U.S. patent application number 16/100226 was filed with the patent office on 2018-12-20 for new compound for inhibiting binding between dx2 protein and p14/arf protein, and pharmaceutical composition for treating or preventing cancer disease containing same as effective ingredient.
This patent application is currently assigned to PUSAN NATIONAL UNIVERSITY INDUSTRY-UNIVERSITY COOP ERATION FOUNDATION. The applicant listed for this patent is THE INDUSTRY & ACADEMIC COOPERATION IN CHUNGNAM NATIONAL UNIVERSITY (IAC), PUSAN NATIONAL UNIVERSITY INDUSTRY-UNIVERSITY COOPERATION FOUNDATION. Invention is credited to Jin-Hyuk HER, Jee-Hyun LEE, Ah-Young OH, Bum Joon PARK, Gyu Yong SONG.
Application Number | 20180362540 16/100226 |
Document ID | / |
Family ID | 55020060 |
Filed Date | 2018-12-20 |
United States Patent
Application |
20180362540 |
Kind Code |
A1 |
PARK; Bum Joon ; et
al. |
December 20, 2018 |
NEW COMPOUND FOR INHIBITING BINDING BETWEEN DX2 PROTEIN AND P14/ARF
PROTEIN, AND PHARMACEUTICAL COMPOSITION FOR TREATING OR PREVENTING
CANCER DISEASE CONTAINING SAME AS EFFECTIVE INGREDIENT
Abstract
Disclosed is a new compound that inhibits binding between a DX2
protein and a p14/ARF protein, a pharmaceutical composition
including the new compound as an effective component for treating
or preventing a cancer disease, an anticancer adjuvant for
improving an anticancer effect of a drug-resistant anticancer drug,
and a composition including an AIMP2-DX2 protein or a fragment
thereof for diagnosing lung cancer.
Inventors: |
PARK; Bum Joon; (Busan,
KR) ; SONG; Gyu Yong; (Daejeon, KR) ; OH;
Ah-Young; (Busan, KR) ; LEE; Jee-Hyun;
(Daejeon, KR) ; HER; Jin-Hyuk; (Daejeon,
KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PUSAN NATIONAL UNIVERSITY INDUSTRY-UNIVERSITY COOPERATION
FOUNDATION
THE INDUSTRY & ACADEMIC COOPERATION IN CHUNGNAM NATIONAL
UNIVERSITY (IAC) |
BUSAN
DAEJEON |
|
KR
KR |
|
|
Assignee: |
PUSAN NATIONAL UNIVERSITY
INDUSTRY-UNIVERSITY COOP ERATION FOUNDATION
BUSAN
KR
THE INDUSTRY & ACADEMIC COOPERATION IN CHUNGNAM NA TIONAL
UNIVERSITY (IAC)
DAEJEON
KR
|
Family ID: |
55020060 |
Appl. No.: |
16/100226 |
Filed: |
August 10, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15323099 |
Dec 30, 2016 |
10072021 |
|
|
PCT/KR2015/006701 |
Jun 30, 2015 |
|
|
|
16100226 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/352 20130101;
A61K 45/06 20130101; G01N 33/57423 20130101; A61P 35/00 20180101;
A61K 31/34 20130101; A61K 31/35 20130101; C07D 493/04 20130101;
G01N 33/574 20130101; A61K 31/366 20130101; G01N 33/564 20130101;
C12Q 1/68 20130101 |
International
Class: |
C07D 493/04 20060101
C07D493/04; A61K 31/366 20060101 A61K031/366; G01N 33/574 20060101
G01N033/574; A61K 31/352 20060101 A61K031/352; A61K 31/34 20060101
A61K031/34; C12Q 1/68 20060101 C12Q001/68; A61K 31/35 20060101
A61K031/35; A61K 45/06 20060101 A61K045/06 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 30, 2014 |
KR |
10-2014-0081396 |
Jun 29, 2015 |
KR |
10-2015-0092057 |
Claims
1. A method of treating a cancer disease in a subject, comprising:
providing a pharmaceutical composition comprising, as an active
ingredient, a compound represented by Formula 3: ##STR00010## and
administering the pharmaceutical composition to the subject,
wherein the cancer disease is treated, wherein the cancer disease
is selected from the group consisting of lung cancer, colorectal
cancer, liver cancer, stomach cancer, esophageal cancer, pancreatic
cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate
cancer, testis cancer, uterine cervical cancer, endometrial cancer,
choriocarcinoma, ovarian cancer, breast cancer, thyroid cancer,
brain cancer, head and neck cancer, malignant melanoma, lymphoma,
and hematologic malignancy.
2. The method of claim 1, wherein the lung cancer is non-small cell
lung cancer or small cell lung cancer.
3. A method of inhibiting drug resistance of an anticancer drug in
a subject, comprising: providing a pharmaceutical composition
comprising, as an active ingredient, a compound represented by
Formula 3: ##STR00011## and administering the pharmaceutical
composition to the subject, wherein drug resistance of the
anticancer drug is inhibited.
4. The method of claim 3, wherein the anticancer drug is selected
from the group consisting of Adriamycin, Capecitabine, Caboplatin,
Cisplatin, Oxaliplain, Cyclophosphamide, Docetaxel, Paclitaxel,
Doxorubicin, Daunorubicin, Epirubicin, Idarubicin, Valrubicin,
Mitoxantrone, Curcumin, Gefitinib, Erlotinib, Irinotecan,
Topotecan, Vinblastine, Vincristine, Gemsitabin, Methotrexate,
Trastzumab, Vinorelbine, Fluorouracil, and 3-(5,
8-dimethoxy-1,4-dioxonaphthalene-2-ylthio)propanoic acid.
5. The method of claim 3, wherein the compound inhibits binding
between DX2 and p14/ARF proteins so that drug resistance of the
anticancer agent is inhibited and anticancer effect of the
anticancer agent is enhanced.
Description
CROSS REFERENCE TO PRIOR APPLICATION
[0001] This application is a divisional Application of U.S. patent
application Ser. No. 15/323,099 filed on Dec. 30, 2016 under 35
U.S.C. .sctn. 120, which is the 35 U.S.C. .sctn. 371 national stage
of International application PCT/KR2015/006701 filed on Jun. 30,
2015, which claims priority to Korean applications 10-2015-0092057
filed on Jun. 29, 2015 and 10-2014-0081396 filed on Jun. 30, 2014,
respectively.
BACKGROUND
[0002] The present invention relates to a new compound that
inhibits binding between a DX2 protein and a p14/ARF protein, a
pharmaceutical composition including the new compound as an
effective component for treating or preventing a cancer disease, an
anticancer adjuvant for improving an anticancer effect of a
drug-resistant anticancer drug, and a composition including an
AIMP2-DX2 protein or a fragment thereof for diagnosing lung
cancer.
[0003] Lung cancer is mainly caused by carcinogens, and incidence
of lung cancer has been on a rising trend worldwide. In South
Korea, lung cancer having the highest mortality rate among all
cancers is regarded as one of the most serious diseases. Lung
cancer is divided into two groups, small cell lung cancer (SCLC)
and non small cell lung cancer (NSCLC), and the NSCLC is also
divided into sub-groups: adenocarcinoma, squamous carcinoma, large
cell carcinoma, and adenosquamous carcinoma, depending on lung
tissue types. Clinical manifestations, such as areas prone to occur
depending on different lung tissue types, progression type and
speed, and symptoms, may vary as well as treatment methods.
[0004] Most of lung cancers cannot be treated by chemotherapy and
radiation therapy. Chemotherapy and radiation therapy may be used
by reducing a size of SCLC while complete treatment cannot be
expected from chemotherapy and radiation therapy. Since an
anticancer drug is less effective in NSCLC than SCLC, the treatment
of lung cancer using chemotherapy only is almost impossible.
Instead, complete removal of tumors in a surgical manner is the
only effective treatment. However, about 30% or less of patients
with lung cancer have tumors that cannot be totally resected when
being diagnosed. In addition, only one-third or less of the
patients survive for 5 years after surgical resection is done.
[0005] Therefore, there is a great demand for a method of more
accurately detecting the early diagnosis of lung cancer and the
spread of cancer and more effectively treating lung cancer.
SUMMARY
[0006] An object of the present invention is to provide a new
compound that inhibits binding between a DX2 protein and a p14/ARF
protein in consideration of development of a new useful compound
for treatment of a cancer disease including lung cancer.
[0007] In addition, another object of the present invention is to
provide a pharmaceutical composition for treating or preventing a
cancer disease, the pharmaceutical composition including, as an
effective compound, a compound that inhibits binding between a DX2
protein and a p14/ARF protein.
[0008] In addition, another object of the present invention is to
provide an anticancer adjuvant for improving an anticancer effect
of a drug-resistant anticancer drug, the anticancer adjuvant
including, as an effective component, a compound that inhibits
binding between a DX2 protein and a p14/ARF protein.
[0009] In addition, another object of the present invention is to
provide a composition for diagnosing lung cancer, the composition
including an AIMP2-DX2 protein or a fragment thereof.
[0010] To achieve the objectives above, the present invention
provides a compound represented by Formula 1 or 2:
##STR00001##
[0011] In addition, the present invention provides a pharmaceutical
composition for treating or preventing a cancer disease, the
pharmaceutical composition including, as an effective component, a
compound represented by Formula 1, 2, or 3:
##STR00002##
[0012] In addition, the present invention provides a pharmaceutical
composition for inhibiting drug resistance of an anticancer drug,
the pharmaceutical composition including, as an effective
component, a compound represented by Formula 1, 2, or 3.
[0013] In addition, the present invention provides a pharmaceutical
composition for treating or preventing a cancer disease, the
pharmaceutical composition including, as effective components, a
compound represented by Formula 1, 2, or 3 and an anticancer
drug.
[0014] In addition, the present invention provides a composition
for diagnosing lung cancer, the composition including an AIMP2-DX2
protein or a fragment thereof.
[0015] In addition, the present invention provides a method of
detecting an autoantibody to an AIMP2-DX2 protein to provide
information for lung cancer diagnosis, the method including: (a)
detecting an antibody to an AIMP2-DX2 protein from a sample derived
from a subject; and (b) determining that a subject has lung cancer
or is susceptible to lung cancer if an amount of the detected
antibody in the subject increases as compared with a normal
person.
[0016] In addition, the present invention provides a kit for
diagnosing lung cancer, the kit including an AIMP2-DX2 protein or a
fragment thereof.
[0017] According to the present invention, a compound that inhibits
interaction of a DX2 protein with a p14/ARF protein may be
selected. An analogous compound to the selected compound is
synthesized, and a review of in vitro and in vivo anticancer
effects of the analogous compound shows that the compound has an
excellent anticancer effect. In particular, in a cell line which is
resistant to an anticancer drug such as Adriamycin, it is confirmed
that the a compound that inhibits interaction between a DX2 protein
and a p14/ARF protein is treated so that resistance of an
anticancer drug against Adriamycin is inhibited while an anticancer
effect of the anticancer drug is improved. Accordingly, the
disclosed compound that inhibits interaction between a DX2 protein
and a p14/ARF protein can be significantly used as an anticancer
drug or anticancer adjuvant for a cancer disease such as lung
cancer.
[0018] In addition, the present invention provides a composition
and a kit, each of which includes an AIMP2-DX2 protein or a
fragment thereof for diagnosing lung cancer. The composition and
the kit may be used to identify incidence of lung cancer only by
using a serum sample of a subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 shows an ELISA-based screening method for screening a
specific inhibitor of DX2 and p14/ARF binding;
[0020] FIG. 2 illustrates A showing results of GST pull-down assay,
B showing results of immunoprecipitation analysis, and C showing
results obtained by performing protein binding analysis using a
His-DX2 protein as an inhibitory effect of SLCB050 on DX2-p14/ARF
binding (IP: a group binding to a protein for precipitation, Sup: a
group not binding to a protein from which supernatant of the
precipitate is separated, Input: cell debris);
[0021] FIG. 3 illustrates A, B, C showing results of GST pull-down
assay to confirm interaction of SLCB050 with a DX2-specific region,
and D, E showing results of GST pull-down assay to confirm
inhibitory effects of HJH141204, HJH141206, and SLCB36 on
DX2-p14/ARF binding (PPT: a group binding to a protein for
precipitation, Sup: a group not binding to a protein from which
supernatant of the precipitate is separated);
[0022] FIG. 4 illustrates A showing dissociation of DX2 and p14/ARF
after performing SLCB050 treatment, B showing differences in
localization of DX2 and p14/ARF after SLCB050 treatment, C showing
SLCB050 treatment effects on NSCLC cell line H1299 and SCLC cell
line H69, and D showing SLCB050 treatment effects on
p14/ARF-deficient H322 cells;
[0023] FIG. 5 shows viability of various human lung cancer cell
lines obtained after performing SLCB050 treatment thereon.
[0024] FIG. 6 shows results of soft agar colony formation assay
obtained after H128 cells which are SCLC cell lines were treated
with SLCB050 treatment on;
[0025] FIG. 7 shows viability of H128 cells which are SCLC cell
lines after the cells were treated with SLCB050, HJH141204,
HJH141206, and SLCB36;
[0026] FIG. 8 shows effects of SLCB050 treatment on reduction of
drug resistance of an anticancer drug;
[0027] FIG. 9 shows inhibitory effects on drug resistance to
Adriamycin in a xenograft model using H446 (Adr: 0.2 .mu.g/ml,
SLCB050: 10 mg/kg);
[0028] FIG. 10 shows in vivo anticancer effects of SLCB050;
[0029] FIG. 11 shows hematoxylin-eosin (H-E) staining results of
lung tissues derived from SLCB050-treated DK mice;
[0030] FIG. 12 shows in vivo anticancer effects of SLCB050;
[0031] FIG. 13 shows the mechanism of SLCB050 of the present
invention, which is a compound inhibiting DX2-p14/ARF binding, on
therapeutic effect on lung cancer;
[0032] FIG. 14 shows results of measuring AIMP2-DX2 expression
levels in various lung cancer cell lines (NSCLC: non small cell
lung cancer cell line; SCLC: small cell lung cancer cell line; H322
and H460: NSCLC cell lines; H146 and H69: SCLC cell lines; AIMP2:
aminoacyl tRNA synthetase complex-interacting multifunctional
protein 2; and Actin: Actin);
[0033] FIG. 15 shows results of measuring AIMP2-DX2 expression
levels in various lung cancer cell lines (NSCLC: non small cell
lung cancer cell line; SCLC: small cell lung cancer cell line;
A549, H1299, H32, H322, and H460: NSCLC cell lines; H146 and H69:
SCLC cell lines; AIMP2: aminoacyl tRNA synthetase
complex-interacting multifunctional protein 2; GAPDH:
Glyceraldehyde 3-phosphate dehydrogenase);
[0034] FIG. 16 is a schematic diagram of an experimental process
for measuring ATMP2-DX2 autoantibody levels in serum of a patient
with SCLC and NSCLS, wherein the experimental process consists of
steps of preparing a diagnostic membrane (step 1), allowing a
reaction with serum of a patient (stpep2), and allowing a reaction
with anti-human antibody; and
[0035] FIG. 17 shows results of measuring AIMP2-DX2 autoantibody
levels in serum of a patient with SCLC and NSCLS (Normal serum,
N1.about.N10: serum of a normal person; SCLC serum, S1.about.S10:
serum of a patient with SCLC; NSCLC, L1.about.L20: serum of a
patient with NSCLC; Lamin A: lamin A; and red color refers to a
sample from which anti-AIMP2-DX2 antibodies were detected while
black color refers to a sample from which anti-AIMP2-DX2 antibodies
were not detected).
DETAILED DESCRIPTION
[0036] Hereinafter, the present invention will be described in
detail. Korean Patent Application No. 2014-0113543 discloses that
DX2 inhibits induction of carcinogen-inducible p14/ARF so that a
specific binding inhibitor of DX2 and p14/ARF can be used as an
anticancer drug. In this regard, the present invention is completed
by discovering a specific binding inhibitor of DX2 and p14/ARF and
confirming an anticancer effect of the inhibitor.
[0037] The present invention provides a compound represented by
Formula 1 or 2:
##STR00003##
[0038] Here, the compound represented by Formula 1 is named as
HJH141204, and the compound represented by Formula 2 is named as
HJH141206. These compounds may inhibit binding between a DX2
protein and a p14/ARF.
[0039] In addition, a compound represented by Formula 3 is named as
SLCB050.
##STR00004##
[0040] In detail, referring to drawings, the compound according to
an embodiment of the present invention which is a specific binding
inhibitor of DX2 and p14/ARF was screened by using an ELISA-based
screening method of FIG. 1. Based on the screening reaction system,
increases in ELISA values with increasing concentrations of p14/ARF
were measured. However, in the case the treatment of a specific
binding inhibitor of DX2 and p14/ARF, such as SLCB050, ELISA
reaction was considerably reduced. Thus, by using the ELISA-based
screening method, compounds that are specific binding inhibitors of
DX2 and p14/ARF were primarily screened.
[0041] FIG. 2A confirms that SLCB050 completely blocked the
DX2-p14/ARF binding through GST pull-down assay. FIG. 2B confirms
that SLCB050 inhibited the interaction of p14/ARF with DX2 in cells
through immunoprecipitation analysis. Here, contransfected 293
cells were allowed to react with MG132 before immunoprecipitation
analysis to prevent reduction of two proteins, and after performing
SLCB050 treatment (10 .mu.M, 6 hours), immunoprecipitation assay
was performed on the cells by using Myc antibodies (DX2). FIG. 2C
shows that binding between DX2 and AIMP2 was reduced by SLCB050
treatment in protein binding assay using His-DX2 protein, in terms
of inhibitory effect of SLCB050 on the binding between DX2 and
AIMP2. In addition, since SLCB050 selectively inhibited DX2-p14/ARF
binding as shown in FIG. 3A, but not on p53-AIMP2 or DX2 binding as
shown in FIG. 3B and p14/ARF binding as shown in FIG. 3C, it was
confirmed that SLCB050 would be interacted with DX2-specific
region.
[0042] In addition, HJH141204, HJH141206, and SLCB36, which are
compounds similar to SLCB050, were each synthesized, and the GST
pull-down assay was performed thereon to verify inhibitory effect
on DX2-p14/ARF binding. As a result, as shown in FIGS. 3D and 3E,
SLCB050, HJH141204, and HJH141206 showed inhibitory effects on
DX2-p14/ARF binding and did not affect the interaction of
p53-p14/ARF, whereas SLCB36 did not show inhibitory effect on both
binding. Accordingly, it was confirmed that inclusion of a ribose
ring structure in the compounds is required for the binding
inhibition.
[0043] FIG. 4A shows results obtained by detection of dissociation
of DX2 and p14/ARF through immunoprecipitation analysis. Here, 293
cells were transfected with indicating vectors for 24 hours and was
allowed to react with MG132 and SLCB050 for 6 hours. FIG. 4B shows
differences in localization of DX2 and p14/ARF after the proteins
were treated with SLCB050. Here, the interaction of DX2 with
p14/ARF was blocked by SLCB050 treatment (10.mu.M, 6 hours) so that
DX2 was decreased and p14/ARF was increased in the nucleoplasm. In
addition, FIG. 4C shows SLCB050 treatment effects on NSCLC cell
line H1299 and SCLC cell line H69, and more particularly, shows
that SLCB050 treatment decreases DX2, but increases p14/ARF in
NSCLC cell line H1299 and SCLC cell line H69. In addition, FIG. 4D
shows SLCB050 treatment effects on p14/ARF-deficient H322 cells.
Here, DX2 levels decreased considerably in the p14/ARF-deficient
H322 cells in response to SLCB050 treatment.
[0044] FIG. 5 shows viability of various human lung cancer cell
lines after the cell lines were treated with SLCB050 for 24 hours,
wherein the viability was determined by MTT assay. Here, SCLC cells
were very sensitive to SLCB050.
[0045] FIG. 6 shows results of soft agar colony formation assay.
H128 cells which are SCLC cell lines were seeded in soft agar
plates and allowed to react with SLCB050 for 48 hours, and then,
the cells were examined after staining the cells with trypan blue.
SLCB050 reduced the number of colonies in a dose-dependent
manner.
[0046] FIG. 7 shows viability of H128 cells which are SCLC cell
lines after the cells were treated with SLCB050, HJH141204,
HJH141206, and SLCB36. The SLCB050, HJH141204, and HJH141206
treatments reduced the viability of H128 cells in a dose-dependent
manner, wherein the viability was determined by MTT assay.
Meanwhile, the SLCB36 treatment did not significantly affect the
cell viability.
[0047] FIG. 8 shows inhibitory effect of SLCB050 on drug resistance
of an anticancer drug against DX2 expressed cells. FIG. 8A shows
effects of SLCB050 on reduction of drug resistance of an anticancer
drug when treated together with GN25 [5 .mu.M,
3-(5,8-dimethoxy-1,4-dioxonaphthalene -2-ylthio)propanoic acid] and
SLCB050 (10 or 20 .mu.M), which are p53 activators, for 6 hours in
DX2 and DK MEFs, wherein the effects were determined by MTT
analysis. Here, resistance to GN25 in DX2 and DK cells was
abolished by SLCB050 treatment, thereby recovering anticancer
effects of GN25. FIG. 8B shows effects of SLCB050 on reduction of
drug resistance of primary tumor cells from DX2 and DK mice when
treated together with Adriamycin (0.2 .mu.g/ml) and SLCB050 (10
.mu.M) for 24 hours, wherein the effects were determined by MTT
analysis. Here, resistance to Adriamycin was also abolished by
SLCB050 treatment, thereby recovering anticancer effects of
Adriamycin. FIG. 8C shows sensitivity of SCLC cell lines to
combinational treatment with Adriamycin and SLCB050. Here, SCLC
cell line H69 was partially responded to SLCB050 so that the
sensitivity to Adriamycin improved, whereas p14/ARF-deficient H322
cells did not show improved sensitivity by combinational treatment
with SLCB050.
[0048] FIG. 9 shows inhibitory effects on drug resistance to
Adriamycin in a xenograft model using H446. FIG. 9A shows
resistance to Adriamycin in the xenograft model using H446, and
also shows decreased resistance by SLCB050 treatment. FIG. 9B shows
that tumor growth was suppressed within 4 weeks by treatment of 5
mg/kg of Adriamycin, but the experiment was ceased by high
toxicity. In constrast, low dose of Adriamycin (2.5 mg/kg) with 10
mg/kg of SLCB050 obviously suppressed tumor growth without severe
toxicity. FIG. 9C confirmed through Wester blotting that
combinational treatment with Adriamycin and SLCB050 induced p53
synergistically in primary tumor cells.
[0049] FIG. 10 shows in vivo anticancer effects of SLCB050. FIG.
10A shows a diagram of experimental schedule with DK mice in terms
of examination of in vivo anticancer effects. FIG. 10B shows
hematoxylin-eosin (H-E) staining results of lung tissues derived
from SLCB050-treated DK mice. Here, combinational treatment with
Adriamycin and SLCB050 induced tumor regression. FIG. 10C shows
that combinational treatment with Adriamycin and SLCB050 reduced
tumor volumes.
[0050] FIG. 11 shows H-E staining results of lung tissues derived
from SLCB050-treated DK mice. Here, SCLC regions were more
obviously erased by combinational treatment with Adriamycin and
SLCB050.
[0051] FIG. 12 shows in vivo anticancer effects of SLCB050. FIG.
12A is a western blot analysis result showing reduction of DX2 in
response to SLCB050 treatment. FIGS. 12B and 12C show TUNEL
staining results from lung tissues of DK mice treated with
Adriamycin and SLCB050 in combination. Here, SLCB050 treatment
obviously increased apoptosis tumer cells.
[0052] As shown in FIG. 13, the results above indicate that DX2
produced by aberrant splicing of AIMP2 promotes tumor progression,
in particularly, small cell lung cancer, via direct interaction and
inhibition of p14/ARF. In this regard, it was confirmed that such
small cell lung cancer can be treated by using compounds that
inhibit DX2-p14/ARF binding.
[0053] Accordingly, the present invention provides a pharmaceutical
composition for treating or preventing a cancer disease, the
pharmaceutical composition including, as an effective component, a
compound represented by Formula 1, 2, or 3:
##STR00005##
[0054] The compound above may inhibit binding between a DX2 protein
and a p14/ARF protein.
[0055] The cancer disease may be selected from the group consisting
of lung cancer, colorectal cancer, liver cancer, stomach cancer,
esophageal cancer, pancreatic cancer, gallbladder cancer, kidney
cancer, bladder cancer, prostate cancer, testis cancer, uterine
cervical cancer, endometrial cancer, choriocarcinoma, ovarian
cancer, breast cancer, thyroid cancer, brain cancer, head and neck
cancer, malignant melanoma, lymphoma, and hematologic malignancy,
and the lung cancer may be non small cell lung cancer or small cell
lung cancer, and more preferable, may be small cell lung
cancer.
[0056] In addition, the present invention provides a pharmaceutical
composition for inhibiting drug resistance of an anticancer drug,
the pharmaceutical composition including, as an effective
component, a compound represented by Formula 1, 2, or 3.
[0057] The anticancer drug may be selected from the group
consisting of Adriamycin, Capecitabine, Caboplatin, Cisplatin,
Oxaliplain, Cyclophosphamide, Docetaxel, Paclitaxel, Doxorubicin,
Daunorubicin, Epirubicin, Idarubicin, Valrubicin, Mitoxantrone,
Curcumin, Gefitinib, Erlotinib, Irinotecan, Topotecan, Vinblastine,
Vincristine, Gemsitabin, Methotrexate, Trastzumab, Vinorelbine,
Fluorouracil, and 3-(5,
8-dimethoxy-1,4-dioxonaphthalene-2-ylthio)propanoic acid.
[0058] The compound above may inhibit binding between a DX2 protein
and a p14/ARF protein to thereby inhibit drug resistance of the
anticancer drug and improve anticancer effect of the anticancer
drug.
[0059] In addition, the present invention provides a pharmaceutical
composition for treating or preventing a cancer disease, the
pharmaceutical composition including, as effective components, a
compound represented by Formula 1, 2, or 3 and an anticancer
drug.
[0060] The anticancer drug may be selected from the group
consisting of Adriamycin, Capecitabine, Caboplatin, Cisplatin,
Oxaliplain, Cyclophosphamide, Docetaxel, Paclitaxel, Doxorubicin,
Daunorubicin, Epirubicin, Idarubicin, Valrubicin, Mitoxantrone,
Curcumin, Gefitinib, Erlotinib, Irinotecan, Topotecan, Vinblastine,
Vincristine, Gemsitabin, Methotrexate, Trastzumab, Vinorelbine,
Fluorouracil, and
3-(5,8-dimethoxy-1,4-dioxonaphthalene-2-ylthio)propanoic acid, lung
cancer, colorectal cancer, liver cancer, stomach cancer, esophageal
cancer, pancreatic cancer, gallbladder cancer, kidney cancer,
bladder cancer, prostate cancer, testis cancer, uterine cervical
cancer, endometrial cancer, choriocarcinoma, ovarian cancer, breast
cancer, thyroid cancer, brain cancer, head and neck cancer,
malignant melanoma, lymphoma, and hematologic malignancy, and the
lung cancer may be non small cell lung cancer or small cell lung
cancer, and more preferable, may be small cell lung cancer.
[0061] The pharmaceutical composition may include, as a specific
inhibitor against binding between DX2 and p14/ARF, not only
screened compounds, SLCB050, HJH141204, and HJH141206, but also a
pharmaceutically acceptable carrier of the screened compounds, in
an effective amount. The term "effective amount" as used herein
refers to an amount sufficient to exhibit therapeutic effects on
cancer.
[0062] The pharmaceutically acceptable carrier included in the
pharmaceutical composition of the present invention may be any
material conventionally used at the time of formulation, and
examples thereof include a carbohydrate compound (e.g., lactose,
amylase, dextrose, sucrose, sorbitol, mannitol, startch, cellulose,
etc), Acacia rubber, calcium phosphate, alginate, gelatin, calcium
silicate, microcrystalline cellulose, polyvinylpyrrolidone,
cellulose, water, syrup, salt solution, alcohol, gum Arabic,
vegetable oil (e.g., corn oil, cotton seed oil, soybean oil, olive
oil, coconut oil, etc), polyethylene glycol, methyl cellulose,
methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium
stearate, and mineral oil. But the examples of the pharmaceutically
acceptable carrier re not limited thereto.
[0063] The pharmaceutical composition according to the present
invention may further include, in addition to the components
described above, a lubricant, a wetting agent, a sweetener, a
flavoring agent, an emulsifying agent, a suspending agent, or a
preservative. Materials suitable as the pharmaceutically acceptable
carrier and formulation are provided in detail in Remington's
Pharmaceutical Sciences (19th ed., 1995).
[0064] The pharmaceutical composition according to the present
invention may be administered orally or parenterally. In the case
of parenteral administration, the administration may be done via
intravenous injection, subcutaneous injection, or muscle
injection.
[0065] A suitable dose of the pharmaceutical composition according
to the present invention may vary depending on various factors such
as a method for formulation, a method for administration, a
patient's age, weight, sex, disease condition, or diet,
administration time, an administration route, an excretion rate,
and responsiveness. In general, a skilled doctor may readily
determine and prescribe an effective dose in terms of desired
treatment or prophylaxis. According to a preferable embodiment of
the present invention, the dose of the pharmaceutical composition
may be 0.0001 to about 100 mg/kg (body weight) per day, and it may
be administered once or several times per day.
[0066] The pharmaceutical composition according to the present
invention may be prepared according to a method that can be easily
carried out by those skilled in the art. For example, the
pharmaceutical composition may be prepared in unit dosage form by
formulation with a pharmaceutically acceptable carrier and/or
excipient. Alternatively, the pharmaceutical composition may be
prepared in a multi-dose container. Here, a formulation of the
pharmaceutical composition may be oil or solution in an aqueous
medium, suspension or emulsion, extract, powder, granule, tablet,
or capsule, and may further include a dispersant or a
stabilizer.
[0067] The present invention provides a composition for diagnosing
lung cancer, the composition including AIMP2-DX2 protein or a
fragment thereof.
[0068] Autoantibodies to AIMP2-DX2 are produced in a patient with
lung cancer, especially with small cell lung cancer. In this
regard, detection of autoantibodies enables diagnose of lung
cancer. As a representative method of detecting the autoantibodies,
target proteins to be antigens are immobilized on a fixture to be
then reactive with a blood or serum sample including antibodies
extracted from a subject, thereby confirming the presence of
binding between the autoantibodies and the sample.
[0069] The inventor of the present invention discovered the
production of autoantibodies to AIMP2-DX2 in a patient with lung
cancer, and confirmed whether autoantibodies to AIMP2-DX2 are found
in serum of a subject after immobilizing AIMP2-DX2 on a fixture for
reaction with serum of the subject. Here, autoantibodies to
AIMP2-DX2 were not detected in serum of a healthy person while the
autoantibodies were detected in a patient with SCLC or NSCLC.
[0070] Therefore, AIMP2-DX2 or a fragment thereof may be used for
diagnosis of lung cancer. AIMP2-DX2 may be a deletion variant of
AIMP2 lacking exon 2 from the AIMP2 sequence, and ARS-interacting
multi-functional protein 2 (AIMP2) is one of proteins related to
formation of an aminoacyl-tRNA synthetase (ARS) composite, and is
also referred to as p38/JTV-1 or p38.
[0071] The inventor of the present invention discovered in a
previous study that, in terms of a new function of AIMP2, genetic
collapse of AIMP2 induced overexpression of c-myc and accordingly
caused hyperproliferation of alveolar epithelial cells in lungs,
thereby inducing neonatal lethality of neuronal mice. In addition,
the inventor of the present invention discovered that AIMP2 induced
by TGF-.beta. moves to the nucleus for inhibition of expression
based on molecular and cytological analysis (M. J. Kim, B.-J. Park,
Y.-S. Kang, H. J. Kim, J.-H. Park, J. W. Kang, S. W. Lee, J. M.
Han, H.-W. Lee, S. Kim, Nat. Genet. 34, 330-336, 2003).
[0072] AIMP2-DX2 of the present invention may be a deletion variant
of AIMP2 lacking exon 2 from the AIMP2 sequence. The AIMP2 sequence
is found in several databases (312aa version:AAC50391.1 or
GI:1215669; 320aa version: AAH13630.1, GI:15489023, BC013630.1) and
publications (312aa version: Nicolaides, N. C., Kinzler, K. W. and
Vogelstein, B. Analysis of the 5' region of PMS2 reveals
heterogeneous transcripts and a novel overlapping gene, Genomics 29
(2), 329-334 (1995)//320 aa version: Generation and initial
analysis of more than 15,000 full-length human and mouse cDNA
sequences, Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903
(2002)). AIMP2-DX2 is a protein lacking a region corresponding to
exon 2 in the sequence. KR 2004-0078035 disclosed by the same
inventor of the present invention discloses cancer therapy efficacy
of AIMP2, and the description of AIMP2 in this patent document is
incorporated herein by reference.
[0073] AIMP2-DX2 protein may include a protein lacking exon 2 from
the whole AIMP2 sequence, and in this regard, may also include a
protein lacking exon 2 from AIMP2 equivalents (functional
equivalents that are variants resulting from substitution,
deletion, insertion, or a combination thereof of the AIMP2 amino
acid sequence, but have substantially equivalent activity to AIMP2,
or functional derivatives that have modifications that enhance or
reduce physicochemical properties or having substantially
equivalent activity to AIMP2) is deleted.
[0074] AIMP2-DX2 protein may include a protein in which the amino
acid sequence spanning exon 2 in AIMP2 wholly deleted, a protein
including the amino acid sequences of exon 2 so that only a part of
the amino acid sequence spanning exon 2 is deleted from exon 1,
exon 3, exon 4, or all of these exons, a protein in which the amino
acid sequence of exon 2 in AIMP2 is partially deleted. Preferably,
AIMP2-DX2 of the present invention may include a protein in which
the amino acid sequence spanning exon 2 in AIMP2 is wholly
deleted.
[0075] AIMP2-DX2 protein of the present invention may include not
only a protein having natural-occurring amino acid sequences, but
also a variant of modified sequences. The variant of
AIMP2-DX2refers to a protein having a different sequence from a
natural-occurring amino acid sequence of AIMP2-DX2 prepared by
deletion, insertion, non-conserved or conserved substitution, or a
combination thereof. The alteration of amino acids in proteins and
peptides where molecular activity is not substantially impaired is
well known in the art. The most common alternation includes
alternation between amino acid residues Val/Ile, Asp/Glu, Thr/Ser,
Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/Pro,
Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly.
[0076] In some cases, AIMP2-DX2 protein may be subjected to
modifications such as phosphorylation, sulfation, acrylation,
glycosylation, methylation, and farnesylation.
[0077] The fragment of AIMP2-DX2 protein of the present invention
refers to a peptide or protein including a part of the amino acid
sequences of AIMP2-DX2 protein. Then, any material having a part of
AIMP2-DX2 amino acid sequence and a structure allowing binding of
an antibody specifically to AIMP2-DX2 protein may be used as the
fragment of AIMP2-DX2 protein.
[0078] AIMP2-DX2 or a fragment thereof may be naturally extracted,
synthesized, or prepared by recombinant methods based on DNA
sequences. When a recombinant DNA technology is used, a suitable
expression vector carrying a nucleic acid encoding AIMP2-DX2 was
transformed to a recombinant expression vector, and a host cell was
cultured with the transformant to allow expression of AIMP2-DX2,
thereby covering AIMP2-DX2 from the transformant.
[0079] Preferably, AIMP2-DX2of the present invention may include an
amino acid sequence of SEQ ID NO: 5 or 6.
[0080] The lung cancer of the present invention may include both
non small cell lung cancer (NSCLC) and (small cell lung cancer
(SCLC), and preferably, the lung cancer of the present invention
may include SCLC.
[0081] The present invention provides a method of detecting
anautoantibody to AIMP2-DX2 protein to provide information for lung
cancer diagnosis, the method including: (a) detecting an antibody
to AIMP2-DX2in a sample derived from a subject; and (b) determining
that a subject has lung cancer or is susceptible to lung cancer in
the case when an amount of the detected antibody in the sample is
greater than that in a normal person.
[0082] Hereinafter, the method of the present invention will be
described step by step.
[0083] (a) Detecting an Antibody to AIMP2-DX2from a Sample Derived
From a Subject
[0084] In step (a), an antibody to AIMP2-DX2 protein is detected
from a sample derived from a subject.
[0085] The sample derived from the subject refers to a substance
extracted from a person desire to confirm whether the person has
lung cancer, and types of the substance are not particularly
limited.
[0086] The sample of the present invention refers to, for example,
a composition obtained or derived from a subject desire to confirm
whether the person has lung cancer, the composition including
autoantibodies that can be identified based on physical,
biochemical, or physiological characteristics.
[0087] The sample may include blood of biological origin and other
liquid and tissue samples. The source of the tissue sample may
include fresh, frozen, and/or preserved organs or tissue samples,
solid tissues from biopsy or aspiration, blood, any blood
component, body fluid, and cells or serum from any time during
pregnancy or embryogeny of a subject. The sample of the present
invention may include whole blood, blood-derived cells, serum,
plasma, lymph, synovia, cell extract, and a combination thereof,
but is not limited thereto. Preferably, the sample may include
serum, plasma or serum, or more preferably, serum.
[0088] The antibody may be against AIMP2-DX2 protein, and more
preferably, may be an anti-AIMP2-DX2 autoantibody, and more
preferably, may be an anti-AIMP2-DX2 IgG.
[0089] The detecting of the antibody to AIMP2-DX2 may be preferably
made by antigen-antibody binding. That is, an antibody specifically
binds to epitopes which are two-dimensional to three-dimensional
parts of an antigen. Therefore, if an antigen and an antibody are
able to bind to each other immunologically, it is said that the
antigen and the antibody are "specific", "recognizable", or
"bound". The antigen may be preferably AIMP2-DX2 protein or a
fragment thereof.
[0090] The detecting of the antibody of the present invention may
be performed by any known method of detecting the presence of
antibody. However, such a known method may be heterogeneous or
homogeneous, sequential or simultaneous, or competitive or
non-competitive. The detecting of the antibody of the present
invention may be performed in a quantitative manner to test a
concentration or amount of anti-AIMP2-DX2 autoantibody.
Alternatively, the detecting of the antibody of the present
invention may be performed in a qualitative manner to test the
presence of anti-AIMP2-DX2 autoantibody.
[0091] Preferably, the step (a) of detecting the antibody to
AIMP2-DX2from the sample derived from the subject may include: (a1)
applying the sample derived from the sample to a fixture on which
AIMP2-DX2or a fragment thereof is immobilized to allow a reaction;
and (a2) detecting antibodies bound to AIMP2-DX2in the reaction
product.
[0092] The detecting of the antibody of the present invention may
be performed by both binding between a non-immobilized antigen and
an antibody and binding between an immobilized antigen and an
antibody, but more preferably, may be performed by binding between
a non-immobilized antigen and an antibody.
[0093] That is, after AIMP2-DX2(antigen) that is specifically
reactive to an anti-AIMP2-DX2 autoantibody is bound to a fixture
(solid support), the sample derived from the subject is mixed the
reaction product to test the presence of the anti-AIMP2-DX2
antibody. Here, the antigen which is in a bound state with the
fixture is in contact with a biological sample which is an unbound
state, thereby forming antigen-antibody binding. Afterwards, the
fixture is washed so that the reaction sample including antibodies
that are not bound to immobilized antigens is removed. After
completion of such treatments, an immune complex of the antigen and
the anti-AIMP2-DX2 antibody is formed.
[0094] The detection of the present invention may be performed by,
more preferably, a sandwich assay including procedures of adding a
secondary antibody conjugate labeled with a detectable marker (for
example, anti-human IgG antibody) to form a sandwich-type
antigen-antibody complex through induction of binding between the
secondary antibody conjugate and the immune complex and identifying
the detectable marker conjugated to the secondary antibody bound to
the sandwich-type antigen-antibody complex.
[0095] The secondary antibody may include an immunoglobulin
fragment prepared by recombination with natural immunoglobulines
isolated from non-human primates (e.g., anti-human IgG mouse
antibody, anti-human IgG goat antibody, etc) or by synthesis.
[0096] The marker conjugated to the secondary antibody may be,
preferably, a conventional coloring agent that performs a color
reaction, and examples of the marker include a fluorescein, such as
horseradish peroxidase (HRP), alkaline phosphatase, coloid gold,
poly L-lysine-fluorescein isothiocyanate (FITC), and
Rhodamine-B-isothiocyanate (RITC), and a dye.
[0097] The sandwich assay was disclosed in U.S. Pat. No. 5,876,935,
and identifying of the detectable marker conjugated to the
secondary antibody may be performed by conventional methods such as
enzyme-linked immunosorbent assay (ELISA), radioimmnoassay (RIA),
sandwich assay, western blotting on polyacrylamide gel,
immunoblotting analysis, or immnohistochemical staining.
[0098] As the fixture of the present invention, any solid support
widely used as a means for immobilizing AIMP2-DX2or its fragment
may be used. Examples of suitable materials for use as the fixture
include synthetic materials, such as polystyrene,
polyvinylchloride, and polyamide, and other synthetic polymers. In
addition, such materials may include natural polymers, such as
cellulose, or may be derived from natural polymers, such as
cellulose acetate, nitrocellulose, and glass. The fixture may be in
form of ball, branch, tube, and microassay or microtiter plate. In
addition, such materials may have a sheet-type structure, such as a
paper strip, a small plate. And a membrane.
[0099] (b) Determining That a Subject Has Lung Cancer or is
Susceptible to Lung Cancer in the Case When an Amount of the
Detected Antibody in the Sample is Greater Than That in a Normal
Person
[0100] In step (b), a subject with an increased amount of
antibodies detected in step (a) as compared with an amount of
anti-AIMP2-DX2 antibodies in a normal person is determined to have
lung caner or be susceptible to lung cancer.
[0101] The amount of antibodies detected in step (a) refers to an
amount of antibodies to AIMP2-DX2 protein in the sample, i.e., an
amount of antu-AIMP2-DX2 autoantibodies.
[0102] The anti-AIMP2-DX2 autoantibodies are not detected in a
normal person who does not have lung cancer, but are detected in a
patient with lung cancer. In particular, the anti-AIMP2-DX2
autoantibodies are significantly highly detected in a patient with
SCLC.
[0103] Therefore, when the level of autoantibodies to AIMP2-DX2
protein detected in a sample of a subject is higher that of
autoantibodies detected in a sample of a normal person, the target
subject may be determined to have lung cancer or to be highly
susceptible to lung cancer.
[0104] Referring to the steps described above, the method of
detecting autoantibodies to AIMP2-DX2 protein of the present
invention may provide information for lung cancer diagnosis to the
target subject.
[0105] According to an embodiment of the present invention, various
SCLC and NSCLC cell lines were incubated, and transcription and
expression levels of AIMP2-DX2 were measured. As a result, the
transcription and expression of AIMP2-DX2 in SCLC and NSCLC cell
lines were confirmed without a difference in levels.
[0106] According to an embodiment of the present invention, serum
of a patient with SCLC and NSCLC was ensured to measure an amount
of anti-AIMP2-DX2 antibodies in the serum by using a nitrocellulose
membrane to which AIMP2-DX2 protein is attached. Consequently, it
was confirmed that the anti-AIMP2-DX2 antibodies were not detected
in a control group including serum of a healthy person, whereas the
anti-AIMP2-DX2 antibodies were detected in a patient with SCLC and
NSCLC. In particular, in the case of a patient with SCLC, it was
confirmed that the anti-AIMP2-DX2 antibodies are significantly
highly detected.
[0107] Meanwhile, the present invention provides a kit for
diagnosing lung cancer, the kit including AIMP2-DX2 protein its a
fragment.
[0108] The kit of the present invention may include AIMP2-DX2
protein or its fragment, detect antibodies to AIMP2-DX2 protein in
the sample, and enable to diagnose lung cancer of a subject.
[0109] The kit of the present invention is characterized by
including AIMP2-DX2 protein or a fragment thereof, and preferably,
may be provided in a fixed conditionon a fixture (solid support) on
which AIMP2-DX2or its fragment can be fixed. The fixture may be the
same as defined above.
[0110] In addition, the kit of the present invention may
specifically bind to an autoantibody binding to AIMP2-DX2, and may
further include a secondary antibody conjugate to which a
detectable marker is conjugated. The secondary antibody may be an
antibody binding to an autoantibody (anti-AIMP2-DX2 antibody), and
preferably, may be an anti-human IgG antibody. The detectable
marker may be the same as defined above.
[0111] In addition, the kit of the present invention may further
include an anti-AIMP2-DX2 autoantibody with a known amount in
advance. Such anti-AIMP2-DX2 autoantibody with a known amount in
advance may be used to establish a standard curve for measurement
of an amount of an anti-AIMP2-DX2 autoantibody with an unknown
amount in a sample derived from a subject.
[0112] In addition, the kit of the present invention may include a
suitable substrate in terms of an antigen-antibody reaction and
color development of the marker, a buffer, or the like.
[0113] Hereinafter, the present invention will be described in
detail by explaining preferred embodiments of the invention.
However, the preferred embodiments should be considered in
descriptive sense only and not for purposes of limitation.
Embodiments of the invention are provided to more fully describe
the present invention to one of ordinary skill in the art.
EXAMPLE 1
Screening of an Inhibitor of DX2-p14/ARF Binding
[0114] The present invention is on the basis of KR 2014-0113543
disclosed by the inventor of the present invention. Considering
that DX2 inhibits induction of carcinogen-inducible p14/ARF so that
a specific binding inhibitor of DX2 and p14/ARF can be used as an
anticancer drug, an anticancer drug was screened as follows.
[0115] 1. Preparation of Compound Library
[0116] Compounds that were individually synthesized and natural
compound library were prepared according to the related document
(J. Clin. Oncol. 16, 1207-1217, 1998; Nat. Rev. Cancer 2, 489-501,
2002), and 8,000 compounds were provided from Korea Chemical Bank
for the present experiments.
[0117] 2. ELISA Analysis
[0118] To screen DX2-p14/ARF binding inhibitors, the screening
system based on ELISA modified as shown in FIG. 1 was used. That
is, 0.5% His-DX2 recombinant proteins were immobilized on a 96-well
plate with paraformaldehyde (PFA). After performing drying and
cleaning processes, GST-p14/ARF proteins were allowed to react with
a random compound (final concentration: 0.1 mM). After 1 hour, the
plate was washed using TBS-T, and then, incubated with anti-GST
antibodies (1:10,000, 30 minutes) and anti-mouse-IgG-HRP (1:50,000,
1 hour). After performing a washing process twice, the plate was
incubated with 3,3',5,5'-tetramethylbenzidine (TMB) solution
(Calbiochem) and stop solution (1N H.sub.2SO.sub.4) for a reaction.
Afterwards, by using an ELISA reader, values were measured at 450
nm, thereby selecting candidate dugs as DX2-p14/ARF binding
inhibitors. Here, more detailed protocol for the present experiment
is described in the known related document (Nat. Rev. Cancer 2,
489-501, 2002), and PAK1-Smad4 binding inhibitors were used to
exclude drugs that are confirmed as common inhibitors.
[0119] 3. Recombinant Proteins, Immunoprecipitation, and GST
Pull-Down Assays
[0120] Through GST pull-down assays, more specific binding
inhibitors were selected among the previously screened candidate
drugs as DX2-p14/ARF binding inhibitors. That is, a p14/ARF
fragment (full-length) was ligated into EcoRI and Hind II sites of
pGEX-TEV vector, which is a modified vector by adding a TEV
protease cleavage site to pGEX-4T1. The recombinant proteins were
then expressed in E. coli strain BL21(DE3) as GST-fusion proteins.
The proteins were purified by glutathione affinity
chromatography.
[0121] To address direct binding between the two proteins,
agarose-bead conjugated GST (negative control) or GST-target
protein was incubated with cell lysate or recombinant protein in
radioimmunoprecipitation assay (RIPA) buffer (NaCl, 25 mM Tris-Cl,
1% NP-40, 1% sodium deoxycholate, 0.1% SDS, protease inhibitor
mixture) for 1 hour at a temperature of 4.degree. C. for a
reaction.
[0122] Immunoprecipitation (IP) assay was performed with cell
lysate or recombinant protein with RIPA buffer. The whole lysates
were incubated with suitable antibodies for 2 hours at a
temperature of 4.degree. C. for a reaction, and then, the mixtures
were added with A/G-agarose beads-conjugated secondary antibody
(Invitrogen, Carlsbad, Calif., USA) for 2 hours. After incubation
for a reaction, the mixtures were washed using RIPA buffer twice,
and precipitated proteins were determined by wester blot
analysis.
[0123] 4. Western Blot Analysis
[0124] To carry out western blot analysis, proteins were thermally
inactivated in RIPA buffer (heat treatment for 7 minutes at a
temperature of 95.degree. C.), and then, the resulting proteins
were applied to SDS-PAGE, followed by western blot analysis
according to a known method in the art (J. Clin. Oncol. 16,
1207-1217, 1998; Nat. Rev. Cancer 2, 489-501, 2002). Antibodies
used herein, e.g., HA (sc-7392), His (sc-8036), GFP (sc-9996), GST
(sc-138), Actin (se-1616), and p19/ARF (sc-32748), were purchased
from Santa Cruz Biochnology, anti-p14/ARF (MAB3782) was purchased
from Millipore, and FLAG-M2 and anti-C-Myc (M5546) were purchased
from Sigma Aldrich. In addition, anti-AIMP2 was provided from
Professor. Kim, Sung-Hoon (Seoul Nat. Univ.).
[0125] 5. Screening of DX2-p14/ARF Binding Inhibitor
[0126] As shown in FIGS. 2A, 2B, and 3A, SLCB050 was obtained as a
compound that selectively inhibits DX2-p14/ARF binding. In
particular, SLCB050 only blocked the interaction of DX2 and AIMP2
as shown in FIG. 2C, but not on p53-AIMP2 or DX2 binding as shown
in FIG. 3B, and p14/ARF as shown in FIG. 3C. In this regard, it was
confirmed that SLCB050 would be interacted with DX2-specific
region.
Synthesis of SLCB050 [(7S)-(+)-3-(2-Furanyl)-acrylic acid,
8,8-dimethyl-2-oxo-6,7-dihydro-2H,8H-pyrano[3,2-g]chromen-7-yl-ester]
##STR00006##
[0128] [Step 1]
[0129] Under N.sub.2 gas, trans-3-(2-furanyl)acrylic acid (560 mg,
4.06 mmol, 1 eq), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide
hydrochloride (EDC, 1.17 g, 6.09 mmol, 1.5 eq), and
4-(dimethylamino)pyridine (4-DMAP, 198 mg, 1.62 mmol, 0.4 eq) were
added to a 100 mL round-bottom flask, and then, dissolved in
anhydrous dichloromethane (100 ml). (S)-(+)-decursinol (1 g, 4.06
mmol, 1 eq, KR 0715206) was added to the mixed solution, followed
by being stirred at room temperature for 5 hours and concentrated
under reduced pressure. The filtrate was then separated by silica
gel column (ethylacetate: n-hexane=gradient elution to 1:3 from
1:8), thereby obtaining (7S)-(+)-3-(2-furanyl)-acrylic acid,
8,8-dimethyl-2-oxo-6,7-dihydro-2H,8H-pyrano[3,2-g]chromen-7-yl-ester
(SLCB050) having the following material properties:
[0130] yield: 73.6%; orange solid-phase; mp: 96.1.degree. C.;
R.sub.f=0.62 (n-hexane:ethyl acetate=1:1);
[.alpha.].sub.D.sup.25+62.4 (c=3, CHCl.sub.3);
[0131] .sup.1H NMR (400 MHz, CDCl.sub.3): .delta..sub.H 7.64 (1H,
s, H-6'), 7.58 (1H, d, J=9.6 Hz, H-4), 7.56 (1H, d, J=16.0 Hz,
H-3'), 7.41 (1H, d, J=1.6 Hz, H-7'), 7.17 (1H, s, H-5), 6.82 (1H,
s, H-10), 6.55 (1H, d, J=1.6 Hz, H-8'), 6.23 (1H, d, J=9.6 Hz,
H-3), 6.13 (1H, d, J=16.0 Hz, H-2'), 5.17 (1H, t, J=4.4 Hz, H-7),
3.23 (1H, dd, J=4.4, 17.6 Hz, H-6a), 2.92 (1H, dd, J=4.4, 17.6 Hz,
H-6b), 1.42 (3H, s, CH.sub.3-8), 1.38 (3H, s, CH.sub.3-8);
[0132] .sup.13C NMR (100 MHz, CDCl.sub.3) .delta..sub.C 166.3
(C-1'), 161.3 (C-2), 156.3 (C-9a), 154.1 (C-10a), 144.8 (C-4'),
144.5 (C-6'), 143.1 (C-4), 135.8 (C-3'), 128.7 (C-5), 117.0 (C-2'),
115.6 (C-5a), 113.3 (C-3), 112.9 (C-7'), 112.9 (C-4a), 107.2
(C-8'), 104.7 (C-10), 76.6 (C-8), 70.0 (C-7), 27.8 (C-6), 24.8
(CH3-8), 23.3 (CH3-8); and
[0133] ESI-MS: m/z=389 [M+Na].sup.+.
[0134] 6. Synthesis of HJH141204 and HJH141206
[0135] As analogous compounds to the previously screened SLCB050,
HJH141204, HJH141206, and SLCB36 were each synthesized.
[0136] As shown in FIGS. 3D and 3E, SLCB050, HJH141204, and
HJH141206 showed inhibitory effects on DX2-p14/ARF binding and did
not affect the interaction of p53-p14/ARF, whereas SLCB36 did not
show inhibitory effect on both binding. Accordingly, it was
confirmed that inclusion of a ribose ring structure in the
compounds is required for the binding inhibition.
1) Synthesis of HJH141206: (7S)-(+)-2-(Furan-2-yl)vinylcarbamic
acid,
8,8-dimethyl-2-oxo-6,7-dihydro-2H,8H-pyrano[3,2-g]chromen-7-yl-ester
##STR00007##
[0138] [Step 1] Trans-3-(2-furanyl)acrylic acid (500 mg, 3.37 mmol)
was dissolved in 20 mL of dry benzene in a round-bottom flask, and
then, triethyamine (TEA, 234 .mu.l, 1.683 mmol) and diphenyl
phosphoryl azide (DPPA, 362 .mu.l, 1.683 mmol) were add thereto for
a reaction at a temperature of 80.degree. C. for 3 hours. After an
extraction process using water and ethylacetate was performed on
the mixed solution, a dehydration process using sodium sulfate was
performed thereon, followed by being concentrated under reduced
pressure.
[0139] [Step 2] The resulting product was dissolved again in dry
benzene, and then, was heated to reflux at a temperature of
80.degree. C. for one day.
[0140] [Step 3] (S)-(+)-decursinol (207 mg, 0.841 mmol) was added
thereto, and TEA (281 .mu.l, 2.019 mmol) and
4-(dimethylamino)pyridine (DMAP, 82 mg, 0.673 mmol) were also added
thereto for a reaction at a temperature of 80.degree. C. for 3
hours. The reaction solution was concentrated under reduced
pressure, and the filtrate was then separated by silica gel column
(ethylacetate: n-hexane=gradient elution to 1:3 from 1:8), thereby
obtaining (7S)-(+)-2-(Furan-2-yl)vinylcarbamic acid,
8,8-dimethyl-2-oxo-6,7-dihydro-2H,8H-pyrano[3,2-g]chromen-7-yl-ester
(HJH141206) having the following material properties:
[0141] yield: 69.7%; brown solid-phase; mp: 58.5.degree. C.;
R.sub.f=0.46 (n-hexane:ethyl acetate=1:1);
[.alpha.].sub.D.sup.25+79.6933 (c=3, CHCl.sub.3);
[0142] .sup.1H NMR (300 MHz, DMSO-d.sub.6): .delta..sub.H 9.894 (d,
J=10.2 Hz, 1H), 7.920 (d, J=9.6 Hz, 1H), 7.493 (s, 2H), 6.984 (dd,
J=10.2, 14.7 Hz, 1H), 6.798 (s, 1H), 6.401-6.383 (m, 1H), 6.264 (d,
J=9.6 Hz, 1H), 6.190 (d, J=3.3, 1H), 5.912 (d, J=14.4 Hz, 1H),
5.056 (t, J=3.6 Hz, 1H), 3.254 (dd, J=4.2, 18.0 Hz, 1H), 2.917 (dd,
J=3.3, 17.7 Hz, 1H), 1.384 (s, 3H, CH.sub.3), 1.313 (s, 3H,
CH.sub.3);
[0143] .sup.13C NMR (100 MHz, DMSO-d.sub.6) .delta..sub.C 160.3,
155.8, 153.5, 153.1, 151.5, 144.1, 141.1, 129.6, 123.9, 115.7,
112.7, 112.6, 111.5, 105.2, 103.5, 99.9, 76.8, 70.2, 27.3, 24.3,
23.7; and
[0144] ESI-MS: m/z=382 [M+H].sup.+.
2) Synthesis of HJH141204: (7R)-(-)-2-(Furan-2-yl)vinylcarbamic
acid,
8,8-dimethyl-2-oxo-6,7-dihydro-2H,8H-pyrano[3,2-g]chromen-7-yl-ester
##STR00008##
[0146] [Step 1] As shown in the reaction formula above,
(+)-decursinol (1, 85 g, 0.35 mol) and triphenylphosphine (226 g,
0.87 mol) were added to a round-bottom flask, and acetonitrile (600
mL) and carbon tetrachloride (600 mL) were dissolved therein at a
ratio of 1:1. Then, the mixed solution was refluxed at temperatures
of 50-60.degree. C. for 2 hours. About half of the filtrate was
concentrated under reduced pressure, followed by being separated by
silica gel column, thereby obtaining
8,8-domethyl-8H-pyrano[3,2-g]chromen-2-one(8) as a sample in the
experiment having the following material properties:
[0147] yield: 98.6%; white solid-phase; m.p: 124.degree. C.;
R.sub.f=0.62 (n-hexane:ethyl acetate=1:1);
[0148] .sup.1H NMR (400 MHz, CDCl.sub.3): .delta..sub.H 7.583 (d,
J=9.52 Hz, 1H), 7.049 (s, 1H), 6.711 (s, 1H), 6.340 (d, J=10.0 Hz,
1H), 6.213 (d, J=9.52 Hz, 1H), 5.691 (d, J=9.76 Hz, 1H), 1.467 (s,
6H, CH.sub.3X2); and
[0149] ESI-MS: m/z=229 [M+H].sup.+.
[0150] [Step 2] 15% sodium hypochlorite (60 mL) and 0.05 M sodium
phosphate dibasic (24 mL) were added to a round-bottom flask, and
the reaction solution was adjusted using 1N sodium hydroxide
solution or 1N hydrochloride solution to have pH of 11.3. Then, to
the reaction solution, a solution in which
8,8-dimethyl-8H-pyrano[3,2-g]chromen-2-on (8, 1.3 g, 5.7 mmol) and
(R,R)-(-),N,N'-bis(3,5-di-tert
butylsalicylidene)-1,2,-cyclohexanediamino manganese (III) chloride
(Jacobsen catalyst, 69.9 mg, 0.11 mmol) were dissolved in
dichloromethane (15 ml) was added. The mixed reaction solution was
stirred at a temperature of 0.degree. C. for about 7 hours. An
extraction process was performed on the mixed reaction solution by
using dichloromethane, and an organic layer obtained therefrom was
washed with water, wherein the organic layer was reddish brown.
After the organic layer was dried over anhydrous magnesium sulfate,
the filtrate was concentrated under reduced pressure. To obtain
pure products, the concentrated solution was separated by silica
gel column, thereby obtaining
(6R,7R)-6,7-epoxy-8,8-dimethyl-6H-pyrano[3,2-g]chromen-2-on(9)
having the following material properties:
[0151] yield: 56.3%; white solid-phase; m.p: 145.2.degree. C.;
R.sub.f=0.32 (n-hexane:ethyl acetate=1:1);
[.alpha.].sub.D.sup.25+201.8 (c=3, CHCl.sub.3);
[0152] .sup.1H NMR (400 MHz, CDCl.sub.3): .delta..sub.H 7.643 (d,
J=9.52 Hz, 1H), 7.470 (s, 1H), 6.754 (s, 1H), 1H), 6.265 (d, J=9.52
Hz, 1H), 3.976 (d, J=3.88 Hz, 1H), 3.551 (d, J=3.88 Hz, 1H), 1.609
(s, 3H, CH.sub.3), 1.312 (s, 3H, CH.sub.3); and
[0153] ESI-MS: m/z=245 [M+H].sup.+.
[0154] [Step 3] As shown in the reaction formula above,
(6R,7S)-6,7-epoxy-8,8-dimethyl-6H-pyrano[3,2-g]cyromen-2-on (9, 600
mg, 2.456 mmol) was dissolved in tetrahydrofuran in a round-bottom
flask. Then, sodium cyanoborohydride and borane trifluoride diethyl
etherate was added thereto. The mixed reaction solution was stirred
at a temperature of 0.degree. C. for 30 minutes. The filtrate of
the mixed reaction solution was concentrated under reduced
pressure, followed by being separated by silica gel column, thereby
obtaining (-)-decursinol[decursinol;
(7R)-7-hydroxy-8,8-dimethyl-8H-pyrano[3,2-g]chromen-2-on (10)] as a
sample in the experiment having the following material
properties:
[0155] yield: 98.6%; white solid-phase; m.p: 135.6.degree. C.;
R.sub.f=0.179 (n-hexane:ethyl acetate=1:1);
[.alpha.].sub.D.sup.25-18.4 (c=4, CHCl.sub.3);
[0156] .sup.1H NMR (400 MHz, CDCl.sub.3): .delta..sub.H 7.579 (d,
J=9.5 Hz, 1H), 7.180 (s, 1H), 6.780 (s, 1H), 6.219 (d, J=9.52 Hz,
1H), 3.876 (d, J=5.1 Hz, 1H), 3.112 (dd, J=4.8 Hz, 16.7 Hz, 1H),
2.837 (dd, J=5.6 Hz, 16.6 Hz, 1H), 1.397 (s, 3H, CH.sub.3), 1.367
(s, 3H, CH.sub.3); and
[0157] ESI-MS: m/z=247 [M+H].sup.+.
[0158] [Step 4] Trans-3-(2-furanyl)acrylic acid (500 mg, 3.37 mmol)
was dissolved in 20 mL of dry benzene in a round-bottom flask, and
then, TEA (234 .mu.l, 1.683 mmol) and DPPA (362 .mu.l, 1.683 mmol)
were add thereto for a reaction at a temperature of 80.degree. C.
for 3 hours. After an extraction process using water and
ethylacetate was performed on the mixed solution, a dehydration
process using sodium sulfate was performed thereon, followed by
being concentrated under reduced pressure.
[0159] [Step 5] The resulting product was dissolved again in dry
benzene, and then, was heated to reflux at a temperature of
80.degree. C. for one day.
[0160] [Step 6] (-)-decursinol (207 mg, 0.841 mmol) synthesized in
step 3 was added thereto, and TEA (281 .mu.l, 2.019 mmol) and
4-(dimethylamino)pyridine (DMAP, 82 mg, 0.673 mmol) was added
thereto for a reaction at a temperature of 80.degree. C. for 3
hours. The reaction solution was concentrated under reduced
pressure, and the filtrate was then separated by silica gel column
(ethyl acetate: n-hexane=gradient elution to 1:3 from 1:8), thereby
obtaining (7R)-(-)-2-(Furan-2-yl)vinylcarbamic acid,
8,8-dimethyl-2-oxo-6,7-dihydro-2H,8H-pyrano[3,2-g]chromen-7-yl-ester
(HJH141204) as a sample in the experiment having the following
material properties:
[0161] yield: 80.9%; brown solid-phase; mp: 58.1.degree. C.;
R.sub.f=0.46 (n-hexane:ethyl acetate=1:1);
[.alpha.].sub.D.sup.25-79.6467 (c=3, CHCl.sub.3);
[0162] .sup.1H NMR (300 MHz, DMSO-d.sub.6): 9.896 (d, J=10.2 Hz,
1H), 7.902 (d, J=9.6 Hz, 1H), 7.477 (s, 2H), 6.992 (dd, J=10.2,
14.4 Hz, 1H), 6.790 (s, 1H), 6.396-6.387 (m, 1H), 6.255 (d, J=9.6
Hz, 1H), 6.185 (d, J=3.3 Hz, 1H), 5.919 (d, J=14.4 Hz, 1H), 5.059
(t, J=3.7 Hz, 1H), 3.251 (dd, J=4.2, 18.0 Hz, 1H), 2.922 (dd,
J=3.3, 18.0 Hz, 1H), 1.384 (s, 3H, CH.sub.3), 1.313 (s, 3H,
CH.sub.3);
[0163] .sup.13C NMR (100 MHz, DMSO-d.sub.6) .delta..sub.C 160.3,
155.9, 153.6, 153.2, 151.6, 144.0, 141.1, 129.6, 124.0, 115.7,
112.7, 112.6, 111.5, 105.2, 103.5, 100.0, 76.9, 70.3, 27.3, 24.3,
23.7; and
[0164] ESI-MS: m/z=382 [M+H].sup.+.
3) SLCB36 Compound
##STR00009##
[0165] EXAMPLE 2
Evaluation of Anticancer Effect
[0166] 1. Cell Culture
[0167] A549, HCT116, H1299, and HEK293 cell lines were each
purchased from American Type culture collection (ATCC, Manassas,
Va.), and cultured in RPMI-1640 medium or Dulbecco modified Eagle
medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1%
antibiotics. NSCLC cell lines (NCI-H23, NCI-H322, NCI-H358, and
NCI-H460) purchased from ATCC and SCLC cell lines (NCI-H69,
NCI-H128m and NCI-H146) purchased from Korean Cell line Bank (KCLB,
Seoul, Korea) were cultured in RPMI-1640 medium supplemented with
10% FBS. Mouse embryonic fibroblast (MEF) cells were isolated from
14.5 day embryos using a standard protocol and cultured in DMEM
medium supplemented with 15% FBS and 1% antibiotics.
[0168] 2. Preparation of Mice
[0169] All experimental procedures using laboratory animals were
approved by the animal care committee of Pusan National University.
DX2 (C57/BL6) and K-RasLA2 (C57/BL6) mice were obtained from Dr.
Kim, Sung-Hoon and Professor. Choi, Kang-Ryeol (Yonsei University),
respectively, and double Tg mice were obtained by cross-breeding of
DX2 and K-RasLA2 mice. Before experiment, all mice were maintained
under temperature- and light-controlled conditions (20-23.degree.
C., 12 h/12 h light/dark cycle), and provided autoclaved food and
water.
[0170] 3. Recombinant Proteins, Immunoprecipitation and GST
Pull-Down Assays
[0171] In the same manner as in Example 1, recombinant proteins, IP
assay, GST pull-down assay, and western blot analysis were
performed.
[0172] 4. MTT Assay
[0173] By MTT assay, anticancer effects were confirmed based on
viability of tumor cells. That is, cells were incubated in 0.5
mg/ml of MTT solution for 4 hours at a temperature of 37.degree. C.
for a reaction, and then, formazen products formed therefrom were
dissolved in dimethyl sulfoxide (DMSO). Then, absorbance thereof
was measured at 540 nm by using a spectrometer.
[0174] 5. Drug Treatment In Vivo
[0175] DK (5 month-old, N=6) mice were administered with carrier,
SLCB050 (5 or 10 mg/kg), Adriamycin (1, 2.5, or 5 mg/kg), and a
combination of SLCB050 and Adriamycin by intraperitoneal (i.p.)
injection. After termination of the experiment of each group, mice
were dissected and isolated lung tissues. For xenograft,
1.times.10.sup.7 H446 cells (ATCC) were seeded in nude ice. After 4
weeks, tumor bearing mice were injected with Adriamycin, SLCB0505,
or a combination thereof for 6 weeks. Every weeks, tumor volume and
body weight were measured.
[0176] 6. Histological Analysis
[0177] After dissection of mice, tissues were fixed using 10%
formalin (in PBS) for 24 hours, and embedded in paraffin blocks
according to a basic tissue processing procedure. For histological
analysis, embedded tissues were cut for 5 .mu.M by Leica microtome
(Wetzlar, Germany) and transferred onto adhesive-coated slides
(Marienfeld laboratory glassware, Germany). After deparaffin and
rehydration, sections were then stained with H&E for routine
examination.
[0178] For IHC staining, rehydrated tissue sections were incubated
with antibodies to Ki-67 (Abcam, ab15580), pan-keratin (Sigma,
C2931), pro-surfactant C (Millipore, AB3786), NSE (DAKO, IS612),
and HER2/Neu (DAKO, A0458) for a reaction. Antigen retrieval was
performed using 10 mM sodium citrate (pH 6.0) twice at a
temperature of 95.degree. C. for 10 minutes each, and endogenous
peroxidase activity was blocked with 3% hydrogen peroxidase for 10
min. Then, the slides were dehydrated following a standard
procedure and sealed with cover glass using mounting solution.
TUNEL reaction was done as described in the manual for In Situ Cell
Death Detection Kit, POD (Hoffmann-La Roche Ltd, Basel,
Swizerland).
[0179] 7. Analysis of Tumor Incidence and Area
[0180] To evaluate tumor incidence, lung tissues of each mouse was
fixed and embedded in paraffin. 5 sections from each mouse were
examined by 3 independent investigator, who counted tumor. In
addition, tumor area was calculated by tumor occupied area in total
lung area using photoshop software.
[0181] 8. Experiment Results
[0182] As shown in FIGS. 4A and 4B, SLCB050 treatment blocked the
interaction of DX2-p14/ARF, and DX2 and p14/ARF were localized in
nucleus. In addition, the increase of p14/ARF in SLCB050-treated
H1299 and H69 cell lines was observed as shown in FIG. 4C while
reduction of DX2 in p14/ARF-deficient cell lines (H322, H460, and
A549) was observed as shown in FIG. 4D. In addition,
p14/ARF-deficient cell lines were resistant to SLCB050 as shown in
FIG. 5, whereas SCLC cell lines were sensitive to SLCB050. In
particular, SLCB050 completely suppressed the H128 cell growth as
shown in FIG. 6. In addition, HJH141204 and HJH141206 also
suppressed cell viability as shown in FIG. 7, and accordingly, it
was confirmed that rumor cell growth suppression was achieved by
compound-DX2 binding.
[0183] It was evaluated whether SLCB050 was able to restore the
sensitivity to the anticancer drug. As shown in FIG. 8A, resistance
to GN 25 (synthesized as described in KR 1298168) in DX2 and DK MEF
was abolished by co-treatment of SLCB050. In addition, as shown in
FIG. 8B, resistance to Adriamycin in DX2 and DK MEF was abolished
by co-treatment of Adriamycin (Adr) and SLCB050. In addition, as
shown in FIG. 8C, SCLC cell line H69 was partially responded to
SLCB050. However, as shown in FIG. 8C, p14/ARF deficient H322 did
not show synergic response to combination treatment with
SLCB050.
[0184] As shown in FIG. 9A, the tumor xenograft model using H446
was resistant to Adriamycin and partially responded to SLCB050. In
addition, as shown in FIG. 9B, the increased tumor volume in the
tumor xenograft model using H446 was moderately suppressed by
SLCB050 injection (10 mg/kg, three times/week). In addition, the
tumor inhibition effect was observed by injection of 5 mg/kg of
Adriamycin (three times/week), but it evoked rapid weight loss and
death. In contrast, combinational treatment with SLCB050 (10 mg/kg)
showed more obvious anticancer effect as shown in FIG. 9B, despite
low dosage (2.5 mg/kg) of Adriamycin treatment. Indeed,
combinational treatment of Adriamycin and SLCB050 could obviously
induce p53 expression in primary tumor cells obtained from DX2 or
DK mouse as shown in FIG. 9C. These results indicate that
inhibition of DX2 could enhance anticancer drug sensitivity through
re-activation of p14/ARF.
[0185] To evaluate the anticancer effect of SLCB050 in a mouse
model, SLCB050 was injected into DK mice according to an
experimental schedule as shown in FIG. 10A. Combinational treatment
of SLCB050 (10 mg/kg) and low dose (2.5 mg/kg) Adriamycin
significantly suppressed tumor progression as shown in FIGS. 10B
and 10C without significant weight loss. However, as shown in FIG.
10B, non-toxic dose of Adriamycin did not show anticancer effect on
the mouse model.
[0186] More detailed histological analysis showed that SCLC region
was more obviously erased by combinational treatment of Adriamycin
and SLCB050 as shown in FIG. 11. As shown in FIG. 12A, under
DX2-reduced condition upon SLCB050 treatment, apoptotic tumor cells
were obviously increased as shown in FIGS. 12B and 12C. These
results indicate that DX2 produced by aberrant splicing of AIMP2
promotes tumor progression, in particular, small cell lung cancer,
via direct interaction and inhibition of p14/ARF as shown in FIG.
13. Thus, it was confirmed that small cell lung cancer would be
treated by the compound inhibiting DX2-p14/ARF binding.
EXAMPLE 3
Comparative Measurement of AIMP2-DX2 Expression Levels in SCLC and
NSCLC Cells
[0187] 1. Cell Culture
[0188] NSCLC cell lines (A549,H1299, NCI-H23, NCI-H322, NCI-H358,
and NCI-H460), HCT116 cell lines, and HEK293 cell lines were
available from American Type Culture Collection (Manassas, Va.),
and cultured in RPMI-1640 medium or DMEM supplemented with 10% FBS
and 1% antibiotics.
[0189] NCI-H69, NCI-H128, and NCI-H146, which are SCLC cell lines,
were purchased from Korean Cell Line Bank (Seoul, Korea), and
cultured in a RPMI-1640 medium supplemented with 10% FBS.
[0190] 2. Measurement of AIMP2-DX2 Expression Levels
[0191] Cells cultured in RIPA buffer (150 mM NaCl, 25 mM Tris-Cl,
1% NonidetP-40, 1% sodium deoxycholate, 0.1% sodium dodecyl
sulfate, protease inhibitor cocktail) were suspended to separate
proteins therefrom.
[0192] A sample including the separated proteins was thermally
inactivated at a temperature of 95.degree. C. for 7 minutes, and
then, the resulting proteins were applied to SDS-PAGE, followed by
western blot analysis according to a known method in the art (T.
Mahmood, P. C. Yang. N. Am. J. Med. Science. 4: 429-434, 2012).
[0193] Commercially available Actin antibodies (sc-1616, Santa Cruz
Biotechnology) were used, and AIMP2 and AIMP2-DX2 antibodies were
prepared according to a conventional antibody preparation
method.
[0194] As shown in FIG. 14, AIMP2-DX2 was similarly expressed in
NSCLC cells and SCLC cells without a significant difference.
[0195] 3. Measurement of AIMP2-DX2 Transcription
[0196] To measure ATMP2-DX2 transcription levels, NSCLC cells, such
as A549, H1299, H23, H322, and H460, and SCLC cells, such as H146
and H69, were used. Primer sequences of SEQ ID NO: 1 or 2 listed in
Table 1 were used to amplify ATMP2-DX2, and primer sequences of SEQ
ID NO: 3 or 4 listed in Table 1 were used to amplify GAPDH.
[0197] Consequently, as shown in FIG. 15, AIMP2-DX2 transcription
levels were not different from those in SCLS cells and NSCLC
cells.
TABLE-US-00001 TABLE 1 SEQ ID Name of primer Sequence NO Forward
ATMP2-DX2 5'- AACGTGCACGGCAGGAGCTAC -3' 1 Reverse ATMP2-DX2 5'-
CCAGCTGATAGTCTTGGCGGG -3' 2 Forward GAPDH 5'- ATCTTCCAGGAGCGAGATCCC
-3' 3 Reverse GAPDH 5'- AGTGAGCTTCCCGTTCAGCTC -3' 4
EXAMPLE 4
Measurement of AIMP2-DX2 Autoantibody Levels Serum of Patients With
SCLC and NSCLS
[0198] Sera of health individuals and patients with SCLC and NSCLC
were available from Bucheon Hospital (schbc-biobank-2011-003). To
measure anti-AIMP2-DX2 antibody levels, autoantibody levels were
measured according to the experiment protocol shown in FIG. 16.
Recombinant AIMP2-DX2, Lamin A, and Snail were each attached onto a
nitrocellulose membrane (0.5 ng/well). Here, each membrane was
incubated with a serum sample, which was diluted with blocking
buffer at a ratio of 1:1000, for a reaction for 1 hour, and
sequentially with (HRP)-conjugated anti-human antibodies (1:20,000)
for 30 minutes. Then, sites on which human antibodies were attached
were visualized by ECL in terms of chemiluminescence and X-ray film
exposure.
[0199] As a result, as shown in FIG. 17, AIMP2-DX2 autoantibodies
were not detected at all in control group (healthy individuals)
while they were detected in a group of patients with NSCLC or SCLC.
In particular, in the case of a group of patients with SCLC (8 out
of 10 cases) AIMP2-DX2 autoantibodies were detected, and thus, it
was confirmed that AIMP2-DX2 autoantibodies were significantly
highly detected in serum of a group of patients with SCLC.
[0200] However, SLCB050 of the present invention can be formulated
in various forms according to purposes. In the following,
embodiments of formulations using the compound of the present
invention as an effective component are provided, but the present
invention is not limited thereto.
FORMULATION EXAMPLE 1
Tablet (Direct Pressurization)
[0201] 5.0 mg of SLCB050 was filtered through a sieve, and then,
mixed with 14.1 mg of lactose, 0.8 mg of Crospovidone USNF, and 0.1
mg of magnesium stearate. A pressure was applied thereto to prepare
the mixture in form of a tablet.
FORMULATION EXAMPLE 2
Tablet (Wet Granulation)
[0202] 5.0 mg of SLCB050 was filtered through a sieve, and then,
mixed with 16.0 mg of lactose and 4.0 mg of starch. A solution in
which 0.3 mg of Polysorbate 80 was dissolved in pure water was
added to the mixture in an appropriate amount, and then, the
resulting solution was subjected to grain refining. After being
dried, grains were filtered through a sieve, and then, mixed with
2.7 mg of colloidal silicon dioxide and 2.0 mg of magnesium
stearate. A pressure was applied thereto to prepare the grains in
form of a tablet.
FORMULATION EXAMPLE 3
Powder and Capsule
[0203] 5.0 mg of SLCB050 was filtered through a sieve, and then,
mixed with 14.8 mg of lactose, 10.0 mg of polyvinyl pyrrolidone,
and 0.2 mg of magnesium stearate. The mixture was added to hard
Gelatin Capsule Size 5 by using an appropriate device, thereby
preparing the mixture in form of a capsule.
FORMULATION EXAMPLE 4
Injection
[0204] 100 mg of SLCB050, 180 mg of mannitol, 26 mg of
Na.sub.2HPO.sub.412H.sub.2O, and 2.974 mg of distilled water were
mixed together. A transparent glass ampoule was filled with the
mixed solution, and then, sealed under an upper lattice by
dissolving the glass. A sterilization process was performed thereon
through autoclave at a temperature of 120.degree. C. for at least
15 minutes, thereby preparing the mixture in form of injection.
[0205] It should be understood that embodiments described herein
should be considered in a descriptive sense only and not for
purposes of limitation. Descriptions of features or aspects within
each embodiment should typically be considered as available for
other similar features or aspects in other embodiments.
[Sequence List Free Text]
[0206] SEQ ID NO: 1 or 2 is a base sequence of a pair of primers
for amplifying AIMP2-DX2.
[0207] SEQ ID NO: 3 or 4 is a base sequence of a pair of primers
for amplifying GAPDH.
[0208] SEQ ID NO: 5 is an amino acid sequence of an AIMP2-DX2
protein.
[0209] SEQ ID NO: 6 is an amino acid sequence of an AIMP2-DX2
protein.
Sequence CWU 1
1
6121DNAArtificial SequenceAIMP2-DX2 forward primer 1aacgtgcacg
gcaggagcta c 21221DNAArtificial SequenceAIMP2-DX2 reverse primer
2ccagctgata gtcttggcgg g 21321DNAArtificial SequenceGAPDH forward
primer 3atcttccagg agcgagatcc c 21421DNAArtificial SequenceGAPDH
reverse primer 4agtgagcttc ccgttcagct c 215251PRTArtificial
SequenceAIMP2-DX2 of Homo sapiens 5Met Pro Met Tyr Gln Val Lys Pro
Tyr His Gly Gly Gly Ala Pro Leu 1 5 10 15 Arg Val Glu Leu Pro Thr
Cys Met Tyr Arg Leu Pro Asn Val His Gly 20 25 30 Arg Ser Tyr Gly
Pro Ala Pro Gly Ala Gly His Val Gln Asp Tyr Gly 35 40 45 Ala Leu
Lys Asp Ile Val Ile Asn Ala Asn Pro Ala Ser Pro Pro Leu 50 55 60
Ser Leu Leu Val Leu His Arg Leu Leu Cys Glu His Phe Arg Val Leu 65
70 75 80 Ser Thr Val His Thr His Ser Ser Val Lys Ser Val Pro Glu
Asn Leu 85 90 95 Leu Lys Cys Phe Gly Glu Gln Asn Lys Lys Gln Pro
Arg Gln Asp Tyr 100 105 110 Gln Leu Gly Phe Thr Leu Ile Trp Lys Asn
Val Pro Lys Thr Gln Met 115 120 125 Lys Phe Ser Ile Gln Thr Met Cys
Pro Ile Glu Gly Glu Gly Asn Ile 130 135 140 Ala Arg Phe Leu Phe Ser
Leu Phe Gly Gln Lys His Asn Ala Val Asn 145 150 155 160 Ala Thr Leu
Ile Asp Ser Trp Val Asp Ile Ala Ile Phe Gln Leu Lys 165 170 175 Glu
Gly Ser Ser Lys Glu Lys Ala Ala Val Phe Arg Ser Met Asn Ser 180 185
190 Ala Leu Gly Lys Ser Pro Trp Leu Ala Gly Asn Glu Leu Thr Val Ala
195 200 205 Asp Val Val Leu Trp Ser Val Leu Gln Gln Ile Gly Gly Cys
Ser Val 210 215 220 Thr Val Pro Ala Asn Val Gln Arg Trp Met Arg Ser
Cys Glu Asn Leu 225 230 235 240 Ala Pro Phe Asn Thr Ala Leu Lys Leu
Leu Lys 245 250 6243PRTArtificial SequenceAIMP2-DX2 of Homo sapiens
6Met Pro Met Tyr Gln Val Lys Pro Tyr His Gly Gly Gly Ala Pro Leu 1
5 10 15 Arg Val Glu Leu Pro Thr Cys Met Tyr Arg Leu Pro Asn Val His
Gly 20 25 30 Arg Ser Tyr Gly Pro Ala Pro Gly Ala Gly His Val Gln
Asp Tyr Gly 35 40 45 Ala Leu Lys Asp Ile Val Ile Asn Ala Asn Pro
Ala Ser Pro Pro Leu 50 55 60 Ser Leu Leu Val Leu His Arg Leu Leu
Cys Glu His Phe Arg Val Leu 65 70 75 80 Ser Thr Val His Thr His Ser
Ser Val Lys Ser Val Pro Glu Asn Leu 85 90 95 Leu Lys Cys Phe Gly
Glu Gln Asn Lys Lys Gln Pro Arg Gln Asp Tyr 100 105 110 Gln Leu Gly
Phe Thr Leu Ile Trp Lys Asn Val Pro Lys Thr Gln Met 115 120 125 Lys
Phe Ser Ile Gln Thr Met Cys Pro Ile Glu Gly Glu Gly Asn Ile 130 135
140 Ala Arg Phe Leu Phe Ser Leu Phe Gly Gln Lys His Asn Ala Val Asn
145 150 155 160 Ala Thr Leu Ile Asp Ser Trp Val Asp Ile Ala Ile Phe
Gln Leu Lys 165 170 175 Glu Gly Ser Ser Lys Glu Lys Ala Ala Val Phe
Arg Ser Met Asn Ser 180 185 190 Ala Leu Gly Lys Ser Pro Trp Leu Ala
Gly Asn Glu Leu Thr Val Ala 195 200 205 Asp Val Val Leu Trp Ser Val
Leu Gln Gln Ile Gly Gly Cys Ser Val 210 215 220 Thr Val Pro Ala Asn
Val Gln Arg Trp Met Arg Ser Cys Glu Asn Leu 225 230 235 240 Ala Pro
Phe
* * * * *