U.S. patent application number 16/126683 was filed with the patent office on 2019-01-10 for ultra-high sensitive monitoring of early transplantation failure.
This patent application is currently assigned to CITY OF HOPE. The applicant listed for this patent is CITY OF HOPE. Invention is credited to Kevin FERRERI, Fouad KANDEEL, Qiang LIU, Rasha SHEHATTA, Steve S. SOMMER, Yun YEN.
Application Number | 20190010550 16/126683 |
Document ID | / |
Family ID | 46721185 |
Filed Date | 2019-01-10 |
![](/patent/app/20190010550/US20190010550A1-20190110-D00001.png)
![](/patent/app/20190010550/US20190010550A1-20190110-D00002.png)
![](/patent/app/20190010550/US20190010550A1-20190110-D00003.png)
![](/patent/app/20190010550/US20190010550A1-20190110-D00004.png)
![](/patent/app/20190010550/US20190010550A1-20190110-D00005.png)
![](/patent/app/20190010550/US20190010550A1-20190110-D00006.png)
![](/patent/app/20190010550/US20190010550A1-20190110-D00007.png)
![](/patent/app/20190010550/US20190010550A1-20190110-D00008.png)
![](/patent/app/20190010550/US20190010550A1-20190110-D00009.png)
United States Patent
Application |
20190010550 |
Kind Code |
A1 |
YEN; Yun ; et al. |
January 10, 2019 |
ULTRA-HIGH SENSITIVE MONITORING OF EARLY TRANSPLANTATION
FAILURE
Abstract
The present invention provides a method for detecting
transplantation failure of a transplanted organ or cells which
comprises detecting a donor-positive but recipient-negative DNA
marker in the recipient's plasma using pyrophosphorolysis activated
polymerization. Because of the high sensitivity, specificity and
selectivity of pyrophosphorolysis activated polymerization,
transplantation failure can be detected at early stages and
treatment can be initiate earlier.
Inventors: |
YEN; Yun; (Arcadia, CA)
; LIU; Qiang; (Upland, CA) ; KANDEEL; Fouad;
(Duarte, CA) ; FERRERI; Kevin; (Duarte, CA)
; SOMMER; Steve S.; (Duarte, CA) ; SHEHATTA;
Rasha; (Duarte, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CITY OF HOPE |
Duarte |
CA |
US |
|
|
Assignee: |
CITY OF HOPE
Duarte
CA
|
Family ID: |
46721185 |
Appl. No.: |
16/126683 |
Filed: |
September 10, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14000485 |
Nov 25, 2014 |
10072294 |
|
|
PCT/US12/25393 |
Feb 16, 2012 |
|
|
|
16126683 |
|
|
|
|
61445287 |
Feb 22, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 2510/00 20130101;
C12Q 1/6883 20130101; C12Q 2600/156 20130101 |
International
Class: |
C12Q 1/6883 20060101
C12Q001/6883 |
Claims
1. A method of detecting transplantation failure of a transplanted
organ or transplanted cells in a recipient which comprises: (a)
screening one or more DNA polymorphisms to identify one or more
donor-positive, recipient-negative DNA polymorphisms and (b)
tracking the presence or increased level of one or more
donor-positive, recipient-negative DNA polymorphisms in recipient
samples over time, wherein the presence or increased level of one
or more donor-positive, recipient-negative DNA polymorphisms in
recipient samples over time indicates transplantation failure.
2. The method of claim 1, wherein the screening and tracking are
done using bi-directional pyrophosphorolysis activated
polymerization.
3. The method of claim 1, wherein the one or more donor-positive,
recipient-negative DNA polymorphisms are selected from a panel of
polymorphisms.
4. The method of claim 3, wherein the panel of polymorphisms is
universal to multiple donors and multiple recipients.
5. The method of claim 1, which further comprises before step (a)
the step: selecting a panel comprising more than one DNA
polymorphism.
6. The method of claim 5, wherein the panel comprises 11 or more
DNA polymorphisms.
7. The method of claim 5, wherein the DNA polymorphisms are single
nucleotide polymorphisms.
8. The method of claim 7, wherein each of the polymorphisms (i) is
a validated polymorphism, (ii) is selected from the group
consisting of C/G, G/C, T/A and A/T polymorphisms and (iii) has a
frequency of greater than or equal to about 30% and less than or
equal to about 70%, preferably about 50%.
9. The method of claim 8, wherein the polymorphisms are those set
forth in Table 2.
10. The method of claim 9, wherein primers for each polymorphism
are those set forth in Table 2.
11. The method of claim 1, wherein a homozygous and/or heterozygous
genotype of a biallelic polymorphism is selected as a DNA
polymorphism for the donor and a homozygous genotype is selected as
a DNA polymorphism for the recipient.
12. A method of detecting transplantation failure of a transplanted
organ or transplanted cells in a recipient which comprises: (a)
isolating a donor sample and a recipient sample, (b) screening one
or more DNA polymorphisms in the donor and recipient samples to
identify one or more donor-positive, recipient-negative DNA
polymorphisms and (c) tracking the presence or increased level of
one or more donor-positive, recipient-negative DNA polymorphisms in
recipient samples over time, wherein the presence or increased
level of one or more donor-positive, recipient-negative DNA
polymorphisms in recipient samples over time indicates
transplantation failure.
13. The method of claim 12, wherein the tracking step comprises:
(i) isolating a recipient sample, (ii) detecting the presence or
increased level of one or more donor-positive, recipient-negative
DNA polymorphisms in the recipient sample, and (iii) repeating
steps (i) and (ii) over time.
14. The method of claim 12, wherein the screening and tracking are
done using bi-directional pyrophosphorolysis activated
polymerization.
15. The method of claim 12, wherein the one or more donor-positive,
recipient-negative DNA polymorphisms are selected from a panel of
polymorphisms.
16. The method of claim 15, wherein the panel of polymorphisms is
universal to multiple donors and multiple recipients.
17. The method of claim 12, which further comprises before step (a)
the step: selecting a panel comprising more than one DNA
polymorphism.
18. The method of claim 17, wherein the panel comprises 11 or more
DNA polymorphisms.
19. The method of claim 17, wherein the DNA polymorphisms are
single nucleotide polymorphisms.
20. The method of claim 19, wherein each of the polymorphisms (i)
is a validated polymorphism, (ii) is selected from the group
consisting of C/G, G/C, T/A and A/T polymorphisms and (iii) has a
frequency of greater than or equal to about 30% and less than or
equal to about 70%, preferably about 50%.
21. The method of claim 20, wherein the polymorphisms are those set
forth in Table 2.
22. The method of claim 21, wherein primers for each polymorphism
are those set forth in Table 2.
23. The method of claim 12, wherein a homozygous and/or
heterozygous genotype of a biallelic polymorphism is selected as a
DNA polymorphism for the donor and a homozygous genotype is
selected as a DNA polymorphism for the recipient.
24. A method of treating transplantation failure of a transplanted
organ or transplanted cells in a subject which comprises: (a)
detecting transplantation failure in a subject according to the
method of claim 1 and (b) initiating treatment of transplantation
failure in the subject if transplantation failure is detected in
step (a).
25. A method of detecting cell death or cellular damage in a
recipient receiving transplanted cells which comprises: (a)
screening one or more DNA polymorphisms to identify one or more
recipient-positive, donor-negative DNA polymorphisms and (b)
tracking the presence or increased level of one or more
recipient-positive, donor-negative DNA polymorphisms in recipient
samples over time, wherein the presence or increased level of one
or more recipient-positive, donor-negative DNA polymorphisms in
recipient samples over time indicates cell death or cellular damage
in the recipient.
26. The method of claim 15, wherein the screening and tracking are
done using bi-directional pyrophosphorolysis activated
polymerization.
27. The method of claim 25, wherein a homozygous genotype of a
biallelic polymorphism is selected as a DNA polymorphism for the
donor and a homozygous and/or heterozygous genotype is selected as
a DNA polymorphism for the recipient.
28. A method of detecting cell death or cellular damage in a
recipient receiving transplanted cells which comprises: (a)
isolating a donor sample and a recipient sample, (b) screening one
or more DNA polymorphisms in the donor and recipient samples to
identify one or more recipient-positive, donor-negative DNA
polymorphisms and (c) tracking the presence or increased level of
one or more recipient-positive, donor-negative DNA polymorphisms in
recipient samples over time, wherein the presence or increased
level of one or more recipient-positive, donor-negative DNA
polymorphisms in recipient samples over time indicates cell death
or cellular damage in the recipient.
29. The method of claim 28, wherein the tracking step comprises:
(i) isolating a recipient sample, (ii) detecting the presence or
increased level of one or more recipient-positive, donor-negative
DNA polymorphisms in the recipient sample, and (iii) repeating
steps (i) and (ii) over time.
30. The method of claim 28, wherein the screening and tracking are
done using bi-directional pyrophosphorolysis activated
polymerization.
31. The method of claim 28, wherein a homozygous genotype of a
biallelic polymorphism is selected as a DNA polymorphism for the
donor and a homozygous and/or heterozygous genotype is selected as
a DNA polymorphism for the recipient.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. patent
application Ser. No. 14/000,485, filed on 25 Nov. 2014, which in
turn is a national phase entry under 35 U.S.C. .sctn. 371 of
PCT/US2012/025393, filed on 16 Feb. 2012, and claims the benefit of
priority to U.S. Provisional Application No. 61/445,287, filed 22
Feb. 2011. Each application is incorporated herein by reference in
its entirety.
SEQUENCE SUBMISSION
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is entitled
1954548US3SequenceListing.txt, created on 10 Sep. 2018 and is 12 kb
in size. The information in the electronic format of the Sequence
Listing is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0003] The present invention relates to the field of organ
transplantation, more particularly to methods for detecting organ
transplantation failure.
[0004] The publications and other materials used herein to
illuminate the background of the invention, and in particular,
cases to provide additional details respecting the practice, are
incorporated by reference in their entirety for all that they
disclose, and for convenience are referenced in the following text
by author and date and are listed alphabetically by author in the
appended bibliography.
[0005] Transplant Rejection:
[0006] Transplant rejection occurs when a transplanted organ,
tissue, or stem cell is not accepted by the body of the transplant
recipient. This is explained by the concept that the immune system
of the recipient attacks the transplanted organ or tissue. This is
expected to happen, because the immune system's purpose is to
distinguish foreign material within the body and attempt to destroy
it (http://en.wikipedia.org/wiki/Transplant_rejection).
[0007] Although immunosuppressive drugs are used to prevent organ
rejection, organ and tissue transplantation would almost always
cause an immune response and result in destruction of the foreign
tissue. Thus, the dying cells of the foreign tissue releases their
DNA and RNA into peripheral blood.
[0008] Current Methods in Detection of Transplant Rejection:
[0009] Currently, transplant rejection can be found by symptoms and
signs that the organ isn't functioning properly, such as elevated
creatinine or less urine output with kidney transplants, shortness
of breath and less tolerance to exertion with heart transplants,
and yellow skin color and easy bleeding with liver transplants. A
biopsy of the transplanted organ can confirm that it is being
rejected. When organ rejection is suspected, one or more of the
following tests may be performed prior to organ biopsy, such as
abdominal CT scan, chest x-ray, heart echocardiography, kidney
arteriography, kidney ultrasound, and lab tests of kidney or liver
function. Although the above examinations are available, it is
still difficult to detect early stage, particularly very early
stage, transplant rejection.
[0010] Limits of PCR-Based Technologies:
[0011] PCR-based methods, such as allele-specific PCR (Newton et
al., 1989; Nichols et al., 1989; Sommer et al., 1989; Wu et al.,
1989), peptide nucleic acid (PNA) clamping blocker PCR,
allele-specific competitive blocker PCR, can typically detect a
copy of the point mutation in no more than 10.sup.2 copies of the
wildtype genome, otherwise they cause false positives (Parsons and
Heflich, 1997).
[0012] In addition to above potential false positives, it is
difficult for PCR to detect a single copy of mutations because of
primer dimers and false priming sites, causing possible false
negatives.
[0013] PAP Technology:
[0014] Pyrophosphorolysis-Activated Polymerization (PAP) is a new
nucleic acid amplification technology that has surprising
properties for nucleic acid amplification (Liu and Sommer, 2004).
For example, its amplification selectivity, or signal to noise
ratio, is so extremely high that it can detect a single copy of DNA
mutant molecule in 1 billion of almost identical wild type
molecules. This level of selectivity is over 1,000,000 times more
than that of PCR or any other technologies. In addition, its
sensitivity or the detectable smallest copy number of the target
molecule can reliably arrive at a single copy level. This level of
sensitivity is over 100 times more than that of PCR technology.
[0015] It is desired to develop new techniques for monitoring early
transplantation failure in transplant donors.
SUMMARY OF THE INVENTION
[0016] Transplant rejection occurs when a transplanted organ,
tissue, or stem cell is not accepted by the body of the transplant
recipient. This is explained by the concept that the immune system
or compounds of the recipient attacks the transplanted organ or
tissue, which causes donor cells to die and release their DNA into
blood. Through detection of minimal levels of donor-positive but
recipient-negative DNA markers in recipient's plasma,
transplantation failure can be identified at very early stages and
therefore therapy can be embarked to patient rejection. In
accordance with the present invention, ultra-high sensitive
pyrophosphorolysis activated polymerization (PAP) is used to detect
even a single copy of donor-positive but recipient-negative DNA
markers in recipient blood. Also in accordance with the present
invention, a universal set of PAP assays is applied for virtually
100% donors and recipients, such as kidney, liver, heart, lung,
islet cell, bone marrow and other transplantations, greatly
reducing the cost of monitoring transplantation failure.
[0017] Therefore, the present invention has the advantages: i)
ability to detect a single copy of the targeted marker in plasma,
ii) over 1000-times more sensitive and selective than any current
PCR-based methods, iii) constant ratio between the dying cells and
the specific marker, iv) cost effective because universal assays
can be used, and v) non-invasive testing.
[0018] Thus, in one aspect, the present invention provides a method
for detecting transplantation failure of a transplanted organ or
cells which comprises detecting a donor-positive but
recipient-negative DNA marker in the recipient. In one embodiment,
one or more donor-positive but recipient-negative DNA markers are
detected. In another embodiment, blood or plasma is isolated from
the recipient for use in detecting the DNA markers. In an
additional embodiment, DNA is isolated from the blood or plasma. In
a further embodiment, the presence of the DNA markers is detected
using one or more PAP amplification reactions.
[0019] In one embodiment, DNA markers that are selected for an
individual donor and an individual recipient are used. Such DNA
markers are termed individual DNA markers. In another embodiment,
DNA markers that are universal for most donors and recipients are
used. Such DNA markers are termed universal markers. In a further
embodiment, the PAP amplification reactions are used to detect the
DNA markers or polymorphisms described herein. In one embodiment,
the transplanted organ is heart, liver, lung, kidney, intestine,
pancreas, islet cells and bone marrow. In another embodiment, the
minimal levels of the DNA markers are detected. Since minimal
levels can be detected in accordance with the present invention,
early detection of transplantation failure can be detected and
treated using appropriate and conventional organ rejection therapy.
In accordance with the present invention, any DNA marker or
polymorphism that is capable of distinguishing the donor tissue
from the recipient tissue can be used to detect early
transplantation failure.
[0020] In one embodiment, the method comprises a screening step and
a tracking step. The screening step comprises screening a donor
sample and a recipient sample to identify donor-positive but
recipient-negative markers. In one embodiment, the sample may be a
plasma sample or it may be any tissue sample. In another
embodiment, a set of common biallelic polymorphisms are compared
between donor and recipient genomic DNA samples extracted from
white blood cells or other tissue samples to select DNA markers
that are different between the donor and the recipient. In an
additional embodiment, PAP amplification reactions or other well
known amplification reactions, such as PCR amplification reactions,
can be used for the screening step. The tracking step comprises
tracking one or more donor-positive but recipient-negative marker
in recipient's blood. In one embodiment, the marker is tracked in
recipient's plasma. In another embodiment, a specific PAP assay is
performed for detecting the DNA marker(s). Through detection of a
DNA marker's presence or increased levels, transplantation failure
can be identified at very early stages.
[0021] In a second aspect, the present invention provides a method
of treating transplantation failure of a transplanted organ or
transplanted cells in a subject. In accordance with the present
invention, the method comprises (a) detecting transplantation
failure in a subject according to the method as disclosed herein
and (b) initiating treatment of transplantation failure in the
subject if transplantation failure is detected in step (a).
Conventional treatments for transplantation failure are well known
to the skilled artisan and can be used to treat transplantation
failure detected by the present invention.
[0022] In a third aspect, the present invention provides a method
for detecting transplantation failure of cells that are
transplanted in multiple recipients which comprises detecting a
donor-positive but recipient-negative DNA marker in the recipient.
This method is similar to that described above for the first aspect
of the invention with the exception of the markers to be examined
and only using a single Bi-Pap assay. In one embodiment, the
transplanted cells are engineered stem cells, engineered
pluripotent stem cells, differentiated stem cells or differentiated
induce pluripotent stem cells. In another embodiment, the blood or
plasma is isolated from the recipient for use in detecting the DNA
markers. In an additional embodiment, DNA is isolated from the
blood or plasma. In a further embodiment, the polymorphism status
of the donor is predetermined on many loci by any suitable method,
such as Sanger sequencing or parallel sequencing. Homozygous and/or
heterozygous genotypes, such as C:G/C:G and/or C:G/G:C of a
biallelic polymorphism, are selected for the donor genotypes. To
differentiate from the donor genotypes, a genotype, such as a
G:C/G:C homozygous genotype, is selected for the recipients. For
each such polymorphism locus, the frequencies of C:G allele and G:C
allele are accounted in the recipients. High frequency of G:C
allele but low frequency of C:G allele are preferred to get the
donor-positive but recipient-negative genotypes efficiently.
[0023] In a fourth aspect, the present invention provides a method
for detecting dying cells of a recipient or cellular damage of a
recipient in instances in which cells are transplanted into
multiple recipients which comprises detecting a recipient-positive
but donor-negative DNA marker in the recipient. This method is
similar to that described above for the first aspect of the
invention with the exception of the markers to be examined and only
using a single Bi-Pap assay. In one embodiment, the transplanted
cells are engineered stem cells, engineered pluripotent stem cells,
differentiated stem cells or differentiated induce pluripotent stem
cells. In another embodiment, the blood or plasma is isolated from
the recipient for use in detecting the DNA markers. In an
additional embodiment, DNA is isolated from the blood or plasma. In
a further embodiment, the polymorphism status of the donor is
predetermined on many loci by any suitable method, such as Sanger
sequencing or parallel sequencing. Homozygous genotypes, such as
G:C/G:C of a biallelic polymorphism, are selected for the donor
genotypes. To differentiate from the donor genotypes, genotypes,
such as C:G/C:G homozygous genotypes and/or C:G/G:C heterozygous
genotypes, are selected for analysis for the recipients. For such
an polymorphism locus, the frequencies of C:G allele and G:C allele
are also accounted in the recipients. High frequency of C:G allele
but low frequency of G:C allele are preferred.
BRIEF DESCRIPTION OF THE FIGURES
[0024] FIG. 1 illustrates the principle of PAP. The primer is
blocked at its 3' end with, e.g., a dideoxynucleotide, preventing
it from being directly extended. When the blocked primer anneals to
its complementary template strand, the 3' blocker can be removed by
pyrophosphorolysis. The activated primer can then be extended.
[0025] FIG. 2 illustrates that PAP has high selectivity in
detecting a mutation in an abundance of the wild type template
because of the serial coupling. The blocked primer matches the
mutant template and specific amplification occurs efficiently. The
blocked primer mismatches the wild type template at the 3' end,
causing types I and II nonspecific amplifications. Type I
nonspecific amplification occurs rarely when mismatched
pyrophosphorolysis occurs (the frequency is estimated to be
10.sup.-5). Type I error cannot be accumulated. Type II error
occurs when both mismatched pyrophosphorolysis and
mis-incorporation are serially coupled (the coupling frequency is
estimated to be 3.3.times.10.sup.-11) (Kornberg and Baker 1992).
Once this Type II error occurs, the mutated product can be
accumulated exponentially in subsequent cycles, limiting the
selectivity.
[0026] FIG. 3 shows the sensitivity and specificity of Bi-PAP.
Experiment I: To test the specificity, the mutant blocked primers
mismatched the wildtype DNA template. Only Lane 1 generated the
mutant product (false positive). Experiment II: To test the
sensitivity, the blocked primers matched the mutant DNA template to
generate the mutant product from Lanes 7 to 10. Lane "C WT" is WT
control. Lane "C Mut" is Mut control. The WT and Mut products (79
bp) with unique mobility are shown on the left of the
non-denaturing PAGE gel.
[0027] FIGS. 4A and 4 B show that Bi-PAP detects an A:T to T:A
mutation with high specificity (FIG. 4A), and a C:G to T:A mutation
with low specificity (FIG. 4B). In lanes 1 to 6, the sensitivity
was examined by a 3-fold serial dilution of the matched mutant
template. The sensitivity is one copy. In lanes 9 to 12, the
specificity was tested by a 10-fold serial dilution of the
mismatched wildtype template. The specificity is 10.sup.9 copy in
(FIG. 4A) and 10.sup.4 in (FIG. 4B). Lanes 7 and 8 are two negative
controls without template. Lane M is 100 ng of Phi-X174/HaeIII
DNA.
[0028] FIG. 5 shows a two-step procedure of screening and tracking
in accordance with one embodiment of the present invention.
[0029] FIG. 6 shows a typical real time PAP sensitivity with
matched template. Assay 3 is exampled. Pooled standard genomic DNA
was 3-fold serially diluted with the matched copied indicated
[0030] FIG. 7 shows PAP sensitivity with matched template on
agarose gel. Assays 1 to 6 are shown. Lane M is 100 ng of
Phi-X174/HaeIII DNA.
[0031] FIGS. 8A and 8b show PAP specificity with mismatched genomic
DNA template (FIG. 8A) and no DNA (FIG. 8B) on agarose gel. Assays
1 to 6 are shown.
[0032] FIG. 9 shows monitoring islet cell transplantation rejection
through detection of donor-positive but recipient-negative DNA
markers in recipient's plasma. The patient received the third and
fourth islet cell transplantations. During post transplantation,
the patient showed levels of donor-positive but recipient-negative
DNA markers in plasma. Importantly, a strong second peak of
donor-positive but recipient-negative DNA markers occurred around
the time when Insulin resumption was greatly increased together
with higher Cylex and immuno-suppressive drug levels, suggesting a
graft rejection. A PAP assay was used to measure the absolute copy
number of donor-positive but recipient-negative DNA markers in 1 mL
of plasma and then converted to the relative level to the total
amount of plasma DNA.
DETAILED DESCRIPTION OF THE INVENTION
[0033] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the art to which the invention belongs.
[0034] As used herein, "pyrophosphorolysis activated
polymerization" ("PAP") refers to a nucleic acid amplification
technology that uses one or more blocked primers and has surprising
properties for nucleic acid amplification. In addition to
references cited herein, PAP has been described in U.S. Pat. Nos.
6,534,269, 7,033,763, 7,105,298, 7,238,480, 7,504,221, 7,914,995
and 7,919,253, each incorporated herein in their entirety, and in
U.S. Patent Application Publication No. 2011/0124051, incorporated
herein in its entirety.
[0035] As used herein, analytical "sensitivity" refers to the
smallest number of copies of a template that generates a detectable
product when the blocked primers match the template.
[0036] As used herein, analytical "specificity" refers to the
largest number of copies of the mismatched template that generates
an undetectable product when the blocked primers mismatch the
template.
[0037] As used herein, analytical "selectivity" refers to the ratio
of sensitivity to specificity.
[0038] The terms "DNA marker," "DNA polymorphism" or "polymorphism"
are used interchangeably herein.
[0039] The terms "transplantation failure," "transplant failure,"
"transplant rejection" or "transplantation rejection" are used
interchangeably herein.
[0040] Briefly, PAP is based on serial coupling of
pyrophosphorolysis and polymerization. Pyrophosphorolysis is the
reverse reaction of DNA polymerization in which the 3' nucleotide
of a hybridized primer is removed:
[dNMP].sub.n+PPi.fwdarw.[dNMP].sub.n-1+dNTP (Deutscher and
Kornberg, 1969).
[0041] In PAP, the primer (also sometimes referred to as
pyrophosphorolysis activatable oligonucleotide (P*)) is blocked at
its 3' end preventing it from being directly extended by DNA
polymerase (FIG. 1). The 3' end of the primer can be blocked using
a 3'deoxynucleotide, a 2',3'-dideoxynucleotide, an
acyclonucleotide, 3'-deoxyadenosine (cordycepin),
3'-azido-3'-deoxythymidine (AZT), 2',3'-dideoxyinosine (ddI),
2',3'-dideoxy-3'-thiacytidine (3TC) or
2',3'-didehydro-2',3'-dideoxythymidine (d4T). Alternatively, the
primer is an inactive oligonucleotide that is activated by a
nucleic acid metabolizing enzyme, such as helicases,
topoisomerases, telomerases, RNase H or restriction enzymes. When
the blocked primer anneals to its complementary template strand,
the 3' blocker can be removed by pyrophosphorolysis. The activated
primer can then be extended. In such a way, pyrophosphorolysis and
polymerization are serially coupled (Liu and Sommer, 2004).
Alternatively, the inactive primer anneals to its complementary
template strand, the inactive primer is activated by a nucleic acid
metabolizing enzyme. The activated primer can then be extended. In
such a way, activation and polymerization are serially coupled
(U.S. Pat. No. 7,919,253).
[0042] The serial coupling provides PAP with extremely high
selectivity, because significant nonspecific amplification that
causes false positive requires mismatch pyrophosphorolysis followed
by mis-incorporation, an event with a frequency estimated to be
3.3.times.10.sup.-11 (FIG. 2).
[0043] The bi-directional form of PAP (Bi-PAP) is especially
suitable for allele-specific amplification that uses two opposing
blocked primers with one nucleotide overlap at their 3' ends (Liu
and Sommer, 2004). Bi-PAP can detect one copy of a mutant allele in
the presence of 10.sup.9 copies of the wildtype DNA with false
positives. Briefly, Bi-PAP is a novel design that preferably uses
two opposing pyrophosphorolysis activatable oligonucleotides (P*)
with one nucleotide overlap at their 3' termini. Thus, in Bi-PAP,
PAP is performed with a pair of opposing activatable
oligonucleotide P*s. Both the downstream and upstream P*s are
specific for the nucleotide of interest at the 3' termini. See,
e.g., U.S. Pat. No. 7,033,763.
[0044] Using .lamda. phage DNA template, we tested the sensitivity
to detect an A:T.fwdarw.T:A mutation when the blocked primers
matched the mutant .lamda. phage DNA template (FIG. 3). The
smallest number of copies of the matched template with a detectable
product, or the sensitivity, is two copies. The specificity was
defined when the blocked primers mismatched the wildtype .lamda.
phage DNA template at the 3' ends. The largest number of copies of
the mismatched template without a detectable product (false
positive), or the specificity, is 2.times.10.sup.9. The
selectivity, the ratio of the sensitivity to the specificity, is
thus 1:10.sup.9. Similar results were also obtained for two other
T:A.fwdarw.G:C and T:A.fwdarw.C:G mutations (Liu and Sommer,
2004).
[0045] Using human genome, 13 assays targeting all six possible
types of single-base substitutions in the P53 gene were further
validated (FIG. 4). Twelve assays had sensitivity of one copy and
one assay had sensitivity of ten copies of the matched templates
(Table 1) (Shi et al., 2007).
TABLE-US-00001 TABLE 1 Relationship Between Assay Performance and
Mutation Types Mutation Number of type.sup.a Sensitivity
Specificity Selectivity assays A:T.fwdarw.G:C 1 copy 10.sup.7
copies 1:10.sup.7 2 A:T.fwdarw.C:G 10 10.sup.9 1:10.sup.8 1
G:C.fwdarw.C:G 1 10.sup.9 1:10.sup.9 3 A:T.fwdarw.T:A 1 10.sup.9
1:10.sup.9 1 G:C.fwdarw.A:T 1 10.sup.4-10.sup.5 1:10.sup.4 to
1:10.sup.5 4 G:C.fwdarw.T:A 1 10.sup.5-10.sup.6 1:10.sup.5 to
1:10.sup.6 2 .sup.aSix possible types of single base substitutions
are classified on both sense and antisense stands. For example,
G:C.fwdarw.A:T and C:G.fwdarw.T:A are considered as one mutation
type.
[0046] Two distinct categories of the specificity were recognized,
and they were highly associated with the targeted six possible
types of single base substitutions. Assays for four types of
mutations, A:T.fwdarw.G:C, A:T.fwdarw.C:G, G:C.fwdarw.C:G, and
A:T.fwdarw.T:A, had high specificity from 10.sup.7 to 10.sup.9,
being particularly suitable for the present invention.
[0047] Assays for the remaining two types of mutations,
G:C.fwdarw.A:T and G:C.fwdarw.T:A, had relatively low specificity
between 10.sup.4 and 10.sup.6 (Table 1) due to spontaneous damage
on the DNA template.
[0048] The relatively low specificity and selectivity for
G:C.fwdarw.A:T mutation is caused by spontaneous deamination of
cytosine, the hydrolysis reaction of dC into dU, or 5'-methylated
dC into dT (Frederico et al., 1990).
[0049] The relatively low specificity and selectivity for
G:C.fwdarw.T:A mutations is due to the presence of 8-oxo-dG in the
genomic DNA, which is commonly found in mammalian DNA. DNA
polymerases can misincorporate dAMP with 8-oxodG as template (Arif
and Gupta, 2003).
[0050] However, two types of mutations, G:C.fwdarw.A:T and
G:C.fwdarw.T:A, are observed to have lower specificity or
selectivity than other types of mutations due to spontaneous
chemical damages on DNA template. G:C.fwdarw.A:T mutation is caused
by spontaneous deamination of cytosine, the hydrolysis reaction of
dC into dU, or 5'-methylated dC into dT. G:C.fwdarw.T:A mutations
is due to the spontaneous presence of 8-oxo-dG. Thus, the low
specificity is not associated with the PAP inherent property.
[0051] In accordance with the present invention, we hypothesized
that the level of donor-positive but recipient-negative DNA markers
in blood can reflect the status of transplant rejection in early
stage because the rejection causes donor cells to die, releasing
their DNA into blood. Through detection of minimal levels of
donor-positive but recipient-negative DNA markers in recipient's
plasma, transplantation failure can be identified at very early
stages.
[0052] In accordance with the present invention, ultra-high
sensitive PAP is used to detect even a single copy of
donor-positive but recipient-negative DNA markers in recipient
blood. Also importantly, a universal set of PAP assays are applied
for virtually 100% donors and recipient including, but not limited
to, islet cell, liver, heart, kidney, lung, and bone marrow
transplantation, thereby greatly reducing the cost. Therefore, the
method of the present invention has the following advantages: i)
Ability to detect a single copy of the targeted marker in plasma,
ii) Over 1000-times more sensitive and selective than any current
PCR-based methods, iii) constant ratio between the dying cells and
the specific marker, iv) Cost effective because of universal
assays, and v) Non-invasive testing.
[0053] Thus, in one aspect, the present invention provides a method
for detecting transplantation failure of a transplanted organ or
cells which comprises detecting a donor-positive but
recipient-negative DNA marker in the recipient's plasma. In one
embodiment, one or more donor-positive but recipient-negative DNA
markers are detected. In another embodiment, plasma is isolated
from the recipient for use in detecting the DNA markers. In an
additional embodiment, DNA is isolated from the plasma. In a
further embodiment, the presence of the DNA markers is detected
using one or more PAP amplification reactions, preferably one or
more Bi-PAP amplification reactions.
[0054] In one embodiment, DNA markers that are selected for an
individual donor and an individual recipient are used. Such DNA
markers are termed individual DNA markers. In one embodiment, DNA
markers are screened with respect to the individual donor and the
individual recipient to identify one or more suitable DNA markers
that can be used to track transplantation failure in the donor. In
one embodiment, suitable DNA markers that can be screened include
HLA alleles.
[0055] In another embodiment, DNA markers that are universal for
most donors and recipients are used. Such DNA markers are termed
universal markers. In one embodiment, the universal DNA markers or
polymorphisms are single nucleotide polymorphisms. In accordance
with the present invention, factors which are used to guide
polymorphism selection include (i) polymorphism reliability, (ii)
polymorphism type and (iii) polymorphism frequency. With respect to
polymorphism reliability, only well validated polymorphisms are
used. Well validated polymorphisms include, but are not limited to,
HapMap, CEPH, AFD, and the like. With respect to polymorphism type,
only C/G, G/C, T/A and A/T polymorphisms are used in order to avoid
issues of spontaneous DNA damage taking place that can occur with
C/T, G/A, T/C and G/A polymorphisms. With respect to polymorphism
frequency, it is preferred to use polymorphisms having a frequency
of greater than or equal to about 30% and less than or equal to
about 70%, preferably a frequency of about 50%. Polymorphisms with
this frequency are preferred in order to minimize the number of
polymorphisms that are needed to test nearly 100% of donors and
recipients. In accordance with the present invention, it has been
found that 11 polymorphisms can be selected for use in the method
of the present invention to cover nearly 100% of all
transplantation cases. It is evident that more polymorphisms can be
developed and used if it is desired, or if none of the 11
polymorphisms is capable of distinguishing between the donor and
the recipient. The selected polymorphisms are sometimes termed a
polymorphism panel herein. In a further embodiment, the PAP
amplification reactions are used to detect the polymorphisms
described herein.
[0056] In one embodiment, the transplanted organ is heart, liver,
lung, kidney, intestine, pancreas, islet cells and bone marrow. In
another embodiment, the minimal levels of the DNA markers are
detected. Since minimal levels can be detected in accordance with
the present invention, early detection of transplantation failure
can be detected and treated using appropriate and conventional
organ rejection therapy. In accordance with the present invention,
any DNA marker or polymorphism that is capable of distinguishing
the donor tissue from the recipient tissue can be used to detect
early transplantation failure.
[0057] In one embodiment, the method comprises a screening step and
a tracking step. The screening step comprises screening a donor
sample and a recipient sample to identify donor-positive but
recipient-negative markers. In one embodiment, the sample may be a
plasma sample or it may be any tissue sample. In another
embodiment, a set of common biallelic polymorphisms are compared
between donor and recipient genomic DNA samples extracted from
white blood cells or other tissue samples to select DNA markers
that are different between the donor and the recipient. In an
additional embodiment, PAP amplification reactions or other well
known amplification reactions, such as PCR amplification reactions,
can be used for the screening step. The tracking step comprises
tracking one or more donor-positive but recipient-negative marker
in recipient's blood over a desired period of time, e.g., daily,
every other day, semi-weekly, weekly, etc., to detect the presence
or increased levels of the marker as an indicator of
transplantation failure. In one embodiment, the marker is tracked
in recipient's plasma. In another embodiment, a specific PAP assay
is performed for detecting the DNA marker(s). Through detection of
a DNA marker's presence or increased levels, transplantation
failure can be identified at very early stages, and appropriate
treatment can be initiated at an earlier time.
[0058] In a second aspect, the present invention provides a method
of treating transplantation failure of a transplanted organ or
transplanted cells in a subject. In accordance with the present
invention, the method comprises (a) detecting transplantation
failure in a subject according to the method as disclosed herein
and (b) initiating treatment of transplantation failure in the
subject if transplantation failure is detected in step (a).
Conventional treatments for transplantation failure are well known
to the skilled artisan and can be used to treat transplantation
failure detected by the present invention.
[0059] In a third aspect, the present invention provides a method
for detecting transplantation failure of cells that are
transplanted in multiple recipients which comprises detecting a
donor-positive but recipient-negative DNA marker in the recipient.
This method is similar to that described above for the first aspect
of the invention with the exception of the markers to be examined
and only using a single Bi-Pap assay. In one embodiment, the
transplanted cells are engineered stem cells, engineered
pluripotent stem cells, differentiated stem cells or differentiated
induce pluripotent stem cells. In another embodiment, the blood or
plasma is isolated from the recipient for use in detecting the DNA
markers. In an additional embodiment, DNA is isolated from the
blood or plasma. In a further embodiment, the polymorphism status
of the donor is predetermined on many loci by any suitable method,
such as Sanger sequencing or parallel sequencing. Homozygous and/or
heterozygous genotypes, such as C:G/C:G and/or C:G/G:C of a
biallelic polymorphism, are selected for the donor genotypes. To
differentiate from the donor genotypes, a genotype, such as a
G:C/G:C homozygous genotype, is selected for the recipients. For
each such polymorphism locus, the frequencies of C:G allele and G:C
allele are accounted in the recipients. High frequency of G:C
allele but low frequency of C:G allele are preferred to get the
donor-positive but recipient-negative genotypes efficiently.
[0060] In a fourth aspect, the present invention provides a method
for detecting dying cells of a recipient or cellular damage of a
recipient in instances in which cells are transplanted into
multiple recipients which comprises detecting a recipient-positive
but donor-negative DNA marker in the recipient. This method is
similar to that described above for the first aspect of the
invention with the exception of the markers to be examined and only
using a single Bi-Pap assay. In one embodiment, the transplanted
cells are engineered stem cells, engineered pluripotent stem cells,
differentiated stem cells or differentiated induce pluripotent stem
cells. In another embodiment, the blood or plasma is isolated from
the recipient for use in detecting the DNA markers. In an
additional embodiment, DNA is isolated from the blood or plasma. In
a further embodiment, the polymorphism status of the donor is
predetermined on many loci by any suitable method, such as Sanger
sequencing or parallel sequencing. Homozygous genotypes, such as
G:C/G:C of a biallelic polymorphism, are selected for the donor
genotypes. To differentiate from the donor genotypes, genotypes,
such as C:G/C:G homozygous genotypes and/or C:G/G:C heterozygous
genotypes, are selected for analysis for the recipients. For such
an polymorphism locus, the frequencies of C:G allele and G:C allele
are also accounted in the recipients. High frequency of C:G allele
but low frequency of G:C allele are preferred.
[0061] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of chemistry,
molecular biology, microbiology, recombinant DNA, genetics,
immunology, cell biology, cell culture and transgenic biology,
which are within the skill of the art. See, e.g., Maniatis et al.,
1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.); Sambrook et al., 1989, Molecular Cloning, 2nd
Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Ausubel
et al., 1992), Current Protocols in Molecular Biology (John Wiley
& Sons, including periodic updates); Glover, 1985, DNA Cloning
(IRL Press, Oxford); Russell, 1984, Molecular biology of plants: a
laboratory course manual (Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.); Anand, Techniques for the Analysis of Complex
Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide
to Yeast Genetics and Molecular Biology (Academic Press, New York,
1991); Harlow and Lane, 1988, Antibodies, (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.); Nucleic Acid
Hybridization (B. D. Hames & S. J. Higgins eds. 1984);
Transcription And Translation (B. D. Hames & S. J. Higgins eds.
1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc.,
1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal,
A Practical Guide To Molecular Cloning (1984); the treatise,
Methods In Enzymology (Academic Press, Inc., N.Y.); Methods In
Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical
Methods In Cell And Molecular Biology (Mayer and Walker, eds.,
Academic Press, London, 1987); Handbook Of Experimental Immunology,
Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott,
Essential Immunology, 6th Edition, Blackwell Scientific
Publications, Oxford, 1988; Fire et al., RNA Interference
Technology: From Basic Science to Drug Development, Cambridge
University Press, Cambridge, 2005; Schepers, RNA Interference in
Practice, Wiley--VCH, 2005; Engelke, RNA Interference (RNAi): The
Nuts & Bolts of siRNA Technology, DNA Press, 2003; Gott, RNA
Interference, Editing, and Modification: Methods and Protocols
(Methods in Molecular Biology), Human Press, Totowa, N.J., 2004;
Sohail, Gene Silencing by RNA Interference: Technology and
Application, C R C, 2004.
EXAMPLES
[0062] The present invention is described by reference to the
following Examples, which is offered by way of illustration and is
not intended to limit the invention in any manner Standard
techniques well known in the art or the techniques specifically
described below were utilized.
Example 1
Materials and Methods
[0063] Separation of Plasma from Cells:
[0064] 10 mL of peripheral blood was collected in an EDTA
anticoagulation tube and then centrifuged at 1,300 RCF (2,500 rpm
with CAT 218 swing rotor, Forma Scientific) for 10 min at 4.degree.
C. Remove plasma in the upper layer into 1.5 mL Eppendorf tubes.
About 5 mL of plasma was collected from each EDTA tube. The white
and red cells in the lower layer was re-suspended in PBS
buffer.
[0065] Extraction of Plasma DNA for Tracking:
[0066] Plasma DNA was extracted using Qiamp MinElute Virus Spin Kit
(Qiagen Cat 57704) according to manufacture's instruction. 1 mL of
plasma was processed and 45 .mu.L of plasma DNA was finally eluted
to an 1.5 mL Eppedorf tube with an estimated recovery efficiency of
90%.
[0067] Two revisions were made to the standard protocol: 1) the
elution buffer contains 10 mM Tris/HCl, pH 8.0, 0.1 mm EDTA for
convenience in downstream treatment; and 2) the elution buffer was
heated to 70.degree. C. before its use for high recovery
efficiency.
[0068] Extraction of Cellular DNA for Screening:
[0069] The cellular DNA was extracted using QIAamp Blood kit
according to manufacturer's protocol (Qiagen). The resulting DNA
was separately resolved in 50 .mu.L of TE buffer.
[0070] Preparation of Standard Genomic DNA Pool:
[0071] To get the expected frequency of the polymorphisms, 16
genomic DNA samples extracted from 16 Caucasians were pooled with
equal quantity. To simulate the size of plasma DNA in vivo, the
genomic DNA was randomly sheared to about 150-200 bp by an
ultrasonic instrument and then extracted by a Qiagen DNA extraction
kit.
[0072] Bi-Pap Assays:
[0073] The blocked primers (Table 2) were purchased from BioVision
USA. The PAP reaction mixture will contain 800 mM Tris HCl (pH 7.8
at 25.degree. C.), 10 mM (NH.sub.4).sub.2SO.sub.4, 1.0 mM
MgCl.sub.2, 25 .mu.M each dNTP, 0.1 .mu.M each blocked primer, 90
.mu.M Na.sub.4PPi, 2 U of PAPase DNA polymerase (BioVision, USA),
0.1.times. Sybr Green I, and genomic DNA template in 25 .mu.L of
reaction (10 .mu.L of plasma DNA sample was typically used,
equivalent to 200 .mu.L of plasma).
TABLE-US-00002 TABLE 2 Primer Design for C:G/G:C and A:T/T:A
Polymorphisms NAME CH SEQUENCE (SEQ ID NO:) C% G% GC% Rs396 5p
5'ACACAGTGCCCTTCTTGCAAGTACTA[C/G]GACACTCCAATCCCATTTCTACCTC (1) 50
50 #6-D-1 5'GGCACACAGTGCCCTTCTTGCAAGTACTAddC (2) For C allele 53
#6-U-1 5'CCCTGAGGTAGAAATGGGATTGGAGTGTCddG (3) 53 #6-D-2
5'GGCACACAGTGCCCTTCTTGCAAGTACTAddG (4) For G allele 53 #6-U-2
5'CCCTGAGGTAGAAATGGGATTGGAGTGTCddC (5) 53 Rs7289 1q
5'CACTGGACCTTACAGTTCTCACTGCC[C/G]TTGGACTCCAGTCCAGCTTTGGGGC (6) 49.2
51.8 #13-D-1 5'CTTCACTGGACCTTACAGTTCTCACTGCCddC (7) For C allele 53
#13-U-1 5'CCCAGCCCCAAAGCTGGACTGGAGTCCAAddG (8) 63 #13-D-2
5'CTTCACTGGACCTTACAGTTCTCACTGCCddG (9) For G allele 53 #13-U-2
5'CCCAGCCCCAAAGCTGGACTGGAGTCCAAddC (10) 63 Rs7825 1p
5'TGACACCAGAGGGGCTTAGGCTTCTT[C/G]ATCCACAGCAGAGTTTTCTGGGATT (11)
49.2 50.8 #4-D-1 5'TTCTGACACCAGAGGGGCTTAGGCTTCTTddC (12) For C
allele 53 #4-U-1 5'AAGAAATCCCAGAAAACTCTGCTGTGGATddG (13) 43 #4-D-2
5'TTCTGACACCAGAGGGGCTTAGGCTTCTTddG (14) For G allele 53 #4-U-2
5'AAGAAATCCCAGAAAACTCTGCTGTGGATddC (15) 43 Rs11793 1q
5'TCCCAAGAACACCTACTAATTCCTCT[C/G]CACTCCTTCATGGCTGGGACAGTTA (16) 50
50 #5-D-1 5'CGGTCCCAAGAACACCTACTAATTCCTCTddC (17) For C allele 50
#5-U-1 5'CCAGTAACTGTCCCAGCCATGAAGGAGTGddG (18) 56 #5-D-2
5'CGGTCCCAAGAACACCTACTAATTCCTCTddG (19) For G allele 50 #5-U-2
5'CCAGTAACTGTCCCAGCCATGAAGGAGTGddC (20) 56 Rs11901 16p
5'GCCCTCCTTTCCCAGTCCAAGGTTGA[C/G]AGGGTCCTGTCATTTCCTGTCCCAA (21)
47.5 52.5 or q #3-D-1 5'GAAGCCCTCCTTTCCCAGTCCAAGGTTGAddC (22) For C
allele 53 #3-U-1 5'CTACTTGGGACAGGAAATGACAGGACCCTddG (23) 57 #3-D-2
5'GAAGCCCTCCTTTCCCAGTCCAAGGTTGAddG (24) For G allele 53 #3-U-2
5'CTACTTGGGACAGGAAATGACAGGACCCTddC (25) 57 Rs33296 5q
5'GTACTTTTTGGCATGTACTCTCCACG[C/G]CATAATTTGTAAATGCCCTGGTCTT (26)
49.2 50.8 #2-D-1 5'TATGTACTTTTTGGCATGTACTCTCCACGddC (27) For C
allele 43 #2-U-1 5'CCGCAAGACCAGGGCATTTACAAATTATGddG 28() 47 #2-D-2
5'TATGTACTTTTTGGCATGTACTCTCCACGddG (29) For G allele 43 #2-U-2
5'CCGCAAGACCAGGGCATTTACAAATTATGddC (30) 47 Rs153887 5q
5'CCAAGGGGAATTTCAGTGCAGGATGT[C/G]TTGTGATGGGAGTAGTGAGTTAGCA (31)
50.9 49.1 #1-D-1 5'ATACCAAGGGGAATTTCAGTGCAGGATGTddC (32) For C
allele 43 #1-U-1 5'CAAATGCTAACTCACTACTCCCATCACAAddG (33) 46 #1-D-2
5'ATACCAAGGGGAATTTCAGTGCAGGATGTddG (34) For G allele 43 #1-U-2
5'CAAATGCTAACTCACTACTCCCATCACAAddC (35) 46 Rs4261 7q
5'TAAAATTATCCCTGGGCTCTCAGTAA[A/T]GCCAATTGATGTCATCACTTGGACA (36)
50.8 49.2 #7-D-1 5'GGCTAAAATTATCCCTGGGCTCTCAGTAAddA (37) For A
allele 43 #7-U-1 5'ACACTGTCCAAGTGATGACATCAATTGGCddT (38) 43 #7-D-2
5'GGCTAAAATTATCCCTGGGCTCTCAGTAAddT (39) For T allele 43 #7-U-2
5'ACACTGTCCAAGTGATGACATCAATTGGCddA (40) 43 Rs30209 16p
5'TACCGGCAAAGAGGGAACCAGTGAGA[A/T]ATCTTGTCTCAAACTCTGGGGCTGA (41)
45.8 54.2 #8-D-1 5'AATTACCGGCAAAGAGGGAACCAGTGAGAddA (42) For A
allele 47 #8-U-1 5'AACATCAGCCCCAGAGTTTGAGACAAGATddT (42) 43 #8-D-2
5'AATTACCGGCAAAGAGGGAACCAGTGAGAddT (44) For T allele 47 #8-U-2
5'AACATCAGCCCCAGAGTTTGAGACAAGATddA (45) 43 Rs31224 5q
5'CTCACTGCTAATGGGGTTATGCGGTT[A/T]CAAGGGCGTGCATCATTTCGCACAC (46)
46.6 53.4 #9-D-1 5'CTGCTCACTGCTAATGGGGTTATGCGGTTddA (47) For A
allele 50 #9-U-1 5'CTGGGTGTGCGAAATGATGCACGCCCTTGddT (48) 57 #9-D-2
5'CTGCTCACTGCTAATGGGGTTATGCGGTTddT (49) For T allele 50 #9-U-2
5'CTGGGTGTGCGAAATGATGCACGCCCTTGddA (50) 57 Rs156988 1p
5'TGCGTCTCGGTCCTTCCTTTTCACTT[A/T]GCCAGTTGCACATTCCCTGTCCTCC (51)
54.2 45.8 #12-D-1 tel 5'TGATGCGTCTCGGTCCTTCCTTTTCACTTddA (52) For A
allele 47 #12-U-1 5'GTAAGGAGGACAGGGAATGTGCAACTGGCddT (53) 53
#12-D-2 5'TGATGCGTCTCGGTCCTTCCTTTTCACTTddT (54) For T allele 47
#12-U-2 5'GTAAGGAGGACAGGGAATGTGCAACTGGCddA (55) 53 tel =
telomer
[0074] The cycling conditions were 30 cycles for screening and 40
cycles for tracking: 95.degree. C. for 15 s, 60.degree. C. for 30
s, 64.degree. C. for 30 s, 68.degree. C. for 1 min, and 72.degree.
C. for 1 min. A denaturing step of 95.degree. C. for 2 min was
added before the first cycle.
[0075] A Bio-Rad CFX96 real time PCR detection system was used with
Sybr Green fluorophore for real time detection of the amplified
product. Threshold cycle (Ct) was obtained and fluorescence signal
was quantified with baseline subtracted mode.
[0076] In addition for confirmation, the product was
electrophoresed through a standard 3% agarose gel. The gel was
stained with ethidium bromide for UV photography by a
charge-coupled device camera.
Example 2
A Two-Step Procedure of Screening and Tracking
[0077] In the first step for screening for donor-positive but
recipient-negative markers, a set of common biallelic polymorphisms
are compared between donor and recipient genomic DNA samples
extracted from white blood cells or other tissue samples (FIG. 5).
PAP assays or other methods may be applied.
[0078] In the second step, for tracking of a donor-positive but
recipient-negative marker in recipient's blood, such as plasma DNA,
a specific PAP assay is performed. Through detection of its
presence or increased levels, transplantation failure can be
identified at very early stages (FIG. 5).
Example 3
Individual Assays Vs. Universal Assays
[0079] Individual assays mean that each individual pair of donor
and recipient needs a specific assay for them selves. For example,
we can identify HLA variances between the specific donor and
recipient, and then develop an individualized PAP assay. The
disadvantage is that this assay could not be used for others.
[0080] Universal assays mean that a set of assays can be applied
for most, if not all, the donors and recipients. Common biallelic
polymorphisms can be chosen for this purpose. Universal assays are
preferred because of their broad utility and low cost.
Example 4
Frequency of Biallelic DNA Polymorphisms
[0081] For each biallelic polymorphism locus, such as C:G/G:C, two
Bi-PAP assays can be developed. The frequency of biallelic
polymorphisms affects the power to identify a donor-positive but
recipient-negative polymorphism (Table 3). With 50% biallelic
frequency, one PAP assay has 18.75% chance to identify a
donor-positive but recipient-negative marker, and 2 assays for the
locus has 37.5% such chance, higher than with other frequencies.
Thus, biallelic polymorphisms with about 50% frequency were chosen
(Table 2).
TABLE-US-00003 TABLE 3 Frequency Power for a Donor-Positive but
Recipient-Negative Biallelic Polymorphism Positive Negative Joint
donor genotype recipient genotype frequency A. Biallele frequency
with C:G = 50%, G:C = 50% Assay I for C:G and C:G and G:C and G:C
25% 18.75% C:G allele C:G 25% G:C 50% Assay II for G:C and C:G and
C:G and C:G 25% 18.75% G:C allele G:C 25% G:C 50% B. Biallele
frequency with C:G = 30%, G:C = 70% Assay I for C:G and C:G and GC
and G:C 49% 24.99% C:G allele C:G 9% G:C 42% Assay II for G:C and
C:G and C:G and C:G 9% 8.19% G:C allele G:C 49% G:C 42%
[0082] For example, 11 common biallelic polymorphisms can be chosen
to develop 22 corresponding PAP assays that can identify at least
one donor-positive but recipient-negative polymorphism in virtually
100% of donors and recipients.
Example 5
Types of Biallelic DNA Polymorphisms as Markers
[0083] There are 6 possible types of mutations of A:T.fwdarw.G:C,
A:T.fwdarw.C:G, G:C.fwdarw.C:G, A:T.fwdarw.T:A, G:C.fwdarw.A:T and
G:C.fwdarw.T:A. Bi-PAP assays had ultrahigh selectivity for 4 types
of mutations of A:T.fwdarw.G:C, A:T.fwdarw.C:G, G:C.fwdarw.C:G, and
A:T.fwdarw.T:A, (Shi et al. 2007). Assays for the remaining two
types of mutations of G:C.fwdarw.A:T and G:C.fwdarw.T:A, had
relatively low selectivity due to spontaneous damage on the DNA
template, such as spontaneous deamination of cytosine (Frederico et
al., 1990).
[0084] Corresponding, there are only 4 possible types of biallelic
polymorphisms of A:T/G:C, A:T/C:G, G:C/C:G, and A:T/T:A. Bi-PAP
assays had ultrahigh selectivity for 2 types of biallelic
polymorphisms of G:C/C:G and A:T/T:A. Therefore, G:C/C:G and
A:T/T:A polymorphisms are of choice for the present invention.
Example 6
Development of Bi-PAP Assay
[0085] Eleven G:C/C:G and A:T/T:A biallelic polymorphisms were
chosen (Table 2). For each biallelic polymorphism, two
corresponding Bi-PAP assays were developed and validated. To test
the analytical sensitivity of an assay, the matched pooled DNA
template was 3-fold titrated from .about.435 copies to 1 copy per
reaction. We demonstrated the detection of as few as 1 copy of the
DNA template (sensitivity=1 copy). In addition, a standard curved
was constructed with 3-fold serial dilution from 435 copies to less
than 1 copy per reaction. Due to random sampling, the actual copy
number per reaction is a random variety estimated by the Poisson
distribution. For example, if the expected copy number is one per
reaction, 37% of reactions are expected to contain zero copies and
63% are expected to contain one or more copies. If 3 copies are
expected per reaction, at least 1 actual copy is included in 95%
chance. Threshold cycle (Ct) was typically correlated to copies
with 0.97 to 1.07 amplification efficiency, 0.98 to 0.99 R.sup.2,
and -3.13 to -3.17 slope, showing highly consistent and linear
(FIG. 6).
[0086] To test the analytical specificity, the blocked primers
mismatch the DNA template at their 3' ends. Up to 3.times.10.sup.5
copies, or 1 .mu.g, of the mismatched genomic DNA template was
applied repeatedly without any false positive signal by the end of
40 cycles (specificity .gtoreq.10.sup.6). Furthermore, no template
control was also tested without any false positive signal by the
end of 40 cycles.
[0087] Besides real time detection of the amplified product, the
product was analyzed on 3% agarose gel for confirmation of the
sensitivity (FIG. 7) and specificity (FIG. 8).
Example 7
Example of Clinical Validation of Islet Transplantation
[0088] After a set of PAP assays were developed for 11 common
polymorphisms (Table 2) and validated in real-time fluorescence
detection format (SybrGreen dye), analysis of 15 islet
transplantation patients were conducted.
[0089] As the first step (FIG. 5), we genotyped the donor and
recipient genomic DNA isolated from their white blood cells and
even formalin-fixed tissues. With the 11 common polymorphisms, at
least one donor-positive but recipient-negative DNA markers were
identified in more than 93% of cases (14 out of 15).
[0090] As the second step (FIG. 5), we monitored such
donor-positive but recipient-negative DNA markers in recipient's
plasma. Two types of increased levels or peaks of donor-positive
but recipient-negative markers were detected. The first peak in
each patient started directly after islet infusion and lasted for a
mean of 22 days (15-28). The second peak was observed in follow-up
period in 80% of cases that was associated with islet graft injury
as suggested by more insulin requirement, blood glucose excursion,
or more immunosuppressive drug requirement, demonstrating the
feasibility. An example is shown in FIG. 9.
Example 8
Example of Clinical Validation of Bone Marrow Transplantation
[0091] Samples from 6 pair of recipients and donors collected
before and after bone marrow transplantation were analyzed. As the
first step (FIG. 5), we genotyped the donor and recipient genomic
DNA isolated from their nuclear cells, such as white blood cells.
With the common polymorphisms and corresponding assays, 1 to 6
donor-positive but recipient-negative DNA markers were identified
for each of the 6 pair of recipients and donors.
[0092] As the second step (FIG. 5), we identified such
donor-positive but recipient-negative DNA markers in 5 out of 6
recipient's plasma collected in post-transplantation with low to
medium levels of the markers detected, proving the principle. The
one negative result of the donor-positive but recipient-negative
DNA marker is presumed due to degradation of plasma DNA in sample
storage.
Example 9
Allele Frequency of DNA Polymorphisms for One-Donor Vs.
Multiple-Recipients
[0093] There is another case where a large volume of cells from one
donor is provided to many recipients, such as engineered stem
cells. In such a case, another strategy as described din this
example can be used efficiently for detecting donor-positive but
recipient-negative genotypes in recipient's blood.
[0094] For the donor, the polymorphism status is predetermined on
many loci by such methods as Sanger sequencing or parallel
sequencing. Then homozygous and/or heterozygous genotypes, such as
C:G/C:G and/or C:G/G:C of a biallelic polymorphism, are selected.
To differentiate from the donor genotypes, a G:C/G:C homozygous
genotype is used for the recipients.
[0095] For such an polymorphism locus, the frequencies of C:G
allele and G:C allele are accounted in the recipients. High
frequency of G:C allele but low frequency of C:G allele are
preferred to get the donor-positive but recipient-negative
genotypes efficiently (Table 4). In addition, one Bi-PAP assay
rather than two Bi-PAP assays is applied to each polymorphism.
TABLE-US-00004 TABLE 4 Frequency Power for a Donor-Positive but
Recipient-Negative Biallelic Polymorphism with the Donor's
Genotypes Predetermined Positive donor genotype Negative recipient
Joint Predetermined genotype frequency A. Biallele frequency with
C:G = 30%, G:C = 70% Assay I for C:G and C:G C:G and G:C G:C and
49% C:G allele G:C 49% B. Biallele frequency with C:G = 50%, G:C =
50% Assay I for C:G and C:G C:G and G:C G:C and 25% C:G allele G:C
25% C. Biallele frequency with C:G = 70%, G:C = 30% Assay I for C:G
and C:G C:G and G:C G:C and 9% C:G allele G:C 9%
[0096] In addition, it may be desirable to determine if recipient
cells are dying are if there is cellular damage of the recipient.
In this instance, recipient-positive but donor-negative genotypes
in recipient's blood are detected. For example, the donor has
predetermined G:C/G:C homozygous genotypes of a biallelic
polymorphism. Then, the recipients C:G/C:G homozygous genotypes
and/or C:G/G:C heterozygous genotypes are selected for analysis.
For such an polymorphism locus, the frequencies of C:G allele and
G:C allele are also accounted in the recipients. High frequency of
C:G allele but low frequency of G:C allele are preferred. In
addition, one Bi-PAP assay rather than two Bi-PAP assays is applied
to each polymorphism.
[0097] In the description of the invention, it is understood that
the use of the terms "a" and "an" and "the" and similar referents
in the context of describing the invention (especially in the
context of the following claims) are to be construed to cover both
the singular and the plural, unless otherwise indicated herein or
clearly contradicted by context. The terms "comprising," "having,"
"including," and "containing" are to be construed as open-ended
terms (i.e., meaning "including, but not limited to,") unless
otherwise noted. Recitation of ranges of values herein are merely
intended to serve as a shorthand method of referring individually
to each separate value falling within the range, unless otherwise
indicated herein, and each separate value is incorporated into the
specification as if it were individually recited herein. All
methods described herein can be performed in any suitable order
unless otherwise indicated herein or otherwise clearly contradicted
by context. The use of any and all examples, or exemplary language
(e.g., "such as") provided herein, is intended merely to better
illuminate the invention and does not pose a limitation on the
scope of the invention unless otherwise claimed. No language in the
specification should be construed as indicating any non-claimed
element as essential to the practice of the invention.
[0098] Embodiments of this invention are described herein,
including the best mode known to the inventors for carrying out the
invention. Variations of those embodiments may become apparent to
those of ordinary skill in the art upon reading the foregoing
description. The inventors expect skilled artisans to employ such
variations as appropriate, and the inventors intend for the
invention to be practiced otherwise than as specifically described
herein. Accordingly, this invention includes all modifications and
equivalents of the subject matter recited in the claims appended
hereto as permitted by applicable law. Moreover, any combination of
the above-described elements in all possible variations thereof is
encompassed by the invention unless otherwise indicated herein or
otherwise clearly contradicted by context.
BIBLIOGRAPHY
[0099] Arif, J. M. and, Gupta, R. C. (2003). Artifactual formation
of 8-oxo-2'-deoxyguanosine: role of fluorescent light and
inhibitors. Oncology Reports 10(6):2071-2074. [0100] Deutscher, M.
P. and Kornberg, A. (1969). Enzymatic synthesis of deoxyribonucleic
acid. 28. The pyrophosphate exchange and pyrophosphorolysis
reactions of deoxyribonucleic acid polymerase. Journal Biol Chem
244(11):3019-3028. [0101] Frederico, L. A. et al. (1990). A
sensitive genetic assay for the detection of cytosine deamination:
determination of rate constants and the activation energy. Biochem
29(10):2532-2537. [0102] Kornberg, A. and Baker, T. A. (1992). DNA
Replication. Second Edition, W.H. Freeman and Company, New York
[0103] Liu, Q. and Sommer, S. S. (2004). PAP: detection of ultra
rare mutations depends on P* oligonucleotides: "sleeping beauties"
awakened by the kiss of pyrophosphorolysis. Hum Mutation
23(5):426-436. [0104] Newton, C. R. et al. (1989). Analysis of any
point mutation in DNA. The amplification refractory mutation system
(ARMS). Nucl Acids Res 17(7):2503-2516. [0105] Nichols, W. C. et
al. (1989). Direct sequencing of the gene for Maryland/German
familial amyloidotic polyneuropathy type II and genotyping by
allele-specific enzymatic amplification. Genomics 5(3):535-540.
[0106] Parsons, B. L. and Heflich, R. H. (1997). Genotypic
selection methods for the direct analysis of point mutations.
Mutation Res 387(2):97-121. [0107] Shi, J. et al. (2007). Detection
of ultrarare somatic mutation in the human TP53 gene by
bidirectional pyrophosphorolysis-activated polymerization
allele-specific amplification. Hum Mutation 28 (2): 131-136. [0108]
Sommer, S. S. et al. (1989). A novel method for detecting point
mutations or polymorphisms and its application to population
screening for carriers of phenylketonuria. Mayo Clinic Proceedings
64(11):1361-1372. [0109] Wu, D. Y. et al. (1989). Allele-specific
enzymatic amplification of beta-globin genomic DNA for diagnosis of
sickle cell anemia. Proc Natl Acad Sci USA 86(8):2757-2760.
Sequence CWU 1
1
55152DNAHomo sapiens 1acacagtgcc cttcttgcaa gtactasgac actccaatcc
catttctacc tc 52230DNAHomo sapiensmisc_feature(30)..(30)n is
dideoxyC 2ggcacacagt gcccttcttg caagtactan 30330DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyG 3ccctgaggta gaaatgggat
tggagtgtcn 30430DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyG
4ggcacacagt gcccttcttg caagtactan 30530DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyC 5ccctgaggta gaaatgggat
tggagtgtcn 30652DNAHomo sapiens 6cactggacct tacagttctc actgccsttg
gactccagtc cagctttggg gc 52730DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyC 7cttcactgga ccttacagtt
ctcactgccn 30830DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyG
8cccagcccca aagctggact ggagtccaan 30930DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyG 9cttcactgga ccttacagtt
ctcactgccn 301030DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyC
10cccagcccca aagctggact ggagtccaan 301152DNAHomo sapiens
11tgacaccaga ggggcttagg cttcttsatc cacagcagag ttttctggga tt
521230DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyC
12ttctgacacc agaggggctt aggcttcttn 301330DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyG 13aagaaatccc agaaaactct
gctgtggatn 301430DNAHomo sapiensmisc_feature(30)..(30)n is dideoxy
G 14ttctgacacc agaggggctt aggcttcttn 301530DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyC 15aagaaatccc agaaaactct
gctgtggatn 301652DNAHomo sapiens 16tcccaagaac acctactaat tcctctscac
tccttcatgg ctgggacagt ta 521730DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyC 17cggtcccaag aacacctact
aattcctctn 301830DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyG
18ccagtaactg tcccagccat gaaggagtgn 301930DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyG 19cggtcccaag aacacctact
aattcctctn 302030DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyC
20ccagtaactg tcccagccat gaaggagtgn 302152DNAHomo sapiens
21gccctccttt cccagtccaa ggttgasagg gtcctgtcat ttcctgtccc aa
522230DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyC
22gaagccctcc tttcccagtc caaggttgan 302330DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyG 23ctacttggga caggaaatga
caggaccctn 302430DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyG
24gaagccctcc tttcccagtc caaggttgan 302530DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyC 25ctacttggga caggaaatga
caggaccctn 302652DNAHomo sapiens 26gtactttttg gcatgtactc tccacgscat
aatttgtaaa tgccctggtc tt 522730DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyC 27tatgtacttt ttggcatgta
ctctccacgn 302830DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyG
28ccgcaagacc agggcattta caaattatgn 302930DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyG 29tatgtacttt ttggcatgta
ctctccacgn 303030DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyC
30ccgcaagacc agggcattta caaattatgn 303152DNAHomo sapiens
31ccaaggggaa tttcagtgca ggatgtsttg tgatgggagt agtgagttag ca
523230DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyC
32ataccaaggg gaatttcagt gcaggatgtn 303330DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyG 33caaatgctaa ctcactactc
ccatcacaan 303430DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyG
34ataccaaggg gaatttcagt gcaggatgtn 303530DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyC 35caaatgctaa ctcactactc
ccatcacaan 303652DNAHomo sapiens 36taaaattatc cctgggctct cagtaawgcc
aattgatgtc atcacttgga ca 523730DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyA 37ggctaaaatt atccctgggc
tctcagtaan 303830DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyT
38acactgtcca agtgatgaca tcaattggcn 303930DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyT 39ggctaaaatt atccctgggc
tctcagtaan 304030DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyA
40acactgtcca agtgatgaca tcaattggcn 304152DNAHomo sapiens
41taccggcaaa gagggaacca gtgagawatc ttgtctcaaa ctctggggct ga
524230DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyA
42aattaccggc aaagagggaa ccagtgagan 304330DNAHomo
sapiensmisc_feature(30)..(30)n id dideoxyT 43aacatcagcc ccagagtttg
agacaagatn 304430DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyT
44aattaccggc aaagagggaa ccagtgagan 304530DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyA 45aacatcagcc ccagagtttg
agacaagatn 304652DNAHomo sapiens 46ctcactgcta atggggttat gcggttwcaa
gggcgtgcat catttcgcac ac 524730DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyA 47ctgctcactg ctaatggggt
tatgcggttn 304830DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyT
48ctgggtgtgc gaaatgatgc acgcccttgn 304930DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyT 49ctgctcactg ctaatggggt
tatgcggttn 305030DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyA
50ctgggtgtgc gaaatgatgc acgcccttgn 305152DNAHomo sapiens
51tgcgtctcgg tccttccttt tcacttwgcc agttgcacat tccctgtcct cc
525230DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyA
52tgatgcgtct cggtccttcc ttttcacttn 305330DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyT 53gtaaggagga cagggaatgt
gcaactggcn 305430DNAHomo sapiensmisc_feature(30)..(30)n is dideoxyT
54tgatgcgtct cggtccttcc ttttcacttn 305530DNAHomo
sapiensmisc_feature(30)..(30)n is dideoxyA 55gtaaggagga cagggaatgt
gcaactggcn 30
* * * * *
References