U.S. patent application number 15/967052 was filed with the patent office on 2018-12-06 for polynucleotides for multivalent rna interference, compositions and methods of use thereof.
The applicant listed for this patent is HALO-BIO RNAI THERAPEUTICS, INC.. Invention is credited to Todd M. HAUSER.
Application Number | 20180346908 15/967052 |
Document ID | / |
Family ID | 43298453 |
Filed Date | 2018-12-06 |
United States Patent
Application |
20180346908 |
Kind Code |
A1 |
HAUSER; Todd M. |
December 6, 2018 |
POLYNUCLEOTIDES FOR MULTIVALENT RNA INTERFERENCE, COMPOSITIONS AND
METHODS OF USE THEREOF
Abstract
The present invention includes bivalent or multivalent nucleic
acid molecules or complexes of nucleic acid molecules having two or
more target-specific regions, in which the target-specific regions
are complementary to a single target gene at more than one distinct
nucleotide site, and/or in which the target regions are
complementary to more than one target gene or target sequence. Also
included are compositions comprising such nucleic acid molecules
and methods of using the same for multivalent RNA interference and
the treatment of a variety of diseases and infections.
Inventors: |
HAUSER; Todd M.; (Seattle,
WA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
HALO-BIO RNAI THERAPEUTICS, INC. |
Seattle |
WA |
US |
|
|
Family ID: |
43298453 |
Appl. No.: |
15/967052 |
Filed: |
April 30, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14954653 |
Nov 30, 2015 |
9957505 |
|
|
15967052 |
|
|
|
|
13375460 |
Mar 23, 2012 |
9200276 |
|
|
PCT/US10/36962 |
Jun 1, 2010 |
|
|
|
14954653 |
|
|
|
|
61183011 |
Jun 1, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 9/10 20180101; C12N
2310/51 20130101; C12N 2320/30 20130101; C12N 2310/14 20130101;
C12N 15/111 20130101; C12N 15/113 20130101; C12N 2310/52 20130101;
A61P 31/18 20180101; C12N 15/1131 20130101; C12N 2310/53
20130101 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C12N 15/11 20060101 C12N015/11; C12N 15/113 20060101
C12N015/113 |
Claims
1. A polynucleotide complex of at least three separate
polynucleotides, comprising (a) a first polynucleotide comprising a
target-specific region that is complementary to a first target
sequence, a 5' region, and a 3' region; (b) a second polynucleotide
comprising a target-specific region that is complementary to a
second target sequence, a 5' region, and a 3' region; and (c) a
third polynucleotide comprising a null region or a target-specific
region that is complementary to a third target specific, a 5'
region, and a 3' region, wherein each of the target-specific
regions of the first, second, and third polynucleotides are
complementary to a different target sequence, wherein the 5' region
of the first polynucleotide is complementary to the 3' region of
the third polynucleotide, wherein the 3' region of the first
polynucleotide is complementary to the 5' region of the second
polynucleotide, and wherein the 3' region of the second
polynucleotide is complementary to the 5' region of the third
polynucleotide, and wherein the three separate polynucleotides
hybridize via their complementary 3' and 5' regions to form a
polynucleotide complex with a first, second, and third
single-stranded region, and a first, second, and third
self-complementary region.
2. The polynucleotide complex of claim 1, wherein the first,
second, and/or third polynucleotide comprises about 15-30
nucleotides.
3. The polynucleotide complex of claim 1, wherein the first,
second, and/or third polynucleotide comprises about 17-25
nucleotides.
4. The polynucleotide complex of claim 1, wherein one or more of
the self-complementary regions comprises about 5-10 nucleotide
pairs.
5. The polynucleotide complex of claim 1, wherein one or more of
the self-complementary regions comprises about 7-8 nucleotide
pairs.
6. The polynucleotide complex of claim 1, wherein each of said
first, second, and third target sequences are present in the same
gene, cDNA, mRNA, or microRNA.
7. The polynucleotide complex of claim 1, wherein at least two of
said first, second, and third target sequences are present in
different genes, cDNAs, mRNAs, or microRNAs.
8. The polynucleotide complex of claim 1, wherein all or a portion
of the 5' and/or 3' region of each polynucleotide is also
complementary to the target sequence for that polynucleotide.
9. The polynucleotide complex of claim 1, wherein one or more of
the self-complementary regions comprises a 3' overhang.
10. A self-hybridizing polynucleotide molecule, comprising (a) a
first nucleotide sequence comprising a target-specific region that
is complementary to a first target sequence, a 5' region, and a 3'
region, (b) a second nucleotide sequence comprising a
target-specific region that is complementary to a second target
sequence, a 5' region, and a 3' region; and (c) a third nucleotide
sequence comprising a null region or a target-specific region that
is complementary to a third target sequence, a 5' region, and a 3'
region, wherein the target-specific regions of each of the first,
second, and third nucleotide sequences are complementary to a
different target sequence, wherein the 5' region of the first
nucleotide sequence is complementary to the 3' region of the third
nucleotide sequence, wherein the 3' region of the first nucleotide
sequence is complementary to the 5' region of the second nucleotide
sequence, and wherein the 3' region of the second nucleotide
sequence is complementary to the 5' region of the third nucleotide
sequence, and wherein each of the 5' regions hybridizes to their
complementary 3' regions to form a self-hybridizing polynucleotide
molecule with a first, second, and third single-stranded region,
and a first, second, and third self-complementary region.
11. The self-hybridizing polynucleotide molecule of claim 10,
wherein the first, second, or third nucleotide sequence comprises
about 15-60 nucleotides.
12. The self-hybridizing polynucleotide molecule of claim 10,
wherein the target-specific regions each comprise about 15-30
nucleotides.
13. The self-hybridizing polynucleotide molecule of claim 10,
wherein one or more of the self-complementary regions comprises
about 10-54 nucleotides.
14. The self-hybridizing polynucleotide molecule of claim 10,
wherein one or more of the self-complementary regions comprises a
3' overhang.
15. The self-hybridizing polynucleotide molecule of claim 10,
wherein one or more of the self-complementary regions forms a
stem-loop structure.
16. The self-hybridizing polynucleotide molecule of claim 10,
wherein one or more of the self-complementary regions comprises a
proximal box of dinucleotides AG/UU that is outside of the target
specific region
17. The self-hybridizing polynucleotide molecule of claim 10,
wherein one or more of the self-complementary regions comprises a
distal box of 4 nucleotides that is outside of the target-specific
region, wherein the third nucleotide of the distal box is not a
G.
18. The self-hybridizing polynucleotide molecule of claim 10,
wherein each of said first, second, and third target sequences are
present in the same gene, cDNA, mRNA, or microRNA.
19. The self-hybridizing polynucleotide molecule of claim 10,
wherein at least two of said first, second, and third target
sequences are present in different genes, cDNAs, mRNAs, or
microRNAs.
20. A vector that encodes a self-hybridizing polynucleotide
molecule according to claim 10.
21-25. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATION(S)
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/954,653, filed Nov. 30, 2015, issuing as
U.S. Pat. No. 9,957,505, which is a continuation of U.S. patent
application Ser. No. 13/375,460, filed Mar. 23, 2012, issued as
U.S. Pat. No. 9,200,276, which is a national phase of International
Application No. PCT/US10/36962, filed Jun. 1, 2010, which claims
the benefit under 35 U.S.C. .sctn. 119(e) of U.S. Provisional
Patent Application No. 61/183,011, filed Jun. 1, 2009, which is
incorporated by reference in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy, and is hereby
incorporated by reference into the specification. The name of the
text file containing the Sequence Listing is 8001
US03_SequenceListing.txt. The text file is 107 KB, was created Apr.
30, 2018, and is being submitted electronically via EFS-Web.
BACKGROUND
Technical Field
[0003] The present invention relates generally to precisely
structured polynucleotide molecules, and methods of using the same
for multivalent RNA interference and the treatment of disease.
Description of the Related Art
[0004] The phenomenon of gene silencing, or inhibiting the
expression of a gene, holds significant promise for therapeutic and
diagnostic purposes, as well as for the study of gene function
itself. Examples of this phenomenon include antisense technology
and dsRNA forms of posttranscriptional gene silencing (PTGS) which
has become popular in the form of RNA interference (RNAi).
[0005] Antisense strategies for gene silencing have attracted much
attention in recent years. The underlying concept is simple yet, in
principle, effective: antisense nucleic acids (NA) base pair with a
target RNA resulting in inactivation of the targeted RNA. Target
RNA recognition by antisense RNA or DNA can be considered a
hybridization reaction. Since the target is bound through sequence
complementarity, this implies that an appropriate choice of
antisense NA should ensure high specificity. Inactivation of the
targeted RNA can occur via different pathways, dependent on the
nature of the antisense NA (either modified or unmodified DNA or
RNA, or a hybrid thereof) and on the properties of the biological
system in which inhibition is to occur.
[0006] RNAi based gene suppression is a widely accepted method in
which a sense and an antisense RNA form double-stranded RNA
(dsRNA), e.g., as a long RNA duplex, a 19-24 nucleotide duplex, or
as a short-hairpin dsRNA duplex (shRNA), which is involved in gene
modulation by involving enzyme and/or protein complex machinery.
The long RNA duplex and the shRNA duplex are pre-cursors that are
processed into small interfering RNA (siRNA) by the
endoribonuclease described as Dicer. The processed siRNA or
directly introduced siRNA is believed to join the protein complex
RISC for guidance to a complementary gene, which is cleaved by the
RISC/siRNA complex.
[0007] However, many problems persist in the development of
effective antisense and RNAi technologies. For example, DNA
antisense oligonucleotides exhibit only short-term effectiveness
and are usually toxic at the doses required; similarly, the use of
antisense RNAs has also proved ineffective due to stability
problems. Also, the siRNA used in RNAi has proven to result in
significant off-target suppression due to either strand guiding
cleaving complexes potential involvement in endogenous regulatory
pathways. Various methods have been employed in attempts to improve
antisense stability by reducing nuclease sensitivity and chemical
modifications to siRNA have been utilized. These include modifying
the normal phosphodiester backbone, e.g., using phosphorothioates
or methyl phosphonates, incorporating 2'-OMe-nucleotides, using
peptide nucleic acids (PNAs and using 3'-terminal caps, such as
3'-aminopropyl modifications or 3'-3' terminal linkages. However,
these methods can be expensive and require additional steps. In
addition, the use of non-naturally occurring nucleotides and
modifications precludes the ability to express the antisense or
siRNA sequences in vivo, thereby requiring them to be synthesized
and administered afterwards. Additionally, the siRNA duplex
exhibits primary efficacy to a single gene and off-target to a
secondary gene. This unintended effect is negative and is not a
reliable RNAi multivalence.
[0008] Consequently, there remains a need for effective and
sustained methods and compositions for the targeted, direct
inhibition of gene function in vitro and in vivo, particularly in
cells of higher vertebrates, including a single-molecule complex
capable of multivalent gene inhibition.
BRIEF SUMMARY
[0009] The present invention provides novel compositions and
methods, which include precisely structured oligonucleotides that
are useful in specifically regulating gene expression of one or
more genes simultaneously when the nucleotide target site sequence
of each is not identical to the other.
[0010] In certain embodiments, the present invention includes an
isolated precisely structured three-stranded polynucleotide complex
comprising a region having a sequence complementary to a target
gene or sequence at multiple sites or complementary to multiple
genes at single sites.
[0011] In certain embodiments, the present invention includes an
isolated precisely structured the polynucleotide comprising a
region having a sequence complementary to a target gene or sequence
at multiple sites or complementary to multiple genes at single
sites; each having partially self-complementary regions. In
particular embodiments. the oligonucleotide comprises two or more
self-complementary regions. In certain embodiments, the
polynucleotides of the present invention comprise RNA, DNA, or
peptide nucleic acids.
[0012] Certain embodiments relate to polynucleotide complexes of at
least three separate polynucleotides, comprising (a) a first
polynucleotide comprising a target-specific region that is
complementary to a first target sequence, a 5' region, and a 3'
region; (b) a second polynucleotide comprising a target-specific
region that is complementary to a second target sequence, a region,
and a 3' region; and (c) a third polynucleotide comprising a null
region or a target-specific region that is complementary to a third
target specific, a 5' region, and a 3' region, wherein each of the
target-specific regions of the first, second, and third
polynucleotides are complementary to a different target sequence,
wherein the 5' region of the first polynucleotide is complementary
to the 3' region of the third polynucleotide, wherein the 3' region
of the first polynucleotide is complementary to the 5' region of
the second polynucleotide, and wherein the 3' region of the second
polynucleotide is complementary to the 5' region of the third
polynucleotide, and wherein the three separate polynucleotides
hybridize via their complementary 3' and 5' regions to form a
polynucleotide complex with a first, second, and third-single
stranded region, and a first, second, and third self-complementary
region.
[0013] In certain embodiments, the first, second, and/or third
polynucleotide comprises about 15-30 nucleotides. In certain
embodiments, the first, second, and/or third polynucleotide
comprises about 17-25 nucleotides. In certain embodiments, one or
more of the self-complementary regions comprises about 5-10
nucleotide pairs. In certain embodiments, one or more of the
self-complementary regions comprises about 7-8 nucleotide
pairs.
[0014] In certain embodiments, each of said first, second, and
third target sequences are present in the same gene, cDNA, mRNA, or
microRNA. In certain embodiments, at least two of said first,
second, and third target sequences are present in different genes,
cDNAs, mRNAs, or microRNAs.
[0015] In certain embodiments, all or a portion of the 5' and/or 3'
region of each polynucleotide is also complementary to the target
sequence for that polynucleotide. In certain embodiments, one or
more of the self-complementary regions comprises a 3' overhang.
[0016] Certain embodiments relate to self-hybridizing
polynucleotide molecules, comprising (a) a first nucleotide
sequence comprising a target-specific region that is complementary
to a first target sequence, a 5' region, and a 3' region, (b) a
second nucleotide sequence comprising a target-specific region that
is complementary to a second target sequence, a 5' region, and a 3'
region; and (c) a third nucleotide sequence comprising a null
region or a target-specific region that is complementary to a third
target sequence, a 5' region, and a 3' region, wherein the
target-specific regions of each of the first, second, and third
nucleotide sequences are complementary to a different target
sequence, wherein the 5' region of the first nucleotide sequence is
complementary to the 3' region of the third nucleotide sequence,
wherein the 3' region of the first nucleotide sequence is
complementary to the 5' region of the second nucleotide sequence,
and wherein the 3' region of the second nucleotide sequence is
complementary to the 5' region of the third nucleotide sequence,
and wherein each of the 5' regions hybridizes to their
complementary 3' regions to form a self-hybridizing polynucleotide
molecule with a first, second, and third single-stranded region,
and a first, second, and third self-complementary region.
[0017] In certain embodiments, the first, second, or third
polynucleotide sequences comprise about 15-60 nucleotides. In
certain embodiments, the target-specific region comprises about
15-30 nucleotides. In certain embodiments, one or more of the
self-complementary regions comprises about 10-54 nucleotides. In
certain embodiments, one or more of the self-complementary regions
comprises a 3' overhang. In certain embodiments, one or more of the
self-complementary regions forms a stem-loop structure. In certain
embodiments, one or more of the self-complementary regions
comprises a proximal box of dinucleotides AG/UU that is outside of
the target specific region. In certain embodiments, one or more of
the self-complementary regions comprises a distal box of 4
nucleotides that is outside of the target-specific region, wherein
the third nucleotide of the distal box is not a G. Also included
are vectors that encode a self-hybridizing polynucleotide molecule,
as described herein.
[0018] In certain embodiments, each of said first, second, and
third target sequences are present in the same gene, cDNA, mRNA, or
microRNA. In certain embodiments, at least two of said first,
second, and third target sequences are present in different genes,
cDNAs, mRNAs, or microRNAs.
[0019] In certain embodiments, a self-complementary region
comprises a stem-loop structure composed of a bi-loop, tetraloop or
larger loop. In certain embodiments, the sequence complementary to
a target gene sequence comprises at least 17 nucleotides, or 17 to
30 nucleotides, including all integers in between.
[0020] In certain embodiments, the self-complementary region (or
double-stranded region) comprises at least 5 nucleotides, at least
6 nucleotides, at least 24 nucleotides, or 12 to 54 or 60
nucleotides, including all integers in between.
[0021] In certain embodiments, a loop region of a stem-loop
structure comprises at least 1 nucleotide. In certain embodiments,
the loop region comprises at least 2, at least 3, at least 4, at
least 5, at least 6, at least 7, or at least 8 nucleotides.
[0022] In further embodiments, a loop region of a stem-loop
structure is comprised of a specific tetra-loop sequence NGNN or
AAGU or UUUU or UUGA or GUUA, where these sequences are 5' to
3'.
[0023] In a further embodiment, the present invention includes an
expression vector capable of expressing a polynucleotide of the
present invention. In various embodiments, the expression vector is
a constitutive or an inducible vector.
[0024] The present invention further includes a composition
comprising a physiologically acceptable carrier and a
polynucleotide of the present invention.
[0025] In other embodiments, the present invention provides a
method for reducing the expression of a gene, comprising
introducing a polynucleotide complex or molecule of the present
invention into a cell. In various embodiments, the cell is plant,
animal, protozoan, viral, bacterial, or fungal. In one embodiment,
the cell is mammalian.
[0026] In some embodiments, the polynucleotide complex or molecule
is introduced directly into the cell, while in other embodiments,
the polynucleotide complex or molecule is introduced
extracellularly by a means sufficient to deliver the isolated
polynucleotide into the cell.
[0027] In another embodiment, the present invention includes a
method for treating a disease, comprising introducing a
polynucleotide complex or molecule of the present invention into a
cell, wherein overexpression of the targeted gene is associated
with the disease. In one embodiment, the disease is a cancer.
[0028] The present invention further provides a method of treating
an infection in a patient, comprising introducing into the patient
a polynucleotide complex or molecule of the present invention,
wherein the isolated polynucleotide mediates entry, replication,
integration, transmission, or maintenance of an infective
agent.
[0029] In yet another related embodiment, the present invention
provides a method for identifying a function of a gene, comprising
introducing into a cell a polynucleotide complex or molecule of the
present invention, wherein the polynucleotide complex or molecule
inhibits expression of the gene, and determining the effect of the
introduction of the polynucleotide complex or molecule on a
characteristic of the cell, thereby determining the function of the
targeted gene. In one embodiment, the method is performed using
high throughput screening.
[0030] In a further embodiment, the present invention provides a
method of designing a polynucleotide sequence comprising two or
more self-complementary regions for the regulation of expression of
a target gene, comprising: (a) selecting the first three guide
sequences 17 to 25 nucleotides in length and complementary to a
target gene or multiple target genes; (b) selecting one or more
additional sequences 4 to 54 nucleotides in length, which comprises
self-complementary regions and which are not fully-complementary to
the first sequence; and optionally (c) defining the sequence motif
in (b) to be complementary, non-complementary, or replicate a gene
sequence which are non-complementary to the sequence selected in
step (a).
[0031] In another embodiment, the mutated gene is a gene expressed
from a gene encoding a mutant p53 polypeptide. In another
embodiment, the gene is viral, and may include one or more
different viral genes. In specific embodiments, the gene is an HIV
gene, such as gag, pol, env, or tat, among others described herein
and known in the art. In other embodiments, the gene is ApoB.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIGS. 1 through 6 illustrate exemplary polynucleotide
structures of the present invention.
[0033] FIG. 1 shows a polynucleotide complex of three separate
polynucleotide molecules. (A) indicates the region comprising
sequence complementary to a site on a target gene (hatched); (B)
indicates the region comprising sequence complementary to a second
site on the target gene or a site on a different gene
(cross-hatched); (C) indicates the region comprising sequence
complementary to a third site on the target gene or a site on a
different gene (filled in black). The numbers 1, 2, and 3 indicate
the 3' end of each oligonucleotide that guides gene silencing; (A)
loads in the direction of 1, (B) in the direction 2, and (C) in the
direction 3. The 3' and 5' regions of each molecule, which
hybridize to each other to form their respective self-complementary
or double-stranded regions, are indicated by connecting bars. Each
polynucleotide comprises a two nucleotide 3' overhang.
[0034] FIG. 2 shows a single, self-hybridizing polynucleotide of
the invention, having three single-stranded regions and three
self-complementary regions, which is a precursor for processing
into a core molecule. The target specific regions are darkened. (D)
indicates a self-complementary stem-loop region (filled in white)
capped with a tetraloop of four nucleotides; (D) also indicates a
stem-loop region having a 14/16 nucleotide cleavage site within the
stem-loop structure; cleavage may occur by RNase III to remove the
stem loop nucleotides shown in white); (E) indicates a distal box
wherein the third nucleotide as determined 5' to 3' is not a G,
since it is believed that the presence of a G would block RNase III
cleavage required for removal of the stem-loop region; (F)
indicates a proximal box of dinucleotides AG/UU, which is an in
vivo determinant of RNase III recognition and binding of RNase III
(Nichols 2000); (G) indicates a tetraloop. The polynucleotide
molecule shown in FIG. 2 is a longer transcript RNA that is
`pre-processed` in the cell by RNase III. The resulting RNA
structure is identical to the structure depicted in FIG. 1.
[0035] FIG. 3 depicts a self-forming single-stranded
oligonucleotide with tetraloop formats. (H) indicates a tetraloop;
(I) indicates a tri-loop connecting two core strands when the
leading strand incorporates a 2 nucleotide overhang. In this
structure, tetraloops are used to mimic what would be a 3'
hydroxyl/5' phosphate of the overhangs in the structure shown in
FIG. 1 and function more directly than those of the structure shown
in FIG. 2. As demonstrated in Example 2, this short tetraloop
format guides silencing directly without pre-processing. It is
believed that the GUUA loop twists the nucleotides in the loop and
expose the hydrogens (see, e.g., Nucleic Acids Research, 2003, Vol.
31 No. 3, FIG. 6, page 1094). This structure is compatible with PAZ
or RISC.
[0036] FIG. 4 depicts a self-forming single stranded
oligonucleotide for divalent use. (J) indicates a larger loop
connecting two core strands; (K) indicates the key strand as
completing the complex formation but "null" to a target gene, i.e.,
not-specific for a target gene. The two target specific regions are
shaded. This structure is a composition for `divalent` use when
working with RNA transcripts. Since chemical modifications are not
possible, the structure determines asymmetrically of loading and
silencing activity. The first 19 nucleotides of the molecule is the
PRIMARY strand, (K) indicates a KEY strand that is deactivated, and
the SECONDARY strand is the last 21 nucleotides of the molecule.
The first priority of loading into RISC and functioning is the
SECONDARY strand by exposed 5'/3' ends. The next priority is the
PRIMARY strand, which is exposed after RNase III pre-processing in
the cell. The 3' end of the nullified KEY strand is not functional,
since the large loop is not processed nor is compatible with
loading into RISC itself.
[0037] FIG. 5 depicts a polynucleotide complex of the present
invention having modified RNA bases. (L), (M), and (N) illustrate
regions (defined by hashed lines) in which the Tm can be
incrementally increased by the use of modified RNA (e.g.,
2'-O-methyl RNA or 2'-fluoro RNA instead of 2'-OH RNA) to
preference the annealing and/or the silencing order of ends 1, 2 or
3.
[0038] FIG. 6 depicts two embodiments of oligonucleotide complexes
of the present invention. (O) illustrates a blunt-ended DNA strand
that deactivates the silencing function of this strand; and (P)
illustrates an end that can be utilized for conjugation of a
delivery chemistry, ligand, antibody, or other payload or targeting
molecule.
[0039] FIGS. 7A and 7B show the results of suppression of GFP
expression by multivalent-siRNA molecules of the invention, as
compared to standard shRNA molecules (see Example 1). FIG. 7A shows
increased suppression of GFP by MV clone long I (108%) and MV clone
long II (119%), relative to shRNA control (set at 100%). FIG. 7B
shows increased suppression of GFP expression by synthetic MV-siRNA
GFP I (127%), relative to shRNA control (set at 100%), which is
slightly reduced when one of the strands of the synthetic MV-siRNA
complex is replaced by a DNA strand (MF-siRNA GFP I DNA
(116%)).
[0040] FIGS. 8A, 8B and 8C show exemplary targeting regions
(underlined) for the GFP coding sequence (SEQ ID NO:8). FIG. 8A
shows the regions that were targeted by the MV-siRNA molecules of
Tables 1 and 2 in Example 1. FIGS. 8B and 8C show additional
exemplary targeting regions.
[0041] FIG. 9 shows the inhibitory effects of MV-siRNA molecules on
HIV replication, in which a di-valent MV-siRNA targeted to both gag
and tat has a significantly greater inhibitory effect on HIV
replication than an siRNA targeted to gag only. The di-valent
MV-siRNA exhibited 56.89% inhibition at 10 days and 60.02%
inhibition at 40 days, as compared to the siRNA targeted to gag
alone, which exhibited 19.77% inhibition at 10 days and 32.43%
inhibition at 40 days.
[0042] FIGS. 10A, 10B, 10C and 10D show the nucleotide sequence of
an exemplary HIV genome (SEQ ID NO:9), which can be targeted
according to the MV-siRNA molecules of the present invention. This
sequence extends from FIG. 10A through FIG. 10D.
[0043] FIG. 11 shows the nucleotide sequence of the env gene (SEQ
ID NO:4), derived from the HIV genomic sequence of FIG. 10.
[0044] FIGS. 12A and 12B provide additional HIV sequences. FIG. 12A
shows the nucleotide sequence of the gag gene (SEQ ID NO:2), and
FIG. 12B shows the nucleotide sequence of the tat gene (SEQ ID
NO:3), both of which are derived from the HIV genomic sequence of
FIG. 10.
[0045] FIGS. 13A, 13B, 13C, 13D and 13E show the coding sequence of
murine apolipoprotein B (ApoB) (SEQ ID NO:10), which can be
targeted using certain MV-siRNAs provided herein. This sequence
extends from FIG. 13A through FIG. 13E.
[0046] FIGS. 14A, 14B, 14C, 14D and 14E show the mRNA sequence of
human apolipoprotein B (apoB) (SEQ ID NO:1), which can be targeted
using certain MV-siRNAs provided herein. This sequence extends from
FIG. 14A through FIG. 14E.
DETAILED DESCRIPTION
[0047] The present invention provides novel compositions and
methods for inhibiting the expression of a gene at multiple target
sites, or for inhibiting the expression of multiple genes at one or
more target sites, which sites are not of equivalent nucleotide
sequences, in eukaryotes in vivo and in vitro. In particular, the
present invention provides polynucleotide complexes and
polynucleotide molecules comprising two, three, or more regions
having sequences complementary to regions of one or more target
genes, which are capable of targeting and reducing expression of
the target genes. In various embodiments, the compositions and
methods of the present invention may be used to inhibit the
expression of a single target gene by targeting multiple sites
within the target gene or its expressed RNA. Alternatively, they
may be used to target two or more different genes by targeting
sites within two or more different genes or their expressed
RNAs.
[0048] The present invention offers significant advantages over
traditional siRNA molecules. First, when polynucleotide complexes
or molecules of the present invention target two or more regions
within a single target, gene, they are capable of achieving greater
inhibition of gene expression from the target gene, as compared to
an RNAi agent that targets only one region within a target gene. In
addition, polynucleotide complexes or molecules of the present
invention that target two or more different target genes may be
used to inhibit the expression of multiple target genes associated
with a disease or disorder using a single polynucleotide complex or
molecule. Furthermore, polynucleotide complexes and molecules of
the present invention do not require the additional non-targeting
strand present in conventional double-stranded RNAi agents, so they
do not have off-target effects caused by the non-targeting strand.
Accordingly, the polynucleotide complexes and molecules of the
present invention offer surprising advantages over polynucleotide
inhibitors of the prior art, including antisense RNA and RNA
interference molecules, including increased potency and increased
effectiveness against one or more target genes.
[0049] The present invention is also based upon the recognition of
the polynucleotide structure guiding a protein complex for cleavage
using only one, two, or three of the guide strands, which are
complementary to one, two, or three distinct nucleic sequences of
the target genes. This multivalent function results in a markedly
broader and potent inhibition of a target gene or group of target
genes than that of dsRNA, while utilizing many of the same
endogenous mechanisms.
[0050] Certain embodiments of the present invention are also based
upon the recognition of the polynucleotide structure directionally
by presentation of the 3' overhangs and 5' phosphate resulting in a
sense strand free complex, which contributes to greater specificity
than that of dsRNA-based siRNA.
[0051] Given their effectiveness, the compositions of the present
invention may be delivered to a cell or subject with an
accompanying guarantee of specificity predicted by the single guide
strand complementary to the target gene or multiple target
genes.
Multivalent siRNAs
[0052] The present invention includes polynucleotide complexes and
molecules that comprise two or more targeting regions complementary
to regions of one or more target genes. The polynucleotide
complexes and molecules of the present invention may be referred to
as multivalent siRNAs (mv-siRNAs), since they comprise at least two
targeting regions complementary to regions of one or more target
genes. Accordingly, the compositions and methods of the present
invention may be used to inhibit or reduce expression of one or
more target genes, either by targeting two or more regions within a
single target gene, or by targeting one or more regions within two
or more target genes.
[0053] In certain embodiments, polynucleotide complexes of the
present invention comprise three or more separate oligonucleotides,
each having a 5' and 3' end, with two or more of the
oligonucleotides comprising a targeting region, which
oligonucleotides hybridize to each other as described herein to
form a complex. Each of the strands is referred to herein as a
"guide strand." In other embodiments, polynucleotide molecules of
the present invention are a single polynucleotide that comprises
three or more guide strands, with two or more of the guide strands
comprising a targeting region, which polynucleotide hybridizes to
itself through self-complementary regions to form a structure
described herein. The resulting structure may then be processed,
e.g., intracellularly, to remove loop structures connecting the
various guide strands. Each guide strand, which may be present in
different oligonucleotides or within a single polynucleotide,
comprises regions complementary to other guide strands.
[0054] In certain embodiments, the present invention provides
polynucleotide complexes and molecules that comprise at least three
guide strands, at least two of which comprise regions that are
complementary to different sequences within one or more target
genes. In various embodiments, the polynucleotide complexes of the
present invention comprise two, three or more separate
polynucleotides each comprising one or more guide strands, which
can hybridize to each other to form a complex. In other
embodiments, the polynucleotide molecules of the present invention
comprise a single polynucleotide that comprises three or more guide
strands within different regions of the single polynucleotide.
[0055] Certain embodiments of the present invention are directed to
polynucleotide complexes or molecules having at least three guide
strands, two or more of which are partially or fully complementary
to one or more target genes; and each having about 4 to about 12,
about 5 to about 10, or preferably about 7 to about 8, nucleotides
on either end that are complementary to each other (i.e.,
complementary to a region of another guide strand), allowing the
formation of a polynucleotide complex (see, e.g., FIG. 1). For
example, each end of a guide strand may comprise nucleotides that
are complementary to nucleotides at one end of another of the guide
strands of the polynucleotide complex or molecule. Certain
embodiments may include polynucleotide complexes that comprise 4,
5, 6 or more individual polynucleotide molecules or guide
strands.
[0056] In certain embodiments, a polynucleotide complex of the
present invention comprises at least three separate
polynucleotides, which include: (1) a first polynucleotide
comprising a target-specific region that is complementary to a
first target sequence, a 5' region, and a 3' region; (2) a second
polynucleotide comprising a target-specific region that is
complementary to a second target sequence, a 5' region, and a 3'
region; and (3) a third polynucleotide comprising either a null
region or a target-specific region that is complementary to a third
target specific, a 5' region, and a 3' region, wherein each of the
target-specific regions of the first, second, and third
polynucleotides are complementary to a different target sequence,
wherein the 5' region of the first polynucleotide is complementary
to the 3' region of the third polynucleotide, wherein the 3' region
of the first polynucleotide is complementary to the 5' region of
the second polynucleotide, and wherein the 3' region of the second
polynucleotide is complementary to the 5' region of the third
polynucleotide, and wherein the three separate polynucleotides
hybridize via their complementary 3' and 5' regions to form a
polynucleotide complex with a first, second, and third
single-stranded region, and a first, second, and third
self-complementary region.
[0057] As described above, in particular embodiments, a
polynucleotide complex of the present invention comprises at least
three separate oligonucleotides, each having a 5' end and a 3' end.
As depicted in FIG. 1, a region at the 5' end of the first
oligonucleotide anneals to a region at the 3' end of the third
oligonucleotide; a region at the 5' end of the third
oligonucleotide anneals to a region at the 3' end of the second
oligonucleotide; and a region at the 5' end of the second
oligonucleotide anneals to a region at the 3' end of the first
oligonucleotide. If additional oligonucleotides are present in the
complex, then they anneal to other oligonucleotides of the complex
in a similar manner. The regions at the ends of the
oligonucleotides that anneal to each other may include the ultimate
nucleotides at either or both the 5' and/or 3' ends. Where the
regions of both the hybridizing 3' and 5' ends include the ultimate
nucleotides of the oligonucleotides, the resulting double-stranded
region is blunt-ended. In particular embodiments, the region at the
3' end that anneals does not include the ultimate and/or
penultimate nucleotides, resulting in a double-stranded region
having a one or two nucleotide 3' overhang.
[0058] In certain embodiments, the guide strands are present in a
single polynucleotide molecule, and hybridize to form a single,
self-hybridizing polynucleotide with three single-stranded regions
and three self-complementary regions (or double-stranded regions),
and at least two target-specific regions (see, e.g., FIG. 2). In
related embodiments, a single molecule may comprise at least 3, at
least 4, at least 5 or at least 6 guide strands, and forms a
single, self-hybridizing polynucleotide with at least 3, at least
4, at least 5, or at least 6 self-complementary regions (or
double-stranded regions), and at least 2, at least 3, at least 4,
or at least 5 target-specific regions, respectively. In particular
embodiments, this single, self-hybridizing polynucleotide is a
precursor molecule that may be processed by the cell to remove the
loop regions and, optionally, an amount of proximal double-stranded
region, resulting in an active mv-siRNA molecule (see, e.g., FIG.
2).
[0059] Thus, in particular embodiments, the present invention
includes a self-hybridizing polynucleotide molecule, comprising:
(1) a first nucleotide sequence comprising a target-specific region
that is complementary to a first target sequence, a 5' region, and
a 3' region, (2) a second nucleotide sequence comprising a
target-specific region that is complementary to a second target
sequence, a 5' region, and a 3' region; and (3) a third nucleotide
sequence comprising a null region of a target-specific region that
is complementary to a third target sequence, a 5' region, and a 3'
region, wherein the target-specific regions of each of the first,
second, and third nucleotide sequences are complementary to a
different target sequence, wherein the 5' region of the first
nucleotide sequence is complementary to the 3' region of the third
nucleotide sequence, wherein the 3' region of the first nucleotide
sequence is complementary to the 5' region of the second nucleotide
sequence, and wherein the 3' region of the second nucleotide
sequence is complementary to the 5' region of the third nucleotide
sequence, and wherein each of the 5' regions hybridizes to their
complementary 3' regions to form a self-hybridizing polynucleotide
molecule with a first, second, and third single-stranded region,
and a first, second, and third self-complementary region.
[0060] In particular embodiments, a single, self-hybridizing
polynucleotide of the present invention may comprise one or more
cleavable nucleotides in the single-stranded loops that form when
the polynucleotide is annealed to itself. Once the single,
self-hybridizing polynucleotide is annealed to itself, the
cleavable nucleotides may be cleaved to result in a polynucleotide
complex comprising three or more separate oligonucleotides.
Examples of cleavable nucleotides that may be used according to the
present invention include, but are not limited to, photocleavable
nucleotides, such as pcSpacer (Glen Research Products, Sterling,
Va., USA), or phosphoramadite nucleotides.
[0061] As used herein, polynucleotides complexes and molecules of
the present invention include isolated polynucleotides comprising
three single-stranded regions, at least two of which are
complementary to two or more target sequences, each target sequence
located within one or more target genes, and comprising at least
two or three self-complementary regions interconnecting the 5' or
3' ends of the single-stranded regions, by forming a
double-stranded region, such as a stem-loop structure. The
polynucleotides may also be referred to herein as the
oligonucleotides.
[0062] In certain embodiments, the polynucleotide complexes and
molecules of the present invention comprise two or more regions of
sequence complementary to a target gene. In particular embodiments,
these regions are complementary to the same target genes or genes,
while in other embodiments, they are complementary to two or more
different target genes or genes.
[0063] Accordingly, the present invention includes one or more
self-complementary polynucleotides that comprise a series of
sequences complementary to one or more target genes or genes. In
particular embodiments, these sequences are separated by regions of
sequence that are non-complementary or semi-complementary to a
target gene sequence and non-complementary to a self-complementary
region. In other embodiments of the polynucleotide comprising
multiple sequences that are complementary to target genes or genes,
the polynucleotide comprises a self-complementary region at the 5'
end, 3 end', or both ends of one or more regions of sequence
complementary to a target gene. In a particular embodiment, a
polynucleotide comprises two or more regions of sequence
complementary to one or more target genes, with self-complementary
regions located at the 5' and 3' end of each guide strand that is
complementary to a target gene. In certain embodiments, all or a
portion of these 3' and 5' regions may be complementary to the
target sequence, in addition to being complementary to their
corresponding 3' or 5' regions.
[0064] The term "complementary" refers to nucleotide sequences that
are fully or partially complementary to each other, according to
standard base pairing rules. The term "partially complementary"
refers to sequences that have less than full complementarity, but
still have a sufficient number of complementary nucleotide pairs to
support binding or hybridization within the stretch of nucleotides
under physiological conditions.
[0065] In particular embodiments, the region of a guide strand
complementary to a target gene (i.e., the targeting region) may
comprise one or more nucleotide mismatches as compared to the
target gene. Optionally, the mismatched nucleotide(s) in the guide
strand may be substituted with an unlocked (UNA) nucleic acid or a
phosphoramidite nucleic acid (e.g., rSpacer, Glen Research,
Sterling, Va., USA), to allow base-pairing, e.g., Watson-Crick base
pairing, of the mismatched nucleotide(s) to the target gene.
[0066] As used herein, the term "self-complementary" or
"self-complementary region" may refer to a region of a
polynucleotide molecule of the invention that binds or hybridizes
to another region of the same molecule to form A-T(U) and G-C
hybridization pairs, thereby forming a double stranded region;
and/or it may refer to a region of a first nucleotide molecule that
binds to a region of a second or third nucleotide molecule to form
a polynucleotide complex of the invention (i.e., an RNAi
polynucleotide complex), wherein the complex is capable of RNAi
interference activity against two or more target sites. The two
regions that bind to each other to form the self-complementary
region may be contiguous or may be separated by other nucleotides.
Also, as in an RNAi polynucleotide complex, the two regions may be
on separate nucleotide molecules.
[0067] In certain embodiments, a "self-complementary region"
comprises a "3' region" of a first defined nucleotide sequence that
is bound or hybridized to a "5' region" of a second or third
defined nucleotide sequence, wherein the second or third defined
sequence is within the same molecule--to form a self-hybridizing
polynucleotide molecule. In certain embodiments, a
"self-complementary region" comprises a "3' region" of a first
polynucleotide molecule that is bound or hybridized to a "5'
region" of a separate polynucleotide molecule, to form a
polynucleotide complex. These 3' and 5' regions are typically
defined in relation to their respective target-specific region, in
that the 5' regions are on the 5' end of the target-specific region
and the 3' regions are on the 3' end of the target specific region.
In certain embodiments, one or both of these 3' and 5' regions not
only hybridize to their corresponding 3' or 5' regions to form a
self-complementary region, but may be designed to also contain full
or partial complementarily their respective target sequence,
thereby forming part of the target-specific region. In these
embodiments, the target-specific region contains both a
single-stranded region and self-complementary (i.e.,
double-stranded) region.
[0068] In certain embodiments, these "self-complementary regions"
comprise about 5-12 nucleotide pairs, preferably 5-10 or 7-8
nucleotide pairs, including all integers in between. Likewise, in
certain embodiments, each 3' region or 5' region comprises about
5-12 nucleotides, preferably 5-10 or 7-8 nucleotides, including all
integers in between.
[0069] The term "non-complementary" indicates that in a particular
stretch of nucleotides, there are no nucleotides within that align
with a target to form A-T(U) or G-C hybridizations. The term
"semi-complementary" indicates that in a stretch of nucleotides,
there is at least one nucleotide pair that aligns with a target to
form an A-T(U) or G-C hybridizations, but there are not a
sufficient number of complementary nucleotide pairs to support
binding within the stretch of nucleotides under physiological
conditions.
[0070] The term "isolated" refers to a material that is at least
partially free from components that normally accompany the material
in the material's native state. Isolation connotes a degree of
separation from an original source or surroundings. Isolated, as
used herein, e.g., related to DNA, refers to a polynucleotide that
is substantially away from other coding or non-coding sequences,
and that the DNA molecule can contain large portions of unrelated
coding DNA, such as large chromosomal fragments or other functional
genes or polypeptide coding regions. Of course, this refers to the
DNA molecule as originally isolated, and does not exclude genes or
coding regions later added to the segment by the hand of man.
[0071] In various embodiments, a polynucleotide complex or molecule
of the present invention comprises RNA, DNA, or peptide nucleic
acids, or a combination of any or all of these types of molecules.
In addition, a polynucleotide may comprise modified nucleic acids,
or derivatives or analogs of nucleic acids. General examples of
nucleic acid modifications include, but are not limited to, biotin
labeling, fluorescent labeling, amino modifiers introducing a
primary amine into the polynucleotide, phosphate groups,
deoxyuridine, halogenated nucleosides, phosphorothioates,
2'-O-Methyl RNA analogs, chimeric RNA analogs, wobble groups,
universal bases, and deoxyinosine.
[0072] A "subunit" of a polynucleotide or oligonucleotide refers to
one nucleotide (or nucleotide analog) unit. The term may refer to
the nucleotide unit with or without the attached intersubunit
linkage, although, when referring to a "charged subunit", the
charge typically resides within the intersubunit linkage (e.g., a
phosphate or phosphorothioate linkage or a cationic linkage). A
given synthetic MV-siRNA may utilize one or more different types of
subunits and/or intersubunit linkages, mainly to alter its
stability, Tm, RNase sensitivity, or other characteristics, as
desired. For instance, certain embodiments may employ RNA subunits
with one or more 2'-O-methyl RNA subunits.
[0073] The cyclic subunits of a polynucleotide or an
oligonucleotide may be based on ribose or another pentose sugar or,
in certain embodiments, alternate or modified groups. Examples of
modified oligonucleotide backbones include, without limitation,
phosphorothioates, chiral phosphorothioates, phosphorodithioates,
phosphotriesters, aminoalkylphosphotriesters, methyl and other
alkyl phosphonates including 3'-alkylene phosphonates and chiral
phosphonates, phosphinates, phosphoramidates including 3'-amino
phosphoramidate and aminoalkylphosphoramidates,
phosphorodiamidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters, and
boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs
of these, and those having inverted polarity wherein the adjacent
pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to
5'-2'. Also contemplated are peptide nucleic acids (PNAs), locked
nucleic acids (LNAs), 2'-O-methyl oligonucleotides (2'-OMe),
2'-methoxyethoxy oligonucleotides (MOE), among other
oligonucleotides known in the art.
[0074] The purine or pyrimidine base pairing moiety is typically
adenine, cytosine, guanine, uracil, thymine or inosine. Also
included are bases such as pyridin-4-one, pyridin-2-one, phenyl,
pseudouracil, 2,4,6-trime115thoxy benzene, 3-methyl uracil,
dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g.,
5-methylcytidine), 5-alkyluridines (e.g., ribothymidine),
5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or
6-alkylpyrimidines (e.g. 6-methyluridine), propyne, quesosine,
2-thiouridine, 4-thiouridine, wybutosine, wybutoxosine,
4-acetyltidine, 5-(carboxyhydroxymethyl)uridine,
5'-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluridine, .beta.-D-galactosylqueosine,
1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine,
3-methylcytidine, 2-methyladenosine, 2-methylguanosine,
N6-methyladenosine, 7-methylguanosine,
5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine,
5-methylcarbonyhnethyluridine, 5-methyloxyuridine,
5-methyl-2-thiouridine, 2-methylthio-N6-isopentenyladenosine,
.beta.-D-mannosylqueosine, uridine-5-oxyacetic acid,
2-thiocytidine, threonine derivatives and others (Burgin et al.,
1996, Biochemistry, 35, 14090; Uhlman & Peyman, supra). By
"modified bases" in this aspect is meant nucleotide bases other
than adenine (A), guanine (G), cytosine (C), thymine (T), and
uracil (U), as illustrated above; such bases can be used at any
position in the antisense molecule. Persons skilled in the art will
appreciate that depending on the uses or chemistries of the
oligomers, Ts and Us are interchangeable. For instance, with other
antisense chemistries such as 2'-O-methyl antisense
oligonucleotides that are more RNA-like, the T bases may be shown
as U.
[0075] As noted above, certain polynucleotides or oligonucleotides
provided herein include one or more peptide nucleic acid (PNAs)
subunits. Peptide nucleic acids (PNAs) are analogs of DNA in which
the backbone is structurally homomorphous with a deoxyribose
backbone, consisting of N-(2-aminoethyl) glycine units to which
pyrimidine or purine bases are attached. PNAs containing natural
pyrimidine and purine bases hybridize to complementary
oligonucleotides obeying Watson-Crick base-pairing rules, and mimic
DNA in terms of base pair recognition (Egholm, Buchardt et al.
1993). The backbone of PNAs is formed by peptide bonds rather than
phosphodiester bonds, making them well-suited for antisense
applications (see structure below). A backbone made entirely of
PNAs is uncharged, resulting in PNA/DNA or PNA/RNA duplexes that
exhibit greater than normal thermal stability. PNAs are not
recognized by nucleases or proteases.
[0076] PNAs may be produced synthetically using any technique known
in the art. PNA is a DNA analog in which a polyamide backbone
replaces the traditional phosphate ribose ring of DNA. Despite a
radical structural change to the natural structure, PNA is capable
of sequence-specific binding in a helix form to DNA or RNA.
Characteristics of PNA include a high binding affinity to
complementary DNA or RNA, a destabilizing effect caused by
single-base mismatch, resistance to nucleases and proteases,
hybridization with DNA or RNA independent of salt concentration and
triplex formation with homopurine DNA. Panagene.TM. has developed
its proprietary Bts PNA monomers (Bts; benzothiazole-2-sulfonyl
group) and proprietary oligomerisation process. The PNA
oligomerisation using Bts PNA monomers is composed of repetitive
cycles of deprotection, coupling and capping. Panagene's patents to
this technology include U.S. Pat. No. 6,969,766, U.S. Pat. No.
7,211,668, U.S. Pat. No. 7,022,851, U.S. Pat. No. 7,125,994, U.S.
Pat. No. 7,145,006 and U.S. Pat. No. 7,179,896. Representative
United States patents that teach the preparation of PNA compounds
include, but are not limited to, U.S. Pat. Nos. 5,539,082;
5,714,331; and 5,719,262, each of which is herein incorporated by
reference. Further teaching of PNA compounds can be found in
Nielsen et al. Science, 1991, 254, 1497.
[0077] Also included are "locked nucleic acid" subunits (LNAs). The
structures of LNAs are known in the art: for example, Wengel, et
al., Chemical Communications (1998) 455; Tetrahedron (1998) 54,
3607, and Accounts of Chem. Research (1999) 32, 301); Obika, et
al., Tetrahedron Letters (1997) 38, 8735; (1998) 39, 5401, and
Bioorganic Medicinal Chemistry (2008)16, 9230.
[0078] Polynucleotides and oligonucleotides may incorporate one or
more LNAs; in some cases, the compounds may be entirely composed of
LNAs. Methods for the synthesis of individual LNA nucleoside
subunits and their incorporation into oligonucleotides are known in
the art: U.S. Pat. Nos. 7,572,582; 7,569,575; 7,084,125; 7,060,809;
7,053,207; 7,034,133; 6,794,499; and 6,670,461. Typical
intersubunit linkers include phosphodiester and phosphorothioate
moieties; alternatively, non-phosphorous containing linkers may be
employed. One embodiment includes an LNA containing compound where
each LNA subunit is separated by a RNA or a DNA subunit (i.e., a
deoxyribose nucleotide). Further exemplary compounds may be
composed of alternating LNA and RNA or DNA subunits where the
intersubunit linker is phosphorothioate.
[0079] Certain polynucleotides or oligonucleotides may comprise
morpholino-based subunits bearing base-pairing moieties, joined by
uncharged or substantially uncharged linkages. The terms
"morpholino oligomer" or "PMO" (phosphoramidate- or
phosphorodiamidate morpholino oligomer) refer to an oligonucleotide
analog composed of morpholino subunit structures, where (i) the
structures are linked together by phosphorus-containing linkages,
one to three atoms long, preferably two atoms long, and preferably
uncharged or cationic, joining the morpholino nitrogen of one
subunit to a 5' exocyclic carbon of an adjacent subunit, and (ii)
each morpholino ring bears a purine or pyrimidine or an equivalent
base-pairing moiety effective to bind, by base specific hydrogen
bonding, to a base in a polynucleotide.
[0080] Variations can be made to this linkage as long as they do
not interfere with binding or activity. For example, the oxygen
attached to phosphorus may be substituted with sulfur
(thiophosphorodiamidate). The 5' oxygen may be substituted with
amino or lower alkyl substituted amino. The pendant nitrogen
attached to phosphorus may be unsubstituted, monosubstituted, or
disubstituted with (optionally substituted) lower alkyl. The purine
or pyrimidine base pairing moiety is typically adenine, cytosine,
guanine, uracil, thymine or inosine. The synthesis, structures, and
binding characteristics of morpholino oligomers are detailed in
U.S. Pat. Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506,
5,166,315, 5,521,063, and 5,506,337, and PCT Appn. Nos.
PCT/US07/11435 (cationic linkages) and U.S. Ser. No. 08/012,804
(improved synthesis), all of which are incorporated herein by
reference.
[0081] In one aspect of the invention, MV-siRNA comprise at least
one ligand tethered to an altered or non-natural nucleobase.
Included are payload molecules and targeting molecules. A large
number of compounds can function as the altered base. The structure
of the altered base is important to the extent that the altered
base should not substantially prevent binding of the
oligonucleotide to its target, e.g., mRNA. In certain embodiments,
the altered base is difluorotolyl, nitropyrrolyl, nitroimidazolyl,
nitroindolyl, napthalenyl, anthrancenyl, pyridinyl, quinolinyl,
pyrenyl, or the divalent radical of any one of the non-natural
nucleobases described herein. In certain embodiments, the
non-natural nucleobase is difluorotolyl, nitropyrrolyl, or
nitroimidazolyl. In certain embodiments, the non-natural nucleobase
is difluorotolyl.
[0082] A wide variety ligands are known in the art and are amenable
to the present invention. For example, the ligand can be a steroid,
bile acid, lipid, folic acid, pyridoxal, B12, riboflavin, biotin,
aromatic compound, polycyclic compound, crown ether, intercalator,
cleaver molecule, protein-binding agent, or carbohydrate. In
certain embodiments, the ligand is a steroid or aromatic compound.
In certain instances, the ligand is cholesteryl.
[0083] In other embodiments, the polynucleotide or oligonucleotide
is tethered to a ligand for the purposes of improving cellular
targeting and uptake. For example, an MV-siRNA agent may be
tethered to an antibody, or antigen binding fragment thereof. As an
additional example, an MV-siRNA agent may be tethered to a specific
ligand binding molecule, such as a polypeptide or polypeptide
fragment that specifically binds a particular cell-surface
receptor, or that more generally enhances cellular uptake, such as
an arginine-rich peptide.
[0084] The term "analog" as used herein refers to a molecule,
compound or composition that retains the same structure and/or
function (e.g., binding to a target) as a polynucleotide herein.
Examples of analogs include peptidomimetic and small and large
organic or inorganic compounds.
[0085] The term "derivative" or "variant" as used herein refers to
a polynucleotide that differs from a naturally occurring
polynucleotide (e.g., target gene sequence) by one or more nucleic
acid deletions, additions, substitutions or side-chain
modifications. In certain embodiments, variants have at least 70%,
at least 80% at least 90%, at least 95%, or at least 99% sequence
identity to a region of a target gene sequence. Thus, for example,
in certain embodiments, an oligonucleotide of the present invention
comprises a region that is complementary to a variant of a target
gene sequence.
[0086] Polynucleotide complexes and molecules of the present
invention comprise a sequence region, or two or more sequence
regions, each of which is complementary, and in particular
embodiments completely complementary, to a region of a target gene
or polynucleotide sequences (or a variant thereof). In particular
embodiments, a target gene is a mammalian gene, e.g., a human gene,
or a gene of a microorganism infecting a mammal, such as a virus.
In certain embodiments, a target gene is a therapeutic target. For
example, a target gene may be a gene whose expression or
overexpression is associated with a human disease or disorder. This
may be a mutant gene or a wild type or normal gene. A variety of
therapeutic target genes have been identified, and any of these may
be targeted by polynucleotide complexes and molecules of the
present invention. Therapeutic target genes include, but are not
limited to, oncogenes, growth factor genes, translocations
associated with disease such as leukemias, inflammatory protein
genes, transcription factor genes, growth factor receptor genes,
anti-apoptotic genes, interleukins, sodium channel genes, potassium
channel genes, such as, but not limited to the following genes or
genes encoding the following proteins: apolipoprotein B (ApoB),
apolipoprotein B-100 (ApoB-100), bcl family members, including
bcl-2 and bcl-x, MLL-AF4, Huntington gene, AML-MT68 fusion gene,
IKK-B, Aha1, PCSK9, Eg5, transforming growth factor beta (TGFbeta),
Nav1.8, RhoA, HIF-1alpha, Nogo-L, Nogo-R, toll-like receptor 9
(TLR9), vascular endothelial growth factor (VEGF), SNCA,
beta-catenin, CCR5, c-myc, p53, interleukin-1, interleukin 2,
interleukin-12, interleukin-6, interleukin-17a (IL-17a),
interleukin-17f (IL-17f), Osteopontin (OPN) gene, psoriasis gene,
and tumor necrosis factor gene.
[0087] In particular embodiments, polynucleotide complexes or
molecules of the present invention comprise guide strands or
target-specific regions targeting two or more genes, e.g., two or
more genes associated with a particular disease or disorder. For
example, they may include guide strands complementary to
interleukin-1 gene or mRNA and tumor necrosis factor gene or mRNA;
complementary to interleukin-1 gene or mRNA and interleukin-12 gene
or mRNA; or complementary to interleukin-1 gene or mRNA,
interleukin-12 gene or mRNA and tumor necrosis factor gene or mRNA,
for treatment of rheumatoid arthritis. In one embodiment, they
include guide strands complementary to osteopontin gene or mRNA and
TNF gene or mRNA.
[0088] Other examples of therapeutic target genes include genes and
mRNAs encoding viral proteins, such as human immunodeficiency virus
(HIV) proteins, HTLV virus proteins, hepatitis C virus (HCV)
proteins, Ebola virus proteins, JC virus proteins, herpes virus
proteins, human polyoma virus proteins, influenza virus proteins,
and Rous sarcoma virus proteins. In particular embodiments,
polynucleotide complexes or molecules of the present invention
include guide strands complementary to two or more genes or mRNAs
expressed by a particular virus, e.g., two or more HIV protein
genes or two or more herpes virus protein genes. In other
embodiments, they include guide strands having complementary to two
or more herpes simplex virus genes or mRNAs, e.g., the UL29 gene or
mRNA and the Nectin-1 gene or mRNA of HSV-2, to reduce HSV-2
expression, replication or activity. In one embodiment, the
polynucleotide complexes or molecules having regions targeting two
or more HSV-2 genes or mRNAs are present in a formulation for
topical delivery.
[0089] In particular embodiments, polynucleotide complexes and
molecules of the present invention comprise one, two, three or more
guide strands or target-specific regions that target an
apolipoprotein B (ApoB) gene or mRNA, e.g., the human ApoB gene or
mRNA or the mouse ApoB gene or mRNA. Accordingly, in particular
embodiments, they comprise one, two, three or more regions
comprising a region complementary to a region of the human ApoB
sequence set forth in SEQ ID NO:1. In other embodiments, they
comprise one, two, three or more regions comprising a region
complementary to a region of the mouse ApoB sequence set forth in
SEQ ID NO:10. In particular embodiments, they comprise two or more
guide sequences having the specific sequences set forth in the
accompanying Examples.
[0090] In certain embodiments, polynucleotide complexes and
molecules of the present invention comprise one, two, three or more
guide strands or regions that target HIV genes. In particular
embodiments, they target one, two, three or more HIV genes or mRNAs
encoding one or more proteins selected from HIV gag, HIV tat, HIV
env, HIV gag-pol, HIV vif, and HIV nef proteins. Accordingly, in
particular embodiments, they comprise one, two, three or more
regions complementary to a region of the HIV gag sequence set forth
in SEQ ID NO:2; one, two, three or more regions complementary to a
region of the HIV tat sequence set forth in SEQ ID NO:3, one, two,
three or more regions complementary to a region of the HIV env
sequence set forth in SEQ ID NO:4, one, two, three or more regions
complementary to a region of the HIV gag-pol sequence set forth in
SEQ ID NO:5, one, two, three or more regions comprising a region
complementary to a region of the HIV vif sequence set forth in SEQ
ID NO:6, one, two, three or more regions comprising a region
complementary to a region of the HIV nef sequence set forth in SEQ
ID NO:7. In particular embodiments, they comprise two or more guide
sequences having the specific HIV sequences set forth in the
accompanying Examples.
[0091] In certain embodiments, selection of a sequence region
complementary to a target gene (or gene) is based upon analysis of
the chosen target sequence and determination of secondary
structure, T.sub.m, binding energy, and relative stability and cell
specificity. Such sequences may be selected based upon their
relative inability to form dimers, hairpins, or other secondary
structures that would reduce structural integrity of the
polynucleotide or prohibit specific binding to the target gene in a
host cell.
[0092] Preferred target regions of the target gene or mRNA may
include those regions at or near the AUG translation initiation
codon and those sequences that are substantially complementary to
5' regions of the gene or mRNA. These secondary structure analyses
and target site selection considerations can be performed, for
example, using v.4 of the OLIGO primer analysis software and/or the
BLASTN 2.0.5 algorithm software (Altschul et al., Nucleic Acids
Res. 1997, 25(17):3389-402) or Oligoengine Workstation 2.0.
[0093] In one embodiment, target sites are preferentially not
located within the 5' and 3' untranslated regions (UTRs) or regions
near the start codon (within approximately 75 bases), since
proteins that bind regulatory regions may interfere with the
binding of the polynucleotide In addition, potential target sites
may be compared to an appropriate genome database, such as BLASTN
2.0.5, available on the NCBI server at www.ncbi.nlm, and potential
target sequences with significant homology to other coding
sequences eliminated.
[0094] In another embodiment, the target sites are located within
the 5' or 3' untranslated region (UTRs). In addition, the
self-complementary region of the polynucleotide may be composed of
a particular sequence found in the gene of the target.
[0095] The target gene may be of any species, including, for
example, plant, animal (e.g. mammalian), protozoan, viral (e.g.,
HIV), bacterial or fungal. In certain embodiments, the
polynucleotides of the present invention may comprise or be
complementary to the GFP sequences in Example 1, the HIV sequences
in Example 2, or the ApoB sequences in Example 3.
[0096] As noted above, the target gene sequence and the
complementary region of the polynucleotide may be complete
complements of each other, or they may be less than completely
complementary, as long as the strands hybridize to each other under
physiological conditions.
[0097] The polynucleotide complexes and molecules of the present
invention comprise at least one, two, or three regions
complementary to one or more target genes, as well as one or more
self-complementary regions and/or interconnecting loops, Typically,
the region complementary to a target gene is 15 to 17 to 24
nucleotides in length, including integer values within these
ranges. This region may be at least 16 nucleotides in length, at
least 17 nucleotides in length, at least 20 nucleotides in length,
at least 24 nucleotides in length, between 15 and 24 nucleotides in
length, between 16 and 24 nucleotides in length, or between 17 and
24 nucleotides in length, inclusive of the end values, including
any integer value within these ranges.
[0098] The self-complementary region is typically between 2 and 54
nucleotides in length, at least 2 nucleotides in length, at least
16 nucleotides in length, or at least 20 nucleotides in length,
including any integer value within any of these ranges. Hence, in
one embodiment, a self-complementary region may comprise about 1-26
nucleotide pairs. A single-stranded region can be about 3-15
nucleotides, including all integers in between. A null region
refers to a region that is not-specific for any target gene, at
least by design. A null region or strand may be used in place of a
target-specific region, such as in the design of a bi-valent
polynucleotide complex or molecule of the invention (see, e.g.,
Figure IV(K)).
[0099] In certain embodiments, a self-complementary region is long
enough to form a double-stranded structure. In certain embodiments,
a 3' region and a 5' region may hybridize to for a
self-complementary region (i.e., a double-stranded region)
comprising a stem-loop structure. Accordingly, in one embodiment,
the primary sequence of a self-complementary region comprises two
stretches of sequence complementary to each other separated by
additional sequence that is not complementary or is
semi-complementary. While less optimal, the additional sequence can
be complementary in certain embodiments. The additional sequence
forms the loop of the stem-loop structure and, therefore, must be
long enough to facilitate the folding necessary to allow the two
complementary stretches to bind each other. In particular
embodiments, the loop sequence comprises at least 3, at least 4, at
least 5 or at least 6 bases. In one embodiment, the loop sequence
comprises 4 bases. The two stretches of sequence complementary to
each other (within the self-complementary region; i.e., the stem
regions) are of sufficient length to specifically hybridize to each
other under physiological conditions. In certain embodiments, each
stretch comprises 4 to 12 nucleotides; in other embodiments, each
stretch comprises at least 4, at least 5, at least 6, at least 8,
or at least 10 nucleotides, or any integer value within these
ranges. In a particular embodiment, a self-complementary region
comprises two stretches of at least 4 complementary nucleotides
separated by a loop sequence of at least 4 nucleotides. In certain
embodiments, all or a portion of a self-complementary region may or
may not be complementary to the region of the polynucleotide that
is complementary to the target gene or gene.
[0100] In particular embodiments, self-complementary regions
possess thermodynamic parameters appropriate for binding of
self-complementary regions, e.g., to form a stem-loop
structure.
[0101] In one embodiment, self-complementary regions are
dynamically calculated by use of RNA via free-energy analysis and
then compared to the energy contained within the remaining "non
self-complementary region" or loop region to ensure that the energy
composition is adequate to form a desired structure, e.g., a
stem-loop structure. In general, different nucleotide sequences of
the gene targeting region are considered in determining the
compositions of the stem-loop structures to ensure the formation of
such. The free-energy analysis formula may again be altered to
account for the type of nucleotide or pH of the environment in
which it is used. Many different secondary structure prediction
programs are available in the art, and each may be used according
to the invention. Thermodynamic parameters for RNA and DNA bases
are also publicly available in combination with target sequence
selection algorithms, of which several are available in the
art.
[0102] In one embodiment, the polynucleotide complex or molecule
comprises or consists of (a) three oligonucleotides comprising 17
to 24 nucleotides in length (including any integer value
in-between), which is complementary to and capable of hybridizing
under physiological conditions to at least a portion of an gene
molecule, flanked optionally by (b) self-complementary sequences
comprising 16 to 54 nucleotides in length (including any integer
value in-between) or (c) 2 to 12 nucleotides capable of forming a
loop. In one embodiment, each self-complementary sequence is
capable of forming a stem-loop structure, one of which is located
at the 5' end and one of which is located at the 3' end of the
secondary guide strands.
[0103] In certain embodiments, the self-complementary region
functions as a structure to recruit enzymatic cleavage of itself
and/or bind to particular regions of proteins involved in the
catalytic process of gene modulation, In addition, the loop may be
of a certain 4-nucleotide (e.g., tetraloop NGNN, AAGU, UUGA, or
GUUA) structure to promote the cleavage of the self-complementary
region by an RNase such as RNase III. In addition, the
self-complementary region can be cleaved by RNase III 11/13 or
14/16 nucleotides into the duplex region leaving a 2 nucleotide 3'
end. In certain embodiments, the tetraloop has the sequence GNRA or
GNYA, where N indicates any nucleotide or nucleoside, R indicates a
purine nucleotide or nucleoside; and Y indicates a pyrimidine
nucleotide or nucleoside.
[0104] In certain embodiments, the self-complementary
polynucleotide that has been enzymatically cleaved as described
above will load onto the protein region of RISC complexes. In
certain embodiments, the self-complementary region containing a
loop greater than 4 nucleotides can prevent the cleavage of the
self-complementary region by RNase such as RNase III. In preferred
embodiments, the polynucleotide of the present invention binds to
and reduces expression of a target gene. A target gene may be a
known gene target, or, alternatively, a target gene may be not
known, i.e., a random sequence may be used. In certain embodiments,
target gene levels are reduced at least 10%, at least 20%, at least
30%, at least 40%, at least 50%, at least 60%, at least 70%, at
least 75%, at least 80%, at least 90%, or at least 95%.
[0105] In one embodiment of the invention, the level of inhibition
of target gene expression (i.e., gene expression) is at least 90%,
at least 95%, at least 98%, and at least 99% or is almost 100%, and
hence the cell or organism will in effect have the phenotype
equivalent to a so-called "knock out" of a gene. However, in some
embodiments, it may be preferred to achieve only partial inhibition
so that the phenotype is equivalent to a so-called "knockdown" of
the gene. This method of knocking down gene expression can be used
therapeutically or for research (e.g., to generate models of
disease states, to examine the function of a gene, to assess
whether an agent acts on a gene, to validate targets for drug
discovery).
[0106] The polynucleotide complexes and molecules of the invention
can be used to target and reduce or inhibit expression of genes
(inclusive of coding and non-coding sequences), cDNAs, mRNAs, or
microRNAs. In particular embodiments, their guide strands or
targeting regions bind to mRNAs or microRNAs.
[0107] The invention further provides arrays of the polynucleotide
of the invention, including microarrays. Microarrays are
miniaturized devices typically with dimensions in the micrometer to
millimeter range for performing chemical and biochemical reactions
and are particularly suited for embodiments of the invention.
Arrays may be constructed via microelectronic and/or
microfabrication using essentially any and all techniques known and
available in the semiconductor industry and/or in the biochemistry
industry, provided that such techniques are amenable to and
compatible with the deposition and/or screening of polynucleotide
sequences.
[0108] Microarrays of the invention are particularly desirable for
high throughput analysis of multiple polynucleotides. A microarray
typically is constructed with discrete region or spots that
comprise the polynucleotide of the present invention, each spot
comprising one or more the polynucleotide, preferably at
positionally addressable locations on the array surface. Arrays of
the invention may be prepared by any method available in the art.
For example, the light-directed chemical synthesis process
developed by Affymetrix (see, U.S. Pat. Nos. 5,445,934 and
5,856,174) may be used to synthesize biomolecules on chip surfaces
by combining solid-phase photochemical synthesis with
photolithographic fabrication techniques. The chemical deposition
approach developed by Incyte Pharmaceutical uses pre-synthesized
cDNA probes for directed deposition onto chip surfaces (see, e.g.,
U.S. Pat. No. 5,874,554).
[0109] In certain embodiments, a polynucleotide molecule of the
present invention is chemically synthesized using techniques widely
available in the art, and annealed as a three stranded complex. In
a related embodiment, the three or more guide strands of a
polynucleotide complex of the present invention may be individually
chemically synthesized and annealed to produce the polynucleotide
complex.
[0110] In other embodiments, it is expressed in vitro or in vivo
using appropriate and widely known techniques, such as vectors or
plasmid constructs. Accordingly, in certain embodiments, the
present invention includes in vitro and in vivo expression vectors
comprising the sequence of a polynucleotide of the present
invention interconnected by either stem-loop or loop forming
nucleotide sequences. Methods well known to those skilled in the
art may be used to construct expression vectors containing
sequences encoding a polynucleotide, as well as appropriate
transcriptional and translational control elements. These methods
include in vitro recombinant DNA techniques, synthetic techniques,
and in vivo genetic recombination. Such techniques are described,
for example, in Sambrook, J. et al. (1989) Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y., and
Ausubel, F. M. et al. (1989) Current Protocols in Molecular
Biology, John Wiley & Sons, New York, N.Y.
[0111] A vector or nucleic acid construct system can comprise a
single vector or plasmid, two or more vectors or plasmids, which
together contain the total DNA to be introduced into the genome of
the host cell, or a transposon. The choice of the vector will
typically depend on the compatibility of the vector with the host
cell into which the vector is to be introduced. In the present
case, the vector or nucleic acid construct is preferably one which
is operably functional in a mammalian cell. The vector can also
include a selection marker such as an antibiotic or drug resistance
gene, or a reporter gene (i.e., green fluorescent protein,
luciferase), that can be used for selection or identification of
suitable transformants or transfectants. Exemplary delivery systems
may include viral vector systems (i.e., viral-mediated
transduction) including, but not limited to, retroviral (e.g.,
lentiviral) vectors, adenoviral vectors, adeno-associated viral
vectors, and herpes viral vectors, among others known in the
art.
[0112] As noted above, certain embodiments employ retroviral
vectors such as lentiviral vectors. The term "lentivirus" refers to
a genus of complex retroviruses that are capable of infecting both
dividing and non-dividing cells. Examples of lentiviruses include
HIV (human immunodeficiency virus; including HIV type 1, and HIV
type 2), visna-maedi, the caprine arthritis-encephalitis virus,
equine infectious anemia virus, feline immunodeficiency virus
(FIV), bovine immune deficiency virus (BIV), and simian
immunodeficiency virus (SIV). Lentiviral vectors can be derived
from any one or more of these lentiviruses (see, e.g., Evans et
al., Hum Gene Ther. 10:1479-1489, 1999; Case et al., PNAS USA
96:2988-2993, 1999; Uchida et al., PNAS USA 95:11939-11944, 1998;
Miyoshi et al., Science 283:682-686, 1999; Sutton et al., J Virol
72:5781-5788, 1998; and Frecha et al., Blood. 112:4843-52, 2008,
each of which is incorporated by reference in its entirety).
[0113] In certain embodiments the retroviral vector comprises
certain minimal sequences from a lentivirus genome, such as the HIV
genome or the SIV genome. The genome of a lentivirus is typically
organized into a 5' long terminal repeat (LTR) region, the gag
gene, the pol gene, the env gene, the accessory genes (e.g., nef,
vif, vpr, vpu, tat, rev) and a 3' LTR region. The viral LTR is
divided into three regions referred to as U3, R (repeat) and U5.
The U3 region contains the enhancer and promoter elements, the U5
region contains the polyadenylation signals, and the R region
separates the U3 and U5 regions. The transcribed sequences of the R
region appear at both the 5' and 3' ends of the viral RNA (see,
e.g., "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed.,
Oxford University Press, 2000); O Narayan, J. Gen. Virology.
70:1617-1639, 1989; Fields et al., Fundamental Virology Raven
Press., 1990; Miyoshi et al., J Virol. 72:8150-7, 1998; and U.S.
Pat. No. 6,013,516, each of which is incorporated by reference in
its entirety). Lentiviral vectors may comprise any one or more of
these elements of the lentiviral genome, to regulate the activity
of the vector as desired, or, they may contain deletions,
insertions, substitutions, or mutations in one or more of these
elements, such as to reduce the pathological effects of lentiviral
replication, or to limit the lentiviral vector to a single round of
infection.
[0114] Typically, a minimal retroviral vector comprises certain
5'LTR and 3'LTR sequences, one or more genes of interest (to be
expressed in the target cell), one or more promoters, and a
cis-acting sequence for packaging of the RNA. Other regulatory
sequences can be included, as described herein and known in the
art. The viral vector is typically cloned into a plasmid that may
be transfected into a packaging cell line, such as a eukaryotic
cell (e.g., 293-HEK), and also typically comprises sequences useful
for replication of the plasmid in bacteria.
[0115] In certain embodiments, the viral vector comprises sequences
from the 5' and/or the 3' LTRs of a retrovirus such as a
lentivirus. The LTR sequences may be LTR sequences from any
lentivirus from any species. For example, they may be LTR sequences
from HIV, SIV, FIV or BIV. Preferably the LTR sequences are HIV LTR
sequences.
[0116] In certain embodiments, the viral vector comprises the R and
U5 sequences from the 5' LTR of a lentivirus and an inactivated or
"self-inactivating" 3' LTR from a lentivirus. A "self-inactivating
3' LTR" is a 3' long terminal repeat (LTR) that contains a
mutation, substitution or deletion that prevents the LTR sequences
from driving expression of a downstream gene. A copy of the U3
region from the 3' LTR acts as a template for the generation of
both LTR's in the integrated provirus. Thus, when the 3' LTR with
an inactivating deletion or mutation integrates as the 5' LTR of
the provirus, no transcription from the 5' LTR is possible. This
eliminates competition between the viral enhancer/promoter and any
internal enhancer/promoter. Self-inactivating 3' LTRs are
described, for example, in Zufferey et al., J Virol. 72:9873-9880,
1998; Miyoshi et al., J Virol. 72:8150-8157, 1998; and Iwakuma et
al., Virology 261:120-132, 1999, each of which is incorporated by
reference in its entirety. Self-inactivating 3' LTRs may be
generated by any method known in the art. In certain embodiments,
the U3 element of the 3' LTR contains a deletion of its enhancer
sequence, preferably the TATA box, Spl and/or NF-kappa B sites. As
a result of the self-inactivating 3' LTR, the provirus that is
integrated into the host cell genome will comprise an inactivated
5' LTR.
[0117] Expression vectors typically include regulatory sequences,
which regulate expression of the polynucleotide. Regulatory
sequences present in an expression vector include those
non-translated regions of the vector, e.g., enhancers, promoters,
5' and 3' untranslated regions, which interact with host cellular
proteins to carry out transcription and translation. Such elements
may vary in their strength and specificity. Depending on the vector
system and cell utilized, any number of suitable transcription and
translation elements, including constitutive and inducible
promoters, may be used. In addition, tissue- or -cell specific
promoters may also be used.
[0118] For expression in mammalian cells, promoters from mammalian
genes or from mammalian viruses are generally preferred. In
addition, a number of viral-based expression systems are generally
available. For example, in cases where an adenovirus is used as an
expression vector, sequences encoding a polypeptide of interest may
be ligated into an adenovirus transcription/translation complex
consisting of the late promoter and tripartite leader sequence.
Insertion in a non-essential E1 or E3 region of the viral genome
may be used to obtain a viable virus which is capable of expressing
the polypeptide in infected host cells (Logan, J. and Shenk, T.
(1984) Proc. Natl. Acad. Sci. 81:3655-3659). In addition,
transcription enhancers, such as the Rous sarcoma virus (RSV)
enhancer, may be used to increase expression in mammalian host
cells.
[0119] Certain embodiments may employ the one or more of the RNA
polymerase II and III promoters. A suitable selection of RNA
polymerase III promoters can be found, for example, in Paule and
White. Nucleic Acids Research., Vol 28, pp 1283-1298, 2000, which
is incorporated by reference in its entirety. RNA polymerase II and
III promoters also include any synthetic or engineered DNA
fragments that can direct RNA polymerase II or III, respectively,
to transcribe its downstream RNA coding sequences. Further, the RNA
polymerase II or III (Pol II or III) promoter or promoters used as
part of the viral vector can be inducible. Any suitable inducible
Pol II or III promoter can be used with the methods of the
invention. Exemplary Pol II or III promoters include the
tetracycline responsive promoters provided in Ohkawa and Taira,
Human Gene Therapy, Vol. 11, pp 577-585, 2000; and Meissner et al.,
Nucleic Acids Research, Vol. 29, pp 1672-1682, 2001, each of which
is incorporated by reference in its entirety.
[0120] Non-limiting examples of constitutive promoters that may be
used include the promoter for ubiquitin, the CMV promoter (see,
e.g., Karasuyama et al., J. Exp. Med. 169:13, 1989), the
.beta.-actin (see, e.g., Gunning et al., PNAS USA 84:4831-4835,
1987), and the pgk promoter (see, e.g., Adra et al., Gene 60:65-74,
1987); Singer-Sam et al., Gene 32:409-417, 1984; and Dobson et al.,
Nucleic Acids Res. 10:2635-2637, 1982, each of which is
incorporated by reference). Non-limiting examples of tissue
specific promoters include the Ick promoter (see, e.g., Garvin et
al., Mol. Cell Biol. 8:3058-3064, 1988; and Takadera et al., Mol.
Cell Biol. 9:2173-2180, 1989), the myogenin promoter (Yee et al.,
Genes and Development 7:1277-1289, 1993), and the thy1 (see, e.g.,
Gundersen et al., Gene 113:207-214, 1992).
[0121] Additional examples of promoters include the ubiquitin-C
promoter, the human .mu. heavy chain promoter or the Ig heavy chain
promoter (e.g., MH-b12), and the human .kappa. light chain promoter
or the Ig light chain promoter (e.g., EEK-b12), which are
functional in B-lymphocytes. The MH-b12 promoter contains the human
.mu. heavy chain promoter preceded by the iE.mu. enhancer flanked
by matrix association regions, and the EEK-b12 promoter contains
the .kappa. light chain promoter preceded an intronic enhancer
(iE.kappa.), a matrix associated region, and a 3' enhancer
(3'E.kappa.) (see, e.g., Luo et al., Blood. 113:1422-1431, 2009,
herein incorporated by reference). Accordingly, certain embodiments
may employ one or more of these promoter or enhancer elements.
[0122] In certain embodiments, the invention provides for the
conditional expression of a polynucleotide. A variety of
conditional expression systems are known and available in the art
for use in both cells and animals, and the invention contemplates
the use of any such conditional expression system to regulate the
expression or activity of a polynucleotide. In one embodiment of
the invention, for example, inducible expression is achieved using
the REV-TET system. Components of this system and methods of using
the system to control the expression of a gene are well documented
in the literature, and vectors expressing the
tetracycline-controlled transactivator (tTA) or the reverse tTA
(rtTA) are commercially available (e.g., pTet-Off, pTet-On and
ptTA-2/3/4 vectors, Clontech, Palo Alto, Calif.). Such systems are
described, for example, in U.S. Pat. Nos. 5,650,298, 6,271,348,
5,922,927, and related patents, which are incorporated by reference
in their entirety.
[0123] In certain embodiments, the viral vectors (e.g., retroviral,
lentiviral) provided herein are "pseudo-typed" with one or more
selected viral glycoproteins or envelope proteins, mainly to target
selected cell types. Pseudo-typing refers to generally to the
incorporation of one or more heterologous viral glycoproteins onto
the cell-surface virus particle, often allowing the virus particle
to infect a selected cell that differs from its normal target
cells. A "heterologous" element is derived from a virus other than
the virus from which the RNA genome of the viral vector is derived.
Typically, the glycoprotein-coding regions of the viral vector have
been genetically altered such as by deletion to prevent expression
of its own glycoprotein. Merely by way of illustration, the
envelope glycoproteins gp41 and/or gp120 from an HIV-derived
lentiviral vector are typically deleted prior to pseudo-typing with
a heterologous viral glycoprotein.
[0124] Generation of viral vectors can be accomplished using any
suitable genetic engineering techniques known in the art,
including, without limitation, the standard techniques of
restriction endonuclease digestion, ligation, transformation,
plasmid purification, PCR amplification, and DNA sequencing, for
example as described in Sambrook et al. (Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, N.Y.
(1989)), Coffin et al. (Retroviruses. Cold Spring Harbor Laboratory
Press, N.Y. (1997)) and "RNA Viruses: A Practical Approach" (Alan
J. Cann, Ed., Oxford University Press, (2000)).
[0125] Any variety of methods known in the art may be used to
produce suitable retroviral particles whose genome comprises an RNA
copy of the viral vector. As one method, the viral vector may be
introduced into a packaging cell line that packages the viral
genomic RNA based on the viral vector into viral particles with a
desired target cell specificity. The packaging cell line typically
provides in trans the viral proteins that are required for
packaging the viral genomic RNA into viral particles and infecting
the target cell, including the structural gag proteins, the
enzymatic pol proteins, and the envelope glycoproteins.
[0126] In certain embodiments, the packaging cell line may stably
express certain of the necessary or desired viral proteins (e.g.,
gag, pol) (see, e.g., U.S. Pat. No. 6,218,181, herein incorporated
by reference). In certain embodiments, the packaging cell line may
be transiently transfected with plasmids that encode certain of the
necessary or desired viral proteins (e.g., gag, pol, glycoprotein),
including the measles virus glycoprotein sequences described
herein. In one exemplary embodiment, the packaging cell line stably
expresses the gag and pol sequences, and the cell line is then
transfected with a plasmid encoding the viral vector and a plasmid
encoding the glycoprotein. Following introduction of the desired
plasmids, viral particles are collected and processed accordingly,
such as by ultracentrifugation to achieve a concentrated stock of
viral particles. Exemplary packaging cell lines include 293 (ATCC
CCL X), HeLa (ATCC CCL 2), D17 (ATCC CCL 183), MDCK (ATCC CCL 34),
BHK (ATCC CCL-10) and Cf2Th (ATCC CRL 1430) cell lines.
[0127] In one particular embodiment, the polynucleotides are
expressed using a vector system comprising a pSUPER vector backbone
and additional sequences corresponding to the polynucleotide to be
expressed. The pSUPER vectors system has been shown useful in
expressing shRNA reagents and downregulating gene expression
(Brummelkamp, T. T. et al., Science 296:550 (2002) and Brummelkamp,
T. R. et al., Cancer Cell, published online Aug. 22, 2002). PSUPER
vectors are commercially available from OligoEngine, Seattle,
Wash.
Methods of Regulating Gene Expression
[0128] The polynucleotides of the invention may be used for a
variety of purposes, all generally related to their ability to
inhibit or reduce expression of one or more target genes.
Accordingly, the invention provides methods of reducing expression
of one or more target genes comprising introducing a polynucleotide
complex or molecule of the present invention into a cell comprising
said one or more target genes. In particular embodiments, the
polynucleotide complex or molecule comprises one or more guide
strands that collectively target the one or more target genes. In
one embodiment, a polynucleotide of the invention is introduced
into a cell that contains a target gene or a homolog, variant or
ortholog thereof, targeted by either one, two, or three of the
guide strands or targeting regions.
[0129] In addition, the polynucleotides of the present invention
may be used to reduce expression indirectly. For example, a
polynucleotide complex or molecule of the present invention may be
used to reduce expression of a transactivator that drives
expression of a second gene (i.e., the target gene), thereby
reducing expression of the second gene. Similarly, a polynucleotide
may be used to increase expression indirectly. For example, a
polynucleotide complex or molecule of the present invention may be
used to reduce expression of a transcriptional repressor that
inhibits expression of a second gene, thereby increasing expression
of the second gene.
[0130] In various embodiments, a target gene is a gene derived from
the cell into which a polynucleotide is to be introduced, an
endogenous gene, an exogenous gene, a transgene, or a gene of a
pathogen that is present in the cell after transfection thereof.
Depending on the particular target gene and the amount of the
polynucleotide delivered into the cell, the method of this
invention may cause partial or complete inhibition of the
expression of the target gene. The cell containing the target gene
may be derived from or contained in any organism (e.g., plant,
animal, protozoan, virus, bacterium, or fungus). As used herein,
"target genes" include genes, mRNAs, and microRNAs.
[0131] Inhibition of the expression of the target gene can be
verified by means including, but not limited to, observing or
detecting an absence or observable decrease in the level of protein
encoded by a target gene, an absence or observable decrease in the
level of a gene product expressed from a target gene (e.g., mRNA0,
and/or a phenotype associated with expression of the gene, using
techniques known to a person skilled in the field of the present
invention.
[0132] Examples of cell characteristics that may be examined to
determine the effect caused by introduction of a polynucleotide
complex or molecule of the present invention include, cell growth,
apoptosis, cell cycle characteristics, cellular differentiation,
and morphology.
[0133] A polynucleotide complex or molecule of the present
invention may be directly introduced to the cell (i.e.,
intracellularly), or introduced extracellularly into a cavity or
interstitial space of an organism, e.g., a mammal, into the
circulation of an organism, introduced orally, introduced by
bathing an organism in a solution containing the polynucleotide, or
by some other means sufficient to deliver the polynucleotide into
the cell.
[0134] In addition, a vector engineered to express a polynucleotide
may be introduced into a cell, wherein the vector expresses the
polynucleotide, thereby introducing it into the cell. Methods of
transferring an expression vector into a cell are widely known and
available in the art, including, e.g., transfection, lipofection,
scrape-loading, electroporation, microinjection, infection, gene
gun, and retrotransposition. Generally, a suitable method of
introducing a vector into a cell is readily determined by one of
skill in the art based upon the type of vector and the type of
cell, and teachings widely available in the art. Infective agents
may be introduced by a variety of means readily available in the
art, including, e.g., nasal inhalation.
[0135] Methods of inhibiting gene expression using the
oligonucleotides of the invention may be combined with other
knockdown and knockout methods, e.g., gene targeting, antisense
RNA, ribozymes, double-stranded RNA (e.g., shRNA and siRNA) to
further reduce expression of a target gene.
[0136] In different embodiments, target cells of the invention are
primary cells, cell lines, immortalized cells, or transformed
cells. A target cell may be a somatic cell or a germ cell. The
target cell may be a non-dividing cell, such as a neuron, or it may
be capable of proliferating in vitro in suitable cell culture
conditions. Target cells may be normal cells, or they may be
diseased cells, including those containing a known genetic
mutation. Eukaryotic target cells of the invention include
mammalian cells, such as, for example, a human cell, a murine cell,
a rodent cell, and a primate cell. In one embodiment, a target cell
of the invention is a stem cell, which includes, for example, an
embryonic stem cell, such as a murine embryonic stem cell.
[0137] The polynucleotide complexes, molecules, and methods of the
present invention may be used to treat any of a wide variety of
diseases or disorders, including, but not limited to, inflammatory
diseases, cardiovascular diseases, nervous system diseases, tumors,
demyelinating diseases, digestive system diseases, endocrine system
diseases, reproductive system diseases, hemic and lymphatic
diseases, immunological diseases, mental disorders, muscoloskeletal
diseases, neurological diseases, neuromuscular diseases, metabolic
diseases, sexually transmitted diseases, skin and connective tissue
diseases, urological diseases, and infections.
[0138] In certain embodiments, the methods are practiced on an
animal, in particular embodiments, a mammal, and in certain
embodiments, a human.
[0139] Accordingly, in one embodiment, the present invention
includes methods of using a polynucleotide complex or molecule of
the present invention for the treatment or prevention of a disease
associated with gene deregulation, overexpression, or mutation. For
example, a polynucleotide complex or molecule of the present
invention may be introduced into a cancerous cell or tumor and
thereby inhibit expression of a gene required for or associated
with maintenance of the carcinogenic/tumorigenic phenotype. To
prevent a disease or other pathology, a target gene may be selected
that is, e.g., required for initiation or maintenance of a
disease/pathology. Treatment may include amelioration of any
symptom associated with the disease or clinical indication
associated with the pathology.
[0140] In addition, the polynucleotides of the present invention
are used to treat diseases or disorders associated with gene
mutation. In one embodiment, a polynucleotide is used to modulate
expression of a mutated gene or allele. In such embodiments, the
mutated gene is a target of the polynucleotide complex or molecule,
which will comprise a region complementary to a region of the
mutated gene. This region may include the mutation, but it is not
required, as another region of the gene may also be targeted,
resulting in decreased expression of the mutant gene or gene. In
certain embodiments, this region comprises the mutation, and, in
related embodiments, the polynucleotide complex or molecule
specifically inhibits expression of the mutant gene or gene but not
the wild type gene or gene. Such a polynucleotide is particularly
useful in situations, e.g., where one allele is mutated but another
is not. However, in other embodiments, this sequence would not
necessarily comprise the mutation and may, therefore, comprise only
wild-type sequence. Such a polynucleotide is particularly useful in
situations, e.g., where all alleles are mutated. A variety of
diseases and disorders are known in the art to be associated with
or caused by gene mutation, and the invention encompasses the
treatment of any such disease or disorder with a the
polynucleotide.
[0141] In certain embodiments, a gene of a pathogen is targeted for
inhibition. For example, the gene could cause immunosuppression of
the host directly or be essential for replication of the pathogen,
transmission of the pathogen, or maintenance of the infection. In
addition, the target gene may be a pathogen gene or host gene
responsible for entry of a pathogen into its host, drug metabolism
by the pathogen or host, replication or integration of the
pathogen's genome, establishment or spread of an infection in the
host, or assembly of the next generation of pathogen. Methods of
prophylaxis (i.e., prevention or decreased risk of infection), as
well as reduction in the frequency or severity of symptoms
associated with infection, are included in the present invention.
For example, cells at risk for infection by a pathogen or already
infected cells, particularly human immunodeficiency virus (HIV)
infections, may be targeted for treatment by introduction of a the
polynucleotide according to the invention (see Examples 1 and 2 for
targeting sequences). Thus, in one embodiment, polynucleotide
complexes or molecules of the present invention that target one or
more HIV proteins are used to treat or inhibit HIV infection or
acquired immune deficiency syndrome (AIDS).
[0142] In other specific embodiments, the present invention is used
for the treatment or development of treatments for cancers of any
type. Examples of tumors that can be treated using the methods
described herein include, but are not limited to, neuroblastomas,
myelomas, prostate cancers, small cell lung cancer, colon cancer,
ovarian cancer, non-small cell lung cancer, brain tumors, breast
cancer, leukemias, lymphomas, and others.
[0143] In one embodiment, polynucleotide complexes or molecules of
the present invention that target apolipoprotein B (apoB) are used
to treat, reduce, or inhibit atherosclerosis or heart disease. ApoB
is the primary apolipoprotein of low-density lipoproteins (LDLs),
which is responsible for carrying cholesterol to tissues. ApoB on
the LDL particle acts as a ligand for LDL receptors, and high
levels of ApoB can lead to plaques that cause vascular disease
(atherosclerosis), leading to heart disease.
[0144] The polynucleotide complexes, molecules and expression
vectors (including viral vectors and viruses) may be introduced
into cells in vitro or ex vivo and then subsequently placed into an
animal to affect therapy, or they may be directly introduced to a
patient by in vivo administration. Thus, the invention provides
methods of gene therapy, in certain embodiments. Compositions of
the invention may be administered to a patient in any of a number
of ways, including parenteral, intravenous, systemic, local,
topical, oral, intratumoral, intramuscular, subcutaneous,
intraperitoneal, inhalation, or any such method of delivery. In one
embodiment, the compositions are administered parenterally, i.e.,
intraarticularly, intravenously, intraperitoneally, subcutaneously,
or intramuscularly. In a specific embodiment, the liposomal
compositions are administered by intravenous infusion or
intraperitoneally by a bolus injection.
[0145] Compositions of the invention may be formulated as
pharmaceutical compositions suitable for delivery to a subject. The
pharmaceutical compositions of the invention will often further
comprise one or more buffers (e.g., neutral buffered saline or
phosphate buffered saline), carbohydrates (e.g., glucose, mannose,
sucrose, dextrose or dextrans), mannitol, proteins, polypeptides or
amino acids such as glycine, antioxidants, bacteriostats, chelating
agents such as EDTA or glutathione, adjuvants (e.g., aluminum
hydroxide), solutes that render the formulation isotonic, hypotonic
or weakly hypertonic with the blood of a recipient, suspending
agents, thickening agents and/or preservatives. Alternatively,
compositions of the present invention may be formulated as a
lyophilizate.
[0146] The amount of the oligonucleotides administered to a patient
can be readily determined by a physician based upon a variety of
factors, including, e.g., the disease and the level of the
oligonucleotides expressed from the vector being used (in cases
where a vector is administered). The amount administered per dose
is typically selected to be above the minimal therapeutic dose but
below a toxic dose. The choice of amount per dose will depend on a
number of factors, such as the medical history of the patient, the
use of other therapies, and the nature of the disease. In addition,
the amount administered may be adjusted throughout treatment,
depending on the patient's response to treatment and the presence
or severity of any treatment-associated side effects.
Methods of Determining Gene Function
[0147] The invention further includes a method of identifying gene
function in an organism comprising the use of a polynucleotide
complex or molecule of the present invention to inhibit the
activity of a target gene of previously unknown function. Instead
of the time consuming and laborious isolation of mutants by
traditional genetic screening, functional genomics envisions
determining the function of uncharacterized genes by employing the
invention to reduce the amount and/or alter the timing of target
gene activity. The invention may be used in determining potential
targets for pharmaceutics, understanding normal and pathological
events associated with development, determining signaling pathways
responsible for postnatal development/aging, and the like. The
increasing speed of acquiring nucleotide sequence information from
genomic and expressed gene sources, including total sequences for
the yeast, D. melanogaster, and C. elegans genomes, can be coupled
with the invention to determine gene function in an organism (e.g.,
nematode). The preference of different organisms to use particular
codons, searching sequence databases for related gene products,
correlating the linkage map of genetic traits with the physical map
from which the nucleotide sequences are derived, and artificial
intelligence methods may be used to define putative open reading
frames from the nucleotide sequences acquired in such sequencing
projects.
[0148] In one embodiment, a polynucleotide of the present invention
is used to inhibit gene expression based upon a partial sequence
available from an expressed sequence tag (EST), e.g., in order to
determine the gene's function or biological activity. Functional
alterations in growth, development, metabolism, disease resistance,
or other biological processes would be indicative of the normal
role of the ESTs gene product.
[0149] The ease with which a polynucleotide can be introduced into
an intact cell/organism containing the target gene allows the
present invention to be used in high throughput screening (HTS).
For example, solutions containing the polynucleotide that are
capable of inhibiting different expressed genes can be placed into
individual wells positioned on a microtiter plate as an ordered
array, and intact cells/organisms in each well can be assayed for
any changes or modifications in behavior or development due to
inhibition of target gene activity. The function of the target gene
can be assayed from the effects it has on the cell/organism when
gene activity is inhibited. In one embodiment, the polynucleotides
of the invention are used for chemocogenomic screening, i.e.,
testing compounds for their ability to reverse a disease modeled by
the reduction of gene expression using a polynucleotide of the
invention.
[0150] If a characteristic of an organism is determined to be
genetically linked to a polymorphism through RFLP or QTL analysis,
the present invention can be used to gain insight regarding whether
that genetic polymorphism might be directly responsible for the
characteristic. For example, a fragment defining the genetic
polymorphism or sequences in the vicinity of such a genetic
polymorphism can be amplified to produce an RNA, a polynucleotide
can be introduced to the organism, and whether an alteration in the
characteristic is correlated with inhibition can be determined.
[0151] The present invention is also useful in allowing the
inhibition of essential genes. Such genes may be required for cell
or organism viability at only particular stages of development or
cellular compartments. The functional equivalent of conditional
mutations may be produced by inhibiting activity of the target gene
when or where it is not required for viability. The invention
allows addition of a the polynucleotide at specific times of
development and locations in the organism without introducing
permanent mutations into the target genome. Similarly, the
invention contemplates the use of inducible or conditional vectors
that express a the polynucleotide only when desired.
[0152] The present invention also relates to a method of validating
whether a gene product is a target for drug discovery or
development. A the polynucleotide that targets the gene that
corresponds to the gene for degradation is introduced into a cell
or organism. The cell or organism is maintained under conditions in
which degradation of the gene occurs, resulting in decreased
expression of the gene. Whether decreased expression of the gene
has an effect on the cell or organism is determined. If decreased
expression of the gene has an effect, then the gene product is a
target for drug discovery or development.
Methods of Designing and Producing Polynucleotide Complexes and
Molecules
[0153] The polynucleotide complexes and molecules of the present
invention comprise a novel and unique set of functional sequences,
arranged in a manner so as to adopt a secondary structure
containing one or more double-stranded regions (sometimes adjoined
by stem-loop or loop structures), which imparts the advantages of
the polynucleotide. Accordingly, in certain embodiments, the
present invention includes methods of designing the polynucleotide
complexes and molecules of the present invention. Such methods
typically involve appropriate selection of the various sequence
components of the polynucleotide complexes and molecules. The terms
"primary strand", "secondary strand", and "key strand" refer to the
various guide strands present within a polynucleotide complex or
molecule of the present invention.
[0154] In one embodiment, the basic design of the polynucleotide
complex is as follows:
Design Motifs:
[0155] (primary strand)(UU)(secondary strand)(UU)(key
strand)(UU)
[0156] Accordingly, in a related embodiment, a the polynucleotide
is designed as follows:
[0157] II. (secondary strand)(UU)(UU)(key strand)(UU)(primary
strand)
[0158] III. (secondary strand)(UU)(loop or stem-loop)(key
strand)(UU)(loop or stem-loop)(primary strand)(UU)
Set Parameters
[0159] Set seed size for self-complementarity at approximately
38-43%. For a 19 nucleotide targets, a range or 7 or 8 nucleotides
is preferred as SEED_SIZE.
[0160] For each gene, define a PRIMARY and SECONDARY target
gene.
Define Primary Strands
[0161] Start with one or more target gene sequences. For each gene,
build a list of PRIMARY target sequences 17-24 nucleotide motifs
that meet criteria of G/C content, specificity, and poly-A or
poly-G free. For each, find also a SECONDARY and KEY strand.
Find Secondary and Key Strands
[0162] d. For each target sequence on each gene, clustal align base
1 through SEED_SIZE the reverse of each sequence to the SECONDARY
gene
[0163] Record sequence with a perfect alignment. The target
sequence on the SECONDARY gene is the alignment start, minus the
length of the motif, plus SEED_SIZE to alignment start, plus
SEED_SIZE. The SECONDARY strand is the reverse compliment.
[0164] To find each KEY strand, define SEED_A as base 1 through
SEED_SIZE of the PRIMARY strand, define SEED_B as bases at motif
length minus SEED_SIZE to motif length of the SECONDARY strand. Set
a MID_SECTION as characters "I" repeated of length motif sequence
length minus SEED_A length plus SEED_B length. Set key alignment
sequence as SEED_A, MID_SECTION, SEED_B. Clustal align to the
target gene for the key segment. Record KEY target sequence as
bases at alignment hit on key target gene to bases alignment hit
plus motif length. The KEY strand is the reverse compliment.
Construct Optional Polynucleotide
[0165] g. Build candidate Stem A & B with (4-24) nucleotides
that have melting temperature dominant to equal length region of
target. Stem strands have A-T, G-C complementarity to each other.
Length and composition depend upon which endoribonuclease is chosen
for pre-processing of the stem-loop structure.
[0166] h. Build candidate Stem C & D with (4-24) nucleotides
that have melting temperature dominant to equal length region of
target. Stem strands have A-T, G-C complementarity to each other,
but no complementarity to Stem A & B. Length and composition
depend upon which endoribonuclease is chosen for pre-processing of
the stem-loop structure.
[0167] i. Build loop candidates with (4-12) A-T rich nucleotides
into loop A & B. Length and composition depend upon which
endoribonuclease is chosen for pre-processing of the stem-loop
structure. Tetraloops as described are suggested for longer stems
processed by RNase III or Pac1 RNase III endoribonucleases as drawn
in (Fig. A.). Larger loops are suggested for preventing RNase III
or Pac1 processing and placed onto shorter stems as drawn in (Fig.
C, Fig. D.).
[0168] j. Form a contiguous sequence for each motif candidate.
[0169] k. Fold candidate sequence using software with desired
parameters.
[0170] l. From output, locate structures with single stranded
target regions which are flanked at either one or both ends with a
desired stem/loop structure.
[0171] In one embodiment, a method of designing a polynucleotide
sequence comprising one or more self-complementary regions for the
regulation of expression of a target gene (i.e., a the
polynucleotide), includes: (a) selecting a first sequence 17 to 30
nucleotides in length and complementary to a target gene; and (b)
selecting one or more additional sequences 12 to 54 nucleotides in
length, which comprises self-complementary regions and which are
non-complementary to the first sequence.
[0172] These methods, in certain embodiments, include determining
or predicting the secondary structure adopted by the sequences
selected in step (b), e.g., in order to determine that they are
capable of adopting a stem-loop structure.
[0173] Similarly, these methods can include a verification step,
which comprises testing the designed polynucleotide sequence for
its ability to inhibit expression of a target gene, e.g., in an in
vivo or in vitro test system.
[0174] The invention further contemplates the use of a computer
program to select sequences of a polynucleotide, based upon the
complementarity characteristics described herein. The invention,
thus, provides computer software programs, and computer readable
media comprising said software programs, to be used to select the
polynucleotide sequences, as well as computers containing one of
the programs of the present invention.
[0175] In certain embodiments, a user provides a computer with
information regarding the sequence, location or name of a target
gene. The computer uses this input in a program of the present
invention to identify one or more appropriate regions of the target
gene to target, and outputs or provides complementary sequences to
use in the polynucleotide of the invention. The computer program
then uses this sequence information to select sequences of the one
or more self-complementary regions of the polynucleotide.
Typically, the program will select a sequence that is not
complementary to a genomic sequence, including the target gene, or
the region of the polynucleotide that is complementary to the
target gene. Furthermore, the program will select sequences of
self-complementary regions that are not complementary to each
other. When desired, the program also provides sequences of gap
regions. Upon selection of appropriate sequences, the computer
program outputs or provides this information to the user.
[0176] The programs of the present invention may further use input
regarding the genomic sequence of the organism containing the
target gene, e.g., public or private databases, as well as
additional programs that predict secondary structure and/or
hybridization characteristics of particular sequences, in order to
ensure that the polynucleotide adopts the correct secondary
structure and does not hybridize to non-target genes.
[0177] The present invention is based, in part, upon the surprising
discovery that the polynucleotide, as described herein, is
extremely effective in reducing target gene expression of one or
more genes. The polynucleotide offer significant advantages over
previously described antisense RNAs, including increased potency,
and increased effectiveness to multiple target genes. Furthermore,
the polynucleotide of the invention offer additional advantages
over traditional dsRNA molecules used for siRNA, since the use of
the polynucleotide substantially eliminates the off-target
suppression associated with dsRNA molecules and offers multivalent
RNAi.
[0178] It is understood that the compositions and methods of the
present invention may be used to target a variety of different
target genes. The term "target gene" may refer to a gene, an mRNA,
or a microRNA. Accordingly, target sequences provided herein may be
depicted as either DNA sequences or RNA sequences. One of skill the
art will appreciate that the compositions of the present invention
may include regions complementary to either the DNA or RNA
sequences provided herein. Thus, where either a DNA or RNA target
sequence is provided, it is understood that the corresponding RNA
or DNA target sequence, respectively, may also be targeted.
[0179] The practice of the present invention will employ a variety
of conventional techniques of cell biology, molecular biology,
microbiology, and recombinant DNA, which are within the skill of
the art. Such techniques are fully described in the literature.
See, for example, Molecular Cloning: A Laboratory Manual, 2.sup.nd
Ed., ed. by Sambrook, Fritsch, and Maniatis (Cold Spring Harbor
Laboratory Press, 1989); and DNA Cloning, Volumes I and II (D. N.
Glover ed. 1985).
[0180] All of the patents, patent applications, and non-patent
references referred to herein are incorporated by reference in
their entirety, as if each one was individually incorporated by
reference.
[0181] The various embodiments described above can be combined to
provide further embodiments. All of the U.S. patents, U.S. patent
application publications, U.S. patent applications, foreign
patents, foreign patent applications and non-patent publications
referred to in this specification and/or listed in the Application
Data Sheet are incorporated herein by reference, in their entirety.
Aspects of the embodiments can be modified, if necessary to employ
concepts of the various patents, applications and publications to
provide yet further embodiments.
[0182] These and other changes can be made to the embodiments in
light of the above-detailed description. In general, in the
following claims, the terms used should not be construed to limit
the claims to the specific embodiments disclosed in the
specification and the claims, but should be construed to include
all possible embodiments along with the full scope of equivalents
to which such claims are entitled. Accordingly, the claims are not
limited by the disclosure.
EXAMPLES
Example 1
Trivoid Anti-GFP
[0183] Multivalent siRNA were designed against a single gene, the
green fluorescent protein (GFP). A multivalent synthetic RNA
MV-siRNA complex directed against GFP was tested to compare
suppression activity in relation to that of a single shRNA clone.
Also, to test the effect of deactivating one of the strands of the
synthetic MV-siRNA complex, one strand was replaced with DNA
(T1-19_C_dna); as shown below. This replacement resulted in a
relative drop in suppression by .about.30%. Additionally, `short`
and `long` forms of the MV-siRNA self-complementary clones
described herein were tested and compared to the suppression of GFP
expression in relation to that of a published shRNA clone.
[0184] Oligomer sequences for the synthetic MV-siRNA, and the DNA
replacement strand, are shown below in Table 1. The targeted
regions of the GFP coding sequence are illustrated in FIG. 8A.
TABLE-US-00001 TABLE 1 Oligos for Synthetic MV-siRNA: Name Sequence
SEQ ID NO: TI-19/7_A GGGCAGCUUGCCGGUGGUGUU 11 TI-19/7_B
CACCACCCCGGUGAACAGCUU 12 TI-19/70 GCUGUUCACGUCGCUGCCCUU 13
TI-19/7_C_dna GCTGTTCACGTCGCTGCCC 14
[0185] To prepare the synthetic multivalent-siRNAs (MV-siRNAs),
each tube of the individual oligos above was resuspended in
RNase-free water to obtain a final concentration of 50 .mu.M (50
pmoles/.mu.L). The individual oligos were then combined as (a)
TI-19/7_A, TI-19/7_B, and TI-19/7_C (MV-siRNA GFP I), or as (b)
TI-19/7_A, TI-19/7_B, and TI-19/7_C_dna (MV-siRNA GFP I DNA), and
annealed as follows. 30 .mu.L of each one of the resupended oligos
were combined with 10 .mu.L of 10.times. annealing buffer (100 mM
Tris-HCl pH7.5, 1M NaCl, 10 mM EDTA), vortexed, heated for 5
minutes at 94.degree. C., and step cooled to 70.degree. C. over 30
minutes. The final concentration of the annealed MV-siRNA was about
15 .mu.M.
[0186] To prepare the multivalent-siRNA clones and shRNA control,
the sequences in Table 2 below were cloned into the pSUPER vector,
according to the pSUPER manual. The first sequence for each named
clone (e.g., TI, T1_long, TII) represents the sequence of the
self-complementary multivalent siRNA that was expressed in the cell
as an RNA transcript (comparable to the sequence of the synthetic
MV-siRNAs in Table 1), and the sequence referred to as "_as" is
part of the coding sequence for that molecule.
TABLE-US-00002 TABLE 2 Oligos for MV-siRNA expressing clones: Name
Sequence SEQ ID NO: T1
GATCCCCCACCACCCCGGTGAACAGCgttaGCTGTTCACGTCGCT 15
GCCCgttaGGGCAGCTTGCCGGTGGTGttTTTTTA TI_as
AGCTTAACACCACCGGCAAGCTGCCCTAACGGGCAGCGACGTGAA 16
CAGCTAACGCTGTTCACCGGGGTGGTGGGG T1_long
GATCCCCCACCACCCCGGTGAACAGCTTGTAGGTGGCATCGCAGA 17
AGCGATGCCACCTACAAGCTGTTCACGTCGCTGCCCTTGTAGGTG
GCATCGCAGAAGCGATGCCACCTACAAGGGCAGCTTGCCGGTGGT GttTTTTTA T1_long_as
AGCTTAACACCACCGGCAAGCTGCCCTTGTAGGTGGCATCGCTTC 18
TGCGATGCCACCTACAAGGGCAGCGACGTGAACAGCTTGTAGGTG
GCATCGCTTCTGCGATGCCACCTACAAGCTGTTCACCGGGGTGGT GGGG TII
GATCCCCCGTGCTGCTTCATGTGGTCGTTgttaCGACCACAATGG 19
CGACAACCTTgttaGGTTGTCGGGCAGCAGCACGTTttTTTTTA TII_as
AGCTTAAAACGTGCTGCTGCCCGACAACCTAACAAGGTTGTCGCC 20
ATTGTGGTCGTAACAACGACCACATGAAGCAGCACGGGG TII_long
GATCCCCCGTGCTGCTTCATGTGGTCGTTGTAGGTGGCATCGCAG 21
AAGCGATGCCACCTACAACGACCACAATGGCGACAACCTTGTAGG
TGGCATCGCAGAAGCGATGCCACCTACAAGGTTGTCGGGCAGCAG CACGttTTTTTA
TII_long_as AGCTTAACGTGCTGCTGCCCGACAACCTTGTAGGTGGCATCGCTT 22
CTGCGATGCCACCTACAAGGTTGTCGCCATTGTGGTCGTTGTAGG
TGGCATCGCTTCTGCGATGCCACCTACAACGACCACATGAAGCAG CACGGGG shRNA
GATCCCCGCAAGCTGACCCTGAAGTTCTTCAAGAGAGAACTTCAG 23 GGTCAGCTTGCTTTTTA
shRNA_as AGCTTAAAAAGCAAGCTGACCCTGAAGTTCTOTCTTGAAGAACTT 24
CAGGGTCAGCTTGCGGG
[0187] To test the effects on GFP-expression, the annealed MV-siRNA
molecules (at a final concentration of 7.5 nM per well) and pSUPER
vectors containing the MV-siRNA clones or shRNA control were
transfected with Lipofectamine 2000 into 293 cells that
constitutively express GFP. GFP fluorescence was measure by flow
cytometry 24 hour after transfection.
[0188] The results for one experiment are shown in Table 3 below,
and summarized in FIG. 7A. In FIG. 7A, the MV-siRNA long I and long
II clones demonstrate significantly increased suppression of GFP
activity compared to the shRNA control (referred to in that Figure
as "siRNA").
TABLE-US-00003 TABLE 3 Well Transfected: Mean Fluorescence % GFP
Positive shRNA shRNA 330 66% shRNA 302 60% Synthetic: MV-siRNA 305
61% Clone: MV-siRNA short TI 360 72% MV-siRNA long TI 218 43%
MV-siRNA long TII 245 49% Negative Blank 502 100% non-GFP 293 cells
0.5 0%
[0189] FIG. 7B shows the results of an experiment in which the
synthetic MV-siRNA GFP I complex demonstrated increased suppression
of GFP activity compared to the shRNA clone (referred to in that
Figure as "siRNA"). However, the suppression activity for the
MV-siRNA GFP I complex was slightly reduced when one strand was
replaced with DNA, as shown for the synthetic MV-siRNA GFP I DNA
complex.
[0190] Exemplary synthetic MV-siRNAs directed to GFP can also be
designed as in Table 4 below, in which the 3 oligos of T1.A-C can
be annealed as described above. Similarly, the 3 oligos of T2.A-C
can be annealed as described above.
TABLE-US-00004 TABLE 4 Exemplary synhetic siRNA sets T1 and T2.
Name Sequence SEQ ID NO: T1.A CUGCUGGUAGUGGUCGGCGUU 25 T1.B
CGCCGACUUCGUGACGUGCUU 26 T1.C GCACGUCGCCGUCCAGCAGUU 27 T2.A
GUUGCCGUCGUCCUUGAAGUU 28 T2.B CUUCAAGUGGAACUACGGCUU 29 T2.C
GCCGUAGGUAGGCGGCAACUU 30
[0191] MV-siRNA clones directed to GFP can also be designed as in
Table 5 below. As illustrated above, these sequences can be cloned
into the pSuper vector, or any other vector system.
TABLE-US-00005 TABLE 5 Exemplary MV-siRNA clones Name Sequence SEQ
ID NO: T1_transcript CGCCGACUUCGUGACGUGCUUGUGCACGUCGCCGUCCAGCAG 31
UUGUCUGCUGGUAGUGGUCGGCGUU T1
GATCCCCCGCCGACTTCGTGACGTGCTTGTGCACGTCGCCGT 32
CCAGCAGTTGTCTGCTGGTAGTGGTCGGCGTTTTTTTA T1_as
AGCTTAAAAAAACGCCGACCACTACCAGCAGACAACTGCTGG 33
ACGGCGACGTGCACAAGCACGTCACGAAGTCGGCGGGG T1_long
CGCCGACUUCGUGACGUGCUUGUAGGUGGCAUCGCAGAAGCG 34 transcript
AUGCCACCUACAAGCACGUCGCCGUCCAGCAGUUGUAGGUGG
CAUCGCAGAAGCGAUGCCACCUACAACUGCUGGUAGUGGUCG GCGUU T1_long
GATCCCCCGCCGACTTCGTGACGTGCTTGTAGGTGGCATCGC 35
AGAAGCGATGCCACCTACAAGCACGTCGCCGTCCAGCAGTTG
TAGGTGGCATCGCAGAAGCGATGCCACCTACAACTGCTGGTA GTGGTCGGCGTTTTTA
T1_long_as AGCTTAAAAACGCCGACCACTACCAGCAGTTGTAGGTGGCAT 36
CGCTTCTGCGATGCCACCTACAACTGCTGGACGGCGACGTGC
TTGTAGGTGGCATCGCTTCTGCGATGCCACCTACAAGCACGT CACGAAGTCGGCGGGG
T2_transcript CUUCAAGUGGAACUACGGCUUGUGCCGUAGGUAGGCGGCAAC 37
UUGUGUUGCCGUCGUCCUUGAAGUU T2
GATCCCCGGATCCGACATCCACGTTCTTCAAGAGAGAACGTG 38 GATGTCGGATCCTTTTTA
T2_as AGCTTAAAAAGGATCCGACATCCACGTTCTCTCTTGAAGAAC 39
GTGGATGTCGGATCCGGG T2_long
CUUCAAGUGGAACUACGGCUUGUAGGUGGCAUCGCAGAAGCG 40 transcript
AUGCCACCUACAAGCCGUAGGUAGGCGGCAACUUGUAGGUGG
CAUCGCAGAAGCGAUGCCACCUACAAGUUGCCGUCGUCCUUG AAGUU T2_long
GATCCCCCTTCAAGTGGAACTACGGCTTGTAGGTGGCATCGC 41
AGAAGCGATGCCACCTACAAGCCGTAGGTAGGCGGCAACTTG
TAGGTGGCATCGCAGAAGCGATGCCACCTACAAGTTGCCGTC GTCCTTGAAGTTTTTA
T2_long_as AGCTTAAAAACTTCAAGGACGACGGCAACTTGTAGGTGGCAT 42
CGCTTCTGCGATGCCACCTACAAGTTGCCGCCTACCTACGGC
TTGTAGGTGGCATCGCTTCTGCGATGCCACCTACAAGCCGTA GTTCCACTTGAAGGGG
Example 2
Trivoid Anti-HIV
[0192] Multivalent-siRNA can be designed against multiple genes at
unrelated sites. In this example, a cloned MV-siRNA was tested
against HIV. These results show that a di-valent MV-siRNA molecule
against HIV's Gag and Tat (hv_sB) genes was significantly more
efficient in inhibiting HIV replication than an siRNA directed
against Gag alone (hv_s).
[0193] The oligos shown in Table 6 were cloned into pSUPER.neo+gfp
vector according to manufacturer's guidelines. The hv_s is targeted
to Gag only, and the hv_sB is targeted to both Gag and Tat.
TABLE-US-00006 TABLE 6 Anti-HIV MV-siRNA clones Name Sequence SEQ
ID NO: hv_s GATCCCCGTGAAGGGGAACCAAGAGATTgaTCTCTTGTTAATATCAG 43
CTTgaGCTGATATTTCTCCTTCACTTTTTA hv_s_as
AGCTTAAAAAGTGAAGGAGAAATATCAGCTCAAGCTGATATTAACAA 44
GAGATCAATCTCTTGGTTCCCCTTCACGGG hv_sB
GATCCCCCAAGCAGTTTTAGGCTGACgTTaGTCAGCCTCATTGACAC 45
AGgTTaCTGTGTCAGCTGCTGOTTGTTTTTTTA hv_sB_As
AGCTTAAAAAAACAAGCAGCAGCTGACACAGTAACCTGTGTCAATGA 46
GCCTGACTAACGTCAGCCTAAAACTGCTTGGGG
[0194] The vector constructs encoding the MV-siRNA clones were
transfected into cells, and the analyses were carried out on days
10 and 40 post infection with HIV-1 (pNL4.3 strain) with an MOI of
1.0. FIG. 9 shows that at 10 days post transfection, inhibition of
HIV replication by the MV-siRNA targeted to both Gag and Tat was
about 3 times greater than inhibition by the siRNA molecule
targeted only to Gag.
[0195] Multivalent-siRNA can be designed to target 1, 2, or 3
different genes of HIV. The sequence of an exemplary HIV genome is
provided in FIGS. 10A-D. A sequence of an env gene is provided in
FIG. 11, a gag gene in FIG. 12A, and a tat gene in FIG. 12B. The
various genes or regions of HIV can be generally defined and
targeted by their range of nucleotide sequence as follows: 5' LTR:
1-181; GAG: 336-1838; POL: 1631-4642; VIF: 4587/4662-5165; VPR:
5105-5395 (including mutations at 5157, 5266, and 5297); TAT:
5376-7966; REV: 5515-8195; VPU: 5607-5852; ENV: 5767-8337; NEF:
8339-8959; and 3' LTR: 8628-9263. Based on these target genes,
exemplary MV-RNA oligo sequences for HIV are provided in Table 7
below.
TABLE-US-00007 TABLE 7 Exemplary Trivalent MV-siRNA Sequences No.
Sequence Target Gene SEQ ID NO: 1 GCCUUCCCUUGUGGGAAGGUU 1649 47 2
CCUUCCCUUGUGGGAAGGCUU 1648 48 3 GCCUUCCUUGUGGGAAGGCUU 1648 49 4
UUCUGCACCUUACCUCUUAUU 6259 50 5 UAAGAGGAAGUAUGCUGUUUU 4062 51 6
AACAGCAGUUGUUGCAGAAUU 5291 52 7 CCAGACAAUAAUUGUCUGGUU 7387 53 8
CCAGACAAUAAUUGUCUGGUU 7387 53 9 CCAGACAAUAAUUGUCUGGUU 7387 53 10
CUCCCAGGCUCAGAUCUGGUU 16 54 11 CCAGAUCUUCCCUAAAAAAUU 1630 55 12
UUUUUUAUCUGCCUGGGAGUU 7011 56 13 UGGGUUCCCUAGUUAGCCAUU 40 57 14
UGGCUAAGAUCUACAGCUGUU 8585 58 15 CAGCUGUCCCAAGAACCCAUU 7325 59 16
AUCCUUUGAUGCACACAAUUU 591 60 17 AUUGUGUCACUUCCUUCAGUU 6988 61 18
CUGAAGGAAGCUAAAGGAUUU 1785 62 19 UCCUGUGUCAGCUGCUGCUUU 685 63 20
AGCAGCAUUGUUAGCUGCUUU 8481 64 21 AGCAGCUUUAUACACAGGAUU 9046 65 22
ACCAACAAGGUUUCUGUCAUU 1284 66 23 UGACAGAUCUAAUUACUACUU 6573 67 24
GUAGUAAUUAUCUGUUGGUUU 6311 68 25 CUGAGGGAAGCUAAAGGAUUU 1785 69 26
AUCCUUUGAUGCACACAAUUU 591 60 27 AUUGUGUCACUUCCCUCAGUU 6988 232 28
CAAAGCUAGAUGAAUUGCUUU 3534 70 29 AGCAAUUGGUACAAGCAGUUU 5432 71 30
ACUGCUUGUUAGAGCUUUGUU 2952 72 31 AGGUCAGGGUCUACUUGUGUU 4872 73 32
CACAAGUGCUGAUAUUUCUUU 5779 74 33 AGAAAUAAUUGUCUGACCUUU 7384 75 34
CUAAGUUAUGGAGCCAUAUUU 5212 76 35 AUAUGGCCUGAUGUACCAUUU 758 77 36
AUGGUACUUCUGAACUUAGUU 4736 78 37 UGGCUCCAUUUCUUGCUCUUU 5365 79 38
AGAGCAACCCCAAAUCCCCUU 7544 80 39 GGGGAUUUAGGGGGAGCCAUU 4191 81 40
AUCUCCACAAGUGCUGAUAUU 5784 82 41 UAUCAGCAGUUCUUGAAGUUU 8942 83 42
ACUUCAAAUUGUUGGAGAUUU 8158 84 43 AGACUGUGACCCACAAUUUUU 5862 85 44
AAAUUGUGGAUGAAUACUGUU 4310 86 45 CAGUAUUUGUCUACAGUCUUU 499 87 46
ACAGGCCUGUGUAAUGACUUU 6362 88 47 AGUCAUUGGUCUUAAAGGUUU 8559 89 48
ACCUUUAGGACAGGCCUGUUU 6371 90 49 UCAGUGUUAUUUGACCCUUUU 6973 91 50
AAGGGUCUGAGGGAUCUCUUU 135 92 51 AGAGAUCUUUCCACACUGAUU 158 93 52
CAUAGUGCUUCCUGCUGCUUU 7337 94 53 AGCAGCAUUGUUAGCUGCUUU 8481 95 54
AGCAGCUAACAGCACUAUGUU 8190 96 55 GCUGCUUAUAUGCAGGAUCUU 9044 97 56
GAUCCUGUCUGAAGGGAUGUU 531 98 57 CAUCCCUGUUAAAAGCAGCUU 7118 99 58
UGGUCUAACCAGAGAGACCUU 9081 100 59 GGUCUCUUUUAACAUUUGCUU 928 101 60
GCAAAUGUUUUCUAGACCAUU 7557 102 61 CUCCCAGGCUCAGAUCUGGUU 9097 103 62
CCAGAUCUUCCCUAAAAAAUU 1630 55 63 UUUUUUAUCUGCCUGGGAGUU 7011 56 64
UGGGUUCCCUAGUUAGCCAUU 9121 104 65 UGGCUAAGAUCUACAGCUGUU 8585 58 66
CAGCUGUCCCAAGAACCCAUU 7325 59
[0196] To Make MV-siRNA complexes targeted to HIV from the
sequences in Table 7 above, the individual oligos can be combined
and annealed as follows.
1) MV-siRNA_1649/1648/1648; Anneal sequences 1 & 2, and 3. 2)
MV-siRNA_6259/4062/5291; Anneal sequences 4 & 5, and 6. 3)
MV-siRNA_7387/7387/7387; Anneal sequences 7 & 8, and 9. 4)
MV-siRNA_16/1630/7011; Anneal sequences 10 & 11, and 12. 5)
MV-siRNA_40/8585/7325; Anneal sequences 13 & 14, and 15. 6)
MV-siRNA_591/6988/1785; Anneal sequences 16 & 17, and 18. 7)
MV-siRNA_685/8481/9046; Anneal sequences 19 & 20, and 21. 8)
MV-siRNA_1284/6573/6311; Anneal sequences 21 & 22, and 23. 9)
MV-siRNA_1785/591/6988; Anneal sequences 24 & 25, and 26. 10)
MV-siRNA_3534/5432/2952; Anneal sequences 27 & 28, and 29. 11)
MV-siRNA_4872/5779/7384; Anneal sequences 30 & 31, and 32. 12)
MV-siRNA_5212/758/4736; Anneal sequences 33 & 34, and 35. 13)
MV-siRNA_5365/7544/4191; Anneal sequences 36 & 37, and 38. 14)
MV-siRNA_5784/8942/8158; Anneal sequences 39 & 40, and 41. 15)
MV-siRNA_5862/4310/499; Anneal sequences 42 & 43, and 44. 16)
MV-siRNA_6362/8559/6371; Anneal sequences 45 & 46, and 47. 17)
MV-siRNA_6973/135/158; Anneal sequences 48 & 49, and 50. 18)
MV-siRNA_7337/8481/8190; Anneal sequences 51 & 52, and 53. 19)
MV-siRNA_9044/531/7118; Anneal sequences 54 & 55, and 56. 20)
MV-siRNA_9081/928/7557; Anneal sequences 57 & 58, and 59. 21)
MV-siRNA_9097/1630/7011; Anneal sequences 60 & 61, and 62. 22)
MV-siRNA.sub_9121/8585/7325; Anneal sequences 63 & 64, and
65.
Example 3
Trivoid Anti-apoB
[0197] Multivalent siRNA can be designed to suppress large genes by
targeting in 2-3 locations on a single gene. The MV-siRNA can also
employ alternative RNA chemistries to enhance the Tm during
annealing. In this example, as shown in Table 8 below, a series of
MV-siRNA are designed to target the apolipoprotein B (ApoB) gene,
and the presence of optional 2'-O methyl RNA subunits is indicated
within parenthesis.
TABLE-US-00008 TABLE 8 Trivalent MV-siRNA to ApoB SEQ No. Sequence
Target Gene ID NO: 1 (UGGAACU)UUCAGCUUCAUAUU ApoB @ 268 105 2
(UAUGAAG)GCACCAUGAUGUUU ApoB @ 9905 106 3 (ACAUCAU)CUUCC(AGUUCCA)UU
ApoB @ 1703 107 4 (ACUCUUC)AGAGUUCUUGGUUU ApoB @ 448 108 5
(ACCAAGA)CCUUGGAGACACUU ApoB @ 2288 109 6 (GUGUCUC)AGUUG(GAAGAGU)UU
ApoB @ 6609 110 7 (ACCUGGA)CAUGGCAGCUGCUU ApoB @ 469 111 8
(GCAGCUG)CAAACUCUUCAGUU ApoB @ 458 112 9 (CUGAAGA)CGUAU(UCCAGGU)UU
ApoB @ 113 12263 10 (CAGGGUA)AAGAACAAUUUGUU ApoB @ 520 114 11
(CAAAUUG)CUGUAGACAUUUUU ApoB @ 4182 115 12
(AAAUGUC)CAGCG(UACCCUG)UU ApoB @ 116 12548 13
(CCCUGGA)CACCGCUGGAACUUUU ApoB @ 279 117 14
(AAGUUCC)AAUAACUUUUCCAUUU ApoB @ 9161 118 15
(AUGGAAA)AGGCAAG(UCCAGGG)UU ApoB @ 9968 119 16
(CCCUGGA)CACCGCUGGAACUUUUU ApoB @ 278 120 17
(AAAGUUC)CAAUAACUUUUCCAUUU ApoB @ 9161 121 18
(AUGGAAA)AUGGCAAG(UCCAGGG)UU ApoB @ 9968 122
[0198] To make synthetic MV-siRNA trivalent complexes from the
sequences in Table 8 above, the individual oligos can be combined
and annealed as follows.
1) MV-siRNA_268/9950/1703; Anneal sequences 1 & 2, and then 3.
2) MV-siRNA_448/2288/6609; Anneal sequences 4 & 5, and then 6.
3) MV-siRNA_469/458/12263; Anneal sequences 7 & 8, and then 9.
4) MV-siRNA_520/4182/12548; Anneal sequences 10 & 11, and then
12. 5) MV-siRNA_279/9161/9986; Anneal sequences 13 & 14, and
then 15. 6) MV-siRNA_278/9161/9986; Anneal sequences 16 & 17,
and then 18.
[0199] Multivalent siRNA that are designed with potent primary and
secondary strands can also employ wobble or universal bases to
complete target complimentarity, or blunt ended DNA to deactivate
the strand from silencing any target. Exemplary oligos directed to
ApoB are shown in Table 9 below, in which (*) indicates an optional
wobble or universal base.
TABLE-US-00009 TABLE 9 Exemplary Bivalent MV-siRNA to ApoB No.
Sequence Target Gene SEQ ID NO: 19 UGAAUCGAGUUGCAUCUUUUU ApoB @ 223
123 20 AAAGAUGCUGCUCAUCACAUU ApoB @ 883 124 21
UGUGAUGACACUCGAUUCAUU ApoB @ 10116 (G/A pairs) 125 22
U*UGAU*ACACUCGAUUCAUU ApoB @ 10116 (univ. base) 126 23
TGTGATGACACTCGATTCA null @ 10166 127 24 CAGCUUGAGUUCGUACCUGUU ApoB
@ 483 128 25 CAGGUACAGAGAACUCCAAUU ApoB @ 11596 129 26
UUGGAGUCUGACCAAGCUGUU ApoB @ 2454 130 27 UUGGAGUCUGAC*AAGCU*UU ApoB
@ 2454 131 28 TTGGAGTCTGACCAAGCTG null @ 2454 132
[0200] To make synthetic MV-siRNA bivalent complexes from the
sequences in Table 9 above, the individual oligos can be combined
and annealed as follows.
7a) MV-siRNA_223/883/10116); Anneal sequences 19, 20, and 21. 7b)
MV-siRNA_223/883/10116*); Anneal sequences 19, 20, and 22. 7c)
MV-siRNA_223/883/null); Anneal sequences 19, 20, and 23. 8a)
MV-siRNA_483/11596/2454); Anneal sequences 24, 25, and 26. 8b)
MV-siRNA_483/11596/2454*); Anneal sequences 24, 25, and 26. 8c)
MV-siRNA_483/11596/null); Anneal sequences 24, 25, and 26.
[0201] Multivalent-siRNAs can also be designed to suppress large
genes by targeting 2-3 locations on a single gene. As noted, above,
certain embodiments of the instant MV-siRNAs can also employ
alternative RNA chemistries to enhance the Tm during annealing. In
Table 10 below, optional 2'-O methyl RNA 2'-fluoro bases are
indicated within parenthesis. Among other examples of alternate
bases, 5-methyl can also increase Tm of MV-siRNA structure, if
desired.
TABLE-US-00010 TABLE 10 Exemplary Trivalent MV-siRNA to ApoB No.
Sequence Target Gene SEQ ID NO: 1 UGG(AA)CUUUCAGCUUCAUAUU ApoB @
268 105 2 U(AU)GAAGGCACCAUGAUGUUU ApoB @ 9905 106 3
(ACAUCAU)CUUCCAGUUCCAUU ApoB @ 1703 107 4 AC(U)CUUCAGAGUUCUUGGUUU
ApoB @ 448 108 5 (ACCAAGA)CCUUGGAGACACUU ApoB @ 2288 109 6
G(U)GUCUCAGUUGGAAGAGUUU ApoB @ 6609 110 7 (ACCUGGA)CAUGGCAGCUGCUU
ApoB @ 469 111 8 GC(A)GCUGCAAACUCUUCAGUU ApoB @ 458 112 9
(CUGAAGA)CGUAU(UCCAGGU)UU ApoB @ 12263 113 10
(CAGGGUA)AAGAACAAUUUGUU ApoB @ 520 114 11 (CAAAUU)GCUGUAGACA(UUU)UU
ApoB @ 4182 115 12 (AAAUGUC)CAGCGUACCCUGUU ApoB @ 12548 116 13
(CCCUGGA)CACCGCUGGAACUUUU ApoB @ 279 117 14
(AAGUUCC)AAUAACUUUUCCAUUU ApoB @ 9161 118 15
(AU)GGAAAAGGCAAG(UCCAGGG)UU ApoB @ 9968 119 16
CCC(U)GGACACCGCUGG(AACUUU)UU ApoB @ 278 120 17
(AAA)GUUCCAAUAACUU(UU)CC(AU)UU ApoB @ 9161 121 18
(AUGGAAA)AUGGCAAG(UCCAGGG)UU ApoB @ 9968 122 19
UCAGGGCCGCUCUGUAUUUUU ApoB @ 6427 133 20 AAAUACAUUUCUGGAAGAGUU ApoB
@ 8144 134 21 CUCUUCCAAAAAGCCCUGAUU ApoB @ 12831 135 22
AAAUACAUUUCUGGAAGAGuu&CUCUUCCAAAAA Linker construct for 136
GCCCUGAuu&UCAGGGCCGCUCUGUAUUUuu cleavage after annealing.
"&" = PC Spacer, or linkage phosphoramidite
[0202] To make synthetic MV-siRNA bivalent complexes from the
sequences in Table 10 above, the individual oligos can be combined
and annealed as follows.
1) MV-siRNA_268/9950/1703; Anneal sequences 1 & 2, and then 3.
2) MV-siRNA_448/2288/6609; Anneal sequences 4 & 5, and then 6.
3) MV-siRNA_469/458/12263; Anneal sequences 7 & 8, and then 9.
4) MV-siRNA_520/4182/12548; Anneal sequences 10 & 11, and then
12. 5) MV-siRNA_279/9161/9986; Anneal sequences 13 & 14, and
then 15. 6) MV-siRNA_278/9161/9986; Anneal sequences 16 & 17,
and then 18. 7) MV-siRNA_6427/8144/12831; Anneal sequences 19 &
20, and then 21. 7b) MV-siRNA_6427/8144/12831; Anneal strand 22,
then cleave linkage phosphate with ammonium hydroxide. 7b)
MV-siRNA_6427/8144/12831; Anneal strand 22, then cleave PC Spacer
with UV light in the 300-350 nm spectral range.
[0203] In certain embodiments, multivalent-siRNA that are designed
with potent primary and secondary strands can employ wobble,
spacer, or abasic base types (examples are indicated by (*) in
Table 11 below) to complete target compliments, or blunt ended DNA
to deactivate the strand from silencing any target. In some
embodiments, UNA, linker phosphoramidites, rSpacer, 5-nitroindole
can act as effective abasic bases in place of mismatched
nucleotides. If desired, the use of abasic bases can result in
weakened Tm, and/or pyrimidines surrounding an abasic site can
utilize 2'-fluoro bases to increase Tm by about 2 degrees for every
2'-fluoro base.
TABLE-US-00011 TABLE 11 Exemplary MV-siRNA Targeted to ApoB No.
Sequence Target Gene SEQ ID NO: 23 UGAAUCGAGUUGCAUCUUUUU ApoB @ 223
123 24 AAAGAUGCUGCUCAUCACAUU ApoB @ 883 124 25
UGUGAUGACACUCGAUUCAUU ApoB @ 10116 (G/A pairs) 125 26
U*UGAU*ACACUGAUUCAUU ApoB @ 10116 (* rSPACER base) 126 27
TGTGATGACACTCGATTCA null @ 10116 127 28 CAGCUUGAGUUCGUACCUGUU ApoB
@ 483 128 29 CAGGUACAGAGAACUCCAAUU ApoB @ 11596 129 30
UUGGAGUCUGACCAAGCUGUU ApoB @ 2454 130 31 UUGGAGUCUGAC*AAGCU*UU ApoB
@ 2454 (* abasic base) 131 32 TTGGAGTCTGACCAAGCTG null @ 2454 132
33 AACCCACUUUCAAAUUUCCUU ApoB @ 9244 137 34 GGAAAUUGAGAAUUCUCCAUU
ApoB @ 1958 138 35 UGGAGAAUCUCAGUGGGUUUU ApoB @ 8005 139 36
rUrGrGfA-fArArUrCrUrCrA-fUrGrGrG-fUrUrU ApoB @ 8005 140 37
GAUGAUGAAACAGUGGGUUUU ApoB @ 10439 141 38 AACCCACUUUCAAAUUUCCUU
ApoB @ 9244 137 39 GGAAAUUGGAGACAUCAUCUU ApoB @ 2284 142 40
-rGfAfAfArUrUrGrGrArGrArCfA-rCfArUrCrUrU ApoB @ 2284 143 41
GCAAACUCUUCAGAGUUCUUU ApoB @ 452 144 42 AGAACUCCAAGGGUGGGAUUU ApoB
@ 11588 145 43 AUCCCACUUUCAAGUUUGCUU ApoB @ 9244 146 44
fA-rCrCrCrArCrUrUrUrCrAfA-fUrUrU-rC ApoB @ 9244 147
[0204] To make synthetic MV-siRNA bivalent complexes from the
sequences in Table 11 above, the individual oligos can be combined
and annealed as follows.
7a) MV-siRNA_223/883/10116); Anneal sequences 23, 24, and 25. 7b)
MV-siRNA_223/883/10116*); Anneal sequences 23, 24, and 26. 7c)
MV-siRNA_223/883/null); Anneal sequences 23, 24, and 27. 8a)
MV-siRNA_483/11596/2454); Anneal sequences 28, 29, and 30. 8b)
MV-siRNA_483/11596/2454*); Anneal sequences 28, 29, and 31. 8c)
MV-siRNA_483/11596/null); Anneal sequences 28, 29, and 32. 9)
MV-siRNA_9244/1958/8005); Anneal sequences 33, 34, and 35. 9b)
MV-siRNA_9244/1958/8005); Anneal sequences 33, 34, and 36. 10)
MV-siRNA_10439/9244/2284); Anneal sequences 37, 38, and 39. 10b)
MV-siRNA_10439/9244/2284); Anneal sequences 37, 38, and 40. 11)
MV-siRNA_452/11588/9244); Anneal sequences 41, 42, and 43. 11b)
MV-siRNA_452/11588/9244); Anneal sequences 41, 42, and 44.
[0205] As exemplified in Table 12 below, multivalent siRNA can be
targeted against human ApoB. Bivalent MV-siRNA can function with
various tolerances to structure and target complementarity of each
strand
TABLE-US-00012 TABLE 12 Exemplary Multivalent-siRNA Targeted to
Human ApoB ApoB Gene SEQ No. Sequence site ID NO: 1
CUUCAUCACUGAGGCCUCUUU 1192 148 2 AGAGGCCAAGCUCUGCAUUUU 5140 149 3
AAUGCAGAUGAAGAUGAAGAA 10229 150 4 UUCAGCCUGCAUGUUGGCUUU 2724 151 5
AGCCAACUAUACUUGGAUCUU 13294 152 6 GAUCCAAAAGCAGGCUGAAGA 4960 153 7
CCCUCAUCUGAGAAUCUGGUU 8927 154 8 CCAGAUUCAUAAACCAAGUUU 9044 155 9
ACUUGGUGGCCCAUGAGGGUU 3440 156 10 UCAAGAAUUCCUUCAAGCCUU 9595 157 11
GGCUUGAAGCGAUCACACUUU 758 158 12 AGUGUGAACGUAUUCUUGAUU 4367 159 13
UUGCAGUUGAUCCUGGUGGUU 344 160 14 CCACCAGGUAGGUGACCACUU 1354 161 15
GUGGUCAGGAGAACUGCAAUU 2483 162 16 CCUCCAGCUCAACCUUGCAUU 358 163 17
UGCAAGGUCUCAAAAAAUGUU 6341 164 18 CAUUUUUGAUCUCUGGAGGUU 4043 165 19
CAGGAUGUAAGUAGGUUCAUU 570 166 20 UGAACCUUAGCAACAGUGUUU 5687 167 21
ACACUGUGCCCACAUCCUGUU 9109 168 22 GGCUUGAAGCGAUCACACUUU 758 169 23
AGUGUGAACGUAUUCUUGUUU 4367 170 24 ACAAGAAUUCCUUCAAGCCUU 9595 171 25
UGAAGAGAUUAGCUCUCUGUU 1153 172 26 CAGAGAGGCCAAGCUCUGCUU 5143 173 27
GCAGAGCUGGCUCUCUUCAUU 10304 174 28 CUCAGUAACCAGCUUAUUGUU 1170 175
29 CAAUAAGAUUUAUAACAAAUU 7084 176 30 UUUGUUAUCUUAUACUGAGUU 9650 177
31 GAACCAAGGCUUGUAAAGUUU 1258 178 32 ACUUUACAAAAGCAACAAUUU 6286 179
33 AUUGUUGUUAAAUUGGUUCUU 6078 180 34 CAGGUAGGUGACCACAUCUUU 1350 181
35 AGAUGUGACUGCUUCAUCAUU 1203 182 36 UGAUGAACUGCGCUACCUGUU 8486 183
37 CCAGUCGCUUAUCUCCCGGUU 1786 184 38 CCGGGAGCAAUGACUCCAGUU 2678 185
39 CUGGAGUCAUGGCGACUGGUU 2486 186 40 UGGAAGAGAAACAGAUUUGUU 2046 187
41 CAAAUCUUUAAUCAGCUUCUU 2403 188 42 GAAGCUGCCUCUUCUUCCAUU 12299
189 43 AUCCAAAGGCAGUGAGGGUUU 2152 190 44 ACCCUCAACUCAGUUUUGAUU
12242 191 45 UCAAAACCGGAAUUUGGAUUU 3316 192 46
UAGAGACACCAUCAGGAACUU 2302 193 47 GUUCCUGGAGAGUCUUCAAUU 1102 194 48
UUGAAGAAUUAGGUCUCUAUU 1153 195 49 GCUCAUGUUUAUCAUCUUUUU 2350 196 50
AAAGAUGCUGAACUUAAAGUU 7622 197 51 CUUUAAGGGCAACAUGAGCUU 2863 198 52
GGAGCAAUGACUCCAGAUGUU 2675 199 53 CAUCUGGGGGAUCCCCUGCUU 2544 200 54
GCAGGGGAGGUGUUGCUCCUU 912 201 55 UCACAAACUCCACAGACACUU 2761 202 56
GUGUCUGCUUUAUAGCUUGUU 5672 203 57 CAAGCUAAAGGAUUUGUGAUU 9683 204 58
GCAGCUUGACUGGUCUCUUUU 2914 205 59 AAGAGACUCUGAACUGCCCUU 4588 206 60
GGGCAGUGAUGGAAGCUGCUU 8494 207 61 CAGGACUGCCUGUUCUCAAUU 2996 208 62
UUGAGAACUUCUAAUUUGGUU 8522 209 63 CCAAAUUUGAAAAGUCCUGUU 9855 210 64
UGUAGGCCUCAGUUCCAGCUU 3132 211 65 GCUGGAAUUCUGGUAUGUGUU 8335 212 66
CACAUACCGAAUGCCUACAUU 9926 213 67 GACUUCACUGGACAAGGUCUU 3300 214 68
GACCUUGAAGUUGAAAAUGUU 5301 215 69 CAUUUUCUGCACUGAAGUCUU 11983 216
70 AAGCAGUUUGGCAGGCGACUU 3549 217 71 GUCGCCUUGUGAGCACCACUU 5039 218
72 GUGGUGCCACUGACUGCUUUU 12521 219 73 CAGAUGAGUCCAUUUGGAGUU 3568
220 74 CUCCAAACAGUGCCAUGCCUU 9142 221 75 GGCAUGGAGCCUUCAUCUGUU 3256
222 76 CACAGACUUGAAGUGGAGGUU 4086 223 77 CCUCCACUGAGCAGCUUGAUU 2924
224 78 UCAAGCUUCAAAGUCUGUGUU 974 225 79 AUGGCAGAUGGAAUCCCACUU 4102
226 80 GUGGGAUCACCUCCGUUUUUU 2971 227 81 AAAACGGUUUCUCUGCCAUUU
12836 228 82 UGAUACAACUUGGGAAUGGUU 4148 229 83
CCAUUCCCUAUGUCAGCAUUU 2971 230 84 AUGCUGACAAAUUGUAUCAUU 12836
231
[0206] To make synthetic MV-siRNA bivalent complexes from the
sequences in Table 12 above, the individual oligos can be combined
and annealed as follows. MV-siRNA; Anneal sequences 1, 2, and 3.
MV-siRNA; Anneal sequences 4, 5, and 6. MV-siRNA; Anneal sequences
7, 8, and 9. MV-siRNA; Anneal sequences 10, 11, and 12. MV-siRNA;
Anneal sequences 13, 14, and 15. MV-siRNA; Anneal sequences 16, 17,
and 18. MV-siRNA; Anneal sequences 19, 20, and 21. MV-siRNA; Anneal
sequences 22, 23, and 24. MV-siRNA; Anneal sequences 25, 26, and
27. MV-siRNA; Anneal sequences 28, 29, and 30. MV-siRNA; Anneal
sequences 31, 32, and 33. MV-siRNA; Anneal sequences 34, 35, and
36. MV-siRNA; Anneal sequences 37, 38, and 39. MV-siRNA; Anneal
sequences 40, 41, and 42. MV-siRNA; Anneal sequences 43, 44, and
45. MV-siRNA; Anneal sequences 46, 47, and 48. MV-siRNA; Anneal
sequences 49, 50, and 51. MV-siRNA; Anneal sequences 52, 53, and
54. MV-siRNA; Anneal sequences 55, 56, and 57. MV-siRNA; Anneal
sequences 58, 59, and 60. MV-siRNA; Anneal sequences 61, 62, and
63. MV-siRNA; Anneal sequences 64, 65 and 66. MV-siRNA; Anneal
sequences 67, 68, and 69. MV-siRNA; Anneal sequences 70, 71, and
72. MV-siRNA; Anneal sequences 73, 74, and 75. MV-siRNA; Anneal
sequences 76, 77, and 78. MV-siRNA; Anneal sequences 79, 80, and
81. MV-siRNA; Anneal sequences 82, 83, and 84.
[0207] MV-siRNA directed to ApoB can be used to treat or manage a
wide variety of diseases or conditions associated with the
expression of that target protein, as described herein and known in
the art.
REFERENCES
[0208] 1. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A.,
Driver, S. E., and Mello, C. C. (1998) Potent and specific genetic
interference by double stranded RNA in Caenorhabditis elegans.
Nature. 408, 325-330. [0209] 2. Kennerdell, J. R., and Carthew, R.
W. (1998) Use of dsRNA-mediated genetic interference to demonstrate
that frizzled and frizzled 2 act in the wingless pathway. Cell. 95,
1017-1026. [0210] 3. Misquitta, L., and Paterson, B. M. (1999)
Targeted disruption of gene function in Drosophila by RNA
interference (RNA-i): a role for nautilus in embryonic somatic
muscle formation. Proc. Natl. Acad. Sci. USA. 96, 1451-1456. [0211]
4. Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J.
(2000) An RNA-directed nuclease mediates post transcriptional gene
silencing in Drosophila cells. Nature. 404, 293-296. [0212] 5.
Lohmann, J. U., Endl, I., and Bosch, T. C. (1999) Silencing of
developmental genes in Hydra. Dev. Biol. 214, 211-214. [0213] 6.
Wargelius, A., Ellingsen, S., and Fjose, A. (1999) Double stranded
RNA induces specific developmental defects in zebrafish embyos.
Biochem. Biophys. Res. Commun. 263, 156-161. [0214] 7. Ngo, H.,
Tschudi, C., Gull, K., and Ullu, E. (1998) Double stranded RNA
induces gene degradation in Trypanosoma brucei. Proc. Natl. Acad.
Sci. USA. 95, 14687-14692. [0215] 8. Montgomery, M. K., Xu, S.,
Fire, A. (1998) RNA as a target of double stranded RNA mediated
genetic interference in Caenorhabiditis elegans. Proc. Natl. Acad.
Sci. USA. 95, 15502-15507. [0216] 9. Bosher, J. M., Dufourcq, P.,
Sookhareea, S., Labouesse, M. (1999) RNA interference can target
pre-gene. Consequences for gene expression in Caenorhabiditis
elegans operon. Genetics. 153, 1245-1256. [0217] 10. Fire, A.
(1999) RNA-triggered gene silencing. Trends Genet. 15, 358-363.
[0218] 11. Sharp, P. A. (1999) RNAi and double-stranded RNA. Genes
Dev. 13, 139-141. [0219] 12. Ketting, R. F., Harerkamp, T. H., van
Luenen, H. G., and Plasterk, R. H. (1999) Mut-7 of C. elegans,
required for transposon silencing and RNA interference, is a
homolog of Werner syndrome helicase and RNase I. Cell. 99, 133-141.
[0220] 13. Tabara, H., Sarkissian, M., Kelly, W. G., Fleenor, J.,
Grishok, A., Timmons, L., Fire, A., and Mello, C. C. (1999) The
rde-1 gene, RNA interference, and transposon silencing in C.
elegans. Cell. 99, 123-132. [0221] 14. Zamore, P. D., Tuschl, T.,
Sharp, P. A., and Bartel, D. P. (2000) RNAi: Double stranded RNA
directs the ATP dependent cleavage of gene at 21 to 23 nucleotide
intervals. Cell. 101, 25-33. [0222] 15. Bernstein, E., Caudy, A.
A., Hammond, S. M., and Hannon, G. J. (2001) Role for a bidentate
ribonuclease in the initiation step of RNA interference. Nature.
409, 363-366. [0223] 16. Elbashir, S., Lendeckel, W., and Tuschl,
T. (2001) RNA interference is mediated by 21 and 22 nucleotide
RNAs. Genes and Dev. 15, 188-200. [0224] 17. Sharp, P. A. (2001)
RNA interference 2001. Genes and Dev. 15, 485-490. [0225] 18.
Hunter, T., Hunt, T., and Jackson, R. J. (1975) The characteristics
of inhibition of protein synthesis by double-stranded ribonucleic
acid in reticulocyte lysates. J. Biol. Chem. 250, 409-417. [0226]
19. Bass, B. L. (2001) The short answer. Nature. 411, 428-429.
[0227] 20. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin,
A., Weber, K., and Tuschl, T. (2001) Duplexes of 21-nucleotide RNAs
mediate RNA interference in cultured mammalian cells. Nature. 411,
494-498. [0228] 21. Carson, P. E. and Frischer, H. (1966)
Glucose-6-Phosphate dehydrogenase deficiency and related disorders
of the pentose phosphate pathway. Am J Med. 41, 744-764. [0229] 22.
Stamato, T. D., Mackenzie, L., Pagani, J. M., and Weinstein, R.
(1982) Mutagen treatment of single Chinese Hamster Ovary cells
produce colonies mosaic for Glucose-6-phosphate dehydrogenase
activity. Somatic Cell Genetics. 8, 643-651. [0230] 23. Genetic
characterization of methicillin-resistant Staphylococcus aureus
Vaccine. 2004, Dec. 6; 22 Suppl 1:S5-8. [Hiramatsu K, Watanabe S,
Takeuchi F, Ito T, and Baba T]. [0231] 24. A novel family of RNA
tetraloop structure forms the recognition site for Saccharomyces
cerevisiae RNase III. [EMBO J. 2001]. [0232] 25. Solution structure
of conserved AGNN tetraloops: insights into RNase IIIp RNA
processing. [EMBO J. 2001]. [0233] 26. ReviewThe RNase III family:
a conserved structure and expanding functions in eukaryotic dsRNA
metabolism. [Curr Issues Mol Biol. 2001] [0234] 27. Sequence
dependence of substrate recognition and cleavage by yeast RNase
III. [J Mol Biol. 2003] [0235] 28. Noncatalytic assembly of
ribonuclease III with double-stranded RNA. [Structure. 2004] [0236]
29. Intermediate states of ribonuclease III in complex with
double-stranded RNA. [Structure. 2005] [0237] 30. ReviewStructural
basis for non-catalytic and catalytic activities of ribonuclease
III. [Acta Crystallogr D Biol Crystallogr. 2006] [0238] 31.
ReviewRibonuclease revisited: structural insights into ribonuclease
III family enzymes. [Curr Opin Struct Biol. 2007] [0239] 32. Short
RNA guides cleavage by eukaryotic RNase III. [PLoS ONE. 2007 May
30; 2(5):e472.] [0240] 33. A stepwise model for double-stranded RNA
processing by ribonuclease III. [Mol Microbiol. 2008] [0241] 34.
Review: The mechanism of RNase III action: how dicer dices. [Curr
Top Microbiol Immunol. 2008]
Sequence CWU 1
1
232114119RNAHomo sapiens 1ucccaccggg accugcgggg cugagugccc
uucucgguug cugccgcuga ggagcccgcc 60cagccagcca gggccgcgag gccgaggcca
ggccgcagcc caggagccgc cccaccgcag 120cuggcgaugg acccgccgag
gcccgcgcug cuggcgcugc uggcgcugcc ugcgcugcug 180cugcugcugc
uggcgggcgc cagggccgaa gaggaaaugc uggaaaaugu cagccugguc
240uguccaaaag augcgacccg auucaagcac cuccggaagu acacauacaa
cuaugaggcu 300gagaguucca guggaguccc ugggacugcu gauucaagaa
gugccaccag gaucaacugc 360aagguugagc uggagguucc ccagcucugc
agcuucaucc ugaagaccag ccagugcacc 420cugaaagagg uguauggcuu
caacccugag ggcaaagccu ugcugaagaa aaccaagaac 480ucugaggagu
uugcugcagc cauguccagg uaugagcuca agcuggccau uccagaaggg
540aagcagguuu uccuuuaccc ggagaaagau gaaccuacuu acauccugaa
caucaagagg 600ggcaucauuu cugcccuccu gguuccccca gagacagaag
aagccaagca aguguuguuu 660cuggauaccg uguauggaaa cugcuccacu
cacuuuaccg ucaagacgag gaagggcaau 720guggcaacag aaauauccac
ugaaagagac cuggggcagu gugaucgcuu caagcccauc 780cgcacaggca
ucagcccacu ugcucucauc aaaggcauga cccgccccuu gucaacucug
840aucagcagca gccaguccug ucaguacaca cuggacgcua agaggaagca
uguggcagaa 900gccaucugca aggagcaaca ccucuuccug ccuuucuccu
acaacaauaa guaugggaug 960guagcacaag ugacacagac uuugaaacuu
gaagacacac caaagaucaa cagccgcuuc 1020uuuggugaag guacuaagaa
gaugggccuc gcauuugaga gcaccaaauc cacaucaccu 1080ccaaagcagg
ccgaagcugu uuugaagacu cuccaggaac ugaaaaaacu aaccaucucu
1140gagcaaaaua uccagagagc uaaucucuuc aauaagcugg uuacugagcu
gagaggccuc 1200agugaugaag cagucacauc ucucuugcca cagcugauug
agguguccag ccccaucacu 1260uuacaagccu ugguucagug uggacagccu
cagugcucca cucacauccu ccaguggcug 1320aaacgugugc augccaaccc
ccuucugaua gaugugguca ccuaccuggu ggcccugauc 1380cccgagcccu
cagcacagca gcugcgagag aucuucaaca uggcgaggga ucagcgcagc
1440cgagccaccu uguaugcgcu gagccacgcg gucaacaacu aucauaagac
aaacccuaca 1500gggacccagg agcugcugga cauugcuaau uaccugaugg
aacagauuca agaugacugc 1560acuggggaug aagauuacac cuauuugauu
cugcggguca uuggaaauau gggccaaacc 1620auggagcagu uaacuccaga
acucaagucu ucaauccuca aaugugucca aaguacaaag 1680ccaucacuga
ugauccagaa agcugccauc caggcucugc ggaaaaugga gccuaaagac
1740aaggaccagg agguucuucu ucagacuuuc cuugaugaug cuucuccggg
agauaagcga 1800cuggcugccu aucuuauguu gaugaggagu ccuucacagg
cagauauuaa caaaauuguc 1860caaauucuac caugggaaca gaaugagcaa
gugaagaacu uuguggcuuc ccauauugcc 1920aauaucuuga acucagaaga
auuggauauc caagaucuga aaaaguuagu gaaagaagcu 1980cugaaagaau
cucaacuucc aacugucaug gacuucagaa aauucucucg gaacuaucaa
2040cucuacaaau cuguuucucu uccaucacuu gacccagccu cagccaaaau
agaagggaau 2100cuuauauuug auccaaauaa cuaccuuccu aaagaaagca
ugcugaaaac uacccucacu 2160gccuuuggau uugcuucagc ugaccucauc
gagauuggcu uggaaggaaa aggcuuugag 2220ccaacauugg aagcucuuuu
ugggaagcaa ggauuuuucc cagacagugu caacaaagcu 2280uuguacuggg
uuaaugguca aguuccugau ggugucucua aggucuuagu ggaccacuuu
2340ggcuauacca aagaugauaa acaugagcag gauaugguaa auggaauaau
gcucaguguu 2400gagaagcuga uuaaagauuu gaaauccaaa gaagucccgg
aagccagagc cuaccuccgc 2460aucuugggag aggagcuugg uuuugccagu
cuccaugacc uccagcuccu gggaaagcug 2520cuucugaugg gugcccgcac
ucugcagggg aucccccaga ugauuggaga ggucaucagg 2580aagggcucaa
agaaugacuu uuuucuucac uacaucuuca uggagaaugc cuuugaacuc
2640cccacuggag cuggauuaca guugcaaaua ucuucaucug gagucauugc
ucccggagcc 2700aaggcuggag uaaaacugga aguagccaac augcaggcug
aacugguggc aaaacccucc 2760gugucugugg aguuugugac aaauaugggc
aucaucauuc cggacuucgc uaggaguggg 2820guccagauga acaccaacuu
cuuccacgag ucgggucugg aggcucaugu ugcccuaaaa 2880gcugggaagc
ugaaguuuau cauuccuucc ccaaagagac cagucaagcu gcucagugga
2940ggcaacacau uacauuuggu cucuaccacc aaaacggagg ugaucccacc
ucucauugag 3000aacaggcagu ccuggucagu uugcaagcaa gucuuuccug
gccugaauua cugcaccuca 3060ggcgcuuacu ccaacgccag cuccacagac
uccgccuccu acuauccgcu gaccggggac 3120accagauuag agcuggaacu
gaggccuaca ggagagauug agcaguauuc ugucagcgca 3180accuaugagc
uccagagaga ggacagagcc uugguggaua cccugaaguu uguaacucaa
3240gcagaaggug cgaagcagac ugaggcuacc augacauuca aauauaaucg
gcagaguaug 3300accuugucca gugaagucca aauuccggau uuugauguug
accucggaac aauccucaga 3360guuaaugaug aaucuacuga gggcaaaacg
ucuuacagac ucacccugga cauucagaac 3420aagaaaauua cugaggucgc
ccucaugggc caccuaaguu gugacacaaa ggaagaaaga 3480aaaaucaagg
guguuauuuc cauaccccgu uugcaagcag aagccagaag ugagauccuc
3540gcccacuggu cgccugccaa acugcuucuc caaauggacu caucugcuac
agcuuauggc 3600uccacaguuu ccaagagggu ggcauggcau uaugaugaag
agaagauuga auuugaaugg 3660aacacaggca ccaauguaga uaccaaaaaa
augacuucca auuucccugu ggaucucucc 3720gauuauccua agagcuugca
uauguaugcu aauagacucc uggaucacag agucccugaa 3780acagacauga
cuuuccggca cguggguucc aaauuaauag uugcaaugag cucauggcuu
3840cagaaggcau cugggagucu uccuuauacc cagacuuugc aagaccaccu
caauagccug 3900aaggaguuca accuccagaa caugggauug ccagacuucc
acaucccaga aaaccucuuc 3960uuaaaaagcg auggccgggu caaauauacc
uugaacaaga acaguuugaa aauugagauu 4020ccuuugccuu uugguggcaa
auccuccaga gaucuaaaga uguuagagac uguuaggaca 4080ccagcccucc
acuucaaguc ugugggauuc caucugccau cucgagaguu ccaagucccu
4140acuuuuacca uucccaaguu guaucaacug caagugccuc uccugggugu
ucuagaccuc 4200uccacgaaug ucuacagcaa cuuguacaac ugguccgccu
ccuacagugg uggcaacacc 4260agcacagacc auuucagccu ucgggcucgu
uaccacauga aggcugacuc ugugguugac 4320cugcuuuccu acaaugugca
aggaucugga gaaacaacau augaccacaa gaauacguuc 4380acacuaucau
gugauggguc ucuacgccac aaauuucuag auucgaauau caaauucagu
4440cauguagaaa aacuuggaaa caacccaguc ucaaaagguu uacuaauauu
cgaugcaucu 4500aguuccuggg gaccacagau gucugcuuca guucauuugg
acuccaaaaa gaaacagcau 4560uuguuuguca aagaagucaa gauugauggg
caguucagag ucucuucguu cuaugcuaaa 4620ggcacauaug gccugucuug
ucagagggau ccuaacacug gccggcucaa uggagagucc 4680aaccugaggu
uuaacuccuc cuaccuccaa ggcaccaacc agauaacagg aagauaugaa
4740gauggaaccc ucucccucac cuccaccucu gaucugcaaa guggcaucau
uaaaaauacu 4800gcuucccuaa aguaugagaa cuacgagcug acuuuaaaau
cugacaccaa ugggaaguau 4860aagaacuuug ccacuucuaa caagauggau
augaccuucu cuaagcaaaa ugcacugcug 4920cguucugaau aucaggcuga
uuacgaguca uugagguucu ucagccugcu uucuggauca 4980cuaaauuccc
auggucuuga guuaaaugcu gacaucuuag gcacugacaa aauuaauagu
5040ggugcucaca aggcgacacu aaggauuggc caagauggaa uaucuaccag
ugcaacgacc 5100aacuugaagu guagucuccu ggugcuggag aaugagcuga
augcagagcu uggccucucu 5160ggggcaucua ugaaauuaac aacaaauggc
cgcuucaggg aacacaaugc aaaauucagu 5220cuggauggga aagccgcccu
cacagagcua ucacugggaa gugcuuauca ggccaugauu 5280cugggugucg
acagcaaaaa cauuuucaac uucaagguca gucaagaagg acuuaagcuc
5340ucaaaugaca ugaugggcuc auaugcugaa augaaauuug accacacaaa
cagucugaac 5400auugcaggcu uaucacugga cuucucuuca aaacuugaca
acauuuacag cucugacaag 5460uuuuauaagc aaacuguuaa uuuacagcua
cagcccuauu cucugguaac uacuuuaaac 5520agugaccuga aauacaaugc
ucuggaucuc accaacaaug ggaaacuacg gcuagaaccc 5580cugaagcugc
auguggcugg uaaccuaaaa ggagccuacc aaaauaauga aauaaaacac
5640aucuaugcca ucucuucugc ugccuuauca gcaagcuaua aagcagacac
uguugcuaag 5700guucagggug uggaguuuag ccaucggcuc aacacagaca
ucgcugggcu ggcuucagcc 5760auugacauga gcacaaacua uaauucagac
ucacugcauu ucagcaaugu cuuccguucu 5820guaauggccc cguuuaccau
gaccaucgau gcacauacaa auggcaaugg gaaacucgcu 5880cucuggggag
aacauacugg gcagcuguau agcaaauucc uguugaaagc agaaccucug
5940gcauuuacuu ucucucauga uuacaaaggc uccacaaguc aucaucucgu
gucuaggaaa 6000agcaucagug cagcucuuga acacaaaguc agugcccugc
uuacuccagc ugagcagaca 6060ggcaccugga aacucaagac ccaauuuaac
aacaaugaau acagccagga cuuggaugcu 6120uacaacacua aagauaaaau
uggcguggag cuuacuggac gaacucuggc ugaccuaacu 6180cuacuagacu
ccccaauuaa agugccacuu uuacucagug agcccaucaa uaucauugau
6240gcuuuagaga ugagagaugc cguugagaag ccccaagaau uuacaauugu
ugcuuuugua 6300aaguaugaua aaaaccaaga uguucacucc auuaaccucc
cauuuuuuga gaccuugcaa 6360gaauauuuug agaggaaucg acaaaccauu
auaguuguag uggaaaacgu acagagaaac 6420cugaagcaca ucaauauuga
ucaauuugua agaaaauaca gagcagcccu gggaaaacuc 6480ccacagcaag
cuaaugauua ucugaauuca uucaauuggg agagacaagu uucacaugcc
6540aaggagaaac ugacugcucu cacaaaaaag uauagaauua cagaaaauga
uauacaaauu 6600gcauuagaug augccaaaau caacuuuaau gaaaaacuau
cucaacugca gacauauaug 6660auacaauuug aucaguauau uaaagauagu
uaugauuuac augauuugaa aauagcuauu 6720gcuaauauua uugaugaaau
cauugaaaaa uuaaaaaguc uugaugagca cuaucauauc 6780cguguaaauu
uaguaaaaac aauccaugau cuacauuugu uuauugaaaa uauugauuuu
6840aacaaaagug gaaguaguac ugcauccugg auucaaaaug uggauacuaa
guaccaaauc 6900agaauccaga uacaagaaaa acugcagcag cuuaagagac
acauacagaa uauagacauc 6960cagcaccuag cuggaaaguu aaaacaacac
auugaggcua uugauguuag agugcuuuua 7020gaucaauugg gaacuacaau
uucauuugaa agaauaaaug auguucuuga gcaugucaaa 7080cacuuuguua
uaaaucuuau uggggauuuu gaaguagcug agaaaaucaa ugccuucaga
7140gccaaagucc augaguuaau cgagagguau gaaguagacc aacaaaucca
gguuuuaaug 7200gauaaauuag uagaguugac ccaccaauac aaguugaagg
agacuauuca gaagcuaagc 7260aauguccuac aacaaguuaa gauaaaagau
uacuuugaga aauugguugg auuuauugau 7320gaugcuguga agaagcuuaa
ugaauuaucu uuuaaaacau ucauugaaga uguuaacaaa 7380uuccuugaca
uguugauaaa gaaauuaaag ucauuugauu accaccaguu uguagaugaa
7440accaaugaca aaauccguga ggugacucag agacucaaug gugaaauuca
ggcucuggaa 7500cuaccacaaa aagcugaagc auuaaaacug uuuuuagagg
aaaccaaggc cacaguugca 7560guguaucugg aaagccuaca ggacaccaaa
auaaccuuaa ucaucaauug guuacaggag 7620gcuuuaaguu cagcaucuuu
ggcucacaug aaggccaaau uccgagagac ucuagaagau 7680acacgagacc
gaauguauca aauggacauu cagcaggaac uucaacgaua ccugucucug
7740guaggccagg uuuauagcac acuugucacc uacauuucug auugguggac
ucuugcugcu 7800aagaaccuua cugacuuugc agagcaauau ucuauccaag
auugggcuaa acguaugaaa 7860gcauugguag agcaaggguu cacuguuccu
gaaaucaaga ccauccuugg gaccaugccu 7920gccuuugaag ucagucuuca
ggcucuucag aaagcuaccu uccagacacc ugauuuuaua 7980gucccccuaa
cagauuugag gauuccauca guucagauaa acuucaaaga cuuaaaaaau
8040auaaaaaucc cauccagguu uuccacacca gaauuuacca uccuuaacac
cuuccacauu 8100ccuuccuuua caauugacuu ugucgaaaug aaaguaaaga
ucaucagaac cauugaccag 8160augcagaaca gugagcugca guggcccguu
ccagauauau aucucaggga ucugaaggug 8220gaggacauuc cucuagcgag
aaucacccug ccagacuucc guuuaccaga aaucgcaauu 8280ccagaauuca
uaaucccaac ucucaaccuu aaugauuuuc aaguuccuga ccuucacaua
8340ccagaauucc agcuucccca caucucacac acaauugaag uaccuacuuu
uggcaagcua 8400uacaguauuc ugaaaaucca aucuccucuu uucacauuag
augcaaaugc ugacauaggg 8460aauggaacca ccucagcaaa cgaagcaggu
aucgcagcuu ccaucacugc caaaggagag 8520uccaaauuag aaguucucaa
uuuugauuuu caagcaaaug cacaacucuc aaacccuaag 8580auuaauccgc
uggcucugaa ggagucagug aaguucucca gcaaguaccu gagaacggag
8640caugggagug aaaugcuguu uuuuggaaau gcuauugagg gaaaaucaaa
cacaguggca 8700aguuuacaca cagaaaaaaa uacacuggag cuuaguaaug
gagugauugu caagauaaac 8760aaucagcuua cccuggauag caacacuaaa
uacuuccaca aauugaacau ccccaaacug 8820gacuucucua gucaggcuga
ccugcgcaac gagaucaaga cacuguugaa agcuggccac 8880auagcaugga
cuucuucugg aaaaggguca uggaaauggg ccugccccag auucucagau
8940gagggaacac augaaucaca aauuaguuuc accauagaag gaccccucac
uuccuuugga 9000cuguccaaua agaucaauag caaacaccua agaguaaacc
aaaacuuggu uuaugaaucu 9060ggcucccuca acuuuucuaa acuugaaauu
caaucacaag ucgauuccca gcaugugggc 9120cacaguguuc uaacugcuaa
aggcauggca cuguuuggag aagggaaggc agaguuuacu 9180gggaggcaug
augcucauuu aaauggaaag guuauuggaa cuuugaaaaa uucucuuuuc
9240uuuucagccc agccauuuga gaucacggca uccacaaaca augaagggaa
uuugaaaguu 9300cguuuuccau uaagguuaac agggaagaua gacuuccuga
auaacuaugc acuguuucug 9360agucccagug cccagcaagc aaguuggcaa
guaagugcua gguucaauca guauaaguac 9420aaccaaaauu ucucugcugg
aaacaacgag aacauuaugg aggcccaugu aggaauaaau 9480ggagaagcaa
aucuggauuu cuuaaacauu ccuuuaacaa uuccugaaau gcgucuaccu
9540uacacaauaa ucacaacucc uccacugaaa gauuucucuc uaugggaaaa
aacaggcuug 9600aaggaauucu ugaaaacgac aaagcaauca uuugauuuaa
guguaaaagc ucaguauaag 9660aaaaacaaac acaggcauuc caucacaaau
ccuuuggcug ugcuuuguga guuuaucagu 9720cagagcauca aauccuuuga
caggcauuuu gaaaaaaaca gaaacaaugc auuagauuuu 9780gucaccaaau
ccuauaauga aacaaaaauu aaguuugaua aguacaaagc ugaaaaaucu
9840cacgacgagc uccccaggac cuuucaaauu ccuggauaca cuguuccagu
ugucaauguu 9900gaagugucuc cauucaccau agagaugucg gcauucggcu
auguguuccc aaaagcaguc 9960agcaugccua guuucuccau ccuagguucu
gacguccgug ugccuucaua cacauuaauc 10020cugccaucau uagagcugcc
aguccuucau gucccuagaa aucucaagcu uucucuucca 10080cauuucaagg
aauuguguac cauaagccau auuuuuauuc cugccauggg caauauuacc
10140uaugauuucu ccuuuaaauc aagugucauc acacugaaua ccaaugcuga
acuuuuuaac 10200cagucagaua uuguugcuca ucuccuuucu ucaucuucau
cugucauuga ugcacugcag 10260uacaaauuag agggcaccac aagauugaca
agaaaaaggg gauugaaguu agccacagcu 10320cugucucuga gcaacaaauu
uguggagggu agucauaaca guacugugag cuuaaccacg 10380aaaaauaugg
aagugucagu ggcaaaaacc acaaaagccg aaauuccaau uuugagaaug
10440aauuucaagc aagaacuuaa uggaaauacc aagucaaaac cuacugucuc
uuccuccaug 10500gaauuuaagu augauuucaa uucuucaaug cuguacucua
ccgcuaaagg agcaguugac 10560cacaagcuua gcuuggaaag ccucaccucu
uacuuuucca uugagucauc uaccaaagga 10620gaugucaagg guucgguucu
uucucgggaa uauucaggaa cuauugcuag ugaggccaac 10680acuuacuuga
auuccaagag cacacggucu ucagugaagc ugcagggcac uuccaaaauu
10740gaugauaucu ggaaccuuga aguaaaagaa aauuuugcug gagaagccac
acuccaacgc 10800auauauuccc ucugggagca caguacgaaa aaccacuuac
agcuagaggg ccucuuuuuc 10860accaacggag aacauacaag caaagccacc
cuggaacucu cuccauggca aaugucagcu 10920cuuguucagg uccaugcaag
ucagcccagu uccuuccaug auuucccuga ccuuggccag 10980gaaguggccc
ugaaugcuaa cacuaagaac cagaagauca gauggaaaaa ugaaguccgg
11040auucauucug ggucuuucca gagccagguc gagcuuucca augaccaaga
aaaggcacac 11100cuugacauug caggauccuu agaaggacac cuaagguucc
ucaaaaauau cauccuacca 11160gucuaugaca agagcuuaug ggauuuccua
aagcuggaug uaaccaccag cauugguagg 11220agacagcauc uucguguuuc
aacugccuuu guguacacca aaaaccccaa uggcuauuca 11280uucuccaucc
cuguaaaagu uuuggcugau aaauucauua cuccugggcu gaaacuaaau
11340gaucuaaauu caguucuugu caugccuacg uuccaugucc cauuuacaga
ucuucagguu 11400ccaucgugca aacuugacuu cagagaaaua caaaucuaua
agaagcugag aacuucauca 11460uuugcccuca accuaccaac acuccccgag
guaaaauucc cugaaguuga uguguuaaca 11520aaauauucuc aaccagaaga
cuccuugauu cccuuuuuug agauaaccgu gccugaaucu 11580caguuaacug
ugucccaguu cacgcuucca aaaaguguuu cagauggcau ugcugcuuug
11640gaucuaaaug caguagccaa caagaucgca gacuuugagu ugcccaccau
caucgugccu 11700gagcagacca uugagauucc cuccauuaag uucucuguac
cugcuggaau ugucauuccu 11760uccuuucaag cacugacugc acgcuuugag
guagacucuc ccguguauaa ugccacuugg 11820agugccaguu ugaaaaacaa
agcagauuau guugaaacag uccuggauuc cacaugcagc 11880ucaaccguac
aguuccuaga auaugaacua aauguuuugg gaacacacaa aaucgaagau
11940gguacguuag ccucuaagac uaaaggaaca cuugcacacc gugacuucag
ugcagaauau 12000gaagaagaug gcaaauuuga aggacuucag gaaugggaag
gaaaagcgca ccucaauauc 12060aaaagcccag cguucaccga ucuccaucug
cgcuaccaga aagacaagaa aggcaucucc 12120accucagcag ccuccccagc
cguaggcacc gugggcaugg auauggauga agaugacgac 12180uuuucuaaau
ggaacuucua cuacagcccu caguccucuc cagauaaaaa acucaccaua
12240uucaaaacug aguugagggu ccgggaaucu gaugaggaaa cucagaucaa
aguuaauugg 12300gaagaagagg cagcuucugg cuugcuaacc ucucugaaag
acaacgugcc caaggccaca 12360gggguccuuu augauuaugu caacaaguac
cacugggaac acacagggcu cacccugaga 12420gaagugucuu caaagcugag
aagaaaucug cagaacaaug cugagugggu uuaucaaggg 12480gccauuaggc
aaauugauga uaucgacgug agguuccaga aagcagccag uggcaccacu
12540gggaccuacc aagaguggaa ggacaaggcc cagaaucugu accaggaacu
guugacucag 12600gaaggccaag ccaguuucca gggacucaag gauaacgugu
uugauggcuu gguacgaguu 12660acucaaaaau uccauaugaa agucaagcau
cugauugacu cacucauuga uuuucugaac 12720uuccccagau uccaguuucc
ggggaaaccu gggauauaca cuagggagga acuuugcacu 12780auguucauaa
gggagguagg gacgguacug ucccagguau auucgaaagu ccauaauggu
12840ucagaaauac uguuuuccua uuuccaagac cuagugauua cacuuccuuu
cgaguuaagg 12900aaacauaaac uaauagaugu aaucucgaug uauagggaac
uguugaaaga uuuaucaaaa 12960gaagcccaag agguauuuaa agccauucag
ucucucaaga ccacagaggu gcuacguaau 13020cuucaggacc uuuuacaauu
cauuuuccaa cuaauagaag auaacauuaa acagcugaaa 13080gagaugaaau
uuacuuaucu uauuaauuau auccaagaug agaucaacac aaucuucaau
13140gauuauaucc cauauguuuu uaaauuguug aaagaaaacc uaugccuuaa
ucuucauaag 13200uucaaugaau uuauucaaaa cgagcuucag gaagcuucuc
aagaguuaca gcagauccau 13260caauacauua uggcccuucg ugaagaauau
uuugauccaa guauaguugg cuggacagug 13320aaauauuaug aacuugaaga
aaagauaguc agucugauca agaaccuguu aguugcucuu 13380aaggacuucc
auucugaaua uauugucagu gccucuaacu uuacuuccca acucucaagu
13440caaguugagc aauuucugca cagaaauauu caggaauauc uuagcauccu
uaccgaucca 13500gauggaaaag ggaaagagaa gauugcagag cuuucugcca
cugcucagga aauaauuaaa 13560agccaggcca uugcgacgaa gaaaauaauu
ucugauuacc accagcaguu uagauauaaa 13620cugcaagauu uuucagacca
acucucugau uacuaugaaa aauuuauugc ugaauccaaa 13680agauugauug
accuguccau ucaaaacuac cacacauuuc ugauauacau cacggaguua
13740cugaaaaagc ugcaaucaac cacagucaug aaccccuaca ugaagcuugc
uccaggagaa 13800cuuacuauca uccucuaauu uuuuaaaaga aaucuucauu
uauucuucuu uuccaauuga 13860acuuucacau agcacagaaa aaauucaaac
ugccuauauu gauaaaacca uacagugagc 13920cagccuugca guaggcagua
gacuauaagc agaagcacau augaacugga ccugcaccaa 13980agcuggcacc
agggcucgga aggucucuga acucagaagg auggcauuuu uugcaaguua
14040aagaaaauca ggaucugagu uauuuugcua aacuuggggg aggaggaaca
aauaaaugga 14100gucuuuauug uguaucaua 1411921503DNAHuman
immunodeficiency virus 2atgggtgcga gagcgtcagt attaagcggg ggagaattag
atcgatggga aaaaattcgg 60ttaaggccag ggggaaagaa aaaatataaa ttaaaacata
tagtatgggc aagcagggag 120ctagaacgat tcgcagttaa tcctggcctg
ttagaaacat cagaaggctg tagacaaata 180ctgggacagc tacaaccatc
ccttcagaca ggatcagaag aacttagatc attatataat 240acagtagcaa
ccctctattg tgtgcatcaa aggatagaga taaaagacac caaggaagct
300ttagacaaga tagaggaaga gcaaaacaaa agtaagaaaa aagcacagca
agcagcagct 360gacacaggac acagcaatca ggtcagccaa aattacccta
tagtgcagaa catccagggg 420caaatggtac atcaggccat atcacctaga
actttaaatg catgggtaaa agtagtagaa 480gagaaggctt tcagcccaga
agtgataccc atgttttcag cattatcaga aggagccacc 540ccacaagatt
taaacaccat gctaaacaca gtggggggac atcaagcagc catgcaaatg
600ttaaaagaga ccatcaatga ggaagctgca gaatgggata gagtgcatcc
agtgcatgca 660gggcctattg caccaggcca gatgagagaa ccaaggggaa
gtgacatagc aggaactact 720agtacccttc aggaacaaat aggatggatg
acaaataatc cacctatccc agtaggagaa 780atttataaaa gatggataat
cctgggatta aataaaatag taagaatgta tagccctacc
840agcattctgg acataagaca aggaccaaag gaacccttta gagactatgt
agaccggttc 900tataaaactc taagagccga gcaagcttca caggaggtaa
aaaattggat gacagaaacc 960ttgttggtcc aaaatgcgaa cccagattgt
aagactattt taaaagcatt gggaccagcg 1020gctacactag aagaaatgat
gacagcatgt cagggagtag gaggacccgg ccataaggca 1080agagttttgg
ctgaagcaat gagccaagta acaaattcag ctaccataat gatgcagaga
1140ggcaatttta ggaaccaaag aaagattgtt aagtgtttca attgtggcaa
agaagggcac 1200acagccagaa attgcagggc ccctaggaaa aagggctgtt
ggaaatgtgg aaaggaagga 1260caccaaatga aagattgtac tgagagacag
gctaattttt tagggaagat ctggccttcc 1320tacaagggaa ggccagggaa
ttttcttcag agcagaccag agccaacagc cccaccagaa 1380gagagcttca
ggtctggggt agagacaaca actccccctc agaagcagga gccgatagac
1440aaggaactgt atcctttaac ttccctcagg tcactctttg gcaacgaccc
ctcgtcacaa 1500taa 15033261DNAHuman immunodeficiency virus
3atggagccag tagatcctag actagagccc tggaagcatc caggaagtca gcctaaaact
60gcttgtacca attgctattg taaaaagtgt tgctttcatt gccaagtttg tttcataaca
120aaagccttag gcatctccta tggcaggaag aagcggagac agcgacgaag
agctcatcag 180aacagtcaga ctcatcaagc ttctctatca aagcaaccca
cctcccaacc ccgaggggac 240ccgacaggcc cgaaggaata g 26142571DNAHuman
immunodeficiency virus 4atgagagtga aggagaaata tcagcacttg tggagatggg
ggtggagatg gggcaccatg 60ctccttggga tgttgatgat ctgtagtgct acagaaaaat
tgtgggtcac agtctattat 120ggggtacctg tgtggaagga agcaaccacc
actctatttt gtgcatcaga tgctaaagca 180tatgatacag aggtacataa
tgtttgggcc acacatgcct gtgtacccac agaccccaac 240ccacaagaag
tagtattggt aaatgtgaca gaaaatttta acatgtggaa aaatgacatg
300gtagaacaga tgcatgagga tataatcagt ttatgggatc aaagcctaaa
gccatgtgta 360aaattaaccc cactctgtgt tagtttaaag tgcactgatt
tgaagaatga tactaatacc 420aatagtagta gcgggagaat gataatggag
aaaggagaga taaaaaactg ctctttcaat 480atcagcacaa gcataagagg
taaggtgcag aaagaatatg cattttttta taaacttgat 540ataataccaa
tagataatga tactaccagc tataagttga caagttgtaa cacctcagtc
600attacacagg cctgtccaaa ggtatccttt gagccaattc ccatacatta
ttgtgccccg 660gctggttttg cgattctaaa atgtaataat aagacgttca
atggaacagg accatgtaca 720aatgtcagca cagtacaatg tacacatgga
attaggccag tagtatcaac tcaactgctg 780ttaaatggca gtctagcaga
agaagaggta gtaattagat ctgtcaattt cacggacaat 840gctaaaacca
taatagtaca gctgaacaca tctgtagaaa ttaattgtac aagacccaac
900aacaatacaa gaaaaagaat ccgtatccag agaggaccag ggagagcatt
tgttacaata 960ggaaaaatag gaaatatgag acaagcacat tgtaacatta
gtagagcaaa atggaataac 1020actttaaaac agatagctag caaattaaga
gaacaatttg gaaataataa aacaataatc 1080tttaagcaat cctcaggagg
ggacccagaa attgtaacgc acagttttaa ttgtggaggg 1140gaatttttct
actgtaattc aacacaactg tttaatagta cttggtttaa tagtacttgg
1200agtactgaag ggtcaaataa cactgaagga agtgacacaa tcaccctccc
atgcagaata 1260aaacaaatta taaacatgtg gcagaaagta ggaaaagcaa
tgtatgcccc tcccatcagt 1320ggacaaatta gatgttcatc aaatattaca
gggctgctat taacaagaga tggtggtaat 1380agcaacaatg agtccgagat
cttcagacct ggaggaggag atatgaggga caattggaga 1440agtgaattat
ataaatataa agtagtaaaa attgaaccat taggagtagc acccaccaag
1500gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc
tttgttcctt 1560gggttcttgg gagcagcagg aagcactatg ggcgcagcct
caatgacgct gacggtacag 1620gccagacaat tattgtctgg tatagtgcag
cagcagaaca atttgctgag ggctattgag 1680gcgcaacagc atctgttgca
actcacagtc tggggcatca agcagctcca ggcaagaatc 1740ctggctgtgg
aaagatacct aaaggatcaa cagctcctgg ggatttgggg ttgctctgga
1800aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa
atctctggaa 1860cagatttgga atcacacgac ctggatggag tgggacagag
aaattaacaa ttacacaagc 1920ttaatacact ccttaattga agaatcgcaa
aaccagcaag aaaagaatga acaagaatta 1980ttggaattag ataaatgggc
aagtttgtgg aattggttta acataacaaa ttggctgtgg 2040tatataaaat
tattcataat gatagtagga ggcttggtag gtttaagaat agtttttgct
2100gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt
tcagacccac 2160ctcccaaccc cgaggggacc cgacaggccc gaaggaatag
aagaagaagg tggagagaga 2220gacagagaca gatccattcg attagtgaac
ggatccttgg cacttatctg ggacgatctg 2280cggagcctgt gcctcttcag
ctaccaccgc ttgagagact tactcttgat tgtaacgagg 2340attgtggaac
ttctgggacg cagggggtgg gaagccctca aatattggtg gaatctccta
2400cagtattgga gtcaggaact aaagaatagt gctgttagct tgctcaatgc
cacagccata 2460gcagtagctg aggggacaga tagggttata gaagtagtac
aaggagcttg tagagctatt 2520cgccacatac ctagaagaat aagacagggc
ttggaaagga ttttgctata a 257154308DNAHuman immunodeficiency virus
5atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgatggga aaaaattcgg
60ttaaggccag ggggaaagaa aaaatataaa ttaaaacata tagtatgggc aagcagggag
120ctagaacgat tcgcagttaa tcctggcctg ttagaaacat cagaaggctg
tagacaaata 180ctgggacagc tacaaccatc ccttcagaca ggatcagaag
aacttagatc attatataat 240acagtagcaa ccctctattg tgtgcatcaa
aggatagaga taaaagacac caaggaagct 300ttagacaaga tagaggaaga
gcaaaacaaa agtaagaaaa aagcacagca agcagcagct 360gacacaggac
acagcaatca ggtcagccaa aattacccta tagtgcagaa catccagggg
420caaatggtac atcaggccat atcacctaga actttaaatg catgggtaaa
agtagtagaa 480gagaaggctt tcagcccaga agtgataccc atgttttcag
cattatcaga aggagccacc 540ccacaagatt taaacaccat gctaaacaca
gtggggggac atcaagcagc catgcaaatg 600ttaaaagaga ccatcaatga
ggaagctgca gaatgggata gagtgcatcc agtgcatgca 660gggcctattg
caccaggcca gatgagagaa ccaaggggaa gtgacatagc aggaactact
720agtacccttc aggaacaaat aggatggatg acaaataatc cacctatccc
agtaggagaa 780atttataaaa gatggataat cctgggatta aataaaatag
taagaatgta tagccctacc 840agcattctgg acataagaca aggaccaaag
gaacccttta gagactatgt agaccggttc 900tataaaactc taagagccga
gcaagcttca caggaggtaa aaaattggat gacagaaacc 960ttgttggtcc
aaaatgcgaa cccagattgt aagactattt taaaagcatt gggaccagcg
1020gctacactag aagaaatgat gacagcatgt cagggagtag gaggacccgg
ccataaggca 1080agagttttgg ctgaagcaat gagccaagta acaaattcag
ctaccataat gatgcagaga 1140ggcaatttta ggaaccaaag aaagattgtt
aagtgtttca attgtggcaa agaagggcac 1200acagccagaa attgcagggc
ccctaggaaa aagggctgtt ggaaatgtgg aaaggaagga 1260caccaaatga
aagattgtac tgagagacag gctaattttt taagggaaga tctggccttc
1320ctacaaggga aggccaggga attttcttca gagcagacca gagccaacag
ccccaccaga 1380agagagcttc aggtctgggg tagagacaac aactccccct
cagaagcagg agccgataga 1440caaggaactg tatcctttaa cttccctcag
gtcactcttt ggcaacgacc cctcgtcaca 1500ataaagatag gggggcaact
aaaggaagct ctattagata caggagcaga tgatacagta 1560ttagaagaaa
tgagtttgcc aggaagatgg aaaccaaaaa tgataggggg aattggaggt
1620tttatcaaag taagacagta tgatcagata ctcatagaaa tctgtggaca
taaagctata 1680ggtacagtat tagtaggacc tacacctgtc aacataattg
gaagaaatct gttgactcag 1740attggttgca ctttaaattt tcccattagc
cctattgaga ctgtaccagt aaaattaaag 1800ccaggaatgg atggcccaaa
agttaaacaa tggccattga cagaagaaaa aataaaagca 1860ttagtagaaa
tttgtacaga gatggaaaag gaagggaaaa tttcaaaaat tgggcctgaa
1920aatccataca atactccagt atttgccata aagaaaaaag acagtactaa
atggagaaaa 1980ttagtagatt tcagagaact taataagaga actcaagact
tctgggaagt tcaattagga 2040ataccacatc ccgcagggtt aaaaaagaaa
aaatcagtaa cagtactgga tgtgggtgat 2100gcatattttt cagttccctt
agatgaagac ttcaggaagt atactgcatt taccatacct 2160agtataaaca
atgagacacc agggattaga tatcagtaca atgtgcttcc acagggatgg
2220aaaggatcac cagcaatatt ccaaagtagc atgacaaaaa tcttagagcc
ttttagaaaa 2280caaaatccag acatagttat ctatcaatac atggatgatt
tgtatgtagg atctgactta 2340gaaatagggc agcatagaac aaaaatagag
gagctgagac aacatctgtt gaggtgggga 2400cttaccacac cagacaaaaa
acatcagaaa gaacctccat tcctttggat gggttatgaa 2460ctccatcctg
ataaatggac agtacagcct atagtgctgc cagaaaaaga cagctggact
2520gtcaatgaca tacagaagtt agtggggaaa ttgaattggg caagtcagat
ttacccaggg 2580attaaagtaa ggcaattatg taaactcctt agaggaacca
aagcactaac agaagtaata 2640ccactaacag aagaagcaga gctagaactg
gcagaaaaca gagagattct aaaagaacca 2700gtacatggag tgtattatga
cccatcaaaa gacttaatag cagaaataca gaagcagggg 2760caaggccaat
ggacatatca aatttatcaa gagccattta aaaatctgaa aacaggaaaa
2820tatgcaagaa tgaggggtgc ccacactaat gatgtaaaac aattaacaga
ggcagtgcaa 2880aaaataacca cagaaagcat agtaatatgg ggaaagactc
ctaaatttaa actgcccata 2940caaaaggaaa catgggaaac atggtggaca
gagtattggc aagccacctg gattcctgag 3000tgggagtttg ttaatacccc
tcccttagtg aaattatggt accagttaga gaaagaaccc 3060atagtaggag
cagaaacctt ctatgtagat ggggcagcta acagggagac taaattagga
3120aaagcaggat atgttactaa tagaggaaga caaaaagttg tcaccctaac
tgacacaaca 3180aatcagaaga ctgagttaca agcaatttat ctagctttgc
aggattcggg attagaagta 3240aacatagtaa cagactcaca atatgcatta
ggaatcattc aagcacaacc agatcaaagt 3300gaatcagagt tagtcaatca
aataatagag cagttaataa aaaaggaaaa ggtctatctg 3360gcatgggtac
cagcacacaa aggaattgga ggaaatgaac aagtagataa attagtcagt
3420gctggaatca ggaaagtact atttttagat ggaatagata aggcccaaga
tgaacatgag 3480aaatatcaca gtaattggag agcaatggct agtgatttta
acctgccacc tgtagtagca 3540aaagaaatag tagccagctg tgataaatgt
cagctaaaag gagaagccat gcatggacaa 3600gtagactgta gtccaggaat
atggcaacta gattgtacac atttagaagg aaaagttatc 3660ctggtagcag
ttcatgtagc cagtggatat atagaagcag aagttattcc agcagaaaca
3720gggcaggaaa cagcatattt tcttttaaaa ttagcaggaa gatggccagt
aaaaacaata 3780catactgaca atggcagcaa tttcaccggt gctacggtta
gggccgcctg ttggtgggcg 3840ggaatcaagc aggaatttgg aattccctac
aatccccaaa gtcaaggagt agtagaatct 3900atgaataaag aattaaagaa
aattatagga caggtaagag atcaggctga acatcttaag 3960acagcagtac
aaatggcagt attcatccac aattttaaaa gaaaaggggg gattgggggg
4020tacagtgcag gggaaagaat agtagacata atagcaacag acatacaaac
taaagaatta 4080caaaaacaaa ttacaaaaat tcaaaatttt cgggtttatt
acagggacag cagaaatcca 4140ctttggaaag gaccagcaaa gctcctctgg
aaaggtgaag gggcagtagt aatacaagat 4200aatagtgaca taaaagtagt
gccaagaaga aaagcaaaga tcattaggga ttatggaaaa 4260cagatggcag
gtgatgattg tgtggcaagt agacaggatg aggattag 43086579DNAHuman
immunodeficiency virus 6atggaaaaca gatggcaggt gatgattgtg tggcaagtag
acaggatgag gattagaaca 60tggaaaagtt tagtaaaaca ccatatgtat gtttcaggga
aagctagggg atggttttat 120agacatcact atgaaagccc tcatccaaga
ataagttcag aagtacacat cccactaggg 180gatgctagat tggtaataac
aacatattgg ggtctgcata caggagaaag agactggcat 240ttgggtcagg
gagtctccat agaatggagg aaaaagagat atagcacaca agtagaccct
300gaactagcag accaactaat tcatctgtat tactttgact gtttttcaga
ctctgctata 360agaaaggcct tattaggaca catagttagc cctaggtgtg
aatatcaagc aggacataac 420aaggtaggat ctctacaata cttggcacta
gcagcattaa taacaccaaa aaagataaag 480ccacctttgc ctagtgttac
gaaactgaca gaggatagat ggaacaagcc ccagaagacc 540aagggccaca
gagggagcca cacaatgaat ggacactag 5797621DNAHuman immunodeficiency
virus 7atgggtggca agtggtcaaa aagtagtgtg attggatggc ctactgtaag
ggaaagaatg 60agacgagctg agccagcagc agatagggtg ggagcagcat ctcgagacct
ggaaaaacat 120ggagcaatca caagtagcaa tacagcagct accaatgctg
cttgtgcctg gctagaagca 180caagaggagg aggaggtggg ttttccagtc
acacctcagg tacctttaag accaatgact 240tacaaggcag ctgtagatct
tagccacttt ttaaaagaaa aggggggact ggaagggcta 300attcactccc
aaagaagaca agatatcctt gatctgtgga tctaccacac acaaggctac
360ttccctgatt agcagaacta cacaccaggg ccaggggtca gatatccact
gacctttgga 420tggtgctaca agctagtacc agttgagcca gataagatag
aagaggccaa taaaggagag 480aacaccagct tgttacaccc tgtgagcctg
catgggatgg atgacccgga gagagaagtg 540ttagagtgga ggtttgacag
ccgcctagca tttcatcacg tggcccgaga gctgcatccg 600gagtacttca
agaactgctg a 6218721RNAAequorea victoria 8auggugagca agggcgagga
gcuguucacc gggguggugc ccauccuggu cgagcuggac 60ggcgacguaa acggccacaa
guucagcgug uccggcgagg gcgagggcga ugccaccuac 120ggcaagcuga
cccugaaguu caucugcacc accggcaagc ugcccgugcc cuggcccacc
180cucgugacca cccugaccua cggcgugcag ugcuucagcc gcuaccccga
ccacaugaag 240cagcacgacu ucuucaaguc cgccaugccc gaaggcuacg
uccaggagcg caccaucuuc 300uucaaggacg acggcaacua caagacccgc
gccgagguga aguucgaggg cgacacccug 360gugaaccgca ucgagcugaa
gggcaucgac uucaaggagg acggcaacau ccuggggcac 420aagcuggagu
acaacuacaa cagccacaac gucuauauca uggccgacaa gcagaagaac
480ggcaucaagg ugaacuucaa gauccgccac aacaucgagg acggcagcgu
gcagcucgcc 540gaccacuacc agcagaacac ccccaucggc gacggccccg
ugcugcugcc cgacaaccac 600uaccugagca cccaguccgc ccugagcaaa
gaccccaacg agaagcgcga ucacaugguc 660cugcuggagu ucgugaccgc
cgccgggauc acucucggca uggacgagcu guacaaguaa 720a 72199262RNAHuman
immunodeficiency virus 9gucucucugg uuagaccaga ucugagccug ggagcucucu
ggcuaacuag ggaacccacu 60gcuuaagccu caauaaagcu ugccuugagu gcuucaagua
gugugugccc gucuguugug 120ugacucuggu aacuagagau cccucagacc
cuuuuaguca guguggaaaa ucucuagcag 180uggcgcccga acagggacau
gaaagcgaaa gggaaaccag aggagcucuc ucgacgcagg 240acucggcuug
cugaagcgcg cacggcaaga ggcgaggggc ggcgacuggu gaguacgcca
300aaaauuuuga cuagcggagg cuagaaggag agagaugggu gcgagagcgu
caguauuaag 360cgggggaaaa uuagaucgau gggaaaaaau ucgguuaagg
ccagggggaa agaaaaaaua 420uaaauuaaaa cauauaguau gggcaagcag
ggagcuagaa cgauucgcag uuaauccugg 480ccuguuagaa acaucagaag
gcuguagaca aauacuggga cagcuacaac caucccuuca 540gacaggauca
gaagaacgua gaucauuaua uaauacagua gcaacccucu auugugugca
600ucaaaggaua gagauaaaag acaccaagga agcuuuagac aagauagagg
aagagcaaaa 660caaaaguaag aaaaaagcac agcaagcagc agcugacaca
ggacacagca gccaggucag 720ccaaaauuac ccuauagugc agaacaucca
ggggcaaaug guacaucagg ccauaucacc 780uagaacuuua aaugcauggg
uaaaaguagu agaagagaag gcuuucagcc cagaagugau 840acccauguuu
ucagcauuau cagaaggagc caccccacaa gauuuaaaca ccaugcuaaa
900cacagugggg ggacaucaag cagccaugca aauguuaaaa gagaccauca
augaggaagc 960ugcagaaugg gauagagugc auccagugca ugcagggccu
auugcaccag gccagaugag 1020agaaccaagg ggaagugaca uagcaggaac
uacuaguacc cuucaggaac aaauaggaug 1080gaugacacau aauccaccua
ucccaguagg agaaaucuau aaaagaugga uaauccuggg 1140auuaaauaaa
auaguaagaa uguauagccc uaccagcauu cuggacauaa gacaaggacc
1200aaaggaaccc uuuagagacu auguagaccg auucuauaaa acucuaagag
ccgagcaagc 1260uucacaagag guaaaaaauu ggaugacaga aaccuuguug
guccaaaaug cgaacccaga 1320uuguaagacu auuuuaaaag cauugggacc
aggagcgaca cuagaagaaa ugaugacagc 1380augucaggga guggggggac
ccggccauaa agcaagaguu uuggcugaag caaugagcca 1440aguaacaaau
ccagcuacca uaaugauaca gaaaggcaau uuuaggaacc aaagaaagac
1500uguuaagugu uucaauugug gcaaagaagg gcacauagcc aaaaauugca
gggccccuag 1560gaaaaagggc uguuggaaau guggaaagga aggacaccaa
augaaagauu guacugagag 1620acaggcuaau uuuuuaggga agaucuggcc
uucccacaag ggaaggccag ggaauuuucu 1680ucagagcaga ccagagccaa
cagccccacc agaagagagc uucagguuug gggaagagac 1740aacaacuccc
ucucagaagc aggagccgau agacaaggaa cuguauccuu uagcuucccu
1800cagaucacuc uuuggcagcg accccucguc acaauaaaga uaggggggca
auuaaaggaa 1860gcucuauuag auacaggagc agaugauaca guauuagaag
aaaugaauuu gccaggaaga 1920uggaaaccaa aaaugauagg gggaauugga
gguuuuauca aaguaagaca guaugaucag 1980auacucauag aaaucugcgg
acauaaagcu auagguacag uauuaguagg accuacaccu 2040gucaacauaa
uuggaagaaa ucuguugacu cagauuggcu gcacuuuaaa uuuucccauu
2100aguccuauug agacuguacc aguaaaauua aagccaggaa uggauggccc
aaaaguuaaa 2160caauggccau ugacagaaga aaaaauaaaa gcauuaguag
aaauuuguac agaaauggaa 2220aaggaaggaa aaauuucaaa aauugggccu
gaaaauccau acaauacucc aguauuugcc 2280auaaagaaaa aagacaguac
uaaauggaga aaauuaguag auuucagaga acuuaauaag 2340agaacucaag
auuucuggga aguucaauua ggaauaccac auccugcagg guuaaaacag
2400aaaaaaucag uaacaguacu ggaugugggc gaugcauauu uuucaguucc
cuuagauaaa 2460gacuucagga aguauacugc auuuaccaua ccuaguauaa
acaaugagac accagggauu 2520agauaucagu acaaugugcu uccacaggga
uggaaaggau caccagcaau auuccagugu 2580agcaugacaa aaaucuuaga
gccuuuuaga aaacaaaauc cagacauagu caucuaucaa 2640uacauggaug
auuuguaugu aggaucugac uuagaaauag ggcagcauag aacaaaaaua
2700gaggaacuga gacaacaucu guugaggugg ggauuuacca caccagacaa
aaaacaucag 2760aaagaaccuc cauuccuuug gauggguuau gaacuccauc
cugauaaaug gacaguacag 2820ccuauagugc ugccagaaaa ggacagcugg
acugucaaug acauacagaa auuaguggga 2880aaauugaauu gggcaaguca
gauuuaugca gggauuaaag uaaggcaauu auguaaacuu 2940cuuaggggaa
ccaaagcacu aacagaagua guaccacuaa cagaagaagc agagcuagaa
3000cuggcagaaa acagggagau ucuaaaagaa ccgguacaug gaguguauua
ugacccauca 3060aaagacuuaa uagcagaaau acagaagcag gggcaaggcc
aauggacaua ucaaauuuau 3120caagagccau uuaaaaaucu gaaaacagga
aaguaugcaa gaaugaaggg ugcccacacu 3180aaugauguga aacaauuaac
agaggcagua caaaaaauag ccacagaaag cauaguaaua 3240uggggaaaga
cuccuaaauu uaaauuaccc auacaaaagg aaacauggga agcauggugg
3300acagaguauu ggcaagccac cuggauuccu gagugggagu uugucaauac
cccucccuua 3360gugaaguuau gguaccaguu agagaaagaa cccauaauag
gagcagaaac uuucuaugua 3420gauggggcag ccaauaggga aacuaaauua
ggaaaagcag gauauguaac ugacagagga 3480agacaaaaag uugucccccu
aacggacaca acaaaucaga agacugaguu acaagcaauu 3540caucuagcuu
ugcaggauuc gggauuagaa guaaacauag ugacagacuc acaauaugca
3600uugggaauca uucaagcaca accagauaag agugaaucag aguuagucag
ucaaauaaua 3660gagcaguuaa uaaaaaagga aaaagucuac cuggcauggg
uaccagcaca caaaggaauu 3720ggaggaaaug aacaaguaga uaaauugguc
agugcuggaa ucaggaaagu acuauuuuua 3780gauggaauag auaaggccca
agaagaacau gagaaauauc acaguaauug gagagcaaug 3840gcuagugauu
uuaaccuacc accuguagua gcaaaagaaa uaguagccag cugugauaaa
3900ugucagcuaa aaggggaagc caugcaugga caaguagacu guagcccagg
aauauggcag 3960cuagauugua cacauuuaga aggaaaaguu aucuugguag
caguucaugu agccagugga 4020uauauagaag cagaaguaau uccagcagag
acagggcaag aaacagcaua cuuccucuua 4080aaauuagcag gaagauggcc
aguaaaaaca guacauacag acaauggcag caauuucacc 4140aguacuacag
uuaaggccgc cuguuggugg gcggggauca agcaggaauu uggcauuccc
4200uacaaucccc aaagucaagg aguaauagaa ucuaugaaua aagaauuaaa
gaaaauuaua 4260ggacagguaa gagaucaggc ugaacaucuu aagacagcag
uacaaauggc aguauucauc 4320cacaauuuua aaagaaaagg ggggauuggg
ggguacagug caggggaaag aauaguagac 4380auaauagcaa cagacauaca
aacuaaagaa uuacaaaaac aaauuacaaa aauucaaaau 4440uuucggguuu
auuacaggga cagcagagau ccaguuugga aaggaccagc aaagcuccuc
4500uggaaaggug aaggggcagu aguaauacaa gauaauagug acauaaaagu
agugccaaga 4560agaaaagcaa agaucaucag ggauuaugga aaacagaugg
caggugauga uuguguggca 4620aguagacagg augaggauua acacauggaa
aagauuagua aaacaccaua uguauauuuc 4680aaggaaagcu aaggacuggu
uuuauagaca ucacuaugaa aguacuaauc caaaaauaag 4740uucagaagua
cacaucccac uaggggaugc uaaauuagua auaacaacau auuggggucu
4800gcauacagga gaaagagacu ggcauuuggg ucagggaguc uccauagaau
ggaggaaaaa
4860gagauauagc acacaaguag acccugaccu agcagaccaa cuaauucauc
ugcacuauuu 4920ugauuguuuu ucagaaucug cuauaagaaa uaccauauua
ggacguauag uuaguccuag 4980gugugaauau caagcaggac auaacaaggu
aggaucucua caguacuugg cacuagcagc 5040auuaauaaaa ccaaaacaga
uaaagccacc uuugccuagu guuaggaaac ugacagagga 5100cagauggaac
aagccccaga agaccaaggg ccacagaggg agccauacaa ugaauggaca
5160cuagagcuuu uagaggaacu uaagagugaa gcuguuagac auuuuccuag
gauauggcuc 5220cauaacuuag gacaacauau cuaugaaacu uacggggaua
cuugggcagg aguggaagcc 5280auaauaagaa uucugcaaca acugcuguuu
auccauuuca gaauugggug ucgacauagc 5340agaauaggcg uuacucgaca
gaggagagca agaaauggag ccaguagauc cuagacuaga 5400gcccuggaag
cauccaggaa gucagccuaa aacugcuugu accaauugcu auuguaaaaa
5460guguugcuuu cauugccaag uuuguuucau aacaaaagcc uuaggcaucu
ccuauggcag 5520gaagaagcgg agacagcgac gaagaccucc ucaaggcagu
cagacucauc aaguuucucu 5580aucaaagcag uaaguaauac auguaaugca
accuauacaa auagcaauag uagcauuagu 5640aguagcaaua auaauagcaa
uaguugugug guccauagua aucauagaau auaggaaaau 5700auuaagacaa
agaaaaauag acagguuaau ugauagacua auagaaagag cagaagacag
5760uggcaaugag agugaaggag aaauaucagc acuuguggag augggggugg
agauggggca 5820ccaugcuccu ugggauguug augaucugua gugcuacaga
aaaauugugg gucacagucu 5880auuauggggu accugugugg aaggaagcaa
ccaccacucu auuuugugca ucagaugcua 5940aagcauauga uacagaggua
cauaauguuu gggccacaca ugccugugua cccacagacc 6000ccaacccaca
agaaguagua uugguaaaug ugacagaaaa uuuuaacaug uggaaaaaug
6060acaugguaga acagaugcau gaggauauaa ucaguuuaug ggaucaaagc
cuaaagccau 6120guguaaaauu aaccccacuc uguguuaguu uaaagugcac
ugauuugaag aaugauacua 6180auaccaauag uaguagcggg agaaugauaa
uggagaaagg agagauaaaa aacugcucuu 6240ucaauaucag cacaagcaua
agagguaagg ugcagaaaga auaugcauuu uuuuauaaac 6300uugauauaau
accaauagau aaugauacua ccagcuauac guugacaagu uguaacaccu
6360cagucauuac acaggccugu ccaaagguau ccuuugagcc aauucccaua
cauuauugug 6420ccccggcugg uuuugcgauu cuaaaaugua auaauaagac
guucaaugga acaggaccau 6480guacaaaugu cagcacagua caauguacac
auggaauuag gccaguagua ucaacucaac 6540ugcuguuaaa uggcagucua
gcagaagaag agguaguaau uagaucuguc aauuucacgg 6600acaaugcuaa
aaccauaaua guacagcuga acacaucugu agaaauuaau uguacaagac
6660ccaacaacaa uacaagaaaa aaaauccgua uccagagggg accagggaga
gcauuuguua 6720caauaggaaa aauaggaaau augagacaag cacauuguaa
cauuaguaga gcaaaaugga 6780augccacuuu aaaacagaua gcuagcaaau
uaagagaaca auuuggaaau aauaaaacaa 6840uaaucuuuaa gcaauccuca
ggaggggacc cagaaauugu aacgcacagu uuuaauugug 6900gaggggaauu
uuucuacugu aauucaacac aacuguuuaa uaguacuugg uuuaauagua
6960cuuggaguac ugaaggguca aauaacacug aaggaaguga cacaaucaca
cucccaugca 7020gaauaaaaca auuuauaaac auguggcagg aaguaggaaa
agcaauguau gccccuccca 7080ucagcggaca aauuagaugu ucaucaaaua
uuacagggcu gcuauuaaca agagauggug 7140guaauaacaa caaugggucc
gagaucuuca gaccuggagg aggagauaug agggacaauu 7200ggagaaguga
auuauauaaa uauaaaguag uaaaaauuga accauuagga guagcaccca
7260ccaaggcaaa gagaagagug gugcagagag aaaaaagagc agugggaaua
ggagcuuugu 7320uccuuggguu cuugggagca gcaggaagca cuaugggcgc
agcgucaaug acgcugacgg 7380uacaggccag acaauuauug ucugguauag
ugcagcagca gaacaauuug cugagggcua 7440uugaggcgca acagcaucug
uugcaacuca cagucugggg caucaagcag cuccaggcaa 7500gaauccuggc
uguggaaaga uaccuaaagg aucaacagcu ccuggggauu ugggguugcu
7560cuggaaaacu cauuugcacc acugcugugc cuuggaaugc uaguuggagu
aauaaaucuc 7620uggaacagau uuggaaucac acgaccugga uggaguggga
cagagaaauu aacaauuaca 7680caagcuuaau acacuccuua auugaagaau
cgcaaaacca gcaagaaaag aaugaacaag 7740aauuauugga auuagauaaa
ugggcaaguu uguggaauug guuuaacaua acaaauuggc 7800ugugguauau
aaaauuauuc auaaugauag uaggaggcuu gguagguuua agaauaguuu
7860uugcuguacu uucuguagug aauagaguua ggcagggaua uucaccauua
ucguuucaga 7920cccaccuccc aaucccgagg ggacccgaca ggcccgaagg
aauagaagaa gaagguggag 7980agagagacag agacagaucc auucgauuag
ugaacggauc cuuagcacuu aucugggacg 8040aucugcggag ccugugccuc
uucagcuacc accgcuugag agacuuacuc uugauuguaa 8100cgaggauugu
ggaacuucug ggacgcaggg ggugggaagc ccucaaauau ugguggaauc
8160uccuacaaua uuggagucag gagcuaaaga auagugcugu uagcuugcuc
aaugccacag 8220cuauagcagu agcugagggg acagauaggg uuauagaagu
aguacaagaa gcuuauagag 8280cuauucgcca cauaccuaga agaauaggac
agggcuugga aaggauuuug cuauaagaug 8340gguggcaagu ggucaaaaag
uagugugguu ggauggccug cuguaaggga aagaaugaga 8400cgagcugagc
cagcagcaga ugggguggga gcagcaucuc gagaccuaga aaaacaugga
8460gcaaucacaa guagcaacac agcagcuaac aaugcugcuu gugccuggcu
agaagcacaa 8520gaggaggaga agguggguuu uccagucaca ccucagguac
cuuuaagacc aaugacuuac 8580aaggcagcug uagaucuuag ccacuuuuua
aaagaaaagg ggggacugga agggcuaauu 8640cacucccaac gaagacaaga
uauccuugau cuguggaucu accacacaca aggcuacuuc 8700ccugauuggc
agaacuacac accaggacca gggaucagau auccacugac cuuuggaugg
8760cgcuacaagc uaguaccagu ugagccagag aaguuagaag aagccaacaa
aggagagaac 8820accagcuugu uacacccugu gagccugcau ggaauggaug
acccggagag agaaguguua 8880gaguggaggu uugacagccg ccuagcauuu
caucacgugg cccgagagcu gcauccggag 8940uacuucaaga acugcugaua
ucgagcuugc uacaagggac uuuccgcugg ggacuuucca 9000gggaggcgug
gccugggcgg gacuggggag uggcgagccc ucagauccug cauauaagca
9060gcugcuuuuu gccuguacug ggucucucug guuagaccag aucugagccu
gggagcucuc 9120uggcuaacua gggaacccac ugcuuaagcc ucaauaaagc
uugccuugag ugcuucaagu 9180agugugugcc cgucuguugu gugacucugg
uaacuagaga ucccucagac ccuuuuaguc 9240aguguggaaa aucucuagca gu
92621013931RNAMus musculus 10uaccugccug agcuccgccu ccgaagaccc
uguagagcaa gcagcagggg cuaggcccgu 60ggccaggcca cagccaggaa gccaccccac
cauccauccg ccaugggccc acgaaagccu 120gcccugcgga cgccguuacu
gcugcuguuc cugcuacugu ucuuggacac cagcgucugg 180gcucaagaug
aaguccugga aaacuuaagc uucagcuguc caaaagaugc aacucgauuc
240aagcaccucc gaaaguacgu guacaacuau gaagcugaaa guuccagcgg
uguccagggc 300acagcugacu ccagaagcgc caccaagauc aacuguaagg
uagagcugga ggucccccaa 360aucugugguu ucaucaugag gaccaaccag
uguacccuua aagaggugua uggcuucaac 420ccugagggca aggccuugau
gaagaaaacc aagaacucug aagaguuugc agcugccaug 480uccagguacg
aacucaagcu ggccauuccu gaagggaaac aaauuguucu uuacccugac
540aaggaugaac cuaaauauau ccugaacauc aagaggggca ucaucucugc
ucuucugguu 600cccccagaga cagaagagga ccaacaagag uuguuccugg
auaccgugua uggaaacugc 660ucaacucagg uuaccgugaa uucaagaaag
ggaaccguac caacagaaau guccacagag 720agaaaccugc agcaauguga
cggcuuccag cccaucagua caagugucag cccucucgcu 780cucaucaaag
gccuggucca ccccuuguca acucuuauca gcagcagcca aacuugccag
840uacacccugg auccuaagag gaagcaugug ucugaagcug ucugugauga
gcagcaucuu 900uuccugccuu ucuccuacaa gaauaaguau gggaucauga
cacguguuac acagaaacug 960agucuugaag acacaccuaa gaucaacagu
cgcuucuuca gugaagguac caaccggaug 1020ggucuggccu uugagagcac
caaguccacg ucauccccaa agcaggcuga ugcuguuuug 1080aagacccuuc
aagaacugaa aaaauugucc aucucagagc agaaugcuca gagagcaaau
1140cucuucaaua aacugguuac ugagcugaga ggccucacug gugaagcaau
cacaucccuc 1200uugccacagc ugauugaagu guccagcccc aucacuuuac
aagccuuggu ucagugugga 1260cagccacagu gcuauacuca cauccuccag
uggcugaaaa cugagaaggc ucacccccuc 1320cugguugaca uugucaccua
ccugauggcu cugaucccaa aucccucaac acagaggcug 1380caggaaaucu
uuaauacugc caaggagcag cagagccgag ccacucugua ugcacugagc
1440cacgcaguua acagcuauuu ugauguggac cauucaagga gcccaguucu
gcaggauauc 1500gcugguuacc uguugaaaca gaucgacaau gaaugcacgg
gcaaugaaga ccacaccuuc 1560uugauucuga gggucauugg aaauauggga
agaaccaugg aacaaguaau gccagcccuc 1620aaguccucag uccugagcug
uguacgaagu acaaaaccau cucugcugau ucagaaagcu 1680gcucuccagg
cccugaggaa gauggaacug gaagaugagg uccggacgau ccuuuuugau
1740acauuuguaa auggugucgc ucccguggag aagagacugg cugccuaucu
cuugcugaug 1800aagaacccuu ccucaucaga uauuaacaaa auugcccaac
uucuccaaug ggaacagagu 1860gagcagguga agaacuucgu ggcaucucac
auugccaaca ucuugaacuc ggaagaacug 1920uauguccaag aucugaaagu
uuugaucaaa aaugcucugg agaauucuca auuuccaacg 1980aucauggacu
ucagaaaauu uucccgaaac uaucagauuu ccaaaucugc uucucuccca
2040auguucgacc cagucucagu caaaauagaa gggaaucuua uauuugaucc
aagcaguuau 2100cuucccagag aaagcuugcu gaaaacaacc cucacagucu
uuggacuugc uucacuugau 2160cucuuugaga uugguuuaga aggaaaaggg
uuugagccaa cacuagaagc ucuuuuuggu 2220aagcaaggau ucuucccaga
cagugucaac aaggcuuugu auugggucaa uggccgaguu 2280ccagauggug
ucuccaaggu cuugguggac cacuuuggcu auacuacaga uggcaagcau
2340gaacaggaca uggugaaugg aaucaugccc auuguggaca aguugaucaa
agaucugaaa 2400ucuaaagaaa uuccugaagc cagggccuau cuccgcaucc
uaggaaaaga gcuaagcuuu 2460gucagacucc aagaccucca aguccugggg
aagcuguugc ugaguggugc acaaacuuug 2520cagggaaucc cccagauggu
uguacaggcc aucagagaag ggucaaagaa ugacuuguuu 2580cuccacuaca
ucuucaugga caaugccuuu gagcucccca cuggagcagg guuacagcug
2640caaguguccu cgucuggagu cuucaccccc gggaucaagg cugguguaag
acuggaauua 2700gccaacauac aggcagagcu aguggcaaag cccucugugu
ccuuggaguu ugugacaaau 2760augggcauca ucaucccaga cuucgcuaag
agcagugucc agaugaacac caacuucuuc 2820cacgagucag gccuggaggc
gcgaguggcc cugaaggcug ggcagcugaa ggucaucauu 2880ccuucuccaa
agaggccagu caagcuguuc aguggcagca acacacugca ucuggucucu
2940accaccaaaa cagaagugau cccaccucug guugagaaca ggcaguccug
gucaacuugc 3000aagccucucu ucacuggaau gaacuacugu accacaggag
cuuacuccaa cgccagcucc 3060acggagucug ccucuuacua cccacugaca
ggggacacaa gguaugagcu ggagcugagg 3120cccacgggag aaguggagca
guauucugcc acugcaaccu augaacuccu aaaagaggac 3180aagucuuugg
uugacacauu gaaguuccua guucaagcag aaggagugca gcagucugaa
3240gcuacuguac uguucaaaua uaaucggaga agcaggaccu uaucuaguga
aguccuaauu 3300ccaggguuug augucaacuu cgggacaaua cuaagaguua
augaugaauc ugcuaaggac 3360aaaaacacuu acaaacucau ccuggacauu
cagaacaaga aaaucacuga ggucucucuc 3420gugggccacu ugaguuauga
uaaaaaggga gauggcaaga ucaaaggugu uguuuccaua 3480ccacguuugc
aagcagaagc caggagugag guccacaccc acugguccuc caccaaacug
3540cucuuccaaa uggacucauc ugcuacagcu uacggcucaa caauuuccaa
gagagugaca 3600uggcguuacg auaaugagau aauagaauuu gauuggaaca
cgggaaccaa uguggauacc 3660aaaaaagugg ccuccaauuu cccuguggau
cuuucccauu auccuagaau guugcaugag 3720uaugccaaug gucuccugga
ucacagaguc ccucaaacag augugacuuu ucgggacaug 3780gguuccaaau
uaauuguugc aacaaacaca uggcuucaga uggcaaccag gggucuuccu
3840uacccccaaa cucuacagga ucaccucaau agccucucag aguugaaccu
ccugaaaaug 3900ggacugucug acuuccauau uccagacaac cucuuccuaa
agacugaugg cagagucaaa 3960uacacaauga acaggaacaa aauaaacauu
gacaucccuu ugccuuuggg uggcaagucu 4020ucaaaagacc ucaagaugcc
agagagugug aggacaccag cccucaacuu caagucugug 4080ggauuccauc
ugccaucucg agagguccag guccccacuu uuacaauccc caagacacau
4140cagcuucaag ugccucucuu ggguguucua gaccuuucca caaaugucua
cagcaauuug 4200uacaacuggu cagccuccua cacugguggc aacaccagca
gagaccacuu cagccuucag 4260gcucaguacc gcaugaagac ugacucugug
guugaccugu uuuccuacag ugugcaagga 4320ucuggagaaa caacauauga
cagcaagaac acauuuacau uguccuguga uggaucucua 4380caccauaaau
uucuagacuc aaaauucaaa gucagccacg uagaaaaauu uggaaacagc
4440ccagucucaa aagguuuacu aacauuugaa acaucuagug ccuugggacc
acagaugucu 4500gcuacuguuc accuagacuc aaaaaagaaa caacaucuau
acgucaaaga uaucaagguu 4560gauggacagu ucagagcuuc uucauuuuau
gcucaaggca aauauggccu gucuugugag 4620agagauguua caacuggcca
gcugagcggc gaauccaaca ugagauuuaa cuccaccuac 4680uuccagggca
ccaaccagau cgugggaaug uaccaggaug gagcccuguc caucaccucc
4740acuucugacc ugcaagaugg cauauucaag aacacagcuu ccuugaaaua
ugaaaacuau 4800gagcugacuc ugaaaucuga uagcaguggg caguaugaga
acuucgcugc uuccaacaag 4860cuggauguga ccuucucuac gcaaagugca
cugcugcguu cugaacacca ggccaauuac 4920aagucccuga ggcuugucac
ccuucuuuca ggaucccuca cuucccaggg uguagaauua 4980aaugcugaca
ucuugggcac agacaaaauu aauacuggug cucacaaggc aacacuaaag
5040auugcacgug auggacuauc aaccagugcg accaccaacu ugaaguacag
cccccugcug 5100cuggagaaug aguugaaugc agagcuuggg cucucugggg
cauccaugaa auuaucaaca 5160aacggccgcu ucaaagaaca ccaugcaaaa
uucagucuug augggagagc ugcccucaca 5220gaggugucac uggggagcau
uuaccaggcc augauucugg gugcagacag caaaaacauc 5280uucaacuuca
aacucagccg agaagggcug aggcugucca augauuugau gggcuccuau
5340gcugagauga aacuugacca cacacacagu cugaacauug caggucucuc
acuggacuuc 5400uucucaaaaa uggacaauau uuacagugga gacaaguucu
auaagcagaa uuuuaacuua 5460cagcuacagc ccuauucuuu cauaacuacu
uuaagcaacg accugagaua uggugcucua 5520gauuugacca acaauggaag
guuucggcug gagccacuga agcugaaugu ggguggcaac 5580uuuaaaggaa
ccuaucaaaa uaaugagcug aaacauaucu auaccauauc uuauacugac
5640cugguaguag caaguuacag agcagacacu guggcuaagg uucagggugu
cgaauucagc 5700cauaggcuaa augcagacau ugaaggacug acuuccucug
uugaugucac uaccagcuac 5760aauucagauc cacugcauuu uaacaauguu
uuccacuuuu cucuggcacc uuuuaccuug 5820ggcaucgaca cacauacaag
uggugauggg aaacuguccu ucuggggaga acacacuggg 5880cagcuauaua
guaaguuucu guugaaagca gaaccucugg cacuuauugu cucucaugac
5940uacaaaggau ccacaagcca cagucucccg uacgagagca gcaucagcac
ggcucuugaa 6000cacacaguca gugccuugcu gacgccagcu gagcagacaa
gcaccuggaa auucaagacc 6060aaacugaaug acaaaguaua cagccaggac
uuugaagccu acaacacuaa agacaaaauc 6120gguguugagc uuaguggacg
ggcugaccuc ucugggcugu auucuccaau uaaacuaccg 6180uuuuucuaca
gugagccugu caauguccuu aauggcuuag agguaaauga ugcuguugac
6240aagccccaag aauucacaau uauugcugug gugaaguacg auaagaacca
ggauguucac 6300accaucaacc ucccauucuu caaaagccug ccagacuauu
uggagagaaa ucgaagagga 6360augauaaguc uacuggaagc caugcgaggg
gaauugcaac gccucagugu ugaucaguuu 6420gugaggaaau acagagcggc
ccugagcaga cuuccucagc agauucauca uuaucugaau 6480gcaucugacu
gggagagaca aguagcuggu gccaaggaaa aaauaacuuc uuucauggaa
6540aauuauagaa uuacagauaa ugauguacua auugccauag auagugccaa
aaucaacuuc 6600aaugaaaaac ucucucaacu ugagacauac gcgauacaau
uugaucagua uauuaaagau 6660aauuaugauc cacaugacuu aaaaagaacu
auugcugaga uuauugaucg aaucauugaa 6720aaguuaaaaa uucuugauga
acaguaucau auccguguaa aucuagcaaa aucaauccau 6780aaucucuauu
uauuuguuga aaacguugau cuuaaccaag ucaguaguag uaacaccucu
6840uggauccaaa auguggauuc caauuaucaa gucagaaucc aaauucaaga
aaaacuacag 6900cagcucagga cacaaauuca gaauauagac auucagcagc
uugcugcaga gguaaaacga 6960cagauggacg cuauugaugu cacaaugcau
uuagaucaau ugagaacugc aauucuauuc 7020caaagaauaa gugacauuau
ugaccguguc aaauacuuug uuaugaaucu uauugaagau 7080uuuaaaguaa
cugagaaaau caauacuuuu agaguuauag uccgugagcu aauugagaaa
7140uaugaaguag accaacacau ccagguuuua auggauaaau caguagaguu
ggcccacaga 7200uauagccuga gcgagccucu ucagaaacuc aguaaugugc
uacagcgaau ugagauaaaa 7260gauuacuaug agaaauuggu uggguuuauu
gaugauacug uugaguggcu uaaagcauug 7320ucuuucaaaa auaccauuga
agaacuaaau agauugacug acauguuggu gaagaaguug 7380aaagcauuug
auuaucacca guuuguagac aaaaccaaca gcaaaauccg ugagaugacu
7440cagagaauca augcugaaau ccaagcucuc aaacuuccac aaaaaaugga
agcauuaaaa 7500cuguugguag aagacuucaa aaccacaguc uccaauuccc
uggaaagacu caaggacacc 7560aaaguaacug uggucauuga uuggcugcag
gauauuuuga cucaaaugaa agaccauuuc 7620caagauacuc uggaagaugu
aagagaccga auuuaucaaa uggacauuca gagggaacug 7680gagcacuucu
ugucucuggu aaaccaaguu uacaguacac uggucaccua uaugucugac
7740ugguggacuc ugacugcuaa aaacauaaca gacuuugcag agcaauauuc
cauccaaaac 7800ugggcugaga guauaaaagu acugguggaa caaggauuca
uaguuccuga aaugcaaaca 7860uuucugugga ccaugccugc uuuugagguc
agucuccgug cucuccaaga agguaacuuu 7920cagaccccug ucuuuauagu
ccccuugaca gauuugagga uuccaucaau ucggauaaac 7980uuuaaaaugu
uaaagaauau aaaaauccca uugagauuuu ccacuccaga auucacucuu
8040cucaacaccu uccaugucca uuccuuuaca auugacuugc uggaaauaaa
agcaaagauc 8100auuagaacua ucgaccaaau uuugagcagu gagcuacagu
ggccucuucc agaaauguau 8160uugagagacc uggauguagu gaacauuccu
cuugcaagac ugacucugcc agacuuccau 8220guaccagaaa ucacaauucc
agaauucaca aucccaaaug ucaaucucaa agauuuacac 8280guuccugauc
uucacauacc agaauuccaa cuuccucacc ucucacauac aauugaaaua
8340ccugcuuuug gcaaacugca uagcauccuu aagauccaau cuccucucuu
uauauuagau 8400gcuaaugcca acauacagaa uguaacaacu ucagggaaca
aagcagagau uguggcuucu 8460gucacugcua aaggagaguc ccaauuugaa
gcucucaauu uugauuuuca agcacaagcu 8520caauuccugg aguuaaaucc
ucauccucca guccugaagg aauccaugaa cuucuccagu 8580aagcauguga
gaauggagca ugagggugag auaguauuug auggaaaggc cauugagggg
8640aaaucagaca cagucgcaag uuuacacaca gagaaaaaug aaguagaguu
uaauaauggu 8700augacuguca aaguaaacaa ucagcucacc cuugacaguc
acacaaagua cuuccacaag 8760uugaguguuc cuaggcugga cuucuccagu
aaggcuucuc uuaauaauga aaucaagaca 8820cuauuagaag cuggacaugu
ggcauugaca ucuucaggga cagggucaug gaacugggcc 8880ugucccaacu
ucucggauga aggcauacau ucgucccaaa uuagcuuuac uguggauggu
8940cccauugcuu uuguuggacu auccaauaac auaaauggca aacacuuacg
ggucauccaa 9000aaacugacuu augaaucugg cuuccucaac uauucuaagu
uugaaguuga gucaaaaguu 9060gaaucucagc acgugggcuc cagcauucua
acagccaaug gucgggcacu gcucaaggac 9120gcaaaggcag aaaugacugg
ugagcacaau gccaacuuaa auggaaaagu uauuggaacu 9180uugaaaaauu
cucucuucuu uucagcacaa ccauuugaga uuacugcauc cacaaauaau
9240gaaggaaauu ugaaaguggg uuuuccacua aagcugacug ggaaaauaga
cuuccugaau 9300aacuaugcau uguuucugag uccccgugcc caacaagcaa
gcuggcaagc gaguaccaga 9360uucaaucagu acaaauacaa ucaaaacuuu
ucugcuauaa acaaugaaca caacauagaa 9420gccaguauag gaaugaaugg
agaugccaac cuggauuucu uaaacauacc uuuaacaauu 9480ccugaaauua
acuugccuua cacggaguuc aaaacucccu uacugaagga uuucuccaua
9540ugggaagaaa caggcuugaa agaauuuuug aagacaacaa agcaaucauu
ugauuugagu 9600guaaaggcuc aauauaaaaa gaacagugac aagcauucca
uuguuguccc ucuggguaug 9660uuuuaugaau uuauucucaa caaugucaau
ucgugggaca gaaaauuuga gaaagucaga 9720aacaaugcuu uacauuuucu
uaccaccucc uauaaugaag caaaaauuaa gguugauaag 9780uacaaaacug
aaaauucccu uaaucagccc ucugggaccu uucaaaauca uggcuacacu
9840aucccaguug ucaacauuga aguaucucca uuugcuguag agacacuggc
uuccagccau 9900gugaucccca cagcaauaag caccccaagu gucacaaucc
cugguccuaa caucauggug 9960ccuucauaca aguuagugcu gccaccccug
gaguugccag uuuuccaugg uccugggaau 10020cuauucaagu uuuuccuccc
agauuucaag ggauucaaca cuauugacaa uauuuauauu 10080ccagccaugg
gcaacuuuac cuaugacuuu ucuuuuaaau caagugucau cacacugaau
10140accaaugcug gacuuuauaa ccaaucagau aucguugccc auuuccuuuc
uuccucuuca 10200uuugucacug acgcccugca guacaaauua gagggaacau
cacgucugau gcgaaaaagg 10260ggauugaaac uagccacagc ugucucucua
acuaacaaau uuguaaaggg cagucaugac 10320agcaccauua guuuaaccaa
gaaaaacaug gaagcaucag ugagaacaac ugccaaccuc 10380caugcuccca
uauucucaau gaacuucaag caggaacuua auggaaauac caagucaaaa
10440cccacuguuu caucauccau ugaacuaaac uaugacuuca auuccucaaa
gcugcacucu 10500acugcaacag gaggcauuga ucacaaguuc agcuuagaaa
gucucacuuc cuacuuuucc 10560auugagucau ucaccaaagg aaauaucaag
aguuccuucc
uuucucagga auauucagga 10620aguguugcca augaagccaa uguauaucug
aauuccaagg guacucgguc uucagugagg 10680cuacaaggag cuuccaaagu
ugaugguauc uggaacguug aaguaggaga aaauuuugcu 10740ggagaagcca
cccuccaacg caucuacacc acaugggagc acaauaugaa aaaccauuug
10800cagguauaua gcuacuucuu cacaaaagga aagcaaacau gcagagcuac
uuuggagcuc 10860uccccaugga ccaugucaac cuugcuacag guucauguga
gucaacucag uucccuccuu 10920gaccuccauc acuuugacca ggaagugauc
cuaaaagcua acacuaagaa ccagaagauc 10980agcuggaaag guggggucca
gguugaauca cggguucuuc agcacaaugc acaguucucc 11040aaugaccaag
aagaaauacg gcuugaccuu gcaggauccu uagacggaca gcugugggac
11100cuugaagcua ucuuuuuacc aguauauggc aagagcuugc aggaacuccu
acaaauggau 11160ggaaagcgac aguaucuuca agcuucaacu ucucuucuau
auaccaaaaa cccuaauggc 11220uaucuccucu cacuccccgu gcaagaacug
gcugauagau uuauuauacc agggauaaaa 11280cuaaaugacu ucaguggagu
aaaaaucuau aagaaguuaa guacuucacc auuugcccuc 11340aaccuaacaa
ugcuccccaa aguaaaauuc ccugggauug aucuguuaac acaguacucu
11400acaccagagg gcuccucugu cccuauuuuu gaggcaacua uaccugaaau
ucauuuaacu 11460guaucccagu uuacacuucc aaagagccuu ccaguuggca
acacagucuu ugaucugaau 11520aaguuggcca acaugauugc cgauguugac
cugccuagug ucacccugcc ugagcagacu 11580auuguaaucc cacccuugga
guucucugua ccugcuggga uuuuuauucc uuucuuugga 11640gaacugacug
cacgugcugg gauggcuucu ccccuguaua augucacuug gagcgcuggu
11700uggaaaacca aagcagauca uguugaaacg uuccuagauu ccaugugcac
uucaaccuug 11760caguuucugg aguaugcuuu aaaaguugua gaaacacaca
aaauugaaga agaucuguua 11820accuauaaua ucaaaggaac acuucaacac
ugugacuuca auguggagua uaaugaagau 11880ggucuauuua aaggacuuug
ggacuggcag ggagaggcuc accuggacau caccagccca 11940gcacugacug
acuuucaucu guacuacaaa gaagacaaga caagucuguc ugccucagca
12000gccuccucga ccaucggcac ugugggucug gauucgagca cagaugacca
gaguguggag 12060cugaaugucu acuuccaccc acaguccccu ccagagaaga
aacucagcau auucaaaacu 12120gaguggaggu acaaggaguc ugauggugaa
agguacauca aaauuaauug ggaagaagag 12180gcagcuucca gauugcuagg
cucccuaaaa agcaaugugc ccaaggcuuc uaaggcuauu 12240uaugauuaug
ccaauaagua ccaccuggaa uacguuucuu cagaacuaag aaaaagucua
12300caggucaaug cugaacaugc cagaaggaug guugaugaaa ugaacaugag
uuuccagaga 12360guagcccgug auaccuacca gaaucucuau gaggagaugu
uggcucagaa gagccugagc 12420aucccugaga aucucaagaa gaggguguua
gacaguauag uacauguuac ucagaaguac 12480cacauggcag ucauguggcu
gauggacuca uucauucauu uucugaaauu caauagaguc 12540caguucccag
gguacgcugg aacauauacu guggacgaac ucuacacuau agucaugaag
12600gaaaccaaga agucacuguc ucagcuguuu aauggguuag gaaaccuacu
uuccuacguu 12660caaaaccaag uagagaaauc aagauuaauc aaugacauaa
cauuuaaaug uccuuuuuuc 12720ucaaaaccuu guaaacuaaa agaucucaua
uugauuuuca gggaggaguu aaacauuuua 12780ucaaacauag gccaacagga
uaucaaguuu acaacaauac uaaguagucu ucagggcuuu 12840uuggagagag
uuuuagacau cauagaagaa caaauuaaau gccuaaagga caaugaaucu
12900acuuguguug cugaccauau caacaugguu uucaaaauac aggucccaua
ugcuuuuaaa 12960ucccuaagag aagacauaua cuuuguccuc ggugaguuca
augacuuucu ucaauccaua 13020cuucaggagg gguccuacaa gcuacagcag
guccaucagu auaugaaggc ccuucgugaa 13080gaguauuuug auccgagcau
gguugggugg acagugaaau auuaugaaau agaagaaaau 13140augguugagc
ugaucaagac ccuuuuaguu uccuuuaggg augucuacuc ugaauauagu
13200gugacagcug cugauuuugc uuccaaaaug ucaacucaag uugaacaauu
uguguccagg 13260gauaucagag aguaucuuag caugcuuacu gauauaaaug
gaaaguggau ggaaaagauu 13320gcagagcuuu cuauuguggc aaaggaaaca
augaaaagcu gggucacugc cguggccaaa 13380auaaugucug auuaccccca
gcaguuccac uccaaucugc aggauuuuuc agaccaacuc 13440ucuagcuacu
augaaaaauu uguuggugag uccacaagau ugauugaccu guccauucaa
13500aacuaccacg uguuucucag auacaucacc gaguuacuga gaaagcugca
gguggccaca 13560gccaauaaug ugagccccua uauaaagcuu gcucaaggag
agcugaugau caccuucuga 13620uucaucuacu aacaaauuca aauuaaaccu
ucacauagua ggagacuuug uagacuacua 13680uaaagaccau ccugagccag
accugcaguc aacagcaaga gcaagaagca cauaggaacu 13740auaccugcaa
ccaagcuggc auaagaacca agaccuucaa agcagccuga acucaagaug
13800acauauuuua caaguuagag uaaagucaag agcugaguug uuuuguccaa
cucaggaugg 13860agggagggag ggaaggggaa auaaauaaau acuuccuuau
ugugcagcaa aaaaaaaaaa 13920aaaaaaaaaa a 139311121RNAAequorea
victoria 11gggcagcuug ccgguggugu u 211221RNAAequorea victoria
12caccaccccg gugaacagcu u 211321RNAAequorea victoria 13gcuguucacg
ucgcugcccu u 211419DNAAequorea victoria 14gctgttcacg tcgctgccc
191580DNAArtificial SequenceOligo for MV-siRNA expressing clones
15gatcccccac caccccggtg aacagcgtta gctgttcacg tcgctgcccg ttagggcagc
60ttgccggtgg tgttttttta 801675DNAArtificial SequenceOligo for
MV-siRNA expressing clones 16agcttaacac caccggcaag ctgccctaac
gggcagcgac gtgaacagct aacgctgttc 60accggggtgg tgggg
7517144DNAArtificial SequenceOligo for MV-siRNA expressing clones
17gatcccccac caccccggtg aacagcttgt aggtggcatc gcagaagcga tgccacctac
60aagctgttca cgtcgctgcc cttgtaggtg gcatcgcaga agcgatgcca cctacaaggg
120cagcttgccg gtggtgtttt ttta 14418139DNAArtificial SequenceOligo
for MV-siRNA expressing clones 18agcttaacac caccggcaag ctgcccttgt
aggtggcatc gcttctgcga tgccacctac 60aagggcagcg acgtgaacag cttgtaggtg
gcatcgcttc tgcgatgcca cctacaagct 120gttcaccggg gtggtgggg
1391989DNAArtificial SequenceOligo for MV-siRNA expressing clones
19gatcccccgt gctgcttcat gtggtcgttg ttacgaccac aatggcgaca accttgttag
60gttgtcgggc agcagcacgt tttttttta 892084DNAArtificial SequenceOligo
for MV-siRNA expressing clones 20agcttaaaac gtgctgctgc ccgacaacct
aacaaggttg tcgccattgt ggtcgtaaca 60acgaccacat gaagcagcac gggg
8421147DNAArtificial SequenceOligo for MV-siRNA expressing clones
21gatcccccgt gctgcttcat gtggtcgttg taggtggcat cgcagaagcg atgccaccta
60caacgaccac aatggcgaca accttgtagg tggcatcgca gaagcgatgc cacctacaag
120gttgtcgggc agcagcacgt tttttta 14722142DNAArtificial
SequenceOligo for MV-siRNA expressing clones 22agcttaacgt
gctgctgccc gacaaccttg taggtggcat cgcttctgcg atgccaccta 60caaggttgtc
gccattgtgg tcgttgtagg tggcatcgct tctgcgatgc cacctacaac
120gaccacatga agcagcacgg gg 1422362DNAArtificial SequenceOligo for
MV-siRNA expressing clones 23gatccccgca agctgaccct gaagttcttc
aagagagaac ttcagggtca gcttgctttt 60ta 622462DNAArtificial
SequenceOligo for MV-siRNA expressing clones 24agcttaaaaa
gcaagctgac cctgaagttc tctcttgaag aacttcaggg tcagcttgcg 60gg
622521RNAArtificial Sequencesynthetic siRNA 25cugcugguag uggucggcgu
u 212621RNAArtificial Sequencesynthetic siRNA 26cgccgacuuc
gugacgugcu u 212721RNAArtificial Sequencesynthetic siRNA
27gcacgucgcc guccagcagu u 212821RNAArtificial Sequencesynthetic
siRNA 28guugccgucg uccuugaagu u 212921RNAArtificial
Sequencesynthetic siRNA 29cuucaagugg aacuacggcu u
213021RNAArtificial Sequencesynthetic siRNA 30gccguaggua ggcggcaacu
u 213167RNAArtificial Sequencemultivalent-siRNA clones 31cgccgacuuc
gugacgugcu ugugcacguc gccguccagc aguugucugc ugguaguggu 60cggcguu
673280DNAArtificial Sequencemultivalent-siRNA clones 32gatcccccgc
cgacttcgtg acgtgcttgt gcacgtcgcc gtccagcagt tgtctgctgg 60tagtggtcgg
cgttttttta 803380DNAArtificial Sequencemultivalent-siRNA clones
33agcttaaaaa aacgccgacc actaccagca gacaactgct ggacggcgac gtgcacaagc
60acgtcacgaa gtcggcgggg 8034131RNAArtificial
Sequencemultivalent-siRNA clones 34cgccgacuuc gugacgugcu uguagguggc
aucgcagaag cgaugccacc uacaagcacg 60ucgccgucca gcaguuguag guggcaucgc
agaagcgaug ccaccuacaa cugcugguag 120uggucggcgu u
13135142DNAArtificial Sequencemultivalent-siRNA clones 35gatcccccgc
cgacttcgtg acgtgcttgt aggtggcatc gcagaagcga tgccacctac 60aagcacgtcg
ccgtccagca gttgtaggtg gcatcgcaga agcgatgcca cctacaactg
120ctggtagtgg tcggcgtttt ta 14236142DNAArtificial
Sequencemultivalent-siRNA clones 36agcttaaaaa cgccgaccac taccagcagt
tgtaggtggc atcgcttctg cgatgccacc 60tacaactgct ggacggcgac gtgcttgtag
gtggcatcgc ttctgcgatg ccacctacaa 120gcacgtcacg aagtcggcgg gg
1423767RNAArtificial Sequencemultivalent-siRNA clones 37cuucaagugg
aacuacggcu ugugccguag guaggcggca acuuguguug ccgucguccu 60ugaaguu
673860DNAArtificial Sequencemultivalent-siRNA clones 38gatccccgga
tccgacatcc acgttcttca agagagaacg tggatgtcgg atccttttta
603960DNAArtificial Sequencemultivalent-siRNA clones 39agcttaaaaa
ggatccgaca tccacgttct ctcttgaaga acgtggatgt cggatccggg
6040131RNAArtificial Sequencemultivalent-siRNA clones 40cuucaagugg
aacuacggcu uguagguggc aucgcagaag cgaugccacc uacaagccgu 60agguaggcgg
caacuuguag guggcaucgc agaagcgaug ccaccuacaa guugccgucg
120uccuugaagu u 13141142DNAArtificial Sequencemultivalent-siRNA
clones 41gatccccctt caagtggaac tacggcttgt aggtggcatc gcagaagcga
tgccacctac 60aagccgtagg taggcggcaa cttgtaggtg gcatcgcaga agcgatgcca
cctacaagtt 120gccgtcgtcc ttgaagtttt ta 14242142DNAArtificial
Sequencemultivalent-siRNA clones 42agcttaaaaa cttcaaggac gacggcaact
tgtaggtggc atcgcttctg cgatgccacc 60tacaagttgc cgcctaccta cggcttgtag
gtggcatcgc ttctgcgatg ccacctacaa 120gccgtagttc cacttgaagg gg
1424377DNAArtificial SequenceAnti-HIV MV-siRNA oligo 43gatccccgtg
aaggggaacc aagagattga tctcttgtta atatcagctt gagctgatat 60ttctccttca
cttttta 774477DNAArtificial SequenceAnti-HIV MV-siRNA oligo
44agcttaaaaa gtgaaggaga aatatcagct caagctgata ttaacaagag atcaatctct
60tggttcccct tcacggg 774580DNAArtificial SequenceAnti-HIV MV-siRNA
oligo 45gatcccccaa gcagttttag gctgacgtta gtcagcctca ttgacacagg
ttactgtgtc 60agctgctgct tgttttttta 804680DNAArtificial
SequenceAnti-HIV MV-siRNA oligo 46agcttaaaaa aacaagcagc agctgacaca
gtaacctgtg tcaatgaggc tgactaacgt 60cagcctaaaa ctgcttgggg
804721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
47gccuucccuu gugggaaggu u 214821RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 48ccuucccuug ugggaaggcu u
214921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
49gccuuccuug ugggaaggcu u 215021RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 50uucugcaccu uaccucuuau u
215121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
51uaagaggaag uaugcuguuu u 215221RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 52aacagcaguu guugcagaau u
215321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
53ccagacaaua auugucuggu u 215421RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 54cucccaggcu cagaucuggu u
215521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
55ccagaucuuc ccuaaaaaau u 215621RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 56uuuuuuaucu gccugggagu u
215721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
57uggguucccu aguuagccau u 215821RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 58uggcuaagau cuacagcugu u
215921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
59cagcuguccc aagaacccau u 216021RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 60auccuuugau gcacacaauu u
216121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
61auugugucac uuccuucagu u 216221RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 62cugaaggaag cuaaaggauu u
216321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
63uccuguguca gcugcugcuu u 216421RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 64agcagcauug uuagcugcuu u
216521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
65agcagcuuua uacacaggau u 216621RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 66accaacaagg uuucugucau u
216721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
67ugacagaucu aauuacuacu u 216821RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 68guaguaauua ucuguugguu u
216921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
69cugagggaag cuaaaggauu u 217021RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 70caaagcuaga ugaauugcuu u
217121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
71agcaauuggu acaagcaguu u 217221RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 72acugcuuguu agagcuuugu u
217321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
73aggucagggu cuacuugugu u 217421RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 74cacaagugcu gauauuucuu u
217521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
75agaaauaauu gucugaccuu u 217621RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 76cuaaguuaug gagccauauu u
217721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
77auauggccug auguaccauu u 217821RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 78augguacuuc ugaacuuagu u
217921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
79uggcuccauu ucuugcucuu u 218021RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 80agagcaaccc caaauccccu u
218121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
81ggggauuuag ggggagccau u 218221RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 82aucuccacaa gugcugauau u
218321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
83uaucagcagu ucuugaaguu u 218421RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 84acuucaaauu guuggagauu u
218521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
85agacugugac ccacaauuuu u 218621RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 86aaauugugga ugaauacugu u
218721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
87caguauuugu cuacagucuu u 218821RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 88acaggccugu guaaugacuu u
218921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
89agucauuggu cuuaaagguu u 219021RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 90accuuuagga caggccuguu u
219121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
91ucaguguuau uugacccuuu u 219221RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 92aagggucuga gggaucucuu u
219321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
93agagaucuuu ccacacugau u 219421RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 94cauagugcuu ccugcugcuu u
219521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
95agcagcauug uuagcugcuu u 219621RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 96agcagcuaac agcacuaugu u
219721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
97gcugcuuaua ugcaggaucu u 219821RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 98gauccugucu gaagggaugu u
219921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
99caucccuguu aaaagcagcu u 2110021RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 100uggucuaacc agagagaccu u
2110121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
101ggucucuuuu aacauuugcu u 2110221RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 102gcaaauguuu ucuagaccau u
2110321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences
103cucccaggcu cagaucuggu u 2110421RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 104uggguucccu aguuagccau u
2110521RNAArtificial SequenceTrivalent MV-siRNA to ApoB
105uggaacuuuc agcuucauau u 2110621RNAArtificial SequenceTrivalent
MV-siRNA to ApoB 106uaugaaggca ccaugauguu u 2110721RNAArtificial
SequenceTrivalent MV-siRNA to ApoB 107acaucaucuu ccaguuccau u
2110821RNAArtificial SequenceTrivalent MV-siRNA to ApoB
108acucuucaga guucuugguu u 2110921RNAArtificial SequenceTrivalent
MV-siRNA to ApoB 109accaagaccu uggagacacu u 2111021RNAArtificial
SequenceTrivalent MV-siRNA to ApoB 110gugucucagu uggaagaguu u
2111121RNAArtificial SequenceTrivalent MV-siRNA to ApoB
111accuggacau ggcagcugcu u 2111221RNAArtificial SequenceTrivalent
MV-siRNA to ApoB 112gcagcugcaa acucuucagu u 2111321RNAArtificial
SequenceTrivalent MV-siRNA to ApoB 113cugaagacgu auuccagguu u
2111421RNAArtificial SequenceTrivalent MV-siRNA to ApoB
114caggguaaag aacaauuugu u 2111521RNAArtificial SequenceTrivalent
MV-siRNA to ApoB 115caaauugcug uagacauuuu u 2111621RNAArtificial
SequenceTrivalent MV-siRNA to ApoB 116aaauguccag cguacccugu u
2111723RNAArtificial SequenceTrivalent MV-siRNA to ApoB
117cccuggacac cgcuggaacu uuu 2311823RNAArtificial SequenceTrivalent
MV-siRNA to ApoB 118aaguuccaau aacuuuucca uuu 2311923RNAArtificial
SequenceTrivalent MV-siRNA to ApoB 119auggaaaagg caaguccagg guu
2312024RNAArtificial SequenceTrivalent MV-siRNA to ApoB
120cccuggacac cgcuggaacu uuuu 2412124RNAArtificial
SequenceTrivalent MV-siRNA to ApoB 121aaaguuccaa uaacuuuucc auuu
2412224RNAArtificial SequenceTrivalent MV-siRNA to ApoB
122auggaaaaug gcaaguccag gguu 2412321RNAArtificial SequenceBivalent
MV-siRNA oligo to ApoB 123ugaaucgagu ugcaucuuuu u
2112421RNAArtificial SequenceBivalent MV-siRNA oligo to ApoB
124aaagaugcug cucaucacau u 2112521RNAArtificial SequenceBivalent
MV-siRNA oligo to ApoB 125ugugaugaca cucgauucau u
2112623RNAArtificial SequenceBivalent MV-siRNA oligo to
ApoBmodified_base2,7n = any base, universal base, rSpacer, linker
phosphoramidite, 5-nitrodole, PC Spacer, or abasic base
126unguganuga cacucgauuc auu 2312719DNAArtificial SequenceBivalent
MV-siRNA oligo to ApoB 127tgtgatgaca ctcgattca 1912821RNAArtificial
SequenceBivalent MV-siRNA oligo to ApoB 128cagcuugagu ucguaccugu u
2112921RNAArtificial SequenceBivalent MV-siRNA oligo to ApoB
129cagguacaga gaacuccaau u 2113021RNAArtificial SequenceBivalent
MV-siRNA oligo to ApoB 130uuggagucug accaagcugu u
2113121RNAArtificial SequenceBivalent MV-siRNA oligo to
ApoBmodified_base13, 19n = any base, universal base, rSpacer,
linker phosphoramidite, 5-nitrodole, PC Spacer, or abasic base
131uuggagucug acnaagcunu u 2113219DNAArtificial SequenceBivalent
MV-siRNA oligo to ApoB 132ttggagtctg accaagctg 1913321RNAArtificial
SequenceTrivalent MV-siRNA oligonucleotide to ApoB 133ucagggccgc
ucuguauuuu u 2113421RNAArtificial SequenceTrivalent MV-siRNA
oligonucleotide to ApoB 134aaauacauuu cuggaagagu u
2113521RNAArtificial SequenceTrivalent MV-siRNA oligonucleotide to
ApoB 135cucuuccaaa aagcccugau u 2113665RNAArtificial
SequenceTrivalent MV-siRNA oligonucleotide to ApoBmodified_base22,
44n = any base, universal base, rSpacer, linker phosphoramidite,
5-nitrodole, PC Spacer, or abasic base 136aaauacauuu cuggaagagu
uncucuucca aaaagcccug auunucaggg ccgcucugua 60uuuuu
6513721RNAArtificial Sequencemultivalent-siRNA oligonucleotide
targeted to ApoB 137aacccacuuu caaauuuccu u 2113821RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to ApoB
138ggaaauugag aauucuccau u 2113921RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to ApoB
139uggagaaucu caguggguuu u 2114021RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to
ApoBmodified_base5,13,18n = any base, universal base, rSpacer,
linker phosphoramidite, 5-nitrodole, PC Spacer, or abasic
basemisc_feature1,2,3,7,8,9,10,11,12,15,16,17,20,21Bases have an
rSpace linkagemodified_base4,6,14,19Bases have a 2'-fluoro
modification 140ugganaaucu canugggnuu u 2114121RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to ApoB
141gaugaugaaa caguggguuu u 2114221RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to ApoB
142ggaaauugga gacaucaucu u 2114321RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to
ApoBmodified_base1,15n = any base, universal base, rSpacer, linker
phosphoramidite, 5-nitrodole, PC Spacer, or abasic
basemisc_feature2,6,7,8,9,10,11,12,13,16,18,19,20,21Bases have an
rSpace linkagemodified_base3,4,5,14,17Bases have a 2'-fluoro
modification 143ngaaauugga gacancaucu u 2114421RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to ApoB
144gcaaacucuu cagaguucuu u 2114521RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to ApoB
145agaacuccaa gggugggauu u 2114621RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to ApoB
146aucccacuuu caaguuugcu u 2114719RNAArtificial
Sequencemultivalent-siRNA oligonucleotide targeted to
ApoBmodified_base2,14,18n = any base, universal base, rSpacer,
linker phosphoramidite, 5-nitrodole, PC Spacer, or abasic
basemisc_feature3,4,5,6,7,8,9,10,11,12,16,17,19Bases have an rSpace
linkagemodified_base1,13,15Bases have a 2'-fluoro modification
147ancccacuuu caanuuunc 1914821RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
148cuucaucacu gaggccucuu u 2114921RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
149agaggccaag cucugcauuu u 2115021RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
150aaugcagaug aagaugaaga a 2115121RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
151uucagccugc auguuggcuu u 2115221RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
152agccaacuau acuuggaucu u 2115321RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
153gauccaaaag caggcugaag a 2115421RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
154cccucaucug agaaucuggu u 2115521RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
155ccagauucau aaaccaaguu u 2115621RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
156acuugguggc ccaugagggu u 2115721RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
157ucaagaauuc cuucaagccu u 2115821RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
158ggcuugaagc gaucacacuu u 2115921RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
159agugugaacg uauucuugau u 2116021RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
160uugcaguuga uccugguggu u 2116121RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
161ccaccaggua ggugaccacu u 2116221RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
162guggucagga gaacugcaau u 2116321RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
163ccuccagcuc aaccuugcau u 2116421RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
164ugcaaggucu caaaaaaugu u 2116521RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
165cauuuuugau cucuggaggu u 2116621RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
166caggauguaa guagguucau u 2116721RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
167ugaaccuuag caacaguguu u 2116821RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
168acacugugcc cacauccugu u 2116921RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
169ggcuugaagc gaucacacuu u 2117021RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
170agugugaacg uauucuuguu u 2117121RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
171acaagaauuc cuucaagccu u 2117221RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
172ugaagagauu agcucucugu u 2117321RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
173cagagaggcc aagcucugcu u 2117421RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
174gcagagcugg cucucuucau u 2117521RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
175cucaguaacc agcuuauugu u 2117621RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
176caauaagauu uauaacaaau u 2117721RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
177uuuguuaucu uauacugagu u 2117821RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
178gaaccaaggc uuguaaaguu u 2117921RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
179acuuuacaaa agcaacaauu u 2118021RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
180auuguuguua aauugguucu u 2118121RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
181cagguaggug accacaucuu u 2118221RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
182agaugugacu gcuucaucau u 2118321RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
183ugaugaacug cgcuaccugu u 2118421RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
184ccagucgcuu aucucccggu u 2118521RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
185ccgggagcaa ugacuccagu u 2118621RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
186cuggagucau ggcgacuggu u 2118721RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
187uggaagagaa acagauuugu u 2118821RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
188caaaucuuua aucagcuucu u 2118921RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
189gaagcugccu cuucuuccau u 2119021RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
190auccaaaggc agugaggguu u 2119121RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
191acccucaacu caguuuugau u 2119221RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
192ucaaaaccgg aauuuggauu u 2119321RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
193uagagacacc aucaggaacu u 2119421RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
194guuccuggag agucuucaau u 2119521RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
195uugaagaauu aggucucuau u 2119621RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
196gcucauguuu aucaucuuuu u 2119721RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
197aaagaugcug aacuuaaagu u 2119821RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
198cuuuaagggc aacaugagcu u 2119921RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted
to Human ApoB 199ggagcaauga cuccagaugu u 2120021RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
200caucuggggg auccccugcu u 2120121RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
201gcaggggagg uguugcuccu u 2120221RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
202ucacaaacuc cacagacacu u 2120321RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
203gugucugcuu uauagcuugu u 2120421RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
204caagcuaaag gauuugugau u 2120521RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
205gcagcuugac uggucucuuu u 2120621RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
206aagagacucu gaacugcccu u 2120721RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
207gggcagugau ggaagcugcu u 2120821RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
208caggacugcc uguucucaau u 2120921RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
209uugagaacuu cuaauuuggu u 2121021RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
210ccaaauuuga aaaguccugu u 2121121RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
211uguaggccuc aguuccagcu u 2121221RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
212gcuggaauuc ugguaugugu u 2121321RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
213cacauaccga augccuacau u 2121421RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
214gacuucacug gacaaggucu u 2121521RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
215gaccuugaag uugaaaaugu u 2121621RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
216cauuuucugc acugaagucu u 2121721RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
217aagcaguuug gcaggcgacu u 2121821RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
218gucgccuugu gagcaccacu u 2121921RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
219guggugccac ugacugcuuu u 2122021RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
220cagaugaguc cauuuggagu u 2122121RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
221cuccaaacag ugccaugccu u 2122221RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
222ggcauggagc cuucaucugu u 2122321RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
223cacagacuug aaguggaggu u 2122421RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
224ccuccacuga gcagcuugau u 2122521RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
225ucaagcuuca aagucugugu u 2122621RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
226auggcagaug gaaucccacu u 2122721RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
227gugggaucac cuccguuuuu u 2122821RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
228aaaacgguuu cucugccauu u 2122921RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
229ugauacaacu ugggaauggu u 2123021RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
230ccauucccua ugucagcauu u 2123121RNAArtificial
SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB
231augcugacaa auuguaucau u 2123221RNAArtificial SequenceTrivalent
MV-siRNA oligo sequences 232auugugucac uucccucagu u 21
* * * * *
References