U.S. patent application number 16/139534 was filed with the patent office on 2019-01-10 for production of dha and other lc pufas in plants.
The applicant listed for this patent is Dow AgroSciences LLC, DSM IP Assets B.V.. Invention is credited to Scott Bevan, Daniel Gachotte, Jerry Kuner, Ann Owens Merlo, James Metz, Paul G. Roessler, Terence A WALSH.
Application Number | 20190010510 16/139534 |
Document ID | / |
Family ID | 44992026 |
Filed Date | 2019-01-10 |
![](/patent/app/20190010510/US20190010510A1-20190110-D00001.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00002.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00003.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00004.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00005.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00006.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00007.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00008.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00009.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00010.png)
![](/patent/app/20190010510/US20190010510A1-20190110-D00011.png)
View All Diagrams
United States Patent
Application |
20190010510 |
Kind Code |
A1 |
WALSH; Terence A ; et
al. |
January 10, 2019 |
PRODUCTION OF DHA AND OTHER LC PUFAS IN PLANTS
Abstract
The invention provides recombinant host organisms (e.g., plants)
genetically modified with a polyunsaturated fatty acid (PUFA)
synthase system and one or more accessory proteins (e.g., PPTase
and/or ACoAS) that allow for and/or improve the production of PUFAs
in the host organism. The present invention also relates to methods
of making and using such organisms (e.g., to obtain PUFAs) as well
as products obtained from such organisms (e.g., oil and/or
seed).
Inventors: |
WALSH; Terence A; (Carmel,
IN) ; Gachotte; Daniel; (Indianapolis, IN) ;
Merlo; Ann Owens; (Carmel, IN) ; Roessler; Paul
G.; (Fort Myers, FL) ; Metz; James; (Longmont,
CO) ; Bevan; Scott; (Indianapolis, IN) ;
Kuner; Jerry; (Longmont, CO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
DSM IP Assets B.V.
Dow AgroSciences LLC |
TE Heerlen
Indianapolis |
IN |
NL
US |
|
|
Family ID: |
44992026 |
Appl. No.: |
16/139534 |
Filed: |
September 24, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15825107 |
Nov 29, 2017 |
|
|
|
16139534 |
|
|
|
|
13698412 |
Feb 12, 2013 |
|
|
|
PCT/US2011/036869 |
May 17, 2011 |
|
|
|
15825107 |
|
|
|
|
61345537 |
May 17, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 7/00 20180101; A61P
31/04 20180101; A61P 9/12 20180101; A61P 27/02 20180101; A61P 9/10
20180101; A61P 1/16 20180101; A61P 31/00 20180101; A61P 37/06
20180101; A61P 19/10 20180101; A61P 3/02 20180101; C12N 15/8247
20130101; A61P 25/00 20180101; A61P 29/00 20180101; A61P 15/00
20180101; A61P 3/06 20180101; A61P 1/04 20180101; A61P 11/00
20180101; A61P 19/08 20180101; C12P 7/6427 20130101; A61P 19/02
20180101; A61P 3/00 20180101; C12N 9/1029 20130101; A61P 25/08
20180101; C12N 9/1288 20130101; A61P 13/02 20180101; A61P 25/24
20180101; A61P 35/00 20180101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12P 7/64 20060101 C12P007/64; C12N 9/10 20060101
C12N009/10; C12N 9/12 20060101 C12N009/12 |
Claims
1-68. (canceled)
69. A seed oil obtained from a genetically modified plant,
descendant, seed, cell, tissue, or part thereof, wherein said seed
oil comprises 0.01% to 15% DHA and wherein said plant is
Brassica.
70. The seed oil of claim 69, wherein said seed oil comprises 0.01%
to 10% DHA.
71. The seed oil of claim 69, wherein said seed oil comprises 0.05%
to 1% DHA.
72. The seed oil of any one of claims 69-71, wherein said seed oil
further comprises 0.01% to 10% EPA.
73. The seed oil of any one of claims 69-71, wherein said seed oil
further comprises 0.01% to 5% EPA.
74. The seed oil of any one of claims 69-71, wherein said seed oil
further comprises 0.05% to 1% EPA.
75. A canola seed oil, wherein said seed oil is substantially free
of intermediate or side products of the system for synthesizing
PUFAs and that are not naturally produced by the endogenous FAS
system in the wild-type plants.
76. The seed oil of claim 75, wherein said seed oil comprises less
than 7% by weight of total fatty acids of intermediate or side
products of the system for synthesizing PUFAs.
77. The seed oil of claim 75, wherein said seed oil comprises less
than 5% by weight of total fatty acids of intermediate or side
products of the system for synthesizing PUFAs.
78. The seed oil of claim 75, wherein said seed oil comprises less
than 3% by weight of total fatty acids of intermediate or side
products of the system for synthesizing PUFAs.
79. The seed oil of any one of claims 78-82, wherein said
intermediate or side products of the system for synthesizing PUFAs
comprises gamma-linolenic acid (GLA; 18:3, n-6), stearidonic acid
(STA or SDA; 18:4, n-3), dihomo-gamma-linolenic acid (DGLA or HGLA;
20:3, n-6), arachidonic acid (ARA, C20:4, n-6), and eicosatrienoic
acid (ETA; 20:3, n-9).
80. The seed oil of claim 79, wherein said intermediate or side
products of the system for synthesizing PUFAs further comprises
20:0, 20:1 (.DELTA.5), 20:1 (.DELTA.11), 20:2 (.DELTA.8,11), 20:2
(.DELTA.11,14), 20:3 (.DELTA.5,11,14), 20:3 (.DELTA.11,14,17), mead
acid (20:3; .DELTA.5,8,11), and 20:4 (.DELTA.5,1,14,17).
81. A seed oil obtained from a genetically modified plant,
descendant, seed, cell, tissue, or part thereof, wherein said seed
oil comprises 0.01% to 10% EPA and wherein said plant is
Brassica.
82. The seed oil of claim 81, wherein said seed oil comprises 0.01%
to 5% EPA.
83. The seed oil of claim 81, wherein said seed oil comprises 0.05%
to 1% EPA.
84. A canola seed oil, wherein said seed oil comprises DHA and DPA,
wherein the proportion of DHA is at least 70% by weight of the
total amount of DHA and DPA.
85. A canola seed oil, wherein said seed oil further comprises EPA,
wherein the proportion of DHA is at least 70% by weight of the
total amount of DHA, DPA and EPA.
86. A food product for animals or humans, comprising the seed oil
of any one of claims 69 to 85.
87. The food product for animals of claim 86, wherein said food
product is animal feed or feed additive.
88. The food product for animals of claim 87, wherein the animal is
non-ruminant, pig, poultry, or fish.
Description
BACKGROUND OF THE INVENTION
Field of the Invention
[0001] The present invention generally relates to recombinant host
organisms (e.g., plants) genetically modified with a
polyunsaturated fatty acid (PUFA) synthase system and one or more
accessory proteins that allow for and/or improve the production of
PUFAs in the host organism. The present invention also relates to
methods of making and using such organisms (e.g., to obtain PUFAs)
as well as products obtained from such organisms (e.g., oil and
seed).
Background Art
[0002] Polyunsaturated fatty acids (PUFAs) are considered to be
useful for nutritional applications, pharmaceutical applications,
industrial applications, and other purposes. However, the current
supply of PUFAs from natural sources (e.g., fish oils) and from
chemical synthesis is not sufficient for long-term commercial
needs.
[0003] Vegetable oils derived from plants (e.g., oil seed crops)
are relatively inexpensive and do not have the contamination issues
associated with fish oils. However, the PUFAs found in
commercially-developed plants and plant oils do not typically
include more saturated or longer-chain PUFAs, and only typically
include fatty acids such as linoleic acid (eighteen carbons with 2
double bonds, in the delta 9 and 12 positions--18:2 delta 9,12) and
linolenic acid (18:3 delta 9,12,15).
[0004] The production of more unsaturated or longer-chain PUFAs in
plants by the modification of the fatty acids endogenously produced
by plants has been described. For example, the genetic modification
of plants with various individual genes encoding fatty acid
elongases and/or desaturases has been described as resulting in the
generation of leaves or seeds containing significant levels of
longer-chain and more unsaturated PUFAs such as eicosapentaenoic
acid (EPA), but also containing significant levels of mixed
shorter-chain and less unsaturated PUFAs (Qi et al., Nature
Biotech. 22:739 (2004); WO 04/071467; Abbadi et al., Plant Cell
16:1 (2004); Napier and Sayanova, Proceedings of the Nutrition
Society 64:387-393 (2005); Robert et al., Functional Plant Biology
32:473-479 (2005); U.S. Appl. Pub. No. 2004/0172682).
[0005] The genus Brassica includes canola, one of the world's most
important oilseed crops, and the most important oilseed crop grown
in temperate geographies. Canola has been traditionally
characterized as Brassica napus (a species derived as a result of
inter-specific crosses of Brassica rapa and Brassica oleracea) in
which erucic acid and glucosinolates have been eliminated or
significantly reduced through conventional breeding. The majority
of canola oil is in the form of vegetable oils produced for human
consumption. There is also a growing market for the use of canola
oil in industrial applications.
[0006] The quality of edible and industrial oil derived from a
particular variety of canola seed is determined by its constituent
fatty acids, as the type and amount of fatty acid unsaturation have
implications for both dietary and industrial applications.
Conventional canola oil contains about 60% oleic acid (C18:1),
about 20% linoleic acid (C18:2) and about 10% linolenic acid
(18:3). The levels of polyunsaturated linolenic acid typical of
conventional canola are undesirable as the oil is easily oxidized,
the rate of oxidation being affected by several factors, including
the presence of oxygen, exposure to light and heat, and the
presence of native or added antioxidants and pro-oxidants in the
oil. Oxidation causes off-flavors and rancidity of as a result of
repeated frying (induced oxidation) or storage for a prolonged
period (auto-oxidation). Oxidation can also alter the lubricative
and viscous properties of canola oil.
[0007] Oils exhibiting reduced levels of polyunsaturated fatty
acids and increases in the level of monounsaturated oleic acid
relative to conventional canola oil are associated with higher
oxidative stability. The susceptibility of individual fatty acids
to oxidation is dependent on their degree of unsaturation. Thus,
the rate of oxidation of linolenic acid, which possesses three
carbon-carbon double bonds, is 25 times that of oleic acid, which
has only one double bond, and 2 times that of linoleic acid, which
has two double bonds. Linoleic and linolenic acids also have the
most impact on flavor and odor because they readily form
hydroperoxides. High oleic oil (>70% oleic acid) is less
susceptible to oxidation during storage, frying and refining, and
can be heated to a higher temperature without smoking, making it
more suitable as cooking oil. Examples of commercially sold canola
varieties having a fatty acid profile in seed oil of oleic acid
(C18:1) above 70% (by weight) and linolenic acid (C18:3) below 3.5%
(by weight) are the NEXERA.TM. varieties, marketed by Dow
AgroSciences LLC (Indianapolis, Ind.), which varieties produce
"Omega-9 oil," a non-hydrogenated, high oleic acid, low linolenic
acid oil currently used in numerous applications, including deep
frying, sauteing, baking, spraying and in salad dressings, by
restaurants and the foodservice industry.
BRIEF SUMMARY OF THE INVENTION
[0008] There is a need in the art for a relatively inexpensive
method to efficiently and effectively produce quantities (e.g.,
commercial quantities) of longer-chain or more unsaturated PUFAs in
plants, plant seed or plant oil, as well as quantities of lipids
(e.g., triacylglycerol (TAG) and phospholipid (PL)) enriched in
such PUFAs in plants, plant seed or plant oil. A system for
providing and improving PUFA production in host organisms (e.g.,
plants) by providing recombinant host organisms genetically
modified with a polyunsaturated fatty acid (PUFA) synthase and one
or more accessory proteins, as described herein, is a significant
alternative to the approaches in the art.
[0009] The present invention is directed to genetically modified
plants (e.g., Brassica), descendants, seeds, cells, tissues, or
parts thereof, comprising (i) a nucleic acid sequence encoding a
polyunsaturated fatty acid (PUFA) synthase system (e.g., an algal
PUFA synthase system) that produces at least one PUFA; and (ii) a
nucleic acid sequence encoding a phosphopantetheinyl transferase
(PPTase) that transfers a phosphopantetheinyl cofactor to an PUFA
synthase system (e.g., an algal PUFA synthase system) ACP domain.
In some embodiments, the genetically modified plant, descendant,
seed, cell, tissue, or part thereof is from an economically
important Brassica species (e.g., Brassica napus or Brassica
juncea). In some embodiments, the PUFA synthase system comprises an
amino acid sequence that is at least 60% to 99% identical to the
amino acid sequence of SEQ ID NO:1 or comprises the amino acid
sequence of SEQ ID NO:1. In some embodiments, the nucleic acid
sequence encoding the PUFA synthase system comprises a nucleic acid
sequence at least 60% to 99% identical to the nucleic acid sequence
of SEQ ID NO:6 or comprises the nucleic acid sequence of SEQ ID
NO:6. In some embodiments, the PUFA synthase system comprises an
amino acid sequence that is at least 60% to 99% identical to the
amino acid sequence of SEQ ID NO:2 or comprises the amino acid
sequence of SEQ ID NO:2. In some embodiments, the nucleic acid
sequence encoding the PUFA synthase system comprises a nucleic acid
sequence that is at least 60% to 99% identical to the nucleic acid
sequence of SEQ ID NO:7 or comprises the nucleic acid sequence of
SEQ ID NO:7. In some embodiments, the PUFA synthase system
comprises an amino acid sequence that is at least 60% to 99%
identical to the amino acid sequence of SEQ ID NO:3 or comprises
the amino acid sequence of SEQ ID NO:3. In some embodiments, the
nucleic acid sequence encoding the PUFA synthase system comprises a
nucleic acid sequence that is at least 60% to 99% identical to the
nucleic acid sequence of SEQ ID NO:8 or comprises the nucleic acid
sequence of SEQ ID NO:8. In some embodiments, the PUFA synthase
system comprises the amino acid sequence of SEQ ID NOs: 1, 2, or 3
or any combination thereof. In some embodiments, the nucleic acid
sequence encoding the PUFA synthase system comprises the nucleic
acid sequence of SEQ ID NOs: 6, 7 or 8 of any combination
thereof.
[0010] In some embodiments, the PPTase comprises an amino acid
sequence that is at least 60% to 99% identical to SEQ ID NO:5 or
comprises the amino acid sequence of SEQ ID NO:5. In some
embodiments, the nucleic acid sequence encoding the PPTase is at
least 60% to 99% identical to the nucleic acid sequence of SEQ ID
NO:10 or comprises the nucleic acid sequence of SEQ ID NO:10.
[0011] In some embodiments, the nucleic acid sequences of (i) and
(ii) are contained in a single recombinant expression vector. In
some embodiments, the nucleic acid sequences of (i) and (ii) are
operably linked to a seed-specific promoter. In some embodiments,
the nucleic acid sequences of (i) and (ii) are operably linked to a
promoter selected from the group consisting of PvDlec2,
PvPhaseolin, LfKCS3 and FAE 1.
[0012] In some embodiments, the genetically modified plant (e.g., a
Brassica species producing canola oil), descendant, seed, cell,
tissue, or part thereof further comprises (iii) a nucleic acid
sequence encoding an acyl-CoA synthetase (ACoAS) that catalyzes the
conversion of long chain PUFA free fatty acids (PITA) to acyl-CoA.
In some embodiments, the ACoAS comprises an amino acid sequence
that is at least 60% to 99% identical to SEQ ID NO:4 or comprises
the amino acid sequence of SEQ ID NO:4. In some embodiments, the
ACoAS comprises a nucleic acid sequence that is at least 60% to 99%
identical to the nucleic acid sequence of SEQ ID NO:9 or comprises
the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the
nucleic acid sequence encoding the ACoAS comprises the nucleic acid
sequence of SEQ ID NO:34. In some embodiments, the nucleic acid
sequences of (i), (ii) and/or (iii) are contained in a single
recombinant expression vector, in some embodiments, the nucleic
acid sequences of (i), (ii) and/or (iii) are operably linked to a
seed-specific promoter. In some embodiments, the nucleic acid
sequences of (i), (ii) and/or (iii) are operably linked to a
promoter selected from the group consisting of: PvDlec2, LfKCS3 and
FAE 1.
[0013] In some embodiments, the genetically modified plant (e.g.,
Brassica), descendant, cell, tissue, or part thereof further
comprises a nucleic acid sequence encoding an acetyl CoA
carboxylase (ACCase) and/or a nucleic acid sequence encoding a type
2 diacylglycerol acyltransferase (DGAT2).
[0014] The present invention is directed to an isolated nucleic
acid molecule comprising a nucleic acid sequence selected from SEQ
ID NOs: 6-10 and SEQ NO:34, a recombinant expression vector
pDAB7361, a recombinant expression vector pDAB7362, a recombinant
expression vector pDAB7363, a recombinant expression vector
pDAB7365, a recombinant expression vector pDAB7368, a recombinant
expression vector pDAB7369, a recombinant expression vector
pDAB7370, a recombinant expression vector pDAB100518, a recombinant
expression vector pDAB101476, a recombinant expression vector
pDAB9166, a recombinant expression vector pDAB9167, a recombinant
expression vector pDAB7379, a recombinant expression vector
pDAB7380, a recombinant expression vector pDAB9323, a recombinant
expression vector pDAB9330, a recombinant expression vector
pDAB9337, a recombinant expression vector pDAB9338, a recombinant
expression vector pDAB9344, a recombinant expression vector
pDAB9396, a recombinant expression vector pDAB10141.2, a
recombinant expression vector pDAB7733, a recombinant expression
vector pDAB7734, a recombinant expression vector pDAB101493, a
recombinant expression vector pDAB109507, a recombinant expression
vector pDAB109508, a recombinant expression vector pDAB109509, a
recombinant expression vector pDAB9151, a recombinant expression
vector pDAB108207, a recombinant expression vector pDAB108208, a
recombinant expression vector pDAB108209, a recombinant expression
vector pDAB9159, a recombinant expression vector pDAB9147, a
recombinant expression vector pDAB108224, or a recombinant
expression vector pDAB108225.
[0015] In some embodiments, a seed oil obtained from the
genetically modified plant, descendant, seed, cell, tissue, or part
thereof comprises detectable amounts of DHA (docosahexaenoic acid
(C22:6, n-3)) and/or EPA (eicosapentaenoic acid (C20:5, n-3)). In
some embodiments, the seed oil comprises 0.01% to 15% DHA, 0.05% to
10% DHA, or 0.05% to 5% DHA. In some embodiments, the seed oil
comprises 0.01% to 5% EPA, 0.05% to 5% EPA, or 0.05% to 1% EPA. In
other embodiments, the detectable amounts of DHA and/or EPA found
in the seed oil are also found in grain and/or meal obtained from
the genetically modified plant. In some embodiments, the detectable
amounts of DHA and/or EPA are found seed oil of a Brassica species
having a fatty acid content comprising, by weight, 70% or greater
of oleic acid (C18:1) and/or 4% or lower linolenic acid
(C18:3).
[0016] The present invention is directed to an oil or a seed
obtained from a genetically modified plant (e.g., Brassica),
descendant, cell, tissue, or part thereof described herein. The
present invention is directed to a food product comprising an oil
obtained from a genetically modified plant, descendant, cell,
tissue, or part thereof described herein. The present invention is
also directed to a functional food comprising an oil obtained from
a genetically modified plant, descendant, cell, tissue, or part
thereof described herein, or a seed obtained from a genetically
modified plant, descendant, cell, tissue, or part thereof described
herein. The present invention is directed to a pharmaceutical
product comprising an oil obtained from a genetically modified
plant, descendant, cell, tissue, or part described herein.
[0017] The present invention is directed to a method to produce an
oil comprising at least one LC-PUFA, comprising recovering oil from
a genetically modified plant (e.g., Brassica), descendant, cell,
tissue, or part thereof described herein or from a seed of a
genetically modified plant (e.g., Brassica), descendant, cell,
tissue, or part thereof described herein. The present invention is
also directed to a method to produce an oil comprising at least one
LC-PUFA, comprising growing a genetically modified plants (e.g.,
Brassica), descendant, cell, tissue, or part thereof described
herein. The present invention is also directed to a method to
produce at least one LC-PUFA in a seed oil, comprising recovering
oil from a seed of a genetically modified plant (e.g., Brassica),
descendant, cell, tissue, or part thereof described herein.
[0018] The present invention is directed to a method to produce at
least one PUFA in a seed oil, comprising growing a genetically
modified plant (e.g., Brassica), descendant, cell, tissue, or part
thereof described herein. The present invention is also directed to
a method to provide a supplement or therapeutic product containing
at least one PUFA to an individual, comprising providing to the
individual a genetically modified plant (e.g., Brassica),
descendant, cell, tissue, or part thereof of described herein, an
oil described herein, a seed described herein, a food product
described herein, a functional food described herein, or a
pharmaceutical product described herein. In some embodiments, a
PUFA contained in such embodiments is DHA and/or EPA.
[0019] The present invention is directed to a method to produce a
genetically modified plant (e.g., Brassica), descendant, cell,
tissue, or part thereof described herein, comprising transforming a
plant or plant cell with (i) a nucleic acid sequence encoding a
PUFA synthase system (e.g., an algal PUFA synthase system) that
produces at least one polyunsaturated fatty acid (PUFA); and (ii) a
nucleic acid sequence encoding a phosphopantetheinyl transferase
(PPTase) that transfers a phosphopantetheinyl cofactor to an PUFA
synthase system (e.g., an algal PUFA synthase system) ACP domain.
In some embodiments, the method further comprises transforming the
plant or plant cell with (iii) a nucleic acid sequence encoding an
acyl-CoA synthetase (ACoAS) that catalyzes the conversion of long
chain PUFA free fatty acids (FFA) to acyl-CoA.
BRIEF DESCRIPTION OF DRAWINGS
[0020] The various embodiments of the invention can be more fully
understood from the following detailed description, the figures,
and the accompanying sequence descriptions, which form a part of
this application.
[0021] FIG. 1 depicts the Clustal W (alignments in Vector NTI) of
the redesigned DNA sequences encoding each of the 9 repeat domains
of PUFA OrfA.
[0022] FIG. 2 shows the plasmid map of pDAB7361.
[0023] FIG. 3 shows the plasmid map of pDAB7362.
[0024] FIG. 4 shows the plasmid map of pDAB7363.
[0025] FIG. 5 shows single seed analysis of the DHA content of
T.sub.1 seeds from canola event 5197[14]-032.002.
[0026] FIG. 6 shows the results of SDS-PAGE western blots of
extracts from late stage (>30 DAP) developing T1 seed from
canola event 5197[14]-032.002 probed with Orf A, Orf B and Orf C
specific antisera.
[0027] FIG. 7a shows the lipid content of developing T2 seed
samples collected 15, 20, 25, 30, 35 and 42 days after pollination
from the DHA-producing canola event 5197[14]-032.002.Sx002.
[0028] FIG. 7b shows the presence of the OrfA, OrfB and OrfC
polypeptides in extracts from DHA-producing canola event
5197[14]-032.002.Sx002 by western blot.
[0029] FIG. 8 shows the LC-PUFA content of homozygous T2 plants
from the greenhouse-grown T1 plants of canola event
5197[14]-032.002.
[0030] FIG. 9 shows a summary of the LC-PUFA of single T2 seed
analyses from six homozygous lines.
[0031] FIG. 10 shows DHA content of the resulting parent and F1
hybrid seeds from a reciprocal cross of two T.sub.1 lines and
untransformed Omega-9 Nexera 710.
[0032] FIG. 11 shows pat gene copy number of sixty individual T1
plants derived from canola event 5197[13]-010.001.
[0033] FIG. 12 shows expression profiles of genes of interest in
the null untransformed Omega-9 Nexera 710 line using the raw
intensity values for each of the 6 time points expressed as days
after pollination (DAP).
[0034] FIG. 13 shows expression profiles of genes of interest in
the null untransformed Omega-9 Nexera 710 line using the normalized
intensity values for each of the 6 time points expressed as
DAP.
[0035] FIG. 14 shows expression profiles of genes of interest in
the homozygote event 5197[14]-032.002 line using the raw intensity
values for each of the 6 time points expressed as DAP.
[0036] FIG. 15 shows expression profiles of genes of interest in
the homozygote event 5197[14]-032.002 line using the normalized
intensity values for each of the 6 time points expressed as
DAP.
[0037] FIG. 16 shows PUFA synthase activity in mature transgenic
canola seed measured by thin layer chromatography (TLC).
[0038] FIG. 17 shows the calculated ratios of reference peptides to
each other from OrfA expressed in E. coli with and without
co-expressed HetI, and OrfA expressed in canola event
5197[14]-032.002.
[0039] FIG. 18 shows the calculated ratios of the apo2-9 peptide to
each of six reference peptides from OrfA expressed in E. coli with
and without HetI, and OrfA expressed in transgenic canola event
5197[14]-032.002.
[0040] FIG. 19 shows the plasmid map of pDAB7365.
[0041] FIG. 20 shows the plasmid map of pDAB7368.
[0042] FIG. 21 shows the plasmid map of pDAB7369.
[0043] FIG. 22 shows the plasmid map of pDAB7370.
[0044] FIG. 23 shows the plasmid map of pDAB100518.
[0045] FIG. 24 shows the plasmid map of pDAB101476.
[0046] FIG. 25 shows the plasmid map of pDAB101477.
[0047] FIG. 26 shows the plasmid map of pDAB9166.
[0048] FIG. 27 shows the plasmid map of pDAB9167.
[0049] FIG. 28 shows the plasmid map of pDAB7379.
[0050] FIG. 29 shows the plasmid map of pDAB7380.
[0051] FIG. 30 shows the plasmid map of pDAB9323.
[0052] FIG. 31 shows the plasmid map of pDAB9330.
[0053] FIG. 32 shows the plasmid map of pDAB9337.
[0054] FIG. 33 shows the plasmid map of pDAB9338.
[0055] FIG. 34 shows the plasmid map of pDAB9344.
[0056] FIG. 35 shows the plasmid map of pDAB9396.
[0057] FIG. 36 shows the plasmid map of pDAB101412.
[0058] FIG. 37 shows the plasmid map of pDAB7733.
[0059] FIG. 38 shows the plasmid map of pDAB7734.
[0060] FIG. 39 shows the plasmid map of pDAB101493.
[0061] FIG. 40 shows the plasmid map of pDAB109507.
[0062] FIG. 41 shows the plasmid map of pDAB109508.
[0063] FIG. 42 shows the plasmid map of pDAB109509.
[0064] FIG. 43 shows the plasmid map of pDAB9151.
[0065] FIG. 44 shows the plasmid map of pDAB108207.
[0066] FIG. 45 shows the plasmid map of pDAB108208.
[0067] FIG. 46 shows the plasmid map of pDAB108209.
[0068] FIG. 47 shows the plasmid map of pDAB9159.
[0069] FIG. 48 shows the plasmid map of pDAB9147.
[0070] FIG. 49 shows the plasmid map of pDAB108224.
[0071] FIG. 50 shows the plasmid map of pDAB108225.
[0072] FIG. 51 illustrates DHA and LC-PUFA content of T.sub.2 seed
from individual transgenic Arabidopsis events transformed with
pDAB101493, pDAB7362, pDAB7369, pDAB101412 or pDAB7380.
DETAILED DESCRIPTION OF THE INVENTION
[0073] The term "polyunsaturated fatty acid" or "PUFA" as used
herein refers to fatty acids with a carbon chain length of at least
16 carbons, at least 18 carbons, at least 20 carbons, or 22 or more
carbons, with at least 3 or more double bonds, 4 or more double
bonds, 5 or more double bonds, or 6 or more double bonds, wherein
all double bonds are in the cis configuration.
[0074] The term "long chain polyunsaturated fatty acids" or
"LC-PUFAs" as used herein refers to fatty acids of 18 and more
carbon chain length, 20 and more carbon chain length, containing 3
or more double bonds, or 22 or more carbons, with at least 3 or
more double bonds, 4 or more double bonds, 5 or more double bonds,
or 6 or more double bonds. LC-PUFAs of the omega-6 series include,
but are not limited to, gamma-linolenic acid (C18:3),
di-homo-gamma-linolenic acid (C20:3n-6), arachidonic acid
(C20:4n-6), adrenic acid (also called docosatetraenoic acid or DTA)
(C22:4n-6), and docosapentaenoic acid (C22:5n-6). LC-PUFAs of the
omega-3 series include, but are not limited to, alpha-linolenic
acid (C18:3), eicosatrienoic acid (C20:3n-3), eicosatetraenoic acid
(C20:4n-3), eicosapentaenoic acid (C20:5n-3), docosapentaenoic acid
(C22:5n-3), and docosahexaenoic acid (C22:6n-3). LC-PUFAs also
include fatty acids with greater than 22 carbons and 4 or more
double bonds including but not limited to, C28:8(n-3).
[0075] The terms "PUFA synthase" or "PUFA synthase system" or
"SzPUFA" or "hSzThPUFA" as used herein refers to an enzyme system
that produces polyunsaturated fatty acids (PUFAs) and particularly,
long chain PUFAs (LC-PUFAs) as well as any domain of such an enzyme
in a complex. The term PUFA synthase includes, but is not limited
to, PUFA PKS systems or PKS-like systems for the production of
PUFAs.
[0076] The term "phosphopantetheinyl transferase" or "PPTase" or
"NoHetI" as used herein refers to an enzyme which activates a PUFA
synthase system by transferring a cofactor (e.g.,
4-phosphopantetheine) from coenzyme A (CoA) to one or more ACP
domain present in the PUFA synthase system.
[0077] The term "acyl-CoA synthetase" or "ACoAS" or "SzACS-2" as
used herein refers to an enzyme that catalyzes the conversion of
long chain polyunsaturated free fatty acids (FFA) to acyl-CoA.
[0078] The term "plant" as used herein includes, but is not limited
to, any descendant, cell, tissue, or part of a plant.
[0079] "Nutraceutical" means a product isolated, purified,
concentrated, or produced from plants that provides a physiological
benefit or provides protection against disease, including processed
foods supplemented with such products, along with foods produced
from crops that have been genetically engineered to contain
enhanced levels of such physiologically-active components.
[0080] "Functional food" means a food that (a) is similar in
appearance to or can be a conventional food that is consumed as
part of a usual diet and (b) has enhanced nutritional value and/or
specific dietary benefits based on a modification in the proportion
of components that typically exist in the unmodified food.
[0081] The terms "polynucleotide" and "nucleic acid" are intended
to encompass a singular nucleic acid as well as plural nucleic
acids, a nucleic acid molecule or fragment, variant, or derivative
thereof, or construct, e.g., messenger RNA (mRNA) or plasmid DNA
(pDNA). A polynucleotide or nucleic acid can contain the nucleotide
sequence of the full-length cDNA sequence, or a fragment thereof,
including the untranslated 5' and 3' sequences and the coding
sequences. A polynucleotide or nucleic acid can be composed of any
polyribonucleotide or polydeoxyribonucleotide, which can be
unmodified RNA or DNA or modified RNA or DNA. For example, a
polynucleotide or nucleic acid can be composed of single- and
double-stranded DNA, DNA that is a mixture of single- and
double-stranded regions, single- and double-stranded RNA, and RNA
that is mixture of single- and double-stranded regions, hybrid
molecules comprising DNA and RNA that can be single-stranded or,
more typically, double-stranded or a mixture of single- and
double-stranded regions. These terms also embraces chemically,
enzymatically, or metabolically modified forms of a polynucleotide
or nucleic acid.
[0082] A polynucleotide or nucleic acid sequence can be referred to
as "isolated," in which it has been removed from its native
environment. For example, a heterologous polynucleotide or nucleic
acid encoding a polypeptide or polypeptide fragment having
dihydroxy-acid dehydratase activity contained in a vector is
considered isolated for the purposes of the present invention.
Further examples of an isolated polynucleotide or nucleic acid
include recombinant polynucleotides maintained in heterologous host
cells or a purified (partially or substantially) polynucleotide or
nucleic acid in solution. An isolated polynucleotide or nucleic
acid according to the present invention further includes such
molecules produced synthetically. An isolated polynucleotide or
nucleic acid in the form of a polymer of DNA can be comprised of
one or more segments of cDNA, genomic DNA or synthetic DNA.
[0083] The term "gene" refers to a nucleic acid or fragment thereof
that is capable of being expressed as a specific protein,
optionally including regulatory sequences preceding (5' non-coding
sequences) and following (3' non-coding sequences) the coding
sequence.
[0084] As used herein, the term "coding region" refers to a DNA
sequence that codes for a specific amino acid sequence. "Suitable
regulatory sequences" refer to nucleotide sequences located
upstream (5' non-coding sequences), within, or downstream (3'
non-coding sequences) of a coding sequence, and which influence the
transcription, RNA processing or stability, or translation of the
associated coding sequence. Regulatory sequences can include
promoters, translation leader sequences, introns, polyadenylation
recognition sequences, RNA processing site, effector binding site,
and stem-loop structure.
[0085] As used herein, the terms "polypeptide" is intended to
encompass a singular "polypeptide" as well as plural "polypeptides"
and fragments thereof, and refers to a molecule composed of
monomers (amino acids) linearly linked by amide bonds (also known
as peptide bonds). The term "polypeptide" refers to any chain or
chains of two or more amino acids, and does not refer to a specific
length of the product. Thus, peptides, dipeptides, tripeptides,
oligopeptides, protein, amino acid chain, or any other term used to
refer to a chain or chains of two or more amino acids, are included
within the definition of "polypeptide," and the term "polypeptide"
can be used instead of, or interchangeably with any of these terms.
A polypeptide can be derived from a natural biological source or
produced by recombinant technology, but is not necessarily
translated from a designated nucleic acid sequence. It can be
generated in any manner, including by chemical synthesis.
[0086] By an "isolated" polypeptide or a fragment, variant, or
derivative thereof is intended a polypeptide that is not in its
natural milieu. No particular level of purification is required.
For example, an isolated polypeptide can be removed from its native
or natural environment. Recombinantly produced polypeptides and
proteins expressed in host cells are considered isolated for
purposed of the invention, as are native or recombinant
polypeptides which have been separated, fractionated, or partially
or substantially purified by any suitable technique.
[0087] As used herein, "native" refers to the form of a
polynucleotide, gene or polypeptide as found in nature with its own
regulatory sequences, if present.
[0088] As used herein, "endogenous" refers to the native form of a
polynucleotide, gene or polypeptide in its natural location in the
organism or in the genome of an organism. "Endogenous
polynucleotide" includes a native polynucleotide in its natural
location in the genome of an organism. "Endogenous gene" includes a
native gene in its natural location in the genome of an organism.
"Endogenous polypeptide" includes a native polypeptide in its
natural location in the organism.
[0089] As used herein, "heterologous" refers to a polynucleotide,
gene or polypeptide not normally found in the host organism but
that is introduced into the host organism. "Heterologous
polynucleotide" includes a native coding region, or portion
thereof, that is reintroduced into the source organism in a form
that is different from the corresponding native polynucleotide.
"Heterologous gene" includes a native coding region, or portion
thereof, that is reintroduced into the source organism in a form
that is different from the corresponding native gene. For example,
a heterologous gene can include a native coding region that is a
portion of a chimeric gene including non-native regulatory regions
that is reintroduced into the native host. "Heterologous
polypeptide" includes a native polypeptide that is reintroduced
into the source organism in a form that is different from the
corresponding native polypeptide.
[0090] As used herein, the term "modification" refers to a change
in a polynucleotide disclosed herein that results in reduced,
substantially eliminated or eliminated activity of a polypeptide
encoded by the polynucleotide, as well as a change in a polypeptide
disclosed herein that results in reduced, substantially eliminated
or eliminated activity of the polypeptide. Such changes can be made
by methods well known in the art, including, but not limited to,
deleting, mutating (e.g., spontaneous mutagenesis, random
mutagenesis, mutagenesis caused by mutator genes, or transposon
mutagenesis), substituting, inserting, down-regulating, altering
the cellular location, altering the state of the polynucleotide or
polypeptide (e.g., methylation, phosphorylation or ubiquitination),
removing a cofactor, introduction of an antisense RNA/DNA,
introduction of an interfering RNA/DNA, chemical modification,
covalent modification, irradiation with UV or X-rays, homologous
recombination, mitotic recombination, promoter replacement methods,
and/or combinations thereof. Guidance in determining which
nucleotides or amino acid residues can be modified, can be found by
comparing the sequence of the particular polynucleotide or
polypeptide with that of homologous polynucleotides or
polypeptides, e.g., yeast or bacterial, and maximizing the number
of modifications made in regions of high homology (conserved
regions) or consensus sequences.
[0091] The term "derivative," as used herein, refers to a
modification of a sequence disclosed in the present invention.
Illustrative of such modifications would be the substitution,
insertion, and/or deletion of one or more bases relating to a
nucleic acid sequence of a coding sequence disclosed herein that
preserve, slightly alter, or increase the function of a coding
sequence disclosed herein in oil seed crop species. Such
derivatives can be readily determined by one skilled in the art,
for example, using computer modeling techniques for predicting and
optimizing sequence structure. The term "derivative" thus also
includes nucleic acid sequences having substantial sequence
homology with the disclosed coding sequences herein such that they
are able to have the disclosed functionalities for use in producing
LC-PUFAs of the present invention.
[0092] As used herein, the term "variant" refers to a polypeptide
differing from a specifically recited polypeptide of the invention
by amino acid insertions, deletions, mutations, and substitutions,
created using, e.g., recombinant DNA techniques, such as
mutagenesis. Guidance in determining which amino acid residues can
be replaced, added, or deleted without abolishing activities of
interest, can be found by comparing the sequence of the particular
polypeptide with that of homologous polypeptides and minimizing the
number of amino acid sequence changes made in regions of high
homology (conserved regions) or by replacing amino acids with
consensus sequences.
[0093] Alternatively, recombinant polynucleotide variants encoding
these same or similar polypeptides can be synthesized or selected
by making use of the "redundancy" in the genetic code. Various
codon substitutions, such as silent changes which produce various
restriction sites, can be introduced to optimize cloning into a
plasmid or viral vector for expression. Mutations in the
polynucleotide sequence can be reflected in the polypeptide or
domains of other peptides added to the polypeptide to modify the
properties of any part of the polypeptide.
[0094] Amino acid "substitutions" can be the result of replacing
one amino acid with another amino acid having similar structural
and/or chemical properties, conservative amino acid replacements,
or they can be the result of replacing one amino acid with an amino
acid having different structural and/or chemical properties, i.e.,
non-conservative amino acid replacements. "Conservative" amino acid
substitutions can be made on the basis of similarity in polarity,
charge, solubility, hydrophobicity, hydrophilicity, or the
amphipathic nature of the residues involved. For example, nonpolar
(hydrophobic) amino acids include alanine, leucine, isoleucine,
valine, proline, phenylalanine, tryptophan, and methionine; polar
neutral amino acids include glycine, serine, threonine, cysteine,
tyrosine, asparagine, and glutamine; positively charged (basic)
amino acids include arginine, lysine, and histidine; and negatively
charged (acidic) amino acids include aspartic acid and glutamic
acid. Alternatively, "non-conservative" amino acid substitutions
can be made by selecting the differences in polarity, charge,
solubility, hydrophobicity, hydrophilicity, or the amphipathic
nature of any of these amino acids. "Insertions" or "deletions" can
be within the range of variation as structurally or functionally
tolerated by the recombinant proteins. The variation allowed can be
experimentally determined by systematically making insertions,
deletions, or substitutions of amino acids in a polypeptide
molecule using recombinant DNA techniques and assaying the
resulting recombinant variants for activity.
[0095] The term "promoter" refers to a DNA sequence capable of
controlling the expression of a coding sequence or functional RNA.
In general, a coding sequence is located 3' to a promoter sequence.
Promoters can be derived in their entirety from a native gene, or
be composed of different elements derived from different promoters
found in nature, or even comprise synthetic DNA segments. It is
understood by those skilled in the art that different promoters can
direct the expression of a gene in different tissues or cell types,
or at different stages of development, or in response to different
environmental or physiological conditions. Promoters which cause a
gene to be expressed in most cell types at most times are commonly
referred to as "constitutive promoters." It is further recognized
that since in most cases the exact boundaries of regulatory
sequences have not been completely defined, DNA fragments of
different lengths can have identical promoter activity.
[0096] The term "operably linked" refers to the association of
nucleic acid sequences on a single nucleic acid fragment so that
the function of one is affected by the other. For example, a
promoter is operably linked with a coding sequence when it is
capable of effecting the expression of that coding sequence (e.g.,
that the coding sequence is under the transcriptional control of
the promoter). Coding sequences can be operably linked to
regulatory sequences in sense or antisense orientation.
[0097] The term "expression," as used herein, refers to the
transcription and stable accumulation of sense (mRNA) or antisense
RNA derived from the nucleic acid fragment of the invention.
Expression can also refer to translation of mRNA into a
polypeptide.
[0098] The term "overexpression" as used herein, refers to
expression that is higher than endogenous expression of the same or
related gene. A heterologous gene is overexpressed if its
expression is higher than that of a comparable endogenous gene.
[0099] As used herein, the term "transformation" refers to the
transfer of a nucleic acid or fragment into a host organism,
resulting in genetically stable inheritance. Host organisms
containing the transformed nucleic acid fragments are referred to
as "transgenic" or "recombinant" or "transformed" organisms.
[0100] The terms "plasmid" and "vector" as used herein refer to an
extra chromosomal element often carrying genes which are not part
of the central metabolism of the cell, and usually in the form of
circular double-stranded DNA molecules. Such elements can be
autonomously replicating sequences, genome integrating sequences,
phage or nucleotide sequences, linear or circular, of a single- or
double-stranded DNA or RNA, derived from any source, in which a
number of nucleotide sequences have been joined or recombined into
a unique construction which is capable of introducing a promoter
fragment and DNA sequence for a selected gene product along with
appropriate 3' untranslated sequence into a cell.
[0101] As used herein, the term "codon degeneracy" refers to the
nature in the genetic code permitting variation of the nucleotide
sequence without affecting the amino acid sequence of an encoded
polypeptide. The skilled artisan is well aware of the "codon-bias"
exhibited by a specific host cell in usage of nucleotide codons to
specify a given amino acid. Therefore, when synthesizing a gene for
improved expression in a host cell, it is desirable to design the
gene such that its frequency of codon usage approaches the
frequency of preferred codon usage of the host cell.
[0102] The term "codon-optimized" as it refers to genes or coding
regions of nucleic acid molecules for transformation of various
hosts refers to the alteration of codons in the gene or coding
regions of the nucleic acid molecules to reflect the typical codon
usage of the host organism without altering the polypeptide encoded
by the DNA. Such optimization includes replacing at least one, or
more than one, or a significant number, of codons with one or more
codons that are more frequently used in the genes of that
organism.
[0103] Deviations in the nucleotide sequence that comprise the
codons encoding the amino acids of any polypeptide chain allow for
variations in the sequence coding for the gene. Since each codon
consists of three nucleotides, and the nucleotides comprising DNA
are restricted to four specific bases, there are 64 possible
combinations of nucleotides, 61 of which encode amino acids (the
remaining three codons encode signals ending translation). The
"genetic code" which shows which codons encode which amino acids is
reproduced herein as Table 1. As a result, many amino acids are
designated by more than one codon. For example, the amino acids
alanine and proline are coded for by four triplets, serine and
arginine by six, whereas tryptophan and methionine are coded by
just one triplet. This degeneracy allows for DNA base composition
to vary over a wide range without altering the amino acid sequence
of the proteins encoded by the DNA.
TABLE-US-00001 TABLE 1 The Standard Genetic Code T C A G T TTT Phe
(F) TCT Ser (S) TAT Tyr (Y) TGT Cys (C) TTC '' TCC '' TAC '' TGC
TTA Leu (L) TCA '' TAA Stop TGA Stop TTG TCG '' TAG Stop TGG Trp
(W) C CTT Leu (L) CCT Pro (P) CAT His (H) CGT Arg (R) CTC '' CCC ''
CAC '' CGC '' CTA '' CCA '' CAA GLn (Q) CGA '' CTG '' CCG '' CAG ''
CGG '' A ATT Ile (I) ACT Thr (T) AAT Asn (N) AGT Ser (S) ATC '' ACC
'' AAC '' AGC '' ATA '' ACA '' AAA Lys (K) AGA Arg (R) ATG Met (M)
ACG '' AAG '' AGG '' G GTT Val (V) GCT Ala (A) GAT Asp (D) GGT
Gly(G) GTC '' GCC '' GAC '' GGC '' GTA '' GCA '' GAA Glu (E) GGA ''
GTG '' GCG '' GAG '' GGG ''
[0104] Many organisms display a bias for use of particular codons
to code for insertion of a particular amino acid in a growing
peptide chain. Codon preference, or codon bias, differences in
codon usage between organisms, is afforded by degeneracy of the
genetic code, and is well documented among many organisms. Codon
bias often correlates with the efficiency of translation of
messenger RNA (mRNA), which is in turn believed to be dependent on,
inter alia, the properties of the codons being translated and the
availability of particular transfer RNA (tRNA) molecules. The
predominance of selected tRNAs in a cell is generally a reflection
of the codons used most frequently in peptide synthesis.
Accordingly, genes can be tailored for optimal gene expression in a
given organism based on codon optimization.
[0105] Given the large number of gene sequences available for a
wide variety of animal, plant and microbial species, it is possible
to calculate the relative frequencies of codon usage. Codon usage
tables are readily available and can be adapted in a number of
ways. See Nakamura et al. Nucl. Acids Res. 28:292 (2000). By
utilizing this or similar tables, one of ordinary skill in the art
can apply the frequencies to any given polypeptide sequence, and
produce a nucleic acid fragment of a codon-optimized coding region
which encodes the polypeptide, but which uses codons optimal for a
given species. The present invention pertains to codon optimized
forms of OrfA, OrfB, chimeric OrfC, PPTase and/or other accessory
proteins of the invention, as described further herein.
[0106] The term "percent identity," as known in the art, is a
relationship between two or more polypeptide sequences or two or
more polynucleotide sequences, as determined by comparing the
sequences. In the art, "identity" also means the degree of sequence
relatedness between polypeptide or polynucleotide sequences, as the
case can be, as determined by the match between strings of such
sequences. "Identity" and "similarity" can be readily calculated by
known methods, including but not limited to those disclosed in: 1)
Computational Molecular Biology (Lesk, A. M., Ed.) Oxford
University: NY (1988); 2) Biocomputing: Informatics and Genome
Projects (Smith, D. W., Ed.) Academic: NY (1993); 3) Computer
Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H.
G., Eds.) Humania: NJ (1994); 4) Sequence Analysis in Molecular
Biology (von Heinje, G., Ed.) Academic (1987); and 5) Sequence
Analysis Primer (Gribskov, M. and Devereux, J., Eds.) Stockton: NY
(1991).
[0107] Methods to determine identity are designed to give the best
match between the sequences tested. Methods to determine identity
and similarity are codified in publicly available computer
programs. Sequence alignments and percent identity calculations can
be performed, for example, using the AlignX program of the Vector
NTI.RTM. suite (Invitrogen, Carlsbad, Calif.) or MegAlign.TM.
program of the LASERGENE bioinformatics computing suite (DNASTAR
Inc., Madison, Wis.). Multiple alignment of the sequences is
performed using the "Clustal method of alignment" which encompasses
several varieties of the algorithm including the "Clustal V method
of alignment" corresponding to the alignment method labeled Clustal
V (disclosed by Higgins and Sharp, CABIOS. 5:151-153 (1989);
Higgins, D. G. et al., Comput. Appl. Biosci., 8:189-191 (1992)) and
found in the MegAlign.TM. program of the LASERGENE bioinformatics
computing suite (DNASTAR Inc.). For multiple alignments, the
default values correspond to GAP PENALTY-10 and GAP LENGTH
PENALTY-10. Default parameters for pairwise alignments and
calculation of percent identity of protein sequences using the
Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS
SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP
PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the
sequences using the Clustal V program, it is possible to obtain a
"percent identity" by viewing the "sequence distances" table in the
same program. Additionally the "Clustal W method of alignment" is
available and corresponds to the alignment method labeled Clustal W
(described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins,
D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992)) and found in
the MegAlign.TM. v6.1 program of the LASERGENE bioinformatics
computing suite (DNASTAR Inc.). Default parameters for multiple
alignment (GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergen
Seqs (%)=30, DNA Transition Weight=0.5, Protein Weight
Matrix=Gonnet Series, DNA Weight Matrix=IUB). After alignment of
the sequences using the Clustal W program, it is possible to obtain
a "percent identity" by viewing the "sequence distances" table in
the same program.
[0108] It is well understood by one skilled in the art that many
levels of sequence identity are useful in identifying polypeptides,
from other species, wherein such polypeptides have the same or
similar function or activity. Useful examples of percent identities
include, but are not limited to: 60%, 65%, 70%, 75%, 80%, 85%, 90%,
or 95%, or any integer percentage from 60% to 100% can be useful in
describing the present invention, such as 60%, 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Suitable nucleic
acid fragments not only have the above homologies but typically
encode a polypeptide having at least 50 amino acids, at least 100
amino acids, at least 150 amino acids, at least 200 amino acids,
and at least 250 amino acids.
[0109] The term "sequence analysis software" refers to any computer
algorithm or software program that is useful for the analysis of
nucleotide or amino acid sequences. "Sequence analysis software"
can be commercially available or independently developed. Typical
sequence analysis software will include, but is not limited to: 1.)
the GCG suite of programs (Wisconsin Package Version 9.0, Genetics
Computer Group (GCG), Madison, Wis.); 2.) BLASTP, BLASTN, BLASTX
(Altschul et al., J. Mol. Biol., 215:403-410 (1990)); 3.) DNASTAR
(DNASTAR, Inc. Madison, Wis.); 4.) Sequencher (Gene Codes
Corporation, Ann Arbor, Mich.); and 5,) the FASTA program
incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput.
Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992,
111-20. Editor(s): Suhai, Sandor. Plenum: New York, N.Y.). Within
the context of this application it will be understood that where
sequence analysis software is used for analysis, that the results
of the analysis will be based on the "default values" of the
program referenced, unless otherwise specified. As used herein
"default values" will mean any set of values or parameters that
originally load with the software when first initialized.
[0110] Standard recombinant DNA and molecular cloning techniques
used here are well known in the art and are described, e.g., by
Sambrook et al., Molecular Cloning: A Laboratory Manual, Third
Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. (2000); and by Silhavy et al., Experiments with Gene Fusions,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1984); and by Ausubel et al., Current Protocols in Molecular
Biology, published by Greene Publishing Assoc. and
Wiley-Interscience (1987 to present).
[0111] The genetic manipulations of a recombinant hosts disclosed
herein can be performed using standard genetic techniques and
screening and can be made in any host cell that is suitable to
genetic manipulation. In some embodiments, a recombinant host cell
disclosed herein can be any organism or microorganism host useful
for genetic modification and recombinant gene expression. In some
embodiments, a recombinant host can be but is not limited to any
higher plant, including both dicotyledonous and monocotyledonous
plants, and consumable plants, including crop plants and plants
used for their oils. Thus, any plant species or plant cell can be
selected as described further below.
[0112] Oils of the present invention can be obtained from canola
cultivars producing DHA and/or EPA in seed oil of a Brassica
species where the oils have a fatty acid content comprising, by
weight, 70% or greater of oleic acid (C18:1) and/or 4% or lower
linolenic acid (C18:3). Such oils are heart healthy and have
increased stability for foodservice and consumer packaged goods
applications. Such oils also reduce the need for hydrogenation and
provide nutritional advantages relative to soy, palm and many other
oils used by the food industry. The oxidative stability of such
oils can be further increased by the addition of antioxidants and
processing additives known in the art.
[0113] The oils of the present invention can also be used in
non-culinary or dietary processes and compositions. Some of these
uses can be industrial, cosmetic or medical. Oils of the present
invention can also be used in any application for which the oils of
the present invention are suited. In general, the oils of the
present invention can be used to replace, e.g., mineral oils,
esters, fatty acids, or animal fats in a variety of applications,
such as lubricants, lubricant additives, metal working fluids,
hydraulic fluids and fire resistant hydraulic fluids. The oils of
the present invention can also be used as materials in a process of
producing modified oils. Examples of techniques for modifying oils
of the present invention include fractionation, hydrogenation,
alteration of the oil's oleic acid or linolenic acid content, and
other modification techniques known to those of skill in the
art.
[0114] Examples of cosmetic uses for oils of the present invention
include use as an emollient in a cosmetic composition; as a
petroleum jelly replacement; as comprising part of a soap, or as a
material in a process for producing soap; as comprising part of an
oral treatment solution; as comprising part of an ageing treatment
composition; and as comprising part of a skin or hair aerosol foam
preparation.
[0115] Additionally, the oils of the present invention can be used
in medical applications. For example, oils of the present invention
can be used in a protective barrier against infection and oils high
in omega-9 fatty acids can be used to enhance transplant graft
survival (U.S. Pat. No. 6,210,700).
[0116] It should be understood that the foregoing are non-limiting
examples of non-culinary uses for which the oils of the present
invention are suited. As previously stated, oils and modified oils
of the present invention can be used to replace, e.g., mineral
oils, esters, fatty acids, or animal fats in all applications known
to those of skill in the art.
PUFA Synthase System
[0117] The "standard" or "classical" pathway for synthesis of long
chain. PUFAs (LC-PUFAs) in eukaryotic organisms involves the
elongation and desaturation of medium chain-length saturated or
mono-unsaturated fatty acids and has been described. The pathway
for synthesis of long chain PUFAs via a PUFA synthase system has
also been described and is very different from the "standard"
pathway. Specifically, PUFA synthases utilize malonyl-CoA as a
carbon source and produce the final PUFA without releasing
intermediates in any significant amount. Also, with PUFA synthases,
the appropriate cis double bonds are added during the synthesis
using a mechanism that does not require oxygen. In some
embodiments, NADPH is used as a reductant during the synthesis
cycles.
[0118] The present invention relates to host organisms (e.g.,
plants) that have been genetically modified to express a PUFA
synthase system (either endogenously or by genetic manipulation).
In some embodiments, an organism that has been genetically modified
to express a PUFA synthase system, wherein the organism does not
naturally (endogenously, without genetic modification) express such
a system, or at least that particular PUFA synthase or portion
thereof with which the organism is being genetically modified, can
be referred to herein as a "heterologous" host organism with regard
to the modification of the organism with the PUFA synthase or with
another protein that is not endogenously expressed by the organism.
The genetic modifications of the present invention can be used to
improve PUFA production in a host organism that endogenously
expresses a PUFA synthase system, where the organism is not further
modified with a different PUFA synthase or a portion thereof.
[0119] A PUFA synthase system according to the present invention
can comprise several multifunctional proteins (and can include
single function proteins, particularly for PUFA synthase systems
from marine bacteria) that can act together to conduct both
iterative processing of the fatty acid chain as well non-iterative
processing, including trans-cis isomerization and enoyl reduction
reactions in selected cycles. These proteins can also be referred
to herein as the core PUFA synthase enzyme complex or the core PUFA
synthase system. The general functions of the domains and motifs
contained within these proteins are individually known in the art
and have been described in detail with regard to various PUFA
synthase systems from marine bacteria and eukaryotic organisms
(see, e.g., U.S. Pat. No. 6,140,486; U.S. Pat. No. 6,566,583; Metz
et al., Science 293:290-293 (2001); U.S. Appl. Pub. No.
2002/0194641; U.S. Appl. Pub. No. 2004/0235127; U.S. Appl. Pub. No.
2005/0100995, and WO 2006/135866). The domains can be found as a
single protein (e.g., the domain and protein are synonymous) or as
one of two or more (multiple) domains in a single protein, as
mentioned above. The domain architecture of various PUFA synthases
from marine bacteria and members of Thraustochytrium, and the
structural and functional characteristics of genes and proteins
comprising such PUFA synthases, have been described (see, e.g.,
U.S. Pat. No. 6,140,486; U.S. Pat. No. 6,566,583; Metz et al.,
Science 293:290-293 (2001); U.S. Appl. Pub. No. 2002/0194641; U.S.
Appl. Pub. No. 2004/0235127; U.S. Appl. Pub. No. 2005/0100995 and
WO 2006/135866).
[0120] Numerous examples of polynucleotides, genes and polypeptides
having PUFA synthase activity are known in the art and can be used
in a genetically modified host disclosed herein. PUFA synthase
proteins or domains that are useful in the present invention can
include both bacterial and non-bacterial PUFA synthases. A
non-bacterial PUFA synthase is a system that is from or derived
from an organism that is not a bacterium, such as a eukaryote.
Bacterial PUFA synthases are described, for example, in U.S. Appl.
Pub. No. 2008/0050505. Genetically modified plants of the invention
can be produced which incorporate non-bacterial PUFA synthase
functional domains with bacterial PUFA synthase functional domains,
as well as PUFA synthase functional domains or proteins from other
PKS systems (Type I iterative or modular, Type II, or Type III) or
FAS systems.
[0121] In some embodiments, a PUFA synthase system of the present
invention comprises at least the following biologically active
domains that are typically contained on three or more proteins (a)
at least one enoyl-ACP reductase (ER) domain; (b) multiple acyl
carrier protein (ACP) domain(s) (e.g., at least from one to four,
and preferably at least five ACP domains, and in some embodiments
up to six, seven, eight, nine, ten, or more than ten ACP domains);
(c) at least two .beta.-ketoacyl-ACP synthase (KS) domains; (d) at
least one acyltransferase (AT) domain; (e) at least one
.beta.-ketoacyl-ACP reductase (KR) domain; (f) at least two
FabA-like .beta.-hydroxyacyl-ACP dehydrase (DH) domains; (g) at
least one chain length factor (CLF) domain; (h) at least one
malonyl-CoA:ACP acyltransferase (MAT) domain. In some embodiments,
a PUFA synthase system according to the present invention also
comprises at least one region containing a dehydratase (DH)
conserved active site motif.
[0122] In some embodiments, a PUFA synthase system comprises at
least the following biologically active domains (a) at least one
enoyl-ACP reductase (ER) domain; (b) at least five acyl carrier
protein (ACP) domains; (c) at least two .beta.-ketoacyl-ACP
synthase (KS) domains; (d) at least one acyltransferase (AT)
domain; (e) at least one .beta.-ketoacyl-ACP reductase (KR) domain;
(f) at least two FabA-like .beta.-hydroxyacyl-ACP dehydrase (DH)
domains; (g) at least one chain length factor (CLF) domain; and (h)
at least one malonyl-CoA:ACP acyltransferase (MAT) domain. In some
embodiments, a PUFA synthase system according to the present
invention also comprises at least one region or domain containing a
dehydratase (DH) conserved active site motif that is not a part of
a FabA-like DH domain. The structural and functional
characteristics of each of these domains are described in detail in
U.S. Appl. Pub. No. 2002/0194641; U.S. Appl. Pub. No. 2004/0235127;
U.S. Appl. Pub. No. 2005/0100995; U.S. Appl. Pub. No. 2007/0245431
and WO 2006/135866.
[0123] There are three open reading frames that form the core
Schizochytrium PUFA synthase system and that have been described
previously, e.g., in U.S. Appl. Pub. No. 2007/0245431. The domain
structure of each open reading frame is as follows.
[0124] Schizochytrium Open Reading Frame A (OrfA or Pfa1):
[0125] OrfA is a 8730 nucleotide sequence (not including the stop
codon) which encodes a 2910 amino acid sequence. Within OrfA are
twelve domains (a) one .beta.-keto acyl-ACP synthase (KS) domain;
(b) one malonyl-CoA:ACP acyltransferase (MAT) domain; (c) nine acyl
carrier protein (ACP) domains; and (d) one ketoreductase (KR)
domain. Genomic DNA clones (plasmids) encoding OrfA from both
Schizochytrium sp. ATCC 20888 and a daughter strain of ATCC 20888,
denoted Schizochytrium sp., strain N230D, have been isolated and
sequenced.
[0126] Genomic clone pJK1126 (denoted pJK1126 OrfA genomic clone,
in the form of an E. coli plasmid vector containing "OrfA" gene
from Schizochytrium ATCC 20888) was deposited with the American
Type Culture Collection (ATCC), 10801 University Boulevard,
Manassas, Va. 20110-2209 USA on Jun. 8, 2006, and assigned ATCC
Accession No. PTA-7648.
[0127] Genomic clone pJK306 (denoted pJK306 OrfA genomic clone, in
the form of an E. coli plasmid containing 5' portion of OrfA gene
from Schizochytrium sp. N230D (2.2 kB overlap with pJK320)) was
deposited with the American Type Culture Collection (ATCC), 10801
University Boulevard, Manassas, Va. 20110-2209 USA on Jun. 8, 2006,
and assigned ATCC Accession No. PTA-7641.
[0128] Genomic clone pJK320 (denoted pJK320 OrfA genomic clone, in
the form of an E. coli plasmid containing 3' portion of OrfA gene
from Schizochytrium sp. N230D (2.2 kB overlap with pJK306)) was
deposited with the American Type Culture Collection (ATCC), 10801
University Boulevard, Manassas, Va. 20110-2209 USA on Jun. 8, 2006,
and assigned ATCC Accession No. PTA-7644.
[0129] Schizochytrium Open Reading Frame B (OrfB or Pfa2):
[0130] OrfB is a 6177 nucleotide sequence (not including the stop
codon) which encodes a 2059 amino acid sequence. Within OrfB are
four domains: (a) one-keto acyl-ACP synthase (KS) domain; (b) one
chain length factor (CLF) domain; (c) one acyl transferase (AT)
domain; and, (d) one enoyl ACP-reductase (ER) domain. Genomic DNA
clones (plasmids) encoding OrfB from both Schizochytrium sp. ATCC
20888 and a daughter strain of ATCC 20888, denoted Schizochytrium
sp., strain N230D, have been isolated and sequenced.
[0131] Genomic clone pJK1129 (denoted pJK1129 OrfB genomic clone,
in the form of an E. coli plasmid vector containing "OrfB" gene
from Schizochytrium ATCC 20888) was deposited with the American
Type Culture Collection (ATCC), 10801 University Boulevard,
Manassas, Va. 20110-2209 USA on Jun. 8, 2006, and assigned ATCC
Accession. No. PTA-7649.
[0132] Genomic clone pJK324 (denoted pJK324 OrfB genomic clone, in
the form of an E. coli plasmid containing the OrfB gene sequence
from Schizochytrium sp. N230D) was deposited with the American Type
Culture Collection (ATCC), 10801 University Boulevard, Manassas,
Va. 20110-2209 USA on Jun. 8, 2006, and assigned ATCC Accession No.
PTA-7643.
[0133] Schizochytrium Open Reading Frame C (OrfC or Pfa3):
[0134] OrfC is a 4506 nucleotide sequence (not including the stop
codon) which encodes a 1502 amino acid sequence. Within OrfC are
three domains: (a) two FabA-like-hydroxy acyl-ACP dehydrase (DH)
domains; and (b) one enoyl ACP-reductase (ER) domain. Genomic DNA
clones (plasmids) encoding OrfC from both Schizochytrium sp. ATCC
20888 and a daughter strain of ATCC 20888, denoted Schizochytrium
sp., strain N230D, have been isolated and sequenced.
[0135] Genomic clone pJK1131 (denoted pJK1131 OrfC genomic clone,
in the form of an E. coli plasmid vector containing "OrfC" gene
from Schizochytrium ATCC 20888) was deposited with the American
Type Culture Collection (ATCC), 10801 University Boulevard,
Manassas, Va. 20110-2209 USA on Jun. 8, 2006, and assigned ATCC
Accession No. PTA-7650.
[0136] Genomic clone pBR002 (denoted pBR002 OrfC genomic clone, in
the form of an E. coli plasmid vector containing the OrfC gene
sequence from Schizochytrium sp. N230D) was deposited with the
American Type Culture Collection (ATCC), 10801 University
Boulevard, Manassas, Va. 20110-2209 SA on Jun. 8, 2006, and
assigned ATCC Accession No. PTA-7642.
[0137] In addition, there are three open reading frames that form
the core Thraustochytrium PUFA synthase that have been described
previously. The domain structure of each open reading frame is as
follows.
[0138] Thraustochytrium 23B Open Reading Frame A (OrfA):
[0139] OrfA is a 8433 nucleotide sequence (not including the stop
codon) which encodes a 2811 amino acid sequence. The following
domains are present in Th. 23B OrfA (a) one .beta.-ketoacyl-ACP
synthase (KS) domain; (b) one malonyl-CoA:ACP acyltransferase (MAT)
domain; (c) eight acyl carrier protein (ACP) domains; and (d) one
.beta.-ketoacyl-ACP reductase (KR) domain.
[0140] Genomic clone Th23BOrfA_pBR812.1 (denoted Th23BOrfA_pBR812.1
genomic clone, in the form of an E. coli plasmid vector containing
the OrfA gene sequence from Thraustochytrium 23B) was deposited
with the American Type Culture Collection (ATCC), University
Boulevard, Manassas, Va. 20110-2209 USA on Mar. 1, 2007, and
assigned ATCC Accession No. PTA-8232. Genomic clone
Th23BOrfA_pBR811 (denoted Th23BOrfA_pBR811 genomic clone, in the
form of an E. coli plasmid vector containing the OrfA gene sequence
from Thraustochytrium 23B) was deposited with the American Type
Culture Collection (ATCC), 10801 University Boulevard, Manassas,
Va. 20110-2209 USA on Mar. 1, 2007, and assigned ATCC Accession No.
PTA-8231.
[0141] Thraustochytrium 23B Open Reading Frame B (OrfB):
[0142] OrfB is a 5805 nucleotide sequence (not including the stop
codon) that encodes a 1935 amino acid sequence. The following
domains are present in Th. 23B OrfB (a) one .beta.-ketoacyl-ACP
synthase (KS) domain; (b) one chain length factor (CLF) domain; (c)
one acyltransferase (AT) domain; and, (d) one enoyl-ACP reductase
(ER) domain. Genomic clone Th23BOrfB_pBR800 (denoted
Th23BOrfB_pBR800 genomic clone, in the form of an E. coli plasmid
vector containing the OrfB gene sequence from Thraustochytrium 23B)
was deposited with the American Type Culture Collection (ATCC),
10801 University Boulevard, Manassas, Va. 20110-2209 USA on Mar. 1,
2007, and assigned ATCC Accession No. PTA-8227.
[0143] Thraustochytrium 23B Open Reading Frame C (OrfC):
[0144] OrfC is a 4410 nucleotide sequence (not including the stop
codon) that encodes a 1470 amino acid sequence. The following
domains are present in Th. 23B OrfC: (a) two FabA-like
.beta.-hydroxyacyl-ACP dehydrase (DH) domains, both with homology
to the FabA protein (an enzyme that catalyzes the synthesis of
trans-2-decenoyl-ACP and the reversible isomerization of this
product to cis-3-decenoyl-ACP); and (b) one enoyl-ACP reductase
(ER) domain with high homology to the ER domain of Schizochytrium
OrfB. Genomic clone Th23BOrfC_pBR709A (denoted Th23BOrfC_pBR709A
genomic clone, in the form of an E. coli plasmid vector containing
the OrfC gene sequence from Thraustochytrium 23B) was deposited
with the American Type Culture Collection (ATCC), 10801 University
Boulevard, Manassas, Va. 20110-2209 USA on Mar. 1, 2007, and
assigned ATCC Accession No. PTA-8228.
[0145] Chimeric or Hybrid PUFA Synthase Systems:
[0146] In some embodiments, the PUFA synthase system comprises
domains selected from any of those described herein, wherein the
domains are combined (e.g., mixed and matched) to form a complete
PUFA synthase system meeting the minimum requirements described
herein. In some embodiments, the genetically modified organism of
the invention can be further modified with at least one domain or
biologically active fragment thereof of another PUFA synthase
system. In some embodiments, any of the domains of a PUFA synthase
system can be modified from their natural structure to modify or
enhance the function of that domain in the PUFA synthase system
(e.g., to modify the PUFA types or ratios thereof produced by the
system). Such mixing of domains to produce chimeric PUFA synthase
systems is described in the patents and publications referenced
herein.
[0147] In some embodiments, the PUFA synthase system comprises a
Schizochytrium PUFA synthase system wherein OrfC from the
Schizochytrium PUFA synthase system is replaced with OrfC from
Thraustochytrium 23B. In some embodiments, such a chimeric OrfC
from Thraustochytrium 23B is encoded by a nucleic acid sequence
that is optimized for Schizochytrium codon usage. As a non-limiting
example of such a chimeric OrfC, plasmid pThOrfC-synPS (denoted
pThOrfC-synPS, in the form of an E. coli plasmid vector containing
a "perfect stitch" synthetic Thraustochytrium 23B PUFA PKS OrfC
codon optimized for expression in Schizochytrium or other
heterologous hosts) was deposited with the American Type Culture
Collection (ATCC), 10801 University Boulevard, Manassas, Va.
20110-2209 USA on Mar. 1, 2007, and assigned ATCC Accession No.
PTA-8229 (see also U.S. Appl. Pub. No. 2008/0022422).
[0148] Other examples of PUFA synthase genes and polypeptides that
can be used in a genetically modified organism of the invention
include, but are not limited to, the following codon-optimized
sequences generated by the methods described further herein: SEQ ID
NO:1 (SzPUFA OrfA v3 protein); SEQ ID NO:2 (SzPUFA OrfB v3
protein); SEQ ID NO:3 (hSzThPUFA OrfC v3 protein); SEQ ID NO:6
(SzPUFA OrfA gene); SEQ ID NO:7 (SzPUFA OrfB v3 gene); and SEQ ID
NO:8 (hSzThPUFA OrfC v3 gene), as well as an active variant,
portion, fragment, or derivative of such sequences, wherein such a
gene encodes, or such a polypeptide or protein has, PUFA synthase
activity. The present invention includes an isolated polynucleotide
or polypeptide comprising or consisting of one or more of such
sequences.
[0149] Other examples of PUFA synthase genes and polypeptides that
can be used in a genetically modified organism of the invention
include, but are not limited to, PUFA synthase genes or
polypeptides having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99% or 100% sequence identity to any one of the PUFA
synthases or sequences described herein. Useful ranges can be
selected between any of these values (for example, 60% to 99%, 65%
to 95%, 70% to 95%, 75% to 95%, 80% to 95%, 85% to 95%, or 90% to
99%). Still other examples of PUFA synthase genes and polypeptides
that can used in a genetically modified organism of the invention
include, but are not limited to an active variant, portion,
fragment of derivative of any one of the PUFA synthases or
sequences described herein, wherein such a gene encodes, or such a
polypeptide has, PUFA synthase activity.
[0150] In some embodiments, the PUFA synthase system can be an
algal PUFA synthase. In some embodiments, the PUFA synthase system
can comprise an amino acid sequence that is at least 60% to 99%
identical to the amino acid sequence of SEQ ID NO:1. In some
embodiments, the PUFA synthase system can comprise the amino acid
sequence of SEQ ID NO:1. In some embodiments, the nucleic acid
sequence encoding the PUFA synthase system can comprise a nucleic
acid sequence at least 60% to 99% identical to the nucleic acid
sequence of SEQ ID NO:6. In some embodiments, the nucleic acid
sequence encoding the PUFA synthase system can comprise the nucleic
acid sequence of SEQ ID NO:6. In some embodiments, the PUFA
synthase system can comprise an amino acid sequence that is at
least 80% identical to the amino acid sequence of SEQ ID NO:2. In
some embodiments, the PUFA synthase system can comprise the amino
acid sequence of SEQ ID NO:2. In some embodiments, the nucleic acid
sequence encoding the PUFA synthase system can comprise a nucleic
acid sequence that is at least 80% identical to the nucleic acid
sequence of SEQ ID NO:7. In some embodiments, the nucleic acid
sequence encoding the synthase system can comprise the nucleic acid
sequence of SEQ ID NO:7. In some embodiments, the PUFA synthase
system can comprise an amino acid sequence that is at least 80%
identical to the amino acid sequence of SEQ ID NO:3. In some
embodiments, the PUFA synthase system comprises the amino acid
sequence of SEQ ID NO:3. In some embodiments, the nucleic acid
sequence encoding the PUFA synthase system comprises a nucleic acid
sequence that is at least 80% identical to the nucleic acid
sequence of SEQ ID NO:8. In some embodiments, the nucleic acid
sequence encoding the PUFA synthase system comprises the nucleic
acid sequence of SEQ ID NO:8.
[0151] In some embodiments, the PUFA synthase system comprises the
amino acid sequence of SEQ ID NO:1, 2, or 3 or any combinations
thereof. In some embodiments, the PUFA synthase system comprises
the nucleic acid sequence of SEQ ID NO:6, 7, or 8 or any
combinations thereof.
[0152] In some embodiments, the sequences of other PUFA synthase
genes and/or polypeptides can be identified in the literature and
in bioinformatics databases well known to the skilled person using
sequences disclosed herein and available in the art. For example,
such sequences can be identified through BLAST searching of
publicly available databases with known PUFA synthase gene or
polypeptide sequences. In such a method, identities can be based on
the Clustal W method of alignment using the default parameters of
GAP PENALTY-10, GAP LENGTH PENALTY=0.1, and Gannet 250 series of
protein weight matrix.
[0153] Additionally, the PUFA synthase gene or polypeptide
sequences disclosed herein or known the art can be used to identify
other PUFA synthase homologs in nature. For example, each of the
PUFA synthase nucleic acid fragments disclosed herein can be used
to isolate genes encoding homologous proteins. Isolation of
homologous genes using sequence-dependent protocols is well known
in the art. Examples of sequence-dependent protocols include, but
are not limited to (1) methods of nucleic acid hybridization; (2)
methods of DNA and RNA amplification, as exemplified by various
uses of nucleic acid amplification technologies [e.g., polymerase
chain reaction (PCR), Mullis et al., U.S. Pat. No. 4,683,202;
ligase chain reaction (LCR), Tabor, S. et al., Proc. Acad. Sci. USA
82:1074 (1985); or strand displacement amplification (SDA), Walker
et al., Proc. Natl. Acad. Sci. U.S.A., 89:392 (1992)]; and (3)
methods of library construction and screening by
complementation.
[0154] All of these methods can be readily practiced by one skilled
in the art making use of the known or identified sequences encoding
target proteins. In some embodiments, DNA sequences surrounding a
target PUFA synthase coding sequence are also useful in some
modification procedures and can be readily found by one of skill in
the art in publicly available databases. Methods for creating
genetic mutations are common and well known in the art and can be
applied to the exercise of creating mutants.
Phosphopantethienyl Transferase
[0155] The phosphopantethienyl transferases (PPTases) are a family
of enzymes that have been well characterized in fatty acid
synthesis, polyketide synthesis, and non-ribosomal peptide
synthesis. In particular, the ACP domains present in the PUFA
synthase enzymes require activation by attachment of a cofactor
(4-phosphopantetheine) from coenzyme A to the acyl carrier protein
(ACP). Attachment of this cofactor is carried out by PPTases. If
the endogenous PPTases of the host organism are incapable of
activating the PUFA synthase ACP domains, then it is necessary to
provide a PPTase that is capable of carrying out that function. The
sequences of many PPTases are known, and crystal structures have
been determined (e.g., Reuter et al., EMBO J. 18:6823-31 (1999)) as
well as mutational analysis of amino acid residues important for
activity (Mofid et al., Biochemistry 43:4128-36 (2004)).
[0156] One example of a heterologous PPTase which has been
demonstrated previously to recognize the OrfA ACP domains described
herein as substrates is the Het I protein of Nostoc sp. PCC 7120
(formerly called Anabaena sp. PCC 7120). Het I is present in a
cluster of genes in Nostoc known to be responsible for the
synthesis of long chain hydroxy-fatty acids that are a component of
a glyco-lipid layer present in heterocysts of that organism (Black
and Wolk, J. Bacteriol. 176:2282-2292 (1994); Campbell et al.,
Arch. Microbiol. 167:251-258 (1997)). Het I is likely to activate
the ACP domains of a protein, Hgl E, present in that cluster. The
two ACP domains of Hgl E have a high degree of sequence homology to
the ACP domains found in Schizochytrium Orf A and other PUFA
synthases.
[0157] In some embodiments, a PUFA synthase can be considered to
include at least one 4'-phosphopantetheinyl transferase (PPTase)
domain, or such a domain can be considered to be an accessory
domain or protein to the PUFA synthase. Structural and functional
characteristics of PPTases have been described in detail, for
example, in U.S. Appl. Pub. No. 2002/0194641; U.S. Appl. Pub. No.
2004/0235127; and U.S. Appl. Pub. No. 2005/0100995.
[0158] Numerous examples of genes and polypeptides having PPTase
activity are known in the art and could be used in a genetically
modified organism of the invention if they are capable of
activating the ACP domains of the particular PUFA synthase being
used. Examples of genes and polypeptides that can be used in a
genetically modified organism of the invention can include, but are
not limited to, the following codon-optimized sequences described
further herein: SEQ ID NO:5 (NoHetI v3 protein) and SEQ ID NO:10
(NoHetI v3 gene).
[0159] Other examples of PPTase genes and polypeptides that can be
used in a genetically modified organism of the invention include,
but are not limited to, PPTase genes or polypeptides having 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%
sequence identity to any one of the PPTases or sequences described
herein. Useful ranges can be selected between any of these values
(for example, 60% to 99%, 65% to 95%, 70% to 95%, 75% to 95%, 80%
to 95%, 85% to 95%, 90% to 99%). Still other examples of PPTase
genes and polypeptides that can used in a genetically modified
organism of the invention include, but are not limited to an active
variant, fragment, portion or derivative of any one of the PPTase
sequences described herein, wherein such a gene encodes, or such a
polypeptide has, PPTase activity.
[0160] In some embodiments, the PPTase can be an algal PPTase. In
some embodiments, the PPTase can comprise an amino acid sequence
that is at least 60% to 99% identical to the amino acid sequence of
SEQ ID NO:5. In some embodiments, the PPTase can comprise the amino
acid sequence of SEQ ID NO:5. In some embodiments, the nucleic acid
sequence encoding the algal PPTase can comprise a nucleic acid
sequence at least 60% to 99% identical to the nucleic acid sequence
of SEQ ID NO:10. In some embodiments, the nucleic acid sequence
encoding the algal PPTase can comprise the nucleic acid sequence of
SEQ ID NO:10.
[0161] In some embodiments of the present invention, a PPTase can
be provided for production and/or accumulation of PPTase in a
heterologous host.
[0162] In some embodiments, a gene and/or polypeptide encoding
PPTase can be used to identify another PPTase gene and/or
polypeptide sequences and/or can be used to identify a PPTase
homolog in other cells. Such PPTase encoding sequences can be
identified, for example, in the literature and/or in bioinformatics
databases well known to the skilled person. For example, the
identification of a PPTase encoding sequence in another cell type
using bioinformatics can be accomplished through BLAST (as
disclosed above) searching of publicly available databases with a
known PPTase encoding DNA and polypeptide sequence, such as any of
those provided herein. Identities are based on the Clustal W method
of alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight
matrix.
[0163] In some embodiments, the genetically modified plant (e.g.,
Brassica), descendant, cell, tissue, or part thereof contains the
nucleic acid sequences of (i) and (ii) in a single recombinant
expression vector.
Acyl-CoA Synthetase
[0164] The present invention provides acyl-CoA synthetase (ACoAS)
proteins that catalyze the conversion of long chain PUFA free fatty
acids (FFA) to acyl-CoA. The endogenous producer of PUFAs by PUFA
synthase, Schizochytrium, possesses one or more ACoASs that are
capable of converting the free fatty acid products of its PUFA
synthase into acyl-CoA. This is evident by the fact that high
levels of PUFAs accumulate in those fractions in this organism.
Therefore, Schizochytrium, as well as other organisms that
endogenously contain a PUFA synthase (e.g., other Thraustochytrids)
or other organisms that can convert PUFA FFAs into acyl-COAs (such
as Thalassiosira pseudonana or Crypthecodinium cohnii), could
represent sources for genes encoding enzymes that are useful in
permitting or increasing the accumulation of the products of a PUFA
synthase expressed in a heterologous host. Other ACoAS sequences
have been described in U.S. Appl. Pub. No, 2007/0245431.
[0165] Numerous examples of genes and polypeptides having ACoAS
activity are known in the art and can be used in a genetically
modified organism of the invention. Examples of genes and
polypeptides that can be used in a genetically modified organism of
the invention can include, but are not limited to, the following
codon-optimized sequences described further herein: SEQ ID NO:4
(SzACS-2 v3 protein) and SEQ ID NO:9 (hSzThACS-2 v3 gene).
[0166] Other examples of ACoAS genes and polypeptides that can be
used in a genetically modified organism of the invention include,
but are not limited to, ACoAS genes or polypeptides having 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%
sequence identity to any one of the ACoAS or sequences described
herein. Useful ranges can be selected between any of these values
(for example, 60% to 99%, 65% to 95%, 70% to 95%, 75% to 95%, 80%
to 95%, 85% to 95%, 90% to 99%). Still other examples of ACoAS
genes and polypeptides that can used in a genetically modified
organism of the invention include, but are not limited to an active
variant, fragment, portion, or derivative of any one of the ACoAS
sequences described herein, wherein such a gene encodes, or such a
polypeptide has, ACoAS activity.
[0167] In some embodiments, the ACoAS can be an algal ACoAS. In
some embodiments, the ACoAS can comprise an amino acid sequence
that is at least 60% to 99% identical to the amino acid sequence of
SEQ ID NO:4. In some embodiments, the ACoAS can comprise the amino
acid sequence of SEQ ID NO:4. In some embodiments, the nucleic acid
sequence encoding the algal ACoAS can comprise a nucleic acid
sequence at least 60% to 99% identical to the nucleic acid sequence
of SEQ ID NO:9. In some embodiments, the nucleic acid sequence
encoding the algal ACoAS can comprise the nucleic acid sequence of
SEQ ID NO:9. In some embodiments, the nucleic acid sequence
encoding the ACoAS comprises the nucleic acid sequence of SEQ ID
NO:34.
[0168] In some embodiments of the present invention, ACoAS can be
provided for production and/or accumulation of ACoAS in a
heterologous host as well as for improved production and/or
accumulation of ACoAS in an endogenous host.
[0169] In some embodiments, a gene and/or polypeptide encoding
ACoAS can be used to identify another ACoAS gene and/or polypeptide
sequences and/or can be used to identify an ACoAS homolog in other
cells. Such ACoAS encoding sequences can be identified, for
example, in the literature and/or in bioinformatics databases well
known to the skilled person. For example, the identification of a
ACoAS encoding sequence in another cell type using bioinformatics
can be accomplished through BLAST (as disclosed above) searching of
publicly available databases with a known ACoAS encoding DNA and
polypeptide sequence, such as any of those provided herein.
Identities are based on the Clustal W method of alignment using the
default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and
Gonnet 250 series of protein weight matrix.
[0170] In some embodiments, the genetically modified plant (e.g.,
Brassica), descendant, cell, tissue, or part thereof comprises the
nucleic acid sequences of (i), (ii) or (iii), or any combinations
thereof, contained in a single recombinant expression vector. In
some embodiments, the nucleic acid sequences of (i), (ii) or (iii),
or any combinations thereof, are under the control of one or more
seed-specific promoters and/or are contained in a single
recombinant expression vector.
Methods of Making Genetically Modified Organisms
[0171] To produce significantly high yields of one or more desired
polyunsaturated fatty acids, an organism (e.g., a plant), can be
genetically modified to introduce a PUFA synthase into the plant.
The present invention also relates to methods to improve or enhance
the effectiveness of such genetic modification and particularly, to
improve or enhance the production and/or accumulation of the
endproduct of a PUFA synthase, e.g., PUFA(s).
[0172] Methods for gene expression in a genetically modified
organism, including, but not limited to plants, are known in the
art. In some embodiments, the coding region for the PUFA synthase
genes to be expressed can be codon optimized for the target host
cell as described below. Expression of genes in recombinant host
cells, including but not limited to plant cells, can require a
promoter operably linked to a coding region of interest, and/or a
transcriptional terminator. A number of promoters can be used in
constructing vectors for genes, including but not limited to a
seed-specific promoter (e.g., PvDlec2, LfKCS3 and FAE 1). Other
non-limiting examples of promoters that can be used in the present
invention include the acyl carrier protein promoter disclosed in WO
1992/18634; the Phaseolus vulgaris beta-phaseolin promoter and
truncated versions disclosed in Slightom et al. (Proc. Natl. Acad.
Sci. U.S.A. 80:1897-1901; 1983); Sengupta-Gopalan et al. (Proc.
Nat. Acad, Sci. 82:3320-3324; 1985); van der Geest et al. (Plant
Mol. Biol. 33:553-557; 1997), and Bustos et al. (EMBO J.
10:1469-1479; 1991).
[0173] In some embodiments of the present invention, a recombinant
vector is an engineered (e.g., artificially produced) nucleic acid
molecule that is used as a tool for manipulating a nucleic acid
sequence of choice and for introducing such a nucleic acid sequence
into a host cell. The recombinant vector is therefore suitable for
use in cloning, sequencing, and/or otherwise manipulating the
nucleic acid sequence of choice, such as by expressing and/or
delivering the nucleic acid sequence of choice into a host cell to
form a recombinant cell. Such a vector typically contains
heterologous nucleic acid sequences, that is nucleic acid sequences
that are not naturally found adjacent to nucleic acid sequence to
be cloned or delivered, although the vector can also contain
regulatory nucleic acid sequences (e.g., promoters, untranslated
regions) which are naturally found adjacent to nucleic acid
molecules of the present invention or which are useful for
expression of the nucleic acid molecules of the present invention.
The vector can be either RNA or DNA, either prokaryotic or
eukaryotic, and typically is a plasmid. The vector can be
maintained as an extrachromosomal element (e.g., a plasmid) or it
can be integrated into the chromosome of a recombinant organism
(e.g., a microbe or a plant). The entire vector can remain in place
within a host cell, or under certain conditions, the plasmid DNA
can be deleted, leaving behind the nucleic acid molecule of the
present invention. The integrated nucleic acid molecule can be
under chromosomal promoter control, under native or plasmid
promoter control, or under a combination of several promoter
controls. Single or multiple copies of the nucleic acid molecule
can be integrated into the chromosome. A recombinant vector of the
present invention can contain at least one selectable marker.
[0174] In some embodiments, a recombinant vector used in a
recombinant nucleic acid molecule of the present invention is an
expression vector. In such an embodiment, a nucleic acid sequence
encoding the product to be produced (e.g., a PUFA synthase) is
inserted into the recombinant vector to produce a recombinant
nucleic acid molecule. The nucleic acid sequence encoding the
protein to be produced is inserted into the vector in a manner that
operatively links the nucleic acid sequence to regulatory sequences
in the vector that enable the transcription and translation of the
nucleic acid sequence within the recombinant host cell.
[0175] Vectors useful for the transformation of a variety of host
organisms and cells are common and disclosed in the literature.
Typically the vector contains a selectable marker and sequences
allowing autonomous replication or chromosomal integration in the
desired host. In addition, suitable vectors can comprise a promoter
region which harbors transcriptional initiation controls and a
transcriptional termination control region, between which a coding
region DNA fragment can be inserted, to provide expression of the
inserted coding region. Both control regions can be derived from
genes homologous to the transformed host cell, although it is to be
understood that such control regions can also be derived from genes
that are not native to the specific species chosen as a production
host.
[0176] The present invention includes the expression of one or more
acyl-CoA synthetases as described and exemplified herein with a
PUFA synthase as described herein and with an exogenous PPTase
which are utilized alone or in combination with any one or more
strategies described herein (e.g., any one, two, three, or four of:
codon optimization, organelle-targeting, enhancement of PUFA
synthase competition for malonyl CoA (e.g., by inhibition of FAS),
and/or expression of one or more acyltransferases or related
enzymes), to increase PUFA production and/or accumulation in a
heterologous host.
[0177] Some embodiments of the invention relate to the targeting of
expression of the PUFA synthase enzymes, the PPTase, and/or any one
or more of the accessory proteins and/or targeted genetic
modifications to one or more organelles of the host. For example,
in some embodiments, expression of the PUFA synthase system and the
PPTase can be targeted to the plastid of a plant. In some
embodiments, expression of the PUFA synthase and the PPTase is
targeted to the cytosol. In some embodiments, expression of the
PUFA synthase and the PPTase is targeted to both the plastid and
the cytosol of a plant. In any of these embodiments, other targets
can be directed to the plastid or the cytosol.
[0178] In some embodiments, acyl-CoA synthetases are expressed in
the cytosol to convert the DHA and/or other LC-PUFA free fatty
acids to acyl-CoAs, which in turn can be utilized by the
acyltransferases.
[0179] One exemplary plastid targeting sequence is derived from a
Brassica napus acyl-ACP thioesterase and is described in U.S. Appl.
Pub. No. 2007/0245431. A variety of other plastid targeting
sequences are known in the art and can be used in embodiments where
the heterologous host is a plant or plant cell, and wherein
targeting to the plastid is desired.
[0180] The present invention includes the use of organelle
targeting (e.g., to the plastid or chloroplast in plants) with
expression of a PUFA synthase as described herein and with an
exogenous PPTase, which are utilized alone or in combination with
any one or more strategies described herein (e.g., any one, two,
three, or four of: codon optimization, enhancement of PUFA synthase
competition for malonyl CoA (e.g., by inhibition of FAS),
expression of one or more acyl-CoA synthetases, and/or expression
of one or more acyltransferases or related enzymes), to increase
PUFA production and/or accumulation in a heterologous host.
[0181] The targeting of gene products to the plastid or chloroplast
is controlled by a signal sequence found at the amino terminal end
of various proteins and which is cleaved during import yielding the
mature protein (e.g., with regard to chloroplast targeting, see,
e.g., Comai et al., J. Biol. Chem. 263:15104-15109 (1988)). These
signal sequences can be fused to heterologous gene products to
effect the import of heterologous products into the chloroplast
(van den Broeck et al. Nature 313:358-363 (1985)). DNA encoding for
appropriate signal sequences can be isolated from the cDNAs
encoding the RUBISCO protein, the CAB protein, the EPSP synthase
enzyme, the GS2 protein and many other proteins which are known to
be chloroplast localized.
[0182] In some embodiments of the invention, the localization of
proteins employed in the invention is directed to a subcellular
compartment, for example, to the plastid or chloroplast. Proteins
can be directed to the chloroplast by including at their
amino-terminus a chloroplast transit peptide (CTP). Similarly,
proteins can be directed to the plastid by including at their
N-terminus a plastid transit or signaling peptide.
[0183] Naturally occurring chloroplast targeted proteins,
synthesized as larger precursor proteins containing an
amino-terminal chloroplast targeting peptide directing the
precursor to the chloroplast import machinery, are well known in
the art. Chloroplast targeting peptides are generally cleaved by
specific endoproteases located within the chloroplast organelle,
thus releasing the targeted mature and preferably active enzyme
from the precursor into the chloroplast milieu. Examples of
sequences encoding peptides which are suitable for directing the
targeting of the gene or gene product to the chloroplast or plastid
of the plant cell include the petunia EPSPS CTP the Arabidopsis
EPSPS CTP2 and intron, and others known to those skilled in the
art. Such targeting sequences provide for the desired expressed
protein to be transferred to the cell structure in which it most
effectively functions, or by transferring the desired expressed
protein to areas of the cell in which cellular processes necessary
for desired phenotypic function are concentrated. Specific examples
of chloroplast targeting peptides are well known in the art and
include the Arabidopsis thaliana ribulose bisphosphate carboxylase
small subunit ats1A transit peptide, an Arabidopsis thaliana EPSPS
transit peptide, and a Zea maize ribulose bisphosphate carboxylase
small subunit transit peptide.
[0184] An optimized transit peptide is described, for example, by
van den Broeck et al., Nature, 313:358-363 (1985). Prokaryotic and
eukaryotic signal sequences are disclosed, for example, by
Michaelis et al., Ann. Rev. Microbiol. 36:425 (1982). Additional
examples of transit peptides that can be used in the invention
include the chloroplast transit peptides such as those described in
Von Heijne et al., Plant Mol. Biol. Rep. 9:104-126 (1991); Mazur et
al., Plant Physiol. 85:1110 (1987); Vorst et al., Gene 65:59
(1988). Chen & Jagendorf (J. Biol. Chem. 268:2363-2367 (1993))
have described use of a chloroplast transit peptide for import of a
heterologous transgene. This peptide used is the transit peptide
from the rbcS gene from Nicotiana plumbaginifolia (Poulsen et al.
Mol. Gen. Genet. 205: 193-200 (1986)). One CTP that has functioned
herein to localize heterologous proteins to the chloroplast was
derived from Brassica napus acyl-ACP thioesterase.
[0185] An alternative means for localizing genes to chloroplast or
plastid includes chloroplast or plastid transformation. Recombinant
plants can be produced in which only the chloroplast DNA has been
altered to incorporate the molecules envisioned in this
application. Promoters which function in chloroplasts are known in
the art (Hanley-Bowden et al., Trends in Biochemical Sciences
12:67-70 (1987)). Methods and compositions for obtaining cells
containing chloroplasts into which heterologous DNA has been
inserted have been described, for example by Daniell et al. (U.S.
Pat. No. 5,693,507) and Maliga et al. (U.S. Pat. No.
5,451,513).
Combinations of Strategies
[0186] According to the present invention, in the production of a
heterologous host for the production and accumulation of one or
more target PUFAs, any one or more (any combination) of the
strategies described herein for improving the production and/or
accumulation of PUFAs in the host can be used. Indeed, it is
anticipated that various combinations of strategies will be
additive or synergistic and provide improved production and/or
accumulation of PUFAs as compared to in the absence of one or more
such strategies. Indeed, the Examples provide exemplary strategies
for the production of PUFAs in a host organism.
[0187] Any plant or plant cell using these combinations of
modifications, or any other modification or combination of
modifications described herein, is encompassed by the invention. In
some embodiments, such a plant has been further genetically
modified to express an accessory protein as described herein for
the improvement of the production and/or accumulation of PUFAs (or
other bioactive products of the PUFA synthase) by the host (e.g.,
ACoAS, GPAT, LPAAT, DAGAT or acetyl CoA carboxylase (ACCase)).
Furthermore, any host cell or organism using any modifications or
combination of modifications described herein is encompassed by the
invention, as are any products derived from such cell or organisms,
including seed or oil comprising the target PUFAs.
[0188] In some embodiments, plants to genetically modify according
to the present invention (e.g., plant host cells) includes, but is
not limited to any higher plants, including both dicotyledonous and
monocotyledonous plants, and particularly consumable plants,
including crop plants and especially plants used for their oils.
Such plants can include, but are not limited to, for example:
canola, soybeans, rapeseed, linseed, corn, safflowers, sunflowers
and tobacco. Thus, any plant species or plant cell can be selected.
In embodiments, plant cells used herein, and plants grown or
derived therefrom, include, but are not limited to, cells
obtainable from canola (Brassica napus); oilseed rape (Brassica
napus); indian mustard (Brassica juncea); Ethiopian mustard
(Brassica carinata); turnip (Brassica rapa); cabbage (Brassica
oleracea); soybean (Glycine max); linseed/flax (Linum
usitatissimum); maize (corn) (Zea mays); safflower (Carthamus
tinctorius); sunflower (Helianthus annuus); tobacco (Nicotiana
tabacum); Arabidopsis thaliana, Brazil nut (Betholettia excelsa);
castor bean (Ricinus communis); coconut (Cocus nucifera); coriander
(Coriandrum sativum); cotton (Gossypium spp.); groundnut (Arachis
hypogaea); jojoba (Simmondsia chinensis); oil palm (Elaeis
guineeis); olive (Olea eurpaea); rice (Oryza sativa); squash
(Cucurbita maxima); barley (Hordeum vulgare); wheat (Triticum
aestivum); and duckweed (Lemnaceae sp.). In some embodiments, the
genetic background within a plant species can vary.
[0189] "Plant parts," as used herein, include any parts of a plant,
including, but not limited to, seeds (including mature seeds and
immature seeds), pollen, embryos, flowers, fruits, shoots, leaves,
roots, stems, explants, etc. In some embodiments, a genetically
modified plant has a genome which is modified (e.g., mutated or
changed) from its normal (e.g., wild-type or naturally occurring)
form such that the desired result is achieved (e.g., increased or
modified PUFA synthase and/or production and/or accumulation of a
desired product using the PUFA synthase). In some embodiments,
genetic modification of a plant can be accomplished using classical
strain development and/or molecular genetic techniques. Methods for
producing a transgenic plant, wherein a recombinant nucleic acid
molecule encoding a desired amino acid sequence is incorporated
into the genome of the plant, are known in the art. In some
embodiments, a plant to genetically modify according to the present
invention is a plant suitable for consumption by animals, including
humans.
[0190] Plant lines from these plants, optimized for a particularly
desirable trait, e.g. disease resistance, case of plant
transformation, oil content or profile, etc., can be produced,
selected or identified. In some embodiments, plant lines can be
selected through plant breeding, or through methods such as marker
assisted breeding and tilling. In some embodiments, plant cell
cultures can be used and, for example, are not grown into
differentiated plants and cultivated using ordinary agricultural
practices, but instead grown and maintained in a liquid medium.
[0191] In some embodiments, the plant can be an oil seed plant,
wherein the oil seeds, and/or the oil in the oil seeds contain
PUFAs produced by the PUFA synthase. In some embodiments, such oils
can contain a detectable amount of at least one target or primary
PUFA that is the product of the PUFA synthase. In some embodiments,
such oils can be substantially free of intermediate or side
products that are not the target or primary PUFA products and that
are not naturally produced by the endogenous FAS system in the
wild-type plants (e.g., wild-type plants produce some shorter or
medium chain PUFAs, such as 18 carbon PUFAs, via the FAS system,
but there will be new, or additional, fatty acids produced in the
plant as a result of genetic modification with a PUFA synthase
system).
[0192] With regard to the production of genetically modified
plants, methods for the genetic engineering of plants are well
known in the art. For instance, numerous methods for plant
transformation have been developed, including biological and
physical transformation protocols for dicotyledonous plants as well
as monocotyledonous plants (e.g., Goto-Fumiyuki et al., Nature
Biotech 17:282-286 (1999); Miki et al., Methods in Plant Molecular
Biology and Biotechnology, Glick, B. R. and Thompson, J. E. Eds.,
CRC Press, Inc., Boca Raton, pp. 67-88 (1993). In addition, vectors
and in vitro culture methods for plant cell or tissue
transformation and regeneration of plants are available, for
example, in Gruber et al., Methods in Plant Molecular Biology and
Biotechnology, Glick, B. R. and Thompson, J. E. Eds., CRC Press,
Inc., Boca Raton, pp. 89-119 (1993).
[0193] The present invention is drawn to an isolated nucleic acid
molecule comprising a nucleic acid sequence selected from SEQ NOs:
6-10 as well as an isolated nucleic acid molecule comprising a
modification or mutation of such a sequence as described herein.
The present invention is drawn to isolated polypeptides comprising
an amino acid sequence selected from SEQ ID NOs: 1-5 as well as an
isolated polypeptide comprising a modification or mutation or such
a sequence as described herein.
[0194] The present invention includes a recombinant expression
vector pDAB7361. The present invention includes a recombinant
expression vector pDAB7362. The present invention includes a
recombinant expression vector pDAB7363. The present invention
includes a recombinant expression vector pDAB736. The present
invention includes a recombinant expression vector pDAB7368. The
present invention includes a recombinant expression vector
pDAB7369. The present invention includes a recombinant expression
vector pDAB7370. The present invention includes a recombinant
expression vector pDAB100518. The present invention includes a
recombinant expression vector pDAB101476. The present invention
includes a recombinant expression vector pDAB9166. The present
invention includes a recombinant expression vector pDAB9167. The
present invention includes a recombinant expression vector
pDAB7379. The present invention includes a recombinant expression
vector pDAB7380. The present invention includes a recombinant
expression vector pDAB9323. The present invention includes a
recombinant expression vector pDAB9330. The present invention
includes a recombinant expression vector pDAB9337. The present
invention includes a recombinant expression vector pDAB9338. The
present invention includes a recombinant expression vector
pDAB9344. The present invention includes a recombinant expression
vector pDAB9396. The present invention includes a recombinant
expression vector pDAB101412. The present invention includes a
recombinant expression vector pDAB7733. The present invention
includes a recombinant expression vector pDAB7734. The present
invention includes a recombinant expression vector pDAB101493. The
present invention includes a recombinant expression vector
pDAB109507. The present invention includes a recombinant expression
vector pDAB109508. The present invention includes a recombinant
expression vector pDAB109509. The present invention includes a
recombinant expression vector pDAB9151. The present invention
includes a recombinant expression vector pDAB108207. The present
invention includes a recombinant expression vector pDAB108208. The
present invention includes a recombinant expression vector
pDAB108209. The present invention includes a recombinant expression
vector pDAB9159. The present invention includes a recombinant
expression vector pDAB9147. The present invention includes a
recombinant expression vector pDAB108224. The present invention
includes a recombinant expression vector pDAB108225.
[0195] As used herein, the term "transfection" is used to refer to
any method by which an exogenous nucleic acid molecule (e.g., a
recombinant nucleic acid molecule) can be inserted into a cell. The
term "transformation" can be used interchangeably with the term
"transfection" when such term is used to refer to the introduction
of nucleic acid molecules into microbial cells, such as algae,
bacteria and yeast, or into plant cells. In microbial and plant
systems, the term "transformation" is used to describe an inherited
change due to the acquisition of exogenous nucleic acids by the
microorganism or plant and is essentially synonymous with the term
"transfection." In some embodiments, transfection techniques
include, but are not limited to, transformation, particle
bombardment, diffusion, active transport, bath sonication,
electroporation, microinjection, lipofection, adsorption, infection
and protoplast fusion.
[0196] A widely utilized method for introducing an expression
vector into plants is based on the natural transformation system of
Agrobacterium. Horsch et al., Science 227:1229 (1985). A.
tumefaciens and A. rhizogenes are plant pathogenic soil bacteria
known to be useful to genetically transform plant cells. The Ti and
Ri plasmids of A. tumefaciens and A. rhizogenes, respectively,
carry genes responsible for genetic transformation of the plant.
Kado, C. I., Crit. Rev. Plant. Sci. 10:1 (1991). Descriptions of
Agrobacterium vector systems and methods for Agrobacterium-mediated
gene transfer are also available, for example, Gruber et al.,
supra, Miki et al., supra, Moloney et al., Plant Cell Reports 8:238
(1989), and U.S. Pat. Nos. 4,940,838 and 5,464,763.
[0197] Another known method of plant transformation is
microprojectile-mediated transformation wherein DNA is carried on
the surface of microprojectiles. In this method, the expression
vector is introduced into plant tissues with a biolistic device
that accelerates the microprojectiles to speeds sufficient to
penetrate plant cell walls and membranes. Sanford et al., Part.
Sci. Technol. 5:27 (1987), Sanford, J. C., Trends Biotech. 6:299
(1988), Sanford, J. C., Physiol. Plant 79:206 (1990), Klein et al.,
Biotechnology 10:268 (1992).
[0198] Yet another method for physical delivery of DNA to plants is
sonication of target cells. Zhang et al., Bio/Technology 9:996
(1991). Also, liposome or spheroplast fusion have been used to
introduce expression vectors into plants. Deshayes et al., EMBO J.,
4:2731 (1985), Christou et al., Proc Natl. Acad. Sci. USA 84:3962
(1987). Direct uptake of DNA into protoplasts using CaCl.sub.2
precipitation, polyvinyl alcohol or poly-L-ornithine have also been
reported. Hain et al., Mol. Gen. Genet. 199:161 (1985) and Draper
et al., Plant Cell Physiol. 23:451 (1982). Electroporation of
protoplasts and whole cells and tissues has also been described.
Donn et al., Abstracts of VIIth International Congress on Plant
Cell and Tissue Culture IAPTC, A2-38, p. 53 (1990); D'Halluin et
al., Plant Cell 4:1495-1505 (1992) and Spencer et al., Plant Mol.
Biol. 24:51-61 (1994). Additionally, silicone carbide whiskers
(Kaepler et al., 1990, Plant Cell Reports) and in plant
transformation using, for example, a flower dipping methodology
(Clough and Bent, Plant J. 16:735-743 (1998)) can also be used. The
exact plant transformation methodology can vary somewhat depending
on the plant species selected and the plant cell type selected for
transformation (e.g., seedling derived cell types such as
hypocotyls and cotyledons or embryonic tissue).
[0199] Following the introduction of the genetic construct into
plant cells, plant cells can be grown and upon emergence of
differentiating tissue such as shoots and roots, mature plants can
be generated. In some embodiments, a plurality of plants can be
generated. Methodologies for regenerating plants are known to those
of ordinary skill in the art and can be found, for example, in:
Plant Cell and Tissue Culture, 1994, Vasil and Thorpe Eds. Kluwer
Academic Publishers and in: Plant Cell Culture Protocols (Methods
in Molecular Biology 111, 1999 Hall Eds Humana Press).
[0200] In some embodiments, a genetically modified plant described
herein can be cultured in a fermentation medium or grown in a
suitable medium such as soil. In some embodiments, a suitable
growth medium for higher plants can include any growth medium for
plants, including, but not limited to, soil, sand, any other
particulate media that support root growth (e.g., vermiculite,
perlite, etc.) or hydroponic culture, as well as suitable light,
water and nutritional supplements which optimize the growth of the
higher plant.
[0201] It will be appreciated by one skilled in the art that use of
recombinant DNA technologies can improve control of expression of
transfected nucleic acid molecules by manipulating, for example,
the number of copies of the nucleic acid molecules within the host
cell, the efficiency with which those nucleic acid molecules are
transcribed, the efficiency with which the resultant transcripts
are translated, and the efficiency of post-translational
modifications. Additionally, the promoter sequence might be
genetically engineered to improve the level of expression as
compared to the native promoter. Recombinant techniques useful for
controlling the expression of nucleic acid molecules include, but
are not limited to, integration of the nucleic acid molecules into
one or more host cell chromosomes, addition of vector stability
sequences to plasmids, substitutions or modifications of
transcription control signals (e.g., promoters, operators,
enhancers), substitutions or modifications of translational control
signals (e.g., ribosome binding sites, Shine-Dalgarno sequences),
modification of nucleic acid molecules to correspond to the codon
usage of the host cell, and deletion of sequences that destabilize
transcripts.
[0202] In some embodiments, a plant can include those plants that
are known to produce compounds used as pharmaceutical agents,
flavoring agents, nutraceutical agents, functional food ingredients
or cosmetically active agents or plants that are genetically
engineered to produce these compounds/agents.
[0203] All of these embodiments of the invention apply to the
discussion of any of the genetically modified organisms and methods
of producing and using such organisms as described herein.
Products from Genetically Modified Organisms
[0204] In some embodiments, a genetically modified organism of the
invention produces one or more polyunsaturated fatty acids
including, but not limited to, EPA (C20:5, n-3), DHA (C22:6, n-3),
DPA (C22:5, n-6 or n-3), ARA (C20:4, n-6), GLA (C18:3, n-6), ALA
(C18:3, n-3), and/or SDA (C18:4, n-3)), and in some embodiments,
one or more longer-chain PUFAs, including, but not limited to, EPA
(C20:5, n-3), DHA (C22:6, n-3), DPA (C22:5, n-6 or n-3), or DTA
(C22:4, n-6), or any combination thereof. In some embodiments, a
genetically modified plant of the invention produces one or more
polyunsaturated fatty acids including, but not limited to, EPA
(C20:5, n-3), DHA (C22:6, n-3), and/or DPA (C22:5, n-6 or n-3), or
any combination thereof.
[0205] In some embodiments, a genetically modified organism is a
plant that has been genetically modified to recombinantly express a
PUFA synthase system and a PPTase, as described herein. In some
embodiments, such a plant has been genetically modified further to
express an accessory protein as described herein for the
improvement of the production and/or accumulation of PUFAs (or
other bioactive products of the PUFA synthase) by the host (e.g.,
ACoAS, GPAT, LPAAT, DAGAT or ACCase).
[0206] Some embodiments of the present invention include the
production of polyunsaturated fatty acids of desired chain length
and with desired numbers of double bonds and, by extension, oil
seed and oils obtained from the genetically modified plants
described herein (e.g., obtained from the oil or seeds of such
plants) comprising these PUFAs. Examples of PUFAs that can be
produced by the present invention include, but are not limited to,
DHA (docosahexaenoic acid (C22:6, n-3)), ARA (eicosatetraenoic acid
or arachidonic acid (C20:4, n-6)), DPA (docosapentaenoic acid
(C22:5, n-6 or n-3)), and EPA (eicosapentaenoic acid (C20:5, n-3)),
and any combinations thereof. The present invention allows for the
production of commercially valuable lipids enriched in one or more
desired (target or primary) PUFAs by the present inventors'
development of genetically modified plants through the use of a
PUFA synthase system that produces PUFAs.
[0207] In some embodiments, a given PUFA synthase system derived
from a particular organism will produce particular PUFA(s), such
that selection of a PUFA synthase system from a particular organism
will result in the production of specified target or primary PUFAs.
In some embodiments, the ratio of the PUFAs can differ depending on
the selection of the particular PUFA synthase system and on how
that system responds to the specific conditions in which it is
expressed. For example, use of a PUFA synthase from
Thraustochytrium 23B (ATCC No. 20892) can also result in the
production of DHA and DPAn-6 as the target or primary PUFAs;
however, in the case of Thraustochytrium 23B, the ratio of DHA to
DPAn-6 is about 10:1 (and can range from about 8:1 to about 40:1),
whereas in Schizochytrium, the ratio is typically about 2.5:1. In
some embodiments, a given PUFA synthase can be modified by
intermixing proteins and domains from different PUFA synthases, or
one can modify a domain or protein of a given PUFA synthase to
change the target PUFA product and/or ratios.
[0208] In some embodiments, reference to "intermediate products" or
"side products" of an enzyme system that produces PUFAs refers to
any products, and particularly, fatty acid products, that are
produced by the enzyme system as a result of the production of the
target or primary PUFA(s) of the system, but which are not the
primary or target PUFA(s). In some embodiments, intermediate and
side products can include non-target fatty acids that are naturally
produced by the wild-type plant, or by the parent plant used as a
recipient for the indicated genetic modification, but are now
classified as intermediate or side products because they are
produced in greater levels as a result of the genetic modification,
as compared to the levels produced by the wild-type plant, or by
the parent plant used as a recipient for the indicated genetic
modification. In some embodiments, a primary or target PUFA of one
enzyme system can be an intermediate of a different enzyme system
where the primary or target product is a different PUFA. For
example, when using the standard pathway to produce EPA, fatty
acids such as GLA, DGLA and SDA are produced as intermediate
products significant quantities (e.g., U.S. Appl. Pub. No.
2004/0172682). Similarly, and also illustrated by U.S. Appl. Pub.
No. 2004/0172682, when using the standard pathway to produce DHA,
in addition to the fatty acids mentioned above, ETA and EPA
(notably the target PUFA in the first example above) can be
produced in significant quantities and can be present in
significantly greater quantities relative to the total fatty acid
product than the target PUFA itself.
[0209] In some embodiments, to produce significantly high yields of
one or more desired polyunsaturated fatty acids, a plant can be
genetically modified to introduce a PUFA synthase system into the
plant. Plants are not known to endogenously contain a PUFA
synthase, and therefore, the present invention represents an
opportunity to produce plants with unique fatty acid production
capabilities. The present invention provides genetically engineered
plants to produce one or more PUFAs in the same plant, including,
but not limited to, EPA, DHA, DPA (n3 or n6), ARA, GLA, SDA and
others, including any combination thereof. The present invention
offers the ability to create any one of a number of "designer oils"
in various ratios and forms. In some embodiments, the use of a PUFA
synthase system from the particular marine organisms described
herein can extend the range of PUFA production and successfully
produce such PUFAs within temperature ranges used to grow most crop
plants.
[0210] In some embodiments, to be "substantially free" of
intermediate or side products of the system for synthesizing PUFAs,
or to not have intermediate or side products present in substantial
amounts, means that any intermediate or side product fatty acids
(non-target PUFAs) that are produced in the genetically modified
plant (and/or parts of plants and/or seed oil fraction) as a result
of the introduction or presence of the enzyme system for producing
PUFAs (e.g., that are not produced by the wild-type plant or the
parent plant used as a recipient for the indicated genetic
modification), can be present in a quantity that is less than about
10% by weight of the total fatty acids produced by the plant, and
more preferably less than about 9%, and more preferably less than
about 8%, and more preferably less than about 7%, and more
preferably less than about 6%, and more preferably less than about
5%, and more preferably less than about 4%, and more preferably
less than about 3%, and more preferably less than about 2%, and
more preferably less than about 1% by weight of the total fatty
acids produced by the plant, and more preferably less than about
0.5% by weight of the total fatty acids produced by the plant.
[0211] In some embodiments, a genetically modified plant of the
invention or an oil or seed obtained from a genetically modified
plant of the invention comprises detectable amounts of DHA
(docosahexaenoic acid (C22:6, n-3)) or EPA (eicosapentaenoic acid
(C20:5, n-3)). In some embodiments, a genetically modified plant of
the invention or an oil or seed obtained from a genetically
modified plant of the invention comprises 0.01%, 0.02%, 0.03%,
0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%,
0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%,
4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%,
11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5% or 15% DHA. Useful
ranges can be selected between any of these values, for example,
0.01-15%, 0.05-10% and 1-5% DHA.
[0212] In some embodiments, a genetically modified plant or the
invention or an oil or seed obtained from a genetically modified
plant of the invention comprises 0.01%, 0.02%, 0.03%, 0.04%, 0.05%,
0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%,
0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%,
6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% EPA. Useful ranges
can be selected between any of these values, for example, 0.01-10%,
0.05-5% and 0.1-5% EPA.
[0213] In some embodiments, when the target product of a PUFA
synthase system is a long chain PUFA, such as DHA, DPA (n-6 or
n-3), or EPA, intermediate products and side products that are not
present in substantial amounts in the total lipids of plants
genetically modified with such a PUFA synthase system can include,
but are not limited to: gamma-linolenic acid (GLA; 18:3, n-6);
stearidonic acid (STA or SDA; 18:4, n-3); dihomo-gamma-linolenic
acid (DGLA or HGLA; 20:3, n-6), arachidonic acid (ARA, C20:4, n-6);
eicosatrienoic acid (ETA; 20:3, n-9) and various other intermediate
or side products, such as 20:0; 20:1 (.DELTA.5); 20:1 (.DELTA.11);
20:2 (.DELTA.8,11); 20:2 (.DELTA.11,14); 20:3 (.DELTA.5,11,14);
20:3 (.DELTA.11,14,17); mead acid (20:3; .DELTA.5,8,11); or 20:4
(.DELTA.5,1,14,17).
[0214] The genetic modification of a plant according to the present
invention can result in the production of one or more PUFAs by the
plant. In some embodiments, the PUFA profile and the ratio of the
PUFAs produced by the plant are not necessarily the same as the
PUFA profile or ratio of PUFAs produced by the organism from which
the PUFA synthase was derived.
[0215] In some embodiments, a genetically modified plant of the
present invention can be engineered to produce PUFAs through the
activity of the PUFA synthase. In some embodiments, the PUFAs can
be recovered through purification processes which extract the
compounds from the plant. In some embodiments, the PUFAs can be
recovered by harvesting the plant. In some embodiments, the PUFAs
can be recovered by harvesting the oil from the plant (e.g., from
the oil seeds) or seeds from the plant. In some embodiments, the
plant can also be consumed in its natural state or further
processed into consumable products.
[0216] In some embodiments, a genetically modified plant of the
invention can produce one or more polyunsaturated fatty acids. In
some embodiments, the plant can produce (e.g., in its mature seeds,
if an oil seed plant, or in the oil of the seeds of an oil seed
plant) at least one PUFA (the target PUFA), and wherein the total
fatty acid profile in the plant, or the part of the plant that
accumulates PUFAs (e.g., mature seeds, if the plant is an oil seed
plant or the oil of the seeds of an oil seed plant), comprises a
detectable amount of this PUFA or PUFAs. In some embodiments, the
target PUFA is at least a 20 carbon PUFA and comprises at least 3
double bonds, and more preferably at least 4 double bonds, and even
more preferably, at least 5 double bonds. In some embodiments, the
target PUFA can be a PUFA that is not naturally produced by the
plant. In some embodiments, the total fatty acid profile in the
plant or in the part of the plant that accumulates PUFAs (including
the seed oil of the plant) comprises at least 0.1% of the target
PUFA(s) by weight of the total fatty acids, at least 0.2%, at least
0.3%, at least 0.4%, at least 0.5%, at least 1%, at least 1.5%, at
least 2%, at least 2.5%, at least 3%, at least 3.5%, at least 4%,
at least 4.5%, at least 5%, at least 5.5%, at least 10%, at least
15%, at least 20%, at least 25%, at least 30%, at least 35%, at
least 40%, at least 45%, at least 50%, at least 55%, at least 60%,
at least 65%, at least 70%, at least 75%, more than 75% of at least
one polyunsaturated fatty acid (the target PUFA or PUFAs) by weight
of the total fatty acids produced by the plant, or any percentage
from 0.1% to 75%, or greater than 75% (up to 100% or 100%), in 0.1%
increments, of the target PUFA(s).
[0217] As generally used herein, reference to a percentage amount
of PUFA production is by weight of the total fatty acids produced
by the organism (plant), unless otherwise stated. In some
embodiments, total fatty acids produced by a plant are presented as
a weight percent as determined by gas chromatography (GC) analysis
of a fatty acid methyl ester (FAME) preparation, although
determination of total fatty acids is not limited to this
method.
[0218] In some embodiments, the total fatty acids in a plant of the
invention (and/or parts of plants or seed oil fraction) can contain
less than 10% by weight of the total fatty acids produced by the
plant, less than 9%, and less than 8%, less than 7%, less than 6%,
less than 5%, less than 4%, less than 3%, less than 2%, less than
1% of a fatty acid selected from any one or more of:
gamma-linolenic acid (GLA; 18:3, n-6); stearidonic acid (STA or
SDA; 18:4, n-3); dihomo-gamma-linolenic acid (DGLA or HGLA; 20:3,
n-6), arachidonic acid (ARA, C20:4, n-6); eicosatrienoic acid (ETA;
20:3, n-9) and various other fatty acids, such as 20:0; 20:1
(.DELTA.5); 20:1 (.DELTA.11); 20:2 (.DELTA.8,11); 20:2
(.DELTA.11,14); 20:3 (.DELTA.5,11,14); 20:3 (.DELTA.11,14,17); mead
acid. (20:3; .DELTA.5,8,11); or 20:4 (.DELTA.5,1,14,17).
[0219] The present invention includes any seed produced by the
plants described herein, as well as any oil produced by a plant or
seed of the present invention. The present invention also includes
any products produced using the plants, seed or oils as described
herein.
Uses and Products Related to the Genetically Modified Organisms of
the Invention
[0220] The present invention includes a method to produce PUFAs by
growing or culturing a genetically modified organism (e.g., a
plant) of the present invention described in detail above. In some
embodiments, such a method includes, for example, the step of
growing in a suitable environment, such as soil, a plant that has a
genetic modification as described previously herein and in
accordance with the present invention.
[0221] The present invention includes a method to produce an oil
comprising at least one PUFA, comprising recovering oil from a
genetically modified plant of the invention or from a seed of a
genetically modified plant of the invention. The present invention
includes a method to produce an oil comprising at least one PUFA,
comprising growing a genetically modified plant of the invention.
The present invention includes a method to produce at least one
PUFA in a seed oil comprising recovering an oil from a seed of a
genetically modified plant of the invention. The present invention
includes a method to produce at least one PUFA in a seed oil
comprising growing a genetically modified plant of the
invention.
[0222] The present invention includes a method to provide a
supplement or therapeutic product containing at least one PUFA to
an individual, comprising providing to the individual a genetically
modified plant of the invention, an oil of the invention, a seed of
the invention, a food product of the invention, a functional food
of the invention, or a pharmaceutical product of the invention. The
present invention also includes a method to produce a genetically
modified plant of the invention comprising transforming a plant or
plant cell with (i) a nucleic acid sequence encoding an algal PUFA
synthase system that produces at least one polyunsaturated fatty
acid (PUFA); and (ii) a nucleic acid sequence encoding a
phosphopantetheinyl transferase (PPTase) that transfers a
phosphopantetheinyl cofactor to an algal PUFA synthase system ACP
domain. In some embodiments, the method further comprises
transforming the plant or plant cell with (iii) a nucleic acid
sequence encoding an acyl-CoA synthetase (ACoAS) that catalyzes the
conversion of long chain PUFA free fatty acids (FFA) to
acyl-CoA.
[0223] In some embodiments, the PUFA of such methods is DHA or
EPA.
[0224] The present invention further includes any organisms or
parts thereof described herein (e.g., plants, parts of the plants
(e.g., oil seeds), or preparations or fractions thereof), as well
as any oils produced by the organisms described herein. The
invention also includes any products produced using the organisms,
parts thereof, or oils described herein.
[0225] The present invention relates to a method to modify a
product containing at least one fatty acid, comprising adding to
the product an organism, part thereof, or oil produced by a
genetically modified organism according to the invention and as
described herein (e.g., a plant that has been genetically modified
as described herein). Any products produced by this method or
generally containing any organisms, parts thereof, or oils from the
organisms described herein are also encompassed by the
invention.
[0226] In some embodiments, the product is selected from the group
consisting of a food, a dietary supplement, a pharmaceutical
formulation, a humanized animal milk, an infant formula, a
nutraceutical and a functional food. Suitable pharmaceutical
formulations include, but are not limited to, an anti-inflammatory
formulation, a chemotherapeutic agent, an active excipient, an
osteoporosis drug, an anti-depressant, an anti-convulsant, an
anti-Helicobacter pylori drug, a drag for treatment of
neurodegenerative disease, a drug for treatment of degenerative
liver disease, an antibiotic, and a cholesterol lowering
formulation. In some embodiments, the product is used to treat a
condition selected from the group consisting of chronic
inflammation, acute inflammation, gastrointestinal disorder,
cancer, cachexia, cardiac restenosis, neurodegenerative disorder,
degenerative disorder of the liver, blood lipid disorder,
osteoporosis, osteoarthritis, autoimmune disease, preeclampsia,
preterm birth, age related maculopathy, pulmonary disorder, and
peroxisomal disorder.
[0227] In some embodiments, the product is a food product or
functional food product. Suitable food products include, but are
not limited to, fine bakery wares, bread and rolls, breakfast
cereals, processed and unprocessed cheese, condiments (ketchup,
mayonnaise, etc.), dairy products (milk, yogurt), puddings and
gelatin desserts, carbonated drinks, teas, powdered beverage mixes,
processed fish products, fruit-based drinks, chewing gum, hard
confectionery, frozen dairy products, processed meat products, nut
and nut-based spreads, pasta, processed poultry products, gravies
and sauces, potato chips and other chips or crisps, chocolate and
other confectionery, soups and soup mixes, soya based products
(e.g., milks, drinks, creams, whiteners), vegetable oil-based
spreads, and vegetable-based drinks.
[0228] In some embodiments of the invention, the product is a feed
or meal composition, or an additive for a feed or meal composition,
for an animal. The term animal includes all animals, including
human beings. Non-limiting examples of animals are non-ruminants
(e.g., pigs, poultry, or fish), and ruminants (e.g., cows, sheep
and horses. The term feed or feed composition means any compound,
preparation, mixture, or composition suitable for, or intended for
intake by an animal.
[0229] In some embodiments, the genetically modified plant, seed or
oil (e.g., canola) comprises reduced levels of polyunsaturated
fatty acids and increased levels of monounsaturated oleic acid
relative to conventional oils. Such a plant, seed or oil can
exhibit, for example, higher oxidative stability. In some
embodiments, the genetically modified plant, seed or oil comprises
a high oleic acid oil background (e.g., 70%, 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98% or 99% oleic acid). Such a plant, seed or oil
can be, for example, less susceptible to oxidation during storage,
frying and/or refining, and/or can be heated to a higher
temperature without smoking, making it more suitable as a cooking
oil. In some embodiments, the genetically modified plant, seed or
oil comprises an amount of DHA as described herein and a high oleic
oil background (e.g., an amount greater than or equal to 70%,
including 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99%
oleic acid and any ranges thereof). In some embodiments, the
genetically modified plant, seed or oil comprises an amount of DHA
as described herein and a low linolenic acid background (e.g., an
amount less than or equal to 10%, including 9.5%, 9%, 8.5%, 8%,
7.5%, 7%, 6.5%, 6%, 5.5%, 5%, 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%,
1%, 0.05%, 0.02%, or 0.01% linolenic acid and any ranges thereof).
In some embodiments, the genetically modified plant, seed or oil
comprises an amount of DHA as described herein, a high oleic oil
background (e.g., present in an amount greater than or equal to
70%, including 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99%
oleic acid and any ranges thereof), and a low linolenic acid
background (e.g., an amount less than or equal to 10%, including
9.5%, 9%, 8.5%, 8%, 7.5%, 7%, 6.5%, 6%, 5.5%, 5%, 4.5%, 4%, 3.5%,
3%, 2.5%, 2%, 1.5%, 1%, 0.05%, 0.02%, or 0.01% linolenic acid and
any ranges thereof). In some embodiments, such a genetically
modified plant, seed or oil (e.g., canola) can be incorporated into
a product described herein.
[0230] Additional objects, advantages, and novel features of this
invention will become apparent to those skilled in the art upon
examination of the following examples thereof, which are not
intended to be limiting.
EXAMPLES
Example 1
Codon Optimization of PUFA Synthase OrfA, PUFA Synthase OrfB, PUFA
Synthase OrfC, Acyl-CoA Synthetase and 4' Phosphopantetheinyl
Transferase HetI
[0231] Analysis of the DNA sequences encoding PUFA OrfA from
Schizochytrium sp. ATCC_20888 (GenBank ID: AF378327, GI:158518688),
PUFA OrfB from Schizochytrium sp. ATCC_20888 (GenBank ID: AF378328,
GI:158518690), chimeric PUFA OrfC from Schizochytrium sp. ATCC
20888 and Thraustochytrium (U.S. Appl. Pub. No. 2008/0022422)
("chimeric OrfC" or "hybrid OrfC"), acyl-CoA synthetase from
Schizochytrium sp. ATCC 20888 (U.S. Appl. Pub. No. 2007/0245431),
and 4' phosphopantetheinyl transferase HetI from Nostoc sp. PCC
7120 (GenBank ID: P37695, GI:20141367) coding regions revealed the
presence of several sequence motifs containing non-optimal codon
compositions that can be detrimental to optimal plant expression.
The design of the gene(s) encoding PUFA synthase OrfA, PUFA
synthase OrfB, PUFA synthase chimeric OrfC, acyl-CoA synthetase and
4' phosphopantetheinyl transferase HetI proteins was optimized to
generate a DNA sequence that is more "plant-like" in nature, and in
which the sequence modifications do not hinder translation or
create mRNA instability through non-optimal codon composition.
[0232] Due to the plasticity afforded by the redundancy/degeneracy
of the genetic code (e.g., some amino acids are specified by more
than one codon), evolution of the genomes in different organisms or
classes of organisms has resulted in differential usage of
synonymous codons. This "codon bias" is reflected in the mean base
composition of protein coding regions. For example, organisms
having genomes with relatively low G+C contents utilize more codons
having A or T in the third position of synonymous codons, whereas
those having higher G+C contents utilize more codons having G or C
in the third position. Further, it is thought that the presence of
"minor" codons within an mRNA can reduce the absolute translation
rate of that mRNA, especially when the relative abundance of the
charged tRNA corresponding to the minor codon is low. An extension
of this reasoning is that the diminution of translation rate by
individual minor codons would be at least additive for multiple
minor codons. Therefore, mRNAs having high relative contents of
minor codons would have correspondingly low translation rates. This
rate would be reflected by correspondingly low levels of the
encoded protein.
[0233] In engineering genes encoding a PUFA synthase OrfA, PUFA
synthase OrfB, PUFA synthase chimeric OrfC, acyl-CoA synthetase and
4' phosphopantetheinyl transferase HetI protein for expression in
canola (or other plants, such as rice, tobacco, maize, cotton or
soybean), the codon usages for canola were accessed by publicly
available databases (Table 2).
TABLE-US-00002 TABLE 2 Synonymous codon representation in coding
regions of Brassica napus (canola) genes (Columns C and G). Values
for a balanced-biased codon representation set for a
plant-optimized synthetic gene design are in Columns D and H. A C D
E G H Amino B Canola Weighted Amino F Canola Weighted Acid Codon %
Average Acid Codon % Average ALA (A) GCA 23.3 23.3 LEU (L) CTA 10.1
DNU GCC 21.2 21.2 CTC 22.8 28.5 GCG 14.2 14.2 CTG 11.6 14.6 GCT
41.3 41.3 CTT 25.2 31.6 TTA 10.1 DNU TTG 20.2 25.3 ARG (R) AGA 31.8
43.8 LYS (K) AAA 44.6 44.6 AGG 22.1 30.5 AAG 55.4 55.4 CGA 9.9 DNU
CGC 8.9 DNU CGG 8.6 DNU CGT 18.6 25.7 ASN (N) AAC 62.6 62.6 MET (M)
ATG 100.0 100.0 AAT 37.4 37.4 ASP (D) GAC 42.5 42.5 PHE (F) TTC
58.6 58.6 GAT 57.5 57.5 TTT 41.4 41.4 CYS (C) TGC 49.2 49.2 PRO (P)
CCA 29.6 29.6 TGT 50.8 50.8 CCC 14.6 14.6 CCG 18.4 18.4 CCT 37.3
37.3 END TAA 38.5 DNU SER (S) AGC 16.0 17.9 TAG 22.1 DNU AGT 14.1
15.8 TGA 39.4 100.0 TCA 18.2 20.4 TCC 16.7 18.7 TCG 10.7 DNU TCT
24.3 27.2 GLN (Q) CAA 50.0 50.0 THR (T) ACA 26.3 26.3 CAG 50.0 50.0
ACC 26.9 26.9 ACG 16.9 16.9 ACT 30.0 30.0 GLU (E) GAA 43.6 43.6 TRP
(W) TGG 100.0 100.0 GAG 56.4 56.4 GLY (G) GGA 36.4 36.4 TYR (Y) TAC
59.4 59.4 GGC 16.2 16.2 TAT 40.6 40.6 GGG 15.2 15.2 GGT 32.1 32.1
HIS (H) CAC 49.6 49.6 VAL (V) GTA 10.8 DNU CAT 50.4 50.4 GTC 24.1
27.0 GTG 28.3 31.7 GTT 36.8 41.3 ILE (I) ATA 21.1 21.1 ATC 42.7
42.7 ATT 36.2 36.2
[0234] To balance the distribution of the remaining codon choices
for an amino acid, a Weighted Average representation for each codon
was calculated (Table 2), using the formula:
[0235] Weighted. Average % of C1=1/(% C1+% C2+% C3+ etc.).times. %
C1.times.100, where C1 is the codon in question and % C2, % C3,
etc. represent the averages of the % values for canola of remaining
synonymous codons (average % values for the relevant codons are
taken from Columns C and G) of Table 2.
[0236] The Weighted Average % value for each codon is given in
Columns D and H of Table 2.
[0237] In designing coding regions for plant expression, the
primary ("first choice") codons preferred by the plant was
determined, as well as the second, third, fourth etc. choices of
preferred codons when multiple choices exist. A new DNA sequence
was then designed which encoded essentially the same amino acid
sequence of an PUFA synthase OrfA, PUFA synthase OrfB, PUFA
synthase OrfC, acyl-CoA synthetase and 4' phosphopantetheinyl
transferase HetI, but which differed from the original DNA sequence
(encoding the PUFA synthase OrfA, PUFA synthase OrfB, PUFA synthase
chimeric OrfC, acyl-CoA synthetase and 4' phosphopantetheinyl
transferase HetI) by the substitution of plant (first preferred,
second preferred, third preferred, or fourth preferred, etc.)
codons to specify the amino acid at each position within the amino
acid sequence.
[0238] The new sequences were then analyzed for restriction enzyme
sites created by the modifications in the sequence. The identified
sites were then modified by replacing the codons with first,
second, third, or fourth choice preferred codons. The sequence was
then further analyzed and modified to reduce the frequency of TA or
GC doublets.
[0239] Analysis of these sequences revealed that the new DNA
sequences encoded essentially the amino acid sequence of the PUFA
synthase OrfA, PUFA synthase OrfB, PUFA synthase chimeric OrfC,
acyl-CoA synthetase and 4' phosphopantetheinyl transferase HetI
proteins but were respectively designed for optimal expression in
canola using a balanced codon distribution of frequently used
codons found in canola genes. In particular, the new DNA sequences
differed from the original DNA sequences encoding an PUFA synthase
OrfA, PUFA synthase OrfB, PUFA synthase chimeric OrfC, acyl-CoA
synthetase and 4' phosphopantetheinyl transferase HetI by the
substitution of plant (first preferred, second preferred, third
preferred, or fourth preferred) codons to specify the appropriate
amino acid at each position within the protein amino acid
sequence.
[0240] Design of the plant-optimized DNA sequences were initiated
by reverse-translation of the protein sequences of SEQ ID NO:1, SEQ
ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 using a canola
codon bias table constructed from Table 2, Columns D and H. The
protein sequence for acyl-CoA synthetase (SEQ ID NO:4) was altered
from the original sequence; wherein the second amino acid Alanine
was removed from the protein. The initial sequences were then
modified by compensating codon changes (while retaining overall
weighted average codon representation) to remove or add restriction
enzyme recognition sites, remove highly stable intrastrand
secondary structures, and remove other sequences that might be
detrimental to cloning manipulations or expression of the
engineered gene in plants. The DNA sequences were then re-analyzed
for restriction enzyme recognition sites that might have been
created by the modifications. The identified sites were further
modified by replacing the relevant codons with first, second,
third, or fourth choice preferred codons. Other sites in the
sequences that could affect transcription or translation of the
gene of interest include the exon:intron junctions (5' or 3'), poly
A addition signals, or RNA polymerase termination signals. The
modified sequences were further analyzed and further modified to
reduce the frequency of TA or CG doublets, and to increase the
frequency of TG or CT doublets. In addition to these doublets,
sequence blocks that have more than about six consecutive residues
of [G+C] or [A+T] can affect transcription or translation of the
sequence. Therefore, these sequence blocks were also modified by
replacing the codons of first or second choice, etc. with other
preferred codons of choice. Rarely used codons are not included to
a substantial extent in the gene design, being used only when
necessary to accommodate a different design criterion than codon
composition per se (e.g., addition or deletion of restriction
enzyme recognition sites).
[0241] The protein encoded by PUFA synthase OrfA comprises 10
repeated "Proline-Alanine" domains ranging in size from 17 to 29
amino acids. Interspersed between the Proline-Alanine repeats were
9 longer repeated sequence domains comprising 87 amino acids. The
amino acid sequences of these repeats vary at only 4 positions, and
there were only two amino acid choices at each of the variant
positions. Analyses of the amino acid sequences of the 9 repeats
using the Clustal W computer program generated a homology value of
100%, and an identity value of 95.4%. At the DNA level, the
sequences encoding the 9 repeats are 100% homologous, 89.7%
identical, varying at only 27 positions in the 261 bases encoding
each repeat (23 of the 27 changes are "silent" differences, in
which synonymous codons for the same amino acid are
interchanged).
[0242] Standard gene design processes cannot easily accommodate
developing new codon biased DNA sequences for multiple repeats of
this size, since one must continually balance all the codon choices
in an individual repeat with the codon choices made at the same
position in the other 8 repeats, to avoid generating highly related
DNA sequences. For each of the 87 residue repeats, there were more
than 4.5.times.10.sup.43 possible DNA sequences to encode the same
amino acid sequence (calculated as the product of the number of
synonymous codons for each amino acid in the sequence). Thus, there
was a very large computing space available to generate
identically-encoding DNA sequences. The following protocol
describes a method used to generate (in silico) multiple sequence
designs for each individual repeat, followed by comparison of all
the sequence versions in bulk to identify a set that represents
highly diverged sequences encoding the repeats:
[0243] Step 1: Extract the native DNA sequence encoding each
repeated amino acid domain as a separate sequence.
[0244] Step 2: Import the individual repeated DNA sequences as
separate sequences into a gene design program (e.g., OPTGENE.TM.,
Ocimum Biosolutions, Hyderabad, India). Steps 3-5 are performed on
each sequence separately.
[0245] Step 3: Translate the DNA sequence using the standard
genetic code.
[0246] Step 4: Reverse translate the translated protein sequence
using the standard genetic code and the appropriate codon bias
table. In this example, a biased codon table compiled from 530
Brassica napus protein coding regions was used, and each generated
sequence was code-named "nap" (for "napus") plus the version
number. Thus, the first reverse-translated, codon biased sequence
for Repeat 1 was named "rpt1 nap1." In this illustration, this
process was performed 10 times, to generate 10 DNA sequence
versions encoding the protein sequence of Repeat 1.
[0247] Step 5: Export the 10 sequence versions into the
corresponding number of text files.
[0248] Step 6: Repeat Steps 3-5 for each of the other repeated
sequence domains. In this illustration, a total of 90 "nap"
sequence versions were generated (10 for each repeated
element).
[0249] Step 7 Import the 90 sequence files into the Clustal W
program Mega 3.1 (accessed at Megasoftware) and perform a multiple
sequence alignment using all 90 sequences as input. Because these
sequences are segments of protein coding regions, the alignments
are performed with no gaps allowed. After Clustal W Alignment, a
Neighbor-Joining tree is assembled and visualized, and one of the
ten codon-optimized sequences for each of the nine repeated domains
in the protein is picked visually. Each selected sequence version
is chosen from a section of the tree that is the most deeply
branched.
[0250] Step 8: The chosen sequence for each repeated domain is
incorporated into the codon-optimized DNA sequence encoding the
entire protein, in the proper position for each particular
repeat.
[0251] Step 9: Final analyses of the entire codon optimized
sequence, including the separately designed diverged repeat
elements, are performed to assure the absence of undesired motifs,
restriction enzyme recognition sites, etc.
[0252] The newly designed, canola optimized PUFA synthase OrfA,
PUFA synthase OrfB, PUFA synthase OrfC, acyl-CoA synthetase and 4'
phosphopantetheinyl transferase HetI DNA sequences are listed,
respectively, in SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9
and SEQ ID NO:10. These codon optimized sequences are identified as
version 3 (v3) throughout the specification. The sequences labeled
as version 2 (v2) describe the original noncodon optimized
sequences.
[0253] The resulting DNA sequences have a higher degree of codon
diversity, a desirable base composition, contain strategically
placed restriction enzyme recognition sites, and lacks sequences
that might interfere with transcription of the gene, or translation
of the product mRNA. Table 3, Table 4, Table 5, Table 6 and Table 7
present the comparisons of the codon compositions of the coding
regions for the PUFA synthase OrfA, PUFA synthase OrfB, PUFA
synthase chimeric OrfC, acyl-CoA synthetase and 4'
phosphopantetheinyl transferase HetI proteins found in the original
gene, the plant-optimized versions and the codon composition
recommendations for a plant optimized sequence as calculated from
Table 2, Columns D and H.
TABLE-US-00003 TABLE 3 PUFA OrfA codon compositions Amino Original
Original Plnt Opt Plnt Opt Plnt Opt Amino Original Original Plnt
Opt Plnt Opt Plnt Opt Acid Codon Gene # Gene % Gene # Gene % Reem'd
Acid Codon Gene # Gene % Gene # Gene % Reem'd ALA (A) GCA 7 1.5 109
23.3 23.3 LEU (L) CTA 0 0.0 0 0.0 0.0 GCC 302 64.5 99 21.2 21.2 CTC
173 77.9 63 28.4 28.5 GCG 49 10.5 67 14.3 14.2 CTG 15 6.8 32 14.4
14.6 GCT 110 23.5 193 41.2 41.3 CTT 33 14.9 71 32.0 31.6 TTA 0 0.0
0 0.0 0.0 TTG 1 0.5 56 25.2 25.3 ARG (R) AGA 0 0.0 57 43.5 43.8 LYS
(K) AA 2 1.2 73 44.5 44.6 AGG 0 0.0 40 30.5 30.5 AAG 162 98.8 91
55.5 55.4 CGA 0 0.0 0 0.0 0.0 CGC 112 85.5 0 0.0 0.0 CGG 1 0.8 0
0.0 0.0 CGT 18 13.7 4 26.0 25.7 ASN (N) AAC 73 97.3 47 62.7 62.6
MET (M) ATG 88 100 88 100 100. AAT 2 2.7 28 37.3 37.4 ASP (D) GAC
126 76.8 70 42.7 42.5 PHE (F) TTC 50 69.4 42 58.3 58.6 GAT 38 23.2
94 57.3 57.5 TTT 22 30.6 30 41.7 41.4 CYS (C) TGC 34 94.4 18 50.0
49.2 PRO (P) CCCA 2 1.3 45 30.0 29.6 TGT 2 5.6 18 50.0 50.8 CCC 56
37.3 22 14.7 14.6 CCG 46 30.7 27 18.0 18.4 CCT 46 30.7 56 37.3 37.3
END TAA 1 100.0 0 0.0 0.0 SER (S) AGC 40 21.3 34 18.1 17.9 TAG 0
0.0 0 0.0 0.0 AGT 1 0.5 30 16.0 15.8 TGA 0 0.0 1 100.0 100.0 TCA 0
0.0 38 20.2 20.4 TCC 70 37.2 35 18.6 18.7 TCG 59 31.4 0 0.0 0.0 TCT
18 9.6 51 27.1 27.2 GLN (Q) CAA 4 4.4 46 50.5 50.0 THR (T) ACA 2
1.2 41 26.3 26.3 CAG 87 95.6 45 49.5 50.0 ACC 81 51.9 42 26.9 26.9
ACG 26 16.7 26 16.7 16.9 ACT 47 30.1 47 30.1 30.0 GLU (E) GAA 9 3.8
103 43.6 43.6 TRP (W) TGG 13 100 13 100 100.0 16 GAG 227 96.2 133
56.4 56.4 GLY (G) GGA 6 3.1 71 36.2 36.4 TYR (Y) TAC 42 97.7 26
60.5 59.4 GGC 156 79.6 32 16.3 16.2 TAT 1 2.3 17 39.5 40.6 GGG 0
0.0 30 15.3 15.2 GGT 34 17.3 63 32.1 32.1 HIS (H) CAC 25 83.3 15
50.0 49.6 VAL (V) GTA 0 0.0 0 0.0 0.0 CAT 5 16.7 15 50.0 50.4 GTC
176 70.7 67 26.9 27.0 GTG 39 15.7 79 31.7 31.7 GTT 34 13.7 103 41.4
41.3 ILE (I) ATA 0 0.0 29 21.0 21.1 Totals 1345 1345 ATC 99 71.7 59
42.8 42.7 ATT 39 28.3 50 36.2 36.2 Totals 1566 1566
TABLE-US-00004 TABLE 4 PUFA OrfB codon compositions Amino Original
Original Plnt Opt Plnt Opt Plnt Opt Amino Original Original Plnt
Opt Plnt Opt Plnt Opt Acid Codon Gene # Gene % Gene # Gene % Reem'd
Acid Codon Gene # Gene % Gene # Gene % Reem'd ALA (A) GCA 13 5.7 53
23.2 23.3 LEU (L) CTA 0 0.0 0 0.0 0.0 GCC 135 59.2 48 21.1 21.2 CTC
116 63.0 51 27.7 28.5 GCG 43 18.9 34 14.9 14.2 CTG 21 11.4 27 14.7
14.6 GCT 37 16.2 93 40.8 41.3 CTT 44 23.9 59 32.1 31.6 TTA 0 0.0 0
0.0 0.0 TTG 3 1.6 47 25.5 25.3 ARG (R) AGA 0 0.1 54 45.0 43.8 LYS
(K) AA 10 8.8 52 45.6 44.6 AGG 0 0.0 36 30.0 30.5 AAG 104 91.2 62
54.4 55.4 CGA 1 0.8 0 0.0 0.0 CGC 95 79.2 0 0.0 0.0 CGG 1 0.8 0 0.0
0.0 CGT 23 19.2 30 25.0 25.7 ASN (N) AAC 75 89.3 51 60.7 62.6 MET
(M) ATG 45 100 45 100 100.0 AAT 9 10.7 33 39.3 37.4 ASP (D) GAC 86
72.3 52 43.7 42.5 PHE (F) TTC 33 47.8 41 59.4 58.6 GAT 33 27.7 67
56.3 57.5 TTT 36 52.2 28 40.6 41.4 CYS (C) TGC 41 100.0 20 48.8
49.2 PRO (P) CCCA 8 7.2 33 29.7 29.6 TGT 0 0.0 21 51.2 50.8 CCC 47
42.3 16 14.4 14.6 CCG 35 31.5 20 18.0 18.4 CCT 21 18.9 42 37.8 37.3
END TAA 1 100.0 0 0.0 0.0 SER (S) AGC 40 26.5 28 18.5 17.9 TAG 0
0.0 0 0.0 0.0 AGT 7 4.6 24 15.9 15.8 TGA 0 0.0 1 100.0 100.0 TCA 2
1.3 31 20.5 20.4 TCC 55 36.4 28 18.5 18.7 TCG 33 21.9 0 0.0 0.0 TCT
14 9.3 40 26.5 27.2 GLN (Q) CAA 8 13.5 30 50.8 50.0 THR (T) ACA 8
8.1 28 28.3 26.3 CAG 51 86.4 29 49.2 50.0 ACC 58 58.6 24 24.2 26.9
ACG 26 26.3 16 16.2 16.9 ACT 7 7.1 31 31.3 30.0 GLU (E) GAA 33 24.8
58 43.6 43.6 TRP (W) TGG 22 100 22 100 100.0 16 GAG 100 75.2 75
56.4 56.4 GLY (G) GGA 11 7.2 55 36.2 36.4 TYR (Y) TAC 51 91.1 32
57.1 59.4 GGC 102 67.1 25 16.4 16.2 TAT 5 8.9 24 42.9 40.6 GGG 3
2.0 23 15.1 15.2 GGT 36 23.7 49 32.2 32.1 HIS (H) CAC 29 75.3 19
50.0 49.6 VAL (V) GTA 1 0.8 0 0.0 0.0 CAT 9 23.7 19 50.0 50.4 GTC
85 65.4 34 26.2 27.0 GTG 30 23.1 42 32.3 31.7 GTT 14 10.8 54 41.5
41.3 ILE (I) ATA 0 0.0 22 21.2 21.1 Totals 981 981 ATC 67 64.4 44
42.3 42.7 ATT 37 35.6 38 36.5 36.2 Totals 1079 1079
TABLE-US-00005 TABLE 5 PUFA OrfC codon compositions Amino Original
Original Plnt Opt Plnt Opt Plnt Opt Amino Original Original Plnt
Opt Plnt Opt Plnt Opt Acid Codon Gene # Gene % Gene # Gene % Reem'd
Acid Codon Gene # Gene % Gene # Gene % Reem'd ALA (A) GCA 18 14.0
30 23.3 23.3 LEU (L) CTA 2 1.6 0 0.0 0.0 GCC 84 65.1 28 21.7 21.2
CTC 78 63.9 34 27.9 28.5 GCG 14 10.9 19 14.7 14.2 CTG 16 14.8 18
14.8 14.6 GCT 13 10.1 52 40.3 41.3 CTT 16 13.1 39 32.0 31.6 TTA 1
0.8 0 0.0 0.0 TTG 7 5.7 31 25.4 25.3 ARG (R) AGA 1 1.3 33 44.0 43.8
LYS (K) AA 15 16.1 42 45.2 44.6 AGG 1 1.3 23 30.7 30.5 AAG 78 83.9
51 54.8 55.4 CGA 6 8.0 0 0.0 0.0 CGC 53 70.7 0 0.0 0.0 CGG 3 4.0 0
0.0 0.0 CGT 11 14.7 19 25.3 25.7 ASN (N) AAC 63 90.0 43 61.4 62.6
MET (M) ATG 48 100 48 100 100.0 AAT 7 10.0 27 38.6 37.4 ASP (D) GAC
70 76.9 40 44.0 42.5 PHE (F) TTC 40 58.8 40 58.8 58.6 GAT 21 23.1
51 56.0 57.5 TTT 28 41.2 28 41.2 41.4 CYS (C) TGC 26 81.3 16 50.0
49.2 PRO (P) CCCA 10 11.2 27 30.3 29.6 TGT 6 18.8 16 50.0 50.8 CCC
35 39.3 13 14.6 14.6 CCG 26 29.2 16 18.0 18.4 CCT 18 20.2 33 37.1
37.3 END TAA 1 100.0 0 0.0 0.0 SER (S) AGC 16 19.0 13 15.5 17.9 TAG
0 0.0 0 0.0 0.0 AGT 3 3.6 14 16.7 15.8 TGA 0 0.0 1 100.0 100.0 TCA
9 10.7 18 21.4 20.4 TCC 28 33.3 16 19.0 18.7 TCG 21 25.0 0 0.0 0.0
TCT 7 8.3 23 27.4 27.2 GLN (Q) CAA 11 24.4 25 55.6 50.0 THR (T) ACA
4 6.2 17 26.2 26.3 CAG 34 75.6 20 44.4 50.0 ACC 41 63.1 17 26.2
26.9 ACG 8 12.3 11 16.9 16.9 ACT 12 18.5 20 30.8 30.0 GLU (E) GAA
17 19.1 40 44.9 43.6 TRP (W) TGG 18 100 18 100 100.0 16 GAG 72 80.9
49 55.1 56.4 GLY (G) GGA 21 17.9 43 36.8 36.4 TYR (Y) TAC 41 87.2
28 59.6 59.4 GGC 78 66.7 18 15.4 16.2 TAT 6 12.8 19 40.4 40.6 GGG 7
6.0 18 15.4 15.2 GGT 11 9.4 38 32.5 32.1 HIS (H) CAC 24 85.7 14
50.0 49.6 VAL (V) GTA 6 5.3 0 0.0 0.0 CAT 4 14.3 14 50.0 50.4 GTC
62 54.4 31 27.2 27.0 GTG 24 21.1 37 32.5 31.7 GTT 22 19.3 46 40.4
41.3 ILE (I) ATA 0 0.0 15 21.7 21.1 Totals 748 748 ATC 48 69.6 30
43.5 42.7 ATT 21 30.4 24 34.8 36.2 Totals 746 746
TABLE-US-00006 TABLE 6 Acyl-CoA synthase codon compositions Amino
Original Original Plnt Opt Plnt Opt Plnt Opt Amino Original
Original Plnt Opt Plnt Opt Plnt Opt Acid Codon Gene # Gene % Gene #
Gene % Reem'd Acid Codon Gene # Gene % Gene # Gene % Reem'd ALA (A)
GCA 2 2.3 21 24.7 23.3 LEU (L) CTA 0 0.0 0 0.0 0.0 GCC 59 68.6 18
21.2 21.2 CTC 35 63.6 15 27.3 28.5 GCG 11 12.8 12 14.1 14.2 CTG 6
10.9 9 16..4 14.6 GCT 14 16.3 34 40.0 41.3 CTT 13 23.6 17 30.9 31.6
TTA 0 0.0 0 0.0 0.0 TTG 1 1.8 14 25.5 25.3 ARG (R) AGA 0 0.0 14
43.8 43.8 LYS (K) AA 2 4.1 22 44.9 44.6 AGG 3 9.4 10 31.3 30.5 AAG
47 95.9 27 55.1 55.4 CGA 0 0.0 0 0.0 0.0 CGC 25 78.1 0 0.0 0.0 CGG
0 0.0 0 0.0 0.0 CGT 4 12.5 8 25.0 25.7 ASN (N) AAC 22 95.7 14 60.9
62.6 MET (M) ATG 21 100 21 100 100.0 AAT 1 4.3 9 39.1 37.4 ASP (D)
GAC 38 74.5 22 43.1 42.5 PHE (F) TTC 16 51.6 18 58.1 58.6 GAT 13
25.5 29 56.9 57.5 TTT 15 48.4 13 41.9 41.4 CYS (C) TGC 11 91.7 6
50.0 49.2 PRO (P) CCCA 0 0.0 11 30.6 29.6 TGT 1 8.3 6 50.0 5110.8
CCC 20 55.6 5 13.9 14.6 5 CCG 9 25.0 7 19.4 18.4 7 CCT 7 19.4 13
36.1 37.3 END TAA 1 100.0 0 0.0 0.0 SER (S) AGC 7 17.5 7 17.5 17.9
TAG 0 0.0 0 0.0 0.0 AGT 4 10.0 6 15.0 15.8 TGA 0 0.0 1 100.0 100.0
TCA 1 2.5 8 20.0 20.4 TCC 19 47.5 8 20.0 18.7 TCG 7 17.5 0 0.0 0.0
TCT 2 5.0 11 27.5 27.2 GLN (Q) CAA 3 18.8 8 50.0 50.0 THR (T) ACA 1
2.0 13 25.5 26.3 CAG 13 81.3 8 50.0 50.0 ACC 27 52.9 14 27.5 26.9
ACG 19 37.3 9 17.6 16.9 ACT 4 7.8 15 29.4 30.0 GLU (E) GAA 11 17.7
27 43.5 43.6 TRP (W) TGG 10 100 10 100 100.0 16 GAG 51 82.3 35 56.5
56.4 GLY (G) GGA 5 7.4 25 36.8 36.4 TYR (Y) TAC 18 85.7 12 57.1
59.4 GGC 49 72.1 11 16.2 16.2 TAT 3 14.3 9 42.9 40.6 GGG 0 0.0 10
14.7 15.2 GGT 14 20.6 22 32.4 32.1 HIS (H) CAC 10 83.3 6 50.0 49.6
VAL (V) GTA 0 0.0 0 0.0 0.0 CAT 2 16.7 6 50.0 50.4 GTC 34 58.6 16
27.6 27.0 GTG 9 15.5 19 32.8 31.7 GTT 15 25.9 23 39.7 41.3 ILE (I)
ATA 0 0.0 10 21.3 51.1 Totals 372 372 ATC 27 57.4 20 42.6 42.7 ATT
20 42.6 17 36.2 36.2 Totals 410 409
TABLE-US-00007 TABLE 7 Phosphopantetheinyl transferase HetI codon
compositions Amino Original Original Plnt Opt Plnt Opt Plnt Opt
Amino Original Original Plnt Opt Plnt Opt Plnt Opt Acid Codon Gene
# Gene % Gene # Gene % Reem'd Acid Codon Gene # Gene % Gene # Gene
% Reem'd ALA (A) GCA 4 20.0 5 25.0 23.3 LEU (L) CTA 6 17.1 0 0.0
0.0 GCC 6 30.0 4 20.0 21.2 CTC 4 11.4 10 28.6 28.5 GCG 2 10.0 3
15.0 14.2 CTG 0 0.0 5 14.3 14.6 GCT 8 40.0 8 40.0 41.3 CTT 3 8.6 11
31.4 31.6 TTA 14 40.0 0 0.0 0.0 TTG 8 22.9 9 25.7 25.3 ARG (R) AGA
1 6.3 6 37.5 43.8 LYS (K) AA 10 90.9 5 45.5 44.6 AGG 1 6.3 5 31.3
30.5 AAG 1 9.1 6 54.5 55.4 CGA 2 12.5 0 0.0 0.0 CGC 6 37.5 0 0.0
0.0 CGG 1 6.3 0 0.0 0.0 CGT 5 31.3 5 31.3 25.7 ASN (N) AAC 3 50.0 4
66.7 62.6 MET (M) ATG 1 100 1 100 100.0 AAT 3 50.0 2 33.3 37.4 ASP
(D) GAC 3 25.0 5 41.7 42.5 PHE (F) TTC 3 25.0 6 50.0 58.6 GAT 9
75.0 7 58.3 57.5 TTT 9 75.0 6 50.0 41.4 CYS (C) TGC 0 0.0 1 33.3
49.2 PRO (P) CCCA 9 56.3 5 31.2 29.6 TGT 3 100.0 2 66.7 50.8 CCC 6
37.5 2 12.5 14.6 CCG 1 6.3 3 18.8 18.4 CCT 0 0.0 6 37.5 37.3 END
TAA 0 0.0 0 0.0 0.0 SER (S) AGC 0 0.0 2 15.4 17.9 TAG 0 0.0 0 0.0
0.0 AGT 4 30.8 2 15.4 15.8 TGA 1 100.0 1 100.0 100.0 TCA 3 23.1 3
23.1 20.4 TCC 3 23.1 2 15.4 18.7 TCG 1 7.7 0 0.0 0.0 TCT 2 15.4 4
30.8 27.2 GLN (Q) CAA 5 45.5 5 45.5 50.0 THR (T) ACA 3 27.3 3 27.3
26.3 CAG 6 54.5 6 54.5 50.0 ACC 2 18.2 3 27.3 26.9 ACG 2 18.2 2
18.2 16.9 ACT 4 36.4 3 27.3 30.0 GLU (E) GAA 13 72.2 8 44.4 43.6
TRP (W) TGG 6 100 6 100 100.0 16 GAG 5 27.8 10 55.6 56.4 GLY (G)
GGA 0 0.0 5 35.7 36.4 TYR (Y) TAC 2 22.2 5 55.6 59.4 GGC 5 35.7 2
14.3 16.2 TAT 7 77.8 4 44.4 40.6 GGG 2 14.3 2 14.3 15.2 GGT 7 50.0
5 35.7 32.1 HIS (H) CAC 1 20.0 3 60.0 49.6 VAL (V) GTA 0 0.0 0 0.0
0.0 CAT 4 80.0 2 40.0 50.4 GTC 1 12.5 2 25.0 27.0 GTG 3 37.5 3 37.5
31.7 GTT 4 50.0 3 37.5 41.3 ILE (I) ATA 2 20.0 3 30.0 21.1 Totals
122 122 ATC 4 40.0 4 40.0 42.7 ATT 4 40.0 3 30.0 36.2 Totals 116
116
[0254] After the codon optimization of the coding region sequences
were completed, additional nucleotide sequences were added to the
optimized coding region sequence. Restriction sites for the
facilitation of cloning, a Kozak sequence and additional stop
codons were added to the plant optimized coding sequence. In
addition, a second series of PUFA synthase OrfA, PUFA synthase
OrfB, PUFA synthase chimeric OrfC, acyl-CoA synthetase and
phosphopantetheinyl transferase HetI coding sequences were designed
which contained a chloroplast targeting sequence from the
Arabidopsis thaliana Ribulose Bisphosphate Carboxylase small chain
1A (GenBank ID: NM_202369.2). This sequence SEQ ID NO:11 was added
to the previously described coding sequences for PUFA synthase
OrfA, PUFA synthase OrfB, PUFA synthase chimeric OrfC and
phosphopantetheinyl transferase HetI. The initial Methionine from
SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:10 was removed
and replaced with the chloroplast targeting sequence. The sequences
which contain the chloroplast targeting sequence are identified as
version 4 (v4) throughout the specification.
[0255] A second chloroplast transit peptide was added to the PUFA
synthase OrfA, PUFA synthase OrfB, PUFA synthase chimeric OrfC,
acyl-CoA synthetase and phosphopantetheinyl transferase HetI coding
sequences. These coding sequences were designed to contain a
chloroplast targeting sequence from acyl-ACP-thioesterase (GenBank
ID: X73849.1). This sequence, SEQ ID NO:38, was added to the
previously described coding sequences for PUFA synthase OrfA, PUFA
synthase OrfB, PUFA synthase chimeric OrfC and phosphopantetheinyl
transferase HetI. The initial Methionine from SEQ ID NO: 6, SEQ ID
NO: 7, SEQ ID NO: 8, SEQ ID NO:9 and SEQ ID NO: 10 was removed and
replaced with the chloroplast targeting sequence. The sequences
which contain the chloroplast targeting sequence are identified as
version 5 (v5) throughout the specification.
[0256] Once a plant-optimized DNA sequence has been designed on
paper or in silica, actual DNA molecules can be synthesized in the
laboratory to correspond in sequence precisely to the designed
sequence. Such synthetic DNA molecules can be cloned and otherwise
manipulated exactly as if they were derived from natural or native
sources. Synthesis of DNA fragments comprising SEQ ID NO:6, SEQ ID
NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10 containing the
additional sequences described above were performed by commercial
suppliers (Geneart Ag, Regensburg, Germany). The synthetic DNA was
then cloned into expression vectors and transformed into
Agrobacterium and canola as described in Examples 2, 3, and 4.
[0257] Employing this method with the codon optimization of the
PUFA synthase OrfA coding sequence resulted in the selection of
repeated Proline-Alanine sequences that are sufficiently diverged
to avoid repeated sequence instability. These sequences were chosen
from the deepest branches of the Neighbor-Joining tree (i.e., are
the most distantly related to one another in this sequence set).
Smith-Wasserman global alignments were done for all pair wise
combinations and the range of homology was 74-81% with a probable
median of 76-77% (Table 8).
TABLE-US-00008 TABLE 8 Smith-Wasserman homologies of selected
codon-optimized sequences of repeats of PUFA OrfA. rpt1 nap9 rpt2
nap10 rpt3 nap10 rpt4 nap1 rpt5 nap10 rpt6 nap6 rpt7 nap9 rpt8 nap4
rpt9 nap10 rpt1 nap9 100 77 74 77 74 77 81 76 76 rpt2 nap10 100 81
76 74 77 79 76 77 rpt3 nap10 100 79 80 74 74 76 78 rpt4 nap1 100 80
77 75 76 76 rpt5 nap10 100 78 77 77 77 rpt6 nap6 100 78 76 77 rpt7
nap9 100 75 74 rpt8 nap4 100 76 rpt9 nap10 100
[0258] A Clustal W alignment (Vector NTI, Invitrogen, Carlsbad,
Calif.) of the chosen 9 newly designed coding regions for the 9
repeated domains is shown in FIG. 1. Overall, the sequences are
93.1% homologous, 61.7% identical as compared to the original
sequences which were 100% homologous and 89.7% identical. Greater
sequence divergence could be achieved by using more than 10
sequence iterations and employing a computer program or
mathematical algorithm to select from these sequences (instead of
choosing sequences visually). Nevertheless, the sequences
exemplified are highly divergent, and produced stable
poly-nucleotide fragments containing nucleotides.
Example 2
Plasmid Construction for pDAB7361, pDAB7362, pDAB7363, and
Additional Constructs
[0259] Construction of pDAB7361
[0260] The pDAB7361 plasmid (FIG. 2; SEQ ID NO:35) was constructed
using a multi-site Gateway recombination L-R reaction (Invitrogen,
Carlsbad, Calif.). pDAB7361 contains three PUFA synthase plant
transcription units (PTUs), one acyl-CoA synthetase PTU, one
phosphopantetheinyl transferase PTU, and a phosphinothricin acetyl
transferase PTU as follows. Specifically, the first PUFA synthase
PTU contains a truncated Phaseolus vulgaris phytohaemagglutinin-L
gene promoter (PvDlec2 promoter v2; GenBank Accession Number
X06336), Arabidopsis thaliana AT2S3 gene 5' untranslated region (2S
5' UTR; GenBank Accession Number NM_118850), Schizochytrium sp.
PolyUnsaturated Fatty Acid synthase Open Reading Frame A (Sz PUFA
OrfA v2) and Arabidopsis thaliana 2S albumin gene 3' untranslated
region terminator v1 (At2S SSP terminator v1; GenBank Accession
Number M22035). The second PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, Schizochytrium sp. PolyUnsaturated Fatty
Acid synthase Open Reading Frame B (SzPUFA OrfB v3) and At2S SSP
terminator v1. The third PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, Schizochytrium and Thraustochytrium sp.
PolyUnsaturated Fatty Acid synthase Open Reading Frame C (hSzThPUFA
OrfC v3) and At2S SSP terminator v1. The acyl-CoA synthetase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, Schizochytrium sp.
acyl-CoA synthetase (SzACS-2 v3) and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the PvDlec2 promoter
v2, 2S 5' UTR, Nostoc sp. 4' phosphopantetheinyl transferase HetI
(NoHetI v3) and At2S SSP terminator v1.
[0261] Plasmids pDAB7355, pDAB7335, pDAB7336, pDAB7339 and pDAB7333
were recombined to form pDAB7361. Specifically, the five PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. pDAB7333 also contains the phosphinothricin acetyl
transferase PTU: Cassava vein Mosaic Virus Promoter (CsVMV promoter
v2; Verdaguer et al., Plant Molecular Biology 31:1129-1139; 1996),
phosphinothricin acetyl transferase (PAT v5; Wohlleben et al., Gene
70:25-37; 1988) and Agrobacterium tumefaciens ORF1 3' untranslated
region (AtuORF1 3' UTR v4; Huang et al., J. Bacteria 172:1814-1822;
1990), in addition to other regulatory elements such as Overdrive
(Toro et al., PNAS 85(22): 8558-8562; 1988) and T-stand border
sequences (T-DNA Border A and T-DNA Border B; Gardner et al.,
Science 231:725-727; 1986 and WO 2001/025459 A1). Recombinant
plasmids containing the five PTUs were then isolated and tested for
incorporation of the five PTUs with restriction enzyme digestion
and DNA sequencing.
Construction of pDAB7362
[0262] The pDAB7362 plasmid (FIG. 3; SEQ ID NO:36) was constructed
using a multi-site Gateway L-R recombination reaction. pDAB7362
contains three PUFA synthase PTUs, one acyl-CoA synthetase PTU, one
phosphopantetheinyl transferase PTU sequence and a phosphinothricin
acetyl transferase PTU. Specifically, the first PUFA synthase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and
At2S SSP terminator v1. The second PUFA synthase PTU contains the
PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfB v3 and At2S SSP
terminator v1. The third PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, hSzThPUFA OrfC v3 and At2S SSP terminator
v1. The acyl-CoA synthetase PTU contains the PvDlec2 promoter v2,
2S 5' UTR, SzACS-2 v3 gene and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the PvDlec2 promoter
v2, 2S 5' UTR, NoHetI v3 and At2S SSP terminator v1.
[0263] Plasmids pDAB7334, pDAB7335, pDAB7336, pDAB7339 and pDAB7333
were recombined to form pDAB7362. Specifically, the five PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. pDAB7333 also contains the phosphinothricin acetyl
transferase PTU: CsVMV promoter v2, PAT v5, AtuORF1 3' UTR v4 in
addition to other regulatory elements such as Overdrive and T-stand
border sequences (T-DNA Border A and T-DNA Border B). Recombinant
plasmids containing the five PTUs were then isolated and tested for
incorporation of the five PTUs with restriction enzyme digestion
and DNA sequencing.
Construction of pDAB7363
[0264] pDAB7363 (FIG. 4; SEQ ID NO:37) was constructed using a
multi-site Gateway L-R recombination reaction. pDAB7363 contains
three PUFA synthase PTUs, one acyl-CoA synthetase PTU and one
phosphopantetheinyl transferase PTU sequence. Specifically, the
first PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5'
UTR, SzPUFA OrfA v4 and At2S SSP terminator v1. The second PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA
OrfB v4 and At2S SSP terminator v1. The third PUFA synthase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA OrfC v4 and
At2S SSP terminator v1. The acyl-CoA synthetase PTU contains the
PvDlec2 promoter v2, 2S 5' UTR, SzACS-2 v3 gene and At2S SSP
terminator v1. The phosphopantetheinyl transferase PTU contains the
PvDlec2 promoter v2, 2S 5' UTR, NoHetI v4 and At2S SSP terminator
v1. In addition, all PTUs also contained the Arabidopsis thaliana
Ribulose Bisphosphate Carboxylase small chain 1A chloroplast
targeting sequence as indicated by the label "v4."
[0265] Plasmids pDAB7340, pDAB7341, pDAB7342, pDAB7344 and pDAB7333
were recombined to form pDAB7363. Specifically, the five PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333 pDAB7333 also contains the phosphinothricin acetyl
transferase PTU: CsVMV promoter v2, PAT v5, AtuORF1 3' UTR v4 in
addition to other regulatory elements such as Overdrive and T-stand
border sequences (T-DNA Border A and T-DNA Border B). Recombinant
plasmids containing the five PTUs were then isolated and tested for
incorporation of the five PTUs with restriction enzyme digestion
and DNA sequencing.
Construction of pDAB7365
[0266] pDAB7365 is a binary plasmid that was constructed to contain
native, non-codon optimized versions of SzPUFA OrfA v2, SzPUFA OrfB
v2, hSzThPUFA OrfC v2, SzACS-2 v2, and NoHetI v2. The pDAB7365
plasmid (FIG. 19; SEQ ID NO:39) was constructed using a multi-site
Gateway L-R recombination reaction. pDAB7365 contains three PUFA
synthase PTUs, one acyl-CoA synthetase PTU, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfA v2 and At2S SSP terminator v1.
The second PUFA synthase PTU contains the PvDlec2 promoter v2, 2S
5' UTR, SzPUFA OrfB v2 and At2S SSP terminator v1. The third PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA
OrfC v2 and At2S SSP terminator v1. The acyl-CoA synthetase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, SzACS-2 v2 gene and
At2S SSP terminator v1. The phosphopantetheinyl transferase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, NoHetI v2 and At2S SSP
terminator v1.
[0267] Plasmids pDAB7355, pDAB7356, pDAB7357, pDAB7360 and pDAB7333
were recombined to form pDAB7365. Specifically, the five PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v2, SzPUFA OrfB
v2. SzPUFA OrfC v2, SzACS-2 v2, NoHetI v2. pDAB7333 also contains
the phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT
v5, AtuORF1 3'UTR v4 in addition to other regulatory elements such
as Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the six PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB7368
[0268] pDAB7368 is a binary plasmid that was constructed to contain
native, non-codon optimized versions of SzPUFA OrfA v2, SzPUFA OrfB
v2, hSzThPUFA OrfC v2, and NoHetI v2. This construct does not
contain the SzACS-2 coding sequence. The pDAB7368 plasmid (FIG. 20;
SEQ ID NO:40) was constructed using a multi-site Gateway L-R
recombination reaction. pDAB7368 contains three PUFA synthase PTUs,
one acyl-CoA synthetase PTU, one phosphopantetheinyl transferase
PTU and a phosphinothricin acetyl transferase PTU. Specifically,
the first PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5'
UTR, SzPUFA OrfA v2 and At2S SSP terminator v1. The second PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA
OrfB v2 and At2S SSP terminator v1. The third PUFA synthase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfC v2 and
At2S SSP terminator v1. The phosphopantetheinyl transferase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, NoHetI v2 and At2S SSP
terminator v1.
[0269] Plasmids pDAB7355, pDAB7356, pDAB7357, pDAB7359 and pDAB7333
were recombined to form pDAB7368. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v2, SzPUFA OrfB
v2, SzPUFA OrfC v2, NoHetI v2, pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB7369
[0270] pDAB7369 is a binary plasmid that was constructed to contain
rebuilt, codon optimized versions of SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, and NoHetI v3. This construct does not
contain the SzACS-2 coding sequence PTU. The pDAB7369 plasmid (FIG.
21; SEQ ID NO:41) was constructed using a multi-site Gateway L-R
recombination reaction. pDAB7369 contains three PUFA synthase PTUs,
one acyl-CoA synthetase PTU, one phosphopantetheinyl transferase
PTU and phosphinothricin acetyl transferase PTU. Specifically, the
first PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5'
UTR, SzPUFA OrfA v3 and At2S SSP terminator v1. The second PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA
OrfB v3 and At2S SSP terminator v1. The third PUFA synthase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA OrfC v3 and
At2S SSP terminator v1. The phosphopantetheinyl transferase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, NoHetI v3 and At2S SSP
terminator v1.
[0271] Plasmids pDAB7334, pDAB7335, pDAB7336, pDAB7338 and pDAB7333
were recombined to form pDAB7369. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB7370
[0272] pDAB7370 is a binary plasmid that was constructed to contain
rebuilt, codon optimized versions of SzPUFA OrfA v4, SzPUFA OrfB
v4, hSzThPUFA OrfC v4, and NoHetI v4 which contain the Ribulose
Bisphosphate Carboxylase small chain 1A (labeled as SSU-TP v1)
which is fused to the amino terminus of the coding sequence. This
construct does not contain the SzACS-2 coding sequence PTU. The
pDAB7370 plasmid (FIG. 22: SEQ ID NO:42) was constructed using a
multi-site Gateway L-R recombination reaction. pDAB7370 contains
three PUFA synthase PTUs, one acyl-CoA synthetase PTU, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfA v4 and At2S SSP
terminator v1. The second PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfB v4 and At2S SSP terminator v1.
The third PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5'
UTR, hSzThPUFA OrfC v4 and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the PvDlec2 promoter
v2, 2S 5' UTR, NoHetI v4 and At2S SSP terminator v1.
[0273] Plasmids pDAB7340, pDAB7341, pDAB7342, pDAB7343 and pDAB7333
were recombined to form pDAB7370. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v4, SzPUFA OrfB
v4, hSzThPUFA OrfC v4, NoHetI v4. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB100518
[0274] pDAB100518 is a binary plasmid that was constructed to
contain rebuilt, codon optimized versions of SzPUFA OrfA v5, SzPUFA
OrfB v5, hSzThPUFA OrfC v5, and NoHetI v5 which contain the
chloroplast transit peptide from acyl-ACP-thioesterase (labeled as
Thioesterase Transit Peptide) which is fused to the amino terminus
of the coding sequence. In addition, the plasmid contains a SzACS-2
v3 coding sequence PTU which does not possess a chloroplast transit
peptide. The pDAB100518 plasmid (FIG. 23; SEQ ID NO:43) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB100518 contains three PUFA synthase PTUs, one acyl-CoA
synthetase PTU, one phosphopantetheinyl transferase PTU and a
phosphinothricin acetyl transferase PTU. Specifically, the first
PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR,
SzPUFA OrfA v5 and At2S SSP terminator v1. The second PUFA synthase
PTU contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfB v5 and
At2S SSP terminator v1. The third PUFA synthase PTU contains the
PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA OrfC v5 and At2S SSP
terminator v1. The acyl-CoA synthetase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzACS-2 v3 gene and At2S SSP terminator v1.
The phosphopantetheinyl transferase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, NoHetI v5 and At2S SSP terminator v1.
[0275] Plasmids pDAB100517, pDAB100514, pDAB100511, pDAB100515 and
pDAB7333 were recombined to form pDAB100518. Specifically, the five
PTUs described above were placed in a head-to-tail orientation
within the T-strand DNA border regions of the plant transformation
binary pDAB7333. The order of the genes is: SzPUFA OrfA v5, SzPUFA
OrfB v5, hSzThPUFA OrfC v5, SzACS-2 v3, NoHetI v5. pDAB7333 also
contains the phosphinothricin acetyl transferase PTU: CsVMV
promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to other
regulatory elements such as Overdrive and T-stand border sequences
(T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the six PTUs were then isolated and tested for
incorporation of the six PTUs with restriction enzyme digestion and
DNA sequencing.
Construction of pDAB101476
[0276] pDAB101476 is a binary plasmid that was constructed to
contain rebuilt, codon optimized versions of SzPUFA OrfA v3, SzPUFA
OrfB v3, hSzThPUFA OrfC v3, and NoHetI v3. The SzACS-2 v2 gene
sequence is the native, non-codon optimized version. The pDAB101476
plasmid (FIG. 24; SEQ ID NO:44) was constructed using a multi-site
Gateway L-R recombination reaction. pDAB101476 contains three PUFA
synthase PTUs, one acyl-CoA synthetase PTU, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP terminator v1.
The second PUFA synthase PTU contains the PvDlec2 promoter v2, 2S
5' UTR, SzPUFA OrfB v3 and At2S SSP terminator v1. The third PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA
OrfC v3 and At2S SSP terminator v1. The acyl-CoA synthetase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, SzACS-2 v2 gene and
At2S SSP terminator v1. The phosphopantetheinyl transferase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, NoHetI v3 and At2S SSP
terminator v1.
[0277] Plasmids pDAB7334, pDAB7335, pDAB7336, pDAB101471 and
pDAB7333 were recombined to form pDAB101476. Specifically, the five
PTUs described above were placed in a head-to-tail orientation
within the T-strand DNA border regions of the plant transformation
binary pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA
OrfB v3, hSzThPUFA OrfC v3, SzACS-2 v2, NoHetI v3. pDAB7333 also
contains the phosphinothricin acetyl transferase PTU: CsVMV
promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to other
regulatory elements such as Overdrive and T-stand border sequences
(T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the six PTUs were then isolated and tested for
incorporation of the six PTUs with restriction enzyme digestion and
DNA sequencing.
Construction of pDAB101477
[0278] pDAB101477 is a binary plasmid that was constructed to
contain rebuilt, codon optimized versions of SzPUFA OrfA v3, SzPUFA
OrfB v3, hSzThPUFA OrfC v3, and NoHetI v3. The pDAB101477 plasmid
(FIG. 25; SEQ ID NO:45) was constructed using a multi-site Gateway
L-R recombination reaction. pDAB101477 contains three PUFA synthase
PTUs, one acyl-CoA synthetase PTU, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP terminator v1.
The second PUFA synthase PTU contains the PvDlec2 promoter v2, 2S
5' UTR, SzPUFA OrfB v3 and At2S SSP terminator v1. The third PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA
OrfC v3 and At2S SSP terminator v1. The acyl-CoA synthetase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, SzACS-2 v4 gene and
At2S SSP terminator v1. The phosphopantetheinyl transferase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, NoHetI v3 and At2S SSP
terminator v1.
[0279] Plasmids pDAB7334, pDAB7335, pDAB7336, pDAB101472 and
pDAB7333 were recombined to form pDAB101477. Specifically, the five
PTUs described above were placed in a head-to-tail orientation
within the T-strand DNA border regions of the plant transformation
binary pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA
OrfB v3, hSzThPUFA OrfC v3, SzACS-2 v4, NoHetI v3. pDAB7333 also
contains the phosphinothricin acetyl transferase PTU: CsVMV
promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to other
regulatory elements such as Overdrive and T-stand border sequences
(T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the six PTUs were then isolated and tested for
incorporation of the six PTUs with restriction enzyme digestion and
DNA sequencing.
Example 3
Agrobacterium Strain Production for Plasmids pDAB7361, pDAB7362,
pDAB7363
[0280] The pDAB7361, pDAB7362 and pDAB7363 plasmids were
transformed into Agrobacterium tumefaciens using standard
electroporation techniques. Specifically, the Agrobacterium
tumefaciens strain Z707S (Hepburn et al. J. Gen. Microbial.
131:2961-2969 (1985)) was electroporated with the pDAB7361,
pDAB7362 or pDAB7363 plasmids. Transformed colonies of
Agrobacterium which contained the plasmids were selected and
confirmed using restriction enzyme digestion. The Agrobacterium
strains containing pDAB7361, pDAB7362 or pDAB7363 were stored as
glycerol stocks at -80.degree. C.
Example 4
Agrobacterium-Mediated Transformation of Canola
Agrobacterium Preparation
[0281] A loop of glycerol stock of the Agrobacterium strains
containing either pDAB7361, pDAB7362 or pDAB7363 was used to streak
YEP (Bacto Peptone 20.0 gm/L and Yeast Extract 10.0 gm/L) plates
containing streptomycin (100 mg/ml) and spectinomycin (50 mg/ml)
and incubated for 2 days at 28.degree. C. A loop of the 2-day
streak plate was then inoculated into 150 mL modified YEP liquid
with streptomycin (100 mg/me and spectinomycin (50 mg/ml) into
sterile 500 mL baffled flask(s) and shaken at 200 rpm at 28.degree.
C. The cultures were resuspended in M--medium (LS salts, 3%
glucose, modified B5 vitamins, 1 .mu.M kinetin, 1 .mu.M 2,4-D, pH
5.8) and diluted to the appropriate density (50 Klett Units) prior
to transformation of canola hypocotyls.
Canola Transformation
[0282] Seed Germination:
[0283] Canola seeds (variety Nexera 710) were surface-sterilized in
10% Clorox for 10 minutes and rinsed three times with sterile
distilled water (seeds are contained in steel strainers during this
process). Seeds were planted for germination on 1/2 MS Canola
medium (1/2 MS, 2% sucrose, 0.8% Agar) contained in Phytatrays, 25
seeds per Phytatray and placed in a Percival chamber with growth
regime set at 25.degree. C., photoperiod of 16 hours light, 8 hours
dark; and germinated for 5 days.
[0284] Pre-Treatment:
[0285] On day 5, .about.3 mm hypocotyl segments were aseptically
excised, discarding the root and shoot sections (drying of
hypocotyls was prevented by placing them into 10 ml of sterile
milliQ water during excision process). Hypocotyl segments were
placed horizontally on sterile filter paper on callus induction
medium MSK1D1 (MS, 1 mg/l Kinetin, 1 mg/l 2,4-D, 3% sucrose, 0.7%
Phytagar) for 3 days pre-treatment in a Percival chamber with
growth regime set at 22-23.degree. C., (photoperiod of 16 hours
light, 8 hours dark).
[0286] Co-Cultivation with Agrobacterium:
[0287] The day before Agrobacterium treatment, flasks of YEP medium
containing the appropriate antibiotics, were inoculated. Hypocotyl
segments were transferred from filter paper to empty 100.times.25
mm petri dishes containing 10 ml of liquid M medium to prevent the
hypocotyl segments from drying. A spatula was used at this stage to
scoop the segments and transfer. The liquid M medium was removed
with a pipette and 40 ml of Agrobacterium suspension added to the
petri dish (500 segments with 40 ml of Agrobacterium solution). The
segments were treated for 30 minutes with periodic swirling of the
petri dish so that the hypocotyls stayed immersed in the
Agrobacterium solution. At the end of the treatment period, the
Agrobacterium solution was pipetted into a waste beaker, autoclaved
and discarded (the Agrobacterium solution was completely removed to
prevent Agrobacterium overgrowth). The treated hypocotyls were
transferred with forceps back to the original plates containing
MSK1D1 with filter paper (care was taken to ensure that the
segments did not dry). The hypocotyl segments along with control
segments were returned to the Percival chamber under reduced light
intensity (by covering the plates with aluminum foil), and the
treated hypocotyls co-cultivated with Agrobacterium for 3 days.
[0288] Callus Induction on Selection Medium:
[0289] After 3 days of co-cultivation, the hypocotyl segments were
transferred individually with forceps onto callus induction medium
MSK1D1H1 (MS, 1 mg/l Kinetin, 1 mg/l 2,4-D, 0.5 gm/l MES, 5 mg/l
AgNO3, 300 mg/l Timentin, 200 mg/l Carbenicillin, 1 mg/l Herbiace,
3% sucrose, 0.7% Phytagar). The hypocotyl segments were anchored on
the medium but were not embedded in the medium.
[0290] Selection and Shoot Regeneration:
[0291] After 7 days on callus induction medium, the callusing
hypocotyl segments were transferred to Shoot Regeneration Medium 1
with selection MSB3Z1H1 (MS, 3 mg/l BAP, 1 mg/l Zeatin, 0.5 gm/l
MES, 5 mg/l AgNO3, 300 mg/l Timentin, 200 mg/l Carbenicillin, 1
mg/l Herbiace, 3% sucrose, 0.7% Phytagar). After 14 days, the
hypocotyl s with shoots were transferred to Regeneration Medium 2
with increased selection MSB3Z1H3 (MS, 3 mg/l BAP, 1 mg/l Zeatin,
0.5 gm/l MES, 5 mg/l AgNO3, 300 mg/l Timentin, 200 mg/l
Carbenicillin, 3 mg/l HERBIACE, 3% sucrose, 0.7% Phytagar).
[0292] Shoot Elongation:
[0293] After 14 days, the segments with shoots were transferred to
shoot elongation medium MSMESH5 (MS, 300 mg/l Timentin, 5 mg/l
Herbiace, 2% sucrose, 0.7% TC Agar). Shoots that were already
elongated were isolated and transferred to MSMESH5. After 14 days
the remaining shoots which had not elongated in the first round
were placed on MSMESH5 and transferred to fresh selection medium of
the same composition. At this stage all remaining hypocotyl
segments were discarded.
[0294] Shoots that elongated on MSB3Z1H3 medium after 2 weeks were
isolated and transferred to MSMESH5 medium. Remaining shoots that
had not elongated in the first round on MSMESH5 were isolated and
transferred to fresh selection medium of the same composition. At
this stage all remaining hypocotyl segments were discarded.
[0295] Root Induction:
[0296] After 14 days, the shoots were transferred to MSMEST medium
(MS, 0.5 g/l MES, 300 mg/l Timentin, 2% sucrose, 0.7% TC Agar for
root induction. The shoots that did not root in the first transfer
on MSMEST medium were transferred for a second or third cycle on
MSMEST medium until rooted plants were obtained. The shoots that
did not elongate or root in the first transfer on MSMEST medium
were transferred for a second or third cycle on MSMEST medium until
the rooted plants were obtained.
[0297] PCR Analysis:
[0298] Samples for PCR were isolated after the shoots were cultured
on MSMESH5 medium for at least 14 days. Leaf tissue from the green
shoots was tested by PCR for the presence of the PAT selectable
marker gene. All chlorotic shoots were discarded and not subjected
to the PAT assay. Samples that were positive for the PCR reaction
were kept and the shoots were left on the MSMEST medium to elongate
and develop roots. The shoots that were negative according to the
PCR assay were discarded.
[0299] Plants that rooted on MSMESH5 or MSMEST and were
PCR-positive were sent for transplanting into soil. After
hardening, the T.sub.0 canola plants were further analyzed for
events which contained all of the transgene PTU cassettes and then
plants were transferred to the greenhouse, grown to maturity and
the seed was harvested for additional analysis.
Example 5
Copy Number Analysis and Detection of the Coding Region in
Transgenic Canola
[0300] T.sub.0 plants selected from Example 4 were further analyzed
to identify plants which contained each of the transgene PTU
expression cassettes. Invader and hydrolysis probe assays were
performed to initially screen samples of putatively transformed
T.sub.0 plants to identify events which contained the PAT
expression cassette. Subsequent PCR analysis of the PUFA synthase
OrfA, PUFA synthase OrfB, PUFA synthase chimeric OrfC, acyl-CoA
synthetase and 4' phosphopantetheinyl transferase HetI gene
expression cassettes were completed to further identify plants
which contained the each gene expression cassette PTU from the
binary vector used to transform the plants. Events containing all
of the PTUs were selected for advancement to T.sub.1 plants.
[0301] Tissue samples were collected in 96-well collection plates
and lyophilized for 2 days. Tissue maceration was performed with a
Kleco tissue pulverizer and tungsten beads (Kleco, Visalia,
Calif.). Following tissue maceration the genomic DNA was isolated
in high throughput format using the DNeasy 96 Plant kit (Qiagen,
Germantown, Md.) according to the manufacturer's suggested
protocol.
[0302] gDNA was quantified by Quant-IT Pico Green DNA assay kit
(Molecular Probes, Invitrogen, Carlsbad, Calif.). Quantified gDNA
was adjusted to 10 ng/.mu.l for the Invader.RTM. assay or to 2
ng/.mu.l for the hydrolysis probe assay using a Biorobot3000
automated liquid handler (Qiagen, Germantown, Md.).
[0303] Custom INVADER.RTM. assays were developed for pat analysis
within canola by Third Wave Technologies (Madison, Wis.). The gDNA
samples (7.5 .mu.l of 10 ng/.mu.l gDNA) were first denatured in
96-well plate format by incubation at 95.degree. C. for 10 minutes
and then cooled to ambient temperature. Next, 7.5 .mu.l of master
mix (3 .mu.l of probe mix for pat and the HMG internal reference
gene (Weng, 2005) Weng H. et al., (2005). J. AOAC Int.
88(2):577-84, 3.5 .mu.l Cleavase XI FRET mix, and 1 .mu.l of
Cleavase XI Enzyme/MgCl.sub.2 solution) were added to each well and
the samples were overlayed with mineral oil. Plates were sealed and
incubated at 63.degree. C. for 1 hour in a BioRad Tetrad
thermocycler. Plates were cooled to ambient temperature before
being read on a fluorescence plate reader. All plates contained 1
copy, 2 copy and 4 copy standards as well as wild type control
samples and blank wells containing no sample.
[0304] Readings were collected for both FAM (.lamda.485-528 nm) and
RED (.lamda. 560-620 nm) channels and from these the fold over zero
(i.e., background) for each channel was determined for each sample
by the sample raw signal divided by no template raw signal. From
this data a standard curve was constructed and the best fit
determined by linear regression analysis. Using the parameters
identified from this fit, the apparent pat copy number was then
estimated for each sample.
[0305] Transgene copy number determination by hydrolysis probe
assay, analogous to TAQMAN.RTM. assay, was performed by real-time
PCR using the LIGHTCYCLER.RTM.480 system (Roche Applied Science,
Indianapolis, Ind.). Assays were designed for pat and the internal
reference gene HMG using LIGHTCYCLER.RTM. Probe Design Software 2M.
For amplification, LIGHTCYCLER.RTM.480 Probes Master mix (Roche
Applied Science, Indianapolis, Ind.) was prepared at 1.times. final
concentration in a 10 .mu.L volume multiplex reaction containing
0.4 .mu.M of each primer and 0.2 .mu.M of each probe (Table 8). A
two-step amplification reaction was performed with an extension at
60.degree. C. for 35 seconds with fluorescence acquisition. All
samples were run in triplicate and the averaged Cycle threshold
(Ct) values were used for analysis of each sample.
[0306] Analysis of real time PCR data was performed using
LIGHTCYCLER.RTM. software release 1.5 using the relative quant
module and is based on the .DELTA..DELTA.Ct method. For this, a
sample of gDNA from a single copy calibrator and known 2 copy check
were included in each run (identical to those used for Invader
assays above).
[0307] The presence of the other gene expression cassettes
contained in the T.sub.0 plant events was detected by individual
PCR reactions. Primer pairs (Table 9) specific to the coding
regions of these five PTU's were used for detection.
TABLE-US-00009 TABLE 9 Primerand probe information for hydrolysis
probe assay of pat and internal reference (HMG) Primer Name
Sequence Detection TQPATS SEQ ID NO: 12; 5'
ACAAGAGTGGATTGATGATCTAGAGAGGT 3' TQPATA SEQ ID NO: 13; 5'
CTTTGATGCCTATGTGACACGTAAACAGT 3' TQPATFQ SEQ ID NO: 14; 5' CY5- Cy5
GGTGTTGTGGCTGGTATTGCTTACGCTGG-BHQ2 3' HMGF SEQ ID NO: 15; 5'
CCTCTCTACCACCGTCTCACATG ' HMGR SEQ ID NO: 16; 5'
GATCTGGCCGGACTGTTTCA 3' HMG-HEX SEQ ID NO: 17; 5' Hex
CGCTCCTCAGCTACCACCTCAACCA-IB 3'
[0308] The PUFA synthase OrfA PCR reactions required two separate
PCR reactions and different conditions (e.g., PCR primers and
cycling conditions) to amplify the open reading frame of the gene
sequence. All of the PCR reactions were completed using the
conditions described in Table 10 with 35 cycles using the EX-TAQ
PCR kit (TaKaRa Biotechnology Inc. Otsu, Shiga, Japan) per
manufacturer's instructions. PCR products were resolved and
identified using TAE agarose gel electrophoresis. The expected gel
fragment sizes for the PCR products which would indicate the
presence of a full length PTU are described in Table 10 in the
"Expected sizes" column.
TABLE-US-00010 TABLE 10 PCR primers and conditions. 1st Half of On
A Primers pDAB7361 Sequence Expected sizes Conditions MAS480 SEQ ID
NO: 18 CGAGTTCGGACTCAACATGTTCCA 2524 bp 94.degree. C. 3' 94.degree.
C. 30'' 60.degree. C. 30'' 72.degree. C. 2'30'' 72.degree. C. 10'
4.degree. C. .infin. pDAB7362 and pDAB7363 Sequence Expected sizes
Conditions MAS547 SEQ ID NO: 20 AAGTTTGGAGTTGGCTTCTGCAGC 2833 bp
94.degree. C. 3' MAS581 SEQ ID NO: 21 TGAGTTTGGTCTCAACATGTTCCA
94.degree. C. 30'' 60.degree. C. 30'' 72.degree. C. 2'30''
72.degree. C. 10' 4.degree. C. .infin. 2nd Half of Orf A Primers
pDAB7361 Sequence Expected sizes Conditions MAS556 SEQ ID NO: 22
GATGCACGCCAAGGTGGTTGACAT 2246 bp 94.degree. C. 3' MAS481 SEQ ID NO:
23 TAATGTAGAAGGGCTTGTCCTGCG 94.degree. C. 30'' 60.degree. C. 30''
72.degree. C. 2' 72.degree. C. 10' 4.degree. C. .infin. pDAB7362
and pDAB7363 Sequence Expected sizes Conditions MAS550 SEQ ID NO:
24 GATGCACGCAAAGGTGGTTGACAT 2246 bp 94.degree. C. 3' MAS572 SEQ ID
NO: 25 TGATGTAGAAGGGTTTGTCTTGTG 94.degree. C. 30'' 60.degree. C.
30'' 72.degree. C. 2' 72.degree. C. 10' 4.degree. C. .infin. Orf B
Primers pDBA7361 and PDAB7362, & pDAB7363 Sequence Expected
sizes Conditions MAS482 SEQ ID NO: 26 CATGAGATGCATGACGAGAAGAGG 5476
bp 94.degree. C. 3' MAS483 SEQ ID NO: 27 TGGCAACTTGGTTCACTGTTCCAG
94.degree. C. 30'' 60.degree. C. 30'' 72.degree. C. 5' 72.degree.
C. 10' 4.degree. C. .infin. Chimeric Orf C Primers pDBA7361 and
PDAB7362, & pDAB7363 Sequence Expected sizes Conditions MAS488
SEQ ID NO: 28 CGCTTCGTGTCAAGACCAACAAGA 4356 bp 94.degree. C. 3'
MAS489 SEQ ID NO: 29 GCACCACGCAAAATCTGAAGGTTG 94.degree. C. 30''
60.degree. C. 30'' 72.degree. C. 5' 72.degree. C. 10' 4.degree. C.
.infin. Acs-2 Primers pDBA7361 and PDAB7362, & pDAB7363
Sequence Expected sizes Conditions MAS496 SEQ ID NO: 30
GAACTTCTCTGAAACTGGTGTGGG 1827 bp 94.degree. C. 3' MAS497 SEQ ID NO:
31 TCACAGGCATCCTCAATGGTCTCA 94.degree. C. 30'' 60.degree. C. 30''
72.degree. C. 1'30'' 72.degree. C. 10' 4.degree. C. .infin. HetI
Primers pDBA7361 and PDAB7362, & pDAB7363 Sequence Expected
sizes Conditions MAS500 SEQ ID NO: 32 TCAGATGAGGTTCATCTCTGGAGG 576
bp 94.degree. C. 3' MAS501 SEQ ID NO: 33 ATCTGGCACAAGCTCCAACAGAGA
94.degree. C. 30'' 60.degree. C. 30'' 72.degree. C. 30'' 72.degree.
C. 10' 4.degree. C. .infin.
[0309] A total of 197 canola events were identified as pat positive
from the Invader and hydrolysis probe experiments. Fifteen of these
events produced PCR amplicons for all five of the gene expression
cassettes (PUFA synthase OrfA, PUFA synthase OrfB, PUFA synthase
chimeric OrfC, acyl-CoA synthetase and 4' phosphopantetheinyl
transferase HetI) that were contained within the binary used to
transform the plants. Table 11 provides the fifteen events which
were further analyzed from the production of docosahexaenoic acid
(DHA). These T.sub.0 canola plants were grown to maturity in the
greenhouse and were subsequently self-fertilized. The mature
T.sub.1 seed was harvested and analyzed for the DHA via GC-FAME
analysis.
TABLE-US-00011 TABLE 11 PCR detection of docosahexaenoic acid (DHA)
producing genes in transgenic canola plants. Copy PCR Reactions
Plasmid Name Event Name Number ORFA ORFB ORFC SzACS-2 HetI pDAB7361
5197[13]- 1.3 - - + + + 010.001 5197[14]- 1 + + + + + 032.002
5197[21]- 4.3 + + + + + 052.001 5197[21]- 4.6 + + + + + 053.001
5197[23]- 8.2 + + + + + 054.001 pDAB7362 5217[6]- 2.5 + + + + +
058.001 5217[6]- 1.1 + + + + + 065.002 5217[1]- 3.1 + + + + +
021.001 5217[4]- 2.0 + + + + + 011.001 5217[2]- 1.2 + + + + +
038.001 5217[2]- 5.4 + + + + + 039.001 5217[6]- 6.0 + + + + +
055.001 5217[6]- 2.2 + + + + + 057.001 pDAB7363 5222[1]- 6.3 + + +
+ + 026.001 5222[1]- 1.7 + + + + + 004.001 5222[7]- 2.6 + + + + +
029.002
Example 6
Detection of DHA in Transgenic Canola Seed Lipids
[0310] Canola seed samples (either single seeds or bulked samples)
were homogenized in heptane containing triheptadecanoin (Nu-Chek
prep) as a triacylglycerol internal standard, using steel ball
mill. Prior to homogenization, a solution of 0.25 M of freshly
prepared sodium methoxide (Sigma-Aldrich, St. Louis, Mo.) in
methanol was added. Extraction was conducted at 40.degree. C. with
constant shaking. Recoveries were verified by the recovery of the
methylated surrogate C17 fatty acid. Extraction of FAMEs
(fatty-acid methyl esters) was repeated three times and the heptane
layers were pooled prior to analysis. The completeness of the
reaction was verified by checking for the presence of endogenous
FAMEs in a fourth extraction/derivatization. The resulting FAMEs
were analyzed by GC-FID using a capillary column BPX 70 from SGE
(15 m.times.0.25 mm.times.0.25 .mu.M). Each FAME was identified by
retention time and quantified by the injection of a rapeseed oil
reference mix from Matreya LLC (Pleasant Gap, Pa.) as a calibration
standard with addition of appropriate long chain polyunsaturated
fatty acids (Nu-Chek Prep, Elysian Minn.).
[0311] FAMEs extract corresponding to seeds from seven events were
found to contain peaks corresponding to DHA and DPA (n-6) following
the GC-FAME analyses of T.sub.1 seed (tabulated below in Table 12).
Table 12 shows that the number of DHA-containing seeds varies (as
expected from segregation of various copies of the transgene set
inserted into the canola genome), as does the maximum content of
DHA observed in the single seeds.
TABLE-US-00012 TABLE 12 LC-PUFA content of T1 seed from seven
transgenic canola events containing genes for the PUFA synthase
genes, SzACS-2 and HetI. Number of DHA Avg Avg Avg Highest Plasmid
Event PAT positive DHA Avg DPA Total n-3/ DHA (pDAB) Name Copy #
seeds.sup.1 content.sup.2 content.sup.2 PUFA.sup.3 PUFA.sup.4
content.sup.5 7361 5197[13]- 1.3 75/96 0.36 0.15 0.51 70% 0.81
010.001 7361 5197[14]- 1 67/96 0.43 0.12 0.55 78% 1.05 032.002 7361
5197[21]- 4.3 5/24 0.02 0.01 0.03 81% 0.05 052.001 7361 5197[21]-
4.6 32/48 0.07 0.03 0.11 64% 0.22 053.001 7362 5217[6]- 2.5 13/48
0.36 0.23 0.61 60% 1.02 058.001 7362 5217[6]- 1.1 16/48 0.15 0.09
0.25 61% 0.23 065.002 7363 5222[1]- 6.3 46/48 0.09 0.05 0.16 59%
0.40 026.001 a. Number of seeds that contained detectable DHA/total
number of seeds analyzed from the T1 bulk. b. Average DHA content
(% of total lipids) of all the DHA-positive seeds. c. Average PUFA
content (% of total lipids) of all the DHA-positive seeds. d.
Average % ratio of DHAn-3/total LC-PUFA (DHA + DPAn-6). e. Highest
DHA content observed in a single seed.
[0312] The developing seed from an additional event was analyzed
and found to contain DHA but the mature plant yielded insufficient
T.sub.1 seed for further analysis. The long chain polyunsaturated
fatty acids (LC-PUFA) peak identities were confirmed by mass
spectrometry analysis and compared with authentic standards
(Nu-Chek Prep, Elysian Minn.).
[0313] The single seed analysis for DHA content of T.sub.1 seeds
from one event (Event 5197[14]-032.002) is shown in FIG. 5. Single
seeds contained up to 1% DHA (as % of total FAMEs). The DHA levels
appear to segregate into three classes (0, .about.0.4% and
.about.0.9% DHA) reflecting segregation of a single locus
containing the DHA-producing genes.
[0314] These data indicate that DHA was produced in plants
transformed with plasmids pDAB7361, pDAB7362 and pDAB7363. The
pDAB7362 plasmid contains plant-optimized versions of all five
genes (encoding PUFA synthase OrfA, PUFA synthase OrfB, PUFA
synthase chimeric OrfC, acyl-CoA synthetase and 4'
phosphopantetheinyl transferase HetI) driven by the Phaseolus
vulgaris phytohaemagglutinin-L gene promoter. In pDAB7361, a native
gene sequence of PUFA synthase OrfA (SzOrfA v2) replaces the
plant-optimized version (SzOrfA v3). pDAB7363 is also similar to
pDAB7362 except that a Arabidopsis thaliana Ribulose Bisphosphate
Carboxylase small chain 1A chloroplast transit peptide is added to
the N-terminus of PUFA synthase OrfA, PUFA synthase OrfB, PUFA
synthase chimeric OrfC, and 4' phosphopantetheinyl transferase HetI
to target these polypeptides to the plastid.
Example 7
Detection of PUFA Synthase Proteins in Canola Seed
[0315] PUFA synthase polypeptides were detected in mature
transgenic seed samples by Western blot. Seed was prepared for
analysis by cracking dry seed with 2 stainless steel beads in a
Kleco Bead Beater (Garcia Machine, Visalia, Calif.). Extraction
buffer was added (50 mM Tris, 10 mM EDTA, 2% SDS) and sample tubes
were rocked gently for 30 minutes. Samples were centrifuged for 30
minutes at 3000 ref. The supernatant was collected and used for
analysis. The amount of total soluble protein in the seed extract
was determined by Lowry assay (BioRad, Hercules, Calif.). Samples
were normalized to 1.55 mg/ml total soluble protein and prepared in
LDS sample buffer (Invitrogen, Carlsbad, Calif.) with 40 mM DTT for
a normalized load of 20 .mu.g total soluble protein per lane.
Samples were electrophoresed in 3-8% Tris acetate gels (Invitrogen,
Carlsbad, Calif.) and transferred to nitrocellulose membranes.
Blots were blocked in blocking buffer and probed with antibodies
against the different PUFA synthase OrfA, OrfB and OrfC
polypeptides. The Rabbit anti-A2-A which is directed against the A2
region of Schizochytrium PUFA Synthase subunit A (SzPUFS-A) and the
Rabbit anti-B3-A which is directed against the B3 region of
Schizochytrium PUFA Synthase subunit B (SzPUFS-B) were used. Region
B3 is the Enoyl Reductase (ER) region. There is also an ER region
in subunit C, so this antiserum will recognize both subunits B and
C on a western blot. An anti-rabbit fluorescent labeled secondary
antibody (Goat Anti-Rabbit AF 633 (Invitrogen, Carlsbad, Calif.))
was used for detection. Blots were visualized on a Typhoon Trio
Plus fluorescent imager (GE Healthcare, New Brunswick N.J.).
[0316] SDS-PAGE western blots of extracts from late stage (>30
DAP) developing T1 seed from event 5197[14]-032.002 showed bands at
the appropriate size when probed with Orf A, Orf B and Orf C
specific antisera (FIG. 6). These bands could also be seen by
direct staining with Coomassie Blue. Orf A, Orf B and Orf C have
also been detecting in seed samples from DHA producing events
5197[13]-010.001, 5197[21]-052.001, 5197[21]-053.001 and
5217[6]-065.002.
[0317] A set of developing T2 seed samples collected 15, 20, 25,
30, 35, and 42 days after pollination (DAP) from DHA-producing
canola event 5197[14]-032.002.Sx002 were analyzed for lipid content
(FIG. 7a) and the presence of the OrfA, OrfB and OrfC polypeptides
by western blot (FIG. 7b).
[0318] Expression of all three polypeptides was detected in
developing seed at 30 and 35 days after pollination, and
prominently detected at 42 days after pollination and in the mature
seed (FIGS. 7a and 7b).
Example 8
DHA, DPA and EPA Levels in T.sub.2 Canola Seeds
[0319] T.sub.1 seeds from Event 5197[14]-032.002 were planted in
the greenhouse and leaf samples were taken from 96 plants at the
4-5 leaf stage for DNA analysis to determine the number of copies
of the transgene in each T.sub.1 segregant plant. This was
performed by Hydrolysis probe assays of the pat gene, using the
protocol described above, and identified three distinct classes of
segregants; 21 homozygous, 45 heterozygous and 30 null plants. All
of the homozygous and 31 null plants were grown to maturity in the
greenhouse and the seed harvested. Average T.sub.2 seed yield per
plant from the homozygous and null plants were 7.36 gm and 8.61 gm
respectively.
[0320] The long-chain polyunsaturated fatty acids (LC-PUFA) content
of T.sub.2 seeds from the greenhouse-grown T.sub.1 plants of Event
5197[14]-032.002 were determined in bulk extractions of 8-12 seeds
by GC-FAME analysis, as previously described. 21 null segregant
plants were also grown to maturity as controls. The LC-PUFA content
of the homozygous plants is shown in FIG. 8. No LC-PUFAs were
detected in seeds from any of the null segregants. Twenty of the
transgenic lines produced between 0.28% and 0.90% DHA in the bulk
seed analyses and one line failed to produce any LC-PUFA. The
DHA-containing seeds also contained between 0.09 and 0.34% DPA
(n-6). The average proportion of DHA in total PUFA (DHA+DPA) was
77%.
[0321] The fatty acid composition of seed from four lines producing
over 0.7% DHA is shown in Table 13 in comparison with that from
four null segregant lines
TABLE-US-00013 TABLE 13 Fatty acid composition of bulk T2 seeds
from four transgenic lines and four null segregants from Event
5197[14]-032.002. Line ID Zygosity C14:0 C16:0 C16:1 C18:0 C18:1
C18:2 C18:3 5197-[14]- HOMO 0.05 3.49 0.24 1.69 76.33 10.87 3.80
032.002.Sx002.012 5197-[14]- HOMO 0.07 3.50 0.24 1.67 76.10 11.39
3.63 032.002.Sx002.093 5197-[14]- HOMO 0.05 3.43 0.24 1.87 77.73
9.72 3.48 032.002.Sx002.050 5197-[14]- HOMO 0.06 3.48 0.24 1.70
75.53 11.63 3.73 032.002.Sx002.010 5197-[14]- NULL 0.06 3.59 0.23
1.68 76.56 12.08 3.24 032.002.Sx002.011 5197-[14]- NULL 0.06 3.63
0.25 1.60 76.28 12.21 3.33 032.002.Sx002.032 5197-[14]- NULL 0.05
3.74 0.25 1.61 77.46 10.78 3.35 032.002.Sx002.037 5197-[14]- NULL
0.06 3.61 0.24 1.61 75.83 12.54 3.67 032.002.Sx002.048 Line ID
Zygosity C20:0 C20:1 C22:0 C22:1 C24:0 C22:5 C22:6 5197-[14]- HOMO
0.67 1.25 0.39 0.02 0.18 0.28 0.74 032.002.Sx002.012 5197-[14]-
HOMO 0.60 1.21 0.33 0.02 0.16 0.32 0.77 032.002.Sx002.093
5197-[14]- HOMO 0.70 1.18 0.39 0.02 0.19 0.20 0.80
032.002.Sx002.050 5197-[14]- HOMO 0.62 1.22 0.36 0.02 0.16 0.34
0.90 032.002.Sx002.010 5197-[14]- NULL 0.68 1.29 0.37 0.03 0.20
0.00 0.00 032.002.Sx002.011 5197-[14]- NULL 0.67 1.31 0.40 0.03
0.23 0.00 0.00 032.002.Sx002.032 5197-[14]- NULL 0.70 1.37 0.42
0.01 0.26 0.00 0.00 032.002.Sx002.037 5197-[14]- NULL 0.64 1.24
0.35 0.01 0.19 0.00 0.00 032.002.Sx002.048
[0322] Single seed analysis of 48 T.sub.2 seeds from six lines of
these homozygous T.sub.1 plants (4, 35, 63, 96, 50, and 106) was
performed. Detailed analysis of the GC-FAME profile showed that an
additional peak was consistently present in seeds containing DHA
and DPA. This was identified as C20:5(n-3) EPA by comparison with
an authentic standard (NU-Chek). The retention time matched that
for authentic EPA (C20:5 (n-3)) and the nominal molecular mass
determined by GC-MS via the PolarisQ was identical.
[0323] A summary of the LC-PUFA of the single T.sub.2 seed analyses
from the six lines is shown in FIG. 9. Single seeds with DHA
content up to 1.6% were found. In addition plants with EPA content
up to 0.27% were identified.
[0324] Reciprocal crosses were made between two T.sub.1 lines and
untransformed Nexera710. The resulting parent and 1 hybrid seeds
were analyzed for DHA content (FIG. 10). In FIG. 10, diamonds
represent the mean ANOVA for each category described on the X axis.
The vertical bar represents the mean for the category and the
distance between the extreme of the diamond is the 95% confidence
interval. The average level of DHA accumulation in F1 seed (0.29%
and 0.28%) is half of what the transgenic parent seed are
accumulating (0.51% and 0.47%). A quantitative correlation of the
phenotype and zygosity level can be deduced from this result.
[0325] In summary, these data show that the DHA trait conferred by
the five transgenes is heritable and is maintained into a second
generation.
Example 9
DHA Production in Canola Event-10 T2 Seed
[0326] Sixty T.sub.1 seeds from canola event 5197[13]-010.001
(containing, two copies of the pat gene as shown in FIG. 11) were
planted in the greenhouse. Hydrolysis probe assays of the pat gene
identified five distinct classes of segregants corresponding to 0-4
copies of the pat gene.
[0327] The two loci corresponding to the transgenic inserts could
be distinguished by Southern blot analysis (denoted locus A and B).
DNA from all of the plants containing two pat copies were analyzed
by Southern blot to determine their genotype (homozygous for locus
A or locus B, or hemizygous for both loci). Four single copy and
two null control plants were also analyzed as controls. All of the
T.sub.1 plants were grown to maturity in the greenhouse. The seed
was harvested and analyzed in bulk seed analyses for LC-PUFA
content (Table 14).
TABLE-US-00014 TABLE 14 LC-PUFA content of T.sub.2 seeds from
T.sub.1 segregants from Event 5197[13]-010.001 (Means were compared
by Tukey-Kramer HSD Test and levels not connected with same latter
are significantly different.) Average LC-PUFA Statis- PAT # of T1
Content tical Copy plants % total Signif- Genotype # analyzed FAMEs
SE icance Null 0 5 0.00 0.07 d Hemizygous at locus A 1 2 0.47 0.11
ab Hemizygous at locus B 1 2 0.02 0.11 bcd Hemizygous at locus 2 13
0.15 0.04 bcd A & B Homozygous at locus A 2 4 0.65 0.08 a
Homozygous at locus B 2 5 0.00 0.07 cd Homozygous at one 3 13 0.03
0.04 d locus, hemizygous at the other Homozygous Locus 4 5 0.00
0.07 d A & B
[0328] These data show that plants that are homozygous at Event
5197[13]-010.001 locus A direct the production of LC-PUFA whereas
locus B homozygotes do not. Furthermore locus B interferes with
LC-PUFA production as four-copy double homozygotes produce very low
levels of DHA as do the three-copy plants. Similarly hemizygous
single-copy locus A plants produce 0.47% LC-PUFA, whereas
hemizygous single-copy locus B produce very low levels of LC-PUFA
(0.02%).
[0329] The complete fatty composition determined by GC-FAME
analysis of the bulk T2 seed from plants derived from event Event
5197[13]-010.001 that were homozygous at locus A (and null for
locus B) is shown in Table 15.
TABLE-US-00015 TABLE 15 Fatty acid composition of T.sub.2 seed from
event Event 5197[13]-010.001 homozygous at locus A Line ID C14:0
C16:0 C16:1 C18:0 C18:1 C18:2 C18:3 C20:0 5197 [13]- 0.05 3.46 0.23
0.57 79.40 10.23 3.09 0.65 010.Sx001.008 5197 [13]- 0.05 3.53 0.25
1.42 78.36 10.57 3.17 0.61 010.Sx001.015 5197 [13]- 0.05 3.60 0.24
1.72 77.40 10.73 3.15 0.59 010.Sx001.050 5197 [13]- 0.05 3.63 0.26
1.48 78.41 10.32 3.01 0.58 010.Sx001.051 Line ID C20:1 C22:0 C22:1
C20:5 C24:0 C22:5 C22:6 5197 [13]- 1.28 0.38 0.02 0.04 0.20 0.12
0.28 010.Sx001.008 5197 [13]- 1.07 0.32 0.02 0.04 0.16 0.12 0.31
010.Sx001.015 5197 [13]- 0.99 0.28 0.03 0.05 0.13 0.33 0.70
010.Sx001.050 5197 [13]- 1.11 0.34 0.02 0.04 0.15 0.18 0.41
010.Sx001.051
Example 10
Field Production of DHA in Canola
[0330] The T.sub.2 seed from ten homozygous lines of
5197[14]-032.002 that contained the highest levels of DHA were
pooled to yield 60 gm of seed. Seed was also pooled from 10 null
segregant lines to give 47 gm of seed for use as a negative
control. The seed was planted at two locations in North Dakota in
May 2009 with 8 plots of the transgene-containing seed, 6 plots of
null segregant seed and two plots of a commercial control (Nexera
845CL) at each location. All of the transgenic plant plots and four
of the null segregant plots were covered with isolation cages
during flowering. The remaining two null plots and the Nexera 845CL
plots were left uncovered. The plots were swathed and harvested in
September according to normal practices. At Site 1, a plot average
of 0.95 kg of seed was obtained from transgenic plants and 0.99 kg
from the null plants. At Site 2, plot averages were 0.64 kg from
transgenic plants and 0.73 kg from nulls. GC-FAME lipid analysis of
seed from each plot was performed to determine the levels of
LC-PUFAs in the field-grown seed (Table 16).
TABLE-US-00016 TABLE 16 T3 seed DHA content by 10-seed bulk
analysis from field-grown T.sub.2 plants of 5197[14]-032.002.
Average DHA Average LC-PUFA content content Site Plot (% total
FAMEs) (% Total FAMEs) Site 1 1-11 (homo) 0.01% 0.02% Site 1 1-12
(homo) 0.18% 0.27% Site 1 1-17 (homo) 0.13% 0.19% Site 1 1-18
(homo) 0.21% 0.33% Site 1 1-21 (homo) 0.17% 0.26% Site 1 1-23
(homo) 0.21% 0.32% Site 1 1-27 (homo) 0.30% 0.44% Site 1 1-28
(homo) 0.15% 0.23% Site 1 1-13 (sib null) 0.00% 0.00% Site 1 1-15
(sib null) 0.00% 0.00% Site 1 1-16 (sib null) 0.00% 0.00% Site 1
1-22 (sib null) 0.00% 0.00% Site 1 1-24 (sib null) 0.00% 0.00% Site
1 1-26 (sib null) 0.00% 0.00% Site 1 1-25_Nexera845 0.00% 0.00%
Site 2 2-11 (homo) 0.24% 0.37% Site 2 2-13 (homo) 0.19% 0.27% Site
2 2-17 (homo) 0.23% 0.36% Site 2 2-18 (homo) 0.32% 0.48% Site 2
2-21 (homo) 0.38% 0.56% Site 2 2-23 (homo) 0.27% 0.41% Site 2 2-26
(homo) 0.33% 0.47% Site 2 2-28 (homo) 0.16% 0.24% Site 2 2-12 (sib
null) 0.00% 0.00% Site 2 2-14 (sib null) 0.00% 0.00% Site 2 2-16
(sib null) 0.00% 0.00% Site 2 2-22 (sib null) 0.00% 0.00% Site 2
2-25 (sib null) 0.00% 0.00% Site 2 2-27 (sib null) 0.00% 0.00% Site
2 2-15_Nexera845 0.00% 0.00%
[0331] The results from Table 16 represent an analysis of three
samples from each plot. Seed from plot 1-11 contained lower levels
of 18:1 (65.5%) and higher levels of 18:3 (7.6%) compared to other
Site 1 plots (average 76.7% 18:1 and 2.9% 18:3), and was therefore
considered to be extensively contaminated with conventional canola.
This plot was excluded from subsequent analyses. The average DHA
content by 10-seed bulk analyses of the T.sub.3 seed from the
transgenic plants from Site 1 was 0.19% and from Site 2 was 0.26%.
The highest DHA content was 0.38% (with 0.03% EPA). The average %
ratio of n-3 LC-PUFA/Total PUFAs was 73%.
[0332] Samples of each T.sub.2 line used in the field trial were
also grown in the greenhouse. The average DHA content by 10-seed
bulk analyses of the T.sub.3 greenhouse seed was 0.22% with
individual plants having up to 0.8% DHA. This correlates with the
amount of DHA produced in the field.
[0333] These data slow that the subject PUFA synthase gene suite
can direct production of DHA under field conditions.
Example 11
DHA Gene Expression Analysis Using Microarray Technology
[0334] Developing canola seeds were collected from a transgenic
homozygous Event 5197[14]-032.002 line and untransformed null
plants at 15, 20, 25, 30, 35 and 42 days after pollination (DAP). A
single-color global gene expression profiling design was used to
determine the levels of expression of each of the newly introduced
genes into the homozygous transformed line in relation to the
untransformed null line for each of the defined time points during
seed development. Three identical technical replicates of
individual 60-mer oligo arrays (Agilent Technologies Inc., Santa
Clara, Calif.) were hybridized with amplified, Cy3 labeled cRNA
from each sample. A custom designed (eArray, Agilent Technologies
Inc., Santa Clara, Calif.) 60-mer comprehensive transcriptome-wide
canola oligonucleotide array was used to carry out the
hybridizations previously described. This array contains more than
37,000 different canola transcripts (Agilent Technologies Inc.,
Santa Clara, Calif.) obtained from public data sources. To
efficiently measure the expression levels of each transcript, the
oligos present in the array were designed to be unique and specific
for each target to efficiently hybridize with the predicted target
sequence. Oligos that form a duplex with more than one transcript
were eliminated from the array. Each oligo also fulfills the
chemical and physical properties required for optimal performance
throughout microarray processing. In addition, specific and unique
oligos representing the newly introduced genes as well as several
other genes of interest are also represented in the custom designed
canola oligo array. The 60-mer oligos were synthesized in-situ
using the Sure-Print technology from the manufacturer.
RNA Isolation and Purification
[0335] Samples of developing seeds from Event 5197[14]-032.002 and
a null plant control were frozen and pooled to be used as starting
material for RNA isolation and purification. A total of 500 mgs of
seed tissue per pooled sample were ground with liquid nitrogen
using a mortar and pestle and approximately 50 mgs of the ground
tissue were resuspended in 450 .mu.L of extraction buffer RLT from
the RNeasy Kit for RNA extraction (Qiagen, Valencia, Calif.).
Samples were vortexed briefly to disrupt tissues before continuing
with the extraction protocol. Total RNA was purified following the
instructions from the RNeasy Kit for RNA extraction (Qiagen,
Valencia, Calif.). Purified total RNA was then quantified using a
NanoQuant (TECAN, Research Triangle Park, N.C.) spectrophotometer
and visualized by standard 1% Agarose gel electrophoresis.
[0336] For labeling, a total of 1.0 .mu.g of purified total RNA
from each sample was reverse transcribed, amplified and labeled
with Cy3-CTP following the Agilent (Santa Clara, Calif.) One-color
microarray-based gene expression QuickAmp labeling protocol. Since
each canola array contains more than 1300 internal spike-in
controls a One-color RNA spike-in kit (Agilent, Santa Clara,
Calif.) was also labeled according to manufacturer's instructions.
Samples were reverse transcribed using MMLV Reverse Transcriptase
and amplified using a T7 RNA Polymerase. After amplification cRNA
was purified using Qiagen's RNeasy mini spin columns and quantified
using a NanoQuant spectrophotometer (TECAN, Research Triangle Park,
N.C.). Specific activity for Cy3 was determined by the following
formula: (Concentration of Cy3/(Concentration of cRNA)*1000=pmol of
Cy3 per .mu.g of cRNA. Samples for hybridization were normalized to
1.65 .mu.gs with a specific activity of >9.0 pmol of Cy3 per
.mu.g of cRNA.
Hybridization, Scanning and Feature Extraction
[0337] Oligo gene expression arrays were hybridized using the
Agilent Technologies (Santa Clara, Calif.) Gene Expression
Hybridization kit and Wash Buffer kit. Hybridizations were carried
out on a fully automated TECAN HS4800 PRO (TECAN, Research Triangle
Park, N.C.) hybridization station. The hybridization mixture was
injected at 65.degree. C. and incubated with agitation for 17 hrs
after following a slide pre-hybridization step at 65.degree. C. for
30 seconds. Slides were then washed at 37.degree. C. for 1 minute
using the Agilent GE Wash #1 followed by a second wash at
30.degree. C. with Agilent GE Wash #2 for 1 minute and a final
drying step using Nitrogen gas for 2 minutes and 30 seconds at
30.degree. C. Slides were scanned immediately to minimize impact of
environmental oxidants on signal intensities.
[0338] Arrays were scanned using an Agilent G2565CA microarray
scanner with SureScan high resolution technology (Agilent
Technologies, Santa Clara, Calif.). The protocol for scanning each
array defines parameters for dye channel, scan region and
resolution, TIFF file dynamic range, PMT gain and the setting for
the final image outcome. Once the array has been scanned a feature
extraction (FE) protocol is followed, using parameters defined for
placing and optimizing the grid fit, finding the spots, flagging
outliers, computing background bias, error and ratios, and
calculating quality control metrics. After scanning and feature
extraction protocols are completed, a TIFF file containing the Cy3
image is generated along with a quality control metrics report and
a final file (TXT) containing all the raw data. The image files
(TIFF) were used to examine general quality of the slides, presence
of spike-in controls in the right positions (four corners) and
intensities, as well as to confirm that hybridization, washing,
scanning and feature extraction processes were successful. The FE
quality control (QC) report provided values of coefficient of
variation allowing to measure dispersion of data based on positive
and negative (prokaryotic genes and artificial sequences) spike-in
controls provided and designed by Agilent Technologies (Santa
Clara, Calif.). This report also provided information about data
distribution, uniformity, background, reproducibility, sensitivity
and general quality of data. The TXT file containing all the raw
data was uploaded into GeneSpring (Agilent, Santa Clara Calif.) for
further analysis.
Data Normalization and Statistical Analysis
[0339] After scanning and feature extraction, raw data files were
uploaded into GeneSpring GX version 10.0.2 (Agilent Technologies,
Santa Clara, Calif.) and a project was created defining each array
data file as a sample and assigning the appropriate parameter
values. Samples with the same parameter values were treated as
replicates. Interpretations were created to specify how the samples
were grouped into experimental conditions and were used to
visualize and analyze data. Quality control on samples based on
spike-in controls, parameters and interpretations previously
defined, was performed to ensure quality of data before starting
analysis and a quality control metrics report by GeneSpring was
generated.
[0340] Data was normalized using a global percentile shift
normalization method to minimize systematic non-biological
differences and standardize arrays for cross comparisons. This
algorithm transformed signal intensities to log base 2 and arranged
them in increasing order, computing the rank of the 75.sup.th
percentile and subtracting this value from each of the log
transformed signal intensities generating the normalized intensity
value. Data was filtered by selecting entities that were flagged as
Present in every single sample under study and eliminating entities
flagged as Marginal or Absent. The filtered and normalized list of
entities was used as input for statistical analysis using a Two Way
ANOVA method with a corrected p-value cut-off of p<0.05 defining
DAP and Genotype as parameters. The expression profile for each of
the newly introduced genes was determined.
Results
[0341] The values obtained for concentration of total RNA as well
as labeled and amplified cRNA were optimal. Also the values for
concentration after amplification, efficiency of labeling with Cy3
and specific activity required for consistent and reliable results
were excellent. The quality control (QC) report provided by the
feature extraction protocol for each individual array after
scanning provided values of coefficient of variation that were used
to measure dispersion of data based on positive and negative
spike-in controls. All the values obtained from the reports showed
optimal quality of data distribution, uniformity, background and
sensitivity. The GeneSpring (Agilent Technologies, Santa Clara,
Calif.) quality control metrics report on samples used during this
study provided significant statistical values that assisted in the
evaluation of reproducibility and reliability of the data obtained.
The reported values for the groups of technically replicated arrays
(3 per sample) were within range and indicated that the data
obtained was reliable (Data not shown).
[0342] The raw values reported for each of the six time points
defined during seed development for the homozygote (Table 17)
("DAP" represents days after pollination) and null (Table 18) lines
represent the signal intensity values left after all the feature
extraction (FE) processing steps have been completed including
background subtraction and multiplicative detrending when
necessary. Normalized values for homozygote (Table 19) and null
(Table 20) lines on the other hand, have been processed using a
global percentile shift normalization method that accounts for
technical variation, minimizes systematic non-biological
differences and standardizes arrays for cross comparisons.
TABLE-US-00017 TABLE 17 Raw intensity values of expression for each
of the newly introduced genes in the homozygote Event
5197[14]-032.002. Oligo ID Contig_ID 15 DAP 20 DAP 25 DAP 30 DAP 35
DAP 42 DAP BnOL1037472 SzPUFA_OrfA_v2 550.5884 1555.393 10616.878
55336.754 53827.918 168238.69 BnOL1037031 SzACS-2_v3 735.7014
7502.7305 53598.45 160619.44 125797.09 149734.28 BnOL1037030
hSzThPUFA_OrfC_v3 278.55338 6337.2075 41672.094 101111.23 65916.695
79815.85 BnOL1037032 NoHetl_v3 438.25513 2608.736 22412.197
84830.35 72039.04 81936.24 BnOL1037029 SzPUFA_OrfB_v3 20.972246
319.27515 3329.6416 8812.985 4742.8223 9504.665 BnOL1037034 PAT_v5
1433.2236 3672.4446 6221.7075 6744.2925 1784.8667 5964.65
TABLE-US-00018 TABLE 18 Raw intensity values of expression for each
of the newly introduced genes in the null untransformed Omega-9
Nexera 710 line. Oligo ID Contig_ID 15 DAP 20 DAP 25 DAP 30 DAP) 35
DAP 42 DAP BnOL1037472 SzPUFA_OrfA_v2 24.637857 13.909026 18.128113
17.591684 21.86625 22.927202 BnOL1037031 SzACS-2_v3 4.892006
1.9428447 4.488978 4.234072 33.388905 5.6000123 BnOL1037030
hSzThPUFA_OrfC_v3 19.027159 14.894593 24.208069 20.789322 20.698792
16.794432 BnOL1037032 NoHetl_v3 3.1428213 1.9340261 4.188954
3.1923647 17.189857 4.665717 BnOL1037029 SzPUFA_OrfB_v3 2.3353922
3.9272563 6.6409183 3.3479385 3.8365993 32.812595 BnOL1037034
PAT_v5 3.3936017 2.7436378 4.193728 35.491924 11.871919
27.160715
TABLE-US-00019 TABLE 19 Normalized intensity values of expression
for each of the newly introduced genes in the homozygote Event
5197[14]-032.002. Oligo ID Contig_ID 15 DAP 20 DAP 25 DAP 30 DAP 35
DAP 42 DAP BnOL1037472 SzPUFA_OrfA_v2 1.7016697 3.3545377 6.0190024
8.880801 9.054455 11.272922 BnOL1037031 SzACS-2_v3 1.8789514
5.3857155 8.116115 10.176245 10.039913 10.870583 BnOL1037030
hSzThPUFA_OrfC_v3 1.4449383 6.1070085 8.718198 10.475076 10.072738
10.922383 BnOL1037032 NoHetl_v3 1.887683 4.618933 7.613214 10.01268
9.989469 10.756434 BnOL1037029 SzPUFA_OrfB_v3 -0.7546156 3.3309612
6.6095963 8.492256 7.811666 9.391258 BnOL1037034 PAT_v5 1.9656178
3.4748821 4.1320724 4.72564 3.0201833 5.337647
TABLE-US-00020 TABLE 20 Normalized intensity values of expression
for each of the newly introduced genes in the null untransformed
Omega-9 Nexera 710 line. Oligo ID Contig_ID 15 DAP 20 DAP 25 DAP 30
DAP 35 DAP 42 DAP BnOL1037472 SzPUFA_OrfA_v2 -2.6522558 -3.253315
-3.0071614 -2.8780248 -2.3888729 -2.038585 BnOL1037031 SzACS-2_v3
-5.3231525 -6.39583 -5.3554688 -5.8499255 -1.9909037 -4.2954717
BnOL1037030 hSzThPUFA_OrfC_v3 -2.3083773 -2.42181 -1.8761693
-1.9263924 -1.7606672 -1.6746639 BnOL1037032 NoHetl_v3 -5.2632127
-5.647943 -4.671536 -5.151732 -2.2263987 -3.93217 BnOL1037029
SzPUFA_OrfB_v3 -3.8752975 -2.9589367 -2.3685415 -3.026766 -2.905297
0.8310469 BnOL1037034 PAT_v5 -6.7221875 -6.835022 -6.305078
-3.753248 -4.357948 -2.8239324
[0343] The schematic representation of the raw (FIG. 12) and
normalized (FIG. 13) values obtained for the null line at every
time point during seed development confirm that these genes are not
present in the Omega-9 Nexera 710 untransformed line and therefore
significant expression is not detected. In the Event
5197[14]-032.002 line as shown in FIG. 14 (raw) and FIG. 15
(normalized), a general trend of increasing transcript accumulation
of all genes as seed development progresses can be observed. The
initial significant increase of transcript accumulation occurs
during 15 and 30 DAP and reaches maximum levels at DAP 42. The raw
curves showed in FIG. 14, provide a visualization of the relative
hybridization intensity values obtained for each of the genes under
study, while the normalized curves summarized in FIG. 15 represent
the general trend of gene expression profiles with minimized
systematic non-biological variation and standardized comparisons
across arrays.
Example 12
Expression of the Algal PUFA Synthase Gene Suite Using Alternative
Promoters
[0344] The use of additional transcriptional regulatory elements to
express the gene(s) encoding PUFA synthase OrfA, PUFA synthase
OrfB, PUFA synthase chimeric OrfC, acyl-CoA synthetase and 4'
phosphopantetheinyl transferase HetI proteins can further increase
DHA content within canola. Identification and use of
transcriptional regulatory elements which express earlier in
development and for extended periods of time can increase the
levels of DHA within canola seed by promoting transcription of a
heterologous gene at earlier stages of seed development (e.g., at
15 to 25 DAP) and therefore extend the time of DHA production.
Examples of such transcriptional regulatory regions include, but
are not limited to, the LfKCS3 promoter (U.S. Pat. No. 7,253,337)
and FAE 1 promoter (U.S. Pat. No. 6,784,342) and the ACP promoter
(WO 1992/18634). These promoters are used singularly or in
combination to drive the expression of the PUFA synthase OrfA, PUFA
synthase OrfB, PUFA synthase chimeric OrfC, acyl-CoA synthetase and
4' phosphopantetheinyl transferase HetI expression cassettes, which
were previously described in the following plasmids; pDAB7361,
pDAB7362, and pDAB7363. Methods to replace transcriptional
regulatory regions within a plasmid are well known within the art.
As such, a polynucleotide fragment comprising the PvDlec2 promoter
v2 is removed from pDAB7361, pDAB7362, or pDAB7363 (or the
preceding plasmids used to build pDAB7361, pDAB7362, or pDAB7363)
and replaced with either LfKCS3 or the FAE 1 promoter regions. The
newly constructed plasmids are used to stably transform canola
plants. Transgenic canola plants are isolated and molecularly
characterized. The resulting LC-PUFA accumulation is determined and
canola plants which produce 0.01% to 15% DHA or 0.01% to 10% EPA
are identified.
Construction of pDAB9166
[0345] The pDAB9166 plasmid (FIG. 26; SEQ ID NO:46) was constructed
using a multi site Gateway L-R recombination reaction. pDAB9166
contains three PUFA synthase PTUs, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the LfKCS3
promoter v1, SzPUFA OrfA v3 and AtuORF23 3' UTR v1. The second PUFA
synthase PTU contains the LfKCS3 promoter v1, SzPUFA OrfB v3 and
AtuOrf23 3' UTR v1. The third PUFA synthase PTU contains the LfKCS3
promoter v1, hSzThPUFA OrfC v3 and AtuORF23 3' UTR v1. The
phosphopantetheinyl transferase PTU contains the LfKCS3 promoter
v1, NoHetI' v3 and AtuORF23 3' UTR v1.
[0346] Plasmids pDAB9161, pDAB9162, pDAB9163, pDAB101484 and
pDAB7333 were recombined to form pDAB9166. Specifically, the four
PTUs described above were placed in a head-to-tail orientation
within the T-strand DNA border regions of the plant transformation
binary pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA
OrfB v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB9167
[0347] The pDAB9167 plasmid (FIG. 27; SEQ ID NO:47) was constructed
using a multi-site Gateway L-R recombination reaction. pDAB9167
contains three PUFA synthase PTUs, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the LfKCS3
promoter v1, SzPUFA OrfA v3 and AtuORF23 3' UTR v1. The second PUFA
synthase PTU contains the BoACP promoter v1, BoACP 5' UTR v1,
SzPUFA OrfB v3 and AtuOrf23 3' UTR v1. The third PUFA synthase PTU
contains the LfKCS3 promoter v1, hSzThPUFA OrfC v3 and AtuORF23 3'
UTR v1. The phosphopantetheinyl transferase PTU contains the BoACP
promoter v1, BoACP 5' UTR v1, NoHetI v3 and AtuORF23 3' UTR v1.
[0348] Plasmids pDAB9161, pDAB9165, pDAB9163, pDAB101485 and
pDAB7333 were recombined to form pDAB9167. Specifically, the four
PTUs described above were placed in a head-to-tail orientation
within the T-strand DNA border regions of the plant transformation
binary pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA
OrfB v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB7379
[0349] pDAB7379 is a binary plasmid that was constructed to contain
rebuilt, codon optimized versions of SzPUFA OrfA, SzPUFA OrfB,
hSzThPUFA OrfC, and NoHetI. The SzACS-2 gene sequence is not
included in this construct. The pDAB7379 plasmid (FIG. 28; SEQ ID
NO:48) was constructed using a multi-site Gateway L-R recombination
reaction.
[0350] pDAB7379 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvPhas Promoter v3, PvPhas 5' UTR, SzPUFA OrfA v3 and AtuORF23
3' UTR v1. The second PUFA synthase PTU contains the PvPhas
Promoter v3, PvPhas 5' UTR, SzPUFA OrfB v3 and AtuORF23 3' UTR v1.
The third PUFA synthase PTU contains the PvPhas Promoter v3, PvPhas
5' UTR, hSzThPUFA OrfC v3 and AtuORF23 3' UTR v1. The
phosphopantetheinyl transferase PTU contains the PvPhas Promoter
v3, PvPhas 5' UTR, NoHetI v3 and AtuORF23 3' UTR v1.
[0351] Plasmids pDAB7371, pDAB7372, pDAB7373, pDAB7374 and pDAB7333
were recombined to form pDAB7379. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB7380
[0352] pDAB7380 is a binary plasmid that was constructed to contain
rebuilt, codon optimized versions of SzPUFA OrfA, SzPUFA OrfB,
hSzThPUFA OrfC, and NoHetI. The SzACS-2 gene sequence is not
contained in this construct. The version of the phaseolin promoter
used in this construct was modified essentially as described in
Bustos et al., 1989 (The Plant Cell, Vol. 1; 839-853), wherein the
5' portion of the promoter was truncated and the phaseolin 5'
untranslated region was left intact. The pDAB7380 plasmid (FIG. 29;
SEQ ID NO:49) was constructed using a multi-site Gateway L-R
recombination reaction.
[0353] pDAB7380 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvPhas Promoter v4, PvPhas 5' UTR, SzPUFA OrfA v3 and AtuORF23
3' UTR v1. The second PUFA synthase PTU contains the PvPhas
Promoter v4, PvPhas 5' UTR, SzPUFA OrfB v3 and AtuORF23 3' UTR v1.
The third PUFA synthase PTU contains the PvPhas Promoter v4, PvPhas
5' UTR, hSzThPUFA OrfC v3 and AtuORF23 3' UTR v1. The
phosphopantetheinyl transferase PTU contains the PvPhas Promoter
v5, PvPhas 5' UTR, NoHetI v3 and AtuORF23 3' UTR v1.
[0354] Plasmids pDAB7375, pDAB7376, pDAB7377, pDAB7378 and pDAB7333
were recombined to form pDAB7380. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB9323
[0355] pDAB9323 is a binary plasmid that was constructed to contain
native, non-codon optimized versions of SzPUFA OrfA, SzPUFA OrfB,
hSzThPUFA OrfC, SzACS-2, and NoHetI. The pDAB9323 plasmid (FIG. 30;
SEQ ID NO:50) was constructed using a multi-site Gateway L-R
recombination reaction.
[0356] pDAB9323 contains three PUFA synthase PTUs, one acyl-CoA
synthetase PTU, one phosphopantetheinyl transferase PTU and a
phosphinothricin acetyl transferase PTU. Specifically, the first
PUFA synthase PTU contains the PvPhas Promoter v3, PvPhas 5' UTR,
SzPUFA OrfA v2, PvPhas 3' UTR v1 and PvPhas 3' MAR v2 (unannotated
on the plasmid map). The second PUFA synthase PTU contains the
PvPhas Promoter v3, PvPhas 5' UTR, SzPUFA OrfB v2, PvPhas 3' UTR v1
and PvPhas 3' MAR v2 (unannotated on the plasmid map). The third
PUFA synthase PTU contains the PvPhas Promoter v3, PvPhas 5' UTR,
SzPUFA OrfC v2, PvPhas 3' UTR v1 and PvPhas 3' MAR v2 (unannotated
on the plasmid map). The acyl-CoA synthetase PTU contains the
PvPhas Promoter v3, PvPhas 5' UTR, SzACS-2 v2 gene, PvPhas 3' UTR
v1 and PvPhas 3' MAR v2 (unannotated on the plasmid map). The
phosphopantetheinyl transferase PTU contains the PvPhas Promoter
v3, PvPhas 5' UTR, NoHetI v2, PvPhas 3' UTR v1 and PvPhas 3' MAR v2
(unannotated on the plasmid map).
[0357] Plasmids pDAB9307, pDAB9311, pDAB9315, pDAB9322 and pDAB7333
were recombined to form pDAB9323. Specifically, the five PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v2, SzPUFA OrfB
v2, SzPUFA OrfC v2, NoHetI v2. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the six PTUs were then
isolated and tested for incorporation of the six PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB9330
[0358] pDAB9330 is a binary plasmid that was constructed to contain
rebuilt, codon optimized versions of SzPUFA OrfA, SzPUFA OrfB,
hSzThPUFA OrfC, SzACS-2, and NoHetI. The pDAB9330 plasmid (FIG. 31;
SEQ ID NO:51) was constructed using a multi-site Gateway L-R
recombination reaction. pDAB9330 contains three PUFA synthase PTUs,
one acyl-CoA synthetase PTU, one phosphopantetheinyl transferase
PTU and a phosphinothricin acetyl transferase PTU. Specifically,
the first PUFA synthase PTU contains the PvPhas Promoter v3, PvPhas
5' UTR, SzPUFA OrfA v3, PvPhas 3' UTR v1 and PvPhas 3' MAR v2
(unannotated on the plasmid map). The second PUFA synthase PTU
contains the PvPhas Promoter v3, PvPhas 5' UTR, SzPUFA OrfB v3,
PvPhas 3' UTR and PvPhas 3' MAR v2 (unannotated on the plasmid
map). The third PUFA synthase PTU contains the PvPhas Promoter v3,
PvPhas 5' UTR, hSzThPUFA OrfC v3, PvPhas 3' UTR v1 and PvPhas 3'
MAR v2 (unannotated on the plasmid map). The acyl-CoA synthetase
PTU contains the PvPhas Promoter v3, PvPhas 5' UTR, SzACS-2 v3
gene, PvPhas 3' UTR v1 and PvPhas 3' MAR v2 (unannotated on the
plasmid map). The phosphopantetheinyl transferase PTU contains the
PvPhas Promoter v3, PvPhas 5' UTR, NoHetI v3, PvPhas 3' UTR v1 and
PvPhas 3' MAR v2 (unannotated on the plasmid map).
[0359] Plasmids pDAB9324, pDAB9325, pDAB9326, pDAB9329 and pDAB7333
were recombined to form pDAB9330. Specifically, the five PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, SzACS-2 v3, NoHetI v3. pDAB7333 also
contains the phosphinothricin acetyl transferase PTU: CsVMV
promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to other
regulatory elements such as Overdrive and T-stand border sequences
(T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the six PTUs were then isolated and tested for
incorporation of the six PTUs with restriction enzyme digestion and
DNA sequencing.
Construction of pDAB9337
[0360] pDAB9337 is a binary plasmid that was constructed to contain
rebuilt, codon optimized versions of SzPUFA OrfA, SzPUFA OrfB,
hSzThPUFA OrfC, and NoHetI expression of which is driven by the
phaseolin promoter. The pDAB9337 plasmid (FIG. 32; SEQ ID NO:52)
was constructed using a multi-site Gateway L-R recombination
reaction.
[0361] pDAB9337 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvPhas Promoter v3, PvPhas 5' UTR, SzPUFA OrfA v3, PvPhas 3'
UTR v1 and PvPhas 3' MAR v2 (unannotated on the plasmid map). The
second PUFA synthase PTU contains the PvPhas Promoter v3, PvPhas 5'
UTR, SzPUFA OrfB v3, PvPhas 3' UTR v1 and PvPhas 3' MAR v2
(unannotated on the plasmid map). The third PUFA synthase PTU
contains the PvPhas Promoter v3, PvPhas 5' UTR, hSzThPUFA OrfC v3,
PvPhas 3' UTR v1 and PvPhas 3' MAR v2 (unannotated on the plasmid
map). The phosphopantetheinyl transferase PTU contains the PvPhas
Promoter v3, PvPhas 5' UTR, NoHetI v3, PvPhas 3' UTR v1 and PvPhas
3' MAR v2 (unannotated on the plasmid map).
[0362] Plasmids pDAB9324, pDAB9325, pDAB9326, pDAB9328 and pDAB7333
were recombined to form pDAB9337. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB9338
[0363] pDAB9338 is a binary plasmid that was constructed to contain
rebuilt, codon optimized versions of SzPUFA OrfA, SzPUFA OrfB,
hSzThPUFA OrfC, and NoHetI. The phaseolin promoter is used to drive
expression of SzPUFA OrfA, and PvDlec2 promoter is used to drive
the other transgenes. The pDAB9338 plasmid (FIG. 33; SEQ ID NO:53)
was constructed using a multi-site Gateway L-R recombination
reaction.
[0364] pDAB9338 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvPhas Promoter v3, PvPhas 5' UTR, SzPUFA OrfA v3, PvPhas 3'
UTR v1 and PvPhas 3' MAR v2 (unannotated on the plasmid map). The
second PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5'
UTR, SzPUFA OrfB v3 and At2S SSP terminator v1. The third PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA
OrfC v3 and At2S SSP terminator v1. The phosphopantetheinyl
transferase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, NoHetI
v3 and At2S SSP terminator v1.
[0365] Plasmids pDAB9324, pDAB7335, pDAB7336, pDAB7338 and pDAB7333
were recombined to form pDAB9338. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the 1-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB9344
[0366] pDAB9344 is a binary plasmid that was constructed to contain
rebuilt, codon optimized versions of SzPUFA OrfA, SzPUFA OrfB,
hSzThPUFA OrfC, and NoHetI all of which contain the Ribulose
Bisphosphate Carboxylase small chain 1A (labeled as SSU-TP v1)
which is fused to the amino terminus of the coding sequence. The
phaseolin promoter is used to drive expression of SzPUFA OrfA, and
PvDlec2 promoter is used to dive the other transgenes.
[0367] The pDAB9344 plasmid (FIG. 34; SEQ ID NO:54) was constructed
using a multi-site Gateway L-R recombination reaction. pDAB9344
contains three PUFA synthase PTUs, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvPhas
Promoter v3, PvPhas 5' UTR, SzPUFA OrfA v4, PvPhas 3' UTR v1 and
PvPhas 3' MAR v2 (unannotated on the plasmid map). The second PUFA
synthase PTU contains the PvPhas Promoter v3, PvPhas 5' UTR, SzPUFA
OrfB v4, PvPhas 3' UTR v1 and PvPhas 3' MAR v2 (unannotated on the
plasmid map). The third PUFA synthase PTU contains the PvPhas
Promoter v3, PvPhas 5' UTR, hSzThPUFA OrfC v4, PvPhas 3' UTR v1 and
PvPhas 3' MAR v2 (unannotated on the plasmid map). The
phosphopantetheinyl transferase PTU contains the PvPhas Promoter
v3, PvPhas 5' UTR, NoHetI v4, PvPhas 3' UTR v1 and PvPhas 3' MAR v2
(unannotated on the plasmid map).
[0368] Plasmids pDAB9343, pDAB9342, pDAB9340, pDAB9331 and pDAB7333
were recombined to form pDAB9344. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v4, SzPUFA OrfB
v4, hSzThPUFA OrfC v4, NoHetI v4. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the six PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB9396
[0369] pDAB9396 is a binary plasmid that was constructed to contain
rebuilt, codon optimized versions of SzPUFA OrfA, SzPUFA OrfB,
hSzThPUFA OrfC, SzACS-2, and NoHetI. The phaseolin promoter is used
to drive expression of SzPUFA OrfA and SzPUFA OrfB. The PvDlec2
promoter is used to drive the other transgenes; hSzThPUFA OrfC,
SzACS-2, and NoHetI.
[0370] The pDAB9396 plasmid (FIG. 35; SEQ ID NO:55) was constructed
using a multi-site Gateway L-R recombination reaction. pDAB9396
contains three PUFA synthase PTUs, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvPhas
Promoter v3, PvPhas 5' UTR, SzPUFA OrfA v3, PvPhas 3' UTR v1 and
PvPhas 3' MAR v2 (unannotated on the plasmid map). The second PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA
OrfB v3 and At2S SSP terminator v1. The third PUFA synthase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA OrfC v3 and
At2S SSP terminator v1. The acyl-CoA synthetase PTU contains the
PvPhas Promoter v3, PvPhas 5' UTR, SzACS-2 v3 gene, PvPhas 3' UTR
v1 and PvPhas 3' MAR v2 (unannotated on the plasmid map). The
phosphopantetheinyl transferase PTU contains the PvDlec2 promoter
v2, 2S 5' UTR, NoHetI v3 and At2S SSP terminator v1.
[0371] Plasmids pDAB9324, pDAB7335, pDAB7336, pDAB7339 and pDAB7333
were recombined to form pDAB9338. Specifically, the five PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, SzACS-2 v3, NoHetI v3. pDAB7333 also
contains the phosphinothricin acetyl transferase PTU: CsVMV
promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to other
regulatory elements such as Overdrive and T-stand border sequences
(T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the five PTUs were then isolated and tested for
incorporation of the six PTUs with restriction enzyme digestion and
DNA sequencing.
[0372] Construction of pDAB101412
[0373] pDAB101412 is a binary plasmid that was constructed to
contain rebuilt, codon optimized versions of SzPUFA OrfA, SzPUFA
OrfB, hSzThPUFA OrfC, SzACS-2, and NoHetI. The version of the
phaseolin promoter used in this construct was modified essentially
as described in Bustos et al., 1989 (The Plant Cell, Vol. 1;
839-853), wherein the 5' portion of the promoter was truncated and
the phaseolin 5' untranslated region was left intact. The truncated
phaseolin promoter sequences are identified throughout this
application as version 4 (v4), version 5 (v5), and version 6 (v6).
The pDAB101412 plasmid (FIG. 36; SEQ ID NO:56) was constructed
using a multi-site Gateway L-R recombination reaction.
[0374] pDAB101412 contains three PUFA synthase PTUs, one acyl-CoA
synthetase PTU, one phosphopantetheinyl transferase PTU and a
phosphinothricin acetyl transferase PTU. Specifically, the first
PUFA synthase PTU contains the PvPhas Promoter v4, PvPhas 5' UTR,
SzPUFA OrfA v3 and AtuORF23 3' UTR v1. The second PUFA synthase PTU
contains the PvPhas Promoter v4, PvPhas 5' UTR, SzPUFA OrfB v3 and
AtuORF23 3' UTR v1. The third PUFA synthase PTU contains the PvPhas
Promoter v4, PvPhas 5' UTR, hSzThPUFA OrfC v3 and AtuORF23 3' UTR
v1. The acyl-CoA synthetase PTU contains the PvPhas Promoter v4,
PvPhas 5' UTR, 2S 5' UTR, SzACS-2 v3 gene and AtuORF23 5' UTR v1.
The phosphopantetheinyl transferase PTU contains the PvPhas
Promoter v5, PvPhas 5' UTR, NoHetI v3 and AtuORF23 3' UTR v1.
[0375] Plasmids pDAB7375, pDAB7376, pDAB7377, pDAB7398 and pDAB7333
were recombined to form pDAB101412. Specifically, the five PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, SzACS-2 v3, NoHetI v3. pDAB7333 also
contains the phosphinothricin acetyl transferase PTU: CsVMV
promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to other
regulatory elements such as Overdrive and T-stand border sequences
(T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the five PTUs were then isolated and tested for
incorporation of the six PTUs with restriction enzyme digestion and
DNA sequencing.
Canola Transformation with Promoters which Express Early in Seed
Development
[0376] The plasmids are used to stably transform canola plants
using the protocols described above. Transgenic canola plants are
isolated and molecularly characterized. The use of alternative
constructs result in canola plants which contain greater amounts of
DHA and LC-PUFAs. The resulting LC-PUFA accumulation is determined
and canola plants which produce 0.01% to 15% DHA or 0.01% to 15%
LC-PUFA are identified.
Example 13
Co-Expression of DGAT2 or ACCase with the Algal PUFA Synthase Gene
Suite within Canola
[0377] Oil content within canola plants is further modified by
transformation of chimeric DNA molecules which encode and express
an acetyl CoA carboxylase (ACCase) or an type 2 diacylglycerol
acyltransferase (DGAT2). These genes are co-expressed with the
algal PUFA synthase genes described above, either through breeding
canola plants containing the ACCase or DGAT2 expression cassette
with canola plants containing the PUFA synthase genes; or by
transforming canola plants with a gene stack containing the ACCase
or DGAT2 and the PUFA synthase genes. Regulatory elements necessary
for expression of an ACCase or DGAT2 coding sequence can include
those described above. Additional regulatory elements expression
sequences known in the art can also be used. The ACCase and DGAT2
expression cassettes are transformed into canola using
transformation protocols described above. Transformation can occur
as molecular stacks of the ACCase or DGAT2 expression cassette
combined with the PUFA synthase OrfA, PUFA synthase OrfB, PUFA
synthase OrfC, acyl-CoA synthetase and 4' phosphopantetheinyl
transferase HetI expression cassettes; or as independent ACCase or
DGAT2 expression cassettes linked to a selectable marker and then
subsequently crossed with canola plants which contain the PUFA
synthase OrfA, PUFA synthase OrfB, PUFA synthase OrfC, acyl-CoA
synthetase and 4' phosphopantetheinyl transferase HetI expression
cassettes. Positive transformants are isolated and molecularly
characterized. Canola plants are identified which contain increased
accumulation of LC-PUFAs in the plant, the seed of the plant, or
plant oil concentrations compared to untransformed control canola
plants. Such increases can range from a 1.2 to a 20-fold
increase.
[0378] The over-expression of ACCase in the cytoplasm can produce
higher levels of malonyl-CoA. Canola plants or seed containing
increased levels of cytoplasmic malonyl-CoA can produce
subsequently higher levels of the long-chain polyunsaturated fatty
acid (LC-PUFA) when the algal PUFA synthase genes are present and
expressed. DGAT2 genes which are expressed within canola plants can
be capable of preferentially incorporating significant amounts of
docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) into
triacylglycerol. DGAT2 genes with substrate preference toward
LC-PUFAs (see e.g., WO 2009/085169) can increase incorporation of
these fatty acids into triacylglycerol (TAG). Such DGAT genes are
useful for directing the incorporation of LC-PUFA, particularly
DHA, into TAG and for increasing the production of TAG in plants
and other organisms.
Example 14
Use of the Native Acyl-CoA Synthetase Gene Sequence for Higher
Levels of Acyl-CoA Synthetase Expression within Plants
[0379] An alternative version of the acyl-CoA synthetase gene from
Schizochytrium sp. was created by modifying the native gene
sequence to remove superfluous open reading frames. This version
was labeled as "SzACS-2 v4" and listed as SEQ ID NO:34. The
sequence was synthesized by the service provider, DNA 2.0 (Menlo
Park, Calif.). The coding sequence was incorporated into a plant
expression cassette containing a promoter and a 3' untranslated
region, which were described in these Examples. The resulting
expression cassette was used to replace the acyl-CoA synthetase
expression cassette, described above as "SzACS-2 v3," SEQ ID NO:9,
which was combined with the PUFA synthase OrfA, PUFA synthase OrfB,
PUFA synthase chimeric OrfC and 4' phosphopantetheinyl transferase
HetI expression cassettes to construct pDAB7361, pDAB7362 and
pDAB7363. The new plasmids which contain the "SzACS-2 v4"
expression cassette were given unique identification labels. The
newly constructed plasmids can be used to stably transform canola
plants. Transgenic canola plants are isolated and molecularly
characterized. The alternative version of the gene, "SzACS-2 v4,"
can result in canola plants which contain greater amounts of DHA
and LC-PUFAs. The resulting LC-PUFA accumulation is determined and
canola plants which produce 0.01% to 15% DHA or 0.01% to 10% EPA
are identified.
Example 15
PUFA Synthase Activity in Mature Transgenic Canola Seed
[0380] PUFA synthase activity was detected in extracts from mature
T1 transgenic canola seed from plants generated utilizing the
Agrobacterium vector pDAB 7361 (Event 5197[14]-032). The seed was
soaked with water for 3-4 hours prior to removing the seed coats
and grinding on dry ice in extraction buffer (200 mM phosphate pH
7.0. 1 mM EDTA, 1 mM DTT, 50 mM NaCl, 5% glycerol, 1% PVPP, 0.52
.mu.g/mL antipain, 0.58 .mu.g/mL leupeptin, 0.83 .mu.g/mL pepstatin
A, 12 .mu.g/mL TLCK, 12 .mu.g/mL TPCK, and 6 .mu.g/mL soybean
trypsin inhibitor) and microfuging at 4.degree. C. for 10 min. The
fat pad was removed, and the resulting pellet was incubated with
higher ionic strength buffer prior to re-centrifugation. The fat
pad and lipid layer were removed from the sample and the aqueous
supernatant passed through Zeba desalt columns pre-equilibrated
with 50 mM phosphate pH 7.2, 1 mM DTT, 10% glycerol, and 1 mM EDTA.
Untransformed Nexera 710 seeds were processed in parallel as a
negative control. Samples from both seed sets were assayed using
the HIP extraction and TLC method described in Metz et al., Plant
Physiol. Biochem. 47:6 (2009) (FIG. 16). Assay conditions were
modified to include 2 mM NADH, a NADH regeneration system
(glucose+glucose dehydrogenase), continual shaking and a final
malonyl-CoA concentration of 100 .mu.M (0.064 .mu.Ci/100 .mu.L per
assay). Assays of the resulting supernatants were normalized by
volume and indicated that FFA formation could be detected after 60
min. This was not observed in the Nexera 710 control, and indicates
that the FFA formation was from DHA formation via PUFA
synthase.
Example 16
Pantetheinylation of OrfA Produced in Canola by Co-Expressed
HetI
[0381] OrfA contains nine acyl-carrier protein domains that each
require derivatization with a phosphopantetheine group by a
phosphopantetheinyl transferase (PPTase) to be functional. The
degree of pantetheinylation of OrfA by the PPTase HetI in
transgenic canola seeds was assessed by nano-liquid
chromatography-mass spectrometry (nanoLC-MS) evaluation of tryptic
peptides containing the pantetheinylation site from various OrfA
samples.
[0382] Recombinant holo and apo Orf A polypeptide standards were
produced in E. coli by co-expression with or without HetI.
Expression of OrfA in the absence of HetI generates a
non-functional protein because endogenous PPTases from E. coli are
incapable of adding the phosphopantetheine group (Hauvermale et
al., Lipids 41:739-747; 2006). In contrast, expression with HetI
yields an OrfA protein which has a high degree of
pantetheinylation. To extract E. coli-expressed OrfA, frozen cells
from 0.5 L of recombinant cell culture were resuspended in 20 mL of
extraction buffer: 20 mM Tris pH 7.0, 1 mg/mL lysozyme, 1 mM EDTA,
1 mM PMSF, 1 mM DTT, 0.52 .mu.g/mL antipain, 0.58 .mu.g/mL
leupeptin, 0.83 .mu.g/mL pepstatin A, 12 .mu.g/mL TLCK, 12 .mu.g/mL
TPCK, 6 .mu.g/mL soybean trypsin inhibitor. After lysis, the
extract was treated with DNase and 4 mM MgCl.sub.2, clarified by
centrifugation and the supernatant frozen at -80.degree. C.
[0383] Plant-produced OrfA was isolated from re-hydrated mature
canola seeds of event 5197[14]-032.002 using the extraction method
previously described for in vitro assay of canola-produced PUFA
synthase. OrfA protein from both E. coli standards and the canola
sample were enzymatically digested and analyzed by nanoLC-MS using
an Agilent ChipCube nanochrornatography inlet with MS analysis by
an Agilent QTOF mass spectrometer (model 6530). The QTOF was
programmed to carry out automated MS.sup.2 analysis to generate
peptide sequence data during chromatography. The essential feature
of the method is that the mass spectrometer is programmed to carry
out a full-scan MS scan, followed by automated MS.sup.2 of the
three most abundant ions to generate MS.sup.2 sequence spectra.
Ions were subsequently excluded from MS.sup.2 after 2 occurrences,
for an exclusion period of 30 sec. An internal reference was
continuously infused during nanospray to generate reference ions
for internal calibration of the QTOF (at m/z 299.29446 and
1221.99064). Ions commonly found from carry-over of the calibration
stock were defined as excluded ions, in order to prevent spurious
MS.sup.2 scans of these ions. MS scans were carried over the range
of m/z 295-2400. MS.sup.2 scans were carried over the range of m/z
59-3000. Automated MS.sup.2 was carried out giving preference to
charge states in the following order:
+2>+3>(>+3)>unknown>+1.
[0384] Tandem mass spectra were extracted by Mascot Distiller
(Matrix Science, London UK; version 2.3.2). Charge state
deconvolution and deisotoping were not performed. All MS/MS spectra
were analyzed using Mascot (Matrix Science, London, UK; version
2.2.06) and X! Tandem (www.thegpm.org; version 2007.01.01.1).
Mascot and X! Tandem were both set up to search a protein sequence
database containing the full length sequence of the OrfA protein
assuming trypsin digestion specificity. Mascot and X! Tandem were
searched with a fragment ion mass tolerance of 0.30 Da and a parent
ion tolerance of 10.0 ppm. Oxidation of methionine and
phosphopantetheine of serine were specified in Mascot and X! Tandem
as variable modifications.
[0385] Scaffold (version Scaffold_2_05_02, Proteome Software Inc.,
Portland, Oreg.) was used to validate MS/MS based peptide and
protein identifications. Peptide identifications were accepted if
they could be established at greater than 95.0% probability as
specified by the Peptide Prophet algorithm (Keller et al., Anal.
Chem. 74:5383-92 (2002)). Protein identifications were accepted if
they could be established at greater than 99.0% probability and
contained at least 2 identified peptides. Protein probabilities
were assigned by the Protein Prophet algorithm (Nesvizhskii, Anal
Chem. 75:4646-58 (2003)). Proteins that contained similar peptides
and could not be differentiated based on MS/MS analysis alone were
grouped to satisfy the principles of parsimony. Database searches
identified tryptic peptides corresponding to the apo forms of
pantetheinylation site 1 (SEQ ID NO:78 TGYETDMIEADMELETELGIDSIK)
and pantetheinylation sites 2-9 (SEQ ID NO:77
TGYETDMIESDMELETELGIDSIK). Direct evidence for pantetheinylated
peptides was not observed.
[0386] To estimate the degree of pantetheinylation of sites 2-9 in
OrfA isolated from canola, the amount of the apo2-9 peptide was
measured relative to six different reference peptides identified
from other regions of the Orf A molecule (Table 21).
TABLE-US-00021 TABLE 21 Peptides used in calculating the relative
amount of the apo2-9 peptide in OrfA digests. ''Start'' refers to
the start position of the indicated peptide in the full length
protein. The start position for apo2-9 refers to the first
occurrence of the peptide in the protein sequence. The abbreviation
''z'' indicates charge, and the abbreviation m/z indicates mass
over charge. Amino acid SEQ ID start NO: Peptide position z m/z SEQ
ID [LNYVVVEK] 148 2 482.279 NO: 71 SEQ ID [FGALGGFISQQAER] 2200 2
740.880 NO: 72 SEQ ID [AEIAGGSAPAPAAAAPAPAAAAPAPAAPAPAVSSELLEK]
1416 4 851.452 NO: 73 SEQ ID [AAPAAAAPAVSNELLEK] 1216 2 811.940 NO:
74 SEQ ID [IVQHRPVPQDKPFYITLR] 2854 5 442.255 NO: 75 SEQ ID
[IFVEFGPK] 880 2 468.770 NO: 76 apo2-9) [TGYETDMIESDMELETELGIDSIK]
1245 3 907.079 SEQ ID NO: 77
[0387] The internal ratio of the apo2-9 peptide to the reference
peptides in the E. coli derived protein (without HetI) was taken as
an estimate of no pantetheinylation, whereas the internal ratio in
the E. coli derived protein expressed with HetI was taken as an
estimate of a high degree of pantetheinylation. These internal
ratios assume that the molar abundance of the reference peptides is
equivalent, regardless of the source of the OrfA protein (FIG. 17).
The ratio of the apo2-9 peptide to each of the six reference
peptides was calculated and averaged. (Three ratios were calculated
for the six reference peptides.) In addition, three ratios of six
reference peptides to each other were calculated (ref1/ref2,
ref3/ref4 and ref5/ref6) to demonstrate that the reference peptides
did not vary significantly between the three OrfA samples (FIG. 17)
and would be suitable for calculating the relative amount of the
apo2-9 peptide present.
[0388] In contrast to the calculated ratios of the reference
peptides, the ratio of apo2-9 to each of the reference peptides
showed that there were dramatically lower levels of the apo2-9
peptide in both OrfA/HetI and the canola samples in comparison to
the OrfA standard without HetI, (FIG. 18). The simplest explanation
of these results is that the pantetheinylation site on the apo2-9
peptide is substantially occupied by phosphopantetheinyl groups,
thereby significantly decreasing the molar abundance of apo2-9
peptides. This indicates that the canola-expressed PPTase, HetI,
was functionally capable of activation of OrfA in transgenic canola
seed, and the canola-expressed OrfA ACP units are functionally
competent.
Example 17
Additional Constructs
Introducing Promoter Diversity to Reduce the Duplication of
Regulatory Elements
[0389] Gene silencing is a phenomenon which has been observed in
progeny generations of transgenic canola events. Several review
articles discuss Transcriptional Gene Silencing (TGS) and Post
Transcriptional Gene Silencing (PTGS), such as those of Waterhouse
et al., 2001 (Nature 411:834-842), Vaucheret and Fagard, 2001
(Trends in Genetics 17(1):29-35, and Okamoto and Hirochika, 2001
(Trends in Plant Sci. 6 (11): 527-534). In plants, gene silencing
can be triggered by the duplication of transgenic polynucleotide
sequences (tandem repeat transgene sequences, inverted repeat
transgene sequences, or multiple insertions into the chromosome) or
when a sequence homologous to the target gene sequences is carried
either by an infecting plant virus or by the T-DNA of Agrobacterium
tumefaciens.
[0390] In addition, the duplication of transgene polynucleotide
sequences can act as triggers for construct instability. Multiple
transgene sequences which share high levels of sequence similarity
can fold back on one another. Rearrangements can occur via
homologous recombination, wherein intervening sequences of DNA are
excised. As a result fragments of DNA which are located between
repeated transgene polynucleotide sequences are excised.
[0391] One strategy in designing plasmid vectors is to introduce
promoter diversity into a construct by incorporating multiple,
unique seed specific promoters which maintain high level expression
of each transgene. Introducing promoter sequence diversity into the
plasmid vectors can reduce gene silencing and improve plasmid
stability. Multiple seed specific promoters include PvDlec2,
Phaseolin, and Napin (U.S. Pat. No. 5,608,152). These promoters are
relatively comparable in promoter activity such as tissue
specificity, levels of expression, duration of expression, etc.
Construction of pDAB7733
[0392] The pDAB7733 binary plasmid (FIG. 37; SEQ ID NO:57) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB7733 contains three PUFA synthase PTUs, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvPhas
promoter v4, PvPhas 5' UTR, SzPUFA OrfA v3 and AtuORF23 3' UTR v1.
The second PUFA synthase PTU contains the BnaNapinC promoter v1,
BnaNapinC 5' UTR, SzPUFA OrfB v3 and BnaNapinC 3' UTR v1. The third
PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR,
hSzThPUFA OrfC v3 and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the PvPhas promoter
v5, PvPhas 5' UTR, NoHetI v3 and AtuOrf23 3' UTR v1.
[0393] Plasmids pDAB7375, pDAB7731, pDAB7336, pDAB7378 and pDAB7333
were recombined to form pDAB7733. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB7734
[0394] The pDAB7734 binary plasmid (FIG. 38; SEQ ID NO:58) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB7734 contains three PUFA synthase PTUs, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP terminator v1.
The second PUFA synthase PTU contains the PvPhas promoter v4,
PvPhas 5' UTR, SzPUFA OrfB v3 and AtuORF23 3' UTR v1. The third
PUFA synthase PTU contains the BnaNapinC promoter v1, BnaNapinC 5'
UTR, hSzThPUFA OrfC v3 and BnaNapinC 3' UTR v1. The
phosphopantetheinyl transferase PTU contains the PvDlec2 promoter
v2, 2S 5' UTR, NoHetI v3 and At2S SSP terminator v1.
[0395] Plasmids pDAB7334, pDAB7376, pDAB7732, pDAB7338 and pDAB7333
were recombined to form pDAB7734. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
[0396] Construction of pDAB101493
[0397] The pDAB101493 binary plasmid (FIG. 39; SEQ ID NO:59) was
constructed using a multi-site Gateway L-R recombination reaction,
pDAB101493 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP
terminator v1. The second PUFA synthase PTU contains the PvPhas
promoter v4, PvPhas 5' UTR, SzPUFA OrfB v3 and AtuORF23 3' UTR v1.
The third PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5'
UTR, hSzThPUFA OrfC v3 and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the PvPhas promoter
v5, PvPhas 5' UTR, NoHetI v3 and AtuOrf23 3' UTR v1.
[0398] Plasmids pDAB7334, pDAB7376, pDAB7336, pDAB7378 and pDAB7333
were recombined to form pDAB101493. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB109507
[0399] The pDAB109507 plasmid (FIG. 40; SEQ ID NO:60) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB109507 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvPhas promoter v3, PvPhas 5' UTR, SzPUFA OrfA v3 and PvPhas 3'
UTR v1 and PvPhas 3' MAR v2 (unannotated on the plasmid map). The
second PUFA synthase PTU contains the BnaNapinC promoter v1,
BnaNapinC 5' UTR, SzPUFA OrfB v3 and BnaNapinC 3' UTR v1. The third
PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR,
hSzThPUFA OrfC v3 and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the BoACP promoter/5'
UTR v1, NoHetI v3 and AtuOrf23 3' UTR v1.
[0400] Plasmids pDAB9324, pDAB7731, pDAB7336, pDAB101485 and
pDAB7333 were recombined to form pDAB109507. Specifically, the four
PTUs described above were placed in a head-to-tail orientation
within the T-strand DNA border regions of the plant transformation
binary pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA
OrfB v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB109508
[0401] The pDAB109508 plasmid (FIG. 41; SEQ ID NO:61) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB109508 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvPhas promoter v3, PvPhas 5' UTR, SzPUFA OrfA v3 and PvPhas 3'
UTR v1 and PvPhas 3' MAR v2 (unannotated on the plasmid map). The
second PUFA synthase PTU contains the BnaNapinC promoter v1,
BnaNapinC 5' UTR, SzPUFA OrfB v3 and BnaNapinC 3' UTR v1. The third
PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR,
hSzThPUFA OrfC v3 and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the PvDlec2 promoter
v2, 2S 5' UTR, NoHetI v3 and At2S SSP terminator v1.
[0402] Plasmids pDAB9324, pDAB7731, pDAB7336, pDAB7338 and pDAB7333
were recombined to form pDAB109508. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB109509
[0403] The pDAB109509 plasmid (FIG. 42; SEQ ID NO:62) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB109509 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP
terminator v1. The second PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfB v3 and At2S SSP terminator v1.
The third PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5'
UTR, hSzThPUFA OrfC v3 and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the BoACP promoter/5'
UTR v1, NoHetI v3 and AtuOrf23 3' UTR v1.
[0404] Plasmids pDAB7334, pDAB7335, pDAB7336, pDAB101485 and
pDAB7333 were recombined to form pDAB109509. Specifically, the four
PTUs described above were placed in a head-to-tail orientation
within the T-strand DNA border regions of the plant transformation
binary pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA
OrfB v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Rearranging the Order of the Binary Construct PTUs to Reduce
Fragmentation of Long Gene Sequences
[0405] The SzPUFA OrfA PTU was placed at the 3' end of the binary
construct to test whether the order of the PTU cassettes could
reduce fragmentation and rearrangements in isolated transgenic
events. SzPUFA OrfA is a large open reading frame (.about.8,700
b.p.) containing nine tandem acyl carrier protein repeats. In the
first series of completed constructs, the SzPUFA OrfA PTU was
positioned to be integrated first into the plant chromosome. The
SzPUFA OrfA PTU was subsequently followed by the remaining PUFA
synthesis-related gene PTUs as they decreased in molecular size.
Molecular analysis of the SzPUFA OrfA coding region indicated that
some transgenic canola and Arabidopsis thaliana events contained
fragmented insertions. Alternative Construct Designs are described,
wherein the order of the PUFA synthase PTUs has been changed to the
following configuration; hSzThPUFA OrfC PTU, SzPUFA OrfB PTU,
NoHetI PTU, SzPUFA OrfA PTU, and PAT PTU. Changing the location of
the SzPUFA OrfA PTU on the binary construct is completed to reduce
fragmentation and rearrangement in isolated transgenic events
Construction of pDAB9151
[0406] The pDAB9151 plasmid (FIG. 43; SEQ ID NO:63) was constructed
using a multi-site Gateway L-R recombination reaction. pDAB9151
contains three PUFA synthase PTUs, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfB v3 and At2S SSP terminator v1.
The second PUFA synthase PTU contains the PvDlec2 promoter v2, 2S
5' UTR, hSzThPUFA OrfC v3 and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the PvDlec2 promoter
v2, 2S 5' UTR, NoHetI v3 and At2S SSP terminator v1. The final PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA
OrfA v3 and At2S SSP terminator v1.
[0407] Plasmids pDAB9148, pDAB7335, pDAB9149, pDAB9150 and pDAB7333
were recombined to form pDAB9151. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: hSzThPUFA OrfC v3, SzPUFA OrfB
v3, NoHetI v3, SzPUFA OrfA v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Change the Transcriptional Direction of the Binary Construct PTUs
to Introduce Construct Diversity
[0408] An alternative construct design includes changing the order
of PUFA synthase PTUs and the transcriptional direction of the gene
expression cassettes. In the first series of completed constructs,
each gene expression cassette was positioned in the same direction
("head to tail," wherein the promoter of one gene expression
cassette is located adjacent to the 3'UTR of a second gene
expression cassette). The following constructs describe a strategy
wherein, gene expression cassettes are positioned in different
directions, and utilize alternative promoters. In these examples,
the gene expression cassette is located in trans to a second gene
expression cassette such that the promoters of both gene expression
cassettes are engineered adjacent to one another. This
configuration is described as a "head-to-head" configuration. Other
configurations are described in the examples, wherein one gene
expression cassettes is located in trans to a second gene
expression cassette such that the 3'UTRs of both gene expression
cassettes are engineered adjacent to one another. This
configuration is described as a "tail-to-tail" configuration. To
mitigate potential read-through of such a design, the bidirectional
Orf 23/24 terminator has been placed between these two PTUs. These
configurations are proposed to increase expression of the
transgenes, thereby resulting in higher concentrations and content
of LC-PUFA and DHA fatty acid.
Construction of pDAB108207
[0409] The pDAB108207 plasmid (FIG. 44; SEQ ID NO:64) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB108207 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP
terminator v1. The phosphopantetheinyl transferase PTU contains the
PvPhas promoter v6, PvPhas 5' UTR, NoHetI v3, PvPhas 3' UTR v1 and
PvPhas 3' MAR v2 (unannotated on the plasmid map). The second PUFA
synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA
OrfC v3, At2S SSP terminator v1 and AtuORF23 3' UTR v1. The third
PUFA synthase PTU contains the PvPhas promoter v6, PvPhas 5' UTR,
SzPUFA OrfB v3, PvPhas 3' UTR and PvPhas 3' MAR v2 (unannotated on
the plasmid map) and AtuORF23 3' UTR v1.
[0410] Plasmids pDAB7334, pDAB101489, pDAB108205, pDAB108206 and
pDAB7333 were recombined to form pDAB108207. Specifically, the
SzPUFA OrfA v3 and NoHetI v3 are placed in a tail-to-tail
orientation; NoHetI v3 and hSzThPUFA OrfC v3 are placed in a
head-to-head orientation; hSzThPUFA OrfC v3 and SzPUFA OrfB are
placed in a tail-to-tail orientation within the T-strand DNA border
regions of the plant transformation binary pDAB7333. The order of
the genes is: SzPUFA OrfA v3, NoHetI v3, hSzThPUFA OrfC v3, SzPUFA
OrfB v3. pDAB7333 also contains the phosphinothricin acetyl
transferase PTU: CsVMV promoter v2, PAT v5, AtuORF1 3'UTR v4 in
addition to other regulatory elements such as Overdrive and T-stand
border sequences (T-DNA Border A and T-DNA Border B). Recombinant
plasmids containing the five PTUs were then isolated and tested for
incorporation of the five PTUs with restriction enzyme digestion
and DNA sequencing.
Construction of pDAB108208
[0411] The pDAB108208 plasmid (FIG. 45; SEQ ID NO:65) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB108208 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP
terminator v1. The phosphopantetheinyl transferase PTU contains the
PvPhas promoter v4, PvPhas 5' UTR, NoHetI v3 and AtuORF23 3' UTR
v1. The second PUFA synthase PTU contains the PvDlec2 promoter v2,
2S 5' UTR, hSzThPUFA OrfC v3 and At2S SSP terminator v1. The third
PUFA synthase PTU contains the PvPhas promoter v5, PvPhas 5' UTR,
SzPUFA OrfB v3, PvPhas 3' UTR, PvPhas 3' MAR v2 (unannotated on the
plasmid map), and AtuORF23 3' UTR v1.
[0412] Plasmids pDAB108200, pDAB101490, pDAB108201, pDAB108202 and
pDAB7333 were recombined to form pDAB108208. Specifically, the
SzPUFA OrfA v3 and NoHetI v3 are placed in a head-to-head
orientation; NoHetI v3 and hSzThPUFA OrfC v3 are placed in a
tail-to-tail orientation; hSzThPUFA OrfC v3 and SzPUFA OrfB are
placed in a head-to-head orientation within the T-strand DNA border
regions of the plant transformation binary pDAB7333. The order of
the genes is: SzPUFA OrfA v3, NoHetI v3, hSzThPUFA OrfC v3, SzPUFA
OrfB v3. pDAB7333 also contains the phosphinothricin acetyl
transferase PTU: CsVMV promoter v2, PAT v5, AtuORF1 3'UTR v4 in
addition to other regulatory elements such as Overdrive and T-stand
border sequences (T-DNA Border A and T-DNA Border B). Recombinant
plasmids containing the five PTUs were then isolated and tested for
incorporation of the five PTUs with restriction enzyme digestion
and DNA sequencing.
Construction of pDAB108209
[0413] The pDAB108209 plasmid (FIG. 46; SEQ ID NO:66) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB108209 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP
terminator v1. The phosphopantetheinyl transferase PTU contains the
PvPhas promoter v4, PvPhas 5' UTR, NoHetI v3 and AtuORF23 3' UTR
v1. The second PUFA synthase PTU contains the PvDlec2 promoter v2,
2S 5' UTR, hSzThPUFA OrfC v3 and At2S SSP terminator v1. The third
PUFA synthase PTU contains the PvPhas promoter v5, PvPhas 5' UTR,
SzPUFA OrfB v3, PvPhas 3' UTR and PvPhas 3' MAR v2 (unannotated on
the plasmid map), and random DNA spacer.
[0414] Plasmids pDAB108200, pDAB108204, pDAB108201, pDAB108202 and
pDAB7333 were recombined to form pDAB108209. Specifically, the
SzPUFA OrfA v3 and NoHetI v3 are placed in a head-to-head
orientation; NoHetI v3 and hSzThPUFA OrfC v3 are placed in a
tail-to-tail orientation; hSzThPUFA OrfC v3 and SzPUFA OrfB are
placed in a head-to-head orientation within the T-strand DNA border
regions of the plant transformation binary pDAB7333. The order of
the genes is: SzPUFA OrfA v3, NoHetI v3, hSzThPUFA OrfC v3, SzPUFA
OrfB v3. pDAB7333 also contains the phosphinothricin acetyl
transferase PTU: CsVMV promoter v2, PAT v5, AtuORF1 3' UTR v4 in
addition to other regulatory elements such as Overdrive and T-stand
border sequences (T-DNA Border A and T-DNA Border B). Recombinant
plasmids containing the five PTUs were then isolated and tested for
incorporation of the five PTUs with restriction enzyme digestion
and DNA sequencing.
Doubling 3'UTRs and Including Spacer DNA to Minimize
Transcriptional Interference.
[0415] Transcriptional interference can occur when multiple genes
are stacked in a series thereby resulting in reduced expression of
the downstream genes. This phenomenon results from transcriptional
read-through of the 3'UTR and terminator into the next
promoter-transcription unit. Alternative construct designs
consisting of two strategies to minimize transcriptional
interference and transcriptional interference are described. The
first strategy deploys the use of two terminator/3'UTRs which are
stacked between individual DHA gene expression cassettes to limit
read-through into the next gene expression cassette. The second
strategy inserts about one-thousand base pairs of spacer DNA
between gene expression cassettes, thereby minimizing
transcriptional interference.
Construction of pDAB108207
[0416] The pDAB108207 plasmid (FIG. 44; SEQ ID NO:64) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB108207 contains three PUFA synthase PTUs, one
phosphopantetheinyl transferase PTU and a phosphinothricin acetyl
transferase PTU. Specifically, the first PUFA synthase PTU contains
the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP
terminator v1. The second PUFA synthase PTU contains the PvPhas
promoter v3, PvPhas 5' UTR, SzPUFA OrfB v3, PvPhas 3' UTR, PvPhas
3' MAR v2 (unannotated on the plasmid map), and AtuORF23 3' UTR v1.
The third PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5'
UTR, hSzThPUFA OrfC v3, At2S SSP terminator v1 and AtuORF23 3' UTR
v1. The phosphopantetheinyl transferase PTU contains the PvPhas
promoter v6, PvPhas 5' UTR, NoHetI v3, PvPhas 3' UTR v1 and PvPhas
3' MAR v2 (unannotated on the plasmid map).
[0417] Plasmids pDAB7334, pDAB101489, pDAB108205, pDAB108206 and
pDAB7333 were recombined to form pDAB108207. Specifically, the
SzPUFA OrfA v3 and NoHetI v3 are placed in a tail-to-tail
orientation and an AtuORF23 3' UTR is placed between the two PTUs;
NoHetI v3 and hSzThPUFA OrfC v3 are placed in a head-to-head
orientation; hSzThPUFA OrfC v3 and SzPUFA OrfB are placed in a
head-to-tail orientation and an AtuORF23 3'UTR is placed between
the two PTUs within the T-strand DNA border regions of the plant
transformation binary pDAB7333. The order of the genes is: SzPUFA
OrfA v3, NoHetI v3, hSzThPUFA OrfC v3, SzPUFA OrfB v3. pDAB7333
also contains the phosphinothricin acetyl transferase PTU: CsVMV
promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to other
regulatory elements such as Overdrive and T-stand border sequences
(T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the five PTUs were then isolated and tested for
incorporation of the five PTUs with restriction enzyme digestion
and DNA sequencing.
Construction of pDAB108208
[0418] The pDAB108208 plasmid (FIG. 45; SEQ ID NO:65) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB108208 contains three PUFA synthase PTUs, one acyl-CoA
synthetase PTU, one phosphopantetheinyl transferase PTU and a
phosphinothricin acetyl transferase PTU. Specifically, the first
PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR,
SzPUFA OrfA v3 and At2S SSP terminator v1. The second PUFA synthase
PTU contains the PvPhas promoter v5, PvPhas 5' UTR, SzPUFA OrfB v3,
PvPhas 3' UTR, PvPhas 3' MAR v2 (unannotated on the plasmid map)
and AtuORF23 3' UTR v1. The third PUFA synthase PTU contains the
PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA OrfC v3 and At2S SSP
terminator v1. The phosphopantetheinyl transferase PTU contains the
PvPhas promoter v4, PvPhas 5' UTR, NoHetI v3 and AtuORF23 3' UTR
v1.
[0419] Plasmids pDAB108200, pDAB101490, pDAB108201, pDAB108202 and
pDAB7333 were recombined to form pDAB108208. Specifically, the
SzPUFA OrfA v3 and NoHetI v3 are placed in a head-to-head
orientation; NoHetI v3 and hSzThPUFA OrfC v3 are placed in a
tail-to-tail orientation and an AtuORF23 3'UTR is placed between
the two PTUs; hSzThPUFA OrfC v3 and SzPUFA OrfB are placed in a
head-to-head orientation within the T-strand DNA border regions of
the plant transformation binary pDAB7333. The order of the genes
is: SzPUFA OrfA v3, NoHetI v3, hSzThPUFA OrfC v3, SzPUFA OrfB v3.
pDAB7333 also contains the phosphinothricin acetyl transferase PTU:
CsVMV promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to other
regulatory elements such as Overdrive and T-stand border sequences
(T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the five PTUs were then isolated and tested for
incorporation of the five PTUs with restriction enzyme digestion
and DNA sequencing.
Construction of pDAB108209
[0420] The pDAB108209 plasmid (FIG. 46; SEQ ID NO:66) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB108209 contains three PUFA synthase PTUs, one acyl-CoA
synthetase PTU, one phosphopantetheinyl transferase PTU and a
phosphinothricin acetyl transferase PTU. Specifically, the first
PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5' UTR,
SzPUFA OrfA v3 and At2S SSP terminator v1. The second PUFA synthase
PTU contains the PvPhas promoter v5, PvPhas 5' UTR, SzPUFA OrfB v3,
PvPhas 3' UTR, PvPhas 3' MAR v2 (unannotated on the plasmid map),
and random DNA spacer. The third PUFA synthase PTU contains the
PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA OrfC v3 and At2S SSP
terminator v1. The phosphopantetheinyl transferase PTU contains the
PvPhas promoter v4, PvPhas 5' UTR, NoHetI v3 and AtuORF23 3' UTR
v1.
[0421] Plasmids pDAB108200, pDAB108204, pDAB108201, pDAB108202 and
pDAB7333 were recombined to form pDAB108209. Specifically, the
SzPUFA OrfA v3 and NoHetI v3 are placed in a head-to-head
orientation; NoHetI v3 and hSzThPUFA OrfC v3 are placed in a
tail-to-tail orientation and a one-thousand base pair spacer is
placed between the two PTUs; hSzThPUFA OrfC v3 and SzPUFA OrfB are
placed in a head-to-head orientation within the T-strand DNA border
regions of the plant transformation binary pDAB7333. The order of
the genes is: SzPUFA OrfA v3, NoHetI v3, hSzThPUFA OrfC v3, SzPUFA
OrfB v3. pDAB7333 also contains the phosphinothricin acetyl
transferase PTU: CsVMV promoter v2, PAT v5, AtuORF1 3'UTR v4 in
addition to other regulatory elements such as Overdrive and T-stand
border sequences (T-DNA Border A and T-DNA Border B). Recombinant
plasmids containing the five PTUs were then isolated and tested for
incorporation of the five PTUs with restriction enzyme digestion
and DNA sequencing.
Using Alternative 3'UTR-Terminator to Limit Transcriptional
Read-Through.
[0422] Due to a limited number of proprietary 3'UTR-terminators the
Agrobacterium ORF 23 3'UTR-terminator is primarily used to
terminate transcription. It was recently shown the ZmLipase
3'UTR-terminator is more effective in terminating transcriptional
read-through in Arabidopsis thaliana. As such, one version of
constructs utilize the ZmLipase 3'UTR-terminator in combination
with the PvDlec2 promoter to test if this 3'UTR can reduce
transcriptional read-through of upstream genes, thereby reducing
transcriptional interference.
Construction of pDAB9159
[0423] The pDAB9159 plasmid (FIG. 47; SEQ ID NO:67) was constructed
using a multi-site Gateway L-R recombination reaction. pDAB9159
contains three PUFA synthase PTUs, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and ZmLip 3' UTR v1. The
second PUFA synthase PTU contains the PvPhas promoter v3, PvPhas 5'
UTR, SzPUFA OrfB v3 and ZmLip 3' UTR v1. The third PUFA synthase
PTU contains the PvDlec2 promoter v2, 2S 5' UTR, hSzThPUFA OrfC v3
and ZmLip 3' UTR v1. The phosphopantetheinyl transferase PTU
contains the PvPhas promoter v3, PvPhas 5' UTR, NoHetI v3 and ZmLip
3' UTR v1.
[0424] Plasmids pDAB9152, pDAB9153, pDAB9154, pDAB9155 and pDAB7333
were recombined to form pDAB9159. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Construction of pDAB9147
[0425] The pDAB9147 plasmid (FIG. 48; SEQ ID NO:68) was constructed
using a multi-site Gateway L-R recombination reaction. pDAB9147
contains three PUFA synthase PTUs, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfA v3, At2S SSP terminator v1 and
ZmLip 3' UTR v1. The second PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfB v3 and At2S SSP terminator v1.
The third PUFA synthase PTU contains the PvDlec2 promoter v2, 2S 5'
UTR, hSzThPUFA OrfC v3 and At2S SSP terminator v1. The
phosphopantetheinyl transferase PTU contains the PvDlec2 promoter
v2, 2S 5' UTR, NoHetI v3 and At2S SSP terminator v1.
[0426] Plasmids pDAB9146, pDAB7335, pDAB7336, pDAB7338 and pDAB7333
were recombined to form pDAB9147. Specifically, the four PTUs
described above were placed in a head-to-tail orientation within
the T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfA v3, SzPUFA OrfB
v3, hSzThPUFA OrfC v3, NoHetI v3. pDAB7333 also contains the
phosphinothricin acetyl transferase PTU: CsVMV promoter v2, PAT v5,
AtuORF1 3'UTR v4 in addition to other regulatory elements such as
Overdrive and T-stand border sequences (T-DNA Border A and T-DNA
Border B). Recombinant plasmids containing the five PTUs were then
isolated and tested for incorporation of the five PTUs with
restriction enzyme digestion and DNA sequencing.
Deliver of DHA Genes on Two Separate T-DNAs.
[0427] An alternative construct design consists of constructing two
separate binary vectors, the first vector containing a sub-set of
PUFA synthase genes on one T-DNA, and the second binary vector
containing the remaining PUFA synthase genes on a second T-DNA.
These binary vectors are individually used to transform plants
which are sexually crossed, thereby resulting in progeny which
contain all of the PUFA synthase gene expression constructs. An
alternative method to produce transgenic plants would be to
co-transform both binary vectors into canola tissue, and select or
screen for a single plant which contain both T-strands.
Construction of pDAB108224
[0428] The pDAB108224 plasmid (FIG. 49; SEQ ID NO:69) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB108224 contains one PUFA synthase PTU, one phosphopantetheinyl
transferase PTU and a phosphinothricin acetyl transferase PTU.
Specifically, the first PUFA synthase PTU contains the PvDlec2
promoter v2, 2S 5' UTR, SzPUFA OrfA v3 and At2S SSP terminator v1.
The phosphopantetheinyl transferase PTU contains the PvPhas
promoter v4, PvPhas 5' UTR, NoHetI v3 and AtuORF23 3' UTR v1.
[0429] Plasmids pDAB108216, pDAB108221 and pDAB7333 were recombined
to form pDAB108224. Specifically, the SzPUFA OrfA v3 and NoHetI v3
are placed in a head-to-head orientation within the T-strand DNA
border regions of the plant transformation binary pDAB7333. The
order of the genes is: SzPUFA OrfA v3, NoHetI v3. pDAB7333 also
contains the phosphinothricin acetyl transferase PTU: CsVMV
promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to other
regulatory elements such as Overdrive and T-stand border sequences
(T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the five PTUs were then isolated and tested for
incorporation of the three PTUs with restriction enzyme digestion
and DNA sequencing.
Construction of pDAB108225
[0430] The pDAB108225 plasmid (FIG. 50; SEQ ID NO:70) was
constructed using a multi-site Gateway L-R recombination reaction.
pDAB108225 contains two PUFA synthase PTUs and a phosphinothricin
acetyl transferase PTU. Specifically, the first PUFA synthase PTU
contains the PvDlec2 promoter v2, 2S 5' UTR, SzPUFA OrfB v3 and
At2S SSP terminator v1. The second PUFA synthase PTU contains the
PvPhas promoter v4, SzPUFA OrfB v3 and Atu ORF23 3' UTR v1.
[0431] Plasmids pDAB108217, pDAB108222 and pDAB7333 were recombined
to form pDAB108225. Specifically, the SzPUFA OrfB v3 and hSzThPUFA
OrfC v3 are placed in a head-to-head orientation within the
T-strand DNA border regions of the plant transformation binary
pDAB7333. The order of the genes is: SzPUFA OrfB v3, hSzThPUFA OrfC
v3. pDAB7333 also contains the phosphinothricin acetyl transferase
PTU: CsVMV promoter v2, PAT v5, AtuORF1 3'UTR v4 in addition to
other regulatory elements such as Overdrive and T-stand border
sequences (T-DNA Border A and T-DNA Border B). Recombinant plasmids
containing the five PTUs were then isolated and tested for
incorporation of the three PTUs with restriction enzyme digestion
and DNA sequencing.
Canola Transformation with Constructs Containing Alternative
Designs
[0432] These plasmids are used to stably transform canola plants
using the protocols described above. Transgenic canola plants are
isolated and molecularly characterized. The use of alternative
constructs result in canola plants which contain greater amounts of
DHA and LC-PUFAs. The resulting LC-PUFA accumulation is determined
and canola plants which produce 0.01% to 15% DHA or 0.01% to 15%
LC-PUFA are identified.
Example 18
Alternative Construct Designs Used for Transformation of
Arabidopsis thaliana and Subsequent Production of LC-PUFA and
DHA
[0433] Arabidopsis thaliana plants were transformed with
Agrobacterium tumefaciens strains containing the pDAB101493,
pDAB7362, pDAB7369, pDAB101412, or pDAB7380 binary vectors. A
floral dipping transformation protocol described by Clough and Bent
(1998) was used for the transformation. Clough and Bent, "Floral
dip: a simplified method for agrobacterium-mediated transformation
of Arabidopsis thalia," Plant J., 16:735-743, 1998. Transformed
Arabidopsis plants were obtained and molecular confirmation of the
transgene presence was completed. T.sub.1 plants from the
transgenic Arabidopsis events were grown to maturity in the
greenhouse. These plants were self-fertilized and the resulting
T.sub.2 seed harvested at maturity. Single seeds were analyzed via
FAMEs GC-FID to determine the LC-PUFA and DHA content in the
T.sub.2 Arabidopsis seed. The tissue was analyzed via the FAMEs
GC-FID method as described in the previous examples. Single T.sub.2
seeds from a T.sub.1 plant of the Arabidopsis plants contained from
0.00% to 0.95% DHA and 0.00% to 1.50% total LC-PUFA. The LC-PUFA
and DHA content of each T.sub.2 seed from the individual T.sub.1
plants is shown in FIG. 51.
Example 19
Transformation of a "Non-High Oleic" Canola Variety (DH12075) with
the PUFA Synthase Gene Set
[0434] Brassica napus variety DH12075 was transformed by the
hypocotyl transformation method essentially as described in Example
4 using Agrobacterium tumefaciens harboring plasmid pDAB7362.
Unlike the Nexera 710 genetic background, DH12075 is not a "high
oleic" variety. To DH12075 plants that were positive for the
presence of the pat gene were recovered and analyzed for presence
of all five of the DHA gene set (PUFA synthase OrfA, PUFA synthase
OrfB, PUFA synthase chimeric OrfC, acyl-CoA synthetase and 4'
phosphopantetheinyl transferase HetI) by the molecular analysis
methods described in Example 5. Event 001-2009-006DH (Event 006)
was identified as a T.sub.0 plant containing all five DHA genes. It
was grown to maturity in the growth chamber and T.sub.1 seed
harvested. Analysis of single T.sub.1 seeds of Event 006 by the
methods described in Example 6 showed that 31 of 48 seeds analyzed
contained DHA with levels between 0.19% and 0.86% DHA. 113 T.sub.1
seeds were planted, grown in growth chamber and leaf tissue
samples: analyzed by the methods described in Example 4 to
determine the zygosity of individual plants. 23 plants were
determined by qPCR analysis to be homozygous for the PAT gene and
also showed cosegregation of the five DHA genes, indicating the
presence of a single locus. Southern analysis of Event 006 T.sub.1
plant tissue using pat and OrfA probes indicated that there was one
additional copy of the OrfA gene present. The homozygous plants
were grown to maturity and seed harvested. FAME analysis of bulk
T.sub.2 seed samples from each of these plants showed that 17 of 23
homozygous T.sub.2 plants produced LC-PUFAs with DHA contents
between 0.17 and 0.72%. Five T.sub.2 seed samples contained EPA
between 0.08% and 0.16%, and the total LC-PUFA (DHA+EPA+DPA[n-6])
of the LC-PUFA-producing events was between 0.33% and 1.35%. Table
22a shows the complete fatty acid profile of two of the
DHA-containing bulk T.sub.2 samples of Event 006. Single seed
analysis was performed on 48 individual T.sub.2 seeds from eight of
the homozygous T.sub.1 lines and the average DHA content of these
seeds are shown in Table 23. Single T.sub.2 seeds with DHA content
of up to 1.31% were detected. Table 22b shows the complete fatty
acid profile of four DHA-containing T.sub.2 seeds. These data show
that DHA can be produced in canola with genetic backgrounds having
oleic acid contents of less than 72% via transformation with the
PUFA synthase gene set.
TABLE-US-00022 TABLE 22 Complete FAME profiles of T.sub.2 seeds
from Event 006 in DH12075 genetic background C18:1 C14:0 C16:0
C16:1 C18:0 C18:1 (n-7) C18:2 C18:3 a. Bulk T2 seed analysis Event
006-033 0.08 3.51 0.14 2.49 70.21 1.27 11.39 6.36 Event 006-002
0.08 3.99 0.16 2.10 69.52 1.28 12.56 5.85 b. Single T2 seed
analysis Event 006-019 0.00 3.88 0.28 2.42 68.75 0.00 13.43 5.88
#32 Event 006-012 0.00 3.53 0.18 3.55 68.41 2.24 11.04 5.11 #7
Event 006-033 0.00 3.22 0.31 3.17 71.02 1.69 8.57 5.25 #43 Event
006-004 0.00 4.02 0.26 0.95 46.04 3.13 27.43 12.75 #20 C22:5 C20:0
C20:1 C22:0 C22:1 C20:5 C24:0 (n-6) C22:6 a. Bulk T2 seed analysis
Event 006-033 0.81 1.31 0.40 0.23 0.15 0.32 0.64 0.70 Event 006-002
0.85 1.35 0.52 0.00 0.00 0.39 0.63 0.72 b. Single T2 seed analysis
Event 006-019 0.93 1.19 0.61 0.00 0.00 0.72 0.77 1.15 #32 Event
006-012 1.05 1.43 0.41 0.25 0.00 0.49 1.00 1.31 #7 Event 006-033
1.00 1.26 0.62 0.00 0.00 1.44 1.15 1.31 #43 Event 006-004 0.72 1.23
0.49 0.00 0.00 0.87 0.80 1.30 #20
TABLE-US-00023 TABLE 23 Average DHA content of T.sub.2 seeds from
eight homozygous Event 006 T.sub.1 canola plants in the DH12075
genetic background (48 seeds per plant were analyzed). Average
Average Total Minimum Maximum DHA LC-PUFA DHA DHA T.sub.1 plant ID
content content content content Event 006-002 0.68% 1.26% 0.00%
1.01% Event 006-004 0.52% 0.91% 0.00% 1.30% Event 006-019 0.55%
0.96% 0.00% 1.15% Event 006-012 0.32% 0.57% 0.00% 1.31% Event
006-014 0.68% 1.28% 0.00% 0.91% Event 006-026 0.00% 0.00% 0.00%
0.00% Event 006-033 0.78% 1.39% 0.00% 1.31% Event 006-037 0.47%
0.85% 0.00% 1.01%
[0435] The foregoing description of the invention has been
presented for purposes of illustration and description.
Furthermore, the description is not intended to limit the invention
to the form disclosed herein.
[0436] All of the various aspects, embodiments, and options
described herein can be combined in any and all variations.
[0437] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20190010510A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20190010510A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References