U.S. patent application number 15/936284 was filed with the patent office on 2019-03-07 for lipid encapsulating interfering rna.
The applicant listed for this patent is ARBUTUS PIOPHARMA CORPORATION. Invention is credited to James Heyes, Ian MacLachlan, Lorne R. Palmer.
Application Number | 20190071669 15/936284 |
Document ID | / |
Family ID | 35503071 |
Filed Date | 2019-03-07 |
View All Diagrams
United States Patent
Application |
20190071669 |
Kind Code |
A1 |
MacLachlan; Ian ; et
al. |
March 7, 2019 |
LIPID ENCAPSULATING INTERFERING RNA
Abstract
The present invention provides lipid-based formulations for
delivering, e.g., introducing, nucleic acid-lipid particles
comprising an interference RNA molecule to a cell, and assays for
optimizing the delivery efficiency of such lipid-based
formulations.
Inventors: |
MacLachlan; Ian; (Mission,
CA) ; Palmer; Lorne R.; (Burnaby, CA) ; Heyes;
James; (Vancouver, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ARBUTUS PIOPHARMA CORPORATION |
Vancouver |
|
CA |
|
|
Family ID: |
35503071 |
Appl. No.: |
15/936284 |
Filed: |
March 26, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14936169 |
Nov 9, 2015 |
9926560 |
|
|
15936284 |
|
|
|
|
12852379 |
Aug 6, 2010 |
9181545 |
|
|
14936169 |
|
|
|
|
11148152 |
Jun 7, 2005 |
7799565 |
|
|
12852379 |
|
|
|
|
60577961 |
Jun 7, 2004 |
|
|
|
60578075 |
Jun 7, 2004 |
|
|
|
60610746 |
Sep 17, 2004 |
|
|
|
60679427 |
May 9, 2005 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2310/14 20130101; A61K 31/7088 20130101; C12N 15/88 20130101;
A61K 9/1272 20130101; C12N 2310/351 20130101; C12N 15/111 20130101;
C12N 2320/32 20130101; A61K 31/7105 20130101 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C12N 15/113 20060101 C12N015/113; A61K 31/7088 20060101
A61K031/7088; A61K 9/127 20060101 A61K009/127; C12N 15/88 20060101
C12N015/88; C12N 15/11 20060101 C12N015/11; A61K 31/7105 20060101
A61K031/7105 |
Claims
1-37. (canceled)
38. A method of introducing a nucleic acid into a tumor cell, said
method comprising contacting said tumor cell with a nucleic
acid-lipid particle comprising (a) said nucleic acid; (b) a
cationic lipid of Formula I and having the following structure:
##STR00010## wherein: R.sup.1 and R.sup.2 are independently
selected from the group consisting of: H and C.sub.1-C.sub.3
alkyls; and R.sup.3 and R.sup.4 are independently selected from the
group consisting of alkyl groups having from about 10 to about 20
carbon atoms, wherein at least one of R.sup.3 and R.sup.4 comprises
at least two sites of unsaturation; (c) a non-cationic lipid; and
(d) a conjugated lipid that inhibits aggregation of particles.
39. The method of claim 38, wherein said nucleic acid in said
nucleic acid-lipid particle is resistant in aqueous solution to
degradation with a nuclease.
40. The method of claim 38, wherein said particle has a median
diameter of less than about 150 nm.
41. The method of claim 38, wherein nucleic acid is a small
interfering RNA (siRNA).
42. The method of claim 38, wherein said nucleic acid is
transcribed from a plasmid.
43. The method of claim 38, wherein said non-cationic lipid is a
member selected from the group consisting of
dioleoylphosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine
(EPC), di stearoylphosphatidylcholine (DSPC),
palmitoyloleyolphosphatidylglycerol (POPG), dipalmitoyl
phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine
(DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE),
16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE,
palmitoyloleoyl-phosphatidylethanolamine (POPE),
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol,
and a mixture thereof.
44. The method of claim 38, wherein the conjugated lipid that
inhibits aggregation of particles is a member selected from the
group consisting of a polyethyleneglycol (PEG)-lipid conjugate, a
polyamide (ATTA)-lipid conjugate, and a mixture thereof.
45. The method of claim 38, wherein the conjugated lipid that
inhibits aggregation of particles is a polyethyleneglycol
(PEG)-lipid.
46. The method of claim 45, wherein the PEG-lipid is member
selected from the group consisting of a PEG-diacylglycerol, a PEG
dialkyloxypropyl, a PEG-phospholipid, a PEG-ceramide, and a mixture
thereof.
47. The method of claim 46, wherein the conjugated lipid that
inhibits aggregation of particles is a polyethyleneglycol
(PEG)-dialkyloxypropyl conjugate.
48. The method of claim 47, wherein the PEG-dialkyloxypropyl
conjugate is PEG-dimyristyloxypropyl (C.sub.14).
49. The method of claim 48, wherein said cell is in a mammal.
50. The method of claim 49, wherein the mammal is a human.
51. The method of claim 49, wherein presence of said nucleic acid
at a tumor site distal to the site of administration is detectable
for at least 48 hours after administration of said particle.
52. The method of claim 49, wherein presence of said nucleic acid
at a tumor site distal to the site of administration is detectable
for at least 24 hours after administration of said particle.
53. A method for in vivo delivery of nucleic acid to a liver cell,
said method comprising administering to a mammalian subject a
nucleic acid-lipid particle comprising: (a) said nucleic acid; (b)
a cationic lipid of Formula I and having the following structure:
##STR00011## wherein: R.sup.1 and R.sup.2 are independently
selected from the group consisting of: H and C.sub.1-C.sub.3
alkyls; and R.sup.3 and R.sup.4 are independently selected from the
group consisting of alkyl groups having from about 10 to about 20
carbon atoms, wherein at least one of R.sup.3 and R.sup.4 comprises
at least two sites of unsaturation; (c) a non-cationic lipid; and
(d) a conjugated lipid that inhibits aggregation of particles.
54. The method of claim 53, wherein said mammal is a human.
55. The method of claim 54, wherein said human has a disease or
disorder associated with expression of a gene and wherein
expression of said gene is reduced by said nucleic acid.
56. The method of claim 53, wherein said disease or disorder is
associated with overexpression of said gene.
57. The method of claim 53, wherein said administration is
intravenous.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application is a Continuation of U.S. patent
application Ser. No. 14/936,169, filed Nov. 9, 2015, which is a
Divisional of U.S. patent application Ser. No. 12/852,379, filed
Aug. 6, 2010, which is a Divisional of U.S. patent application Ser.
No. 11/148,152, filed Jun. 7, 2005, which claims the benefit of
U.S. Provisional Patent Application Nos. 60/577,961 filed Jun. 7,
2004, 60/578,075 filed Jun. 7, 2004, 60/610,746, filed Sep. 17,
2004, and 60/679,427, filed May 9, 2005, the disclosures of each of
which are hereby incorporated by reference in their entirety for
all purposes.
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED ON A COMPACT DISK
[0002] The Sequence Listing written in file
086399-001962US-0963783_SequenceListing.txt, created on Nov. 9,
2015, 1,226 bytes, machine format IBM-PC, MS-Windows operating
system, is hereby incorporated by reference in its entirety for all
purposes.
FIELD OF THE INVENTION
[0003] The present invention relates to compositions and methods
for the therapeutic delivery of a nucleic acid comprising a
serum-stable lipid delivery vehicle encapsulating a nucleic acid to
provide efficient RNA interference (RNAi) in a cell or mammal. More
particularly, the present invention is directed to using a small
interfering RNA (siRNA) encapsulated in a serum-stable lipid
particle having a small diameter suitable for systemic
delivery.
BACKGROUND OF THE INVENTION
[0004] RNA interference (RNAi) is an evolutionarily conserved,
sequence specific mechanism triggered by double stranded RNA
(dsRNA) that induces degradation of complementary target single
stranded mRNA and "silencing" of the corresponding translated
sequences (McManus and Sharp, Nature Rev. Genet. 3:737 (2002)).
RNAi functions by enzymatic cleavage of longer dsRNA strands into
biologically active "short-interfering RNA" (siRNA) sequences of
about 21-23 nucleotides in length (Elbashir, et al., Genes Dev.
15:188 (2001)).
[0005] siRNA can be used downregulate or silence the transcription
and translation of a gene product of interest. For example, it is
desirable to downregulate genes associated with liver diseases and
disorders such as hepatits. In particular, it is desirable to
downregulate genes associated with hepatitis viral infection and
survival.
[0006] An effective and safe nucleic acid delivery system is
required for interference RNA to be therapeutically useful. Viral
vectors are relatively efficient gene delivery systems, but suffer
from a variety of limitations, such as the potential for reversion
to the wild type as well as immune response concerns. As a result,
nonviral gene delivery systems are receiving increasing attention
(Worgall, et al., Human Gene Therapy 8:37 (1997); Peeters, et al.,
Human Gene Therapy 7:1693 (1996); Yei, et al., Gene Therapy 1: 192
(1994); Hope, et al., Molecular Membrane Biology 15:1 (1998)).
Furthermore, viral systems are rapidly cleared from the
circulation, limiting transfection to "first-pass" organs such as
the lungs, liver, and spleen. In addition, these systems induce
immune responses that compromise delivery with subsequent
injections.
[0007] Plasmid DNA-cationic liposome complexes are currently the
most commonly employed nonviral gene delivery vehicles (Feigner,
Scientific American 276:102 (1997); Chonn, et al., Current Opinion
in Biotechnology 6:698 (1995)). For instance, cationic liposome
complexes made of an amphipathic compound, a neutral lipid, and a
detergent for transfecting insect cells are disclosed in U.S. Pat.
No. 6,458,382. Cationic liposome complexes are also disclosed in
U.S. Patent Publication No. 2003/0073640.
[0008] Cationic liposome complexes are large, poorly defined
systems that are not suited for systemic applications and can
elicit considerable toxic side effects (Harrison, et al.,
Biotechniques 19:816 (1995); Li, et al., The Gene 4:891 (1997);
Tam, et al, Gene Ther. 7:1867 (2000)). As large, positively charged
aggregates, lipoplexes are rapidly cleared when administered in
vivo, with highest expression levels observed in first-pass organs,
particularly the lungs (Huang, et al., Nature Biotechnology 15:620
(1997); Templeton, et al., Nature Biotechnology 15:647 (1997);
Hofland, et al., Pharmaceutical Research 14:742 (1997)).
[0009] Other liposomal delivery systems include, for example, the
use of reverse micelles, anionic and polymer liposomes. Reverse
micelles are disclosed in U.S. Pat. No. 6,429,200. Anionic
liposomes are disclosed in U.S. Patent Application No.
2003/0026831. Polymer liposomes, that incorporate dextrin or
glycerol-phosphocholine polymers, are disclosed in U.S. Patent
Application Nos. 2002/0081736 and 2003/0082103, respectively.
[0010] A gene delivery system containing an encapsulated nucleic
acid for systemic delivery should be small (i.e., less than about
100 nm diameter) and should remain intact in the circulation for an
extended period of time in order to achieve delivery to affected
tissues. This requires a highly stable, serum-resistant nucleic
acid-containing particle that does not interact with cells and
other components of the vascular compartment. The particle should
also readily interact with target cells at a disease site in order
to facilitate intracellular delivery of a desired nucleic acid.
[0011] Recent work has shown that nucleic acids can be encapsulated
in small (about 70 nm diameter) "stabilized nucleic acid-lipid
particles" (SNALP) that consist of a single plasmid encapsulated
within a bilayer lipid vesicle (Wheeler, et al., Gene Therapy 6:271
(1999)). These SNALPs typically contain the "fusogenic" lipid
dioleoylphosphatidylethanolamine (DOPE), low levels of cationic
lipid, and are stabilized in aqueous media by the presence of a
poly(ethylene glycol) (PEG) coating. SNALP have systemic
application as they exhibit extended circulation lifetimes
following intravenous (i.v.) injection, accumulate preferentially
at distal tumor sites due to the enhanced vascular permeability in
such regions, and can mediate transgene expression at these tumor
sites. The levels of transgene expression observed at the tumor
site following i.v. injection of SPLP containing the luciferase
marker gene are superior to the levels that can be achieved
employing plasmid DNA-cationic liposome complexes (lipoplexes) or
naked DNA.
[0012] Thus, there remains a strong need in the art for novel and
more efficient methods and compositions for introducing nucleic
acids, such as interfering RNA, into cells. In addition, there is a
need in the art for methods of treating or preventing disorders
such as hepatitis by downregulating genes associated with viral
infection and survival. The present invention addresses this and
other needs.
BRIEF SUMMARY OF THE INVENTION
[0013] The present invention comprises novel, stable nucleic
acid-lipid particles (SNALP) encapsulating one or more interfering
RNA molecules, methods of making the SNALPs and methods of
deliverubg and/or administering the SNALPs.
[0014] In one embodiment, the invention provides for a nucleic
acid-lipid particle comprising an interfering RNA and a cationic
lipid of Formula I or II and having the following structures:
##STR00001##
wherein R.sup.1 and R.sup.2 are independently selected from the
group consisting of: H and C.sub.1-C.sub.3 alkyls; and R.sup.3 and
R.sup.4 are independently selected from the group consisting of
alkyl groups having from about 10 to about 20 carbon atoms, wherein
at least one of R.sup.3 and R.sup.4 comprises at least two sites of
unsaturation. In a preferred embodiment, that cationic lipid is
selected from 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA)
and 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA). In a
preferred embodiment, the interfering RNA molecule is fully
encapsulated within the lipid bilayer of the nucleic acid-lipid
particle such that the nucleic acid in the nucleic acid-lipid
particle is resistant in aqueous solution to degradation by a
nuclease. In a preferred embodiment, the nucleic acid particle is
substantially non-toxic to mammals. The nucleic acid lipid
particles may further comprise a non-cationic lipid, a bilayer
stabilizing component (i.e., a conjugated lipid that prevents
aggregation of particles, a cationic polymer lipid, a sterol (e.g.,
cholesterol) and combinations thereof.
[0015] In some embodiments, the interfering RNA is a
small-interfering RNA molecule that is less than about 60
nucleotides in length or a double-stranded RNA greater than about
25 nucleotides in length. In some embodiments the interfering RNA
is transcribed from a plasmid, in particular a plasmid comprising a
DNA template of a target sequence.
[0016] In one embodiment, the non-cationic lipid is selected from
di stearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine
(DOPC), dipalmitoylphosphatidylcholine (DPPC),
dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoyl-phosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE) and
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), a sterol (e.g.,
cholesterol) and a mixture thereof.
[0017] In one embodiment, the conjugated lipid that inhibits
aggregation of particles is one or more of a polyethyleneglycol
(PEG)-lipid conjugate, a polyamide (ATTA)-lipid conjugate, and a
mixture thereof. In one aspect, the PEG-lipid conjugate is one or
more of a PEG-dialkyloxypropyl (DAA), a PEG-diacylglycerol (DAG), a
PEG-phospholipid, a PEG-ceramide, and a mixture thereof. In one
aspect, the PEG-DAG conjugate is one or more of a
PEG-dilauroylglycerol (C.sub.12), a PEG-dimyristoylglycerol
(C.sub.14), a PEG-dipalmitoylglycerol (C.sub.16), and a
PEG-distearoylglycerol (C.sub.18). In one aspect, the PEG-DAA
conjugate is one or more of a PEG-dilauryloxypropyl (C.sub.12), a
PEG-dimyristyloxypropyl (C.sub.14), a PEG-dipalmityloxypropyl
(C.sub.16), and a PEG-di stearyloxypropyl (C.sub.18).
[0018] The nucleic acid-lipid particles of the present invention
are useful for the therapeutic delivery of nucleic acids comprising
an interfering RNA sequence. In particular, it is an object of this
invention to provide in vitro and in vivo methods for treatment of
a disease in a mammal by downregulating or silencing the
transcription and translation of a target nucleic acid sequence of
interest. In some embodiments, an interfering RNA is formulated
into a nucleic acid-lipid particle, and the particles are
administered to patients requiring such treatment. In other
embodiments, cells are removed from a patient, the interfering RNA
delivered in vitro, and reinjected into the patient. In one
embodiment, the present invention provides for a method of
introducing a nucleic acid into a cell by contacting a cell with a
nucleic acid-lipid particle comprised of a cationic lipid, a
non-cationic lipid, a conjugated lipid that inhibits aggregation,
and an interfering RNA.
[0019] In one embodiment, at least about 5%, 10%, 15%, 20%, or 25%
of the total injected dose of the nucleic acid-lipid particles is
present in plasma about 8, 12, 24, 36, or 48 hours after injection.
In other embodiments, more than 20%, 30%, 40% and as much as 60%,
70% or 80% of the total injected dose of the nucleic acid-lipid
particles is present in plasma about 8, 12, 24, 36, or 48 hours
after injection. In one embodiment, the presence of an interfering
RNA in cells of the lung, liver, tumor or at a site of inflammation
is detectable at about 8, 12, 24, 36, 48, 60, 72 or 96 hours after
administration. In one embodiment, downregulation of expression of
the target sequence is detectable at about 8, 12, 24, 36, 48, 60,
72 or 96 hours after administration. In one embodiment,
downregulation of expression of the target sequence occurs
preferentially in tumor cells or in cells at a site of
inflammation. In one embodiment, the presence of an interfering RNA
in cells at a site distal to the site of administration is
detectable at least four days after intravenous injection of the
nucleic acid-lipid particle. In another embodiment, the presence of
an interfering RNA in of cells in the lung, liver or a tumor is
detectable at least four days after injection of the nucleic
acid-lipid particle. In another embodiment, the nucleic acid-lipid
particle is administered parenterally or intraperitoneally.
[0020] The particles are suitable for use in intravenous nucleic
acid transfer as they are stable in circulation, of a size required
for pharmacodynamic behavior resulting in access to extravascular
sites and target cell populations. The invention also provides for
pharmaceutically acceptable compositions comprising a nucleic
acid-lipid particle.
[0021] Another embodiment of the present invention provides methods
for in vivo delivery of interfering RNA. A nucleic acid-lipid
particle comprising a cationic lipid, a non-cationic lipid, a
conjugated lipid that inhibits aggregation of particles, and
interfering RNA is administered (e.g., intravenously) to a subject
(e.g., a mammal such as a human). In some embodiments, the
invention provides methods for in vivo delivery of interfering RNA
to the liver of a mammalian subject.
[0022] A further embodiment of the present invention provides a
method of treating a disease or disorder in a mammalian subject. A
therapeutically effective amount of a nucleic acid-lipid particle
comprising a cationic lipid, a non-cationic lipid, a conjugated
lipid that inhibits aggregation of particles, and interfering RNA
is administered to the mammalian subject (e.g., a rodent such as a
mouse, a primate such as a human or a monkey). In some embodiments,
the disease or disorder is associated with expression and/or
overexpression of a gene and expression or overexpression of the
gene is reduced by the interfering RNA.
Definitions
[0023] The term "lipid" refers to a group of organic compounds that
include, but are not limited to, esters of fatty acids and are
characterized by being insoluble in water, but soluble in many
organic solvents. They are usually divided into at least three
classes: (1) "simple lipids' which include fats and oils as well as
waxes; (2) "compound lipids" which include phospholipids and
glycolipids; (3) "derived lipids" such as steroids.
[0024] "Lipid vesicle" refers to any lipid composition that can be
used to deliver a compound including, but not limited to,
liposomes, wherein an aqueous volume is encapsulated by an
amphipathic lipid bilayer; or wherein the lipids coat an interior
comprising a large molecular component, such as a plasmid
comprising an interfering RNA sequence, with a reduced aqueous
interior; or lipid aggregates or micelles, wherein the encapsulated
component is contained within a relatively disordered lipid
mixture.
[0025] As used herein, "lipid encapsulated" can refer to a lipid
formulation that provides a compound with full encapsulation,
partial encapsulation, or both. In a preferred embodiment, the
nucleic acid is fully encapsulated in the lipid formulation (e.g.,
to form an SPLP, pSPLP, or other SNALP).
[0026] As used herein, the term "SNALP" refers to a stable nucleic
acid lipid particle, including SPLP. A SNALP represents a vesicle
of lipids coating a reduced aqueous interior comprising a nucleic
acid (e.g., ssDNA, dsDNA, ssRNA, micro RNA (miRNA), short hairpin
RNA (shRNA), dsRNA, siRNA, or a plasmid, including plasmids from
which an interfering RNA is transcribed). As used herein, the term
"SPLP" refers to a nucleic acid lipid particle comprising a nucleic
acid (e.g., a plasmid) encapsulated within a lipid vesicle. SNALPs
and SPLPs typically contain a cationic lipid, a non-cationic lipid,
and a lipid that prevents aggregation of the particle (e.g., a
PEG-lipid conjugate). SNALPs and SPLPs have systemic application as
they exhibit extended circulation lifetimes following intravenous
(i.v.) injection, accumulate at distal sites (e.g., sites
physically separated from the administration site and can mediate
expression of the transfected gene at these distal sites. SPLPs
include "pSPLP" which comprise an encapsulated condensing
agent-nucleic acid complex as set forth in WO 00/03683.
[0027] The term "vesicle-forming lipid" is intended to include any
amphipathic lipid having a hydrophobic moiety and a polar head
group, and which by itself can form spontaneously into bilayer
vesicles in water, as exemplified by most phospholipids.
[0028] The term "vesicle-adopting lipid" is intended to include any
amphipathic lipid that is stably incorporated into lipid bilayers
in combination with other amphipathic lipids, with its hydrophobic
moiety in contact with the interior, hydrophobic region of the
bilayer membrane, and its polar head group moiety oriented toward
the exterior, polar surface of the membrane. Vesicle-adopting
lipids include lipids that on their own tend to adopt a nonlamellar
phase, yet which are capable of assuming a bilayer structure in the
presence of a bilayer-stabilizing component. A typical example is
DOPE (dioleoylphosphatidylethanolamine). Bilayer stabilizing
components include, but are not limited to, conjugated lipids that
inhibit aggregation of the SNALPs, polyamide oligomers (e.g.,
ATTA-lipid derivatives), peptides, proteins, detergents,
lipid-derivatives, PEG-lipid derivatives such as PEG coupled to
dialkyloxypropyls, PEG coupled to diacylglycerols, PEG coupled to
phosphatidyl-ethanolamines, and PEG conjugated to ceramides as
described in U.S. Pat. No. 5,885,613.
[0029] The term "amphipathic lipid" refers, in part, to any
suitable material wherein the hydrophobic portion of the lipid
material orients into a hydrophobic phase, while the hydrophilic
portion orients toward the aqueous phase. Amphipathic lipids are
usually the major component of a lipid vesicle. Hydrophilic
characteristics derive from the presence of polar or charged groups
such as carbohydrates, phosphate, carboxylic, sulfato, amino,
sulfhydryl, nitro, hydroxy and other like groups. Hydrophobicity
can be conferred by the inclusion of apolar groups that include,
but are not limited to, long chain saturated and unsaturated
aliphatic hydrocarbon groups and such groups substituted by one or
more aromatic, cycloaliphatic or heterocyclic group(s). Examples of
amphipathic compounds include, but are not limited to,
phospholipids, aminolipids and sphingolipids. Representative
examples of phospholipids include, but are not limited to,
phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine,
phosphatidylinositol, phosphatidic acid, palmitoyloleoyl
phosphatidylcholine, lysophosphatidylcholine,
lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine,
dioleoylphosphatidylcholine, di stearoylphosphatidylcholine or
dilinoleoylphosphatidylcholine. Other compounds lacking in
phosphorus, such as sphingolipid, glycosphingolipid families,
diacylglycerols and .beta.-acyloxyacids, are also within the group
designated as amphipathic lipids. Additionally, the amphipathic
lipid described above can be mixed with other lipids including
triglycerides and sterols.
[0030] The term "neutral lipid" refers to any of a number of lipid
species that exist either in an uncharged or neutral zwitterionic
form at a selected pH. At physiological pH, such lipids include,
for example, diacylphosphatidylcholine,
diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin,
cholesterol, cerebrosides and diacylglycerols.
[0031] The term "noncationic lipid" refers to any neutral lipid as
described above as well as anionic lipids. Non-cationic lipids
include, e.g., di stearoylphosphatidylcholine (DSPC),
dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine
(DPPC), dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoyl-phosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE) and
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE, and
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE).
[0032] The term "anionic lipid" refers to any lipid that is
negatively charged at physiological pH. These lipids include, but
are not limited to, phosphatidylglycerol, cardiolipin,
diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoyl
phosphatidylethanolamines, N-succinyl phosphatidylethanolamines,
N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols,
palmitoyloleyolphosphatidylglycerol (POPG), and other anionic
modifying groups joined to neutral lipids.
[0033] The term "cationic lipid" refers to any of a number of lipid
species that carry a net positive charge at a selected pH, such as
physiological pH. Such lipids include, but are not limited to:
1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA) and
1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
N,N-dioleyl-N,N-dimethylammonium chloride (DODAC);
N-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA);
N,N-distearyl-N,N-dimethylammonium bromide (DDAB);
N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTAP); 3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol
(DC-Chol) and
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide (DMRIE). The following lipids are cationic and have a
positive charge at below physiological pH: DODAP, DODMA, DMDMA and
the like.
[0034] The term "hydrophobic lipid" refers to compounds having
apolar groups that include, but are not limited to, long chain
saturated and unsaturated aliphatic hydrocarbon groups and such
groups optionally substituted by one or more aromatic,
cycloaliphatic or heterocyclic group(s). Suitable examples include,
but are not limited to, diacylglycerol, dialkylglycerol,
N--N-dialkylamino, 1,2-diacyloxy-3-aminopropane and
1,2-dialkyl-3-aminopropane.
[0035] The term "fusogenic" refers to the ability of a liposome, an
SNALP or other drug delivery system to fuse with membranes of a
cell. The membranes can be either the plasma membrane or membranes
surrounding organelles, e.g., endosome, nucleus, etc.
[0036] The term "diacylglycerol" refers to a compound having
2-fatty acyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons bonded to the 1- and
2-position of glycerol by ester linkages. The acyl groups can be
saturated or have varying degrees of unsaturation. Diacylglycerols
have the following general formula:
##STR00002##
[0037] The term "dialkyloxypropyl" refers to a compound having
2-alkyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons. The alkyl groups can be
saturated or have varying degrees of unsaturation.
Dialkyloxypropyls have the following general formula:
##STR00003##
[0038] The term "ATTA" or "polyamide" refers to, but is not limited
to, compounds disclosed in U.S. Pat. Nos. 6,320,017 and 6,586,559.
These compounds include a compound having the formula
##STR00004##
wherein: R is a member selected from the group consisting of
hydrogen, alkyl and acyl; R.sup.1 is a member selected from the
group consisting of hydrogen and alkyl; or optionally, R and
R.sup.1 and the nitrogen to which they are bound form an azido
moiety; R.sup.2 is a member of the group selected from hydrogen,
optionally substituted alkyl, optionally substituted aryl and a
side chain of an amino acid; R.sup.3 is a member selected from the
group consisting of hydrogen, halogen, hydroxy, alkoxy, mercapto,
hydrazino, amino and NR.sup.4R.sup.5, wherein R.sup.4 and R.sup.5
are independently hydrogen or alkyl; n is 4 to 80; m is 2 to 6; p
is 1 to 4; and q is 0 or 1. It will be apparent to those of skill
in the art that other polyamides can be used in the compounds of
the present invention.
[0039] The terms "polypeptide," "peptide," and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers and non-naturally occurring
amino acid polymers. As used herein, the terms encompass amino acid
chains of any length, including full-length proteins (i.e.,
antigens), wherein the amino acid residues are linked by covalent
peptide bonds.
[0040] The term "amino acid" refers to naturally occurring and
synthetic amino acids, as well as amino acid analogs and amino acid
mimetics that function in a manner similar to the naturally
occurring amino acids. The term "basic amino acid" refers to
naturally-occurring amino acids as well as synthetic amino acids
and/or or amino acid mimetics having a net positive charge at a
selected pH, such as physiological pH. This group includes, but is
not limited to, lysine, arginine, asparagine, glutamine, histidine
and the like. Naturally occurring amino acids are those encoded by
the genetic code, as well as those amino acids that are later
modified, e.g., hydroxyproline, .alpha.-carboxyglutamate, and
O-phosphoserine. Amino acid analogs refers to compounds that have
the same basic chemical structure as a naturally occurring amino
acid, i.e., an .alpha. carbon that is bound to a hydrogen, a
carboxyl group, an amino group, and an R group, e.g., homoserine,
norleucine, methionine sulfoxide, methionine methyl sulfonium. Such
analogs have modified R groups (e.g., norleucine) or modified
peptide backbones, but retain the same basic chemical structure as
a naturally occurring amino acid. "Amino acid mimetics" refers to
chemical compounds that have a structure that is different from the
general chemical structure of an amino acid, but that functions in
a manner similar to a naturally occurring amino acid.
[0041] Amino acids may be referred to herein by either the commonly
known three letter symbols or by the one-letter symbols recommended
by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides,
likewise, may be referred to by their commonly accepted
single-letter codes.
[0042] The term "nucleic acid" or "polynucleotide" refers to a
polymer containing at least two deoxyribonucleotides or
ribonucleotides in either single- or double-stranded form. Unless
specifically limited, the terms encompasses nucleic acids
containing known analogues of natural nucleotides that have similar
binding properties as the reference nucleic acid and are
metabolized in a manner similar to naturally occurring nucleotides.
Unless otherwise indicated, a particular nucleic acid sequence also
implicitly encompasses conservatively modified variants thereof
(e.g., degenerate codon substitutions), alleles, orthologs, SNPs,
and complementary sequences as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with mixed-base
and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.
19:5081 (1991); Ohtsuka et al., Biol. Chem. 260:2605-2608 (1985);
and Cassol et al. (1992); Rossolini et al., Mol. Cell. Probes
8:91-98 (1994)). "Nucleotides" contain a sugar deoxyribose (DNA) or
ribose (RNA), a base, and a phosphate group. Nucleotides are linked
together through the phosphate groups. "Bases" include purines and
pyrimidines, which further include natural compounds adenine,
thymine, guanine, cytosine, uracil, inosine, and natural analogs,
and synthetic derivatives of purines and pyrimidines, which
include, but are not limited to, modifications which place new
reactive groups such as, but not limited to, amines, alcohols,
thiols, carboxylates, and alkylhalides. DNA may be in the form of
antisense, plasmid DNA, parts of a plasmid DNA, pre-condensed DNA,
product of a polymerase chain reaction (PCR), vectors (P1, PAC,
BAC, YAC, artificial chromosomes), expression cassettes, chimeric
sequences, chromosomal DNA, or derivatives of these groups. The
term nucleic acid is used interchangeably with gene, cDNA, mRNA
encoded by a gene, and an interfering RNA molecule.
[0043] "Conservatively modified variants" applies to both amino
acid and nucleic acid sequences. With respect to particular nucleic
acid sequences, "conservatively modified variants" refers to those
nucleic acids that encode identical or essentially identical amino
acid sequences, or where the nucleic acid does not encode an amino
acid sequence, to essentially identical sequences. Because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given protein. For instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations," which are one species of
conservatively modified variations. Every nucleic acid sequence
herein that encodes a polypeptide also describes every possible
silent variation of the nucleic acid. One of skill will recognize
that each codon in a nucleic acid (except AUG, which is ordinarily
the only codon for methionine, and TGG, which is ordinarily the
only codon for tryptophan) can be modified to yield a functionally
identical molecule. Accordingly, each silent variation of a nucleic
acid that encodes a polypeptide is implicit in each described
sequence.
[0044] The term "gene" refers to a nucleic acid (e.g., DNA or RNA)
sequence that comprises partial length or entire length coding
sequences necessary for the production of a polypeptide or
precursor (e.g., hepatitis virus A, B, C, D, E, or G; or herpes
simplex virus).
[0045] "Gene product," as used herein, refers to a product of a
gene such as an RNA transcript.
[0046] The term "interfering RNA" or "RNAi" or "interfering RNA
sequence" refers to double-stranded RNA that results in the
degradation of specific mRNAs and can be used to interfere with
translation from a desired mRNA target transcript. Short RNAi that
is about 15-30 nucleotides in length is referred to as
"small-interfering RNA" or "siRNA." Longer RNAi is generally
referred to as "double-stranded RNA" or "dsRNA." A DNA molecule
that transcribes dsRNA or siRNA (for instance, as a hairpin duplex)
also provides RNAi. DNA molecules for transcribing dsRNA are
disclosed in U.S. Pat. No. 6,573,099, and in U.S. Patent
Publication Nos. 20020160393 and 20030027783. DNA molecules for
transcribing siRNA are reviewed in Tuschl and Borkhardt, Molecular
Interventions, 2:158 (2002).
[0047] By "silencing" or "downregulation" of a gene or nucleic acid
is intended to mean a detectable decrease of transcription and/or
translation of a target nucleic acid sequence, i.e., the sequence
targeted by the RNAi, or a decrease in the amount or activity of
the target sequence or protein in comparison to the normal level
that is detected in the absence of the interfering RNA or other
nucleic acid sequence. A detectable decrease can be as small as
about 5% or 10%, or as great as about 80%, 90% or 100%. More
typically, a detectable decrease is about 20%, 30%, 40%, 50%, 60%,
or 70%.
[0048] As used herein, the term "aqueous solution" refers to a
composition comprising in whole, or in part, water.
[0049] As used herein, the term "organic lipid solution" refers to
a composition comprising in whole, or in part, an organic solvent
having a lipid.
[0050] "Distal site," as used herein, refers to a physically
separated site, which is not limited to an adjacent capillary bed,
but includes sites broadly distributed throughout an organism.
[0051] "Serum-stable" in relation to nucleic acid-lipid particles
means that the particle is not significantly degraded after
exposure to a serum or nuclease assay that would significantly
degrade free DNA. Suitable assays include, for example, a standard
serum assay or a DNAse assay such as those described in the
Examples below.
[0052] "Systemic delivery," as used herein, refers to delivery that
leads to a broad biodistribution of a compound within an organism.
Some techniques of administration can lead to the systemic delivery
of certain compounds, but not others. Systemic delivery means that
a useful, preferably therapeutic, amount of a compound is exposed
to most parts of the body. To obtain broad biodistribution
generally requires a blood lifetime such that the compound is not
rapidly degraded or cleared (such as by first pass organs (liver,
lung, etc.) or by rapid, nonspecific cell binding) before reaching
a disease site distal to the site of administration. Systemic
delivery of nucleic acid-lipid particles can be by any means known
in the art including, for example, intravenous, subcutaneous,
intraperitoneal, In a preferred embodiment, systemic delivery of
nucleic acid-lipid particles is by intravenous delivery.
BRIEF DESCRIPTION OF THE DRAWINGS
[0053] FIG. 1 illustrates the structures of two exemplary cationic
lipids of the invention: 1,2-DiLinoleyloxy-N,N-dimethylaminopropane
(DLinDMA) and 1,2-Dilinolenyloxy-N,N-dimethylaminopropane
(DLenDMA).
[0054] FIG. 2 illustrates the synthetic scheme for DLinDMA.
[0055] FIG. 3 illustrates the synthetic scheme for DLenDMA.
[0056] FIG. 4 illustrates downregulating .beta.-galactosidase
expression in CT26.CL25 cells via in vitro delivery of encapsulated
anti-.beta.-galactosidase siRNA in DSPC:Cholesterol:DODMA:PEG-DMG
liposomes.
[0057] FIG. 5 illustrates that clearance studies with LUVs showed
that SNALPs containing PEG-DAGs were comparable to SNALPs
containing PEG-CeramideC20.
[0058] FIG. 6 illustrates the pharmacokinetic properties of SNALPs
containing PEG-DAGs.
[0059] FIGS. 7A-7D illustrate the biodistribution properties of
SNALPs containing PEG-DAGs.
[0060] FIG. 8 illustrates the luciferase gene expression 24 hrs
post IV administration of SPLPs containing PEG-CeramideC.sub.20
versus PEG-DAGs in Neuro-2a Tumor Bearing Male A/J Mice.
[0061] FIG. 9 illustrates the luciferase gene expression 48 hrs
post IV administration of SPLPs containing PEG-CeramideC.sub.20
versus PEG-DAGs in Neuro-2a Tumor Bearing Male A/J Mice.
[0062] FIG. 10 illustrates the luciferase gene expression 72 hrs
post IV administration of SPLPs containing PEG-CeramideC.sub.20
versus PEG-DAGs in Neuro-2a Tumor Bearing Male A/J Mice.
[0063] FIG. 11 illustrates data showing luciferase gene expression
in tumors 48 hours after intravenous administration of SPLP
comprising PEG-DAA conjugates and PEG-DAG conjugates.
[0064] FIG. 12 illustrates data showing luciferase gene expression
in liver, lung, spleen, heart, and tumor following intravenous
administration of SPLP comprising PEG-DAA conjugates and PEG-DAG
conjugates.
[0065] FIG. 13 illustrates data from clearance studies in Neuro-2a
tumor bearing male A/J mice after administration of SPLPs
comprising a PEG-DAA conjugate and containing a plasmid encoding
luciferase under the control of the CMV promoter and SNALPs
comprising a PEG-DAA conjugate and containing anti-luciferase
siRNA.
[0066] FIG. 14 illustrates data from studies of the pharmacokinetic
properties of SPLPs comprising a PEG-DAA conjugate and containing a
plasmid encoding luciferase under the control of the CMV promoter
and SNALPs comprising a PEG-DAA conjugate and containing
anti-luciferase siRNA in Neuro-2a tumor bearing male A/J mice.
[0067] FIG. 15 illustrates data from clearance studies in Neuro-2a
tumor bearing male A/J mice after administration of SPLPs
comprising a PEG-DAA conjugate or a PEG-DAG conjugate and
containing a plasmid encoding luciferase under the control of the
CMV promoter, pSPLPs comprising a PEG-DAG conjugate and containing
a plasmid encoding luciferase under the control of the CMV promoter
and SNALPs comprising a PEG-DAA conjugate and containing
anti-luciferase siRNA.
[0068] FIG. 16 illustrates data from studies of the pharmacokinetic
properties of SPLPs comprising a PEG-DAA conjugate or a PEG-DAG
conjugate and containing a plasmid encoding luciferase under the
control of the CMV promoter, pSPLPs comprising a PEG-DAG conjugate
and containing a plasmid encoding luciferase under the control of
the CMV promoter and SNALPs comprising a PEG-DAA conjugate and
containing anti-luciferase siRNA in Neuro-2a tumor bearing male A/J
mice.
[0069] FIG. 17 illustrates in vitro data demonstrating silencing of
luciferase expression in luciferase expressing cells treated with
SPLPs comprising a PEG-lipid conjugate and containing a plasmid
encoding luciferase under the control of the CMV promoter and
SNALPs comprising a PEG-lipid conjugate conjugate and containing
anti-luciferase siRNA.
[0070] FIG. 18 illustrates in vivo data demonstrating silencing of
luciferase expression in Neuro-2a tumor bearing male A/J mice
treated with SPLPs comprising a PEG-DAA conjugate and containing a
plasmid encoding luciferase under the control of the CMV promoter
and SNALPs comprising a PEG-DAA conjugate and containing
anti-luciferase siRNA.
[0071] FIG. 19 illustrates in vivo data demonstrating silencing of
luciferase expression in Neuro-2a tumor bearing male A/J mice
treated with SPLPs comprising a PEG-DAA conjugate and containing a
plasmid encoding luciferase under the control of the CMV promoter
and SNALPs comprising a PEG-DAA conjugate and containing
anti-luciferase siRNA.
[0072] FIG. 20 illustrates in vivo data demonstrating silencing of
luciferase expression in Neuro-2a tumor bearing male A/J mice
treated with SPLPs comprising a PEG-DAA conjugate and containing a
plasmid encoding luciferase under the control of the CMV promoter
and SNALPs comprising a PEG-DAA conjugate and containing
anti-luciferase siRNA.
[0073] FIG. 21 illustrates in vivo data demonstrating silencing of
luciferase expression in Neuro-2a tumor bearing male A/J mice
treated with SPLPs comprising a PEG-DAA conjugate and containing a
plasmid encoding luciferase under the control of the CMV promoter
and SNALPs comprising a PEG-DAA conjugate and containing
anti-luciferase siRNA.
[0074] FIG. 22 illustrates in vivo data demonstrating silencing of
luciferase expression in Neuro-2a tumor bearing male A/J mice
treated with SPLPs comprising a PEG-DAA conjugate and containing a
plasmid encoding luciferase under the control of the CMV promoter
and SNALPs comprising a PEG-DAA conjugate and containing
anti-luciferase siRNA.
[0075] FIG. 23 illustrates data showing silencing of gene
expression following in vitro transfection of Neuro2a cells stably
expressing luciferase by an SPLP (i.e., SNALP) comprising DODAC,
DODMA, or DLinDMA and encapsulating an anti-luciferase siRNA
sequence.
[0076] FIG. 24 illustrates data showing SNALP-mediated gene
silencing in vitro.
[0077] FIG. 25 illustrates data showing luciferase gene expression
in tumors 48 hours following intravenous delivery of SPLP
encapsulating a plasmid encoding luciferase. The SPLP comprised
PEG-C-DMA conjugates and either DODMA or DLinDMA. The PEG moieties
had molecular weight of either 2000 or 750.
[0078] FIG. 26 illustrates data showing showing luciferase gene
expression in Neuro2A tumor bearing male A/J mice 48 hours after
intravenous administration of SPLP encapsulating a plasmid encoding
luciferase. The SPLP comprised varying percentages (i.e., 15%, 10%,
5% or 2.5%) of PEG-C-DMA and either DODMA or DLinDMA.
[0079] FIG. 27 illustrates data showing the percentage of the
injected dose of SPLP, SNALP, or empty vesicles remaining in plasma
of male A/J mice following a single intravenous administration of
.sup.3H-CHE-labeled SPLP or SNALP, or empty vesicles, containing
various percentages (i.e., 2%, 5%, 10%, or 15%) of PEG-C-DMA.
[0080] FIG. 28 illustrates data showing the biodistribution SPLP,
SNALP or empty vesicles in Neuro-2A tumor-bearing male A/J mice 48
hours after a single intravenous administration of
.sup.3H-CHE-labelled formulations comprising varying percentages of
PEG-C-DMA. The SNALP and empty vesicles comprised DLinDMA. The SPLP
comprised DODMA.
[0081] FIG. 29 illustrates data showing silencing of luciferase
expression in distal, stable Neuro2A-G tumors in A/J mice 48 hours
after intravenous administration of SNALP comprising DLinDMA.
[0082] FIG. 30 illustrates data showing silencing of luciferase
expression in Neuro2A-G cells following delivery of SNALP
formulations comprising DLinDMA and encapsulating anti-luciferase
siRNA.
[0083] FIG. 31 illustrates data showing silencing of luciferase
expression in Neuro2A-G cells following delivery of SNALP
formulations comprising DLinDMA and encapsulating anti-luciferase
siRNA. Delivery of the SNALP formulations was performed in the
absence or presence of chloroquine.
DETAILED DESCRIPTION
I. Introduction
[0084] The present invention demonstrates the unexpected success of
encapsulating short interfering RNA (siRNA) molecules in SNALPs
comprising cationic lipids of Formula I, II, or mixture thereof.
The SNALPs described herein can be used to deliver an siRNA to a
cell to silence a target sequence of interest. SNALP comprising any
of a broad range of concentrations of additional cationic lipids,
non-cationic lipids, and other lipids can be used to practice the
present invention. The SNALP can be prepared with any nucleic acid
comprising an interfering RNA sequence, from any source and
comprising any polynucleotide sequence, and can be prepared using
any of a large number of methods.
II. Stable Nucleic Acid-Lipid Particles (SNALPs) and Properties
Thereof
[0085] The stable nucleic acid-lipid particles or, alternatively,
SNALPs typically comprise cationic lipid (i.e., a cationic lipid of
Formula I or II) and nucleic acids. Such SNALPs also preferably
comprise noncationic lipid and a bilayer stabilizing component
(i.e., a conjugated lipid that inhibits aggregation of the SNALPs).
The SNALPs of the present invention typically have a mean diameter
of about 50 nm to about 150 nm, more typically about 100 nm to
about 130 nm, most typically about 110 nm to about 115 nm, and are
substantially nontoxic. In addition, the nucleic acids present in
the SNALPs of the present invention are resistant in aqueous
solution to degradation with a nuclease.
[0086] In one embodiment, the present invention provides stabilized
nucleic acid-lipid particles (SPLPs or SNALPs) and other
lipid-based carrier systems (e.g., a liposome, a micelle, a
virosome, a lipid-nucleic acid particle, a nucleic acid complex and
mixtures thereof) containing cationic lipids of the present
invention, i.e., cationic lipids of Formula I, Formula II, or a
combination thereof. The lipid-nucleic acid particles of the
present invention typically comprise a nucleic acid, a cationic
lipid of Formula I or Formula II, a non-cationic lipid and a
PEG-lipid conjugate. The cationic lipid of Formula I or Formula II
typically comprises from about 2% to about 60%, from about 5% to
about 50%, from about 10% to about 45%, from about 20% to about
40%, or about 30% of the total lipid present in said particle. The
non-cationic lipid typically comprises from about 5% to about 90%,
from about 10% to about 85%, from about 20% to about 80%, from
about 30% to about 70%, from about 40% to about 60% or about 48% of
the total lipid present in said particle. The PEG-lipid conjugate
typically comprises from about 1% to about 20%, from about 1.5% to
about 18%, from about 4% to about 15%, from about 5% to about 12%,
or about 2% of the total lipid present in said particle. The
nucleic acid-lipid particles of the present invention may further
comprise cholesterol. If present, the cholesterol typically
comprises from about 10% to about 60%, from about 12% to about 58%,
from about 20% to about 55%, or about 48% of the total lipid
present in said particle. It will be readily apparent to one of
skill in the art that the proportions of the components of the
nucleic acid-lipid particles may be varied, e.g., using the ERP
assay described herein. For example for systemic delivery, the
cationic lipid may comprise from about 5% to about 15% of the total
lipid present in said particle and for local or regional delivery,
the cationic lipid comprises from about 40% to about 50% of the
total lipid present in said particle.
[0087] A. Cationic Lipids
[0088] Cationic lipids of Formula I and II may be used in the
present invention, either alone or in combination with one or more
other cationic lipid species or non-cationic lipid species.
Cationic lipids of Formula I and II have the following
structures:
##STR00005##
wherein R.sup.1 and R.sup.2 are independently selected and are H or
C.sub.1-C.sub.3 alkyls. R.sup.3 and R.sup.4 are independently
selected and are alkyl groups having from about 10 to about 20
carbon atoms; at least one of R.sup.3 and R.sup.4 comprises at
least two sites of unsaturation. In one embodiment, R.sup.3 and
R.sup.4 are both the same, i.e., R.sup.3 and R.sup.4 are both
linoleyl (C18), etc. In another embodiment, R.sup.3 and R.sup.4 are
different, i.e., R.sup.3 is myristyl (C14) and R.sup.4 is linoleyl
(C18). In a preferred embodiment, the cationic lipids of the
present invention are symmetrical, i.e., R.sup.3 and R.sup.4 are
both the same. In another preferred embodiment, both R.sup.3 and
R.sup.4 comprise at least two sites of unsaturation. In some
embodiments, R.sup.3 and R.sup.4 are independently selected from
dodecadienyl, tetradecadienyl, hexadecadienyl, linoleyl, and
icosadienyl. In a preferred embodiment, R.sup.3 and R.sup.4 are
both linoleyl. In some embodiments, R.sup.3 and R.sup.4 comprise at
least three sites of unsaturation and are independently selected
from, e.g., dodecatrienyl, tetradectrienyl, hexadecatrienyl,
linolenyl, and icosatrienyl.
[0089] The cationic lipids of Formula I and Formula II described
herein typically carry a net positive charge at a selected pH, such
as physiological pH. It has been surprisingly found that cationic
lipids comprising alkyl chains with multiple sites of unsaturation,
e.g., at least two or three sites of unsaturation, are particularly
useful for forming lipid-nucleic acid particles with increased
membrane fluidity. A number of cationic lipids and related analogs,
which are also useful in the present invention, have been described
in co-pending U.S. Ser. No. 08/316,399; U.S. Pat. Nos. 5,208,036,
5,264,618, 5,279,833 and 5,283,185, and WO 96/10390.
[0090] Additional suitable cationic lipids include, e.g.,
dioctadecyldimethylammonium ("DODMA"), Di stearyldimethylammonium
("DSDMA"), N,N-dioleyl-N,N-dimethylammonium chloride ("DODAC");
N-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride
("DOTMA"); N,N-distearyl-N,N-dimethylammonium bromide ("DDAB");
N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
("DOTAP"); 3-(N--(N',N'-dimethylaminoethane)-carbamoyl)cholesterol
("DC-Chol") and
N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium
bromide ("DMRIE"). A number of these lipids and related analogs,
which are also useful in the present invention, have been described
in U.S. Pat. Nos. 5,208,036, 5,264,618, 5,279,833, 5,283,185,
5,753,613 and 5,785,992.
[0091] B. Non-Cationic Lipids
[0092] The noncationic lipids used in the present invention can be
any of a variety of neutral uncharged, zwitterionic or anionic
lipids capable of producing a stable complex. They are preferably
neutral, although they can alternatively be positively or
negatively charged. Examples of noncationic lipids useful in the
present invention include: phospholipid-related materials, such as
lecithin, phosphatidylethanolamine, lysolecithin,
lysophosphatidylethanolamine, phosphatidylserine,
phosphatidylinositol, sphingomyelin, cephalin, cardiolipin,
phosphatidic acid, cerebrosides, di cetylphosphate, di
stearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine
(DOPC), dipalmitoylphosphatidylcholine (DPPC),
dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoyl-phosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE) and
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE). Noncationic
lipids or sterols such as cholesterol may be present. Additional
nonphosphorous containing lipids are, e.g., stearylamine,
dodecylamine, hexadecylamine, acetyl palmitate,
glycerolricinoleate, hexadecyl stereate, isopropyl myristate,
amphoteric acrylic polymers, triethanolamine-lauryl sulfate,
alkyl-aryl sulfate polyethyloxylated fatty acid amides,
dioctadecyldimethyl ammonium bromide and the like,
diacylphosphatidylcholine, diacylphosphatidylethanolamine,
ceramide, sphingomyelin, cephalin, and cerebrosides. Other lipids
such as lysophosphatidylcholine and lysophosphatidylethanolamine
may be present. Noncationic lipids also include polyethylene
glycol-based polymers such as PEG 2000, PEG 5000 and polyethylene
glycol conjugated to phospholipids or to ceramides (referred to as
PEG-Cer), as described in co-pending U.S. Ser. No. 08/316,429.
[0093] In preferred embodiments, the noncationic lipids are
diacylphosphatidylcholine (e.g., di stearoylphosphatidylcholine,
dioleoylphosphatidylcholine, dipalmitoylphosphatidylcholine and
dilinoleoylphosphatidylcholine), diacylphosphatidylethanolamine
(e.g., dioleoylphosphatidylethanolamine and
palmitoyloleoylphosphatidylethanolamine), ceramide or
sphingomyelin. The acyl groups in these lipids are preferably acyl
groups derived from fatty acids having C.sub.10-C.sub.24 carbon
chains. More preferably the acyl groups are lauroyl, myristoyl,
palmitoyl, stearoyl or oleoyl. In particularly preferred
embodiments, the noncationic lipid will be cholesterol,
1,2-sn-dioleoylphosphatidylethanolamine, or egg sphingomyelin
(ESM).
[0094] C. Bilayer Stabilizing Component
[0095] In addition to cationic and non-cationic lipids, the SPLPs
of the present invention comprise bilayer stabilizing component
(BSC) such as an ATTA-lipid or a PEG-lipid, such as PEG coupled to
dialkyloxypropyls (PEG-DAA) as described in, e.g., WO 05/026372,
PEG coupled to diacylglycerol (PEG-DAG) as described in, e.g., U.S.
Patent Publication Nos. 20030077829 and 2005008689), PEG coupled to
phosphatidylethanolamine (PE) (PEG-PE), or PEG conjugated to
ceramides, or a mixture thereof (see, U.S. Pat. No. 5,885,613). In
one preferred embodiment, the BSC is a conjugated lipid that
inhibits aggregation of the SPLPs. Suitable conjugated lipids
include, but are not limited to PEG-lipid conjugates, ATTA-lipid
conjugates, cationic-polymer-lipid conjugates (CPLs) or mixtures
thereof. In one preferred embodiment, the SPLPs comprise either a
PEG-lipid conjugate or an ATTA-lipid conjugate together with a
CPL.
[0096] PEG is a polyethylene glycol, a linear, water-soluble
polymer of ethylene PEG repeating units with two terminal hydroxyl
groups. PEGs are classified by their molecular weights; for
example, PEG 2000 has an average molecular weight of about 2,000
daltons, and PEG 5000 has an average molecular weight of about
5,000 daltons. PEGs are commercially available from Sigma Chemical
Co. and other companies and include, for example, the following:
monomethoxypolyethylene glycol (MePEG-OH), monomethoxypolyethylene
glycol-succinate (MePEG-S), monomethoxypolyethylene
glycol-succinimidyl succinate (MePEG-S--NHS),
monomethoxypolyethylene glycol-amine (MePEG-NH.sub.2),
monomethoxypolyethylene glycol-tresylate (MePEG-TRES), and
monomethoxypolyethylene glycol-imidazolyl-carbonyl (MePEG-IM). In
addition, monomethoxypolyethyleneglycol-acetic acid
(MePEG-CH.sub.2COOH), is particularly useful for preparing the
PEG-lipid conjugates including, e.g., PEG-DAA conjugates.
[0097] In a preferred embodiment, the PEG has an average molecular
weight of from about 550 daltons to about 10,000 daltons, more
preferably of about 750 daltons to about 5,000 daltons, more
preferably of about 1,000 daltons to about 5,000 daltons, more
preferably of about 1,500 daltons to about 3,000 daltons and, even
more preferably, of about 2,000 daltons, or about 750 daltons. The
PEG can be optionally substituted by an alkyl, alkoxy, acyl or aryl
group. PEG can be conjugated directly to the lipid or may be linked
to the lipid via a linker moiety. Any linker moiety suitable for
coupling the PEG to a lipid can be used including, e.g., non-ester
containing linker moieties and ester-containing linker moieties. In
a preferred embodiment, the linker moiety is a non-ester containing
linker moiety. As used herein, the term "non-ester containing
linker moiety" refers to a linker moiety that does not contain a
carboxylic ester bond (--OC(O)--). Suitable non-ester containing
linker moieties include, but are not limited to, amido
(--C(O)NH--), amino (--NR--), carbonyl (--C(O)--), carbamate
(--NHC(O)O--), urea (--NHC(O)NH--), disulphide (--S--S--), ether
(--O--), succinyl (--(O)CCH.sub.2CH.sub.2C(O)--), succinamidyl
(--NHC(O)CH.sub.2CH.sub.2C(O)NH--), ether, disulphide, etc. as well
as combinations thereof (such as a linker containing both a
carbamate linker moiety and an amido linker moiety). In a preferred
embodiment, a carbamate linker is used to couple the PEG to the
lipid.
[0098] In other embodiments, an ester containing linker moiety is
used to couple the PEG to the lipid. Suitable ester containing
linker moieties include, e.g., carbonate (--OC(O)O--), succinoyl,
phosphate esters (--O--(O)POH--O--), sulfonate esters, and
combinations thereof.
[0099] Phosphatidylethanolamines having a variety of acyl chain
groups of varying chain lengths and degrees of saturation can be
conjugated to polyethyleneglycol to form the bilayer stabilizing
component. Such phosphatidylethanolamines are commercially
available, or can be isolated or synthesized using conventional
techniques known to those of skilled in the art.
Phosphatidylethanolamines containing saturated or unsaturated fatty
acids with carbon chain lengths in the range of C.sub.10 to
C.sub.20 are preferred. Phosphatidylethanolamines with mono- or
diunsaturated fatty acids and mixtures of saturated and unsaturated
fatty acids can also be used. Suitable phosphatidylethanolamines
include, but are not limited to, the following:
dimyristoylphosphatidylethanolamine (DMPE),
dipalmitoylphosphatidylethanolamine (DPPE),
dioleoylphosphatidylethanolamine (DOPE) and di
stearoylphosphatidylethanolamine (DSPE).
[0100] The term "ATTA" or "polyamide" refers to, but is not limited
to, compounds disclosed in U.S. Pat. Nos. 6,320,017 and 6,586,559.
These compounds include a compound having the formula
##STR00006##
wherein: R is a member selected from the group consisting of
hydrogen, alkyl and acyl; R.sup.1 is a member selected from the
group consisting of hydrogen and alkyl; or optionally, R and
R.sup.1 and the nitrogen to which they are bound form an azido
moiety; R.sup.2 is a member of the group selected from hydrogen,
optionally substituted alkyl, optionally substituted aryl and a
side chain of an amino acid; R.sup.3 is a member selected from the
group consisting of hydrogen, halogen, hydroxy, alkoxy, mercapto,
hydrazino, amino and NR.sup.4R.sup.5, wherein R.sup.4 and R.sup.5
are independently hydrogen or alkyl; n is 4 to 80; m is 2 to 6; p
is 1 to 4; and q is 0 or 1. It will be apparent to those of skill
in the art that other polyamides can be used in the compounds of
the present invention.
[0101] The term "diacylglycerol" refers to a compound having
2-fatty acyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons bonded to the 1- and
2-position of glycerol by ester linkages. The acyl groups can be
saturated or have varying degrees of unsaturation. Diacylglycerols
have the following general formula:
##STR00007##
[0102] The term "dialkyloxypropyl" refers to a compound having
2-alkyl chains, R.sup.1 and R.sup.2, both of which have
independently between 2 and 30 carbons. The alkyl groups can be
saturated or have varying degrees of unsaturation.
Dialkyloxypropyls have the following general formula:
##STR00008##
[0103] In one preferred embodiment, the PEG-lipid is a PEG-DAA
conjugate has the following formula:
##STR00009##
[0104] In Formula VI, R.sup.1 and R.sup.2 are independently
selected and are long-chain alkyl groups having from about 10 to
about 22 carbon atoms. The long-chain alkyl groups can be saturated
or unsaturated. Suitable alkyl groups include, but are not limited
to, lauryl (C12), myristyl (C14), palmityl (C16), stearyl (C18) and
icosyl (C20). In preferred embodiments, R.sup.1 and R.sup.2 are the
same, i.e., R.sup.1 and R.sup.2 are both myristyl (i.e.,
dimyristyl), R.sup.1 and R.sup.2 are both stearyl (i.e.,
distearyl), etc.
[0105] In Formula VI above, "R.sup.1 and R.sup.2" are independently
selected and are alkyl groups having from about 10 to about 20
carbon atoms; PEG is a polyethyleneglycol; and L is a
non-ester-containing linker moiety as described above. Suitable
alkyl groups include, but are not limited to, lauryl (C12),
myristyl (C14), palmityl (C16), stearyl (C18) and icosyl (C20). In
a preferred embodiment; R.sup.1 and R.sup.2 are the same, i.e.,
they are both myristyl (C14) or both palmityl (C16) or both stearyl
(C18). In a preferred embodiment, the alkyl groups are
saturated.
[0106] In Formula VI above, "PEG" is a polyethylene glycol having
an average molecular weight ranging of about 550 daltons to about
10,000 daltons, more preferably of about 750 daltons to about 5,000
daltons, more preferably of about 1,000 daltons to about 5,000
daltons, more preferably of about 1,500 daltons to about 3,000
daltons and, even more preferably, of about 2,000 daltons, or about
750 daltons. The PEG can be optionally substituted with alkyl,
alkoxy, acyl or aryl. In a preferred embodiment, the terminal
hydroxyl group is substituted with a methoxy or methyl group.
[0107] In Formula VI, above, "L" is a non-ester containing linker
moiety or an ester containing linker moiety. In a preferred
embodiment, L is a non-ester containing linker moiety. Suitable
non-ester containing linkers include, but are not limited to, an
amido linker moiety, an amino linker moiety, a carbonyl linker
moiety, a carbamate linker moiety, a urea linker moiety, an ether
linker moiety, a disulphide linker moiety, a succinamidyl linker
moiety and combinations thereof. In a preferred embodiment, the
non-ester containing linker moiety is a carbamate linker moiety
(i.e., a PEG-C-DAA conjugate). In another preferred embodiment, the
non-ester containing linker moiety is an amido linker moiety (i.e.,
a PEG-A-DAA conjugate). In a preferred embodiment, the non-ester
containing linker moiety is a succinamidyl linker moiety (i.e., a
PEG-S-DAA conjugate).
[0108] The PEG-DAA conjugates are synthesized using standard
techniques and reagents known to those of skill in the art. It will
be recognized that the PEG-DAA conjugates will contain various
amide, amine, ether, thio, carbamate and urea linkages. T hose of
skill in the art will recognize that methods and reagents for
forming these bonds are well known and readily available. See,
e.g., March, ADVANCED ORGANIC CHEMISTRY (Wiley 1992), Larock,
COMPREHENSIVE ORGANIC TRANSFORMATIONS (VCH 1989); and Furniss,
VOGEL'S TEXTBOOK OF PRACTICAL ORGANIC CHEMISTRY 5th ed. (Longman
1989). It will also be appreciated that any functional groups
present may require protection and deprotection at different points
in the synthesis of the PEG-DAA conjugates. Those of skill in the
art will recognize that such techniques are well known. See, e.g.,
Green and Wuts, PROTECTIVE GROUPS IN ORGANIC SYNTHESIS (Wiley
1991).
[0109] In a presently preferred embodiment, the PEG-DAA conjugate
is a dilauryloxypropyl (C12)-PEG conjugate, dimyristyloxypropyl
(C14)-PEG conjugate, a dipalmitoyloxypropyl (C16)-PEG conjugate or
a disteryloxypropyl (C18)-PEG conjugate. Those of skill in the art
will readily appreciate that other dialkyloxypropyls can be used in
the PEG-DAA conjugates of the present invention.
[0110] In addition to the foregoing, it will be readily apparent to
those of skill in the art that other hydrophilic polymers can be
used in place of PEG. Examples of suitable polymers that can be
used in place of PEG include, but are not limited to,
polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline,
polyhydroxypropyl methacrylamide, polymethacrylamide and
polydimethylacrylamide, polylactic acid, polyglycolic acid, and
derivatized celluloses, such as hydroxymethylcellulose or
hydroxyethylcellulose.
[0111] In addition to the foregoing components, the SNALPs and
SPLPs of the present invention can further comprise cationic
poly(ethylene glycol) (PEG) lipids, or CPLs, that have been
designed for insertion into lipid bilayers to impart a positive
charge (see, Chen, et al., Bioconj. Chem. 11:433-437 (2000)).
Suitable SPLPs and SPLP-CPLs for use in the present invention, and
methods of making and using SPLPs and SPLP-CPLs, are disclosed,
e.g., in U.S. Pat. No. 6,852,334 and WO 00/62813. Cationic polymer
lipids (CPLs) useful in the present invention have the following
architectural features: (1) a lipid anchor, such as a hydrophobic
lipid, for incorporating the CPLs into the lipid bilayer; (2) a
hydrophilic spacer, such as a polyethylene glycol, for linking the
lipid anchor to a cationic head group; and (3) a polycationic
moiety, such as a naturally occurring amino acid, to produce a
protonizable cationic head group.
[0112] Suitable CPL include compounds of Formula VII:
A-W--Y (VII)
wherein A, W and Y are as described below.
[0113] With reference to Formula VII, "A" is a lipid moiety such as
an amphipathic lipid, a neutral lipid or a hydrophobic lipid that
acts as a lipid anchor. Suitable lipid examples include
vesicle-forming lipids or vesicle adopting lipids and include, but
are not limited to, diacylglycerolyls, dialkylglycerolyls,
N--N-dialkylaminos, 1,2-diacyloxy-3-aminopropanes and
1,2-dialkyl-3-aminopropanes.
[0114] "W" is a polymer or an oligomer, such as a hydrophilic
polymer or oligomer. Preferably, the hydrophilic polymer is a
biocompatable polymer that is nonimmunogenic or possesses low
inherent immunogenicity. Alternatively, the hydrophilic polymer can
be weakly antigenic if used with appropriate adjuvants. Suitable
nonimmunogenic polymers include, but are not limited to, PEG,
polyamides, polylactic acid, polyglycolic acid, polylactic
acid/polyglycolic acid copolymers and combinations thereof. In a
preferred embodiment, the polymer has a molecular weight of about
250 to about 7000 daltons.
[0115] "Y" is a polycationic moiety. The term polycationic moiety
refers to a compound, derivative, or functional group having a
positive charge, preferably at least 2 positive charges at a
selected pH, preferably physiological pH. Suitable polycationic
moieties include basic amino acids and their derivatives such as
arginine, asparagine, glutamine, lysine and histidine; spermine;
spermidine; cationic dendrimers; polyamines; polyamine sugars; and
amino polysaccharides. The polycationic moieties can be linear,
such as linear tetralysine, branched or dendrimeric in structure.
Polycationic moieties have between about 2 to about 15 positive
charges, preferably between about 2 to about 12 positive charges,
and more preferably between about 2 to about 8 positive charges at
selected pH values. The selection of which polycationic moiety to
employ may be determined by the type of liposome application which
is desired.
[0116] The charges on the polycationic moieties can be either
distributed around the entire liposome moiety, or alternatively,
they can be a discrete concentration of charge density in one
particular area of the liposome moiety e.g., a charge spike. If the
charge density is distributed on the liposome, the charge density
can be equally distributed or unequally distributed. All variations
of charge distribution of the polycationic moiety are encompassed
by the present invention.
[0117] The lipid "A," and the nonimmunogenic polymer "W," can be
attached by various methods and preferably, by covalent attachment.
Methods known to those of skill in the art can be used for the
covalent attachment of "A" and "W." Suitable linkages include, but
are not limited to, amide, amine, carboxyl, carbonate, carbamate,
ester and hydrazone linkages. It will be apparent to those skilled
in the art that "A" and "W" must have complementary functional
groups to effectuate the linkage. The reaction of these two groups,
one on the lipid and the other on the polymer, will provide the
desired linkage. For example, when the lipid is a diacylglycerol
and the terminal hydroxyl is activated, for instance with NHS and
DCC, to form an active ester, and is then reacted with a polymer
which contains an amino group, such as with a polyamide (see, U.S.
Pat. Nos. 6,320,017 and 6,586,559), an amide bond will form between
the two groups.
[0118] In certain instances, the polycationic moiety can have a
ligand attached, such as a targeting ligand or a chelating moiety
for complexing calcium. Preferably, after the ligand is attached,
the cationic moiety maintains a positive charge. In certain
instances, the ligand that is attached has a positive charge.
Suitable ligands include, but are not limited to, a compound or
device with a reactive functional group and include lipids,
amphipathic lipids, carrier compounds, bioaffinity compounds,
biomaterials, biopolymers, biomedical devices, analytically
detectable compounds, therapeutically active compounds, enzymes,
peptides, proteins, antibodies, immune stimulators, radiolabels,
fluorogens, biotin, drugs, haptens, DNA, RNA, polysaccharides,
liposomes, virosomes, micelles, immunoglobulins, functional groups,
other targeting moieties, or toxins.
[0119] D. Nucleic Acid Component
[0120] The nucleic acid component of the present invention
comprises an interfering RNA that silences (e.g., partially or
completely inhibits) expression of a gene of interest. An
interfering RNA can be provided in several forms. For example an
interfering RNA can be provided as one or more isolated
small-interfering RNA (siRNA) duplexes, longer double-stranded RNA
(dsRNA) or as siRNA or dsRNA transcribed from a transcriptional
cassette in a DNA plasmid. The interfering RNA can be administered
alone or in combination with the administration of conventional
agents used to treat the disease or disorder associated with the
gene of interest. Genes of interest include, but are not limited
to, genes associated with viral infection and survival, genes
associated with liver and kidney diseases and disorders, genes
associated with tumorigenesis and cell transformation, angiogenic
genes, immunomodulator genes, such as those associated with
inflammatory and autoimmune responses, ligand receptor genes, and
genes associated with neurodegenerative disorders.
[0121] 1. Selecting siRNA sequences
[0122] Suitable siRNA sequences can be identified using any means
known in the art. Typically, the methods described in Elbashir, et
al., Nature 411:494-498 (2001) and Elbashir, et al., EMBO J 20:
6877-6888 (2001) are combined with rational design rules set forth
in Reynolds et al., Nature Biotech. 22(3):326-330 (2004).
[0123] Typically, the sequence within about 50 to about 100
nucleotides 3' of the AUG start codon of a transcript from the
target gene of interest is scanned for dinucleotide sequences
(e.g., AA, CC, GG, or UU) (see, e.g., Elbashir, et al., EMBO J 20:
6877-6888 (2001)). The nucleotides immediately 3' to the
dinucleotide sequences are identified as potential siRNA target
sequences. Typically, the 19, 21, 23, 25, 27, 29, 31, 33, 35 or
more nucleotides immediately 3' to the dinucleotide sequences are
identified as potential siRNA target sites. In some embodiments,
the dinucleotide sequence is an AA sequence and the 19 nucleotides
immediately 3' to the AA dinucleotide are identified as a potential
siRNA target site. Typically siRNA target sites are spaced at
different positions along the length of the target gene. To further
enhance silencing efficiency of the siRNA sequences, potential
siRNA target sites may be further analyzed to identify sites that
do not contain regions of homology to other coding sequences. For
example, a suitable siRNA target site of about 21 base pairs
typically will not have more than 16-17 contiguous base pairs of
homology to other coding sequences. If the siRNA sequences are to
be expressed from an RNA Pol III promoter, siRNA target sequences
lacking more than 4 contiguous A's or T's are selected.
[0124] Once the potential siRNA target site has been identified
siRNA sequences complementary to the siRNA target sites may be
designed. To enhance their silencing efficiency, the siRNA
sequences may also be analyzed by a rational design algorithm to
identify sequences that have one or more of the following features:
(1) G/C content of about 25% to about 60% G/C; (2) at least 3 A/Us
at positions 15-19 of the sense strand; (3) no internal repeats;
(4) an A at position 19 of the sense strand; (5) an A at position 3
of the sense strand; (6) a U at position 10 of the sense strand;
(7) no G/C at position 19 of the sense strand; and (8) no G at
position 13 of the sense strand. siRNA design tools that
incorporate algorithms that assign suitable values of each of these
features and are useful for selection of siRNA can be found at,
e.g., http://boz094.ust.hk/RNAUsiRNA.
[0125] In some embodiments, once a potential siRNA sequence has
been identified, the sequence is analyzed for the presence or
absence of immunostimulatory motifs (e.g., GU-rich motifs) as
described in, e.g., co-pending U.S. Provisional Patent Application
Nos. 60/585,301, filed Jul. 2, 2004; 60/589,363, filed Jul. 19,
2004; 60/627,326, filed Nov. 12, 2004; and 60/665,297, filed Mar.
25, 2005. Once identified, the immunostimulatory siRNA molecules
can be modified to increase or decrease their immunostimulatory
properties and the non-immunostimulatory molecules can be modified
so that they possess immunostimulatory properties
[0126] 2. Generating siRNA
[0127] siRNA can be provided in several forms including, e.g., as
one or more isolated small-interfering RNA (siRNA) duplexes, longer
double-stranded RNA (dsRNA) or as siRNA or dsRNA transcribed from a
transcriptional cassette in a DNA plasmid. siRNA may also be
chemically synthesized. Preferably, the synthesized or transcribed
siRNA have 3' overhangs of about 1-4 nucleotides, preferably of
about 2-3 nucleotides and 5' phosphate termini. The siRNA sequences
may have overhangs (e.g., 3' or 5' overhangs as described in
(Elbashir, et al., Genes Dev. 15:188 (2001); Nykanen, et al., Cell
107:309 (2001)) or may lack overhangs (i.e., to have blunt
ends).
[0128] An RNA population can be used to provide long precursor
RNAs, or long precursor RNAs that have substantial or complete
identity to a selected target sequence can be used to make the
siRNA. The RNAs can be isolated from cells or tissue, synthesized,
and/or cloned according to methods well known to those of skill in
the art. The RNA can be a mixed population (obtained from cells or
tissue, transcribed from cDNA, subtracted, selected, etc.), or can
represent a single target sequence. RNA can be naturally occurring
(e.g., isolated from tissue or cell samples), synthesized in vitro
(e.g., using T7 or SP6 polymerase and PCR products or a cloned
cDNA); or chemically synthesized.
[0129] To form a long dsRNA, for synthetic RNAs, the complement is
also transcribed in vitro and hybridized to form a dsRNA. If a
naturally occurring RNA population is used, the RNA complements are
also provided (e.g., to form dsRNA for digestion by E. coli RNAse
III or Dicer), e.g., by transcribing cDNAs corresponding to the RNA
population, or by using RNA polymerases. The precursor RNAs are
then hybridized to form double stranded RNAs for digestion. The
dsRNAs can be directly administered to a subject or can be digested
in vitro prior to administration.
[0130] Alternatively, one or more DNA plasmids encoding one or more
siRNA templates are used to provide siRNA. siRNA can be transcribed
as sequences that automatically fold into duplexes with hairpin
loops from DNA templates in plasmids having RNA polymerase III
transcriptional units, for example, based on the naturally
occurring transcription units for small nuclear RNA U6 or human
RNase P RNA H1 (see, Brummelkamp, et al., Science 296:550 (2002);
Donze, et al., Nucleic Acids Res. 30:e46 (2002); Paddison, et al.,
Genes Dev. 16:948 (2002); Yu, et al., Proc. Natl. Acad. Sci.
99:6047 (2002); Lee, et al., Nat. Biotech. 20:500 (2002);
Miyagishi, et al., Nat. Biotech. 20:497 (2002); Paul, et al., Nat.
Biotech. 20:505 (2002); and Sui, et al., Proc. Natl. Acad. Sci.
99:5515 (2002)). Typically, a transcriptional unit or cassette will
contain an RNA transcript promoter sequence, such as an H1-RNA or a
U6 promoter, operably linked to a template for transcription of a
desired siRNA sequence and a termination sequence, comprised of 2-3
uridine residues and a polythymidine (T5) sequence (polyadenylation
signal) (Brummelkamp, Science, supra). The selected promoter can
provide for constitutive or inducible transcription. Compositions
and methods for DNA-directed transcription of RNA interference
molecules is described in detail in U.S. Pat. No. 6,573,099. The
transcriptional unit is incorporated into a plasmid or DNA vector
from which the interfering RNA is transcribed. Plasmids suitable
for in vivo delivery of genetic material for therapeutic purposes
are described in detail in U.S. Pat. Nos. 5,962,428 and 5,910,488.
The selected plasmid can provide for transient or stable delivery
of a target cell. It will be apparent to those of skill in the art
that plasmids originally designed to express desired gene sequences
can be modified to contain a transcriptional unit cassette for
transcription of siRNA.
[0131] Methods for isolating RNA, synthesizing RNA, hybridizing
nucleic acids, making and screening cDNA libraries, and performing
PCR are well known in the art (see, e.g., Gubler & Hoffman,
Gene 25:263-269 (1983); Sambrook et al., supra; Ausubel et al.,
supra), as are PCR methods (see U.S. Pat. Nos. 4,683,195 and
4,683,202; PCR Protocols: A Guide to Methods and Applications
(Innis et al., eds, 1990)). Expression libraries are also well
known to those of skill in the art. Additional basic texts
disclosing the general methods of use in this invention include
Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed.
1989); Kriegler, Gene Transfer and Expression: A Laboratory Manual
(1990); and Current Protocols in Molecular Biology (Ausubel et al.,
eds., 1994)).
[0132] A suitable plasmid is engineered to contain, in expressible
form, a template sequence that encodes a partial length sequence or
an entire length sequence of a gene product of interest. Template
sequences can also be used for providing isolated or synthesized
siRNA and dsRNA. Generally, it is desired to downregulate or
silence the transcription and translation of a gene product of
interest.
[0133] 3. Genes of Interest
[0134] Genes of interest include, but are not limited to, genes
associated with viral infection and survival, genes associated with
metabolic diseases and disorders (e.g., liver diseases and
disorders), genes associated with tumorigenesis and cell
transformation, angiogenic genes, immunomodulator genes, such as
those associated with inflammatory and autoimmune responses, ligand
receptor genes, and genes associated with neurodegenerative
disorders.
[0135] a) Genes Associated with Viral Infection and Survival
[0136] Genes associated with viral infection and survival include
those expressed by a virus in order to bind, enter and replicate in
a cell. Of particular interest are viral sequences associated with
chronic viral diseases. Viral sequences of particular interest
include sequences of Hepatitis viruses (Hamasaki, et al., FEBS
Lett. 543:51 (2003); Yokota, et al., EMBO Rep. 4:602 (2003);
Schlomai, et al., Hepatology 37:764 (2003); Wilson, et al., Proc.
Natl. Acad. Sci. 100:2783 (2003); Kapadia, et al., Proc. Natl.
Acad. Sci. 100:2014 (2003); and FIELDS VIROLOGY (Knipe et al. eds.
2001)), Human Immunodeficiency Virus (HIV) (Banerj ea, et al., Mol.
Ther. 8:62 (2003); Song, et al., J Virol. 77:7174 (2003);
Stephenson JAMA 289:1494 (2003); Qin, et al., Proc. Natl. Acad.
Sci. 100:183 (2003)), Herpes viruses (Jia, et al., J. Virol.
77:3301 (2003)), and Human Papilloma Viruses (HPV) (Hall, et al., J
Virol. 77:6066 (2003); Jiang, et al., Oncogene 21:6041 (2002)).
Examplary hepatitis viral nucleic acid sequences that can be
silenced include, but are not limited to: nucleic acid sequences
involved in transcription and translation (e.g., En1, En2, X, P),
nucleic acid sequences encoding structural proteins (e.g., core
proteins including C and C-related proteins; capsid and envelope
proteins including S, M, and/or L proteins, or fragments thereof)
(see, e.g., FIELDS VIROLOGY, 2001, supra). Exemplary Hepatits C
nucleic acid sequences that can be silenced include, but are not
limited to: serine proteases (e.g., NS3/NS4), helicases (e.g. NS3),
polymerases (e.g., NS5B), and envelope proteins (e.g., E1, E2, and
p7). Hepatitis A nucleic acid sequences are set forth in e.g.,
Genbank Accession No. NC_001489; Hepatitis B nucleic acid sequences
are set forth in, e.g., Genbank Accession No. NC_003977; Hepatitis
C nucleic acid sequences are set forth in, e.g., Genbank Accession
No. NC_004102; Hepatitis D nucleic acid sequence are set forth in,
e.g., Genbank Accession No. NC_001653; Hepatitis E nucleic acid
sequences are set forth in e.g., Genbank Accession No. NC_001434;
and Hepatitis G nucleic acid sequences are set forth in e.g.,
Genbank Accession No. NC_001710.
[0137] b) Genes Associated with Metabolic Diseases and
Disorders
[0138] Genes associated with metabolic diseases and disorders
(e.g., disorders in which the liver is the target and liver
diseases and disorders) include, for example genes expressed in,
for example, dyslipidemia (e.g., liver X receptors (e.g.,
LXR.alpha. and LXR.beta. Genback Accession No. NM_007121),
farnesoid X receptors (FXR) (Genbank Accession No. NM_005123),
sterol-regulatory element binding protein (SREBP), Site-1 protease
(SIP), 3-hydroxy-3-methylglutaryl coenzyme-A reductase (HMG
coenzyme-A reductase), Apolipoprotein (ApoB), and Apolipoprotein
(ApoE)) and diabetes (e.g., Glucose 6-phosphatase) (see, e.g.,
Forman et al., Cell 81:687 (1995); Seol et al., Mol. Endocrinol.
9:72 (1995), Zavacki et al., PNAS USA 94:7909 (1997); Sakai, et
al., Cell 85:1037-1046 (1996); Duncan, et al., J. Biol. Chem.
272:12778-12785 (1997); Willy, et al., Genes Dev. 9(9):1033-45
(1995); Lehmann, et al., J. Biol. Chem. 272(6):3137-3140 (1997);
Janowski, et al., Nature 383:728-731 (1996); Peet, et al., Cell
93:693-704 (1998)). One of skill in the art will appreciate that
genes associated with metabolic diseases and disorders (e.g.,
diseases and disorders in which the liver is a target and liver
diseases and disorders) include genes that are expressed in the
liver itself as well as and genes expressed in other organs and
tissues.
[0139] c) Genes Associated with Tumorigenesis
[0140] Examples of gene sequences associated with tumorigenesis and
cell transformation include translocation sequences such as MLL
fusion genes, BCR-ABL (Wilda, et al., Oncogene, 21:5716 (2002);
Scherr, et al., Blood 101:1566), TEL-AML1, EWS-FLI1, TLS-FUS,
PAX3-FKHR, BCL-2, AML1-ETO and AML1-MTG8 (Heidenreich, et al.,
Blood 101:3157 (2003)); overexpressed sequences such as multidrug
resistance genes (Nieth, et al., FEBS Lett. 545:144 (2003); Wu, et
al, Cancer Res. 63:1515 (2003)), cyclins (Li, et al., Cancer Res.
63:3593 (2003); Zou, et al., Genes Dev. 16:2923 (2002)),
beta-Catenin (Verma, et al., Clin Cancer Res. 9:1291 (2003)),
telomerase genes (Kosciolek, et al., Mol Cancer Ther. 2:209
(2003)), c-MYC, N-MYC, BCL-2, ERBB1 and ERBB2 (Nagy, et al. Exp.
Cell Res. 285:39 (2003)); and mutated sequences such as RAS
(reviewed in Tuschl and Borkhardt, Mol. Interventions, 2:158
(2002)). For example, silencing of sequences that encode DNA repair
enzymes find use in combination with the administration of
chemotherapeutic agents (Collis, et al., Cancer Res. 63:1550
(2003)). Genes encoding proteins associated with tumor migration
are also target sequences of interest, for example, integrins,
selectins and metalloproteinases. The foregoing examples are not
exclusive. Any whole or partial gene sequence that facilitates or
promotes tumorigenesis or cell transformation, tumor growth or
tumor migration can be included as a gene sequence of interest.
[0141] d) Angiogenic/Anti-Angiogenic Genes
[0142] Angiogenic genes are able to promote the formation of new
vessels. Of particular interest is Vascular Endothelial Growth
Factor (VEGF) (Reich, et al., Mol. Vis. 9:210 (2003)) or VEGFr.
siRNA sequences that target VEGFr are set forth in, e.g., GB
2396864; U.S. Patent Publication No. 20040142895; and
CA2456444.
[0143] Anti-angiogenic genes are able to inhibit
neovascularization. These genes are particularly useful for
treating those cancers in which angiogenesis plays a role in the
pathological development of the disease. Examples of
anti-angiogenic genes include, but are not limited to, endostatin
(see e.g., U.S. Pat. No. 6,174,861), angiostatin (see, e.g., U.S.
Pat. No. 5,639,725), and VEGF-R2 (see e.g., Decaussin et al. (1999)
J. Pathol. 188(4): 369-737).
[0144] e) Immonomodulator Genes
[0145] Immunomodulator genes are genes that modulate one or more
immune responses. Examples of immunomodulator genes include
cytokines such as growth factors (e.g., TGF-.alpha.,
TGF-.quadrature..beta., EGF, FGF, IGF, NGF, PDGF, CGF, GM-CSF, SCF,
etc.), interleukins (e.g., IL-2, IL-3, IL-4, IL-6, IL-7, IL-10,
IL-12, IL-15, IL-20, etc.), interferons (e.g., IFN-.alpha.,
IFN-.beta., IFN-.gamma., etc.), TNF (e.g., TNF-.alpha.), and
Flt3-Ligand. Fas and Fas Ligand genes are also immunomodulator
target sequences of interest (Song, et al., Nat. Med. 9:347
(2003)). Genes encoding secondary signaling molecules in
hematopoietic and lymphoid cells are also included in the present
invention, for example, Tec family kinases, such as Bruton's
tyrosine kinase (Btk) (Heinonen, et al., FEBS Lett. 527:274
(2002)).
[0146] f) Cell Receptor Ligands
[0147] Cell receptor ligands include ligands that are able to bind
to cell surface receptors (e.g., insulin receptor, EPO receptor,
G-protein coupled receptors, receptors with tyrosine kinase
activity, cytokine receptors, growth factor receptors, etc.), to
modulate (e.g, inhibit, activate, etc.) the physiological pathway
that the receptor is involved in (e.g., glucose level modulation,
blood cell development, mitogenesis, etc.). Examples of cell
receptor ligands include cytokines, growth factors, interleukins,
interferons, erythropoietin (EPO), insulin, glucagon, G-protein
coupled receptor ligands, etc.). Templates coding for an expansion
of trinucleotide repeats (e.g., CAG repeats), find use in silencing
pathogenic sequences in neurodegenerative disorders caused by the
expansion of trinucleotide repeats, such as spinobulbular muscular
atrophy and Huntington's Disease (Caplen, et al., Hum. Mol. Genet.
11:175 (2002)).
[0148] g) Tumor Suppressor Genes
[0149] Tumor suppressor genes are genes that are able to inhibit
the growth of a cell, particularly tumor cells. Thus, delivery of
these genes to tumor cells is useful in the treatment of cancers.
Tumor suppressor genes include, but are not limited to, p53 (Lamb
et al., Mol. Cell. Biol. 6:1379-1385 (1986), Ewen et al., Science
255:85-87 (1992), Ewen et al. (1991) Cell 66:1155-1164, and Hu et
al., EMBO J. 9:1147-1155 (1990)), RB1 (Toguchida et al. (1993)
Genomics 17:535-543), WT1 (Hastie, N. D., Curr. Opin. Genet. Dev.
3:408-413 (1993)), NF1 (Trofatter et al., Cell 72:791-800 (1993),
Cawthon et al., Cell 62:193-201 (1990)), VEIL (Latif et al.,
Science 260:1317-1320 (1993)), APC (Gorden et al., Cell 66:589-600
(1991)), DAP kinase (see e.g., Diess et al. (1995) Genes Dev. 9:
15-30), p16 (see e.g., Marx (1994) Science 264(5167): 1846), ARF
(see e.g., Quelle et al. (1995) Cell 83(6): 993-1000),
Neurofibromin (see e.g., Huynh et al. (1992) Neurosci. Lett.
143(1-2): 233-236), and PTEN (see e.g., Li et al. (1997) Science
275(5308): 1943-1947).
III. Preparation of SNALPS
[0150] The present invention provides a method of preparing
serum-stable nucleic acid-lipid particles in which the plasmid or
other nucleic acid is encapsulated in a lipid bilayer and is
protected from degradation. The particles made by the methods of
this invention typically have a size of about 50 nm to about 150
nm, more typically about 100 nm to about 130 nm, most typically
about 110 nm to about 115 nm. The particles can be formed by any
method known in the art including, but not limited to: a continuous
mixing method, a detergent dialysis method, or a modification of a
reverse-phase method which utilizes organic solvents to provide a
single phase during mixing of the components.
[0151] In preferred embodiments, the cationic lipids are lipids of
Formula I and II or combinations thereof. In other preferred
embodiments, the noncationic lipids are ESM, DOPE, DOPC, DPPE,
DMPE, 16:0 Monomethyl Phosphatidylethanolamine, 16:0 Dimethyl
Phosphatidylethanolamine, 18:1 Trans Phosphatidylethanolamine, 18:0
18:1 Phosphatidylethanolamine (SOPE), 16:0 18:1
Phosphatidylethanolamine, DSPE, polyethylene glycol-based polymers
(e.g., PEG 2000, PEG 5000, PEG-modified diacylglycerols, or
PEG-modified dialkyloxypropyls), di stearoylphosphatidylcholine
(DSPC), cholesterol, or combinations thereof. In still other
preferred embodiments, the organic solvents are methanol,
chloroform, methylene chloride, ethanol, diethyl ether or
combinations thereof.
[0152] In a particularly preferred embodiment, the nucleic acid is
a plasmid; the cationic lipid is a lipid of Formula I or II or
combinations thereof; the noncationic lipid is ESM, DOPE, PEG-DAAs,
distearoylphosphatidylcholine (DSPC), cholesterol, or combinations
thereof (e.g. DSPC and PEG-DAAs); and the organic solvent is
methanol, chloroform, methylene chloride, ethanol, diethyl ether or
combinations thereof.
[0153] In a particularly preferred embodiment, the present
invention provides for nucleic acid-lipid particles produced via a
continuous mixing method, e.g., process that includes providing an
aqueous solution comprising a nucleic acid such as an siRNA or a
plasmid, in a first reservoir, and providing an organic lipid
solution in a second reservoir, and mixing the aqueous solution
with the organic lipid solution such that the organic lipid
solution mixes with the aqueous solution so as to substantially
instantaneously produce a liposome encapsulating the nucleic acid
(e.g., siRNA). This process and the apparatus for carrying this
process is described in detail in U.S. Patent Publication No.
20040142025.
[0154] The action of continuously introducing lipid and buffer
solutions into a mixing environment, such as in a mixing chamber,
causes a continuous dilution of the lipid solution with the buffer
solution, thereby producing a liposome substantially
instantaneously upon mixing. As used herein, the phrase
"continuously diluting a lipid solution with a buffer solution"
(and variations) generally means that the lipid solution is diluted
sufficiently rapidly in a hydration process with sufficient force
to effectuate vesicle generation. By mixing the aqueous solution
comprising a nucleic acid with the organic lipid solution, the
organic lipid solution undergoes a continuous stepwise dilution in
the presence of the buffer solution (i.e., aqueous solution) to
produce a nucleic acid-lipid particle.
[0155] The serum-stable nucleic acid-lipid particles formed using
the continuous mixing method typically have a size of from about 50
nm to about 150 nm, more typically about 100 nm to about 130 nm,
most typically about 110 nm to about 115 nm. The particles thus
formed do not aggregate and are optionally sized to achieve a
uniform particle size.
[0156] In some embodiments, the particles are formed using
detergent dialysis. Without intending to be bound by any particular
mechanism of formation, a plasmid or other nucleic acid (e.g.,
siRNA) is contacted with a detergent solution of cationic lipids to
form a coated nucleic acid complex. These coated nucleic acids can
aggregate and precipitate. However, the presence of a detergent
reduces this aggregation and allows the coated nucleic acids to
react with excess lipids (typically, non-cationic lipids) to form
particles in which the plasmid or other nucleic acid is
encapsulated in a lipid bilayer. Thus, the present invention
provides a method for the preparation of serum-stable nucleic
acid-lipid particles, comprising: [0157] (a) combining a nucleic
acid with cationic lipids in a detergent solution to form a coated
nucleic acid-lipid complex; [0158] (b) contacting non-cationic
lipids with the coated nucleic acid-lipid complex to form a
detergent solution comprising a nucleic acid-lipid complex and
non-cationic lipids; and [0159] (c) dialyzing the detergent
solution of step (b) to provide a solution of serum-stable nucleic
acid-lipid particles, wherein the nucleic acid is encapsulated in a
lipid bilayer and the particles are serum-stable and have a size of
from about 50 to about 150 nm.
[0160] An initial solution of coated nucleic acid-lipid complexes
is formed by combining the nucleic acid with the cationic lipids in
a detergent solution.
[0161] In these embodiments, the detergent solution is preferably
an aqueous solution of a neutral detergent having a critical
micelle concentration of 15-300 mM, more preferably 20-50 mM.
Examples of suitable detergents include, for example,
N,N'-((octanoylimino)-bis-(trimethylene))-bis-(D-gluconamide)
(BIGCHAP); BRIJ 35; Deoxy-BIGCHAP; dodecylpoly(ethylene glycol)
ether; Tween 20; Tween 40; Tween 60; Tween 80; Tween 85; Mega 8;
Mega 9; Zwittergent.RTM. 3-08; Zwittergent.RTM. 3-10; Triton X-405;
hexyl-, heptyl-, octyl- and nonyl-.beta.-D-glucopyranoside; and
heptylthioglucopyranoside; with octyl .beta.-D-glucopyranoside and
Tween-20 being the most preferred. The concentration of detergent
in the detergent solution is typically about 100 mM to about 2 M,
preferably from about 200 mM to about 1.5 M.
[0162] The cationic lipids and nucleic acids will typically be
combined to produce a charge ratio (+/-) of about 1:1 to about
20:1, preferably in a ratio of about 1:1 to about 12:1, and more
preferably in a ratio of about 2:1 to about 6:1. Additionally, the
overall concentration of nucleic acid in solution will typically be
from about 25 .mu.g/mL to about 1 mg/mL, preferably from about 25
.mu.g/mL to about 200 .mu.g/mL, and more preferably from about 50
.mu.g/mL to about 100 .mu.g/mL. The combination of nucleic acids
and cationic lipids in detergent solution is kept, typically at
room temperature, for a period of time which is sufficient for the
coated complexes to form. Alternatively, the nucleic acids and
cationic lipids can be combined in the detergent solution and
warmed to temperatures of up to about 37.degree. C. For nucleic
acids which are particularly sensitive to temperature, the coated
complexes can be formed at lower temperatures, typically down to
about 4.degree. C.
[0163] In a preferred embodiment, the nucleic acid to lipid ratios
(mass/mass ratios) in a formed nucleic acid-lipid particle will
range from about 0.01 to about 0.08. The ratio of the starting
materials also falls within this range because the purification
step typically removes the unencapsulated nucleic acid as well as
the empty liposomes. In another preferred embodiment, the nucleic
acid-lipid particle preparation uses about 400 .mu.g nucleic acid
per 10 mg total lipid or a nucleic acid to lipid ratio of about
0.01 to about 0.08 and, more preferably, about 0.04, which
corresponds to 1.25 mg of total lipid per 50 .mu.g of nucleic
acid.
[0164] The detergent solution of the coated nucleic acid-lipid
complexes is then contacted with non-cationic lipids to provide a
detergent solution of nucleic acid-lipid complexes and non-cationic
lipids. The non-cationic lipids which are useful in this step
include, diacylphosphatidylcholine, diacylphosphatidylethanolamine,
ceramide, sphingomyelin, cephalin, cardiolipin, and cerebrosides.
In preferred embodiments, the non-cationic lipids are
diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide
or sphingomyelin. The acyl groups in these lipids are preferably
acyl groups derived from fatty acids having C.sub.10-C.sub.24
carbon chains. More preferably the acyl groups are lauroyl,
myristoyl, palmitoyl, stearoyl or oleoyl. In particularly preferred
embodiments, the non-cationic lipid will be
1,2-sn-dioleoylphosphatidyl ethanolamine (DOPE), palmitoyl oleoyl
phosphatidylcholine (POPC), egg phosphatidylcholine (EPC),
distearoylphosphatidylcholine (DSPC), cholesterol, or a mixture
thereof. In the most preferred embodiments, the nucleic acid-lipid
particles will be fusogenic particles with enhanced properties in
vivo and the non-cationic lipid will be DSPC or DOPE. In addition,
the nucleic acid-lipid particles of the present invention may
further comprise cholesterol. In other preferred embodiments, the
non-cationic lipids will further comprise polyethylene glycol-based
polymers such as PEG 2000, PEG 5000 and polyethylene glycol
conjugated to a diacylglycerol, a ceramide or a phospholipid, as
described in U.S. Pat. No. 5,820,873 and U.S. Patent Publication
No. 20030077829. In further preferred embodiments, the non-cationic
lipids will further comprise polyethylene glycol-based polymers
such as PEG 2000, PEG 5000 and polyethylene glycol conjugated to a
dialkyloxypropyl.
[0165] The amount of non-cationic lipid which is used in the
present methods is typically about 2 to about 20 mg of total lipids
to 50 .mu.g of nucleic acid. Preferably the amount of total lipid
is from about 5 to about 10 mg per 50 .mu.g of nucleic acid.
[0166] Following formation of the detergent solution of nucleic
acid-lipid complexes and non-cationic lipids, the detergent is
removed, preferably by dialysis. The removal of the detergent
results in the formation of a lipid-bilayer which surrounds the
nucleic acid providing serum-stable nucleic acid-lipid particles
which have a size of from about 50 nm to about 150 nm, more
typically about 100 nm to about 130 nm, most typically about 110 nm
to about 115 nm. The particles thus formed do not aggregate and are
optionally sized to achieve a uniform particle size.
[0167] The serum-stable nucleic acid-lipid particles can be sized
by any of the methods available for sizing liposomes. The sizing
may be conducted in order to achieve a desired size range and
relatively narrow distribution of particle sizes.
[0168] Several techniques are available for sizing the particles to
a desired size. One sizing method, used for liposomes and equally
applicable to the present particles is described in U.S. Pat. No.
4,737,323. Sonicating a particle suspension either by bath or probe
sonication produces a progressive size reduction down to particles
of less than about 50 nm in size. Homogenization is another method
which relies on shearing energy to fragment larger particles into
smaller ones. In a typical homogenization procedure, particles are
recirculated through a standard emulsion homogenizer until selected
particle sizes, typically between about 60 and 80 nm, are observed.
In both methods, the particle size distribution can be monitored by
conventional laser-beam particle size discrimination, or QELS.
[0169] Extrusion of the particles through a small-pore
polycarbonate membrane or an asymmetric ceramic membrane is also an
effective method for reducing particle sizes to a relatively
well-defined size distribution. Typically, the suspension is cycled
through the membrane one or more times until the desired particle
size distribution is achieved. The particles may be extruded
through successively smaller-pore membranes, to achieve a gradual
reduction in size.
[0170] In another group of embodiments, the present invention
provides a method for the preparation of serum-stable nucleic
acid-lipid particles, comprising: [0171] (a) preparing a mixture
comprising cationic lipids and non-cationic lipids in an organic
solvent; [0172] (b) contacting an aqueous solution of nucleic acid
with said mixture in step (a) to provide a clear single phase; and
[0173] (c) removing said organic solvent to provide a suspension of
nucleic acid-lipid particles, wherein said nucleic acid is
encapsulated in a lipid bilayer, and said particles are stable in
serum and have a size of from about 50 to about 150 nm.
[0174] The nucleic acids (or plasmids), cationic lipids and
non-cationic lipids which are useful in this group of embodiments
are as described for the detergent dialysis methods above.
[0175] The selection of an organic solvent will typically involve
consideration of solvent polarity and the ease with which the
solvent can be removed at the later stages of particle formation.
The organic solvent, which is also used as a solubilizing agent, is
in an amount sufficient to provide a clear single phase mixture of
nucleic acid and lipids. Suitable solvents include, but are not
limited to, chloroform, dichloromethane, diethylether, cyclohexane,
cyclopentane, benzene, toluene, methanol, or other aliphatic
alcohols such as propanol, isopropanol, butanol, tert-butanol,
iso-butanol, pentanol and hexanol. Combinations of two or more
solvents may also be used in the present invention.
[0176] Contacting the nucleic acid with the organic solution of
cationic and non-cationic lipids is accomplished by mixing together
a first solution of nucleic acid, which is typically an aqueous
solution, and a second organic solution of the lipids. One of skill
in the art will understand that this mixing can take place by any
number of methods, for example by mechanical means such as by using
vortex mixers.
[0177] After the nucleic acid has been contacted with the organic
solution of lipids, the organic solvent is removed, thus forming an
aqueous suspension of serum-stable nucleic acid-lipid particles.
The methods used to remove the organic solvent will typically
involve evaporation at reduced pressures or blowing a stream of
inert gas (e.g., nitrogen or argon) across the mixture.
[0178] The serum-stable nucleic acid-lipid particles thus formed
will typically be sized from about 50 nm to about 150 nm, more
typically about 100 nm to about 130 nm, most typically about 110 nm
to about 115 nm. To achieve further size reduction or homogeneity
of size in the particles, sizing can be conducted as described
above.
[0179] In other embodiments, the methods will further comprise
adding nonlipid polycations which are useful to effect the delivery
to cells using the present compositions. Examples of suitable
nonlipid polycations include, but are limited to, hexadimethrine
bromide (sold under the brandname POLYBRENE.RTM., from Aldrich
Chemical Co., Milwaukee, Wis., USA) or other salts of
heaxadimethrine. Other suitable polycations include, for example,
salts of poly-L-ornithine, poly-L-arginine, poly-L-lysine,
poly-D-lysine, polyallylamine and polyethyleneimine.
[0180] In certain embodiments, the formation of the nucleic
acid-lipid particles can be carried out either in a mono-phase
system (e.g., a Bligh and Dyer monophase or similar mixture of
aqueous and organic solvents) or in a two-phase system with
suitable mixing.
[0181] When formation of the complexes is carried out in a
mono-phase system, the cationic lipids and nucleic acids are each
dissolved in a volume of the mono-phase mixture. Combination of the
two solutions provides a single mixture in which the complexes
form. Alternatively, the complexes can form in two-phase mixtures
in which the cationic lipids bind to the nucleic acid (which is
present in the aqueous phase), and "pull" it into the organic
phase.
[0182] In another embodiment, the present invention provides a
method for the preparation of nucleic acid-lipid particles,
comprising: [0183] (a) contacting nucleic acids with a solution
comprising non-cationic lipids and a detergent to form a nucleic
acid-lipid mixture; [0184] (b) contacting cationic lipids with the
nucleic acid-lipid mixture to neutralize a portion of the negative
charge of the nucleic acids and form a charge-neutralized mixture
of nucleic acids and lipids; and [0185] (c) removing the detergent
from the charge-neutralized mixture to provide the nucleic
acid-lipid particles in which the nucleic acids are protected from
degradation.
[0186] In one group of embodiments, the solution of non-cationic
lipids and detergent is an aqueous solution. Contacting the nucleic
acids with the solution of non-cationic lipids and detergent is
typically accomplished by mixing together a first solution of
nucleic acids and a second solution of the lipids and detergent.
One of skill in the art will understand that this mixing can take
place by any number of methods, for example, by mechanical means
such as by using vortex mixers. Preferably, the nucleic acid
solution is also a detergent solution. The amount of non-cationic
lipid which is used in the present method is typically determined
based on the amount of cationic lipid used, and is typically of
from about 0.2 to 5 times the amount of cationic lipid, preferably
from about 0.5 to about 2 times the amount of cationic lipid
used.
[0187] In some embodiments, the nucleic acids are precondensed as
described in, e.g., U.S. patent application Ser. No.
09/744,103.
[0188] The nucleic acid-lipid mixture thus formed is contacted with
cationic lipids to neutralize a portion of the negative charge
which is associated with the nucleic acids (or other polyanionic
materials) present. The amount of cationic lipids used will
typically be sufficient to neutralize at least 50% of the negative
charge of the nucleic acid. Preferably, the negative charge will be
at least 70% neutralized, more preferably at least 90% neutralized.
Cationic lipids which are useful in the present invention, include,
for example, DLinDMA and, DLenDMA. These lipids and related analogs
have been described in U.S. Provisional Patent Application Nos.
60/578,075, filed Jun. 7, 2004; 60/610,746, filed Sep. 17, 2004;
and 60/679,427, filed May 9, 2005.
[0189] Contacting the cationic lipids with the nucleic acid-lipid
mixture can be accomplished by any of a number of techniques,
preferably by mixing together a solution of the cationic lipid and
a solution containing the nucleic acid-lipid mixture. Upon mixing
the two solutions (or contacting in any other manner), a portion of
the negative charge associated with the nucleic acid is
neutralized. Nevertheless, the nucleic acid remains in an
uncondensed state and acquires hydrophilic characteristics.
[0190] After the cationic lipids have been contacted with the
nucleic acid-lipid mixture, the detergent (or combination of
detergent and organic solvent) is removed, thus forming the nucleic
acid-lipid particles. The methods used to remove the detergent will
typically involve dialysis. When organic solvents are present,
removal is typically accomplished by evaporation at reduced
pressures or by blowing a stream of inert gas (e.g., nitrogen or
argon) across the mixture.
[0191] The particles thus formed will typically be sized from about
50 nm to several microns, more typically about 50 nm to about 150
nm, even more typically about 100 nm to about 130 nm, most
typically about 110 nm to about 115 nm. To achieve further size
reduction or homogeneity of size in the particles, the nucleic
acid-lipid particles can be sonicated, filtered or subjected to
other sizing techniques which are used in liposomal formulations
and are known to those of skill in the art.
[0192] In other embodiments, the methods will further comprise
adding nonlipid polycations which are useful to effect the
lipofection of cells using the present compositions. Examples of
suitable nonlipid polycations include, hexadimethrine bromide (sold
under the brandname POLYBRENE.RTM., from Aldrich Chemical Co.,
Milwaukee, Wis., USA) or other salts of hexadimethrine. Other
suitable polycations include, for example, salts of
poly-L-ornithine, poly-L-arginine, poly-L-lysine, poly-D-lysine,
polyallylamine and polyethyleneimine. Addition of these salts is
preferably after the particles have been formed.
[0193] In another aspect, the present invention provides methods
for the preparation of nucleic acid-lipid particles, comprising:
[0194] (a) contacting an amount of cationic lipids with nucleic
acids in a solution; the solution comprising from about 15-35%
water and about 65-85% organic solvent and the amount of cationic
lipids being sufficient to produce a +/-charge ratio of from about
0.85 to about 2.0, to provide a hydrophobic nucleic acid-lipid
complex; [0195] (b) contacting the hydrophobic, nucleic acid-lipid
complex in solution with non-cationic lipids, to provide a nucleic
acid-lipid mixture; and [0196] (c) removing the organic solvents
from the nucleic acid-lipid mixture to provide nucleic acid-lipid
particles in which the nucleic acids are protected from
degradation.
[0197] The nucleic acids, non-cationic lipids, cationic lipids and
organic solvents which are useful in this aspect of the invention
are the same as those described for the methods above which used
detergents. In one group of embodiments, the solution of step (a)
is a mono-phase. In another group of embodiments, the solution of
step (a) is two-phase.
[0198] In preferred embodiments, the non-cationic lipids are ESM,
DOPE, DOPC, polyethylene glycol-based polymers (e.g., PEG 2000, PEG
5000, PEG-modified diacylglycerols, or PEG-modified
dialkyloxypropyls), distearoylphosphatidylcholine (DSPC), DPPE,
DMPE, 16:0 Monomethyl Phosphatidylethanolamine, 16:0 Dimethyl
Phosphatidylethanolamine, 18:1 Trans Phosphatidylethanolamine, 18:0
18:1 Phosphatidylethanolamine (SOPE), 16:0 18:1
Phosphatidylethanolamine, DSPE, cholesterol, or combinations
thereof. In still other preferred embodiments, the organic solvents
are methanol, chloroform, methylene chloride, ethanol, diethyl
ether or combinations thereof.
[0199] In one embodiment, the nucleic acid is a plasmid from which
an interfering RNA is transcribed; the cationic lipid is DLindMA,
DLenDMA, DODAC, DDAB, DOTMA, DOSPA, DMRIE, DOGS or combinations
thereof; the non-cationic lipid is ESM, DOPE, DAG-PEGs,
distearoylphosphatidylcholine (DSPC), DPPE, DMPE, 16:0 Monomethyl
Phosphatidylethanolamine, 16:0 Dimethyl Phosphatidylethanolamine,
18:1 Trans Phosphatidylethanolamine, 18:0 18:1
Phosphatidylethanolamine (SOPE), 16:0 18:1 Phosphatidylethanolamine
DSPE, cholesterol, or combinations thereof (e.g. DSPC and PEG-DAA);
and the organic solvent is methanol, chloroform, methylene
chloride, ethanol, diethyl ether or combinations thereof.
[0200] As above, contacting the nucleic acids with the cationic
lipids is typically accomplished by mixing together a first
solution of nucleic acids and a second solution of the lipids,
preferably by mechanical means such as by using vortex mixers. The
resulting mixture contains complexes as described above. These
complexes are then converted to particles by the addition of
non-cationic lipids and the removal of the organic solvent. The
addition of the non-cationic lipids is typically accomplished by
simply adding a solution of the non-cationic lipids to the mixture
containing the complexes. A reverse addition can also be used.
Subsequent removal of organic solvents can be accomplished by
methods known to those of skill in the art and also described
above.
[0201] The amount of non-cationic lipids which is used in this
aspect of the invention is typically an amount of from about 0.2 to
about 15 times the amount (on a mole basis) of cationic lipids
which was used to provide the charge-neutralized nucleic acid-lipid
complex. Preferably, the amount is from about 0.5 to about 9 times
the amount of cationic lipids used.
[0202] In yet another aspect, the present invention provides
nucleic acid-lipid particles which are prepared by the methods
described above. In these embodiments, the nucleic acid-lipid
particles are either net charge neutral or carry an overall charge
which provides the particles with greater gene lipofection
activity. Preferably, the nucleic acid component of the particles
is a nucleic acid which interferes with the production of an
undesired protein. In a preferred embodiment, the nucleic acid
comprises an interfering RNA, the non-cationic lipid is egg
sphingomyelin and the cationic lipid is DLinDMA or DLenDMA. In a
preferred embodiment, the nucleic acid comprises an interfering
RNA, the non-cationic lipid is a mixture of DSPC and cholesterol,
and the cationic lipid is DLinDMA or DLenDMA. In other preferred
embodiments, the non-cationic lipid may further comprise
cholesterol.
[0203] A variety of general methods for making SNALP-CPLs
(CPL-containing SNALPs) are discussed herein. Two general
techniques include "post-insertion" technique, that is, insertion
of a CPL into for example, a pre-formed SNALP, and the "standard"
technique, wherein the CPL is included in the lipid mixture during
for example, the SNALP formation steps. The post-insertion
technique results in SNALPs having CPLs mainly in the external face
of the SNALP bilayer membrane, whereas standard techniques provide
SNALPs having CPLs on both internal and external faces. The method
is especially useful for vesicles made from phospholipids (which
can contain cholesterol) and also for vesicles containing
PEG-lipids (such as PEG-DAAs and PEG-DAGs). Methods of making
SNALP-CPL, are taught, for example, in U.S. Pat. Nos. 5,705,385,
6,586,410, 5,981,501 6,534,484; 6,852,334; U.S. Patent Publication
No. 20020072121; and WO 00/62813.
IV. Administration of Nucleic Acid-Lipid Particle Formulations
[0204] Once formed, the serum-stable nucleic acid-lipid particles
of the present invention are useful for the introduction of nucleic
acids into cells. Accordingly, the present invention also provides
methods for introducing a nucleic acids (e.g., a plasmid or and
siRNA) into a cell. The methods are carried out in vitro or in vivo
by first forming the particles as described above and then
contacting the particles with the cells for a period of time
sufficient for delivery of the nucleic acid to the cell to
occur.
[0205] The nucleic acid-lipid particles of the present invention
can be adsorbed to almost any cell type with which they are mixed
or contacted. Once adsorbed, the particles can either be
endocytosed by a portion of the cells, exchange lipids with cell
membranes, or fuse with the cells. Transfer or incorporation of the
nucleic acid portion of the particle can take place via any one of
these pathways. In particular, when fusion takes place, the
particle membrane is integrated into the cell membrane and the
contents of the particle combine with the intracellular fluid.
[0206] The nucleic acid-lipid particles of the present invention
can be administered either alone or in mixture with a
physiologically-acceptable carrier (such as physiological saline or
phosphate buffer) selected in accordance with the route of
administration and standard pharmaceutical practice. Generally,
normal saline will be employed as the pharmaceutically acceptable
carrier. Other suitable carriers include, e.g., water, buffered
water, 0.4% saline, 0.3% glycine, and the like, including
glycoproteins for enhanced stability, such as albumin, lipoprotein,
globulin, etc.
[0207] The pharmaceutical carrier is generally added following
particle formation. Thus, after the particle is formed, the
particle can be diluted into pharmaceutically acceptable carriers
such as normal saline.
[0208] The concentration of particles in the pharmaceutical
formulations can vary widely, i.e., from less than about 0.05%,
usually at or at least about 2-5% to as much as 10 to 30% by weight
and will be selected primarily by fluid volumes, viscosities, etc.,
in accordance with the particular mode of administration selected.
For example, the concentration may be increased to lower the fluid
load associated with treatment. This may be particularly desirable
in patients having atherosclerosis-associated congestive heart
failure or severe hypertension. Alternatively, particles composed
of irritating lipids may be diluted to low concentrations to lessen
inflammation at the site of administration.
[0209] The pharmaceutical compositions of the present invention may
be sterilized by conventional, well known sterilization techniques.
Aqueous solutions can be packaged for use or filtered under aseptic
conditions and lyophilized, the lyophilized preparation being
combined with a sterile aqueous solution prior to administration.
The compositions can contain pharmaceutically acceptable auxiliary
substances as required to approximate physiological conditions,
such as pH adjusting and buffering agents, tonicity adjusting
agents and the like, for example, sodium acetate, sodium lactate,
sodium chloride, potassium chloride, and calcium chloride.
Additionally, the particle suspension may include lipid-protective
agents which protect lipids against free-radical and
lipid-peroxidative damages on storage. Lipophilic free-radical
quenchers, such as alphatocopherol and water-soluble iron-specific
chelators, such as ferrioxamine, are suitable.
[0210] The nucleic acid-lipid particles can be incorporated into a
broad range of topical dosage forms including, but not limited to,
gels, oils, emulsions, topical creams, pastes, ointments, lotions
and the like.
[0211] A. In Vivo Administration
[0212] Systemic delivery for in vivo gene therapy, i.e., delivery
of a therapeutic nucleic acid to a distal target cell via body
systems such as the circulation, has been achieved using nucleic
acid-lipid particles such as those disclosed in WO 96/40964, U.S.
Pat. Nos. 5,705,385, 5,976,567, 5,981,501, and 6,410,328. This
latter format provides a fully encapsulated nucleic acid-lipid
particle that protects the nucleic acid from nuclease degradation
in serum, is nonimmunogenic, is small in size and is suitable for
repeat dosing.
[0213] For in vivo administration, administration can be in any
manner known in the art, e.g., by injection, oral administration,
inhalation, transdermal application, or rectal administration.
Administration can be accomplished via single or divided doses. The
pharmaceutical compositions are preferably administered
parenterally, i.e., intraarticularly, intravenously,
intraperitoneally, subcutaneously, or intramuscularly. More
preferably, the pharmaceutical compositions are administered
intravenously or intraperitoneally by a bolus injection (see, e.g.,
Stadler, et al., U.S. Pat. No. 5,286,634). Intracellular nucleic
acid delivery has also been discussed in Straubringer, et al.,
Methods Enzymol, Academic Press, New York. 101:512 (1983); Mannino,
et al., Biotechniques 6:682 (1988); Nicolau, et al., Crit. Rev.
Ther. Drug Carrier Syst. 6:239 (1989), and Behr, Acc. Chem. Res.
26:274 (1993). Still other methods of administering lipid based
therapeutics are described in, for example, Rahman et al., U.S.
Pat. No. 3,993,754; Sears, U.S. Pat. No. 4,145,410; Papahadjopoulos
et al., U.S. Pat. No. 4,235,871; Schneider, U.S. Pat. No.
4,224,179; Lenk et al., U.S. Pat. No. 4,522,803; and Fountain et
al., U.S. Pat. No. 4,588,578. The lipid nucleic acid particles can
be administered by direct injection at the site of disease or by
injection at a site distal from the site of disease (see, e.g.,
Culver, HUMAN GENE THERAPY, MaryAnn Liebert, Inc., Publishers, New
York. pp. 70-71(1994)).
[0214] The compositions of the present invention, either alone or
in combination with other suitable components, can be made into
aerosol formulations (i.e., they can be "nebulized") to be
administered via inhalation (see, Brigham, et al., Am. J. Sci.
298(4):278 (1989)). Aerosol formulations can be placed into
pressurized acceptable propellants, such as
dichlorodifluoromethane, propane, nitrogen, and the like.
[0215] Formulations suitable for parenteral administration, such
as, for example, by intraarticular (in the joints), intravenous,
intramuscular, intradermal, intraperitoneal, and subcutaneous
routes, include aqueous and non-aqueous, isotonic sterile injection
solutions, which can contain antioxidants, buffers, bacteriostats,
and solutes that render the formulation isotonic with the blood of
the intended recipient, and aqueous and non-aqueous sterile
suspensions that can include suspending agents, solubilizers,
thickening agents, stabilizers, and preservatives. In the practice
of this invention, compositions can be administered, for example,
by intravenous infusion, orally, topically, intraperitoneally,
intravesically or intrathecally.
[0216] Formulations suitable for oral administration can consist of
(a) liquid solutions, such as an effective amount of the packaged
nucleic acid suspended in diluents, such as water, saline or PEG
400; (b) capsules, sachets or tablets, each containing a
predetermined amount of the active ingredient, as liquids, solids,
granules or gelatin; (c) suspensions in an appropriate liquid; and
(d) suitable emulsions. Tablet forms can include one or more of
lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn
starch, potato starch, microcrystalline cellulose, gelatin,
colloidal silicon dioxide, talc, magnesium stearate, stearic acid,
and other excipients, colorants, fillers, binders, diluents,
buffering agents, moistening agents, preservatives, flavoring
agents, dyes, disintegrating agents, and pharmaceutically
compatible carriers. Lozenge forms can comprise the active
ingredient in a flavor, e.g., sucrose, as well as pastilles
comprising the active ingredient in an inert base, such as gelatin
and glycerin or sucrose and acacia emulsions, gels, and the like
containing, in addition to the active ingredient, carriers known in
the art.
[0217] Generally, when administered intravenously, the nucleic
acid-lipid formulations are formulated with a suitable
pharmaceutical carrier. Many pharmaceutically acceptable carriers
may be employed in the compositions and methods of the present
invention. Suitable formulations for use in the present invention
are found, for example, in REMINGTON'S PHARMACEUTICAL SCIENCES,
Mack Publishing Company, Philadelphia, Pa., 17th ed. (1985). A
variety of aqueous carriers may be used, for example, water,
buffered water, 0.4% saline, 0.3% glycine, and the like, and may
include glycoproteins for enhanced stability, such as albumin,
lipoprotein, globulin, etc. Generally, normal buffered saline
(135-150 mM NaCl) will be employed as the pharmaceutically
acceptable carrier, but other suitable carriers will suffice. These
compositions can be sterilized by conventional liposomal
sterilization techniques, such as filtration. The compositions may
contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions, such as pH
adjusting and buffering agents, tonicity adjusting agents, wetting
agents and the like, for example, sodium acetate, sodium lactate,
sodium chloride, potassium chloride, calcium chloride, sorbitan
monolaurate, triethanolamine oleate, etc. These compositions can be
sterilized using the techniques referred to above or,
alternatively, they can be produced under sterile conditions. The
resulting aqueous solutions may be packaged for use or filtered
under aseptic conditions and lyophilized, the lyophilized
preparation being combined with a sterile aqueous solution prior to
administration.
[0218] When preparing pharmaceutical preparations of the nucleic
acid-lipid particles of the invention, it is preferable to use
quantities of the particles which have been purified to reduce or
eliminate empty particles or particles with nucleic acid associated
with the external surface.
[0219] The methods of the present invention may be practiced in a
variety of hosts. Preferred hosts include mammalian species, such
as avian (e.g., ducks), primates (e.g., humans and chimpanzees as
well as other nonhuman primates), canines, felines, equines,
bovines, ovines, caprines, rodents (e.g., rats and mice),
lagomorphs, and swine.
[0220] The amount of particles administered will depend upon the
ratio of nucleic acid to lipid; the particular nucleic acid used,
the disease state being diagnosed; the age, weight, and condition
of the patient and the judgment of the clinician; but will
generally be between about 0.01 and about 50 mg per kilogram of
body weight; preferably between about 0.1 and about 5 mg/kg of body
weight or about 10.sup.8-10.sup.10 particles per injection.
[0221] B. Cells for Delivery of Interfering RNA
[0222] The compositions and methods of the present invention are
used to treat a wide variety of cell types, in vivo and in vitro.
Stuitable cells include, e.g., hematopoietic precursor (stem)
cells, fibroblasts, keratinocytes, hepatocytes, endothelial cells,
skeletal and smooth muscle cells, osteoblasts, neurons, quiescent
lymphocytes, terminally differentiated cells, slow or noncycling
primary cells, parenchymal cells, lymphoid cells, epithelial cells,
bone cells, and the like.
[0223] In vivo delivery of nucleic acid lipid particles
encapsulating an interfering RNA is particularly suited for
targeting tumor cells of any cell type. In vivo studies show that
SNALP's accumulate at tumor sites and predominantly transfect tumor
cells. See, Fenske, et al., Methods Enzymol, Academic Press, New
York 346:36 (2002). The methods and compositions can be employed
with cells of a wide variety of vertebrates, including mammals, and
especially those of veterinary importance, e.g, canine, feline,
equine, bovine, ovine, caprine, rodent, lagomorph, swine, etc., in
addition to human cell populations.
[0224] To the extent that tissue culture of cells may be required,
it is well known in the art. Freshney (1994) (Culture of Animal
Cells, a Manual of Basic Technique, third edition Wiley-Liss, New
York), Kuchler et al. (1977) Biochemical Methods in Cell Culture
and Virology, Kuchler, R. J., Dowden, Hutchinson and Ross, Inc.,
and the references cited therein provides a general guide to the
culture of cells. Cultured cell systems often will be in the form
of monolayers of cells, although cell suspensions are also
used.
[0225] C. Detection of SNALPs
[0226] In some embodiments, the nucleic acid-lipid particles are
detectable in the subject 8, 12, 24, 48, 60, 72, or 96 hours after
administration of the particles. The presence of the particles can
be detected in the cells, tissues, or other biological samples from
the subject. The particles by be detacted, e.g., by direct
detection of the particles, detection of the interfering RNA
sequence, detection of the target sequence of interest (i.e., by
detecting expression or reduced expression of the sequence of
interest), or a combination thereof.
[0227] 1. Detection of Particles
[0228] Nucleic acid-lipid particles are detected herein using any
methods known in the art. For example, a label can be coupled
directly or indirectly to a component of the SNALP or other
lipid-based carrier system using methods well known in the art. A
wide variety of labels can be used, with the choice of label
depending on sensitivity required, ease of conjugation with the
SNALP component, stability requirements, and available
instrumentation and disposal provisions. Suitable labels include,
but are not limited to, spectral labels, such as fluorescent dyes
(e.g., fluorescein and derivatives, such as fluorescein
isothiocyanate (FITC) and Oregon Green.TM.; rhodamine and
derivatives, such Texas red, tetrarhodimine isothiocynate (TRITC),
etc., digoxigenin, biotin, phycoerythrin, AMCA, CyDyes.TM., and the
like; radiolabels, such as .sup.3H, .sup.125I, .sup.35S, .sup.14C,
.sup.32P, .sup.33P, etc.; enzymes, such as horse radish peroxidase,
alkaline phosphatase, etc.; spectral colorimetric labels, such as
colloidal gold or colored glass or plastic beads, such as
polystyrene, polypropylene, latex, etc. The label can be detected
using any means known in the art.
[0229] 2. Detection of Nucleic Acids
[0230] Nucleic acids are detected and quantified herein by any of a
number of means well known to those of skill in the art. The
detection of nucleic acids proceeds by well known methods such as
Southern analysis, northern analysis, gel electrophoresis, PCR,
radiolabeling, scintillation counting, and affinity chromatography.
Additional analytic biochemical methods such as spectrophotometry,
radiography, electrophoresis, capillary electrophoresis, high
performance liquid chromatography (HPLC), thin layer chromatography
(TLC), hyperdiffusion chromatography, may also be employed
[0231] The selection of a nucleic acid hybridization format is not
critical. A variety of nucleic acid hybridization formats are known
to those skilled in the art. For example, common formats include
sandwich assays and competition or displacement assays.
Hybridization techniques are generally described in "Nucleic Acid
Hybridization, A Practical Approach," Ed. Hames, B. D. and Higgins,
S. J., IRL Press, 1985.
[0232] The sensitivity of the hybridization assays may be enhanced
through use of a nucleic acid amplification system which multiplies
the target nucleic acid being detected. In vitro amplification
techniques suitable for amplifying sequences for use as molecular
probes or for generating nucleic acid fragments for subsequent
subcloning are known. Examples of techniques sufficient to direct
persons of skill through such in vitro amplification methods,
including the polymerase chain reaction (PCR) the ligase chain
reaction (LCR), Q.beta.-replicase amplification and other RNA
polymerase mediated techniques (e.g., NASBA.TM.) are found in
Sambrook, et al., In Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press, 2000, and Ausubel et al., SHORT
PROTOCOLS IN MOLECULAR BIOLOGY, eds., Current Protocols, a joint
venture between Greene Publishing Associates, Inc. and John Wiley
& Sons, Inc., (2002), as well as Mullis et al. (1987), U.S.
Pat. No. 4,683,202; PCR Protocols A Guide to Methods and
Applications (Innis et al. eds) Academic Press Inc. San Diego,
Calif. (1990) (Innis); Arnheim & Levinson (Oct. 1, 1990),
C&EN 36; The Journal Of NIH Research, 3:81 (1991); (Kwoh et
al., Proc. Natl. Acad. Sci. USA, 86:1173 (1989); Guatelli et al.,
Proc. Natl. Acad. Sci. USA, 87:1874 (1990); Lomell et al., J. Clin.
Chem., 35:1826 (1989); Landegren et al., Science, 241:1077 (1988);
Van Brunt, Biotechnology, 8:291 (1990); Wu and Wallace, Gene, 4:560
(1989); Barringer et al., Gene, 89:117 (1990), and Sooknanan and
Malek, Biotechnology, 13:563 (1995). Improved methods of cloning in
vitro amplified nucleic acids are described in Wallace et al., U.S.
Pat. No. 5,426,039. Other methods described in the art are the
nucleic acid sequence based amplification (NASBA.TM., Cangene,
Mississauga, Ontario) and Q Beta Replicase systems. These systems
can be used to directly identify mutants where the PCR or LCR
primers are designed to be extended or ligated only when a select
sequence is present. Alternatively, the select sequences can be
generally amplified using, for example, nonspecific PCR primers and
the amplified target region later probed for a specific sequence
indicative of a mutation.
[0233] Oligonucleotides for use as probes, e.g., in in vitro
amplification methods, for use as gene probes, or as inhibitor
components are typically synthesized chemically according to the
solid phase phosphoramidite triester method described by Beaucage
and Caruthers, Tetrahedron Letts., 22(20):1859 1862 (1981), e.g.,
using an automated synthesizer, as described in Needham VanDevanter
et al., Nucleic Acids Res., 12:6159 (1984). Purification of
oligonucleotides, where necessary, is typically performed by either
native acrylamide gel electrophoresis or by anion exchange HPLC as
described in Pearson and Regnier, J. Chrom., 255:137 149 (1983).
The sequence of the synthetic oligonucleotides can be verified
using the chemical degradation method of Maxam and Gilbert (1980)
in Grossman and Moldave (eds.) Academic Press, New York, Methods in
Enzymology, 65:499.
[0234] An alternative means for determining the level of
transcription is in situ hybridization. In situ hybridization
assays are well known and are generally described in Angerer et
al., Methods Enzymol., 152:649 (1987). In an in situ hybridization
assay cells are fixed to a solid support, typically a glass slide.
If DNA is to be probed, the cells are denatured with heat or
alkali. The cells are then contacted with a hybridization solution
at a moderate temperature to permit annealing of specific probes
that are labeled. The probes are preferably labeled with
radioisotopes or fluorescent reporters.
[0235] D. Transfection Efficiency
[0236] The transfection efficiency of the nucleic acid-lipid
particles described herein can be optimized using an ERP assay. For
example, the ERP assay can be used to disinguish the effect of
various cationic lipids, non-cationic lipids, and bilayer
stabilizing components of the SNALPs based on their relative effect
on binding/uptake or fusion with/destabilization of the endosomal
membrane. This assay allows one to determine quantitatively how
each component of the SNALPs affects transfection efficacy, thereby
optimizing the SNALPs. As explained herein, the Endosomal Release
Parameter or, alternatively, ERP is defined as:
[0237] Reporter Gene Expression/Cell
[0238] SNALP Uptake/Cell
[0239] It will be readily apparent to those of skill in the art
that any reporter gene (e.g., luciferase, .beta.-galactosidase,
green fluorescent protein, etc.) can be used. In addition, the
lipid component (or, alternatively, any component of the SNALP or
lipid-based formulation) can be labeled with any detectable label
provided the does inhibit or interfere with uptake into the cell.
Using the ERP assay of the present invention, one of skill in the
art can assess the impact of the various lipid components (e.g.,
cationic lipid of Formula I or II, non-cationic lipid, PEG-lipid
derivative, PEG-DAA conjugate, ATTA-lipid derivative, calcium,
CPLs, cholesterol, etc.) on cell uptake and transfection
efficiencies, thereby optimizing the SPLP or other lipid-based
carrier system. By comparing the ERPs for each of the various SPLPs
or other lipid-based formulations, one can readily determine the
optimized system, e.g., the SPLP or other lipid-based formulation
that has the greatest uptake in the cell coupled with the greatest
transfection efficiency.
[0240] Suitable labels for carrying out the ERP assay of the
present invention include, but are not limited to, spectral labels,
such as fluorescent dyes (e.g., fluorescein and derivatives, such
as fluorescein isothiocyanate (FITC) and Oregon
Green.sup..differential.; rhodamine and derivatives, such Texas
red, tetrarhodimine isothiocynate (TRITC), etc., digoxigenin,
biotin, phycoerythrin, AMCA, CyDyes.sup..differential., and the
like; radiolabels, such as .sup.3H, .sup.125I, .sup.35S, .sup.14C,
.sup.32P, .sup.33P, etc.; enzymes, such as horse radish peroxidase,
alkaline phosphatase, etc.; spectral colorimetric labels, such as
colloidal gold or colored glass or plastic beads, such as
polystyrene, polypropylene, latex, etc. The label can be coupled
directly or indirectly to a component of the SNALP using methods
well known in the art. As indicated above, a wide variety of labels
can be used, with the choice of label depending on sensitivity
required, ease of conjugation with the SNALP component, stability
requirements, and available instrumentation and disposal
provisions.
[0241] The invention will be described in greater detail by way of
specific examples. The following examples are offered for
illustrative purposes, and are not intended to limit the invention
in any manner. Those of skill in the art will readily recognize a
variety of noncritical parameters which can be changed or modified
to yield essentially the same results.
EXAMPLES
[0242] The following examples are offered to illustrate, but not to
limit the claimed invention.
Example 1: Materials and Methods
[0243] Materials:
[0244] DPPS, 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC) and
cholesterol were purchased from Avanti Polar Lipids (Alabaster,
Ala.). TNS was obtained from Sigma-Aldrich Canada (Oakville, ON).
RiboGreen was obtained from Molecular Probes (Eugene, Oreg.). The
alkyl mesylates were purchased from Nu-Chek Prep, Inc. (Elysian,
Minn., USA). siRNA (anti-luciferase and mismatch control) was
purchased from Dharmacon (Lafayette, Colo., USA). The
anti-luciferase sense sequence was 5'-GAUUAUGUCCGGUUAUGUAUU-3' (SEQ
ID NO:1). The anti-luciferase antisense sequence was
5'-UACAUAACCGGACAUAAUCUU-3' (SEQ ID NO:2). All other chemicals were
purchased from Sigma-Aldrich (Oakville, ON, Canada).
[0245] Synthesis of DSDMA and DODMA:
[0246] DSDMA and DODMA were synthesized using the respective alkyl
bromides with methodology derived from that of a DOTMA precursor
(Feigner et al, PNAS USA, 84, 7413-7417 (1987)).
3-(Dimethylamino)-1,2-propanediol (714 mg, 6 mmol) and 95% sodium
hydride (NaH, 1.26 g, 50 mmol) were stirred in benzene (30 mL)
under argon for 30 minutes. The correct (either oleyl or stearyl)
alkyl bromide (5.0 g, 15 mmol) was added and the reaction refluxed
under argon for 18 hours. The reaction mixture was then cooled in
an ice bath while quenching via the slow addition of ethanol.
Following dilution with a further 150 mL of benzene, the mixture
was washed with distilled water (2.times.150 mL) and brine (150
mL), using ethanol (.about.20 mL) to aid phase separation if
necessary. The organic phase was dried over magnesium sulphate and
evaporated. The crude product was purified on a silica gel (Kiesel
Gel 60) column eluted with chloroform containing 0-5% methanol.
Column fractions were analyzed by thin layer chromatography (TLC)
(silica gel, chloroform/methanol 9:1 v/v, visualized with
molybdate) and fractions containing pure product (R.sub.f=0.5) were
pooled and concentrated. The product was decolorized by stirring
for 30 minutes in a suspension of activated charcoal (1 g) in
ethanol (75 mL) at 60.degree. C. The charcoal was removed by
filtration through Celite, and the ethanol solution concentrated to
typically yield 2.4 g (65%) of pure product. .sup.1H-NMR (DSDMA):
.delta..sub.H 3.65-3.32 (m, 7H, OCH, 3.times.OCH.sub.2), 2.45-2.31
(m, 2H, NCH.sub.2), 2.27 (s, 6H, 2.times.NCH.sub.3), 1.61-1.45 (m,
4H, OCH.sub.2CH.sub.2), 1.40-1.17 (m, 60H, H.sub.stearyl), 0.86 (t,
6H, CH.sub.2CH.sub.3). .sup.1H-NMR (DODMA): .delta..sub.H 5.4-5.27
(m, 4H, 2.times.CH.dbd.CH), 3.65-3.35 (m, 7H, OCH,
3.times.OCH.sub.2), 2.47-2.33 (m, 2H, NCH.sub.2), 2.28 (s, 6H,
2.times.NCH.sub.3), 2.06-1.94 (m, 8H, 4.times.CH.sub.2CH.dbd.CH),
1.61-1.50 (m, 4H, OCH.sub.2CH.sub.2), 1.38-1.20 (m, 48H,
H.sub.oleyl), 0.88 (t, 6H, CH.sub.2CH.sub.3).
Synthesis of 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA)
and 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA)
[0247] 3-(Dimethylamino)-1,2-propanediol (714 mg, 6 mmol) and 95%
sodium hydride (NaH, 1.26 g, 50 mmol) are stirred in benzene (30
mL) under nitrogen for 30 minutes. Linoleyl mesylate (5.0 g, 15
mmol) is added and the reaction refluxed under nitrogen for 3
hours. The reaction mixture is then cooled in an ice bath while
quenching via the slow addition of ethanol. Following dilution with
a further 150 mL of benzene, the mixture is washed with distilled
water (2.times.150 mL) and brine (150 mL). The organic phase is
dried over magnesium sulphate and evaporated to give the crude
product.
The crude product is purified on a silica gel (Kiesel Gel 60)
column eluted with 0-5% methanol in chloroform. Column fractions
are analyzed by thin layer chromatography (TLC) (silica gel,
chloroform/methanol 9:1 v/v, visualized with molybdate dip) and
fractions containing purified product (R.sub.f=0.5) are pooled and
concentrated.
[0248] Decolorization and further purification of DLinDMA is
effected with a second column, this time eluting with 20-50% ethyl
acetate in hexane. Column fractions are analyzed by TLC (silica
gel, ethyl acetate/hexane 1:1 v/v, visualized with molybdate) and
fractions containing pure product (R.sub.f=0.4) are pooled and
concentrated. The procedure described herein typically yields 2.2 g
(60%) of pure product.
[0249] For synthesis of DLenDMA, linolenyl mesylate is substituted
for linoleyl mesylate and the remainder of the synthesis,
decolorization, and purification reactions is carried out as
described above.
[0250] Synthesis of PEG.sub.2000-C-DMA:
[0251] PEG-C-DMA was synthesized as follows. In brief, a C.sub.14
lipid anchor was prepared by first alkylating the hydroxyl groups
of 3-allyloxypropane-1,2-diol with myristyl bromide. The allyl
group was subsequently removed via palladium catalysis, resulting
in the C.sub.14 hydroxyl lipid. The hydroxyl group was converted to
the primary amine by mesylation and amination to yield
1,2-dimyristyloxypropyl-3-amine, the lipid anchor. Conjugation with
PEG was effected by treating monomethoxy poly(ethylene glycol)
(average molecular weight 2000) with an excess of diphosgene to
form the chloroformate. Addition of the C.sub.14 amine lipid anchor
and stirring overnight yielded PEG.sub.2000-C-DMA, referred to here
as PEG-C-DMA.
[0252] SNALP Preparation:
[0253] SNALP with a lipid composition of
DSPC:Chol:PEG-C-DMA:Cationic Lipid (20:48:2:30 molar percent) were
prepared using the spontaneous vesicle formation by ethanol
dilution method [Jeffs et al., Pharm. Res. In Press (2005)]. The
sample's were diafiltered against 100 mL of PBS (20 wash volumes)
using a cross flow ultrafltration cartridge (Amersham Biosciences,
Piscataway, N.J.) and sterile filtered through Acrodisc 0.2 .mu.m
Posidyne filters (Pall Corp., Ann Arbor, Mich.). The siRNA
concentration of final samples was determined using the RiboGreen
assay and a siRNA standard curve. Particle size and polydispersity
was determined using a Malvern Instruments Zetasizer 3000HSA
(Malvern, UK). Nucleic acid encapsulation was determined using a
RiboGreen assay, comparing fluorescence in the presence and absence
of Triton X-100. RiboGreen fluorescence was measured using a Varian
Eclipse Spectrofluorometer (Varian Inc) with .lamda..sub.ex=500 nm,
.lamda..sub.em=525 nm.
[0254] TNS Assay:
[0255] 20 .mu.M of SNALP lipid and 6 .mu.M of TNS were mixed in a
fluorescence cuvette in 2 mL of 20 mM sodium phosphate, 25 mM
citrate, 20 mM ammonium acetate and 150 mM NaCl, at a pH that was
varied from 4.5 to 9.5. Fluorescence was determined at each pH
using a Varian Eclipse Spectrofluorometer (Varian Inc) with
settings of .lamda..sub.ex=322 nm, .lamda..sub.em=431 nm.
Fluorescence for each system at the various pH was then normalized
to the value at pH 4.5. The pK.sub.a values are the point at which
50% of the molecules present are charged. By assuming that minimum
fluorescence represents zero charge, and maximum fluorescence
represents 100% charge, pK.sub.a can be estimated by measuring the
pH at the point exactly half way between the values of minimum and
maximum charge.
[0256] .sup.31P Nuclear Magnetic Resonance Spectroscopy:
[0257] Multilamellar vesicles (MLV) were prepared comprising DPPS
and cationic lipid at a molar ratio of 1:1. This was accomplished
by drying the lipids from chloroform solution, transferring to 10
mm NMR tubes, and hydrating in 1.5 mL of 10 mM sodium citrate, pH
4. Free induction decays (FIDs) corresponding to 1000 scans were
obtained with a 3.0 .mu.s, 60o pulse with a 1 s interpulse delay
and a spectral width of 25000 Hz. A gated two-level proton
decoupling was used to ensure sufficient decoupling with minimum
sample heating. An exponential multiplication corresponding to 50
Hz of line broadening was applied to the FIDs prior to Fourier
transformation. The sample temperature (+/-1.degree. C.) was
regulated using a Bruker B-VT1000 variable temperature unit.
Chemical shifts were referenced to 85% phosphoric acid as an
external standard.
[0258] In Vitro Transfection:
[0259] Cells were cultured in MEM (Invitrogen) containing 10% fetal
bovine serum (FBS) (CanSera) and 0.25 mg/mL G418 (Invitrogen).
Neuro2A-G cells (Neuro2A cells stably transfected to express
luciferase [R. E. Kingston. in Current Protocols in Molecular
Biology, Vol. 2, pp. 9.1.4-9.1.9, John Wiley & Sons, Inc.
(1997)]) were plated at a concentration of 4.times.10.sup.4 cells
per well in 24-well plates and grown overnight. Cells were treated
with SNALP at doses of 0.0625-1.0 .mu.g/mL nucleic acid (AntiLuc
Active or Mismatch Control) and incubated for 48 hours at
37.degree. C. and 5% CO.sub.2. Cells were then washed with PBS and
lysed with 200 .mu.L 250 mM sodium phosphate containing 0.1% Triton
X-100. The luciferase activity for each well was determined using
Luciferase Reagent (Promega) and a standard luciferase protein
(Roche). The luminescence for each was measured using a Berthold
MicroLumatPlus LB96V plate luminometer. The resulting luciferase
activity was then normalized for the amount of protein using the
Micro BCA assay kit (Pierce). Luciferase knockdown relative to a
control was then determined for each system.
[0260] Cellular Uptake:
[0261] SNALP were prepared incorporating the non-exchangeable
tritium-labeled lipid cholesteryl hexadecyl ether (3H-CHE) (11.1
.mu.Ci/.mu.mol total lipid) [Bally et al., in Liposome Technology,
Vol. III, pp. 27-41, CRC Press (1993)]. Neuro2A cells (ATCC, VA,
USA) were plated in 12 well plates at 1.6.times.105 cells per well
in minimal essential media. The following day, media was removed
and replaced with media containing radiolabelled SNALP at 0.5
.mu.g/mL nucleic acid. After 24 hours, the media and unincorporated
SNALP were removed, adherent cells gently washed 4 times with PBS,
and then lysed with 600 .mu.L Lysis Buffer (250 mM phosphate with
0.1% Triton X-100). The resulting cell lysate (500 .mu.L) was added
to glass scintillation vials containing 5 mL Picofluor 40 (Perkin
Elmer) and .sup.3H-CHE was determined using a Beckman LS6500
scintillation counter (Beckman Instruments). The protein content of
cell lysates was determined using the Micro BCA assay (Pierce).
Uptake was expressed as a percentage of the total amount of
activity applied to the cells per mg of cellular protein.
[0262] Uptake of SNALP Containing Cy3-Labeled siRNA:
[0263] SNALP were formulated as previously described, but using
siRNA labelled with the fluorophore Cy3 (Cy3-siRNA was a gift of
Sirna Therapeutics Inc, Boulder, Colo.). The encapsulation, siRNA
concentration, and particle size were determined as described.
[0264] For the uptake study, 8.times.10.sup.4 Neuro2A-G cells were
grown overnight on 4-well chamber slides (BD Falcon, Mississauga,
ON) in MEM containing 0.25 mg/mL G418. DSDMA, DODMA, DLinDMA, and
DLenDMA SNALP containing Cy3-siRNA, as well as naked Cy3-siRNA and
unlabeled DSDMA SNALP were placed on the cells at 0.5 .mu.g/mL
siRNA. After a 4 hour incubation with the transfection media, the
cells were washed with PBS, then with MEM containing G418 and
finally with PBS once more. The cells were then fixed in a 4%
paraformaldehyde solution in PBS for 10 min at room temperature.
The cells were washed with PBS and stained with 300 nM DAPI
(Molecular Probes, Eugene, Oreg.) in PBS for 5 minutes. The cells
were washed with PBS, the mounting media ProLong Gold Antifade
Reagent (Molecular Probes, Eugene, Oreg.) applied and a cover slip
added. The cells were viewed using an Olympus BX60 Microscope
modified for fluorescence capabilities. Cy3 fluorescence within the
cells was visualized using a rhodamine cube set (Microgen Optics,
Redding, Calif.) and the DAPI fluorescence was visualized using a
DAPI cube set (Carsen Group, Markham, ON). Digital pictures were
captured using an Olympus DP70 camera system. Pictures of the cells
were taken at exposure times of 1/4 sec when examining Cy3
fluorescence and 1/80 sec when examining DAPI fluorescence.
Example 2: SNALP Formulations Encapsulating siRNA
[0265] This example demonstrates encapsulating siRNA in SNALP
formulated with either short- or long-chain PEG-DAG and produced by
continuously mixing organic lipid and aqueous buffer solutions.
PEG-DAG lipids employed were PEG-dimyristylglycerol (C.sub.14)
(PEG-DMG) and PEG-distearylglycerol (C.sub.18) (PEG-DSG).
Anti-.beta.-galactosidase (.beta.-gal) siRNA encapsulated in
DSPC:Cholesterol:DODMA:PEG-DMG/PEG-DSG SNALP by this method
resulted in .gtoreq.90% encapsulation (Ribogreen Assay) and
.about.120 nm particle size (Malvern sizer). The preparations had
the following characteristics: [0266] 4 ml prep: anti-B-gal siRNA
in DSPC:Chol:DODMA:PEG-DMG liposomes [0267] Initial mix=94%
encapsulation [0268] Post dilution mix=98% encapsulation [0269]
Post incubation mix=97% encapsulation [0270] Post overnight
dialysis=96% encapsulation [0271] Particle size=109.7 nm [0272]
Polydispersity=0.14 [0273] 8 ml prep: anti-B-gal siRNA in
DSPC:Chol:DODMA:PEG-DMG liposomes [0274] Post dilution &
incubated mix=89% [0275] Post overnight dialysis=91% [0276]
Particle size=127.5 nm [0277] Polydispersity=0.11 [0278] 8 ml prep:
anti-B-gal siRNA in DSPC: Chol:DODMA:PEG-DSG liposomes [0279] Post
dilution & incubated mix=90% [0280] Post overnight dialysis=90%
[0281] Post sterile-filter=90% [0282] Particle size=111.6 nm [0283]
Polydispersity=0.24
Example 3: Downregulation of Intracellular Expression in Cells by
Delivering In Vitro an SNALP Formulation Encapsulating siRNA
[0284] This example demonstrates downregulation of .beta.-Gal
expression in CT26.CL25 cells delivered in vitro
DSPC:Cholesterol:DODMA:PEG-DMG liposomes encapsulating
anti-.beta.-Gal siRNA. The results are depicted in FIG. 4.
[0285] In vitro delivery of 0.2 .mu.g Oligofectamine-encapsulated
siRNA decreased .beta.-Gal activity by about 60% in comparison to
unexposed control cells. Encapsulating 1.5 .mu.g anti-.beta.-Gal
siRNA in DSPC:Cholesterol:DODMA:PEG-DMG liposomes decreased
.beta.-Gal activity by about 30% in comparison to unexposed control
cells.
Example 4: Assays for Serum Stability
[0286] Lipid/therapeutic nucleic acid particles formulated
according to the above noted techniques can be assayed for serum
stability by a variety of methods.
[0287] For instance, in a typical DNase 1 digestion, 1 .mu.g of DNA
encapsulated in the particle of interest is incubated in a total
volume of 100 .mu.L of 5 mM HEPES, 150 mM NaCl, 10.0 mM MgCl.sub.2
pH 7.4. DNase treated samples are treated with either 100 or 10 U
of DNase I (Gibco-BRL). 1.0% Triton X-100 can be added in control
experiments to ensure that lipid formulations are not directly
inactivating the enzyme. Samples are incubated at 37.degree. C. for
30 min after which time the DNA is isolated by addition of 500
.mu.L of DNAZOL followed by 1.0 mL of ethanol. The samples are
centrifuged for 30 min at 15,000 rpm in a tabletop microfuge. The
supernatant is decanted and the resulting DNA pellet is washed
twice with 80% ethanol and dried. This DNA is resuspended in 30
.mu.L of TE buffer. 20 .mu.L of this sample is loaded on a 1.0%
agarose gel and subjected to electrophoresis in TAE buffer.
[0288] In a typical serum assay, 50 .mu.g of DNA in free,
encapsulated, or encapsulated+0.5% Triton X100 was aliquoted into
1.5 mL Eppendorf tubes. To the tubes were added 45 .mu.l normal
murine or human serum, dH2O (to make final volume 50 The tubes were
sealed with parafilm and incubated at 37.degree. C. A sample of the
free, encapsulated, or encapsulated+0.5% Triton X100 not digested
by nuclease (standard) was frozen in liquid nitrogen in an
Eppendorf tube and stored at -20.degree. C. Aliquots were taken at
various time points, added to GDP buffer containing proteinase K
(133 .mu.g/mL) and immediately frozen in liquid nitrogen to stop
the reaction. Once all of the time points were collected, the
samples were incubated at 55.degree. C. in a waterbath to activate
proteinase K enabling it to denature any remaining exonuclease.
Proteinase K digested samples were applied to polyacrylamide gels
to assess levels of exonuclease degradation.
[0289] Particles disclosed above demonstrate serum stability by
showing less than 5% and preferably undetectable amounts of DNA
degradation (partial or total) as a result of such treatment, even
in the presence of 100 U DNase 1. This compares favorably to free
DNA, which is completely degraded, and plasmid/lipid complexes
(such as DOTMA or DODAC:DOPE complexes), wherein DNA is
substantially (i.e., greater than 20%, often 80%) degraded after
such treatment.
Example 5: Characterization of SNALPs
[0290] This example describes disease site targeting and gene
expression resulting from intravenous administration of SNALP
encapsulating plasmids in tumor bearing mice.
[0291] Plasmid DNA was encapsulated in small (diameter.about.70 nm)
nucleic acid-lipid particles (i.e., SNALP) comprising comprise of
one plasmid per particle, encapsulated within a lipid bilayer
stabilized by the presence of a bilayer stabilizing component, such
as a poly(ethyleneglycol) (PEG) coating. SNALP exhibited extended
circulation lifetimes following intravenous administration and
promoted delivery of intact plasmid to distal tumor sites resulting
in reporter gene expression at the disease site.
[0292] SNALP with long circulation times accumulated to levels
corresponding to five to ten percent of the total injected dose per
gram of tumor or greater than 1000 copies of plasmid DNA per cell,
giving rise to levels of gene expression that were more than two
orders of magnitude greater than those observed in any other
tissue. Interestingly, although the liver accumulated 20-30% of the
total injected dose, very low levels of gene expression were
observed in the liver. This is thought to be due to the limited
hepatocellular uptake of the PEG-ylated SNALP. See, FIGS. 8-10.
[0293] The in vivo delivery and transfection potential of nucleic
acid-lipid particles containing a bilayer stabilizing component was
further enhanced through the incorporation of a cationic PEG lipid
(CPL) consisting of a DSPE anchor, PEG.sub.3400 spacer chain and a
cationic head group. When CPL were incorporated into SNALP at
concentrations of 2 to 4 mol % the resulting CPL-SNALP were of a
similar size and stability as native SNALP. Incorporation of CPL
resulted in a dramatic increase in intracellular delivery and a
concomitant increase in transfection activity measured both in
vitro and in vivo. Specifically, CPL-SNALP yielded 10.sup.5-fold
more in vitro gene expression than native SNALP. When CPL-SNALP
were administered intravenously they yielded a substantial (250
fold) increase in hepatic gene expression compared to native SNALP.
The increase in CPL-SNALP potency was specific to the liver. The
levels of gene expression measured in the lung, kidney, spleen or
heart remained unchanged, contributing to more than two orders of
magnitude differential in the gene expression measured in the liver
vs. other organs.
[0294] These results illustrate the potential for modulating the
delivery properties of PEG-lipid containing systems while retaining
the stability and small uniform size required to achieve systemic
gene delivery. In particular they demonstrate that disease site
targeting and tissue specific gene expression can be re-programmed
by altering the lipid composition of non-viral gene delivery
systems.
Example 6: SNALPs Containing PEG-DAG Conjugates
[0295] This example demonstrates the preparation of a series of
PEG-diacylglycerol lipids (PEG-DAG) SNALPs. In this example, the
encapsulated nucleic acid is a plasmid.
[0296] PEG-DAG SNALP were prepared incorporating 10 mol percent
PEG-dilaurylglycerol (C.sub.12), PEG-dimyristylglycerol (C.sub.14),
PEG-dipalmitoylglycerol (C.sub.16) or PEG-disterylglycerol
(C.sub.18) and evaluated for in vitro transfection activity,
pharmacokinetics and the biodistribution of gene expression
resulting from systemic administration in tumor bearing mice.
PEG-DAG lipid containing SNALP demonstrated a similar relationship
between acyl chain length and in vitro transfection activity to
those containing PEG-ceramides. Shorter acyl chain anchors
(dimyristyl (C.sub.14) and dipalmitoyl (C.sub.16)) resulted in
SNALP particles that were less stable but have higher transfection
activity in vitro than those incorporating longer acyl chain
anchors (disteryl (C.sub.18)). Evaluation of the pharmacokinetics
of PEG-DAG containing SNALP confirmed a correlation between the
stability of the PEG lipid component and the circulation lifetime
of SNALP. SNALP containing PEG-dimyristylglycerol (C.sub.14),
PEG-dipalmitoylglycerol (C.sub.16) and PEG-disterylglycerol
(C.sub.18) demonstrated circulation half-lives of 0.75, 7 and 15
hours respectively. Extended circulation lifetime in turn
correlates with an increase in tumor delivery and concomitant gene
expression.
[0297] Upon intravenous administration, PEG-disterylglycerol
(C.sub.18) containing SNALP bypass so-called `first pass` organs,
including the lung, and elicited gene expression in distal tumor
tissue. The level of reporter gene expression observed in tumors
represents a 100 to 1000-fold differential over that observed in
any other tissue. This compared well with the behavior of SNALP
containing PEG-ceramide C.sub.20. The incorporation of PEG-DAG in
SNALP confirmed that small size, low surface charge and extended
circulation lifetimes are prerequisite to the passive disease site
targeting leading to accumulation of plasmid DNA and gene
expression in tumors following systemic administration of non-viral
transfection systems. See, FIGS. 5-10.
Materials and Methods
[0298] Materials
[0299] DOPE and DSPC were obtained from Northern Lipids (Vancouver,
BC). DODAC and the PEG-diacylglycerols were manufactured by Inex
Pharmaceuticals (Burnaby, BC). The other materials, HEPES, OGP and
.sup.3H-cholesteryl hexadecyl ether, were obtained from a number of
different commercial sources.
[0300] DOPE:DODAC:PEG-Diacylglycerols (82.5:7.5:10) large
unilamellar vesicles were prepared via detergent dialysis in Hepes
Buffered Saline (150 mM NaCl and 10 mM HEPES) for 48 hours. Lipid
stock solutions were prepared in ethanol and then dried down to
create a lipid film which was reconstituted in final 200 mM OGP.
LUVs were labeled with .sup.3H-cholesteryl hexadecyl ether at 1
uCi/1 mg lipid. Particle sizes were determined by nicomp analysis.
Radioactivity was determined by scintillation counting with
Picofluor20.
[0301] SNALP containing PEG-Diacyglycerols were formulated via
detergent dialysis by varying the salt concentration to maximize
the percent of DNA encapsulation. Optimal salt concentration was
chosen for the 48 hour detergent dialysis. Empty vesicles were
removed by one step sucrose centrifugation. 3.5% sucrose was used
to separate out the empty particles from the plasmid-containing
PEG-Diacylglycerol formulations except for PEG-Dimyristylglycerol
containing SNALP which used 5.0% sucrose. Empty vesicles migrated
to the top of the tube which were fractioned out and removed.
[0302] In Vitro Transfection
[0303] 5.times.10.sup.4 cells/ml were plated onto 24-well plates (1
ml). Cells were left to grow for 24 hours. 500 .mu.l of
transfection media (2.5 .mu.g/well) was added and then incubated
for stated timepoints. Transfection media was aspirated after
timepoint and then exposed to complete media for another 24 hours
at 37.degree. C. in 5.0% CO.sub.2. Complete media was removed.
Cells were washed with PBS twice and stored at -70.degree. C. until
day of experiment. Cells were lysed with 150 .mu.l of 1.times.CCLR
containing protease inhibitors. Plates were shaken for 5 minutes.
20 .mu.l of each sample were assayed in duplicate on a 96-well
luminescence plate for luciferase activity.
[0304] Pharmacokinetics, Biodistribution, and In Vivo Gene
Expression
[0305] Pharmacokinetics and biodistribution were all determined by
normalizing the data to the quantity of radioactivity present.
Approximately 500 .mu.l of blood was obtained by cardiac puncture.
Red blood cells and plasma were separated by centrifugation
(4.degree. C., 3000 rpm, 10 minutes) and 100 .mu.l of plasma was
used to determine radioactive counts. Organs were harvested at
specified timepoints and homogenized in lysing matrix tubes (Fast
Prep, 2.times.15 seconds, 4.5 intensity) to assay a portion of the
mixture.
[0306] Gene expression was determined by luciferase assay. Organs
were harvested, homogenized, and kept on ice throughout the
experiment. Lysates were centrifuged (10,000 rpm, 5 minutes) and 20
.mu.l of supernatant were assayed in duplicate on a 96-well
luminescence plate for luciferase activity. The results are
depicted in FIGS. 7-10.
[0307] In Vitro Gene Silencing
[0308] Cells were transfected with SPLP comprising PEG-lipid
conjugates and containing a plasmid encoding luciferase under the
control of the CMV promoter and SNALPs containing anti-luciferase
siRNA, according to the methods described above. Gene expression
was determined by luciferase assay. The results are depicted in
FIG. 17.
Example 7: Expression of Nucleic Acids Encapsulated in SPLP
Comprising PEG-Dialkyloxypropyl Conjugates
[0309] This example describes experiments comparing expression of
nucleic acids encapsulated in SPLP comprising PEG-dialkyloxypropyl
conjugates. All SPLP formulations comprise a plasmid encoding
luiferase under the control of the CMV promoter (pLO55).
TABLE-US-00001 # # Group Mice Tumor Route Treatment Route Doses
Timepoint ASSAY*** A 4 Neuro- SC PBS IV 1 48 hrs Body weights, 2a
Blood analyses, B 5 Neuro- SC SPLP PEG-DSG IV 1 48 hrs Luciferase
2a activity C 5 Neuro- SC SPLP PEG-A-DSA IV 1 48 hrs 2a D 5 Neuro-
SC SPLP PEG-A-DPA IV 1 48 hrs 2a E 5 Neuro- SC SPLP PEG-A-DMA IV 1
48 hrs 2a
[0310] The lipids (DSPC:CHOL:DODMA:PEG-Lipid) were present in the
SPLP in the following molar ratios (20:55:15:10). The following
formulations were made:
A: PBS sterile filtered, 5 mL. B: pL055-SPLP with PEG-DSG, 2 mL at
0.50 mg/mL. C: pL055-SPLP with PEG-A-DSA, 2 mL at 0.50 mg/mL. D:
pL055-SPLP with PEG-A-DPA, 2 mL at 0.50 mg/mL. E: pL055-SPLP with
PEG-A-DMA, 2 mL at 0.50 mg/mL.
TABLE-US-00002 # Seeding Injection Collection Group Mice date
Treatment date date A 4 Day 0 PBS Day 12 Day 14 B 5 Day 0 SPLP
PEG-DSG Day 12 Day 14 C 5 Day 0 SPLP PEG-A-DSA Day 12 Day 14 D 5
Day 0 SPLP PEG-A-DPA Day 12 Day 14 E 5 Day 0 SPLP PEG-A-DMA Day 12
Day 14
[0311] 1.5.times.10.sup.6 Neuro2A cells were administered to each
mouse on day 0. When the tumors were of a suitable size (200-400
mm.sup.3), mice were randomized and treated with one dose of an
SPLP formulation or PBS by intravenous (IV) injection. Dose amounts
are based on body weight measurements taken on the day of dosing.
48 hours after SPLP administration, the mice were sacrificed, their
blood was collected, and the following tissues were collected
weighed, immediately frozen and stored at -80.degree. C. until
further analysis: tumor, liver (cut in 2 halves), lungs, spleen and
heart.
[0312] Gene expression in collected tissues was determined by
assaying for enzymatic activity of expressed luciferase reporter
protein. The results are shown in FIGS. 11 and 12.
[0313] The results indicate that SPLP comprising
PEG-dialkyloxypropyls (i.e., PEG-DAA) can conveniently be used to
transfect distal tumor to substantially the same extent as SPLP
comprising PEG-diacylglycerols. Moreover, the transfection levels
seen with SPLP containing PEG-dialkyloxypropyl are similar to those
seen with SPLP containing PEG-diacylglycerols (e.g. PEG-DSG). It
was also shown that similar to the PEG-diacylglycerol system, very
little transfection occurred in non-tumor tissues. Moreover, the
SPLP comprising PEG-dialkyloxypropyls exhibit reduced toxicity
compared to other SPLP formulations.
Example 8: SNALPs Containing PEG-Dialkyloxypropyl Conjugates
[0314] This example described experiments analyzing the
biodistribution (local and systemic) and pharmacokinetics of a
series of PEG-dialkyloxypropyl lipids SNALPs (i.e., SPLP containing
encapsulated siRNA.
[0315] Local Biodistribution
[0316] To determine the local distribution of SPLP resulting from
systemic administration of anti-.beta. galactosidase siRNA
containing SNALP in Neuro-2a tumor bearing mice via fluorescent
microscopy.
A: PBS
[0317] B: anti-.beta.gal siRNA-Rhodamine-PE
labeled-DSPC:Chol:DODMA:PEG-A-DMA SNALP (1:20:54:15:10)
TABLE-US-00003 Group Mice Cells Treatment Timepoint Assay A 2
Neuro2A PBS 24 hr Fluorescent Photomicroscopy B 5 Neuro2A anti-Bgal
siRNA-Rhodamine-PE 24 hr Fluorescent labeled- Photomicroscopy
DSPC:Chol:DODMA:PEG-A-DMA
[0318] 1.5.times.10.sup.6 Neuro2A cells were administered to each
mouse on day 0. When the tumors were of a suitable size (200-400
mm.sup.3, typically day 9-12)), mice were randomized and treated
with one dose of an SNALP formulation comprising 100 .mu.g siRNA or
PBS by intravenous (IV) injection in a total volume of 230 .mu.l.
Dose amounts are based on body weight measurements taken on the day
of dosing. 24 hours after SPLP administration, the mice were
sacrificed, their blood was collected, and the following tissues
were collected weighed, immediately frozen and stored at -80 C
until further analysis: tumor, liver (cut in 2 halves), lungs,
spleen & heart.
[0319] Local distribution of the SNALP was determined by
fluorescence microscopy. Accumulation of SNALP is seen in, e.g.,
the liver, demonstrating the SNALP comprising PEG-dialkyloxypropyls
are able to extravasate, i.e., exit the circulation and home to a
target tissue or organ.
[0320] Pharmacokinetics and Systemic Biodistribution
[0321] This example illustrates the pharmacokinetics and
biodistribution of SPLPs containing a plasmid encoding luciferase
under the control of the CMV promoter (LO55) and SNALPs containing
anti-luciferase siRNA in mice seeded subcutaneously with Neuro2A
tumors.
TABLE-US-00004 Group Mice Cells Treatment Timepoint (h) A 6 Neuro2A
[3-H]CHE-L055-DSPC:Chol:DODMA:PEG-A-DMA 0.25, 1, 4, 8, 24 B 6
Neuro2A [3-H]CHE-anti-luc siRNA-DSPC:Chol:DODMA:PEG-A-DMA 0.25, 1,
4, 8, 24 C 6 Neuro2A [3-H]CHE-L055 -DSPC:Chol:DODMA:PEG-C-DMA 0.25,
1, 4, 8, 24 D 6 Neuro2A [3-H]CHE-L055-pSPLP (PEI) 0.25, 1, 4, 8, 24
E 6 Neuro2A [3-H]CHE-L055-DSPC:Chol:DODMA:PEG-DSG 0.25, 1, 4, 8,
24
[0322] All samples are to be provided at 0.5 mg/ml nucleic acid.
The following SPLP and SNALP formulations were prepared:
A. [.sup.3H] CHE-L055-DSPC:Chol:DODMA:PEG-A-DMA (20:55:15:10)
[0323] B. [.sup.3H] CHE-anti-luc siRNA-DSPC:Chol:DODMA:PEG-A-DMA
(20:55:15:10)
C. [.sup.3H] CHE-L055-DSPC:Chol:DODMA:PEG-C-DMA (20:55:15:10)
[0324] D. [.sup.3H] CHE-L055-pSPLP (PEI) (i.e., precondensed
SPLP)
E. [.sup.3H] CHE-L055-DSPC:Chol:DODMA:PEG-DSG (20:55:15:10)
TABLE-US-00005 [0325] # Seeding Injection Collection Group Mice
date Treatment date date A 6 Day 0
[3-H]CHE-L055-DSPC:Chol:DODMA:PEG-A-DMA Day 12 July31 B 6 Day 0
[3-H]CHE-anti-luc siRNA-DSPC:Chol:DODMA:PEG- Day 12 July31 A-DMA C
6 Day 0 [3-H]CHE-L055 -DSPC:Chol:DODMA:PEG-C-DMA Day 13 Day 14 D 6
Day 0 [3-H]CHE-L055-pSPLP (PEI) Day 13 Day 14 E 6 Day 0
[3-H]CHE-L055-DSPC:Chol:DODMA:PEG-DSG Day 14 Day 15
[0326] 30 male A/J mice (Jackson Laboratories) were seeded
subcutaneously with Neuro 2A cells at a dose of 1.5.times.10.sup.6
cells in a total volume of 50 .mu.L phosphate buffered saline on
day zero. After tumors reached appropriate size (typically on day 9
or later), 200 .mu.l (100 .mu.g nucleic acid) of the SPLP or SNALP
preparations described above, were administered intravenously.
0.25, 1, 2, 4, and 8 hours after administration of SPLP or SNALP,
mice were weighed and blood (typically 25 .mu.L) was collected by
tail nick. 24 hours after administration of SPLP or SNALP, mice
were sacrificed, blood was collected and assayed for clearance of
[.sup.3H]CHE. Organs (e.g., liver, lung, spleen, kidney, heart) and
tumors were collected and evaluated for [.sup.3H]CHE accumulation.
The results are shown in FIGS. 13-16.
[0327] For all formulations, SPLP containing PEG-DSG remained in
circulation the longest, with 50% of the injected dose remaining
after 6 h. Interestingly, there appeared to be a initial rapid
clearance of pSPLP within the first 15 minutes that was not seen
for any other formulation. After 1 h the clearance profile of the
pSPLP was quite similar to SPLP. This initial rapid clearance for
the pSPLP sample may indicate that there are actually two types of
particles present, one that clears very rapidly and one that
behaves very much like SPLP.
[0328] Anti-Luc siRNA containing vesicles (SNALP) formulated with
the C14 PEG-A-DMA showed more rapid clearance from blood than SPLP
containing the C18 PEG-DSG. However, this SNALP formulation showed
significantly slower blood clearance than SPLP formulated with the
same PEG lipid. A possible reason for this result maybe that siRNA
containing particles can evade the cellular immune system more
readily than plasmid containing SPLP.
[0329] SPLP comprising PEG-C-DMA demonstrated a rapid clearance
from blood, which was substantially the same as that observed for
SPLP comprisig PEG-A-DMA. For both of these formulations, the
plasma half lives were approximately 2 h, lower than for SPLP
containing C18 PEG-lipids.
[0330] SPLP containing PEG-DSG had the highest tumor accumulation
at 10.9% inject dose per gram tissue. The two SPLP formulations
containing the C14 PEG-lipids, PEG-A-DMA and PEG-C-DMA, had much
lower tumor accumulation of 6.1% and 5.9% injected dose per gram
tissue. The SiRNA SNALP had slightly more tumor accumulation than
an SPLP sample with the same PEG-lipid at 7.3%, which also
correlates relatively well with the plasma half-life for this
SNALP. The pSPLP formulation had tumor accumulation at 7.5%, which
is lower than the comparable PEG-DSG SPLP.
[0331] Accumulation of PEG-DSG containing SPLP and pSPLP in the
heart and lungs was higher than the other SPLP and SNALP, which is
consistent with the increased circulation half lives of particles
with C18 PEG-lipids. Not surprisingly, there was an inverse
relationship between plasma half-life and accumulation in the liver
for all samples tested, while no trend was apparent for sample
accumulation in the spleen. Accumulation in the kidneys was very
low for all formulations tested, with accumulation between 1.2 and
2.4% injected dose per gram tissue.
Example 9: Silencing of Gene Expression with SNALPS
[0332] This example illustrates silencing of gene expression in
Neuro 2A tumor bearing mice after co-administration of SPLPs
containing a plasmid encoding luciferase under the control of the
CMV promoter and SNALPs containing anti-luciferase siRNA.
TABLE-US-00006 # Time- # Group Mice Tumor Route Treatment point
Route Doses 1 3 Neuro- SQ PBS/PBS 48 h IV 1 24A 4 2a L055-SPLP/PBS
mix 24 h 24B 4 L055-SPLP/anti-luc siRNA liposomes mix 48A 4
L055-SPLP/PBS mix 48 h 48B 4 L055-SPLP/anti-luc siRNA liposomes mix
72A 4 L055-SPLP/PBS mix 72 h 72B 4 L055-SPLP/anti-luc siRNA
liposomes mix
TABLE-US-00007 Injec- Collec- # Seeding Time- tion tion Group Mice
Date Route IV Treatement point date Date 1 3 Day 0 SQ PBS/PBS 48 h
Day 13 Day 15 24A 4 L055-SPLP/PBS 24 h Day 14 mix 24B 4 L055-SPLP/
Day 14 anti-luc siRNA liposomes mix 48A 4 L055-SPLP/PBS 48 h Day 13
mix 48B 4 L055-SPLP/ Day 13 anti-luc siRNA liposomes mix 72A 4
L055-SPLP/PBS 72 h Day 12 mix 72B 4 L055-SPLP/ Day 12 anti-luc
siRNA liposomes mix
[0333] 36 male A/J mice (Jackson Laboratories) were seeded
subcutaneously with Neuro 2A cells at a dose of 1.5.times.10.sup.6
cells in a total volume of 50 .mu.L phosphate buffered saline on
day zero. Once tumors reached appropriate size (typically on day 9
or later), 200-240 .mu.l PBS, SPLP, or SNALP formulations (100
.mu.g nucleic acid total) prepared as described in Example 6 above,
were administered intravenously. 24, 48, or 72 after administration
of PBS, SPLP or a mixture of SPLP and SNALP, mice were sacrificed
and organs (e.g., liver, lung, spleen, kidney, heart) and tumors
were collected and evaluated for luciferase activity. The results
are shown in FIGS. 18-22.
[0334] The results demonstrate that co-administration of pL055 SPLP
and anti-luc siRNA SNALP (both containing PEG-A-DMA) maximally
decreases luciferase gene expression by 40% forty-eight hours after
a single iv dose.
Example 10: Down Regulation of .beta.-Gal Activity in Stably
Transfected CT26-CL25 Cells
[0335] SNALP were prepared containing siRNA duplex directed against
the .beta.-Galactosidase reporter gene and applied to the
.beta.-galactosidase expressing stable cell line: CT26CL25, plated
at 2.times.10.sup.4 cells/well at a concentration of 1.0 .mu.g/mL
siRNA. Cells were exposed to SNALP for 24 hours and
.beta.-galactosidase activity was determined after 96 hours.
Silencing was observed in 90% of the cells in culture which
correlates with silencing of a target protein in 40% of cells in
vivo.
Example 11: Liver Distribution of Rhodamine Labeled SNALP Following
a Single Intravenous Administration
[0336] SNALP were prepared containing siRNA duplex directed against
the .beta.-Galactosidase reporter gene using and administered to
A/J mice intravenously, through the tail vein. Tissues were
collected at 24 hours, snap frozen and sectioned for visualization
of SNALP dissemination. Cells were stained with rhodamine and
counterstained with DAPI, which stains nuclei. The in vivo
biodistribution of the SNALP favors the liver, with as much as 50%
of the administered SNALP material delivered to the liver. The
SNALP delivered to the liver is found in a diffuse pattern,
distributed throughout the liver.
Example 12: Silencing of Gene Expression Following Delivery of
siRNA Encapsulated in SPLP Comprising Cationic Lipids
[0337] This example describes experiments comparing expression of
nucleic acids following in vitro transfection of Neuro2A cells with
SNALP comprising: (1) DODAC, DODMA, or DLinDMA; (2) PEG-C-DMA; and
(3) an siRNA duplex directed against luciferase encapsulated in the
SNALP (i.e., siRNA comprising the following sequence:
GAUUAUGUCCGGUUAUGUAUU (SEQ ID NO:1) and targeting the DNA sequence
complementary to: GATTATGTCCGGTTATGTATT (SEQ ID NO:3)). Neuro2A
cells were stably transfected with a plasmid encoding luciferase
under the control of the CMV promoter (pLO55). The stably
transfected cells were then transfected with SNALP comprising: 15,
20, 25, 30, 35, or 40% of DODAC, DODMA, or DLinDMA; 2% PEG-C-DMA,
and an siRNA duplex directed against luciferase encapsulated in the
SNALP. Luciferase protein expression was measured 48 hours after
transfection with SNALP. SNALP comprising 30% DLinDMA was more
effective in reducing luciferase expression in the Neuro2A cells
than SNALP comprising DODAC or DODMA were. These results are shown
in FIG. 23.
[0338] DLinDMA, the most fusogenic lipid with the lowest apparent
phase transition temperature, yielded the greatest knockdown when
incorporated in SNALP, with luciferase expression only 21% that of
the untreated control. This was followed by the DLenDMA formulation
(32%), and DODMA (54%). The close correspondence between knockdown
efficiency and the H.sub..PI. phase forming ability of the cationic
lipid as observed suggests that the two parameters are linked.
Example 13: SNALP Containing Unsaturated Cationic Lipids Show
Increased Gene-Silencing Activity
[0339] The ability of SNALP containing each of the four cationic
lipids (i.e., DSDMA, DODMA, DLinDMA, and DLenDMA) to effect gene
silencing in stably transfected Neuro2A cells was evaluated.
Neuro2A cells stably transfected to express the luciferase were
treated with SNALP containing anti-luciferase siRNA for 48 hours.
Gene-silencing efficiency was evaluated by comparing the remaining
luciferase activity in these cells to that remaining in cells
treated with control SNALP containing mismatch siRNA.
[0340] Formulations comprising the saturated lipid DSDMA
demonstrated no activity. As unsaturation in the lipid's alkyl
chain increased, so did the capacity for RNA interference, with
DLinDMA particles yielding an 80% knockdown in gene expression.
.sup.31P-NMR established DLinDMA as having the lowest phase
transition temperature in the series and accordingly, being the
most fusogenic lipid. Particles comprising DLenDMA, the most
unsaturated lipid, were slightly less efficient than those
containing DLinDMA. All results were found to be significant by
t-Test (P<0.05 at siRNA concentration of 0.5 .mu.g/mL, and
P<0.01 at siRNA concentration of 1.0 .mu.g/mL). Error bars
represent standard deviation, n=3. The results are shown in FIG.
24.
Example 14: In Vivo Transfection of Organs by Various SPLP
Formulations
[0341] This example describes experiments demonstrating in vivo
transfection of organs with that SPLP comprising 15% DLinDMA can be
used SPLP encapsulating a plasmid encoding luciferase under the
control of the CMV promoter were administered to Neuro2A tumor
bearing male A/J mice. The SPLP had the following formulations:
TABLE-US-00008 Sample Description A SPLP-PEG.sub.2000-C-DMA
(CHOL:DSPC:DODMA:PEG.sub.2000-C-DMA 55:20:15:10 mol %) B
SPLP-PEG.sub.2000 DlinDMA (CHOL:DSPC:DlinDMA:PEG.sub.2000-C-DMA
55:20:15:10 mol %) C SPLP-PEG.sub.750-C-DMA/DODMA
(CHOL:DSPC:DODMA:PEG.sub.750-C-DMA 55:20:15:10 mol %) D
SPLP-PEG.sub.750-C-DMA/DLinDMA (CHOL:DSPC:DlinDMA:PEG.sub.750-C-DMA
55:20:15:10 mol %) 0.41 mg/ml E SPLP- High PEG.sub.750-C-DMA
(CHOL:DSPC:DODMA:PEG.sub.750-C-DMA 50:20:15:15 mol %) F SPLP- High
PEG.sub.750-C-DMA (CHOL:DSPC:DlinDMA:PEG.sub.750-C-DMA 50:20:15:15
mol %) G SPLP-DODAC (CHOL:DSPC:DODMA:PEG.sub.2000-C-DMA:DODAC
45:20:15:10:10 mol %) 0.35 mg/ml
[0342] Luciferase gene expression was assessed in liver, lung,
spleen, heart and tumors 48 hours after intravenous administration
of the SPLP. The results are shown in FIG. 25.
Example 15: In Vivo Transfection of Tumor by Additional SPLP
Formulations
[0343] This example describes experiments demonstrating in vivo
transfection of organs with that SPLP comprising DLinDMA or DODMA
and varying percentages (15%, 10%, 5%, or 2.5%) of PEG-C-DMA. SPLP
encapsulating a plasmid encoding luciferase were administered to
Neuro2A tumor bearing male A/J mice. The SPLP had the following
formulations:
TABLE-US-00009 Mol % (DSPC:Chol:PEG-C-DMA:DXDMA A 20:50:15:15
(DODMA) B 20:55:10:15 (DODMA) C 20:60:5:15 (DODMA) D 20:62.5:2.5:15
(DODMA) E 20:55:10:15 (DLinDMA) F 20:60:5:15 (DLinDMA) G
20:62.5:2.5:15 (DLinDMA)
[0344] Luciferase gene expression was assessed in tumors 48 hours
after intravenous administration of SPLP. The results are shown in
FIG. 26.
Example 16: Blood Clearance of Lipid Vesicles Comprising
PEG-C-DMA
[0345] This example describes experiments conducted to assess the
blood clearance rate of lipid vesicles comprising various
percentages of PEG-C-DMA. A single intravenous dose of
.sup.3H-CHE-labeled SPLP, SNALP, or empty vesicles was administered
to male A/J mice. SPLP comprised the cationic lipid DODMA and SNALP
comprised the cationic lipid DLinDMA. The lipid vesicles had the
following formulations:
TABLE-US-00010 Mol % (DSPC:Chol:PEG-C- Group Treatment DMA:Cationic
Lipid) A Empty vesicles 20:48:2:30 B SNALP (DlinDMA, PEG-C-DMA)
20:48:2:30 C SNALP (DlinDMA, PEG-C-DMA) 20:55:5:20 D SPLP (15 mol %
PEG-C-DMA) 20:50:15:15 E SPLP (10 mol % PEG-C-DMA) 20:55:10:15 F
SPLP (5 mol % PEG-C-DMA) 20:60:5:15
[0346] The percentage of the injected dose of lipid vesicle
remaining in plasma of the mice was determined at 1, 2, 4, and 24
hours following the administration of the .sup.3H-CHE-labeled SPLP,
SNALP, or empty vesicles. The results are shown in FIG. 27.
Example 17: Biodistribution of Lipid Vesicles Comprising
PEG-C-DMA
[0347] The example describes experiments conducted to assess the
biodistribution of lipid vesicles comprising various percentages of
PEG-C-DMA. A single intravenous dose of .sup.3H-CHE-labeled SPLP,
SNALP, or empty vesicles was administered to Neuro 2A tumor bearing
male A/J mice. SPLP comprised the cationic lipid DODMA and SNALP
comprised the cationic lipid DLinDMA. The lipid vesicles had the
following formulations:
TABLE-US-00011 Mol % (DSPC:Chol:PEG-C- Group Treatment DMA:Cationic
Lipid) A Empty vesicles 20:48:2:30 B SNALP (DlinDMA, PEG-C-DMA)
20:48:2:30 C SNALP (DlinDMA, PEG-C-DMA) 20:55:5:20 D SPLP (15 mol %
PEG-C-DMA) 20:50:15:15 E SPLP (10 mol % PEG-C-DMA) 20:55:10:15 F
SPLP (5 mol % PEG-C-DMA) 20:60:5:15
[0348] The percentage of the injected dose of lipid vesicles was
assessed in the liver, spleen, lungs, and tumor of the mice 48
hours after administration of the .sup.3H-CHE-labeled vesicles. The
results are shown in FIG. 28.
Example 18: Silencing of Gene Expression at a Distal Tumor
[0349] This example describes experiments demonstrating gene
silencing in distal tumors following administration of SNALP
comprising DLinDMA and encapsulating an anti-luciferase siRNA
sequence.
[0350] Neuro 2A cells were stably transfected with a plasmid
encoding luciferase under the control of the CMV promoter (pLO55)
to generate Neuro 2A-G cells. Male A/J mice were seeded with the
Neuro 2A-G cells. The SNALP encapsulating the anti-luciferase siRNA
sequence (i.e., siRNA comprising the following sequence:
GAUUAUGUCCGGUUAUGUAUU (SEQ ID NO:1) and targeting the DNA sequence
complementary to: GATTATGTCCGGTTATGTATT (SEQ ID NO:3)) were
administered to the Neuro2A-G tumor bearing A/J mice intravenously.
The SNALP formulations were as follows:
TABLE-US-00012 Mol % (DSPC:Chol:PEG-C- Group DMA:DLinDMA) PBS A
Anti Luciferase SNALP 20:48:2:30 B Control (Invert Sequence) SNALP
20:48:2:30 C Anti Luciferase SNALP 20:55:5:20 D Control (Invert
Sequence) SNALP 20:55:5:20 E Anti Luciferase SNALP 20:55:10:15 F
Control (Invert Sequence) SNALP 20:55:10:15
[0351] Luciferase gene expression was measured 48 hours following
administration of SNALP comprising DLinDMA and encapsulating an
anti-luciferase siRNA sequence. The results are shown in FIG.
29.
Example 19: Silencing of Gene Expression in Neuro2A-G Tumor Cells
In Vitro
[0352] This example describes experiments demonstrating gene
silencing in mammalian cells following contact with SNALP
comprising DLinDMA and encapsulating an anti-luciferase siRNA
sequence described in Example 3 above. Neuro 2A cells were stably
transfected with a plasmid encoding luciferase as described in
Example 3 above to generate Neuro 2A-G cells. The Neuro 2A-G cell
were contacted with SNALP formulations for 24 or 48 hours. The
SNALP formulations comprised either PEG-C-DLA (C.sub.12) or
PEG-C-DMA (C.sub.14) and are as follows:
TABLE-US-00013 Mol % (DSPC:Chol:PEG-C- Group Treatment DAA:DLinDMA)
A SNALP (PEG-C-DLA) 20:48:2:30 B SNALP (PEG-C-DLA) 20:45:5:30 C
SNALP (PEG-C-DLA) 20:40:10:30 D SNALP (PEG-C-DMA) 20:48:2:30
[0353] Luciferase gene expression was measured 24 or 48 hours
following contacting the Neuro 2A-G cells with SNALP encapsulating
an anti-luciferase siRNA sequence. The results are shown in FIG.
30.
Example 20: Silencing of Gene Expression in Neuro2A-G Tumor Cells
In Vitro
[0354] This example describes experiments demonstrating gene
silencing in mammalian cells following contact with SNALP
comprising DLinDMA and encapsulating an anti-luciferase siRNA
sequence described in Example 3 above. Neuro 2A cells were stably
transfected with a plasmid encoding luciferase as described in
Example 3 above to generate Neuro 2A-G cells. The Neuro 2A-G cells
were contacted with SNALP formulations for 48 hours in the presence
and absence of chloroquine. The SNALP formulations contained
varying percentages of PEG-C-DMA (C.sub.14) and either DODMA or
DLinDMA. The formulation were as follows:
TABLE-US-00014 Mol % (DSPC:Chol:PEG-C- Group Treatment DAA:DLinDMA)
A PBS -- B Naked siRNA -- C SNALP (PEG-C-DMA) 20:40:10:30 D SNALP
(PEG-C-DMA) 20:46:4:30 E SNALP (PEG-C-DMA) 20:48:2:30 F SNALP
(PEG-C-DMA) 20:49:1:30
[0355] Luciferase gene expression was measured 48 hours following
contacting the Neuro 2A-G cells with the SNALP encapsulating an
anti-luciferase siRNA sequence. The results are shown in FIG.
31.
[0356] It is to be understood that the above description is
intended to be illustrative and not restrictive. Many embodiments
will be apparent to those of skill in the art upon reading the
above description. The scope of the invention should, therefore, be
determined not with reference to the above description, but should
instead be determined with reference to the appended claims, along
with the full scope of equivalents to which such claims are
entitled. The disclosures of all articles and references, including
patent applications, patents and PCT publications, and Genbank
Accession Nos. are herein incorporated by reference in their
entirety for all purposes.
Sequence CWU 1
1
3121RNAArtificial SequenceDescription of Artificial Sequenceanti-
luciferase siRNA sense sequence 1gauuaugucc gguuauguau u
21221RNAArtificial SequenceDescription of Artificial Sequenceanti-
luciferase siRNA antisense sequence 2uacauaaccg gacauaaucu u
21321DNAArtificial SequenceDescription of Artificial Sequence
complementary target DNA sequence 3gattatgtcc ggttatgtat t 21
* * * * *
References