U.S. patent application number 16/137904 was filed with the patent office on 2019-01-10 for isolation and use of pluripotent stem cell population from adult neural crest-derived tissues.
The applicant listed for this patent is United States Government As Represented By The Department of Veterans Affairs, University of Miami. Invention is credited to Herman S. Cheung, C-Y Charles Huang, Daniel Pelaez.
Application Number | 20190010455 16/137904 |
Document ID | / |
Family ID | 49083349 |
Filed Date | 2019-01-10 |
![](/patent/app/20190010455/US20190010455A1-20190110-D00000.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00001.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00002.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00003.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00004.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00005.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00006.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00007.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00008.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00009.png)
![](/patent/app/20190010455/US20190010455A1-20190110-D00010.png)
View All Diagrams
United States Patent
Application |
20190010455 |
Kind Code |
A1 |
Cheung; Herman S. ; et
al. |
January 10, 2019 |
Isolation And Use Of Pluripotent Stem Cell Population From Adult
Neural Crest-Derived Tissues
Abstract
The present invention relates to methods of isolating a
substantially homogenous population of pluripotent stem cells from
adult neural crest tissue (e.g., periodontal ligament) as well as
pharmaceutical compositions comprising such isolated pluripotent
stem cells. Methods of inducing the isolated pluripotent stem cells
into specific cell lineages, such as neurogenic and retinogenic
lineages, are also described. The isolated pluripotent stem cells
find use in various regenerative medicine applications and the
treatment of degenerative diseases.
Inventors: |
Cheung; Herman S.; (Miami,
FL) ; Pelaez; Daniel; (Miami, FL) ; Huang; C-Y
Charles; (Miami, FL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
United States Government As Represented By The Department of
Veterans Affairs
University of Miami |
Washington
Miami |
DC
FL |
US
US |
|
|
Family ID: |
49083349 |
Appl. No.: |
16/137904 |
Filed: |
September 21, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14382287 |
Aug 29, 2014 |
10106773 |
|
|
PCT/US13/28686 |
Mar 1, 2013 |
|
|
|
16137904 |
|
|
|
|
61605483 |
Mar 1, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/68 20130101;
C12N 5/0607 20130101; C12N 5/062 20130101; C12N 2506/03 20130101;
A61K 35/545 20130101; A61K 35/30 20130101; C12N 5/0618 20130101;
C12N 2501/155 20130101; C12N 2501/415 20130101; C12N 5/0623
20130101; C12N 2501/115 20130101; C12N 2501/11 20130101; C12N
2501/105 20130101 |
International
Class: |
C12N 5/0797 20060101
C12N005/0797; A61K 35/545 20060101 A61K035/545; G01N 33/68 20060101
G01N033/68; A61K 35/30 20060101 A61K035/30; C12N 5/074 20060101
C12N005/074; C12N 5/0793 20060101 C12N005/0793; C12N 5/079 20060101
C12N005/079 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made in part with government support from
the Veterans Affairs Department. The U.S. government has certain
rights in the invention.
Claims
1.-26. (canceled)
27. A method of differentiating pluripotent stem cells isolated
from adult periodontal ligament to neural progenitor cells or
neural cells comprising: incubating said pluripotent stem cells in
a culture media comprising epidermal growth factor (EGF) and basic
fibroblast growth factor (bFGF) for a period of time, wherein a
plurality of said pluripotent stem cells are differentiated into
neural progenitor cells or neural cells at the end of the period of
time.
28. The method of claim 27, wherein EGF is present in the media at
a concentration of about 25 ng/ml to about 150 ng/ml.
29. The method of claim 28, wherein EGF is present in the media at
a concentration of about 50 ng/ml.
30. The method of claim 27, wherein bFGF is present in the media at
a concentration of about 25 ng/ml to about 150 ng/ml.
31. The method of claim 30, wherein bFGF is present in the media at
a concentration of about 50 ng/ml.
32. The method of claim 27, wherein the period of time is about 4
to about 12 days.
33. The method of claim 32, wherein the period of time is about 8
days.
34. The method of claim 27, wherein a plurality of the neural
progenitor cells or neural cells express one or more markers
selected from nestin, tubulin (TUBB3), neurofilament medium (NEFM),
SOX1, synaptophysin, and glial fibrillary acidic protein
(GFAP).
35. The method of claim 27, wherein a plurality of the neural
progenitor cells or neural cells exhibit a voltage-gated sodium
current and/or a delayed, rectifying potassium current.
36. The method of claim 27, wherein the neural cells are neurons
and/or glia.
37. The method of claim 27, wherein the pluripotent stem cells are
human pluripotent stem cells.
38.-56. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application No. 61/605,483, filed Mar. 1, 2012, which is hereby
incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0003] The present invention relates generally to the fields of
stem cell biology and regenerative medicine, and more particularly
to the isolation and uses of a specific population of pluripotent,
neural crest-derived stem cells. The invention also relates to
methods of pre-conditioning these pluripotent stem cells to
differentiate into specific cell lineages for different
regenerative medicine applications, such as the treatment of
degenerative diseases.
BACKGROUND OF THE INVENTION
[0004] Cellular potency, or the potential for a cell to
differentiate down various tissue lineages, is the defining
characteristic as to the viability of the cell source for a given
application. With the establishment of embryonic stem cell lines,
the idea of utilizing pluripotent cell sources for regenerative
medical applications was introduced as a promising alternative to
traditional medical practices. However, there are ethical dilemmas
as well as immunological concerns arising from the use of embryonic
cell sources in clinical settings. The advent of induced
pluripotent stem cells (iPSCs) attempted to circumvent both of
these issues and brought the concept of patient-specific
pluripotent stem cell attainment to the forefront of the field
(Takahashi et al., 2007). This iPSC technology, however, is not
without its drawbacks; still in its early stages, the scientific
community is trying to decipher the mechanisms underlying the
induction of pluripotency (Rezanejad et al., 2012) and overcome the
aberrant epigenetic changes arising from the implementation of the
technique (Ruiz et al., 2012). Nevertheless, the potential of
obtaining pluripotent stem cells from adult tissues is of
significant importance and remains as the ultimate goal in
overcoming the limitations presently found with other post-natal
stem cell populations.
[0005] Researchers have worked on the identification and isolation
of remnant embryonic-like cells from adult tissues (Conrad et al.,
2008; Wagers et al., 2004; Jiang et al., 2002). One of the main
focuses has been on tissues arising from the neural crest (Coura et
al., 2008; Dupin et al., 2012). Neural crest cells are a population
of multipotent and migratory cells that originate from the neural
folds during vertebrate development. They are capable of
differentiating into diverse cell lineages with regards to the
positioning along the anterior-posterior axis (Taneyhill et al.,
2008). Beside the specification to cranial ganglia, craniofacial
cartilages and bones, thymus, middle ear bones and jaws, the
cranial neural crest cells migrating to the pharyngeal pouches and
arches can contribute to tooth formation (Degistirici et al.,
2008). They give rise to most dental tissues including
odontoblasts, dental pulp, apical papilla, dental follicle and
periodontal ligament (PDL). PDL is a soft connective tissue located
between the root of tooth and alveolar bone socket. It contains a
mixed population of fibroblasts, epithelial, undifferentiated
mesenchymal, bone and cememtum cells, sitting in the hydrated
extracellular ground substance with collagen-rich fibrils. Apart
from fixing the tooth to the alveolar bone and withstanding the
compressive force during the chewing motion, PDL provides sensory,
nutritive and homeostatic support to the alveolar compartment.
[0006] Seo and colleagues found that enzymatic treatment of human
PDL released a postnatal stem cell population capable of clonogenic
growth (Seo et al., 2004). These undifferentiated cells express
markers of mesenchymal stem cells (STRO-1, scleraxis), embryonic
stem cells (Oct4, Sox2, Nanog and Klf4) and neural crest cells
(nestin, Slug, p75 neurotrophin receptor, Sox10), reflecting their
pluripotent characteristics, and can differentiate to neurogenic,
cardiomyogenic, chondrogenic and osteogenic lineages (Huang et al.,
2009; Song et al., 2012; Coura et al., 2008). Given their easy
accessibility and vast differentiation potential, PDL-derived stem
cells could be an important cell source for regenerative medicine.
However, there remains a need in the art for methods of isolating a
homogeneous population of pluripotent stem cells from neural crest
tissue, like the periodontal ligament, as well as methods of
conditioning these pluripotent stem cells to differentiate into
desired cell lineages for specific regenerative medicine
applications.
SUMMARY OF THE INVENTION
[0007] The present invention is based, in part, on the discovery
that connexin 43 can be used as a selection marker to obtain a
substantially homogeneous population of pluripotent stem cells from
neural crest tissue, such as the adult periodontal ligament.
Accordingly, the present invention provides a method of selecting
and isolating pluripotent stem cells from neural crest-derived
tissue and using such isolated stem cells in the repair of damaged
tissues and the treatment of various degenerative diseases.
[0008] In one embodiment, the method of isolating pluripotent stem
cells comprises extracting cells from tissue derived from the
neural crest, culturing said extracted cells under adherent
conditions, and isolating said cultured cells that express
Connexin-43, wherein said isolated cells are pluripotent stem
cells. Such isolated pluripotent stem cells are capable of
differentiating into cells of the ectoderm, endoderm, and mesoderm
lineages. In certain embodiments, the tissue derived from the
neural crest is adult periodontal ligament. Expression of one or
more stem cell markers (e.g., Oct4, Nanog, Sox2, Klf4) or neural
crest markers (e.g., p75 neurotrophin receptor, Nestin, Sox10,
N-Cadherin, Slug) may be assessed in the extracted or cultured
cells prior to isolation.
[0009] The present invention also includes homogeneous and
substantially pure populations of adult human pluripotent stem
cells isolated by the selection methods of the invention. In some
embodiments, the homogeneous or substantially pure population
comprises pluripotent stem cells that are positive for at least one
stem cell marker, express Connexin-43, are capable of
differentiating into cells of the ectoderm, endoderm, and mesoderm
lineages, and are isolated from human tissue derived from the
neural crest. In certain embodiments, the pluripotent stem cells
are isolated from adult human periodontal ligament. In other
embodiments, 70% or greater of the pluripotent stem cells in the
population are positive for Oct4. Pharmaceutical compositions
comprising the homogeneous or substantially pure populations of
adult pluripotent stem cells as wells as methods of making the
pharmaceutical compositions are also encompassed by the present
invention.
[0010] In another embodiment, the present invention provides
methods of differentiating the pluripotent stem cells into specific
cell lineages. In one embodiment, a method of differentiating
pluripotent stem cells isolated from adult periodontal ligament to
neural progenitor cells or neural cells is provided. In certain
embodiments, the method comprises incubating the pluripotent stem
cells in a culture media comprising epidermal growth factor (EGF)
and basic fibroblast growth factor (bFGF) for a period of time,
wherein a plurality of said pluripotent stem cells are
differentiated into neural progenitor cells or neural cells at the
end of the period of time.
[0011] In another embodiment, a method of differentiating
pluripotent stem cells isolated from adult periodontal ligament to
retinal progenitor cells or retinal cells is provided. The method
comprises treating cells with Noggin, Dkk-1, and optionally
insulin-like growth factor-1 (IGF-1). For instance, in certain
embodiments, the method comprises culturing said pluripotent stem
cells under non-adherent conditions in a first induction media
comprising a first concentration of Noggin, a first concentration
of Dkk-1, and IGF-1 for a first period of time to obtain
neurospheres, and plating the spheres on a substrate in a second
induction media comprising a second concentration of Noggin and a
second concentration of Dkk-1 for a second period of time, wherein
a plurality of said pluripotent stem cells are differentiated into
retinal progenitor cells or retinal cells at the end of the second
period of time. In some embodiments, the second concentrations of
Noggin and Dkk-1 are higher (e.g. ten-fold) than the first
concentrations of Noggin and Dkk-1.
[0012] Methods of repairing damaged tissue in a subject in need
thereof by administering the isolated pluripotent stem cells or
pharmaceutical compositions described herein are also provided by
the present invention. The isolated pluripotent stem cells may
optionally be preconditioned or induced to differentiate into
specific cell lineages, such as neurogenic or retinogenic lineages,
prior to administration to the subject. Damaged tissue that can be
repaired by the methods of the invention include tissue damaged due
to injury, ischemic events, or degenerative diseases or disorders.
In certain embodiments, the pluripotent stem cells are isolated
from the subject to whom they will be administered (i.e. the
pluripotent stem cells are autologous).
BRIEF DESCRIPTION OF DRAWINGS
[0013] FIG. 1. Schematic of magnetic bead sorting technique. (1)
Suspension of heterogeneous periodontal ligament-derived stem cell
populations. (2) Labeling of Cx43 gap junction protein with primary
antibody. (3) Appropriate anti-primary antibody conjugated magnetic
iron bead incubation and magnetic separation of positively selected
cells. (4) Selection of Cx43-positive cells and culture. Image:
Brightfield image of cell surrounded by magnetic beads following
selection.
[0014] FIG. 2. Diagram illustrating the FACS technique.
Immunocytochemically-positive marked cells are detected by the
photomultiplier and loaded in electrically charged droplets which
get deflected by the deflection plates and collected separately
from negative cell populations.
[0015] FIG. 3. Brightfield images of cell culture of Cx43+ (with
remaining magnetic beads) (A), and Cx43-negative (B) periodontal
ligament-derived stem cells. Bar=50 .mu.m.
[0016] FIG. 4. Brightfield images of Cx43+ periodontal
ligament-derived stem cell culture following non-adherent
aggregation and subsequent adherent culture. (A) Cell cluster from
aggregation stage attached to culture surface. (B) Representative
image of branched network culture morphology. (C-D) Observed
neural-like phenotypes in aggregate-adherent cultures.
[0017] FIG. 5. Double immunohistochemical images (top) of the
expression of pluripotency-associated transcription factors OCT4,
Nanog, and Sox2 (red) and nucleic acids (blue) in unfractionated
(left) and Cx43+ (right) cell populations of periodontal
ligament-derived stem cells. Bar graph (bottom) depicting the
quantitative expression of transcription factor OCT4 in
unfractionated and Cx43+ cell populations of periodontal
ligament-derived stem cells. (**p<0.01). Images are
representative of obtained results for three cell lines.
[0018] FIG. 6. Immunohistochemical images of the expression of
neural crest-specific markers Sox10, p75NTR, Nestin, and N-cadherin
(N-cad) in Cx43+ cell populations of periodontal ligament-derived
stem cells. Middle right and bottom left images show co-expression
and localization of N-cadherin and Nestin, respectively, with Cx43
in these cells. Images are representative of obtained results for
three cell lines.
[0019] FIG. 7. Hematoxilin and Eosin (H&E) stained histological
section images of identified tissues within teratomas formed by
Cx43M19p5 cell line (Cx43+ periodontal ligament-derived stem cells)
in immunodeficient mice. Images show mesodermal [cartilage (A),
ossified cartilage (B)], endodermal [glands (C), ducts (D)], and
ectodermal [pigmented cells (E)] within the tumor mass. Image F is
a representative image of tumors formed on kidneys (left) and
testis (right) of cell-inoculated animals.
[0020] FIG. 8. Top: Hematoxilin and Eosin (H&E) stained
histological section images of identified neural crest-associated
tissues within teratomas formed by Cx43M19p5 cell line (Cx43+
periodontal ligament-derived stem cells) in immunodeficient mice.
Images show formation of mature human cccrine sweat glands (A),
intestinal epithelium (B) and smooth muscle (C) tissues within
teratoma masses. Bottom: Immunohistochemical images showing
undifferentiated stem cells expressing OCT4 (D1-3), as well as
positively marked endoderm (E1-2) and ectoderm (F1-2). Cells
expressing connexin 43 were found in structures similar to those
where GFAP neural marker was localized (C).
[0021] FIG. 9. Gene expression of PDLSC following EGF+bFGF
Treatment. A significant increase can be seen in key immature
neuron/progenitor markers following EGF+bFGF treatment (TUBB3
p<0.01, NESTIN p<0.0001). A significant decrease is also seen
in NOG (p<0.0001). Data was pooled from 3 separate experiments.
Control n=12, Treated n=18.
[0022] FIG. 10. Light microscopic images of (A) EGF+bFGF-treated
PDLSCs and (B) untreated, control PDLSCs. The treated cells (A)
connect and begin to form networks, whereas the untreated, control
cells (B) coalesce and form no visible cell-cell connections.
[0023] FIG. 11. Scanning Electron Micrographs of EGF+bFGF-treated
PDLSCs and untreated, control PDLSCs. (A) Treated PDLSCs have two
distinct phenotypes. The glial phenotype is wide and flat, with
thick processes. The neuronal phenotype is characterized by a more
rounded and raised cell body, with thin processes that then have
further branching. Scale bar=50 .mu.m. (B) The treatment induces a
neuronal phenotype with a raised cell body, with thin processes,
which connect to processes from other cells. Scale bar=10 .mu.m.
(C) Untreated, control PDLSCs have no visible processes, and form a
"sheet" of cells instead of a cell network. Scale bar=50 .mu.m. (D)
At a higher magnification, endocytic vesicles can be seen on the
control cells. Scale bar=5 .mu.m.
[0024] FIG. 12. Immunohistochemical staining of EGF+bFGF-treated
and untreated PDLSCs. (A) Glial fibrillary acidic protein
(GFAP)-labeled cells are observed in EGF+bFGF-treated PDLSC
cultures. GFAP is green and DAPI, a nuclear marker, is shown in
blue. (B) .beta.-tubulin III (TUBB3)-labeled cells are observed in
EGF+bFGF-treated PDLSC cultures. TUBB3 is red, and DAPI, a nuclear
marker, is shown in blue. (C) Synaptophysin, a synaptic vesicle
glycoprotein (shown in green/yellow), can be seen in
EGF+bFGF-treated PDLSC cultures at the locations where one cell
comes in contact with another cell. Alexa Flour 568 Phalloidin
(staining the cytoskeleton) is in red, and DAPI, a nuclear marker,
is in blue.
[0025] FIG. 13. Inward and outward currents of EGF+bFGF-treated and
untreated PDLSCs. (A) Representative outward and inward currents
from a differentiated, neural-like PDLSC following treatment with
EGF+bFGF. Currents were elicited by voltage steps from a holding
potential of -100 mV to various voltages, as illustrated above the
current traces. Fast inactivating inward currents and slow but
sustained outward currents are shown in 20 mV steps. (B) Peak
outward and inward current densities, measured as current amplitude
per unit cell capacitance (proportion to cell surface area), were
plotted against testing pulse voltages. Error bars indicate
standard error of the means. N=6 for both untreated, control and
EGF+bFGF-treated (i.e. differentiated) cells. Significant
differences (p<0.01, t-test) were found for the inward currents
between control and neural-like PDLSC at the four voltages tested.
(C) Voltage-dependent inactivation (a characteristic of
voltage-gated sodium channels and T-type calcium channels) of the
inward currents in a neural-like PDLSC was assayed with a
traditional two-pulse protocol, where the current availability
during the test pulse was used to evaluate the amount of
inactivation during the first pulse or prepulse. Inward currents
were induced similarly as in (A), but stepped briefly (1.5 ms) to
-100 mV before tested again at +10 mV. Prepulse voltages are
color-coded as in (D). (D) Voltage-dependent inactivation of the
inward currents were normalized to the maximal and minimal currents
in each cell before being averaged and fitted with the Boltzmann
equation: I/Imax=1/{1+exp[(V+40.0 mV)/13.55 mV]}. N=4.
[0026] FIG. 14. Primary human PDLSC culture and characterization.
(A) A representative colony of primary cells in culture for 4 days.
(B) Stellate and spindle-shaped cells at day 14 of culture. (C)
Growth curves of PDL-8, 10, 13 and 15 cells at passage 2. Each
point represents mean.+-.standard deviation from triplicate
experiments. (D) RT-PCR analysis showing the expression of neural
crest genes (Notch1, BMP2, Slug, Snail, Nestin and Tuj1) in primary
PDL-8, 13 and 15 cells at passage 2. The expression levels were
compared to two freshly dissected PDL tissues. (E) PDL cells
expressed ES pluripotency genes, c-Myc and Klf4, at comparable
levels as human ES H1 cells, but Nanog, Oct4 and Sox2 had
negligible expression. The relative fold changes of c-Myc and Klf4
among primary PDL and H1 cells are shown in (F).
[0027] FIG. 15. (A to D, I to K) Representative confocal
immunofluorescence images showing the vast expression of MSC
markers (A, CD44; B, CD90 and C, vimentin), ES cell marker (D,
SSEA-4) and neural crest markers (I, Nestin; J, p75/NGFR and K,
Tuj1) in PDL-8 at passage 2. Nuclei were counterstained with DAPT
(blue). Scale bars, 50 .mu.m. (E to H) Flow cytometric histograms
showing event profile of (E) CD44, (F) CD90, (G) vimentin and (H)
SSEA4. Open histograms denote the isotype control.
[0028] FIG. 16. Retinal fate induction of primary PDL cells. (A) A
schematic illustration of retinal fate induction of PDL cells
towards the formation of neurospheres by floating culture and
neuron-like cells by adherent culture. (B) Cell morphology changes
of PDL cells at time intervals of induction. Scale bars, 200
.mu.m.
[0029] FIG. 17. Characterization of PDLSC-derived neurospheres. The
neurospheres at day 3 of low attachment culture were collected and
assayed for expression of (A) Nestin, (B) p75/NGFR, (E) ABCG2, (F)
Pax6, (I) SSEA4 and (J) Tuj1. (C, G, K) All nuclei were
counterstained with DAPI and (D, H, L) were merged images of
respective staining. (M) Low magnification picture showing
neurite-like processes extending from neurospheres. (N) Phase
contrast micrograph of neurospheres attached on matrigel-coated
surface at day 3 of culture. The insert shows neurites between
spheres. Scale bars, 50 .mu.m.
[0030] FIG. 18. Retinal lineage commitment of human PDLSC. (A-F)
Immunostaining of neuronal markers (Tuj1, S100 and NFM) at day 25
of treatment (D-F), when compared to untreated control (A-C). Scale
bars: 50 .mu.m. (G and H) RT-PCR and qPCR analyses showing an
up-regulation of genes identifying retinal progenitors (Lhx2, Dcx,
Chx10, Rx, Sox2, Otx2) and photoreceptors (Nrl and rhodopsin) at
various time intervals during treatment.
[0031] FIG. 19. PDLSCs express Pax6 and Rx under retinal fate
induction. Confocal immunofluorescence pictures showing Pax6
localization in (A) untreated cells and (B) cells treated for 25
days. Significant nuclear translocation of Pax6 was detected after
induction. (C) Percentage of cells with nuclear Pax6 increased
during treatment. The data represented mean.+-.SD from three
independent experiments. (D-F) Rx was induced in cells with Pax6
nuclear expression. Nuclei were counterstained with DAPI. (G-I)
Expression of Pax6 nuclear Rx+ cells at 25 days of induction, when
compared to (J-K) control cells at day -1. (M) Percentage of Pax6
nuclear Rx+ cells increased during treatment. (N) A representative
picture of Pax6 nuclear Rx+ cells at day 17 of experiment. All
quantitative data in (C) and (M) represented mean.+-.SD from three
independent experiments. Scale bars, 50 .mu.m.
[0032] FIG. 20. Photoreceptor fate of PDLSCs under induction.
Compared to control cells (A), treated cells (B) at day 25
exhibited rhodopsin expression. (C-D) Cells under prolonged
treatment for 45 days displayed dendritic morphology (C) and
rhodopsin (Rho) expression in the cell body as well as along the
neurite process (D). Nuclei in (A) and (D) were counterstained with
DAPI. Scale bars, 50 .mu.m. (E) Western blot analysis showing
elevated rhodopsin kinase at day 25 of retinal fate induction.
Expression of proliferating cell nuclear antigen had negligible
change. .beta.-Actin served as the housekeeping control.
[0033] FIG. 21. Glutamate evokes calcium influx in PDLSCs under
retinal fate induction. (A) Representative pseudo-color images of
Fluo-4 AM fluorescence in untreated and treated PDLSCs (day 25)
after 1 mM glutamate insult for 35, 60 and 120 sec. The color code
denotes the calcium level. Scale bar, 100 .mu.m. (B) Calcium flux
profiles of 5 randomly selected cells (indicated in A upper right
image). The fluorescence intensity change was represented as %
.DELTA.F/F0. The detection was carried out until 120 sec of
glutamate stimulation. (C) Peak calcium responses in treated cells
(PDL-8, 10 and 15) at day 25 was compared to baseline levels. All
data are mean.+-.SD, determined from 50 cells in 3 separate
experiments. * P<0.001 (paired Student's t-test).
DETAILED DESCRIPTION OF THE INVENTION
[0034] The present invention is based, in part, on the discovery
that connexin 43 can be used as a surface marker to select and
isolate remnant neural crest pluripotent stem cells from adult
human tissues, such as adult periodontal ligaments. The inventors
have surprisingly found that selection of connexin 43-positive
cells from adherent cultures of cells isolated from adult human
periodontal ligaments results in a substantially homogeneous
population of pluripotent, embryonic-like stem cells that are
capable of generating cells from all three germ layers. The
isolation methods of the invention allow for the creation of
patient-specific cell lines from tissues that can be easily
obtained from routine medical procedures. Such isolated pluripotent
stem cells find use in various regenerative medicine applications,
such as treatment of degenerative diseases and disorders.
[0035] In one embodiment, the present invention provides a method
of isolating pluripotent stem cells comprising extracting cells
from tissue derived from the neural crest, culturing said extracted
cells under adherent conditions, and isolating said cultured cells
that express Connexin-43, wherein said isolated cells are
pluripotent stem cells. "Pluripotent stem cells" are stem cells
that have the potential to differentiate into any of the three germ
layers: endoderm (e.g., interior stomach lining, gastrointestinal
tract, the lungs), mesoderm (e.g., muscle, bone, blood,
urogenital), or ectoderm (e.g., epidermal tissues and nervous
system). Thus, the pluripotent cells isolated by the methods of the
invention are capable of differentiating into cells of the
ectoderm, endoderm, and mesoderm lineages, including neurogenic,
adipogenic, cardiomyogenic, chondrogenic, myogenic and osteogenic
lineages. Pluripotency of the isolated stem cells can be assessed
by various in vitro and in vivo methods, including in vitro
differentiation assays or in vivo teratoma formation in
immunodeficient mice.
[0036] Preferably, the cells are extracted from adult neural crest
tissues. Thus, the pluripotent stem cells isolated by the methods
of the invention are adult pluripotent stem cells. As used herein,
"adult stem cells" refer to stem cells that are not embryonic in
origin nor derived from embryos or fetal tissue. The term adult
stem cells also encompasses stem cells isolated from subjects of
all ages (e.g. human infants and children). Tissues derived from
the neural crest from which cells can be extracted include, but are
not limited to, dental pulp, periodontal ligament, gut, dorsal root
ganglia, exfoliated deciduous teeth (including baby teeth), hair
follicle, skin, lung, cartilage, dental follicle, olfactory
epithelium, turbinates (e.g., nasal concha: superior, middle and
inferior), cardiac outflow tract, cardiac semilunar valves,
myocardium, and cardiac septum. In certain embodiments, cells are
extracted from periodontal ligament, preferably adult periodontal
ligament. Methods of extracting cells from tissue samples are known
to those of skill in the art and may include mechanical separation
(e.g., mincing) and/or enzymatic digestion of the tissue followed
by placement in appropriate culture media, such as those described
herein. Cells may be optionally filtered to produce single-cell
suspensions and subsequently cultured to produce clones from
individual cells.
[0037] In some embodiments, the cells are extracted from tissue
obtained from a patient or subject in need of treatment. In other
words, the pluripotent stem cells isolated by the methods of the
invention are autologous stem cells, which refers to stem cells
that are derived or transferred from the same individual's body. In
contrast, "allogeneic stem cells" are stem cells that are
genetically different although belonging to or obtained from the
same species. A patient or subject in need of treatment may be a
patient or subject who has damaged organ tissue as a result of
injury (e.g., spinal cord injury), ischemia (e.g. myocardial
infarction or stroke), or degenerative disease (e.g. Parkinson's
Disease, Alzheimer's Disease, amyotrophic lateral sclerosis,
osteoarthritis, or macular degeneration). As used herein, "patient"
or "subject" may encompass any vertebrate, including but not
limited to, humans, primates, mammals, reptiles, amphibians and
fish. However, advantageously, the patient or subject is a mammal
such as a human, or a mammal such as a domesticated mammal, e.g.,
dog, cat, horse, and the like, or production mammal, e.g., cow,
sheep, pig, and the like. In a preferred embodiment, the patient or
subject is human.
[0038] In certain embodiments, cells extracted from the neural
crest-derived tissue are cultured under adherent conditions.
"Adherent culture conditions" involve plating cells on a substrate
or surface that is optionally coated with a substance that
facilitates adhesion of the cells to the substrate or surface, such
as one or more components of the extracellular matrix.
"Non-adherent" or "suspension" culture conditions involve growing
the cells in a free-floating manner in the culture medium, e.g. in
a tissue flask or container. The cells may be passaged (i.e.
subcultured or split) one or more times prior to selection of cells
expressing connexin 43 or other markers as described in more detail
below. In some embodiments, the cells are passaged at least twice
prior to selection for one or more surface markers. In other
embodiments, the cells are passaged at least three times prior to
selection for one or more surface markers. In still other
embodiments, the cells are passaged at least four times prior to
selection for one or more surface markers.
[0039] Following propagation in adherent cell cultures, cells
expressing connexin 43 are selected and isolated. Connexin 43 is a
surface protein that is a component of cellular gap junctions and
can be detected by routine methods known to the skilled artisan.
Such methods include, but are not limited to, labeling with an
anti-connexin 43 antibody followed by fluorescence-activated cell
sorting (FACS), magnetic bead cell sorting, or modified forms of
affinity chromatography. The cells expressing connexin 43 isolated
from the adherent cell culture constitute a substantially
homogeneous population of pluripotent stem cells. This
substantially homogeneous pluripotent stem cell population can be
incorporated into pharmaceutical compositions and used in methods
of tissue repair and treatment as described herein. The pluripotent
stem cells positive for connexin 43 may be further expanded and
propagated in culture following isolation.
[0040] In certain embodiments, the method further comprises
screening the extracted or cultured cells for expression of
connexin 43 or one or more stem cell markers or neural crest
markers prior to isolation. Suitable stem cell markers include, but
are not limited to, Oct4, Nanog, Sox2, Klf4, or combinations
thereof. Neural crest markers, the expression of which may be
assessed in the extracted or cultured cells, include, but are not
limited to, p75 neurotrophin receptor, Nestin, Sox10, N-Cadherin,
Notch1, BMP2, Slug, Snail, or combinations thereof. The cells
expressing one or more stem cell or neural crest markers may be
selected or isolated to obtain a subpopulation of cells that is in
turn subject to selection for connexin 43 expression.
Alternatively, the expression of one or more stem cell or neural
crest markers may be determined in the isolated cells expressing
connexin 43 to assess the homogeneity or purity of the pluripotent
stem cell population. Cells that are "positive" for a marker are
cells that express the marker protein at a level detectable by
routine methods known to those of skill in the art, such as
immunohistochemistry, FACs, immunoblotting, and the like. In
contrast, cells that are "negative" for a marker refer to cells
that do not express detectable levels of the marker protein using
routine methods.
[0041] The present invention also includes a population of
pluripotent stem cells isolated by the methods described herein.
For instance, in one embodiment, the invention encompasses a
homogeneous or substantially pure population of adult pluripotent
stem cells, wherein said stem cells are positive for at least one
stem cell marker, express connexin 43, are capable of
differentiating into cells of the ectoderm, endoderm, and mesoderm
lineages, and are isolated from tissue derived from the neural
crest. In certain embodiments, the cells are isolated from adult
periodontal ligament. In preferred embodiments, the adult
pluripotent stem cells are human pluripotent stem cells and are
isolated from human neural crest-derived tissue, such as adult
human periodontal ligament.
[0042] As used herein, a "substantially pure population" means at
least 80%, at least 85%, at least 90%, at least 95%, at least 96%,
at least 97%, at least 98%, at least 99%, or 100% pure i.e., that
the population comprises at least 80%, at least 85%, at least 90%,
at least 95%, at least 96%, at least 97%, at least 98%, at least
99%, or 100% pluripotent stem cells. In certain embodiments, the
pluripotent stem cells express one or more stem cell markers (e.g.,
Oct4, Nanog, Sox2, Klf4) or neural crest markers (e.g., p75
neurotrophin receptor, Nestin, Sox10, N-Cadherin, Slug) as
described herein. In one particular embodiment, the pluripotent
stem cells exhibit nuclear expression of Oct4. In these and related
embodiments, 70% or greater, 75% or greater, 80% or greater, 85% or
greater, or 90% or greater of said stem cells in the substantially
pure population are positive for Oct4.
[0043] The invention also encompasses methods for preparing
compositions, such as pharmaceutical compositions, including the
isolated pluripotent stem cells (e.g. periodontal ligament-derived
pluripotent stem cells), for instance, for use in inventive methods
for repairing damaged tissue and treating degenerative disorders or
conditions. In one embodiment, the pharmaceutical composition
comprises a therapeutically effective amount of isolated
pluripotent stem cells and a pharmaceutically acceptable carrier,
wherein said isolated pluripotent stem cells are positive for at
least one stem cell marker, express Connexin-43, are capable of
differentiating into cells of the ectoderm, endoderm, and mesoderm
lineages, and are isolated from tissue derived from the neural
crest. In another embodiment, the pluripotent stem cells are
isolated from human neural crest-derived tissue. In still another
embodiment, the pluripotent stem cells are isolated from adult
human periodontal ligament. A "therapeutically effective amount"
refers to an amount sufficient to effect a beneficial or desired
clinical result. For example, a therapeutically effective amount of
isolated pluripotent stem cells is an amount sufficient to effect
repair of damaged tissue and/or ameliorate one or more systems of a
degenerative disease or disorder. In one embodiment, a
therapeutically effective amount of isolated pluripotent stem cells
is about 1.times.10.sup.5 to about 1.times.10.sup.7 cells/dose.
However, the precise determination of what would be considered an
effective dose may be based on factors individual to each subject,
including their size, age, type of tissue damage to be repaired,
and amount of time since damage, or stage/severity of disorder or
disease to be treated. Thus, the skilled artisan can readily
determine the dosages and the amount of isolated stem cells and
optional additives, vehicles, and/or carrier in compositions to be
administered in the treatment methods of the invention.
[0044] The pharmaceutical compositions comprising the isolated
pluripotent stem cells can be prepared, in some embodiments, by
suspending or mixing the homogeneous or substantially pure
population of pluripotent stem cells as described herein with a
pharmaceutically acceptable carrier. The phrase "pharmaceutically
acceptable" refers to molecular entities and compositions that do
not produce an adverse, allergic or other untoward reaction when
administered to an animal, such as, for example, a human, as
appropriate. Suitable pharmaceutically acceptable carriers include,
but are not limited to, sterile water, physiological saline,
glucose or the like. Standard texts, such as "REMINGTON'S
PHARMACEUTICAL SCIENCE", 17th edition, 1985, incorporated herein by
reference, may be consulted to prepare suitable preparations,
without undue experimentation. Moreover, for animal (e.g., human)
administration, it will be understood that preparations should meet
sterility, pyrogenicity, general safety and purity standards as
required by FDA Office of Biological Standards.
[0045] The present invention also provides methods of
differentiating or preconditioning the isolated pluripotent stem
cells described herein to differentiate to a particular cell
lineage, such as neurogenic, adipogenic, cardiomyogenic,
chondrogenic, myogenic, or osteogenic lineage. Because pluripotent
stem cells have the capability of differentiating into any adult
cell type, conditioning or inducing the stem cells to commit to a
specific, desired cell lineage prior to administration to a patient
or subject in need of treatment can minimize the in vivo generation
of unwanted cell types.
[0046] A heterogeneous population of pluripotent stem cells
isolated from neural crest-derived tissue (e.g. adult periodontal
ligament) as described in Huang et al., 2009, which is hereby
incorporated by reference in its entirety, can be used in the
preconditioning or differentiation methods of the invention.
Alternatively, the substantially homogeneous population of neural
crest-derived pluripotent stem cells (e.g. periodontal
ligament-derived pluripotent stem cells) obtained by selection of
the connexin 43 surface protein as described herein can be used in
the preconditioning or differentiation methods of the invention. In
certain embodiments, the pluripotent stem cells are human
pluripotent stem cells. Specific methods of inducing the
pluripotent stem cells to differentiate into the neural and retinal
lineages is described in more detail below. Methods of inducing
differentiation into other lineages, including cardiomyogenic,
osteogenic, and chondrogenic lineages is described in U.S. Patent
Publication No. 2011/0236356, which is hereby incorporated by
reference in its entirety.
[0047] In one aspect, the invention provides a method of
differentiating pluripotent stem cells isolated from adult
periodontal ligament to neural progenitor cells or neural cells. In
one embodiment, the method comprises incubating said pluripotent
stem cells in a culture media comprising epidermal growth factor
(EGF) and basic fibroblast growth factor (bFGF) for a period of
time, wherein a plurality of said pluripotent stem cells are
differentiated into neural progenitor cells or neural cells at the
end of the period of time.
[0048] The pluripotent stem cells can be cultured under adherent or
non-adherent (e.g., suspension) conditions. In one particular
embodiment, the stem cells are cultured under adherent conditions,
for example, by plating on a substrate or surface. The stem cells
may be passaged one or more times as described herein prior to
exposure to the growth factors. EGF and bFGF can be added to a
defined media containing inorganic salts, trace minerals, energy
substrates, lipids, amino acids, vitamins, growth factors and
proteins, and other components. In certain embodiments, EGF and
bFGF are added to commercially available media, such as DMEM media.
In such embodiments, the DMEM media may be supplemented with other
components, such as nutrients (e.g., DMEM/F12 media), glucose,
fetal bovine scrum, penicillin, streptomycin, and antimycotics
(e.g., amphotericin B). EGF may be added to the culture media at a
concentration from about 10 ng/ml to about 250 ng/ml, or from about
25 ng/ml to about 150 ng/ml, or from about 10 ng/ml to about 75
ng/ml. In certain embodiments, EGF is present in a concentration of
about 50 ng/ml. bFGF may be added to the culture media at a
concentration from about 10 ng/ml to about 250 ng/ml, or from about
25 ng/ml to about 150 ng/ml, or from about 10 ng/ml to about 75
ng/ml. In certain embodiments, bFGF is present in a concentration
of about 50 ng/ml.
[0049] To induce differentiation of or commit the isolated
pluripotent stem cells to a neurogenic lineage, the stem cells
should be exposed to the combination of EGF and bFGF for at least
four days. The growth factor incubation period can be from about 4
days to about 12 days, or from about 6 days to about 10 days, or
from about 7 days to about 21 days, or, in some embodiments, about
8 days. The incubation or exposure time may adjusted for the
particular application for which the pluripotent stem cells are to
be used. For instance, shorter incubation times may be desirable if
the stem cells are to be preconditioned to a neurogenic lineage
shortly before administration to a patient or subject in need of
neuronal tissue repair. Longer incubation times may be desirable if
complete or nearly complete differentiation to mature neuronal
cells is required to generate, for example, ex vivo neuronal tissue
for subsequent implantation as grafts.
[0050] Following the incubation period with EGF and bFGF, a
plurality of said pluripotent stem cells are differentiated into
neural progenitor cells or neural cells, including both neurons and
glia. The differentiated cells may be identified through cell
morphology, electrophysiology characteristics, and/or expression of
any markers known in the art to identify the cells in question. For
instance, in one embodiment, neural progenitor cells or neural
cells are identified by the expression of one or more markers.
Suitable markers for the identification of neural progenitor cells
include, but are not limited to, nestin, MSi-1, N-cadherin, Sox1,
Sox2, ABCG2, Pax6, and Tau (neurofibrillary tangle protein).
Suitable markers for the identification of neurons include, but are
not limited to, .beta.-III tubulin (TUBB3; also known as Tuj1),
microtubule associated proteins (e.g., MAP-1, MAP-2, and MAP-5),
ChAT (choline acetyltransferase), CgA (anti-chromagranin A), DARRP
(dopamine and cAMP-regulated phosphoprotein), DAT (dopamine
transporter), GAD (glutamic acid decarboxylase), GAP (growth
associated protein), NeuN (neuron-specific nuclear protein); NF
(neurofilament), neurofilament medium (NEFM), NGF (nerve growth
factor), .gamma.-NSE (neuron specific enolase), SERT (serotonin
transporter), synapsin, synaptophysin, Tau (neurofibrillary tangle
protein), TRK (tyrosine kinase receptor; e.g., TrkA, TrkB, TrkC),
TRH (tryptophan hydroxylase), TH (tyrosine hydroxylase), VRL
(vanilloid receptor like protein), VGAT (vesicular GABA
transporter), and VGLUT (vesicular glutamate transporter).
[0051] Glial cells include both astrocytes and oligodendrocytes.
Astrocytes may be identified by expression of astrocyte markers,
such as GFAP (glial fibrillary acid protein), ASTO-1, or S-100
protein. Oligodendrocytes may be identified by expression of
oligodendrocyte markers, such as GC (galactocerebrocide, also
referred to as GalC), MBP (myelin basic protein), CNPase
(2',3'-cyclic nucleotide 3'-phosphodiesterase), NSP, RIP, MOSP, O1
or O4.
[0052] In other embodiments, the differentiated cells may be
identified by cell morphology. Compact, rounded cell bodies that
extend thin processes are characteristic features of neurons,
whereas glial cells have flat, wide cell bodies that extend thick
processes and typically have a star-like appearance (see, e.g.,
FIG. 12). In certain embodiments, the differentiated cells may be
identified by their electrophysiological characteristics. Neural
cells are electrically excitable and exhibit changes in membrane
voltage mediated by activation and inactivation of voltage-gated
ion channels in response to various electrical and chemical (e.g.
neurotransmitters) stimuli. Typically, neurons have voltage-gated
sodium and potassium channels that underlie action potentials.
Thus, neuronal cells can be identified by measuring inward sodium
currents and outward, delayed rectifying potassium currents by
standard voltage-clamping techniques (see Example 3).
[0053] In another aspect, the invention provides a method of
differentiating pluripotent stem cells isolated from adult
periodontal ligament to retinal progenitor cells or retinal cells.
In certain embodiments, the method comprises treating the
pluripotent stem cells with a combination of an antagonist of the
bone morphogenetic protein (BMP) signaling pathway and an
antagonist of the WNT/beta-catenin signaling pathway. Suitable
antagonists of the BMP signaling pathway include, but are not
limited to, noggin, chordin, follistatin, and Xnr3. Suitable
antagonists of the WNT/beta-catenin signaling pathway include, but
are not limited to, Wnt Inhibitory Factor 1 (WTF1) and Dickkopf 1
(Dkk-1). In some embodiments, the method comprises treating cells
with Noggin, Dkk-1, and optionally IGF-1. For instance, in one
embodiment, the method comprises first obtaining neurospheres by
culturing the pluripotent stem cells under non-adherent (i.e.
suspension) conditions in a first induction media for a first
period of time, and then plating the neurospheres on a substrate or
surface in a second induction media (e.g., adherent culture) for a
second period of time, wherein a plurality of said pluripotent stem
cells are differentiated into retinal progenitor cells or retinal
cells at the end of the second period of time in adherent culture.
The stem cells may be passaged one or more times as described
herein prior to the induction method (i.e., prior to the step of
obtaining neurospheres).
[0054] The first induction media may comprise at least one
antagonist of the BMP signaling pathway and one antagonist of the
WNT/beta-catenin signaling pathway. For instance, in preferred
embodiments, the first induction media comprises a first
concentration of Noggin, a first concentration of Dkk-1 (Dickkopf
1), and insulin-like growth factor-1 (IGF-1). These proteins can be
added to defined media, including commercially available media, as
described above for the neural induction protocol. In one
embodiment, Noggin, Dkk-1, and IGF-1 are added to DMEM/F12 media
supplemented with B27. In some embodiments, one or more of these
proteins are recombinantly produced proteins. Either the murine or
human homolog of these three proteins are suitable for use in the
induction media. In certain embodiments, the human homolog of the
proteins are preferred. In one embodiment, mouse Noggin, human
Dkk-1, and human IGF-1 are included in the first induction
media.
[0055] In some embodiments, Noggin is present in the first
induction media in a concentration range from about 0.5 ng/ml to
about 20 ng/ml or about 1 ng/ml to about 10 ng/ml. In one
embodiment, Noggin is present in the first induction media at about
1 ng/ml. Dkk-1 may also be present in the first induction media in
a concentration range from about 0.5 ng/ml to about 20 ng/ml or
about 1 ng/ml to about 10 ng/ml. In a particular embodiment, Dkk-1
is present in the first induction media at about 1 ng/ml. The first
induction media may include IGF-1 in a concentration range of about
2.5 ng/ml to about 100 ng/ml or about 5 ng/ml to about 50 ng/ml. In
certain embodiments, IGF-1 is present in the first induction media
at about 5 ng/ml. In certain embodiments, the first induction media
comprises 1 ng/ml Noggin, 1 ng/ml Dkk-1, and 5 ng/ml IGF-1.
[0056] Initially, the isolated pluripotent stem cells (e.g.,
isolated periodontal ligament-derived pluripotent stem cells) are
cultured in the first induction media under non-adherent (i.e.
suspension or free-floating) conditions for a first period of time
to allow for formation of neurospheres. A period of about three
days is generally sufficient for neurosphere formation to occur.
However, the first period of time could be longer or shorter so
long as neurospheres form. For instance, the first period of time
may be from about two days to three weeks or from about three days
to about six weeks. In addition to morphological observations,
neurosphere formation can be assessed by expression of one or more
neuronal progenitor cell or neural markers as described herein. For
instance, in some embodiments, the neurospheres express one or more
neuronal progenitor cell or neural markers selected from Nestin,
p75 neurotrophin receptor, ABCG2, Pax6, and TUBB3 (also known as
Tuj1).
[0057] Following neurosphere formation, the neurospheres are plated
on a substrate or surface (i.e. under adherent conditions) in a
second induction media for a second period of time. Suitable
substrates or surfaces for neurosphere plating include, but are not
limited to, glass coverslips and microtiter wells or sheets
produced with any of the following materials: controlled pore
glass, functionalized glass, ceramics, silica, silica-based
materials, polystyrene, polystyrene latex, polyvinyl chloride,
polyvinylidene fluoride, polyvinyl acetate, polyvinyl pyrrolidone,
polyacrylonitrile, polyacrylamide, polymethyl methacrylate,
polytetrafluoroethylene, polyethylene, polypropylene, and
polycarbonate, divinylbenzene styrene-based polymers, celluloses
(such as nitrocellulose), cellulosic polymers, polysaccharides, and
metals. The substrate or surface may be coated with a substance to
facilitate adhesion, such as one or more components of the
extracellular matrix, including collagen IV, fibronectin, laminin,
and vitronectin. In certain embodiments, the substrate or surface
is coated with matrigel. Matrigel is a gelatinous protein mixture
secreted by mouse tumor cells and is commercially available (BD
Biosciences, New Jersey, USA). The mixture resembles the complex
extracellular environment found in many tissues.
[0058] The second induction media typically comprises a combination
of an antagonist of the BMP signaling pathway and one antagonist of
the WNT/beta-catenin signaling pathway. The antagonists can be the
same or different than the antagonists present in the first
induction media. In embodiments in which the antagonists are the
same as the antagonists in the first induction media, the
antagonists in the second induction media are present in a higher
concentration. In certain embodiments, the second induction media
comprises a second concentration of Noggin and a second
concentration of Dkk-1, and optionally IGF-1. Similar to
preparation of the first induction media, Noggin and Dkk-1 can be
added to a defined media, such as DMEM/F12 media. In such
embodiments, the media may further comprise N2 supplement
(Invitrogen). The second concentration of Noggin may be ten-fold
higher than the first concentration of Noggin. Thus, Noggin may be
present in the second induction media in a concentration range of
about 5 ng/ml to about 200 ng/ml or about 10 ng/ml to about 100
ng/ml. In one embodiment, Noggin is present in the second induction
media at about 10 ng/ml. Similarly, the second concentration of
Dkk-1 may be ten-fold higher than the first concentration of Dkk-1.
Thus, Dkk-1 may be present in the second induction media in a
concentration range of about 5 ng/ml to about 200 ng/ml or about 10
ng/ml to about 100 ng/ml. In one embodiment, Dkk-1 is present in
the second induction media at about 10 ng/ml. IGF-1 may optionally
be present in the second induction media at the same range of
concentrations as described for the first induction media. In
certain embodiments, the second induction medium comprises 10 ng/ml
of Noggin, 10 ng/ml of Dkk-1, and optionally 5 ng/ml IGF-1.
[0059] The second period of time should be of sufficient length to
allow the neurospheres to attach to the substrate and the cells to
expand out from the neurosphere. Thus, the second period of time
should be at least 7 days and can extend to 45 days or more. For
instance, the second period of time is about 7 days to about 50
days. In some embodiments, the second period of time is at least 25
days.
[0060] Following the adherent culture in the second induction media
(i.e. at the end of second period of time), a plurality of said
pluripotent stem cells are differentiated into retinal progenitor
cells or retinal cells. The differentiated cells may be identified
through expression of one or more markers of retinal development.
For instance, in some embodiments, a plurality of the retinal
progenitor cells or retinal cells express one or more eye field
specification genes, including without limitation Lhx2, DCX, Chx10,
Rx, Sox2, and Otx2. In related embodiments, a plurality of the
retinal progenitor cells or retinal cells are Pax6.sup.nuclear and
Rx positive--that is, express Rx in combination with nuclear
expression of Pax6. In other embodiments, a plurality of the
retinal progenitor cells or retinal cells may express one or more
markers of photoreceptors, such as Nrl (Nrl), rhodopsin, and/or
rhodopsin kinase. The photoreceptor phenotype may also be
identified by functional assays, such as increases in intracellular
calcium induced by glutamate stimulation using standard calcium
imaging techniques. Thus, in some embodiments, a plurality of the
retinal progenitor cells or retinal cells exhibit an increase in
intracellular calcium in response to glutamate stimulation as
compared to baseline cellular calcium levels (i.e. in the absence
of glutamate).
[0061] The isolated pluripotent stem cells and compositions
comprising such stem cells can be used in various therapeutic and
regenerative medicine applications. For instance, in one
embodiment, the present invention provides a method of repairing
damaged tissue in a subject in need thereof by administering to the
subject an isolated population of pluripotent stem cells or
pharmaceutical compositions comprising such cells as described
herein. The isolated pluripotent stem cells, such as the connexin
43 positive stem cells, are suitable for use in the therapeutic
methods and may optionally be preconditioned or induced to
differentiate into specific cell lineages according to the
induction methods described herein. In preferred embodiments, the
pluripotent stem cells are obtained from the same patient or
subject to whom the cells are to be administered (i.e. the
pluripotent stem cells are autologous).
[0062] Because the pluripotent stem cells of the invention have the
ability to differentiate into cells of all three germ layers
(endoderm, mesoderm, and ectoderm), including neurogenic,
adipogenic, cardiomyogenic, chondrogenic, myogenic and osteogenic
lineages, any type of damaged tissue may be repaired by
administration or implantation of the pluripotent stem cells (e.g.
periodontal ligament-derived pluripotent stem cells). For instance,
in certain embodiments, the damaged tissue is neural tissue,
retinal tissue, cardiac tissue, skeletal muscle tissue, bone, or
cartilage. The damaged tissue may arise from some type of injury
(e.g., a mechanical muscle, ligament, or bone injury or spinal cord
compression or transaction), an ischemic event (e.g., myocardial
infarction or stroke), or degenerative disease or condition (e.g.,
Alzheimer's disease, Parkinson's disease, amyotrophic lateral
sclerosis, osteoarthritis, macular degeneration).
[0063] In certain embodiments, the damaged tissue is neural tissue.
Accordingly, the invention includes a method of treating
neurodegenerative disorders and brain (e.g. stroke) and spinal cord
injuries comprising administering to the subject an isolated
pluripotent stem cell population as described herein. In one
embodiment, the isolated pluripotent stem cell population is
induced to differentiate into a neurogenic lineage by exposure to
EGF and bFGF according to the methods described herein prior to
administration of the stem cells to the patient or subject.
[0064] In other embodiments, the damaged tissue is retinal tissue.
Accordingly, the invention also includes a method of treating
ocular diseases by administering to the subject an isolated
pluripotent stem cell population as described herein. In one
embodiment, the isolated pluripotent stem cell population is
induced to differentiate into a retinal progenitor cell/retinal
cell lineage using the two step induction protocol described herein
prior to administration of the stem cells to the subject. Ocular
diseases that may be treated by such a method include, but are not
limited to, retinitis pigmentosa, age-related macular degeneration
(exudative and non-exudative), glaucoma and diabetic
retinopathy.
[0065] Administration of the isolated pluripotent stem cells (e.g.,
periodontal ligament-derived pluripotent stem cells) or
compositions thereof to a patient or subject for therapeutic
purposes will be via any common route so long as the target tissue
is available via that route. This includes administration by
systemic or parenteral methods including intravenous injection,
intraspinal injection, intrathecal injection, or intracerebral,
intraocular, intravitreal, intra-articular, intradermal,
subcutaneous, intramuscular, or intraperitoneal methods. The
pluripotent stem cells may also be administered to a patient or
subject in need of treatment by implantation of a tissue graft
comprised of the stem cells or differentiated cells generated from
the stem cells. Such tissue grafts can be produced ex vivo by
differentiating the pluripotent stem cells in culture using the
media and differentiation methods described herein or described in
U.S. Patent Publication No. 2011/0236356, which is hereby
incorporated by reference in its entirety.
[0066] This invention is further illustrated by the following
additional examples that should not be construed as limiting. Those
of skill in the art should, in light of the present disclosure,
appreciate that many changes can be made to the specific
embodiments which are disclosed and still obtain a like or similar
result without departing from the spirit and scope of the
invention.
EXAMPLES
Example 1. Isolation of Pluripotent Stem Cells from Adult Human
Periodontal Ligament
[0067] Recently, our laboratory reported that a population of cells
within the periodontal ligament of adult humans retained some
expression of embryonic and pluripotency-associated markers, as
well as neural crest-specific markers (Huang et al., 2009). The
objective of this example was to investigate whether connexin 43
(Cx43) could be used as a selection marker to isolate a
substantially homogeneous, pluripotent periodontal ligament-derived
stem cell population.
[0068] Impacted 3rd molars were obtained from healthy human donors
following routine medical procedures requiring their extraction and
the middle third of the periodontal ligament was enzymatically
digested in a collagenase solution overnight and filtered through a
40 .mu.m cell strainer to obtain single-cell suspensions. Cells
were then selected for adherent-dependence and cultured in
Dulbecco's Modified Eagle Medium (DMEM; Invitrogen) supplemented
with 10% Fetal Bovine Serum (Invitrogen), and 100 U/ml
Penicillin-streptomycin (Invitrogen) and 0.1% v/v amphotericin B.
Passaging of the cells was achieved by enzymatic digestion in
Trypsin/EDTA (Invitrogen) and subcultured as mentioned above. Cell
lines were passaged at least twice before selection of Cx43+
fraction was performed.
[0069] For Cx43 selection, all cells were used at either passage 3
or 4. Following enzymatic lifting, the cells were maintained at
4.degree. C. and incubated in primary antibody against human
connexin-43 (abeam #ab11370) diluted to 1:100 in 2% FBS-containing
DMEM overnight with constant agitation. Following primary antibody
incubation, cells were lightly centrifuged at 1,000 rpm for 10
minutes, washed with PBS twice and then marked for magnetic (FIG.
1) or fluorescence-activated sorting (FIG. 2). For magnetic
sorting, following primary antibody incubation and wash, cells were
incubated in pre-washed Dynabeads.RTM. conjugated with sheep anti
rabbit IgG secondary antibody (Invitrogen, #112-03D) according to
the manufacturers recommended protocol for 4 hours at 4.degree. C.
The cell-bead suspension was then placed on a magnetic tube rack
and allowed to settle for 2 minutes, after which the supernate was
carefully removed without disturbing the cell-bead conjugates
aggregated towards the magnet. Cell-bead suspension was washed
twice in PBS following the magnetic aggregation procedure described
above and then resuspended in culture media and seeded onto
adherent culture flasks. Cells were then allowed to adhere for a
period of 3 days and washed several times with PBS to remove excess
magnetic beads still remaining in culture.
[0070] Magnetic bead selection (FIG. 1) of Cx43+ periodontal
ligament-derived stem cells (PDLSC) yielded a number of cells
presenting the correct membrane conformation of the gap junction
protein as can be seen by the covering of the cell body with the
iron beads immediately after selection (FIG. 1, panel 4 image) and
remaining after establishment of adherent cultures (FIG. 3A).
Cultured Cx43+ cells grown in adherent culture appeared similar to
fibroblastic-like or other mesenchymal cells. Morphologically,
however, these cells appeared to be thinner, and elongate beyond
the traditional spindle-like shape of fibroblastic cultures, with
fairly long processes (some>1 mm) that afforded them a more
neural-like appearance (FIG. 3A). Conversely, Cx43-negative
fractions had a complete fibroblastic-like appearance and were
flatter and much wider than their Cx43+ counterparts (FIG. 3B).
Furthermore, when grown in non-adherent conditions, the Cx43+ cells
readily aggregated into what could be described as neurosphere-like
structures (FIG. 4A), which then created highly branched networks
when allowed to adhere (FIG. 4B). Within these cultures, several
neural-like morphologies could be observed including glial and
neuron-like structures (FIG. 4C-D).
[0071] Immunohistochemical analysis for the expression of
pluripotency-associated markers OCT4, Nanog, and Sox2 revealed that
Cx43+ selection augmented the percentage of cells staining positive
for these markers when compared to that seen in heterogeneous
cultures of PDLSC as previously reported by our group (Huang et
al., 2009). For the expression of transcription factor OCT4, FIG. 5
clearly shows that Cx43+ selection enriched not only the percentage
of positively marked cells (19.46%.+-.3.40 for heterogeneous
cultures vs. 91.76%.+-.2.81 for Cx43+ cells; **p<0.01), but also
the presentation of this marker within these cultures.
Heterogeneous cultures of PDLSC had several positively marked cells
for OCT4; however, most of the staining was not located within the
nucleus of the cell, but in the peri-nuclear region--possibly at
translational sites for the protein. Conversely, once the cell
population was enriched to a homogeneous Cx43+ phenotype, OCT4
expression was observed mainly in the cell nucleus with positive
staining still observed at peri-nuclear regions of some of the
cells. Although not as significant as for OCT4, the selection of
Cx43+ cells had a similar augmenting effect on the level of
expression and pattern of presentation of Nanog and Sox2 (FIG. 5).
Although both Nanog and Sox2 were originally seen in the
heterogeneous cultures of PDLSCs, their expression and nuclear
translocation was much more pronounced (in intensity and number)
when the cells were enriched to a homogeneous Cx43+ phenotype (FIG.
5).
[0072] Connexin 43+ cultures were positive for the neural
crest-specific transcriptional factor Sox10 (FIG. 6), a known
neural crest specifier gene (Bronner, 2012). Similarly, the
selected cells were positive for the expression of the p75
neurotrophin receptor (p75NTR), another marker recently proposed to
isolate neural crest-derived stem cells (Wen et al., 2012).
Analysis of the correlation between Cx43 expression and the neural
marker nestin, as well as the neural crest modulator N-cadherin (Xu
et al., 2001), revealed that nearly all cells ubiquitously
expressed both markers as clusters on cell membranes and within
cell bodies (FIG. 6). Furthermore, Cx43 immunohistochemical
analysis showed that selected cells express this gap junction
protein as discrete membrane-bound structures specifically at
cell-cell interfaces, indicating the correct functional
presentation of the protein within these cells.
[0073] The results of the experiments described in this example
show that enrichment through Cx43+ marker expression had a profound
effect on the phenotypic expression of pluripotency-associated
markers OCT4, Nanog, and Sox2. Cx43+ cells have a significantly
greater number of OCT4 positive cells than the unfractionated cell
population from the same donors. Moreover, Cx43+ cells presented a
functional expression of these markers with nuclear translocation
of all 3 markers seen mainly in Cx43+ cells (FIG. 5). Thus, Cx43 is
a useful selection marker for the isolation of pluripotent stem
cells in the adult periodontal ligament and may also be a useful
selection marker for remnant neural crest stem cells in other
tissues derived from this embryological structure.
[0074] Methods
[0075] For immunohistochemical analysis, Cx43+ selected cells were
grown on poly-1-lysine coated glass coverslips at a density of
2,500 cells/cm.sup.2 and allowed to reach confluence. Cells were
then fixed in 10% neutral buffered formalin for 10 minutes at room
temperature. Samples were then washed 3 times in PBS containing
0.05% v/v Tween 20 (Sigma). For nuclear marker staining, further
incubation for 10 min in 0.1% Triton X-100 was performed. All
samples were then blocked using 5% BSA (containing 0.05% Tween 20)
in PBS for 1 hour at room temperature. Samples were then incubated
in primary antibody (Rabbit pAb to OCT4, Nanog or Sox2) diluted to
1:200 in blocking buffer overnight at 4.degree. C. Following
incubation with primary antibodies, the samples were washed twice
in PBS and then incubated in secondary antibody (Bovine anti Rabbit
IgG-TRITC) at a 1:200 dilution for 2 hours at room temperature. To
confirm the neural crest origin of the cells, primary antibodies
against Sox10, p75, N-cadherin and Nestin were used. N-cadherin and
Nestin expression was correlated with the Cx43 expression in the
cells using the same protocol as described above (dilution: 1:200).
All antibodies were purchased from either Abeam (Abeam, Cambridge
Mass.) or Santa Cruz Biotechnology (Santa Cruz Calif.). Samples
were finally washed twice in PBS, mounted in VectaShield with DAPI
(Vector Labs, Burlingame Calif.) and imaged using a Nikon Eclipse
Ti inverted fluorescent microscope. Unsorted, heterogeneous
cultures of PDL cells were maintained as controls for comparison.
Quantitative expression levels of OCT4 were determined by the
number of positively marked cells versus total number of nuclei in
frame of view for both heterogeneous and Cx43+ cells for several
frames of view (n=8).
[0076] All numerical values presented reflect mean.+-.standard
deviation. Statistical analyses were performed by means of
two-tailed student t-tests and statistical significance was
determined by any statistical test returning a p value less than
0.05 (p<0.05).
Example 2. Connexin 43-Positive Periodontal Ligament-Derived Stem
Cells Form Teratomas with Mature Structures In-Vivo
[0077] To determine whether Cx43.sup.+ periodontal ligament-derived
stem cells (PDLSCs) were truly pluripotent and could generate cell
types from all three embryological germ layers (ectoderm, mesoderm,
and endoderm), immunodeficient mice were inoculated with Cx43+
PDLSCs obtained by the method described in Example 1 in air
capsules created in the lateral flank of the kidneys and testis.
Inoculated mice generated neoplastic tumor growth in all injection
sites (FIG. 7F). Teratoma tissues consisted of scattered regions of
differentiated cells containing tissues from all three
embryological germ layers clearly identifiable. Among the tissues
identified were cartilage and ossified cartilage (mesoderm, FIG.
7A-B), glandular and duct structures (endoderm, FIG. 7C-D), and
pigmented cells (ectoderm, FIG. 7E).
[0078] Closer histological analysis of teratoma tissues also
revealed the presence of mature structures including double-walled
eccrine sweat glands (FIG. 8A), gut epithelium with
enterochromaffin cells (FIG. 8B), and smooth muscle (FIG. 8C).
Immunohistochemical analysis of obtained tissues confirmed these
observations (FIG. 8E-G) and also showed the existence of glial
cells within defined pockets of teratoma tissues (FIG. 8F1-2) that
stained positive for glial fibrillary acidic protein (GFAP).
Finally, immunohistochemical analysis demonstrated that there are
regions of undifferentiated stem cells still expressing the
transcriptional factor OCT4 (FIG. 8D1-3).
[0079] The results of this experiment show that, in an in-vivo
setting, Cx43+ PDLSCs were capable of generating teratomas in 100%
of the inoculation sites. The obtained teratoma tissues contained
clearly identifiable mature structures from all of the three germ
layers (FIGS. 7 and 8). This observation was further confirmed by
immunohistochemical analysis of tumor sections showing expression
of glial marker GFAP (FIG. 8F), and endodermal marker N-cadherin
(FIG. 8E). The neural crest origin of these cells was demonstrated
by the expression of several neural crest markers. Specifically,
the expression of transcription factor Sox10 and membrane marker
p75 provide evidence of the neural crest origin of the isolated
stem cell population (see Example 1). Furthermore, the
identification of eccrine sweat glands (FIG. 8A), mature gut
epithelium containing enterochromaffin cells (FIG. 8B), and glial
cells (FIG. 8F) in teratomas formed by Cx43+ PDLSCs further
confirms these cells as remnant neural crest stem cells. The
presence of the double-walled eccrine sweat glands in teratoma
tissue confirms the human origin of the tumor cells, since murine
skin does not possess endogenous sweat glands and those found in
the palmar skin of mice are single-cell walled type glands (Nejsum
et al., 2005). These observations confirm that Cx43+ PDLSCs are a
remnant neural crest-derived pluripotent stem cell population that
can be isolated from adult neural crest tissues, such as the
periodontal ligament.
[0080] Methods
[0081] Following isolation of Connexin 43+ cell fraction as
described in Example 1, a teratoma formation service and analysis
was performed by Applied StemCell Inc, (Fremont, Calif.). Cells
provided to Applied StemCell, Inc were from the cell line Cx43M19
at passage 5. By means of a novel kidney and testis capsule
injection technique, 1.5-2 million cells in 30% matrigel (BD
Biosciences) were injected into an air capsule created in the
lateral flank of the kidneys and testis (3 sites of injection in
each) under anesthesia, sutured closed and allowed to reach
homeostasis. Mice used were Fox Chase SCID-beige, male, 6 week old
mice (Charles Rivers) and a total of three mice were used for the
procedure. The animals were sacrificed 88 days post-injection of
the cells and solid tumors were fixed in 10% formalin overnight,
embedded in paraffin, cut into 5-.mu.m serial sections, and
processed for hematoxilin and eosin (H&E) staining.
Pathological assessments were performed by the contracted company
with following assessments of provided tissue sections performed by
collaborating pathologists in our institution.
Example 3. Neural Induction of Adult Human Periodontal
Ligament-Derived Stem Cells
[0082] Stem cells in the body differentiate into several cell types
based on various environmental cues, and studies have shown that
neural-like and glial-like cells have been successfully generated
from multiple (human and animal) stem cells (Kim and de Vellis,
2009), including induced pluripotent stem cells (iPSCs) (Kuo and
Chang, 2012; Kuo and Wang, 2012), embryonic stem cells (ESCs)
(Ostrakhovitch et al., 2012), mesenchymal stem cells (MSCs)
(Cardozo et al., 2012), and neural stem cells (Ribeiro et al.,
2012; Ostrakhovitch et al., 2012). MSCs, the most widely studied
stem cell type, have undergone several protocols for generating
neural-like cells. Recent methods for inducing MSCs (human and
animal) to neural-like cells in vitro have included: chemical and
growth factors (Jang et al., 2010; Qian et al., 2010; Cheng et al.,
2009; Li et al., 2009), microRNA techniques (Zhou et al., 2012),
and growing on different biomaterial/extracellular matrix surfaces
(D'Angelo et al., 2010; Mruthyunjaya et al., 2010). Even if not
able to generate "fully functioning" tissues or organs in vitro,
pre-committing stem cells to various lineages is important in order
to prevent undesired cell types in vivo.
[0083] Pluripotent periodontal ligament-derived stem cells (PDLSC)
express neural crest markers and can differentiate into ectoderm,
mesoderm, and endoderm lineages (see Examples 1 and 2). As both
PDLSCs and many neural types are derived from the neural crest, the
stem cells of the periodontal ligament are more closely related to
neural cells than other types of stem cells. Therefore, the
objective of this example was to determine if neural-like cells
could be generated from PDLSCs by exposing the cells to a
combination of epidermal growth factor (EGF) and basic fibroblast
growth factor (bFGF).
[0084] PDLSCs were harvested from impacted wisdom teeth as
previously described (Example 1; Huang et al., 2009). Cells were
cultured with HGCCM and passaged when they reached .about.70%
confluence. HGCCM medium consisted of high glucose Dulbccco's
modified eagle medium (DMEM) supplemented with 10% fetal bovine
serum (FBS), 1% penicillin streptomycin (100 units/ml Penicillin
and 100 .mu.g/ml Streptomycin) and 0.1% amphotericin B (0.25
.mu.g/ml). Cells that were passage 4 were used for all of the
experiments. PDLSCs were separated into two groups: control and
EGF+bFGF treated. All cells were plated at a density of 4000
cells/well in 6-well tissue culture plastic plates. All cells were
plated using HGCCM. Cells were allowed to adhere to the plates
overnight. Media was removed the following day and treatments were
begun. The control cells were cultured in HGCCM for the duration of
the experiment. EGF and bFGF were each added to the EGF+bFGF
treated group at a concentration of 50 ng/ml. Media was changed
every 2 days for a total of 8 days of treatment. Cells were then
collected for RNA extraction or fixed for immunohistochemical
staining.
Gene Expression
[0085] Following treatment with EGF+bFGF, several genetic marker
categories were examined with qPCR to determine changes in the
genotypes of the cells: adult/neural stem cell (CD133, SOX1, noggin
(NOG)), neural progenitor/immature neuron (.beta.-111 tubulin
(TUBB3) and nestin), and mature neuron (neurofilament medium
(NEFM)). The genes and associated primers used in the qPCR analysis
are shown in Table 1 below. Genetic analysis demonstrated
significant changes in gene expression of several key genes
following treatment with EGF+bFGF (FIG. 9). In particular, there
was a statistically significant increase in the expression of the
neural progenitor/immature neuron markers nestin and TUBB3. SOX1,
one of the neural stem cell genes, showed a marked increase in
expression, along with NEFM, a mature neuron marker. Interestingly,
the expression of NOG significantly decreased following the
induction protocol. Taken together, the results from the gene
expression suggest that the induction protocol (treatment with
EGF+bFGF) induces a switch in the PDLSCs from a multipotent state
to a neural lineage.
TABLE-US-00001 TABLE 1 Genes and associated primers for qPCR
analysis Accession Gene Number Forward Primer Reverse Primer CD133
NM_ GATGCCTCTGGTGG TTTCCTTCTGTCGC 006017.1 GGTATTTC TGGTGC (SEQ ID
NO: 1) (SEQ ID NO: 2) SOX1 NM_ TGCTGGATTCTCAC CTCGTCAGGAATAA 005986
ACAC TGAACAAG (SEQ ID NO: 3) (SEQ ID NO: 4) Nestin NM_
ATCAGATGACATTA CTTCAGTGATTCTA (NES) 006617.1 AGAC GGAT (SEQ ID NO:
5) (SEQ ID NO: 6) Noggin NM_ AACTGTGTAGGAAT ATTAGCAACAACCA (NOG)
005450 GTATATGTG GAATAAGT (SEQ ID NO: 7) (SEQ ID NO: 8) .beta.- NM_
CAAGTTCTGGGAAG TTGTAGTAGACGCT tubulin 006086 TCATCA GATCC III (SEQ
ID NO: 9) (SEQ ID NO: 10) (TUBB3) Neuro- NG_ TTGGCAAGGGAAAC
TCAGGGAAATTGGGA filament 008388 AAACAC TGTATATGT Medium (SEQ ID NO:
11) (SEQ ID NO: 12) (NEFM)
Scanning Electron Microscopy and Immunohistochemistry
[0086] Morphological differences between the EGF+bFGF-treated cells
versus control cells were apparent under a light microscope (FIG.
10). The treated cells had a more compact cell body with extending
neurite-like processes that appeared to connect with one another
and form a cellular network (FIG. 10A). On the other hand, the
control cells were not as elongated, and presented no visible
neurite-like processes (FIG. 10B). To explore this morphological
difference in depth, we examined the differences between the
treated and control cell populations with a scanning electron
microscope (SEM). Under the scanning electron microscope, both
neural-like and glial phenotypes were observed in the culture
containing the EGF+bFGF-treated cells (FIG. 11). The neural-like
cells were easily distinguished by their rounded and raised cell
bodies and very thin neurite-like processes (FIG. 11A, B).
Glial-like cells appeared flatter and wider, with thicker processes
that extend to neighboring cells (FIG. 11A). The untreated control
cells looked very different and presented no morphological
similarities to neural-like cells (FIG. 11C, D). In particular, the
control cells did not demonstrate any extending processes, and
seemed to coalesce as a sheet rather than form a network structure.
These images suggest that treatment with EGF and bFGF effectively
produces morphologically correct phenotypes of both glial and
neuronal progenitor cells.
[0087] While the SEM images demonstrated positive morphological
presentation of both glial and neuronal-like cells, to further
verify the neural induction of the PDLSCs we employed
immunohistochemical analyses. Immunohistochemical analysis of the
EGF+bFGF-treated PDLSCs revealed positive staining for both
neuron-specific .beta.-tubulin III (TUBB3) and the astrocyte
specific marker glial fibrillary acidic protein (GFAP) (FIG. 12).
Corroborating the SEM micrographs, the cells that had a compact,
raised, and rounded cytoplasm with neurite-like processes were
indeed positive for TUBB3 (FIG. 12B), whereas the cells that had a
flatter cytoplasm and broader processes stained positive for GFAP
(FIG. 12A). The control cells, however, demonstrated no visible
staining for either of these proteins (images not shown).
[0088] Synaptophysin, a synaptic vesicle glycoprotein commonly
located pre-synaptically, was also present in the EGF+bFGF-treated
group (FIG. 12C). No synaptophysin staining was observed in cells
in the control group (images not shown). These findings further
demonstrate that the neuro-induction protocol (e.g. treatment with
EGF and bFGF) is effective at inducing PDLSCs to differentiate to a
neural lineage, including both glial and neuronal populations.
Electrophysiology
[0089] Following the positive immunohistochemical staining for
synaptophysin we wanted to determine whether or not the growth
factor-treated cells were beginning to have the
electrophysiological properties of neural cells. Although
preliminary current-clamping experiments on untreated, control
PDLSC cells failed to elicit action potentials, voltage-clamp
experiments demonstrated active ionic currents in EGF+bFGF-treated
PDLSC. These cells contained both fast-inactivating inward and slow
outward currents during voltage jumps to various voltages from a
holding voltage of -100 mV (FIG. 13A). The fast-inactivating
currents peaked around -10 mV, having kinetics and a range of
activation similar to voltage-activated sodium currents. When the
peak inward and outward currents were plotted against the testing
voltage, they looked similar to the fast Na+ current and
delayed-rectifier K+ currents in neurons (FIG. 13B). Interestingly,
after treatment with EGF+bFGF, the neural-like PDLSC cells
exhibited increased Na+-like current density, while the outward K+
current density stayed the same. To test if the increased inward
currents were indeed Na+ currents, we replaced the Na+ in the
external bath with N-methyl-D-glucamine chloride (NMDG), and found
that no inward currents were observable, whereas the recorded
outward currents slightly increased over the range where Na+-like
currents were activated. These results were significantly different
than those obtained from control cells (FIG. 13B). We also used a
standard two-pulse protocol (FIG. 13C) to characterize the Na+
currents, and found voltage-dependent inactivation as is typical
for voltage-dependent Na+ channels (FIG. 13D). As can be seen in
FIG. 13C, the more channels that were activated during the
prepulses, the fewer channels that remained available for opening
during the second testing pulse at +10 mV. Fitting the inactivation
curve with Boltzmann equation resulted in a half-inactivation
voltage at -40 mV. As is commonly known, sodium channels are the
basis for an action potential in neurons. These results indicate,
therefore, that the inward current observed in PDLSCs treated with
EGF+bFGF is a voltage-activated Na+ current, suggesting that the
EGF+bFGF treatment induces neuronal differentiation of PDLSCs.
[0090] Taken together, the results of the experiments described in
this example demonstrate that PDLSCs can be induced to
differentiate into the neural lineage by treatment with EGF and
bFGF. This neural induction protocol produced both glial and
neuronal cell phenotypes. Thus, pre-treatment of PDLSCs with these
growth factors can be employed prior to administration of the cells
to a patient in need of neural cell regeneration. Pre-commitment of
the PDLSCs to the neural lineage prior to administration to a
patient can minimize the generation of unwanted cell types and
facilitate neuronal repair.
Methods
[0091] RNA Extraction, cDNA Synthesis and qPCR
[0092] At the end of the treatment, cells used for gene expression
analysis were collected and Trizol extraction was performed
(Invitrogen, part of Life Technologies, Grand Island, N.Y.) per the
manufacturer's instructions with the following modifications:
centrifugation for phase separation and RNA precipitation was done
at 14,000 rpm for 20 minutes. Centrifugation for the RNA wash was
done at 7,500 rpm for 10 minutes. Total RNA yield was determined
using the NanoDropND-1000 spectrophotometer (Thermo Scientific,
Wilmington, Del.). Total RNA (1 .mu.g) was converted to cDNA using
the ABI High Capacity cDNA Reverse Transcription Kit (Applied
Biosystems, part of Life Technologies, Grand Island, N.Y.) and the
GeneAmp PCR System 9700 (Applied Biosystems, Grand Island, N.Y.).
Quantitative PCR (qPCR) was performed using the Stratagene Mx3005P
(Agilent Technologies, Santa Clara, Calif.). The samples were
prepared using the Sybr Green PCR master mix (Applied Biosystems,
part of Life Technologies, Grand Island, N.Y.), with 20 ng cDNA per
reaction. The genes evaluated along with their primer sequences are
in Table 1.
Immunohistochemistry
[0093] Following treatment and culture, cells used for
immunohistochemistry were washed once with phosphate buffered
saline (PBS). PBS was removed and cells were fixed with either 10%
formalin (cell membrane markers) or 100% ice-cold methanol
(intracellular markers) for 10 minutes. After removal of the
fixative the cells were washed twice with PBS and remained in PBS
at 4.degree. C. until processed. Cell membrane marker samples were
blocked for 1 hour in 5 mg/mL bovine serum albumin (BSA) in PBS.
Intracellular marker samples were blocked for 1 hour in PBS+0.05%
Tween 20+2% BSA+1% FBS. Immunostaining was carried out using the
following primary antibodies and dilutions in 0.5 mg/mL BSA in PBS:
synaptophysin--1:150 (Millipore, Billerica, Mass.), neuron-specific
beta-tubulin III--1:100 (Abeam, Cambridge, Mass.), glial fibrillary
acidic protein--1:1000 (Abeam, Cambridge, Mass.). Cells were left
incubating in the primary antibodies overnight. The following day,
the primary antibody was discarded and the cells were washed twice
in PBS. The following secondary antibodies were applied diluted
1:200 in PBS: synaptophysin--Goat pAb to MsIgG (FITC),
.beta.-tubulin III--Bovine anti mouse IgG (R), GFAP--Goat pAb to
RbIgG (FITC) (all secondary antibodies: Abeam, Cambridge, Mass.).
The samples were shielded from light and incubated for 2 hours. For
the synaptophysin staining, the secondary antibody was discarded
following the 2 hour incubation and the samples were washed once
with PBS. An Alexa Fluor 568 Phalloidin (Invitrogen, part of Life
Technologies, Grand Island, N.Y.) was added to PBS at a 1:25
dilution and placed in the sample well. The sample was shielded
from light and left to incubate for 30 minutes.
[0094] Following the 30 minute incubation, the Alexa Fluor was
removed and the wells were washed once with PBS. For all samples, 2
drops of Vectashield hard set mounting media with DAPI (Fischer
Scientific, Hampton, N.H.) was placed in each well. A glass
coverslip was thoroughly washed, dried, and placed in each well.
The samples were shielded from light and taken to image
Immunohistochemical images were acquired using a Nikon Digital
Camera DS-Qi1MCmounted to a Nikon Eclipse Ti inverted fluorescent
microscope. The NIS Elements software package was used for merging
images and image analysis.
Scanning Electron Microscopy
[0095] Tissue culture coverslips (13 mm round) were coated for 5
minutes with 1% gelatin filtered through a 0.8 .mu.m filter. After
5 minutes the gelatin was removed and the culture rounds were
washed once with PBS. PDLSC were seeded unto the culture rounds at
a density of 2500 cells/tissue culture round. All cells were plated
using HGCCM. Cells were allowed to adhere to the tissue culture
rounds overnight. Media was removed the following day and
treatments were begun. The control cells were cultured in HGCCM for
the duration of the experiment. EGF and bFGF were added to the
EGF+bFGF treated group at a concentration of 50 ng/ml. Media was
changed every 2 days for a total of 8 days of treatment. After
completing the treatment, the media was removed and samples were
fixed with Millonigs phosphate buffer+2.5% glutaraldehyde. Samples
were kept at 4.degree. C. until further processing. Once ready for
processing the samples were rinsed 3 times for 5 minutes with the
Millonigs phosphate buffer. Half strength Millonigs phosphate
buffer was added to the samples with 1% OsO4 and left to incubate
at room temperature for 1.5 hours. Following incubation the
Millonigs and OsO4 were removed and the samples were once again
rinsed 3 times for 5 minutes with Millonigs phosphate buffer. A
dehydration series was performed with 50%, 70%, and 95% acetone
where the acetone was added and incubated for 5 minutes, removed,
and the same concentration was once again added and left for 10
minutes. Following the removal of the 95% acetone, 100% acetone was
added to each sample and incubated for 10 minutes. The acetone was
removed and addition of 100% acetone was repeated 3 more times for
a total of 4 incubations with 100% acetone. The 100% acetone was
decanted and critical point drying was performed using
Hexamethyldisilazane (HMDS). A 2:1, 1:1, and 1:2 ratio of acetone
to HMDS was added to the samples with wait times of 10 minutes in
between removal and addition of HMDS. The 1:2 ratio of acetone:HMDS
was removed and 100% HMDS was added to each sample. The samples
were incubated for 5 minutes and the HMDS was removed. This was
done one more time with 100% HMDS. The samples were removed from
the HMDS and allowed to dry. The samples were then mounted onto 1
cm SEM sample stubs and sputter coated using a Hummer 6.2 sputter
coater per the manufacturer's instructions. Samples were then
imaged using a Jeo15600 LV Scanning Electron Microscope at 10 kV.
Adobe Photoshop or Microsoft Publisher was used for image
processing.
Electrophysiology
[0096] 35 mm.sup.2 dishes were plated with PDLSC at a density of 50
cells/dish. All cells were plated using HGCCM. Cells were allowed
to adhere to the dishes overnight. Media was removed the following
day and replaced with fresh HGCCM. Following an additional two
days, the media was removed and the treatments were begun. EGF and
bFGF were added to the EGF+bFGF treated group at a concentration of
50 ng/ml. Media was changed every 2 days for a total of 8 days of
treatment. After completing the treatment, inward and outward
currents were recorded in the whole-cell voltage-clamp
configuration with an Axopatch 200A amplifier, Digidata 1322A
interface, and pClamp9.0 software (Molecular Devices, Sunnyvale,
Calif.). Data were sampled at 50 kHz and low-pass filtered at 5 kHz
before off-line filtered at 2 kHz for final analysis. Borosilicate
pipettes with 2-5 megaohm resistance were used when placed in the
bath solution. The pipette solution contained (in mM): 130
K-gluconate, 10 KCl, 1 MgCl.sub.2, 1 CaCl.sub.2, 1 EGTA, and 10
HEPES, pH 7.2. The bath solution contained (in mM): 140 NaCl, 5
KCl, 2 MgCl.sub.2, 2 CaCl.sub.2, 10 glucose, and 10 HEPES, pH 7.4.
For sodium-free experiments the K-gluconate and KCl in the pipette
solution were replaced by 140 mM CsCl, and the NaCl in the bath
solution was replaced by 140 mM N-methyl-D-glucamine chloride.
Leaks and capacitive transients were online subtracted using the
p/-4 or p/-5 leak subtraction routine.
Example 4. Induction of Adult Human Periodontal Ligament-Derived
Stem Cells to Retinal Fate
[0097] As described in Example 2, adult human periodontal
ligament-derived stem cells (PDLSCs) are pluripotent and have the
capacity to differentiate into multiple lineages. To investigate
whether PDLSCs could be directed to attain a retinal fate, PDLSCs
were treated with Noggin (antagonist of BMP signaling), Dkk-1
(antagonist of Wnt/.beta.-catenin signaling) and insulin-like
growth factor-1 (IGF1) to mimic the signaling systems active during
mammalian retinogenesis.
[0098] Primary human periodontal ligament (PDL) cultures were
established from healthy subjects under the age of 35 with informed
consent. Within six hours from tooth extraction, PDL tissue was
scrapped mechanically from the root surface, finely chopped and
digested with 0.1% collagenase I and III (Worthington, Lakewood,
N.J.) in culture medium added with 0.5% fetal bovine serum (FBS,
Invitrogen, Eugene, Oreg.) and antibiotics for 4 to 6 hours with
agitation at 37.degree. C. (Huang et al., 2009). After passing
through cell strainer (40 .mu.m pore size, BD, Franklin Lakes,
N.J.), the single cells were cultured in DMEM/F12 medium
(Invitrogen) supplemented with 10% FBS, 100 U/ml penicillin
sulfate, 100 .mu.g/ml streptomycin and 1% antimycotics.
[0099] Twenty five primary human PDL cultures from adult Chinese
subjects below age of 35 were established. From our cell culture
record, all teeth samples showed similar efficiency of PDL cell
isolation, irrespective to variation of age and sex. Normally,
within 5 days of initial seeding, P1 PDLSCs displayed clonogenic
growth of 6 to 8 cells. The adherent cells continued to proliferate
and the colony size increased substantially in the first 3 to 4
days. Cells in the center of colony were more densely packed than
those in periphery (FIG. 14A). We frequently observed more
migratory cells in the peripheral region (data not shown). Most
cells were spindle to slender in shape at early culture time. After
14 days in culture, the cells displayed dendritic morphology with
distinct cell nuclei and more intercellular connection at ends of
dendritic processes (FIG. 14B). Some cells exhibited a more
flattened morphology, whereas other cells had more compact and
crescent shapes.
[0100] Four primary PDLSCs from patients of younger age range were
randomly selected for further study (PDL-8: female/21 years old;
PDL-10: female/13; PDL-13: male/16 and PDL-15: female/33). All
cells at passage 2 had similar growth rate (FIG. 14C). The mean
cell doubling time was 25-30 hours at the exponential growth phase.
The cells stably expressed neural crest markers (Notch1, BMP2,
Slug, Snail, Nestin and Tuj1) as shown by real-time PCR analysis
(FIG. 14D). The expression was similar as the PDL tissues freshly
isolated from the root surface. This expression profile was
consistent in all 25 primary PDLSCs, irrespective to age and sex
variation. Representative staining of PDL-8 cells with antibodies
recognizing Nestin, p75/NGFR, and Tuj1 is shown in FIG. 15I-K. In
addition to the Nestin staining in >90% of the cells, the
majority (>95%) of cells were immunopositive for p75/NGFR and
Tuj1 (FIG. 15I-K). This was supported by flow cytometry analysis
(data not shown). The cells also expressed a set of mesenchymal
stem cell (MSC) markers (CD44, CD90 and vimentin), as shown by
immunofluorescence (FIG. 15A-C) and flow cytometry (FIG. 15E-G). On
the other hand, PDLSCs exhibited variable expression of
pluripotency genes. Although the cells had comparable expression
levels of c-Myc and Klf4 to those of human ES H1 cells, Oct4, Sox2
and Nanog were barely expressed (FIG. 14E-F). SSEA-4 was only
expressed in a subset of PDLSCs (FIG. 15D) and flow cytometry
showed 28% were SSEA-4 positive (FIG. 15H).
Neural Retinal Fate Commitment from Human PDLSCs
[0101] To test the capacity of PDLSCs to differentiate towards a
retinal progenitor fate, a two-step differentiation protocol was
employed involving initial neurosphere formation followed by
propagation as adherent cultures (FIG. 16A-B). Specifically, PDLSCs
at passage 3 were recruited for a 2-step retinal fate induction
procedure. Step 1 was to obtain neurospheres by culturing cells
with induction medium 1 (IM1), which was DMEM/F12 supplemented with
B27 (Invitrogen), 1 ng/ml mouse Noggin (R&D Systems), 1 ng/ml
human recombinant Dkk-1 (R&D Systems) and 5 ng/ml human
recombinant IGF-1 (R&D Systems), under an attachment-free
condition for 3 days. Step 2 was to plate neurospheres on
matrigel-coated surface in induction medium 2 (IM2) (same
composition as IM1, except for the addition of N2 (Invitrogen) and
Noggin and Dkk-1 were added to a final concentration of 10 ng/ml
each). Fresh medium was replenished every 3 days and culture was
maintained for up to 25 days.
[0102] Human PDLSCs were sensitive to this free-floating culture
system and generated neurospheres rapidly and efficiently. The
neurospheres expanded for 3 days were immunopositive for a variety
of neural stem and precursor markers including Nestin, p75, ABCG2
and Pax6 (FIG. 17A-H). The vast majority of the Nestin expressing
cells were p75 reactive, and ABCG2 was often coexpressed with Pax6.
In addition, greater than 95% of the cells within neurospheres were
labeled with Tuj1, while cells expressing SSEA4 were found
predominantly in the outer portions of neurospheres (FIG. 17I-L).
Interestingly, some cells around neurospheres showed Tuj1 positive
exhibiting long neurite like processes and extended to adjacent
neurospheres forming networks (FIG. 17M-N).
[0103] When the neurospheres were plated on Matrigel-coated surface
in IM2 condition (with 10 ng/ml Noggin and Dkk-1, and N2
supplement), they attached and formed rosette-like outgrowth (FIG.
16B). Majority of cells exhibited extended projections and
neurite-like morphology after treatment for 25 days (FIG. 16B).
Neuronal lineage differentiation was evidenced by immunoreactivity
for a variety of neuronal markers (including Tuj1, S100, p75 and
neurofilament M) (FIG. 18A-F). At intervals during IM2 treatment,
the cells were harvested and RT-PCR analysis revealed that there
was gradual up-regulation of multiple genes associated with eye
field specification (Lhx2, Dcx, Chx10, Rx, Sox2, and Otx2) (FIG.
18G). Up to 110-fold increase in Rx level was detected at day 25 of
IM2 treatment, when compared to untreated control cells by qPCR
(FIG. 18H). Minor alterations in the expression levels of different
neural crest related genes (Tuj1, Nestin, Snail and Slug) were
found during the induction course (data not shown).
Pax6 Activation by Retinal Fate Induction
[0104] Untreated PDLSCs had a diffuse cytoplasmic expression of
Pax6, as shown by immunofluorescence in FIG. 19A. After 25 days of
IM2 incubation, we observed a clear nuclear translocation of Pax6
(FIG. 19B-C). Interestingly, these cells were associated with Rx
induction. Rx was exclusively expressed in Pax6.sup.nuclear cells
and vice versa (FIG. 19D-I). By cell counting analysis of >500
cells, we detected that retinal fate induction (RFI) resulted in
94.6.+-.4.7% cells becoming Pax6.sup.nuclear Rx+, when compared to
0% cells without RFI. Such expression phenotype indicated high
efficient conversion of PDL cells to retinal progenitors.
[0105] In addition, the active state of the induced hPDLSCs-derived
retinal progenitor-like cells was evaluated by cell-cycle
regulators Cyclin A and p21 expression. Compared with untreated
PDLSCs, day 25 differentiated PDLSCs showed stronger staining for
Cyclin A. Consistently, Western blotting results demonstrated high
protein content of Cyclin A with concomitant downregulation of p21
expression and constant expression of PCNA after the 10.times.NDI
treatment. These findings indicate the PDLSCs-derived retinal
progenitor-like cells are proliferative and mitotically active.
Acquisition of Photoreceptor Phenotypes
[0106] To determine if PDLSC-derived retinal progenitors could
obtain photoreceptor phenotype under RFI condition, we examined the
expression of photoreceptor markers. Our RT-PCR result revealed
that Nrl and rhodopsin gene expression was detected as early as day
14 of IM2 treatment (FIG. 18G). Both genes were up-regulated by 180
and 110 folds, respectively (FIG. 18H). At day 25, 5.1.+-.0.5%
cells expressed rhodopsin (FIG. 20B), the rod-specific marker.
Rhodopsin kinase, an enzyme involved in rhodopsin biosynthesis in
rod photoreceptors was obviously up-regulated in IM2 treated cells
(FIG. 20E). When IM2 treatment was prolonged to day 45, PDL cells
stopped dividing and developed a small, round cell body and single,
thin processes, morphological characteristics of photoreceptors
(FIG. 20C).
Electrophysiological Properties of the PDLSC-Derived Retinal
Neuron-Like Cells
[0107] To identify the functional membrane properties of the
PDLSC-derived retinal neurons, the intracellular Ca.sup.2' level in
response to glutamate was examined via fluo-4 imaging. Day 25
differentiated PDLSCs showed spontaneous responses to glutamate
stimulation producing rapid and robust increase of fluo-4
fluorescence intensity (FIG. 21A). Approximately 92% of the
differentiated PDLSCs responded to glutamate (184 responsive cells
in 200 cells from 3 separate experiments). Most of the increases
occurred during the first 40 seconds, peaked in 60-80 s after scan
onset and then decayed slowly, although the response kinetics in
time course and stimulus intensity varied between cells (FIG. 21B).
Electrophysiological recordings showed that 191.+-.108%
(mean.+-.SD) of peak glutamate responses were detected in Day 25
differentiated PDLSCs, which was significant greater than that in
untreated PDLSCs (P<0.001; FIG. 21C). These strong (an average
of 191% .DELTA.F/F0) and spontaneous glutamate-evoked fluorescence
intensity increases with Ca.sup.2+ influx in PDLSC-derived retinal
neuron-like cells is consistent with previous observations in
retinal progenitors and photoreceptor precursors (Tucker et al.,
2011), suggesting the differentiated cells may obtain excitable
membrane properties corresponding to developing retinal
neurons.
[0108] The results of the experiments in this example show that
pluripotent adult PDLSCs call be directed to adopt a retinal fate
with competence of photoreceptor differentiation by treatment with
Noggin, Dkk-1, and IGF-1. Our findings suggest that adult PDLSCs
are a novel and crucial autologous cell source for retinal lineage
differentiation and future design of retinal repair and
regeneration for the treatment of retinal degenerative
diseases.
Methods
Cell Proliferation Assay
[0109] Primary cells at passage 2 were seeded at a density of
5.times.10.sup.3 cells/well in a 96-well plate. Cell proliferation
was assessed by MTT method at different time intervals. MTT (0.5
mg/ml, Sigma, St Louis, Mo.) was applied to cells in culture for 3
hours, and isopropanol was added to dissolve formazan crystals. The
solution absorbance was determined by spectrophotometery with
excitation wavelength at 590 nm (PowerWave microplate reader,
BioTek Instru inc., Winooski, Vt.). Results from triplicate
experiments were represented as mean.+-.standard deviation
(SD).
Immunocytochemistry
[0110] Cells were fixed with freshly prepared 2% neutral buffered
paraformaldehyde and permeabilized with 0.15% saponin (Sigma).
After blocking, the samples were incubated with primary antibodies
(Table 2) and subsequently with either Alexa 488 or Rhodamine
Red-X-conjugated secondary antibodies (Jackson ImmunoRes Lab), and
all nuclei were counterstained with DAPI
(4',6-diamidino-2-phenylindole, Invitrogen). Result was visualized
using confocal laser scanning microscopy (SPS, Leica). A minimum of
10 fields viewed at 20.times. magnification (objective) were taken
for cell quantification. The percentage of labeled cells in
triplicate experiments was expressed as mean.+-.SD. Result was
compared between control and treated samples and analyzed by paired
Student's t-test and P<0.05 was considered as statistically
significant.
TABLE-US-00002 TABLE 2 Primary antibody list Antibody Type Source
Dilution CD44 Mouse monoclonal Pharmingen 1:200 CD90 Mouse
monoclonal Pharmingen 1:200 Neurofilament-M Mouse monoclonal DAKO
1:200 Nestin Mouse monoclonal Chemicon 1:200 p75/NGFR Rabbit
polyclonal Promega 1:200 Pax6 Rabbit polyclonal Covance 1:150 PCNA
Mouse monoclonal Zymed 1:500 Rhodopsin Mouse monoclonal Thermo
1:100 Rhodopsin Kinase Mouse monoclonal Thermo 1:500 Rx Mouse
monoclonal Santa Cruz 1:150 S100 Rabbit polyclonal DAKO 1:200 SSEA4
Mouse monoclonal Stemgent 1:200 .beta.III tubulin Rabbit monoclonal
Covance 1:200 Vimentin Mouse monoclonal DAKO 1:200
Flow Cytometry
[0111] Trypsinized cells were washed and fixed with 2%
paraformaldehyde in DMEM/F12 medium containing 2% bovine serum
albumin for 20 min. After washes, they were incubated with primary
antibodies (Table 2) or isotype control for overnight at 4.degree.
C., followed by either donkey-anti-mouse or donkey-anti-rabbit
Alexa 488 secondary antibodies for another 2 hours at ambient
temperature. Single cell suspension after passing through a cell
strainer (40 .mu.m pore diameter) was analyzed by before flow
cytometry (LSR Fortessa flow cytometer, BD Biosciences) and a
minimum of 10,000 events was recorded for each sample for data
analysis using FACS Diva software.
Gene Expression Analysis
[0112] Cells were collected in RLT buffer freshly added with 1%
.beta.-mercaptoethanol and total RNA was extracted by RNeasy kit
(Qiagen) according to manufacturer's protocol. Reverse
transcription of 1 .mu.g total RNA was performed with Superscript
III RT-PCR kit (Invitrogen) using random hexanucleotide primers.
Gene expression was assayed by PCR using Master Mix (Invitrogen)
and specific primers (Table 3) and PCR products were resolved by
agarose gel electrophoresis. Alternatively, quantitative real-time
PCR (qPCR) was performed with Sybr Green Supermix (Applied
Biosystems) in ABI PRISM 7900HT Sequence Detection System (Applied
Biosystems). Experiments were run in triplicate. Relative gene
expression of each sample was normalized by the mean CT value to
housekeeping GAPDH (CT.sub.GAPDH) and expressed as mean.+-.SD.
TABLE-US-00003 TABLE 3 Gene expression primers Ampli- GeneBank con
Accession size Gene No. Sequences (5'-3') (bp) Chx10 NM_ F:
ATTCAACGAAGCCCACTACCCA 229 182894.2 (SEQ ID NO: 13) R:
ATCCTTGGCTGACTTGAGGATG (SEQ ID NO: 14) cMyc NM_ F:
CTACCCTCTCAACGACAGCA 179 002467.4 (SEQ ID NO: 15) R:
GTTCCTCCTCAGAGTCGCTG (SEQ ID NO: 16) DCX NM_ F:
GACAGCCCACTCTTTTGAGC 229 000555.3 (SEQ ID NO: 17) R:
TGGGTTTCCCTTCATGACTC (SEQ ID NO: 18) GAPDH NM_ F:
GAACATCATCCCTGCATCCA 226 002046.3 (SEQ ID NO: 19) R:
CCAGTGAGCTTCCCGTTCA (SEQ ID NO: 20) Klf4 NM_ F:
CAGGTGCCCCAGCTGCTTCG 188 004235.4 (SEQ ID NO: 21) R:
CCCGCCAGCGGTTATTCGGG (SEQ ID NO: 22) Lhx2 NM_ F:
CAAGATCTCGGACCGCTACT 284 004789.3 (SEQ ID NO: 23) R:
CCGTGGTCAGCATCTTGTTA (SEQ ID NO: 24) Nanog NM_ F:
CTGCAGAGAAGAGTGTCGCA 188 002865.2 (SEQ ID NO: 25) R:
GGTCTTCACCTGTTTGTAGCTG (SEQ ID NO: 26) Nestin NM_ F:
CAGGAGAAACAGGGCCTACAGA 191 006617.1 (SEQ ID NO: 27) R:
TCCAGCTTGGGGTCCTGAA (SEQ ID NO: 28) Notch1 NM_ F:
CCTGAGGGCTTCAAAGTGTC 164 017617.2 (SEQ ID NO: 29) R:
CGGAACTTCTTGGTCTCCAG (SEQ ID NO: 30) Nr1 NM_ F:
GGCTCCACACCTTACAGCTC 219 006177.2 (SEQ ID NO: 31) R:
CTGGGCTCCCTGGGTAGTAG (SEQ ID NO: 32) Oct4 NM_ F:
CTTCAGGAGATATGCAAAGCAG 135 002701.4 (SEQ ID NO: 33) R:
GCTGATCTGCTGCAGTGTG (SEQ ID NO: 34) Otx2 NM_ F:
GCAGAGGTCCTATCCCATGA 211 021728.2 (SEQ ID NO: 35) R:
CTGGGTGGAAAGAGAAGCTG (SEQ ID NO: 36) Rho- NM_ F:
CGGAGGTCAACAACGAGTC 156 dopsin 000539.1 (SEQ ID NO: 37) R:
TCTCTGCCTTCTGTGTGGTG (SEQ ID NO: 38) Snail NM_ F:
GACCCCAATCGGAAGCCTAACTA 164 005985.3 (SEQ ID NO: 39) R:
AGCCTTTCCCACTGTCCTCATCT (SEQ ID NO: 40) Slug NM_ F:
TTCGGACCCACACATTACCT 122 003068.4 (SEQ ID NO: 41) R:
GCAGTGAGGGCAAGAAAAAG (SEQ ID NO: 42) Sox2 NM_ F:
CCCCCCTGTGGTTACCTCTT 137 003106.3 (SEQ ID NO: 43) R:
GCTGGGACATGTGAAGTCTGC (SEQ ID NO: 44) .beta.III NM_ F:
ACCTCAACCACCTGGTATCG 223 tubulin 006086.3 (SEQ ID NO: 45) R:
TTCTTGGCATCGAACATCTG (SEQ ID NO: 46)
Western Blotting
[0113] Cells were collected in lysis buffer, containing 50 mM
Tris-HCl, 150 mM sodium chloride, 1% Nonidet P-40, 0.25% sodium
deoxycholate, protease inhibitor cocktail (Complete.TM., Roche) and
1 mM phenylmethyl sulfonyfluoride. The clear soluble lysate was
heat-denatured with 2% sodium dodecylesulfate (SDS, weight/volume).
The samples were resolved with SDS-PAGE (polyacrylamide gel
electrophoresis), blotted and immunolabeled with primary antibodies
(Table 2) followed by appropriate horseradish peroxidase-conjugated
Ig secondary antibodies (Jackson ImmunoRes Lab). Signal was
detected by enhanced chemiluminescence (ECL, GE Healthcare,
Pittsburgh, Pa.).
Calcium Imaging Assay in Response to Glutamate Stimulation
[0114] Intracellular calcium transient was evaluated using
fluo-4-acetoxymethyl (Fluo-4AM) ester (Invitrogen). Cells were
incubated in balanced salt solution containing 5 .mu.M Fluo-4AM,
0.1% pluronic F-127 (Sigma) for 30 min at room temperature.
Fluorescence image was captured using Olympus Fluoview FV1000 laser
scanning confocal system (Olympus, Melville, N.Y.), with excitation
wavelength at 495 nm and emitted wavelength at 515 nm, at every 5
sec for a total of 2 minutes. Stimulation by glutamate (1 mM,
Sigma) was performed. Data was analyzed using Olympus FV10-AS W
version 1.7. The change of fluorescence (F) (%
.DELTA.F/F.sub.baseline) of each cells were calculated as:
(F.sub.treatedF.sub.baseline)/F.sub.baseline.times.100%. A minimum
of 10 cells of each sample at specific time interval was recorded
for fluorescence calculation using FACS Diva software.
[0115] All publications, patents, and patent applications discussed
and cited herein are hereby incorporated by reference in their
entireties. It is understood that the disclosed invention is not
limited to the particular methodology, protocols and materials
described as these can vary. It is also understood that the
terminology used herein is for the purposes of describing
particular embodiments only and is not intended to limit the scope
of the present invention which will be limited only by the appended
claims.
[0116] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
REFERENCES
[0117] Bronner M E. Formation and migration of neural crest cells
in the vertebrate embryo. Histochem Cell Biol. 2012 August;
138(2):179-86. [0118] Cardozo A J, Gomez D E, Argibay P F.
Neurogenic differentiation of human adipose-derived stem cells:
Relevance of different signaling molecules, transcription factors,
and key marker genes. Gene. 2012 Sep. 18.pii:
S0378-1119(12)01119-5. [0119] Cheng Z, Zheng Q, Wang W, Guo X, Wu
Y, Zheng J. Targeted induction of differentiation of human bone
mesenchymal stem cells into neuron-like cells. J
HuazhongUnivSciTechnolog Med Sci. 2009 June; 29(3):296-9. [0120]
Conrad S, Renninger M, Hennenlotter J, Wiesner T, Just L, Bonin M,
et al. Generation of pluripotent stem cells from adult human
testis. Nature. 2008 Nov. 20; 456(7220):344-9. [0121] Coura G S,
Garcez R C, de Aguiar C B, Alvarez-Silva M, Magini R S, Trentin A
G. Human periodontal ligament: A niche of neural crest stem cells.
J Periodontal Res. 2008 October; 43(5):531-6. [0122] D'Angelo F,
Armentano I, Mattioli S, Crispoltoni L, Tiribuzi R, Cerulli G G,
Palmerini C A, Kenny J M, Martino S, Orlacchio A. Micropatterned
hydrogenated amorphous carbon guides mesenchymal stem cells towards
neuronal differentiation. Eur Cell Mater. 2010 Oct. 5; 20:231-44.
[0123] Degistirici O, Jaquiery C, Schonebeck B, Siemonsmeier J,
Gotz W, Martin I, Thie M. Defining properties of neural
crest-derived progenitor cells from the apex of human developing
tooth. Tissue Eng Part A. 2008 February; 14(2):317-30. [0124] Dupin
E, Coelho-Aguiar J M. Isolation and differentiation properties of
neural crest stem cells. Cytometry A. 2012 Jul. 26. [0125] Huang C
Y, Pelaez D, Dominguez-Bendala J, Garcia-Godoy F, Cheung H S.
Plasticity of stem cells derived from adult periodontal ligament.
Regen Med. 2009 November; 4(6):809-21. [0126] Jang S, Cho H H, Cho
Y B, Park J S, Jeong H S. Functional neural differentiation of
human adipose tissue-derived stem cells using bFGF and forskolin.
BMC Cell Biol. 2010 Apr. 16; 11:25. [0127] Jiang Y, Jahagirdar B N,
Reinhardt R L, Schwartz R E, Keene C D, Ortiz-Gonzalez X R, et al.
Pluripotency of mesenchymal stem cells derived from adult marrow.
Nature. 2002 Jul. 4; 418(6893):41-9. [0128] Kim S U, de Vellis J.
Stem cell-based cell therapy in neurological diseases: a review. J
Neurosci Res. 2009 Aug. 1; 87(10):2183-200. [0129] Kuo Y C, Chang Y
H. Differentiation of induced pluripotent stem cells toward neurons
in hydrogel biomaterials. Colloids Surf B Biointerfaces. 2012 Sep.
6; 102C:405-411. [0130] Kuo Y C, Wang C T. Neuronal differentiation
of induced pluripotent stem cells in hybrid polyester scaffolds
with heparinized surface. Colloids Surf B Biointerfaces. 2012 Dec.
1; 100:9-15. [0131] Li, X.-W., Tian, Y.-H. Amplification and
directional differentiation in vitro of human umbilical cord blood
derived mesenchymal stem cells into neuron-like cells. Journal of
Clinical Rehabilitative Tissue Engineering Research, 2009; 13 (1):
57-60. [0132] Mruthyunjaya S, Manchanda R, Godbole R, Pujari R,
Shiras A, Shastry P. Laminin-1 induces neurite outgrowth in human
mesenchymal stem cells in serum/differentiation factors-free
conditions through activation of FAK-MEK/ERK signaling pathways.
Biochem Biophys Res Commun. 2010 Jan. 1; 391(1):43-8. [0133] Nejsum
L N, Praetorius J, Nielsen S. NKCC1 and NHE1 are abundantly
expressed in the basolateral plasma membrane of secretory coil
cells in rat, mouse, and human sweat glands. Am J Physiol Cell
Physiol. 2005 August; 289(2):C333-40. [0134] Ostrakhovitch E A,
Byers J C, O'Neil K D, Semenikhin O A. Directed differentiation of
embryonic P19 cells and neural stem cells into neural lineage on
conducting PEDOT-PEG and ITO glass substrates. Arch BiochemBiophys.
2012 Aug. 25; 528(1):21-31. [0135] Qian D X, Zhang H T, Ma X, Jiang
X D, Xu R X. Comparison of the efficiencies of three neural
induction protocols in human adipose stromal cells. Neurochem Res.
2010 April; 35(4):572-9. [0136] Rezanejad H, Matin M M. Induced
pluripotent stem cells: Progress and future perspectives in the
stem cell world. Cell Reprogram. 2012 Oct. 4. [0137] Ribeiro D,
Laguna Goya R, Ravindran G, Vuono R, Parish C L, Foldi C, Piroth T,
Yang S, Parmar M, Nikkhah G, Hjerling-Leffler J, Lindvall O, Barker
R A, Arenas E. Efficient expansion and dopaminergic differentiation
of human fetal ventral midbrain neural stem cells by midbrain
morphogens. Neurobiol Dis. 2012 Aug. 24; 49C:118-127. [0138] Ruiz
S, Diep D, Gore A, Panopoulos A D, Montserrat N, Plongthongkum N,
et al. Identification of a specific reprogramming-associated
epigenetic signature in human induced pluripotent stem cells. Proc
Natl Acad Sci USA. 2012 Oct. 2; 109(40):16196-201. [0139] Seo B M,
Miura M, Gronthos S, Bartold P M, Batouli S, Brahim J, Young M,
Robey P G, Wang C Y, Shi S. Investigation of multipotent postnatal
stem cells from human periodontal ligament. Lancet. 2004 Jul.
10-16; 364(9429):149-55. [0140] Song J S, Kim S O, Kim S H, Choi H
J, Son H K, Jung H S, Kim C S, Lee J H. In vitro and in vivo
characteristics of stem cells derived from the periodontal ligament
of human deciduous and permanent teeth. Tissue Eng Part A. 2012
October; 18(19-20):2040-51. [0141] Takahashi K, Tanabe K, Ohnuki M,
Narita M, Ichisaka T, Tomoda K, et al. Induction of pluripotent
stem cells from adult human fibroblasts by defined factors. Cell.
2007 November 30; 131(0092-8674; 5):861-72. [0142] Taneyhill L A.
To adhere or not to adhere: the role of Cadherins in neural crest
development. Cell Adh Migr. 2008 October-December; 2(4):223-30.
[0143] Tucker B A, I H Park, S D Qi, H J Klassen, C Jiang, J Yao, S
Redenti, G Q Daley and M J Young. Transplantation of adult mouse
iPS cell-derived photoreceptor precursors restores retinal
structure and function in degenerative mice. PLoS One 2011
6:e18992. [0144] Wagers A J, Weissman I L. Plasticity of adult stem
cells. Cell. 2004 Mar. 5; 116(5):639-48. [0145] Wen X, Liu L, Deng
M, Zhang L, Liu R, Xing Y, et al. Characterization of p75(+)
ectomesenchymal stem cells from rat embryonic facial process
tissue. Biochem Biophys Res Commun. 2012 Sep. 12. [0146] Xu X, Li W
E, Huang G Y, Meyer R, Chen T, Luo Y, et al. Modulation of mouse
neural crest cell motility by N-cadherin and connexin 43 gap
junctions. J Cell Biol. 2001 Jul. 9; 154(1):217-30. [0147] Zhou Y,
Chen K S, Gao J B, Han R, Lu J J, Peng T, Jia Y J. [miR-124-1
promotes neural differentiation of rat bone marrow mesenchymal stem
cells]. Zhongguo Dang Dai ErKeZaZhi. 2012 March; 14(3):215-20.
Chinese.
Sequence CWU 1
1
46122DNAArtificial SequenceSynthetic construct 1gatgcctctg
gtggggtatt tc 22220DNAArtificial SequenceSynthetic construct
2tttccttctg tcgctggtgc 20318DNAArtificial SequenceSynthetic
construct 3tgctggattc tcacacac 18422DNAArtificial SequenceSynthetic
construct 4ctcgtcagga ataatgaaca ag 22518DNAArtificial
SequenceSynthetic construct 5atcagatgac attaagac 18618DNAArtificial
SequenceSynthetic construct 6cttcagtgat tctaggat 18723DNAArtificial
SequenceSynthetic construct 7aactgtgtag gaatgtatat gtg
23822DNAArtificial SequenceSynthetic construct 8attagcaaca
accagaataa gt 22920DNAArtificial SequenceSynthetic construct
9caagttctgg gaagtcatca 201019DNAArtificial SequenceSynthetic
construct 10ttgtagtaga cgctgatcc 191120DNAArtificial
SequenceSynthetic construct 11ttggcaaggg aaacaaacac
201224DNAArtificial SequenceSynthetic construct 12tcagggaaat
tgggatgtat atgt 241322DNAArtificial SequenceSynthetic construct
13attcaacgaa gcccactacc ca 221422DNAArtificial SequenceSynthetic
construct 14atccttggct gacttgagga tc 221520DNAArtificial
SequenceSynthetic construct 15ctaccctctc aacgacagca
201620DNAArtificial SequenceSynthetic construct 16gttcctcctc
agagtcgctg 201720DNAArtificial SequenceSynthetic construct
17gacagcccac tcttttgagc 201820DNAArtificial SequenceSynthetic
construct 18tgggtttccc ttcatgactc 201920DNAArtificial
SequenceSynthetic construct 19gaacatcatc cctgcatcca
202019DNAArtificial SequenceSynthetic construct 20ccagtgagct
tcccgttca 192120DNAArtificial SequenceSynthetic construct
21caggtgcccc agctgcttcg 202220DNAArtificial SequenceSynthetic
construct 22cccgccagcg gttattcggg 202320DNAArtificial
SequenceSynthetic construct 23caagatctcg gaccgctact
202420DNAArtificial SequenceSynthetic construct 24ccgtggtcag
catcttgtta 202520DNAArtificial SequenceSynthetic construct
25ctgcagagaa gagtgtcgca 202622DNAArtificial SequenceSynthetic
construct 26ggtcttcacc tgtttgtagc tg 222722DNAArtificial
SequenceSynthetic construct 27caggagaaac agggcctaca ga
222819DNAArtificial SequenceSynthetic construct 28tccagcttgg
ggtcctgaa 192920DNAArtificial SequenceSynthetic construct
29cctgagggct tcaaagtgtc 203020DNAArtificial SequenceSynthetic
construct 30cggaacttct tggtctccag 203120DNAArtificial
SequenceSynthetic construct 31ggctccacac cttacagctc
203220DNAArtificial SequenceSynthetic construct 32ctgggctccc
tgggtagtag 203322DNAArtificial SequenceSynthetic construct
33cttcaggaga tatgcaaagc ag 223419DNAArtificial SequenceSynthetic
construct 34gctgatctgc tgcagtgtg 193520DNAArtificial
SequenceSynthetic construct 35gcagaggtcc tatcccatga
203620DNAArtificial SequenceSynthetic construct 36ctgggtggaa
agagaagctg 203719DNAArtificial SequenceSynthetic construct
37cggaggtcaa caacgagtc 193820DNAArtificial SequenceSynthetic
construct 38tctctgcctt ctgtgtggtg 203923DNAArtificial
SequenceSynthetic construct 39gaccccaatc ggaagcctaa cta
234023DNAArtificial SequenceSynthetic construct 40agcctttccc
actgtcctca tct 234120DNAArtificial SequenceSynthetic construct
41ttcggaccca cacattacct 204220DNAArtificial SequenceSynthetic
construct 42gcagtgaggg caagaaaaag 204320DNAArtificial
SequenceSynthetic construct 43cccccctgtg gttacctctt
204421DNAArtificial SequenceSynthetic construct 44gctgggacat
gtgaagtctg c 214520DNAArtificial SequenceSynthetic construct
45acctcaacca cctggtatcg 204620DNAArtificial SequenceSynthetic
construct 46ttcttggcat cgaacatctg 20
* * * * *