U.S. patent application number 15/138221 was filed with the patent office on 2019-01-03 for genetic testing for improved cattle fertility.
The applicant listed for this patent is WISCONSIN ALUMNI RESEARCH FOUNDATION. Invention is credited to Hasan Khatib.
Application Number | 20190002992 15/138221 |
Document ID | / |
Family ID | 49292838 |
Filed Date | 2019-01-03 |
![](/patent/app/20190002992/US20190002992A9-20190103-D00001.png)
![](/patent/app/20190002992/US20190002992A9-20190103-D00002.png)
![](/patent/app/20190002992/US20190002992A9-20190103-D00003.png)
![](/patent/app/20190002992/US20190002992A9-20190103-D00004.png)
United States Patent
Application |
20190002992 |
Kind Code |
A9 |
Khatib; Hasan |
January 3, 2019 |
GENETIC TESTING FOR IMPROVED CATTLE FERTILITY
Abstract
Arrays of nucleic acid molecules, kits, methods of genotyping
and marker assisted bovine breeding methods based on novel SNPs on
genes of the bovine transforming growth factor-.beta. (TGF-.beta.)
signaling pathway for improved bovine fertilization rate. The
methods and compositions of the present invention are related to
SNPs in the DNA-binding protein inhibitor 3 (ID3) gene, and in the
bone morphogenetic protein 4 (BMP4) gene corresponding to position
2702 of SEQ ID NO: 2. Also disclosed are methods for determining
viability of developing bovine embryos by measuring the expression
level of one or more target genes in the TGF-signaling pathway, and
selecting for implantation only embryos whose target gene
expression level is not up-regulated.
Inventors: |
Khatib; Hasan; (Fitchburg,
WI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
WISCONSIN ALUMNI RESEARCH FOUNDATION |
MADISON |
WI |
US |
|
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20160237508 A1 |
August 18, 2016 |
|
|
Family ID: |
49292838 |
Appl. No.: |
15/138221 |
Filed: |
April 26, 2016 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13798176 |
Mar 13, 2013 |
|
|
|
15138221 |
|
|
|
|
61621571 |
Apr 8, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2600/124 20130101;
C12Q 1/6888 20130101; A61D 19/02 20130101; C12Q 2600/156 20130101;
C12Q 1/6876 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; A61D 19/02 20060101 A61D019/02 |
Goverment Interests
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with government support under
12-CRHF-0-6055 awarded by the USDA/NIFA. The government has certain
rights in the invention.
Claims
1. An isolated oligonucleotide molecule, or a complement thereof,
consisting of position 1213 of SEQ ID NO: 1 and between 11 and 150
contiguous nucleotides adjacent to position 1213 of SEQ ID NO: 1,
wherein position 1213 is cytosine or thymine; or an isolated
oligonucleotide molecule, or a complement thereof, consisting of
position 2702 of SEQ ID NO: 2 and between 11 and 150 contiguous
nucleotides adjacent to position 2702 of SEQ ID NO: 2, wherein
position 2702 is cytosine or adenine.
2. The oligonucleotide molecule according to claim 1, which
comprises at least about 15 contiguous nucleotides adjacent to
position 1213 of SEQ ID NO: 1, or to position 2702 of SEQ ID NO:
2.
3. The oligonucleotide molecule according to claim 2, which
comprises at least about 20 contiguous nucleotides adjacent to
position 1213 of SEQ ID NO:1, or position 2702 of SEQ ID NO: 2.
4. The oligonucleotide molecule according to claim 1, which
consists of not more than about 100 nucleotides.
5. The oligonucleotide molecule according to claim 1, which
consists of not more than about 50 nucleotides.
6. The oligonucleotide molecule according to claim 1, wherein
position 1213 of SEQ ID NO: 1 or position 2702 of SEQ ID NO: 2 is
within 4 nucleotides of the center of the oligonucleotide
molecule.
7. The oligonucleotide molecule according to claim 6, wherein
position 1213 of SEQ ID NO: 1 or position 2702 of SEQ ID NO: 2 is
at the center of the oligonucleotide molecule.
8. The oligonucleotide molecule according to claim 1, wherein
position 1213 of SEQ ID NO: 1 or position 2702 of SEQ ID NO: 2 is
at the 3'-end of the oligonucleotide molecule.
9. An array of nucleic acid molecules comprising the isolated
oligonucleotide molecule according to claim 1 supported on a
substrate.
10. A kit comprising an isolated oligonucleotide molecule of claim
1, and a suitable container.
11. A method for detecting single nucleotide polymorphism (SNP) in
a gene encoding a DNA binding protein inhibitor 3 (ID3 gene), in a
bovine cell, the method comprising determining the identity of a
nucleotide on the ID3 gene of the cell at a position corresponding
to position 1213 of SEQ ID NO: 1, and comparing the identity to the
nucleotide identity at a corresponding position of in SEQ ID NO: 1;
or a method for detecting single nucleotide polymorphism (SNP) in a
gene encoding a bone morphogenetic protein 4 (BMP4 gene) in a
bovine cell, the method comprising determining the identity of a
nucleotide on the BMP4 gene of the cell at a position corresponding
to position 2702 of SEQ ID NO: 2, and comparing the identity to the
nucleotide identity at a corresponding position of in SEQ ID NO:
2.
12-18. (canceled)
19. A method for determining whether an individual bovine animal is
suitable as a gamete donor for natural mating, artificial
insemination or in vitro fertilization, the method comprising
detecting the SNP according to claim 11, and excluding as gamete
donor an individual whose genotype is TT at a position in the ID3
gene corresponding to position 1213 of SEQ ID NO: 1, or selecting
as a gamete donor an individual whose genotype is TT at a position
in the BMP4 gene corresponding to position 2702 of SEQ ID NO:
2.
20. A method of selecting a bovine embryo for planting in a uterus,
the method comprising genotyping the embryo according to claim 11
while preserving the viability of the embryo, and excluding from
planting an embryo whose genotype is TT at a position in the ID3
gene corresponding to position 1213 of SEQ ID NO: 1, or selecting
for planting an embryo whose genotype is TT at a position in the
BMP4 gene corresponding to position 2702 of SEQ ID NO: 2.
21. A method for selectively breeding of cattle using a multiple
ovulation and embryo transfer procedure (MOET), the method
comprising superovulating a female animal, collecting eggs from
said superovulated female, in vitro fertilizing said eggs from a
suitable male animal, implanting said fertilized eggs into other
females allowing for an embryo to develop, and genotyping said
developing embryo according to claim 11, and terminating pregnancy
if the genotype of the developing embryo is TT at a position in the
ID3 gene corresponding to position 1213 of SEQ ID NO: 1, or
allowing pregnancy to proceed if the genotype of the embryo is TT
at a position in the BMP4 gene corresponding to position 2702 of
SEQ ID NO: 2.
22-26. (canceled)
27. A cattle breeding method comprising determining whether an
individual bovine animal is suitable as a gamete donor for natural
mating, artificial insemination or in vitro fertilization according
to claim 19, and using said selected bovine animal as a breeding
parent in a process of natural mating, artificial insemination or
in vitro fertilization.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This is a divisional application of U.S. application Ser.
No. 13/798,176 filed on Mar. 13, 2013 claiming priority to U.S.
Patent Application No. 61/621,571 filed on Apr. 8, 2012, the entire
disclosure of which is incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The present invention relates to methods for genetically
testing cattle using molecular genetic methods by assaying for the
presence of at least one genetic marker which is indicative of
fertility. The present invention further relates to a method for
assaying cattle embryo viability by assaying gene expression
pattern in the embryo. Specifically, genetic variations in, and
expression level of genes, of the transforming growth factor beta
signaling pathway are tested for improved pre-implantation
embryonic development in cattle.
BACKGROUND OF THE INVENTION
[0004] Dairy cows are significant investments for dairy farmers,
and enormous efforts, such as animal breeding and artificial
insemination, have been and continue to be made to ensure that the
animals have high and sustained productivity, and that the milk
produced is of high quality. The dairy cattle genome has been
significantly restructured over the past 30 years due to intensive
selection for production traits.
[0005] Reproductive deterioration in high-producing dairy cows has
caused substantial economic loss in the dairy cattle industry
(Lucy, 2007). Two of the key factors contributing to decreasing
fertility of dairy cow are low fertilization rate and early
embryonic mortality (Royal et al., 2000. Sheldon et al. 2006), both
of which occur during the pre-implantation embryo development.
Although genetic factors are known to affect reproductive
performance (Shook, 2006), the identification of specific genes has
been a challenge, probably due to the low accuracy of fertility
data collected in the field, and the low heritability of these
traits (VanRaden et al., 2004). Thus, understanding the genetic
regulation of bovine pre-implantation embryo development and
identifying associated biomarkers are becoming progressively
essential to improving dairy cattle fertility.
[0006] To investigate the relationship between genetic factors and
pre-implantation embryo development in bovine, the present inventor
has created an in vitro fertilization (IVF) system, which enables
the identification of genetic factors affecting fertilization and
early embryonic development at both the cow and embryo levels. At
the cow level, the IVF system has been utilized to uncover
associations of cow genotypes with fertilization success and
blastocyst rate of embryos produced from these cows (Driver et al.
2009; Huang et al. 2010a; Khatib et al. 2009a,b; Khatib et al.
2008a,b; Wang et al. 2009). At the embryo level, differential gene
expression between normal blastocysts and degenerate embryos has
been investigated by applying RNA-Seq (Huang & Khatib, 2010),
microarray expression (Huang et al., 2010b), and candidate gene and
pathway analyses (Laporta et al., 2011; Zhang et al., 2011).
[0007] The transforming growth factor-.beta. (TGF-.beta.) signaling
pathway has long been acknowledged for signal transduction and
other intracellular activities, such as cell division,
differentiation, migration, apoptosis, and transformation
(Santibanez et al., 2011). In addition, several studies have
suggested the involvement of the TGF-.beta. signaling cascade and
its components in preimplantation embryo development as well as
ovarian function (Shimasaki et al., 2004; Zhang et al., 2007). For
example, Said et al. (2010) recently reported that known members of
TGF-.beta. pathway showed dynamic changes in gene expression
profiles during the three early stages of human embryonic
development, including oocytes, day-3 embryos, and human embryonic
stem cells on day 7. Also, results from the mouse showed that
multiple bone morphogenetic proteins (BMPs) and SMAD6 in the
TGF-.beta. pathway were found to be expressed in a stage-specific
pattern and were developmentally regulated in oocytes and
preimplantation embryos (Wang et al., 2004). BMPs and GDF9, also a
member of TGF-.beta., have been reported as crucial regulators of
folliculogenesis in mouse models (Otsuka et al. 2011; Trombly et
al. 2009).
[0008] It is worth mentioning that most of the reported data on
TGF-.beta. pathway genes have been generated in the mouse model and
there is little information on other species such as cattle.
Interestingly, in a recent transcriptomic study of the bovine IVF
system, the TGF-.beta. pathway was found to be upregulated in
degenerate embryos compared to blastocysts using microarrays (Huang
et al., 2010b). However, several genes from this pathway were not
included in the microarray analysis.
[0009] Many components of the signaling cascade of TGF-.beta.
pathway are known, and they include ligands (BMP4, GDF9, and
INHBA); receptors (BMPR1A and ACVR1); SMAD proteins (SMAD2);
upstream regulators (THBS2, THBS4, DCN); and downstream regulators
(ID3, BMPER, PPP2R1A, RPS6KB2, PITX2). The signaling process of
this pathway necessitates coordination of gene regulation among the
different members of the pathway. For example, the activation of
latent TGF-.beta. requires binding of the thrombospondin-1 (THBS1)
to the TGF-.beta. precursor complex (Murphy-Ullrich & Poczatek,
2000). Protein phosphatase 2 (PPP2) and Ribosomal protein S6 kinase
(RPS6K) are key regulators implicated in the phosphorylation of
receptor and SMADs in the TGF-.beta. signaling cascade (Fenton
& Gout, 2010; Zolnierowicz, 2000). ID proteins are direct
targets of BMP and TGF-3 signaling, which serve as essential
mediators in biological responses downstream the pathway (Miyazono
& Miyazawa, 2002). The cell distribution and coordination of
gene expression among the TGF-.beta. genes testify to the
significance of this pathway in embryo development.
[0010] Furthermore, the expression of many members of the
TGF-.beta. superfamily in the endometrium suggests a pivotal role
of these genes in the differentiation of the endometrium and the
implantation process (Jones et al. 2006). Consequently, the
expression of TGF-.beta. genes in preimplantation bovine embryos
suggests an important role of these genes in the embryo-uterus
connection. Indeed, it has been reported that blastocysts express
TGF-.beta. proteins that induce apoptosis of endometrial epithelial
cells during implantation (Jones et al. 2006). Collectively,
expression of TGF-.beta. signaling genes in the bovine embryo
suggests important role for the TGF-.beta. pathway in the
preimplantation stage of bovine embryo.
[0011] There are also reports that these genes function in
maintaining pluripotency in the inner cell mass of bovine
blastocysts (Pant & Keefer, 2009). Koide et al. (2009)
demonstrated that overactivity of BMP4 signaling led to excessive
apoptosis in early mammalian embryo development. Also, La Rosa et
al. (2011) reported that supplementation of BMP4 to culture medium
of IVF embryos decreased blastocyst production and concluded that a
balanced BMP signaling activity is required for proper
preimplantation development of cattle embryos.
[0012] The ID proteins function as key regulators of development by
stimulating and maintaining proliferation and to preventing
premature differentiation (Yokota & Mori, 2002), and are known
to be regulated by other members of the TGF-.beta. pathway such as
BMPs (Hogg et al. 2010). BMPER is a BMP binding endothelial
regulator and has been reported to modulate BMP4 signaling in
endothelial cell differentiation and angiogenesis (Heinke et al.
2008; Moser et al. 2003).
[0013] Although the specific roles in bovine embryo development of
differentially expressed genes are unknown, they have critical
functions in the TGF-.beta. signaling. For example, SMAD2 belongs
to the SMAD family of proteins, which are transducers of TGF-.beta.
signal from the cell surface to the nucleus and transcription
factors mediating the expression of target genes in the TGF-.beta.
cascade (Heldin et al. 1997; Massague et al. 2005). SMAD proteins
are required for pluripotency maintenance of the inner cell mass in
mouse blastocysts (James et al. 2005).
[0014] In a genome-wide association study, a SNP associated with
fertilization rate was located within 50 Kb distance of ID3 (Huang
et al. 2010a). Although the molecular regulation of fertilization
success is not fully understood, maternal genome activity and
oocyte quality appear to have critical roles in embryogenesis
(Marteil et al. 2009; Stitzel & Seydoux, 2007). Recently, Hogg
et al. (2010) observed that four ID isoforms (ID1-4) were expressed
across the ovine ovarian follicle development and possibly
regulated by TGF-.beta. signaling via SMADs, and suggested
mechanistic roles of the ID proteins in mammalian oocyte
development. Furthermore, ID proteins are key regulators for many
cellular processes, such as cell proliferation, differentiation,
and cell cycle progression, which in turn are required for oocyte
maturation, oocyte-to-embryo transition, and embryogenesis (Norton,
2000; Stitzel & Seydoux, 2007).
[0015] Indeed, it has been acknowledged that blastocyst yield can
be affected by intrinsic oocyte quality (Rizos et al. 2002), and
the involvement of BMP4 in ovarian function has been extensively
reported (Shimasaki et al. 1999). The spatiotemporal expression of
BMP4 signaling in follicle development has been broadly observed
across different species including human, rat, bovine, swine, and
zebrafish (Fatehi et al. 2005; Li & Ge, 2011; Nilsson &
Skinner, 2003; Shimizu et al. 2004; Tanwar & McFarlane, 2011).
Functional studies have also shown that BMP4 suppresses bovine
granulose cell apoptosis and promotes follicle survival and
development in rats (Kayamori et al. 2009; Nilsson & Skinner,
2003).
[0016] Nevertheless, even though the TGF-.beta. signaling pathway
was known to play a crucial role in ovarian and embryonic
development, it had not been established whether the balance of
expression level of various genes from this pathway is needed for
proper preimplantation development of IVF embryos. Furthermore,
there was limited information on the extent of contributions of
maternal and embryonic genomes to the survival of the developing
embryo. More importantly, no indication existed that variations of
the maternal genotype in regard to the TGF-.beta. genes had an
impact on fertility rates. Identifying genetic factors that show
association with fertility would enable selection or breeding
programs that reduce the frequency of deleterious alleles at these
loci by marker- or gene-assisted selection, preventing further
decline or even improving reproductive status of the global dairy
herd. In this regard, a plurality of or multiple genes are likely
more reliable than a single gene or SNP in predicting high
fertility or enhanced embryo survival.
SUMMARY OF THE INVENTION
[0017] The present inventor investigated the expression profiles of
TGF-.beta. genes in degenerate embryos and normal blastocysts and
evaluated the association between maternal genotypes of the
TGF-.beta. genes and fertility traits, specifically fertilization
success and blastocyst rate, and whether altered expression of
TGF-.beta. genes in preimplantation bovine embryos is associated
with morphological abnormalities of these embryos, and concluded
that TGF-.beta. pathway genes play a vital function in the
regulation of preimplantation embryo development at both embryo and
cow levels, and that these genes can be used as genetic markers for
embryo development and fertility in cattle.
[0018] Specifically, cattle embryos were produced and classified at
the blastocyst stage as either normally-developed blastocysts or
degenerates (growth-arrested embryos). The expression patterns of
25 genes from the TGF-.beta. pathway were assessed using
quantitative real time PCR. Ten genes showed differential
expression between the two embryo groups, four genes displayed
similar expressional profiles, and eleven genes had no detectable
expression. An altered expression profile was found to be
statistically significant for 10 out of the 14 expressed genes, and
all were upregulated in degenerate embryos versus blastocysts.
[0019] Furthermore, genomic association analysis of the cows from
which embryos were produced revealed a significant association of
polymorphisms in DNA-binding protein inhibitor 3 (ID3) and bone
morphogenetic protein 4 (BMP4)--two of the gens that showed the
most significant differential expression--with fertilization rate
and blastocyst rate, respectively.
[0020] Accordingly, in one embodiment, the present invention
provides method for screening cattle embryos for implanting, the
method comprising measuring the expression level of at least one
Target Gene, without adversely affecting or at least maintaining
the viability of the embryo, and selecting an embryo whose Target
Gene expression level is not elevated for planting into a suitable
uterus for further development. The Target Gene as used herein is a
gene from the TGF-.beta. pathway, preferably a gene selected from
the group consisting of: DNA-binding protein inhibitor 3 (ID3);
thrombospondin-2 (THBS2); bone morphogenetic protein 4 (BMP4);
growth differentiation factor-9 (GDF9); BMP binding endothelial
regulator (BMPER); decorin (DCN); SMAD family member 2 (SMAD2);
thrombospondin-4 (THBS4); protein phosphatase 2, regulatory subunit
A, alpha (PPP2R1A); and ribosomal protein S6 kinase, 70 kDa,
polypeptide 2 (RPS6KB2).
[0021] In one embodiment, the expression level if the target gene
is measured, e.g. via quantitative PCR, as a relative value against
one or more housekeeping genes. In another embodiment, the
expression level of the Target Gene(s) from a sample of a number of
embryos, and those embryos whose gene expression level is higher
than the others in the same sample are deemed to have up-regulated
Target Gene expression and will be discarded. In another
embodiment, the expression levels of a plurality of the Target
Genes are measured against a plurality of housekeeping genes, to
determine if the Target Genes are up-regulated or not. Because the
Target Genes belong to the same signaling pathway, upregulation of
one is indicative of upregulation of many or all in the same
pathway, and is sufficient as an indication that the embryo is
undesirable as an implant candidate.
[0022] In another embodiment, the present invention provides an
isolated oligo- or polynucleotide molecule consisting of position
1213 of SEQ ID NO: 1, which represents a portion of the ID3 gene,
and between 11 and 150 contiguous nucleotides adjacent to position
1213 of SEQ ID NO: 1, wherein position 1213 is cytosine or thymine.
In addition, the present invention provides an isolated
oligonucleotide molecule consisting of position 2702 of SEQ ID NO:
2, which represents a portion of the BMP4 gene, and between 11 and
150 contiguous nucleotides adjacent to position 2702 of SEQ ID NO:
2, wherein position 2702 is cytosine or adenine. Such isolated
oligo- or polynucleotides are suitable for use as probes or primers
for genotyping purposes, as are detailed elsewhere in this
disclosure.
[0023] In one embodiment, the nucleotide molecule of the present
invention comprises at least about 15 contiguous nucleotides
adjacent to position 1213 of SEQ ID NO: 1, or about 15 contiguous
nucleotides adjacent to position 2702 of SEQ ID NO: 2. In one
embodiment, the nucleic acid molecule of the present invention
comprises at least about 20 contiguous nucleotides adjacent to the
respective SNP positions (i.e. position 1213 of SEQ ID NO:1, or
position 2702 of SEQ ID NO: 2). In one embodiment, the
oligonucleotide molecule of the present invention consists of not
more than about 100 nucleotides. In one embodiment, the
oligonucleotide molecule of the present invention consists of not
more than about 50 nucleotides. In one embodiment, the SNP position
of the nucleotide molecule of the present invention near or at the
center of the molecule; alternatively, the SNP position is at the
3'-end of the oligonucleotide molecule.
[0024] Also provided herein is an array of nucleic acid molecules
comprising the isolated oligonucleotide molecule of the present
invention, supported on a substrate. The substrate may be any
suitable medium such as glass, known and readily available to one
of ordinary skills in the art, and the array may be
addressable.
[0025] The present invention further provides a kit comprising an
isolated oligonucleotide molecule of the present invention, and a
suitable container.
[0026] In another embodiment, the present invention provides a
method for detecting single nucleotide polymorphism (SNP) in a gene
encoding the DNA binding protein inhibitor 3 (ID3 gene), in a
bovine cell, the method comprising determining the identity of a
nucleotide on the ID3 gene of the cell at a position corresponding
to position 1213 of SEQ ID NO: 1, and comparing the identity to the
nucleotide identity at a corresponding position of in SEQ ID NO:
1.
[0027] The present invention further provides a method for
detecting single nucleotide polymorphism (SNP) in a gene encoding
the bone morphogenetic protein 4 (BMP4 gene) in a bovine cell, the
method comprising determining the identity of a nucleotide on the
BMP4 gene of the cell at a position corresponding to position 2702
of SEQ ID NO: 2, and comparing the identity to the nucleotide
identity at a corresponding position of in SEQ ID NO: 2.
[0028] In one embodiment, the bovine cell may be an adult cell, an
embryo cell, a sperm, an egg, a fertilized egg, or a zygote. The
identity of the nucleotide may be determined by many methods known
and readily available to those ordinarily skilled in the art, such
as but not limited to sequencing a nucleic acid molecule comprising
a suitable portion of the ID3 or BMP4 gene of the cell comprising
respectively a position corresponding to position 1213 of SEQ ID
NO: 1 or position 2702 of SEQ ID NO: 2; or by hybridizing a
suitable probe to a nucleic acid preparation from the cell, which
probe may be suitably labeled e.g. fluorescently or
radioactively.
[0029] The nucleic acid molecule may be isolated from the cell via
a large variety of methods, known and readily available to an
ordinarily skilled artisan, such amplification by the polymerase
chain reaction (PCR) of genomic DNA of the cell, or when
appropriate, by RT-PCR of the mRNA of the cell.
[0030] In preferred embodiment, both copies of the gene in a
diploid genome are genotyped according to the method of the present
invention.
[0031] The identity of the nucleotide may be determined based on
genotypes of the parent of the cell, genotypes of the daughter of
the cell, or both, through genetic analysis methods well-known to
those skilled in the art.
[0032] A method is further provided for determining whether an
individual bovine animal is suitable as a gamete donor for natural
mating, artificial insemination or in vitro fertilization, the
method comprising detecting the SNP according to the above method
of the present invention, and excluding as gamete donor an
individual whose genotype is TT at a position in the ID3 gene
corresponding to position 1213 of SEQ ID NO: 1. In one embodiment,
the individual is excluded as a gamete donor if the individual,
when mated with another parent, produces an offspring (e.g. a
zygote or fertilized egg) whose genotype is TT at a position in the
ID3 gene corresponding to position 1213 of SEQ ID NO: 1.
[0033] The present invention also provides a method for determining
whether an individual bovine animal is suitable as a gamete donor
for natural mating, artificial insemination or in vitro
fertilization, the method comprising detecting the SNP according to
the above method of the present invention, and selecting as a
gamete donor an individual whose genotype is TT at a position in
the BMP4 gene corresponding to position 2702 of SEQ ID NO: 2. In
one embodiment, the individual is selected as a gamete donor if the
individual, when mated with another parent, produces an offspring
(e.g. a zygote or fertilized egg) whose genotype is TT at a
position in the BMP4 gene corresponding to position 2702 of SEQ ID
NO: 2.
[0034] The present invention additionally provides a method of
selecting a bovine embryo for planting in a uterus, the method
comprising genotyping the embryo according to the present
invention, while preserving the viability of the embryo, and
excluding from planting an embryo whose genotype is TT at a
position in the ID3 gene corresponding to position 1213 of SEQ ID
NO: 1, or selecting for planting an embryo whose genotype is TT at
a position in the BMP4 gene corresponding to position 2702 of SEQ
ID NO: 2.
[0035] In another embodiment, the present invention further
provides a method for selectively breeding cattle using a multiple
ovulation and embryo transfer procedure (MOET), the method
comprising superovulating a female animal, collecting eggs from
said superovulated female, in vitro fertilizing said eggs from a
suitable male animal, implanting said fertilized eggs into other
females allowing for an embryo to develop, and genotyping said
developing embryo, and terminating pregnancy if the genotype of the
developing embryo is TT at a position in the ID3 gene corresponding
to position 1213 of SEQ ID NO: 1, or allowing pregnancy to proceed
if the genotype of the embryo is TT at a position in the BMP4 gene
corresponding to position 2702 of SEQ ID NO: 2. In one embodiment,
the embryo is selected only if the genotype of the developing
embryo is TT at a position in the BMP4 gene corresponding to
position 2702 of SEQ ID NO: 2 but not TT at a position in the ID3
gene corresponding to position 1213 of SEQ ID NO: 1.
DESCRIPTION OF THE DRAWINGS
[0036] FIG. 1 shows differential expression, represented as fold
change (Mean.+-.SEM), of genes in the TGF-.beta. pathway in
degenerate embryos vs. blastocysts using qRT-PCR. Upregulation in
degenerative embryos or blastocysts is shown by bars above or below
the x-axis, respectively. The qRT-PCR was performed in three sets
of biological replicates of blastocysts and degenerate embryos. *
p<0.05; ** p<0.01; *** p<0.001.
[0037] FIG. 2 shows the partial sequence of the ID3 gene (SEQ ID
NO:1) where the relevant SNP position is noted, as well as the
primers used for the qRT-PCR.
[0038] FIG. 3 shows the partial sequence of the BMP4 gene (SEQ ID
NO:2) where the relevant SNP position is noted, as well as the
primers used for the qRT-PCR.
DETAILED DESCRIPTION OF THE INVENTION
[0039] It has now been found that genes in the TGF-.beta. pathway
are involved in the development of preimplantation bovine embryos
at both the embryonic and maternal levels. At the embryo level,
some genes of the TGF-.beta. pathway are upregulated in the
growth-arrested embryos compared to normal blastocysts. At the
maternal level, two genes are differentially-expressed in embryos,
and their expression levels also show significant association with
fertilization and blastocyst rates.
[0040] The expression profiles of the TGF-.beta. genes in
normally-developed blastocysts as compared to growth-arrested
embryos produced from the same parents and cultured at the same
laboratory conditions were examined, in order to investigate the
role in blastocyst formation. It was found that fourteen (14) genes
of the signaling cascade of TGF-.beta. pathway were expressed in
pre-implantation embryos, and these genes represent all components
of the pathway, including ligands (BMP4, GDF9, and INHBA);
receptors (BMPR1A and ACVR1); SMAD proteins (SMAD2); upstream
regulators (THBS2, THBS4, DCN); and downstream regulators (ID3,
BMPER, PPP2R1A, RPS6KB2, PITX2).
[0041] Out of the 14 expressed genes, 10 showed statistically
significant expression differences between the embryo types, of
which all were found to be upregulated in the degenerate embryos.
Four genes that showed the most significant expression differences
between embryo groups were tested for single nucleotide
polymorphisms (SNP) association with fertilization and blastocyst
rates, using an IVF experimental system that has been recently
developed to identify genes affecting fertilization and embryo
development in cattle. This IVF experimental system is fully
described previously, e.g. in Driver et al. 2009; Huang et al.
2010a; Khatib et al. 2009a, 2009b; Khatib et al. 2008a, 2008b;
Laporta et al. 2011; Wang et al. 2009, all of which are
specifically incorporated herein by reference in their
entirety.
[0042] A significant association was observed between ID3 maternal
genotypes and fertilization rate. This result is consistent with a
previous genome-wide association study, in which a SNP associated
with fertilization rate was located within 50 Kb distance of ID3
(Huang et al. 2010a), and suggest that ID3 affects fertilization
rate through maternal genome effects that control oocyte quality
and oocyte-to-embryo transition.
[0043] Maternal genotypes of BMP4 were found to be significantly
associated with blastocyst rate, suggesting its role in controlling
intrinsic oocyte competence and development up to the blastocyst
stage. The differential expression of BMP4 in embryos and the
significant association of maternal genotypes with blastocyst rate
indicate that this gene could regulate preimplantation embryo
development not only through the embryo proper but also through the
maternal genome.
[0044] More specifically, the present inventions identified two
SNPs, one in the 3'untranslated region (3'UTR) of ID3, and one in
the coding region (CDS) of BMP4. These SNPs were found to be in
Hardy-Weinberg equilibrium (see Table 1). Estimates of the
genotypic classes in each SNP for blastocyst and fertilization rate
and relevant P values are given in Table 2 in the Examples.
Analysis of SNP in ID3 revealed a significant association with
fertilization rate (P=0.029). Oocytes from genotypes TT ovaries had
5.2% and 5.3% lower fertilization rates than those from TC and CC
ovaries, respectively (Table 1). Blastocyst rate was significantly
associated with SNP rs109778173 of BMP4 (P=0.006), whereas the
association with fertilization rate was not statistically
significant (P=0.095). Embryos produced from genotype TT cows
showed 10.5% and 16.1% higher blastocyst rates than GG and GT cows,
respectively (Table 2).
[0045] Accordingly, in one embodiment, the present invention
provides a method for screening cattle embryos for implanting, the
method comprising measuring the expression level of at least one
Target Gene, while maintaining the viability of the embryo, and
selecting an embryo whose Target Gene expression level is not
elevated for planting into a suitable uterus for further
development.
[0046] Methods of extracting a blastomere, or a single cell from a
developing embryo, even at the early stage of development (5-8
cells), are readily known to those ordinarily skilled in the art,
without affecting the viability of the embryo. Furthermore single
cell cDNA analysis may be performed on the extracted blastomere,
using methods well-established and readily available to those of
ordinary skills in the art. See e.g. Amparo et al., Functional
Genomics of 5- to 8-cell Stage Human Embryos by Blastomere
Single-Cell cDNA Analysis, PLoS One 5(10) e13615, the entire
content of which is incorporated herein by reference.
[0047] The Target Gene as used herein refers to a gene from the
TGF-.beta. pathway, preferably a gene selected from the group
consisting of: DNA-binding protein inhibitor 3 (ID3);
thrombospondin-2 (THBS2); bone morphogenetic protein 4 (BMP4);
growth differentiation factor-9 (GDF9); BMP binding endothelial
regulator (BMPER); decorin (DCN); SMAD family member 2 (SMAD2);
thrombospondin-4 (THBS4); protein phosphatase 2, regulatory subunit
A, alpha (PPP2R1A); and ribosomal protein S6 kinase, 70 kDa,
polypeptide 2 (RPS6KB2).
[0048] In one embodiment, to determine whether the expression level
of the target gene is up-regulated or not, the expression level of
the Target Gene is measured as a relative value against one or more
housekeeping genes. A housekeeping gene is typically a constitutive
gene that is required for the maintenance of basic cellular
function, and is expressed in all cells of an organism. Some
housekeeping genes are expressed at relatively constant levels
(such as HSP90 and Beta-actin), while other housekeeping genes may
vary depending on experimental conditions, but are nevertheless
suitable as internal control because the embryos or blastomere
isolated therefrom are cultured under the same condition.
[0049] In another embodiment, the expression level of the Target
Gene(s) from a sample of a number of embryos is measured.
Generally, in a sample of sufficient size, the embryos will belong
to two groups, one whose Target Gene expression level is higher
than the other, and those embryos in the group of higher gene
expression level are deemed to have up-regulated Target Gene
expression and will be discarded according to the present
invention. Statistically, and based on data obtained so far, it is
reasonable to assume that in any given sample, e.g. of at least 10
embryos, some of the embryos will have a relatively low level of
Target Gene expression while others will have a relatively high
level. Because these embryos are cultured or otherwise treated
under identical conditions, such relative upregulation, even
without any other reference point or control, indicates that the
Target Genes are up-regulated, and the embryos should be discarded.
It is readily recognized that the larger the sample size, the more
reliable the determination. Preferably, the number of embryos to be
tested simultaneously should be at least 20 or higher.
[0050] In another embodiment, the expression levels of a plurality
of the Target Genes are measured against a plurality of
housekeeping genes, to determine if the Target Genes are
up-regulated or not. This approach improves the reliability of the
measurements, because the target genes belong to the same pathway,
upregulation of one is indicative of upregulation of many or all,
and is sufficient as an indication that the embryo is undesirable
as an implant candidate.
[0051] It is readily recognized that the RNA should be extracted
from the blastomere under conditions that provide a maximum
representation of all transcribed RNA species present in the
blastomere. The RNA should then be treated with a reverse
transcription reaction mixture comprising a plurality of
gene-specific oligonucleotides corresponding to at least a subset
of said RNA species, dNTPs and a reverse transcriptase, under
conditions allowing transcription of said RNA into complementary
DNA (cDNA).
[0052] Furthermore, the present invention provides nucleic
acid-based genetic markers for identifying bovine animals with
superior fertility, specifically, fertilization or blastocyst
rates. In general, for use as markers, isolated oligonucleotide or
polynucleotide molecules, or isolated nucleic acid fragments,
preferably DNA fragments, as used. Such markers will be of at least
10 nucleotides (nt), preferably at least 11, 12, or 15 nt, usually
at least 20 nt, often at least 50 nt. Such small DNA fragments are
useful as primers for the polymerase chain reaction (PCR), and
probes for hybridization screening, etc.
[0053] In the context of the present invention, the term "isolated"
refers to a nucleic acid molecule purified to some degree from
endogenous materials with which the nucleic acid molecule may
naturally occur or exist. At the least, the term "isolated" refers
to a nucleic acid molecule separated from chromatin or other
protein or components of the genomic DNA. Preferably, the isolated
oligonucleic acid molecule or polynucleic acid molecule of the
present invention comprises a fragment that is shorter than that
which is naturally occurring.
[0054] The provided sequences also encompass the complementary
sequence corresponding to any of the provided polymorphisms. Where
appropriate, and in order to provide an unambiguous identification
of the specific site of a polymorphism, the numbering of the
original nucleic sequences in the GenBank may be used;
alternatively, the numbering may simply refer to the specific
sequence in the Sequence Listing accompanying this disclosure.
[0055] The term primer refers to a single-stranded oligonucleotide
capable of acting as a point of initiation of template-directed DNA
synthesis under appropriate conditions (i.e., in the presence of
four different nucleoside triphosphates and an agent for
polymerization, such as, DNA or RNA polymerase or reverse
transcriptase) in an appropriate buffer and at a suitable
temperature. The appropriate length of a primer depends on the
intended use of the primer but typically ranges from 15 to 30
nucleotides. Short primer molecules generally require cooler
temperatures to form sufficiently stable hybrid complexes with the
template. A primer need not reflect the exact sequence of the
template but must be sufficiently complementary to hybridize with a
template. The term primer site, or priming site, refers to the area
of the target DNA or RNA to which a primer hybridizes. The term
primer pair means a set of primers including a 5' upstream primer
that hybridizes with the 5' end of the DNA sequence to be amplified
and a 3', downstream primer that hybridizes with the complement of
the 3' end of the sequence to be amplified. One of these two
primers is often referred to as the "forward primer," while the
other the "reverse primer."
[0056] The term "probe" or "hybridization probe" denotes a defined
nucleic acid segment (or nucleotide analog segment) which can be
used to identify by hybridization a specific polynucleotide
sequence present in samples, said nucleic acid segment comprising a
nucleotide sequence complementary of the specific polynucleotide
sequence to be identified. "Probes" or "hybridization probes" are
nucleic acids capable of binding in a base-specific manner to a
complementary strand of nucleic acid.
[0057] An objective of the present invention is to determine which
embodiment of the polymorphisms a specific sample of DNA has. For
example, it is desirable to determine whether the nucleotide at a
particular position is A or G. An oligonucleotide probe can be used
for such purpose. Preferably, the oligonucleotide probe will have a
detectable label, and contains an A at the corresponding position.
Experimental conditions can be chosen such that if the sample DNA
contains an A, they hybridization signal can be detected because
the probe hybridizes to the corresponding complementary DNA strand
in the sample, while if the sample DNA contains a G, no
hybridization signal is detected.
[0058] Similarly, PCR primers and conditions can be devised,
whereby the oligonucleotide is used as one of the PCR primers, for
analyzing nucleic acids for the presence of a specific sequence.
These may be direct amplification of the genomic DNA, or RT-PCR
amplification of the mRNA transcript of the gene of interest. The
use of the polymerase chain reaction is described in Saiki et al.
(1985) Science 230:1350-1354. Amplification may be used to
determine whether a polymorphism is present, by using a primer that
is specific for the polymorphism. Alternatively, various methods
are known in the art that utilize oligonucleotide ligation as a
means of detecting polymorphisms, for examples see Riley et al
(1990) Nucleic Acids Res. 18:2887-2890; and Delahunty et al (1996)
Am. J. Hum. Genet. 58:1239-1246. The detection method may also be
based on direct DNA sequencing, or hybridization, or a combination
thereof. Where large amounts of DNA are available, genomic DNA is
used directly. Alternatively, the region of interest is cloned into
a suitable vector and grown in sufficient quantity for analysis.
The nucleic acid may be amplified by PCR, to provide sufficient
amounts for analysis.
[0059] Hybridization may be performed in solution, or such
hybridization may be performed when either the oligonucleotide
probe or the target polynucleotide is covalently or noncovalently
affixed to a solid support. Attachment may be mediated, for
example, by antibody-antigen interactions, poly-L-Lys, streptavidin
or avidin-biotin, salt bridges, hydrophobic interactions, chemical
linkages, UV cross-linking baking, etc. Oligonucleotides may be
synthesized directly on the solid support or attached to the solid
support subsequent to synthesis. Solid-supports suitable for use in
detection methods of the invention include substrates made of
silicon, glass, plastic, paper and the like, which may be formed,
for example, into wells (as in 96-well plates), slides, sheets,
membranes, fibers, chips, dishes, and beads. The solid support may
be treated, coated or derivatized to facilitate the immobilization
of the allele-specific oligonucleotide or target nucleic acid. For
screening purposes, hybridization probes of the polymorphic
sequences may be used where both forms are present, either in
separate reactions, spatially separated on a solid phase matrix, or
labeled such that they can be distinguished from each other.
[0060] Hybridization may also be performed with nucleic acid arrays
and subarrays such as described in WO 95/11995. The arrays would
contain a battery of allele-specific oligonucleotides representing
each of the polymorphic sites. One or both polymorphic forms may be
present in the array. Usually such an array will include at least 2
different polymorphic sequences, i.e. polymorphisms located at
unique positions within the locus, and may include all of the
provided polymorphisms. Arrays of interest may further comprise
sequences, including polymorphisms, of other genetic sequences,
particularly other sequences of interest. The oligonucleotide
sequence on the array will usually be at least about 12 nt in
length, may be the length of the provided polymorphic sequences, or
may extend into the flanking regions to generate fragments of 100
to 200 nt in length. For examples of arrays, see Ramsay (1998) Nat.
Biotech. 16:4044; Hacia et al. (1996) Nature Genetics 14:441-447;
Lockhart et al. (1996) Nature Biotechnol. 14:1675-1680; and De Risi
et al. (1996) Nature Genetics 14:457-460.
[0061] The identity of polymorphisms may also be determined using a
mismatch detection technique, including but not limited to the
RNase protection method using riboprobes (Winter et al., Proc.
Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al., Science
230:1242, 1985) and proteins which recognize nucleotide mismatches,
such as the E. coli mutS protein (Modrich, P. Ann. Rev. Genet.
25:229-253, 1991). Alternatively, variant alleles can be identified
by single strand conformation polymorphism (SSCP) analysis (Orita
et al., Genomics 5:874-879, 1989; Humphries et al., in Molecular
Diagnosis of Genetic Diseases, R. Elles, ed., pp. 321-340, 1996) or
denaturing gradient gel electrophoresis (DGGE) (Wartell et al.,
Nucl. Acids Res. 18:2699-2706, 1990; Sheffield et al., Proc. Natl.
Acad. Sci. USA 86:232-236, 1989).
[0062] A polymerase-mediated primer extension method may also be
used to identify the polymorphism(s). Several such methods have
been described in the patent and scientific literature and include
the "Genetic Bit Analysis" method (WO92/15712) and the
ligase/polymerase mediated genetic bit analysis (U.S. Pat. No.
5,679,524). Related methods are disclosed in WO91/02087,
WO90/09455, WO95/17676, U.S. Pat. Nos. 5,302,509, and 5,945,283.
Extended primers containing a polymorphism may be detected by mass
spectrometry as described in U.S. Pat. No. 5,605,798. Another
primer extension method is allele-specific PCR (Ruao et al., Nucl.
Acids Res. 17:8392, 1989; Ruao et al., Nucl. Acids Res. 19,
6877-6882, 1991; WO 93/22456; Turki et al., J. Clin. Invest.
95:1635-1641, 1995). In addition, multiple polymorphic sites may be
investigated by simultaneously amplifying multiple regions of the
nucleic acid using sets of allele-specific primers as described in
Wallace et al. (WO 89/10414).
[0063] A detectable label may be included in an amplification
reaction. Suitable labels include fluorochromes, e.g. fluorescein
isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin,
allophycocyanin, 6-carboxyfluorescein (6-FAM),
2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE),
6-carboxy-X-rhodamine (ROX),
6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX),
5-carboxyfluorescein (5-FAM) or
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive
labels, e.g. .sup.32P, .sup.35S, .sup.3H; etc. The label may be a
two stage system, where the amplified DNA is conjugated to biotin,
haptens, etc. having a high affinity binding partner, e.g. avidin,
specific antibodies, etc., where the binding partner is conjugated
to a detectable label. The label may be conjugated to one or both
of the primers. Alternatively, the pool of nucleotides used in the
amplification is labeled, so as to incorporate the label into the
amplification product.
[0064] It is readily recognized by those ordinarily skilled in the
art that in order to maximize the signal to noise ratio, in probe
hybridization detection procedure, the polymorphic site should at
the center of the probe fragment used, whereby a mismatch has a
maximum effect on destabilizing the hybrid molecule; and in a PCR
detection procedure, the polymorphic site should be placed at the
very 3'-end of the primer, whereby a mismatch has the maximum
effect on preventing a chain elongation reaction by the DNA
polymerase. The location of nucleotides in a polynucleotide with
respect to the center of the polynucleotide are described herein in
the following manner. When a polynucleotide has an odd number of
nucleotides, the nucleotide at an equal distance from the 3' and 5'
ends of the polynucleotide is considered to be "at the center" of
the polynucleotide, and any nucleotide immediately adjacent to the
nucleotide at the center, or the nucleotide at the center itself is
considered to be "within 1 nucleotide of the center." With an odd
number of nucleotides in a polynucleotide any of the five
nucleotides positions in the middle of the polynucleotide would be
considered to be within 2 nucleotides of the center, and so on.
When a polynucleotide has an even number of nucleotides, there
would be a bond and not a nucleotide at the center of the
polynucleotide. Thus, either of the two central nucleotides would
be considered to be "within 1 nucleotide of the center" and any of
the four nucleotides in the middle of the polynucleotide would be
considered to be "within 2 nucleotides of the center," and so
on.
[0065] In some embodiments, a composition contains two or more
differently labeled oligonucleotides for simultaneously probing the
identity of nucleotides or nucleotide pairs at two or more
polymorphic sites. It is also contemplated that primer compositions
may contain two or more sets of allele-specific primer pairs to
allow simultaneous targeting and amplification of two or more
regions containing a polymorphic site.
[0066] Alternatively, the relevant portion of the gene of the
sample of interest may be amplified via PCR and directly sequenced,
and the sequence be compared to the wild type sequence shown in the
figures. It is readily recognized that, other than those disclosed
specifically herein, numerous primers can be devised to achieve the
objectives. PCR and sequencing techniques are well known in the art
and reagents and equipments are readily available commercially.
[0067] Alternatively, an invasive signal amplification assay, as
described in e.g. U.S. Pat. No. 5,422,253 and Lyamichev et al.,
2000, Biochemistry 39:9523-9532, both incorporated herein by
reference in their entirety, may be used for detecting the SNP of
interest. This assay takes advantage of enzymes such as the 5'
nuclease activity of a DNA polymerase or the gene 6 product from
bacteriophage T7 in their ability to cleave polynucleotide
molecules by recognizing specific structures instead of specific
sequences. A single-stranded target molecule is annealed to a pilot
oligonucleotide such that the 5' end of the pilot forms a duplex
with the target molecule. If the 3' end of the pilot
oligonucleotide does not pair with the target, a 3' arm is formed.
When exposed to a cleavage agent such as a DNA polymerase having a
5' nuclease activity or the gene 6 product from bacteriophage T7,
the target molecule is cleaved in the 5' region, one nucleotide
into the duplex adjacent to the unpaired region of the target. If a
cut in a double-stranded molecule is required, the double-stranded
molecule is denatured. Because this unpaired 3' arm can be as short
as one nucleotide, this assay can be used for detecting a
single-nucleotide difference, e.g. in the context of SNP detection.
The pilot oligonucleotide is designed such that it pairs perfectly
with one allele, but has a 3', single nucleotide mismatch with
another allele. Cleavage only occurs if there is a mismatch between
the target molecule and the pilot. To achieve signal amplification,
the above invasive reaction is modified such that cleavage occurs
on the pilot oligonucleotide. Two oligonucleotides are annealed in
an adjacent manner to the target molecule. The resulting adjacent
duplexes overlaps by at least one nucleotide to create an efficient
substrate, called the overlapping substrate, for the 5' nucleases.
The 5' end of the downstream oligonucleotide, also called the
probe, contains an unpaired region termed the 5' arm (Lyamichev et
al., 1993, Science 260:778-783.) or flap (Harrington and Lieber,
1994, EMBO J 13: 1235-1246) that is not required for the enzyme
activity; however, very long arms can inhibit cleavage (Lyamichev
et al., 1993, Science 260:778-783). Specific cleavage of the probe,
termed invasive cleavage (Lyamichev et al., 1999, Nat. Biotechnol.
17 292-296; Kwiatkowski et al., 1999, Mol. Diagn. 4, 353-364.),
occurs at the position defined by the 3' end of the upstream
oligonucleotide, which displaces or "invades" the probe. If the
overlap between the adjacent oligonucleotides is only one
nucleotide, cleavage takes place between the first two base pairs
of the probe, thus releasing its 5' arm and one nucleotide of the
base paired region (Lyamichev et al., 1999, Proc. Natl. Acad. Sci.
USA. 96: 6143-6148, and Kaiser et al., 1999, J Biol. Chem.
274:21387-21394). If the upstream oligonucleotide and the probe are
present in large molar excess over the target nucleic acid, and
invasive cleavage is carried out near the melting temperature of
the probe, a cut probe can rapidly dissociate, and an intact probe
will anneal to the target more frequently than will a cut probe,
thus initiating a new cycle of cleavage. This allows multiple
probes to be cut for each target molecule under isothermal
conditions, resulting in linear signal amplification with respect
to target concentration and time (Lyamichev et al., 1999, Nat.
Biotechnol. 17: 292-296).
[0068] DNA markers have several advantages; segregation is easy to
measure and is unambiguous, and DNA markers are co-dominant, i.e.,
heterozygous and homozygous animals can be distinctively
identified. Once a marker system is established selection decisions
could be made very easily, since DNA markers can be assayed any
time after a blood sample can be collected from the individual
infant animal, or even earlier by testing embryos in vitro if very
early embryos are collected. The use of marker assisted genetic
selection will greatly facilitate and speed up cattle breeding
problems. For example, a modification of the multiple ovulation and
embryo transfer (MOET) procedure can be used with genetic marker
technology. Specifically, females are superovulated, eggs are
collected, in vitro fertilized using semen from superior males and
implanted into other females allowing for use of the superior
genetics of the female (as well as the male) without having to wait
for her to give birth to one calf at a time. Developing blastomeres
at the 4-8 cell stage may be assayed for presence of the marker,
and selection decisions made accordingly.
[0069] In one embodiment of the invention an assay is provided for
detection of presence of a desirable genotype using the
markers.
[0070] The term "genotype" as used herein refers to the identity of
the alleles present in an individual or a sample. In the context of
the present invention a genotype preferably refers to the
description of the polymorphic alleles present in an individual or
a sample. The term "genotyping" a sample or an individual for a
polymorphic marker refers to determining the specific allele or the
specific nucleotide carried by an individual at a polymorphic
marker.
[0071] The present invention is suitable for identifying a bovine,
including a young or adult bovine animal, an embryo, a semen
sample, an egg, a fertilized egg, or a zygote, or other cell or
tissue sample therefrom, to determine whether said bovine possesses
the desired genotypes of the present invention, some of which are
indicative of improved reproduction traits.
[0072] Further provided is a method for genotyping the bovine ID3
or BMP4 genes, comprising determining for the two copies of the
gene in a diploid genome present the identity of the nucleotide
pair at the relevant SNP position (see below).
[0073] One embodiment of a genotyping method of the invention
involves examining both copies of the gene, or a fragment thereof,
to identify the nucleotide pair at the polymorphic site in the two
copies to assign a genotype to the individual. In some embodiments,
"examining a gene" may include examining one or more of: DNA
containing the gene, mRNA transcripts thereof, or cDNA copies
thereof. As will be readily understood by the skilled artisan, the
two "copies" of a gene, mRNA or cDNA, or fragment thereof in an
individual may be the same allele or may be different alleles. In
another embodiment, a genotyping method of the invention comprises
determining the identity of the nucleotide pair at the polymorphic
site.
[0074] The present invention further provides a kit for genotyping
a bovine sample, the kit comprising in a container a nucleic acid
molecule, as described above, designed for detecting the
polymorphism, and optionally at least another component for
carrying out such detection. Preferably, a kit comprises at least
two oligonucleotides packaged in the same or separate containers.
The kit may also contain other components such as hybridization
buffer (where the oligonucleotides are to be used as a probe)
packaged in a separate container. Alternatively, where the
oligonucleotides are to be used to amplify a target region, the kit
may contain, preferably packaged in separate containers, a
polymerase and a reaction buffer optimized for primer extension
mediated by the polymerase, such as PCR.
[0075] In one embodiment the present invention provides a breeding
method whereby genotyping as described above is conducted on bovine
embryos, and based on the results, certain cattle are either
selected or dropped out of the breeding program.
[0076] Through use of the linked marker loci, procedures termed
"marker assisted selection" (MAS) may be used for genetic
improvement within a breeding nucleus; or "marker assisted
introgression" for transferring useful alleles from a resource
population to a breeding nucleus (Soller 1990; Soller 1994).
[0077] In one embodiment, the present invention provides a method
for selectively breeding of cattle, the method comprising selecting
a suitable bovine animal having the desired genotype according to
the method described above. In another embodiment, the present
invention provides a cattle breeding method wherein a developing
embryo is tested according to the genotyping method described
above, and the embryo is allowed to develop further only if it has
the desired genotype. In a further embodiment, a multiple ovulation
and embryo transfer procedure (MOET) is used as part of the
breeding procedure of the present invention, wherein the method
comprises super-ovulating a female animal, collecting eggs from
said superovulated female, in vitro fertilizing said eggs from a
suitable male animal, implanting said fertilized eggs into other
females allowing for an embryo to develop, and genotyping said
developing embryo as described above, and terminating pregnancy if
said developing embryo does not all have a desired genotype.
[0078] The method according to the present invention for
determining whether an individual bovine animal is suitable as a
gamete donor for natural mating, artificial insemination or in
vitro fertilization, comprises detecting the SNP according to the
above method of the present invention, and excluding as gamete
donor an individual whose genotype is TT at a position in the ID3
gene corresponding to position 1213 of SEQ ID NO: 1; or detecting
the SNP according to the above method of the present invention, and
selecting as a gamete donor an individual whose genotype is TT at a
position in the BMP4 gene corresponding to position 2702 of SEQ ID
NO: 2.
[0079] In one embodiment, the individual is excluded as a gamete
donor if the individual, when mated with another parent, produces
an offspring (e.g. a zygote or fertilized egg) whose genotype is TT
at a position in the ID3 gene corresponding to position 1213 of SEQ
ID NO: 1. In one embodiment, the individual is selected as a gamete
donor if the individual, when mated with another parent, produces
an offspring (e.g. a zygote or fertilized egg) whose genotype is TT
at a position in the BMP4 gene corresponding to position 2702 of
SEQ ID NO: 2.
[0080] The present invention additionally provides a method of
selecting a bovine embryo for planting in a uterus, the method
comprising genotyping the embryo according to the present
invention, while preserving the viability of the embryo, and
excluding from planting an embryo whose genotype is TT at a
position in the ID3 gene corresponding to position 1213 of SEQ ID
NO: 1, or selecting for planting an embryo whose genotype is TT at
a position in the BMP4 gene corresponding to position 2702 of SEQ
ID NO: 2. In one embodiment, the embryo is selected only if the
genotype of the developing embryo is TT at a position in the BMP4
gene corresponding to position 2702 of SEQ ID NO: 2 but not TT at a
position in the ID3 gene corresponding to position 1213 of SEQ ID
NO: 1.
[0081] In another embodiment, the present invention further
provides a method for selectively breeding cattle using a multiple
ovulation and embryo transfer procedure (MOET), the method
comprising superovulating a female animal, collecting eggs from
said superovulated female, in vitro fertilizing said eggs from a
suitable male animal, implanting said fertilized eggs into other
females allowing for an embryo to develop, and genotyping said
developing embryo, and terminating pregnancy if the genotype of the
developing embryo is TT at a position in the ID3 gene corresponding
to position 1213 of SEQ ID NO: 1, or allowing pregnancy to proceed
if the genotype of the embryo is TT at a position in the BMP4 gene
corresponding to position 2702 of SEQ ID NO: 2. In one embodiment,
the embryo is selected only if the genotype of the developing
embryo is TT at a position in the BMP4 gene corresponding to
position 2702 of SEQ ID NO: 2 but not TT at a position in the ID3
gene corresponding to position 1213 of SEQ ID NO: 1.
[0082] The following examples are intended to illustrate preferred
embodiments of the invention and should not be interpreted to limit
the scope of the invention as defined in the claims.
EXAMPLES
Materials and Methods
[0083] In this study, two different experiments were performed to
assess the involvement of the TGF-.beta. pathway genes in embryo
development and fertility traits. In the first experiment, we
compared the expression profiles of the TGF-.beta. pathway genes in
two populations of embryos differing in their morphology and
development. The most significant differentially expressed genes
between the embryo groups were tested in the second experiment for
genomic association with fertility traits in a cow population.
[0084] I. Expression Profiles of TGF-.beta. Pathway Genes in Cattle
Embryos
[0085] Embryo Production and Morphological Classification
[0086] Oocytes were aspirated from ovaries obtained from a local
slaughterhouse and underwent maturation until they were combined
with frozen-thawed semen. The procedures of in vitro fertilization
and subsequent embryo culture were as described in Khatib et al.
(2008a,b). Embryos that showed signs of cellular compaction by Day
5 of culture (morula stage) were further cultured until Day 8.
Embryos failing to show signs of compaction were excluded from
further analysis. Embryos that exhibited a clear inner cell mass
and a fluid filled cavity (blastocoele) on Day 8 were classified as
blastocysts and those with abnormal blastocyst formation and
morula-phenotype were classified as degenerates. Embryos randomly
collected from each morphological group (n=20) were pooled and
preserved in RNAlater (Ambion, Austin, Tex.). Three sets
(blastocysts and degenerates) of embryo pools were used in the RNA
expression analysis, in which two sets of biological replicate
pools were produced from one sire and one set of embryos was
produced from a second sire.
[0087] Real-Time RT-PCR Quantification
[0088] Total RNA was extracted from pools of embryos using
RNaqueous Micro (Ambion) and quality controlled by a RNA6000
PicoChip (Agilent Technologies, CA). The mRNA amplified by
MessageAmp II (Ambion) was converted to cDNA using the iScript cDNA
synthesis kit (Bio-Rad Laboratories, CA). Dilution of cDNA was used
as template in qRT-PCR with the iQ SYBR Green Supermix kit (Bio-Rad
Laboratories). The housekeeping gene glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) was selected as an endogenous control.
Primers for 25 genes from the TGF-.beta. pathway (Table 1) were
designed to amplify fragments that span at least one intron to
avoid genomic DNA contamination using the Beacon Designer software
(Premier Biosoft International, Palo Alto, Calif.). Each sample was
tested in quadruplicate. The relative quantification of gene
expression was performed using 2-.DELTA..DELTA.ct method (Livak
& Schmittgen, 2001).
TABLE-US-00001 TABLE 1 Primers used for real-time RT-PCR,
sequencing, and RFLP genotyping SEQ SEQ ID ID Amplicon Gene Forward
primer 5'-3' NO: Reverse primer 5'-3' NO: size(bp) Real time RT-PCR
1D3 GCATCTTCCCATCCAGACA 3 CAGTGGCAGAAGCTCCTT 4 75 THBS2
CTACTTCTCGGACCTCAA 5 TGGGTAACAGCATCTACA 0 88 THBS4
GTGGGCTACATCAGGGTG 7 ATGGTGGTGTCTATGGTGA 8 77 PPP2R1A
CCTTCCTCTTGGTGGTTT 9 GGCCTTTATTTCTCTGTGAA 10 85 PITX2
CCGCAGAGAAAGATAAGA 11 TTGCCTTTTCTTCTTGGA 12 77 BMP4
TTTCCAGCAAGTTTGTTCA 13 CCATCAGCATTCGGTTAC 14 106 BMP3
TGTCCTCACTCAGCATCT 15 GCAAGCACAAGACTCTACT 16 89 BMP2
CACGAAGAATCTTTGGAAG 17 GTTCTGCTGAGGTGATAA 18 109 BMPER
GGACTACACTACTTTCTAC 19 GTATATGCCAGGAATGAT 20 93 BMPR1A
GTCTTACTCTGAACAAACAACT 21 GCTCTGATTCCTCCACTT 27 125 BMPR1B
CAGAACGGAATGAATGTAAT 23 AATGATGAGGACCAAGAG 24 140 SMAD2
CCAACTCTTCTGTCATAG 25 GAACATAGGAAACCACTT 26 126 GDF9
CCAAGACCATCCTGTGTA 27 CTTAGTGGCTATCATATCTTCATA 28 108 BMP15
CCAAGAGGTAGTGAGGTT 29 AATACAGTAACAAGAAGACAGT 30 76 INHBA
GCAGAAATGAATGAACTTAT 31 CCTTCTTTGGAAATCTCA 32 101 DCN
CGATCATAAGTACATCCA 33 TCACTCCTGAATAAGAAG 34 116 RPS6KB2
CATGGACAAGATCATCAGAG 35 CTGGTTAGGATTCCGCTT 36 100 SMAD1
CCACTATAAGCGAGTAGAA 37 TGTGCTGAGGATTGTATT 38 77 SMAD6
GTACAAGCCACTGGATCTATC 39 GCTGTGATGAGGGAGTTG 40 75 ACVR1
GGATGAGAAGTCGTGGTT 41 TACTGGAGTGTCTTGATGTC 42 110 ACVR1C
AGTTCCGACCAAGTATTC 43 ACACTCACGCATTATTCT 44 77 ACVR1B
AGAGATATACCAGACAGT 45 GTGCCGTTATCTTTATTG 46 78 TGF.beta.R1
TTACCATTGCTTGTTCAG 47 CTTCTTCTCCTCTCCATT 48 109 TGF.beta.R2
TGTGTGGAAAGCATGAAGG 49 GATGCCCTGGTGGTTGAG 50 84 Lefty2
AGCCAGAACTTCCGAGAG 51 CATGTCGAACACCAGCAA 52 75 GAPDH
TGCCCAGAATATCATCCC 53 AGGTCAGATCCACAACAG 54 134 SNP identification
BMP4 (1) GACCGCTGGAGGTTTGGG 55 GACTGAGGACTTTCCGTTTG 56 637 BMP4 (2)
TACAGGGCAATTCCTACTTT 57 GTCCAGATTCCAGGTAAGG 58 628 BMP4 (3)
TGGTGCTTGCTGAATGCT 59 GTGGGTCCGTGTCTGATG 60 600 BMP4 (4)
GGAGAAGCAGCCCAACTA 61 TCAGAACCACCTTGTCATAC 62 506 BMP4 (5)
GAGTATGACAAGGTGGTTCT 63 GAGTCTTTAATCCAGCCTA 64 642 ID3(1)
GCGGTATTCGGCGTCAGA 65 CGCACGGAGTTTGGAAGGT 66 623 ID3(2)
CTCCGTGCGTAAACCCTT 67 TTCCGTCATTCATTTGCTGT 68 297 ID3(3)
TCCGCCTGTGGTCTTTCG 69 CCTAAATCCAGCTTTGTGAGA 70 733 THBS2(1)
AACGAGTCCAGCTCTTCCG 71 TCCCTGCCTGCTTCAAAA 72 322 THBS2(2)
TCCGCTCCCGCACTTCAA 73 CCTCCCAGGAGTTTCCCACC 74 416 THBS2(3)
CAGTCTCCAAATTCTGTCCCTA 75 TGAGTTGACCCTTCTTTAT 76 533 THBS2(4)
CTGTTGCCAGTGACTTTA 77 CACATCATCATCCCGTAC 78 527 SNP genotyping BMP4
TAGAACATCTGGAGAACATC 79 GGCTTCATAACCTCATAAATG 80 190 THBS2
TCTTCACCTGCTGTCCTC 81 CTTACATTTCATATGTAAACCT 82 206 ID3
TGGATGGGCCTCAACCTT 83 GGCAGAATTTGGAGAACAGC 84 243
[0089] II. Association Study of TGF-.beta. Pathway Genes with
Fertilization and Blastocyst Rates
[0090] To further evaluate the effects of the differentially
expressed genes on fertility traits, maternal genotypes were tested
for association with fertilization and blastocyst rates. The genes
BMP4, THBS2, and ID3 were selected because they showed the most
significant fold differences in expression between blastocysts and
degenerates.
[0091] Phenotypic Data
[0092] Oocytes were collected from a total of 496 ovaries obtained
from 496 Holstein cows and fertilized by semen samples from 12
Holstein bulls. For each cow, fertilization rate was defined as the
number of cleaved embryos at Day 2 post-fertilization divided by
the total number of fertilized oocytes collected from one ovary.
Blastocyst rate was defined as the number of embryos that reached
the blastocyst stage (Day 8) out of the total number of cultured
embryos. A total of 7,865 fertilizations were performed and a total
of 5,270 embryos were produced to generate fertilization and
blastocyst rate data.
[0093] Polymorphism Identification and Genotyping
[0094] The DNA was isolated from ovaries (n=496) using standard
phenol/chloroform protocols. DNA concentrations were measured using
an Ultraspec 2100 spectrophotometer (Amersham Biosciences,
Piscataway, N.J.). For single nucleotide polymorphism (SNP)
identification, one DNA pool was constructed from 20 random ovary
samples containing equal amounts of DNA from each (25 ng/.mu.l).
The DNA pool was amplified by 12 sets of primers designed from the
exons of the three candidate genes (Table S1). Amplification,
sequencing of PCR products, and SNP identification were as
described in Khatib et al. (2008a, b). For genotyping, three sets
of primers (Table S1) were designed in ID3, BMP4 and THBS2. The PCR
products of SNP rs109818980 (ID3), rs109778173 (BMP4), and
rs110619673 (THBS2) were digested with the restriction enzymes
FauI, HinfI and TaiI, respectively and electrophoresed on a 2.0%
agarose gel.
[0095] Statistical Analysis
[0096] For expression analysis, normalized gene expression values
(.DELTA.Ct) were analyzed using a general linear model as
follows:
y.sub.ijk=.mu.+b.sub.i+p.sub.j+embryo.sub.ijk+e.sub.ijk (I)
where y.sub.ijk is the normalized gene expression value (.DELTA.Ct)
of sample k from pool j fertilized by bull i; .mu. represents an
overall mean for the trait considered; p.sub.j is the random effect
of pool j; b.sub.iis the fixed effect of bull i; embryo.sub.ijk is
the fixed effect of the embryo type; and e.sub.ijk represents the
residual. Association between the normalized gene expression and
the type of embryo was tested using a likelihood ratio test by
comparing model (1) to a reduced model without the embryo effect.
The mean and the range of the fold change for each gene were
calculated as 2-.DELTA..DELTA.Ct using the estimated
.DELTA..DELTA.Ct value.+-.standard error. The analysis was
performed by the LME4 package in R software.
[0097] The association of SNP genotypes with fertilization or
blastocyst rate was tested using the following mixed linear
model,
y.sub.ijk=.mu.+o.sub.i+b.sub.i+SNP.sub.ijk+e.sub.ijk (2)
where y.sub.ijk represents the fertilization rate or embryo
survival rate of oocyte k from ovary i fertilized by bull j; .mu.
represents an overall mean for the trait considered; o.sub.i is the
random effect of the i.sup.th ovary from which oocytes were
harvested; b.sub.i represents the random effect of the sire used in
the fertilization; SNP.sub.ijk represents the fixed effect of the
genotype for the SNP considered; and e.sub.ijk represents the
residuals. Ovary and bull variables were assumed uncorrelated.
Association between fertilization rate or embryo survival rate and
SNP genotype was analyzed by the MIXED procedure of SAS (9.0).
[0098] Results
[0099] Two separate and complementary experiments were done in this
study to investigate the roles of TGF-.beta. genes in fertility
traits in cattle. In the first experiment, we assessed and compared
expression profiles of these genes in degenerate embryos that do
not make a complete transition to blastocysts versus embryos that
reach the blastocyst stage in a timely manner. In the second
experiment, we tested the effects of the dams' genotypes on the
fertilization and blastocyst rates of their embryos.
[0100] Differential Expression of the TGF-.beta. Pathway Genes
[0101] A total of 25 genes from the TGF-.beta. pathway were
evaluated for their expression patterns in blastocysts and
degenerate embryos; 14 genes were expressed and 11 genes were not
detectable in embryos examined. FIG. 1 shows differential
expression of the 14 expressed genes in embryos. Expression of all
examined genes, except for ACVR1, was higher in degenerate embryos
than blastocysts. The mRNA expression level of the following genes
were significantly increased in degenerate embryos: DNA-binding
protein inhibitor 3 (ID3; 25.8-fold difference: P<0.001),
thrombospondin-2 (THBS2; 4.56-fold difference: P<0.001), bone
morphogenetic protein 4 (BMP4; 4.96-fold difference; P=0.001),
growth differentiation factor-9 (GDF9; 14.42-fold difference;
P=0.001), BMP binding endothelial regulator (BMPER; 6.12-fold
difference; P=0.004), and decorin (DCN; 8.57-fold difference;
P=0.028). Moreover, lesser fold differences in expression, but
still statistically significant, were observed for SMAD family
member 2 (SMAD2; 2.26-fold difference; P=0.002), thrombospondin-4
(THBS4; 1.54-fold difference; P=0.006), protein phosphatase 2,
regulatory subunit A, alpha (PPP2R1A; 2.56-fold difference;
P=0.025) and ribosomal protein S6 kinase, 70 kDa, polypeptide 2
(RPS6KB2; 2.46-fold difference; P=0.007). However, the effect of
embryo group was not statistically significant for the expression
levels of BMP receptor, type 1A (BMPR1A), paired-like homeodomain 2
(PITX2), inhibin, beta A (INHBA) and activin A receptor, type1
(ACVR1) with fold change ranging from 1.16 to 2.64. Expression of
BMP2, BMP3, BMP15, BMPR1B, SMAD1, SMAD6, TGF-.beta.R2,
TGF-.beta.R1, ACVR1B, ACVR1C, and lefty2 was not detected in cattle
embryos.
[0102] Association of Differentially Expressed Genes with
Fertilization Rate and Blastocyst Rate
[0103] Genes with the most significant differential expression
between embryo types (ID3, GDF9, BMP4, and THBS2) were further
investigated for association analysis of cow's genotype with
fertilization and blastocyst rates. Using the pooled DNA sequencing
method in the ovary/cow population, SNPs were identified in ID3,
BMP4, and THBS2. No SNPs were detected in GDF9. The SNPs,
rs109818980, rs109778173 and rs110619673, are located in the
3'untranslated region (3'UTR) of ID3, the coding region (CDS) of
BMP4, and the 3' UTR of THBS2, respectively. SNPs were in
Hardy-Weinberg equilibrium (Table 1). Estimates of the three
genotypic classes in each SNP for blastocyst and fertilization rate
and relevant P values are given in Table 1. Analysis of SNP
rs109818980 in ID3 revealed a significant association with
fertilization rate (P=0.029). Oocytes from genotypes TT ovaries had
5.2% and 5.3% lower fertilization rates than those from TC and CC
ovaries, respectively (Table 1). Blastocyst rate was significantly
associated with SNP rs109778173 of BMP4 (P=0.006), whereas the
association with fertilization rate was not statistically
significant (P=0.095). Embryos produced from genotype TT cows
showed 10.5% and 16.1% higher blastocyst rates than GG and GT cows,
respectively (Table 2). For SNP rs110619673 of THBS2, no
significant associations were found with the examined traits (Table
2).
TABLE-US-00002 TABLE 2 P-values of HWE equilibrium test, estimate
of blastocyst rate (.+-.SE), and estimate of fertilization rate
(.+-.SE) for the ovary SNP genotypes in ID3, BMP4, and THBS2 HWE
Blastocyst rate Fertilization rate Gene/SNP Genotype.sup.1 P-value
Estimate .+-. SE p-value Estimate .+-. SE P-value ID3/rs109818980
TT(237) 0.089 0.338 .+-. 0.022 0.247 0.631 .+-. 0.028 0.029 TC(154)
0.304 .+-. 0.024 0.683 .+-. 0.029 CC(38) 0.371 .+-. 0.044 0.684
.+-. 0.041 BMP4/rs109778173 GG(243) 0.607 0.349 .+-. 0.019 0.006
0.675 .+-. 0.027 0.095 GT(162) 0.293 .+-. 0.022 0.635 .+-. 0.028
TT(23) 0.454 .+-. 0.053 0.625 .+-. 0.046 THBS2/rs110619673 CC(251)
0.424 0.332 .+-. 0.022 0.371 0.652 .+-. 0.028 0.957 TC(147) 0.304
.+-. 0.026 0.657 .+-. 0.030 TT(26) 0.369 .+-. 0.054 0.660 .+-.
0.046 .sup.1in parenthesis is the number of cows genotyped
REFERENCES
[0104] Assou S, Boumela I, Haouzi D, Anahory T, Dechaud H, De Vos J
& Hamamah S 2010. Dynamic changes in gene expression during
human early embryo development: from fundamental aspects to
clinical applications. Human Reproduction Update 17 272-290. [0105]
Driver A M, Huang W, Gajic S, Monson R L, Rosa G J & Khatib H
2009. Short communication: Effects of the progesterone receptor
variants on fertility traits in cattle. Journal of Dairy Science 92
4082-4085. [0106] Fatehi A N, van den Hurk R, Colenbrander B,
Daemen A J, van Tol H T, Monteiro R M, Roelen B A & Bevers M M
2005. Expression of bone morphogenetic protein2 (BMP2), BMP4 and
BMP receptors in the bovine ovary but absence of effects of BMP2
and BMP4 during IVM on bovine oocyte nuclear maturation and
subsequent embryo development. Theriogenology 63 872-889. [0107]
Fenton T R & Gout I T 2010. Functions and regulation of the 70
kDa ribosomal S6 kinases. International Journal of Biochemistry and
Cell Biology 43 47-59. [0108] Heinke J, Wehofsits L, Zhou Q,
Zoeller C, Baar K M, Helbing T, Laib A, Augustin H, Bode C,
Patterson C & Moser M 2008. BMPER is an endothelial cell
regulator and controls bone morphogenetic protein-4-dependent
angiogenesis. Circulation Research 103 804-812. [0109] Heldin C H,
Miyazono K & ten Djke P 1997. TGF-beta signalling from cell
membrane to nucleus through SMAD proteins. Nature 390 465-471.
[0110] Hogg K, Etherington S L, Young J M, McNeilly A S &
Duncan W C 2010. Inhibitor of differentiation (Id) genes are
expressed in the steroidogenic cells of the ovine ovary and are
differentially regulated by members of the transforming growth
factor-beta family. Endocrinology 151 1247-1256. [0111] Huang W
& Khatib H 2010. Comparison of transcriptomic landscapes of
bovine embryos using RNA-Seq. BMC Genomics 11 711. [0112] Huang W,
Kirkpatrick B W, Rosa G J & Khatib H 2010a. A genome-wide
association study using selective DNA pooling identifies candidate
markers for fertility in Holstein cattle. Animal Genetics 41
570-578. [0113] Huang W, Yandell B S & Khatib H 2010b.
Transcriptomic profiling of bovine IVF embryos revealed candidate
genes and pathways involved in early embryonic development. BMC
Genomics 11 23. [0114] James D, Levine A J, Besser D &
Hemmati-Brivanlou A 2005. TGFbeta/activin/nodal signaling is
necessary for the maintenance of pluripotency in human embryonic
stem cells. Development 132 1273-1282. [0115] Jones R L, Stolkos C,
Findlay J K & Salamonsen L A 2006. TGF-beta superfamily
expression and actions in the endometrium and placenta.
Reproduction 132 217-232. [0116] Kayamori T, Kosaka N, Miyamoto A
and Shimizu T 2009. The differential pathways of bone morphogenetic
protein (BMP)-4 and -7 in the suppression of the bovine granulosa
cell apoptosis. Molecular and Cellular Biochemistry 323 161-168.
[0117] Khatib H, Huang W, Mikheil D, Schutzkus V & Monson R L
2009a. Effects of signal transducer and activator of transcription
(STAT) genes STAT1 and STAT3 genotypic combinations on
fertilization and embryonic survival rates in Holstein cattle.
Journal of Dairy Science 92 6186-6191. [0118] Khatib H, Huang W,
Wang X, Tran A H, Bindrim A B, Schutzkus V, Monson R L &
Yandell B S 2009b. Single gene and gene interaction effects on
fertilization and embryonic survival rates in cattle. Journal of
Dairy Science 92 2238-2247. [0119] Khatib H, Maltecca C, Monson R
L, Schutzkus V, Wang X & Rutledge J J 2008a. The fibroblast
growth factor 2 gene is associated with embryonic mortality in
cattle. Journal of Animal Science 86 2063-2067. [0120] Khatib H,
Monson R L, Schutzkus V, Kohl D M, Rosa G J & Rutledge J J
2008b. Mutations in the STAT5A gene are associated with embryonic
survival and milk composition in cattle. Journal of Dairy Science
91 784-793. [0121] Koide Y, Kiyota T, Tonganunt M, Pinkaew D, Liu
Z, Kato Y, Hutadilok-Towatana N, Phongdara A & Fujise K 2009.
Embryonic lethality of fortilin-null mutant mice by BMP-pathway
overactivation. Biochimica et Biophysica Acta 1790 326-338. [0122]
Laporta J, Driver A & Khatib H 2011. Short communication:
expression and alternative splicing of POU1F1 pathway genes in
preimplantation bovine embryos. Journal of Dairy Science 94
4220-4223. [0123] Li C W & Ge W 2011. Spatiotemporal expression
of bone morphogenetic protein family ligands and receptors in the
zebrafish ovary: a potential paracrine-signaling mechanism for
oocyte-follicle cell communication. Biology of Reproduction 85
977-986. [0124] Livak K J & Schmittgen T D 2001. Analysis of
relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) Method. Methods 25 402-408. [0125] Lucy M
C 2007. Fertility in high-producing dairy cows: reasons for decline
and corrective strategies for sustainable improvement. Society of
Reproduction and Fertility Supplement. 64 237-254. [0126] Martell
G, Richard-Parpaillon L & Kubiak J Z 2009. Role of oocyte
quality in meiotic maturation and embryonic development.
Reproductive Biology 9 203-224. [0127] Massague J, Seoane J &
Wotton D 2005. Smad transcription factors. Genes & Development
19 2783-2810. [0128] Miyazono K & Myazawa K 2002. Id: a target
of BMP signaling. Science's STKE 151 pe40. [0129] Moser M, Binder
O, Wu Y, Altsebaomo J, Ren R, Bode C, Bautch V L, Conlon F L &
Patterson C 2003. BMPER, a novel endothelial cell precursor-derived
protein, antagonizes bone morphogenetic protein signaling and
endothelial cell differentiation. Molecular and Cellular Biology 23
5664-5679. [0130] Murphy-Ullrich J E & Poczatek M 2000.
Activation of latent TGF-beta by thrombospondin-1: mechanisms and
physiology. Cytokine & Growth Factor Reviews 11 59-69. [0131]
Nilsson E E & Skinner M K 2003. Bone morphogenetic protein-4
acts as an ovarian follicle survival factor and promotes primordial
follicle development. Biology of Reproduction 69 1265-1272. [0132]
Norton J D 2000. ID helix-loop-helix proteins in cell growth,
differentiation and tumorigenesis. Journal of Cell Science 113
3897-3905. [0133] Otsuka F, McTavish K J & Shimasaki S 2011.
Integral role of GDF-9 and BMP-15 in ovarian function. Molecular
Reproduction and Development 78 9-21. [0134] Pant D & Keefer C
L 2009. Expression of pluripotency-related genes during bovine
inner cell mass explant culture. Cloning Stein Cells 11 355-365.
[0135] Rizos D, Ward F, Duffy P, Boland M P & Lonergan P 2002.
Consequences of bovine oocyte maturation, fertilization or early
embryo development in vitro versus in vivo: implications for
blastocyst yield and blastocyst quality. Molecular Reproduction and
Development 61 234-248. [0136] Rodriguez-Zas S L, Schellander K
& Lewin H A 2008. Biological interpretations of transcriptomic
profiles in mammalian oocytes and embryos. Reproduction 135
129-139. [0137] Royal M, Mann G E & Flint A P 2000. Strategies
for reversing the trend towards subfertility in dairy cattle. The
Veterinary Journal 160 53-60. [0138] Santibanez J F, Quintanilla M
& Bernabeu C 2011. TGF-beta/TGF-beta receptor system and its
role in physiological and pathological conditions. Clinical Science
121 233-251. [0139] Sheldon I M, Wathes D C & Dobson H 2006.
The management of bovine reproduction in elite herds. The
Veterinary Journal 171 70-78. [0140] Shimasaki S, Moore R K, Otsuka
F & Erickson G F 2004. The bone morphogenetic protein system in
mammalian reproduction. Endocrine Reviews 25 72-101. [0141]
Shimasaki S, Zachow R J, Li D, Kim H, lemura S, Ueno N, Sampath K,
Chang R J & Erickson G F 1999. A functional bone morphogenetic
protein system in the ovary. Proceedings of the National Academy of
Sciences of the United States of America 96 7282-7287. [0142]
Shimizu T, Yokoo M, Miyake Y, Sasada H & Sato E 2004.
Differential expression of bone morphogenetic protein 4-6 (BMP-4,
-5, and -6) and growth differentiation factor-9 (GDF-9) during
ovarian development in neonatal pigs. Domestic Animal Endocrinology
27 397-405. [0143] Shook G E 2006. Major advances in determining
appropriate selection goals. Journal of Dairy Science 89 1349-1361.
[0144] Stitzel M L & Seydoux G 2007. Regulation of the
oocyte-to-zygote transition. Science 316 407-408. [0145] Tanwar P S
& McFarlane J R 2011. Dynamic expression of bone morphogenetic
protein 4 in reproductive organs of female mice. Reproduction 142
573-579. [0146] Trombly D J, Woodruff T K & Mayo K E 2009.
Roles for transforming growth factor beta superfamily proteins in
early folliculogenesis. Seminars in Reproductive Medicine 27 14-23.
[0147] VanRaden P M, Sanders A H, Tooker M E, Miller R H, Norman H
D, Kuhn M T & Wiggans G R 2004. Development of a national
genetic evaluation for cow fertility. Journal of Dairy Science 87
2285-2292. [0148] Wang Q T, Piotrowska K, Ciemerych M A, Milenkovic
L, Scott M P, Davis R W & Zernicka-Goetz M 2004. A genome-wide
study of gene activity reveals developmental signaling pathways in
the preimplantation mouse embryo. Developmental Cell 6 133-144.
[0149] Wang X, Schutzkus V, Huang W, Rosa G J & Khatib H 2009.
Analysis of segregation distortion and association of the bovine
FGF2 with fertilization rate and early embryonic survival. Animal
Genetics 40 722-728. [0150] Yokota Y & Mori S 2002. Role of Id
family proteins in growth control. Journal of Cellular Physiology
190 21-28. [0151] Zhang B, Penagaricano F, Driver A, Chen H &
Khatib H 2011. Differential expression of heat shock protein genes
and their splice variants in bovine preimplantation embryos.
Journal of Dairy Science 94 4174-4182. [0152] Zhang Y, Yang Z &
Wu J 2007. Signaling pathways and preimplantation development of
mammalian embryos. The FEBS Journal 274 4349-4359. [0153]
Zolnierowicz S 2000. Type 2A protein phosphatase, the complex
regulator of numerous signaling pathways. Biochemical Pharmacology
60 1225-1235.
Sequence CWU 1
1
8411700DNABos taurusmisc_feature(1213)..(1213)y is t or c
1tctgtctatc tccttccttc cagcacttcc caacctcatt gctcagtatg aaggcgctca
60gcccggttcg cggctgctac gaggcggtat gctgcctgtc ggaacgcagc ctggccatcg
120cgcggggccg tggcaagagc ccggccgccg aggagccgct gagcctgctt
gacgacatga 180accactgcta ctcgcgactg agggaactgg tacccggagt
cccgcgaggc actcagctta 240gccaggtgga aatcctgcag cgcgtcatcg
actacatcct cgacctgcag gtggtcctgg 300ccgagccggc ccctgggccc
ccagacggcc cgcatcttcc catccaggtg cgcgcgggcg 360tgctcgggag
ctggggcggg gctgagctcc agggctggga tgctacgggg acccctggac
420cttccaaact ccgtgcgtaa acccttcccc ccttttcctt ctctcagaca
gctgagctcg 480ctccggaact tgtgatctcc aacgaccaaa ggagcttctg
ccactgacct ggcccgtcct 540ggcgcctcca ggtgagtatc caagccttct
ctcgggggcg gggaaggggg acagctggtg 600cttaaacggc gatcttggag
ttggtaggcc ttttaaagga ttaccgcggc cccctcggtt 660tagggaaatt
caggccagag agacgcaagt gacttgcccg tggtcacagc aaatgaatga
720cggaaccaat tctgatccag agttcgtttc aaccttaagt gcacgttgtt
cccgtcctcc 780ccattggcca aaggtgcgaa actatagacg caggtccgac
tagataaaat aaccagtctg 840tctgtggctt ggagtcgtaa aaggagccgc
gtttttctca gcccccctcc caactagtgt 900cacttccaat aggcaggggt
ggtgcaagct ccgcctgtgg tctttcggcg ccaactgggt 960gggggcagtg
tggggcgcga gttatcagct ggaggtagag accaagtttc ctccctggcg
1020ccggccagtc tgcggacggc ccccgcttgg gcgcgctcgg cggaaactga
cggctccctg 1080gtcttctttc ctcccccgcc cagaacgcag gtgctggcgc
ccgtccggga ccccgggacc 1140ctctacggcc ggaagcccga gggcatggat
gggcctcaac cttgccctgc ccacttgact 1200tccccaaacc ccygcctcga
ggctggacct gcgcccggga gcgaaggact gtgaacttgg 1260gtggcctaaa
gagccggcgc tagctctggg caccagctgg gcaacctccc cctgccctca
1320ccccactccc aagttttaaa gactgtcttt cagtgtgtgg aggtgtacgg
ggttgggggt 1380gggggctggc tgttctccaa attctgcctt ggccaaggca
gcggtagagc tggtcttctg 1440gtctccttgg agaaagactc tgttgccctg
attatgaact ctataataga gtatttagct 1500tttgtacctt ttttgcagga
aggtgacttt ctgtaaccat gcgatgtata ttaaactttt 1560tataaaagtt
aacattttgc ataataaacg gtttttaaac acttgtgttt ataatttgat
1620tccttaagtg ctaacactgt ttctcacaaa gctggattta gggagaataa
attcatgtct 1680ttcttggagc ttaggaaaag 170023734DNABos
taurusmisc_feature(2702)..(2702)m is c or a 2702 2aggggctgga
agaaaaacag agtccgtctg cgccagtctc attatattca aatattcatt 60ttaggagcca
ttccgtagtg ccatccagag caacgcactg ccgcagctcc tctgagcctt
120tccagcaagt ttgttcaaga ttggctgtca agaatcatgg actgttatta
tatgccttgt 180tttctgtcag tgagtagaca cctcttcctt ccctcttccc
gggaattcac tctgccctcc 240ccacccgcgc tcgccttgtg tccctcccgt
cggaccttcc ttccagagtc cacactcttc 300tttctggcag cgctgtcgct
ttcttctagg ccgggcagcc actgcgctcg gagcctaccg 360gttctggttg
aagtgcagct tgctccactg gctctctgtc tgatcactgc gttacaagaa
420aggggagcga gaaggggctg aacaaacgga aagtcctcag tcgggggagt
tgaccgcccc 480cctccccaca tgactgggag cacccagtgc ccctgtggcg
cgctcctagc tgcttgtcaa 540aactcacaga ggtcgccctt ggaatcatcc
cctcccacac ccccttccct gggagtgagc 600gagagggcgc gatcagatgc
tttttgctgg gcatttcaaa actcctcagc cacagtaaaa 660taaaccctct
ggccactcgg tacgctccca gatcctgccg ccccgtgtct tcaccctgct
720cctgcttctc tgctttccct ccctccgaac cagctggaag ttgtggaagt
cgggctagga 780agggcggagg aagaaggggg gtggaggaga agggagagag
aggctgaagg tctgaagtgg 840agaggagagc gctggcattt gaactctccc
tcccccaccc ttctttacct tctcactgtt 900aactgtttat ccctaaagaa
gccaagctga gatcatggct cagatagcag ttgggacaaa 960aaaagattaa
caggatggag gctatctgat ttggggttat ttgactgtaa acaagttaga
1020ccaagtaatt acagggcaat tcctactttc aggccgtgca tggctgcagc
tggtggtggt 1080ggtggggggg ggtgtgtgtg tcagaggaag acacaaactt
gatctttctg acctgtgtta 1140cttctggacc ctctagctgt agctctccac
gcctatgcag agacatctct atttctctct 1200agttattggt gtttatttat
tctttaccct tccacctcct cccctcccca gagacaccat 1260gattcctggt
aaccgaatgc tgatggtcgt tttattatgc caagtcctgc taggaggcgc
1320gagccatgct agtttgatac ctgagacggg gaagaaaaaa gtcgccgaga
ttcagggcca 1380cgcgggagga cgccgctcag ggcagagcca tgagctcctt
cgggacttcg aggccacact 1440tctgcagatg ttcgggctgc gccgccgccc
gcagcctagc aagagcgcag tcatcccgga 1500ttacatgcgg gatctttaca
gacttcagtc tggggaggag gaagaggaag agcagatcca 1560gggcatcggt
ctggagtatc ctgagcgccc cgccagtcgg gccaacaccg tgaggagctt
1620ccaccacgaa ggtcagtccc ttacctggaa tctggactgg ggtggggcag
tggaagctgt 1680gggaaggcga ggagttcagg ttacatcaga gccccaaatc
caggagactg ggaaaagaga 1740gctgcttacc ttcaagagtc tccagagctg
tggctgaatt tattttttgg agacagaagg 1800gaagggaggg gtcggcgaga
agggaatgac accactcaga cgtgggttag cccctgcggt 1860gtgtttttgc
tatatcaaag ccttttatgc caggttttct gccttttttt tttttttcca
1920aagcacctac tgaatttaat attacagctg tgtgtttgtc aggtttattc
aataggggcc 1980ttgtaatccg atctgaatgt ttcctagcgg atgtttcttt
tccaaagtaa atctgagtta 2040ttaatccacc agcatcatta ctgtgttgga
atttattttc ctctctgtaa catgatcaac 2100aaggcatgct ctgtgtttcc
aagatcgctg gggaaatgtt tggtaacata ctcgaaagtg 2160gaagaagagg
gagagggtgg ctgtgtgcat gttccctcct gcctctgctc tgttggcccc
2220tcttcttctt tacaaccact tgtaaagaaa actgtgtaca caaagccaag
agggctttaa 2280aaggggagtc tgatggtggt ggagtaagga gttgacacat
ggaaattatt agacatgtaa 2340aggaggttgg gagattctgt ctttggtgct
tgctgaatgc tagctaggct tggctggtct 2400gctcactgcc tcatttatct
gctctgtgaa attaaaggta tgcttatttc tcccaaatag 2460gcttccacta
taaacagagt tcactactca tcacccaact cttagctgtt tcttgacttt
2520tcagtctctg aaaaagctca tttgcttttt ttctctgttc tcttattttt
tttcctcccc 2580aatggtgcct agaacatctg gagaacatcc cagggaccag
cgaaaactct gcttttcgtt 2640tcctctttaa cctcagcagc atcccagaga
acgaggtgat ctcgtctgcc gagcttcgac 2700tmttccggga gcaggtggac
cagggccctg actgggatca gggctttcat cgtataaaca 2760tttatgaggt
tatgaagccc ccggcagaag tggtgcctgg gcacctcatc acacgactac
2820tggacacaag actggtccac cacaatgtga cgcggtggga aacttttgat
gtgagccctg 2880cagtccttcg ctggacccgg gagaagcagc ccaactatgg
gctggccatt gaggtgaccc 2940acctccatca gacacggacc caccagggcc
agcatgtcag gattagccga tcgttacctc 3000aagggagtgg ggattgggcc
cagctccggc ccctcctggt cacctttggc catgatggcc 3060ggggacatgc
cttgacccga cgcaggaggg ccaagcgtag ccccaagcat cacccacaga
3120gggcccggaa gaagaataag aactgccggc gccactcgct ctacgtggac
ttcagtgatg 3180tgggctggaa tgactggatt gtggccccac caggctacca
ggcattctac tgccacgggg 3240actgcccctt tccactggcc gaccacctca
actcaaccaa ccacgccatt gtgcagaccc 3300tggtcaactc tgtcaattcc
agtatcccca aagcctgttg tgttcccacc gaactcagcg 3360ccatctccat
gctgtacctg gatgagtatg acaaggtggt tctgaaaaat tatcaggaga
3420tggtagtgga gggatgtggg tgccgctgag atcaggcctt ctttggggac
acacacacac 3480acacacacac acacacacac acacacacat cccatccact
actcacccac acactacaca 3540gactgcttcc ttatagctgg acttttatct
taaaaaaaaa aaaaaggaaa aaaaaatcta 3600aacattcacc ttgaccttat
ttatgacttt acgtgcaaat gttttgacca tattgatcat 3660atattttgac
aaaatatatt tataactaca tattaaaaga aaaaaataaa atgagtcatt
3720attttaaagg taaa 3734319DNAArtificial SequenceForward Primer ID3
3gcatcttccc atccagaca 19418DNAArtificial SequenceReverse Primer ID3
4cagtggcaga agctcctt 18518DNAArtificial SequenceForward Primer
THBS2 5ctacttctcg gacctcaa 18618DNAArtificial SequenceReverse
Primer THBS2 6tgggtaacag catctaca 18718DNAArtificial
SequenceForward Primer THBS4 7gtgggctaca tcagggtg
18819DNAArtificial SequenceReverse Primer THBS4 8atggtggtgt
ctatggtga 19918DNAArtificial SequenceForward Primer PPP2R1A
9ccttcctctt ggtggttt 181020DNAArtificial SequenceReverse Primer
PPP2R1A 10ggcctttatt tctctgtgaa 201118DNAArtificial SequenceForward
Primer PITX2 11ccgcagagaa agataaga 181218DNAArtificial
SequenceReverse Primer PITX2 12ttgccttttc ttcttgga
181319DNAArtificial SequenceForward Primer BMP4 13tttccagcaa
gtttgttca 191418DNAArtificial SequenceReverse Primer BMP4
14ccatcagcat tcggttac 181518DNAArtificial SequenceForward Primer
BMP3 15tgtcctcact cagcatct 181619DNAArtificial SequenceReverse
Primer BMP3 16gcaagcacaa gactctact 191719DNAArtificial
SequenceForward Primer BMP2 17cacgaagaat ctttggaag
191818DNAArtificial SequenceReverse Primer BMP2 18gttctgctga
ggtgataa 181919DNAArtificial SequenceForward Primer BMPER
19ggactacact actttctac 192018DNAArtificial SequenceReverse Primer
BMPER 20gtatatgcca ggaatgat 182122DNAArtificial SequenceForward
Primer BMPR1A 21gtcttactct gaacaaacaa ct 222218DNAArtificial
SequenceReverse Primer BMPR1A 22gctctgattc ctccactt
182320DNAArtificial SequenceForward Primer BMPR1B 23cagaacggaa
tgaatgtaat 202418DNAArtificial SequenceReverse Primer BMPR1B
24aatgatgagg accaagag 182518DNAArtificial SequenceForward Primer
SMAD2 25ccaactcttc tgtcatag 182618DNAArtificial SequenceReverse
Primer SMAD2 26gaacatagga aaccactt 182718DNAArtificial
SequenceForward Primer GDF9 27ccaagaccat cctgtgta
182824DNAArtificial SequenceReverse Primer GDF9 28cttagtggct
atcatatctt cata 242918DNAArtificial SequenceForward Primer BMP15
29ccaagaggta gtgaggtt 183022DNAArtificial SequenceReverse Primer
BMP15 30aatacagtaa caagaagaca gt 223120DNAArtificial
SequenceForward Primer INHBA 31gcagaaatga atgaacttat
203218DNAArtificial SequenceReverse Primer INHBA 32ccttctttgg
aaatctca 183318DNAArtificial SequenceForward Primer DCN
33cgatcataag tacatcca 183418DNAArtificial SequenceReverse Primer
DCN 34tcactcctga ataagaag 183520DNAArtificial SequenceForward
Primer RPS6KB2 35catggacaag atcatcagag 203618DNAArtificial
SequenceReverse Primer RPS6KB2 36ctggttagga ttccgctt
183719DNAArtificial SequenceForward Primer SMAD1 37ccactataag
cgagtagaa 193818DNAArtificial SequenceReverse Primer SMAD1
38tgtgctgagg attgtatt 183921DNAArtificial SequenceForward Primer
SMAD6 39gtacaagcca ctggatctat c 214018DNAArtificial SequenceReverse
Primer SMAD6 40gctgtgatga gggagttg 184118DNAArtificial
SequenceForward Primer ACVR1 41ggatgagaag tcgtggtt
184220DNAArtificial SequenceReverse Primer ACVR1 42tactggagtg
tcttgatgtc 204318DNAArtificial SequenceForward Primer ACVR1C
43agttccgacc aagtattc 184418DNAArtificial SequenceReverse Primer
ACVR1C 44acactcacgc attattct 184518DNAArtificial SequenceForward
Primer ACVR1B 45agagatatac cagacagt 184618DNAArtificial
SequenceReverse Primer ACVR1B 46gtgccgttat ctttattg
184718DNAArtificial SequenceForward Primer TGF?AR1 47ttaccattgc
ttgttcag 184818DNAArtificial SequenceReverse Primer TGF?AR1
48cttcttctcc tctccatt 184919DNAArtificial SequenceForward Primer
TGF?AR2 49tgtgtggaaa gcatgaagg 195018DNAArtificial SequenceReverse
Primer TGF?AR2 50gatgccctgg tggttgag 185118DNAArtificial
SequenceForward Primer Lefty2 51agccagaact tccgagag
185218DNAArtificial SequenceReverse Primer Lefty2 52catgtcgaac
accagcaa 185318DNAArtificial SequenceForward Primer GAPDH
53tgcccagaat atcatccc 185418DNAArtificial SequenceReverse Primer
GAPDH 54aggtcagatc cacaacag 185518DNAArtificial SequenceForward
Primer BMP4 (1) 55gaccgctgga ggtttggg 185620DNAArtificial
SequenceReverse Primer BMP4 (1) 56gactgaggac tttccgtttg
205720DNAArtificial SequenceForward Primer BMP4 (2) 57tacagggcaa
ttcctacttt 205819DNAArtificial SequenceReverse Primer BMP4 (2)
58gtccagattc caggtaagg 195918DNAArtificial SequenceForward Primer
BMP4 (3) 59tggtgcttgc tgaatgct 186018DNAArtificial SequenceReverse
Primer BMP4 (3) 60gtgggtccgt gtctgatg 186118DNAArtificial
SequenceForward Primer BMP4 (4) 61ggagaagcag cccaacta
186220DNAArtificial SequenceReverse Primer BMP4 (4) 62tcagaaccac
cttgtcatac 206320DNAArtificial SequenceForward Primer BMP4 (5)
63gagtatgaca aggtggttct 206419DNAArtificial SequenceReverse Primer
BMP4 (5) 64gagtctttaa tccagccta 196518DNAArtificial SequenceForward
Primer ID3(1) 65gcggtattcg gcgtcaga 186619DNAArtificial
SequenceReverse Primer ID3(1) 66cgcacggagt ttggaaggt
196718DNAArtificial SequenceForward Primer ID3(2) 67ctccgtgcgt
aaaccctt 186820DNAArtificial SequenceReverse Primer ID3(2)
68ttccgtcatt catttgctgt 206918DNAArtificial SequenceForward Primer
ID3(3) 69tccgcctgtg gtctttcg 187021DNAArtificial SequenceReverse
Primer ID3(3) 70cctaaatcca gctttgtgag a 217119DNAArtificial
SequenceForward Primer THBS2(1) 71aacgagtcca gctcttccg
197218DNAArtificial SequenceReverse Primer THBS2(1) 72tccctgcctg
cttcaaaa 187318DNAArtificial SequenceForward Primer THBS2(2)
73tccgctcccg cacttcaa 187420DNAArtificial SequenceReverse Primer
THBS2(2) 74cctcccagga gtttcccacc 207522DNAArtificial
SequenceForward Primer THBS2(3) 75cagtctccaa attctgtccc ta
227619DNAArtificial SequenceReverse Primer THBS2(3) 76tgagttgacc
cttctttat 197718DNAArtificial SequenceForward Primer THBS2(4)
77ctgttgccag tgacttta 187818DNAArtificial SequenceReverse Primer
THBS2(4) 78cacatcatca tcccgtac 187920DNAArtificial SequenceForward
Primer BMP4 79tagaacatct ggagaacatc 208021DNAArtificial
SequenceReverse Primer BMP4 80ggcttcataa cctcataaat g
218118DNAArtificial SequenceForward Primer THBS2 81tcttcacctg
ctgtcctc 188222DNAArtificial SequenceReverse Primer THBS2
82cttacatttc atatgtaaac ct 228318DNAArtificial SequenceForward
Primer ID3 83tggatgggcc tcaacctt 188420DNAArtificial
SequenceReverse Primer ID3 84ggcagaattt ggagaacagc 20
* * * * *