U.S. patent application number 16/101762 was filed with the patent office on 2019-02-28 for methods of treating autophagy-associated disorders and related pharmaceutical compositions, diagnostics, screening techniques and kits.
The applicant listed for this patent is STC.UNM. Invention is credited to Steven Bradfute, Eliseo Castillo, Vojo Deretic, Larry A Sklar.
Application Number | 20190060289 16/101762 |
Document ID | / |
Family ID | 47139997 |
Filed Date | 2019-02-28 |
![](/patent/app/20190060289/US20190060289A1-20190228-D00001.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00002.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00003.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00004.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00005.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00006.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00007.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00008.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00009.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00010.png)
![](/patent/app/20190060289/US20190060289A1-20190228-D00011.png)
View All Diagrams
United States Patent
Application |
20190060289 |
Kind Code |
A1 |
Deretic; Vojo ; et
al. |
February 28, 2019 |
METHODS OF TREATING AUTOPHAGY-ASSOCIATED DISORDERS AND RELATED
PHARMACEUTICAL COMPOSITIONS, DIAGNOSTICS, SCREENING TECHNIQUES AND
KITS
Abstract
The invention provides methods of treating autophagy mediated
diseases and disorders and related pharmaceutical compositions,
diagnostics, screening techniques and kits. In one embodiment, the
invention provides a method of determining whether a subject
suffers from, or is at risk of developing, and autophagy mediated
disease state and/or condition by evaluating LC3 levels.
Inventors: |
Deretic; Vojo; (Placitas,
NM) ; Castillo; Eliseo; (Albuquerque, NM) ;
Bradfute; Steven; (Albuquerque, NM) ; Sklar; Larry
A; (Albuquerque, NM) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
STC.UNM |
Albuquerque |
NM |
US |
|
|
Family ID: |
47139997 |
Appl. No.: |
16/101762 |
Filed: |
August 13, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15287323 |
Oct 6, 2016 |
|
|
|
16101762 |
|
|
|
|
14116581 |
Nov 8, 2013 |
9572820 |
|
|
PCT/US2012/037300 |
May 10, 2012 |
|
|
|
15287323 |
|
|
|
|
61484653 |
May 10, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/56972 20130101;
A61K 31/522 20130101; A61K 31/4535 20130101; A61K 31/136 20130101;
A61K 31/4365 20130101; A61K 31/54 20130101; A61K 31/473 20130101;
G01N 2333/9015 20130101; A61K 31/5685 20130101; A61K 31/436
20130101; A61K 31/519 20130101; A61K 31/472 20130101; A61K 31/546
20130101; A61P 29/00 20180101; A61K 31/65 20130101; A61K 31/12
20130101; A61K 31/585 20130101; G01N 33/6893 20130101; A61K 31/517
20130101; A61K 31/4184 20130101; C07K 16/18 20130101 |
International
Class: |
A61K 31/436 20060101
A61K031/436; A61K 31/54 20060101 A61K031/54; A61K 31/12 20060101
A61K031/12; A61K 31/136 20060101 A61K031/136; A61K 31/585 20060101
A61K031/585; A61K 31/472 20060101 A61K031/472; A61K 31/473 20060101
A61K031/473; A61K 31/4535 20060101 A61K031/4535; A61K 31/546
20060101 A61K031/546; A61K 31/4365 20060101 A61K031/4365; A61K
31/519 20060101 A61K031/519; A61K 31/5685 20060101 A61K031/5685;
A61K 31/517 20060101 A61K031/517; A61K 31/522 20060101 A61K031/522;
A61K 31/4184 20060101 A61K031/4184; G01N 33/68 20060101 G01N033/68;
C07K 16/18 20060101 C07K016/18; G01N 33/569 20060101 G01N033/569;
A61K 31/65 20060101 A61K031/65 |
Goverment Interests
RELATED APPLICATIONS AND GOVERNMENT SUPPORT
[0002] The invention described herein was funded in part by
National Institute of Health Grant No. RO1 A1069345. Accordingly,
the United States has certain rights in the invention.
Claims
1. A method of determining whether a patient or subject suffers
from, or is at risk of developing an autophagy mediate disease
state or condition, the method comprising determining LG3 levels on
white blood cells or in plasma obtained from the subject and
comparing the determined LC3 level to a control LC3 level, wherein
an increase or decrease in LC3 levels compared to a control LC3
level indicates an increased likelihood that the subject suffers
from or is at risk of developing an autophagy-mediated disease
state or condition.
2-46. (canceled)
47. A pharmaceutical composition comprising: (a) an autophagy
modulator (autostatin) in an effective amount; and optionally (b) a
pharmaceutically-acceptable carrier, additive and/or excipient, and
further optionally (c) at least one additional bioactive agent.
48. The composition according to claim 47 wherein said autophagy
modulator is selected from the group consisting of flubendazole,
hexachlorophene, propidium iodide, bepridil, clomiphene citrate
(Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine,
dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine,
norcyclobenzaprine, diperodon, nortriptyline,
tetrachlorisophthalonitrile and phenylmercuric acetate,
pharmaceutically acceptable salts thereof and mixtures thereof.
49. The composition according to claim 47 wherein said autophagy
modulator is selected from the group consisting of flubendazole,
hexachlorophene, propidium iodide, bepridil, clomiphene citrate
(Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine,
dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine,
norcyclobenzaprine, diperodon, nortriptyline pharmaceutically
acceptable salts thereof and mixtures thereof.
50. The composition according to claim 47 wherein said autophagy
modulator is tetrachlorisophthalonitrile, phenylmercuric acetate,
pharmaceutically acceptable salts thereof and mixtures thereof.
51. The composition according to any of claims 47-50 wherein said
additional bioactive agent includes an additional autophagy
modulator.
52. The composition according to claim 51 wherein said additional
autophagy modulator is selected from the group consisting of
benzethonium, niclosamide, monensin, bromperidol, levobunolol,
dehydroisoandosterone 3-acetate, sertraline, tamoxifen, reserpine,
hexachlorophene, dipyridamole, harmaline, prazosin, lidoflazine,
thiethylperazine, dextromethorphan, desipramine, mebendazole,
canrenone, chlorprothixene, maprotiline, homochlorcyclizine,
loperamide, nicardipine, dexfenfluramine, nilvadipine, dosulepin,
biperiden, denatonium, etomidate, toremifene, tomoxetine,
clorgyline, zotepine, beta-escin, tridihexethyl, ceftazidime,
methoxy-6-harmalan, melengestrol, albendazole, rimantadine,
chlorpromazine, pergolide, cloperastine, prednicarbate,
haloperidol, clotrimazole, nitrofural, iopanoic acid, naftopidil,
methimazole, trimeprazine, ethoxyquin, clocortolone, doxycycline,
pirlindole mesylate, doxazosin, deptropine, nocodazole,
scopolamine, oxybenzone, halcinonide, oxybutynin, miconazole,
clomipramine, cyproheptadine, doxepin, dyclonine, salbutamol,
flavoxate, amoxapine, fenofibrate, pimethixene, pharmaceutically
acceptable salts thereof and mixtures thereof.
53. The composition according to claim 47 wherein said additional
bioactive agent is an antibiotic or an antiviral agent.
54. The composition according to claim 53 wherein said antiviral
agent is an anti-HIV agent, an anti-HBV agent, anti-influenza
agent, an anti-herpes agent or an anti-HCV agent.
55. The composition according to claim 54 wherein said antiviral
agent is an anti-HIV agent is a nucleoside reverse transcriptase
inhibitor (NRTI), a non-nucleoside reverse transcriptase inhibitor
(NNRTI), a protease inhibitor, a fusion inhibitor or a mixture
thereof.
56. The composition according to claim 54 wherein said anti-HIV
agent is 3TC (Lamivudine), AZT (Zidovudine), (-)-FTC, ddI
(Didanosine), ddC (zalcitabine), abacavir (ABC), tenofovir (PMPA),
D-D4FC (Reverset), D4T (Stavudine), Racivir, L-FddC, L-FD4C, NVP
(Nevirapine), DLV (Delavirdine), EFV (Efavirenz), SQVM (Saquinavir
mesylate), RTV (Ritonavir), IDV (Indinavir), SQV (Saquinavir), NFV
(Nelfinavir), APV (Amprenavir), LPV (Lopinavir), fusion inhibitors
such as T20, among others, fuse on and mixtures thereof.
57. The composition according to claim 47 wherein said bioactive
agent includes an anticancer agent.
58. The composition according to claim 57 wherein said anticancer
agent is an antimetabolite, an inhibitor of topoisomerase I and/or
II, an alkylating agent, a microtubule inhibitor, a tyrosine kinase
inhibitor, an EGF kinase inhibitor or an ABL kinase inhibitor.
59. The composition according to claim 57 wherein said anticancer
agent is Aldesleukin; Alemtuzumab; alitretinoin; allopurinol;
altretamine; amifostine; anastrozole; arsenic trioxide;
Asparaginase; BCG Live; bexarotene capsules; bexarotene gel;
bleomycin; busulfan intravenous; busulfan oral; calusterone;
capecitabine; carboplatin; carmustine; carmustine with Polifeprosan
20 Implant; celecoxib; chlorambucil; cisplatin; cladribine;
cyclophosphamide; cytarabine; cytarabine liposomal; dacarbazine;
dactinomycin; actinomycin D; Darbepoetin alfa; daunorubicin
liposomal; daunorubicin, daunomycin; Denileukin diftitox,
dexrazoxane; docetaxel; doxorubicin; doxorubicin liposomal;
Dromostanolone propionate; Elliott's B Solution; epirubicin;
Epoetin alfa estramustine; etoposide phosphate; etoposide (VP-16);
exemestane; Filgrastim; floxuridine (intraarterial); fludarabine;
fluorouracil (5-FU); fulvestrant; gemtuzumab ozogamicin; gleevec
(imatinib); goserelin acetate; hydroxyurea; Ibritumomab Tiuxetan;
idarubicin; ifosfamide; imatinib mesylate; Interferon alfa-2a;
Interferon alfa-2b; irinotecan; letrozole; leucovorin; levamisole;
lomustine (CCNU); meclorethamine (nitrogen mustard); megestrol
acetate; melphalan (L-PAM); mercaptopurine (6-MP); mesna;
methotrexate; methoxsalen; mitomycin C; mitotane; mitoxantrone;
nandrolone phenpropionate; Nofetumomab; LOddC; Oprelvekin;
oxaliplatin; paclitaxel; pamidronate; pegademase; Pegaspargase;
Pegfilgrastim; pentostatin; pipobroman; plicamycin; mithramycin;
porfimer sodium; procarbazine; quinacrine; Rasburicase; Rituximab;
Sargramostim; streptozocin; surafenib; talbuvidine (LDT); talc;
tamoxifen; tarceva (erlotinib); temozolomide; teniposide (VM-26);
testolactone; thioguanine (6-TG); thiotepa; topotecan; toremifene;
Tositumomab; Trastuzumab; tretinoin (ATRA); Uracil Mustard;
valrubicin; valtorcitabine (monoval LDC); vinblastine; vinorelbine;
zoledronate or a mixture thereof.
60. (canceled)
61. A method of treating an autophagy-mediated disease in a patient
in need thereof comprising administering to said patient an
effective amount of a composition according to claim 47.
62. The method according to claim 61 wherein said
autophagy-mediated disease is cancer, lysosomal storage diseases,
Alzheimer's disease, Parkinson's disease; a chronic inflammatory
disease, Crohn's disease, diabetes I, diabetes II, metabolic
syndrome, an inflammation-associated metabolic disorder, liver
disease, renal disease, cardiovascular disease, muscle degeneration
and atrophy, symptoms of aging (including the amelioration or the
delay in onset or severity or frequency of aging-related symptoms
and chronic conditions including muscle atrophy, frailty, metabolic
disorders, low grade inflammation, atherosclerosis and associated
conditions such as cardiac and neurological both central and
peripheral manifestations including stroke, age-associated dementia
and sporadic form of Alzheimer's disease, pre-cancerous states, and
psychiatric conditions including depression), spinal cord injury,
infectious disease and developmental disease.
63. The method according to claim 61 wherein said
autophagy-mediated disease is selected from the group consisting of
Type I and Type II diabetes, severe insulin resistance,
hyperinsulinemia, hyperlipidemia, obesity, insulin-resistant
diabetes, Mendenhall's Syndrome, Werner Syndrome, leprechaunism,
lipoatrophic diabetes, acute and chronic renal insufficiency,
end-stage chronic renal failure, glomerulonephritis, interstitial
nephritis, pyelonephritis, glomerulosclerosis, GH-deficiency, GH
resistance, Turner's syndrome, Laron's syndrome, short stature,
increased fat mass-to-lean ratios, decreased CD.sub.4+ T cell
counts and decreased immune tolerance, chemotherapy-induced tissue
damage, congestive heart failure, Alzheimer's disease, Parkinson's
disease, multiple sclerosis, Crohn's disease, peripheral
neuropathy, muscular dystrophy, myotonic dystrophy, anorexia
nervosa, a viral infection, and a bacterial infection.
64. The method according to claim 61 wherein said
autophagy-mediated disease is selected from the group consisting of
activator deficiency/GM2 gangliosidosis, alpha-mannosidosis,
aspartylgluosaminuria, cholesteryl ester storage disease, chronic
hexosaminidase A deficiency, cystinosis, Danon disease, Fabry
disease, Farber disease, fucosidosis, galactosialidosis, Gaucher
Disease (Types I, II and III), GM! Ganliosidosis, including
infantile, late infantile/juvenile and adult/chronic), Hunter
syndrome (MPS II), I-Cell disease/Mucolipidosis II, Infantile Free
Sialic Acid Storage Disease (ISSD), Juvenile Hexosaminidase A
Deficiency, Krabbe disease, Lysosomal acid lipase deficiency,
Metachromatic Leukodystrophy, Hurler syndrome, Scheie syndrome,
Hurler-Scheie syndrome, Sanfilippo syndrome, Morquio Type A and B,
Maroteaux-Lamy, Sly syndrome, mucolipidosis, multiple sulfate
deficiency, Niemann-Pick disease, Neuronal ceroid lipofuscinoses,
CLN6 disease, Jansky-Bielschowsky disease, Pompe disease,
pycnodysostosis, Sandhoff disease, Schindler disease, Tay-Sachs or
Wolman disease.
65. A method of treating cancer in a patient in need, comprising
administering to said patient an effective amount of a composition
according to claim 57.
66. A method of treating an HIV infection or AIDS in a patient in
need thereof, comprising administering to said patient an effective
amount of a composition according to claim 55 hereof.
67-71. (canceled)
72. A kit comprising: (a) at least one reagent which is selected
from the group consisting of (i) reagents that detect a
transcription product of the gene coding for a LC3 protein marker
herein (ii) reagents that detect a translation product of the gene
coding for LC3 protein marker, and/or reagents that detect a
fragment or derivative or variant of said transcription or
translation product; (b) instructions for diagnosing, or
prognosticating either an autophagy mediated disease state or
condition or determining the propensity or predisposition of a
subject to develop said autophagy mediated disease state or
condition.
73-85. (canceled)
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. US15/287,323 filed on Oct. 6, 2016 which is a
continuation of U.S. patent application Ser. No. 14/116,581, of 371
filing date Nov. 8, 2013 which issued as U.S. Pat. No. 9,572,820 of
Issue Date Feb. 21, 2017, which is a United States national phase
application based on International Patent Application No.
PCT/US2012/037300 of international filing date May 10, 2012
entitled "Methods of Treating Autophagy-Associated Disorders and
Related Pharmaceutical Compositions, Diagnostics, Screening
Techniques and Kits", which claims benefit of priority from from
U.S. Provisional Application No. US61/484,653 filed on May 10,
2011, entitled "Autophagy Diagnostics, Screening, and
Therapeutics", the complete disclosure of which said four
applications is hereby incorporated by reference in its
entirety.
FIELD OF THE INVENTION
[0003] The invention provides methods of treating
autophagy-associated disorders, and related pharmaceutical
compositions, diagnostics, screening techniques and kits.
BACKGROUND OF THE INVENTION
[0004] Autophagy is a homeostatic process highly conserved in
eukaryotic cells where it acts as a cytoplasmic biomass quantity
and quality control system (Mizushima et al., 2008; Yang and
Klionsky, 2010). Its functions encompass programmed cell survival
and cell death, normally skewed toward cell survival (Kroemer and
Levine, 2008) through provision of energy and nutrients and ridding
the cytoplasm of toxic macromolecular aggregates faulty organelles
(Mizushima et al., 2008; Yang and Klionsky, 2010) and invading
microorganisms (Deretic and Levine, 2009; Levine et al., 2011).
[0005] The cell-autonomous antimicrobial defense functions of
autophagy, demonstrated initially in the case of streptococci
(Nakagawa et al., 2004) and Mycobacterium tuberculosis (Gutierrez
et al., 2004; Harris et al., 2007; Ponpuak et al., 2010), have been
extended to a wide variety of microbes with a caveat that most
highly adapted pathogens have evolved specific protective
mechanisms against autophagic elimination of microbes (Deretic and
Levine; 2009; Gannage et al., 2009; Kyei et al., 2009; Lee et al.,
2009; Orvedahl et al., 2007; Yoshikawa et al., 2009). Other studies
have uncovered orderly intersections between autophagy and innate
(Chaturvedi et al., 2008; Cooney et al., 2010; Delgado et al.,
2008; Huang et al., 2009; Sanjuan et al., 2007; Shi and Kehrl,
2010; Tang et al., 2010; Travassos et al., 2009; Xu et al., 2007;
Yano et al., 2008) and adaptive immunity (Blanchet et al., 2010,
Lee et al., 2010; Munz, 2009; Nedjic et al., 2008; Paludan et al.,
2005); T cell development, differentiation and homeostasis (Jia and
He, 2011; Nedjie et al., 2008), and inflammatory responses (Cadwell
et al., 2010; Jounai et al., 2007; Levine et al., 2011; Saitoh and
Akira, 2010). Autophagy suppresses endogenous, cell-autonomous
promoters of inflammation (Mathew et al., 2009; Orvedahl et al.,
2010).
[0006] Specific autophagic factors, such as Atg5-Atg12, have been
shown to inhibit RIG-1 signaling (Jounai et al., 2007) whereas
Atg9, have been reported to negatively regulate trafficking,
assembly and activation of TBK-1 (TANK-binding kinase 1), which,
among its key functions, controls type I interferon response
elicited by intracellular double stranded DNA (Saitoh et al.,
2009). In the context of anti-inflammatory function, recent studies
indicate that autophagy plays an inhibitory role in inflammasome
and IL-1p activation by mechanisms that involve mitochondrial
homeostasis (Nakahira et al., 2010; Zhou et al., 2011) or
potentially direct effects (Harris et al., 2011). Finally, a number
of genetic links have been found in human populations between
autophagy and idiopathic inflammatory (Consortium, 2007; Craddock
et al., 2010) or infectious diseases such as tuberculosis (Che et
al., 2010; Intemann et al., 2009; Singh et al., 2006; Singh et al.,
2010), with significant inflammatory components and tissue
damage.
[0007] Given the interconnectedness of autophagy and immunity, it
is likely that the immune manifestations of autophagy are affected
not only by the induction of autophagy but also by the completion
of the autophagic pathway. The formation of the autophagic
organelles of the sensa stricio autophagy pathway (also referred to
as macroautophagy) depends on multiple sources of membrane or
regulatory factors (Tooze and Yoshimori, 2010). The key stages of
autophagy however are not restricted to the formation of
autophagosomal membranes and include the sequestration of the
marked cargo by the autophagic adaptors (Bjorkoy et al., 2005;
Kirkin et al., 2009; Thurston et al., 2009; Wild et al., 2011), and
the less understood process of the maturation of autophagic
organelles into autolysosomes where the captured material is
degraded (Korolchuk et al., 2011; Liang et al., 2008; Matsunaga et
al., 2009; Zhong et al., 2009).
[0008] Thus, autophagy is directly implicated in cancer, type II
diabetes, neurodegenerative syndromes such as Alzheimer's,
Huntington's and Parkinson's diseases, chronic inflammatory
diseases (e.g., Crohn's disease), type II diabetes, infections
(such as tuberculosis and HIV (I and II)/AIDS, hepatitis B,
hepatitis C), and a variety of disorders associated with aging. A
better understanding of how autophagic mechanisms are implicated in
the aforementioned diseases could prove critical to preventing or
treating these maladies.
[0009] The references which are cited above are presented after
Example 2 of the present specification.
SUMMARY OF THE INVENTION
[0010] The elucidation of certain autophagic processes involved in
the onset and progression of a variety of infectious and
inflammatory-related disorders has led to the discovery of methods
of treating and diagnosing such ailments. Further, the discovered
novel methods have led to our being able to identify compounds that
are effective as modulators of autophagy in the treatment of
infectious and inflammatory-related disorders, as well as versatile
techniques that enable the high through-put analyses of autophagic
processes, including the disease state in a patient for diagnosis
and/or monitoring therapy of the disease state. The present
invention is directed to a method of identifying compounds which
exhibit biological activity as modulators (inhibitors or agonists)
of autophagy and consequently, can be used in the treatment of
diseases which occur or are mediated through autophagy as a
mechanism.
[0011] In one embodiment, the present invention provides a method
of modulating autophagy in a biological system, in particular a
patient or subject. In this aspect of the invention, a compound
identified herein as an autophagy modulator (inhibitor or agonist,
also referred to generically as an "autostatin") is presented to
the biological system, including administration to a patient or
subject in need, in order to modulate (often enhance or up-regulate
but in certain instances, for example cancer, inhibit) autophagy
and effect a favorable result in the biological system, often a
patient or subject. The resulting modulation may be monitored or
applied in the biological system to effect a favorable result,
including the inhibition, treatment and/or prevention of cancer,
including metastasis of cancer, or the inhibition, treatment
(including the amelioration of symptoms) and/or prevention of one
or more disease states or conditions in which the modulation,
especially including upregulation or inhibition of autophagy
provides a favorable result in numerous disease states and/or
conditions including neurodegeneration (including, for example,
Alzheimer's disease, Parkinson's disease; other ataxias), chronic
inflammatory diseases (including, for example, inflammatory bowel
disease, including Crohn's disease, rheumatoid arthritis, lupus,
multiple sclerosis, chronic obstructive pulmony disease/COPD,
pulmonary fibrosis, cystic fibrosis, Sjogren's disease), diabetes
and metabolic syndrome, muscle degeneration and atrophy, frailty in
aging, stroke and spinal cord injury, arteriosclerosis, infectious
diseases (HIV I and II, HBV, HCV, including secondary disease
states or conditions associated with infectious diseases, including
AIDS) and tuberculosis, among others. The common principle of this
embodiment of the invention is that compounds, including
autostatins which are autophagy modulators (i.e., inhibitors or
activators of autophagy), depending upon the disease state,
condition or symptom to be treated, may cure, prevent (including
reducing the likelihood of), improve prognosis, ameliorate symptoms
and/or improve the quality of the patient's or subject's life. In
addition, in the therapeutic aspects of the invention, the
administration of an autophagy modulator (autostatin) may prolong
the life of the patient, as well as improve the quality of life in
the aging patient or subject.
[0012] In one embodiment the method of treating an
autophagy-mediated disease state or condition comprising
administering at least one autostatin alone or optionally in
combination with at least one additional bioactive agent. In this
method an autostatin selected from the group consisting of
flubendazole, hexachlorophene, propidium iodide, bepridil,
clomiphene citrate (Z,E), GBR 12909, propafenone, metixene,
dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine,
memantine, bromhexine, norcyclobenzaprine, diperodon and
nortriptyline, tetrachloroisophthalonitrile and phenylmercuric
acetate, pharmaceutically acceptable salts thereof and mixtures
thereof, alone or in combination with at least one additional
bioactive agent, optionally in combination with a pharmaceutically
acceptable carrier, additive or excipient, may be administered to a
patient or subject in need to treat an autophagy-mediated disease
state and/or condition. It is noted that flubendazole,
hexachlorophene, propidium iodide, bepridil, clomiphene citrate
(Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine,
dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine,
norcyclobenzaprine, diperodon, nortriptyline and their
pharmaceutically acceptable salts show activity as agonists or
inducers of autophagy in the treatment of an autophagy-mediated
disease, tetrachlorisophthalonitrile, phenylmercuric acetate and
their pharmaceutically acceptable salts, find use as antagonists or
inhibitors of autophagy. All of these compounds will find use as
modulators of autophagy in the various autophagy-mediated disease
states and conditions described herein, with the agonists being
preferred in most disease states other than cancer and in the case
of the treatment of cancer, the inhibitors described above are
preferred, alone or in combination with an autophagy agonist as
described above and/or an additional anticancer agent as otherwise
described herein.
[0013] Pharmaceutical compositions according to the present
invention comprise an effective amount of at least one autophagy
modulator selected from the group consisting of flubendazole,
hexachlorophene, propidium iodide, bepridil, clomiphene citrate
(Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine,
dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine,
norcyclobenzaprine, diperodon, nortriptyline,
tetrachlorisophthalonitrile, phenylmercuric acetate and their
pharmaceutically acceptable salts, optionally in combination with a
pharmaceutically acceptable carrier, additive and/or excipient and
further optionally, in combination with at least one additional
bioactive agent (e.g., an anticancer agent, antibiotic,
anti-tuberculosis agent, antiviral agent such as an anti-HIV agent,
anti-HBV agent or anti-HCV agent etc.), preferably at least one
anticancer agent as otherwise disclosed herein or at least one
additional autophagy modulator as otherwise described herein. In
the present invention, an additional autophagy modulator
(autostatin) is selected from the group consisting of may be
combined with an additional autophagy modulator selected from the
group consisting of benzethonium, niclosamide, monensin,
bromperidol, levobunolol, dehydroisoandrosterone 3-acetate,
sertraline, tamoxifen, reserpine, hexachlorophene, dipyridamole,
harmaline, prazosin, lidoflazine, thiethylperazine,
dextromethorphan, desipramine, mebendazole, canrenone,
chlorprothixene, maprotiline, homochlorcyclizine, loperamide,
nicardipine, dexfenfluramine, nilvadipine, dosulepin, biperiden,
denatonium, etomidate, toremifene, tomoxetine, clorgyline,
zotepine, beta-escin, tridilhexethyl, ceftazidime,
methoxy-6-harmalan, melegestrol, albendazole, rimantadine,
chlorpromazine, pergolide, cloperastine, prednicarbate,
haloperidol, clotrimazole, nitrofural, iopanoic acid, naftopidil,
methimazole, trimeprazine, ethoxyquin, clocortolone, doxycycline,
pirlindole mesylate, doxazosin, deptropine, nocodazole,
scopolamine, oxybenzone, halcinonide, oxybutynin, miconazole,
clomipramine, cyproheptadine, doxepin, dyclonine, salbutamol,
flavoxate, amoxapine, fenofibrate, pimethixene and mixtures
thereof.
[0014] In an additional embodiment, the invention provides a method
of monitoring or determining whether a subject is responding to
therapy with an autophagy modulator (autostatin) suffers from, or
is at risk of developing a disease or condition which is an
autophagy-mediated disease or condition, the method comprising
measuring LC3 levels in a blood sample of the patient or subject,
measuring the LC3 levels in said sample and comparing the LC3
levels with a control, wherein a measurement of LC3 levels in said
sample which is higher or lower than the control (the control may
be derived from a sample of tissue from healthy, disease-free
individuals of individuals known to have a disease state or
condition being identified) is evidence of the likelihood of the
existence of said disease state or condition in said tissue of said
patient. It unexpectedly has been discovered that LC3 polypeptide
is expressed on blood cells, in particular, mononuclear cells. This
discovery makes analysis readily amenable to immunohistochemistry,
immunostaining, immunofluorescence and western blot assay. Also,
the method can use monoclonal or polyclonal antibodies. In one
embodiment, the assay is a sandwich assay for point of care or home
use.
[0015] In another embodiment, the present disclosure provides a
clinically usable assay that can be applied for diagnostics and
monitoring the progression of therapy of an autophagy mediated
disease using an easy to obtain blood sample from a patient or
subject. It is based upon the unexpected discovery that LC3
polypeptides are expressed on the surface of blood cells, in
particular, peripheral blood mononuclear cells (PBMC) in
particular, primary lymphocytes. Counterintuitively, given the
engagement of autophagy and intracellular membranes, the
expectation is the LC3 polypeptides are found exclusively
intracellularly, yet, it have been discovered by the present
inventor that LC3 as an an autophagy marker can be detected on the
surface of cells, in particular primary lymphocytes. The inventors
find surprisingly that LC3 polypeptide (which has heretofore been
found only on intracellular membranes detectable by complicated
methods of microscopy) is detected by simple antibody staining on
the cell surface of primary lymphocytes using antibodies and flow
cytometry or other simple assays of detection, including antibody
assays such as an ELISA assay. This makes the quantification of LC3
in blood/plasm samples of patients relatively facile. This
information (i.e., the relative level of LC3 expressed in the blood
of a patient) is useful for diagnosis, prognosis and monitoring of
the effective of therapy of disease states and/or conditions which
are mediated through autophagy.
[0016] Based on prior art understanding regarding autophagy, one
could not predict that LC3 polypeptide, including LC3B, would be
exposed on the surface of the plasma membrane of the cell, such as
a blood lymphocyte and be amenable to identification with surface
based assays, including antibody-based assays or flow cytometry.
This is due to the accepted topology of the LC3 distribution on the
intracellular membranes. According to prior art convention, even if
the intracellular membranes were to fuse with the plasma membrane
(PM), LC3 would not be exposed to the outside (the surface of the
cell); according to conventional understanding, LD3 would always be
shielded from the exposure to the outside and not accessible to
antibodies, unless the cells were permeabilized). In one
embodiment, in the present invention, it has been discovered
unexpectedly that LC3 is exposed on the external cell surface
(i.e., on the external side of the plasma membrane facing the
outside of the cell, rather than the inside surface) and thus is
accessible to the exogenously added antibody to recognize LC3. In
one embodiment, the assay method takes advantage of this discovery
and can conduct assays of LC3 in blood sample of cells quickly,
accurately and without permeabilization of the cell (which can lead
to inaccuracies). In this method, LC3 in a blood sample, including
a plasma sample, is quantified and compared to a control or
standard. The results can be used to evidence the existence or
absence of an autophagy mediate disease state or condition, provide
an indication of the prognosis of treating a disease state (for
example, by comparing the results to a control which is obtained
from a population of patients or subjects who have had favorable or
unfavorable therapeutic results) or monitor therapy of an
autophagy-mediated disease state with an autophagy modulator
(autostatin) over a period of therapeutic intervention. This
discovery make analysis readily amenable to immunohistochemistry,
immunostaining, immunofluorescence and western blot assay. Also,
the method can use monoclonal or polyclonal antibodies, including
especially in a sandwich assay in point of care facilities and/or
home use.
[0017] Pursuant to this embodiment, blood from patients or subjects
can be drawn, and white blood cells (or more specifically different
mononuclear cell populations, e.g. primary lymphocytes including
CD4 and CDS cells and their subsets) untreated or exposed to
starvation in a buffer (simple PBS or EBSS) for a period of time
(between 10 minutes and several hours, often about an hour to an
hour and a half) and LC3 is detected on the surface preferably by
antibody staining (the antibody preferably being conjugated to a
reporter moiety which provides a fluorescent or other signal which
can be readily observed and optionally, quantitated) without
specifically permeabilizing the cells. Alternatively, in the assay
method described above, the amount of LC3 can be determined by a
variety of techniques, including immunohistochemistry,
immunostaining, immunofluorescence and western blot assay. Also,
the method can use monoclonal or polyclonal antibodies. In certain
embodiments, the assay is a sandwich assay, an ELISA assay or other
antibody based assay, including a fluorometric and/or colorimetric
assay which can be used at point of care facilities or at home.
[0018] Thus, the discovery related to external cell surface
expressed LC3 forms the basis for one or more of the following: (i)
clinical tests for patients (blood drawing and staining for LC3 on
lymphocytes or whole white blood cells), (b) biomarkers in clinical
studies (same as above), including providing a prognosis for
therapy with a particular autostatin for a particular
autophagy-mediated disease state or condition, (iii) drug screening
and development of approaches for the induction and/or inhibition
of autophagy, and (iv) a target for treatment with blocking
antibodies should LC3 on the cell surface show biological
functions. Additional information may be found in the present
specification as described in detail herein. This discovery makes
analysis is readily amenable to immunohistochemistry,
immunostaining, immunofluorescence and western blot assay. Also,
the method can use monoclonal or polyclonal antibodies.
[0019] In one embodiment, the invention provides a method for
identifying the existence of compound which exhibit activity
consistent with modulation of autophagy such that the compounds may
be useful in treating disease states or conditions which are
mediated through autophagy. In this embodiment of the invention,
the method comprises exposing cells expressing LC3 to one or more
compounds, including a library of compounds, and determining
whether a compound or compounds bind to LC3 wherein a compound
which binds to LC3 is a potential modulator of LC3. In an
alternative embodiment, the assay comprises determining whether the
compound is an inhibitor or agonist of LC3 and therefore autophagy,
for example, by determining whether the compound induces or
inhibits the formation of LC3 puncta (as evidenced by the signal
provided by a fluorescent reporter such as green fluorescent green
protein/FOP or red fluorescent protein/FRP as described in greater
detail in the examples herein), wherein a compound which induces
the formation of LC3 punta is evidence that a tested compound is a
potential therapeutic compound as a modulator (in this case, an
agonist) of autophagy and a compound which inhibits the formation
of LC3 punta is evidence that a tested compound is a potential
therapeutic compound as a modulator (in this case, an antagonist)
of autophagy. Once identified and further tested, the compounds may
be used as therapeutic agents in the treatment of disease states
and/or conditions which are mediated through an autophagy mechanism
as otherwise described herein. In the assay method described above,
the amount of LC3 can be determined by a variety of techniques,
including immunohistochemistry, immunostaining, immunofluorescence
and western blot assay. Also, the method can use monoclonal or
polyclonal antibodies.
[0020] The present invention also relates to compounds which have
been identified as modulators of autophagy (autostatins) which can
be used for the treatment of an autophagy mediated disease state or
condition. Thus, the present invention is also directed to
pharmaceutical compositions which comprise an effective amount of
at least one compound identified as an autophagy modulator in the
assay described above, optionally in combination with a
pharmaceutically acceptable carrier, additive or excipient and
further optionally, at least one additional bioactive agent. Such
disease states or conditions, include, for example, cancer,
including metastasis of cancer, lysosomal storage diseases
(discussed in detail hereinbelow), neurodegeneration (including,
for example, Alzheimer's disease, Parkinson's disease; other
ataxias), immune response, chronic inflammatory disease, including
inflammatory bowel disease, including Crohn's disease, rheumatoid
arthritis, lupus, multiple sclerosis, chronic obstructive pulmony
disease/COPD, pulmonary fibrosis, cystic fibrosis, Sjogren's
disease; diabetes (I and II) and metabolic syndrome, liver disease,
renal disease (including glomerular disease), cardiovascular
disease (especially including ischemia, stroke, pressure overload
and complications during reperfusion), muscle degeneration and
atrophy, symptoms of aging (including amelioration or the delay in
onset or severity or frequency of aging-related symptoms and
chronic conditions including muscle atrophy, frailty, metabolic
disorders, low grade inflammation, atherosclerosis and associated
conditions such as cardiac and neurological both central and
peripheral manifestations including stroke, age-associated dementia
and sporadic form of Alzheimer's disease, pre-cancerous states, and
psychiatric conditions including depression), stroke and spinal
cord injury, arteriosclerosis, infectious diseases (microbial
infections, including bacterial, fungal, cellular, viral (including
influenza, herpes virus, HIV, HBV and HCV, among others) and
parasitic infections, including protozoal and helminthic, including
secondary disease states or conditions associated with infectious
diseases), including AIDS and tuberculosis, among others, including
in periodontal disease, development, both overly mature and
immature development (including erythrocyte differentiation),
embryogenesis/fertility and ageing/progeria. The common principle
of this embodiment of the invention is that compounds, including
autostatins which are modulators (i.e., inhibitors or activators)
of autophagy (depending upon the disease) may be used alone or in
combination with other agents, including other agents in a cocktail
for the treatment of the disease state and/or condition which is
mediated through autophagy.
[0021] In still other aspects of the invention, in one embodiment,
the invention provides a method of determining whether a subject
suffers from, or is at risk of developing tuberculosis as defined
hereinafter, including M. tuberculosis, the method comprising
determining a caspase-1 level in a sample obtained from the subject
and comparing the determined caspase-1 level to a control caspase-1
level (from a sample of one or more healthy patients without
tuberculosis or a sample of wherein an increase or decrease in
caspase-1 level indicates an increased likelihood that the subject
suffers from or is at risk of developing tuberculosis. For example,
this method can comprise the steps of:
(a) contacting a biological test sample obtained from the subject
with an antibody or an antigen binding fragment thereof having
specific binding affinity for caspase-1, under conditions such that
a complex can form between caspase-1 and the antibody or the
antigen binding fragment thereof; (b) measuring the amount of said
complex, thereby determining the amount of caspase-1 in said
biological test sample; and (c) comparing the amount of caspase-1
in said biological test sample to a standard or control sample;
wherein an increased amount of caspase-1 in said biological test
sample relative to the standard or control sample is indicative of
tuberculosis in said test sample.
[0022] The amount of caspase-1 in a biological sample can be
determined by a variety of techniques, including
immunohistochemistry, immunostaining, immunofluorescence and
western blot assay. Antibodies used in the methods of the invention
can be monoclonal or polyclonal antibodies.
[0023] In another embodiment, the invention provides a method of
determining whether a subject suffers from, or is at risk of
developing an inflammation-associated metabolic disorder as defined
hereinafter, the method comprising determining the level of one or
more autophagy-related immunomodulatory cytokines, alarmins or
their regulators in a sample obtained from the subject and
comparing determined autophagy-related immunomodulatory cytokine
levels to control autophagy-related immunomodulatory cytokine
levels, wherein a decrease in autophagy-related immunomodulatory
cytokine levels indicates an increased likelihood that the subject
suffers from or is at risk of developing an inflammation-associated
metabolic disorder. For example, this method can comprise the steps
of:
(a) contacting a biological test sample obtained from the subject
with an antibody or an antigen binding fragment thereof having
specific binding affinity for an autophagy-related immunomodulatory
cytokine as defined hereinafter, under conditions such that a
complex can form between the autophagy-related immunomodulatory
cytokine and the antibody or the antigen binding fragment thereof;
(b) measuring the amount of said complex, thereby determining the
amount of autophagy-related immunomodulatory cytokine in said
biological test sample; and (c) comparing the amount of
autophagy-related immunomodulatory cytokine in said biological test
sample to a standard or control sample; wherein a decreased amount
of autophagy-related immunomodulatory cytokine in said biological
test sample relative to the standard or control sample is
indicative of an inflammation-associated metabolic disorder in said
test sample. This assay may be used alone or in combination with
other assays in order to identify a particular disease state or
condition to be treated.
[0024] In the assay method described above, the amount of
autophagy-related immunomodulatory cytokine can be determined by a
variety of techniques, including immunohistochemistry,
immunostaining, immunofluorescence and western blot assay. Also,
the method can use monoclonal or polyclonal antibodies.
[0025] In a preferred embodiment of the method described above:
(1) the inflammation-associated metabolic disorder is selected from
the group consisting of a hyperglycemic disorder (e.g. Type I and
Type II diabetes, severs insulin resistance, hyperinsulinemia,
insulin-resistant diabetes (e.g. Mendenhall's Syndrome, Werner
Syndrome, leprechaunism, and lipoatrophic diabetes) and
dyslipidemia (e.g. hyperlipidema as expressed by obese subjects,
elevated low-density lipoprotein (LDL), depressed high-density
lipoprotein (HDL), and elevated triglycerides); (2) the
autophagy-related immunomodulatory cytokine is selected from the
group consisting of IL-1a, IL-1B, IL-18, IL-12 p40 subunit. IL-4,
IL13, LMP1, EBNA2, IFN-y, ATG16L1, IRGM1, LC3B-II, HMGB1, TBK-1,
GRASP-55 and GRASP-65, exocyst components regulating secretion of
the said cytokines and alarmins and mixtures thereof and (3) the
method is conducted in a high-throughput, high-content imaging
format as descried hereinafter.
[0026] In still another embodiment, the invention provides a method
of screening for a composition useful in the treatment of
tuberculosis (e.g. M. tuberculosis), the method comprising
contacting a sample of a tuberculosis-infected lung cell population
with a candidate composition and determining the extent to which
the candidate composition down-regulates translation of caspase-1,
wherein the candidate composition is identified as being
potentially useful in the treatment of tuberculosis if translation
levels of caspase-1 in the sample are less than the comparable
control values for an untreated tuberculosis-infected lung cell
population. For example, this method can comprise the steps of:
(a) contacting a first sample of a tuberculosis-infected lung cell
population with a candidate composition; (b) determining one or
more values representing the extent to which the candidate
composition down-regulates translation of caspase-1 in the first
sample; and (c) comparing the determined one or more values to
control values based on translation levels of caspase-1 in a
second, untreated sample of the cell population, wherein the
candidate composition is identified as being potentially useful in
the treatment of tuberculosis if translation levels of caspase-1 in
the first sample are less than the comparable control values in the
second sample.
[0027] In still another embodiment, the invention provides method
of screening for a composition useful in the treatment of an
inflammation-associated metabolic disorder, the method comprising
contacting a sample of a cell population evidencing a
inflammation-associated metabolic disorder morphology with a
candidate composition and determining the extend to which the
candidate composition up-regulates translation of one or more
autophagy-related immunomodulatory cytokines, wherein the candidate
composition is identified as being potentially useful in the
treatment of an inflammation-associated metabolic disorder if
translation levels of the one or more autophagy-related
immunomodulatory cytokines in the sample are less than the
comparable control values for an untreated sample of the cell
population. For example, this method can comprise the steps of:
(a) contacting a first sample of a cell population evidencing an
inflammation-associated metabolic disorder morphology with a
candidate composition; (b) determining one or more values
representing the extent to which the candidate composition
down-regulates translation of one or more autophagy-related
immunomodulatory cytokines in the first sample; and (c) comparing
the determined one or more values to control values based on
translation levels of one or more autophagy-related
immunomodulatory cytokines in a second, untreated sample of the
cell population, wherein the candidate composition is identified as
being potentially useful in the treatment of an
inflammation-associated metabolic disorder if translation levels of
one or more autophagy-related immunomodulatory cytokines in the
first sample are greater than the comparable control values in the
second sample.
[0028] In still another embodiment, the invention provides method
of determining whether a subject suffers from, or is at risk of
developing an inflammation-associated metabolic disorder, the
method comprising:
(a) contacting a biological test sample obtained from the subject
with an antibody or an antigen binding fragment thereof having
specific binding affinity for LC3B-I or LC3B-II, under conditions
such that a complex can form between the autophagy-related
immunomodulatory cytokine and the antibody or the antigen binding
fragment thereof; (b) measuring the amount of said complex, thereby
determining the amount of LC3B-I or LC3B-II in said biological test
sample; and (c) comparing the amount of LC3B-I or LC3B-II in said
biological test sample to a standard or control sample; wherein a
difference in the amount of LC3B-I or LC3B-II in said biological
test sample relative to the standard or control sample is
indicative of an inflammation-associated metabolic disorder in said
test sample. In this method, the biological test sample preferably
is a sample of white blood cells and the antibody is a purified
monoclonal antibody (e.g., LC3B (D1 I) XP.RTM. Rabbit mAb #3868
from Cell Signalling Technology, Inc., Danvers, Mass., USA), and
wherein the antibody fragment is a fragment of such antibody. Also,
the antibody or fragment thereof may also be used.
[0029] In still another embodiment, the invention provides a method
of determining whether a subject suffers from, or is at risk of
developing tuberculosis (e.g., M. tuberculosis), the method
comprising determining TBK-1 levels in a sample obtained from the
subject and comparing determined TBK-1 levels to control TBK-1
levels, wherein a decrease in TBK-1 levels indicates an increased
likelihood that the subject suffers from or is at risk of
developing tuberculosis (e.g. M. tuberculosis). For example, this
method can comprise the steps of:
(a) contacting a biological test sample obtained from the subject
with an antibody or an antigen binding fragment thereof having
specific binding affinity for TBK-1, under conditions such that a
complex can form between TBK-1 and the antibody or the antigen
binding fragment thereof; (b) measuring the amount of said complex,
thereby determining the amount of TBK-1 in said biological test
sample; and (c) comparing the amount of TBK-1 in said biological
test sample to a standard or control sample; wherein a decreased
amount of TBK-1 in said biological test sample relative to the
standard or control sample is indicative of tuberculosis in said
test sample.
[0030] In the method described above, the amount of TBK-1 can be
determined by a variety of techniques, including
immunohistochemistry, immunostaining, immunofluorescence and
western blot assay and the antibody can be a monoclonal or
polyclonal antibody.
[0031] In still another embodiment, the invention provides method
of screening for a composition useful in the treatment of
tuberculosis (e.g. M. tuberculosis), the method comprising
contacting a sample of a tuberculosis-infected lung cell population
with a candidate composition and determining the extent to which
the candidate composition up-regulates translation of TBK-1,
wherein the candidate composition is identified as being
potentially useful in the treatment of tuberculosis if translation
levels of TBK-1 in the sample are greater than the comparable
control values for an untreated tuberculosis-infected lung cell
population. For example, this method can comprise the steps of:
(a) contacting a first sample of a tuberculosis-infected lung cell
population with a candidate composition; (b) determining one or
more values representing the extent to which the candidate
composition up-regulates translation of TBK-1 in the first sample;
and (c) comparing the determined one or more values to control
values based on translation levels TBK-1 in a second, untreated
sample of the cell population, wherein the candidate composition is
identified as being potentially useful in the treatment of
tuberculosis if translation levels of TBK-1 in the first sample are
greater than the comparable control values in the second
sample.
[0032] In still another embodiment, the invention provides a method
of screening a composition for an autophagy-associated effect on
cytoplasmic puncta of either (1) tuberculosis-infected lung cells,
or (2) cells implicated in a lipid-related metabolic disorder, the
method comprising:
(a) culturing a sample of the cells; (b) plating the cell sample on
multi-well plates; (c) contacting the cell sample with the
composition; and (d) using high-content imaging to examine the cell
sample for an autophagy-associated effect on cytoplasmic puncta,
wherein the method is conducted using a high-throughput format.
[0033] In a preferred embodiment of the high-content imaging method
described above (any embodiment, especially including those
embodiments related to identifying autostatins as otherwise
described herein), the multi-well plates are 384-well plates, the
cells are transfected with RFP-LC3 or GFP-LC3 prior to plating, the
cytoplasmic puncta are RFP-LC3 puncta or Gf P-LC3 puncta, and the
composition is selected from a chemical library such as Prestwick
chemical library or the Torrey Pines Institute library. In another
preferred embodiment, this method includes comparing the
autophagy-associated effect on cytoplasmic puncta in cell samples
that have been contacted with the composition and the morphology of
positive control cell samples that have been contacted with either
pp242, rapamycin or other mTor inhibitor as described herein, or
that have been starved.
[0034] In still another embodiment, the invention provides a method
of treating a subject who has been infected with tuberculosis (e.g.
M. tuberculosis) or who is at risk of such infection, the method
comprising administering to the subject a pharmaceutically
effective amount of a caspase-1 inhibitor as defined
hereinafter.
[0035] In still another embodiment, the invention provides a method
of treating a subject who suffers from an inflammation-associated
metabolic disorder or who is at risk of developing such a disorder,
the method comprising administering to the subject a
pharmaceutically effective amount of a TBK-1 agonist as defined
hereinafter.
[0036] In still another embodiment, the invention provides a method
of treating a subject who has been infected with tuberculosis (e.g.
M. tuberculosis) or who is at risk of such infection, the method
comprising administering to the subject a pharmaceutically
effective amount of a TBK-1 agonist (e.g. a vascular disrupting
agent (VDA) such as lavone acetic acid and its derivatives, e.g.,
5,6-dimethylxanthenone-4-acetic acid (DMXAA)).
[0037] In still another embodiment, the invention provides a kit
comprising:
(a) at least one reagent which is selected from the group
consisting of (i) reagents that detect a transcription product of
the gene coding for a TBK-1 protein marker or autophagy-related
immunomodulatory cytokine as describe herein (ii) reagents that
detect a translation product of the gene coding for TBK-1 or an
autophagy-related immunomodulatory cytokine, and/or reagents that
detect a fragment or derivative or variant of said transcription or
translation product; (b) instructions for diagnosing, or
prognosticating either an infection by tuberculosis (e.g., M.
tuberculosis) or the presence of an inflammation-associated
metabolic disorder, or determining the propensity or predisposition
of a subject to develop either tuberculosis (e.g. M. tuberculosis)
or an inflammation-associated metabolic disorder or of monitoring
the effect of a treatment of a tuberculosis (e.g. M.
tuberculosis)-related infection or an inflammation-associated
metabolic disorder.
[0038] In still another embodiment, the invention provides a kit
comprising:
(a) at least one reagent which is selected from the group
consisting of (i) reagents that detect a transcription product of
the gene coding for caspase-1 marker or an autophagy-related
immunomodulatory cytokine as described herein (ii) reagents that
detect a translation product of the gene coding for caspase-1 or an
autophagy-related immunomodulatory cytokine, and/or reagents that
detect a fragment or derivative or variant of said transcription or
translation product; (b) instructions for diagnosing, or
prognosticating either an autophagy-related immunomodulatory
cytokine or infection by tuberculosis (e.g. M. tuberculosis), or
determining the propensity or predisposition of a subject to
develop an autophagy-related immunomodulatory cytokine or to
contract a tuberculosis (e.g. M. tuberculosis)-associated infection
or of monitoring the effect of a treatment of a tuberculosis (e.g.
M. tuberculosis)-associated infection.
[0039] In still another embodiment, the invention provides a
pharmaceutical composition comprising:
(a) an autophagy-related immunomodulatory cytokine antagonist, and
optionally (b) a pharmaceutically-acceptable excipient.
[0040] In still another embodiment, the invention provides a
pharmaceutical composition comprising:
(a) an autophagy-related immunomodulatory cytokine agonist; and
optionally (b) a pharmaceutically-acceptable excipient.
[0041] In still another embodiment, the invention provides a
pharmaceutical composition comprising:
(a) a caspase-1 or TBK-1 antagonist; and optionally (b) a
pharmaceutically-acceptable excipient.
[0042] The autophagy-related methods disclosed herein therefore
provide versatile approaches to the diagnosis and treatment of a
wide variety of diseases that to date have remained difficult to
identify and treat. These and other aspects of the invention are
explained further in the Detailed Description of the Invention.
BRIEF DESCRIPTION OF THE FIGURES
Figures for Example 1
[0043] FIG. 1. Autophagy protects from excessive inflammation in a
mouse model of tuberculosis infection.
[0044] (A) Weight loss in Atg.sup.5fl/fl LysM-Cre+ and
Atg.sup.5fl/fl LysM-Cre- mice infected with M. tuberculosis H37Rv
(e.sup.3 dose; see Suppl. Table 1). (B) Gross lung pathology
(e.sup.3 dose). (C) Lung histological sections (e.sup.3 dose, day
36). Panels. i-iv, H&E stain (arrows, necrotic lesions); v and
vi, acid-fast staining (arrows, bacilli; insets enlarged area). (D)
Survival of Atg.sup.5fl/fl LysM-Cre+ and Atg.sup.5fl/fl LysM-Cre-
mice infected with M. tuberculosis H37Rv (e4 dose). (E) Weight loss
in Atg.sup.5fl/fl LysMCre+ and Atg.sup.5fl/fl LysM-Cre- mice
infected with M. tuberculosis H37Rv (e4 dose). Date, means.+-.SE,
**p<0.01 (t test). Mouse survival statistics: Kaplan-Meier
survival analysis with the Log-Rank method.
[0045] FIG. 2. Intrinsically activated phenotype of lung
macrophages and neutrophilic infiltration in uninfected Atg5fl/fl
LysM-Cre+ mice.
[0046] (A,B) Flow cytometric quantification of macrophages per
organ tissues in uninfected Atg.sup.5fl/fl LysM-Cre+ and
Atg.sup.5fl/fl LysM-Cre- mice. (C) Activation state of macrophages
measured by surface markers CD1d, MHC II, DEC205 and CD86 in the
lungs of uninfected Atg.sup.5fl/fl LysM-Cre- (left plots and
Atg.sup.5fl/fl LysM-Cre+ mice (right plots). (D,E) PMN
quantification in the lungs and bone marrow of uninfected Atg5fl/fl
LysM-Cre+ and Atg.sup.5fl/fl LysM-Cre- mice. Data, means.+-.SE,
n.gtoreq.3, *p<0.05, .dagger.>0.05 (t test).
[0047] FIG. 3. Excess cytokine secretion is a cell-autonomous
property of autophagy-deficient macrophages.
[0048] (A-C) Multiplex cytokine detection by Luminex in the lungs
of M. tuberculosis H37Rv infected Atg.sup.5fl/fl LysM-Cre+ and Cre-
mice (e2 dose, 102 CFU); shown: IL-1.alpha., CXCL1, and IL-12p70
(see Suppl. Fig. S3 for additional cytokines). (D-F) In vitro
cytokine (IL-1 u, CXCL1, and IL-12p70) release (ELISA) from
LPS+IFN-.gamma.-stimulated Atg.sup.5fl/fl LysM-Cre+ and Cre- bone
marrow-derived macrophages (BMM). (G,H) IL-1.alpha. and CXCL1
levels (ELISA) in lung homogenates of uninfected Atg5fl/fl
LysM-Cre+ and Cre- mice. Data, means.+-.SE, n.gtoreq.3, *p<0.05,
**p<0.01 (test).
[0049] FIG. 4. Autophagy regulates IL-1.alpha. release.
[0050] (A,B) IL-1.alpha. (ELISA) released from LPS+IFN-.gamma.
stimulated Atg5.sup.fl/fl LysM-Cre+ and Atg5.sup.fl/fl LysM-Cre-
BMM in the presence of 50 .mu.g/ml rapamycin (Rap), 10 mM 3-MA, or
100 nM Bafilomycin A1 (Baf A1) after 12 h of stimulation. (C)
IL-1.alpha. (ELISA) in culture supernatants of cells as in A,
treated with calpain inhibitor, ALLN (100 .mu.M). (D-F) Images and
quantification of cells positive for LC3-only, IL-1.alpha.-only or
LC3+IL-1.alpha.. Cells, wild type (Atg5+) BMM stimulated with
LPS+IFN-.gamma. and incubated for 90 min in EBSS in the absence (D,
control) or presence (E, Baf A1) of bafilomycin A1. Cutoff for
cells to be considered positive: >6 red or green puncta. Red
arrowheads, IL-1.alpha.+ LC3- cells; green arrowheads, IL-1.alpha.-
LC3+ cells; 10 .mu.m. Data, means.+-.SE; n.gtoreq.3; *p<0.05,
**p<0.01, .dagger.>0.05 (t test).
[0051] FIG. 5. Active caspase-1 is a target for autophagy.
[0052] (A) Confocal microcopy analysis of caspase-1 colocalization
relative to LC3 in GFP-LC3 expressing BMM induced for autophagy by
starvation (EBSS) in the presence of bafilomycin A1 for 90 minutes.
Scale bar, 5 .mu.M; Arrowheads and insets, LC3+ caspase-1+ positive
profiles (colocalization). (B) Pearson's colocalization coefficient
for caspase-1 vs. LC3 and IL-1.alpha. vs. LC2. (C) Caspase-1
accumulation in Atg5.sup.fl/fl LysM-Cre- or Atg5.sup.fl/fl
LysM-Cre+ BMM induced for autophagy in EBSS with or without
bafilomycin A1 (BafA1) and subjected wo Western blot analysis. (D)
IL-1.alpha. (culture supernatant ELISA) released from Atg5fl/fl
LysM-Cre+ and Atg5fl/fl LysM-Cre- BMM incubated overnight with 100
ng/ml LPS and exposed for 1 h to inflammasome agonist silica (250
.mu.g/ml) in EBSS. Data, means.+-.SE, n.gtoreq.3; **p<0.01 (t
test).
[0053] FIG. 6. IL-17 phenotype in CD4 T cells from Atg5fl/fl
LysM-Cre+ mice.
[0054] (A) CD44 and CD25 expression on CD4 T cells from lungs of
uninfected Atg5.sup.fl/fl LysM-Cre+ and Atg5.sup.fl/fl LysM-Cre-
mice. (B,C) Intracellular levels of IL-17A (top panel) and
IFN-.gamma. (bottom panel) in CD4 T cells isolated from lungs of
uninfected Atg5.sup.fl/fl LysM-Cre+ and Cre- mice and stimulated
with phorbol 12-myristate 13-acetate and ionomycin ex vivo in the
presence of brefeldin A and monensin. (D) DTH reaction (footpad
induration) in BCG-infected Atg5.sup.fl/fl LysM-Cre+ and
Atg5.sup.fl/fl LysM-Cre- mice footpad-injected with the synthetic
PPD at day 21 postinfection. Data, percent change (footpad
thickness) upon challenge with the synthetic PPD relative to the
contralateral PBS-challenged footpad. (E,F) Cytokine production
(IL-17A and IFN-.gamma.; ELISA) by splenocytes from Atg5.sup.fl/fl
LysM-Cre+ ant Atg5.sup.fl/fl LysM-Cre- mice (day 23 post-infection
with BCG) re-stimulated for 3 days ex vivo with the synthetic PPD.
(G) Intracellular IL-17A production (day 4; release blocked with
monensin) by naive CD4 T cells polarized in the presence of
cytokine cocktails: 5 ng/ml TGF-.beta. and 20 ng/ml IL-6, plus 20
ng/ml IL-1.alpha. or 20 ng/ml IL-1.beta.. Dot plot, levels of
IL-17A in unstimulated cells (staring material). Histograms, IL-17A
in naive CD4 T cells polarized in the presence of TGF-.beta., IL-6
and IL-1.alpha. or TGF-.beta., IL-6 and IL-1.beta.. (H) Percent of
IL-17A+ CD4 T cells under respective polarizing conditions. Data:
means.+-.SE; n.gtoreq.3; **p<0.01; .dagger., p>0.05 (t
test).
[0055] FIG. 1T. Tabular summary of results of mouse tuberculosis
experiment of Example 1.
[0056] FIGS. 1-6 (Supplementary). Pathology, immunoblotting,
detection assay and flow cytometry results of mouse tuberculosis
experiment of Example 1.
Figures for Example 2
[0057] FIG. 1X2. Analysis of the complete set of murine Rab and
Rab-like factors for effects on cell-autonomous autophagic
elimination of mycobacteria and the role of Rab8b. A. Sixty-two Rab
or Rab-like factors encoded by the Mus musculus genome were knocked
down by siRNA in RAW264.7 macrophages (details and identity of each
bar in Supple. Table 1S), macrophages infected with M. tuberculosis
var. bovis BCG, autophagy induced by starvation (Starv), and
autophagic killing of BCG quantified. Increase in BCG survival
indicated decrease in autophagic killing. Scr, scrambled (control)
siRNA. B-D. Effect of Rab8b knockdown on maturation of BCG
phagosomes into autophagolysosomes. LTR, Lysotracker Red
(acidotropic dye); CathD, cathepsin D. E-F. Validation of the role
for Rab8b in autophagic killing of BCG, BCG survival, % of BCG CFU
recovered from RAW 264.7 macrophages pretreated with siRNAs: si
Scr, control scrambled siRNA; si Rab8b, Rab8b siRNA; Full, full
medium; Starve, autophagy induced by starvation. Data, means.+-.se
(n.gtoreq.3; .dagger., p.gtoreq.0.05*, p<0.05, **, p<0.01;
ANOVA).
[0058] FIG. 2X2. Role of TBK-1, a Rab8b downstream effector, in
autophagic maturation, A. Rab8b effector cascade. Double headed
arrows, protein interactions. Arrows, processes downstream of TBK-1
(autophagy connection established here). Htt, Huntingtin (normal,
without expanded Glu repeats). B. Role of downstream effectors of
Rab8b in autophagic killing of BCG, BCG survival, % of BCG CFU
recovered from RAW 264.7 macrophages pretreated with siRNAs. Full,
full medium (control conditions); si Scr, scrambled siRNA (control
siRNA); Starve, autophagy induced by starvation; si TBK1, siRNA to
TBK1. C. Effect of TBK-1 inhibitor BX795 on acidification of
BCG-containing organelles following induction of autophagy. RAW
264.7 macrophages were pretreated with 10 nM BX795, infected, and
induced for autophagy by starvation (Starve). D. Autophagic killing
of BCG in RAW 264.7 macrophages pretreated with BX795. BCG
survival, % CFU recovered from RAW 264.7 cells. E,F. RAW 264.7
expressing RFP-GFP-LC3 and pretreated with scrambled or TBK-1
siRNAs were untreated (Full) or induced (Starv) for autophagy.
Puncta; R+R+ (RFP+ GFP+), early autophagic organelles; R+R- (RFP+
GFP-), late autophagic organelles. Images, merged red and green
channels. G,H. Effects of TBK-1 on LC3-II levels and degradation
during autophagic maturation. Tbk-1-/- and Tbk-1+/+ MEFs were
uninduced and induced for autophagy, treated or not treated with
bafilomycin A1 (BafA1) to inhibit autophagic degradation of LC3-II.
Data, means.+-.se (n.gtoreq.3; \, p.gtoreq.0.05*, p<0.05; **,
p<0.01; ANOVA).
[0059] FIG. 3X2. IL-1.beta.-induced autophagy eliminates
intracellular mycobacteria in a process dependent on TBK-1. A.
RAW264.7 macrophages were transiently transfected with EGFP-LC3 and
treated with 10 ng/ml murine IL-1.beta. for 2 h, and 27 assayed for
LC3 puncta formation by confocal microscopy (only puncta .gtoreq.1
.mu.m were scored as positive). B, RAW264.7 macrophages transfected
with mRFPGFP-LC3 tandem probe, treated with 10 ng/ml IL-1.beta. for
2 h were scored for number (per transfected cell) of RFP+GFP+
puncta (R+G+; early autophagosomes), RFP+GFP- (R+G-;
autolysosomes), and total LC3 puncta. C. Immuoblot analysis of
endogenous LC3 conversion to lipidated form (LC3-II) in RAW 264.7
murine macrophages upon treatment with 10 ng/ml IL-1.beta. for 2 h,
in the absence or presence of bafilomycin A1. Graph, ratio of
LC3-II to actin intensity in immunoblots from bafilomycin
A1-treated samples. D. RAW264.7 murine macrophages were
co-transfected with tandem mRFP-GFP-LC3 probe and expression
constructs containing either wild-type MyD88 (MyD88-WT) or a
dominant-negative mutant of MyD88 (MyD88-DN). Following stimulation
with 10 ng/ml IL-1.beta. for 2 h, LC3 puncta were quantified as in
B. E. Induction of autophagy in response to IL-1.beta. is abrogated
in bone marrow-derived macrophages (BMM) from MyD88 knockout
(MyD88-/-) mice, measured by ratios of LC3-II band relative to
actin following treatments of BMMs and immunoblotting of cellular
extracts. F. Proteolysis of stable proteins (radiolabeled by a
pulse chase protocol) upon stimulation of RAW264.7 cells with 10
ng/ml IL-1.beta. for 2 h (Full+IL-1.beta.) relative to control
(Full) or starvation-induced autophagy (Starve). G. Mycobacterial
killing as a measure of autophagic endpoint is induced by
IL-1.beta.. RAW264.7 macrophages were knocked down for Atg7 (by
Atg7 siRNA transfections 48 h prior to infection), infected with M.
tuberculosis H37Rv for 1 h, washed and then left untreated or
treated with 10 ng/ml recombinant murine IL-1 b for 2 h after which
they were lysed and plated for colony forming units determination,
and survival expressed relative to sample transfected with control
scrambled siRNA and not treated with IL-1.beta.. Immunoblots, Atg7
knockdown and levels of Atg5-Atg12 complexes. Data, means.+-.se,
except in E where data are means.+-.sd (n.gtoreq.3; \, p0.05*,
p<0.05; **, p<0.01; ANOVA).
[0060] FIG. 4X2. Requirement for TBK1in IL-1.beta. mediated
autophagic killing of BCG. A. BCG survival, % CFU recovered from
RAW 264.7 macrophages pretreated with IL-1.beta. with and without
10 nM BX795 measurement. B. BCG survival in infected RAW264.7 (and
knocked down or not for TBK-1) macrophages stimulated with
IL-1.beta.. C-F. Requirement for TBK-1 in IL-1.beta. induced
autophagy. RAW264.7 macrophages were incubated in full medium
(Control) or induced by adding IL-1.beta. to full medium. Cells
were pretreated with 10 nM BX795 where indicated. Macrophages were
treated with or without bafilomycin A1 (BafA1) to inhibit
autophagic degradation of LC3-II, and cellular extracts analyzed by
immunoblotting. Graphs, densitometric analyses of LC3-II levels
normalized to actin levels (LC3-II/Actin) were plotted. Data,
means.+-.se (n=3; \, 0.05; **, p<0.01; ANOVA).
[0061] FIG. 5X2. Rab8b and its downstream effector TBK-1
co-immunoprecipitate and colocalize with autophagic organelles.
A.
[0062] HEK 293T cell extracts, transiently transfected with control
(EGFP), GFP-Rab8b (Wt, wild type) and GFP-Rab8b Q67L (Q67L,
constitutively active) expression constructs were
immunoprecipitated with anti-GFP antibody; immunoblots for immune
complexes and inputs were probed with anti-TBK-1 and anti-GFP
antibodies. B. Colocalization of Rab8b and its downstream effector,
TBK-1 with the basal autophagic machinery factor LC3. Florescence;
endogenous TBK-1 (red, Alexa568), Rab8b (green, Alexa488), LC3
(blue, Alexa633). Cells (mouse primary bone marrow macrophages;
BMM) were induced for autophagy by starvation in the presence of
bafilomycin A1 to inhibit autophagic maturation and degradation.
Arrows, colocalization of Rab8b, TBK-1, and LC3. C. Representative
line tracing of three fluorescence channels in images in A. D.
TBK-1 colocalization with the autophagic adaptor sequestosome 1/p62
and LC3. Cells (BMM), treatments, labels and graphs as in a and b.
Arrows, colocalization of TBK-1, p62 and LC3. Cells (BMM) were
induced for autophagy be starvation in the presence of bafilomycin
A1 to inhibit autophagic maturation. E. Representative line tracing
of fluorescence channels in images in C. Data, representative of
.gtoreq.3 independent experiments.
[0063] FIG. 6X2. TBK-1 co-fractionates and colocalizes on
intracellular membranous organelles with autophagic adaptors and
machinery. Analysis by subcellular fractionation of the assembly of
Rab8b-TBK-1 and autophagic machinery in resting cells or upon
induction of autophagy (by starvation). RAW 264.7 macrophages
uninduced (A) or induced (B) for autophagy were subjected to
subcellular fractionation of organelles by isopycnic sucrose
density gradient centrifugation, PNS, postnuclear supernatant. 1-4,
pooled fractions. Rectangle over fraction 9; convergence in
autophagic organelles (LC3-II) of: Rab8b, TBK-1, UVRAG (Beclin 1
interacting protein specific for autophagosomal maturation), and
autophagic adapters p62 and NDP52. Refractive indexed below the
lanes reflect sucrose density of each fraction. C. Images;
endogenous UVRAG (Alexa568), endogenous TBK-1 (Alexa488). Cells,
BMM, uninduced (Full) and induced (Starvation) for autophagy. D.
Pearson's coefficient of TBK-1 and UVRAG colocalization. E. TBK-1
colocalization with autophagic adaptors in BMM. Images: endogenous
TBK-1 (Alexa568; red), p62 (Alexa488; green), NDP52 (Alexa633;
blue) and merged. Line tracing, analysis of colocalization of TBK-1
(red tracing), p62 (green tracing) and NDP52 (blue tracings). F,G.
Pearson's colocalization coefficients for TBK-1 -p62 and
TBK-1-NDP52. Data, means.+-.se (n=3, three independent experiments
with at least 5 images analyzed per experiment; \, p.gtoreq.0.05;
**, p<0.01; ANOVA).
[0064] FIG. 7X2. TBK-1 controls p62 phosphorylation, and affects
autophagic clearance of p62 and its cargo capture, delivery and
degradation. A-C. High content imaging analysis (using Cellomics
high-content microscopy system) of p62 puncta (endogenous, revealed
by immunofluorescence) in BMM with or without treatment with TBK-1
inhibitor BX795. Panel A shows output from Cellomics high-content
microscopy and analysis software comparing the number 29 of p62
puncta between TBK-1 inhibitor-treated (BX795) and control (DMSO)
BMM. Vertical axis denotes the mean number of p62 puncta per cell
and horizontal axis denotes the position of the well (B, BX795
series; C, control series) on the plate. Between 754 and 2395 cells
were analyzed per well. Panel C shows t test (data, means.+-.se;
**, p<0.01) from cumulative data treating only whole wells as
independent samples (n=4). D. Effects of TBK1 pharmacological
inhibitor, BX795 on p62 levels. Tbk-1+/+ MEFs were treated with
BX795; bafilomycin A1 (BafA1) to inhibit autophagic degradation.
Densitometric analyses of p62 levels normalized against actin
levels were plotted (n=2; error bars, range). E. TBK-1 is necessary
for efficient autophagic clearance of poly ubiquitinated proteins.
Cell lysates from Tbk-1+/+ and Tbk-1-/- MEFs uninduced and induced
for autophagy by starvation were incubated with TUBE2 agarose beads
and bound material pulled down. Western blots were probed for K63
polyubiquitin chains. F-H. Identification of TBK-1-dependent S403
phosphorylation of the UBA domain of p62. In vivo phosphorylation
of p62 UBA domain following cotransfection of GFP-p62D69A (D69A
mutation prevents oligomerization with endogenous p62) and
expression constructs of TBK-1 wild type or kinase defective form.
Immunoprecipitated (GFP-p62) material was subjected to tandem mass
spectrometry. A triply charged ion with the mass 857.01 was
selected for fragmentation. This ion was identified as the
phosphorylated LIESLSQMLpSMGFSDEGGWLTR peptide (shown in panel H)
from p62. Panel G shows MS spectra from LC-MS, showing the
phosphopeptide of 857.01 m/z observed in p62 phosphorylated by
TBK1. The peptide was not observed when GFP-p62 was co-transfected
with the kinase-defective K38D mutant of TBK1. Spectra are taken
from the same retention time in both runs, confirmed by the
unspecific peaks observed in both spectra. I. HEK293 cells
transfected with vector control, myc-TBK-1 or myc-TBK-1 K38D were
left untreated or were treated for 2 h with 1 .mu.m BX795. Cell
extracts were immunoblotted with antibodies against phospho-p62
(S403), p62, myc and actin. Abbreviations: end. p62, endogenous
p62. J. MBP or MBP-tagged p62 proteins were expressed and
affinity-purified from E. coli. TBK-1 mediated phosphorylation was
assessed by incubating recombinant MBP, MBP-p62 or MBP-p62 S403A
with recombinant active TBK-1 in the presence of [.gamma.-32P] ATP
for 10 min at 30.degree. C. The reaction products were analyzed by
autoradiography (AR). CBB, Coomassive Brilliant Blue staining.
[0065] FIG. 8X2. Additional Rabs displayed a range of effects on
autophagic killing of BCG, including those Rabs previously
implicated in autophagy.
[0066] Suppl. FIG. 1S. Analysis of the effect of Rab34 on
autophagy. A. Rab34 knockdown elevates proportion of autolysosomes
under basal conditions. RAW264.7 macrophages, knocked down for
Rab34 by siRNA and expressing RFP-GFP-LC3, were quantified for
early (G+R+) and acidified late (G-R+) autophagic organelles. Note
an increase in G-R+ LC3 puncta under uninduced (Full) conditions
and no increase relative to scramble siRNA control under induced
(starvation) conditions. B. Rab34 increases BCG survival (relative
to Full control) under both uninduced (Full) and induced (Starve)
conditions. C. A monolayer of cells (unpermeabilized) stained for
CD98. D. Flow cytometry analysis of CD98 expression. E. Rab34 is
required for CD98 (amino acid importer) expression on plasma
membrane. CD98 was stained in unpermeabilized (external) and
permeabilized (internal) cells and fluorescence examined by imaging
and quantified by line tracing intensity. F. Uptake of [3H] Leu by
cells knocked down for Rab34. RAW264.7 macrophages were transfected
with control (Scr) and Rab34 siRNA (for 48 h) and DMEM supplemented
with 1 .mu.Ci/ml tritiated L-Leucine was added to cells. Samples
for uptake were taken at 0.5 and 2 h. At each time point, cells
were washed quickly three ties in PBS, hypotonically lysed and
measured for total radioactivity using liquid scintillation. Uptake
was normalized to control siRNA treated cells. G. Membrane permeant
form of pyruvate (methyl pyruvate) employed as previously described
(Lum et al., 2005) for nutritional bypass restores LC3-II levels in
cells knocked down for Rab34. H. Role of Rab8a in autophagic
killing of BCG. Knockdown of Rab8a shows a trend but not
statistical significance in protecting BCG form autophagic killing.
Rab8a knockdown analyzed by immunoblotting. Data, means and
standard errors (n=3); *, p<0.05; \, p.gtoreq.0.5 (ANOVA).
[0067] Suppl. FIG. 2S. TBK-1 is required for autophagic maturation.
A. Effects of TBK-1 absence or presence on LC3-II levels in mouse
embryonic fibroblasts (MEFs). Tbk-1-/- and Tbk-1+/+ MEFs were
uninduced and induced for autophagy, treated or not treated with
100 nM bafilomycin A1 (BafA1) to inhibit autophagic degradation of
LC3-II under basal conditions (Full) or during 90 min of starvation
in EBSS (Starve). B,C. Effects on LC3-II levels of BX795, a
pharmacological inhibitor of TBK1. Tbk-1+/+ MEFs, untreated or
treated with 10 nM BX795 (16 h) in the presence or absence of 100
nM bafilomycin A1 (BafA1; 2 h) were subjected to immunoblotting
analysis. Ratio of LC3-II/actin band intensity. Data, means.+-.se
(n=3; \, *, p<0.05; **, p<0.01; t-test) D,E. Although
attempts to complement the absence of TBK-1 in Tbk1-/- MEFs by
transfection with Tbk-1 expression constructs was hampered by low
transfection efficiency, overexpression of Tbk-1 transgene in RAW
264.7 cells caused alterations in LC3-II levels, which diminished
faster with time in Tbk-1 transgene expressing cells relative to
untransfected cells.
[0068] Suppl. FIG. 3S. TBK-1 is required for cathepsin D delivery
to autophagolysosmes and conventional phagosomes and IL-1.beta.
induces autophagy in primary murine and human macrophages. A,B. RAW
264.7 macrophages pretreated with siRNAs, after ingestion of 1
.mu.m magnetic beads were either induced (A) or uninduced (B) for
autophagy by starvation. MBP, previously characterized magnetic
bead autophagolysosomal organelles 2 (Ponpuak et al., 2010).
Delivery of cathepsin D was determined by immunoblotting. PNS,
post-nuclear supernatant. C. Macrophages derived from bone marrows
obtained from femurs of EGFP-LC3 knock-in mice were treated with 10
ng/ml recombinant murine IL-1.beta. and LC3 puncta quantified. D.
Immunoblot analysis of LC3-II formation, in human monocyte-derived
macrophages treated with 10 ng/ml human recombinant IL-1.beta..
Data, means.+-.se (n=3; *, p<0.05; t-test).
[0069] Suppl. FIG. 4S. Rab8b and TBK-1 colocalize with autophagic
machinery. A,B. Endogenous proteins in BMM as in FIG. 5 were imaged
in cells incubated in indicated conditions: Full, compete medium;
Full+BafA1, complete medium supplemented with bafilomycin A1;
Starv, autophagy induced by starvation (EBSS); Starv+BafA1,
autophagy induced by starvation in the presence of bafilomycin A1.
When treated with BafA1, the purpose was inhibit autophagic
maturation and degradation. Triangle in insets, colocalization of
all three fluorescent probes.
[0070] Suppl. FIG. 5S. TBK-1 renders p62 competent for entry into
the autophagy pathway. Immunoblot of cell lysates from Tbk-1-/- and
Tbk-1+/+ MEFs, uninduced (Full) and induced (Starve) for autophagy,
untreated or treated with bafilomycin A1 (BafA1). Immunoblot was
developed using p62 antibody.
Figures for Example 3
[0071] FIG. 1X3. Induction of autophagy enhances IL-1.beta.
secretion. (A) Atg5fl/fl Cre.sup.- and Atg.sup.5fl/fl Cre.sup.+
bone marrow-derived macrophages (BMMs), pretreated overnight with
100 ng/ml LPS, were stimulated for 1 h with the inflammasome
agonist nigericin (20 mM) with (Starvation; EBSS) or without (Full;
full medium) autophagic induction. Cell culture supernatants were
assayed for murine IL-1.beta. by ELISA. Data represent mean
values.+-.s.d. (nX3); *Po 0.05, (B) LPS-pretreated Atg5fl/fl
Cre.sup.- and Atg.sup.5fl/fl Cre.sup.+ BMMs were stimulated with 20
mM nigericin for 1 h in OptiMEM and the release of active caspase-1
and IL-1.beta. was determined by immunoblotting. (C) As in (A),
assayed for IL-18. Data represent mean values.+-.s.d. (nX3); *Po
0.05. (D) LPS-pretreated BMMs were exposed to alum (250 mg/ml) for
1 h with or without autophagic induction by starvation. Secreted
IL-1.beta. was measured as in (A). Data represent mean
values.+-.s.d. (nX3); *Po 0.05, (E) LPS-pretreated BMMs were
exposed to silica (250 mg/ml) for 1 h with or without autophagic
induction by starvation. Secreted IL-1.beta. was measured as in
(A). Data represent mean values.+-.s.d. (nX3); *Po 0.05. (F) BMMs
were transfected with scramble (Scr) control siRNA or siRNAs
against ASC and NLRP3. After 48 h following transfection, cells
were treated overnight with LPS and subjected to nigericin (20 mM)
and starvation for 1 h. Data represent means values.+-.s.d. (nX3);
*Po 0.05, (G) Immunoblot analysis of ASC and NLRP3 knockdowns. (H)
BMMs were transfected with scramble (Scr) control siRNA or siRNAs
against ASC and NLRP3. After 48 h following transfection, cells
were treated overnight with LPS and subjected to silica (250 mg/ml)
and starvation for 1 h. Data represent means values.+-.s.d. (nX3);
*Po 0.05. (I) Colocalization of IL-1.beta. with the basal
autophagic machinery factor LC3. Fluorescence: LC3 (green,
Alexa488); IL-1.beta. (red, Alexa568). BMMs were from GFP-LC3
knock-in mice, treated with LPS then prepared for
immunofluorescence microscopy using fluorescently labelled
antibodies against GFP and IL-1b. (J, K) A line fluorescence
tracing from images in (I). (L) Pearson's colocalization
coefficient for IL-1.beta. and LC3. Pearson's coefficient was
derived from three independent experiments with five fields per
experiment, for a total of 15 fields contributing to the cumulative
result.
[0072] FIG. 2X3 Autophagic pathway progression promotes secretion
of inflammasome substrates. (A, B) LPS-pretreated BMMs were treated
with 20 mM nigericin (Nig) and 100 nM bafilomycin A1 (Bat) with
(Starvation) or without (Full) autophagic induction for 1 h and
secreted IL-1.beta. (A) and IL-18 (B) were measured. Data represent
mean values.+-.s.d. (nX3); *Po 0.05. (C) LPS-pretreated BMMs were
treated with 250 mg/ml of silica and 100 nM bafilomycin A1 (Bat)
with (Starvation) ow without (Full autophagic induction for 1 h and
secreted IL-1.beta. were measured. Data represent means
values.+-.s.d. (nX3); *Po 0.05. (D) Colocalization of cathepsin B
with the basal autophagic machinery factor LC3 and IL-1b.
Fluorescence: LC3 (green, Alexa488), IL-1.beta. (red, Alexa568);
and cathepsin B (blue, Alexa633). BMMs from GFP-LC3 knockin mice
were treated with LPS and then analysed for immunofluorescence. (E)
Colocalization line tracing analysis from images in (D). (F)
LPS-pretreated BMMs were treated with 20 mM nigericin and cathepsin
B inhibitor CA-074 Me (10 mM), with (Starvation) or without (Full)
autophagic induction, for 1 h and secreted IL-1.beta. was measured.
Data represent mean values.+-.s.d. (nX3); *Po 0.05. (G)
LPS-pretreated Atg.sup.5fl/fl Cre.sup.+ and Atg.sup.5fl/fl
Cre.sup.- BMMs were stimulated with 20 mM nigericin for 1 h in
OptiMEM and release of cathepsin B was determined by
immunoblotting.
[0073] FIG. 3X3. Rab8a is required for autophagy-activated
IL-1.beta. secretion. (A) Colocalization of Rab8a with the basal
autophagic machinery factor LC3 and IL-1b. Fluorescence; LC3
(green, Alexa488), IL-1.beta. (red, Alexa568), Rab8a (blue,
Alexa633). BMMs from GFP-LC3 knock-in mice were pretreated with LPS
and analysed by immunofluorescence microscopy. Arrows indicate
triple colocalization. (B) Line tracing analysis of fluorescence
signal intensity. (C) Pearson's colocalization coefficient for
IL-1.beta. and Rab8a. Pearson's coefficients were derived from
three completely independent experiments with 45 fields per
experiment, for a total of X15 fields contributing to the
cumulative result. (D) BMMs were transfected with siRNAs against
Rab8a or scramble (Scr) control. At 24 h after the first
transfection, cells were transfected again with siRNA, treated with
LPS and the day after subjected to nigericin in full medium for 1
h, and IL-1.beta. secretion measured. (E) Immunoblot analysis of
Rab8a knockdown in BMMs. (F) RAW264.7 macrophages were transfected
with GFP-tagged Rab8a constructs (WT, wild type; S22N,
dominant-negative mutant), treated overnight with LPS and
stimulated for 1 h with 20 mM nigericin along with induction of
autophagy by starvation. IL-1.beta. secretion was measured by
ELISA. Data represent mean values.+-.s.d. (nX3); *Po 0.05.
[0074] FIG. 4X3. GRASP55 is required for autophagy-activated
IL-1.beta. secretion. (A) BMM cells were transfected with scramble
(Scr) control siRNA or siRNA against GRASP55. After 48 h of
transfection, cells were treated with LPS and the day after
subjected to 20 mM nigericin in EBSS, and secreted IL-1.beta. was
measured by ELISA. Data represent mean values.+-.s.d. (nX3); *Po
0.05. Inset: immunoblot analysis of GRASP55 knockdown. (B)
Immunofluorescence confocal microscopy analysis of LC3 and GRASP55
distribution. LCT (green, Alexa488), GRASP55 (red, Alexa568). BMMs
were pretreated overnight with 100 ng/ml LPS and either not
stimulated (Ctrl) or stimulated (Nig) for 30 min with the
inflammasome agonist nigericin (20 mM) in full medium. (C) Line
tracings, analysis of fluorescence signal intensity from images in
(B). (D) Pearson's coefficients for LC3 and GRASP55 were quantified
using SlideBook morphometric analysis software as a measure of
adjacency between GRASP55 and LC3 profiles. Pearson's coefficients
were derived from three independent experiments with five fields
per experiment, for a total of 15 fields contributing to the
cumulative result.
[0075] FIG. 5X3. GRASP55 controls autophagy initiation. (A, B)
Effect of GRASP55 on autophagy induction by measuring LC3-II. BMM
cells were transfected with GRASP55 siRNAs or scramble (Scr)
control. At 72 h post transfection, cells were induced for
autophagy, treated or not with Bafilomycin A1 (Bat) to inhibit
autophagic degradation and LC3-II/actin ratios determined by
immunoblotting (A) followed by densitometry (B). Data represent
mean values.+-.s.d. (nX3); *Po 0.05. (C, D) RAW 264.7 was
transfected with GRASP55 siRNAs or scramble (SCR) siRNA control.
Following 48 h of siRNA treatment, cells were transfected with
RFP-GFP-LC3 plasmid (GFP is sensitive to acidification, whereas RFP
is not), after 24 h induced for autophagy in EBSS for 1 h and
autophagic induction and flux quantified (graph in D) by
determining the number of early autophagic organelles ( puncta) and
autolysosomal organelles (GFP.sup.-RFP.sup.+ puncta) per cell as
illustrated in fluorescent images (yellow arrows, GFP.sup.+
RFP.sup.+ red arrows, GFP.sup.- RFP.sup.+) Total, yellow+red puncta
per cell. Data represent mean values.+-.s.c. (nX3); *Po 0.05.
[0076] FIG. 6X3. HMGB1 is an autophagy-based alternative secretion
substrate. (A) Atg.sup.5fl/fl Cre.sup.+ and Atg.sup.5fl/fl
Cre.sup.+ BMMs, pretreated overnight with 100 ng/ml LPS, were
stimulated for 1 h with 20 mM nigericin (Nig; inflammasome agonist)
while incubated in EBSS for induction of autophagy by starvation.
Cell culture supernatants were assayed for murine HMGB1 by ELISA.
Data (normalized to sample with maximum HMGB1 secretion in each
experimental repeat; Cre- and Nig) represent mean values.+-.s.d.
(nX3); *Po 0.05. (B) LPS-pretreated Atg.sup.5fl/fl Cre.sup.- and
Atg.sup.5fl/fl Crep BMMs were stimulated with 20 mM nigericin for 1
h in OptiMEM and the release of HMGB1 was determined by
immunoblotting.
Figure for Example 4
[0077] FIG. 1X4. LC3B-II autophagy marker is detected on the
surface of cells (see Example 4).
[0078] FIG. 2X4 shows that even if the intracellular membranes were
to fuse with the plasma membrane (PM), LC3 would not be exposed to
the outside according to the current Knowledge. Instead, LC3 would
always be shielded from the exposure to the outside and not
accessible to antibodies in a sandwich assay, unless the cells were
permeabilized. Scheme 1 process B, depicts what is experimentally
detected pursuant to the present invention, i.e. LC3 is exposed on
the cell surface on the side of the plasma membrane facing the
outside of the cell and thus being accessible to the exogenously
added antibody to recognize LC3.
Figures for Example 5
[0079] FIG. 1AXS. Depiction of autophagic processes.
[0080] FIG. 1BX5. Further depiction of autophagic processes.
[0081] FIG. 2X5. Detection of puncta as observed in the experiment
of Example 5.
[0082] FIG. 3X5. High-content imaging experimental design used to
examine cell samples for an autophagy-associated effect on
cytoplasmic puncta in the experiment of Example 5.
[0083] FIG. 4X5. Positive and negative controls used in
high-content imaging experiment of Example 5.
[0084] FIG. 5X5. Summary of Prestwich and TPIMS screens used in the
high-content imaging experiment of Example 5.
[0085] FIG. 6X5. Comparison of autophagy-associated effects on
cytoplasmic puncta in the experiment of Example 5.
[0086] FIG. 7AX5. Prestwick screen data determined in the
high-content imaging experiment of Example 5.
[0087] FIG. 8X5. Overlap of hits from two separate Prestwick
screens for induction of autophagy as determined in the experiment
of Example 5.
[0088] FIG. 9X5. Hits, real and imagined, as determined in the
high-content imaging experiment of Example 5.
[0089] FIG. 10X5. Dose response curves to pp242 as determined in
the high-content imaging experiment of Example 5.
[0090] FIG. 11X5. TIPMS library screen conducted in the
high-content imaging experiment of Example 5.
Figures for Example 6
[0091] FIG. 1X6. Use of Cellomics ArrayScan to detect induction of
autophagy. LC3-RFP/RFP HeLa cells were incubated with the known
inducer of autophagy pp242, an mTOR inhibitor, for 4 hours then
fixed in 0.1% PFA. Wells were scanned for number, area, or
intensity of GFP+ or RFP+ puncta per cell using a Cellomics
ArrayScan. Negative control (DMF-treated) wells were also measured.
Each dot represents the data from a single well.
[0092] FIG. 2X6. Chemical library screen for modulation of
autophagy. LC3-RFP/GFP HeLa cells were incubated with compounds
from the chemical library for 4 hours, then fixed in 0.1% PFA.
Wells were scanned using a Cellomics ArrayScan. Negative control
(DMSO-treated) and positive control (pp242) wells were also
measured. Each dot represents the data from a single well.
[0093] FIG. 3X6. Shows comparison of replicate chemical library
screens for modulation of autophagy. Two different chemical library
screens were performed as in FIG. 2 on separate days. The data was
combined, and compounds that were hits in both screens were picked
for further experimentation.
[0094] FIG. 4X6. Dose response measurement of pp242 and induction
of autophagy. LC3-RFP/GFP HeLa cells were incubated with different
concentrations of pp242 for 4 hours, then fixed in 0.1% in PFA.
Wells were scanned using a Cellomics ArrayScan. Negative control
(DMSO-treated) and positive control (pp242) wells were also
measured. Each dot represents the data from four separate wells,
and error bars are standard deviation.
[0095] FIG. 5X6. Overview of chemical screens for modulation of
autophagy. Two different chemical library screens were performed on
separate days. The data was combined, and compounds that were hits
in both screens were picked for further experimentation.
DETAILED DESCRIPTION OF THE INVENTION
[0096] It is noted that, as used in this specification and the
appended claims, the singular forms "a," "an," and "the," include
plural referents unless expressly and unequivocally limited to one
referent. Thus, for example, reference to "a compound" includes two
or more different compound. As used herein, the term "include" and
its grammatical variants are intended to be non-limiting, such that
recitation of items in a list is not to the exclusion of other like
items that can be substituted or other items that can be added to
the listed items.
[0097] The term "compound" or "agent", as used herein, unless
otherwise indicated, refers to any specific chemical compound
disclosed herein and includes tautomers, regioisomers, geometric
isomers as applicable, and also were applicable, optical isomers
(e.g. enantiomers) thereof, as well as pharmaceutically acceptable
salts thereof. Within its use in context, the term compound
generally refers to a single compound, but also may include other
compounds such as stereoisomers, regioisomers and/or optical
isomers (including racemic mixtures) as well as specific
enantiomers or enantiomerically enriched mixtures of disclosed
compounds as well as diastereomers and epimers, where applicable in
context. The term also refers, in context to prodrug forms of
compounds which have been modified to facilitate the administration
and delivery of compounds to a site of activity.
[0098] The term "patient" or "subject" is used throughout the
specification within context to describe an animal, generally a
mammal, including a domesticated mammal including a farm animal
(dog, cat, horse, cow, pig, sheep, goat, etc.) and preferably a
human, to whom treatment, including prophylactic treatment
(prophylaxis), with the methods and compositions according to the
present invention is provided. For treatment of those conditions or
disease states which are specific for a specific animal such as
human patient, the term patient refers to that specific animal,
often a human.
[0099] The terms "effective" or "pharmaceutically effective" are
used herein, unless otherwise indicated, to describe an amount of a
compound or composition which, in context, is used to produce or
affect an intended result, usually the modulation of autophagy
within the context of a particular treatment or alternatively, the
effect of a bioactive agent which is coadministered with the
autophagy modulator (autotoxin) in the treatment of disease.
[0100] The terms "treat", "treating", and "treatment", etc., as
used herein, refer to any action providing a benefit to a patient
at risk for or afflicted by as autophagy mediated disease state or
condition as otherwise described herein. The benefit may be in
curing the disease state or condition, inhibition its progression,
or ameliorating, lessening or suppressing one or more symptom of an
autophagy mediated disease state or condition. Treatment, as used
herein, encompasses both prophylactic and therapeutic
treatment.
[0101] As used herein, the term "autophagy mediated disease state
or condition" refers to a disease state or condition that results
from disruption in autophagy or cellular self-digestion. Autophagy
is a cellular pathway involved in protein and organelle
degradation, and has a large number of connections to human
disease. Autophagic dysfunction is associated with cancer,
neurodegeneration, microbial infection and ageing, among numerous
other disease states and/or conditions. Although autophagy plays a
principal role as a protective process for the cell, it also plays
a role in cell death. Disease states and/or conditions which are
mediated through autophagy (which refers to the fact that the
disease state or condition may manifest itself as a function of the
increase or decrease in autophagy in the patient or subject to be
treated and treatment requires administration of an inhibitor or
agonist of autophagy in the patient or subject) include, for
example, cancer, including metastasis of cancer, lysosomal storage
diseases (discussed hereinbelow), neurodegeneration (including, for
example, Alzheimer's disease, Parkinson's disease, Huntington's
disease; other ataxias), immune response (T cell maturation, B cell
and T cell homeostasis, counters damaging inflammation) and chronic
inflammatory diseases (may promote excessive cytokines when
autophagy is defective), including, for example, inflammatory bowel
disease, including Crohn's disease, rheumatoid arthritis, lupus,
multiple sclerosis, chronic obstructive pulmony disease/COPD,
pulmonary fibrosis, cystic fibrosis, Sjogren's disease;
hyperglycemic disorders, diabetes (I and II), affecting lipid
metabolism islet function and/or structure, excessive autophagy may
lead to pancreatic P-cell death and related hyperglycemic
disorders, including severe insulin resistance, hyperinsulinemia,
insulin-resistant diabetes (e.g. Mendenhall's Syndrome, Werner
Syndrome, leprechaunism, and lipoatrophic diabetes) and
dyslipidemia (e.g. hyperlipidemia as expressed by obese subjects,
elevated low-density lipoprotein (LDL), depressed high-density
lipoprotein (HDL), and elevated triglycerides) and metabolic
syndrome, liver disease (excessive autophagic removal of cellular
entities--endoplasmic reticulum), renal disease (apoptosis in
plaques; glomerular disease), cardiovascular disease (especially
including ischemia, stroke, pressure overload and complications
during reperfusion), muscle degeneration and atrophy, symptoms of
aging (including amelioration or the delay in onset or severity or
frequency of aging-related symptoms and chronic conditions
including muscle atrophy, frailty, metabolic disorders, low grade
inflammation, atherosclerosis and associated conditions such as
cardiac and neurological both central and peripheral manifestations
including stroke, age-associated dementia and specific form of
Alzheimer's disease, pre-cancerous states, and psychiatric
conditions including depression), stroke and spinal cord injury,
arteriosclerosis, infectious diseases (microbial infections,
removes microbes, provides a protective inflammatory response to
microbial products, limits adaptation of autophagy of host by
microbe for enhancement of microbial growth, regulation of innate
immunity) including bacterial, fungal, cellular and viral
(including secondary disease states or conditions associated with
infectious diseases), including AIDS and tuberculosis, among
others, development (including erythrocyte differentiation),
embryogenesis/fertility/infertility (embryo implantation and
neonate survival after termination of transplacental supply of
nutrients, removal of dead cells during programmed cell death) and
ageing (increased autophagy leads to the removal of damaged
organelles or aggregated macromolecules to increase health and
prolong life, but increased levels of autophagy in children/young
adults may lead to muscle and organ wasting resulting in
ageing/progeria).
[0102] The term "lysosomal storage disorder" refers to a disease
state or condition that results from a defect in lysosomal storage.
These disease states or conditions generally occur when the
lysosome malfunctions. Lysosomal storage disorders are caused by
lysosomal dysfunction usually as a consequence of deficiency of a
single enzyme required for the metabolism of lipids, glycoproteins
or mucopolysaccharides. The incidence of lysosomal storage disorder
(collectively) occurs at an incidence of about about
1:5,000-1:10,000. The lysosome is commonly referred to as the
cell's recycling center because it processes unwanted material into
substances that the cell can utilize. Lysosomes break down this
unwanted matter via high specialized enzymes. Lysosomal disorders
generally are triggered when a particular enzyme exists in too
small an amount or is missing altogether. When this happens,
substances accumulate in the cell. In other words, when the
lysosome doesn't function normally, excess products destined for
breakdown and recycling are stored in the cell. Lysosomal storage
disorders are genetic diseases, but these may be treated using
autophagy modulators (autostatins) as described herein. All of
these diseases share a common biochemical characteristic, i.e.,
that all lysosomal disorders originate from an abnormal
accumulation of substances inside the lysosome. Lysosomal storage
diseases mostly affect children who often die as a consequence at
an early stage of life, many within a few months or years of birth.
Many other children die of this disease following years of
suffering from various symptoms of their particular disorder.
[0103] Examples of lysosomal storage diseases include, for example,
activator deficiency/GM2 gangliosidosis, alpha-mannosidosis,
aspartylgluosaminuria, cholesteryl ester storage disease, chronic
hexosaminidase A deficiency, cystinosis, Danon disease, Fabry
disease, Farber disease, fucosidosis, galactosialidosis, Gaucher
Disease (Types I, II and III), GM! Ganliosidosis, including
infantile, late infantile/juvenile and adult/chronic), Hunter
syndrome (MPS II), I-Cell disease/Mucolipidosis II, Infantile Free
Sialic Acid Storage Disease (ISSD), Juvenile Hexosaminidase A
Deficiency, Krabble disease, Lysosomal acid lipase deficiency,
Metachromatic Leukodystrophy, Hurler syndrome, Scheie syndrome,
Hurler-Scheie syndrome, Sanfilippo syndrome, Morquio Type A and B,
Maroteaux-Lamy, Sly syndrome, mucolipidosis, multiple sulfate
deficiency, Niemann-Pick disease, Neuronal ceroid lipofuscinosis,
CLN6 disease, Jansky-Bielschowsky disease, Pompe disease,
pycnodysostosis, Sandhoff disease, Schindler disease. Tay-Sachs and
Wolman disease, among others.
[0104] The term "modulator of autophagy", "regulator of autophagy"
or "autostatin" is used to refer to a compound which functions as
an agonist (inducer or up-regulator) or antagonist (inhibitor or
down-regulator) of autophagy. Depending upon the disease state or
condition, autophagy may be upregulated (and require inhibition of
autophagy for therapeutic intervention) or down-regulated (and
require upregulation of autophagy for therapeutic intervention). In
most instances, in the case of cancer treatment with a modulator of
autophagy as otherwise described herein, the autophagy modulator is
often an antagonist of autophagy. In the case of cancer, the
antagonist (inhibitor) of autophagy may be used alone or combined
with an agonist of autophagy.
[0105] The following compounds have been identified as autophagy
modulators according to the present invention and can be used in
the treatment of an autophagy mediated disease state or condition
as otherwise described herein. It is noted that an inhibitor of
autophagy is utilized where the disease state or condition is
mediated through upregulation or an increase in autophagy which
causes the disease state or condition and an agonist of autophagy
is utilized where the disease state or condition is mediated
through downregulation or a decrease in autophagy. The following
compounds have been identified as autophagy modulators (autotaxins)
in autophagy assays according to the present invention
flubendazole, hexachlorophene, propidium iodide, bepridil,
clomiphene citrate (Z,E) GBR 12909, propafenone, metixene,
dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine,
memantine, bromhexine, norcyclobenzaprine, diperodon and
nortriptyline, tetrachlorisophthalonitrile, phenylmercuric acetate
and pharmaceutically acceptable salts thereof. It is noted that
flubendazole, hexachlorophene, propidium iodide, bepridil,
clomiphene citrate (Z,E), GBR 12909, propafenone, metixene,
dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine,
memantine, bromhexine, norcyclobenzaprine, diperodon, nortriptyline
and their pharmaceutical acceptable salts show activity as agonists
or inducers of autophagy in the treatment of an autophagy-mediated
disease, whereas tetrachlorisophthalonitrile, phenylmercuric
acetate and their pharmaceutically acceptable salts, find use as
antagonists or inhibitors of autophagy. All of these compounds will
find use as modulators of autophagy in the various
autophagy-mediated disease states and conditions described herein,
with the agonists being preferred in most disease states other than
cancer (although inhibitors may also be used alone, or preferably
in combination with the agonists) and in the case of the treatment
of cancer, the inhibitors described above are preferred, alone or
in combination with an autophagy agonist as described above and/or
an additional anticancer agent as otherwise described herein.
[0106] Other compounds which may be used in combination with the
autophagy modulators which are described above, include for
example, other "additional autophagy modulators" or "additional
autostatins" which are known in the art. These can be combined with
one or more of the autophagy modulators which are disclosed above
to provide novel pharmaceutical compositions and/or methods of
treating autophagy mediated disease states and conditions which are
otherwise described herein. These additional autophagy modulators
including benzethonium, niclosamide, monensin, bromperidol,
levebunolol, dehydroisoandrosterone 3-acetate, seritraline,
tamoxifen, reserpine, hexachlorophene, dipyridamole, harmaline,
prazosin, lidoflazine, thiethylperazine, dextromethorphan,
desipramine, mebendazole, canrenone, chlorprothixene, maprotiline,
homochlorcyclizine, loperamide, nicardipine, dexfenfluramine,
nilvadipine, dosulepin, biperiden, denatonium, etomidate,
toremifene, tomoxetine, clorgyline, zotepine, beta-escin,
tridhexethyl, ceftazidime, methoxy-6-harmalan, melengestrol,
albendazole, rimantadine, chlorpromazine, pergolide, cloperastine,
prednicarbate, haloperidol, clotrimazole, nitrofural, iopanoic
acid, naftopidil, Methimazole, Trimeprazine, Ethoxyquin,
Clocortolone, Doxycycline, Pirlindole mesylate, Doxazosin,
Deptropine, Nocodazole, Scopolamine, Oxybenzone, Halcinonide,
Oxybutynin, Miconazole, Clomipramine, Cyproheptadine, Doxepin,
Dyclonine, Salbutamol, Flavoxate, Amoxapine, Fenofibrate,
Pimethixene and mixtures thereof.
[0107] The term "co-administration" or "combination therapy" is
used to describe a therapy in which at least two active compounds
in effective amounts are used to treat an autophagy mediated
disease state or condition as otherwise described herein, either at
the same time or within dosing or administration schedules defined
further herein or ascertainable by those of ordinary skill in the
art. Although the term co-administration preferably includes the
administration of two active compounds to the patient at the same
time, it is not necessary that the compounds be administered to the
patient at the same time, although effective amounts of the
individual compounds will be present in the patient at the same
time. In addition, in certain embodiments, co-administration will
refer to the face that two compounds are administered at
significantly different times, but the effects of the two compounds
are present at the same time. Thus, the term co-administration
includes an administration in which one active agent (especially an
autophagy modulator) is administered at approximately the same time
(contemporaneously), or from about one to several minutes to about
24 hours or more than the other bioactive agent coadministered with
the autophagy modulator. The additional bioactive agent may be any
bioactive agent, but is generally selected from an additional
autophagy mediated compound, an additional anticancer agent, or
another agent, such as a mTOR inhibitor such as pp242, rapamycin,
enviolimus, evesolimas or cidaforollimus, among others including
epigallocatechin gallate (EGCG), caffeine, curcumin or resveratrol
(which mTOR inhibitors find particular use as enhancers of
autophagy using the compounds disclosed herein and in addition, in
the treatment of cancer with an autophagy modulator (inhibitor) as
described herein, including in combination with
tetrachlorisophthalonitrile, phenylmercuric acetate and their
pharmaceutically acceptable salts, which are inhibitors of
autophagy. It is noted that in the case of the treatment of cancer,
the use of an autophagy inhibitor is preferred, alone or in
combination with an autophagy inducer (agonist) as otherwise
described herein and/or an mTOR inhibitor as described above. In
certain embodiments, an mTOR inhibitor selected from the group
consisting of pp242, rapamycin, enviolimus, evesolimas,
cidaforollimus, epigallocatechin gallate (EGCG), caffeine,
curcumin, resveratrol and mixtures thereof may be combined with at
least one agent selected from the group consisting of digoxin,
xylazine, hexetidine and sertindole, the combination of such agent
being effective as autophagy modulators in combination.
[0108] The term "cancer" is used throughput the specification to
refer to the pathological process that results in the formation and
growth of cancerous or malignant neoplasm, i.e., abnormal tissue
that grows by cellular proliferation, often more rapidly than
normal and continues to grow after the stimuli that initiated the
new growth case. Malignant neoplasms show partial or complete lack
of structural organization and functional coordination with the
normal tissue and most invade surrounding tissues, metastasize to
several sites, and are likely to recur after attempted removal and
to cause the death of the patient unless adequately treated.
[0109] As used herein, the term neoplasia is used to describe all
cancerous disease states and embraces or encompasses the
pathological process associated with malignant hematogenous,
ascitic and solid tumors. Representative cancers include, for
example, stomach, colon, rectal, liver, pancreatic, lung, breast
cervix uteri, corpus uteri, ovary, prostate, testis, bladder,
renal, brain/CNS, head and neck, throat, Hodgkin's disease,
non-Hodgkin's lymphoma, multiple myeloma, leukemia, melanoma,
non-melanoma skin cancer (especially basal cell carcinoma or
squamous cell carcinoma) acute lymphocytic leukemia, acute
myelogenous, leukemia, Ewing's sarcoma, small cell lung cancer,
choriocarcinoma, rhabdomyosarcoma, Wilms' tumor, neuroblastoma,
hairy cell leukemia, mouth/pharynx, esophagus, larynx, kidney
cancer and lymphoma, among others, which may be treated by one or
more compounds according to the present invention. In certain
aspects, the cancer which is treated is lung cancer, breast cancer,
ovarian cancer and/or prostate cancer.
[0110] The term "tumor" is used to describe a malignant or benign
growth or tumefacient.
[0111] The term "additional anti-cancer compound", "additional
anti-cancer drug" or "additional anti-cancer agent" is used to
described any compound (including its derivatives) which may be
used to treat cancer. The "additional anti-cancer compound",
"additional anti-cancer drug" or "additional anti-cancer agent" can
be an anticancer agent which is distinguishable from a
CIAE-inducing anticancer ingredient such as a taxane, vinca
alkaloid and/or radiation sensitizing agent otherwise used as
chemotherapy/cancer therapy agents herein. In many instance, the
co-administration of another anti-cancer compound according to the
present invention results in a synergistic anti-cancer effect.
Exemplary anti-cancer compounds for co-administration with
formulations according to the present invention include
anti-metabolites agents which are broadly characterized as
antimetabolites, inhibitors of topoisomerase I and II, alkylating
agents and microtubule inhibitors (e.g., taxol), as well as
tyrosine kinase inhibitors (e.g., surafenib), EGF kinase inhibitors
(e.g., tarceva or erlotinib) and tryosine kinase inhibitors or ABL
kinase inhibitors (e.g. imatinib).
[0112] Anti-cancer compounds for co-administration include, for
example, Aldesleukin; Alemtuzumab; alitrelinoin; allopurinol;
altretamine; amifostine; anastrozole; arsenic trioxide;
Asparaginase; BCG Live; bexarotene capsules; bexarotene gel;
bleomycin; busulfan intravenous, busulfan oral; calusterone,
capacitabine; carboplatin, carmustine; carmustine with Polifeprosan
20 Implant; celecoxib; chlorambucil; cisplatin; cladribine;
cyclophosphamide, cytarabine; cytarabine liposomal; dacarbazine;
dactinomycin; actinomycin D; Darbepoetin alfa, daunorubicin
liposomal; danuorubicin, daunomycin; Denileukin diftilox,
dexrazoxane; docetaxel; doxorubicin; doxorubicin liposomal;
Dromostanolone propionate; Elliot's B Solution, epirubicia; Epoetin
alfa estramustine; etoposide phosphate; etoposide (VP-16),
exemestane; Filgastim; floxuridine (intraarterial); fludarabine;
fluorouracil (5-FU); fulvestrant; gemtuzumab ozogamicin; gleevec
(imatinib); goserelin acetate; hydroxyurea, Ibritumomab Tiuxetan,
idarubicin; ifosfamide; imatinib mesylate; Interferon alfa-2a;
Interferon alfa-2b; irinotecan; letrozole; leucovorin; levamisole;
lomustine (CCNU); meclorethamine (nitrogen mustard), megestrol
acetate, melphalan (L-PAM); mercaptopurine (6-MP); mesna;
methotrexate; methoxsalen; mitomycin C; mitotane; mitoxantrone;
nandrolone phenpropionate; Nofetumomab; LOddC; Oprelvekin;
oxaliplatin; paclitaxel, pamidronate; pegademase, Pegaspargase;
Pegfligrastim, pentostatin, pipobroman; plicamycin; mithramycin;
portimer sodium, procarbazine, quinacrine; Rasburicase; Rituximab;
Sargramostim, streptozocin; sorafenib; talbuvidine (LDT); talc,
tamoxifen; tarceva (erlotinib), temozolomide; teniposide (VM-26);
testolactone; thioguanine (6TG); thiotepa; topotecan; torenifene;
Tositumomab; Trastuzumab; tretinoin (ATRA); Uracil Mustard;
valrubicin; valtorcitabine (monoval LDC); vinblastine; vinorelbine;
zoledronate; and mixtures thereof, among others.
[0113] Co-administration of one of the formulations of the
invention with another anticancer agent will often result in a
synergistic enhancement of the anticancer activity of the other
anticancer agent, an unexpected result. One or more of the present
formulations comprising an autophagy modulator (autostatin) may
also be co-administered with another bioactive, agent (e.g.,
antiviral agent, antihyperproliferative disease agent, agents which
treat chronic inflammatory disease, among others as otherwise
described herein).
[0114] The term "antiviral agent" refers to an agent which may be
used in combination with autophagy modulators (autostatins) as
otherwise described herein to treat viral infections, especially
including HIV infections, HBV infections and/or HCV infections.
Exemplary anti-HIV agents include, for example, nucleoside reverse
transcriptase inhibitors (NRTI), non-nucleoside reverse
transcriptase inhibitors (NNRTI), protease inhibitors, fusion
inhibitors, amount others, exemplary compounds of which may
include, for example, 3TC (Lamivudine), AZT (Zidovudine), (-)-FTC,
ddI (Didanosine), ddC (zalcitabine), abacavir (ABC), tenofovir
(PMPA), D-D4FC (Reverse), D4T (Stavudine), Racivir, L-FddC, L-FD4C,
NVP (Nevirapine), DLV (Delavirdine), EFV (Efavirenz), SQVM
(Saquinavir mesylate), RTV (Ritonavir), IDV (Indiavir), SQV
(Saquinavir), NFV (Nelfinavir), APV (Amprenavir), LPV (Lopinavir),
fusion inhibitors such as T20, among others, fusion and mixtures
thereof, including anti-HIV compounds presently in clinical trials
or in development. Exemplary anti-HBV agents include, for example,
hepsera (adefovir dipivoxil), lamivudine, entecavir, telbivudine,
tenofovir, emtricitabine, elevudine, valtoricitabine, amdoxovir,
pradefovir, racivir, BAM 205, nitazoxamide, UT-231-B, Bay 41-4109,
EHT899, zadaxin (thymosin alpha-1) and mixtures thereof. Anti-HCV
agents include, for example, interferon, pegylated intergeron,
ribavirin, NM 283, VX-950 (telaprevir), SCH 50304, TMC435, VX-500,
BX-813, SCH503034, R1626, ITMN-191 (R7227), R7128, PF-868554,
TT033, CGH-759, GI 5005, MK-7009, SIRNA-034, MK-0608, A-837093, GS
9190, ACH-1095, GSK625433, TG4040 (MVA-HCV). A-831, F351, NS5A,
NS4B, ANA598, A-689, GNI-104, IDX102, ADX184, GL59728, GL60667,
PSI-7851, TLR9 Agonist, PHX1 766, SP-30 and mixtures thereof.
[0115] As used herein, "antibody" includes, but is not limited to,
monoclonal antibodies. The following disclosure from U.S. Patent
Application Document No. 2010284921, the entire contents of which
are hereby incorporated by reference, exemplifies techniques that
are useful in making antibodies employed in formulations of the
instant invention.
[0116] As described in U.S. Patent Application Document No.
20100284921, "antibodies . . . may be polyclonal or monoclonal.
Monoclonal antibodies are preferred. The antibody is preferably a
chimeric antibody. For human use, the antibody is preferably a
humanized chimeric antibody.
[0117] An anti-target-structure antibody . . . may be monovalent,
divalent or polyvalent in order to achieve target structure
binding. Monovalent immunoglobulins are dimers (HL) formed of a
hybrid heavy chain associated through disulfide bridges with a
hybrid light chain. Divalent immunoglobulins are tetramers (H2L2)
formed of two dimers associated through at least one disulfide
bridge.
[0118] The invention also includes functional equivalents of the
antibodies described herein. Functional equivalents have binding
characteristics comparable to those of the antibodies, and include,
for example, hybridized and single chain antibodies, as well as
fragments thereof. Methods of producing such functional equivalents
are disclosed in PCT Application Nos. WO 1993/21319 and WO
1989/09622. Functional equivalents include polypeptides with amino
acid sequences substantially the same as the amino acid sequence of
the variable or hypervariable regions of the antibodies raised
against target integrins according to the practice of the present
invention.
[0119] Functional equivalents of the anti-target-structure
antibodies further include fragments of antibodies that have the
same, or substantially the same, binding characteristics to those
of the whole antibody. Such fragments may contain one or both Fab
fragments or the F(ab').sub.2 fragment. Preferably the antibody
fragments contain all six complement determining regions of the
whole antibody, although fragments containing fewer than all of
such regions, such as three, four or five complement determining
regions, are also functional. The functional equivalents are
members of the IgG immunoglobulin class and subclasses thereof, but
may be or may combine any one of the following immunoglobulin
classes: IgM, IgA, IgD, or IgE, and subclasses thereof. Heavy
chains of various subclasses, such as the IgG subclasses, are
responsible for different effector functions and thus, by choosing
the desired heavy chain constant region, hybrid antibodies with
desired effector function are produced. Preferred constant regions
are gamma 1 (IgG 1) gamma 2 (IgG2 and IgG), gamma 3 (IgG3) and
gamma 4 (IgG4). The light chain constant region can be of the kappa
or lambda type.
[0120] The monoclonal antibodies may be advantageously cleaved by
proteolytic enzymes to generate fragments retaining the target
structure binding side. For example, proteolytic treatment of IgG
antibodies with papain at neutral pH generates two identical
so-called "Fab" fragments, each containing one intact light chain
disulfide-bonded to a fragment of the heavy chain (Fc). Each Fab
fragment contains one antigen-combining site. The remaining portion
of the IgG molecule is a dimer known as "Fc". Similarly, pepsin
cleavage at pH 4 results in the so-called F(ab')2 fragment.
[0121] Single chain antibodies or Fv fragments are polypeptides
that consist of the variable region of the heavy chain of the
antibody linked to the variable region of the light chain, with or
without an interconnecting linker. Thus, the Fv comprises an
antibody combining site.
[0122] Hybrid antibodies may be employed. Hybrid antibodies have
constant regions derived substantially or exclusively from human
antibody constant regions and variable regions derived
substantially or exclusively from the sequence of the variable
region of a monoclonal antibody from each stable hybridoma.
[0123] Methods for preparation of fragments of antibodies (e.g. for
preparing an antibody or an antigen binding fragment thereof having
specific binding affinity for either caspase-1 or an
autophagy-related immunomodulatory cytokine) are either described
in the experiments herein or are otherwise known to those skilled
in the art. See, Goding, "Monoclonal Antibodies Principles and
Practice", Academic Press (1983), p. 119-123. Fragments of the
monoclonal antibodies containing the antigen binding site, such as
Fab and F(ab')2 fragments, may be preferred in therapeutic
applications, owing to their reduced immunogenicity. Such fragments
are less immunogenic than the intact antibody, which contains the
immunogenic Fc portion. Hence, as used herein, the term "antibody"
includes intact antibody molecules and fragments thereof that
retain antigen binding ability.
[0124] When the antibody used in the practice of the invention is a
polyclonal antibody (IgG), the antibody is generated by inoculating
a suitable animal with a target structure or a fragment thereof.
Antibodies produced in the inoculated animal that specifically bind
the target structure are then isolated from fluid obtained from the
animal. Anti-target-structure antibodies may be generated in this
manner in several non-human mammals such as, but not limited to,
goat, sheep, horse, rabbit, and donkey. Methods for generating
polyclonal antibodies are well known in the art and are described,
for example in Harlow et al. (In: Antibodies, A Laboratory Manual,
1988, Cold Spring Harbor, N.Y.).
[0125] When the antibody used in the methods used in the practice
of the invention is a monoclonal antibody, the antibody is
generated using any well known monoclonal antibody preparation
procedures such as those descried, for example, in Harlow et al.
(supra) and in Tuszynski et el. (Blood 1988, 72:109-115).
Generally, monoclonal antibodies directed against a desired antigen
are generated from mice immunized with the antigen using standard
procedures as referenced herein. Monoclonal antibodies directed
against full length or fragments of target structure may be
prepared using the techniques described in Harlow et al.
(supra).
[0126] The effects of sensitization in the therapeutic use of
animal-origin monoclonal antibodies in the treatment of human
disease may be diminished by employing a hybrid molecule generated
from the same Fab fragment, but a different Fc fragment, then
contained in monoclonal antibodies previously administered to the
same subject. It is contemplated that such hybrid molecules formed
from the anti-target-structure monoclonal antibodies may be used in
the present invention. The effects of sensitization are further
diminished by preparing animal/human chimeric antibodies, e.g.,
mouse/human chimeric antibodies, or humanized (i.e. CDR-grafted)
antibodies. Such monoclonal antibodies comprise a variable region,
i.e., antigen binding region, and a constant region derived from
different species. By `chimeric` antibody is meant an antibody that
comprises elements partly derived from one species and partly
derived from at least one other species, e.g., a mouse/human
chimeric antibody.
[0127] Chimeric animal-human monoclonal antibodies may be prepared
by conventional recombinant DNA and gene transfection techniques
well known in the art. The variable region genes of a mouse
antibody-producing myeloma cell line of known antigen-binding
specificity are joined with human immunoglobulin constant region
genes. When such gene constructs are transfected into mouse myeloma
cells, the antibodies produced are largely human but contain
antigen-binding specificities generated in mice. As demonstrated by
Morrison et al., 1984, Proc. Natl. Acad. Sci. USA 81:6851-6855,
both chimeric heavy chain V region exon (VH)-human heavy chain C
region genes and chimeric mouse light chain V region exon
(VK)-human K light chain gene constructs may be expressed when
transfected into mouse myeloma cell lines. When both chimeric heavy
and light chain genes are transfected into the same myeloma cell,
an intact H2L2 chimeric antibody is produced. The methodology for
producing such chimeric antibodies by combining genomic clones of V
an C region genes is described in the above-mentioned paper of
Morrison et al., and by Boulianne et al. (Nature 1984,
312:642-646). Also see Tan et al. (J. Immunol. 1985, 135:3564-3567)
for a description of high level expression from a human heavy chain
promotor of a human-mouse chimeric K chain after transfection of
mouse myeloma cells. As an alternative to combining genomic DNA,
cDNA clones of the relevant V and C regions may be combined for
production of chimeric antibodies, as described by Whitte et al.
(Protein Eng. 1987, 1:499-505) and Liu et al. (Proc. Natl. Acad.
Sci. USA, 1987, 84:3439-3443). For examples of the preparation of
chimeric antibodies, see the following U.S. Pat. Nos. 5,292,867;
5,091,313; 5,204,244; 5,202,238; and 5,169,939. The entire
disclosures of these patents, and the publication mentioned in the
preceding paragraph, are incorporated herein by reference. Any of
these recombinant techniques are available for production of
rodent/human chimeric monoclonal antibodies against target
structures.
[0128] To further reduce the immunogenicity of murine antibodies,
"humanized" antibodies have been constructed in which only the
minimum necessary parts of the mouse antibody, the
complementarity-determining regions (CDRs), are combined with human
V region frameworks and human C regions (Jones et al., 1986, Nature
321:522-525; Verhoeyen et al., 1988, Science 239:1534-1536; Hale et
al., 1988, Lancet 2:1394-1399; Queen et al., 1989, Proc. Natl.
Acad. Sci. USA 86:10029-10033). The entire disclosures of the
aforementioned papers are incorporated herein by reference. This
technique results in the reduction of the xenogeneic elements in
the humanized antibody to a minimum. Rodent antigen binding sites
are built directly into human antibodies by transplanting only the
antigen binding site, rather than the entire variable domain, from
a rodent antibody. This technique is available for production of
chimeric rodent/human anti-target structure antibodies of reduced
human immunogenicity."
[0129] Further, standard techniques for growing cells, separating
cells, and where relevant, cloning, DNA isolation, amplification
and purification, for enzymatic reactions involving DNA ligase, DNA
polymerase, restriction endonucleases and the like, and various
separation techniques are those known and commonly employed by
those skilled in the art. A number of standard techniques are
described in Sambrook et al., 1989 Molecular Cloning, Second
Edition, Cold Spring Harbor Laboratory, Plainview, N.Y.: Maniatis
el al., 1982 Molecular Cloning, Cold Spring Harbor laboratory,
Plainview, N.Y.; Wu (ed.) 1993 Meth. Enzymol. 218, Part 1; Wu (Ed.)
1979 Meth. Enzymol. 68; Wu et al., (Eds.) 1983 Meth. Enzymol. 100
and 101; Grossman and Moldave (Eds.) 1980 Meth. Enzymol. 65; Miller
(ed.) 1972 Experiments in Molecular Genetics, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.; Old and Primrose, 1981
Principles of Gene Manipulation, University of California Press,
Berkeley; Schleif and Wensink, 1982 Practical Methods in Molecular
Biology; Glover (Ed.) 1985 DNA Cloning Vol. I and II, IRL Press,
Oxford, UK; Hames and Higgins (Eds.) 1985 Nucleic Acid
Hybridization, IRL Press, Oxford, UK; and Setlow and Hollaender
1979 Genetic Engineering: Principles and Methods, Vols. 1-4, Plenum
Press, New York. Abbreviations and nomenclature, where employed,
are deemed standard in the field and commonly used in professional
journals such as those cited herein.
[0130] High-content imaging techniques and diagnostic methods
described herein can use fluorescence-inducing compounds, e.g. a
fluorescent moiety such as a fluorescein dye or a rhodamine dye. In
some embodiments, the fluorescent moiety comprises two or more
fluorescent dyes that can act cooperatively with one another, for
example by fluorescence resonance energy transfer ("FRET"). The
fluorescent moiety may be any fluorophore that is capable of
producing a detectable fluorescence signal in an aqueous medium.
"Quench" refers to a reduction in the fluorescence intensity of a
fluorescent group as measured at a specified wavelength, regardless
of the mechanism by which the reduction is achieved. As specific
examples, the quenching may be due to molecular collision, energy
transfer such as FRET, a change in the fluorescence spectrum
(color) of the fluorescent group or any other mechanism. The amount
of the reduction is not critical and may vary over a broad range.
The only requirement is that the reduction be measurable by the
detection system being used. Thus, a fluorescence signal is
"quenched" if its intensity at a specified wavelength is reduced by
any measurable amount.
[0131] Examples of fluorophores include xanthenes such as
fluoresceins, rhodamines and rhodols, cyanines, phtalocyamines,
squaraines, bodipy dyes, pyrene, anthracene, naphthalene, acridine,
stilbene, indole or benzindole, oxazole or benzoxazole, thiazole or
benzothiazole, carbocyanine, carbostryryl, porphyrin, salicylate,
anthranilate, azulene, perylene, pyridine, quinoline,
borapolyazaindacene, xanthene, oxazine or benzoxazine, carbazine,
phenalenome, coumarin, benzofuran, or benzphenalenone. Examples of
rhodamine dyes include, but are not limited to, rhodamine B,
5-carboxyrhodamine, rhodamine X (ROX), 4,7-dichlororhodamine X
(dROX), rhodamine 6G (R6G), 4,7-dichlororhodamine 6G, rhodamine 110
(R1 10), 4,7-dichlororhodamine 110 (dRI 10), tetramethyl rhodamine
(TAMRA) and 4,7-dichlorotetramethylrhodamine (dTAMRA). Examples of
fluorescein dyes include, but are not limited to,
4,7-dichlorofluoresceins, 5-carboxyfluorescein (5-FAM) and
6-carboxyfluorescein (6-FAM).
[0132] For example, cells can be transfected with green fluorescent
protein-tagged autophagic marker protein light chain 3 (GFP-LC3)
(see e.g., Gonzalez-Pole R-A, et al. (2005) J. Cell Sci.
188:3091-3102), which is a fluorescent fusion protein that is
incorporated into autophagosomes (also called autophagic vesicles,
or AV); confocal microscopy can be used to score the number of
autophagosomes (LC3-GFP dots) per cell. Although this can be done
using robotics and automated microscopy.
[0133] Detection and spatial localization in a biological sample as
described herein may be based on, but not restricted to
fluorescence in the ultra-violet, visible, infrared spectral
regions, or may report via radio frequencies (MRI/NMR) and well as
radioactive detection. In addition, a reporter group containing
heavy atoms is employed for detection using electron microscopy (EM
or TEM), scanning EM (SEM) or mass spectral or equivalent
techniques. In alternative embodiments, the reporter (domains or
moieties) comprise functional groups that either turn off or on its
reporting function from its native state, but in the presence of a
biological sample (for example, pH change, presence of a specific
enzyme, metal etc.) changes its state, giving further details to
the biological environment in an autophagic vesicle.
[0134] In one embodiment of the invention, "sandwich" type
immunoassays are utilized to measure LC3 in a sample, preferably a
blood sample, to facilitate an case of analysis of LC3 activity in
the blood of a patient or subject. In one embodiment, the methods
of the invention utilize a capture antibody that specifically binds
to LC3. The capture antibody may be coupled to a solid substrate or
solid phase. Examples of suitable substrates include, but are not
limited to, wells of microtiter plates or cuvettes, or
nitrocellulose or nylon membranes. In one embodiment of the
invention, the capture antibodies are coupled to paramagnetic
particles in wells of microtiter plates or cuvettes. For example,
biotin-coupled capture antibodies can couple to streptavidin coated
paramagnetic particles via the well known avidin-biotin binding
reaction. Other methods of coupling the capture antibody to the
solid phase of the assays are known to those skilled in the art.
LC3 antibodies, including monoclonal antibodies are available in
the art (available from Cell Signalling Technology, Danvers, Mass.,
USA). The use of these and/or other antibodies which are otherwise
described herein or are well known in the art and may be readily
adapted to the present invention.
[0135] In practicing the sandwich immunoassay, LC3 may also be
exposed to a detection antibody that is coupled to a detectable
label. Examples of suitable labels are described above, one example
of a label is an acridinium ester. Methods of coupling labels to
antibodies are well known in the art. For example, acridinium, as a
"sulfonyl chloride ester" can be crosslinked to the detection
antibody by the reaction of the lysly moiety of the epsilon amino
group of lysine in proteins, such as antibodies, to the acridinium
ester. The reaction products may then be separated by size
exclusion chromatography on Sepharose beads or otherwise.
[0136] In certain embodiments of the invention, the sandwich
immunoassays may be chemiluminescent immunoassays, but colorimetric
assays may be preferred for point of care application, including
home applications. Although specific monoclonal antibodies are
disclosed herein and are commercially available, other monoclonal
antibodies that could be used as capture and detection antibodies
for LC3 as described herein can be produced using conventional
methods known in the art. See, for example, Kohler and Milstein,
(1975) Nature, 256:495-97; or Sambrook et al. (2001) Molecular
Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor
Laboratory Press. Briefly, animals, such as mice, are injected with
an antigen, such as LC3 or fragments thereof, that may be coupled
to a carrier protein. The animals are boosted with one or more
antigen injections, and are hyperimmunized by an intravenous (IV)
booster about three days before fusion. Spleen cells from the mice
are isolated and are fused by standard methods to myeloma cells.
Hybridomas are selected in standard
hypoxanthine/aminopterin/thymine (HAT) medium, according to
standard methods. Hybridomas secreting antibodies which recognize
different epitopes of the antigen are identified, cultured, and
subcloned using standard immunological techniques. The antibodies
are then screened for the desired specificity or cross reactivity
using methods known in the art.
[0137] Although one embodiment of the invention employs
colorimetric or chemiluminescent sandwich immunoassays to practice
the methods of the invention, other immunoassays, such as ELISAs
and RIAs may be used. The parameters and components of the assays
are determined and optimized as is well known to those skilled in
the art such that the assays provide measurement of LC3 levels in
the biological samples being assayed. In addition, although certain
embodiments of the invention utilize antibodies as the agents
capturing LC3, LC3 may be captured in the assays of the invention
using other chemical agents or molecules that are not antibodies.
For example, such an agent may recognize carbohydrate profiles of
LC3 and thereby bind the LC3 to a solid phase in a similar manner
as the capture antibodies described herein.
[0138] In some embodiments of the invention, it may be desirable to
automate the methods as much as practical in order to improve
replicability of the results and reduce the time and costs required
to conduct the assays. Automated assays used to practice the
methods of the invention permit users to conduct at least about 80
tests per hour, and preferably more than about 100 test per
hour.
[0139] One may also use any conventional, non-automated, assay
device to practice the methods of the invention. For example, a
conventional microtiter plate can be used to store the various
solutions used in performing the assay. The device should permit
the biological sample to be exposed to a combination of antibodies.
The antibodies may recognize different epitopes of the antigen(s)
being assayed. The device should also cause the bound antigen to be
retained to a substrate as solutions are added and removed during
the assay.
[0140] By way of example, and not by way of limitation, wells of a
microtiter plate can be loaded with a solution containing
streptavidin coated magnetic particles, as described herein. A
solution containing biotin coupled capture antibodies (e.g., biotin
coupled mAb) is added to the well to enable the coupling of the
capture antibodies to the magnetic particles. A concentration of
capture antibody is empirically selected (based on expected antigen
concentrations) as discussed herein, to permit binding of all, or
essentially all, of the test antigen that is available in the
sample. In that regard, typical antigen concentrations in
biological samples are in the nanogram to low microgram range
(e.g., less than 1 ng/ml-5 .mu.g/ml) so that the capture antibody
concentrations are in the low to high microgram range (e.g. 1-100
.mu.g/ml). The sample is added to the well. If the sample contains
the antigens of interest (e.g., LC3), the antigen will bind to the
capture antibodies. The plate is exposed to a magnetic field to
immobilize the magnetic particles, and the solution is removed from
the well; but the antigen will not be removed because it is bound
to the antibodies that are bound to the magnetic particles that are
immobilized by the magnetic field. A solution containing the
detection antibody coupled to a label (e.g., acridinium labeled
mAb) is added to the well containing the bound antigen. As
indicated elsewhere herein, the concentration of the detection
antibody is preferably selected so that all, or essentially all, of
the test antigen molecules (e.g., LC3 ) are bound by the detection
antibody. Thus, the detection antibody can be provided at
concentrations at least an order of magnitude greater than the
expected concentration of the test antigen. For example, if a test
antigen has an expected concentration of 2 ng/ml, the detection
antibody concentrations can be at least 20 ng/ml (0.02 .mu.g/ml).
After a sufficient amount of time (from about 10 minutes to about 8
or more hours, which is determined in a calibration step),
determined an optimized empirically as described herein, the plate
is exposed to a magnetic field, the solution is then removed, and
the sample is washed. The amount of label remaining in the well is
then measured (e.g., by a luminometer). The measured values can be
quantitative or qualitative. Quantitative results are usually
preferred. The measured values may then be compared to a standard
or a threshold.
[0141] One immunoassay system which may be used in the present
invention is the Nichols Advantage.RTM. immunoassay system, which
is fully automated chemiluminescent system. The system is a
bench-top instrument that performs solid phase chemiluminescent
immunoassays. Streptavidin-coated magnetic particles and
biotinylated antibodies may be employed in the assay system.
Acridinium ester is typically the chemiluminescence label for
signal detection. Other assay systems may also be employed in the
present method.
[0142] In practicing the methods of the invention, a control may be
provided in the assay to ensure that the reactions have been
successful. For example, a control could be provided with a
polyclonal antibody solution for other analytes present in the
biological sample or the same analytes present in other control
samples.
[0143] In point of care applications, and in home assay tests, the
following exemplary colorimetric assay may be used. The assay may
also be chemiluminescent, but it preferably colorimetric in nature
(for ease of use). The test device for determining concentration
levels of LC3 may be a nitrocellulose-based (or other appropriate
polymeric material) colorimetric sandwich assay
(nitrocellulose-based sandwich assay) or two antibody test based
upon a capture antibody and a detection antibody (at least one)
wherein the capture and detection antibodies recognize and bind
different epitopes of LC3, and wherein one of the antibodies (the
detection antibody) is coupled to a label that produces a
detectable or colorimetric signal (through a dye such as a
gold-based dye) and the other antibody, the capture antibody, is
anchored to a support, preferably a polymeric material, preferably
a nitrocellulose or other film layer, wherein the capture antibody
is fixed in a line in the film layer. In this preferred assay, both
the capture antibody and the detection antibody are specific for
different epitopes on LC3, such that the LC3 may be measured. In
preferred aspects, the capture antibody is specific for a
particular epitope on LC3 and the detection antibody may be much
less specific provided that the antibody binds, and consequently
labels, essentially all of the LC3 which is bound to the capture
antibody. In this assay the capture antibody is specific for a
different epitope on LC3 than is the detection antibody although
both the capture and detection antibodies (in the case of the
detection antibody either singly or collectively) are specific for
LC3 to maximize accuracy.
[0144] In this point of home or point of care diagnostic test, the
detection antibody is linked to dye (gold-based or other) and
initially is in an upper layer material which is porous to liquid
and is free to move to a lower layer when it comes into contact
with liquid, such as blood, serum, plasm or urine, which contains
LC3. The detection antibody of the upper layer is free to move from
the upper layer (preferably a porous sponge material) to the lower
layer. The other antibody (the capture antibody) is anchored in the
nitrocellose matrix or other similar material in a shape like a
line. The LC3 containing cells in serum would enter the device and
bind to the antibody-dye. There can an opening in the device case
called the "result window", exposing any color from the dye. The
LC3 antibody-dye would then move into or through the nitrocellulose
matrix until it reaches the anchored captured antibody. The result
("result line") would be a colored line in the "result window". A
further line of die could be shown in the "result window". This is
the "control dye line" or line generated by a dye that corresponds
to the color and intensity that would be observed in the line in
the "result window" from the antibody-dye: LC3 : anchored antibody
sandwich if blood/serum/urine concentration was formed by at least
about a certain concentration of LC3 containing cells. If the
"result line" was not as intense as the "control dye line" than LC3
are at which evidence that autophagy was not responsible for the
patient's illness or condition. If the "result line" was similar or
more intense than the "control dye line" then the patient is
predicted to have an autophagy-mediated disease state and/or
condition with a high accuracy. The aim would be for a test of high
sensitivity calibrated preferably to a level of LC3 predictive of a
disease state.
[0145] "Cells implicated in a lipid-related metabolic disorder"
include any cell manifesting a disruption of cellular lipid
homeostasis. For example, familial hypercholesterolemia (FH) is
caused by mutations in the LDL receptor. Although LDL receptors are
expressed ubiquitously, the hepatic LDL receptor has the greatest
quantitative effect in controlling plasma LDL levels. Hence
hepatocytes are type of cells implicated in a lipid-related
metabolic disorder. Lipoprotein lipase (LP) deficiency is a rare
autosomal recessive disorder characterized by markedly elevated
plasm levels of triglycerides. Most LPL expression is in muscle and
adipose tissue. Muscle (e.g. skeletal muscle) and adipose tissue
cells are therefore another type of useful cell implicated in
metabolic disorders. ApoE serves as a ligand that mediates the
clearance of chylomicron and VLDL remnant lipoproteins by binding
to the LDL receptor and related members of the same gene family.
Most apoE in plasma is derived from the liver. A genetic deficiency
of apoE results in substantially elevated levels of lipoprotein
remnants and is associated with an increased risk for
atherosclerotic vascular disease. Hepatocytes can be used in the
evaluation of this disorder using techniques described herein.
[0146] Unesterified cholesterol is esterified to cholesteryl ester
in the blood by the lipoprotein-associated enzyme lecithin:
cholesterol acyltransferase (LCAT). Complete LCAT deficiency is is
characterized by markedly reduced HDL cholesterol levels (less than
10 mg/dl), corneal opacities, anemia, and progressive proteinuria
and renal insufficiency eventually leading to end-stage renal
disease. Although LCAT is normally synthesized in the liver,
because it is a secreted protein it could theoretically be made in
other tissues such as muscle. Hepatocytes and muscle cells can
therefore be used in the evaluation of this disorder using
techniques described herein. Tangier disease is a rare genetic
disorder associated with markedly reduced HDL cholesterol levels
(less than 5 mg/dl), the accumulation of cholesterol in macrophages
and related cells, neuropathy, and premature atherosclerosis.
Macrophages or bone marrow stem cells can therefore be used in the
evaluation of this disorder using techniques described herein.
ApoA-1 is the major protein in HDL; a genetic deficiency of apoA-1
results in markedly reduced HDL and seems, at least in some
kindreds, to increase the risk for coronary artery disease.
Hepatocytes and muscle cells can be used in the evaluation of this
disorder using techniques described herein.
[0147] Cell samples used in methods of the invention can be stem
cells. Stem cells are cells capable of differentiation into other
cell types, including those having a particular, specialized
function (i.e., terminally differentiated cells, such as
erythrocytes, macrophages, etc.), progenitor (i.e., "multipotent")
cells which can give rise to any one of several different
terminally differentiated cell types, and cells that are capable of
giving rise to various progenitor cells. Cells that give rise to
some or many, but not all, of the cell types of an organism are
often termed "pluripotent" stem cells, which are able to
differentiate into any cell type in the body of a mature organism,
although without reprogramming they are unable to de-differentiate
into the cells from which they were derived. "Multipotent"
stem/progenitor cells (e.g., neural stem cells) have a more narrow
differentiation potential than do pluripotent stem cells. Another
class of cells even more primitive (i.e., uncommitted to a
particular differentiation fate) than pluripotent stem cells are
the so-called "totipotent" stem cells (e.g., fertilized oocytes,
cells of embryos at the two and four cell stages of development),
which have the ability to differentiate into any type of cell of
the particular species. For example, a single totipotent stem cell
could give rise to a complete animal, as well as to any of the
myriad of cell types found in the particular species (e.g.,
humans). In this specification, pluripotent and totipotent cells,
as well as cells with the potential for differentiation into a
complete organ or tissue, are referred as "primordial" stem
cells.
[0148] "The morphology of positive control cell samples" can be
determined using techniques that are well-known to those or
ordinary skill in the art. For example, microtubule associated
protein light chain 3 (LC3) is an ubiquitin-like protein that binds
to autophagosomes (AVs). Mammalian cells can be transfected with
GFP tagged LC3 to track and follow the fate of AVs in the cell and
to measure autophagic flux. Also, GFP-LC3 puncta that colocalize
with mitochondria is a way to measure the initiation of
mitochondrial autophagy, the catabolic process by which
mitochondria are targeted for lysosomal degradation. See e.g., Chu,
C. T., Plowey, E. D., Dagda, R. K., Hickey, R. W., Cherra III, S.
J., and Clark, R. S. Autophagy in Nerine Injury and
Neurodegeneration: in vitro and in vivo models. Meth. Enzymol:
453;217-49, 2009; Dagda, R. K., Zhu, J., Kulich, S. M., and Chu, C.
T. Mitochondrially localized ERK2 regulates mitophagy and
autophagic cell stress. Autophagy, 4 (6): 770-82, 2008. PMID:
18594198; and Zhu J. Dagda R. K, Chu C T. Monitoring mycophagy in
neuronal cell cultures. Department of Pathology, University of
Pittsburgh School of Medicine, Pittsburgh, Pa., USA. Methods Mol
Biol. 2011; 793:325-39, 2011.
[0149] As disclosed herein the invention enables the use of
high-throughput format, high-content imaging to examine the cell
sample for an autophagy-associated effect on cytoplasmic
puncta.
[0150] In one embodiment, determination of an autophagy-associated
effect on cytoplasmic puncta involves detecting the amount of
autophagy, or the amount of autophagosomes (AV) or AV activity, in
a sample (e.g. a cell) both in the absence and presence of a
candidate composition and an increase or a decrease in the amount
of autophagy as compared to control indicates that the candidate
composition is a modulator of autophagy in a cell extract, cell,
tissue, organ, organism or individual. Fluorescence microscopy or a
fluorescence imaging can be used to determine the amount of and/or
the location of the detectable composition or moiety in a sample
cell. The screening, e.g., high-throughput screening, method can
comprise high-content imaging on a multi-well plate. The screening
can be constructed and practiced on a multi-well plate. (Typically,
wells are arranged in two-dimensional linear arrays on the
multi-well platform. However, the wells can be provided in any type
of array, such as geometric or non-geometric arrays. Commonly used
numbers of wells include 24, 96, 384, 864, 1,536, 3,456, and
9.600.) Transmission electron microscopy (TEM) can be used to
determine the amount of and/or the location of the detectable
composition or moiety in the cell extract, cell, tissue, organ,
organism or individual. This technique can be adapted to a
plate-reader format for high-throughput screening of drugs that
modulate autophagy, i.e., high-throughput detection of autophagic
(autophagosome) levels and/or activity in cells or tissues.
Compositions disclosed in U.S. Patent Application Document No.
20120042398 (e.g., cadaverine derivatives) can localize into or
detect autophagosomes (AV) or AV subpopulations, and these
compositions can comprise any detectable moiety or group, e.g.,
cadaverine derivative(s), or fluorescent-; bioluminescent,
radioactive- and/or paramagnetic-conjugated cadaverine
reagents.
[0151] For generally applicable methods and materials that can be
employed in the use of high-throughput format, high-content imaging
to examine a cell sample for a autophagy-associated effect on
cytoplasmic puncta, see: Eils et al., Concurrent detection of
autolysosome formation lysosomal degradation by flow cytometry in a
high-content screen for inducers of autophagy. BMC Biology 2011,
9:38; Carragher, et al., Combining imaging and pathway profiling:
an alternative approach to cancer drug discovery, Drug Discovery
Today, Volume 17, Issues 5-6, March 2012, Pages 203--214; and
Methods in Enzymology Volume 506 Imaging and Spectroscopic Analysis
of Living Cells (Conn ed.) (2012).
[0152] In preferred embodiments, the methods of the invention are
conducted in a high-throughput format.
[0153] Exemplary high-throughput assay systems include, but are not
limited to, an Applied Biosystems plate-reader system (using a
plate with any number of wells, including, but not limited to, a
96-well plate, a-384 well plate, a 768-well plate, a 1,536-well
pate, a 3,456-well plate, a 6,144-well plate, and a plate with
30,000 or more wells), the ABI 7900 Micro Fluidic Card system
(using a card with any number of wells, including, but not limited
to, 384-well card), other microfluidic systems that exploit the use
of TaqMan probes (including, but not limited to, systems described
in WO 04083443 A1, and published U.S. Patent Application Nos.
2003-0138829 A1 and 2003-0008308 A1), other micro card systems
(including, but not limited to, W004067175 A1), the Invader.RTM.
system (Third Wave Technologies), the OpenArray.TM. system
(Biotrove), systems including integrated fluidic circuits
(Fluidigm), and other assay systems known in the art. In certain
embodiments, multiple different labels are used
[0154] in each multiplex amplification reaction in a
high-throughput multiplex amplification assay system such that a
large number of different target nucleic acid sequences can be
analyzed on a single plate or card. In certain embodiments, a
high-throughout multiplex amplification assay system is capable of
analyzing most of the genes in a genome on a single plate or card.
In certain embodiments, a high-throughput multiplex amplification
assay system is capable of analyzing all genes in an entire genome
on a single plate or card. In certain embodiments, a
high-throughput multiplex amplification assay system is capable of
analyzing most of the nucleic acids in a transcriptome on a single
plate or card. In certain embodiments, a high-throughput multiplex
amplification assay system is capable of analyzing all of the
nucleic acids in a transcriptome on a single plate or card.
[0155] The practice of the present invention may also employ
conventional biology methods, software and systems. Computer
software products of the invention typically include computer
readable medium having computer-executable instructions for
performing the logic steps of the method of the invention. Suitable
computer readable medium include floppy disk, CD-ROM/DVD/DVD-ROM,
hard-disk drive, flash memory, ROM/RAM, magnetic tapes and etc. The
computer executable instructions may be written in a suitable
computer language or combination of several languages. Basic
computational biology methods are described in, for example Setubal
and Meidanis et al., Introduction to Computational Biology Methods
(PWS Publishing Company, Boston, 1997); Salzberg, Searles, Kasif,
(Ed.), Computational Methods in Molecular Biology, (Elsevier,
Amsterdam, 1998); Rashidi and Buchler, Bioinformatics Basics:
Application in Biological Science and Medicine (CRC Press, London,
2000) and Ouelette and Bzevanis, Bioinformatics: A Practical Guide
for Analysis of Gene and Proteins (Wiley & Sons, Inc.,
2.sup.nd.ed., 2001). See U.S. Pat. No. 6,420,108.
[0156] The present invention may also make use of various computer
program products and software for a variety of purposes, such as
probe design, management of data, analysis, and instrument
operation. See, U.S. Pat. Nos. 5,593,839, 5,795,716, 5,733,729,
5,974,164, 6,066,454, 6,090,555, 6,185,561, 6,188,783, 6,223,127,
6,229,911 and 6,308,170.
[0157] Additionally, the present invention relates to embodiments
that include methods for providing information over networks such
as the Internet. For example, the components of the system may be
interconnected via any suitable means including over a network,
e.g. the ELISA plate reader to the processor or computing device.
The processor may take the form of a portable processing device
that may be carried by an individual user e.g. lap top, and data
can be transmitted to or received from any device, such as for
example, server, laptop, desktop, PDA, cell phone capable of
receiving data, BLACKBERRY.TM., and the like. In some embodiments
of the invention, the system and the processor may be integrated
into a single unit. In another example, a wireless device can be
used to receive information and forward it to another processor
over a telecommunications network, for example, a text or
multi-media message.
[0158] The functions of the processor need not be carried out on a
single processing device. They may, instead by distributed among a
plurality of processors, which may be interconnected over a
network. Further, the information can be encoded using encryption
methods, e.g., SSL, prior to transmitting over a network or remote
user. The information required for decoding the captured encoded
images taken from test objects may be stored in databases that are
accessible to various users over the same or a different
network.
[0159] In some embodiments, the data is saved to a data storage
device and can be accessed through a web site. Authorized users can
log onto the web site, upload scanned images, and immediately
receive results on their browser. Results can also be stored in a
database for future reviews.
[0160] In some embodiments, a web-based service may be implemented
using standards for interface and data representation, such as SOAP
and XML, to enable third parties to connect their information
services and software to the data. This approach would enable
seamless data request/response flow among diverse platforms and
software applications.
[0161] The term "compound" is used herein to refer to any specific
chemical compound disclosed herein. Within its use in context, the
term generally may refer to a single compound, such as a
polypeptide or other molecular entity used in the present
invention.
[0162] In certain non-limiting embodiments, an increase or a
decrease in a subject or test sample of the level of measured
protein or gene expression or autophagic change as compared to a
comparable level of measured protein or gene expression or
autophagic change in a control subject or sample can be an increase
or decrease in the magnitude of approximately .+-.5,000-10,000%, or
approximately .+-.2,500-5,000%, or approximately .+-.1,000-2,500%,
or approximately .+-.500-1,000%, or approximately 250-500%, or
approximately .+-.100-250%, or approximately .+-.50-100%, or
approximately .+-.25-50%, or approximately .+-.10-25%, or
approximately .+-.10-20%, or approximately .+-.10-15, or
approximately .+-.5-10%, or approximately .+-.1-5%, or
approximately .+-.0.5-1%, or approximately .+-.0.1-0.5%, or
approximately .+-.0.01-0.1%, or approximately .+-.0.01-0.01%, or
approximately .+-.0.001-0.001%.
[0163] The values obtained from controls are reference values
representing a known health status and the values obtained from the
test samples or subjects are reference values representing a known
disease status. The term "control", as used herein, can mean a
sample of preferably the same source (e.g. blood, serum, tissue
etc.) which is obtained from at least one healthy subject to be
compared to the sample to be analyzed. In order to receive
comparable results the control as well as the sample should be
obtained, handled and treated in the same way. In certain examples,
the number of healthy individuals used to obtain a control value
may be at least one, preferably at least two, more preferably at
least five, most preferably at least ten, in particular at least
twenty. However, the values may also be obtained from at least one
hundred, one thousand or ten thousand individuals.
[0164] A level and/or an activity and/or expression of a
translation product of a gene and/or of a fragment, or derivative,
or variant of said translation product, and/or the level or
activity of said translation product, and/or of a fragment, or
derivative, or variant thereof, can be detected using an
immunoassay, an activity assay, and/or a binding assay. These
assays can measure the amount of binding between said protein
molecule and an anti-protein antibody by the use of enzymatic,
chromodynamic, radioactive, magnetic, or luminescent labels which
are attached to either the anti-protein antibody or secondary
antibody which binds the anti-protein antibody. In addition, other
high affinity ligands may be used. Standard techniques for growing
cells, separating cells, and where relevant, cloning, DNA
isolation, amplification and purification, for enzymatic reactions
involving DNA ligase, DNA polymerase, and restriction endonucleases
as disclosed above can be employed.
[0165] In exemplary embodiments of the invention which comprise
detecting the presence of antibodies that are reactive to
caspase-1, antibodies are found in a sample from a subject. The
antibodies can be detected by an immunoassay where an
antibody-protein complex is formed. The antibodies are found in the
sample of the subject, e.g. serum. The subject is a human and the
implicated disease (e.g. tuberculosis) is idiopathic. Healthy
individuals have minimal or undetectable anti-caspase-1 by
conventional ELISA or Western blots. Individuals with idiopathic
tuberculosis have significant amount of detectable
anti-caspase-1auto-antibodies, at least 10% more anti-caspase-1
auto-antibodies detected over that from a healthy non-tuberculosis
individual or the level obtained for a population of healthy
non-tuberculosis individuals by conventional ELISA or Western blots
as described herein. Moreover the levels of auto-antibodies
correspond with the clinical features of the disease condition.
Patients in remission after effective treatment have minimal or
undetectable anti-caspase-1 auto-antibodies by conventional ELISA
or Western blots. As an example, by undetectable amount of
anti-caspase-1 auto-antibodies, it means that no visible band is
observed in a Western Blot analysis performed as described in
Example 1, wherein human serum is diluted 1:100 and used in blot
assays described herein. In one embodiment, the amount of
anti-caspase-1auto-antibodies in a healthy non-tuberculosis
individual or the average amount in a population of healthy
non-tuberculosis individuals as determined by conventional ELISA or
Western blot can be considered as the background, reference or the
control level. The collected samples of serum from the healthy
non-tuberculosis individuals are diluted 1:100 and used in Western
blot assays. The intensity of the visible band is quantified by
densitometry. The densitometry intensity can be calibrated with a
range of known titer of anti-caspase-1 antibodies reacting with a
fixed amount of antigen caspase-1. For example, the range of known
antibody titer can be O .mu.g/ml, 0.5 .mu.g/ml, 1.0 .mu.g/ml, 1.5
.mu.g/ml, 2.0 .mu.g/ml, 2.5 .mu.g/ml, 3.0 .mu.g/ml, 5 .mu.g/ml, 7.5
.mu.g/ml, 10 .mu.g/ml, 15 .mu.g/ml and the fixed amount of
caspase-1 can 0.5 .mu.g on a blot. By comparing the densitometry
intensity of a human sample with the calibration curve, it is
possible to estimate the titer of the anti-caspase-1 in the sample.
For the data collected for a population of individuals, the average
value and one order of standard deviation is computed. Ideally, a
population has about 25 healthy non-tuberculosis individuals,
preferably more. The statistics, the average value and one order of
standard deviation can be uploaded to the computer system and data
storage media. Patients having at least 10% more than this average
amount of anti-caspase-1 auto-antibodies is likely to have
tuberculosis, especially if the patient is also presents the
clinical significant features of the disease. Methodologies that
are similar to those described above can be used to evaluate other
targets and disorders described herein.
[0166] In one embodiment, the auto-antibodies in the sample are
reactive against the caspase-1 that has been extracted from
mammalian tissues or recombinant mammalian caspase-1, e.g., the
human caspase-1. The sample from the subject can be a blood sample.
In other embodiments, the sample is a serum or plasma sample. In
one embodiment, the auto-antibodies are detected by a serological
immunoassay, such as an enzyme-linked immunosorbant assay or a
nephelometric immunoassay.
[0167] The term "patient" or "subject" refers to an animals, such
as a mammal, or a human, in need of treatment or therapy to which
compounds according to the present invention are administered in
order to treat a condition or disease state associated with a
tuberculosis infection or inflammation-associated metabolic
disorder, for instance, a particular stage of an obesity-related
disorder, using compounds according to the present invention.
[0168] An "inflammation-associated metabolic disorder" includes,
but is not limited to, lung diseases, hyperglycemic disorders
including diabetes and disorders resulting from insulin resistance,
such as Type I and Type II diabetes, as well as severe insulin
resistance, hyperinsulinemia, and dyslipidemia or a lipid-related
metabolic disorder (e.g., hyperlipidemia (e.g., as expressed by
obese subjects), elevated low-density lipoprotein (LDL), depressed
high-density lipoprotein (HDL), and elevated triglycerides) and
insulin-resistant diabetes, such as Mendenhall's Syndrome, Werner
Syndrome, leprechaunism, and lipoatrophic diabetes, renal
disorders, such as acute and chronic renal insufficiency, end-state
chronic renal failure, glomerulonephritis, intestinal nephritis,
pyelonephritis, glomerulosclerosis, e.g., Kimmelstiel-Wilson in
diabetic patients and kidney failure after kidney transplantation,
obesity, GH-deficiency, GH resistance, Turner's syndrome, Laron's
syndrome, short stature, increased fat mass-to-lean ratios,
immunodeficiencies including decreased CD4+ T cell counts and
decreased immune tolerance or chemotherapy-induced tissue damage,
bone marrow transplantation, diseases or insufficiencies of cardiac
structure or function such as heart dysfunctions and congestive
heart failure, neuronal, neurological, or neuromuscular disorders,
e.g., diseases of the central nervous system including Alzheimer's
disease, or Parkinson's disease or multiple sclerosis, and diseases
of the peripheral nervous system and musculature including
peripheral neuropathy, muscular dystrophy, or myotonic dystrophy,
and catabolic states, including those associated with wasting
caused by any condition, including, e.g., mental health condition
(e.g., anorexia nervosa), trauma or wounding or infection such as
with a bacterium or human virus such as HIV, wounds, skin
disorders, gut structure and function that need restoration, and so
forth.
[0169] An "inflammation-associated metabolic disorder" also
includes a cancer and an "infectious disease" as defined herein, as
well as disorders of bone or cartilage growth in children,
including short stature, and in children and adults disorders of
cartilage and bone in children and adults, including arthritis and
osteoporosis. An "inflammation-associated metabolic disorder"
includes a combination of two or more of the above disorders (e.g.,
osteoporosis that is a sequela of a catabolic state). Specific
disorders of particular interest targeted for treatment herein are
diabetes and obesity, heart dysfunctions, kidney disorders,
neurological disorders, bone disorders, whole body growth
disorders, and immunological disorders.
[0170] In one embodiment, "inflammation-associated metabolic
disorder" includes: central obesity, dyslipidemia including
particularly hypertriglyceridemia, low HDL cholesterol, small dense
LDL particles and postprandial lipemia; glucose intolerance such as
impaired fasting glucose; insulin resistance and hypertension, and
diabetes. The term "diabetes" is used to described diabetes
mellitus type I or type II. The present invention relates to a
method for improving renal function and symptoms, conditions and
disease states which occur secondary to impaired renal function in
patients or subjects with diabetes as otherwise described herein.
It is noted that in diabetes mellitus type I and II, renal function
is impaired from collagen deposits, and not from cysts in the other
disease states treated by the present invention.
[0171] Mycobacterial infections often manifest as diseases such as
tuberculosis. Human infections caused by mycobacteria have been
widespread since ancient times, and tuberculosis remains a leading
cause of death today. Although the incidence of the disease
declined, in parallel with advancing standards of living, since the
mid-nineteenth century, mycobacterial diseases still constitute a
leading cause of morbidity and mortality in countries with limited
medical resources. Additionally, mycobacterial diseases can cause
overwhelming, disseminated disease in immunocompromised patients.
In spite of the efforts of numerous health organizations worldwide,
the eradication of mycobacterial diseases has never been achieved,
nor is eradication imminent. Nearly one third of the world's
population is infected with Mycobacterium tuberculosis complex,
commonly referred to as tuberculosis (TB), with approximately 8
million new cases, and two to three million deaths attributable to
TB yearly. Tuberculosis (TB) is the cause of the largest number of
human deaths attributable to a single etiologic agent (see Dye et
al., J. Am. Med. Association, 282, 677-686, (1999); and 2000
WHO/OMS Press Release).
[0172] Mycobacteria other than M. tuberculosis are increasingly
found in opportunistic infections that plague the AIDS patient.
Organisms from the M. avium-intracellulare complex (MAC),
especially serotypes four and eight, account for 68% of the
mycobacterial isolates from AIDS patients. Enormous numbers of MAC
are found (up to 10.sup.10 acid-fast bacilli per gram of tissue),
and consequently, the prognosis for the infected AIDS patient is
poor.
[0173] In many countries the only measure for TB control has been
vaccination with M. bovis bacille Calmette-Guerin (BCG). The
overall vaccine efficacy of BCG against TB, however, is about 50%
with extreme variations ranging from 0% to 80% between different
field trials. The widespread emergence of multiple drug-resistant
M. tuberculosis strains is also a concern.
[0174] M. tuberculosis belongs to the group of intracellular
bacterial that replicate within the phagosomal vacuoles of resting
macrophages, thus protection against TB depends on T cell-mediated
immunity. Several studies in mice and humans, however, have shown
that Mycobacteria stimulate antigen-specific, major
histocompatibility complex (MHC) class II- or class I-restricted
CD4 and CD8 T cells, respectively. The important role of MHC class
I-restricted CD8 T cells was convincingly demonstrated by the
failure of P2-microglobulin) deficient mice to control experimental
M. tuberculosis infection.
[0175] As used herein, the term "tuberculosis" comprises disease
states usually associated with infections caused by mycobacteria
species comprising M. tuberculosis complex. The term "tuberculosis"
is also associated with mycobacterial infections caused by
mycobacteria other than M. tuberculosis. Other mycobacterial
species include M. avium-intracellulare, M. kansurii, M. fortuitum,
M. chelonae, M. leprae, M. africanum, and M. microti, M. avium
parascrofulaceum, M. intracellulare, M. scrofulaceum, M. xenopi, M.
marinum, M. ulcerans.
[0176] An "infectious disease" includes but is limited to those
caused by bacterial, mycological, parasitic, and viral agents.
Examples of such infectious agents include the following:
staphylococcus, streptococcaceae, neisseriaceae, cocci,
enterbacteriaceae, pseudomondaceae, vibrionaceae, campylobacter,
pasteurellaceae, bordetella, francisella, brucella, legionellaceae,
bacteroidaceae, gram-negative bacilli, clostridium,
corynebacterium, propionibacterium, gran-positive bacilli, anthrax,
actinomyces, nocardia, mycobacterium, treponema, borrelia,
leptospira, mycoplasma, ureaplasma, rickettsia, chlamydiae,
systemic mycoses, opportunistic mycoses, protozoa, nematodes,
trematodes, cestodes, adenoviruses, herpesviruses, poxviruses,
papovaviruses, hepatitis viruses, orthomyxoviruses,
paramyxoviruses, coronaviruses, picomaviruses, reoviruses,
togaviruses, flaviviruses, bunyaviridae, rhabdoviruses, human
immunodeficiency virus and retroviruses.
[0177] In certain embodiments, an "infectious disease" is selected
from the group consisting of tuberculosis, leprosy, Crohn's
Disease, acquired immunodeficiency syndrome, Lyme disease,
cat-scratch disease, Rocky Mountain spotted fever and influenza or
a viral infection selected from HIV (I and/or II), hepatitis B
virus (HBV) or hepatitis C virus (HCV).
[0178] "Autophagy-related immunomodulatory cytokines" include, but
are not limited to, IL-1a, IL-1, IL-18, IL-12p40 subunit, IL-4,
IL13, LMP1, EBNA2, IFN-y, ATG16L1, IRGM1, LC3B-II, HMGB1 and TBK-1,
among others.
[0179] "TKB-1 agonists" include, but are not limited to, a vascular
disrupting agent (VDA) such as lavone acetic acid and its
derivatives, e.g., 5,6-dimethylxanthenone-4-acetic acid
(DMXAA)).
[0180] "Caspase-1 inhibitors" include, but are not limited to,
minocycline, VX-765, IL-18BP, Ac-YVAD.cmk,
acetyl-Tyr-Val-Ala-Asp-chloromethylketone,
N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone, zVAD-fmk,
Z-Val-Ala-DL-Asp-fluoromethylketone, ML132 (CID-4462093;
NCGC-00183434), (-)-berkeleyamide A (1), NCGCOO 185682, VRT-043198,
the caspase-1 inhibitors identified in Boxer, et al., Chem Med
Chem, 2010 May 3; 3(5):730-8; and N-Ac-Tyr-Val-Ala-Asp-chloromethyl
ketone (Ac-YVAD-CMK).
[0181] "Autophagy-related immunomodulatory cytokine antagonists"
include but are not limited to interleukin-1 receptor antagonist
(IL-IRA), human recombinant forms of IL-IRA, a vascular disrupting
agent (VDA) such as lavone acetic acid and its derivatives, e.g.,
5,6-dimethylxanthenone-4 acetic acid (DMXAA).
[0182] The term "biological sample" encompasses a variety of sample
type obtained from an organism and can be used in a diagnostic or
monitoring assay. The term encompasses blood and/or plasma and
other liquid samples of biological origin, solid tissue samples,
such as a biopsy specimen or tissue cultures or cells derived
therefrom and the progeny thereof. The term encompasses samples
that have been manipulated in any way after their procurement, such
as by treatment with reagents, solubilization, or enrichment for
certain components. The term encompasses a clinical sample, and
also includes cells in cell culture, cell supernatants, cell
lysates, serum, plasma, biological fluids, and tissue samples.
[0183] The terms "body fluid" and "bodily fluid," used
interchangeably herein, refer to a biological sample of liquid from
a mammal, e.g., from a human. Such fluids include aqueous fluids
such as serum, plasma, lymph fluid, synovial fluid, follicular
fluid, seminal fluid, amniotic fluid, milk, whole blood, urine,
cerebrospinal fluid, saliva, sputum, tears, perspiration, mucus,
tissue culture medium, tissue extracts, and cellular extracts.
Particular bodily fluids that are interest in the context of the
present invention include serum, plasma, and blood.
[0184] According to various embodiments, the compounds according to
the present invention may be used for treatment or prevention
purposes in the form of a pharmaceutical composition. This
pharmaceutical composition may comprise one or more of an active
ingredient as described herein.
[0185] As indicated, the pharmaceutical composition may also
comprise a pharmaceutically acceptable excipient, additive or inert
carrier. The pharmaceutically acceptable excipient, additive or
inert carrier may be in a form chosen from a solid, semi-solid, and
liquid. The pharmaceutically acceptable excipient or additive may
be chosen from a starch, crystalline cellulose, sodium starch
glycolate, polyvinylpyrolidone, polyvinylpolypyrolidone, sodium
acetate, magnesium stearate, sodium laurylsulfate, sucrose,
gelatin, silicic acid, polyethylene gylcol, water, alcohol,
propylene glycol, vegetable oil, corn oil, peanut oil, olive oil,
surfactants, lubricants, disintegrating agents, preservative
agents, flavoring agents, pigments, and other conventional
additives. The pharmaceutical composition may be formulated by
admixing the active with a pharmaceutically acceptable excipient or
additive.
[0186] The pharmaceutical composition may be in a form chosen from
sterile isotonic aqueous solutions, pills, drops, pastes, cream,
spray (including aerosols), capsules, tablets, sugar coating
tablets, granules, suppositories, liquid, lotion, suspension,
emulsion, ointment, gel, and the like. Administration route may be
chosen from subcutaneous, intravenous, intestinal, parenteral,
oral, buccal, nasal, intramuscular, transcutaneous, transdermal,
intranasal, intraperitoneal, and topical. The pharmaceutical
compositions may be immediate release, sustained/controlled
release, or a combination of immediate release and
sustained/controlled release depending upon the compound(s) to be
delivered, the compound(s), if any, to be coadministered, as well
as the disease state and/or condition to be treated with the
pharmaceutical composition. A pharmaceutical composition may be
formulated with differing compartments or layers in order to
facilitate effective administration of any variety consistent with
good pharmaceutical practice.
[0187] The subject or patient may be chosen from, for example, a
human, a mammal such as domesticated animal, or other animal. The
subject may have one or more of the disease states, conditions or
symptoms associated with autophagy as otherwise described
herein.
[0188] The compounds according to the present invention may be
administered in an effective amount to treat or reduce the
likelihood of an autophagy-mediated disease and/or condition as
well one or more symptoms associated with the disease state or
condition. One of ordinary skill in the art would be readily able
to determine an effective amount of active ingredient by taking
into consideration several variables including, but not limited to,
the animal subject, age, sex, weight, site of the disease state or
condition in the patient, previous medical history, other
medications, etc.
[0189] For example, the dose of an active ingredient which is
useful in the treatment of an autophagy mediated disease state,
condition and/or symptom for a human patient is that which is an
effective amount and may range from as little as 100 .mu.g or even
less to at least about 500 mg or more, which may be administered in
a manner consistent with the delivery of the drug and the disease
state or condition to be treated. In the case of oral
administration, active is generally administered from one to four
times or more daily. Transdermal patches or other topical
administration may administer drugs continuously, one or more times
a day or less frequently than daily, depending upon the
absorptivity of the active and delivery to the patient's skin. Of
course, in certain instances where parenteral administration
represents a favorable treatment option, intramuscular
administration or slow IV drip may be used to administer active.
The amount of active ingredient which is administered to a human
patient preferably ranges from about 0.05 mg/kg to about 10 mg/kg,
about 0.1 mg/kg to about 7.5 mg/kg, about 0.25 mg/kg to about 6
mg/kg, about 1.25 to about 5.7 mg/kg.
[0190] The dose of a compound according to the present invention
may be administered at the first signs of the onset of an autophagy
mediated disease state, condition or symptom. For example, the dose
may be administered for the purpose of lung or heart function
and/or treating or reducing the likelihood of any one or more of
the disease states or conditions which become manifest during an
inflammation-associated metabolic disorder or tuberculosis or
associated disease states or conditions, including pain, high blood
pressure, renal failure, or lung failure. The dose of active
ingredient may be administered at the first sign of relevant
symptoms prior to diagnosis, but in anticipation of the disease or
disorder or in anticipation of decreased bodily function or any one
or more of the other symptoms or secondary disease states or
conditions associated with an autophagy mediated disorder to
condition.
[0191] These and other aspects of the invention are described
further in the following illustrative examples.
EXAMPLE 1
Autophagy is a Barrier Against Excessive Inflammation and Active
Tuberculosis
[0192] Here we show that autophagy plays a dual role against
tuberculosis; anti-bacterial and anti-inflammatory. Autophagy
defect in Atg5fl/fl LysM-Cre+ mice, infected with M. tuberculosis,
resulted in increased bacillary burden and excessive pulmonary
inflammation, neutrophilic infiltration, and necrosis. This
response was in part due to a cell-autonomous pro-inflammatory
phenotype. Autophagy-deficient macrophages released excessive
amounts of cytokines delivered by conventional and unconventional
secretory pathways. The mechanism for excessive secretion was
determined for the cytosolic alarmin IL-1a; caspase 1, required for
unconventional secretion of IL-1a, was downregulated by autophagy.
IL-1a induced IL-17 in CD4 T cells in keeping with neutrophilic
inflammatory state. Thus, autophagy protects against M.
tuberculosis and prevents uncontrolled inflammation leading to
tissue necrosis characteristic of active tuberculosis disease.
Introduction
[0193] Despite M. tuberculosis being one of the first recognized
microbes subject to elimination by immunological autophagy in ex
vivo systems in murine and human macrophages (Alonso et al., 2007,
Gutierrez et al., 2004; Harris et al., 2007; Kim et al., 2011; Xu
et al., 2007; Yuk et al, 2009a) the in vivo role of autophagy in
control of M. tuberculosis has not been reported, although genetic
evidence nevertheless indicates that at least one of the autophagic
factors (Singh et al., 2006; Singh et al., 2010) involved in
Crohn's disease (Craddock et al., 2010; Mccarroll et al., 2008) may
predispose human populations to tuberculosis (Intemann et al.,
2009). Given the compelling reasons to test whether autophagy
matters for control of M. tuberculosis in vivo, here we used a
mouse model of tuberculosis and employed transgenic mice deficient
in Atg5 in macrophages, the cell type parasitized by M.
tuberculosis (Vergne et al., 2004). We demonstrate that autophagy
controls tuberculosis infection in vivo and uncover a potentially
key role of autophagy in containing the inflammatory reactions of
the host. When autophagy is deficient in the macrophages of
infected mice, not only does this permit bacterial growth but also
leads to an excessive proinflammatory response, with partial roots
in sterile inflammation, leading to lung tissue destruction,
necrosis and active tuberculosis. Thus, in addition to the
demonstration that autophagy controls M. tuberculosis in vivo, out
data indicate that autophagy represents a barrier against tissue
destruction, the hallmark of active disease and the necessary
infection state for the propagation of tuberculosis in human
populations.
Results
Autophagy Protects Mice from Excessive Lung Pathology Following
Aerogenic Infection with M. Tuberculosis
[0194] The in vivo role of autophagy was investigated by selective
genetic deletion of Atg5 in myeloid cells, with macrophages being
of principal interest as the cells both successfully parasitized by
intracellular M. tuberculosis (Vergne et al., 2004) and targeted by
protective immune responses. We used the previously reported
conditional gene knockout mouse model Atg5fl/fl LysM-Cre+ with Atg5
deletion in myeloid lineage (Zhao et al., 2008). The Atg5+ mice
(Atg5fl/fl LysM-Cre-) and their Atg5fl/fl LysM-Cre+ littermates,
previously characterized for lack of Atg5 and autophagy in
macrophages (Dupont et al., 2011), were subjected to acrogenic
infection with virulent M. tuberculosis H37Rv. A major weight loss
was observed in the infected Atg5-deficient mice compared to
Atg5-proficient mice (FIG. 1A) when mice were infected with 103 M.
tuberculosis cfu (lung deposition infectious dose termed c3;
Supplementary Table 1). This was accompanied by lung pathology
remarkable for gross tubercle lesions in contrast to smaller
infected foci in the lungs of Atg5+ animals (FIG. 1B) Microscopic
examination of Atg5fl/fl LysM-Cre+ lung tissue revealed massive
lesions showing poor cellular organization and extensive necrotic
centers, with veterinary pathologist findings described in
Supplementary Materials (FIG. 1C). Acid fast bacilli, with
prominence of extracellular bacteria, were notable in Atg5fl/fl
LysM-Cre+ compared to Atg5fl/fl LysM-Cre- lung sections (FIG. 1C).
Unlike the infected Atg5fl/fl LysM-Cre+ lungs, the lungs from the
infected Atg5fl/fl LysM-Cre- mice had fewer intracellular bacilli
with little to no extracellular bacilli present in the lung
sections (FIG. 1C).
[0195] In keeping with the well-known general resistance of mice to
tuberculosis, neither group of mice succumbed to the infection in
short term (36 days) experiments (Supplementary Table 1). When a
higher infection dose (e4; lung disposition of 104 cfu
Supplementary Table 1) was employed, this resulted in animal
mortality with accelerated deaths (along with weight loss) among
Atg5fl/fl LysM-Cre+ mice relative to their Atg5fl/fl LysM-Cre-
littermates, starting 20 days post infection (FIG. 1D,E). With the
most commonly used low infectious dose (e2; lung disposition of 102
cfu), the Atg5fl/fl LysM-Cre+ mice displayed increased lung gross
pathology and organ size/weight of both lungs and spleens (Suppl.
FIG. 1A-C), poorer cellular organization and more necrosis (Suppl.
FIG. 1D), increased infiltration of innate immune cells into the
lungs (Suppl. FIG. 1E-G), and more acid fast bacilli in lung
sections (Suppl. FIG. 1H). The lungs of e2 infected animals showed
a ten-fold increase in cfu recovered from Atg5fl/fl LysM-Cre+ mice
relative to their Atg5fl/fl LysM-Crelittermates (Suppl. FIG.
1H).
[0196] These data collectively show that Atg5.sup.fl/fl LysM-Cre+
mice are more susceptible to M. tuberculosis infection and display
increased inflammation and lung pathology over a range of
infectious doses
Atg5 Deficiency Increases Basal Immune Activation State in the
Uninfected Lung
[0197] Given the large differences in lung gross and histopathology
and a relatively small detectable difference in bacterial loads
between infected Atg5fl/fl LysM-Cre+ and Atg5.sup.fl/fl LysM-Cre-
mice (Suppl. FIG. 1H), we considered the possibility that, apart
from the direct effects in eliminating mycobacteria from
macrophages as previously established in vitro (Alonso et al.,
2007; Gutierrez et al., 2004; Harris et al., 2007; Kim et al.,
2011; Xu et al., 2007; Yuk et al., 2009a), autophagy in myeloid
cells may be necessary for innate immune cellular homeostasis or
function to prevent an excessive response to infection. We tested
whether indications of such alterations may be detectable in
animals not infected with M. tuberculosis, since infection would
complicate interpretations. Similar numbers of cells expressing
macrophage markers, F4/80+ CD11b+ (Lineage-negative: CD3- CD19-),
were detected in the lungs and bone marrow of uninfected Atg5fl/fl
LysMCre+ and Cre- mice (FIG. 2A,B). However, lung macrophages
obtained from uninfected Atg5.sup.fl/fl LysM-Cre+ mice displayed an
activated phenotype (FIG. 2C), in keeping with their general in
situ morphology (Suppl. FIG. 2A, inset). Specifically,
Atg5.sup.fl/fl LysM-Cre+ cells had increased expression of MHC
class II, DEC205, and CD86. An increase in the numbers of CD11b+
F4/80- cells was observed in uninfected Atg5.sup.fl/fl LysM-Cre+
mice (FIG. 2A). Further examination revealed that these cells were
Ly6G+ (1a8 clone) polymorphonuclear granulocytes (PMN; neutrophils)
(FIG. 2D). This increase in PMN total number was only observed in
the lungs, as bone marrow PMN numbers were comparable for both
groups of mice (FIG. 2E). These data indicate that autophagy in
myeloid cells of peripheral organs such as lungs, where continual
immune surveillance is necessary, maintains a homeostatic balance
of immune cells and their activations states under normal
physiological conditions.
Atg5-Deficiency in Myeloid Lineage Results in Excessive
Inflammatory Cytokine Response to Infection
[0198] We examined cytokine profiles (using Luminex technology)
during the course of e.sup.2 infection in the lungs of
Atg5.sup.fl/fl LysM-Cre+ and Atg5fl/fl LysM-Cre- littermates.
Within the broad panel of cytokines and chemokines tested, the
e.sup.2-infected Atg5fl/fl LysM-Cre+ lungs displayed a significant
increase in the cytokines IL-1.alpha. and IL-12 and a chemokine,
CXCL1, at different time points of infection (FIG. 3A-C).
Additional increases were observed for IL-1.beta. (albeit the
absolute levels were low) and GM-CSF with no differences in IL-6
and the chemokine MIP-1.beta. (Suppl. FIG. 3A-D). We did not see a
major difference in IFN-.gamma. and TNF.alpha. the well established
anti-tuberculosis cytokines (Flynn and Chan, 2001), or IL-4, an
intracellular pathogen-permissive cytokine known to inhibit
autophagy ex vivo (Harris et al., 2007) (Suppl. FIG. 3E-G). A
difference in IL-17 levels was detected (Suppl. FIG. 3H). To test
whether cytokine increases in the lungs of infected Atg5.sup.fl/fl
LysM-Cre+ animals had cell-autonomous and infection-independent
roots based on defective autophagy in relevant cell types, we
compared bone marrow macrophages (BMM) from uninfected
Atg5.sup.fl/fl Lys-Cre+ mice and Atg5fl/fl LysM-Cre- littermate
controls. Uninfected BMM were stimulated with IFN-.gamma. and the
TNF-.alpha. mimetic LPS, with IFN-.gamma. and TNF-.alpha. being two
key cytokines driving the responses to M. tuberculosis infection.
Remarkably, Atg5.sup.fl/fl LysM-Cre+ BMM recapitulated the in vivo
pattern of elevated cytokine secretion and displayed increased
release of IL-1.alpha., IL-12p70 and CXCL1 relative to
Atg5.sup.fl/fl LysM-Cre- BMM (FIG. 3D-F). Differential IL-1.alpha.
release was not due to changes in cell death or membrane
permeability since in vitro activated BMM from Atg5.sup.fl/fl
LysM-Cre+ and Atg5.sup.fl/fl LysM-Cre- mice showed no difference in
staining with 7-AAD (Suppl. FIG. 3I). Furthermore, Atg5.sup.fl/fl
LysM-Cre+ and Atg5.sup.fl/fl LysM-Cre- showed differential release
of only a subset of cytokines, including IL-12p70 and CXCL1 that,
unlike IL-1.alpha., utilize the biosynthetic pathway and traffic
through the lumen of ER-Golgi-post-Golgi organelles for active
secretion from the cells. Intracellular IL-12p35 was also shown via
flow cytometry to be increased in stimulated BMM lacking Atg5
relative to Atg5-proficient BMM (Suppl. FIG. 3J,K). A subset of the
above in vitro findings showing elevated cytokine secretion were
corroborated in vivo using lung homogenates of uninfected Atg5fl/fl
LysM-Cre+ and Cre- mice (FIG. 3D-F). Atg5.sup.fl/fl LysM-Cre+ lung
samples had significantly increased amounts of IL-1.alpha. and
CXCL1compared to Atg5.sup.fl/fl LysM-Cre- lungs (FIG. 3G,H).
IL-12p70 was below the limit of detection in uninfected lung
homogenates and could not be assessed in this way. Conversely, the
chemokine, CXCL2, which was expressed at similar levels in the
presence or absence of an intact autophagy pathway in BMM examined
in vitro, was increased in Atg5fl/fl LysM-Cre+ lung homogenate
(Suppl. FIG. 3L,M). These results revealed additional complexities
in vivo, but nevertheless validated both in vivo and in vitro the
elevated IL-1.alpha. and CXCL1 phenotype in Atg5fl/fl LysM-Cre+
lungs and macrophages.
Autophagy is Essential for the Regulation of IL-1.alpha.
Secretion
[0199] We next focused on the cell-autonomous IL-1.alpha.
hypersecretion phenotype in Atg5.sup.fl/fl LysM-Cre+ macrophages.
IL-1.alpha. is a cytosolic protein, produced as a proform processed
during activation by proteases such as calpain or alternative
proteolytic enzymes (Afonina et al., 2011) and actively exported
out of the cell (Yazdi et al., 2010) or passively released upon
cell death (Chen et al., 2007). We first confirmed that autophagy
was a negative regulator of IL-1.alpha. release by
pharmacologically manipulating autophagy in autophagy-competent
macrophages. When autophagy was induced with rapamycin in Atg5fl/fl
LysM-Cre- BMM this reduced the amount of IL-1.alpha. being secreted
(FIG. 4A). Conversely, when Atg5fl/fl LsyM-Cre- BMM were treated
with 3-methyladenine, an inhibitor of autophagosome formation, the
levels of IL-1.alpha. were significantly increased (FIG. 4A)
mimicking a condition observed upon genetic disabling of autophagy.
A similar trend was observed when bafilomycin A1, an inhibitor of
autophagic flux was added during stimulation (FIG. 4B). The results
of pharmacological modulation of autophagy in normal BMM validated
the conclusions derived with Atg5.sup.fl/fl LysM-Cre+ BMM that
autophagy negatively regulates IL-1.alpha. activation and
secretion.
Cell-Autonomous IL-1.alpha. Hypersecretion Phenotype in
Autophagy-Deficient Macrophages is no Secondary to Autophagic
Effects on p62 or Calpain
[0200] To delineate the mechanism of how autophagy controls
IL-1.alpha. activation and secretion we considered several levels
and factors that could potentially mediate the effects of the
absence of autophagy. The autophagic adaptor protein p62, which is
consumed during autophagy (Jain et al., 2010) and is the founding
member of the SLR family of PRR functions in innate immunity
signaling (Deretic, 2011), accumulates in the absence of autophagy
pathway and has been shown to perturb NF-.kappa.B responses (Mathew
et al., 2009; Moscat and Diaz-Meco, 2009). As IL-1.alpha.
expression is induced by NF-.kappa.B (Xia et al., 1999), p62
accumulation could be the cause of elevated IL-1.alpha. expression.
However, knocking down p62 via siRNA in Atg5.sup.fl/fl LysM-Cre+
BMM (Suppl. FIG. 4A) did not abrogate the elevated IL-1.alpha.
secretion by these cells (Suppl. FIG. 4B). A converse experiment
was also carried out. Atg5 was knocked down in BMM from p62-/-
knockout mice and this still caused more (albeit less pronounced
likely due to residual Atg5 levels) IL-1.alpha. secretion than in
the scrambled siRNA control (Suppl. FIG. 4C). Finally, no increase
in IL1.alpha. mRNA levels were detected in Atg5.sup.fl/fl LysM-Cre+
BMM relative to Atg5fl/fl LysM-Cr- BMM (Suppl. FIG. 4D), thus
establishing that Atg5-deficient cells are neither
transcriptionally pre-activated for IL-1.alpha. expression nor that
p62 contributes to the IL-1.alpha. phenotype. Since calpain
activates IL-1.alpha., we used ALLN, a calpain inhibitor, to test
whether calpain was involved in the IL-1.alpha. hyper-secretion
phenotype of Atg5fl/fl LysM-Cre+ cells. ALLN treatment of Atg5fl/fl
LysM-Cre+ completely abrogated the excess IL-1.alpha. production
normalizing its secretion to the levels seen with Atg5fl/fl
LysM-Cre cells (FIG. 4C). Hence, we considered the possibility that
calpain was involved in mediating differences between Atg5fl/fl
LysM-Cre+ and Atg5fl/fl LysM-Cre+ cells, and that is could be a
substrate for autophagic removal. However, calpain and LC3 did not
colocalize in the cytoplasm, as indicated by a negative Pearson's
colocalization coefficient in bafilomycin A1-treated cells that
would have preserved calpain in autophagic organelles due to
inhibition of autophagic flux and degradation (Suppl. FIG. 5A,B).
Most importantly, the intracellular levels of calpain were similar
in Atg5fl/fl LysM-Cre+ and Atg5fl/fl LysM-Cre BMM (Suppl. FIG.
5C,D).
Factor X is Responsible for Hypersecretion of IL-1.alpha. in the
Absence of Autophagy
[0201] Next we studied whether IL-1.alpha. is a direct target for
removal in autophagic organelles. When autophagy-competent BMM
(Atg5.sup.fl/fl LysM-Cre-) were examined by fluorescent confocal
microscopy, cells fell into two categories--those that were
positive for IL-1.alpha. punctate staining and those that were
positive for LC3 puncta (FIG. 4D) with very few cells that were
positive for both IL-1.alpha. established by a .chi.2 test
(.chi.2<0.02; Suppl. FIG. 4E). This observation was initially
taken as an indication that IL-1.alpha. may be targeted by
autophagy for degradation, so we proceeded by examining whether
bafilomycin A1 treatment could spare IL-1.alpha.. Indeed,
bafilomycin A1 treatment increased the number of cells positive for
both IL-1.alpha. and LC3 (FIGS. 4E and F) with nonrandom
distribution (Suppl. Figure S4E; .chi.2<0.95). However, LC3 and
IL-1.alpha. did not colocalize (FIGS. 4E and 5A,B), suggesting that
it is not IL-1.alpha. that is a direct substrate for autophagic
elimination. This led us to postulate the existence of a putative
factor, dubbed factor X, regulating IL-1.alpha. in some way, e.g.
amounts or secretion, was a substrate for autophagy.
Factor X is Caspase 1
[0202] In considering the candidates for factor X, we were aided by
the recent reports that alarmins, including IL-1.alpha. that are
not conventional substrates for inflammasome can nevertheless be
affected by a platform similar to that which controls the
conventional caspase 1 substrate IL-1.beta. (Fettelschoss et al.,
2011; Keller et al., 2008; Yazdi et al., 2010). In contrast to the
negative Pearson's colocalization coefficient for IL-1.alpha. and
LC3, caspase 1 LC3 showed positive colocalization (FIG. 5A,B).
Next, BMM were tested for caspase 1 levels and activation.
Atg5fl/fl LysM-Cre+ BMM showed increased levels of activated
caspase 1 (p20) in comparison Atg5.sup.fl/fl LsyM-Cre- BMM, whereas
pro-caspase 1 levels did not differ (FIG. 5C and Suppl. FIG. 5E).
Bafilomycin A1 treatment resulted in abnormally higher levels of
caspase 1 p20 in Atg5fl/fl LysM-Cre- BMM mimicking the state of
Atg5.sup.fl/fl LysM-Cre+ cells (FIG. 5C and Suppl. FIG. 5E).
Furthermore, caspase 1 activity measured by FLICA assay
demonstrated increased enzymatically active Caspase 1 in Atg5fl/fl
LysM-Cre+ BMM compared to Atg5fl/fl LysM-Cre- BMM (suppl. FIG. 5F).
Finally, IL-1.alpha. secretion was further increased from
autophagy-defective BMM in response to silica, which is a
conventional inflammasome agonist (FIG. 5D). We conclude that
factor X is caspase 1 and that is it normally targeted by autophagy
for downregulation. Caspase 1is increased in amounts and activity
in autophagy-defective macrophages, and is a contributor to the
cell-autonomous phenotype of elevated IL-1.alpha. secretion
observed in our experiments with Atg5.sup.fl/fl LysM-Cre+
macrophages.
Functional Autophagic Machinery in Macrophages Dictates CD4 T Cell
Polarization and Regulates IL-17 Response
[0203] The activated macrophages, PMN infiltrates, cytokines and
chemokines present in the lung of uninfected Atg5fl/fl LysM-Cre+
mice suggested features of a Thl 7 response (Chung et al., 2009,
Korn et al., 2009). We considered this further. First, we
determined the proportion of CD8 and CD4 T cells displaying an
activated/memory phenotype. CD44 and CD25 expression was examined
on both CD8 and CD4 T cells. The proportion of T cells displaying
an activated/memory phenotype (CD4-high) was significantly
increased for both CD8 and CD4 populations in Atg5fl/fl LysM-Cre+
mice (FIG. 6A, Suppl. FIG. 6A). A portion of the CD4 high CD4 T
cells were also positive for CD25 suggesting that these cells were
recently activated (FIG. 6A). To determine if these T cells were
polarized to a certain subset of helper T cells we stimulated total
lung leukocytes with PMA/ionomycin (plus protein transport
inhibitors) and then assessed intracellular levels of IL-17A and
IFN-y expressed by CD4 T cells. CD4 T cells from Atg5fl/fl
LysM-Cre+ lungs but not those from Atg5fl/fl LysM-Cre- lungs
produced IL-17A (FIG. 6B,C). There was no marked difference between
the same cells from two sources in their ability to mount IFN-y
response (FIG. 6B,C). These findings indicate a propensity of CD4 T
cells from Atg5fl/fl LysM-Cre+ CD4 T cells to produce IL-17A upon
stimulation.
Defective Autophagy in Myeloid Lineage of Atg5fl/fl LysM-Cre+ Mice
Promotes IL-17 Response to Defined JV1Tuberculosis Antigens by T
Cells
[0204] The cells from the lungs of tuberculosis infected Atg5fl/fl
LysM-Cre+ and Cre mice revealed little difference in key Th 1 and
Th2 cytokines as described above. However, a trend was observed for
more IL-17 in infected Atg5fl/fl LysM-Cre+ mice (Figure S3E-H). We
followed up on this lead using a cocktail of 5 well defined Jv1
tuberculosis protein antigens (Dnak, GroEL, Rv009, RV0569, Rv0685),
collectively referred to as synthetic PPD (Yang et al., 2011) in
reference to the purified protein derivative (PPD) used clinically
as tuberculin skin test for evidence of recent tuberculosis
infection or BCG vaccination. This synthetic reagent contains the
dominant antigens present in the convention PPD, includes
additional key immunogenic proteins. Synthetic PPD reproduces the
anatomical and molecular properties of the tuberculin skin test and
eliminates false positive inflammatory reactions (seen in
uninfected hosts) caused by the contaminating lipoglycans and
carbohydrates resident in conventional PPD, thus enabling
monitoring of specific responses to infection with the Jv1
tuberculosis complex organisms in a model system (Yang et al.,
2011). Atg5fl/fl LysM-Cre+ and Cre- mice were infected with live M.
bovis BCG and then evaluated for their ability to mount a delayed
type hypersensitivity response (0TH) to synthetic PPD (Yang et al.,
2011). Three weeks postinfection, mice were injected with the
synthetic PPD or PBS in the hind footpad and swelling was measured
at 0, 2, 24 and 48 h postinoculation (FIG. 6C). No measurable
difference was observed at 24 and 48 h time point between the
autophagy competent and mutant mice. However, when splenocytes were
re-stimulated ex vivo with the synthetic PPD, IL-17A was detected
at a significantly higher levels with Atg5fl/fl LysM-Cre+
splenocyte supernatant whereas no differences were observed for
typical Th 1 and Th2 cytokine signatures (FIG. 6D,E; Suppl. Figure
S6B,C) indicating polarization to IL-17 producing phenotype in
Atg5fl/fl LysM-Cre+ lungs or with Atg5fl/fl LysM-Cre+ BMM could act
similarly to IL-1p in promoting Th 17 polarization (Chung et al.,
2009). Naive CD4 T cells were treated in the presence of TGF-P,
IL-6 and IL-1.alpha. or IL-1 B and then stimulated in the presence
of protein transport inhibitors. The intracellular levels of IL-17A
were elevated whether IL-1a or IL-1P were used to promote Th 17
differentiation (FIG. 6F).
[0205] These data sets indicate that a dysregulation in the
autophagic pathway in macrophages can result in an in situ
generation of IL-17-producing T cells via the excess production of
IL-1a.
Discussion
[0206] This work demonstrates the in vivo role for autophagy in
protection against tuberculosis. Along with the previous in vitro
studies (Alonso et al., 2007; Gutierrez et al., 2004; Harris et
al., 2007; Hartman and Kornfeld, 2011; Kim et al., 2011; Xu et al.,
2007; Yuk et al., 2009a) this established that autophagy is an
antimycobacterial effector mechanism. Autophagy also protects
against excessive tissue necrosis and lung pathology, the hallmarks
of active tuberculosis. This effect is not a trivial consequence of
increased bacillary loads but reflects a cell-autonomous action of
autophagy as shown in vitro with macrophages from uninfected
animals. In addition to the expected immune activation commensurate
with bacterial loads, autophagy-defective macrophages have an
intrinsic propensity to release excessive amounts of inflammatory
mediators IL-1a and CXCL1, shown in vitro and mirrored in vivo in
uninfected lungs. A model emerges whereby these mediators pivot
inflammation with features of Th 17 response, neutrophilic
infiltration, tissue necrosis and organ damage, the main features
of active tuberculosis and contagious state of the host.
[0207] The mechanisms of cell-autonomous elimination of M.
tuberculosis by autophagy have been extensively studied in vitro
and include direct microbial digestion in autophagolysosomes
(Gutierrez et al., 2004), delivery of neoantimicrobial peptides
generated in autolysosomes to compartments harboring intracellular
mycobacteria (Alonso et al., 2007; Kim et al., 2011; Ponpuak et
al., 2010) and an interplay of autophagy with conventional
antimicrobial peptides (Yuk et al., 2009b). Our previous work
(Ponpuak et al., 2010) has highlighted the role of the SLR p62 in
these processes, along with the examples of other SLRs engaging an
array of intracellular bacteria (Deretic, 2011; Dupont et al.,
2009; Thurston et al., 2009; Wild et al., 2011; Yoshikawa et al.,
2009) and viruses (Orvedahl et al., 2010). The work presented in
the accompanying study by J. Cox and colleagues extends this
further and places the role of SLRs in the context of the ESX
dependent interactions between M. tuberculosis and the host cell
cytosol. In contrast to a preponderance of studies in vitro,
autophagic control of microbes remains to be fully understood in
vivo (Orvedahl et al., 2010; Zhao et al., 2008). Altered intestinal
tissue and Paneth cell function has been noted in response to
microbial flora and viral co-infection in an Atg16L1 hypomorph
mouse model of Crohn's disease, a chronic inflammatory condition
[Cadwell, 2010 #13743]. In the animal model of protection against
lethal Sindbis virus infection, the dominant contribution of
autophagy was in preventing tissue damage independently of viral
loads (Orvedahl et al., 2010). This dovetails with the aspect of
our study that shows autophagic protection against excessive
inflammation and necrosis in the murine model of tuberculosis.
[0208] The finding that a loss of autophagy in macrophages results
in increased release of IL-1.alpha. and CXCL 1 and fosters an
environment where T cells produce IL-17 A production links for the
first time autophagy with elements of the Th17 response. The
increased presence of neutrophils in the lungs of Atg.sup.5fl/fl
LysM-Cre+ mice infected with M. tuberculosis was consistent with
lung tissue damage and progressive disease. The role of neutrophils
in tuberculosis has been both highlighted in recent patient cohort
studies (Berry et al., 2010) and may be associated with the
paradoxical Koch effect (Koch, 1891), whereby administration of M.
tuberculosis antigens to pre-infected subjects increases
granulocyte influx, and necrosis in the preexisting stabilized
lesions in the lung (Moreira et al., 2002; Taylor et al., 2003;
Turner et al., 2000). Neutrophils contribute to tuberculosis
pathogenesis (Eruslanov et al. 2005), support lymphatic
mycobacterial dissemination (Abadie et al., 2005), and promote
person-to-person transmission via cavitary disease or other routes
of bacillary delivery into patients' sputa (Eum et al., 2010),
outweighing potential antibacterial actions or neutrophils. Our
data indicate that autophagy, when functional, curbs neutrophilic
response.
[0209] A specific dysregulated cytokine response in Atg.sup.5fl/fl
LysM-Cre+ mice for which a cell-autonomous molecular mechanism has
been determined in this work is the excessive release of
IL-1.alpha.. IL-1 signaling has been implicated in defense against
M. tuberculosis but presents a host of non-trivial relationships.
IL-1p and its receptor IL-IR1 have been associated with the
powerful antimycobacterial role of MyD88 (Fremond et al., 2007;
Mayer-Barber et al., 2010), an adaptor downstream of IL-IR1 and
other pattern recognition receptors. Mycobacterial products can
induce inflammasome, caspase 1, and IL-1p production (Mishra et
al., 2010) and virulent M. tuberculosis actively suppresses
inflammasome activation and IL-1P production in vivo (Master et
al., 2008). The effector mechanisms downstream of IL-1 signaling
include autophagy as a mycobactericidal mechanism activated by
IL-1P via MyD88 (Pilli et al., submitted). Nevertheless, not all
aspects of IL-1 signaling are protective. IL-1P suppresses IFN-y
production and Th 1 polarization by inducing COX-1 and promotes Thl
7 responses causing neutrophil-dominated inflammation (van de
Veerdonk et al., 2011). Whereas beneficial in control of
extracellular bacteria, these features may not be desirable against
M. tuberculosis as discussed above and instead may contribute to
immunopathology. This is in keeping with the findings that excess
IL-17A and potentially other Thl 7 cytokines and neutrophil
chemokines can deleteriously enhance lung pathology during M.
tuberculosis infection (Cruz et al., 2010). As observed in present
study, IL-1a can affect aspects of Thl 7 polarization as
effectively as IL-1p. It has been reported that the abundant
presence of IL-1.alpha. in IL-1P-deficient mice (Mayer-Barber et
al., 2010) cannot compensate for the lack of IL-1P, arguing that
IL-1a may not have the anti-mycobacterial potency or
bioavailability as IL-1P, which suggest that IL-1a may be primarily
pathogenic. Nevertheless, the results of two recent studies (Guler
et al., 2011; Mayer-Barber et al., 2011) indicate that IL-1a is
required to control tuberculosis at a yet to be defined stage
during immune response or tissue remodeling. Thus, any therapeutic
strategies aiming at neutralizing IL-1a specifically to curb tissue
destruction and neutrophilic contribution to contagious state in
active disease will have to await further studies.
[0210] IL-1a is produced as a cytosolic proc. form that can be
processed by calpain or other proteases (Afonina et al., 2011) and
actively exported out of the cell as shown here and elsewhere
(Yazdi et al., 2010) or be passively released upon cell death (Chen
et al., 2007). The IL-1a secretion, normally suppressed by basal
autophagy as detected here was an active process of unconventional
secretion from macrophages, in keeping with macrophages being one
of the major sources of secreted IL-1a in certain forms of
inflammation (Kono et al., 2010). The cellular mechanism of
excessive IL-1a release was linked to increased intracellular
active caspase-1 in Atg.sup.5fl/fl LysM-Cre+ macrophages. Although
surprising, this is in keeping with the growing evidence
(Fettelschoss et al., 2011; Keller et al., 2008; Lamkanfi, 2011;
Lamkanfi et al., 2010; Willingham et al., 2009; Yazdi et al., 2010)
that various inflammasome components contribute to extracellular
release of substrates other than the canonical caspase-1-processed
targets such as IL-1p (Dinarello, 2009). Like IL-1P, the alarmins
HGMB1 (Keller et al., 2008; Lamkanfi, 2011; Lamkanfi et al., 2010;
Willingham et al., 2009) and IL-1a (Fettelschoss et al., 2011;
Keller et al., 2008; Yazdi et al., 2010) are subject to
unconventional secretion and are affected by inflammasome
components although they are not proteolytically processed by
caspase-1 (Johansen et al., 2011; Keller et al., 2008; Lamkanfi,
2011; Lamkanfi et al., 2010; Willingham et al., 2009; Yazdi et al.,
2010). The mechanism for hypersecretion of IL-12 and CXCL1 by
Atg5fl/fl LysM-Cre+ macrophages was not determined. We favor the
possibility that these cytokines, which utilize the conventional
secretory pathway, are influenced by the recently described
specific intersections between the organelles of the biosynthetic
secretory pathway and autophagy as shown in the case of IL-6
(Narita et al., 2011).
[0211] Tuberculosis has been and remains one of the main global
public health hazards further augmented by the HIV co-pandemic
(Nunn et al., 2005). The classical presentation of disease is often
masked by the untreated HIV co-infection (Nunn et al., 2005), but
in principle the majority of humans have a well developed capacity
to contain the infection so that the majority of the world's
population infected with the tubercle bacillus is asymptomatic and
only approximately 10% of individuals develop active disease. This
tip of the iceberg is nevertheless key to continuing the
tuberculosis contagion in human populations, since active disease
is necessary for the transmission of tuberculosis. We propose that
autophagy plays a dual role; it both protects against the microbe
and guards against host-inflicted tissue destruction and active
disease. In this model autophagy curbs tuberculosis transmission by
helping maintain the majority of the infected population
asymptomatic. Strategies aimed at pharmacological manipulation of
autophagy may diminish tuberculosis spread, which may prove vital
in containing the spread of the increasingly drug-resistant
tuberculosis strains.
Experimental Procedures
Mice, Infection, Cells Flow Cytometry and Immunodetection
Methods
[0212] The transgene Atg.sup.5fl/fl LysM-Cre+ (myeloid specific
Atg5 deletion) and Atg.sup.5fl/fl LysM-Cre- mice have been
previously characterized [Zhao, 2008 #6094] and the autophagy
defect in BMM extensively documented [Dupont, 2011 #14374]. LC3-GFP
knock-in transgenic mice [Mizushima, 2004 #17] and p62-/- knockout
mice [Komatsu, 2007 #5273] have been previously described. Mice
were maintained under specific pathogen-free conditions. F1 progeny
from Atg.sup.5fl/fl LysM-Cre.times.Atg.sup.5fl/fl crosses were
genotyped for presence (LysM-Cre+) or absence (LysMCre) of the
LysM-Cre allele by Transnetyx, Inc. (Cordova, Tenn.). Infection
studies were carried out using murine respiratory infection model
[Flynn, 2008 #5138] and virulent M. tuberculosis H37Rv with
modifications [Talaat, 2004 #14428] [Zahrt, 2001 #1633] described
in supplementary materials. All cells were pretreated with Stain
FcX (anti-CD 1632) (Biolegend) before being stained for CD14
(Sal4-2), F4/80 (BM8), IFN-y (XMG 1.2), IL-17A (TC11-18H10.1),
CD11b (MI/70), DEC205 (NLDL-145), CDS (53-6.7), CD86 (GL-1), Ly6G
(1 A8), CD25 (PC61), MHC II (M5/114.15.2) (Biolegend). CD19
(eBiolD3), TCR (H57-597), CD3e (145-2CII), CD44 (IM7), CD4 (GK1.5),
CD1d (1B1), DEC205 (205yckta), CD4 (RM4-5), CD45 (30-F11), CD3
(17A2), F4/80 (BM8), CD11b (MI/70), B220 (RA3-6B2), CD8a (53-6.7),
IL-12p35 (4D10p35), IL-1a (ALF-161), MCH II (M5/1 14.15.2), CD25
(PC61.5) (eBioscience), Ly6G (1a8) (BD Biosciences). Caspase 1
activity was measured by flow cytometry using the FLICA caspase 1
reagent (FAM-YVAD-FMK) (Immunochemistry Technologies). Cells were
incubated with 7-AAD for viability assessment. Secreted cytokines
(IL-1a, CXCL1, CXCL2 and IL-12p70) were measured by ELISA (R&D
Systems). For cytokine secretion, murine BMM, prepared as described
[Ponpuak, 2010 #13020], were stimulated with 5 ng/ml mIFN-y and 100
.mu.g/ml LPS, with autophagy agonist and antagonists rapamycin
(Invivogen), 3-MA, bafilomycin A1, and ALLN (Sigma) added 30
minutes prior to LPS and IFN-y stimulation. For autophagy-dependent
unconventional secretion of cytosolic cytokines as described
[Dupont, 2011 #14374], BMM were stimulated for 1 h with 250
.mu.g/ml silica (MIN-U-SIL-15, US Silica) with starvation (EBSS) to
induce autophagy.
Microscopy and Image Analysis
[0213] For confocal microscopy, BMM were stained with mouse
anti-GFP (Abcam, 10 .mu.g/ml) to enhance LC3-GFP visualization,
rabbit anti-caspase 1 (Santa Cruz Biotechnology), rabbit
anti-calpain 1 (Cell Signaling Technology), or hamster anti-IL-1a
(eBioscience) followed by secondary antibodies. Pearson's
colocalization coefficients were derived using SLIDEBOOK 5.0
(Intelligent Imaging Innovations) applying the SLIDEBOOK 5 default
algorithm command `AND`. All Pearson's coefficients were derived
from three independent experiments with five fields or more per
experiment. For a total of 15 fields contributing to the cumulative
result.
Delayed-Type Hypersensitivity and Cell-Mediated Immunity
[0214] Mice were infected intranasally with 5.times.106 BCG for 21
days, and then injected with the synthetic PPD (a five antigens
cocktail: Dnak, GroEL, Rv009, RV0569, and RV0685) at 1.0 .mu.g/ml
in PBS, or PBS control, 50 .mu.l in separate footpads. DTH was
assessed as described [Yang, 2011 #14416] by comparing swelling to
a baseline value immediately after injection. Splenocytes
(5.0.times.105 cells/well) were restimulated with the synthetic PPD
adjusted for 2.0 .mu.g/ml (Dnak and GroEL), and 4.0 .mu.g/ml
(Rv009, RV0569 and Rv0685) and culture supernatants assayed for
IFN-y, TNF-a, IL-4 and IL-17 secretion by ELISA (R&D
Systems).
T Cell Assays
[0215] Single cell suspensions from whole lungs isolated from
na{hacek over (i)}ve Atg5fl/fl LysM-Cre+ and Cre- mice were
cultured in RPMI 10% FBS and Cell Stimulation Cocktail (phorbol
12-myristate 13-acetate and ionomycin plus brefeldin A and
monensin; eBioscience) for 4 h and analyzed by flow cytometry. For
in vitro polarization, naive CD4+ T cell from spleens were sorted
CD44 low CD4+ TCRP+ cells in a MoFlo high speed cell sorter
BeckmanCoulter), sorted cells (5.times.105 cells/well), incubated
with plate-bound anti-CD3 antibody (Hu et al., 2011) and stimulated
with 20 ng/ml IL-6, 5 ng/ml TGF-p, 20 ng/ml| IL-1a or 20 ng/ml
IL-1P (R&D Systems) in the presence of anti-CD28 (37.5|),
anti-IFN-P (R4.6A2), anti-IL-4 (11B1 1), anti-IL-2 (JE56-1A12)
(eBioscience). After 4 days, cells were stimulated with 1.times.
Cell Stimulation cocktail in the presence of protein transport
inhibitors for 5 hours at 37.degree. C. and analyzed by flow
cytometry.
Other Experimental Procedures
[0216] Additional methods are described in Supplementary
Materials.
Supplementary Results
Histopathology Findings in Atg5fl/fl LysM-Cre+ Mice Infected with
M. Tuberculosis H37Rv
[0217] At necropsy the veterinary pathologist's findings were as
follows: the Atg5-deficient mice exhibited extensive, discreet
multinodular to coalescing foci of lung inflammation (granulomas),
whereas the Atg5fl/fl LysM-Cre- mice exhibited more subtle lung
lesions characterized by mild, patchy foci of white discoloration
without nodule formation (FIG. 1B). Microscopic examination
revealed that the lungs from the Atg.sup.5fl/fl LysMCre+ mice
exhibited marked pulmonary inflammation resembling the cascading
granulomas found in cases of human TB, characterized by modular,
often coalescing foci consisting of peripheral infiltrates of
lymphocytes, macrophages, plasma cells and occasional neutrophils,
surrounding central foci of necrotic debri containing dead and
dying neutrophils (FIG. 1C; Figure S1D). Acid-fast staining of the
lungs from these mice revealed abundant intracellular and
extracellular bacilli. In contrast lungs from the infected
Atg.sup.5fl/fl LysM-Cre- mice exhibited only irregular, mild to
moderate,
[0218] bronchoalveolar and interstitial infiltrates of lymphocytes,
macrophages and plasma cells without organization into discreet
modules. Acid-fast staining of lungs from these mice revealed very
sparse intracellular bacilli, and no apparent extracellular bacilli
(FIG. 1C; Figure S1H).
Supplementary Experimental Procedures
M. tuberculosis Infection of Atg.sup.5fl/fl LysM-Cre Mice
[0219] M. tuberculosis, strain H37Rv, inoculum was prepared by
diluting a frozen stock of known titer in sterile PBS/0.05% Tween
80. Mice were anesthetized with isoflurane (Abbott Laboratories,
Chicago, Ill.) and 50 .mu.l of fluid containing M. tuberculosis
were placed on the nostrils of mice, after which mice were allowed
to inhale the inoculum under direct observation. The mice awoke
approximately 1 minute after sedation. The mice were kept warm with
a heat lamp and allowed to recover under direct observation. One
hour after inoculation, 3 randomly selected mice from the infected
cohort were harvested to determine lung depositions. Bacterial
burden was determined using homogenized organs. Samples were
serially diluted and duplicated, and 50 .mu.l aliquots of each
dilution were spread on Selective Mitchinson 7H1 1 agar plates
(Remel) and placed into humidified incubator at 37.degree. C. for
12 days. Mice were weighted twice prior to infection on days -3 and
-1 for baseline. Upon infection, mice were monitored daily for
survival and weighted semi-weekly. At the indicated times, mice
were sacrificed by CO2 overdose, and lungs were harvested and
homogenized in 1 ml of PBS/0.05% Tween 80. For histopathological
examination, lungs were insufflated with 10% neutral buffered
formalin via tracheal cannulation and removed en bloc. At the same
time, spleens were harvested and all organs were placed into 10%
buffered formalin for further processing in a histological studies.
Paraffin embedded sections were stained with hematoxylin and cosin
(H&E stain) or acid fast stain and evaluated by a board
certified veterinary pathologist. Samples were subjected to a
freeze/thaw cycle, sonicated for 30 sec. allowed to sit on ice for
30 min, centrifuged at 12,000 rpm for 10 min, supernatants
collected and filtered through a 45 .mu.m syringe filter and
assayed for cytokines using Luminex Multiplex System (Luminex Corp.
Austin Tex.). Beads for cytokine quantification were from
Invitrogen and used according to the manufacturer's
instruction.
Cells and Tissue Preparation
[0220] Lungs were perfused with sterile saline in order to remove
peripheral blood cells. Lungs were than minced and enzymatically
(DNAse/collagenase solution) treated at 370.degree. C. for 60 min.
The digested lung tissue was than mechanically disrupted using a
pestle and wire screen. Cells were then filtered over a nylon wool
column to remove particulate and remaining red blood cells were
lysed and cells were then centrifuged through a layer of 30%
percoll to remove debris and dead cells. Spleens were homogenized
in HBSS containing HEPES, L-glutamine and pen-strep (HGPG) using
frosted slides. For lung homogenate, lungs were minced,
homogenized, homogenate resuspended in a total volume of 1 ml PBS,
pressed through a 70-mm cell strainer, centrifuged and clarified
supernatant collected for analysis.
Antibodies, Immunoblotting, Detection Assays, siRNA Knockdowns
Airflow Cytometry
[0221] Cells were washed with PBS and lysed with RIPA buffer
containing proteases inhibitor (Roche). Cells extracts were
analyzed by standard immunoblotting techniques with antibodies to
ASC (Enzo Life Science, A1 177), procaspase-1 and active caspase-1
(P20) Cell Signaling, 2225), GFP (Abcam), calpain 1 (Cell
Signaling), p62 (Abcam) and actin (Sigma). Proteins were resolved
on a 12% SDS-polyacylamide gels and transferred to nitrocellulose
membranes. The membrane was blocked for 1 h in 5% nonfat dried milk
in PBS/Tween 20 (0.1) and probed with primary antibody overnight at
4.degree. C. After washing with PBS/Tween, the blot was probed with
appropriate anti-mouse HRP-conjugated secondary antibody for 1 h at
room temperature and stained with SuperSignal West Dura
chemiluminescent substrate (Thermo Fisher Scientific). Actin was
used as standardization control. For siRNA knockdowns, BMM were
transfected by nucleoporation using Nucleofector Reagent Kit Mouse
Macrophage (Amaxa/Lonza Biosystems). For murine p62 or Atg5
knockdowns, cells were transfected with siGENOME SMARTpool reagents
(Dharmacon). p62-(GCATTGAAGTGGATATTGA; GACGATGACTGGACCCATT;
TCGGAGGATCCCAGTGTGA; CAGCAAGCCGGGTGGGAAT),
Atg5-(CCAAUUGGUUUACUAUUG; CGAAUUCCAACUUGCUUUA; UUAGUGAGAUAUGGUUUGA;
GCAUAAAGUCAAGUGAUC). Non-targeting siRNA pool (Scramble) was used
as a control--(UAGCGACUAAACACAUCAA; UAAGGCUAUGAAGAGAUAC;
AUGUAUUGGCCUGUAUUAG; AUGAACGUGAAUUGCUCAA). At 48 h post
transfection, cells were stimulated overnight with LPS and
IFN-.gamma. (1 .mu.g/ml and 5 ng/ml, respectively) and the
supernatants were collected for further analysis. Cells were
collected and analyzed for targeted protein expression by
immunoblotting as described above. Flow cytometry was carried out
on a LSRFortessa or RACSCalibur (BD Biosciences) and data analyzed
using FlowJo software (TreeStar).
Quantitative RT PCR
[0222] Total RNA was isolated from BMM using RNeasy kit (Qiagen)
and cDNA was generated using QuantiTect Reverse Transcription kit
(Qiagen). RT-PCR was performed using SYBR Green 1 QuantiFast SYBR
Green Kit (Qiagen) using the following amplification conditions:
PCR initial activation step: 950 C-5 min; Two-step cycling:
Denaturation: 950 C-10 sec; Combined annealing/extension: 600 C-10
sec; Number of cycles 40. The primers for IL-1a: (F) 5'-GCA ACG GGA
AGA TTC TGA AG-3'; (R) 5'-TGA CAA ACT TCT GCC TGA CG-3'. The
results were analyzed using relative quantification by comparing
the ratios of the target gene and the reference housekeeping gene,
actin.
References for Example 1
[0223] Abadie, V., Badell, E., Douillard, P., Ensergueix, D.,
Leenen, P. J., Tanguy, M., Piette, L., Sacland, S., Gicquel, B.,
and Winter, N. (2005). Neutrophilis rapidly migrate via lymphatics
after Mycobacterium bovis BCG intradermal vaccination and shuttle
live bacilli to the draining lymph nodes. Blood 106, 1843-1850.
[0224] Afonina, L. S., Tynan, G. A., Logue, S. E., Cullen, S. P.,
Bots, M., Luthi, A. U., Reeves, E. P., McElvaney, N. G., Mederma,
J. P., Lavelle, E. C., et al. (2011). Granyzme B-dependent
proteolysis acts as a switch to enhance the proinflammatory
activity of IL-1 alpha. Molecular cell 44, 265-278. [0225] Alonso,
S., Pethe, K., Russell, D. G., and Purdy, G. E. (2007) Lysosomal
killing of Mycobacterium mediated by ubiquitin-derived peptides is
enhanced by autophagy. Proc Natl Acad Sci USA 104, 6031-6036.
[0226] Axe, E. L., Walker, S. A., Manifava, M., Chandra, P.,
Roderick, H. L., Habermann, A., Griffiths, G., and Ktistakis, N. T.
(2008). Autophagosome formation from membrane compartments enriched
in phosphatidylinositol 3-phosphate and dynamically connected to
the endoplasmic reticulum. J Cell Biol 182, 685-701. [0227] Berry,
M. P., Graham, C. M., NcNab, F. W., Xu, Z., Bloch, S. A., Oni, T.,
Wilkinson, K. A., Banchereau, R., Skinner, J., Wilkinson, R. J., et
al. (2010). An interferon inducible neutrophil-driven blood
transcriptional signature in human tuberculosis. Nature 466,
973-977. [0228] Blanchet, F. P., Moris, A., Nikolic, D. S.,
Lehmann, M., Cardinaud, S., Stalder, R., Garcia, E., Dinkins, C.,
Leuba, F., Wu, L., et al. (2010). Human immunodeficiency virus-1
inhibition of immunoamphisomes in dendritic cells impairs early
innate and adaptive immune responses. Immunity 32, 654-669. [0229]
Chen, C. J., Kono, H., Golenbock, D., Reed, G., Akira, S., and
Rock, K. L., (2007). Identification of a key pathway required for
the sterile inflammatory response triggered by dying cells. Nat Med
13, 851-856. [0230] Chung, Y., Chang, S. H., Martinez, G. J., Yang,
X. O., Nurieva, R., Kang, H. S., Ma, L., Watowich, S. S., Jetten,
A. M., Tian, Q., et al. (2009). Critical regulation of early Th 17
cell differentiation by interleukin-1 signaling. Immunity 30,
576-587. [0231] Craddock, N., Hurles, M. E., Cardin, N., Pearson,
R. D., Plagnol, V., Robson, S., Vukcevic, D., Barnes, C., Conrad,
D. F., Giannoulatou, E., et al. (2010). Genome wide association
study of CNVs in 16,000 cases of eight common diseases and 3,000
shared controls. Nature 464, 713-720. [0232] Criollo, A.,
Niso-Santano, M., Malik, S. A., Michaud, M., Morselli, E., Marino,
G., Lachkar, S., Arkhipenko, A. V., Harper, F., Pierron, G., et al.
(2011). Inhibition of autophagy by TAB2 and TAB3. Embo J 30,
4908-4920. [0233] Criollo, A., Senovilla, L., Authier, H., Maiuri,
M. C., Morselli, E., Vitale, I., Kepp, O., Tasdemir, E., Galluzzi,
L., Shen, S., et al. (2010). The IKK complex contributes to the
induction of autophagy. Embo J 29, 619-631. [0234] Cruz, A., Fraga,
A. G., Fountain, J. J., Rangel-Moreno, J., Torrado, E., Saraiva,
M., Pereira, D. R., Randall, T. D., Pedrosa, J., Cooper, A. M., et
al. (2010). Pathological role of interleukin 17 in mice subjected
to repeated BCG vaccination after infection with Mycobacterium
tuberculosis, J Exp Med 207, 1609-1616. [0235] Delgado, M. A.,
Elmaoued, R. A., Davis, A. S., Kyei, G., and Deretic, V. (2008).
Toll-like receptors control autophagy. Embo J. 27, 1110-1121.
[0236] Deretic, V. (2005). Autophagy in innate and adaptive
immunity. Trends Immunol 26, 523-528. [0237] Deretic, V. (2011).
Autophagy as an innate immunity paradigm: expanding the scope and
repertoire of pattern recognition receptors. Curr Opin Immunol.
[0238] Deretic, V., and Levine, B. (2009). Autophagy, immunity, and
microbial adaptations. Cell Host Microbe 5, 527-549. [0239]
Dinarello, C. A. (2009). Immunological and inflammatory functions
of the interleukin-1 family. Annu Rev Immunol 27, 519-550. [0240]
Dupont, N., Jiang, S., Pilli, M., Omatowski, W., Bhattacharya, D.,
and Deretic, V. (2011). Autophagy-based unconventional secretory
pathway for extracellular delivery of IL-1 beta. Embo J 30,
4701-4711. [0241] Dupont, N., Lacas-Gervais, S., Bertout, J., Paz,
I., Freche, B., Van Nhieu, G. T., van der Goot, F. G., Sansonetti,
P. J., and Lafont, F. (2009). Shigella phagocytic vacuolar membrane
remnants participate in the cellular response to pathogen invasion
and are regulated by autophagy. Cell Host Microbe 6, 137-149.
[0242] Duran, J. M., Anjard, C., Stefan, C., Loomis, W. F., and
Malhotra, V. (2010). Unconventional secretion of Acb1 is mediated
by autophagosomes J Cell Biol 188, 527-536. [0243] Egan, D. F.,
Shackelford, D. B., Miharylova, M. M., Gelino, S., Kohnz, R. A.,
Mair, W., Vasquez, D. S., Joshi, A., Gwina, D. M., Taylor, R., et
al. (2011). Phosphorylation of ULK 1 (hATG1) by AMP-activated
protein kinase connects energy sensing to mitophagy. Science 331,
456-461. [0244] Eruslanov, E. B., Lyadova, I. V., Kondratieva, T.
K., Majorov, K. B., Scheglov, I. V., Orlova, M. O., and Apt, A. S.
(2005). Neutrophil responses to Mycobacterium tuberculosis
infection in genetically susceptible and resistant mice. Infect
Immun 73, 1744-1753. [0245] Eum, S. Y., Kong, J. H., Hong, M. S.,
Lee, Y. J., Kim, J. H., Hwang, S. H., Cho, S. N., Via, L. E., and
Barry, C. E., 3rd (2010). Neutrophils are the predominant infected
phagocytic cells in the airways of patients with active pulmonary
TB. Chest. 137, 122-128. [0246] Fettelschoss, A., Kistowska, M.,
LeibundGut-Landmann, S., Beer, H. D., Johansen, P., Senti, G.,
Contassot, E., Bachmann, M. F., French, L. E., Oxenius, A., et al.
(2011). Inflammasome activation and IL-1 beta target IL-1 alpha for
secretion as opposed to surface expression. Proc Natl Acad Sci USA
108, 18055-18060. [0247] Flynn, J. L., and Chan, J. (2001).
Immunology of tuberculosis. Annu Rev Immunol 19, 93-129. [0248]
Fremond, C. M., Togbe, D., Doz, E., Rose, S., Vasseur, V., Maillet,
I., Jacobs, M., Ryffel, B., and Quesniaux, V. F. (2007). IL-1
receptor-mediated signal is an essential component of
MyD88-dependent innate response to Mycobacterium tuberculosis
infection. J. Immunol. 179, 1178-1189. [0249] Fujita, N.,
Hayashi-Nishino, M., Fukumotomo, H., Omori, H., Yamamoto, A., Noda,
T., and Yoshimori, T. (2008). An Atg4B mutant hampers the
lipidation of LC3 paralogues and causes defects in autophagosome
closure. Mol Biol Cell 19, 4651-4659. [0250] Guler, R., Parihar, S.
P., Spohn, G., Johansen, P., Brombacher, F., and Bachmann, M. F.
(2011). Blocking IL-1 alpha but not IL-1 beta increases
susceptibility to chronic Mycobacterium tuberculosis infection in
mice. Vaccine 29, 1339-1346. [0251] Gutierrez, M. G., Master, S.
S., Singh, S. B., Taylor, G. A., Colombo, M. I., and Deretic, V.
(2004). Autophagy is a defense mechanism inhibiting BCG and
Mycobacterium tuberculosis survival in infected macrophages. Cell
119, 753-766. [0252] Harris, J., De Haro, S. A., Master, S. S.,
Keane, J., Roberts, E. A., Delgado, M. and Deretic, V. (2007). T
helper 2 cytokines inhibit autophagic control of intracellular
Mycobacterium tuberculosis. Immunity 27, 505-517. [0253] Hartman,
M. L., and Kornfeld, H. (2011). Interactions between Naive and
Infected Macrophages Reduce Mycobacterium tuberculosis Viability.
PLoS One 6, e27972. [0254] He, C., and Levine, B. (2010). The
Beclin 1 interactome. Curr Opin Cell Biol 22, 140-149. [0255]
Intemann, C. D., Thye, T., Niemann, S., Browne, E. N., Amamua
Chinbuah, M., Enimil, A., Gyapong, J., Osei, I., Owusu-Dabo, E.,
Helm, S., et al. (2009) Autophagy gene variant IRGM-261T
contributes to protection from tuberculosis caused by Mycobacterium
tuberculosis but not by M. africanum strains. PLoS Pathog 5,
e1000577. [0256] Itakura, E., and Mizushima, N. (2011). p62
Targeting to the autophagosome formation site requires
self-oligomerization but not LC3 binding. The Journal of cell
biology 192, 17-27. [0257] Jain, A., Lamark, T., Sjottem, E.,
Larsen, K. B., Awuh, J. A., Overvatn, A., McMahon, M., Hayes, J.
D., and Johansen, T. (2010). p62/SQSTM1 is a target gene for
transcription factor NRF2 and creates a positive feedback loop by
inducing antioxidant response element-driven gene transcription. J
Biol Chem 285, 22576-22591. [0258] Jia, W., Pua, H. H., Li, Q. J.,
and He, Y. W. (2011). Autophagy regulates endoplasmic reticulum
homeostasis and calcium mobilization is T lymphocytes. J Immunol.
186, 1564-1574. [0259] Johansen, P., Fettelschoss, A., Amstutz, B.,
Selchow, P., Waeckerle-Men, Y., Keller, P., Deretic, V., Held, L.,
Kundig, T. M., Bottger, E. C., et al. (2011). Relief from Zmp
1-mediated arrest of phagosome maturation is associated with
facilitated presentation and enhanced immunogenicity of
mycobacterial antigens. Clin. Vaccine Immunol. 18, 907-913. [0260]
Jounai, N., Kobiyama, K., Shiina, M., Ogata, K., Ishii, K. J., and
Takeshita, F. (2011). NLRP4 negatively regulates autophagic
processes through an association with beclin 1 J Immunol 186,
1646-1655. [0261] Keller, M., Ruegg, A., Werner, S., and Beer, H.
D. (2008). Active caspase-1 is a regulator of unconventional
protein secretion. Cell 132, 818-831. [0262] Kim, B. H., Shenoy, A.
R., Kumar, P., Das, R., Tiwari, S., and MacMicking, J. D., (2011).
A family of IFN-gamma-inducible 65-kD GTPases protects against
bacterial infection. Science 332, 717-721. [0263] Koch, R. (1891).
A Further Communication on a Remedy for Tuberculosis. Br Med J 1,
125-127. [0264] Kono, H., Karmarkar, D., Iwakura, Y., and Rock, K.
L. (2010). Identification of the cellular sensor that stimulates
the inflammatory response to sterile cell death. J Immunol 184,
4470-4478. [0265] Korn, T., Bettelli, E., Oukka, M., and Kuchroo,
V. K. (2009). IL-17 and Th 17 Cells Annu Rev Immunol 27, 485-517.
[0266] Kyei, G. B., Dinkins, C., Davis, A. S., Roberts, E., Singh,
S. B., Dong, C., Wu, L., Kominami, E., Ueno, T., Yamamoto, A., et
al. (2009). Autophagy pathway intersects with HIV-1 biosynthesis
and regulates viral yields in macrophages. J Cell Biol 186,
255-268. [0267] Lamkanfi, M. (2011). Emerging inflammasome effector
mechanisms. Nature reviews Immunology 11, 213-220. [0268] Lamkanfi,
M., Sarkar, A., Vande Walle, L., Vitari, A. C., Amer, A. O.,
Wewers, M. D., Tracey, K. J., Kanneganti, T. D., and Dixit, V. M.
(2010). Inflammasome dependent release of the alarmin HMGB1 in
endotoxemia. J. Immunol. 185, 4385-4392. [0269] Lee, H. K., Lund,
J. M., Ramanathan, B., Mizushima, N., and Iwasaki, A. (2007).
Autophagy-dependent viral recognition by plasmacytoid dendritic
cells. Science 315, 1398-1401. [0270] Lee, H. K., Mattei, L. M.,
Steinberg, B. E., Alberts, P., Lee, Y. H., Chervonsky, A.,
Mizushima, N., Grinstein, S., and Iwaski, A. (2010). In vivo
requirement for Atg5 in antigen presentation by dendritic cells.
Immunity 32, 227-239. [0271] Levine, B., Mizushima, N., and Virgin,
H. W. (2011). Autophagy in immunity and inflammation. Nature 469,
323-335. [0272] Manjithaya, R., Anjard, C., Loomis, W. F., and
Subramani, S. (2010). Unconventional secretion of Pichia pastoris
Acb 1 is dependent on GRASP protein, peroxisomal functions, and
autophagosome formation. J Cell Biol 188, 537-546. [0273] Master,
S. S., Rampini, S. K., Davis, A. S., Keller, C., Ehlers, S.,
Springer, B., Timmins, G. S., Sander, P., and Deretic, V. (2008).
Mycobacterium tuberculosis prevents inflammasome activation. Cell
Host Microbe 3, 224-232. [0274] Mathew, R., Karp, C. M., Beaudoin,
B., Vuong, N., Chen, G., Chen, H. Y., Bray, K., Reddy, A., Bhanot,
G., Gelinas, C., et al. (2009). Autophagy suppresses tumorigenesis
through elimination of p62. Cell 137, 1062-1075. [0275]
Mayer-Barber, K. D., Andrade, B. B., Barber, D. L., Hieny, S.,
Feng, C. G., Caspar, P., Oland, S., Gordon, S., and Sher, A.
(2011). Innate and Adaptive Interferons Suppress IL-1 alpha and
IL-1 beta Production by Distinct Pulmonary Myeloid Subsets during
Mycobacterium tuberculosis Infection. Immunity 35, 1023-1034.
[0276] Mayer-Barber, K. D., Barber, D. L., Shenderov, K., White, S.
D., Wilson, M. S., Cheever, A., Kugler, D., Hieny, S., Caspar, P.,
Nunez, G. et al. (2010). Caspase-1 independent IL-1 beta production
is critical for host resistance to Mycobacterium tuberculosis and
does not require TLR signaling in vivo. J Immunol 184, 3326-3330.
[0277] McCarroll, S. A., Huett, A., Kuballa, P., Chilewski, S. D.,
Landry, A., Goyene, P., Zody, M. C., Hall, J. L., Brant, S. R.,
Cho, J. H., et al. (2008). Deletion polymorphism upstream of IRGM
associated with altered IRGM expression and Crohn's disease. Nat
Genet 40, 1107-1112. [0278] Mishra, B. B., Moura-Alves, P.,
Sonawane, A., Hacohen, N., Griffiths, G., Miota, L. F., and Anes,
E. (2010). Mycobacterium tuberculosis protein ESAT-1 is a potent
activator of the NLRP3/ASC inflammasome. Cell Microbiol. 12,
1046-1063. [0279] Mizushima, N., Levine, B., Cuervo, A. M., and
Klionsky, D J. (2008). Autophagy fights disease through cellular
self-digestion. Nature 451, 1069-1075. [0280] Mizushima, N.,
Yoshimori, T., and Ohsumi, Y. (2011). The role of atg proteins in
autophagosome formation. Annu Rev Cell Dev Biol 27, 107-132. [0281]
Moreira, A. L., Tsenova, L., Aman, M. H., Bekker, L. G., Freeman,
S., Mangaliso, B., Schroder, U., Jagirdar, J., Rom, W. N., Tovey,
M. G., et al. (2002). Mycobacterial antigens exacerbate disease
manifestations in Mycobacterium tuberculosis-infected mice. Infect
Immun 70, 2100-2107. [0282] Moscat, J., and Diaz-Meco, M. T.
(2009). p62 at the crossroads of autophagy, apoptosis, and cancer.
Cell 137, 1001-1004. [0283] Nakagawa, I., Amano, A., Mizushima, N.,
Yamamoto, A., Yamaguchi, H., Kamimoto, T., Nara, A., Funao, J.,
Nakata, M., Tsuda, K., et al. (2004). Autophagy defends cells
against invading group A Streptococcus. Science 306, 1037-1040.
[0284] Narita, M., Young, A. R., Arakawa, S., Samarajiwa, S. A.,
Nakashima, T., Yoshida, S., Hong, S., Berry, L. S., Reichelt, S.,
Ferreira, M., et al., (2011). Spatial coupling of mTOR and
autophagy augments secretory phenotypes. Science 332, 966-970.
[0285] Nedjie, J., Aichinger, M., Emmerick, J., Mizushima, N., and
Klein, L. (2008). Autophagy in thyme epithelium shapes the T-cell
repertoire and is essential for tolerance, Nature 455, 396-400.
[0286] Nunn, P., Williams, B., Floyd, K., Dye, C., Elzinga, G., and
Raviglione, M. (2005). Tuberculosis control in the era of HIV. Nat
Rev Immunol 5, 819-826. [0287] Orvedahl, A., Macpherson, S.,
Sumpter, R., Jr., Talloczy, Z., Zou, Z., and Levine, A. (2010).
Autophagy Protects against Sindbis Virus Infection of the Central
Nervous System. Cell Host Microbe 7, 115-127. [0288] Paludan, C.,
Schmid, D., Landthaler, M., Vockerodt, M., Kube, D., Tushl, T., and
Munz, C. (2005). Endogenous MHC class II processing of a viral
nuclear antigen after autophagy. Science 307, 593-596. [0289]
Ponpuak, M., Davis, A. S., Roberts, E. A., Delgado, M. A., Dinkins,
C., Zhao, Z., Virgin, H. W. t., Kyei, G. B., Johansen, T., Vergne,
I., et al. (2010). Delivery of cytosolic components by autophagic
adaptor protein p62 endows autophagosomes with unique antimicrobial
properties. Immunity 32, 329-341.
[0290] Pua, H. H., Guo, J., Komatsu, M., and He, Y. W. (2009).
Autophagy is essential for mitochondrial clearance in mature T
lymphocytes. J Immunol 182, 4046-4055. [0291] Saitoh, T., and
Akira, S. (2010). Regulation of innate immune responses by
autophagy-related proteins, J Cell Biol 189, 925-935. [0292]
Sancak, Y., Bar-Peled, L., Zoncu, R., Markhard, A. L., Nada, S.,
and Sabatini, D. M. (2010). Regulator-Rag complex targets mTORC1 to
the lysosomal surface and is necessary for its activation by amino
acids. Cell 141, 290-303. [0293] Singh, S. B., Davis, A. S.,
Taylor, G. A., and Deretic, V. (2006). Human IRGM induces autophagy
to eliminate intracellular mycobacteria. Science 313, 1438-1441.
[0294] Singh, S. B., Omatowski, W., Vergne, I., Naylor, J.,
Delgado, M., Roberts, E., Ponpuak, M., Master, S., Pilli, M.,
White, E., et al. (2010). Human IRGM regulates autophagy and
cell-autonomous immunity functions through mitochondria. Nat Cell
Biol 12, 1154-1165. [0295] Taylor, J. L., Turner, O. C., Basaraba,
R. J., Belisle, J. T., Huygen, K., and Orme, I. M. (2003).
Pulmonary necrosis resulting from DNA vaccination against
tuberculosis. Infect Immun 71, 2192-2198. [0296] Thurston, T. L.,
Ryzhakov, G., Bloor, S., von Muhlinen, N., and Randow, F. (2009).
The TBK1 adaptor and autophagy receptor NDP52 restricts the
proliferation of ubiquitin-coated bacteria. Nat Immunol 10,
1215-1221. [0297] Tooze, S. A., and Yoshimori, T. (2010). The
origin of the autophagosomal membrane. Nat Cell Biol 12, 831-835.
[0298] Travassos, L. H., Carneiro, L. A., Ramjeet, M., Hussey, S.,
Kim, Y. G., Magalhaes, J. G., Yuan, L., Soares, F., Chea, E., Le
Bourhis, L., et al. (2010). Nod1 and Nod2 direct autophagy by
recruiting ATG16L 1 to the plasma membrane at the site of bacterial
entry. Nat Immunol 11, 55-62. [0299] Turner, J., Rhoades, E. R.,
Keen, M., Belisle, J. T., Frank, A. A., and Orme, I. M. (2000).
Effective preexposure tuberculosis vaccines fail to protect when
they are given in an immunotherapeutic mode. Infect Immun 68,
1706-1709. [0300] van der Veerdonk, F. L., Netea, M. G., Dinarello,
C. A., and Joosten, L. A. (2011). Inflammasome activation and IL-1
beta and IL-18 processing during infection. Trends Immunol 32,
110-116. [0301] Vergne, I., Chua, J., Singh, S. B., and Deretic, V.
(2004). Cell biology of Mycobacterium tuberculosis phagosome. Annu
Rev Cell Dev Biol 20, 367-364. [0302] Weidberg, H., Shvets, E.,
Shpika, T., Shimron, F., Shinder, V., and Elazar, Z. (2010). LC3
and GATE-16/GABARAP subfamilies are both essential yet act
differently in autophagosome biogenesis. Embo J 29, 1792-1802.
[0303] Wild, P., Parhan, H., McEwan, D. G., Wagner, S., Rogov, V.
V., Brady, N. R., Richter, B., Korac, J., Waidmann, O., Choudhary,
C., et al., (2011). Phosphorylation of the autophagy receptor
optineurin restricts Salmonella growth. Science 333, 228-233.
[0304] Willingham, S. B., Allen, L C., Bergstralh, D. T., Brickey,
W. J., Huang, M. T., Taxman, D. J., Duncan, J. A., and Ting, J. P.
(2009). NLRP3 (NALP3, Cryopyrin) facilitates in vivo caspase-1
activation, necrosis, and HMGB1 release via inflammasome-dependent
and -independent pathways. J Immunol 183, 2008-2105. [0305] Xia,
Y., Chen, S., Wang, Y., Mackman, N., Ku, G., Lo, D., and Feng, L.
(1999). RelB modulation of 1 kappaBalpha stability as a mechanism
of transcription suppression of interleukin-1 alpha (IL-1 alpha),
IL-1 beta, and tumor necrosis factor alpha in fibroblasts. Mol Cell
Biol 19, 7688-7696. [0306] Eissa, N. T. (2007). Toll-like receptor
4 is a sensor for autophagy associated with innate immunity.
Immunity 27, 135-144. [0307] Yang, H., Troudt, J., Grover, A.,
Arnett, K., Lucas, M., Cho, Y. S., Bielefeldt-Ohmann, H., Taylor,
J., Izzo, A., and Dobos, K. M. (2011). Three protein cocktails
mediate delayed-type hypersensitivity responses indistinguishable
from that elicited by purified protein derivative in the guinea pig
model of Mycobacterium tuberculosis infection. Infect Immun 79,
716-723. [0308] Yang, Z., and Klionsky, D. J. (2010). Eaten alive:
a history of macroautophagy Nat Cell Biol 12, 814-822. [0309]
Yazdi, A. S., Guarda, G., Riteau, N., Drexler, S. K., Tardivel, A.,
Couilin, I., and Tschopp, J. (2010). Nanoparticles activate the NLR
pyrin domain containing 3 (Nlrp3) inflammasome and cause pulmonary
inflammation through release of IL-1 alpha and IL-1 beta. Proc Natl
Acad Sci USA 107, 19449-19454. [0310] Yoshikawa, Y., Ogawa, M.,
Hain, T., Yoshida, M., Fukumatsu, M., Kim, M., Mimuro, H.,
Nakagawa, I., Yanagawa, T., Ishii, T., et al., (2009). Listeria
monocytogenes ActA-mediated escape from autophagic recognition. Nat
Cell Biol 11, 1233-1240. [0311] Yuk, J. M., Shin, D. M., Lee, H.
M., Yang, C. S., Jia, H. S., Kim, K. K., Lee, Z. W., Lee, S. H.,
Kim, J. M., and Jo, E. K. (2009a). Vitamin D3 induces autophagy in
human monocytes/macrophages via cathelicidin. Cell Host Microbe 6,
231-243. [0312] Yuk, J. M., Shin, D. M., Lee, H. M., Yang, C. S.,
Jin, H. S., Kim, K. K., Lee, Z. W., Lee, S. H., Kim, J. M., and Jo,
E. K. (2009b). Vitamin D3 induces autophagy in human
monocytes/macrophages via cathelicidin. Cell Host Microbe 6,
231-243. [0313] Zhao, Z., Fux, B., Goodwin, M., Dunay, I. R.,
Strong, D., Miller, B. C., Cadwell, K., Delgado, M. A., Ponpuak,
M., Green, K. G., et al., (2008). Autophagosome independent
essential function for the autophagy protein Atg5 in cellular
immunity to intracellular pathogens. Cell Host Microbe 4,
458-469.
EXAMPLE 2
TBK-1 Controls Autophagy Pathway in Cell-Autonomous Antimicrobial
Defense
[0314] We screened the Rab family of membrane trafficking
regulators for effects on autophagic elimination of Mycobacterium
tuberculosis var. bovis BCG and found that Rab8b and its downstream
effector, innate immunity regulator TBK-1, are required for
autophagic elimination of mycobacteria in macrophages. TBK-1 was
necessary for proper autophagic flux via coordinated assembly and
function of the autophagic machinery. TBK-1 phosphorylated the
autophagic adaptor p62/sequestosome 1 Ser-403, a residue essential
for its role in autophagic clearance. TBK-1 was required for the
execution of IL-1P-induced autophagy and IL-1P-dependent autophagic
killing of mycobacteria. Thus, TBK-1 is a key regulator of
immunological autophagy and is responsible for the maturation of
autophagosomes into lytic bactericidal organelles.
[0315] We approached the far less studies processes governing
autophagic flux by a systematic screening of Rabs, the central
regulators of membrane trafficking and organellar identity in
eukaryotic cells (Stenmark, 2009). We show that Rab8b and its
downstream effector TBK-1 play a key role in orchestrating
autophagic maturation and cell-autonomous defense against
mycobacteria. We furthermore show that the major proinflammatory
cytokine IL-1 induces autophagy, that the IL-1 stimulated autophagy
can eliminate intracellular Mycobacterium tuberculosis, and that
TBK-1 was responsible for maturation of autophagosomes into
mycobactericidal organelles. Finally, we show that TBK-1
phosphorylates a key autophagy adapter p62/sequestrosome 1 (Bjorkoy
et al., 2005), the founding member of a new subfamily of pattern
recognition receptors (PRRs) termed Sequestosome: like receptors
(SLRs) (Deretic, 2011), at the Ser-403 residue essential for its
autophagic clearance function.
Results
[0316] Rab screen for autophagic killing of M. tuberculosis var.
bovis BCG reveals a role for Rab8b. We screened a library of siRNAs
to all murine Rabs and Rab like factors (FIG. 1A and Suppl. Table
S1) for effects on the previously characterized (Gutierrez et al.,
2004; Harris et al., 2007; Singh et al., 2006; Singh et al., 2010)
autophagic killing of Mycobacterium tuberculosis var. bovis BCG
(BCG), as a demonstrated (Ponpuak et al., 2010) measure of the
function of the entire autophagy pathway (from initiation to
maturation) in a biologically, immunologically, and medically
significant system. The previously implicated endocytic Rabs (e.g.,
Rab5) showed a role in accordance with observations in other
autophagy-dependent systems (Ravikumar et al., 2008). Additional
Rabs displayed a range of effects on autophagic killing of BCG,
including those Rabs previously implicated in autophagy, e.g.,
Rab7, Rab32, Rab33b, (Hirota and Tanaka, 2009, Itoh et al., 2011;
Jager et al., 2004) with the notable exception of Rab2, (Olkkonen
et al., 1993). We focused in subsequent studies on two Rabs, Rab8
and Rab34, which has no immediately predictable function whereas
our preliminary observations indicated that they affected
autophagic maturation. A knockdown of Rab34 caused premature
formation of autolysosomes (Suppl. Fig. S1A) associated with a
decline in the ability to kill BCG (Suppl. Fig. S1B), reduced
plasma membrane expression of CD98 (Suppl. Fig. S1C-E), a subunit
of amino acid transporters that import amino acids including
leucine. A knockdown of Rab34 diminished [3H] Leu uptake by the
cells (Suppl. Fig. S1F), and its effects on autophagy measured by
LC3-II could be reversed by addition of methyl-pyruvate to the
medium (Suppl. Fig. S1G). The action of Rab34 was complementary to
the previously reported effects of Rab7 (Edinger et al., 2003) and
although indirect was informative regarding how cellular energetics
governs autophagy in cell-autonomous defense against microbes.
[0317] Rab8b knockdown caused a decrease in conversion of BCG
phagosomes to degradative compartment following induction of
autophagy (Gutierrez et al., 2004; Harris et al., 2007; Ponpuak et
al., 2010) (FIG. 1X2B-D) and autophagic killing of mycobacteria
(FIG. 1X2E). In side-by-side comparisons, we observed only a tread
with Rab8a (Suppl. Fig. S1H), whereas Rab8b siRNA reproducibly
diminished autophagic killing of BCG in a statistically significant
fashion (FIG. 1X2E). We concluded that both Rab8a and Rab8b likely
play a role in autophagy but that Rab8b had a dominant effect at
least in our model system measuring autophagic killing of
mycobacteria.
[0318] TBK-1 is a downstream effector of Rab8b contributing to
autophagic elimination of mycobacteria affecting autophagic
maturation. How might Rab8b affect autophagic killing of
mycobacteria? Among the few known interacting partners of Rab8b is
FIP-2 (also known as optineurin; FIG. 2X2A). FIP-2 in turn
associates with the wild type (non-pathogenic) huntingtin (Htt)
(Hattula and Peranen, 2000), and TBK-1 (Morton et al., 2008), a
protein broadly conserved within Coelomata. TBK-1 is a pivotal
regulator of innate immunity strategically positioned a the
interface with cellular pro-survival pathways (Ou et al., 2011).
Htt and TBK-1 have been thus far implicated as an autophagic
degradation substrate (mutant Htt aggregates (Ravikumar et al.,
2008; Sarkar et al., 2007)) and, in the case of TBK-1, as being
indirectly inhibited by intracellular trafficking imposed by the
autophagy factor Atg9 (Saitoh et al., 2009) or playing a role in
modifying an autophagic adaptor for Salmonella (Wild et al., 2011).
Here we considered a model, whereby these factors could play an
active role in the regulation of the autophagic pathway. The role
of the wild type Htt is not well understood although it has been
implicated in cargo trafficking from the trans-Golgi network (TGN)
to lysosomal compartments (del Toro et al., 2009). We first tested
whether the Rab8b phenotype was exerted via Htt as a putative
effector (known to functionally affect peripheral myeloid cells in
Huntington's disease patients (Bjorkqvist et al., 2008)). However,
an Htt knockdown in macrophages did not result in a statistically
significant loss of autophagic killing of BCG (FIG. 2B). Thus, we
concluded that Htt was not critical for autophagic elimination of
mycobacteria and turned our attention to TBK-1.
[0319] In contrast to Htt, a knockdown of TBK-1 caused a deficient
in autophagic killing of BCG (FIG. 2X2B), indicating that Rab8b
effects on autophagy and elimination of mycobacteria may be exerted
via TBK-1. This was confirmed using the TBK-1 inhibitor BX795
(Clark et al., 2009). When macrophages were treated with BX795,
this abrogated starvation-induced BCG phagosome maturation (FIG.
2X2C) and autophagic killing of BCG (FIG. 2X2D).
[0320] TBK-1 is necessary for autophagosome maturation. We next
tested how TBK-1 affected autophagy and found that TBK-1 knockdown
did not affect formation of autophagosomes but suppressed their
maturation (autophagic flux) into autolysosomes, as revealed by the
tandem RFP-GFP-LC3 reported (FIG. 2X2E,F), which identifies early
autophagic organelles as RFP+GFP+ and matured autolysosomal
organelles as RFP+GFP- since GFP (but not RFP) fluorescence is
sensitive to lumenal acidification (Kimura et al., 2007; Pankiv et
al., 2007). A loss of TBK-1 reduced the number of RFP+GFP-
acidified autophagic organelles and increased RFP+GFP+ puncta,
consistent with inhibition of autophagic maturation (FIG. 2X2E,F).
A positive role of TBK-1 in autophagosomal maturation was confirmed
by LC3 immunoblots in TBK-1-/- MEFs (FIG. 2X2G,H). MEFs lacking
TBK-1 showed accumulation of LC3-II (a marker of early autophagic
organelles) under both basal (full medium) and induced (starvation)
conditions. The increase in LC3 -II in the absence of TBK-1 cannot
be explained by de-repression of autophagy initiation since the
levels of LC3-II protected from degradation by bafilomycin A1 were
slightly lower in or equal to TBK-1 knockout cells (FIG. 20,H and
Suppl. Fig. S2A).
[0321] To confirm that the phenotype was due to TBK-1 deficiency,
we inhibited with BX795 TBK-1 in wild type (TBK-1+/+) MEFs and
tested effects of BX795 on starvation induced autophagy. As with
genetically deficient TBK-1--/- MEFs, pharmacological inhibition of
TBK-1 led to diminished autophagic maturation as determined by
LC3-II blots (Suppl. Fig. S2B,C). Although attempts to complement
the absence of TBK-1 in Tbk-1-MEFs by transfection with Tbk-1
expression constructs was hampered by low transfection efficiency,
overexpression of Tbk-1 transgene in RAW 264.7 cells caused
alterations in LC3-II levels, which diminished faster with time in
Tbk-1 transgene expressing cells relative to untransfected cells
(Suppl. Fig. S2D,E). The LC3-II immunoblot experiments and the
assays using RFP-GFP-LC3 reporter collectively established that
TBK-1 was key for autophagic flux and maturation. TBK-1was also
important for delivery of the lysosomal hydrolase Cathepsin D to
autophagolysosomal compartments, purified from macrophages induced
for autophagy by starvation using magnetic beads as previously
described (Ponpuak et al., 2010), as knockin down TBK-1 diminished
cathepsin D delivery to one third of normal (Suppl. Fig. S3A). This
was specific for TBK-1 as a knockdown of another Rab8b-optineurin
interacting partner, Htt, did not reduce cathepsin: D delivery
(Suppl. Fig. S2A). TBK-1was also needed for delivery of Cathepsin D
to conventional phagolysosomes (Suppl. Fig. S2B) mirroring the
Rab8a-dependent delivery of cathepsins from the TGN to the
lysosomal compartments (del Toro et al., 2009).
[0322] TBK-1 is necessary for maturation of IL-1P-induced
autophagic organelles and mycobacterial killing in macrophages.
Although IL-1P is a key proinflammatory cytokine, its role in
autophagy has not been a subject of in-depth studies. It has
nevertheless been indirectly implicated in autophagy during MHC
class I presentation of viral antigens (English et al., 2009) and
in studies of autophagy activation via TLR4 signaling pathways (Shi
and Kehrl, 2010). Since IL-1 Ws role in cell-autonomous autophagic
defense against intracellular pathogens has not been investigated
and in order to provide an immunologically relevant context in
which to test the role of TBK-1 in autophagy, we examined here
whether IL-1P could induce autophagy in macrophages, whether
IL-1P-induced autophagy could inhibit intracellular M.
tuberculosis, and whether TBK-1 played a role in these
processes.
[0323] When RAW264.7 macrophages transiently expressing EGFP-LC3
were treated with mouse IL-1p this induced LC3 puncta formation
(FIG. 3 X2A). When RAW264.7 cells transiently expressing the tandem
RFP-GFP-LC3 probe were stimulated with IL-1P (FIG. 3 X2B), an
increase in both early autophagosomal (R+G+) and mature, acidified
puncta (R+G-) was detected indicating that IL-1p induces both
autophagic initiation and maturation resulting in progression
through the autophagic pathway. Induction of autophagy by IL-1p was
confirmed by immunoblot analysis of lipidated LC3-II levels in the
presence of autophagic maturation inhibitor bafilomycin A 1, since
LC3-II levels were increased in IL-1P-stimulated cells (FIG. 3
X2C). IL-1p induced autophagy in primary cells, including murine
bone marrow-derived macrophages (BMM) (Suppl. Fig. S3C) and human
peripheral blood monocyte-derived macrophages (Suppl. Fig. S3D).
Induction of autophagy by IL-1p was dependent on MyD88, similarly
to what as been reported for LPS and TLR4, as shown by expression
of dominant negative MyD88 (FIG. 3 X2D) and by analyzing BMM from
MyD88 knockout mice (FIG. 3E). A progression through the autophagic
pathway was confirmed by detecting proteolysis of long-lived
proteins (Roberts and Deretic, 2008) in macrophages stimulated with
IL-1p (FIG. 3 X2F). Finally, we used mycobacterial killing as a
measure of autophagic cell-autonomous defense output (Ponpuak et
al., 2010). IL-1p induced killing of M. tuberculosis, whereas
elimination of mycobacteria was abrogated in cells that were
knocked down for Atg7 (FIG. 3 X2G), demonstrating that
IL-1P-induced autophagy can, similarly to starvation (Ponpuak et
al., 2010), eliminate intracellular M. tuberculosis.
[0324] Having established that IL-1p induces autophagy with its
physiological and cell-autonomous immunity outputs, we asked
whether TBK-1 was important for these processes. RAW264.7
macrophages infected with mycobacteria were stimulated with IL-1P
or by starvation in the presence or absence of TBK-1 inhibitor
BX795. Either starvation or IL-1P caused mycobacterial killing,
whereas BX795 abrogated (FIG. 4 X2A) whereas TBK-1 siRNA (FIG. 4
X2B) reduced their autophagic elimination. As with starvation,
TBK-1 inhibition did not affect initiation of autophagy (FIG. 4C,D)
but suppressed autophagic maturation (FIG. 4 X2E,F). In conclusion,
TBK-1 is important for conversions of autophagic organelles into
mature and bactericidal organelles, for both physiologically
(starvation) and immunologically (IL-1P) induced autophagy.
[0325] TBK-1 associated with Rab8b and colocalizes with Rab8b on
autophagic organelles. We next turned to the mechanisms of how
TBK-1 affects autophagy. If Rab8 b and TBK-1 cooperate in the
control of the autophagic pathway, we reasoned that they might
associate. This was tested and shown in coimmunoprecipitation
experiments with GFP-Rab8b (FIG. 5A). When we examined
intracellular localization of Rab8b and TBK-1 relative to
autophagic organelles, TBK-1 colocalized with endogenous LC3 and
Rab8b (FIG. 5 X2B,C). The autophagic adaptor p62/sequestosome 1,
recently demonstrated to be critical for autophagic killing of M.
tuberculosis (Ponpuak et al., 2010) also colocalized with TBK-1
(FIG. 5 X2D,E). Supplementary Fig. S4 shows colocalization analyses
of TBK-1 and LC3 with Rab8b (Suppl. Fig. S4A) and with p62 (Suppl.
Fig. S4B), under different conditions: basal, induced autophagy,
presence or absence of bafilomycin A1. The colocalization and a
striking similarity in the overall intracellular organellar
distribution were enhanced in the presence of LC3- and p62-sparing
activity of bafilomycin A1 (FIG. 5 X2B-E; Suppl. Fig. S4A,B). We
conclude that Rab8b and TBK-1 localize to autophagosomal organelles
in keeping with their role in regulating autophagic flux.
[0326] Induction of autophagy results in assembly of membranous
compartments containing Rab8b, TBK-1 and autophagy factors. When
subcellular membranous compartments were separated by isopycnic
centrifugation in sucrose gradients, induction of autophagy
resulted in redistribution of multiple components engaged in
autophagy causing them to co-fractionate with TBK-1 and Rab8b (FIG.
6A,B). These were LC3-II, the autophagic adaptors p62/sequestosome
1 (Bjorkoy et al., 2005; Johansen and Lamark, 2011) and NDP52
(Thurston et al., 2009), as well as UVRAGNPS38, the component of
the Beclin 1-hVPS34 complex II specific for autophagosomal
maturation into lytic compartments (Liang et al., 2008). In keeping
with its sucrose gradient confractionation with TBK-1 (FIG. 6A,B),
UVRAG colocalized with TBK-1 (FIG. 6 X2C, D). Both autophagic
adaptors (Johansen and Lamark, 2011) p62 (Bjorkoy et al., 2005) and
NDP52 (Thurston et al., 2009) colocalized with TBK-1 (FIG. 6
X2E-G), congruent with the biochemical analyses of intracellular
organelles separated on sucrose gradients (FIG. 5 X2A-B). In the
imaging experiments in FIG. 6E-G no bafilomycin A1 was added and
thus as expected upon induction of autophagy by starvation,
p62-TBK-1 and NDP52-TBK-1 colocalization was reduced (FIG. 6
X2F,G).
[0327] These findings expanded the spectrum of autophagic machinery
components converging on Rab8b and TBK-1 containing
compartments.
[0328] TBK-1affects p62 clearance. If TBK-1 is needed for
autophagic maturation, we reasoned that it might affect clearance
of the autophagic adaptor p62, as it has been reported to be a good
marker of autophagic maturation, matching or exceeding in
performance LC3-based assays (Larsen et al., 2010). Using antibody
to endogenous p62 we employed high content quantitative imaging
analysis and detected significant increase in p62 puncta in BMMs
treated with TBK-1 inhibitor BX795 (FIG. 7 X2A-C). Western blot
analysis confirmed that p62 levels increased when TBK-1 was
inhibited (FIG. 7 X2D), in keeping with the high content image
analysis of p62. TBK-1 was also necessary to authorize
p62/sequestosome 1 for autophagic degradation, since
p62/sequestosome 1 accumulated in TBK-1-/- cells, the surplus
p62/sequestosome 1 seen in TBK-1-/- MEFs showed a laddering pattern
(Suppl. Fig. S5) neither previously reported nor observed here in
the presence of TBK-1. Furthermore, ubiquitinated proteins
accumulated in TBK-1-/- cells revealed by pull-down assays in
cellular extracts using TUBE-2 (tandem ubiquitin binding entities
2), which recognizes polyubiquitinated proteins and protects them
from deubiquitinating enzymes and proteasome during isolation
(Hjerpe et al., 2009) (FIG. 7 X2E). This indicates that p62 is not
being cleared by autophagy when TBK-1 is unavailable and
accumulates in the cell, that TBK-1 is needed to enable p623 s
entry into autophagic degradative pathway, and that several
ubiquitinated cargo do no enter degradative pathways in the absence
of TBK-1.
[0329] TBK-1 phosphorylates p62 on Ser-403. To determine whether
TBK-1 modified (e.g., phosphorylate) p62 in vivo and to examine the
potential sites involved we co-expressed GFP-p62 D69A (mutant
preventing oligomerization of p62) and myc-TBK 1 in HEK293 cells,
immunoprecipitated GFP-p62 from cellular extracts and carried out
mass spectrometry analyses on the immunoprecipitated material. As a
control, we cotransfected GFP-p62D69A with myc-TBK-1K38D, a kinase
defective mutant. By manual inspection of the mass spectrometry
data, a peptide of 857.01 m/z (2568.03 Da) was detected in
GFP-p62D69A expressing cells cotransfected with myc-TBK-1, but not
when GFP-p62D69A was co-expressed with the kinase defective mutant
myc-TBK-1K38D (FIG. 7 X2F). The 857.01 m/z (2568.03 Da) peptide was
selected for tandem mass spectrometry and identified as the
LIESLSQMLpSMGFSDEGGWLTR phosphopeptide from p62, where serine 403
in the UBA domain of p62 is phosphorylated (FIG. 7 X2G,H). The
unphosphorylated peptide with the mass 2488.1 was observed in both
samples. The Ser-403 site corresponds to the TBK-1 consensus
sequence SxxxpS. Thus, TBK-1 affects p62 phosphorylation of the
ubiquitin associated (UBA) domain, providing a specific link
between TBK-1 and autophagic adaptor posttranslational
modifications. A recent study (Matsumoto et al., 2011) has shown
that phosphorylation of Ser-403 strongly increases affinity of the
UBA domain of p62 for K48 and K63-linked ubiquitin chains, and
promoters autophagic clearance of p62 and polyubiquitinated protein
aggregates. Using a phosphospecific antibody developed by Matsumoto
et al., (2011), we monitored phosphorylation of Ser-403 in vivo and
in vitro (FIG. 7 X2I,J). TBK-1phosphorylated Ser-403 of endogenous
p62 in HEK293 cells transfected with a myc TBK-1 expression vector
(FIG. 7 X2I). This was not observed when HEK293 cells were
transfected with kinase defective TBK-1 or when mycTBK-1 expressing
cells where treated with the TBK-1 inhibitor BX795 (FIG. 7X2I).
When purified proteins were examined in a phosphorylation in vitro
assay, TBK-1 directly phosphorylated p62 at the Ser-403 site (FIG.
7 X2J). Thus, TBK-1 phosphorylates p62 at Ser-403, a residue
required for autophagic function of p62 (Matsumoto et al.,
2011).
Discussion
[0330] This study has uncovered roles of TBK-1 at a specific
execution state of the autophagic pathway known as autophagic
maturation, and in posttranslational modification of the
prototypical SLR (Deretic, 2011), p62, at the Ser-403 residue,
known to be essential for its function in autophagic clearance
(Matsumoto et al., 2011). Whereas efforts have been devoted to the
initiation and elongation stages of autophagy (Tooze and Yoshimori,
2010), the control of the flux and conversion of autophagic
organelles into degradative compartments is just as important since
in most cases autophagy exerts its physiological and immunological
functions by degrading or processing the captured intracellular
material. TBK-1 (McWhirter et al., 2004) is a member of the IKK
family of central regulators of innate immunity. (Perkins, 2007;
Richmond, 2002; Shen and Hahn, 2011) and is a downstream effector
of Rab8b. TBK-1 and Rab8b are found in shared protein complexes,
and following induction of autophagy. TBK-1 and Rab8b colocalize
and confractionate with autophagic organelles. TBK-1 is required
for the execution of the maturation program and autophagic killing
of mycobacteria in response to physiological (starvation) and
immunological (IL-1P) stimuli. Furthermore, TBK-1 phosphorylates
the key Ser-403 residue of p62/sequestosome 1, an autophagic
adaptor (Bjorkoy et al., 2005) that is the founding member of the
new class of innate immunity receptors termed SLRs (Deretic, 2011).
The phosphorylation of Ser-403 on p62 enables this PRR to recognize
and autophagically clear target substrates (Matsumoto et al.,
2011).
[0331] TBK-1 enables the execution of autophagosomal maturation and
likely couples this state of autophagy with cargo capture. This is
evidenced by the in vivo dependence on TBK-1 of the phosphorylation
of the key Ser-403 residue within the UBA domain of one of the
principal autophagic adaptors, p62/sequestosome 1. While our study
was in revision, phosphorylation of Ser-403 by CK2 was shown to
increase affinity of p62 UBA for polyubiquitin chains on its cargo
(Matsumoto et al., 2011). Our findings are congruent with these
observations and suggest that TBK-1 also targets and phosphorylates
directly the Ser-403 site, thus linking immunological and
physiological inputs with p62 UBA activation in vivo. Of further
note is that our data on the effects of TBK-1 on autophagic
maturation are in keeping with the extended model recently depicted
by von Muhlinen et al., (von Muhlinen et al., 2010), whereby TBK-1
plays a role not only in modifying autophagic adaptors such as
NDP-52 (Thurston et al., 2009), optineurin (Wild et al., 2011), and
as shown here p62, but also plays additional but hitherto undefined
roles in the autophagic pathway. The Rab screen performed here
relied on the cell-autonomous antimicrobial defense functionality
that depended on the execution of the entire autophagic pathway as
previously defined (Ponpuak et al., 2010) from signaling and
imitation, through maturation, to its final biological output, i.e.
the bactericidal action of autophagy. We acknowledge that this
approach may not account for functions of Rabs in the context of
how starvation may affect viability of mycobacteria by a
potentially unknown process other than autophagy. In this work, we
focused on two Rabs, Rab34 and Rab8b, which have not been covered
in prior studies. Of the two Rab8 GTPases only Rab8b showed
statistically significant effect on autophagic killing of BCG.
Although Rab8a and Rab8b share several interacting partners, Rab8b
also features a number of unique interactors (Chen et al., 2001:
Fransen et al., 2008; Heidrych et al., 2008) and the Rab8b sequence
diverges from Rab8 a in its variable region near the C-terminus.
Since optineurin binds Rab8a as well as Rab8b, it is likely that
differences in localization of Rab8b-optineurin underlie the
stronger Rab8b engagement with autophagy maturation as detected
here, along with potential participation of unique interacting
partners specific for Rab8b, e.g. otoferlin, associated with
autosomal recessive deafness (Heidrych et al., 2008), and
Pex5Rp/TRP8b, a protein related to the peroxisomal targeting signal
1 receptor Pex5p (Fransen et al., 2008). The other Rab8 paralog,
Rab8a, does associate with a subset of LC3 compartments, however
they specialize in the alternative secretory pathway of
inflammasome substrates such as IL-1p (Dupont et al., 2011).
[0332] The follow up analyses with Rab34 led to a connection with
amino acid import. This is a plausible link since autophagy is
controlled by amino acid starvation and can be abrogated by
addition of amino acids such as leucine (Grinde and Seglen, 1981).
Cells displayed reduced leucine uptake when Rab34 was knocked down
and thus the negative effects of the loss of Rab34 on autophagic
killing of BCG may appear paradoxical. However, a similar effect
was observed in studies with myotubularins (Vergne et al., 2009)
where knocking down myotubularin phosphatidylinositol
3-phosphatases led to chronic autophagy activation and exhaustion,
diminishing its efficacy in antimicrobial defense. These
observations underscore a requirement for precise timing of
autophagy induction in order for it to exert its cell-autonomous
antimicrobial defense. Since autophagy is affected by growth
factors and hormones (Ezaki et al., 2011) its response to
immunological signals (Delgado et al., 2008; Gutierrez et al.,
2004; Harris et al., 2007; Shi and Kehrl, 2010; Tang et al., 2010;
Xu et al., 2007), nutritional and hormonal imbalance may be a
determinant of the efficacy of autophagic immunological
outputs.
[0333] TBK-1 is spatially and biochemically associated with Rab8b
in the context of autophagy, and this likely occurs via an
intermediary protein optineurin. Optineurin mutants with altered
binding of TBK-1 have been linked to glaucoma (Morton et al., 2008)
whereas optineurin mutations linked to amyotrophic lateral
sclerosis (ALS) display changes in inflammatory signaling (Maruyama
et al., 2010). Optineurin is present in neuronal cytoplasmic
inclusions in ASL and in a range of neurodegenerative disorders
(Maruyama et al., 2010; Osawa et al., (2011). Given the
neuroprotective role of autophagy (Mizushima et al., 2008),
optineurin's mechanism of action in disease may now be considered
in the context of autophagy. Optineurin, also known as NEMO-related
protein (NRP) is a tetra-ubiquitin binding protein (Laplantine et
al., 2009). NEMO (or IKK-y) is a regulatory scaffold for IKK-a and
IKK-P (canonical IKKs), controlling proinflammatory responses via
NF-KB, whereas optineurin serves as a platform for assembly of
multiprotein complexes including TBK-1 (Morton et al., 2008). TBK-1
is in turn linked to the autophagic adaptor NDP52 (Thurston et al.,
2009) via Sinbad and Nap 1, in keeping with our observations that
induction of autophagy by starvation leads to co-fractionation of
TBK1 and NDP52. The two (canonical IKK and TBK 1) platforms show
more interactions than previously appreciated (Clark et al., 2011),
which opens the possibility of a sequential or coordinated action
in autophagy of canonical IKKs (Comb et al., 2011; Criollo et al.,
2010) and TBK-1 as revealed here.
[0334] TBK-1turned out to be important in cell-autonomous defense
against mycobacteria downstream of macrophage activation by
inflammatory cytokine IL-1p. We show in this study that IL-1P
induces autophagy in a MyD88-dependent fashion and that one of the
outputs of this proinflammatory cytokine is to promote autophagic
killing of M. tuberculosis. This is in keeping with the reports
that IL-1P, IL-1R, and MyD88 are important in elimination of M.
tuberculosis (Fremond et al., 2007; Master el al., 2008;
Mayer-Barber et al., 2010). Congruent with our observations, IL-1p
has been indirectly implicated in previous studies investigating
immunological roles of autophagy (English et al., 2009; Shi and
Kehrl, 2010). IL-1P thus joins other alarmins, such as HMGB1 (Tang
et al., 2010), as an inducer of autophagy. On the flip side,
autophagy-based unconventional secretion has been implicated in
activation and extracellular delivery of IL-1p and HMGB 1 (Dupont
et al., 2011), thus indicating a possible role for autophagy in
amplifying autocrine and paracrine signals of key alarmins IL-1P
and HMGB-1. Whether TBK-1 primarily plays a role in promoting
autophagic flux during IL-1P- or starvation-induced autophagy that
has been uncovered in our present study, or also throttles
autophagy-based unconventional secretion remains to be
determined.
[0335] A further connection between TBK-1, autophagy, and
immunological functions has been recently suggested by implicating
TBK-1 via optineurin sponsored events in autophagic control of
Salmonella when it escapes in the cytosol (Wild et al., 2011). Both
the study by Wild et al., (Wild et al., 2011) and our present work
are in keeping with the report by O'Riordan and colleagues (Radtke
et al., 2007) uncovering the role of TBK-1 in control of
intracellular bacteria, in addition to its well appreciated role in
antiviral defenses. O'Riordan and colleagues (Radtke et al., 2007)
pointed to the role of TBK-1 as keeping the cytosolic bacteria in
check by a mechanism that at the time was characterized as
prevention of bacterial escape into or multiplication in the
cytosol but was deemed not to involve autophagy due to an apparent
increase in LC3 puncta in Tbk-1-/- cells. Given that TBK-1, as
shown here, is primarily involved in autophagosomal maturation,
accumulation of LC3 in the absence of TBK1 observed by O'Riordan
(Radtke et al., 2007) and colleagues remarkably fits our data
showing that TBK 1 controls flux and progression through the
autophagic pathway (causing disappearance of the initially formed
LC3 puncta via degradation in autolysosomes), rather than its
initiation (characterized by appearance of LC3 puncta). Thus, all
presently existing data are compatible with the role of TBK-1in
autophagic maturation and its role as an antimicrobial mechanism
that can eliminate cytoplasmic bacteria.
[0336] The role of TBK-1 in autophagy maturation expands the role
of IKKs in autophagy, previously limited to IKK-a and IKK-P (Comb
et al., 2011; Criollo et al., 2010) IKK-a and IKK-P, play a role in
the induction of autophagy (independently of NF-K13) in response to
starvation (Comb et al., 2011; Criollo et al., 2010). We propose a
model in which IKK-a and IKK-P serve to initiate autophagy whereas
TBK-1 ensures its completion. Nevertheless, a recent report (Clark
et al., 2011) has indicated a negative regulatory interaction
between the canonical IKKs (IKK-a and IKK-P), and IKK-related
factors (TBK-1 and IKK-E/i). This poses the question of potential
antagonism between the canonical IKKs and TBK-1 and IKK-E/i.
[0337] We however did not observe a negative effect of TBK-1 on
autophagy initiation since LC3-II levels were equal or reduced (and
not increased) in Tbk-/- MEFs when the autophagic flux was blocked
using bafilomycin A1. Nevertheless, at least one self-limiting
feed-back loop exists at a different level in the TBK-1-autophagy
system, based on the reported negative regulatory effects of
several Atg factors on TBK-1 signaling (Jounai et al, 2007; Saitoh
et al., 2009).
[0338] In sum, our work has expanded the role in autophagy of IKKs,
the central kinases governing innate immunity, from participation
of canonical IKK family members in autophagy induction (Comb et
al., 2011; Criollo et al., 2010) to now include TBK-1 in the
control of autophagic maturation and cell autonomous antimicrobial
defense functions of autophagy. Thus, both canonical and
non-canonical IKKs play key roles in inflammatory signaling and
cell-autonomous defenses, and our observations and those of others
may help integrate the role of different IKKs in cell-autonomous
defenses specifically in the context of autophagy as an innate
immunity mechanism.
Experimental Procedures
[0339] Cell Culture, Pharmacological and Cytokine Treatments,
Transfections, siRNA Knockdowns, Autophagy Induction, and
Immunoprecipitations
[0340] Mouse macrophage-like cell line RAW 264.7 were from ATCC.
Tbk-1-/- and Tbk-1+/+ (wild type) MEFs were from M. O'Riordan,
University of Michigan. Murine primary bone marrow macrophages were
isolated and differentiated from mouse femur marrows. When
indicated, cells were treated with 100 nM bafilomycin A1 to prevent
protein degradation in lytic compartments. Cells were treated for
16 h with 10 nM TBK1 pharmacological inhibitor, BX795 (InvioGen).
Murine macrophages were treated with mouse IL-1P (Sigma and R&D
Biosciences) 50 ng/ml for 16 h or 200 ng/ml for 3 h. RAW 264.7
cells were transfected by nucleoporation using Nucleofector Reagent
Kit V (Amaxa/Lonza biosystems). Rabs and Rab-like factors
knockdowns details are given in Suppl. Table S1). For murine TBK-1
and Huntingtin knockdowns, cells were transfected with SMART pool
reagents (Dharmacon), TBK-1 SMARTpool: (GAAGCCGUCUGGUGCAAUA;
UGACGGCGCAUAAGAUUUA; CUACGAAGGACGACGCUUA; GUAUGAAG-CGUUUUAAAGAU).
Huntingtin SMARTpool: (GAAAUUAAGGUUCUGUUGA; CCACUCACGCCAACUAUAA;
GAUGAAGGCUUUCGAGUCG; UAACAUGGC-UCAUUGUGAA). Non-targeting siRNA
pool (Scrambled) was used as a control. With Rab8's, Rab34, and
Rab8 effectors individual or combinations of two siRNAs from the
SMARTpool were used in separate experiments to establish SMARTpool
specificity; in no case were off target effects seen within a set
of targets examined in this study. For autophagy effects, cells
were uninduced (in full medium) or induced for autophagy by
starvation with EBSS for 90 min (parallel controls with Beclin 1 or
Atg7 knockdowns were used to ascertain autophagy authenticity).
Immunoprecipitation was carried out as previously described
(Ponpuak et al., 2010; Singh et al., 2010). An untagged TBK-1 cDNA
expression construct was from OriGene (Vector; pCMV6-XL5).
[0341] Subcellular fractionation, immunoblot analysis, antibodies,
and stable protein turn-over. Subcellular compartments were
separated by isopycnic density equilibrium centrifugation in
sucrose gradients as described (Singh et al., 2010). Cells were
homogenized in 250 mM sucrose, 20 mM HEPES-NaOH and 0.5 mM EGTA, pH
7.5 (SHE). The post nuclear supernatant was layered on top of a
pre-formed sucrose gradient consisting of 60%, 50%, 40%, 35%, 30%,
25%, 20%, 15% sucrose from top to bottom. The sample was
centrifuged at 100,000 g in a Beckman SW 40 rotor at 4.degree. C.
for 18 hours. Equivalent density fractions (verified for refractive
index match) were analyzed with antibodies to UVRAG (MBL), TBK-1
(AbCam), NDP52 (Millipore), LC3 (Sigma), p62 (Promega) and Rab8b
(custom made); staining was revealed with Super Signal West Dura
chemiluminescent substrate (Pierce). Long-lived protein turnover
was measured as described previously (Ponpuak et al., 2009).
Anti-phospho-S403 p62 antibody (Matsumoto et al., 2011) was from
Nobuyuki Nukina.
[0342] Phosphorylation analysis of p62. HEK293 cells were
transfected using Metafectene Pro (Biontex) with GFP-p62 D69A (a
mutant in the PB 1 domain, to prevent oligomerization) and
myc-TBK-1 or as a control TBK-1 kinase defective mutant myc-TBK-1
K38D. Immunoprecipitation of GFP-p62 D69A from cell extracts
prepared from two 10-cm plates) using a custom made GFP antibody
was performed as described previously (Lamark et al., 2003).
Following SDS PAGE, gel bands containing GFP-p62 (D69A) were
excised and subjected to ingel reduction, alkylation, and tryptic
digestion using 2-10 ng/.mu.l trypsin (V511A; Promega) (Shevchenko
et al., 1996). Peptide mixtures containing 0.1% formic acid were
loaded onto a nanoACQUITY UltraPerformance LC (Waters), containing
a 5-.mu.m Symmetry C18 Trap column (180 .mu.m.times.20 mm; Waters)
in front of a 1.7-.mu.m BEH130 C18 analytical column (100
.mu.m.times.100 mm; Waters). Peptides were separated with a
gradient of 5.95% acetonitrile, 0.1% formic acid, with a flow of
0.4 .mu.l/min eluted to a Q-TOF Ultima mass spectrometer
(Micromass/Waters). Each sample was run in ms and data dependent
tandem ms mode. Peak lists were generated from MS/MS by the
ProteinLynx Global server software (version 2.2; Waters). The
resulting pk1 files were searched against the Swiss-Prat 57.15
protein sequence databases using an in-house Mascot server (Matrix
Sciences). Peptide mass tolerances used in the search were 100 ppm,
and fragment mass tolerance was 0.1 Da. Mascot analysis confirmed
that the sample contained p62. The Mascot analysis also confirmed
that p62 was phosphorylated on Serine 403 after cotransfection with
myc-TBK1. For in vitro kinase assays recombinant maltose binding
protein (MBP) and MBPp62 proteins were purified from E. coli.
Recombinant TBK-1 (50 ng; Millipore) was incubated with recombinant
MBP, MBP-p62 or MBP-p62 S403A in the presence of 10 mM ATP and 5
mCi [y-32P] ATP using kinase buffer (40 mM Tris-HCl pH 7.5, 10 mM
MgCl2, 1 mM DTT supplemented with Calbiochem phosphatase inhibitor
cocktail set II) at 30.degree. C. The reaction was terminated by
boiling in SDS sample buffer after 10 min. Samples were separated
by SDS-PAGE, the gels were stained with coomassie brilliant blue,
dried and analysed by autoradiography.
[0343] TUBE2 pulldown. Tandems ubiquitin binding entities (TUBE) in
the form of TUBE2-agarose beads (Lifesensors) were used as
described (Hjerpe et al., 2009) to pull down polyubiquitinated
proteins from cell lysates precleared with agarose beads for 1 h at
4.degree. C. and incubated with 20 .mu.l of pre-equilibrated
TUBE2-agarose beads in 20 mM Tris, pH 8.0, 0.15M NaCl, 0.1%
Tween-20 (TBS-T) with mutation overnight at 4.degree. C. Agarose
beads were washed three times with TBS-T, eluted with 25 .mu.l
2.times. Laemmeli buffer and subjected to SDS PAGE and immunoblot
analysis.
[0344] Confocal and high content quantitative microscopy. Images
using a Zeiss LSM 510 Meta confocal microscope (laser wavelength,
488 nm, 543 nm and 633 nm). Antibodies against endogenous proteins
TBK-1 (AbCam), Rab8b (AbCam & custom made), p62 (AbCam), NDP52
(Millipore), LC3 (Sigma) and UVRAG (MBL) were used for indirect
immunofluorescence analysis. Post-imaging analyses were done with
LSM 510 software and Slide Book 5.0 (Intelligent Imaging
Innovations) for morphometrics. For quantitative p62 puncta
analysis, Cellomics Array Scan (Thermo Scientific) was used to
acquire images by computer-driven collection of 49 valid fields per
well with cells in 96 well plates stained for endogenous p62, and
data morphometrically and statistically analyzed using
puncta-counting application within the iDev software (Thermo
Scientific).
[0345] Mycobacterial survival, phagosome and phagolysosome
purification purification. Microbiological analyses of bacterial
viability were carried out as previously described (Gutierrez et
al., 2004; Harris et al., 2007; Singh et al., 2006; Singh et al.,
2010) using previously described detailed methods (Ponpuak et al.,
2010; Ponpuak et al., 2009). RAW 264.7 cells were used to isolate
phagosomes (Fratti et al., 2001) or magnetic bead
autophagolysosomes (Ponpuak et al., 2010) as previously
described.
References for Background of the Invention and Example 2
[0346] Bjorkoy, G., Lamark, T., Brech, A., Outzen, H., Perander,
M., Overvatn, A., Stenmark, H., and Johansen, T. (2005). p62/SQSTM1
forms protein aggregates degraded by autophagy and has a protective
effect on huntingtin-induced cell death. J Cell Biol 171, 603-614.
[0347] Bjorkqvist, M., Wild, E. J., Thiele, J., Silvestroni, A.,
Andre, R., Lahiri, N., Raibon, E., Lee, R. V., Benn, C. L., Soulet,
D., et al. (2008). A novel pathogenic pathway of immune activation
detectable before clinical onset in Huntington's disease. J Exp Med
205, 1869-1877. [0348] Blanchet, F. P., Moris, A., Nikolic, D. S.,
Lehmann, M., Cardinaud, S., Stalder, R., Garcia, E., Dinkins, C.,
Leuba, F., Wu, L., et al. (2010). Human immunodeficiency virus-1
inhibition of immunoamphisomes in dendritic cells impairs early
innate and adaptive immune responses. Immunity 32, 654-669. [0349]
Cadwell, K., Patel, K. K., Maloney, N. S., Liu, T. C., Ng, A. C.,
Storer, C. E., Head, R. D., Xavier, R., Stappenbeck, T. S., and
Virgin, H. W. (2010). Virus-plus18 susceptibility gene interaction
determines Crohn's disease gene Atg16L1 phenotypes in intestine.
Cell 141, 1135-1145. [0350] Chaturvedi, A., Dorward, D., and
Pierce, S. K. (2008). The B cell receptor governs the subcellular
location of T cell-like receptor 9 leading to hyper responses to
DNA containing antigens. Immunity 28, 799-809. [0351] Che, N., Li,
S., Gao, T., Zhang, Z., Han, Y., Zhang, W., Sun, Y., Liu, Y., Sun,
Z., Zhang, J., et al. (2010). Identification of a novel IRGM
promoter single nucleotide polymorphism associated with
tuberculosis. Clin Chim Acta 411, 1645-1649. [0352] Chen, S.,
Liang, M. C., Chia, J. N., Ngsee, J. K., and Ting, A., E., (2011).
Rab8b and its interacting partner TRIP86 are involved in regulated
secretion in AtT20 cells. J Biol Chem 276, 13209-13216. [0353]
Clark, K., Peggie, M., Plater, L., Sorcek, R. J., Young, E. R.,
Madwed, J. B., Hough, J., Melver, E. G., and Cohen, P. (2011).
Novel cross-talk within the IKK family controls innate immunity.
The Biochemical journal 434, 93-104. [0354] Clark, K., Plater, L.,
Peggie, M., and Cohen, P. (2009). Use of the pharmacological
inhibitor BX795 to study the regulation and physiological roles of
TBK1 and 1 kappa B kinase epsilon: a distinct upstream kinase
mediates Ser-172 phosphorylation and activation. J Biol Chem 284,
14136-14146. [0355] Comb, W. C., Cogswell, P., Sitcheran, R., and
Baldwin, A. S. (2011), IKK dependent, NF-kappa B-independent
control of autophagic gene expression. Oncogene 30, 1727-1732.
Consortium (2007). Genome-wide association study of 14,000 cases of
seven common diseases and 3,000 shared controls. Nature 447,
661-678. [0356] Cooney, R., Baker, J., Brain, O., Danis, B.,
Pichulik, T., Allan, P., Ferguson, D. J., Campbell, B. J., Jewell,
D., and Simmons, A. (2010). NOD2 stimulation induces autophagy in
dendritic cells influencing bacterial handling and antigen
presentation. Nat Med 16, 90-97. [0357] Craddock, N., Hurles, M.
E., Cardin, N., Pearson, R. D., Plagnol, V., Robson, S., Vukcevic,
D., Barnes, C., Conrad, D. G., Giannoulatou, E., et al. (2010).
Genome wide association study of CNVs in 16,000 cases of eight
common diseases and 3,000 shared controls. Nature 464, 713-720.
[0358] Criollo, A., Senovilla, L., Authier, H., Maiuri, M. C.,
Morselli, E., Vitale, I., Kepp, O., Tasdemir, E., Galluzzi, L.,
Shen, S., et al. (2010). The IKK complex contributes to the
induction of autophagy. Embo J 29, 619-631. [0359] del Toro, D.,
Alberch, J., Lazaro-Dieguez, F., Martin-Ibanez, R., Xifro, X.,
Egca, G., and Canals, J. M. (2009). Mutant huntingtin impairs
post-Golgi trafficking to lysosomes by delocalizing optineurin/Rab8
complex from the Golgi apparatus. Mol Biol Cell 20, 1478-1492.
[0360] Delgado, M. A., Elmaoued, R. A., Davis, A. S., Kyei, G., and
Deretic, V. (2008). Toll-like receptors control autophagy. Embo J
27, 1110-1121. [0361] Deretic, V. (2011). Autophagy as an innate
immunity paradigm: expanding the scope and repertoire of pattern
recognition receptors. Curr Opin Immunol. [0362] Deretic, V., and
Levine, B. (2009). Autophagy, immunity, and microbial adaptations,
Cell Host Microbe 5, 527-549. [0363] Dupont, N., Jiang, S., Pilli,
M., Omatowski, W., Bhattacharya, D., and Deretic, V. (2011).
Autophagy-based unconventional secretory pathway for extracellular
delivery of IL-1p. EMBO J Impress. [0364] Edinger, A. L., Cinalli,
R. M., and Thompson, C. B. (2003). Rab7 prevents growth
factor-independent survival by inhibiting cell-autonomous nutrient
transporter expression. Dev Cell 5, 571-582. [0365] English, L.,
Chemali, M., Duron, J., Rondeau, C., Laplante, A., Gingras, D.,
Alexander, D., Leib, D., Norbury, C., Lippe, R., et al. (2009).
Autophagy enhances the presentation of endogenous viral antigens on
MHC class I molecules during HSV-1 infection. Nat Immunol. [0366]
Ezaki, J., Matsumoto, N., Takeda-Ezaki, M., Komatsu, M., Takahashi,
K., Hiraoka, U., Taka, H., Fujimura, T., Takehana, K., Yoshida, M.,
et al. (2011). Liver autophagy contributes to the maintenance of
blood glucose and amino acid levels. Autophagy 7. [0367] Fransen,
M., Amery, L., Hartig, A., Brees, C., Rabijns, A., Mannaerts, G.
P., and Van Veldhoven, P. P. (2008). Comparison of the PTS1- and
Rab8b-binding properties of Pex5p and Pex5Rp/TRIP86. Biochimica et
biophysica acta 1783, 864-873. [0368] Fratti, R. A., Backer, J. M.,
Gruenberg, J., Corvera, S., Deretic, V. (2001). Role of
phosphatidylinositol 3-kinase and Rab5 effectors in phagosomal
biogenesis and mycobacterial phagosome maturation arrest. J Cell
Biol 154, 631-644. [0369] Fremond, C. M., Togbe, D., Doz, E., Rose,
S., Vasseur, V., Maillet, I., Jacobs, M., Ryffel, B., and
Quesniaux, V. F., (2007). IL-1 receptor-mediated signal is an
essential component of MyD88-dependent innate response to
Mycobacterium tuberculosis infection. J Immunol 179, 1178-1189.
[0370] Gannage, M., Dormann, D., Albrecht, R., Dengjiel, J.,
Torossi, T., Ramer, P. C., Lee, M., Strowig, T., Amery, F.,
Conenello, G., et al. (2009). Matrix protein 2 of influenza A virus
blocks autophagosome fusion with lysosomes. Cell Host Microbe 6,
367-380. [0371] Grinde, B., and Seglen, P. O. (1981). Leucine
inhibition of autophagic vacuole formation in isolated rat
hepatocytes. Experimental cell research 134, 33-39. [0372]
Gutierrez, M. G., Master, S. S., Singh, S. B., Taylor, G. A,
Colombo, M. I., and Deretic, V. (2004). Autophagy is a defense
mechanism inhibiting BCG and Mycobacterium tuberculosis survival in
infected marophages. Cell 119, 753-766. [0373] Harris, J., De Haro,
S. A., Master, S. S., Keane, J., Roberts, E. A., Delgado, M., and
Deretic, V., (2007). T helper 2 cytokines inhibit autophagic
control of intracellular Mycobacterium tuberculosis. Immunity 27,
505-517. [0374] Harris, J., Hartman, M., Roche, C., Zeng, S. G.,
O'Shea, A., Sharp, F. A., Lambe, E. M., Creagh, E. M., Golenbock,
D. T., Tschopp, J., et al., (2011). Autophagy controls IL-1 (beta)
secretion by targeting pro-IL-1(beta) for degradation. J Biol Chem.
[0375] Hattula, K., and Peranen, J. (2000). FIP-2, a coiled-coil
protein, links Huntingtin to Rab8 and modulates cellular
morphogenesis. Curr Biol 10, 1603-1606. [0376] Heidrych, P.,
Zimmermann, U., Bress, A., Pusch, C. M., Ruth, P., Pfister, M.,
Knipper, M., and Blin, N. (2008). Rab8 GTPase, a protein transport
regulator, is an interacting partner of otoferlin, defective in a
human autosomal recessive deafness form. Human molecular genetics
17, 3814-3821. [0377] Hirota, Y. and Tanaka, Y. (2009). A small
GTPase, human Rab32, is required for the formation of autophagic
vacuoles under basal conditions. Cell Mol Life Sci. [0378] Hjerpe,
R., Aillet, F., Lopitz-Otsoa, F., Lang, V., England, P., and
Rodriguez, M B. (2009). Efficient protection and isolation of
ubiguitylated proteins using tandem ubiquitin-binding entities.
EMBO Rep JO, 1250-1258. [0379] Huang J., Canadien, V., Lam, G. Y.,
Steinberg, B. E., Dinauer, M. C., Magalhaes, M. A., Glognuer, M.,
Grinstein, S., and Brumell, J. H. (2009). Activation of
antibacterial autophagy by NADPH oxidases. Proc Natl Acad Sci USA.
[0380] Intemman, C. D., Thye, T., Niemann, S., Browne, E. N.,
Amanus Chinbuah, M., Enimil, A., Gyapong, J., Osei, I., Owusu-Dabo,
E., Helm, S., et al. (2009). Autophagy gene variant IRGM-261T
contributes to protection from tuberculosis caused by Mycobacterium
tuberculosis but not by M. africanum strains. PLoS Pathog 3,
e1000577. [0381] Itoh, T., Kanno, E., Uemura, T., Waguri, S., and
Fukuda, M. (2011). OATH1, a novel autophagosome-resident
Rab33B-GAP, regulates autophagosomal maturation. The Journal of
cell biology 192, 839-853. [0382] Jager, S., Bucci, C., Tanida, I.,
Ueno, T., Kominami, E., Saftig, P., and Eskelinen, E. L., (2004).
Role for Rab7 in maturation of late autophagic vacuoles J Cell Sci
117, 4837-4848, [0383] Jia, W., and He, Y. W. (2011). Temporal
regulation of intracellular organelle homeostasis in T lymphocytes
by autophagy. J Immunol 186, 5313-5322. [0384] Johansen, T., and
Lamark, T. (2011). Selective autophagy mediated by autophagic
adapter proteins. Autophagy 7. [0385] Jounai, N., Takeshita, F.,
Kobiyama, K., Sawano, A., Miyawaki, A., Xin, K. Q., Ishii, K. J.,
Kawai, T., Akira, S., Suzuki, K., et al. (2007). The Atg5 Atg12
conjugate associates with innate antiviral immune responses. Proc
Natl Acad Sci USA 104, 14050-14055. [0386] Kimura, S., Noda, T, and
Yoshimori, T. (2007). Dissection of the autophagosome maturation
process by a novel reporter protein, tandem fluorescent-tagged LC3,
Autophagy 3, 452-460. [0387] Kirkin, V., Lamark, T., Sou, Y. S.,
Bjorkoy, G., Nunn, J. L., Bruun, J. A., Shvets, E., McEwan, D. G.,
Clausen, T. H., Wild, P., et al. (2009). A role for NBR1 in
autophagosomal degradation of ubiquitinated substrates. Mol Cell
33, 505-516. [0388] Korolchuk, V. I., Saiki, S., Lichtenberg, M.,
Siddiqi, F. H., Roberts, E. A., Imarisio, S., Jahreiss, L., Sarkar,
S., Futter, M., Menzies, F. M., et al. (2011). Lysosomal
positioning coordinates cellular nutrient responses. Nat Cell Biol.
[0389] Kroemer, G., and Levine, B. (2008). Autophagic cell death:
the story of a misnomer. Nat Rev Mol Cell Biol 9, 1004-1010. [0390]
Kyei, G. B., Dinkins, C., Davis, A. S., Roberts, E., Singh, S. B.,
Dong, C., Wu, L., Kominami, E., Ueno, T., Yamamoto, A., et al.
(2009). Autophagy pathway intersects with HIV-1 biosynthesis and
regulates viral yields in macrophages. J Cell Biol 186, 255-268.
[0391] Lamark, T., Perander, M., Outzen, H., Kristiansen, K.,
Overvatn, A., Michaelsen, E., Bjorkoy, G., and Johansen, T. (2003).
Interaction codes within the family of mammalian Phox and Bem 1p
domain-containing proteins. J Biol Chem 278, 34568-34581. [0392]
Laplantine, E., Fontan, E., Chiaravalli, J., Lopez, T., Lakisie,
G., Veron, M., Agou, F., and Israel, A. (2009). NEMO specifically
recognizers K63-linked poly-ubiquitin chains through a new
bipartite ubiquitin-binding domain. Embo J 28, 2885-2895. [0393]
Larsen, K. B., Lamark, T., Overvatn, A., Hameshaug, I., Johansen,
T., and Bjorkoy, G. (2010). A reporter cell system to monitor
autophagy based on p62/SQSTM1. Autophagy 6, 784-793. [0394] Lee, H.
K., Mattei, L. M., Steinberg, B. E., Alberts, P., Lee, Y. H.,
Chervonsky, A., Mizushima, N., Grinstein, S., and Iwasaki, A.
(2010). In vivo requirement for Atg5 in antigen presentation by
dendritic cells. Immunity 32, 227-239. [0395] Lee, J. S., Li, Q.,
Lee, J. Y., Lee, S. H., Jeong, J. H., Lee, H. R., Chang, H., Zhou,
F. C., Gao, S. J., Liang, C., et al. (2009). FLIP-mediated
autophagy regulation in cell death control. Nat Cell Biol. 11,
1355-1362. [0396] Levine, B., Mizushima, N., and Virgin, H. W.
(2011). Autophagy in immunity and inflammation. Nature 469,
323-335. [0397] Liang, C., Lee, J. S., Inn, K. S., Gack, M. U., Li,
Q., Roberts, F. A., Vergne, I., Deretic, V., Feng, P., Akazawa, C.,
et al. (2008). Beclin 1-binding UVRAG targets the class C Vps
complex to coordinate autophagosome maturation and endocytic
trafficking. Nat Cell Biol JO, 776-787. [0398] Maruyama, H.,
Morino, H., Ito, H., Izumi, Y., Kato, H., Watanabe, Y., Kinoshita,
Y., Kamada, M., Nodera, H., Suzuki, H., et al. (2010). Mutations of
optineurin in amyotrophic lateral sclerosis. Nature 465, 223-226.
[0399] Master, S. S., Rampini, S. K., Davis, A. S., Keller, C.,
Ehlers, S., Springer, B., Timmins, G. S., Sander, P., and Deretic,
V. (2008). Mycobacterium tuberculosis prevents inflammasome
activation. Cell Host Microbe 3, 224-232. [0400] Mathew, R., Karp,
C. M., Beaudoin, B., Vuong, N., Chem, G., Chen, H. Y., Bray, K.,
Reddy, A., Bhanot, G., Gelinas, C., et al. (2009). Autophagy
suppresses tumorigenesis through elimination of p62. Cell 137,
1062-1075. [0401] Matsumoto, G., Wada, K., Okuno, M., Kurosawa, M.,
and Nukina, N. (2011). Serine 403 Phosphorylation of p62/SQSTM1
Regulates Selective Autophagic Clearance of Ubiquitinated Proteins:
Molecular Cell 44, 279-289. [0402] Matsunaga, K., Saitoh, T.,
Tabata, K., Omori, H., Satoh, T., Kurotori, N., Maejima, I.,
Shirahama-Noda, K., Ichimura, T., Isobe, T., et al. (2009). Two
Beclin 1-binding proteins, Atg14L and Rubicon, reciprocally
regulate autophagy at different stages. Nat Cell Biol 11, 385-396.
[0403] Mayer-Barber, K. D., Barber, D. L., Shenderov, K., White, S.
D., Wilson, M. S., Cheever, A., Kugler, D., Hieny, S., Caspar, P.,
Nunez, G., et al. (2010). Caspase-1 independent IL-1 beta
production is critical for host resistance to Mycobacterium
tuberculosis and does not require TLR signaling in vivo J Immunol
184, 3326-3330. [0404] McWhirter, S. M., Fitzgerald, K. A.,
Rosains, J., Rowe, D. C., Golenbock, D. T., and Maniatis, T.
(2004). IFN-regulatory factor 3-dependent gene expression is
defective in Tbk 1-deficient mouse embryonic fibroblasts.
Proceedings of the National Academy of Sciences of the United
States of America I OJ, 233-238. [0405] Mizushima, N., Levine, B.,
Cuervo, A. M., and Klionsky, D. J. (2008). Autophagy fights disease
through cellular self-digestion. Nature 451, 1069-1075. [0406]
Morton, S., Hesson, L., Peggie, M., and Cohen, P. (2008). Enhanced
binding of TBK 1 by an optineurin mutant that causes a familial
form of primary open angle glaucoma. FEBS Lett 382, 997-1002.
[0407] Munz, C. (2009). Enhancing immunity through autophagy. Annu
Rev Immunol 27, 423-449. [0408] Nakagawa, I., Amano, A., Mizushima,
N., Yamamoto, A., Yamaguchi, H., Kamimoto, T. Nara, A., Funao, J.,
Nakata, M., Tsuda, K., et al. (2004). Autophagy defends cells
against invading group A Streptococcus. Science 306, 1037-1040.
[0409] Nakahira, K., Haspel, J. A., Rathinam, V. A., Lee, S. J.,
Dolinay, T., Lam, H. C., Englert, J. A., Rabinovitch, M., Cemadas,
M., Kim, H. P., et al. (2010). Autophagy proteins regulate innate
immune responses by inhibiting the release of mitochondrial DNA
mediated by the NALP3 inflammasome. Nat Immunol. [0410] Nedjie, J.,
Aichinger, M., Emmerich, J., Mizushima, N., and Klein, L. (2008).
Autophagy in thymic epithelium shapes the T-cell repertoire and is
essential for tolerance, Nature 455, 396-400.
[0411] Olkkonen, V. M., Dupree, P., Killisch, I., Lutcke, A.,
Zerial, M., and Simons, K. (1993). Molecular cloning and
subcellular localization of three OTP-binding proteins of the rab
subfamily. J Cell Sci 106 (Pt 4), 1249-1261. [0412] Orvedahl, A.,
Alexander, D., Talloczy, A., Sun, Q., Wei, Y., Zhang, W., Burns,
D., Leib, D., and Levine, B. (2007). HSV-1 ICP34.5 Confers
Neurovirulence by Targeting the Beclin 1 Autophagy Protein. Cell
Host and Microbe 1, 23-35. [0413] Orvedahl, A., Macpherson, S.,
Sumpter, R., Jr., Talloczy, Z., Zou, Z., and Levine, B. (2010).
Autophagy Protects against Sindbis Virus Infection of the Central
Nervous System. Cell Host Microbe 7, 115-127. [0414] Osawa, T.,
Mizuno, Y., Fujita, Y., Takatama, M., Nakazato, Y., and Okamoto, K.
(2011). Optineurin in neurodegenerative diseases. Neuropathology:
official journal of the Japanese Society of Neuropathology. [0415]
Ou, Y. H., Torres, M., Ram, R., Formstecher, E., Roland, C., Cheng,
T., Bickken, R., Wurz, R., Tasker, A., Polverino, T., et al.
(2011). TBK1 Directly Engages Akt/PKB Survival Signaling to Support
Oncogenic Transformation. Mol Cell 41, 458-470. [0416] Paludan, C.,
Schmid, D., Landthaler, M., Vockerodt, M., Kube, D., Tuschl, T.,
and Munz, C. (2005). Endogenous MHC class II processing of a viral
nuclear antigen after autophagy. Science 307, 593-596. [0417]
Pankiv, S., Clausen, T. H., Lamark, T., Brech, A., Brunn, I. A.,
Outzen, H., Overvatn, A., Bjorkoy, G., and Johansen, T. (2007).
p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of
ubiquitinated protein aggregates by autophagy. J Biol Chem 282,
24131-24145. [0418] Perkins, N. D. (2007). Integrating
cell-signalling pathways with NF-kappa B and IKK function. Nature
reviews Molecular cell biology 8, 49-62. [0419] Ponpuak, M., Davis,
A. S., Roberts, E. A., Delgado, M. A., Dinkins, C., Zhao, Z.,
Virgin H. W. t. Kyei, G. B., Johansen, T., Vergne, I., et al.
(2010). Delivery of cytosolic components by autophagic adaptor
protein p62 endows autophagosomes with unique antimicrobial
properties. Immunity 32, 329-341. [0420] Ponpuak, M., Delgado, M.
A., Elmaoued, R. A., and Deretic, V. (2009). Monitoring autophagy
during Mycobacterium tuberculosis infection. Methods Enzymol 452,
345-361. [0421] Radtke, A. I., Delbridge, L. M., Balachandran, S.,
Barber, G. N., and O'Riordan, M. X. (2007). TBK1 protects vacuolar
integrity during intracellular bacterial infection. PLoS Pathog 3,
e29. [0422] Ravikumar, B., Imarisio, S., Sarkar, S., O'Kane, C J.,
and Rubinsztein, D. C. (2008). Rab5 modulates aggregation and
toxicity of mutant huntingtin through macroautophagy in cell and
fly models of Huntington disease. J Cell Sci 121, 1649-1660. [0423]
Richmond, A. (2002). Nf-kappa B, chemokine gene transcription and
tumour growth. Nature reviews Immunology 2, 664-674. [0424]
Roberts, E. A., and Deretic, V. (2008). Autophagic proteolysis of
long-lived proteins in nonliver cells. Methods Mol Biol 445,
111-117. [0425] Saitoh, T., and Akira, S. (2010). Regulation of
innate immune responses by autophagy-related proteins. J Cell Biol
189, 925-935. [0426] Saitoh, T., Fujita, N., Hayashi, T., Takahara,
K., Satoh, T., Lee, H., Matsunaga, K., Kageyama, S., Omori, H.,
Noda, T., et al. (2009). Atg9a controls dsDNA driven dynamic
translocation of STING and the innate immune response. Proc Natl
Acad Sci USA 106, 20842-20846. [0427] Sanjuan, M. A., Dillon, C.
P., Tait, S. W., Moshiach, S., Dorsey, F., Connell, S., Komatsu,
M., Tamaka, K., Cleveland, J. L., Withoff, S., et al. (2007).
Toll-like receptor signalling in macrophages links the autophagy
pathway to phagocytosis. Nature 450, 1253-1257. [0428] Sarkar, S.,
Perlstein, E. O., Imarisio, S., Pineau, S., Cordenier, A.,
Maglathlin, R. L., Webster, I. A., Lewis, T. A., O'Kane, C J.,
Schreiber, S. L., et al. (2007). Small molecules enhance autophagy
and reduce toxicity in Huntington's disease models. Nat Chem Biol
3, 331-338. [0429] Shen, R. R., and Hahn, W. C. (2011). Emerging
roles for the non-canonical IKKs in cancer. Oncogene 30, 631-641.
[0430] Shevechenko, A., Wilm, M., Vorm, O., and Mann, M. (1996).
Mass spectrometric sequencing of proteins silver-stained
polyacrylamide gels. Anal Chem 66, 850-858. [0431] Shi, C. S., and
Kehrl, J. H. (2010). TRAF6 and A20 regulate lysine 63-linked
ubiquitination of Beclin-1 to control TLR4-induced autophagy. Sci
Signal 3, ra42. [0432] Singh, S. B., Davis, A. S., Taylor, G. A.,
and Deretic, V. (2006). Human IRGM induces autophagy to eliminate
intracellular mycobacteria. Science 313, 1438-1441. [0433] Singh,
S. B., Omatowski, W., Vergne, I., Naylor, J., Delgado, M., Roberts,
E., Ponpuak, M., Master, S., Pilli, M., White, E., et al. (2010).
Human IRGM regulates autophagy and cell-autonomous immunity
functions through mitochondria. Nat Cell Biol 12, 1154-1165. [0434]
Stenmark, H. (2009). Rab GTPases as coordinators of vesicle
traffic. Nat Rev Mol Cell Biol JO, 513-525. [0435] Tang, D., Kang,
R., Livesey, K. M., Cheh, C. W., Farkas, A., Loughran, P., Hoppe,
G., Bianchi, M. E., Tracey, K. J., Zeh, H. J., 3rd, et al. (2010).
Endogenous HMGB1 regulates autophagy. J Cell Biol 190, 881-892.
[0436] Thurston, T. L., Ryzhakov, G., Bloor, S., von Muhlinen, N.,
and Randow, F. (2009). The TBK1 adaptor and autophagy receptor
NDP52 restricts the proliferation of ubiquitin-coated bacteria. Nat
Immunol 10, 1215-1221. [0437] Tooze, S. A., and Yoshimori, T.
(2010). The origin of the autophagosomal membrane. Nat Cell Biol
12, 831-835. [0438] Travassos, L. H., Carneiro, L. A., Ramjeet, M.,
Hussey, S., Kim, Y. G., Magalhaes, J. G., Yuan, L., Soares, F.,
Chea, E., Le Bourhis, L., et al. (2009). Nod1 and Nod2 direct
autophagy by recruiting ATG 16L1 to the plasma membrane at the site
of bacterial entry. Nat Immunol. [0439] Vergne, I., Roberts, E.,
Elmaoued, R. A., Tosch, V., Delgado, M. A., Proikas-Cezanne, T.,
Laporte, J., and Deretic, V. (2009). Control of autophagy
initiation by phosphoinositide 3-phosphatase Jumpy. Embo J 28,
2244-2258. [0440] von Muhlinen, N., Thurston, T., Ryzhakov, G.,
Bloor, S., and Randow, F. (2010). NDP52, a novel autophagy receptor
for ubiquitin-decorated cytosolic bacteria. Autophagy 6, 288-289.
[0441] Wild, P., Parhan, H., McEwan, D. G., Wagner, S., Rogov, V.
V., Brady, N. R., Richter, B., Korac, J., Waidmann, O., Choudhary,
C., et al. (2011). Phosphorylation of the autophagy receptor
optineurin restricts Salmonella growth. Science 333, 228-233.
[0442] Xu, Y., Jagannath, C., Liu, X. D., Sharafkhanch, A.,
Kolodziejska, K. E., and Eissa, N. T. (2007). Toll-like receptor 4
is a sensor for autophagy associated with innate immunity. Immunity
27, 135-144. [0443] Yang, Z., and Klionsky, D. J. (2010). Eaten
alive: a history of macroautophagy. Nat Cell Biol 12, 814-822.
[0444] Yano, T., Mita, S., Ohmori, H., Oshima, Y., Fujimoto, Y.,
Ueda, R., Takada, H., Goldman, W. E., Fukase, K., Silverman, N., et
al. (2008). Autophagic control of listeria through intracellular
innate immune recognition in drosophila Nat. Immunol. 9, 908-916.
[0445] Yoshikawa, Y., Ogawa, M., Hain, T., Yoshida, M., Fukumatsu,
M., Kim, M., Mimuro, H., Nakagawa, I., Yanagawa, T., Ishii, T., et
al., (2009). Listeria monocytogenes ActA-mediated escape from
autophagic recognition. Nat Cell Biol 11, 1233-1240. [0446] Zhong,
Y., Wang, Q. J., Li, X., Yan, Y., Backer, J. M., Chait, B. T.,
Heintz, N., and Yue, Z. (2009). Distinct regulation of autophagic
activity by Atg14L and Rubicon associated with Beclin
1-phosphatidylinositol-3-kinase complex. Nat Cell Biol. [0447]
Zhou, R., Yazdi, A. S., Menu, P., and Tschopp. J. (2011). A role
for mitochondria in NLRP3 inflammasome activation. Nature 459,
221-225.
EXAMPLE 3
Autophagy-Based Unconventional Secretory Pathway for Extracellular
Delivery of IL-1 b
[0448] Here, we have addressed the question of whether autophagy
plays a direct role in inflammasome and IL-1p activation and
secretion. We found that, whereas basal autophagy inhibits IL-1b
secretion in concordance with the recent reports (Nakahira et al.,
2010; Zhou et al. 2011), induced autophagy augments IL-1b
secretion. We show that inflammasome and the autophagy apparatus
synergize during IL-1p secretion in cells stimulated to undergo
autophagy. We also show that autophagy induction cooperates with
GRASP and Rab8a (A GTPase controlling post-Golgi polarized sorting
and exocytosis) in driving IL-1P secretion. We, thus, define one of
the first biogenesis functions of autophagy in mammalian cells and
show that at least one type of unconventional secretion utilizes
autophagic machinery in higher vertebrate cells.
Results
Induction of Autophagy Promotes Inflammosome Dependent IL-
Secretion
[0449] Whereas it has been found that basal autophagy reduces
extracellular release of the major proinflammatory cytokine IL-1P
(Nakahira et al., 2010; Zhou et al., 2011), we detected the
opposite when autophagy was induced in primary murine bone
marrow-derived macrophages (BMMs; FIG. 1). Stimulation of autophagy
by starvation strongly enhanced IL-1P secretion in response to
convention NLRP3 (NALP3) inflammasome agonist nigericin (FIG.
1X3A). This effect was also seen (FIG. 1B) in western blots of
caspase 1 and mature IL-1P of culture supernatants from cells grown
in the absence of serum, as conventionally done when assessing
IL-1P secretion by immunoblotting (Martinon et al., 2006). A
reduced secretion in BMMs from Atg.sup.5fl/fl LyzM-Crep mice,
compared with BMMs from their Cre- littermates, was accompanied and
contrasted by the higher level of cell-associated pro-IL-1p in Cre-
versus Cre+ BMMs (FIG. 1X3B). The BMMs derived from Atg.sup.5fl/fl
LyzM-Cre+ mice for these and other experiments has, as expected, no
detectable Atg5 (since the Atg5 gene is excised in Cre+
macrophages; Zhao et al, 2008) and LC3-II, a key marker of
autophagy (Supplementary Figure S1AX3). The effects of induced
autophagy on secretion of inflammasome substrates described above
were not limited to IL-1b, since secretion of another
inflammasome-dependent cytokine from the IL-1 family, IL-18
(IL-1F4), was enhanced when autophagy was induced (FIG. 1X3C).
Pharmacological induction of autophagy by mTOR inhibition with
pp242 (Torkinib) increased secretion of IL-1P by BMMs
(Supplementary Figure S1BX3). An enhancement of IL-1P secretion
upon induction of autophagy was also detected when particulate
inflammasome agonists, alum (Eisenbarth et al., 2008; FIG. 1D;
Supplementary Figure S1CX3), silica FIG. 1E; Hornung et al, 2008),
and amyloid-b fibrils (Halle et al, 2008; Supplementary Figure
S1DX3), were used as inflammasome inducers. The enhancement of
IL-1p secretion associated with autophagy induction was
inflammasome dependent, as IL-1p activation was diminished by
knockdowns of the inflammasome components ASC and NLRP3, regardless
of whether the inflammasome agonist used was nigericin or silica
(FIG. 1F-HX3). The knockdowns of ASC and NLRP3 did not change IL-1P
expression (Supplementary Figure S1E and F). The increased
secretion of IL-1p was not due to the increased cell death or
nonspecific membrane permeability as LDH release showed a kinetic
lag behind release of IL-1p whether the inflammasome agonist used
was nigericin or silica (Supplementary Figure S2A-DX3). The
stimulation of autophagy promoted IL-1p secretion in an
Atg5-dependent manner, based on comparisons between BMMs from
Atg.sup.5fl/fl-LyzM-Crep mice and BMMs from their Atg5-competent
(Atg.sup.5fl/fl Cre-) littermates (FIG. 1AX3). However, the loss
was not complete in Crep BMMs (FIG. 1AX3). We interpret the
incomplete reduction in IL-1P secretion in the absence of Atg5 as a
net result of two opposing effects--one described here as a product
of positive contribution of induced autophagy on extracellular
delivery of IL-1p and the other being the recently reported
negative regulation of IL-1P secretion by basal autophagy (Nakahira
et al. 2010; Harris et al. 2011; Zhou et al. 2011). In keeping with
this interpretation and in contrast to the stimulatory effects of
induced autophagy (FIG. 1A-EX3; Supplementary Figure S1B-DX3),
basal autophagy negatively affected IL-1P and IL-18 secretion
(Supplementary FIG. 2SE and FX3) in agreement with the recent
reports in cells not induced for autophagy (Nakahira et al, 2010;
Harris et al, 2011; Zhou et al, 2011).
IL-1/J and Autophagic Protein LC3 Colocalize in the Cytoplasm
[0450] How might induced autophagy enhance IL-1P secretion? We
considered a model in which autophagy, as a process that can
translocate cytosolic proteins and other targets (en masse or
specific components) from the cytosol to the inside of vesicular
compartments, brought IL-1P into the lumen of autophagic vacuoles
followed by exocytosis. When we examined IL-1p and the key marker
of autophagosomes LC3 by immunofluorescence confocal microscopy,
LC3 and IL-1p colocalized and displayed major similarities in the
overall intracellular organellar distribution (FIG. 11-LX3). The
overlap between IL-1P and LC3 remained detectable when cells were
treated with nigericin (Supplementary Figure S3Z-CX3). These
observations indicate that autophagic organelles and IL-P
intersect.
Inhibition of Autophagy flux Reduces IL-1/J Secretion
[0451] A question arose whether the LC3+ organelles containing
IL-1P are on pathway to degradation or facilitated IL-1P secretion.
We first tested the effects of bafilomycin A1, a conventional
inhibitor of autophagic maturation, which acts as an antagonist of
vacuolar H+ ATPase and prevents lumenal acidification and
autophagosomal cargo degradation. If induction of autophagy acted
to degrade IL-1P, then bafilomycin A1 was expected to increase
IL-1p levels. Instead, bafilomycin A 1 decreased IL-1p secretion in
cells stimulated for autophagy by starvation, whereas no change was
observed with bafilomycin A1 in cells undergoing basal autophagy
only (FIG. 2AX3).
[0452] Thus, autophagy flux during autophagy induction was not
inhibitory to IL-1P but was instead promoting IL-1p secretion. A
similar trend was detected with another inflammasome substrate
IL-18 (FIG. 2BX3). Equivalent relationships have been observed for
IL-1P secretion whether nigericin (FIG. 2AX3) or silica (FIG. 2CX3)
was used as inflammasome agonists. The absence of IL-1P or IL-18
sparing effects of bafilomycin A1 is in keeping with the
interpretation that autophagy is not degrading inflammasome
components but that an unobstructed autophagy pathway is necessary
for inflammasome-dependent IL-1 family members secretion.
Lysosomal Hydrolase Cathepsin B is a Positive Factor in
Autophagy-Driven IL-JP Secretion
[0453] Next, we investigated the role of lysosomal hydrolases,
focusing on cathepsin B. We observed that IL-1P and LC3 colocalized
with cathepsin B (FIG. 2DX3 and FIG. 2EX3). However, cathepsin B
did not play an inhibitory role. Similarly to bafilomycin A1,
cathepsin B inhibitor CA-074 Me suppressed IL-1p production.
Instead of protecting IL-1P from potential degradation. CA-074 Me
strongly inhibited IL-1p secretion in cells stimulated for
autophagy by starvation (FIG. 2FX3). No differences in expression
of pro-IL-1P were observed in cells treated with bafilomycin A1 or
CA-074 Me (Supplementary Figure S3DX3). Of further interest was
that cathepsin B (mature form) was secreted along with the
inflammasome substrates in a manner dependent on an intact
autophagic apparatus loss of Atg5 in BMMs from Crep mice
(Atg.sup.5fl/fl LyzM-Cre) diminished the levels of the secreted
mature cathepsin B relative to BMMs from Cre.sub.- littermates
(FIG. 2G). The findings with cathepsin B inhibitor CA-074 Me
indicate a positive role for cathepsin B in IL-1p activation and
autophagy-driven pathway of extracellular delivery of IL-1b. They
can also help explain in part the observations that a lysosomal
hydrolase, cathepsin B, assists in inflammasome activation and
IL-1p secretion in response to particulate inflammasome agonists
(Halle et al, 2008; Hornung et al, 2008).
Rab8a, a Regulator of Polarized Sorting to Plasma Membrane
Colocalizes with IL-JP and LC3 and Controls IL-JP Secretion
[0454] We next addressed the features of the compartment where LC3
and IL-1P colocalized. We observed an overlap between the LC3+
IL-1b+ profiles and Rab8a (FIG. 3A-CS3). Rab8a is a regulator of
polarized membrane trafficking constitutive biosynthetic
trafficking, and plasma membrane fusion of insulin-responsive (Sun
et al, 2010) and other vesicular carriers (Moritz et al, 2001;
Bravo-Cordero et al. 2007; Nachury et al, 2007; Bryant et al,
2010). Rab8 a also colocalized with LC3 and IL-1p in cells exposed
to nigericin (Supplementary Figure S4A-CS3). Rab8a was required for
enhanced IL-1P secretion caused by starvation-induced autophagy and
inflammasome activation with nigericin, since siRNA knockdown of
Reb8a diminished IL-1P secretion from BMMs under these conditions
(FIG. 3DX3) and (FIG. 3EX3). Rab8a knockdown did not change
pro-IL-1P mRNA levels (Supplementary Figure S4DX3). Overexpression
of dominant negative Rab8a mutant (S22N) inhibited IL-1P secretion
from RAW264.7 cells, employed in that experiment based on their
high efficiency of transfection (FIG. 3FX3) (verified by flow
cytometry of GFP-Rab8a for equal yields). Additionally, LC3+ IL-1b+
profiles were positive for subunits of the exocyst complex
(Supplementary Figure S4E-JX3). Exocyst has been shown to cooperate
with Rab8a in polarized plasma membrane delivery of vascular
carriers (Mazelova et al, 2009; Bryant et al, 2010). The presence
of exocyst components on IL-1b+ autophagic organelles was also in
keeping with a recent report implicating exocyst in autophagy
(Bodemann et al, 2011). In summary, these experiments indicate that
systems involved in vectorial vesicular transport to the plasma
membrane participate in autophagy-based unconventional secretion
and that Rab8a is required for efficient autophagy-dependent
secretion of IL-1p.
GRASP5 Controls Secretion of IL-1/J
[0455] Two studies in yeast (Duran et al, 2010; Manjithaya et al,
2010) have reported that autophagic machinery is required for
unconventional secretion of the protein Acb1, and that this pathway
depends on the yeast equivalent of a Golgi-associated protein GRASP
in mammals (Kinseth et al, 2007; Nickel and Rabouille, 2009).
Mammalian cells encode two GRASP paralogues, GRASP5 (GORASP2) and
GRASP65 (GORASP1) (Barr et al, 1997; Shorter et al, 1999). We first
tested whether any of the mammalian GRASPs were required for IL-1P
secretion. We could not obtain a good knockdown of GRASP65
(GORASP1) and thus could not evaluate its involvement. However, a
knockdown of GRASP55 diminished IL-1P secretion (FIG. 4AX3;
Supplementary Figure S5AX3). A similar downregulation of IL-18
secretion was observed with GRASP55 knockdown (Supplementary Figure
S5BX3). We next tested whether GRASP55 showed any detectable
response to inflammasome stimulation. GRASP55 in resting cells is
mostly localized aligned within the perinuclear Golgi (FIG. 4BX3;
Supplementary Figure S6AX3). However, a fraction of it dispersed
upon treatment of cells with the inflammasome agonist nigericin
(Figure S6BX3) and was found juxtaposed and partially overlapping
with LC3 profiles (FIGS. 4B and C). Thus, GRASP55 responds to
inflammasome stimulation and is important for secretion of the
inflammasome substrates IL-1 and IL18.
GRASP55 Controls Autophagy Imitation
[0456] In addition to being required for IL-1 secretion, GRASP55
showed functional effects on LC3 and autophagy, tested by employing
two core assays (Mizushima et al, 2010): LC3-II lipidation and the
RFP-GFP-LC3 tandem probe. When GRASP55 was knocked down, autophagy
initiation was negatively affected as LC3-II levels were lower in
both untreated and bafilomycin A1-treated cells (FIGS. 5AX3 and
BX3). A partial downregulation of GRASP65 (to the extent that it
could be achieved in BMMs) suggested a minor synergistic effect
with GRASP55 on LC3-II levels upon induction of autophagy
(Supplementary Figure S5CS3). Knocking down GRASP55 reduced the
total number of autophagic puncta, and selectively reduced the
formation of autophagosomes but not their maturation (FIGS. 5CS3
and DX3). This was apparent from the data obtained with the
RFP-GFP-LC3 probe following published methods (Kimura et al, 2007),
which showed reduced GFP+RFP+LC3 profiles (early autophagosome) and
equal number of GFP LC3 profiles (mature autophagic organelles) in
cells knocked down for GRASP55 (FIG. 5DX3). Thus, mammalian
GRASP55, a paralogue of GRASP from lower organisms that has thus
far been the sole definitive molecular factor associated with
unconventional secretion (Giuliani et al, 2011), displays important
and previously unappreciated positive regulatory effects on
autophagy induction. These findings strengthen the connections
between autophagy and GRASPs in general, and specifically
demonstrate the role of mammalian GRASP55 both in autophagy
substrates such as IL-1 and IL-18
Autophagy-Based Unconventional Secretion is Not Limited to
Proteolytically Processed Inflammasome Substrates
[0457] We next wondered whether the unconventional process
described above is limited to inflammasome substrates epitomized by
IL-1 that are concomitantly with their secretion proteolytically
processed from precursor pro-proteins into mature forms. We tested
whether induction of autophagy affected other proteins not
connected to proteolytic process sing in the inflammasome, such as
HMGB 1 (high mobility group box 1 protein). HMGB 1 is a major
proinflammatory alarmin or DAMP (damage-associated molecular
pattern) normally present in the nucleus (Andersson and Tracey,
2011). This chromatin-associated nuclear protein (with additional
intracellular and extracellular signaling roles), upon exposure to
inputs including those that induce autophagy (Singh et al, 2010;
Tang et al, 2010), undergoes a complex set of biochemical and
localization changes. In the process, it first translocates from
the nucleus into the cytoplasm and then is released from the
cytoplasm to act in tissue remodeling signaling (when acting alone)
or as an inflammatory mediator (when combined with bacterial
agonists or other alarmins such as IL-). When tested, starvation
and nigericin co-treatment caused HMGB1 extracellular release in an
Atg5-dependent manner (FIG. 6AX3). HMGB1 band was detected by
immunoblots in BMMs culture supernatants upon stimulation of cells
with nigericin, whereas HMGB 1 was largely diminished when BMMs
from Atg5fl/fl Cre-LyzM mice were tested (FIG. 6BX3). Nigericin was
used in these experiments as an inflammasome agonist based on the
reports that HMGB1, along with additional unconventional
substrates, depends on inflammasome for secretion although the
protein itself is not subjected to proteolytic processing by
caspase 1 (Keller et al, 2008; Willingham et al, 2009; Lamkanfi et
al, 2010; Lamkanfi, 2011). These experiments show that
autophagy-based unconventional secretion affects release of HMGB 1
in a manner similar to IL-. Our findings broaden the spectrum of
autophagy-based unconventional secretion substrates, and establish
this type of unconventional secretion as a more general process in
extracellular delivery of cytosolic proteins.
Discussion
[0458] The data presented in this work outline several elements of
the autophagy-based unconventional secretory pathway in mammalian
cells. This type of unconventional secretion is shown here to
support the extracellular delivery of inflammasome substrates, in
particular, IL-1f3 and IL-18 and may potentially have a broader
number of clients. A relevant aspect of the process described here
is that induction of autophagy is required to observe the
manifestations of this type of unconventional secretion. Since
basal autophagy suppresses spurious induction of inflammasome
(Nakahira et al, 2010; Zhou et al. 2011), autophagy provides both
avoidance of unscheduled inflammasome activation and a platform for
extracellular delivery of inflammasome substrates. Since a number
of hormones, cytokines, pathogen associated molecular patterns, and
danger-associated molecular patterns (Tang et al, 2010; Deretic,
2011) are known to induce or inhibit autophagy, a link between
autophagy and secretion of major immunomodulatory cytokines such as
IL- could significantly influence the extent and duration of
inflammation. Connections between metabolic syndrome, high fat
diet, and inflammasome activity are now beginning to be appreciated
(Vandanmagsar et al. 2011; Wen et al, 2011), and we propose that
autophagy-based unconventional secretion may be a key coupler
between the metabolism and inflammation.
[0459] Since a number of genetic links have been found between
autophagy and idiopathic inflammatory diseases or infectious
diseases with significant inflammatory components (Levine et al,
2011), it is possible that at least in part the genetic
associations between autophagy risk loci and disease states may
stem from altered autophagy-based unconventional secretion of
inflammatory cytokines. The role of autophagy was represented here
by the effects of induction of autophagy and by employing
conditional knockout mice with a loss of Atg5 in macrophages. We
interpret the incomplete inhibition of IL-1P secretion upon
cre-dependent Atg.sup.5fl/fl exercision as a result of the
composite effects of Atg5-dependent basal autophagy (inhibitory)
(Zhou et al, 2011) and induced autophagy (stimulatory) although we
cannot exclude the possibility of slight leakiness of the
Atg.sup.5fl/fl LyzM-Cre system or the existence of additional
pathways. Importantly, blocking autophagic maturation has not
salvaged IL-1p but rather inhibited its secretion. This appears to
be in contrast to what has been reported for Acb1 in yeast
(Manjithaya et al, 2010). Moreover, cathepsin B activity was
needed, suggesting that autophagic organelles here did not function
as mere cargo carriers but provided a platform for activation of
inflammasome and IL-1b. In keeping with these observations,
cathepsin B have been implicated in inflammasome activation in
response to particulate inflammasome agonists (Halle et al, 2008;
Hornung et al, 2008), such as those (alum, amyloid-b) used here in
addition to nigericin, but now the substrate and cathepsin B meet
has hitherto not been defined. Our data indicate that induction of
autophagy enhances assembly of inflammasome-activating components
and suggest that autophagic organelles may be a platform for
concentration of components engaged in proteolytic activation of
inflammasome components and inflammasome substrates. In keeping
with this model of a muster station for inflammasome components,
activation and subsequent extracellular delivery, is the
translocation of pro-IL-1P to membranous organelles upon
stimulation with the inflammasome agonist nigericin, as previously
observed by Sitia and colleagues (Rubartelli et al, 1990) who have
established early on that this process does not follow the
conventional secretory pathway. The autophagy-based unconventional
secretion pathway in mammalian cells includes GRASP, one of the
peripheral Golgi proteins involved in lateral organization of Golgi
ribbons. Although the role of GRASP in alternative secretory
pathway has been studied, its exact mechanism of action has not
been elucidated (Kinseth et al, 2007; Nickel and Rabouille, 2009).
We observed here a potentially telling connection between GRASP and
autophagy, by showing that GRASP affects autophagy induction, which
places GRASP upstream of autophagy execution, including the
conjugation systems involved in LC3 lipidation. The response of
GRASP to nigericin stimulation in terms of its redistributions and
juxtaposition to autophagic organelles further links autophagy,
inflammasome, and GRASP, although alternative explanations are
possible. The finding that Rab8a plays a functional role in
autophagy-based unconventional secretions of significance not just
by assigning a trafficking regulator to this pathway but also by
providing additional links with exocyst components, implicated to
cooperate with Rab8a in other systems (Mazelova et al, 2009; Bryant
et al, 2010) and to play a role in autophagy (Bodemann et al,
2011).
[0460] In summary, in this study we have uncovered the role of
autophagy in the secretion of cytosolic proinflammatory factors
that cannot enter the conventional biosynthetic pathway due to the
absence of leader peptides that would bring them into the ER and
the organelles of the canonical secretory pathway. Both cytosolic
IL-1p and IL-18 are processed from their precursor proteins into
their active forms via the inflammasome apparatus (Davis et al,
2011; Lamkanfi, 2011); however, the process that delivers the
proteolytically activated IL-1p and IL-18 to the extracellular
environment has hitherto remained unclear. To be eligible for
export outside of the cell without invoking a pore mechanism,
cytosolic proteins first need to be brought somehow into the lumen
of vesicular carriers, as previously shown by others (Rubartelli et
al, 1990). We have elsewhere noted (Deretic, 2005, 2011) that
autophagy is a bulk topological inverter for cytosolic proteins and
other molecules, ferrying them from the cytosol into the organellar
lumen. We now show that induction of autophagy does that with IL-1p
in the process of its secretion. In doing so, autophagic machinery
cooperates with the Golgi associated factor GRASP and post-Golgi
membrane trafficking and exocytosis regulator Rab8a. Autophagy
captures cytosolic IL-1p and brings IL-1p into the organelles of a
specialized unconventional secretory pathway. Broadening the scope
of autophagy-based alternative secretion pathway is the observation
that it facilitates exit from cells of the alarmin HMGB 1, HMGB 1
is a DAMP that is actively released from immune cells unlike its
passive release from several cell types secondary to cell death
(Andersson and Tracey, 2011). It has been recently shown that
inflammasome, rather unexpectedly given that HMGB 1 is not a known
substrate for caspase-1 processing, plays a role in HMGB 1 release
(Lamkanfi et al, 2010). One explanation that can be offered based
on our studies is that a role of inflammasome may not be related
solely to proteolytic substrate processing but that it may be
hardwired into the secretory pathway studied here. This is in
keeping with the requirement for NLRP3 and ASC and not the caspase
1 activity for HMGB 1 release as a recently recognized
non-canonical inflammasome client (Willingham et al, 2009). We
propose here that autophagy-based unconventional secretion may be
used for extracellular delivery of a spectrum of cytosolic proteins
or processed cytoplasmic substrates, not restricted to the proteins
explored here, and possibly including other biological mediators
such as the recently discovered cryptides (Deretic, 2005; Ponpuak
et al, 2010). A recent study that appeared while this work was in
revision suggests that an unconventional secretion process, also
dependent on GRASP and autophagic machinery may facilitate plasma
membrane delivery of mutant CFTR, potentially expanding the range
of substrates to integral membrane proteins (Gee et al, 2011).
Given the capacity for either bulk transport or selectivity when
coupled with autophagic adaptors, we predict that autophagy-based
unconventional secretion serves a potential broad spectrum of yet
to be uncovered physiological functions.
Materials and Methods
Macrophages
[0461] Murine BMM cells were prepared from femurs of C57/BL6 mice,
Atg.sup.5fl/fl LyzM-Cre mice (Zhao et al, 2008) and their
Cre-negative Atg5fl/fl littermates, and GFP-LC3 transgene knock-in
mice (Mizushima et al, 2004) as previously described (Ponpuak et
al, 2010). RAW 264.7 macrophages were maintained and manipulated as
previously described (Ponpuak et al, 2010).
Pharmacological Agonists, Inhibitors, Inflammasome, and
Autophagy
[0462] To include pro-IL-1p expression, cells were pretreated
overnight with 100 ng/ml LPS (Sigma). Inflammasome was induced with
20 mM nigericin (Sigma) for 1 h or with 250 mg/ml Alum
(Thermoscientific) for 1 h or with 250 mg/ml silica crystals
(MIN-U-SIL-15, US Silica) for 1 h or with 5 mM Amyloid-b peptide
(Ab; American Peptide Company) fibrils prepared as described (Moore
et al, 2002). Cells were treated with 100 nM bafilomycin A1 (LC
Laboratories) or 10 mM cathepsin B inhibitor (CA-074 Me) (Enzo Life
Science). Autophagy was induced for 1 h by starvation in EBSS or
with pp242 in full medium (Torkinib, Chemidea). Starvation and
other treatments (except for macrophage priming with LPS done in
advance) were carried out concurrently (i.e., initiated at the same
time).
Transfections and siRNA Knockdowns
[0463] BMM and RAW 264.7 cells were transfected by nucleoporation
using Nucleofector Reagent Kit V or Kit Mouse Macrophage
(Amaxa/Lonza Biosystems). For murine NLRP3, ASC, Rab8 a or GRASP
knockdowns, cells were transfected with siGENOME SMARTpool reagents
(Dharmacon). Rab8 a SMARTpool (GAAUAAG UGUGAUGUGAAU;
GAAGACCUGUGUCCUGUUC; GACCUACGAUU ACCUGUUC; GAGCAGCCAUGGAGUCAAG),
ASC SMARTpool (AUACAUCCCUACUUGGUGA; GCUUAGAGACAUGGGCUUA;
GCAACUGCGAGAAGGCUAU; CUGCAAACAGACUAAAGAAG), NLRP3 SMARTpool
(GUUCUUCGCUGCUAUGUAC; GCACCAGGCUGUAACAUU; UGA AGGACCCACAGUGUAA;
UCACAUUCCUCUAUGGUAU), GORASP1SMARTpool (CAUGAAGGUGCGCGAGGUA;
CAGAGGACAUUGGUUCUAG; ACUCGAGGUGAACAAGGA; GCUACGACCUCACAACUUA), and
GORASP2 SMARTpool (GAAGACCUGUUCAGCCUUA; UACCAAGUCUGAUGCCUUU;
GUAAACCAGUCCCUUGCUU; GAUCAUCACACCAACUCU). Non-targeting siRNA pool
(Scrambled) was used as a control. Plasmid encoding tandem
RFP-GFP-LC3 fusion for quantification of autophagic maturation was
from T Yoshimori (Osaka, Japan). Plasmids encoding Rab8a wt (wild
type and Rab8a S22 N were from Johan Peranen (University of
Helsinki, Finland).
Antibodies, Immunoblotting, Detection Assays, and Microscopy
[0464] Cells extracts were analysed by standard immunoblot
techniques with antibodies to pro-IL-1P (Abcam), NLRP3 (AdipoGen),
ASC (Enzo Life Sciences), LC3 (Sigma), GRASP65 (Novus), GRASP55
(Abcam), Rab8a (Abcam), and Actin (Sigma); staining was revealed
with Super Signal West Dura chemiluminescent substrate (Pierce).
For all conditions, cell-free supernatants were assayed by
immunoblotting after TCA precipitation for mouse IL-1P pl 7
(R&D), caspase-1 plO (Santa Cruz Biotechnology), HMGB1 (Abcam)
and Cathepsin B (R&D) or by ELISA for mouse IL-1p (R&D),
IL-18 (MBL), and HMGB1 (IBL). Immunofluorescence confocal
microscopy was carried out using a Zeiss LSM 510 Meta microscope
(laser wavelengths 488, 543, and 633 nm). Antibodies against
endogenous proteins IL-1P (Abcam), Sec6 (Shu C Hsu, Rutgers
University, NJ, USA), Cathepsin B (R&D), Rab8a (Abcam), GORASP1
(Novus), GORASP2 (Protein Tech Group). GM130 (BD), LC3 (MBL) and
GFP (Abcam: for BMMs from GFP-LC3 knock-in transgenic mice) were
used for indirect immunofluorescence analysis. Pearson's
colocalization coefficients were derived using SLIDEBOOK 5.0
(Intelligent Imaging Innovations) applying the SLIDEBOOK 5 default
algorithm command `AND`. All Pearson's coefficients were derived
from three completely independent experiments with five fields or
more per experiment, for a total of X15 fields contributing to the
cumulative result.
Statistics
[0465] All data were analysed using two-tailed unpaired Student's
t-tests. All experiments were performed at least three times, with
data representing mean values.+-.s.d. (standard derivation).
References for Example 3
[0466] Alavez S. Vantipalli M C. Zucker D J. Klang I M, Lithgow G J
(2011) Amyloid-binding compounds maintain protein homeostasis
during ageing and extend lifespan. Nature 472: 226-229 [0467]
Andersson U, Tracey K J (2011) HMGB 1 is a therapeutic target for
sterile inflammation and infection. Annu Rev Immunol 29: 139-162
[0468] Barr F A, Puype M, Vanderkerekhove J, Warren G (1997)
GRASP65, a protein involved in the stacking of Golgi cisternae.
Cell 91:253-262 [0469] Bodemann B O, Orvedahl A, Cheng T, Ram R R,
Ou Y H, Formstecher E, Maiti M, Hazelett C C, Wauson E M,
Balakireva M, Camonis J H, Yeaman C, Levine B, White M A (2011)
RalB and the exocyst mediate the cellular starvation response by
direct activation of autophagosome assembly. Cell 144: 253-267
[0470] Bravo-Cordero J J, Marrero-Diaz R, Megias D, Genis L,
Garcia-Grande A, Garcia M A, Arroyo A G, Montoya M C (2007) MTI-MMP
proinvasive activity is regulated by a novel Rab8-dependent
exocytic pathway. EMBO J 26: 1499-1510 [0471] Bryant D M, Datta A,
Rodriguez-Fraticelli A E, Peranen J, Martin-Belmonte F, Mostov K E
(2010) A molecular network for de novo generation of the apical
surface and lumen. Nat Cell Biol 12: 1035-1045 [0472] Davis B K,
Wen H, Ting J P (2011) The inflammasome NLRs in immunity,
inflammation, and associated diseases, Annu Rev Immunol 29: 707-735
[0473] Deretic V (2005) Autophagy in innate and adaptive immunity.
Trends Immunol 26: 523-528 [0474] Deretic V (2011) Autophagy in
immunity and cell-autonomous defense against intracellular
microbes. Immunol Rev. 240: 92-104 [0475] Deretic V, Levine B
(2009) Autophagy, immunity and microbial adaptations. Cell Host
Microbe 5: 527-549 [0476] Dou Z, Chattopadhyay M, Pan J A,
Guerriero J L, Jian Y P, Ballou L M, Yue Z, Lin R Z, Zong W X
(2010) The class IA phosphatidylinositol 3-kinase p 110-beta
subunit is a positive regulator of autophagy. J Cell Biol 191:
827-843 [0477] Duran J M, Anjard C, Stefan C, Loomis W F, Malhotra
V (2010) Unconventional secretion of Acb1 is mediated by
autophagosomes. J Cell Biol 188: 527-536 [0478] Egan D F,
Shackelford D B, Mihaylova M M, Gelino S, Kohnz R A, Mair W,
Vasquez D S, Joshi A, Gwinn D M, Taylor R, Asara J M, Fitzpatrick
J, Dillin A, Viollet B, Kundu M, Hansen M, Shaw R J (2011)
Phosphorylation of ULK 1 (hATG1) by AMP activated protein kinase
connects energy sensing to mitophagy. Science 331: 456-461 [0479]
Eisenbarth S C, Colegio O R, O OConnor W, Sutterwals F S, Flavell R
A (2008) Crucial role for the Nalp3 inflammasome in the
immunostimulatory properties of aluminium adjuvants. Nature 453:
1122-1126 [0480] Ezaki J, Matsumoto N, Takeda-Ezaki M, Komatsu M,
Takahashi K, Hiraoka Y, Taka H, Fujimura T, Takehana K, Yoshida M,
Iwata J, Tanida I, Furuya N, Zheng D M, Tada N, Tanaka K, Kominami
E, Ueno T (2011) Liver autophagy contributes to the maintenance of
blood glucose and amino acid levels. Autophagy 7: 727-736 [0481]
Gee H Y, Noh S H, Tang B L, Kim K H, Lee M G (2011) Rescue of
DeltaF508-CFTR trafficking via a GRASP-dependent unconventional
secretion pathway. Cell 146: 746-760 [0482] Giuliani F, Grieve A,
Rabouille C (2011) Unconventional secretion: a stress on GRASP.
Curr Opin Cell Biol 23: 498-504 [0483] Gonzalez C D, Lee M S,
Marchetti P, Pietropaolo M, Towns R, Vaccaro M I, Watada H, Wiley J
W (2011) The emerging role of autophagy in the pathophysiology of
diabetes mellitus. Autophagy 7: 2-11 [0484] Guo J Y, Chen H Y,
Mathew R, Fan J, Strohecker A M, Karsli-Uzunbas G, Kamphorst J J,
Chen G, Lemons J M, Karantza V, Coller H A, Diapola R S, Gelinas C,
Rabinowitz J D, White E (2011) Activated Ras requires autophagy to
maintain oxidative metabolism and tumorigenesis. Genes Dev 25:
460-470 [0485] Halle A. Hornung V, Petzold G C, Stewart C R, Monks
B G, Reinheckel T, Fitzgerald K A, Latz E, Moore K J, Golenbock D T
(2008) The NALP3 inflammasome is involved in the innate immune
response to amyloid-beta. Nat Immunol 9: 857-865 [0486] Harris J,
Hartman M, Roche C, Zeng S G, O OShea A, Sharp F A, Lambe E M,
Creagh E M, Golenbock D T, Tschopp J, Kornfeld J, Fitzgerald K A,
Lavelle E C (2011) Autophagy controls IL-1 {beta} secretion by
targeting pro-IL1 {beta} for degradation. J Biol Chem 286:
9587-9597 [0487] He C, Levine B (2010) The Beclin 1 interactome.
Curr Opin Cell Biol 22: 140-149 [0488] Hornung V, Bauernfeind F,
Halle A, Samstad E O, Kono H, Rock K L, Fitzgerald K A, Latz E
(2008) Silica crystals and aluminum salts activate the NALP3
inflammasome through phagosomal destabilization. Nat Immunol 9:
847-856 [0489] Itakura E, Mizushima N (2011) p62 Targeting to the
autophagosome formation site requires self-oligomerization but not
LC3 binding. J Cell Biol 192: 17-27 [0490] Johansen T, Lamark T
(2011) Selective autophagy mediated by autophagic adapter proteins.
Autophagy 7: 279-296 [0491] Keller M, Ruegg A, Werner S, Beer H D
(2008) Active caspase-1 is a regulator of unconventional protein
secretion. Cell 132: 818-831 [0492] Kihara A, Kabeya Y, Ohsumi Y,
Yoshimori T (2001) Beclin-phosphatidylinositol 3-kinase complex
functions at the trans-Golgi network. EMBO Rep 2: 330-335 [0493]
Kim J, Kundu M, Viollet B, Guan K L (2011) AMPK and mTOR regulate
autophagy through direct phosphorylation of Ulk 1 Nat Cell Biol 12:
132-141 [0494] Kimura S, Noda T, Yoshimori T (2007) Dissection of
the autophagosome maturation process by a novel reporter protein,
tandem fluorescent-tagged LC3. Autophagy 3: 452-460 [0495] Kinseth
M A, Anjard C, Fuller D, Guizzunti G, Loomis W F, Malhotra V (2007)
The Golgi-associated protein GRASP is required for unconventional
protein secretin during development. Cell 130: 524-534 [0496]
Kroemer G, Levine B (2008) Autophagic cell death: the story of a
misnomer. Nat Rev Mol Cell Biol 9: 1004-1010 [0497] Droemer G,
Marino G, Levine B (2010) Autophagy and the integrated stress
response. Mol Cell 40: 280-293 [0498] Lamkanfi M (2011) Emerging
inflammasome effector mechanisms. Nat Rev Immunol 11: 213-220
[0499] Lamkanfi M, Sarkar A, Vande Walle I, Vitari A C, Amer A O,
Wewers M D, Tracey K J, Kanneganti T D, Dixit V M (2010)
Inflammasome dependent release of the alarmin HMGB 1 in
endotoxemia. J Immunol 185: 4385-4392 [0500] Levine B, Mizushima N,
Virgin H W (2011) Autophagy immunity and inflammation. Nature 469:
323-335 [0501] Manjithaya R, Anjard C, Loomis W F, Subramani S
(2010) Unconventional secretion of Pichia pastoris Acb 1 is
dependent on GRASP protein, peroxisomal functions, and
autophagosome formation. J Cell Biol 188: 537-546 [0502] Martinon
F, Petrilli V, Mayor A, Tardivel A, Tschopp J (2006) Gout
associated uric acid crystals activate the NALP3 inflammasome.
Nature 440: 237-241 [0503] Mazelova J, Ransom N, Astuto-Gribble L,
Wilson M C, Deretic D (2009) Syntaxin 3 and SNAP-25 pairing,
regulated by omega-3 docosahexaenoic acid, controls the delivery of
rhodopsin for the biogenesis of cilia-derived sensory organelles,
the rod outer segments. J Cell Sci 122: 2003-2013 [0504] Mizushima
N, Levine B (2010) Autophagy in mammalian development and
differentiation. Nat Cell Biol 12: 823-830 [0505] Mizushima N,
Levine B, Cuervo A M, Klionsky D J (2008) Autophagy fights disease
through cellular self-digestion. Nature 451: 1069-1075 [0506]
Mizushima N, Yamamoto A, Matsui M, Yoshimori T, Ohsumi Y (2004) In
vivo analysis of autophagy in response to nutrient starvation using
transgenic mice expressing a fluorescent autophagosome marker. Mol
Biol Cell 15: 1101-1111 [0507] Mizushima N, Yoshimori T, Levine B
(2010) Methods in mammalian autophagy research. Cell 140: 313-326
[0508] Moore K J, El Khoury J, Medeiros L A, Terada K, Geula C,
Luster A D, Freeman M W (2002) A CD36-initiated signaling cascade
mediates inflammatory effects of beta-amyloid. J Biol Chem 277:
47373-47379 [0509] Moritz O L, Tam B M, Hurd L L, Peranen J,
Deretic D, Papermaster D S (2001) Mutant rab8 Impairs docking and
fusion of rhodopsin bearing post-Golgi membranes and causes cell
death of transgenic Xenopus rods. Mol Biol Cell 12:2341-2351 [0510]
Nachury M V, Loktev A V, Zhang Q, Westlake C J, Peranen J. Merdes
A. Slusarski D C, Scheller R H, Bazan J F, Sheffield V C, Jackson P
K (2007) A core complex of BBS proteins cooperates with the GTPase
Rab8 to promote ciliary membrane biogenesis. Cell 129: 1201-1213
[0511] Nakahira K, Haspel J A, Rathinam V A, Lee S J, Dolinay T,
Lam H C, Englert J A, Rabinovitch M. Cernadas M, Kim H P,
Fitzgerald K A, Ryter S W, Choi A M (2010) Autophagy proteins
regulate innate immune responses by inhibiting the release of
mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol
12: 222-230 [0512] Nickel W, Rabouille C (2009) Mechanisms of
regulated unconventional protein secretion. Nat Rev Mol Cell Biol
10: 148-155 [0513] Ponpuak M, Davis A S, Roberts E A, Delgado M A,
Dinkins C, Zhao Z, Virgin 3rd H W, Kyei G B, Johansen T, Vergne I,
Deretic V (2010) Delivery of cytosolic components by autophagic
adaptor protein p62 endows autophagosomes with unique antimicrobial
properties. Immunity 32: 329-341 [0514] Renna M, Jimenez-Sanchez M,
Sarkar S, Rubinsztein D C (2010) Chemical inducers of autophagy
that enhance the clearance of mutant proteins in neurodegenerative
diseases. J Biol Chem 285: 11061-11067 [0515] Romanello V,
Guadagnin E, Gomes L, Roder I, Sandri C, Petersen Y, Milan G,
Masiero E. Del Piccolo P, Foretz M, Scorrano L, Rudolf R, Sandri M
(2010) Mitochondrial fission and remodelling contributes to muscle
atrophy. EMBO J 29: 1774-1785 [0516] Rubartelli A, Cozzolino F,
Talio M, Sitia R (1990) A novel secretory pathway for interleukin-1
beta, a protein lacking a signal sequence. EMBO J 9: 15031510
[0517] Shorter J, Watson R, Giannakon M E, Clarke M, Warren G, Barr
F A (1999) GRASP55, a second mammalian GRASP protein involved in
the stacking of Golgi cisternae in a cell-free system. EMBO J 18:
4949-4960 [0518] Singh S B, Omatowski W, Vergne I, Naylor J,
Delgado M, Roberts E, Ponpuak M, Master S, Pilli M, White E,
Komatsu M, Deretic V (2010) Human IRGM regulates autophagy and
cell-autonomous immunity functions through mitochondria. Nat Cell
Biol 12: 1154-1165 [0519] Strappazzon F, Vietri-Rudan M, Campello
S, Nazio F, Florenzano F, Finia G M, Piacentini M, Levine B,
Cecconi F (2011) Mitochondrial BCL-2 inhibits AMBRA1-induced
autophagy. [0520] Sun Y, Bilan P J, Liu Z, Klip A (2010) Rab8A and
Rab13 are activated by insulin and regulate GLUT4 translocation in
muscle cells. Proc Natl Acad Sci USA 107: 19909-19914 [0521] Tang
D, Kang R, Livesey K M, Cheh C W, Farkas A, Loughran P, Hoppe G,
Bianchi M E, Tracey K J, Zeh 3rd H J, Lotze M T (2010) Endogenous
HMGB1 regulates autophagy. J Cell Biol 190: 881-892 [0522]
Vandanmagsar B, Yourn Y H, Ravussian A, Galgani J E, Stadler K,
Mynatt R L, Ravussin E, Stephens J M, Dixit V D (2011) The NLRP3
inflammasome instigates obesity-induced inflammation and insulin
resistance. Nat Med 17: 179-188 [0523] Wen H, Gris D, Lei Y, Jha S,
Zhang L, Huang M T, Brickey W J, Ting J P (2011) Fatty acid-induced
NLRP3-ASC inflammasome activation interferes with insulin
signaling. Nat Immunol 12: 408-415 [0524] Willingham S B, Allen I
C, Bergstralh D T, Brickey W J, Huang M T, Taxman D J, Duncan J A,
Ting J P (2009) NLRP3 (NALP3, Cryopyrin) facilitates in vivo
caspase-1 activation, necrosis, and HMGB 1 release via
inflammasome-dependent and -independent pathways. J Immunol 183:
2008-2015 [0525] Wong E, Cuervo A M (2010) Autophagy gone awry in
neurodegenerative diseases. Nat Neurosci 13: 805-811 [0526] Yang Z,
Geng J, Yen W L, Wang K, Klionsky D J (2010) Positive or negative
roles of different cyclin-dependent kinase Pho85-cyclin complexes
orchestrate induction of autophagy in Saccharomyces cerevisiae. Mol
Cell 38: 250-264 [0527] Youle R J, Narendra D P (2011) Mechanisms
of mitophagy. Nat Rev Mol Cell Biol 12: 9-14 [0528] Zhao Z, Fux B,
Goodwin M, Dunay I R, Strong D, Miller B C, Cadwell K, Delgado M A,
Ponpuak M, Green K G, Schmidt R E, Mizushima N, Deretic V, Sibley L
D, Virgin H W (2008) Autophagosome independent essential function
for the autophagy protein Atg5 in cellular immunity to
intracellular pathogens. Cell Host Microbe 4: 458-469 [0529] Zhou
R, Yazdi A S, Menu P, Tschopp J (2011) A role for mitochondria in
NLRP3 inflammasome activation. Nature 469: 221-225
EXAMPLE 4
LC3B-II Autophagy Marker can be Detected on the Surface of
Cells
[0530] Counterintuitively, given the engagement of autophagy and
intracellular membranes, we tested whether an autophagy marker can
be detected on the surface of cells. We find surprisingly that
LC3B-II (which has been found only on intracellular membranes
detectable by complicated methods of microscopy) is detected by
simple antibody staining on the cell surface of primary lymphocytes
using antibodies and flow cytometry or other simple assays of
detection (FIG. 1X4). Based on prior art about autophagy one could
not predict that LC3B would be exposed on the surface of the plasma
membrane (Scheme 1, PM) of the cell, such as a blood lymphocyte.
This is due to the accepted topology of the LC3 distribution on the
intracellular membranes. Even is the intracellular membranes were
to fuse with the plasma membrane (PM), LC3 would not be exposed to
the outside (see Scheme I, conventional process A; according to the
current knowledge LC3 would always be shielded from the exposure to
the outside and not accessible to antibodies, unless the cells were
permeabilized). Scheme 1 process B, depicts what we experimentally
detect, e.g. LC3 is exposed on the cell surface on the side of the
plasma membrane facing the outside of the cell and thus being
accessible to the exogenously added antibody to recognize LC3.
[0531] The first application of this finding is that, as shown in
FIG. 1X4, blood from patients or subjects can be drawn, and white
blood cells (or more specifically different cell populations
including CD4 and CDS cells and their subsets) untreated or exposed
to starvation in a buffer (Simple PBS or EBSS) for a period of time
(FIG. 1X4 is 90 min in EBSS) and LC3 detected on the surface by
antibody staining without specifically permeabilizing the cells.
This new principle is the basis for the following: (i) clinical
tests for patients (blood drawing and staining for LC3 on
lymphocytes or whole white blood cells), (b) biomarker in clinical
studies (same as above), (iii) drug screening and development for
induction or blocking of autophagy, and (iv) target for treatment
with blocking antibodies should LC3 on the cell surface show
biological functions.
EXAMPLE 5
Use of High-Content Imaging to Determine Autophagy-Associated
Effects on Cytoplasmic Puncta
[0532] The experiment of this example showed that high-content
imaging can be used in a high-throughout format to determine
autophagy-associated effects on cytoplasmic puncta of M.
tuberculosis-infected lung cells and cells implicated in a
lipid-related metabolic disorder.
[0533] Our high-content imaging system is represented schematically
in FIG. 3X5 and can be used to screen for a composition's
autophagy-associated effect on cytoplasmic puncta of either M.
tuberculosis-infected lung cells or cells implicated in a
lipid-related metabolic disorder. The following steps were
performed:
(a) culturing a sample of the cells; (b) plating the cell sample on
multi-well pates; (c) contacting the cell sample with the
composition; and (d) using high-content imaging to examine the cell
sample for an autophagy-associated effect on cytoplasmic puncta.
The screen was conducted using a high-throughput format.
[0534] More specifically, the multi-well plates were 384-well
plates, the cells were transfected with RFP-LC3 or GFP-LC3 prior to
plating, and the observed cytoplasmic puncta were RFP-LC3 puncta or
GFP-LC3 puncta. See FIGS. 2X5, 3X5, 4X5. Positive controls and read
times are summarized in FIG. 5AX5.
[0535] Red puncta and green puncta number, intensity, and area were
considered as selection parameters. FIG. 6X5. Screens using
compounds from the Prestwick library were conducted and total GFP+
puncta area/cell and total GFP area/cell were determined. FIG. 7X5.
An approximately 34% overlap of hits from two separate Prestwick
screens from induction of autophagy was observed. Compound hits,
both real and imagined, were determined. FIG. 9X5, and dose
response curve to pp242 were generated. FIG. 10X5. Comparable TPIMS
screen results are summarized in FIG. 11X5.
EXAMPLE 6
[0536] A number of compounds have been identified by screening
small molecule libraries for their autophagic regulatory capacities
by using a Cellomics ArrayScan to quantitate LC3-GFP/RFP puncta in
HeLa cells. LC3 is a widely-used marker for autophagic vacuoles.
HeLa cells stably transduced with LC3-GFP/RFP tandem construct
generate fluorescent autophagic puncta, which are either
green/yellow (early autophagosomes) or red (late autophagosomes
fused with lysosomes, which degrades the GFP). By quantitating the
number or total areal of fluorescent puncta per cell, we can detect
alterations in autophagic flux and regulation.
[0537] Prior to any actual screening, however, preliminary
experiments to modify our protocols for use in 384-well plate
high-content screening had to be conducted. To that end, we ran a
series of experiments to show that -5,000 LC3-GFP/RFP HeLa cells
per well of a 384-well plate was optimal for imaging on the
Cellomics ArrayScan. The next question was which parameter was most
sensitive for detecting changes in autophagy. We tested total
puncta area, number, or intensity per cell for both GFP+ and RFP+
puncta after treatment with pp242, an mTOR inhibitor and known
inducer of autophagy. As shown in FIG. 1X6, GFP+ puncta area was
the most distinct readout for induction of autophagy, although
other parameters in both the RFP and GFP channels also showed
changes. Other methods of induction of autophagy were tested for
use a positive controls, including starvation and the mTOR
inhibitor rapamycin (data not shown). However, pp242 was
consistently the stronger inducer of autophagy in our hands in this
assay, and was used in most studies.
[0538] Using the above system, we performed two separate screens on
a chemical library. This library contain 1,200 FDS-approved
compounds, and represents wide functional and chemical diversity.
This library spans four 384-well plates, with 64 wells on each
plate with DMSO only as negative controls. We used 32 of these
wells for addition of our positive control (pp242 or rapamycin),
and left the other 32 for DMSO negative controls. FIG. 2X6 shows
the raw data from one of these screens. The first screen revealed
266"hits"--compounds that induced or decreased autophagy in the
LC3-GFP/RFP HeLa cells. A hit was defined as 3 standard deviations
above or below the mean of the negative control wells on a given
plate. The second screen gave 182 hits. Overall, 96 compounds were
found to affect autophagy in both screens, for an overlap rate of
-34% (FIG. 3X6). Analysis of the images from the experiments
revealed that 6 of these compounds were false positives (due to
autofluorescence, etc). Therefore, a total 90 compounds were
identified from the two chemical library screens and appear in the
present specification.
[0539] In order to further dissect the ability of the 90 hits to
affect autophagy, we wished to test whether the screening system we
used was sufficient to determine dose responses for each compound.
To that end, we performed dose response experiments using pp242. As
shown in FIG. 4, dose responses could be performed successful.
[0540] Therefore, we performed two separate dose response
experiments of 85 of the 90 hits obtained from the two Prestwick
Chemical Library screens. As shown in Appendix 2, a range of does
response curves were identified in the different compounds. This
assay resulted in 25 compounds that showed acceptable dose response
curves in both experiments, 20 of these compounds were not
previously known to induce autophagy. Current studies are underway
to measure LC3-I and LC3-II levels by western blood, and p62 levels
by Cellomics and western blot, to further confirm the autophagic
activity of these compounds.
[0541] In parallel to the second Prestwick Chemical Library screen,
we also wished to test which compounds might be useful for
combinatorial drug products. Using the data from FIG. 4, we treated
LC3-GFP/RFP HeLa cells with a suboptimal dose of pp2424 that did
not induce autophagy (-0.06 uM), then added the Prestwick Chemical
Library to these cells and analyzed as before. After two separate
screens, we found 8 compounds (Appendix 4) that altered autophagy
in the presence, but not the absence, of suboptimal pp242
concentration. Four of these 8 compounds were found in either of
our prior Prestwick Chemical Library screen or are known mTOR
pathway modulators (and therefore merely exerting additive
effects). Therefore, 4 compounds in this screen could modulate
autophagy in concert with, but not without, suboptimal amounts of
pp242. We are currently testing these compounds in dose response
experiments to confirm the pp242 effects and to test whether any
activity is additive or synergistic.
[0542] Wild-type HIV-1 viruses will be used in further tests to
determine whether the compounds in our screens will alter HIV-1
replication. We have already grown and titered a wild-type
macrophage-tropic HIV-1. Two separate wild-type CD4+ T cell-tropic
HIV strains have also been generated. Compounds that inhibit or
induce autophagy, as identified in our ongoing screes, will be
incubated with human peripheral blood monocyte-derived macrophages
that have been infected with wile-type HIV-1 in 96-well plates. At
different time points, supernatants will be harvested and added to
TMZ-b1/JC53BL cells, which express luciferase after HIV
replication. Replication will be assessed by luciferase levels
relative to DMSO-treated controls. Alternately, p24 levels will be
assessed.
[0543] We have also performed two separate screens using the
LC3-GFP/RFP HeLa cells against the Spectrum 2000 library. As shown
in FIG. 5, 207 compounds were identified as regulators of
autophagy. After visual inspection of the images, 21 compounds were
excluded due to autofluorescence or other false positive
characteristics. Of the remaining 186 compounds, 94 were also
present in the Prestwick Chemical Library, so these were excluded.
This left 92 compounds, 83 of which were not know to be regulators
of autophagy. There is a range of compound types in this group
(FIG. 5). These compounds have been described in the specification
as set forth above.
Summary
[0544] We have optimized our high-content imaging screening system
for measurement of regulation of autophagy. We have used this
system to screen two different drug libraries and have identified
up to 182 compounds (125 of which have been used in humans) that
regulate autophagy, and have conducted dose response studies to
begin to narrow down these hits to identify the most promising
compounds. In addition, we have found 4 compounds that only induce
autophagy in a combination setting (with low doses of pp 242). We
are in the process of setting up our HIV in vitro replication assay
to further test these hits. Additional library screens are planned.
Sequence CWU 1
1
44122PRTArtificial Sequencesynthetic sequence 1Leu Ile Glu Ser Leu
Ser Gln Met Leu Ser Met Gly Phe Ser Asp Glu 1 5 10 15 Gly Gly Trp
Leu Thr Arg 20 219DNAArtificial Sequencesynthetic sequence
2gcattgaagt ggatattga 19319DNAArtificial Sequencesynthetic sequence
3gacgatgact ggacccatt 19419DNAArtificial Sequencesynthetic sequence
4tcggaggatc ccagtgtga 19519DNAArtificial Sequencesynthetic sequence
5cagcaagccg ggtgggaat 19619RNAArtificial Sequencesynthetic sequence
6ccaauugguu uacuauuug 19719RNAArtificial Sequencesynthetic sequence
7cgaauuccaa cuugcuuua 19819RNAArtificial Sequencesynthetic sequence
8uuagugagau augguuuga 19919RNAArtificial Sequencesynthetic sequence
9gcauaaaagu caagugauc 191019RNAArtificial Sequencesynthetic
sequence 10uagcgacuaa acacaucaa 191119RNAArtificial
Sequencesynthetic sequence 11uaaggcuaug aagagauac
191219RNAArtificial Sequencesynthetic sequence 12auguauuggc
cuguauuag 191319RNAArtificial Sequencesynthetic sequence
13augaacguga auugcucaa 191420DNAArtificial Sequencesynthetic
sequence 14gcaacgggaa gattctgaag 201520DNAArtificial
Sequencesynthetic sequence 15tgacaaactt ctgcctgacg
201619RNAArtificial Sequencesynthetic sequence 16gaagccgucu
ggugcaaua 191719RNAArtificial Sequencesynthetic sequence
17ugacggcgca uaagauuua 191819RNAArtificial Sequencesynthetic
sequence 18cuacgaagga cgacgcuua 191919RNAArtificial
Sequencesynthetic sequence 19guaugaagcg uuuaaagau
192019RNAArtificial Sequencesynthetic sequence 20gaaauuaagg
uucuguuga 192119RNAArtificial Sequencesynthetic sequence
21ccacucacgc caacuauaa 192219RNAArtificial Sequencesynthetic
sequence 22gaugaaggcu uucgagucg 192319RNAArtificial
Sequencesynthetic sequence 23uaacauggcu cauugugaa
192419RNAArtificial Sequencesynthetic sequence 24gaauaagugu
gaugugaau 192519RNAArtificial Sequencesynthetic sequence
25gaagaccugu guccuguuc 192619RNAArtificial Sequencesynthetic
sequence 26gaccuacgau uaccuguuc 192719RNAArtificial
Sequencesynthetic sequence 27gagcagccau ggagucaag
192819RNAArtificial Sequencesynthetic sequence 28auacaucccu
acuugguga 192919RNAArtificial Sequencesynthetic sequence
29gcuuagagac augggcuua 193019RNAArtificial Sequencesynthetic
sequence 30gcaacugcga gaaggcuau 193119RNAArtificial
Sequencesynthetic sequence 31cugcaaacga cuaaagaag
193219RNAArtificial Sequencesynthetic sequence 32guucuucgcu
gcuauguac 193319RNAArtificial Sequencesynthetic sequence
33gcacccaggc uguaacauu 193419RNAArtificial Sequencesynthetic
sequence 34ugaaggaccc acaguguaa 193519RNAArtificial
Sequencesynthetic sequence 35ucacauuccu cuaugguau
193619RNAArtificial Sequencesynthetic sequence 36caugaaggug
cgcgaggua 193719RNAArtificial Sequencesynthetic sequence
37cagaggacau ugguucuag 193819RNAArtificial Sequencesynthetic
sequence 38acucgaggcu gaacaagga 193919RNAArtificial
Sequencesynthetic sequence 39gcuacgaccu cacaacuua
194019RNAArtificial Sequencesynthetic sequence 40gaagaccugu
ucagccuua 194119RNAArtificial Sequencesynthetic sequence
41uaccaagucu gaugccuuu 194219RNAArtificial Sequencesynthetic
sequence 42guaaaccagu cccuugcuu 194319RNAArtificial
Sequencesynthetic sequence 43gaucaucaca ccaaacucu
19444PRTArtificial Sequencesynthetic sequence 44Tyr Val Ala Asp
1
* * * * *