U.S. patent application number 16/145790 was filed with the patent office on 2019-03-21 for chimeric antigen receptors and methods of making.
The applicant listed for this patent is BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM. Invention is credited to Laurence J.N. Cooper, Ana Beatriz Korngold, Simon Olivares, Brian A. Rabinovich, Harjeet Singh.
Application Number | 20190085079 16/145790 |
Document ID | / |
Family ID | 53800695 |
Filed Date | 2019-03-21 |
![](/patent/app/20190085079/US20190085079A1-20190321-D00001.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00002.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00003.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00004.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00005.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00006.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00007.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00008.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00009.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00010.png)
![](/patent/app/20190085079/US20190085079A1-20190321-D00011.png)
View All Diagrams
United States Patent
Application |
20190085079 |
Kind Code |
A1 |
Cooper; Laurence J.N. ; et
al. |
March 21, 2019 |
CHIMERIC ANTIGEN RECEPTORS AND METHODS OF MAKING
Abstract
Provided are methods of generating chimeric antigen receptors
(CAR). In some embodiments, library screening of CAR is performed
by generating a vector encoding the CAR from random attachment of
vectors from libraries of vectors encoding antigen-binding domains
(e.g., scFv regions), hinge regions, and endodomains. In some
embodiments, the vectors contain a transposon.
Inventors: |
Cooper; Laurence J.N.;
(Houston, TX) ; Korngold; Ana Beatriz; (Houston,
TX) ; Rabinovich; Brian A.; (Houston, TX) ;
Singh; Harjeet; (Houston, TX) ; Olivares; Simon;
(Houston, TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM |
Austin |
TX |
US |
|
|
Family ID: |
53800695 |
Appl. No.: |
16/145790 |
Filed: |
September 28, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15118245 |
Aug 11, 2016 |
10125193 |
|
|
PCT/US2015/016057 |
Feb 16, 2015 |
|
|
|
16145790 |
|
|
|
|
61940339 |
Feb 14, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 35/02 20180101;
A61P 35/00 20180101; C07K 2319/02 20130101; A61P 31/12 20180101;
C07K 14/70578 20130101; C07K 14/70521 20130101; C07K 2319/03
20130101; C12N 9/1241 20130101; A61P 31/04 20180101; C07K 14/7051
20130101; C07K 2319/00 20130101; C12Y 207/07 20130101; A61K 35/17
20130101; C07K 14/70517 20130101; A61K 2035/124 20130101; C07K
2317/622 20130101; C07K 14/4748 20130101; C12N 15/85 20130101; C07K
14/4746 20130101; A61P 31/00 20180101; A61P 31/10 20180101; C07K
16/2803 20130101 |
International
Class: |
C07K 16/28 20060101
C07K016/28; C07K 14/725 20060101 C07K014/725; C07K 14/705 20060101
C07K014/705; C12N 9/12 20060101 C12N009/12; A61K 35/17 20150101
A61K035/17; C12N 15/85 20060101 C12N015/85; C07K 14/47 20060101
C07K014/47 |
Goverment Interests
[0002] This invention was made with government support under grant
number W81XWH-11-1-0002 awarded by the U.S. Department of the Army.
The government has certain rights in the invention.
Claims
1. A composition comprising: (a) a plurality of first vectors
encoding one or more distinct antigen binding domains; (b) a
plurality of second vectors encoding one or more distinct hinge
domains; and (c) a plurality of third vectors encoding one or more
distinct endodomains; wherein at least two of the first, second and
third vectors comprise a plurality of two or more vectors encoding
distinct antigen binding domains, hinge domains and/or endodomains,
respectively, and further wherein the vectors comprise sites for
homologous recombination to permit the generation of a fourth
vector encoding a chimeric antigen receptor (CAR).
2. The composition of claim 1, wherein the plurality of first
vectors encodes a plurality of distinct antigen binding domains,
the plurality of second vectors encodes one hinge domain, and the
plurality of third vectors encodes a plurality of distinct
endodomains.
3. The composition of claim 1, wherein the plurality of first
vectors encodes a plurality of distinct antigen binding domains,
the plurality of second vectors encodes a plurality of distinct
hinge domains, and the plurality of third vectors encodes a
plurality of distinct endodomains.
4. The composition of claim 1, wherein the plurality of first
vectors encodes a plurality of distinct antigen binding domains,
the plurality of second vectors encodes a plurality of distinct
hinge domains, and the plurality of third vectors encodes a one
endodomain.
5. The composition of claim 1, wherein the plurality of first
vectors encodes one antigen binding domain, the plurality of second
vectors encodes a plurality of distinct hinge domains, and the
plurality of third vectors encodes a plurality of distinct
endodomains.
6-8. (canceled)
9. The composition of claim 1, wherein the composition further
comprises a plurality of fifth vectors encoding one or more
transmembrane domain; wherein the first vectors, the second
vectors, the third vectors, and the fifth vectors comprise sites
for homologous recombination to generate a fourth vector encoding a
chimeric antigen receptor (CAR).
10-19. (canceled)
20. The composition of claim 1, wherein the antigen binding domain
selectively binds CD19, Universal Antigen (mouse), HER-3, GD2,
Gp75, CS1 protein, mesohelin, phosphatidylserine, cMyc, CD22, CD4,
CD44v6, CD45, CD28, CD3, CD3e, CD123, CD138, CD52, CD56, CD74,
CD30, Gp75, CD38, CD33, CD20, Her1/HER3 fusion, GD2, a
carbohydrate, Aspergillus, ROR1, c-MET, EGFR, Dectin, Ebola, a
fungus, GP, HERV-K (HERVK), NY-ESO-1, VEGF-R2, TGF-b2R, IgG4,
Biotin, or 0-AcGD2.
21. (canceled)
22. The composition of claim 1, wherein the hinge region encodes
the 12 AA peptide (GAGAGCAAGTACGGCCTCCTCCCTGCCCCCCTTGCCCCT, SEQ ID
NO: 1), t-20 AA peptide, IgG4 Fc .DELTA. EQ, IgG4 Fe .DELTA. Q,
(t-12AA+t-20AA), mKate, phiLov, dsRed, Venus, eGFP, CH3 HA,
CD8.alpha.+t-20AA), Double t-20 AA, (t-20AA+CD8.alpha.),
(CD8.alpha.+Leucine Zipper Basep1), (CD8.alpha.+Leucine Zipper
Acid1), 2D3, CD8.alpha., or IgG4 Fc.
23. The method of claim 1, wherein at least one of the endodomains
comprise CD3.zeta..
24. The method of claim 1, wherein at least one of the endodomains
comprises one or more ITAM domains.
25. The method of claim 1, wherein at least one of the endodomains
comprise (CD28+CD3.zeta., (CD28+CD27+CD3.zeta.),
(CD28+OX40+CD3.zeta.), (CD28+4-1BB+CD3.zeta.),
(CD28+CD27+OX40+CD3.zeta.), (CD28+4-1BB+CD27+CD3.zeta.),
(CD28+4-1BB+OX40+CD3.zeta.), (4-1BB+CD3.zeta.),
(4-1BB+OX40+CD3.zeta.), (4-1BB+CD27+CD3.zeta.), (CD27+CD3.zeta.),
(CD27+OX40+CD3.zeta.), (CD28A+CO3Q, (CD28A+CD27+CD3.zeta.),
(CD28A+OX40+CD3.zeta.), (CD28A+4-1BB+CD3.zeta.),
(CD28A+4-1BB+OX40+CD3.zeta.), (CD28A+CD27+OX40+CD3.zeta.),
(CD28A+4-BB+CD27+CD3.zeta.), (4-1BB+ICOS+CD3.zeta.),
(CD28+ICOS+CD3.zeta.), (ICOS+CD3.zeta.), CD3.zeta., or CD28
only.
26. (canceled)
27. A method of producing a plurality of vectors each encoding a
chimeric antigen receptor (CAR) comprising: (i) obtaining the
composition comprising a plurality of first vectors encoding one or
more distinct antigen binding domains; a plurality of second
vectors encoding one or more distinct hinge domains; and a
plurality of third vectors encoding one or more distinct
endodomains; wherein at least two of the first, second and third
vectors comprise a plurality of two or more vectors encoding
distinct antigen binding domains, hinge domains and/or endodomains,
respectively, and further wherein the vectors comprise sites for
homologous recombination to permit the generation of a fourth
vector encoding a chimeric antigen receptor (CAR); and (ii)
subjecting the composition to conditions sufficient to allow for
the distinct antigen binding domains, hinge domains and/or
endodomains encoded by said vectors to recombine via homologous
recombination to produce a plurality of fourth vectors, wherein
each of said fourth vectors encodes a CAR.
28. The method of claim 27, wherein the method further comprises
expressing the CAR in a cell.
29. The method of claim 27, wherein the method further comprises
testing the CAR for activity.
30-43. (canceled)
44. The method of claim 27, wherein the first vectors, the second
vectors, and/or the third vectors encode a transposase.
45. The method of claim 27, wherein a sixth vector encodes a
transposase, and wherein the method comprises introducing,
electroporating, or transfecting one or more of said fourth vectors
and said sixth vector into a cell.
46. (canceled)
47. The method of claim 27, further comprising culturing or
providing cells transfected with the CAR in the presence of
artificial antigen presenting cells (aAPCs) that can stimulate
expansion of the CAR-expressing T-cells.
48-52. (canceled)
53. The method of claim 28, wherein the cell is a T cell or a
pluripotent cell.
54-66. (canceled)
67. The method of claim 29, wherein said activity comprises ability
of the CAR to selectively bind a cancer cell, selectively bind a
pathogen, selectively bind a cell involved in an autoimmune disease
or promote activation of a T-cell, destruction of a T cell,
differentiation of a T cell, proliferation of a T cell,
de-differentiation of a T cell, movement of a T cell, cytokine
production by a T cell, or killing by a T cell.
68-88. (canceled)
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/118,245, filed Aug. 11, 2016, as a national
phase application under 35 U.S.C. .sctn. 371 of International
Application No. PCT/US2015/016057, filed Feb. 16, 2015, which
claims the priority benefit of U.S. Provisional Patent Application
No. 61/940,339, filed Feb. 14, 2014, the entirety of each of which
are incorporated herein by reference.
BACKGROUND OF THE INVENTION
Field of the Invention
[0003] The present invention relates generally to the field of
molecular biology and medicine. More particularly, it concerns
methods of generating chimeric antigen receptors (CAR).
Description of Related Art
[0004] Adoptive T cell transfer is a promising therapeutic approach
that may be used for the treatment of cancer. Adoptive T cell
transfer involves isolating and expanding antigen-specific T cells
that can selectively kill tumor cells. Generally, T cells are
removed from a subject and cultured in vitro. A Chimeric Antigen
Receptor (CARs) may be introduced into a T cell in vitro to direct
the T cell, once re-introduced into the subject, to selectively
kill tumor cells based on expression of an antigen (e.g., Wieczorek
et al. 2013; Berry et al., 2013).
[0005] One problem associated with adoptive T cell transfer is that
significant variability exists between which CAR may work more
effectively in certain populations of patients, e.g., for treating
a specific cancer. Due to the very large number of potential
different CAR that could potentially be generated that might
exhibit therapeutic activity against a cancer, it is presently very
difficult for clinicians anticipate which CAR may display
therapeutic activity against a given cancer or subtype of cancer.
Due to the significant therapeutic potential of adoptive T cell
transfer, there is a clear need for improved methods for
identifying and generating new CARs.
SUMMARY OF THE INVENTION
[0006] The present invention provides, in some aspects, methods for
the generation of CAR, and specific CAR are provided. In some
aspects, methods are provided for the generation of large number of
CAR that may be screened for activity against a particular cancer
or sub-type of cancer; in this way, CAR may be generated and
identified that can exhibit improved therapeutic potential against
a particular cancer or sub-type of cancer. CAR provided herein may
be therapeutically administered to a subject or human patient,
e.g., to treat a cancer.
[0007] Clinical data demonstrates that a particular chimeric
antigen receptor (CAR) design targeting T cells to a given
tumor-associated antigen (TAA) may have varying therapeutic
potential in different patients. For example, second generation
CD19-specific CARs activated via chimeric CD28/CD3zeta or
CD137/CD3-zeta can exhibit superior clinical responses when
autologous genetically modified T cells are administered to
patients with acute, rather than chronic, B-lineage leukemia. To
address this problem, provided herein are methods for generating
CAR species that may exhibit an improved anti-tumor effect for a
given tumor.
[0008] For example, methods are provided herein that may be used to
generate and screen a large number of CAR for their ability to
treat a cancer from a given patient; in this way, the methods may
be used to personalize a therapy for a patient and select a
particular CAR that displays an improved therapeutic potential for
a particular patient or subset of patients with a particular
cancer. A clinical approach to gene therapy may utilize the
electro-transfer of DNA plasmids from the Sleeping Beauty (SB)
transposon system, e.g., to reduce the cost and complexity to
manufacture individual CAR designs for small subsets of patients.
These methods for personalizing CAR+ T cells may utilize the
generation a large number of CAR molecules that can be screened and
assessed for their ability to benefit a given patient.
[0009] In some aspects, provided are methods for the high
throughput assembly of CAR molecules using a triple site-specific
recombination system (also referred to as the "EZ-CAR" Platform).
In some embodiments, these methods can allow for the rapid
combination of 3 components of a prototypical CAR from (i) the
single chain variable fragment (scFv) that defines specificity,
(ii) the scaffold/hinge that appends the scFv from the cell
surface, and (iii) one or more intracellular signaling domains. For
example, as shown in the below examples, a CD19-specific CAR that
is activated through chimeric CD28/CD3-zeta was generated using the
EZ CAR platform in parallel with clinical-grade CD19RCD28m.zeta.
CAR+ T cells (CG CAR).
[0010] In some embodiments, a CAR provided herein or generated by
methods according to the present invention may be co-expressed in a
T cell with a membrane bound IL-15. In this way, the T cell may
survive or exist in a quiescent state without significant
proliferation in vitro or in vivo. In contrast, as described
previously T-cells expressing CAR will typically die when cytokines
are withdrawn in vitro, and this cell death may serve as a safety
feature in certain instances when the T cells are administered
clinically. T cell proliferation is typically measured using a
autonomous cell assay. Thus, in contrast to certain previously
identified CAR, where T cells cannot persist in vitro without
antigenic stimulation, CAR are provided herein which may induce
cytotoxicity without autonomous growth in vitro. Depending on the
particular embodiment desired, a CAR produced by methods of the
present invention or provided herein may be expressed in a T cell
either with or without co-expression in the T cell of a membrane
bound IL-15.
[0011] An aspect of the present invention relates to a composition
comprising: (a) a plurality of first vectors encoding one or more
distinct antigen binding domains; (b) a plurality of second vectors
encoding one or more distinct hinge domains; and (c) a plurality of
third vectors encoding one or more distinct endodomains; wherein at
least two of the first, second and third vectors comprise a
plurality of two or more vectors encoding distinct antigen binding
domains, hinge domains and/or endodomains, respectively, and
further wherein the vectors comprise sites for homologous
recombination to permit the generation of a fourth vector encoding
a chimeric antigen receptor (CAR).
[0012] In the present invention, as used in reference to protein
domains and polypeptides such as antigen binding domains, hinge
domains, transmembrane domains, and endodomains, the term
"distinct" means domains having, comprising, or consisting of
different polypeptide (amino acid) sequences. For example, two
"distinct" antigen binding domains may bind the same antigen
(indeed, even the same epitope on that antigen); however, the
antigen binding domains are "distinct" if their sequential amino
acid compositions differ from each other. Likewise, two "distinct"
antigen binding domains, differing in sequential amino acid
composition, may also specifically bind different antigens and
epitopes. Conversely, as used herein, two molecules (polypeptides)
of identical amino acid sequence are not "distinct"
polypeptides.
[0013] In some embodiments, the plurality of first vectors encodes
a plurality of distinct antigen binding domains, the plurality of
second vectors encodes one hinge domain, and the plurality of third
vectors encodes a plurality of distinct endodomains. In some
embodiments, the plurality of first vectors encodes a plurality of
distinct antigen binding domains, the plurality of second vectors
encodes a plurality of distinct hinge domains, and the plurality of
third vectors encodes a plurality of distinct endodomains. In some
embodiments, the plurality of first vectors encodes a plurality of
distinct antigen binding domains, the plurality of second vectors
encodes a plurality of distinct hinge domains, and the plurality of
third vectors encodes a one endodomain. In some embodiments, the
plurality of first vectors encodes one antigen binding domain, the
plurality of second vectors encodes a plurality of distinct hinge
domains, and the plurality of third vectors encodes a plurality of
distinct endodomains. In some embodiments, the antigen binding
domains comprise or consist of scFv. The third vectors may encode a
transmembrane domain. The second vectors may encode a transmembrane
domain. In some embodiments, the composition further comprises a
plurality of fifth vectors encoding one or more transmembrane
domain; wherein the first vectors, the second vectors, the third
vectors, and the fifth vectors comprise sites for homologous
recombination to generate a fourth vector encoding a chimeric
antigen receptor (CAR). The first vector may comprise a first
sequence and a second site of homologous recombination. The second
vector may comprise the second sequence of homologous recombination
and a third sequence of homologous recombination. The third vector
may comprise the third sequence of homologous recombination and a
fourth sequence of homologous recombination. The third vector may
comprise the third sequence of homologous recombination and a
fourth sequence of homologous recombination. The fourth vector
comprises the first sequence of homologous recombination and the
fourth sequence of homologous recombination. The first vector, the
second vector, and/or the third vector may encode a transposase.
The transposase may be a salmonid-type Tc1-like transposase (SB).
In some embodiments, 1, 2, 3, 4, or all of the first vector, the
second vector, the third vector, the fourth vector, and/or the
fifth vector is a Sleeping Beauty (SB) or piggyBac transposon
vector. Alternately, in some embodiments, the first vector, the
second vector, the third vector, the fourth vector, and/or the
fifth vector is not a Sleeping Beauty (SB) or piggyBac transposon
vector; for example, in some embodiments, a CAR may be generated
without using a Sleeping Beauty (SB) or piggyBac vector, and then
the CAR may subsequently be inserted in a vector suitable for
transfecting T cells (e.g., inserted into a Sleeping Beauty (SB)
vector as described, e.g., in Singh et al., 2015). Nonetheless, in
some embodiments, generating a CAR already present in a vector that
is suitable for transfecting T cells may simply the process or
reduce the number of steps required to both generate a CAR and
transfect a T cell. The distinct antigen binding domains may
selectively bind different antigens. In some embodiments, the
distinct antigen binding domains selectively bind the same antigen.
The antigen binding domain may selectively bind CD19, Universal
Antigen (mouse), HER-3, GD2, Gp75, CS1 protein, mesothelin,
phosphatidylserine, cMyc, CD22, CD4, CD44v6, CD45, CD28, CD3, CD3e,
CD123, CD138, CD52, CD56, CD74, CD30, Gp75, CD38, CD33, CD20,
Her1/HER3 fusion, GD2, a carbohydrate, Aspergillus, ROR1, c-MET,
EGFR, Dectin, Ebola, a fungus, GP, HERV-K (HERVK), NY-ESO-1,
VEGF-R2, TGF-b2R, IgG4, Biotin, or O-AcGD2. The distinct antigen
binding domains may consist of or comprise scFv. The hinge region
may consist of or comprise the 12 AA peptide
(GAGAGCAAGTACGGCCCTCCCTGCCCCCCTTGCCCT; SEQ ID NO:1), t-20 AA
peptide, IgG4 Fc .DELTA. EQ, IgG4 Fc .DELTA. Q, (t-12AA+t-20AA),
mKate, phiLov, dsRed, Venus, eGFP, CH3 HA, (CD8.alpha.+t-20AA),
Double t-20 AA, (t-20AA+CD8.alpha.), (CD8.alpha.+Leucine Zipper
Basep1), (CD8.alpha.+Leucine Zipper Acid1), 2D3, CD8.alpha., or
IgG4 Fc. At least one of the endodomains may comprise CD3.zeta.. At
least one of the endodomains may comprise one or more ITAM domains.
In some embodiments, at least one of the endodomains comprise
(CD28+CD3.zeta.), (CD28+CD27+CD3.zeta.), (CD28+OX40+CD3.zeta.),
(CD28+4-1BB+CD3.zeta.), (CD28+CD27+OX40+CD3.zeta.),
(CD28+4-1BB+CD27+CD3.zeta.), (CD28+4-1BB+OX40+CD3.zeta.),
(4-1BB+CD3.zeta.), (4-1BB+OX40+CD3.zeta.), (4-1BB+CD27+CD3.zeta.),
(CD27+CD3.zeta.), (CD27+OX40+CD3.zeta.), (CD28.DELTA.+CD3.zeta.),
(CD28.DELTA.+CD27+CD3.zeta.), (CD28.DELTA.+OX40+CD3.zeta.),
(CD28.DELTA.+4-1BB+CD3.zeta.), (CD28.DELTA.+4-1BB+OX40+CD3.zeta.),
(CD28.DELTA.+CD27+OX40+CD3.zeta.),
(CD28.DELTA.+4-1BB+CD27+CD3.zeta.), (4-1BB+ICOS+CD3.zeta.),
(CD28+ICOS+CD3.zeta.), (ICOS+CD3.zeta.), CD3.zeta., or CD28 only.
In some embodiments, the CARs may be tested for activity, e.g.,
using the iQue.TM. Screener (IntelliCyt, Albuquerque, N. Mex.). In
some embodiments CARs may evaluated for one or more characteristics
(e.g., viability, upregulation of activation signals, upregulation
of CD25, cytokine release, and/or cell killing) when expressed in
cells such as T cells using a technique such as, e.g., flow
cytometry.
[0014] Another aspect of the present invention relates to a
composition comprising a collection of vectors encoding chimeric
antigen receptors encoding a plurality of distinct antigen binding
domains, hinge domains and endodomains, the vectors of said
collection being randomized with respect to said domains.
[0015] Yet another aspect of the present invention relates to a
method of producing a plurality of vectors each encoding a chimeric
antigen receptor (CAR) comprising: (i) obtaining the composition
comprising a plurality of vectors of the present invention (e.g.,
as described above); and (ii) subjecting the composition to
conditions sufficient to allow for the distinct antigen binding
domains, hinge domains and/or endodomains comprised in or encoded
by said vectors to recombine via homologous recombination to
produce a plurality of fourth vectors, wherein each of said fourth
vectors encodes a CAR. The method may further comprise expressing
the CAR in a cell. The method may further comprise testing the CAR
for activity. In some embodiments, one or more of the first vectors
encodes a scFv region. In some embodiments, one or more of the
third vectors encodes a transmembrane domain. In some embodiments,
one or more of the second vectors encodes a transmembrane domain.
The method may further comprise randomly incorporating by
recombination a fifth vector encoding a transmembrane domain with
said first vectors, second vectors, and third vectors to form said
fourth vector. In some embodiments, said first vectors and said
seconds vector are randomly attached from a plurality of vectors
encoding a plurality of distinct scFv regions and a plurality of
distinct hinge regions. In some embodiments, said first vectors and
said third vectors are randomly attached from a plurality of
vectors encoding a plurality of distinct scFv regions and a
plurality of distinct endodomains. In some embodiments, said second
vectors and said third vectors are randomly attached from a
plurality of vectors encoding a plurality of distinct hinge regions
and a plurality of distinct endodomains. In some embodiments, said
first vectors, said second vectors, and said third vectors are
randomly attached from a plurality of vectors encoding a plurality
of distinct scFv regions, a plurality of distinct hinge regions,
and a plurality of distinct endodomains. The method may further
comprise generating said fourth vectors by random attachment of
said first vectors from a first library of vectors encoding a
plurality of scFv regions, random attachment of said second vectors
from a second library of vectors encoding a plurality of scFv
regions, and random attachment of said third vectors from a third
library of vectors encoding a plurality of endodomains, to form
said fourth vector encoding the CAR. The first vectors may comprise
a first sequence and a second site of homologous recombination. The
second vectors may comprise the second sequence of homologous
recombination and a third sequence of homologous recombination. The
third vectors may comprise the third sequence of homologous
recombination and a fourth sequence of homologous recombination.
The third vectors may comprise the third sequence of homologous
recombination and a fourth sequence of homologous recombination.
The fourth vectors may comprise the first sequence of homologous
recombination and the fourth sequence of homologous recombination.
The first vectors, the second vectors, and/or the third vectors may
encode a transposase. In some embodiments, a sixth vector encodes a
transposase, and wherein the method comprises introducing,
electroporating, or transfecting one or more of said fourth vectors
and said sixth vector into a cell. The transposase may be a
salmonid-type Tc1-like transposase (SB). The method may further
comprise culturing or providing cells transfected with the CAR in
the presence of artificial antigen presenting cells (aAPCs) that
can stimulate expansion of the CAR-expressing T-cells. In some
embodiments, each of the scFv region, the hinge region, and the
endodomain are each encoded in a Sleeping Beauty (SB) or piggyBac
transposon vector. In some embodiments, each of the first vector,
the second vector, and/or the third vector are randomly attached by
said recombination from a plurality of vectors encoding multiple
distinct scFv regions, the hinge regions, and endodomains. In some
embodiments, said first vectors, the second vectors, and the third
vectors each contain a transposon; and wherein said attaching via
homologous recombination comprises site specific recombination. In
some embodiments, the first vectors and the second vectors each
have a first homologous recombination site; and wherein the second
vectors and the third vectors each have a second homologous
recombination site. In some embodiments, the first vectors have a
third recombination site, and wherein the fourth vectors have a
fourth recombination site, wherein the third recombination site and
fourth recombination site can allow for homologous recombination
into a cell. The cell may be a T cell such as, e.g., an alpha beta
T cell, a gamma delta T cell, or NK cell, or NKT cell. In some
embodiments, the cell is a pluripotent cell such as, e.g., a stem
cell or an induced pluripotent stem cell. In some embodiments, the
cell is derived from a stem cell, an induced pluripotent stem cell,
or a stem cell. The cell may be a T cell or NK cell derived from an
induced pluripotent stem cell. In some embodiments, said distinct
antigen binding domains include at least 2, 3, 4, 5, 6, 7, 8, 9, or
more scFv that selectively recognize different antigens. In some
embodiments, said distinct antigen binding domains include at least
2, 3, 4, 5, 6, 7, 8, 9, or more scFv that selectively recognize
(i.e., specifically bind) the same antigen. In some embodiments,
the antigen binding domains selectively (specifically) bind CD19,
Universal Antigen (mouse), HER-3, GD2, Gp75, CS1 protein,
mesothelin, phosphatidylserine, cMyc, CD22, CD4, CD44v6, CD45,
CD28, CD3, CD3e, CD123, CD138, CD52, CD56, CD74, CD30, Gp75, CD38,
CD33, CD20, Her1/HER3 fusion, GD2, a carbohydrate, Aspergillus,
ROR1, c-MET, EGFR, Dectin, Ebola, a fungus, GP, HERV-K, NY-ESO-1,
VEGF-R2, TGF-b2R, IgG4, Biotin, or O-AcGD2. In some embodiments,
said antigen binding domains comprise or consist of scFv. The hinge
region may encode the 12 AA peptide
(GAGAGCAAGTACGGCCCTCCCTGCCCCCCTTGCCCT, SEQ ID NO: 1), t-20 AA
peptide, IgG4 Fc .DELTA. EQ, IgG4 Fc .DELTA. Q, (t-12AA+t-20AA),
mKate, phiLov, dsRed, Venus, eGFP, CH3 HA, (CD8.alpha.+t-20AA),
Double t-20 AA, (t-20AA+CD8.alpha.), (CD8.alpha.+Leucine Zipper
Basep1), (CD8.alpha.+Leucine Zipper Acid1), 2D3, CD8.alpha., or
IgG4 Fc. The endodomain may encode CD3.zeta.. The endodomain may
encode one or more ITAM domains. In some embodiments, the
endodomain encodes (CD28+CD3.zeta.), (CD28+CD27+CD3.zeta.),
(CD28+OX40+CD3.zeta.), (CD28+4-1BB+CD3.zeta.),
(CD28+CD27+OX40+CD3.zeta.), (CD28+4-1BB+CD27+CD3.zeta.),
(CD28+4-1BB+OX40+CD3.zeta.), (4-1BB+CD3.zeta.),
(4-1BB+OX40+CD3.zeta.), (4-1BB+CD27+CD3.zeta.), (CD27+CD3.zeta.),
(CD27+OX40+CD3.zeta.), (CD28.DELTA.+CD3.zeta.),
(CD28.DELTA.+CD27+CD3.zeta.), (CD28.DELTA.+OX40+CD3.zeta.),
(CD28.DELTA.+4-1BB+CD3.zeta.), (CD28.DELTA.+4-1BB+OX40+CD3.zeta.),
(CD28.DELTA.+CD27+OX40+CD3.zeta.),
(CD28.DELTA.+4-1BB+CD27+CD3.zeta.), (4-1BB+ICOS+CD3.zeta.),
(CD28+ICOS+CD3.zeta.), (ICOS+CD3.zeta.), CD3.zeta., or CD28 only.
In some embodiments, the CARs may be tested for activity, e.g.,
using the iQue.TM. Screener (IntelliCyt, Albuquerque, N. Mex.). In
some embodiments CARs may evaluated for one or more characteristics
(e.g., viability, upregulation of activation signals, upregulation
of CD25, cytokine release, and/or cell killing) when expressed in
cells such as T cells using a technique such as, e.g., flow
cytometry. In some embodiments, said activity comprises ability of
the CAR to selectively bind a cancer cell, selectively bind a
pathogen, selectively bind a cell involved in an autoimmune
disease, or promote activation of a T-cell, destruction of a T
cell, differentiation of a T cell, proliferation of a T cell,
de-differentation of a T cell, movement of a T cell, cytokine
production by a T cell, or killing by a T cell.
[0016] In some embodiments, the cancer cell is an ovarian cancer, a
lymphoma, a renal cell carcinoma, a B-cell malignancy, CLL, B-ALL,
ALL, a leukemia, a B-cell malignancy or lymphoma, mantle cell
lymphoma, an indolent B-cell lymphoma, Hodgkin lymphoma, AML,
cervical cancer, breast cancer, colorectal cancer, ovarian cancer,
neuroblastoma, skin cancer, melanoma, a lung cancer, osteosarcoma,
glioma, an epithelial derived tumor, prostate cancer, or a
pediatric cancer. The pathogen may be a virus, a fungi, or a
bacteria. In some embodiments, said testing comprises single cell
imaging, single cell genetics, assessment of single T cells or
populations of T cells; measuring specific killing or serial
killing, gene expression, protein expression, movement towards or
away from a target, proliferation, activation-induced cell death,
secretion of cytokines, or secretion of chemokines. The method may
further comprise selecting a single CAR from said plurality of
vectors based on a property of the single CAR. The method may
further comprise therapeutically administering the single CAR to a
subject. The subject may be a mammal such as, e.g., a human.
[0017] Another aspect of the present invention relates to a
polypeptide comprising or consisting of CAR 217 (SEQ ID NO: 2), CAR
194 (SEQ ID NO: 3), CAR 212 (SEQ ID NO: 4), CAR 213 (SEQ ID NO: 5),
CAR 265 (SEQ ID NO: 6), CAR 214 (SEQ ID NO:56), CAR 215 (SEQ ID
NO:57), CAR 216 (SEQ ID NO:58), CAR 218 (SEQ ID NO:59), CAR 193
(SEQ ID NO:55), or CAR 268 (SEQ ID NO: 7).
[0018] Yet another aspect of the present invention relates to a
transformed T cell expressing the polypeptide comprising or
consisting of CAR 217 (SEQ ID NO:2), CAR 194 (SEQ ID NO:3), CAR 212
(SEQ ID NO:4), CAR 213 (SEQ ID NO:5), CAR 265 (SEQ ID NO:6), CAR
214 (SEQ ID NO:56), CAR 215 (SEQ ID NO:57), CAR 216 (SEQ ID NO:58),
CAR 218 (SEQ ID NO:59), CAR 193 (SEQ ID NO:55), or CAR 268 (SEQ ID
NO:7). The cell may be an immortalized cell. The T cell may be an
alpha beta T cell, a gamma delta T cell, NK cell, NKT cell, stem
cell, cells derived from stem cells, including cells of the immune
system.
[0019] Another aspect of the present invention relates to a
pharmaceutical preparation comprising the transformed T cell of the
present invention.
[0020] Yet another aspect of the present invention relates to a
nucleic acid encoding a chimeric antigen receptor comprising or
consisting of CAR 217 (SEQ ID NO:2), CAR 194 (SEQ ID NO:3), CAR 212
(SEQ ID NO:4), CAR 213 (SEQ ID NO:5), CAR 265 (SEQ ID NO:6), CAR
214 (SEQ ID NO:56), CAR 215 (SEQ ID NO:57), CAR 216 (SEQ ID NO:58),
CAR 218 (SEQ ID NO:59), CAR 193 (SEQ ID NO:55), or CAR 268 (SEQ ID
NO:7). The nucleic acid may be comprised in a T cell such as, e.g.,
an alpha beta T cell, a gamma delta T cell, NK cell, NKT cell, stem
cell, or a T cell derived from a pluripotent cell. The T cell may
be comprised in a pharmaceutically acceptable carrier or
excipient.
[0021] Another aspect of the present invention relates to a
composition comprising a library of different CAR encoding vectors,
the vectors of said library being randomized in terms of distinct
antigen binding domains, hinge domains and/or endodomains. In some
embodiments, the library randomized in terms of distinct antigen
binding domains, hinge domains, and endodomains. In some
embodiments, the library randomized in terms of distinct antigen
binding domains and endodomains. In some embodiments, the library
randomized in terms of distinct antigen binding domains and hinge
domains. In some embodiments, the library randomized in terms of
distinct antigen hinge domains and endodomains.
[0022] Examples of antigen binding domains, hinge regions,
transmembrane domains, and endodomains that be used in methods of
the present invention to generate a CAR are shown below in Table 1.
The antigen binding domains, hinge regions, transmembrane domains,
and endodomains are merely provided in Table 1 as non-limiting
examples, and it is anticipated that one may select virtually any
antigen binding domain (e.g., targeting a cancerous cell, bacteria,
fungi, virus, or virus-infected cell) as desired for the particular
clinical application. In Table 1, the target of the antigen binding
domain is provided (e.g., "CD19" may refer to a scFv region that
selectively binds CD19). In some embodiments, the antigen binding
domain comprises or consists of a scFv that selectively binds the
antigen. If desired, a portion of the scFv (e.g., part of the
variable region of the scFv) may be randomized if desired. In some
embodiments, the antigen binding domain selectively binds a
protein. Alternately, the antigen binding domain may selectively
bind a carbohydrate expressed on a target such as, e.g., a fungi,
virus, bacteria, or cancerous cell. For example, in some
embodiments, the antigen binding domain comprises or consists of
Dectin-1, which can selectively bind .beta.-glucans and
carbohydrate found in fungal cell walls. In some embodiments, the
CAR may selectively bind a virus, e.g., the CAR may bind a viral
protein such as a hepatitis envelope protein (e.g., Krebs et al.,
2013). In some embodiments, the antigen binding domain is a
cytokine. The antigen binding domain may selectively bind a
protein, carbohydrate, or sugar. In some embodiments, a CAR is
generated from a plurality of antigen binding domains that
selectively bind a single target, antigen, or the antigen binding
domains may have overlapping antigens. In some embodiments, a CAR
is generated from a plurality of antigen binding domains that
selectively bind different targets or antigens. The endodomain in a
CAR may result in an inhibitory signal (e.g., PD-1, CTLA-4, TIM-3,
LAG-3, BTLA, ITIM, SHP-1, LAIR-1, TIGIT, Siglecs) or a stimulatory
signal (e.g., CD27, CD28, ICOS, CD134, CD137, LCK, DAP10, ITAM,
ZAP-70, LAT, SLP-76, cytokines as well as cytokine receptors; as
well as combinations and mutations) in a cell expressing the CAR
such as, e.g., a T cell or a natural killer (NK) cell. When the
antigen binding region selectively recognizes an antigen, the
endodomain may cause or promote the cell (e.g., T cell or NK cell)
comprising the CAR to activate cell killing, migrate,
differentiate, de-differentiate, or result in inducing an apoptotic
signal in the cell. The apoptotic signal may comprise or consist of
a CTLA4 apoptotic signal and/or a PD1 (protein death 1) apoptotic
signal. In some embodiments, more than one distinct CAR may be
expressed in a cell such as, e.g., a T cell or a NK cell. For
example, a first CAR and a second CAR may be expressed in a cell,
wherein the first CAR selectively binds an antigen on a healthy
cell and induces an inhibitory signal via a first endodomain (e.g.,
reducing the probability that the T cell or NK cell will damage the
healthy cell) and the second CAR selectively binds an antigen on a
target cell (e.g., cancerous cell, fungi, virus-infected cell,
bacteria) and induces a stimulatory signal via a second endodomain
(e.g., promoting or causing cell killing of the target cell by the
T cell or NK cell). A CAR generated via the methods of the present
invention may be inserted in a target cell such as, e.g., a T cell
or a NK cell, as integrating DNA (e.g., using electroporation and
homologous recombination via a transposase/transposon vector or
system) or as non-integrating DNA or RNA (e.g., viral delivery of a
mRNA using a viral vector such as, e.g., a lentivirus or
retrovirus). In some embodiments, the T cell encoding a CAR
according to the present invention is an immortalized cell; such
immortalized cells may function may be used to evaluate or measure
the therapeutic potential or toxicity of the CAR. In this way, many
CARs may be screened for a desired pharmacological profile,
toxicity towards diseased cells or pathogens, lack of toxicity in
healthy cells, and/or therapeutic efficacy.
TABLE-US-00001 TABLE 1 DNA molecules that can be combined as
Antigen binding domain-hinge-signaling domains to generate CARs.
Antigen-binding Domain (e.g., an ScFv that selectively bind a
target listed below) CD19 (mouse) (e.g., SEQ ID NO: 8) CD19 (human)
(e.g., SEQ ID NO: 9) CD19 (humanized) Universal Antigen (mouse)
(Rushworth et al., 2014) CD22 (e.g., scFv from Jabbour et al., 2014
or Kong et al., 2014) CD4 (e.g., scFv from Humblet-Baron et al.,
2015) CD44v6 (e.g., scFv from Leung 2010 or Verel 2002) CD45 (e.g.,
scFv from Shin et al., 2011) CD28 (e.g., scFv from Czerwinski et
al, 2015) CD3 (e.g., SEQ ID NO: 10) CD3e (e.g., scFv from
monoclonal antibody SPV-T3b, Life Technologies, Carlsbad, CA),
CD123 (e.g., SEQ ID NO: 11) CD138 (e.g., scFv from Sun et al.,
2007) CD52 (e.g., scFv from Wang et al., 2015) CD56 (e.g., scFv
from Kaufmann et al., 1997) CD74 (e.g., scFv from Kaufman et al.,
2013) CD30 (e.g., SEQ ID NO: 12) Gp75 (e.g., scFv from Patel et
al., 2008) CD38 (e.g., scFv from de Weers et al., 2011) CD33 (e.g.,
scFv from Manero et al., 2013) CD20 (e.g., scFv from Le
Garff-Tavernier et al., 2014 or Winiarska et al, 2014) Her1/HER3
fusion (e.g., scFv from Sarup et al., 2008) HER-3 (e.g., SEQ ID NO:
13) GD2 (e.g., SEQ ID NO: 14) Carbohydrates (such as an Aspergillus
carbohydrate), e.g., scfv from Stynen et al., 1991) ROR1 (e.g., SEQ
ID NO: 15) c-MET (e.g., scFv from Zhuang et al., 2014) cMyc (e.g.,
SEQ ID NO: 16) EGFR (e.g., scFv from Funakoshi et al., 2014) Dectin
(e.g., Dectin 1 ectodomain, SEQ ID NO: 17) Dectin-1 binding site
Ebola virus (e.g., scFv from Audet et al., 2014 or Qiu et al.,
2012) Fungal antigens (e.g., scFv from Guimaraes et al., 2011) GP
(Qiu et al., 2012) Gp75 (e.g., TA99, SEQ ID NO: 18) HERV-K (HERVK)
(e.g., SEQ ID NO: 19) NY-ESO-1 (e.g., scFv from Schultz-Thater et
al., 2000) VEGF-R2 (e.g., scFv from Zhang et al., 2002) TGF-b2R
(e.g., scFv from Leung, 2011) IgG4 (e.g., scFv from Curtin et al.,
2015) Biotin (e.g., scFv from Vincent et al., 1993) O-AcGD2 (e.g.,
scFv from Goldberg et al., 2014 or Ahmed et al., 2014) CS1 protein
(e.g., Elotuzumab or huLuc63, SEQ ID NO: 20) Mesothelin (e.g.,
using the SS-1 scFv, SEQ ID NO: 21) Phosphatidylserine (e.g., scFv
from Gerber et al., 2011) Hinge/Scaffold 12 AA (peptide) (e.g., SEQ
ID NO: 1) t-20 AA (peptide) (e.g., SEQ ID NO: 22) CD8 .alpha.
(e.g., SEQ ID NO: 23) IgG4 Fc (e.g., SEQ ID NO: 24) 2D3 (e.g., SEQ
ID NO: 25) IgG4 Fc .DELTA. EQ (IgG4Fc N40Q) (e.g., SEQ ID NO: 26)
IgG4 Fc .DELTA. Q (IgG4Fc L18E N40Q) (e.g. SEQ ID NO: 27) t-12AA +
t-20AA mKate (e.g., SEQ ID NO: 28) phiLov (e.g., SEQ ID NO: 29)
dsRed (e.g., SEQ ID NO: 30) Venus (e.g., SEQ ID NO: 31) eGFP (e.g.,
SEQ ID NO: 32) CH3 HA (e.g., SEQ ID NO: 33) mTFP-1 (e.g., SEQ ID
NO: 34) CD8 .alpha. + t-20AA Double t-20 AA t-20AA + CD8.alpha.
CD8.alpha. + Leucine Zipper Basep1 (e.g., SEQ ID NO: 35) CD8.alpha.
+ Leucine Zipper Acid1 (e.g., SEQ ID NO: 36) Transmembrane domain
CD28 (e.g., SEQ ID NO: 37) CD137 (4-1BB) (e.g., SEQ ID NO: 38)
CD8.alpha. (e.g., SEQ ID NO: 39) CD3.zeta. (e.g., SEQ ID NO: 40)
Endo-domain (signaling domain) CD28 + CD3.zeta. CD28 + CD27 +
CD3.zeta. CD28 + OX40 + CD3.zeta. CD28 + 4-1BB + CD3.zeta. CD28 +
CD27 + OX40 + CD3.zeta. CD28 + 4-1BB + CD27 + CD3.zeta. CD28 +
4-1BB + OX40 + CD3.zeta. 4-1BB + CD3.zeta. 4-1BB + OX40 + CD3.zeta.
4-1BB + CD27 + CD3.zeta. CD27 + CD3.zeta. CD27 + OX 40 + CD3.zeta.
CD28.DELTA. + CD3.zeta. CD28.DELTA. + CD27 + CD3.zeta. CD28.DELTA.
+ OX40 + CD3.zeta. CD28.DELTA. + 4-1BB + CD3.zeta. CD28.DELTA. +
4-1BB + OX40 + CD3.zeta. CD28.DELTA. + CD27 + OX40 + CD3.zeta.
CD28.DELTA. + 4-1BB + CD27 + CD3.zeta. 4-1BB + ICOS + CD3.zeta.
CD28 + ICOS + CD3.zeta. ICOS + CD3.zeta. CD3.zeta. CD28 only
.zeta.--zeta; .DELTA.- mutant; Note = 4-1BB is also referred to as
CD137; "+" refers to the fusion of the different regions.
[0023] For example, in some embodiments, the following
antigen-binding domains, hinge/scaffolds, transmembrane domains,
and endodomains may be used, as shown in Table 2. Examples of
sequences included in signaling domains, e.g., in Table 1 or Table
2, include CD27 (SEQ ID NO:41), CD28 (SEQ ID NO:42), CD28.DELTA.
(SEQ ID NO:43), CD134 (OX40) (SEQ ID NO:44), CD137 (41BB) (SEQ ID
NO:45), ICOS (SEQ ID NO:46) and CD3 zeta (SEQ ID NO:47). Examples
of scFv Anti-EGFR domains as listed in Table 2 include Nimotuximab
(SEQ ID NO:48) and Cetuximab (SEQ ID NO:49). An example of a scFv
Anti-Phosphatidylserine as listed in Table 2 is Bavituximab (SEQ ID
NO:50).
TABLE-US-00002 TABLE 2 Example of libraries used to generate CAR
ScFv Anti-CS1 protein Anti-mesothelin (SS-1) Anti-CD123 Anti-CD19
human Anti-CD19 mouse Anti-CD3 Anti-CD30 Anti-Dectin Anti-G2D
Anti-Gp75 Anti-HERVK Anti-CD22 Anti-ROR-1 Anti-EGFR Anti-HER-3
Anti-Phosphatidylserine Hinge/Scaffold t-12 AA (peptide) t-20 AA
(peptide) CD8 .alpha. IgG4 Fc IgG4Fc .DELTA. EQ IgG4Fc .DELTA. Q
t-12AA + t-20AA mKate phiLov dsRed Venus eGFP CH3 HA CD8 .alpha. +
t-20AA Double t-20 AA t-20AA + CD8.alpha. CD8.alpha. + Leucine
Zipper Basep1 CD8.alpha. + Leucine Zipper Acid1 Transmembrane
domain CD28 4-1BB CD3.zeta. Signaling Domain CD28 + CD3.zeta. CD28
+ CD27 + CD3.zeta. CD28 + OX40 + CD3.zeta. CD28 + 4-1BB + CD3.zeta.
CD28 + CD27 + OX40 + CD3.zeta. CD28 + 4-1BB + CD27 + CD3.zeta. CD28
+ 4-1BB + OX40 + CD3.zeta. 4-1BB + CD3.zeta. 4-1BB + OX40 +
CD3.zeta. 4-1BB + CD27 + CD3.zeta. CD28.DELTA. + CD3.zeta.
CD28.DELTA. + CD27 + CD3.zeta. CD28.DELTA. + OX40 + CD3.zeta.
CD28.DELTA. + 4-1BB + CD3.zeta. CD28.DELTA. + 4-1BB + OX40 +
CD3.zeta. CD28.DELTA. + CD27 + OX40 + CD3.zeta. CD28.DELTA. + 4-1BB
+ CD27 + CD3.zeta. 4-1BB + ICOS + CD3.zeta. CD28 + ICOS + CD3.zeta.
ICOS + CD3 .zeta. CD3 .zeta. CD28 only
[0024] The term "chimeric antigen receptors (CARs)" or "CAR" as
used herein, includes artificial T-cell receptors, chimeric T-cell
receptors, or chimeric immunoreceptors. CARs are generally
engineered receptors that may graft an artificial specificity onto
a particular immune effector cell. CARs may be employed to impart
the specificity of a monoclonal antibody onto a T cell, thereby
allowing a large number of specific T cells to be generated, for
example, for use in an adoptive cell therapy. In some embodiments,
CARs direct specificity of the cell to a tumor associated antigen.
In preferred embodiments, CARs comprise an endodomain (comprising
an intracellular activation domain), a transmembrane domain, a
hinge or scaffold region, and an extracellular domain comprising a
targeting domain (e.g., a scFv derived from a monoclonal antibody).
In some embodiments, the extracellular targeting domain may be a
ligand of a receptor (e.g., a peptide that selectively binds a
protein receptor). In some embodiments, one can target malignant
cells by redirecting the specificity of T cells by using a CAR
specific for the malignant cells (e.g., by using an anti-CD19 scFv
to target a cancerous B-lineage cell).
[0025] Examples of scFv regions, hinge/scaffold regions,
transmembrane domains, and endodomains are shown in Table 1 and
examples of related sequences are also provided herein. Note in
Table 1 that the scFv regions may refer to a plurality of scFv
regions for a particular target (e.g., "CD19" in Table 1 may refer
to a single monoclonal antibody sequence, or in some preferred
embodiments, it may refer to a plurality of scFv regions derived
from monoclonal antibodies that selectively target CD19). It is
anticipated that methods of the present invention may be used to
generate a CAR that comprises, e.g., a fusion of any combination of
a scFv region, hinge/scaffold, transmembrane domain, and endodomain
of Table 1. For example, in some embodiments, the CAR may comprise
a scFv region that selectively targets CD19 (e.g., derived from a
mouse, human, or humanized monoclonal antibody) fused to an IgG4 Fc
hinge/scaffold region, a CD28 transmembrane domain, and an
endodomain comprising CD28 and CD3.zeta.. In some embodiments, the
CAR may comprise a scFv region that selectively targets ROR1 fused
to IgG4 Fc hinge/scaffold region, a CD28 transmembrane domain, and
an endodomain comprising CD28 and CD3.zeta.. In some embodiments,
the CAR may comprise a scFv region that selectively targets ROR1
fused to IgG4 Fc hinge/scaffold region, a CD28 transmembrane
domain, and an endodomain comprising 4-1BB and CD3.zeta.. In some
embodiments, the CAR may comprise a scFv region that selectively
targets CD19 (e.g., derived from a mouse, human, or humanized
monoclonal antibody) fused to IgG4 Fc hinge/scaffold region, a CD28
transmembrane domain, and an endodomain comprising CD28 and
CD3.zeta..
[0026] As used herein, the term "antigen" is a molecule capable of
being bound by an antibody or T-cell receptor. An antigen may
generally be used to induce a humoral immune response and/or a
cellular immune response leading to the production of B and/or T
lymphocytes.
[0027] As used herein the specification, "a" or "an" may mean one
or more. As used herein in the claim(s), when used in conjunction
with the word "comprising", the words "a" or "an" may mean one or
more than one.
[0028] The use of the term "or" in the claims is used to mean
"and/or" unless explicitly indicated to refer to alternatives only
or the alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or." As used herein "another" may mean at least a second or
more.
[0029] Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among the study subjects.
[0030] Other objects, features and advantages of the present
invention will become apparent from the following detailed
description. It should be understood, however, that the detailed
description and the specific examples, while indicating preferred
embodiments of the invention, are given by way of illustration
only, since various changes and modifications within the spirit and
scope of the invention will become apparent to those skilled in the
art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0032] FIG. 1. Cloning vectors used to re-assemble CARs using three
donor plasmids expressing (i) specific scFv, (ii) extracellular
hinge and (iii) endodomains. This approach will be adapted to
generate panels of CARs that differ in hinge, transmembrane, and
intracellular regions. Engineering CAR molecules from components
scFv, IgG4 Fc (Long hinge); or CD8a (Medium hinge) or peptide only
(Small hinge) and CD3.zeta. .nu. combinations with different
signaling domains using triple recombination site system. A library
of scFv and distinct scaffolds and signaling domains encoded in
three donor plasmids (entry clones), are recombined in to the
expression DNA vector. This approach generated multiple CAR species
in the format scFv-B-scaffold-C-signaling domain(s).
[0033] FIGS. 2A-B: (FIG. 2A) Expression of CAR (Fc) and CD8.sup.+
in T cells after 66 days post electroporation by flow cytometry.
The cells were expanded in aAPC loaded with CD19 antigen (clone 4)
(FIG. 2B) Lysis of CD19+ EL-4 was compared to background lysis of
CD19.sup.neg EL-4 using 4-h chromium release assay by CD19CAR+ T
cells Clinical Grade (CG) CD19CAR+ T cells by triple recombination
sites (EZ CAR) and CAR.sup.neg T cells. The CAR.sup.neg T were
expanded in with irradiated and anti-CD3 (OKT3) loaded K562-derived
aAPC clone #4.
[0034] FIG. 3: CAR Designs. CAR 212=SEQ ID NO:4; CAR 213=SEQ ID
NO:5; CAR 214=SEQ ID NO:56; CAR 215=SEQ ID NO:57; CAR 216=SEQ ID
NO:58; CAR 217=SEQ ID NO:2; CAR 218=SEQ ID NO:59; CAR 193=SEQ ID
NO:55.
[0035] FIG. 4: Sleeping Beauty tracking plasmids
[0036] FIGS. 5A-B: CAR Expression.
[0037] FIG. 6: CAR Expression Kinetics
[0038] FIG. 7: Phenotype.
[0039] FIGS. 8A-D: Extended Phenotype is shown in FIG. 8A and FIG.
8B.
[0040] FIG. 9: Western Blot Analysis.
[0041] FIG. 10: Expansion Kinetics.
[0042] FIG. 11: Fold Expansion: Total Cells
[0043] FIG. 12: Fold Expansion: CAR+ T cells.
[0044] FIG. 13: Cytotoxicity.
[0045] FIG. 14: 4-1BB CARs: Cytotoxicity.
[0046] FIG. 15: TM domain: Cytotoxicity.
[0047] FIG. 16: Spacer (IgG4 vs CD8): Cytotoxicity
[0048] FIG. 17: IFN-.gamma. production.
[0049] FIG. 18: 4-1BB CARs: IFN-.gamma. production
[0050] FIG. 19: TM domain: IFN-.gamma. production
[0051] FIG. 20: Spacer (IgG4 vs CD8): IFN-.gamma. production.
[0052] FIG. 21: Safety: PCR for SB11 transposase.
[0053] FIG. 22: Safety: CAR copy number (qPCR).
[0054] FIG. 23: Safety: Autonomous Growth. As shown in the figure,
a lack of autonomous growth was observed.
[0055] FIG. 24: CAR design. An example of a CAR is provided on the
right-hand side of the figure.
[0056] FIG. 25: CD3-zeta. Query=SEQ ID NO:51; Subject--top=SEQ ID
NO:52; Subject--middle=SEQ ID NO:53; Subject--bottom=SEQ ID
NO:54.
[0057] FIG. 26: CAR designs.
[0058] FIG. 27: CARs.
[0059] FIG. 28: CAR Expression.
[0060] FIG. 29: Expansion Kinetics.
[0061] FIG. 30: Expansion Kinetics.
[0062] FIG. 31: Cytotoxicity.
[0063] FIG. 32: Cytotoxicity.
[0064] FIG. 33: Memory Markers. Percent expression of CD27, CD62L,
CD28 and CCR7 on CAR.sup.+ T cells (expressing constructs shown in
FIG. 26) are shown.
[0065] FIG. 34: IFN-.gamma. production.
[0066] FIG. 35: IFN-.gamma. production (PMA-Ion)
[0067] FIG. 36: Autonomous Growth.
[0068] FIG. 37: CAR Copy Number.
[0069] FIG. 38: CAR Copy Number.
[0070] FIG. 39: CAR Copy Number.
[0071] FIGS. 40A-E: Transfection of 293-HEK cells with plasmids
carrying the CAR DNA (pSBSO EZ CAR) by lipofectamine was performed.
The transfected cells were analyzed by flow cytometry after stained
with anti-Fc or anti-idiotipic (antiCD19svFv) antibodies.
[0072] FIGS. 41A-C: FIGS. 41A-B, Nalm-6; EL-4 CD19+ cells; patient
tumor cells with MCL and CLL (targets) and were previously modified
to express GFP. 5.times.10.sup.3 target cells were incubated with
increasing concentration of CD19RIgG4CD28CAR T cells,
CD19RCD8.alpha.CD28 CAR T cells and CAR.sup.neg T cells (used as
the control) for 4 hours. After 4 hours the cells were acquired by
IntelliCyt's iQue and the data analyses were made in their
proprietary software. FIG. 41C, The graphs are representing the
killing percentage of CAR T cells against tumor cells. The ratio
between effector and target cells ranged from 0 to 40 cells.
[0073] FIG. 42: 5.times.10.sup.3 target cells (EL-4 CD19+ Granzyme
B cells reporter) were incubated with increasing concentration of
Clinical-grade CD19RIgG4CD28CAR T cells, EZ CD19RCD8.alpha.CD28 CAR
T cells and CAR.sup.neg T cells (used as the control) for 4 and 10
hours. After incubation time the cells were acquired by
IntelliCyt's iQue and the data analyses were made in their
proprietary software. The graphs are representing the killing
percentage of CAR T cells against tumor cells. The ratio between
effector and target cells ranged from 0 to 20 cells.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0074] Provided herein are methods for generating chimeric antigen
receptors (CARs). The method utilizes a plurality of vectors each
encoding an antigen binding domain (e.g., a scFv region), a hinge
region, a transmembrane region, and/or an endodomain. For example
in some embodiments a first vector encodes the antigen binding
domain, a second vector encodes the hinge region, and a third
region encodes an endodomain. In some embodiments, the
transmembrane region is encodes either in the second vector, in the
third vector, or in a fourth vector. In some preferred embodiments,
the vectors can homologously recombine to form a nucleic acid
encoding a CAR comprising the antigen binding domain, the hinge
region, the transmembrane region, and the endodomain. In this way,
many CAR may be generated and screened for a desired activity such
as, e.g., selective recognition and killing of a cancerous cell
expressing an antigen that is selectively bound by the CAR. The CAR
may then be expressed in a cell such as a T cell or a natural
killer (NK) cell as an integrating nucleic acid (e.g., a DNA
integrated into the host genome using a transposase/transposon) or
as a non-integrating nucleic acid (e.g., a mRNA delivered via a
viral vector such as a lentivirus or retrovirus). The T cell or NK
cell expressing the CAR may then be administered in a
pharmaceutical preparation or excipient to a subject such as a
human patient to treat or prevent a disease (e.g., a cancer, a
fungal infection, a bacterial infection, or a viral infection).
I. Library Generation
[0075] Libraries encoding a plurality of scFv regions,
hinge/scaffold regions, transmembrane domains, and endodomains
(signaling domains) may be generated by methods known to one of
skill in the art. In some embodiments, multiple possibilities are
available for two or three of the scFv regions, hinge/scaffold
regions, and endodomains (signaling domains). In some embodiments,
multiple possibilities are available for two, three, or all of the
scFv regions, hinge/scaffold regions, transmembrane domains, and
endodomains (signaling domains). Examples of scFv regions,
hinge/scaffold regions, transmembrane domains, and endodomains
(signaling domains) are provided, e.g., in Table 1. In some
embodiments, the library may encode a plurality of scFv that target
different antigens, such as such as multiple anti-cancer or
tumor-targeting antigens; in other embodiments, the library may
encode a plurality of different scFv that selectively bind a single
target (e.g., a single anticancer antigen such as CD19, etc.). In
this way, the methods may be used to either identify which
tumor-targeting construct may work more effectively for a given
cell sample (e.g., to be used in a personalized medicine) or the
methods may be used to identify new CAR that function more
effectively in targeting a given antigen. The scFv region generally
comprises a variable light (VL) and a variable heavy (VH) chain
derived from an antibody. In some embodiments, portions of the VL
and VH regions may be randomized if desired. General methods for
generating libraries include, e.g., the generation of yeast
libraries, bacterial, phage libraries, infiltrating B cells,
hybridomas (including from human and rodents), or libraries from
llamas, camels, equine libraries, and in silico methods (See, e.g.,
Lennard, 2002).
[0076] In some embodiments, the different vectors encoding the
scFv, hinge/scaffold region, transmembrane domain, and endodomain
are fused to form a single vector encoding a CAR. The fusion may
occur via transposon-mediated homologous recombination.
[0077] For example, in some embodiments, the vectors encoding the
scFv, hinge/scaffold region, transmembrane domain, and/or
endodomain may be Sleeping Beauty (SB) or piggyBac DNA plasmids.
Sleeping Beauty (SB) and piggyBac DNA plasmids are described, e.g.,
in Maiti et al. (2013), Singh et al. (2008), and Huls et al.
(2013). In some embodiments, the transposon is mediated by a
salmonid-type Tc1-like transposase (SB). In some preferred
embodiments, the vector encoding the CAR is transfected or
incorporated into T cells from a subject, such as a human patient
with cancer, via the methods as described in Singh et al., 2014 or
Huls et al. For example, DNA vectors derived from the Sleeping
Beauty (SB) system can be used to avoid expense and manufacturing
difficulties associated with transducing T cells with recombinant
viral vectors. After electroporation, the transposon/transposase
can improve the efficiency of integration of plasmids used to
express CAR and other transgenes in T cells. The SB system combined
with artificial antigen-presenting cells (aAPC) can selectively
propagate and produce CAR(+) T cells suitable for human
application. In some embodiments, synchronous electro-transfer of
two DNA plasmids, a SB transposon (encoding a CAR of interest) and
a SB transposase (e.g., SB11) may be followed by retrieval of
stable integrants by the every-7-day additions (stimulation cycle)
of .gamma.-irradiated aAPC in the presence of soluble recombinant
human IL-2 and IL-21. For example, 4 cycles (28 days of continuous
culture) may be undertaken to generate clinically-appealing numbers
of T cells that stably express a CAR of interest. Use of a
transposon/transposase system may be utilized for delivery of T
cells expressing a CAR as described, e.g., in Hackett et al.
II. Chimeric Antigen Receptors
[0078] Embodiments of the present invention involve generation and
identification of nucleic acids encoding an antigen-specific
chimeric antigen receptor (CAR) polypeptide. In some embodiments,
the CAR is humanized to reduce immunogenicity (hCAR).
[0079] In some embodiments, the CAR may recognize an epitope
comprised of the shared space between one or more antigens. Pattern
recognition receptors, such as Dectin-1, may be used to derive
specificity to a carbohydrate antigen. In certain embodiments, the
binding region may comprise complementary determining regions of a
monoclonal antibody, variable regions of a monoclonal antibody,
and/or antigen binding fragments thereof. In some embodiments the
binding region is an scFv. In another embodiment, a peptide (e.g.,
a cytokine) that binds to a receptor or cellular target may be
included as a possibility or substituted for a scFv region in the
binding region of a CAR. Thus, in some embodiments, a CAR may be
generated from a plurality of vectors encoding multiple scFv
regions and/or other targeting proteins. A complementarity
determining region (CDR) is a short amino acid sequence found in
the variable domains of antigen receptor (e.g., immunoglobulin and
T-cell receptor) proteins that complements an antigen and therefore
provides the receptor with its specificity for that particular
antigen. Each polypeptide chain of an antigen receptor contains
three CDRs (CDR1, CDR2, and CDR3). Since the antigen receptors are
typically composed of two polypeptide chains, there are six CDRs
for each antigen receptor that can come into contact with the
antigen--each heavy and light chain contains three CDRs. Because
most sequence variation associated with immunoglobulins and T-cell
receptor selectivity are generally found in the CDRs, these regions
are sometimes referred to as hypervariable domains. Among these,
CDR3 shows the greatest variability as it is encoded by a
recombination of the VJ (VDJ in the case of heavy chain and TCR
.alpha..beta. chain) regions.
[0080] A CAR-encoding nucleic acid generated via the present
invention may comprise one or more human genes or gene fragments to
enhance cellular immunotherapy for human patients. In some
embodiments, a full length CAR cDNA or coding region may be
generated via the methods described herein. The antigen binding
regions or domain may comprise a fragment of the V.sub.H and
V.sub.L chains of a single-chain variable fragment (scFv) derived
from a particular human monoclonal antibody, such as those
described in U.S. Pat. No. 7,109,304, incorporated herein by
reference. In some embodiments, the scFv comprises an antigen
binding domains of a human antigen-specific antibody. In some
embodiments, the scFv region is an antigen-specific scFv encoded by
a sequence that is optimized for human codon usage for expression
in human cells.
[0081] The arrangement of the antigen-binding domain of a CAR may
be multimeric, such as a diabody or multimers. The multimers can be
formed by cross pairing of the variable portions of the light and
heavy chains into what may be referred to as a diabody. The hinge
portion of the CAR may in some embodiments be shortened or excluded
(i.e., generating a CAR that only includes an antigen binding
domain, a transmembrane region and an intracellular signaling
domain). A multiplicity of hinges may be used with the present
invention, e.g., as shown in Table 1. In some embodiments, the
hinge region may have the first cysteine maintained, or mutated by
a proline or a serine substitution, or be truncated up to the first
cysteine. The Fc portion may be deleted from scFv used to as an
antigen-binding region to generate CARs according to the present
invention. In some embodiments, an antigen-binding region may
encode just one of the Fc domains, e.g., either the CH2 or CH3
domain from human immunoglobulin. One may also include the hinge,
CH2, and CH3 region of a human immunoglobulin that has been
modified to improve dimerization and oligermerization. In some
embodiments, the hinge portion of may comprise or consist of a 8-14
amino acid peptide (e.g., a 12 AA peptide), a portion of
CD8.alpha., or the IgG4 Fc. In some embodiments, the antigen
binding domain may be suspended from cell surface using a domain
that promotes oligomerization, such as CD8 alpha. In some
embodiments, the antigen binding domain may be suspended from cell
surface using a domain that is recognized by monoclonal antibody
(mAb) clone 2D3 (mAb clone 2D3 described, e.g., in Singh et al.,
2008).
[0082] The endodomain or intracellular signaling domain of a CAR
can generally cause or promote the activation of at least one of
the normal effector functions of an immune cell comprising the CAR.
For example, the endodomain may promote an effector function of a T
cell such as, e.g., cytolytic activity or helper activity including
the secretion of cytokines. The effector function in a naive,
memory, or memory-type T cell may include antigen-dependent
proliferation. The terms "intracellular signaling domain" or
"endodomain" refers to the portion of a CAR that can transduce the
effector function signal and/or direct the cell to perform a
specialized function. While usually the entire intracellular
signaling domain may be included in a CAR, in some cases a
truncated portion of an endodomain may be included. Generally,
endodomains include truncated endodomains, wherein the truncated
endodomain retains the ability to transduce an effector function
signal in a cell.
[0083] In some embodiments, an endodomain comprises the zeta chain
of the T-cell receptor or any of its homologs (e.g., eta, delta,
gamma, or epsilon), MB1 chain, B29, Fc RIII, Fc RI, and
combinations of signaling molecules, such as CD3.zeta. and CD28,
CD27, 4-1BB, DAP-10, OX40, and combinations thereof, as well as
other similar molecules and fragments. Intracellular signaling
portions of other members of the families of activating proteins
can be used, such as Fc.gamma.RIII and Fc.epsilon.RI. Examples of
these alternative transmembrane and intracellular domains can be
found, e.g., Gross et al. (1992), Stancovski et al. (1993), Moritz
et al. (1994), Hwu et al. (1995), Weijtens et al. (1996), and
Hekele et al. (1996), which are incorporated herein be reference in
their entirety. In some embodiments, an endodomain may comprise the
human CD3.zeta. intracellular domain.
[0084] The antigen-specific extracellular domain and the
intracellular signaling-domain are preferably linked by a
transmembrane domain. Transmembrane domains that may be included in
a CAR include, e.g., the human IgG4 Fc hinge and Fc regions, the
human CD4 transmembrane domain, the human CD28 transmembrane
domain, the transmembrane human CD3.zeta. domain, or a cysteine
mutated human CD3.zeta. domain, or a transmembrane domains from a
human transmembrane signaling protein such as, e.g., the CD16 and
CD8 and erythropoietin receptor. Examples of transmembrane domains
are provided, e.g., in Table 1.
[0085] In some embodiments, the endodomain comprises a sequence
encoding a costimulatory receptors such as, e.g., a modified CD28
intracellular signaling domain, or a CD28, CD27, OX-40 (CD134),
DAP10, or 4-1BB (CD137) costimulatory receptor. In some
embodiments, both a primary signal initiated by CD3.zeta., an
additional signal provided by a human costimulatory receptor may be
included in a CAR to more effectively activate a transformed T
cells, which may help improve in vivo persistence and the
therapeutic success of the adoptive immunotherapy. As noted in
Table 1, the endodomain or intracellular receptor signaling domain
may comprise the zeta chain of CD3 alone or in combination with an
Fc.gamma. RIII costimulatory signaling domains such as, e.g., CD28,
CD27, DAP10, CD137, OX40, CD2, 4-1BB. In some embodiments, the
endodomain comprises part or all of one or more of TCR zeta chain,
CD28, CD27, OX40/CD134, 4-1BB/CD137, Fc.epsilon.RI.gamma.,
ICOS/CD278, IL-2Rbeta/CD122, IL-2Ralpha/CD132, DAP10, DAP12, and
CD40. In some embodiments, 1, 2, 3, 4 or more cytoplasmic domains
may be included in an endodomain. For example, in some CARs it has
been observed that at least two or three signaling domains fused
together can result in an additive or synergistic effect.
[0086] In some aspects, an isolated nucleic acid segment and
expression cassette including DNA sequences that encode a CAR may
be generated. A variety of vectors may be used. In some preferred
embodiments, the vector may allow for delivery of the DNA encoding
a CAR to immune such as T cells. CAR expression may be under the
control of regulated eukaryotic promoter such as, e.g., the MNDU3
promoter, CMV promoter, EF1alpha promoter, or Ubiquitin promoter.
Also, the vector may contain a selectable marker, if for no other
reason, to facilitate their manipulation in vitro. In some
embodiments, the CAR can be expressed from mRNA in vitro
transcribed from a DNA template.
[0087] Chimeric antigen receptor molecules are recombinant and are
distinguished by their ability to both bind antigen and transduce
activation signals via immunoreceptor activation motifs (ITAM's)
present in their cytoplasmic tails. Receptor constructs utilizing
an antigen-binding moiety (for example, generated from single chain
antibodies (scFv)) afford the additional advantage of being
"universal" in that they can bind native antigen on the target cell
surface in an HLA-independent fashion. For example, a scFv
constructs may be fused to sequences coding for the intracellular
portion of the CD3 complex's zeta chain (.zeta.), the Fc receptor
gamma chain, and sky tyrosine kinase (Eshhar et al., 1993;
Fitzer-Attas et al., 1998). Re-directed T cell effector mechanisms
including tumor recognition and lysis by CTL have been documented
in several murine and human antigen-scFv: .zeta. systems (Eshhar et
al., 1997; Altenschmidt et al., 1997; Brocker et al., 1998).
[0088] The antigen binding region may, e.g., be from a human or
non-human scFv. One possible problem with using non-human antigen
binding regions, such as murine monoclonal antibodies, is reduced
human effector functionality and a reduced ability to penetrate
into tumor masses. Furthermore, non-human monoclonal antibodies can
be recognized by the human host as a foreign protein, and
therefore, repeated injections of such foreign antibodies might
lead to the induction of immune responses leading to harmful
hypersensitivity reactions. For murine-based monoclonal antibodies,
this effect has been referred to as a Human Anti-Mouse Antibody
(HAMA) response. In some embodiments, inclusion of human antibody
or scFv sequences in a CAR may result in little or no HAMA response
as compared to some murine antibodies. Similarly, the inclusion of
human sequences in a CAR may be used to reduce or avoid the risk of
immune-mediated recognition or elimination by endogenous T cells
that reside in the recipient and might recognize processed antigen
based on HLA.
[0089] In some embodiments, the CAR comprises: a) an intracellular
signaling domain, b) a transmembrane domain, c) a hinge region, and
d) an extracellular domain comprising an antigen binding region. In
some embodiments, the intracellular signaling domain and the
transmembrane domain are encoded with the endodomain by a single
vector that can be fused (e.g., via transposon-directed homologous
recombination) with a vector encoding a hinge region and a vector
encoding an antigen binding region. In other embodiments, the
intracellular signaling region and the transmembrane region may be
encoded by two separate vectors that are fused (e.g., via
transposon-directed homologous recombination).
[0090] In some embodiments, the antigen-specific portion of a CAR,
also referred to as an extracellular domain comprising an antigen
binding region, selectively targets a tumor associated antigen. A
tumor associated antigen may be of any kind so long as it is
expressed on the cell surface of tumor cells. Examples of tumor
associated antigens that may be targeted with CARs generated via
the present invention include, e.g., CD19, CD20, carcinoembryonic
antigen, alphafetoprotein, CA-125, MUC-1, CD56, EGFR, c-Met, AKT,
Her2, Her3, epithelial tumor antigen, melanoma-associated antigen,
mutated p53, mutated ras, Dectin-1, and so forth. In some
embodiments that antigen specific portion of the CAR is a scFv.
Examples of tumor-targeting scFv are provided in Table 1. In some
embodiments, a CAR may be co-expressed with a membrane-bound
cytokine, e.g., to improve persistence when there is a low amount
of tumor-associated antigen. For example, a CAR can be co-expressed
with membrane-bound IL-15.
[0091] In some embodiments, an intracellular tumor associated
antigen such as, e.g., HA-1, survivin, WT1, and p53 may be targeted
with a CAR. This may be achieved by a CAR expressed on a universal
T cell that recognizes the processed peptide described from the
intracellular tumor associated antigen in the context of HLA. In
addition, the universal T cell may be genetically modified to
express a T-cell receptor pairing that recognizes the intracellular
processed tumor associated antigen in the context of HLA.
[0092] The pathogen recognized by a CAR may be essentially any kind
of pathogen, but in some embodiments the pathogen is a fungus,
bacteria, or virus. Exemplary viral pathogens include those of the
families of Adenoviridae, Epstein-Barr virus (EBV), Cytomegalovirus
(CMV), Respiratory Syncytial Virus (RSV), JC virus, BK virus, HSV,
HHV family of viruses, Picornaviridae, Herpesviridae,
Hepadnaviridae, Flaviviridae, Retroviridae, Orthomyxoviridae,
Paramyxoviridae, Papovaviridae, Polyomavirus, Rhabdoviridae, and
Togaviridae. Exemplary pathogenic viruses cause smallpox,
influenza, mumps, measles, chickenpox, ebola, and rubella.
Exemplary pathogenic fungi include Candida, Aspergillus,
Cryptococcus, Histoplasma, Pneumocystis, and Stachybotrys.
Exemplary pathogenic bacteria include Streptococcus, Pseudomonas,
Shigella, Campylobacter, Staphylococcus, Helicobacter, E. coli,
Rickettsia, Bacillus, Bordetella, Chlamydia, Spirochetes, and
Salmonella. In some embodiments the pathogen receptor Dectin-1 may
be used to generate a CAR that recognizes the carbohydrate
structure on the cell wall of fungi such as Aspergillus. In another
embodiment, CARs can be made based on an antibody recognizing viral
determinants (e.g., the glycoproteins from CMV and Ebola) to
interrupt viral infections and pathology.
[0093] In some embodiments, naked DNA or a suitable vector encoding
a CAR can be introduced into a subject's T cells (e.g., T cells
obtained from a human patient with cancer or other disease).
Methods of stably transfecting T cells by electroporation using
naked DNA are known in the art. See, e.g., U.S. Pat. No. 6,410,319.
Naked DNA generally refers to the DNA encoding a chimeric receptor
of the present invention contained in a plasmid expression vector
in proper orientation for expression. In some embodiments, the use
of naked DNA may reduce the time required to produce T cells
expressing a CAR generated via methods of the present
invention.
[0094] Alternatively, a viral vector (e.g., a retroviral vector,
adenoviral vector, adeno-associated viral vector, or lentiviral
vector) can be used to introduce the chimeric construct into T
cells. Generally, a vector encoding a CAR that is used for
transfecting a T cell from a subject should generally be
non-replicating in the subject's T cells. A large number of vectors
are known that are based on viruses, where the copy number of the
virus maintained in the cell is low enough to maintain viability of
the cell. Illustrative vectors include the pFB-neo vectors
(STRATAGENE.RTM.) as well as vectors based on HIV, SV40, EBV, HSV,
or BPV.
[0095] Once it is established that the transfected or transduced T
cell is capable of expressing a CAR as a surface membrane protein
with the desired regulation and at a desired level, it can be
determined whether the chimeric receptor is functional in the host
cell to provide for the desired signal induction. Subsequently, the
transduced T cells may be reintroduced or administered to the
subject to activate anti-tumor responses in the subject. To
facilitate administration, the transduced T cells may be made into
a pharmaceutical composition or made into an implant appropriate
for administration in vivo, with appropriate carriers or diluents,
which are preferably pharmaceutically acceptable. The means of
making such a composition or an implant have been described in the
art (see, for instance, Remington's Pharmaceutical Sciences, 16th
Ed., Mack, ed. (1980)). Where appropriate, transduced T cells
expressing a CAR can be formulated into a preparation in semisolid
or liquid form, such as a capsule, solution, injection, inhalant,
or aerosol, in the usual ways for their respective route of
administration. Means known in the art can be utilized to prevent
or minimize release and absorption of the composition until it
reaches the target tissue or organ, or to ensure timed-release of
the composition. Generally, a pharmaceutically acceptable form is
preferably employed that does not ineffectuate the cells expressing
the chimeric receptor. Thus, desirably the transduced T cells can
be made into a pharmaceutical composition containing a balanced
salt solution such as Hanks' balanced salt solution, or normal
saline.
IV. Artificial Antigen Presenting Cells
[0096] In some cases, aAPCs are useful in preparing CAR-based
therapeutic compositions and cell therapy products. For general
guidance regarding the preparation and use of antigen-presenting
systems, see, e.g., U.S. Pat. Nos. 6,225,042, 6,355,479, 6,362,001
and 6,790,662; U.S. Patent Application Publication Nos.
2009/0017000 and 2009/0004142; and International Publication No.
WO2007/103009).
[0097] aAPCs may be used to expand T Cells expressing a CAR. During
encounter with tumor antigen, the signals delivered to T cells by
antigen-presenting cells can affect T-cell programming and their
subsequent therapeutic efficacy. This has stimulated efforts to
develop artificial antigen-presenting cells that allow optimal
control over the signals provided to T cells (Turtle et al., 2010).
In addition to antibody or antigen of interest, the aAPC systems
may also comprise at least one exogenous assisting molecule. Any
suitable number and combination of assisting molecules may be
employed. The assisting molecule may be selected from assisting
molecules such as co-stimulatory molecules and adhesion molecules.
Exemplary co-stimulatory molecules include CD70 and B7.1 (also
called B7 or CD80), which can bind to CD28 and/or CTLA-4 molecules
on the surface of T cells, thereby affecting, e.g., T-cell
expansion, Th1 differentiation, short-term T-cell survival, and
cytokine secretion such as interleukin (IL)-2 (see Kim et al.,
2004). Adhesion molecules may include carbohydrate-binding
glycoproteins such as selectins, transmembrane binding
glycoproteins such as integrins, calcium-dependent proteins such as
cadherins, and single-pass transmembrane immunoglobulin (Ig)
superfamily proteins, such as intercellular adhesion molecules
(ICAMs), that promote, for example, cell-to-cell or cell-to-matrix
contact. Exemplary adhesion molecules include LFA-3 and ICAMs, such
as ICAM-1. Techniques, methods, and reagents useful for selection,
cloning, preparation, and expression of exemplary assisting
molecules, including co-stimulatory molecules and adhesion
molecules, are exemplified in, e.g., U.S. Pat. Nos. 6,225,042,
6,355,479, and 6,362,001.
[0098] Cells selected to become aAPCs, preferably have deficiencies
in intracellular antigen-processing, intracellular peptide
trafficking, and/or intracellular MHC Class I or Class II
molecule-peptide loading, or are poikilothermic (i.e., less
sensitive to temperature challenge than mammalian cell lines), or
possess both deficiencies and poikilothermic properties.
Preferably, cells selected to become aAPCs also lack the ability to
express at least one endogenous counterpart (e.g., endogenous MHC
Class I or Class II molecule and/or endogenous assisting molecules
as described above) to the exogenous MHC Class I or Class II
molecule and assisting molecule components that are introduced into
the cells. Furthermore, aAPCs preferably retain the deficiencies
and poikilothermic properties that were possessed by the cells
prior to their modification to generate the aAPCs. Exemplary aAPCs
either constitute or are derived from a transporter associated with
antigen processing (TAP)-deficient cell line, such as an insect
cell line. An exemplary poikilothermic insect cells line is a
Drosophila cell line, such as a Schneider 2 cell line (e.g.,
Schneider, J.m 1972). Illustrative methods for the preparation,
growth, and culture of Schneider 2 cells, are provided in U.S. Pat.
Nos. 6,225,042, 6,355,479, and 6,362,001.
[0099] aAPCs may be subjected to a freeze-thaw cycle. For example,
aAPCs may be frozen by contacting a suitable receptacle containing
the aAPCs with an appropriate amount of liquid nitrogen, solid
carbon dioxide (dry ice), or similar low-temperature material, such
that freezing occurs rapidly. The frozen aAPCs are then thawed,
either by removal of the aAPCs from the low-temperature material
and exposure to ambient room temperature conditions, or by a
facilitated thawing process in which a lukewarm water bath or warm
hand is employed to facilitate a shorter thawing time.
Additionally, aAPCs may be frozen and stored for an extended period
of time prior to thawing. Frozen aAPCs may also be thawed and then
lyophilized before further use. Preservatives that might
detrimentally impact the freeze-thaw procedures, such as dimethyl
sulfoxide (DMSO), polyethylene glycols (PEGs), and other
preservatives, may be advantageously absent from media containing
aAPCs that undergo the freeze-thaw cycle, or are essentially
removed, such as by transfer of aAPCs to media that is essentially
devoid of such preservatives.
[0100] In other preferred embodiments, xenogenic nucleic acid and
nucleic acid endogenous to the aAPCs may be inactivated by
crosslinking, so that essentially no cell growth, replication or
expression of nucleic acid occurs after the inactivation. For
example, aAPCs may be inactivated at a point subsequent to the
expression of exogenous MHC and assisting molecules, presentation
of such molecules on the surface of the aAPCs, and loading of
presented MHC molecules with selected peptide or peptides.
Accordingly, such inactivated and selected peptide loaded aAPCs,
while rendered essentially incapable of proliferating or
replicating, may retain selected peptide presentation function. The
crosslinking can also result in aAPCS that are essentially free of
contaminating microorganisms, such as bacteria and viruses, without
substantially decreasing the antigen-presenting cell function of
the aAPCs. Thus crosslinking can be used to maintain the important
APC functions of aAPCs while helping to alleviate concerns about
safety of a cell therapy product developed using the aAPCs. For
methods related to crosslinking and aAPCs, see for example, U.S.
Patent Application Publication No. 20090017000, which is
incorporated herein by reference.
IV. Examples
[0101] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1
Materials and Methods
[0102] Generation of Clinical-Grade DNA Plasmids
[0103] The SB transposon, CoOpCD19RCD28.zeta./pSBSO, expresses the
human codon optimized (CoOp) 2nd generation CoOpCD19RCD28.zeta. CAR
under EF-1/HTLV hybrid composite promoter (InvivoGen) comprised of
Elongation Factor-1a (EF-1a [Kim et al., 1990] and 59 untranslated
region of the Human T-Cell Leukemia Virus (HTLV) [Singh et al.,
2011; Davies et al., 2010]. The derivation of this DNA plasmid is
described in Figure S1. The SB transposase, SB11, under the
cytomegalovirus (CMV) promoter is expressed in cis from the DNA
plasmid pCMV-SB11 (Singh et al., 2011; Singh et al., 2008). Both
plasmids were sequenced in their entirety and manufactured by
Waisman Clinical Biomanufacturing Facility (Madison, Wis.) using
kanamycin for selection of the bacterial strain E. Coli DH5a.
[0104] Generation of Triple Site-Specific Recombination DNA
Plasmids--EZ-Build-CARs
[0105] Using the DNA sequence from the CAR described above
(CoOpCD19RCD28z/pSBSO), the parts CD19 ScFv, the hinge IgG4 Fc and
the domain CD28 transmembrane and cytosolic portion conjugated with
CD3.zeta. signaling domain were flanked by lambda recombination
sites, synthetized by Geneart (Life Technologies) as PCR products.
These three parts were individually inserted into pDonors221
plasmids (by the enzyme BP clonase (both from Invitrogen). The
three plasmids were recombined with the triple site specific
recombination Sleeping Beauty plasmid by the enzyme LR PLUS clonase
(Invitrogen) generating the EZ-Build CD19CD28.zeta. CAR in the
format scFv-B-scaffold-C-signaling domain(s) (FIG. 1).
[0106] Cell Counting
[0107] Trypan-blue exclusion was used to distinguish live from dead
cells and counted using Cellometer (Nexecelom Bioscience) (Singh et
al., 2011).
[0108] Isolation of PBMC
[0109] Leukapheresis products from two male volunteer healthy
donors were purchased from Key Biologics LLC (Memphis, Tenn.). The
peripheral blood mononuclear cells (PBMC) were isolated by our
adapting the Biosafe Sepax system (Eysins, Switzerland) for work in
compliance with cGMP. Briefly, after closing all the clamps on the
CS-900 kit, 100 mL Ficoll (GE Healthcare) was aseptically
transferred via 60 mL syringes to a density gradient media bag
("ficoll bag") via Luer-lock connector and the tubing was heat
sealed using a hand held sealer (Sebra, Model#2380). The kit was
spike-connected to a 1,000 mL bag containing CliniMACS buffer
(PBS/EDTA, Miltenyi, Cat#70026) with 20 mL 25% Human Serum Albumin
(HSA) (Baxter) (2% v/v, wash buffer) for washes, a final product
bag [300 mL Transfer Pack with Coupler (Baxter/Fenwal 4R2014)] and
a reagent/blood bag. Using the density gradient-based separation
protocol (v126), the syringe piston was loaded into the centrifuge
chamber and the cover of the Sepax aAPC (clone #4) to selectively
propagate CAR+ T cells The c-irradiated aAPC were used to
numerically expand the genetically modified T cells. Thawed aAPC
from WCB were propagated in CM for up to 60 days in VueLife cell
culture bags and harvested using Biosafe Sepax II harvest
procedure. Briefly, CS-490.1 kit was connected to a 300 mL output
bag (transfer pack) via Luer lock connection. The separation
chamber was installed in the pit and the tubing was inserted into
the optical sensor and stopcocks aligned in T-position. After
connecting the pressure sensor line, the product bag and
supernatant/plasma bags were hung on the holder. The modified
protocol PBSCv302 was selected from the Sepax menu and the volume
of input product to be processed (initial volume) was set to #840
mL. After validation and kit test, the procedure was started.
Following completion, the bags were removed, clamps closed and the
kit was removed. The cells from the final product bag were
aseptically removed, washed twice with wash media (10% HSA in
Plasmalyte) and counted. aAPC were irradiated (100 Gy) using a CIS
BIO International radiator (IBL-437 C#09433) and cryopreserved for
later use in cryopreservation media using controlled-rate freezer
(Planer Kryo 750). The anti-CD3 (OKT3) loaded K562-derived aAPC
clone #4 was used to propagate control (CARneg) autologous control
T cells that had not undergone genetic modification. The aAPC,
obtained from culture, were incubated overnight in serum-free
X-Vivo 15 (cat #04-744Q, Lonza) containing 0.2% acetyl cysteine
(Acetadote, Cumberland Pharmaceuticals) termed Loading Medium (LM).
The next day cells were washed, irradiated (100 Gy) using a Gamma
Cell 1000 Elite Cs-137 radiator (MDS Nordion), resuspended in LM at
a concentration of 106 cells/mL along with 1 mg/10.sup.6 cells of
functional grade purified anti-human CD3 (clone-OKT3, 16-0037-85,
eBioscience) and incubated with gentle agitation on a 3-D rotator
(Lab-Line) at 4.degree. C. for 30 minutes. Following three washes
with LM the cells were used in experiments or frozen in aliquots in
liquid nitrogen in vapor layer for later use.
[0110] Manufacture of CAR+ T Cells
[0111] Thawed PBMC were resuspended in (i) Human T-cell kit (cat#
VPA-1002, Lonza; 100 .mu.L for 2.times.10.sup.7 cells in one
cuvette), with (ii) the DNA plasmid (CoOpCD19RCD28/pSBSO) coding
for CD19RCD28 CAR transposon (15 .mu.g supercoiled DNA per
2.times.10.sup.7 PBMC per cuvette), and (iii) the DNA plasmid
(pCMVSB11) coding for SB11 transposase (5 .mu.g supercoiled DNA per
2.times.10.sup.7 PBMC per cuvette). This mixture was immediately
transferred to a cuvette (Lonza), electroporated (defining culture
day 0) using Nucleofector II (Program U-14, Amaxa/Lonza), rested in
10% RPMI complete media for 2 to 3 hours, and after a half-media
change, incubated overnight at 37.degree. C., 5% CO.sub.2. The
following day, cells were harvested, counted, phenotyped by flow
cytometry, and co-cultured with c-irradiated aAPC at a ratio of 1:2
(CAR+ T cell:aAPC), which marked culture day 1 and the beginning of
a 7-day stimulation cycle. IL-21 (cat # AF-200-21, PeproTech) and
IL-2 (cat # NDC 65483-116-07, Novartis) were added on a
Monday-Wednesday-Friday schedule onwards of day 1 and day 7
respectively. NK cells can prevent the numeric expansion of CAR+ T
cells, especially if their overgrowth occurs early in the tissue
culturing process. Therefore, a CD56-depletion was performed if
CD3negCD56+ cells $10% using CD56 beads (cat #70206, Miltenyi
Biotech, 20 mL beads/107 cells) on LS columns (cat #130-042-401,
Miltenyi Biotech) in CliniMACS buffer containing 25% HSA (80 mL/107
cells).
[0112] Generation of CAR.sup.neg Control T Cells
[0113] As a control, 5.times.10.sup.6 mock transfected PBMC were
co-cultured with irradiated and anti-CD3 (OKT3) loaded K562-derived
aAPC clone #4 at a ratio of 1:1 in a 7-day stimulation cycle. All
the cultures were supplemented with IL-21 (30 ng/mL) from culture
day 1 onwards, and IL-2 (50 U/mL) starting 7 days after the start
of the culture. All cytokines were subsequently added every other
day
[0114] Immunophenotype of Cells
[0115] Cells were stained using antibodies in 100 mL FACS Buffer
(2% FBS, 0.1% Sodium Azide) for 30 minutes at 4.degree. C.
Acquisition was performed using FACSCalibur (BD Bioscience) and
analyzed using FCS Express 3.00.0612
[0116] Chromium Release Assay
[0117] T cells were evaluated for their cytotoxicity in a standard
4-hour chromium release assay using .sup.51Cr-labeled target cells.
T cells were plated in triplicate at 1.times.10.sup.5,
0.5.times.10.sup.5, 0.25.times.10.sup.5, 0.125.times.10.sup.5
bottom plate (Costar). After incubation, 50 .mu.L of supernatant
was harvested onto LumaPlate (Perkin Elmer), read in TopCount NXT
(Perkin Elmer) and percent specific lysis was calculated per:
Experimental 51 Cr released - Spontaneous 51 Cr released Maximum 51
Cr released - Spontaneous 51 Cr released .times. 100
##EQU00001##
[0118] Spontaneous and maximum release was determined by measuring
chromium in the conditioned supernatant from target cells incubated
with CM or 0.1% Triton X-100 (Sigma), respectively and
0.0625.times.10.sup.5 cells/well with 5.times.10.sup.3 target cells
in a 96-well V (Manufacturee Novo Software, Thornhill, Ontario,
Canada).
Example 2
Generation of CD19.sup.+ CAR
[0119] A CD19+ CAR was generated using the methods described above
in Example 1 (referred to as the "EZ" method). These CD19.sup.+ CAR
(CD19CAR) were compared to a clinical grade ("CG") CD19CAR
generated via a previous method.
[0120] The data showed that the triple site-recombination system
generated a CD19CAR (EZ) similar to the clinical grade CD19CAR
(CG). The footprints left by recombination-sites in the plasmids
did not interfere in the expression and function of the CAR (FIGS.
2A-B).
Example 3
Generation of CAR Containing (CD8, CD28) Transmembrane Domains and
(CD28, 4-1BB) Signaling Domains
[0121] Various CARs tested have shown similar expansion,
cytotoxicity, and Th1 cytotoxicity. CD19-BB-z has shown lower
production of Th2 cytokines; in vivo, it was efficient in
controlling disease in mice (Molecular Therapy 17 (8): 1453-1464,
2009). Nonetheless, a concern exists due to the fact that cells
persisted in vitro without antigenic stimulation.
[0122] CARs in the clinic are shown below in Table 2. In some
embodiments, a CAR of the present invention does not have the
specific construct as shown in the below Table 2. Alternately, in
some embodiments, methods of the present invention may be used to
generate another variation of a CAR having the characteristics of
the CAR mentioned below in Table 2 that is nonetheless distinct
from the CAR currently being used in the clinic.
TABLE-US-00003 TABLE 2 CARs in the Clinic Clinical Trial UPenn
Cooper (MDACC) Gene Transfer Lentivirus Electroporation/ Method
Sleeping Beauty scfv derived from FMC63 FMC63 Scaffold CD8alpha
IgG4 Space region 69 aa 230 aa Transmembrane CD8alpha CD28 CAR
signaling CD137 and CD28 and CD3-zeta endomain(s) CD3-zeta Culture
Method CD3/CD28 beads K562 aAPC Cytokine IL-2 IL-2 and IL-21
Culture Time 14 days 28 days Transgene 4-23% >80% Expression in
product infused
[0123] Specific CAR construct designs are illustrated in FIG. 3. As
shown in FIG. 3, a schematic of various CARs using a combination of
CD19scfv, CD8a hinge or IgG4 Fc stalk, CD8 transmembrane (TM) or
CD28 TM or CD137 TM and signaling through CD28 or CD137 endodomain
along with CD3zeta endodomain were generated.
[0124] The CAR constructs shown in FIG. 3 were then cloned into
Sleeping Beauty plasmids containing SIM and FRA tags to allow
tracking in competitive repopulation studies, when amplified using
a common CVseq7 primer. The Sleeping Beauty tracking plasmids are
shown in FIG. 4.
[0125] The CAR constructs shown in FIG. 3 were electroporated into
T cells using Amaxa Nucleofector II and co-cultured with aAPC for
28 days in the presence of cytokines (IL2, IL-21). CAR expression
the day after electroporation (day 1) and after 28 days of
co-culture with aAPC (day 28) is shown. Dot-plots for CD3 and CAR
are shown, where CD3 and anti-CD19scfv specific Ab was used to
distinguish T cells and CAR. CAR expression results are shown in
FIG. 5.
[0126] The CAR constructs shown in FIG. 3 were evaluated for CAR
expression over time for 28 days and is shown. After 21 days most
of the cultures had >80% CAR expression. CAR expression kinetics
are shown in FIG. 6.
[0127] Percent expression of CD4 and CD8 T cells in cultures
nucleofected with CARs from FIG. 3 is shown after 28 days of
co-culture with aAPC. These phenotype results are shown in FIG.
7.
[0128] After 28 days of co-culture CAR.sup.+ T cells (expressing
the CAR described in FIG. 3) were evaluated for expression of
markers pertaining to memory (CD45RA, CCR7, CD27), activation
(CD69, HLA-DR), cytotoxic (Perforin, Granzyme B),
exhaustion/senescence (CD57, KLRG1, PD1), and adhesion (CD39,
CD150). Results for this extended phenotype are shown in FIGS.
8A-B.
[0129] CAR.sup.+ T cells (expressing the CAR described in FIG. 3)
were evaluated for expression of CD3.zeta. using western blot. Cell
lysates were run under denaturing conditions, transferred and the
expression of chimeric CD3.zeta. was measured using a primary mouse
anti-human CD3.zeta. mAb and HRP-conjugated goat anti-mouse IgG
using SuperSignal West Femto Maximum Sensitivity substrate.
Chimeric CD3.zeta. bands at 52, 71 and 78 kD are observed relative
to size of CAR constructs. These western blot results are shown in
FIG. 9.
[0130] T cells electroporated with the CAR constructs (described in
FIG. 3) were stimulated with K562 aAPC at day 1 and every 7 days
thereafter for 28 days. At the end of each stimulation cycle, cells
were counted using trypan blue exclusion method and phenotyped for
CD3 and CAR expression. The graphs shown in FIG. 10 depict inferred
cell counts for total, CD3, and CAR.sup.+ T cells over time.
[0131] Expansion of cells was measured. Fold expansion for Total
Cells (FIG. 11) and CAR.sup.+ (FIG. 12) T cells was calculated at
day 14, 21 and 28 days of co-culture by comparing counts to day 1
(post electroporation). Results are shown in FIG. 11 and FIG.
12.
[0132] Cytotoxicity was measured for the CAR-expressing T Cells
(CAR.sup.+ T cells). CAR+ T cells (expressing CAR described in FIG.
3) were evaluated for their cytotoxicity against CD19 tumor targets
(Daudi.beta..sub.2m, NALM-6 and CD19.sup.+ EL-4) as compared to
CD19.sup.neg EL-4 in a standard 4-hr chromium release assay.
Results are shown in FIG. 13, FIG. 14, FIG. 15, and FIG. 16.
[0133] Intracellular IFN-.gamma. production. CAR.sup.+ T cells
(expressing the constructs described in FIG. 3) were incubated with
(CD19.sup.+ and CD19.sup.neg) stimulator cells in the presence of
protein transport inhibitor for 4-6 hr, fixed, permeabilized and
stained with IFN-.gamma. specific mAb. PMA-Ionomycin was used as a
positive control. Results for intracellular IFN-.gamma. production
are shown in FIG. 17, FIG. 18, FIG. 19, and FIG. 20.
[0134] PCR for SB11 transposase. DNA isolated from CAR+ T cells
(FIG. 3) was amplified using SB11 specific primers in a thermal
cycler. GAPDH was used as the housekeeping gene, and linearized
pCMV-SB11 plasmid, genomic DNA from Jurkat cells expressing SB11
were used as positive controls. CAR.sup.neg cells (No DNA) were
used as negative controls. These PCR results are shown in FIG.
21.
[0135] CAR copy number was measured using quantitative PCR (qPCR).
The integrated number of CAR transgene in cells (of the CAR
constructs shown in FIG. 3) were evaluated by amplifying genomic
DNA using primers and probes specific for the IgG4 Fc stalk and
inverted/direct repeats (IR/DR). RNAse P gene was used as an
internal control, and the Jurkat cell line expressing a single copy
of CAR was used to generate a standard curve. Results are shown in
FIG. 22.
[0136] Next, CAR+ T cells were measured for the presence or absence
of autonomous growth. Aberrant growth of CAR+ T cells (expressing
CAR constructs shown in FIG. 3) was monitored and measured by
culturing T cells in the absence of cytokines and aAPC. Cells were
counted every 7 days and the percents alive/dead cells (from day 1)
were calculated and plotted. As shown in FIG. 23, more than 80% of
T cells were observed to be dead by day 14 showing lack of
autonomous growth.
[0137] Various CARs could be expressed (>80%), expanded
(.about.1010) and were cytotoxic (.about.60%, Daudi) to similar
extend. Scaffolding domains (IgG4 or CD8.alpha.) were used to build
CAR and didn't effect expression or potency. Transmembrane domains
(CD8, CD28) did not affect potency. 4-1BB transmembrane domain
(216) affected expression (anti-scFv Ab), but not cytoxicity and
cytokine production. Combination of signaling domains, CD28 and
4-1BB did not have an additive effect. CAR+ T cells exhibited
memory/effector phenotype. CARs containing only 4-1BB domain (212,
214, 217) had higher CCR7 expression as compared to others. Cells
expressed markers for memory (CD27hi, CD45RAhi, CCR7lo), activation
(CD69med, HLA-DRhi), cytolysis (granzymehi, perforinlo), and
adhesion (CD39hi, CD150lo), but negligible amounts of inhibitory
markers (CD57, PD1, KLRG1) were observed. All the CARs including
the ones containing 4-1BB domain lacked SB11 transposase and did
not auto-proliferate.
Example 4
Generation of CAR Containing CD3-zeta
[0138] CAR containing CD3.zeta. are provided in this example. A
general diagram of CAR design is shown in FIG. 24. As shown in FIG.
24, a comparison of CAR design (FIG. 24, right) with an antibody
molecule (FIG. 24, left) are shown.
[0139] CD3.zeta. sequences are shown in FIG. 25. The sequence of
CD3zeta and its isoform are shown in FIG. 25. The CAR designs
included CD3 zeta (isoform 1) which forms one of the endodomain
signaling moieties and has three ITAMs.
[0140] Specific CAR constructs are shown in FIG. 26 and FIG. 27.
FIG. 26 shows a schematic of CD19-specific CARs having long (IgG4),
medium (CD8a hinge) and small (IgG 12 aa) stalks which signaling
through CD28 or CD137 endodomains. Nomenclature of CAR molecules
with different stalks and signaling are shown in FIG. 27.
[0141] CAR expression was measured. Expression of CAR (as described
in FIG. 26) was measured the day after electroporation (day 1) and
after 28 days of co-culture on aAPC (day 28). Dot plots of CD3 and
CAR (as measured by CD19scfv-specific mAb) are shown in FIG.
28.
[0142] Expansion kinetics were measured for the CAR. T cells
electroporated with CAR constructs (shown in FIG. 26) were
co-cultured on aAPC in a 7-day stimulation cycle. Cells were
counted and evaluated for expression of CD3 and CAR. Results are
shown in FIG. 29 and FIG. 30.
[0143] Cytotoxicity of the CAR.sup.+ T cells was measured. At the
end of 28 days of co-culture CAR.sup.+ T cells (expressing
constructs shown in FIG. 26) were evaluated for cytotoxicity
against tumor targets in a chromium release assay. As shown in FIG.
31, percent cytotoxicity was measured at various effector-to-target
ratio for CD19RCD28 (CAR 194) and CD19RCD137 (CAR 217) CARs against
CD19.sup.+ and CD19.sup.neg tumor targets. As shown in FIG. 32,
data were obtained for percent lysis of CD19.sup.+ EL-4 by
CAR.sup.+ T cells (expressing CAR constructs shown in FIG. 26) at
E:T ratio of 20:1. The percent expression of CD27, CD62L, CD28 and
CCR7 on CAR.sup.+ T cells (expressing constructs shown in FIG. 26)
was measured, and results are shown in FIG. 33.
[0144] Intracellular cytokine production was measured for the
CAR.sup.+ T cells. Stimulator cells (CD19.sup.+ and CD19.sup.neg)
were incubated with CAR.sup.+ T cells (expressing CAR shown in FIG.
26) for 4 hr in the presence of protein transport inhibitor and
stained with IFN-.gamma. and IL-2 mAb. PMA-Ionomycin served as a
positive control and T cells alone served as negative control. FIG.
34 shows percentage of IFN-.gamma. producing cells after
stimulation. FIG. 35 shows breakdown of IFN-.gamma. and or, IL-2
producing cells after incubation with cell stimulation cocktail
(PMA-Ionomycin).
[0145] The CAR.sup.+ T cells were measured for the presence of
absence of autonomous growth. CAR.sup.+ T cells (expressing CAR
described in FIG. 26) were evaluated for their lack of aberrant
growth in the absence of external stimulation (cytokines and aAPC)
for 18 days. At the end of 18 days, more than 80% of the cells were
dead showing lack of unwanted growth. As shown in FIG. 36, a lack
of autonomous growth was observed.
[0146] CAR copy number was measured in the CAR.sup.+ T cells. The
number of copies of integrated CAR molecule was evaluated using
primers/probes specific for IgG4-Fc and IR/DR regions by qPCR. As
shown in FIG. 37, CAR copy number integrated (of CAR shown in FIG.
26) was observed using the IR/DR probe. As shown in FIG. 38 and
FIG. 39, a compilation of CAR copy number data are provided in a
table and graphical form for CAR constructs (for both CAR
constructs shown in FIG. 3 and CAR constructs shown in FIG. 26) as
tested in two separate experiments (P491; C714 and GCR357861).
[0147] These data show that CARs with various spacers can be
expressed and grown in vitro in the culture system as described
herein. All CARs were observed to have similar CAR expression. The
maximum cytotoxicity of CD19+ EL-4s was observed in CARs with a CD8
hinge region. Similar expression of CD62L and CD28 was observed on
all CARs tested. High integration frequency as measured by CAR copy
number was observed in all CAR, except for CAR containing IgG4-Fc
stalk. A lack of autonomous growth and SB11 was observed by PCR.
Contrary to previous reports, inclusion of a 12aa spacer in the CAR
did not confer improved functionality in these studies.
Example 5
Rapid Assembly of CARs from Principal Components
[0148] The inventors generated a CD19-specific CAR that is
activated through chimeric CD28/CD3-zeta using the EZ CAR platform
in parallel with clinical-grade CD19RCD28m.zeta. CAR+ T cells (CG
CAR). Both, Clinical Grade CD28/CD3-.zeta. and EZ CAR
CD19RCD28m.zeta. CARs sequences were inserted into Sleeping Beauty
transposon vectors and electroporated into T cells. After
electroporation the T cells were cultivated in presence of CD19+
artificial Antigen Presenting Cells (also called Activating and
Propagating Cells, or AaPCs) for antigen specific expansion of the
T cells. The expression of the CARs in the T cell's surface was
measured every week by flow cytometry (Fc+ expression), showing
similar CAR expression in Clinical Grade CD19 CAR T cells and EZ
CD19 CAR T cells. A Chromium Release Assay (CRA) was also performed
to evaluate the killing function of T cells CD19 CAR+ generated by
EZ CAR platform against tumor cells. After 4 hours of incubation
the percentage of specific cell lysis was observed to be 52% by the
EZ CAR T cells and 49% by the CG CAR T cells.
[0149] These results demonstrate that functional CAR.sup.+ T cells
were generated using these methods. The inventors then performed a
rapid production of CARs using methods as described above in
combination with a library of plasmids containing the following
three components of a CAR molecule: (i) anti-CD19 scFv (ii) 5
hinges with different sizes (long--IgG4a and IgG4AEQ, medium--CD8c,
short--t-20AA and t-12AA) and (iii) different combinations of 7
signaling domains (CD27, CD28,
CD28.DELTA.Y.sup.173.fwdarw.F.sup.173, CD134, CD137, CD278) with
the CD3.zeta. domain. Transfection of HEK 293 cells with plasmid
containing the CAR transgene were used to screen 27 different CARs
constructs to ensure the expression of the CAR protein in the cell
surface. The high throughput testing of individual CAR molecules
was undertaken using the iQue.TM. Screener (Intellicyt,
Albuquerque, N. Mex.), a high throughput flow cytometer, where
cytotoxic assays are performed using engineered target cells
expressing a fluorescent granzyme B reporter or GFP. Results are
shown in FIGS. 40A-E.
[0150] Additional experiments were performed to screen the CAR
molecules using IntelliCyt's iQue.TM.. iQue.TM. uses high
throughput flow cytometry, a complementary technology that
generates information by studying large populations using
multiplexing capabilities and cell-by-cell analysis. The inventors
adapted this technology to inform on the therapeutic potential of T
cells modified with panels of CARs. T cells from the wells can be
stained for viability, as well as activation signals (e.g.,
upregulation of CD25), cytokine release, and killing. Thus the
inventors adapted the iQue Screener and harnessed its ability to
perform multiplexed bead-based cytokine detection and cell-based
assays. The results obtained indicate that this technology may be
used to test a large number of different CAR T cells generated by
the EZ CAR platform. Data was generated using IntelliCyt's
iQue.TM., where 2 populations of CAR T cells were evaluated on
their abilities to kill target cells. Results are shown in FIGS.
41A-B and FIG. 42. These results demonstrate that the CAR molecules
were active and the iQue.TM. method may be effectively used to
evaluate CAR activity.
[0151] All of the methods disclosed and claimed herein can be made
and executed without undue experimentation in light of the present
disclosure. While the compositions and methods of this invention
have been described in terms of preferred embodiments, it will be
apparent to those of skill in the art that variations may be
applied to the methods and in the steps or in the sequence of steps
of the method described herein without departing from the concept,
spirit and scope of the invention. More specifically, it will be
apparent that certain agents which are both chemically and
physiologically related may be substituted for the agents described
herein while the same or similar results would be achieved. All
such similar substitutes and modifications apparent to those
skilled in the art are deemed to be within the spirit, scope and
concept of the invention as defined by the appended claims.
REFERENCES
[0152] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by reference.
[0153] U.S. Pub. No. 2009/0017000 [0154] U.S. Pub. No. 2009/0004142
[0155] U.S. Pat. No. 6,225,042 [0156] U.S. Pat. No. 6,355,479
[0157] U.S. Pat. No. 6,362,001 [0158] U.S. Pat. No. 6,410,319
[0159] U.S. Pat. No. 6,790,662 [0160] U.S. Pat. No. 7,109,304
[0161] WO2007/103009 [0162] Ahmed and Cheung, FEBS Lett. 2014 Jan.
21; 588(2):288-97. [0163] Altenschmidt et al., Adoptive transfer of
in vitro-targeted, activated T lymphocytes results in total tumor
regression, J Immunol. 1997 Dec. 1; 159(11):5509-15. [0164] Audet
et al., Sci Rep. 2014 Nov. 6; 4:6881. [0165] Berry et al. Adoptive
immunotherapy for cancer: the next generation of gene-engineered
immune cells. Tissue Antigens. 2009 October; 74(4):277-89. [0166]
Brocker et al., Adv. Immunol., 68:257, 1998. [0167] Curtin et al.,
MAbs. 2015 Jan. 2; 7(1):265-75. [0168] Czerwi ski et al., Drug
Metab Dispos. 2015 January; 43(1):42-52. [0169] Davies J K, Singh
H, Huls H, Yuk D, Lee D A, et al. (2010) Combining CD19 redirection
and alloanergization to generate tumor-specific human T cells for
allogeneic cell therapy of B-cell malignancies. Cancer Res 70:
3915-3924. [0170] de Weers et al., J Immunol. 2011 Feb. 1;
186(3):1840-8. [0171] Duong et al., (2013) Engineering T Cell
Function Using Chimeric Antigen Receptors Identified Using a DNA
Library Approach. PLOS ONE 8(5):e63037. [0172] Eshhar et al.,
Specific activation and targeting of cytotoxic lymphocytes through
chimeric single chains consisting of antibody-binding domains and
the gamma or zeta subunits of the immunoglobulin and T-cell
receptors. Proc Natl Acad Sci USA.; 90(2):720-4, 1993. [0173]
Eshhar, Tumor-specific T-bodies: towards clinical application.
Cancer Immunol Immunother. 1997 November-December; 45(3-4):131-6.
1997 [0174] Fitzer-Attas et al., Harnessing Syk family tyrosine
kinases as signaling domains for chimeric single chain of the
variable domain receptors: optimal design for T cell activation. J
Immunol. 1998 Jan. 1; 160(1):145-54. 1998 [0175] Funakoshi et al.,
Cancer Treat Rev. 2014 December; 40(10):1221-9. [0176] Gerber et
al., Clin Cancer Res. 2011 Nov. 1; 17(21):6888-96. [0177] Goldberg
et al., J Clin Oncol. 2014 May 10; 32(14):1445-52. [0178] Gross et
al., Expression of immunoglobulin-T-cell receptor chimeric
molecules as functional receptors with antibody-type specificity.
Proc. Natl. Acad. Sci. USA, 86:10024-10028, 1989. [0179] Gross et
al. (1992) Endowing T cells with antibody specificity using
chimeric T cell receptors. FASEB J. 1992 December; 6(15):3370-8.
[0180] Hackett et al., A transposon and transposase system for
human application, Mol Ther. 2010 April; 18(4):674-83). [0181]
Hekele et al. Growth retardation of tumors by adoptive transfer of
cytotoxic T lymphocytes reprogrammed by CD44v6-specific
scFv:zeta-chimera. Int J Cancer. 1996 Oct. 9; 68(2):232-8, 1996.
[0182] Huls et al., Clinical Application of Sleeping Beauty and
Artificial Antigen Presenting Cells to Genetically Modify T Cells
from Peripheral and Umbilical Cord Blood. J. Vis. Exp.,
doi:10.3791/50070, 2013. [0183] Huls et al. "Clinical application
of Sleeping Beauty and artificial antigen presenting cells to
genetically modify T cells from peripheral and umbilical cord
blood" J Vis Exp. 2013 Feb. 1; (72):e50070. [0184] Humblet-Baron
and Baron, Immunol Cell Biol. 2015 Feb. 10.
doi:10.1038/icb.2014.120. [0185] Hwu et al. (1995) In vivo
antitumor activity of T cells redirected with chimeric
antibody/T-cell receptor genes. Cancer Res. 1995 Aug. 1;
55(15):3369-73. [0186] Ikeda et al., Clin Cancer Res. 2009 Jun. 15;
15(12):4028-37. [0187] Jabbour et al., Am J Hematol. 2014 Nov. 18.
[0188] Kaufmann et al., Hum Pathol. 1997 December; 28(12):1373-8.
[0189] Kaufman et al., Br J Haematol. 2013 November; 163(4):478-86.
[0190] Kim D W, Uetsuki T, Kaziro Y, Yamaguchi N, Sugano S (1990)
Use of the human elongation factor 1 alpha promoter as a versatile
and efficient expression system. Gene 91: 217-223. [0191] Kim et
al., 2004, Nature, Vol. 22(4), pp. 403-410. [0192] Kim et al.,
Immunology. 2010 August; 130(4):545-55. [0193] Kong et al., Leuk
Res. 2014 November; 38(11):1320-6. [0194] Krebs et al., T cells
expressing a chimeric antigen receptor that binds hepatitis B virus
envelope proteins control virus replication in mice.
Gastroenterology. 2013 August; 145(2):456-65. [0195] Le
Garff-Tavernier et al., Haematologica. 2014 Dec. 31. [0196] Lennard
S., Standard protocols for the construction of scFv libraries.
Methods Mol Biol. 2002; 178:59-71. [0197] Leung, Molecular Imaging
and Contrast Agent Database (MICAD), Bethesda (Md.): National
Center for Biotechnology Information (US); 2004-2013. 2010 Mar. 25
[0198] Leung 2011, IRDye800CW-anti-CD105 TRC105 chimeric monoclonal
antibody. Molecular Imaging and Contrast Agent Database (MICAD).
Bethesda (Md.): National Center for Biotechnology Information (US);
2004-2013. 2011 Dec. 1 [0199] Maiti et al., Sleeping beauty system
to redirect T-cell specificity for human applications. J
Immunother. 36(2):112-23, 2013. [0200] Manero et al.,
Haematologica. 2013 February; 98(2):217-21. [0201] Molecular
Therapy 17 (8): 1453-1464, 2009. [0202] Moritz et al. (1994)
Cytotoxic T lymphocytes with a grafted recognition specificity for
ERBB2-expressing tumor cells. Proc Natl Acad Sci USA. 1994 May 10;
91(10):4318-22. [0203] Patel et al., Anticancer Res. 2008
September-October; 28(5A):2679-86. [0204] Qiu et al., PLoS Negl
Trop Dis. 2012; 6(3):e1575. [0205] Remington's Pharmaceutical
Sciences, 16th Ed., Mack, ed. (1980) [0206] Rushworth et al.,
(2014) "Universal Artificial Antigen Presenting Cells to
Selectively Propagate T Cells Expressing Chimeric Antigen Receptor
Independent of Specificity" J Immunother. May; 37(4):204-13. [0207]
Sarup et al., Mol Cancer Ther. 2008 October; 7(10):3223-36. [0208]
Schneider, J. Embryol. Exp. Morph. 1972 Vol 27, pp. 353-365 [0209]
Schultz-Thater et al., Br J Cancer. 2000 July; 83(2):204-8. [0210]
Shin et al, Immune Netw. 2011 April; 11(2):114-22. [0211] Singh et
al., Redirecting specificity of T-cell populations for CD19 using
the Sleeping Beauty system. Cancer Res., 68:2961-2971, 2008. [0212]
Singh H, Figliola M J, Dawson M J, Huls H, Olivares S, et al.
(2011) Reprogramming CD19-specific T cells with IL-21 signaling can
improve adoptive immunotherapy of B-lineage malignancies. Cancer
Res 71: 3516-3527. [0213] Singh et al. "A new approach to gene
therapy using Sleeping Beauty to genetically modify clinical-grade
T cells to target CD19." Immunol Rev. 2014 January; 257(1):181-90.
[0214] Singh et al., "Manufacture of T cells using the Sleeping
Beauty system to enforce expression of a CD19-specific chimeric
antigen receptor." Cancer Gene Ther. 2015 Jan. 16. [0215]
Stancovski et al. (1993) [0216] Stynen et al., Fungal Cell Wall and
Immune Response, NATO ASI Series Volume 53, 1991, pp 181-193.
[0217] Sun et al., Cell Mol Immunol. 2007 June; 4(3):209-14. [0218]
Turtle et al., "Artificial antigen-presenting cells for use in
adoptive immunotherapy" Cancer J. 2010 July-August; 16(4):374-81.
[0219] Verel, Int J Cancer. 2002 May 20; 99(3):396-402. [0220]
Vincent and Samuel, Journal of Immunological Methods, Volume 165,
Issue 2, 15 Oct. 1993, Pages 177-182. [0221] Wang et al.,
Immunology. 2015 February; 144(2):254-62. [0222] Weijtens et al.
(1996) Single chain Ig/gamma gene-redirected human T lymphocytes
produce cytokines, specifically lyse tumor cells, and recycle lytic
capacity. J Immunol. 1996 Jul. 15; 157(2):836-43. [0223] Wieczorek
et al., Genetically Modified T Cells for the Treatment of Malignant
Disease. Transfus Med Hemother. 2013 December; 40(6):388-402.
[0224] Winiarska et al., MAbs. 2014; 6(5):1300-13. [0225] Zhuang et
al., Cancer Cell Int. 2014 Nov. 30; 14(1):109. [0226] Zhang et al.,
Angiogenesis. 2002; 5(1-2):35-44.
Sequence CWU 1
1
59136DNAArtificial sequenceSynthetic oligonucleotide 1gagagcaagt
acggccctcc ctgcccccct tgccct 3622037DNAArtificial sequenceSynthetic
oligonucleotide 2atgctgctgc tggtgaccag cctgctgctg tgtgagctgc
cccaccccgc ctttctgctg 60atccccgaca tccagatgac ccagaccacc tccagcctga
gcgccagcct gggcgaccgg 120gtgaccatca gctgccgggc cagccaggac
atcagcaagt acctgaactg gtatcagcag 180aagcccgacg gcaccgtcaa
gctgctgatc taccacacca gccggctgca cagcggcgtg 240cccagccggt
ttagcggcag cggctccggc accgactaca gcctgaccat ctccaacctg
300gagcaggagg acatcgccac ctacttttgc cagcagggca acacactgcc
ctacaccttt 360ggcggcggaa caaagctgga gatcaccggc agcacctccg
gcagcggcaa gcctggcagc 420ggcgagggca gcaccaaggg cgaggtgaag
ctgcaggaga gcggccctgg cctggtggcc 480cccagccaga gcctgagcgt
gacctgtacc gtgtccggcg tgtccctgcc cgactacggc 540gtgtcctgga
tccggcagcc ccctaggaag ggcctggagt ggctgggcgt gatctggggc
600agcgagacca cctactacaa cagcgccctg aagagccggc tgaccatcat
caaggacaac 660agcaagagcc aggtgttcct gaagatgaac agcctgcaga
ccgacgacac cgccatctac 720tactgtgcca agcactacta ctacggcggc
agctacgcca tggactactg gggccagggc 780accagcgtga ccgtgtccag
cgagagcaag tacggccctc cctgcccccc ttgccctgcc 840cccgagttcc
tgggcggacc cagcgtgttc ctgttccccc ccaagcccaa ggacaccctg
900atgatcagcc ggacccccga ggtgacctgt gtggtggtgg acgtgtccca
ggaggacccc 960gaggtccagt tcaactggta cgtggacggc gtggaggtgc
acaacgccaa gaccaagccc 1020cgggaggagc agttcaatag cacctaccgg
gtggtgtccg tgctgaccgt gctgcaccag 1080gactggctga acggcaagga
atacaagtgt aaggtgtcca acaagggcct gcccagcagc 1140atcgagaaaa
ccatcagcaa ggccaagggc cagcctcggg agccccaggt gtacaccctg
1200ccccctagcc aagaggagat gaccaagaat caggtgtccc tgacctgcct
ggtgaagggc 1260ttctacccca gcgacatcgc cgtggagtgg gagagcaacg
gccagcccga gaacaactac 1320aagaccaccc cccctgtgct ggacagcgac
ggcagcttct tcctgtacag caggctgacc 1380gtggacaaga gccggtggca
ggagggcaac gtctttagct gctccgtgat gcacgaggcc 1440ctgcacaacc
actacaccca gaagagcctg tccctgagcc tgggcaagat gttctgggtg
1500ctggtcgtgg tgggtggcgt gctggcctgc tacagcctgc tggtgacagt
ggccttcatc 1560atcttttggg tgaagagagg ccggaagaaa ctgctgtaca
tcttcaagca gcccttcatg 1620cggcccgtgc agaccaccca ggaagaggac
ggctgcagct gccggttccc cgaggaagag 1680gaaggcggct gcgaactgcg
ggtgaagttc agccggagcg ccgacgcccc tgcctaccag 1740cagggccaga
accagctgta caacgagctg aacctgggcc ggagggagga gtacgacgtg
1800ctggacaagc ggagaggccg ggaccctgag atgggcggca agccccggag
aaagaaccct 1860caggagggcc tgtataacga actgcagaaa gacaagatgg
ccgaggccta cagcgagatc 1920ggcatgaagg gcgagcggcg gaggggcaag
ggccacgacg gcctgtacca gggcctgagc 1980accgccacca aggataccta
cgacgccctg cacatgcagg ccctgccccc cagatga 203732034DNAArtificial
sequenceSynthetic oligonucleotide 3atgctgctgc tggtgaccag cctgctgctg
tgtgagctgc cccaccccgc ctttctgctg 60atccccgaca tccagatgac ccagaccacc
tccagcctga gcgccagcct gggcgaccgg 120gtgaccatca gctgccgggc
cagccaggac atcagcaagt acctgaactg gtatcagcag 180aagcccgacg
gcaccgtcaa gctgctgatc taccacacca gccggctgca cagcggcgtg
240cccagccggt ttagcggcag cggctccggc accgactaca gcctgaccat
ctccaacctg 300gagcaggagg acatcgccac ctacttttgc cagcagggca
acacactgcc ctacaccttt 360ggcggcggaa caaagctgga gatcaccggc
agcacctccg gcagcggcaa gcctggcagc 420ggcgagggca gcaccaaggg
cgaggtgaag ctgcaggaga gcggccctgg cctggtggcc 480cccagccaga
gcctgagcgt gacctgtacc gtgtccggcg tgtccctgcc cgactacggc
540gtgtcctgga tccggcagcc ccctaggaag ggcctggagt ggctgggcgt
gatctggggc 600agcgagacca cctactacaa cagcgccctg aagagccggc
tgaccatcat caaggacaac 660agcaagagcc aggtgttcct gaagatgaac
agcctgcaga ccgacgacac cgccatctac 720tactgtgcca agcactacta
ctacggcggc agctacgcca tggactactg gggccagggc 780accagcgtga
ccgtgtccag cgagagcaag tacggccctc cctgcccccc ttgccctgcc
840cccgagttcc tgggcggacc cagcgtgttc ctgttccccc ccaagcccaa
ggacaccctg 900atgatcagcc ggacccccga ggtgacctgt gtggtggtgg
acgtgtccca ggaggacccc 960gaggtccagt tcaactggta cgtggacggc
gtggaggtgc acaacgccaa gaccaagccc 1020cgggaggagc agttcaatag
cacctaccgg gtggtgtccg tgctgaccgt gctgcaccag 1080gactggctga
acggcaagga atacaagtgt aaggtgtcca acaagggcct gcccagcagc
1140atcgagaaaa ccatcagcaa ggccaagggc cagcctcggg agccccaggt
gtacaccctg 1200ccccctagcc aagaggagat gaccaagaat caggtgtccc
tgacctgcct ggtgaagggc 1260ttctacccca gcgacatcgc cgtggagtgg
gagagcaacg gccagcccga gaacaactac 1320aagaccaccc cccctgtgct
ggacagcgac ggcagcttct tcctgtacag caggctgacc 1380gtggacaaga
gccggtggca ggagggcaac gtctttagct gctccgtgat gcacgaggcc
1440ctgcacaacc actacaccca gaagagcctg tccctgagcc tgggcaagat
gttctgggtg 1500ctggtcgtgg tgggtggcgt gctggcctgc tacagcctgc
tggtgacagt ggccttcatc 1560atcttttggg tgaggagcaa gcggagcaga
ggcggccaca gcgactacat gaacatgacc 1620ccccggaggc ctggccccac
ccggaagcac taccagccct acgcccctcc cagggacttc 1680gccgcctacc
ggagccgggt gaagttcagc cggagcgccg acgcccctgc ctaccagcag
1740ggccagaacc agctgtacaa cgagctgaac ctgggccgga gggaggagta
cgacgtgctg 1800gacaagcgga gaggccggga ccctgagatg ggcggcaagc
cccggagaaa gaaccctcag 1860gagggcctgt ataacgaact gcagaaagac
aagatggccg aggcctacag cgagatcggc 1920atgaagggcg agcggcggag
gggcaagggc cacgacggcc tgtaccaggg cctgagcacc 1980gccaccaagg
atacctacga cgccctgcac atgcaggccc tgccccccag atga
203441491DNAArtificial sequenceSynthetic oligonucleotide
4atgctgctgc tggtgaccag cctgctgctg tgtgagctgc cccaccccgc ctttctgctg
60atccccgaca tccagatgac ccagaccacc tccagcctga gcgccagcct gggcgaccgg
120gtgaccatca gctgccgggc cagccaggac atcagcaagt acctgaactg
gtatcagcag 180aagcccgacg gcaccgtcaa gctgctgatc taccacacca
gccggctgca cagcggcgtg 240cccagccggt ttagcggcag cggctccggc
accgactaca gcctgaccat ctccaacctg 300gagcaggagg acatcgccac
ctacttttgc cagcagggca acacactgcc ctacaccttt 360ggcggcggaa
caaagctgga gatcaccggc agcacctccg gcagcggcaa gcctggcagc
420ggcgagggca gcaccaaggg cgaggtgaag ctgcaggaga gcggccctgg
cctggtggcc 480cccagccaga gcctgagcgt gacctgtacc gtgtccggcg
tgtccctgcc cgactacggc 540gtgtcctgga tccggcagcc ccctaggaag
ggcctggagt ggctgggcgt gatctggggc 600agcgagacca cctactacaa
cagcgccctg aagagccggc tgaccatcat caaggacaac 660agcaagagcc
aggtgttcct gaagatgaac agcctgcaga ccgacgacac cgccatctac
720tactgtgcca agcactacta ctacggcggc agctacgcca tggactactg
gggccagggc 780accagcgtga ccgtgtccag caagcccacc accacccctg
cccccagacc tccaacccca 840gcccctacaa tcgccagcca gcccctgagc
ctgaggcccg aagcctgtag acctgccgct 900ggcggagccg tgcacaccag
aggcctggat ttcgcctgcg acatctacat ctgggcccct 960ctggccggca
cctgtggcgt gctgctgctg agcctggtca tcaccctgta ctgcaaccac
1020cggaacaaga gaggccggaa gaaactgctg tacatcttca agcagccctt
catgcggccc 1080gtgcagacca cccaggaaga ggacggctgc agctgccggt
tccccgagga agaggaaggc 1140ggctgcgaac tgcgggtgaa gttcagccgg
agcgccgacg cccctgccta ccagcagggc 1200cagaaccagc tgtacaacga
gctgaacctg ggccggaggg aggagtacga cgtgctggac 1260aagcggagag
gccgggaccc tgagatgggc ggcaagcccc ggagaaagaa ccctcaggag
1320ggcctgtata acgaactgca gaaagacaag atggccgagg cctacagcga
gatcggcatg 1380aagggcgagc ggcggagggg caagggccac gacggcctgt
accagggcct gagcaccgcc 1440accaaggata cctacgacgc cctgcacatg
caggccctgc cccccagatg a 149151488DNAArtificial sequenceSynthetic
oligonucleotide 5atgctgctgc tggtgaccag cctgctgctg tgtgagctgc
cccaccccgc ctttctgctg 60atccccgaca tccagatgac ccagaccacc tccagcctga
gcgccagcct gggcgaccgg 120gtgaccatca gctgccgggc cagccaggac
atcagcaagt acctgaactg gtatcagcag 180aagcccgacg gcaccgtcaa
gctgctgatc taccacacca gccggctgca cagcggcgtg 240cccagccggt
ttagcggcag cggctccggc accgactaca gcctgaccat ctccaacctg
300gagcaggagg acatcgccac ctacttttgc cagcagggca acacactgcc
ctacaccttt 360ggcggcggaa caaagctgga gatcaccggc agcacctccg
gcagcggcaa gcctggcagc 420ggcgagggca gcaccaaggg cgaggtgaag
ctgcaggaga gcggccctgg cctggtggcc 480cccagccaga gcctgagcgt
gacctgtacc gtgtccggcg tgtccctgcc cgactacggc 540gtgtcctgga
tccggcagcc ccctaggaag ggcctggagt ggctgggcgt gatctggggc
600agcgagacca cctactacaa cagcgccctg aagagccggc tgaccatcat
caaggacaac 660agcaagagcc aggtgttcct gaagatgaac agcctgcaga
ccgacgacac cgccatctac 720tactgtgcca agcactacta ctacggcggc
agctacgcca tggactactg gggccagggc 780accagcgtga ccgtgtccag
caagcccacc accacccctg cccctagacc tccaacccca 840gcccctacaa
tcgccagcca gcccctgagc ctgaggcccg aagcctgtag acctgccgct
900ggcggagccg tgcacaccag aggcctggat ttcgcctgcg acatctacat
ctgggcccct 960ctggccggca cctgtggcgt gctgctgctg agcctggtca
tcaccctgta ctgcaaccac 1020cggaatagga gcaagcggag cagaggcggc
cacagcgact acatgaacat gaccccccgg 1080aggcctggcc ccacccggaa
gcactaccag ccctacgccc ctcccaggga cttcgccgcc 1140taccggagcc
gggtgaagtt cagccggagc gccgacgccc ctgcctacca gcagggccag
1200aaccagctgt acaacgagct gaacctgggc cggagggagg agtacgacgt
gctggacaag 1260cggagaggcc gggaccctga gatgggcggc aagccccgga
gaaagaaccc tcaggagggc 1320ctgtataacg aactgcagaa agacaagatg
gccgaggcct acagcgagat cggcatgaag 1380ggcgagcggc ggaggggcaa
gggccacgac ggcctgtacc agggcctgag caccgccacc 1440aaggatacct
acgacgccct gcacatgcag gccctgcccc ccagatga 148861380DNAArtificial
sequenceSynthetic oligonucleotide 6atgctgctgc tggtgaccag cctgctgctg
tgtgagctgc cccaccccgc ctttctgctg 60atccccgaca tccagatgac ccagaccacc
tccagcctga gcgccagcct gggcgaccgg 120gtgaccatca gctgccgggc
cagccaggac atcagcaagt acctgaactg gtatcagcag 180aagcccgacg
gcaccgtcaa gctgctgatc taccacacca gccggctgca cagcggcgtg
240cccagccggt ttagcggcag cggctccggc accgactaca gcctgaccat
ctccaacctg 300gagcaggagg acatcgccac ctacttttgc cagcagggca
acacactgcc ctacaccttt 360ggcggcggaa caaagctgga gatcaccggc
agcacctccg gcagcggcaa gcctggcagc 420ggcgagggca gcaccaaggg
cgaggtgaag ctgcaggaga gcggccctgg cctggtggcc 480cccagccaga
gcctgagcgt gacctgtacc gtgtccggcg tgtccctgcc cgactacggc
540gtgtcctgga tccggcagcc ccctaggaag ggcctggagt ggctgggcgt
gatctggggc 600agcgagacca cctactacaa cagcgccctg aagagccggc
tgaccatcat caaggacaac 660agcaagagcc aggtgttcct gaagatgaac
agcctgcaga ccgacgacac cgccatctac 720tactgtgcca agcactacta
ctacggcggc agctacgcca tggactactg gggccagggc 780accagcgtga
ccgtgtccag cgagagcaag tacggccctc cctgcccccc ttgccctttc
840tgggtgctgg tcgtggtggg tggcgtgctg gcctgctaca gcctgctggt
gacagtggcc 900ttcatcatct tttgggtgag gagcaagcgg agcagaggcg
gccacagcga ctacatgaac 960atgacccccc ggaggcctgg ccccacccgg
aagcactacc agccctacgc ccctcccagg 1020gacttcgccg cctaccggag
ccgggtgaag ttcagccgga gcgccgacgc ccctgcctac 1080cagcagggcc
agaaccagct gtacaacgag ctgaacctgg gccggaggga ggagtacgac
1140gtgctggaca agcggagagg ccgggaccct gagatgggcg gcaagccccg
gagaaagaac 1200cctcaggagg gcctgtataa cgaactgcag aaagacaaga
tggccgaggc ctacagcgag 1260atcggcatga agggcgagcg gcggaggggc
aagggccacg acggcctgta ccagggcctg 1320agcaccgcca ccaaggatac
ctacgacgcc ctgcacatgc aggccctgcc ccccagatga 138071383DNAArtificial
sequenceSynthetic oligonucleotide 7atgctgctgc tggtgaccag cctgctgctg
tgtgagctgc cccaccccgc ctttctgctg 60atccccgaca tccagatgac ccagaccacc
tccagcctga gcgccagcct gggcgaccgg 120gtgaccatca gctgccgggc
cagccaggac atcagcaagt acctgaactg gtatcagcag 180aagcccgacg
gcaccgtcaa gctgctgatc taccacacca gccggctgca cagcggcgtg
240cccagccggt ttagcggcag cggctccggc accgactaca gcctgaccat
ctccaacctg 300gagcaggagg acatcgccac ctacttttgc cagcagggca
acacactgcc ctacaccttt 360ggcggcggaa caaagctgga gatcaccggc
agcacctccg gcagcggcaa gcctggcagc 420ggcgagggca gcaccaaggg
cgaggtgaag ctgcaggaga gcggccctgg cctggtggcc 480cccagccaga
gcctgagcgt gacctgtacc gtgtccggcg tgtccctgcc cgactacggc
540gtgtcctgga tccggcagcc ccctaggaag ggcctggagt ggctgggcgt
gatctggggc 600agcgagacca cctactacaa cagcgccctg aagagccggc
tgaccatcat caaggacaac 660agcaagagcc aggtgttcct gaagatgaac
agcctgcaga ccgacgacac cgccatctac 720tactgtgcca agcactacta
ctacggcggc agctacgcca tggactactg gggccagggc 780accagcgtga
ccgtgtccag cgagagcaag tacggccctc cctgcccccc ttgccctttc
840tgggtgctgg tcgtggtggg tggcgtgctg gcctgctaca gcctgctggt
gacagtggcc 900ttcatcatct tttgggtgaa gagaggccgg aagaaactgc
tgtacatctt caagcagccc 960ttcatgcggc ccgtgcagac cacccaggaa
gaggacggct gcagctgccg gttccccgag 1020gaagaggaag gcggctgcga
actgcgggtg aagttcagcc ggagcgccga cgcccctgcc 1080taccagcagg
gccagaacca gctgtacaac gagctgaacc tgggccggag ggaggagtac
1140gacgtgctgg acaagcggag aggccgggac cctgagatgg gcggcaagcc
ccggagaaag 1200aaccctcagg agggcctgta taacgaactg cagaaagaca
agatggccga ggcctacagc 1260gagatcggca tgaagggcga gcggcggagg
ggcaagggcc acgacggcct gtaccagggc 1320ctgagcaccg ccaccaagga
tacctacgac gccctgcaca tgcaggccct gccccccaga 1380tga
13838720DNAArtificial sequenceSynthetic oligonucleotide 8atctgcgaca
tccagatgac ccagagccct gccagcctgt ctaccagcct gggcgagaca 60gtgaccatcc
agtgtcaggc cagcgaggac atctactctg gcctggcttg gtatcagcag
120aagcccggca agagccctca gctgctgatc tacggcgcca gcgacctgca
ggacggcgtg 180ccaagcagat tcagcggcag cggctccgga acccagtaca
gcctgaagat caccagcatg 240cagaccgagg acgagggcgt gtacttctgc
cagcaaggcc tgacctaccc tagaaccttc 300ggaggaggca ccaagctgga
actgaagggc ggaggcggaa gtggaggcgg aggatctggc 360ggcggaggct
ctgaagtgca gctgcagcag tctggcgctg aactggtccg gcctggcact
420agcgtgaagc tgtcctgcaa ggtgtccggc gacaccatca ccttctacta
catgcacttc 480gtgaagcaga ggccaggaca gggcctggaa tggatcggca
gaatcgaccc tgaggacgag 540agcaccaagt acagcgagaa gttcaagaac
aaggccaccc tgaccgccga caccagcagc 600aacaccgcct acctgaagct
gtctagcctg acctccgagg acaccgccac ctacttttgc 660atctacggcg
gctactactt cgactactgg ggccagggcg tgatggtcac cgtgtccagc
7209741DNAArtificial sequenceSynthetic oligonucleotide 9ctgatccccg
acatccagat gacccagacc acctccagcc tgagcgccag cctgggcgac 60cgggtgacca
tcagctgccg ggccagccag gacatcagca agtacctgaa ctggtatcag
120cagaagcccg acggcaccgt caagctgctg atctaccaca ccagccggct
gcacagcggc 180gtgcccagcc ggtttagcgg cagcggctcc ggcaccgact
acagcctgac catctccaac 240ctggagcagg aggacatcgc cacctacttt
tgccagcagg gcaacacact gccctacacc 300tttggcggcg gaacaaagct
ggagatcacc ggcagcacct ccggcagcgg caagcctggc 360agcggcgagg
gcagcaccaa gggcgaggtg aagctgcagg agagcggccc tggcctggtg
420gcccccagcc agagcctgag cgtgacctgt accgtgtccg gcgtgtccct
gcccgactac 480ggcgtgtcct ggatccggca gccccctagg aagggcctgg
agtggctggg cgtgatctgg 540ggcagcgaga ccacctacta caacagcgcc
ctgaagagcc ggctgaccat catcaaggac 600aacagcaaga gccaggtgtt
cctgaagatg aacagcctgc agaccgacga caccgccatc 660tactactgtg
ccaagcacta ctactacggc ggcagctacg ccatggacta ctggggccag
720ggcaccagcg tgaccgtgtc c 74110723DNAArtificial sequenceSynthetic
oligonucleotide 10cagatcgtgc tgacccagag ccccgccatc atgagcgcca
gccctggcga gaaggtgacc 60atgacctgca gcgccagcag cagcgtgagc tacatgaact
ggtatcagca gaagagcggc 120accagcccca agcggtggat ctacgacacc
agcaagctgg ccagcggcgt gcccgcccac 180ttcaggggca gcggatctgg
gacttcctac tctctgacca tcagcggcat ggaagccgag 240gatgccgcta
cttactactg ccagcagtgg agcagcaacc ccttcacctt cggctccggc
300accaagctgg aaatcaaccg gggaggcggc ggttccggcg gaggtggctc
tggcggtggc 360ggaagtcagg tgcagctgca gcagagcgga gccgagctgg
ccagacctgg cgcctccgtg 420aagatgagct gcaaggccag cggctacacc
ttcacccggt acaccatgca ctgggtgaag 480cagagacccg gccagggcct
ggaatggatc ggctacatca accccagccg gggctacacc 540aactacaacc
agaagttcaa ggacaaggcc accctgacca ccgacaagag cagcagcacc
600gcctacatgc agctgtccag cctgacctcc gaggacagcg ccgtgtacta
ctgcgcccgg 660tactacgacg accactactg cctggactac tggggccagg
gcaccacact gaccgtgagc 720agc 72311735DNAArtificial
sequenceSynthetic oligonucleotide 11ctgatccccg acgtgcagat
cacccagagc cccagctacc tggccgccag ccctggcgag 60acaatcacca tcaactgccg
ggccagcaag agcatcagca aggacctggc ctggtatcag 120gaaaagcccg
gcaagaccaa caagctgctg atctacagcg gcagcaccct gcagagcggc
180atccccagca gattcagcgg cagcggctcc ggaaccgact tcaccctgac
catcagcagc 240ctggaacccg aggacttcgc catgtactac tgccagcagc
acaacaagta cccctacacc 300ttcggcggag gcaccaagct ggaaatcaag
ggcagcacct ccggcagcgg caagcctggc 360agcggcgagg gcagcaccaa
gggccaggtg cagctgcagc agccaggcgc cgagctggtg 420aaacctggcg
cccctgtgaa gctgagctgc aaggccagcg gctacacctt caccaactac
480tggatgaact ggatcaagca gaggcccggc agaggcctgg aatggatcgg
cagaatcgac 540cccagcgaca gcgagagcca ctacaaccag aagttcaagg
acaaggccac actgaccgtg 600gacaagagca gcaacaccgc ctacatccag
ctgtcttctc tgaccagcga ggacagcgcc 660gtgtactatt gcgccagata
cgactacgac gacaccatgg actactgggg ccagggcacc 720agcgtgaccg tgtct
73512810DNAArtificial sequenceSynthetic oligonucleotide
12atggattttc aggtgcagat tttcagcttc ctgctaatca gtgcctcagt cataatgtct
60agaatggccc aggtgcaact gcagcagtca ggggctgagc tggctagacc tggggcttca
120gtgaagatgt cctgcaaggc ttctggctac acctttacta cctacacaat
acactgggta 180agacggaggc ctggacacga tctggaatgg attggataca
ttaatcctag cagtggatgt 240tctgactaca atcaaaactt caagggcaag
accacattga ctgcagacaa gtcctccaac 300acagcctaca tgcaactgaa
cagcctgaca tctgaggact ctgcggtcta ttactgtgca 360agaagagcgg
actatggtaa ctacgaatat acctggtttg cttactgggg ccaagggacc
420acggtcaccg tctcctcaag tggaggcggt tcaggtggag gtggctctgg
cggtggcgga 480tcggtcatcg agctcactca gtctccaaaa ttcatgtcca
catcagtagg agacagggtc 540aacgtcacct acaaggccag tcagaatgtg
ggtactaatg tagcctggtt tcaacaaaaa 600ccagggcaat ctcctaaagt
tctgatttac tcggcatctt accgatacag tggagtccct 660gatcgcttca
caggcagtgg atctggaaca gatttcactc tcaccatcag caatgtgcag
720tctgaagact tggcagagta tttctgtcag caatatcaca cctatcctct
cacgttcgga 780gggggcacca agctggaaat caaacggtcg
81013735DNAArtificial sequenceSynthetic oligonucleotide
13caggtgcagc tggtgcagag cggcggcggc ctggtgcagc atggcggcag cctgcgcctg
60agctgcgcgg cgagcggctt tacctttagc agctatgaaa tgaactgggt gcgccaggcg
120ccgggcaaag gcctggaatg ggtgagcggc attagcggca gcggcggcag
cacctattat 180gcggatagcg tgaaaggccg ctttaccccc attagccgcg
ataacagcaa aaacaccctg 240tatctgcaga tgaaccgcct gcgcgcggaa
gataccgcgg tgtattattg cgcgcgcgat 300aacggctggg aactgaccga
ttggtatttt gatctgtggg gccgcggcac catggtgacc 360gtgagcagcg
gcggcggcgg cagcggcggc ggcggcagcg gcggcggcgg cagcgatatt
420cagatgaccc
agagcccgag caccctgagc gcgagcattg gcgatcgcgt gaccattacc
480tgccgcgcga gcgaaggcat ttatcattgg ctggcgtggt atcagcagaa
accgggcaaa 540gcgccgaaac tgctgattta taaagcgagc agcctggcga
gcggcgcgcc gagccgcttt 600agcggcagcg gcagcggcac cgattttacc
ctgaccatta gcagcctgca gccggatgat 660tttgcgacct attattgcca
gcagtatagc aactatccgc tgacctttgg cggcggcacc 720aaactggaaa ttaaa
73514747DNAArtificial sequenceSynthetic oligonucleotide
14gacgttgtga tgacccagac ccctctgagc ctgcctgtgt ccctgggaga tcaggccagc
60atcagctgca gaagcagcca gagcctgctg aagaacaacg gcaacacctt cctgcactgg
120tatctgcaga agtccggcca gtcccccaag ctgctgatct acaaggtgtc
caaccggctg 180agcggcgtgc ccgatagatt ttctggctct ggcagcggca
cctacttcac cctgaagatc 240agccgggtgg aagccgagga cctgggcgtg
tacttctgta gccagagcac ccacatccct 300tacaccttcg gcggaggcac
caagctggaa ctgaagcggg gcagcacctc cggcagcggc 360aagcctggca
gcggcgaggg cagcaccaag ggcgaagtga agctggtgga aagcggcgga
420ggcctggtgc tgcctggcga ttctctgaga ctgagctgcg ccaccagcga
gttcaccttc 480accgactact acatgacctg ggtgcgccag ccccccagaa
aggctctgga atggctgggc 540ttcatccgga accgggccaa cggctacacc
accgagtaca accctagcgt gaagggccgg 600ttcaccatca gccgggacaa
cagccagagc atcctgtacc tgcagatgaa caccctgcgg 660accgaggaca
gcgccaccta ctactgtgct cgggtgtcca actgggcctt cgactattgg
720ggccagggca ccaccctgac cgtgtct 74715759DNAArtificial
sequenceSynthetic oligonucleotide 15gacatcaaga tgacccagag
ccccagctct atgtacgcca gcctgggcga gcgcgtgacc 60atcacctgta aagccagccc
cgacatcaac agctacctga gctggttcca gcagaagccc 120ggcaagagcc
ccaagaccct gatctaccgg gccaacagac tggtggatgg cgtgcccagc
180agattcagcg gcggaggctc tggccaggac tacagcctga ccatcaactc
cctggaatac 240gaggacatgg gcatctacta ctgcctgcag tacgacgagt
tcccctacac cttcggaggc 300ggcaccaagc tggaaatgaa gggcagcaca
agcggcagcg gcaagcctgg atctggcgag 360ggaagcacca agggcgaagt
gaagctggtg gaatctggcg gcggactcgt gaagcctggc 420ggctctctga
agctgtcttg tgccgccagc ggcttcacct tcagcagcta cgccatgagc
480tgggtgcggc agatccccga gaagcggctg gaatgggtgg ccagcatcag
cagaggcgga 540accacctact accccgactc tgtgaagggc cggttcacca
tcagccggga caacgtgcgg 600aacatcctgt acctgcagat gagcagcctg
cggagcgagg acaccgccat gtactactgt 660ggcagatacg actacgacgg
ctactatgcc atggattact ggggccaggg caccagcgtg 720accgtgtcta
gccagggaac ctccgtgaca gtgtccagc 75916759DNAArtificial
sequenceSynthetic oligonucleotide 16gaagtacatc tggttgagtc
tggtggagac ttagtgaagc ctggagggtc cctgaaactc 60tcctgtgcag cctctggatt
cactttcagt cactatggca tgtcttgggt tcgccagact 120ccagacaaga
ggctggagtg ggtcgcaacc attggtagtc gtggtactta cacccactat
180ccagacagtg tgaagggacg attcaccatc tccagagaca atgacaagaa
cgccctgtac 240ctgcaaatga acagtctgaa gtctgaagac acagccatgt
attactgtgc aagaagaagt 300gaattttatt actacggtaa tacctactat
tactctgcta tggactactg gggccaaggc 360accacggtca ccgtctcctc
aggtggcggt ggcagcggcg gtggtgggtc cggtggcggc 420ggatctgaca
tcgtactcac acagtctcca gctagcctgg ctgtatctct aggacagagg
480gccaccatct cctgcagagc cagcgaaagt gttgataatt atggctttag
ttttatgaac 540tggttccaac agaaaccagg acagccaccc aaactcctca
tctatgctat atccaaccga 600ggatccgggg tccctgccag gtttagtggc
agtgggtctg ggacagactt cagcctcaac 660atccatcctg tagaggagga
tgatcctgca atgtatttct gtcagcaaac taaggaggtt 720ccgtggacgt
tcggagctgg caccaagctc gagatcaaa 75917543DNAArtificial
sequenceSynthetic oligonucleotide 17atggccatct ggcggagcaa
cagcggcagc aacaccctgg aaaacggcta cttcctgagc 60cggaacaaag agaaccacag
ccagcccacc cagagcagcc tggaagatag cgtgaccccc 120accaaggccg
tgaaaaccac cggcgtgctg tccagcccct gccctcccaa ctggatcatc
180tacgagaaga gctgctacct gttcagcatg agcctgaaca gctgggacgg
cagcaagcgg 240cagtgctggc agctgggcag caacctgctg aagatcgaca
gcagcaacga gctgggcttc 300atcgtgaagc aggtgtccag ccagcccgac
aactccttct ggatcggcct gagcaggccc 360cagaccgagg tgccctggct
gtgggaggac ggctccacct tcagctccaa cctgttccag 420atccggacca
ccgccacaca ggaaaacccc agccccaact gcgtgtggat ccacgtgagc
480gtgatctacg accagctgtg cagcgtgccc agctacagca tctgcgagaa
gaaattcagc 540atg 54318987DNAArtificial sequenceSynthetic
oligonucleotide 18atggattttc aggtgcagat tttcagcttc ctgctaatca
gtgcctcagt cataatgtct 60agacaattcc aagtgaagct ggaggagtct ggggctgagc
ttgtgaggcc aggggccttg 120gtcaagttgt cctgcaaaac ttctggcttc
aacattaaag actacttttt acactgggtg 180agacagaggc ctgaccaggg
cctggagtgg attggatgga ttaatcctga taatggtaat 240actgtttatg
acccgaagct tcagggcacg gccagtttaa cagcagacac atcctccaac
300acagtctact tgcagctcag cggcctgaca tctgaggaca ctgccgtcta
tttctgtact 360cggagggact atacttatga aaaggctgct ctggactact
ggggtcaggg agcctcagtc 420atcgtctcct cagccaaaac aacagcccca
tcggtctatc cactggcccc tgtgtgtgga 480gatacaactg gctcctcggt
gactctagga tgcctggtca agagatctgg cggtggcggt 540tctggtggcg
gtggctccgg cggtggcggt tctggagctc gacattgtgc tcacacagac
600tccaaatcca tgtccatgtc agtaggagag agggtcacct tgacctgcaa
ggccagtgag 660aatgtggtta cttatgtttc ctggtatcaa cagaaaccag
agcagtctcc taaactgctg 720atatacgggg catccaaccg gtacactggg
gtccccgatc gcttcacagg cagtggatct 780gcaacagatt tcactctgac
catcagcagt gtgcaggctg aagaccttgc agattatcac 840tgtggacagg
gttacagcta tccgtacacg ttcggagggg ggaccaagct ggaaataaaa
900cgggctgatg ctgcaccaac ttatccgcat caccatcatc atcatcatct
gcagatatcc 960agcacagtgg cggccgctcg agtctag 98719753DNAArtificial
sequenceSynthetic oligonucleotide 19ctgatcccca tggcccaggt
gaagctgcag cagagcggcc ctgatctggt gaagcctggc 60gccagcgtga agatcagctg
caaggccagc ggctacagct tcaccggcta ctacatgcac 120tgggtgaaac
agagccacgg caagagcctg gaatggatcg gcagagtgaa ccccaatagc
180ggcggcacca gctacaacca gaagttcaag gacaaggcca tcctgaccgt
ggacaagagc 240agcagcaccg cctacatgga actgcggagc ctgaccagcg
aggacagcgc cgtgtactac 300tgcgcccggt ccaagggcaa ctacttctac
gccatggact actggggcca gggcaccacc 360gtgaccgtgt ctagcagcgg
cggaggaagc ggagggggag gatctggcgg aggcggcagc 420gatatcgagc
tgacccagag ccctagcagc ctggccgtgt cactgggcca gagagccacc
480atcagctgca gagcctccga gagcgtggat agccacggca ccagcctgat
gcactggtat 540cagcagaagc ccggccagcc ccccaagttc ctgatctacc
gggccagcaa cctggaaagc 600ggcatccccg ccagattttc cggcagcggc
agcagaaccg acttcaccct gaccatcaac 660cccgtggaga cagacgacgt
ggccatctac tactgccagc agagcaacga ggaccctccc 720acctttggcg
gaggcaccaa gctggaactg aag 75320732DNAArtificial sequenceSynthetic
oligonucleotide 20gaagtgcagc tggtggaatc tggcggcgga ctggtgcagc
ctggcggatc tctgagactg 60agctgtgccg ccagcggctt cgacttcagc cggtactgga
tgagctgggt gcgccaggcc 120cctggcaaag gcctggaatg gatcggcgag
atcaaccccg acagcagcac catcaactac 180gcccccagcc tgaaggacaa
gttcatcatc agccgggaca acgccaagaa cagcctgtac 240ctgcagatga
actccctgcg ggccgaggac accgccgtgt actattgcgc cagacccgac
300ggcaactact ggtacttcga cgtgtggggc cagggcaccc tcgtgacagt
gtctggcagc 360acaagcggct ctggcaagcc tggatctggc gagggctcta
ccaagggcga catccagatg 420acccagagcc ccagcagcct gtctgccagc
gtgggcgaca gagtgaccat cacatgcaag 480gccagccagg acgtgggaat
cgccgtggcc tggtatcagc agaaacccgg caaggtgccc 540aagctgctga
tctactgggc cagcaccaga cacaccggcg tgcccgatag attttccggc
600agcggctccg gcaccgactt caccctgaca atcagctccc tgcagcctga
ggacgtggcc 660acctactact gccagcagta cagcagctac ccctacacct
tcggacaggg caccaaggtg 720gaaatcaagc gg 73221720DNAArtificial
sequenceSynthetic oligonucleotide 21caggtgcagc tgcagcagtc
tggccccgag ctggaaaaac ctggcgcctc cgtgaagatc 60agctgcaagg ccagcggcta
cagcttcacc ggctacacca tgaactgggt caagcagagc 120cacggcaaga
gcctggaatg gatcggcctg atcaccccct acaacggcgc cagcagctac
180aaccagaagt tccggggcaa ggccaccctg accgtggaca agtctagcag
caccgcctac 240atggacctgc tgagcctgac cagcgaggac agcgccgtgt
acttctgtgc cagaggcggc 300tacgacggca gaggcttcga ttattggggc
cagggcacca ccgtgacagt gtctagcgga 360gtgggaggat ctggcggagg
cggaagtggc ggagggggat ctgatatcga gctgacccag 420agccccgcca
tcatgtctgc tagccctggc gagaaagtga ccatgacctg cagcgccagc
480tccagcgtgt cctacatgca ctggtatcag cagaagtccg gcaccagccc
caagcggtgg 540atctacgaca caagcaagct ggcctctggc gtgcccggca
gattttctgg cagcggctcc 600ggcaacagct actccctgac aatcagcagc
gtggaagccg aggacgacgc cacctactac 660tgccagcagt ggagcggcta
ccccctgact tttggagccg gcaccaagct ggaaatcaag 7202260DNAArtificial
sequenceSynthetic oligonucleotide 22agccaggaag agatgaccaa
gaaccaggtg tccctgacct gcctcgtgaa gggcttctac 6023141DNAArtificial
sequenceSynthetic oligonucleotide 23aagcctacca caacccctgc
ccccagacct cctacacccg cccctacaat tgccagccag 60cctctgtctc tgaggcccga
ggcttgtaga cctgctgctg gcggagccgt gcacaccaga 120ggactggatt
tcgcctgcga c 14124696DNAArtificial sequenceSynthetic
oligonucleotide 24agcgagagca agtacggccc tccctgcccc ccttgccctg
cccccgagtt cctgggcgga 60cccagcgtgt tcctgttccc ccccaagccc aaggacaccc
tgatgatcag ccggaccccc 120gaggtgacct gtgtggtggt ggacgtgtcc
caggaggacc ccgaggtcca gttcaactgg 180tacgtggacg gcgtggaggt
gcacaacgcc aagaccaagc cccgggagga gcagttcaat 240agcacctacc
gggtggtgtc cgtgctgacc gtgctgcacc aggactggct gaacggcaag
300gaatacaagt gtaaggtgtc caacaagggc ctgcccagca gcatcgagaa
aaccatcagc 360aaggccaagg gccagcctcg ggagccccag gtgtacaccc
tgccccctag ccaagaggag 420atgaccaaga atcaggtgtc cctgacctgc
ctggtgaagg gcttctaccc cagcgacatc 480gccgtggagt gggagagcaa
cggccagccc gagaacaact acaagaccac cccccctgtg 540ctggacagcg
acggcagctt cttcctgtac agcaggctga ccgtggacaa gagccggtgg
600caggagggca acgtctttag ctgctccgtg atgcacgagg ccctgcacaa
ccactacacc 660cagaagagcc tgtccctgag cctgggcaag atgttc
6962560DNAArtificial sequenceSynthetic oligonucleotide 25agccaggaag
agatgaccaa gaaccaggtg tccctgacct gcctcgtgaa gggcttctac
6026696DNAArtificial sequenceSynthetic oligonucleotide 26agcgagagca
agtacggccc tccctgcccc ccttgccctg cccccgagtt cctgggcgga 60cccagcgtgt
tcctgttccc ccccaagccc aaggacaccc tgatgatcag ccggaccccc
120gaggtgacct gtgtggtggt ggacgtgtcc caggaggacc ccgaggtcca
gttcaactgg 180tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc
cccgggagga gcagttccag 240agcacctacc gggtggtgtc cgtgctgacc
gtgctgcacc aggactggct gaacggcaag 300gaatacaagt gtaaggtgtc
caacaagggc ctgcccagca gcatcgagaa aaccatcagc 360aaggccaagg
gccagcctcg ggagccccag gtgtacaccc tgccccctag ccaagaggag
420atgaccaaga atcaggtgtc cctgacctgc ctggtgaagg gcttctaccc
cagcgacatc 480gccgtggagt gggagagcaa cggccagccc gagaacaact
acaagaccac cccccctgtg 540ctggacagcg acggcagctt cttcctgtac
agcaggctga ccgtggacaa gagccggtgg 600caggagggca acgtctttag
ctgctccgtg atgcacgagg ccctgcacaa ccactacacc 660cagaagagcc
tgtccctgag cctgggcaag atgttc 69627696DNAArtificial
sequenceSynthetic oligonucleotide 27agcgagagca agtacggccc
tccctgcccc ccttgccctg cccccgagtt cgaaggcgga 60cccagcgtgt tcctgttccc
ccccaagccc aaggacaccc tgatgatcag ccggaccccc 120gaggtgacct
gtgtggtggt ggacgtgtcc caggaggacc ccgaggtcca gttcaactgg
180tacgtggacg gcgtggaggt gcacaacgcc aagaccaagc cccgggagga
gcagttccag 240agcacctacc gggtggtgtc cgtgctgacc gtgctgcacc
aggactggct gaacggcaag 300gaatacaagt gtaaggtgtc caacaagggc
ctgcccagca gcatcgagaa aaccatcagc 360aaggccaagg gccagcctcg
ggagccccag gtgtacaccc tgccccctag ccaagaggag 420atgaccaaga
atcaggtgtc cctgacctgc ctggtgaagg gcttctaccc cagcgacatc
480gccgtggagt gggagagcaa cggccagccc gagaacaact acaagaccac
cccccctgtg 540ctggacagcg acggcagctt cttcctgtac agcaggctga
ccgtggacaa gagccggtgg 600caggagggca acgtctttag ctgctccgtg
atgcacgagg ccctgcacaa ccactacacc 660cagaagagcc tgtccctgag
cctgggcaag atgttc 69628711DNAArtificial sequenceSynthetic
oligonucleotide 28atggtgtcca agggcgagga actgatcaaa gaaaacatgc
acatgaagct gtacatggaa 60ggcaccgtga acaaccacca cttcaagtgc accagcgagg
gagagggcaa gccctacgag 120ggcacccaga ccatgcggat caaggtggtc
gagggcggac ctctgccctt cgccttcgac 180atcctggcca caagcttcat
gtacggcagc aagaccttca tcaaccacac ccagggcatc 240cccgatttct
tcaagcagag cttccccgag ggcttcacct gggagagagt gaccacctac
300gaggacggcg gcgtgctgac cgccacccag gacaccagcc tgcaggacgg
ctgcctgatc 360tacaacgtga agatccgggg cgtgaacttc cccagcaacg
gccccgtgat gcagaagaaa 420accctgggct gggaggccag caccgagatg
ctgtaccctg ccgatggcgg cctggaaggc 480agagccgaca tggccctgaa
actggtcggc ggagggcacc tgatctgcaa cctgaaaacc 540acctacagaa
gcaagaagcc cgccaagaac ctgaagatgc ccggcgtgta ctacgtggac
600cggcggctgg aaaggatcaa agaggccgac aaagaaacct acgtggagca
gcacgaggtg 660gccgtggccc ggtactgcga cctgccctcc aagctgggcc
acaaactgaa c 71129333DNAArtificial sequenceSynthetic
oligonucleotide 29atgatcgaga agtccttcgt gatcaccgac ccccggctgc
ccgactaccc tatcatcttt 60gccagcgacg gcttcctgga actgaccgag tacagccggg
aagagatcat gggccggaac 120gccagattcc tgcagggccc cgaaaccgat
caggccaccg tgcagaagat ccgggacgcc 180atcagggacc agcgggaaac
cacagtgcag ctgatcaact acaccaagag cggcaagaag 240ttctggaacc
tgctgcatct gcagcccgtg cgggatagaa agggcggcct gcagtacttc
300atcggcgtgc agctcgtggg cagcgaccac gtg 33330675DNAArtificial
sequenceSynthetic oligonucleotide 30atggccagca gcgaggacgt
gatcaaagaa ttcatgcggt tcaaagtgcg gatggaaggc 60agcgtgaacg gccacgagtt
cgagattgag ggcgagggcg aaggcagacc ctacgaggga 120acacagaccg
ccaagctgaa agtgaccaag ggcggacccc tgcccttcgc ctgggatatc
180ctgagccccc agttccagta cggcagcaag gtgtacgtga agcaccccgc
cgacatcccc 240gactacaaga agctgagctt ccccgagggc ttcaagtggg
agagagtgat gaacttcgag 300gacggcggcg tcgtgaccgt gacccaggat
agctctctgc aggacggcag cttcatctac 360aaagtgaagt ttatcggcgt
gaacttcccc agcgacggcc ccgtgatgca gaaaaagacc 420atgggctggg
aggccagcac cgagagactg taccctagag atggcgtgct gaagggcgag
480atccacaagg ccctgaagct gaaggatggc ggccactacc tggtggaatt
caagagcatc 540tacatggcca agaaacccgt gcagctgccc ggctactact
acgtggacag caagctggac 600atcaccagcc acaacgagga ctacaccatc
gtggaacagt acgagcgggc cgagggccgg 660caccatctgt ttctg
67531717DNAArtificial sequenceSynthetic oligonucleotide
31atggtgtcca agggcgagga actgttcacc ggcgtggtgc ccatcctggt ggaactggat
60ggcgacgtga acggccacaa gttcagcgtg tccggcgagg gcgaaggcga cgccacatat
120ggcaagctga ccctgaagct gatctgcacc accggcaagc tgcccgtgcc
ttggcctacc 180ctcgtgacca cactgggcta cggcctgcag tgcttcgcca
gataccccga ccatatgaag 240cagcacgact tcttcaagag cgccatgccc
gagggctacg tgcaggaacg gaccatcttc 300tttaaggacg acggcaacta
caagaccagg gccgaagtga agttcgaggg cgacaccctc 360gtgaaccgga
tcgagctgaa gggcatcgac ttcaaagagg acggcaacat cctgggccac
420aagctggagt acaactacaa cagccacaac gtgtacatca ccgccgacaa
gcagaagaac 480ggcatcaagg ccaacttcaa gatccggcac aacatcgagg
acggcggcgt gcagctggcc 540gatcactacc agcagaacac ccctatcggc
gacggccctg tgctgctgcc cgacaatcac 600tacctgagct accagagcgc
cctgagcaag gaccccaacg agaagcggga ccacatggtg 660ctgctggaat
tcgtgaccgc cgctggcatc accctgggca tggacgagct gtacaag
71732717DNAArtificial sequenceSynthetic oligonucleotide
32atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac
60ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac
120ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc
ctggcccacc 180ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc
gctaccccga ccacatgaag 240cagcacgact tcttcaagtc cgccatgccc
gaaggctacg tccaggagcg caccatcttc 300ttcaaggacg acggcaacta
caagacccgc gccgaggtga agttcgaggg cgacaccctg 360gtgaaccgca
tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac
420aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa
gcagaagaac 480ggcatcaagg tgaacttcaa gatccgccac aacatcgagg
acggcagcgt gcagctcgcc 540gaccactacc agcagaacac ccccatcggc
gacggccccg tgctgctgcc cgacaaccac 600tacctgagca cccagtccgc
cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660ctgctggagt
tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaag
71733363DNAArtificial sequenceSynthetic oligonucleotide
33gccaagggcc agcctcggga gccccaggtg tacaccctgc cccctagcca agaggagatg
60accaagaatc aggtgtccct gacctgcctg gtgaagggct tctaccccag cgacatcgcc
120gtggagtggg agagcaacgg ccagcccgag aacaactaca agaccacccc
ccctgtgctg 180gacagcgacg gcagcttctt cctgtacagc aggctgaccg
tggacaagag ccggtggcag 240gagggcaacg tctttagctg ctccgtgatg
cacgaggccc tgcacaacca ctacacccag 300aagagcctgt ccctgagcct
gggcaagatg ttctacccat acgatgttcc agattacgct 360tac
36334708DNAArtificial sequenceSynthetic oligonucleotide
34atggtgagca agggcgagga gaccacaatg ggcgtaatca agcccgacat gaagatcaag
60ctgaagatgg agggcaacgt gaatggccac gccttcgtga tcgagggcga gggcgagggc
120aagccctacg acggcaccaa caccatcaac ctggaggtga aggagggagc
ccccctgccc 180ttctcctacg acattctgac caccgcgttc gcctacggca
acagggcctt caccaagtac 240cccgacgaca tccccaacta cttcaagcag
tccttccccg agggctactc ttgggagcgc 300accatgacct tcgaggacaa
gggcatcgtg aaggtgaagt ccgacatctc catggaggag 360gactccttca
tctacgagat acacctcaag ggcgagaact tcccccccaa cggccccgtg
420atgcagaaga agaccaccgg ctgggacgcc tccaccgaga ggatgtacgt
gcgcgacggc 480gtgctgaagg gcgacgtcaa gcacaagctg ctgctggagg
gcggcggcca ccaccgcgtt 540gacttcaaga ccatctacag ggccaagaag
gcggtgaagc tgcccgacta tcactttgtg 600gaccaccgca tcgagatcct
gaaccacgac aaggactaca acaaggtgac cgtttacgag 660agcgccgtgg
cccgcaactc caccgacggc atggacgagc tgtacaag 70835423DNAArtificial
sequenceSynthetic oligonucleotide 35aagcctacca caacccctgc
ccccagacct cctacacccg cccctacaat tgccagccag 60cctctgtctc tgaggcccga
ggcttgtaga cctgctgctg gcggagccgt gcacaccaga 120ggactggatt
tcgcctgcga caagcctacc acaacccctg cccccagacc tcctacaccc
180gcccctacaa ttgccagcca gcctctgtct ctgaggcccg aggcttgtag
acctgctgct 240ggcggagccg tgcacaccag aggactggat ttcgcctgcg
acagcagcgg cggcggcggc 300agcggcggcg
gcggcagcgg cggcggcggc agcgcgcagc tgaaaaaaaa actgcaggcg
360ctgaaaaaaa aaaacgcgca gctgaaatgg aaactgcagg cgctgaaaaa
aaaactggcg 420cag 42336423DNAArtificial sequenceSynthetic
oligonucleotide 36aagcctacca caacccctgc ccccagacct cctacacccg
cccctacaat tgccagccag 60cctctgtctc tgaggcccga ggcttgtaga cctgctgctg
gcggagccgt gcacaccaga 120ggactggatt tcgcctgcga caagcctacc
acaacccctg cccccagacc tcctacaccc 180gcccctacaa ttgccagcca
gcctctgtct ctgaggcccg aggcttgtag acctgctgct 240ggcggagccg
tgcacaccag aggactggat ttcgcctgcg acagcagcgg cggcggcggc
300agcggcggcg gcggcagcgg cggcggcggc agcgcccagc tggaaaaaga
gctgcaggcc 360ctggaaaaag aaaacgctca gctggaatgg gaactgcagg
ctctggaaaa agagctggcc 420cag 4233769DNAArtificial sequenceSynthetic
oligonucleotide 37tgggtgctgg tcgtggtggg tggcgtgctg gcctgctaca
gcctgctggt gacagtggcc 60ttcatcatc 693881DNAArtificial
sequenceSynthetic oligonucleotide 38attatctcat tcttcctggc
cctgacctct accgccctgc tgtttctgct gttctttctg 60accctgcggt tcagcgtggt
g 813984DNAArtificial sequenceSynthetic oligonucleotide
39atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc
60accctttact gcaaccacag gaac 844063DNAArtificial sequenceSynthetic
oligonucleotide 40ctctgctacc tgctggatgg aatcctcttc atctatggtg
tcattctcac tgccttgttc 60ctg 6341144DNAArtificial sequenceSynthetic
oligonucleotide 41cagcggcgga agtacagaag caacaagggc gagagccccg
tggaacctgc cgagccttgc 60agatacagct gccccagaga ggaagagggc agcaccatcc
caatccagga agattaccgg 120aagcccgagc ccgcctgtag ccct
14442132DNAArtificial sequenceSynthetic oligonucleotide
42ttttgggtga ggagcaagcg gagcagaggc ggccacagcg actacatgaa catgaccccc
60cggaggcctg gccccacccg gaagcactac cagccctacg cccctcccag ggacttcgcc
120gcctaccgga gc 13243132DNAArtificial sequenceSynthetic
oligonucleotide 43ttttgggtga ggagcaagcg gagcagaggc ggccacagcg
acttcatgaa catgaccccc 60cggaggcctg gccccacccg gaagcactac cagccctacg
cccctcccag ggacttcgcc 120gcctaccgga gc 13244108DNAArtificial
sequenceSynthetic oligonucleotide 44agggaccaga gactgcctcc
cgatgcccac aaacctccag gcggcggaag cttcagaacc 60cccatccagg aagaacaggc
cgacgcccac agcaccctgg ccaagatt 10845126DNAArtificial
sequenceSynthetic oligonucleotide 45aagcggggca gaaagaagct
gctgtacatc ttcaagcagc ccttcatgcg gcccgtgcag 60accacccagg aagaggacgg
ctgctcctgc agattccccg aggaagaaga aggcggctgc 120gagctg
12646102DNAArtificial sequenceSynthetic oligonucleotide
46aagaaaaagt acagcagcag cgtgcacgac cccaacggcg agtacatgtt catgcgggcc
60gtgaacaccg ccaagaagtc cagactgacc gacgtgaccc tg
10247336DNAArtificial sequenceSynthetic oligonucleotide
47cgggtgaagt tcagccggag cgccgacgcc cctgcctacc agcagggcca gaaccagctg
60tacaacgagc tgaacctggg ccggagggag gagtacgacg tgctggacaa gcggagaggc
120cgggaccctg agatgggcgg caagccccgg agaaagaacc ctcaggaggg
cctgtataac 180gaactgcaga aagacaagat ggccgaggcc tacagcgaga
tcggcatgaa gggcgagcgg 240cggaggggca agggccacga cggcctgtac
cagggcctga gcaccgccac caaggatacc 300tacgacgccc tgcacatgca
ggccctgccc cccaga 33648759DNAArtificial sequenceSynthetic
oligonucleotide 48gatattcaga tgacccagag cccgagcagc ctgagcgcga
gcgtgggcga tcgcgtgacc 60attacctgcc gcagcagcca gaacattgtg catagcaacg
gcaacaccta tctggattgg 120tatcagcaga ccccgggcaa agcgccgaaa
ctgctgattt ataaagtgag caaccgcttt 180agcggcgtgc cgagccgctt
tagcggcagc ggcagcggca ccgattttac ctttaccatt 240agcagcctgc
agccggaaga tattgcgacc tattattgct ttcagtatag ccatgtgccg
300tggacctttg gccagggcac caaactgcag attaccggca gcacctccgg
cagcggcaag 360cctggcagcg gcgagggcag caccaagggc agccaggtgc
agctgcagca gagcggcgcg 420gaagtgaaaa aaccgggcag cagcgtgaaa
gtgagctgca aagcgagcgg ctataccttt 480accaactatt atatttattg
ggtgcgccag gcgccgggcc agggcctgga atggattggc 540ggcattaacc
cgaccagcgg cggcagcaac tttaacgaaa aatttaaaac ccgcgtgacc
600attaccgcgg atgaaagcag caccaccgcg tatatggaac tgagcagcct
gcgcagcgaa 660gataccgcgt tttatttttg cacccgccag ggcctgtggt
ttgatagcga tggccgcggc 720tttgattttt ggggccaggg caccaccgtg accgtgagc
75949732DNAArtificial sequenceSynthetic oligonucleotide
49gatattctgc tgacccagag cccggtgatt ctgagcgtga gcccgggcga acgcgtgagc
60tttagctgcc gcgcgagcca gagcattggc accaacattc attggtatca gcagcgcacc
120aacggcagcc cgcgcctgct gattaaatat gcgagcgaaa gcattagcgg
cattccgagc 180cgctttagcg gcagcggcag cggcaccgat tttaccctga
gcattaacag cgtggaaagc 240gaagatattg cggattatta ttgccagcag
aacaacaact ggccgaccac ctttggcgcg 300ggcaccaaac tggaactgaa
aggcagcacc tccggcagcg gcaagcctgg cagcggcgag 360ggcagcacca
agggcagcca ggtgcagctg aaacagagcg gcccgggcct ggtgcagccg
420agccagagcc tgagcattac ctgcaccgtg agcggcttta gcctgaccaa
ctatggcgtg 480cattgggtgc gccagagccc gggcaaaggc ctggaatggc
tgggcgtgat ttggagcggc 540ggcaacaccg attataacac cccgtttacc
agccgcctga gcattaacaa agataacagc 600aaaagccagg tgttttttaa
aatgaacagc ctgcagagca acgataccgc gatttattat 660tgcgcgcgcg
cgctgaccta ttatgattat gaatttgcgt attggggcca gggcaccctg
720gtgaccgtga gc 73250726DNAArtificial sequenceSynthetic
oligonucleotide 50gaagtgcagc tgcagcagag cggcccggaa ctggaaaaac
cgggcgcgag cgtgaaactg 60agctgcaaag cgagcggcta tagctttacc ggctataaca
tgaactgggt gaaacagagc 120catggcaaaa gcctggaatg gattggccat
attgatccgt attatggcga taccagctat 180aaccagaaat ttcgcggcaa
agcgaccctg accgtggata aaagcagcag caccgcgtat 240atgcagctga
aaagcctgac cagcgaagat agcgcggtgt attattgcgt gaaaggcggc
300tattatggcc attggtattt tgatgtgtgg ggcgcgggca ccaccgtgac
cgtgagcagc 360ggcggaggcg gctctggcgg cggaggatca ggtggcggag
gatccgatat tcagatgacc 420cagagcccga gcagcctgag cgcgagcctg
ggcgaacgcg tgagcctgac ctgccgcgcg 480agccaggata ttggcagcag
cctgaactgg ctgcagcagg gcccggatgg caccattaaa 540cgcctgattt
atgcgaccag cagcctggat agcggcgtgc cgaaacgctt tagcggcagc
600cgcagcggca gcgattatag cctgaccatt agcagcctgg aaagcgaaga
ttttgtggat 660tattattgcc tgcagtatgt gagcagcccg ccgacctttg
gcgcgggcac caaactggaa 720ctgaaa 72651111PRTArtificial
sequenceSynthetic polypeptide 51Arg Val Lys Phe Ser Arg Ser Ala Asp
Ala Pro Ala Tyr Gln Gln Gly1 5 10 15Gln Asn Gln Leu Tyr Asn Glu Leu
Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30Asp Val Leu Asp Lys Arg Arg
Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45Pro Arg Arg Lys Asn Pro
Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys 50 55 60Asp Lys Met Ala Glu
Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg65 70 75 80Arg Gly Lys
Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr 85 90 95Lys Asp
Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 100 105
11052108PRTArtificial sequenceSynthetic polypeptide 52Arg Val Lys
Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly1 5 10 15Gln Asn
Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30Asp
Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40
45Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln
50 55 60Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly
Glu65 70 75 80Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu
Ser Thr Ala 85 90 95Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala
100 10553112PRTArtificial sequenceSynthetic polypeptide 53Arg Val
Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly1 5 10 15Gln
Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25
30Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys
35 40 45Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu
Gln 50 55 60Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys
Gly Glu65 70 75 80Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly
Leu Ser Thr Ala 85 90 95Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln
Ala Leu Pro Pro Arg 100 105 11054111PRTArtificial sequenceSynthetic
polypeptide 54Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr
Gln Gln Gly1 5 10 15Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg
Arg Glu Glu Tyr 20 25 30Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro
Glu Met Gly Gly Lys 35 40 45Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu
Tyr Asn Glu Leu Gln Lys 50 55 60Asp Lys Met Ala Glu Ala Tyr Ser Glu
Ile Gly Met Lys Gly Glu Arg65 70 75 80Arg Gly Lys Gly His Asp Gly
Leu Tyr Gln Gly Leu Ser Thr Ala Thr 85 90 95Lys Asp Thr Tyr Asp Ala
Leu His Met Gln Ala Leu Pro Pro Arg 100 105 110552034DNAArtificial
sequenceSynthetic oligonucleotide 55atgctgctgc tggtgaccag
cctgctgctg tgtgagctgc cccaccccgc ctttctgctg 60atccccgaca tccagatgac
ccagaccacc tccagcctga gcgccagcct gggcgaccgg 120gtgaccatca
gctgccgggc cagccaggac atcagcaagt acctgaactg gtatcagcag
180aagcccgacg gcaccgtcaa gctgctgatc taccacacca gccggctgca
cagcggcgtg 240cccagccggt ttagcggcag cggctccggc accgactaca
gcctgaccat ctccaacctg 300gagcaggagg acatcgccac ctacttttgc
cagcagggca acacactgcc ctacaccttt 360ggcggcggaa caaagctgga
gatcaccggc agcacctccg gcagcggcaa gcctggcagc 420ggcgagggca
gcaccaaggg cgaggtgaag ctgcaggaga gcggccctgg cctggtggcc
480cccagccaga gcctgagcgt gacctgtacc gtgtccggcg tgtccctgcc
cgactacggc 540gtgtcctgga tccggcagcc ccctaggaag ggcctggagt
ggctgggcgt gatctggggc 600agcgagacca cctactacaa cagcgccctg
aagagccggc tgaccatcat caaggacaac 660agcaagagcc aggtgttcct
gaagatgaac agcctgcaga ccgacgacac cgccatctac 720tactgtgcca
agcactacta ctacggcggc agctacgcca tggactactg gggccagggc
780accagcgtga ccgtgtccag cgagagcaag tacggccctc cctgcccccc
ttgccctgcc 840cccgagttcc tgggcggacc cagcgtgttc ctgttccccc
ccaagcccaa ggacaccctg 900atgatcagcc ggacccccga ggtgacctgt
gtggtggtgg acgtgtccca ggaggacccc 960gaggtccagt tcaactggta
cgtggacggc gtggaggtgc acaacgccaa gaccaagccc 1020cgggaggagc
agttcaatag cacctaccgg gtggtgtccg tgctgaccgt gctgcaccag
1080gactggctga acggcaagga atacaagtgt aaggtgtcca acaagggcct
gcccagcagc 1140atcgagaaaa ccatcagcaa ggccaagggc cagcctcggg
agccccaggt gtacaccctg 1200ccccctagcc aagaggagat gaccaagaat
caggtgtccc tgacctgcct ggtgaagggc 1260ttctacccca gcgacatcgc
cgtggagtgg gagagcaacg gccagcccga gaacaactac 1320aagaccaccc
cccctgtgct ggacagcgac ggcagcttct tcctgtacag caggctgacc
1380gtggacaaga gccggtggca ggagggcaac gtctttagct gctccgtgat
gcacgaggcc 1440ctgcacaacc actacaccca gaagagcctg tccctgagcc
tgggcaagat gttctgggtg 1500ctggtcgtgg tgggtggcgt gctggcctgc
tacagcctgc tggtgacagt ggccttcatc 1560atcttttggg tgaggagcaa
gcggagcaga ggcggccaca gcgactacat gaacatgacc 1620ccccggaggc
ctggccccac ccggaagcac taccagccct acgcccctcc cagggacttc
1680gccgcctacc ggagccgggt gaagttcagc cggagcgccg acgcccctgc
ctaccagcag 1740ggccagaacc agctgtacaa cgagctgaac ctgggccgga
gggaggagta cgacgtgctg 1800gacaagcgga gaggccggga ccctgagatg
ggcggcaagc cccggagaaa gaaccctcag 1860gagggcctgt ataacgaact
gcagaaagac aagatggccg aggcctacag cgagatcggc 1920atgaagggcg
agcggcggag gggcaagggc cacgacggcc tgtaccaggg cctgagcacc
1980gccaccaagg atacctacga cgccctgcac atgcaggccc tgccccccag atga
2034562040DNAArtificial sequenceSynthetic oligonucleotide
56atgctgctgc tggtgaccag cctgctgctg tgtgagctgc cccaccccgc ctttctgctg
60atccccgaca tccagatgac ccagaccacc tccagcctga gcgccagcct gggcgaccgg
120gtgaccatca gctgccgggc cagccaggac atcagcaagt acctgaactg
gtatcagcag 180aagcccgacg gcaccgtcaa gctgctgatc taccacacca
gccggctgca cagcggcgtg 240cccagccggt ttagcggcag cggctccggc
accgactaca gcctgaccat ctccaacctg 300gagcaggagg acatcgccac
ctacttttgc cagcagggca acacactgcc ctacaccttt 360ggcggcggaa
caaagctgga gatcaccggc agcacctccg gcagcggcaa gcctggcagc
420ggcgagggca gcaccaaggg cgaggtgaag ctgcaggaga gcggccctgg
cctggtggcc 480cccagccaga gcctgagcgt gacctgtacc gtgtccggcg
tgtccctgcc cgactacggc 540gtgtcctgga tccggcagcc ccctaggaag
ggcctggagt ggctgggcgt gatctggggc 600agcgagacca cctactacaa
cagcgccctg aagagccggc tgaccatcat caaggacaac 660agcaagagcc
aggtgttcct gaagatgaac agcctgcaga ccgacgacac cgccatctac
720tactgtgcca agcactacta ctacggcggc agctacgcca tggactactg
gggccagggc 780accagcgtga ccgtgtccag cgagagcaag tacggccctc
cctgcccccc ttgccctgcc 840cccgagttcc tgggcggacc cagcgtgttc
ctgttccccc ccaagcccaa ggacaccctg 900atgatcagcc ggacccccga
ggtgacctgt gtggtggtgg acgtgtccca ggaggacccc 960gaggtccagt
tcaactggta cgtggacggc gtggaggtgc acaacgccaa gaccaagccc
1020cgggaggagc agttcaatag cacctaccgg gtggtgtccg tgctgaccgt
gctgcaccag 1080gactggctga acggcaagga atacaagtgt aaggtgtcca
acaagggcct gcccagcagc 1140atcgagaaaa ccatcagcaa ggccaagggc
cagcctcggg agccccaggt gtacaccctg 1200ccccctagcc aagaggagat
gaccaagaat caggtgtccc tgacctgcct ggtgaagggc 1260ttctacccca
gcgacatcgc cgtggagtgg gagagcaacg gccagcccga gaacaactac
1320aagaccaccc cccctgtgct ggacagcgac ggcagcttct tcctgtacag
caggctgacc 1380gtggacaaga gccggtggca ggagggcaac gtctttagct
gctccgtgat gcacgaggcc 1440ctgcacaacc actacaccca gaagagcctg
tccctgagcc tgggcaagat gatctacatc 1500tgggcccctc tggccggcac
ctgtggcgtg ctgctgctga gcctggtcat caccctgtac 1560tgcaaccacc
ggaacaagag aggccggaag aaactgctgt acatcttcaa gcagcccttc
1620atgcggcccg tgcagaccac ccaggaagag gacggctgca gctgccggtt
ccccgaggaa 1680gaggaaggcg gctgcgaact gcgggtgaag ttcagccgga
gcgccgacgc ccctgcctac 1740cagcagggcc agaaccagct gtacaacgag
ctgaacctgg gccggaggga ggagtacgac 1800gtgctggaca agcggagagg
ccgggaccct gagatgggcg gcaagccccg gagaaagaac 1860cctcaggagg
gcctgtataa cgaactgcag aaagacaaga tggccgaggc ctacagcgag
1920atcggcatga agggcgagcg gcggaggggc aagggccacg acggcctgta
ccagggcctg 1980agcaccgcca ccaaggatac ctacgacgcc ctgcacatgc
aggccctgcc ccccagatga 2040572037DNAArtificial sequenceSynthetic
oligonucleotide 57atgctgctgc tggtgaccag cctgctgctg tgtgagctgc
cccaccccgc ctttctgctg 60atccccgaca tccagatgac ccagaccacc tccagcctga
gcgccagcct gggcgaccgg 120gtgaccatca gctgccgggc cagccaggac
atcagcaagt acctgaactg gtatcagcag 180aagcccgacg gcaccgtcaa
gctgctgatc taccacacca gccggctgca cagcggcgtg 240cccagccggt
ttagcggcag cggctccggc accgactaca gcctgaccat ctccaacctg
300gagcaggagg acatcgccac ctacttttgc cagcagggca acacactgcc
ctacaccttt 360ggcggcggaa caaagctgga gatcaccggc agcacctccg
gcagcggcaa gcctggcagc 420ggcgagggca gcaccaaggg cgaggtgaag
ctgcaggaga gcggccctgg cctggtggcc 480cccagccaga gcctgagcgt
gacctgtacc gtgtccggcg tgtccctgcc cgactacggc 540gtgtcctgga
tccggcagcc ccctaggaag ggcctggagt ggctgggcgt gatctggggc
600agcgagacca cctactacaa cagcgccctg aagagccggc tgaccatcat
caaggacaac 660agcaagagcc aggtgttcct gaagatgaac agcctgcaga
ccgacgacac cgccatctac 720tactgtgcca agcactacta ctacggcggc
agctacgcca tggactactg gggccagggc 780accagcgtga ccgtgtccag
cgagagcaag tacggccctc cctgcccccc ttgccctgcc 840cccgagttcc
tgggcggacc cagcgtgttc ctgttccccc ccaagcccaa ggacaccctg
900atgatcagcc ggacccccga ggtgacctgt gtggtggtgg acgtgtccca
ggaggacccc 960gaggtccagt tcaactggta cgtggacggc gtggaggtgc
acaacgccaa gaccaagccc 1020cgggaggagc agttcaatag cacctaccgg
gtggtgtccg tgctgaccgt gctgcaccag 1080gactggctga acggcaagga
atacaagtgt aaggtgtcca acaagggcct gcccagcagc 1140atcgagaaaa
ccatcagcaa ggccaagggc cagcctcggg agccccaggt gtacaccctg
1200ccccctagcc aagaggagat gaccaagaat caggtgtccc tgacctgcct
ggtgaagggc 1260ttctacccca gcgacatcgc cgtggagtgg gagagcaacg
gccagcccga gaacaactac 1320aagaccaccc cccctgtgct ggacagcgac
ggcagcttct tcctgtacag caggctgacc 1380gtggacaaga gccggtggca
ggagggcaac gtctttagct gctccgtgat gcacgaggcc 1440ctgcacaacc
actacaccca gaagagcctg tccctgagcc tgggcaagat gatctacatc
1500tgggcccctc tggccggcac ctgtggcgtg ctgctgctga gcctggtcat
caccctgtac 1560tgcaaccacc ggaataggag caagcggagc agaggcggcc
acagcgacta catgaacatg 1620accccccgga ggcctggccc cacccggaag
cactaccagc cctacgcccc tcccagggac 1680ttcgccgcct accggagccg
ggtgaagttc agccggagcg ccgacgcccc tgcctaccag 1740cagggccaga
accagctgta caacgagctg aacctgggcc ggagggagga gtacgacgtg
1800ctggacaagc ggagaggccg ggaccctgag atgggcggca agccccggag
aaagaaccct 1860caggagggcc tgtataacga actgcagaaa gacaagatgg
ccgaggccta cagcgagatc 1920ggcatgaagg gcgagcggcg gaggggcaag
ggccacgacg gcctgtacca gggcctgagc 1980accgccacca aggataccta
cgacgccctg cacatgcagg ccctgccccc cagatga 2037582037DNAArtificial
sequenceSynthetic oligonucleotide 58atgctgctgc tggtgaccag
cctgctgctg tgtgagctgc cccaccccgc ctttctgctg 60atccccgaca tccagatgac
ccagaccacc tccagcctga gcgccagcct gggcgaccgg 120gtgaccatca
gctgccgggc cagccaggac
atcagcaagt acctgaactg gtatcagcag 180aagcccgacg gcaccgtcaa
gctgctgatc taccacacca gccggctgca cagcggcgtg 240cccagccggt
ttagcggcag cggctccggc accgactaca gcctgaccat ctccaacctg
300gagcaggagg acatcgccac ctacttttgc cagcagggca acacactgcc
ctacaccttt 360ggcggcggaa caaagctgga gatcaccggc agcacctccg
gcagcggcaa gcctggcagc 420ggcgagggca gcaccaaggg cgaggtgaag
ctgcaggaga gcggccctgg cctggtggcc 480cccagccaga gcctgagcgt
gacctgtacc gtgtccggcg tgtccctgcc cgactacggc 540gtgtcctgga
tccggcagcc ccctaggaag ggcctggagt ggctgggcgt gatctggggc
600agcgagacca cctactacaa cagcgccctg aagagccggc tgaccatcat
caaggacaac 660agcaagagcc aggtgttcct gaagatgaac agcctgcaga
ccgacgacac cgccatctac 720tactgtgcca agcactacta ctacggcggc
agctacgcca tggactactg gggccagggc 780accagcgtga ccgtgtccag
cgagagcaag tacggccctc cctgcccccc ttgccctgcc 840cccgagttcc
tgggcggacc cagcgtgttc ctgttccccc ccaagcccaa ggacaccctg
900atgatcagcc ggacccccga ggtgacctgt gtggtggtgg acgtgtccca
ggaggacccc 960gaggtccagt tcaactggta cgtggacggc gtggaggtgc
acaacgccaa gaccaagccc 1020cgggaggagc agttcaatag cacctaccgg
gtggtgtccg tgctgaccgt gctgcaccag 1080gactggctga acggcaagga
atacaagtgt aaggtgtcca acaagggcct gcccagcagc 1140atcgagaaaa
ccatcagcaa ggccaagggc cagcctcggg agccccaggt gtacaccctg
1200ccccctagcc aagaggagat gaccaagaat caggtgtccc tgacctgcct
ggtgaagggc 1260ttctacccca gcgacatcgc cgtggagtgg gagagcaacg
gccagcccga gaacaactac 1320aagaccaccc cccctgtgct ggacagcgac
ggcagcttct tcctgtacag caggctgacc 1380gtggacaaga gccggtggca
ggagggcaac gtctttagct gctccgtgat gcacgaggcc 1440ctgcacaacc
actacaccca gaagagcctg tccctgagcc tgggcaagat gattatctca
1500ttcttcctgg ccctgacctc taccgccctg ctgtttctgc tgttctttct
gaccctgcgg 1560ttcagcgtgg tcaagagagg ccggaagaaa ctgctgtaca
tcttcaagca gcccttcatg 1620cggcccgtgc agaccaccca ggaagaggac
ggctgcagct gccggttccc cgaggaagag 1680gaaggcggct gcgaactgcg
ggtgaagttc agccggagcg ccgacgcccc tgcctaccag 1740cagggccaga
accagctgta caacgagctg aacctgggcc ggagggagga gtacgacgtg
1800ctggacaagc ggagaggccg ggaccctgag atgggcggca agccccggag
aaagaaccct 1860caggagggcc tgtataacga actgcagaaa gacaagatgg
ccgaggccta cagcgagatc 1920ggcatgaagg gcgagcggcg gaggggcaag
ggccacgacg gcctgtacca gggcctgagc 1980accgccacca aggataccta
cgacgccctg cacatgcagg ccctgccccc cagatga 2037592160DNAArtificial
sequenceSynthetic oligonucleotide 59atgctgctgc tggtgaccag
cctgctgctg tgtgagctgc cccaccccgc ctttctgctg 60atccccgaca tccagatgac
ccagaccacc tccagcctga gcgccagcct gggcgaccgg 120gtgaccatca
gctgccgggc cagccaggac atcagcaagt acctgaactg gtatcagcag
180aagcccgacg gcaccgtcaa gctgctgatc taccacacca gccggctgca
cagcggcgtg 240cccagccggt ttagcggcag cggctccggc accgactaca
gcctgaccat ctccaacctg 300gagcaggagg acatcgccac ctacttttgc
cagcagggca acacactgcc ctacaccttt 360ggcggcggaa caaagctgga
gatcaccggc agcacctccg gcagcggcaa gcctggcagc 420ggcgagggca
gcaccaaggg cgaggtgaag ctgcaggaga gcggccctgg cctggtggcc
480cccagccaga gcctgagcgt gacctgtacc gtgtccggcg tgtccctgcc
cgactacggc 540gtgtcctgga tccggcagcc ccctaggaag ggcctggagt
ggctgggcgt gatctggggc 600agcgagacca cctactacaa cagcgccctg
aagagccggc tgaccatcat caaggacaac 660agcaagagcc aggtgttcct
gaagatgaac agcctgcaga ccgacgacac cgccatctac 720tactgtgcca
agcactacta ctacggcggc agctacgcca tggactactg gggccagggc
780accagcgtga ccgtgtccag cgagagcaag tacggccctc cctgcccccc
ttgccctgcc 840cccgagttcc tgggcggacc cagcgtgttc ctgttccccc
ccaagcccaa ggacaccctg 900atgatcagcc ggacccccga ggtgacctgt
gtggtggtgg acgtgtccca ggaggacccc 960gaggtccagt tcaactggta
cgtggacggc gtggaggtgc acaacgccaa gaccaagccc 1020cgggaggagc
agttcaatag cacctaccgg gtggtgtccg tgctgaccgt gctgcaccag
1080gactggctga acggcaagga atacaagtgt aaggtgtcca acaagggcct
gcccagcagc 1140atcgagaaaa ccatcagcaa ggccaagggc cagcctcggg
agccccaggt gtacaccctg 1200ccccctagcc aagaggagat gaccaagaat
caggtgtccc tgacctgcct ggtgaagggc 1260ttctacccca gcgacatcgc
cgtggagtgg gagagcaacg gccagcccga gaacaactac 1320aagaccaccc
cccctgtgct ggacagcgac ggcagcttct tcctgtacag caggctgacc
1380gtggacaaga gccggtggca ggagggcaac gtctttagct gctccgtgat
gcacgaggcc 1440ctgcacaacc actacaccca gaagagcctg tccctgagcc
tgggcaagat gttctgggtg 1500ctggtcgtgg tgggtggcgt gctggcctgc
tacagcctgc tggtgacagt ggccttcatc 1560atcttttggg tgaggagcaa
gcggagcaga ggcggccaca gcgactacat gaacatgacc 1620ccccggaggc
ctggccccac ccggaagcac taccagccct acgcccctcc cagggacttc
1680gccgcctacc ggagcaagag aggccggaag aaactgctgt acatcttcaa
gcagcccttc 1740atgcggcccg tgcagaccac ccaggaagag gacggctgca
gctgccggtt ccccgaggaa 1800gaggaaggcg gctgcgaact gcgggtgaag
ttcagccgga gcgccgacgc ccctgcctac 1860cagcagggcc agaaccagct
gtacaacgag ctgaacctgg gccggaggga ggagtacgac 1920gtgctggaca
agcggagagg ccgggaccct gagatgggcg gcaagccccg gagaaagaac
1980cctcaggagg gcctgtataa cgaactgcag aaagacaaga tggccgaggc
ctacagcgag 2040atcggcatga agggcgagcg gcggaggggc aagggccacg
acggcctgta ccagggcctg 2100agcaccgcca ccaaggatac ctacgacgcc
ctgcacatgc aggccctgcc ccccagatga 2160
* * * * *