecules, wherein (i) the one or more
libraries comprise two or more different labeled molecules, (ii)
the two or more different labeled molecules differ by the molecule
region, sample index region, label region, or a combination
thereof.
[0123] The method for producing one or more libraries may comprise:
a) producing a plurality of sample-tagged nucleic acids by: i)
contacting a first sample comprising a plurality of nucleic acids
with a plurality of first sample tags to produce a plurality of
first sample-tagged nucleic acids; and ii) contacting a second
sample comprising a plurality of nucleic acids with a plurality of
second sample tags to produce a plurality of second sample-tagged
nucleic acids, wherein the plurality of first sample tags are
different from the second sample tags; and b) contacting the
plurality of sample-tagged nucleic acids with a plurality of
molecular identifier labels to produce a plurality of labeled
nucleic acids, thereby producing a labeled nucleic acid
library.
[0124] The contacting to a sample can be random or non-random. For
example, the contacting of a sample with sample tags can be a
random or non-random contacting. In some embodiments, the sample is
contacted with sample tags randomly. In some embodiments, the
sample is contacted with sample tags non-randomly. The contacting
to a plurality of nucleic acids can be random or non-random. For
example, the contacting of a plurality of nucleic acids with sample
tags can be a random or non-random contacting. In some embodiments,
the plurality of nucleic acids is contacted with sample tags
randomly. In some embodiments, the plurality of nucleic acids is
contacted with sample tags non-randomly.
[0125] Further disclosed herein are methods of producing one or
more sets of labeled beads. The method of producing the one or more
sets of labeled beads may comprise attaching one or more nucleic
acids to one or more beads, thereby producing one or more sets of
labeled beads. The one or more nucleic acids may comprise one or
more molecular barcodes. The one or more nucleic acids may comprise
one or more sample tags. The one or more nucleic acids may comprise
one or more molecular identifier labels. The one or more nucleic
acids may comprise a) a primer region; b) a sample index region;
and c) a linker or adaptor region. The one or more nucleic acids
may comprise a) a primer region; b) a label region; and c) a linker
or adaptor region. The one or more nucleic acids may comprise a) a
sample index region; and b) a label region. The one or more nucleic
acids may further comprise a primer region. The one or more nucleic
acids may further comprise a target specific region. The one or
more nucleic acids may further comprise a linker region. The one or
more nucleic acids may further comprise an adaptor region. The one
or more nucleic acids may further comprise a sample index region.
The one or more nucleic acids may further comprise a label
region.
[0126] Further disclosed herein are methods for selecting one or
more custom primers. The method of selecting a custom primer for
analyzing molecules in a plurality of samples may comprise: a) a
first pass, wherein primers chosen may comprise: i) no more than
three sequential guanines, no more than three sequential cytosines,
no more than four sequential adenines, and no more than four
sequential thymines; ii) at least 3, 4, 5, or 6 nucleotides that
are guanines or cytosines; and iii) a sequence that does not easily
form a hairpin structure; b) a second pass, comprising: i) a first
round of choosing a plurality of sequences that have high coverage
of all transcripts; and ii) one or more subsequent rounds,
selecting a sequence that has the highest coverage of remaining
transcripts and a complementary score with other chosen sequences
no more than 4; and c) adding sequences to a picked set until
coverage saturates or total number of customer primers is less than
or equal to about 96.
[0127] Further disclosed herein are kits for use in analyzing two
or more molecules from two or more samples. The kit may comprise
(a) a first container comprising a first set of molecular barcodes,
wherein (i) a molecular barcode of the first set of molecular
barcodes comprise a sample index region and a label region; (ii)
the sample index region of two or more barcodes of the first set of
molecular barcodes are the same; and (iii) the label region of two
or more barcodes of the first set of molecular barcodes are
different; and (b) a second container comprising a second set of
molecular barcodes, wherein (i) a molecular barcode of the second
set of molecular barcodes comprise a sample index region and a
label region; (ii) the sample index region of two or more barcodes
of the second set of molecular barcodes are the same; (iii) the
label region of two or more barcodes of the second set of molecular
barcodes are different; (iv) the sample index region of the
barcodes of the second set of molecular barcodes are different from
the sample index region of the barcodes of the first set of
molecular barcodes; and (v) the label region of two or more
barcodes of the second set of molecular barcodes are identical to
the label region of two or more barcodes of the first set of
molecular barcodes.
[0128] Alternatively, the kit comprises: a) a plurality of beads,
wherein one or more beads of the plurality of beads may comprise at
least one of a plurality of nucleic acids, wherein at least one of
a plurality nucleic acids may comprise: i) at least one primer
sequence, wherein the primer sequence of at least one of the
plurality of nucleic acids is the same for the plurality of beads;
ii) a bead-specific sequence, wherein the bead-specific sequence of
any one of the plurality of nucleic acids is the same, and wherein
the bead-specific sequence is different for any one of the
plurality of beads; and iii) a stochastic sequence, wherein the
stochastic sequence is different for any one of the plurality of
nucleic acids; b) a primer may comprise a sequence complementary to
the primer sequence; and c) one or more amplification agents
suitable for nucleic acid amplification.
[0129] Alternatively, the kit comprises: a) a first container
comprising a first set of sample tags, wherein (i) a sample tag of
the first set of sample tags comprises a sample index region; and
(ii) the sample index regions of the sample tags of the first set
of sample tags are at least about 80% identical; and b) a second
container comprising a first set of molecular identifier labels,
wherein (i) a molecular identifier label of the first set of
molecular identifier labels comprises a label region; and (ii) at
least about 30% of the label regions of the total molecular
identifier labels of the first set of molecular identifier labels
are different
[0130] Before the present methods, kits and compositions are
described in greater detail, it is to be understood that this
invention is not limited to particular method, kit or composition
described, as such may, of course, vary. It is also to be
understood that the terminology used herein is for the purpose of
describing particular embodiments only, and is not intended to be
limiting, since the scope of the present invention will be limited
only by the appended claims. Examples are put forth so as to
provide those of ordinary skill in the art with a complete
disclosure and description of how to make and use the present
invention, and are not intended to limit the scope of what the
inventors regard as their invention nor are they intended to
represent that the experiments below are all or the only
experiments performed. Efforts have been made to ensure accuracy
with respect to numbers used (e.g., amounts, temperature, etc.) but
some experimental errors and deviations should be accounted for.
Unless indicated otherwise, parts are parts by weight, molecular
weight is weight average molecular weight, temperature is in
degrees Centigrade, and pressure is at or near atmospheric.
[0131] Methods, kits and compositions are provided for stochastic
labeling of nucleic acids in a plurality of samples or in a complex
nucleic acid preparation. These methods, kits and compositions find
use in unraveling mechanisms of cellular response, differentiation
or signal transduction and in performing a wide variety of clinical
measurements. These and other objects, advantages, and features of
the invention will become apparent to those persons skilled in the
art upon reading the details of the methods, kits and compositions
as more fully described below.
[0132] The methods disclosed herein comprise attaching one or more
molecular barcodes, sample tags, and/or molecular identifier labels
to two or more molecules from two or more samples. The molecular
barcodes, sample tags and/or molecular identifier labels may
comprise one or more oligonucleotides. In some instances,
attachment of molecular barcodes, sample tags, and/or molecular
identifier labels to the molecules comprises stochastic labeling of
the molecules. Methods for stochastically labeling molecules may be
found, for example, in U.S. Ser. Nos. 12/969,581 and 13/327,526.
Generally, the stochastic labeling method comprises the random
attachment of a plurality of the tag and label oligonucleotides to
one or more molecules. The molecular barcodes, sample tags, and/or
molecular identifier labels are provided in excess of the one or
more molecules to be labeled. In stochastic labeling, each
individual molecule to be labeled has an individual probability of
attaching to the plurality of the molecular barcodes, sample tags,
and/or molecular identifier labels. The probability of each
individual molecule to be labeled attaching to a particular
molecular barcodes, sample tags, and/or molecular identifier labels
may be about the same as any other individual molecule to be
labeled. Accordingly, in some instances, the probability of any of
the molecules in a sample finding any of the tags and labels is
assumed to be equal, an assumption that may be used in mathematical
calculations to estimate the number of molecules in the sample. In
some circumstances the probability of attaching may be manipulated
by, for example electing tags and labels with different properties
that would increase or decrease the binding efficiency of that
molecular barcodes, sample tags, and/or molecular identifier labels
with an individual molecule. The tags and labels may also be varied
in numbers to alter the probability that a particular molecular
barcodes, sample tags, and/or molecular identifier labels will find
a binding partner during the stochastic labeling. For example, one
label is overrepresented in a pool of labels, thereby increasing
the chances that the overrepresented label finds at least one
binding partner.
[0133] The methods disclosed herein may further comprise combining
two or more samples. The methods disclosed herein may further
comprise combining one or more molecules from two or more samples.
For example, the methods disclosed herein comprise combining a
first sample and a second sample. The two or more samples may be
combined after conducting one or more stochastic labeling
procedures. The two or more samples may be combined after
attachment of one or more sets of molecular barcodes to two or more
molecules from the two or more samples. The two or more samples may
be combined after attachment of one or more sets of sample tags to
two or more molecules from the two or more samples. The two or more
samples may be combined after attachment of one or more sets of
molecular identifier labels to two or more molecules from the two
or more samples. For example, the first and second samples are
combined prior to contact with the plurality of molecular
identifier labels.
[0134] Alternatively, the two or more samples may be combined prior
to conducting one or more stochastic labeling procedures. The two
or more samples may be combined prior to attachment of one or more
sets of molecular barcodes to two or more molecules from the two or
more samples. The two or more samples may be combined prior to
attachment of one or more sets of sample tags to two or more
molecules from the two or more samples. The two or more samples may
be combined prior to attachment of one or more sets of molecular
identifier labels to two or more molecules from the two or more
samples.
[0135] The two or more samples may be combined after conducting one
or more assays on two or more molecules or derivatives thereof
(e.g., labeled molecules, amplicons) from the two or more samples.
The one or more assays may comprise one or more amplification
reactions. The one or more assays may comprise one or more
enrichment assays. The one or more assays may comprise one or more
detection assays. For example, the first and second samples are
combined after detecting the labeled nucleic acids.
[0136] The two or more samples may be combined prior to conducting
one or more assays on two or more molecules or derivatives thereof
(e.g., labeled molecules, amplicons) from the two or more samples.
The one or more assays may comprise one or more amplification
reactions. The one or more assays may comprise one or more
enrichment assays. The one or more assays may comprise one or more
detection assays. For example, the first and second samples are
combined prior to detecting the labeled nucleic acids.
Supports
[0137] The present disclosure comprises compositions and methods
for multiplex sequence analysis from single cells. The methods and
compositions of the present disclosure provide for the use of solid
supports. In some instances, the methods, kits, and compositions
disclosed herein comprise a support.
[0138] The terms "support", "solid support", "semi-solid support",
and "substrate" may be used interchangeably and refer to a material
or group of materials having a rigid or semi-rigid surface or
surfaces. A support may refer to any surface that is transferable
from solution to solution or forms a structure for conducting
oligonucleotide-based assays. The support or substrate may be a
solid support. Alternatively, the support is a non-solid support. A
support may refer to an insoluble, semi-soluble, or insoluble
material. A support may be referred to as "functionalized" when it
includes a linker, a scaffold, a building block, or other reactive
moiety attached thereto, whereas a solid support may be
"nonfunctionalized" when it lack such a reactive moiety attached
thereto. The support may be employed free in solution, such as in a
microtiter well format; in a flow-through format, such as in a
column; or in a dipstick.
[0139] The support or substrate may comprise a membrane, paper,
plastic, coated surface, flat surface, glass, slide, chip, or any
combination thereof. In many embodiments, at least one surface of
the support may be substantially flat, although in some embodiments
it may be desirable to physically separate synthesis regions for
different compounds with, for example, wells, raised regions, pins,
etched trenches, or the like. According to other embodiments, the
solid support(s) may take the form of resins, gels, microspheres,
or other geometric configurations. Alternatively, the solid
support(s) comprises silica chips, microparticles, nanoparticles,
plates, and arrays. Solid supports may include beads (e.g., silica
gel, controlled pore glass, magnetic beads, Dynabeads, Wang resin;
Merrifield resin, Sephadex/Sepharose beads, cellulose beads,
polystyrene beads etc.), capillaries, flat supports such as glass
fiber filters, glass surfaces, metal surfaces (steel, gold silver,
aluminum, silicon and copper), glass supports, plastic supports,
silicon supports, chips, filters, membranes, microwell plates,
slides, or the like. plastic materials including multiwell plates
or membranes (e.g., formed of polyethylene, polypropylene,
polyamide, polyvinylidenedifluoride), wafers, combs, pins or
needles (e.g., arrays of pins suitable for combinatorial synthesis
or analysis) or beads in an array of pits or nanoliter wells of
flat surfaces such as wafers (e.g., silicon wafers), wafers with
pits with or without filter bottoms.
[0140] Methods and techniques applicable to polymer (including
protein) array synthesis have been described in U.S. Patent Pub.
No. 20050074787, WO 00/58516, U.S. Pat. Nos. 5,143,854, 5,242,974,
5,252,743, 5,324,633, 5,384,261, 5,405,783, 5,424,186, 5,451,683,
5,482,867, 5,491,074, 5,527,681, 5,550,215, 5,571,639, 5,578,832,
5,593,839, 5,599,695, 5,624,711, 5,631,734, 5,795,716, 5,831,070,
5,837,832, 5,856,101, 5,858,659, 5,936,324, 5,968,740, 5,974,164,
5,981,185, 5,981,956, 6,025,601, 6,033,860, 6,040,193, 6,090,555,
6,136,269, 6,269,846 and 6,428,752, in PCT Publication No. WO
99/36760 and WO 01/58593, which are all incorporated herein by
reference in their entirety for all purposes. Patents that describe
synthesis techniques in specific embodiments include U.S. Pat. Nos.
5,412,087, 6,147,205, 6,262,216, 6,310,189, 5,889,165, and
5,959,098. Nucleic acid arrays are described in many of the above
patents, but many of the same techniques may be applied to
polypeptide arrays. Additional exemplary substrates are disclosed
in U.S. Pat. No. 5,744,305 and US Patent Pub. Nos. 20090149340 and
20080038559.
[0141] The attachment of the labeled nucleic acids to the support
may comprise amine-thiol crosslinking, maleimide crosslinking,
N-hydroxysuccinimide or N-hydroxysulfosuccinimide, Zenon or
SiteClick. Attaching the labeled nucleic acids to the support may
comprise attaching biotin to the plurality of labeled nucleic acids
and coating the one or more beads with streptavadin.
[0142] In some instances, a solid support may comprise a molecular
scaffold. Exemplary molecular scaffolds may include antibodies,
antigens, affinity reagents, polypeptides, nucleic acids, cellular
organelles, and the like. Molecular scaffolds may be linked
together (e.g., a solid support may comprise a plurality of
connected molecular scaffolds). Molecular scaffolds may be linked
together by an amino acid linker, a nucleic acid linker, a small
molecule linkage (e.g., biotin and avidin), and/or a matrix linkage
(e.g., PEG or glycerol). Linkages may be non-covalent. Linkages may
be covalent. In some instances, molecular scaffolds may not be
linked. A plurality of individual molecular scaffolds may be used
in the methods of the disclosure.
[0143] In some instances a support may comprise a nanoparticle. The
nanoparticle may be a nickel, gold, silver, carbon, copper,
silicate, platinum cobalt, zinc oxide, silicon dioxide crystalline,
and/or silver nanoparticle. Alternatively, or additionally, the
nanoparticle may be a gold nanoparticle embedded in a porous
manganese oxide. The nanoparticle may be an iron nanoparticle. The
nanoparticle may be a nanotetrapod studded with nanoparticles of
carbon.
[0144] A support may comprise a polymer. A polymer may comprise a
matrix. A matrix may further comprise one or more beads. A polymer
may comprise PEG, glycerol, polysaccharide, or a combination
thereof. A polymer may be a plastic, rubber, nylon, silicone,
neoprene, and/or polystyrene. A polymer may be a natural polymer.
Examples of natural polymers include, but are not limited to,
shellac, amber, wool, silk, cellulose, and natural rubber. A
polymer may be a synthetic polymer. Examples of synthetic polymers
include, but are not limited to, synthetic rubber, phenol
formaldehyde resin (or Bakelite), neoprene, nylon, polyvinyl
chloride (PVC or vinyl), polystyrene, polyethylene, polypropylene,
polyacrylonitrile, PVB, and silicone.
[0145] A support may be a semi-solid support. A support may
comprise a gel (e.g., a hydrogel). The terms "hydrogel", "gel" and
the like, are used interchangeably herein and may refer to a
material which is not a readily flowable liquid and not a solid but
a gel which gel is comprised of from 0.5% or more and preferably
less than 40% by weight of gel forming solute material and from 95%
or less and preferably more than 55% water. The gels of the
invention may be formed by the use of a solute which is preferably
a synthetic solute (but could be a natural solute, e.g., for
forming gelatin) which forms interconnected cells which binds to,
entrap, absorb and/or otherwise hold water and thereby create a gel
in combination with water, where water includes bound and unbound
water. The gel may be the basic structure of the hydrogel patch of
the invention will include additional components beyond the gel
forming solute material and water such as an enzyme and a salt
which components are further described herein. The gel may be a
polymer gel.
[0146] A solid support may comprise a structured nanostructure. For
example, the structured nanostructure may comprise capture
containers (e.g., a miniaturized honeycomb) which may comprise the
oligonucleotides to capture the cell and/or contents of the cell.
In some instances, structured nanostructures may not need the
addition of exogenous reagents.
[0147] In some instances, the support comprises a bead. A bead may
encompass any type of solid or hollow sphere, ball, bearing,
cylinder, or other similar configuration composed of plastic,
ceramic, metal, or polymeric material onto which a nucleic acid may
be immobilized (e.g., covalently or non-covalently). A bead may
comprise nylon string or strings. A bead may be spherical in shape.
A bead may be non-spherical in shape. Beads may be unpolished or,
if polished, the polished bead may be roughened before treating,
(e.g., with an alkylating agent). A bead may comprise a discrete
particle that may be spherical (e.g., microspheres) or have an
irregular shape. Beads may comprise a variety of materials
including, but not limited to, paramagnetic materials, ceramic,
plastic, glass, polystyrene, methylstyrene, acrylic polymers,
titanium, latex, sepharose, cellulose, nylon and the like. A bead
may be attached to or embedded into one or more supports. A bead
may be attached to a gel or hydrogel. A bead may be embedded into a
gel or hydrogel. A bead may be attached to a matrix. A bead may be
embedded into a matrix. A bead may be attached to a polymer. A bead
may be embedded into a polymer. The spatial position of a bead
within the support (e.g., gel, matrix, scaffold, or polymer) may be
identified using the oligonucleotide present on the bead which
serves as a location address. Examples of beads include, but are
not limited to, streptavidin beads, agarose beads, magnetic beads,
Dynabeads.RTM., MACS.RTM. microbeads, antibody conjugated beads
(e.g., anti-immunoglobulin microbead), protein A conjugated beads,
protein G conjugated beads, protein A/G conjugated beads, protein L
conjugated beads, oligodT conjugated beads, silica beads,
silica-like beads, anti-biotin microbead, anti-fluorochrome
microbead, and BcMag.TM. Carboxy-Terminated Magnetic Beads. The
diameter of the beads may be about 5 .mu.m, 10 .mu.m, 20 .mu.m, 25
.mu.m, 30 .mu.m, 35 .mu.m, 40 .mu.m, 45 .mu.m, or 50 .mu.m. A bead
may refer to any three dimensional structure that may provide an
increased surface area for immobilization of biological particles
and macromolecules, such as DNA and RNA.
[0148] A support may be porous. A support may be permeable or
semi-permeable. A support may be solid. A support may be
semi-solid. A support may be malleable. A support may be flexible.
In some instances, a support may be molded into a shape. For
example, a support may be placed over an object and the support may
take the shape of the object. In some instances, the support is
placed over an organ and takes the shape of the organ. In some
instances, the support is produced by 3D-printing.
[0149] The support (e.g., beads, nanoparticles) may be at least
about 0.1, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 100, 500,
1000, or 2000 or more micrometers in diameter. The solid supports
(e.g., beads) may be at most about 0.1, 0.5, 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 20, 30, 100, 500, 1000, or 2000 or more micrometers in
diameter. The diameter of the bead may be about 20 microns.
[0150] In some instances, a solid support comprises a dendrimer. A
dendrimer may be smaller than a bead. A dendrimer may be
subcellular. A dendrimer may be less than 1, 0.9, 0.8, 0.7, 0.6,
0.5, 0.4, 0.3, 0.2, or 0.1 micron in diameter. A dendrimer may be
less than 0.09, 0.08, 0.07, 0.06, 0.05, 0.04, 0.03, or 0.01 micron
in diameterA dendrimer may comprise three major portions, a core,
an inner shell, and an outer shell. A dendrimer may be synthesized
to have different functionality in each of these portions. The
different functionality of the portions of the dendrimer may
control properties such as solubility, thermal stability, and
attachment of compounds for particular applications. A dendrimer
may be synthetically processed. A dendrimer may be synthesized by
divergent synthesis. Divergent synthesis may comprise assembling a
dendrimer from a multifunctional core, which is extended outward by
a series of reactions. Divergent synthesis may comprise a series of
Michael reactions. Alternatively, a dendrimer may be synthesized by
convergent synthesis. Convergent synthesis may comprise building
dendrimers from small molecules that end up at the surface of the
sphere, and reactions may proceed inward and are eventually
attached to a core. Dendrimers may also be prepared by click
chemistry. Click chemistry may comprise Diels-Alder reactions,
thiol-yne reactions, azide-alkyne reactions, or a combination
thereof. Examples of dendrimers include, but are not limited to,
poly(amidoamine) (PAMAM) dendrimer, PEG-core denderimer,
phosphorous dendrimer, polypropylenimine dendrimer, and polylysine
dendrimer. A dendrimer may be a chiral dendrimer. Alternatively, a
dendrimer may be an achiral dendrimer.
[0151] A solid support may comprise a portion of a dendrimer. The
portion of the dendrimer may comprise a dendron. A dendron may
comprise monodisperse wedge-shaped dendrimer sections with multiple
terminal groups and a single reaction function at the focal point.
A solid support may comprise a polyester dendrom. Examples of
dendrons include, but are not limited to,
polyester-8-hydroxyl-1-acetylene bis-MPA dendron,
polyester-16-hydroxyl-1-acetylene bis-MPA dendron,
polyester-32-hydroxyl-1-acetylene bis-MPA dendron,
polyester-8-hydroxyl-1-carboxyl bis-MPA dendron,
polyester-16-hydroxyl-1-carboxyl bis-MPA dendron, and
polyester-32-hydroxyl-1-carboxyl bis-MPA dendron.
[0152] A solid support may comprise a hyberbranched polymer. A
hyperbranched polymer may comprise polydisperse dendritic
macromolecules that possess dendrimer-like properties. Often,
hyberbranched polymers are prepared in a single synthetic
polymerization step. The hyperbranched polymer may be based on
2,2-bis(hydroxymethyl)propanoic acid (bis-MPA) monomer. Examples of
hyperbranched polymers include, but are not limited to,
hyperbranched bis-MPA polyester-16-hydroxyl, hyperbranched bis-MPA
polyester-32-hydroxyl, and hyperbranched bis-MPA
polyester-64-hydroxyl.
[0153] The solid support may be an array or microarray. The solid
support may comprise discrete regions. The solid support may be an
addressable array. In some instances, the array comprises a
plurality of probes fixed onto a solid surface. The plurality of
probes enables hybridization of the labeled-molecule and/or
labeled-amplicon to the solid surface. The plurality of probes
comprises a sequence that is complementary to at least a portion of
the labeled-molecule and/or labeled-amplicon. In some instances,
the plurality of probes comprises a sequence that is complementary
to at least a portion of the sample tag, molecular identifier
label, nucleic acid, or a combination thereof. In other instances,
the plurality of probes comprises a sequence that is complementary
to the junction formed by the attachment of the sample tag or
molecular identifier label to the nucleic acid.
[0154] The array may comprise one or more probes. The probes may be
in a variety of formats. The array may comprise a probe comprising
a sequence that is complementary to at least a portion of the
target nucleic acid and a sequence that is complementary to the
unique identifier region of a sample tag or molecular identifier
label, wherein the sample tag or molecular identifier label
comprises an oligonucleotide. The sequence that is complementary to
at least a portion of the target nucleic acid may be attached to
the array. The sequence that is complementary to the unique
identifier region may be attached to the array. The array may
comprise a first probe comprising a sequence that is complementary
to at least a portion of the target nucleic acid and a second probe
that is complementary to the unique identifier region. There are
various ways in which a stochastically labeled nucleic acid may
hybridize to the arrays. For example, the junction of the unique
identifier region and the target nucleic acid of the stochastically
labeled nucleic acid may hybridize to the probe on the array. There
may be a gap in the regions of the stochastically labeled nucleic
acid that may hybridize to the probe on the array. Different
regions of the stochastically labeled nucleic acid may hybridize to
two or more probes on the array. Thus, the array probes may be in
many different formats. The array probes may comprise a sequence
that is complementary to a unique identifier region, a sequence
that is complementary to the target nucleic acid, or a combination
thereof. Hybridization of the stochastically labeled nucleic acid
to the array may occur by a variety of ways. For example, two or
more nucleotides of the stochastically labeled nucleic acid may
hybridize to one or more probes on the array. The two or more
nucleotides of the stochastically labeled nucleic acid that
hybridize to the probes may be consecutive nucleotides,
non-consecutive nucleotides, or a combination thereof. The
stochastically labeled nucleic acid that is hybridized to the probe
may be detected by any method known in the art. For example, the
stochastically labeled nucleic acids may be directly detected.
Directly detecting the stochastically labeled nucleic acid may
comprise detection of a fluorophore, hapten, or detectable label.
The stochastically labeled molecules may be indirectly detected.
Indirect detection of the stochastically labeled nucleic acid may
comprise ligation or other enzymatic or non-enzymatic methods.
[0155] The array may be in a variety of formats. For example, the
array may be in a 16-, 32-, 48-, 64-, 80-, 96-, 112-, 128-, 144-,
160-, 176-, 192-, 208-, 224-, 240-, 256-, 272-, 288-, 304-, 320-,
336-, 352-, 368-, 384-, or 400-format. Alternatively, the array is
in an 8.times.60K, 4.times.180K, 2.times.400K, 1.times.1M format.
In other instances, the array is in an 8.times.15K, 4.times.44K,
2.times.105K, 1.times.244K format.
[0156] The array may comprise a single array. The single array may
be on a single substrate. Alternatively, the array is on multiple
substrates. The array may comprise multiple formats. The array may
comprise a plurality of arrays. The plurality of arrays may
comprise two or more arrays. For example, the plurality of arrays
may comprise at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95, or 100 arrays. In some instances, at least two
arrays of the plurality of arrays are identical. Alternatively, at
least two arrays of the plurality of arrays are different.
[0157] In some instances, the array comprises symmetrical chambered
areas. For example, the array comprises 0.5.times.0.5 millimeters
(mm), 1.times.1 mm, 1.5.times.1.5 mm, 2.times.2 mm, 2.5.times.2.5
mm, 3.times.3 mm, 3.5.times.3.5 mm, 4.times.4 mm, 4.5.times.4.5 mm,
5.times.5 mm, 5.5.times.5.5 mm, 6.times.6 mm, 6.5.times.6.5 mm,
7.times.7 mm, 7.5.times.7.5 mm, 8.times.8 mm, 8.5.times.8.5 mm,
9.times.9 mm, 9.5.times.9.5 mm, 10.times.10 mm, 10.5.times.10.5 mm,
11.times.11 mm, 11.5.times.11.5 mm, 12.times.12 mm, 12.5.times.12.5
mm, 13.times.13 mm, 13.5.times.13.5 mm, 14.times.14 mm,
14.5.times.14.5 mm, 15.times.15 mm, 15.5.times.15.5 mm, 16.times.16
mm, 16.5.times.16.5 mm, 17.times.17 mm, 17.5.times.17.5 mm,
18.times.18 mm, 18.5.times.18.5 mm, 19.times.19 mm, 19.5.times.19.5
mm, or 20.times.20 mm chambered areas. In some instances, the array
comprises 6.5.times.6.5 mm chambered areas. Alternatively, the
array comprises asymmetrical chambered areas. For example, the
array comprises 6.5.times.0.5 mm, 6.5.times.1 mm, 6.5.times.1.5 mm,
6.5.times.2 mm, 6.5.times.2.5 mm, 6.5.times.3 mm, 6.5.times.3.5 mm,
6.5.times.4 mm, 6.5.times.4.5 mm, 6.5.times.5 mm, 6.5.times.5.5 mm,
6.5.times.6 mm, 6.5.times.6.5 mm, 6.5.times.7 mm, 6.5.times.7.5 mm,
6.5.times.8mm, 6.5.times.8.5 mm, 6.5.times.9 mm, 6.5.times.9.5 mm,
6.5.times.10 mm, 6.5.times.10.5 mm, 6.5.times.11 mm, 6.5.times.11.5
mm, 6.5.times.12 mm, 6.5.times.12.5 mm, 6.5.times.13 mm,
6.5.times.13.5 mm, 6.5.times.14 mm, 6.5.times.14.5 mm, 6.5.times.15
mm, 6.5.times.15.5 mm, 6.5.times.16 mm, 6.5.times.16.5 mm,
6.5.times.17 mm, 6.5.times.17.5 mm, 6.5.times.18 mm, 6.5.times.18.5
mm, 6.5.times.19 mm, 6.5.times.19.5 mm, or 6.5.times.20 mm
chambered areas.
[0158] The array may comprise at least about 1 micron (.mu.m), 2
.mu.m, 3 .mu.m, 4 .mu.m, 5 .mu.m, 6 .mu.m, 7 .mu.m, 8 .mu.m, 9
.mu.m, 10 .mu.m, 15 .mu.m, 20 .mu.m, 25 .mu.m, 30 .mu.m, 35 .mu.m,
40 .mu.m, 45 .mu.m, 50 .mu.m, 55 .mu.m, 60 .mu.m, 65 .mu.m, 70
.mu.m, 75 .mu.m, 80 .mu.m, 85 .mu.m, 90 .mu.m, 95 .mu.m, 100 .mu.m,
125 .mu.m, 150 .mu.m, 175 .mu.m, 200 .mu.m, 225 .mu.m, 250 .mu.m,
275 .mu.m, 300 .mu.m, 325 .mu.m, 350 .mu.m, 375 .mu.m, 400 .mu.m,
425 .mu.m, 450 .mu.m, 475 .mu.m, or 500 .mu.m, spots. In some
instances, the array comprises 70 .mu.m, spots.
[0159] The array may comprise at least about 1 .mu.m, 2 .mu.m, 3
.mu.m, 4 .mu.m, 5 .mu.m, 6 .mu.m, 7 .mu.m, 8 .mu.m, 9 .mu.m, 10
.mu.m, 15 .mu.m, 20 .mu.m, 25 .mu.m, 30 .mu.m, 35 .mu.m, 40 .mu.m,
45 .mu.m, 50 .mu.m, 55 .mu.m, 60 .mu.m, 65 .mu.m, 70 .mu.m, 75
.mu.m, 80 .mu.m, 85 .mu.m, 90 .mu.m, 95 .mu.m, 100 .mu.m, 125
.mu.m, 150 .mu.m, 175 .mu.m, 200 .mu.m, 225 .mu.m, 250 .mu.m, 275
.mu.m, 300 .mu.m, 325 .mu.m, 350 .mu.m, 375 .mu.m, 400 .mu.m, 425
.mu.m, 450 .mu.m, 475 .mu.m, or 500 .mu.m, 525 .mu.m, 550 .mu.m,
575 .mu.m, 600 .mu.m, 625 .mu.m, 650 .mu.m, 675 .mu.m, 700 .mu.m,
725 .mu.m, 750 .mu.m, 775 .mu.m, 800 .mu.m, 825 .mu.m, 850 .mu.m,
875 .mu.m, 900 .mu.m, 925 .mu.m, 950 .mu.m, 975 .mu.m, 1000 .mu.m,
feature pitch. In some instances, the array comprises 161 .mu.m,
feature pitch.
[0160] The array may comprise one or more probes. In some
instances, the array comprises at least about 5, 10, 15, 20, 25,
30, 40, 50, 60, 70, 80, 90, or 100 probes. Alternatively, the array
comprises at least about 200, 300, 400, 500, 600, 700, 800, 900,
1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000,
2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, or 3000
probes. The array may comprise at least about 3500, 4000, 4500,
5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, or
10000 probes. In some instances, the array comprises at least about
960 probes. Alternatively, the array comprises at least about 2780
probes. The probes may be specific for the plurality of
oligonucleotide tags. The probes may be specific for at least a
portion of the plurality of oligonucleotide tags. The probes may be
specific for at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 95%, 97% or 100% of the total number of the plurality of
oligonucleotide tags. Alternatively, the probes are specific for at
least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%,
97% or 100% of the total number of different oligonucleotide tags
of the plurality of oligonucleotide tags. The probes may be
oligonucleotides. The oligonucleotides may be at least about 1, 2,
5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 nucleotides long. In
other instances, the probes are non-specific probes. For example,
the probes may be specific for a detectable label that is attached
to the labeled-molecule. The probe may be streptavidin.
[0161] The array may be a printed array. In some instances, the
printed array comprises one or more oligonucleotides attached to a
substrate. For example, the printed array comprises 5' amine
modified oligonucleotides attached to an epoxy silane
substrate.
[0162] Alternatively, the array comprises a slide with one or more
wells. The slide may comprise at least about 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 wells.
Alternatively, the slide comprises at least about 125, 150, 175,
200, 250, 300, 350, 400, 450, 500, 650, 700, 750, 800, 850, 900,
950, or 1000 wells. In some instances, the slide comprises 16
wells. Alternatively, the slide comprises 96 wells. In other
instances, the slide comprises at least about 80, 160, 240, 320,
400, 480, 560, 640, 720, 800, 880, or 960 wells.
[0163] In some instances, the solid support is an Affymetrix 3K tag
array, Arrayjet non-contact printed array, or Applied Microarrays
Inc (AMI) array. Alternatively, the support comprises a contact
printer, impact printer, dot printer, or pin printer.
[0164] The solid support may comprise the use of beads that
self-assemble in microwells. For example, the solid support
comprises IIlumina's BeadArray Technology. Alternatively, the solid
support comprises Abbott Molecular's Bead Array technology, and
Applied Microarray's FlexiPlex.TM. system.
[0165] In other instances, the solid support is a plate. Examples
of plates include, but are not limited to, MSD multi-array plates,
MSD Multi-Spot.RTM. plates, microplate, ProteOn microplate,
AlphaPlate, DELFIA plate, IsoPlate, and LumaPlate.
[0166] The method may further comprise attaching at least one of a
plurality of labeled nucleic acids to a support. The support may
comprise a plurality of beads. The support may comprise an array.
The support may comprise a glass slide.
[0167] The glass slide may comprise one or more wells. The one or
more wells may be etched on the glass slide. The one or more wells
may comprise at least 960 wells. The glass slide may comprise one
or more probes. The one or more probes may be printed onto the
glass slide. The one or more wells may further comprise one or more
probes. The one or more probes may be printed within the one or
more wells. The one or more probes may comprise 960 nucleic
acids.
[0168] The methods and kits disclosed herein may further comprise
distributing the plurality of first sample tags, the plurality of
second sample tags, the plurality of molecular identifier labels,
or any combination thereof in a microwell plate. The methods and
kits disclosed herein may further comprise distributing one or more
beads in the microwell plate. The methods and kits disclosed herein
may further comprise distributing the plurality of samples in a
plurality of wells of a microwell plate. The one or more of the
plurality of samples may comprise a plurality of cells. One or more
of the plurality of samples may comprise a plurality of nucleic
acids. The method may further comprise distributing one or fewer
cells to the plurality of wells. The plurality of cells may be
lysed in the microwell plate. The method may further comprise
synthesizing cDNA in the microwell plate. Synthesizing cDNA may
comprise reverse transcription of mRNA. The microwell plate may
comprise a microwell plate fabricated on PDMS by soft lithography,
etched on a silicon wafer, etched on a glass slide, patterned
photoresist on a glass slide, or a combination thereof. The
microwell may comprise a hole on a microcapillary plate. The
microwell plate may comprise a water-in-oil emulsion. The microwell
plate may comprise at least one or more wells. The microwell plate
may comprise at least about 6 wells, 12 wells, 48 wells, 96 wells,
384 wells, 960 wells or 1000 wells.
[0169] The methods and kits may further comprise a chip. The
microwell plate may be attached to the chip. The chip may comprise
at least about 6 wells, 12 wells, 48 wells, 96 wells, 384 wells,
960 wells, 1000 wells, 2000 wells, 3000 wells, 4000 wells, 5000
wells, 6000 wells, 7000 wells, 8000 wells, 9000 wells, 10,000
wells, 20,000 wells, 30,000 wells, 40,000 wells, 50,000 wells,
60,000 wells, 70,000 wells, 80, 000 wells, 90,000 wells, 100,000
wells, 200,000 wells, 500,000 wells, or a million wells. The wells
may comprise an area of at least about 300 microns.sup.2, 400
microns.sup.2, 500 microns.sup.2, 600 microns.sup.2, 700
microns.sup.2, 800 microns.sup.2, 900 microns.sup.2, 1000
microns.sup.2, 1100 microns.sup.2, 1200 microns.sup.2, 1300
microns.sup.2, 1400 microns.sup.2, 1500 microns.sup.2. The method
may further comprise distributing between about 10,000 and 30,000
samples on the chip.
Functionalized Surfaces and Oligonucleotides
[0170] The bead may comprise a functionalized surface. A
functionalized surface may refer to the surface of the solid
support comprising a functional group. A functional group may be a
group capable of forming an attachment with another functional
group. For example, a functional group may be biotin, which may
form an attachment with streptavidin, another functional group.
Exemplary functional groups may include, but are not limited to,
aldehydes, ketones, carboxy groups, amino groups, biotin,
streptavidin, nucleic acids, small molecules (e.g., for click
chemistry), homo- and hetero-bifunctional reagents (e.g.,
N-succinimidyl(4-iodoacetyl) aminobenzoate (STAB), dimaleimide,
dithio-bis-nitrobenzoic acid (DTNB),
N-succinimidyl-S-acetyl-thioacetate (SATA),
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl
4-(N-mafeimidomethyl)-cyclohexane-1- carboxylate (SMCC) and
6-hydrazinonicotimide (HYNIC), and antibodies. In some instances
the functional group is a carboxy group (e.g., COOH).
[0171] Oligonucleotides (e.g., nucleic acids) may be attached to
functionalized solid supports. The immobilized oligonucleotides on
solid supports or similar structures may serve as nucleic acid
probes, and hybridization assays may be conducted wherein specific
target nucleic acids may be detected in complex biological
samples.
[0172] The solid support (e.g., beads) may be functionalized for
the immobilization of oligonucleotides. An oligonucleotide may be
conjugated to a solid support through a covalent amide bond formed
between the solid support and the oligonucleotide.
[0173] A support may be conjugated to at least about 10, 20, 30,
40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900
or 1000 or more oligonucleotides. A support may be conjugated to at
least about 100000, 200000, 300000, 400000, 500000, 600000, 700000,
800000, 900000, 1000000, 2000000, 3000000, 4000000, 5000000,
6000000, 7000000, 8000000, 9000000 or 10000000, 100000000,
500000000, 1000000000 or more oligonucleotides. A support may be
conjugated to at least about 100000, 200000, 300000, 400000,
500000, 600000, 700000, 800000, 900000, 1000000, 2000000, 3000000,
4000000, 5000000, 6000000, 7000000, 8000000, 9000000 or 10000000,
100000000, 500000000, 1000000000 or more oligonucleotides. A
support may be conjugated to at least 1 million oligonucleotides. A
support may be conjugated to at least 10 million oligonucleotides.
A support may be conjugated to at least 25 million
oligonucleotides. A support may be conjugated to at least 50
million oligonucleotides. A support may be conjugated to at least
100 million oligonucleotides. A support may be conjugated to at
least 250 million oligonucleotides. A support may be conjugated to
at least 500 million oligonucleotides. A support may be conjugated
to at least 750 million oligonucleotides. A support may be
conjugated to at least about 1, 2, 3 4, 5, 6, 7, 8, 9, 10, 11, 12
13, 14, or 15 billion oligonucleotides. A support may be conjugated
to at least 1 billion oligonucleotides. A support may be conjugated
to at least 5 billion oligonucleotides.
[0174] The oligonucleotides may be attached to the support (e.g.,
beads, polymers, gels) via a linker. Conjugation may comprise
covalent or non-covalent attachment. Conjugation may introduce a
variable spacer between the beads and the nucleic acids. The linker
between the support and the oligonucleotide may be cleavable (e.g.,
photocleavable linkage, acid labile linker, heat sensitive linker,
and enzymatically cleavable linker).
[0175] Cross-linking agents for use for conjugating molecules to
supports may include agents capable of reacting with a functional
group present on a surface of the solid support and with a
functional group present in the molecule. Reagents capable of such
reactivity may include aldehydes, ketones, carboxy groups, amino
groups, biotin, streptavidin, nucleic acids, small molecules (e.g.,
for click chemistry), homo- and hetero-bifunctional reagents (e.g.,
N-succinimidyl(4-iodoacetyl) aminobenzoate (SIAB), dimaleimide,
dithio-bis-nitrobenzoic acid (DTNB),
N-succinimidyl-S-acetyl-thioacetate (SATA),
N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl
4-(N-mafeimidomethyl)-cyclohexane-1-carboxylate (SMCC) and
6-hydrazinonicotimide (HYNIC).
[0176] A bead may be functionalized with a carboxy functional group
and an oligonucleotide may be functionalized with an amino
functional group.
[0177] A support may be smooth. Alternatively, or additionally, a
support may comprise divets, ridges, or wells. A support may
comprise a microwell array. A microwell array may be functionalized
with functional groups that facilitate the attachment of
oligonucleotides. The functional groups on the microwell array may
be different for different positions on the microwell array. The
functional groups on the microwell array may be the same for all
regions of the microwell array.
Assay System Components
Microwell Arrays
[0178] As described above, microwell arrays are used to entrap
single cells and beads (one bead per cell) within a small reaction
chamber of defined volume. Each bead comprises a library of
oligonucleotide probes for use in stochastic labeling and digital
counting of the entire complement of cellular mRNA molecules, which
are released upon lysis of the cell. In one embodiment of the
present disclosure, the microwell arrays are a consumable component
of the assay system. In other embodiments, the microwell arrays may
be reusable. In either case, they may be configured to be used as a
stand-alone device for use in performing assays manually, or they
may be configured to comprise a removable or fixed component of an
instrument that provides for full or partial automation of the
assay procedure.
[0179] The microwells of the array can be fabricated in a variety
of shapes and sizes, which are chosen to optimize the efficiency of
trapping a single cell and bead in each well. Appropriate well
geometries include, but are not limited to, cylindrical, conical,
hemispherical, rectangular, or polyhedral (e.g., three dimensional
geometries comprised of several planar faces, for example,
hexagonal columns, octagonal columns, inverted triangular pyramids,
inverted square pyramids, inverted pentagonal pyramids, inverted
hexagonal pyramids, or inverted truncated pyramids). The microwells
may comprise a shape that combines two or more of these geometries.
For example, in one embodiment it may be partly cylindrical, with
the remainder having the shape of an inverted cone. In another
embodiment, it may include two side-by-side cylinders, one of
larger diameter than the other, that are connected by a vertical
channel (that is, parallel to the cylinder axes) that extends the
full length (depth) of the cylinders. In general, the open end (or
mouth) of each microwell will be located at an upper surface of the
microwell array, but in some embodiments the openings may be
located at a lower surface of the array. In general, the closed end
(or bottom) of the microwell will be flat, but curved surfaces
(e.g., convex or concave) are also possible. In general, the shape
(and size) of the microwells will be determined based on the types
of cells and/or beads to be trapped in the microwells.
[0180] Microwell dimensions may be characterized in terms of the
diameter and depth of the well. As used herein, the diameter of the
microwell refers to the largest circle that can be inscribed within
the planar cross-section of the microwell geometry. In one
embodiment of the present disclosure, the diameter of the
microwells may range from about 0.1 to about 5-fold the diameter of
the cells and/or beads to be trapped within the microwells. In
other embodiments, the microwell diameter is at least 0.1-fold, at
least 0.5-fold, at least 1-fold, at least 2-fold, at least 3-fold,
at least 4-fold, or at least 5-fold the diameter of the cells
and/or beads to be trapped within the microwells. In yet other
embodiments, the microwell diameter is at most 5-fold, at most
4-fold, at most 3-fold, at most 2-fold, at most 1-fold, at most
0.5-fold, or at most 0.1-fold the diameter of the cells and/or
beads to be trapped within the microwells. In one embodiment, the
microwell diameter is about 2.5-fold the diameter of the cells
and/or beads to be trapped within the microwells. Those of skill in
the art will appreciate that the microwell diameter may fall within
any range bounded by any of these values (e.g., from about 0.2-fold
to about 3.5-fold the diameter of the cells and/or beads to be
trapped within the microwells). Alternatively, the diameter of the
microwells can be specified in terms of absolute dimensions. In one
embodiment of the present disclosure, the diameter of the
microwells may range from about 5 to about 50 microns. In other
embodiments, the microwell diameter is at least 5 microns, at least
10 microns, at least 15 microns, at least 20 microns, at least 25
microns, at least 30 microns, at least 35 microns, at least 40
microns, at least 45 microns, or at least 50 microns. In yet other
embodiments, the microwell diameter is at most 50 microns, at most
45 microns, at most 40 microns, at most 35 microns, at most 30
microns, at most 25 microns, at most 20 microns, at most 15
microns, at most 10 microns, or at most 5 microns. In one
embodiment, the microwell diameter is about 30 microns. Those of
skill in the art will appreciate that the microwell diameter may
fall within any range bounded by any of these values (e.g., from
about 28 microns to about 34 microns).
[0181] The microwell depth is chosen to optimize cell and bead
trapping efficiency while also providing efficient exchange of
assay buffers and other reagents contained within the wells. In one
embodiment of the present disclosure, the depth of the microwells
may range from about 0.1 to about 5-fold the diameter of the cells
and/or beads to be trapped within the microwells. In other
embodiments, the microwell depth is at least 0.1-fold, at least
0.5-fold, at least 1-fold, at least 2-fold, at least 3-fold, at
least 4-fold, or at least 5-fold the diameter of the cells and/or
beads to be trapped within the microwells. In yet other
embodiments, the microwell depth is at most 5-fold, at most 4-fold,
at most 3-fold, at most 2-fold, at most 1-fold, at most 0.5-fold,
or at most 0.1-fold the diameter of the cells and/or beads to be
trapped within the microwells. In one embodiment, the microwell
depth is about 2.5-fold the diameter of the cells and/or beads to
be trapped within the microwells. Those of skill in the art will
appreciate that the microwell depth may fall within any range
bounded by any of these values (e.g., from about 0.2-fold to about
3.5-fold the diameter of the cells and/or beads to be trapped
within the microwells). Alternatively, the diameter of the
microwells can be specified in terms of absolute dimensions. In one
embodiment of the present disclosure, the depth of the microwells
may range from about 10 to about 60 microns. In other embodiments,
the microwell depth is at least 10 microns, at least 20 microns, at
least 25 microns, at least 30 microns, at least 35 microns, at
least 40 microns, at least 50 microns, or at least 60 microns. In
yet other embodiments, the microwell depth is at most 60 microns,
at most 50 microns, at most 40 microns, at most 35 microns, at most
30 microns, at most 25 microns, at most 20 microns, or at most 10
microns. In one embodiment, the microwell depth is about 30
microns. Those of skill in the art will appreciate that the
microwell depth may fall within any range bounded by any of these
values (e.g., from about 24 microns to about 36 microns).
[0182] The wells of the microwell array are arranged in a one
dimensional, two dimensional, or three dimensional array, where
three dimensional arrays may be achieved, for example, by stacking
a series of two or more two dimensional arrays (that is, by
stacking two or more substrates comprising microwell arrays). The
pattern and spacing between wells is chosen to optimize the
efficiency of trapping a single cell and bead in each well, as well
as to maximize the number of wells per unit area of the array. The
wells may be distributed according to a variety of random or
non-random patterns, for example, they may be distributed entirely
randomly across the surface of the array substrate, or they may be
arranged in a square grid, rectangular grid, or hexagonal grid. In
one embodiment of the present disclosure, the center-to-center
distance (or spacing) between wells may vary from about 15 microns
to about 75 microns. In other embodiments, the spacing between
wells is at least 15 microns, at least 20 microns, at least 25
microns, at least 30 microns, at least 35 microns, at least 40
microns, at least 45 microns, at least 50 microns, at least 55
microns, at least 60 microns, at least 65 microns, at least 70
microns, or at least 75 microns. In yet other embodiments, the
microwell spacing is at most 75 microns, at most 70 microns, at
most 65 microns, at most 60 microns, at most 55 microns, at most 50
microns, at most 45 microns, at most 40 microns, at most 35
microns, at most 30 microns, at most 25 microns, at most 20
microns, or at most 15 microns. In one embodiment, the microwell
spacing is about 55 microns. Those of skill in the art will
appreciate that the microwell depth may fall within any range
bounded by any of these values (e.g., from about 18 microns to
about 72 microns).
[0183] The microwell array may comprise surface features between
the microwells that are designed to help guide cells and beads into
the wells and/or prevent them from settling on the surfaces between
wells. Examples of suitable surface features include, but are not
limited to, domed, ridged, or peaked surface features that encircle
the wells and/or straddle the surface between wells.
[0184] The total number of wells in the microwell array is
determined by the pattern and spacing of the wells and the overall
dimensions of the array. In one embodiment of the present
disclosure, the number of microwells in the array may range from
about 96 to about 5,000,000 or more. In other embodiments, the
number of microwells in the array is at least 96, at least 384, at
least 1,536, at least 5,000, at least 10,000, at least 25,000, at
least 50,000, at least 75,000, at least 100,000, at least 500,000,
at least 1,000,000, or at least 5,000,000. In yet other
embodiments, the number of microwells in the array is at most
5,000,000, at most 1,000,000, at most 75,000, at most 50,000, at
most 25,000, at most 10,000, at most 5,000, at most 1,536, at most
384, or at most 96 wells. In one embodiment, the number of
microwells in the array is about 96. In another embodiment, the
number of microwells is about 150,000. Those of skill in the art
will appreciate that the number of microwells in the array may fall
within any range bounded by any of these values (e.g., from about
100 to 325,000).
[0185] Microwell arrays may be fabricated using any of a number of
fabrication techniques known to those of skill in the art. Examples
of fabrication methods that may be used include, but are not
limited to, bulk micromachining techniques such as photolithography
and wet chemical etching, plasma etching, or deep reactive ion
etching; micro-molding and micro-embossing; laser micromachining;
3D printing or other direct write fabrication processes using
curable materials; and similar techniques.
[0186] Microwell arrays may be fabricated from any of a number of
substrate materials known to those of skill in the art, where the
choice of material typically depends on the choice of fabrication
technique, and vice versa. Examples of suitable materials include,
but are not limited to, silicon, fused-silica, glass, polymers
(e.g., agarose, gelatin, hydrogels, polydimethylsiloxane (PDMS;
elastomer), polymethylmethacrylate (PMMA), polycarbonate (PC),
polypropylene (PP), polyethylene (PE), high density polyethylene
(HDPE), polyimide, cyclic olefin polymers (COP), cyclic olefin
copolymers (COC), polyethylene terephthalate (PET), and epoxy
resins), metals or metal films (e.g., aluminum, stainless steel,
copper, nickel, chromium, and titanium), and the like. Typically, a
hydrophilic material is desirable for fabrication of the microwell
arrays (to enhance wettability and minimize non-specific binding of
cells and other biological material), but hydrophobic materials
that can be treated or coated (e.g., by oxygen plasma treatment, or
grafting of a polyethylene oxide surface layer) can also be used.
The use of porous, hydrophilic materials for the fabrication of the
microwell array may be desirable in order to facilitate capillary
wicking/venting of entrapped air bubbles in the device. In some
embodiments, the microwell array is fabricated with an optical
adhesive. In some embodiments, the microwell array is fabricated
with a plasma or corona treated material. The use of plasma or
corona treated materials can make the material hydrophillic. In
some embodiments, plasma or corona treated materials, such as a
hydrophillic material, can be more stable than non-treated
materials. In some embodiments, the microwell array is fabricated
from a single material. In other embodiments, the microwell array
may comprise two or more different materials that have been bonded
together or mechanically joined.
[0187] A variety of surface treatments and surface modification
techniques may be used to alter the properties of microwell array
surfaces. Examples include, but are not limited to, oxygen plasma
treatments to render hydrophobic material surfaces more
hydrophilic, the use of wet or dry etching techniques to smooth (or
roughen) glass and silicon surfaces, adsorption and/or grafting of
polyethylene oxide or other polymer layers to substrate surfaces to
render them more hydrophilic and less prone to non-specific
adsorption of biomolecules and cells, the use of silane reactions
to graft chemically-reactive functional groups to otherwise inert
silicon and glass surfaces, etc. Photodeprotection techniques can
be used to selectively activate chemically-reactive functional
groups at specific locations in the array structure, for example,
the selective addition or activation of chemically-reactive
functional groups such as primary amines or carboxyl groups on the
inner walls of the microwells may be used to covalently couple
oligonucleotide probes, peptides, proteins, or other biomolecules
to the walls of the microwells. In general, the choice of surface
treatment or surface modification utilized will depend both on the
type of surface property that is desired and on the type of
material from which the microwell array is made.
[0188] In some embodiments, it may be advantageous to seal the
openings of microwells during, for example, cell lysis steps, to
prevent cross hybridization of target nucleic acid between adjacent
microwells. A microwell may be sealed using a cap such as a solid
support or a bead, where the diameter of the bead is larger than
the diameter of the microwell. For example, a bead used as a cap
can be at least about 10, 20, 30, 40, 50, 60, 70, 80 or 90% larger
than the diameter of the microwell. Alternatively, a cap may be at
most about 10, 20, 30, 40, 50, 60, 70, 80 or 90% larger than the
diameter of the microwell.
[0189] A bead used as a cap may comprise cross-linked dextran beads
(e.g., Sephadex). Cross-linked dextran can range from about 10
micrometers to about 80 micrometers. The cross-linked dextran of
the bead cap can be from 20 micrometers to about 50 micrometers. A
cap can comprise, for example, inorganic nanopore membranes (e.g.,
aluminum oxides), dialysis membranes, glass slides, coverslips,
and/or hydrophilic plastic film (e.g., film coated with a thin film
of agarose hydrated with lysis buffer).
[0190] In some embodiments, the cap may allow buffer to pass into
and out of the microwell, while preventing macromolecules (e.g.,
nucleic acids) from migrating out of the well. A macromolecule of
at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16,
17, 18, 19, or 20 or more nucleotides can be blocked from migrating
into or out of the microwell by the cap. A macromolecule of at most
about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18,
19, or 20 or more nucleotides can be blocked from migrating into or
out of the microwell by the cap.
[0191] In some embodiments, a sealed microwell array can comprise a
single layer of beads on top of the microwells. In some
embodiments, a sealed microwell array can comprise multiple layers
of beads on top of the microwells. A sealed microwell array can
comprise about 1, 2, 3, 4, 5, or 6 or more layers of beads.
Mechanical Fixtures
[0192] When performing multiplexed, single cell stochastic
labeling/molecular indexing assays manually, it is convenient to
mount the microwell array in a mechanical fixture to create a
reaction chamber and facilitate the pipetting or dispensing of cell
suspensions and assay reagents onto the array (FIGS. 69 and 70). In
the example illustrated in FIG. 69, the fixture accepts a microwell
array fabricated on a 1 mm thick substrate, and provides mechanical
support in the form of a silicone gasket to confine the assay
reagents to a reaction chamber that is 16 mm wide.times.35 mm
long.times.approximately 4 mm deep, thereby enabling the use of 800
microliters to 1 milliliter of cell suspension and bead suspension
(comprising bead-based oligonucleotide labels) to perform the
assay.
[0193] The fixture consists of rigid, machined top and bottom
plates (e.g., aluminum) and a compressible (e.g., silicone,
polydimethylsiloxane) gasket for creating the walls of the chamber
or well. Design features include: (i) Chamfered aperture edges and
clearance for rotating microscope objectives in and out of position
as needed (for viewing the microwell array at different
magnifications). (ii) Controlled compression of the silicone gasket
to ensure uniform, repeatable formation of a leak-proof seal with
the microwell array substrate. (iii) Captive fasteners for
convenient operation. (iv) A locating clamp mechanism for secure
and repeatable positioning of the array. (v) Convenient disassembly
for removal of the array during rinse steps.
[0194] The top and bottom plates may be fabricated using any of a
variety of techniques (e.g., conventional machining, CNC machining,
injection molding, 3D printing, etc.) using a variety of materials
(e.g., aluminum, anodized aluminum, stainless steel, teflon,
polymethylmethacrylate (PMMA), polycarbonate (PC), or similar rigid
polymer materials).
[0195] The silicone (polydimethylsiloxane; PDMS) gasket may be
configured to create multiple chambers (see FIG. 71) in order to
run controls and experiments (or replicate experiments, or multiple
independent experiments) in parallel. The gasket is molded from
PDMS or similar elastomeric material using a Teflon mold that
includes draft angles for the vertical gasket walls to provide for
good release characteristics. Alternatively, molds can be machined
from aluminum or other materials (e.g., black delrin,
polyetherimide (ultem), etc.), and coated with Teflon if necessary
to provide for good release characteristics. The gasket mold
designs are inverted, i.e. so that the top surface of the molded
part (i.e. the surface at the interface with a glass slide or
silicon wafer used to cover the mold during casting) becomes the
surface for creating a seal with the microwell array substrate
during use, thereby avoiding potential problems with mold surface
roughness and surface contamination in creating a smooth gasket
surface (to ensure a leak-proof seal with the array substrate), and
also providing for a flexible choice of substrate materials and the
option of pre-assembly by using the microwell array substrate as a
base during casting. The gasket mold designs may also include force
focusing ridges at the boundaries of the well areas, i.e. the
central mesa(s) in the mold (which form the well(s)) have raised
ridges at the locations which become the perimeter of the well(s),
so that a cover placed on top of the mold after filling rests on a
small contact area at the precise location where good edge profile
is critical for forming a leak-proof seal between the gasket and
substrate during use.
Instrument Systems
[0196] The present disclosure also includes instrument systems and
consumables to support the automation of multiplexed, single cell
stochastic labeling/molecular indexing assays. Such systems may
include consumable cartridges that incorporate microwell arrays
integrated with flow cells, as well as the instrumentation
necessary to provide control and analysis functionality such as (i)
fluidics control, (ii) temperature control, (iii) cell and/or bead
distribution and collection mechanisms, (iv) cell lysis mechanisms,
(v) imaging capability, and (vi) image processing. In some
embodiments, the input for the system comprises a cell sample and
the output comprises a bead suspension comprising beads having
attached oligonucleotides that incorporate sample tags, cell tags,
and molecular indexing tags. In other embodiments, the system may
include additional functionality, such as thermal cycling
capability for performing PCR amplification, in which case the
input for the system comprises a cell sample and the output
comprises an oligonucleotide library resulting from amplification
of the oligonucleotides incorporating sample tags, cell tags, and
molecular indexing tags that were originally attached to beads. In
yet other embodiments, the system may also include sequencing
capability, with or without the need for oligonucleotide
amplification, in which case the input for the system is a cell
sample and the output comprises a dataset further comprising the
sequences of all sample tag, cell tag, and molecular indexing tags
associated with the target sequences of interest.
Microwell Array Flow Cells
[0197] In many embodiments of the automated assay system, the
microwell array substrate will be packaged within a flow cell that
provides for convenient interfacing with the rest of the fluid
handling system and facilitates the exchange of fluids, e.g., cell
and bead suspensions, lysis buffers, rinse buffers, etc., that are
delivered to the microwell array. Design features may include: (i)
one or more inlet ports for introducing cell samples, bead
suspensions, and/or other assay reagents, (ii) one or more
microwell array chambers designed to provide for uniform filling
and efficient fluid-exchange while minimizing back eddies or dead
zones, and (iii) one or more outlet ports for delivery of fluids to
a sample collection point and/or a waste reservoir. In some
embodiments, the design of the flow cell may include a plurality of
microarray chambers that interface with a plurality of microwell
arrays such that one or more cell samples may be processed in
parallel. In some embodiments, the design of the flow cell may
further include features for creating uniform flow velocity
profiles, i.e. "plug flow", across the width of the array chamber
to provide for more uniform delivery of cells and beads to the
microwells, for example, by using a porous barrier located near the
chamber inlet and upstream of the microwell array as a "flow
diffuser", or by dividing each array chamber into several
subsections that collectively cover the same total array area, but
through which the divided inlet fluid stream flows in parallel. In
some embodiments, the flow cell may enclose or incorporate more
than one microwell array substrate. In some embodiments, the
integrated microwell array/flow cell assembly may constitute a
fixed component of the system. In some embodiments, the microwell
array/flow cell assembly may be removable from the instrument.
[0198] In general, the dimensions of fluid channels and the array
chamber(s) in flow cell designs will be optimized to (i) provide
uniform delivery of cells and beads to the microwell array, and
(ii) to minimize sample and reagent consumption. In some
embodiments, the width of fluid channels will be between 50 microns
and 20 mm. In other embodiments, the width of fluid channels may be
at least 50 microns, at least 100 microns, at least 200 microns, at
least 300 microns, at least 400 microns, at least 500 microns, at
least 750 microns, at least 1 mm, at least 2.5 mm, at least 5 mm,
at least 10 mm, or at least 20 mm. In yet other embodiments, the
width of fluid channels may at most 20 mm, at most 10 mm, at most 5
mm, at most 2.5 mm, at most 1 mm, at most 750 microns, at most 500
microns, at most 400 microns, at most 300 microns, at most 200
microns, at most 100 microns, or at most 50 microns. In one
embodiment, the width of fluid channels is about 2 mm. Those of
skill in the art will appreciate that the width of the fluid
channels may fall within any range bounded by any of these values
(e.g., from about 250 microns to about 3 mm).
[0199] In some embodiments, the depth of the fluid channels will be
between 50 microns and 10 mm. In other embodiments, the depth of
fluid channels may be at least 50 microns, at least 100 microns, at
least 200 microns, at least 300 microns, at least 400 microns, at
least 500 microns, at least 750 microns, at least 1 mm, at least
1.25 mm, at least 1.5 mm, at least 1.75 mm, at least 2 mm, at least
2.5 mm, at least 3 mm, at least 3.5 mm, at least 4 mm, at least 4.5
mm, at least 5 mm, at least 5.5 mm, at least 6 mm, at least 6.5 mm,
at least 7 mm, at least 7.5 mm, at least 8 mm, at least 8.5 mm, at
least 9 mm, or at least 9.5 mm. In other embodiments, the depth of
fluid channels may be at most 10 mm, at most 9.5 mm, at most 9 mm,
at most 8.5 mm, at most 8 mm, at most 7.5 mm, at most 7 mm, at most
6.5 mm, at most 6 mm, at most 5.5 mm, at most 5 mm, at most 4.5 mm,
at most 4 mm, at most 3.5 mm, at most 3 mm, at most 2 mm, at most
1.75 mm, at most 1.5 mm, at most 1.25 mm, at most 1 mm, at most 750
microns, at most 500 microns, at most 400 microns, at most 300
microns, at most 200 microns, at most 100 microns, or at most 50
microns. In one embodiment, the depth of the fluid channels is
about 1 mm. Those of skill in the art will appreciate that the
depth of the fluid channels may fall within any range bounded by
any of these values (e.g., from about 800 microns to about 1
mm).
[0200] Flow cells may be fabricated using a variety of techniques
and materials known to those of skill in the art. In general, the
flow cell will be fabricated as a separate part and subsequently
either mechanically clamped or permanently bonded to the microwell
array substrate. Examples of suitable fabrication techniques
include conventional machining, CNC machining, injection molding,
3D printing, alignment and lamination of one or more layers of
laser or die-cut polymer films, or any of a number of
microfabrication techniques such as photolithography and wet
chemical etching, dry etching, deep reactive ion etching, or laser
micromachining Once the flow cell part has been fabricated it may
be attached to the microwell array substrate mechanically, e.g., by
clamping it against the microwell array substrate (with or without
the use of a gasket), or it may be bonded directly to the microwell
array substrate using any of a variety of techniques (depending on
the choice of materials used) known to those of skill in the art,
for example, through the use of anodic bonding, thermal bonding,
ultrasonic welding, or any of a variety of adhesives or adhesive
films, including epoxy-based, acrylic-based, silicone-based, UV
curable, polyurethane-based, or cyanoacrylate-based adhesives.
[0201] Flow cells may be fabricated using a variety of materials
known to those of skill in the art. Examples of suitable materials
include, but are not limited to, silicon, fused-silica, glass, any
of a variety of polymers, e.g., polydimethylsiloxane (PDMS;
elastomer), polymethylmethacrylate (PMMA), polycarbonate (PC),
polypropylene (PP), polyethylene (PE), high density polyethylene
(HDPE), polyimide, cyclic olefin polymers (COP), cyclic olefin
copolymers (COC), polyethylene terephthalate (PET), epoxy resins,
metals (e.g., aluminum, stainless steel, copper, nickel, chromium,
and titanium), or a combination of these materials.
Cartridges
[0202] In many embodiments of the automated assay system, the
microwell array, with or without an attached flow cell, will be
packaged within a consumable cartridge that interfaces with the
instrument system and which may incorporate additional
functionality. Design features of cartridges may include (i) one or
more inlet ports for creating fluid connections with the instrument
and/or manually introducing cell samples, bead suspensions, and/or
other assay reagents into the cartridge, (ii) one or more bypass
channels, i.e. for self-metering of cell samples and bead
suspensions, to avoid overfilling and/or back flow, (iii) one or
more integrated microwell array/flow cell assemblies, or one or
more chambers within which the microarray substrate(s) are
positioned, (iv) integrated miniature pumps or other fluid
actuation mechanisms for controlling fluid flow through the device,
(v) integrated miniature valves for compartmentalizing pre-loaded
reagents and/or controlling fluid flow through the device, (vi)
vents for providing an escape path for trapped air, (vii) one or
more sample and reagent waste reservoirs, (viii) one or more outlet
ports for creating fluid connections with the instrument and/or
providing a processed sample collection point, (ix) mechanical
interface features for reproducibly positioning the removable,
consumable cartridge with respect to the instrument system, and for
providing access so that external magnets can be brought into close
proximity with the microwell array, (x) integrated temperature
control components and/or a thermal interface for providing good
thermal contact with the instrument system, and (xi) optical
interface features, e.g., a transparent window, for use in optical
interrogation of the microwell array. In some embodiments, the
cartridge is designed to process more than one sample in parallel.
In some embodiments of the device, the cartridge may further
comprise one or more removable sample collection chamber(s) that
are suitable for interfacing with stand-alone PCR thermal cyclers
and/or sequencing instruments. In some embodiments of the device,
the cartridge itself is suitable for interfacing with stand-alone
PCR thermal cyclers and/or sequencing instruments.
[0203] In some embodiments of the device, the cartridge may further
comprise components that are designed to create physical and/or
chemical barriers that prevent diffusion of (or increase path
lengths and diffusion times for) large molecules in order to
minimize cross-contamination between microwells. Examples of such
barriers include, but are not limited to, a pattern of serpentine
channels used for delivery of cells and beads to the microwell
array, a retractable platen or deformable membrane that is pressed
into contact with the surface of the microwell array substrate
during lysis or incubation steps, the use of larger beads, e.g.,
Sephadex beads as described previously, to block the openings of
the microwells, or the release of an immiscible, hydrophobic fluid
from a reservoir within the cartridge during lysis or incubation
steps, to effectively separate and compartmentalize each microwell
in the array. Any or all of these barriers, or an embodiment
without such barriers, may be combined with raising the viscosity
of the solution in and adjacent to the microwells, e.g., through
the addition of solution components such as glycerol or
polyethylene glycol.
[0204] In general, the dimensions of fluid channels and the array
chamber(s) in cartridge designs will be optimized to (i) provide
uniform delivery of cells and beads to the microwell array, and
(ii) to minimize sample and reagent consumption. In some
embodiments, the width of fluid channels will be between 50 microns
and 20 mm. In other embodiments, the width of fluid channels may be
at least 50 microns, at least 100 microns, at least 200 microns, at
least 300 microns, at least 400 microns, at least 500 microns, at
least 750 microns, at least 1 mm, at least 2.5 mm, at least 5 mm,
at least 10 mm, or at least 20 mm. In yet other embodiments, the
width of fluid channels may at most 20 mm, at most 10 mm, at most 5
mm, at most 2.5 mm, at most 1 mm, at most 750 microns, at most 500
microns, at most 400 microns, at most 300 microns, at most 200
microns, at most 100 microns, or at most 50 microns. In one
embodiment, the width of fluid channels is about 2 mm. Those of
skill in the art will appreciate that the width of the fluid
channels may fall within any range bounded by any of these values
(e.g., from about 250 microns to about 3 mm).
[0205] In some embodiments, the depth of the fluid channels in
cartridge designs will be between 50 microns and 10 mm. In other
embodiments, the depth of fluid channels may be at least 50
microns, at least 100 microns, at least 200 microns, at least 300
microns, at least 400 microns, at least 500 microns, at least 750
microns, at least 1 mm, at least 1.25 mm, at least 1.5 mm, at least
1.75 mm, at least 2 mm, at least 2.5 mm, at least 3 mm, at least
3.5 mm, at least 4 mm, at least 4.5 mm, at least 5 mm, at least 5.5
mm, at least 6 mm, at least 6.5 mm, at least 7 mm, at least 7.5 mm,
at least 8 mm, at least 8.5 mm, at least 9 mm, or at least 9.5 mm.
In yet other embodiments, the depth of fluid channels may be at
most 10 mm, at most 9.5 mm, at most 9 mm, at most 8.5 mm, at most 8
mm, at most 7.5 mm, at most 7 mm, at most 6.5 mm, at most 6 mm, at
most 5.5 mm, at most 5 mm, at most 4.5 mm, at most 4 mm, at most
3.5 mm, at most 3 mm, at most 2 mm, at most 1.75 mm, at most 1.5
mm, at most 1.25 mm, at most 1 mm, at most 750 microns, at most 500
microns, at most 400 microns, at most 300 microns, at most 200
microns, at most 100 microns, or at most 50 microns. In one
embodiment, the depth of the fluid channels is about 1 mm. Those of
skill in the art will appreciate that the depth of the fluid
channels may fall within any range bounded by any of these values
(e.g., from about 800 microns to about 1 mm).
[0206] Cartridges may be fabricated using a variety of techniques
and materials known to those of skill in the art. In general, the
cartridges will be fabricated as a series of separate component
parts (FIG. 72) and subsequently assembled (FIGS. 72 and 73) using
any of a number of mechanical assembly or bonding techniques.
Examples of suitable fabrication techniques include, but are not
limited to, conventional machining, CNC machining, injection
molding, thermoforming, and 3D printing. Once the cartridge
components have been fabricated they may be mechanically assembled
using screws, clips, and the like, or permanently bonded using any
of a variety of techniques (depending on the choice of materials
used), for example, through the use of thermal or ultrasonic
bonding/welding or any of a variety of adhesives or adhesive films,
including epoxy-based, acrylic-based, silicone-based, UV curable,
polyurethane-based, or cyanoacrylate-based adhesives.
[0207] Cartridge components may be fabricated using any of a number
of suitable materials, including but not limited to silicon,
fused-silica, glass, any of a variety of polymers, e.g.,
polydimethylsiloxane (PDMS; elastomer), polymethylmethacrylate
(PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE),
high density polyethylene (HDPE), polyimide, cyclic olefin polymers
(COP), cyclic olefin copolymers (COC), polyethylene terephthalate
(PET), epoxy resins, or metals (e.g., aluminum, stainless steel,
copper, nickel, chromium, and titanium).
[0208] As described above, the inlet and outlet features of the
cartridge may be designed to provide convenient and leak-proof
fluid connections with the instrument, or may serve as open
reservoirs for manual pipetting of samples and reagents into or out
of the cartridge. Examples of convenient mechanical designs for the
inlet and outlet port connectors include, but are not limited to,
threaded connectors, swaged connectors, Luer lock connectors, Luer
slip or "slip tip" connectors, press fit connectors, and the like.
In some embodiments, the inlet and outlet ports of the cartridge
may further comprise caps, spring-loaded covers or closures, phase
change materials, or polymer membranes that may be opened or
punctured when the cartridge is positioned in the instrument, and
which serve to prevent contamination of internal cartridge surfaces
during storage and/or which prevent fluids from spilling when the
cartridge is removed from the instrument. As indicated above, in
some embodiments the one or more outlet ports of the cartridge may
further comprise a removable sample collection chamber that is
suitable for interfacing with stand-alone PCR thermal cyclers
and/or sequencing instruments.
[0209] As indicated above, in some embodiments the cartridge may
include integrated miniature pumps or other fluid actuation
mechanisms for control of fluid flow through the device. Examples
of suitable miniature pumps or fluid actuation mechanisms include,
but are not limited to, electromechanically- or
pneumatically-actuated miniature syringe or plunger mechanisms,
chemical propellants, membrane diaphragm pumps actuated
pneumatically or by an external piston, pneumatically-actuated
reagent pouches or bladders, or electro-osmotic pumps.
[0210] As described above, in some embodiments the cartridge may
include miniature valves for compartmentalizing pre-loaded reagents
and/or controlling fluid flow through the device. Examples of
suitable miniature valves include, but are not limited to, one-shot
"valves" fabricated using wax or polymer plugs that can be melted
or dissolved, or polymer membranes that can be punctured; pinch
valves constructed using a deformable membrane and pneumatic,
hydraulic, magnetic, electromagnetic, or electromechanical
(solenoid) acutation, one-way valves constructed using deformable
membrane flaps, and miniature gate valves.
[0211] As indicated above, in some embodiments the cartridge may
include vents for providing an escape path for trapped air. Vents
may be constructed according to a variety of techniques known to
those of skill in the art, for example, using a porous plug of
polydimethylsiloxane (PDMS) or other hydrophobic material that
allows for capillary wicking of air but blocks penetration by
water. Vents may also be constructed as apertures through
hydrophobic barrier materials, such that wetting to the aperture
walls does not occur at the pressures used during operation.
[0212] In general, the mechanical interface features of the
cartridge provide for easily removable but highly precise and
repeatable positioning of the cartridge relative to the instrument
system. Suitable mechanical interface features include, but are not
limited to, alignment pins, alignment guides, mechanical stops, and
the like. In some embodiments, the mechanical design features will
include relief features for bringing external apparatus, e.g.,
magnets or optical components, into close proximity with the
microwell array chamber (FIG. 72).
[0213] In some embodiments, the cartridge will also include
temperature control components or thermal interface features for
mating to external temperature control modules. Examples of
suitable temperature control elements include, but are not limited
to, resistive heating elements, miniature infrared-emitting light
sources, Peltier heating or cooling devices, heat sinks,
thermistors, thermocouples, and the like. Thermal interface
features will typically be fabricated from materials that are good
thermal conductors (e.g., copper, gold, silver, aluminium, etc.)
and will typically comprise one or more flat surfaces capable of
making good thermal contact with external heating blocks or cooling
blocks.
[0214] In many embodiments, the cartridge will include optical
interface features for use in optical imaging or spectroscopic
interrogation of the microwell array. Typically, the cartridge will
include an optically transparent window, e.g., the microwell
substrate itself or the side of the flow cell or microarray chamber
that is opposite the microwell array, fabricated from a material
that meets the spectral requirements for the imaging or
spectroscopic technique used to probe the microwell array. Examples
of suitable optical window materials include, but are not limited
to, glass, fused-silica, polymethylmethacrylate (PMMA),
polycarbonate (PC), cyclic olefin polymers (COP), or cyclic olefin
copolymers (COC). Typically, the cartridge will include a second
optically transparent or translucent window or region which can be
used to illuminate the microwell array in transverse, reflected, or
oblique illumination orientations.
Instruments
[0215] The present disclosure also includes instruments for use in
the automation of multiplexed, single cell stochastic
labeling/molecular indexing assays. As indicated above, these
instruments may provide control and analysis functionality such as
(i) fluidics control, (ii) temperature control, (iii) cell and/or
bead distribution and collection mechanisms, (iv) cell lysis
mechanisms, (v) magnetic field control, (vi) imaging capability,
and (vii) image processing. In some embodiments, the instrument
system may comprise one or more modules (one possible embodiment of
which is illustrated schematically in FIG. 74), where each module
provides one or more specific functional feature sets to the
system. In other embodiments, the instrument system may be packaged
such that all system functionality resides within the same package.
FIG. 75 provides a schematic illustration of the process steps
included in one embodiment of the automated system. As indicated
above, in some embodiments, the system may comprise additional
functional units, either as integrated components or as modular
components of the system, that expand the functional capabilities
of the system to include PCR amplification (or other types of
oligonucleotide amplification techniques) and oligonucleotide
sequencing.
[0216] In general, the instrument system will provide fluidics
capability for delivering samples and/or reagents to the one or
more microarray chamber(s) or flow cell(s) within one or more assay
cartridge(s) connected to the system. Assay reagents and buffers
may be stored in bottles, reagent and buffer cartridges, or other
suitable containers that are connected to the cartridge inlets. The
system may also include waste reservoirs in the form of bottles,
waste cartridges, or other suitable waste containers for collecting
fluids downstream of the assay cartridge(s). Control of fluid flow
through the system will typically be performed through the use of
pumps (or other fluid actuation mechanisms) and valves. Examples of
suitable pumps include, but are not limited to, syringe pumps,
programmable syringe pumps, peristaltic pumps, diaphragm pumps, and
the like. In some embodiments, fluid flow through the system may be
controlled by means of applying positive pneumatic pressure at the
one or more inlets of the reagent and buffer containers, or at the
inlets of the assay cartridge(s). In some embodiments, fluid flow
through the system may be controlled by means of drawing a vacuum
at the one or more outlets of the waste reservoirs, or at the
outlets of the assay cartridge(s). Examples of suitable valves
include, but are not limited to, check valves, electromechanical
two-way or three-way valves, pneumatic two-way and three-way
valves, and the like. In some embodiments, pulsatile flow may be
applied during assay wash/rinse steps to facilitate complete and
efficient exchange of fluids within the one or more microwell array
flow cell(s) or chamber(s).
[0217] As indicated above, in some embodiments the instrument
system may include mechanisms for further facilitating the uniform
distribution of cells and beads over the microwell array. Examples
of such mechanisms include, but are not limited to, rocking,
shaking, swirling, recirculating flow, low frequency agitation (for
example, using a rocker plate or through pulsing of a flexible
(e.g., silicone) membrane that forms a wall of the chamber or
nearby fluid channel), or high frequency agitation (for example,
through the use of piezoelectric transducers). In some embodiments,
one or more of these mechanisms is utilized in combination with
physical structures or features on the interior walls of the flow
cell or array chamber, e.g., mezzanine/top hat structures,
chevrons, or ridge arrays, to facilitate mixing and/or to help
prevent pooling of cells or beads within the array chamber.
Flow-enhancing ribs on upper or lower surfaces of the flow cell or
array chamber may be used to control flow velocity profiles and
reduce shear across the microwell openings (i.e. to prevent cells
or beads from being pulled out of the microwells during reagent
exchange and rinse steps).
[0218] In some embodiments, the instrument system may include
mechanical cell lysis capability as an alternative to the use of
detergents or other reagents. Sonication using a high frequency
piezoelectric transducer is one example of a suitable
technique.
[0219] In some embodiments, the instrument system will include
temperature control functionality for the purpose of facilitating
the accuracy and reproducibility of assay results, for example,
cooling of the microwell array flow cell or chamber may be
advantageous for minimizing molecular diffusion between microwells.
Examples of temperature control components that may be incorporated
into the instrument system design include, but are not limited to,
resistive heating elements, infrared light sources, Peltier heating
or cooling devices, heat sinks, thermistors, thermocouples, and the
like. In some embodiments of the system, the temperature controller
may provide for programmable changes in temperature over specified
time intervals.
[0220] As indicated elsewhere in this disclosure, many embodiments
of the disclosed methods utilize magnetic fields for removing beads
from the microwells upon completion of the assay. In some
embodiments, the instrument system may further comprise use of
magnetic fields for transporting beads into or out of the microwell
array flow cell or chamber. Examples of suitable means for
providing control of magnetic fields include, but are not limited
to, use of electromagnets in fixed position(s) relative to the
cartridge, or the use of permanent magnets that are mechanically
repositioned as necessary. In some embodiments of the instrument
system, the strength of the applied magnetic field(s) will be
varied by varying the amount of current applied to one or more
electromagnets. In some embodiments of the instrument system, the
strength of the applied magnetic fields will be varied by changing
the position of one or more permanent magnets relative to the
position of the microarray chamber(s) using, for example, stepper
motor-driven linear actuators, servo motor-driven linear actuators,
or cam shaft mechanisms. In some embodiments of the instrument
system, the use of pulsed magnetic fields may be advantageous, for
example, to prevent clustering of magnetic beads. In some
embodiments, a magnet in close proximity to the array or chamber
may be moved, once or multiple times, between at least two
positions relative to the microwell array. Motion of the magnets
can serve to agitate beads within microwells, to facilitate removal
of beads from microwells, or to collect magnetic beads at a desired
location.
[0221] As indicated above, in many embodiments the instrument
system will include optical imaging and/or other spectroscopic
capabilities. Such functionality may be useful, for example, for
inspection of the microwell array(s) to determine whether or not
the array has been uniformly and optimally populated with cells
and/or beads. Any of a variety of imaging modes may be utilized,
including but not limited to, bright-field, dark-field, and
fluorescence/luminescence imaging. The choice of imaging mode will
impact the design of microwell arrays, flow cells, and cartridge
chambers in that the array substrate and/or opposing wall of the
flow cell or array chamber will necessarily need to be transparent
or translucent over the spectral range of interest. In some
embodiments, each microwell array may be imaged in its entirety
within a single image. In some embodiments, a series of images may
be "tiled" to create a high resolution image of the entire array.
In some embodiment, a single image that represents a subsection of
the array may be used to evaluate properties, e.g., cell or bead
distributions, for the array as a whole. In some embodiments, dual
wavelength excitation and emission (or multi-wavelength excitation
and/or emission) imaging may be performed. Any of a variety of
light sources may be used to provide the imaging and/or excitation
light, including but not limited to, tungsten lamps,
tungsten-halogen lamps, arc lamps, lasers, light emitting diodes
(LEDs), or laser diodes. Any of a variety of image sensors may be
used for imaging purposes, including but not limited to, photodiode
arrays, charge-coupled device (CCD) cameras, or CMOS image sensors.
The optical system will typically include a variety of optical
components for steering, shaping, filtering, and/or focusing light
beams through the system. Examples of suitable optical components
include, but are not limited to, lenses, mirrors, prisms,
diffraction gratings, colored glass filters, narrowband
interference filters, broadband interference filters, dichroic
reflectors, optical fibers, optical waveguides, and the like. In
some embodiments, the instrument system may use an optically
transparent microarray substrate as a waveguide for delivering
excitation light to the microwell array. The choice of imaging mode
may also enable the use of other types of assays to be run in
parallel with stochastic labeling/molecular indexing assays, for
example, the use of trypan blue live cell/dead cell assays with
bright field imaging, the use of fluorescence-based live cell/dead
cell assays with fluorescence imaging, etc. Correlation of
viability data for individual cells with the cell tag associated
with each bead in the associated microwell may provide an
additional level of discrimination in analyzing the data from
multiplexed, single cell assays. Alternatively, viability data in
the form of statistics for multiple cells may be employed for
enhancing the analytical capabilities and quality assurance of the
assay.
[0222] n some embodiments, the system may comprise non-imaging
and/or non-optical capabilities for probing the microwell array.
Examples of non-imaging and/or non-optical techniques for detecting
trapped air bubbles, determining the cell and/or bead distribution
over the array, etc., include but are not limited to measurements
of light scattering, ultraviolet/visible/infrared absorption
measurements (e.g., using stained cells and/or beads that
incorporate dyes), coherent raman scattering, and conductance
measurements (e.g., using microfabricated arrays of electrodes in
register with the microwell arrays).
System Processor and Software
[0223] In general, instrument systems designed to support the
automation of multiplexed, single cell stochastic
labeling/molecular indexing assays will include a processor or
computer, along with software to provide (i) instrument control
functionality, (ii) image processing and analysis capability, and
(iii) data storage, analysis, and display functionality.
[0224] In many embodiments, the instrument system will comprise a
computer (or processor) and computer-readable media that includes
code for providing a user interface as well as manual,
semi-automated, or fully-automated control of all system functions,
i.e. control of the fluidics system, the temperature control
system, cell and/or bead distribution functions, magnetic bead
manipulation functions, and the imaging system. Examples of fluid
control functions provided by the instrument control software
include, but are not limited to, volumetric fluid flow rates, fluid
flow velocities, the timing and duration for sample and bead
addition, reagent addition, and rinse steps. Examples of
temperature control functions provided by the instrument control
software include, but are not limited to, specifying temperature
set point(s) and control of the timing, duration, and ramp rates
for temperature changes. Examples of cell and/or bead distribution
functions provided by the instrument control software include, but
are not limited to, control of agitation parameters such as
amplitude, frequency, and duration. Examples of magnetic field
functions provided by the instrument control software include, but
are not limited to, the timing and duration of the applied magnetic
field(s), and in the case of electromagnets, the strength of the
magnetic field as well. Examples of imaging system control
functions provided by the instrument control software include, but
are not limited to, autofocus capability, control of illumination
and/or excitation light exposure times and intensities, control of
image acquisition rate, exposure time, and data storage
options.
[0225] In some embodiments of the instrument system, the system
will further comprise computer-readable media that includes code
for providing image processing and analysis capability. Examples of
image processing and analysis capability provided by the software
include, but are not limited to, manual, semi-automated, or
fully-automated image exposure adjustment (e.g., white balance,
contrast adjustment, signal-averaging and other noise reduction
capability, etc.), automated object identification (i.e. for
identifying cells and beads in the image), automated statistical
analysis (i.e. for determining the number of cells and/or beads
identified per unit area of the microwell array, or for identifying
wells that contain more than one cell or more than one bead), and
manual measurement capabilities (e.g., for measuring distances
between objects, etc.). In some embodiments, the instrument control
and image processing/analysis software will be written as separate
software modules. In some embodiments, the instrument control and
image processing/analysis software will be incorporated into an
integrated package. In some embodiments, the system software may
provide integrated real-time image analysis and instrument control,
so that cell and bead sample loading steps can be prolonged or
repeated until optimal cell/bead distributions are achieved.
[0226] In some embodiments of the instrument system, the system
will comprise computer-readable media that includes code for
providing sequence data analysis. Examples of sequence data
analysis functionality that may be provided by the data analysis
software includes, but is not limited to, (i) algorithms for
determining the number of reads per gene per cell, and the number
of unique transcript molecules per gene per cell, based on the data
provided by sequencing the oligonucleotide library created by
running the assay, (ii) statistical analysis of the sequencing
data, e.g., principal component analysis, for predicting confidence
intervals for determinations of the number of transcript molecules
per gene per cell, etc., (iii) sequence alignment capabilities for
alignment of gene sequence data with known reference sequences,
(iv) decoding/demultiplexing of sample barcodes, cell barcodes, and
molecular barcodes, and (v) automated clustering of molecular
labels to compensate for amplification or sequencing errors.
[0227] In general, the computer or processor included in the
presently disclosed instrument systems, as illustrated in FIG. 76,
may be further understood as a logical apparatus that can read
instructions from media 511 and/or a network port 505, which can
optionally be connected to server 509 having fixed media 512. The
system 500, such as shown in FIG. 76 can include a CPU 501, disk
drives 503, optional input devices such as keyboard 515 and/or
mouse 516 and optional monitor 507. Data communication can be
achieved through the indicated communication medium to a server at
a local or a remote location. The communication medium can include
any means of transmitting and/or receiving data. For example, the
communication medium can be a network connection, a wireless
connection or an internet connection. Such a connection can provide
for communication over the World Wide Web. It is envisioned that
data relating to the present disclosure can be transmitted over
such networks or connections for reception and/or review by a party
522 as illustrated in FIG. 76.
[0228] FIG. 77 is a block diagram illustrating a first example
architecture of a computer system 100 that can be used in
connection with example embodiments of the present disclosure. As
depicted in FIG. 77, the example computer system can include a
processor 102 for processing instructions. Non-limiting examples of
processors include: Intel Xeon.TM. processor, AMD Opteron.TM.
processor, Samsung 32-bit RISC ARM 1176JZ(F)-S v1.0.TM. processor,
ARM Cortex-A8 Samsung S5PC100.TM. processor, ARM Cortex-A8 Apple
A4.TM. processor, Marvell PXA 930.TM. processor, or a
functionally-equivalent processor. Multiple threads of execution
can be used for parallel processing. In some embodiments, multiple
processors or processors with multiple cores can also be used,
whether in a single computer system, in a cluster, or distributed
across systems over a network comprising a plurality of computers,
cell phones, and/or personal data assistant devices.
[0229] As illustrated in FIG. 77, a high speed cache 104 can be
connected to, or incorporated in, the processor 102 to provide a
high speed memory for instructions or data that have been recently,
or are frequently, used by processor 102. The processor 102 is
connected to a north bridge 106 by a processor bus 108. The north
bridge 106 is connected to random access memory (RAM) 110 by a
memory bus 112 and manages access to the RAM 110 by the processor
102. The north bridge 106 is also connected to a south bridge 114
by a chipset bus 116. The south bridge 114 is, in turn, connected
to a peripheral bus 118. The peripheral bus can be, for example,
PCI, PCI-X, PCI Express, or other peripheral bus. The north bridge
and south bridge are often referred to as a processor chipset and
manage data transfer between the processor, RAM, and peripheral
components on the peripheral bus 118. In some alternative
architectures, the functionality of the north bridge can be
incorporated into the processor instead of using a separate north
bridge chip.
[0230] In some embodiments, system 100 can include an accelerator
card 122 attached to the peripheral bus 118. The accelerator can
include field programmable gate arrays (FPGAs) or other hardware
for accelerating certain processing. For example, an accelerator
can be used for adaptive data restructuring or to evaluate
algebraic expressions used in extended set processing.
[0231] Software and data are stored in external storage 124 and can
be loaded into RAM 110 and/or cache 104 for use by the processor.
The system 100 includes an operating system for managing system
resources; non-limiting examples of operating systems include:
Linux, Window.TM., MACOS.TM., BlackBerry OS.TM., iOS.TM., and other
functionally-equivalent operating systems, as well as application
software running on top of the operating system for managing data
storage and optimization in accordance with example embodiments of
the present invention.
[0232] In this example, system 100 also includes network interface
cards (NICs) 120 and 121 connected to the peripheral bus for
providing network interfaces to external storage, such as Network
Attached Storage (NAS) and other computer systems that can be used
for distributed parallel processing.
[0233] FIG. 78 is a diagram showing a network 200 with a plurality
of computer systems 202a, and 202b, a plurality of cell phones and
personal data assistants 202c, and Network Attached Storage (NAS)
204a, and 204b. In example embodiments, systems 212a, 212b, and
212c can manage data storage and optimize data access for data
stored in Network Attached Storage (NAS) 214a and 214b. A
mathematical model can be used for the data and be evaluated using
distributed parallel processing across computer systems 212a, and
212b, and cell phone and personal data assistant systems 212c.
Computer systems 212a, and 212b, and cell phone and personal data
assistant systems 212c can also provide parallel processing for
adaptive data restructuring of the data stored in Network Attached
Storage (NAS) 214a and 214b. FIG. 78 illustrates an example only,
and a wide variety of other computer architectures and systems can
be used in conjunction with the various embodiments of the present
invention. For example, a blade server can be used to provide
parallel processing. Processor blades can be connected through a
back plane to provide parallel processing. Storage can also be
connected to the back plane or as Network Attached Storage (NAS)
through a separate network interface.
[0234] In some example embodiments, processors can maintain
separate memory spaces and transmit data through network
interfaces, back plane or other connectors for parallel processing
by other processors. In other embodiments, some or all of the
processors can use a shared virtual address memory space.
[0235] FIG. 79 is a block diagram of a multiprocessor computer
system 300 using a shared virtual address memory space in
accordance with an example embodiment. The system includes a
plurality of processors 302a-f that can access a shared memory
subsystem 304. The system incorporates a plurality of programmable
hardware memory algorithm processors (MAPs) 306a-f in the memory
subsystem 304. Each MAP 306a-f can comprise a memory 308a-f and one
or more field programmable gate arrays (FPGAs) 310a-f. The MAP
provides a configurable functional unit and particular algorithms
or portions of algorithms can be provided to the FPGAs 310a-f for
processing in close coordination with a respective processor. For
example, the MAPs can be used to evaluate algebraic expressions
regarding the data model and to perform adaptive data restructuring
in example embodiments. In this example, each MAP is globally
accessible by all of the processors for these purposes. In one
configuration, each MAP can use Direct Memory Access (DMA) to
access an associated memory 308a-f, allowing it to execute tasks
independently of, and asynchronously from, the respective
microprocessor 302a-f. In this configuration, a MAP can feed
results directly to another MAP for pipelining and parallel
execution of algorithms.
[0236] The above computer architectures and systems are examples
only, and a wide variety of other computer, cell phone, and
personal data assistant architectures and systems can be used in
connection with example embodiments, including systems using any
combination of general processors, co-processors, FPGAs and other
programmable logic devices, system on chips (SOCs), application
specific integrated circuits (ASICs), and other processing and
logic elements. In some embodiments, all or part of the computer
system can be implemented in software or hardware. Any variety of
data storage media can be used in connection with example
embodiments, including random access memory, hard drives, flash
memory, tape drives, disk arrays, Network Attached Storage (NAS)
and other local or distributed data storage devices and
systems.
[0237] In example embodiments, the computer subsystem of the
present disclosure can be implemented using software modules
executing on any of the above or other computer architectures and
systems. In other embodiments, the functions of the system can be
implemented partially or completely in firmware, programmable logic
devices such as field programmable gate arrays (FPGAs) as
referenced in FIG. 79, system on chips (SOCs), application specific
integrated circuits (ASICs), or other processing and logic
elements. For example, the Set Processor and Optimizer can be
implemented with hardware acceleration through the use of a
hardware accelerator card, such as accelerator card 122 illustrated
in FIG. 77.
Oligonucleotides (e.g., Molecular Barcodes)
[0238] The methods and kits disclosed herein may comprise one or
more oligonucleotides or uses thereof. The oligonucleotides may be
attached to a solid support disclosed herein. Attachment of the
oligonucleotide to the solid support may occur through functional
group pairs on the solid support and the oligonucleotide. The
oligonucleotide may be referred to as a molecular bar code. The
oligonucleotide may be referred to as a label (e.g., molecular
label, cellular label) or tag (e.g., sample tag).
[0239] Oligonucleotides may comprise a universal label. A universal
label may be the same for all oligonucleotides in a sample. A
universal label may be the same for oligonucleotides in a set of
oligonucleotides. A universal label may be the same for two or more
sets of oligonucleotides. A universal label may comprise a sequence
of nucleic acids that may hybridize to a sequencing primer.
Sequencing primers may be used for sequencing oligonucleotides
comprising a universal label. Sequencing primers (e.g., universal
sequencing primers) may comprise sequencing primers associated with
high-throughput sequencing platforms. A universal label may
comprise a sequence of nucleic acids that may hybridize to a PCR
primer. A universal label may comprise a sequence of nucleic acids
that may hybridize to a sequencing primer and a PCR primer. The
sequence of nucleic acids of the universal label that may hybridize
to a sequencing and/or PCR primer may be referred to as a primer
binding site. A universal label may comprise a sequence that may be
used to initiate transcription of the oligonucleotide. A universal
label may comprise a sequence that may be used for extension of the
oligonucleotide or a region within the oligonucleotide. A universal
label may be at least about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35,
40, 45, 50 or more nucleotides in length. A universal label may
comprise at least about 10 nucleotides. A universal label may be at
most about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or
more nucleotides in length.
[0240] Oligonucleotides may comprise a cellular label. A cellular
label may comprise a nucleic acid sequence that may provide
information for which cell the oligonucleotide is contacted to
(e.g., determining which nucleic acid originated from which cell).
At least 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% or 100% of
oligonucleotides on the same solid support may comprise the same
cellular label. At least 60% of oligonucleotides on the same solid
support may comprise the same cellular label. At least 95% of
oligonucleotides on the same solid support may comprise the same
cellular label. All the oligonucleotides on a same solid support
may comprise the same cellular label. The cellular label of the
oligonucleotides on a first solid support may be different than the
cellular labels of the oligonucleotides on the second solid
support.
[0241] A cellular label may be at least about 1, 2, 3, 4, 5, 10,
15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides in length. A
cellular label may be at most about 300, 200, 100, 90, 80, 70, 60,
50, 40, 30, 20, 15, 12, 10, 9, 8, 7, 6, 5, 4 or fewer or more
nucleotides in length. A cellular label may comprise between about
5 to about 200 nucleotides. A cellular label may comprise between
about 10 to about 150 nucleotides. A cellular label may comprise
between about 20 to about 125 nucleotides in length.
[0242] Oligonucleotides may comprise a molecular label. A molecular
label may comprise a nucleic acid sequence that may provide
identifying information for the specific nucleic acid species
hybridized to the oligonucleotide. Oligonucleotides conjugated to a
same solid support may comprise different molecular labels. In this
way, the molecular label may distinguish the types of target
nucleic acids (e.g., genes), that hybridize to the different
oligonucleotides. A molecular label may be at least about 1, 2, 3,
4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides in
length. A molecular label may be at most about 300, 200, 100, 90,
80, 70, 60, 50, 40, 30, 20, 15, 12, 10, 9, 8, 7, 6, 5, 4 or fewer
nucleotides in length.
[0243] Oligonucleotides may comprise a sample label (e.g., sample
index). A sample label may comprise a nucleic acid sequence that
may provide information about from where a target nucleic acid
originated. For example, a sample label may be different on
different solid supports used in different experiments. A sample
label may be at least about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35,
40, 45, 50 or more nucleotides in length. A sample label may be at
most about 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20, 15, 12,
10, 9, 8, 7, 6, 5, 4 or fewer nucleotides in length.
[0244] An oligonucleotide may comprise a universal label, a
cellular label, a molecular label and a sample label, or any
combination thereof. In combination, the sample label may be used
to distinguish target nucleic acids between samples, the cellular
label may be used to distinguish target nucleic acids from
different cells in the sample, the molecular label may be used to
distinguish the different target nucleic acids in the cell (e.g.,
different copies of the same target nucleic acid), and the
universal label may be used to amplify and sequence the target
nucleic acids.
[0245] A universal label, a molecular label, a cellular label,
linker label and/or a sample label may comprise a random sequence
of nucleotides. A random sequence of nucleotides may be computer
generated. A random sequence of nucleotides may have no pattern
associated with it. A universal label, a molecular label, a
cellular label, linker label and/or a sample label may comprise a
non-random (e.g., the nucleotides comprise a pattern) sequence of
nucleotides. Sequences of the universal label, a molecular label, a
cellular label, linker label and/or a sample label may be
commercially available sequences. Sequences of the universal label,
a molecular label, a cellular label, linker label and/or a sample
label may be comprise randomer sequences. Randomer sequences may
refer to oligonucleotide sequences composed of all possible
sequences for a given length of the randomer. Alternatively, or
additionally, a universal label, a molecular label, a cellular
label, linker label and/or a sample label may comprise a
predetermined sequence of nucleotides.
[0246] FIG. 1 shows an exemplary oligonucleotide of the disclosure
comprising a universal label, a cellular label and a molecular
label.
[0247] FIG. 3 shows an exemplary oligonucleotide coupled solid
support comprising a solid support (301) coupled to an
oligonucleotide (312). The oligonucleotide (312) comprises a
chemical group (5' amine, 302), a universal label (303), a cellular
label (311), a molecular label (Molecular BC, 311), and a target
binding region (oligodT, 310). In this schematic, the cellular
label (311) comprises a first cell label (CL Part 1, 304), a first
linker (Linked, 305), a second cell label (CL Part 2, 306), a
second linker (Linker2, 307), a third cell label (CL Part 3, 308).
The cellular label (311) is common for each oligonucleotide on the
solid support. The cellular labels (311) for two or more beads may
be different. The cellular labels (311) for two or more beads may
differ by the cell labels (e.g., CL Part 1 (304), CL Part 2 (306),
CL Part 3 (308) ). The cellular labels (311) for two or more beads
may differ by the first cell label (304), second cell label (306),
third cell label (308), or a combination thereof. The first and
second linkers (303, 305) of the cellular labels (311) may be
identical for two or more oligonucleotide coupled solid supports.
The universal label (303) may be identical for two or more
oligonucleotide coupled solid supports. The universal label (303)
may be identical for two or more oligonucleotides on the same solid
support. The molecular label (311) may be different for at least
two or more oligonucleotides on the solid support. The solid
support may comprise 100 or more oligonucleotides. The solid
support may comprise 1000 or more oligonucleotides. The solid
support may comprise 10000 or more oligonucleotides. The solid
support may comprise 100000 or more oligonucleotides.
[0248] In addition to a universal label, a cellular label, and a
molecular label, an oligonucleotide may comprise a target binding
region. A target binding region may comprise a nucleic acid
sequence that may bind to a target nucleic acid (e.g., a cellular
nucleic acid to be analyzed). A target binding region may be a gene
specific sequence. For example, a target binding region may
comprise a nucleic acid sequence that may attach (e.g., hybridize)
to a specific location of a specific target nucleic acid. A target
binding region may comprise a non-specific target nucleic acid
sequence. A non-specific target nucleic acid sequence may refer to
a sequence that may bind to multiple target nucleic acids,
independent of the specific sequence of the target nucleic acid.
For example, target binding region may comprise a random multimer
sequence or an oligo dT sequence (e.g., a stretch of thymidine
nucleotides that may hybridize to a poly-adenylation tail on
mRNAs). A random multimer sequence can be, for example, a random
dimer, trimer, quatramer, pentamer, hexamer, septamer, octamer,
nonamer, decamer, or higher multimer sequence of any length. A
target binding region may be at least about 5, 10, 15, 20, 25, 30,
35, 40, 45, 50 or more nucleotides in length. A target binding
region may be at most about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50
or more nucleotides in length.
[0249] An oligonucleotide may comprise a plurality of labels. For
example an oligonucleotide may comprise at least about 1, 2, 3, 4,
5, 6, 7, or 8 or more universal labels. An oligonucleotide may
comprise at most about 1, 2, 3, 4, 5, 6, 7, or 8 or more universal
labels. An oligonucleotide may comprise at least about 1, 2, 3, 4,
5, 6, 7, or 8 or more cellular labels. An oligonucleotide may
comprise at most about 1, 2, 3, 4, 5, 6, 7, or 8 or more cellular
labels. An oligonucleotide may comprise at least about 1, 2, 3, 4,
5, 6, 7, or 8 or more molecular labels. An oligonucleotide may
comprise at most about 1, 2, 3, 4, 5, 6, 7, or 8 or more molecular
labels. An oligonucleotide may comprise at least about 1, 2, 3, 4,
5, 6, 7, or 8 or more sample labels. An oligonucleotide may
comprise at most about 1, 2, 3, 4, 5, 6, 7, or 8 or more sample
labels. An oligonucleotide may comprise at least about 1, 2, 3, 4,
5, 6, 7, or 8 or more target binding regions. An oligonucleotide
may comprise at most about 1, 2, 3, 4, 5, 6, 7, or 8 or more target
binding regions.
[0250] When an oligonucleotide comprises more than one of a type of
label (e.g., more than one cellular label or more than one
molecular label), the labels may be interspersed with a linker
label sequence. A linker label sequence may be at least about 5,
10, 15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides in length. A
linker label sequence may be at most about 5, 10, 15, 20, 25, 30,
35, 40, 45, 50 or more nucleotides in length. In some instances, a
linker label sequence is 12 nucleotides in length. A linker label
sequence may be used to facilitate the synthesis of the
oligonucleotide, such as diagrammed in FIG. 2A.
[0251] The number of oligonucleotides conjugated to a solid support
may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold more than the number
of target nucleic acids in a cell. In some instances, at least 10,
20, 30, 40, 50, 60, 70, 80, 90 or 100% of the oligonucleotides are
bound by a target nucleic acid. In some instances, at most 10, 20,
30, 40, 50, 60, 70, 80, 90 or 100% of the oligonucleotides are
bound by a target nucleic acid. In some instances, at least 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 or
more different target nucleic acids are captured by the
oligonucleotides on a solid support. In some instances, at most 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100
or more different target nucleic acids are captured by the
oligonucleotides on a solid support.
[0252] A polymer may comprise additional solid supports. For
example, a polymer may be dotted with beads. The beads may be
spatially located at different regions of the polymer. The beads or
supports comprising oligonucleotides of the disclosure may be
spatially addressed. The beads or supports may comprise a barcode
corresponding to a spatial address on the polymer. For example,
each bead or support of a plurality of beads or supports may
comprise barcode that corresponds to a position on a polymer, such
as a position on an array or a particular microwall of a plurality
of microwells. The spatial address can be decoded to determine the
location from which a bead or support was positioned. For example,
a spatial address, such as a barcode, can be decoded by
hybridization of an oligonucleotide to the barcode or by sequencing
the barcode. Alternatively, beads or supports can bear other types
of barcodes, such as graphical features, chemical groups, colors,
fluorescence, or combinations any combination thereof, for spatial
address decoding purposes.
[0253] The methods and kits disclosed herein may comprise one or
more sets of molecular barcodes. One or more molecular barcodes may
comprise a sample index region and a label region. Two or more
molecular barcodes of a set of molecular barcodes may comprise the
same sample index region and two or more different label regions.
Two or more molecular barcodes of two or more sets of molecular
barcodes may comprise two or more different sample index regions.
Two or more molecular barcodes from a set of molecular barcodes may
comprise different label regions. Two or more molecular barcodes of
two or more sets of molecular barcodes may comprise the same label
region. Molecular barcodes from two or more sets of molecular
barcodes may differ by their sample index regions. Molecular
barcodes from two or more sets of molecular barcodes may be similar
based on their label regions.
[0254] The molecular barcodes may further comprise a target
specific region, an adapter region, a universal PCR region, a
target specific region or any combination thereof. The molecular
barcode may comprise a universal PCR region and a target specific
region. The molecular barcode may comprise one or more secondary
structures. The molecular barcode may comprise a hairpin structure.
The molecular barcode may comprise a target specific region and a
cleavable stem.
[0255] The methods and kits disclosed herein may comprise one or
more sets of sample tags. One or more sample tags may comprise a
sample index region. One or more sample tags may comprise a sample
index region. Two or more sample tags of a set of sample tags may
comprise the same sample index region. Two or more sample tags of
two or more sets of sample tags may comprise two or more different
sample index regions.
[0256] The sample tags may further comprise a target specific
region, an adapter region, a universal PCR region, a target
specific region or any combination thereof. The sample tag may
comprise a universal PCR region and a target specific region. The
sample tag may comprise one or more secondary structures. The
sample tag may comprise a hairpin structure. The sample tag may
comprise a target specific region and a cleavable stem.
[0257] The methods and kits disclosed herein may comprise one or
more sets of, molecular identifier labels. One or more molecular
identifier labels may comprise a label region. One or more
molecular identifier labels may comprise a label region. Two or
more molecular identifier labels of a set of molecular identifier
labels may comprise two or more different label regions. Two or
more molecular identifier labels of two or more sets of molecular
identifier labels may comprise two or more identical label regions.
The molecular identifier labels may further comprise a target
specific region, an adapter region, a universal PCR region, a
target specific region or any combination thereof. The molecular
identifier label may comprise a universal PCR region and a target
specific region. The molecular identifier label may comprise one or
more secondary structures. The molecular identifier label may
comprise a hairpin structure. The molecular identifier label may
comprise a target specific region and a cleavable stem.
[0258] The molecular barcode, sample tag or molecular identifier
label may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90,
100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or
base pairs. In another example, the sample tag or molecular
identifier label comprises at least about 1500, 2,000; 2500, 3,000;
3500, 4,000; 4500, 5,000; 5500, 6,000; 6500, 7,000; 7500, 8,000;
8500, 9,000; 9500, or 10,000 nucleotides or base pairs.
[0259] The molecular barcodes, sample tags or molecular identifier
labels may be multimers, e.g., random multimers. A multimer
sequence can be, for example, a non-random or random dimer, trimer,
quatramer, pentamer, hexamer, septamer, octamer, nonamer, decamer,
or higher multimer sequence of any length. The tags may be randomly
generated from a set of mononucleotides. The tags may be assembled
by randomly incorporating mononucleotides.
[0260] The molecular barcodes, sample tags or molecular identifier
labels may also be assembled without randomness, to generate a
library of different tags which are not randomly generated but
which includes sufficient numbers of different tags to practice the
methods.
[0261] In some embodiments a molecular barcode, sample tag or
molecular identifier label may comprise a cutback in a target
nucleic acid. The cutback may be, for example, an enzymatic
digestion of one or both ends of a target nucleic acid. The cutback
may be used in conjunction with the addition of added molecular
barcodes, sample tags (e.g., sample index region, sample label),
cellular label, and molecular identifier labels (e.g., molecular
label). The combination of the cutback and the added tags may
contain information related to the particular starting molecule. By
adding a random cutback to the molecular barcode, sample tag or
molecular identifier label, a smaller diversity of the added tags
may be necessary for counting the number of target nucleic acids
when detection allows a determination of both the random cutback
and the added oligonucleotides.
[0262] The molecular barcode, sample tag or molecular identifier
label may comprise a target specific region. The target specific
region may comprise a sequence that is complementary to the
molecule. In some instances, the molecule is an mRNA molecule and
the target specific region comprises an oligodT sequence that is
complementary to the polyA tail of the mRNA molecule. The target
specific region may also act as a primer for DNA and/or RNA
synthesis. For example, the oligodT sequence of the target specific
region may act as a primer for first strand synthesis of a cDNA
copy of the mRNA molecule. Alternatively, the target specific
region comprises a sequence that is complementary to any portion of
the molecule. In other instances, the target specific region
comprises a random sequence that may be hybridized or ligated to
the molecule. The target specific region may enable attachment of
the sample tag or molecular identifier label to the molecule.
Attachment of the sample tag or molecular identifier label may
occur by any of the methods disclosed herein (e.g., hybridization,
ligation). In some instances, the target specific region comprises
a sequence that is recognized by one or more restriction enzymes.
The target specific region may comprise at least about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40,
50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or
1000 nucleotides or base pairs. In another example, the target
specific region comprises at least about 1500, 2000, 2500, 3000,
3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500,
9000, 9500, or 10000 nucleotides or base pairs. Preferably, the
target specific region comprises at least about 5-10, 10-15, 10-20,
10-30, 15-30, or 20-30 nucleotides or base pairs.
[0263] In some instances, the target specific region is specific
for a particular gene or gene product. For example, the target
specific region comprises a sequence complementary to a region of a
p53 gene or gene product. Therefore, the sample tags and molecular
identifier labels may only attach to molecules comprising the
p53-specific sequence. Alternatively, the target specific region is
specific for a plurality of different genes or gene products. For
example, the target specific region comprises an oligodT sequence.
Therefore, the sample tags and molecular identifier labels may
attach to any molecule comprising a polyA sequence. In another
example, the target specific region comprises a random sequence
that is complementary to a plurality of different genes or gene
products. Thus, the sample tag or molecular identifier label may
attach to any molecule with a sequence that is complementary to the
target specific region. In other instances, the target specific
region comprises a restriction site overhang (e.g., EcoRI
sticky-end overhang). The sample tag or molecular identifier label
may ligate to any molecule comprising a sequence complementary to
the restriction site overhang.
[0264] In some instances, the target specific region is specific
for a particular microRNA or microRNA product. For example, the
target specific region comprises a sequence complementary to a
region of a specific microRNA or microRNA product. For example, the
target specific regions comprise sequences complementary to regions
of a specific panel of microRNAs or panel of microRNA products.
Therefore, the sample tags and molecular identifier labels may only
attach to molecules comprising the micoRNA-specific sequence.
Alternatively, the target specific region is specific for a
plurality of different micoRNAs or micoRNA products. For example,
the target specific region comprises a sequence complimentary to a
region comprised in two or more microRNAs, such as a panel of
microRNAs containing a common sequence. Therefore, the sample tags
and molecular identifier labels may attach to any molecule
comprising the common microRNA sequence. In another example, the
target specific region comprises a random sequence that is
complementary to a plurality of different microRNAs or microRNA
products. Thus, the sample tag or molecular identifier label may
attach to any microRNA molecule with a sequence that is
complementary to the target specific region. In other instances,
the target specific region comprises a restriction site overhang
(e.g., EcoRI sticky-end overhang). The sample tag or molecular
identifier label may ligate to any microRNA molecule comprising a
sequence complementary to the restriction site overhang.
[0265] The molecular barcode or molecular identifier label
disclosed herein often comprises a label region. The label region
may be used to uniquely identify occurrences of target species
thereby marking each species with an identifier that may be used to
distinguish between two otherwise identical or nearly identical
targets. The label region of the plurality of sample tags and
molecular identifier labels may comprise a collection of different
semiconductor nanocrystals, metal compounds, peptides,
oligonucleotides, antibodies, small molecules, isotopes, particles
or structures having different shapes, colors, barcodes or
diffraction patterns associated therewith or embedded therein,
strings of numbers, random fragments of proteins or nucleic acids,
different isotopes, or any combination thereof. The label region
may comprise a degenerative sequence. The label region may comprise
at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400,
500, 600, 700, 800, 900, or 1000 nucleotides or base pairs. In
another example, the label region comprises at least about 1500;
2,000; 2500, 3,000; 3500, 4,000; 4500, 5,000; 5500, 6,000; 6500,
7,000; 7500, 8,000; 8500, 9,000; 9500, or 10,000 nucleotides or
base pairs. Preferably, the label region comprises at least about
10-30, 15-40, or 20-50 nucleotides or base pairs.
[0266] In some instances, the molecular barcode, sample tag or
molecular identifier label comprises a universal primer binding
site. The universal primer binding site allows the attachment of a
universal primer to the labeled-molecule and/or labeled-amplicon.
Universal primers are well known in the art and include, but are
not limited to, -47F (M13F), alfaMF, AOX3', AOX5', BGH_r, CMV_-30,
CMV_-50, CVM_f, LACrmt, lamgda gt10F, lambda gt 10R, lambda gt11F,
lambda gt11R, M13 rev, M13Forward(-20), M13Reverse, male,
p10SEQP_pQE, pA_-120, pet_4, pGAP Forward, pGL_RVpr3, pGLpr2_R,
pKLAC1_4, pQE_FS, pQE_RS, puc_U1, puc_U2, revers_A, seq_IRES_tam,
seq_IRES_zpet, seq_ori, seq_PCR, seq_RES-, seq_pIRES+, seq_pSecTag,
seq_pSecTag+, seq_retro+PSI, SP6, T3-prom, T7-prom, and T7-term
Inv. Attachment of the universal primer to the universal primer
binding site may be used for amplification, detection, and/or
sequencing of the labeled-molecule and/or labeled-amplicon. The
universal primer binding site may comprise at least about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30,
40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800,
900, or 1000 nucleotides or base pairs. In another example, the
universal primer binding site comprises at least about 1500; 2,000;
2500, 3,000; 3500, 4,000; 4500, 5,000; 5500, 6,000; 6500, 7,000;
7500, 8,000; 8500, 9,000; 9500, or 10,000 nucleotides or base
pairs. Preferably, the universal primer binding site comprises
10-30 nucleotides or base pairs.
[0267] The molecular barcode, sample tag or molecular identifier
label may comprise an adapter region. The adapter region may enable
hybridization of one or more probes. The adapter region may enable
hybridization of one or more HCR probes.
[0268] The molecular barcode, sample tag or molecular identifier
label may comprise one or more detectable labels.
[0269] The molecular barcode, sample tag or molecular identifier
label may act as an initiator for a hybridization chain reaction
(HCR). The adapter region of the sample tag or molecular identifier
label may act as an initiation for HCR. The universal primer
binding site may act as an initiator for HCR.
[0270] In some instances, the molecular barcode, sample tag or
molecular identifier label is single-stranded. In other instances,
the molecular barcode, sample tag or molecular identifier label is
double-stranded. The molecular barcode, sample tag or molecular
identifier label may be linear. Alternatively, the molecular
barcode, sample tag or molecular identifier label comprises a
secondary structure. As used herein, "secondary structure" includes
tertiary, quaternary, etc. . . . structures. In some instances, the
secondary structure is a hairpin, a stem-loop structure, an
internal loop, a bulge loop, a branched structure or a pseudoknot,
multiple stem loop structures, cloverleaf type structures or any
three dimensional structure. In some instances, the secondary
structure is a hairpin. The hairpin may comprise an overhang
sequence. The overhang sequence of the hairpin may act as a primer
for a polymerase chain reaction and/or reverse transcription
reaction. The overhang sequence comprises a sequence that is
complementary to the molecule to which the sample tag or molecular
identifier label is attached and the overhang sequence hybridizes
to the molecule. The overhang sequence may be ligated to the
molecule and acts as a template for a polymerase chain reaction
and/or reverse transcription reaction. In some embodiments,
molecular barcode, the sample tag, or molecular identifier label
comprises nucleic acids and/or synthetic nucleic acids and/or
modified nucleic acids.
[0271] In some instances, the plurality of molecular barcodes,
sample tags (e.g., sample index region, sample label), cellular
label, and molecular identifier labels (e.g., molecular label)
comprises at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100
different molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label). In other instances, the plurality
of molecular barcodes, sample tags (e.g., sample index region,
sample label), cellular label, and molecular identifier labels
(e.g., molecular label) comprises at least about 200; 300; 400;
500; 600; 700; 800; 900; 1,000; 2,000; 3,000; 4,000; 5,000; 6,000;
7,000; 8,000; 9,000; or 10000 different molecular barcodes, sample
tags (e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label). Alternatively;
the plurality of molecular barcodes, sample tags (e.g., sample
index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label) comprises at least about
20,000; 30,000; 40,000; 50,000; 60,000; 70,000; 80,000; 90,000; or
100,000 different molecular barcodes, sample tags (e.g., sample
index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label).
[0272] The number of molecular barcodes, sample tags (e.g., sample
index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label) in the plurality of
molecular barcodes, sample tags (e.g., sample index region, sample
label), cellular label, and molecular identifier labels (e.g.,
molecular label) is often in excess of the number of molecules to
be labeled. In some instances, the number of molecular barcodes,
sample tags (e.g., sample index region, sample label), cellular
label, and molecular identifier labels (e.g., molecular label) in
the plurality of molecular barcodes, sample tags (e.g., sample
index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label) is at least about 2, 3,
4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100
times greater than the number of molecules to be labeled.
[0273] The number of different molecular barcodes, sample tags
(e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label) in the
plurality of molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) is often in excess of the number of
different molecules to be labeled. In some instances, the number of
different molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) in the plurality of molecular
barcodes, sample tags (e.g., sample index region, sample label),
cellular label, and molecular identifier labels (e.g., molecular
label) is at least about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7,
8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times greater
than the number of different molecules to be labeled.
[0274] In some instances, stochastic labeling of a molecule
comprises a plurality of molecular barcodes, sample tags (e.g.,
sample index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label), wherein the
concentration of the different molecular barcodes, sample tags
(e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label) in the
plurality of molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) is the same. In such instances, the
plurality of molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) comprises equal numbers of each
different molecular barcode, sample tag or molecular identifier
label.
[0275] In some instances, stochastic labeling of a molecule
comprises a plurality of molecular barcodes, sample tags (e.g.,
sample index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label), wherein the
concentration of the different molecular barcodes, sample tags
(e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label) in the
plurality of molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) is different. In such instances, the
plurality of molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) comprises different numbers of each
different molecular barcode, sample tag or molecular identifier
label.
[0276] In some instances, some molecular barcodes, sample tags
(e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label) are present at
higher concentrations than other molecular barcodes, sample tags
(e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label) in the
plurality of molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label). In some instances, stochastic
labeling with different concentrations of molecular barcodes,
sample tags (e.g., sample index region, sample label), cellular
label, and molecular identifier labels (e.g., molecular label)
extends the sample measurement dynamic range without increasing the
number of different labels used. For example, consider
stochastically labeling 3 nucleic acid sample molecules with 10
different molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) all at equal concentration. We
expect to observe 3 different labels. Now instead of 3 nucleic acid
molecules, consider 30 nucleic acid molecules, and we expect to
observe all 10 labels. In contrast, if we still used 10 different
stochastic labels and alter the relative ratios of the labels to
1:2:3:4 . . . 10, then with 3 nucleic acid molecules, we would
expect to observe between 1-3 labels, but with 30 molecules we
would expect to observe only approximately 5 labels thus extending
the range of measurement with the same number of stochastic
labels.
[0277] The relative ratios of the different molecular barcodes,
sample tags (e.g., sample index region, sample label), cellular
label, and molecular identifier labels (e.g., molecular label) in
the plurality of molecular barcodes, sample tags (e.g., sample
index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label) may be 1:X, where X is at
least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40,
45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100. Alternatively,
the relative ratios of "n" different molecular barcodes, sample
tags (e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label) in the
plurality of molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) is 1:A:B:C: . . . Zn, where A, B, C
. . . Zn is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or
100.
[0278] In some instances, the concentration of two or more
different molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) in the plurality of molecular
barcodes, sample tags (e.g., sample index region, sample label),
cellular label, and molecular identifier labels (e.g., molecular
label) is the same. For "n" different molecular barcodes, sample
tags (e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label), the
concentration of at least 2, 3, 4, . . . n different molecular
barcodes, sample tags (e.g., sample index region, sample label),
cellular label, and molecular identifier labels (e.g., molecular
label) is the same. Alternatively, the concentration of two or more
different molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) in the plurality of molecular
barcodes, sample tags (e.g., sample index region, sample label),
cellular label, and molecular identifier labels (e.g., molecular
label) is different. For "n" different molecular barcodes, sample
tags (e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label), the
concentration of at least 2, 3, 4, . . . n different molecular
barcodes, sample tags (e.g., sample index region, sample label),
cellular label, and molecular identifier labels (e.g., molecular
label) is different. In some instances, for "n" different molecular
barcodes, sample tags (e.g., sample index region, sample label),
cellular label, and molecular identifier labels (e.g., molecular
label), the difference in concentration for at least 2, 3, 4, . . .
n different molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) is at least about 0.1, 0.2, 0.3,
0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5,
2.75, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90,
100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000-fold.
[0279] In some instances, at least about 1%, 2%, 3%, 4%, 5%, 6%,
7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100% of the different
molecular barcodes, sample tags (e.g., sample index region, sample
label), cellular label, and molecular identifier labels (e.g.,
molecular label) in the plurality of molecular barcodes, sample
tags (e.g., sample index region, sample label), cellular label, and
molecular identifier labels (e.g., molecular label) have the same
concentration. Alternatively, at least about 1%, 2%, 3%, 4%, 5%,
6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100% of the
different molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) in the plurality of molecular
barcodes, sample tags (e.g., sample index region, sample label),
cellular label, and molecular identifier labels (e.g., molecular
label) have a different concentration.
[0280] As shown in FIG. 65, molecular barcodes (1004) may be
synthesized separately. The molecular barcodes (1004) may comprise
a universal PCR region (1001), one or more identifier regions
(1002), and a target specific region. The one or more identifier
regions may comprise a sample index region, label region, or a
combination thereof. The one or more identifier regions may be
adjacent. The one or more identifier regions may be non-adjacent.
The individual molecular barcodes may be pooled to produce a
plurality of molecular barcodes (1005) comprising a plurality of
different identifier regions. Sample tags may be synthesized in a
similar manner as depicted in FIG. 65, wherein the one or more
identifier regions comprise a sample index region. Molecular
identifier labels may be synthesized in a similar manner as
depicted in FIG. 65, wherein the one or more identifier regions
comprises a label region.
[0281] The target specific region may be ligated to the identifier
region to produce a molecular barcode comprising a target specific
region. 5' and 3' exonucleases may be added to the reaction to
remove non-ligated products. The molecular barcode may comprise the
universal primer binding site, label region and target specific
region and may be resistant to 5' and 3' exonucleases. As used
herein, the terms "universal primer binding site" and "universal
PCR region" may be used interchangeably and refer to a sequence
that can be used to prime an amplification reaction. The 3'
phosphate group from the ligated identifier region may be removed
to produce a molecular barcode without a 3' phosphate group. The 3'
phosphate group may be removed enzymatically. For example, a T4
polynucleotide kinase may be used to remove the 3' phosphate
group.
[0282] Another method of synthesizing molecular barcodes is
depicted in FIG. 66A. As shown in FIG. 66A, a molecular barcode
(1128) may be synthesized by ligating two or more oligonucleotide
fragments (1121 and 1127). One oligonucleotide fragment (1121) may
comprise a universal primer binding site (1122), identifier region
(1123) and a first splint (1123). The other oligonucleotide
fragment (1128) may comprise a second splint (1125) and a target
specific region (1126). A ligase (e.g., T4 DNA ligase) may be used
to join the two oligonucleotide fragments (1121 and 1127) to
produce a molecular barcode (1128). Double stranded ligation of the
first splint (1124) and second splint (1125) may produce a
molecular barcode (1128) with a bridge splint (1129).
[0283] An alternative method of synthesizing a molecular barcode by
ligating two oligonucleotide fragments is depicted in FIG. 66B. As
shown in FIG. 66B, a molecular barcode (1158) is synthesized by
ligating two oligonucleotide fragments (1150 and 1158). One
oligonucleotide fragment (1150) may comprise a universal primer
binding site (1151), one or more identifier region (1152), and a
ligation sequence (1153). The other oligonucleotide fragment (1158)
may comprise a ligation sequence (1154) that is complementary to
the ligation sequence (1153) of the first oligonucleotide fragment
(1150), a complement of a target specific region (1155), and a
label (1156). The oligonucleotide fragment (1159) may also comprise
a 3' phosphate which prevents extension of the oligonucleotide
fragment. As shown in Step 1 of FIG. 66B, the ligation sequences
(1153 and 1154) of the two oligonucleotide fragments may anneal and
a polymerase may be used to extend the 3' end of the first
oligonucleotide fragment (1150) to produce molecular barcode
(1158). The molecular barcode (1158) may comprise a universal
primer binding site (1151), one or more identifier regions (1152),
ligation sequence (1153), and a target specific sequence (1157).
The target specific sequence (1157) of the molecular barcode (1158)
may be the complement of the complement of the target specific
region (1155) of the second oligonucleotide fragment (1159). The
oligonucleotide fragment comprising the label (1156) may be removed
from the molecular barcode (1158). For example, the label (1156)
may comprise biotin and oligonucleotide fragments (1159) comprising
the biotin label (1156) may be removed via streptavidin capture. In
another example, the label (1156) may comprise a 5' phosphate and
oligonucleotide fragments (1159) comprising the 5' phosphate (1156)
may be removed via an exonuclease (e.g., Lambda exonuclease).
[0284] As depicted in FIG. 66C, a first oligonucleotide fragment
(1170) comprising a universal primer binding site (1171), one or
more identifier regions (1172), a first ligation sequence (1173) is
annealed to a second oligonucleotide fragment (1176) comprising a
second ligation sequence (1174) and an RNA complement of the target
sequence (1175). Step 1 may comprise annealing the first and second
ligation sequences (1173 and 1174) followed by reverse
transcription of the RNA complement of the target sequence (1175)
to produce molecular barcode (1177) comprising a universal primer
binding site (1171), one or more identifier regions (1172), a first
ligation sequence (1173), and a target specific region (1178). The
oligonucleotide fragments comprising the RNA complement of the
target sequence may be selectively degraded by RNAse treatment.
[0285] The sequences of the molecular barcodes, sample tags (e.g.,
sample index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label) may be optimized to
minimize dimerization of molecular barcodes, sample tags (e.g.,
sample index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label). The molecular barcode,
sample tag or molecular identifier label dimer may be amplified and
result in the formation of an amplicon comprising two universal
primer binding sites on each end of the amplicon and a target
specific region and a unique identifier region. Because the
concentration of the molecular barcodes, sample tags (e.g., sample
index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label) are far greater that the
number of DNA templates, these molecular barcode, sample tag or
molecular identifier label dimers may outcompete the labeled DNA
molecules in an amplification reaction. Unamplified DNAs lead to
false negatives, and amplified molecular barcode, sample tag or
molecular identifier label dimers lead to high false positives.
Thus, the molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) may be optimized to minimize
molecular barcode, sample tag or molecular identifier label dimer
formation. Alternatively, molecular barcodes, sample tags (e.g.,
sample index region, sample label), cellular label, and molecular
identifier labels (e.g., molecular label) that dimerize are
discarded, thereby eliminating molecular barcode, sample tag or
molecular identifier label dimer formation.
[0286] Alternatively, molecular barcode, sample tag or molecular
identifier label dimer formation may be eliminated or reduced by
incorporating one or more modifications into the molecular barcode,
sample tag or molecular identifier label sequence. A molecular
barcode, sample tag or molecular identifier label comprising a
universal primer binding site, unique identifier region, and target
specific region comprising uracils and a 3' phosphate group is
annealed to a target nucleic acid. The target nucleic acid may be a
restriction endonuclease digested fragment. The restriction
endonuclease may recognize the recognition site. PCR amplification
may comprise one or more forward primers and one or more reverse
primers. PCR amplification may comprise nested PCR with a forward
primer specific for the universal primer binding site of the
molecular barcode, sample tag or molecular identifier label and a
forward primer specific for the target specific region of the
molecular barcode, sample tag or molecular identifier label and
reverse primers that are specific for the target nucleic acid. The
target nucleic acid may be amplified using a Pfu DNA polymerase,
which cannot amplify template comprising one or more uracils. Thus,
any dimerized molecular barcodes, sample tags (e.g., sample index
region, sample label), cellular label, and molecular identifier
labels (e.g., molecular label) cannot be amplified by Pfu DNA
polymerase.
[0287] Methods to Synthesize Oligonucleotides (e.g., Molecular
Barcodes)
[0288] An oligonucleotide may be synthesized. An oligonucleotide
may be synthesized, for example, by coupling (e.g., by
1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide) of a 5' amino group
on the oligonucleotide to the carboxyl group of the functionalized
solid support.
[0289] Uncoupled oligonucleotides may be removed from the reaction
mixture by multiple washes. The solid supports may be split into
wells (e.g., 96 wells). Each solid support may be split into a
different well. Oligonucleotide synthesis may be performed using
the split/pool method of synthesis. The split/pool method may
utilize a pool of solid supports comprising reactive moieties
(e.g., oligonucleotides to be synthesized). This pool may be split
into a number of individual pools of solid supports. Each pool may
be subjected to a first reaction that may result in a different
modification to the solid supports in each of the pools (e.g., a
different nucleic acid sequence added to the oligonucleotide).
After the reaction, the pools of solid supports may be combined,
mixed, and split again. Each split pool may be subjected to a
second reaction or randomization that again is different for each
of the pools. The process may be continued until a library of
target compounds is formed.
[0290] Using split/pool synthesis, the nucleic acid sequence to be
added to the oligonucleotide may be incorporated by primer
extension (e.g., Klenow extension). The nucleic acid sequence to be
added to the oligonucleotide may be referred to as a primer
fragment. Each primer fragment for each individual pool may
comprise a different sequence (e.g., either in the cellular label,
the molecular label, the sample label, or any combination thereof).
The primer fragment may comprise a sequence that may hybridize to
the linker label sequence of the oligonucleotide (e.g., the
oligonucleotide coupled to the solid support). The primer fragment
may further comprise a second cell label and a second linker label
sequence. Primer extension may be used to introduce the second cell
label sequence and the second linker label sequence onto the
oligonucleotide coupled to the solid support (See FIG. 2B). After
primer extension incorporates the new sequences, the solid supports
may be combined. The combined solid supports may be heated to
denature the enzyme. The combined solid supports may be heated to
disrupt hybridization. The combined solid supports may be split
into wells again. The process may be repeated to add additional
sequences to the solid support-conjugated oligonucleotide.
[0291] The split/pool process may lead to the creation of at least
about 1000, 10000, 100000, 500000, or 1000000 or more different
oligonucleotides. The process may lead to the creation of at most
about 1000, 10000, 100000, 500000, or 1000000 or more different
oligonucleotides.
[0292] Split pool synthesis may comprise chemical synthesis.
Different oligonucleotides may be synthesized using DMT chemistry
on solid supports in individual reactions, then pooled into
reactions for synthesis. The split/pool process may be repeated 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more times. The split/pool process
may be repeated 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35,
40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more times.
The split/pool process may be repeated 2 or more times. The
split/pool process may be repeated 3 or more times. The split/pool
process may be repeated 5 or more times. The split/pool process may
be repeated 10 or more times.
[0293] Further disclosed herein are methods of producing one or
more sets of labeled beads (e.g., oligonucleotide conjugated
beads). The method of producing the one or more sets of labeled
beads may comprise attaching one or more nucleic acids to one or
more beads, thereby producing one or more sets of labeled beads.
The one or more nucleic acids may comprise one or more molecular
barcodes. The one or more nucleic acids may comprise one or more
sample tags (e.g., sample labels, sample index regions). The one or
more nucleic acids may comprise one or more cellular labels. The
one or more nucleic acids may comprise one or more molecular
identifier labels (e.g., molecular labels). The one or more nucleic
acids may comprise a) a primer region; b) a sample index region;
and c) a linker or adaptor region. The one or more nucleic acids
may comprise a) a primer region; b) a label region (e.g., molecular
label); and c) a linker or adaptor region. The one or more nucleic
acids may comprise a) a sample index region (e.g., sample tag); and
b) a label region (e.g., molecular label). The one or more nucleic
acids may comprise a) a sample index region; and b) a cellular
label. The one or more nucleic acids may comprise a) a cellular
label; and b) a molecular label. The one or more nucleic acids may
comprise a) a sample index region; b) cellular label; and c) a
molecular label. The one or more nucleic acids may further comprise
a primer region. The one or more nucleic acids may further comprise
a target specific region. The one or more nucleic acids may further
comprise a linker region. The one or more nucleic acids may further
comprise an adaptor region. The one or more nucleic acids may
further comprise a sample index region. The one or more nucleic
acids may further comprise a label region.
[0294] Alternatively, the method comprises: a) depositing a
plurality of first nucleic acids into a plurality of wells, wherein
two or more different wells of the plurality of wells may comprise
two or more different nucleic acids of the plurality of nucleic
acids; b) contacting one or more wells of the plurality of wells
with one or fewer beads to produce a plurality of single label
beads, wherein a single label bead of the plurality of first
labeled beads comprises a bead attached to a nucleic acid of the
plurality of first nucleic acids; c) pooling the plurality of first
labeled beads from the plurality of wells to produce a pool of
first labeled beads; d) distributing the pool of first labeled
beads to a subsequent plurality of wells, wherein two or more wells
of the subsequent plurality of wells comprise two or more different
nucleic acids of a plurality of subsequent nucleic acids; and e)
attaching one or more nucleic acids of the plurality of subsequent
nucleic acids to one or more first labeled beads to produce a
plurality of uniquely labeled beads.
Libraries
[0295] Disclosed herein are methods of producing molecular
libraries. The method may comprise: (a) stochastically labeling two
or more molecules from two or more samples to produce labeled
molecules, wherein the labeled molecules comprise (i) a molecule
region based on or derived from the two or more molecules, (ii) a
sample index region for use in differentiating two or more
molecules from two or more samples; and (iii) a label region for
use in differentiating two or more molecules from a single sample.
Stochastic labeling may comprise the use of one or more sets of
molecular barcodes. Stochastic labeling may comprise the use of one
or more sets of sample tags. Stochastic labeling may comprise the
use of one or more sets of molecular identifier labels.
[0296] Stochastically labeling the two or more molecules may
comprise contacting the two or more samples with a plurality of
sample tags and the plurality of molecule specific labels to
produce the plurality of labeled nucleic acids. The contacting can
be random. The method may further comprise amplifying one or more
of the labeled molecules, thereby producing an enriched population
of labeled molecules of the library. The method may further
comprise conducting one or more assays on the two or more molecules
from the two or more samples. The method may further comprise
conducting one or more pull-down assays.
[0297] The method of producing a labeled nucleic acid library may
further comprise adding one or more controls to the two or more of
samples. The one or more controls may be stochastically labeled to
produce labeled controls. The one or more controls may be used to
measure an efficiency of producing the labeled molecules.
[0298] The libraries disclosed herein may be used in a variety of
applications. For example, the library could be used for sequencing
applications. The library may be stored and used multiple times to
generate samples for analysis. Some applications include, for
example, genotyping polymorphisms, studying RNA processing, and
selecting clonal representatives to do sequencing.
Sample Preparation and Applications
[0299] The oligonucleotides (e.g., molecular bar code, sample tag,
molecular label, cellular label) disclosed herein may be used in a
variety of methods. The oligonucleotides may be in methods for
nucleic acid analysis. Nucleic acid analysis may include, but is
not limited to, genotyping, gene expression, copy number variation,
and molecular counting.
[0300] The disclosure provides for methods of multiplex nucleic
acid analysis. The method may comprise (a) contacting one or more
oligonucleotides from a cell with one or more oligonucleotides
attached to a support, wherein the one or more oligonucleotides
attached to the support comprise (i) a cell label region comprising
two or more randomer sequences connected by a non-random sequence;
and (ii) a molecular label region; and (b) conducting one or more
assays on the one or more oligonucleotides from the cell.
[0301] Further disclosed herein are methods of producing single
cell nucleic acid libraries. The method may comprise (a) contacting
one or more oligonucleotides from a cell with one or more
oligonucleotides attached to a support, wherein the one or more
oligonucleotides attached to the support comprise (i) a cell label
region comprising two or more randomer sequences connected by a
non-random sequence; and (ii) a molecular label region; and (b)
conducting one or more assays on the one or more oligonucleotides
from the cell.
[0302] In some instances, the method comprises adding a one or more
cells onto a microwell array. The number of cells to be added may
be determined from counting. Excess or unbound cells may be washed
away using a buffer (e.g., phosphobuffered saline buffer, HEPES,
Tris). The number of cells that may be captured by the wells of the
microwell array may be related to the size of the cell. For
example, depending on the design of the microwell, larger cells may
be more easily captured than smaller cells, as depicted in FIG. 6.
Different microwells (e.g., different dimensions) may be used for
capturing different cell types.
[0303] The methods described here allow for the addition of
sequences that can nucleic acids for sequencing or other molecular
analyses. These methods can allow detection of nucleic acid
variants, mutants, polymorphisms, inversions, deletions, reversions
and other qualitative events found in a population of RNA or DNA
molecules. For example, the methods can allow for identification of
target frequencies (e.g., gene expression or allelic distribution).
For example, the methods also allow for identification of mutations
or SNPs in a genome or transcriptome, such as from a diseased or
non-diseased subject. The methods also allow for determining the
presence or absence of contamination or infections in a biological
sample from a subject, such as foreign organisms or viruses, such
as a bacteria or a fungus.
[0304] Cells can be added into microwells by any method. In some
embodiments, cells are added to microwells as a diluted cell
sample. In some embodiments, cells are added to microwells and
allowed to settle in the microwells by gravity. In some
embodiments, cells are added to microwells and centrifugatiion is
used to settle the cells in the microwells. In some embodiments,
cells are added to microwells by injecting one or more cells into
one or more microwells. For example, a single cell can be added to
a microwell by injecting the single cell in to a microwell. The
injecting of a cell can be through the use of any device or method,
such as through the use of a micro manipulator. In some
embodiments, cell can be added to microwells using a magnet. For
example, cells can coated on their surface with magnetic particles,
such as magnetic microparticles or magnetic nanoparticles and added
to microwells using a magnet or a magnetic field.
[0305] The microwell array comprising cells may be contacted with
an oligonucleotide conjugated solid support (e.g., bead).
Uncaptured oligonucleotide conjugated solid supports may be removed
(e.g., washed away with buffer). FIG. 5 depicts a microwell array
with captured solid supports. A microwell may comprise at least one
solid support. A microwell may comprise at least two solid
supports. A microwell may comprise at most one solid support. A
microwell may comprise at most two solid supports. A microwell may
comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more
solid supports. A microwell may comprise at most about 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10 or more solid supports. Some of the microwells
of the microwell array may comprise one solid support and some of
the microwells of the microwell array may comprise two or more
solid supports, as shown in FIG. 5. The microwell may not need to
be covered for any of the methods of the disclosure. In other
words, microwells may not need to be sealed during the method. When
the microwells are not covered (e.g., sealed), the wells may be
spaced apart such that the contents of one microwell may not
diffuse into another microwell.
[0306] Alternatively, or additionally, cells may be captured and/or
purified prior to being contacted with an oligonucleotide
conjugated support. Methods to capture and/or purify cells may
comprise use of antibodies, molecular scaffolds, and/or beads.
Cells may be purified by flow cytometry. Commercially available
kits may be used to capture or purify cells. For example,
Dynabeads(R) may be used to isolate cells. Magnetic isolation may
be used to purify cells. Cells may be purified by
centrifugation.
[0307] Cells may be contacted with oligonucleotide conjugated
supports by creating a suspension comprising cells and the
supports. The suspension may comprise a gel. Cells may be
immobilized on a support or in a solution prior to contact with the
oligonucleotide conjugated supports. Alternatively, cells may be
added to a suspension comprising the oligonucleotide conjugated
support. For example, cells may be added to a hydrogel that is
embedded with oligonucleotide conjugated supports.
[0308] A single cell may be contacted with a single oligonucleotide
coupled solid support. A single cell may be contacted with multiple
oligonucleotide conjugated solid supports. Multiple cells may
interact with a single oligonucleotide conjugated solid support.
Multiple cells may interact with multiple oligonucleotide
conjugated solid supports. The oligonucleotide conjugated solid
supports may be cell-type specific. Alternatively, the
oligonucleotide conjugated support may interact with two or more
different cell types.
Lysis
[0309] Cells in the microwells may be lysed. Lysis may be performed
by mechanical lysis, heat lysis, optical lysis, and/or chemical
lysis. Chemical lysis may include the use of digestive enzymes such
as proteinase K, pepsin, and trypsin. Lysis may be performed by the
addition of a lysis buffer to the microwells. A lysis buffer may
comprise Tris HCl. A lysis buffer may comprise at least about 0.01,
0.05, 0.1, 0.5, or 1M or more Tris HCl. A lysis buffer may comprise
at most about 0.01, 0.05, 0.1, 0.5, or 1M or more Tris HCL. A lysis
buffer may comprise about 0.1 M Tris HCl. The pH of the lysis
buffer may be at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or
more. The pH of the lysis buffer may be at most about 1, 2, 3, 4,
5, 6, 7, 8, 9, or 10 or more. In some instances, the pH of the
lysis buffer is about 7.5. The lysis buffer may comprise a salt
(e.g., LiCl). The concentration of salt in the lysis buffer may be
at least about 0.1, 0.5, or 1M or more. The concentration of salt
in the lysis buffer may be at most about 0.1, 0.5, or 1M or more.
In some instances, the concentration of salt in the lysis buffer is
about 0.5M. The lysis buffer may comprise a detergent (e.g., SDS,
Li dodecyl sufate, triton X, tween, NP-40). The concentration of
the detergent in the lysis buffer may be at least about 0.0001,
0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 2, 3, 4, 5, 6, or 7%
or more. The concentration of the detergent in the lysis buffer may
be at most about 0.0001, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1,
0.5, 1, 2, 3, 4, 5, 6, or 7% or more. In some instances, the
concentration of the detergent in the lysis buffer is about 1% Li
dodecyl sulfate. The time used in the method for lysis may be
dependent on the amount of detergent used. In some instances, the
more detergent used, the less time needed for lysis. The lysis
buffer may comprise a chelating agent (e.g., EDTA, EGTA). The
concentration of a chelating agent in the lysis buffer may be at
least about 1, 5, 10, 15, 20, 25, or 30 mM or more. The
concentration of a chelating agent in the lysis buffer may be at
most about 1, 5, 10, 15, 20, 25, or 30 mM or more. In some
instances, the concentration of chelating agent in the lysis buffer
is about 10 mM. The lysis buffer may comprise a reducing reagent
(e.g., beta-mercaptoethanol, DTT). The concentration of the
reducing reagent in the lysis buffer may be at least about 1, 5,
10, 15, or 20 mM or more. The concentration of the reducing reagent
in the lysis buffer may be at most about 1, 5, 10, 15, or 20 mM or
more. In some instances, the concentration of reducing reagent in
the lysis buffer is about 5 mM. In some instances, a lysis buffer
may comprise about 0.1M TrisHCl, about pH 7.5, about 0.5M LiCl,
about 1% lithium dodecyl sulfate, about 10 mM EDTA, and about 5 mM
DTT.
[0310] Lysis may be performed at a temperature of about 4, 10, 15,
20, 25, or 30 C. Lysis may be performed for about 1, 5, 10, 15, or
20 or more minutes. A lysed cell may comprise at least about
100000, 200000, 300000, 400000, 500000, 600000, or 700000 or more
target nucleic acid molecules. A lysed cell may comprise at most
about 100000, 200000, 300000, 400000, 500000, 600000, or 700000 or
more target nucleic acid molecules. FIG. 7 illustrates exemplary
statistics about the concentration of target nucleic acid (i.e.,
mRNA) that may be obtained from lysis.
Sealing
[0311] The microwells of the microwell array may be sealed during
lysis. Sealing may be useful for preventing cross hybridization of
target nucleic acid between adjacent microwells. A microwell may be
sealed using a cap as shown in FIGS. 8A and B. A cap may be a solid
support. A cap may comprise a bead. The diameter of the bead may be
larger than the diameter of the microwell. For example, a cap may
be at least about 10, 20, 30, 40, 50, 60, 70, 80 or 90% larger than
the diameter of the microwell. For example, a cap may be at most
about 10, 20, 30, 40, 50, 60, 70, 80 or 90% larger than the
diameter of the microwell.
[0312] A cap may comprise cross-linked dextran beads (e.g.,
Sephadex). Cross-linked dextran may range from about 10 micrometers
to about 80 micrometers. The cross-linked dextran of the cap may be
from 20 micrometers to about 50 micrometers. A cap may comprise,
for example, anopore inorganic membranes (e.g., aluminum oxides),
dialysis membranes, glass slides, coverslips, and/or hydrophilic
plastic film (e.g., film coated with a thin film of agarose
hydrated with lysis buffer).
[0313] The cap may allow buffer to pass through into and out of the
microwell, but may prevent macromolecules (e.g., nucleic acid) from
migrating out of the well. A macromolecule of at least about 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or
more nucleotides may be blocked from migrating into or out of the
microwell by the cap. A macromolecule of at most about 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more
nucleotides may be blocked from migrating into or out of the
microwell by the cap.
[0314] A sealed microwell array may comprise a single layer of
beads on top of the microwells. A sealed microwell array may
comprise multiple layers of beads on top of the microwells. A
sealed microwell array may comprise about 1, 2, 3, 4, 5, or 6 or
more layers of beads.
[0315] Depositing a bead, or plurality of beads, onto a solid
support (e.g., a microwell array) can be random or non-random. For
example, contacting a bead with a microwell array can be a random
or non-random contacting. In some embodiments, the bead is
contacted with a microwell array randomly. In some embodiments, the
bead is contacted with a microwell array non-randomly. Depositing
of a plurality of beads to a microwell array can be random or
non-random. For example, the contacting of a plurality of beads to
a microwell array can be a random or non-random contacting. In some
embodiments, the plurality of beads is contacted to a microwell
array randomly. In some embodiments, the plurality of beads is
contacted to a microwell array non-randomly.
Stochastic Labeling of Molecules
[0316] Wherein the sample tag or molecular identifier label is an
oligonucleotide, attachment of the oligonucleotide to a nucleic
acid may occur by a variety of methods, including, but not limited
to, hybridization of the oligonucleotide to the nucleic acid. In
some instances, the oligonucleotide comprises a target specific
region. The target specific region may comprise a sequence that is
complementary to at least a portion of the molecule to be labeled.
The target specific region may hybridize to the molecule, thereby
producing a labeled nucleic acid. Hybridization of the
oligonucleotide to the nucleic acid may be followed by a nucleic
acid extension reaction. The nucleic acid extension reaction may be
reverse transcription.
[0317] Attaching, alternatively referred to as contacting, the
plurality of nucleic acids with the sample tag may comprise
hybridizing the sample tag to one or more of the plurality of
nucleic acids. Contacting the plurality of nucleic acids with the
sample tag may comprise performing a nucleic acid extension
reaction. The nucleic acid extension reaction may be a reverse
transcription reaction.
[0318] Contacting the plurality of nucleic acids with the molecular
identifier label may comprise hybridizing the molecular identifier
label to one or more of the plurality of nucleic acids. Contacting
the plurality of nucleic acids with the molecular identifier label
may comprise performing a nucleic acid extension reaction. The
nucleic acid extension reaction may comprise reverse
transcription.
[0319] Contacting the plurality of nucleic acids with the molecular
identifier label may comprise hybridizing the sample tag to one or
more of the plurality of nucleic acids. Contacting the plurality of
nucleic acids with the molecular identifier label may comprise
hybridizing the molecular identifier label to the sample tag.
[0320] Contacting the plurality of nucleic acids with the sample
tag may comprise hybridizing the molecular identifier label to one
or more of the plurality of nucleic acids. Contacting the plurality
of nucleic acids with the sample tag may comprise hybridizing the
sample tag to the molecular identifier label.
[0321] Attachment of the sample tag and/or the molecular identifier
label to a nucleic acid may occur by ligation. Contacting the
plurality of nucleic acids with the sample tag may comprise
ligating the sample tag to any one of the plurality of nucleic
acids. Contacting the plurality of nucleic acids with the molecular
identifier label may comprise ligating the molecular identifier
label to one or more of the plurality of nucleic acids. Contacting
the plurality of nucleic acids with the sample tag may comprise
ligating the molecular identifier label one or more the nucleic
acids. Contacting the plurality of nucleic acids with the molecular
identifier label may comprise ligating the sample tag to one or
more of the nucleic acids. Ligation techniques comprise blunt-end
ligation and sticky-end ligation. Ligation reactions may include
DNA ligases such as DNA ligase I, DNA ligase III, DNA ligase IV,
and T4 DNA ligase. Ligation reactions may include RNA ligases such
as T4 RNA ligase I and T4 RNA ligase II.
[0322] Methods of ligation are described, for example in Sambrook
et al. (2001) and the New England BioLabs catalog both of which are
incorporated herein by reference for all purposes. Methods include
using T4 DNA Ligase which catalyzes the formation of a
phosphodiester bond between juxtaposed 5' phosphate and 3' hydroxyl
termini in duplex DNA or RNA with blunt and sticky ends; Taq DNA
Ligase which catalyzes the formation of a phosphodiester bond
between juxtaposed 5' phosphate and 3' hydroxyl termini of two
adjacent oligonucleotides which are hybridized to a complementary
target DNA; E. coli DNA ligase which catalyzes the formation of a
phosphodiester bond between juxtaposed 5'-phosphate and 3'-hydroxyl
termini in duplex DNA containing cohesive ends; and T4 RNA ligase
which catalyzes ligation of a 5' phosphoryl-terminated nucleic acid
donor to a 3' hydroxyl-terminated nucleic acid acceptor through the
formation of a 3'.fwdarw.5' phosphodiester bond, substrates include
single-stranded RNA and DNA as well as dinucleoside pyrophosphates;
or any other methods described in the art. Fragmented DNA may be
treated with one or more enzymes, for example, an endonuclease,
prior to ligation of adaptors to one or both ends to facilitate
ligation by generating ends that are compatible with ligation.
[0323] In some instances, both ends of the oligonucleotide are
attached to the molecule. For example, both ends of the
oligonucleotide may be hybridized and/or ligated to one or more
ends of the molecule. In some instances, attachment of both ends of
the oligonucleotide to both ends of the molecule results in the
formation of a circularized labeled nucleic acid. Both ends of the
oligonucleotide may also be attached to the same end of the
molecule. For example, the 5' end of the oligonucleotide is ligated
to the 3' end of the molecule and the 3' end of the oligonucleotide
is hybridized to the 3'end of the molecule, resulting in a labeled
nucleic acid with a hairpin structure at one end. In some instances
the oligonucleotide is attached to the middle of the molecule.
[0324] In some instances, attachment of the oligonucleotide to the
nucleic acid comprises attaching one or more oligonucleotide
linkers to the plurality of nucleic acids. The method may further
comprise attaching one or more oligonucleotide linkers to the
sample-tagged nucleic acids. The method may further comprise
attaching one or more oligonucleotide linkers to the labeled
nucleic acids. Attaching one or more oligonucleotide linkers to a
nucleic acid, sample tag or molecular identifier label may comprise
ligating one or more oligonucleotide linkers to a nucleic acid,
sample tag or molecular identifier label. The one or more linkers
may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70,
80, 90, 100 nucleotides. In some instances, the linker may comprise
at least about 1000 nucleotides.
[0325] In some instances, attachment of the molecular barcode to
the molecule comprises the use of one or more adaptors. As used
herein, the terms "adaptors" and "adaptor regions" may be used
interchangeably. Adaptors may comprise a target specific region,
which allows the attachment of the adaptor to the molecule, and an
oligonucleotide specific region, which allows attachment of the
molecular barcode to the adaptor. Adaptors may further comprise a
universal primer. Adaptors may further comprise a universal PCR
region. Adaptors may be attached to the molecule and/or molecular
barcodes by methods including, but not limited to, hybridization
and/or ligation.
[0326] Methods for ligating adaptors to fragments of nucleic acid
are well known. Adaptors may be double-stranded, single-stranded or
partially single-stranded. In some aspects, adaptors are formed
from two oligonucleotides that have a region of complementarity,
for example, about 10 to 30, or about 15 to 40 bases of perfect
complementarity; so that when the two oligonucleotides are
hybridized together they form a double stranded region. Optionally,
either or both of the oligonucleotides may have a region that is
not complementary to the other oligonucleotide and forms a single
stranded overhang at one or both ends of the adaptor.
Single-stranded overhangs may be about 1 to about 8 bases, or about
2 to about 4. The overhang may be complementary to the overhang
created by cleavage with a restriction enzyme to facilitate
"sticky-end" ligation. Adaptors may include other features, such as
primer binding sites and restriction sites. In some aspects the
restriction site may be for a Type IIS restriction enzyme or
another enzyme that cuts outside of its recognition sequence, such
as EcoP151 (see, Mucke et al. J Mol Biol 2001, 312(4) :687-698 and
U.S. Pat. No. 5,710,000 which is incorporated herein by reference
in its entirety).
[0327] In some instances, stochastically counting the number of
copies of a nucleic acid in a plurality of samples comprises
detecting the adaptor, a complement of the adaptor, a reverse
complement of the adaptor or a portion thereof to determine the
number of different labeled nucleic acids. Detecting the adaptor, a
complement of the adaptor, a reverse complement of the adaptor or a
portion thereof may comprise sequencing the adaptor, a complement
of the adaptor, a reverse complement of the adaptor or a portion
thereof.
[0328] The molecular barcode may be attached to any region of a
molecule. For example, the molecular barcode may be attached to the
5' or 3' end of a polynucleotide (e.g., DNA, RNA). For example, the
target-specific region of the molecular barcode comprises a
sequence that is complementary to a sequence in the 5' region of
the molecule. The target-specific region of the molecular barcode
may also comprise a sequence that is complementary to a sequence in
the 3' region of the molecule. In some instances, the molecular
barcode is attached a region within a gene or gene product. For
example, genomic DNA is fragmented and a sample tag or molecular
identifier label is attached to the fragmented DNA. In other
instances, an RNA molecule is alternatively spliced and the
molecular barcode is attached to the alternatively spliced
variants. In another example, the polynucleotide is digested and
the molecular barcode is attached to the digested polynucleotide.
In another example, the target-specific region of the molecular
barcode comprises a sequence that is complementary to a sequence
within the molecule.
[0329] A molecular barcode, sample tag (e.g., sample index),
cellular label, or molecular identifier label (e.g., molecular
label) comprising a hairpin may act as a probe for a hybridization
chain reaction (HCR), and, thus, may be referred to as an HCR
probe. The HCR probe may comprise a molecular barcode comprising a
hairpin structure. The HCR probe may comprise a sample tag
comprising a hairpin structure. The HCR probe may comprise a
molecular identifier label comprising a hairpin structure. Further
disclosed herein is a stochastic label-based hybridization chain
reaction (HCR) method comprising stochastically labeling one or
more nucleic acid molecules with an HCR probe, wherein the HCR
probe comprises a molecular barcode comprising a hairpin and the
one or more nucleic acid molecules act as initiators for a
hybridization chain reaction. Further disclosed herein is a
stochastic label-based hybridization chain reaction (HCR) method
comprising stochastically labeling one or more nucleic acid
molecules with an HCR probe, wherein the HCR probe comprises a
sample tag comprising a hairpin and the one or more nucleic acid
molecules act as initiators for a hybridization chain reaction.
Further disclosed herein is a stochastic label-based hybridization
chain reaction (HCR) method comprising stochastically labeling one
or more nucleic acid molecules with an HCR probe, wherein the HCR
probe comprises a molecular identifier label comprising a hairpin
and the one or more nucleic acid molecules act as initiators for a
hybridization chain reaction.
[0330] The HCR probe may comprise a hairpin with an overhang
region. The overhang region of the hairpin may comprise a target
specific region. The overhang region may comprise an oligodT
sequence. The sample comprising the one or more nucleic acid
molecules may be treated with one or more restriction nucleases
prior to stochastic labeling. The overhang region may comprise a
restriction enzyme recognition sequence. The sample comprising the
one or more nucleic acid molecules may be contacted with one or
more adapters prior to stochastic labeling to produce an
adapter-nucleic acid molecule hybrid. The overhang region and the
stem may be complementary to the one or more adapters. The HCR
probe may comprise a hairpin with a loop. The loop of the HCR probe
may comprise a label region and/or sample index region.
[0331] Hybridization of a first HCR probe to the nucleic acid
molecules may result in the formation of a labeled nucleic acid,
wherein the first HCR probe is linearized to produce a first
linearized HCR probe. The first linearized HCR probe of the labeled
nucleic acid may act as an initiator for hybridization of a second
HCR probe to the labeled nucleic acid to produce a labeled nucleic
acid with two linearized HCR probes. The second linearized HCR
probe may act as an initiator for another hybridization reaction.
This process may be repeated multiple times to produce a labeled
nucleic acid with multiple linearized HCR probes. The detectable
labels on the HCR probe may enable detection of the labeled nucleic
acid. The detectable labels may be any type of label (e.g.,
fluorphore, chromophore, small molecule, nanoparticle, hapten,
enzyme, antibody, magnet). The detectable labels may comprise
fragments of a single label. The detectable labels may generate a
detectable signal when they are in close proximity. When the HCR
probe is a hairpin, the detectable labels may be too far away to
produce a detectable signal. When the HCR probe is linearized and
multiple linearized HCR probes are hybridized together, the
detectable labels may be in close enough proximity to generate a
detectable signal. For example, a HCR probe may comprise two pyrene
moieties as detectable labels. Alternatively, the detectable labels
may be nanoparticles. The stochastic label-based HCR method may
enable attachment of multiple hairpin HCR probes to a labeled
nucleic acid, which may result in signal amplification. Stochastic
label-based HCR may increase the sensitivity of detection, analysis
and/or quantification of the nucleic acid molecules. Stochastic
label-based HCR may increase the accuracy of detection, analysis,
and/or quantification of one or more nucleic acid molecules.
[0332] After lysis the target nucleic acid of the cells may
hybridize to the oligonucleotide conjugated to the solid support.
The target nucleic acid may hybridize to the target binding region
of the oligonucleotide. The nucleic acid may hybridize to any
region of the olignucleotide.
[0333] In some instances, not all oligonucleotides may bind a
target nucleic acid. This is because in some instances, the number
of oligonucleotides is larger than the number of target nucleic
acids. The number of oligonucleotides conjugated to a solid support
may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold more than the number
of target nucleic acids in a cell. At least 10, 20, 30, 40, 50, 60,
70, 80, 90 or 100% of the oligonucleotides may be bound by a target
nucleic acid. At most 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% of
the oligonucleotides may be bound by a target nucleic acid. In some
instances, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50,
60, 70, 80, 90 or 100 or more different target nucleic acids may be
captured by the oligonucleotides on a solid support. In some
instances, at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50,
60, 70, 80, 90 or 100 or more different target nucleic acids may be
captured by the oligonucleotides on a solid support.
[0334] In some instances, at least about 40, 50, 60, 70, 80, 90,
95, 96, 97, 98, 99, or 100% of the number of copies of a target
nucleic acid are bound to oligonucleotides on a solid support. In
some instances, at most about 40, 50, 60, 70, 80, 90, 95, 96, 97,
98, 99, or 100% of the number of copies of a target nucleic acid
are bound to oligonucleotides on a solid support.
Retrieval
[0335] After lysis, the solid supports may be retrieved. Retrieval
of the solid supports may be performed by using a magnet. Retrieval
of the solid supports may be performed by melting the microwell
array and/or sonication. Retrieval of the solid supports may
comprise centrifugation. Retrieval of the solid supports may
comprise size exclusion. In some instances, at least about 50, 60,
70, 80, 90, 95, or 100% of the solid supports are recovered from
the microwells. In some instances, at most about 50, 60, 70, 80,
90, 95, or 100% of the solid supports are recovered from the
microwells.
Reverse Transcription
[0336] The methods disclosed herein may further comprise reverse
transcription of a labeled-RNA molecule to produce a labeled-cDNA
molecule. In some instances, at least a portion of the
oligonucleotide acts as a primer for the reverse transcription
reaction. The oligodT portion of the oligonucleotide may act as a
primer for first strand synthesis of the cDNA molecule.
[0337] In some instances the labeled cDNA molecule may be used as a
molecule for a new stochastic labeling reaction. The labeled cDNA
may have a first tag or set of tags from attachment to the RNA
prior to reverse transcription and a second tag or set of tags
attached to the cDNA molecule. These multiple labeling reactions
can, for example, be used to determine the efficiency of events
that occur between the attachment of the first and second tags,
e.g., an optional amplification reaction or the reverse
transcription reaction.
[0338] In another example, an oligonucleotide is attached to the 5'
end of an RNA molecule to produce a labeled-RNA molecule. Reverse
transcription of the labeled-RNA molecule may occur by the addition
of a reverse transcription primer. In some instances, the reverse
transcription primer is an oligodT primer, random hexanucleotide
primer, or a target-specific oligonucleotide primer. Generally,
oligodT primers are 12-18 nucleotides in length (SEQ ID NO: 1) and
bind to the endogenous poly(A)+ tail at the 3' end of mammalian
mRNA. Random hexanucleotide primers may bind to mRNA at a variety
of complementary sites. Target-specific oligonucleotide primers
typically selectively prime the mRNA of interest.
[0339] In some instances, the method comprises repeatedly reverse
transcribing the labeled-RNA molecule to produce multiple
labeled-cDNA molecules. The methods disclosed herein may comprise
conducting at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 reverse transcription reactions.
The method may comprise conducting at least about 25, 30, 35, 40,
45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 reverse
transcription reactions.
[0340] Nucleic acid synthesis (e.g., cDNA synthesis) may be
performed on the retrieved solid supports. Nucleic acid synthesis
may be performed in a tube and/or on a rotor to keep the solid
supports suspended. The resulting synthesized nucleic acid may be
used in subsequent nucleic acid amplification and/or sequencing
technologies. Nucleic acid synthesis may comprise generating cDNA
copies on a RNA attached to the oligonucleotide on the solid
support. Generating cDNA copies may comprise using a reverse
transcriptase (RT) or DNA polymerases having RT activity. This may
result in the production of single-stranded cDNA molecules. After
nucleic acid synthesis, unused oligonucleotides may be removed from
the solid support. Removal of the oligonucleotides may occur by
exonuclease treatment (e.g., by ExoI).
[0341] In some embodiments, nucleic acids can be removed from the
solid support using chemical cleavage. For example, a chemical
group or a modified base present in a nucleic acid can be used to
facilitate its removal from a solid support. For example, an ezyme
can be used to remove a nucleic acid from a solid support. For
example, a nucleic acid can be removed from a solid support through
a restriction endonucelase digestion. For example, treatment of a
nucleic acid containing a dUTP or ddUTP with uracil-d-glycosylase
(UDG) can be used to remove a nucleic acid from a solid support.
For example, a nucleic acid can be removed from a solid support
using an enzyme that performs nucleotide excision, such as a base
excision repair enzyme, such as an apurinic/apyrimidinic (AP)
endonuclease. In some embodiments, a nucleic acid can be removed
from a solid support using a photocleavable group and light. In
some embodiments, a cleavable linker can be used to remove a
nucleic acid from the solid support. For example, the cleavable
linker can comprise at least one of biotin/avidin,
biotin/streptavidin, biotin/neutravidin, Ig-protein A, a
photo-labile linker, acid or base labile linker group, or an
aptamer.
[0342] In some embodiments, nucleic acids are not amplified. In
some embodiments, nucleic acids are not amplified prior to
sequencing the nucelic acids. In some embodiments, nucleic acids
not attached to a solid support can be directly sequenced without
prior amplification. In some embodiments, nucleic acids can be
directly sequenced without performing amplification when attached
to a solid support, for example, nucleic acids attached to a solid
support can be directly sequenced while attached to the solid
support. In some embodiments, a nucleic acid that has been removed
from a solid support can be directly sequenced. For example, a
nucleic acid that has been removed from a solid support can be
directly sequenced without performing amplification. Any sequencing
platform conducive to sequencing without amplification can be used
to perform the sequencing.
Amplification
[0343] After the nucleic acid has been synthesized (e.g., reverse
transcribed), it may be amplified. Amplification may be performed
in a multiplex manner, wherein multiple target nucleic acid
sequences are amplified simultaneously. Amplification may add
sequencing adaptors to the nucleic acid. Amplification may be
performed by polymerase chain reaction (PCR). PCR may refer to a
reaction for the in vitro amplification of specific DNA sequences
by the simultaneous primer extension of complementary strands of
DNA. PCR may encompass derivative forms of the reaction, including
but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative
PCR, multiplexed PCR, digital PCR, and assembly PCR.
[0344] The method may further comprise conducting one or more
amplification reactions to produce labeled nucleic acid amplicons.
The labeled nucleic acids may be amplified prior to detecting the
labeled nucleic acids. The method may further comprise combining
the first and second samples prior to conducting the one or more
amplification reactions.
[0345] The amplification reactions may comprise amplifying at least
a portion of the sample tag. The amplification reactions may
comprise amplifying at least a portion of the label. The
amplification reactions may comprise amplifying at least a portion
of the sample tag, label, nucleic acid, or a combination thereof.
The amplification reactions may comprise amplifying at least 1%,
2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,
45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100%
of the plurality of nucleic acids. The method may further comprise
conducting one or more cDNA synthesis reactions to produce one or
more cDNA copies of the sample-tagged nucleic acids or molecular
identifier labeled nucleic acids.
[0346] Amplification of the labeled nucleic acids may comprise
PCR-based methods or non-PCR based methods. Amplification of the
labeled nucleic acids may comprise exponential amplification of the
labeled nucleic acids. Amplification of the labeled nucleic acids
may comprise linear amplification of the labeled nucleic acids.
[0347] In some instances, amplification of the labeled nucleic
acids comprises non-PCR based methods. Examples of non-PCR based
methods include, but are not limited to, multiple displacement
amplification (MDA), transcription-mediated amplification (TMA),
nucleic acid sequence-based amplification (NASBA), strand
displacement amplification (SDA), real-time SDA, rolling circle
amplification, or circle-to-circle amplification. Other
non-PCR-based amplification methods include multiple cycles of
DNA-dependent RNA polymerase-driven RNA transcription amplification
or RNA-directed DNA synthesis and transcription to amplify DNA or
RNA targets (WO 89/01050; WO 88/10315; and U.S. Pat. Nos.
5,130,238; 5,409,818; 5,466,586; 5,514,545; 5,554,517; 5,888,779;
6,063,603; and 6,197,554), a ligase chain reaction (LCR), a Q.beta.
replicase (Q.beta.) method as described in U.S. Pat. No. 4,786,600,
use of palindromic probes, strand displacement amplification,
oligonucleotide-driven amplification using a restriction
endonuclease, an amplification method in which a primer is
hybridized to a nucleic acid sequence and the resulting duplex is
cleaved prior to the extension reaction and amplification, strand
displacement amplification using a nucleic acid polymerase lacking
5' exonuclease activity (U.S. Pat. No. 6,214,587), rolling circle
amplification, and ramification extension amplification (RAM) (U.S.
Pat. No. 5,942,391).
[0348] Amplification of the labeled nucleic acids may comprise
hybridization chain reaction (HCR) based methods (Dirks and Pierce,
PNAS, 2004; Zhang et al., Anal Chem, 2012). HCR based methods may
comprise DNA-based HCR. HCR based methods may comprise one or more
labeled probes. The one or more labeled probes may comprise one or
more sample tags or molecular identifier labels, or the complement
thereof, disclosed herein.
[0349] In some instances, the methods disclosed herein further
comprise conducting a polymerase chain reaction on the labeled
nucleic acid (e.g., labeled-RNA, labeled-DNA, labeled-cDNA) to
produce a labeled-amplicon. The labeled-amplicon may be
double-stranded molecule. The double-stranded molecule may comprise
a double-stranded RNA molecule, a double-stranded DNA molecule, or
a RNA molecule hybridized to a DNA molecule. One or both of the
strands of the double-stranded molecule may comprise the sample tag
or molecular identifier label. Alternatively, the labeled-amplicon
is a single-stranded molecule. The single-stranded molecule may
comprise DNA, RNA, or a combination thereof. The nucleic acids of
the present invention may comprise synthetic or altered nucleic
acids.
[0350] The polymerase chain reaction may be performed by methods
such as PCR, HD-PCR, Next Gen PCR, digital RTA, or any combination
thereof. Additional PCR methods include, but are not limited to,
allele-specific PCR, Alu PCR, assembly PCR, asymmetric PCR, droplet
PCR, emulsion PCR, helicase dependent amplification HDA, hot start
PCR, inverse PCR, linear-after-the-exponential (LATE)-PCR, long
PCR, multiplex PCR, nested PCR, hemi-nested PCR, quantitative PCR,
RT-PCR, real time PCR, single cell PCR, touchdown PCR or
combinations thereof.
[0351] Multiplex PCR reactions may comprise nested PCR reactions.
The method may comprise a pair of primers wherein a first primer
that anneals to any one of the plurality of nucleic acids at least
300 to 400 nucleotides from the 3' end of any one of the plurality
of nucleic acids and a second primer that anneals to any one of the
plurality of nucleic acids at least 200 to 300 nucleotides from the
3' end of any one of the plurality of nucleic acids, wherein the
first primer and second primer generate complementary DNA synthesis
towards the 3' end of any one of the plurality of nucleic
acids.
[0352] In some instances, conducting a polymerase chain reaction
comprises annealing a first target specific primer to the labeled
nucleic acid. Alternatively or additionally, conducting a
polymerase chain reaction further comprises annealing a universal
primer to a universal primer binding site region of the sample tag
or molecular identifier label, wherein the sample tag or molecular
identifier label is on a labeled nucleic acid or labeled-amplicon.
The methods disclosed herein may further comprise annealing a
second target specific primer to the labeled nucleic acid and/or
labeled-amplicon.
[0353] In some instances, the method comprises repeatedly
amplifying the labeled nucleic acid to produce multiple
labeled-amplicons. The methods disclosed herein may comprise
conducting at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 amplification reactions.
Alternatively, the method comprises conducting at least about 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100
amplification reactions.
[0354] Other suitable amplification methods include the ligase
chain reaction (LCR) (for example, Wu and Wallace, Genomics 4, 560
(1989), Landegren et al., Science 241, 1077 (1988) and Barringer et
al. Gene 89:117 (1990)), transcription amplification (Kwoh et al.,
Proc. Natl. Acad. Sci. USA 86, 1173 (1989) and WO88/10315),
self-sustained sequence replication (Guatelli et al., Proc. Nat.
Acad. Sci. USA, 87, 1874 (1990) and WO90/06995), selective
amplification of target polynucleotide sequences (U.S. Pat. No.
6,410,276), consensus sequence primed polymerase chain reaction
(CP-PCR) (U.S. Pat. No. 4,437,975), arbitrarily primed polymerase
chain reaction (AP-PCR) (U.S. Pat. Nos. 5,413,909, 5,861,245),
rolling circle amplification (RCA) (for example, Fire and Xu, PNAS
92:4641 (1995) and Liu et al., J. Am. Chem. Soc. 118:1587 (1996) )
and U.S. Pat. No. 5,648,245, strand displacement amplification (see
Lasken and Egholm, Trends Biotechnol. 2003 21(12):531-5; Barker et
al. Genome Res. 2004 May; 14(5) :901-7; Dean et al. Proc Natl Acad
Sci USA 2002; 99(8) :5261-6; Walker et al. 1992, Nucleic Acids Res.
20(7):1691-6, 1992 and Paez, et al. Nucleic Acids Res. 2004; 32(9)
:e71), Qbeta Replicase, described in PCT Patent Application No.
PCT/US87/00880 and nucleic acid based sequence amplification
(NABSA). (See, U.S. Pat. Nos. 5,409,818, 5,554,517, and 6,063,603,
each of which is incorporated herein by reference), Other
amplification methods that may be used are described in, U.S. Pat.
Nos. 6,582,938, 5,242,794, 5,494,810, 4,988,617, and US Pub. No.
20030143599 each of which is incorporated herein by reference. DNA
may also be amplified by multiplex locus-specific PCR or using
adaptor-ligation and single primer PCR (See Kinzler and Vogelstein,
NAR (1989) 17:3645-53. Other available methods of amplification,
such as balanced PCR (Makrigiorgos, et al. (2002), Nat Biotechnol,
Vol. 20, pp. 936-9), may also be used.
[0355] Molecular inversion probes ("MIPs") may also be used for
amplification of selected targets. MIPs may be generated so that
the ends of the pre-circle probe are complementary to regions that
flank the region to be amplified. The gap may be closed by
extension of the end of the probe so that the complement of the
target is incorporated into the MIP prior to ligation of the ends
to form a closed circle. The closed circle may be amplified and
detected by sequencing or hybridization as previously disclosed in
Hardenbol et al., Genome Res. 15:269-275 (2005) and in U.S. Pat.
No. 6,858,412.
[0356] Amplification may further comprise adding one or more
control nucleic acids to one or more samples comprising a plurality
of nucleic acids. Amplification may further comprise adding one or
more control nucleic acids to a plurality of nucleic acids. The
control nucleic acids may comprise a control label.
[0357] Amplification may comprise use of one or more non-natural
nucleotides. Non-natural nucleotides may comprise photolabile
and/or triggerable nucleotides. Examples of non-natural nucleotides
include, but are not limited to, peptide nucleic acid (PNA),
morpholino and locked nucleic acid (LNA), as well as glycol nucleic
acid (GNA) and threose nucleic acid (TNA). Non-natural nucleotides
may be added to one or more cycles of an amplification reaction.
The addition of the non-natural nucleotides may be used to identify
products as specific cycles or time points in the amplification
reaction.
[0358] Conducting the one or more amplification reactions may
comprise the use of one or more primers. The one or more primers
may comprise one or more oligonucleotides. The one or more
oligonucleotides may comprise at least about 7-9 nucleotides. The
one or more oligonucleotides may comprise less than 12-15
nucleotides. The one or more primers may anneal to at least a
portion of the plurality of labeled nucleic acids. The one or more
primers may anneal to the 3' end and/or 5' end of the plurality of
labeled nucleic acids. The one or more primers may anneal to an
internal region of the plurality of labeled nucleic acids. The
internal region may be at least about 50, 100, 150, 200, 220, 230,
240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360,
370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490,
500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700,
750, 800, 850, 900 or 1000 nucleotides from the 3' ends the
plurality of labeled nucleic acids. The one or more primers may
comprise a fixed panel of primers. The one or more primers may
comprise at least one or more custom primers. The one or more
primers may comprise at least one or more control primers. The one
or more primers may comprise at least one or more housekeeping gene
primers. The one or more oligonucleotides may comprise a sequence
selected from a group consisting of sequences in Table 23. The one
or more primers may comprise a universal primer. The universal
primer may anneal to a universal primer binding site. The one or
more custom primers may anneal to the first sample tag, the second
sample tag, the molecular identifier label, the nucleic acid or a
product thereof. The one or more primers may comprise a universal
primer and a custom primer. The custom primer may be designed to
amplify one or more target nucleic acids. The target nucleic acids
may comprise a subset of the total nucleic acids in one or more
samples. The target nucleic acids may comprise a subset of the
total labeled nucleic acids in one or more samples. The one or more
primers may comprise at least 96 or more custom primers. The one or
more primers may comprise at least 960 or more custom primers. The
one or more primers may comprise at least 9600 or more custom
primers. The one or more custom primers may anneal to two or more
different labeled nucleic acids. The two or more different labeled
nucleic acids may correspond to one or more genes.
[0359] Disclosed herein is a method of selecting a custom primer
comprising: a) a first pass, wherein primers chosen may comprise:
i) no more than three sequential guanines, no more than three
sequential cytosines, no more than four sequential adenines, and no
more than four sequential thymines; ii) at least 3, 4, 5, or 6
nucleotides that are guanines or cytosines; and iii) a sequence
that does not easily form a hairpin structure; b) a second pass,
comprising: i) a first round of choosing a plurality of sequences
that have high coverage of all transcripts; and ii) one or more
subsequent rounds, selecting a sequence that has the highest
coverage of remaining transcripts and a complementary score with
other chosen sequences no more than 4; and c) adding sequences to a
picked set until coverage saturates or total number of customer
primers is less than or equal to about 96.
[0360] The method of selecting the custom primer may further
comprise selecting the at least one common primer based on one or
more mRNA transcripts, non-coding transcripts including structural
RNAs, transcribed pseudogenes, model mRNA provided by a genome
annotation process, sequences corresponding to the genomic contig,
or any combination thereof.
[0361] The method of selecting the custom primer may further
comprise a primer selection method that enriches for one or more
subsets of nucleic acids. The one or more subsets may comprise low
abundance mRNAs.
[0362] The method of selecting the custom primer may further
comprise a computational algorithm. Primers used in the method may
be designed with the use of the Primer 3, a computer program which
suggests primer sequences based on a user defined input sequence.
Other primer designs may also be used, or primers may be selected
by eye without the aid of computer programs. There are many options
available with the program to tailor the primer design to most
applications. Primer3 may consider many factors, including, but not
limited to, oligo melting temperature, length, GC content, 3'
stability, estimated secondary structure, the likelihood of
annealing to or amplifying undesirable sequences (for example
interspersed repeats) and the likelihood of primer-dimer formation
between two copies of the same primer. In the design of primer
pairs, Primer3 may consider product size and melting temperature,
the likelihood of primer-dimer formation between the two primers in
the pair, the difference between primer melting temperatures, and
primer location relative to particular regions of interest to be
avoided.
[0363] The methods, compositions and kits disclosed herein may
comprise one or more primers disclosed in Tables 23-24.
Sequencing
[0364] In some aspects, determining the number of different labeled
nucleic acids may comprise determining the sequence of the labeled
nucleic acid or any product thereof (e.g., labeled-amplicons,
labeled-cDNA molecules). In some instances, an amplified target
nucleic acid may be subjected to sequencing. Determining the
sequence of the labeled nucleic acid or any product thereof may
comprise conducting a sequencing reaction to determine the sequence
of at least a portion of the sample tag, molecular identifier
label, at least a portion of the labeled nucleic acid, a complement
thereof, a reverse complement thereof, or any combination thereof.
In some instances only the sample tag or a portion of the sample
tag is sequenced. In some instances only the molecular identifier
label or a portion of the molecular identifier label is
sequenced.
[0365] Determining the sequence of the labeled nucleic acid or any
product thereof may be performed by sequencing methods such as
Helioscope.TM. single molecule sequencing, Nanopore DNA sequencing,
Lynx Therapeutics' Massively Parallel Signature Sequencing (MPSS),
454 pyrosequencing, Single Molecule real time (RNAP) sequencing,
Illumina (Solexa) sequencing, SOLiD sequencing, Ion Torrent.TM.,
Ion semiconductor sequencing, Single Molecule SMRT.TM. sequencing,
Polony sequencing, DNA nanoball sequencing, and VisiGen
Biotechnologies approach. Alternatively, determining the sequence
of the labeled nucleic acid or any product thereof may use
sequencing platforms, including, but not limited to, Genome
Analyzer IIx, HiSeq, and MiSeq offered by Illumina, Single Molecule
Real Time (SMRT.TM.) technology, such as the PacBio RS system
offered by Pacific Biosciences (California) and the Solexa
Sequencer, True Single Molecule Sequencing (tSMS.TM.) technology
such as the HeliScope.TM. Sequencer offered by Helicos Inc.
(Cambridge, Mass.).
[0366] In some embodiments, the labeled nucleic acids comprise
nucleic acids representing from about 0.01% of the genes of an
organism's genome to about 100% of the genes of an organism's
genome. For example, about 0.01% of the genes of an organism's
genome to about 100% of the genes of an organism's genome can be
sequenced using a target complimentary region comprising a
plurality of multimers by capturing the genes containing a
complimentary sequence from the sample. In some embodiments, the
labeled nucleic acids comprise nucleic acids representing from
about 0.01% of the transcripts of an organism's transcriptome to
about 100% of the transcripts of an organism's transcriptome. For
example, about 0.501% of the transcripts of an organism's
transcriptome to about 100% of the transcripts of an organism's
transcriptome can be sequenced using a target complimentary region
comprising a poly-T tail by capturing the mRNAs from the
sample.
[0367] In some instances, determining the sequence of the labeled
nucleic acid or any product thereof comprises paired-end
sequencing, nanopore sequencing, high-throughput sequencing,
shotgun sequencing, dye-terminator sequencing, multiple-primer DNA
sequencing, primer walking, Sanger dideoxy sequencing,
Maxim-Gilbert sequencing, pyrosequencing, true single molecule
sequencing, or any combination thereof. Alternatively, the sequence
of the labeled nucleic acid or any product thereof may be
determined by electron microscopy or a chemical-sensitive field
effect transistor (chemFET) array.
[0368] Determination of the sequence of a nucleic acid (e.g.,
amplified nucleic acid, labeled nucleic acid, cDNA copy of a
labeled nucleic acid, etc.) may be performed using variety of
sequencing methods including, but not limited to, sequencing by
hybridization (SBH), sequencing by ligation (SBL), quantitative
incremental fluorescent nucleotide addition sequencing (QIFNAS),
stepwise ligation and cleavage, fluorescence resonance energy
transfer (FRET), molecular beacons, TaqMan reporter probe
digestion, pyrosequencing, fluorescent in situ sequencing (FISSEQ),
FISSEQ beads, wobble sequencing, multiplex sequencing, polymerized
colony (POLONY) sequencing; nanogrid rolling circle sequencing
(ROLONY), allele-specific oligo ligation assays (e.g., oligo
ligation assay (OLA), single template molecule OLA using a ligated
linear probe and a rolling circle amplification (RCA) readout,
ligated padlock probes, and/or single template molecule OLA using a
ligated circular padlock probe and a rolling circle amplification
(RCA) readout) and the like. High-throughput sequencing methods,
such as cyclic array sequencing using platforms such as Roche 454,
Illumina Solexa, ABI-SOLiD, ION Torrents, Complete Genomics,
Pacific Bioscience, Helicos, Polonator platforms, may also be
utilized. Sequencing may comprise MiSeq sequencing. Sequencing may
comprise HiSeq sequencing. Sequencing may read the cell label, the
molecular label and/or the gene that was on the original
oligonucleotide.
[0369] In another example, determining the sequence of labeled
nucleic acids or any product thereof comprises RNA-Seq or microRNA
sequencing. Alternatively, determining the sequence of labeled
nucleic acids or any products thereof comprises protein sequencing
techniques such as Edman degradation, peptide mass fingerprinting,
mass spectrometry, or protease digestion.
[0370] The sequencing reaction can, in certain embodiments, occur
on a solid or semi-solid support, in a gel, in an emulsion, on a
surface, on a bead, in a drop, in a continuous follow, in a
dilution, or in one or more physically separate volumes.
[0371] Sequencing may comprise sequencing at least about 10, 20,
30, 40, 50, 60, 70, 80, 90, 100 or more nucleotides or base pairs
of the labeled nucleic acid. In some instances, sequencing
comprises sequencing at least about 200, 300, 400, 500, 600, 700,
800, 900, 1000 or more nucleotides or base pairs of the labeled
nucleic acid. In other instances, sequencing comprises sequencing
at least about 1500; 2,000; 3,000; 4,000; 5,000; 6,000; 7,000;
8,000; 9,000; or 10,000 or more nucleotides or base pairs of the
labeled nucleic acid.
[0372] Sequencing may comprise at least about 200, 300, 400, 500,
600, 700, 800, 900, 1000 or more sequencing reads per run. In some
instances, sequencing comprises sequencing at least about 1500;
2,000; 3,000; 4,000; 5,000; 6,000; 7,000; 8,000; 9,000; or 10,000
or more sequencing reads per run. Sequencing may comprise less than
or equal to about 1,600,000,000 sequencing reads per run.
Sequencing may comprise less than or equal to about 200,000,000
reads per run.
[0373] Determining the number of different labeled nucleic acids
may comprise one or more arrays.
[0374] Determining the number of different labeled nucleic acids
may comprise contacting the labeled nucleic acids with the one or
more probes.
[0375] Probes, as described herein, may comprise a sequence that is
complementary to at least a portion of the labeled nucleic acid or
labeled-amplicon. The plurality of probes may be arranged on the
solid support in discrete regions, wherein a discrete region on the
solid support comprises probes of identical or near-identical
sequences. In some instances, two or more discrete regions on the
solid support comprise two different probes comprising sequences
complementary to the sequence of two different unique identifier
regions of the oligonucleotide tag.
[0376] In some instances, the plurality of probes is hybridized to
the array. The plurality of probes may allow hybridization of the
labeled-molecule to the array. The plurality of probes may comprise
a sequence that is complementary to the stochastic label oligo dT.
Alternatively, or additionally, the plurality of probes comprises a
sequence that is complementary to the molecule.
[0377] Determining the number of different labeled nucleic acids
may comprise contacting the labeled nucleic acids with an array of
a plurality of probes. Determining the number of different labeled
nucleic acids may comprise contacting the labeled nucleic acids
with a glass slide of a plurality of probes.
[0378] Determining the number of different labeled nucleic acids
may comprise labeled probe hybridization, target-specific
amplification, target-specific sequencing, sequencing with labeled
nucleotides specific for target small nucleotide polymorphism,
sequencing with labeled nucleotides specific for restriction enzyme
digest patterns, sequencing with labeled nucleotides specific for
mutations, or a combination thereof.
[0379] Determining the number of different labeled nucleic acids
may comprise flow cytometry sorting of a sequence-specific label.
Determining the number of different labeled nucleic acids may
comprise detection of the labeled nucleic acids attached to the
beads. Detection of the labeled nucleic acids attached to the beads
may comprise fluorescence detection.
[0380] Determining the number of different labeled nucleic acids
may comprise counting the plurality of labeled nucleic acids by
fluorescence resonance energy transfer (FRET), between a
target-specific probe and a labeled nucleic acid or a
target-specific labeled probe.
Detection of Labeled Nucleic Acids
[0381] The methods disclosed herein may further comprise detection
of the labeled nucleic acids and/or labeled-amplicons. Detection of
the labeled nucleic acids and/or labeled-amplicons may comprise
hybridization of the labeled nucleic acids to surface, e.g., a
solid support. The method may further comprise immunoprecipitation
of a target sequence with a nucleic-acid binding protein. Detection
of the labeled nucleic acids and/or labeled amplicons may enable or
assist in determining the number of different labeled nucleic
acids.
[0382] In some instances, the method further comprises contacting
the labeled nucleic acids and/or labeled-amplicons with a
detectable label to produce a detectable-label conjugated labeled
nucleic acid. The methods disclosed herein may further comprise
detecting the detectable-label conjugated labeled nucleic acid.
Detection of the labeled nucleic acids or any products thereof
(e.g., labeled-amplicons, detectable-label conjugated labeled
nucleic acid) may comprise detection of at least a portion of the
sample tag or molecular identifier label, molecule, detectable
label, a complement of the sample tag or molecular identifier
label, a complement of the molecule, or any combination
thereof.
[0383] Detection of the labeled nucleic acids or any products
thereof may comprise an emulsion or a droplet. For example, the
labeled nucleic acids or any products thereof may be in an emulsion
or droplet. A droplet can be a small volume of a first liquid that
is encapsulated by an immiscible second liquid, such as a
continuous phase of an emulsion (and/or by a larger droplet). The
volume of a droplet, and/or the average volume of droplets in an
emulsion, can, for example, be less than about one microliter (or
between about one microliter and one nanoliter or between about one
microliter and one picoliter), less than about one nanoliter (or
between about one nanoliter and one picoliter), or less than about
one picoliter (or between about one picoliter and one femtoliter),
among others. A droplet (or droplets of an emulsion) can have a
diameter (or an average diameter) of less than about 1000, 100, or
10 micrometers, or about 1000 to 10 micrometers, among others. A
droplet can be spherical or nonspherical. Droplets can be generated
having an average diameter of about, less than about, or more than
about 0.001, 0.01, 0.05, 0.1, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80,
100, 120, 130, 140, 150, 160, 180, 200, 300, 400, or 500 microns.
Droplets can have an average diameter of about 0.001 to about 500,
about 0.01 to about 500, about 0.1 to about 500, about 0.1 to about
100, about 0.01 to about 100, or about 1 to about 100 microns. A
droplet can be a simple droplet or a compound droplet. The term
emulsion, as used herein, can refer to a mixture of immiscible
liquids (such as oil and water). Oil-phase and/or water-in-oil
emulsions allow for the compartmentalization of reaction mixtures
within aqueous droplets. The emulsions can comprise aqueous
droplets within a continuous oil phase. The emulsions provided
herein can be oil-in-water emulsions, wherein the droplets are oil
droplets within a continuous aqueous phase. When an emulsion or
droplet is used to isolate, for example, spatially isolate, single
cells, a solid support may not be used. Thus the nucleic acids to
be tagged and analyzed may not be bound to a solid support and in
such instances; a cellular label can correspond to the single cell
or population of cells present in the emulsion or droplet when
tagged. The emulsion or droplet can thus effectively isolate the
tagging or labeling steps with a single cell or plurality of cells
and the cellular label can be used to identify the nucleic acids
that came from the single cell or plurality of cells. In some
embodiments, droplets can be applied to microwells, for example,
similarly to application of beads to microwell arrays.
[0384] Alternatively, detection of the labeled nucleic acids or any
products thereof comprises one or more solutions. In other
instances, detection of the labeled nucleic acids comprises one or
more containers.
[0385] Detection of the labeled nucleic acids or any products
thereof (e.g., labeled-amplicons, detectable-label conjugated
labeled nucleic acid) may comprise detecting each labeled nucleic
acid or products thereof. For example, the methods disclosed herein
comprise sequencing at least a portion of each labeled nucleic
acid, thereby detecting each labeled nucleic acid.
[0386] In some instances, detection of the labeled nucleic acids
and/or labeled-amplicons comprises electrophoresis, spectroscopy,
microscopy, chemiluminescence, luminescence, fluorescence,
immunofluorescence, colorimetry, or electrochemiluminescence
methods. For example, the method comprises detection of a
fluorescent dye. Detection of the labeled nucleic acid or any
products thereof may comprise colorimetric methods. For example,
the colorimetric method comprises the use of a colorimeter or a
colorimetric reader. A non-limiting list of colorimeters and
colorimetric readers include Sensovation's Colorimetric Array
Imaging Reader (CLAIR), ESEQuant Lateral Flow Immunoassay Reader,
SpectraMax 340PC 38, SpectraMax Plus 384, SpectraMax 190, VersaMax,
VMax, and EMax.
[0387] Additional methods used alone or in combination with other
methods to detect the labeled nucleic acids and/or amplicons may
comprise the use of an array detector, fluorescence reader,
non-fluorescent detector, CR reader, luminometer, or scanner. In
some instances, detecting the labeled nucleic acids and/or
labeled-amplicons comprises the use of an array detector. Examples
of array detectors include, but are not limited to, diode-array
detectors, photodiode array detectors, HLPC photodiode array
detectors, array detectors, Germanium array detectors, CMOS and CCD
array detectors, Gated linear CCD array detectors, InGaAs
photodiode array systems, and TE cooled CCD systems. The array
detector may be a microarray detector. Non-limiting examples of
microarray detectors include microelectrode array detectors,
optical DNA microarray detection platforms, DNA microarray
detectors, RNA microarray detectors, and protein microarray
detectors.
[0388] In some instances, a fluorescence reader is used to detect
the labeled nucleic acid and/or labeled-amplicons. The fluorescence
reader may read 1, 2, 3, 4, 5, or more color fluorescence
microarrays or other structures on biochips, on slides, or in
microplates. In some instances, the fluorescence reader is a
Sensovation Fluorescence Array imaging Reader (FLAIR).
Alternatively, the fluorescence reader is a fluorescence microplate
reader such as the Gemini XPS Fluorescence microplate reader,
Gemini EM Fluorescence microplate reader, Finstruments.RTM.
Fluoroskan filter based fluorescence microplate reader, PHERAstar
microplate reader, FlUOstar microplate reader, POLARstar Omega
microplate reader, FLUOstar OPTIMA multi-mode microplate reader and
POLARstar OPTIMA multi-mode microplate reader. Additional examples
of fluorescence readers include PharosFX.TM. and PharosFX Plus
systems.
[0389] In some instances, detection of the labeled nucleic acid
and/or labeled-amplicon comprises the use of a microplate reader.
In some instances, the microplate reader is an xMark.TM. microplate
absorbance spectrophotometer, iMark microplate absorbance reader,
EnSpire.RTM. Multimode plate reader, EnVision Multilabel plate
reader, VICTOR X Multilabel plate reader, FlexStation, SpectraMax
Paradigm, SpectraMax M5e, SpectraMax M5, SpectraMax M4, SpectraMax
M3, SpectraMax M2-M2e, FilterMax F series, Fluoroskan Ascent FL
Microplate Fluoremeter and Luminometer, Fluoroskan Ascent
Microplate Fluoremeter, Luminoskan Ascent Microplate Luminometer,
Multiskan EX Microplate Photometer, Muliskan FC Microplate
Photometer, and Muliskan GO Microplate Photometer. In some
instances, the microplate reader detects absorbance, fluorescence,
luminescence, time-resolved fluorescence, light scattering, or any
combination thereof. In some embodiments, the microplate reader
detects dynamic light scattering. The microplate reader, may in
some instances, detect static light scattering. In some instances,
detection of the labeled nucleic acids and/or labeled-amplicons
comprises the use of a microplate imager. In some instances, the
microplate imager comprises ViewLux uHTS microplate imager and
BioRad microplate imaging system.
[0390] Detection of labeled nucleic acids and/or products thereof
may comprise the use of a luminometer. Examples of luminometers
include, but are not limited to, SpectraMax L, GloMax0-96
microplate luminometer, GloMax.RTM.-20/20 single-tube luminometer,
GloMax.RTM.-Multi+ with Instinct.TM. software, GloMax.RTM.-Multi Jr
single tube multimode reader, LUMIstar OPTIMA, LEADER HC+
luminometer, LEADER 450i luminometer, and LEADER 50i
luminometer.
[0391] In some instances, detection of the labeled nucleic acids
and/or labeled-amplicons comprises the use of a scanner. Scanners
include flatbed scanners such as those provided by Cannon, Epson,
HP, Fujitsu, and Xerox. Additional examples of flatbed scanners
include the FMBIO.RTM. fluorescence imaging scanners (e.g.,
FMBIO.RTM. II, III, and III Plus systems). Scanners may include
microplate scanners such as the Arrayit ArrayPix.TM. microarray
microplate scanner. In some instances, the scanner is a Personal
Molecular Imager.TM. (PMI) system provided by Bio-rad.
[0392] Detection of the labeled nucleic acid may comprise the use
of an analytical technique that measures the mass-to-charge ratio
of charged particles, e.g., mass spectrometry. In some embodiments
the mass-to-charge ratio of charged particles is measured in
combination with chromatographic separation techniques. In some
embodiments sequencing reactions are used in combination with
mass-to-charge ratio of charged particle measurements. In some
embodiments the tags comprise isotopes. In some embodiments the
isotope type or ratio is controlled or manipulated in the tag
library.
[0393] Detection of the labeled nucleic acids or any products
thereof comprises the use of small particles and/or light
scattering. For example, the amplified molecules (e.g.,
labeled-amplicons) are attached to haptens or directly to small
particles and hybridized to the array. The small particles may be
in the nanometer to micrometer range in size. The particles may be
detected when light is scattered off of its surface.
[0394] A colorimetric assay may be used where the small particles
are colored, or haptens may be stained with colorimetric detection
systems. In some instances, a flatbed scanner may be used to detect
the light scattered from particles, or the development of colored
materials. The methods disclosed herein may further comprise the
use of a light absorbing material. The light absorbing material may
be used to block undesirable light scatter or reflection. The light
absorbing material may be a food coloring or other material. In
some instances, detection of the labeled nucleic acid or any
products thereof comprises contacting the labeled nucleic acids
with an off-axis white light.
[0395] In some mebodiments, two or more different types of
biological materials from a sample can be detected simultaneously.
For example, two or more different types of biological materials
selected from the group consisiting of DNA, RNA (e.g., microRNA,
mRNA, etc.), nucleotide, protein, and carbohydrate, from a sample
can be detected simultaneously. For example, DNA and RNA from a
sample can be detected simultaneously using the methods described
herein.
Data Analysis
[0396] The sequencing data may be used to count the number of
target nucleic acid molecules in a cell. For example, a plurality
of copies of a target nucleic acid in a cell may bind to a
different oligonucleotide on the solid support. When the plurality
of target nucleic acids are amplified and sequenced, they may
comprise different molecular labels. The number of molecular labels
for a same target nucleic acid may be indicative of the number of
copies of the target nucleic acid in the cell. Determining the copy
number of a target nucleic acid may be useful for removing
amplification bias when determining the concentration of a target
nucleic acid in a cell.
[0397] The sequencing data may be used to genotype a subject. By
comparing target nucleic acids with different cellular labels, the
copy number variation and/or concentration of the target nucleic
acid may be determined. By comparing concentrations of target
nucleic acids with different cellular labels, the sequencing data
may be used to determine cellular genotype heterogeneity. For
example, a first cell of a sample may comprise a target nucleic
acid at high concentrations, whereas a second cell of the sample
may not comprise the target nucleic acid, or may comprise the
target nucleic acid at low concentrations, thereby indicating the
heterogeneity of the cellular sample.
[0398] Determining cellular genotype heterogeneity may be useful
for diagnosing, prognosing, and determining a course of treatment
of a disease. For example, if a first cell of a sample comprises
the target nucleic acid, but a second cell of the sample does not
comprise the target nucleic acid, but comprises a second target
nucleic acid, then a course of a treatment may include an agent
(e.g., drug) to target the first genotype and an agent (e.g., drug)
to target the second genotype.
[0399] In some embodiments, certain sequence types can be linked to
a DNA or RNA profile. For example, T-cell receptor and/or B-cell
receptor sequences can be linked to a transcription profile,
microRNA profile, or genomic mutation profile of a sample, such as
a single cell. In some embodiments, certain sequence types can be
linked to an antigenicity or protein expression profile. For
example, T-cell receptor and/or B-cell receptor sequences can be
linked to to an antigenicity or protein expression profile via
binding antibodies to a surface, such as a surface comprising
proteins, such as protein targets of antibodies comprising the
T-cell receptor and/or B-cell receptor sequences.
[0400] In some embodiments, the presence or absence of a sequence,
such as a viral sequence, can be linked to a DNA or RNA profile.
For example, the presence or absence of a sequence, such as a viral
sequence, can be linked to a transcription profile, microRNA
profile, or genomic mutation profile of a sample, such as a single
cell.
Kits
[0401] The present disclosure provides kits for carrying out the
methods of the disclosure. A kit may comprise one or more of: a
microwell array, an oligonucleotide, and a solid support. A kit may
comprise a reagent for reconstituting and/or diluting the
oligonucleotides and/or solid support. A kit may comprise reagents
for conjugating the oligonucleotides to the solid support. A kit
may further comprise one or more additional reagents, where such
additional reagents may be selected from: a wash buffer; a control
reagent, an amplification agent for amplifying (e.g., performing
cDNA synthesis and PCR) a target nucleic acid, and a conjugation
agent for conjugating an oligonucleotide to the solid support.
Components of a subject kit may be in separate containers, or may
be combined in a single container.
[0402] A kit may comprise instructions for using the components of
the kit to practice the subject methods. The instructions for
practicing the subject methods may be recorded on a suitable
recording medium. For example, the instructions may be printed on a
substrate, such as paper or plastic, etc. As such, the instructions
may be present in the kits as a package insert, in the labeling of
the container of the kit or components thereof (i.e., associated
with the packaging or subpackaging) etc. In some embodiments, the
instructions may be present as an electronic storage data file
present on a suitable computer readable storage medium, e.g.,
CD-ROM, diskette, flash drive, etc. In some embodiments, the actual
instructions may not be present in the kit, but means for obtaining
the instructions from a remote source, e.g., via the internet, are
provided. For example a kit may comprise a web address where the
instructions may be viewed and/or from which the instructions may
be downloaded. As with the instructions, this means for obtaining
the instructions is recorded on a suitable substrate.
[0403] Further disclosed herein are kits for use in analyzing two
or more molecules from two or more samples. The kits disclosed
herein may comprise a plurality of beads, a primer and
amplification agents sufficient to process at least about 384
samples. Any one of the samples may comprise a single cell. The
nucleic acid amplification may result in a measurement of about 1,
2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80,
85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000
targeted nucleic acids in a sample. The nucleic acid amplification
may result in a measurement of about 1000 targeted nucleic acids in
a sample. The nucleic acid amplification may result in a
measurement of about 100 targeted nucleic acids in a sample. The
nucleic acid amplification may result in a measurement of about 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 100% of total nucleic acids in single
cells. The nucleic acid amplification may result in a global
measurement of all nucleic acid sequences in single cells. The
nucleic acid amplification may result in a measurement of targeted
nucleic acid sequences in single cells by sequencing. The nucleic
acid amplification may result in a measurement of targeted nucleic
acid sequences in single cells by an array.
[0404] The amplification agents may comprise a fixed panel of
primers. The amplification agents may comprise at least one pair of
custom primers. The amplification agents may comprise at least one
pair of control primers. The amplification agents may comprise at
least one pair of housekeeping gene primers. The amplification
agents suitable may comprise a PCR master mix. The kit may further
comprise instructions for primer design and optimization. The kit
may further comprise a microwell plate, wherein the microwell plate
may comprise at least one well in which no more than one bead is
distributed. The kit may further comprise one or more additional
containers. The one or more additional containers may comprise one
or more additional plurality of sample tags. The plurality of one
or more additional sample tags in the one or more additional
containers are different from the first plurality of sample tags in
the first container. The one or more additional containers may
comprise one or more additional molecular identifier labels. The
one or more additional molecular identifier labels of the one or
more additional containers are the same as the one or more
additional molecular identifier labels of the second container.
[0405] The methods and kits disclosed herein may comprise the use
of one or more pipette tips and/or containers (e.g., tubes, vials,
multiwell plates, microwell plates, eppendorf tubes, glass slides,
beads). In some instances, the pipet tips are low binding pipet
tips. Alternatively, or additionally, the containers may be low
binding containers. Low binding pipet tips and low binding
containers may have reduced leaching and/or subsequent sample
degradation associated with silicone-based tips and non-low binding
containers. Low binding pipet tips and low binding containers may
have reduced sample binding as compared to non-low binding pipet
tips and containers. Examples of low binding tips include, but are
not limited to, Corning.RTM. DeckWorks.TM. low binding tips and
Avant Premium low binding graduated tips. A non-limiting list of
low-binding containers include Corning.RTM. Costar.RTM. low binding
microcentrifuge tubes and Cosmobrand low binding PCR tubes and
microcentrifuge tubes.
[0406] Any of the kits disclosed herein can further comprise
software. For example, a kit can comprise software for analyzing
sequences, such as barcodes or target sequences. For example, a kit
can comprise software for analyzing sequences, such as barcodes or
target sequences for counting unique target molecules, such as
unique target molecules from a single cell. For example, a kit can
comprise software for analyzing sequences, such as barcodes or
target sequences for counting unique target molecules, such as
unique target molecules from a gene, such as a gene from a single
cell.
Microwells and Microwell Arrays
[0407] In some instances, the methods of the disclosure provide for
contacting a solid support comprising a conjugated oligonucleotide
with a cell. The contacting step may be performed on a surface.
Exemplary surfaces may include a microwell, a tube, a flask, and
chip. In some instances, the surface comprises a microwell. In some
instances, the microwell is part of a microwell array.
[0408] The microwells of a microwell array may be of a size and
shape capable of containing at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or
10 or more cells per microwell. The microwells may be of a size and
shape capable of containing at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or
10 or more cells per microwell. The microwells of a microwell array
may be of a size and shape capable of containing at least 1, 2, 3,
4, 5, 6, 7, 8, 9, or 10 or more solid supports per microwell. The
microwells may be of a size and shape capable of containing at most
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more solid supports per
microwell. A microwell may comprise at most one cell and one solid
support. A microwell may comprise at most one cell and two solid
supports. A microwell may comprise at least one cell and at most
one solid support. A microwell may comprise at least one cell and
at most two solid supports.
[0409] Microwells on the microwell array may be arranged
horizontally. The microwells may be arranged vertically. The
microwells may be arranged with equal or near equal spacing. The
microwell array may have markers associated with one or more
microwells. For example, the microwells of the microwell array may
be divided into groups each comprised of a prescribed number of
microwells. These groups may be provided on the principal surface
of the substrate. Markers may be provided so that the position of
each group may be determined. A marker may be detectable by the
naked eye. A marker may be a marker that requires optics to see
(e.g., fluorescent marker, emission marker, UV marker).
[0410] A microwell array may comprise at least about 96, 384, 1000,
5000, 10000, 15000, 100000, 150000, 500000, 1000000, or 5000000 or
more microwells. A microwell array may comprise at most about 96,
384, 1000, 5000, 10000, 15000, 100000, 150000 500000, 1000000, or
5000000 or more microwells.
[0411] The shape of the microwell may be cylindrical. The shape of
the microwell may be noncylindrical, such as a polyhedron comprised
of multiple faces (for example, a parallelepiped, hexagonal column,
or octagonal column), an inverted cone, an inverted pyramid
(inverted triangular pyramid, inverted square pyramid, inverted
pentagonal pyramid, inverted hexagonal pyramid, or an inverted
polygonal pyramid with seven or more angles). The microwell may
comprise a shape combining two or more of these shapes. For
example, it may be partly cylindrical, with the remainder having
the shape of an inverted cone. The shape of the microwell may be
one in which a portion of the top of an inverted cone or inverted
pyramid is cut off. The mouth of the microwell may be on the top of
the microwell or the bottom of the microwell. The bottom of the
microwell may be flat, but curved surfaces (e.g., convex or
concave) are also possible. The shape and size of the microwell may
be determined in consideration of the type of cell and/or solid
substrate (e.g., shape, size) to be stored in the microwell.
[0412] The diameter of the microwell may refer to the largest
circle that may be inscribed in the planar shape of the microwell.
The diameter of the microwell may be at least about 0.1, 0.5, 1, 2,
or 3-fold or more the diameter of the cell and/or solid support to
be contained in the microwell. The diameter of the microwell may be
at most about 0.1, 0.5, 1, 2, or 3-fold or more the diameter of the
cell and/or solid support to be contained in the microwell. The
diameter of the microwell may be at least about 10, 20, 30, 40, or
50% or more the diameter of the solid support. The diameter of the
microwell may be at most about 10, 20, 30, 40, or 50% or more the
diameter of the solid support. The diameter of the microwell may be
at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 or more
micrometers. The diameter of the microwell may be at most about 5,
10, 15, 20, 25, 30, 35, 40, 45, or 50 or more micrometers. The
diameter of the microwell is about 25 micrometers. In some
instances, the diameter of the microwell is about 30 micrometers.
In some instances, the diameter of the microwell is about 28
micrometers.
[0413] The difference between the microwell volume and the solid
support volume may be at least about 1.times.10(.sup.-14) m.sup.3,
1.5.times.10(.sup.-14) m.sup.3, 1.7.times.10(.sup.-14) m.sup.3,
2.0.times.10(.sup.-14) m.sup.3, 2.5.times.10(.sup.-14) m.sup.3, or
3.0.times.10(.sup.-14) m.sup.3or more. The difference between the
microwell volume and the solid support volume may be at most about
1.times.10(.sup.-14) m.sup.3, 1.5.times.10(.sup.-14) m.sup.3,
1.7.times.10(.sup.-14) m.sup.3, 2.0.times.10(.sup.-14) m.sup.3,
2.5.times.10(.sup.-14) m.sup.3, or 3.0.times.10(.sup.-14) m.sup.3
or more. The difference between the microwell volume and the solid
support volume may be at least about 1.times.10(.sup.-11) L,
1.5.times.10(.sup.-11) L, 1.7.times.10(.sup.-11) L,
2.0.times.10(.sup.-11) L, 2.5.times.10(.sup.-11) L, or
3.0.times.10(.sup.-11) L or more. The difference between the
microwell volume and the solid support volume may be at most about
1.times.10(.sup.-11) L, 1.5.times.10(.sup.-11) L,
1.7.times.10(.sup.-11) L, 2.0.times.10(.sup.-11) L,
2.5.times.10(.sup.-11) L, or 3.0.times.10(.sup.-11) L or more. FIG.
7 illustrates exemplary statistics about the volume of the
microwell, the solid support, and the differences between the
microwell and the solid support volumes.
[0414] The depth of the microwell may be at least about 0.1, 0.5,
1, 2, 3, 4, or 5-fold or more the diameter of the cell and/or solid
support to be contained in the microwell. The depth of the
microwell may be at most about 0.1, 0.5, 1, 2, 3, 4, or 5-fold or
more the diameter of the cell and/or solid support to be contained
in the microwell. The depth of the microwell may be at least about
10, 20, 30, 40, or 50% or more the depth of the solid support. The
depth of the microwell may be at most about 10, 20, 30, 40, or 50%
or more the depth of the solid support. The depth of the microwell
may be at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 or
more micrometers. The depth of the microwell may be at most about
5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 or more micrometers. The
depth of the microwell may be about 30 micrometers. The depth of
the microwell may be about 28 micrometers. The microwell may be
flat, or substantially flat.
[0415] A microwell array may comprise spacing between the wells.
The spacing between the wells may be at least about 5, 10, 25, 20,
25, 30, 35, 40, 45, or 50 or more micrometers. The spacing between
the wells may be at most about 5, 10, 25, 20, 25, 30, 35, 40, 45,
or 50 or more micrometers. The spacing between the wells may be
about 15 micrometers. The spacing between the wells may be about 25
micrometers.
[0416] There may be differences in the height of dips and rises at
any position on the inner wall of a microwell. By creating dips and
rises on a portion of the inner wall of a well that has been
treated for smoothness, functionality may be added to the well. The
inner wall of a microwell may be smoothed by etching. The degree of
vacuum in the etching device, the type of etching gas, the etching
steps, and the like may be suitably selected. For example,
smoothing of the inner wall of a microwell may be conducted by wet
etching or by combining a hot oxidation step with oxide film
etching. The inner wall of the microwell may be functionalized
(e.g., functionalized with an oligonucleotide, a reactive group, a
functional group).
[0417] The microwell array may be made of silicon, metal (e.g.,
aluminum, stainless steel, copper, nickel, chromium, and titanium),
PDMS (elastomer), glass, polypropylene, agarose, gelatin, pluoronic
(e.g., pluronic F127), plastics (e.g., plastics that are naturally
hydrophilic, such as PMMA), plastics (e.g., PP, COP, COC) and
elastomer (e.g., PDMS) that are hydrophobic but may be treated to
be made hydrophilic), hydrogels (e.g., polyacrylamide, alginate),
or resin (e.g., polyimide, polyethylene, vinyl chloride,
polypropylene, polycarbonate, acrylic, and polyethylene
terephthalate). The microwell array may be made of a material that
is hydrophobic. The microwell array may be made of a material that
is hydrophobic but coated to be made hydrophilic (e.g., by oxygen
plasma treatment). The microwell array may be made of a material
that is hydrophilic but coated to be made hydrophobic.
[0418] A microwell array may be assembled. Microwell array assembly
may comprise obtaining a silicon wafter with patterning (e.g.,
patterned posts made with SU8 photoresist) and incubating it with
PDMS material to create arrays of wells through soft lithography
(e.g., at 80 C for a few hours). For example, uncured PDMS may be
liquid. Uncured PDMS may fill gaps between posts. When PDMS is
cured by heat, it may be come solid, thereby generating the array
of wells. An optical adhesive (e.g., NOA81/NOA63) may be applied to
the PDMS material (e.g., using UV light) to create an array of
posts (e.g., a plurality of arrays). The application may be
performed for at least about 1 second, 2 seconds, 3 seconds, 4
seconds, 5 seconds, 6 seconds, 7 seconds, 8 seconds, 9 seconds, 10
seconds or 1 minute, 2 minutes, 3 minutes, 4 minutes, or 5 or more
minutes. A layer comprising agarose may be applied to the optical
adhesive. The agarose layer may be at least about 1, 2, 3, 4, 5, 6,
7, 8, 9, 10% or more agarose. The agarose layer may be most about
1, 2,3,4 5, 6, 7, 8, 9, 10% or more agarose. The agarose layer may
be about 5% agarose. The agarose layer may be set on Gelbond film,
or any hydrophilic substrate that the agarose may adhere to. The
incubation of the agarose layer on the optical surface may be at
least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more minutes. The
incubation of the agarose layer on the optical surface may be at
most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more minutes.
[0419] In some instances, the methods of the disclosure may use a
surface that may not comprise microwells. The surface may be glass,
plastic, metal. The surface may be coated with solid supports,
extracellular matrix, polymers. The surface may not comprise wells.
The surface may comprise solid supports spatially arranged to limit
molecular diffusion. The methods of the disclosure of capturing
cells and/or cell contents may occur on a flat surface. The methods
of the disclosure of capturing cells and/or cell contents may occur
in a suspension.
Cells and Samples
[0420] The cell and of the disclosure may be a cell from an animal
(e.g., human, rat, pig, horse, cow, dog, mouse). In some instances,
the cell is a human cell. The cell may be a fetal human cell. The
fetal human cell may be obtained from a mother pregnant with the
fetus. The cell may be a cell from a pregnant mother. The cell may
be a cell from a vertebrate, invertebrate, fungi, archae, or
bacteria. The cell may be from a multicellular tissue (e.g., an
organ (e.g., brain, liver, lung, kidney, prostate, ovary, spleen,
lymph node, thyroid, pancreas, heart, skeletal muscle, intestine,
larynx, esophagus, and stomach), a blastocyst). The cell may be a
cell from a cell culture. The cell may be a HeLa cell, a K562 cell,
a Ramos cell, a hybridoma, a stem cell, an undifferentiated cell, a
differentiated cell, a circulating cell, a CHO cell, a 3T3 cell,
and the like.
[0421] In some instances, the cell is a cancerous cell.
Non-limiting examples of cancer cells may include a prostate cancer
cell, a breast cancer cell, a colon cancer cell, a lung cancer
cell, a brain cancer cell, and an ovarian cancer cell. In some
instances, the cell is from a cancer (e.g., a circulating tumor
cell). Non-limiting examples of cancers may include, adenoma,
adenocarcinoma, squamous cell carcinoma, basal cell carcinoma,
small cell carcinoma, large cell undifferentiated carcinoma,
chondrosarcoma, and fibrosarcoma.
[0422] In some instances, the cell is a rare cell. A rare cell can
be a circulatiing tumor cell (CTC), circulating epithelial cell
(CEC), circulating stem cell (CSC), stem cells, undifferentiated
stem cells, cancer stem cells, bone marrow cells, progenitor cells,
foam cells, fetal cells, mesenchymal cells, circulating endothelial
cells, circulating endometrial cells, trophoblasts, immune system
cells (host or graft), connective tissue cells, bacteria, fungi, or
pathogens (for example, bacterial or protozoa), microparticles,
cellular fragments, proteins and nucleic acids, cellular
organelles, other cellular components (for example, mitochondria
and nuclei), and viruses.
[0423] In some instances, the cell is from a tumor. In some
instances, the tumor is benign or malignant. The tumor cell may
comprise a metastatic cell. In some instances, the cell is from a
solid tissue that comprises a plurality of different cell types
(e.g., different genotypes).
[0424] The cell may comprise a virus, bacterium, fungus, and
parasite. Viruses may include, but are not limited to, DNA or RNA
animal viruses (e.g., Picornaviridae (e.g., polioviruses),
Reoviridae (e.g., rotaviruses), Togaviridae (e.g., encephalitis
viruses, yellow fever virus, rubella virus), Orthomyxoviridae
(e.g., influenza viruses), Paramyxoviridae (e.g., respiratory
syncytial virus, measles virus, mumps virus, parainfluenza virus),
Rhabdoviridae (e.g., rabies virus), Coronaviridae, Bunyaviridae,
Flaviviridae, Filoviridae, Arenaviridae, Bunyaviridae and
Retroviridae (e.g., human T cell lymphotropic viruses (HTLV), human
immunodeficiency viruses (HIV), Papovaviridae (e.g., papilloma
viruses), Adenoviridae (e.g., adenovirus), Herpesviridae (e.g.,
herpes simplex viruses), and Poxviridae (e.g., variola
viruses)).
[0425] Exemplary bacteria that may be used in the methods of the
disclosure may include Actinomedurae, Actinomyces israelii,
Bacillus anthracis, Bacillus cereus, Clostridium botulinum,
Clostridium difficile, Clostridium perfringens, Clostridium tetani,
Corynebacterium, Enterococcus faecalis, Listeria monocytogenes,
Nocardia, Propionibacterium acnes, Staphylococcus aureus,
Staphylococcus epiderm, Streptococcus mutans, Streptococcus
pneumoniae and the like. Gram negative bacteria include, but are
not limited to, Afipia felis, Bacteroides, Bartonella
bacilliformis, Bortadella pertussis, Borrelia burgdorferi, Borrelia
recurrentis, Brucella, Calymmatobacterium granulomatis,
Campylobacter, Escherichia coli, Francisella tularensis,
Gardnerella vaginalis, Haemophilius aegyptius, Haemophilius
ducreyi, Haemophilius influenziae, Heliobacter pylori, Legionella
pneumophila, Leptospira interrogans, Neisseria meningitidia,
Porphyromonas gingivalis, Providencia sturti, Pseudomonas
aeruginosa, Salmonella enteridis, Salmonella typhi, Serratia
marcescens, Shigella boydii, Streptobacillus moniliformis,
Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae,
Yersinia enterocolitica, Yersinia pestis and the like. Other
bacteria may include Myobacterium avium, Myobacterium leprae,
Myobacterium tuberculosis, Bartonella henseiae, Chlamydia psittaci,
Chlamydia trachomatis, Coxiella burnetii, Mycoplasma pneumoniae,
Rickettsia akari, Rickettsia prowazekii, Rickettsia rickettsii,
Rickettsia tsutsugamushi, Rickettsia typhi, Ureaplasma urealyticum,
Diplococcus pneumoniae, Ehrlichia chafensis, Enterococcus faecium,
Meningococci and the like.
[0426] Exemplary fungi to be used in the methods of the disclosure
may include, but are not limited to Aspergilli, Candidae, Candida
albicans, Coccidioides immitis, Cryptococci, and combinations
thereof.
[0427] Exemplary parasites to be used in the methods of the
disclosure may include, but are not limited to, Balantidium coli,
Cryptosporidium parvum, Cyclospora cayatanensis, Encephalitozoa,
Entamoeba histolytica, Enterocytozoon bieneusi, Giardia lamblia,
Leishmaniae, Plasmodii, Toxoplasma gondii, Trypanosomae,
trapezoidal amoeba, worms (e.g., helminthes), particularly
parasitic worms including, but not limited to, Nematoda
(roundworms, e.g., whipworms, hookworms, pinworms, ascarids,
filarids and the like), Cestoda (e.g., tapeworms).
[0428] The sample of the disclosure may be a sample from an animal
(e.g., human, rat, pig, horse, cow, dog, mouse). In some instances,
the sample is a human sample. The sample may be a fetal human
sample. The fetal human sample may be obtained from a mother
pregnant with the fetus. The sample may be a sample from a pregnant
mother. The sample may be a sample from a vertebrate, invertebrate,
fungi, archae, or bacteria. The sample may be from a multicellular
tissue (e.g., an organ (e.g., brain, liver, lung, kidney, prostate,
ovary, spleen, lymph node, thyroid, pancreas, heart, skeletal
muscle, intestine, larynx, esophagus, and stomach), a blastocyst).
The sample may be a cell from a cell culture.
[0429] The sample may comprise a plurality of cells. The sample may
comprise a plurality of the same type of cell. The sample may
comprise a plurality of different types of cells. The sample may
comprise a plurality of cells at the same point in the cell cycle
and/or differentiation pathway. The sample may comprise a plurality
of cells at different points in the cell cycle and/or
differentiation pathway. A sample may comprise a plurality of
samples.
[0430] The plurality of samples may comprise at least 5, 10, 20,
30, 40, 50, 60, 70, 80, 90 or 100 or more samples. The plurality of
samples may comprise at least about 100, 200, 300, 400, 500, 600,
700, 800, 900 or 1000 or more samples. The plurality of samples may
comprise at least about 1000, 2000, 3000, 4000, 5000, 6000, 7000,
8000 samples, 9000, or 10,000 samples, or 100,000 samples, or
1,000,000 or more samples. The plurality of samples may comprise at
least about 10,000 samples.
[0431] The one or more nucleic acids in the first sample may be
different from one or more nucleic acids in the second sample. The
one or more nucleic acids in the first sample may be different from
one or more nucleic acids in a plurality of samples. The one or
more nucleic acids may comprise a length of at least about 1
nucleotide, 2 nucleotides, 5 nucleotides, 10 nucleotides, 20
nucleotides, 50 nucleotides, 100 nucleotides, 200 nucleotides, 300
nucleotides, 500 nucleotides, 1000 nucleotides, 2000 nucleotides,
3000 nucleotides, 4000 nucleotides, 5000 nucleotides, 10,000
nucleotides, 100,000 nucleotides, 1,000,000 nucleotides.
[0432] The first sample may comprise one or more cells and the
second sample may comprise one or more cells. The one or more cells
of the first sample may be of the same cell type as the one or more
cells of the second sample. The one or more cells of the first
sample may be of a different cell type as one or more different
cells of the plurality of samples. The cell type may be
chondrocyte, osteoclast, adipocyte, myoblast, stem cell,
endothelial cell or smooth muscle cell. The cell type may be an
immune cell type. The immune cell type may be a T cell, B cell,
thrombocyte, dendritic cell, neutrophil, macrophage or
monocyte.
[0433] The plurality of samples may comprise one or more malignant
cell. The one or more malignant cells may be derived from a tumor,
sarcoma or leukemia.
[0434] The plurality of samples may comprise at least one bodily
fluid. The bodily fluid may comprise blood, urine, lymphatic fluid,
saliva. The plurality of samples may comprise at least one blood
sample.
[0435] The plurality of samples may comprise at least one cell from
one or more biological tissues. The one or more biological tissues
may be a bone, heart, thymus, artery, blood vessel, lung, muscle,
stomach, intestine, liver, pancreas, spleen, kidney, gall bladder,
thyroid gland, adrenal gland, mammary gland, ovary, prostate gland,
testicle, skin, adipose, eye or brain.
[0436] The biological tissue may comprise an infected tissue,
diseased tissue, malignant tissue, calcified tissue or healthy
tissue.
[0437] The plurality of samples may be from one or more sources.
The plurality of samples may be from two or more sources. The
plurality of samples may be from one or more subjects. The
plurality of samples may be from two or more subjects. The
plurality of samples may be from the same subject. The one or more
subjects may be from the same species. The one or more subjects may
be from different species. The one or more subjects may be healthy.
The one or more subjects may be affected by a disease, disorder or
condition. The plurality of samples may comprise cells of an origin
selected from a mammal, bacteria, virus, fungus or plant. The one
or more samples may be from a human, horse, cow, chicken, pig, rat,
mouse, monkey, rabbit, guinea pig, sheep, goat, dog, cat, bird,
fish, frog and fruit fly.
[0438] The plurality of samples may be obtained concurrently. The
plurality of samples may be obtained at the same time. The
plurality of samples may be obtained sequentially. The plurality of
samples may be obtained over a course of years, 100 years, 10
years, 5 years, 4 years, 3 years, 2 years or 1 year of obtaining
one or more different samples. One or more samples may be obtained
within about one year of obtaining one or more different samples.
One or more samples may be obtained within 12 months, 11 months, 10
months, 9 months, 8 months, 7 months, 6 months, 4 months, 3 months,
2 months or 1 month of obtaining one or more different samples. One
or more samples may be obtained within 30 days, 28 days, 26 days,
24 days, 21 days, 20 days, 18 days, 17 days, 16 days, 15 days, 14
days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6
days, 5 days, 4 days, 3 days, 2 days or one day of obtaining one or
more different samples. One or more samples may be obtained within
about 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours,
12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours or 1 hour of
obtaining one or more different samples. One or more samples may be
obtained within about 60 sec, 45 sec, 30 sec, 20 sec, 10 sec, 5
sec, 2 sec or 1 sec of obtaining one or more different samples. One
or more samples may be obtained within less than one second of
obtaining one or more different samples.
Target Molecules
[0439] The methods and kits disclosed herein may be used in the
stochastic labeling of molecules. Such molecules include, but are
not limited to, polynucleotides and polypeptides. As used herein,
the terms "polynucleotide" and "nucleic acid molecule" refers to a
polymeric form of nucleotides of any length, either
ribonucleotides, deoxyribonucleotides, locked nucleic acids (LNA)
or peptide nucleic acids (PNAs), that comprise purine and
pyrimidine bases, or other natural, chemically or biochemically
modified, non-natural, or derivatized nucleotide bases. A
"polynucleotide" or "nucleic acid molecule" may consist of a single
nucleotide or base pair. Alternatively, the "polynucleotide" or
"nucleic acid molecule" comprises two or more nucleotides or base
pairs. For example, the "polynucleotide" or "nucleic acid molecule"
comprises at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200,
300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or base
pairs. In another example, the polynucleotide comprises at least
about 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000,
6500, 7000, 7500, 8000, 8500, 9000, 9500, or 10000 nucleotides or
base pairs. The backbone of the polynucleotide may comprise sugars
and phosphate groups, as may typically be found in RNA or DNA, or
modified or substituted sugar or phosphate groups. A polynucleotide
may comprise modified nucleotides, such as methylated nucleotides
and nucleotide analogs. The sequence of nucleotides may be
interrupted by non-nucleotide components. Thus the terms
nucleoside, nucleotide, deoxynucleoside and deoxynucleotide
generally include analogs such as those described herein. These
analogs are those molecules having some structural features in
common with a naturally occurring nucleoside or nucleotide such
that when incorporated into a nucleic acid or oligonucleoside
sequence, they allow hybridization with a naturally occurring
nucleic acid sequence in solution. Typically, these analogs are
derived from naturally occurring nucleosides and nucleotides by
replacing and/or modifying the base, the ribose or the
phosphodiester moiety. The changes may be tailor made to stabilize
or destabilize hybrid formation or enhance the specificity of
hybridization with a complementary nucleic acid sequence as
desired. In some instances, the molecules are DNA, RNA, or DNA-RNA
hybrids. The molecules may be single-stranded or double-stranded.
In some instances, the molecules are RNA molecules, such as mRNA,
rRNA, tRNA, ncRNA, lncRNA, siRNA, microRNA or miRNA. The RNA
molecules may be polyadenylated. Alternatively, the mRNA molecules
are not polyadenylated. Alternatively, the molecules are DNA
molecules. The DNA molecules may be genomic DNA. The DNA molecules
may comprise exons, introns, untranslated regions, or any
combination thereof. In some instances, the molecules are a panel
of molecules.
[0440] The methods and kits disclosed herein may be used to
stochastically label individual occurrences of identical or nearly
identical molecules and/or different molecules. In some instances,
the methods and kits disclosed herein may be used to stochastically
label identical or nearly identical molecules (e.g., molecules
comprise identical or nearly identical sequences). For example, the
molecules to be labeled comprise at least about 80%, 85%, 90%, 95%,
96%, 97%, 98%, 99%, or 100% sequence identity. The nearly identical
molecules may differ by less than about 100, 90, 80, 70, 60, 50,
40, 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide or
base pair. The plurality of nucleic acids in one or more samples of
the plurality of samples may comprise two or more identical
sequences. At least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%,
80%, 85%, 90%, 95%, 97%, or 100% of the total nucleic acids in one
or more of the plurality of samples may comprise the same sequence.
The plurality of nucleic acids in one or more samples of the
plurality of samples may comprise at least two different sequences.
At least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%,
55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of
the total nucleic acids in one or more of the plurality of samples
may comprise at least two different sequences. In some instances,
the molecules to be labeled are variants of each other. For
example, the molecules to be labeled may contain single nucleotide
polymorphisms or other types of mutations. In another example, the
molecules to be labeled are splice variants. In some instances, at
least one molecule is stochastically labeled. In other instances,
at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 identical or nearly
identical molecules are stochastically labeled. Alternatively, at
least 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600,
700, 800, 900, or 1000 identical or nearly identical molecules are
stochastically labeled. In other instances, at least 1500; 2,000;
2500; 3,000; 3500; 4,000; 4500; 5,000; 6,000; 7,000; 8,000; 9,000;
or 10000 identical or nearly identical molecules are stochastically
labeled. In other instances; at least 15,000; 20,000; 25,000;
30,000; 35,000; 40,000; 45,000; 50,000; 60,000; 70,000; 80,000;
90,000; or 100,000 identical or nearly identical molecules are
stochastically labeled.
[0441] In other instances, the methods and kits disclosed herein
may be used to stochastically label different molecules. For
example, the molecules to be labeled comprise less than 75%, 70%,
65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%,
3%, 2%, 1% sequence identity. The different molecules may differ by
at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40,
50, 60, 70, 80, 90, 100 or more nucleotides or base pairs. In some
instances, at least one molecule is stochastically labeled. In
other instances, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different
molecules are stochastically labeled. Alternatively, at least 20,
30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800,
900, or 1000 different molecules are stochastically labeled. In
other instances, at least 1500; 2,000; 2500; 3,000; 3500; 4,000;
4500; 5,000; 6,000; 7,000; 8,000; 9,000; or 10000 different
molecules are stochastically labeled. In other instances; at least
15,000; 20,000; 25,000; 30,000; 35,000; 40,000; 45,000; 50,000;
60,000; 70,000; 80,000; 90,000; or 100,000 different molecules are
stochastically labeled.
[0442] The different molecules to be labeled may be present in the
sample at different concentrations or amounts. For example, the
concentration or amount of one molecule is greater than the
concentration or amount of another molecule in the sample. In some
instances, the concentration or amount of at least one molecule in
the sample is at least about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100
or more times greater than the concentration or amount of at least
one other molecule in the sample. In some instances, the
concentration or amount of at least one molecule in the sample is
at least about 1000 or more times greater than the concentration or
amount of at least one other molecule in the sample. In another
example, the concentration or amount of one molecule is less than
the concentration or amount of another molecule in the sample. The
concentration or amount of at least one molecule in the sample may
be at least about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 or more
times less than the concentration or amount of at least one other
molecule in the sample. The concentration or amount of at least one
molecule in the sample may be at least about 1000 or more times
less than the concentration or amount of at least one other
molecule in the sample.
[0443] In some instances, the molecules to be labeled are in one or
more samples. The molecules to be labeled may be in two or more
samples. The two or more samples may contain different amounts or
concentrations of the molecules to be labeled. In some instances,
the concentration or amount of one molecule in one sample may be
greater than the concentration or amount of the same molecule in a
different sample. For example, a blood sample might contain a
higher amount of a particular molecule than a urine sample.
Alternatively, a single sample is divided into two or more
subsamples. The subsamples may contain different amounts or
concentrations of the same molecule. The concentration or amount of
at least one molecule in one sample may be at least about 1.5, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40,
45, 50, 60, 70, 80, 90, or 100 or more times greater than the
concentration or amount of the same molecule in another sample.
Alternatively, the concentration or amount of one molecule in one
sample may be less than the concentration or amount of the same
molecule in a different sample. For example, a heart tissue sample
might contain a higher amount of a particular molecule than a lung
tissue sample. The concentration or amount of at least one molecule
in one sample may be at least about 1.5, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90,
or 100 or more times less than the concentration or amount of the
same molecule in another sample. In some instances, the different
concentrations or amounts of a molecule in two or more different
samples is referred to as sample bias.
[0444] The methods and kits disclosed herein may be used for the
analysis of two or more molecules from two or more samples. The two
or more molecules may comprise two or more polypeptides. The method
may comprise determining the identity of two or more labeled
polypeptides. Determining the identity of two or more labeled
polypeptides may comprise mass spectrometry. The method may further
comprise combining the labeled polypeptides of the first sample
with the labeled polypeptides of the second sample. The labeled
polypeptides may be combined prior to determining the number of
different labeled polypeptides. The method may further comprise
combining the first sample-tagged polypeptides and the second
sample-tagged polypeptides. The first sample-tagged polypeptides
and the second sample-tagged polypeptides may be combined prior to
contact with the plurality of molecular identifier labels.
Determining the number of different labeled polypeptides may
comprise detecting at least a portion of the labeled polypeptide.
Detecting at least a portion of the labeled polypeptide may
comprise detecting at least a portion of the sample tag, molecular
identifier label, polypeptide, or a combination thereof.
[0445] As used herein, the term "polypeptide" refers to a molecule
comprising at least one peptide. In some instances, the polypeptide
consists of a single peptide. Alternatively, the polypeptide
comprises two or more peptides. For example, the polypeptide
comprises at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200,
300, 400, 500, 600, 700, 800, 900, or 1000 peptides. Examples of
polypeptides include, but are not limited to, amino acids,
proteins, peptides, hormones, oligosaccharides, lipids,
glycolipids, phospholipids, antibodies, enzymes, kinases,
receptors, transcription factors, and ligands.
Subjects
[0446] The methods and kits disclosed herein may comprise use of a
cell or sample from one or more subjects. A subject may be a human
or a non-human subject. A subject may be living. A subject may be
dead. A subject may be a human that is under the care of a
caregiver (e.g., medical professional). A subject may be suspected
of having a disease. A subject may have a disease. A subject may
have symptoms of a disease. A subject may be a subject that
provides one or more samples. A subject may be a mammal, reptile,
amphibian, and/or bird. A subject may be a non-human primate.
Enzymes
[0447] The methods and kits disclosed herein may comprise one or
more enzymes. Examples of enzymes include, but are not limited to
ligases, reverse transcriptases, polymerases, and restriction
nucleases. In some instances, attachment of the oligonucleotide tag
to the molecules comprises the use of one or more ligases. Examples
of ligases include, but are not limited to, DNA ligases such as DNA
ligase I, DNA ligase III, DNA ligase IV, and T4 DNA ligase, and RNA
ligases such as T4 RNA ligase I and T4 RNA ligase II.
[0448] The methods and kits disclosed herein may further comprise
the use of one or more reverse transcriptases. In some instances,
the reverse transcriptase is a HIV-1 reverse transcriptase, M-MLV
reverse transcriptase, AMV reverse transcriptase, and telomerase
reverse transcriptase. In some instances, the reverse transcriptase
is M-MLV reverse transcriptase.
[0449] In some instances, the methods and kits disclosed herein
comprise the use of one or more polymerases. Examples of
polymerases include, but are not limited to, DNA polymerases and
RNA polymerases. In some instances, the DNA polymerase is a DNA
polymerase I, DNA polymerase II, DNA polymerase III holoenzyme, and
DNA polymerase IV. Commercially available DNA polymerases include,
but are not limited to, Bst 2.0 DNA Polymerase, Bst 2.0
WarmStart.TM. DNA Polymerase, Bst DNA Polymerase, Sulfolobus DNA
Polymerase IV, Taq DNA Polymerase, 9.degree. N.sup.TMm DNA
Polymerase, Deep VentR.TM. (exo-) DNA Polymerase, Deep VentR.TM.
DNA Polymerase, Hemo KlenTaq.TM., LongAmp.RTM. Taq DNA Polymerase,
OneTaq.RTM. DNA Polymerase, Phusion.RTM. DNA Polymerase, Q5.TM.
High-Fidelity DNA Polymerase, Therminator.TM.. y DNA Polymerase,
Therminator.TM. DNA Polymerase, Therminator.TM. II DNA Polymerase,
Therminator.TM. III DNA Polymerase, VentR.RTM. DNA Polymerase,
VentR.RTM. (exo-) DNA Polymerase, Bsu DNA Polymerase, phi29 DNA
Polymerase, T4 DNA Polymerase, T7 DNA Polymerase, Terminal
Transferase, Titanium.RTM. Taq Polymerase, KAPA Taq DNA Polymerase
and KAPA Taq Hot Start DNA Polymerase.
[0450] Alternatively, the polymerase is an RNA polymerases such as
RNA polymerase I, RNA polymerase II, RNA polymerase III, E. coli
Poly(A) polymerase, phi6 RNA polymerase (RdRP), Poly(U) polymerase,
SP6 RNA polymerase, and T7 RNA polymerase.
[0451] In some instances, the methods and kits disclosed herein
comprise one or more restriction enzymes. Restriction enzymes
include type I, type II, type III, and type IV restriction enzymes.
In some instances, Type I enzymes are complex, multi-subunit,
combination restriction-and-modification enzymes that cut DNA at
random far from their recognition sequences. Generally, type II
enzymes cut DNA at defined positions close to or within their
recognition sequences. They may produce discrete restriction
fragments and distinct gel banding patterns. Type III enzymes are
also large combination restriction-and-modification enzymes. They
often cleave outside of their recognition sequences and may require
two such sequences in opposite orientations within the same DNA
molecule to accomplish cleavage; they rarely give complete digests.
In some instances, type IV enzymes recognize modified, typically
methylated DNA and may be exemplified by the McrBC and Mrr systems
of E. coli.
Additional Reagents
[0452] The methods and kits disclosed herein may comprise the use
of one or more reagents. Examples of reagents include, but are not
limited to, PCR reagents, ligation reagents, reverse transcription
reagents, enzyme reagents, hybridization reagents, sample
preparation reagents, and reagents for nucleic acid purification
and/or isolation.
[0453] The methods and kits disclosed herein may comprise the use
of one or more buffers. Examples of buffers include, but are not
limited to, wash buffers, ligation buffers, hybridization buffers,
amplification buffers, and reverse transcription buffers. In some
instances, the hybridization buffer is a commercially available
buffer, such as TMAC Hyb solution, SSPE hybridization solution, and
ECONO.TM. hybridization buffer. The buffers disclosed herein may
comprise one or more detergents.
[0454] The methods and kits disclosed herein may comprise the use
of one or more carriers. Carriers may enhance or improve the
efficiency of one or more reactions disclosed herein (e.g.,
ligation reaction, reverse transcription, amplification,
hybridization). Carriers may decrease or prevent non-specific loss
of the molecules or any products thereof (e.g., labeled-molecule,
labeled-cDNA molecule, labeled-amplicon). For example, the carrier
may decrease non-specific loss of a labeled-molecule through
absorption to surfaces. The carrier may decrease the affinity of
the molecule, labeled-molecule, or any product thereof to a surface
or substrate (e.g., container, eppendorf tube, pipet tip).
Alternatively, the carrier may increase the affinity of the
molecule or any product thereof to a surface or substrate (e.g.,
bead, array, glass, slide, chip). Carriers may protect the molecule
or any product thereof from degradation. For example, carriers may
protect an RNA molecule or any product thereof from ribonucleases.
Alternatively, carriers may protect a DNA molecule or any product
thereof from a DNase. Examples of carriers include, but are not
limited to, nucleic acid molecules such as DNA and/or RNA, or
polypeptides. Examples of DNA carriers include plasmids, vectors,
polyadenylated DNA, and DNA oligonucleotides. Examples of RNA
carriers include polyadenylated RNA, phage RNA, phage MS2 RNA, E.
coli RNA, yeast RNA, yeast tRNA, mammalian RNA, mammalian tRNA,
short polyadenylated synthetic ribonucleotides and RNA
oligonucleotides. The RNA carrier may be a polyadenylated RNA.
Alternatively, the RNA carrier may be a non-polyadenylated RNA. In
some instances, the carrier is from a bacteria, yeast, or virus.
For example, the carrier may be a nucleic acid molecule or a
polypeptide derived from a bacteria, yeast or virus. For example,
the carrier is a protein from Bacillus subtilis. In another
example, the carrier is a nucleic acid molecule from Escherichia
coli. Alternatively, the carrier is a nucleic acid molecule or
peptide from a mammal (e.g., human, mouse, goat, rat, cow, sheep,
pig, dog, or rabbit), avian, amphibian, or reptile.
[0455] The methods and kits disclosed herein may comprise the use
of one or more control agents. Control agents may include control
oligos, inactive enzymes, non-specific competitors. Alternatively,
the control agents comprise bright hybridization, bright probe
controls, nucleic acid templates, spike-in controls, PCR
amplification controls. The PCR amplification controls may be
positive controls. In other instances, the PCR amplification
controls are negative controls. The nucleic acid template controls
may be of known concentrations. The control agents may comprise one
or more labels.
[0456] Spike-in controls may be templates that are added to a
reaction or sample. For example, a spike-in template may be added
to an amplification reaction. The spike-in template may be added to
the amplification reaction any time after the first amplification
cycle. In some instances, the spike-in template is added to the
amplification reaction after the 2nd, 3rd, 4th, 5th, 6th, 7th, 8th,
9th, 10th, 11th, 12th, 13th, 14th, 15th, 20th, 25th, 30th, 35th,
40th, 45th, or 50th amplification cycle. The spike-in template may
be added to the amplification reaction any time before the last
amplification cycle. The spike-in template may comprise one or more
nucleotides or nucleic acid base pairs. The spike-in template may
comprise DNA, RNA, or any combination thereof. The spike-in
template may comprise one or more labels.
Detectable Labels
[0457] The methods, kits, and compositions disclosed herein may
further comprise a detectable label. The terms "detectable label",
"tag" or "label" may be used interchangeably and refer to any
chemical moiety attached to a molecule (e.g., nucleotide,
nucleotide polymer, or nucleic acid binding factor, molecular
barcode). The chemical moiety may be covalently attached the
molecule. The chemical moiety may be non-covalently attached to the
molecule. The molecular barcodes, sample tags and molecular
identifier labels may further comprise a detectable label, tag or
label. Preferably, the label is detectable and renders the
nucleotide or nucleotide polymer detectable to the practitioner of
the invention. Detectable labels that may be used in combination
with the methods disclosed herein include, for example, a
fluorescent label, a chemiluminescent label, a quencher, a
radioactive label, biotin, pyrene moiety, gold, or combinations
thereof. Non-limiting example of detectable labels include
luminescent molecules, fluorochromes, fluorescent quenching agents,
colored molecules, radioisotopes or scintillants.
[0458] In some instances, the methods disclosed herein further
comprise attaching one or more detectable labels to the molecular
barcode, molecular identifier label, the sample tag, the labeled
nucleic acid or any product thereof (e.g., labeled-amplicon). The
methods may comprise attaching two or more detectable labels to the
molecular barcode, molecular identifier label, the sample tag or
the labeled nucleic acid. Alternatively, the method comprises
attaching at least about 3, 4, 5, 6, 7, 8, 9, or 10 detectable
labels to the molecular barcode, molecular identifier label, the
sample tag or the labeled nucleic acid. In some instances, the
detectable label is a Cy.TM. label. The Cy.TM. label is a Cy3
label. Alternatively, or additionally, the detectable label is
biotin. In some embodiments the detectable label is attached to a
probe which binds to the molecular barcode, molecular identifier
label, the sample tag or the labeled nucleic acid. This may occur,
for example, after the nucleic acid or labeled nucleic acid has
been hybridized to an array. In one example the nucleic acid or
labeled nucleic acid is bound to partners on an array. After the
binding, a probe which may bind the labeled nucleic acid is bound
to the molecules on the array. This process may be repeated with
multiple probes and labels to decrease the likelihood that a signal
is the result of nonspecific binding of a label or nonspecific
binding of the molecule to the array.
[0459] A donor acceptor pair may be used as the detectable labels.
Either the donor or acceptor may be attached to a probe that binds
a nucleic acid. The probe may be, for example, a nucleic acid probe
that may bind to a nucleic acid or the labeled nucleic acid. The
corresponding donor or acceptor may be added to cause a signal.
[0460] In some instances, the detectable label is a Freedom dye,
Alexa Fluor.RTM. dye, Cy.TM. dye, fluorescein dye, or LI-COR
IRDyes.RTM.. In some instances, the Freedom dye is fluorescein
(6-FAM.TM., 6-carboxyfluoroscein), MAX (NHS Ester), TYE.TM. 563,
TEX 615, TYE.TM. 665, TYE 705. The detectable label may be an Alexa
Fluor dye. Examples of Alexa Fluor.RTM. dyes include Alexa
Fluor.RTM. 488 (NHS Ester), Alexa Fluor.RTM. 532 (NHS Ester), Alexa
Fluor.RTM. 546 (NHS Ester), Alexa Fluor.RTM. 594 (NHS Ester), Alexa
Fluor.RTM. 647 (NHS Ester), Alexa Fluor.RTM. 660 (NHS Ester), or
Alexa Fluor.RTM. 750 (NHS Ester). Alternatively, the detectable
label is a Cy.TM. dye. Examples of Cy.TM. dyes include, but are not
limited to, Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, and Cy7. In some
instances, the detectable label is a fluorescein dye. Non-limiting
examples of fluorescein dyes include 6-FAM.TM. (Azide), 6-FAM.TM.
(NHS Ester), Fluorescein dT, JOE (NHS Ester), TET.TM., and HEX.TM..
In some instances, the detectable label is a LI-COR IRDyes.RTM.,
such as 5' IRDye.RTM. 700, 5' IRDye.RTM. 800, or IRDye.RTM. 800CW
(NHS Ester). In some instances, the detectable label is TYE.TM.
563. Alternatively, the detectable label is Cy3.
[0461] The detectable label may be Rhodamine dye. Examples of
rhodamine dyes include, but are not limited to, Rhodamine
Green.TM.-X (NHS Ester), TAMRA.TM., TAMRA.TM. (NHS Ester),
Rhodamine Red.TM.-X(NHS Ester), ROX.TM. (NHS Ester), and
5'TAMRA.TM. (Azide). In other instances, the detectable label is a
WellRED Dye. WellRED Dyes include, but are not limited to, WellRED
D4 dye, WellRED D3 dye, and WellRED D2 dye. In some instances, the
detectable label is Texas Red.RTM.-X (NHS Ester), Lightcycler.RTM.
640 (NHS Ester), or Dy 750 (NHS Ester).
[0462] In some instances, detectable labels include a linker
molecule. Examples of linker molecules include, but are not limited
to, biotin, avidin, streptavidin, HRP, protein A, protein G,
antibodies or fragments thereof, Grb2, polyhistidine, Ni2+, FLAG
tags, myc tags. Alternatively, detectable labels include heavy
metals, electron donors/acceptors, acridinium esters, dyes and
calorimetric substrates. In other instances, detectable labels
include enzymes such as alkaline phosphatase, peroxidase and
luciferase.
[0463] A change in mass may be considered a detectable label, as is
the case of surface plasmon resonance detection. The skilled
artisan would readily recognize useful detectable labels that are
not mentioned herein, which may be employed in the operation of the
present invention.
[0464] In some instances, detectable labels are used with primers.
For example, the universal primer is a labeled with the detectable
label (e.g., Cy3 labeled universal primer, fluorophore labeled
universal primer). Alternatively, the target specific primer is
labeled with the detectable label (e.g., TYE 563-labeled target
specific primer). In other instances, detectable labels are used
with the sample tags or molecular identifier labels. For example,
the oligonucleotide tag is labeled with a detectable label (e.g.,
biotin-labeled oligonucleotide tag). In other instances, detectable
labels are used with the nucleic acid template molecule. Detectable
labels may be used to detect the labeled-molecules or
labeled-amplicons. Alternatively, detectable labels are used to
detect the nucleic acid template molecule.
[0465] In some instances, the detectable label is attached to the
primer, molecular barcode, sample tag, molecular identifier label,
labeled-molecule, labeled-amplicon, probe, HCR probe, and/or
non-labeled nucleic acid. Methods for attaching the detectable
label to the primer, oligonucleotide tag, labeled-molecule,
labeled-amplicon, and/or non-labeled nucleic acid include, but are
not limited to, chemical labeling and enzymatic labeling. In some
instances, the detectable label is attached by chemical labeling.
In some embodiments, chemical labeling techniques comprise a
chemically reactive group. Non-limiting examples of reactive groups
include amine-reactive succinimidyl esters such as NHS-fluorescein
or NHS-rhodamine, amine-reactive isothiocyanate derivatives
including FITC, and sulfhydryl-reactive maleimide-activated fluors
such as fluorescein-5-maleimide. In some embodiments, reaction of
any of these reactive dyes with another molecule results in a
stable covalent bond formed between a fluorophore and the linker
and/or agent. In some embodiments, the reactive group is
isothiocyanates. In some embodiments, a label is attached to an
agent through the primary amines of lysine side chains. In some
embodiments, chemical labeling comprises a NHS-ester chemistry
method.
[0466] Alternatively, the detectable label is attached by enzymatic
labeling. Enzymatic labeling methods may include, but are not
limited to, a biotin acceptor peptide/biotin ligase (AP/Bir A),
acyl carrier protein/phosphopantetheine transferase (ACP/PPTase),
human 06-alkylguanine transferase (hAGT), Q-tag/transglutaminase
(TGase), aldehyde tag/formylglycine-generating enzyme, mutated
prokaryotic dehalogenase (HaloTag.TM.), and farnesylation
motif/protein farnesyltransferase (PFTase) methods. Affinity
labeling may include, but is not limited to, noncovalent methods
utilizing dihydrofolate reductase (DHFR) and Phe36Val mutant of
FK506-binding protein 12 (FKBP12(F36V)), and metal-chelation
methods.
[0467] Crosslinking reagents may be used to attach a detectable
label to the primer, oligonucleotide tag, labeled-molecule,
labeled-amplicon, and/or non-labeled nucleic acid. In some
instances, the crosslinking reagent is glutaraldehyde.
Glutaraldehyde may react with amine groups to create crosslinks by
several routes. For example, under reducing conditions, the
aldehydes on both ends of glutaraldehyde couple with amines to form
secondary amine linkages.
[0468] In some instances, attachment of the detectable label to the
primer, oligonucleotide tag, labeled-molecule, labeled-amplicon,
and/or non-labeled nucleic acid comprises periodate-activation
followed by reductive amination. In some instances, Sulfo-SMCC or
other heterobifunctional crosslinkers are used to conjugate the
detectable to the primer, oligonucleotide tag, labeled-molecule,
labeled-amplicon, and/or non-labeled nucleic acid. For example,
Sulfo-SMCC is used to conjugate an enzyme to a drug. In some
embodiments, the enzyme is activated and purified in one step and
then conjugated to the drug in a second step. In some embodiments,
the directionality of crosslinking is limited to one specific
orientation (e.g., amines on the enzyme to sulfhydryl groups on the
antibody).
Diseases/Conditions
[0469] Disclosed herein are methods, kits and compositions for
diagnosing, monitoring, and/or prognosing a status or outcome of a
disease or condition in a subject. Generally, the method comprises
(a) stochastically labeling two or more molecules from two or more
samples to produce two or more labeled nucleic acids; (b) detecting
and/or quantifying the two or more labeled nucleic acids; and (c)
diagnosing, monitoring, and/or prognosing a status or outcome of a
disease or condition in a subject based on the detecting and/or
quantifying of the two or more labeled nucleic acids. may The
method may further comprise determining a therapeutic regimen. The
two or more of samples may comprise one or more samples from a
subject suffering from a disease or condition. The two or more
samples may comprise one or more samples from a healthy subject.
The two or more samples may comprise one or more samples from a
control.
[0470] Monitoring a disease or condition may further comprise
monitoring a therapeutic regimen. Monitoring a therapeutic regimen
may comprise determining the efficacy of a therapeutic regimen. In
some instances, monitoring a therapeutic regimen comprises
administrating, terminating, adding, or altering a therapeutic
regimen. Altering a therapeutic regimen may comprise increasing or
reducing the dosage, dosing frequency, or mode of administration of
a therapeutic regimen. A therapeutic regimen may comprise one or
more therapeutic drugs. The therapeutic drugs may be an anticancer
drug, antiviral drug, antibacterial drug, antipathogenic drug, or
any combination thereof.
Cancer
[0471] In some instances, the disease or condition is a cancer. The
molecules to be stochastically labeled may be from a cancerous cell
or tissue. In some instances, the cancer is a sarcoma, carcinoma,
lymphoma or leukemia. Sarcomas are cancers of the bone, cartilage,
fat, muscle, blood vessels, or other connective or supportive
tissue. Sarcomas include, but are not limited to, bone cancer,
fibrosarcoma, chondrosarcoma, Ewing's sarcoma, malignant
hemangioendothelioma, malignant schwannoma, bilateral vestibular
schwannoma, osteosarcoma, soft tissue sarcomas (e.g., alveolar soft
part sarcoma, angiosarcoma, cystosarcoma phylloides,
dermatofibrosarcoma, desmoid tumor, epithelioid sarcoma,
extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma,
hemangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma,
lymphangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma,
neurofibrosarcoma, rhabdomyosarcoma, and synovial sarcoma).
[0472] Carcinomas are cancers that begin in the epithelial cells,
which are cells that cover the surface of the body, produce
hormones, and make up glands. By way of non-limiting example,
carcinomas include breast cancer, pancreatic cancer, lung cancer,
colon cancer, colorectal cancer, rectal cancer, kidney cancer,
bladder cancer, stomach cancer, prostate cancer, liver cancer,
ovarian cancer, brain cancer, vaginal cancer, vulvar cancer,
uterine cancer, oral cancer, penile cancer, testicular cancer,
esophageal cancer, skin cancer, cancer of the fallopian tubes, head
and neck cancer, gastrointestinal stromal cancer, adenocarcinoma,
cutaneous or intraocular melanoma, cancer of the anal region,
cancer of the small intestine, cancer of the endocrine system,
cancer of the thyroid gland, cancer of the parathyroid gland,
cancer of the adrenal gland, cancer of the urethra, cancer of the
renal pelvis, cancer of the ureter, cancer of the endometrium,
cancer of the cervix, cancer of the pituitary gland, neoplasms of
the central nervous system (CNS), primary CNS lymphoma, brain stem
glioma, and spinal axis tumors. In some instances, the cancer is a
skin cancer, such as a basal cell carcinoma, squamous cell
carcinoma, melanoma, nonmelanoma, or actinic (solar) keratosis.
[0473] In some instances, the cancer is a lung cancer. Lung cancer
may start in the airways that branch off the trachea to supply the
lungs (bronchi) or the small air sacs of the lung (the alveoli).
Lung cancers include non-small cell lung carcinoma (NSCLC), small
cell lung carcinoma, and mesotheliomia. Examples of NSCLC include
squamous cell carcinoma, adenocarcinoma, and large cell carcinoma.
The mesothelioma may be a cancerous tumor of the lining of the lung
and chest cavity (pleura) or lining of the abdomen (peritoneum).
The mesothelioma may be due to asbestos exposure. The cancer may be
a brain cancer, such as a glioblastoma.
[0474] Alternatively, the cancer may be a central nervous system
(CNS) tumor. CNS tumors may be classified as gliomas or nongliomas.
The glioma may be malignant glioma, high grade glioma, diffuse
intrinsic pontine glioma. Examples of gliomas include astrocytomas,
oligodendrogliomas (or mixtures of oligodendroglioma and astocytoma
elements), and ependymomas. Astrocytomas include, but are not
limited to, low-grade astrocytomas, anaplastic astrocytomas,
glioblastoma multiforme, pilocytic astrocytoma, pleomorphic
xanthoastrocytoma, and subependymal giant cell astrocytoma.
Oligodendrogliomas include low-grade oligodendrogliomas (or
oligoastrocytomas) and anaplastic oligodendriogliomas. Nongliomas
include meningiomas, pituitary adenomas, primary CNS lymphomas, and
medulloblastomas. In some instances, the cancer is a
meningioma.
[0475] The leukemia may be an acute lymphocytic leukemia, acute
myelocytic leukemia, chronic lymphocytic leukemia, or chronic
myelocytic leukemia. Additional types of leukemias include hairy
cell leukemia, chronic myelomonocytic leukemia, and juvenile
myelomonocytic leukemia.
[0476] Lymphomas are cancers of the lymphocytes and may develop
from either B or T lymphocytes. The two major types of lymphoma are
Hodgkin's lymphoma, previously known as Hodgkin's disease, and
non-Hodgkin's lymphoma. Hodgkin's lymphoma is marked by the
presence of the Reed-Sternberg cell. Non-Hodgkin's lymphomas are
all lymphomas which are not Hodgkin's lymphoma. Non-Hodgkin
lymphomas may be indolent lymphomas and aggressive lymphomas.
Non-Hodgkin's lymphomas include, but are not limited to, diffuse
large B cell lymphoma, follicular lymphoma, mucosa-associated
lymphatic tissue lymphoma (MALT), small cell lymphocytic lymphoma,
mantle cell lymphoma, Burkitt's lymphoma, mediastinal large B cell
lymphoma, Waldenstrom macroglobulinemia, nodal marginal zone B cell
lymphoma (NMZL), splenic marginal zone lymphoma (SMZL), extranodal
marginal zone B cell lymphoma, intravascular large B cell lymphoma,
primary effusion lymphoma, and lymphomatoid granulomatosis.
Pathogenic Infection
[0477] In some instances, the disease or condition is a pathogenic
infection. The molecules to be stochastically labeled may be from a
pathogen. The pathogen may be a virus, bacterium, fungi, or
protozoan. In some instances, the pathogen may be a protozoan, such
as Acanthamoeba (e.g., A. astronyxis, A. castellanii, A.
culbertsoni, A. hatchetti, A. polyphaga, A. rhysodes, A. healyi, A.
divionensis), Brachiola (e.g., B. connori, B. vesicularum),
Cryptosporidium (e.g., C. parvum), Cyclospora (e.g., C.
cayetanensis), Encephalitozoon (e.g., E. cuniculi, E. hellem, E.
intestinalis), Entamoeba (e.g., E. histolytica), Enterocytozoon
(e.g., E. bieneusi), Giardia (e.g., G. lamblia), Isospora (e.g., I.
belli), Microsporidium (e.g., M. africanum, M. ceylonensis),
Naegleria (e.g., N. fowleri), Nosema (e.g., N. algerae, N.
ocularum), Pleistophora, Trachipleistophora (e.g., T.
anthropophthera, T. hominis), and Vittaforma (e.g., V. corneae).
The pathogen may be a fungus, such as, Candida, Aspergillus,
Cryptococcus, Histoplasma, Pneumocystis, and Stachybotrys.
[0478] The pathogen may be a bacterium. Exemplary bacteria include,
but are not limited to, Bordetella, Borrelia, Brucella,
Campylobacter, Chlamydia, Chlamydophila, Clostridium,
Corynebacterium, Enterococcus, Escherichia, Francisella,
Haemophilus, Helicobacter, Legionella, Leptospira, Listeria,
Mycobacterium, Mycoplasma, Neisseria, Pseudomonas, Rickettsia,
Salmonella, Shigella, Staphylococcus, Streptococcus, Treponema,
Vibrio, or Yersinia.
[0479] The virus may be a reverse transcribing virus. Examples of
reverse transcribing viruses include, but are not limited to,
single stranded RNA-RT (ssRNA-RT) virus and double-stranded DNA-RT
(dsDNA-RT) virus. Non-limiting examples of ssRNA-RT viruses include
retroviruses, alpharetrovirus, betaretrovirus, gammaretrovirus,
deltaretrovirus, epsilonretrovirus, lentivirus, spuma virus,
metavirirus, and pseudoviruses. Non-limiting examples of dsDNA-RT
viruses include hepadenovirus and caulimovirus. The virus can be a
DNA virus. The virus can be a RNA virus. The DNA virus may be a
double-stranded DNA (dsDNA) virus. In some instances, the dsDNA
virus is an adenovirus, herpes virus, or pox virus. Examples of
adenoviruses include, but are not limited to, adenovirus and
infectious canine hepatitis virus. Examples of herpes viruses
include, but are not limited to, herpes simplex virus,
varicella-zoster virus, cytomegalovirus, and Epstein-Barr virus. A
non-limiting list of pox viruses includes smallpox virus, cow pox
virus, sheep pox virus, monkey pox virus, and vaccinia virus. The
DNA virus may be a single-stranded DNA (ssDNA) virus. The ssDNA
virus may be a parvovirus. Examples of parvoviruses include, but
are not limited to, parvovirus B19, canine parvovirus, mouse
parvovirus, porcine parvovirus, feline panleukopenia, and Mink
enteritis virus.
[0480] The virus can be a RNA virus. The RNA virus may be a
double-stranded RNA (dsRNA) virus, (+) sense single-stranded RNA
virus ((+)ssRNA) virus, or (-) sense single-stranded ((-) ssRNA)
virus. A non-limiting list of dsRNA viruses include reovirus,
orthoreovirus, cypovirus, rotavirus, bluetongue virus, and
phytoreovirus. Examples of (+) ssRNA viruses include, but are not
limited to, picornavirus and togavirus. Examples of picornaviruses
include, but are not limited to, enterovirus, rhinovirus,
hepatovirus, cardiovirus, aphthovirus, poliovirus, parechovirus,
erbovirus, kobuvirus, teschovirus, and coxsackie. In some
instances, the togavirus is a rubella virus, Sindbis virus, Eastern
equine encephalitis virus, Western equine encephalitis virus,
Venezuelan equine encephalitis virus, Ross River virus,
O'nyong'nyong virus, Chikungunya, or Semliki Forest virus. A
non-limiting list of (-) ssRNA viruses include orthomyxovirus and
rhabdovirus. Examples of orthomyxoviruses include, but are not
limited to, influenzavirus a, influenzavirus B, influenzavirus C,
isavirus, and thogotovirus. Examples of rhabdoviruses include, but
are not limited to, cytorhabdovirus, dichorhabdovirus,
ephemerovirus, lyssavirus, novirhabdovirus, and vesiculovirus.
Fetal Disorders
[0481] In some instances, the disease or condition is pregnancy.
The methods and kits disclosed herein may comprise diagnosing a
fetal condition in a pregnant subject. The methods and kits
disclosed herein may comprise identifying fetal mutations or
genetic abnormalities. The molecules to be stochastically labeled
may be from a fetal cell or tissue. Alternatively, or additionally,
the molecules to be labeled may be from the pregnant subject.
[0482] The methods and kits disclosed herein may be used in the
diagnosis, prediction or monitoring of autosomal trisomies (e.g.,
Trisomy 13, 15, 16, 18, 21, or 22). In some cases the trisomy may
be associated with an increased chance of miscarriage (e.g.,
Trisomy 15, 16, or 22). In other cases, the trisomy that is
detected is a liveborn trisomy that may indicate that an infant
will be born with birth defects (e.g., Trisomy 13 (Patau Syndrome),
Trisomy 18 (Edwards Syndrome), and Trisomy 21 (Down Syndrome)). The
abnormality may also be of a sex chromosome (e.g., XXY
(Klinefelter's Syndrome), XYY (Jacobs Syndrome), or XXX (Trisomy
X). The molecule(s) to be labeled may be on one or more of the
following chromosomes: 13, 18, 21, X, or Y. For example, the
molecule is on chromosome 21 and/or on chromosome 18, and/or on
chromosome 13.
[0483] Further fetal conditions that may be determined based on the
methods and kits disclosed herein include monosomy of one or more
chromosomes (X chromosome monosomy, also known as Turner's
syndrome), trisomy of one or more chromosomes (13, 18, 21, and X),
tetrasomy and pentasomy of one or more chromosomes (which in humans
is most commonly observed in the sex chromosomes, e.g.,)(XXX, XXYY,
XXXY, XYYY, XXXXY, XXXYY, XYYYY and XXYYY), monoploidy, triploidy
(three of every chromosome, e.g., 69 chromosomes in humans),
tetraploidy (four of every chromosome, e.g., 92 chromosomes in
humans), pentaploidy and multiploidy.
[0484] Iurther disclosed herein is a method of forensic analysis
comprising any of the above described methods. Forensic scientists
may use nucleic acids in various samples (e.g., blood, semen, skin,
saliva, hair) found at a crime scene to identify the presence of an
individual at the scene, such as a perpetrator. This process is
formally termed DNA profiling, but may also be called "genetic
fingerprinting." For example, DNA profiling comprises measuring and
comparing the lengths of variable sections of repetitive DNA, such
as short tandem repeats and minisatellites, in various samples and
people. This method is usually an extremely reliable technique for
matching a DNA sample from a person with DNA in a sample found at
the crime scene. However, identification may be complicated if the
scene is contaminated with DNA from several people. In this
instance, as well as in other forensic applications, it may be
advantageous to obtain absolute quantification of nucleic acids
from a single cell or small number of cells.
[0485] In some instances, the disease or condition is an immune
disorder. An immune diorder can be an inflammatory disorder, an
autoimmune disorder, irritable bowel syndrome or ulcerative
colitis. Examples of autoimmune diseases include Chrohn's disease,
lupus, and Graves' disease.
[0486] In some instances, the disease or disorder is a neorlogical
condition or disorder. A neorlogical condition or disorder can be
Acquired Epileptiform Aphasia, Acute Disseminated
Encephalomyelitis, Adrenoleukodystrophy, Agenesis of the corpus
callosum, Agnosia, Aicardi syndrome, Alexander disease, Alpers'
disease, Alternating hemiplegia, Alzheimer's disease, Amyotrophic
lateral sclerosis (see Motor Neuron Disease), Anencephaly, Angelman
syndrome, Angiomatosis, Anoxia, Aphasia, Apraxia, Arachnoid cysts,
Arachnoiditis, Arnold-Chiari malformation, Arteriovenous
malformation, Asperger's syndrome, Ataxia Telangiectasia, Attention
Deficit Hyperactivity Disorder, Autism, Auditory processing
disorder, Autonomic Dysfunction, Pain, Batten disease, Behcet's
disease, Bell's palsy, Benign Essential Blepharospasm, Benign Focal
Amyotrophy, Benign Intracranial Hypertension, Bilateral
frontoparietal polymicrogyria, Binswanger's disease, Blepharospasm,
Bloch-Sulzberger syndrome, Brachial plexus injury, Brain abscess,
Brain damage, Brain injury, Brain tumor, Brown-Sequard syndrome,
Canavan disease, Carpal tunnel syndrome (CTS), Causalgia, Central
pain syndrome, Central pontine myelinolysis, Centronuclear
myopathy, Cephalic disorder, Cerebral aneurysm, Cerebral
arteriosclerosis, Cerebral atrophy, Cerebral gigantism, Cerebral
palsy, Charcot-Marie-Tooth disease, Chiari malformation, Chorea,
Chronic inflammatory demyelinating polyneuropathy (CIDP), Chronic
pain, Chronic regional pain syndrome, Coffin Lowry syndrome, Coma,
including Persistent Vegetative State, Complex I deficiency
syndrome, Complex I deficiency syndrome, Complex II deficiency
syndrome, Complex III deficiency syndrome, Complex IV/COX
deficiency syndrome, Complex V deficiency syndrome, Congenital
facial diplegia, Corticobasal degeneration, Cranial arteritis,
Craniosynostosis, Creutzfeldt-Jakob disease, Cumulative trauma
disorders, Cushing's syndrome, Cytomegalic inclusion body disease
(CIBD), Cytomegalovirus Infection, Dandy-Walker syndrome, Dawson
disease, Deficiency of mitochondrial NADH dehydrogenase component
of Complex I, De Morsier's syndrome, Dejerine-Klumpke palsy,
Dejerine-Sottas disease, Delayed sleep phase syndrome, Dementia,
Dermatomyositis, Neurological Dyspraxia, Diabetic neuropathy,
Diffuse sclerosis, Dysautonomia, Dyscalculia, Dysgraphia, Dyslexia,
Dystonia, Early infantile epileptic encephalopathy, Empty sella
syndrome, Encephalitis, Encephalocele, Encephalotrigeminal
angiomatosis, Encopresis, Epilepsy, Erb's palsy, Erythromelalgia,
Essential tremor, Fabry's disease, Fahr's syndrome, Fainting,
Familial spastic paralysis, Febrile seizures, Fisher syndrome,
Friedreich's ataxia, FART Syndrome, Gaucher's disease, Gerstmann's
syndrome, Giant cell arteritis, Giant cell inclusion disease,
Globoid cell Leukodystrophy, Gray matter heterotopia,
Guillain-Barre syndrome, HTLV-1 associated myelopathy,
Hallervorden-Spatz disease, Head injury, Headache, Hemifacial
Spasm, Hereditary Spastic Paraplegia, Heredopathia atactica
polyneuritiformis, Herpes zoster oticus, Herpes zoster, Hirayama
syndrome, Holoprosencephaly, Huntington's disease, Hydranencephaly,
Hydrocephalus, Hypercortisolism, Hypoxia, Immune-Mediated
encephalomyelitis, Inclusion body myositis, Incontinentia pigmenti,
Infantile phytanic acid storage disease, Infantile Refsum disease,
Infantile spasms, Inflammatory myopathy, Intracranial cyst,
Intracranial hypertension, Joubert syndrome, Kearns-Sayre syndrome,
Kennedy disease, Kinsbourne syndrome, Klippel Feil syndrome, Krabbe
disease, Kufor-Rakeb syndrome, Kugelberg-Welander disease, Kuru,
Lafora disease, Lambert-Eaton myasthenic syndrome, Landau-Kleffner
syndrome, Lateral medullary (Wallenberg) syndrome, Learning
disabilities, Leigh's disease, Lennox-Gastaut syndrome, Lesch-Nyhan
syndrome, Leukodystrophy, Lewy body dementia, Lissencephaly,
Locked-In syndrome, Lou Gehrig's disease, Lumbar disc disease, Lyme
disease-Neurological Sequelae, Machado-Joseph disease
(Spinocerebellar ataxia type 3), Macrencephaly, Maple Syrup Urine
Disease, Megalencephaly, Melkersson-Rosenthal syndrome, Menieres
disease, Meningitis, Menkes disease, Metachromatic leukodystrophy,
Microcephaly, Migraine, Miller Fisher syndrome, Mini-Strokes,
Mitochondrial disease, Mitochondrial dysfunction, Mitochondrial
Myopathies, Mitochondrial Respiratory Chain Complex I Deficiency,
Mobius syndrome, Monomelic amyotrophy, Motor Neuron Disease, Motor
skills disorder, Moyamoya disease, Mucopolysaccharidoses,
Multi-Infarct Dementia, Multifocal motor neuropathy, Multiple
sclerosis, Multiple system atrophy with postural hypotension,
Muscular dystrophy, Myalgic encephalomyelitis, Myasthenia gravis,
Myelinoclastic diffuse sclerosis, Myoclonic Encephalopathy of
infants, Myoclonus, Myopathy, Myotubular myopathy, Myotonia
congenita, NADH-coenzyme Q reductase deficiency, NADH:Q(1)
oxidoreductase deficiency, Narcolepsy, Neurofibromatosis,
Neuroleptic malignant syndrome, Neurological manifestations of
AIDS, Neurological sequelae of lupus, Neuromyotonia, Neuronal
ceroid lipofuscinosis, Neuronal migration disorders, Niemann-Pick
disease, Non 24-hour sleep-wake syndrome, Nonverbal learning
disorder, O'Sullivan-McLeod syndrome, Occipital Neuralgia, Occult
Spinal Dysraphism Sequence, Ohtahara syndrome, Olivopontocerebellar
atrophy, Opsoclonus myoclonus syndrome, Optic neuritis, Orthostatic
Hypotension, Overuse syndrome, oxidative phosphorylation disorders,
Palinopsia, Paresthesia, Parkinson's disease, Paramyotonia
Congenita, Paraneoplastic diseases, Paroxysmal attacks,
Parry-Romberg syndrome (also known as Rombergs Syndrome),
Pelizaeus-Merzbacher disease, Periodic Paralyses, Peripheral
neuropathy, Persistent Vegetative State, Pervasive neurological
disorders, Photic sneeze reflex, Phytanic Acid Storage disease,
Pick's disease, Pinched Nerve, Pituitary Tumors, PMG, Polio,
Polymicrogyria, Polymyositis, Porencephaly, Post-Polio syndrome,
Postherpetic Neuralgia (PHN), Postinfectious Encephalomyelitis,
Postural Hypotension, Prader-Willi syndrome, Primary Lateral
Sclerosis, Prion diseases, Progressive Hemifacial Atrophy also
known as Rombergs_Syndrome, Progressive multifocal
leukoencephalopathy, Progressive Sclerosing Poliodystrophy,
Progressive Supranuclear Palsy, Pseudotumor cerebri, Ramsay-Hunt
syndrome (Type I and Type II), Rasmussen's encephalitis, Reflex
sympathetic dystrophy syndrome, Refsum disease, Repetitive motion
disorders, Repetitive stress injury, Restless legs syndrome,
Retrovirus-associated myelopathy, Rett syndrome, Reye's syndrome,
Rombergs_Syndrome, Rabies, Saint Vitus dance, Sandhoff disease,
Schytsophrenia, Schilder's disease, Schizencephaly, Sensory
Integration Dysfunction, Septo-optic dysplasia, Shaken baby
syndrome, Shingles, Shy-Drager syndrome, Sjogren's syndrome, Sleep
apnea, Sleeping sickness, Snatiation, Sotos syndrome, Spasticity,
Spina bifida, Spinal cord injury, Spinal cord tumors, Spinal
muscular atrophy, Spinal stenosis, Steele-Richardson-Olszewski
syndrome, see Progressive Supranuclear Palsy, Spinocerebellar
ataxia, Stiff-person syndrome, Stroke, Sturge-Weber syndrome,
Subacute sclerosing panencephalitis, Subcortical arteriosclerotic
encephalopathy, Superficial siderosis, Sydenham's chorea, Syncope,
Synesthesia, Syringomyelia, Tardive dyskinesia, Tay-Sachs disease,
Temporal arteritis, Tethered spinal cord syndrome, Thomsen disease,
Thoracic outlet syndrome, Tic Douloureux, Todd's paralysis,
Tourette syndrome, Transient ischemic attack, Transmissible
spongiform encephalopathies, Transverse myelitis, Traumatic brain
injury, Tremor, Trigeminal neuralgia, Tropical spastic paraparesis,
Trypanosomiasis, Tuberous sclerosis, Vasculitis including temporal
arteritis, Von Hippel-Lindau disease (VHL), Viliuisk
Encephalomyelitis (VE), Wallenberg's syndrome, Werdnig-Hoffman
disease, West syndrome, Whiplash, Williams syndrome, Wilson's
disease, X-Linked Spinal and Bulbar Muscular Atrophy, or Zellweger
syndrome.
Definitions
[0487] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limits of that range is also specifically disclosed. Each
smaller range between any stated value or intervening value in a
stated range and any other stated or intervening value in that
stated range is encompassed within the invention. The upper and
lower limits of these smaller ranges may independently be included
or excluded in the range, and each range where either, neither or
both limits are included in the smaller ranges is also encompassed
within the invention, subject to any specifically excluded limit in
the stated range. Where the stated range includes one or both of
the limits, ranges excluding either or both of those included
limits are also included in the invention.
[0488] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, some potential and preferred methods and materials are
now described. All publications mentioned herein are incorporated
herein by reference to disclose and describe the methods and/or
materials in connection with which the publications are cited. It
is understood that the present disclosure supersedes any disclosure
of an incorporated publication to the extent there is a
contradiction.
[0489] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which may be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present invention. Any recited
method can be carried out in the order of events recited or in any
other order which is logically possible.
[0490] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a cell" includes a plurality of such cells
and reference to "the peptide" includes reference to one or more
peptides and equivalents thereof, e.g., polypeptides, known to
those skilled in the art, and so forth.
[0491] As used herein, the term "label" may refer to a unique
oligonucleotide sequence that may allow a corresponding nucleic
acid base and/or nucleic acid sequence to be identified. In some
embodiments, the nucleic acid base and/or nucleic acid sequence may
be located at a specific position on a larger polynucleotide
sequence (e.g., a polynucleotide attached to a bead).
[0492] As used herein, the term "hybridization" may refer to the
process in which two single-stranded polynucleotides bind
non-covalently to form a stable double-stranded polynucleotide. The
term "hybridization" may also refer to triple-stranded
hybridization. The resulting (usually) double-stranded
polynucleotide is a "hybrid" or "duplex."
[0493] As used herein, "nucleoside" may include natural
nucleosides, such as 2'-deoxy and 2'-hydroxyl forms. "Analogs" in
reference to nucleosides may include synthetic nucleosides
comprising modified base moieties and/or modified sugar moieties,
or the like. Analogs may be capable of hybridization. Analogs may
include synthetic nucleosides designed to enhance binding
properties, reduce complexity, increase specificity, and the like.
Exemplary types of analogs may include oligonucleotide
phosphoramidates (referred to herein as "amidates"), peptide
nucleic acids (referred to herein as "PNAs"),
oligo-2'-O-alkylribonucleotides, polynucleotides containing C-5
propynylpyrimidines, and locked nucleic acids (LNAs).
[0494] As used herein, the terms "nucleic acid molecule," "nucleic
acid sequence," "nucleic acid fragment," "oligonucleotide,"
"oligonucleotide fragment" and "polynucleotide" may be used
interchangeably and may be intended to include, but are not limited
to, polymeric forms of nucleotides that may have various lengths,
either deoxyribonucleotides or ribonucleotides, or analogs thereof.
Nucleic acid molecules may include single stranded DNA (ssDNA),
double stranded DNA (dsDNA), single stranded RNA (ssRNA) and double
stranded RNA (dsRNA). Different nucleic acid molecules may have
different three-dimensional structures, and may perform various
functions. Non-limiting examples of nucleic acid molecules may
include a gene, a gene fragment, a genomic gap, an exon, an intron,
intergenic DNA (including, without limitation, heterochromatic
DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes,
small interfering RNA (siRNA), miRNA, small nucleolar RNA (snoRNA),
cDNA, recombinant polynucleotides, branched polynucleotides,
plasmids, vectors, isolated DNA of a sequence, isolated RNA of a
sequence, nucleic acid probes, and primers.
[0495] Oligonucleotides may refer to a linear polymer of natural or
modified nucleosidic monomers linked by phosphodiester bonds or
analogs thereof. An "oligonucleotide fragment" refers to an
oligonucleotide sequence that has been cleaved into two or more
smaller oligonucleotide sequences. Oligonucleotides may be natural
or synthetic. Oligonucleotides may include deoxyribonucleosides,
ribonucleosides, and non-natural analogs thereof, such as anomeric
forms thereof, peptide nucleic acids (PNAs), and the like.
Oligonucleotides may be capable of specifically binding to a target
genome by way of a regular pattern of monomer-to-monomer
interactions, such as Watson-Crick type of base pairing, base
stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or
the like. Oligonucleotides and the term "polynucleotides" may be
used interchangeably herein.
[0496] Whenever an oligonucleotide is represented by a sequence of
letters, such as "ATGCCTG," it may be understood that the
nucleotides are in 5' to 3' order from left to right and that "A"
denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes
deoxyguanosine, "T" denotes deoxythymidine, and "U" denotes the
ribonucleoside, uridine, unless otherwise noted.
[0497] Oligonucleotides may include one or more non-standard
nucleotide(s), nucleotide analog(s) and/or modified nucleotides.
Examples of modified nucleotides may include, but are not limited
to diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl)uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-D46-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, oligonucleotide
phosphoramidates (referred to herein as "amidates"), peptide
nucleic acids (referred to herein as "PNAs"),
oligo-2'-O-alkylribonucleotides, polynucleotides containing C-5
propynylpyrimidines, locked nucleic acids (LNAs), 2,6-diaminopurine
and the like. Nucleic acid molecules may also be modified at the
base moiety (e.g., at one or more atoms that typically are
available to form a hydrogen bond with a complementary nucleotide
and/or at one or more atoms that are not typically capable of
forming a hydrogen bond with a complementary nucleotide), sugar
moiety or phosphate backbone.
[0498] As used herein, a "sample" may refer to a single cell or
many cells. Nucleic acid molecules may be obtained from one or more
samples. A sample may comprise a single cell type or a combination
of two or more cell types. A sample may include a collection of
cells that perform a similar function such as those found, for
example, in a tissue. A sample may comprise one or more tissues.
Examples of tissues may include, but are not limited to, epithelial
tissue (e.g., skin, the lining of glands, bowel, skin and organs
such as the liver, lung, kidney), endothelium (e.g., the lining of
blood and lymphatic vessels), mesothelium (e.g., the lining of
pleural, peritoneal and pericardial spaces), mesenchyme (e.g.,
cells filling the spaces between the organs, including fat, muscle,
bone, cartilage and tendon cells), blood cells (e.g., erythrocytes,
granulocytes, neutrophils, eosinophils, basophils, monocytes,
T-lymphocytes (also known as T-cells), B-lymphocytes (also known as
B-cells), plasma cells, megakaryocytes and the like), neurons, germ
cells (e.g., spermatozoa, oocytes), amniotic fluid cells, placenta,
stem cells and the like. A sample may be obtained from one or more
of single cells in culture, metagenomic samples, embryonic stem
cells, induced pluripotent stem cells, cancer samples, tissue
sections, and biopsies, or any combination thereof.
[0499] As used herein, the term "organism" may include, but is not
limited to, a human, a non-human primate, a cow, a horse, a sheep,
a goat, a pig, a dog, a cat, a rabbit, a mouse, a rat, a gerbil, a
frog, a toad, a fish (e.g., Danio rerio) a roundworm (e.g., C.
elegans) and any transgenic species thereof. The term "organism"
may also include, but is not limited to, a yeast (e.g., S.
cerevisiae) cell, a yeast tetrad, a yeast colony, a bacterium, a
bacterial colony, a virion, virosome, virus-like particle and/or
cultures thereof, and the like.
[0500] As used herein, the term "attach," "conjugate," and "couple"
may be used interchangeably and may refer to both covalent
interactions and noncovalent interactions.
[0501] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. It is intended that the following claims
define the scope of the invention and that methods and structures
within the scope of these claims and their equivalents be covered
thereby.
EXAMPLES
Example 1
Enzymatic Split-Pool Synthesis
[0502] In this example, an enzymatic split-pool synthesis method
was used to produce oligonucleotide coupled beads. As shown in FIG.
2A, a set of oligonucleotides was added to each well of a first
plate. An oligonucleotide in a set of oligonucleotides comprises a
5'amine, universal sequence, cell label and a linker. The 5' amine,
universal sequence and linker are the same for each set of
oligonucleotides. The universal sequence and linker are different
from each other. However, the cell label is different for each set
of oligonucleotides. Thus, each well has a different cell label. In
Step 1 of the enzymatic split-pool synthesis,
oligonucleotide-coupled beads were synthesized by adding a single
bead to each well and performing
1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) coupling
reactions. The oligonucleotides beads resulting from Step 1
comprise a bead coupled to multiple oligonucleotides. The
oligonucleotide comprises a 5'-amine, universal sequence, cellular
label 1, and linker 1 (see FIG. 2A). The oligonucleotides on the
same bead are the same. However, oligonucleotides on a first bead
are different from oligonucleotides on a second bead.
[0503] In Step 2 of the enzymatic split-pool synthesis, multiple
washes were performed to remove uncoupled oligonucleotides. Once
the uncoupled oligonucleotides were removed, the
oligonucleotide-coupled beads were pooled (see FIG. 2A). The
oligonucleotide coupled beads resulting from Step 2 comprise a bead
coupled to multiple single stranded oligonucleotides. The single
stranded oligonucleotide comprises a 5' amine, universal sequence,
cell label 1 and linker 1. Each oligonucleotide on a bead is
identical. However, each bead comprises a different
oligonucleotide. The oligonucleotides coupled to the different
beads differ by the cell label 1 sequence.
[0504] As shown in FIG. 2B, a set of oligonucleotides was added to
each well of a second plate. An oligonucleotide in a set of
oligonucleotides comprises a first linker, cell label, and a second
linker. The first and second linkers are the same for each set of
oligonucleotides. The first and second linkers are different from
each other. However, the cell label is different for each set of
oligonucleotides. Thus, each well has a different cell label.
[0505] In Step 3 of the enzymatic split-pool synthesis, the
oligonucleotide coupled beads that were pooled in Step 2 were split
into the wells of the second plate. Because the first linker of the
oligonucleotides in the wells of the second plate are complementary
to the linker of the oligonucleotides coupled to the beads, primer
extension using Klenow large fragment was performed to couple the
oligonucleotides from the second plate to the oligonucleotide
coupled beads from Step 2. The oligonucleotides coupled beads
resulting from Step 3 comprise a bead coupled to multiple double
stranded oligonucleotides. The double stranded oligonucleotide
comprises a 5' amine, universal sequence, cell label 1, linker 1,
cell label 2, and linker 2 (see FIG. 2B).
[0506] In Step 4 of the enzymatic split-pool synthesis, multiple
washes were performed to remove uncoupled oligonucleotides and the
Klenow large fragment enzymes. The second plate was heated to
denature the double stranded oligonucleotides, and the
oligonucleotide coupled beads were pooled (see FIG. 2B). The
oligonucleotide coupled beads resulting from Step 4 comprise a bead
coupled to multiple single stranded oligonucleotides. The single
stranded oligonucleotide comprises a 5' amine, universal sequence,
cell label 1, linker 1, cell label 2, and linker 2. Each
oligonucleotide on a bead is identical. However, each bead
comprises a different oligonucleotide. The oligonucleotides coupled
to the different beads differ by the combined cell label sequences.
For example, a first bead may comprise oligonucleotides comprising
a first cell label of cell label A and second cell label of cell
label C and a second bead may comprise oligonucleotides comprising
a first cell label of cell label C and a second cell label of cell
label D. Thus, the first bead and the second bead may comprise the
same cell label (in this case, cell label C), however, the combined
cell label sequences of the first bead and the second bead are
different (e.g., for the first bead, the combined cell label
sequence is cell label A+cell label C; for the second bead, the
combined cell label sequence is cell label C+cell label A). In
other instances, two beads may comprise oligonucleotides comprising
different cell labels. For example, a first bead may comprise
oligonucleotides comprising cell label A and cell label B and a
second bead may comprise oligonucleotides comprising cell label C
and cell label D. In this instance, both of the cell labels of the
first bead are different from both of the cell labels of the second
bead.
[0507] As shown in FIG. 2C, a set of oligonucleotides was added to
each well of a third plate. An oligonucleotide in a set of
oligonucleotides comprises a linker, cell label, molecular label,
and an oligodT. The linker and oligodT sequences are the same for
each set of oligonucleotides. However, the cell label is different
for each set of oligonucleotides. Thus, each well has a different
cell label. In addition, the molecular label is different for
oligonucleotides within a set. Thus, a single well contains a
plurality of oligonucleotides with the same cell label, but
different molecular labels. The oligonucleotides from different
wells may contain the same molecular label.
[0508] In Step 5 of the enzymatic split-pool synthesis, the
oligonucleotide coupled beads that were pooled in Step 4 were split
into the wells of the third plate. Because the linker of the
oligonucleotides in the wells of the second plate are complementary
to the second linker of the oligonucleotides coupled to the beads,
primer extension using Klenow large fragment was performed to
couple the oligonucleotides from the third plate to the
oligonucleotide coupled beads from Step 4. The oligonucleotides
coupled beads resulting from Step 5 comprise a bead coupled to
multiple double stranded oligonucleotides. The double stranded
oligonucleotide comprises a 5' amine, universal sequence, cell
label 1, linker 1, cell label 2, linker 2, cell label 3, molecular
label and oligodT (see FIG. 2C).
[0509] In Step 6 of the enzymatic split-pool synthesis, multiple
washes were performed to remove uncoupled oligonucleotides and the
Klenow large fragment enzymes. The third plate was heated to
denature the double stranded oligonucleotides, and the
oligonucleotide coupled beads were pooled (see FIG. 2C). The
oligonucleotide coupled beads resulting from Step 4 comprise a bead
coupled to multiple single stranded oligonucleotides. The single
stranded oligonucleotide comprises a 5' amine, universal sequence,
cell label 1, linker 1, cell label 2, linker 2, cell label 3,
molecular label and oligodT. The multiple single stranded
oligonucleotides on a single bead may be differentiated by the
molecular label. The cell label portions of the multiple
oligonucleotides on a single bead are identical. Each bead
comprises different oligonucleotides. The oligonucleotides coupled
to the different beads differ by the cell label sequences. The
molecular label on the oligonucleotides from different beads may be
the same. The molecular label on the oligonucleotides from
different beads may be different. Two or more beads may differ by
the combined cell label sequences. For example, a first bead may
comprise an oligonucleotide comprising cell label A, cell label B
and cell label C and a second bead may comprise an oligonucleotide
comprising cell label B, cell label D and cell label A. In this
instance, the first and second bead both contain cell label B,
however the two other cell labels are different. Thus, two or more
beads may comprise oligonucleotides differing by at least one cell
label. Two or more beads may comprise oligonucleotides differing by
at least two cell labels. Two or more beads may comprise
oligonucleotides differing by at least three cell labels. However,
a bead may comprise an oligonucleotide comprising two or more
identical cell labels. For example, a bead may comprise an
oligonucleotide comprising cell label A, cell label A and cell
label D. A bead may comprise oligonucleotides comprising at least
three identical cell labels. For example, a bead may comprise an
oligonucleotide comprising cell label A, cell label A and cell
label A. A bead may comprise oligonucleotides comprising three
non-identical cell labels. For example, a bead may comprise an
oligonucleotide comprising cell label A, cell label D and cell
label E. A bead may comprise at least two oligonucleotides
comprising at least two different molecular labels. For example, a
bead may comprise a first oligonucleotide comprising molecular
label A and a second oligonucleotide comprising molecular label D.
However, a bead may comprise multiple copies of an oligonucleotide
comprising a first molecular label. Thus, a bead may comprise at
least two oligonucleotides comprising the same molecular label. For
example, a bead may comprise a first oligonucleotide comprising
molecular label A and a second oligonucleotide comprising molecular
label A. At least 30% of the oligonucleotides on a bead may
comprise different molecular labels. At least 40% of the
oligonucleotides on a bead may comprise different molecular labels.
At least 50% of the oligonucleotides on a bead may comprise
different molecular labels. At least 60% of the oligonucleotides on
a bead may comprise different molecular labels. Less than 30% of
the oligonucleotides on a bead may comprise the same molecular
label. Less than 20% of the oligonucleotides on a bead may comprise
the same molecular label. Less than 15% of the oligonucleotides on
a bead may comprise the same molecular label. Less than 10% of the
oligonucleotides on a bead may comprise the same molecular label.
Less than 5% of the oligonucleotides on a bead may comprise the
same molecular label.
[0510] The enzymatic split-pool synthesis technique may be
performed on multiple plates or plates with a greater number of
wells to produce a larger number of oligonucleotide coupled beads.
The use of three separate cell label portions may increase the
diversity of the total cell label portions on the beads. With 96
different sequence options for each cell label portion, 884,736
different cell label combinations may be created.
Example 2
Comparison of Amplification in Tube and Microwell
[0511] The disclosure provides a method for capturing cells. About
5,000 Ramos cells were captured on a microwell array comprising
microwells of about 30 micron in diameter. Some cells were not
captured. The control for the experiment was an equivalent number
of cells captured in a tube. Both the cells in the tube and the
cells in the microwell array were lysed. The nucleic acid was
allowed to hybridize to a conjugated bead. Real time PCR of GAPDH
and RPL19 genes was performed.
[0512] FIG. 9 shows the results of the real time PCR amplification.
The yield from the microwell was larger than the yield from the
nucleic acid in the tube, indicating that the hybridization of the
nucleic acid to the oligonucleotide was more effective in the
microwell than the tube (compare grey bar and white bar,
respectively).
Example 3
Comparison of Amplification of Second Synthesized Strand and
Synthesis on Bead
[0513] Cells were obtained and lysed as described in Example 1.
RPL19, TUBB, and GAPDH were amplified either off the second strand
synthesized off the solid supports, or direct on the solid supports
using a universal primer. FIG. 10 shows, amplification directly on
the solid supports (FIG. 10) yielded less off-target amplification
than amplification not directly off a solid support. GAPDH and TUBB
amplifications produced correctly sized products regardless of
method (the left lane of each triplet in FIG. 10 corresponds to
solid support plus lysate in tube format, the middle lane of each
triplet corresponds to solid supports from the microwell, and the
right lane of each triplet corresponds to solid supports plus
purified nucleic acid). The RPL19 product had minimal off-target
amplification products, but only produced a strong product when
purified nucleic acid was used with the solid support. These
experiments indicate that amplification directly on the beads
produces less off-target amplification products than amplification
using a second strand synthesized off the solid support.
Example 4
Multiplex Analysis of Target Nucleic Acids
[0514] Cells are obtained and lysed as described in Example 1.
Target nucleic acids are hybridized to the solid support comprising
oligonucleotides. A plurality of copies of the target nucleic acid
are hybridized to a target binding region comprising an oligodT
sequence. The plurality of copies of the target nucleic acid are
reverse transcribed using reverse transcriptase. Reverse
transcription incorporates the features of the oligonucleotide to
which the copy of the target nucleic acid was hybridized (e.g., the
molecular label, the cellular label, and the universal label). The
plurality of copies of the target nucleic acid are amplified using
PCR. The amplified copies of the target nucleic acid are sequenced.
The sequenced target nucleic acids are counted to determine the
copy number of the target nucleic acid in the cell. The counting is
performed by counting the number of different molecular labels for
each of the same sequence read of target nucleic acid. In this way,
amplification bias may be diminished.
Example 5
Evaluating Efficacy of Split-Pool Synthesis to Produce Beads with
Clonal Copies of One Cell Label Combination
[0515] In this example, the efficacy of split-pool synthesis to
produce beads with clonal copies of one cell label combination was
evaluated. Oligonucleotide coupled beads were synthesized by the
enzymatic split-pool synthesis method as described in Example 1.
250 ng of total RNA was purified from Ramos cells, which is
equivalent to RNA from 25,000 cells. The total RNA was contacted
with 35,000 oligonucleotide coupled beads, resulting in
hybridization of mRNA to the oligonucleotide coupled beads. cDNA
synthesis was performed on the mRNA hybridized to the
oligonucleotide coupled beads. Samples comprising 18, 175, and 1750
beads were used for further analysis. PCR amplification reactions
using GAPDH-specific primers and IGJ-specific primers were
performed on the cDNA bound to the beads from the 18-, 175- and
1750-bead samples. The cDNA molecules attached to the beads were
sequenced. FIG. 11A-I show graphical representations of the
sequencing results. For FIG. 11A-C, the number of reads per bead is
plotted on the y-axis and the unique barcode (e.g., cell label
combination) is plotted on the x-axis for the 18-bead, 175-bead and
1750-bead samples, respectively. For FIG. 11D-F, the number of
unique molecules per bead is plotted on the y-axis and the unique
barcode (e.g., cell label combination) is plotted on the x-axis for
the 18-bead, 175-bead and 1750-bead samples, respectively. For FIG.
11G-I, the number of unique molecules per bead is plotted on the
y-axis and the unique barcode is plotted on the x-axis for the
18-bead, 175-bead and 1750-bead samples, respectively. The results
for FIG. 11G-I are sorted by the total number of molecules. The
median number of unique molecules per bead for the various samples
is shown in Table 1. Numerical values for the sequencing results
are shown in Table 2. For FIG. 11J-L, the number of unique barcode
(bc) combination using the index is plotted on the y-axis and the
barcode (bc) segment index is plotted on the x-axis for the cell
label 1, cell label 2, and cell label 3 for the 1750-bead sample,
respectively. The barcode (bc) refers to the cell label (e.g., bc
segmentl=cell label part 1). As shown in FIG. 11J-L, the presence
of almost all 96 barcodes within each segment was detected by
sequencing. These results demonstrate the success of the enzymatic
split-pool synthesis method to produce beads with clonal copies of
one cell label combination.
TABLE-US-00001 TABLE 1 Median number of unique molecules 18 beads
175 beads 1750 beads IGJ 78 85 40 GAPDH 22 45 25
TABLE-US-00002 TABLE 2 Expected # of beads 17.5 175 1750 Total
number of reads 58321 60308 133043 >=8 match in constant 1 56385
57615 123349 >=8 match in constant 2 54117 55187 115126 >=8
match in constant 1 & 2 54114 55185 115107 Perfect match in all
38585 46066 95217 3 sub-barcodes Perfect match in gene (40 bp)
29968 33775 72260 Total number of unique 239 407 1654 barcode
combination % useful reads 51.388% 56.00% 54.31% Number of unique
barcode 5 26 288 combinations > 20 read
Example 6
Single Cell RNA Labeling Using Oligonucleotide Coupled Beads
[0516] In this example, the efficacy of single cell RNA labeling
using oligonucleotide coupled beads was evaluated. Three cell
samples were prepared as follows:
TABLE-US-00003 Sample 3: Sample 1: Sample 2: Ramos + K562 only
Ramos only K562 mixture Number of microwells ~10000 ~10000 ~10000
Number of Ramos cells 0 5000 3750 Number of K562 cells 1000 0
2500
[0517] The cell suspension of the samples was added to the top of a
microwell and cells were allowed to settle into the wells of the
microwell array. Cells not captured by the microwell array were
washed away in a phosphate buffered saline (PBS) bath.
Oligonucleotide coupled beads, as prepared by the enzymatic
split-pool synthesis method described in Example 1, were added to
the microwell array. The oligonucleotide coupled bead comprises a
magnetic bead with a plurality of oligonucleotides. Each
oligonucleotide on the bead comprises a 5'amine, universal
sequence, cell label 1, linker 1, cell label 2, linker 2, cell
label 3, molecular label, and oligodT. For each oligonucleotide on
the same bead, the sequences of the oligonucleotides are identical
except for the molecular label. For oligonucleotides on different
beads, the cell label 1, 2, and 3 combinations are different.
Approximately 5-6 beads were added per well of the microwell array.
In some instances, for every 10 wells, 50 beads may be deposited on
the array, with 0-2 beads falling into each well. The beads were
allowed to settle into the wells and uncaptured beads were washed
away in a PBS bath. A magnet was placed underneath the microwell
array. Cells were lysed by the addition of cold lysis buffer. The
array and magnet were placed on a cold aluminum block for 5
minutes. mRNA from the lysed cells were hybridized to the
oligonucleotides coupled to the beads. The array was washed with
excess lysis buffer to remove unbound mRNA. The beads were
retrieved from the wells by placing a magnet on top of the
microwell array. The retrieved beads were washed. cDNA synthesis
was performed on the beads using Superscript III at 50.degree. C.
for 50 minutes on a rotor. Non-extended oligodT from the
oligonucleotides on the beads were removed by Exol treatment
conducted at 37.degree. C. for 30 minutes on a rotor. Gene-specific
PCR amplification was conducted on the cDNA. The genes selected for
the gene-specific PCR were cell-type specific and are shown in
Table 3. The PCR amplified products were sequenced. Sequencing
statistics are shown in Table 4. FIGS. 12A-C show a histogram of
the sequencing results for the K562-only sample, Ramos-only sample,
and K562+Ramos mixture sample, respectively. For FIG. 12A-C, the
unique molecule per barcode plotted on the y-axis and the unique bc
combination index, sorted by read per bc plotted on the x-axis.
TABLE-US-00004 TABLE 3 Number Gene Cell-type 1 CD74 Ramos-specific
2 CD79a Ramos-specific 3 IGJ Ramos-specific 4 TCL1A Ramos-specific
5 SEPT9 Ramos-specific 6 CD27 Ramos-specific 7 CD41 K562-specific 8
GYPA K562-specific 9 GATA1 K562-specific 10 GATA2 K562-specific 11
HBG1 K562-specific 12 GAPDH common
TABLE-US-00005 TABLE 4 Sample 3: Sample 1: Sample 2: Ramos + K562
only Ramos only K562 mixture Number of Ramos cells 0 5000 3750
Number of K562 cells 1000 0 2500 Total number of reads 717718
1329189 2399025 >=8 match in constant 1 657911 1201081 2026726
>=8 match in constant 2 581581 1071364 1513466 >=8 match in
constant 1 & 2 581508 1071153 1513102 Perfect match in all 3
sub-barcodes 481564 862348 1248073 Perfect match in gene (40 bp)
283463 575713 1004338 % useful reads 39.50% 43.31% 41.86% Total
number of unique barcode 8501 29647 28783 combination Number of
unique barcode 145 1072 768 combinations > 30 molecule Capture
efficiency 0.145 0.2144 0.12288
[0518] Single cell labeling was used to determine the copy number
for the single-cell type samples (e.g., K562-only sample,
Ramos-only sample). FIG. 12D-E shows a graph of the copy number for
genes listed in Table 3 for the Ramos-only cell sample and
K562-only cell sample, respectively. For FIG. 12D-E, the number of
molecules per barcode (bc) combination is plotted on the y-axis and
the unique barcode combination, sorted by total number of molecules
per bc combination is plotted on the x-axis. The results shown in
FIGS. 12D-E were based on sequencing data from beads with >30
total number of unique molecules. These results demonstrate that
the proportion of molecules per amplicon per bead matches
expectations for the cell type. For the K562-only cell sample, the
skew of the number of molecules is more severe and it appears that
HBG1, which is highly abundant in this cell type, has a variable
copy number. However, GAPDH copy number appears to be constant even
though the total number of molecules per bead is skewed. The copy
number for the individual genes are shown in FIG. 12F-I. For FIG.
12F-G, the copy number is represented as copy per bead or single
cell for Ramos-only cells and K562-only cells, respectively. For
FIG. 12H-I, the copy number is represented as relative abundance
per bead or single cell for Ramos-only cells and K562-only cells,
respectively.
[0519] Single cell labeling was used to determine the cell type of
single cells in the K562+Ramos mixture sample. Sequencing results
from 100 unique barcode combinations with the most abundant
molecules were analyzed to evaluate the efficacy of single cell
labeling to determine the cell type of single cells in the
K562+Ramos mixture sample. FIG. 12J-M show graphs of the number of
unique molecules per gene (y-axis) for the beads with the 100
unique barcode combinations. The numbers on the x-axis refer to the
gene (see Table 3). FIG. 12J-M clearly depict general gene
expression patterns for the K562 and Ramos cells. FIG. 12N-O show
enlarged graphs of two beads that depict the general pattern of
gene expression profiles for the two cell types. FIG. 12N shows the
general pattern of gene expression profile for K562-like cells and
FIG. 120 shows the general pattern of gene expression profile for
Ramos-like cells. FIG. 12P shows a scatter plot of results based on
principal component analysis of gene expression profile of 768
beads with >30 molecules per bead from the K562+Ramos mixture
sample. Component 1, which is plotted on the x-axis, separates the
two cell types. Component 2, which is plotted on the y-axis,
separates K562 cells with high and low HBG1 copy number. Each dot
on the scatter plot represents one unique barcode combination,
which is equivalent to one bead or one cell. Based on the principal
component analysis, 409 beads corresponded to K562 cells and 347
beads corresponded to Ramos cells. The copy number of the genes
from Table 3 was determined for the K562-like and Ramos-like cell
types. FIG. 12Q-R show histograms of the copy number per amplicon
per bead for the K562-like cells (beads on the left of the first
principal component based on FIG. 12P) and Ramos-like cells (beads
on the right of the first principal component based on FIG. 12P),
respectively. For FIG. 12Q-R, number of per bc combination is on
the y-axis and unique barcode combination, sorted by total number
of molecules per bc combination is on the x-axis. FIG. 12S-T show
the copy number per bead or single cell of the individual genes for
the K562-like cells (beads on the left of the first principal
component based on FIG. 12P) and Ramos-like cells (beads on the
right of the first principal component based on FIG. 12P),
respectively. Table 5 shows the mean copy number per bead for the
single cell and mixture samples.
TABLE-US-00006 TABLE 5 Single cell K562 + Ramos type samples
mixture sample Gene K562-only Ramos-only K562-like Ramos-like CD74
0.00 39.95 0.10 7.50 CD79a 0.02 30.97 0.84 18.88 IGJ 0.03 42.43
0.81 27.76 TCL1A 0.01 31.78 0.71 19.44 SEPT9 0.88 3.89 1.35 1.52
CD27 0.00 5.31 0.03 1.30 CD41 0.61 0.00 0.47 0.01 GYPA 1.92 0.00
0.73 0.02 GATA2 1.38 0.00 0.60 0.04 GATA1 0.94 0.00 1.04 0.04 HBG1
201.09 0.00 72.27 1.37 GAPDH 51.77 39.13 44.94 13.53 GAPDH read
2.04 1.47 7.67 7.22 redundancy
Example 7
Evaluating Cross-Talk Between Beads
[0520] In this example, the cross-talk between beads was evaluated.
Samples comprising mixtures of mouse EL4 cells and Ramos cells were
prepared as follows:
TABLE-US-00007 High density Low density Number of microwells ~10000
~10000 Number of mouse EL4 cells 2500 1500 Number of Ramos cells
3750 1500
[0521] The cell suspension of the samples was added to the top of a
microwell and cells were allowed to settle into the wells of the
microwell array. Cells not captured by the microwell array were
washed away in a phosphate buffered saline (PBS) bath.
Oligonucleotide coupled beads, as prepared by the enzymatic
split-pool synthesis method described in Example 1, were added to
the microwell array. The oligonucleotide coupled bead comprises a
magnetic bead with a plurality of oligonucleotides. Each
oligonucleotide on the bead comprises a 5'amine, universal
sequence, cell label 1, linker 1, cell label 2, linker 2, cell
label 3, molecular label, and oligodT. For each oligonucleotide on
the same bead, the sequences of the oligonucleotides are identical
except for the molecular label. For oligonucleotides on different
beads, the cell label 1, 2, and 3 combinations are different.
Approximately 5-6 beads were added per well of the microwell array.
The beads were allowed to settle into the wells and uncaptured
beads were washed away in a PBS bath. A magnet was placed
underneath the microwell array. Cells were lysed by the addition of
cold lysis buffer. The array and magnet were placed on a cold
aluminum block for 5 minutes. mRNA from the lysed cells were
hybridized to the oligonucleotides coupled to the beads. The array
was washed with excess lysis buffer to remove unbound mRNA. The
beads were retrieved from the wells by placing a magnet on top of
the microwell array. The retrieved beads were washed. cDNA
synthesis was performed on the beads using Superscript III at
50.degree. C. for 50 minutes on a rotor. Non-extended oligodT from
the oligonucleotides on the beads were removed by Exol treatment
conducted at 37.degree. C. for 30 minutes on a rotor. Gene-specific
PCR amplification was conducted on the cDNA. The genes selected for
the gene-specific PCR were cell-type specific and are shown in
Table 6.
TABLE-US-00008 TABLE 6 Number Gene Cell-type 1 HS_CD74 human 2
HS_CD79a human 3 HS_IGJ human 4 HS_TCL1A human 5 HS_SEPT9 human 6
HS_CD27 human 7 HS_GAPDH human 8 MM_B2M mouse 9 MM_ACTM mouse 10
MM_HPRT mouse 11 MM_SHDA mouse
[0522] The PCR amplified products were sequenced. Sequencing
statistics are shown in Table 7.
TABLE-US-00009 TABLE 7 Low density High density Number of Ramos
cells 15000 3750 Number of mouse cells 1500 2500 Total number of
reads 2391780 4038217 >=8 match in constant 1 2162945 3651643
>=8 match in constant 2 1981835 3356493 >=8 match in constant
1 & 2 1981626 3355787 Perfect match in all 3 sub-barcodes
1645994 2790879 Perfect match in gene (40 bp) 1083013 2171930 %
useful reads 45% 54% Total number of unique barcode 16695 36595
combination Number of unique barcode 80 281 combinations > 30
molecule Capture efficiency 0.03 0.04
[0523] Gene expression profiles for 100 unique barcode combinations
with the most abundant molecules were determined for the high
density and low density samples. The gene expression profiles were
generated based on the sequencing results. FIG. 13A shows graphs of
the gene expression profile for 35 of the 100 unique barcode
combinations from the high density sample. For FIG. 13A, the number
of unique molecules is on the y-axis and the gene reference number
is on the x-axis (see Table 6 for genes corresponding to the gene
reference number). FIG. 13A clearly depicts general gene expression
patterns for the mouse and Ramos cells. FIG. 13B-C show scatter
plots of results based on principal component analysis of gene
expression profile of the high density sample and low density
sample, respectively. Component 1, which is plotted on the x-axis,
separates the two cell types. Component 2, which is plotted on the
y-axis, indicates variability in gene expression within the Ramos
cell population. Each dot on the scatter plot represents one unique
barcode combination, which is equivalent to one bead or one cell.
Based on the principal component analysis of the high density
sample, 144 beads corresponded to the mouse cells and 132 beads
corresponded to Ramos cells. Based on the principal component
analysis of the low density sample, 52 beads corresponded to the
mouse cells and 27 beads corresponded to Ramos cells.
[0524] Once the cell types were determined, cross-talk between the
beads was assessed by detecting the genes from Table 6 in the
different cell types. FIG. 13D-E depict graphs of the read per
barcode (bc) combination (y-axis) versus the unique barcode
combination, sorted by the total number of molecules per bc
combination (x-axis) for Ramos-like cells and mouse-like cells from
the high density sample, respectively. FIG. 13F-G depict graphs of
the number of molecules per bc combination (y-axis) versus the
unique barcode combination, sorted by the total number of molecules
per bc combination (x-axis) for Ramos-like cells and mouse-like
cells from the high density sample, respectively. FIG. 13H-I depict
graphs of the read per barcode (bc) combination (y-axis) versus the
unique barcode combination, sorted by the total number of molecules
per bc combination (x-axis) for Ramos-like cells and mouse-like
cells from the low density sample, respectively. FIG. 13J-K depict
graphs of the number of molecules per bc combination (y-axis)
versus the unique barcode combination, sorted by the total number
of molecules per bc combination (x-axis) for Ramos-like cells and
mouse-like cells from the low density sample, respectively. Table 8
shows the average fold coverage or read redundancy per unique
molecule for the low and high density samples.
TABLE-US-00010 TABLE 8 Low density High density Ramos-like
Mouse-like Ramos-like Mouse-like Gene cells cells cells cells
HS_CD74 29.75 3.17 23.75 2.15 HS_CD79a 47.2 4.09 42.30 2.67 HS_IGJ
29.65 1.39 30.23 2.4 HS_TCL1A 45.74 2.26 39.00 4.13 HS_SEPT9 11.85
1.00 12.75 1.18 HS_CD27 37.99 1.00 32.12 1.10 HS_GAPDH 19.97 1.55
17.37 2.57 MM_B2M 1.21 31.98 3.05 31.48 MM_ACTM 1.05 29.08 1.90
28.38 MM_HPRT 1.02 39.96 1.03 43.65 MM_SHDA 1.00 39.60 1.02
29.60
[0525] The results in Table 8 show that average fold coverage per
unique molecule was much higher for human genes than mouse genes in
Ramos cells, and vice versa.
[0526] As a control, a mixture of mouse and human cells were lysed
in a tube, converted to cDNA synthesis with the beads, and the cDNA
was sequenced. FIG. 4XL shows a graphical representation of the
sequencing results. As expected, a large number of unique barcode
(bc) combinations was observed, and most beads only had one to two
copies total.
[0527] These results demonstrate that there was minimal cross-talk
between beads and that the cross-talk may be identified
bioinformatically.
Example 8
Single Cell Nucleic Acid Library Production
[0528] The oligonucleotide conjugated supports disclosed herein may
be used to produce single cell nucleic acid libraries. In this
example, single cell nucleic acid libraries are produced by adding
a cell sample to a surface (e.g., grid) that has the
oligonucleotide conjugated supports. An oligonucleotide conjugated
support comprises a plurality of oligonucleotides conjugated to a
bead. An oligonucleotide comprises (a) a cell label region
comprising at least two distinct regions connected by a linker; and
(b) a molecular label region. Two or more oligonucleotides on a
bead comprise identical cell label regions. Two or more
oligonucleotides on a bead comprise two or more different molecular
label regions. Two or more oligonucleotides on two or more
different beads comprise two or more different cell label regions.
Thus, each cell associated with an oligonucleotide conjugated
support has a different cell label region. The concentration of
cells in the cell sample is sufficiently dilute to enable
association of one or fewer cells to one oligonucleotide conjugated
support on the surface. Cells are lysed using a lysis buffer. mRNAs
from a cell are hybridized to the oligonucleotides of the
oligonucleotide conjugated support. Thus, all mRNAs from a cell are
labeled with oligonucleotides comprising identical cell label
regions. Two or more mRNAs from a cell are labeled with two or more
oligonucleotides comprising two or more different molecular label
regions. A magnet is applied to the surface to purify the
oligonucleotide conjugated solid supports from the surface. The
oligonucleotide conjugated solid supports may be individually
purified from the surface. The mRNAs hybridized to the
oligonucleotides on the oligonucleotide conjugated solid support
are reverse transcribed to produce labeled cDNA. The labeled cDNA
comprise a reverse complement of the mRNA and a copy of the
oligonucleotide that the mRNA was hybridized to. The labeled cDNA
are amplified by PCR to produce labeled amplicons. The labeled cDNA
and/or labeled amplicons may be removed from the bead by
restriction enzyme digestion. A library of nucleic acids from the
single cell is produced from the labeled amplicons.
[0529] Alternatively, the oligonucleotide conjugated solid supports
are purified together. Reverse transcription of the mRNA may be
performed on the combined oligonucleotide conjugated solid
supports. Because mRNAs from different cells are labeled with
oligonucleotides comprising different cell label regions, the cell
label regions may be used to determine which cell the labeled cDNA
or labeled amplicons originated from. Thus, a library of nucleic
acids from a plurality cells may be produced, wherein the identity
of the cell from which the labeled amplicon originated from may be
determined by the cell label region.
[0530] Single cell nucleic acid libraries may also be produced by
contacting the cells with an agent prior to lysing the cell. The
agent may be an antigen, drug, cell, toxin, etc. Thus, specialized
single cell nucleic libraries may be produced. Analysis of the
nucleic acid libraries may be used to generate single cell drug
expression profiles. Signal transduction pathways on a single cell
level may also be determined from these nucleic acid libraries. The
nucleic acid libraries may also be used to determine the effects of
antigens on specific cell types.
Example 9
Single Cell Expression Profiling
[0531] The oligonucleotide conjugated supports disclosed herein may
be used to determine the expression profile of single cells. In
this example, a cell sample comprising a mixture of cells is
contacted with a plurality of antibodies. A subset of the cells is
purified using flow cytometry. The subset of cells is added to a
microwell array. A plurality of oligonucleotide conjugated supports
is added to the microwell array. An oligonucleotide conjugated
support comprises a plurality of oligonucleotides coupled to a
nanoparticle. An oligonucleotide comprises (a) a cell label region
comprising three distinct sequences connected by two predetermined
sequences; and (b) a molecular label region. Two or more
oligonucleotides on a nanoparticle comprise identical cell label
regions. Two or more oligonucleotides on a nanoparticle comprise
two or more different molecular label regions. Two or more
oligonucleotides on two or more different nanoparticles comprise
two or more different cell label regions. Thus, each cell
associated with an oligonucleotide conjugated support has a
different cell label region.
[0532] A magnet is applied to the microwell array and the cells
that are not associated with an oligonucleotide conjugated support
are washed away. A sponge comprising a lysis buffer is placed on
top of the microwell array, thereby lysing the cells.
[0533] mRNAs from the lysed cells hybridize to the oligonucleotides
on the bead. The mRNAs are reverse transcribed to produce labeled
cDNA. The labeled cDNA comprise a reverse complement of the mRNA
and a copy of the oligonucleotide that the mRNA was hybridized to.
The labeled cDNA are amplified by PCR to produce labeled amplicons.
The labeled amplicons are sequenced. Because each mRNA from a cell
is labeled with the same cell label and mRNAs from different cells
are labeled with different cell labels, the sequence information of
the labeled amplicons is used to generate single cell expression
profiles.
Example 10
Immunophenotyping by Single Cell Sequencing
[0534] A blood sample was collected from a subject and peripheral
blood mononuclear cells (PMBCs) were isolated from the blood
sample. PMBCs were cultured in RPMI1640 medium and placed in an
incubator overnight. The PMBCs were washed multiple times in PBS to
remove the serum. Approximately 7000 PMBCs were deposited onto a
microwell array with 32,400 wells. Thus, most wells on the
microwell array contained no cells and some wells on the cell
contained only 1 cell. Oligonucleotide-conjugated beads were
applied to the microwell array. Each oligonucleotide-conjugated
bead contained approximately 1 billion oligonucleotides attached to
a bead. Each oligonucleotide attached to the bead contained a 5'
amine, universal sequence, three-part cellular label (e.g., three
cell label sections connected by two linkers), molecular label, and
oligodT. Each bead contained a unique three-part cellular label,
which is a result of the unique combination of the three cell label
sections. All of the oligonucleotides on a single bead contained
the same three-part cellular label. Oligonucleotides from different
beads contained different three-part cellular labels. Each well
contained 1 or fewer oligonucleotide-conjugated bead. A cell lysis
reagent was applied to the microwell array, resulting in lysis of
the cells. Polyadenylated molecules (e.g., mRNA) from the cell
hybridized to the oligodT sequence of the oligonucleotides from the
oligonucleotide-conjugated beads. The polyadenylated molecules that
were hybridized to the oligonucleotides from the
oligonucleotide-conjugated bead were reverse transcribed with
SuperScript II at 42.degree. C. at 90 minutes on a rotor. The
oligonucleotide from the oligonucleotide-conjugated bead served as
a primer for first strand cDNA synthesis. A SMART oligo was
incorporated in the cDNA synthesis such that the superscript II may
add the complement of the SMART oligo sequence to the 3' end of the
cDNA when it reaches the end. The cDNA synthesis reaction produces
a bead conjugated to unextended oligonucleotides (e.g.,
oligonucleotides that were not attached to the polyadenylated
molecule from the cell) and the extended oligonucleotides (e.g.,
oligonucleotides that were attached to the polyadenylated molecule
and comprise a polyadenylated molecule/cDNA hybrid).
[0535] The beads are combined and the oligonucleotides comprising
the polyadenylated molecule/cDNA hybrid were amplified. Multiplex
PCR was performed to amplify a panel of 98 genes (see Table 9) from
the cDNA on the beads. Primers for the multiplexed PCR comprised a
first gene specific primer that was designed to sit approximately
500 base pairs from the 3' end of the mRNA and a nested
gene-specific primer that was designed to sit approximately 300
base pairs from the 3' end of the mRNA. Primers for the multiplex
PCR were designed to require no significant complementarity in the
last 6 bases of the primers in the panel. If complementarity was
detected in the multiplex PCR primers, then the primers were
manually replaced. The multiplex PCR reaction comprised the
following steps: 1) 15 cycles of first gene specific PCR (KAPA
multiplex mix, 50 nM of each primer--first gene specific primer and
universal primer that is complementary to the universal sequence of
the oligonucleotide-conjugated bead), Ampure clean up (0.7.times.
bead to template ratio), 15 cycles of nested gene specific PCR
(KAPA multiplex mix, 50 nM of each primer-nested gene-specific
primer and universal primer that is complementary to the universal
sequence of the oligonucleotide-conjugated bead), Ampure clean up
(0.7 .times. bead to template ratio), 8 cycles of final PCR to add
full length 11lumina adaptor (KAPA HiFi ReadyMix), and Ampure clean
up (1.times. bead to template ratio).
TABLE-US-00011 TABLE 9 Gene Panel Cell type Gene Cell type Gene
Cell type Gene Cell type Gene B cell PAX5 monocytes CD14 naive
CD62L (SELL) Th17 IL17A CD19 classical S100A12 CD45RA IL17F CD20
monocytes CCR2 Naive Th THPOK/ZBTB7B IL21 BCMA/TNFRSF17 SELL/CD62L
Naive Tc RUNX3 IL22 (L-selectin) BAFF nonclassical CD16/FCGR3B
memory CD45RO/PTPRC CCL20 TCL1A monocytes CX3CR1 CD44 IL23R TACI
ITGAL Central CCR7 RORa/RORA B naive IGHD conventional CD1b Memory
TXK RORgamat/RORC IGHM myeoloid DC FOXQ1 CD8+/CD4+ MBD2 Follicular
T OX40L/TNFSF4/CD252 B memory CD27 CD209/ BCL6 helper CXCR5 DC-SIGN
CD38 CD1e Effector BLIMP1 SLAM/SLAMF1 Memory CD8+/CD4+ CD24 CCL17
Th1 CXCR3 ICOS AICDA DTNA IFNGR1 SAP/SH2D1A CD95 plasmacytoid
CLEC4C/CD303 IL12RB2 Activated T CD69 dendritic cell (rare) B
transitional CD10 rare myeloid CD141/TM IFN gamma Activated T CD30
dendritic cell and B (0.02%) B reg IL10 NKT Th2 IL33R/IL1RL1
Toll-like TLR1 plasma RASD1 PLZF/ZBTB16 IL4R receptors TLR2 AMPD1
SLAMF1 CCR4 (innate) TLR3 SDC1 T cell CD3 (CD3D) CRTH2/PTGDR2 TLR4
(CD138) NK OSBPL5 CD3 (CD3E) IL4 TLR5 CD56/NCAM1 Cytotoxic T CD8
(CD8A) IL5 TLR6 IGFBP7 CD8 (CD8B) Treg CD25 TLR7 KIR2DS5 PRF1
(perforin) FOXP1 TLR8 KIR2DS2 EOMES TGFbeta TLR9 RAB4B Helper T CD4
IL10 TLR10
[0536] The amplified products were sequenced. The sequence reads
with 150 bp were aligned to entire mRNA sequences of the 98 genes
listed in Table 9 using Bowtie2. The results of the sequence
alignment (see Table 10) demonstrate that the multiplex PCR
reaction resulted in highly specific products. FIG. 14 shows a
graph depicting the genes on the X-axis and the log 10 of the
number of reads. 16 genes of the 98 genes were not present. Absence
of these genes may be due to the fact that some of the genes target
rare cells that may not be present in this blood sample. Overall,
approximately, 84% of the genes from the 98 gene panel were
detected
TABLE-US-00012 TABLE 10 total 6357075 aligned 0 times 703616
aligned exactly 1 time 5584201 aligned > 1 time 69258 % aligned
exactly once 88%
[0537] Table 11 shows the results of the overall sequencing
statistics. For Read1, the total readl match criteria required a
perfect match to the three-part cellular label (e.g., cell barcode)
and at most 1 mismatch to the linkers.
TABLE-US-00013 TABLE 11 total num read 6357075 total read1 match
criteria 4384245 read2 also align 3943667 % read2 align 89.95%
number of unique cell bc 31129 read count per unique bc > 100
3228 read count per unique bc > 50 3721 % useful reads
62.04%
[0538] FIG. 15A shows a graph of the distribution of genes detected
per three-part cell label (e.g., cell barcode). FIG. 15B shows a
graph of the distribution of unique molecules detected per bead
(expressing the gene panel).
[0539] Cell clustering analysis was performed to determine whether
the sequencing results could be used to analyze cell populations
based on the cell barcode. SPADE (a minimum spanning tree algorithm
developed by the Nolan lab for CyTOF data) was used to cluster
cells based on the presence/absence of 17 genes. For a gene to be
considered present, the average sequencing redundancy for the gen
has to be greater than 5 fold. After sequence filtering, there were
approximately 500 unique cell barcodes (e.g., cell labels)
associated with greater than 20 unique molecules. Each unique cell
barcode corresponds to a single cell. Based on the genes that were
associated with a unique cell barcode, cells were clustered into
cell types. Table 12 shows a list of genes that may be used to
definitively identify a cell type. Thus, cell barcodes that are
associated with CD20, IGHM, TCL1A and CD24 were designated as
B-cells, whereas cell barcodes that are associated with CD8A, CD3D,
CD3E, CD4 and CD62L were designated as T-cells. The remaining genes
from Table 9 were mapped to the cell clusters. FIG. 16 depicts the
cell clusters based on the genes associated with a cell barcode.
The size of the cluster is proportionate to the number of cells
that were assigned to the cluster. The results shown in FIG. 16
demonstrate that the combination of cell and molecular barcoding
may be used to uniquely label copies of molecules from a single
cell, which may enable immunophenotyping by single cell sequencing.
In addition to clustering PMBCs into the major cell types based on
the genes listed in Table 12, the 98 gene panel may also be used to
identify clusters of sub-types of the major cell types. Table 13
shows the frequency of each major cell type detected by single cell
sequencing. As shown in Table 13, with the exception of CD8+ T
cells, the percentage of each cell type corresponded to the normal
cell percentage range. A slightly higher percentage of CD8+ T cells
was observed in the PMBC sample. Using the cell clusters based on
FIG. 16, expression profiles of additional genes from the 98 gene
panel were used to further analyze the cell clusters.
TABLE-US-00014 TABLE 12 Major cell types Genes B cells CD20, IGHM,
TCL1A, CD24 T cells CD8A, CD3D, CD3E, CD4, CD62L NKT cells ZBTB16
Dendritic cells CD209 Natural Killer cells KIR2DS5, KIR2DS2, CD16
Monocytes CD16, CD14, CCR2, S100A12, CD62L
TABLE-US-00015 TABLE 13 Cell type # cells percentage normal range
monocytes 67 13.3% 10-30% NK 85 16.9% up to 15% B 47 9.3% up to 15%
CD8 210 41.7% 5-30% CD4 94 18.7% 25-60% total assigned cluster 503
100.0%
[0540] FIG. 17A-D show the analysis of monocyte specific markers.
FIG. 17E shows the cell cluster depicted in FIG. 16. FIG. 17A shows
the cell expression profile for CD14, which is a monocyte specific
marker. "Hot colors" (e.g., red) represent high gene expression and
"cool colors" (e.g., blue) represent low gene expression. As shown
in FIG. 17A, CD14 is highly expressed in the monocyte population
and had low to no expression in the other cell types. The cell
expression profile for CD16 which is known to be present in both
monocytes and NK is shown in FIG. 17B. As shown in FIG. 17B, the
monocyte and NK cell clusters had high expression of CD16, whereas
the other cell types had low to no expression. CCR2 and S100A12 are
known to be highly expressed in monocytes. The CCR2 and S100A12
monocyte-specific expression was also demonstrated in the cell
expression profiles shown in FIGS. 17C and D, respectively.
However, the expression of CCR2 and S100A12 separated into two
branches of monocyte cells. The other cell types exhibited low to
no expression of CCR2 and S100A12.
[0541] FIG. 18A-B show the analysis of the T cell specific markers.
FIG. 18C shows the cell cluster depicted in FIG. 16. FIG. 18A shows
the cell expression profile for CD3D which is a chain of the CD3
molecule. CD3 is a pan T cell marker. FIG. 18A shows that CD3D is
highly expressed in two branches of CD8+ T cells and moderately
expressed in a third branch of CD8+ T cells. However, CD3D is not
highly expressed in CD4+T cells. Also, the other cell types have
low to no expression of CD3D. FIG. 18B shows the cell expression
profile for CD3E which is a chain of the CD3 molecule. FIG. 18B
shows that CD3D is highly expressed in CD4+T cells. Different
branches of CD8+ T cells exhibit high to moderate expression of
CD3D. Little to no expression of CD3D is observed in the other cell
types.
[0542] FIG. 19A-B show the analysis of the CD8+ T cell specific
markers. FIG. 19C shows the cell cluster depicted in FIG. 16. FIG.
19A shows the cell expression profile for CD8A which is a chain of
the CD8 molecule. As shown in FIG. 19A, different branches of CD8+
T cells have various levels of CD8A expression, with some branches
having high expression, other branches having moderate expression
and one branch exhibiting low to no expression of CD8A. High CD8A
expression was observed in a branch of the CD16+NK cells. It has
been reported in the literature that up to 80% of NK cells express
CD8. Little to no CD8A expression was observed in the other cell
types. FIG. 19B shows the cell expression profile for CD8B which is
a chain of the CD8 model. As shown in FIG. 19B, different branches
of CD8+ T cells have various levels of CD8B expression, with one
branch having high expression, some branches having moderate
expression and two branches exhibiting low to no expression of
CD8B. High CD8B expression was also observed in a branch of the
CD16+NK cells. Little to no CD8B expression was observed in the
other cell types.
[0543] FIG. 20A shows the analysis of CD4+T cell specific markers.
FIG. 20B shows the cell cluster depicted in FIG. 16. FIG. 20A shows
the expression profile for CD4. Moderate expression of CD4 was
observed in a subset of cells in the CD4+T cell cluster and high
expression of CD4 was observed in a branch of the monocyte cluster.
It has previously been documented in the literature that monocytes
also express CD4. Moderate to low expression of CD4 was observed in
a branch of CD8+ T-cells and in NK cells. Low to no expression of
CD4 was observed in the other cell types.
[0544] FIG. 21A-D show the analysis of Natural Killer (NK) cell
specific markers. FIG. 20E shows the cell cluster depicted in FIG.
16. FIG. 20A shows the expression profile for KIR2DS2. All of the
cell types exhibited little to no KIR2DS2 expression. FIG. 20B
shows the expression profile for KIR2DS5. Killer immunoglobulin
receptors (KIRs) are known to be expressed in NK cells and a subset
of T cells. High expression of KIR2DS5 was observed in 2 branches
of NK cells and moderate to low expression of KIR2DS5 was observed
in one branch of NK cells. Moderate to high expression of KIR2DS5
was observed in 2 branches of CD8+ T cells. Low to no expression of
KIR2DS5 was observed in all other cell types. OSBPL5 and IGFBP7 are
known to be highly expressed in NK cells. FIG. 20C shows the
expression profile for OSBPL5. OSBPL5 was highly expressed in one
branch of NK cells. Moderate to low expression of OSBPL5 was
observed in a branch of B cells. Low to no expression of OSBPL5 was
observed in all other cell types. FIG. 20D shows the expression
profile for IGFPBP7. High expression of IGFPBP7 was observed in two
branches of NK cells and one branch of monocytes. Moderate
expression of IGFPBP7 was observed in one branch of B cells. Low to
no expression of IGFPBP7 was observed in all other cell types.
[0545] FIG. 22A-E show the analysis of B cell specific markers.
FIG. 22F shows the cell cluster depicted in FIG. 16. FIG. 22A shows
the expression profile for IGHM CH4. IGHM CH4 was highly expressed
in one branch of B cells and moderately expressed in the second
branch of B cells. Low to no expression of IGHM CH4 was observed in
all other cell types. FIG. 22B shows the expression profile for
PAX5. PAX5 was highly expressed in one branch of B cells. Low to no
expression of PAX5 was observed in all other cell types. FIG. 22C
shows the expression profile for CD20. CD20 was highly expressed in
one branch of B cells. Low to no expression of CD20 was observed in
all other cell types. FIG. 22D shows the expression profile for
TCL1A. Low to no expression of TCL1A was observed in all other cell
types. FIG. 22E shows the expression profile for IGHD CH2. IGHD CH2
was highly expressed in one branch of B cells. Low to no expression
of IGHD CH2 was observed in all other cell types.
[0546] FIG. 23A-F show the analysis of Toll-like receptors.
Toll-like receptors are mainly expressed by monocytes and some B
cells. FIG. 23G shows the cell cluster depicted in FIG. 16. FIG.
23A shows the expression profile for TLR1. One branch of monocytes
exhibited high expression of TLR1 and two branches of monocytes
exhibited moderate expression of TLR1. Low to no expression of TLR1
was observed in all other cell types. FIG. 23B shows the expression
profile for TLR4. One branch of monocytes exhibited high expression
of TLR4. Moderate TLR4 expression was observed in two branches of
monocytes and one branch of NK cells. Low to no expression of TLR4
was observed in all other cell types. FIG. 23C shows the expression
profile for TLR7. High expression of TLR7 was observed in one
branch of monocytes and moderate expression of TLR7 was observed in
one branch of NK cells. Low to no expression of TLR7 was observed
in all other cell types. FIG. 23D shows the expression profile for
TLR2. High expression of TLR2 was observed in one branch of B
cells. Low to no expression of TLR2 was observed in all other cell
types. FIG. 23E shows the expression profile for TLR3. High
expression of TLR3 was observed in one branch of B cells. Low to no
expression of TLR3 was observed in all other cell types. FIG. 23F
shows the expression profile for TLR8. High expression of TLR8 was
observed in three branches of monocytes. Moderate to low expression
of TLR8 was observed in two branches of monocytes and one branch of
NK cells. Low to no expression of TLR8 was observed in all other
cell types.
[0547] These results demonstrate that massively parallel single
cell sequencing may successfully identify major cell types in
PMBCs. The sequencing results also determined that some cell
markers that are used in FACs for identifying cell types do not
have high mRNA expression (e.g., CD56 for NK cells, CD19 for B
cells). In addition, many of the genes in the gene panel were
expressed across multiple cell types. These expression profiles may
be used to subtype cells within a major cell type (e.g., activated
cell versus resting cell, etc.).
Example 11
Identifying Rare Cells in a Population
[0548] In this experiment, massively parallel single cell
sequencing is used to identify cancer cells from a mixture of
cancer and non-cancer cells. Ramos (Burkitt lymphoma) cells were
spiked into a population of CD19+B cells that were isolated from a
healthy individual. The concentration of the Ramos cells in the
mixed population was about 4-5%. Approximately 7000 normal B cells
and 300 Ramos cells were deposited on a microwell array with 25,200
wells. Thus, most wells on the microwell array contained no cells
and some wells on the cell contained only 1 cell.
Oligonucleotide-conjugated beads were applied to the microwell
array. Each oligonucleotide-conjugated bead contained approximately
1 billion oligonucleotides attached to a bead. Each oligonucleotide
attached to the bead contained a 5' amine, universal sequence,
three-part cellular label (e.g., three cell label sections
connected by two linkers), molecular label, and oligodT. Each bead
contained a unique three-part cellular label, which is a result of
the unique combination of the three cell label sections. All of the
oligonucleotides on a single bead contained the same three-part
cellular label. Oligonucleotides from different beads contained
different three-part cellular labels. Each well contained 1 or
fewer oligonucleotide-conjugated bead. A cell lysis reagent was
applied to the microwell array, resulting in lysis of the cells.
Polyadenylated molecules (e.g., mRNA) from the cell hybridized to
the oligodT sequence of the oligonucleotides from the
oligonucleotide-conjugated beads. The polyadenylated molecules that
were hybridized to the oligonucleotides from the
oligonucleotide-conjugated bead were reverse transcribed with
SuperScript II at 42.degree. C. at 90 minutes on a rotor. The
oligonucleotide from the oligonucleotide-conjugated bead served as
a primer for first strand cDNA synthesis. A SMART oligo was
incorporated in the cDNA synthesis such that the superscript II may
add the complement of the SMART oligo sequence to the 3' end of the
cDNA when it reaches the end. The cDNA synthesis reaction produces
a bead conjugated to unextended oligonucleotides (e.g.,
oligonucleotides that were not attached to the polyadenylated
molecule from the cell) and the extended oligonucleotides (e.g.,
oligonucleotides that were attached to the polyadenylated molecule
and comprise a polyadenylated molecule/cDNA hybrid).
[0549] The beads are combined and the oligonucleotides comprising
the polyadenylated molecule/cDNA hybrid were amplified. Multiplex
PCR was performed to amplify a panel of 111 genes from the cDNA on
the beads. The 111 genes represent markers for different subsets of
B cells. Primers for the multiplexed PCR comprised a first gene
specific primer that was designed to sit approximately 500 base
pairs from the 3' end of the mRNA and a nested gene-specific primer
that was designed to sit approximately 300 base pairs from the 3'
end of the mRNA. Primers for the multiplex PCR were designed to
require no significant complementarity in the last 6 bases of the
primers in the panel. If complementarity was detected in the
multiplex PCR primers, then the primers were manually replaced. The
multiplex PCR reaction comprised the following steps: 1) 15 cycles
of first gene specific PCR (KAPA multiplex mix, 50 nM of each
primer-first gene specific primer and universal primer that is
complementary to the universal sequence of the
oligonucleotide-conjugated bead), Ampure clean up (0.7.times.bead
to template ratio), 15 cycles of nested gene specific PCR (KAPA
multiplex mix, 50 nM of each primer-nested gene-specific primer and
universal primer that is complementary to the universal sequence of
the oligonucleotide-conjugated bead), Ampure clean up
(0.7.times.bead to template ratio), 8 cycles of final PCR to add
full length Illumina adaptor (KAPA HiFi ReadyMix), and Ampure clean
up (1.times.bead to template ratio).
[0550] The amplified products were sequenced. The sequence reads
comprising 150 bp were aligned to entire mRNA sequences of the 111
genes (Table 17) using Bowtie2. The results of the sequence
alignment (see Table 14) demonstrate that the multiplex PCR
reaction resulted in highly specific products. FIG. 24 depicts a
graph of the genes versus the log 10 of the number of reads. 24 of
the 111 genes were not present. At least two of the genes, RAG1 and
RAG2 which are involved in VDJ recombination and should be present
only in pre-B cells, should not be present. A few of the absent
genes are specific for plasma cells, which are very rarely
preserved in frozen cells.
TABLE-US-00016 TABLE 17 CD19 AURKB FOXP1 CCND3 TLR1 FOXP3 CXCL12
GNAI2 CD27 CD81 MCL1 IL12A TLR2 LAG3 CCL3 RGS1 CD138 CD80 IFNB1
IFNG TLR3 CD73 CCL14 CD5 CD38 CD23a BLNK TNFA TLR4 CD70 CCL20 CD22
CD24 CD44 CD40LG IL2 TLR5 CCR7 CCL18 PIK3CD CD10 LEF1 IGBP1 IL4
TLR6 CD45RA TCL1A DOCK8 CD95 CXCR5 IRF4 IL6 TLR7 PDCD1 TACI CD11b
CD21 PRKCB CD79a BAFF TLR8 MYC AICDA FCGR2B CXCR3 PRKCD LTA IGHE
TLR9 CD25 FCRL4 CD72 CD40 CD20 HDAC5 IGHD TLR10 FCAMR BCL2 BCL11B
CD69 CD30 RAG1 IGHM GAPDH CCND2 FASLG CD86 CD1c CD30L RAG2 IGHA CD9
MKI67 BCL6 TBX21 IL10 BAFFR CD1d IGHG1 CD11c IL21R IGHG2 PRDM1 IL4R
CMRF- TGFB1 IGHG4 IL6R HLA- IGHG3 35H DRA
TABLE-US-00017 TABLE 14 total 5711013 aligned 0 times 504775
aligned exactly 1 time 5203308 aligned > 1 time 2930 % aligned
exactly once 91.6%
[0551] Table 15 shows the results of the overall sequencing
statistics. For Readl, the total readl match criteria required a
perfect match to the three-part cellular label (e.g., cell barcode)
and at most 1 mismatch to the linkers.
TABLE-US-00018 TABLE 15 total num read 5711013 total read1 match
criteria 3795915 read2 also align 3495392 % read2 align 92% number
of unique cell bc 40764 read count per unique bc > 100 3313 read
count per unique bc > 50 4154 % useful reads 61%
[0552] FIG. 25A-D shows graphs of the molecular barcode versus the
number of reads or log 10 of the number of reads for two genes.
FIG. 25A shows a graph of the molecular barcode (sorted by
abundance) versus the number of reads for CD79. FIG. 25B shows a
graph of the molecular barcode (sorted by abundance) versus the log
10 of the number of reads for CD79. FIG. 25C shows a graph of the
molecular barcode (sorted by abundance) versus the number of reads
for GAPDH. FIG. 25D shows a graph of the molecular barcode (sorted
by abundance) versus the log 10 of the number of reads for
GAPDH.
[0553] 856 cells were retained for analysis. FIG. 26A shows a graph
of the number of genes in the panel expressed per cell barcode
versus the number of unique cell barcodes/single cell. FIG. 26B
shows a histogram of the number of unique molecules detected per
bead versus frequency of the number of cells per unique cell
barcode carrying a given number of molecules. A small subset of
cells showed distinctly higher number of mRNA molecules and number
of genes expressed from the 111 gene panel (see circled sections in
FIG. 26A-B). FIG. 26C shows a histogram of the number of unique
GAPDH molecules detected per bead versus frequency of the number of
cells/unique cell barcode carrying a given number of molecules.
[0554] Principal component analysis (PCA) was used to generate a
scatterplot of cells. FIG. 27 shows a scatterplot of the 856 cells.
PCA identified the small subset of cells with a different gene
expression pattern than the majority of cells. The subset of cells
contained 18 cells, which is approximately 2% of all of the cells
analyzed. This percentage is similar to the percentage of Ramos
cells that was spiked into the population.
[0555] Ramos cells are derived from follicular B cells and strongly
express B cell differentiation markers CD20, CD22, CD19, CD10 and
BCL6. Ramos cells also express IgM and overexpress c-myc. FIG. 28
shows a heat map of expression of the top 100 (in terms of the
total number of molecules detected). The subset of cells (18 cells)
that express much higher levels of mRNA also strongly express genes
that are known markers for Ramos cells (e.g., CD10, Bc1-6, CD22,
C-my, and IgM).
[0556] These results demonstrate that massively parallel single
cell sequencing successfully identified small subsets (as low as
2%) of abnormal cell types in a cell suspension. Massively parallel
single cell sequencing may be used in cancer diagnostics (e.g.,
biopsy/circulating tumor cells). Since cancer cells are larger in
size and carry more mRNA, they may be easily differentiated from
normal cells.
Example 12
Massively Parallel Single Cell Whole Genome and Multiplex
Amplification of gDNA Targets Using RESOLVE
[0557] FIG. 29 shows a workflow for this example. As shown in FIG.
29, a cell suspension is applied to a microwell array (2901). The
number of cells in the cell suspension is less than the number of
wells in the microwell array, such that application of the cell
suspension to the microwell array results in a well in the
microwell array containing 1 or fewer cells.
Oligonucleotide-conjugated beads (2905) are applied to the
microwell array. An oligonucleotide-conjugated bead (2905) contains
a bead (2910) attached to an oligonucleotide comprising a 5' amine
(2915), universal primer sequence (2920), cell label (2925),
molecular label (2930) and randomer (2935). The
oligonucleotide-conjugated bead contains approximately 1 billion
oligonucleotides. An oligonucleotide contains a 5' amine, universal
primer sequence, cell label, molecular label, and randomer. Each
oligonucleotide on a single bead contains the same cell label.
However, two or more oligonucleotides on a single bead may contain
two or more different molecular labels. A bead may contain multiple
copies of oligonucleotides containing the same molecular label.
[0558] After the oligonucleotide-conjugated beads are added to the
microwell array, a cell lysis buffer is applied to the array
surface. As shown in FIG. 29, the genomic DNA (2945) from the cell
hybridizes to the randomer sequence (2935) of the
oligonucleotide-conjugated beads (2940). A neutralization buffer is
added to the array surface. A DNA polymerase (e.g., Phi29) and
dNTPs are added to the array surface. The randomer sequence (2935)
acts as a primer for amplification of the genomic DNA, thereby
produce a gDNA-conjugated bead (2555). The gDNA-conjugated bead
(2955) contains an oligonucleotide comprising a 5' amine (2915),
universal primer sequence (2920), cell label (2925), molecular
label (2925), randomer (2935) and copy of the genomic DNA (2955).
The original genomic DNA (2945) is hybridized to the randomer
(2935) and the copy of the genomic DNA (2955). For a single bead,
there are multiple different genomic DNA molecules attached to the
oligonucleotides.
[0559] As shown in FIG. 29, the gDNA-conjugated beads (2950) from
the wells are combined into an eppendorf tube (2960). The genomic
DNA on the gDNA MDA mix containing randomers, dNTPs and a DNA
polymerase (e.g., Phi29) is added to the eppendorf tube containing
the combined gDNA-conjugated beads. The labeled genomic DNA is
further amplified to yield labeled amplicons (2965) in solution. A
labeled amplicon (2965) comprises a universal primer sequence
(2920), cell label (2925), molecular label (2930), randomer (2935),
and copy of the genomic DNA (2955). The labeled amplicons are
sheared to smaller pieces of approximately 1 kb or less.
Alternatively, the labeled amplicons may be fragmented by to
Tagmentation (Nextera). Shearing or fragmenting the labeled
amplicons results in labeled-fragments (2980) and unlabeled
fragments (2985). The labeled fragment (2980) contains the
universal primer sequence (2920), cell label (2925), molecular
label (2930), randomer (2935), and fragment of the copy of the
genomic DNA (2955). Adaptors (2970, 7975) are added to the
fragments. The universal primer sequence may be used to select for
labeled fragments (2980) via hybridization pulldown or PCR using
the universal primer sequence and a primer against one of the
adaptors (2970, 2975).
[0560] The labeled fragments may be sequenced. Sequence reads
comprising a sequence of the cell label, molecular label and
genomic fragment may be used to identify cell populations from the
cell suspension. Principal component analysis may be used to
generate scatterplots of the cells based on known cell markers.
Alternatively, or additionally, SPADE may be used to produce cell
cluster plots. A computer software program may be used to generate
a list comprising a cell label and the molecular labels and genomic
fragments associated with the cell label.
Example 13
Massively Parallel Sequencing to Identify Cells in a Heterogeneous
Population
[0561] The experimental workflow for this example is shown in FIG.
30. As shown in FIG. 30, a mixed population of cells was
stochastically dispersed onto a microwell array. In this example,
the mixed population of cells comprises a mixture of Ramos cells
and K562 cells. The cell suspension comprises a low concentration
of cells such that each microwell in the array contains 1 or fewer
cells. After the cells were applied to the microwell array, a
plurality of oligonucleotide conjugated beads was stochastically
dispersed onto the microwell array. The oligonucleotide bead
contains a plurality of oligonucleotides comprising a 5' amine,
universal primer sequence, cell label, molecular label, and
oligodT. The cell labels of the plurality of oligonucleotides from
a single bead are identical. A single bead may comprise multiple
oligonucleotides comprising the same molecular label. In addition,
a single bead may comprise multiple oligonucleotides comprising
different molecular labels. A cell label of an oligonucleotide
conjugated to a first bead is different from a cell label of an
oligonucleotide conjugated to a second bead. Thus, the cell label
may be used to differentiate two or more oligonucleotide conjugated
beads. The cells were lysed and the RNA molecules from a single
cell were attached to the oligonucleotide conjugated beads in the
same well. FIG. 30 shows the attachment of the polyA sequence of a
RNA to the oligodT sequence of the oligonucleotide. After
attachment of the RNA molecules from the individual cells to the
oligonucleotide conjugated beads in the same well, the beads were
combined into a single sample. A cDNA synthesis reaction was
carried out on the beads in the single sample. FIG. 30 shows the
product of the cDNA synthesis comprises a bead attached to an
oligonucleotide, the oligonucleotide comprising the 5' amine,
universal primer sequence, cell label, molecular label, oligodT and
a copy of the RNA molecule. For simplicity, only one
oligonucleotide is depicted in FIG. 30, however, in this example,
each oligonucleotide conjugated bead comprises approximately 1
billion oligonucleotides. As shown in FIG. 30, multiplexed PCR was
performed with the beads in the single sample using a universal
primer that hybridized to the universal primer sequence and a
gene-specific primer that hybridized to the copy of the RNA
molecule. The gene-specific primers were designed to bind to
Ramos-specific genes or K562-specific genes from the gene panel
shown in Table 16. As a control, a GAPDH gene-specific primer was
also used in the multiplexed PCR reaction. Lastly, next-generation
sequencing was used to sequence the amplified products. The
sequencing reads included information pertaining to the cell label,
molecular label and the gene. Using principal component analysis, a
scatter plot of the cells was constructed based on the sequencing
information pertaining to the cell label, molecular label and the
gene. Analogous to how FACs is used to sort cells and scatter plots
based on the surface markers is used to group cells, the cell label
is used to identify genes from a single cell and the molecular
label is used to determine the quantity of the genes. This combined
information is then used to relate the gene expression profile
individual cells. As shown in FIG. 31A, massively parallel single
cell sequencing with cell and molecular labels was able to
successfully identify the two cell populations (K562 and Ramos
cells) in the mixed cell population.
TABLE-US-00019 TABLE 16 Gene Cell Gene Cell CD74 Ramos specific
CD41 K562 specific CD79a Ramos specific GYPA K562 specific IGJ
Ramos specific GATA2 K562 specific TCL1A Ramos specific GATA1 K562
specific SEPT9 Ramos specific HBG1 K562 specific CD27 Ramos
specific GAPDH Common
EXAMPLE 14
Massively Parallel Single Cell Sequencing with Principal Component
Analysis
[0562] In this example, mRNA molecules from individual cells were
stochastically labeled with oligonucleotide conjugated beads in
parallel. PBMCs were isolated from blood and frozen at 80.degree.
C. in RPMI1640 plus FBS and DMSO. The PMBCs were thawed and washed
three times with PBS. A PBMC sample comprising a mixture of cell
types (4000 total cells) was stochastically applied to an agarose
microwell array. The agarose microwell array contained 37,500
cells. A mixture of 150,000 oligonucleotide conjugated beads was
stochastically applied to the microwell array via a PDMS gasket
that surrounded the microwell array. The oligonucleotide conjugated
bead is depicted in FIG. 1. For simplicity, only one
oligonucleotide is shown to be attached to the bead, however, the
oligonucleotide conjugated beads contained approximately 1 billion
oligonucleotides.
[0563] Cells were lysed by placing the microwell array on a cold
block for 10 minutes and by applying lysis buffer to the array
surface. Once the cells in the wells were lysed, the mRNA molecules
from the single cells were attached to the oligonucleotide
conjugated bead via the oligodT sequence. A magnet was applied to
the array and the array was washed twice with wash buffer.
[0564] The beads with the attached mRNA molecules were combined
into an eppendorf tube. The mRNA molecules attached to the beads
were reverse transcribed to produce cDNA. The following cDNA
synthesis mixture was prepared as follows:
TABLE-US-00020 Component Volume (uL) Water 8 dNTP (10 mM) 2 5x
first strand buffer 4 MgCl2 2.4 SuperRase In 1 SMART oligo (50 uM)
0.4 0.1M DTT 1 100x BSA 0.2 SSII 1 total 20
[0565] The cDNA synthesis mixture was added to the eppendorf tube
containing the beads with the attached mRNA molecules. The
eppendorf tube was incubated at 40.degree. C. for 90 minutes on a
rotor. The cDNA synthesis reaction occurred on the beads. After 90
minutes, a magnet was applied to the tube and the cDNA mix was
removed and replaced with the following Exol reaction mixture:
TABLE-US-00021 Component Volume (uL) ExoI buffer 2 water 17 ExoI
1
[0566] The tubes were incubated at 37.degree. C. for 30 minutes on
a rotor. The tubes were then transferred to a thermal cycler for 15
minutes at 80.degree. C. After incubating the tube at 80.degree. C.
for 15 minutes, 70 microliters of TE+Tween20 was added to the tube.
A magnet was applied to the tube and the buffer was removed. The
beads were then resuspended in 50 microliters TE+Tween20.
[0567] The cDNA attached to the beads were amplified by real-time
PCR using the following amplification mixture:
TABLE-US-00022 Component Volume (uL) 2x iTaq mix 10 GAPDH ILMN (10
uM) 0.6 ILR2 (10 uM) 0.6 bead 2 water 6.8 total 20
[0568] The labeled cDNA amplicons were sequenced to detect the cell
label, molecular index, and gene. Sequencing reads were aligned to
the cell label, then the gene, and lastly the molecular label. A
cell label associated with 4 or more genes or associated with 10 or
more unique transcript molecules, with each unique transcript
molecule sequenced more than once, was designated a cell. Principal
component analysis with all of genes from Table 9 detected was used
to identify the set of genes that had the greatest contribution to
the variation in data. 632 single cells were used in the principal
component analysis. Based on the sequencing results, 81 out of the
98 genes were detected.
[0569] FIG. 32 shows a principal component analysis plot for GAPDH
expression. As shown in FIG. 32, two cell clusters were observed
based on the location of the principal component space.
[0570] FIG. 33A-F shows the principal component analysis (PCA) for
monocyte associated genes. FIG. 33A shows the PCA for CD16. FIG.
33B shows the PCA for CCRvarA. FIG. 33C shows the PCA for CD14.
FIG. 33D shows the PCA for S100A12. FIG. 33E shows the PCA for
CD209. FIG. 33F shows the PCA for IFNGR1.
[0571] FIG. 34A-B shows the principal component analysis (PCA) for
pan-T cell markers (CD3). FIG. 34A shows the PCA for CD3D and FIG.
34B shows the PCA for CD3E.
[0572] FIG. 35A-E shows the principal component analysis (PCA) for
CD8 T cell associated genes. FIG. 35A shows the PCA for CD8A. FIG.
35B shows the PCA for EOMES. FIG. 35C shows the PCA for CD8B. FIG.
35D shows the PCA for PRF1. FIG. 35E shows the PCA for RUNX3.
[0573] FIG. 36A-C shows the principal component analysis (PCA) for
CD4 T cell associated genes. FIG. 36A shows the PCA for CD4. FIG.
36B shows the PCA for CCR7. FIG. 36C shows the PCA for CD62L.
[0574] FIG. 37A-F shows the principal component analysis (PCA) for
B cell associated genes. FIG. 37A shows the PCA for CD20. FIG. 37B
shows the PCA for IGHD. FIG. 37C shows the PCA for PAX5. FIG. 37D
shows the PCA for TCL1A. FIG. 37E shows the PCA for IGHM. FIG. 37F
shows the PCA for CD24.
[0575] FIG. 38A-C shows the principal component analysis (PCA) for
Natural Killer cell associated genes. FIG. 38A shows the PCA for
KIR2DS5. FIG. 38B shows the PCA for CD16. FIG. 38C shows the PCA
for CD62L.
[0576] Based on the principal component analyses, monocytes and
lymphocytes formed two distinct clusters on PC1. B, T, and NK cells
formed another cluster that resided as a continuum in the cluster
along PC2. FIG. 39 shows the PCA analysis of GAPDH expression with
annotations for the cell types and cell subtypes. FIG. 40 depicts a
heat map that shows the correlation in gene expression profile
between cells. Along the diagonal starting with the left upper
corner, the cells are monocytes, naive CD4 T cells, naive CD8 T
cells, cytotoxic CD8 T cells, NK cells, and B cells. FIG. 41 shows
another version of a heat map demonstrating the correlation between
gene expression and cell type. FIG. 42 shows a heat map
demonstrating the correlation in gene expression profile between
genes.
Example 15
Uncovering Cellular Heterogeneity by Digital Gene Expression
Cytometry
[0577] An approach for gene expression cytometry is presented
combining next-generation sequencing with stochastic barcoding of
single cells. Thousands of cells were deposited randomly onto an
array of approximately 150,000 microwells. A library of beads
bearing cell- and transcript-barcoding capture probes was added so
that each cell is partitioned alongside a bead with a unique cell
barcode. Following cell lysis, mRNAs were hybridized to beads, and
were pooled for reverse transcription, amplification, and
sequencing. The digital gene expression profile for each cell was
reconstructed when barcoded transcripts were counted and assigned
to the cell of origin. We applied the technology to dissect the
human hematopoietic system into cell sub-populations, and to
characterize the heterogeneous response of immune cells to in vitro
stimulation. Furthermore, the high sensitivity of the method was
demonstrated by the detection of rare cells, such as
antigen-specific T cells, and tumor cells in a high background of
normal cells.
Introduction
[0578] Understanding cellular diversity and function in a large
collection of cells requires the measurement of specific genes or
proteins expressed by individual cells. Flow cytometry is well
established for measuring protein expression of single cells, yet
mRNA expression measurements are typically conducted in bulk
samples, obscuring individual cell contributions. While single cell
mRNA expression measurements using microtiter plates or commercial
microfluidic chips have recently been reported (1-5), these
approaches are extremely low-throughput and difficult to scale.
Because of these limitations, most studies to date are restricted
in both the number of cells interrogated and the number of
conditions explored.
[0579] Here, we have developed a highly scalable approach that
enables routine, digital gene expression profiling of thousands of
single cells across an arbitrary number of genes. Microscale
engineering and combinatorial chemistry were used to label all mRNA
molecules in a cell with a unique cellular barcode in a massively
parallel manner. In addition, each transcript copy within a cell
was tagged with a molecular barcode, allowing absolute digital gene
expression measurements (6). Tagged mRNA molecules from all cells
were pooled, amplified, and sequenced. The digital gene expression
profile of each cell was reconstructed using the cell and molecular
barcodes on each sequence. This highly scalable technology enables
gene expression cytometry, which we term CytoSeq. We have applied
the technique to multiparameter genetic classification of the
hematopoietic system and demonstrated its use for studying cellular
heterogeneity and detecting rare cells in a population.
Results
CytoSeq
[0580] The procedure was outlined in FIG. 43A. A cell suspension
was first loaded onto a microfabricated surface with up to 150,000
microwells. Each 30 micron diameter microwell has a volume of about
20 picoliters. The number of cells was adjusted so that only about
1 out of 10 or more wells receives a cell. The cells settled within
the wells by gravity.
[0581] Magnetic beads were loaded onto the microwell array to
saturation, such that a bead sat partially on top of, or adjacent
to, each cell within a well. The dimension of the bead was chosen
such that each microwell may hold only one bead. Each magnetic bead
carried approximately one billion oligonucleotide templates with
the structure outlined in FIG. 43B. Each oligonucleotide displayed
a universal priming site, followed by a cell label, a molecular
label, and a capture sequence of oligo(dT). All the
oligonucleotides on each bead have the same cell label but contain
a diversity of molecular labels. We have devised a combinatorial
split-pool method to synthesize beads with a diversity of close to
one million. The probability of having two single cells being
tagged with the same cell label was low (on the order of 10.sup.-4)
because only about 10% of the wells were occupied by a single cell.
Similarly, the diversity of the molecular labels on a single bead
was on the order of 10.sup.4, and the likelihood of two transcript
molecules of the same gene in the same cell being tagged with the
same molecular label was also low.
[0582] Lysis buffer was applied onto the surface of the microwell
array and diffuses into the microwells. The poly(dA) tailed mRNA
molecules released from a cell hybridize to the oligo(dT) on the 3'
end of the oligonucleotides on the bead. Because the cell was
adjacent to the bead, under the high salt conditions of the lysis
buffer and high local concentration of mRNA (tens of nanomolar),
mRNA molecules were captured on the bead.
[0583] After lysis and hybridization, all beads were collected from
the microwell array into a tube using a magnet. From this point
forward, all reactions were carried out in a single tube. cDNA
synthesis was performed on the beads using conventional protocols
(Methods). The cDNA molecules derived from each cell were
covalently attached to their corresponding bead, each tagged on the
5'end with a cell label and a molecular label. Nested multiplex
PCRs were carried out to amplify genes of interest (FIG. 55).
Because the mRNA from each cell had been copied onto a bead as
cDNA, the beads may be repeatedly amplified and analyzed, for
example, for a different set of genes.
[0584] Sequencing of the amplicons revealed the cell label, the
molecular label, and the gene identity (FIG. 55). Computational
analysis grouped the reads based on the cell label, and collapsed
the reads with the same molecular label and gene sequence into a
single entry to suppress any amplification bias. The use of
molecular label enabled us to measure the absolute number of
molecules per gene per cell, and therefore allowed the direct
comparison of cellular expression level across biological samples
that may have undergone different depths of sequencing.
Identification of Distinct Cell Types in Controlled Cell
Mixtures
[0585] In order to measure the ability of the method to separate
two cell types, a about 1:1 mixture of K562 and Ramos cells was
loaded onto the microwell array with 10,000 wells. Approximately
6000 cells were used to capture 1000 cells. A panel of 12 genes was
selected and amplified from the beads. The panel consists of 5
genes specific for K562 (myelogenous leukemia) cells, 6 genes
specific for Ramos (follicular lymphoma) cells, and the
housekeeping gene GAPDH (Table 18). With approximately 1000 cells
captured on a 10,000-well array each with a single bead, only 10%
of the beads should carry mRNA and one should in theory observe
only a maximum of 1000 unique cell labels in the sequencing data.
Indeed, we found 768 cell labels that were associated with
significant number of reads after data filtering (see Methods for
filtering criteria). As a comparison, we carried out bulk cell
lysis and mRNA capture in a microcentrifuge tube with similar
number of cells and beads, and observed a large number of cell
labels with mostly only one read associated with each cell label.
This demonstrates that the microwell array was effective in
confining hybridization of mRNA from a single cell to the bead in
the same well.
[0586] The gene expression profile of each of the 768 single cells
was clustered using principal component analysis (PCA) (FIG. 31A).
The first principal component (PC) clearly separated the single
cells into two major clusters based on the cell type. The genes
that contributed to the positive side of the first principal
component were those that are specific to Ramos, while the genes
that contributed to the negative side of the same principal
component were those that are specific to K562. This successful
clustering of cells into groups based on their specific expression
showed that inter-well contamination, if any, was negligible. The
second principal component highlighted the high degree of
variability in fetal hemoglobin (HBG1) within the K562 cells, which
had been observed previously (7).
TABLE-US-00023 TABLE 18 SEQ ID Nested Primer with Common SEQ ID
Gene Outer Primer NO: 5' Flanking Sequence NO: CD41
CCCCTGGAAGAAGATG 2 CAGACGTGTGCTCTTCCGATCTTTCT 3 ATGA
CCAACAAGTTGCCTCC GYPD GAGGAAATGAAGCCAA 4 CAGACGTGTGCTCTTCCGATCTAAT
5 ACACA CGTGACCTTAAAGGCCC GATA1 TTAGCCACCTCATGCCT 6
CAGACGTGTGCTCTTCCGATCTCTAC 7 TTC TGTGGTGGCTCCGCT GATA2
GGAGGAGGATTGTGCT 8 CAGACGTGTGCTCTTCCGATCTGTG 9 GATG
TCCGCATAAGAAAAAGAATC HBG1 GCAAGAAGGTGCTGAC 10
CAGACGTGTGCTCTTCCGATCTCTGC 11 TTCC ATGTGGATCCTGAGAA CD27
CTGCAGTCCCATCCTCT 12 CAGACGTGTGCTCTTCCGATCTGAT 13 TGT
GAGGTGGAGAGTGGGAA IGJ GGACATAACAGACTTG 14 CAGACGTGTGCTCTTCCGATCTCAA
15 GAAGCA TCCATTTTGTAACTGAACCTT TCL1A AAGCCTCTGGGTCAGTG 16
CAGACGTGTGCTCTTCCGATCTTGG 17 GT AAAAGGGATAGAGGTTGG CD74
TAGACAGATCCCCGTTC 18 CAGACGTGTGCTCTTCCGATCTACA 19 CTG
GGGAGAAGGGATAACCC SEPT9 CAGCATCCCAGCCTTGA 20
CAGACGTGTGCTCTTCCGATCTCCTC 21 G AATGGCCTTTTGCTAC CD79a
CCTCTAAACTGCCCCAC 22 CAGACGTGTGCTCTTCCGATCTCCTT 23 CTC
AATCGCTGCCTCTAGG GAPDH CACATGGCCUCCAAGG 24
CAGACGTGTGCTCTTCCGATCTCAG 25 AGUAA CAAGAGCACAAGAGGAA
[0587] In another experiment, we spiked in Ramos (Burkitt lymphoma)
cells at a few percentage into primary B cells from a healthy
individual. A panel of 111 genes (Table 22) was designed to
represent different states of B cells. 1198 single cells were
analyzed. A small group of the population, constituting 18 single
cells (about 1.5% of the population), was found to have a distinct
gene expression pattern as compared to the rest (FIG. 31B). The
genes that were preferentially expressed by this group are known to
be associated with Burkitt lymphoma, such as MYC and IgM, as well
as B cell differentiation markers (CD10, CD20, CD22, BCL6) that are
expressed specifically by follicular B cells, which are the subset
of B cells that Burkitt lymphoma originates (FIGS. 31C and 31D). In
addition, this group of cells carried higher level of CCND3 and
GAPDH, as well as an overall higher mRNA content, as determined by
the total number of unique mRNA molecules detected based on
analyzing the molecular indices (FIG. 31B). This finding was
consistent with the fact that lymphoma cells are physically larger
than the primary B cells in normal individuals, and that they are
rapidly proliferating and producing larger amount of
transcripts.
Simultaneous Identification of Multiple Cell Types in Human
PBMCs
[0588] While the controlled experiments involved artificial
mixtures of two distinct types of cells, most naturally occurring
biological samples contain diverse populations with numerous cell
types and states with more subtle differences in gene expression
profile. A prominent example is blood. We carried out an experiment
in which we aimed to simultaneously identify all of the major cell
types in human peripheral blood mononuclear cells (PBMCs),
including monocytes, NK cells, and the different T and B cell
subsets, by measuring the expression profile of a panel of 98 genes
(Table 19) that are specific to each of the major cell type. Unlike
traditional immunophenotyping that is limited mostly to surface
protein markers, we included genes that encode cytokines,
transcription factors, and intracellular proteins of various
cellular functions in addition to surface proteins. We analyzed
with PCA the digital gene expression profile of 632 single PBMCs
using 81 genes present (FIG. 32-39). The first principal component
clearly separated monocytes and lymphocytes into two orthogonal
clusters, as evidenced by the expression of CD16a, CD14, S100A12,
and CCR2 in one cluster, and lymphocyte associated genes in the
other. The different subtypes of lymphocytes lay in a continuum
along the second principal component, with B cells (expressing IgM,
IgD, TCL1A, CD20, CD24, PAX5) at one end, naive T cells (expressing
CD4, CCR7, CD62L) in the middle, and cytotoxic T cells (expressing
CD8A, CD8B, EOMES, PRF1) at the other end. Natural killer cells
that express killer-like immunoglobulin receptor, CD16a, and
perforin (PRF1) lay in the space between monocytes and cytotoxic T
cells. We also observed that GAPDH, an indicator of cellular
metabolism, was expressed at highest levels in monocytes and lowest
in B cells, which are presumably mostly resting. Correlation
analysis of gene expression profile across cells reiterated
observations with PCA and revealed additional smaller subsets of
cells within each major cell type (FIG. 40A-B). A replicate
experiment of the same PBMC sample with 731 cells yielded largely
similar segregation and cell type frequency (FIG. 41).
TABLE-US-00024 TABLE 22 SEQ SEQ ID Nested Primer ID Gene Outer
Primer NO: with Common 5' Flanking Sequence NO: CD19
GCAGGGTCCCAGTCCTATG 26 CAGACGTGTGCTCTTCCGATCTCCAATCATGAGGAAGAT 27
GCA CD27 TCCAGGAGGATTACCGAAAA 28
CAGACGTGTGCTCTTCCGATCTCCATCCAAGGGAGAGT 29 GAGA CD138
AATGGCAAAGGAAGGTGGAT 30 CAGACGTGTGCTCTTCCGATCTGCAGACACCTTGGACAT 31
CCT CD38 AGATCTGAGCCAGTCGCTGT 32
CAGACGTGTGCTCTTCCGATCTTGGTGCAGAGCTGAAG 33 ATTTT CD24
AAAAGTGGGCTTGATTCTGC 34 CAGACGTGTGCTCTTCCGATCTTTTTGTTCGCATGGTCA 35
CAC CD10 ATATTCCTTTGGGCCTCTGC 36
CAGACGTGTGCTCTTCCGATCTTCAAGTTTGGGTCTGTG 37 CTG CD95
CCCCCGAAAATGTTCAATAA 38 CAGACGTGTGCTCTTCCGATCTTGCTCTTGTCATACCCC 39
CA CD21 TAGCTTCCTCCTCTGGTGGT 40
CAGACGTGTGCTCTTCCGATCTTTTGCCTTTCCATAATC 41 ACTCA CXCR3
CTGGCTCTCCCCAATATCCT 42 CAGACGTGTGCTCTTCCGATCTGCTCTGAGGACTGCACC 43
ATT CD40 GTGGTGTTGGGGTATGGTTT 44
CAGACGTGTGCTCTTCCGATCTATACACAGATGCCCATT 45 GCA CD69
AGACAGGTCCTTTTCGATGG 46 CAGACGTGTGCTCTTCCGATCTTGTGCAATATGTGATGT 47
GGC CD1c TTGAGACAGGCACATACAGCTT 48
CAGACGTGTGCTCTTCCGATCTTTGCTTCCTCAATCTGT 49 CCA IL10
CCCCAACCACTTCATTCTTG 50 CAGACGTGTGCTCTTCCGATCTTTCAATTCCTCTGGG 51
AATGTT IL4R TGCCTAGAGGTGCTCATTCA 52
CAGACGTGTGCTCTTCCGATCTGTTGATGCTGGAGGCAG 53 AAT IL21R
AGCCTGGGTCACAGATCAAG 54 CAGACGTGTGCTCTTCCGATCTAGGTAGGAGGGTGGAT 55
GGAG IL6R CCAGCACCAGGGAGTTTCTA 56
CAGACGTGTGCTCTTCCGATCTAGGAAAGGATTGGAAC 57 AGCA CXCL12
GGGTTTCAGGTTCCAATCAG 58 CAGACGTGTGCTCTTCCGATCTTTTGTAACTTTTTGCAA 59
GGCA CCL3 GTGAGGAGTGGGTCCAGAAA 60
CAGACGTGTGCTCTTCCGATCTAGTGGGGAGGAGCAGG 61 AG CCL14
CCATTCCCTTCTTCCTCCTC 62 CAGACGTGTGCTCTTCCGATCTTACCTACAAGATCCCGC 63
GTC CCL20 TTGGACATAGCCCAAGAACA 64
CAGACGTGTGCTCTTCCGATCTTGTGCCTCACTGGACTT 65 GTC CCL18
ACCTGAAGCTGAATGCCTGA 66 CAGACGTGTGCTCTTCCGATCTCTGGAGGCCACCTCTTC 67
TAA TCL1A GGTAAACACGCCTGCAAAC 68
CAGACGTGTGCTCTTCCGATCTCAGGACTCAGAAGCCT 69 CTGG TACI
CAACAAAGCACAGTGTTAAATGAA 70 CAGACGTGTGCTCTTCCGATCTTGTGTCAGCTACTGCGG
71 AAA AICDA TGAGCAGATCCACAGGAAAA 72
CAGACGTGTGCTCTTCCGATCTGAAATGGAGTCTCAAA 73 GCTTCA FCRL4
TCCCAACTACGCTGATTTGA 74 CAGACGTGTGCTCTTCCGATCTGACCAAAAGGAATGTG 75
TGGG BCL2 TGCAAGAGTGACAGTGGATTG 76
CAGACGTGTGCTCTTCCGATCTTCAACCAAGGTTTGCTT 77 TTGT FASLG
AGAGGCTGAAAGAGGCCAAT 78 CAGACGTGTGCTCTTCCGATCTAATATGGGTTGCATTTG 79
GTCA BCL6 AAATCTGCAGAAGGAAAAATGTG 80
CAGACGTGTGCTCTTCCGATCTAGTTTTCAATGATGGGC 81 GAG AURKB
GCTCAAGGGAGAGCTGAAGA 82 CAGACGTGTGCTCTTCCGATCTGACTACCTGCCCCCAGA 83
GAT CD81 GTGGCGTGTATGAGTGGAGA 84
CAGACGTGTGCTCTTCCGATCTCACTCGCCCAGAGACTC 85 AG CD80
GCACATCTCATGGCAGCTAA 86 CAGACGTGTGCTCTTCCGATCTGCTTCACAAACCTTGCT 87
CCT CD23a ACATTTTCTGCCACCCAAAC 88
CAGACGTGTGCTCTTCCGATCTAACAGCACCCTCTCCAG 89 ATG CD44
GCCTGGTAGAATTGGCTTTTC 90 CAGACGTGTGCTCTTCCGATCTTTTTGTAGCCAACATTC 91
ATTCAA LEF1 CAATTGGCAGCCCTATTTCA 92
CAGACGTGTGCTCTTCCGATCTGTTCAGCAGACTGGTTT 93 GCA CXCR5
CCGTGAGGATGTCACTCAGA 94 CAGACGTGTGCTCTTCCGATCTACGAGGAAGCCCTAAG 95
ACGT PRKCB TTGAGCCTGGGGTGTAAGAC 96
CAGACGTGTGCTCTTCCGATCTGTCTTCCAGGATTCACG 97 GTG PRKCD
GAGCACCTCCTGGAAGATTG 98 CAGACGTGTGCTCTTCCGATCTTAAGCACCAGTGGGACT 99
GTG CD20 TAGGAGCAGGCCTGAGAAAA 100
CAGACGTGTGCTCTTCCGATCTGATTCCTCTCCAAACCC 101 ATG CD30
TGTTTTGGGGAAAGTTGGAG 102 CAGACGTGTGCTCTTCCGATCTCTGTTTGCCCAGTGTTT
103 GTG CD30L TGCAACCCAACTGTGTGTTA 104
CAGACGTGTGCTCTTCCGATCTTTTCACCAACTGTTCTC 105 TGAGC BAFFR
GCCCTGAGCAACAATAGCAG 106 CAGACGTGTGCTCTTCCGATCTTTCAGCTCTTCACTCCA
107 GCA CMRF-35H AGGAAAAGATGTGGCTCACG 108
CAGACGTGTGCTCTTCCGATCTGGAGTTGGGGAGAACT 109 GTCA PRDM1
TCGAATAATCCAGGGAAACC 110 CAGACGTGTGCTCTTCCGATCTACCAAAGCATCACGTTG
111 ACA HLA-DRA GGCTTTACAAAGCTGGCAAT 112
CAGACGTGTGCTCTTCCGATCTTATGCCTCTTCGATTGC 113 TCC GNAI2
CCTTGAGTGTGTCTGCGTGT 114 CAGACGTGTGCTCTTCCGATCTCCACAGAATTGGGTTCC
115 AAG RGS1 AACTGGGAAGGCCAGGTAAC 116
CAGACGTGTGCTCTTCCGATCTTGTTTTCAAATTGCCAT 117 TGC CD5
CTTTCTCCACGCCATTTGAT 118 CAGACGTGTGCTCTTCCGATCTACTAGGATATGGGGTGG
119 GCT CD22 GGGATCTGCTCGTCATCATT 120
CAGACGTGTGCTCTTCCGATCTGTTTCTGCCTCTGAGGG 121 AAA PIK3CD
GCGTGCGCGTTATTTATTTA 122 CAGACGTGTGCTCTTCCGATCTTGTCTGGGGAAGGCAA 123
GTTA DOCK8 GCAGTCAGCCAGAAATCACA 124
CAGACGTGTGCTCTTCCGATCTTTTTCTCCTCTCTGGGA 125 CCA CD11b
TGAAAAGTCTCCCTTTCCAGA 126 CAGACGTGTGCTCTTCCGATCTCCTTCAGACAGATTCCA
127 GGC FCGR2B GGAGAGGAGAGATGGGGATT 128
CAGACGTGTGCTCTTCCGATCTGAGTGAGTGCCCCTTTT 129 CTT CD72
CTCATGCCAACAAGAACCTG 130 CAGACGTGTGCTCTTCCGATCTTGACCCACACCTGACAC
131 TTC BCL11B TCGTGGAACACAGGCAAAC 132
CAGACGTGTGCTCTTCCGATCTTTGCATTTGTACTGGCA 133 AGG CD86
TCAAGGCAACCAGAGGAAAC 134 CAGACGTGTGCTCTTCCGATCTACTAAGGGATGGGGCA 135
GTCT TBX21 ACCTTTTCGTTGGCATGTGT 136
CAGACGTGTGCTCTTCCGATCTTCAGGGAAAGGACTCA 137 CCTG FOXP1
ATGCTGAAGGCATTTCTTGG 138 CAGACGTGTGCTCTTCCGATCTCTGTGAGCATGGTGCTT
139 CAT MCL1 GAGGGGAGTGGTGGGTTTAT 140
CAGACGTGTGCTCTTCCGATCTCAAAAGGGAAAGGGAG 141 GATT IFNB1
AGGGGAAAACTCATGAGCAG 142 CAGACGTGTGCTCTTCCGATCTTCACTGTGCCTGGACCA
143 TAG BLNK TTGGGCAGAAAGAAAAATGG 144
CAGACGTGTGCTCTTCCGATCTCAAAAGATTCCACCAG 145 ACTGAA CD40LG
CCTCCCCCAGTCTCTCTTCT 146 CAGACGTGTGCTCTTCCGATCTGAGTCAGGCCGTTGCTA
147 GTC IGBP1 GGCTGATCTTCCCACAACAC 148
CAGACGTGTGCTCTTCCGATCTACGAGGGCAAAGATGC 149 TAAA IRF4
ATTCCCGTGTTGCTTCAAAC 150 CAGACGTGTGCTCTTCCGATCTAGAACTGCCAGCAGGT 151
AGGA CD79a CACTTCCCTGGGACATTCTC 152
CAGACGTGTGCTCTTCCGATCTCTCACTCTTCTCCAGGC 153 CAG LTA
TGATGTCTGTCTGGCTGAGG 154 CAGACGTGTGCTCTTCCGATCTCCACACACAGAGGAAG 155
AGCA HDAC5 CCAGCCTGTAGGAAACCAAA 156
CAGACGTGTGCTCTTCCGATCTCTCCTTCTATCTCCAGG 157 GCC RAG1
GGATGCAGGTGGTTTTTGAT 158 CAGACGTGTGCTCTTCCGATCTCATTGTACCCATTTTAC
159 ATTTTCTT RAG2 CAAACCTTAAACACCCAGAAGC 160
CAGACGTGTGCTCTTCCGATCTATAACAATTCGGCAGTT 161 GGC CD1d
GAACCAGTTTCCTCCTGTGC 162 CAGACGTGTGCTCTTCCGATCTAAGATGTGGAGGCTGTT
163 GCT TGFB1 GACTGCGGATCTCTGTGTCA 164
CAGACGTGTGCTCTTCCGATCTTCTGCACTATTCCTTTG 165 CCC
CD9 TCAGTATGATCTTGTGCTGTGCT 166
CAGACGTGTGCTCTTCCGATCTTACCCATGAAGATTGGT 167 GGG CD11c
CACAGCATGAGAGGCTCTGT 168 CAGACGTGTGCTCTTCCGATCTTCTCAGTTCCGATTTCC
169 CAG FOXP3 TCAGGATCTGAGGTCCCAAC 170
CAGACGTGTGCTCTTCCGATCTTCACCTGTGTATCTCAC 171 GCA LAG3
AGAGCTGTCTAGCCCAGGTG 172 CAGACGTGTGCTCTTCCGATCTTGGTGTCCTTTCTCTGC
173 TCC CD73 CTTAACGTGGGAGTGGAACC 174
CAGACGTGTGCTCTTCCGATCTGTGTGCAAATGGCAGCT 175 AGA CD70
TCTCAGCTTCCACCAAGGTT 176 CAGACGTGTGCTCTTCCGATCTTCACTGGGACACTTTTG
177 CCT CCR7 CAGGGGAGAGTGTGGTGTTT 178
CAGACGTGTGCTCTTCCGATCTGACATGCACTCAGCTCT 179 TGG CD45RA
TGCATAGTTCCCATGTTAAATCC 180 CAGACGTGTGCTCTTCCGATCTTACCAGGAATGGATGTC
181 GCT PDCD1 ACATCCTACGGTCCCAAGGT 182
CAGACGTGTGCTCTTCCGATCTGCAGAAGTGCAGGCAC 183 CTA MYC
TGCATGATCAAATGCAACCT 184 CAGACGTGTGCTCTTCCGATCTTTGGACTTTGGGCATAA
185 AAGA CD25 AAATCACGGCAGTTTTCAGC 186
CAGACGTGTGCTCTTCCGATCTCTCATCTGTGCACTCTC 187 CCC FCAMR
GTGGGAAGAGAAGCTGATGC 188 CAGACGTGTGCTCTTCCGATCTTCAAGCATTATCCACGT
189 CCA CCND2 TGTGATGCCATATCAAGTCCA 190
CAGACGTGTGCTCTTCCGATCTTCAGTGTATGCGAAAAG 191 GTTTTT MKI67
AGCCTCTCTTGGGCTTTCTT 192 CAGACGTGTGCTCTTCCGATCTGTTTTCCCTGCCTGGAA
193 CTT CCND3 CTTTGCTGCTGAAGGCTCAT 194
CAGACGTGTGCTCTTCCGATCTACAAGTGGTGGTAACCC 195 TGG IL12A
TGCTTCCTAAAAAGCGAGGT 196 CAGACGTGTGCTCTTCCGATCTGAACTAGGGAGGGGGA 197
AAGA IFNG GCAGCCAACCTAAGCAAGAT 198
CAGACGTGTGCTCTTCCGATCTATCCAGTTACTGCCGGT 199 TTG TNFA
GAATGCTGCAGGACTTGAGA 200 CAGACGTGTGCTCTTCCGATCTACTTCCTTGAGACACGG
201 AGC IL2 ACCCAGGGACTTAATCAGCA 202
CAGACGTGTGCTCTTCCGATCTGCTGATGAGACAGCAA 203 CCATT IL4
GACATCTTTGCTGCCTCCA 204 CAGACGTGTGCTCTTCCGATCTATGAGAAGGACACTCG 205
CTGC IL6 TTAAGGAGTTCCTGCAGTCCA 206
CAGACGTGTGCTCTTCCGATCTTCCACTGGGCACAGAA 207 CTTA BAFF
TCCTTCGCTTTGCTTGTCTT 208 CAGACGTGTGCTCTTCCGATCTAGGTGGAAAAATAGAT 209
GCCAGTC IGHE CCCGGAAGTCTATGCGTTT 210
CAGACGTGTGCTCTTCCGATCTAGGACATCTCGGTGCAG 211 TG IGHD
TGTGTGAGGTGTCTGGCTTC 212 CAGACGTGTGCTCTTCCGATCTAGGAGCACCACGTTCTG
213 G IGHM CCCGGAGAAGTATGTGACCA 214
CAGACGTGTGCTCTTCCGATCTGTACTTCGCCCACAGCA 215 TC IGHA
CTGAACGAGCTGGTGACG 216 CAGACGTGTGCTCTTCCGATCTAGTACCTGACTTGGGCA 217
TCC IGHG1 CAAGGGCCCATCGGTCTT 218
CAGACGTGTGCTCTTCCGATCTTTGTGACAAAACTCACA 219 CATGC IGHG4
CAAGGGCCCATCGGTCTT 220 CAGACGTGTGCTCTTCCGATCTCAAATATGGTCCCCCAT 221
GC IGHG2 CAAGGGCCCATCGGTCTT 222
CAGACGTGTGCTCTTCCGATCTGCAAATGTTGTGTCGAG 223 TGC IGHG3
CAAGGGCCCATCGGTCTT 224 CAGACGTGTGCTCTTCCGATCTACCCCACTTGGTGACAC 225
AAC TLR1 CCATTCCGCAGTACTCCATT 226
CAGACGTGTGCTCTTCCGATCTAAGGAAAAGAGCAAAC 227 GTGG TLR2
TTGGTTGACTTCATGGATGC 228 CAGACGTGTGCTCTTCCGATCTGGAAACAGCACAAATG 229
AACTTAA TLR3 CATCATGCAGTTCAACAAGC 230
CAGACGTGTGCTCTTCCGATCTATGCACTCTGTTTGCGA 231 AGA TLR4
GGGTGTGTTTCCATGTCTCA 232 CAGACGTGTGCTCTTCCGATCTTTGAAAGTGTGTGTGTC
233 CGC TLR5 TCAGGCTGTTGCATGAAGAA 234
CAGACGTGTGCTCTTCCGATCTGTATGCCCTTGCTGGAC 235 CTA TLR6
ATGCGCAGTAAAAACTCGTG 236 CAGACGTGTGCTCTTCCGATCTTACAGTTCCACGCTGAG
237 CTG TLR7 GCCTGTACTTTCAGCTGGGTA 238
CAGACGTGTGCTCTTCCGATCTAAGGTGTTTGTGCCATT 239 TGG TLR8
GGTGAGCTCTGATTGCTTCA 240 CAGACGTGTGCTCTTCCGATCTTATCAGGAGGCAGGGA 241
TCAC TLR9 GACCGGGTCAGTGGTCTCT 242
CAGACGTGTGCTCTTCCGATCTGGTGATCCTGAGCCCTG 243 AC TLR10
TGCAGTGAGCTGAGATCGAG 244 CAGACGTGTGCTCTTCCGATCTATGGAAAACATCCTCAT
245 GGC GAPDH CACATGGCCUCCAAGGAGUAA 246
CAGACGTGTGCTCTTCCGATCTCAGCAAGAGCACAAGA 247 GGAA
TABLE-US-00025 TABLE 19 SEQ SEQ ID Nested ID Gene Outer Primer NO:
Primer with common 5' Flanking Sequence NO: CD19
GCAGGGTCCCAGTCCTATG 248 CAGACGTGTGCTCTTCCGATCTCCAATCATGAGGAAGAT 249
GCA CD20 TAGGAGCAGGCCTGAGAAAA 250
CAGACGTGTGCTCTTCCGATCTGATTCCTCTCCAAACCCA 251 TG BAFF
TCCTTCGCTTTGCTTGTCTT 252 CAGACGTGTGCTCTTCCGATCTAGGTGGAAAAATAGATG
253 CCAGTC TCL1A GGTAAACACGCCTGCAAAC 254
CAGACGTGTGCTCTTCCGATCTCAGGACTCAGAAGCCTC 255 TGG TACI
CAACAAAGCACAGTGTTAAATGA 256
CAGACGTGTGCTCTTCCGATCTTGTGTCAGCTACTGCGGA 257 A AA IGHD
TGTGTGAGGTGTCTGGCTTC 258 CAGACGTGTGCTCTTCCGATCTAGGAGCACCACGTTCTG
259 G IGHM CCCGGAGAAGTATGTGACCA 260
CAGACGTGTGCTCTTCCGATCTGTACTTCGCCCACAGCAT 261 C CD27
TCCAGGAGGATTACCGAAAA 262 CAGACGTGTGCTCTTCCGATCTCCATCCAAGGGAGAGTG
263 AGA CD38 AGATCTGAGCCAGTCGCTGT 264
CAGACGTGTGCTCTTCCGATCTTGGTGCAGAGCTGAAGA 265 TTTT CD24
AAAAGTGGGCTTGATTCTGC 266 CAGACGTGTGCTCTTCCGATCTTTTTGTTCGCATGGTCAC
267 AC AICDA TGAGCAGATCCACAGGAAAA 268
CAGACGTGTGCTCTTCCGATCTGAAATGGAGTCTCAAAG 269 CTTCA CD95
CCCCCGAAAATGTTCAATAA 270 CAGACGTGTGCTCTTCCGATCTTGCTCTTGTCATACCCCC
271 A CD10 ATATTCCTTTGGGCCTCTGC 272
CAGACGTGTGCTCTTCCGATCTTCAAGTTTGGGTCTGTGC 273 TG IL10
CCCCAACCACTTCATTCTTG 274 CAGACGTGTGCTCTTCCGATCTTTCAATTCCTCTGGGAAT
275 GTT CD138 AATGGCAAAGGAAGGTGGAT 276
CAGACGTGTGCTCTTCCGATCTGCAGACACCTTGGACAT 277 CCT CD45RA
TGCATAGTTCCCATGTTAAATCC 278 CAGACGTGTGCTCTTCCGATCTTACCAGGAATGGATGTC
279 GCT BCL6 AAATCTGCAGAAGGAAAAATGTG 280
CAGACGTGTGCTCTTCCGATCTAGTTTTCAATGATGGGCG 281 AG PRDM1
TCGAATAATCCAGGGAAACC 282 CAGACGTGTGCTCTTCCGATCTACCAAAGCATCACGTTG
283 ACA CXCR3 CTGGCTCTCCCCAATATCCT 284
CAGACGTGTGCTCTTCCGATCTGCTCTGAGGACTGCACC 285 ATT IFNG
GCAGCCAACCTAAGCAAGAT 286 CAGACGTGTGCTCTTCCGATCTATCCAGTTACTGCCGGTT
287 TG IL4R TGCCTAGAGGTGCTCATTCA 288
CAGACGTGTGCTCTTCCGATCTGTTGATGCTGGAGGCAG 289 AAT IL4
GACATCTTTGCTGCCTCCA 290 CAGACGTGTGCTCTTCCGATCTATGAGAAGGACACTCGC 291
TGC CCL20 TTGGACATAGCCCAAGAACA 292
CAGACGTGTGCTCTTCCGATCTTGTGCCTCACTGGACTTG 293 TC CD25
AAATCACGGCAGTTTTCAGC 294 CAGACGTGTGCTCTTCCGATCTCTCATCTGTGCACTCTCC
295 CC FOXP1 ATGCTGAAGGCATTTCTTGG 296
CAGACGTGTGCTCTTCCGATCTCTGTGAGCATGGTGCTTC 297 AT TGFB1
GACTGCGGATCTCTGTGTCA 298 CAGACGTGTGCTCTTCCGATCTTCTGCACTATTCCTTTGC
299 CC CXCR5 CCGTGAGGATGTCACTCAGA 300
CAGACGTGTGCTCTTCCGATCTACGAGGAAGCCCTAAGA 301 CGT CD69
AGACAGGTCCTTTTCGATGG 302 CAGACGTGTGCTCTTCCGATCTTGTGCAATATGTGATGTG
303 GC CD30 TGTTTTGGGGAAAGTTGGAG 304
CAGACGTGTGCTCTTCCGATCTCTGTTTGCCCAGTGTTTG 305 TG PDCD1
ACATCCTACGGTCCCAAGGT 306 CAGACGTGTGCTCTTCCGATCTGCAGAAGTGCAGGCACC
307 TA LAG3 AGAGCTGTCTAGCCCAGGTG 308
CAGACGTGTGCTCTTCCGATCTTGGTGTCCTTTCTCTGCT 309 CC PAX5
TGACGTGTGTTGCTTTTGTG 310 CAGACGTGTGCTCTTCCGATCTACTTGGGAGAAAACAGG
311 GGT TNFRSF17 GCTTTCCACTCCCAGCTATG 312
CAGACGTGTGCTCTTCCGATCTTGCTTTGAGTGCTACGGA 313 GA RASD1
GGGGGAGGGATGTGAAGTTA 314 CAGACGTGTGCTCTTCCGATCTATCTTGTCTGTGATTCCG
315 GG AMPD1 ACAGATGACCCAATGCAATTC 316
CAGACGTGTGCTCTTCCGATCTGAGCACCTGTGATATGTG 317 CG OSBPL5
AGACCGATGCACAGTCTTCC 318 CAGACGTGTGCTCTTCCGATCTCTTCACGTCTGGCCTCAG
319 TC CD56 GGAGCACTCAAGTGTGACGA 320
CAGACGTGTGCTCTTCCGATCTTTTTCTATGGAGCCTTCC 321 GA IGFBP7
CATCCAATTCCCAAGGACAG 322 CAGACGTGTGCTCTTCCGATCTGGTGAAGGTGCCGAGCT
323 ATA KIR2DS5 GCTCTTCCTCAAACCACGAA 324
CAGACGTGTGCTCTTCCGATCTCACACTCCTTTGCTTAGC 325 CC KIR2DS2
TCCTCACACCACGAATCTGA 326 CAGACGTGTGCTCTTCCGATCTCACTCCTTTGCTTAGCCC
327 AC RAB4B CCAGCTCACCTGTTCTCCAG 328
CAGACGTGTGCTCTTCCGATCTGAATCCCGTACCTGCTGC 329 T CD14
CTAAAGGACTGCCAGCCAAG 330 CAGACGTGTGCTCTTCCGATCTATAACCTGACACTGGAC
331 GGG S100A12 CACATTCCTGTGCATTGAGG 332
CAGACGTGTGCTCTTCCGATCTATACTCAGTTCGGAAGG 333 GGC CCR2
GAAGGAGGGAGACATGAGCA 334 CAGACGTGTGCTCTTCCGATCTACTGGTCCTTAGCCCCAT
335 variant B CT CD62L TCAGTTGGCTGACTTCCACA 336
CAGACGTGTGCTCTTCCGATCTTTAGTTTGGGGGTTTTGC 337 TG CD16
TCTTGGCCAGGGTAGTAAGAA 338 CAGACGTGTGCTCTTCCGATCTGTCAGTTCCAATGAGGTG
339 GG CX3CR1 CGTCCAGACCTTGTTCACAC 340
CAGACGTGTGCTCTTCCGATCTCCACAAATAGTGCTCGC 341 TTTC CD1b
TAGAGGGCCAGGACATCATC 342 CAGACGTGTGCTCTTCCGATCTTTGCTCCTTTTGCTATGC
343 CT FOXQ1 TGCTATTGACCGATGCTTCA 344
CAGACGTGTGCTCTTCCGATCTGCAACGGGCTACAGCTT 345 TAT CD209
GCTCTTGTTCTTGCCGTTTT 346 CAGACGTGTGCTCTTCCGATCTGAGTCCCTCAGTGGAGC
347 AAG CD1e CACAAGCACATTCATCTCTTCC 348
CAGACGTGTGCTCTTCCGATCTATTCAGGGCCAGCTTCAT 349 AA CCL17
TACTTCAAGGGAGCCATTCC 350 CAGACGTGTGCTCTTCCGATCTTTTGTAACTGTGCAGGGC
351 AG DTNA AGCAACGTGGAGTCAGTCTGT 352
CAGACGTGTGCTCTTCCGATCTCTCACCTTCTCTTGCCTT 353 GG CLEC4C
TTATTTTCTGGGGCTGTCAGA 354 CAGACGTGTGCTCTTCCGATCTCATTCTGGCACTCAGGTG
355 AA ZBTB16 TGATCAAGCACCTGAGAACG 356
CAGACGTGTGCTCTTCCGATCTTACCAGTGCACCATCTGC 357 AC SLAMF1
TGCAAAACCCAGAAGCTAAAA 358 CAGACGTGTGCTCTTCCGATCTGTTCTGTGCAAATGGCAT
359 TC CD3D AGAGCTGTGTGGAGCTGGAT 360
CAGACGTGTGCTCTTCCGATCTGGAGTCTTCTGCTTTGCT 361 GG CD3E
GCCCTCTTGCCAGGATATTT 362 CAGACGTGTGCTCTTCCGATCTGCATGTAAGTTGTCCCCC
363 AT CD8A CTGGCCTCTGCTCAACTAGC 364
CAGACGTGTGCTCTTCCGATCTATGGTACAAGCAATGCC 365 TGC CD8B
CAGCCTCAAGGGGAAGGTAT 366 CAGACGTGTGCTCTTCCGATCTTGCTTAACCCATGGATCC
367 TG PRF1 CCCTGCAGTCACAGCTACAC 368
CAGACGTGTGCTCTTCCGATCTTCAGGGCTGGTCTTTTAG 369 GA EOMES
TGGGATAATGTAAAACTGGTGCT 370
CAGACGTGTGCTCTTCCGATCTCATCCCCATGATATTTGG 371 GA CD4
AGCTAGCCTGAGAGGGAACC 372 CAGACGTGTGCTCTTCCGATCTTCCTCCAGACCATTCAGG
373 AC THPOK GGCTCTGCCTTGCACTATTT 374
CAGACGTGTGCTCTTCCGATCTCTCTTCCTCCCTTCCATG 375 C
RUNX3 TAAGGCCCAAAGTGGGTACA 376
CAGACGTGTGCTCTTCCGATCTTAGGAAGCACGAGGAAA 377 GGA CD45RO
ACCCTCTCTCCCTCCCTTTC 378 CAGACGTGTGCTCTTCCGATCTTAGTTGGCTATGCTGGCA
379 TG CD44 GCCTGGTAGAATTGGCTTTTC 380
CAGACGTGTGCTCTTCCGATCTTTTTGTAGCCAACATTCA 381 TTCAA CCR7
CAGGGGAGAGTGTGGTGTTT 382 CAGACGTGTGCTCTTCCGATCTACTCAGCTCTTGGCTCCA
383 CT TXK ACATCAAGCTCCATTGTTTCG 384
CAGACGTGTGCTCTTCCGATCTTTTGCCTGCACTCTTTGT 385 AGG MBD2
GCCTGGCACGTAATAGCTTG 386 CAGACGTGTGCTCTTCCGATCTAGGAAAGAAATGCCCTT
387 GGT IFNGR1 GAGGATGTGTGGCATTTTCA 388
CAGACGTGTGCTCTTCCGATCTGGTTCCTAGGTGAGCAG 389 GTG IL12RB2
AGCAGGCTGTACACAGCAGA 390 CAGACGTGTGCTCTTCCGATCTGACACTAGGCACATTGG
391 CTG IL33R ACTGTGCCCTCATCCAGAAC 392
CAGACGTGTGCTCTTCCGATCTAACGACGCCAAGGTGAT 393 ACT CCR4
TGGTGAAATGCAGAGTCAATG 394 CAGACGTGTGCTCTTCCGATCTTCAGGAGGAAGGCTTAC
395 ACC CRTH2 TGAATTTTGCTTGGTGGATG 396
CAGACGTGTGCTCTTCCGATCTTGTCAGTGGAAGAAGCA 397 GATG IL5
CAGTGAGAATGAGGGCCAAG 398 CAGACGTGTGCTCTTCCGATCTGAATGAGGGCCAAGAAA
399 GAG IL17A AAAATGAAACCCTCCCCAAA 400
CAGACGTGTGCTCTTCCGATCTTCCTTTGGAGATTAAGGC 401 CC IL17F
CTGCATCAATGCTCAAGGAA 402 CAGACGTGTGCTCTTCCGATCTCCAAGGCTGCTCTGTTTC
403 TT IL21 AAATCAAGCTCCCAAGGTCA 404
CAGACGTGTGCTCTTCCGATCTTGTGAATGACTTGGTCCC 405 TG IL22
ATGCCCCAAAGCGATTTTT 406 CAGACGTGTGCTCTTCCGATCTCAAAGGAAACCAATGCC 407
ACT IL23R TCCCTCATTGAAAGATGCAA 408
CAGACGTGTGCTCTTCCGATCTTAGAATCATTAGGCCAG 409 GCG RORA
TGCAAGCCATTTATGGGAAT 410 CAGACGTGTGCTCTTCCGATCTCCTTGGGTTTTCTTTTCA
411 ATTC RORC ATTTCCATGGTGCTCCAGTC 412
CAGACGTGTGCTCTTCCGATCTAGAGAAGCAGAAGTCGC 413 TCG OX40L
CTGCTGGCCCTGTACCTG 414 CAGACGTGTGCTCTTCCGATCTCTCCACCCTGGCCAAGA 415
T ICOS TTCAGCTGACTTGGACAACCT 416
CAGACGTGTGCTCTTCCGATCTGGACAACCTGACTGGCT 417 TTG SH2D1A
GGGTGTTGGTGAACTTGGTT 418 CAGACGTGTGCTCTTCCGATCTTTTAATATGGATGCCGTG
419 GG CCR2 GTTGCCCAGTGTGTTTCTGA 420
CAGACGTGTGCTCTTCCGATCTAACCAGGCAACTTGGGA 421 variant A ACT TLR1
CCATTCCGCAGTACTCCATT 422 CAGACGTGTGCTCTTCCGATCTAAGGAAAAGAGCAAACG
423 TGG TLR2 TTGGTTGACTTCATGGATGC 424
CAGACGTGTGCTCTTCCGATCTGGAAACAGCACAAATGA 425 ACTTAA TLR3
CATCATGCAGTTCAACAAGC 426 CAGACGTGTGCTCTTCCGATCTATGCACTCTGTTTGCGAA
427 GA TLR4 GGGTGTGTTTCCATGTCTCA 428
CAGACGTGTGCTCTTCCGATCTTTGAAAGTGTGTGTGTCC 429 GC TLR5
TCAGGCTGTTGCATGAAGAA 430 CAGACGTGTGCTCTTCCGATCTGTATGCCCTTGCTGGACC
431 TA TLR6 ATGCGCAGTAAAAACTCGTG 432
CAGACGTGTGCTCTTCCGATCTTACAGTTCCACGCTGAG 433 CTG TLR7
GCCTGTACTTTCAGCTGGGTA 434 CAGACGTGTGCTCTTCCGATCTAAGGTGTTTGTGCCATTT
435 GG TLR8 GGTGAGCTCTGATTGCTTCA 436
CAGACGTGTGCTCTTCCGATCTTATCAGGAGGCAGGGAT 437 CAC TLR9
GACCGGGTCAGTGGTCTCT 438 CAGACGTGTGCTCTTCCGATCTGGTGATCCTGAGCCCTG 439
AC TLR10 TGCAGTGAGCTGAGATCGAG 440
CAGACGTGTGCTCTTCCGATCTATGGAAAACATCCTCAT 441 GGC GAPDH
CACATGGCCUCCAAGGAGUAA 442 CAGACGTGTGCTCTTCCGATCTCAGCAAGAGCACAAGAG
443 GAA
[0589] Studying Diversity of Response of Human T Cells to In Vitro
Stimulus
[0590] When examining the gene expression pattern of a bulk sample,
the observed pattern was contributed by both the sample's cell
composition and the expression level of each gene in each cell type
or subtype. These two effects cannot be deconvoluted by bulk
analysis but only with large-scale single cell analysis. To
illustrate, we utilized our platform to study the variability of
response of human T cells to an in vitro stimulus.
[0591] We purified CD3+ T cells by negative selection from a blood
donor and stimulated them with anti-CD28/anti-CD3 beads for 6
hours, and performed experiments with the stimulated and a separate
aliquot of unstimulated cells. We designed a panel of 93 genes
(Table 20) that encompassed surface proteins, cytokines,
chemokines, and effector molecules expressed by the different T
cell subsets. A total of 3517 and 1478 single cells were analyzed
for the stimulated and unstimulated samples, respectively.
TABLE-US-00026 TABLE 20 SEQ ID Nested SEQ ID Gene Outer Primer NO:
Primer with Common 5' Flanking Sequence NO: GAPDH
GACTTCAACAGCGACACCCA 444 CAGACGTGTGCTCTTCCGATCTGCCCTCAACGACCACTTTGT
445 CD3D GAAAACGCATCCTGGACCCA 446
CAGACGTGTGCTCTTCCGATCTTGATGTCATTGCCACTCTGCT 447 CD3E
AAGTTGTCCCCCATCCCAAA 448
CAGACGTGTGCTCTTCCGATCTCTGGGGATGGACTGGGTAAAT 449 CD8A
ACTGCTGTCCCAAACATGCA 450
CAGACGTGTGCTCTTCCGATCTATGCCTGCCCATTGGAGAGAA 451 CD8B
CCACCATCTTTGCAGGTTGC 452 CAGACGTGTGCTCTTCCGATCTGCTGTCCAGTTCCCAGAAGG
453 CD4 CTGGGAGAGGGGGTAGCTAG 454
CAGACGTGTGCTCTTCCGATCTACCACTTCCCTCAGTCCCAA 455 FOXP3
ACAGAAGCAGCGTCAGTACC 456 CAGACGTGTGCTCTTCCGATCTGGGTCTCTTGAGTCCCGTG
457 CCR7 GGGGAGAGTGTGGTGTTTCC 458
CAGACGTGTGCTCTTCCGATCTCTCTTGGCTCCACTGGGATG 459 CD5
ATCAATGGTCCAAGCCGCAT 460 CAGACGTGTGCTCTTCCGATCTAGGTCACAGATCTTCCCCCG
461 IL32 CTTTCCAGTCCTACGGAGCC 462
CAGACGTGTGCTCTTCCGATCTTGCTCTGAACCCCAATCCTC 463 CD28
ACCATCACAGGCATGTTCCT 464 CAGACGTGTGCTCTTCCGATCTTGTAGATGACCTGGCTTGCC
465 SELL GCATCTCATGAGTGCCAAGC 466
CAGACGTGTGCTCTTCCGATCTCCTGCCCCCAGACCTTTTATC 467 CD27
TGCAGAGCCTTGTCGTTACA 468 CAGACGTGTGCTCTTCCGATCTCGTGACAGAGTGCCTTTTCG
469 GZMB AGGTGAAGATGACAGTGCAGG 470
CAGACGTGTGCTCTTCCGATCTAGGCCCTCTTGTGTGTAACA 471 GZMA
GGAACCATGTGCCAAGTTGC 472 CAGACGTGTGCTCTTCCGATCTCCTTTGTTGTGCGAGGGTGT
473 GZMH AGTGTTGCTGACAGTGCAGA 474
CAGACGTGTGCTCTTCCGATCTCCAAAGAAGACACAGACCGGT 475 GZMK
TTGCCACAAAGCCTGGAATC 476 CAGACGTGTGCTCTTCCGATCTAAAGCAACCTTGTCCCGCCT
477 PRF1 GGAGTCCAGCGAATGACGTC 478
CAGACGTGTGCTCTTCCGATCTCATGGCCACGTTGTCATTGT 479 NKG2D
CAACACCCAGGGGATCAGTG 480 CAGACGTGTGCTCTTCCGATCTCCACCCTCCACAGGAAATTG
481 LAG3 AGCTGTACCAGGGGGAGAG 482
CAGACGTGTGCTCTTCCGATCTCTTTGGAGAAGACAGTGGCGA 483 CD160
GGAAGACAGCCAGATCCAGTG 484
CAGACGTGTGCTCTTCCGATCTTTGTGCAGACCAAGAGCACC 485 CD244
GGGCTGAGAATGAGGCAGTT 486 CAGACGTGTGCTCTTCCGATCTGGAAAGCGACAAGGGTGAAC
487 EOMES ACTTAACAGCTGCAGGGGC 488
CAGACGTGTGCTCTTCCGATCTACTAACTTGAACCGTGTTTAAGG 489 TBX21
TTATAACCATCAGCCCGCCA 490 CAGACGTGTGCTCTTCCGATCTAGAAAAGGGGCTGGAAAGGG
491 PRDM1 ACCAAAGCATCACGTTGACAT 492
CAGACGTGTGCTCTTCCGATCTACATGTGAATGTTGAGCCCA 493 IRF4
CTCTTCAGCATCCCCCGTAC 494 CAGACGTGTGCTCTTCCGATCTGCCCCCAAATGAAAGCTTGA
495 ZNF683 GGAGAGCGTCCATTCCAGTG 496
CAGACGTGTGCTCTTCCGATCTATCCACCTGAAGCTGCACC 497 ZBED2
AATGTACCAGCCAGTCAGCG 498 CAGACGTGTGCTCTTCCGATCTGGTTTTGGTGGAGCTGACGA
499 CD30 TTTACTCATCGGGCAGCCAC 500
CAGACGTGTGCTCTTCCGATCTTGTTTGCCCAGTGTTTGTGC 501 CD69
GCTGTAGACAGGTCCTTTTCG 502
CAGACGTGTGCTCTTCCGATCTAGTGTTGGAAAATGTGCAATATG 503 TG HLA-DRA
GGGTCTGGTGGGCATCATTA 504 CAGACGTGTGCTCTTCCGATCTGCCTCTTCGATTGCTCCGTA
505 CD38 AGGTCAATGCCAGAGACGGA 506
CAGACGTGTGCTCTTCCGATCTATCAGCATACCTTTATTGTGATC 507 TATC TNFRSF9
TGGCATGTGAGTCATTGCTC 508 CAGACGTGTGCTCTTCCGATCTTTTTGATGTGAGGGGCGGAT
509 MKI67 TACTTTTTCGCCTCCCAGGG 510
CAGACGTGTGCTCTTCCGATCTTCCTGCCCCACCAAGATCAT 511 BIRC5
TGCCACGGCCTTTCCTTAAA 512 CAGACGTGTGCTCTTCCGATCTTTGTCTAAGTGCAACCGCCT
513 FOSL1 CTCCTGACAGAAGGTGCCAC 514
CAGACGTGTGCTCTTCCGATCTGGTGATTGGACCAGGCCATT 515 MCL1
GACTGGCTACGTAGTTCGGG 516 CAGACGTGTGCTCTTCCGATCTTTTGCTTAGAAGGATGGCGC
517 MYC AGCTACGGAACTCTTGTGCG 518
CAGACGTGTGCTCTTCCGATCTCAACCTTGGCTGAGTCTTGA 519 TYMS
TCAGTCTTTAGGGGTTGGGC 520
CAGACGTGTGCTCTTCCGATCTATGTGCATTTCAATCCCACGTAC 521 CDCA7
CCAGTCTAGTTTCTGGGCAGG 522
CAGACGTGTGCTCTTCCGATCTATGTAAACCATTGCTGTGCCATT 523 UHRF1
CCAGTTCTTCCTGACACCGG 524
CAGACGTGTGCTCTTCCGATCTCCAAAGTTTGCAGCCTATACC 525 SAP30
ACCAACCAGACCAGGACTTA 526
CAGACGTGTGCTCTTCCGATCTTCACTAGGAGACGTGGAATTG 527 CX3CR1
CACCCGTCCAGACCTTGTT 528
CAGACGTGTGCTCTTCCGATCTTGTTTTCCTCTTAACGTTAGACC 529 AC BCL2
TGCAAGAGTGACAGTGGATTG 530
CAGACGTGTGCTCTTCCGATCTGCTGATATTCTGCAACACTGTAC 531 A BCL6
TGTCCTCACGGTGCCTTTT 532 CAGACGTGTGCTCTTCCGATCTGTAGGCAGACACAGGGACTT
533 FASLG CCTCAAGGGGGACTGTCTTTC 534
CAGACGTGTGCTCTTCCGATCTGCATATCCTGAGCCATCGGT 535 FAS
ATTGCTGGTAGAGACCCCCA 536 CAGACGTGTGCTCTTCCGATCTCCCCCATTTCCCCGATGT
537 CCL4 CCCAGCCAGCTGTGGTATTC 538
CAGACGTGTGCTCTTCCGATCTTGGAACTGAACTGAGCTGCT 539 IFNG
CTAGGCAGCCAACCTAAGCA 540 CAGACGTGTGCTCTTCCGATCTCCTGCAATCTGAGCCAGTGC
541 TNF AGTGGACCTTAGGCCTTCCT 542
CAGACGTGTGCTCTTCCGATCTGGCTCAGACATGTTTTCCGTG 543 IL2
TCACTTAAGACCCAGGGACTT 544
CAGACGTGTGCTCTTCCGATCTAAGCATCATCTCAACACTGACTT 545 IL4
ACCATGAGAAGGACACTCGC 546 CAGACGTGTGCTCTTCCGATCTCGGGCTTGAATTCCTGTCCT
547 IL6 CGGCAAATGTAGCATGGGC 548
CAGACGTGTGCTCTTCCGATCTGGAAAGTGGCTATGCAGTTTG 549 IL1A
GGCATCCTCCACAATAGCAGA 550
CAGACGTGTGCTCTTCCGATCTGCATTTTGGTCCAAGTTGTGC 551 IL1B
CTTAAAGCCCGCCTGACAGA 552 CAGACGTGTGCTCTTCCGATCTACATTCTGATGAGCAACCGC
553 IL3 ACAGACGACTTTGAGCCTCG 554
CAGACGTGTGCTCTTCCGATCTATTTCACCTTTTCCTGCGGC 555 IL13
GGAGCCAAGGGTTCAGAGAC 556 CAGACGTGTGCTCTTCCGATCTTGCTACCTCACTGGGGTCCT
557 IL31 GGCCATCTCTTCCTTTCGGA 558
CAGACGTGTGCTCTTCCGATCTGTGTGGGAACTCTGCCGTG 559 IL24
CTCACCCCATCATCCCTTTCC 560
CAGACGTGTGCTCTTCCGATCTGCCCAGTGAGACTGTGTTGT 561 IL26
TACTGACGGCATGTTAGGTG 562 CAGACGTGTGCTCTTCCGATCTTGTGTGTGGAGTGGGATGTG
563 LTA AGGCAGGGAGGGGACTATTT 564
CAGACGTGTGCTCTTCCGATCTGGAGAAACAGAGACAGGCCC 565 IL5
GCAGTGAGAATGAGGGCCA 566 CAGACGTGTGCTCTTCCGATCTAGGCATACTGACACTTTGCC
567 CSF2 AGCCAGTCCAGGAGTGAGAC 568
CAGACGTGTGCTCTTCCGATCTGGCCACACTGACCCTGATAC 569 IL21
CCCAAGGTCAAGATCGCCAC 570 CAGACGTGTGCTCTTCCGATCTCTGCCAGCTCCAGAAGATGT
571 IL22 TGGGAAGCCAAACTCCATCAT 572
CAGACGTGTGCTCTTCCGATCTGGAAACCAATGCCACTTTTGT 573 IL17A
GCCTTCAAGACTGAACACCGA 574
CAGACGTGTGCTCTTCCGATCTGCCCCTCAGAGATCAACAGAC 575 IL17F
TTGGAGAAGGTGCTGGTGAC 576 CAGACGTGTGCTCTTCCGATCTCTTACCCAGTGCTCTGCAAC
577 TGFB1 TATTCCTTTGCCCGGCATCA 578
CAGACGTGTGCTCTTCCGATCTACCTTGGGCACTGTTGAAGT 579 CCL20
ACTTGCACATCATGGAGGGT 580
CAGACGTGTGCTCTTCCGATCTTCCATAAGCTATTTTGGTTTAGT 581 GC IL12A
GGTCCCTCCAAACCGTTGTC 582
CAGACGTGTGCTCTTCCGATCTGAACTAGGGAGGGGGAAAGAAG 583 CXCL12
TGGGAGTTGATCGCCTTTCC 584
CAGACGTGTGCTCTTCCGATCTCTCATTCTGAAGGAGCCCCAT 585 CCL3
TGGACTGGTTGTTGCCAAAC 586 CAGACGTGTGCTCTTCCGATCTCTCTGAGAGTTCCCCTGTCC
587 CCL14 TTCCTCCTCATCACCATCGC 588
CAGACGTGTGCTCTTCCGATCTCTTACCACCCCTCAGAGTGC 589 CCL18
GAAGCTGAATGCCTGAGGGG 590 CAGACGTGTGCTCTTCCGATCTGTCCCATCTGCTATGCCCA
591 CCL17 GAGTGCTGCCTGGAGTACTT 592
CAGACGTGTGCTCTTCCGATCTCTCACCCCAGACTCCTGACT 593 IL12B
GCTATGGTGAGCCGTGATTG 594 CAGACGTGTGCTCTTCCGATCTTCCTCACCCCCACCTCTCTA
595 CXCR3 GACCTCAGAGGCCTCCTACT 596
CAGACGTGTGCTCTTCCGATCTCCAATATCCTCGCTCCCGG 597 IL33R
TTCAGGACTCCCTCCAGCAT 598 CAGACGTGTGCTCTTCCGATCTAGGTACCAAATGCCTGTGCC
599 IL4R TGAACTTCAGGGAGGGTGGT 600
CAGACGTGTGCTCTTCCGATCTTCCTCGTATGCATGGAACCC 601 CCR4
CCAAAGGGAAGAGTGCAGGG 602
CAGACGTGTGCTCTTCCGATCTATTCTGTATAACACTCATATCTT 603 TGCC
IL23R AGAATCATTAGGCCAGGCGTG 604
CAGACGTGTGCTCTTCCGATCTCTGGCCAATATGCTGAAACCC 605 IL21R
ATTTGAGGCTGCAGTGAGCT 606 CAGACGTGTGCTCTTCCGATCTAGACAAGAGCTGGCTCACCT
607 CXCR5 CCTCCCCAGCCTTTGATCAG 608
CAGACGTGTGCTCTTCCGATCTTCCTCGCAAGCTGGGTAATC 609 IL6R
CCAGCACCAGGGAGTTTCTA 610 CAGACGTGTGCTCTTCCGATCTACAGCATGTCACAAGGCTGT
611 CXCL13 AGGCAGATGGAACTTGAGCC 612
CAGACGTGTGCTCTTCCGATCTGCATTCGAAGATCCCCAGACTT 613 LIF
TCCCCATCGTCCTCCTTGTC 614 CAGACGTGTGCTCTTCCGATCTTTGCCGGCTCTCCAGAGTA
615 PTPRCv1 GTTCCCATGTTAAATCCCATTCAT 616
CAGACGTGTGCTCTTCCGATCTTACCAGGAATGGATGTCGCTAA 617 (CD45RA) TCA
PTPRCv2 ACCCTCTCTCCCTCCCTTTC 618
CAGACGTGTGCTCTTCCGATCTTAGTTGGCTATGCTGGCATG 619 (CD45RO) IL10
CCCCAACCACTTCATTCTTG 620
CAGACGTGTGCTCTTCCGATCTTTCAATTCCTCTGGGAATGTT 621 CD40LG
CCTCCCCCAGTCTCTCTTCT 622 CAGACGTGTGCTCTTCCGATCTGAGTCAGGCCGTTGCTAGTC
623
[0592] In the unstimulated sample, PCA analysis revealed two major
subsets of cells. A closer look at the genes enriched in each
subset showed that one subset represented CD8+ cells with
expression of CD8A, CD8B, NKG2D, GZMA, GZMH, GZMK, and EOMES, and
the other subset represented CD4+cells with expression of CD4, CCR7
and SELL (FIG. 44A and FIG. 45).
[0593] In the stimulated sample, two branches of cells were
immediately clear on the PCA plot (FIG. 44B and FIG. 46A-D). The
first principal component represented the degree of response of
individual cells to stimulant in terms of varying level of
expression of IFNG, TNF, CD69, and GAPDH. Expression of CCL3, CCL4,
and GZMB, which are cytokines and effector molecules associated
with cytotoxic T cells, and LAG3, a marker associated with
exhausted cells, was localized to cells in the upper branch.
Expression of IL2, LTA, CD4OLG, and CCL20, which are cytokines
associated with helper T cells, was localized to the lower branch.
Other genes that have been known to be upregulated in activated T
cells, including ZBED2, IL4R, PRDM1, TBX21, MYC, FOSL1, CSF2,
TNFRSF9, BCL2 and FASLG, were expressed in various degrees in a
smaller number of cells (FIG. 46A-D). Most of these cytokines,
effector molecules, and transcription factors were not expressed or
were expressed at very low levels by cells in the unstimulated
sample. While most of the cells that responded within this short
period of stimulation were presumably memory cells, we observed a
small population of cells that produced lower level of IL2 and not
other cytokines nor effector molecules, and may represent naive
cells (FIG. 44B, arrow).
[0594] To fully appreciate the heterogeneity in response, we
clustered the cells based on a pair-wise correlation coefficient.
While the two main groups of CD4 and CD8 cells were obvious, there
was considerable diversity within each set in terms of the
combination and level of activated genes expressed (FIG. 47 and
FIG. 48).
[0595] We observed that there were a few cytokines, namely IL4,
ILS, IL13, IL17F, IL22, LW, IL3, and IL21, that were upregulated by
a few hundred or more folds in the stimulated sample as a whole as
compared to the unstimulated one, but were contributed only by a
few cells in the sample (FIG. 44C). Subsets of these cytokines were
expressed by the same cells (FIG. 49A-C). For instance, the same
single cell contributed to most of the counts of IL17F and IL22,
which were signatures for Th17 cells. Another 7 cells expressed
various combinations of IL4, ILS, IL13, which were signatures of
Th2 cells, and expressed various combinations of them. Such
observation highlights the importance of large-scale single cell
analysis, especially when the contribution to overall expression
changes was derived from a rare subpopulation.
[0596] We repeated the same stimulation experiment with T cells
from a second blood donor and analyzed the profile of 669 and 595
single cells in the stimulated and unstimulated sample,
respectively. While the overall level of activation was lower
(smaller magnitude in terms of change in expression) in this
individual (possibly indicating inter-individual variability to
stimulation), we observed the same trends in PCA analysis, as well
as heterogeneity in individual cell's response to stimulus (FIG.
48).
Identification of Rare Antigen Specific T Cells
[0597] We demonstrated the utility of our platform to identify rare
cells using the model of antigen specific cells in CD8+ T cell
population. We exposed fresh blood of the same two blood donors who
were seropositive for cytomegalovirus (CMV) to CMV pp65 peptide
pool. A separate untreated blood aliquot of each donor served as
negative control. We subsequently isolated CD8+ T cells and
analyzed the response of stimulated and unstimulated cells on our
platform. We obtained data from 2274, 2337, 581, and 253 cells in
donor 2's CMV stimulated and unstimulated, and donor 1's CMV
stimulated and unstimulated samples, respectively.
[0598] Except for donor 1's negative control that yielded
relatively small number of cells to form obvious clusters in
clustering analysis, all the rest of the samples showed two main
groups of cells (FIGS. 50A, 51 and 52). Cells in one group
expressed naive cell and central memory associated markers SELL,
CCR7, and CD27, while cells in the other group expressed effector
memory cell (CCL4, CX3CR1, CXCR3) and effector cell associated
genes (EOMES, GZMA, GZMB, GZMH, TBX21, ZNF683). There was a
distinct small subset of cells that occupy space in between the two
branches and express granzyme K (GZMK), as well as another subset
of HLA-DRA expressing cells. The differential expression of the
different types of granzymes has previously been reported (8). Our
results recapitulated those observed in previous CyTOF experiments
with CD8+ T cells (9).
[0599] While a considerable proportion of cells seemed to respond
to the exposure to the antigen via expression CD69 and MYC (FIG.
52), we found only a few cells that expressed IFNG, a signature
cytokine for activated antigen specific cell. Most of the IFNG
expressing cells were also among those cells carried the most total
detected transcript molecules in the gene panel, an indication of
active cell state, and belong to the effector memory/effector cell
cluster (FIGS. 50B and 53). We identified 5 out of 581 (0.86%) and
2 out of 2274 (0.09%) cells in donors 1 and 2 respectively that
were likely to be CMV specific based on IFNG expression and overall
transcription level. Among those cells, there was substantial
amount of heterogeneity in terms of combinations and levels of
effector molecules (e.g., granzymes) and cytokines (e.g., IFNG,
IL2, CCL3, CCL4, TNF, CSF2, IL4) expressed (FIG. 54). Interesting,
the single cell that expressed most transcripts in donor 2
expressed both IL6 and IL1B but not IFNG.
Discussion
[0600] In this example, we presented highly scalable mRNA cytometry
that used a recursive Poisson strategy to isolate single cells, to
uniquely barcode cellular content, and to barcode individual
molecules for quantitative analysis. We have shown that we may
simultaneously identify and count transcript molecules belonging to
each cell in a sample containing a few thousands cells. Further, we
have demonstrated to use of this technique to characterize
individual cells based on their expression profiles in naturally
occurring heterogeneous systems, and detection of rare cells in a
large background population.
[0601] The throughput and simplicity of CytoSeq presents a major
advance over existing approaches involving microtiter plates or
microfluidic chips for sequencing based measurement of gene
expression of single cells. Because the experimental procedure is
simple and reagent consumption per cell is low (in the nanoliter
range), it enables one to readily carry out single cell analysis
for large number of cells across multiple conditions. In this study
alone, we performed gene expression profiling of a total of about
14,600 single cell across 12 experiments, which would be costly and
time-consuming if carried out by existing approaches. The number of
cells measured by CytoSeq may be further scaled up simply by
increasing the size of the microwell array and the library size of
the barcoded beads, which is readily achieved by combinatorial
synthesis. In addition, there is no restriction on the uniformity
of cell sizes, thus allowing direct analysis of complex samples
containing cells with a variety of cell sizes and shapes, such as
PBMCs shown in this example, without any pre-sorting.
[0602] CytoSeq data resembled those of flow cyometry (FC), but with
important differences. First, CytoSeq offers more versatility in
terms of the number and type of gene products studied. Unlike flow
cytometry that is confined mostly to a handful of surface proteins
and requires optimally binding antibodies, CytoSeq allowed
measurement of any transcribed mRNAs via nucleic acid amplification
techniques. Optimal primer design and assay conditions enable us to
routinely achieve about 88% mapped rate via multiplex PCR for an
arbitrarily chosen panel of 100 or more genes (Table 21).
Additionally, the entire transcriptome of each single cell in the
sample may also be measured via universal amplification of the bead
bound cDNA, although one has to be mindful with the relatively low
efficiency of commonly used universal amplification techniques (7)
and the high sequencing depth required for measuring the whole
transcriptome across thousands of cells.
[0603] Second, in contrast to flow cytometry that relies on the
kinetics of antibody binding, CytoSeq provides digital, absolute
readout of gene expression level through molecular indexing. It has
higher sensitivity and specificity to a single rare cell event
because the detection was achieved by the co-expression of large
number of genes specific to the rare cells. It therefore consumes
much smaller amount of sample as compared to flow cytometry that
requires certain number of events in order to form reliable
clusters for gating.
[0604] Our data illustrates the importance of single cell versus
bulk analysis. For instance, we showed scenarios where the most
highly expressed genes in a sample of thousands of cells as whole
were contributed by only one or a few cells. Most importantly, our
experiments illustrate the importance of examining both large
number of cells and large number of genes in single cell gene
expression studies, an ability that is extremely limiting in prior
approaches. The availability of such a tool for the routine
measurement of expression across thousands of single cells in a
biological sample may help accelerate the understanding of complex
biological systems and drive novel applications in clinical
diagnostics, such as circulating tumor cell analysis and immune
responses monitoring. We envision that our massive parallel single
cell barcoding regime may also be adopted to measure the genome, as
well as the genome and the transcriptome simultaneously, for
studying single cell genome instability in areas such as cancer
biology and neuroscience.
TABLE-US-00027 TABLE 21 number of number of number of number of
reads with reads with unique cell reads exactly 1 % reads exact
match to a % read barcodes associated total match to aligned to
cell barcode and after gene that satisfy with those number of gene
in one gene in alignment to and barcode filtering cell Experiment
reads panel the panel one gene alignment criteria barcodes K562 +
Ramos 2399025 2154454 90% 1175715 49% 768 859470 Primary B +
5711013 5203308 91% 3495392 61% 1198 2868577 Ramos PBMC 1270214
1105687 87% 803151 63% 632 670576 PBMC replicate 3927672 3468538
88% 2459367 63% 731 1920956 Donor 1 3529898 3249998 92% 2122416 60%
3517 1466000 antiCD3/antiCD2 8 stimulated Donor 1 1557996 1292211
83% 939094 60% 1478 719351 antiCD3/antiCD2 8 negative control Donor
2 606865 552877 91% 403943 67% 669 246234 antiCD3/antiCD2 8
stimulated Donor 2 332951 283723 85% 205762 62% 595 86866
antiCD3/antiCD2 8 negative control Donor 1 CMV 1064648 958410 90%
697057 65% 581 401629 stimulated Donor 1 CMV 619957 547259 88%
406801 66% 253 192605 negative control Donor 2 CMV 1902977 1692734
89% 1229667 65% 2274 688296 stimulated Donor 2 CMV 1671419 1346637
81% 977344 58% 2337 715453 negative control
Synthesis of Bead Library
[0605] Beads were manufactured by Cellular Research, Inc. using a
split-pool combinatorial approach. Briefly, twenty-micron magnetic
beads functionalized with carboxyl groups were distributed into a
96 tubes containing oligos with 5' amine, followed by a universal
sequence, first part of the cell label that is different for
different tubes, and a linker sequence. The oligos were covalently
coupled onto the beads by carbodiimide chemistry. Beads were pooled
and split into a second set of 96 tubes containing oligos with a
second linker sequence on the 5' end, followed by the second part
of the cell label that is different for different tubes, and
complementary sequence to the first linker. Oligos on the beads
were extended by DNA polymerase upon hybridization to oligos in
solution via the first linker. Beads were pooled and split into a
third set of 96 tubes containing oligos with oligo(dA) on the 5'
end, followed by a randomer sequence that serves as the molecular
label, the third part of the cell label, and a complementary
sequence to the second linker. Oligos on the beads were extended by
DNA polymerase upon hybridization to oligos in solution via the
second linker. The final bead library has a size of
96.times.96.times.96 (884,736) cell labels.
Fabrication of Microwell Array
[0606] Microwell arrays were fabricated using standard
photolithography. Arrays of pillars were patterned on photoresist
on silicon wafer. PDMS was poured onto the wafer to create arrays
of microwells. Replicas of the wafer were made with NOA63 optical
adhesive using PDMS microwell array as template. Agarose (5%, type
IX-A, Sigma) microwell arrays were casted from the NOA63 replica
before each experiment.
Sample Preparation
[0607] K562 and Ramos cells were cultured in RPMI-1640 with 10% FBS
and 1.times.antibiotic-antimycotic. Primary B cells from a healthy
donor were purchased from Sanguine Biosciences. PBMCs from a
healthy donor were isolated from fresh whole blood in sodium
heparin tube acquired from the Stanford Blood Center using
Lymphoprep solution (StemCell).
T Cell Stimulation
[0608] Heparinized whole blood of two CMV seropositive blood donors
was obtained from the Stanford Blood Center. For CMV stimulation, 1
ml of whole blood was stimulated with CMV pp65 peptide pool diluted
in PBS (Miltenyi Biotec) at a final concentration of 1.81 .mu.g/ml
for 6 hours at 37 C. A separate aliquot of whole blood of each
donor was incubated with PBS as negative controls. CD8+ T cells
were isolated using RosetteSep cocktail (StemCell) and subsequently
deposited onto microwell arrays. For anti-CD3/anti-CD28
stimulation, T cells from the same two donors were isolated from
whole blood using RosetteSep T cell enrichment cocktail and
resusupended in RPMI-1640 with 10% FBS and
1.times.antibiotic-antimycotic. One aliquot of cells from each
donor was incubated with Dynabeads Human T-Activator CD3/CD28 (Life
Technologies) at about 1:1 bead to cell ratio at 37 C for 6 hours.
A separate aliquot of cells from each donor were placed in
incubator with no stimulation and served as negative control.
Single Cell Capture
[0609] Single cell suspension was pipetted on to the microwell
array at a density of about 1 cell per 10 microwells. After washing
to remove uncaptured cells, magnetic beads were loaded at a density
of about 5 beads per well to saturate the microwell array. After
washing to remove excess beads, cold lysis buffer (0.1M Tris-HC1 pH
7.5, 0.5M LiCl, 1% LiSDS, 10 mM EDTA, 5 mM DTT) was pipetted over
the surface of the microwell array. After 10 minutes of incubation
on a slide magnet, beads were retrieved from the microwell array.
Beads were collected in a microcentrifuge tube, and washed twice
with wash A buffer (0.1M Tris-HCl, 0.5M LiCl, mM EDTA) and once
with wash B buffer (20 mM Tris-HCl pH 7.5, 50 mM KCl, 3 mM MgCl2).
From this point forward, all reactions were carried out in a single
tube.
cDNA Synthesis
[0610] Washed beads were resupsended in 404 RT mix (1.times.First
Strand buffer, 1 .mu.L SuperRase Inhibitor, 1 .mu.L SuperScript II
or SuperScript III, 3 mM additional MgC12, 1 mM dNTP, 0.2 ug/.mu.L
BSA) in a microcentrifuge tube placed on a rotor in a hybridization
oven at temperatures 50 C for 50 minutes (when using SuperScript
III for the early experiment with K562 and Ramos cells) or 42 C for
90 minutes (when using Superscript II for the rest of the
experiments). Beads were treated with 1 .mu.L of Exol (NEB) in 20
.mu.L, of 1.times.Exol buffer at 37.degree. C. for 30 minutes, and
80.degree. C. for 15 minutes.
Multiplex PCR and Sequencing
[0611] Each gene panel contained two sets of gene specific primers
designed by Primer3. A custom MATLAB script was written to select
PCR primers such that there was minimal 3' end complementarity
across the primers within the set. Primers in each panel are listed
in Table 21. The amplification scheme is shown in FIG. 55. PCR were
performed with the beads with KAPA Fast Multiplex Kit, with 50 nM
of each gene specific primer in the first primer set and 400 nM
universal primer, in a volume of 100 .mu.L or 200 .mu.L, with the
following cycling protocol: 3 min at 95 C; 15 cycles of 15 s at 95
C, 60s at 60 C, 90 s at 72 C; 5 min at 72 C. Magnetic beads were
recovered and PCR products were purified with 0.7.times.Ampure XP.
Half of the purified products were used for the next round of
nested PCR with the second primer set using the same KAPA kit and
cycling protocol. After clean up with 0.7.times.Ampure XP,
1/10.sup.th of the product was input into a final PCR reaction
whereby the full-length IIlumina adaptors were appended
(1.times.KAPA HiFi Ready Mix, 200 nM of P5, 200 nM of P7. 95 C 5
min; 8 cycles of 98 C 15 s, 60 C 30 s, 72 C 30 s; 72 C 5 min).
Data Analysis
[0612] Sequencing of library was performed on IIlumina MiSeq
instrument with 150.times.2 by chemistry at a median depth of 1.6
million reads per sample. Sequencing revealed the cell label, the
molecular label, and the gene of each read (FIG. 55). The
assignment of gene of each read was done with the alignment
software `bowtie` (ref). The cell and molecular labels of each read
were analyzed using custom MATLAB scripts. Reads were grouped first
by cell label, then by gene and molecular label. To calculate the
number of unique molecules per gene per cell, the molecular labels
of reads with the same cell label and gene assignment were
clustered. Edit distance greater than 1 base was considered as a
unique cluster, and thus a unique transcript molecule. A table
containing digital gene expression information of each cell was
constructed for each sample--each row in the table represented a
unique cell label, each column represented a gene, and each entry
in the table represented the count of unique molecules within a
gene per cell label. The table was filtered such that unique
molecules that were sequenced only once (i.e. redundancy=1) were
removed. Subsequently, cells with a sum of unique molecules less
than 10 or with co-expression of 4 or less genes in the panel were
removed. The filtered table was then used for clustering analysis.
Principal component analysis and hierarchical clustering was
performed on log-transformed transcript count (with pseudocount of
1 added) with built-in functions in MATLAB.
[0613] References cited in Example 15, all of which are
incorporated by reference in their entireties:
[0614] A. K. Shalek et al., Single-cell transcriptomics reveals
bimodality in expression and splicing in immune cells. Nature 498,
236 (Jun. 13, 2013).
[0615] S. C. Bendall et al., Single-cell mass cytometry of
differential immune and drug responses across a human hematopoietic
continuum. Science 332, 687 (May 6, 2011).
[0616] A. R. Wu et al., Quantitative assessment of single-cell
RNA-sequencing methods. Nature methods 11, 41 (January, 2014).
[0617] B. Treutlein et al., Reconstructing lineage hierarchies of
the distal lung epithelium using single-cell RNA-seq. Nature 509,
371 (May 15, 2014).
[0618] S. Islam et al., Characterization of the single-cell
transcriptional landscape by highly multiplex RNA-seq. Genome
research 21, 1160 (July, 2011).
[0619] G. K. Fu, J. Hu, P. H. Wang, S. P. Fodor, Counting
individual DNA molecules by the stochastic attachment of diverse
labels. Proceedings of the National Academy of Sciences of the
United States of America 108, 9026 (May 31, 2011).
[0620] G. K. Fu, J. Wilhelmy, D. Stern, H. C. Fan, S. P. Fodor,
Digital encoding of cellular mRNAs enabling precise and absolute
gene expression measurement by single-molecule counting. Analytical
chemistry 86, 2867 (Mar. 18, 2014).
[0621] K. Bratke, M. Kuepper, B. Bade, J. C. Virchow, Jr., W.
Luttmann, Differential expression of human granzymes A, B, and K in
natural killer cells and during CD8+ T cell differentiation in
peripheral blood. European journal of immunology 35, 2608
(September, 2005).
[0622] E. W. Newell, N. Sigal, S. C. Bendall, G. P. Nolan, M. M.
Davis, Cytometry by time-of-flight shows combinatorial cytokine
expression and virus-specific cell niches within a continuum of
CD8+ T cell phenotypes. Immunity 36, 142 (Jan. 27, 2012).
Example 16
Development of Single Cell Quantification Protocol
[0623] FIG. 56 depicts a general workflow for the quantification of
RNA molecules in a sample. In this example, the total number of RNA
molecules in the sample was equivalent to the total number of RNA
molecules in a single cell. As shown in Step 1 of FIG. 56, RNA
molecules (110) were reverse transcribed to produce cDNA molecules
(105) by the stochastic hybridization of a set of molecular
identifier labels (115) to the polyA tail region of the RNA
molecules. The molecular identifier labels (115) comprised an
oligodT region (120), label region (125), and universal PCR region
(130). The set of molecular identifier labels contained 960
different types of label regions.
Part I. Reverse Transcription and Labeling of RNA Molecules
[0624] An RNA sample was prepared by mixing the following:
TABLE-US-00028 Genes number of RNA molecules Lys (spike-in control)
456 Phe (spike-in control) 912 Thr (spike-in control) 1824 Dap
(spike-in control) 6840 Kan (spike-in control) 7352 Lymphocyte cell
line RNA 10 pg (1 cell equivalent) MS2 carrier (no polyA) 6 .times.
10.sup.11
[0625] RNA molecules were labeled by preparing in an eppendorf tube
a labeling mix as follows:
TABLE-US-00029 Amount (.mu.L) RNA sample 2 ms2 RNA 1 .mu.g/.mu.L 1
10 mM dNTP 1 960 dT oligos pool (set#4) 10 .mu.M 0.4 water 9.1
[0626] Note: dT oligos pool (set #4) refers to the set of molecular
identifier labels.
[0627] The molecular identifier labels were hybridized to the RNA
molecules by incubation at 65.degree. C. for 5 minutes. The
labeling mix was stored on ice for at least 1 minute.
[0628] The labeled RNA molecules were reverse transcribed by the
addition of the reverse transcription mix as described below:
TABLE-US-00030 Amount (.mu.L) 5X first strand buffer 4 0.1M DTT 1
superase-in 20 u/.mu.L 0.5 superscript III RT 1
[0629] Once the reverse transcription mix was added to the
eppendorf tube containing labeling mix reaction, the reverse
transcription reaction was conducted by incubating the sample at
37.degree. C. for 5 minutes, followed by incubation at 50.degree.
C. for 30 minutes, and lastly incubation at 75.degree. C. for 15
minutes. Reverse transcription of the labeled RNA molecules
produced labeled cDNA molecules (170).
[0630] Once the RNA molecules were reverse transcribed and labeled,
excess oligos were removed from the sample by Ampure bead
purification (Step 2 of FIG. 1). Ampure bead purification was
performed by adding 20 .mu.l of ampure beads to the eppendorf tube
containing the reverse transcribed and labeled RNA molecules and
incubating the tube at room temperature for 5 minutes, The beads
were washed twice with 70% ethanol to remove the excess oligos.
Once the excess oligos were removed by the ethanol washes, 20 .mu.l
of 10 mM Tris was added to the tube containing the bead-bound
labeled cDNA molecules.
[0631] As shown in Step 3 of FIG. 56, the labeled cDNA molecules
(170) were amplified by multiplex PCR. Custom amplification of the
labeled cDNA molecules was performed by using a custom forward
primer (F1, 135 in FIG. 1) and a universal PCR primer (140). Table
23 lists the 96 different custom forward primers that were used to
amplify 96 different genes to produce labeled amplicons (180) in a
single reaction volume.
[0632] In order to optimize multiplex PCR reactions, 3 multiplex
PCR reactions mixtures were prepared. Multiplex PCR reaction 1 was
prepared as follows:
TABLE-US-00031 Reaction 1 Amount (.mu.L) 10X titanium 5 10 mM dNTP
1.5 water 35.5 1 .mu.M each F1 primer pool 5 PCR004 10 .mu.M 1
purified cDNA 1 Titanium polymerase 1
[0633] The reaction condition for Multiplex PCR reaction was 1
cycle at 94.degree. C. for 2 min, followed by 25 cycles of
94.degree. C. for 30 sec, 57.degree. C. for 60 sec, and 68.degree.
C. for 1 min, then 1 cycle of 68.degree. C. for 7 min and 1 hold
cycle at 4.degree. C.
[0634] Multiplex PCR reactions 2 and 3 were prepared as
follows:
TABLE-US-00032 Reaction 2 Reaction 3 Amount (.mu.L) Amount (.mu.L)
2X Qiagen Multiplex mix 25 25 1 .mu.M each F1 primer pool 5 5
PCR004 10 .mu.M 1 1 Q solution 5 water 18 13 purified cDNA 1 1
[0635] The multiplex PCR reaction condition for Reactions 2 and 3
was 1 cycle at 95.degree. C. for 15 min, followed by 25 cycles of
94.degree. C. for 30 sec, 57.degree. C. for 90 sec, and 72.degree.
C. for 1 min, then 1 cycle of 68.degree. C. for 7 min and 1 hold
cycle at 4.degree. C.
[0636] The F1 primer pools contained the following primers:
TABLE-US-00033 F1 PCR Primers Sequence SEQ ID NO: 100611KanF2
CTGCCTCGGTGAGTTTTCTC 624 Lys_L_269 CTTCCCGTTACGGTTTTGAC 625
phe_L_177 AAAACCGGATTAGGCCATTA 626 thr_L_332 TCTCGTCATGACCGAAAAAG
627 dap_L_276 CAACGCCTACAAAAGCCAGT 628
[0637] Kan, Phe and Dap control genes were selectively amplified by
nested PCR. Nested PCR amplification reactions were prepared as
follows:
TABLE-US-00034 Multiplex PCR Rxn # 1 2 3 1 2 3 1 2 3 PCR Rxn # 1 2
3 4 5 6 7 8 9 .mu.L .mu.L .mu.L .mu.L .mu.L .mu.L .mu.L .mu.L .mu.L
10x Taq 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 10 mM dNTP 0.5 0.5 0.5
0.5 0.5 0.5 0.5 0.5 0.5 water 22.25 22.25 22.25 22.25 22.25 22.25
22.25 22.25 22.25 Cy3 PCR004 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 10
.mu.M KanF3_5P 5 .mu.M 1 1 1 Phe_L_215 5 .mu.M 1 1 1 Dap_L_290 5
.mu.M 1 1 1 Multiplex PCR Rxn 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5
USB taq 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25
[0638] Note: The multiplex PCR reaction used for PCR reactions 1,
4, and 7 was multiplex PCR reaction #1. The multiplex PCR reaction
used for PCR reactions 2, 5 and 8 was multiplex PCR reaction #2.
The multiplex PCR reaction used for PCR reactions 3, 6 and 9 was
multiplex PCR reaction #3.
[0639] The primers used for nested PCR are disclosed as
follows:
TABLE-US-00035 Nested PCR SEQ primer Sequence ID NO: KanF4_5P
/5Phos/GTGGCAAAGCAAAAGTTCAA 629 Phe_L_215 TGAGAAAGCGTTTGATGATGTA
630 Dap_L_290 GCCAGTTTATCCCGTCAAAG 631
[0640] The PCR amplification reaction condition for Reactions 1-9
was 1 cycle of 94.degree. C. for 2 min, 30 cycles of 94.degree. C.
for 20 sec, 55.degree. C. for 20 sec, and 72.degree. C. for 20 sec,
then 1 cycle at 72.degree. C. for 4 min and 1 hold cycle at
4.degree. C.
[0641] The 4 .mu.l of PCR products of PCR amplification reactions
1-9 were run on an agarose gel. As shown in FIG. 58A, Reactions 1-3
showed the presence of the Kan control gene, Reactions 4-6 showed
the presence of the Phe control gene, and Reactions 7-9 showed the
presence of the Dap control gene.
[0642] The PCR products from PCR reactions 1-9 were prepared for
hybridization to an Applied Microarray Inc. (AMI) array.
Hybridization mixtures were prepared as follows:
TABLE-US-00036 .mu.L PCR product 20 Wash A (6X SSPE + 0.01% Triton
55 X-100) Cy3 Oligo (760 pM) 1
[0643] The hybridization mixtures 1-9, corresponding to the
mixtures containing PCR products from PCR reactions 1-9,
respectively, were denatured at 95.degree. C. for 5 minutes and
then placed at 4.degree. C. The hybridization mixtures were
transferred to an AMI array slide and incubated overnight at
37.degree. C.
[0644] After the overnight hybridization, the AMI array slide was
washed and then scanned. Theoretical and actual measurements and
percent accuracy are depicted below:
TABLE-US-00037 Hybridization mixtures # 1 2 3 4 5 6 7 8 9 Multiplex
Titanium Qiagen Qiagen + Q Titanium Qiagen Qiagen + Q Titanium
Qiagen Qiagen + Q PCR condition (1) (2) (3) (1) (2) (3) (1) (2) (3)
(Rxn #) Theoretical 3676 (bioanalyzer) 912 6840 measurement Actual
1826 1740 2116 299 235 251 1165 1077 172 measurement % detection
49.7 47.3 57.6 32.8 25.8 27.5 17 15.7 2.5
[0645] Note: The theoretical measurement is based on detection of
100% of the Kan, Phe and Dap control genes.
[0646] PCR products from Reaction 2 were purified by Ampure
purification.
[0647] Ampure purification was performed as follows:
TABLE-US-00038 .mu.L F1 PCR products from X01 sample 2 30 Ampure
beads 30
[0648] Ampure purification reactions were incubated at room
temperature for 5 min and then washed in 70% ethanol. Purified PCR
products were eluted from the beads in 30 .mu.l of water. The
concentration of the PCR products was 6 ng/.mu.L as determined by a
Nanodrop spectrometer.
Part II: Library Preparation Protocol
[0649] PCR products purified from the X01 sample 2 (see Example 1)
were used to prepare a DNA library. An F2 primer pool was created
from mixing the following primers:
TABLE-US-00039 F2 PCR Primers Sequence SEQ ID NO: Lys_L_269
CTTCCCGTTACGGTTTTGAC 632 phe_L_177 AAAACCGGATTAGGCCATTA 633
thr_L_332 TCTCGTCATGACCGAAAAAG 634 dap_L_276 CAACGCCTACAAAAGCCAGT
635
[0650] An F2 primer mix was prepared by mixing the following
TABLE-US-00040 F2 primer mix .mu.L water 750 F2 primer pool 1 uM
each/100 uM total 100
[0651] The F2 primer mix was incubated at 95.degree. C. for 3 min
and then stored on ice. The following ligation mix was added to the
F2 primer mix to produce an F2 primer ligation mix:
TABLE-US-00041 Ligation mix .mu.L 10X DNA ligase buffer 100 NEB T4
PNK USB 50
[0652] The F2 primer ligation mix was incubated at 37.degree. C.
for 1 hour, followed by an incubation at 65.degree. C. for 20 min.
The F2 PCR primers were ethanol precipitated and the concentration
of the primer pool was determined by a Nanodrop spectrophotometer.
The F2 primer pool was resuspended to produce a final concentration
of 1 uM each/100 uM total.
[0653] As shown in Step 4 of FIG. 56, the labeled amplicons (180)
were amplified by multiplex PCR. 96 different custom forward
primers (F2, 145 in FIG. 1) and a universal PCR primer (140) were
used to amplify the labeled amplicons (X01 sample 2 from Example 1)
in a single reaction volume. Table 24 lists the 96 different custom
forward primers.
[0654] The multiplex PCR reaction was prepared as follows:
TABLE-US-00042 Multiplex PCR mix .mu.L 2X Qiagen Multiplex mix 25 1
.mu.M each F2 primer pool kinase 5 PCR004 5'P 10 .mu.M 1 water 18
purified first PCR X01 sample 2 1
[0655] The multiplex PCR condition was 1 cycle at 95.degree. C. for
15 min, followed by 18 cycles of 94.degree. C. for 30 sec,
57.degree. C. for 90 sec, and 72.degree. C. for 1 min, then 1 cycle
of 68.degree. C. for 7 min and 1 hold cycle at 4.degree. C. The
multiplexed amplicons were purified by Ampure purification and
eluted with 50 .mu.L of water. The concentration of the amplicons
was determined to be 30 ng/.mu.L by a Nanodrop spectrophotometer. 5
.mu.L of the amplicons was run on an agarose gel (FIG. 58B).
[0656] As shown in Step 5 of FIG. 56, adaptors (150, 155) were
ligated to the labeled amplicons (180) to produce adaptor labeled
amplicons (190). Adaptor labeled amplicons were produced as
follows:
TABLE-US-00043 Adaptor mix .mu.L 10X T4 ligase USB 10 water 60
purified nested PCR product 10 annealed, pooled 96 ABC adaptors 50
.mu.M 10 T4 DNA ligase (3 .mu.l neb hc, 7 .mu.l usb) 10
[0657] The adaptor mix was incubated at 16.degree. C. for 4 hours.
The adaptor labeled amplicons were purified by Ampure purification
and eluted in 20 .mu.L of 10 mM Tris.
[0658] The purified adaptor labeled amplicons were gap-repaired and
PCR amplified as follows:
TABLE-US-00044 Fill-in and PCR mix .mu.L 10x thermoPol buffer 5 10
mM dNTP 1.5 water 32 CR P1 10 .mu.M 3 CR IDX D1 10 .mu.M 3 purified
adaptor labeled 5 amplicons Vent exo- 2 u/.mu.L 0.5
[0659] The PCR condition was 1 cycle of 72.degree. C. for 2 min,
followed by 94.degree. C. for 1 min, 12 cycles of 94.degree. C. for
15 sec, 60.degree. C. for 15 sec and 72.degree. C. for 30 sec, 1
cycle of 72.degree. C. for 4 min and 1 hold cycle at 4.degree. C.
The PCR products were purified by Ampure purification and eluted in
30 .mu.l of TE. The concentration of the purified PCR product was
22 ng/.mu.L (83 nM) as determined by Nanodrop spectroscopy. 5 .mu.L
of the PCR purified products were run on a 1% agarose gel (FIG.
58B)
Part III. Sequencing of the Adaptor Labeled Amplicon Library
[0660] The adaptor labeled amplicon library was sequenced using a
MiSeq Sequencer.
[0661] A sequence mapping summary is shown below:
TABLE-US-00045 Require Perfect Allow 1 bp Match mismatch Total Read
Pairs 7,724,955 # of RNA with universal 2,499,444 (32%) 4,716,378
(61%) primer and polyA match # of RNA mapped to 2,373,700 4,489,485
targets (96 genes)
[0662] As shown in the sequence mapping summary above, many reads
were lost due to the stringent polyA matching criteria. FIG. 59
shows the reads and counts across all detected genes.
[0663] Sequencing reads were also used to quantify specific genes.
FIG. 61-62 depict a plot of the reads observed per label detected
(RPLD) for various genes. Conventional rpkm values are also shown
in the plots depicted in FIG. 61-62. FIG. 59 summarizes a
comparison of RPLD and RPKM for various genes.
[0664] FIG. 63 depicts a plot of total reads (labels) versus rpld
for various genes.
[0665] The data represented in FIGS. 4, 7 and 8 are also shown in
numerical form in Table 25.
[0666] FIG. 64 depicts a plot of RPKM for undetected genes.
[0667] The quantity of the spike-in controls in the adaptor labeled
amplicon library was determined by MiSeq sequencing. Results from
MiSeq sequencing of the spike-in controls are shown in the table
below.
TABLE-US-00046 Spike-in Control input N (mfg) Reads Labels (K) Dap
6840 1,920,503 893 Phe 912 470,738 859 Thr 1824 410,664 847 Lys 456
282,174 847 Kan 7352 24 23
[0668] In the table above, input N refers to the original number of
the spike-in control; Reads refers to the total number of read
pairs; and Labels (K) refers to the number of different labels
detected by sequencing. FIG. 60A-D depicts a plot of the reads
observed per label detected (RPLD) for Lys, Phe, Thr, and Dap
spike-in controls, respectively. FIG. 60E depicts a plot of Reads
versus Input.
TABLE-US-00047 TABLE 23 SEQ ID Name Sequence NO: NM_144646.3F1
TTGACTTTGCCTTGGAGAGC 636 NR_015342.1F1 TTTTTCTTACAGTGTCTTGGCATA 637
NM_000193.2F1 CGTGACCCTAAGCGAGGAG 638 NM_001777.3F1
TTTGCAGTGATTTGAAGACCA 639 NM_000600.3F1 GGCATTCCTTCTTCTGGTCA 640
NM_021127.2F1 CTGGGCTATATACAGTCCTCAAA 641 NM_004318.3F1
GGGGTGATTATGACCAGTTGA 642 NM_002467.4F1 TGCATGATCAAATGCAACCT 643
NM_001773.2F1 TCTTCCGAAAAATCCTCTTCC 644 NM_001770.5F1
CTGGGGTCCCAGTCCTATG 645 NM_001718.4F1 TGTACTGGGAAGGCAATTTCA 646
NR_023920.1F1 GAGCCGCTGGGGTTACTC 647 NM_000267.3F1
CAGTTAGTTGCTGCACATGGA 648 NM_000633.2F1 TTGCATTTCTTTTGGGGAAG 649
NM_000314.4F1 GTCATGCATGCAGATGGAAG 650 NM_021151.3F1
GCTGCAGTGAGCTGTGATGT 651 NM_002415.1F1 GTTCCTCTCCGAGCTCACC 652
NM_004985.3F1 TCCGAAAGTTTCCAATTCCA 653 NM_005375.2F1
TTGTTTGGGAGACTCTGCATT 654 NM_000555.3F1 GACCCCACTTGGACTGGTAG 655
NM_001668.3F1 GTGATCTTGATTGCGGCTTT 656 NM_025237.2F1
GGGGGAAAAACTACAAGTGC 657 NM_021117.3F1 TGATTCCTTTTCCTGCCTGT 658
NM_016316.2F1 AAAAACCTCCAGGCCAGACT 659 NM_021975.3F1
AATCAAAATAACGCCCCAGA 660 NM_004333.4F1 TTGCTAAAAATTGGCAGAGC 661
NM_001621.4F1 TTGTTAAGTGCCAAACAAAGGA 662 NM_005239.5F1
AAGCTGGGAAGAGCAAAGC 663 NM_000485.2F1 AGGACAGAGGGTGGTCGTC 664
NM_004048.2F1 TGAGTGCTGTCTCCATGTTTG 665 NM_001657.2F1
CCTCACAGCTGTTGCTGTTATT 666 NM_012238.4F1 AAAACACCCAGCTAGGACCA 667
NM_002055.4F1 AACTGAGGCACGAGCAAAGT 668 NM_002392.4F1
GCTTTATGGGTGGATGCTGA 669 NM_001625.3F1 ATAATATCGCCAGCCTCAGC 670
NM_002110.3F1 TCCAGAGTGTGCTGGATGAC 671 NM_002943.3F1
TGCAAGCCATTTATGGGAAT 672 NM_000059.3F1 TGGAATGAGGTCTCTTAGTACAGTT
673 NM_018136.4F1 TCCCAGAAACACCTGTAAGGA 674 NM_003467.2F1
TGTCTAGGCAGGACCTGTGG 675 NM_004958.3F1 AGTGATGCTGCGACTCACAC 676
NM_006139.3F1 GGCTCAGAAAGTCTCTCTTTCC 677 NM_002693.2F1
CTCCCAAACTCAGGCTTTCA 678 NM_001080432.2F1 AAAGCGCTGGGATTACAGG 679
NM_005954.2F1 CGTCCAGTTGCTTGGAGAAG 680 NM_024865.2F1
AATAACCTTGGCTGCCGTCT 681 NM_001905.2F1 GGGAATTCTCAGTGCCAACT 682
NM_002046.4F1 GCATCCTGGGCTACACTGAG 683 NM_002253.2F1
TGCTGGGAACAATGACTATAAGA 684 NM_002356.5F1 GCCTAAAACACTTTGGGTGGT 685
NM_000189.4F1 GGGTGCCCACAAAATAGAGA 686 NM_000546.5F1
GAGACTGGGTCTCGCTTTGT 687 NM_152860.1F1 TGGGGAAGGCTTTCTCTAGG 688
NM_016231.4F1 TTCAACTTGAGTGATCTGAGCTG 689 NM_000518.4F1
TATGGGCAACCCTAAGGTGA 690 NM_000905.3F1 CGCTGCGACACTACATCAAC 691
NM_005038.2F1 TGGAGTCTTGCTCTGTCACC 692 NM_000041.2F1
ACGAGGTGAAGGAGCAGGT 693 NM_005957.4F1 CGATGCCTTTGGGTAGAGAG 694
NR_002785.2F1 ACTGATCGTCCAAGGACTGG 695 NM_000321.2F1
AAAAAGAAATCTGGTCTTGTTAGAAAA 696 NM_152756.3F1
TTGAAAAGTGGTAAGGAATTGTGA 697 NM_000610.3F1 CACCAAGAATTGATTTTGTAGCC
698 NR_033314.1F1 AAAAATGGGGGAAAATGGTG 699 NM_017460.5F1
CATGGTTGAAACCCCATCTC 700 NR_002196.1F1 TTCAAAGCCTCCACGACTCT 701
NM_000591.3F1 GCTGGAACAGGTGCCTAAAG 702 NM_000106.5F1
CCCTAAGGGAACGACACTCA 703 NM_138712.3F1 ACCTGCTACAAGCCCTGGA 704
NM_004304.4F1 GGATCCCTAAGACCGTGGAG 705 NM_000754.3F1
CCACCTCAGAGGCTCCAA 706 NM_000492.3F1 TGCTGTATTTTAAAAGAATGATTATGA
707 NM_000444.4F1 GTAGCTGGGACGCTGGTTTA 708 NM_002463.1F1
ATTCCCTTCCCCCTACAAGA 709 NM_000552.3F1 CCTGAGTGCAACGACATCAC 710
NM_005430.3F1 GGGGGAACCAGCAGAAAT 711 NM_003150.3F1
GACCTAGGGCGAGGGTTC 712 NM_000388.3F1 AATTCCTGAAGCCAGATCCA 713
NM_007294.3F1 AAAATGTTTATTGTTGTAGCTCTGG 714 NM_005933.3F1
TTTCAAGAGCTCAACAGATGACA 715 NM_002343.3F1 GACTGCCCGGACAAGTTTT 716
NM_000376.2F1 GAGAAGGTGCCCCAAAATG 717 NM_002462.3F1
AGCCACTGGACTGACGACTT 718 NM_021005.3F1 GGAGGACTAGTGAGGGAGGTG 719
NM_012343.3F1 GGCAAGTGATGTGGCAATTA 720 NM_001741.2F1
GTTGGAGCACCTGGAAAGAA 721 NM_014417.4F1 ATGCCTGCCTCACCTTCAT 722
NM_014009.3F1 ACAGGGGCACTGTCAACAC 723 NM_006908.4F1
AAAAATCATGTGTTGCAGCTTT 724 NM_005228.3F1 TGCTTTCACAACATTTGCAG 725
NM_013994.2F1 AATGTTTCCTTGTGCCTGCT 726 NM_000639.1F1
ATATCCTGAGCCATCGGTGA 727 NM_002701.4F1 TTTTGGTACCCCAGGCTATG 728
NM_000268.3F1 ACCCCGTGGCATTACATAAC 729 NM_003140.1F1
CTTCCAGGAGGCACAGAAAT 730 NM_000551.3F1 CTAACCTGGGCGACAGAGTG 731
TABLE-US-00048 TABLE 24 SEQ ID Name Sequence NO: NM_144646.3F2
ATATTTGGACATAACAGACTTGGAA 732 NR_015342.1F2
TGCTGACTTTTAAAATAAGTGATTCG 733 NM_000193.2F2 GCGGCAGAGTAGCCCTAAC
734 NM_001777.3F2 TGGGCTATTTCTATTGCTGCT 735 NM_000600.3F2
AATGGAAAGTGGCTATGCAG 736 NM_021127.2F2 GGTTGTAGTCACTTTAGATGGAAAA
737 NM_004318.3F2 TTTGTTTGACTTTGAGCACCA 738 NM_002467.4F2
AATGTTTCTCTGTAAATATTGCCATT 739 NM_001773.2F2 CACCCCCATATGGTCATAGC
740 NM_001770.5F2 AGCACCAGGTGATCCTCAG 741 NM_001718.4F2
TGTTTTGCTGTAACATTGAAGGA 742 NR_023920.1F2 TAATGCCACAGTGGGGATG 743
NM_000267.3F2 GGGCCTAAACTTTGGCAGTT 744 NM_000633.2F2
TTTTACCTTCCATGGCTCTTTT 745 NM_000314.4F2 GCCTTACTCTGATTCAGCCTCTT
746 NM_021151.3F2 CGTAACAAAATTCATTGTGGTGT 747 NM_002415.1F2
AGAACCGCTCCTACAGCAAG 748 NM_004985.3F2 GTGCTTTCTTTTGTGGGACA 749
NM_005375.2F2 GGGAGTTCTGCATTTGATCC 750 NM_000555.3F2
TGGGTCAGAGGACTTCAAGG 751 NM_001668.3F2 AGGGTTCTGATCACATTGCAC 752
NM_025237.2F2 CTGCAGGACTGGTCGTTTTT 753 NM_021117.3F2
AGGGCAGGGTAGAGAGGGTA 754 NM_016316.2F2 TTCTTCCATGCGGAGAAATC 755
NM_021975.3F2 CATGGCTGAAGGAAACCAGT 756 NM_004333.4F2
TTGCCAGCTATCACATGTCC 757 NM_001621.4F2 TCTTTTCCTGTACCAGGTTTTTC 758
NM_005239.5F2 TGACTGGGAACATCTTGCTG 759 NM_000485.2F2
TGGCACCTGTACCCTTCTTC 760 NM_004048.2F2 TTCAATCTCTTGCACTCAAAGC 761
NM_001657.2F2 TGGAGTCACTGCCAAGTCAT 762 NM_012238.4F2
TTTGCATGATGTTTGTGTGC 763 NM_002055.4F2 GCACCCACTCTGCTTTGACT 764
NM_002392.4F2 ACCATGTAGCCAGCTTTCAA 765 NM_001625.3F2
GCAACTGGGCATGAGTACCT 766 NM_002110.3F2 CCACACCCCCTTCCTACTC 767
NM_002943.3F2 AGTCTGCTTATTTCCAGCTGTTT 768 NM_000059.3F2
TCCTGTTCAAAAGTCAGGATGA 769 NM_018136.4F2 AAATCACAAATCCCCTGCAA 770
NM_003467.2F2 CTGAACATTCCAGAGCGTGT 771 NM_004958.3F2
CAGTGGGACCACCCTCACT 772 NM_006139.3F2 TCTGTAGATGACCTGGCTTGC 773
NM_002693.2F2 TCAGAACCAAGATGCCAACA 774 NM_001080432.2F2
CATGACCCAGCCTATGGTTT 775 NM_005954.2F2 ACCTCCTGCAAGAAGAGCTG 776
NM_024865.2F2 TTGGGAGGCTTTGCTTATTTT 777 NM_001905.2F2
CTGGGAAACACTCCTTGCAT 778 NM_002046.4F2 CAACGAATTTGGCTACAGCA 779
NM_002253.2F2 CAAAGGTCATAATGCTTTCAGC 780 NM_002356.5F2
TTTGACGTATCTTTTCATCCAA 781 NM_000189.4F2 TGTTGTTGGTTTCCAAAAAGG 782
NM_000546.5F2 GCCAACTTTTGCATGTTTTG 783 NM_152860.1F2
CCCAAGCTGATCTGGTGGT 784 NM_016231.4F2 TGCTGTGAAAGAAACAAACATTG 785
NM_000518.4F2 GCACGTGGATCCTGAGAACT 786 NM_000905.3F2
CCAGCCCAGAGACACTGATT 787 NM_005038.2F2 CACGCCCAGCTAATTTTTGT 788
NM_000041.2F2 CCTGGTGGAAGACATGCAG 789 NM_005957.4F2
TCACACCTGTAATCCCAGCA 790 NR_002785.2F2 CAGAGCTCCGCCTCATTAGT 791
NM_000321.2F2 TCCATTTCATCATTGTTTCTGC 792 NM_152756.3F2
TGGTGTTTGTAGGTCACTGAACA 793 NM_000610.3F2 AACATGGTCCATTCACCTTTATG
794 NR_033314.1F2 AGAGCGAGACTCCGTCTCAA 795 NM_017460.5F2
AGTGAGCTGAGATTGCACCA 796 NR_002196.1F2 AGACGGCCTTGAGTCTCAGT 797
NM_000591.3F2 GGGAATCCCTTCCTGGTC 798 NM_000106.5F2
CTTCCTGCCTTTCTCAGCAG 799 NM_138712.3F2 TGCAGGTGATCAAGAAGACG 800
NM_004304.4F2 GGTTTTGAGCATGGGTTCAT 801 NM_000754.3F2
CCAGCCCACTCCTATGGAT 802 NM_000492.3F2 AAACTGGGACAGGGGAGAAC 803
NM_000444.4F2 TTTGGGTAGGTGACCTGCTT 804 NM_002463.1F2
TCACTGAACGAATGAGTGCTG 805 NM_000552.3F2 ACGATGTGCAGGACCAGTG 806
NM_005430.3F2 AATTTGCACTGAAACGTGGA 807 NM_003150.3F2
CTGTTGTGGCCCATTAAAGAA 808 NM_000388.3F2 TTCCCTCCAGCAGTGGTATT 809
NM_007294.3F2 CACCAGGAAGGAAGCTGTTG 810 NM_005933.3F2
TTTCCTTGTGTTCTTCCAAGC 811 NM_002343.3F2 TCGCAGGCATTACTAATCTGAA 812
NM_000376.2F2 CTCTGGCTGGCTAACTGGAA 813 NM_002462.3F2
AGAGCCCCACCCTCAGAT 814 NM_021005.3F2 TGTGCAGAGTTCTCCATCTGA 815
NM_012343.3F2 TGCCTGTTACAAATATCAAGGAA 816 NM_001741.2F2
TTTCCCTTCTTGCATCCTTC 817 NM_014417.4F2 TGTGACCACTGGCATTCATT 818
NM_014009.3F2 CTCACACACACGGCCTGTTA 819 NM_006908.4F2
CACTTGACCAATACTGACCCTCT 820 NM_005228.3F2 GTGTGTGCCCTGTAACCTGA 821
NM_013994.2F2 CCACTTCCCACTTGCAGTCT 822 NM_000639.1F2
TGTGTGTGTGTGTGTGTGTGT 823 NM_002701.4F2 TCTCCCATGCATTCAAACTG 824
NM_000268.3F2 TCTAAGTGTTCCTCACTGACAGG 825 NM_003140.1F2
TACTCTGCAGCGAAGTGCAA 826 NM_000551.3F2 CCAAGATCACACCATTGCAC 827
NM_144646.3F2 ATATTTGGACATAACAGACTTGGAA 828
TABLE-US-00049 TABLE 25 reads per Number of Number of kb/million
Gene reads labels (RPKM) APOE 1585 408 0.2 APRT 11280 56 103.4 AREG
147 102 0.0 ASPM 4683 53 4.4 B2M 209362 698 3891.7 BBC3 8 1 0.0
BCL2 3627 27 33.2 BDNF 12778 116 0.3 CD19 38 5 43.1 CD44 6789 47
8.1 COMT 2828 16 10.7 CTPS1 3998 15 25.4 CXCR4 10547 54 19.2 CYP3A4
80982 267 0.1 DCX 28 24 0.0 ETS2 6 5 0.0 FASLG 3182 565 0.2 FTO
8877 58 11.3 GAPDH 227129 661 3870.8 HCK 294 2 2.4 HK2 593 2 12.7
IGJ 119449 454 438.9 KDR 2 2 0.0 KRAS 64 31 6.8 LTF 126 90 0.0
MARCKS 1563 12 36.9 MIF 17775 89 760.4 MLL 72 9 2.6 MTHFR 4854 282
3.9 MX1 100701 285 119.0 MX2 2145 13 45.2 MYB 18361 100 2.8 MYC
6859 27 130.5 NF1 4 1 3.7 NNT 15673 78 14.1 PMAIP1 50604 244 126.9
POLG 5163 46 7.4 POU5F1 1924 12 1.0 PPID 27354 303 39.0 PTEN 20884
109 51.6 RAC1 12454 67 44.8 RB1 1420 14 46.1 RELA 3893 26 17.9
RICTOR 898 5 5.2 RORA 954 7 0.1 SOST 1 1 0.0 SP7 1 1 0.0 STAT3 706
28 16.9 TP53 900 34 14.6 VHL 11576 106 0.0
[0669] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention.
[0670] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
Embodiments
[0671] Disclosed herein are methods for analyzing molecules in two
or more samples. The method may comprise: a) producing a plurality
of sample-tagged nucleic acids by: i) contacting a first sample
comprising a plurality of nucleic acids with a plurality of first
sample tags to produce a plurality of first sample-tagged nucleic
acids; and ii) contacting a second sample comprising a plurality of
nucleic acids with a plurality of second sample tags to produce a
plurality of second sample-tagged nucleic acids, wherein the
plurality of second sample tags are different from the first sample
tags; b) contacting the plurality of sample-tagged nucleic acids
with a plurality of molecular identifier labels to produce a
plurality of labeled nucleic acids; and c) detecting at least one
of the labeled nucleic acids, thereby determining a count of a
plurality of nucleic acids in a plurality of samples. One or more
of the plurality of samples may comprise a single cell or cell
lysate. One or more of the plurality of samples may consist of a
single cell. The sample tag may comprise a cellular label that
identifies the cell from which the labeled nucleic acids originated
from. The plurality of samples consisting of a single cell may be
from one or more sources. The sample tag may comprise a sample
index region that identifies the source of the single cell. The
molecular identifier labels may be referred to as a molecular
label. One or more of the plurality of samples may comprise fewer
than 1,000,000 cells. One or more of the plurality of samples may
comprise fewer than 100,000 cells. One or more of the plurality of
samples may comprise fewer than 10,000 cells. One or more of the
plurality of samples may comprise fewer than 1,000 cells. One or
more of the plurality of the samples may comprise fewer than 100
cells. One or more of the plurality of samples may comprise a cell
lysate.
[0672] Alternatively, the method for analyzing molecules in a
plurality of samples may comprise: a) producing a plurality of
labeled nucleic acids comprising: i) contacting a first sample with
a first plurality of sample tags, wherein the first plurality of
sample tags comprise identical nucleic acid sequences; ii)
contacting the first sample with a first plurality of molecular
identifier labels comprising different nucleic acid sequences,
thereby producing a plurality of first-labeled nucleic acids; iii)
contacting a second sample with a second plurality of sample tags,
wherein the second plurality of sample tags comprise identical
nucleic acid sequences; iv) contacting the second sample with a
second plurality of molecular identifier labels comprising
different nucleic acid sequences, thereby producing a plurality of
second-labeled nucleic acids, wherein the plurality of labeled
nucleic acids comprises the plurality of first-labeled nucleic
acids and the second-labeled nucleic acids; and b) determining a
number of different labeled nucleic acids, thereby determining a
count of a plurality of nucleic acids in a plurality of samples.
The sample tag may comprise a cellular label that identifies the
cell from which the labeled nucleic acids originated from. The
sample tag may comprise a sample index region that identifies the
source of the single cell. The molecular identifier labels may be
referred to as a molecular label.
[0673] Alternatively, the method for analyzing molecules in a
plurality of samples may comprise: a) contacting a plurality of
samples comprising two or more different nucleic acids with a
plurality of sample tags and a plurality of molecular identifier
labels to produce a plurality of labeled nucleic acids, wherein: i)
the plurality of labeled nucleic acids comprise two or more nucleic
acids attached to two or more sample tags and two or more molecular
identifier labels; ii) the sample tags attached to nucleic acids
from a first sample of the plurality of samples are different from
the sample tags attached to nucleic acid molecules from a second
sample of the plurality of samples; and iii) two or more identical
nucleic acids in the same sample are attached to two or more
different molecular identifier labels; and b) detecting at least a
portion of the labeled nucleic acids, thereby determining a count
of two or more different nucleic acids in the plurality of samples.
The sample tag may comprise a cellular label that identifies the
cell from which the labeled nucleic acids originated from. The
sample tag may comprise a sample index region that identifies the
source of the single cell. The molecular identifier labels may be
referred to as a molecular label.
[0674] Further disclosed herein are methods for analyzing molecules
in a plurality of samples comprising: a) contacting a first
plurality of molecules from a first sample of a plurality of
samples with a first set of molecular barcodes to produce a first
plurality of labeled molecules, wherein a molecular barcode of the
first plurality of molecular barcodes comprises a label region and
a sample index region; b) contacting a second plurality of
molecules from a second sample of the plurality of samples with a
second set of molecular barcodes to produce a second plurality of
labeled molecules, wherein a molecular barcodes of the second
plurality of molecular barcodes comprises a label region and a
sample index region, and wherein the first plurality of molecular
barcodes and the second plurality of molecular barcodes differ at
least by the sample index region of the molecular barcodes; and c)
detecting at least a portion of two or more molecules of the first
plurality of labeled molecules and at least a portion of two or
more molecules of the second plurality of labeled molecules,
thereby determining a count of the two or more molecules in the
plurality of samples. The first plurality of molecules may comprise
nucleic acid molecules. The second plurality of molecules may
comprise nucleic acid molecules. The label region may be referred
to as a molecular label. The molecular barcode may further comprise
a cellular label. In instances in which a sample of the plurality
of samples consists of a single cell, the sample index region may
refer to the cellular label.
[0675] Disclosed herein is a method of selecting a custom primer,
comprising: a) a first pass, wherein primers chosen comprise: i) no
more than three sequential guanines, no more than three sequential
cytosines, no more than four sequential adenines, and no more than
four sequential thymines; ii) at least 3, 4, 5, or 6 nucleotides
that are guanines or cytosines; and iii) a sequence that does not
easily form a hairpin structure; b) a second pass, comprising: i) a
first round of choosing a plurality of sequences that have high
coverage of all transcripts; and ii) one or more subsequent rounds,
selecting a sequence that has the highest coverage of remaining
transcripts and a complementary score with other chosen sequences
of no more than 4; and c) adding sequences to a picked set until a
coverage saturates or a total number of customer primers is less
than or equal to about 96.
[0676] Further disclosed herein is a method for producing a labeled
molecule library comprising: a) producing a plurality of
sample-tagged nucleic acids by: i) contacting a first sample
comprising a plurality of nucleic acids with a plurality of first
sample tags to produce a plurality of first sample-tagged nucleic
acids; and ii) contacting a second sample comprising a plurality of
nucleic acids with a plurality of second sample tags to produce a
plurality of second sample-tagged nucleic acids, wherein the
plurality of first sample tags are different from the second sample
tags; and b) contacting the plurality of sample-tagged nucleic
acids with a plurality of molecular identifier labels to produce a
plurality of labeled nucleic acids, thereby producing a labeled
nucleic acid library.
[0677] Disclosed herein are kits for use in analyzing molecules in
a plurality of samples. The kit may comprise: a) two or more sets
of molecular barcodes, wherein a molecular barcode of the set of
one or more molecular barcodes comprise a sample index region and a
label region, wherein (i) the sample index regions of the molecular
barcodes of a set of molecular barcodes is the same; and (ii) the
sample index regions of a first set of molecular barcodes are
different from the sample index regions of a second set of
molecular barcodes; and b) a plurality of beads. The two or more
sets of molecular barcodes may be attached to the plurality of
beads. The two or more sets of molecular barcodes may be conjugated
to the bead. The label region may be referred to as a molecular
label. The molecular barcode may further comprise a cellular label.
In instances in which a sample of the plurality of samples consists
of a single cell, the sample index region may refer to a cellular
label.
[0678] The kit for analyzing molecules in a plurality of samples
may comprise: a) a first container comprising a first plurality of
molecular barcodes, wherein: (i) a molecular barcode comprises a
sample index region and a label region; (ii) the sample index
regions of at least about 80% of the total number of molecular
barcodes of the first plurality of molecular barcodes are
identical; and (iii) the label regions of two or more barcodes of
the first plurality of molecular barcodes are different; and (b) a
second container comprising a second plurality of molecular
barcodes, wherein: (i) a molecular barcode comprises a sample index
region and a label region; (ii) the sample index regions of at
least about 80% of the total number of molecular barcodes of the
first plurality of molecular barcodes are identical; and (iii) the
label regions of two or more barcodes of the first plurality of
molecular barcodes are different; wherein the sample index regions
of the first plurality of molecular barcodes is different from the
sample index regions of the second plurality of molecular barcodes.
The label region may be referred to as a molecular label. The
molecular barcode may further comprise a cellular label. In
instances in which a sample of the plurality of samples consists of
a single cell, the sample index region may refer to a cellular
label.
[0679] Alternatively, the kit for analyzing molecules in a
plurality of samples comprises: a) a first container comprising a
first plurality of sample tags, wherein the plurality of sample
tags comprises the same nucleic acid sequence; and b) a second
container comprising a first plurality of molecular identifier
labels, wherein the plurality of molecular identifier labels
comprises two or more different nucleic acid sequences. The label
region may be referred to as a molecular label. In instances in
which a sample of the plurality of samples consists of a single
cell, the sample tag may refer to a cellular label. The kit may
further comprise a third container comprising a first plurality of
cellular labels, wherein the plurality of cellular labels comprises
two or more different nucleic acid sequences.
[0680] The kits and methods disclosed herein may comprise one or
more sets of molecular barcodes. The kits and methods disclosed
herein may comprise one or more molecular barcodes. The molecular
barcodes may comprise a sample index region, molecular label
region, cellular label region, or a combination thereof. At least
two molecular barcodes of a set of molecular barcodes may comprise
two or more different label regions. Label regions of two or more
molecular barcodes of two or more sets of molecular barcodes may be
identical. Two or more sets of molecular barcodes may comprise
molecular barcodes comprising the same label region. In instances
in which a sample of the plurality of samples consists of a single
cell, the sample tag may refer to a cellular label.
[0681] The molecular barcodes disclosed herein may comprise a
sample index region. The sample index region of molecular barcodes
of two or more sets of molecular barcodes may be different. The
sample index region may comprise one or more nucleotides. Two or
more sequences of sample index regions of two or more different
sets of molecular barcodes may be less than about 90%, 85%, 80%,
75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%,
10%, or 5% homologous. Two or more sequences of sample index
regions of two or more different sets of molecular barcodes may be
less than about 80% homologous. Two or more sequences of sample
index regions of two or more different sets of molecular barcodes
may be less than about 60% homologous. Two or more sequences of
sample index regions of two or more different sets of molecular
barcodes may be less than about 40% homologous. Two or more
sequences of sample index regions of two or more different sets of
molecular barcodes may be less than about 20% homologous.
[0682] The molecular barcodes disclosed herein may comprise a
cellular label. The cellular label of molecular barcodes of two or
more sets of molecular barcodes may be different. The cellular
label may comprise one or more nucleotides. Two or more sequences
of cellular labels of two or more different sets of molecular
barcodes may be less than about 90%, 85%, 80%, 75%, 70%, 65%, 60%,
55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% homologous.
Two or more sequences of cellular labels of two or more different
sets of molecular barcodes may be less than about 80% homologous.
Two or more sequences of cellular labels of two or more different
sets of molecular barcodes may be less than about 60% homologous.
Two or more sequences of cellular labels of two or more different
sets of molecular barcodes may be less than about 40% homologous.
Two or more sequences of cellular labels of two or more different
sets of molecular barcodes may be less than about 20%
homologous.
[0683] The molecular barcode disclosed herein may further comprise
a universal PCR region. The molecular barcode may further comprise
a target-specific region. The molecular barcode may comprise one or
more nucleotides. The label region may comprise one or more
nucleotides. The sample index region may comprise one or more
nucleotides. The universal PCR region may comprise one or more
nucleotides. The target-specific region may comprise one or more
nucleotides.
[0684] The kits and methods disclosed herein may comprise one or
more sets of sample tags. The kits and methods disclosed herein may
comprise one or more sample tags. The sample tags may comprise a
sample index region. The sample index region of the sample tags of
a first set of sample tags may be different from the sample index
region of the sample tags of a second set of sample tags. The
sample index region may comprise one or more nucleotides. Two or
more sequences of sample index regions of two or more different
sets of sample tags may be less than about 90%, 85%, 80%, 75%, 70%,
65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%
homologous. Two or more sequences of sample index regions of two or
more different sets of sample tags may be less than about 80%
homologous. Two or more sequences of sample index regions of two or
more different sets of sample tags may be less than about 60%
homologous. Two or more sequences of sample index regions of two or
more different sets of sample tags may be less than about 40%
homologous. Two or more sequences of sample index regions of two or
more different sets of sample tags may be less than about 20%
homologous.
[0685] The kits and methods disclosed herein may comprise one or
more sets of molecular identifier labels. The kits and methods
disclosed herein may comprise one or more molecular identifier
labels. The molecular identifier labels may comprise a label
region. The label regions of two or more molecular identifier
labels of a set of molecular identifier labels may be different.
The label region may comprise one or more nucleotides. A sequence
of label regions of two or more molecular identifier labels of a
set of molecular identifier labels may be less than about 90%, 85%,
80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%,
15%, 10%, or 5% homologous. A sequence of label regions of two or
more molecular identifier labels of a set of molecular identifier
labels may be less than about 80% homologous. A sequence of label
regions of two or more molecular identifier labels of a set of
molecular identifier labels may be less than about 60% homologous.
A sequence of label regions of two or more molecular identifier
labels of a set of molecular identifier labels may be less than
about 40% homologous. A sequence of label regions of two or more
molecular identifier labels of a set of molecular identifier labels
may be less than about 20% homologous. A label region may be
referred to as a cellular label region.
[0686] The kits and methods disclosed herein may further comprise
one or more primers. The one or more primers may comprise a
sequence that is at least partially complementary to the universal
PCR region. The one or more primers may comprise a sequence that is
at least about 50% complementary to the universal PCR region. The
one or more primers may comprise a sequence that is at least about
80% complementary to the universal PCR region.
[0687] The kits and methods disclosed herein may further comprise
one or more amplification agents. The amplification agents may
comprise a fixed panel of primers. The amplification agents may
comprise one or more custom primers. The amplification agents may
comprise one or more control primers. The amplification agents may
comprise one or more housekeeping gene primers. The amplification
agents may comprise one or more PCR reagents. The one or more PCR
reagents may comprise polymerases, deoxyribonucleotide
triphosphates (dNTPs), buffers, or a combination thereof.
[0688] The kits and methods disclosed herein may further comprise
one or more beads. The molecular barcodes may be attached to the
one or more beads. The sample tags may be attached to the one or
more beads. The molecular identifier labels may be attached to the
one or more beads.
[0689] Further disclosed herein are methods for generating one or
more sets of beads. The method may comprise: a) depositing a
plurality of first nucleic acids into a plurality of wells, wherein
two or more different wells of the plurality of wells may comprise
two or more different nucleic acids of the plurality of nucleic
acids; b) contacting one or more wells of the plurality of wells
with one or fewer beads to produce a plurality of single label
beads, wherein a single label bead of the plurality of first
labeled beads comprises a bead attached to a nucleic acid of the
plurality of first nucleic acids; c) pooling the plurality of first
labeled beads from the plurality of wells to produce a pool of
first labeled beads; d) distributing the pool of first labeled
beads to a subsequent plurality of wells, wherein two or more wells
of the subsequent plurality of wells comprise two or more different
nucleic acids of a plurality of subsequent nucleic acids; and e)
attaching one or more nucleic acids of the plurality of subsequent
nucleic acids to one or more first labeled beads to produce a
plurality of uniquely labeled beads.
[0690] The methods and kits disclosed herein may be used to analyze
a plurality of nucleic acids. The methods and kits disclosed herein
may be used to analyze less than about 100,000,000 nucleic acids.
The methods and kits disclosed herein may be used to analyze less
than about 10,000,000 nucleic acids. The methods and kits disclosed
herein may be used to analyze less than about 1,000,000 nucleic
acids. Further disclosed herein are methods of analyzing a
plurality of proteins. The method may comprise: a) producing a
plurality of sample-tagged polypeptides by: i) contacting a first
sample comprising a plurality of polypeptides with a plurality of
first sample tags to produce a plurality of first sample-tagged
polypeptides; and ii) contacting a second sample comprising a
plurality of polypeptides with a plurality of second sample tags to
produce a plurality of second sample-tagged polypeptides, wherein
the plurality of first sample tags are different from the plurality
of second sample tags; b) contacting the plurality of sample-tagged
polypeptides with a plurality of molecular identifier labels to
produce a plurality of labeled polypeptides; and c) detecting at
least a portion of the labeled polypeptides, thereby determining a
count of the plurality of polypeptides in the plurality of
samples.
[0691] The methods of analyzing polypeptides in a plurality of
samples may further comprise determining the identity of one or
more labeled polypeptides. Determining the identity of the one or
more labeled polypeptides may comprise mass spectrometry. The
method may further comprise combining the labeled polypeptides of
the first sample with the labeled polypeptides of the second
sample. The labeled polypeptides may be combined prior to
determining the number of different labeled polypeptides. The
method may further comprise combining the first sample-tagged
polypeptides and the second sample-tagged polypeptides. The first
sample-tagged polypeptides and the second sample-tagged
polypeptides may be combined prior to contact with the plurality of
molecular identifier labels. Determining the number of different
labeled polypeptides may comprise detecting at least a portion of
the tagged labeled polypeptide. Detecting at least a portion of the
tagged labeled polypeptide may comprise detecting at least a
portion of the sample tag, molecule-specific tag, polypeptide, or a
combination thereof.
[0692] The methods disclosed herein may comprise contacting a
plurality of samples with a plurality of sample tags and a
plurality of molecular identifier labels. Contacting the plurality
of samples with the plurality of sample tags and the plurality of
molecular identifier labels may occur simultaneously. Contacting
the plurality of samples with the plurality of sample tags and the
plurality of molecular identifier labels may occur concurrently.
Contacting the plurality of samples with the plurality of sample
tags and the plurality of molecular identifier labels may occur
sequentially. Contacting the plurality of samples with the
plurality of sample tags may occur prior to contacting the
plurality of samples with the plurality of molecular identifier
labels. Contacting the plurality of samples with the plurality of
sample tags may occur after contacting the plurality of samples
with the plurality of molecular identifier labels.
[0693] The methods disclosed herein may comprise contacting a first
sample with a first plurality of sample tags and a first plurality
of molecular identifier labels. Contacting the first sample with
the first plurality of sample tags and the first plurality of
molecular identifier labels may occur simultaneously. Contacting
the first sample with the first plurality of sample tags and the
first plurality of molecular identifier labels may occur
concurrently. Contacting the first sample with the first plurality
of sample tags and the first plurality of molecular identifier
labels may occur sequentially. Contacting the first sample with the
first plurality of sample tags may occur prior to contacting the
first sample with the first plurality of molecular identifier
labels. Contacting the first sample with the first plurality of
sample tags may occur after contacting the first sample with the
first plurality of molecular identifier labels.
[0694] The methods disclosed herein may comprise contacting a
second sample with a second plurality of sample tags and a second
plurality of molecular identifier labels. Contacting the second
sample with the second plurality of sample tags and the second
plurality of molecular identifier labels may occur simultaneously.
Contacting the second sample with the second plurality of sample
tags and the second plurality of molecular identifier labels may
occur concurrently. Contacting the second sample with the second
plurality of sample tags and the second plurality of molecular
identifier labels may occur sequentially. Contacting the second
sample with the second plurality of sample tags may occur prior to
contacting the second sample with the second plurality of molecular
identifier labels. Contacting the second sample with the second
plurality of sample tags may occur after contacting the second
sample with the second plurality of molecular identifier
labels.
[0695] The methods and kits disclosed herein may further comprise
combining two or more samples. The methods and kits disclosed
herein may further comprise combining the first sample and the
second sample. The first and second samples may be combined prior
to contact with the plurality of molecular identifier labels. The
first and second samples may be combined prior to detecting the
labeled nucleic acids. The two or more samples may be combined
prior to stochastically labeling two or more molecules in the two
or more samples. The two or more samples may be combined after
stochastically labeling two or more molecules in the two or more
samples. The two or more samples may be combined prior to detecting
two or more molecules in the two or more samples. The two or more
samples may be combined after detecting two or more molecules in
the two or more samples. The two or more samples may be combined
prior to analyzing two or more molecules in the two or more
samples. The two or more samples may be combined after analyzing
two or more molecules in the two or more samples. The two or more
samples may be combined prior to conducting one or more assays on
two or more molecules in the two or more samples. The two or more
samples may be combined after conducting one or more assays on two
or more molecules in the two or more samples.
[0696] The methods and kits disclosed herein may comprise
conducting one or more assays on two or more molecules in a sample.
The one or more assays may comprise one or more amplification
reactions. The methods and kits disclosed herein may further
comprise conducting one or more amplification reactions to produce
labeled nucleic acid amplicons. The labeled nucleic acids may be
amplified prior to detecting the labeled nucleic acids. The method
may further comprise combining the first and second samples prior
to conducting the one or more amplification reactions.
[0697] The amplification reactions may comprise amplifying at least
a portion of the sample tag. The amplification reactions may
comprise amplifying at least a portion of the label. The
amplification reactions may comprise amplifying at least a portion
of the sample tag, label, nucleic acid, or a combination thereof.
The amplification reactions may comprise amplifying at least about
1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, or 100% of the total number of
nucleic acids of the plurality of nucleic acids. The amplification
reactions may comprise amplifying at least about 1% of the total
number of nucleic acids of the plurality of nucleic acids. The
amplification reactions may comprise amplifying at least about 5%
of the total number of nucleic acids of the plurality of nucleic
acids. The amplification reactions may comprise amplifying at least
about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the total number
of labeled nucleic acids of the plurality of labeled nucleic acids.
The amplification reactions may comprise amplifying at least about
1% of the total number of labeled nucleic acids of the plurality of
labeled nucleic acids. The amplification reactions may comprise
amplifying at least about 5% of the total number of labeled nucleic
acids of the plurality of labeled nucleic acids. The amplification
reactions may comprise amplifying at least about 10% of the total
number of labeled nucleic acids of the plurality of labeled nucleic
acids. The amplification reactions may comprise amplifying less
than about 95%, 90%, 80%, 70%, 60% or 50% of the total number of
nucleic acids of the plurality of nucleic acids. The amplification
reactions may comprise amplifying less than about 50% of the total
number of nucleic acids of the plurality of nucleic acids. The
amplification reactions may comprise amplifying less than about 20%
of the total number of nucleic acids of the plurality of nucleic
acids. The amplification reactions may comprise amplifying less
than about 10% of the total number of nucleic acids of the
plurality of nucleic acids. The amplification reactions may
comprise amplifying less than about 95%, 90%, 80%, 70%, 60% or 50%
of the total number of labeled nucleic acids of the plurality of
labeled nucleic acids. The amplification reactions may comprise
amplifying less than about 40% of the total number of labeled
nucleic acids of the plurality of labeled nucleic acids. The
amplification reactions may comprise amplifying less than about 25%
of the total number of labeled nucleic acids of the plurality of
labeled nucleic acids. The amplification reactions may comprise
amplifying less than about 10% of the total number of labeled
nucleic acids of the plurality of labeled nucleic acids.
[0698] The one or more amplification reactions may result in
amplification of about 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600,
700, 800, 900 or 1000 targeted nucleic acids in a sample. The one
or more amplification reactions may result in amplification of
about 2000 targeted nucleic acids in a sample. The one or more
amplification reactions may result in amplification of about 1000
targeted nucleic acids in a sample. The one or more amplification
reactions may result in amplification of about 2000 targeted
molecules. The one or more amplification reactions may result in
amplification of about 100 targeted nucleic acids in a sample.
[0699] The amplification reactions may comprise one or more
polymerase chain reactions (PCRs). The one or more polymerase chain
reactions may comprise multiplex PCR, nested PCR, absolute PCR,
HD-PCR, Next Gen PCR, digital RTA, or any combination thereof. The
one or more polymerase chain reactions may comprise multiplex PCR.
The one or more polymerase chain reactions may comprise nested
PCR.
[0700] Conducting the one or more amplification reactions may
comprise the use of one or more primers. The one or more primers
may comprise one or more oligonucleotides. The one or more
oligonucleotides may comprise at least about 7-9 nucleotides. The
one or more oligonucleotides may comprise less than 12-15
nucleotides. The one or more primers may anneal to at least a
portion of the plurality of labeled nucleic acids. The one or more
primers may anneal to the 3' end and/or 5' end of the plurality of
labeled nucleic acids. The one or more primers may anneal to an
internal region of the plurality of labeled nucleic acids. The
internal region may be at least about 50, 100, 150, 200, 220, 230,
240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360,
370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490,
500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 700,
750, 800, 850, 900 or 1000 nucleotides from the 3' ends the
plurality of labeled nucleic acids. The internal region may be at
least about 2000 nucleotides from the 3' ends the plurality of
labeled nucleic acids. The one or more primers may comprise a fixed
panel of primers. The one or more primers may comprise at least one
or more custom primers. The one or more primers may comprise at
least one or more control primers. The one or more primers may
comprise at least one or more housekeeping gene primers. The one or
more oligonucleotides may comprise a sequence selected from a group
consisting of sequences in Table 1. The one or more primers may
comprise a universal primer. The universal primer may anneal to a
universal primer binding site. The universal primer may anneal to a
universal PCR region. The one or more custom primers may anneal to
at least a portion of a sample tag. The one or more custom primers
may anneal to at least a portion of a molecular identifier label.
The one or more custom primers may anneal to at least a portion of
a molecular barcode. The one or more custom primers may anneal to
the first sample tag, the second sample tag, the molecular
identifier label, the nucleic acid or a product thereof. The one or
more primers may comprise a universal primer and a custom primer.
The one or more primers may comprise at least about 96 or more
custom primers. The one or more primers may comprise at least about
960 or more custom primers. The one or more primers may comprise at
least about 9600 or more custom primers. The one or more custom
primers may anneal to two or more different labeled nucleic acids.
The two or more different labeled nucleic acids may correspond to
one or more genes.
[0701] Multiplex PCR reactions may comprise a nested PCR reaction.
The nested PCR reaction may comprise a pair of primers comprising a
first primer and a second primer. The first primer may anneal to a
region of one or more nucleic acids of the plurality of nucleic
acids. The region of the one or more nucleic acids may be at least
about 300 to 400 nucleotides from the 3' end of the one or more
nucleic acids. The second primer may anneal to a region of one or
more nucleic acids of the plurality of nucleic acids. The region of
the one or more nucleic acids may be at least 200 to 300
nucleotides from the 3' end of the one or more nucleic acids.
[0702] The methods and kits disclosed herein may further comprise
conducting one or more cDNA synthesis reactions to produce one or
more cDNA copies of the molecules or derivatives thereof (e.g.,
labeled molecules). The one or more cDNA synthesis reactions may
comprise one or more reverse transcription reactions.
[0703] The methods and kits disclosed herein may comprise one or
more samples. The methods and kits disclosed herein may comprise a
plurality of samples. The plurality of samples may comprise at
least about 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100
or more samples. The plurality of samples may comprise at least
about 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 or more
samples. The plurality of samples may comprise at least about 1000,
2000, 3000, 4000, 5000, 6000, 7000, 8000 samples, 9000, or 10,000
samples, or 100,000 samples, or 1,000,000 or more samples. The
plurality of samples may comprise at least about 10,000 samples.
The plurality of samples may comprise at least about 2 samples. The
plurality of samples may comprise at least about 5 samples. The
plurality of samples may comprise at least about 10 samples. The
plurality of samples may comprise at least about 50 samples. The
plurality of samples may comprise at least about 100 samples.
[0704] The methods and kits disclosed herein may comprise one or
more samples comprising one or more cells. The methods and kits
disclosed herein may comprise two or more samples comprising one or
more cells. A first sample may comprise one or more cells. A second
sample may comprise one or more cells. The one or more cells of the
first sample may be of the same cell type as the one or more cells
of the second sample.
[0705] The methods and kits disclosed herein may comprise a
plurality of samples. The plurality of samples may be from one or
more subjects. The plurality of samples may be from two or more
subjects. The plurality of samples may be from the same subject.
The two or more subjects may be from the same species. The two or
more subjects may be from different species. The plurality of
samples may be from one or more sources. The plurality of samples
may be from two or more sources. The plurality of samples may be
from the same subject. The two or more sources may be from the same
species. The two or more sources may be from different species.
[0706] The plurality of samples may be obtained concurrently. The
plurality of samples may be obtained sequentially. The plurality of
samples may be obtained over two or more time periods. The two or
more time periods may be one or more hours apart. The two or more
time periods may be one or more days apart. The two or more time
periods may be one or more weeks apart. The two or more time
periods may be one or more months apart. The two or more time
periods may be one or more years apart.
[0707] The plurality of samples may be from one or more bodily
fluids, tissues, cells, organs, or muscles. The plurality of
samples may comprise one or more blood samples.
[0708] The methods and kits disclosed herein may comprise one or
more samples comprising one or more nucleic acids. Two or more
samples may comprise one or more nucleic acids. Two or more samples
may comprise two or more nucleic acids. The one or more nucleic
acids of a first sample may be different from one or more nucleic
acids of a second sample. The nucleic acids in a first sample may
be at least about 50% identical to the nucleic acids in a second
sample. The nucleic acids in a first sample may be at least about
70% identical to the nucleic acids in a second sample. The nucleic
acids in a first sample may be at least about 80% identical to the
nucleic acids in a second sample.
[0709] The plurality of nucleic acids in the one or more samples
may comprise two or more identical sequences. At least about 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, 100% of the total nucleic acids in the one
or more samples may comprise the same sequence. The plurality of
nucleic acids in one or more samples may comprise at least two
different sequences. At least about 5%, 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%,
100% of the total nucleic acids in the one or more samples may
comprise different sequences.
[0710] The plurality of nucleic acids may comprise RNA, DNA, cDNA,
mRNA, genomic DNA, small RNA, non-coding RNA, or other nucleic acid
contents of a cell. The plurality of nucleic acids may comprise
mRNA. The plurality of nucleic acids may comprise RNA. The
plurality of nucleic acids may comprise mRNA. The plurality of
nucleic acids may comprise DNA.
[0711] The methods and kits disclosed herein may comprise one or
more sample tags. The methods and kits disclosed herein may
comprise one or more pluralities of sample tags. The sample tags
may comprise a sample index region. The sample index region of a
first plurality of sample tags may be different from the sample
index region of a second plurality of sample tags. The sample tags
may comprise one or more nucleotides.
[0712] The sample tags may comprise at least about 5, 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100
nucleotides. The sample tags may comprise at least about 5 or more
nucleotides. The sample tags may comprise at least about 10 or more
nucleotides. The sample tags may comprise less than about 200
nucleotides. The sample tags may comprise less than about 100
nucleotides. The sample tags may comprise less than about 60
nucleotides.
[0713] The sample tags may further comprise a universal primer
binding site. The sample tags may further comprise a universal PCR
region. The sample tags may further comprise one or more adaptor
regions. The sample tags may further comprise one or more
target-specific regions.
[0714] The methods and kits disclosed herein may comprise one or
more molecular identifier labels. The methods and kits disclosed
herein may comprise one or more pluralities of molecular identifier
labels. The one or more pluralities of molecular identifier labels
may comprise two or more different molecular identifier labels. The
one or more pluralities of molecular identifier labels may comprise
50 or more different molecular identifier labels. The one or more
pluralities of molecular identifier labels may comprise 90 or more
different molecular identifier labels. The one or more pluralities
of molecular identifier labels may comprise 100 or more different
molecular identifier labels. The one or more pluralities of
molecular identifier labels may comprise 300 or more different
molecular identifier labels. The one or more pluralities of
molecular identifier labels may comprise 500 or more different
molecular identifier labels. The one or more pluralities of
molecular identifier labels may comprise 960 or more different
molecular identifier labels. The one or more pluralities of
molecular identifier labels may comprise multiple copies of one or
more molecular identifier labels. Two or more pluralities of
molecular identifier labels may comprise one or more identical
molecular identifier labels. Two or more pluralities of molecular
identifier labels may comprise 10 or more identical molecular
identifier labels. The molecular identifier labels of a first
plurality of molecular identifier labels may be at least about 30%
identical to the molecular identifier labels of a second plurality
of molecular identifier labels. The molecular identifier labels of
a first plurality of molecular identifier labels may be at least
about 50% identical to the molecular identifier labels of a second
plurality of molecular identifier labels. The molecular identifier
labels of a first plurality of molecular identifier labels may be
at least about 80% identical to the molecular identifier labels of
a second plurality of molecular identifier labels.
[0715] The molecular identifier labels may comprise a label region
(e.g., molecular label region, molecular index region). The label
region of two or more molecular identifier labels of a first
plurality of molecular identifier labels may be different. One or
more pluralities of molecular identifier labels may comprise at
least about 20 different label regions. One or more pluralities of
molecular identifier labels may comprise at least about 50
different label regions. One or more pluralities of molecular
identifier labels may comprise at least about 96 different label
regions. One or more pluralities of molecular identifier labels may
comprise at least about 200 different label regions. One or more
pluralities of molecular identifier labels may comprise at least
about 500 different label regions. One or more pluralities of
molecular identifier labels may comprise at least about 960
different label regions.
[0716] The molecular identifier labels may comprise at least about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides. The molecular
identifier labels may comprise at least about 20, 30, 40, 50 or
more nucleotides. The molecular identifier labels may comprise at
least about 21 nucleotides.
[0717] The molecular identifier labels may further comprise a
target-specific region. The target-specific region may comprise an
oligodT sequence.
[0718] The molecular identifier labels may further comprise one or
more dye labels. The molecular identifier labels may further
comprise a Cy3 dye. The molecular identifier labels may further
comprise a Tye563 dye.
[0719] The methods and kits disclosed herein may comprise one or
more labeled molecules. The one or more labeled molecules may be
produced by contacting a plurality of molecules with a plurality of
sample tags. The one or more labeled molecules may be produced by
contacting a plurality of nucleic acids with a plurality of sample
tags. Contacting the plurality of nucleic acids with the plurality
of sample tags may comprise ligating one or more sample tags to one
or more nucleic acids. Contacting the plurality of nucleic acids
with the plurality of sample tag may comprise hybridizing one or
more sample tags to one or more nucleic acids. Contacting the
plurality of nucleic acids with the plurality of sample tag may
comprise performing one or more nucleic acid extension reactions.
The one or more nucleic acid extension reactions may comprise
reverse transcription.
[0720] The methods and kits disclosed herein may further comprise
attaching one or more oligonucleotide linkers to the plurality of
nucleic acids. The method and kits may further comprise attaching
one or more oligonucleotide linkers to the sample tagged nucleic
acids. The methods and kits may further comprise attaching one or
more oligonucleotide linkers to the labeled nucleic acids. The one
or more linkers may comprise at least about 10 nucleotides.
[0721] The methods and kits disclosed herein may further comprise
attaching one or more labeled nucleic acids to a support. The
support may comprise a solid support. The support may comprise a
bead. The support may comprise an array. The support may comprise a
glass slide.
[0722] Attachment of the labeled nucleic acids to the support may
comprise amine-thiol cros slinking, maleimide crosslinking,
N-hydroxysuccinimide or N-hydroxysulfosuccinimide, Zenon,
SiteClick, or a combination thereof. Attaching the labeled nucleic
acids to the support may comprise attaching biotin to the one or
more labeled nucleic acids.
[0723] The support may comprise one or more beads. The one or more
beads may be a coated bead. The coated bead may be coated with
streptavadin.
[0724] The support may comprise an array. The array may comprise
one or more probes. The labeled nucleic acids may be attached to
the one or more probes. The one or more probes may comprise one or
more oligonucleotides. The one or more probes may be attached to at
least a portion of the labeled nucleic acids. The portion of the
labeled nucleic acids attached to the one or more probes may
comprise at least a portion of the sample tag, molecular identifier
label, molecular barcode, nucleic acid, or a combination
thereof.
[0725] The support may comprise a glass slide. The glass slide may
comprise one or more wells. The one or more wells may be etched on
the glass slide. The one or more wells may comprise at least 960
wells. The glass slide may comprise one or more probes. The one or
more probes may be printed onto the glass slide. The one or more
wells may further comprise one or more probes. The one or more
probes may be printed within the one or more wells. The one or more
probes may comprise 960 nucleic acids. The nucleic acids may be
different. The nucleic acids may be the same.
[0726] The methods and kits disclosed herein may be used to
determine a count of one or more molecules in one or more samples.
Determining the count of one or more molecules may comprise
determining the number of different labeled nucleic acids.
Determining the number of different labeled nucleic acids may
comprise detecting at least a portion of the labeled nucleic acid.
Detecting at least a portion of the labeled nucleic acid may
comprise detecting at least a portion of the sample tag, molecular
identifier label, molecular barcode, nucleic acid, or a combination
thereof.
[0727] Determining the number of different labeled nucleic acids
may comprise sequencing. Sequencing may comprise MiSeq sequencing.
Sequencing may comprise HiSeq sequencing. Determining the number of
different labeled nucleic acids may comprise an array. Determining
the number of different labeled nucleic acids may comprise
contacting the labeled nucleic acids with the one or more
probes.
[0728] Determining the number of different labeled nucleic acids
may comprise contacting the labeled nucleic acids with an array.
The array may comprise a plurality of probes. Determining the
number of different labeled nucleic acids may comprise contacting
the labeled nucleic acids with a glass slide of a plurality of
probes.
[0729] Determining the number of different labeled nucleic acids
may comprise labeled probe hybridization, target-specific
amplification, target-specific sequencing, sequencing with labeled
nucleotides specific for target small nucleotide polymorphism,
sequencing with labeled nucleotides specific for restriction enzyme
digest patterns, sequencing with labeled nucleotides specific for
mutations, or a combination thereof.
[0730] Determining the number of different labeled nucleic acids
may comprise flow cytometry sorting of a sequence-specific label.
Determining the number of different labeled nucleic acids may
comprise detection of the labeled nucleic acids attached to the
beads. Detection of the labeled nucleic acids attached to the beads
may comprise fluorescence detection.
[0731] Determining the number of different labeled nucleic acids
may comprise counting the plurality of labeled nucleic acids by
fluorescence resonance energy transfer (FRET), between a
target-specific probe and a labeled nucleic acid or a
target-specific labeled probe. Determining the number of different
labeled nucleic acids may comprise attaching the labeled nucleic
acid to the support.
[0732] The methods and kits disclosed herein may further comprise
immunoprecipitation of a target sequence with a nucleic-acid
binding protein.
[0733] The methods and kits disclosed herein may further comprise
distributing the plurality of samples into a plurality of wells of
a microwell plate. One or more of the plurality of samples may
comprise a plurality of cells. One or more of the plurality of
samples may comprise a plurality of nucleic acids. The methods and
kits disclosed herein may further comprise distributing one or
fewer cells to the plurality of wells. The plurality of cells may
be lysed in the microwell plate. The methods and kits disclosed
herein may further comprise synthesizing cDNA in the microwell
plate. Synthesizing cDNA may comprise reverse transcription of
mRNA.
[0734] The methods and kits disclosed herein may further comprise
distributing the plurality of first sample tags, the plurality of
second sample tags, the plurality of molecular identifier labels,
or any combination thereof into a microwell plate.
[0735] The methods and kits disclosed herein may further comprise
distributing one or more beads in the microwell plate. The
microwell plate may comprise a microwell plate fabricated on PDMS
by soft lithography, etched on a silicon wafer, etched on a glass
slide, patterned photoresist on a glass slide, or a combination
thereof. The microwell may comprise a hole on a microcapillary
plate. The microwell plate may comprise a water-in-oil emulsion.
The microwell plate may comprise at least one or more wells. The
microwell plate may comprise at least about 6 wells, 12 wells, 48
wells, 96 wells, 384 wells, 960 wells or 1000 wells.
[0736] The methods and kits disclosed herein may further comprise a
chip. The microwell plate may be attached to the chip. The chip may
comprise at least about 6 wells, 12 wells, 48 wells, 96 wells, 384
wells, 960 wells, 1000 wells, 2000 wells, 3000 wells, 4000 wells,
5000 wells, 6000 wells, 7000 wells, 8000 wells, 9000 wells, 10,000
wells, 20,000 wells, 30,000 wells, 40,000 wells, 50,000 wells,
60,000 wells, 70,000 wells, 80,000 wells, 90,000 wells, 100,000
wells, 200,000 wells, 500,000 wells, or a million wells. The wells
may comprise an area of at least about 300 microns.sup.2, 400
microns.sup.2, 500 microns.sup.2, 600 microns.sup.2, 700
microns.sup.2, 800 microns.sup.2, 900 microns.sup.2, 1000
microns.sup.2, 1100 microns.sup.2, 1200 microns.sup.2, 1300
microns.sup.2, 1400 microns.sup.2, 1500 microns.sup.2. The methods
and kits disclosed herein may further comprise distributing between
about 10,000 and 30,000 samples on the chip.
[0737] The methods and kits disclosed herein may further comprise
diagnosing a condition, disease, or disorder in a subject in need
thereof.
[0738] The methods and kits disclosed herein may further comprise
prognosing a condition, disease, or disorder in a subject in need
thereof. The methods and kits disclosed herein may further comprise
determining a treatment for a condition, disease, or disorder in a
subject in need thereof.
[0739] The plurality of samples may comprise one or more samples
from a subject suffering from a disease or condition. The plurality
of samples may comprise one or more samples from a healthy
subject.
[0740] Further disclosed herein is a method of forensic analysis
comprising: a) stochastically labeling two or more molecules in two
or more samples to produce two or more labeled molecules; and b)
detecting the two or more labeled molecules.
[0741] The method of selecting the custom primer may further
comprise selecting the custom primer based on one or more nucleic
acids. The one or more nucleic acids may comprise mRNA transcripts,
non-coding transcripts including structural RNAs, transcribed
pseudogenes, model mRNA provided by a genome annotation process,
sequences corresponding to a genomic contig, or any combination
thereof. The one or more nucleic acids may be RNA. The one or more
nucleic acids may be mRNA. The one or more nucleic acids may
comprise one or more exons. The method of selecting the custom
primer may further comprise enriching for one or more subsets of
nucleic acids. The one or more subsets comprise low abundance
mRNAs. The method of selecting the custom primer may further
comprise a computational algorithm.
[0742] The methods and kits disclosed herein may comprise the use
of one or more controls. The one or more controls may be spiked in
controls. The one or more controls may comprise nucleic acids. The
one or more samples comprising a plurality of nucleic acids may be
spiked with one or more control nucleic acids. The one or more
control nucleic acids may be used to measure an efficiency of
producing the labeled nucleic acid library.
[0743] The methods and kits disclosed herein may be used in the
production of one or more nucleic acid libraries. The one or more
nucleic acid libraries may comprise a plurality of labeled nucleic
acids or derivatives thereof (e.g., labeled amplicons). The method
of producing the labeled nucleic acid library may comprise
stochastically labeling two or more nucleic acids in two or more
samples with two or more sets of molecular barcodes to produce a
plurality of labeled nucleic acids. The method of producing a
labeled nucleic acid library may comprise contacting two or more
samples with a plurality of sample tags and a plurality of molecule
specific labels to produce a plurality of labeled nucleic acids.
The labeled nucleic acids may comprise a sample index region, a
label region and a nucleic acid region. The sample index region may
be used to confer a sample or sub-sample identity to the nucleic
acid. The sample index region may be used to determine the source
of the nucleic acid. The label region may be used to confer a
unique identity to the nucleic acid, thereby enabling
differentiation of two or more identical nucleic acids in the same
sample or sub-sample.
[0744] The method of producing a nucleic acid library may further
comprise amplifying one or more labeled nucleic acids to produce
one or more enriched labeled nucleic acids. The method may further
comprise conducting one or more pull-down assays of the one or more
enriched labeled nucleic acids. The method may further comprise
purifying the one or more enriched labeled nucleic acids.
[0745] The kits disclosed herein may comprise a plurality of beads,
a primer and/or amplification agents. One or more kits may be used
in the analysis of at least about 10, 20, 30, 40, 50, 60, 70, 80,
90, or 100 or more samples or sub-samples. One or more kits may be
used in the analysis of at least about 96 samples. One or more kits
may be used in the analysis of at least about 384 samples. The kit
may further comprise instructions for primer design and
optimization.
[0746] The kit may further comprise one or more microwell plates.
The one or more microwell plates may be used for the distribution
of one or more beads. The one or more microwell plates may be used
for the distribution of one or more molecules or derivatives
thereof (e.g., labeled molecules, labeled amplicons) from one or
more samples.
[0747] The kit may further comprise one or more additional
containers. The one or more additional containers may comprise one
or more additional pluralities of sample tags. The one or more
additional pluralities of sample tags in the one or more additional
containers may be different from the first plurality of sample tags
in the first container. The one or more additional containers may
comprise one or more additional pluralities of molecular identifier
labels. The one or more additional pluralities of molecular
identifier labels of the one or more additional containers may be
at least about 50% identical to the one or more additional
molecular identifier labels of the second container. The one or
more additional pluralities of molecular identifier labels of the
one or more additional containers may be at least about 80%
identical to the one or more additional molecular identifier labels
of the second container. The one or more additional pluralities of
molecular identifier labels of the one or more additional
containers may be at least about 90% identical to the one or more
additional molecular identifier labels of the second container.
[0748] Further disclosed herein are methods of producing one or
more sets of labeled beads. The method of producing the one or more
sets of labeled beads may comprise attaching one or more nucleic
acids to one or more beads, thereby producing one or more sets of
labeled beads. The one or more nucleic acids may comprise one or
more molecular barcodes. The one or more nucleic acids may comprise
one or more sample tags. The one or more nucleic acids may comprise
one or more molecular identifier labels. The one or more nucleic
acids may comprise a) a primer region; b) a sample index region;
and c) a linker or adaptor region. The one or more nucleic acids
may comprise a) a primer region; b) a label region; and c) a linker
or adaptor region. The one or more nucleic acids may comprise a) a
sample index region; and b) a label region. The one or more nucleic
acids may further comprise a primer region. The one or more nucleic
acids may further comprise a target specific region. The one or
more nucleic acids may further comprise a linker region. The one or
more nucleic acids may further comprise an adaptor region. The one
or more nucleic acids may further comprise a sample index region.
The one or more nucleic acids may further comprise a label
region.
[0749] The primer region of the nucleic acids for a set of labeled
beads may be at least about 70% identical. The primer region of the
nucleic acids for a set of labeled beads may be at least about 90%
identical. The primer region of the nucleic acids for a set of
labeled beads may be the same.
[0750] The sample index region of the nucleic acids for a set of
labeled beads may be at least about 70% identical. The sample index
region of the nucleic acids for a set of labeled beads may be at
least about 90% identical. The sample index region of the nucleic
acids for a set of labeled beads may be the same. The sample index
region of the nucleic acids for two or more sets of sample indexed
beads may be less than about 40% identical. The sample index region
of the nucleic acids for two or more sets of sample indexed beads
may be less than about 50% identical. The sample index region of
the nucleic acids for two or more sets of sample indexed beads may
be less than about 60% identical. The sample index region of
nucleic acids for two or more sets of sample indexed beads may be
different.
[0751] The label region of the nucleic acids for two or more sets
of labeled beads may be at least about 70% identical. The label
region of the nucleic acids for two or more sets of labeled beads
may be at least about 90% identical. The label region of the
nucleic acids for two or more sets of labeled beads may be the
same. The label region of the nucleic acids for a set of labeled
beads may be less than about 40% identical. The label region of the
nucleic acids for a set of labeled beads may be less than about 50%
identical. The label region of the nucleic acids for a set of
labeled beads may be less than about 60% identical. The label
region of two or more nucleic acids for a set of labeled beads may
be different.
[0752] The linker or adaptor region of the nucleic acids for a set
of labeled beads may be at least about 70% identical. The linker or
adaptor region of the nucleic acids for a set of labeled beads may
be at least about 90% identical. The linker or adaptor region of
the nucleic acids for a set of labeled beads may be the same.
[0753] The target specific region of the nucleic acids for two or
more sets of target specified beads may be at least about 70%
identical. The target specific region of the nucleic acids for two
or more sets of target specified beads may be at least about 90%
identical. The target specific region of the nucleic acids for two
or more sets of target specified beads may be the same. The target
specific region of the nucleic acids for a set of target specified
beads may be less than about 40% identical. The target specific
region of the nucleic acids for a set of target specified beads may
be less than about 50% identical. The target specific region of the
nucleic acids for a set of target specified beads may be less than
about 60% identical. The target specific region of two or more
nucleic acids for a set of target specified beads may be
different.
[0754] The one or more sets of labeled beads may comprise one
million or more labeled beads. The one or more sets of labeled
beads may comprise ten million or more labeled beads.
[0755] Attaching the one or more nucleic acids to the beads may
comprise covalent attachment. Attaching the one or more nucleic
acids to the beads may comprise conjugation. Attaching the one or
more nucleic acids to the beads may comprise ionic
interactions.
[0756] The beads may be coated beads. The nucleic acids may be
attached to one or more tags. The beads may be coated with
streptavidin. The nucleic acids may be attached to biotin. The
beads may also be coated with antibodies or nucleic acids, and the
nucleic acids may be attached to the beads indirectly via such
surface coated materials.
[0757] In one aspect, the disclosure provides for a composition
comprising: a solid support, wherein said solid support comprises a
plurality of oligonucleotides, wherein at least two of said
plurality of oligonucleotides comprises a cellular label and a
molecular label, wherein said cellular labels of said at least two
of said plurality of oligonucleotides are the same, and wherein
said molecular labels of said at least two of said plurality of
oligonucleotides are different. In some embodiments, the plurality
of oligonucleotide further comprises a sample label. In some
embodiments, the plurality of oligonucleotides further comprises a
target binding region. In some embodiments, the target binding
region comprises a sequence is adapted to hybridize to a target
nucleic acid. In some embodiments, the target binding region
comprises a sequence selected from the group consisting of: a
random multimer e.g., a random dimer, trimer, quatramer, pentamer,
hexamer, septamer, octamer, nonamer, decamer, or higher multimer
sequence of any length; a gene-specific primer; and oligo dT; or
any combination thereof. In some embodiments, the plurality of
oligonucleotides comprises a universal label. In some embodiments,
the universal label comprises a binding site for a sequencing
primer. In some embodiments, the plurality of oligonucleotides
comprises a linker. In some embodiments, the linker comprises a
functional group. In some embodiments, the linker is located 5' to
said oligonucleotide. In some embodiments, the linker is selected
from the group consisting of: C6, biotin, streptavidin, primary
amines, aldehydes, and ketones, or any combination thereof. In some
embodiments, the solid support is comprised of polystyrene. In some
embodiments, the in solid support is magnetic. In some embodiments,
the solid support is selected from the group consisting of: a PDMS
solid support, a glass solid support, a polypropylene solid
support, an agarose solid support, a gelatin solid support, a
magnetic solid support, and a pluronic solid support, or any
combination thereof. In some embodiments, the solid support
comprises a bead. In some embodiments, the solid support comprises
a diameter of about 20 microns. In some embodiments, the solid
support comprises a diameter from about 5 microns to about 40
microns. In some embodiments, the solid support comprises a
functional group. In some embodiments, the functional group is
selected from the group consisting of: C6, biotin, streptavidin,
primary amines, aldehydes, and ketones, or any combination thereof.
In some embodiments, the cellular label comprises a plurality of
cellular labels. In some embodiments, the plurality of cellular
labels are interspersed with a plurality of linker label sequences.
In some embodiments, the plurality of oligonucleotides comprises
from 10,000 to 1 billion oligonucleotides.
[0758] In one aspect the disclosure provides for a solid support
comprising: a first oligonucleotide comprising: a first cellular
label comprising a first random sequence, a second random sequence,
and a first linker label sequence, wherein said first linker label
sequence connects said first random sequence and said second random
sequence; and a first molecular label comprising a random sequence;
and a second oligonucleotide comprising: a second cellular label
comprising a third random sequence, a fourth random sequence, and a
second linker label sequence, wherein said second linker label
sequence connects said third random sequence and said fourth random
sequence; and a second molecular label comprising a random
sequence, wherein said first cellular label and said second
cellular label are the same and said first molecular label and said
second molecular label are different. In some embodiments, the
first and second oligonucleotides further comprise identical sample
index regions. In some embodiments, the sample index region
comprises a random sequence. In some embodiments, the sample index
region is 4-12 nucleotides in length. In some embodiments, the
cellular label is directly attached to said molecular label. In
some embodiments, the cellular label and said molecular label are
attached through a linker label sequence. In some embodiments, the
random sequence of said cellular label is from 4-12 nucleotides in
length. In some embodiments, the constant sequence of said cellular
label is at least 4 nucleotides in length. In some embodiments, the
cellular label has a total length of at least 12 nucleotides. In
some embodiments, the cellular label further comprises one or more
additional random sequences. In some embodiments, the cellular
label further comprises one or more additional linker label
sequences. In some embodiments, the one or more additional linker
label sequences connect the one or more additional random
sequences. In some embodiments, the random sequence of the
molecular label is 4-12 nucleotides in length.
[0759] In one aspect the disclosure provides for a composition
comprising: a solid support, wherein said solid support comprises a
plurality of oligonucleotides, wherein at least two of said
plurality of oligonucleotides comprises: a cellular label, a
molecular label; and a target binding region; and a plurality of a
target nucleic acids, wherein said cellular labels of said at least
two of said plurality of oligonucleotides are the same, and wherein
said molecular labels of said at least two of said plurality of
oligonucleotides are different. In some embodiments, the target
binding region comprises a sequence that is adapted to hybridize to
at least one of said plurality of target nucleic acids. In some
embodiments, the target binding region comprises a sequence
selected from the group consisting of: a random a random multimer
e.g., a random dimer, trimer, quatramer, pentamer, hexamer,
septamer, octamer, nonamer, decamer, or higher multimer sequence of
any length; a gene-specific primer; and oligo dT; or any
combination thereof. In some embodiments, the plurality of
oligonucleotides comprises from 10,000 to 1 billion
oligonucleotides. In some embodiments, the plurality of
oligonucleotides comprises a number of oligonucleotides greater
than the number of target nucleic acids of said plurality of target
nucleic acids. In some embodiments, the plurality of target nucleic
acids comprises multiple copies of a same target nucleic acid. In
some embodiments, the plurality of target nucleic acids comprises
multiple copies of different target nucleic acids. In some
embodiments, the plurality of target nucleic acids are bound to
said plurality of oligonucleotides. In some embodiments, the
oligonucleotide further comprises a sample label. In some
embodiments, the plurality of oligonucleotides comprises a
universal label. In some embodiments, the universal label comprises
a binding site for a sequencing primer. In some embodiments, the
plurality of oligonucleotides comprises a linker. In some
embodiments, the linker comprises a functional group. In some
embodiments, the linker is located 5' to said oligonucleotide. In
some embodiments, the functional group comprises an amino group. In
some embodiments, the linker is selected from the group consisting
of: C6, biotin, streptavidin, primary amines, aldehydes, and
ketones, or any combination thereof. In some embodiments, the solid
support is comprised of polystyrene. In some embodiments, the solid
support is magnetic. In some embodiments, the solid support is
selected from the group consisting of: a PDMS solid support, a
glass solid support, a polypropylene solid support, an agarose
solid support, a gelatin solid support, a magnetic solid support,
and a pluronic solid support, or any combination thereof. In some
embodiments, the solid support comprises a bead. In some
embodiments, the solid support comprises a diameter of about 20
microns. In some embodiments, the solid support comprises a
diameter from about 5 microns to about 40 microns. In some
embodiments, the solid support comprises a functional group. In
some embodiments, the functional group comprises a carboxy group.
In some embodiments, the functional group is selected from the
group consisting of: C6, biotin, streptavidin, primary amines,
aldehydes, and ketones, or any combination thereof. In some
embodiments, the cellular label comprises a plurality of cellular
labels. In some embodiments, the plurality of cellular labels is
interspersed with a plurality of linker label sequences.
[0760] In one aspect the disclosure provides for a kit comprising:
a first solid support, wherein said first solid support comprises a
first plurality of oligonucleotides, wherein said first plurality
of oligonucleotides comprises the same first cellular label, a
second solid support, wherein said second solid support comprises a
second plurality of oligonucleotides, wherein said second plurality
of oligonucleotides comprises the same second cellular label,
instructions for use, wherein said first cellular label and said
second cellular label are different. In some embodiments,
oligonucleotides form said first plurality of oligonucleotides and
said second plurality of oligonucleotides comprises a molecular
label. In some embodiments, the molecular labels of said
oligonucleotides are different. In some embodiments, the molecular
labels of said oligonucleotides are the same. In some embodiments,
the molecular label of some of said oligonucleotides are different
and some are the same. In some embodiments, the oligonucleotides
from said first plurality of oligonucleotides and said second
plurality of oligonucleotides comprise a target binding region. In
some embodiments, the kit further comprises: a microwell array. In
some embodiments, the kit further comprises: a buffer. In some
embodiments, the buffer is selected from the group consisting of: a
reconstitution buffer, a dilution buffer, and a stabilization
buffer, or any combination thereof.
[0761] In one aspect the disclosure provides for a method for
determining an amount of a target nucleic acid comprising:
contacting a sample with a solid support, wherein said solid
support comprises a plurality of oligonucleotides, wherein at least
two of said plurality of oligonucleotides comprises a cellular
label and a molecular label, wherein said cellular labels of said
at least two of said plurality of oligonucleotides are the same,
and wherein said molecular labels of said at least two of said
plurality of oligonucleotides are different; and hybridizing said
target nucleic acid from said sample to an oligonucleotide of said
plurality of oligonucleotides. In some embodiments, the sample
comprises cells. In some embodiments, the sample is lysed prior to
said hybridizing. In some embodiments, the hybridizing comprising
hybridizing multiple copies of a same target nucleic acid to said
plurality of oligonucleotides. In some embodiments, the method
further comprises: amplifying said target nucleic acid. In some
embodiments, the amplifying comprises reverse transcribing said
target nucleic acid. In some embodiments, the amplifying comprises
amplification using a method selected from the group consisting of:
PCR, quantitative PCR, real-time PCR, and digital PCR, or any
combination thereof. In some embodiments, the amplifying is
performed directly on said solid support. In some embodiments, the
amplifying is performed on a template transcribed from said solid
support. In some embodiments, the method further comprises:
sequencing said target nucleic acid. In some embodiments, the
sequencing comprises sequencing said target nucleic acid and said
molecular label. In some embodiments, the method further comprises:
determining an amount of said target nucleic acid. In some
embodiments, the determining comprises quantifying levels of said
target nucleic acid. In some embodiments, the determining comprises
counting the number of sequenced molecular labels for said target
nucleic acid. In some embodiments, the contacting occurs in a
microwell. In some embodiments, the microwell is made from a
material selected from the group consisting of: hydrophilic
plastic, plastic, elastomer, and hydrogel, or any combination
thereof. In some embodiments, the microwell comprises agarose. In
some embodiments, the microwell is one microwell of a microwell
array. In some embodiments, the microwell array comprises at least
90 microwells. In some embodiments, the microwell array comprises
at least 150,000 microwells. In some embodiments, the microwell
comprises at least one solid support per well. In some embodiments,
the microwell comprises at most two solid supports per well. In
some embodiments, the microwell is of a size that accommodates at
most two of said solid support. In some embodiments, the microwell
is of a size that accommodates at most one solid support. In some
embodiments, the microwell is at least 25 microns deep. In some
embodiments, the microwell is at least 25 microns in diameter.
[0762] In one aspect the disclosure provides for a method to reduce
amplification bias of a target nucleic acid comprising: contacting
a sample to a solid support, wherein said solid support comprises a
plurality of oligonucleotides, wherein at least two of said
plurality of oligonucleotides comprises a cellular label and a
molecular label, wherein said cellular labels of said at least two
of said plurality of oligonucleotides are the same, and wherein
said molecular labels of said at least two of said plurality of
oligonucleotides are different; and hybridizing a target nucleic
acid from said sample to said plurality of oligonucleotides;
amplifying said target nucleic acidl; sequencing said target
nucleic acid, wherein said sequencing sequences said target nucleic
acid and said molecular label of said oligonucleotide to which said
target nucleic acid is bound; and determining an amount of said
target nucleic acid. In some embodiments, the hybridizing
comprising hybridizing multiple copies of a same target nucleic
acid to said plurality of oligonucleotides. In some embodiments,
the determining comprises counting a number of sequenced molecular
labels for a same target nucleic acid. In some embodiments, the
counting counts the number of copies of said same target nucleic
acid. In some embodiments, the sample comprises cells. In some
embodiments, the amplifying comprises reverse transcribing said
target nucleic acid. In some embodiments, the amplifying comprises
amplification using a method selected from the group consisting of:
PCR, quantitative PCR, real-time PCR, and digital PCR, or any
combination thereof. In some embodiments, the amplifying is
performed directly on said solid support. In some embodiments, the
amplifying is performed on a template transcribed from said solid
support.
[0763] In one aspect the disclosure provides for a composition
comprising: a microwell; a cell; and a solid support, wherein said
solid support comprises a plurality of oligonucleotides, wherein at
least two of said plurality of oligonucleotides comprises a
cellular label and a molecular label, wherein said cellular labels
of said at least two of said plurality of oligonucleotides are the
same, and wherein said molecular labels of said at least two of
said plurality of oligonucleotides are different. In some
embodiments, the at least two of said plurality of oligonucleotides
further comprises a sample label. In some embodiments, the at least
two of said plurality of oligonucleotides further comprises a
target binding region. In some embodiments, the target binding
region comprises a sequence selected from the group consisting of:
a random multimer e.g., a random dimer, trimer, quatramer,
pentamer, hexamer, septamer, octamer, nonamer, decamer, or higher
multimer sequence of any length; a gene-specific primer; and oligo
dT; or any combination thereof. In some embodiments, the plurality
of oligonucleotides comprises a universal label. In some
embodiments, the universal label comprises a binding site for a
sequencing primer. In some embodiments, the solid support is
comprised of polystyrene. In some embodiments, the solid support is
magnetic. In some embodiments, the solid support is selected from
the group consisting of: a PDMS solid support, a glass solid
support, a polypropylene solid support, an agarose solid support, a
gelatin solid support, a magnetic solid support, and a pluronic
solid support, or any combination thereof. In some embodiments, the
solid support comprises a bead. In some embodiments, the solid
support has a diameter of about 20 microns. In some embodiments,
the solid support has a diameter from about 5 microns to about 40
microns. In some embodiments, the cellular label comprises a
plurality of cellular labels. In some embodiments, the plurality of
cellular labels is interspersed with a plurality of linker
sequences. In some embodiments, the microwell is made from a
material selected from the group consisting of: hydrophilic
plastic, plastic, elastomer, and hydrogel, or any combination
thereof. In some embodiments, the microwell comprises agarose. In
some embodiments, the microwell is a microwell of a microwell
array. In some embodiments, the microwell comprises at least one
solid support per well. In some embodiments, the microwell
comprises at most two solid supports per well. In some embodiments,
the microwell is of a size that accommodates at least one of said
solid support and at least one of said cell. In some embodiments,
the microwell is of a size that accommodates at most one of said
solid support and at least one of said cell. In some embodiments,
the microwell is at least 25 microns deep. In some embodiments, the
microwell is at least 25 microns in diameter. In some embodiments,
the microwell is flat.
[0764] In one aspect the disclosure provides for a device
comprising: a first substrate comprising a first microwell array;
wherein said first microwell array comprises a plurality of first
microwells in a first pre-determined spatial arrangement configured
to perform multiplexed, single cell stochastic labeling and
molecular indexing assays.
[0765] In some embodiments, the device comprises a first substrate
comprising at least a second microwell array, wherein said at least
second microwell array comprises a plurality of at least second
microwells in an at least second pre-determined spatial
arrangement. In some embodiments, the first microwells and the at
least second microwells are the same. In some embodiments, the
first microwells and the at least second microwells are different.
In some embodiments, the first pre-determined spatial arrangement
and the at least second pre-determined spatial arrangement are the
same. In some embodiments, the first pre-determined spatial
arrangement and the at least second pre-determined spatial
arrangement are different. In some embodiments, a pre-determined
spatial arrangement comprises a one dimensional or two dimensional
array pattern. In some embodiments, the two dimensional array
pattern comprises a square grid, a rectangular grid, or a hexagonal
grid. In some embodiments, the microwells comprise a cylindrical
geometry, a conical geometry, a hemispherical geometry, a
rectangular geometry, a polyhedral geometry, or a combination
thereof. In some embodiments, a diameter of the microwells is
between about 5 microns and about 50 microns. In some embodiments,
a depth of the microwells is between about 10 microns and about 60
microns. In some embodiments, a center-to-center spacing between
two adjacent microwells is between about 15 microns and about 75
microns. In some embodiments, a total number of microwells in a
first or at least second microwell array is between about 96 and
about 5,000,000. In some embodiments, the first substrate comprises
silicon, fused-silica, glass, a polymer, a metal, or a combination
thereof. In some embodiments, the first substrate further comprises
agarose or a hydrogel. In some embodiments, a microwell array
further comprises at least one surface feature, wherein said
surface feature surrounds one or more individual microwells or
straddles a surface between individual microwells, and wherein said
surface feature is domed, ridged, or peaked.
[0766] In one aspect the disclosure provides for a device
comprising: a first substrate comprising at least a first microwell
array; and a mechanical fixture comprising a top plate, a bottom
plate, and a gasket; wherein when the first substrate and
mechanical fixture are in assembled form, the first substrate is
positioned between the gasket and the bottom plate, the gasket
forms a leak-proof seal with the first substrate, and the top plate
and gasket form at least a first chamber encompassing said at least
first microwell array such that a cell sample and a bead-based
oligonucleotide label may be dispensed into said at least first
chamber to perform multiplexed, single cell stochastic labeling and
a molecular indexing assays.
[0767] In some embodiments, the at least first microwell array is
any described herein. In some embodiments, the gasket is fabricated
from polydimethylsiloxane (PDMS) or a similar elastomeric material.
In some embodiments, the top and bottom plates are fabricated from
aluminum, anodized aluminum, stainless steel, teflon,
polymethylmethacrylate, polycarbonate, or a similar rigid polymer
material.
[0768] In one aspect the disclosure provides for a device
comprising: at least one substrate further comprising at least one
microwell array; and a flow cell; wherein the flow cell encloses or
is attached to said at least one substrate, and includes at least
one inlet port and at least one outlet port for the purpose of
delivering fluids to said microwell arrays; and wherein the device
is configured to perform multiplexed, single cell stochastic
labeling and molecular indexing assays.
[0769] In some embodiments, said at least one substrate comprise at
least one microwell array as described herein. In some embodiments,
the flow cell further comprises a plurality of microarray chambers
that interface with a plurality of microwell arrays such that one
or more samples may be processed in parallel. In some embodiments,
the flow cell further comprises a porous barrier or flow diffuser
to provide more uniform delivery of cells and beads to the at least
one microwell array. In some embodiments, the flow cell further
comprises dividers that divide each chamber containing a microwell
array into subsections that collectively cover the same total array
area and provide for more uniform delivery of cells and beads to
the at least one microwell array. In some embodiments, the width of
fluid channels incorporated into the device is between about 50
microns and 20 mm. In some embodiments, the depth of fluid channels
incorporated into the device is between about 50 microns and about
2 mm. In some embodiments, the flow cell is fabricated from a
material selected from the group consisting of silicon,
fused-silica, glass, polydimethylsiloxane (PDMS; elastomer),
polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene
(PP), polyethylene (PE), high density polyethylene (HDPE),
polyimide, cyclic olefin polymers (COP), cyclic olefin copolymers
(COC), polyethylene terephthalate (PET), epoxy resin, metal, or a
combination of these materials. In some embodiments, the device
comprises a fixed component of an instrument system configured to
perform automated multiplexed, single cell stochastic labeling and
molecular indexing assays. In some embodiments, the device
comprises a removable component of an instrument system configured
to perform automated multiplexed, single cell stochastic labeling
and molecular indexing assays.
[0770] In one aspect the disclosure provides for a cartridge
comprising: at least a first substrate further comprising at least
a first microwell array; at least a first flow cell or microwell
array chamber; one or more sample or reagent reservoirs; and
wherein the cartridge further comprises at least one inlet port and
at least one outlet port for the purpose of delivering fluids to
said at least first microwell array; and wherein the cartridge is
configured to perform multiplexed, single cell stochastic labeling
and molecular indexing assays.
[0771] In some embodiments, said at least first substrate comprises
at least a first microwell array as described herein. In some
embodiments, the cartridge comprises a plurality of microwell
arrays and is configured to process one or more samples in
parallel. In some embodiments, the at least first flow cell or
microwell array chamber further comprises a porous barrier or flow
diffuser to provide more uniform delivery of cells and beads to the
at least first microwell arrays. In some embodiments, the at least
first flow cell or microwell array chamber further comprises
dividers that divide the at least first flow cell or microwell
array chamber into subsections that collectively cover the same
total array area and provide for more uniform delivery of cells and
beads to the microwell arrays. In some embodiments, the width of
fluid channels incorporated into the cartridge is between about 50
microns and 200 microns. In some embodiments, the width of the
fluid channels incorporated into the cartridge is between about 200
microns and 2 mm. In some embodiments, the width of the fluid
channels incorporated into the cartridge is between about 2 mm and
10 mm. In some embodiments, the width of the fluid channels
incorporated into the cartridge is between about 10 mm and 20 mm.
In some embodiments, the depth of fluid channels incorporated into
the cartridge is between about 50 microns and about 2 mm. In some
embodiments, the depth of fluid channels incorporated into the
cartridge is between about 500 microns and 1 mm. In some
embodiments, the depth of fluid channels incorporated into the
cartridge is between about 1 mm and about 2 mm. In some
embodiments, the one or more flow cells or microwell array chambers
are fabricated from a material selected from the group consisting
of silicon, fused-silica, glass, polydimethylsiloxane (PDMS;
elastomer), polymethylmethacrylate (PMMA), polycarbonate (PC),
polypropylene (PP), polyethylene (PE), high density polyethylene
(HDPE), polyimide, cyclic olefin polymers (COP), cyclic olefin
copolymers (COC), polyethylene terephthalate (PET), epoxy resin,
metal, or a combination of these materials. In some embodiments,
the device comprises a removable, consumable component of an
instrument system configured to perform automated multiplexed,
single cell stochastic labeling and molecular indexing assays. In
some embodiments, the cartridge further comprises bypass channels
or other design features for providing self-metering of cell
samples or bead suspensions dispensed or injected into the
cartridge. In some embodiments, the cartridge further comprises
integrated miniature pumps for controlling fluid flow through the
device. In some embodiments, the cartridge further comprises
integrated miniature valves for compartmentalizing pre-loaded
reagents and for controlling fluid flow through the device. In some
embodiments, the cartridge further comprises vents for providing an
escape path for trapped air. In some embodiments, the cartridge
further comprises design elements for creating physical or chemical
barriers that effectively increase pathlength and prevent or
minimize diffusion of molecules between microwells, wherein the
design elements are selected from the group consisting of: a
pattern of serpentine channels for delivery of cells and beads to
the at least first microwell array, a retractable platen or
deformable membrane that is pressed into contact with the surface
of the at least first microwell array, or the release of an
immiscible, hydrophobic fluid from a reservoir within the
cartridge. In some embodiments, the cartridge further comprises
integrated temperature control components or an integrated thermal
interface for providing good thermal contact with an external
instrument system. In some embodiments, the cartridge further
comprises an optical interface or window for optical imaging of the
at least first microwell array. In some embodiments, the cartridge
further comprises one or more removable sample collection chambers
that are configured to interface with stand-alone PCR thermal
cyclers and/or sequencing instruments. In some embodiments, the
cartridge itself is configured to interface directly with
stand-alone PCR thermal cyclers and/or sequencing instruments.
[0772] In one aspect the disclosure provides for an instrument
system comprising: at least a first flow cell or cartridge further
comprising at least a first microwell array; and a flow controller;
wherein the flow controller controls the delivery of cell samples,
bead-based oligonucleotide labeling reagents, and other assay
reagents to the at least first microwell array, and the instrument
system is configured to perform multiplexed, single cell stochastic
labeling and molecular indexing assays.
[0773] In some embodiments, the at least first microwell array as
described herein. In some embodiments, the at least first flow cell
is a fixed component of the system. In some embodiments, the at
least first flow cell is a removable, consumable component of the
system. In some embodiments, the at least first cartridge is a
removable, consumable component of the system. In some embodiments,
cell samples and bead-based oligonucleotide reagents are dispensed
or injected directly into the cartridge by the user. In some
embodiments, assay reagents other than cell samples are preloaded
in the cartridge. In some embodiments, the instrument system
further comprises an imaging system for imaging the at least first
microwell array. In some embodiments, the instrument system further
comprises a cell or bead distribution system for facilitating
uniform distribution of cells and beads across the at least first
microwell array, wherein the mechanism underlying said distribution
system is selected from the group consisting of rocking, shaking,
swirling, recirculating flow, low frequency agitation, or high
frequency agitation. In some embodiments, the instrument system
further comprises a cell lysis system wherein the system uses a
high frequency piezoelectric transducer for sonicating the cells.
In some embodiments, the instrument system further comprises a
temperature controller for maintaining a user-specified
temperature, or for ramping temperature between two or more
specified temperatures over two or more specified time intervals.
In some embodiments, the instrument system further comprises a
magnetic field controller for use in eluting beads from microwells.
In some embodiments, the instrument system further comprises a
computer or processor programmed to provide a user interface and
control of system functions. In some embodiments, the instrument
system further comprises program code for providing real-time image
analysis capability. In some embodiments, the real-time image
analysis and instrument control functions are coupled, so that cell
and bead sample loading steps can be prolonged or repeated until
optimal cell/bead distributions are achieved. In some embodiments,
the instrument system further comprises an integrated PCR thermal
cycler for amplification of oligonucleotide labels. In some
embodiments, the instrument system further comprises an integrated
sequencer for sequencing of oligonucleotide libraries, thereby
providing sample-to-answer capability. In some embodiments, the
cell samples comprise patient samples and the results of the
multiplexed, single cell stochastic labeling and molecular indexing
assay are used for clinical diagnostic applications. In some
embodiments, the cell samples comprise patient samples and the
results of the multiplexed, single cell stochastic labeling and
molecular indexing assay are used by a healthcare provider to make
informed healthcare treatment decisions.
[0774] In one aspect the disclosure provides for software residing
in a computer readable medium programmed to perform one or more of
the following sequence data analysis functions: determining the
number of reads per gene per cell, and the number of unique
transcript molecules per gene per cell; principal component
analysis or other statistical analysis to predict confidence
intervals for determinations of the number of transcript molecules
per gene per cell; alignment of gene sequence data with known
reference sequences; decoding/demultiplexing of sample barcodes,
cell barcodes, and molecular barcodes; and automated clustering of
molecular labels to compensate for amplification or sequencing
errors; wherein the sequence data is generated by performing
multiplexed, single cell stochastic labeling and molecular indexing
assays.
[0775] In one aspect the disclosure provides for a composition
comprising: a solid support, wherein the solid support comprises a
plurality of oligonucleotides, wherein at least two of the
plurality of oligonucleotides comprises a cellular label and a
molecular label, wherein the cellular labels of the at least two of
the plurality of oligonucleotides are the same, and wherein the
molecular labels of the at least two of the plurality of
oligonucleotides are different.
[0776] In some embodiments, the plurality of oligonucleotide
further comprises a sample label. In some embodiments, the
plurality of oligonucleotides further comprises a target binding
region. In some embodiments, the target binding region comprises a
sequence is adapted to hybridize to a target nucleic acid. In some
embodiments, the target nucleic acid comprises a plurality of
target nucleic acids comprising at least 0.01%, 0.02%, 0.05%, 0.1%,
0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 60%, 70%, 80%, 90%, or 100% of the transcripts of a
transcriptome of an organism. In some embodiments, the target
nucleic acid is DNA. In some embodiments, the target nucleic acid
is RNA. In some embodiments, the target nucleic acid is mRNA. In
some embodiments, the DNA is genomic DNA. In some embodiments, the
genomic DNA is sheared. In some embodiments, the sheared genomic
DNA comprises at least 0.01%, 0.02%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%,
0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%,
15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%,
70%, 80%, 90%, or 100% of the genes of a genome of an organism. In
some embodiments, the target binding region comprises a sequence
selected from the group consisting of: a random multimer e.g., a
random dimer, trimer, quatramer, pentamer, hexamer, septamer,
octamer, nonamer, decamer, or higher multimer sequence of any
length; a gene-specific primer; and oligo dT; or any combination
thereof. In some embodiments, the plurality of oligonucleotides
comprises a universal label. In some embodiments, the universal
label comprises a binding site for a sequencing primer. In some
embodiments, the plurality of oligonucleotides comprises a linker.
In some embodiments, the linker comprises a functional group. In
some embodiments, the linker is located 5' to the oligonucleotide.
In some embodiments, the linker is selected from the group
consisting of: C6, biotin, streptavidin, primary amines, aldehydes,
and ketones, or any combination thereof. In some embodiments, the
solid support is comprised of polystyrene. In some embodiments, in
solid support is magnetic. In some embodiments, the solid support
is selected from the group consisting of: a PDMS solid support, a
glass solid support, a polypropylene solid support, an agarose
solid support, a gelatin solid support, a magnetic solid support,
and a pluronic solid support, or any combination thereofln some
embodiments, the solid support comprises a bead. In some
embodiments, the solid support comprises a diameter of about 20
microns. In some embodiments, the solid support comprises a
diameter from about 5 microns to about 40 microns. In some
embodiments, the solid support comprises a functional group. In
some embodiments, the functional group is selected from the group
consisting of: C6, biotin, streptavidin, primary amines, aldehydes,
and ketones, or any combination thereof. In some embodiments, the
cellular label comprises a plurality of cellular labels. In some
embodiments, the plurality of cellular labels is interspersed with
a plurality of linker label sequences. In some embodiments, the
plurality of oligonucleotides comprises from 10,000 to 1 billion
oligonucleotides. In some embodiments, the plurality of
oligonucleotides comprises from 10,000 to 1 billion target binding
regions. In some embodiments, the plurality of oligonucleotides
comprises from 10,000 to 1 billion different target binding
regions. In some embodiments, the plurality of oligonucleotides
comprises from 10,000 to 1 billion same target binding regions. In
some embodiments, the different target binding regions can
hybridize to at least 0.01%, 0.02%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%,
0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%,
15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%,
70%, 80%, 90%, or 100% of the transcripts of a transcriptome of an
organism. In some embodiments, the different target binding regions
can hybridize to at least 0.01%, 0.02%, 0.05%, 0.1%, 0.2%, 0.3%,
0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%,
14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%,
60%, 70%, 80%, 90%, or 100% of the transcripts of a transcriptome
of an organism.
[0777] In one aspect the disclosure provides for a composition
comprising: a solid support, wherein the solid support comprises a
plurality of oligonucleotides, wherein at least two of the
plurality of oligonucleotides comprises a cellular label and a
molecular label, wherein the cellular labels of the at least two of
the plurality of oligonucleotides are the same, and wherein the
molecular labels of the at least two of the plurality of
oligonucleotides are different.
[0778] In some embodiments, the plurality of oligonucleotide
further comprises a sample label. In some embodiments, the
plurality of oligonucleotides further comprises a target binding
region. In some embodiments, the target binding region comprises a
sequence is adapted to hybridize to a target nucleic acid. In some
embodiments, the target nucleic acid comprises a plurality of
target nucleic acids comprising at least 0.01%, 0.02%, 0.05%, 0.1%,
0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 60%, 70%, 80%, 90%, or 100% of the transcripts of a
transcriptome of an organism. In some embodiments, the target
nucleic acid comprises sheared genomic DNA wherein the wherein the
sheared genomic DNA comprises at least 0.01%, 0.02%, 0.05%, 0.1%,
0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 60%, 70%, 80%, 90%, or 100% of the genes of a genome
of an organism. In some embodiments, the target binding region
comprises an oligo dT. In some embodiments, the at least two of the
plurality of oligonucleotides comprises a first oligonucleotide and
a second oligonucleotide, wherein the first oligonucleotide
comprises a first cellular label and a first molecular label,
wherein the first cellular label comprises a first random sequence,
a second random sequence, and a first linker label sequence,
wherein the first linker label sequence connects the first random
sequence and the second random sequence; and the first molecular
label comprises a random sequence; and the second oligonucleotide
comprises a second cellular label and a second molecular label,
wherein the second cellular label comprises a third random
sequence, a fourth random sequence, and a second linker label
sequence, wherein the second linker label sequence connects the
third random sequence and the fourth random sequence; and the
second molecular label comprising a random sequence, and wherein
the first cellular label and the second cellular label are the same
and the first molecular label and the second molecular label are
different.
[0779] In one aspect the disclosure provides for a kit comprising
any composition described herein and instructions for use.
[0780] In one aspect the disclosure provides for a method,
comprising: contacting a sample with a solid support, wherein the
solid support comprises a plurality of oligonucleotides, wherein at
least two of the plurality of oligonucleotides comprises a cellular
label and a molecular label, wherein the cellular labels of the at
least two of the plurality of oligonucleotides are the same, and
wherein the molecular labels of the at least two of the plurality
of oligonucleotides are different; and hybridizing the target
nucleic acid from the sample to an oligonucleotide of the plurality
of oligonucleotides.
[0781] In some embodiments, the sample comprises cells. In some
embodiments, the sample is lysed prior to the hybridizing. In some
embodiments, the hybridizing comprising hybridizing multiple copies
of a same target nucleic acid to the plurality of oligonucleotides.
In some embodiments, the method further comprises reverse
transcribing the target nucleic acid. In some embodiments, the
method further comprises performing an oligonucletide
amplification. In some embodiments, the amplifying comprises
amplification using a method selected from the group consisting of:
PCR, quantitative PCR, real-time PCR, and digital PCR, or any
combination thereof.
[0782] In one aspect the disclosure provides for a A solid support
comprising: a first oligonucleotide comprising: a first cellular
label comprising a first random sequence, a second random sequence,
and a first linker label sequence, wherein the first linker label
sequence connects the first random sequence and the second random
sequence; and a first molecular label comprising a random sequence;
and a second oligonucleotide comprising: a second cellular label
comprising a third random sequence, a fourth random sequence, and a
second linker label sequence, wherein the second linker label
sequence connects the third random sequence and the fourth random
sequence; and a second molecular label comprising a random
sequence, wherein the first cellular label and the second cellular
label are the same and the first molecular label and the second
molecular label are different. In some embodiments, the first and
second oligonucleotides further comprise identical sample index
regions. In some embodiments, the sample index region comprises a
random sequence. In some embodiments, the sample index region is
4-12 nucleotides in length. In some embodiments, the cellular label
is directly attached to the molecular label. In some embodiments,
the cellular label and the molecular label are attached through a
linker label sequence. In some embodiments, the random sequence of
the cellular label is from 4-12 nucleotides in length. In some
embodiments, the constant sequence of the cellular label is at
least 4 nucleotides in length. In some embodiments, the cellular
label has a total length of at least 12 nucleotides. In some
embodiments, the cellular label further comprises one or more
additional random sequences. In some embodiments, the cellular
label further comprises one or more additional linker label
sequences. In some embodiments, the one or more additional linker
label sequences connect the one or more additional random
sequences. In some embodiments, the random sequence of the
molecular label is 4-12 nucleotides in length.
[0783] In one aspect the disclosure provides for a composition
comprising: a solid support, wherein the solid support comprises a
plurality of oligonucleotides, wherein at least two of the
plurality of oligonucleotides comprises: a cellular label, a
molecular label; and a target binding region; and a plurality of a
target nucleic acids, wherein the cellular labels of the at least
two of the plurality of oligonucleotides are the same, and wherein
the molecular labels of the at least two of the plurality of
oligonucleotides are different.
[0784] In some embodiments, the target binding region comprises a
sequence that is adapted to hybridize to at least one of the
plurality of target nucleic acids. In some embodiments, the target
binding region comprises a sequence selected from the group
consisting of: a random multimer e.g., a random dimer, trimer,
quatramer, pentamer, hexamer, septamer, octamer, nonamer, decamer,
or higher multimer sequence of any length; a gene-specific primer;
and oligo dT; or any combination thereof. In some embodiments, the
plurality of oligonucleotides comprises from 10,000 to 1 billion
oligonucleotides. In some embodiments, the plurality of
oligonucleotides comprises a number of oligonucleotides greater
than the number of target nucleic acids of the plurality of target
nucleic acids. In some embodiments, the plurality of target nucleic
acids comprises multiple copies of a same target nucleic acid. In
some embodiments, the plurality of target nucleic acids comprises
multiple copies of different target nucleic acids. In some
embodiments, the plurality of target nucleic acids are bound to the
plurality of oligonucleotides. In some embodiments, the
oligonucleotide further comprises a sample label. In some
embodiments, the plurality of oligonucleotides comprises a
universal label. In some embodiments, the universal label comprises
a binding site for a sequencing primer. In some embodiments, the
plurality of oligonucleotides comprises a linker. In some
embodiments, the linker comprises a functional group. In some
embodiments, the linker is located 5' to the oligonucleotide. In
some embodiments, the functional group comprises an amino group. In
some embodiments, the linker is selected from the group consisting
of: C6, biotin, streptavidin, primary amines, aldehydes, and
ketones, or any combination thereof. In some embodiments, the solid
support is comprised of polystyrene. In some embodiments, in solid
support is magnetic. In some embodiments, the solid support is
selected from the group consisting of: a PDMS solid support, a
glass solid support, a polypropylene solid support, an agarose
solid support, a gelatin solid support, a magnetic solid support,
and a pluronic solid support, or any combination thereof. In some
embodiments, the solid support comprises a bead. In some
embodiments, the solid support comprises a diameter of about 20
microns. In some embodiments, the solid support comprises a
diameter from about 5 microns to about 40 microns. In some
embodiments, the solid support comprises a functional group. In
some embodiments, the functional group comprises a carboxy group.
In some embodiments, the functional group is selected from the
group consisting of: C6, biotin, streptavidin, primary amines,
aldehydes, and ketones, or any combination thereof. In some
embodiments, the cellular label comprises a plurality of cellular
labels. In some embodiments, the plurality of cellular labels is
interspersed with a plurality of linker label sequences.
[0785] In one aspect the disclosure provides for a kit comprising:a
first solid support, wherein the first solid support comprises a
first plurality of oligonucleotides, wherein the first plurality of
oligonucleotides comprises a same first cellular label, a second
solid support, wherein the second solid support comprises a second
plurality of oligonucleotides, wherein the second plurality of
oligonucleotides comprises a same second cellular label, and
instructions for use, wherein the first cellular label and the
second cellular label are different.
[0786] In some embodiments, oligonucleotides from the first
plurality of oligonucleotides and the second plurality of
oligonucleotides comprises a molecular label. In some embodiments,
the molecular label of the oligonucleotides are different. In some
embodiments, the molecular label of the oligonucleotides are the
same. In some embodiments, the molecular label of some of the
oligonucleotides are different and some are the same. In some
embodiments, oligonucleotides from the first plurality of
oligonucleotides and the second plurality of oligonucleotides
comprise a target binding region. In some embodiments, the kit
further comprises a microwell array. In some embodiments, the kit
further comprises a buffer. In some embodiments, the buffer is
selected from the group consisting of: a reconstitution buffer, a
dilution buffer, and a stabilization buffer, or any combination
thereof.
[0787] In one aspect the disclosure provides for a method for
determining an amount of a target nucleic acid comprising:
contacting a sample with a solid support, wherein the solid support
comprises a plurality of oligonucleotides, wherein at least two of
the plurality of oligonucleotides comprises a cellular label and a
molecular label, wherein the cellular labels of the at least two of
the plurality of oligonucleotides are the same, and wherein the
molecular labels of the at least two of the plurality of
oligonucleotides are different; and hybridizing the target nucleic
acid from the sample to an oligonucleotide of the plurality of
oligonucleotides.
[0788] In some embodiments, the sample comprises cells. In some
embodiments, the sample is lysed prior to the hybridizing. In some
embodiments, the hybridizing comprising hybridizing multiple copies
of a same target nucleic acid to the plurality of oligonucleotides.
In some embodiments, the method further comprises amplifying the
target nucleic acid. In some embodiments, the amplifying comprises
reverse transcribing the target nucleic acid. In some embodiments,
the amplifying comprises amplification using a method selected from
the group consisting of: PCR, quantitative PCR, real-time PCR, and
digital PCR, or any combination thereof. In some embodiments, the
amplifying is performed directly on the solid support. In some
embodiments, the amplifying is performed on a template transcribed
from the solid support. In some embodiments, the method further
comprises sequencing the target nucleic acid. In some embodiments,
the sequencing comprises sequencing the target nucleic acid and the
molecular label. In some embodiments, the method further comprises
determining an amount of the target nucleic acid. In some
embodiments, the determining comprises quantifying levels of the
target nucleic acid. In some embodiments, the determining comprises
counting the number of sequenced molecular labels for the target
nucleic acid. In some embodiments, the contacting occurs in a
microwell. In some embodiments, the microwell is made from a
material selected from the group consisting of: hydrophilic
plastic, plastic, elastomer, and hydrogel, or any combination
thereof. In some embodiments, the microwell comprises agarose. In
some embodiments, the microwell is one microwell of a microwell
array. In some embodiments, the microwell array comprises at least
90 microwells. In some embodiments, the microwell array comprises
at least 150,000 microwells. In some embodiments, the microwell
comprises at least one solid support per well. In some embodiments,
the microwell comprises at most two solid supports per well. In
some embodiments, the microwell is of a size that accommodates at
most two of the solid support. In some embodiments, the microwell
is of a size that accommodates at most one solid support. In some
embodiments, the microwell is at least 25 microns deep. In some
embodiments, the microwell is at least 25 microns in diameter.
[0789] In one aspect the disclosure provides for a method to reduce
amplification bias of a target nucleic acid comprising: contacting
a sample to a solid support, wherein the solid support comprises a
plurality of oligonucleotides, wherein at least two of the
plurality of oligonucleotides comprises a cellular label and a
molecular label, wherein the cellular labels of the at least two of
the plurality of oligonucleotides are the same, and wherein the
molecular labels of the at least two of the plurality of
oligonucleotides are different; and hybridizing a target nucleic
acid from the sample to the plurality of oligonucleotides;
amplifying the target nucleic acid or compliment thereof.
sequencing the target nucleic acid or compliment thereof, wherein
the sequencing sequences the target nucleic acid or compliment
thereof and the molecular label of the oligonucleotide to which the
target nucleic acid or compliment thereof is bound. determining an
amount of the target nucleic acid.
[0790] In some embodiments, the hybridizing comprising hybridizing
multiple copies of a same target nucleic acid to the plurality of
oligonucleotides. In some embodiments, the determining comprises
counting a number of sequenced molecular labels for a same target
nucleic acid. In some embodiments, the counting counts the number
of copies of the same target nucleic acid. In some embodiments, the
sample comprises cells. In some embodiments, the amplifying
comprises reverse transcribing the target nucleic acid. In some
embodiments, the amplifying comprises amplification using a method
selected from the group consisting of: PCR, quantitative PCR,
real-time PCR, and digital PCR, or any combination thereof. In some
embodiments, the amplifying is performed directly on the solid
support. In some embodiments, the amplifying is performed on a
template transcribed from the solid support.
[0791] In one aspect the disclosure provides for a composition
comprising a microwell; a cell; and a solid support, wherein the
solid support comprises a plurality of oligonucleotides, wherein at
least two of the plurality of oligonucleotides comprises a cellular
label and a molecular label, wherein the cellular labels of the at
least two of the plurality of oligonucleotides are the same, and
wherein the molecular labels of the at least two of the plurality
of oligonucleotides are different.
[0792] In some embodiments, the at least two of the plurality of
oligonucleotides further comprises a sample label. In some
embodiments, the at least two of the plurality of oligonucleotides
further comprises a target binding region. In some embodiments, the
target binding region comprises a sequence selected from the group
consisting of: a random multimer e.g., a random dimer, trimer,
quatramer, pentamer, hexamer, septamer, octamer, nonamer, decamer,
or higher multimer sequence of any length; a gene-specific primer;
and oligo dT; or any combination thereof. In some embodiments, the
plurality of oligonucleotides comprises a universal label. In some
embodiments, the universal label comprises a binding site for a
sequencing prumer. In some embodiments, the solid support is
comprised of polystyrene. In some embodiments, in solid support is
magnetic. In some embodiments, the solid support is selected from
the group consisting of: a PDMS solid support, a glass solid
support, a polypropylene solid support, an agarose solid support, a
gelatin solid support, a magnetic solid support, and a pluronic
solid support, or any combination thereofln some embodiments, the
solid support comprises a bead. In some embodiments, the solid
support has a diameter of about 20 microns. In some embodiments,
the solid support has a diameter from about 5 microns to about 40
microns. In some embodiments, the cellular label comprises a
plurality of cellular labels. In some embodiments, the plurality of
cellular labels is interspersed with a plurality of linker
sequences. In some embodiments, the microwell is made from a
material selected from the group consisting of: hydrophilic
plastic, plastic, elastomer, and hydrogel, or any combination
thereof. In some embodiments, the microwell comprises agarose. In
some embodiments, the microwell is a microwell of a microwell
array. In some embodiments, the microwell comprises at least one
solid support per well. In some embodiments, the microwell
comprises at most two solid supports per well. In some embodiments,
the microwell is of a size that accommodates at least one of the
solid support and at least one of the cell. In some embodiments,
the microwell is of a size that accommodates at most one of the
solid support and at least one of the cell. In some embodiments,
the microwell is at least 25 microns deep. In some embodiments, the
microwell is at least 25 microns in diameter. In some embodiments,
the microwell is flat
[0793] In one aspect the disclosure provides for a device,
comprising a plurality of microwells, wherein the plurality of
microwells comprises at least two microwells; and wherein each
microwell of the plurality of microwells has a volume ranging from
about 1,000 .mu.m.sup.3 to about 120,000 .mu.m.sup.3. In some
embodiments, each microwell of the plurality of microwells has a
volume of about 20,000 .mu.m.sup.3. In some embodiments, the
plurality of microwells comprises from about 1,000 to about
5,000,000 microwells. In some embodiments, the plurality of
microwells comprises about 100,000 to about 200,000 microwells. In
some embodiments, the microwells are comprised in a single layer of
a material. In some embodiments, at least about 10% of the
microwells further comprise a cell. In some embodiments, at least
about 10% of the microwells further comprise a solid support which
comprises a plurality of oligonucleotides, wherein at least two of
the plurality of oligonucleotides comprise a cellular label and a
molecular label, wherein the cellular labels of the at least two of
the plurality of oligonucleotides are the same, and wherein the
molecular labels of the at least two of the plurality of
oligonucleotides are different. In some embodiments, the solid
supports are magnetized.
[0794] In one aspect the disclosure provides for an apparatus
comprising any device described herein, and a liquid handler.
[0795] In some embodiments, the liquid handler delivers liquid to
the plurality of microwells in about 1 second. In some embodiments,
the apparatus delivers liquid to the plurality of microwells from a
single input port. In some embodiments, the apparatus further
comprises a magnet. In some embodiments, the apparatus further
comprises at least one of: an inlet port, an outlet port, a pump, a
valve, a vent, a reservoir, a sample collection chamber, a
temperature control apparatus, or any combination thereof. In some
embodiments, the apparatus comprises the sample collection chamber,
wherein the sample collection chamber is removable from the
apparatus. In some embodiments, the apparatus further comprises an
optical imager. In some embodiments, the optical imager produces an
output signal which is used to control the liquid handler. In some
embodiments, the apparatus further comprises a thermal cycling
mechanism configured to perform polymerase chain reaction (PCR)
amplification of oligonucleotides.
[0796] In one aspect the disclosure provides for a method of
producing a clinical diagnostic test result, comprising producing
the clinical diagnostic test result with any device or apparatus
described herein. In some embodiments, the clinical diagnostic test
result is transmitted via a communication medium.
[0797] In one aspect the disclosure provides for a device
comprising: one or more substrates further comprising one or more
microwell arrays; wherein the microwell arrays are used to perform
multiplexed, single cell stochastic labeling and molecular indexing
assays.
[0798] In some embodiments, the microwell arrays of the substrates
comprise microwells arranged in a one dimensional or two
dimensional array pattern. In some embodiments, the two dimensional
array pattern of microwells is selected from the group including a
square grid, a rectangular grid, or a hexagonal grid.
[0799] In some embodiments, the microwells of the microwell arrays
are fabricated using a well geometry selected from the group
including cylindrical, conical, hemispherical, rectangular, or
polyhedral. In some embodiments, the microwells of the microwell
arrays are fabricated using a overall geometry that comprises two
or more component geometries selected from the group including
cylindrical, conical, hemispherical, rectangular, or polyhedral. In
some embodiments, the diameter of the microwells in the microwell
arrays is between about 5 microns and about 50 microns. In some
embodiments, the depth of the microwells in the microwell arrays is
between about 10 microns and about 60 microns. In some embodiments,
the center-to-center spacing between microwells in the microwell
arrays is between about 15 microns an about 75 microns. In some
embodiments, the total number of microwells in each of the
microwell arrays is between about 96 and about 5,000,000. In some
embodiments, the one or more substrates are fabricated from a
material selected from the group including silicon, fused-silica,
glass, a polymer, or a metal. In some embodiments, the one or more
substrates are fabricated from agarose or a hydrogel. In some
embodiments, the microwell arrays further comprise surface features
between microwells that surround the microwells or straddle the
surface between microwells, and are selected from the group
including domed, ridged, or peaked surface features.
[0800] In one aspect the disclosure provides for a device
comprising: a substrate further comprising one or more microwell
arrays; and a mechanical fixture comprising a top plate, a bottom
plate, and a gasket; wherein when assembled the substrate is
positioned between the gasket and the bottom plate, the gasket
forms a leak-proof seal with the substrate, and the top plate and
gasket form one or more chambers encompassing the microwell arrays
such that one or more cell samples and bead-based oligonucleotide
labels may be dispensed into the chambers for the purpose of
performing multiplexed, single cell stochastic labeling and
molecular indexing assays.
[0801] In some embodiments, the substrate comprises any one or more
microwell arrays as described herein. In some embodiments, the
gasket is fabricated from polydimethylsiloxane (PDMS) or a similar
elastomeric material. In some embodiments, the top and bottom
plates are fabricated from aluminum, anodized aluminum, stainless
steel, teflon, polymethylmethacrylate, polycarbonate, or a similar
rigid polymer material.
[0802] In one aspect the disclosure provides for a device
comprising: one or more substrates further comprising one or more
microwell arrays; and one or more flow cells; wherein the one or
more flow cells enclose or are attached to the one or more
substrates, and include at least one inlet port and at least one
outlet port for the purpose of delivering fluids to the microwell
arrays; and wherein the device is used to perform multiplexed,
single cell stochastic labeling and molecular indexing assays.
[0803] In some embodiments, the one or more substrates comprise any
one or more microwell arrays as described herein. In some
embodiments, each of the one or more flow cells further comprise a
plurality of microarray chambers that interface with a plurality of
microwell arrays such that one or more samples may be processed in
parallel. In some embodiments, the one or more flow cells further
comprise a porous barrier or flow diffuser to provide more uniform
delivery of cells and beads to the microwell arrays. In some
embodiments, the one or more flow cells further comprise dividers
that divide chambers containing microwell arrays into subsections
that collectively cover the same total array area and provide for
more uniform delivery of cells and beads to the microwell arrays.
In some embodiments, the width of fluid channels incorporated into
the device is between about 50 microns and 20 mm. In some
embodiments, the depth of fluid channels incorporated into the
device is between about 50 microns and about 2 mm. In some
embodiments, the one or more flow cells are fabricated from a
material selected from the group consisting of silicon,
fused-silica, glass, polydimethylsiloxane (PDMS; elastomer),
polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene
(PP), polyethylene (PE), high density polyethylene (HDPE),
polyimide, cyclic olefin polymers (COP), cyclic olefin copolymers
(COC), polyethylene terephthalate (PET), epoxy resin, metal, or a
combination of these materials. In some embodiments, the device
comprises a fixed component of an instrument system for performing
automated multiplexed, single cell stochastic labeling and
molecular indexing assays. In some embodiments, the device
comprises a removable component of an instrument system for
performing automated multiplexed, single cell stochastic labeling
and molecular indexing assays.
[0804] In one aspect the disclosure provides for a cartridge
comprising: one or more substrates further comprising one or more
microwell arrays; one or more flow cells or microwell array
chambers; one or more sample or reagent reservoirs; and wherein the
cartridge further comprises at least one inlet port and at least
one outlet port for the purpose of delivering fluids to the
microwell arrays; and wherein the cartridge is used to perform
multiplexed, single cell stochastic labeling and molecular indexing
assays.
[0805] In some embodiments, the one or more substrates comprise any
one or more microwell arrays as described herein. In some
embodiments, the one or more flow cells or microwell array chambers
interface with a plurality of microwell arrays such that one or
more samples may be processed in parallel. In some embodiments, the
one or more flow cells or microwell array chambers further comprise
a porous barrier or flow diffuser to provide more uniform delivery
of cells and beads to the microwell arrays. In some embodiments,
the one or more flow cells or microwell array chambers further
comprise dividers that divide the flow cells or chambers into
subsections that collectively cover the same total array area and
provide for more uniform delivery of cells and beads to the
microwell arrays. In some embodiments, the width of fluid channels
incorporated into the cartridge is between about 50 microns and 200
microns. In some embodiments, the width of the fluid channels
incorporated into the cartridge is between about 200 microns and 2
mm. In some embodiments, the width of the fluid channels
incorporated into the cartridge is between about 2 mm and 10 mm. In
some embodiments, the width of the fluid channels incorporated into
the cartridge is between about 10 mm and 20 mm. In some
embodiments, the depth of fluid channels incorporated into the
cartridge is between about 50 microns and about 10 mm. In some
embodiments, the depth of fluid channels incorporated into the
cartridge is between about 500 microns and 1 mm. In some
embodiments, the depth of fluid channels incorporated into the
cartridge is between about 1 mm and about 2 mm. In some
embodiments, the one or more flow cells or microwell array chambers
are fabricated from a material selected from the group consisting
of silicon, fused-silica, glass, polydimethylsiloxane (PDMS;
elastomer), polymethylmethacrylate (PMMA), polycarbonate (PC),
polypropylene (PP), polyethylene (PE), high density polyethylene
(HDPE), polyimide, cyclic olefin polymers (COP), cyclic olefin
copolymers (COC), polyethylene terephthalate (PET), epoxy resin,
metal, or a combination of these materials. In some embodiments,
the device comprises a removable, consumable component of an
instrument system for performing automated multiplexed, single cell
stochastic labeling and molecular indexing assays. In some
embodiments, the cartridge further comprises bypass channels or
other design features for providing self-metering of cell samples
or bead suspensions dispensed or injected into the cartridge. In
some embodiments, the cartridge further comprises integrated
miniature pumps for controlling fluid flow through the device. In
some embodiments, the cartridge further comprises integrated
miniature valves for compartmentalizing pre-loaded reagents and for
controlling fluid flow through the device. In some embodiments, the
cartridge further comprises vents for providing an escape path for
trapped air. In some embodiments, the cartridge further comprises
comprise design elements for creating physical or chemical barriers
that effectively increase pathlength and prevent or minimize
diffusion of molecules between microwells, wherein the design
elements are selected from the group consisting of: a pattern of
serpentine channels for delivery of cells and beads to the
microwell array, a retractable platen or deformable membrane that
is pressed into contact with the surface of the microwell array, or
the release of an immiscible, hydrophobic fluid from a reservoir
within the cartridge. In some embodiments, the cartridge further
comprises integrated temperature control components or an
integrated thermal interface for providing good thermal contact
with an external instrument system. In some embodiments, the
cartridge further comprises an optical interface or window for
optical imaging of the one or more microwell arrays. In some
embodiments, the cartridge further comprises one or more removable
sample collection chambers that are configured to interface with
stand-alone PCR thermal cyclers and/or sequencing instruments. In
some embodiments, the cartridge itself is configured to interface
directly with stand-alone PCR thermal cyclers and/or sequencing
instruments.
[0806] In one aspect the disclosure provides for an instrument
system comprising: one or more flow cells or cartridges further
comprising one or more microwell arrays; and a flow controller;
wherein the flow controller controls the delivery of cell samples,
bead-based oligonucleotide labeling reagents, and other assay
reagents to the microwell arrays, and the instrument system is used
to perform multiplexed, single cell stochastic labeling and
molecular indexing assays.
[0807] In some embodiments, the one or more microwell arrays are
any described herein. In some embodiments, the one or more flow
cells are a fixed component of the system. In some embodiments, the
one or more flow cells are a removable, consumable component of the
system. In some embodiments, the one or more cartridges are
removable, consumable components of the system. In some
embodiments, cell samples and bead-based oligonucleotide reagents
are dispensed or injected directly into the cartridge by the user.
In some embodiments, assay reagents other than cell samples are
preloaded in the cartridge. In some embodiments, the instrument
system further comprises an imaging system for imaging the
microwell arrays. In some embodiments, the instrument system
further comprises a cell or bead distribution system for
facilitating uniform distribution of cells and beads across the
microwell arrays, wherein the mechanism underlying the distribution
system is selected from the group consisting of rocking, shaking,
swirling, recirculating flow, low frequency agitation, or high
frequency agitation. In some embodiments, the instrument system
further comprises a cell lysis system wherein the system uses a
high frequency piezoelectric transducer for somicating the cells.
In some embodiments, the instrument system further comprises a
temperature controller for maintaining a user-specified
temperature, or for ramping temperature between two or more
specified temperatures over two or more specified time intervals.
In some embodiments, the instrument system further comprises a
magnetic field controller for use in eluting beads from microwells.
In some embodiments, the instrument system further comprises a
computer or processor programmed to provide a user interface and
control of system functions. In some embodiments, the instrument
system further comprises program code for providing real-time image
analysis capability. In some embodiments, the real-time image
analysis and instrument control functions are coupled, so that cell
and bead sample loading steps can be prolonged or repeated until
optimal cell/bead distributions are achieved. In some embodiments,
the instrument system further comprises an integrated PCR thermal
cycler for amplification of oligonucleotide labels. In some
embodiments, the instrument system further comprises an integrated
sequencer for sequencing of oligonucleotide libraries, thereby
providing sample-to-answer capability. In some embodiments, the
cell samples comprise patient samples and the results of the
multiplexed, single cell stochastic labeling and molecular indexing
assay are used for clinical diagnostic applications. In some
embodiments, the cell samples comprise patient samples and the
results of the multiplexed, single cell stochastic labeling and
molecular indexing assay are used by a healthcare provider to make
informed healthcare treatment decisions.
[0808] In one aspect the disclosure provides for software residing
in a computer readable medium programmed to perform one or more of
the following sequence data analysis: determining the number of
reads per gene per cell, and the number of unique transcript
molecules per gene per cell; principal component analysis or other
statistical analysis to predict confidence intervals for
determinations of the number of transcript molecules per gene per
cell; alignment of gene sequence data with known reference
sequences; decoding/demultiplexing of sample barcodes, cell
barcodes, and molecular barcodes; and automated clustering of
molecular labels to compensate for amplification or sequencing
errors; wherein the sequence data is generated by performing
multiplexed, single cell stochastic labeling and molecular indexing
assays.
Sequence CWU 1
1
843118DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer"misc_feature(1)..(18)/note="This sequence
may encompass 12-18 nucleotides" 1tttttttttt tttttttt
18220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 2cccctggaag aagatgatga
20342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 3cagacgtgtg ctcttccgat ctttctccaa
caagttgcct cc 42421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 4gaggaaatga agccaaacac a
21542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 5cagacgtgtg ctcttccgat ctaatcgtga
ccttaaaggc cc 42620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 6ttagccacct catgcctttc
20741DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 7cagacgtgtg ctcttccgat ctctactgtg
gtggctccgc t 41820DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 8ggaggaggat tgtgctgatg
20945DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 9cagacgtgtg ctcttccgat ctgtgtccgc
ataagaaaaa gaatc 451020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 10gcaagaaggt gctgacttcc 201142DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 11cagacgtgtg ctcttccgat ctctgcatgt ggatcctgag aa
421220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 12ctgcagtccc atcctcttgt
201342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 13cagacgtgtg ctcttccgat ctgatgaggt
ggagagtggg aa 421422DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 14ggacataaca gacttggaag ca
221546DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 15cagacgtgtg ctcttccgat ctcaatccat
tttgtaactg aacctt 461619DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 16aagcctctgg gtcagtggt 191743DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 17cagacgtgtg ctcttccgat cttggaaaag ggatagaggt tgg
431820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 18tagacagatc cccgttcctg
201942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 19cagacgtgtg ctcttccgat ctacagggag
aagggataac cc 422018DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 20cagcatccca gccttgag
182142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 21cagacgtgtg ctcttccgat ctcctcaatg
gccttttgct ac 422220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 22cctctaaact gccccacctc
202342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 23cagacgtgtg ctcttccgat ctccttaatc
gctgcctcta gg 422421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer"source/note="Description of
Combined DNA/RNA Molecule Synthetic primer" 24cacatggccu ccaaggagua
a 212542DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 25cagacgtgtg ctcttccgat
ctcagcaaga gcacaagagg aa 422619DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 26gcagggtccc agtcctatg 192742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 27cagacgtgtg ctcttccgat ctccaatcat gaggaagatg ca
422820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 28tccaggagga ttaccgaaaa
202942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 29cagacgtgtg ctcttccgat ctccatccaa
gggagagtga ga 423020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 30aatggcaaag gaaggtggat
203142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 31cagacgtgtg ctcttccgat ctgcagacac
cttggacatc ct 423220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 32agatctgagc cagtcgctgt
203343DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 33cagacgtgtg ctcttccgat cttggtgcag
agctgaagat ttt 433420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 34aaaagtgggc ttgattctgc
203542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 35cagacgtgtg ctcttccgat ctttttgttc
gcatggtcac ac 423620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 36atattccttt gggcctctgc
203742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 37cagacgtgtg ctcttccgat cttcaagttt
gggtctgtgc tg 423820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 38cccccgaaaa tgttcaataa
203941DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 39cagacgtgtg ctcttccgat cttgctcttg
tcataccccc a 414020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 40tagcttcctc ctctggtggt
204144DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 41cagacgtgtg ctcttccgat cttttgcctt
tccataatca ctca 444220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 42ctggctctcc ccaatatcct 204342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 43cagacgtgtg ctcttccgat ctgctctgag gactgcacca tt
424420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 44gtggtgttgg ggtatggttt
204542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 45cagacgtgtg ctcttccgat ctatacacag
atgcccattg ca 424620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 46agacaggtcc ttttcgatgg
204742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 47cagacgtgtg ctcttccgat cttgtgcaat
atgtgatgtg gc 424822DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 48ttgagacagg cacatacagc tt
224942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 49cagacgtgtg ctcttccgat ctttgcttcc
tcaatctgtc ca 425020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 50ccccaaccac ttcattcttg
205143DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 51cagacgtgtg ctcttccgat ctttcaattc
ctctgggaat gtt 435220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 52tgcctagagg tgctcattca
205342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 53cagacgtgtg ctcttccgat ctgttgatgc
tggaggcaga at 425420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 54agcctgggtc acagatcaag
205542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 55cagacgtgtg ctcttccgat ctaggtagga
gggtggatgg ag 425620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 56ccagcaccag ggagtttcta
205742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 57cagacgtgtg ctcttccgat ctaggaaagg
attggaacag ca 425820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 58gggtttcagg ttccaatcag
205943DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 59cagacgtgtg ctcttccgat cttttgtaac
tttttgcaag gca 436020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 60gtgaggagtg ggtccagaaa
206140DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 61cagacgtgtg ctcttccgat ctagtgggga
ggagcaggag 406220DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 62ccattccctt cttcctcctc
206342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 63cagacgtgtg ctcttccgat cttacctaca
agatcccgcg tc 426420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 64ttggacatag cccaagaaca
206542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 65cagacgtgtg ctcttccgat cttgtgcctc
actggacttg tc 426620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 66acctgaagct gaatgcctga
206742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 67cagacgtgtg ctcttccgat ctctggaggc
cacctcttct aa 426819DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 68ggtaaacacg cctgcaaac
196942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 69cagacgtgtg ctcttccgat ctcaggactc
agaagcctct gg 427024DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 70caacaaagca cagtgttaaa
tgaa 247142DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 71cagacgtgtg ctcttccgat
cttgtgtcag ctactgcgga aa 427220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 72tgagcagatc cacaggaaaa 207344DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 73cagacgtgtg ctcttccgat ctgaaatgga gtctcaaagc ttca
447420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 74tcccaactac gctgatttga
207542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 75cagacgtgtg ctcttccgat ctgaccaaaa
ggaatgtgtg gg 427621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 76tgcaagagtg acagtggatt g
217743DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 77cagacgtgtg ctcttccgat cttcaaccaa
ggtttgcttt tgt 437820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 78agaggctgaa agaggccaat
207943DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 79cagacgtgtg ctcttccgat ctaatatggg
ttgcatttgg tca 438023DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 80aaatctgcag aaggaaaaat
gtg 238142DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 81cagacgtgtg ctcttccgat
ctagttttca atgatgggcg ag 428220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 82gctcaaggga gagctgaaga 208342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 83cagacgtgtg ctcttccgat ctgactacct gcccccagag at
428420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 84gtggcgtgta tgagtggaga
208541DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 85cagacgtgtg ctcttccgat ctcactcgcc
cagagactca g 418620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 86gcacatctca tggcagctaa
208742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 87cagacgtgtg ctcttccgat ctgcttcaca
aaccttgctc ct 428820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 88acattttctg ccacccaaac
208942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 89cagacgtgtg ctcttccgat ctaacagcac
cctctccaga tg 429021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 90gcctggtaga attggctttt c
219145DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 91cagacgtgtg ctcttccgat ctttttgtag
ccaacattca ttcaa 459220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 92caattggcag ccctatttca 209342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 93cagacgtgtg ctcttccgat ctgttcagca gactggtttg ca
429420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 94ccgtgaggat gtcactcaga
209542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 95cagacgtgtg ctcttccgat ctacgaggaa
gccctaagac gt 429620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 96ttgagcctgg ggtgtaagac
209742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 97cagacgtgtg ctcttccgat ctgtcttcca
ggattcacgg tg 429820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 98gagcacctcc tggaagattg
209942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 99cagacgtgtg ctcttccgat cttaagcacc
agtgggactg tg 4210020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
primer" 100taggagcagg cctgagaaaa 2010142DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 101cagacgtgtg ctcttccgat ctgattcctc tccaaaccca tg
4210220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 102tgttttgggg aaagttggag
2010342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 103cagacgtgtg ctcttccgat ctctgtttgc
ccagtgtttg tg 4210420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 104tgcaacccaa ctgtgtgtta
2010544DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 105cagacgtgtg ctcttccgat cttttcacca
actgttctct gagc 4410620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 106gccctgagca acaatagcag 2010742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 107cagacgtgtg ctcttccgat ctttcagctc ttcactccag ca
4210820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 108aggaaaagat gtggctcacg
2010942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 109cagacgtgtg ctcttccgat ctggagttgg
ggagaactgt ca 4211020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 110tcgaataatc cagggaaacc
2011142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 111cagacgtgtg ctcttccgat ctaccaaagc
atcacgttga ca 4211220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 112ggctttacaa agctggcaat
2011342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 113cagacgtgtg ctcttccgat cttatgcctc
ttcgattgct cc 4211420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 114ccttgagtgt gtctgcgtgt
2011542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 115cagacgtgtg ctcttccgat ctccacagaa
ttgggttcca ag 4211620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 116aactgggaag gccaggtaac
2011742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 117cagacgtgtg ctcttccgat cttgttttca
aattgccatt gc 4211820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 118ctttctccac gccatttgat
2011942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 119cagacgtgtg ctcttccgat ctactaggat
atggggtggg ct 4212020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 120gggatctgct cgtcatcatt
2012142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 121cagacgtgtg ctcttccgat ctgtttctgc
ctctgaggga aa 4212220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 122gcgtgcgcgt tatttattta
2012342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 123cagacgtgtg ctcttccgat cttgtctggg
gaaggcaagt ta 4212420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 124gcagtcagcc agaaatcaca
2012542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 125cagacgtgtg ctcttccgat ctttttctcc
tctctgggac ca 4212621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 126tgaaaagtct ccctttccag a
2112742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 127cagacgtgtg ctcttccgat ctccttcaga
cagattccag gc 4212820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 128ggagaggaga gatggggatt
2012942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 129cagacgtgtg ctcttccgat ctgagtgagt
gccccttttc tt 4213020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 130ctcatgccaa caagaacctg
2013142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 131cagacgtgtg ctcttccgat cttgacccac
acctgacact tc 4213219DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 132tcgtggaaca caggcaaac
1913342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 133cagacgtgtg ctcttccgat ctttgcattt
gtactggcaa gg 4213420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 134tcaaggcaac cagaggaaac
2013542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 135cagacgtgtg ctcttccgat ctactaaggg
atggggcagt ct 4213620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 136accttttcgt tggcatgtgt
2013742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 137cagacgtgtg ctcttccgat cttcagggaa
aggactcacc tg 4213820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 138atgctgaagg catttcttgg
2013942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 139cagacgtgtg ctcttccgat ctctgtgagc
atggtgcttc at 4214020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 140gaggggagtg gtgggtttat
2014142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 141cagacgtgtg ctcttccgat ctcaaaaggg
aaagggagga tt 4214220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 142aggggaaaac tcatgagcag
2014342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 143cagacgtgtg ctcttccgat cttcactgtg
cctggaccat ag 4214420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 144ttgggcagaa agaaaaatgg
2014544DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 145cagacgtgtg ctcttccgat ctcaaaagat
tccaccagac tgaa 4414620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 146cctcccccag tctctcttct 2014742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 147cagacgtgtg ctcttccgat ctgagtcagg ccgttgctag tc
4214820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 148ggctgatctt cccacaacac
2014942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 149cagacgtgtg ctcttccgat ctacgagggc
aaagatgcta aa 4215020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 150attcccgtgt tgcttcaaac
2015142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 151cagacgtgtg ctcttccgat ctagaactgc
cagcaggtag ga 4215220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 152cacttccctg ggacattctc
2015342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 153cagacgtgtg ctcttccgat ctctcactct
tctccaggcc ag 4215420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 154tgatgtctgt ctggctgagg
2015542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 155cagacgtgtg ctcttccgat ctccacacac
agaggaagag ca 4215620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 156ccagcctgta ggaaaccaaa
2015742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 157cagacgtgtg ctcttccgat ctctccttct
atctccaggg cc 4215820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 158ggatgcaggt ggtttttgat
2015947DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 159cagacgtgtg ctcttccgat ctcattgtac
ccattttaca ttttctt 4716022DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 160caaaccttaa acacccagaa gc 2216142DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 161cagacgtgtg ctcttccgat ctataacaat tcggcagttg gc
4216220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 162gaaccagttt cctcctgtgc
2016342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 163cagacgtgtg ctcttccgat ctaagatgtg
gaggctgttg ct 4216420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 164gactgcggat ctctgtgtca
2016542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 165cagacgtgtg ctcttccgat cttctgcact
attcctttgc cc 4216623DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 166tcagtatgat cttgtgctgt
gct 2316742DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 167cagacgtgtg ctcttccgat
cttacccatg aagattggtg gg 4216820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 168cacagcatga gaggctctgt 2016942DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 169cagacgtgtg ctcttccgat cttctcagtt ccgatttccc ag
4217020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 170tcaggatctg aggtcccaac
2017142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 171cagacgtgtg ctcttccgat cttcacctgt
gtatctcacg ca 4217220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 172agagctgtct agcccaggtg
2017342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 173cagacgtgtg ctcttccgat cttggtgtcc
tttctctgct cc 4217420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 174cttaacgtgg gagtggaacc
2017542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 175cagacgtgtg ctcttccgat ctgtgtgcaa
atggcagcta ga 4217620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 176tctcagcttc caccaaggtt
2017742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 177cagacgtgtg ctcttccgat cttcactggg
acacttttgc ct 4217820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 178caggggagag tgtggtgttt
2017942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 179cagacgtgtg ctcttccgat ctgacatgca
ctcagctctt gg 4218023DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 180tgcatagttc ccatgttaaa
tcc 2318142DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 181cagacgtgtg ctcttccgat
cttaccagga atggatgtcg ct 4218220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 182acatcctacg gtcccaaggt 2018341DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 183cagacgtgtg ctcttccgat ctgcagaagt gcaggcacct a
4118420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 184tgcatgatca aatgcaacct
2018543DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 185cagacgtgtg ctcttccgat ctttggactt
tgggcataaa aga 4318620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 186aaatcacggc agttttcagc 2018742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 187cagacgtgtg ctcttccgat ctctcatctg tgcactctcc cc
4218820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 188gtgggaagag aagctgatgc
2018942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 189cagacgtgtg ctcttccgat cttcaagcat
tatccacgtc ca 4219021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 190tgtgatgcca tatcaagtcc a
2119145DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 191cagacgtgtg ctcttccgat cttcagtgta
tgcgaaaagg ttttt 4519220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 192agcctctctt gggctttctt 2019342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 193cagacgtgtg ctcttccgat ctgttttccc tgcctggaac tt
4219420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 194ctttgctgct gaaggctcat
2019542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 195cagacgtgtg ctcttccgat ctacaagtgg
tggtaaccct gg 4219620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 196tgcttcctaa aaagcgaggt
2019742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 197cagacgtgtg ctcttccgat ctgaactagg
gagggggaaa ga 4219820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 198gcagccaacc taagcaagat
2019942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 199cagacgtgtg ctcttccgat ctatccagtt
actgccggtt tg 4220020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 200gaatgctgca
ggacttgaga
2020142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 201cagacgtgtg ctcttccgat ctacttcctt
gagacacgga gc 4220220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 202acccagggac ttaatcagca
2020343DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 203cagacgtgtg ctcttccgat ctgctgatga
gacagcaacc att 4320419DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 204gacatctttg ctgcctcca 1920542DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 205cagacgtgtg ctcttccgat ctatgagaag gacactcgct gc
4220621DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 206ttaaggagtt cctgcagtcc a
2120742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 207cagacgtgtg ctcttccgat cttccactgg
gcacagaact ta 4220820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 208tccttcgctt tgcttgtctt
2020945DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 209cagacgtgtg ctcttccgat ctaggtggaa
aaatagatgc cagtc 4521019DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 210cccggaagtc tatgcgttt 1921141DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 211cagacgtgtg ctcttccgat ctaggacatc tcggtgcagt g
4121220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 212tgtgtgaggt gtctggcttc
2021340DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 213cagacgtgtg ctcttccgat ctaggagcac
cacgttctgg 4021420DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 214cccggagaag tatgtgacca
2021541DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 215cagacgtgtg ctcttccgat ctgtacttcg
cccacagcat c 4121618DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 216ctgaacgagc tggtgacg
1821742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 217cagacgtgtg ctcttccgat ctagtacctg
acttgggcat cc 4221818DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 218caagggccca tcggtctt
1821944DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 219cagacgtgtg ctcttccgat ctttgtgaca
aaactcacac atgc 4422018DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 220caagggccca tcggtctt 1822141DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 221cagacgtgtg ctcttccgat ctcaaatatg gtcccccatg c
4122218DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 222caagggccca tcggtctt
1822342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 223cagacgtgtg ctcttccgat ctgcaaatgt
tgtgtcgagt gc 4222418DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 224caagggccca tcggtctt
1822542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 225cagacgtgtg ctcttccgat ctaccccact
tggtgacaca ac 4222620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 226ccattccgca gtactccatt
2022742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 227cagacgtgtg ctcttccgat ctaaggaaaa
gagcaaacgt gg 4222820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 228ttggttgact tcatggatgc
2022945DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 229cagacgtgtg ctcttccgat ctggaaacag
cacaaatgaa cttaa 4523020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 230catcatgcag ttcaacaagc 2023142DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 231cagacgtgtg ctcttccgat ctatgcactc tgtttgcgaa ga
4223220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 232gggtgtgttt ccatgtctca
2023342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 233cagacgtgtg ctcttccgat ctttgaaagt
gtgtgtgtcc gc 4223420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 234tcaggctgtt gcatgaagaa
2023542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 235cagacgtgtg ctcttccgat ctgtatgccc
ttgctggacc ta 4223620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 236atgcgcagta aaaactcgtg
2023742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 237cagacgtgtg ctcttccgat cttacagttc
cacgctgagc tg 4223821DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 238gcctgtactt tcagctgggt a
2123942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 239cagacgtgtg ctcttccgat ctaaggtgtt
tgtgccattt gg 4224020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 240ggtgagctct gattgcttca
2024142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 241cagacgtgtg ctcttccgat cttatcagga
ggcagggatc ac 4224219DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 242gaccgggtca gtggtctct
1924341DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 243cagacgtgtg ctcttccgat ctggtgatcc
tgagccctga c 4124420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 244tgcagtgagc tgagatcgag
2024542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 245cagacgtgtg ctcttccgat ctatggaaaa
catcctcatg gc 4224621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer"source/note="Description of
Combined DNA/RNA Molecule Synthetic primer" 246cacatggccu
ccaaggagua a 2124742DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 247cagacgtgtg ctcttccgat
ctcagcaaga gcacaagagg aa 4224819DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 248gcagggtccc agtcctatg 1924942DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 249cagacgtgtg ctcttccgat ctccaatcat gaggaagatg ca
4225020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 250taggagcagg cctgagaaaa
2025142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 251cagacgtgtg ctcttccgat ctgattcctc
tccaaaccca tg 4225220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 252tccttcgctt tgcttgtctt
2025345DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 253cagacgtgtg ctcttccgat ctaggtggaa
aaatagatgc cagtc 4525419DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 254ggtaaacacg cctgcaaac 1925542DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 255cagacgtgtg ctcttccgat ctcaggactc agaagcctct gg
4225624DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 256caacaaagca cagtgttaaa tgaa
2425742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 257cagacgtgtg ctcttccgat cttgtgtcag
ctactgcgga aa 4225820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 258tgtgtgaggt gtctggcttc
2025940DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 259cagacgtgtg ctcttccgat ctaggagcac
cacgttctgg 4026020DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 260cccggagaag tatgtgacca
2026141DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 261cagacgtgtg ctcttccgat ctgtacttcg
cccacagcat c 4126220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 262tccaggagga ttaccgaaaa
2026342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 263cagacgtgtg ctcttccgat ctccatccaa
gggagagtga ga 4226420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 264agatctgagc cagtcgctgt
2026543DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 265cagacgtgtg ctcttccgat cttggtgcag
agctgaagat ttt 4326620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 266aaaagtgggc ttgattctgc 2026742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 267cagacgtgtg ctcttccgat ctttttgttc gcatggtcac ac
4226820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 268tgagcagatc cacaggaaaa
2026944DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 269cagacgtgtg ctcttccgat ctgaaatgga
gtctcaaagc ttca 4427020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 270cccccgaaaa tgttcaataa 2027141DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 271cagacgtgtg ctcttccgat cttgctcttg tcataccccc a
4127220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 272atattccttt gggcctctgc
2027342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 273cagacgtgtg ctcttccgat cttcaagttt
gggtctgtgc tg 4227420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 274ccccaaccac ttcattcttg
2027543DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 275cagacgtgtg ctcttccgat ctttcaattc
ctctgggaat gtt 4327620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 276aatggcaaag gaaggtggat 2027742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 277cagacgtgtg ctcttccgat ctgcagacac cttggacatc ct
4227823DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 278tgcatagttc ccatgttaaa tcc
2327942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 279cagacgtgtg ctcttccgat cttaccagga
atggatgtcg ct 4228023DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 280aaatctgcag aaggaaaaat
gtg 2328142DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 281cagacgtgtg ctcttccgat
ctagttttca atgatgggcg ag 4228220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 282tcgaataatc cagggaaacc 2028342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 283cagacgtgtg ctcttccgat ctaccaaagc atcacgttga ca
4228420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 284ctggctctcc ccaatatcct
2028542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 285cagacgtgtg ctcttccgat ctgctctgag
gactgcacca tt 4228620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 286gcagccaacc taagcaagat
2028742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 287cagacgtgtg ctcttccgat ctatccagtt
actgccggtt tg 4228820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 288tgcctagagg tgctcattca
2028942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 289cagacgtgtg ctcttccgat ctgttgatgc
tggaggcaga at 4229019DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 290gacatctttg ctgcctcca
1929142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 291cagacgtgtg ctcttccgat ctatgagaag
gacactcgct gc 4229220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 292ttggacatag cccaagaaca
2029342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 293cagacgtgtg ctcttccgat cttgtgcctc
actggacttg tc 4229420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 294aaatcacggc agttttcagc
2029542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 295cagacgtgtg ctcttccgat ctctcatctg
tgcactctcc cc 4229620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 296atgctgaagg catttcttgg
2029742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 297cagacgtgtg ctcttccgat ctctgtgagc
atggtgcttc at 4229820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 298gactgcggat ctctgtgtca
2029942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 299cagacgtgtg ctcttccgat cttctgcact
attcctttgc cc 4230020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 300ccgtgaggat
gtcactcaga
2030142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 301cagacgtgtg ctcttccgat ctacgaggaa
gccctaagac gt 4230220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 302agacaggtcc ttttcgatgg
2030342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 303cagacgtgtg ctcttccgat cttgtgcaat
atgtgatgtg gc 4230420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 304tgttttgggg aaagttggag
2030542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 305cagacgtgtg ctcttccgat ctctgtttgc
ccagtgtttg tg 4230620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 306acatcctacg gtcccaaggt
2030741DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 307cagacgtgtg ctcttccgat ctgcagaagt
gcaggcacct a 4130820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 308agagctgtct agcccaggtg
2030942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 309cagacgtgtg ctcttccgat cttggtgtcc
tttctctgct cc 4231020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 310tgacgtgtgt tgcttttgtg
2031142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 311cagacgtgtg ctcttccgat ctacttggga
gaaaacaggg gt 4231220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 312gctttccact cccagctatg
2031342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 313cagacgtgtg ctcttccgat cttgctttga
gtgctacgga ga 4231420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 314gggggaggga tgtgaagtta
2031542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 315cagacgtgtg ctcttccgat ctatcttgtc
tgtgattccg gg 4231621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 316acagatgacc caatgcaatt c
2131742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 317cagacgtgtg ctcttccgat ctgagcacct
gtgatatgtg cg 4231820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 318agaccgatgc acagtcttcc
2031942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 319cagacgtgtg ctcttccgat ctcttcacgt
ctggcctcag tc 4232020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 320ggagcactca agtgtgacga
2032142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 321cagacgtgtg ctcttccgat ctttttctat
ggagccttcc ga 4232220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 322catccaattc ccaaggacag
2032342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 323cagacgtgtg ctcttccgat ctggtgaagg
tgccgagcta ta 4232420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 324gctcttcctc aaaccacgaa
2032542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 325cagacgtgtg ctcttccgat ctcacactcc
tttgcttagc cc 4232620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 326tcctcacacc acgaatctga
2032742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 327cagacgtgtg ctcttccgat ctcactcctt
tgcttagccc ac 4232820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 328ccagctcacc tgttctccag
2032941DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 329cagacgtgtg ctcttccgat ctgaatcccg
tacctgctgc t 4133020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 330ctaaaggact gccagccaag
2033142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 331cagacgtgtg ctcttccgat ctataacctg
acactggacg gg 4233220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 332cacattcctg tgcattgagg
2033342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 333cagacgtgtg ctcttccgat ctatactcag
ttcggaaggg gc 4233420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 334gaaggaggga gacatgagca
2033542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 335cagacgtgtg ctcttccgat ctactggtcc
ttagccccat ct 4233620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 336tcagttggct gacttccaca
2033742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 337cagacgtgtg ctcttccgat ctttagtttg
ggggttttgc tg 4233821DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 338tcttggccag ggtagtaaga a
2133942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 339cagacgtgtg ctcttccgat ctgtcagttc
caatgaggtg gg 4234020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 340cgtccagacc ttgttcacac
2034143DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 341cagacgtgtg ctcttccgat ctccacaaat
agtgctcgct ttc 4334220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 342tagagggcca ggacatcatc 2034342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 343cagacgtgtg ctcttccgat ctttgctcct tttgctatgc ct
4234420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 344tgctattgac cgatgcttca
2034542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 345cagacgtgtg ctcttccgat ctgcaacggg
ctacagcttt at 4234620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 346gctcttgttc ttgccgtttt
2034742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 347cagacgtgtg ctcttccgat ctgagtccct
cagtggagca ag 4234822DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 348cacaagcaca ttcatctctt
cc 2234942DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 349cagacgtgtg ctcttccgat
ctattcaggg ccagcttcat aa 4235020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 350tacttcaagg gagccattcc 2035142DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 351cagacgtgtg ctcttccgat cttttgtaac tgtgcagggc ag
4235221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 352agcaacgtgg agtcagtctg t
2135342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 353cagacgtgtg ctcttccgat ctctcacctt
ctcttgcctt gg 4235421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 354ttattttctg gggctgtcag a
2135542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 355cagacgtgtg ctcttccgat ctcattctgg
cactcaggtg aa 4235620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 356tgatcaagca cctgagaacg
2035742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 357cagacgtgtg ctcttccgat cttaccagtg
caccatctgc ac 4235821DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 358tgcaaaaccc agaagctaaa a
2135942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 359cagacgtgtg ctcttccgat ctgttctgtg
caaatggcat tc 4236020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 360agagctgtgt ggagctggat
2036142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 361cagacgtgtg ctcttccgat ctggagtctt
ctgctttgct gg 4236220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 362gccctcttgc caggatattt
2036342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 363cagacgtgtg ctcttccgat ctgcatgtaa
gttgtccccc at 4236420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 364ctggcctctg ctcaactagc
2036542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 365cagacgtgtg ctcttccgat ctatggtaca
agcaatgcct gc 4236620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 366cagcctcaag gggaaggtat
2036742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 367cagacgtgtg ctcttccgat cttgcttaac
ccatggatcc tg 4236820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 368ccctgcagtc acagctacac
2036942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 369cagacgtgtg ctcttccgat cttcagggct
ggtcttttag ga 4237023DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 370tgggataatg taaaactggt
gct 2337142DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 371cagacgtgtg ctcttccgat
ctcatcccca tgatatttgg ga 4237220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 372agctagcctg agagggaacc 2037342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 373cagacgtgtg ctcttccgat cttcctccag accattcagg ac
4237420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 374ggctctgcct tgcactattt
2037541DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 375cagacgtgtg ctcttccgat ctctcttcct
cccttccatg c 4137620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 376taaggcccaa agtgggtaca
2037742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 377cagacgtgtg ctcttccgat cttaggaagc
acgaggaaag ga 4237820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 378accctctctc cctccctttc
2037942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 379cagacgtgtg ctcttccgat cttagttggc
tatgctggca tg 4238021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 380gcctggtaga attggctttt c
2138145DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 381cagacgtgtg ctcttccgat ctttttgtag
ccaacattca ttcaa 4538220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 382caggggagag tgtggtgttt 2038342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 383cagacgtgtg ctcttccgat ctactcagct cttggctcca ct
4238421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 384acatcaagct ccattgtttc g
2138543DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 385cagacgtgtg ctcttccgat cttttgcctg
cactctttgt agg 4338620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 386gcctggcacg taatagcttg 2038742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 387cagacgtgtg ctcttccgat ctaggaaaga aatgcccttg gt
4238820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 388gaggatgtgt ggcattttca
2038942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 389cagacgtgtg ctcttccgat ctggttccta
ggtgagcagg tg 4239020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 390agcaggctgt acacagcaga
2039142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 391cagacgtgtg ctcttccgat ctgacactag
gcacattggc tg 4239220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 392actgtgccct catccagaac
2039342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 393cagacgtgtg ctcttccgat ctaacgacgc
caaggtgata ct 4239421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 394tggtgaaatg cagagtcaat g
2139542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 395cagacgtgtg ctcttccgat cttcaggagg
aaggcttaca cc 4239620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 396tgaattttgc ttggtggatg
2039743DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 397cagacgtgtg ctcttccgat cttgtcagtg
gaagaagcag atg 4339820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 398cagtgagaat gagggccaag 2039942DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 399cagacgtgtg ctcttccgat ctgaatgagg gccaagaaag ag
4240020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 400aaaatgaaac cctccccaaa
2040142DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 401cagacgtgtg ctcttccgat
cttcctttgg agattaaggc cc 4240220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 402ctgcatcaat gctcaaggaa 2040342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 403cagacgtgtg ctcttccgat ctccaaggct gctctgtttc tt
4240420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 404aaatcaagct cccaaggtca
2040542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 405cagacgtgtg ctcttccgat cttgtgaatg
acttggtccc tg 4240619DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 406atgccccaaa gcgattttt
1940742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 407cagacgtgtg ctcttccgat ctcaaaggaa
accaatgcca ct 4240820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 408tccctcattg aaagatgcaa
2040942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 409cagacgtgtg ctcttccgat cttagaatca
ttaggccagg cg 4241020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 410tgcaagccat ttatgggaat
2041144DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 411cagacgtgtg ctcttccgat ctccttgggt
tttcttttca attc 4441220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 412atttccatgg tgctccagtc 2041342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 413cagacgtgtg ctcttccgat ctagagaagc agaagtcgct cg
4241418DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 414ctgctggccc tgtacctg
1841540DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 415cagacgtgtg ctcttccgat ctctccaccc
tggccaagat 4041621DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 416ttcagctgac ttggacaacc t
2141742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 417cagacgtgtg ctcttccgat ctggacaacc
tgactggctt tg 4241820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 418gggtgttggt gaacttggtt
2041942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 419cagacgtgtg ctcttccgat cttttaatat
ggatgccgtg gg 4242020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 420gttgcccagt gtgtttctga
2042142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 421cagacgtgtg ctcttccgat ctaaccaggc
aacttgggaa ct 4242220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 422ccattccgca gtactccatt
2042342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 423cagacgtgtg ctcttccgat ctaaggaaaa
gagcaaacgt gg 4242420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 424ttggttgact tcatggatgc
2042545DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 425cagacgtgtg ctcttccgat ctggaaacag
cacaaatgaa cttaa 4542620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 426catcatgcag ttcaacaagc 2042742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 427cagacgtgtg ctcttccgat ctatgcactc tgtttgcgaa ga
4242820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 428gggtgtgttt ccatgtctca
2042942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 429cagacgtgtg ctcttccgat ctttgaaagt
gtgtgtgtcc gc 4243020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 430tcaggctgtt gcatgaagaa
2043142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 431cagacgtgtg ctcttccgat ctgtatgccc
ttgctggacc ta 4243220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 432atgcgcagta aaaactcgtg
2043342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 433cagacgtgtg ctcttccgat cttacagttc
cacgctgagc tg 4243421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 434gcctgtactt tcagctgggt a
2143542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 435cagacgtgtg ctcttccgat ctaaggtgtt
tgtgccattt gg 4243620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 436ggtgagctct gattgcttca
2043742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 437cagacgtgtg ctcttccgat cttatcagga
ggcagggatc ac 4243819DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 438gaccgggtca gtggtctct
1943941DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 439cagacgtgtg ctcttccgat ctggtgatcc
tgagccctga c 4144020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 440tgcagtgagc tgagatcgag
2044142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 441cagacgtgtg ctcttccgat ctatggaaaa
catcctcatg gc 4244221DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer"source/note="Description of
Combined DNA/RNA Molecule Synthetic primer" 442cacatggccu
ccaaggagua a 2144342DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 443cagacgtgtg ctcttccgat
ctcagcaaga gcacaagagg aa 4244420DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 444gacttcaaca gcgacaccca 2044542DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 445cagacgtgtg ctcttccgat ctgccctcaa cgaccacttt gt
4244620DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 446gaaaacgcat cctggaccca
2044743DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 447cagacgtgtg ctcttccgat cttgatgtca
ttgccactct gct 4344820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 448aagttgtccc ccatcccaaa 2044943DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 449cagacgtgtg ctcttccgat ctctggggat ggactgggta aat
4345020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 450actgctgtcc caaacatgca
2045143DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 451cagacgtgtg ctcttccgat ctatgcctgc
ccattggaga gaa 4345220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 452ccaccatctt tgcaggttgc 2045342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 453cagacgtgtg ctcttccgat ctgctgtcca gttcccagaa gg
4245420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 454ctgggagagg gggtagctag
2045542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 455cagacgtgtg ctcttccgat ctaccacttc
cctcagtccc aa 4245620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 456acagaagcag cgtcagtacc
2045741DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 457cagacgtgtg ctcttccgat ctgggtctct
tgagtcccgt g 4145820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 458ggggagagtg tggtgtttcc
2045942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 459cagacgtgtg ctcttccgat ctctcttggc
tccactggga tg 4246020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 460atcaatggtc caagccgcat
2046142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 461cagacgtgtg ctcttccgat ctaggtcaca
gatcttcccc cg 4246220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 462ctttccagtc ctacggagcc
2046342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 463cagacgtgtg ctcttccgat cttgctctga
accccaatcc tc 4246420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 464accatcacag gcatgttcct
2046542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 465cagacgtgtg ctcttccgat cttgtagatg
acctggcttg cc 4246620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 466gcatctcatg agtgccaagc
2046743DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 467cagacgtgtg ctcttccgat ctcctgcccc
cagacctttt atc 4346820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 468tgcagagcct tgtcgttaca 2046942DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 469cagacgtgtg ctcttccgat ctcgtgacag agtgcctttt cg
4247021DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 470aggtgaagat gacagtgcag g
2147142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 471cagacgtgtg ctcttccgat ctaggccctc
ttgtgtgtaa ca 4247220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 472ggaaccatgt gccaagttgc
2047342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 473cagacgtgtg ctcttccgat ctcctttgtt
gtgcgagggt gt 4247420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 474agtgttgctg acagtgcaga
2047543DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 475cagacgtgtg ctcttccgat ctccaaagaa
gacacagacc ggt 4347620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 476ttgccacaaa gcctggaatc 2047742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 477cagacgtgtg ctcttccgat ctaaagcaac cttgtcccgc ct
4247820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 478ggagtccagc gaatgacgtc
2047942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 479cagacgtgtg ctcttccgat ctcatggcca
cgttgtcatt gt 4248020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 480caacacccag gggatcagtg
2048142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 481cagacgtgtg ctcttccgat ctccaccctc
cacaggaaat tg 4248219DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 482agctgtacca gggggagag
1948343DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 483cagacgtgtg ctcttccgat ctctttggag
aagacagtgg cga 4348421DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 484ggaagacagc cagatccagt g 2148542DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 485cagacgtgtg ctcttccgat ctttgtgcag accaagagca cc
4248620DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 486gggctgagaa tgaggcagtt
2048742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 487cagacgtgtg ctcttccgat ctggaaagcg
acaagggtga ac 4248819DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 488acttaacagc tgcaggggc
1948945DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 489cagacgtgtg ctcttccgat ctactaactt
gaaccgtgtt taagg 4549020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 490ttataaccat cagcccgcca 2049142DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 491cagacgtgtg ctcttccgat ctagaaaagg ggctggaaag gg
4249221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 492accaaagcat cacgttgaca t
2149342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 493cagacgtgtg ctcttccgat ctacatgtga
atgttgagcc ca 4249420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 494ctcttcagca tcccccgtac
2049542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 495cagacgtgtg ctcttccgat ctgcccccaa
atgaaagctt ga 4249620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 496ggagagcgtc cattccagtg
2049741DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 497cagacgtgtg ctcttccgat ctatccacct
gaagctgcac c 4149820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 498aatgtaccag ccagtcagcg
2049942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 499cagacgtgtg ctcttccgat ctggttttgg
tggagctgac ga 4250020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 500tttactcatc gggcagccac
2050142DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 501cagacgtgtg ctcttccgat
cttgtttgcc cagtgtttgt gc 4250221DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 502gctgtagaca ggtccttttc g 2150347DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 503cagacgtgtg ctcttccgat ctagtgttgg aaaatgtgca atatgtg
4750420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 504gggtctggtg ggcatcatta
2050542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 505cagacgtgtg ctcttccgat ctgcctcttc
gattgctccg ta 4250620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 506aggtcaatgc cagagacgga
2050749DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 507cagacgtgtg ctcttccgat ctatcagcat
acctttattg tgatctatc 4950820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 508tggcatgtga gtcattgctc 2050942DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 509cagacgtgtg ctcttccgat ctttttgatg tgaggggcgg at
4251020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 510tactttttcg cctcccaggg
2051142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 511cagacgtgtg ctcttccgat cttcctgccc
caccaagatc at 4251220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 512tgccacggcc tttccttaaa
2051342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 513cagacgtgtg ctcttccgat ctttgtctaa
gtgcaaccgc ct 4251420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 514ctcctgacag aaggtgccac
2051542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 515cagacgtgtg ctcttccgat ctggtgattg
gaccaggcca tt 4251620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 516gactggctac gtagttcggg
2051742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 517cagacgtgtg ctcttccgat cttttgctta
gaaggatggc gc 4251820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 518agctacggaa ctcttgtgcg
2051942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 519cagacgtgtg ctcttccgat ctcaaccttg
gctgagtctt ga 4252020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 520tcagtcttta ggggttgggc
2052145DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 521cagacgtgtg ctcttccgat ctatgtgcat
ttcaatccca cgtac 4552221DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 522ccagtctagt ttctgggcag g 2152345DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 523cagacgtgtg ctcttccgat ctatgtaaac cattgctgtg ccatt
4552420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 524ccagttcttc ctgacaccgg
2052543DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 525cagacgtgtg ctcttccgat ctccaaagtt
tgcagcctat acc 4352620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 526accaaccaga ccaggactta 2052743DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 527cagacgtgtg ctcttccgat cttcactagg agacgtggaa ttg
4352819DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 528cacccgtcca gaccttgtt
1952947DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 529cagacgtgtg ctcttccgat cttgttttcc
tcttaacgtt agaccac 4753021DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 530tgcaagagtg acagtggatt g 2153146DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 531cagacgtgtg ctcttccgat ctgctgatat tctgcaacac tgtaca
4653219DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 532tgtcctcacg gtgcctttt
1953342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 533cagacgtgtg ctcttccgat ctgtaggcag
acacagggac tt 4253421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 534cctcaagggg gactgtcttt c
2153542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 535cagacgtgtg ctcttccgat ctgcatatcc
tgagccatcg gt 4253620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 536attgctggta gagaccccca
2053740DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 537cagacgtgtg ctcttccgat ctcccccatt
tccccgatgt 4053820DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic primer" 538cccagccagc tgtggtattc
2053942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 539cagacgtgtg ctcttccgat cttggaactg
aactgagctg ct 4254020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 540ctaggcagcc aacctaagca
2054142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 541cagacgtgtg ctcttccgat ctcctgcaat
ctgagccagt gc 4254220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 542agtggacctt aggccttcct
2054343DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 543cagacgtgtg ctcttccgat ctggctcaga
catgttttcc gtg 4354421DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 544tcacttaaga cccagggact t 2154545DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 545cagacgtgtg ctcttccgat ctaagcatca tctcaacact gactt
4554620DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 546accatgagaa ggacactcgc
2054742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 547cagacgtgtg ctcttccgat ctcgggcttg
aattcctgtc ct 4254819DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 548cggcaaatgt agcatgggc
1954943DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 549cagacgtgtg ctcttccgat ctggaaagtg
gctatgcagt ttg 4355021DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 550ggcatcctcc acaatagcag a 2155143DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 551cagacgtgtg ctcttccgat ctgcattttg gtccaagttg tgc
4355220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 552cttaaagccc gcctgacaga
2055342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 553cagacgtgtg ctcttccgat ctacattctg
atgagcaacc gc 4255420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 554acagacgact ttgagcctcg
2055542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 555cagacgtgtg ctcttccgat ctatttcacc
ttttcctgcg gc 4255620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 556ggagccaagg gttcagagac
2055742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 557cagacgtgtg ctcttccgat cttgctacct
cactggggtc ct 4255820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 558ggccatctct tcctttcgga
2055941DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 559cagacgtgtg ctcttccgat ctgtgtggga
actctgccgt g 4156021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 560ctcaccccat catccctttc c
2156142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 561cagacgtgtg ctcttccgat ctgcccagtg
agactgtgtt gt 4256220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 562tactgacggc atgttaggtg
2056342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 563cagacgtgtg ctcttccgat cttgtgtgtg
gagtgggatg tg 4256420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 564aggcagggag gggactattt
2056542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 565cagacgtgtg ctcttccgat ctggagaaac
agagacaggc cc 4256619DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 566gcagtgagaa tgagggcca
1956742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 567cagacgtgtg ctcttccgat ctaggcatac
tgacactttg cc 4256820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 568agccagtcca ggagtgagac
2056942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 569cagacgtgtg ctcttccgat ctggccacac
tgaccctgat ac 4257020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 570cccaaggtca agatcgccac
2057142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 571cagacgtgtg ctcttccgat ctctgccagc
tccagaagat gt 4257221DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 572tgggaagcca aactccatca t
2157343DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 573cagacgtgtg ctcttccgat ctggaaacca
atgccacttt tgt 4357421DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 574gccttcaaga ctgaacaccg a 2157543DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 575cagacgtgtg ctcttccgat ctgcccctca gagatcaaca gac
4357620DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 576ttggagaagg tgctggtgac
2057742DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 577cagacgtgtg ctcttccgat ctcttaccca
gtgctctgca ac 4257820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 578tattcctttg cccggcatca
2057942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 579cagacgtgtg ctcttccgat ctaccttggg
cactgttgaa gt 4258020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 580acttgcacat catggagggt
2058147DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 581cagacgtgtg ctcttccgat cttccataag
ctattttggt ttagtgc 4758220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 582ggtccctcca aaccgttgtc 2058344DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 583cagacgtgtg ctcttccgat ctgaactagg gagggggaaa gaag
4458420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 584tgggagttga tcgcctttcc
2058543DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 585cagacgtgtg ctcttccgat ctctcattct
gaaggagccc cat 4358620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 586tggactggtt gttgccaaac 2058742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 587cagacgtgtg ctcttccgat ctctctgaga gttcccctgt cc
4258820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 588ttcctcctca tcaccatcgc
2058942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 589cagacgtgtg ctcttccgat ctcttaccac
ccctcagagt gc 4259020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 590gaagctgaat gcctgagggg
2059141DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 591cagacgtgtg ctcttccgat ctgtcccatc
tgctatgccc a 4159220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 592gagtgctgcc tggagtactt
2059342DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 593cagacgtgtg ctcttccgat ctctcacccc
agactcctga ct 4259420DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 594gctatggtga gccgtgattg
2059542DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 595cagacgtgtg ctcttccgat cttcctcacc
cccacctctc ta 4259620DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 596gacctcagag gcctcctact
2059741DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 597cagacgtgtg ctcttccgat ctccaatatc
ctcgctcccg g 4159820DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 598ttcaggactc cctccagcat
2059942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 599cagacgtgtg ctcttccgat ctaggtacca
aatgcctgtg cc 4260020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 600tgaacttcag ggagggtggt
2060142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 601cagacgtgtg ctcttccgat
cttcctcgta tgcatggaac cc 4260220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 602ccaaagggaa gagtgcaggg 2060349DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 603cagacgtgtg ctcttccgat ctattctgta taacactcat atctttgcc
4960421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 604agaatcatta ggccaggcgt g
2160543DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 605cagacgtgtg ctcttccgat ctctggccaa
tatgctgaaa ccc 4360620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 606atttgaggct gcagtgagct 2060742DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 607cagacgtgtg ctcttccgat ctagacaaga gctggctcac ct
4260820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 608cctccccagc ctttgatcag
2060942DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 609cagacgtgtg ctcttccgat cttcctcgca
agctgggtaa tc 4261020DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 610ccagcaccag ggagtttcta
2061142DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 611cagacgtgtg ctcttccgat ctacagcatg
tcacaaggct gt 4261220DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic primer" 612aggcagatgg aacttgagcc
2061344DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 613cagacgtgtg ctcttccgat ctgcattcga
agatccccag actt 4461420DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 614tccccatcgt cctccttgtc 2061541DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 615cagacgtgtg ctcttccgat ctttgccggc tctccagagt a
4161624DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 616gttcccatgt taaatcccat tcat
2461747DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 617cagacgtgtg ctcttccgat cttaccagga
atggatgtcg ctaatca 4761820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 618accctctctc cctccctttc 2061942DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 619cagacgtgtg ctcttccgat cttagttggc tatgctggca tg
4262020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 620ccccaaccac ttcattcttg
2062143DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 621cagacgtgtg ctcttccgat ctttcaattc
ctctgggaat gtt 4362220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 622cctcccccag tctctcttct 2062342DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 623cagacgtgtg ctcttccgat ctgagtcagg ccgttgctag tc
4262420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 624ctgcctcggt gagttttctc
2062520DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 625cttcccgtta cggttttgac
2062620DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 626aaaaccggat taggccatta
2062720DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 627tctcgtcatg accgaaaaag
2062820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 628caacgcctac aaaagccagt
2062920DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 629gtggcaaagc aaaagttcaa
2063022DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 630tgagaaagcg tttgatgatg ta
2263120DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 631gccagtttat cccgtcaaag
2063220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 632cttcccgtta cggttttgac
2063320DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 633aaaaccggat taggccatta
2063420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 634tctcgtcatg accgaaaaag
2063520DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 635caacgcctac aaaagccagt
2063620DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 636ttgactttgc cttggagagc
2063724DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 637tttttcttac agtgtcttgg cata
2463819DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 638cgtgacccta agcgaggag
1963921DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 639tttgcagtga tttgaagacc a
2164020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 640ggcattcctt cttctggtca
2064123DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 641ctgggctata tacagtcctc aaa
2364221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 642ggggtgatta tgaccagttg a
2164320DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 643tgcatgatca aatgcaacct
2064421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 644tcttccgaaa aatcctcttc c
2164519DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 645ctggggtccc agtcctatg
1964621DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 646tgtactggga aggcaatttc a
2164718DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 647gagccgctgg ggttactc
1864821DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 648cagttagttg ctgcacatgg a
2164920DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 649ttgcatttct tttggggaag
2065020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 650gtcatgcatg cagatggaag
2065120DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 651gctgcagtga gctgtgatgt
2065219DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 652gttcctctcc gagctcacc
1965320DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 653tccgaaagtt tccaattcca
2065421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 654ttgtttggga gactctgcat t
2165520DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 655gaccccactt ggactggtag
2065620DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 656gtgatcttga ttgcggcttt
2065720DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 657gggggaaaaa ctacaagtgc
2065820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 658tgattccttt tcctgcctgt
2065920DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 659aaaaacctcc aggccagact
2066020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 660aatcaaaata acgccccaga
2066120DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 661ttgctaaaaa ttggcagagc
2066222DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 662ttgttaagtg ccaaacaaag ga
2266319DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 663aagctgggaa gagcaaagc
1966419DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 664aggacagagg gtggtcgtc
1966521DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 665tgagtgctgt ctccatgttt g
2166622DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 666cctcacagct gttgctgtta tt
2266720DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 667aaaacaccca gctaggacca
2066820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 668aactgaggca cgagcaaagt
2066920DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 669gctttatggg tggatgctga
2067020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 670ataatatcgc cagcctcagc
2067120DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 671tccagagtgt gctggatgac
2067220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 672tgcaagccat ttatgggaat
2067325DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 673tggaatgagg tctcttagta cagtt
2567421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 674tcccagaaac acctgtaagg a
2167520DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 675tgtctaggca ggacctgtgg
2067620DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 676agtgatgctg cgactcacac
2067722DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 677ggctcagaaa gtctctcttt cc
2267820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 678ctcccaaact caggctttca
2067919DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 679aaagcgctgg gattacagg
1968020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 680cgtccagttg cttggagaag
2068120DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 681aataaccttg gctgccgtct
2068220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 682gggaattctc agtgccaact
2068320DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 683gcatcctggg ctacactgag
2068423DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 684tgctgggaac aatgactata aga
2368521DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 685gcctaaaaca ctttgggtgg t
2168620DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 686gggtgcccac aaaatagaga
2068720DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 687gagactgggt ctcgctttgt
2068820DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 688tggggaaggc tttctctagg
2068923DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 689ttcaacttga gtgatctgag ctg
2369020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 690tatgggcaac cctaaggtga
2069120DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 691cgctgcgaca ctacatcaac
2069220DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 692tggagtcttg ctctgtcacc
2069319DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 693acgaggtgaa ggagcaggt
1969420DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 694cgatgccttt gggtagagag
2069520DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 695actgatcgtc caaggactgg
2069627DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 696aaaaagaaat ctggtcttgt tagaaaa
2769724DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 697ttgaaaagtg gtaaggaatt gtga
2469823DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 698caccaagaat tgattttgta gcc
2369920DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 699aaaaatgggg gaaaatggtg
2070020DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 700catggttgaa accccatctc
2070120DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 701ttcaaagcct ccacgactct
2070220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 702gctggaacag gtgcctaaag 2070320DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 703ccctaaggga acgacactca 2070419DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 704acctgctaca agccctgga 1970520DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 705ggatccctaa gaccgtggag 2070618DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 706ccacctcaga ggctccaa 1870727DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 707tgctgtattt taaaagaatg attatga 2770820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 708gtagctggga cgctggttta 2070920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 709attcccttcc ccctacaaga 2071020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 710cctgagtgca acgacatcac 2071118DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 711gggggaacca gcagaaat 1871218DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 712gacctagggc gagggttc 1871320DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 713aattcctgaa gccagatcca 2071425DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 714aaaatgttta ttgttgtagc tctgg 2571523DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 715tttcaagagc tcaacagatg aca 2371619DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 716gactgcccgg acaagtttt 1971719DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 717gagaaggtgc cccaaaatg 1971820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 718agccactgga ctgacgactt 2071921DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 719ggaggactag tgagggaggt g 2172020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 720ggcaagtgat gtggcaatta 2072120DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 721gttggagcac ctggaaagaa 2072219DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 722atgcctgcct caccttcat 1972319DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 723acaggggcac tgtcaacac 1972422DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 724aaaaatcatg tgttgcagct tt 2272520DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 725tgctttcaca acatttgcag 2072620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 726aatgtttcct tgtgcctgct 2072720DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 727atatcctgag ccatcggtga 2072820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 728ttttggtacc ccaggctatg 2072920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 729accccgtggc attacataac 2073020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 730cttccaggag gcacagaaat 2073120DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 731ctaacctggg cgacagagtg 2073225DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 732atatttggac ataacagact tggaa 2573326DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 733tgctgacttt taaaataagt gattcg 2673419DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 734gcggcagagt agccctaac 1973521DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 735tgggctattt ctattgctgc t 2173620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 736aatggaaagt ggctatgcag 2073725DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 737ggttgtagtc actttagatg gaaaa 2573821DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 738tttgtttgac tttgagcacc a 2173926DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 739aatgtttctc tgtaaatatt gccatt 2674020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 740cacccccata tggtcatagc 2074119DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 741agcaccaggt gatcctcag 1974223DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 742tgttttgctg taacattgaa gga 2374319DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 743taatgccaca gtggggatg 1974420DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 744gggcctaaac tttggcagtt 2074522DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 745ttttaccttc catggctctt tt 2274623DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 746gccttactct gattcagcct ctt 2374723DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 747cgtaacaaaa ttcattgtgg tgt 2374820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 748agaaccgctc ctacagcaag 2074920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 749gtgctttctt ttgtgggaca 2075020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 750gggagttctg catttgatcc 2075120DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 751tgggtcagag gacttcaagg 2075221DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 752agggttctga tcacattgca c 2175320DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 753ctgcaggact ggtcgttttt 2075420DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 754agggcagggt agagagggta 2075520DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 755ttcttccatg cggagaaatc 2075620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 756catggctgaa ggaaaccagt 2075720DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 757ttgccagcta tcacatgtcc 2075823DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 758tcttttcctg taccaggttt ttc 2375920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 759tgactgggaa catcttgctg 2076020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 760tggcacctgt acccttcttc 2076122DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 761ttcaatctct tgcactcaaa gc 2276220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 762tggagtcact gccaagtcat 2076320DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 763tttgcatgat gtttgtgtgc 2076420DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 764gcacccactc tgctttgact 2076520DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 765accatgtagc cagctttcaa 2076620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 766gcaactgggc atgagtacct 2076719DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 767ccacaccccc ttcctactc 1976823DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 768agtctgctta tttccagctg ttt 2376922DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 769tcctgttcaa aagtcaggat ga 2277020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 770aaatcacaaa tcccctgcaa 2077120DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 771ctgaacattc cagagcgtgt 2077219DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 772cagtgggacc accctcact 1977321DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 773tctgtagatg acctggcttg c 2177420DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 774tcagaaccaa gatgccaaca 2077520DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 775catgacccag cctatggttt 2077620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 776acctcctgca agaagagctg 2077721DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 777ttgggaggct ttgcttattt t 2177820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 778ctgggaaaca ctccttgcat 2077920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 779caacgaattt ggctacagca 2078022DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 780caaaggtcat aatgctttca gc 2278122DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 781tttgacgtat cttttcatcc aa 2278221DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 782tgttgttggt ttccaaaaag g 2178320DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 783gccaactttt gcatgttttg 2078419DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 784cccaagctga tctggtggt 1978523DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 785tgctgtgaaa gaaacaaaca ttg 2378620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 786gcacgtggat cctgagaact 2078720DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 787ccagcccaga gacactgatt 2078820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 788cacgcccagc taatttttgt 2078919DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 789cctggtggaa gacatgcag 1979020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 790tcacacctgt aatcccagca 2079120DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 791cagagctccg cctcattagt 2079222DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 792tccatttcat cattgtttct gc 2279323DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 793tggtgtttgt aggtcactga aca 2379423DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 794aacatggtcc attcaccttt atg 2379520DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 795agagcgagac tccgtctcaa 2079620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 796agtgagctga gattgcacca 2079720DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 797agacggcctt gagtctcagt 2079818DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 798gggaatccct tcctggtc 1879920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 799cttcctgcct ttctcagcag 2080020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 800tgcaggtgat caagaagacg 2080120DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 801ggttttgagc atgggttcat 2080219DNAArtificial
Sequencesource/note="Description of Artificial Sequence
Synthetic
primer" 802ccagcccact cctatggat 1980320DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 803aaactgggac aggggagaac 2080420DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 804tttgggtagg tgacctgctt 2080521DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 805tcactgaacg aatgagtgct g 2180619DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 806acgatgtgca ggaccagtg 1980720DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 807aatttgcact gaaacgtgga 2080821DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 808ctgttgtggc ccattaaaga a 2180920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 809ttccctccag cagtggtatt 2081020DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 810caccaggaag gaagctgttg 2081121DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 811tttccttgtg ttcttccaag c 2181222DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 812tcgcaggcat tactaatctg aa 2281320DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 813ctctggctgg ctaactggaa 2081418DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 814agagccccac cctcagat 1881521DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 815tgtgcagagt tctccatctg a 2181623DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 816tgcctgttac aaatatcaag gaa 2381720DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 817tttcccttct tgcatccttc 2081820DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 818tgtgaccact ggcattcatt 2081920DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 819ctcacacaca cggcctgtta 2082023DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 820cacttgacca atactgaccc tct 2382120DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 821gtgtgtgccc tgtaacctga 2082220DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 822ccacttccca cttgcagtct 2082321DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 823tgtgtgtgtg tgtgtgtgtg t 2182420DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 824tctcccatgc attcaaactg 2082523DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 825tctaagtgtt cctcactgac agg 2382620DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 826tactctgcag cgaagtgcaa 2082720DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 827ccaagatcac accattgcac 2082825DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
primer" 828atatttggac ataacagact tggaa 2582918DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 829tttttttttt tttttttv 1883010DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 830aaaaaaaaaa 1083131DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 831aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa a
3183217DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 832cgactacgac gactacg
1783318DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 833atgatacgac tagcggat
1883438DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 834cgactacgac gactacgcga
catcgactac gagtcggt 3883524DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 835aatgctatga tacgactagc ggat 2483662DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 836cgactacgac gactacgcga catcgactac gagtcggtaa
tgctatgata cgactagcgg 60at 6283712DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 837agcattaccg ac 1283838DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 838cgactacgac gactacgcga catcgactac gagtcggt
3883924DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 839atccgctagt cgtatcatac cgac
2484056DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 840cgactacgac gactacgcga
catcgactac gagtcggtat gatacgacta gcggat 5684138DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 841cgactacgac gactacgcga catcgactac gagtcggt
3884224RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 842auccgcuagu cguaucauac cgac
2484356DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 843cgactacgac gactacgcga
catcgactac gagtcggtat gatacgacta gcggat 56
* * * * *