U.S. patent application number 16/048389 was filed with the patent office on 2018-12-06 for monoclonal antibody against novel epitopes of foot-and-mouth disease virus protein 3abc and uses thereof.
The applicant listed for this patent is The Government of the United States of America, as Represented by the Secretary of Homeland Security, THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF AGRICULTURE, THE TEXAS A&M UNIVERSITY SYSTEM, THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF AGRICULTURE. Invention is credited to MANGKEY A. BOUNPHENG, THOMAS G. BURRAGE, ALFONSO CLAVIJO, BROOKE A. DANCHO, AIDA ELIZABETH RIEDER, ABU SAYED, SABENA UDDOWLA BLAKENEY.
Application Number | 20180346553 16/048389 |
Document ID | / |
Family ID | 59386420 |
Filed Date | 2018-12-06 |
United States Patent
Application |
20180346553 |
Kind Code |
A1 |
CLAVIJO; ALFONSO ; et
al. |
December 6, 2018 |
MONOCLONAL ANTIBODY AGAINST NOVEL EPITOPES OF FOOT-AND-MOUTH
DISEASE VIRUS PROTEIN 3ABC AND USES THEREOF
Abstract
This disclosure pertains to isolated antibodies or antigen
binding fragments thereof that specifically bind to the 3ABC
non-structural protein of Foot-and-Mouth Disease virus (FMDV),
wherein the antibodies or antigen binding fragments thereof
recognize the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 3,
SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 12.
Accordingly, this disclosure also pertains to polypeptides having
an amino acid sequence selected from SEQ ID NO: 2, SEQ ID NO: 3,
SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 12. Monoclonal antibody
Mab 40C8 is also provided. The current disclosure also pertains to
methods of detecting FMDV infection in an animal (including assays
differentiating infected animals from vaccinated animals (DIVA))
and kits for performing the detection methods. Competitive ELISA
kits comprising the antibody or antigen binding fragment thereof
and immunoassay plates coated with the polypeptide comprising the
amino acid sequence selected from SEQ ID NO: 2, SEQ ID NO: 3, SEQ
ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and/or SEQ ID NO: 12 are also
provided.
Inventors: |
CLAVIJO; ALFONSO; (RIO DE
JANEIRO, BR) ; RIEDER; AIDA ELIZABETH; (WESTBROOK,
CT) ; SAYED; ABU; (EAST LYME, CT) ; BOUNPHENG;
MANGKEY A.; (AUSTIN, TX) ; BURRAGE; THOMAS G.;
(GUILFORD, CT) ; DANCHO; BROOKE A.; (ATHENS,
GA) ; UDDOWLA BLAKENEY; SABENA; (LANHAM, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE TEXAS A&M UNIVERSITY SYSTEM
THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF
AGRICULTURE
The Government of the United States of America, as Represented by
the Secretary of Homeland Security |
COLLEGE STATION
WASHINGTON
WASHINGTON |
TX
DC
DC |
US
US
US |
|
|
Family ID: |
59386420 |
Appl. No.: |
16/048389 |
Filed: |
July 30, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15010278 |
Jan 29, 2016 |
10035841 |
|
|
16048389 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 2319/21 20130101;
C12N 2770/32134 20130101; C07K 16/1009 20130101; G01N 33/56983
20130101; G01N 2333/09 20130101; C07K 2317/34 20130101; C12N
2770/32122 20130101 |
International
Class: |
C07K 16/10 20060101
C07K016/10; G01N 33/569 20060101 G01N033/569 |
Goverment Interests
[0002] This invention was made with Government support under
HSHQDC-11-X-00189 and HSHQDC-09-X-00369 awarded by the United
States Department of Homeland Security Science and Technology (DHS
S&T) to the U.S. Department of Agriculture, and under
2007-ST-061-000002-02 and HSHQDC-11-J-00452, awarded by DHS S&T
to Texas A&M AgriLife Research. The Government has certain
rights in the invention.
Claims
1. An isolated monoclonal antibody or antigen binding fragment
thereof that specifically binds to 3ABC non-structural protein of
Foot-and-Mouth Disease virus (FMDV), wherein the antibody or
antigen binding fragment thereof specifically binds an epitope
consisting essentially of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5,
SEQ ID NO: 6 or SEQ ID NO: 12.
2. The antibody or antigen binding fragment thereof of claim 1 that
specifically binds the amino acid sequence of SEQ ID NO: 3, SEQ ID
NO: 6, or SEQ ID NO: 12 as the epitope.
3. The antibody or antigen binding fragment thereof of claim 1 that
specifically binds the amino acid sequence of SEQ ID NO: 4 as the
epitope.
4. The antibody or antigen binding fragment thereof of claim 1 that
specifically binds the amino acid sequence of SEQ ID NO: 5 as the
epitope.
5. The antibody or antigen binding fragment thereof of claim 1,
wherein the antibody is selected from a chimeric antibody, a single
chain antibody, a single chain fragment variable (scFv) antibody,
or a fragment antigen-binding (Fab fragment).
6. The antibody or antigen binding fragment thereof of claim 1,
wherein the antibody or antigen binding fragment thereof is
conjugated to a label.
7. A method of detecting FMDV infection in an animal, the method
comprising contacting a sample from an animal with a monoclonal
antibody according to claim 1.
8. The method of claim 7, wherein the sample obtained from the
animal is a body-fluid sample or a tissue sample.
9. The method of claim 8, wherein the body-fluid sample is aqueous
humor, vitreous humor, blood serum, blood plasma, cerebrospinal
fluid, endolymph, perilymph, exudates, lymph, mucus, pericardial
fluid, pleural fluid, synovial fluid, milk, or oral fluids.
10. The method of claim 8, wherein the tissue sample is brain,
eyes, pineal gland, pituitary gland, thyroid gland, parathyroid
glands, thorax, heart, lungs, esophagus, thymus gland, pleura,
adrenal glands, appendix, gall bladder, urinary bladder, large
intestine, small intestine, kidneys, liver, pancreas, spleen,
stoma, prostate gland, testes, ovaries, or uterus.
11. A kit comprising a monoclonal antibody or antigen binding
fragment according to claim 1, said antibody or antigen binding
fragment specifically binding to 3ABC non-structural protein of
FMDV, wherein the antibody or antigen binding fragment thereof
specifically binds the amino acid sequence of SEQ ID NO: 2, SEQ ID
NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO:
12.
12. The kit of claim 11, wherein said kit further comprising an
immunoassay plate coated with a polypeptide comprising the amino
acid sequence selected from SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:
4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 12, FMDV non-structural
protein 3ABC or combinations thereof.
13. The kit of claim 11, wherein the antibody or antigen binding
fragment thereof is conjugated to a label.
14. A method of producing an antibody comprising immunizing an
animal with an immunogen comprising a polypeptide consisting
essentially of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:
5, SEQ ID NO: 6 or SEQ ID NO: 12, or combinations thereof; and
collecting antibodies from said animal.
15. A polypeptide consisting of or consisting essentially of an
amino acid sequence selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ
ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 12.
16. An immunogenic carrier protein covalently attached to a
polypeptide according to claim 15.
17. A composition of matter comprising a polypeptide according to
claim 15 bound to a substrate.
18. A composition of matter comprising a substrate to which an
antibody according to claim 1 is bound.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. application Ser.
No. 15/010,278, filed Jan. 29, 2016, now U.S. Pat. No.
10,035,841.
[0003] The Sequence Listing for this application is labeled
"Seq-List.txt" which was created on Dec. 15, 2017 and is 27 KB. The
entire contents of the sequence listing is incorporated herein by
reference in its entirety.
BACKGROUND
[0004] Foot-and-mouth disease (FMD) is a highly contagious viral
disease (Foot-and-Mouth Disease Virus (FMDV)) that may affect
domestic (e.g., cattle, swine, sheep, and goats) and wild (e.g.,
deer, bison, pronghorn antelope, and feral swine) cloven-hoofed
animals. The disease is characterized by fever, vesicular
(blister-like) lesions, and subsequent erosions (ulcers) of the
surfaces of the mouth, tongue, nostrils, muzzle, feet, and teats.
FMD does not typically kill adult livestock, but it does have very
detrimental effects on productivity (meat and milk) and high
mortality rates may occur in young animals.
[0005] FMD is caused by the FMD virus (FMDV) of the Aphthovirus
genus in the Picornaviridae family. There are seven different
serotypes of FMDV: O, A, C, Southern African Territories [SAT] 1,
SAT 2, SAT 3 and Asia 1. Multiple serotypes co-circulate around the
world; six out of the seven serotypes have been recorded in Africa
(O, A, C, SAT 1, SAT 2, SAT 3), while four serotypes (O, A, C, Asia
1) have been documented in the Middle East and Asia. O serotype is
most common, followed by Asia 1. All serotypes are immunologically
distinct but produce clinically indistinguishable disease. There is
no cross protection between serotypes.
[0006] Primary infection of ruminants is mainly by the respiratory
route, whereas infection of pigs is usually through the oral route.
Infection results in production of protective serotype specific
antibodies against FMDV structural proteins 5 to 14 days
post-infection. Transmission of FMDV mainly occurs through direct
contact between infected and susceptible animals. Indirect
transmission is also possible through fomites contaminated with
secretions and excretions from infected animals. FMDV can be found
in secretions and excretions such as expired air, saliva, nasal
secretions, milk, urine, feces, and semen from acutely infected
animals. Shedding can occur up to 4 days prior to the onset of
clinical signs. Aerosol transmission also occurs, particularly
through pigs that excrete large amounts of virus through their
respiratory tract, resulting in infectious aerosols that can be
inhaled by other animals in proximity.
[0007] FMD is present in about two-thirds of the world and endemic
in parts of Africa, Asia, the Middle East, and South America. The
global economic impact is colossal due to direct losses associated
with reduced production efficiency and changes in herd structure,
and indirect losses associated with cost of control strategies, and
loss of international trade status. The estimated annual economic
impact of FMD in production losses and vaccination cost in endemic
regions is estimated between $6.5 and $21 billion USD, and $1.5
billion USD in FMD free countries if outbreaks occurred, based on
reported loss of $20 billion USD during the last 15 years in
countries that were previously considered FMD-free. The United
States has been FMD-free since 1929. However, there are many
susceptible animals in the United States, including approximately
94.5 million cattle, 67 million swine, and 8.5 million sheep and
goats. An outbreak of FMD in the U.S. would have a devastating
economic impact, due to the loss of international trade, production
lost, and costs associated with depopulation, disposal, and
disinfection. Diagnostic testing capabilities to differentiate
infected and vaccinated animals (DIVA) are necessary to support
emergency vaccination strategies. To this end, there is a need for
reagents that enables FMD serological testing in the US mainland.
The current disclosure provides antibodies, peptides, and kits for
detection of FMDV infections and differentiation of FMDV infected
animals from FMDV vaccinated animals.
BRIEF SUMMARY
[0008] The current disclosure provides isolated antibodies or
antigen binding fragments thereof that specifically bind to the
3ABC non-structural protein of Foot-and-Mouth Disease Virus (FMDV),
wherein the antibodies or antigen binding fragments thereof
recognize the amino acid sequence of SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5 or SEQ ID NO: 12 as an epitope. Accordingly, the
current disclosure provides polypeptides providing a novel epitope
from FMDV protein 3ABC. The epitope has the amino acid sequence set
forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 12.
The antibodies or antigen binding fragments thereof can be
monoclonal antibodies (Mab), chimeric antibodies, single chain
antibodies, single chain fragment variable (scFv) antibodies, or
fragment antigen-binding (Fab fragment). In an embodiment, the
antibody is Mab 40C8 as produced by hybridoma which is deposited
with the American Type Culture Collection with Designation:
PTA-122531.
[0009] The current disclosure also provides methods of detecting
Foot-and-Mouth Disease virus (FMDV) infection in an animal, the
method comprising performing an assay using the polypeptides
(epitope sequences) disclosed herein or antibodies or antigen
binding fragments thereof that bind the disclosed polypeptides on a
biological sample obtained from the animal. The assay can be an
enzyme-linked immunosorbent assay (ELISA), for example, sandwich
ELISA or competitive ELISA. An infected animal may be infected
naturally (e.g., animals at commercial farms, etc.) or
experimentally (e.g., in laboratories or experimental
facility).
[0010] The current disclosure also provides kits, for example ELISA
kits, comprising the antibody or antigen binding fragment thereof.
The antibodies or antigen binding fragments thereof can be labeled
with an enzyme in the ELISA kits. Alternately, the antibodies or
antigen binding fragments thereof can be coated onto immunoassay
plates. The kits can further comprise an immunoassay plate coated
with the polypeptide comprising the amino acid sequence selected
from SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ
ID NO: 12.
[0011] Further, the current disclosure provides antibodies or
antigen binding fragments thereof obtained from an animal that has
been immunized with a polypeptide comprising an amino acid sequence
selected from SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID
NO: 12, and wherein the antibodies or antigen binding fragments
thereof recognize the amino acid sequence of SEQ ID NO: 3, SEQ ID
NO: 4, SEQ ID NO: 5 or SEQ ID NO: 12 as an epitope.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication, with color drawing(s), will be provided by the Office
upon request and payment of the necessary fee.
[0013] FIG. 1 shows sequence and location of the epitope (SEQ ID
NO: 3) bound by the 40C8 antibody within the FMDV protein. The
sequence in FIG. 1 includes a N-terminal cysteine residue used to
conjugate the epitope to a carrier protein and is presented as SEQ
ID NO: 6).
[0014] FIG. 2 shows a sequence analysis of 331 strains from GenBank
which revealed up to 20% variability in the 3ABC epitope. The
sequences are presented as SEQ ID NOs: 13-28.
[0015] FIG. 3 shows amino acid variability within the 3ABC peptide;
the variability is higher in residues alanine (A), leucine (L) and
lysine (K) at positions 4, 7, and 11, respectively.
[0016] FIG. 4 shows that Mab 40C8 exhibited positive reactivity to
diverse 3ABC peptide variants. The sequences are presented as SEQ
ID NOs: 13-28.
[0017] FIG. 5 shows that Mab 40C8 exhibited positive reactivity to
the 3ABC recombinant protein, PET31b3b12X (44.7 kDa; SEQ ID NO: 2),
which contains sequence variations within the 3B portion of the
protein. Left: intact recombinant protein, analyzed by SDS PAGE;
Right: specific Mab 40C8 detection of recombinant protein using
Western blot analysis.
[0018] FIG. 6 shows reactivity of Mab 40C8-HRP with 6 major FMDV
serotypes tested in direct ELISA.
[0019] FIGS. 7A and 7B show western blot analysis using Mab 40C8
antibody to detect various serotypes of FMDV. As a control the
infected cell-lysates were also examined using a monoclonal
antibody (F19-2) specific to the FMDV 3D polymerase.
[0020] FIG. 8 shows schematic of recombinant 3ABC* protein (*
indicates mutation in the protein).
[0021] FIG. 9 shows schematic representation of entire plasmid for
the expression of FMDV 01 Campos mutant 3ABC* protein (SEQ ID NO:
29 and SEQ ID NO: 30).
[0022] FIG. 10 shows SDS PAGE gel of recombinant 3ABC* protein. L:
molecular weight markers; A: lot A; B: lot B.
[0023] FIG. 11 shows detection of antibodies by the 3ABC ELISA
following Infection of cattle with one of four serotypes of FMDV
(n=4 animals/serotype; data averaged).
[0024] FIG. 12 shows detection of antibodies to the FMDV 3ABC
non-structural proteins in cattle vaccinated with Ad-A24.
[0025] FIG. 13 shows percent inhibition (% I) distribution of 486
bovine FMDV negative and 139 FMDV positive samples. The vertical
line denotes the 45% I cut-off; Dx Se denotes diagnostic
sensitivity; Dx Sp denotes specificity.
[0026] FIG. 14 shows percent inhibition (% I) distribution of 491
bovine negative samples. The vertical line denotes the 45% I
cut-off; Dx Sp denotes diagnostic specificity.
BRIEF DESCRIPTION OF THE SEQUENCES
[0027] SEQ ID NO: 1: Sequence of 3ABC protein from FMDV serotype
O.
[0028] SEQ ID NO: 2: Amino acid sequence for the 3ABC recombinant
protein designated PET31b3b12X.
[0029] SEQ ID NO: 3: Sequence of the epitope for Mab 40C8 binding.
(Sequence: GPYAGPLERQKPLK).
[0030] SEQ ID NO: 4: Sequence of the minimal epitope for Mab 40C8
binding. (Sequence: GPLERQ).
[0031] SEQ ID NOs: 5 and 12: Alternate sequence of the minimal
epitopes for MAB 40C8 binding, where X is any amino acid.
(Sequence: G X.sub.1X.sub.2ERQ; GPYAGX.sub.1X.sub.2ERQKPLK).
[0032] SEQ ID NO: 6: FMDV peptide for generation of Mab 40C8
antibody with amino terminal cysteine added. (Sequence:
CGPYAGPLERQKPLK).
[0033] SEQ ID NO: 7: Forward PCR primer for overlap extension PCR
of 3ABC cDNA. (Sequence: CAATTCCTTCCCAAAAATCT).
[0034] SEQ ID NO: 8: Reverse PCR primer for overlap extension PCR
of 3ABC cDNA. (Sequence: GTGGTGTGGTTCGGGGTCCAA).
[0035] SEQ ID NO: 9: Nucleotide sequence of plasmid pET30c O1C
3ABC* (3C mutation at nucleotide 6381: T to C, Cysteine to
Arginine).
[0036] SEQ ID NO: 10: Nucleotide sequence encoding O1C 3ABC* (3C
mutant at nucleotide 1239; T to C, Cysteine to Arginine).
[0037] SEQ ID NO: 11: Amino acid sequence corresponding to the
serotype O FMDV 3ABC* mutant protein containing a His6 tag for
expression and purification from Escherichia coli (3C mutant at
amino acid 163: Cysteine to Arginine).
[0038] SEQ ID NOs: 13-28: Peptide sequences disclosed in FIGS. 2
and 4.
DETAILED DISCLOSURE
Overview
[0039] We have developed a monoclonal antibody (40C8) specific for
the FMDV nonstructural protein (NSP) 3ABC polypeptide and have
demonstrated broad reactivity of this antibody against bovine sera
from all seven FMDV serotypes. This monoclonal antibody may be used
for FMDV serological diagnostics (including differentiation between
infected and vaccinated animals (DIVA) capability) and attenuated
FMD vaccine production quality control testing.
[0040] Foot-and-mouth disease (FMD) serological testing in the U.S.
is currently performed only at the USDA Animal and Plant Health
Inspection Service (APHIS) Foreign Animal Disease Diagnostic
Laboratory (FADDL) at Plum Island Animal Disease Center (PIADC)
under an experimental research and evaluation permit using an ELISA
kit. The current disclosure provides antibodies, peptides, and kits
for detection of FMDV infections and differentiation of FMDV
infected animals from FMDV vaccinated animals.
Disclosure
[0041] ATCC information: The hybridoma cell line which can be used
to produce Mab 40C8 was deposited with American Type Culture
Collection (ATCC), P.O. Box 1549, Manassas, Va. 20108, on Sep. 29,
2015 (ATCC Designation PTA-122531). The subject hybridoma cell line
has been deposited under conditions that assure that access to the
cell line will be available during the pendency of this patent
application to one determined by the Commissioner of Patents and
Trademarks to be entitled thereto under 37 C.F.R. 1.14 and 35
U.S.C. .sctn. 122. This deposit will be available as required by
foreign patent laws in countries wherein counterparts of the
subject application, or its progeny, are filed. However, it should
be understood that the availability of a deposit does not
constitute a license to practice the subject invention in
derogation of patent rights granted by governmental action.
[0042] The current disclosure provides a novel epitope of the 3ABC
protein from FMDV, for example, an epitope having the amino acid
sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO:
12 (or any polypeptide disclosed in FIG. 4), and antibodies and
antigen binding fragments thereof that specifically recognize one
of these epitopes. This disclosure also describes methods,
techniques, approaches, kits for use in conjunction with the
present disclosure.
[0043] The current disclosure also provides methods of using the
antibodies or antigen binding fragments thereof and the novel
epitopes for detection for FMDV infection in animals and for
distinguishing FMDV infected animals from animals vaccinated
against FMDV infection. The methods of the current disclosure
provide improved sensitivity and specificity over the existing
methods of detection of FMDV in animals and reduces the time
necessary to identify animals having a positive serotype for
FMDV.
[0044] Accordingly, the current disclosure provides antibodies and
antigen binding fragments thereof that specifically binds to the
3ABC non-structural protein of FMDV, wherein the antibodies or
antigen binding fragments thereof recognize the amino acid sequence
of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 12 (or
any polypeptide disclosed in FIG. 4) as an epitope. In some
embodiments, antibodies bind to the same epitope as the monoclonal
antibody produced by the hybridoma 40C8. Such antibodies can be
identified using any one of a variety of immunological screening
assays in which antibody competition can be assessed. In an
embodiment, the antibody is a monoclonal antibody. Additionally,
the antibodies can be polyclonal antibodies. In further
embodiments, the antibody or antigen binding fragments thereof can
be chimeric antibodies, single chain antibodies, scFv antibodies,
or Fab fragments.
[0045] Thus, one embodiment provides a monoclonal antibody, Mab
40C8, as produced by hybridoma cell line deposited with the
American Type Culture Collection with Designation: PTA-122531.
[0046] A further embodiment provides antibodies or antigen binding
fragments thereof obtained from an animal that has been immunized
with a polypeptide comprising an amino acid sequence selected from
SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 12 (or any polypeptide
disclosed in FIG. 4), and wherein the antibodies or antigen binding
fragments thereof recognize the amino acid sequence of SEQ ID NO:
3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 12 (or the immunizing
polypeptide from FIG. 4) as an epitope. These antibodies can also
be monoclonal antibodies or polyclonal antibodies.
[0047] The antibodies and antigen binding fragments thereof can be
used in an assay to detect the presence or absence in a sample of
3ABC protein from FMDV, for example by a Western blot analysis or a
sandwich ELISA; to detect the presence in a sample of antibodies
against 3ABC protein from FMDV, for example, by a competitive
ELISA; or to detect the presence of FMDV infection in an animal,
for example, by a western blot analysis or an ELISA. The antibodies
and antigen binding fragments thereof can also be used to
distinguish the animals infected with FMDV from the animals
vaccinated against FMDV. Accordingly, the current disclosure
provides methods of detecting the presence of 3ABC protein, or
antibodies against 3ABC proteins and thus detect the presence of
FMDV infection in an animal.
[0048] The detection of the presence of 3ABC protein, or the
antibodies against 3ABC proteins can be facilitated by
conjugating/coupling the antibodies and antigen binding fragments
thereof to appropriate labels. Non-limiting examples of labels that
can be conjugated to the antibodies or antigen binding fragments
thereof as disclosed herein include an enzyme, a radioisotope, a
fluorescent label, or a bioluminescent label. Additional
embodiments of labels that can be conjugated/coupled to the
antibodies and antigen binding fragments thereof of the current
disclosure and various methods of detecting the labels are
recognized.
[0049] Various assays for detection of 3ABC proteins can be used to
detect FMDV infection in an animal using the antibodies or antigen
binding fragments thereof of the current disclosure. Non-limiting
examples of protein detection assays include Western blot analysis,
ELISA, immunohistochemistry, or immunoprecipitation. Additional
examples of assays utilizing antibodies or antigen binding
fragments thereof to detect the presence of specific proteins or
specific antibodies in samples are recognized.
[0050] Assays disclosed herein can be used to detect the 3ABC
protein, or antibodies against 3ABC proteins can be performed on a
biological sample obtained from an animal. In certain embodiments,
the biological sample obtained from the animal contains the 3ABC
proteins derived from FMDV or the antibodies produced in the body
of the animal against 3ABC proteins. In embodiments the biological
sample is a body-fluid sample or a tissue sample. It should be
appreciated that the assays may be used as part of an approach to
determine the absence of the 3 ABC protein in some instances.
[0051] This disclosure also provides methods of screening a
population of animals for FMDV infection, an exemplary method
includes:
[0052] a) obtaining a biological sample from each animal from the
population of animals,
[0053] b) conducting an assay comprising contacting said biological
sample with an 3ABC polypeptide or a polypeptide comprising SEQ ID
NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, any polypeptide
disclosed in FIG. 4 or SEQ ID NO: 12, said polypeptide being
optionally bound to a substrate, using an antibody or an antigen
binding fragment thereof to distinguish FMDV infected animals from
animals vaccinated against FMDV infection, wherein the antibody or
the antigen binding fragment thereof recognizes the amino acid
sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, any
polypeptide disclosed in FIG. 4 or SEQ ID NO: 12 as an epitope,
and
[0054] c) identifying individual animals from the population of
animals as FMDV infected animals or FMDV vaccinated animals. In
certain embodiments, the assay is performed using the kit according
to the current disclosure. In a further embodiment, the animal
screened for FMDV infection is at least one of cattle, buffalo,
water buffalo, sheep, goat, antelope, deer, bison, elephant, llama,
or alpaca. The sample obtained from the animal can be any
biological sample described above. Additional embodiments provide
for the optional quarantine or slaughter of infected animals.
[0055] Non-limiting examples of biological samples (e.g., body
fluid samples) include aqueous humor, vitreous humor, blood serum,
blood plasma, cerebrospinal fluid, endolymph, perilymph, exudates,
lymph, mucus, pericardial fluid, pleural fluid, synovial fluid,
milk, or oral fluids. Non-limiting examples of tissue samples
include brain, eyes, pineal gland, pituitary gland, thyroid gland,
parathyroid glands, thorax, heart, lungs, esophagus, thymus gland,
pleura, adrenal glands, appendix, gall bladder, urinary bladder,
large intestine, small intestine, kidneys, liver, pancrease,
spleen, stoma, prostate gland, testes, ovaries, or uterus. The
tissue samples can be appropriately processed to produce a sample
suitable for performing the assay for detection of the 3ABC
protein, or antibodies against 3ABC proteins. It is to be apparent
that the foregoing method can also be used to identify animals that
have been innoculated for protection against FMD as is
understandable to a person of ordinary skill.
[0056] The current disclosure further provides kits containing the
antibodies or antigen binding fragments thereof. A kit, for
example, is used to detect the presence in a sample of 3ABC
protein, to detect the presence in a sample of antibodies against
3ABC protein from FMDV, or to detect the presence of FMDV infection
in an animal. Using the antibodies or antigen binding fragments
described herein, a person of ordinary skill in the art can design
various assays for different purposes in accordance with this
disclosure, for example, to detect the presence of 3ABC protein, to
detect the presence of antibodies against 3ABC protein, or to
detect the presence of FMDV infection in an animal. Antibodies that
bind to an epitope defined by any one of SEQ ID NO: 3, 4, 5 or 12
are also expected to bind to proteins containing this epitope
(e.g., the 3B, 3AB, 3ABC or the recombinant protein of SEQ ID NO:
2).
[0057] The kits in accordance with this disclosure can comprise
reagents for conducting various assays. The reagents provided in a
kit depend on the purpose and design of the assay to be performed.
For example, a kit designed for a western blot analysis contains a
labeled secondary antibody and additional reagents for visualizing
the label. Various embodiments of western blot analyses are
contemplated.
[0058] Kits for performing ELISA are also disclosed. The kits can
be designed to perform different types of ELISA, for example, a
sandwich ELISA or a competitive ELISA. A person of ordinary skill
in the art knows various reagents and tools required for conducting
each of the different types of ELISAs and accordingly, the current
disclosure provides kits containing appropriate reagents and tools
for performing these ELISAs.
[0059] For example, a kit for conducting a sandwich ELISA can
contain an immunoassay plate coated with the antibodies or antigen
binding fragments thereof disclosed herein. The sandwich ELISA kit
can further contain 3ABC antibodies directed to different epitopes
than the epitopes of the current disclosure. These different
antibodies can be conjugated to an enzyme. The sandwich ELISA kit
can further contain reagents for carrying out and visualizing the
enzymatic reaction catalyzed by the conjugated enzyme.
[0060] A person of ordinary skill in the art with this disclosure
can design various embodiments of a sandwich ELISA kit using the
antibodies or antigen binding fragments thereof disclosed herein.
For example, instead of coating the immunoassay plate with the
antibodies or antigen binding fragments thereof, a kit contains
immunoassay plate coated with antibodies against 3ABC epitopes
different from the epitopes disclosed herein and enzymatically
labeled antibodies or antigen binding fragments thereof of the
current disclosure. Alternately, enzyme linked secondary antibodies
can also be provided. Additional designs of ELISAs can be
envisioned based on the present disclosure.
[0061] A further embodiment of this disclosure provides a kit for
performing cELISA for detection of antibodies against 3ABC protein
in a sample, for example a biological sample obtained from an
animal. The USDA and Department of Homeland Security (DHS) Science
and Technology research teams at Plum Island Animal Disease Center
(PIADC) have developed the first bioengineered vaccine against FMDV
that can be produced in the U.S. The cELISA kit of the current
disclosure provides a companion diagnostic tool for a U.S.-based
FMD vaccination program that utilizes FMD vaccines lacking a
full-length 3ABC protein. Therefore, the kit can be used to detect
FMDV infection in animals and can also differentiate infected
animals from vaccinated animals, animals vaccinated for immunity to
FMDV. For example, animals vaccinated with FMD vaccines lacking a
full-length 3ABC protein or FMD vaccines that do not code for the
FMDV 3ABC protein lack antibodies that bind to the 3ABC polypeptide
or the epitope bound by the antibodies disclosed herein. Thus, such
animals should not have antibodies that bind to a polypeptide
disclosed herein and such animals should not have antibodies that
compete with the disclosed antibodies (e.g., such animals should
have no antibodies that compete with the 40C8 monoclonal antibody
(or antibodies that bind to the same epitope as the 40C8 antibody)
for binding to a peptide as disclosed herein or the 3ABC
polypeptide).
[0062] The cELISA kit described herein can provide a fast FMD
serological assay which provides results in hours rather than days,
as well as superior specificity and sensitivity compared to a
commercial product. The cELISA kit of the current disclosure also
provides a differentiation between infected and vaccinated animals
(DIVA) test for the adenovirus serotype 5 FMD vaccine (and future
vaccines that lack FMDV 3ABC immunogenic proteins. Certain aspects
of this disclosure provide polypeptides useful for making
antibodies or in competitive immunoassays. With respect to the
amino acid sequences set forth in SEQ ID NO: 5 and SEQ ID NO: 12,
X.sub.1 and X.sub.2 can be any amino acid (as set forth in Table
1), provided that if X.sub.1 is proline, then X.sub.2 cannot be
leucine and if X.sub.2 is leucine, then X.sub.1 cannot be proline
(e.g., SEQ ID NO: 12 specifically excludes the amino acid sequence
of SEQ ID NO: 3 as a possible sequence). Another embodiment
provides, with respect to the amino acid sequences set forth in SEQ
ID NO: 5 and SEQ ID NO: 12, that X.sub.1 and X.sub.2 can be any
amino acid (as set forth in Table 1), provided that if X.sub.1 is
proline, then X.sub.2 cannot be methionine. Other non-limiting
examples of polypeptides are provided in FIG. 4). In some other
embodiments, polypeptides in which a cysteine (C) is found at the
amino terminus of the polypeptide are also provided (e.g., SEQ ID
NO: 6). Polypeptides containing a cysteine residue at the amino
terminus of the polypeptide are suitable for covalent attachment to
a carrier protein via another cysteine residue or various
linkers.
TABLE-US-00001 TABLE 1 20 amino acids and single letter codes (SLC)
Amino Acid SLC Isoleucine I Leucine L Valine V Phenylalanine F
Methionine M Cysteine C Alanine A Glycine G Proline P Threonine T
Serine S Tyrosine Y Tryptophan W Glutamine Q Asparagine N Histidine
H Glutamic acid E Aspartic acid D Lysine K Arginine R
[0063] In another aspect, immunoassays using the disclosed
polypeptides or antibodies are provided. In embodiments in
accordance with this aspect, antibodies that bind to an epitope
comprising SEQ ID NO: 3, 4, 5 or 12 (or the polypeptides disclosed
in FIG. 4) or a polypeptide selected from SEQ ID NO: 2, 3, 4, 5 or
12 (or polypeptides disclosed in FIG. 4) are bound to a substrate.
The term "bound" refers to both covalent and non-covalent
attachment of an antibody or polypeptide to a substrate. Thus,
antibodies or polypeptides can be covalently bound to the substrate
via a linker physically attached to a substrate or non-covalently
bound to a substrate (e.g., adsorbed to a substrate surface, for
example, a polystyrene surface).
[0064] In various embodiments, the substrate is one or more tubes,
cylinders, beads, discs, silicon chips, microplates, polyvinylidene
difluoride (PVDF) membrane, nitrocellulose membrane, nylon
membrane, porous membranes, non-porous membranes, plastic, polymer,
silicon, polymeric pins, a plurality of microtiter wells, or
combinations thereof. The composition of the substrate can also be
varied. Substrates (alternatively referred to as a support) can
comprise glass, cellulose-based materials, thermoplastic polymers,
such as polyethylene, polypropylene, or polyester, sintered
structures composed of particulate materials (e.g., glass or
various thermoplastic polymers), or cast membrane film composed of
nitrocellulose, nylon, polysulfone, or the like. Thus, the
substrate may be any surface or support upon which an antibody or a
polypeptide selected from those disclosed in FIG. 4 or SEQ ID NOs:
2, 3, 4, 5, 6 and/or 12 can be immobilized, including one or more
of a solid support (e.g., glass such as a glass slide or a coated
plate, silica, plastic or derivatized plastic, paramagnetic or
non-magnetic metal), a semi-solid support (e.g., a polymeric
material, a gel, agarose, or other matrix), and/or a porous support
(e.g., a filter, a nylon or nitrocellulose membrane or other
membrane). In some embodiments, synthetic polymers is used as a
substrate, including, e.g., polystyrene, polypropylene,
polyglycidylmethacrylate, aminated or carboxylated polystyrenes,
polyacrylamides, polyamides, polyvinylchlorides, and the like. In
preferred embodiments, the substrate comprises a microtiter
immunoassay plate or other surface suitable for use in an
ELISA.
[0065] In embodiments, polypeptides have additional material
covalently linked to either or both ends of the polypeptide (e.g.,
additional amino acids to the amino acid sequence of interest),
provided that, in the case of SEQ ID NOs: 3, 4, 5, 6 or 12 (or the
polypeptides disclosed in FIG. 4), the additional amino acids do
not provide the sequence of the FMDV 3ABC or any other naturally
occurring polypeptide containing SEQ ID NO: 3, 4, 5 or 12 (or
sequence as disclosed in FIG. 4). Covalent linkage of additional
amino acids to either or both ends of the polypeptide disclosed
herein results in a combined amino acid sequence that is not
naturally occurring, e.g. an unnatural amino acid sequence that is
not found in nature. Polypeptides include a polypeptide having an
amino acid sequence selected from the group consisting of SEQ ID
NO: 4, 5, 6 or 12 (or any polypeptide disclosed in FIG. 4) coupled
to a carrier protein (e.g., a carrier such as an albumin (e.g.,
bovine serum albumin), keyhole limpet hemocyanin, ovalbumin). Such
coupling can be a covalent linkage. These peptides are rendered
immunogenic by coupling them to an immunogenic carrier by the
following procedure.
[0066] An immunizing agent is constructed by covalently conjugating
a polypeptide selected from the polypeptides disclosed in FIG. 4,
SEQ ID NOs: 4, 5, 6 and/or 12 to an immunogenic carrier protein,
preferably by means of a crosslinker, such as a glutaraldehyde
moiety or other known linkers. Immunogenic carriers include
compounds to which any one of the peptides disclosed herein
attached so as to render the peptide immunogenic. Non-limiting
examples of such carriers include proteins such as keyhole limpet
hemocyanin (KLH), bovine serum albumin (BSA), ovalbumin (OVA),
tetanus toxoid and human thyroglobulin. One function of the
crosslinker is to introduce into the immunizing agent a spacer of
sufficient size to prevent the carrier protein from masking the
polypeptide. Suitable crosslinking agents are known in the art and
are commercially available. The immunizing agent is then
administered to a subject, such as a goat, sheep, rabbit, mouse,
rat, guinea pig, pig, cow, buffalo or other appropriate non-human
mammal in an amount sufficient to raise an immune response to the
immunizing agent, specifically the polypeptide of SEQ ID NO: 2, 4,
5, 6 or 12 or any of the polypeptides disclosed in FIG. 4. The
immunizing agent can be administered in combination with an
adjuvant, such as Freund's Complete adjuvant, Freund's Incomplete
adjuvant, aluminum salts, oil based adjuvants, saponins, chemically
synthesized adjuvants, or other adjuvants.
[0067] Another embodiment provides for the use of the disclosed
peptides for FMDV antigen or antibody detection. For example, the
peptide can be used to coat an ELISA plate in a competitive or
indirect ELISA format to detect FMDV antibody from diverse samples
(e.g., natural or experimental infections). Alternatively, the
peptide can be used in a liquid phase competitive ELISA for
detection of FMDV antigen. In this example, an ELISA plate is
coated with the 3ABC monoclonal antibody and a liquid sample
containing the FMDV 3ABC antigen is then added and allowed to
compete with a constant concentration of 3ABC peptide. Thus, one
can detect 3ABC contaminants in vaccine preparations.
[0068] An example cELISA kit includes: [0069] a) the antibodies or
antigen binding fragments thereof optionally labeled with an enzyme
or other label, [0070] b) an immunoassay plate or other substrate
coated with a polypeptide comprising an amino acid sequence
selected from those disclosed in FIG. 4, SEQ ID NO: 3, SEQ ID NO:
4, SEQ ID NO: 5, SEQ ID NO: 6 and/or SEQ ID NO: 12, [0071] c) if
the antibody or antigen binding fragment thereof is not labeled
with an enzyme or other label, an antibody against the antibody or
antigen binding fragment thereof conjugated to an enzyme or label,
and [0072] d) reagents and tools for conducting the cELISA
assay.
[0073] The antibody or antigen binding fragment thereof of the
current disclosure provided in the kit can be chimeric antibodies,
single chain antibodies, scFv antibodies, or Fab fragments. In one
embodiment, the kit contains Mab 40C8 antibody as produced by
hybridoma which is deposited with the American Type Culture
Collection with Designation: PTA-122531.
[0074] The immunoassay plate can be coated with a polypeptide
consisting essentially of the amino acid sequence selected from
those disclosed in FIG. 4, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:
4, SEQ ID NO: 5 and/or SEQ ID NO: 12 (or any combination thereof).
Non-limiting examples of polypeptides that can be conjugated to the
immunoassay plate include peptides consisting of those disclosed in
FIG. 4, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5
and/or SEQ ID NO: 12; 3ABC protein; or 3ABC protein carrying a
mutation rendering it protease resistant (described in detail in
the Materials and Methods section and the Examples below). Any
peptide containing the epitopes for the antibodies or antigen
binding fragments thereof disclosed herein can be used to coat the
immunoassay plate and such embodiments are within the purview this
disclosure.
[0075] The current disclosure also provides the following
non-limiting embodiments:
[0076] 1. An isolated antibody or antigen binding fragment thereof
that specifically binds to 3ABC non-structural protein of
Foot-and-Mouth Disease virus (FMDV), wherein the antibody or
antigen binding fragment thereof specifically binds an epitope
consisting essentially of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5,
SEQ ID NO: 6 or SEQ ID NO: 12.
[0077] 2. The antibody or antigen binding fragment thereof of
embodiment 1 that specifically binds the amino acid sequence of SEQ
ID NO: 3, SEQ ID NO: 6, or SEQ ID NO: 12 as the epitope.
[0078] 3. The antibody or antigen binding fragment thereof of
embodiment 1 that specifically binds the amino acid sequence of SEQ
ID NO: 4 as the epitope.
[0079] 4. The antibody or antigen binding fragment thereof of
embodiment 1 that specifically binds the amino acid sequence of SEQ
ID NO: 5 as the epitope.
[0080] 5. The antibody of embodiment 1, wherein the antibody is a
monoclonal antibody.
[0081] 6. The antibody of embodiment 1, wherein the antibody is a
polyclonal antibody.
[0082] 7. The antibody or antigen binding fragment thereof of
embodiment 1, wherein the antibody is selected from a chimeric
antibody, a single chain antibody, a single chain fragment variable
(scFv) antibody, or a fragment antigen-binding (Fab fragment).
[0083] 8. The antibody of embodiment 1, wherein the antibody is Mab
40C8 as produced by hybridoma which is deposited with the American
Type Culture Collection with Designation: PTA-122531.
[0084] 9. The antibody or antigen binding fragment thereof of
embodiment 1, wherein the antibody or antigen binding fragment
thereof is conjugated to a label.
[0085] 10. The antibody of embodiment 9, wherein the label is
selected from an enzyme label, a radioisotope, a fluorescent label,
or a bioluminescent label.
[0086] 11. A method of detecting FMDV infection in an animal, the
method comprising contacting a sample from an animal with an
antibody or antigen binding fragment thereof of that specifically
binds to the 3ABC non-structural protein of FMDV, wherein the
antibody or antigen binding fragment thereof specifically binds the
amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5 SEQ ID NO: 6, or SEQ ID NO: 12.
[0087] 12. The method of embodiment 11, wherein the sample obtained
from the animal is a body-fluid sample or a tissue sample.
[0088] 13. The method of embodiment 12, wherein the body-fluid
sample is aqueous humor, vitreous humor, blood serum, blood plasma,
cerebrospinal fluid, endolymph, perilymph, exudates, lymph, mucus,
pericardial fluid, pleural fluid, synovial fluid, milk, or oral
fluids.
[0089] 14. The method of embodiment 12, wherein the tissue sample
is brain, eyes, pineal gland, pituitary gland, thyroid gland,
parathyroid glands, thorax, heart, lungs, esophagus, thymus gland,
pleura, adrenal glands, appendix, gall bladder, urinary bladder,
large intestine, small intestine, kidneys, liver, pancreas, spleen,
stoma, prostate gland, testes, ovaries, or uterus.
[0090] 15. The method of embodiment 11 or 12, wherein the assay is
a Western blot analysis.
[0091] 16. The method of embodiment 11 or 12, wherein the assay is
an ELISA.
[0092] 17. The method of embodiment 16, wherein the ELISA is
sandwich ELISA, or competitive ELISA.
[0093] 18. The method of embodiment 17, wherein the competitive
ELISA is performed using an immunoassay plate, wherein the
immunoassay plate is coated with one or more polypeptide consisting
essentially of an amino acid sequence selected from SEQ ID NO: 2,
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID
NO: 12.
[0094] 19. The method of embodiment 16, wherein the antibody or
antigen binding fragment thereof is conjugated to an enzyme.
[0095] 20. The method of embodiment 19, wherein the enzyme is
horseradish peroxidase.
[0096] 21. The method of embodiment 11 or 12, wherein the antibody
or antigen binding fragment thereof is conjugated to a label.
[0097] 22. The method of embodiment 21, wherein the label is an
enzyme label, a radioisotope, a fluorescent label, or a
bioluminescent label.
[0098] 23. A kit comprising an antibody or antigen binding fragment
according to any one of embodiments 1-10, said antibody or antigen
binding fragment specifically binding to 3ABC non-structural
protein of FMDV, wherein the antibody or antigen binding fragment
thereof specifically binds the amino acid sequence of SEQ ID NO: 2,
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID
NO: 12.
[0099] 24. The kit of embodiment 23, wherein said kit further
comprising an immunoassay plate coated with a polypeptide
comprising the amino acid sequence selected from SEQ ID NO: 2, SEQ
ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO:
12, FMDV non-structural protein 3ABC or combinations thereof.
[0100] 25. The kit of embodiment 23, wherein the antibody or
antigen binding fragment thereof is conjugated to a label.
[0101] 26. The kit of embodiment 23, wherein said label is an
enzyme label, a radioisotope, a fluorescent label, or a
bioluminescent label.
[0102] 27. The kit of embodiment 23, wherein the antibody is a
monoclonal antibody.
[0103] 28. The kit of embodiment 23, wherein the antibody is a
polyclonal antibody.
[0104] 29. The kit of embodiment 23, wherein the antibody or
antigen binding fragment thereof is a chimeric antibody, a single
chain antibody, a scFv antibody, or a Fab fragment.
[0105] 30. The kit of embodiment 23, wherein the antibody is Mab
40C8 as produced by hybridoma which is deposited with the American
Type Culture Collection with Designation: PTA-122531.
[0106] 31. A method of producing an antibody comprising immunizing
an animal with an immunogen comprising a polypeptide consisting
essentially of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:
5, SEQ ID NO: 6 or SEQ ID NO: 12, or combinations thereof; and
collecting antibodies from said animal.
[0107] 32. The method according to embodiment 31, said method
further comprising comparing the binding specificity of said
collected antibodies to the monoclonal antibody 40C8.
[0108] 33. The method of embodiment 31, said method comprising
immunizing said animal, generating monoclonal antibodies from
splenocytes isolated from said animal and comparing the binding
specificity of monoclonal antibodies generated by said method with
the 40C8 monoclonal antibody.
[0109] 34. The method according to embodiment 32, wherein said
generated monoclonal antibody specifically binds the amino acid
sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6,
or SEQ ID NO: 12 as the epitope.
[0110] 35. The method according to embodiment 32, wherein said
generated monoclonal antibody specifically binds the amino acid
sequence of SEQ ID NO: 4 as the epitope.
[0111] 36. The method according to embodiment 32, wherein said
generated monoclonal antibody specifically binds the amino acid
sequence of SEQ ID NO: 5 as the epitope.
[0112] 37. A polypeptide consisting of an amino acid sequence
selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO:
6 or SEQ ID NO: 12.
[0113] 38. A polypeptide consisting essentially of an amino acid
sequence selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5,
SEQ ID NO: 6 or SEQ ID NO: 12.
[0114] 39. An immunogenic carrier protein covalently attached
to:
[0115] a) a polypeptide consisting of an amino acid sequence
selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO:
6 or SEQ ID NO: 12; or
[0116] b) consisting essentially of an amino acid sequence selected
from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ
ID NO: 12.
[0117] 40. A composition of matter comprising a polypeptide bound
to a substrate, said polypeptide:
[0118] a) consisting of an amino acid sequence selected from SEQ ID
NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 12;
or
[0119] b) consisting essentially of an amino acid sequence selected
from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ
ID NO: 12.
[0120] 41. A composition of matter comprising a substrate to which
an antibody according ant one of embodiments 1-10 is bound.
[0121] 42. The method of any one of embodiments 11-22, wherein said
antibody binds to the same epitope as the 40C8 antibody.
[0122] 43. The method of embodiment 42, wherein said antibody is
the antibody produced by the hybridoma 40C8 or is an antigen
binding fragment thereof.
[0123] 44. An immunogenic composition comprising an adjuvant and a
polypeptide:
[0124] a) consisting of an amino acid sequence selected from SEQ ID
NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 12;
or
[0125] b) consisting essentially of an amino acid sequence selected
from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ
ID NO: 12, said polypeptide being, optionally, conjugated to an
immunogenic carrier protein.
[0126] 45. The method of embodiment 11 or 12, wherein the sample is
from a vaccinated animal, infected animal or a combination of
vaccinated and infected animals.
[0127] 46. The method of embodiments 11, 12, 17-22 or 45, wherein
said method is a competitive immunoassay and said method
comprises:
[0128] combining said biological sample with Mab 40C8 or an antigen
binding fragment thereof, or antibodies having the binding
specificity of Mab 40C8, or antigen binding fragments thereof,
prior to contacting said biological with one or more 3ABC
polypeptide or one or more polypeptide comprising an epitope
comprising SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6
or SEQ ID NO: 12 or a 3ABC polypeptide;
[0129] contacting an immunoassay plate coated with one or more 3ABC
polypeptide or one or more polypeptide containing an epitope
consisting essentially of an amino acid sequence selected from SEQ
ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 12
with an antibody or antigen binding fragment having the binding
specificity of Mab 40C8, optionally washing said plate and,
subsequently contacting said immunoassay plate with said biological
sample; or
[0130] contacting an immunoassay plate coated with one or more 3ABC
polypeptide or one or more polypeptide containing an epitope
consisting essentially of an amino acid sequence selected from SEQ
ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 12
with said biological sample, optionally washing said plate and,
subsequently contacting said immunoassay plate with an antibody or
antigen binding fragment having the binding specificity of Mab
40C8.
[0131] 47. The method of embodiment 46, wherein said polypeptide
comprises FMDV 3ABC.
[0132] 48. The method of embodiment 46, wherein said method
comprises contacting an immunoassay plate coated with one or more
3ABC polypeptide or one or more polypeptide containing an epitope
consisting essentially of an amino acid sequence selected from SEQ
ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 12
with an antibody or antigen binding fragment having the binding
specificity of Mab 40C8, optionally washing said plate and,
subsequently contacting said immunoassay plate with said biological
samples, infected animals being identified by reduced binding of
antibodies in said biological sample to said polypeptide being the
inhibition of antibody binding.
[0133] 49. The method of embodiment 46, wherein said method
comprises contacting an immunoassay plate coated with one or more
3ABC polypeptide or one or more polypeptide containing an epitope
consisting essentially of an amino acid sequence selected from SEQ
ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 12
with said biological sample; contacting said immunoassay plate with
an antibody or antigen binding fragment having the binding
specificity of Mab 40C8 that is labeled with at least one of a
fluorescent label, an enzymatic label or a radiolabel; and
detecting the binding of said labeled antibody or antigen.
[0134] 50. The method of embodiment 49, wherein reduced binding of
said labeled antibody indicates that the animal from which the
biological sample was obtained is infected by FMDV.
EXAMPLE MATERIALS AND METHODS
Example: Cloning and Expression of 3ABC* His-Tagged Recombinant
Protein from E. coli Expression Plasmid
[0135] The viral RNA for the FMDV 01 Campos strain was isolated
from FMDV infected BHK-21 cells following manufacturer protocols
(RNeasy kit, Qiagen, Valencia, Calif.). The required recombinant
protein 3ABC* fragment of the viral genome was transcribed to cDNA
using SuperScript.TM. III First-Strand Synthesis System for
real-time polymerase chain reaction (RT-PCR) (Invitrogen, Carlsbad,
Calif.) following the manufacturer's instructions. The cDNA
obtained was then amplified by an overlap extension PCR (Forward
oligonucleotide: 5'-CAATTCCTTCCCAAAAATCT-3' (SEQ ID NO: 7), Reverse
oligonucleotide: 5'-GTGGTGTGGTTCGGGGTCCAA-3' (SEQ ID NO: 8).
Expected PCR product size was 1316 bp). Site-directed mutagenesis
and overlapping PCR was used to introduce a mutation (*) that
changes the residue Cysteine at position 163 into an Arginine at
the active site of the 3C.sub.pro viral proteinase.
[0136] The schematic representations of the recombinant protein and
of the plasmid used for expression in prokaryotic cells are shown
in FIG. 8 and FIG. 9. The sense and antisense primers were designed
for cloning of 3ABC* PCR into pET30c 6.times.His tag expression
plasmid containing a 6.times.His-tag at the N-terminus of the
cloned protein. Cloning of the 3ABC* insert was accomplished by
BamHI/HindIII restriction endonuclease digestion using standard
molecular biology techniques. Sequence analysis verified the
presence of the correct mutant recombinant protein. This was
accomplished by using Big Dye Terminator Cycle Sequencing Kits
(Applied Biosystems, Foster City, Calif.) and a PRISM 3700
automated sequencer.
[0137] p3ABC* was expressed in E. coli Rosetta (DE3)pLysS competent
cells and induced with addition of isopropyl
.beta.-D-1-thiogalactopyranoside (IPTG) as follows:
[0138] Expression:
[0139] 1. Grow single colony in 5 ml LB broth containing 0.4%
glucose and 50 .mu.g/ml kanamycin and 20 .mu.g/ml chloramphenicol,
overnight at 37.degree. C. and 220 rpm in an incubator.
[0140] 2. Inoculate the starter culture to 50 ml LB broth
containing identical antibiotic concentration.
[0141] 3. Grow cells at 37.degree. C. and 220 rpm in the incubator
to reach OD=0.8.
[0142] 4. Induce with 1 mM IPTG (final concentration); grow at
37.degree. C. for 4 hrs.
[0143] 5. Freeze the cell pellet in -20.degree. C. freezer.
[0144] Solubilization:
[0145] 1. Thaw the frozen cell pellet on ice for 30 min.
[0146] 2. Resuspend the cell pellet in BugBuster.RTM. reagent (5 ml
buffer/g cells) (EMD Millipore, Billerica, Mass.).
[0147] 3. Add Benzonase (Novagen, Bilerica, Mass.), lysozyme,
leupeptin, and pepstatin to 1.times. concentration.
[0148] 4. Incubate at room temperature for 20 min with intermittent
stirring.
[0149] 5. Centrifuge at 11,600 rpm in a SL-50T rotor for 20 minutes
at 4.degree. C. Discard supernatant.
[0150] 6. Add same amount of volume (as above) of 1:10
Bugbuster.RTM..
[0151] 7. Centrifuge at 3000 rpm in a ST-H750 rotor for 20 min at
4.degree. C.
[0152] 8. Collect the pellet and resuspend in 1:10 concentration of
BugBuster.RTM. again.
[0153] 9. Centrifuge at 3000 rpm using ST-H750 rotor for 20 min at
4.degree. C.
[0154] 10. Resuspend the pellet in 1:10 Bugbuster.RTM. and
centrifuge at 11,600 rpm for 20 min at 4.degree. C. Discard the
supernatant.
[0155] 11. The protein was harvested from inclusion bodies and the
protein pellet was solubilized with 100 mM NaH.sub.2PO.sub.4, 10 mM
Tris, 8 M Urea pH 8 supplemented with 12 mM .beta.-mercaptoethanol
(BME) and 10% glycerol for 1 hour on ice.
[0156] 12. The protein solution was centrifuged at 11,600 rpm in a
SL-50T rotor for 20 min at 4.degree. C. The supernatant was
collected.
[0157] Protein preparations were aliquoted as 100 .mu.l and stored
at -20.degree. C. Two lots of 3ABC* were verified in 12% Bis-Tris
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS
PAGE) gel (FIG. 10) and can be seen as an approximate 55 kDa
band.
[0158] A standard BCA protein assay (Thermo Fisher Scientific Inc.,
Waltham, Mass.) was performed to determine the approximate
concentration of the crude recombinant protein preparation. Table 2
shows the concentration and inventory of the two lots of
recombinant proteins.
TABLE-US-00002 TABLE 2 Batch information of recombinant 3ABC*
proteins Recombinant protein Concentration (mg/ml) FMDV 3ABC* Lot
20112A 7.5 FMDV 3ABC* Lot 20112B 6.25
[0159] Following are examples which illustrate procedures for
practicing the invention. These examples should not be construed as
limiting. All percentages are by weight and all solvent mixture
proportions are by volume unless otherwise noted.
Example 1--Mab 40C8 Production
[0160] An embodiment of the current disclosure provides a cELISA
that utilizes an indicator monoclonal antibody (Mab), Mab 40C8, in
a competitive format, i.e. sera from infected animals are used to
block the binding of the indicator antibody to a target antigen.
Mab 40C8 specifically binds to a B-cell linear epitope
NH2-GPYAGPLERQKPLK-COOH (SEQ ID NO: 3) of the 3ABC protein of
foot-and-mouth disease virus (FMDV) and is a key component of the
cELISA. The minimal optimal reactive epitope is mapped to GPLERQ
(SEQ ID NO: 4), enabling unique and useful function of the Mab in
diagnostic testing that are described here after.
[0161] Mab 40C8 was generated using the peptide
NH2-CGPYAGPLERQKPLK-COOH, (SEQ ID NO: 6, FIG. 1, which was
chemically synthesized and purified by HPLC. Sequence analysis
(n=331 strains available in GenBank), indicates .about.20% genetic
variability in this epitope (FIG. 2) indicating that a monoclonal
generated against this peptide may recognize these sequence
variants, thus enabling a cross-reactive serological test. The
variability within the peptide is higher in the amino acid residues
alanine (A), leucine (L), and lysine (K) at position 4, 7 and 11,
respectively (FIG. 3).
[0162] The peptide was conjugated to KLH and used for mice
immunization and Mab production using standard protocols. Briefly,
female BALB/C mice were immunized subcutaneously with 20 .mu.g of
the peptide NH2-GPYAGPLERQKPLK-COOH (SEQ ID NO: 3) conjugated to
KLH emulsified in an equal volume of Complete Freund's Adjuvant.
Three identical boosters emulsified in incomplete Freund's adjuvant
were given at four weeks interval. The mice were boosted with the
peptide-KLH conjugate in PBS (40 .mu.g/mouse) by intraperitoneal
injection 4 days before fusion. Immunized spleen cells were fused
with myeloma cells (P3X63 Ag8.653). After 2 weeks, hybridoma
supernatants were screened using the FMDV recombinant 3ABC as the
antigen in an indirect ELISA. Mab 40C8 exhibited strong reactivity
with the 3ABC antigen and was characterized as IgG1 isotype with
kappa light chains.
[0163] Mab 40C8 Reactivity to Peptides and 3ABC Recombinant
Protein
[0164] Additional indirect ELISA testing confirmed reactivity to
diverse 3ABC peptide variants (FIG. 4). This result indicates that
this Mab exhibits broad peptide reactivity, potentially enabling
detection of diverse strains of FMDV (n=331 by in silico analysis,
as depicted in FIG. 2). The minimal epitopes are GPLERQ (SEQ ID NO:
4), and residues 2 and 3 of this sequence are not critical for Mab
40C8 binding.
[0165] Mab 40C8 also exhibited strong Western blot reactivity to
the 3ABC recombinant protein, consisting of all sequence variants
within the 3ABC epitope (FIG. 5). Furthermore, this Mab was able to
compete with sera from a FMDV infected animals to the recombinant
3ABC protein, demonstrating the feasibility of a competitive ELISA
application.
[0166] Mab 40C8 Reactivity to the Six FMDV Serotypes Infected Cell
Lysates
[0167] For a cELISA, Mab 40C8 was directly conjugated to the
horseradish peroxidase (HRP) detection system and the reactivity of
Mab 40C8 conjugated to HRP (40C8-HRP) was screened with a panel of
fifteen FMDV isolates using a direct ELISA format. These FMDV
antigens were prepared from a cell line known to be highly
permissive to FMDV growth (LFBK .alpha.v.beta.6). FIG. 6 shows that
in two separate experiments 40C8-HRP bound to FMDV antigen in
infected cell lysates. Variability in binding (e.g., measured by
450 nm absorbance) can be attributed to differences in the FMDV
antigen content in the cell lysates. For example, isolates such as
serotype O Israel (O Isr), A24 Cruzeiro SDG (A24 SDG), and SAT-2
that did not bind efficiently to Mab 40C8 in this assay were
suspected of not growing well since other isolates of the same
serotype and strain were reactive to Mab 40C8 using Western Blot
analysis (see FIG. 7 and associated result descriptions below).
Moreover, a similar low immunoreactivity for O Isr and A24 SDG was
observed in another experiment (data not shown) in which the
pan-FMDV specific monoclonal antibody, F1412SA (F14), which
specifically binds an epitope in the FMDV VP2 (1B) protein, was
used as a positive control. Collectively, these ELISA results
indicate that Mab 40C8 exhibited reactivity to six FMDV serotypes
using cell-lysates. SAT-1, the seventh serotype, was not available
at the time of this analysis.
[0168] Furthermore, Western blot analysis was also performed to
verify the ELISA results. Cell lysates prepared from BHK-21 cells
infected with FMD viruses representing different serotypes were
mixed with 2.times. Laemmli buffer, boiled, and stored. For Western
blot analysis, a 1/10 fraction of cell extracts was run on 12%
SDS-PAGE gels and transferred onto nitrocellulose blots following
standard procedures. The blots were probed using Mab 40C8. The
results are shown in FIGS. 7A and 7B. As a control, and to
demonstrate that all samples contained the viral antigen, a second
Western blot was developed using a FMDV 3D-specific monoclonal
antibody (see upper panel in FIG. 5A where a product of about 52
KDa is detected that corresponds to the FMDV protein 3D). Together
these results show that Mab 40C8 reacted with FMDV 3ABC across six
strains in four serotypes. Certain strains exhibit strong
reactivity while others required higher concentration of the Mab
40C8. The collective ELISA and Western blot data demonstrate that
Mab 40C8 specifically binds FMDV proteins from all available
serotypes.
[0169] SAT-2 Reactivity Confirmation
[0170] In the initial studies, characterizing the reactivity of the
Mab 40C8 with cell culture-grown FMDV serotype SAT-2, results
indicated that one strain of SAT-2 was not reactive, as seen in
FIG. 6, and FIG. 7B. However, when another SAT-2 strain was used,
there was a positive reaction (FIG. 7A). In additional studies
using different strains of SAT-2 in which animals were infected,
all three serum samples were positive. So, it appears that the one
strain of SAT-2 was not reactive due to low cell culture
growth.
[0171] Mab 40C8 Non Reactivity to Ad-FMD Vaccines Infected
Cells
[0172] The current disclosure provides a cELISA that can also
discriminate between animals infected with FMDV and those immunized
with FMD vaccines that have been inactivated and purified of NSPs.
The FMD vaccine immunized animals (immunized using inactivated,
purified FMDV vaccine or an adenovector serotype 5 vaccine) do not
contain FMDV protein 3ABC which is recognized by Mab 40C8-HRP. For
example, a vaccine containing the molecular clone of the
adenovector serotype 5 carrying the FMDV capsid and processing
genes (Ad-FMD) lack the specific 3ABC immunogenic site in the FMDV
3ABC protein. The antibody responses of animals immunized with
vaccines lacking the viral non-structural proteins (e.g. Ad-FMD or
inactivated, purified FMDV vaccines) can be discriminated or
differentiated from those responses exhibited by FMDV infected
animals. These differences can be detected by companion diagnostic
tests, so-called DIVA (differentiation between infected and
vaccinated animals). The Ad-FMD vaccines were designed to be
vaccines with DIVA capabilities using a FMDV 3ABC cELISA designed
as a companion diagnostic assay. The reactivity of Mab 40C8 with
Ad-FMD infected cells was screened with FMDV Asia 1, O1 Campos, and
O1 Manisa constructs using a direct ELISA as above. Ad-FMD-infected
M2A cells actively express FMDV capsid and some processing genes.
Ad-FMD antigens (infected M2A cell lysates) were directly adsorbed
to ELISA plates and processed as above. Table 3 shows the clear
binding of Mab F14 to the expressed FMDV capsid proteins, and the
lack of binding of Mab 40C8 to the Ad-FMD cell lysates that lack
immunogenic FMDV 3ABC nonstructural proteins. Therefore, the ELISA
of the present disclosure can serve as a companion diagnostic assay
for Ad-FMD vaccines.
TABLE-US-00003 TABLE 3 Immunoreactivity of Mab 40C8 and Mab F14 to
Ad-FMD vaccine constructs grown in M2A cells. Highest dilution for
a Adenovector FMD vaccine positive response construct Mab 40C8 Mab
F14 Ad5-ASaudi Arabia 95 <1:2* >1:64 Ad5-O1 Manisa <1:2
>1:64 Ad5-O1 Campos <1:2 >1:64 Ad5-O1Campos.2B <1:2
>1:64 Ad5-O1Campos.2B + F (RGD) <1:2 >1:64 M2A cells (no
vaccine control) <1:2 <1:2 *No positive reaction detected at
the lowest dilution tested (1:2)
Example 2--3ABC cELISA Kit
[0173] Preparation of Horse-Radish Peroxidase (HRPO)-Conjugated Mab
40C8
[0174] Mab 40C8 ascites purified by sodium ammonium sulfate cut
method were diluted in PBS to provide 2 mg/ml antibody. Mab 40C8
was dialyzed against 0.1 M sodium bicarbonate/carbonate buffer, pH
9.6. Half ml of a 4 mg/ml horseradish peroxidase solution (HRPO)
dissolved in distilled water was mixed with 100 .mu.l of freshly
prepared 0.1 M sodium periodate by stirring for 20 minutes at room
temperature. The HRPO/sodium periodate solution was dialyzed
against 1.0 mM sodium acetate buffer, pH 4.4 at 4.degree. C. The pH
of HRPO/sodium periodate solution was adjusted from 4.05 to pH 9.6
by adding 15 .mu.l of freshly prepared 0.1 M sodium carbonate. The
dialyzed Mab were combined with the HRPO/sodium periodate solution,
and stirred for 2 hours at room temperature. Fifty .mu.l of freshly
prepared 4 mg/ml sodium borohydride solution was slowly added to
the HRPO/FMDV ascites SAS Cut solution, incubated for 2 hours at
4.degree. C., and then dialyzed against 1.times.PBS. The
HRPO-conjugated Mab 40C8 was stabilized by adding a final
concentration of 10% heat inactivated goat serum, 0.01% thimerosal,
and 0.03% WAWA (4-aminoantipyrine).
Example: Preparation of Recombinant 3ABC-Coated Immunoassay
Plate
[0175] A dilution of recombinant 3ABC was made in 0.1 M
carbonate/bicarbonate buffer. Immunoassay plates were filled with
50 .mu.l antigen per well, incubated in humid chamber overnight at
4.degree. C. Wells were blocked with 20 .mu.l blocking agent by
incubating for 2 hours at 37.degree. C. in humid chamber. The
plates were dried overnight after discarding the liquid.
Example: Optimizations of Other Format Variables and Formulation of
Kit Components
[0176] Other format variables including serum dilution factor,
serum incubation time, buffer types for serum dilution, conjugate
dilution buffer and plate wash were thoroughly compared and the
combination supporting best analytical sensitivity and specificity
was chosen. Components of the kit were formulated as follows.
[0177] 1. Test serum dilution: PBS
[0178] 2. Serum dilution factor: 1:2
[0179] 3. Conjugate diluting buffer: 1:2 dilution of Stabilzyme
(SurModics, Inc., Eden Prairie, Minn.) in PBS
[0180] 4. Wash buffer: PBS containing 0.1% TWEEN (polysorbate
20)
[0181] 5. Color reaction substrate: TMB
(3,3',5,5'-Tetramethylbenzidine)
[0182] Preparation of Positive and Negative Controls
[0183] FMDV antibody negative bovine and porcine from FMDV-free
farms in the U.S. were screened using a 3ABC cELISA. One bovine and
three porcine were first immunized with recombinant 3ABC emulsified
in Complete Freund's Adjuvant and then boosted with the same
antigen emulsified in Incomplete Freund's Adjuvant. Serum from a
FMDV negative bovine was used as the negative control in the assay.
Positive bovine and porcine control serum was also collected and
used to validate the immunoassay. These non-infectious positive
controls showed reliable and concentration-dependent positive
results in the cELISA format (Table 4).
Example: Assay Procedure
[0184] 1. Add 50 .mu.l serum at 1:2 in PBS to each well and
incubate 30 min at room temperature.
[0185] 2. Wash plate three times with 250 .mu.l per well.
[0186] 3. Add 50 .mu.l HRP conjugated Mab and incubate at room
temperature for 30 min.
[0187] 4. Wash plate 3 times with 250 .mu.l per well wash
buffer.
[0188] 5. Add 50 .mu.l substrate per well and incubate 20 min at
room temperature.
[0189] 6. Add 50 .mu.l Stop solution to each well and read at 450
nm.
TABLE-US-00004 TABLE 4 Representative QC data tested with
sensitivity panel and control sera (bovine positive and negative) %
Sample I.D., Dilution OD OD Mean Inhibition C673 (+), 1:20 0.204
0.198 0.201 77.4 C673 (+), 1:40 0.274 0.278 0.276 68.9 C673 (+),
1:80 0.392 0.393 0.393 55.8 C673 (+), 1:160 0.602 0.598 0.600 32.5
Kit (-) 0.905 0.924 0.889 0.0 0.849 0.876 Kit (+) 0.265 0.266 0.259
70.8 0.250 0.256
Example: Analytical Sensitivity Evaluation
[0190] Seven FMDV Serotypes Limit of Detection Analysis
[0191] In order to determine the analytical sensitivity of the
assay, sera collected from animals infected with one of each of the
seven FMDV serotypes were diluted two-fold, to a maximum dilution
of 1:2048. Samples from each dilution were evaluated in the 3ABC
ELISA twice and once in a commercially available assay according to
manufacturer's instructions (PrioCHECK.RTM. FMDV NS Antibody ELISA,
ThermoFisher Scientific, Grand Island, N.Y.). The highest dilution
at which a positive reaction was recorded is listed in Table 5. The
analytical sensitivity for the 3ABC ELISA was at least 16- to
32-fold more sensitive for the Asia-1 serotype sample (cut-off
dependent), two-fold more sensitive for serotype O 1, comparable
sensitivity for serotypes A, C, SAT-1, and SAT-2, and one dilution
less sensitive for SAT-3 compared to the PrioCHECK.RTM. FMDV NS
Antibody ELISA. Sera collected from animals infected with one of
the seven FMDV serotypes were reactive in both assays, and the
sensitivity for the 3ABC ELISA was optimal for a competitive ELISA
format.
TABLE-US-00005 TABLE 5 Analytical Sensitivity of the 3ABC ELISA for
seven FMDV serotypes with 35% inhibition as the cut-off (1st test)
(45% inhibition as the cut-off in the 2nd test). For example,
1:2048 detection is better/more sensitive than 1:32. Highest
dilution for a positive response 3ABC ELISA 3ABC ELISA FMDV
serotype (1.sup.st test) (2nd test) PrioCHECK .RTM. A 1:512 (256)
1:256 (128) 1:128 Asia-1 1:2048 (512) 1:2048 (1024) 1:32 C 1:64
(32) 1:128 (32) 1:32 O 1 1:512 (256) 1:256 (128) 1:64 SAT-1 1:512
(256) 1:256 (128) 1:128 SAT-2 1:128 (64) 1:64 (64) 1:32 SAT-3 1:32
(16) 1:32 (16) 1:32
[0192] Post-Infection Antibody Detection Time Point/Window
Determination
[0193] One male castrated steer was infected intradermolingually
(IDL) with one FMDV serotype, (4 calves were each infected with one
of 4 FMDV serotypes, A Iraq 2009, Asia 1 Shamir, SAT-1, and O
Israel 2008). For each IDL-challenge calf, four uninfected cattle
were mingled in order to be infected via the contact route. Serum
samples were collected from each animal nearly every day from days
0 to 14, and then on days 21 or 22, 28, and 35 or 36.
[0194] The 3ABC ELISA detected antibodies in sera from cattle
infected with one of the four FMDV serotypes between 7 to 10 days
post-infection (dpi) (FIG. 11). Antibodies to FMDV O Israel 2008
were detected by 7 dpi, to Asia 1 Shamir by 8 dpi, to A Iraq 2009
by 9 dpi, and to SAT-1 by 10 dpi.
[0195] In another embodiment designed to determine when antibodies
to the FMDV 3ABC nonstructural proteins can be detected by the 3ABC
ELISA following infection, sera were collected over time from
cattle that were infected with one of three FMDV serotypes, SAT-1,
SAT-2, or SAT-3. Sera from various days post-infection (dpi) were
evaluated using the 3ABC ELISA. The first day on which there was a
positive reaction in the 3ABC ELISA are summarized in Table 6.
TABLE-US-00006 TABLE 6 Detection of antibodies to FMDV
nonstructural proteins from FMDV- infected cattle. Days
Post-Infection when antibodies to FMDV non-structural proteins were
detected in cattle Test used to detect sera following infection
with one of three antibodies to FMDV FMDV serotypes (no. cattle)
non-structural proteins SAT-1 (n = 2) SAT-2 (n = 2) SAT-3 (n = 2)
3ABC ELISA 7, 10 6, 4 10, 11
[0196] These data indicates that the new FMDV 3ABC ELISA will be
useful in detecting antibodies in cattle within 7 to 13 days
post-infection with any one of the FMDV serotype SAT 1, SAT-2, or
SAT-3 strains.
Example: Analytical Specificity Evaluation
[0197] FMD Look-Alike Samples Specificity Analysis
[0198] Diagnostic bovine sera samples previously evaluated and
identified as having been collected from animals infected with
pathogens that cause FMD look-alike lesions were tested with the
3ABC ELISA, the FMDV 3D virus infection associated antigen agar gel
immunodiffusion (VIAA AGID), and by assays specific for the
pathogen, e.g. Vesicular Stomatitis Virus (VSV) ELISA. Data are
summarized in Table 7.
TABLE-US-00007 TABLE 7 Specificity of FMDV 3ABC ELISA on diagnostic
serum samples that were confirmed as negative for FMDV antibodies
and positive for VSV antibodies. No. of No. Identified as Positive
samples FMDV 3D FMDV 3ABC tested VSV ELISA VIAA AGID ELISA
Specificity 55 55 0 0 100%
[0199] The specificity was 100% for sera tested from 55 cattle that
had been infected with VSV and were positive for VSV antibodies. In
the 3ABC ELISA, all samples exhibited .ltoreq.28% inhibition with
an average of -12% inhibition and a standard deviation of 25%.
[0200] In another experiment, 44 samples from 8 species of
FMDV-susceptible animals that exhibited vesicular lesions but were
free of FMDV, were tested by three assays: 1) FMDV 3ABC ELISA, 2)
FMDV 3D VIAA AGID, and 3) FMDV PrioCHECK. Data are summarized in
Table 8.
TABLE-US-00008 TABLE 8 Specificity of FMDV 3ABC ELISA on sera from
vesicular disease diagnostic samples that were confirmed as FMDV
negative No. Identified No. Identified as Negative As Positive
Animal FMDV 3ABC FMDV 3D FMDV by any of Species ELISA VIAA AGID
PrioCHECK .RTM. the three assays Alpaca 2 2 2 0 Bison 1 1 1 0
Bovine 28 28 28 0 Buffalo 1 1 1 0 Goat 4 4 4 0 Ovine 2 2 2 0 Swine
4 4 4 0 Yak 2 2 2 0 Total 44 44 44 0
[0201] The specificity of the 3ABC ELISA was 100% for 44 samples
collected from 8 species of animals that were FMDV free and
exhibited vesicular lesions, i.e. rule-out data provided by the
USDA Animal and Plant Health Inspection Service Foreign Animal
Disease Diagnostic Laboratory. The same results were obtained in
the FMDV PrioCHECK.RTM. FMDV NS Antibody ELISA and the FMDV 3D VIAA
AGID assays.
[0202] Adenovirus-A24 FMD Vaccine Vaccinated Samples Specificity
Analysis
[0203] Cattle from Michigan and Nebraska were vaccinated with the
conditionally licensed Ad-A24 FMD vaccine (USDA product code
1FM1.R0). Forty-nine cattle serum samples collected approximately
11 months post-vaccination were positive using serum virus
neutralization (SVN) to detect antibodies produced to the FMDV A24
capsid proteins (average titer=1.5 log 10, std. dev.=0.5, range 0.9
to 2.7 log 10) (FIG. 12). Antibodies were not detected to the FMDV
non-structural proteins, as expected, since these animals had been
vaccinated but not infected with FMDV. In the 3ABC ELISA, the
average % inhibition was 1.5%, std. dev.=16%, and range=-29% to
31%. There was no correlation between the SVN titers to the A24
antigen and the percent inhibition measured in the 3ABC ELISA;
correlation=0.025 (R.sup.2=0.0006). This data indicates that the
3ABC ELISA is suitable as a companion diagnostic assay for AdFMD
based vaccines.
Example: Diagnostic Sensitivity Evaluation
[0204] Positive Reference Sample Set (Known Positive Status)
Analysis
[0205] Serum samples obtained from 139 animals, at least 10 to 14
days post-infection with a known serotype of FMDV, were evaluated
for their response in the 3ABC ELISA and with the commercially
available PrioCHECK.RTM. FMDV NS Antibody ELISA. The samples were
obtained from 112 cattle, 18 pigs, 5 sheep, and 4 goats that were
experimentally infected with one of the seven FMDV serotypes; this
sample set covered the full spectrum of all seven serotypes. All
139 serum samples were positive with the FMDV 3ABC ELISA assay, and
136 of those samples were positive with the PrioCHECK.RTM. FMDV NS
Antibody ELISA (Table 9). The results demonstrate that the 3ABC
ELISA can detect antibodies produced to the seven serotypes of FMDV
3ABC nonstructural protein in diverse animal species.
[0206] The diagnostic sensitivity was calculated using the results
from the 139 serum samples (Table 10). Since all 139 serum samples
that were collected from FMDV-infected animals (known positives)
exhibited a positive response in the 3ABC ELISA, the diagnostic
sensitivity was 100%. In the PrioCHECK.RTM. FMDV NS Antibody ELISA,
136 of the same 139 samples were positive, which indicates a
diagnostic sensitivity of 97.8%. The % inhibition (% I)
distribution of these samples in the 3ABC ELISA are provided
graphically on the right side of the vertical line in FIG. 13.
TABLE-US-00009 TABLE 9 Detection of antibodies to FMDV produced in
animals infected with one of seven serotypes of FMDV FMDV Serotype*
3ABC ELISA Positive FMDV PrioCHECK .RTM. Positive A 52 52 O 23 23 C
1 1 SAT1 22 20 SAT2 3 3 SAT3 20 20 Asia-1 18 17 Total 139 136
*Serum samples were from 112 bovine, 18 swine, 5 ovine, and 4
caprine experimentally infected animals.
TABLE-US-00010 TABLE 10 Diagnostic sensitivity of the 3ABC ELISA
compared to the PrioCHECK with reference to samples that were
obtained from animals infected with FMDV. FMDV Assay Result 3ABC
ELISA PrioCHECK Positive 139 136 Negative 0 3 Total Samples Tested
(Known Positives) 139 139 Diagnostic Sensitivity 100% 97.8%
[0207] Diagnostic Specificity Evaluation
[0208] Approximately 500 bovine sera were split into two sample
sets and tested by two laboratories, to assessed diagnostic
specificity. At TVMDL, there were 4 false positives out of 491
serum samples using 45% inhibition cut-off, resulting in 99.2%
diagnostic specificity (FIG. 14). At FADDL, one false positive (out
of 486) was obtained, resulting in 99.8% diagnostic specificity;
this one false positive was one of the four false positives
identified at TVMDL, i.e., same biological sample. Comparison of
the TVMDL and FADDL % inhibition for the samples resulted in TVMDL
% I average (Avg)=-0.018, standard deviation (SD)=14.6; FADDL % I
Avg=-7.48, SD=22.5; p value <0.05. Although a significant
difference in % I was observed, equivalent diagnostic specificity
(probability that a negative sample test negative) was obtained;
TVMDL Dx sp=99.2% and FADDL Dx sp=99.8%. This indicates that the
assay of the current disclosure exhibits a wide % I distribution
range for negatives (see FIGS. 12, 13, and 14) enabling tolerance
of % I differences between labs and testers and high diagnostic
specificity.
[0209] Furthermore, 200 samples from this 491 sample set was also
tested with the PrioCHECK.RTM. FMDV NS Antibody ELISA at FADDL and
8 false positives were identified, resulting in 96% diagnostic
specificity; only one of the false positives corresponded to the
3ABC ELISA false positive identified by TVMDL, i.e., same
biological sample.
[0210] It should be understood that the examples and embodiments
described herein are for illustrative purposes only and that
various modifications or changes in light thereof will be suggested
to persons skilled in the art and are to be included within the
spirit and purview of this application and the scope of the
appended claims. In addition, any elements or limitations of any
invention or embodiment thereof disclosed herein can be combined
with any and/or all other elements or limitations (individually or
in any combination) or any other invention or embodiment thereof
disclosed herein, and all such combinations are contemplated with
the scope of the invention without limitation thereto.
Sequence CWU 1
1
301437PRTFoot-and-mouth disease virusMISC_FEATURE(1)..(437)3ABC
protein from FMDV Campos 437 (GenBank CAC86575.1, amino acids
1426-1862) 1Ile Ser Ile Pro Ser Gln Lys Ser Val Leu Tyr Phe Leu Ile
Glu Lys 1 5 10 15 Gly Gln His Glu Ala Ala Ile Glu Phe Phe Glu Gly
Met Val His Asp 20 25 30 Ser Ile Lys Glu Glu Leu Arg Pro Leu Ile
Gln Gln Thr Ser Phe Val 35 40 45 Lys Arg Ala Phe Lys Arg Leu Lys
Glu Asn Phe Glu Ile Val Ala Leu 50 55 60 Cys Leu Thr Leu Leu Ala
Asn Ile Val Ile Met Ile Arg Glu Thr Arg 65 70 75 80 Lys Arg Gln Lys
Met Val Asp Asp Ala Val Asn Glu Tyr Ile Glu Lys 85 90 95 Ala Asn
Ile Thr Thr Asp Asp Lys Thr Leu Asp Glu Ala Glu Lys Ser 100 105 110
Pro Leu Glu Thr Ser Gly Ala Ser Thr Val Gly Phe Arg Glu Arg Thr 115
120 125 Leu Pro Gly Gln Lys Ala Cys Asp Asp Val Asn Ser Glu Pro Ala
Gln 130 135 140 Pro Val Glu Glu Gln Pro Gln Ala Glu Gly Pro Tyr Ala
Gly Pro Leu 145 150 155 160 Glu Arg Gln Lys Pro Leu Lys Val Arg Ala
Lys Leu Pro Gln Gln Glu 165 170 175 Gly Pro Tyr Ala Gly Pro Met Glu
Arg Gln Lys Pro Leu Lys Val Lys 180 185 190 Ala Lys Ala Pro Val Val
Lys Glu Gly Pro Tyr Glu Gly Pro Val Lys 195 200 205 Lys Pro Val Ala
Leu Lys Val Lys Ala Lys Asn Leu Ile Val Thr Glu 210 215 220 Ser Gly
Ala Pro Pro Thr Asp Leu Gln Lys Met Val Met Gly Asn Thr 225 230 235
240 Lys Pro Val Glu Leu Ile Leu Asp Gly Lys Thr Val Ala Ile Cys Cys
245 250 255 Ala Thr Gly Val Phe Gly Thr Ala Tyr Leu Val Pro Arg His
Leu Phe 260 265 270 Ala Glu Lys Tyr Asp Lys Ile Met Leu Asp Gly Arg
Ala Met Thr Asp 275 280 285 Ser Asp Tyr Arg Val Phe Glu Phe Glu Ile
Lys Val Lys Gly Gln Asp 290 295 300 Met Leu Ser Asp Ala Ala Leu Met
Val Leu His Arg Gly Asn Arg Val 305 310 315 320 Arg Asp Ile Thr Lys
His Phe Arg Asp Thr Ala Arg Met Lys Lys Gly 325 330 335 Thr Pro Val
Val Gly Val Ile Asn Asn Ala Asp Val Gly Arg Leu Ile 340 345 350 Phe
Ser Gly Glu Ala Leu Thr Tyr Lys Asp Ile Val Val Cys Met Asp 355 360
365 Gly Asp Thr Met Pro Gly Leu Phe Ala Tyr Arg Ala Ala Thr Lys Ala
370 375 380 Gly Tyr Cys Gly Gly Ala Val Leu Ala Lys Asp Gly Ala Asp
Thr Phe 385 390 395 400 Ile Val Gly Thr His Ser Ala Gly Gly Asn Gly
Val Gly Tyr Cys Ser 405 410 415 Cys Val Ser Arg Ser Met Leu Leu Lys
Met Lys Ala His Ile Asp Pro 420 425 430 Glu Pro His His Glu 435
2209PRTArtificial SequenceFMDV sequence encoded by pET31b+12X3B
2Gly Gly Gly Gly Ser Pro Tyr Val Gly Pro Leu Glu Arg Gln Lys Pro 1
5 10 15 Leu Gly Gly Gly Gly Ser Pro Tyr Ser Gly Pro Leu Glu Arg Gln
Lys 20 25 30 Pro Leu Gly Gly Gly Gly Ser Pro Tyr Gly Gly Pro Leu
Glu Arg Gln 35 40 45 Lys Pro Leu Gly Gly Gly Gly Ser Pro Tyr Ala
Gly Pro Val Glu Arg 50 55 60 Gln Lys Pro Leu Gly Gly Gly Gly Ser
Pro Tyr Ala Gly Pro Met Glu 65 70 75 80 Arg Gln Lys Pro Leu Gly Gly
Gly Gly Ser Pro Tyr Thr Gly Pro Leu 85 90 95 Glu Arg Gln Arg Pro
Leu Gly Gly Gly Gly Ser Pro Tyr Ala Gly Pro 100 105 110 Leu Glu Arg
Gln Gln Pro Leu Gly Gly Gly Gly Ser Pro Tyr Thr Gly 115 120 125 Pro
Leu Glu Arg Gln Lys Pro Leu Gly Gly Gly Gly Ser Pro Tyr Ala 130 135
140 Gly Pro Leu Glu Arg Gln Arg Pro Leu Gly Gly Gly Gly Ser Pro Tyr
145 150 155 160 Ala Gly Pro Leu Glu Arg Gln Lys Pro Leu Gly Gly Gly
Gly Ser Pro 165 170 175 Tyr Ala Gly Pro Leu Glu Arg Gln Ile Pro Leu
Gly Gly Gly Gly Ser 180 185 190 Pro Tyr Ala Gly Ala Phe Glu Arg Gln
Lys Thr Leu Gly Gly Gly Gly 195 200 205 Ser 314PRTArtificial
SequenceSequence of the epitope for Mab 40C8 binding 3Gly Pro Tyr
Ala Gly Pro Leu Glu Arg Gln Lys Pro Leu Lys 1 5 10 46PRTArtificial
SequenceSequence of the minimal epitope for Mab 40C8 binding 4Gly
Pro Leu Glu Arg Gln 1 5 56PRTArtificial SequenceAlternate sequence
of the minimal epitopes for MAB 40C8MISC_FEATURE(2)..(3)Xaa is any
amino acid 5Gly Xaa Xaa Glu Arg Gln 1 5 615PRTArtificial
SequenceFMDV peptide 6Cys Gly Pro Tyr Ala Gly Pro Leu Glu Arg Gln
Lys Pro Leu Lys 1 5 10 15 720DNAArtificial SequenceForward PCR
primer 7caattccttc ccaaaaatct 20821DNAArtificial SequenceReverse
PCR primer 8gtggtgtggt tcggggtcca a 2196708DNAArtificial
SequenceNucleotide sequence of plasmid pET30c O1C 3ABC* 9tggcgaatgg
gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60cagcgtgacc
gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc
120ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc
tccctttagg 180gttccgattt agtgctttac ggcacctcga ccccaaaaaa
cttgattagg gtgatggttc 240acgtagtggg ccatcgccct gatagacggt
ttttcgccct ttgacgttgg agtccacgtt 300ctttaatagt ggactcttgt
tccaaactgg aacaacactc aaccctatct cggtctattc 360ttttgattta
taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta
420acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag
gtggcacttt 480tcggggaaat gtgcgcggaa cccctatttg tttatttttc
taaatacatt caaatatgta 540tccgctcatg aattaattct tagaaaaact
catcgagcat caaatgaaac tgcaatttat 600tcatatcagg attatcaata
ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660actcaccgag
gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc
720gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta
tcaagtgaga 780aatcaccatg agtgacgact gaatccggtg agaatggcaa
aagtttatgc atttctttcc 840agacttgttc aacaggccag ccattacgct
cgtcatcaaa atcactcgca tcaaccaaac 900cgttattcat tcgtgattgc
gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960aattacaaac
aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat
1020tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg
gggatcgcag 1080tggtgagtaa ccatgcatca tcaggagtac ggataaaatg
cttgatggtc ggaagaggca 1140taaattccgt cagccagttt agtctgacca
tctcatctgt aacatcattg gcaacgctac 1200ctttgccatg tttcagaaac
aactctggcg catcgggctt cccatacaat cgatagattg 1260tcgcacctga
ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca
1320tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg
ctcataacac 1380cccttgtatt actgtttatg taagcagaca gttttattgt
tcatgaccaa aatcccttaa 1440cgtgagtttt cgttccactg agcgtcagac
cccgtagaaa agatcaaagg atcttcttga 1500gatccttttt ttctgcgcgt
aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560gtggtttgtt
tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc
1620agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca
ccacttcaag 1680aactctgtag caccgcctac atacctcgct ctgctaatcc
tgttaccagt ggctgctgcc 1740agtggcgata agtcgtgtct taccgggttg
gactcaagac gatagttacc ggataaggcg 1800cagcggtcgg gctgaacggg
gggttcgtgc acacagccca gcttggagcg aacgacctac 1860accgaactga
gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga
1920aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac
gagggagctt 1980ccagggggaa acgcctggta tctttatagt cctgtcgggt
ttcgccacct ctgacttgag 2040cgtcgatttt tgtgatgctc gtcagggggg
cggagcctat ggaaaaacgc cagcaacgcg 2100gcctttttac ggttcctggc
cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160tcccctgatt
ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc
2220agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg
cctgatgcgg 2280tattttctcc ttacgcatct gtgcggtatt tcacaccgca
tatatggtgc actctcagta 2340caatctgctc tgatgccgca tagttaagcc
agtatacact ccgctatcgc tacgtgactg 2400ggtcatggct gcgccccgac
acccgccaac acccgctgac gcgccctgac gggcttgtct 2460gctcccggca
tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag
2520gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat
cagcgtggtc 2580gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc
agctcgttga gtttctccag 2640aagcgttaat gtctggcttc tgataaagcg
ggccatgtta agggcggttt tttcctgttt 2700ggtcactgat gcctccgtgt
aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760acgagagagg
atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg
2820ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa
tcactcaggg 2880tcaatgccag cgcttcgtta atacagatgt aggtgttcca
cagggtagcc agcagcatcc 2940tgcgatgcag atccggaaca taatggtgca
gggcgctgac ttccgcgttt ccagacttta 3000cgaaacacgg aaaccgaaga
ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060gcagtcgctt
cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc
3120ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc
gtggggccgc 3180catgccggcg ataatggcct gcttctcgcc gaaacgtttg
gtggcgggac cagtgacgaa 3240ggcttgagcg agggcgtgca agattccgaa
taccgcaagc gacaggccga tcatcgtcgc 3300gctccagcga aagcggtcct
cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360gagttgcatg
ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca
3420ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc
ccggtgccta 3480atgagtgagc taacttacat taattgcgtt gcgctcactg
cccgctttcc agtcgggaaa 3540cctgtcgtgc cagctgcatt aatgaatcgg
ccaacgcgcg gggagaggcg gtttgcgtat 3600tgggcgccag ggtggttttt
cttttcacca gtgagacggg caacagctga ttgcccttca 3660ccgcctggcc
ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa
3720aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg
gtatcgtcgt 3780atcccactac cgagatgtcc gcaccaacgc gcagcccgga
ctcggtaatg gcgcgcattg 3840cgcccagcgc catctgatcg ttggcaacca
gcatcgcagt gggaacgatg ccctcattca 3900gcatttgcat ggtttgttga
aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960tcggctgaat
ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg
4020agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat
gcgaccagat 4080gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat
aatactgttg atgggtgtct 4140ggtcagagac atcaagaaat aacgccggaa
cattagtgca ggcagcttcc acagcaatgg 4200catcctggtc atccagcgga
tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260tgtgcaccgc
cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc
4320tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac
ggcgcgtgca 4380gggccagact ggaggtggca acgccaatca gcaacgactg
tttgcccgcc agttgttgtg 4440ccacgcggtt gggaatgtaa ttcagctccg
ccatcgccgc ttccactttt tcccgcgttt 4500tcgcagaaac gtggctggcc
tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560catactctgc
gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct
4620cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg
gtgtccggga 4680tctcgacgct ctcccttatg cgactcctgc attaggaagc
agcccagtag taggttgagg 4740ccgttgagca ccgccgccgc aaggaatggt
gcatgcaagg agatggcgcc caacagtccc 4800ccggccacgg ggcctgccac
catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860cgagcccgat
cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg
4920gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatcga
tctcgatccc 4980gcgaaattaa tacgactcac tataggggaa ttgtgagcgg
ataacaattc ccctctagaa 5040ataattttgt ttaactttaa gaaggagata
tacatatgca ccatcatcat catcattctt 5100ctggtctggt gccacgcggt
tctggtatga aagaaaccgc tgctgctaaa ttcgaacgcc 5160agcacatgga
cagcccagat ctgggtaccg acgacgacga caaggccatg ggatatctgt
5220ggatcccaat tccttcccaa aaatctgtgt tgtactttct cattgagaag
ggccaacatg 5280aggcagcaat tgaattcttt gagggcatgg tccacgactc
catcaaagag gaactccgac 5340ccctcatcca acaaacttca tttgtgaaac
gcgctttcaa gcgcctgaag gaaaattttg 5400agattgttgc tctgtgttta
acacttttgg caaacattgt gatcatgatc cgtgagactc 5460gcaagaggca
gaaaatggtg gatgatgcag tgaatgagta cattgagaaa gcaaacatca
5520ccacagatga caagactctt gacgaggcgg agaagagccc tctagagacc
agcggcgcca 5580gcaccgttgg ctttagagag agaactctcc caggtcaaaa
ggcatgcgat gacgtgaact 5640ccgagcctgc ccaacctgtt gaggagcaac
cacaagctga aggaccctac gccggaccac 5700tcgagcgtca gaaacctctg
aaagtgagag ccaagctccc acagcaggag gggccttacg 5760ctggtccgat
ggagagacag aaaccgctaa aagtgaaagc aaaagccccg gtcgtgaagg
5820aaggacctta cgagggaccg gtgaagaagc ctgtcgcttt gaaagtgaaa
gctaagaacc 5880tgattgtcac tgagagtggt gctccaccga ccgacttgca
aaagatggtc atgggcaaca 5940caaagcctgt tgagctcatc ctcgacggga
agacagtagc catctgctgc gctactggag 6000tgtttggcac tgcttacctc
gtgcctcgtc acctcttcgc agagaagtat gacaagatca 6060tgttggacgg
cagagccatg acagacagtg actacagagt gtttgagttt gagatcaaag
6120taaaaggaca ggacatgctc tcagacgccg cgctcatggt gctccaccgt
gggaaccgcg 6180tgagggacat cacgaagcac tttcgtgaca cagcaagaat
gaagaaaggc acccccgttg 6240tcggtgtgat caacaacgcc gatgtcggga
gactgatttt ctctggtgag gcccttactt 6300acaaggacat tgtggtttgc
atggacggag acaccatgcc tggcctcttt gcctacagag 6360ccgccaccaa
ggctggttat cgtggaggag ccgtcctcgc taaggacggg gctgacacgt
6420tcatcgttgg cacccactcc gctggaggca agggagttgg atactgctca
tgcgtttcca 6480ggtccatgct tcttaaaatg aaggcacaca ttgaccccga
accacaccac aagcttgcgg 6540ccgcactcga gcaccaccac caccaccact
gagatccggc tgctaacaaa gcccgaaagg 6600aagctgagtt ggctgctgcc
accgctgagc aataactagc ataacccctt ggggcctcta 6660aacgggtctt
gaggggtttt ttgctgaaag gaggaactat atccggat 6708101304DNAArtificial
SequenceNucleotide sequence encoding O1C 3ABC* 10caattccttc
ccaaaaatct gtgttgtact ttctcattga gaagggccaa catgaggcag 60caattgaatt
ctttgagggc atggtccacg actccatcaa agaggaactc cgacccctca
120tccaacaaac ttcatttgtg aaacgcgctt tcaagcgcct gaaggaaaat
tttgagattg 180ttgctctgtg tttaacactt ttggcaaaca ttgtgatcat
gatccgtgag actcgcaaga 240ggcagaaaat ggtggatgat gcagtgaatg
agtacattga gaaagcaaac atcaccacag 300atgacaagac tcttgacgag
gcggagaaga gccctctaga gaccagcggc gccagcaccg 360ttggctttag
agagagaact ctcccaggtc aaaaggcatg cgatgacgtg aactccgagc
420ctgcccaacc tgttgaggag caaccacaag ctgaaggacc ctacgccgga
ccactcgagc 480gtcagaaacc tctgaaagtg agagccaagc tcccacagca
ggaggggcct tacgctggtc 540cgatggagag acagaaaccg ctaaaagtga
aagcaaaagc cccggtcgtg aaggaaggac 600cttacgaggg accggtgaag
aagcctgtcg ctttgaaagt gaaagctaag aacctgattg 660tcactgagag
tggtgctcca ccgaccgact tgcaaaagat ggtcatgggc aacacaaagc
720ctgttgagct catcctcgac gggaagacag tagccatctg ctgcgctact
ggagtgtttg 780gcactgctta cctcgtgcct cgtcacctct tcgcagagaa
gtatgacaag atcatgttgg 840acggcagagc catgacagac agtgactaca
gagtgtttga gtttgagatc aaagtaaaag 900gacaggacat gctctcagac
gccgcgctca tggtgctcca ccgtgggaac cgcgtgaggg 960acatcacgaa
gcactttcgt gacacagcaa gaatgaagaa aggcaccccc gttgtcggtg
1020tgatcaacaa cgccgatgtc gggagactga ttttctctgg tgaggccctt
acttacaagg 1080acattgtggt ttgcatggac ggagacacca tgcctggcct
ctttgcctac agagccgcca 1140ccaaggctgg ttatcgtgga ggagccgtcc
tcgctaagga cggggctgac acgttcatcg 1200ttggcaccca ctccgctgga
ggcaagggag ttggataccg ctcatgcgtt tccaggtcca 1260tgcttcttaa
aatgaaggca cacattgacc ccgaaccaca ccac 130411447PRTArtificial
SequenceAmino acid sequence corresponding to the serotype O FMDV
3ABC* protein and encoding a His6 tag for E. coli expression 11Ile
Pro Ser Gln Lys Ser Val Leu Tyr Phe Leu Ile Glu Lys Gly Gln 1 5 10
15 His Glu Ala Ala Ile Glu Phe Phe Glu Gly Met Val His Asp Ser Ile
20 25 30 Lys Glu Glu Leu Arg Pro Leu Ile Gln Gln Thr Ser Phe Val
Lys Arg 35 40 45 Ala Phe Lys Arg Leu Lys Glu Asn Phe Glu Ile Val
Ala Leu Cys Leu 50 55 60 Thr Leu Leu Ala Asn Ile Val Ile Met Ile
Arg Glu Thr Arg Lys Arg 65 70 75 80 Gln Lys Met Val Asp Asp Ala Val
Asn Glu Tyr Ile Glu Lys Ala Asn 85 90 95 Ile Thr Thr Asp Asp Lys
Thr Leu Asp Glu Ala Glu Lys Ser Pro Leu 100 105 110 Glu Thr Ser Gly
Ala Ser Thr Val Gly Phe Arg Glu Arg Thr Leu Pro 115 120 125 Gly Gln
Lys Ala Cys Asp Asp Val Asn Ser Glu Pro Ala Gln Pro Val 130 135 140
Glu Glu Gln Pro Gln Ala Glu Gly Pro Tyr Ala Gly Pro Leu Glu Arg 145
150 155 160 Gln Lys Pro Leu Lys Val Arg Ala Lys Leu Pro Gln Gln Glu
Gly Pro 165 170 175 Tyr Ala Gly Pro Met Glu Arg Gln Lys Pro Leu Lys
Val Lys Ala Lys 180 185 190 Ala Pro Val Val Lys Glu Gly Pro Tyr Glu
Gly Pro Val Lys Lys Pro 195 200 205 Val Ala Leu Lys Val Lys Ala Lys
Asn Leu Ile Val Thr Glu Ser Gly 210 215 220 Ala Pro Pro Thr Asp Leu
Gln Lys Met Val Met Gly Asn Thr Lys Pro 225 230 235 240 Val Glu Leu
Ile Leu Asp Gly Lys Thr Val Ala
Ile Cys Cys Ala Thr 245 250 255 Gly Val Phe Gly Thr Ala Tyr Leu Val
Pro Arg His Leu Phe Ala Glu 260 265 270 Lys Tyr Asp Lys Ile Met Leu
Asp Gly Arg Ala Met Thr Asp Ser Asp 275 280 285 Tyr Arg Val Phe Glu
Phe Glu Ile Lys Val Lys Gly Gln Asp Met Leu 290 295 300 Ser Asp Ala
Ala Leu Met Val Leu His Arg Gly Asn Arg Val Arg Asp 305 310 315 320
Ile Thr Lys His Phe Arg Asp Thr Ala Arg Met Lys Lys Gly Thr Pro 325
330 335 Val Val Gly Val Ile Asn Asn Ala Asp Val Gly Arg Leu Ile Phe
Ser 340 345 350 Gly Glu Ala Leu Thr Tyr Lys Asp Ile Val Val Cys Met
Asp Gly Asp 355 360 365 Thr Met Pro Gly Leu Phe Ala Tyr Arg Ala Ala
Thr Lys Ala Gly Tyr 370 375 380 Arg Gly Gly Ala Val Leu Ala Lys Asp
Gly Ala Asp Thr Phe Ile Val 385 390 395 400 Gly Thr His Ser Ala Gly
Gly Lys Gly Val Gly Tyr Arg Ser Cys Val 405 410 415 Ser Arg Ser Met
Leu Leu Lys Met Lys Ala His Ile Asp Pro Glu Pro 420 425 430 His His
Lys Leu Ala Ala Ala Leu Glu His His His His His His 435 440 445
1214PRTFoot-and-mouth disease virusMISC_FEATURE(6)..(7)Xaa is any
amino acid 12Gly Pro Tyr Ala Gly Xaa Xaa Glu Arg Gln Lys Pro Leu
Lys 1 5 10 1314PRTArtificial Sequence3 ABC peptide 13Gly Pro Tyr
Ala Gly Pro Leu Glu Arg Gln Lys Pro Leu Lys 1 5 10
1414PRTArtificial Sequence3 ABC peptide 14Gly Pro Tyr Thr Gly Pro
Leu Glu Arg Gln Lys Pro Leu Lys 1 5 10 1514PRTArtificial Sequence3
ABC peptide 15Gly Pro Tyr Ala Gly Pro Leu Glu Arg Gln Arg Pro Leu
Lys 1 5 10 1614PRTArtificial Sequence3 ABC peptide 16Gly Pro Tyr
Ala Gly Pro Leu Glu Arg Gln Gln Pro Leu Lys 1 5 10
1714PRTArtificial Sequence3 ABC peptide 17Gly Pro Tyr Thr Gly Pro
Leu Glu Arg Gln Arg Pro Leu Lys 1 5 10 1814PRTArtificial Sequence3
ABC peptide 18Gly Pro Tyr Ala Gly Pro Met Glu Arg Gln Lys Pro Leu
Lys 1 5 10 1914PRTArtificial Sequence3 ABC peptide 19Gly Pro Tyr
Val Gly Pro Leu Glu Arg Gln Lys Pro Leu Lys 1 5 10
2014PRTArtificial Sequence3 ABC peptide 20Gly Pro Tyr Ser Gly Pro
Leu Glu Arg Gln Lys Pro Leu Lys 1 5 10 2114PRTArtificial Sequence3
ABC peptide 21Gly Pro Tyr Gly Gly Pro Leu Glu Arg Gln Lys Pro Leu
Lys 1 5 10 2214PRTArtificial Sequence3 ABC peptide 22Gly Pro Tyr
Ala Gly Pro Val Glu Arg Gln Lys Pro Leu Arg 1 5 10
2314PRTArtificial Sequence3 ABC peptide 23Gly Pro Tyr Ala Gly Pro
Leu Glu Arg Gln Lys Pro Leu Thr 1 5 10 2414PRTArtificial Sequence3
ABC peptide 24Gly Pro Tyr Ala Gly Pro Leu Glu Arg Gln Lys Pro Leu
Arg 1 5 10 2514PRTArtificial Sequence3 ABC peptide 25Gly Pro Tyr
Ala Gly Pro Leu Glu Arg Gln Lys Pro Leu Gln 1 5 10
2614PRTArtificial Sequence3 ABC peptide 26Gly Pro Tyr Ala Gly Pro
Leu Glu Arg Gln Lys Pro Leu Glu 1 5 10 2714PRTArtificial Sequence3
ABC peptide 27Gly Pro Tyr Ala Gly Pro Leu Glu Arg Gln Ile Pro Leu
Lys 1 5 10 2814PRTArtificial Sequence3 ABC peptide 28Gly Pro Tyr
Ala Gly Ala Phe Glu Arg Gln Lys Thr Leu Lys 1 5 10 298PRTArtificial
Sequencesynthetic 29Ile Pro Ile Pro Ser Gln Lys Ser 1 5
305PRTArtificial Sequencesynthetic 30Pro Glu Pro His His 1 5
* * * * *