U.S. patent application number 16/124798 was filed with the patent office on 2019-03-07 for compositions and methods for treatment of hereditary cystatin c amyloid angiopathy (hccaa) and other neurodegenerative disorders associated with aberrant amyloid deposits.
The applicant listed for this patent is The Children's Hospital of Philadelphia. Invention is credited to Alvaro Gutierrez-Uzquiza, Hakon Hakonarson, Michael March.
Application Number | 20190070247 16/124798 |
Document ID | / |
Family ID | 65517553 |
Filed Date | 2019-03-07 |
![](/patent/app/20190070247/US20190070247A1-20190307-D00001.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00002.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00003.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00004.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00005.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00006.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00007.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00008.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00009.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00010.png)
![](/patent/app/20190070247/US20190070247A1-20190307-D00011.png)
View All Diagrams
United States Patent
Application |
20190070247 |
Kind Code |
A1 |
Hakonarson; Hakon ; et
al. |
March 7, 2019 |
Compositions and Methods for Treatment of Hereditary Cystatin C
Amyloid Angiopathy (HCCAA) and Other Neurodegenerative Disorders
Associated with Aberrant Amyloid Deposits
Abstract
Compositions and Methods for the Treatment of Amyloid Deposit
diseases, e.g., Hereditary cystatin C amyloid angiopathy and other
neurodegenerative disorders, are disclosed.
Inventors: |
Hakonarson; Hakon; (Malvern,
PA) ; Gutierrez-Uzquiza; Alvaro; (Madrid, ES)
; March; Michael; (Lansdowne, PA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Children's Hospital of Philadelphia |
Philadelphia |
PA |
US |
|
|
Family ID: |
65517553 |
Appl. No.: |
16/124798 |
Filed: |
September 7, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62555496 |
Sep 7, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/5023 20130101;
A61P 25/28 20180101; A61K 38/063 20130101; G01N 33/5032
20130101 |
International
Class: |
A61K 38/06 20060101
A61K038/06; A61P 25/28 20060101 A61P025/28; G01N 33/50 20060101
G01N033/50 |
Claims
1. A method for treating amyloid deposit disease comprising
delivering an effective amount of at least one antioxidant to a
patient at risk for amyloid disease.
2. The method of claim 1 wherein said amyloid disease is hereditary
cystatin C amyloid angiopathy (HCCAA) caused by mutated cystatin
C.
3. The method of claim 2 wherein said mutated cystatin C comprises
a L68Q cystatin C.
4. The method of claim 1, wherein said antioxidant is selected from
the group consisting of glutathione, N-acetyl cysteine or a
derivative thereof and is effective to reduce amyloid disease
symptoms.
5. The method of claim 4, wherein said derivative is selected from
NAC-amide, NAC-ethyl ester and zinc mercaptide N-acetyl cysteine
carboxylate salt.
6. A method for treatment of hereditary cystatin C amyloid
angiopathy (HCCAA) in a human subject in need thereof, comprising
administration of an effective amount of N-acetyl cysteine or
functional derivative thereof in a pharmaceutically acceptable
carrier, said administration being effective to reduce
amyloid-cystatin protein aggregates, thereby alleviating symptoms
of HCCAA, wherein said NAC derivative is selected from NAC-amide,
NAC-ethyl ester and zinc mercaptide N-acetyl cysteine carboxylate
salt.
7. The method of claim 6 further comprising performing a skin
biopsy on said subject following treatment to assess reduction in
amyloid-cystatin protein aggregates in skin.
8. The method of claim 6 comprising administration of an
ionophore.
9. The method of claim 1 comprising administration of an
anti-inflammatory agent.
10. The method of claim 9, wherein said disease is HCCAA, said
antioxidant is a NAC derivative is selected from NAC-amide,
NAC-ethyl ester and zinc mercaptide N-acetyl cysteine carboxylate
salt and said anti-inflammatory agent is selected from the group
consisting of one or more of corticosteroids, aspirin, celecoxib,
diclofenac, diflunisal, etodolac, ibuprofen, indomethacin,
ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam,
salsalate, sulindac, tolmetin, interleukin (IL)-1 receptor
antagonist, IL-4, IL-6, IL-10, IL-11, IL-13, cytokine receptors for
IL-1, tumor necrosis factor-alpha, IL-18 and derivatives and
biosimilars thereof.
11. The method of claim 1, comprising administration of one or more
of glutathione, siRNA, monensin, papain, cathepsin B, and
falcipain
12. A method for treatment of a neurodegenerative disorder
associated with pathogenic fibrillation protein aggregates in a
human subject in need thereof, comprising administration of an
effective amount of N-acetyl cysteine or functional derivative
thereof in a pharmaceutically acceptable carrier, said
administration being effective to reduce said protein aggregates,
thereby alleviating symptoms of said neurodegenerative
disorder.
13. The method of claim 1, wherein said disorder is selected from
Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jacob's
disease, Huntington disease and other CAAs.
14. The method of claim 1 further comprising monitoring said
patient for amyloid deposit levels.
15. A method for identifying therapeutic agents which alter
amyloid-cystatin protein aggregate formation for use in the method
of claim 1, comprising, a) providing cells expressing a nucleic
acid encoding a mutant hCC protein, said mutant causing formation
of amyloid-cystatin protein aggregates; b) providing cells which
express a hCC protein which lacks the hCC mutation; c) contacting
the cells of steps a) and b) with a test agent and d) analyzing
whether said agent alters amyloid-cystatin protein aggregate
formation of cells of step a) relative to those of step b), thereby
identifying agents which alter amyloid-cystatin protein
aggregation.
16. The method of claim 15 wherein said therapeutic has efficacy
for the treatment of HCCAA or other disorders associated aberrant
fibril formation.
17. A method for the treatment of HCCAA in a patient in need
thereof comprising administration of an effective amount of the
agent identified by claim 15.
18. The method of claim 15, wherein said agent is NAC or a
functional derivative thereof.
19. A pharmaceutical composition comprising an effective amount of
an agent which acts as an antioxidant and, or a reducing agent for
the treatment of amyloid deposit disease in a pharmaceutically
acceptable carrier.
20. The pharmaceutical composition of claim 19 wherein said agent
is glutathione, N-acetyl cysteine or a derivative thereof.
21. The pharmaceutical composition of claim 20 wherein said
derivative is selected from NAC-amide, NAC-ethyl ester and zinc
mercaptide N-acetyl cysteine carboxylate salt.
22. The pharmaceutical composition of claim 19, further comprising
one or more of an ionophore, an anti-inflammatory agent or a
protease.
Description
[0001] This application claims priority to U.S. Provisional
Application No. 62/555,496 filed Sep. 7, 2017, the entire contents
being incorporated herein by reference as though set forth in
full.
FIELD OF THE INVENTION
[0002] The present invention relates to the fields of angiopathy,
most notably including cerebral amyloid angiopathy and
neurodegenerative disorders, associated with pathogenic fibril
formation. More specifically the invention provides compositions
and methods useful for the treatment and management of diseases
associated with aberrant fibril formation, particularly hereditary
cystatin C amyloid angiopathy (HCCAA) and Alzheimer's disease.
BACKGROUND OF THE INVENTION
[0003] Several publications and patent documents are cited through
the specification in order to describe the state of the art to
which this invention pertains. Each of these citations is
incorporated herein by reference as though set forth in full.
[0004] Hereditary cystatin C amyloid angiopathy (HCCAA) is a
dominantly inherited disease caused by a leucine 68 to glutamine
variant of human cystatin C (hCC; L68Q-hCC)..sup.1 HCCAA is
classified as a cerebral amyloid angiopathy (CAA), a group of
diseases in which amyloid deposits form on the walls of blood
vessels in the central nervous system (CNS). Although HCCAA is
rightly classified as a CAA disorder due to its strong cerebral
presentation, hCC deposition is systemic and is also found in other
internal organs. Most carriers of the mutation suffer
micro-infarcts and brain hemorrhages in their twenties leading to
paralysis, dementia and death in young adults, with an average life
expectancy of 30 years. .sup.2-6 Post-mortem studies in humans show
that hCC is deposited in all brain areas, grey and white matter
alike, most prominently in arteries and arterioles.
[0005] Human cystatin C, a cysteine protease inhibitor that belongs
to the cystatin super-family, is a secretory type 2 cystatin,
expressed in all nucleated human cells and found in all tissues and
body fluids and at particularly high concentrations in
cerebrospinal fluid. .sup.2, 7-9 hCC inhibits cysteine proteases
like papain and legumain by its interaction through multiple
binding motifs resulting from the characteristic hCC fold..sup.9-11
Its normal conformation is composed of a polypeptide that folds
into a five-stranded .beta.-sheet, which partially wraps around a
central .alpha.-helix. The N-terminal segment and two hair-pin
loops build the edge of the protein, which binds into the active
site of cysteine proteases and blocks their proteolytic activity.
.sup.12-14 The mutation of leucine 68 to glutamic acid destabilizes
the packing between the beta sheets and the alpha helix, allowing
the molecule to open. Two such open hCC molecules can interact with
each other, with the helix of each molecule interacting with the
beta sheet of the other; the resulting dimer is said to be the
product of domain swapping..sup.15-17 Additionally, through a
process called propagated domain swapping, long chains of molecules
can be built, in which the free domain of each molecule interacts
with a new hCC monomer." The aggregation of proteins leads to the
formation of highly ordered pathogenic fibrillar aggregates, called
amyloid fibrils,.sup.19,20 which are implicated not only in HCCAA
but also in a wide range of neurodegenerative diseases such as
Alzheimer's, Parkinson's, Creutzfeldt-Jacob's, Huntington's disease
and other CAAs..sup.20
[0006] The degree of amyloid maturation observed in cystatin C
deposits has been shown to vary between tissues (i.e, less
prominent maturation in skin than in brain)..sup.21 Although
deposits in the skin are not comprised of amyloid fibers,
quantitative studies on hCC deposition within the skin of mutant
carriers showed that symptomatic carriers had significantly higher
levels of hCC immunoreactivity in their skin than asymptomatic
carriers. The fact that the quantity of hCC deposition in skin was
associated with the progression of the disease in the CNS shows
that skin biopsies could be used to assess disease progression and
could, therefore, be of use in the evaluation of therapeutic
interventions..sup.22
[0007] Protein oligomers of different pathogenic amyloidogenic
proteins precede the fibril formation stage in HCCAA and other
diseases, although for HCCAA it is unclear if such oligomers lead
directly to pathogenic fibrils, or if assembly of fibrils occurs
most rapidly from monomers..sup.23 Drugs reducing aggregation of
amyloid-producing proteins have the potential to reduce the
formation of toxic oligomers known to occur in several types of
amyloidosis..sup.24, 25 Previous investigations have suggested that
preventing domain swapping of hCC might be used for treatment of
HCCAA,.sup..24 Nilsson and colleagues developed variants of WT hCC
and L6Q-hCC with intra-chain stabilizing disulfide bonds preventing
domain swapping that could form either dimers or amyloid
fibrils..sup.26 These results suggest that the knowledge of the
molecular mechanism causing the transition of physiologically
normal and soluble proteins to toxic oligomers and insoluble
fibrils is essential for the development of treatment
strategies.
[0008] Ostner et al. have previously attempted to prevent
polymerization of hCC monomers, or disrupt or remove multimeric
species, through various approaches..sup.24 As mentioned, modified,
stabilized hCC monomers have been used to demonstrate that
preventing domain swapping prevents aggregations. Antibodies can be
raised specifically against the domain swapped, dimeric form of
hCC; those antibodies were able to specifically remove dimers of
hCC, and not monomers, from patient plasma using size exclusion
chromatography..sup.27 A high-throughput screen of compounds has
been pursued using the US Drug Collection (comprised of 1040 FDA
approved compounds; (found on the world wide web at
.msdiscovery.com/usdrug.html) in an effort to find molecules that
prevent dimerization..sup.24 Although promising, this approach
required large amounts of purified hCC protein produced in
bacteria, and the compounds that were identified as inhibiting
dimer formation were for the most part used at concentrations too
high to be considered therapeutic in an organism.
[0009] Clearly, there is a need for improved methods and
compositions for treating HCCAA.
SUMMARY OF THE INVENTION
[0010] In accordance with the present invention, a method for
treating amyloid deposit disease comprising delivering an effective
amount of at least one antioxidant to a patient, said anti-oxidant
disrupting said amyloid deposit, thereby alleviating disease
symptoms. Amyloid deposit diseases, include for example, hereditary
cystatin C amyloid angiopathy (HCCAA), Alzheimer's disease,
Parkinson's disease, Creutzfeldt-Jacob's disease, Huntington
disease and other forms of cerebral amyloid angiopathies such as
the Dutch form of the disease. In certain embodiments, the amyloid
disease is HCCAA caused by mutated cystatin C. In other
embodiments, the mutated cystatin C comprises a L68Q cystatin C.
Preferred antioxidants for use in the method above, include,
without limitation, glutathione, N-acetyl cysteine or a derivative
thereof. In certain embodiments, the derivatives are selected from
NAC-amide, NAC-ethyl ester and zinc mercaptide N-acetyl cysteine
carboxylate salt.
[0011] In another aspect, a method for treatment of hereditary
cystatin C amyloid angiopathy (HCCAA) in a human subject in need
thereof is provided. An exemplary method comprises administration
of an effective amount of N-acetyl cysteine or functional
derivative thereof in a pharmaceutically acceptable carrier to the
subject, the administration being effective to reduce
amyloid-cystatin protein aggregates, thereby alleviating symptoms
of HCCAA. In certain embodiments, the NAC derivative is selected
from NAC-amide, NAC-ethyl ester and zinc mercaptide N-acetyl
cysteine carboxylate salt. The method can optionally entail
performing a skin biopsy on said subject following treatment to
assess reduction in amyloid-cystatin protein aggregates in skin or
measuring cystatin C monomer, dimer or oligomer in serum or plasma
or the amount of monomer excreted in the urine.
[0012] In another aspect, the method can entail administration of
additional agents which alleviate amyloid deposit symptoms. These
include without limitation, one or more ionophores, one or more
anti-inflammatory agents and one or more proteases. In other
embodiments, siRNA directed to cystatin C coding sequences are
administered to selectively block the mutated allele.
[0013] In another aspect of the invention, a method for treatment
of a neurodegenerative disorder associated with pathogenic
fibrillation protein aggregates in a human subject in need thereof
is disclosed. An exemplary method comprising administration of an
effective amount of N-acetyl cysteine or functional derivative
thereof in a pharmaceutically acceptable carrier to the subject
wherein the administration is effective to reduce said protein
fibril aggregates, thereby alleviating symptoms of the
neurodegenerative disorder. In certain embodiments, the disorder is
selected from Alzheimer's disease, Parkinson's disease,
Creutzfeldt-Jacob's disease, Huntington disease and other forms of
cerebral amyloid angiopathy (CAA) such as the Dutch form.
[0014] In certain embodiments, the methods above comprise
monitoring said patient for amyloid deposit levels.
[0015] In yet another aspect of the invention, a method for
identifying therapeutic agents which alter amyloid-cystatin protein
aggregate formation is provided. An exemplary method comprising
providing cells expressing a nucleic acid encoding a mutant hCC
protein, said mutant causing formation of amyloid-cystatin protein
aggregates; and providing cells which express a hCC protein which
lacks the hCC mutation. Both populations of cells are contacted
with a test agent and assessed to determine whether the agent
alters amyloid-cystatin protein aggregate formation of cells
expressing the mutant relative to those expressing the wild type
protein, thereby identifying agents which alter amyloid-cystatin
protein aggregation. Agents so identified should have efficacy for
the treatment of HCCAA or other disorders associated aberrant
fibril formation.
[0016] Also provided is a pharmaceutical composition comprising an
effective amount of an agent which acts as an antioxidant and, or a
reducing agent for the treatment of amyloid deposit disease in a
pharmaceutically acceptable carrier. Diseases to be treated with
the composition, include for example, HCCAA, Alzheimer's disease,
Parkinson's disease, Creutzfeldt-Jacob's disease, Huntington
disease and other CAAs. In one embodiment, the agent is
glutathione, N-acetyl cysteine or a derivative thereof. In a
preferred embodiment, the agent is a derivative and is selected
from NAC-amide, NAC-ethyl ester and zinc mercaptide N-acetyl
cysteine carboxylate salt. The inventive compositions of the
invention can also comprise one or more of an ionophore, an
anti-inflammatory agent or a protease.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1A: Genetically engineeredHEK-293T cells produce and
secrete detectable levels of hCC (WT or L68Q) capable of
oligomerizing under non-reducing conditions. FIG. 1A. Schematic
representation of WT and L68Q mutant hCC proteins. Dashed line
represents the N-terminal signal peptide subject to proteolysis.
The red rectangle represents the Myc tag added to the C-terminal
end. FIG. 1B. (left panel) Lysates from HEK-293T cells stably
expressing hCC WT or L68Q mutant or supernatants (right panel) were
mixed with 2% SDS with or without the reducing agents DTT or
.beta.-mercaptoetanol when indicated. Samples were subject to
electrophoresis and CST3 levels examined by the Western blot
procedure using anti-cystatin C antibody. FIG. 1B: Incubation with
glutathione impairs cystatin C di/oligomerization in cellular
extracts and supernatants (biological replica) FIG. 1C. Biological
replicates related to experiments shown in FIG. 2 where
supernatants and cellular extracts were incubated in the presence
of glutathione during 1 h at 37.degree. C. with indicated
concentrations. Samples were mixed with 2% SDS without reducing
agents prior to electrophoresis, and proteins levels were detected
by anti-cystatin C antibody WB.
[0018] FIG. 2A: Incubation with glutathione impairs cystatin C
di/oligomerization in cellular extracts and supernatants.
Supernatants and cellular extracts were incubated in the presence
of glutathione at the indicated concentrations for 1 h at
37.degree. C. Samples were mixed with 2% SDS without reducing
agents prior to electrophoresis, and protein levels were detected
by Western blot for cystatin C. (N=3; *significant at P<0.05
with respect to untreated (HMW); +significant at P<0.05 with
respect to untreated (monomer)). FIG. 2B: Glutathione and
N-acetylcysteine impairs oligomerization of secreted cystatin C
L68Q (Biological replicates). Biological replicates related to
experiments shown in FIG. 3 where supernatants were incubated in
the presence of glutathione or NAC during 1 h at 37.degree. C. with
indicated concentrations. Samples were mixed with 2% SDS without
reducing agents prior to electrophoresis, and proteins levels were
detected by anti-cystatin C antibody WB.
[0019] FIG. 3A: Glutathione and N-acetylcysteine impairs
oligomerization of secreted cystatin C L68Q. Supernatants were
incubated in the presence of the indicated concentrations of
glutathione or NAC for 1 h at 37.degree. C. Samples were mixed with
2% SDS without reducing agents prior to electrophoresis, and
protein levels were detected by anti-cystatin C antibody. The
histogram represents the quantification by densitometry of the
Western blot bands for the high molecular weight fraction (HMW)
relative to the untreated sample or monomer (Mono) relative to the
DTT treated sample. No HMW fraction was detected in supernatants
from HEK-293T cells stably expressing hCC WT. (* significant at
P<0.05 with respect to untreated (HMW); +significant at
P<0.05 with respect to untreated (Monomer)). FIG. 3B:
N-acetylcysteine impairs oligomerization of secreted cystatin C
L68Q (Biological replicates) Biological replicates related to
experiments shown in FIG. 4 where 293T cells expressing WT or L68Q
cystatin C were incubated with the indicated amounts of compound
during 24, 48 or 72 h. Small amounts of supernatant were removed
from the cells and analyzed by Western blot at the indicated times.
On days 2 and 3, only the L68Q supernatants were analyzed. Samples
were mixed with 2% SDS without reducing agents prior to
electrophoresis, and protein levels were detected by anti-cystatin
C antibody WB.
[0020] FIG. 4: NAC impairs oligomerization of secreted hCC L68Q.
293T cells expressing WT or L68Q cystatin C were incubated with
media containing the indicated amount of either GSH or NAC for 24,
48 or 72 h. Small amounts of supernatant were removed from the
cells and analyzed by Western blot at the indicated times. On days
2 and 3, only the supernatants from cells expressing hCC L68Q
variant were analyzed. Samples were mixed with 2% SDS without
reducing agents prior to electrophoresis, and protein levels were
detected by anti-cystatin C antibody. The histogram represents the
quantification by densitometry of the Western blot bands for the
high molecular weight fraction (HMW) relative to the untreated
sample or monomer (Mono) relative to the DTT treated sample. (*
significant at P<0.05 with respect to untreated (HMW);
+significant at P<0.05 with respect to untreated (Monomer)).
[0021] FIG. 5. Reducing activity of GSH or NAC are critical for
breaking oligomers into monomers of secreted Cystatin C L68Q.
Supernatants were incubated in presence of oxidized (GSSG) or
reduced glutathione (GSH), NAC or its inactive analogous (NAS)
during 1 h at 37.degree. C. with indicated concentrations. Samples
were mixed with 2% SDS without reducing agents prior to
electrophoresis, and proteins levels were detected by anti-cystatin
C antibody.
[0022] FIG. 6. NAC-amide and NAC-ethyl-ester impair oligomerization
of intracellular and secreted
[0023] Cystatin C L68. Supernatants and cellular extracts were
incubated in presence of NAC, NAC-amide and NAC-methyl ester during
1 h at 37 C with indicated concentrations. Samples were mixed with
2% SDS without reducing agents prior to electrophoresis, and
proteins levels were detected by anti-cystatin C antibody.
[0024] FIG. 7. High molecular weight complexes of Cyst-C L68Q can
be detected in transgenic mice. Short incubation of NAC impairs
oligomerization of Cyst-C L68Q on blood and brain extracts. Plasma
or brain extracts were incubated in presence of NAC during 1 h at
37.degree. C. with indicated concentrations. Samples were mixed
with 2% SDS without reducing agents prior to electrophoresis, and
proteins levels were detected by biotinylated anti-cystatin C
antibody followed by streptavidin-HRP.
[0025] FIG. 8: Effects of NAC therapy in HCCAA patients. Cystatin C
immunostaining (brown stain) was performed on 3 separate skin
biopsies obtained from the same location of the back, from two
members of a HCCAA family who are carriers of the hCC L68Q variant,
using a rabbit-anti human cystatin C antibody. The biopsies in each
left panel (skin biopsy 1 in FIG. 8A and FIG. 8B) were obtained
when the family participated in research over 2 years prior to the
initiation of this work. The biopsies in the middle figure panels
(skin biopsy 2 in FIG. 8A and FIG. 8B) were obtained approximately
18 months later. The biopsies in the right panels (skin biopsies #3
in FIG. 8A and FIG. 8B) from both subjects show cystatin C protein
complex deposition after 6 months of therapy with NAC. A marked
reduction was seen in the proband (panel A) and the parent (panel
B) after 6 months of NAC therapy. Panel A: Cystatin C
immunostaining of skin biopsies from the proband. Panel B: Cystatin
C immunostaining of skin biopsies from the parent. FIG. 8C. Cyst-C
monomers are detectable at reduced levels in blood from subjects
carrying the L68Q mutation. High molecular weight complexes appear
to be present in one carrier who is not taking NAC.
DETAILED DESCRIPTION OF THE INVENTION
[0026] To create a system in which to test the ability of a
compound to impact hCC multimerization while gaining some insight
into its toxicity, we created cell lines that express high amounts
of either wild type or mutant hCC. The cell lines and the monomeric
and multimeric hCC that they create were characterized and employed
in experiments for non-toxically interfering with aggregation of
the mutant protein. Additionally, a biomarker study using NAC to
treat human subjects with HCCAA was conducted.
[0027] This system facilitates evaluation of the ability of a
molecule to interfere with aggregation of mutant hCC while also
providing information about toxicity to cells or organisms. Clones
of 293T cells that overexpress either wild type or mutant hCC were
generated. These cells produce and secrete detectable levels of
hCC. Importantly, we have established conditions that allow
detection of high molecular complexes that form in both lysates and
supernatants of cells expressing mutant hCC that are absent in
cells expressing comparable amounts of the wild type protein. We
are able to detect the high molecular weight complexes of mutant
hCC by Western blotting under non-reducing conditions.
Interestingly, a short incubation of either lysate or supernatant
with one of two reducing agents, either reduced glutathione (GSH)
or N-acetyl-cysteine (NAC), breaks oligomers of the mutant into
monomers. Additionally, treatment of L68Q hCC expressing cells with
either NAC or GSH reduces oligomerization of secreted hCC L68Q at
24, 48 and 72 h. Patients with HCCAA were subsequently treated with
NAC for six months. As a biomarker of response, skin biopsies were
obtained to determine if staining for amyloid cystatin C complexes
were reduced in the skin following treatment. The proband, who was
on the highest dose and had been on NAC for 9 months to treat
mucous plugs in her lungs and had previously sustained 3 major
strokes over a 9 month period prior to starting NAC, had
approximately 75% reduction in the amyloid stain in the skin and
has been event free for the 18 months of NAC therapy.
[0028] In summary, this study provides a new cellular model to test
new therapies for the treatment of HCCAA and provides clear
evidence that mutant hCC is a pharmacological target for reducing
agents like NAC. Most importantly, the data implicate NAC as a
potentially a useful therapy to treat this devastating disease
based on skin biomarker results from three patients with HCCAA.
[0029] The following definitions are provided to aid in
understanding the subject matter regarded as the invention.
[0030] In this invention, "a" or "an" means "at least one" or "one
or more," etc., unless clearly indicated otherwise by context. The
term "or" means "and/or" unless stated otherwise. In the case of a
multiple-dependent claim, however, use of the term "or" refers to
more than one preceding claim in the alternative only.
[0031] As used herein, "human cystatin C (hCC)" refers to a protein
which functions as cysteine protease inhibitor that belongs to the
cystatin superfamily. hCC is a secretory type 2 cystatin and is
expressed in all nucleated human cells. L68Q-hcc refers to a
mutated hCC wherein a leucine at position 68 is substituted for a
glutamine variant.
[0032] The terms "agent" and "test compound" are used
interchangeably herein and denote a chemical compound, a mixture of
chemical compounds, a biological macromolecule, or an extract made
from biological materials such as bacteria, plants, fungi, or
animal (particularly mammalian) cells or tissues. Biological
macromolecules include siRNA, shRNA, antisense oligonucleotides,
peptides, peptide/DNA complexes, and any nucleic acid based
molecule which exhibits the capacity to modulate the activity of
the hCC. Example agents include reducing agents such as NAC and
derivatives thereof used alone and in combination. Other useful
agents include, without limitation, glutathione, monensin, papain,
cathepsin B, and falcipain. The biological activity of such agents
can be assessed in the screening assays described herein below.
[0033] "Treatment," as used herein, covers any administration or
application of a therapeutic for disease in a mammal, including a
human, and includes inhibiting the disease or progression of the
disease, inhibiting or slowing the disease or its progression,
arresting its development, partially or fully relieving the
disease, preventing the onset of the disease, or preventing a
recurrence of symptoms of the disease. Example treatments include
administration at least one NAC derivative at efficacious
doses.
[0034] The terms "inhibition" or "inhibit" refer to a decrease or
cessation of any event (such as fibril formation) or to a decrease
or cessation of any phenotypic characteristic or to the decrease or
cessation in the incidence, degree, or likelihood of that
characteristic. To "reduce" or "inhibit" is to decrease, reduce or
arrest an activity, function, and/or amount as compared to a
reference. It is not necessary that the inhibition or reduction be
complete. For example, in certain embodiments, "reduce" or
"inhibit" refers to the ability to cause an overall decrease of 20%
or greater. In another embodiment, "reduce" or "inhibit" refers to
the ability to cause an overall decrease of 50% or greater. In yet
another embodiment, "reduce" or "inhibit" refers to the ability to
cause an overall decrease of 75%, 85%, 90%, 95%, or greater.
[0035] The term "inhibitor" refers to an agent that slows down or
prevents a particular chemical reaction, signaling pathway or other
process, or that reduces the activity of a particular reactant,
catalyst, or enzyme.
[0036] The terms "patient" and "subject" are used interchangeably
to mean a mammal, including human.
[0037] N-acetyl cysteine (NAC)" is a derivative of cysteine that
acts to reduce disulphide bonds associated with fibril formation
present in neurodegenerative disorders such as HCCAA and
Alzheimer's disease. While NAC and ester derivatives are
exemplified herein, other NAC derivatives are known in the art and
described in the following patent documents; U.S. Pat. No.
3,242,052, U.S. Pat. No. 3,591,686, U.S. Pat. No. 3,647,834, U.S.
Pat. No. 3,749,770, U.S. Pat. No. 4,016,287, U.S. Pat. No.
4,132,803, U.S. Pat. No. 4,276,284, U.S. Pat. No. 4,331,648, U.S.
Pat. No. 4,708,965, U.S. Pat. No. 4,711,780, U.S. Pat. No.
4,721,705, U.S. Pat. No. 4,724,239, U.S. Pat. No. 4,827,016, U.S.
Pat. No. 4,859,653, U.S. Pat. No. 4,868,114, U.S. Pat. No.
4,876,283, DE150694C, EP0219455A2, EP0269017A2, EP0280606A1,
EP0304017A2, and EP0339508A1 which are incorporated herein by
reference.
[0038] "Nucleic acid" or a "nucleic acid molecule" as used herein
refers to any DNA or RNA molecule, either single or double stranded
and, if single stranded, the molecule of its complementary sequence
in either linear or circular form. In discussing nucleic acid
molecules, a sequence or structure of a particular nucleic acid
molecule may be described herein according to the normal convention
of providing the sequence in the 5' to 3' direction.
[0039] With reference to nucleic acids of the invention, the term
"isolated nucleic acid" is sometimes used. This term, when applied
to DNA, refers to a DNA molecule that is separated from sequences
with which it is immediately contiguous in the naturally occurring
genome of the organism in which it originated. For example, an
"isolated nucleic acid" may comprise a DNA molecule inserted into a
vector, such as a plasmid or virus vector, or integrated into the
genomic DNA of a prokaryotic or eukaryotic cell or host
organism.
[0040] When applied to RNA, the term "isolated nucleic acid" refers
primarily to an RNA molecule encoded by an isolated DNA molecule as
defined above. Alternatively, the term may refer to an RNA molecule
that has been sufficiently separated from other nucleic acids with
which it would be associated in its natural state (i.e., in cells
or tissues). An isolated nucleic acid (either DNA or RNA) may
further represent a molecule produced directly by biological or
synthetic means and separated from other components present during
its production.
[0041] A "replicon" is any genetic element, for example, a plasmid,
cosmid, bacmid, phage or virus, that is capable of replication
largely under its own control. A replicon may be either RNA or DNA
and may be single or double stranded.
[0042] A "vector" is a replicon, such as a plasmid, cosmid, bacmid,
phage or virus, to which another genetic sequence or element
(either DNA or RNA) may be attached so as to bring about the
replication of the attached sequence or element. Exemplary vectors
of the invention include without limitation, adenoviral-based
vectors, adeno-associated viral vectors and retroviral vectors.
[0043] An "expression operon" refers to a nucleic acid segment that
may possess transcriptional and translational control sequences,
such as promoters, enhancers, translational start signals (e.g.,
ATG or AUG codons), polyadenylation signals, terminators, and the
like, and which facilitate the expression of a polypeptide coding
sequence in a host cell or organism.
[0044] The term "isolated protein" or "isolated and purified
protein" is sometimes used herein. This term refers primarily to a
protein produced by expression of an isolated nucleic acid molecule
of the invention. Alternatively, this term may refer to a protein
that has been sufficiently separated from other proteins with which
it would naturally be associated, so as to exist in "substantially
pure" form. "Isolated" is not meant to exclude artificial or
synthetic mixtures with other compounds or materials, or the
presence of impurities that do not interfere with the fundamental
activity, and that may be present, for example, due to incomplete
purification, addition of stabilizers, or compounding into, for
example, immunogenic preparations or pharmaceutically acceptable
preparations.
[0045] The term "substantially pure" refers to a preparation
comprising at least 50-60% by weight of a given material (e.g.,
nucleic acid, oligonucleotide, protein, etc.). More preferably, the
preparation comprises at least 75% by weight, and most preferably
90-95% by weight of the given compound. Purity is measured by
methods appropriate for the given compound (e.g. chromatographic
methods, agarose or polyacrylamide gel electrophoresis, HPLC
analysis, and the like).
[0046] The term "tag," "tag sequence" or "protein tag" refers to a
chemical moiety, either a nucleotide, oligonucleotide,
polynucleotide or an amino acid, peptide or protein or other
chemical, that when added to another sequence, provides additional
utility or confers useful properties, particularly in the detection
or isolation, to that sequence. Thus, for example, a homopolymer
nucleic acid sequence or a nucleic acid sequence complementary to a
capture oligonucleotide may be added to a primer or probe sequence
to facilitate the subsequent isolation of an extension product or
hybridized product. In the case of protein tags, histidine residues
(e.g., 4 to 8 consecutive histidine residues) may be added to
either the amino- or carboxy-terminus of a protein to facilitate
protein isolation by chelating metal chromatography. Alternatively,
amino acid sequences, peptides, proteins or fusion partners
representing epitopes or binding determinants reactive with
specific antibody molecules or other molecules (e.g., flag epitope,
c-myc epitope, transmembrane epitope of the influenza A virus
hemaglutinin protein, protein A, cellulose binding domain,
calmodulin binding protein, maltose binding protein, chitin binding
domain, glutathione S-transferase, and the like) may be added to
proteins to facilitate protein isolation by procedures such as
affinity or immunoaffinity chromatography. Chemical tag moieties
include such molecules as biotin, which may be added to either
nucleic acids or proteins and facilitates isolation or detection by
interaction with avidin reagents, and the like. Numerous other tag
moieties are known to, and can be envisioned by, the trained
artisan, and are contemplated to be within the scope of this
definition.
[0047] As used herein, the terms "reporter," "reporter system",
"reporter gene," or "reporter gene product" shall mean an operative
genetic system in which a nucleic acid comprises a gene that
encodes a product that when expressed produces a reporter signal
that is a readily measurable, e.g., by biological assay,
immunoassay, radioimmunoassay, or by colorimetric, fluorogenic,
chemiluminescent or other methods. The nucleic acid may be either
RNA or DNA, linear or circular, single or double stranded,
antisense or sense polarity, and is operatively linked to the
necessary control elements for the expression of the reporter gene
product. The required control elements will vary according to the
nature of the reporter system and whether the reporter gene is in
the form of DNA or RNA, but may include, but not be limited to,
such elements as promoters, enhancers, translational control
sequences, poly A addition signals, transcriptional termination
signals and the like.
[0048] The terms "transform", "transfect", "transduce", shall refer
to any method or means by which a nucleic acid is introduced into a
cell or host organism and may be used interchangeably to convey the
same meaning. Such methods include, but are not limited to,
transfection, electroporation, microinjection, PEG-fusion and the
like.
[0049] The introduced nucleic acid may or may not be integrated
(covalently linked) into nucleic acid of the recipient cell or
organism. In bacterial, yeast, plant and mammalian cells, for
example, the introduced nucleic acid may be maintained as an
episomal element or independent replicon such as a plasmid.
Alternatively, the introduced nucleic acid may become integrated
into the nucleic acid of the recipient cell or organism and be
stably maintained in that cell or organism and further passed on or
inherited to progeny cells or organisms of the recipient cell or
organism. In other manners, the introduced nucleic acid may exist
in the recipient cell or host organism only transiently.
[0050] A "clone" or "clonal cell population" is a population of
cells derived from a single cell or common ancestor by mitosis.
[0051] A "cell line" is a clone of a primary cell or cell
population that is capable of stable growth in vitro for many
generations.
Methods and Uses for Treating HCCAA and Other Neurodegenerative
Disorders
[0052] Encompassed herein are methods of treating HCCAA and other
neurodegenerative disorders in a subject, comprising administering
an effective amount of NAC or a functional derivative thereof. The
term "treatment," as used herein, includes any administration or
application of a therapeutic for a disease or disorder in a
subject, and includes inhibiting the disease, arresting its
development, relieving the symptoms of the disease, or preventing
occurrence or reoccurrence of the disease or symptoms of the
disease.
[0053] In some embodiments, the treatment methods comprise
identifying or diagnosing a subject as having a genetic alteration
in hCC causative of HCCAA, and administering a NAC or a functional
derivative thereof to the identified or diagnosed subject. In other
embodiments, the subject has a different disease associated with
pathological fibril formation, including but not limited to
Alzheimer's disease.
[0054] The total treatment dose or doses (when two or more targets
are to be modulated) can be administered to a subject as a single
dose or can be administered using a fractionated treatment
protocol, in which multiple/separate doses are administered over a
more prolonged period of time, for example, over the period of a
day to allow administration of a daily dosage or over a longer
period of time to administer a dose over a desired period of time.
One skilled in the art would know that the amount of therapeutic
agent required to obtain an effective dose in a subject depends on
many factors, including the age, weight and general health of the
subject, as well as the route of administration and the number of
treatments to be administered. In view of these factors, the
skilled artisan would adjust the particular dose so as to obtain an
effective dose for treating an individual having HCCAA.
[0055] The effective dose of therapeutic agent(s) will depend on
the mode of administration, and the weight of the individual being
treated. The dosages described herein are generally those for an
average adult but can be adjusted for the treatment of children.
The dose will generally range from about 0.001 mg to about 1000
mg.
[0056] In an individual suffering from a more severe form of the
disease, administration of therapeutic agents can be particularly
useful when administered in combination, for example, with a
conventional agent for treating such a disease. The skilled artisan
would administer therapeutic agent(s), alone or in combination and
would monitor the effectiveness of such treatment using routine
methods such as neurological or pulmonary function determination,
radiologicor immunologic assays, or, where indicated,
histopathologic methods.
[0057] Administration of the pharmaceutical preparation is
preferably in an "effective amount" this being sufficient to show
benefit to the individual. This amount prevents, alleviates,
abates, or otherwise reduces the severity of HCCAA symptoms in a
patient. Treatment of patients having HCCAA with an efficacious
amount of NAC or a functional derivative thereof may produce
improvements in neurological function, respiratory function,
tapering of concomitant medication usage, or increased
survival.
[0058] The pharmaceutical preparation is formulated in dosage unit
form for ease of administration and uniformity of dosage. Dosage
unit form, as used herein, refers to a physically discrete unit of
the pharmaceutical preparation appropriate for the patient
undergoing treatment.
[0059] Each dosage should contain a quantity of active ingredient
calculated to produce the desired effect in association with the
selected pharmaceutical carrier. Procedures for determining the
appropriate dosage unit are well known to those skilled in the
art.
[0060] Dosage units may be proportionately increased or decreased
based on the weight of the patient. Appropriate concentrations for
alleviation of a particular pathological condition may be
determined by dosage concentration curve calculations, as known in
the art.
[0061] Pharmaceutical compositions that are useful in the methods
of the invention may be administered systemically in parenteral,
oral solid and liquid formulations, subcutaneously, intradermally,
intramuscularly, sublingually, topically, intraperitoneal, nasally,
percutaneous, respiratory, ophthalmic, suppository, aerosol,
topical or other known routes of administration. In addition to the
agent(s) useful for treating a HCCAA, the pharmaceutical
compositions may contain pharmaceutically-acceptable carriers and
other ingredients known to enhance and facilitate drug
administration. Thus, such compositions may optionally contain
other components, such as adjuvants, e.g., aqueous suspensions of
aluminum and magnesium hydroxides, and/or other pharmaceutically
acceptable carriers, such as saline. Other possible formulations,
such as nanoparticles, liposomes, resealed erythrocytes, and
immunologically based systems may also be used to
deliver/administer the appropriate agent to a patient according to
the methods of the invention. The use of nanoparticles to deliver
such agents, as well as cell membrane permeable peptide carriers
that can be used are described in Crombez et al., Biochemical
Society Transactions v35:p44 (2007).
[0062] The pharmaceutical compositions can also comprise
anti-inflammatory agents for co administration to further alleviate
symptoms of amyloid disease. These include, without limitation,
corticosteroids, aspirin, celecoxib, diclofenac, diflunisal,
etodolac, ibuprofen, indomethacin, ketoprofen, ketorolac,
nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac,
tolmetin, interleukin (IL)-1 receptor antagonist, IL-4, IL-6,
IL-10, IL-11, IL-13, cytokine receptors for IL-1, tumor necrosis
factor-alpha, IL-18 and derivatives and biosimilars thereof.
[0063] The following materials and methods are provided to
facilitate the practice of the present invention.
Cells and hCC WT vs. L68Q Variant Expression Constructs
[0064] Human embryonic kidney 293 (HEK-239T) cells were obtained
from ATCC (Manassas, Va.) and grown at 37.degree. C. in Dulbecco's
modified Eagle's medium (DMEM) supplemented with 10% fetal bovine
serum. A plasmid containing a cDNA of CST3 was obtained from
Dharmacon (Lafayette, Colo.). The full length coding sequence was
amplified with a c-terminal Myc tag by PCR using the forward primer
GATCGAATTCGCCACCATGGCCGGGCCCCTGCGCG (SEQ ID NO: 1) and reverse
primer TCGCGGCCGCCTACAGATCCTCTTCTGAGATGAGTTTTTGTTCGGCGTCCTGACAGGT
GGATTTCG (SEQ ID NO: 2) and ligated into the EcoRI and NotI sites
of pBABE-CMV-Puro..sup.58 The L68Q mutation was introduced by
QuikChange site-directed mutagenesis (Agilent, Santa Clara, Calif.)
using primers: GTGAACTACTTCTTGGACGTCGAGCAGGGCCGAACCACGTGTACC (SEQ
ID NO: 3) and GGTACACGTGGTTCGGCCCTGCTCGACGTCCAAGAAGTAGTTCAC (SEQ ID
NO: 4). All sequences were confirmed by Sanger sequencing. Wild
type and mutant constructs were transfected into HEK-293T cells
using Fugene HD (Promega, Madison, Wis.), with 3 .mu.g DNA and 9
.mu.l of the transfection reagent, according to the manufacturer's
protocol. After transfection cells were incubated with fresh medium
containing puromycin (1 .mu.g/ml) for 3 weeks. After selection,
stable clones of each transfectant were generated by limiting
dilution. Clones were screened by Western blot using anti-hCystatin
C antibody MAB1196 (R&D, Minneapolis, Minn.).
Western Blot
[0065] HEK-293T cells expressing hCC WT or the L68Q variant were
washed twice with ice-cold phosphate-buffered saline (PBS) and
lysed on ice using a freshly prepared ice-cold cell lysis buffer
containing 50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 50 mM
.beta.-glycerophosphate, 10% glycerol (w/v), 1% NP-40 (w/v), 1 mM
EDTA, 2 mM NaVO.sub.4, and a complete, EDTA-free, protein inhibitor
cocktail (Roche Applied Science, Mannheim Germany) at 20 .mu.l per
mL of lysis buffer. After clearing the cell lysates by
centrifugation (10 minutes, 21,000.times. g, 4.degree. C.), the
supernatants were collected and used for Western blotting. Sample
buffer containing SDS, glycerol, Tris-HCl pH 6.8, and bromophenol
blue was added to each sample to the following final
concentrations: 2% SDS, 10% glycerol, 50 mM Tris-HCl, 0.02%
bromophenol blue. In samples that were reduced, either DTT (50 mM
final concentration) or .beta.-mercaptoethanol (5% final
concentration) were added. Equal volumes of lysate or supernatant
samples were loaded on NuPAGE 4-12% Bis-Tris gels (Thermo Fisher
Scientific, Waltham Mass.) without heating/boiling. Proteins were
transferred to PVDF membranes (Millipore, Billerica, Mass.) and
blotted with anti-hCystatin C, and developed by enhanced
chemiluminescence (ECL; Thermo Fisher Scientific). ECL films were
scanned, and densities of bands were determined using the gel
analysis features of Fiji..sup.59
Drug Treatments
[0066] HEK-239T cells were plated on 6-well plates and cultured for
2 days, at which point reduced glutathione (GSH) (Sigma, St. Louis,
Mo.) or N-acetylcystein (NAC) (Sigma) were added to the indicated
concentrations. Cells were incubated with compounds for 72 hours,
and 100 .mu.l samples of supernatants were removed at 24, 48, and
72 hours. Supernatants were cleared by centrifugation (10 minutes,
21,000.times. g, 4.degree. C.). Sample buffer containing SDS,
glycerol, Tris-HCl pH 6.8, and bromophenol blue was added to each
sample to the following final concentrations: 2% SDS, 10% glycerol,
50 mM Tris-HCl, 0.02% bromophenol blue. When indicated, cells were
washed with PBS and lysed and cystatin C levels were determined by
means of Western blot analysis.
Statistical Analysis
[0067] The means and standard deviations of data were calculated.
One-sided T-test tests were used to determine the level of
significance with respect to the untreated samples, with p<0.05
being considered statistically significant.
Treatment of HCCAA Patients with NAC
[0068] Three 4 mm skin biopsies from the back were taken from each
of the three studied individuals. The skin biopsies were
formalin-fixed and paraffin-embedded. They were cut into 3 .mu.m
sections for immunohistochemistry and immunostained with rabbit
polyclonal cystatin C antibody (Sigma, HPA013143) using the
EnVision Detection System as previously described..sup.22 hCC
immunoreactivity in the carriers skin biopsies was quantified by
semi-automated image analysis using the ImageJ software as
previously described..sup.22 Bright-field images of each section
from the carriers were captured using a .times.20/0.3 NA objective.
RGB color images of the sections were imported to Image." On each
image, a rectangular 2000.times.2000 pixels region of interest
(ROI) was defined. Subsequent processing yielding the % area
coverage of hCC immunoreactivity within each ROI was performed as
previously described .sup.22. The first biopsy was a historical
biopsy taken approximately 2 years before the beginning of the
study, during which the proband had experienced over 9 months of
NAC therapy (400 mg 4.times. per day) to treat mucus plugging in
the lungs following her third stroke. The second biopsy was taken
immediately prior to the family-wide initiation of NAC treatment
(600 mg of NAC 3.times. per day for 6 months). The third biopsy was
taken following 6 months of 600 mg 3.times. per day of NAC
therapy.
[0069] The proband received 400 mg NAC 4.times. per day for 9
months followed by 600 mg 3.times. per day for 6 months. The parent
received only the 600 mg 3.times. per day for 6 months course. The
proband never missed a dose; the parent did miss the middle dose
2-3 times per week.
Study Approval
[0070] All necessary permits for the use of skin biopsies from
L68Q-CST3 carriers, and records associated with samples as well as
medical information, were obtained from the National Bioethics
Committee of Iceland, reference numbers 04-046-S2 and 15-060-S1.
Both family members signed the informed consent. The NAC therapy
was clinically and serendipitously prescribed as a mucolytic
therapy to treat lung atelectasis in the proband. The other family
member took NAC as a dietary supplement (i.e., purchasing NAC
on-line through Amazon).
[0071] The following Examples are provided to illustrate certain
embodiments of the invention. It is not intended to limit the
invention in any way.
EXAMPLE I
[0072] As discussed above, HCCAA is a dominantly inherited disease
caused by a leucine 68 to glutamine variant of Human Cystatin C
(hCC; L68Q-hCC) (reference). Most carriers of the mutation suffer
micro-infarcts and brain hemorrhages in their twenties leading to
paralysis, dementia and death in young adults, with an average live
expectancy of 30 years (1-5). Post-mortem studies in humans show
that hCC was deposited in all brain areas, grey and white matter
alike, most prominently in arteries and arterioles. These deposits
are composed of amyloid fibers, consisting of hCC; this can be
demonstrated through staining of post mortem tissue with Congo red
staining which causes amyloid structures to show birefringence
under polarized light (6).
[0073] To create a system in which to test the ability of a
compound to impact hCC multimerization while gaining some insight
into its toxicity, we created cell lines that express high amounts
of either wild type or mutant hCC. This example describes our
characterization of the cell lines and the monomeric and multimeric
hCC that they create, attempts to non-toxically interfere with
aggregation of the mutant protein as well as a pilot biomarker
study using NAC to treat human subjects with HCCAA.
[0074] Genetically Engineered HEK-293T Cells Produce and Secrete
hCC (wt or L68Q) Capable of Oligomerizing under Non-Reducing
Conditions.
In order to identify therapeutics agents capable of stopping the
production of oligomers and fibrils of L68Q hCC, we generated
genetically engineered HEK-293T cells with the expression of either
wild type (WT) or L68Q mutant hCC. The protein was tagged at the
c-terminus with a myc-tag; c-terminal tagging was chosen to avoid
any interference with the cleavage of the signal peptide or
secretion of the produced protein that may result from n-terminal
tagging. After stable integration of these constructs into HEK-293T
cells, we monitored both the secreted and the intracellular steady
state levels of hCC WT and the L68Q variant. Analysis of hCC was
developed by an SDS-PAGE gel electrophoresis system that allows the
formation and detection of low- and high-molecular weight oligomer
(LMW and HMW). As shown in FIG. 1A, cells produce and secrete
detectable levels of both, hCC WT or the variant L68Q, capable of
oligomerizing under non-reducing conditions (lanes #1 and 3). WT
and L68Q expressing cells contain similar levels of hCC protein in
lysates, indicating similar expression levels. However, conditioned
supernatants from the L68Q expressing cells contain far less hCC
protein than supernatants from the WT expressing cells. This
indicates that the L68Q variant protein is not secreted from cells
as effectively as the WT, consistent with previous reports (17,
18). While intracellular hCC WT exists predominantly as a monomer,
with a small percentage of dimer (99 and 1%, respectively),
intracellular hCC L68Q variant was found forming monomer, dimer but
also LMW and HMW species as expected due to its increased
propensity to form oligomers (19). Interestingly, the secreted form
of hCC WT behaves similarly to the intracellular fraction, being
found mainly as a monomer. In comparison, secreted hCC L68Q is
found only as HMW. Remarkably, the oligomerization of both
proteins, WT and L68Q variant, are completely abolished in presence
of reducing agents DTT or b-mercaptoethanol; both are strong
reducing agents that cause reduction of a typical disulfide
bond.
[0075] Immunofluorescence assay was performed to detect the level
of hCC protein in untransfected or WT and L68Q expressing 293T
cells. hCC protein was mainly expressed in the cytoplasma. It shows
a subcellular distribution consistent with the previously reported
localization in late-endosomes/prelysosomes, as well as in the
Golgi/ER/early-endosomal compartment, the latter in large agreement
with typical characteristics of a secretory protein (20).
Incubation with Glutathione Impairs hCC Di/Oligomerization in
Cellular Extracts and Supernatants
[0076] Depletion of LMW and HMW in presence of DTT or
.beta.-mercaptoetanol highlights the importance of disulfide bonds
for the dimerization/oligomerization process; therefore we
hypothesize that treatment with other reducing agents will impair
the dimerization. We extensively characterized the effect of
reducing agents on the dimerization/oligomerization levels of both
the secreted and the intracellular levels of hCC WT and L68Q
variant. Supernatants and cellular extracts were treated with
different concentrations of GSH at 37.degree. C. for 15 min.
Notably, as FIG. 2A shows, treatments with 3 or 10 mM of GSH
severely reduced the amount of dimer and/or HMW oligomer observed
in both the secreted and the intracellular fraction of hCC WT or
the L68Q variant. Quantitation of these results by densitometry
shows that 3 mM of GSH displayed a .apprxeq.90% inhibition of the
HMW in the secreted fraction and a inhibition on the intracellular
fraction of the L68Q hCC variant (FIG. 2A and FIG. 1B).
Incubation with NAC or Gluthathione Impairs Dimerization of
Secreted hCC L68Q
[0077] Oxidized/reduced glutathione pair is critical to fight
against oxidative stress, and, as shown in FIG. 2, it can
effectively disrupt the dimers and HMW oligomers of hCC.
Accordingly, we analyzed whether another reducing agent, the
commonly used dietary supplement NAC (with similar antioxidant
effects as GSH) would affect the oligomerization/dimerization of
secreted hCC. Supernatants were treated with different
concentrations of GSH and NAC at 37.degree. C. for 60 min. As FIG.
3A shows, treatments with 3 or 10 mM of glutathione or NAC severely
reduces the oligomerization/dimerization levels of secreted hCC
L68Q variant in vitro. Quantitation showed almost complete ablation
of HMW with 3 mM concentration of either GSH or NAC (FIG. 3A and
FIG. 2B). This result clearly demonstrates that GSH or NAC are able
to decrease the oligomerization levels of the pathogenic version of
hCC L68Q and can be potentially used as for treatment of patients
HCCAA.
Presence of GSH or NAC Reduces Oligomerization of Secreted Cystatin
C L68Q at 24, 48 and 72 h
[0078] To investigate whether the effect of NAC or GSH reduces the
olygomerization of secreted hCC L68Q in a cellular system more
reflective of in vivo biology, we treated cells expressing hCC WT
or L68Q with both agents. Cells were seeded in plates and allowed
to secrete hCC for 48 hours, at which point increasing
concentrations of GSH or NAC were added to the cultures. Cells were
cultured for 72 hours in the presence of reducing agents, with
samples of the supernatants being removed after 24, 48, and 72
hours. Oligomerization status of hCC was determined by western blot
at each time point. Cells were viable for the duration of the
experiment in the presence of all concentrations (up to 10 mM) of
both reducing agents. Proliferation of the cells was slightly
impacted at the highest 10 mM concentration (data not shown). As
shown in FIG. 4 (and FIG. 3B), treatment of cells with 10 mM of
either GSH or NAC completely abolished the presence of HMW and LMW
at 24 h and 48 h time points, and appreciable but incomplete
reduction of BMW and LMW persisted at 72 h. Treatments with lower
doses of NAC or GSH were only incompletely effective at 24 h and 48
h and no significant effect was detected after 72 h.
[0079] It is clear that treatment with reducing agents such as NAC
or reduced glutathione of either supernatants or cellular extracts
from cell lines engineered to overexpress the mutant version of
human cystatin C (Cyst-C) reduces the formation of high molecular
complexes of L68Q mutant Cyst-C. To determine if the effects of NAC
and GSH are due to their capacity as reducing agents or some other
properties of the compounds, supernatants and cell extracts were
treated with compounds structurally similar to NAC and GSH that
lack reducing activity. As shown in FIG. 5, treatment with either
n-acetyl-serine (NAS), where the reducing sulfhydryl group in NAC
is replaced with a hydroxyl group, or the oxidized form of
glutathione (GSSH), does not affect high molecular weight complexes
of L68Q Cyst-C, while significant reduction was observed with both
reducing agents. The reducing activity of either NAC or GSH is
required for the effects on Cyst-C oligomerization.
[0080] Multiple derivatives of NAC exhibiting improved reducing
activity and bioavailability, as well as the ability to cross the
blood/brain barrier have been generated. Two NAC derivatives have
been tested with our cell culture system. As shown in FIG. 6, both
an amide- and a methyl-ester derivative of NAC retain the ability
to disrupt high molecular weight complexes of L68Q Cyst-C, when
either supernatants or cell extracts are treated in vitro. Our data
also indicate that both derivatives may be slightly more potent in
their ability to disrupt oligomerization, as loss of high molecular
signal was observed at 1 mM of the derivatives equivalent to that
seen with 10 mM of NAC.
[0081] Additional results have been generated from transgenic mice
that were obtained from our collaborator Eufrat Levy at New York
University. These mice have been transformed with a human genomic
DNA which contains the coding sequence of Cyst-C, while lacking
non-coding portions of the gene which may impact expression levels.
The mice do not display a phenotype comparable to that of HCCAA.
However, we as shown in FIG. 7, we have been able to show the
presence of high molecular weight Cyst-C complexes in both brain
and blood of transgenic animals. Western blots from the mouse
tissue extracts are not as clean as blots from the cell system, as
the antibody we use to detect was raised in a mouse. Despite this
complication, comparison of the transgenic mice (numbers 6028 and
6019) to the non-transgenic C57B16 animal shows considerable signal
caused by the transgenic human Cyst-C. Although there are several
non-specific high molecular weight bands observed in the
non-transgenic samples, a clear high molecular weight "smear" is
seen in the transgenic animals, consistent with what we observe in
supernatant from the cell culture system. Treatment with NAC
reduces this smear, and causes the appearance of monomer, showing
that NAC is capable of reducing oligomerization in biological
samples.
Effects of NAC Therapy in HCCAA Patients
[0082] There are several hundred patients in Iceland who suffer
from HCCAA (i.e., suffering major strokes in their early 20's) and
they all result from a founder mutation from the early 1500s. We
have performed RNAseq on 30 subjects from 3 multiplex families and
shown that genes involved in coronary disease, stroke and
atherosclerosis are upregulated in mutation carriers of Cystatin C.
As there is no therapy available for these patients, intervention
that has a potential to delay or reverse the disease process would
be readily approved by the Icelandic Medicinal Agency. Amyloid
fiber dimerization is a critical step in the amyloid deposition
process into small-medium sized brain arteries. In cell-based
assays, we have shown that both the wild type and mutated proteins
are expressed and that expression of the mutated protein dimerizes,
a process that can be inhibited. Thus, drugs that block
dimerization of the amyloid fibers would be anticipated to be
effective in preventing amyloid deposition and halt progression of
the disease process, thereby presenting an effective therapy.
[0083] FIG. 8A demonstrates the changes in staining from biopsy 1
obtained in all 3 individuals, 2 years ago, biopsy 2 obtained 6
months ago and biopsy 3 obtained 2 weeks ago post 6 months of NAC
therapy. So overall the drug is reducing the intensity of the
biomarker (amyloid-cystatin protein aggregate) in the skin,
suggesting that amyloid precipitation in other organs is also
reduced as previously demonstrated (21).
[0084] Based on staining results measuring the amyloid-cystatin
protein complex aggregates in the skin, it became evident that the
proband who had very high level of amyloid-cystatin stain on the
first skin biopsy had not progressed in any significant way
(measured by the intensity of the stain) between skin biopsy #1 and
#2, whereas her father and her older sibling (both of whom are also
carriers of the L68Q mutant) showed significant progression in the
intensity of the stain, reflective of increased amyloid complex
precipitation in the skin over time in the absence of NAC therapy.
It is noteworthy that the proband was on the NAC drug for about 9
months to treat her lungs. She had stopped the therapy only for a
few months prior to the second biopsy. Second biopsy was performed
first as a baseline to serve as biomarker response to subsequent
NAC therapy.
[0085] The three biopsies for each individual were stained all
together at the same time, for legitimate comparison. The lead
proband (stroke .times.3 in 9 months) has been 100% compliant with
NAC therapy of 600 mg 3.times. per day and she demonstrated highly
visible reduction in the amyloid stain in comparison with her
original skin biopsy, which amounted to 75% reduction at the end of
the 6 months of prospective therapy (FIG. 8A). Her father's
reduction in staining amounted to 50% and reduction in staining of
her sister's biopsy was less obvious as she had taken lower doses
of NAC as indicated in material and methods sections.
[0086] Finally, blood samples were acquired from 7 members of an
Icelandic family known to be carriers of the L68Q mutation. Five of
the family members were of known mutation status (3 L68Q carriers,
2 wild type), and DNA from all individuals was Sanger sequenced to
confirm known statuses and to determine the status of the
previously unexamined individuals, one of whom was found to carry
the mutation. Mutation status and relationship to the proband in
this family are shown in FIG. 8B. Western blotting of plasma run
under reducing conditions showed a reduction of the amount of total
Cyst-C in adult carriers of the L68Q mutation (proband, sibling,
father). The child carrier did not show a reduction in the amount
of protein, indicating potential age-related effects (also not on
any therapy). Blotting of non-reduced samples showed detection of
high molecular weight complexes in the child carrier. In other
subjects, interpretation of these results is complicated by the
fact that the adult carriers of the mutation are all taking NAC
regularly. It is possible that oligomers would be detectable in
adult L68Q carriers not taking NAC.
[0087] Both NAC derivatives have been proposed to have increased
membrane permeability, due to the replacement of a hydroxyl group
with less polar substituents. Increased membrane permeability often
correlates with better crossing of the blood brain barrier. To
access the membrane permeability of the derivative compounds, live
cells were treated with NAC or the derivatives. If the compounds
cross the cell membrane, we expect to see impacts of the
derivatives on accumulation of intracellular oligomers of L68Q
Cyst-C. As shown in FIG. 6, the compounds reduced the amount of
high molecular weight Cyst-C in the supernatants. The lesser
effects on the intracellular material is likely due to a timing
issue. The cells continuously produce L68Q Cyst-C at overexpressed
levels, and any compound that enters the cells may be consumed
quickly, having an earlier effect that is lost with continued
culture.
Discussion
[0088] Identification of agents with the ability to reduce hCC
dimerization and amyloid fibril formation is the key for the
development of drugs for the treatment and/or prevention of the
amyloid formation and lethal brain hemorrhage associated with
HCCAA. The hCC variant is responsible for HCCAA and there is no
treatment available to avoid early death by brain hemorrhage. Here,
we first created cells that produce and secrete detectable levels
of hCC (wt or L68Q) capable of oligomerizing under non-reducing
conditions, and we then show that short incubation with either GSH
or NAC breaks oligomers into monomers of both intracellular and
secreted hCC L68Q. We show that treatment with either NAC or GSH
reduces oligomerization of the secreted hCC L68Q at 24, 48 and 72 h
and that treatment with NAC in human patients not only prevents
ongoing precipitation of amyloid in the skin, but also reduces
previously precipitated amyloid in a significant way, with over 75%
reduction observed following 6 months of oral therapy with doses
that are well tolerated and without adverse events.
[0089] The cellular system developed was constructed to identify
agents that could reduce the hCC dimerization and amyloid fibril
formation "in vivo" of both wt cystatin C and L68Q variant.
Previous systems for the study of the dimerization of hCC had been
developed, however, most of them were performed mainly with
wildtype cystatin C as it is extremely difficult to produce
sufficient amounts of monomeric L68Q-cystatin C (14). The
genetically engineered HEK-293T cells with the expression of both
c-terminal tagged wt and L68Q hCC provide a superior model to study
and characterize the impact of the small molecules on both the
secreted and the intracellular levels of wt and L68Q hCC. It is
important to highlight that the study and characterization of
agents that reduce oligomerization should be made on both fractions
because the behavior is different; in particular, on the L68Q-hCC
variant. This variant was found mainly as LMW oligomers in the
intracellular fraction but mainly forms HMW in the extracellular
compartment. These can be due to either the secretion process
induces oligomerization of the L68Q variant or because the
environmental conditions of the extracellular compartment promote
the oligomerization of this variant or because the oligomerization
prolonges the half-life of the protein.
[0090] L68Q cystatin C, is highly amyloidogenic, and subjects
carrying the corresponding mutation suffer from massive cerebral
amyloidosis leading to brain hemorrhage and death in early adult
life (16). Other amyloid diseases such as Alzheimer, Parkinson, and
HD have similar amyloid origins and they are also caused by
accumulation of misfolded proteins. This broad-spectrum effect of
proteotoxic stress has led to the term "proteinopathies" for
neurodegenerative diseases. Interestingly, the risk of getting any
of these neurodegenerative diseases increases dramatically with age
(22), probably, as a consequence of an increase in
protein-misfolding stress, a reduced proteasome activity and a
decrease in antioxidant defenses that drive to an extracellular
accumulation of misfolded proteins (22). The proteasome and
autophagy-lysosomal pathways are the major routes for intracellular
aggregation clearance. However, little is known about any
corresponding mechanisms that operate extracellularly and about
effective strategies to slow or prevent the neurodegeneration
resulting from these diseases in humans (23).
[0091] Glutathione (GSH) is synthesized in the cytosol from the
precursor amino acids glutamate, cysteine and glycine and it is
considered the primary endogenous antioxidant in the cell. It is
present in the cell at different concentrations, which can go up to
10 mM, depending on the subcellular compartment being present at
high concentrations on the cytosol and very low concentration
inside the ER (24). Protein disulfide bonds rarely form in the
cytosol because of the high concentrations of GSH, by contrast, the
lumen of the endoplasmic reticulum (ER) and the extracellular
compartment contains a relatively higher concentration of oxidized
glutathione (GSSG) (25). This differential distribution of GSH
allows the formation of native disulfide bonds in the ER through a
complex process involving not only disulfide-bond formation, but
also the isomerization of non-native disulfide bonds. Our
immunofluorescence studies and previous reports indicate that hCC
localizes in late-endosomes/prelysosomes, as well as in the
Golgi/ER/early-endosomal compartment (20). This localization is in
agreement with typical characteristics of a secretory protein and
it is consistent with the hypothesis that L68Q hCC polymerizes in
these compartments where exposure to GSH is reduced thereby
increasing aggregation, thus, explaining the released aggregates in
the extracellular compartment.
[0092] Under normal conditions, GSH levels are regulated by two
major mechanisms: by controlling the rates of its synthesis and of
its export from cells; however, GSH levels are also influenced by
agents or conditions that alter the thiol redox state that lead to
the formation of glutathione S-conjugates or complexes, and/or that
disrupt the distribution of GSH among various intracellular
organelles. In addition, GSH levels are affected by the nutritional
status and hormonal/stress levels, they exhibit developmental and
diurnal variations, and are affected by certain physiological
states, including pregnancy and exercise (26-33). Physiological
levels of GSH in blood should provide an appropriate antioxidant
environment that avoids extracellular accumulation of proteins,
however, presence of mutations like hCC L68Q or deficiencies in the
levels of GSH, as a consequence of nutritional status or age, could
drive to undesired accumulation of misfolded proteins (3). In
addition, it is known that GSH deficiency, or a decrease in the
GSH/glutathione disulfide (GSSG) ratio, manifests itself largely
through an increased susceptibility to oxidative stress, and the
resulting damage is thought to be involved in diseases such as
Parkinson's disease, and Alzheimer's disease and it is strongly
associated with other age-related pathologies (34, 35). Results
shown in this work indicates that NAC can represent an interesting
therapeutic approach to amyloid diseases such as HCCAA, by the
reduction of accumulation of amyloid proteins.
[0093] Acetylcysteine is a synthetic N-acetyl derivative of the
endogenous amino acid L-cysteine, a precursor of the antioxidant
enzyme glutathione. Both GSH and NAC already have been approved for
use in humans and have been administered at high doses for long
periods without adverse side effects. They work as a direct
reactive oxygen species (ROS) scavenger and as a source of SH
groups, stimulating the GSH synthesis and increasing the presence
of 1) non-protein and 2) protein SH groups. Acetylcysteine, in
addition, also regenerates liver stores of GSH. These effects
confer NAC the ability to reduce disulfide bounds and are the
reason why NAC is widely used to reduce viscosity and elasticity of
the mucus among other uses. Our data show that treatment with
antioxidants such as GSH and NAC (and also DTT or beta-MetOH)
abolishes hCC oligomerization. This effect indicates that disulfide
bond formation is essential for the oligomerization process.
Disulfide bonds do not appear to be directly involved in the
dimerization process (16), however the presence of two disulfide
bonds in human cystatin C (as in all type 2 cystatins), and the
preservation of them in the dimeric structure indicates its key
role in the dimerization process (16). We postulate that the
intramolecular disulfide bonds are essential for the correct
folding of the hCC monomer and for the exchange of
three-dimensional `subdomains` between the two subunits of the
dimer and its impairment abolish the oligomerization.
[0094] Our data show that treatment with NAC will increase GSH
production and both antioxidants will reduce oligomerization of the
secreted hCC reducing the amyloid formation on the brain of persons
with HCCAA. Treatment with GSH may be effective, however, its low
bioavailability limits it's potential as a therapeutic for the
treatment of patients with HCCAA. NAC appears as the perfect
candidate because of its role in restoring GSH levels, antioxidant
properties, and its ability to break disulfide bonds reviewed in
(36). In addition, NAC supplementation significantly improved
coronary and peripheral vasodilatation (37). Specific to brain
disorders, NAC has been administered with some efficacy in patients
with Alzheimer disease (38), and our data show that it can be a
good alternative for the HCCAA.
[0095] Cellular membranes, along with the blood-brain barrier,
exhibit reduced permeability to NAC, thus extracellular NAC
treatment does not appear to impact the dimerization status of the
intracellular levels of L68Q hCC (data not shown). Accordingly, the
effects of NAC derivatives including without limitation,
N-acetylcysteine ethyl ester (NACET) or N-acetylcysteine methyl
ester are preferably administered. These novel lipophilic cell
permeable membrane cysteine derivatives should provide good
candidates for the oral use as an H.sub.2S producer in the
treatment of amyloid disease like HCCAA (39).
[0096] The reduction observed in the amyloid stain in the skin
biopsies with NAC treatment is highly encouraging and indicates
that this therapy will have efficacy in treating patients with
HCCAA. As amyloid precipitates in all organs, there is no reason to
believe that there is ongoing precipitation and accumulation of
amyloid in the brain, when reduction is observed in the skin. More
likely, there is similar reduction in other body organs, including
brain vessels and the brain. No new events have occurred in any of
the 3 individuals, all of whom have continued therapy and the
proband is now approximately two years post her third and last
stroke.
[0097] It is noteworthy that a significant number of the HCCAA
patients in Iceland never get a clinical stroke, and only present
with dementia at an early age. As the disease process of amyloid
precipitation is comparable in HCCAA patients to that in Alzheimer
disease, blocking the ability of amyloid fibers to dimerize and
polymerize (which is enhanced by the L68Q-cystatin C founder
mutation cases), could help Alzheimer patients with amyloid
associated dementia. Thus, NAC therapy or NAC-like compounds could
be beneficial for Alzheimer disease.
[0098] The analogy here is familial combined hypercholesterolemia
(FCH), as statin drugs were developed to treat this familial
condition (patients with FCH develop stroke and myocardial
infarction in their 20s); it subsequently became evident that
elevated cholesterol was harmful and a major risk factor for MI and
stroke, and that patients with CV risk factors benefitted from
statin treatment. HCCAA is an enhanced amyloid precipitation that
occurs in early life and leads to catastrophic events in the 20's
and early dementia. This process is somewhat comparable but occurs
slower in Alzheimer disease so the dementia typically presents not
until mid to late 60's or 70's--whereas the treatment would be the
same.
REFERENCES
[0099] 1. Palsdottir, A. et al. Mutation in cystatin C gene causes
hereditary brain haemorrhage. Lancet 2, 603-604 (1988). [0100] 2.
Abrahamson, M., Barrett, A. J., Salvesen, G. & Grubb, A.
Isolation of six cysteine proteinase inhibitors from human urine.
Their physicochemical and enzyme kinetic properties and
concentrations in biological fluids. J Biol Chem 261, 11282-11289
(1986). [0101] 3. Snorradottir, A. O. et al. Deposition of collagen
IV and aggrecan in leptomeningeal arteries of hereditary brain
haemorrhage with amyloidosis. Brain Res 1535, 106-114 (2013).
[0102] 4. Palsdottir, A. et al. A drastic reduction in the life
span of cystatin C L68Q carriers due to life-style changes during
the last two centuries. PLoS Genet 4, e1000099 (2008). [0103] 5.
Gudmundsson, G., Hallgrimsson, J., Jonasson, T. A. & Bjarnason,
O. Hereditary cerebral haemorrhage with amyloidosis. Brain 95,
387-404 (1972). [0104] 6. Osk Snorradottir, A. et al. Parenchymal
cystatin C focal deposits and glial scar formation around brain
arteries in Hereditary Cystatin C Amyloid Angiopathy. Brain Res
1622, 149-162 (2015). [0105] Abrahamson, M., Grubb, A., Olafsson,
I. & Lundwall, A. Molecular cloning and sequence analysis of
cDNA coding for the precursor of the human cysteine proteinase
inhibitor cystatin C. FEBS Lett 216, 229-233 (1987). [0106] 8.
Grubb, A. & Lofberg, H. Human gamma-trace, a basic
microprotein: amino acid sequence and presence in the
adenohypophysis. Proc Natl Acad Sci USA 79, 3024-3027 (1982).
[0107] 9. Grubb, A. O. Cystatin C--properties and use as diagnostic
marker. Adv Clin Chem 35, 63-99 (2000). [0108] 10. Henskens, Y. M.
et al. Effect of periodontal treatment on the protein composition
of whole and parotid saliva. J Periodontol 67, 205-212 (1996).
[0109] 11. Turk, V. & Bode, W. The cystatins: protein
inhibitors of cysteine proteinases. FEBS Lett 285, 213-219 (1991).
[0110] 12. Bode, W. et al. The 2.0 A X-ray crystal structure of
chicken egg white cystatin and its possible mode of interaction
with cysteine proteinases. EMBO J7, 2593-2599 (1988). [0111] 13.
Orlikowska, M., Jankowska, E., Kolodziejczyk, R., Jaskolski, M.
& Szymanska, A. Hinge-loop mutation can be used to control 3D
domain swapping and amyloidogenesis of human cystatin C. J Struct
Biol 173, 406-413 (2011). [0112] 14. Kolodziejczyk, R. et al.
Crystal structure of human cystatin C stabilized against amyloid
formation. FEBS J 277, 1726-1737 (2010). [0113] 15. Janowski, R. et
al. Human cystatin C, an amyloidogenic protein, dimerizes through
three-dimensional domain swapping. Nat Struct Biol 8, 316-320
(2001). [0114] 16. Janowski, R., Abrahamson, M., Grubb, A. &
Jaskolski, M. Domain swapping in N-truncated human cystatin C. J
Mol Biol 341, 151-160 (2004). [0115] 17. Janowski, R., Kozak, M.,
Abrahamson, M., Grubb, A. & Jaskolski, M. 3D domain-swapped
human cystatin C with amyloidlike intermolecular beta-sheets.
Proteins 61, 570-578 (2005). [0116] 18. Wahlbom, M. et al.
Fibrillogenic oligomers of human cystatin C are formed by
propagated domain swapping. J Biol Chem 282, 18318-18326 (2007).
[0117] 19. Tsiolaki, P. L., Louros, N. N., Hamodrakas, S. J. &
Iconomidou, V. A. Exploring the `aggregation-prone` core of human
Cystatin C: A structural study. J Struct Biol 191, 272-280 (2015).
[0118] 20. Sipe, J. D. et al. Amyloid fibril protein nomenclature:
2012 recommendations from the Nomenclature Committee of the
International Society of Amyloidosis. Amyloid 19, 167-170 (2012).
[0119] 21. Palsdottir, A., Snorradottir, A. O. & Thorsteinsson,
L. Hereditary cystatin C amyloid angiopathy: genetic, clinical, and
pathological aspects. Brain Pathol 16, 55-59 (2006). [0120] 22.
Snorradottir, A. O. et al. Pathological changes in basement
membranes and dermal connective tissue of skin from patients with
hereditary cystatin C amyloid angiopathy. Lab Invest 97, 383-394
(2017). [0121] 23. Perlenfein, T. J., Mehlhoff, J. D. & Murphy,
R. M. Insights into the mechanism of cystatin C oligomer and
amyloid formation and its interaction with beta-amyloid. J Biol
Chem 292, 11485-11498 (2017). [0122] 24. Ostner, G. et al. High
throughput testing of drug library substances and monoclonal
antibodies for capacity to reduce formation of cystatin C dimers to
identify candidates for treatment of hereditary cystatin C amyloid
angiopathy. Scandinavian Journal of Clinical and Laboratory
Investigation 71, 676-682 (2011). [0123] 25. Chen, J., Armstrong,
A. H., Koehler, A. N. & Hecht, M. H. Small molecule microarrays
enable the discovery of compounds that bind the Alzheimer's Abeta
peptide and reduce its cytotoxicity. J Am Chem Soc 132, 17015-17022
(2010). [0124] 26. Nilsson, M. et al. Prevention of domain swapping
inhibits dimerization and amyloid fibril formation of cystatin C:
use of engineered disulfide bridges, antibodies, and
carboxymethylpapain to stabilize the monomeric form of cystatin C.
J Biol Chem 279 (2004). [0125] 27. Ostner, G. et al. Stabilization,
Characterization, and Selective Removal of Cystatin C Amyloid
Oligomers. Journal of Biological Chemistry 288, 16438-16450 (2013).
[0126] 28. Pollak, J., Szymanska, A., Lindstrom, V. & Grubb, A.
Production of Cystatin C Wild Type and Stabilized Mutants. EJIFCC
20, 166-170 (2010). [0127] 29. Bjarnadottir, M. et al.
Intracellular accumulation of the amyloidogenic L68Q variant of
human cystatin C in NIH/3T3 cells. Mol Pathol 51, 317-326 (1998).
[0128] 30. Benedikz, E. et al. Cellular processing of the
amyloidogenic cystatin C variant of hereditary cerebral hemorrhage
with amyloidosis, Icelandic type. Amyloid 6, 172-182 (1999). [0129]
31. Thorsteinsson, L. et al. On the role of monocytes/macrophages
in the pathogenesis of central nervous system lesions in hereditary
cystatin C amyloid angiopathy. J Neurol Sci 108, 121-128 (1992).
[0130] 32. Wei, L. et al. Instability of the amyloidogenic cystatin
C variant of hereditary cerebral hemorrhage with amyloidosis,
Icelandic type. J Biol Chem 273, 11806-11814 (1998). [0131] 33.
Merz, G. S. et al. Human cystatin C forms an inactive dimer during
intracellular trafficking in transfected CHO cells. J Cell Physiol
173, 423-432 (1997). [0132] 34. Xu, Y., Lindemann, P., Vega-Ramos,
J., Zhang, J. G. & Villadangos, J. A. Developmental regulation
of synthesis and dimerization of the amyloidogenic protease
inhibitor cystatin C in the hematopoietic system. J Biol Chem 289,
9730-9740 (2014). [0133] 35. Benedikz, E., Blondal, H. &
Gudmundsson, G. Skin deposits in hereditary cystatin C amyloidosis.
Virchows Arch A Pathol Anat Histopathol 417, 325-331 (1990). [0134]
36. Unnithan, A. S., Choi, H. J., Titler, A. M., Posimo, J. M.
& Leak, R. K. Rescue from a two hit, high-throughput model of
neurodegeneration with N-acetyl cysteine. Neurochem Int 61, 356-368
(2012). [0135] 37. Yerbury, J. J., Stewart, E. M., Wyatt, A. R.
& Wilson, M. R. Quality control of protein folding in
extracellular space. EMBO Rep 6, 1131-1136 (2005). [0136] 38. Lai,
A. Y. & McLaurin, J. Clearance of amyloid-beta peptides by
microglia and macrophages: the issue of what, when and where.
Future Neurol 7, 165-176 (2012). [0137] 39. Go, Y. M. & Jones,
D. P. Redox compartmentalization in eukaryotic cells. Biochim
Biophys Acta 1780, 1273-1290 (2008). [0138] 40. Hwang, C., Sinskey,
A. J. & Lodish, H. F. Oxidized redox state of glutathione in
the endoplasmic reticulum. Science 257, 1496-1502 (1992). [0139]
41. Lautwein, A. et al. Inflammatory stimuli recruit cathepsin
activity to late endosomal compartments in human dendritic cells.
Eur J Immunol 32, 3348-3357 (2002). [0140] 42. DeLeve, L. D. &
Kaplowitz, N. Importance and regulation of hepatic glutathione.
Semin Liver Dis 10, 251-266 (1990). [0141] 43. Hahn, R., Wendel, A.
& Flohe, L. The fate of extracellular glutathione in the rat.
Biochim Biophys Acta 539, 324-337 (1978). [0142] 44. Isaacs, J. T.
& Binkley, F. Cyclic AMP-dependent control of the rat hepatic
glutathione disulfide-sulfhydryl ratio. Biochim Biophys Acta 498,
29-38 (1977). [0143] 45. Kemp, M., Go, Y. M. & Jones, D. P.
Nonequilibrium thermodynamics of thiol/disulfide redox systems: a
perspective on redox systems biology. Free radical biology &
medicine 44, 921-937 (2008). [0144] 46. Lauterburg, B. H., Smith,
C. V., Hughes, H. & Mitchell, J. R. Biliary excretion of
glutathione and glutathione disulfide in the rat. Regulation and
response to oxidative stress. J Clin Invest 73, 124-133 (1984).
[0145] 47. Meister, A. & Tate, S. S. Glutathione and related
gamma-glutamyl compounds: biosynthesis and utilization. Annu Rev
Biochem 45, 559-604 (1976). [0146] 48. Meister, A. & Anderson,
M. E. Glutathione. Annu Rev Biochem 52, 711-760 (1983). [0147] 49.
Uhlig, S. & Wendel, A. The physiological consequences of
glutathione variations. Life Sci 51, 1083-1094 (1992). [0148] 50.
Ballatori, N. et al. Glutathione dysregulation and the etiology and
progression of human diseases. Biol Chem 390, 191-214 (2009).
[0149] 51. Samiec, P. S. et al. Glutathione in human plasma:
decline in association with aging, age-related macular
degeneration, and diabetes. Free radical biology & medicine 24,
699-704 (1998). [0150] 52. Atkuri, K. R., Mantovani, J. J.,
Herzenberg, L. A. & Herzenberg, L. A. N-Acetylcysteine--a safe
antidote for cysteine/glutathione deficiency. Curr Opin Pharmacol
7, 355-359 (2007). [0151] 53. Aitio, M. L.
N-acetylcysteine--passe-partout or much ado about nothing? Br J
Clin Pharmacol 61, 5-15 (2006). [0152] 54. Bavarsad Shahripour, R.,
Harrigan, M. R. & Alexandrov, A. V. N-acetylcysteine (NAC) in
neurological disorders: mechanisms of action and therapeutic
opportunities. Brain Behav 4, 108-122 (2014). [0153] 55. Andrews,
N. P., Prasad, A. & Quyyumi, A. A. N-acetylcysteine improves
coronary and peripheral vascular function. J Am Coll Cardiol 37,
117-123 (2001). [0154] 56. Adair, J. C., Knoefel, J. E. &
Morgan, N. Controlled trial of N-acetylcysteine for patients with
probable Alzheimer's disease. Neurology 57, 1515-1517 (2001).
[0155] 57. Giustarini, D., Milzani, A., Dalle-Donne, I., Tsikas, D.
& Rossi, R. N-Acetylcysteine ethyl ester (NACET): A novel
lipophilic cell-permeable cysteine derivative with an unusual
pharmacokinetic feature and remarkable antioxidant potential.
Biochemical pharmacology 84, 1522-1533 (2012). [0156] 58. Cohen, G.
B. et al. The selective downregulation of class I major
histocompatibility complex proteins by HIV-1 protects HIV-infected
cells from NK cells. Immunity 10, 661-671 (1999). [0157] 59.
Schindelin, J. et al. Fiji: an open-source platform for
biological-image analysis. Nat Methods 9, 676-682 (2012).
[0158] While certain of the preferred embodiments of the present
invention have been described and specifically exemplified above,
it is not intended that the invention be limited to such
embodiments. It will be apparent to one skilled in the art that
various changes and modifications can be made therein without
departing from the scope of the present invention, as set forth in
the following claims.
* * * * *