U.S. patent application number 15/536018 was filed with the patent office on 2019-01-31 for differentiation of pluripotent stem cells to form renal organoids.
The applicant listed for this patent is The University of Queensland. Invention is credited to Melissa LITTLE, Minoru TAKASATO.
Application Number | 20190032020 15/536018 |
Document ID | / |
Family ID | 56125447 |
Filed Date | 2019-01-31 |
![](/patent/app/20190032020/US20190032020A1-20190131-D00000.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00001.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00002.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00003.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00004.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00005.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00006.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00007.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00008.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00009.png)
![](/patent/app/20190032020/US20190032020A1-20190131-D00010.png)
View All Diagrams
United States Patent
Application |
20190032020 |
Kind Code |
A1 |
TAKASATO; Minoru ; et
al. |
January 31, 2019 |
DIFFERENTIATION OF PLURIPOTENT STEM CELLS TO FORM RENAL
ORGANOIDS
Abstract
A method is provided for producing renal organoids comprising
nephrons, ureteric bud and vasculature and/or progenitors of these.
In one embodiment, the methods includes contacting intermediate
mesoderm cells with: fibroblast growth factor 9 and/or fibroblast
growth factor 20 and/or fibroblast growth factor 2 and optionally,
one or more selected from the group consisting of: bone morphogenic
protein 7; heparin; a Wnt agonist; retinoic acid; and an RA
antagonist under conditions that promote formation of vascularized
renal organoids. Another embodiment includes producing mesoderm
cells by sequentially contacting pluripotent stem cells with a Wnt
agonist and fibroblast growth factor 9 and/or fibroblast growth
factor 20 and/or fibroblast growth factor 2, followed by a
relatively short re-exposure to the Wnt agonist. The renal
organoids may have end uses such as for kidney repair and re
generation, bioprinting of kidneys or functional components
thereof, renal cell arrays and screening compounds for
nephrotoxicity.
Inventors: |
TAKASATO; Minoru; (Moonee
Ponds, Victoria, AU) ; LITTLE; Melissa; (Coburg,
Victoria, AU) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The University of Queensland |
St Lucia, Queensland |
|
AU |
|
|
Family ID: |
56125447 |
Appl. No.: |
15/536018 |
Filed: |
December 15, 2015 |
PCT Filed: |
December 15, 2015 |
PCT NO: |
PCT/AU2015/050798 |
371 Date: |
June 14, 2017 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2506/02 20130101;
C12N 2506/45 20130101; C12N 5/0687 20130101; C12N 2501/415
20130101; C12N 5/0686 20130101; C12N 5/0696 20130101; C12N 2501/385
20130101; C12N 2501/119 20130101; C12N 2501/16 20130101; C12N
2501/155 20130101 |
International
Class: |
C12N 5/071 20100101
C12N005/071; C12N 5/074 20100101 C12N005/074 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 15, 2014 |
AU |
2014277667 |
Claims
1. A method of producing nephron progenitor cells and ureteric
epithelial progenitor cells comprising contacting intermediate
mesoderm (IM) cells with: fibroblast growth factor 9 (FGF9) and/or
fibroblast growth factor 20 (FGF20) and/or fibroblast growth factor
2 (FGF2); and optionally, one or more selected from the group
consisting of: bone morphogenic protein 7 (BMP7); heparin; a Wnt
agonist; retinoic acid (RA), analog or agonist; and an RA
antagonist; to thereby produce nephron progenitor cells and
ureteric epithelial progenitor cells under conditions that induce
aggregation of nephron progenitor cells and ureteric epithelial
progenitor cells into one or more renal organoids whereby the renal
organoids are at least partly vascularized and/or comprise vascular
progenitors.
2. The method of claim 1, wherein vascularization is facilitated by
conditions that promote or direct development of vascular
endothelium or vascular progenitors from mesenchymal cells or
tissues.
3.-4. (canceled)
5. The method of claim 1, wherein RA, analog or agonist increases
the relative production of ureteric epithelial progenitor cells
from the IM cells.
6. (canceled)
7. The method of claim 1, wherein the RA antagonist increases the
relative production of nephron progenitor cells from the IM
cells.
8. (canceled)
8. The method of claim 1, wherein the Wnt agonist increases the
relative production of nephron progenitor progenitor cells from the
IM cells.
9.-11. (cancelled)
12. The method of claim 1, wherein the nephron progenitor cells and
ureteric epithelial progenitor cells are produced synchronously or
simultaneously from the IM cells.
13. The method of claim 1, which includes further comprising
contacting posterior primitive streak cells with one or more agents
that facilitate differentiation of the posterior primitive streak
cells into said IM cells.
14. The method of claim 13, further comprising contacting human
pluripotent stem cells (hPSCs) with one or more agents that
facilitate differentiation of the hPSCs into said posterior
primitive streak cells.
15. A method of producing mesoderm cells, comprising contacting
hPSCs with a Wnt agonist to produce the mesodeini cells.
16. The method of claim 15, wherein the mesodeini cells are a mixed
population comprising one or more of definitive mesoderm and
intermediate mesoderm.
17.-23. (canceled)
24. The method of claim 15, which further includes the production
of further comprising producing vasculature and/or vascular
progenitor cells.
25.-26. (canceled)
27. Isolated, enriched or purified nephron progenitor cells,
ureteric epithelial progenitor cells and/or renal organoids
produced according to the method of claim 1.
28. The renal organoid of claim 27, which comprises segmented
nephrons, endothelia and renal interstitium.
29. (canceled)
30. A method of producing a kidney, or kidney cells or tissues,
comprising differentiating the isolated or purified nephron
progenitor cells, ureteric epithelial progenitor cells and/or renal
organoids of claim 27, to produce the kidney, or kidney cells or
tissues.
31. The Isolated, enriched, or purified nephron progenitor cells,,
ureteric epithelial progenitor cells, and/or renal organoids
produced according to the method of claim 30.
32. A method of bioprinting a renal structure, comprising
depositing a plurality of hPSCs or other progenitor cells to form a
renal structure that is at least partly vascularized and/or
comprises vascular progenitors and having one or more functional
characteristics of a kidney or component thereof, or which is
capable of developing one or more functional characteristics of a
kidney or component thereof.
33. The method of claim 3332, wherein the hPSCs or other progenitor
cells are prepared by contacting intermediate mesoderm (IM) cells
with: fibroblast growth factor 9 (FGF9) and/or fibroblast growth
factor 20 (FGF20) and/or fibroblast growth factor 2 (FGF2); and
optionally, one or more selected from the group consisting of: bone
morphogenic protein 7 (BMP7); heparin; a Wnt agonist; retinoic acid
(RA), analog or agonist; and an RA antagonist, to thereby produce
nephron progenitor cells, ureteric epithelial progenitor cells and
vasculature in the bioprinted renal structure.
34. A method of bioprinting a renal structure, comprising
depositing a plurality of nephron progenitor cells and ureteric
epithelial progenitor cells disclosed herein to form a renal
structure that is at least partly vascularized and/or comprises
vascular progenitors and having one or more functional
characteristics of a kidney or component thereof, or which is
capable of developing one or more functional characteristics of a
kidney or component thereof.
35. (canceled)
36. A bioprinted renal structure which is at least partly
vascularized having one or more functional characteristics of a
kidney or component thereof, or which is capable of developing one
or more functional characteristics of a kidney or component
thereof, produced by the method of claim 32.
37. A method of (i) bioprinting or bio-engineering whole kidneys
and kidney tissue for kidney transplant or treating chronic kidney
disease; (ii) recellularisation of whole organ decellularised
kidney to thereby create a reconstituted or replacement kidney; or
(iii) cellular therapy of a damaged kidney or one or more kidney
diseases or conditions comprising bioprinting the isolated,
enriched, or purified nephron progenitor cells, ureteric epithelial
progenitor cells, and/or renal organoids of claim 31.
38.-42. (canceled)
43. A method of determining the nephrotoxicity of one or a
plurality of compounds, comprising contacting the one or plurality
of compounds with the isolated or purified nephron progenitor
cells, ureteric epithelial progenitor cells, and/or renal organoids
of any one of claim 27, or kidney cells or tissues differentiated
or otherwise obtained therefrom, and determining whether or not the
one or plurality of compounds is nephrotoxic.
44. (canceled)
Description
TECHNICAL FIELD
[0001] THIS INVENTION relates to kidney development. More
particularly, this invention relates to an in vitro method of
producing renal organoids comprising nephrons and/or ureteric bud
and/or progenitors of these, which are at least partly vascularized
and contain a renal interstitial compartment.
BACKGROUND
[0002] With the prevalence of end stage renal disease rising 8% per
annum globally, there is an urgent need for renal regenerative
strategies. The kidney is a mesodermal organ that differentiates
from the intermediate mesoderm (IM) via the formation of a ureteric
bud (UB) and the interaction between this bud and the adjacent
IM-derived metanephric mesenchyme (MM). The nephrons arise from a
nephron progenitor population derived from the MM. Other
progenitors within the IM or MM are regarded as contributing to the
renal stroma/interstitium and components of the renal vasculature,
including the glomerular capillaries. The IM itself is derived from
the posterior primitive streak. While the developmental origin of
the kidney is well understood, nephron formation in the human
kidney is completed before birth.sup.5. Hence, there is no
postnatal stem cell able to replace lost nephrons.
[0003] Human Pluripotent Stem cells have great potential for the
generation of a cell-based treatment for kidney disease. However,
the realisation of human pluripotent stem cells as a source of
cells for clinical use and as a treatment, such as for kidney
disease, has been hindered by the lack of understanding of how to
produce the necessary cell types that give rise to nephrons and
other structures of the kidney.
SUMMARY
[0004] The present inventors have successfully directed the
differentiation of human pluripotential stem cells through
posterior primitive streak and intermediate mesoderm (IM) under
fully chemically defined monolayer culture conditions using growth
factors used during normal embryogenesis. This differentiation
protocol results in the synchronous induction of ureteric bud (UB)
and metanephric mesenchyme (MM) that forms a self-organising
structure, including nephron formation and segmentation to form
distal tubule, proximal tubule and Bowman's capsule, in vitro.
Organoids also contain mesenchyme-derived kidney stroma. Such
hESC-derived components show broad renal potential ex vivo,
illustrating the potential for pluripotent stem cell-based renal
regeneration. Further to this, the inventors have directed the
differentiation of vasculature within kidney organoids comprising
differentiated ureteric bud (UB), metanephric mesenchyme (MM) and
MM-derived nephrons and stroma. In a particular form, the invention
provides generation of aggregated nephron progenitor cells and
ureteric epithelial progenitor cells that form renal organoids in a
shortened culture period. More particularly, the invention provides
a method for directing human pluripotent stem cells to form a
complex multicellular kidney organoid that comprises fully
segmented nephrons surrounded by endothelia and renal interstitium
and is transcriptionally similar to a human fetal kidney.
[0005] Accordingly, one aspect of the invention provides a method
of producing nephron progenitor cells and ureteric epithelial
progenitor cells, said method including the step of contacting
intermediate mesoderm (IM) cells with: fibroblast growth factor 9
(FGF9) and/or fibroblast growth factor 20 (FGF20) and/or fibroblast
growth factor 2 (FGF2); and optionally, one or more agents selected
from the group consisting of: bone morphogenic protein 7 (BMP7);
heparin; a Wnt agonist; retinoic acid (RA), analog or agonist; and
an RA antagonist; to thereby produce nephron progenitor cells and
ureteric epithelial progenitor cells from the IM cells, under
conditions that induce or promote aggregation of nephron progenitor
cells and ureteric epithelial progenitor cells into one or more
renal organoids whereby the renal organoids are at least partly
vascularized and/or comprise vascular progenitor cells.
[0006] In some embodiments, at least partial vascularization and/or
the presence of vascular progenitor cells is facilitated by
conditions that promote or direct development of vascular
endothelium or vascular progenitors from mesenchyme cells or
tissues.
[0007] In one embodiment, vascularization of the renal organoid is
facilitated by inclusion of one or more human pluripotent stem
cells and/or vascular endothelial progenitors differentiated
therefrom.
[0008] In another embodiment, vascularization of the renal organoid
is facilitated by use of a suitable oxygen tension that facilitates
vascularization.
[0009] In one embodiment, the IM cells are derived or
differentiated from posterior primitive streak cells.
[0010] In one embodiment, the posterior primitive streak cells are
derived or differentiated from human pluripotent stem cells
(hPSCs). Non-limiting examples of hPSCs include human embryonic
stem cells (hESCs) and induced human pluripotent stem cells
(iPSCs).
[0011] A related aspect of the invention provides a method of
producing mesoderm cells, said method including the steps of
contacting hPSCs with a Wnt agonist to thereby produce mesoderm
cells. The mesoderm cells may be a mixed population of mesodermal
cells such as definitive mesoderm and intermediate mesoderm (IM)
including rostral IM and/or caudal IM.
[0012] The method may further include the subsequent step of
contacting the definitive mesoderm cells with fibroblast growth
factor 9 (FGF9) and/or fibroblast growth factor 20 (FGF20) and/or
fibroblast growth factor 2 (FGF2). Suitably, the subsequent step of
contacting the definitive mesoderm cells with fibroblast growth
factor 9 (FGF9) and/or fibroblast growth factor 20 (FGF20) and/or
fibroblast growth factor 2 (FGF2) step facilitates the formation of
intermediate mesoderm (IM) which subsequently gives rise to the
differentiation of both ureteric epithelium and nephron progenitor
cells from the IM cells. In a further embodiment, the method
further includes the subsequent step of dissociating and
reaggregating the cells into a pellet for culture in the presence
of FGF2, FGF9 and/or FGF20. Suitably, this step facilitates the
production of renal organoids comprising nephrons. The culture in
the presence of FGF2, FGF9 and/or FGF20 may be performed on a
floating filter at an air/media interface. In a further embodiment,
the method further includes the addition of a Wnt agonist prior to
removal of FGF2, FGF9 and/or FGF20 and subsequent culture without
growth factors. This step further facilitates the formation of
nephrons within renal organoids. Suitably, the Wnt agonist is at
relatively high concentration for a relatively short period of time
(e.g 30-60 minutes)
[0013] Optionally, culturing cells in the presence of the Wnt
agonist, fibroblast growth factor 9 (FGF9) and/or fibroblast growth
factor 20 (FGF20) and/or fibroblast growth factor 2 (FGF2) in any
of the aforementioned steps may further include one or more of: a
retinoic acid (RA) antagonist, RA or RA agonist, bone morphogenic
protein 7 (BMP7); and/or retinoic acid.
[0014] Preferably, the renal organoids are at least partly
vascularized. Preferably, the renal organoid comprises segmented
nephrons surrounded by endothelia, perivascular cells and renal
interstitium.
[0015] In one embodiment, vascularization of the kidney organoid is
facilitated by inclusion of one or more human pluripotent stem
cells and/or vascular endothelial progenitors differentiated
therefrom.
[0016] In another embodiment, vascularization of the kidney
organoid is facilitated by use of a suitable oxygen tension that
facilitates vascularization.
[0017] In one embodiment, the method further includes the step of
identifying viable nephron progenitor cells and/or ureteric
epithelial progenitor cells.
[0018] In certain embodiments, identification of viable nephron
progenitor cells and/or ureteric epithelial progenitor cells
includes measurement or detection of co-expression of a plurality
of nucleic acids and/or proteins as markers for the viable nephron
and/or ureteric epithelial progenitor cells.
[0019] In another aspect, the invention provides isolated, enriched
or purified nephron and/or ureteric epithelial progenitor cells
and/or a renal organoid produced according to the method of the
aforementioned aspect.
[0020] Preferably, the renal organoid comprises segmented nephrons
surrounded by endothelia and renal interstitium.
[0021] In yet another aspect, the invention provides a method of
producing a kidney, or kidney cells or tissues, said method
including the step of differentiating kidney, or kidney cells or
tissues from the nephron progenitor cells and/or ureteric
epithelial progenitor cells and/or the renal organoid of the
aforementioned aspects to thereby produce the kidney, or kidney
cells or tissues.
[0022] In some embodiments, the nephron progenitor cells and/or
ureteric epithelial progenitor cells and/or the renal organoid tnay
he used for the recellularisation of whole organ decellularised
kidney to thereby create a reconstituted or replacement kidney.
[0023] In other embodiments, the nephron progenitor cells and/or
ureteric epithelial progenitor cells and/or the renal organoid may
be used as a source for cellular therapy of kidney diseases and
conditions.
[0024] In certain aspects, the nephron progenitor cells and/or
ureteric epithelial progenitor cells and/or renal organoids may be
used as a source of cells or tissues for bioprinting or
bio-engineering whole kidneys, kidney cells and/or tissues for
kidney transplant or treating chronic kidney damage or disease.
[0025] A particular aspect provides a method of bioprinting a renal
structure, said method including depositing a plurality of hPSCs or
other progenitor cells disclosed herein to form a renal structure
having one or more functional characteristics of a kidney or
component thereof, or which is capable of developing one or more
functional characteristics of a kidney or component thereof.
[0026] Suitably, the renal structure is at least partly
vascularized and/or comprises vascular progenitor cells.
[0027] Suitably, the hPSCs or other progenitor cells are subjected
to a method disclosed herein for producing nephron progenitor cells
and ureteric epithelial progenitor cells in the three-dimensional
structure.
[0028] This particular aspect also provides a bioprinted, renal
structure having one or more functional characteristics of a kidney
or component thereof, or which is capable of developing one or more
functional characteristics of a kidney or component thereof,
produced by the aforementioned method.
[0029] Another particular aspect provides a method of bioprinting a
renal structure, said method including depositing a plurality of
nephron progenitor cells and ureteric epithelial progenitor cells
disclosed herein to form a renal structure having one or more
functional characteristics of a kidney or component thereof, or
which is capable of developing one or more functional
characteristics of a kidney or component thereof.
[0030] Suitably, the bioprinted renal structure is at least partly
vascularized and/or comprises vascular progenitor cells.
[0031] Suitably, the nephron progenitor cells and ureteric
epithelial progenitor cells have been produced from hPSCs by a
method disclosed herein.
[0032] This particular aspect also provides a bioprinted renal
structure having one or more functional characteristics of a kidney
or component thereof, or which is capable of developing one or more
functional characteristics of a kidney or component thereof,
produced by the aforementioned method.
[0033] Another aspect of the invention provides an array of nephron
progenitors and ureteric progenitors having a planar geometry.
[0034] The array may comprise 2-15 or more stacked arrays.
[0035] The arrays may stacked in a tessellated pattern.
[0036] A related aspect of the invention provides a renal organoid
obtained by maturing or differentiating the array, or cells
therein, of the aforementioned aspect.
[0037] Suitably, the renal organoid is at least partially
vascularized and/or comprise vascular progenitors.
[0038] In a further aspect, the invention provides a method of
determining the nephrotoxicity of one or a plurality of compounds,
said method including the step of contacting the one or plurality
of compounds with the isolated or purified nephron progenitor cells
and/or ureteric epithelial progenitor cells, bioprinted renal
structure, array and/or renal organoid of the aforementioned
aspects, or kidney cells or tissues differentiated or otherwise
obtained therefrom, to thereby determine whether or not the one or
plurality of compounds is nephrotoxic.
[0039] In one embodiment, this aspect provides bioprinting of the
nephron progenitors and/or ureteric epithelial progenitors into
kidney organoids for nephrotoxicity screening.
BRIEF DESCRIPTION OF THE FIGURES
[0040] FIG. 1. Differential effects of culturing with CHIR for 3, 4
or 5 days followed by FGF9 alone (b) or together with RA (a) or an
RA antagonist (c).
[0041] FIG. 2. Presence of a MEIS1.sup.+ stromal population present
between the forming nephrons. Red=MEIS1; Blue=nuclei.
[0042] FIG. 3. Presence of CD31.sup.+ vascular progenitors.
Red=NPHS1 (podocyte), Blue=nuclei, Green=CD31.
[0043] FIG. 4. Presence of all segments of a normal developing
nephron, including collecting duct
(GATA3.sup.+PAX2.sup.+ECAD.sup.+), distal tubule
(ECAD.sup.+GATA3.sup.-LTL.sup.-), proximal tubule
(LTL.sup.+AQP1.sup.+) and glomerulus
(WT1.sup.+NPHS1.sup.+SYNPO.sup.+), connected to each other
suggestive of normal embryonic organogenesis. Pink=GATA3,
Green=ECAD, Blue=LTL, Red=WT1, Collecting duct (Pink and green),
Distal tubule (green), Proximal tubule (blue), glomeruli (red in
nuclei).
[0044] FIG. 5. Renal organoids of 11 days culture after being
pelleted. a=an image of bright field showing 3 to 5 cm in diameter.
b=an image of immunofluorescent staining. Green=ECAD, Red=NPHS1,
Blue=LTL, Distal tubule (green), Proximal tubule (blue), glomeruli
(red).
[0045] FIG. 6. Addition of a 45 minute pulse of high CHIR (5 .mu.M)
immediately upon reaggregation followed by culture in FGF9 with or
without AGN (retinoic inhibitor), BMP7, low CHIR or RA for 5 days
then without these factors for 6 days. a=4 day pellet with no CHIR;
b=4 day pellet with 45 min CHIR pulse; c=11 day pellet with no
CHIR; d=11 day pellet with 45 min CHIR pulse.
[0046] FIG. 7. Selective induction of either the collecting duct or
kidney mesenchyme lineage. a, Schematic illustrating the mechanism
of A-P patterning of the IM in the embryogenesis.sup.13. The timing
of PSM cell migration determines the timing of the exposure to FGF9
and RA, resulting in fate selection between AI and PI. PSM,
presomitic mesoderm; AI, anterior intermediate mesoderm; PI,
posterior intermediate mesoderm; UE, ureteric epithelium; MM,
metanephric mesenchyme. b, Schematic of three experimental
timelines. c, Timecourse qPCR of an initial 7 days of the
differentiation from the above timings. Experiments were conducted
using monolayer culture condition. (mean.+-.s.d., n=3 independent
experiments) d, Immunofluorescence at day 7 of differentiation with
the AI marker, GATA3, and the PI marker, HOXD11. Scale=100 .mu.m.
Experimental replicates=3 e, Schematic illustrating RA signaling
post primitive streak stage. An RA-metabolizing enzyme, CYP26, is
expressed in the PSM region to shield PSM cells from RA signaling.
f, Schematic of three experimental timelines. RA or AGN193109 (AGN)
were added with FGF9 after CHIR99021, followed by growth factor
withdrawal (no GFs). Experiments were conducted with monolayer
culture condition. g, Immunofluorescence at day 18 of
differentiation from 3 days CHIR99021 followed by .+-.RA/AGN. AGN
inhibited the AI specification of early migrating cells, causing
posteriorization. At day 18, GATA3 and HOXD11 mark the UE and the
MM respectively (left panels). GATA3.sup.+PAX2.sup.+ECAD.sup.+cells
represent the UE whereas GATA3.sup.-TAX2.sup.+ cells do the MM
(ECAD.sup.-) and its derivatives (ECAD.sup.+) (right panels).
Experimental replicates=3. Scale=100 .mu.m.
[0047] FIG. 8. Generating a kidney organoid equivalent to the human
fetal kidney in vitro. a, Schematic of the differentiation protocol
from hPSCs. b, Global brightfield observations of self-organizing
kidney organoids across a time series. The success rate of organoid
differentiation was 94.2% (138 organoids, 5 experiments). Scale=1
mm. c, Tile scan immunofluorescence of a whole kidney organoid
displaying structural complexity. Scale=1 mm d, High power
immunofluorescence microscopy showing a nephron segmented into 4
compartments, including the collecting duct (CD,
GATA3.sup.+ECAD.sup.+), distal tubule (DT,
GATA3.sup.-ECADITL.sup.-), proximal tubule (PT,
ECAD.sup.-LTL.sup.+) and the glomerulus (G, WT1.sup.+). Scale=100
.mu.m. e, Confocal microscopy generating serial z-stack images from
the bottom to the top of a day 11 kidney organoid (Extended Data
Video 1 and 2). Schematic illustrates the position of different
structures within an organoid. e', e'' and e''' are representative
images taken through the organoids at the position indicated in e.
Each segment of the nephron is marked (or colored in schematic) as
described below: collecting ducts, GATA3.sup.+ECAD.sup.+(green dots
in yellow); distal tubules, ECAD.sup.+(yellow); proximal tubules,
LTL.sup.+ (red); glomeruli, NPHS1 (green circles). Scale=100 .mu.m.
f, Heat map visualizing the relative transcriptional identity
(score from 0 to 1 determined using the KeyGene algorithm.sup.15)
of kidney organoids to 13 human fetal tissues. RNA-seq was
performed on whole kidney organoids from 4 time points (day 0, 3,
11, 18 post aggregation).times.3 individual organoids from 1
experiment/timepoint (See Supplementary Table 2). g, A dendrogram
showing the hierarchical clustering of day 0, 3, 11 and 18 kidney
organoids with human fetal organs from both first trimester and
second trimester, based upon 85 key genes (Supplementary Table 3)
previously defined.sup.15. This clearly shows a close match with
Trimester 1 fetal kidney from day 11 and 18 of culture.
[0048] FIG. 9. Kidney organoids contain differentiating nephrons,
stroma and vasculature with progressive maturation with time in
culture. a, Schematic illustrating the developmental pathway from
IM to each cellular component of the kidney. CD, collecting ducts;
DT, distal tubules; LoH, loops of Henle; PT, proximal tubules; POD,
podocytes; VASC, vasculature; STROM, renal interstitium. b-j,
Immunofluorescence of kidney organoids at either day 11 or 18. b,
Collecting ducts marked by PAX2, GATA3 and ECAD. Scale=50 .mu.m.
c,d, Early proximal tubules of LTL.sup.+ECAD.sup.- at day 11
(Blanked arrowheads). LTL.sup.+ECAD.sup.+ maturing proximal tubules
appear by day 18 (White arrowheads). Scale=100 .mu.m. e, Proximal
tubules express Cubilin (CUBN). Scale=50 f, Loops of Henle marked
by UMOD and ECAD. Scale=50 .mu.m. g, A developing glomerulus with
podocytes marked by WT1 and NPHS1. Scale=50 .mu.m. h,
CD31.sup.+endothelia within the renal interstitium. Scale=200
.mu.m. i, Evidence of endothelial invasion into glomeruli at day 18
of culture. Scale=50 .mu.m. j, The kidney interstitium marked by
MEIS1. Scale=100 .mu.m. k-m, Transmission Electron Microscopy of
kidney organoids. k, A putative distal tubule with relatively
sparse short microvilli (m) and tight junctions (tj). l, A putative
proximal tubule with a lumen filled with extensive closely packed
microvilli characteristic of the brush border (bb). m, Podocytes
(p) with characteristic large nuclei and primary (pf) and secondary
foot (sf) processes. Data are representative from a minimum of 3
independent experiments.
[0049] FIG. 10. Functional maturation of the proximal tubule.
[0050] a, Dextran uptake assay showing endocytic ability of
LTL.sup.+ tubules. Scale=50 .mu.m. b, Treating kidney organoids
with 20 .mu.M of Cisplatin caused apoptosis in LTL.sup.+ECAD.sup.+
proximal tubular cells. Apoptotic cells were detected by cleaved
Caspase 3 antibody-staining (CASP3). Scale=100 .mu.m. c,
Quantification of the number of apoptotic tubules showing mature
proximal tubules-specific apoptosis by a nephrotoxicant, Cisplatin.
In response to 5 uM and 20 uM Cisplatin, LTL.sup.+ECAD.sup.+ mature
proximal tubules (PT) underwent apoptosis dose-dependently. In
contrast, LTL.sup.+ECAD.sup.- immature PT did not respond to
Cisplatin. P values were calculated by independent t-test
(mean.+-.s.e., n=5 independent experiments).
[0051] FIG. 11. Regulation of nephrogenesis in the kidney organoid.
a, Stimulating organoids with 5 .mu.M of CHIR99021 for 1 h
immediately post aggregation promoted nephrogenesis (CHIR pulse),
whereas only limited numbers of nephrogenesis events happened
without CHIR99021 (no pulse). Scale=1 mm. b, Without the addition
of FGF9 after this CHIR99021 pulse, organoids did not initiate
nephrogenesis (-FGF9). Scale=200 .mu.m.
[0052] FIG. 12. Changes of gene expression during development of
the kidney organoid. a-c, Graphs showing expression changes of
selected marker genes at 4 time points (day 0, 3, 11 and 18) of the
kidney organoid culture. X-axis represents the count of detection
for each gene in an RNA sequencing analysis. Markers of the nephron
progenitor (Cap mesenchyme) and collecting duct progenitor
(Ureteric tip) were peaked by day 3 then dropped (a). Markers of
early nephron increased by day 3, while those of mature nephron
components (Proximal and distal tubule and Podocytes) started after
day 3. Illustrations show expression regions (blue colored) of each
selected gene in the developing kidney (b).
[0053] FIG. 13. Dendrogram showing the hierarchical clustering of
D0, D3, D11, D18 differentiation experiments and 21 human fetal
organs from first and second trimester (GSE66302).sup.15. Sample
name is composed of individual ID followed by an organ name and
gestation week. For instance, `DJ1 kidney_9` represents a kidney at
9th week gestation from individual ID: DJ1. D0 and D3 kidney
organoids cluster with gonad, in agreement with the common origin
of both gonad and kidney from the intermediate mesoderm. D11 and
D18 kidney organoids show strongest similarity to trimester 1 human
kidney. The Classifier genes used for this analysis are detailed in
Table 3.
[0054] FIG. 14. Characterization of non-epithelial structures in
the kidney organoid. All images were taken from day 18 kidney
organoids a, PDGFRA.sup.+pericytic cells attaching on KDR.sup.+
vessels. Scale=50 .mu.m, Some glomeruli contained PDGFRA.sup.+
cells likely to represent early mesangial cells.sup.19. Scale=50
.mu.m.
DETAILED DESCRIPTION
[0055] The invention is at least partly predicated on the
identification of specific in vitro culture conditions that are
tailored to promote the synchronous, simultaneous differentiation
of nephron progenitor cells and ureteric epithelial progenitors
from intermediate mesoderm (IM) to produce at least partly
vascularized renal organoids or other renal cell or tissue
aggregates. More specifically, FGF9 plus heparin alone, or in
combination with one or more agents including bone morphogenic
protein 7 (BMP7), retinoic acid (RA), an RA antagonist; a Wnt
agonist; and/or FGF20 plus heparin; and/or FGF2 plus heparin, is
capable of facilitating differentiation of intermediate mesoderm
into nephron progenitor cells and ureteric epithelial progenitors.
Further to this, the in vitro culture method provides a system for
differentiating human embryonic stem cells through posterior
primitive streak, IM and metanephric mesenchymal stages to produce
nephron progenitor cells and ureteric epithelial progenitor cells.
Advantageously, the presence or absence of certain molecules such
as RA, RA antagonist and/or Wnt agonist can be manipulated to
preferentially promote the production of nephron progenitor cells
versus ureteric epithelial progenitors, or vice versa. More
particularly, the invention is also predicated on the discovery
that human pluripotent stem cells may be directed to form a complex
multicellular kidney organoid that comprises fully segmented
nephrons surrounded by endothelia and renal interstitium and is
transcriptionally similar to a human fetal kidney. Vascularization
may be facilitated by conditions that promote or direct development
of vascular endothelium from mesenchymal cells or tissues.
[0056] The nephron progenitor cells and ureteric epithelial
progenitor cells are simultaneously induced, direct the
differentiation of each other in vivo and are capable of developing
into distinct tubular epithelial structures, including ureteric
tree and nephron progenitor mesenchyme, during which the epithelial
structures substitute for the ureteric tip to maintain the nephron
progenitor cells. It is therefore proposed that the hESC-derived
ureteric epithelium and/or nephron progenitor cells produced
according to the invention may be directed to differentiate into
renal cells from both the ureteric and mesenchymal compartments.
Furthermore, the capacity of these cells to `self-organise` into
aggregated, organoid structures may therefore be exploited to
facilitate kidney repair, such as by way of kidney bioengineering.
The nephron progenitor cells, nephrons derived therefrom or kidney
organoids "self organized" as described above, may also be suited
to nephrotoxicity testing, which has been hampered by a previous
inability to produce cells suitable for testing.
[0057] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by those
of ordinary skill in the art to which the invention belongs.
Although any methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, preferred methods and materials are
described.
[0058] As used herein, except where the context requires otherwise,
the term "comprise" and variations of the term, such as
"comprising", "comprises" and "comprised", are not intended to
exclude further additives, components, integers or steps.
[0059] It will be appreciated that the indefinite articles "a" and
"an" are not to be read as singular indefinite articles or as
otherwise excluding more than one or more than a single subject to
which the indefinite article refers. For example, "a" cell includes
one cell, one or more cells and a plurality of cells.
[0060] For the purposes of this invention, by "isolated" is meant
material that has been removed from its natural state or otherwise
been subjected to human manipulation. Isolated material (e.g.,
cells) may be substantially or essentially free from components
that normally accompany it in its natural state, or may be
manipulated so as to be in an artificial state together with
components that normally accompany it in its natural state.
[0061] By "enriched" or "purified" is meant having a higher
incidence, representation or frequency in a particular state (e.g
an enriched or purified state) compared to a previous state prior
to enrichment or purification.
[0062] The terms "differentiate", "differentiating" and
"differentiated", relate to progression of a cell from an earlier
or initial stage of a developmental pathway to a later or more
mature stage of the developmental pathway. It will be appreciated
that in this context "differentiated" does not mean or imply that
the cell is fully differentiated and has lost pluropotentiality or
capacity to further progress along the developmental pathway or
along other developmental pathways. Differentiation may be
accompanied by cell division.
[0063] A "progenitor cell" is a cell which is capable of
differentiating along one or a plurality of developmental pathways,
with or without self-renewal. Typically, progenitor cells are
unipotent or oligopotent and are capable of at least limited
self-renewal.
[0064] As will be well understood in the art, the stage or state of
differentiation of a cell may be characterized by the expression
and/or non-expression of one of a plurality of markers. In this
context, by "markers" is meant nucleic acids or proteins that are
encoded by the genome of a cell, cell population, lineage,
compartment or subset, whose expression or pattern of expression
changes throughout development. Nucleic acid marker expression may
be detected or measured by any technique known in the art including
nucleic acid sequence amplification (e.g. polymerase chain
reaction) and nucleic acid hybridization (e.g. microarrays,
Northern hybridization, in situ hybridization), although without
limitation thereto. Protein marker expression may be detected or
measured by any technique known in the art including flow
cytometry, immunohistochemistry, immunoblotting, protein arrays,
protein profiling (e.g 2D gel electrophoresis), although without
limitation thereto.
[0065] One aspect of the invention provides a method of producing
nephron progenitor cells and ureteric epithelial progenitor cells
including the step of contacting intermediate mesoderm (IM) cells
with: BMP7; retinoic acid (RA); RA antagonist; a Wnt agonist;
fibroblast growth factor 9 (FGF9) and/or FGF20; and heparin; to
thereby produce nephron progenitor cells and ureteric epithelial
progenitor cells from the IM cells.
[0066] Reference herein to "retinoic acid" or "RA" includes all
forms of retinoic acid (e.g including all trans RA and 9-cis RA),
analogs and/or retinoic acid receptor (RAR) agonists that have a
similar biological activity to RA. Various different RA analogs and
RAR agonists (including agonists non-selective and selective for
RAR.alpha., .beta. or .gamma.) are commercially available such as
from R & D Systems and Tocris Bioscience.
[0067] Specific reference to an "RA antagonist" includes retinoic
acid receptor (RAR) antagonists and any other molecule(s) that
inhibit, block or prevent RA signalling via the RAR. Non-limiting
examples of RAR antagonists include AGN193109, LE 135, ER 50891,
BMS 493, BMS 453 and MM 11253, although without limitation thereto.
This definition does not exclude the possibility that the RA
antagonist also or alternatively mimics a block in signalling via
RAR from binding of another ligand.
[0068] As used herein a "Wnt agonist" is a molecule that inhibits
GSK3 (e.g GSK3-.beta.) in the context of the canonical Wnt
signalling pathway, but preferably not in the context of other
non-canonical, Wnt signalling pathways. Non-limiting examples of
Wnt agonists include CHIR99021, LiCl SB-216763, CAS 853220-52-7 and
other Wnt agonists that are commercially available from sources
such as Santa Cruz Biotechnology and R & D Systems. This
definition should not be read as absolutely excluding the
possibility that the Wnt agonist mimics one or more other
inhibitors of GSK3.beta. activity.
[0069] It will also be appreciated that fibroblast growth factors
such as FGF2, FGF 9 and FGF20 may be interchangeable, although FGF9
is preferred. Heparin is typically included to promote or enhance
the biological activity of fibroblast growth factors such as FGF2,
FGF9 and/or FGF20.
[0070] The preferred concentrations of each of FGF9, BMP7, retinoic
acid (RA); RA antagonist; Wnt agonist; FGF20 and heparin will be
described in more detail hereinafter. Reference will also be made
to controlling or manipulating the presence or absence of certain
molecules such as RA agonist or analog, RA antagonist and/or Wnt
agonist to preferentially promote the production of nephron
progenitor cells versus ureteric epithelial progenitors, or vice
versa.
[0071] As used herein "nephron progenitor cells" are progenitor
cells derived from metanephric mesenchyme that can differentiate
into all nephron segments (other than collecting duct) via an
initial mesenchyme to epithelial transition, which include nephron
epithelia such as connecting segment, distal convoluted tubule
(DCT) cells, distal straight tubule (DST) cells, proximal straight
tubule (PST) segments 1 and 2, PST cells, podocytes, glomerular
endothelial cells, ascending Loop of Henle and/or descending Loop
of Henle, although without limitation thereto. Nephron progenitor
cells are also capable of self-renewal.
[0072] Non-limiting examples of markers characteristic or
representative of metanephric mesenchyme include WT1, SIX1, SIX2,
SALL1, GDNF and/or HOXD11, although without limitation thereto.
Non-limiting examples of markers characteristic or representative
of nephron progenitor cells include WT1, SIX1, SIX2, CITED1, PAX2,
GDNF, SALL1, OSR1 and HOXD11, although without limitation
thereto.
[0073] By "ureteric epithelial progenitor cell" is meant an
epithelial progenitor cell derived, obtainable or originating from
mesonephric duct or its derivative ureteric bud that can develop
into kidney tissues and/or structures such as the collecting
duct.
[0074] Non-limiting examples of characteristic or representative
markers of ureteric epithelial progenitor cells include HOXB7,
cRET, GATA3, CALB1, E-CADHERIN and PAX2, although without
limitation thereto.
[0075] As hereinbefore described, the nephron progenitor cells and
ureteric epithelial progenitor cells are differentiated from
intermediate mesoderm (IM) cells is the presence of FGF9 alone or
in combination with one or more agents that include BMP7, retinoic
acid (RA), agonist or analog, an RA antagonist such as AGN193109
and/or FGF20 and preferably heparin.
[0076] By "intermediate mesoderm (IM)" cells is meant embryonic
mesodermal cells that arise from definitive mesoderm which in turn
is derived from posterior primitive streak and can ultimately
develop into the urogenital system, inclusive of the ureter and
kidney and other tissues such as gonad. Non-limiting examples of
markers characteristic or representative of intermediate mesoderm
include PAX 2, OSR1 and/or LHX1.
[0077] It will also be appreciated that production of IM cells is
not meant to imply that the IM cells are a pure or homogeneous
population of IM cells without other cell types being present (such
as definitive mesoderm). Accordingly, reference to "IM cells" or a
"population of IM cells" means that the cells or cell population
comprise(s) IM cells.
[0078] Suitably, according to the invention IM cells are produced
by contacting posterior primitive streak cells with one or more
agents that facilitate differentiation of the posterior primitive
streak cells into IM cells, as will be described in more detail
hereinafter.
[0079] Preferably, the IM cells are produced by contacting
posterior primitive streak cells with one or more agents that
facilitate differentiation of the posterior primitive streak cells
into IM cells
[0080] Typically, the one or more agents include fibroblast growth
factor 9 (FGF9) and, optionally, an RA antagonist such as AGN193109
and/or one or more other FGFs such as FGF 2 and/or FGF20.
[0081] By "posterior primitive streak (PPS)" cells is meant cells
obtainable from, or cells functionally and/or phenotypically
corresponding to, cells of the posterior end of a primitive streak
structure that forms in the blastula during the early stages of
mammalian embryonic development. The posterior primitive streak
establishes bilateral symmetry, determines the site of gastrulation
and initiates germ layer formation. Typically, posterior primitive
streak is the progenitor of mesoderm (i.e presumptive mesoderm) and
anterior primitive streak is the progenitor of endoderm (i.e
presumptive endoderm). Non-limiting examples of markers
characteristic or representative of posterior primitive streak
include Brachyury (T). A non-limiting example of a marker
characteristic or representative of anterior primitive streak is
SOX17. MIXL1 may be expressed by both posterior and anterior
primitive streak.
[0082] It will also be appreciated that production of posterior
primitive streak cells is not meant to imply that the posterior
primitive streak cells are a pure or homogeneous population of
posterior primitive streak cells without other cell types being
present. Accordingly, reference to "posterior primitive streak
cells" or a "population of posterior primitive streak cells" means
that the cells or cell population comprise(s) posterior primitive
streak cells.
[0083] Suitably, according to the invention posterior primitive
streak cells are produced by contacting hPSC cells with one or more
agents that facilitate differentiation of the hPSC cells into
posterior primitive streak cells, as will be described in more
detail hereinafter.
[0084] Typically, the one or more agents include bone morphogenic
protein 4 (BMP4), Activin A and/or a Wnt agonist such as
CHIR99021.
[0085] The terms "human pluripotent stem cell" and "hPSC" refer to
cells derived, obtainable or originating from human tissue that
display pluripotency. The hPSC may be a human embryonic stem cell
or a human induced pluripotent stem cell.
[0086] Human pluripotent stem cells may be derived from inner cell
mass or reprogrammed using Yamanaka factors from many fetal or
adult somatic cell types. The generation of hPSCs may be possible
using somatic cell nuclear transfer.
[0087] The terms "human embryonic stem cell", "hES cell" and "hESC"
refer to cells derived, obtainable or originating from human
embryos or blastocysts, which are self-renewing and pluri- or
toti-potent, having the ability to yield all of the cell types
present in a mature animal. Human embryonic stem cells (hESCs) can
be isolated, for example, from human blastocysts obtained from
human in vivo preimplantation embryos, in vitro fertilized embryos,
or one-cell human embryos expanded to the blastocyst stage.
[0088] The terms "induced pluripotent stem cell" and "iPSC" refer
to cells derivable, obtainable or originating from human adult
somatic cells of any type reprogrammed to a pluripotent state
through the expression of exogenous genes, such as transcription
factors, including a preferred combination of OCT4, SOX2, KLF4 and
c-MYC. hiPSC show levels of pluripotency equivalent to hESC but can
be derived from a patient for autologous therapy with or without
concurrent gene correction prior to differentiation and cell
delivery.
[0089] More generally, the method disclosed herein could be applied
to any pluripotent stem cell derived from any patient or a hPSC
subsequently modified to generate a mutant model using gene-editing
or a mutant hPSC corrected using gene-editing. Gene-editing could
be by way of CRISPR, TALEN or ZF nuclease technologies.
[0090] It will be appreciated from the foregoing, that a preferred
broad form the invention provides a method that includes the
sequential steps of: [0091] (i) contacting hPSCs with one or more
agents that facilitate differentiation of the hPSCs into posterior
primitive streak cells; [0092] (ii) contacting posterior primitive
streak cells with one or more agents that facilitate
differentiation of the posterior primitive streak cells into
intermediate mesoderm cells; and [0093] (iii) contacting
intermediate mesoderm cells with FGF9 and, optionally, one or more
of: BMP7; retinoic acid; an RA antagonist such as AGN193109; a Wnt
agonist such as CHIR99021; FGF20; and heparin; to thereby produce
metanephric mesenchyme cells and ureteric epithelial progenitor
cells from the intermediate mesoderm cells.
[0094] These sequential steps will be described hereinafter as
follows.
(i) Differentiating hPSCs into Posterior Primitive Streak
[0095] As will be appreciated from the foregoing, hPSCs are
contacted with BMP4, Activin A and/or CHIR99021 in a suitable
culture medium in the absence of serum, such as APEL
differentiation medium (Ng et al., 2008, Nat. Protoc. 3: 768),
although without limitation thereto, to thereby produce posterior
primitive streak cells that suitably comprise posterior primitive
streak cells. The hPSCs may be hESCs or iPSCs.
[0096] Suitably, BMP4 is at a concentration of about 5-40 ng/mL and
Activin A is at a concentration of about 3-40 ng/mL. In one
embodiment the concentration of BMP4 is about 20-35 ng/mL, or more
preferably about 30 ng/mL. In one embodiment, the concentration of
Activin A is about 5-30 ng/mL or more preferably 10 ng/mL.
Suitably, an optimal relative activity ratio is in the range of 3:1
to 1:6 BMP4 to Activin A. Preferably, an optimal relative activity
ratio is in the range of 3:1 to 1:1 BMP4 to Activin A.
[0097] In some embodiments, a Wnt agonist such as CHIR99021 may be
at a concentration in the range of about 0.5 to 50 .mu.M,
preferably about 4-30 .mu.M, more preferably about 5-20 .mu.M or
advantageously about 8 .mu.M. In certain embodiments, CHIR99021 is
present alone, in the absence of BMP4 and Activin A.
[0098] The population of stem cells may be cultured in the medium
with BMP4, Activin A and/or a Wnt agonist such as CHIR99021 for
36-120 hours.
[0099] In some non-limiting embodiments, cells may be contacted for
longer periods with BMP4, Activin A and/or CHIR99021 than is
required for hESCs. By way of example, cells such as iPSCs may be
contacted with BMP4, Activin A and/or CHIR99021 for up to 96-120
hrs.
[0100] The culture medium may be changed every 24-48 hrs.
[0101] Although not wishing to be bound by theory, contacting hPSCs
with BMP4, Activin A and/or a Wnt agonist such as CHIR99021 as
disclosed herein results in formation of primitive streak (PS)
including posterior primitive streak. This is an initial step
towards the generation of mesodermal and endodermal tissue.
Typically, differentiation of hPSCs is toward a mixed population of
cells that comprises cells expressing markers characteristic of
posterior primitive streak (i.e. presumptive mesoderm) and cells
expressing markers characteristic of anterior primitive streak
(i.e. presumptive endoderm).
[0102] Non-limiting examples of markers characteristic of posterior
primitive streak (presumptive mesoderm) include Brachyury (T).
[0103] A non-limiting example of a marker characteristic of
anterior primitive streak (presumptive endoderm) is SOX17.
(ii) Differentiation of Posterior Primitive Streak Cells into
Intermediate Mesoderm (IM)
[0104] Suitably, posterior primitive streak cells, or a mixed
primitive streak population comprising posterior primitive streak
cells, are contacted with one or more fibroblast growth factors
(FGFs) that at least includes FGF9 and, optionally, FGF2 and/or
FGF20 and/or a retinoic acid (RA) antagonist in a suitable culture
medium in the absence of serum, such as APEL differentiation
medium.
[0105] Typically, the retinoic acid signalling antagonist is a
retinoic acid receptor (RAR) inhibitor or antagonist such as
AGN193109.
[0106] Suitably, FGF2, FGF9 and/or FGF20 are at a concentration of
about 100 to 400 ng/mL. In a preferred embodiment, FGF2, FGF9
and/or FGF20 are at a concentration of about 150 to 300 ng/ML or
advantageously about 200 ng/mL. In one embodiment, the
concentration of the RA antagonist (e.g. AGN193109) is about 0.1-10
.mu.M or more preferably 0.5-5 .mu.M.
[0107] The cells are contacted with FGF9, alone or together with
FGF2 and/or FGF20 and/or RA antagonist (e.g. AGN193109) for at
least about 96 hours but not more than about 190-200 hours.
Preferably, the cells are contacted with FGF9 alone or with FGF2
and/or FGF20 and/or RA antagonist (e.g AGN193109) for about 96
hours.
[0108] The culture medium may be changed every 40-48 hrs.
[0109] In one embodiment, contacting the posterior primitive streak
cells (which typically express markers characteristic of posterior
primitive streak (presumptive mesoderm) and anterior primitive
streak (presumptive endoderm)) with FGF9 alone or together with
FGF2 and/or FGF20 results in differentiation of the cells toward a
population of cells expressing markers characteristic of
intermediate mesoderm (IM). Non-limiting examples of markers
characteristic of intermediate mesoderm include PAX2, LHX1 and
OSR1.
(iii) Differentiation of Intermediate Mesoderm (IM) into Nephron
Progenitors and Ureteric Epithelial Progenitors
[0110] Suitably, following contacting posterior primitive streak
cells with FGF2, FGF9 and/or FGF20, resultant IM cells are
contacted with FGF9 alone or in combination with one or more of
BMP7, RA, RA antagonist, FGF20, a Wnt agonist and/or heparin in a
suitable culture medium in the absence of serum, such as APEL
differentiation medium.
[0111] Suitably, FGF9 is at a concentration of about 20 ng to 1
.mu.g/mL. In a preferred embodiment, FGF9 is at a concentration of
about 50-500 ng/mL, more preferably about 100-300 ng/mL or
advantageously about 200 ng/mL.Typically, heparin is included at a
concentration of about 0.1-10 .mu.g/mL, preferably about 0.3-5
.mu.g/mL, 0.5-2 .mu.g/mL or advantageously about 1 .mu.g/mL.
[0112] In an embodiment, FGF20 is at a concentration of about 20 ng
to 1 .mu.g/mL. In a preferred embodiment, FGF20 is at a
concentration of about 50-500 ng/mL, more preferably about 100-300
ng/mL or advantageously about 200 ng/mL.
[0113] In an embodiment, FGF2 is at a concentration of about 20 ng
to 1 .mu.g/mL. In a preferred embodiment, FGF2 is at a
concentration of about 50-500 ng/mL, more preferably about 100-300
ng/mL or advantageously about 200 ng/mL.
[0114] It will be appreciated that FGF20 and FGF2 may replace or
supplement FGF9, as these agents have similar biological
activities.
[0115] In an embodiment, BMP7 is at a concentration of about 25 to
75 ng/mL. In a preferred embodiment, BMP7 is at a concentration of
about 35-60 ng/mL, 45-55 ng/mL or advantageously about 50
ng/mL.
[0116] In an embodiment, RA is at a concentration of about 10 .mu.M
to 1 .mu.M. In a preferred embodiment, RA is at a concentration of
about 30 .mu.M to 0.5 .mu.M, more preferably about 50 .mu.M to 0.2
.mu.M or advantageously about 0.1 .mu.M. Although not binding on
the present invention, preliminary data suggest that higher
concentrations of RA promote a relative increase in the proportion
of ureteric epithelial progenitor cells and that lower
concentrations of RA promote a relative decrease in the proportion
of ureteric epithelial progenitor cells.
[0117] In an embodiment, an RA antagonist such as AGN193109 is at a
concentration of about 50 .mu.M to 10 .mu.M. In a preferred
embodiment, AGN193109 is at a concentration of about 0.01 .mu.M to
5 .mu.M, more preferably about 0.1 .mu.M to 5 .mu.M or
advantageously about 1 .mu.M. Although not binding on the present
invention, preliminary data suggest that higher concentrations of
AGN193109 promote a relative increase in the proportion of
metanephric mesenchyme cells.
[0118] In an embodiment, a Wnt agonist such as CHIR99021 is present
at a concentration in the range of about 0.1 .mu.M to 10 .mu.M,
preferably about 0.2 .mu.M to 5 .mu.M or more preferably at about
1-2 .mu.M.
[0119] Although not binding on the present invention, the Wnt
agonist promotes a relative increase in the production of nephron
progenitor cells from the IM cells. Preferably, cells are contacted
with FGF9 alone or together with one or more of BMP7, RA, Wnt
agonist, RA antagonist and/or FGF20 and/or FGF2 plus heparin for at
least 72 hours but not more than 360 hours. Preferably, the cells
are contacted for about 160-220 hrs or more preferably for about
190-200 hours.
[0120] The culture medium may be changed every 48-72 hrs.
Typically, contacting intermediate mesoderm cells with FGF9 alone
or together with one or more of BMP7, RA, an RA antagonist; a Wnt
agonist and/or FGF20 and/or FGF2 and preferably heparin, as
disclosed herein, differentiates the intermediate mesoderm cells
into cells of metanephric mesenchyme and ureteric epithelium cell
lineages. The metanephric mesenchyme lineage includes nephron
progenitor cells that are optimally produced after about 72 hrs of
culture in FGF9 and heparin. It is also proposed that the presence,
absence and/or concentration of RA analog or agonist and/or RA
antagonist may be chosen to manipulate the relative amount of
ureteric epithelium that is produced by the method, compared to
metanephric mesenchyme that is produced by the method. As described
previously, RA promotes the formation of ureteric epithelium at the
expense of metanephric mesenchyme, whereas an RA antagonist such as
AGN193109 promotes the formation of metanephric mesenchyme at the
expense of ureteric epithelium. A Wnt agonist such as CHIR99021 may
also promotes the survival and/or formation of metanephric
mesenchyme at the expense of ureteric epithelium.
[0121] Non-limiting examples of markers characteristic or
representative of cells of the metanephric mesenchyme lineage or
cells thereof include WT1, SIX1, SIX2, SALL1, GDNF and/or HOXD11,
although without limitation thereto.
[0122] Non-limiting examples of markers characteristic or
representative of nephron progenitor cells include WT1, SIX2,
CITED1, PAX2, GDNF, SALL1 and HOXD11, although without limitation
thereto.
[0123] Non-limiting examples of markers characteristic or
representative of cells of the ureteric epithelial lineage include
HOXB7, GATA3, CALB1, E-CADHERIN, PAX2 and/or cRET, although without
limitation thereto.
[0124] Nephron progenitor cells are likely to be maximally
generated 11-15 days, or advantageously 14 days (range of day 11 to
15) after commencement of the method from the start of hPSC cell
culture, based upon the co-expression of WT1, SIX2, CITED1, PAX2,
GDNF, SALL1 and HOXD11.
[0125] Ureteric epithelial progenitor cells may be maximally
generated after at least 10 days, or advantageously 14 days after
commencement of the method from the start of hPSC culture, based
upon the co-expression of HOXB7, cRET, E-CADHERIN and PAX2.
[0126] In a preferred form of the method, FGF9 is present for at
least part of, or entirely throughout, both steps (ii) and (iii)
described herein. More preferably, a Wnt agonist such as CHIR99021
is present for at least part of step (i) described herein.
[0127] A particularly preferred method therefor includes the
sequential steps of: [0128] (a) contacting human pluripotent stem
(hPCS) cells with CHIR99021 to facilitate differentiation of the
hPSC cells into posterior primitive streak cells; [0129] (b)
contacting the posterior primitive streak cells with FGF9, alone or
together with an RA antagonist such as AGN193109, to facilitate
differentiation of the posterior primitive streak cells into IM
cells; and [0130] (c) contacting the IM cells with FGF9 and
heparin, alone or together with an RA antagonist such as AGN193109,
to thereby produce nephron progenitor cells and ureteric epithelial
progenitor cells from the IM cells.
[0131] According to this preferred form, it is possible to
facilitate kidney differentiation from an initial population of hES
cells in a total culture period of about 18-20 days.
[0132] Rapid Generation of Renal Organoids from hPSCs
[0133] A related aspect of the invention provides a method of
producing definitive mesoderm cells, said method including the
steps of contacting hPSCs with a Wnt agonist for a more prolonged
period (optimally 3-5 days). Suitably, the method of this aspect
produces a mesoderm cell population that comprises one or more of
definitive mesoderm cells and IM cells, which may include both
rostral and caudal IM. Typically, the longer the duration of
culture with Wnt agonist, the more caudal IM arises and the less
rostral IM persists.
[0134] In one embodiment, the method further includes the
subsequent step of contacting the mesoderm cells with fibroblast
growth factor 9 (FGF9) and/or fibroblast growth factor 20 (FGF20)
and/or fibroblast growth factor 2 (FGF2).
[0135] Suitably, this step facilitates the differentiation of
caudal and rostral IM. Suitably, the caudal and rostral IM will in
turn differentiate to nephron progenitor cells and ureteric
epithelial cells respectively. As previously described, inclusion
of RA or an analog or agonist may increase the relative production
of ureteric epithelial progenitor cells.
[0136] In another embodiment, after contacting the intermediate
mesoderm (IM) cells with fibroblast growth factor 9 (FGF9) and/or
fibroblast growth factor 20 (FGF20) and/or fibroblast growth factor
2 (FGF2), the method further includes the subsequent step of
dissociating and reaggregating the cells. This may be performed in
culture on a floating filter at an air-media interface. Suitably,
this step facilitates the formation of renal organoids containing
nephrons, stroma and vasculature.
[0137] In another embodiment, after forming an aggregate for
culture (such as on a floating filter), the method further includes
the subsequent addition of a Wnt agonist for 30-60 minutes.
Suitably, this step facilitates the production of aggregated, renal
organoids with maximal nephrons.
[0138] It will be appreciated that a preferred object of the method
is to produce aggregated, differentiated nephron progenitor cells
and ureteric epithelial progenitor cells that form an organoid or
other at least partly organized, renal structure. Preferably, the
presence of all segments of a normal developing nephron may be
present in the organoid, including collecting duct (phenotypically
GATA3.sup.+ECAD.sup.+), early distal tubule (phenotypically
GATA3.sup.-LTUECAD.sup.+), early proximal tubule (phenotypically
LTL.sup.+ECAD) and glomerulus (phenotypically WT1.sup.+).
suggestive of normal embryonic organogenesis.
[0139] In one embodiment, formation of an aggregate of
differentiated cells for culture as an organoid may be achieved in
about 7 days culture as described above.
[0140] A preferred concentration of a Wnt agonist (e.g CHIR99021)
is about 1-50 mM, preferably about 1-20 .mu.M, 5-15 .mu.M or
advantageously about 8 .mu.M. Preferably, the duration of contact
with the Wnt agonist is about 4 days.
[0141] Suitably, FGF9 is at a concentration of about 20 ng to 1
.mu.g/mL. In a preferred embodiment, FGF9 is at a concentration of
about 50-500 ng/mL, more preferably about 100-300 ng/mL or
advantageously about 200 ng/mL. Preferably, the duration of
subsequent contact with FGF9/FGF20/FGF2 includes heparin for about
3 days.
[0142] Preferably, the subsequent addition of a short pulse of a
Wnt agonist such as CHIR99021 is immediately upon reaggregation
following culture in FGF9/FGF20/FGF2 plus heparin. A preferred
concentration of a Wnt agonist (e.g CHIR99021) is about 1-15 .mu.M,
preferably about 2-10 .mu.M or advantageously about 5 .mu.M. The
short pulse is typically between 0.5 and 2 hr, such as about 45
minutes or 1 hr.
[0143] The formation of aggregated, at least partly organized
structures such as renal organoids may be assisted by maintaining
or facilitating physical contact between the cultured cells. In
this regard, pelleting of the cells prior to addition of the "short
pulse" of Wnt agonist (e.g CHIR99021) may assist organoid
formation.
[0144] Optionally, cultures may further include one or more of: a
retinoic acid (RA) antagonist, RA or RA agonist, bone morphogenic
protein 7 (BMP7) and/or heparin. The respective concentrations and
effects of retinoic acid (RA) antagonist, RA agonist, bone
morphogenic protein 7 (BMP7); and/or heparin may be as hereinbefore
described.
[0145] Inducing Vascularization
[0146] Suitably, at least partial vascularization and/or the
presence of vascular progenitor cells in the renal organoids or
aggregates is facilitated by conditions that promote or direct
development of vascular endothelium or vascular progenitors from
mesenchyme cells or tissues.
[0147] Suitably, aggregates of differentiated cells and/or
organoids produced according to the aforementioned aspects may be
cultured under conditions that facilitate at least partial
vascularization, particularly vascularization of glomerular
structures, or at least the production of progenitors of vascular
endothelium or other vascular cells or tissues. In some
embodiments, vascularization is facilitated by conditions that
promote or direct development of vascular endothelium form
mesenchyme cells or tissues.
[0148] In one embodiment, the method may include co-culturing
vascular endothelial progenitors (such as differentiated from human
pluripotent stem cells) together with IM cells as described above,
or added to cultures of at least partly differentiated nephron
progenitor cells and ureteric epithelial progenitor cells, to
thereby produce vascular cells or tissues such as vascular
endothelium.
[0149] In another embodiment, the method may include reduced oxygen
tension during culture. Typically, 21% O.sub.2 is the usual oxygen
tension present in a standard tissue culture incubator. The
invention contemplates to 5 to 12% O.sub.2, which may be more
equivalent to the oxygen tension experienced in the developing
embryo. This may improve the capacity of the metanephric mesenchyme
to generate VEGFA and thereby induce the formation and migration of
Flk1.sup.+ vascular endothelial progenitors.
[0150] In light of the foregoing, reference to protein agents such
as BMP4, BMP7, Activin A, FGF2, FGF9 and FGF20 should be understood
as encompassing native or recombinant or chemical synthetic
proteins of any mammalian origin, inclusive of human, mouse and
rat, although without limitation thereto. Furthermore, these
proteins may include chemical modifications, glycosylation,
lipidation, labels such as biotin and additional amino acid
sequences such as epitope tags or fusion partners as are well known
in the art. Typically, the aforementioned proteins may be obtained
commercially and/or prepared as recombinant or chemical synthetic
proteins by routine laboratory or manufacturing procedures.
[0151] In another aspect, the invention provides isolated or
purified nephron progenitor cells, ureteric epithelial progenitor
cells and/or renal organoids produced according to the methods
disclosed herein.
[0152] Preferably, the renal organoid comprises segmented nephrons
surrounded by endothelia and renal interstitium.
[0153] In a particular embodiment, the nephrons are segmented into
four (4) or more components, including collecting duct
(phenotypically GATA3.sup.+ECAD.sup.+), early distal tubule
(phenotypically GATA3.sup.-LTLECAD.sup.+), early proximal tubule
(phenotypically LTL.sup.+ECAD.sup.-) and glomerulus (phenotypically
WT1.sup.+). Suitably, collecting duct trees are formed at the
bottom of the organoid, connecting to distal and proximal tubules
in the middle, with glomeruli at the top of the organoid.
[0154] It will be appreciated that nephron progenitor cells and/or
ureteric epithelial progenitor cells may be obtained after an
appropriate period of culture as hereinbefore described and in some
optional embodiments may be further enriched or purified according
to co-expression of surface markers. Cell enrichment or
purification may be by any technique or process known in the art
inclusive of flow cytometric cell sorting (e.g. FACS), positive or
negative cell selection by magnetic immunobeads (e.g
Dynabeads.TM.), panning, density separation, complement mediated
lysis or the like, although without limitation thereto.
[0155] Kidney Regeneration and Transplantation
[0156] Chronic kidney disease is a serious medical condition that
affects 31 million Americans and 1.7 million Australians each year.
Patients can lose 90% of their kidney function before they become
symptomatic, resulting in kidney failure and dialysis or a kidney
transplant. Medicare expenditure in the U.S. for end-stage renal
disease was estimated at $28 billion in 2010.
[0157] Accordingly, an aspect of the invention provides a method of
producing a kidney, or kidney cells or tissues, said method
including the step of differentiating the kidney, or the kidney
cells or tissues from the isolated or purified nephron and/or
ureteric epithelial progenitor cells to thereby produce the kidney,
or kidney cells or tissues. Furthermore, this aspect of the
invention provides at least partial vascularization and/or the
generation of vascular progenitor cells under conditions that
promote or direct development of vascular endothelium or vascular
progenitors from mesenchyme cells or tissues.
[0158] The invention provides a method for producing cells of the
ureteric epithelium and metanephric mesenchyme lineages or
compartments. Preferably, these cells are simultaneously induced
and direct the differentiation of each other in vivo. These cells
are capable of developing into distinct tubular epithelial
structures, including ureteric tree and nephron progenitor
mesenchyme. It is therefore proposed that the hPSC cell-derived
ureteric epithelium and/or nephron progenitor cells produced
according to the invention may be directed to differentiate into
renal cells from both the ureteric and mesenteric mesenchymal
compartments. Under appropriate conditions, the nephron progenitor
cells may be capable of differentiating into any nephron segment
(other than collecting duct) including nephron epithelia such as
connecting segment, distal convoluted tubule (DCT) cells, distal
straight tubule (DST) cells, proximal straight tubule (PST)
segments 1 and 2, PST cells, podocytes, glomerular endothelial
cells, ascending loop of Henle and/or descending loop of Henle,
although without limitation thereto.
[0159] Furthermore, the capacity of these cells to `self-organise`
may therefore be exploited to facilitate kidney repair, such as by
way of kidney tissue or organ bioengineering.
[0160] It will be appreciated that one embodiment of the method of
this aspect may include adoptively transferring or transplanting
the isolated or purified nephron and/or ureteric epithelial
progenitor cells into a human to thereby produce the kidney, or
kidney cells or tissues.
[0161] According to this embodiment, differentiation of the
isolated or purified nephron and/or ureteric epithelial progenitor
cells into the kidney or kidney cells or tissues occurs in vivo
[0162] Another embodiment of the method of this aspect may include
at least partly differentiating the isolated or purified nephron
and/or ureteric epithelial progenitor cells in vitro into kidney,
or kidney cells or tissues, or progenitors of these. Suitably, the
at least partly in vitro differentiated cells kidney, or kidney
cells or tissues, or progenitors thereof, are adoptively
transferred or transplanted into a human.
[0163] According to either or both embodiments, the kidney, kidney
cells or tissues may facilitate or contribute to regeneration or
repair of the kidney, cells or tissues thereof.
[0164] One embodiment provides use of an organoid, orisolated
nephron progenitors and/or ureteric epithelial progenitors obtained
therefrom, to produce an engineered or artificial kidney. For
example, isolated nephron progenitors and/or ureteric epithelial
progenitors may be incorporated within a scaffold, such as a
decellularised human kidney or extracellular matrix (ECM) component
thereof, polyester fleece or biodegradable polymer scaffold, to
thereby produce a regenerated renal tubule structure. By way of
example, such methods may include one or more of: (a) isolating one
or more differentiated cell types and/or or intermediate progenitor
cell types from the organoids; and (b) delivering the one or more
differentiated cell types and/or or intermediate progenitor cell
types into a decellularised kidney scaffold. In some embodiments
the ECM from a kidney scaffold may be used as a matrix (e.g
generated from the ECM alone or in association with a hydrogel) in
which to seed or bioprint the one or more differentiated cell types
and/or or intermediate progenitor cell types to thereby
recellularize the kidney scaffold or matrix.
[0165] Another embodiment may relate to repairing a damaged or
diseased kidney.
[0166] By way of example, the method may include one or more of (i)
isolating one or more differentiated cell types and/or or
intermediate progenitor cell types from the organoids; (ii)
delivering the one or more differentiated cell types and/or or
intermediate progenitor cell types into a damaged or diseased
kidney to thereby facilitate repair and/or regeneration of the
diseased or damaged kidney. Delivery might by directly into the
damaged or diseased kidney via parenchymal injection or via a
vascular route.
[0167] Another embodiment of the invention provides use of kidney
cells or tissues differentiated from the isolated nephron
progenitors and/or ureteric epithelial progenitors in devices for
assisting or facilitating renal dialysis. For example,
bioartificial kidneys may be made by seeding kidney cells, or their
progenitors into reactors to produce a `renal assistance device`
for use in parallel with dialysis.
[0168] Also contemplated are "bioprinted" kidneys or other
nephron-containing organs, organoids or organ-like structures using
kidney cells or tissues differentiated or otherwise obtained from
the isolated nephron progenitors and/or ureteric epithelial
progenitors described herein.
[0169] Thus one particular aspect of the invention provides a
method of bioprinting a renal structure, said method including
depositing a plurality of hPSCs or other progenitor cells disclosed
herein to form a renal structure having one or more functional
characteristics of a kidney or component thereof, or which is
capable of developing one or more functional characteristics of a
kidney or component thereof
[0170] Suitably, the hPSCs or other progenitor cells are subjected
to a method disclosed herein for producing nephron progenitor cells
and ureteric epithelial progenitor cells in the three-dimensional
structure.
[0171] This particular aspect also provides a bioprinted renal
structure having one or more functional characteristics of a kidney
or component thereof, or which is capable of developing one or more
functional characteristics of a kidney or component thereof,
produced by the aforementioned method.
[0172] Another particular aspect of the invention provides a method
of bioprinting a renal structure, said method including depositing
a plurality of nephron progenitor cells and ureteric epithelial
progenitor cells disclosed herein to form a renal structure having
one or more functional characteristics of a kidney or component
thereof, or which is capable of developing one or more functional
characteristics of a kidney or component thereof.
[0173] Suitably, the nephron progenitor cells and ureteric
epithelial progenitor cells have been produced from hPSCs by a
method disclosed herein. In some embodiments, the method produces a
bioprinted renal structure that has, or is capable of developing,
at least partial vascularization and/or vascular progenitor
cells.
[0174] This particular aspect also provides a bioprinted renal
structure having one or more functional characteristics of a kidney
or component thereof, or which is capable of developing one or more
functional characteristics of a kidney or component thereof,
produced by the aforementioned method. In some embodiments, the
bioprinted renal structure that has, or is capable of developing,
at least partial vascularization and/or vascular progenitor
cells.
[0175] Suitably, the bioprinted renal structure is a
three-dimensional renal structure.
[0176] It will also be appreciated that the three-dimensional
structure may be constructed or formed from a plurality of
bioprinted "layers" or "arrays", as will be described in more
detail hereinafter.
[0177] The bioprinted renal structure component may be, or
comprise, any structural and/or functional component of a kidney,
such as a glomerulus, juxtaglomerular apparatus, interstitial
tissue, collecting ducts, Bowman's capsule, proximal and/or distal
convoluted tubules, vasculature such as arterioles, arteries, veins
and/or capillaries, although without limitation thereto.
[0178] Suitably, the bioprinted renal structure is at least partly
vascularized and/or comprises vascular progenitor cells.
[0179] In some embodiments, the bioprinted kidney or kidney
component may be implantable or otherwise adoptively transferrable
into a host.
[0180] As used herein, "bioprinting" includes and encompasses
utilizing three-dimensional, precise deposition of cells (e.g.,
cell solutions, cell-containing gels, cell suspensions, cell
concentrations, multicellular aggregates, organoids, multicellular
bodies, etc.) via methodology that is compatible with an automated
or semi-automated, computer-aided, three-dimensional prototyping
device (e.g., a bioprinter). In this regard, reference is made to
United States Patent Applications US20120116568, US20130164339 and
US20140012407 which are herein incorporated by reference and
provide non-limiting examples of potentially suitable bioprinting
techniques.
[0181] By way of example, in some embodiments, at least one
component of an engineered, implantable renal organoid tissue
and/or organ may bioprinted. In further embodiments, the
engineered, implantable tissues and/or organs are entirely
bioprinted. In still further embodiments, bioprinted constructs are
made with a method that utilizes a rapid prototyping technology
based on three-dimensional, automated, computer-aided deposition of
renal cells as disclosed herein, including cell solutions, cell
suspensions, cell-comprising gels or pastes, cell concentrations,
multicellular bodies (e.g., cylinders, spheroids, ribbons, etc.),
and confinement material onto a biocompatible surface (e.g.,
composed of hydrogel and/or a porous membrane) by a
three-dimensional delivery device (e.g., a bioprinter). As used
herein, in some embodiments, the term "engineered," refer to renal
tissues and/or organs means that cells, cell solutions, cell
suspensions, cell-comprising gels or pastes, cell concentrates,
multicellular aggregates, and layers thereof are positioned to form
three-dimensional structures by a computer-aided device (e.g., a
bioprinter) according to a computer script. In further embodiments,
the computer script is, for example, one or more computer programs,
computer applications, or computer modules. In still further
embodiments, three-dimensional tissue structures form through the
post-printing fusion of cells or multicellular bodies similar to
self-assembly phenomena in early morphogenesis.
[0182] While a number of methods are available to arrange cells,
multicellular aggregates, and/or layers thereof on a biocompatible
surface to produce a three-dimensional structure including manual
placement, positioning by an automated, computer-aided machine such
as a bioprinter is advantageous. Advantages of delivery of cells or
multicellular bodies with this technology include rapid, accurate,
and reproducible placement of cells or multicellular bodies to
produce constructs exhibiting planned or pre-determined
orientations or patterns of cells, multicellular aggregates and/or
layers thereof with various compositions. Advantages also include
assured high cell density, while minimizing cell damage. In some
embodiments, the method of bioprinting is continuous and/or
substantially continuous. A non-limiting example of a continuous
bioprinting method is to dispense bio-ink from a bioprinter via a
dispense tip (e.g., a syringe, capillary tube, etc.) connected to a
reservoir of bio-ink. In further non-limiting embodiments, a
continuous bioprinting method is to dispense bio-ink in a repeating
pattern of functional units. In various embodiments, a repeating
functional unit has any suitable geometry, including, for example,
circles, squares, rectangles, triangles, polygons, and irregular
geometries. In further embodiments, a repeating pattern of
bioprinted function units comprises a layer or array and a
plurality of layers or arrays are bioprinted adjacently (e.g.,
stacked) to form an engineered tissue or organ. In various
embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or
more layers or arrays are bioprinted adjacently (e.g., stacked) to
form an engineered renal tissue or organ.
[0183] In some embodiments, a bioprinted functional unit repeats in
a tessellated pattern. A "tessellated pattern" is a plane of
figures that fills the plane with no overlaps and no gaps.
Advantages of continuous and/or tessellated bioprinting include, by
way of non-limiting example, increased productivity of bioprinted
tissue. Another non-limiting, exemplary advantage is eliminating
the need to align the bioprinter with previously deposited elements
of bio-ink. Continuous bioprinting also facilitates printing larger
tissues from a large reservoir of bio-ink, optionally using a
syringe mechanism.
[0184] In various embodiments, methods for continuous bioprinting
involve optimizing and/or balancing parameters such as print
height, pump speed, robot speed, or combinations thereof
independently or relative to each other. In one example, the
bioprinter head speed for deposition was 3 mm/s, with a dispense
height of 0.5 mm for the first layer and dispense height was
increased 0.4 mm for each subsequent layer. In some embodiments,
the dispense height is approximately equal to the diameter of the
bioprinter dispense tip. Without limitation a suitable and/or
optimal dispense distance does not result in material flattening or
adhering to the dispensing needle. In various embodiments, the
bioprinter dispense tip has an inner diameter of about, 20, 50,
100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700,
750, 800, 850, 900, 950, 1000 .mu.m, or more, including increments
therein. In various embodiments, the bio-ink reservoir of the
bioprinter has a volume of about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90,
95, 100 cm.sup.3, or more, including increments therein. In some
embodiments, the pump speed is suitable and/or optimal when the
residual pressure build-up in the system is low. In some
embodiments, favourable pump speeds depend on the ratio between the
cross-sectional areas of the reservoir and dispense needle with
larger ratios requiring lower pump speeds. In some embodiments, a
suitable and/or optimal print speed enables the deposition of a
uniform line without affecting the mechanical integrity of the
material.
[0185] By way of example only, Organovo partnered with Invetech
have developed an organ printing machine which uses a hydrogel
scaffold to place human cells in a desired orientation to recreate
human organs. Kidney cells or tissues differentiated or otherwise
obtained from the isolated nephron progenitors and/or ureteric
epithelial progenitors described herein may be used with machines,
such as the Organovo machine referred to above, to develop a
"bioprinted" human kidney organoid or kidney.
[0186] Another aspect of the invention provides an array of nephron
progenitors and ureteric progenitors having a planar geometry. The
array may comprise a plurality of stacked arrays, preferably 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 or more stacked
arrays.
[0187] The arrays may stacked in a tessellated pattern.
[0188] A related aspect of the invention provides kidney organoid
obtained by maturing the array of the aforementioned aspect
[0189] Suitably, the renal organoids are at least partially
vascularized and/or comprise vascular progenitors.
[0190] It will also be appreciated that the directed
differentiation of isolated nephron progenitors and/or ureteric
epithelial progenitors, organoids and bioprinted renal structures
described herein may be potential sources of purified,
differentiated renal cell subtypes, organoids and/or bioprinted
renal structures for cellular therapy.
[0191] For example, the isolated nephron progenitors and/or
ureteric epithelial progenitors described herein may be useful for
generating renal cells or tissues after gene correction in certain
genetically-inherited renal conditions. For example, correction of
single gene renal disorders, including Alport syndrome (COL4A3
mutation) and the polycystic kidney diseases (PKD1, PKD2 and
others), may be assisted or facilitated by regeneration of renal
tissue from the isolated nephron progenitors and/or ureteric
epithelial progenitors described herein after gene correction.
[0192] In a particular embodiment, iPSC lines derived, obtained or
originating from a patient with genetic renal disease may be used
for repair of genetic mutation(s) in vitro. Such cells could be
used according to the method of the invention and then administered
to the patent for autologous cellular therapy.
Nephrotoxicity Screening
[0193] It will also be appreciated that the directed
differentiation of isolated nephron progenitors and/or ureteric
epithelial progenitors described herein may provide potential
sources of purified, differentiated renal cells, bioprinted renal
structures, renal organoids, arrays or renal tissue subtypes for
nephrotoxicity screening.
[0194] The development of interventions aimed at preventing
disease, including drug and cellular-based therapies, is made
difficult by the lack of availability of primary human kidney cells
for in vitro drug testing.
[0195] Accordingly, another aspect of the invention provides a
method of determining the nephrotoxicity of one or a plurality of
compounds, said method including the step of contacting the one or
plurality of compounds with the nephron progenitor cells and/or
ureteric epithelial progenitor cells described herein, either as an
organoid or after isolation and purification, or kidney cells or
tissues differentiated or otherwise obtained therefrom, to thereby
determine whether or not the one or plurality of compounds is
nephrotoxic.
[0196] Preferably, the method is performed using organoids or from
isolated or purified nephron progenitor cells, or kidney cells or
tissues derived from the nephron progenitor cells.
[0197] Many useful drugs have nephrotoxic side effects, such as by
direct tubular effects (e.g aminoglycoside antibiotics, cisplatin,
radiocontrast media, NSAIDs, ACE inhibitors), interstitial
nephritis (e.g p lactam antibiotics, lithium, CsA, anti-epileptic
drugs such as phenytoin) or glomerulonephritis, for example. It may
therefore be advantageous to test new or existing drugs using
defined, specific kidney cells and tissue types differentiated or
otherwise obtained from the isolated or purified nephron progenitor
cells described herein. The hereinbefore described "bioprinted"
kidney or bioprinted kidney organoid may also be applicable to
nephrotoxicity screening.
[0198] Nephrotoxicity may be assessed or measured by any
appropriate test for renal cell function in vitro, including
decreased creatinine clearance or biomarker expression such as by
the Human Nephrotoxicity RT.sup.2 Profiler.TM. PCR Array from
Qiagen or the High Content Analysis (HCA) Multiplexed
Nephrotoxicity Assay from Eurofins, although without limitation
thereto.
[0199] As described in more detail in the Examples, cisplatin is a
nephrotoxicant that induces caspase-mediated acute apoptosis of
proximal tubular cells in the kidney cisplatin treatment of renal
organoids induced specific acute apoptosis in mature proximal
tubular cells, whereas immature cells did not undergo
apoptosis.
[0200] So that the invention may be readily understood and put into
practical effect, reference is made to the following non-limiting
Examples.
EXAMPLES
[0201] Work leading to the present invention identified specific in
vitro culture conditions that are tailored to promote the
synchronous, simultaneous differentiation of nephron progenitor
cells and ureteric epithelial progenitor from intermediate mesoderm
(IM). More specifically, FGF9 plus heparin alone, or in combination
with one or more agents including bone morphogenic protein 7
(BMP7), retinoic acid (RA), an RA antagonist; a Wnt agonist; and/or
FGF20 plus heparin, is capable of facilitating differentiation of
intermediate mesoderm into nephron progenitor cells and ureteric
epithelial progenitors. Further to this, the in vitro culture
method provides a system for differentiating hPSCs through
posterior primitive streak, IM and metanephric mesenchymal stages
to produce nephron progenitor cells and ureteric epithelial
progenitor cells. The presence or absence of certain molecules such
as RA, RA antagonist and/or Wnt agonist could be manipulated to
preferentially promote the production of nephron progenitor cells
versus ureteric epithelial progenitors, or vice versa. The
posterior PS is the progenitor population for the mesoderm such as
the IM, and is induced from hPSCs using a Wnt agonist (e.g
CHIR99021). The IM differentiates to two key kidney progenitor
populations: the ureteric epithelium (UE), the progenitor of
collecting ducts; the metanehpric mesenchyme (MM), the progenitor
of nephrons. While the anterior IM gives rise to UE, the posterior
IM develops to the MM. Here, we present a method to induce both the
anterior and posterior IM at the same time by the carefully
determined period of using CHIR99021. This simultaneous induction
leads the successful generation of kidney organoids containing all
anticipated renal components including nephrons, interstitia and
endothelia. We also propose that the addition of an inhibitor of RA
signalling, such as the synthetic potent pan-retinoic acid receptor
(RAR) antagonist AGN 193109, would promote metanephric mesenchyme
formation.
Example 1
Materials and Methods
[0202] Non-limiting examples of sources of reagents referred to in
these methods are provided in Table 1.
[0203] Media are as follows: [0204] Gelatin solution: 0.1% gelatin
in PBS. Then the solution is autoclaved. [0205] FDMEM: 89% DMEM
high glucose, 10% Foetal Bovine Serum, 1% GlutaMAX Supplement, 0.5%
Penicillin/Streptomycin. [0206] KSR medium: 77.8% DMEM/F-12, 20%
Knockout Serum Replacement, 1% NEAA, 1% GlutaMAX, 0.5%
Penicillin/Streptomycin, 0.2% 2-Mercaptoethanol (55 mM). Then
medium is filtered by Stericup-GP. [0207] MEF-conditioned KSR
medium: Feed 40 mL of KSR medium to 10 million Mouse embryonic
fibroblast cells in T175 flask for a day. Collect the medium next
day and feed another 40 mL of KSR medium. After repeating this 6
times, collected and pooled medium is filtered by Stericup-GP.
[0208] APEL: Supplement a bottle of STEMdiff APEL (100 mL) with 0.5
mL of Antibiotic-Antimycotic.
[0209] Reference is also made to International Publication
WO2014/197934 and Takasato, M. et al., 2014,. Nat. Cell Biol. 16,
118-26 for additional reagents, methods, PCR primers and the like,
the entirety of which documents are incorporated herein by
reference.
Seed Feeders (Day-8)
[0210] Coat a 25 cm.sup.2 tissue culture flask with 3 mL of 0.1%
gelatin solution. Thaw frozen vial of mitotically inactivated mouse
embryonic fibroblasts (MEFs) by warming vial at 37.degree. C. until
a small ice pellet remains. Add warmed 5 mL FDMEM media in a drop
wise manner to vial and gently mix. Collect into 15 mL tube and
centrifuge at 1,500 rpm for 3 minutes.
[0211] Remove supernatant and resuspend MEFs in FDMEM. Seed onto
flask at 12,000 cells per cm.sup.2 in FDMEM and incubate overnight
in a 37.degree. C. CO.sub.2 incubator.
Thaw hESC/iPSC (Day-7)
[0212] Thaw frozen vial of iPSC/hESC onto the prepared 25 cm.sup.2
tissue culture flask containing mitotically inactivated MEFs by
warming vial at 37.degree. C. until a small ice pellet remains. Add
warmed 5 mL KSR media (see appendix A) in drop wise manner to vial
and gently mix. Collect into 15 mL tube and centrifuge at 1,500 rpm
for 3 minutes. Prepare 5 mL KSR media per 25 cm.sup.2 tissue
culture flask. Add 10 ng/mL bFGF to KSR media.
[0213] Remove supernatant and resuspend iPSC/hESC in KSR media
containing 10 ng/mL bFGF. Seed onto flask and incubate in a
37.degree. C. CO.sub.2 incubator for 3 days.
[0214] Daily, aspirate spent KSR media and replenish with 5 mL
fresh KSR media containing lOng/mL bFGF.
Dissociating and Matrigel Adaption of hESC/iPSC (Day-3)
Matrigel Coating:
[0215] Aliquot 3 mL of cold DMEM/F12 basal media into a 15 mL
tube.
[0216] Add 25 uL of hESC qualified Matrigel to DMEM/F12. Mix well
and transfer into a 25 cm.sup.2 tissue culture flask. (*handle
Matrigel on ice as it solidifies when warmed.)
[0217] Keep flask at room temperature for at least 30 minutes to
allow Matrigel to coat the surface.
[0218] Prepare 5 mL MEF conditioned KSR media (see appendix B) and
add 10 ng/mL bFGF to media.
Dissociating Cells:
[0219] (*For optimal results, cells should be approximately 80-90%
confluent. If cells are not confluent, allow another day for
incubation or do a lower split ratio.)
[0220] Wash confluent 25 cm.sup.2 flask with 3 mL PBS twice.
[0221] Add 2mL TrypLE Select to cells and incubate at 37.degree. C.
for 3 minutes.
[0222] Pipette 5 mL DMEM/F12 basal media to cells, mix and ensure
cells have lifted off from the plastic surface.
[0223] Collect cell suspension at a 1:3 split ratio in a 15 mL tube
and centrifuge at 1,500 rpm for 3 minutes.
Seeding Cells onto Matrigel Coated Flasks:
[0224] Remove supernatant and add prepared 5 mL conditioned KSR
media to cells. Mix gently.
[0225] Aspirate Matrigel-containing DMEM/F12 from prepared tissue
culture flask and seed cells.
[0226] Incubate overnight in a 37 .degree. C. CO.sub.2 incubator
for two days. Daily, aspirate spent conditioned KSR media and
replenish with 5 mL fresh conditioned KSR media containing 10 ng/mL
bFGF.
Seeding Cells for Differentiation (Day-1)
[0227] Wash 25 cm.sup.2 flask with 3 mL PBS twice. Add 2mL TrypLE
Select to cells and incubate at 37 .degree. C. for 3 minutes.
[0228] Pipette 5mL DMEM/F12 basal media to cells, mix and ensure
cells have lifted off from the plastic surface.
[0229] Collect cell suspension into 15 mL tube. Count.
[0230] Calculate desired cell numbers to achieve 4,000 cells per
well (12,500 cells per cm.sup.2).
[0231] Aliquot desired cell numbers into a 15 mL tube. Centrifuge
at 1,500 rpm for 3 minutes.
[0232] Resuspend cells in conditioned KSR, containing 10 ng/mL
bFGF, at 50 uL per well. Seed cells into 96 well glass bottom plate
and incubate at 37.degree. C. overnight.
Differentiation Stage One (Day 0)
[0233] For a freshly opened APEL bottle, add Antibiotic-Antimycotic
(100.times.) at 1 in 100.
[0234] Prepare 81.1M CHIR in APEL.
[0235] Aspirate conditioned KSR from 96 well plate.
[0236] Add 1004 of APEL containing 8 .mu.M CHIR to cells.
[0237] Incubate at 37.degree. C. for 4 days, refreshing the media
every 2 days.
Differentiation stage two (Day 4)
[0238] Prepare 200ng/mL FGF9+1 .mu.g/mL Heparin in APEL.
[0239] Aspirate spent APEL containing CHIR from 96 well plate.
[0240] Add 1004 of APEL containing 200 ng/mL FGF9+1 .mu.g/mL
Heparin to cells.
[0241] Incubate at 37.degree. C. for 2 days, and refreshing the
media on day 6 with fresh APEL containing 200ng/mL FGF9+1 .mu.g/mL
Heparin.
3D Organoid Culture (Day 7)
[0242] Obtain cultured C32 IPS cells of different conditions in 96
well plate.
[0243] Aspirate the culturing media and give a quick wash with
sterile PBS.
[0244] Aspirate the PBS.
[0245] Add 504 of trypsin EDTA (0.25%) to each well.
[0246] Place in 37.degree. C. incubator for up to 3 minutes for
cells to lift off the surfaces.
[0247] Monitor under the microscope to make sure all cells have
lift off the glass (96 well) surfaces. If the cells are still
attached to the surfaces, gently pipette the cells with trypsin and
place back into the incubator for further 2 minutes.
[0248] Neutralize the trypsin with 1004 of DMEM+10% FBS+1% P/S.
[0249] Aliquot the entire culture into a 15 mL Falcon tube.
[0250] Centrifuge the cells at a speed of 1500 rpm for 5 mins.
[0251] Aspirate the media off till just a pellet of cells left.
[0252] Resuspend the cells with 3 mL of CHIR.
[0253] Take out 104 of cell suspension and perform a cell count
with a haemocytometer.
[0254] Each 3D pellet organoid will have roughly 5.times.10.sup.5
cells, aliquot the required amount of cell suspension into a 15 mL
Falcon tube.
[0255] Centrifuge the tube at 2000 RPM for 2 minutes.
[0256] Aliquot 1.2mL of APEL+5 .mu.M CHIR into the 6 well Transwell
polyster membrane cell culture plate.
[0257] Use a P1000 pipette to slowly dislodge the pellet in
solution with APEL.
[0258] Pick the pellet up by using a P1000 wide bore tips.
[0259] Carefully plate the pellet onto the transwell filters with
minimal media carry over.
[0260] Placed in a cell culture incubator for lhr.
[0261] Aliquot 1.2 mL of APEL+200 ng/mL FGF9+1 .mu.g/mL Heparin
into a
[0262] Corning Costar 6 well plate.
[0263] Remove the filters culturing for an hour in APEL+5 .mu.M
CHIR to the APEL+200 ng/mL FGF9+1 .mu.g/mL Heparin plates and
culture for 5 days. (Media change every two days)
[0264] After 5 days, remove the filters and place in a freshly
prepared Corning Costar 6 well plate with 1.2 ml of fresh APEL.
[0265] Culture the organoids for further 6 days in APEL only media.
(Media change every two days)
3D Organoid Immunofluorescence (day 18)
[0266] After 6 days of organoid culture, fix the pellets with 1%
paraformaldehyde at 4.degree. C. for 20 minutes.
[0267] Remove the paraformaldehyde and wash three times with
PBS.
[0268] Once fixed and washed, organoids can be stored at 4.degree.
C. for up to a week before immunofluorescence staining.
[0269] Aliquot around 150 uL of blocking buffer (10% donkey
serum/0.3% Triton-x/PBS) into the MatTek Glass Bottom Dishes.
[0270] Carefully cut the organoids off the filter and submerge the
filter into the blocking buffer.
[0271] Block the organoids for 2-3 hours.
[0272] Prepare primary antibodies of choice in blocking buffer.
[0273] Most of the antibodies listed use a dilution of 1:300.
[0274] Aspirate the blocking buffer off the MatTek dish, and
aliquot 1504 of blocking buffer+primary antibodies into the MatTek
dish.
[0275] Incubate the organoids with primary antibodies at 4.degree.
C. over-night.
[0276] Aspirate the primary antibodies off the dish and wash with
PBTX for 6 times, 10 minutes each.
[0277] Prepare secondary antibodies (1:400 diln) of choice in PBTX
(0.1% Triton-X/PBS).
[0278] Incubate organoids in secondary antibodies for 4 hours.
[0279] Remove secondary antibodies and incubate with DAPI (1:1000
diln) in PBS for 1 hour.
[0280] Wash 3 times, 10 minutes each with PBS.
[0281] Ready for imaging.
Results
[0282] As shown in FIG. 1, to select for collecting duct
(ECAD.sup.+,GATA3.sup.+, PAX2.sup.+), fewer days (2-3) of initial
Wnt agonist and/or subsequent culture with FGF9 together with
activation of retinoic acid signalling is optimal. To select for
nephron-forming metanephric mesenchyme
(WT1.sup.+HOXD11.sup.+ECAD.sup.-) and giving rise to epithelial
structures expressing early nephron markers), more days (3-5) of
initial Wnt agonist and/or subsequent culture with FGF9 together
with inhibition of retinoic acid signalling is optimal.
[0283] We now have evidence that organoids formed via the
aggregation of human pluripotent stem cells using the method
disclosed herein show the following features indicative of normal
kidney organogenesis. As shown in FIG. 2, the presence of a
Meis1.sup.+ stromal population is shown to be present between the
forming nephrons. This population is known to arise from
metanephric mesenchyme, is present between the developing nephrons
of the embryonic kidney and have been shown to contribute to the
formation of the perivasculature of the final organ. In FIG. 3 the
presence of CD31.sup.+ vascular progenitors. We see evidence in
endothelium as assessed by CD31, however CD31 is a marker of mature
endothelium and as yet we do not see early endothelial progenitors
showing active invasion of the glomeruli to form a functional
filtration unit. FIGS. 4 and 5 show the presence of all segments of
a normal developing nephron, including collecting duct
(GATA3.sup.+PAX2.sup.+ECAD.sup.+), distal tubule
(ECAD.sup.+GATA3.sup.-LTL), proximal tubule (LTL.sup.+AQP1.sup.+)
and glomerulus (WT1.sup.+NPHS1.sup.+SYNPO.sup.+), connected to each
other suggestive of normal embryonic organogenesis.
[0284] Variations in a number of parameters has improved the
overall size, complexity, maturity and nephron number present
within organoids formed from human pluripotent stem cells.
[0285] These include formation of an aggregate of differentiated
cells for culture as an organoid after 7 days of induction.
Initially, these were shown to be able to form after 14 or 18 days
of prior culture. We can now reliably get organoid formation after
7 days with this including 4 days of culture in 8 .mu.M CHIR
followed by 3 days of culture in FGF9 with or without AGN (retinoic
inhibitor), BMP7, low CHIR or RA in the concentration ranges
previously described. As shown in FIG. 6, formation of aggregates
was enhanced by addition of a 45 minute pulse of high CHIR (5
.mu.M) immediately upon reaggregation followed by culture in FGF9
with or without AGN (retinoic inhibitor), BMP7, low CHIR or RA in
the concentration ranges previously described.
[0286] The formation of a vascularised glomerulus is critical for
renal function. Evidence that such glomerular vasculature can form
even in vitro would significantly enhance the credibility of
organoids as a model for the kidney.
[0287] One approach combines human pluripotent stem cells
differentiated to kidney together with human pluripotent stem cells
differentiated to vascular endothelial progenitors using a protocol
such as that of Orlova.sup.31.
[0288] Another approach reduces the oxygen tension during
differentiation from 21% O.sub.2 (usual oxygen tension present in a
standard tissue culture incubator) to 5 to 12% O.sub.2 (more
equivalent to the oxygen tension experienced in the developing
embryo). We anticipate that this may well improve the capacity of
the metanephric mesenchyme to generate VEGFA and induce the
formation and migration of Flk1+endothelial progenitors.
Example 2
Cell Culture and Differentiation
[0289] All experiments presented used the previously described
wildtype human iPSC line CRL1502 (clone# C32) generated using
episomal reprogramming.sup.28. Undifferentiated human iPSCs were
maintained on the mouse embryonic fibroblasts (MEFs) (Millipore) as
a feeder layer with human ES cell (hES) medium as described
previously.sup.1. Cells were authenticated and tested for the
mycoplasma infection.sup.28. Human iPSCs were plated on a
Matrigel-coated (Millipore) culture dish and cultured in
MEF-conditioned hES medium (MEF-CM) until reaching to 60-100%
confluent. Then, cells were again plated on a Matrigel-coated at
5,000 cells/cm.sup.2 in MEF-CM. Next day, cells reached to 40-50%
of confluent, cells were treated with 8 .mu.M of CHIR99021 in APEL
basal medium (STEMCELL Technologies) supplemented with
Antibiotic-Antimycotic (Life Technologies) for 2-5 days, followed
by FGF9 (200 ng mL.sup.-1) and Heparin (1 .mu.g mL.sup.-1) for
another 5-2 days, with changing medium every second day. At day 7,
cells were collected and dissociated into single cells using
Trypsin or TrypLE select (Life Technologies). Cells
(0.5.times.10.sup.6) were spun down at .times.400 g for 2 min to
form a pellet and then transferred onto a Transwell 0.4 .mu.m pore
polyester membrane (#CLS3450 Corning). Pellets were treated with 5
.mu.M of CHIR99021 in APEL for 1 h, and then cultured with FGF9
(200 ng mL.sup.-1) and Heparin (1 .mu.g mL.sup.-1) for 5 days,
followed by another 6-13 days in APEL basal medium, with changing
medium three times a week. Culture medium should not exceed above a
membrane. For the differentiation in monolayer cultures, cells post
CHIR99021 induction were treated by FGF9 (200 ng mL.sup.-1) and
Heparin (1 .mu.g mL.sup.-1) for 10 days, followed by APEL basal
medium for another 6 days. In some experiments, RA (0.1 .mu.M) or
AGN193109 (5 .mu.M) were added to FGF9 medium. A step-by step
protocol describing kidney organoid generation was provided in
Example 1.
Immunocytochemistry
[0290] For monolayer cells, antibody staining was performed as
described previously.sup.1. For the kidney organoid, organoids were
fixed with 2% paraformaldehyde in PBS for 20 min at 4.degree. C.
followed by 3 times wash with PBS. Then organoids were blocked with
10% donkey serum, 0.3% Triton X/PBS for 2-3 h at room temperature
and incubated with primary antibodies overnight at 4.degree. C.
After 5 times washing with 0.1% Triton X/PBS, secondary antibodies
were incubated for 4 h at room temperature. The following
antibodies and dilutions were used: rabbit anti-PAX2 (1:300,
#71-6,000, Zymed Laboratories), goat anti-SIX1 (1:300, #sc-9709,
Santa Cruz Biotechnology), rabbit anti-SIX2 (1:300, #11562-1-AP,
Proteintech), mouse anti-ECAD (1:300, #610181, BD Biosciences),
rabbit anti-WT1 (1:100, #sc-192, Santa Cruz Biotechnology), mouse
anti-HOXD11 (1:300, #SAB1403944, Sigma-Aldrich), goat anti-GATA3
(1:300, AF2605, R&D Systems), rabbit anti-JAG1 (1:300, #ab7771,
Abcam), goat anti-Cubilin (1:150, #sc-20607, Santa Cruz
Biotechnology), sheep anti-NPHS1 (1:300, AF4269, R&D Systems),
LTL-biotin-conjugated (1:300, B-1325, Vector Laboratories),
DBA-biotin-conjugated (1:300, B-1035, Vector Laboratories), mouse
anti-KRT8 (1:300, #TROMA, DSHB), mouse anti-CD31 (1:300, #555444,
BD Pharmingen), rabbit anti-KDR (1:300, #2479, Cell Signaling
Technology), goat anti-SOX17 (1:300, #AF1924, R&D Systems),
rabbit anti-NG2 (1:300, #AB5320, Merck Millipore), rabbit anti-SMA
(1:300, #ab15267, Abcam), mouse anti-PDGFRA (1:200, #556001, BD
Pharmingen), rabbit anti-Laminin (1:300, #L9393, Sigma-Aldrich),
rabbit anti-UMOD (1:300, #BT-590, Biomedical Technologies), mouse
anti-MEIS1 (1:300, #ATM39795, activemotif), goat anti-FOXD1 (1:200,
#sc-47585, Santa Cruz Biotechnology) and rabbit anti-cleaved-CASP3
(1:300, #9661, Cell Signaling Technology). Images were taken using
a Nikon Ti-U microscope or a Zeiss LSM 780 confocal microscope. All
immunofluorescence analyses were successfully repeated more than
three times and representative images are shown.
Electron Microscopy
[0291] Organoids were processed for electron microscopy using a
method as follows. A solution of 5% glutaraldehyde in 2.times.PBS
was added directly to the organoid culture dish in equal volume to
the growth medium and placed under vacuum for 5 min. The organoid
was reduced in size by cutting into small blocks
(.about.2.times.2mm), and irradiated in fresh fixative 2.5%, again
under vacuum, for 6 minutes, in a Pelco Biowave (Ted Pella In,
Redding, Calif.) at 80W power. Samples were then washed 4.times.2
min in 0.1 M cacodylate buffer. Samples were then immersed in a
solution containing potassium ferricyanide (3%) and osmium
tetroxide (2%) in 0.1M cacodylate buffer for 30 min at room
temperature. Following 6.times.3 min washes in distilled water the
tissue blocks were then incubated in a filtered solution containing
thiocarbohydrazide (1%) for 30 min at room temperature. After
subsequent washing in distilled water (6 x 2 min) samples were
incubated in an aqueous solution of osmium tetroxide (2%) for 30
min, then in distilled water (6 .times.2 min) and incubated in 1%
aqueous uranyl acetate for 30 min at 4.degree. C. After further
distilled water washes (2.times.2 min) a freshly prepared filtered
solution of 0.06% lead nitrate in aspartic acid (pH 5.5) warmed to
60.degree. C. was added to the dish and further incubated for 20
minutes at 60.degree. C. before rinsing in distilled water (6
.times.3 min) at room temperature. Tissue blocks were dehydrated
twice in each ethanol solution of 30%, 50%, 70%, 90% and absolute
ethanol for 40 sec at 250 watt in the Pelco Biowave. Epon LX112
resin was used for embedding the tissue with infiltration at 25%,
50%, and 75% resin:absolute ethanol in the Pelco Biowave under
vacuum at 250 watt for 3 min and finishing with 100% resin (twice),
before the final embedding/blocking and curing at 60.degree. C. for
12 hours.
qRT-PCR Analysis
[0292] Total RNA was extracted from cells using Purelink RNA mini
kit (Life Technologies) and cDNA was synthesized from >100 ng
total RNA using Super Script III reverse transcriptase (Life
Technologies). qRT-PCR analyses were performed with GoTaq qPCR
Master Mix (Promega) by Roche LightCycler 96 real-time PCR machine.
All absolute data were first normalized to GAPDH and then
normalized to control samples (6-6-Ct method). The sequences of
primers used for qRT-PCR are as listed in Table 2.
Next Generation RNA Sequencing and Comparative Analysis Using
KeyGenes
[0293] Sequencing was performed using the Illumina NextSeq500
(NextSeq control software v1.2/Real Time Analysis v2.1) platform.
The library pool was diluted and denatured according to the
standard NextSeq500 protocol and sequencing was carried out to
generate single-end 76 bp reads using a 75 cycle NextSeq500 High
Output reagent Kit (Catalog # FC-404-1005). Reads were mapped
against the reference human genome (hg19) using STAR.sup.29, and
read counts for each gene in the UCSC annotation were generated
using htseq-count in the HTSeq python package
(http://www-huber.embl.de/users/anders/HTSeq/doc/index.html). The
number of uniquely mapped reads ranged from 18810634-36706805 per
sample. Normalised read counts were calculated using the DESeq2
package.sup.30.
[0294] KeyGenes has used to generate the identity scores of D0, D3,
D11, D18 kidney organoids to different first trimester human
organs, including the kidneys (GSE66302).sup.15. A dendrogram (FIG.
13) showing the hierarchical clustering of D0, D3, D11, D18 kidney
organoids and 21 human fetal organs from first and second trimester
(GSE66302) was based on the Pearson correlation of the expression
levels of 85 classifier genes as determined by KeyGenes (vvi.vv,
icevgenes,n1; Table 3). The classifier genes were calculated by
KeyGenes using the top 500 most differentially expressed genes of
the human fetal data without including the extraembryonic tissues
from that data set.
Functional Analysis for Proximal Tubules
[0295] For Dextran uptake assay, organoids at day 17 were cultured
with 10 .mu.g mL.sup.-1 of 10,000 MW Dextran Alexa488-conjugated
(D-22910, Life Technologies) for 24 h. Organoids were fixed and
stained by LTL without permeabilization. For nephrotoxicity assays,
organoids at day 17 were cultured with 0, 5, 20 or 100 uM of
Cisplatin (Sigma-Aldrich) for 24 h. The ratio of apoptotic proximal
tubules to total proximal tubules was manually counted using ImageJ
in 2 or 3 representative fields per experiment. In total, n=5
independent experiments. Images were taken using Zeiss LSM 780
confocal microscope.
Results & Discussion
[0296] We have previously demonstrated in vitro that formation of
the IM required FGF9 or FGF2.sup.1. Hence, in vivo we have assumed
the UE forms from early migrating PSM cells exposed to FGF9 and RA
soon after the primitive streak stage, while cells late to migrate,
and hence exposed to longer Wnt signaling, should give rise to the
MM.sup.13 (FIG. 7a). To confirm this and further to the data shown
in Example 1, we varied the duration of initial Wnt signaling
(CHIR99201) prior to addition of FGF9 (FIG. 7b) and monitored
markers of the AI and PI by qPCR. A shorter period of CHIR99021
induced the AI markers, LHX1 and GATA3, while longer days of
CHIR99021 increased PI markers, HOXD11 and EYA1, at day 7.
Prolonged expression of the PSM markers, TBX6 and T, after longer
days in CHIR99021 suggested a delay in FGF9-induced fate commitment
(FIG. 7c), as predicted. Immunofluorescence analysis showed that a
longer (or shorter) duration of CHIR99021 induced less (more) AI
but more (less) PI, as indicated by GATA3 and HOXD11 respectively
at day 7 of differentiation (FIG. 7d). These observations persisted
after 18 days of culture, with dominant UE induction
(GATA3.sup.+PAX2.sup.+ECAD.sup.+) after fewer days in CHIR99201 and
preferential induction of MM (PAX2.sup.+ECAD.sup.-) and its
derivatives (PAX2.sup.+ECAD.sup.+) with longer days in CHIR66201.
Further, we investigated whether RA signaling also controls A-P
fate patterning of the IM using RA or an RAR antagonist, AGN193109,
together with FGF9 (FIG. 7e,f). RA promoted UE induction whereas
AGN193109 inhibited UE but enhanced induction of the MM lineage
(FIG. 7g,h).
[0297] These results increase our understanding of embryogenesis as
well as providing a method by which to modulate the relative
induction of each of the two IM-derived progenitor populations
essential for kidney formation. As a result, we modified our
existing kidney differentiation process to increase the proportion
of MM formed, increase the time in 3D culture and actively trigger
nephron formation. This optimized approach was applied to either
hESC or human iPSC and involved an initial 4 days of CHIR99021,
which resulted in the induction of both the UE and MM in monolayer
culture, followed by 3 days of FGF9 before transfer to organoid
culture (FIG. 8a). The resulting aggregates were cultured for up to
20 days, during which time they spontaneously formed complex kidney
organoids (FIG. 8b). During normal kidney development, nephron
formation from the MM is initiated in response to Wnt9b secreted
from the UE. In the mouse, ectopic nephron formation can be
triggered via the addition of canonical Wnt agonists.sup.14.
Indeed, maximal nephron number per organoid required a pulse of
CHIR99021 for one hour after forming a pellet (FIG. 8a and FIG.
11a). In addition, the continued presence of FGF9 post this
CHIR99021 pulse was essential for nephrogenesis, suggesting an
additional role for FGF signaling after Wnt-mediated nephron
induction (FIG. 11b). Within each organoid, the nephrons
appropriately segmented into 4 components, including the collecting
duct (GATA3.sup.+ECAD.sup.+), the early distal tubule
(GATA3.sup.-LTLECAD.sup.+), early proximal tubule
(LTL.sup.+ECAD.sup.-) and the glomerulus (WT1.sup.+) (FIG. 8c, d).
Moreover, kidney organoids showed complex morphogenetic patterning
with collecting duct trees forming at the bottom of the organoid,
connecting to distal and proximal tubules in the middle, with the
glomeruli at the top of each organoid (FIG. 8e', e'', e'''). This
patterning mimics the tissue organization observed in vivo where
glomeruli arise in the cortex whereas the collecting ducts radiate
through the organ from the middle. Here again, the relative level
of collecting duct versus nephron within individual organoids could
be varied with the timing of the initial CHIR99201-to-FGF9 switch.
Next, we performed RNA sequencing of whole kidney organoids at day
(d) 0, 3, 11 and 18 after aggregation and 3D culture. Across this
timecourse we observed a temporal loss of nephron progenitor gene
expression but an increase in markers of multiple nephron segments,
including the podocytes, proximal and distal tubules (FIG. 12).
Transcriptional profiling was performed and compared using an
unbiased method with human fetal transcriptional datasets from 21
human fetal organs/tissues from the first and/or second trimester
of pregnancyl.sup.5. This analysis clustered kidney organoids at
d11 and d18 of culture with first trimester human fetal kidney
(FIG. 8f, g; FIG. 13). At the earlier culture timepoints (d0, d3),
organoids more closely matched the fetal gonad, an embryologically
closely related tissue also derived from the IM.
[0298] In a kidney, the epithelial cell types (nephron and
collecting duct) are surrounded by a renal interstitium (stroma)
within which there is a vascular network. As well as forming the
MM, the IM gives rise to stromal and vascular progenitors (FIG.
9a).sup.16,17. We examined kidney organoids for evidence of
additional cell types and evidence of functional maturation.
Collecting ducts could be distinguished based on co-expression of
PAX2, GATA3 and ECAD (FIG. 9b). At d11, nephron epithelia showed
proximal (LTL.sup.+ECAD.sup.-) and distal (LTL.sup.-ECAD.sup.+)
elements (FIG. 9c). By d18, proximal tubules matured to co-express
LTL with ECAD, with Cubilin evident on the apical surface (FIG. 9d,
e). Transmission electron microscopy (TEM) showed distinct
epithelial subtypes; cells with few short microvilli surrounding an
open lumen characteristic of collecting duct/distal tubule (FIG.
9k) and typical proximal tubular epithelium displaying an apical
brush border with tight junctions (FIG. 9l). By d18, loops of Henle
(UMOD.sup.+) began to form (FIG. 9f). By d11, WT1.sup.+NPHS1.sup.+
early glomeruli.sup.18 comprising a Bowman's capsule with central
podocyte formation was seen connected to proximal tubules (FIG.
9g). Kidney organoids also developed a
CD31.sup.+KDR.sup.+SOX17.sup.+endothelial network with lumen
formation (FIG. 9h). TEM showed the presence of primary and
secondary foot processes characteristic of podocytes (FIG. 9m). In
a developing kidney, renal interstitium differentiates into
pericytes and mesangial cells.sup.19. As expected, kidney organoids
contained PDGFRA.sup.+ perivascular cells that lie along KDR.sup.+
endothelia and PDGFRA.sup.+ early mesangial cells invaginating the
glomeruli (FIG. 14a, b), as observed in human fetal kidney.sup.20.
Early avascular glomeruli contained basement membrane, as indicated
by Laminin staining and TEM, and showed attaching foot processes on
the basement membrane In some instances, glomeruli showed evidence
of endothelial invasion (FIG. 9i), a feature never observed in
explanted embryonic mouse kidneys.sup.21. Finally, nephrons were
surrounded by MEIS1.sup.+renal interstitial cells.sup.22, some of
which were also FOXD1.sup.+(FIG. 9j), suggesting the presence of
cortical (FOXD1.sup.+MEIS1.sup.+) and medullary (FOXDFMEIS1.sup.+)
stroma. Hence, all anticipated kidney components form, pattern and
begin to mature within these hPSC-derived kidney organoids.
Consistent with these observations were the transcriptional changes
across time in culture, with a gradual reduction in the nephrogenic
mesenchyme and ureteric tip markers followed by the upregulation of
genes specific to podocyte, proximal tubule, distal tubule and loop
of Henle.sup.23,24 (FIG. 11).
[0299] The utility of stem-cell derived kidney organoids for
disease modelling or drug screening will be dependent upon the
functional maturation of the nephrons within these organoids. To
test this, we focused on the proximal tubules, a nephron segment
that plays important roles in solute, vitamin, hormone and amino
acids reabsorption. The capacity of Cubilin-mediated proximal
tubule specific endocytosis was demonstrated by the selective
uptake of Dextran-Alexa488 from the media by the LTL.sup.+tubules
after 24 hours of exposure (FIG. 10a). The proximal tubules
represent a particular target for nephrotoxicity due to the
expression of multidrug resistance (such as ABCB1, ABCG2) and anion
and cation transporters (such as the SLC22 gene family).sup.23,24.
Cisplatin is one of such nephrotoxicant that induces
Caspase-mediated acute apoptosis of proximal tubular cells in the
kidney.sup.25,26. We treated kidney organoids with 0, 5 and 20
.mu.M. Cisplatin for 24 hours before examining cleaved-CASP3
antibody staining.. While control organoids showed occasional
apoptotic interstitial cells, both 5 .mu.M and 20 .mu.M. Cisplatin
induced specific acute apoptosis in mature proximal tubular cells
(LTL.sup.+ECAD.sup.+), whereas immature cells (LTL.sup.+ECAIY) did
not undergo apoptosis (FIG. 10b, c).
[0300] In summary, this study demonstrates that by carefully
balancing A/P patterning of IM with small molecules it is possible
to direct human pluripotent stem cells to form a complex
multicellular kidney organoid that comprises fully segmented
nephrons surrounded by endothelia and renal interstitium and is
transcriptionally similar to a human fetal kidney. As such, these
will improve our understanding of human kidney development. Each
kidney organoid reaches a substantial size with >500 nephrons
per organoid, a number equivalent to a mouse kidney at 14.5
dpc.sup.27. While there is room for further improvement with regard
to tubular functional maturity, glomerular vascularisation and a
contiguous collecting duct epithelium with a single exit path for
urine, the tissue complexity and degree of organoid
functionalization observed here supports their use to screen drugs
for toxicity, modelling genetic kidney disease or act as a source
of specific kidney cell types for cellular therapy.
[0301] The fact that we can form organoids from differentiated hES
cell cultures alone opens the possibility of generating
tissue-based nephrotoxicity screens, in vitro disease models or
developing transplantable organoids to supplement renal function.
It also suggests the feasibility of generating specific mature
renal cell types for later purification.
[0302] Particular uses of the cells generated using this method may
include: [0303] Generating mini-kidney organoids or purified renal
cell for nephrotoxicity screening; [0304] Generating mini-kidney
organoids or purified renal cell for disease modelling, either in
general or patient by patient; and/or [0305] Generating mini-kidney
organoids or purified renal cell types for drug screening for the
therapeutic treatment of kidney disease.
[0306] These could be performed in microbioreactors or after
bioprinting into a larger format screen. For disease modelling or
drug screening, it is likely we would purify individual cell types
and culture them in a manner or format that would provide useful
information based upon the specific disease. For example, we might
isolate UB and grow in matrigel cultures to assess cyst formation
(e.g for diseases such as nephronopthisis) or isolate MM to make
podocytes (e.g for diseases such as Finnish nephropathy or Alport
syndrome).
[0307] Particular examples of cellular therapies and organ
replacement or repair may include: [0308] Generating kidney cell
types for cellular therapy (acute kidney injury or chronic kidney
injury); [0309] Generating kidney cell types for whole organ
replacement bioengineering, which may need to link together
multiple smaller kidneys to form a replacement `organ`; and/or
[0310] Generating kidney cell types for recellularisation of
decellularised scaffolds. [0311] Further applications include:
[0312] 1) Generation of kidney organoids from human pluripotent
stem cell lines engineered to report one or more fluorescent
reporters as readouts of differentiation to specific renal cell
types. This would allow the generation from a single starting cell
line an organoid that would both report the degree of
differentiation complexity without the requirement of specific
antibody visualisation and would facilitate combinatorial FACS
sorting to purify a variety of specific renal cell types from the
one differentiation. Such sorted cells might be of use in cellular
therapy. [0313] 2) Generation of kidney organoids from human
pluripotent stem cell lines engineered to report one or more
fluorescent or luciferase based reporters as readouts of cellular
injury (predicted responses to nephrotoxicity, cytotoxicity or
induction of apoptosis/necrosis). This would allow the generation
of organoids for drug or nephrotoxicity screening with a
quantifiable readout of response. [0314] 3) Generation of either
collecting duct alone or metanephric mesenchyme alone for
combination with other bioprinted structures. For example, the
generation of nephron-forming mesenchyme alone for combination with
collecting duct cells differentiated separately but bioprinted into
a ureteric tree. The advantage here would be the creation of a
specifically patterned collecting duct network around which
nephrons could differentiate such that the final product could act
as a transplantable organ capable of directing urine to a single
exit.
[0315] Throughout the specification the aim has been to describe
the preferred embodiments of the invention without limiting the
invention to any one embodiment or specific collection of features.
It will therefore be appreciated by those of skill in the art that,
in light of the instant disclosure, various modifications and
changes can be made in the particular embodiments exemplified
without departing from the scope of the present invention.
[0316] All computer programs, algorithms, patent and scientific
literature referred to herein is incorporated herein by
reference.
TABLE-US-00001 TABLE 1 Reagent sources Catalogue Number Supplier
Reagent Gelatin G9391 Sigma Aldrich bFGF GF003-AF Merck FGF9
273-F9-025 R&D CHIR99021 4423/10 R&D Heparin H4784-250MG
Sigma-Aldrich hESC qualified Matrigel FAL354277 In Vitro
Technologies TrypLE Select 12563029 Life Technologies Trypsin EDTA
(0.25%) 25200-072 Life Technologies APEL Media 05210 Stem Cell
Technologies Antibiotic-Antimycotic 15240-062 Life Technologies
(100X) DMEM/F-12 11320-082 Life Technologies DMEM high glucose
11995-073 Life Technologies Foetal Bovine Serum SFBSF Interpath
Services Penicillin/Streptomycin 15070-063 Life Technologies
Paraformaldehyde 30525-89-4 Sigma-Aldrich Donkey serum D9663-10ML
Sigma-Aldrich Triton X-100 T9284 Sigma-Aldrich Cell line C32 human
iPSC N/A Dr. Wolvetang at UQ (AIBN) Primary mouse PMEF-CFL Merck
embryonic fibroblasts Antibodies ECAD 610181 BD-Bioscience GATA3
AF2605 R&D Systems NPHS1 AF4269 R&D Systems WT1 SC-192
Santa Cruz Biotechnology LTL - biotin conjugated B-1325 Vector
Laboratories Secondary Alexa Fluor Life Technologies (Donkey)
TABLE-US-00002 TABLE 2 Sequences of primers used for qRTPCR Forward
(5'-3') Reverse (5'-3') T AGGTACCCAACCCTGAGGA
GCAGGTGAGTTGTCAGAATAGGT (SEQ ID NO: 1) (SEQ ID NO: 2) LHX1
ATGCAACCTGACCGAGAAGT CAGGTCGCTAGGGGAGATG (SEQ ID NO: 3) (SEQ ID NO:
4) TBX6 CATCCACGAGAATTGTACCCG AGCAATCCAGTTTAGGGGTGT (SEQ ID NO: 5)
(SEQ ID NO: 6) GATA3 GCCCCTCATTAAGCCCAAG TTGTGGTGGTCTGACAGTTCG (SEQ
ID NO: 7) (SEQ ID NO: 8) HOXD11 GCCAGTGTGCTGTCGTTCCC
CTTCCTACAGACCCCGCCGT (SEQ ID NO: 9) (SEQ ID NO: 10) EYA1
ATCTAACCAGCCCGCATAGC GTGCCATTGGGAGTCATGGA (SEQ ID NO: 11) (SEQ ID
NO: 12) GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC (SEQ ID NO:
13) (SEQ ID NO: 14)
TABLE-US-00003 TABLE 3 Ensembl Gene ID Gene Name Chromosome Organ
ENSG00000105398 SULT2A1 19 Adrenal ENSG00000109132 PHOX2B 4 Adrenal
ENSG00000136931 NR5A1 9 Adrenal ENSG00000147256 ARHGAP36 X Adrenal
ENSG00000148795 CYP17A1 10 Adrenal ENSG00000153002 CPB1 3 Adrenal
ENSG00000000005 TNMD X Amnion ENSG00000094755 GABRP 5 Amnion
ENSG00000115221 ITGB6 2 Amnion ENSG00000128709 HOXD9 2 Amnion
ENSG00000134258 VTCN1 1 Amnion ENSG00000167916 KRT24 17 Amnion
ENSG00000125462 C1orf61 1 Brain ENSG00000130287 NCAN 19 Brain
ENSG00000170370 EMX2 10 Brain ENSG00000186487 MYT1L 2 Brain
ENSG00000197757 HOXC6 12 Brain ENSG00000106366 SERPINE1 7 Chorion
ENSG00000185269 NOTUM 17 Chorion ENSG00000196126 HLA-DRB1 6 Chorion
ENSG00000196136 SERPINA3 14 Chorion ENSG00000080166 DCT 13 Eye
ENSG00000137273 FOXF2 6 Eye ENSG00000147655 RSPO2 8 Eye
ENSG00000180660 MAB21L1 13 Eye ENSG00000185960 SHOX X Eye
ENSG00000104435 STMN2 8 Gonad ENSG00000115596 WNT6 2 Gonad
ENSG00000143355 LHX9 1 Gonad ENSG00000143954 REG3G 2 Gonad
ENSG00000184937 WT1 11 Gonad ENSG00000242349 NPPA-AS1 1 Heart A
ENSG00000160808 MYL3 3 Heart V ENSG00000112818 MEP1A 6 Intestine
ENSG00000173702 MUC13 3 Intestine ENSG00000181541 MAB21L2 4
Intestine ENSG00000074803 SLC12A1 15 Kidney ENSG00000075891 PAX2 10
Kidney ENSG00000116218 NPHS2 1 Kidney ENSG00000055957 ITIH1 3 Liver
ENSG00000091513 TF 3 Liver ENSG00000132855 ANGPTL3 1 Liver
ENSG00000162365 CYP4A22 1 Liver ENSG00000164265 SCGB3A2 5 Lung
ENSG00000262152 LINC00514 16 Lung ENSG00000106511 MEOX2 7 Mother
ENSG00000162706 CADM3 1 Mother ENSG00000164825 DEFB1 8 Mother
ENSG00000166426 CRABP1 15 Mother ENSG00000172179 PRL 6 Mother
ENSG00000189058 APOD 3 Mother ENSG00000000005 TNMD X Muscle
ENSG00000122180 MYOG 1 Muscle ENSG00000180818 HOXC10 12 Muscle
ENSG00000114204 SERPINI2 3 Pancreas ENSG00000130675 MNX1 7 Pancreas
ENSG00000139515 PDX1 13 Pancreas ENSG00000255245 FXYD6-FXYD2 11
Pancreas ENSG00000006659 LGALS14 19 Placenta ENSG00000128918
ALDH1A2 15 Placenta ENSG00000164707 SLC13A4 7 Placenta
ENSG00000170498 KISS1 1 Placenta ENSG00000092607 TBX15 1 Skin
ENSG00000121742 GJB6 13 Skin ENSG00000147655 RSPO2 8 Skin
ENSG00000167768 KRT1 12 Skin ENSG00000188508 KRTDAP 19 Skin
ENSG00000262152 LINC00514 16 Skin ENSG00000052344 PRSS8 16 Sp. Cord
ENSG00000120068 HOXB8 17 Sp. Cord ENSG00000177551 NHLH2 1 Sp. Cord
ENSG00000073754 CD5L 1 Spleen ENSG00000133135 RNF128 X Spleen
ENSG00000136931 NR5A1 9 Spleen ENSG00000066405 CLDN18 3 Stomach
ENSG00000131668 BARX1 9 Stomach ENSG00000134812 GIF 11 Stomach
ENSG00000184956 MUC6 11 Stomach ENSG00000112936 C7 5 Tongue
ENSG00000133055 MYBPH 1 Tongue ENSG00000169469 SPRR1B 1 Tongue
ENSG00000052850 ALX4 11 Umb. Cord ENSG00000077279 DCX X Umb. Cord
ENSG00000089199 CHGB 20 Umb. Cord ENSG00000156076 WIF1 12 Umb. Cord
ENSG00000164093 PITX2 4 Umb. Cord ENSG00000166426 CRABP1 15 Umb.
Cord ENSG00000172209 GPR22 7 Umb. Cord ENSG00000187957 DNER 2 Umb.
Cord ENSG00000253293 HOXA10 7 Umb. Cord
REFERENCES
[0317] 1. Takasato, M. et al. Directing human embryonic stem cell
differentiation towards a renal lineage generates a self-organizing
kidney. Nat. Cell Biol. 16, 118-26 (2014). [0318] 2. James, R. G.
& Schultheiss, T. M. Patterning of the Avian Intermediate
Mesoderm by Lateral Plate and Axial Tissues. Dev. Biol. 253,
109-124 (2003). [0319] 3. Mae, S. et al. Monitoring and robust
induction of nephrogenic intermediate mesoderm from human
pluripotent stem cells. Nat. Commun. 4, 1367 (2013). [0320] 4. Xia,
Y. et al. Directed differentiation of human pluripotent cells to
ureteric bud kidney progenitor-like cells. Nat. Cell Biol. 15,
1507-15 (2013). [0321] 5. Taguchi, A. et al. Redefining the in vivo
origin of metanephric nephron progenitors enables generation of
complex kidney structures from pluripotent stem cells. Cell Stem
Cell 14, 53-67 (2014). [0322] 6. Lam, A. Q. et al. Rapid and
Efficient Differentiation of Human Pluripotent Stem Cells into
Intermediate Mesoderm That Forms Tubules Expressing Kidney Proximal
Tubular Markers. J. Am. Soc. Nephrol. 25, 1211-1225 (2014). [0323]
7. Kang, M. & Han, Y. Differentiation of human pluripotent stem
cells into nephron progenitor cells in a serum and feeder free
system. PLoS One 9, e94888 (2014). [0324] 8. Xu, J. et al. Eyal
interacts with Six2 and Myc to regulate expansion of the nephron
progenitor pool during nephrogenesis. Dev. Cell 31, 434-47 (2014).
[0325] 9. Duester, G. Retinoic acid synthesis and signaling during
early organogenesis. Cell 134, 921-31 (2008). [0326] 10. Sakai, Y.
et al. The retinoic acid-inactivating enzyme CYP26 is essential for
establishing an uneven distribution of retinoic acid along the
anterio-posterior axis within the mouse embryo. Genes Dev. 15,
213-25 (2001). [0327] 11. Abu-Abed, S. et al. The retinoic
acid-metabolizing enzyme, CYP26A1, is essential for normal
hindbrain patterning, vertebral identity, and development of
posterior structures. Genes Dev. 15, 226-40 (2001). [0328] 12.
Sweetman, D., Wagstaff, L., Cooper, 0., Weijer, C. &
Mtinsterberg, A. The migration of paraxial and lateral plate
mesoderm cells emerging from the late primitive streak is
controlled by different Wnt signals. BMC Dev. Biol. 8, 63 (2008).
[0329] 13. Takasato, M. & Little, M. H. The origin of the
mammalian kidney: implications for recreating the kidney in vitro.
Development 142, 1937-1947 (2015). [0330] 14. Park, J. et al. Six2
and Wnt regulate self-renewal and commitment of nephron progenitors
through shared gene regulatory networks. Dev. Cell 23, 637-51
(2012). [0331] 15. Roost, M. S. et al. KeyGenes, a Tool to Probe
Tissue Differentiation Using a Human Fetal Transcriptional Atlas.
Stem Cell Reports 4, 1112-1124 (2015). [0332] 16. Mugford, J. W.,
Sipila, P., McMahon, J. A. & McMahon, A. P. Osrl expression
demarcates a multi-potent population of intermediate mesoderm that
undergoes progressive restriction to an Osrl-dependent nephron
progenitor compartment within the mammalian kidney. Dev. Biol. 324,
88-98 (2008). [0333] 17. Sims-Lucas, S. et al. Endothelial
Progenitors Exist within the Kidney and Lung Mesenchyme. PLoS One
8, 1-8 (2013). [0334] 18. Brunskill, E. W., Georgas, K., Rumballe,
B., Little, M. H. & Potter, S. S. Defining the molecular
character of the developing and adult kidney podocyte. PLoS One 6,
(2011). [0335] 19. Kobayashi, A. et al. Identification of a
Multipotent Self-Renewing Stromal Progenitor Population during
Mammalian Kidney Organogenesis. Stem Cell Reports 3, 650-662
(2014). [0336] 20. Floege, J. et al. Localization of PDGF
alpha-receptor in the developing and mature human kidney. Kidney
Int 51, 1140-1150 (1997). [0337] 21. Loughna, S., Yuan, H. T. &
Woolf, A. S. Effects of oxygen on vascular patterning in Tiel/LacZ
metanephric kidneys in vitro. Biochem. Biophys. Res. Commun. 247,
361-6 (1998). [0338] 22. Brunskill, E. W. et al. Atlas of gene
expression in the developing kidney at microanatomic resolution.
Dev. Cell 15, 781-91 (2008). [0339] 23. Thiagarajan, R D., et al.
Identification of anchor genes during kidney development defines
ontological relationships, molecular subcompartments and regulatory
pathways. PLoS One. 6(2):e17286 (2011). [0340] 24. Cheng, X. &
Klassen, C. D. Tissue distribution, ontogeny, and hormonal
regulation of xenobiotic transporters in mouse kidneys. Drug Metab.
Dispos. 37,2178-85 (2009) [0341] 25. Mese, H., Sasaki, A.,
Nakayama, S., Alcalde, R. E. & Matsumura, T. The role of
caspase family protease, caspase-3 on cisplatin-induced apoptosis
in cisplatin- resistant A431 cell line. Cancer Chemother.
Pharmacol. 46, 241-245 (2000). [0342] 26. Cummings, B. S. &
Schnellmann, R. G. Cisplatin-induced renal cell apoptosis: caspase
3-dependent and -independent pathways. I Pharmacol. Exp. Ther. 302,
8-17 (2002). [0343] 27. Short, K. M. et al. Global quantification
of tissue dynamics in the developing mouse kidney. Dev. Cell 29,
188-202 (2014). [0344] 28. Briggs, J. A. et al. Integration-free
induced pluripotent stem cells model genetic and neural
developmental features of down syndrome etiology. Stem Cells 31,
467-78 (2013). [0345] 29. Dobin, A. et al. STAR: Ultrafast
universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013). [0346]
30. Love, M. I., Huber, W. & Anders, S. Moderated estimation of
fold change and dispersion for RNA-seq data with DESeq2. Genome
Biol. 15, 550 (2014). [0347] 31. Orlova V V, van den Hil F E,
Petrus-Reurer S, Drabsch Y, Ten Dijke P, Mummery C L. Generation,
expansion and functional analysis of endothelial cells and
pericytes derived from human pluripotent stem cells. Nat Protoc.
2014; 9(6):1514-31.
Sequence CWU 1
1
14119DNAArtificial SequenceForward primer T 1aggtacccaa ccctgagga
19223DNAArtificial SequenceReverse primer T 2gcaggtgagt tgtcagaata
ggt 23320DNAArtificial SequenceForward primer LHX1 3atgcaacctg
accgagaagt 20419DNAArtificial SequenceReverse primer LHX1
4caggtcgcta ggggagatg 19521DNAArtificial SequenceForward primer
TBX6 5catccacgag aattgtaccc g 21621DNAArtificial SequenceReverse
primer TBX6 6agcaatccag tttaggggtg t 21719DNAArtificial
SequenceForward primer GATA3 7gcccctcatt aagcccaag
19821DNAArtificial SequenceReverse primer GATA3 8ttgtggtggt
ctgacagttc g 21920DNAArtificial SequenceForward primer HOXD11
9gccagtgtgc tgtcgttccc 201020DNAArtificial SequenceReverse primer
HOXD11 10cttcctacag accccgccgt 201120DNAArtificial SequenceForward
primer EYA1 11atctaaccag cccgcatagc 201220DNAArtificial
SequenceReverse primer EYA1 12gtgccattgg gagtcatgga
201319DNAArtificial SequenceForward primer GAPDH 13agccacatcg
ctcagacac 191419DNAArtificial SequenceReverse primer GAPDH
14gcccaatacg accaaatcc 19
* * * * *
References