U.S. patent application number 16/074724 was filed with the patent office on 2018-12-13 for vaccine composition and preparation method and use thereof.
The applicant listed for this patent is PULIKE BIOLOGICAL ENGINEERING,INC.. Invention is credited to Yi CHENG, Wenqiang PANG, Jinzhong SUN, Kegong TIAN, Xuke ZHANG.
Application Number | 20180353595 16/074724 |
Document ID | / |
Family ID | 63674114 |
Filed Date | 2018-12-13 |
United States Patent
Application |
20180353595 |
Kind Code |
A1 |
TIAN; Kegong ; et
al. |
December 13, 2018 |
VACCINE COMPOSITION AND PREPARATION METHOD AND USE THEREOF
Abstract
The present disclosure provides a vaccine composition comprising
an immune amount of Fiber protein of egg drop syndrome virus or an
immune amount of a live vector recombined with gene of the Fiber
protein of egg drop syndrome virus and a veterinarily acceptable
carrier.
Inventors: |
TIAN; Kegong; (Luoyang,
CN) ; CHENG; Yi; (Luoyang, CN) ; PANG;
Wenqiang; (Luoyang, CN) ; SUN; Jinzhong;
(Luoyang, CN) ; ZHANG; Xuke; (Luoyang,
CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PULIKE BIOLOGICAL ENGINEERING,INC. |
Luoyang |
|
CN |
|
|
Family ID: |
63674114 |
Appl. No.: |
16/074724 |
Filed: |
November 3, 2017 |
PCT Filed: |
November 3, 2017 |
PCT NO: |
PCT/CN2017/109358 |
371 Date: |
August 1, 2018 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/552 20130101;
A61K 39/235 20130101; A61K 2039/5252 20130101; A61K 2039/70
20130101; A61P 31/20 20180101; C12N 2720/10034 20130101; C12N
2770/20034 20130101; A61K 39/17 20130101; C12N 2760/16034 20130101;
C12N 2760/18134 20130101; A61K 39/215 20130101; C12N 2710/10034
20130101; A61K 39/145 20130101; A61K 39/12 20130101; A61K
2039/55566 20130101 |
International
Class: |
A61K 39/235 20060101
A61K039/235; A61K 39/17 20060101 A61K039/17; A61K 39/145 20060101
A61K039/145; A61K 39/215 20060101 A61K039/215 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 1, 2017 |
CN |
201710213661.6 |
Claims
1. A vaccine composition against egg drop syndrome virus, wherein
the vaccine composition comprises an immune amount of antigen of
egg drop syndrome virus and a veterinarily acceptable carrier;
wherein the antigen of egg drop syndrome virus is an antigen of
Fiber protein of egg drop syndrome virus or a live vector
recombined with gene of the Fiber protein of egg drop syndrome
virus.
2. The vaccine composition according to claim 1, wherein the Fiber
protein of egg drop syndrome virus is a protein encoded by a
nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2.
3. The vaccine composition according to claim 1, wherein the HA
titer of the antigen of the Fiber protein of egg drop syndrome
virus is equal to or greater than 1:32.
4. The vaccine composition according to claim 1, wherein the HA
titer of the antigen of the Fiber protein of egg drop syndrome
virus is between 1:32 and 1:128.
5. The vaccine composition according to claim 1, wherein the HA
titer of the antigen of the Fiber protein of egg drop syndrome
virus is between 1:32 and 1:64.
6. The vaccine composition according to claim 1, wherein the live
vector recombined with gene of the Fiber protein of egg drop
syndrome virus is recombinant attenuated Salmonella, recombinant
Newcastle disease virus or recombinant poxvirus.
7. The vaccine composition according to claim 1, wherein the
pharmaceutically acceptable carrier comprises an adjuvant, which
comprises one or more of (1) alhydrogel adjuvant, saponins,
Avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion,
water-in-oil-in-water emulsion; or (3) the polymers of acrylic or
methaciylic acid, the copolymers of maleic anhydride and alkenyl
derivative; and the RIBI adjuvant system, Block co-polymer, SAF-M,
monophosphoryl lipid A, lipid-amine adjuvant, heat-labile
enterotoxin from E. coli, cholera toxin, IMS 1314 muramyl dipeptide
and Gel adjuvant.
8. The vaccine composition according to claim 1, wherein the
adjuvant is a white oil adjuvant for preparation of water-in-oil
emulsion.
9. The vaccine composition according to claim 1, wherein the
concentration of the adjuvant ranges from 5% to 70% V/V.
10. The vaccine composition according to claim 9, wherein the
concentration of the adjuvant ranges from 30% to 70% V/V.
11. The vaccine composition according to claim 10, wherein the
concentration of the adjuvant is 66% V/V.
12. The vaccine composition according to claim 1, wherein the
vaccine composition further comprises one or more antigens
including an antigen of Newcastle disease virus, an antigen of
avian influenza virus, an antigen of avian infectious bronchitis
virus, an antigen of infectious bursal disease, an antigen of fowl
adenovirus, an antigen of avian reovirus, an antigen of Escherichia
coli, an antigen of avibacterium paragallinarum, an antigen of
Mycoplasma Synoviae, an antigen of Mycoplasma gallisepticum, an
antigen of Pasteurella multocida, an antigen of Marek's disease
virus, an antigen of avian encephalomyelitis virus and an antigen
of infectious laryngotracheitis virus.
13. The vaccine composition according to claim 1, wherein the
vaccine composition further comprises one or more antigens
including an inactivated antigen of Newcastle disease virus, an
inactivated antigen of avian influenza virus, an inactivated
antigen of avian infectious bronchitis virus, a subunit antigen of
infectious bursal disease virus, and an inactivated antigen or a
subunit antigen of fowl adenovirus.
14. The vaccine composition according to claim 1, wherein the
inactivated antigen of Newcastle disease virus is an inactivated
antigen of N7a strain, the inactivated antigen of avian influenza
virus are inactivated antigens of SZ strain, the inactivated
antigen of avian infectious bronchitis virus are inactivated
antigen of M41 strain, the subunit antigen of infectious bursal
disease virus are VP2 protein of infectious bursal disease virus,
the inactivated antigen of fowl adenovirus are inactivated antigens
of FAV-HN strain, and the subunit antigen of fowl adenovirus are
Penton protein or Fiber-2 protein of the fowl adenovirus.
15. The vaccine composition according to claim 13, wherein the HA
titer of the Fiber protein of the egg drop syndrome virus is
between 1:32 and 1:128, the content of the inactivated antigen of
the Newcastle disease virus is 10.sup.8.0-10.sup.9.0EID.sub.50/0.1
ml before inactivation, the content of the inactivated antigen of
the avian influenza virus is 10.sup.6.5-10.sup.8.5 EID.sub.50/0.1
ml before inactivation, the content of the inactivated antigen of
the avian infectious bronchitis virus is 10.sup.6.0-10.sup.7.0
EID.sub.50/0.1 ml before inactivation, and the AGP titer of the VP2
protein of the avian infectious bursal disease virus is between
1:16 and 1:128, the AGP titer of the Penton protein of the fowl
adenovirus is between 1:2 and 1:16, and the AGP titer of the
Fiber-2 protein of the fowl adenovirus is between 1:2 and 1:16.
16. The vaccine composition according to claim 15, wherein the HA
titer of the Fiber protein of the egg drop syndrome virus is
between 1:32 and 1:128, the content of the inactivated antigen of
the Newcastle disease virus is 10.sup.8.0 EID.sub.50/0.1 ml before
inactivation, the content of the inactivated antigen of the avian
influenza virus is 10.sup.8.0 EID.sub.50/0.1 ml before
inactivation, the content of the inactivated antigen of the avian
infectious bronchitis virus is 10.sup.6'.sup.0EID.sub.50/0.1 ml
before inactivation, and the AGP titer of the VP2 protein of the
avian infectious bursal disease virus is 1:16, the AGP titer of the
Penton protein of the fowl adenovirus is 1:4, and the AGP titer of
the Fiber-2 protein of the fowl adenovirus is 1:4.
17. A preparation method of the vaccine composition according to
claim 1, wherein the preparation method comprises: step (1),
cloning a gene of the Fiber protein of egg drop syndrome virus and
recombining the gene of the Fiber protein of egg drop syndrome
virus into an expression vector so as to obtain a recombinant
expression vector recombined with the gene of the Fiber protein of
egg drop syndrome virus; step (2), transforming the recombinant
expression vector recombined with the gene of the Fiber protein of
egg drop syndrome virus and an expression vector of a molecular
chaperone into Escherichia coli in order to express the Fiber
protein of egg drop syndrome virus; step (3), treating the
expressed the Fiber protein of egg drop syndrome virus with a
non-ionic surfactant in order to remove endotoxin; and step (4),
mixing the Fiber protein of egg drop syndrome virus in which the
endotoxin is removed with an adjuvant to obtain the vaccine
composition.
18. A method of preventing and/or treating infection of egg drop
syndrome virus by applying the vaccine composition according to
claim 1.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims priority from PCT Application Serial
No. PCT/CN2017/109358, entitled "Vaccine Composition and
Preparation Method and Use Thereof," filed on Nov. 3, 2017, which
claims priority from a Chinese Application Serial No.
201710213661.6, filed on Apr. 1, 2017, the contents of which are
hereby incorporated herein in their entirety by this reference.
FIELD OF TECHNOLOGY
[0002] The present disclosure relates to a vaccine composition
against avian egg drop syndrome virus and a preparation method and
use thereof, belonging to the field of biomedicine.
BACKGROUND ART
[0003] Egg drop syndrome virus (EDSV) belongs to the group III of
avian adenovirus. Poultry infected with this virus has no obvious
clinical symptom, some of which may have slight diarrhea. The
infection occurs frequently during a peak of egg laying, resulting
in soft eggshells, thin eggshells, shell-less eggs and a serious
decline in egg production rate, and causing serious economic
losses.
[0004] EDSV has a typical morphology of adenovirus, without any
envelope and with hemagglutination activity, which proliferates in
the fallopian tubes of poultry. The genome of the EDSV is a linear
double-stranded DNA of about 33 kb. The viral particles consist of
structural proteins, the nucleocapsid has a diameter of 70 to 80
nm. The EDSV is icosahedrally symmetrical with DNA encapsidated in
the capsid. The nucleocapsid consists of 252 capsid particles, of
which 240 are Hexon proteins, forming 20 faces and most edges of an
icosahedron. These capsid particles are prismatic, 7 nm wide and 11
nm long. The other 12 are pentons (Penton proteins), located at 12
vertices of the icosahedron. Each Penton protein has a fiber
protrusion (Fiber protein).
[0005] The egg drop syndrome is currently one of the most crucial
diseases that seriously endanger the development of poultry
industry in the world. Among various prevention and control
measures, vaccination is still the most vital measure. The current
EDS inactivated vaccine commonly used in the poultry industry is a
vaccine obtained through emulsification of viruses amplified in
duck embryos with a mineral oil adjuvant after inactivation.
However, since it is difficult to obtain a high titer of virus from
cultivation of EDSV in duck embryos, it is often difficult to
provide a desired immune effect with prepared vaccine. In addition,
the way of production of the virus antigen is completely dependent
on the duck embryos. Once influenza and other infectious diseases
occur, supply of duck hatching eggs could be insufficient which
would seriously affect prevention and control of egg drop syndrome.
In addition, there is a risk of biosafety caused by incomplete
inactivation of viruses during production of whole-virus
vaccine.
[0006] Subunit vaccine is a new reliable type of genetically
engineered vaccine developed in recent years. Hexon (240/252) is a
main object in the study of subunit vaccine of egg drop syndrome
virus. However, the immunological efficiency of its subunit vaccine
has been low, and the subunit vaccine has not been developed into
products. No protein used for vaccines with good immunogenicity has
been prepared in the prior art. So far no subunit vaccine of EDSV
has appeared on the market. Therefore, it is urgently necessary to
develop a subunit vaccine composition with good immunological
effect, which can effectively prevent the spread of the disease and
can be free from the influence of fluctuation of duck egg
supply.
DESCRIPTION
[0007] In order to solve the deficiency of the prior art, the
disclosure provides an immunogenic protein of egg drop syndrome
virus, a vaccine composition prepared therefrom and a preparation
method and use of the vaccine composition; the vaccine composition
can effectively prevent and/or treat infection of the egg drop
syndrome virus.
[0008] The disclosure relates to a vaccine composition against egg
drop syndrome virus, wherein the vaccine composition comprises an
immune amount of antigen of egg drop syndrome virus and a
veterinarily acceptable carrier; wherein the antigen of egg drop
syndrome virus comprises a subunit antigen of immunogenic protein
of the egg drop syndrome virus as described in the present
disclosure or a live vector recombined with gene of the immunogenic
protein of the egg drop syndrome virus.
[0009] The disclosure relates to a vaccine composition against egg
drop syndrome virus, wherein the vaccine composition comprises an
immune amount of antigen of egg drop syndrome virus and a
veterinarily acceptable carrier; wherein, the antigen of egg drop
syndrome virus is an antigen of Fiber protein of egg drop syndrome
virus or a live vector recombined with gene of the Fiber protein of
egg drop syndrome virus.
[0010] The disclosure also relates to a preparation method of the
vaccine composition, the preparation method comprises the following
steps of: (1) cloning a gene of the egg drop syndrome virus
protein; (2) transforming and recombining the gene of the egg drop
syndrome virus protein cloned in the step (1); (3) expressing the
recombinant egg drop syndrome virus protein; (4) isolating and
purifying the recombinant egg drop syndrome virus protein, and
treating the purified recombinant egg drop syndrome virus protein
with a non-ionic surfactant; and (5) mixing the egg drop syndrome
virus protein with an adjuvant based on a certain ratio and
emulsifying the resulting mixture.
[0011] The disclosure also relates to a use of the vaccine
composition according to the disclosure in preparing medicine for
treatment and prevention of diseases related to infection of egg
drop syndrome virus.
[0012] The present disclosure is the first to prepare the vaccine
composition by adopting the EDSV Fiber protein after bulk
expression of the gene of selected EDSV protein. The vaccine
composition prepared by the EDSV Fiber protein can prevent and/or
treat an outbreak of the egg drop syndrome virus, and the body of
the animal after being immunized with the vaccine composition
containing the protein can rapidly produce antibody. The vaccine
composition has good prevention and control effect on infection of
EDSV alone or in combination with other viruses, with good
biosecurity.
[0013] The vaccine composition prepared by the EDSV Fiber protein
can provide complete protection to the chickens and ducks with good
immunogenicity and effectively prevent wild-type strains from a
variety of geographical origins, and can be used for preventing
and/or treating the infection of EDSV in clinical practice.
DETAILED DESCRIPTION
[0014] Hereinafter, embodiments of the present disclosure will be
described.
[0015] The term "Egg Drop Syndrome Virus" (EDSV) belongs to group
III of avian adenovirus and the genome is double-stranded DNA. The
resulting clinical symptoms include production of soft eggshells,
thin eggshells, and shell-less eggs, and a serious decline in egg
production rate. Pathological changes are characterized by ovarian
quiescence and tubal atrophy.
[0016] The disclosure relates to a vaccine composition against egg
drop syndrome virus, wherein the vaccine composition comprises an
immune amount of antigen of egg drop syndrome virus and a
veterinarily acceptable carrier; the antigen of egg drop syndrome
virus is an antigen of Fiber protein of egg drop syndrome virus or
a live vector recombined with gene of the Fiber protein of egg drop
syndrome virus.
[0017] For the first time, the present disclosure has found that
Fiber protein, which is present in a very little amount on the
surface of capsid particles of egg drop syndrome virus, has good
immunogenicity, either the subunit antigen prepared therefrom or
the live vector recombined with its gene can produce good
immunological efficacy after immunization and provide a protection
rate of 100% to chickens and ducks.
[0018] The term "vaccine composition" as used in the present
disclosure refers to a pharmaceutical composition having
immunogenicity of egg drop syndrome virus, which can induce,
stimulate or enhance the immune response of chickens and ducks to
the egg drop syndrome virus.
[0019] The term "immune amount" should be understood as an
"immunologically effective amount," also refers to an
immunoprotective amount or an effective amount to produce an immune
response, which is an amount of antigen effective to induce an
immune response in a body of a recipient, which immune amount is
sufficient to prevent or ameliorate signs or symptoms of a disease
including adverse health effects or complications of the disease.
The immune response may be sufficient for diagnostic purposes or
other tests or may be suitable for use in preventing signs or
symptoms of a disease, including adverse health consequences caused
by an infection caused by a pathogen, or complications of the
disease. Humoral immunity or cell-mediated immunity or both may be
induced. The immune response of the animal to the immunogenic
composition may be assessed indirectly, for example, by measuring
antibody titers and analyzing lymphocyte proliferation, or directly
by monitoring signs or symptoms after challenge with wild-type
strains, while protective immunity provided by the vaccine may be
assessed by measuring, for example, clinical signs of subjects such
as mortality, reduction in morbidity, temperature values, and
overall physiological condition and overall health and performance
of the subjects. The immune response may include, but is not
limited to induction of cellular and/or humoral immunity.
[0020] The term "antigen of egg drop syndrome virus" refers to any
composition that contains at least one form of antigen of egg drop
syndrome virus which can induce, stimulate or enhance an immune
response against infection of egg drop syndrome virus, the forms of
the antigen include but are not limited to inactivated, attenuated
or subunit antigens.
[0021] The Fiber protein antigen of egg drop syndrome virus of the
disclosure may be prepared by recombined and expressed subunit
antigen of the Fiber protein, of which the expression system used
may be eukaryotic expression systems or prokaryotic expression
systems, or alternatively, the Fiber protein antigen of egg drop
syndrome virus may be synthetic peptide antigen artificially
synthesized.
[0022] The "subunit antigen" refers to an antigen that is prepared
by genetically engineering a protective antigen gene of a pathogen
into a prokaryotic or eukaryotic expression system for efficient
expression. It is less likely to cause side effects compared to the
whole-virus antigens.
[0023] The "synthetic peptide antigen" refers to a small peptide
that contains only a component of an immunological determinant,
that is, an antigen that is prepared by synthesizing a protective
short peptide according to the amino acid sequence of a natural
protein by an artificial method, linking this protective short
peptide with a vector, and adding an adjuvant.
[0024] The "live vectors" refers to non-pathogenic microorganisms
which carry and express a gene of an antigenic or antigenic
determinant by mean of genetic engineering as to produce
immunogenicity. The non-pathogenic microorganisms may be bacteria
and viruses, viruses that are often used as viral live vectors
include vaccinia virus, fowlpox virus, turkey herpes virus,
adenovirus, pseudorabies virus, retrovirus, lentivirus; bacterial
live vectors may include attenuated Salmonella, BCG, attenuated
Listeria monocytogenes, attenuated vibrio cholerae, attenuated
Shigella, Lactococcus lactis, Lactobacillus plantarum, and
Streptococcus gordonii.
[0025] As an embodiment of the present disclosure, the Fiber
protein of egg drop syndrome virus in the vaccine composition of
the present disclosure is a protein encoded by a nucleotide
sequence shown in SEQ ID NO. 1.
[0026] As an embodiment of the present disclosure, the Fiber
protein of egg drop syndrome virus in the vaccine composition of
the present disclosure is a protein encoded by a nucleotide
sequence shown in SEQ ID NO. 2.
[0027] As an embodiment of the present disclosure, the gene that
encodes the Fiber protein of egg drop syndrome virus in the vaccine
composition of the present disclosure has a nucleotide sequence
shown in SEQ ID NO. 1 or a degenerate sequence thereof.
[0028] As an embodiment of the present disclosure, the gene that
encodes the Fiber protein of egg drop syndrome virus in the vaccine
composition of the present disclosure has a nucleotide sequence
shown in SEQ ID NO. 2 or a degenerate sequence thereof.
[0029] As an embodiment of the present disclosure, the HA titer of
the antigen of the Fiber protein of egg drop syndrome virus in the
vaccine composition of the present disclosure is equal to or
greater than 1:32.
[0030] As a preferred embodiment of the present disclosure, the HA
titer of the antigen of the Fiber protein of egg drop syndrome
virus in the vaccine composition of the present disclosure is
within a range of 1:32-1:128.
[0031] As a more preferred embodiment of the present disclosure,
the HA titer of the antigen of the Fiber protein of egg drop
syndrome virus in the vaccine composition of the present disclosure
is within a range of 1:32-1:64.
[0032] The HA titer of the antigen of the Fiber protein of egg drop
syndrome virus in the vaccine composition of the present disclosure
may also be within a range of 1:64-1:128.
[0033] As an embodiment of the present disclosure, the live vector
of the Fiber protein gene of egg drop syndrome virus in the vaccine
composition of the present disclosure is recombinant attenuated
Salmonella, recombinant Newcastle disease virus or recombinant
poxvirus.
[0034] Because the live vector vaccine composition of the present
disclosure combines the advantages of an inactivated vaccine and a
live vaccine, it can ensure that the laying fowls can be protected
in terms of the immunological efficacy, and immunological efficacy
of the live vector vaccine composition is so strong that adjuvants
may not be added.
[0035] The term "veterinarily acceptable carrier" refers to all
components other than the antigen of egg drop syndrome virus in the
vaccine composition of the present disclosure which are carriers or
diluents that do not cause significant irritation to an organism
and do not abrogate the biological activity and properties of the
administered compounds, preferably an adjuvant.
[0036] The vaccine composition of the disclosure may further be
added with other reagents.
[0037] As an embodiment of the present disclosure, the veterinarily
acceptable carrier includes drugs, immunostimulants, antioxidants,
surfactants, colorants, volatile oils, buffers, dispersants,
propellants and preservatives; the immunostimulants include
.alpha.-interferon, .beta.-interferon, .gamma.-interferon,
granulocyte-macrophage colony stimulating factor (GM-CSF),
macrophage colony stimulating factor (M-CSF) and interleukin 2
(IL2).
[0038] Preferably, the immunostimulants comprise
.alpha.-interferon, .beta.-interferon, .gamma.-interferon,
granulocyte-macrophage colony stimulating factor (GM-CSF),
macrophage colony stimulating factor (M-CSF) and interleukin 2
(IL2).
[0039] Methods well known in the art can be used to prepare such
compositions.
[0040] The term "adjuvant" may includes a compound selected from a
group consisting of alhydrogel adjuvant, saponins e.g., Quil A.
QS-21 (Cambridge Biotech Inc., Cambridge Mass.), GPI-0100 (Galenica
Pharmaceuticals, Inc., Birmingham, Ala.), water-in-oil emulsion,
oil-in-water emulsion, water-in-oil-in-water emulsion, the polymers
of acrylic or methaciylic acid and the copolymers of maleic
anhydride and alkenyl derivative. The term "emulsion" may be based
in particular on light liquid paraffin oil (European Pharmacopea
type); isoprenoid oil, such as squalane or squalene oil, resulting
from the oligomerization of alkenes, in particular of isobutene or
decene; esters of acids or of alcohols containing a linear alkyl
group, more particularly plant oils, ethyl oleate, propylene glycol
di-(caprylate/caprate), glyceryl tri-(caprylate/caprate) or
propylene glycol dioleate; esters of branched fatty acids or
alcohols, in particular isostearic acid esters. The oil is used in
combination with emulsifiers to form the emulsion. The emulsifiers
are preferably nonionic surfactants, in particular esters of
sorbitan, of mannide (e.g. anhydromannitol oleate), of glycol, of
polyglycerol. of propylene glycol and of oleic, isostearic,
ricinoleic or hydroxy-stearic acid, which are optionally
ethoxylated, and polyoxypropylene-polyoxyethylene block copolymers,
in particular the Pluronic products, especially L121. See Hunter et
al., The Theory and Practical Application of Adjuvants (Ed.
Stewart-Tull, D. E. S). John Wiley and Sons, NY, pp 51-94 (1995)
and Todd et al. Vaccine 15:564-570 (1997). For example, it is
possible to use the SPT emulsion described on page 147 of "Vaccine
Design, The Subunit and Adjuvant Approach" edited by M. Powell and
M. Newman, Plenum Press, 1995, and the emulsion MF59 described on
page 183 of the same book. The term "polymers of acrylic or
methacrylic acid" preferably are the polymers of acrylic or
methacrylic acid which are cross-linked, especially with
polyalkenyl ethers of sugars or polyalcohols. These compounds are
known by the term carbomer (Trade name, Carbopol) (Phameuropa Vol.
8, No. 2, June 1996). Persons skilled in the art can also refer to
U.S. Pat. No. 2,909,462 which describes such acrylic polymers
cross-linked with a polyhydroxylated compounds having at least 3
hydroxyl groups, preferably not more than 8, the hydrogen atoms of
at least three hydroxyls being replaced by unsaturated aliphatic
radicals having at least 2 carbon atoms. The preferred radicals are
those containing 2 to 4 carbon atoms, e.g. vinyls, allyls and other
ethylenically unsaturated groups. The unsaturated radicals
themselves may contain other substituents, such as the methyl
group. The products sold under the name CARBOPOL.RTM. (BF Goodrich,
Ohio. USA) are particularly appropriate. They are cross-linked with
allyl sucrose or with allyl pentaerythritol. Among them, there may
be mentioned Carbopol 974P, 934P and 971 P, most preferably
Carbopol 971P. For the term "copolymerrs of maleic anhydride and
alkenyl derivative", EMA (Monsanto), which is the copolymer of
maleic anhydride and ethylene, can also be considered. The
dissolution of these polymers in water leads to an acid solution
that will be neutralized, preferably to physiological pH, in order
to give the adjuvant solution, into which the immunogenic,
immunological or vaccine composition itself will be incorporated.
The term "adjuvant" includes, but is not limited to, the RIBI
adjuvant system (Ribi Inc.), Block co-polymer (CytRx, Atlanta Ga.),
SAF-M (Chiron, Emeryville Calif.), monophosphoryl lipid A, Avridine
lipid-amine adjuvant, heat-labile enterotoxin from E. coli
(recombinant or otherwise), cholera toxin, IMS 1314, muramyl
dipeptide, and Gel adjuvant among many others. Preferably, the
adjuvant includes one or more of alhydrogel adjuvant, saponins,
water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water
emulsion, the polymers of acrylic or methaciylic acid, the
copolymers of maleic anhydride and alkenyl derivative, the RIBI
adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A,
Avridine lipid-amine adjuvant, heat-labile enterotoxin from E.
coli, cholera toxin, IMS 1314, muramyl dipeptide and Gel
adjuvant.
[0041] As an embodiment of the present disclosure, the
pharmaceutically acceptable carrier includes an adjuvant, which
includes one or more of (1) alhydrogel adjuvant, saponins,
Avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion,
water-in-oil-in-water emulsion; or (3) the polymers of acrylic or
methaciylic acid, the copolymers of maleic anhydride and alkenyl
derivative; and the RIBI adjuvant system, Block co-polymer, SAF-M,
monophosphoryl lipid A, lipid-amine adjuvant, heat-labile
enterotoxin from E. coli, cholera toxin, IMS 1314, muramyl
dipeptide and Gel adjuvant.
[0042] Preferably, the saponin is Quil A, QS-21 or GPI-0100;
[0043] Preferably, the emulsions are SPT emulsion and MF59
emulsion, or the emulsions are formed by combination of oil and
emulsifiers, the emulsions can be based in particular on light
liquid paraffin oil; isoprenoid oil such as squalane or squalene
oil resulting from the oligomerization of alkenes, in particular of
isobutene or decene; esters of acids or of alcohols containing a
linear alkyl group, more particularly plant oils, ethyl oleate,
propylene glycol di-(caprylate/caprate), glyceryl
tri-(caprylate/caprate) or propylene glycol dioleate; esters of
branched fatty acids or alcohols, in particular isostearic acid
esters; the emulsifiers are nonionic surfactants, in particular
esters of Polyoxyethylene fatty acid (e.g. oleic acid), of
sorbitan, of mannide (e.g. anhydromannitol oleate), of glycol, of
polyglycerol, of propylene glycol and of oleic, isostearic,
ricinoleic or hydroxy-stearic acid, which are optionally
ethoxylated, ethers of fatty alcohols and polyhydric alcohols (e.g.
oleyl alcohol) and polyoxypropylene-polyoxyethylene block
copolymers, in particular the Pluronic.RTM., especially L121;
[0044] Preferably, the polymers of acrylic or methacrylic acid are
compounds known by carbomer, in which the polymers of acrylic or
methacrylic acid are cross-linked, especially with polyalkenyl
ethers of sugars or polyalcohols, preferably, Carbopol 974P, 934P
or 971P.
[0045] Preferably, the copolymerrs of maleic anhydride and alkenyl
derivative are copolymers EMA of maleic anhydride and ethylene.
[0046] Preferably, the adjuvant is a white oil adjuvant for
preparation of water-in-oil emulsion.
[0047] The concentration of the adjuvant ranges from 5% to 70% V/V,
preferably from 30% to 70% V/V, more preferably 66% V/V. The Fiber
protein gene of the egg drop syndrome virus according to the
present disclosure can also be applied to the development of
expression vectors, nucleic acid vaccines, diagnostic reagents, and
other drugs for preventing and/or treating the egg drop
syndrome.
[0048] The present disclosure relates to a recombinant vector
capable of expressing the Fiber protein encoded by the nucleotide
sequence according to the present disclosure which is immunogenic
and capable of producing an immune response.
[0049] The present disclosure relates to a transformant containing
an introduced recombinant vector expressing the Fiber protein
according to the present disclosure.
[0050] The Fiber protein of the disclosure may be prepared by any
method known in the art, for example by recombinant expression of
the Fiber protein gene, the expression system used may be any known
expression system, for example: eukaryotic expression systems, or
prokaryotic expression systems. Alternatively, the Fiber protein
sequence may be synthesized directly. The eukaryotic expression
systems can include mammalian cell expression systems, yeast
expression systems, and insect expression systems.
[0051] The vaccine composition according to the present disclosure
further comprises a combination of other pathogens or antigens to
prepare a combined vaccine or a complex vaccine against infection
of various diseases including egg drop syndrome virus.
[0052] The term "combined vaccine" refers to a vaccine prepared
with the virus mixture by mixing the FADV in the present disclosure
with at least one other different virus. The term "complex vaccine"
refers to a vaccine prepared from FADV and bacterium. For example,
the FADV in the present disclosure may be mixed or combined with
Newcastle disease virus, avian infectious bronchitis virus, avian
influenza virus, infectious bursal disease virus, fowl adenovirus,
avian reovirus and/or Escherichia coli, avibacterium
paragallinarum, Mycoplasma synoviae and Mycoplasma
gallisepticum.
[0053] As an embodiment of the present disclosure, the vaccine
composition further comprises one or more of the following antigens
including an antigen of Newcastle disease virus, an antigen of
avian influenza virus, an antigen of avian infectious bronchitis
virus, an antigen of infectious bursal disease, an antigen of fowl
adenovirus, an antigen of avian reovirus, an antigen of Escherichia
coli, an antigen of avibacterium paragallinarum, an antigen of
Mycoplasma Synoviae, an antigen of Mycoplasma gallisepticum, an
antigen of Pasteurella multocida, an antigen of Marek's disease
virus, an antigen of avian encephalomyelitis virus and an antigen
of infectious laryngotracheitis virus.
[0054] As an preferred embodiment of the present disclosure, the
vaccine composition further comprises one or more of the following
antigens including an inactivated antigen of Newcastle disease
virus, an inactivated antigen of avian influenza virus, an
inactivated antigen of avian infectious bronchitis virus, a subunit
antigen of infectious bursal disease virus, and an inactivated
antigen or a subunit antigen of fowl adenovirus.
[0055] As a preferred embodiment of the present disclosure, the
inactivated antigen of Newcastle disease virus is an inactivated
antigen of N7a strain, the inactivated antigen of avian influenza
virus are inactivated antigens of SZ strain, the inactivated
antigen of avian infectious bronchitis virus are inactivated
antigen of M41 strain, the subunit antigen of infectious bursal
disease virus are VP2 protein of infectious bursal disease virus,
the inactivated antigen of fowl adenovirus are inactivated antigens
of FAV-HN strain, and the subunit antigen of fowl adenovirus are
Penton protein or Fiber-2 protein of the fowl adenovirus.
[0056] As an embodiment of the present disclosure, the HA titer of
the Fiber protein of the egg drop syndrome virus is between 1:32
and 1:128, the content of the inactivated antigen of the Newcastle
disease virus is 10.sup.8.0-10.sup.9.0 EID.sub.50/0.1 ml before
inactivation, the content of the inactivated antigen of the avian
influenza virus is 10.sup.6.5-10.sup.8.5 EID.sub.50/0.1 ml before
inactivation, the content of the inactivated antigen of the avian
infectious bronchitis virus is 10.sup.6.0-10.sup.7.0 EID.sub.50/0.1
ml before inactivation, and the AGP titer of the VP2 protein of the
avian infectious bursal disease virus is between 1:16 and 1:128,
the AGP titer of the Penton protein of the fowl adenovirus is
between 1:2 and 1:16, and the AGP titer of the Fiber-2 protein of
the fowl adenovirus is between 1:2 and 1:16.
[0057] As an embodiment of the present disclosure, the HA titer of
the Fiber protein of the egg drop syndrome virus is between 1:32
and 1:128, the content of the inactivated antigen of the Newcastle
disease virus is 10.sup.8.0 EID.sub.50/0.1 ml before inactivation,
the content of the inactivated antigen of the avian influenza virus
is 10.sup.8.0 EID.sub.50/0.1 ml before inactivation, the content of
the inactivated antigen of the avian infectious bronchitis virus is
10.sup.6.0 EID.sub.50/0.1 ml before inactivation, and the AGP titer
of the VP2 protein of the avian infectious bursal disease virus is
1:16, the AGP titer of the Penton protein of the fowl adenovirus is
1:4, and the AGP titer of the Fiber-2 protein of the fowl
adenovirus is 1:4.
[0058] The present disclosure also relates to a method for
preparing said vaccine composition, wherein said method comprises:
step (1), cloning a gene of the Fiber protein of the egg drop
syndrome virus and recombining the gene of the Fiber protein of the
egg drop syndrome virus into an expression vector so as to obtain a
recombinant expression vector recombined with the gene of the Fiber
protein of the egg drop syndrome virus; step (2), transforming the
recombinant expression vector recombined with the gene of the Fiber
protein of the egg drop syndrome virus and an expression vector of
a molecular chaperone into Escherichia coli in order to express the
Fiber protein of the egg drop syndrome virus; step (3), treating
the expressed the Fiber protein of the egg drop syndrome virus with
a non-ionic surfactant in order to remove endotoxin; and step (4),
mixing the Fiber protein of the egg drop syndrome virus in which
the endotoxin is removed with an adjuvant to obtain the vaccine
composition.
[0059] As an embodiment of the present disclosure, in the method
for preparing the vaccine composition, the recombinant expression
vector recombined with the gene of the Fiber protein of the egg
drop syndrome virus in the step (1) is a recombinant pET28a
Plasmid, the expression vector of the molecular chaperone in the
step (2) is pG-Tf2, the Escherichia coli in the step (2) is
Escherichia coli BL21 (DE3); the nonionic surfactant in the step
(3) is Triton X-114.
[0060] The disclosure also relates to a use of the vaccine
composition according to the disclosure in preparing medicine for
treatment and/or prevention of egg drop syndrome.
[0061] The disclosure also relates to a use of the vaccine
composition according to the disclosure in preparing medicine for
treatment and/or prevention of infection of egg drop syndrome
virus.
[0062] Subjects that may be administered with the medicine for
treatment and/or prevention of infection of egg drop syndrome virus
according to the present disclosure include chickens or ducks.
[0063] The term "prevention and/or treatment", when relating to
infection of egg drop syndrome virus, refers to inhibition of
replication and spread of the egg drop syndrome virus or prevention
of the egg drop syndrome virus from colonizing its host, and
alleviation of disease or symptoms of illness of the egg drop
syndrome virus. If the viral load is reduced, the severity of the
illness is reduced, and/or the food intake and/or growth are
increased, then it can be considered that the treatment has
achieved a therapeutic effect.
[0064] The description of the present disclosure is further
provided as follows with reference to the specific embodiments, and
features and advantages of the present disclosure will become more
apparent from the following description. However, these embodiments
are only exemplary, but not forming any limitation to the scope of
the present disclosure. It should be understood by a person skilled
in the art that modifications or alternatives to details and forms
of the technical solution of the present disclosure without
deviation from the spirit and scope of the present disclosure will
be allowed, while those modification and alternatives should all
fall within the scope of the present disclosure.
[0065] The chemical reagents used in the examples of the present
disclosure are of analytical grade and are purchased from Sinopharm
Group Co. Ltd.
[0066] In order to make the present disclosure more understandable,
the present disclosure will be further described with reference to
specific embodiments. The experimental methods described in the
present disclosure are conventional methods unless otherwise
specified. The biological materials are commercially available
unless otherwise specified.
Example 1 Construction of Expression Vector of
pET28a-EDSV-Fiber
[0067] 1. Extraction of EDSV DNA
[0068] A plasmid extraction kit was purchased from TIANGEN BIOTECH;
T4 DNA Ligase was purchased from BioLab; pET28a plasmid was
purchased from Novagen; an agarose gel recovery kit was purchased
from Tianze Biotech, other reagents are analytically pure.
[0069] According to the instruction of the viral DNA extraction
kit, 0.2 ml of the egg drop syndrome virus was placed in a 1.5 ml
sterile centrifuge tube, and added with 0.4 ml of VB buffer, mixed
well by vortexing, and let stand at room temperature for 10
minutes. 0.45 ml of AD buffer was added in the above sample
solution and mixed strongly. The VB column was placed in a 2 ml
collection tube and 0.6 ml of the mixture was added to the VB
column, which was then centrifuged at 14,000 g for 1 minute. The
remaining mixture was added to the VB column which was then
centrifuged at 14,000 g for 1 minute, the 2 ml collection tube was
discarded and the VB column was placed into a new 2 ml collection
tube. 0.4 ml of W1 buffer was added into the VB column which was
then centrifuged at 14000 g for 30 seconds, add 0.6 ml Wash buffer
in VB column, centrifuged at 14000 g for 30 seconds and centrifuged
without adding any buffer for 3 minutes. The VB column is placed
into a new 1.5 ml EP tube. 50 .mu.l RNase free water was added to
the center of membrane and let sit for 3 minute, centrifuged at
14000 g for 1 minute and the centrifuged liquid was DNA genome.
[0070] 2. Amplification of Fiber-2 Protein Gene
[0071] Oligonucleotide primers were synthesized based on the
conserved region sequences at the 5' and 3' ends of the Fiber
protein gene and subjected to PCR. Primer sequences are shown in
Table 1.
[0072] 1. Primers for the Amplification of the Fiber Protein
gene
TABLE-US-00001 Fiber-F (SEQ ID NO. 3) atgaagcgactacggttggaccctg
Fiber-R (SEQ ID NO. 4) ctactgtgctccaacatatgtaaag
[0073] The PCR product was sent to Invitrogen Corporation for
sequencing, and codon optimization was performed to the Fiber
protein gene according to the sequencing result, the sequence of
the optimized Fiber protein gene is shown in SEQ ID NO. 1.
[0074] 3. Construction of Expression Vector
[0075] The optimized Fiber protein gene was sent to GENEWIZ, Inc.
for full sequence synthesis and linked into pET28a plasmid
respectively. The linked plasmid and molecular chaperone plasmid
were co-transformed into E. coli BL21 (DE3). The single clone was
picked up and cultured in LB medium containing 100 .mu.g/ml of
kanamycin and 20 .mu.g/ml of chloramphenicol overnight. The plasmid
was extracted and sequenced. The positive clone was
pET28a-EDSV-Fiber/pG-Tf2 expression strain.
Example 2 Preparation of Fiber Protein
[0076] The pET28a-EDSV-Fiber/pG-Tf2/E. coli BL21(DE3) strain
prepared in Example 1 was inoculated into LB medium containing
50-100 .mu.g/ml of kanamycin and 20 .mu.g/ml of chloramphenicol at
an inoculum amount of 1% (V/V), and cultured with shaking at
37.degree. C.; meanwhile the LB medium also contains 5-10 ng/ml of
tetracycline for inducible expression of molecular chaperone
protein. When OD.sub.600=0.4-0.6, the sample was placed at
28.degree. C. for 30 minutes.
[0077] Isopropyl-.beta.-D-thiogalactopyranoside (IPTG) was added to
a final concentration of 0.1-1.0 mM and the sample was cultured
with shaking at 28.degree. C. for 24 hours. After cultivation, the
bacteria were harvested and resuspended in PBS (sodium chloride, 8
g, potassium chloride, 0.2 g, disodium hydrogen phosphate, 1.44 g,
potassium dihydrogen phosphate, 0.24 g, adjusted to pH 7.4 with a
final volume of 1 L), centrifuged after ultrasonic decomposition
and the supernatant was obtained. The expression product had a
higher content of the soluble target protein, the amount of
expression of the soluble Fiber protein could reach up to 30% of
the total bacterial protein, the HA titer of the Fiber protein
reached 1:512, and the endotoxin had a content of
0.51.times.10.sup.5 EU/ml.
Example 3 Clearance of Endotoxin in the Fiber Protein Expressed in
E. coli
[0078] 0.5 ml of the solution to be treated and Triton X-114 (5
.mu.l) at a final concentration of 1% (v/v) were added to a 1.5 ml
centrifuge tube and vortexed. The sample was placed on ice for 5
minutes. After vortexing the cooled sample, the centrifuge tube was
immediately put in a 37.degree. C. water bath for 5 min to create
new two phases. Then, the sample was centrifuged at 37.degree. C.
for 60 seconds. After centrifugation, the target protein will
remain in the upper layer, while the endotoxin-containing detergent
will remain in the shape of an oil droplet at the bottom of the
centrifuge tube. The entire operation for clearing endotoxin went
through 3 cycles. It was measured that the HA titer of the Fiber
protein reached 1:512, and the content of the endotoxin had been
reduced into 0.009.times.10.sup.5 EU/ml.
[0079] The results showed that Triton X-114 could eliminate the
residual endotoxin in the recombinant protein and had no effect on
the immunogenicity of the Fiber protein.
Example 4 Preparation of Subunit Vaccine of the Fiber Protein of
Egg Drop Syndrome Virus
[0080] The fiber protein purified according to the method of
Example 3 was slowly added to the white oil adjuvant, while the
motor was started to stir the mixture at 17500 r/min for 5 min. 1%
thimerosal solution was added before termination of stirring to a
final concentration of 0.01%. The component ratios are shown in
Table 2.
TABLE-US-00002 TABLE 2 Component ratios of the subunit vaccine of
the Fiber protein of egg drop syndrome virus Component Vaccine 1
Vaccine 2 Vaccine 3 Fiber protein (HA titer) 1:32 1:64 1:128 White
oil adjuvant 66% 66% 66% (v/v %)
Example 5 Safety Test of the Subunit Vaccine of the Fiber Protein
of Egg Drop Syndrome Virus
[0081] 60 21-day-old SPF chickens were divided into 4 groups, that
is to say, 15 chickens per group, the chickens in groups 1-3 were
immunized by subcutaneous injection in necks with corresponding
vaccine 1, vaccine 2, vaccine 3 prepared in Example 4,
respectively, at an immune amount of 0.1 ml, and the chickens in
group 4 were injected with 0.1 ml of physiological saline solution
by subcutaneous injection, as a blank control. The chickens were
fed under the same conditions, and observed starting from the third
week after immunization for clinical symptoms, weight gain rate and
mortality. Five chickens were dissected respectively at 3 weeks, 4
weeks and 5 weeks to observe whether the inoculation site formed
gross lesions. The results showed (see Table 3, Table 4) that, no
clinical symptoms and death could be observed in the vaccination
groups (vaccine 1-3), in addition, the weight gain rate of the
vaccination groups and the control group showed no significant
difference, and no granulomas were formed, indicating that it was
safe and would not have effect on weight gaining to immunize
chickens with the subunit vaccine of the Fiber protein of egg drop
syndrome virus of the present disclosure.
TABLE-US-00003 TABLE 3 Clinical symptoms and number of deaths for
safety test of the subunit vaccine of the Fiber protein of egg drop
syndrome virus Clinical symptoms and number of deaths after
immunization Number of Clinical Group chickens Symptoms deaths 1 15
0/15 0/15 2 15 0/15 0/15 3 15 0/15 0/15 4 15 0/15 0/15
TABLE-US-00004 TABLE 4 Chicken weight change and formation of
granulomas for safety test of the subunit vaccine of the Fiber
protein of egg drop syndrome virus Weight (g, mean .+-. SD)
Formation of End up at the granulomas after Number third week
immunization of Before after 3 4 5 Group chickens immunization
immunization weeks weeks weeks 1 15 323 .+-. 17.1 579 .+-. 19.7 0/5
0/5 0/5 2 15 325 .+-. 16.8 578 .+-. 17.5 0/5 0/5 0/5 3 15 327 .+-.
15.9 576 .+-. 16.6 0/5 0/5 0/5 4 15 328 .+-. 19.2 579 .+-. 20.0 0/5
0/5 0/5
Example 6 Immunogenicity Test of the Subunit Vaccine of the Fiber
Protein of Egg Drop Syndrome Virus in SPF Chickens
[0082] 40 21-day-old SPF chickens were divided into 4 groups, that
is to say, 10 chickens per group, the chickens in groups 5-7 were
immunized by subcutaneous injection in necks with corresponding
vaccines1-3 prepared in Example 4, respectively, at an immune
amount of 0.5 ml, and the chickens in group 8 were injected with
0.5 ml of physiological saline solution by subcutaneous injection,
as a blank control. All experimental chickens were fed in
isolation. Before immunization and on the 21st day after
immunization, blood sample was taken from each of the chickens and
the corresponding serum was separated and the HI titer of the egg
drop syndrome virus antibody in each serum was determined. The
results are shown in Table 5
TABLE-US-00005 TABLE 5 Results of immunogenicity test of the
subunit vaccine of the Fiber protein of egg drop syndrome virus in
SPF chickens Results of determining HI antibody titers (log2)
Immune dose On the 21st (ml per Number of Before day after Group
chicken) chickens immunization immunization 5 0.5 10 0 9.5 6 0.5 10
0 10.2 7 0.5 10 0 10.8 8 0.5 10 0 0
[0083] The results showed that the HI antibody titer in the 8th
group, i.e. control group, on Day 21 after immunization was 0,
while the groups 5-7, immunization groups all had a relatively
higher HI antibody titer in the immunized chickens. The results
showed that the subunit vaccine of the Fiber protein of egg drop
syndrome virus with an HI tier that was not less than 1:32 could
produce relatively higher HI antibody titer and could achieve
effective immune protection for chickens.
Example 7 Immunogenicity Test of the Subunit Vaccine of the Fiber
Protein of Egg Drop Syndrome Virus in Layers
[0084] 40 115-day-old Hy-Line Brown chickens were divided into 4
groups, that is to say, 10 chickens per group, the chickens in
groups 9-11 were immunized by subcutaneous injection in necks with
corresponding vaccines1-3 prepared in Example 4, respectively, at
an immune amount of 0.5 ml, and the chickens in group 12 were
injected with 0.5 ml of physiological saline solution by
subcutaneous injection, as a blank control. Before immunization and
on the 21st day after immunization, blood sample was taken from
each of the chickens and the corresponding serum was separated and
HI titer of the egg drop syndrome virus antibody in each serum was
determined. When the laying rate reached up to about 90% (6 weeks
after immunization), all four groups of chickens were challenged
with virulent AV 127 strains, each chicken took 1 ml of 10-fold
diluted virus orally, the virus content was 10.sup.6.5EID.sub.50,
the chickens were observed for 6 weeks after challenge with respect
to feeding, spirit, stool and other conditions, the egg-laying
numbers were recorded and the egg-laying rates were calculated. The
results are shown in Table 6
TABLE-US-00006 TABLE 6 Results of immunogenicity test of the
subunit vaccine of the Fiber protein of egg drop syndrome virus in
layers Results of determining HI antibody titer (log2) Egg-laying
rates On the Week Week Immune 21st day 3 6 dose Number Before after
Before after after (ml per of immu- immu- chal- chal- chal- Group
chicken) chickens nization nization lenge lenge lenge 9 0.5 10 0
9.4 89.1 91.5 90.7 10 0.5 10 0 9.7 91.0 89.8 91.2 11 0.5 10 0 10.2
90.5 91.4 90.2 12 0.5 10 0 0 90.1 47.4 70.5
[0085] The results showed that the titer of HI antibody of the 12th
group i.e. control group on the 21st day after immunization was 0,
and the egg-laying rate of the chickens in the control group
decreased after challenge, and in the third week after challenge,
the egg-laying rate dropped from about 90% to 47% or so, while the
shell color faded and soft-shell eggs, shell-less eggs and deformed
eggs, and the like were laid; in the sixth week after challenge,
the egg-laying rate was about 70%, but still not back to a normal
level. The immunized groups from group 9 to group 11 all had higher
HI antibody titers in immunized chickens, and there was almost no
change in egg-laying rate after challenge, indicating that the
chickens immunized with the subunit vaccine of the Fiber protein of
egg drop syndrome virus having a HA titer no less than 1:32, all
produced relatively higher HI antibody titers. The Fiber protein
antigens of the present disclosure had good immunogenicity and
could provide effective immune protection for ducks, even at a low
content.
Example 8 Immunogenicity Test of the Subunit Vaccine of the Fiber
Protein of Egg Drop Syndrome Virus in Cherry Valley Ducks
[0086] 40 42-day-old Cherry Valley ducks were divided into 4
groups, that is to say, 10 ducks per group, the ducks in groups
13-15 were immunized by subcutaneous injection in necks with
corresponding vaccines 1-3 prepared in Example 4, respectively, at
an immune amount of 0.5 ml, and the ducks in group 16 were injected
with 0.5 ml of physiological saline solution by subcutaneous
injection, as a blank control. All experimental ducks were fed in
isolation. Before immunization and on the 21st day after
immunization, blood sample was taken from each of the ducks and the
corresponding serum was separated and the HI titer of the egg drop
syndrome virus antibody in each serum was determined. The results
are shown in Table 7.
Example 7 Results of Immunogenicity Test of the Subunit Vaccine of
the Fiber Protein of Egg Drop Syndrome Virus in Cherry Valley
Ducks
TABLE-US-00007 [0087] Results of determining HI antibody titers
(log2) Immune dose On the 21st (ml per Number of Before day after
Group chicken) ducks immunization immunization 13 0.5 10 0 9.3 14
0.5 10 0 10.2 15 0.5 10 0 10.6 16 0.5 10 0 0
[0088] The results showed that the HI antibody titer in the 16th
group, i.e. control group, on Day 21 after immunization was 0,
while the immunization groups 13-15 all had a relatively higher HI
antibody titer in the immunized ducks. The results showed that the
subunit vaccine of the Fiber protein of egg drop syndrome virus
with an HI tier that is not less than 1:32 could produce relatively
higher HI antibody titer. The Fiber protein antigens of the present
disclosure had good immunogenicity and could provide effective
immune protection for ducks, even at a low content.
Example 9 Broad-Spectrum Protection Test of the Subunit Vaccine of
the Fiber Protein of Egg Drop Syndrome Virus
[0089] 100 120-day-old Hy-Line Brown layers were divided into 10
groups, that is to say, 10 chickens per group, the chickens in
groups 17-21 were immunized by subcutaneous injection in necks with
corresponding vaccine 1 prepared in Example 4, respectively, at an
immune amount of 0.5 ml, and the chickens in groups 22-26 were
injected with 0.5 ml of physiological saline solution by
subcutaneous injection. Before immunization and on the 21st day
after immunization, blood sample was taken from each of the
chickens and the corresponding serum was separated and HI titer of
the egg drop syndrome virus antibody in each serum was determined.
When the laying rate reached up to about 90% (6 weeks after
immunization), the experimental chickens from groups 17 and 22 were
challenged with the virulent egg drop syndrome virus HN09 strain
newly isolated from Henan; the experimental chickens from groups 18
and 23 were challenged with the virulent egg drop syndrome virus
SD02 strain newly isolated from Shandong; the experimental chickens
from groups 19 and 24 were challenged with the virulent egg drop
syndrome virus GD04 strain newly isolated from Guangdong; the
experimental chickens from groups 20 and 25 were challenged with
the virulent egg drop syndrome virus LN02 strain newly isolated
from Liaoning; the experimental chickens from groups 21 and 26 were
challenged with the virulent egg drop syndrome virus SC01 strain
newly isolated from Sichuan; each chicken took 1 ml of 10-fold
diluted virus orally, the virus content was 10.sup.6.5EID.sub.50,
the chickens were observed for 6 weeks after challenge in terms of
feeding, spirit, stool and other conditions, the egg-laying numbers
were recorded and the egg-laying rates were calculated. The results
are shown in Table 8.
TABLE-US-00008 TABLE 8 Results of broad-spectrum protection test of
the subunit vaccine of the Fiber protein of egg drop syndrome virus
Results of determining HI antibody titer (log2) Egg-laying rates On
the Week After Immune 21st day 3 chal- dose Number Before after
Before after lenge (ml per of immu- immu- chal- chal- Week Group
chicken) chickens nization nization lenge lenge 6 17 0.5 10 0 5.4
90.3 90.5 91.0 18 0.5 10 0 5.5 90.4 90.6 90.8 19 0.5 10 0 5.5 90.2
90.6 91.2 20 0.5 10 0 5.5 90.2 91.0 91.2 21 0.5 10 0 5.4 90.4 90.6
91.0 22 0.5 10 0 0 90.5 45.4 68.6 23 0.5 10 0 0 90.4 44.4 66.2 24
0.5 10 0 0 90.6 43.6 65.4 25 0.5 10 0 0 90.3 44.1 67.0 26 0.5 10 0
0 90.5 44.6 65.4
[0090] The results showed that the titers of HI antibody of control
groups 22-26 on the 21st day after immunization were 0, and the
egg-laying rate of the chickens decreased after challenge, and in
the third week after challenge, the egg-laying rate dropped from
90.3%-90.6% to 43.6%-45.4%, while the shell color faded and
soft-shell eggs and shell-less eggs and the like were laid; in the
sixth week after challenge, the egg-laying rate returned to
65.4%-68.6%, but still not back to a normal level. However, the
immunization groups 17-21 all had relatively higher HI antibody
titers in immunized chickens, and there was almost no change in
egg-laying rate after challenge, indicating that the chickens
immunized with the subunit vaccine of the Fiber protein of egg drop
syndrome virus having a HA titer of no less than 1:32, all produced
relatively higher HI antibody titers. And the antigen had a broad
spectrum and could provide effective immune protection for chickens
challenged by wild strains of egg drop syndrome virus from
different regions. The egg-laying rate would not be affected by
infection of wild strain of egg drop syndrome virus.
Example 10 Preparation of Antigens of Newcastle Disease Virus
[0091] Newcastle disease virus (genotype VII), N7 strain deposited
in China Center for Type Culture Collection on Oct. 19, 2015 with
an accession number CCTCC NO: V201545 and a deposition address that
is Wuhan University, Wuhan, China, was diluted appropriately
(10.sup.-4 or 10.sup.-5) with sterile saline so as to inoculate
susceptible chicken embryos which are 10-11 days old at 0.1 ml per
embryo and the chicken embryos were placed at 37.degree. C. after
inoculation for subsequent incubation. Allantoic fluid was
harvested from chicken embryos which were died within 48 to 120
hours after inoculation or survived at 120 hours after inoculation,
the virus content determined was 10.sup.8.0EID.sub.50/0.1 ml.
Formaldehyde solution with a final concentration of 0.1% (v/v) was
added into the sample which is then placed at 37.degree. C. to be
inactivated, and stirred once every 4-6 hours during the process,
and stored after 16 hours of complete inactivation.
Example 11 Preparation of Antigens of Avian Influenza Virus
[0092] H9 subtype of avian influenza virus SZ strain (disclosed in
Chinese patent application CN103789272 A) was picked as a virus
species and diluted with sterile saline to 10.sup.-3 (0.1 ml of
virus solution was added to 0.9 ml sterile saline, and then diluted
2 more times after shaking and mixing). The diluted virus solution
was inoculated into 10-day-old susceptible chicken embryos (hatched
from SPF hatching eggs purchased from Beijing Meiliyaweitong
Experimental Animal Technology Co., Ltd) via the allantoic cavity
at 0.1 ml (containing 10.sup.5EID.sub.50) per embryo. The pinhole
was sealed after inoculation, and the chicken embryos were placed
at 36-37.degree. C. for subsequent incubation. It was not necessary
to turn over the chicken embryos. After 96 hours, the chicken
embryos were removed and placed upright with upward gas chambers,
and cooled at 2-8.degree. C. for 12-24 hours. Allantoic fluid was
harvested from the cooled chicken embryos. The virus content
determined was 10.sup.85EID.sub.50/0.1 ml. Formaldehyde solution
with a final concentration of 0.1% (v/v) was added into the sample
which is then placed at 37.degree. C. to be inactivated, and
stirred once every 4-6 hours during the process, and stored after
24 hours of complete inactivation.
Example 12 Preparation of Antigens of Avian Infectious Bronchitis
Virus
[0093] Avian infectious bronchitis virus M41 strain (purchased from
the China Veterinary Drug Administration) was diluted appropriately
(to 10.sup.-2 or 10.sup.-3) with sterile saline so as to inoculate
susceptible chicken embryos which are 10-11 days old at 0.1 ml per
embryo and the chicken embryos placed at 36-37.degree. C. after
inoculation for subsequent incubation. Allantoic fluid was
harvested from chicken embryos which were died within 24 to 48
hours after inoculation or survived 24-48 hours after inoculation,
the virus content determined was 10.sup.6.0 EID.sub.50/0.1 ml.
Formaldehyde solution with a final concentration of 0.1% (v/v) was
added into the sample which is then placed at 37.degree. C. to be
inactivated, and stirred once every 4-6 hours during the process,
and stored after 16 hours of complete inactivation.
Example 13 Preparation of Antigens of Infectious Bursal Disease
Virus
[0094] 1. Preparation of VP2 cDNA
[0095] The IBDV RNA was extracted from the bursa of Fabricius of
SPF chickens infected with very virulent IBDV Chengdu strain by
virus RNA extraction kit and reverse transcribed with random
primers. Oligonucleotide primers were synthesized based on the
conserved region sequences at the 5 `and 3` ends of the VP2 protein
gene. The sequence of the synthesized oligonucleotide primers are
shown in Table 1. PCR amplification was conducted, and the product
was recovered by the agarose gel recovery kit and stored at
-20.degree. C.
TABLE-US-00009 TABLE 9 Primers for amplification of gene of IBDV
VP2 protein VP2-EcoR1-F CCGGAATTCATGACAAACCTGCAAGATCAAAC (SEQ ID
NO. 5) VP2-Sal1-R ACGCGTCGACTTACCTTAGGGCCCGGATTATGT (SEQ ID NO.
6)
[0096] 2. Construction of pCold III VP2/E. coli BL21(DE3)
Strain
[0097] The VP2 cDNA prepared above was double-digested, and the
digested fragment was ligated into the pCold III vector. The
ligated product was directly transformed into E. coli BL21 (DE3)
and spread on a solid LB medium containing 100 .mu.g of ampicillin
and cultured overnight, the colonies grew were the pCold III VP2/E.
coli BL21 (DE3) strain.
[0098] 3. Preparation of Infectious Bursal Disease Virus VP2
Protein
[0099] The strain was cultured in a culture tank with natural
ventilation, which was filled with 70% culture medium and peanut
oil defoamer according to the volume. After sterilization, the seed
solution of pColdIII_VP2/E. coli BL21 (DE3) strain was inoculated
at 2%-4% of the amount of culture medium and cultured at 37.degree.
C. 0.2 mol/L .alpha.-lactose was added in when the OD.sub.600 value
of the solution reached 0.6-1.0, so that its final concentration
reached 0.02 mol/L, then the solution was cultured for 5-8 h.
[0100] After cultivation, the bacteria were collected by
centrifugation, resuspended, ultrasonicated, and centrifuged to
collect the supernatant. After precipitation with ammonium sulfate,
VP2 protein liquid was collected.
Example 14 Preparation of Antigens of Fowl Adenovirus
[0101] 1. Preparation of Fiber-2 cDNA
[0102] FADV DNA was extracted from the FAV-HN strain of fowl
aviadenovirus according to the manual of the virus RNA extraction
kit. The FAV-HN strain (F owl aviadenovirus, strain FAV-HN) has
been deposited in the China Center for Type Culture Collection on
Feb. 29, 2016, of which the accession number is CCTCC NO. V 201609
and the address is Wuhan University, Wuhan, China. Oligonucleotide
primers were synthesized based on the conserved region sequences at
the 5' and 3' ends of the Fiber-2 protein gene. The sequences of
the synthesized oligonucleotide primers are shown in Table 10. PCR
amplification was conducted, and the product was recovered by the
agarose gel recovery kit and stored at -20.degree. C.
TABLE-US-00010 TABLE 10 Primers for amplification of gene of the
Fiber-2 protein of Fowl aviadenovirus Fiber-2-F (SEQ ID NO. 7)
CTCCGGGCCCCTAAAAG Fiber-2-R (SEQ ID NO. 8) CGGGACGGAGGCCGC
[0103] 2. Construction of Expression Vector
[0104] The optimized Fiber-2 protein gene was sent to GENEWIZ, Inc.
for full sequence synthesis and linked into pET28a plasmid
respectively. The linked plasmid and molecular chaperone plasmid
were co-transformed into E. coli BL21 (DE3). The single clone was
picked up and cultured in LB medium containing 100 .mu.g/ml of
kanamycin overnight. The plasmid was extracted and sequenced. The
positive clone was pET28a-FADV-Fiber-2 expression strain.
[0105] 3. Preparation of Fiber-2 Protein
[0106] The pET28a-FADV-Fiber-2/E. coli BL21(DE3) strain prepared in
Example 1 was inoculated into LB medium containing 50-100 .mu.g/ml
of kanamycin at an inoculum amount of 1% (V/V), and cultured with
shaking at 37.degree. C. When OD.sub.600=0.4-0.6, the sample was
placed at 28.degree. C. for 30 minutes.
Isopropyl-.beta.-D-thiogalactopyranoside (IPTG) was added to a
final concentration of 0.1 mM and the sample was cultured with
shaking at 28.degree. C. for 24 hours.
[0107] After cultivation, the bacteria were harvested and
resuspended in PBS (sodium chloride, 8 g, potassium chloride, 0.2
g, disodium hydrogen phosphate, 1.44 g, potassium dihydrogen
phosphate, 0.24 g, adjusted to pH 7.4 with a final volume of 1 L),
centrifuged after ultrasonic decomposition and the supernatant was
obtained. The Fiber-2 protein solution was collected.
Example 15 Preparation of Combined Vaccine of Egg Drop Syndrome
Virus
[0108] The Fiber protein purified according to Example 3 was mixed
with antigen of Newcastle disease virus prepared according to
Example 10, antigen of avian influenza virus prepared according to
Example 11, antigen of avian infectious bronchitis virus prepared
according to Example 12, antigen of infectious bursal disease virus
prepared according to Example 13, and antigen of fowl adenovirus
prepared according to Example 14 in a certain ratio, repectively,
and added to the white oil adjuvant, while the motor was started to
stir the mixture at 17500 r/min for 5 min. 1% thimerosal solution
was added before termination of stirring to a final concentration
of 0.01%. The component ratios are shown in Table 11, 12, 13 and
14.
TABLE-US-00011 TABLE 11 Component ratios of egg drop syndrome virus
two-combined vaccine Vaccine Vaccine Vaccine Vaccine Vaccine
Component 4 5 6 7 8 Fiber protein 1:32 1:64 1:128 1:32 1:64 (HA
titer) Antigen of N7a strain 10.sup.8.0 -- -- -- -- (EID.sub.50/0.1
ml) Antigen of SZ strain -- 10.sup.8.0 -- -- -- (EID.sub.50/0.1 ml)
Antigen of M41 strain -- -- 10.sup.6.0 -- -- (EID.sub.50/0.1 ml)
VP2 protein -- -- -- 1:16 -- (AGP titer) Fiber-2 protein -- -- --
-- 1:4 (AGP titer) White oil adjuvant 66% 66% 66% 66% 66% (V/V
%)
TABLE-US-00012 TABLE 12 Component ratios of egg drop syndrome virus
three-combined vaccine Vaccine Vaccine Vaccine Vaccine Component 9
10 11 12 Fiber protein 1:32 1:64 1:128 1:32 (HA titer) Antigen of
N7a strain 10.sup.8.0 10.sup.8.0 10.sup.8.0 10.sup.8.0
(EID.sub.50/0.1 ml) Antigen of SZ strain 10.sup.8.0 -- -- --
(EID.sub.50/0.1 ml) Antigen of M41 strain -- 10.sup.6.0 -- --
(EID.sub.50/0.1 ml) VP2 protein -- -- 1:16 -- (AGP titer) Fiber-2
protein -- -- -- 1:4 (AGP titer) White oil adjuvant 66% 66% 66% 66%
(V/V %)
TABLE-US-00013 TABLE 13 Component ratios of egg drop syndrome virus
four-combined vaccine Vaccine Vaccine Vaccine Vaccine Vaccine
Component 13 14 15 16 17 Fiber protein 1:32 1:64 1:128 1:32 1:64
(HA titer) Antigen of N7a strain 10.sup.8.0 10.sup.8.0 10.sup.8.0
10.sup.8.0 10.sup.8.0 (EID.sub.50/0.1 ml) Antigen of SZ strain
10.sup.8.0 -- -- 10.sup.8.0 10.sup.8.0 (EID.sub.50/0.1 ml) Antigen
of M41 strain 10.sup.6.0 10.sup.6.0 10.sup.6.0 -- --
(EID.sub.50/0.1 ml) VP2 protein -- 1:16 -- 1:16 -- (AGP titer)
Fiber-2 protein -- -- 1:4 -- 1:4 (AGP titer) White oil adjuvant 66%
66% 66% 66% 66% (V/V %)
TABLE-US-00014 TABLE 14 Component ratios of egg drop syndrome virus
five-combined vaccine Vaccine Vaccine Component 18 19 Fiber protein
1:32 1:64 (HA titer) Antigen of N7a strain 10.sup.8.0 10.sup.8.0
(EID.sub.50/0.1 ml) Antigen of SZ strain 10.sup.8.0 10.sup.8.0
(EID.sub.50/0.1 ml) Antigen of M41 strain 10.sup.6.0 10.sup.6.0
(EID.sub.50/0.1 ml) VP2 protein 1:16 -- (AGP titer) Fiber-2 protein
-- 1:4 (AGP titer) White oil adjuvant 66% 66% (V/V %)
Example 16 Immunogenicity Test of the Combined Vaccine of Egg Drop
Syndrome Virus
[0109] 1. Immunogenicity Test of Egg Drop Syndrome Virus Part
[0110] 170 21-day-old SPF chickens were divided into 17 groups,
that is to say, 10 chickens per group, the chickens in groups 27-42
were immunized by subcutaneous injection in necks with
corresponding vaccines 4-19 prepared in Example 15, respectively,
at an immune amount of 0.5 ml, and the chickens in group 43 were
injected with 0.5 ml of physiological saline solution by
subcutaneous injection, as a blank control. All experimental
chickens were fed in isolation. On the 21st day after immunization,
blood sample was taken from each of the chickens and the
corresponding serum was separated and HI titer of the egg drop
syndrome virus antibody in each serum was determined. The results
are shown in Table 15.
TABLE-US-00015 TABLE 15 Results of immunogenicity test of the egg
drop syndrome virus part of the combined vaccine of egg drop
syndrome virus Results of determining HI antibody titers (log2)
Immune dose On the 21st (ml per Number of Before day after Group
chicken) chickens immunization immunization 27 0.5 10 0 9.9 28 0.5
10 0 10 29 0.5 10 0 10.2 30 0.5 10 0 9.5 31 0.5 10 0 9.8 32 0.5 10
0 10.4 33 0.5 10 0 10.2 34 0.5 10 0 9.9 35 0.5 10 0 10 36 0.5 10 0
9.5 37 0.5 10 0 9.7 38 0.5 10 0 9.6 39 0.5 10 0 9.9 40 0.5 10 0
10.1 41 0.5 10 0 9.4 42 0.5 10 0 10.3 43 0.5 10 0 0
[0111] The results showed that the groups immunized with vaccines
4-19 produced relatively higher HI antibody titers on the 21st days
after immunization, which could effectively prevent the outbreak of
egg drop syndrome among chicken flocks. It is shown that the
oil-emulsion combined vaccine, in which the Fiber protein of egg
drop syndrome virus provided by the present disclosure was prepared
as an antigen, could provide complete protection for the
chickens.
[0112] 2. Immunogenicity Test of Newcastle Disease Virus Part
[0113] 130 21-day-old SPF chickens were divided into 13 groups,
that is to say, 10 chickens per group, the chickens in groups 44-55
were immunized by subcutaneous injection in necks with
corresponding vaccines 4, and 9-19 prepared in Example 15,
respectively, at an immune amount of 20 .mu.l, and the chickens in
group 44 were injected with 20 .mu.l of physiological saline
solution by subcutaneous injection, as a blank control of
challenge. All the experimental chickens were fed in isolation. On
the 21st day after immunization, the blood samples of the immunized
chicken in groups 44-55 together with the control chicken in the
56th group were collected and the corresponding serums were
separated. HI antibody of the Newcastle disease virus was detected,
meanwhile the chicken were challenged by intramuscular injection of
the virus solution of virulent Newcastle disease HN1101 strain and
then were observed for 14 days. The numbers of incidence and deaths
and protection rates were recorded. The results are shown in Table
16.
TABLE-US-00016 TABLE 16 Results of immunogenicity test of the
Newcastle disease virus part of the combined vaccine of egg drop
syndrome virus Results of determining HI antibody titer (log2)
Immune Day 21 Results of challenge dose Number Before after Number
Number Protec- (.mu.l per of immu- immu- of of tion Group chicken)
chickens nization nization incidence deaths rate 44 20 10 0 8.3
0/10 0/10 100% 45 20 10 0 8.0 0/10 0/10 100% 46 20 10 0 8.1 0/10
0/10 100% 47 20 10 0 8.2 0/10 0/10 100% 48 20 10 0 8.2 0/10 0/10
100% 49 20 10 0 8.1 0/10 0/10 100% 50 20 10 0 8.0 0/10 0/10 100% 51
20 10 0 8.0 0/10 0/10 100% 52 20 10 0 8.0 0/10 0/10 100% 53 20 10 0
8.1 0/10 0/10 100% 54 20 10 0 8.1 0/10 0/10 100% 55 20 10 0 8.0
0/10 0/10 100% 56 20 10 0 0 10/10 10/10 0 Note: the HI antibody was
determined as the geometric mean of the immunized chicken
antibody.
[0114] The results showed that the groups immunized with vaccines
4, and 9-19 could all produce a relatively higher Newcastle
antibody and compared with the control group, could provide
complete protection against the virulent strain. It is shown that
the oil-emulsion combined vaccine, in which the Newcastle disease
virus N7a strain solution provided by the present disclosure was
prepared as antigen, could provide complete protection for the
chickens.
[0115] 3. Immunogenicity Test of Avian Influenza Virus Part
[0116] 80 21-day-old SPF chickens were divided into 8 groups, that
is to say, 10 chickens per group, the chickens in groups 57-63 were
immunized by subcutaneous injection in necks with corresponding
vaccines 5, 9, 13, and 16-19 prepared in Example 15, respectively,
at an immune amount of 0.3 ml, and the chickens in group 64 were
injected with 0.3 ml of physiological saline solution by
subcutaneous injection, as a blank control of challenge. All the
experimental chickens were fed in isolation. On the 21st day after
immunization, the blood samples of the immunized chicken in groups
57-63 together with the control chicken in the 64th group were
collected and the corresponding serums were separated. HI antibody
of the H9 subtype of avian influenza virus was detected. Meanwhile
the chickens were challenged by intramuscular injection of the
virus solution of SZ strain at 0.2 ml (containing 10.sup.7.0
EID.sub.50) per chicken. On the 5th day after challenge, cloacal
swabs were collected. 5 SPF chicken embryos of 10 to 11 days old
were inoculated with the treated cloacal swab samples through the
allantoic cavity. After incubating for 5 days, both dead embryos
and live embryos should be assayed for agglutination titers of the
erythrocyte in the chicken embryo solution. Among each five chicken
embryos inoculated with one swab sample, as long as the
agglutination titers of one chicken embryo solution was not less
than 1:16 (micro-method), it could be determined as being positive
virus isolation. The samples showing negative virus isolation
should be re-determined after blind passage. There should be at
least 9 chickens in the immunization group showing negative virus
isolation; and there should be at least 4 chickens in the control
group showing positive virus isolation. The results are shown in
Table 17.
TABLE-US-00017 TABLE 17 Results of immunogenicity test of the avian
influenza virus part of the combined vaccine of egg drop syndrome
virus Results of determining HI antibody titer (log2) Immune Day 21
Results of challenge dose Number Before after isolation (ml per of
immu- immu- rate Protection Group chicken) chickens nization
nization of virus rate 57 0.3 10 0 8.9 0/10 100% 58 0.3 10 0 8.5
0/10 100% 59 0.3 10 0 8.6 0/10 100% 60 0.3 10 0 8.6 0/10 100% 61
0.3 10 0 8.5 0/10 100% 62 0.3 10 0 8.7 0/10 100% 63 0.3 10 0 8.8
0/10 100% 64 0.3 10 0 0 10/10 0 Note: the HI antibody was
determined as the geometric mean of the immunized chicken
antibody.
[0117] The results showed that the groups immunized with vaccines
5, 9, 13, and 16-19 could all produce a relatively higher avian
influenza virus antibody on the 21st day after immunization and
compared with the control group, could provide complete protection
against the virulent strain. It is shown that the oil-emulsion
combined vaccine, in which the avian influenza virus H9 subtype
strain solution provided by the present disclosure was prepared as
antigen, could provide complete protection for the chickens.
[0118] 4. Immunogenicity Test of Avian Infectious Bronchitis
Part
[0119] 80 21-day-old SPF chicken were divided into 8 groups, 10
chickens per group, that is to say, the chickens in groups 65-71
were immunized by eye-drop and norse-drop inoculation with live
vaccines (H120 strain) of avian infectious bronchitis,
respectively, at an immune amount of 0.05 ml per chicken. On the
21st day after immunization, the blood samples of the immunized
chicken in groups 65-71 together with the control chicken in the
72th group were collected and the corresponding serums were
separated. Meanwhile, the chickens in groups 65-71 were immunized
by subcutaneous injection in necks with corresponding vaccines 6,
10, 13, 14, 15, 18, and 19 prepared in Example 15, respectively, at
an immune amount of 0.3 ml per chicken. On the 28st day after
immunization, the blood samples of the immunized chicken in groups
65-71 together with the control chicken in the 72th group were
collected and the corresponding serums were separated. The serum
samples collected from the immunized chickens in groups 65-71 on
the 21th day after first immunization of live vaccines and on the
28th day after immunization of inactivated vaccines (The serum
samples were collected from the control chickens in group 72 at the
same time) were detected for HI antibody titers. For the
immunization groups, the geometric mean of the HI antibody titers
in the serums of second immunization was not less than 4 times of
the geometric mean the HI antibody titers in the serums of first
immunization, and the geometric mean of the HI antibody titers in
the non-immunization control group was not higher than 1:8
(micromethod). At the same time, the challenge experiment was
conducted with virulent M41 strain of avian infectious bronchitis
virus via norse-drop inoculation at 10.sup.3.0 EID.sub.50 per
chicken. The results are shown in Table 18.
TABLE-US-00018 TABLE 18 Results of immunogenicity test of the avian
infectious bronchitis part of the combined vaccine of egg drop
syndrome virus Factors of anti- body titers for the first immu-
Antibody Antibody nization versus isolation titers for titers for
antibody titers rate of the first the second for the second virus
after Group immunization immunization immunization challenge 65
1:18.3 1:91.9 5.0 0/10 66 1:18.7 1:100.4 5.4 0/10 67 1:20.4 1:103.5
5.1 0/10 68 1:24.9 1:125.6 5.0 0/10 69 1:24.1 1:122.8 5.1 0/10 70
1:25.7 1:124.9 4.9 0/10 71 1:20.1 1:121.2 6.0 0/10 72 .ltoreq.1:4
.sup. .ltoreq.1:4 .sup. -- 5/5
[0120] The results showed that the geometric means of the HI
antibody titers in the serums of second immunization for vaccines
6, 10, 13, 14, 15, 18, and 19 were not less than 4 times of the
geometric means of the HI antibody titers in the serums of first
immunization, no virus was isolated from all of the tracheas of
immunized chickens after challenge. The vaccines 6, 10, 13, 14, 15,
18, and 19 could provide complete protection against the virulent
strain. It is shown that the oil-emulsion combined vaccine, in
which the avian infectious bronchitis part strain solution provided
by the present disclosure was prepared as antigen, could provide
complete protection for the chickens.
[0121] 5. Immunogenicity Test of Avian Infectious Bursal Disease
Virus Part
[0122] 60 21-day-old SPF chickens were divided into 6 groups, that
is to say, 10 chickens per group, the chickens in groups 73-77 were
immunized by subcutaneous injection in necks with corresponding
vaccines 7, 11, 14, 16, and 18 prepared in Example 15,
respectively, at an immune amount of 0.3 ml per chicken, and the
chickens in group 78 were injected with 0.3 ml of physiological
saline solution by subcutaneous injection, as a blank control of
challenge. All experimental chickens were fed in isolation. On the
21st day after immunization, the chickens in groups 73-78 were
challenged by eye-drop inoculation with 0.1 ml (actual virus
content.gtoreq.100 BID) of 100-fold dilution of virus solution of
BC6-85((CVCC AV7 strain, purchased from the China Veterinary Drug
Administration) of the avian infectious bursal disease. After
challenge, clinical signs of the chickens were observed daily, and
the numbers of incidence and deaths and protection rates were
recorded. The survived chickens were killed after 72-96 hours,
dissections were conducted respectively to observe lesions of the
Bursa of Fabricus etc. There should be at least 8 normal chickens
in the immunization groups showing negative lesions of the Bursa of
Fabricus; and there should be at least 4 sick chickend in the
control group showing significant lesions of the Bursa of Fabricus
(e.g. one or more of lesions such as strip-like bleeding of breast
or leg muscle, enlargement or shrinking of bursa of Fabricius,
yellowing of bursa of Fabricius, jelly-like secretions within bursa
of Fabricius). The results are shown in Table 19.
TABLE-US-00019 TABLE 19 Results of immunogenicity test of the avian
infectious bursal disease virus part of the combined vaccine of egg
drop syndrome virus Immune dose Results of challenge (ml per Number
of Number of Protection Group chicken) chickens incidence rate 73
0.3 10 0/10 100% 74 0.3 10 0/10 100% 75 0.3 10 0/10 100% 76 0.3 10
0/10 100% 77 0.3 10 0/10 100% 78 0.3 10 10/10 0
[0123] The results showed that vaccines 7, 11, 14, 16, and 18 could
provide complete protection against the virulent strain of the
avian infectious bursal disease virus on Day 21 after
immunization.
[0124] 6. Immunogenicity Test of Fowl Adenovirus Part
[0125] 60 21-day-old SPF chickens were divided into 6 groups, that
is to say, 10 chickens per group, the chickens in groups 79-83 were
immunized by subcutaneous injection in necks with corresponding
vaccine 8, 12, 15, 17, and 19 prepared in Example 15, respectively,
at an immune amount of 0.3 ml per chicken, and the chickens in
group 84 were injected with 0.3 ml of physiological saline solution
by subcutaneous injection, as a blank control. All experimental
chicken were fed in isolation. On the 21st day after immunization,
the chickens were challenged by intramuscular injection of the
virus solution of FAV-HN strain and then were observed for 14 days.
The numbers of incidence and deaths and protection rates were
recorded. The results are shown in Table 20.
TABLE-US-00020 TABLE 20 Results of immunogenicity test of the fowl
adenovirus part of the combined vaccine of egg drop syndrome virus
Immune dose Results of challenge (ml per Number of Number of Number
of Protection Group chicken) chickens incidence deaths rate 79 0.3
10 0/10 0/10 100% 80 0.3 10 0/10 0/10 100% 81 0.3 10 0/10 0/10 100%
82 0.3 10 0/10 0/10 100% 83 0.3 10 0/10 0/10 100% 84 0.3 10 10/10
10/10 0
[0126] The results showed that the control group, the 84th group
all died of the disease, while the immunization groups, groups
79-83 had better immune protection effect on the immunized chickens
and the immunization effect was good. It is shown that the
oil-emulsion combined vaccine, in which the avian influenza virus
strain solution provided by the present disclosure was prepared as
antigen, could provide complete protection for the chickens.
[0127] It is proved that the combined vaccine of egg drop syndrome
virus provided by the disclosure can resist the invasion of related
pathogens and shows good immunogenicity and can effectively control
the epidemic of diseases associated with egg drop syndrome virus in
China.
Example 17 Preparation of Subunit Vaccine of the Fiber Protein of
Egg Drop Syndrome Virus
[0128] The following primers were synthesized based on the Fiber
protein gene of egg drop syndrome virus:
Fiber-F1:5-CATGCCATGGGCATGACAAGACC CGCAAAGCGACTACG GTTGGACCCT-3
(SEQ ID NO. 9), Fiber-R1:5-CCGCTCGAGCTACTGTGCTCCAACATATG-3 (SEQ ID
NO. 10). The gene fragment of the Fiber protein gene of egg drop
syndrome virus was obtained through PCR amplification.
[0129] The PCR product was sent to Invitrogen Corporation for
sequencing, and the sequencing result is as shown in the sequence
of SEQ ID NO. 2.
[0130] The PCR product was electrophoresed to recover the target
fragments and these were ligated into pET28a plasmid. The linked
plasmid and molecular chaperone plasmid were co-transformed into E.
coli BL21 (DE3). The single clone was picked up and cultured in LB
medium containing 100 .mu.g/ml of kanamycin overnight. The plasmid
was extracted and sequenced. The positive clone was
pET28a-EDSV-Fiber expression strain.
[0131] The pET28a EDSV Fiber/E. coli BL21 (DE3) strain was
inoculated into LB medium containing 50-100 .mu.g/ml of kanamycin
and 20 .mu.g/ml of chloramphenicol at an inoculum amount of 1%
(V/V), and cultured with shaking at 37.degree. C. When
OD.sub.600=0.4-0.6, the sample was placed at 28.degree. C. for 30
minutes. Isopropyl-.beta.-D-thiogalactopyranoside (IPTG) was added
to a final concentration of 0.1-1.0 mM and the sample was cultured
with shaking at 28.degree. C. for 24 hours. After cultivation, the
bacteria were harvested and resuspended in PBS (sodium chloride, 8
g, potassium chloride, 0.2 g, disodium hydrogen phosphate, 1.44 g,
potassium dihydrogen phosphate, 0.24 g, adjusted to pH 7.4 with a
final volume of 1 L), centrifuged after ultrasonic decomposition
and the supernatant was obtained. The expression product had a
higher content of the soluble target protein, the amount of
expression of the soluble Fiber protein could reach up to 32% of
the total bacterial protein, the HA titer of Fiber protein reached
1:2048, and the endotoxin had a content of 0.49.times.10.sup.5
EU/ml.
[0132] It was measured that the HA titer of Fiber protein reached
1:2048, and the content of the endotoxin had been reduced into
0.008.times.10.sup.5 EU/ml.
[0133] The results showed that Triton X-114 could eliminate the
residual endotoxin in the recombinant protein and had no effect on
the immunogenicity of Fiber protein.
Example 18 Preparation and Immunogenicity Test of Five-Combined
Vaccines of Newcastle Disease Virus, Avian Infectious Bronchitis
Virus, Avian Influenza Virus, Egg Drop Syndrome Virus and Fowl
Adenovirus
[0134] 1. Preparation of Five-Combined Vaccine
[0135] The fiber protein purified according to Example 17 was mixed
with antigens of Newcastle disease virus prepared according to
Example 10, avian influenza virus prepared according to Example 11,
avian infectious bronchitis virus prepared according to Example 12,
and fowl adenovirus prepared according to Example 14 in a certain
ratio, respectively, and added to the white oil adjuvant, while the
motor was started to stirthe mixtures at 17500 r/min for 5 min. 1%
thimerosal solution was added to a final concentration of 0.01%
before termination of stirring. The component ratios are shown in
Table 21.
TABLE-US-00021 TABLE 21 Component ratios of five-combined vaccine
Component Vaccine 20 Antigen of N7a strain 10.sup.8.0
(EID.sub.50/0.1 ml) Antigen of M41 strain 10.sup.6.0
(EID.sub.50/0.1 ml) Antigen of SZ strain 10.sup.8.0 (EID.sub.50/0.1
ml) Fiber protein 1:32 (HA titer) Fiber-2 protein 1:8 (AGP titer)
White oil adjuvant 66% (v/v %)
[0136] 2. Immunogenicity Test of Egg Drop Syndrome Virus Part of
the Five-Combined Vaccine
[0137] The immunogenicity of the egg drop syndrome virus part of
the five-combined vaccine was verified with reference to the method
in the immunogenicity test of egg drop syndrome virus part in
Example 16 Part 1, group 85 was an immunization group and group 86
was a blank control. The results are shown in Table 22.
TABLE-US-00022 TABLE 22 Result of immunogenicity test of egg drop
syndrome virus part of the five-combined vaccine Results of
determining HI antibody titers (log2) Immune dose On the 21st (ml
per Number of Before day after Group chicken) chickens immunization
immunization 85 0.5 10 0 10.4 86 0.5 10 0 0
[0138] The results showed that, on Day 21 after immunization, the
group immunized with vaccine 20 could produce a relatively higher
HI antibody titer, and this effectively prevents occurrence of the
egg drop syndrome in chickens. The results showed that the
five-combined vaccine, in which the Fiber protein of egg drop
syndrome virus was prepared as the antigen, could provide complete
protection to chickens.
[0139] 3. Immunogenicity Test of the Newcastle Disease Virus Part
of the Five-Combined Vaccine
[0140] The immunogenicity of the Newcastle disease virus part of
the five-combined vaccine was verified with reference to the method
in the immunogenicity test of Newcastle disease virus part in
Example 16 Part 2, group 87 was an immunization group and group 88
was a blank control. The results are shown in Table 23.
TABLE-US-00023 TABLE 23 Results of immunogenicity test of the
Newcastle disease virus part of the five-combined vaccine Results
of determining HI antibody titer (log2) Immune Day 21 Results of
challenge dose Number Before after Number Number Protec- (.mu.l per
of immu- immu- of of tion Group chicken) chickens nization nization
incidence deaths rate 87 20 10 0 8.3 0/10 0/10 100% 88 20 10 0 0
10/10 10/10 0 Note: the HI antibody was determined as the geometric
mean of the immunized chicken antibody.
[0141] The results showed that the group immunized with vaccine 20
could produce a relatively higher titer of Newcastle disease virus
antibody, and compared with the control group, could provide
complete protection against the virulent strain. The results showed
that the combined vaccine, in which the Newcastle disease virus N7a
strain solution was prepared as the antigen, could provide complete
protection to chickens.
[0142] 4. Immunogenicity Test of Avian Influenza Virus Part of the
Five-Combined Vaccine
[0143] The immunogenicity of the avian influenza virus part of the
five-combined vaccine was verified with reference to the method in
the immunogenicity test of avian influenza virus part in Example 16
Part 3, group 89 was an immunization group and group 90 was a blank
control. The results are shown in Table 24.
TABLE-US-00024 TABLE 24 Results of immunogenicity test of the avian
influenza virus part of the five-combined vaccine Results of
determining HI antibody titer (log2) Immune Day 21 Results of
challenge dose Number Before after isolation (ml per of immu- immu-
rate Protection Group chicken) chickens nization nization of virus
rate 89 0.3 10 0 8.9 0/10 100% 90 0.3 10 0 0 10/10 0 Note: the HI
antibody was determined as the geometric mean of the immunized
chicken antibody.
[0144] The results showed that the group immunized with vaccine 20
could produce a higher titer of avian influenza virus antibody on
Day 21 after immunization and compared with the control group,
could provide complete protection against the virulent strain. The
results showed that the five-combined vaccine, in which the H9
subtype of avian influenza virus solution was prepared as the
antigen, could provide complete protection to chickens.
[0145] 5. Immunogenicity Test of Avian Infectious Bronchitis Virus
Part of the Five-Combined Vaccine
[0146] The immunogenicity of the avian infectious bronchitis virus
part of the five-combined vaccine was verified with reference to
the method in the immunogenicity test of avian infectious
bronchitis virus part in Example 16 Part 4, group 91 was an
immunization group and group 92 was a blank control. The results
are shown in Table 25.
TABLE-US-00025 TABLE 25 Results of immunogenicity test of avian
infectious bronchitis virus part of the five-combined vaccine
Factors of anti- body titers for the first immu- Antibody Antibody
nization versus isolation titers for titers for antibody titers
rate of the first the second for the second virus after Group
immunization immunization immunization challenge 91 1:20.4 1:123.2
6.0 0/10 92 .ltoreq.1:4 .sup. .ltoreq.1:4 .sup. -- 5/5
[0147] The results showed that the geometric means of the HI
antibody titers in the serums of second immunization for vaccine 20
were not less than 4 times of the geometric means of the HI
antibody titers in the serums of first immunization, no virus was
isolated from all of the tracheas of immunized chickens after
challenge. The vaccine 20 could provide complete protection against
the virulent strain. The results showed that the five-combined
vaccine, in which the avian infectious bronchitis virus solution
was prepared as the antigen, could provide complete protection to
chickens.
[0148] 6. Immunogenicity Test of the Fowl Adenovirus Part of the
Five-Combined Vaccine
[0149] The immunogenicity of the fowl adenovirus part of the
five-combined vaccine was verified with reference to the method in
the immunogenicity test of fowl adenovirus part in Example 16 Part
6, group 93 was an immunization group and group 94 was a blank
control. The results are shown in Table 26.
TABLE-US-00026 TABLE 26 Results of immunogenicity test of fowl
adenovirus part of the five-combined vaccine Immune dose Results of
challenge (ml per Number of Number of Number of Protection Group
chicken) chickens incidence deaths rate 93 0.3 10 0/10 0/10 100% 94
0.3 10 10/10 10/10 0
[0150] The results showed that the immunization groups could
produce better immune protection on Day 21 after immunization. The
results showed that the five-combined vaccine, in which the fowl
adenovirus Fiber-2 protein was prepared as the antigen, could
provide complete protection to chickens.
[0151] The foregoing descriptions are merely preferred examples of
the present disclosure and are not intended to limit the present
disclosure in any form. Although the present disclosure has been
disclosed by way of preferred examples, it is to be understood that
the disclosure is not limited thereto. A person skilled in the art
can make some equivalent variations or modifications to the
above-disclosed technical content without departing from the scope
of the technical solutions of the present disclosure to obtain
equivalent examples. Simple modifications, equivalent changes and
modifications made to the above examples according to the technical
essence of the present disclosure all fall within the scope of the
technical solutions of the present disclosure without departing
from the contents of the technical solutions of the present
disclosure.
Sequence CWU 1
1
1011560DNAEggdrop syndrome-1976 virus 1atgaaacgtc tgcgtctgga
cccggacccg gtttacccgt tcggtacctc tgaaaccatc 60ccgatgccgc cgttcatcga
agctggttct ggtctggctg ttaacggtct gcagctgtac 120atcaccgctc
aggctccggt tggtttcacc aacaaagctg ttaccctgaa atacggtgac
180ggtctggaag ttaacgaaaa cggtgaactg atcgctaccg cttcttctgc
tgttaaaccg 240ccgctgcact tcgaccgtgg ttacatcgtt ctgaacctgc
aggacccgct gggtgttatc 300gacggtaaac tgggtgttaa actgggtccg
ggtgttcaca tcaacggtga aggtgctgtt 360gctgttgaat ctccggttga
cccgatcacc ctggacaccg ctggtcgtat caccctgaac 420tacggtaccg
gtctgaacgt ttctgacggt aaactgcgtc tggtttctcc ggaatctccg
480ctgaccctgc tgggtaacgg taaagttgct ctgaacttcg gtaactctat
ggaactggtt 540cagggtaccc tgcagctgaa agctccgctg aacccgctgt
tcatgacccc ggctggtgct 600atcggtctgc gtgttgacga catgttcaac
atctctgaag gtctgctgtc tttcaaaatg 660ccgtctgacc cgatctcttt
caacgctgac ggtatgctgt ctctgaacac caacgacacc 720ctgcagacca
ccggtggtct gctgggtctg accgaaccgg ctaaaccgct gaaactggct
780gacggtaaac tgggtgttaa cgttggtctg ggtctggctg tttctaacgg
ttctctgacc 840gttaacgctg gtcagggtct gaccatccgt aacaacgctg
ttgctgttaa cggtggtaac 900accctggctt tcaacaacta cggtgaagtt
gaactgaaaa acccgcgtaa cccgatcggt 960ctgacccagg acggtgaact
ggctctgatc atcggttacg gtctgaccac cctggacggt 1020cgtctgaccc
tgctgaccgc ttctacctct ccgatcgctg ttggtccgac cggtgttacc
1080ttcaacgtta ccccgtctga cttctacttc ctgtcttcta aactggctct
gaacgttgaa 1140acccgtggtg gtctggaaaa atctgacacc ggtctgaaaa
tcaaacgtgc tgctccgctg 1200tctatcacct ctgacggtga actgaccctg
gcttacgact ctaccgactt ccaggttacc 1260gaaaacggtc tggctctgaa
agtttctccg acccagaccc cgctgacccg tatcatctct 1320atgggtaaca
acctgttcga ctctggttac gaaatcttcg cttcttgccc gcagaacaaa
1380gctgctaaag ttgctggtta cgtttacctg acctctgttg gtggtctggt
tcacggtacc 1440atccagatca aagctaccgc tggttactgg ttcaccggtg
gtaactctgt tcaggaatct 1500atccgtttcg gtctggttct gtgcccgttc
tctgctcgtg acccgaccgc taacctgtct 156021947DNAEggdrop syndrome-1976
virus 2atgacaagac ccgcaaagcg actacggttg gaccctgatc ctgtttatcc
cttcgggacg 60agcgagacga tcccaatgcc tccgttcatc gaagctgggt caggtctagc
agtaaatgga 120ctgcagcttt atataacagc tcaagctccg gtgggcttca
ccaacaaagc tgtaacatta 180aaatatggag atggattgga agtaaatgaa
aatggagaac tcatagctac ggcttcttcg 240gcagtaaagc caccactcca
ttttgatagg ggttatatag tgttaaatct tcaggatcca 300ttgggtgtta
ttgatgggaa gcttggggtc aagttaggcc ctggggttca catcaatggt
360gaaggggctg tggcggtaga atcccctgtg gaccccatta cacttgatac
ggctggtaga 420attactttaa attatggcac aggtttaaat gtgagtgatg
gaaaattacg actagtaagt 480cctgaaagtc cgctcacact tcttggaaat
ggcaaggttg ctcttaattt tggtaattca 540atggagcttg tgcaagggac
cttgcaactg aaagctccgc taaatccttt gttcatgacc 600cccgcgggtg
cgatcggctt aagggtggat gacatgttta acatttctga aggtttactc
660tccttcaaga tgccatccga tccaatttcg tttaatgctg atggtatgtt
gtctttgaac 720acaaatgaca cattgcaaac aactggtggg ctgttagggt
tgaccgaacc tgccaagccg 780ttaaaattgg ccgatggcaa gttaggtgta
aatgtgggcc ttgggttagc ggtttctaat 840gggtcattga ctgtaaatgc
agggcagggg ttgactattc gaaataatgc ggtggcagtt 900aatgggggca
acacgcttgc ttttaataat tatggagagg tggaacttaa aaaccctaga
960aaccccataa gcctgaccca agatggtgaa ttggttttga taatcggtca
tggcctaaca 1020acccttgatg gacggctcac tctacttacc gcttcgacct
ctccgatagc tgtagggcca 1080accggtgtta catttaatgt tacaccgagt
gatttttact ttttatctag taaattagct 1140ctcaatgttg agacccgtgg
cggcttagaa aaaagtgaca ctggtttaaa aattaaacgt 1200gcggcccctc
tcagtatcac atctgatggt gagttgactt tggcttatga ttccacggat
1260tttcaggtga cagaaaacgg cctagcccta aaggtatctc cgacgcagac
ccctctcacc 1320agaataattt ctatgggaaa taacttgttt gattctggtt
atgagatttt tgcttcatgt 1380ccgcagaaca aagcagcaaa ggttgcaggg
tatgtgtatt taacatcggt tggtgggctt 1440gtacatggga ccattcagat
taaagctact gcggggtatt ggtttacggg gggaaacagc 1500gtgcaggaaa
gtatcaggtt tggattggtg ttgtgtcctt ttagtgctcg cgaccccact
1560gctaacctgt caggctggcc agcgccagta gtgtggagtg gtgatagcaa
tactccccta 1620tattttgcgg ccaatgccat tagttatacc aataaccgtg
taaatcttgc agttaccggt 1680aacttttaca aggaggaaac cgaattgccg
ggttacactc gtcattcttt ctgccctacc 1740gggaccaccg gaatgaattt
tacagggggt aatttgtatg tgtgtccgtg cactgtaaat 1800acaggggcaa
ccacactgaa tgccatttat atggtgtttg tgattactca atcagctttg
1860ggaactaatt tctttgcttc taacacccct cccaacacat tctttttaac
tccccccatt 1920ccctttacat atgttggagc acagtag 1947325DNAArtificial
SequenceFoward primer for amplification of gene of of Fiber protein
of egg drop syndrome virus 3atgaagcgac tacggttgga ccctg
25425DNAArtificial SequenceReverse primer for amplification of gene
of of Fiber protein of egg drop syndrome virus 4ctactgtgct
ccaacatatg taaag 25532DNAArtificial SequenceFoward primer for
amplification of VP2 gene of infectious bursal disease virus
5ccggaattca tgacaaacct gcaagatcaa ac 32633DNAArtificial
SequenceReverse primer for amplification of VP2 gene of infectious
bursal disease virus 6acgcgtcgac ttaccttagg gcccggatta tgt
33717DNAArtificial SequenceFoward primer for amplification of gene
of Fiber-2 protein of fowl adenovirus 7ctccgggccc ctaaaag
17815DNAArtificial SequenceReverse primer for amplification of gene
of Fiber-2 protein of fowl adenovirus 8cgggacggag gccgc
15948DNAArtificial SequenceFoward primer for amplification of gene
of Fiber protein of egg drop syndrome virus 9catgccatgg gcatgacaag
acccgcaaag cgactacggt tggaccct 481029DNAArtificial SequenceReverse
primer for amplification of gene of Fiber protein of egg drop
syndrome virus 10ccgctcgagc tactgtgctc caacatatg 29
* * * * *