U.S. patent application number 16/061574 was filed with the patent office on 2018-12-20 for efficient phospholipase c mutant that does not rely on zinc ions.
The applicant listed for this patent is Wilmar (Shanghai) Biotechnology Research & Development Center Co., Ltd.. Invention is credited to Yueyi BAO, Sitian GU, Sha LIU, Qiwen NIU, Wei WU, Yaoji XUAN.
Application Number | 20180362942 16/061574 |
Document ID | / |
Family ID | 59055726 |
Filed Date | 2018-12-20 |
United States Patent
Application |
20180362942 |
Kind Code |
A1 |
XUAN; Yaoji ; et
al. |
December 20, 2018 |
Efficient Phospholipase C Mutant That Does Not Rely on Zinc
Ions
Abstract
Provided is a mutant of the wild type
phosphatidylcholine-specific phospholipase C of Bacillus cereus.
The mutations involved comprise the amino acid residue at position
63 being mutated from asparagine to aspartic acid, the amino acid
residue at position 131 being mutated from asparagine to serine,
and the amino acid residue at position 134 being mutated from
asparagine to aspartic acid, and may comprise the amino acid
residue at position 56 being mutated from tyrosine to alanine,
lysine, asparagine, glutamine, histidine or tryptophan, and
further, may also comprise the amino acid residue at position 106
being mutated from methionine to valine. Also provided are a
polynucleotide molecule encoding the mutant, a nucleic acid
construct and a host cell comprising the polynucleotide molecule, a
composition comprising the mutant, and the use of the mutant, the
polynucleotide molecule, the nucleic acid construct and the host
cell.
Inventors: |
XUAN; Yaoji; (Shanghai,
CN) ; GU; Sitian; (Shanghai, CN) ; WU;
Wei; (Shanghai, CN) ; LIU; Sha; (Shanghai,
CN) ; BAO; Yueyi; (Shanghai, CN) ; NIU;
Qiwen; (Shanghai, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Wilmar (Shanghai) Biotechnology Research & Development Center
Co., Ltd. |
Shanghai |
|
CN |
|
|
Family ID: |
59055726 |
Appl. No.: |
16/061574 |
Filed: |
December 15, 2016 |
PCT Filed: |
December 15, 2016 |
PCT NO: |
PCT/CN2016/110030 |
371 Date: |
June 12, 2018 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12P 7/00 20130101; C12N
9/16 20130101; C11B 3/00 20130101; C12N 9/20 20130101; C12N 15/63
20130101; C12R 1/085 20130101; C12Y 301/04003 20130101; C11B 3/003
20130101 |
International
Class: |
C12N 9/16 20060101
C12N009/16; C11B 3/00 20060101 C11B003/00 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 16, 2015 |
CN |
201510946696.1 |
Claims
1. An isolated amino acid sequence comprising: (1) an amino acid
sequence as set forth in SEQ ID NO: 7; or (2) a polypeptide derived
from the amino acid of (1) by substitution, deletion or addition of
one or several amino acids in the amino acid sequence in (1) while
retaining the phospholipase C activity of SEQ ID NO: 7.
2. The amino acid sequence according to claim 1, wherein, the amino
acid Xaa at position 56 of SEQ ID NO: 7 is alanine, lysine,
asparagine, glutamine, histidine or tryptophan; and/or the
substitution, deletion or addition of one or several amino acids in
(2) is M to V mutation at position 106; and/or the amino acid
sequence comprises a signal peptide, terminal extension, GST,
maltose E binding protein, protein A, tag, and/or protease
hydrolysis sites for factor Xa or thrombin or enterokinase.
3. The amino acid sequence according to claim 1, wherein said amino
acid sequence is selected from the group consisting of SEQ ID NOs:
2, 4 and 6.
4. An isolated polynucleotide sequence selected from the group
consisting of: (1) a polynucleotide sequence encoding an isolated
amino acid sequence according to claim 1; (2) a complementary
sequence to the polynucleotide sequence of (1); and (3) a fragment
of (1) or (2) with 15-30 bases.
5. A nucleic acid construct comprising a polynucleotide sequence
selected from the group consisting of: (1) a polynucleotide
sequence encoding an isolated amino acid sequence according to
claim 1; (2) a complementary sequence to the polynucleotide
sequence of (1); and (3) a fragment of (1) or (2) with 15-30
bases.
6. A genetically engineered host cell, wherein the host cell
expresses an amino acid sequence according to claim 1 or comprises
a polynucleotide sequence encoding the amino acid sequence, or a
nucleic acid comprising the polynucleotide sequence.
7. A composition comprising an isolated amino acid sequence
according to claim 1 and optionally comprising an auxiliary
material.
8. (canceled)
9. An enzymatic degumming method, or a method for improving
degumming performance of phospholipase C, wherein the method
comprises: after incubating phospholipase C at a temperature
between 55.degree. C. and 75.degree. C., adding the phospholipase C
to crude oil for degumming.
10. The method according to claim 9, wherein the method has one or
more of the following features: (1) the phospholipase C has an
amino acid sequence comprising: (a) an amino acid sequence as set
forth in SEQ ID NO: 7; or (b) a polypeptide derived from the amino
acid of (a) by substitution, deletion or addition of one or several
amino acids in the amino acid sequence in (a) while retaining the
phospholipase C activity of SEQ ID NO: 7; (2) the phospholipase C
is incubated at a temperature between 60.degree. C. and 70.degree.
C.; (3) the incubation time is 15 to 45 minutes; (4) the enzyme is
added at an amount of 50 to 1000 ppm based on the weight of crude
oil; (5) the crude oil is heated to 50 to 70.degree. C. prior to
adding the enzyme to crude oil; and (6) the degumming comprises
stirring at 50 to 60.degree. C. for 1 to 3 hours, then heating to
80 to 90.degree. C. and holding for 1 to 10 minutes.
11. The amino acid sequence according to claim 2, wherein, the
amino acid Xaa at position 56 of SEQ ID NO: 7 is histidine or
tryptophan; or in the amino acid sequence of (2), the amino acid
residue at position 56 is histidine and the amino acid residue at
position 106 is valine; and/or the tag is 6His or Flag, and the
amino acid sequence of the signal peptide is set forth in SEQ ID
NO: 70 or 72.
12. The isolated polynucleotide sequence according to claim 4,
wherein the isolated amino acid sequence is set forth in SEQ ID NO:
7 with the amino acid Xaa at position 56 of SEQ ID NO: 7 is
alanine, lysine, asparagine, glutamine, histidine or tryptophan; or
the isolated amino acid sequence is a polypeptide derived from the
amino acid of SEQ ID NO:7 by substitution, deletion or addition of
one or several amino acids in the amino acid sequence in SEQ ID
NO:7 while retaining the phospholipase C activity of SEQ ID NO: 7,
with the amino acid residue at position 56 is histidine and the
amino acid residue at position 106 is valine.
13. The isolated polynucleotide sequence according to claim 4,
wherein the isolated amino acid sequence is selected from the group
consisting of SEQ ID NOs: 2, 4 and 6.
14. The isolated polynucleotide sequence according to claim 4,
wherein the polynucleotide sequence is set forth in SEQ ID NOs: 1,
3 or 5.
15. The nucleic acid construct according to claim 5, wherein the
polynucleotide sequence is a polynucleotide sequence encoding an
isolated amino acid sequence set forth in SEQ ID NO: 7 with the
amino acid Xaa at position 56 of SEQ ID NO: 7 is alanine, lysine,
asparagine, glutamine, histidine or tryptophan; or an isolated
amino acid sequence derived from the amino acid of SEQ ID NO:7 by
substitution, deletion or addition of one or several amino acids in
the amino acid sequence in SEQ ID NO:7 while retaining the
phospholipase C activity of SEQ ID NO: 7, with the amino acid
residue at position 56 is histidine and the amino acid residue at
position 106 is valine.
16. The nucleic acid construct according to claim 5, wherein the
polynucleotide sequence is a polynucleotide sequence encoding the
isolated amino acid sequence selected from the group consisting of
SEQ ID NOs: 2, 4 and 6.
17. The nucleic acid construct according to claim 5, wherein the
polynucleotide sequence is set forth in SEQ ID NOs: 1, 3 or 5.
18. The nucleic acid construct according to claim 5, wherein the
nucleic acid construct is an expression vector or a cloning
vector.
19. The composition according to claim 7, wherein the isolated
amino acid sequence is set forth in SEQ ID NO: 7 with the amino
acid Xaa at position 56 of SEQ ID NO: 7 is alanine, lysine,
asparagine, glutamine, histidine or tryptophan; or the isolated
amino acid sequence is a polypeptide derived from the amino acid of
SEQ ID NO:7 by substitution, deletion or addition of one or several
amino acids in the amino acid sequence in SEQ ID NO:7 while
retaining the phospholipase C activity of SEQ ID NO: 7, with the
amino acid residue at position 56 is histidine and the amino acid
residue at position 106 is valine.
20. The composition according to claim 7, wherein the isolated
amino acid sequence is selected from the group consisting of SEQ ID
NOs: 2, 4 and 6.
21. The composition according to claim 7, wherein the auxiliary
material is an absorbing material selected from the group
consisting of activated carbon, alumina, diatomaceous earth, porous
ceramics, and porous glass.
Description
TECHNICAL FIELD
[0001] The invention relates to a zinc ion independent efficient
phospholipase C mutant, particularly to a phosphatidylcholine
specific phospholipase C mutant obtained by the mutant screening
methods in molecular biology, and the use thereof.
BACKGROUND
[0002] Degumming is an important step in oil refining, and the
traditional hydration degumming suffers from high cost, large
material consumption and serious environmental pollution,
therefore, many have been committed to using enzymatic degumming in
the degumming procedure for oil refining and great progress has
been made in recent years. Compared with traditional methods,
enzymatic degumming can improve economic efficiency, save energy,
reduce emission, decrease environment pollution, and have larger
advantages in terms of environment, economic and quality. The
enzyme used in oil degumming is phospholipase. Phospholipases
possess the ability to hydrolyze one or more ester bonds of
phosphoglyceride and represent a class of lipases, acyl hydrolases
and phosphatases. Phospholipases, depending on its site of action
in the phospholipid molecule, can be divided into phospholipase A1
(PLA1), phospholipase A2 (PLA2), phospholipase C (PLC) and
phospholipase D (PLD).
[0003] Phospholipase C (for short, PLC), is a lipid hydrolase
capable of hydrolyzing C3 phosphatidyl site of glycerophospholipids
to form diacylglycerol and phosphorylcholine, inositol phosphates,
phosphoethanolamine and other. Phospholipase C is widely found in
plants and microorganisms. Plant and animal derived PLCs generally
locate on cell membrane, which are complicated in structure,
belonging to endogenous phospholipase C, and difficult to separate.
Compared to other degumming enzymes, phospholipase C (PLC) showed
greater advantages, such as increased yield of diacylglycerol
(DAG), and reduced lose of obtained oil.
[0004] Microbial derived PLCs generally have simpler structures,
and these enzymes have been isolated from various microorganisms,
including many bacterial origin comprising Clostridium perfringens
[Yun T, Siebel C. Cloning and expression of the PLC gene from
Clostridium perfringens and Clostridium bifermentants[J]. Infection
and immunity, 1989, 2: 468-476], C. bifermentans, Burkholderia
pseudomallei, Bacillus cereus, Bacillus mycoiddes, Bacillus
thuringiensis, Listeria monocytogenes, Pseudomonas aeruginosa, P.
fluorescens, Straphylococus aureus, Acinetobacter baumannii,
Streptomyces clavuligerus, Burkholderi, and others. They may be
from actinomycetes such as Streptomyces hachijyoensis, and others.
They may also be from yeasts such as Candia albicans [Analuz E,
Juan-Jose R, Rosario Cueva. Sequencing of a 4.3 kbp region of
chromosome 2 of Candida albicans reveals the presence of homologues
of SHE9 from Saccharomyces cerevisiae and of bacterial
phosphatidylinostiol-phospholipase C[J]. Yeast, 2001, 18(8):
711-721], Saccharomyces cerevisiae [Payne W, Fitzgerald-Hayes M. A
mutation in PLC1, a candidate phosphoinositide specific
phospholipase C gene from Saccharomyces cerevisiae, causes aberrant
mitotic chromosome segregation[J]. Molecular and Cellular Biology,
1993, 13: 4351-4364], and others.
[0005] PC-PLC from Bacillus cereus (BC-PC-PLC) is an earlier
studied phospholipase C. BC-PC-PLC has a full length of 283 amino
acids, comprising a signal peptide of 24 amino acids and a leader
peptide of 14 amino acids. The mature form thereof has 245 amino
acids (Johansen, T., Holm, T., Guddal, P. H., Sletten, K., Haugli,
F. B., Little, C, 1988, "Cloning and sequencing of the gene
encoding the phosphatidylcholine-preferring phospholipase C of
Bacillus cereus", Gene 65(2): 293-304). The crystal structure of
BC-PC-PLC has been reported, which consists of a plurality of
helical domains and has a catalytic site of aspartic acid 55 and at
least three Zn.sup.2+ binding sites (Hough., E., Hansen, L. K.,
Birknes, B., Jynge, K., Hansen, S., Hordvik, A., Little, C.,
Dodson, E., Derewenda, Z., 1989, "High-resolution (1.5 A) crystal
structure of phospholipase C from Bacillus cereus", Nature,
338:357-60). Little has been studied about the heterologous
expression of BC-PC-PLC other than that in Bacillus subtilis and
pichia pastoris (Durban, M. A., Silbersack, J., Schweder, T.,
Schauer, F., Bornscheuer, U. T., 2007, High level expression of a
recombinant phospholipase C from Bacillus cereus in Bacillus
subtilis, Appl Microbiol Biotechnol 74(3):634-639; Seo, K. H, Rhee
J. I., 2004, High-level expression of recombinant phospholipase C
from Bacillus cereus in Pichia pastoris and its characterization,
Biotechnol Lett 26(19):1475-1479).
[0006] Currently, phospholipase C is mainly used in enzymatic
degumming. In the manufacture of edible oil such as soybean oil and
rapeseed oil, unrefined crude oil mainly comprises a complex
mixture of triglycerides, phospholipids, sterols, tocopherols, free
fatty acids, trace metals and other trace compounds, wherein the
phospholipid will cause deterioration of color and taste, shorter
shelf life and affect the effect of subsequent refining process.
Currently, the main degumming processes comprise hydration
degumming, deep degumming and enzymatic degumming. Enzymatic
degumming is becoming preferred due to its mild condition,
non-pollution, and low oil consumption.
[0007] Since phospholipase C can act on glycerophospholipids to
generate diacylglycerol, use of phospholipase C in the enzymatic
degumming process thus can significantly improve the yield of oil,
thereby enhancing the economic efficiency of production. Therefore,
it is of important practical significance to improve the degumming
performance of phospholipase C.
[0008] However, there is still need of BC-PC-PLC with a higher
enzymatic activity in the field.
SUMMARY
[0009] In the invention, asparagines in three glycosylation sites
of BC-PC-PLC, i.e., positions 63, 131 and 134 are mutated to
aspartic acid, serine, and aspartic acid, respectively (see SEQ ID
NO: 2), which increase the enzymatic activity by 16-fold in the
presence of low zinc sulfate compared to the wild-type enzyme.
[0010] Further, in the invention, error-prone PCR is used to
provide a mutant library of SEQ ID NO: 2, the expression vector
within the mutant library is transformed to Pichia host cell to
obtain several mutant strains with a specific activity (U/mg of
total protein) similar to or 1.5 times higher than the parent
(i.e., SEQ ID NO: 2 amino acid sequence shown) by plate screening,
tyrosine at position 56 of the amino acid sequences of these
mutants is mutated to alanine (A), lysine (K), asparagine (N),
glutamine (Q), histidine (H), tryptophan (W), phenylalanine (F),
arginine acid (R), serine (S) or threonine (T). In particularly,
the mutants with W or H at position 56 have a specific activity 7
times higher than the parent.
[0011] The invention therefore provides a zinc ion independent
efficient phospholipase C mutant, which can be used in various
aspects such as oil refining, phospholipid modification, feed
modifier, food industry and pharmaceutical industry, and others,
thereby completing the invention.
[0012] Accordingly, a first aspect of the invention provides an
isolated amino acid sequence comprising:
[0013] (1) an amino acid sequence as set forth in SEQ ID NO: 7;
or
[0014] (2) a polypeptide derived from the amino acid of (1) by
substitution, deletion or addition of one or several amino acids in
the amino acid sequence in (1) while retaining the phospholipase C
activity of SEQ ID NO: 7.
[0015] In one or more embodiments, the amino acid Xaa at position
56 of SEQ ID NO: 7 is alanine, lysine, asparagine, glutamine,
histidine, or tryptophan.
[0016] In one or more embodiments, the amino acid Xaa at position
56 of SEQ ID NO: 7 is histidine or tryptophan.
[0017] In one or more embodiments, the substitution, deletion or
addition of one or more amino acids in (2) is M to V mutation at
position 106.
[0018] In one or more embodiments, the substitution, deletion or
addition of one or more amino acids in (2) is R to H mutation at
position 20.
[0019] In one or more embodiments, the substitution, deletion or
addition of one or more amino acids in (2) is A to D mutation at
position 83.
[0020] In one or more embodiments, the amino acid residual at
position 56 of the amino acid sequence in (2) is histidine, and
that at position 106 is valine.
[0021] In one or more embodiments, the amino acid sequence
comprises a signal peptide (e.g., leader peptide), terminal
extension, GST, maltose E binding protein, protein A, tag (such as
a 6His or Flag), and/or protease hydrolysis sites for factor Xa or
thrombin or enterokinase, or consists of one or more of these
sequences and the amino acid sequence as set forth in SEQ ID NO:
7.
[0022] In one or more embodiments, the amino acid sequence of the
signal peptide is set forth in SEQ ID NO: 70 or 72.
[0023] In one or more embodiments, the amino acid sequence is
selected from SEQ ID NOs: 2, 4 and 6.
[0024] A second aspect of the invention provides an isolated
polynucleotide sequence selected from:
[0025] (1) a polynucleotide sequence encoding an isolated
polypeptide according to the invention;
[0026] (2) a complementary sequence to the polynucleotide of (1);
and
[0027] (3) a fragment of the sequence of (1) or (2) with 15-30
bases.
[0028] In one or more embodiments, the polynucleotide sequence is
set forth in SEQ ID NO: 1, 3 or 5.
[0029] A third aspect of the invention provides a nucleic acid
construct, wherein the nucleic acid construct comprises a
polynucleotide sequence according to the invention.
[0030] In one or more embodiments, the nucleic acid construct is an
expression vector or cloning vector.
[0031] The invention further provides a genetically engineered host
cell, the host cell:
[0032] (1) expresses the amino acid sequence according to the
invention; and/or
[0033] (2) comprises a polynucleotide sequence or nucleic acid
construct according to the invention.
[0034] The invention also provides a composition comprising a
polypeptide according to the invention and optionally auxiliary
materials, preferably, the auxiliary materials are absorbing
materials selected from activated carbon, alumina, diatomaceous
earth, porous ceramics, and porous glass.
[0035] The invention also provides use of an amino acid sequence
according to the invention in oil refining, phospholipid
modification, feed modifier, food industry and pharmaceutical
industry.
[0036] The invention also provides a method for enzymatic
degumming, the method comprises incubating phospholipase C at a
temperature between 55.degree. C. and 75.degree. C., adding
phospholipase C to the crude oil for degumming.
[0037] In one or more embodiments, the phospholipase C have the
amino acid sequence according to the invention.
[0038] In one or more embodiments, phospholipase C, especially the
amino acid sequence according to the invention is incubated at a
temperature between 60.degree. C. and 70.degree. C.
[0039] In one or more embodiments, the incubation time is between
15 and 45 minutes.
[0040] In one or more embodiments, based on the weight of crude
oil, the enzyme is added in an amount of 50 to 1000 ppm, preferably
100 to 500 ppm, more preferably 100 to 300 ppm.
[0041] In one or more embodiments, the enzyme is incubated in an
aqueous solution.
[0042] In one or more embodiments, prior to adding the enzyme to
crude oil, the crude oil is first heated to 50 to 70.degree. C.,
preferably 50 to 60.degree. C.
[0043] In one or more embodiments, degumming comprises stirring at
50 to 60.degree. C. for 1 to 3 hours, and then raising the
temperature to 80 to 90.degree. C. and then holding for 1 to 10
minutes.
[0044] The invention also provides a method for improving degumming
performance of phospholipase C, the method comprises incubating
phospholipase C at a temperature between 55.degree. C. and
75.degree. C., adding phospholipase C to crude oil for
degumming.
[0045] In one or more embodiments, the phospholipase C has the
amino acid sequence according to the invention.
[0046] In one or more embodiments, phospholipase C, especially the
amino acid sequence according to the invention is incubated at a
temperature between 60.degree. C. and 70.degree. C.
[0047] In one or more embodiments, the incubation time is between
15 and 45 minutes.
[0048] In one or more embodiments, based on the weight of crude
oil, the enzyme is added in an amount of 50 to 1000 ppm, preferably
100 to 500 ppm, more preferably 100 to 300 ppm.
[0049] In one or more embodiments, the enzyme is incubated in an
aqueous solution.
[0050] In one or more embodiments, prior to adding the enzyme to
crude oil, the crude oil is first heated to 50 to 70.degree. C.,
preferably 50 to 60.degree. C.
[0051] In one or more embodiments, degumming comprises stirring at
50 to 60.degree. C. for 1 to 3 hours, and then raising the
temperature to 80 to 90.degree. C. and holding for 1 to 10
minutes.
[0052] In one or more embodiments, the crude oil comprises but not
limited to soybean oil, sunflower oil, peanut oil, rapeseed oil,
rice bran oil, corn oil, olive oil, palm oil, palm kernel oil, palm
soft fat, canola oil, castor oil, coconut oil, coriander oil,
cottonseed oil, hazelnut oil, hempseed oil, linseed oil, mango
kernel oil, meadowfoam oil, neat's foot oil, safflower oil,
camellia oil, tall oil, camellia oil and other vegetable oils.
BRIEF DESCRIPTION OF DRAWINGS
[0053] FIG. 1 shows the results of culturing three mutants
PLC-N63DN131SN134D-Y56H, PLC-N63DN131SN134D-M106V and
PLC-N63DN131SN134D-Y56HM106V in BMM-soybean phospholipids screening
plates with 10 .mu.M ZnSO.sub.4.
[0054] FIG. 2 shows the specific activity of each mutant.
[0055] FIG. 3 shows the test results of N63DN131SN134D and
N63DN131SN134D-Y56H degumming.
[0056] FIG. 4 shows the site of action on the phospholipid molecule
for various phospholipases.
[0057] FIG. 5 shows the enzymatic activity results of
BC-PC-PLC-expressing strain fermentation directed by three
different signal peptides.
[0058] FIG. 6 shows the SDS-PAGE electrophorograms of
BC-PC-PLC-expressing strain fermentation directed by three
different signal peptides.
EMBODIMENT
[0059] Polypeptides Having the Phospholipase C Activity
[0060] The invention provides a polypeptide having the amino acid
sequence as set forth in SEQ ID NO: 7. The invention further
comprises a polypeptide comprising one or more (typically 1-10,
e.g. 8, 9, or 10) amino acid deletions, insertions and/or
substitution based on SEQ ID NO: 7, in particular addition of one
or more (typically 20 or less, preferably 10 or less, more
preferably 8 or less) amino acids at C-terminus and/or N-terminus.
These variant forms still have the phospholipase C activity
according to the invention. As an example of such mutation, the
invention comprises phospholipase C of SEQ ID NO: 7 with a mutation
of R to H at position 20, a mutation of A to D at position 83
and/or a mutation of M to V at position 106.
[0061] Conservative variant forms are preferred. For example, in
the art, when conservative substitution of amino acids with close
or similar properties is performed, the function of the protein or
polypeptide typically does not change. "Amino acids with close or
similar properties" includes, for example, a family of amino acid
residues having similar side chains. Such family includes amino
acids having basic side chain (e.g., lysine, arginine, histidine),
amino acids having acidic side chain (e.g. aspartic acid, glutamic
acid), amino acids having uncharged polar side chain (e.g. glycine,
asparagine, glutamine, serine, threonine, tyrosine, cysteine acid),
amino acids having nonpolar side chain (e.g., alanine, valine,
leucine, isoleucine, proline, phenylalanine, methionine,
tryptophan), amino acid having (3-branched side chains (e.g.,
threonine, valine, isoleucine) and amino acid having aromatic side
chain (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus,
in the polypeptide according to the invention, replacement of one
amino acid residue from a class of same side chain with another at
one or more positions will not substantially affect its
activity.
[0062] Furthermore, as well known to those skilled, in the cloning
operation, it is often required to design suitable enzymatic
cleaving sites, which would introduce one or more irrelevant
residues at the terminus of the protein expressed without affecting
the activity of the protein of interest. In another example, in
order to construct fusion protein, facilitate expression of a
recombinant protein, obtain recombinant protein that auto-secrete
to outside of a host cell, or facilitate purification of
recombinant proteins, it is often necessary to add some amino acids
to the N-terminus, C-terminus of the recombinant protein or the
other suitable region within the said protein, e.g., including but
not limited to, a suitable linker peptide, signal peptide, leader
peptide, terminal extension, glutathione S-transferase (GST),
maltose E binding protein, protein A, tag such as 6His or Flag, or
protease hydrolysis sites for factor Xa or thrombin or
enterokinase. It should be understood that the presence of these
amino acid sequences does not affect the activity of the resulted
polypeptide. Accordingly, the invention also comprises addition of
one or more amino acids at the C-terminus and/or N-terminus of the
polypeptide according to the invention (e.g., the previous linker
peptide, signal peptide, leader peptide terminal extension, GST,
maltose E binding protein, protein A, tag such as 6His tag or Flag,
or protease hydrolysis sites for factor Xa or thrombin or
enterokinase, etc.) of the resultant polypeptide, wherein such
polypeptide still has the phospholipase C activity described
herein. In certain embodiments, the invention uses .alpha.-mating
factor signal sequence from Saccharomyces cerevisiae, serum albumin
signal sequence from Homo sapiens and killer protein signal
sequence from Saccharomyces cerevisiae. In certain embodiments, the
coding sequence and amino acid sequence of the albumin signal
peptide are set forth as SEQ ID NOs: 69 and 70, respectively. In
certain embodiments, the coding sequence and amino acid sequence of
the killer protein signal sequence from Saccharomyces cerevisiae
are set forth as SEQ ID NOs: 71 and 72, respectively. In certain
embodiments, the amino acid sequence of the .alpha.-mating factor
signal sequence from Saccharomyces cerevisiae is an amino acid
sequence encoded by position 8-64 of SEQ ID NO: 10.
[0063] In certain aspects, the invention provides a polypeptide
sequence having at least 80%, at least 85%, at least 90%, at least
95%, at least 97% or at least 99% sequence identity to SEQ ID NO:
7, and its phospholipase activity is comparative or superior to the
polypeptide as set forth in SEQ ID NO: 7 (particularly SEQ ID NOs:
2, 4 or 6). The sequence identity of two sequences may be aligned
with conventional methods in the art, for example, Protein BLAST
from NCBI.
[0064] Based on the host used in the recombinant production
protocol, the polypeptide according to the invention may be
glycosylated, or may be non-glycosylated.
[0065] The polypeptide according to the invention may be a
naturally purified product, or a chemically synthesized product, or
produced from a prokaryotic or eukaryotic host (e.g., bacterial,
yeast, higher plant, insect and mammalian cells) using recombinant
techniques.
[0066] Polynucleotide
[0067] The application comprises a nucleotide sequence encoding a
polypeptide according to the invention or its complementary
sequence. Examples of the coding sequence of a polypeptide
according to the invention are set forth in SEQ ID NOs: 1, 3 and 5.
The "coding sequence" comprises a nucleic acid sequences encoding
the polypeptide according to the invention (in particular, SEQ ID
NO: 7). The sequence encoding a polypeptide according to the
invention may be identical to, for example, the coding regions as
set forth in SEQ ID NOs: 1, 3 and 5, or may be its degenerate
variant. As used herein, "degenerate variant" means the case
wherein the amino acid sequences are same, but the nucleotide
sequences are different.
[0068] The sequence encoding a polypeptide according to the
invention comprises: the coding sequence encoding only the mature
polypeptide; the coding sequence for the mature polypeptide and
various additional coding sequences; and the coding sequence for
the mature polypeptide (and optionally an additional coding
sequence) and a non-coding sequence.
[0069] The invention further relates to a variant of the
polynucleotide described above, which encodes fragment, analog,
derivative and variant forms of the same amino acid sequence
according to the invention. Such variant of the polynucleotide may
be a naturally occurring allelic variant or a non-naturally
occurring variant. These nucleotide variants comprise substitution
variants, deletion variants, and insertion variants. As known in
the art, an allelic variant is an alternate form of a
polynucleotide, which may be one or more nucleotide substitutions,
deletions or insertions, but would not substantially alter function
of the protein to be encoded.
[0070] The invention also comprises a fragment of a nucleic acid
sequence encoding a polypeptide according to the invention (e.g.,
SEQ ID NOs: 1, 3, 5, or its complementary sequence). As used
herein, a "nucleic acid fragment" has at least 15 nucleotides,
preferably at least 30 nucleotides, more preferably at least 50
nucleotides, most preferably at least 100 nucleotides or more in
length. A nucleic acid fragment may be used in nucleic acid
amplification techniques (e.g. PCR) to identify and/or separate a
polynucleotide encoding a polypeptide according to the invention.
Thus, in some embodiments, the nucleic acid fragment has 15-30
bases in length. An appropriate nucleic acid fragment may be
selected from a nucleic acid sequence according to the invention
using the prior art as a primer or probe.
[0071] A coding sequence of a polypeptide according to the
invention or its fragment can be obtained by PCR amplification,
recombination or synthetic methods. For PCR amplification, primers
may be designed based on a related nucleotide sequence disclosed in
the invention, in particular open reading frame sequence, and a
commercially available cDNA library or a cDNA library prepared
using conventional methods known in the art is used as a template
for amplifying and obtaining the related sequence. When the
sequence is long, it is often required to conduct two or more PCR
amplifications, and then ligating the amplified fragments from each
time together in a correct order.
[0072] Nucleic Acid Construct
[0073] The invention also relates to a nucleic acid construct
comprising an isolated polypeptide according to the invention
operably linked to one or more regulatory sequences that are
expressed in a suitable host cell under appropriate conditions for
the regulatory sequences. Polynucleotide encoding a polypeptide
according to the invention may be operated in various ways to
ensure the expression of the polypeptide. Prior to its insertion
into a vector, the operation of a polynucleotide sequence may be
desirable or necessary for the expression vector. Methods for
utilizing recombinant DNA techniques to alter a polynucleotide
sequence are known in the art.
[0074] The regulatory sequence may be a suitable promoter sequence
for expressing a nucleotide sequence recognized by a host cell for
expression of a polynucleotide encoding a polypeptide according to
the invention. The promoter sequence comprises transcriptional
regulatory sequences linked to the polypeptide to be expressed. The
promoter may be any nucleotide sequence that exhibits
transcriptional activity in the selected host cell, including
mutant, truncated, and hybrid promoters, and can be obtained from
genes encoding extracellular or intracellular polypeptides
homologous or heterologous to the host cell.
[0075] Examples of a suitable promoter that directs nucleic acid
constructs according to the invention to transcribe especially in a
bacterial host cell is a promoter obtained from bacteriophage T7,
E. coli lac operon, Streptomyces coelicolor agarase gene, Bacillus
subtilis levansucrase gene, Bacillus licheniformis .alpha.-amylase
gene, Bacillus amyloliquefaciens .alpha.-amylase gene, Bacillus
licheniformis penicillinase genes.
[0076] Examples of a suitable promoter that directs the nucleic
acid construct according to the invention to positively transcribe
in a filamentous fungal host cell is a promoter obtained from
Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic
proteinase, Aspergillus niger neutral .alpha.-amylase, A. niger
acid stable .alpha.-amylase, Aspergillus niger or Aspergillus
awamori glucoamylase (glaA), Trichoderma reesei cellobiohydrolase
enzymes I, Trichoderma reesei cellobiohydrolase II enzymes,
Aspergillus oryzae alkaline protease, Aspergillus oryzae triose
phosphate isomerase, Trichoderma reesei glucanase gene or its
mutant, truncated, and hybrid promoter.
[0077] In yeast host, useful promoter may be obtained from
Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae
galactokinase (GAL1), Saccharomyces cerevisiae alcohol
dehydrogenase, glyceraldehyde-3-phosphate dehydrogenase,
Saccharomyces cerevisiae triosephosphate isomerase, Saccharomyces
cerevisiae 3-phosphoglycerate kinase gene, Pichia pastoris alcohol
oxidase gene. Other useful promoters for yeast host cells are
described in Romanos et al., 1992, Yeast 8: 423-488.
[0078] The regulatory sequence may also be a suitable transcription
terminator sequence, a sequence recognized by a host cell terminate
transcription. A terminator sequence is operably linked to the 3'
end of a nucleotide sequence encoding the polypeptide. Any
terminator that is functional in the selected host cell can be used
in the invention.
[0079] A preferred terminator for bacterial host may be a
terminator derived from the bacteriophage T7.
[0080] A preferred terminator for filamentous fungal host cells is
obtained from Aspergillus oryzae TAKA amylase, Aspergillus niger
glucoamylase, Aspergillus nidulans anthranilate synthase,
Aspergillus niger .alpha.-glucosidase.
[0081] A preferred terminator for a yeast host cell is obtained
from Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae
cytochrome C, Saccharomyces cerevisiae glyceraldehyde-3-phosphate
dehydrogenase, Pichia pastoris alcohol oxidase genes.
[0082] The regulatory sequence may also be a suitable leader
sequence, a non-translated region of the mRNA important for the
translation of the host cell. The leader sequence is operably
linked to 5' end of a nucleotide sequence encoding the polypeptide.
Any leader sequence that is functional in the selected host cell
may be used in the invention.
[0083] The regulatory sequence may also be a signal peptide coding
region that encodes an amino acid sequence linked to the
amino-terminal of a polypeptide and directs the encoded polypeptide
into the signal peptide coding region in the cell secretory
pathway. 5' end of the coding sequence of the nucleotide sequence
may inherently contain a signal peptide coding region naturally
linked to translation reading frame comprising the coding section
that encodes the secreted polypeptide. Alternatively, the 5' end of
the coding sequence may contain a signal peptide coding region
which is foreign to the coding region. When the coding sequence
does not naturally contain a signal peptide coding region, a
foreign signal peptide coding region may be required.
Alternatively, the foreign signal peptide coding region may simply
replace the natural signal peptide coding region to enhance
secretion of the polypeptide. However, any signal peptide coding
region that directs the expressed polypeptide to enter the
secretory pathway in the selected host cell of choice can be used
in the invention. In certain embodiments, the invention uses
.alpha.-mating factor signal sequence, albumin signal sequence from
Homo sapiens and killer protein signal sequence from Saccharomyces
cerevisiae. In certain embodiments, the coding sequence and amino
acid sequence of albumin signal sequence are set forth in SEQ ID
NOs: 69 and 70, respectively. In certain embodiments, the coding
sequence and amino acid sequence of the killer protein signal
sequence from Saccharomyces cerevisiae are set forth as SEQ ID NOs:
71 and 72, respectively. In certain embodiments, the coding
sequence of the .alpha.-mating factor signal sequence is set forth
as positions 8-64 of SEQ ID NO: 10.
[0084] Vector
[0085] The invention also relates to a vector comprising a
polynucleotide according to the invention, including but not
limited to a cloning vector and an expression vector. For example,
in certain embodiments, the nucleic acid constructs according to
the invention is an expression vector or a cloning vector.
[0086] In the expression vector, various nucleic acid and
regulatory sequences may be linked together to produce a
recombinant expression vector that may include one or more
convenient restriction sites for insertion or substitution of a
polynucleotide sequence that encodes the polypeptide at such sites.
Alternatively, a nucleotide sequence according to the invention can
be expressed by a nucleic acid construct with nucleotide sequence
inserted or comprising a sequence within a suitable expression
vector. In the constructiion of an expression vector, a coding
sequence is located in the vector so that the coding sequence is
operably linked for appropriate expression of a regulatory
sequence.
[0087] The recombinant expression vector may be any vector (e.g., a
plasmid or virus) that is conveniently subjected to a recombinant
DNA method and can result in the expression of a nucleotide
sequence of interest. The selection of vector depends on the
compatibility of the vector and the host cell into which the vector
is introduced. The vector may be a linear or closed circular
plasmid.
[0088] The vector may be an autonomously replicating vector, which
exists as an extrachromosomal entity and its replication does not
rely on chromosomal replication, e.g., a plasmid, an
extrachromosomal element, minichromosome or an artificial
chromosome. The vector may contain any means for assuring
self-replication. Alternatively, the vector may be a vector that
when introduced into a host cell, it integrates into the genome and
replicates with the vector chromosome into which it has integrated.
Furthermore, a single vector or plasmid, or two or more vectors or
plasmids, or a transposon together comprising total DNA to be
introduced into the host cell genome can be used.
[0089] A preferred vector according to the invention comprises one
or more selectable markers that permit easy selection of
transformed, transfected, transduced cells and the like. A
selectable marker is a gene whose product provides resistance to
antibiotics or viruses, resistance to heavy metals, prototrophy to
auxotrophs and the like.
[0090] A preferred vector according to the invention comprises an
element that allows integration of the vector into the host cell
genome or autonomous replication of the vector independent from the
genome.
[0091] More than one copy of the polynucleotide according to the
invention can be inserted into the host cell to increase production
of the gene product. Increasing the copy number of the
polynucleotide can be achieved by integrating at least one
additional copy of the sequence into the host cell genome or by
including an amplifiable marker gene and the polynucleotide
containing an amplified copy of the selectable marker gene, thereby
a cell comprising an additional copy of a polynucleotide may be
screened by culturing in the presence of a suitable selective
agent.
[0092] A preferred vector according to the invention comprises an
artificially synthesized sequence containing several restriction
enzyme recognition sites, which can provide a variety of positions
to be inserted or insertion strategy for exogenous DNA.
[0093] The expression vector according to the invention may be more
preferably selected as a vector for expression in Pichia. The
vector according to the invention is preferably a commercially
available vector for use in Pichia, such as a series of vectors,
pPIC, pPICZ, pAO, pGAP, pGAPZ or the like.
[0094] A cloning vector comprising a polynucleotide according to
the invention may be used to replicate a sufficient number of
target plasmid. Accordingly, the cloning vector according to the
invention has a stronger self-replicating element, such as an
origin of replication and the like. Typically, the cloning vector
according to the invention does not have an expression element.
[0095] Host Cell
[0096] The invention also relates to a recombinant host cell
comprising a polynucleotide according to the invention for
recombinantly producing a polypeptide. A vector comprising a
polynucleotide according to the invention is introduced into a host
cell so that the vector is maintained as a part of the chromosome
or as an extrachromosomal self-replicating vector as described
earlier. The selection of a host cell largely depends on the
polypeptide encoding gene and its source.
[0097] The host cell may be a unicellular microorganism or a
non-unicellular microorganism. Unicellular microorganisms such as
gram positive bacteria include but not limited to, a Bacillus cell,
e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus
brevis, Bacillus megaterium, Bacillus subtilis, Bacillus
licheniformis, Bacillus coagulans, Bacillus stearothermophilus,
Bacillus thuringiensis and the like; or a Streptomyces cell, e.g.,
Streptomyces lividans; or gram negative bacteria such as E. coli
and Pseudomonas sp. In a preferred aspect, the bacterial host is
Bacillus subtilis, E. coli, Bacillus licheniformis, Bacillus
stearothermophilus and E. coli cells.
[0098] The host cell may be a eukaryote, such as a mammalian,
insect, plant, yeast or fungal cell. In a preferred aspect, the
host cell is a eukaryotic cell, as used herein, "eukaryotic"
includes the Ascomycota, Basidiomycota, Chytridiomycota,
Zygomycota, Oomycota and the like.
[0099] In a more preferred aspect, the host cell is a cell of
Ascomycota such as Saccharomyces, Pichia, Yarrowia, Candida and
Komagataella.
[0100] In a most preferred aspect, the host cell is Pichia
pastoris, Saccharomyces cerevisiae, Yarrowia lipolytica and the
like. In another most preferred aspect, the host cell is a Pichia
pastoris cell.
[0101] Production Method
[0102] After obtaining the coding sequence of a polypeptide, a
method may be employed for producing a polypeptide according to the
invention, the method comprising: (a) culturing a host cell
containing an expression vector of the polypeptide under conditions
conducive to production of the polypeptide; and (b) recovering the
polypeptide.
[0103] In production method according to the invention, the cells
may be cultured in a medium suitable for the production of the
polypeptide using methods known in the art. For example, the cells
can be subjected to the shake flask culture in laboratory or
industrial fermentors and small-scale or large-scale fermentation
(including continuous, batch, feed-batch, or solid state
fermentations), and cultured in a suitable medium and conditions
allowing expression and/or separation of the polypeptide. The
cultivation takes place in a suitable media comprising carbon and
nitrogen sources and inorganic salts using methods known in the
art. A suitable media may be obtained from a commercial supplier or
may be prepared according to a published composition. If the
polypeptide is secreted into the medium, the polypeptide can be
recovered directly from the medium. If the polypeptide is not
secreted into the medium, it can be recovered from cell
lysates.
[0104] In certain embodiments, as previously described, the
invention preferably constructs an expression vector of
phospholipase C with serum albumin signal sequence from Homo
sapiens or the killer protein signal sequence from Saccharomyces
cerevisiae as the signal peptide. After introduced into an
expressing strain, the stain is cultured under conditions conducive
to production of phospholipase C and the phospholipase C is
recovered. In certain embodiments, the strain is Pichia pastoris.
The method for cultivation or fermentation of said strain may be a
conventional fermentation method in the art.
[0105] Alternatively, a polypeptide according to the invention may
also be synthesized with a chemical synthesis method known in the
art. Chemical synthesis methods for a polypeptide include
solid-phase synthesis and liquid phase synthesis method, wherein
the solid phase synthesis is commonly used. Solid phase synthesis
methods include, but not limited to two common methods, Fmoc and
tBoc. Typically, resin is used as an insoluble solid support, and
amino acids are typically connected one by one from the C-terminus
(carboxy terminus) to the N-terminus (amino terminus) onto the
peptide chain, each amino acid linkage cycle consists of the
following three steps: 1) deprotection: in a protected amino acid,
the protecting group of the amino acid must be removed using a
de-protecting solvent; 2) activation: the carboxyl group of the
amino acid to be connected is activated by an activator; and 3)
coupling: the activated carboxyl is reacted with the exposed amino
group of the previous amino acid to form a peptide bond. The cycle
is repeated until the peptide chain is extended to a desirable
length. Finally, the connection between the solid support and the
peptide chain is cleaved by cleaving solution, and the desired
amino acid sequence can be obtained. Above chemical synthesis could
be conducted on a program-controlled automated peptide synthesizer,
such instruments include but not limited to Tribute dual-channel
peptide synthesizer from Protein Technologies, UV Online Monitor
System from CS Bio Company, Focus XC three channel synthesizer from
Aapptec and the like.
[0106] The polypeptide described herein may be recovered with a
known method according to the invention. For example, a polypeptide
may be recycled from the media by conventional methods, including
but not limited to, centrifugation, filtration, ultrafiltration,
extraction, chromatography, spray drying, freeze drying,
evaporation, precipitation or the like.
[0107] A polypeptide according to the invention can be purified by
a variety of methods known in the art, including but not limited
to, chromatography (e.g., ion exchange, affinity, hydrophobic,
chromatofocusing, size exclusion), electrophoresis (e.g.,
isoelectric focusing), differential solubility (such as salting-out
precipitation), SDS-PAGE, or extraction method to obtain a
substantially pure polypeptide.
[0108] Properties and Uses of the Polypeptide
[0109] A polypeptide according to the invention has phospholipase C
activity, which may be used for oil refining, phospholipid
modification, feed modifier and various aspects in food industry
and pharmaceutical industry, including but not limited to baking,
detergents, improvement of filtration of aqueous or syrup and the
like.
[0110] A polypeptide according to the invention may be provided in
form of pure enzyme preparation, or in form of a composition. The
composition may be a powdered composition, a liquid composition, or
a pasty composition. When provided in the form of composition, the
composition may contain various excipients according to the
different uses of the enzyme-containing composition. Excipients
known in the art may be added to the compositions according to the
invention, and such excipients include but are not limited to,
sorbitol, potassium sorbate, methyl benzoate, ethyl benzoate,
sucrose, mannitol, trehalose, starch, sodium chloride, calcium
chloride, other stabilizers or one or more other substances.
[0111] The amount of the polypeptide according to the invention
used in the method according to the invention can be practically
determined.
[0112] Enzymatic Degumming
[0113] The invention also provides a method for enzymatic
degumming, the method comprises incubating phospholipase C at a
temperature between 55.degree. C. and 75.degree. C., then adding
phospholipase C to crude oil for degumming.
[0114] As described above, a polypeptide according to the invention
may be used for the enzymatic degumming in oil and fat production.
Accordingly, the invention provides a method of degumming,
comprising adding a polypeptide according to the invention to crude
oil for degumming.
[0115] A polypeptide according to the invention can be directly
added to crude oil to be degummed, and then degumming under
conventional degumming conditions. Alternatively, it is preferred
that the polypeptide according to the invention is incubated at a
temperature between 55.degree. C. and 75.degree. C., preferably at
a temperature between 60.degree. C. and 70.degree. C., then added
to the crude oil for degumming. The incubation time is usually 15
to 45 minutes, preferably 20 to 40 minutes.
[0116] Typically, the crude oil is heated to 50 to 70.degree. C.,
preferably 50 to 60.degree. C., and then added to an incubated or
unincubated enzyme.
[0117] Enzymes are normally added as aqueous solution. Based on the
weight of crude oil, the enzyme is added in an amount of 50 to 1000
ppm, preferably 100 to 500 ppm, more preferably 100 to 300 ppm.
[0118] Degumming conditions typically include: stirring at 50 to
60.degree. C. for 1 to 3 hours, and then heating to 80 to
90.degree. C. for 1 to 10 minutes.
[0119] Another aspect of the invention further provides a method
for improving degumming performance of phospholipase C, the method
comprises the steps of: incubating phospholipase C at a temperature
between 55.degree. C. and 75.degree. C., preferably 60.degree. C.
to 70.degree. C., and then adding it to crude oil for degumming. As
previously described, the phospholipase C may be a polypeptide
according to the invention. The incubation time is usually 15 to 45
minutes, preferably 20 to 40 minutes. Typically, the crude oil is
first heated to 50.degree. C. to 70.degree. C., preferably
50.degree. C. to 60.degree. C., and then into which incubated or
unincubated enzyme is added. The enzyme is normally added in an
aqueous solution. Based on the weight of crude oil, the enzyme is
added in an amount of 50 to 1000 ppm, preferably 100 to 500 ppm,
more preferably 100 to 300 ppm. Degumming conditions typically
comprise: stirring at 50 to 60.degree. C. for 1 to 3 hours, and
then heating to 80 to 90.degree. C. for 1 to 10 minutes.
[0120] Crude oil suitable for the degumming process of the
invention include, but are not limited to soybean oil, sunflower
oil, peanut oil, rapeseed oil, rice bran oil, corn oil, olive oil,
palm oil, palm kernel oil, palm olein, canola oil, castor oil,
coconut oil, coriander oil, cottonseed oil, hazelnut oil, hempseed
oil, linseed oil, mango kernel oil, meadowfoam oil, neat's foot
oil, safflower oil, camellia oil, tall oil, camellia oil and other
vegetable oils.
[0121] The invention would be illustrated with specific examples
hereinafter. Experimental methods with no specific conditions
specified in the examples below, are performed under routine
conditions, such as those in Sambrook et al., "Molecular Cloning: A
Laboratory Manual" (New York: Cold Spring Harbor Laboratory Press
(Cold Spring Harbor Laboratory Press), 1989), or the conditions
recommended by the manufacturer. For usage and dosage of reagents,
unless otherwise specified, they are used in accordance with
conventional usage and dosage.
[0122] Experimental Materials
[0123] 1. Experimental Strains and Plasmids
[0124] Strain: Pichia SMD1168 (Invitrogen, #C175-00), E. coli DH5a
(TAKARA: Catalog #. D9057A).
[0125] Plasmid: pAO815 plasmid (Invitrogen, #V180-20), pAO-PLC
plasmid (constructed by our laboratory), pmAO-PLC plasmid
(constructed by our laboratory).
[0126] 2. Mediums and Solutions
[0127] LB liquid medium: 0.5% yeast extract, 1% tryptone, 1% NaCl,
pH7.0.
[0128] LB solid medium: LB liquid medium with agar at a
concentration of 1.5%.
[0129] YPD liquid medium: 1% yeast extract, 2% peptone, 2%
glucose.
[0130] YPD solid medium: LB liquid medium with agar at a
concentration of 2%.
[0131] MGYS solid medium: 1.34% yeast nitrogen base (YNB)
containing amino acid-free ammonium sulfate, 1% glycerol, 1M
sorbitol, 4.times.10.sup.-5% D-biotin, 2% agar.
[0132] BMM-soybean phospholipid selection medium: 1.34% yeast
nitrogen base (YNB) containing amino acid-free ammonium sulphate,
4.times.10.sup.-5% D-biotin, 0.5% methanol (added after
sterilization), 2% soybean phospholipid emulsion solution, 0.1 M
citric acid-sodium citrate buffer pH 6.6, 2% agar, with
ZnSO.sub.4.7H.sub.2O added.
[0133] 2% soybean phospholipid emulsion: 2 g soybean phospholipid,
100 ml H.sub.2O, homogenized at 8000 rpm using a high speed
homogenizer for 1 min.
[0134] BMGY liquid medium: 1% yeast extract, 2% peptone, 1.34%
yeast nitrogen base (YNB) containing ammonium sulfate without amino
acids, 1% glycerol, 4.times.10.sup.-5% D-biotin, 0.1M phosphate
dihydrate potassium-dipotassium phosphate buffer pH6.0.
[0135] BMMY liquid medium: 1% yeast extract, 2% peptone, 1.34%
yeast nitrogen base (YNB) containing amino acid-free ammonium
sulfate, 0.3% ZnSO.sub.4.7H.sub.2O, 0.5% methanol (added after
sterilization), 4.times.10.sup.-5% D-biotin (added after
sterilization), 0.1M citric acid-sodium citrate buffer at
pH6.6.
[0136] Soybean phospholipid is purchased from Beijing Meryas
Phospholipid Technology Co., FPLA grade
[0137] Yeast extract and tryptone are purchased from OXOID, peptone
and yeast nitrogen base purchased from BD, biotin is purchased from
Shanghai Sangon, ammonium sulfate, citric acid, and sodium citrate
are purchased from Sinopharm, analytical grade.
[0138] Chemicals not specified in the invention are all purchased
from Sinopharm, analytical grade.
[0139] 3. Reagents Used in Molybdenum Blue Assay for PLC
Viability:
[0140] PLC reaction solution: 0.5% soybean phospholipid, 25 mM
citric acid-sodium citrate buffer at pH 6.6, 10 uM ZnSO.sub.4;
[0141] CIAP reaction solution: 50 mM Tris-HCl pH 9.0, 10 mM
MgCl.sub.2, 1 U CIAP (commercially available from TaKaRa
Biotechnology (Dalian) Co., Ltd.);
[0142] Molybdenum blue development reaction solution: 100 ul CIAP
reactant, 0.2% ascorbic acid, 0.1% ammonium molybdate (formulated
with 30% H.sub.2SO.sub.4);
[0143] Modified Bradford protein concentration assay kit (purchased
from Shanghai Sangon Biological Engineering Co., Ltd.);
[0144] Restriction enzyme HindIII, EcoRI (purchased from New
England Biotechnology (Beijing) Ltd.);
[0145] PCR enzyme: TaKaRa Taq, PrimeSTAR.RTM. HS the DNA Polymerase
(purchased from TaKaRa Biotechnology (Dalian) Co., Ltd.);
[0146] T4 DNA ligase (purchased from Fermentas).
[0147] 4. The Primers Used are Listed in Table 1 Below:
TABLE-US-00001 TABLE 1 Primer Name Primer Sequence 5'-3' AmPLC-1
CCGGACGTCGCTAGCAGATCTAACATCCAAAGACG (SEQ ID NO: 11) AmPLC-2
TCATCGTTTCGCCTAGGATCCTTCGAATAATTAGTTG (SEQ ID NO: 12) AmPLC-3
GATCCTAGGCGAAACGATGAGATTTCCTTC (SEQ ID NO: 13) AmPLC-4
CCGGAATTCTTACCTGTCACCGTAAG (SEQ ID NO: 14) AOXH-2
GTTAAAATCAAAACGTTGTCAATTGGAACCAGTCG (SEQ ID NO: 15) AOXH-3
CCAATTGACAACGTTGATTTTAACGACTTTTAACGACAAC (SEQ ID NO: 16) AOX1-5
CGACTGGTTCCAATTGACAACG (SEQ ID NO: 17) AOX1-3
GGCAAATGGCATTCTGACATCCTC (SEQ ID NO: 18) EPPLC-1
CCCAAGCTTGGTCAGCTGAGGAC (SEQ ID NO: 19) EPPLC-2
CCGGAATTCTTACCTGTCACCGTA (SEQ ID NO: 20) 63D-2
CGAAGGTACTGTCATCGTAATAGGGGTTTTCATAATC (SEQ ID NO: 21) 63D-3
CTATTACGATGACAGTACCTTCGCTTCTCAC (SEQ ID NO: 22) DSD-2
ACAGGTCCGTAAAGGATGCGGCATGCATAGGTTGGTTG (SEQ ID NO: 23) DSD-3
CGCATCCTTTACGGACCTGTCCTATCCACAGGGTTTTCAC (SEQ ID NO: 24) 106V-2
GCCTGCTTCACGTCTTTATTCTTGTATGACTCTCC (SEQ ID NO: 25) 106V-3
GAATAAAGACGTGAAGCAGGCCTTCTTTTATC (SEQ ID NO: 26) 56A-2
GGGTTTTCGGCATCAGCAGCGTAGATGCCA (SEQ ID NO: 27) 56A-3
GCTGCTGATGCCGAAAACCCCTATTACGATGAC (SEQ ID NO: 28) 56C-2
GGGTTTTCGCAATCAGCAGCGTAGATGCCA (SEQ ID NO: 29) 56C-3
GCTGCTGATTGCGAAAACCCCTATTACGATGAC (SEQ ID NO: 30) 56D-2
GGGTTTTCGTCATCAGCAGCGTAGATGCCA (SEQ ID NO: 31) 56D-3
GCTGCTGATGACGAAAACCCCTATTACGATGAC (SEQ ID NO: 32) 56E-2
GGGTTTTCCTCATCAGCAGCGTAGATGCCA (SEQ ID NO: 33) 56E-3
GCTGCTGATGAGGAAAACCCCTATTACGATGAC (SEQ ID NO: 34) 56F-2
GGGTTTTCGAAATCAGCAGCGTAGATGCCA (SEQ ID NO: 35) 56F-3
GCTGCTGATTTCGAAAACCCCTATTACGATGAC (SEQ ID NO: 36) 56G-2
GGGTTTTCACCATCAGCAGCGTAGATGCCA (SEQ ID NO: 37) 56G-3
GCTGCTGATGGTGAAAACCCCTATTACGATGAC (SEQ ID NO: 38) 56H-2
GGTTTTCATGATCAGCAGCGTAGATGCCAT (SEQ ID NO: 39) 56H-3
CGCTGCTGATCATGAAAACCCCTATTACGATGAC (SEQ ID NO: 40) 56I-2
GGGTTTTCGATATCAGCAGCGTAGATGCCA (SEQ ID NO: 41) 56I-3
GCTGCTGATATCGAAAACCCCTATTACGATGAC (SEQ ID NO: 42) 56K-2
AGGGGTTTTCCTTATCAGCAGCGTAGATGCCAT (SEQ ID NO: 43) 56K-3
CGCTGCTGATAAGGAAAACCCCTATTACGATGAC (SEQ ID NO: 44) 56L-2
GGGTTTTCCAAATCAGCAGCGTAGATGCCA (SEQ ID NO: 45) 56L-3
GCTGCTGATTTGGAAAACCCCTATTACGATGAC (SEQ ID NO: 46) 56M-2
GGGTTTTCCATATCAGCAGCGTAGATGCCA (SEQ ID NO: 47) 56M-3
GCTGCTGATATGGAAAACCCCTATTACGATGAC (SEQ ID NO: 48) 56N-2
GGTTTTCGTTATCAGCAGCGTAGATGCCAT (SEQ ID NO: 49) 56N-3
CGCTGCTGATAACGAAAACCCCTATTACGATGAC (SEQ ID NO: 50) 56P-2
GGGTTTTCTGGATCAGCAGCGTAGATGCCA (SEQ ID NO: 51) 56P-3
GCTGCTGATCCAGAAAACCCCTATTACGATGAC (SEQ ID NO: 52) 56Q-2
GGGTTTTCTTGATCAGCAGCGTAGATGCCA (SEQ ID NO: 53) 56Q-3
GCTGCTGATCAAGAAAACCCCTATTACGATGAC (SEQ ID NO: 54) 56R-2
AGGGGTTTTCTCTATCAGCAGCGTAGATGCCAT (SEQ ID NO: 55) 56R-3
CGCTGCTGATAGAGAAAACCCCTATTACGATGAC (SEQ ID NO: 56) 56S-2
GGTTTTCAGAATCAGCAGCGTAGATGCCAT (SEQ ID NO: 57) 56S-3
CGCTGCTGATTCTGAAAACCCCTATTACGATGAC (SEQ ID NO: 58) 56T-2
GGGTTTTCGGTATCAGCAGCGTAGATGCCA (SEQ ID NO: 59) 56T-3
GCTGCTGATACCGAAAACCCCTATTACGATGAC (SEQ ID NO: 60) 56V-2
GGGTTTTCGACATCAGCAGCGTAGATGCCA (SEQ ID NO: 61) 56V-3
GCTGCTGATGTCGAAAACCCCTATTACGATGAC (SEQ ID NO: 62) 56W-2
GGGTTTTCCCAATCAGCAGCGTAGATGCCA (SEQ ID NO: 63) 56W-3
GCTGCTGATTGGGAAAACCCCTATTACGATGAC (SEQ ID NO: 64) 20H-2
TATCAATGGCATGGTTCACGATCCATAAGTGAC (SEQ ID NO: 65) 20H-3
GGATCGTGAACCATGCCATTGATATAATGTCTAGG (SEQ ID NO: 66) 83D-2
CTTAGCTTGCTTGTCGAATGGGATATATGTCTTTCCG (SEQ ID NO: 67) 83D-3
ATCCCATTCGACAAGCAAGCTAAGGAGACTG (SEQ ID NO: 68)
Example 1: Construction and Screening of Mutant Library
PLC-N63DN131SN134D
[0148] BC-PC-PLC DNA sequence (SEQ ID NO: 8, its encoded amino acid
sequence is set forth in SEQ ID NO: 9) is designed according to the
mature peptide sequence of Bacillus cereus
phosphatidylcholine-specific phospholipase C (PDB ID: 1AH7) and
Pichia codon preference, which has a factor signal peptide sequence
and a Pichia Kozak sequence fused at its front end, and eventually
.alpha.-BC-PC-PLC DNA sequence (SEQ ID NO: 10) is obtained.
[0149] The .alpha.-BC-PC-PLC DNA sequence is sent to Shanghai
Sangon Biological Co., Ltd. for total gene synthesis to give a
cloning vector pGEM-T-PLC containing .alpha.-BC-PC-PLC DNA
sequence. PLC fragment is amplified by PCR with this vector as the
template, using PrimeSTAR.RTM. HS DNA Polymerase and primer pair
AmPLC-3/AmPLC-4.
[0150] AOX1 promoter fragment (PAOX1) is amplified by PCR with
pPIC-9k expression vector as the template, using PrimeSTAR.RTM. HS
DNA Polymerase and primer pair AmPLC-1/AmPLC-2.
[0151] PAOX1+PLC fusion fragment is obtained by overlap PCR using
primer pair AmPLC-1/AmPLC-4 and PrimeSTAR.RTM. HS DNA Polymerase.
PAOX1+PLC pAO815 fusion fragment is cloned into the vector using
AatII and EcoRI restriction sites to give the expression vector
pAO-PLC.
[0152] pAO-PLC is linearized with SalI, a 8.5 kb fragment is
recovered by gel. Competent cells of Pichia pastoris GS115 strain
is prepared with LiAC method, and then transformed with linearized
pAO-PLC fragment by electroporation. The transformant is plated on
MGYS plates and cultured at 30.degree. C. for 3 days. The
monoclonal colony on the plate is picked into 5 .mu.L sterile
water, of which 0.5 .mu.L is taken and loaded on a BMM-soybean
phospholipid screening plate. After incubation at 30.degree. C. for
3 days, positive clones may be observed with a white precipitating
ring around the thalli, a positive strain is screened and named
PLC-WT.
[0153] A fragment of about 900 bp is obtained by PCR amplification
with pAO-PLC vector as the template, using PrimeSTAR.RTM. HS DNA
Polymerase and primer pair AmPLC-1/AOXH-2. A fragment of about 1.1
kb is obtained by PCR amplification with pAO-PLC vector as the
template, using PrimeSTAR.RTM. HS DNA Polymerase and primer pair
AOXH-3/AmPLC-4, and a fragment of about 1.9 kb is obtained with PCR
amplification by mixing the previous obtained fragments of about
900 bp and about 1.1 kb as the template in the third step of PCR,
using primer pair AmPLC-1/AmPLC-4 and PrimeSTAR.RTM. HS DNA
Polymerase.
[0154] The fragment of about 1.9 kb is cloned into pAO-PLC at AatII
and EcoRI restriction sites to give pmAO-PLC. In pmAO-PLC, a
HindIII restriction site in pAO-PLC is mutated, thereby leaving a
HindIII restriction site only at 5' end of BC-PC-PLC sequence, so
that HindIII and EcoRI may be used to clone BC-PC-PLC mutated
fragment into pmAO-PLC.
[0155] A fragment of about 207 bp is obtained by PCR amplification
with pAO-PLC vector as the template, using PrimeSTAR.RTM. HS DNA
Polymerase and primer pair EPPLC-1/63D-2. A fragment of about 576
bp is obtained by PCR amplification with pAO-PLC vector as the
template, using PrimeSTAR.RTM. HS DNA Polymerase and primer pair
63D-3/EPPLC-2, and a fragment of about 755 bp is obtained with PCR
amplification by mixing the previous obtained fragments of about
207 bp and about 576 bp as the template in the third step of PCR,
using primer pair EPPLC-1/EPPLC-2 and PrimeSTAR.RTM. HS DNA
Polymerase. The 755 bp fragment is cloned into pmAO-PLC by HindIII
and EcoRI restriction sites to give vector pmAO-PLC-N63D.
[0156] A fragment of about 414 bp is obtained by PCR amplification
with pmAO-PLC-N63D vector as the template, using PrimeSTAR.RTM. HS
DNA Polymerase and primer pair EPPLC-1/DSD-2 (sequence in Table 1).
A fragment of about 361 bp is obtained by PCR amplification with
pAO-PLC vector as the template, using PrimeSTAR.RTM. HS DNA
Polymerase and primer pair DSD-3/EPPLC-2 (sequence in Table 1). A
fragment of 755 bp is obtained with PCR amplification by mixing the
previous obtained fragments of 414 bp and 361 bp as the template,
using primer pair EPPLC-1/EPPLC-2 and PrimeSTAR.RTM. HS DNA
Polymerase. The 755 bp fragment is cloned into pmAO-PLC by HindIII
and EcoRI restriction sites to give pmAO-PLC-N63DN131SN134D
vector.
[0157] Error-prone PCR (0.3 mM MnCl.sub.2 is additionally added
during PCR) is performed with pmAO-PLC-N63DN131SN134D vector as the
template, using TaKaRa Taq enzyme and primer pair EPPLC-1/EPPLC-2
to give a collection of mutant amplicons with a size of about 755
bp. The obtained fragment is cloned into pmAO-PLC by HindIII and
EcoRI restriction sites, and the resultant vector is transformed
into E. coli DH5a strain to give a total of 1.times.10.sup.4
BC-PC-PLC mutants.
[0158] 1.times.10.sup.3 PLC-N63DN131SN134D mutant is washed with 2
ml sterile water to 8 ml liquid LB medium (containing 100 .mu.g/ml
ampicillin) and cultured at 37.degree. C. for 4 hours. plasmid is
extracted, linearized with SalI, with a fragment of about 8.5 kb
recovered. Take 500 ng vector (DNA is used in a minimum amount as
possible to ensure that most positive transformants contain a
single copy of PLC gene), the vector is transformed into competent
cells of Pichia pastoris GS115 strain by electrotransformation. The
transformant is plated onto MGYS plates, cultured at 30.degree. C.
for 3 days to obtain PLC-N63DN131SN134D Pichia mutant library. A
single clone is picked from the plate, and plated to a BMM-soybean
phospholipid screening plate. The clone with a large white halo is
selected. The clone is numbered #31.
Example 2: PLC-N63DN131SN134D Mutant Sequence Analysis
[0159] The #31 strain is plated on 3 ml YPD liquid medium, cultured
at 30.degree. C. overnight, and genomic DNA is extracted. PLC DNA
sequence in the #31 strain is obtained by PCR amplification with
#31 strain genomic DNA as the template, using PrimeSTAR.RTM. HS DNA
Polymerase and primer pair AOX1-5/AOX1-3 PCR. The obtained sequence
is sent to the Shanghai Sangon Biological Co., Ltd. for sequencing
with primer pair AOX1-5/AOX1-3. Sequencing results of the PLC DNA
in #31 show two mutated bases, tyrosine at position 56 is mutated
to histidine (TAT.fwdarw.CAT); and methionine at position 106 is
mutated to valine (ATG.fwdarw.GTG). The sequence is set forth in
SEQ ID NO: 3.
Example 3: Construction and Screening of PLC-N63DN131SN134D Single
Point Mutant Pichia Expression Strain
[0160] 1. Construction and Screening of PLC-N63DN131SN134D-Y56H
[0161] A fragment of about 180 bp is obtained by PCR amplification
with pmAO-PLC-N63DN131SN134D vector as the template, using
PrimeSTAR.RTM. HS DNA Polymerase and primer pair EPPLC-1/56H-2. A
fragment of about 570 bp is obtained by PCR amplification with
pmAO-PLC-N63DN131SN134D vector as the template, using
PrimeSTAR.RTM. HS DNA Polymerase and primer pair 56H-3/EPPLC-2. A
fragment of about 755 bp is obtained with PCR amplification by
mixing thepreviously obtained two-step PCR fragments of about 180
bp and about 570 bp as the template in a third step, using primer
pair EPPLC-1/EPPLC-2 and PrimeSTAR.RTM. HS DNA Polymerase.
[0162] The fragment of about 755 bp is cloned into pmAO-PLC by
HindIII and EcoRI restriction sites to give
pmAO-PLC-N63DN131SN134D-Y56H vector. The
pmAO-PLC-N63DN131SN134D-Y56H is linearized with SalI, an 8.5 kb
fragment is obtained by gel recovery. Competent cells of Pichia
yeast strain SMD1168 are prepared by LiAC method, and then 500 ng
linearized pmAO-PLC-N63DN131SN134D-Y56H is transformed into the
competent cells of SMD1168 by electroporation. The transformant is
plated onto MGYS plates and cultured at 30.degree. C. for 3 days. A
single clone is picked on the plate, and plated to a BMM-soybean
phospholipid screening plate. The clone with a large white halo is
selected.
[0163] 2. Construction and Screening of
PLC-N63DN131SN134D-M106V
[0164] A fragment of about 320 bp is obtained by PCR amplification
with pmAO-PLC-N63DN131SN134D vector as the template, using
PrimeSTAR.RTM. HS DNA Polymerase and primer pair EPPLC-1/106V-2. A
fragment of about 440 bp is obtained by PCR amplification with
pmAO-PLC-N63DN131SN134D vector as the template, using
PrimeSTAR.RTM. HS DNA Polymerase and primer pair 106V-3/EPPLC-2.
Then a fragment of about 755 bp is obtained by PCR amplification
with the fragments of about 320 bp and about 440 bp obtained in the
previous two-step PCR mixed as the template for PCR in a third
step, using primer pair EPPLC-1/EPPLC-2 and PrimeSTAR.RTM. HS DNA
Polymerase.
[0165] The fragment of about 755 bp is cloned into pmAO-PLC by
HindIII and EcoRI restriction sites to give
pmAO-PLC-N63DN131SN134D-M106V vector. pmAO-PLC-N63DN131SN134D-M106V
is linearized with SalI, a 8.5 kb fragment is obtained by gel
recovery. Competent cells of Pichia yeast strain SMD1168 is
prepared by LiAC method, then 500 ng linearized
pmAO-PLC-N63DN131SN134D-M106V is transformed into the competent
cells of SMD1168 by electroporation. The transformant is plated
onto MGYS plates and cultured at 30.degree. C. for 3 days. A single
clone is picked on the plate, and plated to a BMM-soybean
phospholipid screening plate. The clone with a large white halo is
selected.
[0166] 3. Construction and Screening of
PLC-N63DN131SN134D-Y56HM106V
[0167] A fragment of about 755 bp is obtained by PCR amplification
with #31 strain genomic DNA as the template, using PrimeSTAR.RTM.
HS DNA Polymerase and primer pair EPPLC-1/EPPLC-2. The fragment of
about 755 bp is cloned into pmAO-PLC by HindIII and EcoRI
restriction sites to give pmAO-N63DN131SN134D-Y56HM106V vector.
pmAO-7-7PLC-106M is linearized with SalI, a 8.5 kb fragment is
obtained by gel recovery. Competent cells of Pichia yeast strain
SMD1168 is prepared by LiAC method, and then 500 ng linearized
pmAO-N63DN131SN134D-Y56HM106V is transformed into competent cells
of SMD1168 by electroporation. The transformant is plated onto MGYS
plates and cultured at 30.degree. C. for 3 days. A single clone is
picked on the plate, and plated to a BMM-soybean phospholipid
screening plate. The clone with a large white halo is selected.
[0168] As shown in FIG. 1, when the size of white halos on the
BMM-soybean phospholipid screening plate for three mutants
PLC-N63DN131SN134D-Y56H, PLC-N63DN131SN134D-M106V and
PLC-N63DN131SN134D-Y56HM106V is compared, it is found that
PLC-N63DN131SN134D-Y56H and PLC-N63DN131SN134D-Y56HM106V have a
comparative size of white halo, and PLC-N63DN131SN134D-M106V has a
size of white halo significantly smaller than
PLC-N63DN131SN134D-Y56H and PLC-N63DN131SN134D-Y56HM106V,
indicating that Y56H mutation further improves the activity of the
mutant and Y56H is a critical mutation site.
Example 4: Saturation Mutation of Amino Acid at Position 56 of
PLC-N63DN131SN134D
[0169] The tyrosine at position 56 of PLC-N63DN131SN134D is mutated
to alanine (A), cysteine (C), aspartic acid (D), glutamic acid (E),
phenylalanine (F), glycine (G), histidine (H), isoleucine (the I),
lysine (K), leucine (L), methionine (M), asparagine (N), proline
(P), glutamine (Q), arginine (R), threonine (T), valine (V) and
tryptophan (W), respectively.
[0170] Briefly, a fragment of about 180 bp is obtained by PCR
amplification with pmAO-PLC-N63DN131SN134D vector as the template,
using PrimeSTAR.RTM. HS DNA Polymerase and primer pair
EPPLC-1/56X-2 (X refers to the one-letter abbreviation of above 18
amino acids). A fragment of about 570 bp is obtained by PCR
amplification with pmAO-PLC-N63DN131SN134D vector as the template,
using PrimeSTAR.RTM. HS DNA Polymerase and primer pair
56X-3/EPPLC-2. A fragment of about 755 bp is obtained by PCR
amplification with the mixed previously obtained two-step PCR
fragments of about 180 bp and about 570 bp as the template in a
third step, using primer pair EPPLC-1/EPPLC-2 and PrimeSTAR.RTM. HS
DNA Polymerase.
[0171] The 18 resultant fragments about 755 bp are cloned into
pmAO-PLC by HindIII and EcoRI restriction sites, respectively, to
obtain 18 pmAO-7-7PLC-Y56X vectors, which are linearized with SalI,
and an 8.5 kb fragment is obtained by gel recovery. Competent cells
of Pichia yeast strain SMD1168 is prepared by LiAC method, and then
500 ng of each one of the 18 linearized
pmAO-PLC-N63DN131SN134D-Y56X is transformed into the competent
cells of SMD1168 by electroporation. The transformant is plated
onto MGYS plates and cultured at 30.degree. C. for 3 days. A single
clone is picked on the plate, and plated to a BMM-soybean
phospholipid screening plate. The clone with a large white halo is
selected.
[0172] PLC-WT, PLC-N63DN131SN134D and PLC-N63DN131SN134D strains
with saturation mutation at position 56 are picked and first
activated in liquid YPD, and then inoculated into BMGY medium and
subjected to 220 rpm shaking at 30.degree. C. overnight. The
culture is transferred to BMMY medium with an initial OD600 of
6.
[0173] First, induction is performed with 2% methanol, supplemented
with 1% methanol after 24 h and 32 h, supplemented with 1% methanol
after 48 h and 56 h, and sampled at 72 h. The obtained samples are
ultrafiltration desalted and concentrated 20-fold using a
ultrafiltration device with a molecular weight cutoff of 10 kDa.
The treated samples are added to a buffer (20 mM citric acid-sodium
citrate buffer (pH 6.6), 10 uM ZnSO.sub.4).
[0174] 1 .mu.l of fermentation broth is added to 190 .mu.l of PLC
reaction solution (containing 0.5% soybean phospholipid, 25 mM
citric acid-sodium citrate buffer solution pH 6.6, 10 uM
ZnSO.sub.4) and incubated with shaking at 45.degree. C. for 30
minutes. After incubation, 100 .mu.l of chloroform is added
followed by oscillation mixing, centrifugation at 12000 rpm for 2
minutes. 80 .mu.l of supernatant is taken and 20 .mu.l of CIAP
reaction solution (containing 50 mM Tris-HCl pH 9.0, 10 mM
MgCl.sub.2, 1 U CIAP) is added and incubated at 37.degree. C. for 1
h.
[0175] After incubation, 100 .mu.l reaction is taken, and 900 .mu.l
of molybdenum blue development solution (containing 0.2% ascorbic
acid, 0.1% ammonium molybdate) is added and incubated with shaking
at 37.degree. C. for 10 minutes. Absorbance of the samples at a
wavelength of 700 nm is measured and calculated to obtain PLC
activity of each broth sample. The protein concentration in the
fermentation broth of PLC-N63DN131SN134D and PLC-N63DN131SN134D
strains with saturation mutation at position 56 is determined using
the Bradford reagent to obtain the specific enzyme activity. As
shown in FIG. 2, the specific enzyme activities of
PLC-N63DN131SN134D-Y56H and PLC-N63DN131SN134D-Y56W have a 7-fold
and 5-fold increase compared to that of PLC-N63DN131SN134D,
respectively.
Example 5: PLC-N63DN131SN134D-Y56H Degumming Test
[0176] 100 g of soybean crude oil is taken and heated to 55.degree.
C., 200 ppm of PLC-WT, PLC-N63DN131SN134D sample and
PLC-N63DN131SN134D-Y56H are added to obtain 3% aqueous phase in the
system, high sheared using high-speed shearing machine (10000
r/min) for 1 minute, and the reaction is stirred (750 r/min) at
55.degree. C. for 2 h and heated to 85.degree. C. for 5 min. The
samples are centrifuged at 12000 rpm for 10 min, approximately 10 g
of the upper oil sample is taken and the DAG content thereof is
detected by HPLC (determined by the method of AOCS Cd 11d-96(09)).
The DAG increase for PLC-N63DN131SN134D sample and
PLC-N63DN131SN134D-Y56H compared to crude oil is shown in FIG. 3,
and the DAG increase for PLC-N63DN131SN134D-Y56H is 1.5 times of
the PLC-N63DN131SN134D.
Example 6: Mutated Sequence and its Activity
[0177] A fragment of about 78 bp is obtained by PCR amplification
with pmAO-PLC-N63DN131SN134D vector as the template, using
PrimeSTAR.RTM. HS DNA Polymerase and primer pair EPPLC-1/20H-2. A
fragment of about 707 bp is obtained by PCR amplification with
pmAO-PLC-N63DN131SN134D vector as the template, using
PrimeSTAR.RTM. HS DNA Polymerase and primer pair 20H-3/EPPLC-2. A
fragment of about 755 bp is obtained by PCR amplification with the
previously obtained two-step PCR fragments of about 78 bp and about
707 bp mixed as the template in a third step, using primer pair
EPPLC-1/EPPLC-2 and PrimeSTAR.RTM. HS DNA Polymerase.
[0178] The fragment of about 755 bp is cloned into pmAO-PLC by
HindIII and EcoRI restriction sites to give
pmAO-PLC-N63DN131SN134D-R20H vector. pmAO-PLC-N63DN131SN134D-R20H
is linearized with SalI, and a 8.5 kb fragment is obtained by gel
recovery. Competent cells of Pichia yeast strain SMD1168 is
prepared by LiAC method, and then 500 ng linearized
pmAO-PLC-N63DN131SN134D-R20H is transformed into the competent
cells of SMD1168 by electroporation. The transformant is plated
onto MGYS plates and cultured at 30.degree. C. for 3 days. A single
clone is picked on the plate, and plated to a BMM-soybean
phospholipid screening plate. The clone with a large white halo is
selected as PLC-N63DN131SN134D-R20H.
[0179] A fragment of about 266 bp is obtained by PCR amplification
with pmAO-PLC-N63DN131SN134D vector as the template, using
PrimeSTAR.RTM. HS DNA Polymerase and primer pair EPPLC-1/83D-2. A
fragment of about 520 bp is obtained by PCR amplification with
pmAO-PLC-N63DN131SN134D vector as the template, using
PrimeSTAR.RTM. HS DNA Polymerase and primer pair 83D-3/EPPLC-2. A
fragment of about 755 bp is obtained by PCR amplification with the
previously obtained two-step PCR fragments of about 266 bp and
about 520 bp mixed as the template in a third step, using primer
pair EPPLC-1/EPPLC-2 and PrimeSTAR.RTM. HS DNA Polymerase.
[0180] The fragment of about 755 bp is cloned into pmAO-PLC by
HindIII and EcoRI restriction sites to give
pmAO-PLC-N63DN131SN134D-A83D vector. pmAO-PLC-N63DN131SN134D-A83D
is linearized with SalI, and a 8.5 kb fragment is obtained by gel
recovery. Competent cells of Pichia yeast strain SMD1168 is
prepared by LiAC method, and then 500 ng linearized
pmAO-PLC-N63DN131SN134D-A83D is transformed into the competent
cells of SMD1168 by electroporation. The transformant is plated
onto MGYS plates and cultured at 30.degree. C. for 3 days. A single
clone is picked on the plate, and plated to a BMM-soybean
phospholipid screening plate. The clone with a large white halo is
selected as PLC-N63DN131SN134D-A83D.
[0181] PLC-N63DN131SN134D, PLC-N63DN131SN134D-R20H and
PLC-N63DN131SN134D-A83D strains are taken and first activated in
liquid YPD, and then inoculated into BMGY medium and subjected to
220 rpm shaking at 30.degree. C. overnight. The culture is
transferred to BMMY medium with an initial OD600 of 6.
[0182] First, induction is performed with 2% methanol, supplemented
with 1% methanol after 24 h and 32 h, supplemented with 1% methanol
after 48 h and 56 h, and sampled at 72 h. Obtained samples are
ultrafiltration desalted and concentrated 20-fold using an
ultrafiltration device with a molecular weight cutoff of 10 kDa.
The treated samples are added to a buffer (20 mM citric acid-sodium
citrate buffer (pH 6.6), 10 uM ZnSO.sub.4).
[0183] 1 .mu.l of fermentation broth is added to 190 .mu.l of PLC
reaction solution (containing 0.5% soybean phospholipid, 25 mM
citric acid-sodium citrate buffer solution pH 6.6, 10 uM
ZnSO.sub.4) and incubated with shaking at 45.degree. C. for 30
minutes. After incubation, 100 .mu.l of chloroform is added
followed by oscillation mixing, centrifugation at 12000 rpm for 2
minutes. 80 .mu.l supernatant is taken and 20 .mu.l CIAP reaction
solution (containing 50 mM Tris-HCl pH 9.0, 10 mM MgCl.sub.2, 1 U
CIAP) is added and incubated at 37.degree. C. for 1 h.
[0184] After incubation, 100 .mu.l reaction is taken, and 900 .mu.l
molybdenum blue development solution (containing 0.2% ascorbic
acid, 0.1% ammonium molybdate) is added and incubated with shaking
at 37.degree. C. for 10 minutes. Absorbance of the samples at a
wavelength of 700 nm is measured and calculated to obtain PLC
activity of each broth sample. The protein concentration in the
fermentation broth of PLC-N63DN131SN134D, PLC-N63DN131SN134D-R20H
and PLC-N63DN131SN134D-A83D is determined using the Bradford
reagent to obtain the specific enzyme activity. There is no
significant difference among these three in terms of specific
enzyme activity.
Example 7
[0185] 100 g of Soybean crude oil is taken and heated to 55.degree.
C.; samples of phospholipase C (one of SEQ ID SEQ ID NO: 7, wherein
Xaa is His) are diluted by 100-fold; 1 ml water and 2 ml diluted
phospholipase C samples are added (3% water addition, enzyme is
added in 200 ppm); high shear (10000 r/min) for 1 minute; stirred
at 55.degree. C. (750 r/min) for 2 hours; heated to 85.degree. C.
for 5 min; and centrifuged at 12000 rpm for 10 minutes,
approximately 10 g of the upper layer of oil samples is taken and
its DAG content is detected (detection method: AOCS Official method
Cd 11d-96). After calculation, the increase .DELTA.DAG of
diglyceride in the degummed soybean oil is 1.02%.
Example 8
[0186] Samples of phospholipase C (one of SEQ ID NO: 7, wherein Xaa
is His) are diluted 10-fold and placed in a water bath at
50.degree. C. for 0.5 hour.
[0187] 100 g of Soybean crude oil is taken and heated to 55.degree.
C.; samples of phospholipase C are diluted by 10-fold; 1 ml water
and 2 ml diluted phospholipase C samples are added (3% water
addition, enzyme is added in 200 ppm); high shear (10000 r/min) for
1 minute; stirred at 55.degree. C. (750 r/min) for 2 hours; heated
to 85.degree. C. for 5 min; and centrifuged at 12000 rpm for 10
minutes, approximately 10 g of the upper layer of oil samples is
taken and its DAG content is detected (detection method: AOCS
Official method Cd 11d-96). After calculation, the increase
.DELTA.DAG of diglyceride in the degummed soybean oil is 1.02%.
Example 9
[0188] Samples of phospholipase C (one of SEQ ID NO: 7, wherein Xaa
is His) are diluted 10-fold and placed in a water bath at
60.degree. C. for 0.5 hour.
[0189] 100 g of Soybean crude oil is taken and heated to 55.degree.
C.; samples of phospholipase C are diluted by 10-fold; 1 ml water
and 2 ml diluted phospholipase C samples are added (3% water
addition, enzyme is added in 200 ppm); high shear (10000 r/min) for
1 minute; stirred at 55.degree. C. (750 r/min) for 2 hours; heated
to 85.degree. C. for 5 min; and centrifuged at 12000 rpm for 10
minutes, approximately 10 g of the upper layer of oil samples is
taken and its DAG content is detected (detection method: AOCS
Official method Cd 11d-96). After calculation, the increase
.DELTA.DAG of diglyceride in the degummed soybean oil is 1.06%.
Example 10
[0190] Samples of phospholipase C (one of SEQ ID NO SEQ ID NO: 7,
wherein Xaa is His) are diluted 10-fold and placed in a water bath
at 70.degree. C. for 0.5 hour.
[0191] 100 g of Soybean crude oil is taken and heated to 55.degree.
C.; samples of phospholipase C are diluted by 10-fold; 1 ml water
and 2 ml diluted phospholipase C samples are added (3% water
addition, enzyme is added in 200 ppm); high shear (10000 r/min) for
1 minute; stirred at 55.degree. C. (750 r/min) for 2 hours; heated
to 85.degree. C. for 5 min; and centrifuged at 12000 rpm for 10
minutes, approximately 10 g of the upper layer of oil samples is
taken and its DAG content is detected (detection method: AOCS
Official method Cd 11d-96). After calculation, the increase
.DELTA.DAG of diglyceride in the degummed soybean oil is 1.11%.
Example 11
[0192] Samples of phospholipase C (one of SEQ ID NO SEQ ID NO: 7,
wherein Xaa is His) are diluted 10-fold and placed in a water bath
at 80.degree. C. for 0.5 hour.
[0193] 100 g of Soybean crude oil is taken and heated to 55.degree.
C.; samples of phospholipase C are diluted by 10-fold; 1 ml water
and 2 ml diluted phospholipase C samples are added (3% water
addition, enzyme is added in 200 ppm); high shear (10000 r/min) for
1 minute; stirred at 55.degree. C. (750 r/min) for 2 hours; heated
to 85.degree. C. for 5 min; and centrifuged at 12000 rpm for 10
minutes, approximately 10 g of the upper layer of oil samples is
taken and its DAG content is detected (detection method: AOCS
Official method Cd 11d-96). After calculation, the increase
.DELTA.DAG of diglyceride in the degummed soybean oil is 0.73%.
Example 12: Construction of pAO-PLC
[0194] A fragment of about 750 bp is obtained by PCR amplification
with BC-PC-PLC gene (which encodes the amino acid sequence as set
forth in SEQ ID NO: 4) as the template, using PrimeSTAR.RTM. HS DNA
Polymerase and primer pair PLC-F/PLC-R (Table 2 below). The
fragment of about 750 bp is cloned into pAO-PLC by HindIII and
EcoRI restriction sites to give vector pAO-PLC.
Example 13: Obtaining Albumin Signal Sequence from Homo sapiens and
Killer Protein Signal Sequence from Saccharomyces cerevisiae
[0195] The nucleotide sequence and amino acid sequence of albumin
signal sequence from Homo sapiens are:
TABLE-US-00002 (SEQ ID NO: 69)
ATGAAGTGGGTTACCTTTATCTCTTTGTTGTTTCTTTTCTCTTCT GCTTACTCT and (SEQ ID
NO: 70) MKWVTFISLLFLFSSAYS.
[0196] The nucleotide sequence and amino acid sequence of killer
protein signal sequence from Saccharomyces cerevisiae are:
TABLE-US-00003 (SEQ ID NO: 71)
ATGACTAAGCCAACCCAAGTATTAGTTAGATCCGTCAGTATATTA
TTTTTCATCACATTACTACATCTAGTCGTAGCT and (SEQ ID NO: 72)
MTKPTQVLVRSVSILFFITLLHLVVA.
[0197] With pAO-PLC gene as the template, PrimeSTAR.RTM. HS DNA
Polymerase enzyme and primer pair (see Table 2) are used, with the
primers for albumin signal peptide are: S4-1F, S4-2F, S4-3F,
S4-4F/PLC-R, and the primers for killer protein signal sequence
are: S7-1F, S7-2F, S7-3F, S7-4F, S7-5F/PLC. Using overlap PCR, a
signal peptide fusion fragment BC-PC-PLC gene is obtained (with
AvrII, EcoRI restriction sites added at both ends).
TABLE-US-00004 TABLE 2 Primer sequence for signal peptide (SEQ ID
NOs: 73-83) Primer Name Sequence S4-1F
GCGCCTAGGCCGCGGCGAAACGATGAAGTGGGTTACCT S4-2F
CGATGAAGTGGGTTACCTTTATCTCTTTGTTGTTTCT S4-3F
TTATCTCTTTGTTGTTTCTTTTCTCTTCTGCTTACTC S4-4F
TTTCTCTTCTGCTTACTCTGCTCCAGTCAACACTACA S7-1F
GCGCCTAGGCCGCGGCGAAACGATGACTAAGCCAACCC S7-2F
CGATGACTAAGCCAACCCAAGTATTAGTTAGATCCGTC S7-3F
GTATTAGTTAGATCCGTCAGTATATTATTTTTCATCAC S7-4F
TATATTATTTTTCATCACATTACTACATCTAGTCGTAG S7-5F
TACTACATCTAGTCGTAGCTGCTCCAGTCAACACTACA PLC-F
CTGAAGCTTGGTCAGCTGAGGACAAGCAT PLC-R
CCGGAATTCTTACCTGTCACCGTAAGTGTCGAACCATA
Example 14: Construction and Screening of Pichia pastoris
Expression Strains of which the Expression is Driven by Three
Different Signal Peptides
[0198] 1. Construction and Screening of pAO-PLC
[0199] pAO-PLC vector is constructed as Example 12. pAO-PLC is
linearized with SalI, a 8.5 kb fragment is obtained by gel
recovery. Competent cells of Pichia yeast strain SMD1168 are
prepared by LiAC method, and then 500 ng linearized pAO-PLC is
transformed into the competent cells of SMD1168 by electroporation.
The transformant is plated onto MGYS plates and cultured at
30.degree. C. for 3 days. A single colony picked on the plate, and
plated to a BMM-soybean phospholipid screening plate. The clone
with a large white halo is selected to obtain a strain wherein
expression of phospholipase C is driven by .alpha.-mating factor
signal peptide (having a nucleotide sequence as position 8 to 64 of
SEQ ID NO: 64).
[0200] 2. Construction and Screening of pAO4-PLC
[0201] A fragment of about 750 bp is obtained by overlap PCR
amplification with pAO-PLC vector as the template, using
PrimeSTAR.RTM. HS DNA Polymerase and primer pair S4-1F, S4-2F,
S4-3F, S4-4F/PLC-R, amplified by overlap PCR. The fragment is a
fragment of albumin signal sequence from Homo sapiens fused with
BC-PC-PLC gene (with AvrII, EcoRI restriction sites added at both
ends).
[0202] This fragment is cloned into pAO815 by EcoRI and AvrII
restriction sites to give pAO4-PLC vector. pAO4-PLC is linearized
with SalI, a 8.5 kb fragment is obtained by gel recovery. Competent
cells of Pichia yeast strain SMD1168 are prepared by LiAC method,
and then 500 ng linearized pAO4-PLC is transformed into the
competent cells of SMD1168 by electroporation. The transformant is
plated onto MGYS plates and cultured at 30.degree. C. for 3 days. A
single clone is picked on the plate, and plated to a BMM-soybean
phospholipid screening plate. The clone with a large white halo is
selected to obtain a strain wherein expression of phospholipase C
is derived by albumin signal sequence from Homo sapiens.
[0203] 3. Construction and Screening of pAO7-PLC
[0204] A fragment of about 750 bp is obtained by overlap PCR
amplification with pAO-PLC vector as the template, PrimeSTAR.RTM.
HS DNA Polymerase and primer pair S7-1F, S7-2F, S7-3F, S7-4F,
S7-5F/PLC, the fragment is a fragment of killer protein signal
sequence from Saccharomyces cerevisiae fused with BC-PC-PLC gene
(with AvrII, EcoRI restriction sites added at both ends).
[0205] This fragment is cloned into pAO-815 by EcoRI and AvrII
restriction sites to give pAO7-PLC vector. pAO7-PLC is linearized
with SalI, a 8.5 kb fragment is obtained by gel recovery. Competent
cells of Pichia yeast strain SMD1168 are prepared by LiAC method,
and then 500 ng linearized pAO7-PLC is transformed into the
competent cells of SMD1168 by electroporation. The transformant is
plated onto MGYS plates and cultured at 30.degree. C. for 3 days. A
single clone is picked on the plate, and plated to a BMM-soybean
phospholipid screening plate. The clone with a large white halo is
selected to obtain a strain wherein expression of phospholipase C
is driven by killer protein signal sequence from Saccharomyces
cerevisiae.
Example 15: Fermantion of Pichia pastoris Expression Strains of
which the Expression is Driven by Three Different Signal Peptides
and Detection of Enzymatic Activity Thereof
[0206] Strains of which the expression is driven by three different
signal peptides are taken, activated in liquid YPD, and then
inoculated into BMGY medium and subjected to 220 rpm shaking at
30.degree. C. overnight. The culture is transferred to BMMY medium
with an initial OD600 of 6. Induction is performed with 2%
methanol, supplemented with 1% methanol after 24 h and 32 h,
supplemented with 1% methanol after 48 h and 56 h, and sampled at
72 h. Obtained samples are ultrafiltration desalted and
concentrated 20-fold using a ultrafiltration device with a
molecular weight cutoff of 10 kDa. The treated samples are added to
a buffer (20 mM citric acid-sodium citrate buffer (pH 6.6), 10 uM
ZnSO.sub.4). 1 .mu.l of fermentation broth is added to 190 .mu.l of
PLC reaction solution (containing 0.5% soybean phospholipid, 25 mM
citric acid-sodium citrate buffer solution pH 6.6, 10 uM
ZnSO.sub.4) and incubated with shaking at 45.degree. C. for 30
minutes. After incubation, 100 .mu.l of chloroform is added
followed by oscillation mixing, centrifugation at 12000 rpm for 2
minutes. 80 .mu.l of supernatant is taken and 20 .mu.l of CIAP
reaction solution (containing 50 mM Tris-HCl pH 9.0, 10 mM
MgCl.sub.2, 1 U CIAP) is added and incubated at 37.degree. C. for 1
h. After incubation, 100 .mu.l reaction is taken, and 900 .mu.l of
molybdenum blue development solution (containing 0.2% ascorbic
acid, 0.1% ammonium molybdate) is added and incubated with shaking
at 37.degree. C. for 10 minutes. Absorbance of the samples at a
wavelength of 700 nm is measured and calculated to obtain PLC
activity of each broth sample. The concentration of the protein of
interest is detected by SDS-PAGE electrophoretogram.
[0207] The results are shown in FIGS. 5 and 6. The amount of
BC-PC-PLC expression in Pichia driven by albumin signal sequence
from Homo sapiens and killer protein signal sequence from
Saccharomyces cerevisiae is 52% and 41% higher than that by
.alpha.-mating factor signal sequence, respectively.
Sequence CWU 1
1
831738DNAArtificial SequenceSynthetic - Nucleotide sequence of
mutant PLC-N63DN131SN134D 1tggtcagctg aggacaagca taaggaaggt
gtgaatagtc acttatggat cgtgaaccgt 60gccattgata taatgtctag gaatacaact
ctggttaagc aagatagagt tgctcaattg 120aatgaatggc gtacagagct
agagaatggc atctacgctg ctgattatga aaacccctat 180tacgatgaca
gtaccttcgc ttctcacttt tacgatccag acaacggaaa gacatatatc
240ccattcgcca agcaagctaa ggagactgga gctaagtact tcaagttggc
tggagagtca 300tacaagaata aagacatgaa gcaggccttc ttttatcttg
ggttgtcatt gcattatttg 360ggcgatgtca accaacctat gcatgccgca
tcctttacgg acctgtccta tccacagggt 420tttcactcca agtacgagaa
ctttgtcgat actattaaag acaactacaa agttaccgat 480gggaacggat
attggaattg gaaaggcacc aaccctgaag aatggattca cggtgcagca
540gtagttgcaa aacaggacta ctctggaatt gtcaatgaca ataccaaaga
ttggtttgtg 600aaagccgcag tctcccagga atatgcagat aaatggagag
ctgaagttac acctatgact 660ggtaaacgac taatggatgc ccaaagagtt
actgctggtt acattcaatt atggttcgac 720acttacggtg acaggtaa
7382245PRTArtificial SequenceSynthetic - Amino acid sequence of
mutant PLC-N63DN131SN134D 2Trp Ser Ala Glu Asp Lys His Lys Glu Gly
Val Asn Ser His Leu Trp 1 5 10 15 Ile Val Asn Arg Ala Ile Asp Ile
Met Ser Arg Asn Thr Thr Leu Val 20 25 30 Lys Gln Asp Arg Val Ala
Gln Leu Asn Glu Trp Arg Thr Glu Leu Glu 35 40 45 Asn Gly Ile Tyr
Ala Ala Asp Tyr Glu Asn Pro Tyr Tyr Asp Asp Ser 50 55 60 Thr Phe
Ala Ser His Phe Tyr Asp Pro Asp Asn Gly Lys Thr Tyr Ile 65 70 75 80
Pro Phe Ala Lys Gln Ala Lys Glu Thr Gly Ala Lys Tyr Phe Lys Leu 85
90 95 Ala Gly Glu Ser Tyr Lys Asn Lys Asp Met Lys Gln Ala Phe Phe
Tyr 100 105 110 Leu Gly Leu Ser Leu His Tyr Leu Gly Asp Val Asn Gln
Pro Met His 115 120 125 Ala Ala Ser Phe Thr Asp Leu Ser Tyr Pro Gln
Gly Phe His Ser Lys 130 135 140 Tyr Glu Asn Phe Val Asp Thr Ile Lys
Asp Asn Tyr Lys Val Thr Asp 145 150 155 160 Gly Asn Gly Tyr Trp Asn
Trp Lys Gly Thr Asn Pro Glu Glu Trp Ile 165 170 175 His Gly Ala Ala
Val Val Ala Lys Gln Asp Tyr Ser Gly Ile Val Asn 180 185 190 Asp Asn
Thr Lys Asp Trp Phe Val Lys Ala Ala Val Ser Gln Glu Tyr 195 200 205
Ala Asp Lys Trp Arg Ala Glu Val Thr Pro Met Thr Gly Lys Arg Leu 210
215 220 Met Asp Ala Gln Arg Val Thr Ala Gly Tyr Ile Gln Leu Trp Phe
Asp 225 230 235 240 Thr Tyr Gly Asp Arg 245 3738DNAArtificial
SequenceSynthetic -Coding sequence of mutant
PLC-N63DN131SN134D-Y56H 3tggtcagctg aggacaagca taaggaaggt
gtgaatagtc acttatggat cgtgaaccgt 60gccattgata taatgtctag gaatacaact
ctggttaagc aagatagagt tgctcaattg 120aatgaatggc gtacagagct
agagaatggc atctacgctg ctgatcatga aaacccctat 180tacgatgaca
gtaccttcgc ttctcacttt tacgatccag acaacggaaa gacatatatc
240ccattcgcca agcaagctaa ggagactgga gctaagtact tcaagttggc
tggagagtca 300tacaagaata aagacatgaa gcaggccttc ttttatcttg
ggttgtcatt gcattatttg 360ggcgatgtca accaacctat gcatgccgca
tcctttacgg acctgtccta tccacagggt 420tttcactcca agtacgagaa
ctttgtcgat actattaaag acaactacaa agttaccgat 480gggaacggat
attggaattg gaaaggcacc aaccctgaag aatggattca cggtgcagca
540gtagttgcaa aacaggacta ctctggaatt gtcaatgaca ataccaaaga
ttggtttgtg 600aaagccgcag tctcccagga atatgcagat aaatggagag
ctgaagttac acctatgact 660ggtaaacgac taatggatgc ccaaagagtt
actgctggtt acattcaatt atggttcgac 720acttacggtg acaggtaa
7384245PRTArtificial SequenceSynthetic - Amino acid sequence of
mutant PLC-N63DN131SN134D-Y56H 4Trp Ser Ala Glu Asp Lys His Lys Glu
Gly Val Asn Ser His Leu Trp 1 5 10 15 Ile Val Asn Arg Ala Ile Asp
Ile Met Ser Arg Asn Thr Thr Leu Val 20 25 30 Lys Gln Asp Arg Val
Ala Gln Leu Asn Glu Trp Arg Thr Glu Leu Glu 35 40 45 Asn Gly Ile
Tyr Ala Ala Asp His Glu Asn Pro Tyr Tyr Asp Asp Ser 50 55 60 Thr
Phe Ala Ser His Phe Tyr Asp Pro Asp Asn Gly Lys Thr Tyr Ile 65 70
75 80 Pro Phe Ala Lys Gln Ala Lys Glu Thr Gly Ala Lys Tyr Phe Lys
Leu 85 90 95 Ala Gly Glu Ser Tyr Lys Asn Lys Asp Met Lys Gln Ala
Phe Phe Tyr 100 105 110 Leu Gly Leu Ser Leu His Tyr Leu Gly Asp Val
Asn Gln Pro Met His 115 120 125 Ala Ala Ser Phe Thr Asp Leu Ser Tyr
Pro Gln Gly Phe His Ser Lys 130 135 140 Tyr Glu Asn Phe Val Asp Thr
Ile Lys Asp Asn Tyr Lys Val Thr Asp 145 150 155 160 Gly Asn Gly Tyr
Trp Asn Trp Lys Gly Thr Asn Pro Glu Glu Trp Ile 165 170 175 His Gly
Ala Ala Val Val Ala Lys Gln Asp Tyr Ser Gly Ile Val Asn 180 185 190
Asp Asn Thr Lys Asp Trp Phe Val Lys Ala Ala Val Ser Gln Glu Tyr 195
200 205 Ala Asp Lys Trp Arg Ala Glu Val Thr Pro Met Thr Gly Lys Arg
Leu 210 215 220 Met Asp Ala Gln Arg Val Thr Ala Gly Tyr Ile Gln Leu
Trp Phe Asp 225 230 235 240 Thr Tyr Gly Asp Arg 245
5738DNAArtificial SequenceSynthetic - Coding sequence of mutant
PLC-N63DN131SN134D-Y56W 5tggtcagctg aggacaagca taaggaaggt
gtgaatagtc acttatggat cgtgaaccgt 60gccattgata taatgtctag gaatacaact
ctggttaagc aagatagagt tgctcaattg 120aatgaatggc gtacagagct
agagaatggc atctacgctg ctgattggga aaacccctat 180tacgatgaca
gtaccttcgc ttctcacttt tacgatccag acaacggaaa gacatatatc
240ccattcgcca agcaagctaa ggagactgga gctaagtact tcaagttggc
tggagagtca 300tacaagaata aagacatgaa gcaggccttc ttttatcttg
ggttgtcatt gcattatttg 360ggcgatgtca accaacctat gcatgccgca
tcctttacgg acctgtccta tccacagggt 420tttcactcca agtacgagaa
ctttgtcgat actattaaag acaactacaa agttaccgat 480gggaacggat
attggaattg gaaaggcacc aaccctgaag aatggattca cggtgcagca
540gtagttgcaa aacaggacta ctctggaatt gtcaatgaca ataccaaaga
ttggtttgtg 600aaagccgcag tctcccagga atatgcagat aaatggagag
ctgaagttac acctatgact 660ggtaaacgac taatggatgc ccaaagagtt
actgctggtt acattcaatt atggttcgac 720acttacggtg acaggtaa
7386245PRTArtificial SequenceSynthetic - Amino acid sequence of
mutant PLC-N63DN131SN134D-Y56W 6Trp Ser Ala Glu Asp Lys His Lys Glu
Gly Val Asn Ser His Leu Trp 1 5 10 15 Ile Val Asn Arg Ala Ile Asp
Ile Met Ser Arg Asn Thr Thr Leu Val 20 25 30 Lys Gln Asp Arg Val
Ala Gln Leu Asn Glu Trp Arg Thr Glu Leu Glu 35 40 45 Asn Gly Ile
Tyr Ala Ala Asp Trp Glu Asn Pro Tyr Tyr Asp Asp Ser 50 55 60 Thr
Phe Ala Ser His Phe Tyr Asp Pro Asp Asn Gly Lys Thr Tyr Ile 65 70
75 80 Pro Phe Ala Lys Gln Ala Lys Glu Thr Gly Ala Lys Tyr Phe Lys
Leu 85 90 95 Ala Gly Glu Ser Tyr Lys Asn Lys Asp Met Lys Gln Ala
Phe Phe Tyr 100 105 110 Leu Gly Leu Ser Leu His Tyr Leu Gly Asp Val
Asn Gln Pro Met His 115 120 125 Ala Ala Ser Phe Thr Asp Leu Ser Tyr
Pro Gln Gly Phe His Ser Lys 130 135 140 Tyr Glu Asn Phe Val Asp Thr
Ile Lys Asp Asn Tyr Lys Val Thr Asp 145 150 155 160 Gly Asn Gly Tyr
Trp Asn Trp Lys Gly Thr Asn Pro Glu Glu Trp Ile 165 170 175 His Gly
Ala Ala Val Val Ala Lys Gln Asp Tyr Ser Gly Ile Val Asn 180 185 190
Asp Asn Thr Lys Asp Trp Phe Val Lys Ala Ala Val Ser Gln Glu Tyr 195
200 205 Ala Asp Lys Trp Arg Ala Glu Val Thr Pro Met Thr Gly Lys Arg
Leu 210 215 220 Met Asp Ala Gln Arg Val Thr Ala Gly Tyr Ile Gln Leu
Trp Phe Asp 225 230 235 240 Thr Tyr Gly Asp Arg 245
7245PRTArtificial SequenceSynthetic - Amino acid sequence of mutant
PLC-N63DN131SN134D at position 56misc_feature(56)..(56)Xaa is Tyr,
Ala, Lys, Asn, Gln, His, Phe, Arg, Ser, Thr or Trp 7Trp Ser Ala Glu
Asp Lys His Lys Glu Gly Val Asn Ser His Leu Trp 1 5 10 15 Ile Val
Asn Arg Ala Ile Asp Ile Met Ser Arg Asn Thr Thr Leu Val 20 25 30
Lys Gln Asp Arg Val Ala Gln Leu Asn Glu Trp Arg Thr Glu Leu Glu 35
40 45 Asn Gly Ile Tyr Ala Ala Asp Xaa Glu Asn Pro Tyr Tyr Asp Asp
Ser 50 55 60 Thr Phe Ala Ser His Phe Tyr Asp Pro Asp Asn Gly Lys
Thr Tyr Ile 65 70 75 80 Pro Phe Ala Lys Gln Ala Lys Glu Thr Gly Ala
Lys Tyr Phe Lys Leu 85 90 95 Ala Gly Glu Ser Tyr Lys Asn Lys Asp
Met Lys Gln Ala Phe Phe Tyr 100 105 110 Leu Gly Leu Ser Leu His Tyr
Leu Gly Asp Val Asn Gln Pro Met His 115 120 125 Ala Ala Ser Phe Thr
Asp Leu Ser Tyr Pro Gln Gly Phe His Ser Lys 130 135 140 Tyr Glu Asn
Phe Val Asp Thr Ile Lys Asp Asn Tyr Lys Val Thr Asp 145 150 155 160
Gly Asn Gly Tyr Trp Asn Trp Lys Gly Thr Asn Pro Glu Glu Trp Ile 165
170 175 His Gly Ala Ala Val Val Ala Lys Gln Asp Tyr Ser Gly Ile Val
Asn 180 185 190 Asp Asn Thr Lys Asp Trp Phe Val Lys Ala Ala Val Ser
Gln Glu Tyr 195 200 205 Ala Asp Lys Trp Arg Ala Glu Val Thr Pro Met
Thr Gly Lys Arg Leu 210 215 220 Met Asp Ala Gln Arg Val Thr Ala Gly
Tyr Ile Gln Leu Trp Phe Asp 225 230 235 240 Thr Tyr Gly Asp Arg 245
8738DNAArtificial SequenceSynthetic - DNA sequence designed
according to the mature peptide sequence of Bacillus cereus
phosphatidylcholine-specific phospholipase C and Pichia codon
preference 8tggtcagctg aggacaagca taaggaaggt gtgaatagtc acttatggat
cgtgaaccgt 60gccattgata taatgtctag gaatacaact ctggttaagc aagatagagt
tgctcaattg 120aatgaatggc gtacagagct agagaatggc atctacgctg
ctgattatga aaacccctat 180tacgataaca gtaccttcgc ttctcacttt
tacgatccag acaacggaaa gacatatatc 240ccattcgcca agcaagctaa
ggagactgga gctaagtact tcaagttggc tggagagtca 300tacaagaata
aagacatgaa gcaggccttc ttttatcttg ggttgtcatt gcattatttg
360ggcgatgtca accaacctat gcatgccgca aactttacga acctgtccta
tccacagggt 420tttcactcca agtacgagaa ctttgtcgat actattaaag
acaactacaa agttaccgat 480gggaacggat attggaattg gaaaggcacc
aaccctgaag aatggattca cggtgcagca 540gtagttgcaa aacaggacta
ctctggaatt gtcaatgaca ataccaaaga ttggtttgtg 600aaagccgcag
tctcccagga atatgcagat aaatggagag ctgaagttac acctatgact
660ggtaaacgac taatggatgc ccaaagagtt actgctggtt acattcaatt
atggttcgac 720acttacggtg acaggtaa 7389245PRTArtificial
SequenceSynthetic - Amino acid sequence designed according to the
mature peptide sequence of Bacillus cereus
phosphatidylcholine-specific phospholipase C and Pichia codon
preference 9Trp Ser Ala Glu Asp Lys His Lys Glu Gly Val Asn Ser His
Leu Trp 1 5 10 15 Ile Val Asn Arg Ala Ile Asp Ile Met Ser Arg Asn
Thr Thr Leu Val 20 25 30 Lys Gln Asp Arg Val Ala Gln Leu Asn Glu
Trp Arg Thr Glu Leu Glu 35 40 45 Asn Gly Ile Tyr Ala Ala Asp Tyr
Glu Asn Pro Tyr Tyr Asp Asn Ser 50 55 60 Thr Phe Ala Ser His Phe
Tyr Asp Pro Asp Asn Gly Lys Thr Tyr Ile 65 70 75 80 Pro Phe Ala Lys
Gln Ala Lys Glu Thr Gly Ala Lys Tyr Phe Lys Leu 85 90 95 Ala Gly
Glu Ser Tyr Lys Asn Lys Asp Met Lys Gln Ala Phe Phe Tyr 100 105 110
Leu Gly Leu Ser Leu His Tyr Leu Gly Asp Val Asn Gln Pro Met His 115
120 125 Ala Ala Asn Phe Thr Asn Leu Ser Tyr Pro Gln Gly Phe His Ser
Lys 130 135 140 Tyr Glu Asn Phe Val Asp Thr Ile Lys Asp Asn Tyr Lys
Val Thr Asp 145 150 155 160 Gly Asn Gly Tyr Trp Asn Trp Lys Gly Thr
Asn Pro Glu Glu Trp Ile 165 170 175 His Gly Ala Ala Val Val Ala Lys
Gln Asp Tyr Ser Gly Ile Val Asn 180 185 190 Asp Asn Thr Lys Asp Trp
Phe Val Lys Ala Ala Val Ser Gln Glu Tyr 195 200 205 Ala Asp Lys Trp
Arg Ala Glu Val Thr Pro Met Thr Gly Lys Arg Leu 210 215 220 Met Asp
Ala Gln Arg Val Thr Ala Gly Tyr Ile Gln Leu Trp Phe Asp 225 230 235
240 Thr Tyr Gly Asp Arg 245 101012DNAArtificial SequenceSynthetic -
alpha-BC-PC-PLC DNA sequence with fused alpha factor signal peptide
sequence and a Pichia Kozak sequence 10cgaaacgatg agatttcctt
caatttttac tgcagtttta ttcgcagcat cctccgcatt 60agctgctcca gtcaacacta
caacagaaga tgaaacggca caaattccgg ctgaagctgt 120catcggttac
tcagatttag aaggggattt cgatgttgct gttttgccat tttccaacag
180cacaaataac gggttattgt ttataaatac tactattgcc agcattgctg
ctaaagaaga 240aggggtatct cttgagaaaa gagaggctga agcttggtca
gctgaggaca agcataagga 300aggtgtgaat agtcacttat ggatcgtgaa
ccgtgccatt gatataatgt ctaggaatac 360aactctggtt aagcaagata
gagttgctca attgaatgaa tggcgtacag agctagagaa 420tggcatctac
gctgctgatt atgaaaaccc ctattacgat aacagtacct tcgcttctca
480cttttacgat ccagacaacg gaaagacata tatcccattc gccaagcaag
ctaaggagac 540tggagctaag tacttcaagt tggctggaga gtcatacaag
aataaagaca tgaagcaggc 600cttcttttat cttgggttgt cattgcatta
tttgggcgat gtcaaccaac ctatgcatgc 660cgcaaacttt acgaacctgt
cctatccaca gggttttcac tccaagtacg agaactttgt 720cgatactatt
aaagacaact acaaagttac cgatgggaac ggatattgga attggaaagg
780caccaaccct gaagaatgga ttcacggtgc agcagtagtt gcaaaacagg
actactctgg 840aattgtcaat gacaatacca aagattggtt tgtgaaagcc
gcagtctccc aggaatatgc 900agataaatgg agagctgaag ttacacctat
gactggtaaa cgactaatgg atgcccaaag 960agttactgct ggttacattc
aattatggtt cgacacttac ggtgacaggt aa 10121135DNAArtificial
SequenceSynthetic - Primer 11ccggacgtcg ctagcagatc taacatccaa agacg
351237DNAArtificial SequenceSynthetic - Primer 12tcatcgtttc
gcctaggatc cttcgaataa ttagttg 371330DNAArtificial SequenceSynthetic
- Primer 13gatcctaggc gaaacgatga gatttccttc 301426DNAArtificial
SequenceSynthetic - Primer 14ccggaattct tacctgtcac cgtaag
261535DNAArtificial SequenceSynthetic - Primer 15gttaaaatca
aaacgttgtc aattggaacc agtcg 351640DNAArtificial SequenceSynthetic -
Primer 16ccaattgaca acgttgattt taacgacttt taacgacaac
401722DNAArtificial SequenceSynthetic - Primer 17cgactggttc
caattgacaa cg 221824DNAArtificial SequenceSynthetic - Primer
18ggcaaatggc attctgacat cctc 241923DNAArtificial SequenceSynthetic
- Primer 19cccaagcttg gtcagctgag gac 232024DNAArtificial
SequenceSynthetic - Primer 20ccggaattct tacctgtcac cgta
242137DNAArtificial SequenceSynthetic - Primer 21cgaaggtact
gtcatcgtaa taggggtttt cataatc 372231DNAArtificial SequenceSynthetic
- Primer 22ctattacgat gacagtacct tcgcttctca c 312338DNAArtificial
SequenceSynthetic - Primer 23acaggtccgt aaaggatgcg gcatgcatag
gttggttg 382440DNAArtificial SequenceSynthetic - Primer
24cgcatccttt acggacctgt cctatccaca gggttttcac 402535DNAArtificial
SequenceSynthetic - Primer 25gcctgcttca cgtctttatt cttgtatgac tctcc
352632DNAArtificial SequenceSynthetic - Primer 26gaataaagac
gtgaagcagg ccttctttta tc 322730DNAArtificial SequenceSynthetic -
Primer 27gggttttcgg catcagcagc gtagatgcca 302833DNAArtificial
SequenceSynthetic - Primer 28gctgctgatg ccgaaaaccc ctattacgat gac
332930DNAArtificial SequenceSynthetic - Primer 29gggttttcgc
aatcagcagc gtagatgcca 303033DNAArtificial SequenceSynthetic -
Primer 30gctgctgatt gcgaaaaccc ctattacgat gac 333130DNAArtificial
SequenceSynthetic - Primer 31gggttttcgt catcagcagc gtagatgcca
303233DNAArtificial SequenceSynthetic - Primer 32gctgctgatg
acgaaaaccc ctattacgat gac 333330DNAArtificial SequenceSynthetic -
Primer 33gggttttcct catcagcagc gtagatgcca 303433DNAArtificial
SequenceSynthetic - Primer 34gctgctgatg aggaaaaccc ctattacgat gac
333530DNAArtificial SequenceSynthetic - Primer 35gggttttcga
aatcagcagc gtagatgcca 303633DNAArtificial SequenceSynthetic -
Primer 36gctgctgatt tcgaaaaccc ctattacgat gac 333730DNAArtificial
SequenceSynthetic - Primer 37gggttttcac catcagcagc gtagatgcca
303833DNAArtificial SequenceSynthetic - Primer 38gctgctgatg
gtgaaaaccc ctattacgat gac 333930DNAArtificial SequenceSynthetic -
Primer 39ggttttcatg atcagcagcg tagatgccat 304034DNAArtificial
SequenceSynthetic - Primer 40cgctgctgat catgaaaacc cctattacga tgac
344130DNAArtificial SequenceSynthetic - Primer 41gggttttcga
tatcagcagc gtagatgcca 304233DNAArtificial SequenceSynthetic -
Primer 42gctgctgata tcgaaaaccc ctattacgat gac 334333DNAArtificial
SequenceSynthetic - Primer 43aggggttttc cttatcagca gcgtagatgc cat
334434DNAArtificial SequenceSynthetic - Primer 44cgctgctgat
aaggaaaacc cctattacga tgac 344530DNAArtificial SequenceSynthetic -
Primer 45gggttttcca aatcagcagc gtagatgcca 304633DNAArtificial
SequenceSynthetic - Primer 46gctgctgatt tggaaaaccc ctattacgat gac
334730DNAArtificial SequenceSynthetic - Primer 47gggttttcca
tatcagcagc gtagatgcca 304833DNAArtificial SequenceSynthetic -
Primer 48gctgctgata tggaaaaccc ctattacgat gac 334930DNAArtificial
SequenceSynthetic - Primer 49ggttttcgtt atcagcagcg tagatgccat
305034DNAArtificial SequenceSynthetic - Primer 50cgctgctgat
aacgaaaacc cctattacga tgac 345130DNAArtificial SequenceSynthetic -
Primer 51gggttttctg gatcagcagc gtagatgcca 305233DNAArtificial
SequenceSynthetic - Primer 52gctgctgatc cagaaaaccc ctattacgat gac
335330DNAArtificial SequenceSynthetic - Primer 53gggttttctt
gatcagcagc gtagatgcca 305433DNAArtificial SequenceSynthetic -
Primer 54gctgctgatc aagaaaaccc ctattacgat gac 335533DNAArtificial
SequenceSynthetic - Primer 55aggggttttc tctatcagca gcgtagatgc cat
335634DNAArtificial SequenceSynthetic - Primer 56cgctgctgat
agagaaaacc cctattacga tgac 345730DNAArtificial SequenceSynthetic -
Primer 57ggttttcaga atcagcagcg tagatgccat 305834DNAArtificial
SequenceSynthetic - Primer 58cgctgctgat tctgaaaacc cctattacga tgac
345930DNAArtificial SequenceSynthetic - Primer 59gggttttcgg
tatcagcagc gtagatgcca 306033DNAArtificial SequenceSynthetic -
Primer 60gctgctgata ccgaaaaccc ctattacgat gac 336130DNAArtificial
SequenceSynthetic - Primer 61gggttttcga catcagcagc gtagatgcca
306233DNAArtificial SequenceSynthetic - Primer 62gctgctgatg
tcgaaaaccc ctattacgat gac 336330DNAArtificial SequenceSynthetic -
Primer 63gggttttccc aatcagcagc gtagatgcca 306433DNAArtificial
SequenceSynthetic - Primer 64gctgctgatt gggaaaaccc ctattacgat gac
336533DNAArtificial SequenceSynthetic - Primer 65tatcaatggc
atggttcacg atccataagt gac 336635DNAArtificial SequenceSynthetic -
Primer 66ggatcgtgaa ccatgccatt gatataatgt ctagg 356737DNAArtificial
SequenceSynthetic - Primer 67cttagcttgc ttgtcgaatg ggatatatgt
ctttccg 376831DNAArtificial SequenceSynthetic - Primer 68atcccattcg
acaagcaagc taaggagact g 316954DNAHomo sapiens 69atgaagtggg
ttacctttat ctctttgttg tttcttttct cttctgctta ctct 547018PRTHomo
sapiens 70Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser
Ser Ala 1 5 10 15 Tyr Ser 7178DNASaccharomyces cerevisiae
71atgactaagc caacccaagt attagttaga tccgtcagta tattattttt catcacatta
60ctacatctag tcgtagct 787226PRTSaccharomyces cerevisiae 72Met Thr
Lys Pro Thr Gln Val Leu Val Arg Ser Val Ser Ile Leu Phe 1 5 10 15
Phe Ile Thr Leu Leu His Leu Val Val Ala 20 25 7338DNAArtificial
SequenceSynthetic - Primer 73gcgcctaggc cgcggcgaaa cgatgaagtg
ggttacct 387437DNAArtificial SequenceSynthetic - Primer
74cgatgaagtg ggttaccttt atctctttgt tgtttct 377537DNAArtificial
SequenceSynthetic - Primer 75ttatctcttt gttgtttctt ttctcttctg
cttactc 377637DNAArtificial SequenceSynthetic - Primer 76tttctcttct
gcttactctg ctccagtcaa cactaca 377738DNAArtificial SequenceSynthetic
- Primer 77gcgcctaggc cgcggcgaaa cgatgactaa gccaaccc
387838DNAArtificial SequenceSynthetic - Primer 78cgatgactaa
gccaacccaa gtattagtta gatccgtc 387938DNAArtificial
SequenceSynthetic - Primer 79gtattagtta gatccgtcag tatattattt
ttcatcac 388038DNAArtificial SequenceSynthetic - Primer
80tatattattt ttcatcacat tactacatct agtcgtag 388138DNAArtificial
SequenceSynthetic - Primer 81tactacatct agtcgtagct gctccagtca
acactaca 388229DNAArtificial SequenceSynthetic - Primer
82ctgaagcttg gtcagctgag gacaagcat 298338DNAArtificial
SequenceSynthetic - Primer 83ccggaattct tacctgtcac cgtaagtgtc
gaaccata 38
* * * * *