U.S. patent application number 16/054298 was filed with the patent office on 2019-02-07 for tracking and manipulating cellular rna via nuclear delivery of crispr/cas9.
The applicant listed for this patent is The Regents of the University of California. Invention is credited to Ranjan Batra, Mark Fang, David A. Nelles, Gene Yeo.
Application Number | 20190040370 16/054298 |
Document ID | / |
Family ID | 57750540 |
Filed Date | 2019-02-07 |
View All Diagrams
United States Patent
Application |
20190040370 |
Kind Code |
A1 |
Yeo; Gene ; et al. |
February 7, 2019 |
TRACKING AND MANIPULATING CELLULAR RNA VIA NUCLEAR DELIVERY OF
CRISPR/CAS9
Abstract
Cas9 polypeptides which target RNA and methods of using them are
provided.
Inventors: |
Yeo; Gene; (La Jolla,
CA) ; Nelles; David A.; (San Diego, CA) ;
Fang; Mark; (Oakland, CA) ; Batra; Ranjan;
(Oakland, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Regents of the University of California |
|
|
|
|
|
Family ID: |
57750540 |
Appl. No.: |
16/054298 |
Filed: |
August 3, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15359567 |
Nov 22, 2016 |
|
|
|
16054298 |
|
|
|
|
62259014 |
Nov 23, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/10 20130101;
A61P 31/22 20180101; A61P 25/14 20180101; A61P 31/12 20180101; C12N
9/22 20130101; A61P 1/16 20180101; A61P 31/04 20180101; C12N
2310/20 20170501; A61K 48/0058 20130101; A61P 31/20 20180101; A61P
37/04 20180101; C12N 15/113 20130101; C07K 2319/09 20130101; A61P
31/16 20180101; A61K 38/465 20130101; A61P 31/14 20180101; A61P
31/18 20180101; C12N 15/111 20130101; A61P 35/00 20180101; C07K
2319/80 20130101; Y02A 50/30 20180101; A61P 21/02 20180101; A61P
21/04 20180101 |
International
Class: |
C12N 9/22 20060101
C12N009/22; C12N 15/11 20060101 C12N015/11; A61K 48/00 20060101
A61K048/00; A61K 38/46 20060101 A61K038/46; C12N 15/113 20060101
C12N015/113 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED R&D
[0002] This invention was made with government support under NIH
Grant/Contract Numbers HG004659 and NS075449 awarded by the
National Institutes of Health of the United States of America. The
government has certain rights in the invention.
Claims
1.-20. (canceled)
21. A nucleic acid molecule encoding a 2-component RNA targeting
system comprising: (a) nucleic acid sequence encoding a truncated
nuclease-inactive RNA-targeted Cas9 (RCas9) polypeptide, wherein
the truncated nuclease-inactive RCas9 polypeptide lacks all or part
of its HNH domain compared to a wild-type (WT) Cas9 protein; and
(b) a single guide RNA (sgRNA) sequence comprising: (i) on its 5'
end, an RNA sequence that hybridizes to or binds to a target RNA
sequence comprising a repeat sequence selected from the group
consisting of CUG, CCUG, CAG, and GGGGCC; and (ii) on its 3' end,
an RNA sequence capable of binding to or associating with the
truncated nuclease-inactive RCas9 polypeptide, wherein the RNA
sequence capable of binding to or associating with the truncated
nuclease-inactive RCas9 polypeptide comprises or is derived from a
wild type guide RNA of an archaeal or a bacterial organism from
which the truncated nuclease-inactive RCas9 is derived; and wherein
the 2-component RNA targeting system recognizes and alters the
target RNA in a cell in the absence of a PAMmer.
22. The nucleic acid molecule of claim 21, wherein the truncated
nuclease-inactive RCas9 is missing residues 775-909 from
full-length Cas9 protein.
23. The nucleic acid molecule of claim 21, wherein the sequences of
a) and b) are in a single vector.
24. The nucleic acid molecule of claim 23, wherein the sequences of
a) and b) are a size of less than about 4.5 kb, or a size of less
than about 4.7 kb.
25. The nucleic acid molecule of claim 21, wherein the
nuclease-inactive RCas9 polypeptide and the RNA sequence capable of
binding to or associating with the nuclease-inactive RCas9
polypeptide comprises or is derived from Haloferax mediteranii,
Mycobacterium tuberculosis, Francisella tularensis subsp. novicida,
Pasteurella multocida, Neisseria meningitidis, Campylobacter
jejune, Streptococcus thermophilus, Campylobacter lari, Mycoplasma
gallisepticum str. F, Nitratifractor salsuginis str. DSM 16511,
Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria
cinerea, Gluconacetobacter diazotrophicus, Azospirillum B510,
Sphaerochaeta globus str. Buddy, Flavobacterium columnare,
Fluviicola taffensis, Bacteroides coprophilus, Mycoplasma mobile,
Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus
johnsonii, Staphylococcus pseudintermedius, Filifactor alocis,
Treponema denticola, Legionella pneumophila str. Paris, Sutterella
wadsworthensis, Corynebacter diphtheriae, Streptococcus aureus,
Francisella novicida, Francisella novicida, and an Natronobacterium
gregoryi.
26. The nucleic acid molecule of claim 21, wherein the 5' end of
the sgRNA is between about 15 to 25 nucleotides in length, and
wherein the RNA sequence of the RCas9 polypeptide scaffold is
between about 85 and 100 nucleotides in length.
27. The nucleic acid molecule of claim 21, wherein the truncated
nuclease-inactive RCas9 polypeptide is linked to an effector
polypeptide, a targeting agent, an enzyme, a detectable moiety, or
a combination thereof.
28. The nucleic acid molecule of claim 27, wherein the effector
polypeptide comprises an RNA modifying polypeptide.
29. nucleic acid molecule of claim 27, wherein the targeting agent
comprises: (a) a cytoplasmic polyadenylation element binding
protein (CPEB), a zinc finger binding protein (ZBP), TIA-1, PSF, a
DNA-binding domain (DBD) of PSF, fragile X mental retardation
protein (FMRP), IGF-II mRNA-binding protein (IMP)-1 (IMP 1), IMP2,
IMP3, a cytoskeleton binding protein, a transmembrane protein, or
(b) an engineered protein comprising a combination of domains of
the proteins of (a).
30. The nucleic acid molecule of claim 28, wherein the RNA
modifying polypeptide comprises a splicing factor or an RNA
splicing domain, a RBFOX2 domain-containing protein, a protein
known to influence RNA splicing, an RNA cleaving domain or a PTN
domain-containing protein.
31. The nucleic acid molecule of claim 30, wherein the RNA cleaving
domain comprises an endonuclease.
32. The nucleic acid molecule of claim 21, wherein the truncated
nuclease-inactive RCas9 lacks all of its HNH domain.
33. The nucleic acid molecule of claim 21, wherein the sequence of
a) comprises a promoter.
34. The nucleic acid molecule of claim 21, wherein the sequence of
b) comprises a U6 polymerase III promoter.
35. the nucleic acid molecule of claim 21, wherein the sequence of
b) comprises one or more point mutations that remove a
transcription termination sequence.
36. A method of recognizing and altering target RNA in a cell
comprising contacting the cell with the nucleic acid molecule of
claim 21, whereby the nucleic acid molecule encodes an RNA
targeting system which recognizes and alters target RNA in the cell
in the absence of a PAMmer.
37. A method of treating a disease, condition, or infection
associated with an RNA microsatellite repeat expansion in a
patient, comprising administering the nucleic acid molecule of
claim 21 to the patient, whereby the nucleic acid molecule encodes
an RNA targeting system which recognizes and alters target RNA
corresponding to the RNA microsatellite repeat expansion, and
wherein the disease, condition, or infection is selected from the
group consisting of myotonic dystrophy, Huntington's disease,
familial ALS, cancer, spinal muscular atrophy, spinocerebellar
ataxia, Fragile X-associated tremor/ataxia syndrome, Spinal-bulbar
muscular dystrophy, Oculopharyngeal muscular dystrophy, Fragile X
syndrome, a viral infection, a bacterial infection, a Herpesviridae
or herpes simplex virus infection, a human immunodeficiency virus
infection, an Epstein Barr virus infection, a hepatitis virus
infection, a Hepatitis A infection, a Hepatitis B infection, a
Hepatitis C infection, a Hepatitis D infection, a Hepatitis E
infection, a Zika virus infection, an enterovirus infection, a
Human Papillomavirus (HPV) infection, an influenza virus infection,
a Marburg virus infection, an Ebola virus infection, a Mumps virus
infection, a cytomegalovirus infection, a rotavirus infection, a
Rubella virus infection, a Varicella zoster virus infection, a
severe acute respiratory syndrome (SARS) infection, a coronavirus
infection, a Paramyxoviridae or measles virus infection, a West
Nile virus infection, a Yellow fever virus infection, or a Dengue
fever virus infection.
38. A cell or tissue comprising the nucleic acid molecule of claim
21.
39. A nucleic acid molecule encoding a 2-component RNA targeting
system comprising: (A) nucleic acid sequence encoding a
Campylobacter jejune RNA-targeted Cas9 (Rcas9) polypeptide; and (B)
a single guide RNA (sgRNA) sequence comprising: (i) on its 5' end,
an RNA sequence that hybridizes to or binds to a target RNA
sequence comprising a repeat sequence selected from the group
consisting of CUG, CCUG, CAG, and GGGGCC; and (ii) on its 3' end,
an RNA sequence capable of binding to or associating with the
Campylobacter jejune Rcas9 polypeptide, wherein the RNA sequence
capable of binding to or associating with the Campylobacter jejune
Rcas9 polypeptide comprises or is derived from a wild type guide
RNA of a Campylobacter jejune organism from which the Campylobacter
jejune RCas9 is derived; wherein the sequences of (a) and (b) are
in a single vector; and wherein the 2-component RNA targeting
system recognizes and alters the target RNA in the absence of a
PAMmer.
40. A nucleic acid molecule encoding a 2-component RNA targeting
system comprising: (a) nucleic acid sequence encoding an
RNA-targeted Cas9 (Rcas9) polypeptide; and (b) a single guide RNA
(sgRNA) sequence comprising: (1) on its 5' end, an RNA sequence
that hybridizes to or binds to a target RNA sequence comprising a
repeat sequence selected from the group consisting of CUG, CCUG,
CAG, and GGGGCC; and (2) on its 3' end, an RNA sequence capable of
binding to or associating with the RCas9 polypeptide, wherein the
RNA sequence capable of binding to or associating with the RCas9
polypeptide comprises or is derived from a wild type guide RNA of
an archaeal or a bacterial organism from which the RCas9 is
derived; wherein the sequences of (a) and (b) are in a single
vector, wherein the sequences of (a) and (b) are a size of less
than about 4.5 kb, or a size of less than about 4.7 kb, and wherein
the 2-component RNA targeting system recognizes and alters the
target RNA in a cell in the absence of a PAMmer.
Description
INCORPORATION BY REFERENCE TO ANY PRIORITY APPLICATIONS
[0001] Any and all applications for which a foreign or domestic
priority claim is identified in the Application Data Sheet as filed
with the present application are hereby incorporated by reference
under 37 CFR 1.57. In particular, this application claims the
benefit of priority to U.S. Provisional Application Ser. No.
62/259014, entitled "TRACKING AND MANIPULATING CELLULAR RNA VIA
NUCLEAR DELIVERY OF CRISPR/CAS9," filed Nov. 23, 2015, the
disclosures of which are hereby incorporated by reference herein in
their entireties.
REFERENCE TO SEQUENCE LISTING, TABLE, OR COMPUTER PROGRAM
LISTING
[0003] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled UCSD097-001A_SEQLIST.TXT, created Nov. 22, 2016,
which is 105 kb in size. The information in the electronic format
of the Sequence Listing is incorporated herein by reference in its
entirety.
REFERENCE TO COLOR DRAWINGS
[0004] The patent or application filed contains at least one
drawing executed in color. Copies of this patent or patent
application publication with color drawings will be provided by the
Office upon request and payment of the necessary fee.
BACKGROUND OF THE INVENTION
Field of the Invention
[0005] The present application relates to genetic engineering, and
in alternative embodiments, provides Cas9 polypeptides which have
been engineered to bind to RNA.
Description of the Related Art
[0006] Current methods for tracking RNA, determining the amount of
RNA, or modifying the amount or structure of RNA suffer from
various drawbacks. Improved methods and compositions for
implementing them are provided herein.
SUMMARY OF THE INVENTION
[0007] Some embodiments are described in the following numbered
paragraphs:
[0008] 1. An engineered nucleoprotein complex comprising: [0009]
(a) a Cas9 polypeptide, and [0010] (b) a recombinant or synthetic
single guide RNA (sgRNA) which is engineered or designed to
comprise: [0011] (1) on its 5' end, an RNA sequence that recognizes
by hybridization (that hybridizes to or binds to) a target RNA and
[0012] (2) on its 3' end: (i) an RNA sequence capable of binding to
or associating with the Cas9 polypeptide (a Cas9
polypeptide-binding "scaffold sequence"), or (ii) a linker that
binds or covalently or non-covalently links the 5' RNA-hybridizing
or binding end of the sgRNA with the Cas9 polypeptide, [0013]
wherein optionally the nucleoprotein complex does not comprise a
PAMmer oligonucleotide, [0014] and optionally the Cas9 polypeptide:
[0015] (1) is a, or is derived from a, bacterial or archaeal Cas9
polypeptide, [0016] (2) lacks a domain, or a portion of a domain,
of a corresponding wild type (WT) Cas9 polypeptide, wherein
optionally the domain is an HNH and/or RuvC nuclease domain of
Cas9, comprises a .beta..beta..alpha.-metal fold comprising or
including a Cas9 polypeptide active site, or combinations thereof;
[0017] (3) lacks DNase, or DNA cleaving, capability or activity,
nickase activity, or combinations thereof, wherein optionally the
DNase, or DNA cleaving capability or activity is removed by
modification (mutation) or removal of all or part of: an HNH and/or
RuvC nuclease domain of Cas9, a Cas9 polypeptide DNase active site
or a .beta..beta..alpha.-metal fold that comprising a Cas9
polypeptide active site, or combinations thereof, [0018] (4) lacks
all or part of: an HNH and/or RuvC nuclease domain of Cas9, a Cas9
polypeptide DNase active site, a .beta..beta..alpha.-metal fold
that comprising a Cas9 polypeptide active site, or combinations
thereof, thereby optionally reducing the size of the polypeptide,
optionally facilitating packaging of a Cas9-coding nucleotide in a
viral or other delivery vector, or [0019] (5) is a variant of a WT
Cas9 polypeptide, and has one or more amino acid mutations that
result in reduced DNase or nuclease activity relative to a
corresponding WT Cas9 polypeptide, [0020] or optionally the
archaeal or bacterial Cas9 polypeptide is, comprises or is derived
from: a Haloferax mediteranii, a Mycobacterium tuberculosis, a
Francisella tularensis subsp. novicida, a Pasteurella multocida, a
Neisseria meningitidis, a Campylobacter jejune, a Streptococcus
thermophilus LMD-9 CRISPR 3, a Campylobacter lari CF89-12, a
Mycoplasma gallisepticum str. F, a Nitratifractor salsuginis str
DSM 16511, a Parvibaculum lavamentivorans, a Roseburia
intestinalis, a Neisseria cinerea, a Gluconacetobacter
diazotrophicus, an Azospirillum B510, a Sphaerochaeta globus str.
Buddy, a Flavobacterium columnare, a Fluviicola taffensis, a
Bacteroides coprophilus, a Mycoplasma mobile, a Lactobacillus
farciminis, a Streptococcus pasteurianus, a Lactobacillus
johnsonii, a Staphylococcus pseudintermedius, a Filifactor alocis,
a Treponema denticola, a Legionella pneumophila str. Paris, a
Sutterella wadsworthensis, a Corynebacter diphtheriae, or a
Streptococcus aureus; a Francisella novicida (optionally a
Francisella novicida Cpf1) or a Natronobacterium gregoryi Argonaute
modified or repurposed to target RNA, wherein optionally the sgRNA
3' end or "scaffold sequence" comprises all or part of, or is
derived from, the wild type (WT) cognate guide nucleic acid of each
of these respective bacteria or archaeal organisms.
[0021] 2. The engineered nucleoprotein complex of Claim 1, wherein
the 5' RNA-hybridizing or binding end of the sgRNA is between about
15 to 25, or 20, 21, 22 nucleotides in length, and the RNA sequence
capable of binding to or associating with the Cas9 polypeptide is
between about 85 and 100, or 90, 91, 92, 93, 94 or 95 nucleotides
in length, [0022] and optionally the Cas9 polypeptide is adapted to
be associated with, fused with, or that binds to or is covalently
or non-covalently linked to, an effector polypeptide, a targeting
agent, an enzyme, and/or a detectable moiety, wherein optionally
the effector polypeptide comprises an RNA modifying polypeptide,
[0023] wherein optionally the Cas9 polypeptide is a recombinant or
synthetic polypeptide, [0024] wherein optionally the target RNA is
(or the RNA sequence that recognizes by hybridization, or
hybridizes to or binds to, the target RNA, is antisense to:) a
messenger RNA (mRNA), ribosomal RNA (rRNA), signal recognition
particle RNA (SRP RNA), transfer RNA (tRNA), small nuclear RNA
(snRNA), small nucleolar RNA (snoRNA), antisense RNA (aRNA), long
noncoding RNA (IncRNA), microRNA (miRNA), piwi-interacting RNA
(piRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA),
retrotransposon RNA, viral genome RNA, or viral noncoding RNA.
[0025] 3. The engineered nucleoprotein complex of any one of Claims
1 or 2, wherein said Cas9 polypeptide is noncovalently associated
with said effector polypeptide, targeting agent, detectable moiety,
or RNA modifying polypeptide.
[0026] 4. The engineered nucleoprotein complex of any one of Claims
1 or 2, wherein said Cas9 polypeptide is fused to or covalently
linked to said effector polypeptide, targeting agent, detectable
moiety, [0027] and optionally the effector polypeptide is or
comprises an RNA modifying polypeptide, and optionally the
targeting agent is or comprises: a cytoplasmic polyadenylation
element binding protein (CPEB), a zinc finger binding protein
(ZBP), TIA-1 (a 3'UTR mRNA binding protein), a PSF (a protein
component of spliceosomes) or a DNA-binding domain (DBD) of PSF,
fragile X mental retardation protein (FMRP), IGF-II mRNA-binding
protein (IMP)-1 (IMP1), IMP2, IMP3, a cytoskeleton binding protein,
a transmembrane protein, or an engineered protein comprising a
combination of domains of these aforementioned proteins to generate
a combinatorial trafficking phenomena, [0028] and optionally the
enzyme is involved in the modification of synthesis of a compound,
optionally wherein the compound is a polypeptide or a nucleic acid,
and optionally the association of the Cas9 polypeptide on a target
RNA creates a local accumulation of intermediate products in a
biosynthetic pathway to amplify the production of a medically- or
technologically-useful compound compared to free-floating
biosynthetic enzymes.
[0029] 5. The engineered nucleoprotein complex of any one of Claims
1-4, wherein said RNA modifying polypeptide comprises a splicing
factor or an RNA splicing domain, optionally a RBFOX2
domain-containing protein, a protein known to influence RNA
splicing, or an RNA cleaving domain (endonuclease), optionally as a
PIN domain-containing protein.
[0030] 6. The engineered nucleoprotein complex of any one of Claims
1-5, wherein said Cas9 polypeptide is covalently bound to the
single guide RNA (sgRNA) by the linker.
[0031] 7. The engineered nucleoprotein complex of any one of Claims
1-6, wherein said single guide RNA (sgRNA) carries extensions of,
or comprises, secondary RNA structures in the 3' end scaffold
sequence.
[0032] 8. The engineered nucleoprotein complex of any one of Claims
1-7, wherein said single guide RNA (sgRNA) comprises one or more
point mutations that improve expression levels of the single guide
RNAs via removal of partial or full transcription termination
sequences or sequences that destabilize sgRNAs after transcription
via action of trans-acting nucleases by at least about 5%, 10%, 15%
or more.
[0033] 9. The engineered nucleoprotein complex of any one of Claims
1-8, wherein said single guide RNA (sgRNA) comprises an alteration
or an additional nucleotide or chemical moiety at the 5' end which
stabilizes said single guide RNA against degradation.
[0034] 10. The engineered nucleoprotein complex of Claim 9, wherein
said additional nucleotide or chemical moiety at the 5' end of said
single guide RNA (sgRNA) is selected from the group consisting of
2'O-methyl, phosphorothioates, and thiophosphonoacetate linkages
and bases, and optionally the alteration or additional chemical
moiety for chemical stabilization comprises a 2'-F, locked nucleic
acid (LNA), a 2'-O-methoyethyl, or a unlocked nucleic acid
(UNA).
[0035] 11. The engineered nucleoprotein complex of any one of
Claims 1-10, wherein said single guide RNA comprises one or more
methylphosphonate, thiophosponoaceteate, or phosphorothioate
linkages, optionally that reduce RNA nuclease activity on the sgRNA
by at least about 5%, 10%, 15% or more.
[0036] 12. The engineered nucleoprotein complex of any one of
Claims 1-11, wherein said single guide RNA (sgRNA) comprises an
alteration or an additional nucleotide or chemical moiety at the 5'
end which improves RNA targeting by at least about 5%, 10%, 15% or
more.
[0037] 13. The engineered nucleoprotein complex of any one of
Claims 1-12, wherein said single guide RNA comprises 2'-fluorine,
2'O-methyl, and/or 2'-methoxyethyl base modifications in the spacer
or scaffold region of the sgRNA to improve target recognition or
reduce nuclease activity on the single guide RNA by at least about
5%, 10%, 15% or more.
[0038] 14. The engineered nucleoprotein complex of any one of
Claims 1-13, wherein said single guide RNA comprises sufficient
sequence antisense to the target RNA to allow it to hybridize under
physiological conditions to at least about 5%, 10%, 15%, or between
about 5% and 20%, or more of the target RNA.
[0039] 15. The engineered nucleoprotein complex of any one of
Claims 1-14, wherein said single guide RNA comprises a sequence
that is antisense to or complementary to at least a portion of the
target RNA, wherein said portion is optionally at least about 5%,
10%, 15% or more of the target RNA, or between about 5% and 20%, or
more of the target RNA.
[0040] 16. The engineered nucleoprotein complex of any one of
Claims 1-15, further comprising a CRISPR-targeting RNA (crRNA) and
a trans-activating cRNA (tracrRNA), wherein said Cas9 polypeptide
is complexed with or linked to, or covalently or non-covalently
associated with, the CRISPR-targeting RNA (crRNA) in combination
with the trans-activating cRNA (tracrRNA).
[0041] 17. The engineered nucleoprotein complex of any one of
Claims 1-16, wherein said RNA modifying polypeptide is further
complexed with, or is linked to covalently or non-covalently, an
antisense oligonucleotide.
[0042] 18. The engineered nucleoprotein complex of Claim 17,
wherein said antisense oligonucleotide comprises at least one
modified nucleotide.
[0043] 19. The engineered nucleoprotein complex of Claim 18,
wherein said at least one modified nucleotide is selected from the
group consisting of 2'OMe RNA and 2'OMe DNA nucleotides.
[0044] 20. The engineered nucleoprotein complex of any one of
Claims 1-19, wherein said nucleoprotein complex further comprises a
PAMmer oligonucleotide, and optionally the PAMmer also carries a 5'
overhang which is required to maintain target specificity conferred
by the sgRNA.
[0045] 21. The engineered nucleoprotein complex of Claim 20,
wherein said PAMmer oligonucleotide comprises one or more modified
bases or linkages.
[0046] 22. The engineered nucleoprotein complex of Claim 21,
wherein said one or more modified bases or linkages are selected
from the group consisting of locked nucleic acids and nuclease
stabilized linkages.
[0047] 23. The engineered nucleoprotein complex of any one of
Claims 1-22, wherein said engineered nucleoprotein complex is
adapted to be delivered to the nucleus of a cell.
[0048] 24. The engineered nucleoprotein complex of Claim 23,
wherein said engineered nucleoprotein complex is adapted to be
co-exported with a target RNA out of said nucleus.
[0049] 25. The engineered nucleoprotein complex of any one of
Claims 23 or 24, wherein said Cas9 polypeptide comprises, or
further comprises, optionally is fused or linked to a nuclear
localization signal, one or more linker peptides, XTEN peptides, or
optionally, an SV40 nuclear localization signal.
[0050] 26. The engineered nucleoprotein complex of any one of
Claims 1-25, wherein said Cas9 polypeptide is nuclease null.
[0051] 27. The engineered nucleoprotein complex of any one of
Claims 1-26, wherein said target RNA comprises a repeat sequence,
and the 5' end RNA sequence that recognizes by hybridization (that
hybridizes to or binds to) the target RNA comprises a sequence
capable of hybridizing to, or is complementary to, the repeat
sequence.
[0052] 28. The engineered nucleoprotein complex of Claim 27,
wherein said repeat sequence is selected from the group consisting
of CTG, CCTG, CAG, GGGGCC, and any combination thereof.
[0053] 29. The engineered nucleoprotein complex of Claim 27 or 28,
wherein said target RNA is associated with a disease or condition
or infection, and optionally the disease or condition is caused by
or is associated with a RNA microsatellite repeat expansion.
[0054] 30. The engineered nucleoprotein complex of Claim 29,
wherein said disease, condition, or infection is selected from the
group consisting of myotonic dystrophy, Huntington's disease,
familial ALS, cancer, spinal muscular atrophy, spinocerebellar
ataxia, Fragile X-associated tremor/ataxia syndrome, Spinal-bulbar
muscular dystrophy, Oculopharyngeal muscular dystrophy, Fragile X
syndrome, a viral or bacterial infection, wherein optionally the
viral infection is a Herpesviridae or herpes simplex virus, a human
immunodeficiency virus, Epstein Barr virus, hepatitis virus,
Hepatitis A, Hepatitis B, Hepatitis C, Hepatitis D, Hepatitis E,
Zika virus, enteroviruses, Human Papillomavirus (HPV), influenza
virus, Marburg virus, Ebola virus, Mumps virus, cytomegalovirus,
rotavirus, Rubella virus, Varicella zoster virus, severe acute
respiratory syndrome (SARS) coronavirus, a Paramyxoviridae or
measles virus, West Nile virus, Yellow fever virus, or Dengue fever
virus infection.
[0055] 31. The engineered nucleoprotein complex of any of claims 1
to 30, wherein said Cas9 polypeptide is associated with an effector
polypeptide, wherein the polypeptide is a toxic protein.
[0056] 32. The engineered nucleoprotein complex of any of claims 1
to 31, wherein said Cas9 polypeptide is fused to, bound to, or
associated with an effector polypeptide, a targeting agent, an
enzyme or a detectable agent or moiety, wherein optionally the Cas9
polypeptide is a recombinant or synthetic polypeptide.
[0057] 33. The engineered nucleoprotein complex of Claim 32,
wherein said detectable agent or moiety comprises a detectable
polypeptide or composition which has been fused or linked to said
Cas9 polypeptide.
[0058] 34. The engineered nucleoprotein complex of Claim 33,
wherein said detectable polypeptide comprises a polypeptide which
is inactivated when said detectable polypeptide is in the nucleus
of a cell.
[0059] 35. The engineered nucleoprotein complex of Claim 34,
wherein said detectable polypeptide is not detectable when said
detectable polypeptide is in the nucleus of a cell but is
detectable when said detectable polypeptide is not in the nucleus
of the cell.
[0060] 36. The engineered nucleoprotein complex of Claim 35,
wherein said detectable polypeptide is detectable when it is not in
the nucleus of the cell via an association with another agent which
is detectable.
[0061] 37. The engineered nucleoprotein complex of any one of
Claims 32-36, wherein said detectable polypeptide is a fluorescent,
split fluorescent, or luminescent polypeptide, or said detectable
agent or moiety comprises a fluorescent, split fluorescent, or
luminescent agent.
[0062] 38. The engineered nucleoprotein complex of Claim 37 wherein
said fluorescent polypeptide comprises or is a green fluorescent
protein (GFP) or an enhanced GFP.
[0063] 39. The engineered nucleoprotein complex of any one of
Claims 1-38, wherein said single guide RNA (sgRNA) comprises one or
more point mutations that improves expression levels of the single
guide RNAs by at least 5%, 10%, 15% or more via removal of partial
or full transcription termination sequences or sequences that
destabilize single guide RNAs after transcription via action of
trans-acting nucleases.
[0064] 40. The engineered nucleoprotein complex of any one of
Claims 1-39, wherein said Cas9 polypeptide is complexed with a
CRISPR-targeting RNA (crRNA) in combination with a trans-activating
cRNA (tracrRNA).
[0065] 41. The engineered nucleoprotein complex of any one of
Claims 1-40, wherein said Cas9 polypeptide is further complexed
with an antisense oligonucleotide, wherein the antisense
oligonucleotide comprises a PAMmer oligonucleotide which is
complementary to a sequence in the target RNA.
[0066] 42. The engineered nucleoprotein complex of Claim 41,
wherein said PAMmer oligonucleotide comprises at least one modified
nucleotide.
[0067] 43. The engineered nucleoprotein complex of Claim 20,
wherein said at least one modified nucleotide is selected from the
group consisting of 2'OMe RNA and 2'OMe DNA nucleotides.
[0068] 44. The engineered nucleoprotein complex of any one of
Claims 1-43, wherein said Cas9 polypeptide is adapted to be
delivered to the nucleus of a cell.
[0069] 45. The engineered nucleoprotein complex of Claim 44,
wherein said Cas9 polypeptide is adapted to be co-exported with a
target RNA out of said nucleus.
[0070] 46. A vector comprising a nucleic acid, or nucleic acids,
optionally vector or vectors, encoding the engineered nucleoprotein
complex of any one of Claims 1-45, wherein optionally the vector
is, comprises or is derived from an adenovirus, an adeno-associated
virus (AAV), a retrovirus, a herpes simplex virus, a human
immunodeficiency virus (HIV), or a synthetic vector.
[0071] 47. A cell comprising, or having contained therein: [0072]
(a) the engineered nucleoprotein complex of any of claims 1-45; or
[0073] (b) a nucleic acid, or nucleic acids, optionally vector or
vectors, encoding the engineered nucleoprotein complex of any one
of Claims 1-45, wherein optionally the cell is a mammalian cell or
a human cell.
[0074] 48. A chimeric nucleic acid encoding the engineered
nucleoprotein complex of any one of Claims 1-45, wherein optionally
the nucleic acid is a recombinant or synthetic nucleic acid,
wherein optionally the nucleic acid is operably linked to a
constitutive or an inducible promoter.
[0075] 49. The nucleic acid of Claim 48, wherein the expression of
one or more of the Cas9 polypeptide, the sgRNA, the PAMmer
oligonucleotide, the effector polypeptide, the detectable moiety,
or combinations thereof, is controlled by a regulatable or
constitutive promoter.
[0076] 50. A vector comprising the nucleic acid of any of Claims 48
or 49, wherein optionally the vector is, comprises or is derived
from an adenovirus, an adeno-associated virus (AAV), a retrovirus,
a herpes simplex virus, a human immunodeficiency virus (HIV), or a
synthetic vector.
[0077] 51. A cell or tissue comprising: the engineered
nucleoprotein complex of any one of Claims 1-45; the nucleic acid
of Claims 48 or 49; or the vector of Claim 50.
[0078] 52. A method of treating, preventing, ameliorating or
reducing the symptoms of a disease or condition, or infection, in a
mammalian or a human subject comprising administering to said
mammalian or human subject: [0079] (a) the engineered nucleoprotein
complex of any of claims 1-45, wherein said Cas9 polypeptide is
adapted to be associated with, or that binds to or is covalently or
non-covalently linked to, an effector polypeptide wherein
optionally the effector polypeptide comprises an RNA modifying
polypeptide; or [0080] (b) a nucleic acid, or nucleic acids,
optionally vector or vectors, encoding the engineered nucleoprotein
complex of any one of Claims 1-45, wherein said Cas9 polypeptide is
adapted to be associated with, or that binds to or is covalently or
non-covalently linked to, an effector polypeptide wherein
optionally the effector polypeptide comprises an RNA modifying
polypeptide, and wherein the nucleic acid is, or nucleic acids are,
expressed intracellularly and express the engineered nucleoprotein
complex, (c) pharmaceutical composition comprising [0081] (i) the
engineered nucleoprotein complex of any of claims 1-45, wherein
said Cas9 polypeptide is adapted to be associated with, or that
binds to or is covalently or non-covalently linked to, an effector
polypeptide wherein optionally the effector polypeptide comprises
an RNA modifying polypeptide; or [0082] (ii) a nucleic acid, or
nucleic acids, optionally vector or vectors, encoding the
engineered nucleoprotein complex of any one of Claims 1-45, wherein
said Cas9 polypeptide is adapted to be associated with, or that
binds to or is covalently or non-covalently linked to, an effector
polypeptide wherein optionally the effector polypeptide comprises
an RNA modifying polypeptide, [0083] and optionally an excipient,
[0084] and optionally the pharmaceutical compound is formulated for
enteral or parenteral delivery, or for intravenous (IV) delivery;
or [0085] (d) a cell or tissue of claim 51; [0086] thereby
modifying an RNA in a cell and treating, preventing, or
ameliorating or reducing the symptoms of the disease or condition,
or infection, [0087] wherein optionally the engineered
nucleoprotein complex or the nucleic acid or vector encoding the
Cas9 polypeptide is carried or contained in a nanoparticle, a
particle, a micelle or a liposome or lipoplex, a polymersome, a
polyplex or a dendrimer, which optionally can further comprise or
express a cell penetrating moiety or peptide.
[0088] 53. The method of Claim 52, wherein the nucleic acid or
nucleic acids encoding one or all of the components of the
engineered nucleoprotein complex is/are carried by or is/are
contained in a single vector, or each component (the Cas9
polypeptide, the sgRNA, the effector polypeptide, or a combination
of components, is carried by or is contained in a separate vector,
[0089] and optionally the vector or vectors are adenovirus vectors,
or one or more adeno-associated virus (AAV) vectors, a retrovirus,
a herpes simplex virus, a human immunodeficiency virus (HIV), or a
synthetic vector.
[0090] 54. The method of Claim 52 or 53, wherein the expression of
one or more of the Cas9 polypeptide, the sgRNA, the PAMmer
oligonucleotide, the effector polypeptide, or combinations thereof
is controlled by a regulatable or constitutive promoter.
[0091] 55. The method of any of Claims 52-54, wherein the nucleic
acid encoding the single guide RNA (sgRNA) is carried by or is
contained in the same vector as the nucleic acid encoding the Cas9
polypeptide, optionally adenovirus or AAV vectors, a retrovirus, a
herpes simplex virus, a human immunodeficiency virus (HIV), or a
synthetic vector.
[0092] 56. The method of any of Claims 52-55, wherein the nucleic
acid encoding the sgRNA and the nucleic acid encoding the Cas9
polypeptide are carried by or is contained in different vectors,
optionally adenovirus or AAV vectors, a retrovirus, a herpes
simplex virus, a human immunodeficiency virus (HIV), or a synthetic
vector.
[0093] 57. The method of any of Claims 52-56 wherein the nucleic
acid encoding the effector polypeptide, optionally a RNA modifying
polypeptide, is carried by the same or is carried by or is
contained in a separate vector, optionally an AAV vector, a
retrovirus, a herpes simplex virus, a human immunodeficiency virus
(HIV), or a synthetic vector.
[0094] 58. The method of any one of Claims 52-57, wherein the
disease or condition is caused by a repeat sequence selected from
the group consisting of CTG, CCTG, CAG, GGGGCC, and any combination
thereof.
[0095] 59. The method of Claim 52-58, wherein said disease,
condition, or infection is caused by or is associated with a RNA
microsatellite repeat expansion, or is selected from the group
consisting of myotonic dystrophy, Huntington's disease, familial
ALS, cancer, spinal muscular atrophy, spinocerebellar ataxia,
Fragile X-associated tremor/ataxia syndrome, Spinal-bulbar muscular
dystrophy, Oculopharyngeal muscular dystrophy, Fragile X syndrome,
a viral or bacterial infection, wherein optionally the viral
infection is a Herpesviridae or herpes simplex virus, a human
immunodeficiency virus, Epstein Barr virus, hepatitis virus,
Hepatitis A, Hepatitis B, Hepatitis C, Hepatitis D, Hepatitis E,
Zika virus, enteroviruses, Human Papillomavirus (HPV), influenza
virus, Marburg virus, Ebola virus, Mumps virus, cytomegalovirus,
rotavirus, Rubella virus, Varicella zoster virus, severe acute
respiratory syndrome (SARS) coronavirus, a Paramyxoviridae or
measles virus, West Nile virus, Yellow fever virus, or Dengue fever
virus infection.
[0096] 60. The method of any one of Claims 52-59, wherein the
administration route is selected from the group consisting of oral,
pulmonary, intraperitoneal (ip), intravenous (iv), intramuscular
(im), subcutaneous (sc), transdermal, buccal, nasal, sublingual,
ocular, rectal and vaginal.
[0097] 61. A method of expressing the engineered nucleoprotein
complex of any of claims 1-45, comprising introducing a vector of
Claims 46 or 50 or a nucleic acid of claims 48 or 49 into a cell
under conditions in which said cell expresses said nucleoprotein
complex.
[0098] 62. A method of tracking a target RNA or measuring the
amount of a target RNA in a cell comprising administering to the
cell engineered nucleoprotein complex of any of claims 1-45,
wherein said Cas9 polypeptide is adapted to be associated with, or
that binds to or is covalently or non-covalently linked to, a
detectable moiety, and allowing the engineered nucleoprotein
complex to bind to said target RNA in said cell and determining the
location of said target RNA in said cell or determining the amount
of said target RNA in said cell.
[0099] 63. The method of Claim 61, wherein said engineered
nucleoprotein complex binds to said target RNA in a nucleus of said
cell and is subsequently co-exported from said nucleus with said
target RNA.
[0100] 64. The method of any one of Claims 63 or 64, wherein the
location of said target RNA in said cell or the amount of said
target RNA in said cell is determined using a fluorescence
microscopy or equivalent thereof.
[0101] 65. A method of modifying the amount or structure of a
target RNA in a cell in vitro or in vivo comprising allowing an
engineered nucleoprotein complex of any one of Claims 1-45, wherein
said Cas9 polypeptide is adapted to be associated with, or that
binds to or is covalently or non-covalently linked to, an effector
polypeptide wherein optionally the effector polypeptide comprises
an RNA modifying polypeptide, to bind to said target RNA in said
cell under conditions in which the amount or structure of said
target RNA in said cell is modified.
[0102] 66. A method of modifying the amount or structure of a
target RNA in a cell in vitro or in vivo comprising expressing one
or more components of the engineered nucleoprotein complex of any
one of Claims 1-45, wherein said Cas9 polypeptide is adapted to be
associated with, or that binds to or is covalently or
non-covalently linked to, an effector polypeptide wherein
optionally the effector polypeptide comprises an RNA modifying
polypeptide, in a cell under conditions in which the amount or
structure of said target RNA in said cell is modified, wherein the
one or more components of the engineered nucleoprotein complex
comprises a Cas9 polypeptide, a sgRNA, a PAMmer oligonucleotide, an
effector protein, a detectable moiety, or combinations thereof.
[0103] 67. A method of measuring RNA content or dynamics in a
sample, comprising: introducing the engineered nucleoprotein
complex of any one of Claims 1-45, wherein said Cas9 polypeptide is
adapted to be associated with, or that binds to or is covalently or
non-covalently linked to, a detectable moiety, into said sample;
and observing, detecting or measuring the amount of the detectable
agent in said sample.
[0104] 68. The method of Claim 67, comprising introducing a nucleic
acid of Claims 48 or 49 or a vector of Claims 46 or 50 into said
sample under conditions in which said Cas9 polypeptide is
expressed.
[0105] 69. The method of Claims 67 or 68, further comprising
introducing a single guide RNA.
[0106] 70. The method of any one of Claims 67-69, further
comprising introducing a PAMmer oligonucleotide.
[0107] 71. The method of any one of Claims 67-70, wherein said
sample comprises or is derived from a tissue, a biopsy, a serum or
blood sample, or a sputum sample.
[0108] 72. The method of any one of Claims 67-71, wherein said
sample comprises a plurality of cells.
[0109] 73. The method of any one of Claims 67-72, comprising
measuring the expression level or abundance of a target RNA in said
sample.
[0110] 74. The method of any one of Claims 67-73, comprising
diagnosing a disease, condition, or infection of said sample, or in
an individual from which said sample was derived, of said sample
based on the expression level or abundance of said target RNA in
said sample,
[0111] 75. and optionally the target RNA is derived from a viral or
bacterial infection, wherein optionally the viral infection is a
Herpesviridae or herpes simplex virus, a human immunodeficiency
virus, Epstein Barr virus, hepatitis virus, Hepatitis A, Hepatitis
B, Hepatitis C, Hepatitis D, Hepatitis E, Zika virus,
enteroviruses, Human Papillomavirus (HPV), influenza virus, Marburg
virus, Ebola virus, Mumps virus, cytomegalovirus, rotavirus,
Rubella virus, Varicella zoster virus, severe acute respiratory
syndrome (SARS) coronavirus, a Paramyxoviridae or measles virus,
West Nile virus, Yellow fever virus, or Dengue fever virus
infection.
[0112] 76. The method of any one of Claims 67-74, wherein said
target RNA comprises a repeat sequence.
[0113] 77. The method of Claim 75, wherein said repeat sequence is
selected from the group consisting of CTG, CCTG, CAG, GGGGCC, and
any combination thereof.
[0114] 78. The method of Claim 75 or 76, wherein said repeat
sequence is associated with a disease, condition, or infection.
[0115] 79. The method of Claim 77, wherein said disease or
condition is caused by or is associated with a RNA microsatellite
repeat expansion, or is selected from the group consisting of
myotonic dystrophy, Huntington's disease, familial ALS, cancer,
spinal muscular atrophy, spinocerebellar ataxia, Fragile
X-associated tremor/ataxia syndrome, Spinal-bulbar muscular
dystrophy, Oculopharyngeal muscular dystrophy, and Fragile X
syndrome.
[0116] 80. A method of modifying a target RNA in a sample,
comprising: introducing the engineered nucleoprotein complex of any
one of Claims 1-44, wherein said Cas9 polypeptide is adapted to be
associated with, or that binds to or is covalently or
non-covalently linked to, an effector polypeptide wherein
optionally the effector polypeptide comprises an RNA modifying
polypeptide, into said sample; and modifying said target RNA in
said sample using the RNA modifying polypeptide.
[0117] 81. The method of Claim 79, comprising introducing a nucleic
acid of Claim 45 or 49 or a vector of Claim 50 into said sample
under conditions in which said Cas9 polypeptide is expressed.
[0118] 82. The method of Claim 79 or 80, further comprising
introducing a single guide RNA.
[0119] 83. The method of any one of Paragraphs 79-81, further
comprising introducing a PAMmer oligonucleotide.
[0120] 84. The method of any one of Claims 79-82, wherein said
sample comprises a tissue.
[0121] 85. The method of any one of Claims 79-83, wherein said
sample comprises a plurality of cells.
[0122] 86. The method of any one of Claims 79-84, comprising
modifying the amount of target RNA in said sample.
[0123] 87. The method of Claim 85, wherein said target RNA
comprises a repeat sequence.
[0124] 88. The method of Claim 86, wherein said repeat sequence is
selected from the group consisting of CTG, CCTG, CAG, GGGGCC, and
any combination thereof.
[0125] 89. The method of Claim 86 or 87, wherein said repeat
sequence is associated with a disease.
[0126] 90. The method of Claim 88, wherein said disease is caused
by or is associated with a RNA microsatellite repeat expansion, or
is selected from the group consisting of myotonic dystrophy,
Huntington's disease, familial ALS, cancer, spinal muscular
atrophy, spinocerebellar ataxia, Fragile X-associated tremor/ataxia
syndrome, Spinal-bulbar muscular dystrophy, Oculopharyngeal
muscular dystrophy, and Fragile X syndrome.
[0127] 91. A pharmaceutical composition comprising [0128] (a) the
engineered nucleoprotein complex of any of claims 1-45, wherein
said Cas9 polypeptide is adapted to be associated with, or that
binds to or is covalently or non-covalently linked to, an effector
polypeptide wherein optionally the effector polypeptide comprises
an RNA modifying polypeptide; or [0129] (b) a nucleic acid, or
nucleic acids, optionally vector or vectors, encoding the
engineered nucleoprotein complex of any one of Claims 1-45, wherein
said Cas9 polypeptide is adapted to be associated with, or that
binds to or is covalently or non-covalently linked to, an effector
polypeptide wherein optionally the effector polypeptide comprises
an RNA modifying polypeptide, [0130] and optionally an excipient,
[0131] and optionally the pharmaceutical compound is formulated for
enteral or parenteral delivery, or for intravenous (IV)
delivery.
[0132] 92. The pharmaceutical composition of Claim 90, wherein the
engineered nucleoprotein complex or the nucleic acid or vector
encoding the nucleoprotein complex is carried in a nanoparticle, a
particle, a micelle or a liposome or lipoplex, a polymersome, a
polyplex or a dendrimer, which optionally can further comprise or
express a cell penetrating moiety or peptide.
[0133] 93. The pharmaceutical composition of Claim 91, wherein the
nanoparticle or particle comprises lipids, polymers, hydrogel, or a
combination thereof.
[0134] 94. The pharmaceutical composition of any one of Claims
90-93, wherein the sgRNA is contained in the same vector as the
Cas9 polypeptide, or is contained in a different vector as the Cas9
polypeptide.
[0135] 95. The pharmaceutical composition of any one of Claims
90-94, wherein the nucleic acid encoding the Cas9 polypeptide and
the nucleic acid encoding the sgRNA is carried in one or more
vectors, optionally adenovirus vectors or adeno-associated virus
(AAV) vectors, a retrovirus, a herpes simplex virus, a human
immunodeficiency virus (HIV), or a synthetic vector.
[0136] 96. A recombinant or synthetic Cas9 polypeptide, [0137]
wherein the Cas9 polypeptide: [0138] (a) is a, or is derived from
a, bacterial or archaeal Cas9 polypeptide; and [0139] (b) [0140]
(i) lacks a domain, or a portion of a domain, of a corresponding
wild type (WT) Cas9 polypeptide, wherein optionally the domain is
an HNH and/or RuvC nuclease domain of Cas9, comprises a
.beta..beta..alpha.-metal fold comprising or including a Cas9
polypeptide active site, or combinations thereof; [0141] (ii) lacks
DNase, or DNA cleaving, capability or activity, or nickase
activity, wherein optionally the DNase, or DNA cleaving capability
or activity is removed by modification (mutation) or removal of all
or part of: an HNH and/or RuvC nuclease domain of Cas9, a Cas9
polypeptide DNase active site or a .beta..beta..alpha.-metal fold
that comprising a Cas9 polypeptide active site, or combinations
thereof, [0142] (iii) lacks all or part of: an HNH and/or RuvC
nuclease domain of Cas9, a Cas9 polypeptide DNase active site or a
p a-metal fold that comprising a Cas9 polypeptide active site, or
combinations thereof, thereby optionally reducing the size of the
polypeptide, optionally facilitating packaging of a Cas9-coding
nucleotide in a viral or other delivery vector, or [0143] (iv) is a
variant of a WT Cas9 polypeptide, and has one or more amino acid
mutations that result in reduced DNase or nuclease activity
relative to a corresponding WT Cas9 polypeptide, [0144] and
optionally the archaeal or bacterial Cas9 polypeptide is, comprises
or is derived from: a Haloferax mediteranii, a Mycobacterium
tuberculosis, a Francisella tularensis subsp. novicida, a
Pasteurella multocida, a Neisseria meningitidis, a Campylobacter
jejune, a Streptococcus thermophilus LMD-9 CRISPR 3, a
Campylobacter lari CF89-12, a Mycoplasma gallisepticum str. F, a
Nitratifractor salsuginis str DSM 16511, a Parvibaculum
lavamentivorans, a Roseburia intestinalis, a Neisseria cinerea, a
Gluconacetobacter diazotrophicus, an Azospirillum B510, a
Sphaerochaeta globus str. Buddy, a Flavobacterium columnare, a
Fluviicola taffensis, a Bacteroides coprophilus, a Mycoplasma
mobile, a Lactobacillus farciminis, a Streptococcus pasteurianus, a
Lactobacillus johnsonii, a Staphylococcus pseudintermedius, a
Filifactor alocis, a Treponema denticola, a Legionella pneumophila
str. Paris, a Sutterella wadsworthensis, a Corynebacter
diphtheriae, or a Streptococcus aureus; a Francisella novicida
(optionally a Francisella novicida Cpf1) or a Natronobacterium
gregoryi Argonaute modified or repurposed to target RNA. [0145]
wherein optionally the Cas9 polypeptide further comprises an sgRNA,
wherein optionally the sgRNA comprises a "scaffold sequence"
capable of binding to or associating with the Cas9 polypeptide
comprising all or part of, or is derived from, the wild type (WT)
cognate guide nucleic acid of the wild type (WT) bacteria or
archaeal organism from which the Cas9 polypeptide was derived,
[0146] and optionally the sgRNA further comprises on its 5' end, an
RNA sequence that recognizes by hybridization (that hybridizes to
or binds to) a target RNA, [0147] and optionally the Cas9
polypeptide is adapted to be associated with, fused to, or that
binds to or is covalently or non-covalently linked to, an effector
polypeptide, a targeting agent, an enzyme, and/or a detectable
moiety, wherein optionally the effector polypeptide comprises an
RNA modifying polypeptide.
[0148] 96. A recombinant or synthetic nucleic acid encoding the
Cas9 polypeptide of claim 95, wherein optionally the nucleic acid
is a chimeric nucleic acids encoding the Cas9 polypeptide of claim
95 and an sgRNA.
[0149] 97. A vector comprising or having contained therein the
nucleic acid claim 98, wherein optionally the vector is, comprises
or is derived from an adenovirus, an adeno-associated virus (AAV),
a retrovirus, a herpes simplex virus, a human immunodeficiency
virus (H IV), or a synthetic vector
[0150] 98. A cell or tissue comprising or having contained therein
the Cas9 polypeptide of claim 95, or the nucleic acid of claim 96.
[0151] 99. A Cas9 polypeptide which has been engineered to
recognize a target RNA and which is adapted to be associated with
an RNA modifying polypeptide. [0152] 100. The Cas9 polypeptide of
Claim 99, wherein said Cas9 polypeptide is adapted to noncovalently
associate with said RNA modifying polypeptide. [0153] 101. The Cas9
polypeptide of Claim 100, wherein said Cas9 polypeptide is fused to
said RNA modifying polypeptide. [0154] 102. The Cas9 polypeptide of
any one of Claims 99-101, wherein said RNA modifying polypeptide is
a splicing factor. [0155] 103. The Cas9 polypeptide of any one of
Claims 99-102, wherein said Cas9 polypeptide is complexed with a
single guide RNA. [0156] 104. The Cas9 polypeptide of Claim 103,
wherein said single guide RNA carries extensions of secondary
structures in the single guide RNA scaffold sequence. [0157] 105.
The Cas9 polypeptide of any one of Claims 103 or 104, wherein said
single guide RNA comprises one or more point mutations that improve
expression levels of the single guide RNAs via removal of partial
or full transcription termination sequences or sequences that
destabilize single guide RNAs after transcription via action of
trans-acting nucleases. [0158] 106. The Cas9 polypeptide of any one
of Claims 103-105, wherein said single guide RNA comprises an
alteration at the 5' end which stabilizes said single guide RNA
against degradation.
[0159] 107. The Cas9 polypeptide of any one of Claims 103-106,
wherein said single guide RNA comprises an alteration at the 5' end
which improves RNA targeting.
[0160] 108. The Cas9 polypeptide of any one of Claims 107, wherein
said alteration at the 5' end of said single guide RNA is selected
from the group consisting of 2'O-methyl, phosphorothioates, and
thiophosphonoacetate linkages and bases.
[0161] 109. The Cas9 polypeptide of any one of Claims 103-108,
wherein said single guide RNA comprises 2'-fluorine, 2'O-methyl,
and/or 2'-methoxyethyl base modifications in the spacer or scaffold
region of the sgRNA to improve target recognition or reduce
nuclease activity on the single guide RNA.
[0162] 110. The Cas9 polypeptide of any one of Claims 103-109,
wherein said single guide RNA comprises one or more
methylphosphonate, thiophosponoaceteate, or phosphorothioate
linkages that reduce nuclease activity on the target RNA.
[0163] 111. The Cas9 polypeptide of any one of Claims 103-110,
wherein said single guide RNA hybridizes to at least a portion of
the target RNA.
[0164] 112. The Cas9 polypeptide of any one of Claims 103-111,
wherein said single guide RNA comprises a sequence that is
complementary to at least a portion of the target RNA.
[0165] 113. The Cas9 polypeptide of any one of Claims 103-112,
wherein said Cas9 polypeptide is complexed with a clustered
regularly interspaced short palindromic repeats (CRISPR)-targeting
RNA (crRNA) in combination with a trans-activating cRNA
(tracrRNA).
[0166] 114. The Cas9 polypeptide of any one of Claims 103-113,
wherein said RNA modifying polypeptide is further complexed with an
antisense oligonucleotide.
[0167] 115. The Cas9 polypeptide of Claim 114, wherein said
antisense oligonucleotide comprises at least one modified
nucleotide.
[0168] 116. The Cas9 polypeptide of Claim 115, wherein said at
least one modified nucleotide is selected from the group consisting
of 2'OMe RNA and 2'OMe DNA nucleotides.
[0169] 117. The Cas9 polypeptide of any one of Claims 114-116,
wherein said antisense oligonucleotide comprises a PAMmer
oligonucleotide.
[0170] 118. The Cas9 polypeptide of Claim 117, wherein said PAMmer
oligonucleotide comprises one or more modified bases or
linkages.
[0171] 119. The Cas9 polypeptide of Claim 118, wherein said one or
more modified bases or linkages are selected from the group
consisting of locked nucleic acids and nuclease stabilized
linkages.
[0172] 120. The Cas9 polypeptide of any one of Claims 119, wherein
said Cas9 polypeptide is adapted to be delivered to the nucleus of
a cell.
[0173] 121. The Cas9 polypeptide of Claim 120, wherein said Cas9
polypeptide is adapted to be co-exported with a target RNA out of
said nucleus.
[0174] 122. The Cas9 polypeptide of any one of Claims 120 or 121,
wherein said Cas9 polypeptide comprises a nuclear localization
signal.
[0175] 123. The Cas9 polypeptide of any one of Claims 99-122,
wherein said Cas9 polypeptide is nuclease null.
[0176] 124. The Cas9 polypeptide of any one of Claims 103-123,
wherein said target RNA comprises a repeat sequence.
[0177] 125. The Cas9 polypeptide of Claim 124, wherein said repeat
sequence is selected from the group consisting of CTG, CCTG, CAG,
GGGGCC, and any combination thereof.
[0178] 126. The Cas9 polypeptide of Claim 124 or 125, wherein said
target RNA is associated with a disease.
[0179] 127. The Cas9 polypeptide of Claim 126, wherein said disease
is selected from the group consisting of myotonic dystrophy,
Huntington's disease, familial ALS, cancer, spinal muscular atrophy
and Fragile X syndrome.
[0180] 128. A method of treating or ameliorating a disease in a
human subject comprising administering a nucleic acid encoding the
Cas9 polypeptide of any one of Claims 99-127 to said human
subject.
[0181] 129. The method of Claim 128, wherein the nucleic acid
encoding the Cas9 polypeptide is carried by an adeno-associated
virus (AAV) vector.
[0182] 130. The method of Claim 128 or 129, further comprising
administering a nucleic acid encoding the sgRNA.
[0183] 131. The method of Claim 130, wherein the nucleic acid
encoding the sgRNA is carried by the AAV vector.
[0184] 132. The method of Claim 131, wherein the nucleic acid
encoding the sgRNA is carried by a second AAV vector.
[0185] 133. The method of any one of Claims 128-132, wherein the
disease is caused by a repeat sequence selected from the group
consisting of CTG, CCTG, CAG, GGGGCC, and any combination
thereof.
[0186] 134. The method of any one of Claims 128-133, said disease
is selected from the group consisting of myotonic dystrophy,
Huntington's disease, familial ALS, cancer, spinal muscular atrophy
and Fragile X syndrome.
[0187] 135. The method of any one of Claims 128-134, wherein the
administration route is selected from the group consisting of oral,
pulmonary, intraperitoneal (ip), intravenous (iv), intramuscular
(im), subcutaneous (sc), transdermal, buccal, nasal, sublingual,
ocular, rectal and vaginal.
[0188] 136. A pharmaceutical composition comprising a nucleic acid
encoding the Cas9 polypeptide of any one of Claims 99-127 and an
excipient.
[0189] 137. The pharmaceutical composition of Claim 136, wherein
the nucleic acid encoding the Cas9 polypeptide is carried in a
nanoparticle.
[0190] 138. The pharmaceutical composition of Claim 137, wherein
the nanoparticle comprises lipids, polymers, hydrogel, or a
combination thereof.
[0191] 139. The pharmaceutical composition of any one of Claims
136-138, further comprising a nucleic acid encoding the sgRNA.
[0192] 140. The pharmaceutical composition of any one of Claims
136-139, wherein the nucleic acid encoding the Cas9 polypeptide or
the nucleic acid encoding the sgRNA is carried in one or more
adeno-associated virus (AAV) vectors.
[0193] 141. A Cas9 polypeptide which has been engineered to
recognize a target RNA, wherein said Cas9 polypeptide is associated
with a detectable agent.
[0194] 142. The Cas9 polypeptide of Claim 141, wherein said
detectable agent comprises a detectable polypeptide which has been
fused to said Cas9 polypeptide.
[0195] 143. The Cas9 polypeptide of Claim 142, wherein said
detectable polypeptide comprises a polypeptide which is inactivated
when said detectable polypeptide is in the nucleus of a cell.
[0196] 144. The Cas9 polypeptide of Claim 143, wherein said
detectable polypeptide is not detectable when said detectable
polypeptide is in the nucleus of a cell but is detectable when said
detectable polypeptide is not in the nucleus of the cell.
[0197] 145. The Cas9 polypeptide of Claim 144, wherein said
detectable polypeptide is detectable when it is not in the nucleus
of the cell via an association with another agent which is
detectable.
[0198] 146. The Cas9 polypeptide of any one of Claims 141-145
wherein said detectable polypeptide is a fluorescent
polypeptide.
[0199] 147. The Cas9 polypeptide of Claim 146 wherein said
fluorescent polypeptide comprises enhanced GFP.
[0200] 148. The Cas9 polypeptide of any one of Claims 141-147,
wherein said Cas9 polypeptide is complexed with a single guide
RNA.
[0201] 149. The Cas9 polypeptide of Claim 148, wherein said single
guide RNA carries extensions of secondary structures in the single
guide RNA scaffold sequence.
[0202] 150. The Cas9 polypeptide of any one of Claims 148 or 149,
wherein said single guide RNA comprises one or more point mutations
that improves expression levels of the single guide RNAs via
removal of partial or full transcription termination sequences or
sequences that destabilize single guide RNAs after transcription
via action of trans-acting nucleases.
[0203] 151. The Cas9 polypeptide of any one of Claims 148-150,
wherein said single guide RNA comprises an alteration at the 5' end
which stabilizes said single guide RNA against degradation.
[0204] 152. The Cas9 polypeptide of any one of Claims 148-151,
wherein said single guide RNA comprises an alteration at the 5' end
which improves RNA targeting.
[0205] 153. The Cas9 polypeptide of any one of Claims 148-152,
wherein said alteration at the 5' end of said single guide RNA is
selected from the group consisting of 2'O-methyl,
phosphorothioates, and thiophosphonoacetate linkages and bases.
[0206] 154. The Cas9 polypeptide of any one of Claims 148-153,
wherein said single guide RNA comprises 2'-fluorine, 2'O-methyl,
and/or 2'-methoxyethyl base modifications in the spacer or scaffold
region of the sgRNA to improve target recognition or reduce
nuclease activity on the single guide RNA.
[0207] 155. The Cas9 polypeptide of any one of Claims 148-154,
wherein said single guide RNA comprises one or more
methylphosphonate, thiophosponoaceteate, or phosphorothioate
linkages that reduce nuclease activity on the target RNA.
[0208] 156. The Cas9 polypeptide of any one of Claims 148-155,
wherein said single guide RNA hybridizes to at least a portion of
the target RNA.
[0209] 157. The Cas9 polypeptide of any one of Claims 148-156,
wherein said single guide RNA comprises a sequence that is
complementary to at least a portion of the target RNA.
[0210] 158. The Cas9 polypeptide of any one of Claims 148-157,
wherein said Cas9 polypeptide is complexed with a CRISPR-targeting
RNA (crRNA) in combination with a trans-activating cRNA
(tracrRNA).
[0211] 159. The Cas9 polypeptide of any one of Claims 148-158,
wherein said Cas9 polypeptide is further complexed with an
antisense oligonucleotide which is complementary to a sequence in
the target RNA.
[0212] 160. The Cas9 polypeptide of Claim 159, wherein said
antisense oligonucleotide comprises at least one modified
nucleotide.
[0213] 161. The Cas9 polypeptide of Claim 160, wherein said at
least one modified nucleotide is selected from the group consisting
of 2'OMe RNA and 2'OMe DNA nucleotides.
[0214] 162. The Cas9 polypeptide of any one of Claims 159-161,
wherein said antisense oligonucleotide comprises a PAMmer
oligonucleotide.
[0215] 163. The Cas9 polypeptide of Claim 162, wherein said PAMmer
oligonucleotide comprises one or more modified bases or
linkages.
[0216] 164. The Cas9 polypeptide of Claim 163, wherein said one or
more modified bases or linkages are selected from the group
consisting of locked nucleic acids and nuclease stabilized
linkages.
[0217] 165. The Cas9 polypeptide of any one of Claims 141-164,
wherein said Cas9 polypeptide is adapted to be delivered to the
nucleus of a cell.
[0218] 166. The Cas9 polypeptide of Claim 165, wherein said Cas9
polypeptide is adapted to be co-exported with a target RNA out of
said nucleus.
[0219] 167. The Cas9 polypeptide of any one of Claims 165 or 166,
wherein said Cas9 polypeptide comprises a nuclear localization
signal.
[0220] 168. The Cas9 polypeptide of any one of Claims 141-167,
wherein said Cas9 polypeptide is nuclease null.
[0221] 169. The Cas9 polypeptide of any one of Claims 141-168,
wherein said target RNA comprises a repeat sequence.
[0222] 170. The Cas9 polypeptide of Claim 169, wherein said repeat
sequence is selected from the group consisting of CTG, CCTG, CAG,
GGGGCC, and any combination thereof.
[0223] 171. The Cas9 polypeptide of Claim 169 or 170, wherein said
target RNA is associated with a disease.
[0224] 172. The Cas9 polypeptide of Claim 171, wherein said disease
is selected from the group consisting of myotonic dystrophy,
Huntington's disease, familial ALS, cancer, spinal muscular atrophy
and Fragile X syndrome.
[0225] 173. A nucleic acid encoding the Cas9 polypeptide of any one
of Claims 141-172.
[0226] 174. A vector comprising the nucleic acid of Claim 173.
[0227] 175. A cell comprising the nucleic acid of Claim 173, or the
vector of Claim 174.
[0228] 176. A method of expressing the Cas9 polypeptide of any one
of Claims 141-172 comprising introducing a nucleic acid of Claim
172 or a vector of Claim 174 into a cell under conditions in which
said cell expresses said Cas9 polypeptide.
[0229] 177. A method of tracking a target RNA or measuring the
amount of a target RNA in a cell comprising allowing a Cas9
polypeptide of any one of Claims 141-172 to bind to said target RNA
in said cell and determining the location of said target RNA in
said cell or determining the amount of said target RNA in said
cell.
[0230] 178. The method of Claim 177, wherein said Cas9 polypeptide
binds to said target RNA in a nucleus of said cell and is
subsequently co-exported from said nucleus with said target
RNA.
[0231] 179. The method of any one of Claims 177 or 178, wherein the
location of said target RNA in said cell or the amount of said
target RNA in said cell is determined using fluorescence
microscopy.
[0232] 180. A nucleic acid encoding the Cas9 polypeptide of any one
of Claims 99-127.
[0233] 181. A vector comprising the nucleic acid of Claim 180.
[0234] 182. A cell comprising the nucleic acid of Claim 180 or the
vector of Claim 181.
[0235] 183. A method of expressing the Cas9 polypeptide of any one
of Claims 99-127 comprising introducing a nucleic acid of Claim 180
or a vector of Claim 181 into a cell under conditions in which said
cell expresses said Cas9 polypeptide.
[0236] 184. A method of modifying the amount or structure of a
target RNA in a cell comprising allowing a Cas9 polypeptide of any
one of Claims 99-127 to bind to said target RNA in said cell under
conditions in which the amount or structure of said target RNA in
said cell is modified.
[0237] 185. A method of measuring RNA content or dynamics in a
sample, comprising: [0238] introducing the Cas9 polypeptide of any
one of Claims 141-172 into said sample; and [0239] observing the
detectable agent in said sample.
[0240] 186. The method of Claim 185, comprising introducing a
nucleic acid of Claim 131 or a vector of Claim 132 into said sample
under conditions in which said Cas9 polypeptide is expressed.
[0241] 187. The method of Claim 87 or 88, further comprising
introducing a single guide RNA.
[0242] 188. The method of any one of Claims 87-89, further
comprising introducing an antisense oligonucleotide.
[0243] 189. The method of any one of Claims 87-90, wherein said
sample comprises a tissue.
[0244] 190. The method of any one of Claims 87-91, wherein said
sample comprises a plurality of cells.
[0245] 191. The method of any one of Claims 87-92, comprising
measuring the content of a target RNA in said sample.
[0246] 192. The method of Claim 93, comprising diagnosing a disease
condition of said sample based on the content of said target RNA in
said sample.
[0247] 193. The method of Claim 94, wherein said disease is
selected from the group consisting of myotonic dystrophy,
Huntington's disease, familial ALS, cancer, spinal muscular atrophy
and Fragile X syndrome.
[0248] 194. A method of modifying a target RNA in a sample,
comprising: introducing the Cas9 polypeptide of any one of Claims
141-172 into said sample; and modifying said target RNA in said
sample using the RNA modifying polypeptide.
[0249] 195. The method of Claim 96, comprising introducing a
nucleic acid of Claim 180 or a vector of Claim 181 into said sample
under conditions in which said Cas9 polypeptide is expressed.
[0250] 196. The method of Claim 194 or 195, further comprising
introducing a single guide RNA.
[0251] 197. The method of any one of Claims 194-196, further
comprising introducing an antisense oligonucleotide.
[0252] 198. The method of any one of Claims 194-197, wherein said
sample comprises a tissue.
[0253] 199. The method of any one of Claims 194-198, wherein said
sample comprises a plurality of cells.
[0254] 200. The method of any one of Claims 194-199, comprising
modifying a target RNA in said sample.
[0255] 201. The method of Claim 200, wherein said target RNA
comprises a repeat sequence.
[0256] 202. The method of Claim 201, wherein said repeat sequence
is selected from the group consisting of CTG, CCTG, CAG, GGGGCC,
and any combination thereof.
[0257] 203. The method of Claim 201 or 202, wherein said repeat
sequence is associated with a disease.
[0258] 204. The method of Claim 203, wherein said disease is
selected from the group consisting of myotonic dystrophy,
Huntington's disease, familial ALS, cancer, spinal muscular atrophy
and Fragile X syndrome.
BRIEF DESCRIPTION OF THE DRAWINGS
[0259] FIG. 1A. S. pyogenes Cas9 and single guide RNA (sgRNA)
complexes bound to DNA or RNA. The Cas9:sgRNA complex may require a
DNA NGG motif referred to as the protospacer adjacent motif (PAM).
In the case of DNA binding, the PAM is supplied by the DNA target
itself. The mechanism of DNA targeting by Cas9 is described
extensively (Sander J D, Joung J K. CRISPR-Cas systems for editing,
regulating and targeting genomes. Nat Biotechnol.
2014;32(4):347-55; Sternberg S H, Redding S, Jinek M, Greene E C,
Doudna J A. DNA interrogation by the CRISPR RNA-guided endonuclease
Cas9. Nature. 2014;507(7490):62-7; Wu X, Kriz A J, Sharp P A.
Target specificity of the CRISPR-Cas9 system. Quant Biol.
2014;2(2):59-70; Jiang F, Taylor D W, Chen J S, Kornfeld J E, Zhou
K, Thompson A J, Nogales E, Doudna J A. Structures of a CRISPR-Cas9
R-loop complex primed for DNA cleavage. Science.
2016;351(6275):867-71).
[0260] FIG. 1B: In alternative embodiments, RNA-targeted Cas9
(RCas9) relies upon a short oligonucleotide called the PAMmer to
supply the PAM motif. By utilizing a mismatched PAMmer, specificity
of RCas9 for RNA while avoiding the encoding DNA is achieved. The
PAMmer also carries a 5' overhang which is required to maintain
target specificity conferred by the sgRNA. As a result, it is
hypothesized that the 5' end of the PAMmer is at least partially
dehybridized from the target RNA as Cas9-mediated unwinding of the
PAMmer:target RNA duplex may confer an energetic cost that is
recovered when the sgRNA hybridizes the target RNA.
[0261] FIG. 2. Summary of exemplary RCas9 application areas. A-D
describe means by which RNA fate can be manipulated by an exemplary
RCas9 system as provided herein. A: With a nuclease-active version
of Cas9, siRNA-intractable RNA targets could be cleaved. B:
Conversely, gene expression could be amplified by tethering factors
that prevent degradation of target RNAs. C: In alternative
embodiments, by fusing Cas9 to a trafficking agent, RNAs could be
forced, or are directed, to different sites of action in the cell
for local translation or other activities, e.g., RNA nuclease
activity. D: In alternative embodiments, the processing of
pre-mRNAs is modulated by fusing Cas9 with a splicing factor to
force differential exon choice. E: In alternative embodiments,
along with altering RNA fate, RCas9 is used to track RNA abundance
in time with split luminescent or fluorescent proteins whose
complementation is guided by binding of adjacent Cas9 proteins on
RNA. F: In alternative embodiments, split fluorescent proteins are
used to reveal rare cells by their RNA content for isolation by
FACS and subsequent study. G: In alternative embodiments, split
toxic proteins or proteins that transform prodrugs to their active
form are complemented in an RNA-dependent manner via fusion to
Cas9.
[0262] FIG. 3A. Targeting mRNA with RNA-targeted Cas9. In
alternative embodiments, RNA-targeting of mRNA in human cells
requires delivery of three components to the nucleus: an SV40
nuclear localization signal-tagged nuclease-inactive Cas9 and EGFP
or mCherry fused to the C-terminus (dCas9-EGFP), an sgRNA with
expression driven by the U6 polymerase III promoter, and a PAMmer
composed of DNA and 2'-O-methyl RNA bases with a phosphodiester
backbone. The sgRNA and PAMmer are antisense to adjacent regions of
the target mRNA whose encoding DNA does not carry a PAM sequence.
After formation of the RCas9/mRNA complex in the nucleus, the
complex is exported to the cytoplasm.
[0263] FIG. 3B. An RCas9 system was delivered to HEK293T cells with
an sgRNA and PAMmer targeting the 3'UTR of GAPDH or sgRNA and
PAMmer targeting a sequence from .lamda. bacteriophage which should
not be present in human cells (targeting sequence "N/A"). Cellular
nuclei are outlined with a dashed white line.
[0264] FIG. 3C. A chart demonstrating the fraction of cells with a
cytoplasmic RCas9 signal.
[0265] FIG. 3D. A schematic of a Renilla luciferase mRNA construct
carrying a target site for RCas9 adjacent to an MS2 aptamer. The
construct contains a PEST protein degradation signal to reveal any
translational effects of RCas9 binding to the mRNA.
[0266] FIG. 3E. A chart demonstrating RNA immunoprecipitation of
EGFP after transient transfection of the RCas9 system targeting the
luciferase mRNA compared to non-targeting sgRNA and PAMmer or EGFP
alone. Scale bars represent 10 microns.
[0267] FIG. 3F. A chart comparing the amounts of Renilla luciferase
mRNA after transient transfection of the RCas9 system targeting the
luciferase mRNA compared to non-targeting sgRNA and PAMmer or EGFP
alone. No significant change in RNA abundance was revealed which
contrasts with the increase in mRNA amount in the presence of
MCP-EGFP. Scale bars represent 10 microns.
[0268] FIG. 3G. A chart comparing the amounts of Renilla luciferase
protein after transient transfection of the RCas9 system targeting
the luciferase mRNA compared to non-targeting sgRNA and PAMmer or
EGFP alone. No significant change in the amount of Renilla
luciferase protein was revealed. Scale bars represent 10
microns.
[0269] FIG. 4A. Tracking .beta.-actin mRNA localization with RCas9.
An exemplary RCas9 system was delivered to U2OS cells and the cells
were subjected to FISH for .beta.-actin mRNA. RCas9 with sgRNA and
PAMmer targeting .beta.-actin mRNA was compared to non-targeting
sgRNA and PAMmer antisense to a sequence from .lamda. bacteriophage
("-" sgRNA and "-" PAMmer). False color images on the right feature
dotted lines that delineate the nucleus.
[0270] FIG. 4B. Pixel-by-pixel analysis of RCas9 and FISH
colocalization in the form of the Mander's overlap coefficient is
summarized using a cumulative distribution of the percent of
cytoplasmic area with overlapping signal in 60-80 cells in each
condition. Frequency histograms shown to the right demonstrate
degree of overlap for each individual condition. The presence of
the PAMmer produces a significantly greater colocalization among
RCas9 and FISH in the presence of the sgRNA targeting .beta.-actin
mRNA (p=0.035, two-tailed Mann-Whitney Test). Scale bars represent
20 microns.
[0271] FIG. 5A. Tracking of mRNA trafficking to stress granules. An
exemplary RCas9 system targeting .beta.-actin mRNA was delivered to
HEK293T cells expressing G3BP1, a protein known to be efficiently
trafficked to stress granules, fused to mCherry. We oxidatively
stressed the cells with sodium arsenite and measured localization
of RCas9 and G3BP1.
[0272] FIG. 5B. RCas9 and G3BP1 signal distribution was measured in
stressed cells (200 .mu.M sodium arsenite) with the fraction of
G3BP1+ stress granules with RCas9 foci reported. Error bars are
standard deviation calculated from 30-40 cells from each of three
biological replicates (90-120 cells total) and RCas9 overlapping
foci were defined as accumulations of RCas9 signal>50% brighter
than surrounding cytoplasmic signal with overlapping G3BP1
foci.
[0273] FIG. 5C. RNA trafficking to stress granules was imaged in
real time using cells harboring RCas9 targeting .beta.-actin mRNA.
At time zero, cells were imaged and sodium arsenite applied. 60
minutes later, cells were imaged again and a comparison of RCas9
and G3BP1-positive stress granules revealed close correlation of
foci only in the presence of sgRNA and PAMmer targeting
.beta.-actin mRNA.
[0274] FIG. 5D. In a similar experiment, RCas9 targeting
.beta.-actin mRNA signal accumulation in stress granules was
tracked over time. 8-11 stress granules were tracked in each
condition with time points every 8 minutes for 32 minutes where
narrow lines represent individual granules and the thick lines
represent mean signal for each condition (see Methods for detailed
procedure). Error bars represent standard error and scale bars
represent 5 microns.
[0275] FIG. 6. Degree of nuclear export of dCas9-GFP in the
presence of mismatches in the sgRNA seed sequence targeting GAPDH.
0, 4, 8, or 12-base mismatches in the seed sequence of an sgRNA
targeting the 3'UTR of GAPDH were introduced and transfected with
the RCas9 system. Degree of cytoplasmic signal was evaluated with
confocal microscopy. An 8-base mismatch was sufficient to eliminate
cytoplasmic signal. Further non-targeting controls were
indistinguishable from a completely mismatched seed sequence
(12-base mismatch). Cellular nuclei are outlined with a dashed
white line. Scale bars represent 10 microns.
[0276] FIG. 7A1. Alternative embodiments ("Permutation 1,
Permutation 2") and uses for exemplary RNA-targeting Cas9 (RCas9).
Permutations 1 and 2 describe which in some embodiments may be the
minimal components for measuring and manipulating RNA with an
exemplary RNA-targeting Cas9. The RCas9 system is composed of the
Streptococcus pyogenes Cas9 protein, a single guide RNA, and a
short oligonucleotide known as the PAMmer (permutation 1) OR
Streptococcus pyogenes Cas9 protein and a single guide RNA only.
Each use case (1-3) describes a distinct technological or
biomedical exemplary application of the RCas9 system in the context
of living cells.
[0277] FIG. 7A2. Use Case 1 describes tracking the presence,
localization, and movement of a target RNA, such as
repeat-containing RNAs, with applications in diagnostics and
research (data supporting this use case is described in FIGS. 7B
and 7C). Repeat-containing RNAs cause a host of disease including
myotonic dystrophy, familial ALS, Huntington's disease, and many
other conditions.
[0278] FIG. 7A3. Use case 2 describes an exemplary therapeutic
application of RCas9 in living cells that utilizes a fused
endonuclease (effector) protein to Cas9 that destroys targeted
RNAs. This general principle can be used to cleave a variety of
disease causing RNAs that cause various conditions ranging from
neurodegeneration to cancer. Data supporting this application in
the context of targeting the repeat-containing RNA that causes
myotonic dystrophy is described in FIG. 7D2.
[0279] FIG. 7A4. RNA splicing use case 3 describes alteration of
RNA splicing with RCas9. Dysfunctional RNA splicing is linked to
many diseases including cancer and spinal muscular atrophy (SMA).
This use case involves an effector comprising a splicing factor or
other protein that alters RNA splicing that is targeted to
pre-mRNAs to alter splicing. Data supporting this use case is
described in FIG. 7E.
[0280] FIG. 7B. Data demonstrating efficient recognition of
repeat-containing RNA (Use case 1). Results continued in FIG. 7C.
By fusing Cas9 to a fluorescent protein, both permutations 1 and 2
produce signal distributions that reveal presence and location of
CUG repeat-containing RNAs. RCas9 measurements of these repeats are
compared to an established means to track CUG repeats (CUG RNA
fluorescence in situ hybridization, "FISH"). Detailed methods are
described below.
[0281] FIG. 7C. Data demonstrating efficient recognition of
repeat-containing RNA (Use case 1). Results continued from FIG.
7B.
[0282] FIG. 7D1. Data demonstrating cleavage of RNA using an
exemplary RCas9 system (use case 2). Here, the RNA that causes
myotonic dystrophy (composed of repeating CUG RNA bases) was
targeted in living human cells using both permutation 1 and 2 of
the RCas9 system.
[0283] FIG. 7D2. Application of the permutation 2 of the
RNA-cleaving RCas9 system (use case 2) resulted in a large
reduction of the amount of CUG repeat-containing RNA (.about.35%
RNA levels compared to no RCas9 system present, bar on far left).
The bar graph represents a quantification of the Northern dot blot
(below).
[0284] FIG. 7E. Data demonstrating alteration of RNA splicing using
an exemplary RCas9 system (use case 3). Here, the splicing of a
pre-mRNA composed of a minigene for human SMN2 carrying exons 6-8.
By targeting RCas9 fused to FOX2 downstream of exon 7, inclusion of
the differentially-spliced exon 7 is promoted. Promotion of
inclusion of this exon is known to be an effective therapeutic for
spinal muscular atrophy. The bar graph is a quantification of an
RT-PCR for the SMN2 minigene. The minigene carries an MS2 aptamer
site adjacent to the RCas9 binding sites which is strongly bound by
MS2 coat protein fused to FOX2 (MS2-FOX2). This serves as a
positive control to demonstrate that this exon is regulated by FOX2
binding. A negative control, also displayed on the far right side
of the bar graph, involving replacement of FOX2 with GFP shows that
FOX2 is required for regulation of this exon.
[0285] FIG. 7F. Data demonstrating cleavage of RNA using an
exemplary RCas9 system (use case 2). A molecular hallmark of type 1
myotonic dystrophy (DM1) is the association of MBNL1 protein within
CTG repeat RNA foci (Ho et al, 2005, J Cell Sci; Batra et al, 2014,
Mol Cell). Here it is demonstrated that permutation 1 of the RCas9
system causes a redistribution of MBNL1 protein that is identical
to the distribution observed without the repeat RNA present
(compare the middle and bottom rows). FIGS. 7B-D demonstrate that
RCas9 is capable of cleaving CTG repeat RNA. This data demonstrates
that an associated molecular phenotoype (MBNL1 distribution) is
reversed to a healthy pattern upon RCas9-mediated cleavage of the
RNA.
[0286] FIG. 7G. Data demonstrating cleavage of RNA using an
exemplary RCas9 system (use case 2). Here, the RNA that causes
C9orf72-linked ALS (composed of repeating GGGGCC (SEQ ID NO: 19)
RNA bases) was targeted in living human cells using permutation 2
of the RCas9 system. Application of the permutation 2 of the
RNA-cleaving RCas9 system (use case 2) resulted in a large
reduction of the amount of so that the repeat RNA is undetectable
via FISH (bottom images).
[0287] FIG. 8A. Full-Length and Truncated Cas9 Proteins. Domain
structure map describing the truncation of Cas9 protein in a manner
that maintains the ability of RNA-targeting Cas9 to destroy the
pathogenic CTG repeat expansion RNA. This novel variant of the Cas9
protein has never been previously demonstrated and is distinct from
full-length Cas9 or other Cas proteins that have been previously
used in the art. In addition, this truncated Cas9 (referred to as
".DELTA.HNH") facilitates therapeutic applications of the RCas9
system via packaging and delivery in adeno-associated viruses
(AAV). AAV are an increasingly-utilized means to delivery encoded
therapeutic systems such as RCas9 but delivered DNA is limited to
.about.4.5 kb. This truncated version of Cas9 facilitates packaging
of the entire RCas9 system in a single AAV vector, facilitating a
host of therapeutic applications for RCas9. Full-length Cas9 domain
structure shown on top followed by Cas9 truncation variants
"Rec-only" and ".DELTA.HNH" domain structure below. The .DELTA.HNH
truncation is missing residues 775-909 from the full-length (FL)
Cas9 protein.
[0288] FIG. 8B. Data demonstrating CTG repeat degradation using an
RCas9 system with a full-length Cas9 protein compared to an RCas9
system with a truncated Cas9 protein. COSM6 cells were transfected
with the RNA-targeting Cas9 system (Cas9 protein or truncated
version fused to the PIN endonuclease with a single guide RNA
(sgRNA) targeting the CTG repeat or a non-targeting (NT) sgRNA)
with a plasmid encoding CTG repeat. The ability of the RCas9 system
in various truncated permutations was compared via Northern blot
for the CTG repeat RNA with U6 snRNA as a loading control. Both
full-length Cas9 and .DELTA.HNH fused to the PIN domain support
cleavage of the CTG repeat RNA but only in the presence of the
sgRNA targeting the repeat.
[0289] FIG. 8C. Quantification of the Northern blot signal from 8B.
Both full length Cas9 and .DELTA.HNH Cas9 truncations support
efficient cleavage of the CTG RNA (>95% loss).
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0290] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference in their
entireties for all purposes to the same extent as if each
individual publication, patent, or patent application was
specifically and individually indicated to be incorporated by
reference. For example, PCT/US14/53301 is herein incorporated by
reference in its entirety for all purposes.
Definitions
[0291] Unless otherwise defined, all technical terms used herein
have the same meaning as commonly understood by one of ordinary
skill in the art in the field to which this disclosure belongs. As
used in this specification and the appended claims, the singular
forms "a," "an," and "the" include plural references unless the
context clearly dictates otherwise. Any reference to "or" herein is
intended to encompass "and/or" unless otherwise stated.
[0292] As used herein the term "associated" or "associated with"
can mean that two or more moieties, such as chemical groups,
nucleotides, oligonucleotides, proteins or peptides are linked to
each other, either covalently or non-covalently. For example, a
protein may be associated with a nucleotide, a fluorescent agent,
or another protein. An association can mean that two or more
proteins or peptides form a fusion protein. An association can be a
physical association. In some instances two or more proteins or
peptides are "tethered", "attached", or "linked" to one another. An
association may be a covalent bond between two proteins or
peptides.
[0293] As used herein, a "polypeptide" includes proteins, fragments
of proteins, and peptides, whether isolated from natural sources,
produced by recombinant techniques, or chemically synthesized. A
polypeptide may have one or more modifications, such as a
post-translational modification (such as glycosylation, etc.) or
any other modification (such as pegylation, etc.). The polypeptide
may contain one or more non-naturally-occurring amino acids (such
as an amino acid with a side chain modification). Polypeptides
described herein typically comprise at least about 10 amino
acids.
[0294] As used herein, the term "sample" can refer to a composition
comprising targets. Suitable samples for analysis by the disclosed
methods, devices, and systems include cells, tissues, organs, or
organisms or compositions obtained from cells, tissues or
organisms.
[0295] As used herein, the term "specifically binds" refers to the
binding specificity of a specific binding pair. Hybridization by a
target-specific nucleic acid sequence of a particular target
polynucleotide sequence in the presence of other potential targets
is one characteristic of such binding. Specific binding involves
two different nucleic acid molecules wherein one of the nucleic
acid molecules specifically hybridizes with the second nucleic acid
molecule through chemical or physical means. The two nucleic acid
molecules are related in the sense that their binding with each
other is such that they are capable of distinguishing their binding
partner from other assay constituents having similar
characteristics. The members of the binding component pair are
referred to as ligand and receptor (anti-ligand), specific binding
pair (SBP) member and SBP partner, and the like.
[0296] "Polynucleotide," or "nucleotide," as used interchangeably
herein, refer to polymers of nucleotides of any length, and include
DNA and RNA. A polynucleotide or nucleotide sequence could be
either double-stranded or single-stranded. When a polynucleotide or
nucleotide sequence is single stranded, it could refer to either of
the two complementary strands. The nucleotides can be
deoxyribonucleotides, ribonucleotides, modified nucleotides or
bases, and/or their analogs, or any substrate that can be
incorporated into a polymer by DNA or RNA polymerase. A
polynucleotide may comprise modified nucleotides, such as
methylated nucleotides and their analogs. If present, modification
to the nucleotide structure may be imparted before or after
assembly of the polymer. The sequence of nucleotides may be
interrupted by non-nucleotide components. A polynucleotide may be
further modified after polymerization, such as by conjugation with
a labeling component. Other types of modifications include, for
example, "caps", substitution of one or more of the naturally
occurring nucleotides with an analog, internucleotide modifications
such as, for example, those with uncharged linkages (such as methyl
phosphonates, phosphotriesters, phosphoamidates, cabamates, etc.)
and with charged linkages (such as phosphorothioates,
phosphorodithioates, etc.), those containing pendant moieties, such
as, for example, proteins (such as nucleases, toxins, antibodies,
signal peptides, ply-L-lysine, etc.), those with intercalators
(such as acridine, psoralen, etc.), those containing chelators
(such as metals, radioactive metals, boron, oxidative metals,
etc.), those containing alkylators, those with modified linkages
(such as alpha anomeric nucleic acids, etc.), as well as unmodified
forms of the polynucleotide(s). Further, any of the hydroxyl groups
ordinarily present in the sugars may be replaced, for example, by
phosphonate groups, phosphate groups, protected by standard
protecting groups, or activated to prepare additional linkages to
additional nucleotides, or may be conjugated to solid supports. The
5' and 3' terminal OH can be phosphorylated or substituted with
amines or organic capping groups moieties of from 1 to 20 carbon
atoms. Other hydroxyls may also be derivatized to standard
protecting groups. Polynucleotides can also contain analogous forms
of ribose or deoxyribose sugars that are generally known in the
art, including, for example, 2'-O-methyl-2'-O-allyl, 2'-fluoro- or
2'-azido-ribose, carbocyclic sugar analogs, .alpha.-anomeric
sugars, epimeric sugars such as arabinose, xyloses or lyxoses,
pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs
and abasic nucleoside analogs such as methyl riboside. One or more
phosphodiester linkages may be replaced by alternative linking
groups. These alternative linking groups include, but are not
limited to, embodiments wherein phosphate is replaced by
P(O)S("thioate"), P(S)S ("dithioate"), (O)NR 2 ("amidate"), P(O)R,
P(O)OR', CO or CH 2 ("formacetal"), in which each R or R' is
independently H or substituted or unsubstituted alkyl (1-20 C)
optionally containing an ether (--O--) linkage, aryl, alkenyl,
cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a
polynucleotide need be identical. The preceding description applies
to all polynucleotides referred to herein, including RNA and
DNA.
[0297] "Oligonucleotide," as used herein, generally refers to
short, generally single stranded, generally synthetic
polynucleotides that are generally, but not necessarily, less than
about 200 nucleotides in length. The terms "oligonucleotide" and
"polynucleotide" are not mutually exclusive. The description above
for polynucleotides is equally and fully applicable to
oligonucleotides.
[0298] The terms "homologous", "substantially homologous", and
"substantial homology" as used herein denote a sequence of amino
acids having at least 50%, 60%, 70%, 80% or 90% identity wherein
one sequence is compared to a reference sequence of amino acids.
The percentage of sequence identity or homology is calculated by
comparing one to another when aligned to corresponding portions of
the reference sequence.
[0299] As used herein, "complementary or matched" means that two
nucleic acid sequences have at least 50% sequence identity.
Preferably, the two nucleic acid sequences have at least 60%, 70%,
80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of sequence identity.
"Complementary or matched" also means that two nucleic acid
sequences can hybridize under low, middle and/or high stringency
condition(s).
[0300] As used herein, "substantially complementary or
substantially matched" means that two nucleic acid sequences have
at least 90% sequence identity. Preferably, the two nucleic acid
sequences have at least 95%, 96%, 97%, 98%, 99% or 100% of sequence
identity. Alternatively, "substantially complementary or
substantially matched" means that two nucleic acid sequences can
hybridize under high stringency condition(s).
[0301] As used herein, "improve" means a change of at least about
1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 35%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%,
225%, 250%, 275%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%,
900%, 1000% or more or any value between any of the listed values.
Alternatively, "improve" could mean a change of at least about
1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold,
8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold,
50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 500-fold,
1000-fold, 2000-fold or more or any value between any of the listed
values.
[0302] As used herein, "complexed" means non-covalently linked to
or associated with.
[0303] As used herein, "nuclease null" may refer to a polypeptide
with reduced nuclease activity, reduced endo- or exo-DNAse activity
or RNAse activity, reduced nickase activity, or reduced ability to
cleave DNA and/or RNA.
[0304] As used herein, "reduced nuclease activity" means a decline
in nuclease, nickase, DNAse, or RNAse activity of at least about
1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 35%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more or any value
between any of the listed values. Alternatively, "reduced nuclease
activity" may refer to a decline of at least about 1-fold,
1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold,
9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold,
60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 500-fold, 1000-fold,
2000-fold or more or any value between any of the listed
values.
[0305] As used herein, a "trafficking agent or agents" may refer to
any polypeptide that directs the nucleoprotein complex to a desired
location in a cell, such as a cytoplasmic polyadenylation element
binding protein (CPEB), a zinc finger binding protein (ZBP), TIA-1
(a 3'UTR mRNA binding protein), a PSF (a protein component of
spliceosomes) or a DNA-binding domain (DBD) of PSF, fragile X
mental retardation protein (FMRP), IGF-II mRNA-binding protein
(IMP)-1 (IMP1), IMP2, IMP3, a cytoskeleton binding protein, a
transmembrane protein, or an engineered protein comprising a
combination of domains of these aforementioned proteins to generate
a combinatorial trafficking phenomena.
[0306] In general, the stability of a hybrid is a function of the
ion concentration and temperature. Typically, a hybridization
reaction is performed under conditions of lower stringency,
followed by washes of varying, but higher, stringency. Moderately
stringent hybridization refers to conditions that permit a nucleic
acid molecule such as a probe to bind a complementary nucleic acid
molecule. The hybridized nucleic acid molecules generally have at
least 60% identity, including for example at least any of 70%, 75%,
80%, 85%, 90%, or 95% identity. Moderately stringent conditions are
conditions equivalent to hybridization in 50% formamide, 5.times.
Denhardt's solution, 5.times. SSPE, 0.2% SDS at 42.degree. C.,
followed by washing in 0.2.times. SSPE, 0.2% SDS, at 42.degree. C.
High stringency conditions can be provided, for example, by
hybridization in 50% formamide, 5.times. Denhardt's solution,
5.times. SSPE, 0.2% SDS at 42.degree. C., followed by washing in
0.1.times. SSPE, and 0.1% SDS at 65.degree. C.
[0307] Low stringency hybridization refers to conditions equivalent
to hybridization in 10% formamide, 5.times. Denhardt's solution,
6.times.SSPE, 0.2% SDS at 22.degree. C., followed by washing in
1.times. SSPE, 0.2% SDS, at 37.degree. C. Denhardt's solution
contains 1% Ficoll, 1% polyvinylpyrolidone, and 1% bovine serum
albumin (BSA). 20.times. SSPE (sodium chloride, sodium phosphate,
ethylene diamide tetraacetic acid (EDTA)) contains 3 M sodium
chloride, 0.2 M sodium phosphate, and 0.025 M (EDTA). Other
suitable moderate stringency and high stringency hybridization
buffers and conditions are well known to those of skill in the
art.
RNA-Targeting Cas9 Polypeptides (RCas9)
[0308] Some embodiments disclosed herein provide Cas9 polypeptide
which has been engineered to recognize a target RNA, wherein the
Cas9 polypeptide is associated with an effector. In some
embodiments, the Cas9 polypeptide is a Streptococcus pyogenes Cas9
polypeptide. In some embodiments, the Cas9 polypeptide comprises a
mutation, such as D10A, H840A, or both (SEQ ID NO: 31), in the
Streptococcus pyogenes Cas9 polypeptide.
[0309] Some embodiments relate to a version of the Cas9
polypeptide-comprising nucleoprotein complex as provided herein is
involved in the clustered regularly interspaced short palindromic
repeats (CRISPR)/Cas9, or CRISPR/Cas9, system that has been
repurposed or engineered to target RNA instead of DNA in living
cells. This repurposed or engineered Cas9 polypeptide-comprising
nucleoprotein complex binds to RNA is referred to herein as RCas9.
CRISPR has revolutionized genome engineering by allowing
simply-programmed recognition of DNA in human cells and supported
related technologies in imaging and gene expression modulation. We
have developed an analogous means to target RNA using an RCas9, or
with CRISPR/Cas9. In some embodiments, nucleoprotein complexes as
provided herein comprise a Cas9 protein, a single guide RNA
(sgRNA), and optionally an (chemically-modified or synthetic)
antisense PAMmer oligonucleotide. The PAMmer is an antisense
oligonucleotide that serves to simulate a DNA substrate for
recognition by Cas9 via hybridization to the target RNA. Together,
the Cas9 protein and sgRNA components allow recognition of
hypothetically any RNA sequence.
[0310] Thus, in alternative embodiments, compositions and methods
provided herein provide solutions to persistent problems in many
fields of basic biology and therapy. As a tool for basic biology
and drug development, this technology has already supported
nondestructive measurement of RNA localization and gene expression
in living cells (see discussion below). From a therapeutic
perspective, compositions and methods provided herein allow
targeted alteration of RNA compositions via alteration of RNA
splicing or RNA editing to reverse RNA features that are implicated
in diseases such as cancer and neurodegeneration. The nucleoprotein
complexes as provided herein stand apart from the state of the art
as the first simply reprogrammable, nucleic acid-guided RNA binding
protein.
[0311] In some embodiments, exemplary nucleoprotein complexes as
provided herein are associated with, or comprise, a detectable
agent, such as a fluorescent agent, a fluorescent protein, an
enzyme, or the like. In some embodiments, the fluorescent protein
is a green fluorescent protein (GFP), an enhanced GFP (EGFP (SEQ ID
NO: 30)), a blue fluorescent protein or its derivatives (EBFP,
EBFP2, Azurite, mKalama1), a cyan fluorescent protein or its
derivatives (ECFP, Cerulean, CyPet, mTurquoise2), a yellow
fluorescent protein and its derivatives (YFP, Citrine, Venus,
YPet), UnaG, dsRed, eqFP611, Dronpa, TagRFPs, KFP, EosFP, Dendra,
IrisFP, etc., or fragments thereof. In some embodiments, a
fluorescent protein may be split into two halves, each fused with a
Cas9 polypeptide, so that when the two Cas9 polypeptides bind to
adjacent RNA targets, the two halves of the fluorescent protein
come into close proximity of each other and generate a fluorescent
signal. For example, the fluorescent protein Venus can be split
into two halves: an N-terminal portion and a C-terminal portion. In
some embodiments, the N-terminal portion comprises residues 1-155
or 1-173 (SEQ ID NO: 25). In some embodiments, the N-terminal
portion comprises an I152L mutation (SEQ ID NO: 24; I152L reduced
background complementation mutant, from Kodama et al Biotechniques.
2010 Nov. 49(5):793-805). In some embodiments, the C-terminal
portion comprises residues 155-238 (SEQ ID NO: 26). In some
embodiments, the enzyme is luciferase (Gaussia, Renilla, Firefly
variants), tobacco etch virus (TEV) protease, ubiquitin, horse
radish peroxidase, or a toxin such as diphtheria toxin, etc. In
some embodiments, the enzyme may be split into two halves, each
fused with a Cas9 polypeptide, so that when the two Cas9
polypeptides bind to adjacent RNA targets, the two halves of the
enzyme come into close proximity of each other and create the
enzymatic activity. In some embodiments, the enzyme is involved in
the modification of synthesis of a compound. In some embodiments,
the compound is a polypeptide or a nucleic acid. In some
embodiments, the association of the Cas9 polypeptide on a target
RNA creates a local accumulation of intermediate products in a
biosynthetic pathway to amplify the production of a medically- or
technologically-useful compound compared to free-floating
biosynthetic enzymes.
[0312] In some embodiments, the nucleoprotein complexes as provided
herein are associated with an effector polypeptide such as a
nuclease that cleaves RNA, such as, a PIN domain protein, such as
human SMG6 (SEQ ID NO: 27), or fragments thereof. In some
embodiments, nucleoprotein complexes as provided herein are
associated with an RNA binding protein, such as, human RBFOX1 (SEQ
ID NO: 28), Human RBFOX2 (SEQ ID NO: 29), or the like, or fragments
thereof. In some embodiments, the Cas9 polypeptide is associated
with a splicing factor, or fragments thereof. In some embodiments,
the nuclease, RNA binding protein, or splicing factor may be split
into two halves, each fused with a Cas9 polypeptide, so that when
the two Cas9 polypeptides bind to adjacent RNA targets, the two
halves of the nuclease, RNA binding protein, or splicing factor
come into close proximity of each other and create the enzymatic
activity.
[0313] In some embodiments, nucleoprotein complexes as provided
herein are further associated with or comprise one or more nuclear
localization signals, one or more stable, inert linker peptides
such as XTEN peptides, or combinations thereof. XTEN peptides have
been used to extend the serum half-life of translationally fused
biologic drugs by increasing their hydrodynamic radius, acting as a
protein-based functional analog to chemical PEGylation. As XTEN
peptides are chemically stable, non-cationic, non-hydrophobic, and
predicted to adopt an extended, unstructured conformation,
XTEN-based linker peptides can function as stable, inert linker
sequences to join Cas9 polypeptides to an effector polypeptide,
such as an RNA modifying polypeptide, or to a detectable
moiety.
Truncated Cas9 Polypeptides
[0314] Truncated versions of Streptococcus pyogenes Cas9 that are
capable of binding RNA are advantageous in terms of their ability
to specifically alter target RNA but not DNA sequences while
reducing the size of Cas9 protein to fit in adeno-associated viral
vectors (AAV). In some embodiments, the nucleoprotein complexes
comprise truncated versions of Cas9 that lack part or all of the
DNA-cleaving HNH, RuvC domains, or combinations thereof, which
facilitate both of these important features by eliminating the
DNA-cleaving ability of Cas9 (producing a nuclease-null Cas9) and
reducing its size. In some embodiments, AAV vectors capable of
delivering .about.4.5 kb are used for packaging of transgenes. In
some embodiments, AAVs capable of packaging larger transgenes such
as about 4.6 kb, 4.7 kb, 4.8 kb, 4.9 kb, 5.0 kb, 5.1 kb, 5.2 kb,
5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1
kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb,
7.0 kb, 7.5 kb, 8.0 kb, 9.0 kb, 10.0 kb, 11.0 kb, 12.0 kb, 13.0 kb,
14.0 kb, 15.0 kb, or larger are used.
[0315] In other embodiments, the nucleoprotein complexes comprise
truncations lacking all or portions of other domains that contact
specific DNA residues (such as the PAMmer-interaction-domain, or
PAM-ID domain), all or portions of the Rec domain, or combinations
thereof, providing further reductions in size that maintain the
ability of Cas9 to bind RNA. By fusing nuclease-null Cas9 to
effectors such as the PIN domain or other effectors that act on RNA
but not DNA, these embodiments provide means to alter RNA while not
targeting the encoding DNA.
[0316] In some embodiments, the Cas9 active sites (10 and 840) are
mutated to Alanine (D10A and H840A) to eliminate the cleavage
activity of Streptococcus pyogenes Cas9, producing
nuclease-deficient or dCas9. The RuvC domain is distributed among 3
non-contiguous portions of the dCas9 primary structure (residues
1-60, 719-775, and 910-1099). The Rec lobe is composed of residues
61-718. The HNH domain is composed of residues 776-909. The PAM-ID
domain is composed of residues 1100-1368.
[0317] The REC lobe can be considered the structural scaffold for
recognition of the sgRNA and target DNA/RNA. The NUC lobe contains
the two nuclease domains (HNH and RuvC), plus the PAM-interaction
domain (PAM-ID), which recognizes the PAM sequence. In some
embodiments, the 98-nucleotide sgRNA can similarly be broken into
two major structural components: the first contains the
target-specific guide or "spacer" segment (nucleotides 1-20) plus
the repeat-tetraloop-anti-repeat and stem-loop 1 (SL1) regions; the
second contains stem-loops 2 and 3 (SL2, SL3). In some embodiments,
the guide-through-SL1 RNA segment is bound mainly by the Cas9 REC
lobe. In some embodiments, the SL2-SL3 segment is bound mainly by
the NUC lobe.
[0318] A recent study demonstrated that 1368-amino acid
Streptococcus pyogenes Cas9 can be split into two polypeptides
comprising the REC lobe (amino acids 56-714) and the NUC lobe
(amino acids 1-57 fused to 729-1368), which can be combined in
trans to form a functional nuclease (Wright A V, Sternberg S H,
Taylor D W, Staahl B T, Bardales J A, Kornfeld J E, Doudna J A.
Rational design of a split-Cas9 enzyme complex. Proc Natl Acad Sci
USA. 2015; 112(10):2984-9). The study results demonstrate that a
Cas9 construct missing the entire NUC lobe can assemble with sgRNA
with high affinity; albeit significantly lower affinity than
full-length Cas9. Currently, it is unknown how affinity changes in
this range affect either DNA-editing efficiency of CRISPR/Cas9 or
its ability to target RNA in cells.
[0319] In some embodiments, a minimal construct of SpCas9 is
engineered that will recognize a target RNA sequence with high
affinity and guide its fused PIN RNA endonuclease domain to a model
RNA for destruction. In some embodiments, the smallest construct
will be a REC-only construct. In some embodiments, the constructs
will comprise less minimized constructs lacking the HNH, PAM-ID,
parts of each domain, lacking both of each domains, or combinations
thereof. In some embodiments, the HNH domain will be excised by
inserting a five-residue flexible linker between residues 775 and
909 (.DELTA.HNH). In some embodiments, all or part of the PAM-ID
are removed. In some embodiments, truncating Cas9 at residue 1098
(.DELTA.PAM-ID #1), fusing residues 1138 and 1345 with an 8-residue
linker (.DELTA.PAM-ID #2), or fusing residues 1138 with 1200 and
1218 with 1339 (with 5-residue and 2-residue linkers, respectively:
.DELTA.PAM-ID #3) are used to remove all or part of the PAM-ID. The
.DELTA.PAM-ID #2 and 3 constructs will retain elements of the
PAM-ID that contribute to binding of the sgRNA repeat-anti-repeat
(residues 1099-1138) and SL2-SL3 (residues 1200-1218 and 1339-1368)
segments. In some embodiments, the HNH deletion will be combined
with the three PAM-ID deletions.
[0320] In some embodiments, the nucleoprotein complex may comprise
a Cas9 polypeptide that lacks all or part of (1) an HNH domain, (2)
at least one RuvC nuclease domain, (3) a Cas9 polypeptide DNase
active site, (4) a .beta..beta..alpha.-metal fold comprising a Cas9
polypeptide active site, or (5) a Cas9 polypeptide that lacks all
or part of one or more of the HNH domain, at least one RuvC
nuclease domain, a Cas9 polypeptide DNase active site, and/or a
.beta..beta..alpha.-metal fold comprising a Cas9 polypeptide active
site as compared to a corresponding wild type (WT) Cas9 polypeptide
and wherein, the complex may or may not comprise a PAMmer
oligonucleotide.
Single Guide RNA (sgRNA)
[0321] In some embodiments, nucleoprotein complexes as provided
herein are complexed with a single guide RNA (sgRNA). In some
embodiments, the single guide RNA carries extensions of secondary
structures in the single guide RNA scaffold sequence. In some
embodiments, the single guide RNA comprises one or more point
mutations that improve expression levels of the single guide RNAs
via removal of partial or full transcription termination sequences
or sequences that destabilize single guide RNAs after transcription
via action of trans-acting nucleases. In some embodiments, the
single guide RNA comprises an alteration at the 5' end which
stabilizes said single guide RNA against degradation. In some
embodiments, the single guide RNA comprises an alteration at the 5'
end which improves RNA targeting. In some embodiments, the
alteration at the 5' end of said single guide RNA is selected from
the group consisting of 2'O-methyl, phosphorothioates, and
thiophosphonoacetate linkages and bases. In some embodiments, the
single guide RNA comprises 2'-fluorine, 2'O-methyl, and/or
2'-methoxyethyl base modifications in the spacer or scaffold region
of the sgRNA to improve target recognition or reduce nuclease
activity on the single guide RNA. In some embodiments, the single
guide RNA comprises one or more methylphosphonate,
thiophosponoaceteate, or phosphorothioate linkages that reduce
nuclease activity on the target RNA.
[0322] In some embodiments, the single guide RNA can recognize the
target RNA, for example, by hybridizing to the target RNA. In some
embodiments, the single guide RNA comprises a sequence that is
complementary to the target RNA. In some embodiments, the single
guide RNA has a length that is, is about, is less than, or is more
than, 10 nt, 20 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90
nt, 100 nt, 110 nt, 120 nt, 130 nt, 140 nt, 150 nt, 160 nt, 170 nt,
180 nt, 190 nt, 200 nt, 300 nt, 400 nt, 500 nt, 1,000 nt, 2,000 nt,
or a range between any two of the above values. In some
embodiments, the single guide RNA can comprise one or more modified
nucleotides.
[0323] In alternative embodiments, a variety of RNA targets can be
recognized by the single guide RNA. For example, a target RNA can
be messenger RNA (mRNA), ribosomal RNA (rRNA), signal recognition
particle RNA (SRP RNA), transfer RNA (tRNA), small nuclear RNA
(snRNA), small nucleolar RNA (snoRNA), antisense RNA (aRNA), long
noncoding RNA (lncRNA), microRNA (miRNA), piwi-interacting RNA
(piRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA),
retrotransposon RNA, viral genome RNA, viral noncoding RNA, or the
like. In some embodiments, a target RNA can be an RNA involved in
pathogenesis or a therapeutic target for conditions such as
cancers, neurodegeneration, cutaneous conditions, endocrine
conditions, intestinal diseases, infectious conditions,
neurological disorders, liver diseases, heart disorders, autoimmune
diseases, or the like.
[0324] In some embodiments, a target RNA can comprise a repeat
sequence. For example, the repeat sequence can be CTG, CCTG, CAG,
GGGGCC, or any combination thereof. In some embodiments, the repeat
sequence is associated with a disease, for example, myotonic
dystrophy, Huntington's disease, familial ALS, cancer, spinal
muscular atrophy, Fragile X syndrome, etc.
PAMmer Oligonucleotide
[0325] In some embodiments, nucleoprotein complexes as provided
herein are further complexed with an antisense oligonucleotide
which is complementary to a sequence in the target RNA. In some
embodiments, the antisense oligonucleotide comprises a PAMmer
oligonucleotide. In some embodiments, the antisense oligonucleotide
comprises at least one modified nucleotide. In some embodiments,
the at least one modified nucleotide is selected from the group
consisting of 2'OMe RNA and 2'OMe DNA nucleotides. In some
embodiments, the PAMmer oligonucleotide comprises one or more
modified bases or linkages. In some embodiments, the one or more
modified bases or linkages are selected from the group consisting
of locked nucleic acids and nuclease stabilized linkages. In some
embodiments, the antisense oligonucleotide is complementary to a
sequence that is in close proximity to the target RNA. For example,
the antisense oligonucleotide can be complementary to a sequence
that is about 10 nt, 20 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80
nt, 90 nt, 100 nt, from the target RNA. In some embodiments, the
antisense oligonucleotide has a length that is, is about, is less
than, or is more than, 10 nt, 20 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70
nt, 80 nt, 90 nt, 100 nt, 110 nt, 120 nt, 130 nt, 140 nt, 150 nt,
160 nt, 170 nt, 180 nt, 190 nt, 200 nt, 300 nt, 400 nt, 500 nt,
1,000 nt, 2,000 nt, or a range between any two of the above values.
In some embodiments, the antisense oligonucleotide comprises RNA,
DNA, or both.
Nucleic Acids Encoding Cas9 Polypeptides
[0326] Some embodiments disclosed herein provide nucleic acids that
encode the Cas9 polypeptides, sgRNAs, or fusion proteins of the
nucleoprotein complexes as provided herein, optionally associated
with an effector or detectable moiety, such as a detectable reagent
or an RNA modifying polypeptide, e.g., an RNA endonuclease.
[0327] The nucleic acids may be naturally occurring nucleic acids
DNA, RNA, or artificial nucleic acids including peptide nucleic
acid (PNA), Morpholino and locked nucleic acid (LNA), as well as
glycol nucleic acid (GNA) and threose nucleic acid (TNA). Both
single-stranded and double-stranded nucleic acids may be used for
the present disclosure. In some embodiments, the nucleic acid is a
recombinant DNA molecule.
[0328] In some embodiments, the Cas9 polypeptides as encoded herein
comprise archaeal or bacterial Cas9 polypeptides. In some
embodiments the Cas9 polypeptide is, comprises or is derived from:
Haloferax mediteranii, Mycobacterium tuberculosis, Francisella
tularensis subsp. novicida, Pasteurella multocida, Neisseria
meningitidis, Campylobacter jejune, Streptococcus thermophilus
LMD-9 CRISPR 3, Campylobacter lari CF89-12, Mycoplasma
gallisepticum str. F, Nitratifractor salsuginis str. DSM 16511,
Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria
cinerea, Gluconacetobacter diazotrophicus, Azospirillum B510,
Sphaerochaeta globus str. Buddy, Flavobacterium columnare,
Fluviicola taffensis, Bacteroides coprophilus, Mycoplasma mobile,
Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus
johnsonii, Staphylococcus pseudintermedius, Filifactor alocis,
Treponema denticola, Legionella pneumophila str. Paris, Sutterella
wadsworthensis, Corynebacter diphtheriae, or Streptococcus aureus;
a Francisella novicida (optionally a Francisella novicida Cpf1) or
a Natronobacterium gregoryi Argonaute modified or repurposed to
target RNA, wherein optionally the sgRNA 3' end or "scaffold
sequence" comprises all or part of, or is derived from, the wild
type (WT) cognate guide nucleic acid of each of these respective
bacteria or archaeal organisms.
[0329] As used herein, "operatively linked" or "linked operatively"
refer to the situation in which part of a linear DNA sequence can
influence the other parts of the same DNA molecule. For example,
when a promoter controls the transcription of the coding sequence,
it is operatively linked to the coding sequence.
[0330] Some embodiments disclosed herein provide genetically
engineered recombinant vectors comprising nucleic acid molecules
encoding exemplary Cas9 polypeptides, sgRNAs, or fusion proteins of
an exemplary Cas9 polypeptide optionally associated with an
effector or detectable moiety, such as a detectable reagent or an
RNA modifying polypeptide, e.g., an RNA endonuclease. Vectors used
can include those that are suitable for expression in a selected
host, whether prokaryotic or eukaryotic, for example, phage,
plasmid, and viral vectors. Viral vectors may be either replication
competent or replication defective retroviral vectors. Viral
propagation generally will occur only in complementing host cells
comprising replication defective vectors, for example, when using
replication defective retroviral vectors in methods provided herein
viral replication will not occur. Vectors may comprise Kozak
sequences (Lodish et al., Molecular Cell Biology, 4th ed., 1999)
and may also contain the ATG start codon. Promoters that function
in a eukaryotic host include SV40, LTR, CMV, EF-1.alpha., white
cloud mountain minnow .beta.-actin promoter, etc.
[0331] Copy number and positional effects are considered in
designing transiently and stably expressed vectors. Copy number can
be increased by, for example, dihydrofolate reductase
amplification. Positional effects can be optimized by, for example,
Chinese hamster elongation factor-1 vector pDEF38 (CHEF1),
ubiquitous chromatin opening elements (UCOE),
scaffold/matrix-attached region of human (S/MAR), and artificial
chromosome expression (ACE) vectors, as well as by using
site-specific integration methods known in the art. The expression
constructs containing the vector and gene of interest will further
contain sites for transcription initiation, termination, and, in
the transcribed region, a ribosome binding site for translation.
The coding portion of the transcripts expressed by the constructs
can include a translation initiating codon at the beginning and a
termination codon (UAA, UGA, or UAG) appropriately positioned at
the end of the polypeptide to be translated.
[0332] Considering the above-mentioned factors, exemplary vectors
suitable for expressing exemplary Cas9 polypeptides, sgRNAs, and/or
fusion proteins of a Cas9 polypeptide, optionally associated with
an effector or detectable moiety, such as a detectable reagent or
an RNA modifying polypeptide in bacteria include pTT vectors, are
available e.g., from Biotechnology Research Institute (Montreal,
Canada), pQE70, pQE60, and pQE-9, available from Qiagen
(Mississauga, Ontario, Canada); vectors derived from pcDNA3,
available from Invitrogen (Carlsbad, Calif.); pBS vectors,
Phagescript vectors, Bluescript vectors, pNH8A, pNH6a, pNH18A,
pNH46A, available from Stratagene (La Jolla, Calif.); and ptrc99a,
pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia
(Peapack, N.J.). Among suitable eukaryotic vectors are pWLNEO,
pSV2CAT, pOG44, pXT1, and pSG available from Stratagene (La Jolla,
Calif.); and pSVK3, pBPV, pMSG and pSVL, available from Pharmacia
(Peapack, N.J.).
[0333] Vectors for expressing exemplary Cas9 polypeptides, sgRNAs,
or fusion proteins of a Cas9 polypeptide, optionally associated
with an effector or detectable moiety, such as a detectable reagent
or an RNA modifying polypeptide include those comprising a pTT
vector backbone (Durocher et al., Nucl. Acids Res. 30:E9 (2002)).
Briefly, the backbone of a pTT vector may be prepared by obtaining
pIRESpuro/EGFP (pEGFP) and pSEAP basic vector(s), for example from
Clontech (Palo Alto, Calif.), and pcDNA3.1, pCDNA3.1/Myc-(His)6 and
pCEP4 vectors can be obtained from, for example, Invitrogen
(Carlsbad, Calif.). As used herein, the pTT5 backbone vector can
generate a pTT5-Gateway vector and be used to transiently express
proteins in mammalian cells. The pTT5 vector can be derivatized to
pTT5-A, pTT5-B, pTT5-D, pTT5-E, pTT5-H, and pTT5-I, for example. As
used herein, the pTT2 vector can generate constructs for stable
expression in mammalian cell lines.
[0334] A pTT vector can be prepared by deleting the hygromycin
(BsmI and SalI excision followed by fill-in and ligation) and EBNA1
(ClaI and NsiI excision followed by fill-in and ligation)
expression cassettes. The ColEI origin (FspI-SalI fragment,
including the 3' end of the .beta.-lactamase open reading frame
(ORF) can be replaced with a FspI-SalI fragment from pcDNA3.1
containing the pMBI origin (and the same 3' end of .beta.-lactamase
ORF). A Myc-(His)6 C-terminal fusion tag can be added to SEAP
(HindIII-HpaI fragment from pSEAP-basic) following in-frame
ligation in pcDNA3.1/Myc-His digested with HindIII and EcoRV.
Plasmids can subsequently be amplified in E. coli (DH5.alpha.)
grown in LB medium and purified using MAXI prep columns (Qiagen,
Mississauga, Ontario, Canada). To quantify, plasmids can be
subsequently diluted in, for example, 50 mM Tris-HCl pH 7.4 and
absorbencies can be measured at 260 nm and 280 nm. Plasmid
preparations with A260/A280 ratios between about 1.75 and about
2.00 are suitable for producing the Fc-fusion constructs.
[0335] The expression vector pTT5 allows for extrachromosomal
replication of the cDNA driven by a cytomegalovirus (CMV) promoter.
The plasmid vector pCDNA-pDEST40 is a Gateway-adapted vector which
can utilize a CMV promoter for high-level expression. SuperGlo GFP
variant (sgGFP) can be obtained from Q-Biogene (Carlsbad, Calif.).
Preparing a pCEP5 vector can be accomplished by removing the CMV
promoter and polyadenylation signal of pCEP4 by sequential
digestion and self-ligation using SalI and XbaI enzymes resulting
in plasmid pCEP4.DELTA.. A GblII fragment from pAdCMV5 (Massie et
al., J. Virol. 72:2289-2296 (1998)), encoding the CMVS-poly(A)
expression cassette ligated in BglII-linearized pCEP4.DELTA.,
resulting in the pCEP5 vector.
[0336] Vectors for expressing exemplary Cas9 polypeptides, sgRNAs
or fusion proteins of a Cas9 polypeptide, optionally associated
with an effector or detectable moiety, such as a detectable reagent
or an RNA modifying polypeptide can include those comprising
vectors optimized for use in CHO-S or CHO-S-derived cells, such as
pDEF38 (CHEF1) and similar vectors (Running Deer et al.,
Biotechnol. Prog. 20:880-889 (2004)). The CHEF vectors contain DNA
elements that lead to high and sustained expression in CHO cells
and derivatives thereof. They may include, but are not limited to,
elements that prevent the transcriptional silencing of
transgenes.
[0337] Vectors may include a selectable marker for propagation in a
host. In alternative embodiments, a selectable marker is used that
allows the selection of transformed cells based on their ability to
thrive in the presence or absence of a chemical or other agent that
inhibits an essential cell function. The selectable markers confer
a phenotype on a cell expressing the marker, so that the cell can
be identified under appropriate conditions. Suitable markers,
therefore, include genes coding for proteins which confer drug
resistance or sensitivity thereto, impart color to, or change the
antigenic characteristics of those cells transfected with a
molecule encoding the selectable marker, when the cells are grown
in an appropriate selective medium.
[0338] Suitable selectable markers include dihydrofolate reductase
or G418 for neomycin resistance in eukaryotic cell culture; and
tetracycline, kanamycin, or ampicillin resistance genes for
culturing in E. coli and other bacteria. Suitable selectable
markers also include cytotoxic markers and drug resistance markers,
whereby cells are selected by their ability to grow on media
containing one or more of the cytotoxins or drugs; auxotrophic
markers, by which cells are selected for their ability to grow on
defined media with or without particular nutrients or supplements,
such as thymidine and hypoxanthine; metabolic markers for which
cells are selected, for example, for ability to grow on defined
media containing a defined substance, for example, an appropriate
sugar as the sole carbon source; and markers which confer the
ability of cells to form colored colonies on chromogenic substrates
or cause cells to fluoresce.
[0339] As mentioned above, vectors for the expression of exemplary
Cas9 polypeptides, sgRNA, or fusion proteins of an exemplary Cas9
polypeptide optionally associated with an effector or detectable
moiety, such as a detectable reagent or an RNA modifying
polypeptide can also be constructed in retroviral vectors. One such
vector, the ROSA geo retroviral vector, which maps to mouse
chromosome six, was constructed with the reporter gene in reverse
orientation with respect to retroviral transcription, downstream of
a splice acceptor sequence (U.S. Pat. No. 6,461,864; Zambrowicz et
al., Proc. Natl. Acad. Sci. 94:3789-3794 (1997)). Infecting
embryonic stem (ES) cells with ROSA geo retroviral vector resulted
in the ROSA geo26 (ROSA26) mouse strain by random retroviral gene
trapping in the ES cells.
[0340] A DNA insert comprising nucleic acids (optionally contained
in a vector or vectors) encoding exemplary Cas9 polypeptides,
sgRNAs, or fusion proteins of a Cas9 polypeptide, optionally
associated with an effector or detectable moiety, such as a
detectable reagent or an RNA modifying polypeptide can be
operatively linked to an appropriate promoter, such as the phage
lambda PL promoter; the E. coli lac, trp, phoA, and tac promoters;
the SV40 early and late promoters; and promoters of retroviral
LTRs. Suitable vectors and promoters also include the pCMV vector
with an enhancer, pcDNA3.1; the pCMV vector with an enhancer and an
intron, pCIneo; the pCMV vector with an enhancer, an intron, and a
tripartate leader, pTT2, and CHEF1. Other suitable vectors and
promoters will be known to the skilled artisan. The promoter
sequences include at least the minimum number of bases or elements
necessary to initiate transcription of a gene of interest at levels
detectable above background. Within the promoter sequence may be a
transcription initiation site, as well as protein binding domains
(consensus sequences) responsible for the binding of RNA
polymerase. In alternative embodiments, eukaryotic promoters will
often, but not always, contain "TATA" boxes and "CAT" boxes.
[0341] Some embodiments disclosed herein provide vectors for the in
vivo expression of exemplary Cas9 polypeptides, sgRNAs, or fusion
proteins of an exemplary Cas9 polypeptide, optionally associated
with an effector or detectable moiety, such as a detectable reagent
or an RNA modifying polypeptide in animals, including humans, under
the control of a promoter that functions in a tissue-specific
manner. For example, promoters that drive the expression of the
Cas9 polypeptides sgRNAs, or fusion proteins of a Cas9 polypeptide
associated, optionally associated with an effector or detectable
moiety, such as a detectable reagent or an RNA modifying
polypeptide may be liver-specific, as described in
PCT/US06/00668.
[0342] A region of additional amino acids, particularly charged
amino acids, may be added to the N-terminus of the polypeptide to
improve stability and persistence in the host cell purification
throughout and subsequent handling and storage. Also, amino acid
moieties may be added to the polypeptide to facilitate
purification. Such amino acids may or may not be removed prior to
the final preparation of the polypeptide. The Cas9 polypeptides or
fusion proteins of a Cas9 polypeptide, optionally associated with
an effector or detectable moiety, such as a detectable reagent or
an RNA modifying polypeptide can be fused to marker sequences, such
as a peptide, that facilitates purification of the fused
polypeptide. The marker amino acid sequence may be a hexa-histidine
peptide such as the tag provided in a pQE vector (Qiagen,
Mississauga, Ontario, Canada), among others, many of which are
commercially available. As described in Gentz et al., Proc. Natl.
Acad. Sci. 86:821-824 (1989), for instance, hexa-histidine provides
for convenient purification of the fusion protein. Another peptide
tag useful for purification, the hemagglutinin HA tag, corresponds
to an epitope derived from the influenza hemagglutinin protein
(Wilson et al., Cell 37:767-778 (1984)). Any of the above markers
can be engineered using the polynucleotides or the polypeptides as
provided herein.
[0343] The expression constructs can further contain sites for
transcription initiation, termination, and, in the transcribed
region, a ribosome binding site for translation. The coding portion
of the transcripts expressed by the constructs can include a
translation initiating codon at the beginning and a termination
codon (UAA, UGA, or UAG) appropriately positioned at the end of the
polypeptide to be translated.
Cells Expressing Cas9 Polypeptides
[0344] Some embodiments disclosed herein provide a cell line
comprising the nucleic acid or nucleic acids (e.g., vector or
vectors) that encode exemplary Cas9 polypeptides, sgRNAs, or fusion
proteins of an exemplary Cas9 polypeptide associated with an
effector or detectable moiety, such as a detectable reagent or an
RNA modifying polypeptide. In some embodiments, the cell line
transfected may be a prokaryotic cell line, a eukaryotic cell line,
a yeast cell line, an insect cell line, an animal cell line, a
mammalian cell line, a human cell line, etc. The proteins expressed
in mammalian cells have been glycosylated properly. The mammalian
cells can produce the Cas9 polypeptides, sgRNAs, or fusion proteins
of a Cas9 polypeptide, optionally associated with an effector or
detectable moiety, such as a detectable reagent or an RNA modifying
polypeptide in this disclosure. Examples of useful mammalian host
cell lines are HEK293, CHO, sp2/0, NSO, COS, BHK, PerC6. Many other
cells can also be used as the expression and production host, and
hence, are encompassed by this disclosure.
[0345] For recombinant production of the fusion proteins, molecular
cloning method is used based on the molecular cloning protocols,
for example those described in, Sambrook & Russel, Molecular
Cloning (3rd ed., CSHL Press, 2001). The DNA sequences coding the
fusion protein can be acquired by ordinary techniques, e.g. by
whole gene synthesizing or spliced DNA fragments. Many vectors can
be used. The vector components generally include, but are not
limited to, one or more of the following: a signal sequence for the
secretion of expressed proteins, one or more marker genes including
the selection marker gene for the stable cell line screening in
eukaryote cells, an origin of replication, an enhancer element, a
promoter, and a transcription termination sequence, and poly A,
etc.
[0346] Transfection of animal cells typically involves opening
transient pores or "holes" in the cell membrane, to allow the
uptake of material. Genetic material (such as supercoiled plasmid
DNA or siRNA constructs), or even proteins such as antibodies, may
be transfected. There are various methods of introducing foreign
DNA into a eukaryotic cell. Transfection can be carried out using
calcium phosphate, by electroporation, or by mixing a cationic
lipid with the material to produce liposomes, which fuse with the
cell membrane and deposit their cargo inside. Many materials have
been used as carriers for transfection, which can be divided into
three kinds: (cationic) polymers, liposomes and nanoparticles.
[0347] Exemplary Cas9 polypeptides or fusion proteins of an
exemplary Cas9 polypeptide associated with an effector or
detectable moiety, such as a detectable reagent or an RNA modifying
polypeptide may be recovered from the cells by precipitation,
ultracentrifugation, or chromatographic methods, including ion
exchange chromatography, size exclusion chromatography, affinity
chromatography, immunoaffinity chromatography, HPLC, etc. RP-HPLC
may be used to further purify the recovered fusion protein. When
the Cas9 polypeptides or fusion proteins of a Cas9 polypeptide
associated with an effector or detectable moiety, such as a
detectable reagent or an RNA modifying polypeptide are secreted,
commercially available ultrafiltration membranes from Millipore,
Amicon, Pellicon, etc. may be used to concentrate the
supernatant.
[0348] In some embodiments, protein A affinity chromatography may
be used to recover the Cas9 polypeptides or fusion proteins of a
Cas9 polypeptide associated with an effector or detectable moiety,
such as a detectable reagent or an RNA modifying polypeptide.
Protein A is a cell wall component produced by several strains of
Staphylococcus aureus and can be made in a recombinant fashion. It
consists of a single polypeptide chain weighing approximately
42,000 daltons and contains little or no carbohydrate. Protein A
binds specifically to the Fc region of most immunoglobulin
molecules, including IgG (Sjoquist et al., Eur. J. Biochem.
29:572-578 (1972); Hjelm et al., Eur. J. Biochem. 57:395-403
(1975)).
[0349] Protein G affinity chromatography may also be used to purify
the Cas9 polypeptides or fusion proteins of a Cas9 polypeptide
associated with an effector or detectable moiety, such as a
detectable reagent or an RNA modifying polypeptide. Protein G is a
bacterial cell wall protein produced by group G streptococci and
can also be made in a recombinant fashion. Like Protein A, Protein
G binds to most mammalian immunoglobulins, primarily through their
Fc regions (Bjorck et al., J. Immunol. 133:969-974 (1984); Guss et
al., EMBO J. 5:1567-1575 (1986); Akerstrom et al., J. Biol. Chem.
261:10,240-10,247 (1986)). Affinity chromatography using Cas9
binding molecules may further be used to purify Cas9 polypeptides
of the disclosure. For example, Protein A/G is a genetically
engineered protein that combines the IgG binding profiles of both
Protein A and Protein G. Protein A/G is a gene fusion product,
which can be secreted from, inter alia, nonpathogenic Bacillus.
Protein A/G typically weighs approximately 50,000 daltons and was
designed to contain four Fc binding domains from Protein A and two
from Protein G (Sikkema, Amer. Biotech. Lab. 7:42 (1989); Eliasson
et al., J. Biol. Chem. 263:4323-4327 (1988)).
Methods of Tracking or Measuring the Amount of Target RNA
[0350] Some embodiments disclosed herein provide compositions for
and methods of tracking a target RNA or measuring the amount of a
target RNA in a sample, such as a cell, comprising allowing an
exemplary Cas9 polypeptide disclosed herein to bind to said target
RNA in said cell and determining the location of said target RNA in
said cell or determining the amount of said target RNA in said
cell. In some embodiments, the Cas9 polypeptide associated with a
detectable agent as disclosed herein is introduced to the sample.
In some embodiments, a single guide RNA that recognizes the target
RNA, and/or an antisense oligonucleotide, such as a PAMmer
oligonucleotide, is further introduced to the sample.
[0351] In some embodiments, exemplary Cas9 polypeptides bind to
said target RNA in a nucleus of said cell and is subsequently
co-exported from said nucleus with said target RNA. In some
embodiments, the location of said target RNA in said cell or the
amount of said target RNA in said cell is determined using
fluorescence microscopy.
[0352] In some embodiments, the methods provided herein comprise
measuring the content of a target RNA in said sample. In some
embodiments, the methods comprise diagnosing a disease condition of
said sample based on the content of said target RNA in said sample.
In some embodiments, the disease is selected from the group
consisting of myotonic dystrophy, Huntington's disease, familial
ALS, cancer, spinal muscular atrophy and Fragile X syndrome,
etc.
Methods of Modifying a Target RNA
[0353] Some embodiments disclosed herein provide methods of
modifying a target in a sample comprising introducing exemplary
Cas9 polypeptides disclosed herein into the sample and modifying
said target RNA in said sample using an RNA modifying polypeptide,
which in alternative embodiments can be linked or fused to an
exemplary Cas9 polypeptide. In some embodiments, the exemplary Cas9
polypeptide associated with an RNA modifying polypeptide as
disclosed herein is introduced to the sample. In some embodiments,
a single guide RNA (sgRNA) that recognizes the target RNA, and/or
an antisense oligonucleotide, such as a PAMmer oligonucleotide, is
further introduced to the sample, and in some embodiments, the
sgRNA is associated with, or is co-expressed with, the Cas9
polypeptide.
[0354] In some embodiments, the RNA modifying polypeptide can
fragment the target RNA. In some embodiments, the RNA modifying
polypeptide can change the splicing of the target RNA.
[0355] In some embodiments, the methods comprise treating a disease
condition of said sample by modifying said target RNA in said
sample. In some embodiments, the disease is selected from the group
consisting of myotonic dystrophy, Huntington's disease, familial
ALS, cancer, spinal muscular atrophy and Fragile X syndrome,
etc.
[0356] Current methods to target RNA in living cells rely on
nucleic acid basepairing with antisense oligonucleotides (ASOs) or
engineered RNA binding proteins. ASOs can unambiguously recognize
target RNA, but are limited in their function to destruction of the
target RNA or as a means to block association of other nucleic
acids or protein to the RNA. Engineered RNA binding proteins are
difficult and expensive to design, must be completely redesigned
for every RNA target, target structured RNAs poorly, and their
affinities for RNA can vary unpredictably. In contrast to ASOs,
engineered RNA binding proteins can carry a variety of protein
factors to alter the target RNA for therapy for RNA tracking.
Certain Cas9 polypeptides and methods of using them are discussed
in PCT/US2014/069730, entitled Methods and Compositions for
Modifying a Single-Stranded Target Nucleic Acid, filed Dec. 11,
2014 and published as WO2015/089277, the disclosure of which is
incorporated herein by reference in its entirety.
[0357] In alternative embodiments, exemplary RCas9 polypeptides and
RCas9 complexes as provided herein combines the strengths of both
of these approaches by allowing simply-programmed and strong RNA
binding based on nucleic acid basepairing while carrying any
protein factor to achieve the effect of choice on the target RNA.
In alternative embodiments, exemplary RCas9 polypeptides and RCas9
complexes as provided herein also incorporate CRISPR-related
technologies that include modified single guide RNAs that can
recruit trans-acting protein factors, photo- and drug-activatable
Cas proteins, and optogenetics-compatible Cas proteins.
[0358] There currently exist no widely-used methods of RNA
localization tracking that are compatible with living cells. FISH
protocols require destruction of the cells/tissues of interest, but
there is great interest in non-destructive RNA tracking in living
cells. In alternative embodiments, exemplary RNA-targeted Cas9
polypeptides and RCas9 complexes as provided herein can fill this
important gap.
[0359] With respect to altering RNA splicing modulation, PUF
protein splicing factors or 2'-O-methyl and 2'-O-2-methoxyethyl RNA
oligonucleotides have drawbacks (Wang Y, Cheong C G, Hall T M, Wang
Z. 2009. Engineering splicing factors with designed specificities.
Nat Methods 6: 825-830). As mentioned above, there are no
widely-used factors for splicing modulation due to the weaknesses
of PUF proteins and oligonucleotides. In alternative embodiments,
the need for improved splicing modulation for basic research and
therapies can be addressed using exemplary RCas9 technology
described herein.
[0360] Some embodiments described herein relate to the design and
application of RCas9 for RNA tracking in living cells. In some
embodiments, RCas9 comprises a mutant form of Cas9 protein fused to
a fluorescent protein, a single guide RNA with expression in
mammalian cells driven by a U6 polymerase III promoter, and an
antisense oligonucleotide composed of 2'OMe RNA and DNA bases.
These components may be delivered to the cellular nucleus with
transfection reagents and bind mRNA forming the RCas9 complex. The
RCas9 complex is subsequently exported from the nucleus while bound
to the target RNA, allowing tracking of the target mRNA
localization via fluorescence microscopy. Other embodiments allow
measurement of RNA abundance in the cell, or fusion of Cas9 to
splicing factors or other RNA-modifying enzymes to alter RNA
features for therapy or research. In some embodiments, RCas9 is
delivered to the cellular nucleus and subsequently co-exported with
a targeted mRNA to be localized, detected or measured.
[0361] RCas9 RNA tracking has been compared herein to established
methods of RNA tracking. Established methods such as fluorescence
in situ hybridization require killing of the cells-of-interest,
while RCas9 provided high quality RNA tracking measurements in
living cells. Further, RCas9 supported tracking of RNAs as the
translocated in the cytoplasm of living cells. We also demonstrate
co-export of RCas9 from cellular nuclei in response to mRNA
detection. By attaching a split or inactivated protein to RCas9 and
localizing the other half or activating peptide to the cellular
cytoplasm, we have successfully reconstituted split protein
activity in response to RNA abundance.
[0362] In some embodiments, RCas9 provided herein is used for
tracking RNA in living cells. Current methods of RNA tracking
require killing cells of interest. Many diseases feature altered
RNA localization patterns and drug development will require methods
to track endogenous RNAs in diseased cells and in response to drug
treatment.
[0363] In some embodiments, RCas9 provided herein is used for
nondestructive isolation of cells based on gene expression. The
RCas9 system can be used to create fluorescence readout of RNA
abundance in living cells. This could allow isolation of
circulating cancer cells in patient blood or from patient biopsies.
These rare cells could be isolated based on their gene expression
using RCas9 and be expanded and studied, allowing cancer detection
long before development of tumors sufficiently large to identify
with MRI or PET imaging.
[0364] In some embodiments, RCas9 provided herein is used for
altering RNA composition in living cells. The ability for force
binding of Cas9 fused to RNA-modifying enzymes will provide a
fundamental tool to the rapidly growing field of RNA metabolism and
processing. The Human Genome Project has shifted its focus to
studying the importance of RNA and there is a profound lack of
engineering tools for studying and utilizing the consequences of
RNA processing.
[0365] The Streptococcus pyogenes CRISPR-Cas system has gained
widespread application as a genome editing and gene regulation tool
as simultaneous cellular delivery of the Cas9 protein and guide
RNAs enables recognition of specific DNA sequences. As provided
herein, the discovery and engineering of a Cas9 that can bind and
cleave RNA in an RNA-programmable manner demonstrates the utility
of exemplary systems and methods as provided herein as a universal
nucleic acid-recognition technology. In alternative embodiments,
exemplary RNA-targeted Cas9 (RCas9) as provided herein allows
identification and manipulation of RNA substrates in live cells,
empowering the study of cellular gene expression, and could
ultimately spawn patient- and disease-specific diagnostic and
therapeutic tools. Here we describe the development of RCas9 and
compare it to previous methods for RNA targeting, including
engineered RNA binding proteins and other types of CRISPR-Cas
systems. Provided are exemplary alternative uses ranging from live
imaging of transcriptional dynamics to patient-specific therapies
and applications in synthetic biology.
Introduction
[0366] The human genome project was completed more than a decade
ago and sets the foundation for understanding the genetic basis of
cell behavior in health and disease. Since then, efforts have
shifted towards understanding the importance of functional genetic
elements and how they affect gene expression (The ENCODE Project
Consortium. 2012. An integrated encyclopedia of DNA elements in the
human genome. Nature 489: 57-74). Since all cells of an individual
contain largely the same DNA, the functional distinctions between
cell types (a cardiomyocyte and a neuron, for instance) are closely
linked to the portions of the genome that are transcriptionally
active. As a result, measurement of transcribed RNA within
individual cells reveals cellular identity and distinguishes
healthy and disease states. For example, expression levels of a
focused panel of RNA transcripts identified disease-associated
aberrations in neuronal development in models of autism spectrum
disorder (Pasca S P, Portmann T, Voineagu I, Yazawa M, et al. 2011.
Using iPSC-derived neurons to uncover cellular phenotypes
associated with Timothy syndrome. Nat Med 17: 1657-62). As another
example, the expression of certain small non-coding RNAs known as
microRNAs (miRs) is increasingly recognized as a characteristic
signature of oncogenic transformation. Tumor microRNA signatures
can serve as biomarkers informing the type of malignancy and
associated clinical outcomes (Lu J, Getz G, Miska E A,
Alvarez-Saavedra E, et al. 2005. MicroRNA expression profiles
classify human cancers. Nature 435: 834-8; MacKenzie T A, Schwartz
G N, Calderone H M, Graveel C R, et al. 2014. Stromal Expression of
miR-21 Identifies High-Risk Group in Triple-Negative Breast Cancer.
Am J Pathol 184: 3217-25). These studies and others make clear that
tracking informative RNAs in vivo will be key to disease modeling,
diagnostics and potentially therapeutics.
[0367] Due to the obvious impact of expressing specific RNAs on
cell state and behavior, unraveling the mechanisms that affect the
processing of these RNA has become very important. Following
transcription, protein-encoding RNAs undergo a series of maturation
steps that include alternative splicing, nuclear export and
subcellular targeting, turnover and spatiotemporally restricted
translation. These steps are mediated by RNA binding proteins
(RBPs) and dysfunction of these factors and their RNA targets
causes disease in humans (Gerstberger S, Hafner M, Ascano M, Tuschl
T. 2014. Evolutionary conservation and expression of human
RNA-binding proteins and their role in human genetic disease. Adv
Exp Med Biol 825: 1-55). Altered subcellular distribution of RBPs
caused by gain-of-function expanded RNA elements is also becoming a
common theme in human disease. For example, expansion of an
intronic hexanucleotide repeat within the C9ORF72 gene was recently
recognized as the most frequently mutated genetic locus among two
common neurodegenerative disorders, frontotemporal lobar
degeneration and amyotrophic lateral sclerosis (DeJesus-Hernandez
M, Mackenzie I R, Boeve B F, Boxer A L, et al. 2011. Expanded
GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes
chromosome 9p-linked FTD and ALS. Neuron 72: 245-56; Renton A E,
Majounie E, Waite A, Simon-Sanchez J, et al. 2011. A hexanucleotide
repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked
ALS-FTD. Neuron 72: 257-68). In vivo approaches to targeting the
processing of endogenous RNA would open up basic biological
understanding of development and disease as well as new avenues for
therapies.
[0368] A recent publication has raised awareness of the potential
of RNA-guided RNA recognition (O'Connell M R, Oakes B L, Sternberg
S H, East-Seletsky A, et al. 2014. Programmable RNA recognition and
cleavage by CRISPR/Cas9. Nature 516: 263-6). Here, we focus on the
potential of repurposing and engineering Cas9, the effector
nuclease of the Streptcococcus pyogenes CRISPR-Cas system that has
been used to recognize DNA in mammalian cells, as an RNA-programmed
RNA recognition technology.
Current RNA Recognition Modalities and their Limitations
[0369] The development of designer RNA recognition factors will
support a variety of advances in biology and medicine. Aside from
targeted modulation of RNA processing and abundance, a designer RBP
could generate completely novel activities in response to RNA
recognition, such as generating a signal for noninvasive detection
of cell state, promoting association of signaling proteins and
their substrates only in particular cell types, or even ablating
cells that display particular expression profiles. This broad
potential has motivated the development of designer RNA recognition
factors to varying degrees of success.
[0370] An ideal RNA recognition system would be capable of strong
and specific binding to endogenous RNAs and display sufficient
modularity for simple and predictable targeting. Inroads towards
programmable RNA recognition have emerged based upon engineered
natural nucleic acid binding proteins that are powerful for some
applications but suffer from limited programmability, recognize too
short a recognition sequence to be specific, and/or require large
libraries of protein repeat sequences to target all possible RNA
sequences. In contrast to direct recognition of nucleic acids by
proteins, CRISPR-Cas (clustered regularly-interspaced short
palindromic repeats) systems form bacterial adaptive immune systems
and recognize invading nucleic acids with RNA-guided proteins.
[0371] An obvious strategy is the alteration or concatenation of
natural RNA-binding protein domains. The identification of
canonical RNA recognition protein domains such as KH and RRM led to
attempts at identifying and modulating their natural RNA targets
(Beuth B, Pennell S, Arnvig K B, Martin S R, et al. 2005. Structure
of a Mycobacterium tuberculosis NusA-RNA complex. EMBO J 24:
3576-87; Braddock D T, Louis J M, Baber J L, Levens D, et al. 2002.
Structure and dynamics of KH domains from FBP bound to
single-stranded DNA. Nature 415: 1051-6; Laird-Offringa I A,
Belasco J G. 1995. Analysis of RNA-binding proteins by in vitro
genetic selection: identification of an amino acid residue
important for locking U1A onto its RNA target. Proc Natl Acad Sci
USA 92: 11859-63). These domains bind RNA in groups of 4-5
contiguous nucleotides. As a result, libraries of more than 1000
protein domains are required to recognize all 5-base RNA sequences.
In contrast, PUF proteins contain repeat domains that recognize a
single RNA nucleotide each so only four repeats are in principle
required to recognize all possible RNA sequences. The crystal
structures of natural PUF proteins were first described in 2001
(Wang X, Zamore P D, Hall T M. 2001. Crystal structure of a Pumilio
homology domain. Mol Cell 7: 855-65) and revealed recognition of
specific RNA bases that is largely determined by the amino acid
side chains rather than the backbone. Since their initial
discovery, the RNA specificity of PUF proteins has been decoded
(Filipovska A, Razif M F, Nygard K K, Rackham O. 2011. A universal
code for RNA recognition by PUF proteins. Nat Chem Biol 7: 425-7)
and PUFs have been designed against a variety of RNA targets (Wang
Y, Cheong C G, Hall T M, Wang Z. 2009. Engineering splicing factors
with designed specificities. Nat Methods 6: 825-30). Furthermore,
PUFs have been successfully fused to nucleolytic domains to target
and destroy disease-associated RNA (Zhang W, Wang Y, Dong S,
Choudhury R, et al. 2014. Treatment of type 1 myotonic dystrophy by
engineering site-specific RNA endonucleases that target (CUG)(n)
repeats. Molecular therapy: J Am Soc Gene Ther 22: 312-20).
However, PUF proteins can only recognize 8 contiguous bases and
local secondary structures can have a strong influence on RNA
affinity, thus limiting their utility (Zhang W, Wang Y, Dong S,
Choudhury R, et al. 2014. Treatment of type 1 myotonic dystrophy by
engineering site-specific RNA endonucleases that target (CUG)(n)
repeats. Molecular therapy: J Am Soc Gene Ther 22: 312-20).
Cas9 for RNA-Guided Nucleic Acid Recognition
[0372] While PUF, KH, and RRM proteins rely upon protein-RNA
interactions to recognize RNA, nucleic acid base-pairing represents
a simpler means of RNA recognition. The CRISPR-Cas bacterial immune
system utilizes RNA-mediated base-pairing to recognize DNA, and has
been successfully repurposed to target DNA in mammalian cells (Mali
P, Yang L H, Esvelt K M, Aach J, et al. 2013. RNA-Guided Human
Genome Engineering via Cas9. Science 339: 823-6; Cho S W, Kim S,
Kim J M, Kim J S. 2013. Targeted genome engineering in human cells
with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31: 230-2;
Hwang W Y, Fu Y F, Reyon D, Maeder M L, et al. 2013. Efficient
genome editing in zebrafish using a CRISPR-Cas system. Nat
Biotechnol 31: 227-9; Jinek M, East A, Cheng A, Lin S, et al. 2013.
RNA-programmed genome editing in human cells. eLife 2: e00471). In
bacteria and archaea, CRISPR-Cas forms the functional core of
adaptive immune systems that are typically composed of a nuclease
associated with a pair of RNAs called the trans-activating CRISPR
RNA (tracrRNA) and CRIPSR RNA (crRNA). The tracrRNA and crRNA guide
the CRISPR nuclease to invading plasmid or bacteriophage DNA by
base-pairing for cleavage by the nuclease (FIG. 1A). Recently, a
Type II CRISPR-Cas system from S. pyogenes was repurposed to target
mammalian DNA by creation of an artificial combination of the
tracrRNA and crRNA called the single guide RNA (sgRNA) (Mali P,
Yang L H, Esvelt K M, Aach J, et al. 2013. RNA-Guided Human Genome
Engineering via Cas9. Science 339: 823-6; Cong L, Ran F A, Cox D,
Lin S, et al. 2013. Multiplex genome engineering using CRISPR/Cas
systems. Science 339: 819-23). By allowing facile DNA targeting via
the sgRNA sequence, RNA-programmed Cas9 is rapidly proving to be a
popular means of genome editing and transcription modulation. The
recent application of Cas9 to RNA targeting may support a similar
shift in programmable RNA recognition based on RNA programming over
engineered binding proteins.
[0373] RNA-targeted Cas9 (RCas9) is the subject of recent work from
the Doudna lab that demonstrates strong and specific binding and
subsequent cleavage of ssRNA by Cas9 in vitro. In FIGS. 1A and 1B,
we compare this new approach to RNA recognition by Cas9 to DNA
recognition. DNA targeting by Cas9 requires two features: an NGG
sequence referred to as the proto spacer adjacent motif (PAM) and a
sgRNA carrying an antisense sequence adjacent to the PAM (FIG. 1A).
These two features are also required for RNA targeting by Cas9,
although the PAM motif is provided by a hybridized antisense
oligonucleotide (the PAMmer), which sits adjacent to the sgRNA
antisense sequence after hybridization to the target RNA (FIG.
1B).
[0374] O'Connell and Oakes et al. also demonstrated that a 5'
extension of the PAMmer beyond the PAM motif is required to
generate specific RNA recognition programmed by the sgRNA. Shorter
PAMmers lacking this extension promote Cas9:sgRNA binding that is
independent of sgRNA sequence, but the sequence specificity of
sgRNA-programmed RNA recognition is reconstituted by an extension
of the PAMmer. This effect may be due to the energetic cost of
Cas9-mediated unwinding of the PAMmer-RNA target duplex which is
recovered only when the sgRNA hybridizes its target. Since the
sgRNA is encodable and small (.about.100 bases), there is potential
to generate large libraries of sgRNAs to target particular gene
networks or screen the transcriptome. In contrast, the size of
engineered RNA recognition proteins does not easily support
large-scale screens. Although the cost associated with producing
and distributing large libraries of modified oligonucleotide
PAMmers will be an obstacle to work at this scale, future
developments may allow the use of minimally modified
oligonucleotides and leverage low-cost, high-throughput
oligonucleotide synthesis technologies.
[0375] The aforementioned study was conducted exclusively in vitro
and the strength and specificity of RNA-targeting Cas9 (RCas9)
inside living cells or organisms is not yet known. Analogous to
recent measurement of CRISPR-Cas off-target activities on genomic
DNA (Cencic R, Miura H, Malina A, Robert F, et al. 2014.
Protospacer adjacent motif (PAM)-distal sequences engage CRISPR
Cas9 DNA target cleavage. PLoS One 9: e109213; Kuscu C, Arslan S,
Singh R, Thorpe J, et al. 2014. Genome-wide analysis reveals
characteristics of off-target sites bound by the Cas9 endonuclease.
Nat Biotechnol 32: 677-83), extensive validation of the RCas9
binding specificity will be required in order to evaluate its
potential as an intracellular, RNA-programmable RNA-binding
protein. Along with its well-known ability to target DNA, the
comprehensive ability of the S. pyogenes CRISPR-Cas system to
target nucleic acids is now being established. The Information Box
highlights major challenges that must be overcome for RCas9 to be
applicable in vivo.
Information Box: In Vivo Applications of RCas9
[0376] An evaluation of the potential of RCas9 for RNA targeting in
living organisms naturally begins by examining reported in vivo
applications of Cas9 for genome editing. Delivery of Cas9 and the
cognate sgRNA have been achieved by various means, including the
use of viruses that encode Cas9 and the sgRNA (Swiech L,
Heidenreich M, Banerjee A, Habib N, et al. 2015. In vivo
interrogation of gene function in the mammalian brain using
CRISPR-Cas9. Nature Biotechnol 33: 102-6; Maddalo D, Manchado E,
Concepcion C P, Bonetti C, et al. 2014. In vivo engineering of
oncogenic chromosomal rearrangements with the CRISPR/Cas9 system.
Nature 516: 423-7), transgenic animals that allow drug-inducible
expression of Cas9 (Dow L E, Fisher J, O'Rourke K P, Muley A, et
al. 2015. Inducible in vivo genome editing with CRISPR-Cas9. Nature
Biotechnol doi:10.1038/nbt.3155), and delivery of Cas9 protein and
sgRNA via anionic fusion proteins and cationic lipids (Zuris J A,
Thompson D B, Shu Y, Guilinger J P, et al. 2015. Cationic
lipid-mediated delivery of proteins enables efficient protein-based
genome editing in vitro and in vivo. Nature Biotechnol 33: 73-80).
Modulation of RNA splicing by RCas9 via targeting of a splicing
factor fused to Cas9 to a pre-mRNA of interest, for instance, could
be conducted in the central nervous system with an appropriately
serotyped adenovirus. Splicing modulation in other tissues could be
achieved with drug-inducible and tissue-specific expression of Cas9
and its sgRNA. But in all cases, an efficient means to deliver the
RCas9 PAMmer to the appropriate tissues must be identified. By
limiting the expression or delivery of either Cas9 or the sgRNA to
the tissue of interest and conducting systemic administration of
the PAMmer, it may be possible to achieve tissue-specific RCas9
activity. Highly stable modified oligonucleotides such as
2'-O-(2-methoxyethyl)-RNA have supported effective delivery and
targeting of antisense RNAs in vivo (Meng L, Ward A J, Chun S,
Bennett C F, et al. 2015. Towards a therapy for Angelman syndrome
by targeting a long non-coding RNA. Nature 518: 409-12; Hua Y,
Sahashi K, Hung G, Rigo F, et al. 2010. Antisense correction of
SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse
model. Genes Dev 24: 1634-44; Passini M A, Bu J, Richards A M,
Kinnecom C, et al. 2011. Antisense oligonucleotides delivered to
the mouse CNS ameliorate symptoms of severe spinal muscular
atrophy. Science Transl Med 3: 72ra18) and may prove useful in the
RCas9 system as well. Thus, while these and similar approaches have
been used to deliver one or two components of the RCas9 system in
vivo, it remains to be seen which combination allows effective
reconstitution of all three components. Further modifications in
the PAMmer will be required to prevent destruction of the target
RNA due to recognition by RNAse H, the cellular enzyme that
degrades RNA in RNA-DNA hybrids. Careful adjustment of the PAMmer
length and modifications will be important to maintain targeting
specificity while avoiding recruitment of the RNAi machinery.
Although RCas9 does not appear to cleave DNA in vitro, it remains
to be seen if inadvertent DNA targeting may occur in vivo.
Ultimately, the success of RCas9 in vivo will ultimately rely on
its specificity and whether RCas9 destabilizes the target RNA or
interferes with its translation.
Modulating Post-Transcriptional Gene Expression
[0377] Exemplary RCas9 polypeptides as provided herein utilize the
inherent endonucleolytic activity of Cas9 to attenuate gene
expression via cleavage of particular transcripts (FIG. 2A). While
RNA interference (RNAi) supports effective RNA recognition and
cleavage, RCas9-based gene knockdown can be useful in compartments
or organelles where the RNAi machinery is not present or active. In
alternative embodiments, the high affinity of RCas9 for RNA and
dual recognition by both the sgRNA and PAMmer allows more specific
RNA depletion than siRNAs or antisense oligonucleotides. Table 1
compares this and other applications of exemplary RCas9 to current
methods and Table 2 compares RCas9 for RNA knockdown to RNAi in
greater detail.
TABLE-US-00001 TABLE 1 Summary of exemplary RCas9 applications
Application State of the art Limitations RCas9-based approach Main
area of innovation Targeted RNA siRNA, antisense Efficiency limited
Natural nucleolytic Strong binding of Cas9 knockdown
oligonucleotides. by access to RNA activity of Cas9. to target RNA
may (FIG. 2A) silencing allow better machinery and knockdown
efficiency; dependence on may allow knockdown RNA structure. in
compartments lacking RNAi machinery. RNA Coding region of Requires
targeted dCas9 fused to RNA Potential first means to stabilization
GOI placed within genetic stabilizing factor. stabilize any
unlabeled (FIG. 2B) stabilizing UTR manipulation or RNA. contexts
exogenous expression of GOI. RNA localization Cis-acting sequence
Requires targeted dCas9 fused to RNA The high affinity of
alteration tags incorporated genetic trafficking protein. RCas9 for
RNA could (FIG. 2C) into transcript; these manipulation or enable
control of recruit tagged exogenous endogenous RNA exogenous or
expression of GOI. localization. endogenous localization factors.
RNA splicing PUF proteins fused PUFs limited to 8 dCas9 fused to
Potentially more alteration to splicing factors or base recognition
splicing factor specific alteration of (FIG. 2D) splicing factor
sequences, targeted adjacent to splicing allowing either access
blocked with oligonucleotides or inside exons. gain- or loss-of-
antisense limited to splicing function. oligonucleotides. factor
loss-of- function. Imaging of RNA MS2 or Spinach Requires dCas9
fused to May be effective localization labeling of RNA in
modification of fluorescent protein means of revealing (FIG. 2E)
conjunction with target RNA. or split fluorescent localization of
any MS2-GFP protein or protein. unlabeled RNA. Spinach fluorophore.
Time-resolved Incorporation of Requires genetic dCas9 fused to
split May be first means for RNA fluorescent or modification.
fluorescent or time-resolved gene measurements luminescent reporter
luminescent protein. expression (FIG. 2E) at genomic locus
measurement without near GOI. genetic modification. Isolation of
rare Identification of Requires known dCas9 fused to split There
are currently no cells based on surface markers and surface marker
for fluorescent protein. high-sensitivity means gene expression
antibodies for FACS. cell type of interest. to measure RNA (FIG.
2F) content in live cells. Death induction Incorporation of
Requires genetic dCas9 fused to split Potentiallly first means
based in toxic protein at modification, toxic protein. to
programmably target response to genomic locus near limited
therapeutic RNA profiles for death gene expression GOI. potential.
induction. (FIG. 2G) Substrate Fusion of enzymes Results in dCas9
fused to First means to control shuttling or incorporation of
constitutive members of substrate shuttling protein/protein
substrate shuttling. synthetic pathway based upon RNA interaction
partners targeting adjacent abundance. to create enzyme sites on an
RNA. concatemers.
TABLE-US-00002 TABLE 2 Comparison of RNAi and exemplary RCas9 for
gene knockdown RNAi RCas9 Specificity Specificity determined by at
most ~21 RNA Target recognized by both 20 nucleotide within
nucleotides. the sgRNA and the 20+ nucleotide PAMmer. Components
Engages endogenous RNA-induced Requires delivery of Cas9 protein,
sgRNA, and silencing complex (RISC), requires delivery PAMmer
oligonucleotide. of siRNA only. Localization RISC mainly
cytoplasmic; targeting nuclear RCas9 potentially active in both
nucleus and RNAs difficult. cytoplasm. Influence of Efficiency
dependent on RNA accessibility Cas9's helicase activity may allow
recognition of RNA structure and structure. structured RNA
sequences.
[0378] Effective ways to enhance rather than decrease gene
expression have been elusive. In alternative embodiments, by fusing
Cas9 to a factor that stabilizes mature messenger RNAs,
compositions and methods provided herein enhance protein production
from particular transcripts (FIG. 2B). In alternative embodiments,
another permutation of the CRISPR-Cas system called CRISPR
interference (CRISPRi) relies upon transcription modulators fused
to a nuclease-null Cas9 (dCas9) (that can enhance or repress gene
expression by binding to particular genomic loci (Gilbert L A,
Larson M H, Morsut L, Liu Z, et al. 2013. CRISPR-mediated modular
RNA-guided regulation of transcription in eukaryotes. Cell 154:
442-51; Qi L S, Larson M H, Gilbert L A, Doudna J A, et al. 2013.
Repurposing CRISPR as an RNA-guided platform for sequence-specific
control of gene expression. Cell 152: 1173-83). While capable of
strongly influencing gene expression, this approach does not allow
isolation of the effects of RNA and protein gene products. By
fusing Cas9 to translation enhancing factors, RCas9 may allow
enhancement of protein expression of specific genes without
altering RNA abundance in order to measure the specific importance
of the protein gene product.
[0379] Another means by which cells control gene product activity
is through the localization of RNA. In neurons, cell somata can be
separated from synapses by centimeters or more, which presents a
challenge to accumulating synaptic proteins at sufficient
concentrations. After export from the nucleus, mRNAs involved in
synaptic structure and activity such as postsynaptic density
protein 95 (PSD-95) (Muddashetty R S, Nalavadi V C, Gross C, Yao X,
et al. 2011. Reversible inhibition of PSD-95 mRNA translation by
miR-125a, FMRP phosphorylation, and mGluR signaling. Mol Cell 42:
673-88) are transported through dendrites where they are translated
near their site of action (FIG. 2C). By fusing Cas9 to a transport
factor, the RCas9 system could be used to force transport to a
chosen region of the cell such as pre- or postsynaptic terminals.
In the case of regeneration of neuronal processes after injury,
there is some evidence that localization of RNAs that encode
cytoskeletal components are critical to regrowth of axons
(Shestakova E A, Singer R H, Condeelis J. 2001. The physiological
significance of beta-actin mRNA localization in determining cell
polarity and directional motility. Proc Natl Acad Sci USA 98:
7045-50; Donnelly C J, Willis D E, Xu M, Tep C, et al. 2011.
Limited availability of ZBP1 restricts axonal mRNA localization and
nerve regeneration capacity. EMBO J 30: 4665-77). The ability to
manipulate RNA localization in this context could be an important
part of a regenerative therapy.
[0380] In alternative embodiments, exemplary RCas9 is used to alter
the composition of RNAs. Pre-mRNA splicing is a vital step in mRNA
biogenesis and tethering of splicing factors to the pre-mRNA has
been shown to alter the inclusion or exclusion of sequences
(Graveley B R, Maniatis T. 1998. Arginine/serine-rich domains of SR
proteins can function as activators of pre-mRNA splicing. Mol Cell
1: 765-71). For instance, the splicing factor RBFOX2 has been shown
to influence inclusion of exons depending on whether it binds up or
downstream of alternative exons (Lovci M T, Ghanem D, Marr H,
Arnold J, et al. 2013. Rbfox proteins regulate alternative mRNA
splicing through evolutionarily conserved RNA bridges. Nat Struct
Mol Biol 20: 1434-42; Weyn-Vanhentenryck S M, Mele A, Yan Q, Sun S,
et al. 2014. HITS-CLIP and integrative modeling define the Rbfox
splicing-regulatory network linked to brain development and autism.
Cell Rep 6: 1139-52; Yeo G W, Coufal N G, Liang T Y, Peng G E, et
al. 2009. An RNA code for the FOX2 splicing regulator revealed by
mapping RNA-protein interactions in stem cells. Nat Struct Mol Biol
16: 130-7). In alternative embodiments, by carefully choosing
splicing factors and fusing them to exemplary Cas9, it may be
possible to create designer splicing factors whose influence on
splice site choice can be determined by RCas9 sequence binding. For
instance, spinal muscular atrophy is caused by deletion of the gene
SMN1 resulting in neuron death, but there is evidence that forced
alteration of SMN2 splicing in SMN1-deficient cells can produce a
SMN2 isoform that reconstitutes the activity of SMN1 (Hua Y,
Vickers T A, Okunola H L, Bennett C F, et al. 2008. Antisense
masking of an hnRNP A1/A2 intronic splicing silencer corrects SMN2
splicing in transgenic mice. Am J Hum Genet 82: 834-48). In
alternative embodiments, this type of targeted splicing alteration
is used in compositions and methods as provided herein to reverse a
variety of diseases caused by aberrant splicing (Nissim-Rafinia M,
Kerem B. 2002. Splicing regulation as a potential genetic modifier.
Trends Genet 18: 123-7).
[0381] These are just a few examples of exemplary RCas9's as
provided herein to modulate cellular RNA composition and cell
behavior. In alternative embodiments, as universal nucleic
acid-recognitions proteins, Cas proteins as provided herein allow
targeting of particular RNAs to genomic loci. For instance, long
non-coding RNAs (lncRNAs) can recognize particular genomic loci and
guide associated chromatin-modifying factors to dramatic effect on
genomic organization (Geisler S, Coller J. 2013. RNA in unexpected
places: long non-coding RNA functions in diverse cellular contexts.
Nat Rev Mol Cell Biol 14: 699-712). In alternative embodiments,
exemplary RCas9 is fused to another Cas protein that utilizes an
orthogonal sgRNA could be used to alter genome organization in a
similar manner. By bringing targeted RNA in close proximity to a
genomic locus of choice, this DNA- and RNA-binding Cas fusion can
support studies of the function of lncRNAs in any genomic context.
In alternative embodiments, the use of multiple Cas proteins with
orthogonal sgRNAs also allows simultaneous and distinct alteration
of multiple RNAs for instance by utilizing both nuclease-null and
active Cas proteins. In alternative embodiments, However, it is
currently unclear whether other Cas proteins are capable of RNA
recognition, so it remains to be seen if RCas9 can target multiple
RNAs simultaneously (Esvelt K M, Mali P, Braff J L, Moosburner M,
et al. 2013. Orthogonal Cas9 proteins for RNA-guided gene
regulation and editing. Nat Methods 10: 1116-21).
Imaging Applications
[0382] Several RNA recognition tools developed recently have
enabled imaging of specific RNA species in live cells but suffer
from several shortcomings (see (Rath A K, Rentmeister A. 2014.
Genetically encoded tools for RNA imaging in living cells. Curr
Opin Biotechnol 31C: 42-9) for an excellent review). In a manner
analogous to visualizing proteins through fusion with fluorescent
proteins, a set of RNA-based systems that rely on sequence tags
incorporated in the RNA of interest can allow RNA visualization.
These tags are specifically recognized by a protein moiety that
binds strongly and specifically to the RNA tag. One popular
approach utilizes bacteriophage MS2 coat protein (MCP) fused to a
fluorescent protein (Bertrand E, Chartrand P, Schaefer M, Shenoy S
M, et al. 1998. Localization of ASH1 mRNA particles in living
yeast. Mol Cell 2: 437-45) recognizing a short RNA structural motif
(a so-called `hairpin`). The low signal-to-noise ratio due to
background fluorescence from unbound probe can be improved by
incorporating long arrays of tandemly repeated recognition
elements, an approach that has allowed effective imaging of highly
abundant RNAs in live cells (Park H Y, Lim H, Yoon Y J, Follenzi A,
et al. 2014. Visualization of dynamics of single endogenous mRNA
labeled in live mouse. Science 343: 422-4), but there is concern
that such large tags can significantly perturb typical RNA
behavior. An alternative approach is the incorporation of
artificial RNA sequence tags that are bound by an exogenous small
molecule fluorophore (Paige J S, Wu K Y, Jaffrey S R. 2011. RNA
mimics of green fluorescent protein. Science 333: 642-6; Strack R
L, Disney M D, Jaffrey S R. 2013. A superfolding Spinach2 reveals
the dynamic nature of trinucleotide repeat-containing RNA. Nat
Methods 10: 1219-24). By immobilizing the fluorophore in this
aptamer tag, fluorescence signal can be generated by increasing
quantum yield, separating a fluorophore-quencher pair, or by FRET
(Paige J S, Wu K Y, Jaffrey S R. 2011. RNA mimics of green
fluorescent protein. Science 333: 642-6; Strack R L, Disney M D,
Jaffrey S R. 2013. A superfolding Spinach2 reveals the dynamic
nature of trinucleotide repeat-containing RNA. Nat Methods 10:
1219-24; Sunbul M, Jaschke A. 2013. Contact-mediated quenching for
RNA imaging in bacteria with a fluorophore-binding aptamer. Angew
Chem Int Ed Engl 52: 13401-4; Shin I, Ray J, Gupta V, Ilgu M, et
al. 2014. Live-cell imaging of Pol II promoter activity to monitor
gene expression with RNA IMAGEtag reporters. Nucleic Acids Res 42:
e90). A third approach to suppress background fluorescence is the
expression of two polypeptides that reconstitute a functional
fluorescent protein when recruited to an RNA target by taking
advantage of natural or artificial RNA binding domains (Rackham O,
Brown C M. 2004. Visualization of RNA-protein interactions in
living cells: FMRP and IMP1 interact on mRNAs. EMBO J 23: 3346-55).
While all three methods have been tremendously useful and are
widely used to study dynamics of RNA transport and localization,
they require a tagged version of the RNA of interest either through
genetic modification of the endogenous locus or by forced
expression of an exogenous tagged version of the RNA. To
illustrate, cells derived from a knock-in mouse harboring 24 MS2
hairpins in the 3'-untranslated region (UTR) of the beta-actin gene
allowed the real time visualization of transcription from the
modified allele, including the observation of transcriptional
bursting upon serum stimulation (Lionnet T, Czaplinski K, Darzacq
X, Shav-Tal Y, et al. 2011. A transgenic mouse for in vivo
detection of endogenous labeled mRNA. Nature Methods 8: 165-70).
However, the MCP-GFP fusion proteins need to be delivered to cells
exogenously and this system is limited to only highly expressed
RNAs. Furthermore, incomplete occupation of the MS2 hairpins
reduces local signal and generates significant background noise due
to unbound probe (Fusco D, Accornero N, Lavoie B, Shenoy S M, et
al. 2003. Single mRNA molecules demonstrate probabilistic movement
in living mammalian cells. Curr Biol: 13: 161-7). Another
technology, molecular beacons, allows imaging of unmodified
transcripts but suffer from high noise and cumbersome delivery
(Tyagi S, Kramer F R. 1996. Molecular beacons: Probes that
fluoresce upon hybridization. Nat Biotechnol 14: 303-8). RCas9 may
circumvent these issues by allowing direct recognition of untagged
RNAs with high specificity and low noise.
[0383] Exemplary alternative RCas9 applications as provided herein
allow visualization of the abundance and/or localization of one or
more endogenous RNAs simultaneously. By fusing an exemplary
nuclease-null Cas9 to a fluorescent protein, it could be possible
to visualize the localization of particular RNAs or RNA splice
variants. In alternative embodiments, a pair of exemplary Cas9
proteins is fused to halves of split fluorescent protein such as
Venus (Ozawa T, Natori Y, Sato M, Umezawa Y. 2007. Imaging dynamics
of endogenous mitochondrial RNA in single living cells. Nat Methods
4: 413-9) and targeted to adjacent sites on an RNA (FIG. 2E). This
will allow visualization of RNA localization with lower background
than an intact fluorescent protein or measurement of the RNA
content of individual cells. In alternative embodiments, this split
protein approach is used to target adjacent exons in a
differentially spliced transcript, allowing identification and
isolation of individual cells that express particular RNA splice
isoforms. In alternative embodiments, the identification of
exemplary Cas proteins with orthogonal sgRNAs could allow targeting
of multiple transcripts for localization or abundance measurements
simultaneously, allowing multiplexed, live-cell measurement of RNA
dynamics of individual cells.
[0384] In alternative embodiments, provided are applications of
compositions and methods for endogenous RNA localization and
abundance measurements in live cells. For example, characterization
of somatic stem cells remains difficult because few surface markers
exist for cell sorting-based identification and purification of
these rare cells. Gene expression profiling remains the most
effective way to identify rare cell types and in alternative
embodiments, exemplary RCas9 as provided herein enables this type
of nondestructive measurement so that rare cells can be preserved,
expanded, and studied in isolation.
[0385] In alternative embodiments, provided are compositions and
methods for RNA localization, which is important in cellular
response to injury, stress, and some behaviors that promote cell
polarity such as extension of neuronal processes. Stress granules
are a type of RNA and protein cluster that sequester mRNA and
protein and typically form in response to oxidative stress, heat,
viral infection, or hypoxia (Kedersha N, Anderson P. 2007.
Mammalian stress granules and processing bodies. Methods Enzymol
431: 61-81). Aberrant formation of RNA granules is implicated in
many diseases, but the RNA components of these structures are only
beginning to be described. In alternative embodiments, compositions
and methods provided herein can image endogenous RNA trafficking to
stress granules and support investigation of stress granule roles
in health and disease. In order to understand the importance of RNA
granules in disease, exemplary RCas9 can be used for time-resolved
measurements of granule formation in response to stress, disease,
or in drug screens where RNA localization may play a role in
disease progression or regeneration of damaged tissues.
Synthetic Biology Applications
[0386] Provided herein are methods and compositions having
industrial, clinical, and other technological utility. Like all
engineering-oriented disciplines, provided herein are modularized,
flexible platforms that can be tuned for diverse applications. The
highly modular and programmable nature of exemplary RCas9 systems
as provided herein can be used as a platform technology in
synthetic biology. For example, in alternative embodiments, split
enzymes are fused to Cas9 proteins whose activity is reconstituted
upon binding to a target RNA such as complementation of split
death-inducing proteins after detection of a cancer-linked RNA
(FIG. 2G). In alternative embodiments, pathways involving
successive protein/protein interactions are re-engineered by using
RNA to scaffold interactions among exemplary Cas9 fusion proteins
as provided herein. In alternative embodiments, scaffold proteins
as provided herein can bind kinases and their substrates to
strongly influence the output of a signaling pathway, and exemplary
RCas9 polypeptides are used in the scaffolding of protein/protein
interactions to control signaling in a gene expression-dependent
manner. Another group used tethering of enzymes involved in the
production of the drug precursor mevalonate, thereby increasing
production of this small molecule (Dueber J E, Wu G C,
Malmirchegini G R, Moon T S, et al. 2009. Synthetic protein
scaffolds provide modular control over metabolic flux. Nat
Biotechnol 27: 753-9). In principle, strong co-binding of exemplary
Cas9 fusion proteins on a target RNA provides a new level of
control over successive protein interactions or shuttling of
metabolites.
Conclusions, General Concerns and Alternative Approaches
[0387] Progress in RNA targeting methods from their beginnings,
when RBP domains were adapted to serve as sequence specificity
determinants, to RCas9, with its target recognition by simple
nucleic acid hybridization, is poised to closely parallel the
development of DNA targeting technology. Here, zinc finger and TAL
effector nucleases have recently given way to DNA recognition by
the Cas9-bound sgRNA. While for DNA targeting applications, Cas9
and its sgRNA are sufficiently stable and nontoxic in mammalian
cells, it remains to be seen whether all three components of the
RCas9 system (Cas9, sgRNA, and PAMmer) can be delivered efficiently
and, if so, successfully cooperate to bind target RNA. Alternative
approaches to RNA-programmed RNA recognition are on the horizon.
Type III-B CRISPR-Cas systems are known to target and cleave RNA as
part of their normal activities in bacterial immunity. The effector
complexes of these CRISPR systems from Thermus thermophilus (Staals
R H, Zhu Y, Taylor D W, Kornfeld J E, et al. 2014. RNA Targeting by
the Type III-A CRISPR-Cas Csm Complex of Thermus thermophilus. Mol
Cell 56: 518-30) and Pyrococcus furiosus (Yeo G W, Coufal N G,
Liang T Y, Peng G E, et al. 2009. An RNA code for the FOX2 splicing
regulator revealed by mapping RNA-protein interactions in stem
cells. Nat Struct Mol Biol 16: 130-7) have been characterized in
detail and their nucleolytic activities reconstituted in vitro.
While the natural ability of these complexes to recognize RNA is
appealing, each complex is composed of 1-4 copies of six different
proteins, which could pose challenges for its reconstitution in
vivo. Cas9 from Francisella novicida targets a particular
endogenous RNA in this organism in a RNA-guided manner, although
the flexibility of this system to target chosen RNAs remains
unclear (Sampson T R, Saroj S D, Llewellyn A C, Tzeng Y L, et al.
2013. A CRISPR/Cas system mediates bacterial innate immune evasion
and virulence. Nature 497: 254-7).
[0388] In alternative embodiments, exemplary RCas9 polypeptides
recognize untagged, endogenous RNA via simple base-pairing, and
this represents a major advance in RNA targeting and is
particularly critical in diagnostic or therapeutic applications. In
alternative embodiments, exemplary RCas9 polypeptides and systems
as provided herein are delivered efficiently to cells, cooperate to
recognize RNA, with minimal unwanted destabilization or alteration
of target RNA while also avoiding targeting of genomic DNA and
off-target transcripts, and thereby provide new applications of
RCas9 in basic and applied biology and in medicine.
[0389] Data provided herein demonstrates that exemplary RCas9
polypeptides and systems as provided herein are effective for
nucleic acid-programmed recognition and tracking of untagged mRNA
localization in living cells by CRISPR/Cas9.
SUMMARY
[0390] In alternative embodiments, provided herein are RCas9
polypeptides and systems for RNA-programmed genome editing using
CRISPR/Cas9 from Streptococcus pyogenes has enabled rapid and
accessible alteration of genomic loci in a variety of organisms. In
alternative embodiments, provided herein are flexible means to
target RNA to allow alteration and imaging of endogenous RNA
transcripts analogous to CRISPR/Cas-based genomic tools, but most
RNA tracking methods rely on incorporation of exogenous tags. Here
we demonstrate that exemplary nuclease-inactive S. pyogenes
CRISPR/Cas9 can bind RNA in a nucleic acid-programmed manner and
allow endogenous RNA tracking in living cells. We show that
nuclear-localized RNA-targeting Cas9 (RCas9) is exported to the
cytoplasm only in the presence of sgRNAs targeting mRNAs with
distributions that correlate well with fluorescence in situ
hybridization imaging. We also demonstrate time-resolved
measurements of .beta.-actin mRNA trafficking to stress granules.
Our results establish the exemplary RCas9 as provided herein can be
used to bind and track RNA in living cells in a programmable manner
without the requirement of genetically encoded tags.
Introduction
[0391] Clustered Regularly-Interspaced Palindromic Repeats
(CRISPRs) form the basis of adaptive immune systems in bacteria and
archaea by encoding CRISPR RNAs that guide CRISPR-associated (Cas)
nucleases to invading genetic material (Wiedenheft, B., Sternberg,
S. H., and Doudna, J. A. (2012). RNA-guided genetic silencing
systems in bacteria and archaea. Nature 482, 331-338). Cas9 from
the type II CRISPR system of S. pyogenes has been repurposed for
genome engineering in eukaryotic organisms (Hwang, W. Y., Fu, Y.,
Reyon, D., Maeder, M. L., Tsai, S. Q., Sander, J. D., Peterson, R.
T., Yeh, J. R., and Joung, J. K. (2013). Efficient genome editing
in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31, 227-229;
Li, D., Qiu, Z., Shao, Y., Chen, Y., Guan, Y., Liu, M., Li, Y.,
Gao, N., Wang, L., Lu, X., et al. (2013a). Heritable gene targeting
in the mouse and rat using a CRISPR-Cas system. Nat Biotechnol 31,
681-683; Nakayama, T., Fish, M. B., Fisher, M., Oomen-Hajagos, J.,
Thomsen, G. H., and Grainger, R. M. (2013). Simple and efficient
CRISPR/Cas9-mediated targeted mutagenesis in Xenopus tropicalis.
Genesis 51, 835-843; Sander, J. D., and Joung, J. K. (2014).
CRISPR-Cas systems for editing, regulating and targeting genomes.
Nat Biotechnol 32, 347-355; Yang, D., Xu, J., Zhu, T., Fan, J.,
Lai, L., Zhang, J., and Chen, Y. E. (2014). Effective gene
targeting in rabbits using RNA-guided Cas9 nucleases. J Mol Cell
Biol 6, 97-99) and is rapidly proving to be an efficient means of
DNA targeting for other applications such as gene expression
modulation (Qi, L. S., Larson, M. H., Gilbert, L. A., Doudna, J.
A., Weissman, J. S., Arkin, A. P., and Lim, W. A. (2013).
Repurposing CRISPR as an RNA-guided platform for sequence-specific
control of gene expression. Cell 152, 1173-1183) and imaging (Chen,
B., Gilbert, L. A., Cimini, B. A., Schnitzbauer, J., Zhang, W., Li,
G. W., Park, J., Blackburn, E. H., Weissman, J. S., Qi, L. S., et
al. (2013). Dynamic imaging of genomic loci in living human cells
by an optimized CRISPR/Cas system. Cell 155, 1479-1491). Cas9 and
its associated single guide RNA (sgRNA) require two critical
features to target DNA: a short DNA sequence of the form 5'-NGG-3'
(where `N`=any nucleotide) known as the protospacer adjacent motif
(PAM) and an adjacent sequence on the opposite DNA strand that is
antisense to the sgRNA. By supporting DNA recognition with
specificity determined entirely by a short spacer sequence within
the sgRNA, CRISPR/Cas9 provides uniquely flexible and accessible
manipulation of the genome. Manipulating cellular RNA content, in
contrast, remains problematic. While there exist robust means of
attenuating gene expression via RNA interference and antisense
oligonucleotides, other critical aspects of post-transcriptional
gene expression regulation such as alternative splicing,
subcellular trafficking, and spatiotemporally-restricted
translation are largely intractable.
[0392] Analogous to the assembly of zinc finger nucleases (Urnov,
F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., and Gregory, P.
D. (2010). Genome editing with engineered zinc finger nucleases.
Nat Rev Genet 11, 636-646) and transcription activator-like
effector nucleases (TALEN) to recognize specific DNA sequences,
efforts to recognize specific RNA sequences have focused on
engineering RNA binding domains. For instance, the Pumilio and FBF
homology (PUF) proteins carry well-defined modules capable of
recognizing a single base each. However each module must be
redesigned and validated for each RNA target and at most can only
recognize 8 contiguous bases, which limits their utility for
recognizing RNA substrates uniquely in the transcriptome. An
alternative approach to recruiting proteins to specific RNA
substrates is to introduce RNA aptamers into target RNAs, enabling
specific and strong association of cognate aptamer binding proteins
such as the MS2 coat protein (Fouts, D. E., True, H. L., and
Celander, D. W. (1997). Functional recognition of fragmented
operator sites by R17/MS2 coat protein, a translational repressor.
Nucleic Acids Res 25, 4464-4473). This approach has enabled
tracking RNA localization in living cells over time with high
sensitivity (Buxbaum, A. R., Wu, B., and Singer, R. H. (2014).
Single beta-actin mRNA detection in neurons reveals a mechanism for
regulating its translatability. Science 343, 419-422) but relies
upon laborious genetic manipulation of the target RNA in cells and
is not suitable for recognition of arbitrary RNA sequences.
Analogous to CRISPR/Cas9-based recognition of DNA, programmable RNA
recognition based on nucleic acid specificity alone without the
need for genetic manipulation or libraries of RNA binding proteins
would greatly expand researchers' ability to modify the mammalian
transcriptome and enable transcriptome engineering.
[0393] Although the CRISPR/Cas9 system has evolved to recognize
double-stranded DNA, recent in vitro work has demonstrated that
programmable targeting of RNAs with Cas9 is possible by providing
the PAM as part of an exogenously added oligonucleotide (PAMmer)
that hybridizes to the target RNA (O'Connell, M. R., Oakes, B. L.,
Sternberg, S. H., East-Seletsky, A., Kaplan, M., and Doudna, J. A.
(2014). Programmable RNA recognition and cleavage by CRISPR/Cas9.
Nature 516, 263-266). By taking advantage of the Cas9 target search
mechanism that relies on PAM sequences (Sternberg, S. H., Redding,
S., Jinek, M., Greene, E. C., and Doudna, J. A. (2014). DNA
interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature
507, 62-67), a mismatched PAM sequence in the PAMmer/RNA hybrid
allows exclusive targeting of RNA and not the encoding DNA. The
high affinity and specificity of RNA recognition by Cas9 in
cell-free extracts and the success of genome targeting with Cas9
indicate the potential of CRISPR/Cas9 to support programmable RNA
targeting in living cells.
[0394] To assess the potential of CRISPR/Cas9 to act as a
programmable RNA binding protein in living cells, we measured the
degree of nuclear export of a nuclear localization signal-tagged
nuclease-deficient Cas9-GFP fusion. We demonstrate that the sgRNA
alone is sufficient to promote nuclear export of the Cas9 fusion
without influencing the abundance of the targeted mRNA or abundance
of protein encoded by the targeted mRNA. In order to evaluate
whether RNA-targeted Cas9 (RCas9) signal patterns correspond with
an established untagged RNA labeling method, we compared
distributions of RCas9 and fluorescence in situ hybridization
(FISH) targeting .beta.-actin mRNA. We observed high correlation
among FISH and RCas9 colocalization that was dependent on the
presence of a PAMmer, indicating the importance of the PAM for
efficient RNA targeting. In contrast to established untagged RNA
localization measurements such as FISH, RCas9 supports
temporally-resolved measurements of RNA localization. We
demonstrate this capability by tracking .beta.-actin localization
to oxidative stress-induced RNA/protein accumulations called stress
granules. This work establishes the ability of RCas9 to bind RNA in
living cells and sets the foundation for manipulation of the
transcriptome in addition to the genome by CRISPR/Cas9.
EXAMPLES
Example 1
[0395] RNA-Targeted Cas9 Export from Nucleus in Presence of sgRNA
Targeting GAPDH mRNA
[0396] As an initial assessment of the ability of RCas9 to
recognize specific mRNA substrates in human cells, we tested if
enhanced GFP (EGFP)-tagged Cas9 containing a nuclear localization
signal can be co-exported from the nucleus with an mRNA in the
presence of a cognate sgRNA and PAMmer designed to recognize that
mRNA (FIG. 3A). Nuclease-null Cas9 (dCas9) was sandwiched between a
SV40 nuclear localization signal sequence at the N-terminus and two
at the C-terminus and was fused with the coding sequence for EGFP
and cloned into a mammalian expression vector
(NLS-dCas9-2xNLS-EGFP, abbreviated as dCas9-GFP). In a separate
expression vector, a modified sgRNA scaffold with an extended
stem-loop structure that improves association with Cas9 and
mutations that eliminate a partial transcription termination
sequence (Chen, B., Gilbert, L. A., Cimini, B. A., Schnitzbauer,
J., Zhang, W., Li, G. W., Park, J., Blackburn, E. H., Weissman, J.
S., Qi, L. S., et al. (2013). Dynamic imaging of genomic loci in
living human cells by an optimized CRISPR/Cas system. Cell 155,
1479-1491) was driven by the U6 snRNA polymerase III promoter. The
PAMmer was synthesized as a mixed DNA and 2'-O-methyl (2'OMe) RNA
oligonucleotide using standard phosphoramidite chemistry and
purified using HPLC (see Tables 3-4 for target, sgRNA and PAMmer
sequences). As a proof-of-concept, we designed an sgRNA-PAMmer pair
to target the 3' untranslated region (3'UTR) of GAPDH mRNA (FIG.
3B). As a negative control, we designed an sgRNA-PAMmer pair
targeting the .lamda. bacteriophage that is absent in human cells
("N/A" sgRNA and PAMmer). We observed that transiently transfected
dCas9-GFP co-transfected with the negative control sgRNA and PAMmer
is almost exclusively nuclear, with 3% of cells containing GFP
signal in the cytoplasm (FIGS. 3B and 3C). When the negative
control PAMmer is replaced with the GAPDH-targeting PAMmer, the
results are identical. However, upon co-transfection of
GAPDH-targeting sgRNA plasmid, we demonstrated that 24% and 17% of
cells have GFP signal in the cytoplasm with and without a
GAPDH-targeting PAMmer, respectively (FIGS. 3B and 3C). In both
cases, the sgRNA targeting GAPDH result in a significant increase
in the fraction of cells with cytoplasmic GFP signal compared to a
non-targeting sgRNA. We also observed a loss of nuclear export with
as few as 4 bases mismatched in the sgRNA seed sequence (See FIG.
6). Overall, these results are consistent with previous in vitro
RNA pull-down experiments that demonstrate RNA binding by
Cas9:sgRNA that is independent of but strengthened by the PAMmer
(O'Connell et al., 2014). Thus, we demonstrate that RCas9 can be
relocalized into the cytoplasm by programming the sgRNA-PAMmer to
recognize a specific abundant mRNA in live cells.
TABLE-US-00003 TABLE 3 RNA target sequences PAMmer target
underlined, Target sgRNA target bold GAPDH mRNA
CACAAGAGGAAGAGAGAGACCCTCACTGCTGG GGAGTCC 3'UTR (SEQ ID NO: 5)
.beta.-actin mRNA GAAGGTGACAGCAGTCGGTTGGAGCGAGCATC CCCCAAA 3'UTR
(SEQ ID NO: 6) .lamda.2 bacteriophage
GCTCAATTTTGACAGCGGTCATGGCATTCCAC TTATCAC (SEQ ID NO: 7)
TABLE-US-00004 TABLE 4 PAMmer (PAM in bold) and sgRNA (spacer in
bold) sequence PAMmer, .beta.-actin 3'UTR
mUCmGCmUCmCAmUGGmGAmCTmGCmUGmUCmACmCTmUC (SEQ ID NO: 8) sgRNA,
.beta.-actin 3'UTR GTTTGGGGGATGCTCGCTCCAGTTTAAGAGCTATGCTGGAAACAGCAT
AGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCAC CGAGTCGGTGCTTTTTTT
(SEQ ID NO: 9) PAMmer, GAPDH 3'UTR
mAGmUGmAGmGGmCGGmCTmCTmCTmUCmCTmCTmUGmUG (SEQ ID NO: 10) sgRNA,
GAPDH 3'UTR GGACTCCCCAGCAGTGAGGGGTTTAAGAGCTATGCTGGAAACAGCATA
GCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC GAGTCGGTGCTTTTTTT
(SEQ ID NO: 11) PAMmer, .lamda.2 bacteriophage
mATmGCmCAmUGmUGGmGCmUGmUCmAAmAAmUTmGAmGC (SEQ ID NO: 12) sgRNA,
.lamda.2 bacteriophage
GTGATAAGTGGAATGCCATGGTTTAAGAGCTATGCTGGAAACAGCATA
GCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC GAGTCGGTGCTTTTTTT
(SEQ ID NO: 13)
Example 2
[0397] Recognition of an mRNA with RNA-Targeted Cas9 does not Alter
RNA Translation or Stability
[0398] To further characterize the interaction between RCas9 and a
target mRNA, we directed RCas9 to the 3' untranslated region (UTR)
of Renilla luciferase carrying a commonly-used RNA tag for RNA
tracking from the MS2 bacteriophage (Fouts, D. E., True, H. L., and
Celander, D. W. (1997). Functional recognition of fragmented
operator sites by R17/MS2 coat protein, a translational repressor.
Nucleic Acids Res 25, 4464-4473) and a sequence targeted by a
previously validated sgRNA:PAMmer pair (O'Connell, M. R., Oakes, B.
L., Sternberg, S. H., East-Seletsky, A., Kaplan, M., and Doudna, J.
A. (2014). Programmable RNA recognition and cleavage by
CRISPR/Cas9. Nature 516, 263-266) (FIG. 3D). RNA
immunoprecipitation with an antibody recognizing EGFP revealed a
four-fold greater association of luciferase mRNA to dCas9-EGFP in
the presence of a cognate sgRNA and PAMmer, compared to
non-targeting sgRNA or scrambled PAMmer or to EGFP protein alone
(FIG. 3E). We next measured the effect of RCas9 targeting on
luciferase mRNA abundance by quantitative RT-PCR. We observed no
significant difference in the abundance of MS2-tagged luciferase
mRNA in the presence of the targeting or non-targeting RCas9 system
or EGFP alone. In contrast, co-expression of EGFP fused to the MS2
coat protein (MCP) recognizing the MS2 aptamer had a significant
stabilizing effect which could be due to inhibition of RNA
degradation by the MS2 system (Garcia, J. F., and Parker, R.
(2015). MS2 coat proteins bound to yeast mRNAs block 5' to 3'
degradation and trap mRNA decay products: implications for the
localization of mRNAs by MS2-MCP system. RNA 21, 1393-1395) (FIG.
3F). We also considered potential effects of RCas9 targeting on
translation (FIG. 3G) and observed that presence of the targeting
sgRNA and PAMmer caused no significant changes in protein levels
compared to non-targeting RCas9. Our results demonstrate that RCas9
recognition of RNA with an sgRNA and PAMmer avoids perturbation of
RNA and protein levels associated with targeting via MCP-tagged
GFP.
Example 3
[0399] RNA-Targeted Cas9 Signal Distributions Correlate with an
Established Untagged RNA Localization Determination Method
[0400] To assess whether RCas9 signal distributions correlate with
an orthogonal method to measure RNA localization, we targeted the
3'UTR of .beta.-actin ("+" sgRNA and "+" PAMmer) and compared
dCas9-2xNLS-mCherry signal to RNA fluorescence in situ
hybridization (FISH) for .beta.-actin mRNA (FIG. 4A) and
non-targeting sgRNA and PAMmer ("-" sgRNA and "-" PAMmer with
sequences corresponding to .lamda. bacteriophage). By comparing the
Mander's overlap coefficients that describe pixel-by-pixel overlap
among FISH and RCas9 (Manders, E. M., Stap, J., Brakenhoff, G. J.,
van Driel, R., and Aten, J. A. (1992). Dynamics of
three-dimensional replication patterns during the S-phase, analysed
by double labelling of DNA and confocal microscopy. J Cell Sci 103
(Pt 3), 857-862) (FIG. 4B), we determined that the sgRNA primarily
accounts for co-localization among FISH and RCas9 with maximal
overlap in the presence of both sgRNA and PAMmer targeting
.beta.-actin mRNA. A non-targeting PAMmer results in a
significantly less overlap (FIG. 4B) (p=0.035, Mann-Whitney Test)
and produces a diffuse pattern of RCas9 signal in the cytoplasm
that contrasts with the highly localized pattern revealed by FISH
(FIG. 4A). This result is consistent with weaker binding of RCas9
with a non-targeting PAMmer observed in cell-free systems
(O'Connell, M. R., Oakes, B. L., Sternberg, S. H., East-Seletsky,
A., Kaplan, M., and Doudna, J. A. (2014). Programmable RNA
recognition and cleavage by CRISPR/Cas9. Nature 516, 263-266). A
non-targeting sgRNA results in largely nuclear retention of RCas9
signal with low correlation between cytoplasmic RCas9 signal and
FISH (FIG. 4A-B). We conclude that maximal overlap between FISH and
RCas9 signal distributions requires the presence of both cognate
sgRNA and PAMmer.
Example 4
Tracking RNA Trafficking to Stress Granules Over Time
[0401] In addition to promoting local translation, trafficking of
mRNA can also influence temporal programming of protein production
(Buchan, J. R., and Parker, R. (2009). Eukaryotic stress granules:
the ins and outs of translation. Mol Cell 36, 932-941). We
therefore determined whether RCas9 supports tracking of mRNA to
protein-RNA aggregates known as stress granules. Stress granules
are translationally-silent protein and RNA accumulations that can
form aberrantly and may influence disease progression in the
nervous system (Li, Y. R., King, O. D., Shorter, J., and Gitler, A.
D. (2013b). Stress granules as crucibles of ALS pathogenesis. J
Cell Biol 201, 361-372) but there are limited means that can track
the movement of endogenous RNA to these structures in live cells
(Bertrand, E., Chartrand, P., Schaefer, M., Shenoy, S. M., Singer,
R. H., and Long, R. M. (1998). Localization of ASH1 mRNA particles
in living yeast. Mol Cell 2, 437-445). As .beta.-actin mRNA is
known to localize to stress granules (Unsworth, H., Raguz, S.,
Edwards, H. J., Higgins, C. F., and Yague, E. (2010). mRNA escape
from stress granule sequestration is dictated by localization to
the endoplasmic reticulum. FASEB J 24, 3370-3380) during oxidative
stress, we simultaneously tracked .beta.-actin mRNA using RCas9 and
mCherry-fused to the Ras GTPase-activating protein-binding protein
1 (G3BP1) protein, a well-described marker for stress granules
(Tourriere, H., Chebli, K., Zekri, L., Courselaud, B., Blanchard,
J. M., Bertrand, E., and Tazi, J. (2003). The RasGAP-associated
endoribonuclease G3BP assembles stress granules. J Cell Biol 160,
823-831). After application of sodium arsenite to induce cellular
stress, we observed accumulation of RCas9 signal to G3BP1-positive
foci only in the presence of the RCas9 system targeting
.beta.-actin mRNA and not in the presence of non-targeting sgRNA
and PAMmer (FIG. 5A). We quantified the degree of overlap among
RCas9- and G3BP1-foci and determined that the majority of stress
granules feature overlapping RCas9-foci (FIG. 5B). Next we tracked
RCas9 signal in stressed cells over time in living cells (FIG. 5C).
We observed accumulation of RCas9 signal in G3BP1-positive foci in
a manner dependent on the presence of sgRNA and PAMmer targeting
.beta.-actin mRNA (FIG. 5C). We also observed that the rate and
degree of RCas9 signal accumulation in stress granules is dependent
on dosage of the stressor sodium arsenite (FIG. 5D). These results
indicate the potential of RCas9 as a means to generate
time-resolved, quantitative RNA localization measurements.
Discussion
[0402] This work demonstrates, to our knowledge, the first
proof-of-principle that RCas9 can be utilized in living cells to
bind target RNAs such as mRNAs with specificity determined entirely
by simply-programmed sgRNA and PAMmers. In alternative embodiments,
provided are RCas9 polypeptides and systems (complexes) that
support the recognition of RNA sequences that are long enough for
unique discrimination in the transcriptome which contrasts with
engineered RNA-binding proteins such as PUF proteins (Cheong, C.
G., and Hall, T. M. (2006). Engineering RNA sequence specificity of
Pumilio repeats. Proc Natl Acad Sci USA 103, 13635-13639; Wang, X.,
McLachlan, J., Zamore, P. D., and Hall, T. M. (2002). Modular
recognition of RNA by a human pumilio-homology domain. Cell 110,
501-512) that suffer from short RNA recognition sequences and
require protein design, assembly and validation for each RNA
target. Other CRISPR/Cas systems have demonstrated RNA binding in
bacteria (Hale, C. R., Zhao, P., Olson, S., Duff, M. O., Graveley,
B. R., Wells, L., Terns, R. M., and Terns, M. P. (2009). RNA-guided
RNA cleavage by a CRISPR RNA-Cas protein complex. Cell 139,
945-956; Sampson, T. R., Saroj, S. D., Llewellyn, A. C., Tzeng, Y.
L., and Weiss, D. S. (2013). A CRISPR/Cas system mediates bacterial
innate immune evasion and virulence. Nature 497, 254-257) or
eukaryotes (Price, A. A., Sampson, T. R., Ratner, H. K., Grakoui,
A., and Weiss, D. S. (2015). Cas9-mediated targeting of viral RNA
in eukaryotic cells. Proc Natl Acad Sci USA 112, 6164-6169),
although these systems cannot discriminate RNA from DNA targets,
feature RNA targeting rules that remain unclear, or rely on large
protein complexes that may be difficult to reconstitute in
mammalian cells. Further work varying the sgRNA spacer length (Fu,
Y., Sander, J. D., Reyon, D., Cascio, V. M., and Joung, J. K.
(2014). Improving CRISPR-Cas nuclease specificity using truncated
guide RNAs. Nat Biotechnol 32, 279-284) and PAMmer length and
chemical modifications will be required to determine the optimal
RCas9 parameters.
[0403] In some embodiments, the nucleoprotein complexes provided
herein does not include a PAMmer oligonucleotide. The RCas9 system
described in "Methods and compositions for modifying a single
stranded target nucleic acid" (WO 2015089277 A1) as utilize a
PAMmer oligonucleotide. Using a unique nucleoprotein complex
comprising an RCas9 polypeptide and a single guide RNA, but not to
including a PAMmer oligonucleotide, to target RNA, we have
demonstrated that this system recognizes and alters target RNA in
the absence of a PAMmer. Despite the absence of a PAMmer, our
results for this system indicate (1) highly efficient alteration of
targeted RNAs, and (2) RNA recognition in living eukaryotic cells
The fully encodable nature of this 2-component system enables the
deployment of our system in a therapeutic context using viral
vectors, nanoparticles, or other excipients that support delivery
of DNA. Because PAMmer cannot be encoded in DNA due to chemical
modifications that are required to stabilize and protect it from
cellular enzymatic activities, earlier systems requiring a PAMmer
were not fully encodable.
[0404] Alternative applications of exemplary RCas9 as provided
herein measure or alter RNA splicing via targeting of split
fluorescent proteins or splicing factors adjacent to alternatively
spliced exons. In alternative embodiments, the nucleic
acid-programmable nature of exemplary RCas9 as provided herein
allows for multiplexed targeting (Cong, L., Ran, F. A., Cox, D.,
Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W.,
Marraffini, L. A., et al. (2013). Multiplex genome engineering
using CRISPR/Cas systems. Science 339, 819-823) of RNA and the use
of Cas9 proteins that bind orthogonal sgRNAs (Esvelt, K. M., Mali,
P., Braff, J. L., Moosburner, M., Yaung, S. J., and Church, G. M.
(2013). Orthogonal Cas9 proteins for RNA-guided gene regulation and
editing. Nat Methods 10, 1116-1121), which can support distinct
activities on multiple target RNAs simultaneously. In alternative
embodiments, RNA targeting afforded by exemplary RCas9 as provided
herein supports the development of sensors that recognize specific
healthy or disease-related gene expression patterns and reprogram
cell behavior via alteration of gene expression or concatenation of
enzymes on a target RNA (Delebecque, C. J., Lindner, A. B., Silver,
P. A., and Aldaye, F. A. (2011). Organization of intracellular
reactions with rationally designed RNA assemblies. Science 333,
470-474; Sachdeva, G., Garg, A., Godding, D., Way, J. C., and
Silver, P. A. (2014). In vivo co-localization of enzymes on RNA
scaffolds increases metabolic production in a geometrically
dependent manner. Nucleic Acids Res 42, 9493-9503). Efforts towards
In alternative embodiments, Cas9 is delivered in vivo are underway
(Dow, L. E., Fisher, J., O'Rourke, K. P., Muley, A., Kastenhuber,
E. R., Livshits, G., Tschaharganeh, D. F., Socci, N. D., and Lowe,
S. W. (2015). Inducible in vivo genome editing with CRISPR-Cas9.
Nat Biotechnol 33, 390-394; Swiech, L., Heidenreich, M., Banerjee,
A., Habib, N., Li, Y., Trombetta, J., Sur, M., and Zhang, F.
(2015). In alternative embodiments, exemplary RCas9 as provided
herein can be sued for in vivo interrogation of gene function in
the mammalian brain using CRISPR-Cas9. Nat Biotechnol 33, 102-106;
Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen,
J. L., Hu, J. H., Maeder, M. L., Joung, J. K., Chen, Z. Y., and
Liu, D. R. (2015). In alternative embodiments, provided are
cationic lipid-mediated delivery of exemplary RCas9 as provided
herein to enable efficient protein-based genome editing in vitro
and in vivo. Nat Biotechnol 33, 73-80), and these efforts combined
with existing oligonucleotide chemistries (Bennett, C. F., and
Swayze, E. E. (2010). RNA targeting therapeutics: molecular
mechanisms of antisense oligonucleotides as a therapeutic platform.
Annu Rev Pharmacol Toxicol 50, 259-293) could support in vivo
delivery of the RCas9 systems as provided herein for targeted
modulation of many features of RNA processing in living
organisms.
Experimental Procedures
Plasmid Construction, PAMmer Synthesis, and Target Site Choice
[0405] The dCas9-2xNLS sequence was amplified from
pHR-SFFV-dCas9-BFP-KRAB (a gift from Stanley Qi & Jonathan
Weissman, Addgene plasmid #46911), tagged with a SV40 nuclear
localization signal (NLS) on the N-terminus, and fused to EGFP or
mCherry in pcDNA 3.1 (Invitrogen, Carlsbad Calif.) using Gibson
assembly. A version lacking NLS on the N-terminus was also
constructed. To construct the sgRNA scaffold construct, the human
U6 polymerase III promoter with the modified sgRNA scaffold (Chen
et al., 2013) was purchased as a gBlock from IDT with a BbsI
restriction site at the 5' end of the sgRNA scaffold (see sequence
in FIG. 6) and cloned into the multiple cloning site of pBlueScript
II SK (+) (Agilent, Santa Clara, Calif.) using Gibson assembly.
Phosphorylated oligonucleotides encoding the sgRNA sequences were
ligated into BbsI-digested sgRNA scaffold construct to produce
sgRNAs targeting the 3'UTR of GAPDH, .beta.-actin, and renilla
luciferase mRNAs (see FIG. 6). The luciferase-PEST construct for
pull-down and abundance experiments was modified from plasmid xyz
(gift from Jens Lykke-Anderson, UCSD). pCMV-Renilla luciferase is a
version of the same construct lacking MS2 and RCas9 target
sites.
[0406] RCas9 target sites were chosen with a combination of the IDT
antisense oligonucleotide design tool and the microarray probe
design tools Picky (Chou et al., 2004) and OligoWiz (Wernersson and
Nielsen, 2005). We designed PAMmers against high-confidence sites
with 8 bases on the 5' end beyond the PAM sequence. PAMmers were
composed of mixed 2'OMe RNA and DNA bases and purified by HPLC
(Integrated DNA Technologies, Coralville Iowa).
Cell Lines
[0407] U2OS and HEK293T cells were grown in Dulbecco's modified
eagle medium (DMEM) supplemented with 10% fetal bovine serum,
glutamax, and non-essential amino acids (Invitrogen). Cells were
passaged every 3-4 days with TrypLE EXPRESS (Invitrogen) using
standard methods and maintained in a humidified incubator at
37.degree. C. with 5% CO.sub.2.
GAPDH and .beta.-Actin mRNA Targeting with RCas9
[0408] U2OS cells cultured as described above were passaged at
.about.80% confluency. Glass-bottom 96-well plates or chamber
slides were coated with 20 .mu.g/mL fibronectin in PBS for 2 h at
37.degree. C., then the fibronectin solution was aspirated and
20,000 cells were plated in each well. 16 hours later, cells were
transfected with the sgRNA and dCas9-2xNLS-EGFP plasmids using
Lipofectamine 3000 (Invitrogen) according to the manufacturer's
instructions. pCMV-Renilla luciferase was co-transfected in these
experiments so that total transfected protein load was the same
among various dosages of sgRNA and dCas9. The weight ratio of sgRNA
and dCas9-EGFP (carrying a N-terminal NLS) plasmids ranged from 5:1
to 2.5:1, respectively, where the amount of dCas9-EGFP was fixed at
10% of total transfected material. Immediately after plasmid
transfection, PAMmers were transfected using Lipofectamine RNAiMax
(Invitrogen) according to manufacturer's instructions. 24 hours
after transfection, cells were washed with PBS and fixed with 3.7%
paraformaldehyde in PBS, permeabilized with 70% ethanol at
4.degree. C. for one hour, and mounted using Prolong Gold Antifade
mounting medium with DAPI (Invitrogen). Confocal microscopy was
conducted using an Olympus FV1000 confocal microscope.
[0409] Nuclear export of RCas9 in the presence of sgRNA and PAMmer
targeting the 3'UTR of GAPDH was analyzed by measuring the average
signal in the nuclei and cytoplasm of individual cells. Cells with
average cytoplasmic signal greater than 10% of the average nuclear
signal were considered to have a cytoplasmic signal.
RNA Immunoprecipitation
[0410] HEK293T cells cultured as described above were passaged at
80% confluency and 600,000 cells were seeded in each well of 6-well
tissue culture plates coated with poly-L-lysine. 16 hours later,
cells were co-transfected with the RCas9 system as described above
(dCas9-GFP with 2.times. internal NLS tags), or plasmids encoding
MS2-EGFP or EGFP along with a plasmid encoding the model Renilla
luciferase mRNA driven by a CMV promoter. 30 hours later, the
growth media was aspirated and the cells were washed with PBS. 1%
paraformaldehyde in PBS was applied to the cells, incubated for 10
minutes at room temperature, then the solution was aspirated and
the cells washed twice with cold PBS. Next, the cells were scraped
from the wells in cold PBS and the cell suspension was centrifuged
at 800.times.g for 4 minutes to pellet the cells. The cells were
washed once more, then resuspended in RIPA buffer with protease
inhibitor (Roche) and sonicated for 5 minutes in a BIORUPTOR.TM.
sonicator (50% duty cycle, 1 minute period). Insoluble material was
pelleted after a high-speed centrifugation and the supernatant was
applied to protein G DYNABEADS.TM. (Invitrogen) coated with mouse
anti-GFP antibody (Roche). After overnight incubation at 4.degree.
C., the bead supernatant was retained and beads washed 3 times with
RIPA buffer containing 0.02% Tween-20 and once with DNase buffer
(350 mM Tris-HCl, pH 6.5; 50 mM MgCl.sub.2; 5 mM DTT). The beads
were resuspended in DNase buffer and TURBO.TM. DNase (Invitrogen)
was added to 0.08 units/.mu.L. The beads were incubated at
37.degree. C. for 30 minutes, then proteinase K (NEB) was added to
0.1 U/.mu.L and incubated with shaking at 37.degree. C. for 30
minutes. Next, urea was added to 2.5 M and the beads were incubated
with shaking at 37.degree. C. for 30 minutes. The bead supernatant
was collected and subjected to a two sequential
phenol:chloroform:isoamyl alcohol (25:24:1) extractions followed by
three chloroform extractions. The RNA was precipitated and reverse
transcribed using SuperScript III.TM. (Invitrogen) using random
hexamer primers, and relative abundance of Renilla luciferase RNA
on the beads was compared to the supernatant using qPCR (see Table
5 for primer sequences).
TABLE-US-00005 TABLE 5 qPCR primer sequences GAPDH forward primer
AAGGTGAAGGTCGGAGTCAAC (SEQ ID NO: 14) GAPDH reverse primer
GGGGTCATTGATGGCAACAATA (SEQ ID NO: 15) Renilla luciferase
GTAACGCTGCCTCCAGCTAC forward primer (SEQ ID NO: 16) Renilla
luciferase GTGGCCCACAAAGATGATTT reverse primer (SEQ ID NO: 17)
Measurements of Influence of RCas9 on RNA Stability and
Translation
[0411] HEK293T cells were cultured as described above, passaged and
plated in 96- or 12-well tissue culture plates, and were
co-transfected 24 h later with the RCas9 system (dCas9-GFP with
2.times. internal NLS tags) and the Renilla luciferase construct
carrying MS2 and RCas9 binding sites in the 3'UTR. In the protein
abundance measurements, a small amount of CMV-driven firefly
luciferase vector (5% of total transfected plasmid) was
co-transfected as a transfection control. For RNA stability
measurements, RNA was isolated 24 h after transfection, DNase
treated, reverse transcribed with Superscript III (Invitrogen)
using dT(20) primers according the manufacturer's instructions. The
amount of Renilla luciferase cDNA relative to GAPDH was then
measured using qPCR. For the translation studies, Renilla and
firefly luciferase protein were measured with the Dual Luciferase
Kit (Promega) according to the manufacturer's instructions.
Fluorescence In Situ Hybridization for .beta.-Actin mRNA
[0412] Stellaris FISH Probes recognizing human .beta.-actin mRNA
and labeled with Quasar 670.TM. (VSMF-2003-5, Biosearch
Technologies, Inc., Petaluma, Calif.) were hybridized to cells 24
hours after transfection with the RCas9 system targeting
.beta.-actin mRNA. Hybridization was conducted according to the
manufacturer's instructions. Confocal microscopy was conducted
using an Olympus FV1000.TM. confocal microscope.
Overlap Analysis for Fluorescence In Situ Hybridization and
RCas9
[0413] Colocalization analysis among FISH and RCas9 (dCas9-GFP with
2.times. internal NLS tags) targeting .beta.-actin mRNA was
conducted using the Coloc 2 plugin from the image analysis software
FIJI.TM. (Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig,
V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld,
S., Schmid, B., et al. (2012). Fiji: an open-source platform for
biological-image analysis. Nat Methods 9, 676-682). The cytoplasm
of individual cells with similar dCas9-EGFP transfection levels was
selected and the Coloc 2 analysis was conducted using default
parameters. The Mander's overlap coefficient describing degree of
overlap of the FISH signal with RCas9 for more than 60 cells in
each condition was compiled and p-values were calculated with the
two-tailed Mann-Whitney U test.
Tracking .beta.-Actin mRNA Trafficking to Stress Granules
[0414] A HEK293T cell line was genetically modified with a fusion
of mCherry to the C-terminus of Ras GTPase-activating
protein-binding protein 1 (G3BP1) using CRISPR/Cas9. Briefly, a
donor plasmid was constructed consisting of the mCherry ORF, a
puromycin selection cassette, and flanking 1.5 kb homology arms
directed at the G3BP1 locus. An sgRNA sequence targeting the
C-terminus of G3BP1 was cloned into pSpCas9(BB)-2A-GFP (pX458)
(gift from Feng Zhang, Addgene plasmid #48138) and co-transfected
with the donor plasmid using Fugene HD (Roche) following the
manufacturer's instructions. 48 hours after transfection, cells
were selected with 1 .mu.g/mL puromycin in growth medium for 14
days and mCherry-positive clones were selected and screened by
PCR.
[0415] A clone with at least one modified allele was plated on
glass chamber slides coated with fibronectin and transfected with
the RCas9 system targeting the 3'UTR of .beta.-actin mRNA as
described above. 24 hours after transfection, cells were imaged
with a Zeiss LSM 810.TM. confocal microscope with a stage incubator
and sodium arsenite was applied to cells at concentrations ranging
from 50 to 200 .mu.M. Cells were maintained at 37.degree. C. in a
humidified atmosphere and 5% CO.sub.2 and imaged at regular
intervals.
Analysis of .beta.-Actin mRNA Trafficking to Stress Granules
[0416] The average signal intensity in the RCas9 channel in areas
with overlapping G3BP1-mCherry foci was recorded for each time
point. Average signal intensity in the RCas9 channel surrounding
G3BP1-mCherry foci was recorded as background and subtracted from
the previous value to produce the background-adjusted RCas9 signal
in stress granules.
Example 5
Tracking and Manipulating RNA Repeats Using RCas9 Plasmid
Construction, PAMmer Synthesis, and Transfections
[0417] The dCas9-2xNLS sequence was amplified from
pHR-SFFV-dCas9-BFP-KRAB (a gift from Stanley Qi & Jonathan
Weissman, Addgene plasmid #46911), tagged with two SV40 nuclear
localization signals (NLS) on the C-terminus, and fused to EGFP or
mCherry in pCDNA 3.1 (Invitrogen, Carlsbad Calif.) using Gibson
assembly. To construct the sgRNA scaffold construct, the human U6
polymerase III promoter with the modified sgRNA scaffold (Chen et
al., 2013) was purchased as a gBlock from IDT with two BbsI
restriction sites at the 5' end of the sgRNA scaffold (see table 1)
and cloned into the multiple cloning site of pBlueScript II SK
(+).TM. (Agilent, Santa Clara, Calif.) using Gibson assembly.
Phosphorylated oligonucleotides encoding the sgRNA sequences (with
overhangs 5'CACC on the RNA antisense strand and 5'AAAC on the
sense strand) were ligated into BbsI-digested sgRNA scaffold
construct to produce sgRNAs targeting specific transcripts (see
table 1). The SMA minigene construct was a gift from the Adrian
Krainer lab. DM1 related 120 CTG repeats were present downstream of
the CMV promoter in pCDNA 3.1 plasmid backbone for expression in
mammalian cell lines. pCDNA3.1 PIN-XTEN-dCas9-2XNLS was constructed
via amplification of the PIN domain from human cDNA from the SMG6
gene. The XTEN linker is a flexible linker used to isolate adjacent
proteins domains. pCDNA 3.1 FOX2-dCas9-2xNLS was constructed via
amplification of FOX2 from the Open Biosystem Human ORFeome.TM. and
assembled with dCas9-2XNLS using Gibson assembly.
[0418] In all experiments, Lipofectamine 3000 (Life Technologies,
Carlsbad, Calif.) was used according to the manufacturer's
direction. For 100 ng total transfected plasmid in a 96 w format, 5
ng of Cas9 plasmid and 25 ng sgRNA plasmid were transfected. In the
imaging experiments, the GFP-tagged version of Cas9 was used with
20 ng of CAG or GGGGCC (SEQ ID NO: 19) repeat plasmid. In the
cleavage experiments, the PIN-tagged version of Cas9 with used with
the same amount of repeat plasmid. In the RNA splicing experiments,
varied amounts of pCDNA 3.1 FOX2-dCas9-2xNLS were transfected
ranging from 0 to 25 ng per well in 96 w format. FIGS. 7B-C, F-G
was generated from experiments conducted in COS-7 cells and FIG.
D-E was conducted in HEK293T cells.
[0419] For the MBNL1 redistribution experiment (FIG. 7F) either
pcDNA 3.1 MBNL1-EGFP alone, or pcDNA 3.1 MBNL1-EGFP, pCDNA 3.1
CTG.sup.105 and RCas9-PIN, or pcDNA 3.1 MBNL1-EGFP, pCDNA 3.1
CTG.sup.105, sgRNA and RCas9-PIN were transfected in CosM6 cells
using Lipofectamine 3000 using manufacturer's protocol. Cells were
washed with PBS, fixed with 4% PFA for 10 minutes, and
permeabilized with cold 70% ethanol overnight at 4.degree. C. Cells
were rehydrated with 2.times.SSC with 40% formamide for 15 minutes.
The cells were subjected to RNA FISH using CAG10-Cy3 probe as
described previously. The EGFP and Cy3 fluorescence were visualized
using a Zeiss fluorescence microscope at 20.times. and 60.times.
magnifications.
[0420] PAMmers were composed of mixed 2' OMe RNA and DNA bases and
purified by HPLC (Integrated DNA Technologies, Coralville
Iowa).
Cell Lines
[0421] HEK293T and COS-7 cells were grown in Dulbecco's modified
eagle medium (DMEM) supplemented with 10% fetal bovine serum,
glutamax, penicillin/streptomycin and non-essential amino acids
(Invitrogen). Cells were passaged every 3-4 days with TrypLE
EXPRESS (Invitrogen) using standard methods and maintained in a
humidified incubator at 37.degree. C. with 5% CO.sub.2.
RT-PCR
[0422] For the SMN2 minigene splicing experiments, RNA was
extracted using Qiagen RNAeasy.TM. columns, subjected to DNAse
treatment, reverse transcription (Superscript III.TM., Life
Technologies), and PCR (Phusion polymerase, Life Technologies)
according to manufacturer's directions. The PCR products were run
on agarose gels and imaged using Sybr Safe gel stain (Life
Technologies) with a UV imager.
RNA Fish
[0423] Media was removed from the cell culture slides and cells
were washed gently with PBS (pH7.4). Cells were fixed with 4% PFA
at room temperature for 10 minutes and subsequently washed at RT
with PBS 5 times 3 min each. Slides were incubated in pre-chilled
70% ethanol overnight at 4.degree. C. Ethanol was decanted and
slides were rehydrated slides in 40% formamide in 2.times.SSC for
10 minutes at RT (20 ml deionized formamide, 5 ml 20.times.SSC, 25
ml ultrapure/DEPC water). While incubation is going lyophilized DNA
probe (CAG10-cy3 (SEQ ID NO: 23) or GGGGCC-cy3 (SEQ ID NO: 19)) was
reconstituted in water to the concentration of 500 ng/ul. Required
volume of probe was pipetted into a PCR tube, heated at 99 C for 10
minutes and immediately cooled on ice for 10 minutes. Incubate
cells for prehyb with the required volume of prehyb buffer (see
recipe) at 37.degree. C. for 15 mins in a humidified chamber or an
incubator. The probe was added to the hybridization buffer (see
recipe below). Cells were hybridized with DNA probe made in prehyb
buffer (Hyb buffer=prehyb buffer+probe) at 37.degree. C. for 2
hours in a humidified chamber or an incubator. Cells were washed
3.times. with 40% formamide/2.times. SSC at 37-37.degree. C. for 30
min each. Wash sections with PBS at RT for 5 mins and then mounted
them with mounting medium VECTASHIELD.TM. with DAPI (vector labs
H-1200).
Northern Dot Blot
[0424] MATERIALS: Bio-Rad Bio-Dot.TM. Apparatus (1706545),
HYBOND+nylon membrane (GE HealthCare), Whatman paper,
[0425] SOLUTIONS 10 mM EDTA, 20.times. SSC (Lonza 51205), 10.times.
SSC (diluted with RNase Free water from 20.times. SSC), 37%
Formaldehyde, dH2O
[0426] RNA was extracted using Tri reagent (Sigma Aldrich) as per
manufacturer's protocol. 5 ug of RNA was used per lane. RNA can be
stored at -80 C for 6 months until needed.
[0427] For sample preparation, 5 ug (for each sample) of RNA
resuspended in RNase Free water was diluted to 50 ul with RNase
Free water. 30 ul 20.times. SSC, and 20 ul of 37% formaldehyde were
added to each sample. The samples were incubated at 60 C for 30
minutes and then kept on ice until needed.
[0428] The Bio-Rad Bio-Dot.TM. Apparatus (1706545) was assembled as
per manufacturer's protocol, washed with ethanol by passing ethanol
through the wells and dried. The apparatus was then disassembled.
The Hybond+.TM. nylon membrane and 3 pieces of whatman paper were
cut to the size of the Bio-Dot. The Hybond+ membrane was soaked in
RNase Free water for 5 minutes and then transferred to 10.times.
SSC buffer for 5 minutes. The Bio-Dot apparatus was then
reassembled as following: From the top down>Hybond+nylon
membrane, 3.times. Whatman.TM. papers, Gasket, Gasket support
plate, vacuum manifold were assembled and the apparatus was screwed
tight and connected to a lab vacuum assembly. The vacuum was turned
and a quiet seal was taken as the sign of a good seal. The wells to
be used were hydrated and tested by passing 200 ul of 10.times. SSC
twice while the vacuum is on. The sample was then applied for 5
minutes with vacuum off, and then the vacuum was turned on. After
the samples were passed through the membrane by the vacuum, the
wells were washed with 200 ul of 10.times. SCC twice. The vacuum
was turned off, the Bio-Dot assembly was disassembled and the
membrane was crosslinked in the UV STRATALINKER.TM. using the
"Auto-Crosslink" setting which is equivalent to 1200 mJ with sample
side up. At this point, the membrane can be dried and stored at RT
for up to a month.
[0429] For probing, the membrane was hydrated with 10.times. SSC,
and the washed with 1.times. SSC (diluted from 20.times. SSC with
RNase Free water). The membrane was pre-hybridized with 10 ml
Express-Hyb.TM. hybridization solution (Clonetech 636831)
containing 500 ul of 1 mg/ml yeast tRNA (Thermo Fisher
Scientific15401-029) in a borosilicate hybridization tube (Thermo
Scientific ELED-110113) in a hybridization oven (Thermo Scientific
6240TS) for 2 hours at 50 C.
[0430] During Pre-hybridization step, the CAG 10 (CAG CAG CAG CAG
CAG CAG CAG CAG CAG CAG) (SEQ ID NO: 23) DNA probe was end-labeled
with gamma-P32 ATP (Perkin Elmer BLU502Z) using T4 PNK in the
following reaction: [0431] 20 ul 500 ng/ul CAG10 probe [0432] 10 ul
10.times.PNK buffer (NEB) [0433] 5 ul T4-PNK (NEB) [0434] 5 ul
gamma-P32 ATP (Perkin Elemer) [0435] 60 ul Water
[0436] The reaction was incubated at 37 C for 30 minutes. The probe
was cleaned using the GE Lifesciences G-50 columns (28-9034-08) as
per manufacturer's protocol. The probe was boiled at 100 C for 5
minutes and then kept on ice until use. The probe was directly
added to the Pre-hybridization buffer (after 2 hours of
pre-hybridization) and the hybridization was carried out at 45 C
overnight (12-16 hours). After hybridization, the express-hyb
buffer was decanted and the membrane was taken out into a small
glass square baking dish/reservoir and washed with 1.times. SSC
containing 0.1% SDS for 10 minutes at room temperature. 3 more
washes were done with 0.5.times. SSC containing 0.1% SDS for 10
minutes each at room temperature. The membrane was then blotted
with KimWipes.TM. (KimTech) and wrapped in a Saran wrap. The
membrane was exposed to autoradiography film (Thermo Fisher
Scientific) in an autoradiography cassette (GE Healthcare) with an
intensifying screen (GE Healthcare) at -80 C for 4 hours.
TABLE-US-00006 TABLE 6 PAMmer (PAM sequence in bold) and sgRNA
sequences PAMmer, CAG repeat mTGmCTmGCmTGmTGGmCTmGCmTGmCTmG
CmTGmCTmGC (SEQ ID NO: 20) sgRNA, CAG repeat
GTGCTGCTGCTGCTGCTGCTGGUUUAAGAG CAUUGCUGGAAACAGCAUAGCAAGUUUAAA
UAAGGCUAGUCCGUUAUCAACUUGAAAAAG UGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO:
21) U6 promoter- TGTACAAAAAAGCAGGCTTTAAAGGAACCA 2xBbsi-sgRNA
ATTCAGTCGACTGGATCCGGTACCAAGGTC scaffold
GGGCAGGAAGAGGGCCTATTTCCCATGATT CCTTCATATTTGCATATACGATACAAGGCT
GTTAGAGAGATAATTAGAATTAATTTGACT GTAAACACAAAGATATTAGTACAAAATACG
TGACGTAGAAAGTAATAATTTCTTGGGTAG TTTGCAGTTTTAAAATTATGTTTTAAAATG
GACTATCATATGCTTACCGTAACTTGAAAG TATTTCGATTTCTTGGCTTTATATATCTTG
TGGAAAGGACGAAACACCGGGTCTTCGAGA AGACCTGTTTAAGAGCTATGCTGGAAACAG
CATAGCAAGTTTAAATAAGGCTAGTCCGTT ATCAACTTGAAAAAGTGGCACCGAGTCGGT
GCTTTTTTT (SEQ ID NO: 22)
Buffers Recipes:
[0437] 20.times. Standard Sodium Citrate (SSC) Buffer:
TABLE-US-00007 Component Recipe 3 M sodium chloride 175.3 g (FW
58.44) 300 mM sodium citrate 88.2 g (FW 294.1) d2H2O up to 1 L (pH
to 7.0 with HCl and bring to final volume with d2H2O)
Formamide/SSC Buffer:
TABLE-US-00008 [0438] Component Recipe 40% formamide 20 mL (OmniPur
deionized formamide, EMD Cat. # 4650) 2X SSC 5 mL of 20X SSC d2H2O
25 mL
Prehybridization Buffer:
TABLE-US-00009 [0439] Component Recipe 40% formamide 400 .mu.L
(OmniPur deionized formamide, EMD Cat. # 4650) 2X SSC buffer 100
.mu.L of 20X SSC 200 .mu.g/mL BSA 20 .mu.L of 10 mg/mL BSA 10%
dextran sulfate 100 mg (Sigma, Cat. # D8906-10G) 2 mM vanadyl
sulfate 10 .mu.L of 200 mM vanadyl (Aldrich 20,486-2) sulfate 1
mg/mL yeast tRNA 100 .mu.L of 10 mg/mL yeast (Invitrogen Cat. #
15401-029) tRNA d2H2O Up to 1 mL (usually 320 .mu.L)
[0440] Vortex vigorously until dextran sulfate has dissolved.
Solution will be viscous. Alternatively. 200 mM vanadyl adenosine
complex can be used instead of vanadyl sulfate. Vanadyl complex is
an RNase inhibitor that can cither be made or purchased from NEB
(Cat.#S1402S). Alternatively. RNAsin can be used.
Hybridization Buffer:
TABLE-US-00010 [0441] Component Recipe 40% formamide 400 .mu.L
(OmniPur deionized formamide, EMD Cat. # 4650) 2X SSC Buffer 100
.mu.L of 20X SSC 200 .mu.g/mL BSA 20 .mu.L of 10 mg/mL BSA 10%
dextran sulfate 100 mg (Sigma, Cat. # D8906-10G) 2 mM vanadyl
sulfate 10 .mu.L of 200 mM vanadyl (Aldrich 20,486-2) sulfate 1
mg/mL yeast tRNA 100 .mu.L of 10 mg/mL yeast (Invitrogen Cat. #
15401-029) tRNA 500 pg/.mu.L probe 1 .mu.L of 500 ng/uL probe d2H2O
Up to 1 mL (usually 319 .mu.L)
[0442] Prepare initially without probe. Vortex vigorously until
dextran sulfate has dissolved. Solution will be viscous. Add
denatured probe to pre-chilled buffer.
Example 6
[0443] Using an RNA-Targeting Cas9 System for Targeted Destruction
of Disease-Causing RNAs in Humans and/or Animal Models
[0444] An RNA-targeting Cas9 system is used to treat a human
patient suffering from a disease caused by an RNA microsatellite
repeat expansion (such as microsatellite repeat expansion RNAs that
cause myotonic dystrophy, C9orf72-linked ALS. and Huntington's
disease). In alternative embodiments, the RNA-targeting Cas9
system, or nucleoprotein complex as provided herein, comprises two
components: 1) a nuclease-inactive Cas9-polypeptide. optionally
fused to an effector polypeptide and/or detectable moiety, and 2) a
single guide RNA (sgRNA) targeting the repeat-containing
sequence.
[0445] The effector polypeptide can be, but is not limited to, one
of the following proteins: an RNA cleaving domain (endonuclease)
such as a PIN domain-containing protein; a fluorescent protein; or
an RNA splicing domain (splicing factor) such as RBFOX2
domain-containing protein or a protein known to influence RNA
splicing.
[0446] The single guide RNA can be, but is not limited to, one of
the following: an sgRNA targeting the CTG repeat-containing RNA
that causes myotonic dystrophy; an sgRNA targeting the GGGGCC
repeal-containing RNA that causes C9orf72-linked ALS; an sgRNA
targeting the CAG repeat-containing RNA that causes Huntington's
disease; or an sgRNA targeting the other diseases caused by
repeat-containing RNA (microsatellite repeat expansion diseases
such as Fragile X syndrome, spinocerebellar ataxias. Fragile
X-associated tremor/ataxia syndrome, Spinal-bulbar muscular
dystrophy, Oculopharyngeal muscular dystrophy, and others).
[0447] In alternative embodiments, the RNA-targeting Cas9 system is
encoded in DNA carried by a vector, e.g., an adenovirus or an
adeno-associated virus (AAV), and can be delivered to appropriate
tissues via one of the following methods: use of specific AAV
serotypes that display specific tissue tropism (such as AAV-9
targeting neurons or muscle); injection of naked DNA encoding the
RCas9 system into tissue such as muscle or liver, use of
nanoparticles composed of lipids, polymers, or other synthetic or
natural materials that carry DNA or RNA encoding the therapeutic
RCas9 system; or any of the above where the RCas9 system is split
between two separate viruses or DNA molecules so that: one virus
encodes the Cas9 protein and the other virus encodes the sgRNA; or
one virus encodes a portion of the Cas9 protein while the other
virus encodes the another portion of the Cas9 protein and the
sgRNA. In embodiments in which the portions of Cas9 are encoded on
separate vectors, the encoded portions of Cas9 can interact with
one another so as to form a functional Cas9 protein. For example,
in some embodiments, the portions of Cas9 are engineered to
complement via protein splicing or complementation to generate a
functional Cas9 protein (see Wright el al., Rational design of a
split-Cas9 enzyme complex. PNAS 112:2984-2989 (2015), the content
of which is hereby incorporated by reference in its entirety).
[0448] In alternative embodiments, to use exemplary RNA-targeting
Cas9 systems as provided herein in treatment of a human subject or
animal, the vector, e.g., the AVV, encoding the RNA-targeting Cas9
system can, for example, be injected by the following methods:
[0449] 1. Skeletal muscle tissue (intramuscular) at multiple sites
simultaneously (relevant indication: myotonic dystrophy)--injection
of 10.sup.11-10.sup.14 GC (genome copies) per injection into major
muscle group such as the abdominal muscles, biceps, deltoids,
erector spinae, gastrocnemius, soleus, gluteus, hamstrings,
latissimus dorsi, rhomboids, obliques, pectoralis, quadriceps,
trapezius and/or biceps;
[0450] 2. Intravenous delivery of a muscle-targeted AAV serotype
such as AAV-9 or AAV-6 or a novel muscle-targeted serotype
(relevant indication: myotonic dystrophy)--injection of
10.sup.11-10.sup.14 GC per injection for a total of
10.sup.11-10.sup.17 GC delivered;
[0451] 3. Subpial spinal injection of AAV-6, AAV-9 or another
serotype displaying neuronal tropism (relevant indication:
ALS)--injection of 10.sup.11-10.sup.17 GC in a single or multiple
doses;
[0452] 4. Intracranial injection of AAV-6, AAV-9 or another
serotype displaying neuronal tropism (relevant indication:
Huntington's disease, spinocerebellar ataxias. Fragile X
syndrome)--injection of 10.sup.11-10.sup.17 GC in a single or
multiple doses.
Example 7
Treating Myotonic Dystrophy in Human Subjects
[0453] In some embodiments for treating myotonic dystrophy in a
human subject, the modified RCas9 endonuclease system, the nucleic
acid, the genetic construct, or the viral vector (such as a
lentiviral or AAV vector) may be formulated by methods known in the
art. In addition, any route of administration may be envisioned. In
alternative embodiments, the RCas9 endonuclease system, the nucleic
acid, the genetic construct and the viral vector (such as a
lentiviral or AAV vector) is administered by any conventional route
of administration including, but not limited to oral, pulmonary,
intraperitoneal (ip), intravenous (iv). intramuscular (im),
subcutaneous (sc), transdermal, buccal, nasal, sublingual, ocular,
rectal and vaginal. In addition, administration directly to the
nervous system may include, and are not limited to, intracerebral,
intraventricular, intracerebroventricular, intrathecal,
intracistemal, intraspinal or peri-spinal routes of administration
by delivery via intracranial or intravertebral needles or catheters
with or without pump devices. Any dose or frequency of
administration that provides the therapeutic effect described
herein is suitable for use in the present treatment. In a
particular embodiment, the subject is administered a viral vector
encoding the RCas9 endonuclease system according to the disclosure
by the intramuscular route. In a specific variant of this
embodiment, the vector is an AAV vector as defined above, in
particular an AAV9 vector. In some embodiments, the human subject
may receive a single injection of the vector. Additionally,
standard pharmaceutical methods can be employed to control the
duration of action. These are well known in the art and include
control release preparations and can include appropriate
macromolecules, for example polymers, polyesters, polyamino acids,
polyvinyl, pyrolidone, ethylenevinylacetate, methyl cellulose,
carboxymethyl cellulose or protamine sulfate. In addition, the
pharmaceutical composition may comprise nanoparticles that contain
the RCas9 endonuclease system of the present disclosure.
Example 8
[0454] Treating Myotonic Dystrophy in Mouse Models and Measuring
the Effects of such Treatments
[0455] Mouse models which can be used include: HSALR transgenic
mice that express 250 CUG repeats in the human skeletal actin
3'UTR; GGGGCC (G4C2) transgenic mice; and various human HTT
transgenic mouse models,
[0456] The gastronemius or tibialis anterior muscles of adult mice
are injected respectively with 30 to 100 .mu.l of physiological
solution containing or not AAV vectors (AAV-6, AAV-2, or AAV-9).
For each mouse, one muscle is injected with AAV GFP-ACT3 and the
contralateral muscle is injected with control AAV containing any
transgene (MCS) or GFP or vehicle alone (PBS). Six weeks after
injections, the isometric contractile properties of the muscles are
measured as previously described. Then, the mice are killed,
muscles are collected and snap-frozen in liquid nitrogen-cooled
isopentane and stored at -80.degree. C.
[0457] At the physiological level, it has been established that
myotonia observed in the DM1 mouse model results from abnormal
splicing of muscle-specific chloride channel Clc-1 exon 7a.
Myotonia that is characterized by muscle hyperexcitability that
leads to persistent electrical discharges and delayed force
relaxation. One means to assess the efficacy of a myontic dystrophy
therapeutic is to measure splicing of Clc-1 exon 7a via RNA
sequencing or RT-PCR. Further, the effect of the therapeutic on
muscle force relaxation can be determined after induced-contraction
compared to control contralateral muscles. Reversal of myotonic
dystrophy-related electrical activity in muscles will be assessed
using electromyography in mice under general anesthesia using 30
gauge concentric needle electrode in hindlimb muscles (tibialis
anterior, gastrocnemius, and vastus muscles) and forelimb muscles
(flexor compartment of distal forelimb, triceps). At least ten
needle insertions are performed for each muscle and myotonic
discharges will be graded on a 4-point scale where 0 relates to no
myotonia, 1, occasional myotonic discharge in <50% of
insertions, 2, myotnic discharge in >50% of insertions, or 3,
myotonic discharge in nearly ail insertions.
[0458] In at least some of the previously described embodiments,
one or more elements used in an embodiment can interchangeably be
used in another embodiment unless such a replacement is not
technically feasible. It will be appreciated by those skilled in
the art that various other omissions, additions and modifications
may be made to the methods and structures described above without
departing from the scope of the claimed subject matter. All such
modifications and changes are intended to fall within the scope of
the subject matter, as defined by the appended claims.
[0459] With respect to the use of substantially any plural and/or
singular terms herein, those having skill in the art can translate
from the plural to the singular and/or from the singular to the
plural as is appropriate to the context and/or application. The
various singular/plural permutations may be expressly set forth
herein for sake of clarity.
[0460] It will be understood by those within the art that, in
general, terms used herein, and especially in the appended claims
(for example bodies of the appended claims) are generally intended
as "open" terms (for example, the term "including" should be
interpreted as "including but not limited to," the term "having"
should be interpreted as "having at least," the term "includes"
should be interpreted as "includes but is not limited to" etc.). It
will be further understood by those within the art that if a
specific number of an introduced claim recitation is intended, such
an intent will be explicitly recited in the claim, and in the
absence of such recitation no such intent is present. For example,
as an aid to understanding, the following upended claims may
contain usage of the introductory phrases "at least one" and "one
or more" to introduce claim recitations. However, the use of such
phrases should not be construed to imply that the introduction of a
claim recitation by the indefinite articles "a" or "an" limits any
particular claim containing such introduced claim recitation to
embodiments containing only one such recitation, even when the same
claim includes the introductory phrases "one or more" or "at least
one" and indefinite articles such as "a" or "an" (for example, "a"
and/or "an" should be interpreted to mean "at least one" or "one or
more"); the same holds true for the use of definite articles used
to introduce claim recitations. In addition, even if a specific
number of an introduced claim recitation is explicitly recited,
those skilled in the art will recognize that such recitation should
be interpreted to mean at least the recited number (for example,
the bare recitation of "two recitations," without other modifiers,
means at least two recitations, or two or more recitations).
Furthermore, in those instances where a convention analogous to "at
least one of A, B, and C, etc." is used, in general such a
construction is intended in the sense one having skill in the art
would understand the convention (for example, "a system having at
least one of A, B, and C" would include but not be limited to
systems that have A alone, B alone, C alone, A and B together, A
and C together, B and C together, and/or A, B, and C together,
etc.). In those instances where a convention analogous to "at least
one of A, B, or C, etc." is used, in general such a construction is
intended in the sense one having skill in the art would understand
the convention (for example, "a system having at least one of A, B,
or C" would include but not be limited to systems that have A
alone, B alone, C alone, A and B together, A and C together, B and
C together, and/or A, B, and C together, etc.). It will be further
understood by those within the art that virtually any disjunctive
word and/or phrase presenting two or more alternative terms,
whether in the description, claims, or drawings, should be
understood to contemplate the possibilities of including one of the
terms, either of the terms, or both terms. For example, the phrase
"A or B" will be understood to include the possibilities of "A" or
"B" or "A and B."
[0461] In addition, where features or aspects of the disclosure are
described in terms of Markush groups, those skilled in the art will
recognize that the disclosure is also thereby described in terms of
any individual member or subgroup of members of the Markush
group.
[0462] As will be understood by one of skill in the art, for any
and all purposes, such as in terms of providing a written
description, all ranges disclosed herein also encompass any and all
possible sub-ranges and combinations of sub-ranges thereof. Any
listed range can be easily recognized as sufficiently describing
and enabling the same range being broken down into al least equal
halves, thirds, quarters, fifths, tenths, etc. As a non-limiting
example, each range discussed herein can be readily broken down
into a lower third, middle third and upper third, etc. As will also
be understood by one skilled in the art all language such as "up
to," "at least," "greater than," "less than," and the like include
the number recited and refer to ranges which can be subsequently
broken down into sub-ranges as discussed above. Finally, as will be
understood by one skilled in the art, a range includes each
individual member. Thus, for example, a group having 1-3 articles
refers to groups having 1, 2, or 3 articles. Similarly, a group
having 1-5 articles refers to groups having 1, 2, 3, 4, or 5
articles, and so forth.
[0463] All references listed herein are expressly incorporated
herein by reference in their entireties, including the following
references:
REFERENCES
[0464] Bashor C J, Helman N C, Yan S, Lim W A. 2008. Using
engineered scaffold interactions to reshape MAP kinase pathway
signaling dynamics. Science 319: 1539-43.
[0465] Batra et al, 2014, Loss of MBNL Leads to Disruption of
Developmentally Regulated Alternative Polyadenylation in
RNA-Mediated Disease; Mol Cell. 56(2): 311-322.
[0466] Bennett, C. F., and Swayze, E. E. (2010). RNA targeting
therapeutics: molecular mechanisms of antisense oligonucleotides as
a therapeutic platform. Annu Rev Pharmacol Toxicol 50, 259-293.
[0467] Bertrand, E., Chartrand, P., Schaefer, M., Shenoy, S. M.,
Singer, R. H., and Long, R. M. (1998). Localization of ASH1 mRNA
particles in living yeast. Mol Cell 2, 437-445.
[0468] Beuth B, Pennell S, Arnvig K B, Martin S R, et al. 2005.
Structure of a Mycobacterium tuberculosis NusA-RNA complex. EMBO J
24: 3576-87.
[0469] Braddock D T, Louis J M, Baber J L, Levens D, et al. 2002.
Structure and dynamics of KH domains from FBP bound to
single-stranded DNA. Nature 415: 1051-6.
[0470] Buchan, J. R., and Parker, R. (2009). Eukaryotic stress
granules: the ins and outs of translation. Mol Cell 36,
932-941.
[0471] Buxbaum, A. R., Wu, B., and Singer, R. H. (2014). Single
beta-actin mRNA detection in neurons reveals a mechanism for
regulating its translatability. Science 343, 419-422.
[0472] Cencic R, Miura H, Malina A, Robert F, et al. 2014.
Protospacer adjacent motif (PAM)-distal sequences engage CRISPR
Cas9 DNA target cleavage. PLoS One 9: e109213.
[0473] Chen, B., Gilbert, L. A., Cimini, B. A., Schnitzbauer, J.,
Zhang, W., Li, G. W., Park, J., Blackburn, E. H., Weissman, J. S.,
Qi, L. S., Huang, B. (2013). Dynamic imaging of genomic loci in
living human cells by an optimized CRISPR/Cas system. Cell 155,
1479-1491.
[0474] Cheong, C. G., and Hall, T. M. (2006). Engineering RNA
sequence specificity of Pumilio repeats. Proc Natl Acad Sci USA
103, 13635-13639.
[0475] Cho S W, Kim S, Kim J M, Kim J S. 2013. Targeted genome
engineering in human cells with the Cas9 RNA-guided endonuclease.
Nat Biotechnol 31: 230-2.
[0476] Chou, H. H., Hsia, A. P., Mooney, D. L., and Schnable, P. S.
(2004). Picky: oligo microarray design for large genomes.
Bioinformatics 20, 2893-2902.
[0477] Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib,
N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., et al.
(2013). Multiplex genome engineering using CRISPR/Cas systems.
Science 339, 819-823.
[0478] DeJesus-Hernandez M, Mackenzie I R, Boeve B F, Boxer A L, et
al. 2011. Expanded GGGGCC hexanucleotide repeat in noncoding region
of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron 72:
245-56.
[0479] Delebecque, C. J., Lindner, A. B., Silver, P. A., and
Aldaye, F. A. (2011). Organization of intracellular reactions with
rationally designed RNA assemblies. Science 333, 470-474.
[0480] Donnelly C J, Willis D E, Xu M, Tep C, et al. 2011. Limited
availability of ZBP1 restricts axonal mRNA localization and nerve
regeneration capacity. EMBO J 30: 4665-77.
[0481] Doudna lab patent:
https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2015089277&recN-
um=2&maxRec=2924&office=&prevFilter=&sortOption=&queryString=EN_ALL
%3Anmr+AND+PA%3A%22THE+REGENTS+OF+THE+UNIVERSITY+OF+CALIFORNIA
%22&tab=PCT+Biblio
[0482] Dow, L. E., Fisher, J., O'Rourke, K. P., Muley, A.,
Kastenhuber, E. R., Livshits, G., Tschaharganeh, D. F., Socci, N.
D., and Lowe, S. W. (2015). Inducible in vivo genome editing with
CRISPR-Cas9. Nat Biotechnol 33, 390-394.
[0483] Dow L E, Fisher J, O'Rourke K P, Muley A, et al. 2015.
Inducible in vivo genome editing with CRISPR-Cas9. Nature
Biotechnol doi:10.1038/nbt.3155.
[0484] Dueber J E, Wu G C, Malmirchegini G R, Moon T S, et al.
2009. Synthetic protein scaffolds provide modular control over
metabolic flux. Nat Biotechnol 27: 753-9.
[0485] Esvelt, K. M., Mali, P., Braff, J. L., Moosburner, M.,
Yaung, S. J., and Church, G. M. (2013). Orthogonal Cas9 proteins
for RNA-guided gene regulation and editing. Nat Methods 10,
1116-1121.
[0486] Filipovska A, Razif M F, Nygard K K, Rackham O. 2011. A
universal code for RNA recognition by PUF proteins. Nat Chem Biol
7: 425-7.
[0487] Fouts, D. E., True, H. L., and Celander, D. W. (1997).
Functional recognition of fragmented operator sites by R17/MS2 coat
protein, a translational repressor. Nucleic Acids Res 25,
4464-4473.
[0488] Fu, Y., Sander, J. D., Reyon, D., Cascio, V. M., and Joung,
J. K. (2014). Improving CRISPR-Cas nuclease specificity using
truncated guide RNAs. Nat Biotechnol 32, 279-284.
[0489] Fusco D, Accornero N, Lavoie B, Shenoy S M, et al. 2003.
Single mRNA molecules demonstrate probabilistic movement in living
mammalian cells. Curr Biol: 13: 161-7.
[0490] Garcia, J. F., and Parker, R. (2015). MS2 coat proteins
bound to yeast mRNAs block 5' to 3' degradation and trap mRNA decay
products: implications for the localization of mRNAs by MS2-MCP
system. RNA 21, 1393-1395.
[0491] Geisler S, Coller J. 2013. RNA in unexpected places: long
non-coding RNA functions in diverse cellular contexts. Nat Rev Mol
Cell Biol 14: 699-712.
[0492] Gerstberger S, Hafner M, Ascano M, Tuschl T. 2014.
Evolutionary conservation and expression of human RNA-binding
proteins and their role in human genetic disease. Adv Exp Med Biol
825: 1-55.
[0493] Gilbert L A, Larson M H, Morsut L, Liu Z, et al. 2013.
CRISPR-mediated modular RNA-guided regulation of transcription in
eukaryotes. Cell 154: 442-51.
[0494] Graveley B R, Maniatis T. 1998. Arginine/serine-rich domains
of SR proteins can function as activators of pre-mRNA splicing. Mol
Cell 1: 765-71.
[0495] Hale, C. R., Zhao, P., Olson, S., Duff, M. O., Graveley, B.
R., Wells, L., Terns, R. M., and Terns, M. P. (2009). RNA-guided
RNA cleavage by a CRISPR RNA-Cas protein complex. Cell 139,
945-956.
[0496] Halo et al "NanoFlares for the detection, isolation, and
culture of live tumor cells from human blood" PNAS doi:
10.1073/pnas.1418637111.
[0497] Hendel, A., Bak, R. O., Clark, J. T., Kennedy, A. B., Ryan,
D. E., Roy, S., Steinfeld, I., Lunstad, B. D., Kaiser, R. J.,
Wilkens, A. B., Bacchetta, R., Tsalenko, A., Dellinger, D., Bruhn,
L., Porteus, M. H. (2015). Chemically modified guide RNAs enhance
CRISPR-Cas genome editing in human primary cells. Nature
Biotechnology 33, 985-989.
[0498] Ho et al, 2005, Colocalization of muscleblind with RNA foci
is separable from mis-regulation of alternative splicing in
myotonic dystrophy. J Cell Sci. 118(13): 2923-2933.
[0499] Hua Y, Vickers T A, Okunola H L, Bennett C F, et al. 2008.
Antisense masking of an hnRNP A1/A2 intronic splicing silencer
corrects SMN2 splicing in transgenic mice. Am J Hum Genet 82:
834-48.
[0500] Hua Y, Sahashi K, Hung G, Rigo F, et al. 2010. Antisense
correction of SMN2 splicing in the CNS rescues necrosis in a type
III SMA mouse model. Genes Dev 24: 1634-44.
[0501] Hua et al "Peripheral SMN restoration is essential for
long-term rescue of a severe spinal muscular atrophy mouse model."
Nature. 2011 Oct. 5; 478(7367):123-6. doi: 10.1038/nature10485.
[0502] Hwang, W. Y., Fu, Y., Reyon, D., Maeder, M. L., Tsai, S. Q.,
Sander, J. D., Peterson, R. T., Yeh, J. R., and Joung, J. K.
(2013). Efficient genome editing in zebrafish using a CRISPR-Cas
system. Nat Biotechnol 31, 227-229.
[0503] Jiang F, Taylor D W, Chen J S, Kornfeld J E, Zhou K,
Thompson A J, Nogales E, Doudna J A. Structures of a CRISPR-Cas9
R-loop complex primed for DNA cleavage. Science. 2016;
351(6275):867-71.
[0504] Jinek M, East A, Cheng A, Lin S, et al. 2013. RNA-programmed
genome editing in human cells. eLife 2: e00471.
[0505] Kanadia R N, Johnstone K A, Mankodi A, Lungu C, Thornton C
A, Esson D, Timmers A M, Hauswirth W W, Swanson M S. A muscleblind
knockout model for myotonic dystrophy. Science. 2003;
302(5652):1978-80.
[0506] Kedersha N, Anderson P. 2007. Mammalian stress granules and
processing bodies. Methods Enzymol 431: 61-81.
[0507] Kuscu C, Arslan S, Singh R, Thorpe J, et al. 2014.
Genome-wide analysis reveals characteristics of off-target sites
bound by the Cas9 endonuclease. Nat Biotechnol 32: 677-83.
[0508] Laird-Offringa I A, Belasco J G. 1995. Analysis of
RNA-binding proteins by in vitro genetic selection: identification
of an amino acid residue important for locking U1A onto its RNA
target. Proc Natl Acad Sci USA 92: 11859-63.
[0509] Li, D., Qiu, Z., Shao, Y., Chen, Y., Guan, Y., Liu, M., Li,
Y., Gao, N., Wang, L., Lu, X., et al. (2013a). Heritable gene
targeting in the mouse and rat using a CRISPR-Cas system. Nat
Biotechnol 31, 681-683.
[0510] Li, Y. R., King, O. D., Shorter, J., and Gitler, A. D.
(2013b). Stress granules as crucibles of ALS pathogenesis. J Cell
Biol 201, 361-372.
[0511] Lionnet T, Czaplinski K, Darzacq X, Shav-Tal Y, et al. 2011.
A transgenic mouse for in vivo detection of endogenous labeled
mRNA. Nature Methods 8: 165-70.
[0512] Long C, Amoasii L, Mireault A A, McAnally J R, Li H,
Sanchez-Ortiz E, Bhattacharyya S, Shelton J M, Bassel-Duby R, Olson
E N. Postnatal genome editing partially restores dystrophin
expression in a mouse model of muscular dystrophy. Science. 2016;
351(6271):400-3.
[0513] Lovci M T, Ghanem D, Marr H, Arnold J, et al. 2013. Rbfox
proteins regulate alternative mRNA splicing through evolutionarily
conserved RNA bridges. Nat Struct Mol Biol 20: 1434-42.
[0514] Lu J, Getz G, Miska E A, Alvarez-Saavedra E, et al. 2005.
MicroRNA expression profiles classify human cancers. Nature 435:
834-8.
[0515] MacKenzie T A, Schwartz G N, Calderone H M, Graveel C R, et
al. 2014. Stromal Expression of miR-21 Identifies High-Risk Group
in Triple-Negative Breast Cancer. Am J Pathol 184: 3217-25.
[0516] Maddalo D, Manchado E, Concepcion C P, Bonetti C, et al.
2014. In vivo engineering of oncogenic chromosomal rearrangements
with the CRISPR/Cas9 system. Nature 516: 423-7.
[0517] Mali P, Yang L H, Esvelt K M, Aach J, et al. 2013.
RNA-Guided Human Genome Engineering via Cas9. Science 339:
823-6.
[0518] Manders, E. M., Stap, J., Brakenhoff, G. J., van Driel, R.,
and Aten, J. A. (1992). Dynamics of three-dimensional replication
patterns during the S-phase, analysed by double labelling of DNA
and confocal microscopy. J Cell Sci 103 (Pt 3), 857-862.
[0519] Meng L, Ward A J, Chun S, Bennett C F, et al. 2015. Towards
a therapy for Angelman syndrome by targeting a long non-coding RNA.
Nature 518: 409-12.
[0520] Miyanohara A, Kamizato K, Juhas S, Juhasova J, Navarro M,
Marsala S, Lukacova N, Hruska-Plochan M, Curtis E, Gabel B, Ciacci
J, Ahrens E T, Kaspar B K, Cleveland D, Marsala M. Potent spinal
parenchymal AAV9-mediated gene delivery by subpial injection in
adult rats and pigs. Mol Ther Methods Clin Dev. 2016; 3:16046.
[0521] Mouisel E, Blondet B, Escourrou P, Chatonnet A, Molgo J,
Ferry A. Outcome of acetylcholinesterase deficiency for
neuromuscular functioning. Neurosci Res. 2006; 55(4):389-96.
[0522] Muddashetty R S, Nalavadi V C, Gross C, Yao X, et al. 2011.
Reversible inhibition of PSD-95 mRNA translation by miR-125a, FMRP
phosphorylation, and mGluR signaling. Mol Cell 42: 673-88.
[0523] Nakayama, T., Fish, M. B., Fisher, M., Oomen-Hajagos, J.,
Thomsen, G. H., and Grainger, R. M. (2013). Simple and efficient
CRISPR/Cas9-mediated targeted mutagenesis in Xenopus tropicalis.
Genesis 51, 835-843.
[0524] Nissim-Rafinia M, Kerem B. 2002. Splicing regulation as a
potential genetic modifier. Trends Genet 18: 123-7.
[0525] O'Connell, M. R., Oakes, B. L., Sternberg, S. H.,
East-Seletsky, A., Kaplan, M., and Doudna, J. A. (2014).
Programmable RNA recognition and cleavage by CRISPR/Cas9. Nature
516, 263-266.
[0526] Orengo J P, Chambon P, Metzger D, Mosier D R, Snipes G J,
Cooper T A. Expanded CTG repeats within the DMPK 3'UTR causes
severe skeletal muscle wasting in an inducible mouse model for
myotonic dystrophy. Proc Natl Acad Sci USA. 2008;
105(7):2646-51.
[0527] Ozawa T, Natori Y, Sato M, Umezawa Y. 2007. Imaging dynamics
of endogenous mitochondrial RNA in single living cells. Nat Methods
4: 413-9.
[0528] Paige J S, Wu K Y, Jaffrey S R. 2011. RNA mimics of green
fluorescent protein. Science 333: 642-6.
[0529] Park H Y, Lim H, Yoon Y J, Follenzi A, et al. 2014.
Visualization of dynamics of single endogenous mRNA labeled in live
mouse. Science 343: 422-4.
[0530] Pasca S P, Portmann T, Voineagu I, Yazawa M, et al. 2011.
Using iPSC-derived neurons to uncover cellular phenotypes
associated with Timothy syndrome. Nat Med 17: 1657-62.
[0531] Passini M A, Bu J, Richards A M, Kinnecom C, et al. 2011.
Antisense oligonucleotides delivered to the mouse CNS ameliorate
symptoms of severe spinal muscular atrophy. Science Transl Med 3:
72ra18.
[0532] Price, A. A., Sampson, T. R., Ratner, H. K., Grakoui, A.,
and Weiss, D. S. (2015). Cas9-mediated targeting of viral RNA in
eukaryotic cells. Proc Natl Acad Sci USA 112, 6164-6169.
[0533] Qi, L. S., Larson, M. H., Gilbert, L. A., Doudna, J. A.,
Weissman, J. S., Arkin, A. P., and Lim, W. A. (2013). Repurposing
CRISPR as an RNA-guided platform for sequence-specific control of
gene expression. Cell 152, 1173-1183.
[0534] Rackham O, Brown C M. 2004. Visualization of RNA-protein
interactions in living cells: FMRP and IMP1 interact on mRNAs. EMBO
J 23: 3346-55.
[0535] Rath A K, Rentmeister A. 2014. Genetically encoded tools for
RNA imaging in living cells. Curr Opin Biotechnol 31C: 42-9.
[0536] Renton A E, Majounie E, Waite A, Simon-Sanchez J, et al.
2011. A hexanucleotide repeat expansion in C9ORF72 is the cause of
chromosome 9p21-linked ALS-FTD. Neuron 72: 257-68.
[0537] Sachdeva, G., Garg, A., Godding, D., Way, J. C., and Silver,
P. A. (2014). In vivo co-localization of enzymes on RNA scaffolds
increases metabolic production in a geometrically dependent manner.
Nucleic Acids Res 42, 9493-9503.
[0538] Sampson, T. R., Saroj, S. D., Llewellyn, A. C., Tzeng, Y.
L., and Weiss, D. S. (2013). A CRISPR/Cas system mediates bacterial
innate immune evasion and virulence. Nature 497, 254-257.
[0539] Sander, J. D., and Joung, J. K. (2014). CRISPR-Cas systems
for editing, regulating and targeting genomes. Nat Biotechnol 32,
347-355.
[0540] Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V.,
Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S.,
Schmid, B., et al. (2012). Fiji: an open-source platform for
biological-image analysis. Nat Methods 9, 676-682.
[0541] Shestakova E A, Singer R H, Condeelis J. 2001. The
physiological significance of beta-actin mRNA localization in
determining cell polarity and directional motility. Proc Natl Acad
Sci USA 98: 7045-50.
[0542] Shin I, Ray J, Gupta V, Ilgu M, et al. 2014. Live-cell
imaging of Pol II promoter activity to monitor gene expression with
RNA IMAGEtag reporters. Nucleic Acids Res 42: e90.
[0543] Staals R H, Zhu Y, Taylor D W, Kornfeld J E, et al. 2014.
RNA Targeting by the Type III-A CRISPR-Cas Csm Complex of Thermus
thermophilus. Mol Cell 56: 518-30.
[0544] Stepto A, Gallo J M, Shaw C E, Hirth F. Modelling C9ORF72
hexanucleotide repeat expansion in amyotrophic lateral sclerosis
and frontotemporal dementia. Acta Neuropathol. 2014;
127(3):377-89.
[0545] Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C., and
Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided
endonuclease Cas9. Nature 507, 62-67.
[0546] Strack R L, Disney M D, Jaffrey S R. 2013. A superfolding
Spinach2 reveals the dynamic nature of trinucleotide
repeat-containing RNA. Nat Methods 10: 1219-24.
[0547] Sunbul M, Jaschke A. 2013. Contact-mediated quenching for
RNA imaging in bacteria with a fluorophore-binding aptamer. Angew
Chem Int Ed Engl 52: 13401-4.
[0548] Swiech, L., Heidenreich, M., Banerjee, A., Habib, N., Li,
Y., Trombetta, J., Sur, M., and Zhang, F. (2015). In vivo
interrogation of gene function in the mammalian brain using
CRISPR-Cas9. Nat Biotechnol 33, 102-106.
[0549] The ENCODE Project Consortium. 2012. An integrated
encyclopedia of DNA elements in the human genome. Nature 489:
57-74.
[0550] Tourriere, H., Chebli, K., Zekri, L., Courselaud, B.,
Blanchard, J. M., Bertrand, E., and Tazi, J. (2003). The
RasGAP-associated endoribonuclease G3BP assembles stress granules.
J Cell Biol 160, 823-831.
[0551] Tyagi S, Kramer F R. 1996. Molecular beacons: Probes that
fluoresce upon hybridization. Nat Biotechnol 14: 303-8.
[0552] Unsworth, H., Raguz, S., Edwards, H. J., Higgins, C. F., and
Yague, E. (2010). mRNA escape from stress granule sequestration is
dictated by localization to the endoplasmic reticulum. FASEB J 24,
3370-3380.
[0553] Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., and
Gregory, P. D. (2010). Genome editing with engineered zinc finger
nucleases. Nat Rev Genet 11, 636-646.
[0554] Wang X, Zamore P D, Hall T M. 2001. Crystal structure of a
Pumilio homology domain. Mol Cell 7: 855-65.
[0555] Wang, X., McLachlan, J., Zamore, P. D., and Hall, T. M.
(2002). Modular recognition of RNA by a human pumilio-homology
domain. Cell 110, 501-512.
[0556] Wang Y, Cheong C G, Hall T M, Wang Z. 2009. Engineering
splicing factors with designed specificities. Nat Methods 6:
825-830.
[0557] Wernersson, R., and Nielsen, H. B. (2005). OligoWiz
2.0-integrating sequence feature annotation into the design of
microarray probes. Nucleic Acids Res 33, W611-615.
[0558] Weyn-Vanhentenryck S M, Mele A, Yan Q, Sun S, et al. 2014.
HITS-CLIP and integrative modeling define the Rbfox
splicing-regulatory network linked to brain development and autism.
Cell Rep 6: 1139-52.
[0559] Wheeler T M, Lueck J D, Swanson M S, Dirksen R T, Thornton C
A. Correction of ClC-1 splicing eliminates chloride channelopathy
and myotonia in mouse models of myotonic dystrophy. J Clin Invest.
2007; 117(12):3952-7.
[0560] Wiedenheft, B., Sternberg, S. H., and Doudna, J. A. (2012).
RNA-guided genetic silencing systems in bacteria and archaea.
Nature 482, 331-338.
[0561] Wright A V, Sternberg S H, Taylor D W, Staahl B T, Bardales
J A, Kornfeld J E, Doudna J A. Rational design of a split-Cas9
enzyme complex. Proc Natl Acad Sci USA. 2015; 112(10):2984-9.
[0562] Wu X, Kriz A J, Sharp P A. Target specificity of the
CRISPR-Cas9 system. Quant Biol. 2014; 2(2):59-70.
[0563] Yang, D., Xu, J., Zhu, T., Fan, J., Lai, L., Zhang, J., and
Chen, Y. E. (2014). Effective gene targeting in rabbits using
RNA-guided Cas9 nucleases. J Mol Cell Biol 6, 97-99.
[0564] Yang Y, Wang L, Bell P, McMenamin D, He Z, White J, Yu H, Xu
C, Morizono H, Musunuru K, Batshaw M L, Wilson J M. A dual AAV
system enables the Cas9-mediated correction of a metabolic liver
disease in newborn mice. Nat Biotechnol. 2016; 34(3):334-8.
[0565] Yeo G W, Coufal N G, Liang T Y, Peng G E, et al. 2009. An
RNA code for the FOX2 splicing regulator revealed by mapping
RNA-protein interactions in stem cells. Nat Struct Mol Biol 16:
130-7.
[0566] Zhang W, Wang Y, Dong S, Choudhury R, et al. 2014. Treatment
of type 1 myotonic dystrophy by engineering site-specific RNA
endonucleases that target (CUG)(n) repeats. Molecular therapy: J Am
Soc Gene Ther 22: 312-20.
[0567] Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P.,
Bessen, J. L., Hu, J. H., Maeder, M. L., Joung, J. K., Chen, Z. Y.,
and Liu, D. R. (2015). Cationic lipid-mediated delivery of proteins
enables efficient protein-based genome in vitro and in vivo. Nat
Biotechnol 33, 73-80.
* * * * *
References