U.S. patent application number 16/107491 was filed with the patent office on 2019-02-21 for double coupling method for oligonucleotide synthesis.
The applicant listed for this patent is Agilent Technologies, Inc.. Invention is credited to Siyuan Chen, Joel Myerson.
Application Number | 20190055548 16/107491 |
Document ID | / |
Family ID | 63406346 |
Filed Date | 2019-02-21 |
United States Patent
Application |
20190055548 |
Kind Code |
A1 |
Myerson; Joel ; et
al. |
February 21, 2019 |
DOUBLE COUPLING METHOD FOR OLIGONUCLEOTIDE SYNTHESIS
Abstract
Aspects of the present disclosure include methods for double
coupling a nucleoside phosphoramidite during synthesis of an
oligonucleotide. The method can include coupling a free hydroxyl
group of a nucleoside residue with a first sample of a protected
nucleoside phosphoramidite via an internucleoside P(III) linkage,
followed by exposure to an oxidizing agent prior to a second
coupling step with a second sample of the protected nucleoside
phosphoramidite, and further exposure to an oxidizing agent. The
method finds use in synthesizing an oligonucleotide on a solid
phase support, such as a planar surface. The double coupling method
can be utilized at one or more nucleotide positions during
oligonucleotide synthesis thereby reducing single base deletion
rates. Oligonucleotide containing compositions synthesized
according to the disclosed methods are also provided.
Inventors: |
Myerson; Joel; (Berkeley,
CA) ; Chen; Siyuan; (San Mateo, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Agilent Technologies, Inc. |
Santa Clara |
CA |
US |
|
|
Family ID: |
63406346 |
Appl. No.: |
16/107491 |
Filed: |
August 21, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15470779 |
Mar 27, 2017 |
10072261 |
|
|
16107491 |
|
|
|
|
62313641 |
Mar 25, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/1093 20130101;
C12Q 1/6806 20130101; C07H 21/00 20130101; C12Q 1/6834 20130101;
C12Q 1/6834 20130101; C12Q 2523/115 20130101; C12Q 2525/117
20130101; C12Q 2565/501 20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10; C12Q 1/6806 20060101 C12Q001/6806; C07H 21/00 20060101
C07H021/00 |
Claims
1. A method for double coupling a nucleoside phosphoramidite during
synthesis of an oligonucleotide, the method comprising: (a)
contacting a free hydroxyl group of a terminal nucleoside residue
attached to a solid phase support with a first sample of a
protected nucleoside phosphoramidite to couple the protected
nucleoside to the terminal nucleoside residue via an
internucleoside P(III) linkage; (b) exposing the contacted
nucleoside residue to an oxidizing agent to oxidize the linkage and
produce a first coupled and oxidized product; (c) contacting the
first coupled and oxidized product with a second sample of the
protected nucleoside phosphoramidite to couple the protected
nucleoside to residual free hydroxyl groups of the terminal
nucleoside residue via an internucleoside P(III) linkage; and (d)
after step (c), adding an oxidizing agent to oxidize the linkage
and produce a protected terminal nucleoside residue.
2. The method of claim 1, further comprising: (e) deprotecting the
protected hydroxyl group of the terminal nucleoside residue to
produce a free hydroxyl group; repeating steps (a) through (e)
until the oligonucleotide is synthesized.
3. The method of claim 1, wherein steps (b) and (d) comprise
washing the solid phase support after exposure to the oxidizing
agent.
4. The method of claim 1, wherein the solid phase support comprises
a substantially smooth and substantially solid surface.
5. The method of claim 1, wherein the solid phase support comprises
an array of wells.
6. The method of claim 1, wherein the protected nucleoside
phosphoramidite is a nucleoside monomer.
7. The method of claim 1, wherein the protected nucleoside
phosphoramidite is a nucleoside dimer.
8. The method of claim 1, wherein synthesis of the oligonucleotide
is performed in the 3' to 5' direction.
9. The method of claim 1, wherein synthesis of the oligonucleotide
is performed in the 5' to 3' direction.
10. The method of claim 1, wherein no capping is performed.
11. The method of claim 1, wherein oxidizing the linkage produces a
phosphotriester linkage.
12. A method of synthesizing an array of oligonucleotides by using
the method of claim 1.
13. The method of claim 12, further comprising: deprotecting the
protected hydroxyl groups of the terminal nucleoside residues
attached to the plurality of locations of the planar solid phase
support to produce free hydroxy groups; repeating the double
coupling and deprotection steps until the array of oligonucleotides
is synthesized.
14. The method of claim 12, wherein the array comprises
oligonucleotides of between about 30 and 1000 nucleotides in
length.
15. The method of claim 14, wherein the oligonucleotides are
synthesized with an overall single base deletion rate of 1 in 500
or better.
Description
CROSS-REFERENCING
[0001] This application is a continuation application of U.S.
patent application Ser. No. 15/470,779, filed Mar. 27, 2017 which
claims the benefit of priority to U.S. provisional patent
application 62/313,641, filed on Mar. 25, 2016, the entire
disclosures of both applications are incorporated herein by
reference.
INTRODUCTION
[0002] Traditional DNA synthesis consists of 4 steps:
phosphoramidite coupling, capping of unreacted hydroxyls, phosphite
triester oxidation to phosphate triester, and removal of the
terminal dimethoxytrityl-group with acid. Failures of the coupling
step, if subsequently successfully capped, result in a ladder of
shortmers of all possible lengths (oligonucleotides having n-1,
n-2, n-3, etc., lengths compared to n, the desired full-length
oligonucleotide sequence). Failure of the capping step, or failure
of the detritylation step, result in a larger amount of (n-1)mer,
in which the (n-1) impurity is one shorter than the full length.
This (n-1)mer length oligonucleotide is not a pure single compound,
and consists of single base deletion failures distributed over the
entire length of the oligo.
[0003] In order to improve the coupling efficiency of traditional
phosphoramidite chemistry on solid support such as controlled pore
glass using an automated synthesizer a "double couple" cycle is
often used. A traditional double coupling cycle is performed before
the capping step. The capping step, in turn, is performed before
the oxidation step because the capping step is thought to reverse
branching side reactions that can occur at the O6 position of
guanine nucleobases (Pon R T, Usman N, Damha M J, Ogilvie K K:
Prevention of guanine modification and chain cleavage during the
solid phase synthesis of oligonucleotides using phosphoramidite
derivatives. Nucleic Acids Res 1986, 14(16):6453-6470). The double
coupling cycle is performed by repeating the step of addition of
activator and phosphoramidite monomer to the detritylated
oligonucleotide on the solid support, before capping and oxidation.
No oxidation step is performed prior to the second coupling step,
otherwise the benefit of reversing the branching during the capping
step is lost, because oxidation of the phosphite triester
internucleotide linkage stabilizes the undesirable branched
oligonucleotide side product.
SUMMARY
[0004] Aspects of the present disclosure include methods for double
coupling a nucleoside phosphoramidite during synthesis of an
oligonucleotide. The method can include coupling a free hydroxyl
group of a nucleoside residue with a first sample of a protected
nucleoside phosphoramidite via an internucleoside P(III) linkage,
followed by exposure to an oxidizing agent prior to a second
coupling step with a second sample of the protected nucleoside
phosphoramidite, and further exposure to an oxidizing agent. The
method finds use in synthesizing an oligonucleotide on a solid
phase support, such as a planar support surface that finds use in
oligonucleotide arrays. The double coupling method can be utilized
at one or more nucleotide positions during oligonucleotide
synthesis thereby reducing single base deletion rates.
Oligonucleotide containing compositions synthesized according to
the disclosed methods are also provided.
Definitions
[0005] Before describing exemplary embodiments in greater detail,
the following definitions are set forth to illustrate and define
the meaning and scope of the terms used in the description.
[0006] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR
BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale
& Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper
Perennial, N.Y. (1991) provide one of skill with the general
meaning of many of the terms used herein. Still, certain terms are
defined below for the sake of clarity and ease of reference.
[0007] Following long-standing patent law convention, the terms
"a", "an", and "the" refer to "one or more" when used in this
application, including the claims. Thus, for example, reference to
"a cell" includes a plurality of such cells, and so forth.
[0008] As used herein, the term "about," when referring to a value
or to an amount of mass, weight, time, volume, concentration or
percentage is meant to encompass variations of in some embodiments
.+-.20%, in some embodiments .+-.10%, in some embodiments .+-.5%,
in some embodiments .+-.1%, in some embodiments .+-.0.5%, and in
some embodiments .+-.0.1% from the specified amount, as such
variations are appropriate to perform the disclosed method.
[0009] As used herein, ranges can be expressed as from "about" one
particular value, and/or to "about" another particular value. It is
also understood that there are a number of values disclosed herein,
and that each value is also herein disclosed as "about" that
particular value in addition to the value itself. For example, if
the value "10" is disclosed, then "about 10" is also disclosed. It
is also understood that each unit between two particular units are
also disclosed. For example, if 10 and 15 are disclosed, then 11,
12, 13, and 14 are also disclosed.
[0010] The methods described herein include multiple steps. Each
step can be performed after a predetermined amount of time has
elapsed between steps, as desired. As such, the time between
performing each step can be 1 second or more, 10 seconds or more,
30 seconds or more, 60 seconds or more, 5 minutes or more, 10
minutes or more, 60 minutes or more and including 5 hours or more.
In certain embodiments, each subsequent step is performed
immediately after completion of the previous step. In other
embodiments, a step can be performed after an incubation or waiting
time after completion of the previous step, e.g., a few minutes to
an overnight waiting time.
[0011] Numeric ranges are inclusive of the numbers defining the
range.
[0012] The terms "nucleotide" or "nucleotide moiety", as used
herein, refer to a sub-unit of a nucleic acid (whether DNA or RNA
or analogue thereof), which includes a phosphate group, a sugar
group and a heterocyclic base, as well as analogs of such
sub-units. Other groups (e.g., protecting groups) can be attached
to any component(s) of a nucleotide.
[0013] The terms "nucleoside" or "nucleoside moiety", as used
herein, refer a nucleic acid subunit including a sugar group and a
heterocyclic base, as well as analogs of such sub-units. Other
groups (e.g., protecting groups) can be attached to any
component(s) of a nucleoside. The "nucleoside residue" refers to a
nucleic acid subunit that is linked to a support (e.g., via an
optional linker) or linked to a growing oligonucleotide, e.g., that
is itself immobilized on a support.
[0014] The terms "nucleoside" and "nucleotide" are intended to
include those moieties that contain not only the known purine and
pyrimidine bases, e.g. adenine (A), thymine (T), cytosine (C),
guanine (G), or uracil (U), but also other heterocyclic bases that
have been modified. Such modifications include methylated purines
or pyrimidines, alkylated purines or pyrimidines, acylated purines
or pyrimidines, halogenated purines or pyrimidines, deazapurines,
alkylated riboses or other heterocycles. Such modifications
include, e.g., diaminopurine and its derivatives, inosine and its
derivatives, alkylated purines or pyrimidines, acylated purines or
pyrimidines, thiolated purines or pyrimidines, and the like, or the
addition of a protecting group such as acetyl, difluoroacetyl,
trifluoroacetyl, isobutyryl, benzoyl, 9-fluorenylmethoxycarbonyl,
phenoxyacetyl, and substituted phenoxyacetyl, dimethylformamidine,
dibutylformamidine, pyrrolodinoamidine, morpholinoamidine, and
other amidine derivatives, N,N-diphenyl carbamate, or the like. The
purine or pyrimidine base may also be an analog of the foregoing;
suitable analogs will be known to those skilled in the art and are
described in the pertinent texts and literature. Common analogs
include, but are not limited to, 7-deazaadenine, 1-methyladenine,
2-methyladenine, N6-methyladenine, N6-isopentyladenine,
2-methylthio-N6-isopentyladenine, N,N-dimethyladenine,
8-bromoadenine, 2-thiocytosine, 3-methyl cytosine,
5-methylcytosine, 5-ethylcytosine, 4-acetylcytosine,
1-methylguanine, 2-methylguanine, 7-methylguanine,
2,2-dimethylguanine, 8-bromoguanine, 8-chloroguanine,
8-aminoguanine, 8-methylguanine, 8-thioguanine, 5-fluorouracil,
5-bromouracil, 5-chlorouracil, 5-iodouracil, 5-ethyluracil,
5-propyluracil, 5-methoxyuracil, 5-hydroxymethyluracil,
5-(carboxyhydroxymethyl)uracil, 5-(methylaminomethyl)uracil,
5-(carboxymethylaminomethyl)-uracil, 2-thiouracil,
5-methyl-2-thiouracil, 5-(2-bromovinyl)uracil, uracil-5-oxyacetic
acid, uracil-5-oxyacetic acid methyl ester, pseudouracil,
1-methylpseudouracil, queosine, inosine, 1-methylinosine,
hypoxanthine, xanthine, 2-aminopurine, 6-hydroxyaminopurine,
6-thiopurine and 2,6-diaminopurine.
[0015] A "nucleobase" references the heterocyclic base of a
nucleoside or nucleotide. In addition, the terms "nucleoside" and
"nucleotide" include those moieties that contain not only
conventional ribose and deoxyribose sugars, but other sugars as
well. Modified nucleosides or nucleotides also include
modifications on the sugar moiety, e.g., wherein one or more of the
hydroxyl groups are replaced with halogen atoms or aliphatic groups
including locked nucleic acids (LNA) and unlocked nucleic acids
(UNA), 2'-fluoro, 2'-O-alkyl, 2'-O-ethoxymethoxy, or are
functionalized as ethers, amines (e.g., 3'-amino), or the like.
[0016] The term "analogues", as used herein, refer to molecules
having structural features that are recognized in the literature as
being mimetics, derivatives, having analogous structures, or other
like terms, and include, for example, polynucleotides incorporating
non-natural (not usually occurring in nature) nucleotides,
unnatural nucleotide mimetics such as 2'-modified nucleosides,
peptide nucleic acids, oligomeric nucleoside phosphonates, and any
polynucleotide that has added substituent groups, such as
protecting groups or linking groups.
[0017] The term "nucleic acid", as used herein, refers to a polymer
of any length, e.g., greater than about 2 bases, greater than about
10 bases, greater than about 100 bases, greater than about 500
bases, greater than 1,000 bases, up to about 10,000 or more bases
composed of nucleotides, e.g., deoxyribonucleotides or
ribonucleotides, and may be produced synthetically.
Naturally-occurring nucleotides include guanosine and
2'-deoxyguanosine, cytidine and 2'-deoxycytidine, adenosine and
2'-deoxyadenosine, thymidine and uridine (G, dG, C, dC, A, dA, T
and U respectively).
[0018] A nucleic acid may exist in a single stranded or a
double-stranded form. A double stranded nucleic acid has two
complementary strands of nucleic acid may be referred to herein as
the "first" and "second" strands or some other arbitrary
designation. The first and second strands are distinct molecules,
and the assignment of a strand as being a first or second strand is
arbitrary and does not imply any particular orientation, function
or structure. The nucleotide sequences of the first strand of
several exemplary mammalian chromosomal regions (e.g., BACs,
assemblies, chromosomes, etc.), as well as many pathogens, are
known, and may be found in NCBI's Genbank database, for example.
The second strand of a region is complementary to that region.
[0019] As used herein, the terms "oligonucleotide" and
"polynucleotide" are used interchangeably to refer to a single
stranded multimer of nucleotides of, inter alia, from about 2 to
1000 nucleotides. Oligonucleotides may be synthetic and, in some
embodiments, are 10 to 50 nucleotides in length or 50 to 1000
nucleotides in length. Oligonucleotides may contain ribonucleotide
monomers (i.e., may be oligoribonucleotides) or deoxyribonucleotide
monomers. Oligonucleotides may contain, 10 to 20, 21 to 30, 31 to
40, 41 to 50, 51-60, 61 to 70, 71 to 80, 80 to 100, 100 to 150, 150
to 500 or greater than 500 nucleotides in length, for example.
[0020] The terms "deoxyribonucleic acid" and "DNA", as used herein,
refers to a nucleic acid composed of nucleotides and/or
deoxyribonucleotides.
[0021] The terms "ribonucleic acid" and "RNA", as used herein,
refer to a nucleic acid composed of nucleotides and/or
ribonucleotides.
[0022] An "internucleotide bond" or "internucleotide linkage"
refers to a chemical linkage between two nucleoside moieties, such
as the phosphodiester linkage in nucleic acids found in nature, or
linkages well known from the art of synthesis of nucleic acids and
nucleic acid analogues. An internucleotide bond may include, e.g.,
a phosphate, phosphonate, or phosphite group, and may include
linkages where one or more oxygen atoms are either modified with a
substituent or a protecting group or replaced with another atom,
e.g., a sulfur atom, or the nitrogen atom of a mono- or di-alkyl
amino group.
[0023] Given the benefit of this disclosure, one of ordinary skill
in the art will appreciate that synthetic methods, as described
herein, may utilize a variety of protecting groups. The phrase
"protecting group", as used herein, refers to a species which
prevents a portion of a molecule from undergoing a specific
chemical reaction, but which is removable from the molecule
following completion of that reaction. A "protecting group" is used
in the conventional chemical sense as a group which reversibly
renders unreactive a functional group under certain conditions of a
desired reaction, as taught, for example, in Greene, et al.,
"Protective Groups in Organic Synthesis," John Wiley and Sons,
Second Edition, 1991. After the desired reaction, protecting groups
may be removed to deprotect the protected functional group. All
protecting groups should be removable (and hence, labile) under
conditions which do not degrade a substantial proportion of the
molecules being synthesized. In contrast to a protecting group, a
"capping group" binds to a segment of a molecule to prevent any
further chemical transformation of that segment during the
remaining synthesis process. It should be noted that the
functionality protected by the protecting group may or may not be a
part of what is referred to as the protecting group.
[0024] The terms "hydroxyl protecting group" or "0-protecting
group", as used herein, refers to a protecting group where the
protected group is a hydroxyl. A "reactive-site hydroxyl" is the
terminal 5'-hydroxyl during 3'-5' polynucleotide synthesis, or the
3'-hydroxyl during 5'-3' polynucleotide synthesis. A "free
reactive-site hydroxyl" is a reactive-site hydroxyl that is
available to react to form an internucleotide bond (e.g., with a
phosphoramidite functional group) during polynucleotide
synthesis.
[0025] A "DNA writer" refers to a device that uses inkjet heads to
deliver droplets of phosphoramidite and activator solutions to a
substantially smooth, substantially solid support surface to create
large numbers of unique sequences of DNA on a small scale. Compared
to traditional DNA synthesis, this technology creates 10 million to
10 billion times smaller quantities of DNA than are created using
widely available automated chemistry machines using controlled pore
glass as the support. Due to these differences in scale and
methodology, oligonucleotide synthesis chemistry performed using a
DNA writer may behave quite differently than when using traditional
automated chemistry machines, and existing literature regarding
oligonucleotide synthesis chemistry using traditional automated
chemistry machines is often not instructive or predictive about how
oligonucleotide synthesis chemistry will behave on a DNA
writer.
[0026] The term "substantially solid," as used herein for a
surface, means that the location(s) on the surface of the support
where oligonucleotide synthesis is occurring is resistant to the
diffusion, absorption, or permeation of the relevant reagents and
chemicals of oligonucleotide synthesis beyond the surface and into
the body of the support (in contrast to commercial polymeric oligo
synthesizer supports, which permit such diffusion and permeation,
such that oligo synthesis occurs in the body of the support).
[0027] The term "substantially smooth," as used herein for a
surface, means that the location(s) on the surface of the support
where the oligonucleotide synthesis is occurring is at most
superficially irregular, such that irregularities, if any, are not
of a scale which would substantially affect the rapidity with which
reagents can be uniformly applied to, mixed on, or removed from the
surface (in contrast to commercial "controlled pore glass" oligo
synthesizer supports, which contain pores and irregularities that
slow the application and removal of reagents).
[0028] A substantially solid, substantially smooth surface need not
be flat, and would include, for example, flat surfaces, tubes,
cylinders, arrays of depressions or wells, and combinations of
these elements, as well as other designs presenting surface
portions with the above-described attributes. Substantially solid,
substantially smooth surfaces are surfaces (or portions of
surfaces) that can be addressed by an inkjet print head.
DETAILED DESCRIPTION
[0029] As summarized above, the present disclosure provides methods
for double coupling a nucleoside phosphoramidite during synthesis
of an oligonucleotide. The method can include coupling a free
hydroxyl group of a nucleoside residue with a first sample of a
protected nucleoside phosphoramidite via an internucleoside P(III)
linkage, followed by exposure to an oxidizing agent prior to a
second coupling step with a second sample of the protected
nucleoside phosphoramidite, and further exposure to an oxidizing
agent. The method finds use in synthesizing an oligonucleotide on a
solid phase support, such as a planar support surface that finds
use in oligonucleotide arrays. The double coupling method can be
utilized at one or more nucleotide positions during oligonucleotide
synthesis thereby reducing single base deletion rates.
Oligonucleotide containing compositions synthesized according to
the disclosed methods are also provided.
[0030] Before the various embodiments are described, it is to be
understood that the teachings of this disclosure are not limited to
the particular embodiments described, and as such can, of course,
vary. It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to be limiting, since the scope of the present
teachings will be limited only by the appended claims.
[0031] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described in any way. While the present teachings are
described in conjunction with various embodiments, it is not
intended that the present teachings be limited to such embodiments.
On the contrary, the present teachings encompass various
alternatives, modifications, and equivalents, as will be
appreciated by those of skill in the art.
[0032] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this disclosure belongs.
Although any methods and materials similar or equivalent to those
described herein can also be used in the practice or testing of the
present teachings, some exemplary methods and materials are now
described.
[0033] The citation of any publication is for its disclosure prior
to the filing date and should not be construed as an admission that
the present claims are not entitled to antedate such publication by
virtue of prior invention. Further, the dates of publication
provided can be different from the actual publication dates which
can be independently confirmed.
[0034] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which can be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present teachings. Any recited
method can be carried out in the order of events recited or in any
other order which is logically possible.
[0035] All patents and publications, including all sequences
disclosed within such patents and publications, referred to herein
are expressly incorporated by reference.
Methods of Double Coupling
[0036] Aspects of the present disclosure include methods for
performing a double coupling cycle at one or more nucleotides of a
target oligonucleotide sequence during synthesis of the
oligonucleotide on a solid support. After the first coupling step,
a small percentage (e.g., 0.1 to 1 mol %) of the solid
support-bound free terminal groups can remain unreacted, which can
lead to base deletions and over the course of an oligonucleotide
synthesis, a variety of shortmer sequences (e.g., (n-1)mer
sequences). Such non-target sequences can be difficult to remove
during purification. The present disclosure provides double
coupling methods having a sequence of steps which provide for
synthetic oligonucleotide compositions having a reduced amount of
shortmer oligonucleotide sequence impurities. The subject method
can include a double coupling cycle including two coupling steps of
a nucleoside reactant (with an optional oxidation step in between),
and an oxidation step after the two coupling steps to oxidize the
P(III) internucleoside linkages that are produced to P(V) linkages.
In certain instances of the method, no capping step is performed.
In some instances, the double coupling cycle can include,
sequentially: a first coupling step, a second coupling step, and an
oxidation step, without capping before the oxidation step. In
certain instances, the double coupling cycle can include,
sequentially: a first coupling step, an oxidation step, a second
coupling step and an oxidation step. Capping is optional in this
embodiment, which can be performed before or after the second
oxidation step.
[0037] As used herein, the terms "couple" and "coupling" refer to
the covalent attachment of a nucleoside monomer or dimer reactant
to the free terminal of a nucleoside residue of a growing
oligonucleotide according to a desired sequence. Coupling may be
achieved via any suitable chemistry which finds use in
oligonucleotide synthesis. Coupling chemistries of interest
include, but are not limited to, phosphoramidite chemistry. The
subject methods can be directed to the preparation of a target
oligonucleotide sequence that is a DNA or RNA sequence. As such, in
certain instances, the subject methods involve phosphoramidite
couplings with a 3'-hydroxyl or 5'-hydroxyl group of a terminal
nucleoside or nucleotide residue of a growing oligonucleotide
chain, depending on whether the direction of synthesis is performed
in the 5' to 3' direction or the in the 3' to 5' direction.
[0038] In certain embodiments, the subject methods can be directed
to the preparation of a target oligonucleotide sequence that can
include one or more phosphoramidate or thiophosphoramidate
internucleoside linkages. In certain cases, such linkages can be
prepared via phosphoramidite couplings with a 3'-amino group of a
terminal nucleoside or nucleotide residue of a growing
oligonucleotide chain.
[0039] The nucleoside residue may have a variety of terminal
functional groups to which an incoming nucleoside monomer or dimer
reactant may be coupled, depending on the type of coupling
chemistry utilized, the direction of synthesis and whether the
oligonucleotide includes conventional ribose and/or deoxyribose
sugars or modified sugar moieties that find use in preparation of
oligonucleotide analogs. The free terminal group of the nucleoside
residue can be located at a variety of positions, e.g., the 3' or
5' positions of a ribose or deoxyribose sugar moiety, and can
include a variety of functional groups, e.g., hydroxyl, amino or
thiol, connected via an optional linker, e.g., to the sugar
moiety.
[0040] In some instances, coupling includes reaction of a free
terminal hydroxyl group (e.g., a 5'-hydroxyl or a 3'-hydroxyl) with
a nucleoside phosphoramidite to produce a phosphoramidite
internucleoside linkage.
[0041] In some instances, coupling includes reaction of a free
terminal amino group (e.g., a 3' amino) with a nucleoside
phosphoramidite to produce an internucleoside linkage, such as a
N3'.fwdarw.P5' phosphoramidite internucleoside linkage. The
N3'.fwdarw.P5' phosphoramidite internucleoside linkage can then be
subsequently oxidized to a N3'.fwdarw.P5' phosphoramidate
internucleoside linkage, or sulfurized to a N3'.fwdarw.P5'
thiophosphoramidate internucleoside linkage, using any suitable
methods.
[0042] In some embodiments, the method includes contacting a free
terminal group (e.g., a terminal hydroxyl or amino group) of a
nucleoside residue attached to a solid phase support with a first
sample of a protected nucleoside phosphoramidite to couple the
nucleoside monomer to the terminal nucleoside residue via an
internucleoside P(III) linkage. In certain cases, the free terminal
group is a 5'-hydroxyl group of the nucleoside residue. In certain
cases, the free terminal group is a 3'-hydroxyl group of the
nucleoside residue. In certain cases, the free terminal group is a
5'-amino group of the nucleoside residue. In certain cases, the
free terminal group is a 3'-amino group of the nucleoside
residue.
[0043] Oxidation of the internucleotide linkages may be performed
using any suitable methods. As used herein, the terms "oxidize,"
"oxidation," "oxidizing", and the like, in reference to a
phosphorus-containing internucleosidic linkage means a process or
treatment for converting the phosphorus atom of the linkage from a
phosphorus (III) form to a phosphorus (V) form. In certain
embodiments, the method further includes, after the first coupling
step, exposing the contacted nucleoside residue to an oxidizing
agent to oxidize the linkage and produce a first coupled and
oxidized product.
[0044] Aspects of the present disclosure include a double coupling
procedure where no capping step is performed prior to oxidation. In
some cases, no capping step is performed during the synthesis
cycle. In some cases, a capping step is performed after all
oxidation steps have been performed and before deprotection. In
certain instances, the method optionally includes a capping step
before or after the final oxidation step. As used herein, "capping"
refers to a step involving reacting any residual free terminal
groups of the growing oligonucleotide that remain unreacted with
incoming nucleotide reactant after coupling.
[0045] Aspects of the present disclosure include removal of the
reagents from the first coupling before the addition of the
reagents for the second coupling. This can be done by introducing a
wash step in between the two coupling steps, or by performing an
oxidation step in between the two coupling steps, followed by a
wash step. In the latter, the oxidation reagents can both remove
the reagents from the first coupling and oxidize the phosphorus
from the P(III) to the P(V) state. The wash step after the
oxidation step serves to remove the oxidation reagents and prepare
the oligonucleotide for the second coupling step.
[0046] The steps of the subject methods described herein include a
washing step performed after the first coupling step and before the
second coupling step. The washing step can be preceded by an
oxidation step. Any suitable solvents, acids, bases, salts, other
additives and combinations thereof can be utilized in wash
solutions that find use in the subject methods. In some instances,
the subject method includes the following steps: first coupling,
oxidation, washing, second coupling, oxidation. In some instances,
the subject method includes the following steps: first coupling,
washing, second coupling, oxidation with no capping step. In some
instances, the subject method includes the following steps: first
coupling, washing, second coupling, washing, oxidation with no
capping step. In some instances, the subject method includes the
following steps: first coupling, washing, oxidation, washing,
second coupling, oxidation. In some instances, the subject method
includes the following steps: first coupling, washing, oxidation,
washing, second coupling, washing, oxidation. In some instances,
the subject method includes the following steps: first coupling,
washing, second coupling, oxidation, followed by capping. In some
instances, the subject method includes the following steps: first
coupling, washing, second coupling, washing, oxidation, followed by
capping.
[0047] In some embodiments, the subject methods include one or more
washing steps. In certain cases, after each oxidation step, the
solid support to which the growing oligonucleotide is attached is
washed with a suitable solvent. In certain cases of the subject
methods where no oxidation step is performed between the first and
second couplings of a double couple cycle, the solid support to
which the growing oligonucleotide is attached is washed with a
suitable solvent after the first coupling step. In certain cases,
after each deprotection step (e.g., detritylation), the solid
support to which the growing oligonucleotide is attached is washed
with a suitable solvent. In certain instances, the solvent used in
the one or more washing steps is acetonitrile.
[0048] The nucleoside residue can be attached to any suitable solid
support, e.g., as described in greater detail herein. As used
herein, the term "attached" means a nucleoside residue is bound or
linked to a solid support, directly or indirectly, via a covalent
bond or a non-covalent interaction. In certain instances, a
nucleoside residue is attached to a solid phase support via a
growing oligonucleotide chain and a linker that is covalently
bonded to the support.
[0049] In some instances, the subject double coupling method is
performed using a nucleoside residue attached to a support that is
substantially solid. In some cases, the support is a substantially
smooth surface. In some cases, the support is a substantially
smooth and substantially solid surface. The support may be planar.
Any suitable supports that find use in oligonucleotide arrays can
be adapted for use in the subject double coupling methods.
[0050] Any suitable protecting groups can be utilized to protect
the terminal group of the incoming monomer or dimer nucleoside
reactant during coupling. Any suitable hydroxyl, amino or thiol
protecting groups can be utilized. In some instances, the subject
method further includes deprotecting the protected hydroxyl groups
of the terminal nucleoside residue that is formed as a product of
the coupling. After deprotection, a free terminal group is exposed
to which further protected nucleoside monomer or dimer reactants
may be coupled as needed.
Methods of Oligonucleotide Synthesis
[0051] Aspects of the present disclosure include methods of
oligonucleotide synthesis that include the subject double coupling
method, e.g., as described herein. In certain instances, the method
is performed to prepare an oligonucleotide attached to a solid
support that is a substantially solid, substantially smooth surface
(e.g., a smooth planar surface).
[0052] Any suitable coupling chemistry, coupling reagents and
methods may be utilized in the subject methods. Considerable
guidance in making selections concerning coupling conditions,
protecting groups, solid phase supports, linking groups,
deprotection reagents, reagents to cleave products from solid phase
supports, purification of product, and the like, in the context of
the subject methods can be found in literature, e.g. Gait, editor,
Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford,
1984); Amarnath and Broom, Chemical Reviews, Vol. 77, pgs. 183-217
(1977); Pon et al, Biotechniques, Vol. 6, pgs. 768-775 (1988);
Ohtsuka et al, Nucleic Acids Research, Vol. 10, pgs. 6553-6570
(1982); Eckstein, editor Oligonucleotides. and Analogues: A
Practical Approach (IRL Press, Oxford, 1991), Greene and Wuts
"Protective Groups in Organic Synthesis", Third edition, Wiley, New
York 1999, Narang, editor, Synthesis and Applications of DNA and
RNA (Academic Press, New York, 1987), Beaucage and Iyer,
Tetrahedron 48: 2223-2311 (1992), and like references.
[0053] The coupling step of the subject methods may be carried out
in any suitable temperature range. In some instances, the reaction
is carried out at ambient temperature (about 15-30 degrees
Celsius). The reaction may be performed by adding a solution of the
phosphoramidite dimer or monomer and a solution of an activator (or
a solution containing the phosphoramidite dimer or monomer and the
activator) to the reaction chamber containing the free hydroxyl
group of an (oligo)nucleotide covalently attached to a solid
support. Generally, activators of interest include nucleophilic
catalysts that displace the more stable phosphoramidite amino group
to form a highly reactive (and less stable) intermediate which, in
turn, reacts with the free 5' hydroxyl group of a solid supported
oligonucleotide The monomer (or dimer) and the activator can be
premixed, mixed in the valve-block of a suitable synthesizer, mixed
in a pre-activation vessel and pre-equilibrated if desired, or they
can be added separately to the reaction chamber.
[0054] Activators of interest that may be utilized in the subject
methods include, but are not limited to, 5-(benzylthio)tetrazole,
tetrazole, 5-(ethylthio)tetrazole, 5-(4-nitrophenyl)tetrazole,
5-(2-thiophene) tetrazole, triazole, pyridinium chloride, and the
like, e.g. activating agents as described by Beaucage and Iyer
Tetrahedron 48: 2223-2311 (1992); Berner et al, Nucleic Acids
Research, 17: 853-864 (1989); Benson, Chem. Rev. 41: 1-61 (1947).
As used herein, the term "tetrazole activator" refers to activators
which are tetrazole or derivatives of tetrazole. In some
embodiments, the activator is tetrazole. Convenient solvents
include, but are not limited to, propylene carbonate, acetonitrile,
tetrahydrofuran, methylene chloride, and the like, and mixtures
thereof.
[0055] Any suitable protecting group strategies, e.g., protecting
group strategies of oligonucleotide synthesis methods, can be
adopted for use in the subject methods. For example, when the
nucleoside residues include naturally occurring nucleobases,
nucleobase protecting groups such as acyl protecting groups (e.g.,
isobutyryl or benzoyl) or amidine-type protecting groups (e.g.,
N,N-dialkylformamidinyl) can be utilized to prevent undesirable
side reactions.
[0056] Any suitable protecting groups can be utilized to protect
the terminal group of the incoming monomer or dimer nucleoside
reactant during coupling. In certain instances, the terminal group
is a hydroxyl, an amino or a thiol group and the protecting group
is an acid-labile protecting group such as a triarylmethyl
protecting group (e.g., DMT (4,4'-dimethoxytriphenylmethyl)) or a
BOC carbamate (tert-butoxycarbonyl), or a base-labile protecting
group, such as a FMOC (fluorenylmethyloxycarbonyl). In some
instances, the subject method further includes deprotecting the
protected hydroxyl group of the terminal nucleoside residue
attached to the solid phase support to produce free hydroxy groups;
and repeating the synthesis cycle until the target oligonucleotide
sequence is synthesized.
[0057] Oxidation of the internucleotide linkages may be performed
using any suitable methods. Oxidizing agents which are useful in
the subject methods include, but are not limited to, iodine,
chlorine, bromine, peracids such as m-chlorobenzoic acid,
hydroperoxides such as t-butylhydroperoxide, ethyl hydroperoxide,
methyl hydroperoxide and the like, 10-camphorsulfonyl)-oxaziridine,
ozone, mixed acyl-sulfinic anhydrides such as
3H-2,1-benzoxathiolan-3-one-1-oxide, salts of persulfates such as
sodium, ammonium, and tetrabutylammonium persulfate and the like,
monoperoxysulfates such as Oxone.TM., sodium and/or other
hypochlorites, peroxides such as diethyl peroxide or
bis(trimethylsilyl)peroxide, or hydrogen peroxide or non-aqueous
hydrogen peroxide equivalents such as urea/hydrogen peroxide
complex, etc. In some cases oxidation reagents may be dissolved in
aqueous solutions, such as iodine dissolved in a mixture of water,
tetrahydrofuran and pyridine. In some cases oxidation reagents may
be dissolved in anhydrous organic solvents, such as
10-camphorsulfonyl)-oxaziridine dissolved in anhydrous
acetonitrile. Other useful oxidizing agents which may be used to
convert phosphorus (III) to phosphorus (V) are described in
Beaucage and Iyer Tetrahedron 48: 2223-2311 (1992).
[0058] In some instances, oxidizing an internucleoside linkage
includes sulfurization to produce a thio-containing P(V) linkage
(e.g., a thiophosphoramidate or thiophosphate linkage).
Sulfurization may be performed using any convenient methods.
Sulfurization methods of interest include those described by
Gryazonov et al., WO2001018015, the disclosure of which is herein
incorporated by reference in its entirety. Sulfurizing agents for
use in the invention include elemental sulfur, thiuram disulfides
such as tetraethyl thiuram disulfide, acyl disulfides such as
phenacyldisulfide, phosphinothioyl disulfides such as S-Tetra.TM.,
and 1,1-dioxo-3H-1,2-benzodithiol-3-one. In some embodiments,
sulfurization may be performed using elemental sulfur (S8). In
certain embodiments, sulfurization may be performed using Beaucage
reagent, using methods as described by Iyer et al., J. Organic
Chemistry 55:4693-4699, 1990.
[0059] Any suitable capping reagents may be utilized to cap the
free terminal groups. In general, during conventional
oligonucleotide synthesis, a small percentage (e.g., 0.1 to 1%) of
the solid support-bound free terminal groups (e.g., 5'-OH groups)
remains unreacted and needs to be permanently blocked from further
chain elongation to prevent the formation of oligonucleotides with
an internal base deletion commonly referred to as (n-1) shortmers.
In some cases, capping includes acetylation using a capping mixture
(e.g., acetic anhydride and 4-dimethylaminopyridine or
1-methylimidazole). Any suitable capping reagents can be utilized.
Capping reagents useful in the subject methods include
electrophilic reagents such as acetic anhydride and the like, and
phosphoramidites, such as diethyleneglycol ethyl ether
(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite in conjunction
with an activator and followed by oxidation.
[0060] In certain embodiments, for 3'-to-5' synthesis, a
support-bound nucleoside residue is provided having the following
structure:
##STR00001##
wherein:
##STR00002##
represents the solid support (connected via an optional linker) or
a support-bound oligonucleotide chain;
[0061] R is hydrogen, protected hydroxyl group, fluoro, an alkoxy,
O-ethyleneoxyalkyl (O--CH.sub.2CH.sub.2OR), a protected amino, a
protected amido, or protected alkylamino wherein when R is
hydrogen, the support-bound nucleoside is a deoxyribonucleoside, as
will be present in DNA synthesis, and when R is a protected
hydroxyl group, the support-bound nucleoside is a ribonucleoside,
as will be present in RNA synthesis; and B is a nucleobase or a
protected nucleobase, e.g. a purine or pyrimidine base.
[0062] In certain embodiments, the nucleobase may be a conventional
purine or pyrimidine base, e.g., adenine (A), thymine (T), cytosine
(C), guanine (G) or uracil (U), or a protected form thereof, e.g.,
wherein the base is protected with a protecting group such as
acetyl, difluoroacetyl, trifluoroacetyl, isobutyryl, benzoyl,
N,N-dimethylformamidine, N,N-dimethylacetamidine,
N,N-dibutylformamidine, or the like. The purine or pyrimidine base
may also be an analog of the foregoing; suitable analogs include,
but are not limited to: 1-methyladenine, 2-methyladenine,
N.sup.6-methyladenine, N.sup.6-isopentyladenine,
2-methylthio-N.sup.6-isopentyladenine, N,N-dimethyladenine,
8-bromoadenine, 7-deazaadenine, 2-thiocytosine, 3-methylcytosine,
5-methyl cytosine, 5-ethyl cytosine, 4-acetyl cytosine,
1-methylguanine, 2-methylguanine, 7-methylguanine,
2,2-dimethylguanine, 8-bromoguanine, 8-chloroguanine,
8-aminoguanine, 8-methylguanine, 8-thioguanine, 7-deazaguanine,
7-deaza-8-azaguanine, 5-fluorouracil, 5-bromouracil,
5-chlorouracil, 5-iodouracil, 5-ethyluracil, 5-propyluracil,
5-methoxyuracil, 5-hydroxymethyluracil,
5-(carboxyhydroxymethyl)uracil, 5-(methylaminomethyl)uracil,
5-(carboxymethylaminomethyl)-uracil, 2-thiouracil,
5-methyl-2-thiouracil, 5-(2-bromovinyl)uracil, uracil-5-oxyacetic
acid, uracil-5-oxyacetic acid methyl ester, pseudouracil,
1-methylpseudouracil, queosine, inosine, 1-methylinosine,
hypoxanthine, xanthine, 2-aminopurine, 6-hydroxyaminopurine,
6-thiopurine and 2,6-diaminopurine.
[0063] In some embodiments, synthesis of oligonucleotides includes
repeating the subject double coupling method twice or more during
synthesis, such as 30 times or more, 40 times or more, 50 times or
more, 60 times or more, 70 times or more, 80 times or more, 90
times or more, 100 times or more, 150 times or more, 200 times or
more, or even 300 times or more. In certain embodiments, the double
coupling method described herein is performed at every coupling
step in the sequence.
[0064] In another aspect, the present disclosure provides a method
for synthesizing a DNA. In certain embodiments, the synthesized
nucleic acid (e.g., a DNA) has a sequence of 30 nucleotides or
more, such as 40 nucleotides or more, 50 nucleotides or more, 60
nucleotides or more, 70 nucleotides or more, 80 nucleotides or
more, 90 nucleotides or more, 100 nucleotides or more, 125
nucleotides or more, 150 nucleotides or more, 175 nucleotides or
more, 200 nucleotides or more, 300 nucleotides or more, or 500
nucleotides or more. In certain embodiments, the synthesized
nucleic acid is 1000 nucleotides or less in length. In some
instances, in any one of the embodiments described above, the
synthesized nucleic acid (e.g., a DNA) has a sequence having 1000
nucleotides or less, such as 500 nucleotides or less, 400
nucleotides or less, or 300 nucleotides or less. In certain
embodiments, the synthesized DNA has a sequence of between about 30
and about 500 nucleotides, such as between about 30 and about 200
nucleotides, between about 30 and about 100 nucleotides, between
about 40 and about 100 nucleotides, between about 40 and about 80
nucleotides, between about 50 and about 70 nucleotides, or between
about 55 and about 65 nucleotides. In certain embodiments, the
synthesized DNA has a sequence of between about 70 and about 200
nucleotides, such as between about 80 and about 200 nucleotides,
between about 90 and about 200 nucleotides, between about 100 and
about 200 nucleotides, between about 120 and about 200 nucleotides,
or between about 150 and about 200 nucleotides. In certain
embodiments, the synthesized DNA has a sequence of between about 50
and about 500 nucleotides, such as between about 100 and about 400
nucleotides, between about 150 and about 300 nucleotides, or
between about 200 and about 300 nucleotides. In certain
embodiments, the synthesized DNA is of a length of about 200-mer to
about 1,000-mer, (e.g., containing, from about 200-mer to about
800-mer, from about 200-mer to about 500-mer, from about 300-mer to
about 800-mer, from about 300-mer to about 500-mer).
[0065] In certain embodiments, the synthesized oligonucleotide has
a reduced error rate in comparison to a conventional method of
synthesis (e.g., as described herein), such as an error rate that
is reduced to 50% or less, 40% or less, 30% or less, 20% or less,
10% or less, or 5% or less, of that achieved using a control method
(for example, if the error rate using a control method is 1 error
in 400 nucleotides, a reduction to 10% or less results in 1 error
in 4000 or more nucleotides). In some embodiments, the
oligonucleotide synthesized according to the subject method
includes fewer single nucleotide deletions per 100 nucleotides than
is achieved using a control method. In certain embodiments, the
oligonucleotide synthesized according to the subject method gives
an overall single base deletion rate of 1 in 500, or better
("better" in this context means fewer than 1 single base deletion
in 500 nucleotides), such as 1 in 600 or better, 1 in 700 or
better, 1 in 800 or better, 1 in 900 or better, 1 in 1000 or
better, 1 in 1250 or better, 1 in 1750 or better, 1 in 2000 or
better, 1 in 2250 or better, 1 in 2500 or better, 1 in 2750 or
better, 1 in 3000 or better, 1 in 3250 or better, 1 in 3500 or
better, 1 in 3750 or better, or 1 in 4000 or better. Any suitable
methods can be utilized in determining the error rate. Methods of
interest include those described by Hecker KH, and R L Rill (1998
Error analysis of chemically synthesized polynucleotides.
BioTechniques 24: 256-260).
[0066] The method may further comprise calculating the overall
cycle yield of an oligonucleotide synthesis reaction, where the
term "overall cycle yield" refers to the percentage of n+1 products
relative to the amount of n+1 product (a product to which a
nucleotide has been added) and n+0 product (a product to which a
nucleotide not been added) made during each cycle of a synthesis
reaction. The cycle yield can be obtained using the equation:
Cycle yield=(F/(M+F)).sup.1/C
[0067] Where
[0068] F=amount of full length oligonucleotide
[0069] M=total amount of oligonucleotides having a reduced length
as compared to the desired sequence (e.g. n-1, n-2, n-3, etc)
[0070] C=number of cycles
[0071] In another embodiment, the method may further comprise
calculating the single base deletion rate of an oligonucleotide
synthesis reaction. The term "single base deletion rate" refers to
the rate at which an oligonucleotide synthesis reaction fails to
add a monomer, expressed in a per nucleotide basis.
[0072] If no capping is performed, the single base deletion rate
can be calculated from the cycle yield using the equation:
Single base deletion rate=1/(1-cycle yield)
[0073] which results in a calculated single base deletion rate of 1
in X. This means that on average, one out of every X nucleotides
synthesized will be missing. For example, if no capping is
performed, an oligonucleotide synthesis reaction that has an
overall cycle yield of 99% has a single base deletion rate of 1 in
100.
[0074] Aspects of the present disclosure further include the
nucleic acid products of the subject methods. The nucleic acid
products, e.g., RNA, DNA, of the methods of the disclosure may vary
in size, ranging in certain embodiments from 30 or more monomeric
units in length, such as 50 or more, 100 or more, 150 or more, 200
or more, 250 or more, 300 or more, 350 or more, 400 or more, 450 or
more, 500 or more, or even more. In some instances, the nucleic
acids are 1000 nucleotides or less in length. In some embodiments,
the nucleic acid products are 100 to 1000 monomeric units in
length, including, inter alia, 100 to 500 monomeric units in
length, such as 200 to 400 or 300 to 500 monomeric units in length,
In certain embodiments, the nucleic acid product has a reduced
error rate as described above.
[0075] The synthetic methods of the present disclosure may be
conducted on any suitable solid support having a surface to which
chemical entities may bind. In some embodiments, oligonucleotides
being synthesized are attached to a support directly or indirectly.
The support may optionally be placed in an array of wells or
channels. Suitable solid supports may have a variety of forms and
compositions and derive from naturally occurring materials,
naturally occurring materials that have been synthetically
modified, or synthetic materials. In some instances, the support
surface is substantially solid. In some cases, the support surface
is substantially smooth. In some cases the support surface is
substantially solid and substantially smooth. Any suitable supports
that find use in oligonucleotide arrays or are used for creating
libraries of oligonucleotides on a surface using an inkjet
printhead can be adapted for use in the subject methods and
compositions. In some cases, the support has a planar surface. In
some cases, the planar supports further include a surface layer,
e.g., a polymeric matrix or monolayer connected to the underlying
support material that includes a density of functional groups
suitable for oligonucleotide attachment.
[0076] In some cases, a "substantially smooth surface" is a planar
surface. The attributes of a substantially solid, substantially
smooth surface are a function of the surface itself regardless of
the underlying structure supporting the surface and regardless of
the shape of the surface. A solid, smooth surface need not be flat
or planar, and would include for example, flat surfaces, tubes,
cylinders, arrays of depressions or wells, combinations of these
elements, as well as other designs presenting surface portions with
the above described attributes. In some instances, the solid
support includes an array of wells. In some instances, the solid
support is configured to include a microarray of
oligonucleotides.
[0077] In certain embodiments, the surface of the support where the
oligonucleotide synthesis occurs should be sufficiently regular to
permit surface application of reagents applied by an inkjet. The
substantially solid, substantially smooth surfaces (or portions
thereof) can be addressed by an inkjet printhead, in which various
reagents involved in phosphoramidite oligonucleotide synthesis
chemistry can be applied to particular locations on the
surface.
[0078] Examples of substantially solid and substantially smooth
surfaces include, without being limited to, glass, fused silica,
silicon dioxide, and silicon. The surfaces may be chemically
derivatized while still being substantially solid and substantially
smooth (such as described in U.S. Pat. No. 6,444,268, the
disclosure of which is herein incorporated by reference in its
entirety with respect to surface derivatization)). In contrast,
controlled pore glass has extensive pores and is not a
substantially solid and substantially smooth surface.
[0079] Suitable solid supports are in some cases polymeric, and may
have a variety of forms and compositions and derive from naturally
occurring materials, naturally occurring materials that have been
synthetically modified, or synthetic materials. Examples of
suitable support materials include, but are not limited to,
polysaccharides such as agarose (e.g., that available commercially
as Sepharose.RTM., from Pharmacia) and dextran (e.g., those
available commercially under the tradenames Sephadex.RTM. and
Sephacryl.RTM., also from Pharmacia), polyacrylamides,
polystyrenes, polyvinyl alcohols, copolymers of hydroxyethyl
methacrylate and methyl methacrylate, silicas, teflons, glasses,
and the like.
[0080] The initial monomer of the polynucleotide to be synthesized
on the support surface is in some cases bound to a linking moiety
which is in turn bound to a surface hydrophilic group, e.g., to a
surface hydroxyl moiety present on the support. In some cases the
polynucleotide is synthesized on a cleavable linker. In some cases
the cleavable linker is synthesized at the end of a polynucleotide
stilt, which in turn is bound to a surface hydrophilic group, e.g.,
to a surface hydroxyl moiety present on the support. In certain
embodiments of the method said method further comprises cleaving
the oligonucleotide from the solid support to produce a free
oligonucleotide (e.g., a free nucleic acid). Examples of suitable
support materials include, but are not limited to, silicas, silicon
and silicon oxide (including any materials used in semiconductor
fabrication), teflons, glasses, polysaccharides such as agarose
(e.g., Sepharose.RTM. from Pharmacia) and dextran (e.g.,
Sephadex.RTM. and Sephacryl.RTM., also from Pharmacia),
polyacrylamides, polystyrenes, polyvinyl alcohols, copolymers of
hydroxyethyl methacrylate and methyl methacrylate, and the like. In
some cases, the initial monomer of the oligonucleotide to be
synthesized on the support surface is bound to a linking moiety
which is in turn bound to a surface hydrophilic group, e.g., a
surface hydroxyl moiety present on a silica support. In some
embodiments, a universal linker is used. In some other embodiments,
the initial monomer is reacted directly with, e.g., a surface
hydroxyl moiety.
[0081] In some embodiments, multiple oligonucleotides being
synthesized are attached, directly or indirectly, to the same
substantially solid, substantially smooth support and may form part
of an array. An "array" is a collection of separate molecules of
known monomeric sequence each arranged in a spatially defined and a
physically addressable manner, such that the location of each
sequence is known. The number of locations, or "features," that can
be contained on an array will largely be determined by the area of
the support, the size of a feature and the spacing between
features, wherein the array surface may or may not comprise a local
background region represented by non-feature area. Arrays can have
densities of up to several hundred thousand or more features per
cm.sup.2, such as 2,500 to 200,000 features/cm.sup.2. The features
may or may not be covalently bonded to the support. An "array"
includes any one-dimensional, two-dimensional or substantially
two-dimensional (as well as a three-dimensional) arrangement of
addressable regions bearing a particular chemical moiety or
moieties (such as ligands, e.g., biopolymers such as polynucleotide
or oligonucleotide sequences (nucleic acids), polypeptides (e.g.,
proteins), carbohydrates, lipids, etc.) associated with that
region. An array is "addressable" when it has multiple regions of
different moieties (e.g., different polynucleotide sequences) such
that a region (i.e., a "feature" or "spot" of the array) at a
particular predetermined location (i.e., an "address") on the array
will comprises a known predetermined polynucleotide sequence. In
some instances, the addressable array will hybridize to a
particular target or class of targets (although a feature may
incidentally bind non-targets of that feature). Array features are
typically, but need not be, separated by intervening spaces.
[0082] The solid support comprising an array may be substantially
planar or may comprise a plurality of microstructures, such as
wells, channels and microchannels, elevated columns or posts. In
some embodiments, the array is part of a microfluidic device, and
is two or three-dimensional.
[0083] In some embodiments, an array of nucleic acids is
synthesized by the method and compositions of the present
disclosure. Oligonucleotide synthesis on an array can be performed
using any suitable methods, where at least one of the couplings
performed at a position of the array is a double coupling according
to the subject methods. As such, an array of oligonucleotides can
be prepared via double coupling a plurality of protected nucleoside
phosphoramidites to a plurality of nucleoside residues located at
their respective positions of a substantially solid, substantially
smooth support surface according to the subject method (e.g., as
described herein). It is understood that the steps of array
synthesis can be performed in parallel (e.g., where a first step is
performed at multiple positions of the array, before a second step
is performed at those positions).
[0084] In some embodiments, the nucleic acids are kept attached to
the array for their use in array-based applications (such as for
example gene expression, cytogenetics, genotyping, transcripts or
exons profiling etc.). In other embodiments, the nucleic acids are
all--or sometime only a subset--released from the substantially
solid, substantially smooth support to produce a library or
libraries of nucleic acids, or pools that can be optionally
amplified prior to or after cleavage from the support. Pools or
libraries of nucleic acids can be used for example as baits for
selective target enrichment, or used as probes for in situ
hybridization assays (e.g. oligonucleotide FISH) or other
hybridization assays, multiplex site-directed mutagenesis,
multiplex genome engineering and accelerated evolution (MAGE),
genes knockout with libraries encoding siRNAs, shRNAs, miRNAs,
genome engineering with libraries of nucleic acids encoding CRISPR
RNAs and/or Cas proteins, or assembled and ligated into longer DNA
fragments, genes and/or genome. In some embodiments, the assembled
nucleic acids are DNA having a length from about from about 100
nucleotides to about 5000 nucleotides, such as from about 500
nucleotides to about 1500 nucleotides. In other embodiments, the
length of the assembled nucleic acids may vary in size, ranging in
certain embodiments from 300 or more nucleotides in length, such as
500 or more, 600 or more, 700 or more, 800 or more, 900 or more,
1000 or more, or 5000 or more nucleotides.
[0085] Also provided is a library of nucleic acids produced using
the subject compositions and methods. In some embodiments of the
library, the library includes a plurality of nucleic acids, where
each nucleic acid is synthesized by a subject method as described
herein. Also provided is a library including a plurality of nucleic
acids having a length from about 300 to about 10,000 nucleotides,
wherein each nucleic acid is composed of assembled nucleic acid
fragments synthesized by a subject method as described herein. The
nucleic acids may be free nucleic acids. The plurality of nucleic
acids may have sequences that together define a gene of interest.
The plurality of nucleic acids of the library may be assembled into
a gene or fragment of a gene, e.g., using any suitable methods of
fragment coupling.
[0086] The product nucleic acids find use in a variety of
applications, including research, diagnostic and therapeutic
applications. For example, the product nucleic acids find use in
research applications such as genomics, cytogenetics, target
enrichment and sequencing, site-directed mutagenesis, synthetic
biology, gene synthesis, gene assembly, e.g., as probes, primers,
gene fragments, DNA/RNA arrays, libraries of nucleic acids. With
respect to diagnostic applications, such as genomics, cytogenetics,
oncology, infectious diseases, non-invasive prenatal testing
(NIPT), target enrichment and sequencing, the product nucleic acids
may also find use as probes (for example oligoFISH), primers, gene
fragments, transcripts, DNA/RNA arrays, libraries of nucleic acids,
libraries of transcripts or other agents employed in diagnostic
protocols. With respect to therapeutic applications, the product
nucleic acids find use as any DNA, RNA or other nucleic acid
therapeutic, such as antisense nucleic acids, in gene therapy
applications, gene editing, interfering RNA (i.e., iRNA or RNAi)
applications, etc.
[0087] Oligonucleotide containing compositions synthesized
according to the disclosed methods are also provided. In some
cases, the composition includes a population of chemically
synthesized oligonucleotides containing fewer than 1 single base
deletion in 500 nucleotides as compared to the desired sequence. In
certain embodiments, the oligonucleotide compositions contain fewer
than 1 in 600, 1 in 700, 1 in 800, 1 in 900, 1 in 1000, 1 in 1250,
1 in 1750, 1 in 2000, 1 in 2250, etc., single base deletion as
compared to the desired sequence. In certain instances, the
composition comprises a plurality of chemically synthesized
oligonucleotides, wherein the oligonucleotides collectively contain
fewer than 1 in 1250 single base deletions as compared to the
desired oligonucleotide sequence of the plurality of chemically
synthesized oligonucleotides.
EXAMPLES
Example 1
[0088] The capping step is sometimes left out in the production of
DNA microarrays (LeProust E M, Peck B J, Spirin K, McCuen H B,
Moore B, Namsaraev E, Caruthers M H: Synthesis of high-quality
libraries of long (150mer) oligonucleotides by a novel depurination
controlled process. Nucleic Acids Res 2010, 38(8):2522-2540) with
the result that coupling and detritylation failures are both
exhibited as increased amounts of (n-1)mer, and to a lesser extent,
(n-2), (n-3), etc., as would be predicted by a binomial
distribution. In such cases, oligonucleotide libraries that are
prepared using a single coupling step and cleaved off of the
surface of microarrays show single base deletion rates as high as
about 1 in 350 to 1 in 300 or worse. Coupling efficiency is
affected by, among other factors, both concentration and the
relative amount of phosphoramidite used. In some cases, a 3 to 30
fold excess of phosphoramidite over oligonucleotide is used during
coupling, e.g., in some cases when synthesizing on a controlled
pore glass. With a DNA writer, printing on a substantially solid
and substantially smooth surface, the molar excess of
phosphoramidite used relative to the oligonucleotides present in a
single feature on the microarray is on the order of 25,000.times..
Under such conditions, it was expected that the reaction is not
limited by phosphoramidite, and that double coupling will not help.
However, surprisingly, it was discovered that even though there is
a very large excess of phosphoramidite present relative to the
5'-hydroxyl oligonucleotide during the coupling step, the single
base deletion rate can be improved by performing a second coupling
step. The second coupling step can be done after a wash step. The
second coupling can be done after an oxidation step. The second
coupling can be done after a wash step with no previous oxidation
step, and where the second coupling is not followed by a capping
step. The second coupling can be done after a wash step with no
previous oxidation step, and where the second coupling is followed
by an oxidation step, then a capping step.
Any method of double coupling described here can be performed using
a DNA writer on a substantially solid and substantially smooth
support.
[0089] A. Error Rate Determined by Sequencing.
[0090] An Agilent DNA writer was used to print a short stilt at the
3'-end comprising 7 dT nucleotides and a cleavable linker, followed
by the 150mer oligo below. The synthesis was performed on a glass
slide derivatized according to U.S. Pat. No. 6,444,268
TABLE-US-00001 (SEQ ID NO: 1)
5'-ATCGCACCAGCGTGT_TGCACATGAAGTATTTATCCACCTGTTTTA
TTTTCATGAAGTTCTTAGACTAGCTGAATTTGTCTTTAAAATATTTGT
GCAAAGCTATTAATATACACATTTTGTAAAAAAAAAAAAAAA_CACT GCGGCTCCTCA-3'
[0091] The 15mer segments at the 5' and 3' ends, shown separated by
an underscore, were used as primers for PCR amplification, leaving
120 nucleotides for sequencing determination of single base
deletions.
[0092] Three conditions were used for synthesizing the 150mer:
1. Normal single coupling.
[0093] a. Couple
[0094] b. Wash with oxidation solution
[0095] c. Wash with acetonitrile
[0096] d. Normal detritylation and wash.
2. Double couple with oxidation between coupling step
[0097] a. 1st Couple
[0098] b. Wash with oxidation solution
[0099] c. Wash with acetonitrile
[0100] d. 2nd couple
[0101] e. Wash with oxidation solution
[0102] f. Wash with acetonitrile
[0103] g. Normal detritylation and wash.
3. Double couple with no oxidation between coupling steps
[0104] a. 1st Couple
[0105] b. Wash with acetonitrile
[0106] c. 2nd couple
[0107] d. Wash with oxidation solution
[0108] e. Wash with acetonitrile
[0109] f. Normal detritylation and wash.
Experiment 1 (110817), Deletion Rates were Determined by Cloning
and Sequencing
TABLE-US-00002 Condition 1 1 in 316 single base deletion Single
couple control rate (from 88 clones) Condition 2 1 in 1660 single
base deletion Double couple with oxidation rate (from 83 clones)
Condition 3 Double couple with no oxidation gave very little full
length material
Experiment 2 (120514). Deletion Rates were Determined by Cloning
and Sequencing
TABLE-US-00003 Condition 1 1 in 328 single base deletion Single
couple control rate (from 82 clones) Condition 2 1 in 2256 single
base deletion Double couple with oxidation rate (from 94 clones)
Condition 3 Double couple with no oxidation gave slightly less full
length material than with oxidation.
[0110] B. Error Rate Determined by HPLC
[0111] An Agilent DNA writer was used to print a 30mer oligo using
the 3 conditions described in section A. The oligo was cleaved off
of the surface.
[0112] Cycle yields and single base deletion error rates were
obtained by determining the amount of full length material and the
amount of oligonucleotides having a reduced length. In this
example, the performance of the DNA writer was degraded for reasons
unrelated to the double coupling, but the double coupling
experiments still showed a significant improvement in the single
base deletion rate.
Experiment 3 (160212) Deletion Rates were Determined by HPLC
TABLE-US-00004 Condition 1 1 in 201 single base deletion rate
Single couple control Condition 2 1 in 556 single base deletion
rate Double couple with oxidation Condition 3 1 in 333 single base
deletion rate Double couple with no oxidation.
Exemplary Embodiments
[0113] Notwithstanding the appended claims, the disclosure set
forth herein also contemplates, for example, the following
embodiments.
[0114] 1. A method for synthesizing an oligonucleotide comprising:
performing a double coupling cycle at one or more nucleotides of
the oligonucleotide sequence during synthesis, wherein the double
coupling cycle comprises a first coupling step and a second
coupling step, on a substantially solid and substantially smooth
surface.
[0115] 2. The method of clause 1, wherein the double coupling cycle
comprises an oxidation step between the first and second coupling
steps.
[0116] 3. A method for synthesizing an oligonucleotide comprising:
performing a double coupling cycle at one or more nucleotides of
the oligonucleotide sequence during synthesis, wherein the double
coupling cycle comprises a first coupling step and a second
coupling step, with an oxidation step between the first and second
coupling steps, but no capping before the oxidation step.
[0117] 4. The method of clause 3 performed on a substantially solid
and substantially smooth surface.
[0118] 5. The method of any preceding clauses, wherein a double
coupling cycle is performed at all nucleotides of the
oligonucleotide sequence during synthesis.
[0119] 6. A method of producing an array of oligonucleotide
features according to the method of any preceding embodiment,
wherein at least one double coupling cycle is performed on at least
one oligonucleotide feature during synthesis.
[0120] 7. The method of clause 6, wherein a double coupling cycle
is performed at each nucleotide of the oligonucleotide sequence of
each oligonucleotide feature during synthesis.
[0121] 8. The method of any preceding clauses, wherein
phosphoramidite coupling chemistry is utilized to synthesize the
oligonucleotide sequence.
[0122] 9. The method of any preceding embodiment, wherein the
oligonucleotide sequence is between about 50 and 1000 nucleotides
in length.
[0123] 10. The method of any preceding clause, wherein
oligonucleotides of 50-200 nucleotides in length are synthesized
with an overall error rate of less than 1 in 500
oligonucleotides.
[0124] 11. The method of clause 10, wherein the error rate is less
than 1 in 600, 1 in 700, 1 in 800, 1 in 900, 1 in 1000, 1 in 1250,
1 in 1750, 1 in 2000, or 1 in 2250 oligonucleotides.
[0125] 12. A composition comprising a plurality of chemically
synthesized oligonucleotides, wherein the oligonucleotides
collectively contain fewer than 1 in 1250 single base deletions as
compared to the desired oligonucleotide sequence of the plurality
of chemically synthesized oligonucleotides.
[0126] 13. The composition of clause 12, wherein the population of
chemically synthesized oligonucleotides contain fewer than 1 in
600, 1 in 700, 1 in 800, 1 in 900, 1 in 1000, 1 in 1250, 1 in 1750,
1 in 2000, 1 in 2250, etc., single base deletion as compared to the
desired sequence.
[0127] 14. The composition of clause 12 or 13, wherein the
composition is an array of oligonucleotide features, wherein each
feature comprises a population of oligonucleotides that contains
fewer than 1 in 1250 single base deletions as compared to compared
to the desired oligonucleotide sequence of the oligonucleotide
feature.
[0128] 15. The composition of any one of clauses 12 to 14, wherein
the desired oligonucleotide sequence is between about 50 and 1000
nucleotides in length.
[0129] 16. A method of synthesizing an array of oligonucleotides,
the method comprising:
[0130] (a) double coupling a first protected nucleoside
phosphoramidite to a first nucleoside residue located at a first
position of a planar solid phase support (e.g., as described
herein, e.g., according to the method of any one of clauses 1-11 or
claims 1-11);
[0131] (b) repeating step (a) at a plurality of locations on the
planar solid phase support.
[0132] 17. The method of clause 16, further comprising:
deprotecting the protected hydroxyl groups of the terminal
nucleoside residues attached to the plurality of locations of the
planar solid phase support to produce free hydroxy groups; and
repeating steps (a) through (b) until the array of oligonucleotides
is synthesized.
[0133] 18. A composition comprising a plurality of chemically
synthesized oligonucleotides, wherein the oligonucleotides contain
fewer than 1 in 1250 single base deletions as compared to the
desired oligonucleotide sequence of the plurality of chemically
synthesized oligonucleotides.
[0134] 19. The composition of clause 19, wherein the composition is
an array of oligonucleotide features, wherein each feature
comprises an oligonucleotide containing fewer than 1 single base
deletion in 1250 nucleotides.
[0135] 20. The composition of any one of clauses 18-19, wherein the
oligonucleotides comprise sequences of between about 50 and 1000
nucleotides in length.
[0136] 21. The composition of any one of clauses 18-20, wherein the
plurality of chemically synthesized oligonucleotides define a
library of oligonucleotides capable of assembly into a gene or gene
fragment.
Additional Exemplary Embodiments
[0137] A1. A method for covalently adding a nucleotide to a
terminal nucleoside residue attached to a solid support, comprising
a double coupling cycle that comprises: [0138] (a) contacting the
terminal nucleoside residue with a first sample of nucleoside
phosphoramidite under conditions to couple the nucleoside
phosphoramidite to the terminal nucleoside residue via an
internucleoside linkage; [0139] (b) repeating (a) with a second
sample of nucleoside phosphoramidite; and [0140] (c) oxidizing the
internucleoside linkage.
[0141] A2. The method of A1, further comprising oxidizing the
internucleoside linkage after (a) and before (b).
[0142] A3. The method of A2, further comprising adding a capping
agent after (c), or between (b) and (c).
[0143] A4. The method of A1 or A2, wherein no capping is
performed.
[0144] A5. The method of any of the preceding embodiments, further
comprising a washing step between (a) and (b).
[0145] A6. The method of any of the preceding embodiments, further
comprising a washing step after (b) and before (c).
[0146] A7. The method of any of the preceding embodiments, wherein
the solid support comprises a substantially solid, substantially
smooth surface.
[0147] A8. The method of any of the preceding embodiments, wherein
the solid support is planar.
[0148] A9. The method of any of the preceding embodiments, wherein
an error of single base deletion occurs in one or less than one in
500 nucleotides.
[0149] A10. The method of any of the preceding embodiments, wherein
an error of single base deletion occurs in one or less than one in
1000 nucleotides.
[0150] A11. The method of any of the preceding embodiments, wherein
an error of single base deletion occurs in one or less than one in
1250 nucleotides.
[0151] A12. The method of any of the preceding embodiments, wherein
an error of single base deletion occurs in one or less than one in
2000 nucleotides.
[0152] A13. The method of any of the preceding embodiments, wherein
an error of single base deletion occurs in one or less than one in
3000 nucleotides.
[0153] A14. The method of any of the preceding embodiments, wherein
an error of single base deletion occurs in one or less than one in
4000 nucleotides.
[0154] A15. An array of oligonucleotides prepared using the method
of any of the preceding embodiments.
[0155] A16. A library of oligonucleotides prepared by cleaving the
oligonucleotides from the array of A15.
[0156] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it is readily apparent to those of ordinary skill
in the art in light of the teachings of this invention that certain
changes and modifications can be made thereto without departing
from the spirit or scope of the appended claims.
[0157] Accordingly, the preceding merely illustrates the principles
of the invention. It will be appreciated that those skilled in the
art will be able to devise various arrangements which, although not
explicitly described or shown herein, embody the principles of the
invention and are included within its spirit and scope.
Furthermore, all examples and conditional language recited herein
are principally intended to aid the reader in understanding the
principles of the invention and the concepts contributed by the
inventors to furthering the art, and are to be construed as being
without limitation to such specifically recited examples and
conditions. Moreover, all statements herein reciting principles,
aspects, and embodiments of the invention as well as specific
examples thereof, are intended to encompass both structural and
functional equivalents thereof. Additionally, it is intended that
such equivalents include both currently known equivalents and
equivalents developed in the future, i.e., any elements developed
that perform the same function, regardless of structure. The scope
of the present invention, therefore, is not intended to be limited
to the embodiments shown and described herein. Rather, the scope
and spirit of present invention is embodied by the appended
embodiments.
Sequence CWU 1
1
11150DNAArtificial SequencePolynucleotide synthesized in a
laboratory 1atcgcaccag cgtgttgcac atgaagtatt tatccacctg ttttattttc
atgaagttct 60tagactagct gaatttgtct ttaaaatatt tgtgcaaagc tattaatata
cacattttgt 120aaaaaaaaaa aaaaacactg cggctcctca 150
* * * * *