Polynucleotides For Multivalent Rna Interference, Compositions And Methods Of Use Thereof

HAUSER; Todd M.

Patent Application Summary

U.S. patent application number 15/967052 was filed with the patent office on 2018-12-06 for polynucleotides for multivalent rna interference, compositions and methods of use thereof. The applicant listed for this patent is HALO-BIO RNAI THERAPEUTICS, INC.. Invention is credited to Todd M. HAUSER.

Application Number20180346908 15/967052
Document ID /
Family ID43298453
Filed Date2018-12-06

United States Patent Application 20180346908
Kind Code A1
HAUSER; Todd M. December 6, 2018

POLYNUCLEOTIDES FOR MULTIVALENT RNA INTERFERENCE, COMPOSITIONS AND METHODS OF USE THEREOF

Abstract

The present invention includes bivalent or multivalent nucleic acid molecules or complexes of nucleic acid molecules having two or more target-specific regions, in which the target-specific regions are complementary to a single target gene at more than one distinct nucleotide site, and/or in which the target regions are complementary to more than one target gene or target sequence. Also included are compositions comprising such nucleic acid molecules and methods of using the same for multivalent RNA interference and the treatment of a variety of diseases and infections.


Inventors: HAUSER; Todd M.; (Seattle, WA)
Applicant:
Name City State Country Type

HALO-BIO RNAI THERAPEUTICS, INC.

Seattle

WA

US
Family ID: 43298453
Appl. No.: 15/967052
Filed: April 30, 2018

Related U.S. Patent Documents

Application Number Filing Date Patent Number
14954653 Nov 30, 2015 9957505
15967052
13375460 Mar 23, 2012 9200276
PCT/US10/36962 Jun 1, 2010
14954653
61183011 Jun 1, 2009

Current U.S. Class: 1/1
Current CPC Class: A61P 9/10 20180101; C12N 2310/51 20130101; C12N 2320/30 20130101; C12N 2310/14 20130101; C12N 15/111 20130101; C12N 15/113 20130101; C12N 2310/52 20130101; A61P 31/18 20180101; C12N 15/1131 20130101; C12N 2310/53 20130101
International Class: A61K 48/00 20060101 A61K048/00; C12N 15/11 20060101 C12N015/11; C12N 15/113 20060101 C12N015/113

Claims



1. A polynucleotide complex of at least three separate polynucleotides, comprising (a) a first polynucleotide comprising a target-specific region that is complementary to a first target sequence, a 5' region, and a 3' region; (b) a second polynucleotide comprising a target-specific region that is complementary to a second target sequence, a 5' region, and a 3' region; and (c) a third polynucleotide comprising a null region or a target-specific region that is complementary to a third target specific, a 5' region, and a 3' region, wherein each of the target-specific regions of the first, second, and third polynucleotides are complementary to a different target sequence, wherein the 5' region of the first polynucleotide is complementary to the 3' region of the third polynucleotide, wherein the 3' region of the first polynucleotide is complementary to the 5' region of the second polynucleotide, and wherein the 3' region of the second polynucleotide is complementary to the 5' region of the third polynucleotide, and wherein the three separate polynucleotides hybridize via their complementary 3' and 5' regions to form a polynucleotide complex with a first, second, and third single-stranded region, and a first, second, and third self-complementary region.

2. The polynucleotide complex of claim 1, wherein the first, second, and/or third polynucleotide comprises about 15-30 nucleotides.

3. The polynucleotide complex of claim 1, wherein the first, second, and/or third polynucleotide comprises about 17-25 nucleotides.

4. The polynucleotide complex of claim 1, wherein one or more of the self-complementary regions comprises about 5-10 nucleotide pairs.

5. The polynucleotide complex of claim 1, wherein one or more of the self-complementary regions comprises about 7-8 nucleotide pairs.

6. The polynucleotide complex of claim 1, wherein each of said first, second, and third target sequences are present in the same gene, cDNA, mRNA, or microRNA.

7. The polynucleotide complex of claim 1, wherein at least two of said first, second, and third target sequences are present in different genes, cDNAs, mRNAs, or microRNAs.

8. The polynucleotide complex of claim 1, wherein all or a portion of the 5' and/or 3' region of each polynucleotide is also complementary to the target sequence for that polynucleotide.

9. The polynucleotide complex of claim 1, wherein one or more of the self-complementary regions comprises a 3' overhang.

10. A self-hybridizing polynucleotide molecule, comprising (a) a first nucleotide sequence comprising a target-specific region that is complementary to a first target sequence, a 5' region, and a 3' region, (b) a second nucleotide sequence comprising a target-specific region that is complementary to a second target sequence, a 5' region, and a 3' region; and (c) a third nucleotide sequence comprising a null region or a target-specific region that is complementary to a third target sequence, a 5' region, and a 3' region, wherein the target-specific regions of each of the first, second, and third nucleotide sequences are complementary to a different target sequence, wherein the 5' region of the first nucleotide sequence is complementary to the 3' region of the third nucleotide sequence, wherein the 3' region of the first nucleotide sequence is complementary to the 5' region of the second nucleotide sequence, and wherein the 3' region of the second nucleotide sequence is complementary to the 5' region of the third nucleotide sequence, and wherein each of the 5' regions hybridizes to their complementary 3' regions to form a self-hybridizing polynucleotide molecule with a first, second, and third single-stranded region, and a first, second, and third self-complementary region.

11. The self-hybridizing polynucleotide molecule of claim 10, wherein the first, second, or third nucleotide sequence comprises about 15-60 nucleotides.

12. The self-hybridizing polynucleotide molecule of claim 10, wherein the target-specific regions each comprise about 15-30 nucleotides.

13. The self-hybridizing polynucleotide molecule of claim 10, wherein one or more of the self-complementary regions comprises about 10-54 nucleotides.

14. The self-hybridizing polynucleotide molecule of claim 10, wherein one or more of the self-complementary regions comprises a 3' overhang.

15. The self-hybridizing polynucleotide molecule of claim 10, wherein one or more of the self-complementary regions forms a stem-loop structure.

16. The self-hybridizing polynucleotide molecule of claim 10, wherein one or more of the self-complementary regions comprises a proximal box of dinucleotides AG/UU that is outside of the target specific region

17. The self-hybridizing polynucleotide molecule of claim 10, wherein one or more of the self-complementary regions comprises a distal box of 4 nucleotides that is outside of the target-specific region, wherein the third nucleotide of the distal box is not a G.

18. The self-hybridizing polynucleotide molecule of claim 10, wherein each of said first, second, and third target sequences are present in the same gene, cDNA, mRNA, or microRNA.

19. The self-hybridizing polynucleotide molecule of claim 10, wherein at least two of said first, second, and third target sequences are present in different genes, cDNAs, mRNAs, or microRNAs.

20. A vector that encodes a self-hybridizing polynucleotide molecule according to claim 10.

21-25. (canceled)
Description



CROSS-REFERENCE TO RELATED APPLICATION(S)

[0001] This application is a continuation of U.S. patent application Ser. No. 14/954,653, filed Nov. 30, 2015, issuing as U.S. Pat. No. 9,957,505, which is a continuation of U.S. patent application Ser. No. 13/375,460, filed Mar. 23, 2012, issued as U.S. Pat. No. 9,200,276, which is a national phase of International Application No. PCT/US10/36962, filed Jun. 1, 2010, which claims the benefit under 35 U.S.C. .sctn. 119(e) of U.S. Provisional Patent Application No. 61/183,011, filed Jun. 1, 2009, which is incorporated by reference in its entirety.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] The Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing is 8001 US03_SequenceListing.txt. The text file is 107 KB, was created Apr. 30, 2018, and is being submitted electronically via EFS-Web.

BACKGROUND

Technical Field

[0003] The present invention relates generally to precisely structured polynucleotide molecules, and methods of using the same for multivalent RNA interference and the treatment of disease.

Description of the Related Art

[0004] The phenomenon of gene silencing, or inhibiting the expression of a gene, holds significant promise for therapeutic and diagnostic purposes, as well as for the study of gene function itself. Examples of this phenomenon include antisense technology and dsRNA forms of posttranscriptional gene silencing (PTGS) which has become popular in the form of RNA interference (RNAi).

[0005] Antisense strategies for gene silencing have attracted much attention in recent years. The underlying concept is simple yet, in principle, effective: antisense nucleic acids (NA) base pair with a target RNA resulting in inactivation of the targeted RNA. Target RNA recognition by antisense RNA or DNA can be considered a hybridization reaction. Since the target is bound through sequence complementarity, this implies that an appropriate choice of antisense NA should ensure high specificity. Inactivation of the targeted RNA can occur via different pathways, dependent on the nature of the antisense NA (either modified or unmodified DNA or RNA, or a hybrid thereof) and on the properties of the biological system in which inhibition is to occur.

[0006] RNAi based gene suppression is a widely accepted method in which a sense and an antisense RNA form double-stranded RNA (dsRNA), e.g., as a long RNA duplex, a 19-24 nucleotide duplex, or as a short-hairpin dsRNA duplex (shRNA), which is involved in gene modulation by involving enzyme and/or protein complex machinery. The long RNA duplex and the shRNA duplex are pre-cursors that are processed into small interfering RNA (siRNA) by the endoribonuclease described as Dicer. The processed siRNA or directly introduced siRNA is believed to join the protein complex RISC for guidance to a complementary gene, which is cleaved by the RISC/siRNA complex.

[0007] However, many problems persist in the development of effective antisense and RNAi technologies. For example, DNA antisense oligonucleotides exhibit only short-term effectiveness and are usually toxic at the doses required; similarly, the use of antisense RNAs has also proved ineffective due to stability problems. Also, the siRNA used in RNAi has proven to result in significant off-target suppression due to either strand guiding cleaving complexes potential involvement in endogenous regulatory pathways. Various methods have been employed in attempts to improve antisense stability by reducing nuclease sensitivity and chemical modifications to siRNA have been utilized. These include modifying the normal phosphodiester backbone, e.g., using phosphorothioates or methyl phosphonates, incorporating 2'-OMe-nucleotides, using peptide nucleic acids (PNAs and using 3'-terminal caps, such as 3'-aminopropyl modifications or 3'-3' terminal linkages. However, these methods can be expensive and require additional steps. In addition, the use of non-naturally occurring nucleotides and modifications precludes the ability to express the antisense or siRNA sequences in vivo, thereby requiring them to be synthesized and administered afterwards. Additionally, the siRNA duplex exhibits primary efficacy to a single gene and off-target to a secondary gene. This unintended effect is negative and is not a reliable RNAi multivalence.

[0008] Consequently, there remains a need for effective and sustained methods and compositions for the targeted, direct inhibition of gene function in vitro and in vivo, particularly in cells of higher vertebrates, including a single-molecule complex capable of multivalent gene inhibition.

BRIEF SUMMARY

[0009] The present invention provides novel compositions and methods, which include precisely structured oligonucleotides that are useful in specifically regulating gene expression of one or more genes simultaneously when the nucleotide target site sequence of each is not identical to the other.

[0010] In certain embodiments, the present invention includes an isolated precisely structured three-stranded polynucleotide complex comprising a region having a sequence complementary to a target gene or sequence at multiple sites or complementary to multiple genes at single sites.

[0011] In certain embodiments, the present invention includes an isolated precisely structured the polynucleotide comprising a region having a sequence complementary to a target gene or sequence at multiple sites or complementary to multiple genes at single sites; each having partially self-complementary regions. In particular embodiments. the oligonucleotide comprises two or more self-complementary regions. In certain embodiments, the polynucleotides of the present invention comprise RNA, DNA, or peptide nucleic acids.

[0012] Certain embodiments relate to polynucleotide complexes of at least three separate polynucleotides, comprising (a) a first polynucleotide comprising a target-specific region that is complementary to a first target sequence, a 5' region, and a 3' region; (b) a second polynucleotide comprising a target-specific region that is complementary to a second target sequence, a region, and a 3' region; and (c) a third polynucleotide comprising a null region or a target-specific region that is complementary to a third target specific, a 5' region, and a 3' region, wherein each of the target-specific regions of the first, second, and third polynucleotides are complementary to a different target sequence, wherein the 5' region of the first polynucleotide is complementary to the 3' region of the third polynucleotide, wherein the 3' region of the first polynucleotide is complementary to the 5' region of the second polynucleotide, and wherein the 3' region of the second polynucleotide is complementary to the 5' region of the third polynucleotide, and wherein the three separate polynucleotides hybridize via their complementary 3' and 5' regions to form a polynucleotide complex with a first, second, and third-single stranded region, and a first, second, and third self-complementary region.

[0013] In certain embodiments, the first, second, and/or third polynucleotide comprises about 15-30 nucleotides. In certain embodiments, the first, second, and/or third polynucleotide comprises about 17-25 nucleotides. In certain embodiments, one or more of the self-complementary regions comprises about 5-10 nucleotide pairs. In certain embodiments, one or more of the self-complementary regions comprises about 7-8 nucleotide pairs.

[0014] In certain embodiments, each of said first, second, and third target sequences are present in the same gene, cDNA, mRNA, or microRNA. In certain embodiments, at least two of said first, second, and third target sequences are present in different genes, cDNAs, mRNAs, or microRNAs.

[0015] In certain embodiments, all or a portion of the 5' and/or 3' region of each polynucleotide is also complementary to the target sequence for that polynucleotide. In certain embodiments, one or more of the self-complementary regions comprises a 3' overhang.

[0016] Certain embodiments relate to self-hybridizing polynucleotide molecules, comprising (a) a first nucleotide sequence comprising a target-specific region that is complementary to a first target sequence, a 5' region, and a 3' region, (b) a second nucleotide sequence comprising a target-specific region that is complementary to a second target sequence, a 5' region, and a 3' region; and (c) a third nucleotide sequence comprising a null region or a target-specific region that is complementary to a third target sequence, a 5' region, and a 3' region, wherein the target-specific regions of each of the first, second, and third nucleotide sequences are complementary to a different target sequence, wherein the 5' region of the first nucleotide sequence is complementary to the 3' region of the third nucleotide sequence, wherein the 3' region of the first nucleotide sequence is complementary to the 5' region of the second nucleotide sequence, and wherein the 3' region of the second nucleotide sequence is complementary to the 5' region of the third nucleotide sequence, and wherein each of the 5' regions hybridizes to their complementary 3' regions to form a self-hybridizing polynucleotide molecule with a first, second, and third single-stranded region, and a first, second, and third self-complementary region.

[0017] In certain embodiments, the first, second, or third polynucleotide sequences comprise about 15-60 nucleotides. In certain embodiments, the target-specific region comprises about 15-30 nucleotides. In certain embodiments, one or more of the self-complementary regions comprises about 10-54 nucleotides. In certain embodiments, one or more of the self-complementary regions comprises a 3' overhang. In certain embodiments, one or more of the self-complementary regions forms a stem-loop structure. In certain embodiments, one or more of the self-complementary regions comprises a proximal box of dinucleotides AG/UU that is outside of the target specific region. In certain embodiments, one or more of the self-complementary regions comprises a distal box of 4 nucleotides that is outside of the target-specific region, wherein the third nucleotide of the distal box is not a G. Also included are vectors that encode a self-hybridizing polynucleotide molecule, as described herein.

[0018] In certain embodiments, each of said first, second, and third target sequences are present in the same gene, cDNA, mRNA, or microRNA. In certain embodiments, at least two of said first, second, and third target sequences are present in different genes, cDNAs, mRNAs, or microRNAs.

[0019] In certain embodiments, a self-complementary region comprises a stem-loop structure composed of a bi-loop, tetraloop or larger loop. In certain embodiments, the sequence complementary to a target gene sequence comprises at least 17 nucleotides, or 17 to 30 nucleotides, including all integers in between.

[0020] In certain embodiments, the self-complementary region (or double-stranded region) comprises at least 5 nucleotides, at least 6 nucleotides, at least 24 nucleotides, or 12 to 54 or 60 nucleotides, including all integers in between.

[0021] In certain embodiments, a loop region of a stem-loop structure comprises at least 1 nucleotide. In certain embodiments, the loop region comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 nucleotides.

[0022] In further embodiments, a loop region of a stem-loop structure is comprised of a specific tetra-loop sequence NGNN or AAGU or UUUU or UUGA or GUUA, where these sequences are 5' to 3'.

[0023] In a further embodiment, the present invention includes an expression vector capable of expressing a polynucleotide of the present invention. In various embodiments, the expression vector is a constitutive or an inducible vector.

[0024] The present invention further includes a composition comprising a physiologically acceptable carrier and a polynucleotide of the present invention.

[0025] In other embodiments, the present invention provides a method for reducing the expression of a gene, comprising introducing a polynucleotide complex or molecule of the present invention into a cell. In various embodiments, the cell is plant, animal, protozoan, viral, bacterial, or fungal. In one embodiment, the cell is mammalian.

[0026] In some embodiments, the polynucleotide complex or molecule is introduced directly into the cell, while in other embodiments, the polynucleotide complex or molecule is introduced extracellularly by a means sufficient to deliver the isolated polynucleotide into the cell.

[0027] In another embodiment, the present invention includes a method for treating a disease, comprising introducing a polynucleotide complex or molecule of the present invention into a cell, wherein overexpression of the targeted gene is associated with the disease. In one embodiment, the disease is a cancer.

[0028] The present invention further provides a method of treating an infection in a patient, comprising introducing into the patient a polynucleotide complex or molecule of the present invention, wherein the isolated polynucleotide mediates entry, replication, integration, transmission, or maintenance of an infective agent.

[0029] In yet another related embodiment, the present invention provides a method for identifying a function of a gene, comprising introducing into a cell a polynucleotide complex or molecule of the present invention, wherein the polynucleotide complex or molecule inhibits expression of the gene, and determining the effect of the introduction of the polynucleotide complex or molecule on a characteristic of the cell, thereby determining the function of the targeted gene. In one embodiment, the method is performed using high throughput screening.

[0030] In a further embodiment, the present invention provides a method of designing a polynucleotide sequence comprising two or more self-complementary regions for the regulation of expression of a target gene, comprising: (a) selecting the first three guide sequences 17 to 25 nucleotides in length and complementary to a target gene or multiple target genes; (b) selecting one or more additional sequences 4 to 54 nucleotides in length, which comprises self-complementary regions and which are not fully-complementary to the first sequence; and optionally (c) defining the sequence motif in (b) to be complementary, non-complementary, or replicate a gene sequence which are non-complementary to the sequence selected in step (a).

[0031] In another embodiment, the mutated gene is a gene expressed from a gene encoding a mutant p53 polypeptide. In another embodiment, the gene is viral, and may include one or more different viral genes. In specific embodiments, the gene is an HIV gene, such as gag, pol, env, or tat, among others described herein and known in the art. In other embodiments, the gene is ApoB.

BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIGS. 1 through 6 illustrate exemplary polynucleotide structures of the present invention.

[0033] FIG. 1 shows a polynucleotide complex of three separate polynucleotide molecules. (A) indicates the region comprising sequence complementary to a site on a target gene (hatched); (B) indicates the region comprising sequence complementary to a second site on the target gene or a site on a different gene (cross-hatched); (C) indicates the region comprising sequence complementary to a third site on the target gene or a site on a different gene (filled in black). The numbers 1, 2, and 3 indicate the 3' end of each oligonucleotide that guides gene silencing; (A) loads in the direction of 1, (B) in the direction 2, and (C) in the direction 3. The 3' and 5' regions of each molecule, which hybridize to each other to form their respective self-complementary or double-stranded regions, are indicated by connecting bars. Each polynucleotide comprises a two nucleotide 3' overhang.

[0034] FIG. 2 shows a single, self-hybridizing polynucleotide of the invention, having three single-stranded regions and three self-complementary regions, which is a precursor for processing into a core molecule. The target specific regions are darkened. (D) indicates a self-complementary stem-loop region (filled in white) capped with a tetraloop of four nucleotides; (D) also indicates a stem-loop region having a 14/16 nucleotide cleavage site within the stem-loop structure; cleavage may occur by RNase III to remove the stem loop nucleotides shown in white); (E) indicates a distal box wherein the third nucleotide as determined 5' to 3' is not a G, since it is believed that the presence of a G would block RNase III cleavage required for removal of the stem-loop region; (F) indicates a proximal box of dinucleotides AG/UU, which is an in vivo determinant of RNase III recognition and binding of RNase III (Nichols 2000); (G) indicates a tetraloop. The polynucleotide molecule shown in FIG. 2 is a longer transcript RNA that is `pre-processed` in the cell by RNase III. The resulting RNA structure is identical to the structure depicted in FIG. 1.

[0035] FIG. 3 depicts a self-forming single-stranded oligonucleotide with tetraloop formats. (H) indicates a tetraloop; (I) indicates a tri-loop connecting two core strands when the leading strand incorporates a 2 nucleotide overhang. In this structure, tetraloops are used to mimic what would be a 3' hydroxyl/5' phosphate of the overhangs in the structure shown in FIG. 1 and function more directly than those of the structure shown in FIG. 2. As demonstrated in Example 2, this short tetraloop format guides silencing directly without pre-processing. It is believed that the GUUA loop twists the nucleotides in the loop and expose the hydrogens (see, e.g., Nucleic Acids Research, 2003, Vol. 31 No. 3, FIG. 6, page 1094). This structure is compatible with PAZ or RISC.

[0036] FIG. 4 depicts a self-forming single stranded oligonucleotide for divalent use. (J) indicates a larger loop connecting two core strands; (K) indicates the key strand as completing the complex formation but "null" to a target gene, i.e., not-specific for a target gene. The two target specific regions are shaded. This structure is a composition for `divalent` use when working with RNA transcripts. Since chemical modifications are not possible, the structure determines asymmetrically of loading and silencing activity. The first 19 nucleotides of the molecule is the PRIMARY strand, (K) indicates a KEY strand that is deactivated, and the SECONDARY strand is the last 21 nucleotides of the molecule. The first priority of loading into RISC and functioning is the SECONDARY strand by exposed 5'/3' ends. The next priority is the PRIMARY strand, which is exposed after RNase III pre-processing in the cell. The 3' end of the nullified KEY strand is not functional, since the large loop is not processed nor is compatible with loading into RISC itself.

[0037] FIG. 5 depicts a polynucleotide complex of the present invention having modified RNA bases. (L), (M), and (N) illustrate regions (defined by hashed lines) in which the Tm can be incrementally increased by the use of modified RNA (e.g., 2'-O-methyl RNA or 2'-fluoro RNA instead of 2'-OH RNA) to preference the annealing and/or the silencing order of ends 1, 2 or 3.

[0038] FIG. 6 depicts two embodiments of oligonucleotide complexes of the present invention. (O) illustrates a blunt-ended DNA strand that deactivates the silencing function of this strand; and (P) illustrates an end that can be utilized for conjugation of a delivery chemistry, ligand, antibody, or other payload or targeting molecule.

[0039] FIGS. 7A and 7B show the results of suppression of GFP expression by multivalent-siRNA molecules of the invention, as compared to standard shRNA molecules (see Example 1). FIG. 7A shows increased suppression of GFP by MV clone long I (108%) and MV clone long II (119%), relative to shRNA control (set at 100%). FIG. 7B shows increased suppression of GFP expression by synthetic MV-siRNA GFP I (127%), relative to shRNA control (set at 100%), which is slightly reduced when one of the strands of the synthetic MV-siRNA complex is replaced by a DNA strand (MF-siRNA GFP I DNA (116%)).

[0040] FIGS. 8A, 8B and 8C show exemplary targeting regions (underlined) for the GFP coding sequence (SEQ ID NO:8). FIG. 8A shows the regions that were targeted by the MV-siRNA molecules of Tables 1 and 2 in Example 1. FIGS. 8B and 8C show additional exemplary targeting regions.

[0041] FIG. 9 shows the inhibitory effects of MV-siRNA molecules on HIV replication, in which a di-valent MV-siRNA targeted to both gag and tat has a significantly greater inhibitory effect on HIV replication than an siRNA targeted to gag only. The di-valent MV-siRNA exhibited 56.89% inhibition at 10 days and 60.02% inhibition at 40 days, as compared to the siRNA targeted to gag alone, which exhibited 19.77% inhibition at 10 days and 32.43% inhibition at 40 days.

[0042] FIGS. 10A, 10B, 10C and 10D show the nucleotide sequence of an exemplary HIV genome (SEQ ID NO:9), which can be targeted according to the MV-siRNA molecules of the present invention. This sequence extends from FIG. 10A through FIG. 10D.

[0043] FIG. 11 shows the nucleotide sequence of the env gene (SEQ ID NO:4), derived from the HIV genomic sequence of FIG. 10.

[0044] FIGS. 12A and 12B provide additional HIV sequences. FIG. 12A shows the nucleotide sequence of the gag gene (SEQ ID NO:2), and FIG. 12B shows the nucleotide sequence of the tat gene (SEQ ID NO:3), both of which are derived from the HIV genomic sequence of FIG. 10.

[0045] FIGS. 13A, 13B, 13C, 13D and 13E show the coding sequence of murine apolipoprotein B (ApoB) (SEQ ID NO:10), which can be targeted using certain MV-siRNAs provided herein. This sequence extends from FIG. 13A through FIG. 13E.

[0046] FIGS. 14A, 14B, 14C, 14D and 14E show the mRNA sequence of human apolipoprotein B (apoB) (SEQ ID NO:1), which can be targeted using certain MV-siRNAs provided herein. This sequence extends from FIG. 14A through FIG. 14E.

DETAILED DESCRIPTION

[0047] The present invention provides novel compositions and methods for inhibiting the expression of a gene at multiple target sites, or for inhibiting the expression of multiple genes at one or more target sites, which sites are not of equivalent nucleotide sequences, in eukaryotes in vivo and in vitro. In particular, the present invention provides polynucleotide complexes and polynucleotide molecules comprising two, three, or more regions having sequences complementary to regions of one or more target genes, which are capable of targeting and reducing expression of the target genes. In various embodiments, the compositions and methods of the present invention may be used to inhibit the expression of a single target gene by targeting multiple sites within the target gene or its expressed RNA. Alternatively, they may be used to target two or more different genes by targeting sites within two or more different genes or their expressed RNAs.

[0048] The present invention offers significant advantages over traditional siRNA molecules. First, when polynucleotide complexes or molecules of the present invention target two or more regions within a single target, gene, they are capable of achieving greater inhibition of gene expression from the target gene, as compared to an RNAi agent that targets only one region within a target gene. In addition, polynucleotide complexes or molecules of the present invention that target two or more different target genes may be used to inhibit the expression of multiple target genes associated with a disease or disorder using a single polynucleotide complex or molecule. Furthermore, polynucleotide complexes and molecules of the present invention do not require the additional non-targeting strand present in conventional double-stranded RNAi agents, so they do not have off-target effects caused by the non-targeting strand. Accordingly, the polynucleotide complexes and molecules of the present invention offer surprising advantages over polynucleotide inhibitors of the prior art, including antisense RNA and RNA interference molecules, including increased potency and increased effectiveness against one or more target genes.

[0049] The present invention is also based upon the recognition of the polynucleotide structure guiding a protein complex for cleavage using only one, two, or three of the guide strands, which are complementary to one, two, or three distinct nucleic sequences of the target genes. This multivalent function results in a markedly broader and potent inhibition of a target gene or group of target genes than that of dsRNA, while utilizing many of the same endogenous mechanisms.

[0050] Certain embodiments of the present invention are also based upon the recognition of the polynucleotide structure directionally by presentation of the 3' overhangs and 5' phosphate resulting in a sense strand free complex, which contributes to greater specificity than that of dsRNA-based siRNA.

[0051] Given their effectiveness, the compositions of the present invention may be delivered to a cell or subject with an accompanying guarantee of specificity predicted by the single guide strand complementary to the target gene or multiple target genes.

Multivalent siRNAs

[0052] The present invention includes polynucleotide complexes and molecules that comprise two or more targeting regions complementary to regions of one or more target genes. The polynucleotide complexes and molecules of the present invention may be referred to as multivalent siRNAs (mv-siRNAs), since they comprise at least two targeting regions complementary to regions of one or more target genes. Accordingly, the compositions and methods of the present invention may be used to inhibit or reduce expression of one or more target genes, either by targeting two or more regions within a single target gene, or by targeting one or more regions within two or more target genes.

[0053] In certain embodiments, polynucleotide complexes of the present invention comprise three or more separate oligonucleotides, each having a 5' and 3' end, with two or more of the oligonucleotides comprising a targeting region, which oligonucleotides hybridize to each other as described herein to form a complex. Each of the strands is referred to herein as a "guide strand." In other embodiments, polynucleotide molecules of the present invention are a single polynucleotide that comprises three or more guide strands, with two or more of the guide strands comprising a targeting region, which polynucleotide hybridizes to itself through self-complementary regions to form a structure described herein. The resulting structure may then be processed, e.g., intracellularly, to remove loop structures connecting the various guide strands. Each guide strand, which may be present in different oligonucleotides or within a single polynucleotide, comprises regions complementary to other guide strands.

[0054] In certain embodiments, the present invention provides polynucleotide complexes and molecules that comprise at least three guide strands, at least two of which comprise regions that are complementary to different sequences within one or more target genes. In various embodiments, the polynucleotide complexes of the present invention comprise two, three or more separate polynucleotides each comprising one or more guide strands, which can hybridize to each other to form a complex. In other embodiments, the polynucleotide molecules of the present invention comprise a single polynucleotide that comprises three or more guide strands within different regions of the single polynucleotide.

[0055] Certain embodiments of the present invention are directed to polynucleotide complexes or molecules having at least three guide strands, two or more of which are partially or fully complementary to one or more target genes; and each having about 4 to about 12, about 5 to about 10, or preferably about 7 to about 8, nucleotides on either end that are complementary to each other (i.e., complementary to a region of another guide strand), allowing the formation of a polynucleotide complex (see, e.g., FIG. 1). For example, each end of a guide strand may comprise nucleotides that are complementary to nucleotides at one end of another of the guide strands of the polynucleotide complex or molecule. Certain embodiments may include polynucleotide complexes that comprise 4, 5, 6 or more individual polynucleotide molecules or guide strands.

[0056] In certain embodiments, a polynucleotide complex of the present invention comprises at least three separate polynucleotides, which include: (1) a first polynucleotide comprising a target-specific region that is complementary to a first target sequence, a 5' region, and a 3' region; (2) a second polynucleotide comprising a target-specific region that is complementary to a second target sequence, a 5' region, and a 3' region; and (3) a third polynucleotide comprising either a null region or a target-specific region that is complementary to a third target specific, a 5' region, and a 3' region, wherein each of the target-specific regions of the first, second, and third polynucleotides are complementary to a different target sequence, wherein the 5' region of the first polynucleotide is complementary to the 3' region of the third polynucleotide, wherein the 3' region of the first polynucleotide is complementary to the 5' region of the second polynucleotide, and wherein the 3' region of the second polynucleotide is complementary to the 5' region of the third polynucleotide, and wherein the three separate polynucleotides hybridize via their complementary 3' and 5' regions to form a polynucleotide complex with a first, second, and third single-stranded region, and a first, second, and third self-complementary region.

[0057] As described above, in particular embodiments, a polynucleotide complex of the present invention comprises at least three separate oligonucleotides, each having a 5' end and a 3' end. As depicted in FIG. 1, a region at the 5' end of the first oligonucleotide anneals to a region at the 3' end of the third oligonucleotide; a region at the 5' end of the third oligonucleotide anneals to a region at the 3' end of the second oligonucleotide; and a region at the 5' end of the second oligonucleotide anneals to a region at the 3' end of the first oligonucleotide. If additional oligonucleotides are present in the complex, then they anneal to other oligonucleotides of the complex in a similar manner. The regions at the ends of the oligonucleotides that anneal to each other may include the ultimate nucleotides at either or both the 5' and/or 3' ends. Where the regions of both the hybridizing 3' and 5' ends include the ultimate nucleotides of the oligonucleotides, the resulting double-stranded region is blunt-ended. In particular embodiments, the region at the 3' end that anneals does not include the ultimate and/or penultimate nucleotides, resulting in a double-stranded region having a one or two nucleotide 3' overhang.

[0058] In certain embodiments, the guide strands are present in a single polynucleotide molecule, and hybridize to form a single, self-hybridizing polynucleotide with three single-stranded regions and three self-complementary regions (or double-stranded regions), and at least two target-specific regions (see, e.g., FIG. 2). In related embodiments, a single molecule may comprise at least 3, at least 4, at least 5 or at least 6 guide strands, and forms a single, self-hybridizing polynucleotide with at least 3, at least 4, at least 5, or at least 6 self-complementary regions (or double-stranded regions), and at least 2, at least 3, at least 4, or at least 5 target-specific regions, respectively. In particular embodiments, this single, self-hybridizing polynucleotide is a precursor molecule that may be processed by the cell to remove the loop regions and, optionally, an amount of proximal double-stranded region, resulting in an active mv-siRNA molecule (see, e.g., FIG. 2).

[0059] Thus, in particular embodiments, the present invention includes a self-hybridizing polynucleotide molecule, comprising: (1) a first nucleotide sequence comprising a target-specific region that is complementary to a first target sequence, a 5' region, and a 3' region, (2) a second nucleotide sequence comprising a target-specific region that is complementary to a second target sequence, a 5' region, and a 3' region; and (3) a third nucleotide sequence comprising a null region of a target-specific region that is complementary to a third target sequence, a 5' region, and a 3' region, wherein the target-specific regions of each of the first, second, and third nucleotide sequences are complementary to a different target sequence, wherein the 5' region of the first nucleotide sequence is complementary to the 3' region of the third nucleotide sequence, wherein the 3' region of the first nucleotide sequence is complementary to the 5' region of the second nucleotide sequence, and wherein the 3' region of the second nucleotide sequence is complementary to the 5' region of the third nucleotide sequence, and wherein each of the 5' regions hybridizes to their complementary 3' regions to form a self-hybridizing polynucleotide molecule with a first, second, and third single-stranded region, and a first, second, and third self-complementary region.

[0060] In particular embodiments, a single, self-hybridizing polynucleotide of the present invention may comprise one or more cleavable nucleotides in the single-stranded loops that form when the polynucleotide is annealed to itself. Once the single, self-hybridizing polynucleotide is annealed to itself, the cleavable nucleotides may be cleaved to result in a polynucleotide complex comprising three or more separate oligonucleotides. Examples of cleavable nucleotides that may be used according to the present invention include, but are not limited to, photocleavable nucleotides, such as pcSpacer (Glen Research Products, Sterling, Va., USA), or phosphoramadite nucleotides.

[0061] As used herein, polynucleotides complexes and molecules of the present invention include isolated polynucleotides comprising three single-stranded regions, at least two of which are complementary to two or more target sequences, each target sequence located within one or more target genes, and comprising at least two or three self-complementary regions interconnecting the 5' or 3' ends of the single-stranded regions, by forming a double-stranded region, such as a stem-loop structure. The polynucleotides may also be referred to herein as the oligonucleotides.

[0062] In certain embodiments, the polynucleotide complexes and molecules of the present invention comprise two or more regions of sequence complementary to a target gene. In particular embodiments, these regions are complementary to the same target genes or genes, while in other embodiments, they are complementary to two or more different target genes or genes.

[0063] Accordingly, the present invention includes one or more self-complementary polynucleotides that comprise a series of sequences complementary to one or more target genes or genes. In particular embodiments, these sequences are separated by regions of sequence that are non-complementary or semi-complementary to a target gene sequence and non-complementary to a self-complementary region. In other embodiments of the polynucleotide comprising multiple sequences that are complementary to target genes or genes, the polynucleotide comprises a self-complementary region at the 5' end, 3 end', or both ends of one or more regions of sequence complementary to a target gene. In a particular embodiment, a polynucleotide comprises two or more regions of sequence complementary to one or more target genes, with self-complementary regions located at the 5' and 3' end of each guide strand that is complementary to a target gene. In certain embodiments, all or a portion of these 3' and 5' regions may be complementary to the target sequence, in addition to being complementary to their corresponding 3' or 5' regions.

[0064] The term "complementary" refers to nucleotide sequences that are fully or partially complementary to each other, according to standard base pairing rules. The term "partially complementary" refers to sequences that have less than full complementarity, but still have a sufficient number of complementary nucleotide pairs to support binding or hybridization within the stretch of nucleotides under physiological conditions.

[0065] In particular embodiments, the region of a guide strand complementary to a target gene (i.e., the targeting region) may comprise one or more nucleotide mismatches as compared to the target gene. Optionally, the mismatched nucleotide(s) in the guide strand may be substituted with an unlocked (UNA) nucleic acid or a phosphoramidite nucleic acid (e.g., rSpacer, Glen Research, Sterling, Va., USA), to allow base-pairing, e.g., Watson-Crick base pairing, of the mismatched nucleotide(s) to the target gene.

[0066] As used herein, the term "self-complementary" or "self-complementary region" may refer to a region of a polynucleotide molecule of the invention that binds or hybridizes to another region of the same molecule to form A-T(U) and G-C hybridization pairs, thereby forming a double stranded region; and/or it may refer to a region of a first nucleotide molecule that binds to a region of a second or third nucleotide molecule to form a polynucleotide complex of the invention (i.e., an RNAi polynucleotide complex), wherein the complex is capable of RNAi interference activity against two or more target sites. The two regions that bind to each other to form the self-complementary region may be contiguous or may be separated by other nucleotides. Also, as in an RNAi polynucleotide complex, the two regions may be on separate nucleotide molecules.

[0067] In certain embodiments, a "self-complementary region" comprises a "3' region" of a first defined nucleotide sequence that is bound or hybridized to a "5' region" of a second or third defined nucleotide sequence, wherein the second or third defined sequence is within the same molecule--to form a self-hybridizing polynucleotide molecule. In certain embodiments, a "self-complementary region" comprises a "3' region" of a first polynucleotide molecule that is bound or hybridized to a "5' region" of a separate polynucleotide molecule, to form a polynucleotide complex. These 3' and 5' regions are typically defined in relation to their respective target-specific region, in that the 5' regions are on the 5' end of the target-specific region and the 3' regions are on the 3' end of the target specific region. In certain embodiments, one or both of these 3' and 5' regions not only hybridize to their corresponding 3' or 5' regions to form a self-complementary region, but may be designed to also contain full or partial complementarily their respective target sequence, thereby forming part of the target-specific region. In these embodiments, the target-specific region contains both a single-stranded region and self-complementary (i.e., double-stranded) region.

[0068] In certain embodiments, these "self-complementary regions" comprise about 5-12 nucleotide pairs, preferably 5-10 or 7-8 nucleotide pairs, including all integers in between. Likewise, in certain embodiments, each 3' region or 5' region comprises about 5-12 nucleotides, preferably 5-10 or 7-8 nucleotides, including all integers in between.

[0069] The term "non-complementary" indicates that in a particular stretch of nucleotides, there are no nucleotides within that align with a target to form A-T(U) or G-C hybridizations. The term "semi-complementary" indicates that in a stretch of nucleotides, there is at least one nucleotide pair that aligns with a target to form an A-T(U) or G-C hybridizations, but there are not a sufficient number of complementary nucleotide pairs to support binding within the stretch of nucleotides under physiological conditions.

[0070] The term "isolated" refers to a material that is at least partially free from components that normally accompany the material in the material's native state. Isolation connotes a degree of separation from an original source or surroundings. Isolated, as used herein, e.g., related to DNA, refers to a polynucleotide that is substantially away from other coding or non-coding sequences, and that the DNA molecule can contain large portions of unrelated coding DNA, such as large chromosomal fragments or other functional genes or polypeptide coding regions. Of course, this refers to the DNA molecule as originally isolated, and does not exclude genes or coding regions later added to the segment by the hand of man.

[0071] In various embodiments, a polynucleotide complex or molecule of the present invention comprises RNA, DNA, or peptide nucleic acids, or a combination of any or all of these types of molecules. In addition, a polynucleotide may comprise modified nucleic acids, or derivatives or analogs of nucleic acids. General examples of nucleic acid modifications include, but are not limited to, biotin labeling, fluorescent labeling, amino modifiers introducing a primary amine into the polynucleotide, phosphate groups, deoxyuridine, halogenated nucleosides, phosphorothioates, 2'-O-Methyl RNA analogs, chimeric RNA analogs, wobble groups, universal bases, and deoxyinosine.

[0072] A "subunit" of a polynucleotide or oligonucleotide refers to one nucleotide (or nucleotide analog) unit. The term may refer to the nucleotide unit with or without the attached intersubunit linkage, although, when referring to a "charged subunit", the charge typically resides within the intersubunit linkage (e.g., a phosphate or phosphorothioate linkage or a cationic linkage). A given synthetic MV-siRNA may utilize one or more different types of subunits and/or intersubunit linkages, mainly to alter its stability, Tm, RNase sensitivity, or other characteristics, as desired. For instance, certain embodiments may employ RNA subunits with one or more 2'-O-methyl RNA subunits.

[0073] The cyclic subunits of a polynucleotide or an oligonucleotide may be based on ribose or another pentose sugar or, in certain embodiments, alternate or modified groups. Examples of modified oligonucleotide backbones include, without limitation, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Also contemplated are peptide nucleic acids (PNAs), locked nucleic acids (LNAs), 2'-O-methyl oligonucleotides (2'-OMe), 2'-methoxyethoxy oligonucleotides (MOE), among other oligonucleotides known in the art.

[0074] The purine or pyrimidine base pairing moiety is typically adenine, cytosine, guanine, uracil, thymine or inosine. Also included are bases such as pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trime115thoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6-methyluridine), propyne, quesosine, 2-thiouridine, 4-thiouridine, wybutosine, wybutoxosine, 4-acetyltidine, 5-(carboxyhydroxymethyl)uridine, 5'-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, .beta.-D-galactosylqueosine, 1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine, 3-methylcytidine, 2-methyladenosine, 2-methylguanosine, N6-methyladenosine, 7-methylguanosine, 5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylcarbonyhnethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 2-methylthio-N6-isopentenyladenosine, .beta.-D-mannosylqueosine, uridine-5-oxyacetic acid, 2-thiocytidine, threonine derivatives and others (Burgin et al., 1996, Biochemistry, 35, 14090; Uhlman & Peyman, supra). By "modified bases" in this aspect is meant nucleotide bases other than adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), as illustrated above; such bases can be used at any position in the antisense molecule. Persons skilled in the art will appreciate that depending on the uses or chemistries of the oligomers, Ts and Us are interchangeable. For instance, with other antisense chemistries such as 2'-O-methyl antisense oligonucleotides that are more RNA-like, the T bases may be shown as U.

[0075] As noted above, certain polynucleotides or oligonucleotides provided herein include one or more peptide nucleic acid (PNAs) subunits. Peptide nucleic acids (PNAs) are analogs of DNA in which the backbone is structurally homomorphous with a deoxyribose backbone, consisting of N-(2-aminoethyl) glycine units to which pyrimidine or purine bases are attached. PNAs containing natural pyrimidine and purine bases hybridize to complementary oligonucleotides obeying Watson-Crick base-pairing rules, and mimic DNA in terms of base pair recognition (Egholm, Buchardt et al. 1993). The backbone of PNAs is formed by peptide bonds rather than phosphodiester bonds, making them well-suited for antisense applications (see structure below). A backbone made entirely of PNAs is uncharged, resulting in PNA/DNA or PNA/RNA duplexes that exhibit greater than normal thermal stability. PNAs are not recognized by nucleases or proteases.

[0076] PNAs may be produced synthetically using any technique known in the art. PNA is a DNA analog in which a polyamide backbone replaces the traditional phosphate ribose ring of DNA. Despite a radical structural change to the natural structure, PNA is capable of sequence-specific binding in a helix form to DNA or RNA. Characteristics of PNA include a high binding affinity to complementary DNA or RNA, a destabilizing effect caused by single-base mismatch, resistance to nucleases and proteases, hybridization with DNA or RNA independent of salt concentration and triplex formation with homopurine DNA. Panagene.TM. has developed its proprietary Bts PNA monomers (Bts; benzothiazole-2-sulfonyl group) and proprietary oligomerisation process. The PNA oligomerisation using Bts PNA monomers is composed of repetitive cycles of deprotection, coupling and capping. Panagene's patents to this technology include U.S. Pat. No. 6,969,766, U.S. Pat. No. 7,211,668, U.S. Pat. No. 7,022,851, U.S. Pat. No. 7,125,994, U.S. Pat. No. 7,145,006 and U.S. Pat. No. 7,179,896. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al. Science, 1991, 254, 1497.

[0077] Also included are "locked nucleic acid" subunits (LNAs). The structures of LNAs are known in the art: for example, Wengel, et al., Chemical Communications (1998) 455; Tetrahedron (1998) 54, 3607, and Accounts of Chem. Research (1999) 32, 301); Obika, et al., Tetrahedron Letters (1997) 38, 8735; (1998) 39, 5401, and Bioorganic Medicinal Chemistry (2008)16, 9230.

[0078] Polynucleotides and oligonucleotides may incorporate one or more LNAs; in some cases, the compounds may be entirely composed of LNAs. Methods for the synthesis of individual LNA nucleoside subunits and their incorporation into oligonucleotides are known in the art: U.S. Pat. Nos. 7,572,582; 7,569,575; 7,084,125; 7,060,809; 7,053,207; 7,034,133; 6,794,499; and 6,670,461. Typical intersubunit linkers include phosphodiester and phosphorothioate moieties; alternatively, non-phosphorous containing linkers may be employed. One embodiment includes an LNA containing compound where each LNA subunit is separated by a RNA or a DNA subunit (i.e., a deoxyribose nucleotide). Further exemplary compounds may be composed of alternating LNA and RNA or DNA subunits where the intersubunit linker is phosphorothioate.

[0079] Certain polynucleotides or oligonucleotides may comprise morpholino-based subunits bearing base-pairing moieties, joined by uncharged or substantially uncharged linkages. The terms "morpholino oligomer" or "PMO" (phosphoramidate- or phosphorodiamidate morpholino oligomer) refer to an oligonucleotide analog composed of morpholino subunit structures, where (i) the structures are linked together by phosphorus-containing linkages, one to three atoms long, preferably two atoms long, and preferably uncharged or cationic, joining the morpholino nitrogen of one subunit to a 5' exocyclic carbon of an adjacent subunit, and (ii) each morpholino ring bears a purine or pyrimidine or an equivalent base-pairing moiety effective to bind, by base specific hydrogen bonding, to a base in a polynucleotide.

[0080] Variations can be made to this linkage as long as they do not interfere with binding or activity. For example, the oxygen attached to phosphorus may be substituted with sulfur (thiophosphorodiamidate). The 5' oxygen may be substituted with amino or lower alkyl substituted amino. The pendant nitrogen attached to phosphorus may be unsubstituted, monosubstituted, or disubstituted with (optionally substituted) lower alkyl. The purine or pyrimidine base pairing moiety is typically adenine, cytosine, guanine, uracil, thymine or inosine. The synthesis, structures, and binding characteristics of morpholino oligomers are detailed in U.S. Pat. Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,521,063, and 5,506,337, and PCT Appn. Nos. PCT/US07/11435 (cationic linkages) and U.S. Ser. No. 08/012,804 (improved synthesis), all of which are incorporated herein by reference.

[0081] In one aspect of the invention, MV-siRNA comprise at least one ligand tethered to an altered or non-natural nucleobase. Included are payload molecules and targeting molecules. A large number of compounds can function as the altered base. The structure of the altered base is important to the extent that the altered base should not substantially prevent binding of the oligonucleotide to its target, e.g., mRNA. In certain embodiments, the altered base is difluorotolyl, nitropyrrolyl, nitroimidazolyl, nitroindolyl, napthalenyl, anthrancenyl, pyridinyl, quinolinyl, pyrenyl, or the divalent radical of any one of the non-natural nucleobases described herein. In certain embodiments, the non-natural nucleobase is difluorotolyl, nitropyrrolyl, or nitroimidazolyl. In certain embodiments, the non-natural nucleobase is difluorotolyl.

[0082] A wide variety ligands are known in the art and are amenable to the present invention. For example, the ligand can be a steroid, bile acid, lipid, folic acid, pyridoxal, B12, riboflavin, biotin, aromatic compound, polycyclic compound, crown ether, intercalator, cleaver molecule, protein-binding agent, or carbohydrate. In certain embodiments, the ligand is a steroid or aromatic compound. In certain instances, the ligand is cholesteryl.

[0083] In other embodiments, the polynucleotide or oligonucleotide is tethered to a ligand for the purposes of improving cellular targeting and uptake. For example, an MV-siRNA agent may be tethered to an antibody, or antigen binding fragment thereof. As an additional example, an MV-siRNA agent may be tethered to a specific ligand binding molecule, such as a polypeptide or polypeptide fragment that specifically binds a particular cell-surface receptor, or that more generally enhances cellular uptake, such as an arginine-rich peptide.

[0084] The term "analog" as used herein refers to a molecule, compound or composition that retains the same structure and/or function (e.g., binding to a target) as a polynucleotide herein. Examples of analogs include peptidomimetic and small and large organic or inorganic compounds.

[0085] The term "derivative" or "variant" as used herein refers to a polynucleotide that differs from a naturally occurring polynucleotide (e.g., target gene sequence) by one or more nucleic acid deletions, additions, substitutions or side-chain modifications. In certain embodiments, variants have at least 70%, at least 80% at least 90%, at least 95%, or at least 99% sequence identity to a region of a target gene sequence. Thus, for example, in certain embodiments, an oligonucleotide of the present invention comprises a region that is complementary to a variant of a target gene sequence.

[0086] Polynucleotide complexes and molecules of the present invention comprise a sequence region, or two or more sequence regions, each of which is complementary, and in particular embodiments completely complementary, to a region of a target gene or polynucleotide sequences (or a variant thereof). In particular embodiments, a target gene is a mammalian gene, e.g., a human gene, or a gene of a microorganism infecting a mammal, such as a virus. In certain embodiments, a target gene is a therapeutic target. For example, a target gene may be a gene whose expression or overexpression is associated with a human disease or disorder. This may be a mutant gene or a wild type or normal gene. A variety of therapeutic target genes have been identified, and any of these may be targeted by polynucleotide complexes and molecules of the present invention. Therapeutic target genes include, but are not limited to, oncogenes, growth factor genes, translocations associated with disease such as leukemias, inflammatory protein genes, transcription factor genes, growth factor receptor genes, anti-apoptotic genes, interleukins, sodium channel genes, potassium channel genes, such as, but not limited to the following genes or genes encoding the following proteins: apolipoprotein B (ApoB), apolipoprotein B-100 (ApoB-100), bcl family members, including bcl-2 and bcl-x, MLL-AF4, Huntington gene, AML-MT68 fusion gene, IKK-B, Aha1, PCSK9, Eg5, transforming growth factor beta (TGFbeta), Nav1.8, RhoA, HIF-1alpha, Nogo-L, Nogo-R, toll-like receptor 9 (TLR9), vascular endothelial growth factor (VEGF), SNCA, beta-catenin, CCR5, c-myc, p53, interleukin-1, interleukin 2, interleukin-12, interleukin-6, interleukin-17a (IL-17a), interleukin-17f (IL-17f), Osteopontin (OPN) gene, psoriasis gene, and tumor necrosis factor gene.

[0087] In particular embodiments, polynucleotide complexes or molecules of the present invention comprise guide strands or target-specific regions targeting two or more genes, e.g., two or more genes associated with a particular disease or disorder. For example, they may include guide strands complementary to interleukin-1 gene or mRNA and tumor necrosis factor gene or mRNA; complementary to interleukin-1 gene or mRNA and interleukin-12 gene or mRNA; or complementary to interleukin-1 gene or mRNA, interleukin-12 gene or mRNA and tumor necrosis factor gene or mRNA, for treatment of rheumatoid arthritis. In one embodiment, they include guide strands complementary to osteopontin gene or mRNA and TNF gene or mRNA.

[0088] Other examples of therapeutic target genes include genes and mRNAs encoding viral proteins, such as human immunodeficiency virus (HIV) proteins, HTLV virus proteins, hepatitis C virus (HCV) proteins, Ebola virus proteins, JC virus proteins, herpes virus proteins, human polyoma virus proteins, influenza virus proteins, and Rous sarcoma virus proteins. In particular embodiments, polynucleotide complexes or molecules of the present invention include guide strands complementary to two or more genes or mRNAs expressed by a particular virus, e.g., two or more HIV protein genes or two or more herpes virus protein genes. In other embodiments, they include guide strands having complementary to two or more herpes simplex virus genes or mRNAs, e.g., the UL29 gene or mRNA and the Nectin-1 gene or mRNA of HSV-2, to reduce HSV-2 expression, replication or activity. In one embodiment, the polynucleotide complexes or molecules having regions targeting two or more HSV-2 genes or mRNAs are present in a formulation for topical delivery.

[0089] In particular embodiments, polynucleotide complexes and molecules of the present invention comprise one, two, three or more guide strands or target-specific regions that target an apolipoprotein B (ApoB) gene or mRNA, e.g., the human ApoB gene or mRNA or the mouse ApoB gene or mRNA. Accordingly, in particular embodiments, they comprise one, two, three or more regions comprising a region complementary to a region of the human ApoB sequence set forth in SEQ ID NO:1. In other embodiments, they comprise one, two, three or more regions comprising a region complementary to a region of the mouse ApoB sequence set forth in SEQ ID NO:10. In particular embodiments, they comprise two or more guide sequences having the specific sequences set forth in the accompanying Examples.

[0090] In certain embodiments, polynucleotide complexes and molecules of the present invention comprise one, two, three or more guide strands or regions that target HIV genes. In particular embodiments, they target one, two, three or more HIV genes or mRNAs encoding one or more proteins selected from HIV gag, HIV tat, HIV env, HIV gag-pol, HIV vif, and HIV nef proteins. Accordingly, in particular embodiments, they comprise one, two, three or more regions complementary to a region of the HIV gag sequence set forth in SEQ ID NO:2; one, two, three or more regions complementary to a region of the HIV tat sequence set forth in SEQ ID NO:3, one, two, three or more regions complementary to a region of the HIV env sequence set forth in SEQ ID NO:4, one, two, three or more regions complementary to a region of the HIV gag-pol sequence set forth in SEQ ID NO:5, one, two, three or more regions comprising a region complementary to a region of the HIV vif sequence set forth in SEQ ID NO:6, one, two, three or more regions comprising a region complementary to a region of the HIV nef sequence set forth in SEQ ID NO:7. In particular embodiments, they comprise two or more guide sequences having the specific HIV sequences set forth in the accompanying Examples.

[0091] In certain embodiments, selection of a sequence region complementary to a target gene (or gene) is based upon analysis of the chosen target sequence and determination of secondary structure, T.sub.m, binding energy, and relative stability and cell specificity. Such sequences may be selected based upon their relative inability to form dimers, hairpins, or other secondary structures that would reduce structural integrity of the polynucleotide or prohibit specific binding to the target gene in a host cell.

[0092] Preferred target regions of the target gene or mRNA may include those regions at or near the AUG translation initiation codon and those sequences that are substantially complementary to 5' regions of the gene or mRNA. These secondary structure analyses and target site selection considerations can be performed, for example, using v.4 of the OLIGO primer analysis software and/or the BLASTN 2.0.5 algorithm software (Altschul et al., Nucleic Acids Res. 1997, 25(17):3389-402) or Oligoengine Workstation 2.0.

[0093] In one embodiment, target sites are preferentially not located within the 5' and 3' untranslated regions (UTRs) or regions near the start codon (within approximately 75 bases), since proteins that bind regulatory regions may interfere with the binding of the polynucleotide In addition, potential target sites may be compared to an appropriate genome database, such as BLASTN 2.0.5, available on the NCBI server at www.ncbi.nlm, and potential target sequences with significant homology to other coding sequences eliminated.

[0094] In another embodiment, the target sites are located within the 5' or 3' untranslated region (UTRs). In addition, the self-complementary region of the polynucleotide may be composed of a particular sequence found in the gene of the target.

[0095] The target gene may be of any species, including, for example, plant, animal (e.g. mammalian), protozoan, viral (e.g., HIV), bacterial or fungal. In certain embodiments, the polynucleotides of the present invention may comprise or be complementary to the GFP sequences in Example 1, the HIV sequences in Example 2, or the ApoB sequences in Example 3.

[0096] As noted above, the target gene sequence and the complementary region of the polynucleotide may be complete complements of each other, or they may be less than completely complementary, as long as the strands hybridize to each other under physiological conditions.

[0097] The polynucleotide complexes and molecules of the present invention comprise at least one, two, or three regions complementary to one or more target genes, as well as one or more self-complementary regions and/or interconnecting loops, Typically, the region complementary to a target gene is 15 to 17 to 24 nucleotides in length, including integer values within these ranges. This region may be at least 16 nucleotides in length, at least 17 nucleotides in length, at least 20 nucleotides in length, at least 24 nucleotides in length, between 15 and 24 nucleotides in length, between 16 and 24 nucleotides in length, or between 17 and 24 nucleotides in length, inclusive of the end values, including any integer value within these ranges.

[0098] The self-complementary region is typically between 2 and 54 nucleotides in length, at least 2 nucleotides in length, at least 16 nucleotides in length, or at least 20 nucleotides in length, including any integer value within any of these ranges. Hence, in one embodiment, a self-complementary region may comprise about 1-26 nucleotide pairs. A single-stranded region can be about 3-15 nucleotides, including all integers in between. A null region refers to a region that is not-specific for any target gene, at least by design. A null region or strand may be used in place of a target-specific region, such as in the design of a bi-valent polynucleotide complex or molecule of the invention (see, e.g., Figure IV(K)).

[0099] In certain embodiments, a self-complementary region is long enough to form a double-stranded structure. In certain embodiments, a 3' region and a 5' region may hybridize to for a self-complementary region (i.e., a double-stranded region) comprising a stem-loop structure. Accordingly, in one embodiment, the primary sequence of a self-complementary region comprises two stretches of sequence complementary to each other separated by additional sequence that is not complementary or is semi-complementary. While less optimal, the additional sequence can be complementary in certain embodiments. The additional sequence forms the loop of the stem-loop structure and, therefore, must be long enough to facilitate the folding necessary to allow the two complementary stretches to bind each other. In particular embodiments, the loop sequence comprises at least 3, at least 4, at least 5 or at least 6 bases. In one embodiment, the loop sequence comprises 4 bases. The two stretches of sequence complementary to each other (within the self-complementary region; i.e., the stem regions) are of sufficient length to specifically hybridize to each other under physiological conditions. In certain embodiments, each stretch comprises 4 to 12 nucleotides; in other embodiments, each stretch comprises at least 4, at least 5, at least 6, at least 8, or at least 10 nucleotides, or any integer value within these ranges. In a particular embodiment, a self-complementary region comprises two stretches of at least 4 complementary nucleotides separated by a loop sequence of at least 4 nucleotides. In certain embodiments, all or a portion of a self-complementary region may or may not be complementary to the region of the polynucleotide that is complementary to the target gene or gene.

[0100] In particular embodiments, self-complementary regions possess thermodynamic parameters appropriate for binding of self-complementary regions, e.g., to form a stem-loop structure.

[0101] In one embodiment, self-complementary regions are dynamically calculated by use of RNA via free-energy analysis and then compared to the energy contained within the remaining "non self-complementary region" or loop region to ensure that the energy composition is adequate to form a desired structure, e.g., a stem-loop structure. In general, different nucleotide sequences of the gene targeting region are considered in determining the compositions of the stem-loop structures to ensure the formation of such. The free-energy analysis formula may again be altered to account for the type of nucleotide or pH of the environment in which it is used. Many different secondary structure prediction programs are available in the art, and each may be used according to the invention. Thermodynamic parameters for RNA and DNA bases are also publicly available in combination with target sequence selection algorithms, of which several are available in the art.

[0102] In one embodiment, the polynucleotide complex or molecule comprises or consists of (a) three oligonucleotides comprising 17 to 24 nucleotides in length (including any integer value in-between), which is complementary to and capable of hybridizing under physiological conditions to at least a portion of an gene molecule, flanked optionally by (b) self-complementary sequences comprising 16 to 54 nucleotides in length (including any integer value in-between) or (c) 2 to 12 nucleotides capable of forming a loop. In one embodiment, each self-complementary sequence is capable of forming a stem-loop structure, one of which is located at the 5' end and one of which is located at the 3' end of the secondary guide strands.

[0103] In certain embodiments, the self-complementary region functions as a structure to recruit enzymatic cleavage of itself and/or bind to particular regions of proteins involved in the catalytic process of gene modulation, In addition, the loop may be of a certain 4-nucleotide (e.g., tetraloop NGNN, AAGU, UUGA, or GUUA) structure to promote the cleavage of the self-complementary region by an RNase such as RNase III. In addition, the self-complementary region can be cleaved by RNase III 11/13 or 14/16 nucleotides into the duplex region leaving a 2 nucleotide 3' end. In certain embodiments, the tetraloop has the sequence GNRA or GNYA, where N indicates any nucleotide or nucleoside, R indicates a purine nucleotide or nucleoside; and Y indicates a pyrimidine nucleotide or nucleoside.

[0104] In certain embodiments, the self-complementary polynucleotide that has been enzymatically cleaved as described above will load onto the protein region of RISC complexes. In certain embodiments, the self-complementary region containing a loop greater than 4 nucleotides can prevent the cleavage of the self-complementary region by RNase such as RNase III. In preferred embodiments, the polynucleotide of the present invention binds to and reduces expression of a target gene. A target gene may be a known gene target, or, alternatively, a target gene may be not known, i.e., a random sequence may be used. In certain embodiments, target gene levels are reduced at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or at least 95%.

[0105] In one embodiment of the invention, the level of inhibition of target gene expression (i.e., gene expression) is at least 90%, at least 95%, at least 98%, and at least 99% or is almost 100%, and hence the cell or organism will in effect have the phenotype equivalent to a so-called "knock out" of a gene. However, in some embodiments, it may be preferred to achieve only partial inhibition so that the phenotype is equivalent to a so-called "knockdown" of the gene. This method of knocking down gene expression can be used therapeutically or for research (e.g., to generate models of disease states, to examine the function of a gene, to assess whether an agent acts on a gene, to validate targets for drug discovery).

[0106] The polynucleotide complexes and molecules of the invention can be used to target and reduce or inhibit expression of genes (inclusive of coding and non-coding sequences), cDNAs, mRNAs, or microRNAs. In particular embodiments, their guide strands or targeting regions bind to mRNAs or microRNAs.

[0107] The invention further provides arrays of the polynucleotide of the invention, including microarrays. Microarrays are miniaturized devices typically with dimensions in the micrometer to millimeter range for performing chemical and biochemical reactions and are particularly suited for embodiments of the invention. Arrays may be constructed via microelectronic and/or microfabrication using essentially any and all techniques known and available in the semiconductor industry and/or in the biochemistry industry, provided that such techniques are amenable to and compatible with the deposition and/or screening of polynucleotide sequences.

[0108] Microarrays of the invention are particularly desirable for high throughput analysis of multiple polynucleotides. A microarray typically is constructed with discrete region or spots that comprise the polynucleotide of the present invention, each spot comprising one or more the polynucleotide, preferably at positionally addressable locations on the array surface. Arrays of the invention may be prepared by any method available in the art. For example, the light-directed chemical synthesis process developed by Affymetrix (see, U.S. Pat. Nos. 5,445,934 and 5,856,174) may be used to synthesize biomolecules on chip surfaces by combining solid-phase photochemical synthesis with photolithographic fabrication techniques. The chemical deposition approach developed by Incyte Pharmaceutical uses pre-synthesized cDNA probes for directed deposition onto chip surfaces (see, e.g., U.S. Pat. No. 5,874,554).

[0109] In certain embodiments, a polynucleotide molecule of the present invention is chemically synthesized using techniques widely available in the art, and annealed as a three stranded complex. In a related embodiment, the three or more guide strands of a polynucleotide complex of the present invention may be individually chemically synthesized and annealed to produce the polynucleotide complex.

[0110] In other embodiments, it is expressed in vitro or in vivo using appropriate and widely known techniques, such as vectors or plasmid constructs. Accordingly, in certain embodiments, the present invention includes in vitro and in vivo expression vectors comprising the sequence of a polynucleotide of the present invention interconnected by either stem-loop or loop forming nucleotide sequences. Methods well known to those skilled in the art may be used to construct expression vectors containing sequences encoding a polynucleotide, as well as appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook, J. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y., and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y.

[0111] A vector or nucleic acid construct system can comprise a single vector or plasmid, two or more vectors or plasmids, which together contain the total DNA to be introduced into the genome of the host cell, or a transposon. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. In the present case, the vector or nucleic acid construct is preferably one which is operably functional in a mammalian cell. The vector can also include a selection marker such as an antibiotic or drug resistance gene, or a reporter gene (i.e., green fluorescent protein, luciferase), that can be used for selection or identification of suitable transformants or transfectants. Exemplary delivery systems may include viral vector systems (i.e., viral-mediated transduction) including, but not limited to, retroviral (e.g., lentiviral) vectors, adenoviral vectors, adeno-associated viral vectors, and herpes viral vectors, among others known in the art.

[0112] As noted above, certain embodiments employ retroviral vectors such as lentiviral vectors. The term "lentivirus" refers to a genus of complex retroviruses that are capable of infecting both dividing and non-dividing cells. Examples of lentiviruses include HIV (human immunodeficiency virus; including HIV type 1, and HIV type 2), visna-maedi, the caprine arthritis-encephalitis virus, equine infectious anemia virus, feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), and simian immunodeficiency virus (SIV). Lentiviral vectors can be derived from any one or more of these lentiviruses (see, e.g., Evans et al., Hum Gene Ther. 10:1479-1489, 1999; Case et al., PNAS USA 96:2988-2993, 1999; Uchida et al., PNAS USA 95:11939-11944, 1998; Miyoshi et al., Science 283:682-686, 1999; Sutton et al., J Virol 72:5781-5788, 1998; and Frecha et al., Blood. 112:4843-52, 2008, each of which is incorporated by reference in its entirety).

[0113] In certain embodiments the retroviral vector comprises certain minimal sequences from a lentivirus genome, such as the HIV genome or the SIV genome. The genome of a lentivirus is typically organized into a 5' long terminal repeat (LTR) region, the gag gene, the pol gene, the env gene, the accessory genes (e.g., nef, vif, vpr, vpu, tat, rev) and a 3' LTR region. The viral LTR is divided into three regions referred to as U3, R (repeat) and U5. The U3 region contains the enhancer and promoter elements, the U5 region contains the polyadenylation signals, and the R region separates the U3 and U5 regions. The transcribed sequences of the R region appear at both the 5' and 3' ends of the viral RNA (see, e.g., "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed., Oxford University Press, 2000); O Narayan, J. Gen. Virology. 70:1617-1639, 1989; Fields et al., Fundamental Virology Raven Press., 1990; Miyoshi et al., J Virol. 72:8150-7, 1998; and U.S. Pat. No. 6,013,516, each of which is incorporated by reference in its entirety). Lentiviral vectors may comprise any one or more of these elements of the lentiviral genome, to regulate the activity of the vector as desired, or, they may contain deletions, insertions, substitutions, or mutations in one or more of these elements, such as to reduce the pathological effects of lentiviral replication, or to limit the lentiviral vector to a single round of infection.

[0114] Typically, a minimal retroviral vector comprises certain 5'LTR and 3'LTR sequences, one or more genes of interest (to be expressed in the target cell), one or more promoters, and a cis-acting sequence for packaging of the RNA. Other regulatory sequences can be included, as described herein and known in the art. The viral vector is typically cloned into a plasmid that may be transfected into a packaging cell line, such as a eukaryotic cell (e.g., 293-HEK), and also typically comprises sequences useful for replication of the plasmid in bacteria.

[0115] In certain embodiments, the viral vector comprises sequences from the 5' and/or the 3' LTRs of a retrovirus such as a lentivirus. The LTR sequences may be LTR sequences from any lentivirus from any species. For example, they may be LTR sequences from HIV, SIV, FIV or BIV. Preferably the LTR sequences are HIV LTR sequences.

[0116] In certain embodiments, the viral vector comprises the R and U5 sequences from the 5' LTR of a lentivirus and an inactivated or "self-inactivating" 3' LTR from a lentivirus. A "self-inactivating 3' LTR" is a 3' long terminal repeat (LTR) that contains a mutation, substitution or deletion that prevents the LTR sequences from driving expression of a downstream gene. A copy of the U3 region from the 3' LTR acts as a template for the generation of both LTR's in the integrated provirus. Thus, when the 3' LTR with an inactivating deletion or mutation integrates as the 5' LTR of the provirus, no transcription from the 5' LTR is possible. This eliminates competition between the viral enhancer/promoter and any internal enhancer/promoter. Self-inactivating 3' LTRs are described, for example, in Zufferey et al., J Virol. 72:9873-9880, 1998; Miyoshi et al., J Virol. 72:8150-8157, 1998; and Iwakuma et al., Virology 261:120-132, 1999, each of which is incorporated by reference in its entirety. Self-inactivating 3' LTRs may be generated by any method known in the art. In certain embodiments, the U3 element of the 3' LTR contains a deletion of its enhancer sequence, preferably the TATA box, Spl and/or NF-kappa B sites. As a result of the self-inactivating 3' LTR, the provirus that is integrated into the host cell genome will comprise an inactivated 5' LTR.

[0117] Expression vectors typically include regulatory sequences, which regulate expression of the polynucleotide. Regulatory sequences present in an expression vector include those non-translated regions of the vector, e.g., enhancers, promoters, 5' and 3' untranslated regions, which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and cell utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. In addition, tissue- or -cell specific promoters may also be used.

[0118] For expression in mammalian cells, promoters from mammalian genes or from mammalian viruses are generally preferred. In addition, a number of viral-based expression systems are generally available. For example, in cases where an adenovirus is used as an expression vector, sequences encoding a polypeptide of interest may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non-essential E1 or E3 region of the viral genome may be used to obtain a viable virus which is capable of expressing the polypeptide in infected host cells (Logan, J. and Shenk, T. (1984) Proc. Natl. Acad. Sci. 81:3655-3659). In addition, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, may be used to increase expression in mammalian host cells.

[0119] Certain embodiments may employ the one or more of the RNA polymerase II and III promoters. A suitable selection of RNA polymerase III promoters can be found, for example, in Paule and White. Nucleic Acids Research., Vol 28, pp 1283-1298, 2000, which is incorporated by reference in its entirety. RNA polymerase II and III promoters also include any synthetic or engineered DNA fragments that can direct RNA polymerase II or III, respectively, to transcribe its downstream RNA coding sequences. Further, the RNA polymerase II or III (Pol II or III) promoter or promoters used as part of the viral vector can be inducible. Any suitable inducible Pol II or III promoter can be used with the methods of the invention. Exemplary Pol II or III promoters include the tetracycline responsive promoters provided in Ohkawa and Taira, Human Gene Therapy, Vol. 11, pp 577-585, 2000; and Meissner et al., Nucleic Acids Research, Vol. 29, pp 1672-1682, 2001, each of which is incorporated by reference in its entirety.

[0120] Non-limiting examples of constitutive promoters that may be used include the promoter for ubiquitin, the CMV promoter (see, e.g., Karasuyama et al., J. Exp. Med. 169:13, 1989), the .beta.-actin (see, e.g., Gunning et al., PNAS USA 84:4831-4835, 1987), and the pgk promoter (see, e.g., Adra et al., Gene 60:65-74, 1987); Singer-Sam et al., Gene 32:409-417, 1984; and Dobson et al., Nucleic Acids Res. 10:2635-2637, 1982, each of which is incorporated by reference). Non-limiting examples of tissue specific promoters include the Ick promoter (see, e.g., Garvin et al., Mol. Cell Biol. 8:3058-3064, 1988; and Takadera et al., Mol. Cell Biol. 9:2173-2180, 1989), the myogenin promoter (Yee et al., Genes and Development 7:1277-1289, 1993), and the thy1 (see, e.g., Gundersen et al., Gene 113:207-214, 1992).

[0121] Additional examples of promoters include the ubiquitin-C promoter, the human .mu. heavy chain promoter or the Ig heavy chain promoter (e.g., MH-b12), and the human .kappa. light chain promoter or the Ig light chain promoter (e.g., EEK-b12), which are functional in B-lymphocytes. The MH-b12 promoter contains the human .mu. heavy chain promoter preceded by the iE.mu. enhancer flanked by matrix association regions, and the EEK-b12 promoter contains the .kappa. light chain promoter preceded an intronic enhancer (iE.kappa.), a matrix associated region, and a 3' enhancer (3'E.kappa.) (see, e.g., Luo et al., Blood. 113:1422-1431, 2009, herein incorporated by reference). Accordingly, certain embodiments may employ one or more of these promoter or enhancer elements.

[0122] In certain embodiments, the invention provides for the conditional expression of a polynucleotide. A variety of conditional expression systems are known and available in the art for use in both cells and animals, and the invention contemplates the use of any such conditional expression system to regulate the expression or activity of a polynucleotide. In one embodiment of the invention, for example, inducible expression is achieved using the REV-TET system. Components of this system and methods of using the system to control the expression of a gene are well documented in the literature, and vectors expressing the tetracycline-controlled transactivator (tTA) or the reverse tTA (rtTA) are commercially available (e.g., pTet-Off, pTet-On and ptTA-2/3/4 vectors, Clontech, Palo Alto, Calif.). Such systems are described, for example, in U.S. Pat. Nos. 5,650,298, 6,271,348, 5,922,927, and related patents, which are incorporated by reference in their entirety.

[0123] In certain embodiments, the viral vectors (e.g., retroviral, lentiviral) provided herein are "pseudo-typed" with one or more selected viral glycoproteins or envelope proteins, mainly to target selected cell types. Pseudo-typing refers to generally to the incorporation of one or more heterologous viral glycoproteins onto the cell-surface virus particle, often allowing the virus particle to infect a selected cell that differs from its normal target cells. A "heterologous" element is derived from a virus other than the virus from which the RNA genome of the viral vector is derived. Typically, the glycoprotein-coding regions of the viral vector have been genetically altered such as by deletion to prevent expression of its own glycoprotein. Merely by way of illustration, the envelope glycoproteins gp41 and/or gp120 from an HIV-derived lentiviral vector are typically deleted prior to pseudo-typing with a heterologous viral glycoprotein.

[0124] Generation of viral vectors can be accomplished using any suitable genetic engineering techniques known in the art, including, without limitation, the standard techniques of restriction endonuclease digestion, ligation, transformation, plasmid purification, PCR amplification, and DNA sequencing, for example as described in Sambrook et al. (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, N.Y. (1989)), Coffin et al. (Retroviruses. Cold Spring Harbor Laboratory Press, N.Y. (1997)) and "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed., Oxford University Press, (2000)).

[0125] Any variety of methods known in the art may be used to produce suitable retroviral particles whose genome comprises an RNA copy of the viral vector. As one method, the viral vector may be introduced into a packaging cell line that packages the viral genomic RNA based on the viral vector into viral particles with a desired target cell specificity. The packaging cell line typically provides in trans the viral proteins that are required for packaging the viral genomic RNA into viral particles and infecting the target cell, including the structural gag proteins, the enzymatic pol proteins, and the envelope glycoproteins.

[0126] In certain embodiments, the packaging cell line may stably express certain of the necessary or desired viral proteins (e.g., gag, pol) (see, e.g., U.S. Pat. No. 6,218,181, herein incorporated by reference). In certain embodiments, the packaging cell line may be transiently transfected with plasmids that encode certain of the necessary or desired viral proteins (e.g., gag, pol, glycoprotein), including the measles virus glycoprotein sequences described herein. In one exemplary embodiment, the packaging cell line stably expresses the gag and pol sequences, and the cell line is then transfected with a plasmid encoding the viral vector and a plasmid encoding the glycoprotein. Following introduction of the desired plasmids, viral particles are collected and processed accordingly, such as by ultracentrifugation to achieve a concentrated stock of viral particles. Exemplary packaging cell lines include 293 (ATCC CCL X), HeLa (ATCC CCL 2), D17 (ATCC CCL 183), MDCK (ATCC CCL 34), BHK (ATCC CCL-10) and Cf2Th (ATCC CRL 1430) cell lines.

[0127] In one particular embodiment, the polynucleotides are expressed using a vector system comprising a pSUPER vector backbone and additional sequences corresponding to the polynucleotide to be expressed. The pSUPER vectors system has been shown useful in expressing shRNA reagents and downregulating gene expression (Brummelkamp, T. T. et al., Science 296:550 (2002) and Brummelkamp, T. R. et al., Cancer Cell, published online Aug. 22, 2002). PSUPER vectors are commercially available from OligoEngine, Seattle, Wash.

Methods of Regulating Gene Expression

[0128] The polynucleotides of the invention may be used for a variety of purposes, all generally related to their ability to inhibit or reduce expression of one or more target genes. Accordingly, the invention provides methods of reducing expression of one or more target genes comprising introducing a polynucleotide complex or molecule of the present invention into a cell comprising said one or more target genes. In particular embodiments, the polynucleotide complex or molecule comprises one or more guide strands that collectively target the one or more target genes. In one embodiment, a polynucleotide of the invention is introduced into a cell that contains a target gene or a homolog, variant or ortholog thereof, targeted by either one, two, or three of the guide strands or targeting regions.

[0129] In addition, the polynucleotides of the present invention may be used to reduce expression indirectly. For example, a polynucleotide complex or molecule of the present invention may be used to reduce expression of a transactivator that drives expression of a second gene (i.e., the target gene), thereby reducing expression of the second gene. Similarly, a polynucleotide may be used to increase expression indirectly. For example, a polynucleotide complex or molecule of the present invention may be used to reduce expression of a transcriptional repressor that inhibits expression of a second gene, thereby increasing expression of the second gene.

[0130] In various embodiments, a target gene is a gene derived from the cell into which a polynucleotide is to be introduced, an endogenous gene, an exogenous gene, a transgene, or a gene of a pathogen that is present in the cell after transfection thereof. Depending on the particular target gene and the amount of the polynucleotide delivered into the cell, the method of this invention may cause partial or complete inhibition of the expression of the target gene. The cell containing the target gene may be derived from or contained in any organism (e.g., plant, animal, protozoan, virus, bacterium, or fungus). As used herein, "target genes" include genes, mRNAs, and microRNAs.

[0131] Inhibition of the expression of the target gene can be verified by means including, but not limited to, observing or detecting an absence or observable decrease in the level of protein encoded by a target gene, an absence or observable decrease in the level of a gene product expressed from a target gene (e.g., mRNA0, and/or a phenotype associated with expression of the gene, using techniques known to a person skilled in the field of the present invention.

[0132] Examples of cell characteristics that may be examined to determine the effect caused by introduction of a polynucleotide complex or molecule of the present invention include, cell growth, apoptosis, cell cycle characteristics, cellular differentiation, and morphology.

[0133] A polynucleotide complex or molecule of the present invention may be directly introduced to the cell (i.e., intracellularly), or introduced extracellularly into a cavity or interstitial space of an organism, e.g., a mammal, into the circulation of an organism, introduced orally, introduced by bathing an organism in a solution containing the polynucleotide, or by some other means sufficient to deliver the polynucleotide into the cell.

[0134] In addition, a vector engineered to express a polynucleotide may be introduced into a cell, wherein the vector expresses the polynucleotide, thereby introducing it into the cell. Methods of transferring an expression vector into a cell are widely known and available in the art, including, e.g., transfection, lipofection, scrape-loading, electroporation, microinjection, infection, gene gun, and retrotransposition. Generally, a suitable method of introducing a vector into a cell is readily determined by one of skill in the art based upon the type of vector and the type of cell, and teachings widely available in the art. Infective agents may be introduced by a variety of means readily available in the art, including, e.g., nasal inhalation.

[0135] Methods of inhibiting gene expression using the oligonucleotides of the invention may be combined with other knockdown and knockout methods, e.g., gene targeting, antisense RNA, ribozymes, double-stranded RNA (e.g., shRNA and siRNA) to further reduce expression of a target gene.

[0136] In different embodiments, target cells of the invention are primary cells, cell lines, immortalized cells, or transformed cells. A target cell may be a somatic cell or a germ cell. The target cell may be a non-dividing cell, such as a neuron, or it may be capable of proliferating in vitro in suitable cell culture conditions. Target cells may be normal cells, or they may be diseased cells, including those containing a known genetic mutation. Eukaryotic target cells of the invention include mammalian cells, such as, for example, a human cell, a murine cell, a rodent cell, and a primate cell. In one embodiment, a target cell of the invention is a stem cell, which includes, for example, an embryonic stem cell, such as a murine embryonic stem cell.

[0137] The polynucleotide complexes, molecules, and methods of the present invention may be used to treat any of a wide variety of diseases or disorders, including, but not limited to, inflammatory diseases, cardiovascular diseases, nervous system diseases, tumors, demyelinating diseases, digestive system diseases, endocrine system diseases, reproductive system diseases, hemic and lymphatic diseases, immunological diseases, mental disorders, muscoloskeletal diseases, neurological diseases, neuromuscular diseases, metabolic diseases, sexually transmitted diseases, skin and connective tissue diseases, urological diseases, and infections.

[0138] In certain embodiments, the methods are practiced on an animal, in particular embodiments, a mammal, and in certain embodiments, a human.

[0139] Accordingly, in one embodiment, the present invention includes methods of using a polynucleotide complex or molecule of the present invention for the treatment or prevention of a disease associated with gene deregulation, overexpression, or mutation. For example, a polynucleotide complex or molecule of the present invention may be introduced into a cancerous cell or tumor and thereby inhibit expression of a gene required for or associated with maintenance of the carcinogenic/tumorigenic phenotype. To prevent a disease or other pathology, a target gene may be selected that is, e.g., required for initiation or maintenance of a disease/pathology. Treatment may include amelioration of any symptom associated with the disease or clinical indication associated with the pathology.

[0140] In addition, the polynucleotides of the present invention are used to treat diseases or disorders associated with gene mutation. In one embodiment, a polynucleotide is used to modulate expression of a mutated gene or allele. In such embodiments, the mutated gene is a target of the polynucleotide complex or molecule, which will comprise a region complementary to a region of the mutated gene. This region may include the mutation, but it is not required, as another region of the gene may also be targeted, resulting in decreased expression of the mutant gene or gene. In certain embodiments, this region comprises the mutation, and, in related embodiments, the polynucleotide complex or molecule specifically inhibits expression of the mutant gene or gene but not the wild type gene or gene. Such a polynucleotide is particularly useful in situations, e.g., where one allele is mutated but another is not. However, in other embodiments, this sequence would not necessarily comprise the mutation and may, therefore, comprise only wild-type sequence. Such a polynucleotide is particularly useful in situations, e.g., where all alleles are mutated. A variety of diseases and disorders are known in the art to be associated with or caused by gene mutation, and the invention encompasses the treatment of any such disease or disorder with a the polynucleotide.

[0141] In certain embodiments, a gene of a pathogen is targeted for inhibition. For example, the gene could cause immunosuppression of the host directly or be essential for replication of the pathogen, transmission of the pathogen, or maintenance of the infection. In addition, the target gene may be a pathogen gene or host gene responsible for entry of a pathogen into its host, drug metabolism by the pathogen or host, replication or integration of the pathogen's genome, establishment or spread of an infection in the host, or assembly of the next generation of pathogen. Methods of prophylaxis (i.e., prevention or decreased risk of infection), as well as reduction in the frequency or severity of symptoms associated with infection, are included in the present invention. For example, cells at risk for infection by a pathogen or already infected cells, particularly human immunodeficiency virus (HIV) infections, may be targeted for treatment by introduction of a the polynucleotide according to the invention (see Examples 1 and 2 for targeting sequences). Thus, in one embodiment, polynucleotide complexes or molecules of the present invention that target one or more HIV proteins are used to treat or inhibit HIV infection or acquired immune deficiency syndrome (AIDS).

[0142] In other specific embodiments, the present invention is used for the treatment or development of treatments for cancers of any type. Examples of tumors that can be treated using the methods described herein include, but are not limited to, neuroblastomas, myelomas, prostate cancers, small cell lung cancer, colon cancer, ovarian cancer, non-small cell lung cancer, brain tumors, breast cancer, leukemias, lymphomas, and others.

[0143] In one embodiment, polynucleotide complexes or molecules of the present invention that target apolipoprotein B (apoB) are used to treat, reduce, or inhibit atherosclerosis or heart disease. ApoB is the primary apolipoprotein of low-density lipoproteins (LDLs), which is responsible for carrying cholesterol to tissues. ApoB on the LDL particle acts as a ligand for LDL receptors, and high levels of ApoB can lead to plaques that cause vascular disease (atherosclerosis), leading to heart disease.

[0144] The polynucleotide complexes, molecules and expression vectors (including viral vectors and viruses) may be introduced into cells in vitro or ex vivo and then subsequently placed into an animal to affect therapy, or they may be directly introduced to a patient by in vivo administration. Thus, the invention provides methods of gene therapy, in certain embodiments. Compositions of the invention may be administered to a patient in any of a number of ways, including parenteral, intravenous, systemic, local, topical, oral, intratumoral, intramuscular, subcutaneous, intraperitoneal, inhalation, or any such method of delivery. In one embodiment, the compositions are administered parenterally, i.e., intraarticularly, intravenously, intraperitoneally, subcutaneously, or intramuscularly. In a specific embodiment, the liposomal compositions are administered by intravenous infusion or intraperitoneally by a bolus injection.

[0145] Compositions of the invention may be formulated as pharmaceutical compositions suitable for delivery to a subject. The pharmaceutical compositions of the invention will often further comprise one or more buffers (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose, dextrose or dextrans), mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, bacteriostats, chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide), solutes that render the formulation isotonic, hypotonic or weakly hypertonic with the blood of a recipient, suspending agents, thickening agents and/or preservatives. Alternatively, compositions of the present invention may be formulated as a lyophilizate.

[0146] The amount of the oligonucleotides administered to a patient can be readily determined by a physician based upon a variety of factors, including, e.g., the disease and the level of the oligonucleotides expressed from the vector being used (in cases where a vector is administered). The amount administered per dose is typically selected to be above the minimal therapeutic dose but below a toxic dose. The choice of amount per dose will depend on a number of factors, such as the medical history of the patient, the use of other therapies, and the nature of the disease. In addition, the amount administered may be adjusted throughout treatment, depending on the patient's response to treatment and the presence or severity of any treatment-associated side effects.

Methods of Determining Gene Function

[0147] The invention further includes a method of identifying gene function in an organism comprising the use of a polynucleotide complex or molecule of the present invention to inhibit the activity of a target gene of previously unknown function. Instead of the time consuming and laborious isolation of mutants by traditional genetic screening, functional genomics envisions determining the function of uncharacterized genes by employing the invention to reduce the amount and/or alter the timing of target gene activity. The invention may be used in determining potential targets for pharmaceutics, understanding normal and pathological events associated with development, determining signaling pathways responsible for postnatal development/aging, and the like. The increasing speed of acquiring nucleotide sequence information from genomic and expressed gene sources, including total sequences for the yeast, D. melanogaster, and C. elegans genomes, can be coupled with the invention to determine gene function in an organism (e.g., nematode). The preference of different organisms to use particular codons, searching sequence databases for related gene products, correlating the linkage map of genetic traits with the physical map from which the nucleotide sequences are derived, and artificial intelligence methods may be used to define putative open reading frames from the nucleotide sequences acquired in such sequencing projects.

[0148] In one embodiment, a polynucleotide of the present invention is used to inhibit gene expression based upon a partial sequence available from an expressed sequence tag (EST), e.g., in order to determine the gene's function or biological activity. Functional alterations in growth, development, metabolism, disease resistance, or other biological processes would be indicative of the normal role of the ESTs gene product.

[0149] The ease with which a polynucleotide can be introduced into an intact cell/organism containing the target gene allows the present invention to be used in high throughput screening (HTS). For example, solutions containing the polynucleotide that are capable of inhibiting different expressed genes can be placed into individual wells positioned on a microtiter plate as an ordered array, and intact cells/organisms in each well can be assayed for any changes or modifications in behavior or development due to inhibition of target gene activity. The function of the target gene can be assayed from the effects it has on the cell/organism when gene activity is inhibited. In one embodiment, the polynucleotides of the invention are used for chemocogenomic screening, i.e., testing compounds for their ability to reverse a disease modeled by the reduction of gene expression using a polynucleotide of the invention.

[0150] If a characteristic of an organism is determined to be genetically linked to a polymorphism through RFLP or QTL analysis, the present invention can be used to gain insight regarding whether that genetic polymorphism might be directly responsible for the characteristic. For example, a fragment defining the genetic polymorphism or sequences in the vicinity of such a genetic polymorphism can be amplified to produce an RNA, a polynucleotide can be introduced to the organism, and whether an alteration in the characteristic is correlated with inhibition can be determined.

[0151] The present invention is also useful in allowing the inhibition of essential genes. Such genes may be required for cell or organism viability at only particular stages of development or cellular compartments. The functional equivalent of conditional mutations may be produced by inhibiting activity of the target gene when or where it is not required for viability. The invention allows addition of a the polynucleotide at specific times of development and locations in the organism without introducing permanent mutations into the target genome. Similarly, the invention contemplates the use of inducible or conditional vectors that express a the polynucleotide only when desired.

[0152] The present invention also relates to a method of validating whether a gene product is a target for drug discovery or development. A the polynucleotide that targets the gene that corresponds to the gene for degradation is introduced into a cell or organism. The cell or organism is maintained under conditions in which degradation of the gene occurs, resulting in decreased expression of the gene. Whether decreased expression of the gene has an effect on the cell or organism is determined. If decreased expression of the gene has an effect, then the gene product is a target for drug discovery or development.

Methods of Designing and Producing Polynucleotide Complexes and Molecules

[0153] The polynucleotide complexes and molecules of the present invention comprise a novel and unique set of functional sequences, arranged in a manner so as to adopt a secondary structure containing one or more double-stranded regions (sometimes adjoined by stem-loop or loop structures), which imparts the advantages of the polynucleotide. Accordingly, in certain embodiments, the present invention includes methods of designing the polynucleotide complexes and molecules of the present invention. Such methods typically involve appropriate selection of the various sequence components of the polynucleotide complexes and molecules. The terms "primary strand", "secondary strand", and "key strand" refer to the various guide strands present within a polynucleotide complex or molecule of the present invention.

[0154] In one embodiment, the basic design of the polynucleotide complex is as follows:

Design Motifs:

[0155] (primary strand)(UU)(secondary strand)(UU)(key strand)(UU)

[0156] Accordingly, in a related embodiment, a the polynucleotide is designed as follows:

[0157] II. (secondary strand)(UU)(UU)(key strand)(UU)(primary strand)

[0158] III. (secondary strand)(UU)(loop or stem-loop)(key strand)(UU)(loop or stem-loop)(primary strand)(UU)

Set Parameters

[0159] Set seed size for self-complementarity at approximately 38-43%. For a 19 nucleotide targets, a range or 7 or 8 nucleotides is preferred as SEED_SIZE.

[0160] For each gene, define a PRIMARY and SECONDARY target gene.

Define Primary Strands

[0161] Start with one or more target gene sequences. For each gene, build a list of PRIMARY target sequences 17-24 nucleotide motifs that meet criteria of G/C content, specificity, and poly-A or poly-G free. For each, find also a SECONDARY and KEY strand.

Find Secondary and Key Strands

[0162] d. For each target sequence on each gene, clustal align base 1 through SEED_SIZE the reverse of each sequence to the SECONDARY gene

[0163] Record sequence with a perfect alignment. The target sequence on the SECONDARY gene is the alignment start, minus the length of the motif, plus SEED_SIZE to alignment start, plus SEED_SIZE. The SECONDARY strand is the reverse compliment.

[0164] To find each KEY strand, define SEED_A as base 1 through SEED_SIZE of the PRIMARY strand, define SEED_B as bases at motif length minus SEED_SIZE to motif length of the SECONDARY strand. Set a MID_SECTION as characters "I" repeated of length motif sequence length minus SEED_A length plus SEED_B length. Set key alignment sequence as SEED_A, MID_SECTION, SEED_B. Clustal align to the target gene for the key segment. Record KEY target sequence as bases at alignment hit on key target gene to bases alignment hit plus motif length. The KEY strand is the reverse compliment.

Construct Optional Polynucleotide

[0165] g. Build candidate Stem A & B with (4-24) nucleotides that have melting temperature dominant to equal length region of target. Stem strands have A-T, G-C complementarity to each other. Length and composition depend upon which endoribonuclease is chosen for pre-processing of the stem-loop structure.

[0166] h. Build candidate Stem C & D with (4-24) nucleotides that have melting temperature dominant to equal length region of target. Stem strands have A-T, G-C complementarity to each other, but no complementarity to Stem A & B. Length and composition depend upon which endoribonuclease is chosen for pre-processing of the stem-loop structure.

[0167] i. Build loop candidates with (4-12) A-T rich nucleotides into loop A & B. Length and composition depend upon which endoribonuclease is chosen for pre-processing of the stem-loop structure. Tetraloops as described are suggested for longer stems processed by RNase III or Pac1 RNase III endoribonucleases as drawn in (Fig. A.). Larger loops are suggested for preventing RNase III or Pac1 processing and placed onto shorter stems as drawn in (Fig. C, Fig. D.).

[0168] j. Form a contiguous sequence for each motif candidate.

[0169] k. Fold candidate sequence using software with desired parameters.

[0170] l. From output, locate structures with single stranded target regions which are flanked at either one or both ends with a desired stem/loop structure.

[0171] In one embodiment, a method of designing a polynucleotide sequence comprising one or more self-complementary regions for the regulation of expression of a target gene (i.e., a the polynucleotide), includes: (a) selecting a first sequence 17 to 30 nucleotides in length and complementary to a target gene; and (b) selecting one or more additional sequences 12 to 54 nucleotides in length, which comprises self-complementary regions and which are non-complementary to the first sequence.

[0172] These methods, in certain embodiments, include determining or predicting the secondary structure adopted by the sequences selected in step (b), e.g., in order to determine that they are capable of adopting a stem-loop structure.

[0173] Similarly, these methods can include a verification step, which comprises testing the designed polynucleotide sequence for its ability to inhibit expression of a target gene, e.g., in an in vivo or in vitro test system.

[0174] The invention further contemplates the use of a computer program to select sequences of a polynucleotide, based upon the complementarity characteristics described herein. The invention, thus, provides computer software programs, and computer readable media comprising said software programs, to be used to select the polynucleotide sequences, as well as computers containing one of the programs of the present invention.

[0175] In certain embodiments, a user provides a computer with information regarding the sequence, location or name of a target gene. The computer uses this input in a program of the present invention to identify one or more appropriate regions of the target gene to target, and outputs or provides complementary sequences to use in the polynucleotide of the invention. The computer program then uses this sequence information to select sequences of the one or more self-complementary regions of the polynucleotide. Typically, the program will select a sequence that is not complementary to a genomic sequence, including the target gene, or the region of the polynucleotide that is complementary to the target gene. Furthermore, the program will select sequences of self-complementary regions that are not complementary to each other. When desired, the program also provides sequences of gap regions. Upon selection of appropriate sequences, the computer program outputs or provides this information to the user.

[0176] The programs of the present invention may further use input regarding the genomic sequence of the organism containing the target gene, e.g., public or private databases, as well as additional programs that predict secondary structure and/or hybridization characteristics of particular sequences, in order to ensure that the polynucleotide adopts the correct secondary structure and does not hybridize to non-target genes.

[0177] The present invention is based, in part, upon the surprising discovery that the polynucleotide, as described herein, is extremely effective in reducing target gene expression of one or more genes. The polynucleotide offer significant advantages over previously described antisense RNAs, including increased potency, and increased effectiveness to multiple target genes. Furthermore, the polynucleotide of the invention offer additional advantages over traditional dsRNA molecules used for siRNA, since the use of the polynucleotide substantially eliminates the off-target suppression associated with dsRNA molecules and offers multivalent RNAi.

[0178] It is understood that the compositions and methods of the present invention may be used to target a variety of different target genes. The term "target gene" may refer to a gene, an mRNA, or a microRNA. Accordingly, target sequences provided herein may be depicted as either DNA sequences or RNA sequences. One of skill the art will appreciate that the compositions of the present invention may include regions complementary to either the DNA or RNA sequences provided herein. Thus, where either a DNA or RNA target sequence is provided, it is understood that the corresponding RNA or DNA target sequence, respectively, may also be targeted.

[0179] The practice of the present invention will employ a variety of conventional techniques of cell biology, molecular biology, microbiology, and recombinant DNA, which are within the skill of the art. Such techniques are fully described in the literature. See, for example, Molecular Cloning: A Laboratory Manual, 2.sup.nd Ed., ed. by Sambrook, Fritsch, and Maniatis (Cold Spring Harbor Laboratory Press, 1989); and DNA Cloning, Volumes I and II (D. N. Glover ed. 1985).

[0180] All of the patents, patent applications, and non-patent references referred to herein are incorporated by reference in their entirety, as if each one was individually incorporated by reference.

[0181] The various embodiments described above can be combined to provide further embodiments. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications and publications to provide yet further embodiments.

[0182] These and other changes can be made to the embodiments in light of the above-detailed description. In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.

EXAMPLES

Example 1

Trivoid Anti-GFP

[0183] Multivalent siRNA were designed against a single gene, the green fluorescent protein (GFP). A multivalent synthetic RNA MV-siRNA complex directed against GFP was tested to compare suppression activity in relation to that of a single shRNA clone. Also, to test the effect of deactivating one of the strands of the synthetic MV-siRNA complex, one strand was replaced with DNA (T1-19_C_dna); as shown below. This replacement resulted in a relative drop in suppression by .about.30%. Additionally, `short` and `long` forms of the MV-siRNA self-complementary clones described herein were tested and compared to the suppression of GFP expression in relation to that of a published shRNA clone.

[0184] Oligomer sequences for the synthetic MV-siRNA, and the DNA replacement strand, are shown below in Table 1. The targeted regions of the GFP coding sequence are illustrated in FIG. 8A.

TABLE-US-00001 TABLE 1 Oligos for Synthetic MV-siRNA: Name Sequence SEQ ID NO: TI-19/7_A GGGCAGCUUGCCGGUGGUGUU 11 TI-19/7_B CACCACCCCGGUGAACAGCUU 12 TI-19/70 GCUGUUCACGUCGCUGCCCUU 13 TI-19/7_C_dna GCTGTTCACGTCGCTGCCC 14

[0185] To prepare the synthetic multivalent-siRNAs (MV-siRNAs), each tube of the individual oligos above was resuspended in RNase-free water to obtain a final concentration of 50 .mu.M (50 pmoles/.mu.L). The individual oligos were then combined as (a) TI-19/7_A, TI-19/7_B, and TI-19/7_C (MV-siRNA GFP I), or as (b) TI-19/7_A, TI-19/7_B, and TI-19/7_C_dna (MV-siRNA GFP I DNA), and annealed as follows. 30 .mu.L of each one of the resupended oligos were combined with 10 .mu.L of 10.times. annealing buffer (100 mM Tris-HCl pH7.5, 1M NaCl, 10 mM EDTA), vortexed, heated for 5 minutes at 94.degree. C., and step cooled to 70.degree. C. over 30 minutes. The final concentration of the annealed MV-siRNA was about 15 .mu.M.

[0186] To prepare the multivalent-siRNA clones and shRNA control, the sequences in Table 2 below were cloned into the pSUPER vector, according to the pSUPER manual. The first sequence for each named clone (e.g., TI, T1_long, TII) represents the sequence of the self-complementary multivalent siRNA that was expressed in the cell as an RNA transcript (comparable to the sequence of the synthetic MV-siRNAs in Table 1), and the sequence referred to as "_as" is part of the coding sequence for that molecule.

TABLE-US-00002 TABLE 2 Oligos for MV-siRNA expressing clones: Name Sequence SEQ ID NO: T1 GATCCCCCACCACCCCGGTGAACAGCgttaGCTGTTCACGTCGCT 15 GCCCgttaGGGCAGCTTGCCGGTGGTGttTTTTTA TI_as AGCTTAACACCACCGGCAAGCTGCCCTAACGGGCAGCGACGTGAA 16 CAGCTAACGCTGTTCACCGGGGTGGTGGGG T1_long GATCCCCCACCACCCCGGTGAACAGCTTGTAGGTGGCATCGCAGA 17 AGCGATGCCACCTACAAGCTGTTCACGTCGCTGCCCTTGTAGGTG GCATCGCAGAAGCGATGCCACCTACAAGGGCAGCTTGCCGGTGGT GttTTTTTA T1_long_as AGCTTAACACCACCGGCAAGCTGCCCTTGTAGGTGGCATCGCTTC 18 TGCGATGCCACCTACAAGGGCAGCGACGTGAACAGCTTGTAGGTG GCATCGCTTCTGCGATGCCACCTACAAGCTGTTCACCGGGGTGGT GGGG TII GATCCCCCGTGCTGCTTCATGTGGTCGTTgttaCGACCACAATGG 19 CGACAACCTTgttaGGTTGTCGGGCAGCAGCACGTTttTTTTTA TII_as AGCTTAAAACGTGCTGCTGCCCGACAACCTAACAAGGTTGTCGCC 20 ATTGTGGTCGTAACAACGACCACATGAAGCAGCACGGGG TII_long GATCCCCCGTGCTGCTTCATGTGGTCGTTGTAGGTGGCATCGCAG 21 AAGCGATGCCACCTACAACGACCACAATGGCGACAACCTTGTAGG TGGCATCGCAGAAGCGATGCCACCTACAAGGTTGTCGGGCAGCAG CACGttTTTTTA TII_long_as AGCTTAACGTGCTGCTGCCCGACAACCTTGTAGGTGGCATCGCTT 22 CTGCGATGCCACCTACAAGGTTGTCGCCATTGTGGTCGTTGTAGG TGGCATCGCTTCTGCGATGCCACCTACAACGACCACATGAAGCAG CACGGGG shRNA GATCCCCGCAAGCTGACCCTGAAGTTCTTCAAGAGAGAACTTCAG 23 GGTCAGCTTGCTTTTTA shRNA_as AGCTTAAAAAGCAAGCTGACCCTGAAGTTCTOTCTTGAAGAACTT 24 CAGGGTCAGCTTGCGGG

[0187] To test the effects on GFP-expression, the annealed MV-siRNA molecules (at a final concentration of 7.5 nM per well) and pSUPER vectors containing the MV-siRNA clones or shRNA control were transfected with Lipofectamine 2000 into 293 cells that constitutively express GFP. GFP fluorescence was measure by flow cytometry 24 hour after transfection.

[0188] The results for one experiment are shown in Table 3 below, and summarized in FIG. 7A. In FIG. 7A, the MV-siRNA long I and long II clones demonstrate significantly increased suppression of GFP activity compared to the shRNA control (referred to in that Figure as "siRNA").

TABLE-US-00003 TABLE 3 Well Transfected: Mean Fluorescence % GFP Positive shRNA shRNA 330 66% shRNA 302 60% Synthetic: MV-siRNA 305 61% Clone: MV-siRNA short TI 360 72% MV-siRNA long TI 218 43% MV-siRNA long TII 245 49% Negative Blank 502 100% non-GFP 293 cells 0.5 0%

[0189] FIG. 7B shows the results of an experiment in which the synthetic MV-siRNA GFP I complex demonstrated increased suppression of GFP activity compared to the shRNA clone (referred to in that Figure as "siRNA"). However, the suppression activity for the MV-siRNA GFP I complex was slightly reduced when one strand was replaced with DNA, as shown for the synthetic MV-siRNA GFP I DNA complex.

[0190] Exemplary synthetic MV-siRNAs directed to GFP can also be designed as in Table 4 below, in which the 3 oligos of T1.A-C can be annealed as described above. Similarly, the 3 oligos of T2.A-C can be annealed as described above.

TABLE-US-00004 TABLE 4 Exemplary synhetic siRNA sets T1 and T2. Name Sequence SEQ ID NO: T1.A CUGCUGGUAGUGGUCGGCGUU 25 T1.B CGCCGACUUCGUGACGUGCUU 26 T1.C GCACGUCGCCGUCCAGCAGUU 27 T2.A GUUGCCGUCGUCCUUGAAGUU 28 T2.B CUUCAAGUGGAACUACGGCUU 29 T2.C GCCGUAGGUAGGCGGCAACUU 30

[0191] MV-siRNA clones directed to GFP can also be designed as in Table 5 below. As illustrated above, these sequences can be cloned into the pSuper vector, or any other vector system.

TABLE-US-00005 TABLE 5 Exemplary MV-siRNA clones Name Sequence SEQ ID NO: T1_transcript CGCCGACUUCGUGACGUGCUUGUGCACGUCGCCGUCCAGCAG 31 UUGUCUGCUGGUAGUGGUCGGCGUU T1 GATCCCCCGCCGACTTCGTGACGTGCTTGTGCACGTCGCCGT 32 CCAGCAGTTGTCTGCTGGTAGTGGTCGGCGTTTTTTTA T1_as AGCTTAAAAAAACGCCGACCACTACCAGCAGACAACTGCTGG 33 ACGGCGACGTGCACAAGCACGTCACGAAGTCGGCGGGG T1_long CGCCGACUUCGUGACGUGCUUGUAGGUGGCAUCGCAGAAGCG 34 transcript AUGCCACCUACAAGCACGUCGCCGUCCAGCAGUUGUAGGUGG CAUCGCAGAAGCGAUGCCACCUACAACUGCUGGUAGUGGUCG GCGUU T1_long GATCCCCCGCCGACTTCGTGACGTGCTTGTAGGTGGCATCGC 35 AGAAGCGATGCCACCTACAAGCACGTCGCCGTCCAGCAGTTG TAGGTGGCATCGCAGAAGCGATGCCACCTACAACTGCTGGTA GTGGTCGGCGTTTTTA T1_long_as AGCTTAAAAACGCCGACCACTACCAGCAGTTGTAGGTGGCAT 36 CGCTTCTGCGATGCCACCTACAACTGCTGGACGGCGACGTGC TTGTAGGTGGCATCGCTTCTGCGATGCCACCTACAAGCACGT CACGAAGTCGGCGGGG T2_transcript CUUCAAGUGGAACUACGGCUUGUGCCGUAGGUAGGCGGCAAC 37 UUGUGUUGCCGUCGUCCUUGAAGUU T2 GATCCCCGGATCCGACATCCACGTTCTTCAAGAGAGAACGTG 38 GATGTCGGATCCTTTTTA T2_as AGCTTAAAAAGGATCCGACATCCACGTTCTCTCTTGAAGAAC 39 GTGGATGTCGGATCCGGG T2_long CUUCAAGUGGAACUACGGCUUGUAGGUGGCAUCGCAGAAGCG 40 transcript AUGCCACCUACAAGCCGUAGGUAGGCGGCAACUUGUAGGUGG CAUCGCAGAAGCGAUGCCACCUACAAGUUGCCGUCGUCCUUG AAGUU T2_long GATCCCCCTTCAAGTGGAACTACGGCTTGTAGGTGGCATCGC 41 AGAAGCGATGCCACCTACAAGCCGTAGGTAGGCGGCAACTTG TAGGTGGCATCGCAGAAGCGATGCCACCTACAAGTTGCCGTC GTCCTTGAAGTTTTTA T2_long_as AGCTTAAAAACTTCAAGGACGACGGCAACTTGTAGGTGGCAT 42 CGCTTCTGCGATGCCACCTACAAGTTGCCGCCTACCTACGGC TTGTAGGTGGCATCGCTTCTGCGATGCCACCTACAAGCCGTA GTTCCACTTGAAGGGG

Example 2

Trivoid Anti-HIV

[0192] Multivalent-siRNA can be designed against multiple genes at unrelated sites. In this example, a cloned MV-siRNA was tested against HIV. These results show that a di-valent MV-siRNA molecule against HIV's Gag and Tat (hv_sB) genes was significantly more efficient in inhibiting HIV replication than an siRNA directed against Gag alone (hv_s).

[0193] The oligos shown in Table 6 were cloned into pSUPER.neo+gfp vector according to manufacturer's guidelines. The hv_s is targeted to Gag only, and the hv_sB is targeted to both Gag and Tat.

TABLE-US-00006 TABLE 6 Anti-HIV MV-siRNA clones Name Sequence SEQ ID NO: hv_s GATCCCCGTGAAGGGGAACCAAGAGATTgaTCTCTTGTTAATATCAG 43 CTTgaGCTGATATTTCTCCTTCACTTTTTA hv_s_as AGCTTAAAAAGTGAAGGAGAAATATCAGCTCAAGCTGATATTAACAA 44 GAGATCAATCTCTTGGTTCCCCTTCACGGG hv_sB GATCCCCCAAGCAGTTTTAGGCTGACgTTaGTCAGCCTCATTGACAC 45 AGgTTaCTGTGTCAGCTGCTGOTTGTTTTTTTA hv_sB_As AGCTTAAAAAAACAAGCAGCAGCTGACACAGTAACCTGTGTCAATGA 46 GCCTGACTAACGTCAGCCTAAAACTGCTTGGGG

[0194] The vector constructs encoding the MV-siRNA clones were transfected into cells, and the analyses were carried out on days 10 and 40 post infection with HIV-1 (pNL4.3 strain) with an MOI of 1.0. FIG. 9 shows that at 10 days post transfection, inhibition of HIV replication by the MV-siRNA targeted to both Gag and Tat was about 3 times greater than inhibition by the siRNA molecule targeted only to Gag.

[0195] Multivalent-siRNA can be designed to target 1, 2, or 3 different genes of HIV. The sequence of an exemplary HIV genome is provided in FIGS. 10A-D. A sequence of an env gene is provided in FIG. 11, a gag gene in FIG. 12A, and a tat gene in FIG. 12B. The various genes or regions of HIV can be generally defined and targeted by their range of nucleotide sequence as follows: 5' LTR: 1-181; GAG: 336-1838; POL: 1631-4642; VIF: 4587/4662-5165; VPR: 5105-5395 (including mutations at 5157, 5266, and 5297); TAT: 5376-7966; REV: 5515-8195; VPU: 5607-5852; ENV: 5767-8337; NEF: 8339-8959; and 3' LTR: 8628-9263. Based on these target genes, exemplary MV-RNA oligo sequences for HIV are provided in Table 7 below.

TABLE-US-00007 TABLE 7 Exemplary Trivalent MV-siRNA Sequences No. Sequence Target Gene SEQ ID NO: 1 GCCUUCCCUUGUGGGAAGGUU 1649 47 2 CCUUCCCUUGUGGGAAGGCUU 1648 48 3 GCCUUCCUUGUGGGAAGGCUU 1648 49 4 UUCUGCACCUUACCUCUUAUU 6259 50 5 UAAGAGGAAGUAUGCUGUUUU 4062 51 6 AACAGCAGUUGUUGCAGAAUU 5291 52 7 CCAGACAAUAAUUGUCUGGUU 7387 53 8 CCAGACAAUAAUUGUCUGGUU 7387 53 9 CCAGACAAUAAUUGUCUGGUU 7387 53 10 CUCCCAGGCUCAGAUCUGGUU 16 54 11 CCAGAUCUUCCCUAAAAAAUU 1630 55 12 UUUUUUAUCUGCCUGGGAGUU 7011 56 13 UGGGUUCCCUAGUUAGCCAUU 40 57 14 UGGCUAAGAUCUACAGCUGUU 8585 58 15 CAGCUGUCCCAAGAACCCAUU 7325 59 16 AUCCUUUGAUGCACACAAUUU 591 60 17 AUUGUGUCACUUCCUUCAGUU 6988 61 18 CUGAAGGAAGCUAAAGGAUUU 1785 62 19 UCCUGUGUCAGCUGCUGCUUU 685 63 20 AGCAGCAUUGUUAGCUGCUUU 8481 64 21 AGCAGCUUUAUACACAGGAUU 9046 65 22 ACCAACAAGGUUUCUGUCAUU 1284 66 23 UGACAGAUCUAAUUACUACUU 6573 67 24 GUAGUAAUUAUCUGUUGGUUU 6311 68 25 CUGAGGGAAGCUAAAGGAUUU 1785 69 26 AUCCUUUGAUGCACACAAUUU 591 60 27 AUUGUGUCACUUCCCUCAGUU 6988 232 28 CAAAGCUAGAUGAAUUGCUUU 3534 70 29 AGCAAUUGGUACAAGCAGUUU 5432 71 30 ACUGCUUGUUAGAGCUUUGUU 2952 72 31 AGGUCAGGGUCUACUUGUGUU 4872 73 32 CACAAGUGCUGAUAUUUCUUU 5779 74 33 AGAAAUAAUUGUCUGACCUUU 7384 75 34 CUAAGUUAUGGAGCCAUAUUU 5212 76 35 AUAUGGCCUGAUGUACCAUUU 758 77 36 AUGGUACUUCUGAACUUAGUU 4736 78 37 UGGCUCCAUUUCUUGCUCUUU 5365 79 38 AGAGCAACCCCAAAUCCCCUU 7544 80 39 GGGGAUUUAGGGGGAGCCAUU 4191 81 40 AUCUCCACAAGUGCUGAUAUU 5784 82 41 UAUCAGCAGUUCUUGAAGUUU 8942 83 42 ACUUCAAAUUGUUGGAGAUUU 8158 84 43 AGACUGUGACCCACAAUUUUU 5862 85 44 AAAUUGUGGAUGAAUACUGUU 4310 86 45 CAGUAUUUGUCUACAGUCUUU 499 87 46 ACAGGCCUGUGUAAUGACUUU 6362 88 47 AGUCAUUGGUCUUAAAGGUUU 8559 89 48 ACCUUUAGGACAGGCCUGUUU 6371 90 49 UCAGUGUUAUUUGACCCUUUU 6973 91 50 AAGGGUCUGAGGGAUCUCUUU 135 92 51 AGAGAUCUUUCCACACUGAUU 158 93 52 CAUAGUGCUUCCUGCUGCUUU 7337 94 53 AGCAGCAUUGUUAGCUGCUUU 8481 95 54 AGCAGCUAACAGCACUAUGUU 8190 96 55 GCUGCUUAUAUGCAGGAUCUU 9044 97 56 GAUCCUGUCUGAAGGGAUGUU 531 98 57 CAUCCCUGUUAAAAGCAGCUU 7118 99 58 UGGUCUAACCAGAGAGACCUU 9081 100 59 GGUCUCUUUUAACAUUUGCUU 928 101 60 GCAAAUGUUUUCUAGACCAUU 7557 102 61 CUCCCAGGCUCAGAUCUGGUU 9097 103 62 CCAGAUCUUCCCUAAAAAAUU 1630 55 63 UUUUUUAUCUGCCUGGGAGUU 7011 56 64 UGGGUUCCCUAGUUAGCCAUU 9121 104 65 UGGCUAAGAUCUACAGCUGUU 8585 58 66 CAGCUGUCCCAAGAACCCAUU 7325 59

[0196] To Make MV-siRNA complexes targeted to HIV from the sequences in Table 7 above, the individual oligos can be combined and annealed as follows.

1) MV-siRNA_1649/1648/1648; Anneal sequences 1 & 2, and 3. 2) MV-siRNA_6259/4062/5291; Anneal sequences 4 & 5, and 6. 3) MV-siRNA_7387/7387/7387; Anneal sequences 7 & 8, and 9. 4) MV-siRNA_16/1630/7011; Anneal sequences 10 & 11, and 12. 5) MV-siRNA_40/8585/7325; Anneal sequences 13 & 14, and 15. 6) MV-siRNA_591/6988/1785; Anneal sequences 16 & 17, and 18. 7) MV-siRNA_685/8481/9046; Anneal sequences 19 & 20, and 21. 8) MV-siRNA_1284/6573/6311; Anneal sequences 21 & 22, and 23. 9) MV-siRNA_1785/591/6988; Anneal sequences 24 & 25, and 26. 10) MV-siRNA_3534/5432/2952; Anneal sequences 27 & 28, and 29. 11) MV-siRNA_4872/5779/7384; Anneal sequences 30 & 31, and 32. 12) MV-siRNA_5212/758/4736; Anneal sequences 33 & 34, and 35. 13) MV-siRNA_5365/7544/4191; Anneal sequences 36 & 37, and 38. 14) MV-siRNA_5784/8942/8158; Anneal sequences 39 & 40, and 41. 15) MV-siRNA_5862/4310/499; Anneal sequences 42 & 43, and 44. 16) MV-siRNA_6362/8559/6371; Anneal sequences 45 & 46, and 47. 17) MV-siRNA_6973/135/158; Anneal sequences 48 & 49, and 50. 18) MV-siRNA_7337/8481/8190; Anneal sequences 51 & 52, and 53. 19) MV-siRNA_9044/531/7118; Anneal sequences 54 & 55, and 56. 20) MV-siRNA_9081/928/7557; Anneal sequences 57 & 58, and 59. 21) MV-siRNA_9097/1630/7011; Anneal sequences 60 & 61, and 62. 22) MV-siRNA.sub_9121/8585/7325; Anneal sequences 63 & 64, and 65.

Example 3

Trivoid Anti-apoB

[0197] Multivalent siRNA can be designed to suppress large genes by targeting in 2-3 locations on a single gene. The MV-siRNA can also employ alternative RNA chemistries to enhance the Tm during annealing. In this example, as shown in Table 8 below, a series of MV-siRNA are designed to target the apolipoprotein B (ApoB) gene, and the presence of optional 2'-O methyl RNA subunits is indicated within parenthesis.

TABLE-US-00008 TABLE 8 Trivalent MV-siRNA to ApoB SEQ No. Sequence Target Gene ID NO: 1 (UGGAACU)UUCAGCUUCAUAUU ApoB @ 268 105 2 (UAUGAAG)GCACCAUGAUGUUU ApoB @ 9905 106 3 (ACAUCAU)CUUCC(AGUUCCA)UU ApoB @ 1703 107 4 (ACUCUUC)AGAGUUCUUGGUUU ApoB @ 448 108 5 (ACCAAGA)CCUUGGAGACACUU ApoB @ 2288 109 6 (GUGUCUC)AGUUG(GAAGAGU)UU ApoB @ 6609 110 7 (ACCUGGA)CAUGGCAGCUGCUU ApoB @ 469 111 8 (GCAGCUG)CAAACUCUUCAGUU ApoB @ 458 112 9 (CUGAAGA)CGUAU(UCCAGGU)UU ApoB @ 113 12263 10 (CAGGGUA)AAGAACAAUUUGUU ApoB @ 520 114 11 (CAAAUUG)CUGUAGACAUUUUU ApoB @ 4182 115 12 (AAAUGUC)CAGCG(UACCCUG)UU ApoB @ 116 12548 13 (CCCUGGA)CACCGCUGGAACUUUU ApoB @ 279 117 14 (AAGUUCC)AAUAACUUUUCCAUUU ApoB @ 9161 118 15 (AUGGAAA)AGGCAAG(UCCAGGG)UU ApoB @ 9968 119 16 (CCCUGGA)CACCGCUGGAACUUUUU ApoB @ 278 120 17 (AAAGUUC)CAAUAACUUUUCCAUUU ApoB @ 9161 121 18 (AUGGAAA)AUGGCAAG(UCCAGGG)UU ApoB @ 9968 122

[0198] To make synthetic MV-siRNA trivalent complexes from the sequences in Table 8 above, the individual oligos can be combined and annealed as follows.

1) MV-siRNA_268/9950/1703; Anneal sequences 1 & 2, and then 3. 2) MV-siRNA_448/2288/6609; Anneal sequences 4 & 5, and then 6. 3) MV-siRNA_469/458/12263; Anneal sequences 7 & 8, and then 9. 4) MV-siRNA_520/4182/12548; Anneal sequences 10 & 11, and then 12. 5) MV-siRNA_279/9161/9986; Anneal sequences 13 & 14, and then 15. 6) MV-siRNA_278/9161/9986; Anneal sequences 16 & 17, and then 18.

[0199] Multivalent siRNA that are designed with potent primary and secondary strands can also employ wobble or universal bases to complete target complimentarity, or blunt ended DNA to deactivate the strand from silencing any target. Exemplary oligos directed to ApoB are shown in Table 9 below, in which (*) indicates an optional wobble or universal base.

TABLE-US-00009 TABLE 9 Exemplary Bivalent MV-siRNA to ApoB No. Sequence Target Gene SEQ ID NO: 19 UGAAUCGAGUUGCAUCUUUUU ApoB @ 223 123 20 AAAGAUGCUGCUCAUCACAUU ApoB @ 883 124 21 UGUGAUGACACUCGAUUCAUU ApoB @ 10116 (G/A pairs) 125 22 U*UGAU*ACACUCGAUUCAUU ApoB @ 10116 (univ. base) 126 23 TGTGATGACACTCGATTCA null @ 10166 127 24 CAGCUUGAGUUCGUACCUGUU ApoB @ 483 128 25 CAGGUACAGAGAACUCCAAUU ApoB @ 11596 129 26 UUGGAGUCUGACCAAGCUGUU ApoB @ 2454 130 27 UUGGAGUCUGAC*AAGCU*UU ApoB @ 2454 131 28 TTGGAGTCTGACCAAGCTG null @ 2454 132

[0200] To make synthetic MV-siRNA bivalent complexes from the sequences in Table 9 above, the individual oligos can be combined and annealed as follows.

7a) MV-siRNA_223/883/10116); Anneal sequences 19, 20, and 21. 7b) MV-siRNA_223/883/10116*); Anneal sequences 19, 20, and 22. 7c) MV-siRNA_223/883/null); Anneal sequences 19, 20, and 23. 8a) MV-siRNA_483/11596/2454); Anneal sequences 24, 25, and 26. 8b) MV-siRNA_483/11596/2454*); Anneal sequences 24, 25, and 26. 8c) MV-siRNA_483/11596/null); Anneal sequences 24, 25, and 26.

[0201] Multivalent-siRNAs can also be designed to suppress large genes by targeting 2-3 locations on a single gene. As noted, above, certain embodiments of the instant MV-siRNAs can also employ alternative RNA chemistries to enhance the Tm during annealing. In Table 10 below, optional 2'-O methyl RNA 2'-fluoro bases are indicated within parenthesis. Among other examples of alternate bases, 5-methyl can also increase Tm of MV-siRNA structure, if desired.

TABLE-US-00010 TABLE 10 Exemplary Trivalent MV-siRNA to ApoB No. Sequence Target Gene SEQ ID NO: 1 UGG(AA)CUUUCAGCUUCAUAUU ApoB @ 268 105 2 U(AU)GAAGGCACCAUGAUGUUU ApoB @ 9905 106 3 (ACAUCAU)CUUCCAGUUCCAUU ApoB @ 1703 107 4 AC(U)CUUCAGAGUUCUUGGUUU ApoB @ 448 108 5 (ACCAAGA)CCUUGGAGACACUU ApoB @ 2288 109 6 G(U)GUCUCAGUUGGAAGAGUUU ApoB @ 6609 110 7 (ACCUGGA)CAUGGCAGCUGCUU ApoB @ 469 111 8 GC(A)GCUGCAAACUCUUCAGUU ApoB @ 458 112 9 (CUGAAGA)CGUAU(UCCAGGU)UU ApoB @ 12263 113 10 (CAGGGUA)AAGAACAAUUUGUU ApoB @ 520 114 11 (CAAAUU)GCUGUAGACA(UUU)UU ApoB @ 4182 115 12 (AAAUGUC)CAGCGUACCCUGUU ApoB @ 12548 116 13 (CCCUGGA)CACCGCUGGAACUUUU ApoB @ 279 117 14 (AAGUUCC)AAUAACUUUUCCAUUU ApoB @ 9161 118 15 (AU)GGAAAAGGCAAG(UCCAGGG)UU ApoB @ 9968 119 16 CCC(U)GGACACCGCUGG(AACUUU)UU ApoB @ 278 120 17 (AAA)GUUCCAAUAACUU(UU)CC(AU)UU ApoB @ 9161 121 18 (AUGGAAA)AUGGCAAG(UCCAGGG)UU ApoB @ 9968 122 19 UCAGGGCCGCUCUGUAUUUUU ApoB @ 6427 133 20 AAAUACAUUUCUGGAAGAGUU ApoB @ 8144 134 21 CUCUUCCAAAAAGCCCUGAUU ApoB @ 12831 135 22 AAAUACAUUUCUGGAAGAGuu&CUCUUCCAAAAA Linker construct for 136 GCCCUGAuu&UCAGGGCCGCUCUGUAUUUuu cleavage after annealing. "&" = PC Spacer, or linkage phosphoramidite

[0202] To make synthetic MV-siRNA bivalent complexes from the sequences in Table 10 above, the individual oligos can be combined and annealed as follows.

1) MV-siRNA_268/9950/1703; Anneal sequences 1 & 2, and then 3. 2) MV-siRNA_448/2288/6609; Anneal sequences 4 & 5, and then 6. 3) MV-siRNA_469/458/12263; Anneal sequences 7 & 8, and then 9. 4) MV-siRNA_520/4182/12548; Anneal sequences 10 & 11, and then 12. 5) MV-siRNA_279/9161/9986; Anneal sequences 13 & 14, and then 15. 6) MV-siRNA_278/9161/9986; Anneal sequences 16 & 17, and then 18. 7) MV-siRNA_6427/8144/12831; Anneal sequences 19 & 20, and then 21. 7b) MV-siRNA_6427/8144/12831; Anneal strand 22, then cleave linkage phosphate with ammonium hydroxide. 7b) MV-siRNA_6427/8144/12831; Anneal strand 22, then cleave PC Spacer with UV light in the 300-350 nm spectral range.

[0203] In certain embodiments, multivalent-siRNA that are designed with potent primary and secondary strands can employ wobble, spacer, or abasic base types (examples are indicated by (*) in Table 11 below) to complete target compliments, or blunt ended DNA to deactivate the strand from silencing any target. In some embodiments, UNA, linker phosphoramidites, rSpacer, 5-nitroindole can act as effective abasic bases in place of mismatched nucleotides. If desired, the use of abasic bases can result in weakened Tm, and/or pyrimidines surrounding an abasic site can utilize 2'-fluoro bases to increase Tm by about 2 degrees for every 2'-fluoro base.

TABLE-US-00011 TABLE 11 Exemplary MV-siRNA Targeted to ApoB No. Sequence Target Gene SEQ ID NO: 23 UGAAUCGAGUUGCAUCUUUUU ApoB @ 223 123 24 AAAGAUGCUGCUCAUCACAUU ApoB @ 883 124 25 UGUGAUGACACUCGAUUCAUU ApoB @ 10116 (G/A pairs) 125 26 U*UGAU*ACACUGAUUCAUU ApoB @ 10116 (* rSPACER base) 126 27 TGTGATGACACTCGATTCA null @ 10116 127 28 CAGCUUGAGUUCGUACCUGUU ApoB @ 483 128 29 CAGGUACAGAGAACUCCAAUU ApoB @ 11596 129 30 UUGGAGUCUGACCAAGCUGUU ApoB @ 2454 130 31 UUGGAGUCUGAC*AAGCU*UU ApoB @ 2454 (* abasic base) 131 32 TTGGAGTCTGACCAAGCTG null @ 2454 132 33 AACCCACUUUCAAAUUUCCUU ApoB @ 9244 137 34 GGAAAUUGAGAAUUCUCCAUU ApoB @ 1958 138 35 UGGAGAAUCUCAGUGGGUUUU ApoB @ 8005 139 36 rUrGrGfA-fArArUrCrUrCrA-fUrGrGrG-fUrUrU ApoB @ 8005 140 37 GAUGAUGAAACAGUGGGUUUU ApoB @ 10439 141 38 AACCCACUUUCAAAUUUCCUU ApoB @ 9244 137 39 GGAAAUUGGAGACAUCAUCUU ApoB @ 2284 142 40 -rGfAfAfArUrUrGrGrArGrArCfA-rCfArUrCrUrU ApoB @ 2284 143 41 GCAAACUCUUCAGAGUUCUUU ApoB @ 452 144 42 AGAACUCCAAGGGUGGGAUUU ApoB @ 11588 145 43 AUCCCACUUUCAAGUUUGCUU ApoB @ 9244 146 44 fA-rCrCrCrArCrUrUrUrCrAfA-fUrUrU-rC ApoB @ 9244 147

[0204] To make synthetic MV-siRNA bivalent complexes from the sequences in Table 11 above, the individual oligos can be combined and annealed as follows.

7a) MV-siRNA_223/883/10116); Anneal sequences 23, 24, and 25. 7b) MV-siRNA_223/883/10116*); Anneal sequences 23, 24, and 26. 7c) MV-siRNA_223/883/null); Anneal sequences 23, 24, and 27. 8a) MV-siRNA_483/11596/2454); Anneal sequences 28, 29, and 30. 8b) MV-siRNA_483/11596/2454*); Anneal sequences 28, 29, and 31. 8c) MV-siRNA_483/11596/null); Anneal sequences 28, 29, and 32. 9) MV-siRNA_9244/1958/8005); Anneal sequences 33, 34, and 35. 9b) MV-siRNA_9244/1958/8005); Anneal sequences 33, 34, and 36. 10) MV-siRNA_10439/9244/2284); Anneal sequences 37, 38, and 39. 10b) MV-siRNA_10439/9244/2284); Anneal sequences 37, 38, and 40. 11) MV-siRNA_452/11588/9244); Anneal sequences 41, 42, and 43. 11b) MV-siRNA_452/11588/9244); Anneal sequences 41, 42, and 44.

[0205] As exemplified in Table 12 below, multivalent siRNA can be targeted against human ApoB. Bivalent MV-siRNA can function with various tolerances to structure and target complementarity of each strand

TABLE-US-00012 TABLE 12 Exemplary Multivalent-siRNA Targeted to Human ApoB ApoB Gene SEQ No. Sequence site ID NO: 1 CUUCAUCACUGAGGCCUCUUU 1192 148 2 AGAGGCCAAGCUCUGCAUUUU 5140 149 3 AAUGCAGAUGAAGAUGAAGAA 10229 150 4 UUCAGCCUGCAUGUUGGCUUU 2724 151 5 AGCCAACUAUACUUGGAUCUU 13294 152 6 GAUCCAAAAGCAGGCUGAAGA 4960 153 7 CCCUCAUCUGAGAAUCUGGUU 8927 154 8 CCAGAUUCAUAAACCAAGUUU 9044 155 9 ACUUGGUGGCCCAUGAGGGUU 3440 156 10 UCAAGAAUUCCUUCAAGCCUU 9595 157 11 GGCUUGAAGCGAUCACACUUU 758 158 12 AGUGUGAACGUAUUCUUGAUU 4367 159 13 UUGCAGUUGAUCCUGGUGGUU 344 160 14 CCACCAGGUAGGUGACCACUU 1354 161 15 GUGGUCAGGAGAACUGCAAUU 2483 162 16 CCUCCAGCUCAACCUUGCAUU 358 163 17 UGCAAGGUCUCAAAAAAUGUU 6341 164 18 CAUUUUUGAUCUCUGGAGGUU 4043 165 19 CAGGAUGUAAGUAGGUUCAUU 570 166 20 UGAACCUUAGCAACAGUGUUU 5687 167 21 ACACUGUGCCCACAUCCUGUU 9109 168 22 GGCUUGAAGCGAUCACACUUU 758 169 23 AGUGUGAACGUAUUCUUGUUU 4367 170 24 ACAAGAAUUCCUUCAAGCCUU 9595 171 25 UGAAGAGAUUAGCUCUCUGUU 1153 172 26 CAGAGAGGCCAAGCUCUGCUU 5143 173 27 GCAGAGCUGGCUCUCUUCAUU 10304 174 28 CUCAGUAACCAGCUUAUUGUU 1170 175 29 CAAUAAGAUUUAUAACAAAUU 7084 176 30 UUUGUUAUCUUAUACUGAGUU 9650 177 31 GAACCAAGGCUUGUAAAGUUU 1258 178 32 ACUUUACAAAAGCAACAAUUU 6286 179 33 AUUGUUGUUAAAUUGGUUCUU 6078 180 34 CAGGUAGGUGACCACAUCUUU 1350 181 35 AGAUGUGACUGCUUCAUCAUU 1203 182 36 UGAUGAACUGCGCUACCUGUU 8486 183 37 CCAGUCGCUUAUCUCCCGGUU 1786 184 38 CCGGGAGCAAUGACUCCAGUU 2678 185 39 CUGGAGUCAUGGCGACUGGUU 2486 186 40 UGGAAGAGAAACAGAUUUGUU 2046 187 41 CAAAUCUUUAAUCAGCUUCUU 2403 188 42 GAAGCUGCCUCUUCUUCCAUU 12299 189 43 AUCCAAAGGCAGUGAGGGUUU 2152 190 44 ACCCUCAACUCAGUUUUGAUU 12242 191 45 UCAAAACCGGAAUUUGGAUUU 3316 192 46 UAGAGACACCAUCAGGAACUU 2302 193 47 GUUCCUGGAGAGUCUUCAAUU 1102 194 48 UUGAAGAAUUAGGUCUCUAUU 1153 195 49 GCUCAUGUUUAUCAUCUUUUU 2350 196 50 AAAGAUGCUGAACUUAAAGUU 7622 197 51 CUUUAAGGGCAACAUGAGCUU 2863 198 52 GGAGCAAUGACUCCAGAUGUU 2675 199 53 CAUCUGGGGGAUCCCCUGCUU 2544 200 54 GCAGGGGAGGUGUUGCUCCUU 912 201 55 UCACAAACUCCACAGACACUU 2761 202 56 GUGUCUGCUUUAUAGCUUGUU 5672 203 57 CAAGCUAAAGGAUUUGUGAUU 9683 204 58 GCAGCUUGACUGGUCUCUUUU 2914 205 59 AAGAGACUCUGAACUGCCCUU 4588 206 60 GGGCAGUGAUGGAAGCUGCUU 8494 207 61 CAGGACUGCCUGUUCUCAAUU 2996 208 62 UUGAGAACUUCUAAUUUGGUU 8522 209 63 CCAAAUUUGAAAAGUCCUGUU 9855 210 64 UGUAGGCCUCAGUUCCAGCUU 3132 211 65 GCUGGAAUUCUGGUAUGUGUU 8335 212 66 CACAUACCGAAUGCCUACAUU 9926 213 67 GACUUCACUGGACAAGGUCUU 3300 214 68 GACCUUGAAGUUGAAAAUGUU 5301 215 69 CAUUUUCUGCACUGAAGUCUU 11983 216 70 AAGCAGUUUGGCAGGCGACUU 3549 217 71 GUCGCCUUGUGAGCACCACUU 5039 218 72 GUGGUGCCACUGACUGCUUUU 12521 219 73 CAGAUGAGUCCAUUUGGAGUU 3568 220 74 CUCCAAACAGUGCCAUGCCUU 9142 221 75 GGCAUGGAGCCUUCAUCUGUU 3256 222 76 CACAGACUUGAAGUGGAGGUU 4086 223 77 CCUCCACUGAGCAGCUUGAUU 2924 224 78 UCAAGCUUCAAAGUCUGUGUU 974 225 79 AUGGCAGAUGGAAUCCCACUU 4102 226 80 GUGGGAUCACCUCCGUUUUUU 2971 227 81 AAAACGGUUUCUCUGCCAUUU 12836 228 82 UGAUACAACUUGGGAAUGGUU 4148 229 83 CCAUUCCCUAUGUCAGCAUUU 2971 230 84 AUGCUGACAAAUUGUAUCAUU 12836 231

[0206] To make synthetic MV-siRNA bivalent complexes from the sequences in Table 12 above, the individual oligos can be combined and annealed as follows. MV-siRNA; Anneal sequences 1, 2, and 3. MV-siRNA; Anneal sequences 4, 5, and 6. MV-siRNA; Anneal sequences 7, 8, and 9. MV-siRNA; Anneal sequences 10, 11, and 12. MV-siRNA; Anneal sequences 13, 14, and 15. MV-siRNA; Anneal sequences 16, 17, and 18. MV-siRNA; Anneal sequences 19, 20, and 21. MV-siRNA; Anneal sequences 22, 23, and 24. MV-siRNA; Anneal sequences 25, 26, and 27. MV-siRNA; Anneal sequences 28, 29, and 30. MV-siRNA; Anneal sequences 31, 32, and 33. MV-siRNA; Anneal sequences 34, 35, and 36. MV-siRNA; Anneal sequences 37, 38, and 39. MV-siRNA; Anneal sequences 40, 41, and 42. MV-siRNA; Anneal sequences 43, 44, and 45. MV-siRNA; Anneal sequences 46, 47, and 48. MV-siRNA; Anneal sequences 49, 50, and 51. MV-siRNA; Anneal sequences 52, 53, and 54. MV-siRNA; Anneal sequences 55, 56, and 57. MV-siRNA; Anneal sequences 58, 59, and 60. MV-siRNA; Anneal sequences 61, 62, and 63. MV-siRNA; Anneal sequences 64, 65 and 66. MV-siRNA; Anneal sequences 67, 68, and 69. MV-siRNA; Anneal sequences 70, 71, and 72. MV-siRNA; Anneal sequences 73, 74, and 75. MV-siRNA; Anneal sequences 76, 77, and 78. MV-siRNA; Anneal sequences 79, 80, and 81. MV-siRNA; Anneal sequences 82, 83, and 84.

[0207] MV-siRNA directed to ApoB can be used to treat or manage a wide variety of diseases or conditions associated with the expression of that target protein, as described herein and known in the art.

REFERENCES

[0208] 1. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998) Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans. Nature. 408, 325-330. [0209] 2. Kennerdell, J. R., and Carthew, R. W. (1998) Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell. 95, 1017-1026. [0210] 3. Misquitta, L., and Paterson, B. M. (1999) Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): a role for nautilus in embryonic somatic muscle formation. Proc. Natl. Acad. Sci. USA. 96, 1451-1456. [0211] 4. Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J. (2000) An RNA-directed nuclease mediates post transcriptional gene silencing in Drosophila cells. Nature. 404, 293-296. [0212] 5. Lohmann, J. U., Endl, I., and Bosch, T. C. (1999) Silencing of developmental genes in Hydra. Dev. Biol. 214, 211-214. [0213] 6. Wargelius, A., Ellingsen, S., and Fjose, A. (1999) Double stranded RNA induces specific developmental defects in zebrafish embyos. Biochem. Biophys. Res. Commun. 263, 156-161. [0214] 7. Ngo, H., Tschudi, C., Gull, K., and Ullu, E. (1998) Double stranded RNA induces gene degradation in Trypanosoma brucei. Proc. Natl. Acad. Sci. USA. 95, 14687-14692. [0215] 8. Montgomery, M. K., Xu, S., Fire, A. (1998) RNA as a target of double stranded RNA mediated genetic interference in Caenorhabiditis elegans. Proc. Natl. Acad. Sci. USA. 95, 15502-15507. [0216] 9. Bosher, J. M., Dufourcq, P., Sookhareea, S., Labouesse, M. (1999) RNA interference can target pre-gene. Consequences for gene expression in Caenorhabiditis elegans operon. Genetics. 153, 1245-1256. [0217] 10. Fire, A. (1999) RNA-triggered gene silencing. Trends Genet. 15, 358-363. [0218] 11. Sharp, P. A. (1999) RNAi and double-stranded RNA. Genes Dev. 13, 139-141. [0219] 12. Ketting, R. F., Harerkamp, T. H., van Luenen, H. G., and Plasterk, R. H. (1999) Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNase I. Cell. 99, 133-141. [0220] 13. Tabara, H., Sarkissian, M., Kelly, W. G., Fleenor, J., Grishok, A., Timmons, L., Fire, A., and Mello, C. C. (1999) The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell. 99, 123-132. [0221] 14. Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000) RNAi: Double stranded RNA directs the ATP dependent cleavage of gene at 21 to 23 nucleotide intervals. Cell. 101, 25-33. [0222] 15. Bernstein, E., Caudy, A. A., Hammond, S. M., and Hannon, G. J. (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 409, 363-366. [0223] 16. Elbashir, S., Lendeckel, W., and Tuschl, T. (2001) RNA interference is mediated by 21 and 22 nucleotide RNAs. Genes and Dev. 15, 188-200. [0224] 17. Sharp, P. A. (2001) RNA interference 2001. Genes and Dev. 15, 485-490. [0225] 18. Hunter, T., Hunt, T., and Jackson, R. J. (1975) The characteristics of inhibition of protein synthesis by double-stranded ribonucleic acid in reticulocyte lysates. J. Biol. Chem. 250, 409-417. [0226] 19. Bass, B. L. (2001) The short answer. Nature. 411, 428-429. [0227] 20. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411, 494-498. [0228] 21. Carson, P. E. and Frischer, H. (1966) Glucose-6-Phosphate dehydrogenase deficiency and related disorders of the pentose phosphate pathway. Am J Med. 41, 744-764. [0229] 22. Stamato, T. D., Mackenzie, L., Pagani, J. M., and Weinstein, R. (1982) Mutagen treatment of single Chinese Hamster Ovary cells produce colonies mosaic for Glucose-6-phosphate dehydrogenase activity. Somatic Cell Genetics. 8, 643-651. [0230] 23. Genetic characterization of methicillin-resistant Staphylococcus aureus Vaccine. 2004, Dec. 6; 22 Suppl 1:S5-8. [Hiramatsu K, Watanabe S, Takeuchi F, Ito T, and Baba T]. [0231] 24. A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III. [EMBO J. 2001]. [0232] 25. Solution structure of conserved AGNN tetraloops: insights into RNase IIIp RNA processing. [EMBO J. 2001]. [0233] 26. ReviewThe RNase III family: a conserved structure and expanding functions in eukaryotic dsRNA metabolism. [Curr Issues Mol Biol. 2001] [0234] 27. Sequence dependence of substrate recognition and cleavage by yeast RNase III. [J Mol Biol. 2003] [0235] 28. Noncatalytic assembly of ribonuclease III with double-stranded RNA. [Structure. 2004] [0236] 29. Intermediate states of ribonuclease III in complex with double-stranded RNA. [Structure. 2005] [0237] 30. ReviewStructural basis for non-catalytic and catalytic activities of ribonuclease III. [Acta Crystallogr D Biol Crystallogr. 2006] [0238] 31. ReviewRibonuclease revisited: structural insights into ribonuclease III family enzymes. [Curr Opin Struct Biol. 2007] [0239] 32. Short RNA guides cleavage by eukaryotic RNase III. [PLoS ONE. 2007 May 30; 2(5):e472.] [0240] 33. A stepwise model for double-stranded RNA processing by ribonuclease III. [Mol Microbiol. 2008] [0241] 34. Review: The mechanism of RNase III action: how dicer dices. [Curr Top Microbiol Immunol. 2008]

Sequence CWU 1

1

232114119RNAHomo sapiens 1ucccaccggg accugcgggg cugagugccc uucucgguug cugccgcuga ggagcccgcc 60cagccagcca gggccgcgag gccgaggcca ggccgcagcc caggagccgc cccaccgcag 120cuggcgaugg acccgccgag gcccgcgcug cuggcgcugc uggcgcugcc ugcgcugcug 180cugcugcugc uggcgggcgc cagggccgaa gaggaaaugc uggaaaaugu cagccugguc 240uguccaaaag augcgacccg auucaagcac cuccggaagu acacauacaa cuaugaggcu 300gagaguucca guggaguccc ugggacugcu gauucaagaa gugccaccag gaucaacugc 360aagguugagc uggagguucc ccagcucugc agcuucaucc ugaagaccag ccagugcacc 420cugaaagagg uguauggcuu caacccugag ggcaaagccu ugcugaagaa aaccaagaac 480ucugaggagu uugcugcagc cauguccagg uaugagcuca agcuggccau uccagaaggg 540aagcagguuu uccuuuaccc ggagaaagau gaaccuacuu acauccugaa caucaagagg 600ggcaucauuu cugcccuccu gguuccccca gagacagaag aagccaagca aguguuguuu 660cuggauaccg uguauggaaa cugcuccacu cacuuuaccg ucaagacgag gaagggcaau 720guggcaacag aaauauccac ugaaagagac cuggggcagu gugaucgcuu caagcccauc 780cgcacaggca ucagcccacu ugcucucauc aaaggcauga cccgccccuu gucaacucug 840aucagcagca gccaguccug ucaguacaca cuggacgcua agaggaagca uguggcagaa 900gccaucugca aggagcaaca ccucuuccug ccuuucuccu acaacaauaa guaugggaug 960guagcacaag ugacacagac uuugaaacuu gaagacacac caaagaucaa cagccgcuuc 1020uuuggugaag guacuaagaa gaugggccuc gcauuugaga gcaccaaauc cacaucaccu 1080ccaaagcagg ccgaagcugu uuugaagacu cuccaggaac ugaaaaaacu aaccaucucu 1140gagcaaaaua uccagagagc uaaucucuuc aauaagcugg uuacugagcu gagaggccuc 1200agugaugaag cagucacauc ucucuugcca cagcugauug agguguccag ccccaucacu 1260uuacaagccu ugguucagug uggacagccu cagugcucca cucacauccu ccaguggcug 1320aaacgugugc augccaaccc ccuucugaua gaugugguca ccuaccuggu ggcccugauc 1380cccgagcccu cagcacagca gcugcgagag aucuucaaca uggcgaggga ucagcgcagc 1440cgagccaccu uguaugcgcu gagccacgcg gucaacaacu aucauaagac aaacccuaca 1500gggacccagg agcugcugga cauugcuaau uaccugaugg aacagauuca agaugacugc 1560acuggggaug aagauuacac cuauuugauu cugcggguca uuggaaauau gggccaaacc 1620auggagcagu uaacuccaga acucaagucu ucaauccuca aaugugucca aaguacaaag 1680ccaucacuga ugauccagaa agcugccauc caggcucugc ggaaaaugga gccuaaagac 1740aaggaccagg agguucuucu ucagacuuuc cuugaugaug cuucuccggg agauaagcga 1800cuggcugccu aucuuauguu gaugaggagu ccuucacagg cagauauuaa caaaauuguc 1860caaauucuac caugggaaca gaaugagcaa gugaagaacu uuguggcuuc ccauauugcc 1920aauaucuuga acucagaaga auuggauauc caagaucuga aaaaguuagu gaaagaagcu 1980cugaaagaau cucaacuucc aacugucaug gacuucagaa aauucucucg gaacuaucaa 2040cucuacaaau cuguuucucu uccaucacuu gacccagccu cagccaaaau agaagggaau 2100cuuauauuug auccaaauaa cuaccuuccu aaagaaagca ugcugaaaac uacccucacu 2160gccuuuggau uugcuucagc ugaccucauc gagauuggcu uggaaggaaa aggcuuugag 2220ccaacauugg aagcucuuuu ugggaagcaa ggauuuuucc cagacagugu caacaaagcu 2280uuguacuggg uuaaugguca aguuccugau ggugucucua aggucuuagu ggaccacuuu 2340ggcuauacca aagaugauaa acaugagcag gauaugguaa auggaauaau gcucaguguu 2400gagaagcuga uuaaagauuu gaaauccaaa gaagucccgg aagccagagc cuaccuccgc 2460aucuugggag aggagcuugg uuuugccagu cuccaugacc uccagcuccu gggaaagcug 2520cuucugaugg gugcccgcac ucugcagggg aucccccaga ugauuggaga ggucaucagg 2580aagggcucaa agaaugacuu uuuucuucac uacaucuuca uggagaaugc cuuugaacuc 2640cccacuggag cuggauuaca guugcaaaua ucuucaucug gagucauugc ucccggagcc 2700aaggcuggag uaaaacugga aguagccaac augcaggcug aacugguggc aaaacccucc 2760gugucugugg aguuugugac aaauaugggc aucaucauuc cggacuucgc uaggaguggg 2820guccagauga acaccaacuu cuuccacgag ucgggucugg aggcucaugu ugcccuaaaa 2880gcugggaagc ugaaguuuau cauuccuucc ccaaagagac cagucaagcu gcucagugga 2940ggcaacacau uacauuuggu cucuaccacc aaaacggagg ugaucccacc ucucauugag 3000aacaggcagu ccuggucagu uugcaagcaa gucuuuccug gccugaauua cugcaccuca 3060ggcgcuuacu ccaacgccag cuccacagac uccgccuccu acuauccgcu gaccggggac 3120accagauuag agcuggaacu gaggccuaca ggagagauug agcaguauuc ugucagcgca 3180accuaugagc uccagagaga ggacagagcc uugguggaua cccugaaguu uguaacucaa 3240gcagaaggug cgaagcagac ugaggcuacc augacauuca aauauaaucg gcagaguaug 3300accuugucca gugaagucca aauuccggau uuugauguug accucggaac aauccucaga 3360guuaaugaug aaucuacuga gggcaaaacg ucuuacagac ucacccugga cauucagaac 3420aagaaaauua cugaggucgc ccucaugggc caccuaaguu gugacacaaa ggaagaaaga 3480aaaaucaagg guguuauuuc cauaccccgu uugcaagcag aagccagaag ugagauccuc 3540gcccacuggu cgccugccaa acugcuucuc caaauggacu caucugcuac agcuuauggc 3600uccacaguuu ccaagagggu ggcauggcau uaugaugaag agaagauuga auuugaaugg 3660aacacaggca ccaauguaga uaccaaaaaa augacuucca auuucccugu ggaucucucc 3720gauuauccua agagcuugca uauguaugcu aauagacucc uggaucacag agucccugaa 3780acagacauga cuuuccggca cguggguucc aaauuaauag uugcaaugag cucauggcuu 3840cagaaggcau cugggagucu uccuuauacc cagacuuugc aagaccaccu caauagccug 3900aaggaguuca accuccagaa caugggauug ccagacuucc acaucccaga aaaccucuuc 3960uuaaaaagcg auggccgggu caaauauacc uugaacaaga acaguuugaa aauugagauu 4020ccuuugccuu uugguggcaa auccuccaga gaucuaaaga uguuagagac uguuaggaca 4080ccagcccucc acuucaaguc ugugggauuc caucugccau cucgagaguu ccaagucccu 4140acuuuuacca uucccaaguu guaucaacug caagugccuc uccugggugu ucuagaccuc 4200uccacgaaug ucuacagcaa cuuguacaac ugguccgccu ccuacagugg uggcaacacc 4260agcacagacc auuucagccu ucgggcucgu uaccacauga aggcugacuc ugugguugac 4320cugcuuuccu acaaugugca aggaucugga gaaacaacau augaccacaa gaauacguuc 4380acacuaucau gugauggguc ucuacgccac aaauuucuag auucgaauau caaauucagu 4440cauguagaaa aacuuggaaa caacccaguc ucaaaagguu uacuaauauu cgaugcaucu 4500aguuccuggg gaccacagau gucugcuuca guucauuugg acuccaaaaa gaaacagcau 4560uuguuuguca aagaagucaa gauugauggg caguucagag ucucuucguu cuaugcuaaa 4620ggcacauaug gccugucuug ucagagggau ccuaacacug gccggcucaa uggagagucc 4680aaccugaggu uuaacuccuc cuaccuccaa ggcaccaacc agauaacagg aagauaugaa 4740gauggaaccc ucucccucac cuccaccucu gaucugcaaa guggcaucau uaaaaauacu 4800gcuucccuaa aguaugagaa cuacgagcug acuuuaaaau cugacaccaa ugggaaguau 4860aagaacuuug ccacuucuaa caagauggau augaccuucu cuaagcaaaa ugcacugcug 4920cguucugaau aucaggcuga uuacgaguca uugagguucu ucagccugcu uucuggauca 4980cuaaauuccc auggucuuga guuaaaugcu gacaucuuag gcacugacaa aauuaauagu 5040ggugcucaca aggcgacacu aaggauuggc caagauggaa uaucuaccag ugcaacgacc 5100aacuugaagu guagucuccu ggugcuggag aaugagcuga augcagagcu uggccucucu 5160ggggcaucua ugaaauuaac aacaaauggc cgcuucaggg aacacaaugc aaaauucagu 5220cuggauggga aagccgcccu cacagagcua ucacugggaa gugcuuauca ggccaugauu 5280cugggugucg acagcaaaaa cauuuucaac uucaagguca gucaagaagg acuuaagcuc 5340ucaaaugaca ugaugggcuc auaugcugaa augaaauuug accacacaaa cagucugaac 5400auugcaggcu uaucacugga cuucucuuca aaacuugaca acauuuacag cucugacaag 5460uuuuauaagc aaacuguuaa uuuacagcua cagcccuauu cucugguaac uacuuuaaac 5520agugaccuga aauacaaugc ucuggaucuc accaacaaug ggaaacuacg gcuagaaccc 5580cugaagcugc auguggcugg uaaccuaaaa ggagccuacc aaaauaauga aauaaaacac 5640aucuaugcca ucucuucugc ugccuuauca gcaagcuaua aagcagacac uguugcuaag 5700guucagggug uggaguuuag ccaucggcuc aacacagaca ucgcugggcu ggcuucagcc 5760auugacauga gcacaaacua uaauucagac ucacugcauu ucagcaaugu cuuccguucu 5820guaauggccc cguuuaccau gaccaucgau gcacauacaa auggcaaugg gaaacucgcu 5880cucuggggag aacauacugg gcagcuguau agcaaauucc uguugaaagc agaaccucug 5940gcauuuacuu ucucucauga uuacaaaggc uccacaaguc aucaucucgu gucuaggaaa 6000agcaucagug cagcucuuga acacaaaguc agugcccugc uuacuccagc ugagcagaca 6060ggcaccugga aacucaagac ccaauuuaac aacaaugaau acagccagga cuuggaugcu 6120uacaacacua aagauaaaau uggcguggag cuuacuggac gaacucuggc ugaccuaacu 6180cuacuagacu ccccaauuaa agugccacuu uuacucagug agcccaucaa uaucauugau 6240gcuuuagaga ugagagaugc cguugagaag ccccaagaau uuacaauugu ugcuuuugua 6300aaguaugaua aaaaccaaga uguucacucc auuaaccucc cauuuuuuga gaccuugcaa 6360gaauauuuug agaggaaucg acaaaccauu auaguuguag uggaaaacgu acagagaaac 6420cugaagcaca ucaauauuga ucaauuugua agaaaauaca gagcagcccu gggaaaacuc 6480ccacagcaag cuaaugauua ucugaauuca uucaauuggg agagacaagu uucacaugcc 6540aaggagaaac ugacugcucu cacaaaaaag uauagaauua cagaaaauga uauacaaauu 6600gcauuagaug augccaaaau caacuuuaau gaaaaacuau cucaacugca gacauauaug 6660auacaauuug aucaguauau uaaagauagu uaugauuuac augauuugaa aauagcuauu 6720gcuaauauua uugaugaaau cauugaaaaa uuaaaaaguc uugaugagca cuaucauauc 6780cguguaaauu uaguaaaaac aauccaugau cuacauuugu uuauugaaaa uauugauuuu 6840aacaaaagug gaaguaguac ugcauccugg auucaaaaug uggauacuaa guaccaaauc 6900agaauccaga uacaagaaaa acugcagcag cuuaagagac acauacagaa uauagacauc 6960cagcaccuag cuggaaaguu aaaacaacac auugaggcua uugauguuag agugcuuuua 7020gaucaauugg gaacuacaau uucauuugaa agaauaaaug auguucuuga gcaugucaaa 7080cacuuuguua uaaaucuuau uggggauuuu gaaguagcug agaaaaucaa ugccuucaga 7140gccaaagucc augaguuaau cgagagguau gaaguagacc aacaaaucca gguuuuaaug 7200gauaaauuag uagaguugac ccaccaauac aaguugaagg agacuauuca gaagcuaagc 7260aauguccuac aacaaguuaa gauaaaagau uacuuugaga aauugguugg auuuauugau 7320gaugcuguga agaagcuuaa ugaauuaucu uuuaaaacau ucauugaaga uguuaacaaa 7380uuccuugaca uguugauaaa gaaauuaaag ucauuugauu accaccaguu uguagaugaa 7440accaaugaca aaauccguga ggugacucag agacucaaug gugaaauuca ggcucuggaa 7500cuaccacaaa aagcugaagc auuaaaacug uuuuuagagg aaaccaaggc cacaguugca 7560guguaucugg aaagccuaca ggacaccaaa auaaccuuaa ucaucaauug guuacaggag 7620gcuuuaaguu cagcaucuuu ggcucacaug aaggccaaau uccgagagac ucuagaagau 7680acacgagacc gaauguauca aauggacauu cagcaggaac uucaacgaua ccugucucug 7740guaggccagg uuuauagcac acuugucacc uacauuucug auugguggac ucuugcugcu 7800aagaaccuua cugacuuugc agagcaauau ucuauccaag auugggcuaa acguaugaaa 7860gcauugguag agcaaggguu cacuguuccu gaaaucaaga ccauccuugg gaccaugccu 7920gccuuugaag ucagucuuca ggcucuucag aaagcuaccu uccagacacc ugauuuuaua 7980gucccccuaa cagauuugag gauuccauca guucagauaa acuucaaaga cuuaaaaaau 8040auaaaaaucc cauccagguu uuccacacca gaauuuacca uccuuaacac cuuccacauu 8100ccuuccuuua caauugacuu ugucgaaaug aaaguaaaga ucaucagaac cauugaccag 8160augcagaaca gugagcugca guggcccguu ccagauauau aucucaggga ucugaaggug 8220gaggacauuc cucuagcgag aaucacccug ccagacuucc guuuaccaga aaucgcaauu 8280ccagaauuca uaaucccaac ucucaaccuu aaugauuuuc aaguuccuga ccuucacaua 8340ccagaauucc agcuucccca caucucacac acaauugaag uaccuacuuu uggcaagcua 8400uacaguauuc ugaaaaucca aucuccucuu uucacauuag augcaaaugc ugacauaggg 8460aauggaacca ccucagcaaa cgaagcaggu aucgcagcuu ccaucacugc caaaggagag 8520uccaaauuag aaguucucaa uuuugauuuu caagcaaaug cacaacucuc aaacccuaag 8580auuaauccgc uggcucugaa ggagucagug aaguucucca gcaaguaccu gagaacggag 8640caugggagug aaaugcuguu uuuuggaaau gcuauugagg gaaaaucaaa cacaguggca 8700aguuuacaca cagaaaaaaa uacacuggag cuuaguaaug gagugauugu caagauaaac 8760aaucagcuua cccuggauag caacacuaaa uacuuccaca aauugaacau ccccaaacug 8820gacuucucua gucaggcuga ccugcgcaac gagaucaaga cacuguugaa agcuggccac 8880auagcaugga cuucuucugg aaaaggguca uggaaauggg ccugccccag auucucagau 8940gagggaacac augaaucaca aauuaguuuc accauagaag gaccccucac uuccuuugga 9000cuguccaaua agaucaauag caaacaccua agaguaaacc aaaacuuggu uuaugaaucu 9060ggcucccuca acuuuucuaa acuugaaauu caaucacaag ucgauuccca gcaugugggc 9120cacaguguuc uaacugcuaa aggcauggca cuguuuggag aagggaaggc agaguuuacu 9180gggaggcaug augcucauuu aaauggaaag guuauuggaa cuuugaaaaa uucucuuuuc 9240uuuucagccc agccauuuga gaucacggca uccacaaaca augaagggaa uuugaaaguu 9300cguuuuccau uaagguuaac agggaagaua gacuuccuga auaacuaugc acuguuucug 9360agucccagug cccagcaagc aaguuggcaa guaagugcua gguucaauca guauaaguac 9420aaccaaaauu ucucugcugg aaacaacgag aacauuaugg aggcccaugu aggaauaaau 9480ggagaagcaa aucuggauuu cuuaaacauu ccuuuaacaa uuccugaaau gcgucuaccu 9540uacacaauaa ucacaacucc uccacugaaa gauuucucuc uaugggaaaa aacaggcuug 9600aaggaauucu ugaaaacgac aaagcaauca uuugauuuaa guguaaaagc ucaguauaag 9660aaaaacaaac acaggcauuc caucacaaau ccuuuggcug ugcuuuguga guuuaucagu 9720cagagcauca aauccuuuga caggcauuuu gaaaaaaaca gaaacaaugc auuagauuuu 9780gucaccaaau ccuauaauga aacaaaaauu aaguuugaua aguacaaagc ugaaaaaucu 9840cacgacgagc uccccaggac cuuucaaauu ccuggauaca cuguuccagu ugucaauguu 9900gaagugucuc cauucaccau agagaugucg gcauucggcu auguguuccc aaaagcaguc 9960agcaugccua guuucuccau ccuagguucu gacguccgug ugccuucaua cacauuaauc 10020cugccaucau uagagcugcc aguccuucau gucccuagaa aucucaagcu uucucuucca 10080cauuucaagg aauuguguac cauaagccau auuuuuauuc cugccauggg caauauuacc 10140uaugauuucu ccuuuaaauc aagugucauc acacugaaua ccaaugcuga acuuuuuaac 10200cagucagaua uuguugcuca ucuccuuucu ucaucuucau cugucauuga ugcacugcag 10260uacaaauuag agggcaccac aagauugaca agaaaaaggg gauugaaguu agccacagcu 10320cugucucuga gcaacaaauu uguggagggu agucauaaca guacugugag cuuaaccacg 10380aaaaauaugg aagugucagu ggcaaaaacc acaaaagccg aaauuccaau uuugagaaug 10440aauuucaagc aagaacuuaa uggaaauacc aagucaaaac cuacugucuc uuccuccaug 10500gaauuuaagu augauuucaa uucuucaaug cuguacucua ccgcuaaagg agcaguugac 10560cacaagcuua gcuuggaaag ccucaccucu uacuuuucca uugagucauc uaccaaagga 10620gaugucaagg guucgguucu uucucgggaa uauucaggaa cuauugcuag ugaggccaac 10680acuuacuuga auuccaagag cacacggucu ucagugaagc ugcagggcac uuccaaaauu 10740gaugauaucu ggaaccuuga aguaaaagaa aauuuugcug gagaagccac acuccaacgc 10800auauauuccc ucugggagca caguacgaaa aaccacuuac agcuagaggg ccucuuuuuc 10860accaacggag aacauacaag caaagccacc cuggaacucu cuccauggca aaugucagcu 10920cuuguucagg uccaugcaag ucagcccagu uccuuccaug auuucccuga ccuuggccag 10980gaaguggccc ugaaugcuaa cacuaagaac cagaagauca gauggaaaaa ugaaguccgg 11040auucauucug ggucuuucca gagccagguc gagcuuucca augaccaaga aaaggcacac 11100cuugacauug caggauccuu agaaggacac cuaagguucc ucaaaaauau cauccuacca 11160gucuaugaca agagcuuaug ggauuuccua aagcuggaug uaaccaccag cauugguagg 11220agacagcauc uucguguuuc aacugccuuu guguacacca aaaaccccaa uggcuauuca 11280uucuccaucc cuguaaaagu uuuggcugau aaauucauua cuccugggcu gaaacuaaau 11340gaucuaaauu caguucuugu caugccuacg uuccaugucc cauuuacaga ucuucagguu 11400ccaucgugca aacuugacuu cagagaaaua caaaucuaua agaagcugag aacuucauca 11460uuugcccuca accuaccaac acuccccgag guaaaauucc cugaaguuga uguguuaaca 11520aaauauucuc aaccagaaga cuccuugauu cccuuuuuug agauaaccgu gccugaaucu 11580caguuaacug ugucccaguu cacgcuucca aaaaguguuu cagauggcau ugcugcuuug 11640gaucuaaaug caguagccaa caagaucgca gacuuugagu ugcccaccau caucgugccu 11700gagcagacca uugagauucc cuccauuaag uucucuguac cugcuggaau ugucauuccu 11760uccuuucaag cacugacugc acgcuuugag guagacucuc ccguguauaa ugccacuugg 11820agugccaguu ugaaaaacaa agcagauuau guugaaacag uccuggauuc cacaugcagc 11880ucaaccguac aguuccuaga auaugaacua aauguuuugg gaacacacaa aaucgaagau 11940gguacguuag ccucuaagac uaaaggaaca cuugcacacc gugacuucag ugcagaauau 12000gaagaagaug gcaaauuuga aggacuucag gaaugggaag gaaaagcgca ccucaauauc 12060aaaagcccag cguucaccga ucuccaucug cgcuaccaga aagacaagaa aggcaucucc 12120accucagcag ccuccccagc cguaggcacc gugggcaugg auauggauga agaugacgac 12180uuuucuaaau ggaacuucua cuacagcccu caguccucuc cagauaaaaa acucaccaua 12240uucaaaacug aguugagggu ccgggaaucu gaugaggaaa cucagaucaa aguuaauugg 12300gaagaagagg cagcuucugg cuugcuaacc ucucugaaag acaacgugcc caaggccaca 12360gggguccuuu augauuaugu caacaaguac cacugggaac acacagggcu cacccugaga 12420gaagugucuu caaagcugag aagaaaucug cagaacaaug cugagugggu uuaucaaggg 12480gccauuaggc aaauugauga uaucgacgug agguuccaga aagcagccag uggcaccacu 12540gggaccuacc aagaguggaa ggacaaggcc cagaaucugu accaggaacu guugacucag 12600gaaggccaag ccaguuucca gggacucaag gauaacgugu uugauggcuu gguacgaguu 12660acucaaaaau uccauaugaa agucaagcau cugauugacu cacucauuga uuuucugaac 12720uuccccagau uccaguuucc ggggaaaccu gggauauaca cuagggagga acuuugcacu 12780auguucauaa gggagguagg gacgguacug ucccagguau auucgaaagu ccauaauggu 12840ucagaaauac uguuuuccua uuuccaagac cuagugauua cacuuccuuu cgaguuaagg 12900aaacauaaac uaauagaugu aaucucgaug uauagggaac uguugaaaga uuuaucaaaa 12960gaagcccaag agguauuuaa agccauucag ucucucaaga ccacagaggu gcuacguaau 13020cuucaggacc uuuuacaauu cauuuuccaa cuaauagaag auaacauuaa acagcugaaa 13080gagaugaaau uuacuuaucu uauuaauuau auccaagaug agaucaacac aaucuucaau 13140gauuauaucc cauauguuuu uaaauuguug aaagaaaacc uaugccuuaa ucuucauaag 13200uucaaugaau uuauucaaaa cgagcuucag gaagcuucuc aagaguuaca gcagauccau 13260caauacauua uggcccuucg ugaagaauau uuugauccaa guauaguugg cuggacagug 13320aaauauuaug aacuugaaga aaagauaguc agucugauca agaaccuguu aguugcucuu 13380aaggacuucc auucugaaua uauugucagu gccucuaacu uuacuuccca acucucaagu 13440caaguugagc aauuucugca cagaaauauu caggaauauc uuagcauccu uaccgaucca 13500gauggaaaag ggaaagagaa gauugcagag cuuucugcca cugcucagga aauaauuaaa 13560agccaggcca uugcgacgaa gaaaauaauu ucugauuacc accagcaguu uagauauaaa 13620cugcaagauu uuucagacca acucucugau uacuaugaaa aauuuauugc ugaauccaaa 13680agauugauug accuguccau ucaaaacuac cacacauuuc ugauauacau cacggaguua 13740cugaaaaagc ugcaaucaac cacagucaug aaccccuaca ugaagcuugc uccaggagaa 13800cuuacuauca uccucuaauu uuuuaaaaga aaucuucauu uauucuucuu uuccaauuga 13860acuuucacau agcacagaaa aaauucaaac ugccuauauu gauaaaacca uacagugagc 13920cagccuugca guaggcagua gacuauaagc agaagcacau augaacugga ccugcaccaa 13980agcuggcacc agggcucgga aggucucuga acucagaagg auggcauuuu uugcaaguua 14040aagaaaauca ggaucugagu uauuuugcua aacuuggggg aggaggaaca aauaaaugga 14100gucuuuauug uguaucaua 1411921503DNAHuman immunodeficiency virus 2atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgatggga aaaaattcgg 60ttaaggccag ggggaaagaa aaaatataaa ttaaaacata tagtatgggc aagcagggag 120ctagaacgat tcgcagttaa tcctggcctg ttagaaacat cagaaggctg tagacaaata 180ctgggacagc tacaaccatc ccttcagaca ggatcagaag aacttagatc attatataat 240acagtagcaa ccctctattg tgtgcatcaa aggatagaga taaaagacac caaggaagct 300ttagacaaga tagaggaaga gcaaaacaaa agtaagaaaa aagcacagca agcagcagct 360gacacaggac acagcaatca ggtcagccaa aattacccta tagtgcagaa catccagggg 420caaatggtac atcaggccat atcacctaga actttaaatg catgggtaaa agtagtagaa 480gagaaggctt tcagcccaga agtgataccc atgttttcag cattatcaga aggagccacc 540ccacaagatt taaacaccat gctaaacaca gtggggggac atcaagcagc catgcaaatg 600ttaaaagaga ccatcaatga ggaagctgca gaatgggata gagtgcatcc agtgcatgca 660gggcctattg caccaggcca gatgagagaa ccaaggggaa gtgacatagc aggaactact 720agtacccttc aggaacaaat aggatggatg acaaataatc cacctatccc agtaggagaa 780atttataaaa gatggataat cctgggatta aataaaatag taagaatgta tagccctacc

840agcattctgg acataagaca aggaccaaag gaacccttta gagactatgt agaccggttc 900tataaaactc taagagccga gcaagcttca caggaggtaa aaaattggat gacagaaacc 960ttgttggtcc aaaatgcgaa cccagattgt aagactattt taaaagcatt gggaccagcg 1020gctacactag aagaaatgat gacagcatgt cagggagtag gaggacccgg ccataaggca 1080agagttttgg ctgaagcaat gagccaagta acaaattcag ctaccataat gatgcagaga 1140ggcaatttta ggaaccaaag aaagattgtt aagtgtttca attgtggcaa agaagggcac 1200acagccagaa attgcagggc ccctaggaaa aagggctgtt ggaaatgtgg aaaggaagga 1260caccaaatga aagattgtac tgagagacag gctaattttt tagggaagat ctggccttcc 1320tacaagggaa ggccagggaa ttttcttcag agcagaccag agccaacagc cccaccagaa 1380gagagcttca ggtctggggt agagacaaca actccccctc agaagcagga gccgatagac 1440aaggaactgt atcctttaac ttccctcagg tcactctttg gcaacgaccc ctcgtcacaa 1500taa 15033261DNAHuman immunodeficiency virus 3atggagccag tagatcctag actagagccc tggaagcatc caggaagtca gcctaaaact 60gcttgtacca attgctattg taaaaagtgt tgctttcatt gccaagtttg tttcataaca 120aaagccttag gcatctccta tggcaggaag aagcggagac agcgacgaag agctcatcag 180aacagtcaga ctcatcaagc ttctctatca aagcaaccca cctcccaacc ccgaggggac 240ccgacaggcc cgaaggaata g 26142571DNAHuman immunodeficiency virus 4atgagagtga aggagaaata tcagcacttg tggagatggg ggtggagatg gggcaccatg 60ctccttggga tgttgatgat ctgtagtgct acagaaaaat tgtgggtcac agtctattat 120ggggtacctg tgtggaagga agcaaccacc actctatttt gtgcatcaga tgctaaagca 180tatgatacag aggtacataa tgtttgggcc acacatgcct gtgtacccac agaccccaac 240ccacaagaag tagtattggt aaatgtgaca gaaaatttta acatgtggaa aaatgacatg 300gtagaacaga tgcatgagga tataatcagt ttatgggatc aaagcctaaa gccatgtgta 360aaattaaccc cactctgtgt tagtttaaag tgcactgatt tgaagaatga tactaatacc 420aatagtagta gcgggagaat gataatggag aaaggagaga taaaaaactg ctctttcaat 480atcagcacaa gcataagagg taaggtgcag aaagaatatg cattttttta taaacttgat 540ataataccaa tagataatga tactaccagc tataagttga caagttgtaa cacctcagtc 600attacacagg cctgtccaaa ggtatccttt gagccaattc ccatacatta ttgtgccccg 660gctggttttg cgattctaaa atgtaataat aagacgttca atggaacagg accatgtaca 720aatgtcagca cagtacaatg tacacatgga attaggccag tagtatcaac tcaactgctg 780ttaaatggca gtctagcaga agaagaggta gtaattagat ctgtcaattt cacggacaat 840gctaaaacca taatagtaca gctgaacaca tctgtagaaa ttaattgtac aagacccaac 900aacaatacaa gaaaaagaat ccgtatccag agaggaccag ggagagcatt tgttacaata 960ggaaaaatag gaaatatgag acaagcacat tgtaacatta gtagagcaaa atggaataac 1020actttaaaac agatagctag caaattaaga gaacaatttg gaaataataa aacaataatc 1080tttaagcaat cctcaggagg ggacccagaa attgtaacgc acagttttaa ttgtggaggg 1140gaatttttct actgtaattc aacacaactg tttaatagta cttggtttaa tagtacttgg 1200agtactgaag ggtcaaataa cactgaagga agtgacacaa tcaccctccc atgcagaata 1260aaacaaatta taaacatgtg gcagaaagta ggaaaagcaa tgtatgcccc tcccatcagt 1320ggacaaatta gatgttcatc aaatattaca gggctgctat taacaagaga tggtggtaat 1380agcaacaatg agtccgagat cttcagacct ggaggaggag atatgaggga caattggaga 1440agtgaattat ataaatataa agtagtaaaa attgaaccat taggagtagc acccaccaag 1500gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc tttgttcctt 1560gggttcttgg gagcagcagg aagcactatg ggcgcagcct caatgacgct gacggtacag 1620gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag ggctattgag 1680gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca ggcaagaatc 1740ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg ttgctctgga 1800aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa atctctggaa 1860cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa ttacacaagc 1920ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga acaagaatta 1980ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa ttggctgtgg 2040tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat agtttttgct 2100gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt tcagacccac 2160ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg tggagagaga 2220gacagagaca gatccattcg attagtgaac ggatccttgg cacttatctg ggacgatctg 2280cggagcctgt gcctcttcag ctaccaccgc ttgagagact tactcttgat tgtaacgagg 2340attgtggaac ttctgggacg cagggggtgg gaagccctca aatattggtg gaatctccta 2400cagtattgga gtcaggaact aaagaatagt gctgttagct tgctcaatgc cacagccata 2460gcagtagctg aggggacaga tagggttata gaagtagtac aaggagcttg tagagctatt 2520cgccacatac ctagaagaat aagacagggc ttggaaagga ttttgctata a 257154308DNAHuman immunodeficiency virus 5atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgatggga aaaaattcgg 60ttaaggccag ggggaaagaa aaaatataaa ttaaaacata tagtatgggc aagcagggag 120ctagaacgat tcgcagttaa tcctggcctg ttagaaacat cagaaggctg tagacaaata 180ctgggacagc tacaaccatc ccttcagaca ggatcagaag aacttagatc attatataat 240acagtagcaa ccctctattg tgtgcatcaa aggatagaga taaaagacac caaggaagct 300ttagacaaga tagaggaaga gcaaaacaaa agtaagaaaa aagcacagca agcagcagct 360gacacaggac acagcaatca ggtcagccaa aattacccta tagtgcagaa catccagggg 420caaatggtac atcaggccat atcacctaga actttaaatg catgggtaaa agtagtagaa 480gagaaggctt tcagcccaga agtgataccc atgttttcag cattatcaga aggagccacc 540ccacaagatt taaacaccat gctaaacaca gtggggggac atcaagcagc catgcaaatg 600ttaaaagaga ccatcaatga ggaagctgca gaatgggata gagtgcatcc agtgcatgca 660gggcctattg caccaggcca gatgagagaa ccaaggggaa gtgacatagc aggaactact 720agtacccttc aggaacaaat aggatggatg acaaataatc cacctatccc agtaggagaa 780atttataaaa gatggataat cctgggatta aataaaatag taagaatgta tagccctacc 840agcattctgg acataagaca aggaccaaag gaacccttta gagactatgt agaccggttc 900tataaaactc taagagccga gcaagcttca caggaggtaa aaaattggat gacagaaacc 960ttgttggtcc aaaatgcgaa cccagattgt aagactattt taaaagcatt gggaccagcg 1020gctacactag aagaaatgat gacagcatgt cagggagtag gaggacccgg ccataaggca 1080agagttttgg ctgaagcaat gagccaagta acaaattcag ctaccataat gatgcagaga 1140ggcaatttta ggaaccaaag aaagattgtt aagtgtttca attgtggcaa agaagggcac 1200acagccagaa attgcagggc ccctaggaaa aagggctgtt ggaaatgtgg aaaggaagga 1260caccaaatga aagattgtac tgagagacag gctaattttt taagggaaga tctggccttc 1320ctacaaggga aggccaggga attttcttca gagcagacca gagccaacag ccccaccaga 1380agagagcttc aggtctgggg tagagacaac aactccccct cagaagcagg agccgataga 1440caaggaactg tatcctttaa cttccctcag gtcactcttt ggcaacgacc cctcgtcaca 1500ataaagatag gggggcaact aaaggaagct ctattagata caggagcaga tgatacagta 1560ttagaagaaa tgagtttgcc aggaagatgg aaaccaaaaa tgataggggg aattggaggt 1620tttatcaaag taagacagta tgatcagata ctcatagaaa tctgtggaca taaagctata 1680ggtacagtat tagtaggacc tacacctgtc aacataattg gaagaaatct gttgactcag 1740attggttgca ctttaaattt tcccattagc cctattgaga ctgtaccagt aaaattaaag 1800ccaggaatgg atggcccaaa agttaaacaa tggccattga cagaagaaaa aataaaagca 1860ttagtagaaa tttgtacaga gatggaaaag gaagggaaaa tttcaaaaat tgggcctgaa 1920aatccataca atactccagt atttgccata aagaaaaaag acagtactaa atggagaaaa 1980ttagtagatt tcagagaact taataagaga actcaagact tctgggaagt tcaattagga 2040ataccacatc ccgcagggtt aaaaaagaaa aaatcagtaa cagtactgga tgtgggtgat 2100gcatattttt cagttccctt agatgaagac ttcaggaagt atactgcatt taccatacct 2160agtataaaca atgagacacc agggattaga tatcagtaca atgtgcttcc acagggatgg 2220aaaggatcac cagcaatatt ccaaagtagc atgacaaaaa tcttagagcc ttttagaaaa 2280caaaatccag acatagttat ctatcaatac atggatgatt tgtatgtagg atctgactta 2340gaaatagggc agcatagaac aaaaatagag gagctgagac aacatctgtt gaggtgggga 2400cttaccacac cagacaaaaa acatcagaaa gaacctccat tcctttggat gggttatgaa 2460ctccatcctg ataaatggac agtacagcct atagtgctgc cagaaaaaga cagctggact 2520gtcaatgaca tacagaagtt agtggggaaa ttgaattggg caagtcagat ttacccaggg 2580attaaagtaa ggcaattatg taaactcctt agaggaacca aagcactaac agaagtaata 2640ccactaacag aagaagcaga gctagaactg gcagaaaaca gagagattct aaaagaacca 2700gtacatggag tgtattatga cccatcaaaa gacttaatag cagaaataca gaagcagggg 2760caaggccaat ggacatatca aatttatcaa gagccattta aaaatctgaa aacaggaaaa 2820tatgcaagaa tgaggggtgc ccacactaat gatgtaaaac aattaacaga ggcagtgcaa 2880aaaataacca cagaaagcat agtaatatgg ggaaagactc ctaaatttaa actgcccata 2940caaaaggaaa catgggaaac atggtggaca gagtattggc aagccacctg gattcctgag 3000tgggagtttg ttaatacccc tcccttagtg aaattatggt accagttaga gaaagaaccc 3060atagtaggag cagaaacctt ctatgtagat ggggcagcta acagggagac taaattagga 3120aaagcaggat atgttactaa tagaggaaga caaaaagttg tcaccctaac tgacacaaca 3180aatcagaaga ctgagttaca agcaatttat ctagctttgc aggattcggg attagaagta 3240aacatagtaa cagactcaca atatgcatta ggaatcattc aagcacaacc agatcaaagt 3300gaatcagagt tagtcaatca aataatagag cagttaataa aaaaggaaaa ggtctatctg 3360gcatgggtac cagcacacaa aggaattgga ggaaatgaac aagtagataa attagtcagt 3420gctggaatca ggaaagtact atttttagat ggaatagata aggcccaaga tgaacatgag 3480aaatatcaca gtaattggag agcaatggct agtgatttta acctgccacc tgtagtagca 3540aaagaaatag tagccagctg tgataaatgt cagctaaaag gagaagccat gcatggacaa 3600gtagactgta gtccaggaat atggcaacta gattgtacac atttagaagg aaaagttatc 3660ctggtagcag ttcatgtagc cagtggatat atagaagcag aagttattcc agcagaaaca 3720gggcaggaaa cagcatattt tcttttaaaa ttagcaggaa gatggccagt aaaaacaata 3780catactgaca atggcagcaa tttcaccggt gctacggtta gggccgcctg ttggtgggcg 3840ggaatcaagc aggaatttgg aattccctac aatccccaaa gtcaaggagt agtagaatct 3900atgaataaag aattaaagaa aattatagga caggtaagag atcaggctga acatcttaag 3960acagcagtac aaatggcagt attcatccac aattttaaaa gaaaaggggg gattgggggg 4020tacagtgcag gggaaagaat agtagacata atagcaacag acatacaaac taaagaatta 4080caaaaacaaa ttacaaaaat tcaaaatttt cgggtttatt acagggacag cagaaatcca 4140ctttggaaag gaccagcaaa gctcctctgg aaaggtgaag gggcagtagt aatacaagat 4200aatagtgaca taaaagtagt gccaagaaga aaagcaaaga tcattaggga ttatggaaaa 4260cagatggcag gtgatgattg tgtggcaagt agacaggatg aggattag 43086579DNAHuman immunodeficiency virus 6atggaaaaca gatggcaggt gatgattgtg tggcaagtag acaggatgag gattagaaca 60tggaaaagtt tagtaaaaca ccatatgtat gtttcaggga aagctagggg atggttttat 120agacatcact atgaaagccc tcatccaaga ataagttcag aagtacacat cccactaggg 180gatgctagat tggtaataac aacatattgg ggtctgcata caggagaaag agactggcat 240ttgggtcagg gagtctccat agaatggagg aaaaagagat atagcacaca agtagaccct 300gaactagcag accaactaat tcatctgtat tactttgact gtttttcaga ctctgctata 360agaaaggcct tattaggaca catagttagc cctaggtgtg aatatcaagc aggacataac 420aaggtaggat ctctacaata cttggcacta gcagcattaa taacaccaaa aaagataaag 480ccacctttgc ctagtgttac gaaactgaca gaggatagat ggaacaagcc ccagaagacc 540aagggccaca gagggagcca cacaatgaat ggacactag 5797621DNAHuman immunodeficiency virus 7atgggtggca agtggtcaaa aagtagtgtg attggatggc ctactgtaag ggaaagaatg 60agacgagctg agccagcagc agatagggtg ggagcagcat ctcgagacct ggaaaaacat 120ggagcaatca caagtagcaa tacagcagct accaatgctg cttgtgcctg gctagaagca 180caagaggagg aggaggtggg ttttccagtc acacctcagg tacctttaag accaatgact 240tacaaggcag ctgtagatct tagccacttt ttaaaagaaa aggggggact ggaagggcta 300attcactccc aaagaagaca agatatcctt gatctgtgga tctaccacac acaaggctac 360ttccctgatt agcagaacta cacaccaggg ccaggggtca gatatccact gacctttgga 420tggtgctaca agctagtacc agttgagcca gataagatag aagaggccaa taaaggagag 480aacaccagct tgttacaccc tgtgagcctg catgggatgg atgacccgga gagagaagtg 540ttagagtgga ggtttgacag ccgcctagca tttcatcacg tggcccgaga gctgcatccg 600gagtacttca agaactgctg a 6218721RNAAequorea victoria 8auggugagca agggcgagga gcuguucacc gggguggugc ccauccuggu cgagcuggac 60ggcgacguaa acggccacaa guucagcgug uccggcgagg gcgagggcga ugccaccuac 120ggcaagcuga cccugaaguu caucugcacc accggcaagc ugcccgugcc cuggcccacc 180cucgugacca cccugaccua cggcgugcag ugcuucagcc gcuaccccga ccacaugaag 240cagcacgacu ucuucaaguc cgccaugccc gaaggcuacg uccaggagcg caccaucuuc 300uucaaggacg acggcaacua caagacccgc gccgagguga aguucgaggg cgacacccug 360gugaaccgca ucgagcugaa gggcaucgac uucaaggagg acggcaacau ccuggggcac 420aagcuggagu acaacuacaa cagccacaac gucuauauca uggccgacaa gcagaagaac 480ggcaucaagg ugaacuucaa gauccgccac aacaucgagg acggcagcgu gcagcucgcc 540gaccacuacc agcagaacac ccccaucggc gacggccccg ugcugcugcc cgacaaccac 600uaccugagca cccaguccgc ccugagcaaa gaccccaacg agaagcgcga ucacaugguc 660cugcuggagu ucgugaccgc cgccgggauc acucucggca uggacgagcu guacaaguaa 720a 72199262RNAHuman immunodeficiency virus 9gucucucugg uuagaccaga ucugagccug ggagcucucu ggcuaacuag ggaacccacu 60gcuuaagccu caauaaagcu ugccuugagu gcuucaagua gugugugccc gucuguugug 120ugacucuggu aacuagagau cccucagacc cuuuuaguca guguggaaaa ucucuagcag 180uggcgcccga acagggacau gaaagcgaaa gggaaaccag aggagcucuc ucgacgcagg 240acucggcuug cugaagcgcg cacggcaaga ggcgaggggc ggcgacuggu gaguacgcca 300aaaauuuuga cuagcggagg cuagaaggag agagaugggu gcgagagcgu caguauuaag 360cgggggaaaa uuagaucgau gggaaaaaau ucgguuaagg ccagggggaa agaaaaaaua 420uaaauuaaaa cauauaguau gggcaagcag ggagcuagaa cgauucgcag uuaauccugg 480ccuguuagaa acaucagaag gcuguagaca aauacuggga cagcuacaac caucccuuca 540gacaggauca gaagaacgua gaucauuaua uaauacagua gcaacccucu auugugugca 600ucaaaggaua gagauaaaag acaccaagga agcuuuagac aagauagagg aagagcaaaa 660caaaaguaag aaaaaagcac agcaagcagc agcugacaca ggacacagca gccaggucag 720ccaaaauuac ccuauagugc agaacaucca ggggcaaaug guacaucagg ccauaucacc 780uagaacuuua aaugcauggg uaaaaguagu agaagagaag gcuuucagcc cagaagugau 840acccauguuu ucagcauuau cagaaggagc caccccacaa gauuuaaaca ccaugcuaaa 900cacagugggg ggacaucaag cagccaugca aauguuaaaa gagaccauca augaggaagc 960ugcagaaugg gauagagugc auccagugca ugcagggccu auugcaccag gccagaugag 1020agaaccaagg ggaagugaca uagcaggaac uacuaguacc cuucaggaac aaauaggaug 1080gaugacacau aauccaccua ucccaguagg agaaaucuau aaaagaugga uaauccuggg 1140auuaaauaaa auaguaagaa uguauagccc uaccagcauu cuggacauaa gacaaggacc 1200aaaggaaccc uuuagagacu auguagaccg auucuauaaa acucuaagag ccgagcaagc 1260uucacaagag guaaaaaauu ggaugacaga aaccuuguug guccaaaaug cgaacccaga 1320uuguaagacu auuuuaaaag cauugggacc aggagcgaca cuagaagaaa ugaugacagc 1380augucaggga guggggggac ccggccauaa agcaagaguu uuggcugaag caaugagcca 1440aguaacaaau ccagcuacca uaaugauaca gaaaggcaau uuuaggaacc aaagaaagac 1500uguuaagugu uucaauugug gcaaagaagg gcacauagcc aaaaauugca gggccccuag 1560gaaaaagggc uguuggaaau guggaaagga aggacaccaa augaaagauu guacugagag 1620acaggcuaau uuuuuaggga agaucuggcc uucccacaag ggaaggccag ggaauuuucu 1680ucagagcaga ccagagccaa cagccccacc agaagagagc uucagguuug gggaagagac 1740aacaacuccc ucucagaagc aggagccgau agacaaggaa cuguauccuu uagcuucccu 1800cagaucacuc uuuggcagcg accccucguc acaauaaaga uaggggggca auuaaaggaa 1860gcucuauuag auacaggagc agaugauaca guauuagaag aaaugaauuu gccaggaaga 1920uggaaaccaa aaaugauagg gggaauugga gguuuuauca aaguaagaca guaugaucag 1980auacucauag aaaucugcgg acauaaagcu auagguacag uauuaguagg accuacaccu 2040gucaacauaa uuggaagaaa ucuguugacu cagauuggcu gcacuuuaaa uuuucccauu 2100aguccuauug agacuguacc aguaaaauua aagccaggaa uggauggccc aaaaguuaaa 2160caauggccau ugacagaaga aaaaauaaaa gcauuaguag aaauuuguac agaaauggaa 2220aaggaaggaa aaauuucaaa aauugggccu gaaaauccau acaauacucc aguauuugcc 2280auaaagaaaa aagacaguac uaaauggaga aaauuaguag auuucagaga acuuaauaag 2340agaacucaag auuucuggga aguucaauua ggaauaccac auccugcagg guuaaaacag 2400aaaaaaucag uaacaguacu ggaugugggc gaugcauauu uuucaguucc cuuagauaaa 2460gacuucagga aguauacugc auuuaccaua ccuaguauaa acaaugagac accagggauu 2520agauaucagu acaaugugcu uccacaggga uggaaaggau caccagcaau auuccagugu 2580agcaugacaa aaaucuuaga gccuuuuaga aaacaaaauc cagacauagu caucuaucaa 2640uacauggaug auuuguaugu aggaucugac uuagaaauag ggcagcauag aacaaaaaua 2700gaggaacuga gacaacaucu guugaggugg ggauuuacca caccagacaa aaaacaucag 2760aaagaaccuc cauuccuuug gauggguuau gaacuccauc cugauaaaug gacaguacag 2820ccuauagugc ugccagaaaa ggacagcugg acugucaaug acauacagaa auuaguggga 2880aaauugaauu gggcaaguca gauuuaugca gggauuaaag uaaggcaauu auguaaacuu 2940cuuaggggaa ccaaagcacu aacagaagua guaccacuaa cagaagaagc agagcuagaa 3000cuggcagaaa acagggagau ucuaaaagaa ccgguacaug gaguguauua ugacccauca 3060aaagacuuaa uagcagaaau acagaagcag gggcaaggcc aauggacaua ucaaauuuau 3120caagagccau uuaaaaaucu gaaaacagga aaguaugcaa gaaugaaggg ugcccacacu 3180aaugauguga aacaauuaac agaggcagua caaaaaauag ccacagaaag cauaguaaua 3240uggggaaaga cuccuaaauu uaaauuaccc auacaaaagg aaacauggga agcauggugg 3300acagaguauu ggcaagccac cuggauuccu gagugggagu uugucaauac cccucccuua 3360gugaaguuau gguaccaguu agagaaagaa cccauaauag gagcagaaac uuucuaugua 3420gauggggcag ccaauaggga aacuaaauua ggaaaagcag gauauguaac ugacagagga 3480agacaaaaag uugucccccu aacggacaca acaaaucaga agacugaguu acaagcaauu 3540caucuagcuu ugcaggauuc gggauuagaa guaaacauag ugacagacuc acaauaugca 3600uugggaauca uucaagcaca accagauaag agugaaucag aguuagucag ucaaauaaua 3660gagcaguuaa uaaaaaagga aaaagucuac cuggcauggg uaccagcaca caaaggaauu 3720ggaggaaaug aacaaguaga uaaauugguc agugcuggaa ucaggaaagu acuauuuuua 3780gauggaauag auaaggccca agaagaacau gagaaauauc acaguaauug gagagcaaug 3840gcuagugauu uuaaccuacc accuguagua gcaaaagaaa uaguagccag cugugauaaa 3900ugucagcuaa aaggggaagc caugcaugga caaguagacu guagcccagg aauauggcag 3960cuagauugua cacauuuaga aggaaaaguu aucuugguag caguucaugu agccagugga 4020uauauagaag cagaaguaau uccagcagag acagggcaag aaacagcaua cuuccucuua 4080aaauuagcag gaagauggcc aguaaaaaca guacauacag acaauggcag caauuucacc 4140aguacuacag uuaaggccgc cuguuggugg gcggggauca agcaggaauu uggcauuccc 4200uacaaucccc aaagucaagg aguaauagaa ucuaugaaua aagaauuaaa gaaaauuaua 4260ggacagguaa gagaucaggc ugaacaucuu aagacagcag uacaaauggc aguauucauc 4320cacaauuuua aaagaaaagg ggggauuggg ggguacagug caggggaaag aauaguagac 4380auaauagcaa cagacauaca aacuaaagaa uuacaaaaac aaauuacaaa aauucaaaau 4440uuucggguuu auuacaggga cagcagagau ccaguuugga aaggaccagc aaagcuccuc 4500uggaaaggug aaggggcagu aguaauacaa gauaauagug acauaaaagu agugccaaga 4560agaaaagcaa agaucaucag ggauuaugga aaacagaugg caggugauga uuguguggca 4620aguagacagg augaggauua acacauggaa aagauuagua aaacaccaua uguauauuuc 4680aaggaaagcu aaggacuggu uuuauagaca ucacuaugaa aguacuaauc caaaaauaag 4740uucagaagua cacaucccac uaggggaugc uaaauuagua auaacaacau auuggggucu 4800gcauacagga gaaagagacu ggcauuuggg ucagggaguc uccauagaau ggaggaaaaa

4860gagauauagc acacaaguag acccugaccu agcagaccaa cuaauucauc ugcacuauuu 4920ugauuguuuu ucagaaucug cuauaagaaa uaccauauua ggacguauag uuaguccuag 4980gugugaauau caagcaggac auaacaaggu aggaucucua caguacuugg cacuagcagc 5040auuaauaaaa ccaaaacaga uaaagccacc uuugccuagu guuaggaaac ugacagagga 5100cagauggaac aagccccaga agaccaaggg ccacagaggg agccauacaa ugaauggaca 5160cuagagcuuu uagaggaacu uaagagugaa gcuguuagac auuuuccuag gauauggcuc 5220cauaacuuag gacaacauau cuaugaaacu uacggggaua cuugggcagg aguggaagcc 5280auaauaagaa uucugcaaca acugcuguuu auccauuuca gaauugggug ucgacauagc 5340agaauaggcg uuacucgaca gaggagagca agaaauggag ccaguagauc cuagacuaga 5400gcccuggaag cauccaggaa gucagccuaa aacugcuugu accaauugcu auuguaaaaa 5460guguugcuuu cauugccaag uuuguuucau aacaaaagcc uuaggcaucu ccuauggcag 5520gaagaagcgg agacagcgac gaagaccucc ucaaggcagu cagacucauc aaguuucucu 5580aucaaagcag uaaguaauac auguaaugca accuauacaa auagcaauag uagcauuagu 5640aguagcaaua auaauagcaa uaguugugug guccauagua aucauagaau auaggaaaau 5700auuaagacaa agaaaaauag acagguuaau ugauagacua auagaaagag cagaagacag 5760uggcaaugag agugaaggag aaauaucagc acuuguggag augggggugg agauggggca 5820ccaugcuccu ugggauguug augaucugua gugcuacaga aaaauugugg gucacagucu 5880auuauggggu accugugugg aaggaagcaa ccaccacucu auuuugugca ucagaugcua 5940aagcauauga uacagaggua cauaauguuu gggccacaca ugccugugua cccacagacc 6000ccaacccaca agaaguagua uugguaaaug ugacagaaaa uuuuaacaug uggaaaaaug 6060acaugguaga acagaugcau gaggauauaa ucaguuuaug ggaucaaagc cuaaagccau 6120guguaaaauu aaccccacuc uguguuaguu uaaagugcac ugauuugaag aaugauacua 6180auaccaauag uaguagcggg agaaugauaa uggagaaagg agagauaaaa aacugcucuu 6240ucaauaucag cacaagcaua agagguaagg ugcagaaaga auaugcauuu uuuuauaaac 6300uugauauaau accaauagau aaugauacua ccagcuauac guugacaagu uguaacaccu 6360cagucauuac acaggccugu ccaaagguau ccuuugagcc aauucccaua cauuauugug 6420ccccggcugg uuuugcgauu cuaaaaugua auaauaagac guucaaugga acaggaccau 6480guacaaaugu cagcacagua caauguacac auggaauuag gccaguagua ucaacucaac 6540ugcuguuaaa uggcagucua gcagaagaag agguaguaau uagaucuguc aauuucacgg 6600acaaugcuaa aaccauaaua guacagcuga acacaucugu agaaauuaau uguacaagac 6660ccaacaacaa uacaagaaaa aaaauccgua uccagagggg accagggaga gcauuuguua 6720caauaggaaa aauaggaaau augagacaag cacauuguaa cauuaguaga gcaaaaugga 6780augccacuuu aaaacagaua gcuagcaaau uaagagaaca auuuggaaau aauaaaacaa 6840uaaucuuuaa gcaauccuca ggaggggacc cagaaauugu aacgcacagu uuuaauugug 6900gaggggaauu uuucuacugu aauucaacac aacuguuuaa uaguacuugg uuuaauagua 6960cuuggaguac ugaaggguca aauaacacug aaggaaguga cacaaucaca cucccaugca 7020gaauaaaaca auuuauaaac auguggcagg aaguaggaaa agcaauguau gccccuccca 7080ucagcggaca aauuagaugu ucaucaaaua uuacagggcu gcuauuaaca agagauggug 7140guaauaacaa caaugggucc gagaucuuca gaccuggagg aggagauaug agggacaauu 7200ggagaaguga auuauauaaa uauaaaguag uaaaaauuga accauuagga guagcaccca 7260ccaaggcaaa gagaagagug gugcagagag aaaaaagagc agugggaaua ggagcuuugu 7320uccuuggguu cuugggagca gcaggaagca cuaugggcgc agcgucaaug acgcugacgg 7380uacaggccag acaauuauug ucugguauag ugcagcagca gaacaauuug cugagggcua 7440uugaggcgca acagcaucug uugcaacuca cagucugggg caucaagcag cuccaggcaa 7500gaauccuggc uguggaaaga uaccuaaagg aucaacagcu ccuggggauu ugggguugcu 7560cuggaaaacu cauuugcacc acugcugugc cuuggaaugc uaguuggagu aauaaaucuc 7620uggaacagau uuggaaucac acgaccugga uggaguggga cagagaaauu aacaauuaca 7680caagcuuaau acacuccuua auugaagaau cgcaaaacca gcaagaaaag aaugaacaag 7740aauuauugga auuagauaaa ugggcaaguu uguggaauug guuuaacaua acaaauuggc 7800ugugguauau aaaauuauuc auaaugauag uaggaggcuu gguagguuua agaauaguuu 7860uugcuguacu uucuguagug aauagaguua ggcagggaua uucaccauua ucguuucaga 7920cccaccuccc aaucccgagg ggacccgaca ggcccgaagg aauagaagaa gaagguggag 7980agagagacag agacagaucc auucgauuag ugaacggauc cuuagcacuu aucugggacg 8040aucugcggag ccugugccuc uucagcuacc accgcuugag agacuuacuc uugauuguaa 8100cgaggauugu ggaacuucug ggacgcaggg ggugggaagc ccucaaauau ugguggaauc 8160uccuacaaua uuggagucag gagcuaaaga auagugcugu uagcuugcuc aaugccacag 8220cuauagcagu agcugagggg acagauaggg uuauagaagu aguacaagaa gcuuauagag 8280cuauucgcca cauaccuaga agaauaggac agggcuugga aaggauuuug cuauaagaug 8340gguggcaagu ggucaaaaag uagugugguu ggauggccug cuguaaggga aagaaugaga 8400cgagcugagc cagcagcaga ugggguggga gcagcaucuc gagaccuaga aaaacaugga 8460gcaaucacaa guagcaacac agcagcuaac aaugcugcuu gugccuggcu agaagcacaa 8520gaggaggaga agguggguuu uccagucaca ccucagguac cuuuaagacc aaugacuuac 8580aaggcagcug uagaucuuag ccacuuuuua aaagaaaagg ggggacugga agggcuaauu 8640cacucccaac gaagacaaga uauccuugau cuguggaucu accacacaca aggcuacuuc 8700ccugauuggc agaacuacac accaggacca gggaucagau auccacugac cuuuggaugg 8760cgcuacaagc uaguaccagu ugagccagag aaguuagaag aagccaacaa aggagagaac 8820accagcuugu uacacccugu gagccugcau ggaauggaug acccggagag agaaguguua 8880gaguggaggu uugacagccg ccuagcauuu caucacgugg cccgagagcu gcauccggag 8940uacuucaaga acugcugaua ucgagcuugc uacaagggac uuuccgcugg ggacuuucca 9000gggaggcgug gccugggcgg gacuggggag uggcgagccc ucagauccug cauauaagca 9060gcugcuuuuu gccuguacug ggucucucug guuagaccag aucugagccu gggagcucuc 9120uggcuaacua gggaacccac ugcuuaagcc ucaauaaagc uugccuugag ugcuucaagu 9180agugugugcc cgucuguugu gugacucugg uaacuagaga ucccucagac ccuuuuaguc 9240aguguggaaa aucucuagca gu 92621013931RNAMus musculus 10uaccugccug agcuccgccu ccgaagaccc uguagagcaa gcagcagggg cuaggcccgu 60ggccaggcca cagccaggaa gccaccccac cauccauccg ccaugggccc acgaaagccu 120gcccugcgga cgccguuacu gcugcuguuc cugcuacugu ucuuggacac cagcgucugg 180gcucaagaug aaguccugga aaacuuaagc uucagcuguc caaaagaugc aacucgauuc 240aagcaccucc gaaaguacgu guacaacuau gaagcugaaa guuccagcgg uguccagggc 300acagcugacu ccagaagcgc caccaagauc aacuguaagg uagagcugga ggucccccaa 360aucugugguu ucaucaugag gaccaaccag uguacccuua aagaggugua uggcuucaac 420ccugagggca aggccuugau gaagaaaacc aagaacucug aagaguuugc agcugccaug 480uccagguacg aacucaagcu ggccauuccu gaagggaaac aaauuguucu uuacccugac 540aaggaugaac cuaaauauau ccugaacauc aagaggggca ucaucucugc ucuucugguu 600cccccagaga cagaagagga ccaacaagag uuguuccugg auaccgugua uggaaacugc 660ucaacucagg uuaccgugaa uucaagaaag ggaaccguac caacagaaau guccacagag 720agaaaccugc agcaauguga cggcuuccag cccaucagua caagugucag cccucucgcu 780cucaucaaag gccuggucca ccccuuguca acucuuauca gcagcagcca aacuugccag 840uacacccugg auccuaagag gaagcaugug ucugaagcug ucugugauga gcagcaucuu 900uuccugccuu ucuccuacaa gaauaaguau gggaucauga cacguguuac acagaaacug 960agucuugaag acacaccuaa gaucaacagu cgcuucuuca gugaagguac caaccggaug 1020ggucuggccu uugagagcac caaguccacg ucauccccaa agcaggcuga ugcuguuuug 1080aagacccuuc aagaacugaa aaaauugucc aucucagagc agaaugcuca gagagcaaau 1140cucuucaaua aacugguuac ugagcugaga ggccucacug gugaagcaau cacaucccuc 1200uugccacagc ugauugaagu guccagcccc aucacuuuac aagccuuggu ucagugugga 1260cagccacagu gcuauacuca cauccuccag uggcugaaaa cugagaaggc ucacccccuc 1320cugguugaca uugucaccua ccugauggcu cugaucccaa aucccucaac acagaggcug 1380caggaaaucu uuaauacugc caaggagcag cagagccgag ccacucugua ugcacugagc 1440cacgcaguua acagcuauuu ugauguggac cauucaagga gcccaguucu gcaggauauc 1500gcugguuacc uguugaaaca gaucgacaau gaaugcacgg gcaaugaaga ccacaccuuc 1560uugauucuga gggucauugg aaauauggga agaaccaugg aacaaguaau gccagcccuc 1620aaguccucag uccugagcug uguacgaagu acaaaaccau cucugcugau ucagaaagcu 1680gcucuccagg cccugaggaa gauggaacug gaagaugagg uccggacgau ccuuuuugau 1740acauuuguaa auggugucgc ucccguggag aagagacugg cugccuaucu cuugcugaug 1800aagaacccuu ccucaucaga uauuaacaaa auugcccaac uucuccaaug ggaacagagu 1860gagcagguga agaacuucgu ggcaucucac auugccaaca ucuugaacuc ggaagaacug 1920uauguccaag aucugaaagu uuugaucaaa aaugcucugg agaauucuca auuuccaacg 1980aucauggacu ucagaaaauu uucccgaaac uaucagauuu ccaaaucugc uucucuccca 2040auguucgacc cagucucagu caaaauagaa gggaaucuua uauuugaucc aagcaguuau 2100cuucccagag aaagcuugcu gaaaacaacc cucacagucu uuggacuugc uucacuugau 2160cucuuugaga uugguuuaga aggaaaaggg uuugagccaa cacuagaagc ucuuuuuggu 2220aagcaaggau ucuucccaga cagugucaac aaggcuuugu auugggucaa uggccgaguu 2280ccagauggug ucuccaaggu cuugguggac cacuuuggcu auacuacaga uggcaagcau 2340gaacaggaca uggugaaugg aaucaugccc auuguggaca aguugaucaa agaucugaaa 2400ucuaaagaaa uuccugaagc cagggccuau cuccgcaucc uaggaaaaga gcuaagcuuu 2460gucagacucc aagaccucca aguccugggg aagcuguugc ugaguggugc acaaacuuug 2520cagggaaucc cccagauggu uguacaggcc aucagagaag ggucaaagaa ugacuuguuu 2580cuccacuaca ucuucaugga caaugccuuu gagcucccca cuggagcagg guuacagcug 2640caaguguccu cgucuggagu cuucaccccc gggaucaagg cugguguaag acuggaauua 2700gccaacauac aggcagagcu aguggcaaag cccucugugu ccuuggaguu ugugacaaau 2760augggcauca ucaucccaga cuucgcuaag agcagugucc agaugaacac caacuucuuc 2820cacgagucag gccuggaggc gcgaguggcc cugaaggcug ggcagcugaa ggucaucauu 2880ccuucuccaa agaggccagu caagcuguuc aguggcagca acacacugca ucuggucucu 2940accaccaaaa cagaagugau cccaccucug guugagaaca ggcaguccug gucaacuugc 3000aagccucucu ucacuggaau gaacuacugu accacaggag cuuacuccaa cgccagcucc 3060acggagucug ccucuuacua cccacugaca ggggacacaa gguaugagcu ggagcugagg 3120cccacgggag aaguggagca guauucugcc acugcaaccu augaacuccu aaaagaggac 3180aagucuuugg uugacacauu gaaguuccua guucaagcag aaggagugca gcagucugaa 3240gcuacuguac uguucaaaua uaaucggaga agcaggaccu uaucuaguga aguccuaauu 3300ccaggguuug augucaacuu cgggacaaua cuaagaguua augaugaauc ugcuaaggac 3360aaaaacacuu acaaacucau ccuggacauu cagaacaaga aaaucacuga ggucucucuc 3420gugggccacu ugaguuauga uaaaaaggga gauggcaaga ucaaaggugu uguuuccaua 3480ccacguuugc aagcagaagc caggagugag guccacaccc acugguccuc caccaaacug 3540cucuuccaaa uggacucauc ugcuacagcu uacggcucaa caauuuccaa gagagugaca 3600uggcguuacg auaaugagau aauagaauuu gauuggaaca cgggaaccaa uguggauacc 3660aaaaaagugg ccuccaauuu cccuguggau cuuucccauu auccuagaau guugcaugag 3720uaugccaaug gucuccugga ucacagaguc ccucaaacag augugacuuu ucgggacaug 3780gguuccaaau uaauuguugc aacaaacaca uggcuucaga uggcaaccag gggucuuccu 3840uacccccaaa cucuacagga ucaccucaau agccucucag aguugaaccu ccugaaaaug 3900ggacugucug acuuccauau uccagacaac cucuuccuaa agacugaugg cagagucaaa 3960uacacaauga acaggaacaa aauaaacauu gacaucccuu ugccuuuggg uggcaagucu 4020ucaaaagacc ucaagaugcc agagagugug aggacaccag cccucaacuu caagucugug 4080ggauuccauc ugccaucucg agagguccag guccccacuu uuacaauccc caagacacau 4140cagcuucaag ugccucucuu ggguguucua gaccuuucca caaaugucua cagcaauuug 4200uacaacuggu cagccuccua cacugguggc aacaccagca gagaccacuu cagccuucag 4260gcucaguacc gcaugaagac ugacucugug guugaccugu uuuccuacag ugugcaagga 4320ucuggagaaa caacauauga cagcaagaac acauuuacau uguccuguga uggaucucua 4380caccauaaau uucuagacuc aaaauucaaa gucagccacg uagaaaaauu uggaaacagc 4440ccagucucaa aagguuuacu aacauuugaa acaucuagug ccuugggacc acagaugucu 4500gcuacuguuc accuagacuc aaaaaagaaa caacaucuau acgucaaaga uaucaagguu 4560gauggacagu ucagagcuuc uucauuuuau gcucaaggca aauauggccu gucuugugag 4620agagauguua caacuggcca gcugagcggc gaauccaaca ugagauuuaa cuccaccuac 4680uuccagggca ccaaccagau cgugggaaug uaccaggaug gagcccuguc caucaccucc 4740acuucugacc ugcaagaugg cauauucaag aacacagcuu ccuugaaaua ugaaaacuau 4800gagcugacuc ugaaaucuga uagcaguggg caguaugaga acuucgcugc uuccaacaag 4860cuggauguga ccuucucuac gcaaagugca cugcugcguu cugaacacca ggccaauuac 4920aagucccuga ggcuugucac ccuucuuuca ggaucccuca cuucccaggg uguagaauua 4980aaugcugaca ucuugggcac agacaaaauu aauacuggug cucacaaggc aacacuaaag 5040auugcacgug auggacuauc aaccagugcg accaccaacu ugaaguacag cccccugcug 5100cuggagaaug aguugaaugc agagcuuggg cucucugggg cauccaugaa auuaucaaca 5160aacggccgcu ucaaagaaca ccaugcaaaa uucagucuug augggagagc ugcccucaca 5220gaggugucac uggggagcau uuaccaggcc augauucugg gugcagacag caaaaacauc 5280uucaacuuca aacucagccg agaagggcug aggcugucca augauuugau gggcuccuau 5340gcugagauga aacuugacca cacacacagu cugaacauug caggucucuc acuggacuuc 5400uucucaaaaa uggacaauau uuacagugga gacaaguucu auaagcagaa uuuuaacuua 5460cagcuacagc ccuauucuuu cauaacuacu uuaagcaacg accugagaua uggugcucua 5520gauuugacca acaauggaag guuucggcug gagccacuga agcugaaugu ggguggcaac 5580uuuaaaggaa ccuaucaaaa uaaugagcug aaacauaucu auaccauauc uuauacugac 5640cugguaguag caaguuacag agcagacacu guggcuaagg uucagggugu cgaauucagc 5700cauaggcuaa augcagacau ugaaggacug acuuccucug uugaugucac uaccagcuac 5760aauucagauc cacugcauuu uaacaauguu uuccacuuuu cucuggcacc uuuuaccuug 5820ggcaucgaca cacauacaag uggugauggg aaacuguccu ucuggggaga acacacuggg 5880cagcuauaua guaaguuucu guugaaagca gaaccucugg cacuuauugu cucucaugac 5940uacaaaggau ccacaagcca cagucucccg uacgagagca gcaucagcac ggcucuugaa 6000cacacaguca gugccuugcu gacgccagcu gagcagacaa gcaccuggaa auucaagacc 6060aaacugaaug acaaaguaua cagccaggac uuugaagccu acaacacuaa agacaaaauc 6120gguguugagc uuaguggacg ggcugaccuc ucugggcugu auucuccaau uaaacuaccg 6180uuuuucuaca gugagccugu caauguccuu aauggcuuag agguaaauga ugcuguugac 6240aagccccaag aauucacaau uauugcugug gugaaguacg auaagaacca ggauguucac 6300accaucaacc ucccauucuu caaaagccug ccagacuauu uggagagaaa ucgaagagga 6360augauaaguc uacuggaagc caugcgaggg gaauugcaac gccucagugu ugaucaguuu 6420gugaggaaau acagagcggc ccugagcaga cuuccucagc agauucauca uuaucugaau 6480gcaucugacu gggagagaca aguagcuggu gccaaggaaa aaauaacuuc uuucauggaa 6540aauuauagaa uuacagauaa ugauguacua auugccauag auagugccaa aaucaacuuc 6600aaugaaaaac ucucucaacu ugagacauac gcgauacaau uugaucagua uauuaaagau 6660aauuaugauc cacaugacuu aaaaagaacu auugcugaga uuauugaucg aaucauugaa 6720aaguuaaaaa uucuugauga acaguaucau auccguguaa aucuagcaaa aucaauccau 6780aaucucuauu uauuuguuga aaacguugau cuuaaccaag ucaguaguag uaacaccucu 6840uggauccaaa auguggauuc caauuaucaa gucagaaucc aaauucaaga aaaacuacag 6900cagcucagga cacaaauuca gaauauagac auucagcagc uugcugcaga gguaaaacga 6960cagauggacg cuauugaugu cacaaugcau uuagaucaau ugagaacugc aauucuauuc 7020caaagaauaa gugacauuau ugaccguguc aaauacuuug uuaugaaucu uauugaagau 7080uuuaaaguaa cugagaaaau caauacuuuu agaguuauag uccgugagcu aauugagaaa 7140uaugaaguag accaacacau ccagguuuua auggauaaau caguagaguu ggcccacaga 7200uauagccuga gcgagccucu ucagaaacuc aguaaugugc uacagcgaau ugagauaaaa 7260gauuacuaug agaaauuggu uggguuuauu gaugauacug uugaguggcu uaaagcauug 7320ucuuucaaaa auaccauuga agaacuaaau agauugacug acauguuggu gaagaaguug 7380aaagcauuug auuaucacca guuuguagac aaaaccaaca gcaaaauccg ugagaugacu 7440cagagaauca augcugaaau ccaagcucuc aaacuuccac aaaaaaugga agcauuaaaa 7500cuguugguag aagacuucaa aaccacaguc uccaauuccc uggaaagacu caaggacacc 7560aaaguaacug uggucauuga uuggcugcag gauauuuuga cucaaaugaa agaccauuuc 7620caagauacuc uggaagaugu aagagaccga auuuaucaaa uggacauuca gagggaacug 7680gagcacuucu ugucucuggu aaaccaaguu uacaguacac uggucaccua uaugucugac 7740ugguggacuc ugacugcuaa aaacauaaca gacuuugcag agcaauauuc cauccaaaac 7800ugggcugaga guauaaaagu acugguggaa caaggauuca uaguuccuga aaugcaaaca 7860uuucugugga ccaugccugc uuuugagguc agucuccgug cucuccaaga agguaacuuu 7920cagaccccug ucuuuauagu ccccuugaca gauuugagga uuccaucaau ucggauaaac 7980uuuaaaaugu uaaagaauau aaaaauccca uugagauuuu ccacuccaga auucacucuu 8040cucaacaccu uccaugucca uuccuuuaca auugacuugc uggaaauaaa agcaaagauc 8100auuagaacua ucgaccaaau uuugagcagu gagcuacagu ggccucuucc agaaauguau 8160uugagagacc uggauguagu gaacauuccu cuugcaagac ugacucugcc agacuuccau 8220guaccagaaa ucacaauucc agaauucaca aucccaaaug ucaaucucaa agauuuacac 8280guuccugauc uucacauacc agaauuccaa cuuccucacc ucucacauac aauugaaaua 8340ccugcuuuug gcaaacugca uagcauccuu aagauccaau cuccucucuu uauauuagau 8400gcuaaugcca acauacagaa uguaacaacu ucagggaaca aagcagagau uguggcuucu 8460gucacugcua aaggagaguc ccaauuugaa gcucucaauu uugauuuuca agcacaagcu 8520caauuccugg aguuaaaucc ucauccucca guccugaagg aauccaugaa cuucuccagu 8580aagcauguga gaauggagca ugagggugag auaguauuug auggaaaggc cauugagggg 8640aaaucagaca cagucgcaag uuuacacaca gagaaaaaug aaguagaguu uaauaauggu 8700augacuguca aaguaaacaa ucagcucacc cuugacaguc acacaaagua cuuccacaag 8760uugaguguuc cuaggcugga cuucuccagu aaggcuucuc uuaauaauga aaucaagaca 8820cuauuagaag cuggacaugu ggcauugaca ucuucaggga cagggucaug gaacugggcc 8880ugucccaacu ucucggauga aggcauacau ucgucccaaa uuagcuuuac uguggauggu 8940cccauugcuu uuguuggacu auccaauaac auaaauggca aacacuuacg ggucauccaa 9000aaacugacuu augaaucugg cuuccucaac uauucuaagu uugaaguuga gucaaaaguu 9060gaaucucagc acgugggcuc cagcauucua acagccaaug gucgggcacu gcucaaggac 9120gcaaaggcag aaaugacugg ugagcacaau gccaacuuaa auggaaaagu uauuggaacu 9180uugaaaaauu cucucuucuu uucagcacaa ccauuugaga uuacugcauc cacaaauaau 9240gaaggaaauu ugaaaguggg uuuuccacua aagcugacug ggaaaauaga cuuccugaau 9300aacuaugcau uguuucugag uccccgugcc caacaagcaa gcuggcaagc gaguaccaga 9360uucaaucagu acaaauacaa ucaaaacuuu ucugcuauaa acaaugaaca caacauagaa 9420gccaguauag gaaugaaugg agaugccaac cuggauuucu uaaacauacc uuuaacaauu 9480ccugaaauua acuugccuua cacggaguuc aaaacucccu uacugaagga uuucuccaua 9540ugggaagaaa caggcuugaa agaauuuuug aagacaacaa agcaaucauu ugauuugagu 9600guaaaggcuc aauauaaaaa gaacagugac aagcauucca uuguuguccc ucuggguaug 9660uuuuaugaau uuauucucaa caaugucaau ucgugggaca gaaaauuuga gaaagucaga 9720aacaaugcuu uacauuuucu uaccaccucc uauaaugaag caaaaauuaa gguugauaag 9780uacaaaacug aaaauucccu uaaucagccc ucugggaccu uucaaaauca uggcuacacu 9840aucccaguug ucaacauuga aguaucucca uuugcuguag agacacuggc uuccagccau 9900gugaucccca cagcaauaag caccccaagu gucacaaucc cugguccuaa caucauggug 9960ccuucauaca aguuagugcu gccaccccug gaguugccag uuuuccaugg uccugggaau 10020cuauucaagu uuuuccuccc agauuucaag ggauucaaca cuauugacaa uauuuauauu 10080ccagccaugg gcaacuuuac cuaugacuuu ucuuuuaaau caagugucau cacacugaau 10140accaaugcug gacuuuauaa ccaaucagau aucguugccc auuuccuuuc uuccucuuca 10200uuugucacug acgcccugca guacaaauua gagggaacau cacgucugau gcgaaaaagg 10260ggauugaaac uagccacagc ugucucucua acuaacaaau uuguaaaggg cagucaugac 10320agcaccauua guuuaaccaa gaaaaacaug gaagcaucag ugagaacaac ugccaaccuc 10380caugcuccca uauucucaau gaacuucaag caggaacuua auggaaauac caagucaaaa 10440cccacuguuu caucauccau ugaacuaaac uaugacuuca auuccucaaa gcugcacucu 10500acugcaacag gaggcauuga ucacaaguuc agcuuagaaa gucucacuuc cuacuuuucc 10560auugagucau ucaccaaagg aaauaucaag aguuccuucc

uuucucagga auauucagga 10620aguguugcca augaagccaa uguauaucug aauuccaagg guacucgguc uucagugagg 10680cuacaaggag cuuccaaagu ugaugguauc uggaacguug aaguaggaga aaauuuugcu 10740ggagaagcca cccuccaacg caucuacacc acaugggagc acaauaugaa aaaccauuug 10800cagguauaua gcuacuucuu cacaaaagga aagcaaacau gcagagcuac uuuggagcuc 10860uccccaugga ccaugucaac cuugcuacag guucauguga gucaacucag uucccuccuu 10920gaccuccauc acuuugacca ggaagugauc cuaaaagcua acacuaagaa ccagaagauc 10980agcuggaaag guggggucca gguugaauca cggguucuuc agcacaaugc acaguucucc 11040aaugaccaag aagaaauacg gcuugaccuu gcaggauccu uagacggaca gcugugggac 11100cuugaagcua ucuuuuuacc aguauauggc aagagcuugc aggaacuccu acaaauggau 11160ggaaagcgac aguaucuuca agcuucaacu ucucuucuau auaccaaaaa cccuaauggc 11220uaucuccucu cacuccccgu gcaagaacug gcugauagau uuauuauacc agggauaaaa 11280cuaaaugacu ucaguggagu aaaaaucuau aagaaguuaa guacuucacc auuugcccuc 11340aaccuaacaa ugcuccccaa aguaaaauuc ccugggauug aucuguuaac acaguacucu 11400acaccagagg gcuccucugu cccuauuuuu gaggcaacua uaccugaaau ucauuuaacu 11460guaucccagu uuacacuucc aaagagccuu ccaguuggca acacagucuu ugaucugaau 11520aaguuggcca acaugauugc cgauguugac cugccuagug ucacccugcc ugagcagacu 11580auuguaaucc cacccuugga guucucugua ccugcuggga uuuuuauucc uuucuuugga 11640gaacugacug cacgugcugg gauggcuucu ccccuguaua augucacuug gagcgcuggu 11700uggaaaacca aagcagauca uguugaaacg uuccuagauu ccaugugcac uucaaccuug 11760caguuucugg aguaugcuuu aaaaguugua gaaacacaca aaauugaaga agaucuguua 11820accuauaaua ucaaaggaac acuucaacac ugugacuuca auguggagua uaaugaagau 11880ggucuauuua aaggacuuug ggacuggcag ggagaggcuc accuggacau caccagccca 11940gcacugacug acuuucaucu guacuacaaa gaagacaaga caagucuguc ugccucagca 12000gccuccucga ccaucggcac ugugggucug gauucgagca cagaugacca gaguguggag 12060cugaaugucu acuuccaccc acaguccccu ccagagaaga aacucagcau auucaaaacu 12120gaguggaggu acaaggaguc ugauggugaa agguacauca aaauuaauug ggaagaagag 12180gcagcuucca gauugcuagg cucccuaaaa agcaaugugc ccaaggcuuc uaaggcuauu 12240uaugauuaug ccaauaagua ccaccuggaa uacguuucuu cagaacuaag aaaaagucua 12300caggucaaug cugaacaugc cagaaggaug guugaugaaa ugaacaugag uuuccagaga 12360guagcccgug auaccuacca gaaucucuau gaggagaugu uggcucagaa gagccugagc 12420aucccugaga aucucaagaa gaggguguua gacaguauag uacauguuac ucagaaguac 12480cacauggcag ucauguggcu gauggacuca uucauucauu uucugaaauu caauagaguc 12540caguucccag gguacgcugg aacauauacu guggacgaac ucuacacuau agucaugaag 12600gaaaccaaga agucacuguc ucagcuguuu aauggguuag gaaaccuacu uuccuacguu 12660caaaaccaag uagagaaauc aagauuaauc aaugacauaa cauuuaaaug uccuuuuuuc 12720ucaaaaccuu guaaacuaaa agaucucaua uugauuuuca gggaggaguu aaacauuuua 12780ucaaacauag gccaacagga uaucaaguuu acaacaauac uaaguagucu ucagggcuuu 12840uuggagagag uuuuagacau cauagaagaa caaauuaaau gccuaaagga caaugaaucu 12900acuuguguug cugaccauau caacaugguu uucaaaauac aggucccaua ugcuuuuaaa 12960ucccuaagag aagacauaua cuuuguccuc ggugaguuca augacuuucu ucaauccaua 13020cuucaggagg gguccuacaa gcuacagcag guccaucagu auaugaaggc ccuucgugaa 13080gaguauuuug auccgagcau gguugggugg acagugaaau auuaugaaau agaagaaaau 13140augguugagc ugaucaagac ccuuuuaguu uccuuuaggg augucuacuc ugaauauagu 13200gugacagcug cugauuuugc uuccaaaaug ucaacucaag uugaacaauu uguguccagg 13260gauaucagag aguaucuuag caugcuuacu gauauaaaug gaaaguggau ggaaaagauu 13320gcagagcuuu cuauuguggc aaaggaaaca augaaaagcu gggucacugc cguggccaaa 13380auaaugucug auuaccccca gcaguuccac uccaaucugc aggauuuuuc agaccaacuc 13440ucuagcuacu augaaaaauu uguuggugag uccacaagau ugauugaccu guccauucaa 13500aacuaccacg uguuucucag auacaucacc gaguuacuga gaaagcugca gguggccaca 13560gccaauaaug ugagccccua uauaaagcuu gcucaaggag agcugaugau caccuucuga 13620uucaucuacu aacaaauuca aauuaaaccu ucacauagua ggagacuuug uagacuacua 13680uaaagaccau ccugagccag accugcaguc aacagcaaga gcaagaagca cauaggaacu 13740auaccugcaa ccaagcuggc auaagaacca agaccuucaa agcagccuga acucaagaug 13800acauauuuua caaguuagag uaaagucaag agcugaguug uuuuguccaa cucaggaugg 13860agggagggag ggaaggggaa auaaauaaau acuuccuuau ugugcagcaa aaaaaaaaaa 13920aaaaaaaaaa a 139311121RNAAequorea victoria 11gggcagcuug ccgguggugu u 211221RNAAequorea victoria 12caccaccccg gugaacagcu u 211321RNAAequorea victoria 13gcuguucacg ucgcugcccu u 211419DNAAequorea victoria 14gctgttcacg tcgctgccc 191580DNAArtificial SequenceOligo for MV-siRNA expressing clones 15gatcccccac caccccggtg aacagcgtta gctgttcacg tcgctgcccg ttagggcagc 60ttgccggtgg tgttttttta 801675DNAArtificial SequenceOligo for MV-siRNA expressing clones 16agcttaacac caccggcaag ctgccctaac gggcagcgac gtgaacagct aacgctgttc 60accggggtgg tgggg 7517144DNAArtificial SequenceOligo for MV-siRNA expressing clones 17gatcccccac caccccggtg aacagcttgt aggtggcatc gcagaagcga tgccacctac 60aagctgttca cgtcgctgcc cttgtaggtg gcatcgcaga agcgatgcca cctacaaggg 120cagcttgccg gtggtgtttt ttta 14418139DNAArtificial SequenceOligo for MV-siRNA expressing clones 18agcttaacac caccggcaag ctgcccttgt aggtggcatc gcttctgcga tgccacctac 60aagggcagcg acgtgaacag cttgtaggtg gcatcgcttc tgcgatgcca cctacaagct 120gttcaccggg gtggtgggg 1391989DNAArtificial SequenceOligo for MV-siRNA expressing clones 19gatcccccgt gctgcttcat gtggtcgttg ttacgaccac aatggcgaca accttgttag 60gttgtcgggc agcagcacgt tttttttta 892084DNAArtificial SequenceOligo for MV-siRNA expressing clones 20agcttaaaac gtgctgctgc ccgacaacct aacaaggttg tcgccattgt ggtcgtaaca 60acgaccacat gaagcagcac gggg 8421147DNAArtificial SequenceOligo for MV-siRNA expressing clones 21gatcccccgt gctgcttcat gtggtcgttg taggtggcat cgcagaagcg atgccaccta 60caacgaccac aatggcgaca accttgtagg tggcatcgca gaagcgatgc cacctacaag 120gttgtcgggc agcagcacgt tttttta 14722142DNAArtificial SequenceOligo for MV-siRNA expressing clones 22agcttaacgt gctgctgccc gacaaccttg taggtggcat cgcttctgcg atgccaccta 60caaggttgtc gccattgtgg tcgttgtagg tggcatcgct tctgcgatgc cacctacaac 120gaccacatga agcagcacgg gg 1422362DNAArtificial SequenceOligo for MV-siRNA expressing clones 23gatccccgca agctgaccct gaagttcttc aagagagaac ttcagggtca gcttgctttt 60ta 622462DNAArtificial SequenceOligo for MV-siRNA expressing clones 24agcttaaaaa gcaagctgac cctgaagttc tctcttgaag aacttcaggg tcagcttgcg 60gg 622521RNAArtificial Sequencesynthetic siRNA 25cugcugguag uggucggcgu u 212621RNAArtificial Sequencesynthetic siRNA 26cgccgacuuc gugacgugcu u 212721RNAArtificial Sequencesynthetic siRNA 27gcacgucgcc guccagcagu u 212821RNAArtificial Sequencesynthetic siRNA 28guugccgucg uccuugaagu u 212921RNAArtificial Sequencesynthetic siRNA 29cuucaagugg aacuacggcu u 213021RNAArtificial Sequencesynthetic siRNA 30gccguaggua ggcggcaacu u 213167RNAArtificial Sequencemultivalent-siRNA clones 31cgccgacuuc gugacgugcu ugugcacguc gccguccagc aguugucugc ugguaguggu 60cggcguu 673280DNAArtificial Sequencemultivalent-siRNA clones 32gatcccccgc cgacttcgtg acgtgcttgt gcacgtcgcc gtccagcagt tgtctgctgg 60tagtggtcgg cgttttttta 803380DNAArtificial Sequencemultivalent-siRNA clones 33agcttaaaaa aacgccgacc actaccagca gacaactgct ggacggcgac gtgcacaagc 60acgtcacgaa gtcggcgggg 8034131RNAArtificial Sequencemultivalent-siRNA clones 34cgccgacuuc gugacgugcu uguagguggc aucgcagaag cgaugccacc uacaagcacg 60ucgccgucca gcaguuguag guggcaucgc agaagcgaug ccaccuacaa cugcugguag 120uggucggcgu u 13135142DNAArtificial Sequencemultivalent-siRNA clones 35gatcccccgc cgacttcgtg acgtgcttgt aggtggcatc gcagaagcga tgccacctac 60aagcacgtcg ccgtccagca gttgtaggtg gcatcgcaga agcgatgcca cctacaactg 120ctggtagtgg tcggcgtttt ta 14236142DNAArtificial Sequencemultivalent-siRNA clones 36agcttaaaaa cgccgaccac taccagcagt tgtaggtggc atcgcttctg cgatgccacc 60tacaactgct ggacggcgac gtgcttgtag gtggcatcgc ttctgcgatg ccacctacaa 120gcacgtcacg aagtcggcgg gg 1423767RNAArtificial Sequencemultivalent-siRNA clones 37cuucaagugg aacuacggcu ugugccguag guaggcggca acuuguguug ccgucguccu 60ugaaguu 673860DNAArtificial Sequencemultivalent-siRNA clones 38gatccccgga tccgacatcc acgttcttca agagagaacg tggatgtcgg atccttttta 603960DNAArtificial Sequencemultivalent-siRNA clones 39agcttaaaaa ggatccgaca tccacgttct ctcttgaaga acgtggatgt cggatccggg 6040131RNAArtificial Sequencemultivalent-siRNA clones 40cuucaagugg aacuacggcu uguagguggc aucgcagaag cgaugccacc uacaagccgu 60agguaggcgg caacuuguag guggcaucgc agaagcgaug ccaccuacaa guugccgucg 120uccuugaagu u 13141142DNAArtificial Sequencemultivalent-siRNA clones 41gatccccctt caagtggaac tacggcttgt aggtggcatc gcagaagcga tgccacctac 60aagccgtagg taggcggcaa cttgtaggtg gcatcgcaga agcgatgcca cctacaagtt 120gccgtcgtcc ttgaagtttt ta 14242142DNAArtificial Sequencemultivalent-siRNA clones 42agcttaaaaa cttcaaggac gacggcaact tgtaggtggc atcgcttctg cgatgccacc 60tacaagttgc cgcctaccta cggcttgtag gtggcatcgc ttctgcgatg ccacctacaa 120gccgtagttc cacttgaagg gg 1424377DNAArtificial SequenceAnti-HIV MV-siRNA oligo 43gatccccgtg aaggggaacc aagagattga tctcttgtta atatcagctt gagctgatat 60ttctccttca cttttta 774477DNAArtificial SequenceAnti-HIV MV-siRNA oligo 44agcttaaaaa gtgaaggaga aatatcagct caagctgata ttaacaagag atcaatctct 60tggttcccct tcacggg 774580DNAArtificial SequenceAnti-HIV MV-siRNA oligo 45gatcccccaa gcagttttag gctgacgtta gtcagcctca ttgacacagg ttactgtgtc 60agctgctgct tgttttttta 804680DNAArtificial SequenceAnti-HIV MV-siRNA oligo 46agcttaaaaa aacaagcagc agctgacaca gtaacctgtg tcaatgaggc tgactaacgt 60cagcctaaaa ctgcttgggg 804721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 47gccuucccuu gugggaaggu u 214821RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 48ccuucccuug ugggaaggcu u 214921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 49gccuuccuug ugggaaggcu u 215021RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 50uucugcaccu uaccucuuau u 215121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 51uaagaggaag uaugcuguuu u 215221RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 52aacagcaguu guugcagaau u 215321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 53ccagacaaua auugucuggu u 215421RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 54cucccaggcu cagaucuggu u 215521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 55ccagaucuuc ccuaaaaaau u 215621RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 56uuuuuuaucu gccugggagu u 215721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 57uggguucccu aguuagccau u 215821RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 58uggcuaagau cuacagcugu u 215921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 59cagcuguccc aagaacccau u 216021RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 60auccuuugau gcacacaauu u 216121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 61auugugucac uuccuucagu u 216221RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 62cugaaggaag cuaaaggauu u 216321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 63uccuguguca gcugcugcuu u 216421RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 64agcagcauug uuagcugcuu u 216521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 65agcagcuuua uacacaggau u 216621RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 66accaacaagg uuucugucau u 216721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 67ugacagaucu aauuacuacu u 216821RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 68guaguaauua ucuguugguu u 216921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 69cugagggaag cuaaaggauu u 217021RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 70caaagcuaga ugaauugcuu u 217121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 71agcaauuggu acaagcaguu u 217221RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 72acugcuuguu agagcuuugu u 217321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 73aggucagggu cuacuugugu u 217421RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 74cacaagugcu gauauuucuu u 217521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 75agaaauaauu gucugaccuu u 217621RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 76cuaaguuaug gagccauauu u 217721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 77auauggccug auguaccauu u 217821RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 78augguacuuc ugaacuuagu u 217921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 79uggcuccauu ucuugcucuu u 218021RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 80agagcaaccc caaauccccu u 218121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 81ggggauuuag ggggagccau u 218221RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 82aucuccacaa gugcugauau u 218321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 83uaucagcagu ucuugaaguu u 218421RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 84acuucaaauu guuggagauu u 218521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 85agacugugac ccacaauuuu u 218621RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 86aaauugugga ugaauacugu u 218721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 87caguauuugu cuacagucuu u 218821RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 88acaggccugu guaaugacuu u 218921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 89agucauuggu cuuaaagguu u 219021RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 90accuuuagga caggccuguu u 219121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 91ucaguguuau uugacccuuu u 219221RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 92aagggucuga gggaucucuu u 219321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences

93agagaucuuu ccacacugau u 219421RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 94cauagugcuu ccugcugcuu u 219521RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 95agcagcauug uuagcugcuu u 219621RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 96agcagcuaac agcacuaugu u 219721RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 97gcugcuuaua ugcaggaucu u 219821RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 98gauccugucu gaagggaugu u 219921RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 99caucccuguu aaaagcagcu u 2110021RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 100uggucuaacc agagagaccu u 2110121RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 101ggucucuuuu aacauuugcu u 2110221RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 102gcaaauguuu ucuagaccau u 2110321RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 103cucccaggcu cagaucuggu u 2110421RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 104uggguucccu aguuagccau u 2110521RNAArtificial SequenceTrivalent MV-siRNA to ApoB 105uggaacuuuc agcuucauau u 2110621RNAArtificial SequenceTrivalent MV-siRNA to ApoB 106uaugaaggca ccaugauguu u 2110721RNAArtificial SequenceTrivalent MV-siRNA to ApoB 107acaucaucuu ccaguuccau u 2110821RNAArtificial SequenceTrivalent MV-siRNA to ApoB 108acucuucaga guucuugguu u 2110921RNAArtificial SequenceTrivalent MV-siRNA to ApoB 109accaagaccu uggagacacu u 2111021RNAArtificial SequenceTrivalent MV-siRNA to ApoB 110gugucucagu uggaagaguu u 2111121RNAArtificial SequenceTrivalent MV-siRNA to ApoB 111accuggacau ggcagcugcu u 2111221RNAArtificial SequenceTrivalent MV-siRNA to ApoB 112gcagcugcaa acucuucagu u 2111321RNAArtificial SequenceTrivalent MV-siRNA to ApoB 113cugaagacgu auuccagguu u 2111421RNAArtificial SequenceTrivalent MV-siRNA to ApoB 114caggguaaag aacaauuugu u 2111521RNAArtificial SequenceTrivalent MV-siRNA to ApoB 115caaauugcug uagacauuuu u 2111621RNAArtificial SequenceTrivalent MV-siRNA to ApoB 116aaauguccag cguacccugu u 2111723RNAArtificial SequenceTrivalent MV-siRNA to ApoB 117cccuggacac cgcuggaacu uuu 2311823RNAArtificial SequenceTrivalent MV-siRNA to ApoB 118aaguuccaau aacuuuucca uuu 2311923RNAArtificial SequenceTrivalent MV-siRNA to ApoB 119auggaaaagg caaguccagg guu 2312024RNAArtificial SequenceTrivalent MV-siRNA to ApoB 120cccuggacac cgcuggaacu uuuu 2412124RNAArtificial SequenceTrivalent MV-siRNA to ApoB 121aaaguuccaa uaacuuuucc auuu 2412224RNAArtificial SequenceTrivalent MV-siRNA to ApoB 122auggaaaaug gcaaguccag gguu 2412321RNAArtificial SequenceBivalent MV-siRNA oligo to ApoB 123ugaaucgagu ugcaucuuuu u 2112421RNAArtificial SequenceBivalent MV-siRNA oligo to ApoB 124aaagaugcug cucaucacau u 2112521RNAArtificial SequenceBivalent MV-siRNA oligo to ApoB 125ugugaugaca cucgauucau u 2112623RNAArtificial SequenceBivalent MV-siRNA oligo to ApoBmodified_base2,7n = any base, universal base, rSpacer, linker phosphoramidite, 5-nitrodole, PC Spacer, or abasic base 126unguganuga cacucgauuc auu 2312719DNAArtificial SequenceBivalent MV-siRNA oligo to ApoB 127tgtgatgaca ctcgattca 1912821RNAArtificial SequenceBivalent MV-siRNA oligo to ApoB 128cagcuugagu ucguaccugu u 2112921RNAArtificial SequenceBivalent MV-siRNA oligo to ApoB 129cagguacaga gaacuccaau u 2113021RNAArtificial SequenceBivalent MV-siRNA oligo to ApoB 130uuggagucug accaagcugu u 2113121RNAArtificial SequenceBivalent MV-siRNA oligo to ApoBmodified_base13, 19n = any base, universal base, rSpacer, linker phosphoramidite, 5-nitrodole, PC Spacer, or abasic base 131uuggagucug acnaagcunu u 2113219DNAArtificial SequenceBivalent MV-siRNA oligo to ApoB 132ttggagtctg accaagctg 1913321RNAArtificial SequenceTrivalent MV-siRNA oligonucleotide to ApoB 133ucagggccgc ucuguauuuu u 2113421RNAArtificial SequenceTrivalent MV-siRNA oligonucleotide to ApoB 134aaauacauuu cuggaagagu u 2113521RNAArtificial SequenceTrivalent MV-siRNA oligonucleotide to ApoB 135cucuuccaaa aagcccugau u 2113665RNAArtificial SequenceTrivalent MV-siRNA oligonucleotide to ApoBmodified_base22, 44n = any base, universal base, rSpacer, linker phosphoramidite, 5-nitrodole, PC Spacer, or abasic base 136aaauacauuu cuggaagagu uncucuucca aaaagcccug auunucaggg ccgcucugua 60uuuuu 6513721RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoB 137aacccacuuu caaauuuccu u 2113821RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoB 138ggaaauugag aauucuccau u 2113921RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoB 139uggagaaucu caguggguuu u 2114021RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoBmodified_base5,13,18n = any base, universal base, rSpacer, linker phosphoramidite, 5-nitrodole, PC Spacer, or abasic basemisc_feature1,2,3,7,8,9,10,11,12,15,16,17,20,21Bases have an rSpace linkagemodified_base4,6,14,19Bases have a 2'-fluoro modification 140ugganaaucu canugggnuu u 2114121RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoB 141gaugaugaaa caguggguuu u 2114221RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoB 142ggaaauugga gacaucaucu u 2114321RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoBmodified_base1,15n = any base, universal base, rSpacer, linker phosphoramidite, 5-nitrodole, PC Spacer, or abasic basemisc_feature2,6,7,8,9,10,11,12,13,16,18,19,20,21Bases have an rSpace linkagemodified_base3,4,5,14,17Bases have a 2'-fluoro modification 143ngaaauugga gacancaucu u 2114421RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoB 144gcaaacucuu cagaguucuu u 2114521RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoB 145agaacuccaa gggugggauu u 2114621RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoB 146aucccacuuu caaguuugcu u 2114719RNAArtificial Sequencemultivalent-siRNA oligonucleotide targeted to ApoBmodified_base2,14,18n = any base, universal base, rSpacer, linker phosphoramidite, 5-nitrodole, PC Spacer, or abasic basemisc_feature3,4,5,6,7,8,9,10,11,12,16,17,19Bases have an rSpace linkagemodified_base1,13,15Bases have a 2'-fluoro modification 147ancccacuuu caanuuunc 1914821RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 148cuucaucacu gaggccucuu u 2114921RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 149agaggccaag cucugcauuu u 2115021RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 150aaugcagaug aagaugaaga a 2115121RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 151uucagccugc auguuggcuu u 2115221RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 152agccaacuau acuuggaucu u 2115321RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 153gauccaaaag caggcugaag a 2115421RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 154cccucaucug agaaucuggu u 2115521RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 155ccagauucau aaaccaaguu u 2115621RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 156acuugguggc ccaugagggu u 2115721RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 157ucaagaauuc cuucaagccu u 2115821RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 158ggcuugaagc gaucacacuu u 2115921RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 159agugugaacg uauucuugau u 2116021RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 160uugcaguuga uccugguggu u 2116121RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 161ccaccaggua ggugaccacu u 2116221RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 162guggucagga gaacugcaau u 2116321RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 163ccuccagcuc aaccuugcau u 2116421RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 164ugcaaggucu caaaaaaugu u 2116521RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 165cauuuuugau cucuggaggu u 2116621RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 166caggauguaa guagguucau u 2116721RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 167ugaaccuuag caacaguguu u 2116821RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 168acacugugcc cacauccugu u 2116921RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 169ggcuugaagc gaucacacuu u 2117021RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 170agugugaacg uauucuuguu u 2117121RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 171acaagaauuc cuucaagccu u 2117221RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 172ugaagagauu agcucucugu u 2117321RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 173cagagaggcc aagcucugcu u 2117421RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 174gcagagcugg cucucuucau u 2117521RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 175cucaguaacc agcuuauugu u 2117621RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 176caauaagauu uauaacaaau u 2117721RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 177uuuguuaucu uauacugagu u 2117821RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 178gaaccaaggc uuguaaaguu u 2117921RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 179acuuuacaaa agcaacaauu u 2118021RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 180auuguuguua aauugguucu u 2118121RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 181cagguaggug accacaucuu u 2118221RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 182agaugugacu gcuucaucau u 2118321RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 183ugaugaacug cgcuaccugu u 2118421RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 184ccagucgcuu aucucccggu u 2118521RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 185ccgggagcaa ugacuccagu u 2118621RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 186cuggagucau ggcgacuggu u 2118721RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 187uggaagagaa acagauuugu u 2118821RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 188caaaucuuua aucagcuucu u 2118921RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 189gaagcugccu cuucuuccau u 2119021RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 190auccaaaggc agugaggguu u 2119121RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 191acccucaacu caguuuugau u 2119221RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 192ucaaaaccgg aauuuggauu u 2119321RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 193uagagacacc aucaggaacu u 2119421RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 194guuccuggag agucuucaau u 2119521RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 195uugaagaauu aggucucuau u 2119621RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 196gcucauguuu aucaucuuuu u 2119721RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 197aaagaugcug aacuuaaagu u 2119821RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 198cuuuaagggc aacaugagcu u 2119921RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted

to Human ApoB 199ggagcaauga cuccagaugu u 2120021RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 200caucuggggg auccccugcu u 2120121RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 201gcaggggagg uguugcuccu u 2120221RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 202ucacaaacuc cacagacacu u 2120321RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 203gugucugcuu uauagcuugu u 2120421RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 204caagcuaaag gauuugugau u 2120521RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 205gcagcuugac uggucucuuu u 2120621RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 206aagagacucu gaacugcccu u 2120721RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 207gggcagugau ggaagcugcu u 2120821RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 208caggacugcc uguucucaau u 2120921RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 209uugagaacuu cuaauuuggu u 2121021RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 210ccaaauuuga aaaguccugu u 2121121RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 211uguaggccuc aguuccagcu u 2121221RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 212gcuggaauuc ugguaugugu u 2121321RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 213cacauaccga augccuacau u 2121421RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 214gacuucacug gacaaggucu u 2121521RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 215gaccuugaag uugaaaaugu u 2121621RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 216cauuuucugc acugaagucu u 2121721RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 217aagcaguuug gcaggcgacu u 2121821RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 218gucgccuugu gagcaccacu u 2121921RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 219guggugccac ugacugcuuu u 2122021RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 220cagaugaguc cauuuggagu u 2122121RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 221cuccaaacag ugccaugccu u 2122221RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 222ggcauggagc cuucaucugu u 2122321RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 223cacagacuug aaguggaggu u 2122421RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 224ccuccacuga gcagcuugau u 2122521RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 225ucaagcuuca aagucugugu u 2122621RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 226auggcagaug gaaucccacu u 2122721RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 227gugggaucac cuccguuuuu u 2122821RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 228aaaacgguuu cucugccauu u 2122921RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 229ugauacaacu ugggaauggu u 2123021RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 230ccauucccua ugucagcauu u 2123121RNAArtificial SequenceMultivalent-siRNA Oligonucleotide Targeted to Human ApoB 231augcugacaa auuguaucau u 2123221RNAArtificial SequenceTrivalent MV-siRNA oligo sequences 232auugugucac uucccucagu u 21

* * * * *

References


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed