U.S. patent application number 16/039121 was filed with the patent office on 2018-12-06 for compositions and methods for improving post-harvest properties of agricultural crops.
This patent application is currently assigned to Novozymes A/S. The applicant listed for this patent is Novozymes A/S. Invention is credited to Romil Benyamino, Alex Berlin, Jason Quinlan.
Application Number | 20180343862 16/039121 |
Document ID | / |
Family ID | 52684733 |
Filed Date | 2018-12-06 |
United States Patent
Application |
20180343862 |
Kind Code |
A1 |
Berlin; Alex ; et
al. |
December 6, 2018 |
Compositions And Methods For Improving Post-Harvest Properties Of
Agricultural Crops
Abstract
The present invention relates to methods for modifying an
agricultural crop comprising treating the agricultural crop with a
composition comprising a xyloglucan endotransglycosylase and (a) a
polymeric xyloglucan and a functionalized xyloglucan oligomer
comprising a chemical group; (b) a polymeric xyloglucan
functionalized with a chemical group and a functionalized
xyloglucan oligomer comprising a chemical group; (c) a polymeric
xyloglucan functionalized with a chemical group and a xyloglucan
oligomer; (d) a polymeric xyloglucan, and a xyloglucan oligomer;
(e) a polymeric xyloglucan functionalized with a chemical group;
(f) a polymeric xyloglucan; (g) a functionalized xyloglucan
oligomer comprising a chemical group; or (h) a xyloglucan oligomer,
or (a-h) without a xyloglucan endotransglycosylase, in a medium
under conditions leading to a modified agricultural crop possessing
an improved property compared to the unmodified agricultural crop.
The present invention also relates to a modified agricultural crop
obtained by such methods.
Inventors: |
Berlin; Alex; (Davis,
CA) ; Quinlan; Jason; (Davis, CA) ; Benyamino;
Romil; (Davis, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Novozymes A/S |
Bagsvaerd |
|
DK |
|
|
Assignee: |
Novozymes A/S
Bagsvaerd
DK
|
Family ID: |
52684733 |
Appl. No.: |
16/039121 |
Filed: |
July 18, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15122610 |
Aug 30, 2016 |
|
|
|
PCT/US2015/019011 |
Mar 5, 2015 |
|
|
|
16039121 |
|
|
|
|
61948232 |
Mar 5, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A23V 2002/00 20130101;
A23B 7/14 20130101; A01N 37/20 20130101; A01N 43/16 20130101; A23B
7/155 20130101; A01N 37/46 20130101; A01N 37/46 20130101; A01N
43/16 20130101; A23L 3/3544 20130101; A01N 63/30 20200101; A01N
63/30 20200101; A01N 43/16 20130101 |
International
Class: |
A01N 43/16 20060101
A01N043/16; A01N 37/20 20060101 A01N037/20; A23L 3/3544 20060101
A23L003/3544 |
Claims
1-19. (canceled)
20. A modified agricultural crop comprising a modification selected
from the group consisting of (a) a polymeric xyloglucan and a
functionalized xyloglucan oligomer comprising a chemical group; (b)
a polymeric xyloglucan functionalized with a chemical group and a
functionalized xyloglucan oligomer comprising a chemical group; (c)
a polymeric xyloglucan functionalized with a chemical group and a
xyloglucan oligomer; (d) a polymeric xyloglucan, and a xyloglucan
oligomer; (e) a polymeric xyloglucan functionalized with a chemical
group; (f) a polymeric xyloglucan; (g) a functionalized xyloglucan
oligomer comprising a chemical group; and (h) a xyloglucan
oligomer, wherein the modified agricultural crop possesses an
improved property, and wherein the modified agricultural crop is a
fruit, a vegetable, a grain, a flower, or a spice.
21. The modified agricultural crop of claim 20, wherein the
improved property is one or more improvements selected from the
group consisting of reducing or preventing oxidative browning,
dehydration, desiccation, bacterial, fungal, microbial, animal, or
insect pest infestation, senescence, early ripening, and softening;
prevention of bruising, resistance to crushing, prevention or
enhancement of clustering, aggregation, or association; resistance
to adverse environmental factors; appearance, and taste, and
resistance to sun or UV damage.
22. The modified agricultural crop of claim 20, wherein the average
molecular weight of the polymeric xyloglucan or the polymeric
xyloglucan functionalized with a chemical group ranges from 2 kDa
to about 500 kDa.
23. The modified agricultural crop of claim 20, wherein the average
molecular weight of the xyloglucan oligomer or the functionalized
xyloglucan oligomer comprising a chemical group ranges from 0.5 kDa
to about 500 kDa.
24. The modified agricultural crop of claim 20, wherein the
polymeric xyloglucan or the polymeric xyloglucan functionalized
with a chemical group is present at about 1 ng per g of the
agricultural crop to about 1 g per g of the agricultural crop.
25. The modified agricultural crop of claim 20, wherein the
xyloglucan oligomer or the functionalized xyloglucan oligomer is
present with the polymeric xyloglucan at about 50:1 molar ratio to
about 0.5:1 xyloglucan oligomer or functionalized xyloglucan
oligomer to polymeric xyloglucan.
26. The modified agricultural crop of claim 20, wherein the
concentration of polymeric xyloglucan, the polymeric xyloglucan
functionalized with a chemical group, the xyloglucan oligomer, or
the functionalized xyloglucan oligomer comprising a chemical group
is about 0.01 g to about 500 mg per g of the agricultural crop.
27. The modified agricultural crop of claim 20, wherein the
xyloglucan oligomer or the functionalized xyloglucan oligomer is
present without polymeric xyloglucan or polymeric xyloglucan
functionalized with a chemical group at about 1 ng per g to about 1
g per g of the agricultural crop.
28. The modified agricultural crop of claim 20, wherein the
chemical group is a compound of interest or a reactive group.
29. The modified agricultural crop of claim 28, wherein the
reactive group is selected from the group consisting of an aldehyde
group, an amino group, an aromatic group, a carboxyl group, a
halogen group, a hydroxyl group, a ketone group, a nitrile group, a
nitro group, a sulfhydryl group, and a sulfonate group.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 15/122,610 filed on Aug. 30, 2016, which is a
35 U.S.C. .sctn. 371 national application of PCT/US2015/019011
filed on Mar. 5, 2015, which claims priority or the benefit under
35 U.S.C. .sctn. 119 of U.S. Provisional Application No. 61/948,232
filed on Mar. 5, 2014, the contents of which are fully incorporated
herein by reference.
REFERENCE TO A SEQUENCE LISTING
[0002] This application contains a Sequence Listing in computer
readable form, which is incorporated herein by reference.
BACKGROUND OF THE INVENTION
Field of the Invention
[0003] The present invention relates to compositions and methods
for improving properties of agricultural crops.
Description of the Related Art
[0004] Xyloglucan endotransglycosylase (XET) is an enzyme that
catalyzes endotransglycosylation of xyloglucan, a structural
polysaccharide of plant cell walls. The enzyme is present in most
plants, and in particular, land plants. XET has been extracted from
dicotyledons and monocotyledons.
[0005] Xyloglucan is present in cotton, paper, or wood fibers
(Hayashi et al., 1988, Carbohydrate Research 181: 273-277) making
strong hydrogen bonds to cellulose (Carpita and Gibeaut, 1993, The
Plant Journal 3: 1-30). Adding xyloglucan endotransglycosylase to
various cellulosic materials containing xyloglucan alters the
xyloglucan mediated interlinkages between cellulosic fibers
improving their strength, and maintaining the cellulose-structure
while permitting the cellulose fibers to move relative to one
another under force.
[0006] It is known in the art that much of the agricultural crops
grown in greenhouses and particularly open fields is spoiled by
exposure to the environment or to agricultural pests. It is
desirable in the art to form physical protection or barriers around
agricultural crops without the use of chemical or biological
pesticides. U.S. Pat. No. 6,027,740; U.S. Pat. No. 6,069,112; U.S.
Pat. No. 6,110,867, and U.S. Pat. No. 6,156,327 disclose methods of
crop protection by generating a physical barrier around produce. It
is also known that much of the produce harvested from fields,
gardens and greenhouses is lost to spoilage before consumption or
sale. The quantity of loss is estimated from 0 to 25% in first
world nations, and 0 to 50% in third world nations, depending on
the crop harvested, which extrapolates to substantial economic,
nutritive and sociological loss. In first world nations, the
majority of post-harvest loss is termed qualitative loss; produce
not spoiled remains unconsumed or unsold due to negative
appearance.
[0007] There is a need in the art to preserve agricultural crops,
both in appearance and from spoilage, rot, or contamination. There
is also a need in the art to extend the length of time between
harvest and market over which harvested crops remain fresh in
appearance. There is a further need in the art to preserve or slow
the onset of spoilage or the appearance of spoilage for cut or
prepared produce.
[0008] The present invention provides methods for improving
properties of agricultural crops.
SUMMARY OF THE INVENTION
[0009] The present invention relates to methods for modifying an
agricultural crop comprising treating the agricultural crop with a
composition selected from the group consisting of (a) a composition
comprising a xyloglucan endotransglycosylase, a polymeric
xyloglucan, and a functionalized xyloglucan oligomer comprising a
chemical group; (b) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan functionalized with a
chemical group, and a functionalized xyloglucan oligomer comprising
a chemical group; (c) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan functionalized with a
chemical group, and a xyloglucan oligomer; (d) a composition
comprising a xyloglucan endotransglycosylase, a polymeric
xyloglucan, and a xyloglucan oligomer; (e) a composition comprising
a xyloglucan endotransglycosylase and a polymeric xyloglucan
functionalized with a chemical group; (f) a composition comprising
a xyloglucan endotransglycosylase and a polymeric xyloglucan; (g) a
composition comprising a xyloglucan endotransglycosylase and a
functionalized xyloglucan oligomer comprising a chemical group; (h)
a composition comprising a xyloglucan endotransglycosylase and a
xyloglucan oligomer, and (i) a composition of (a), (b), (c), (d),
(e), (f), (g), or (h) without a xyloglucan endotransglycosylase,
wherein the modified agricultural crop possesses an improved
property compared to the unmodified agricultural crop.
[0010] The present invention also relates to modified agricultural
crops obtained by such methods.
[0011] The present invention also relates to modified agricultural
crops comprising (a) a polymeric xyloglucan and a functionalized
xyloglucan oligomer comprising a chemical group; (b) a polymeric
xyloglucan functionalized with a chemical group and a
functionalized xyloglucan oligomer comprising a chemical group; (c)
a polymeric xyloglucan functionalized with a chemical group and a
xyloglucan oligomer; (d) a polymeric xyloglucan and a xyloglucan
oligomer; (e) a polymeric xyloglucan functionalized with a chemical
group; (f) a polymeric xyloglucan; (g) a functionalized xyloglucan
oligomer comprising a chemical group; or (h) a xyloglucan oligomer,
wherein the modified agricultural crop possesses an improved
property compared to the unmodified agricultural crop.
[0012] The present invention further relates to a composition
selected from the group consisting of (a) a composition comprising
a xyloglucan endotransglycosylase, a polymeric xyloglucan, and a
functionalized xyloglucan oligomer comprising a chemical group; (b)
a composition comprising a xyloglucan endotransglycosylase, a
polymeric xyloglucan functionalized with a chemical group, and a
functionalized xyloglucan oligomer comprising a chemical group; (c)
a composition comprising a xyloglucan endotransglycosylase, a
polymeric xyloglucan functionalized with a chemical group, and a
xyloglucan oligomer; (d) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan, and a xyloglucan
oligomer; (e) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan functionalized with
a chemical group; (f) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan; (g) a composition
comprising a xyloglucan endotransglycosylase and a functionalized
xyloglucan oligomer comprising a chemical group; (h) a composition
comprising a xyloglucan endotransglycosylase and a xyloglucan
oligomer, and (i) a composition of (a), (b), (c), (d), (e), (f),
(g), or (h) without a xyloglucan endotransglycosylase.
BRIEF DESCRIPTION OF THE FIGURES
[0013] FIG. 1 shows a restriction map of pDLHD0012.
[0014] FIG. 2 shows a restriction map of pMMar27.
[0015] FIG. 3 shows a restriction map of pEvFz1.
[0016] FIG. 4 shows a restriction map of pDLHD0006.
[0017] FIG. 5 shows a restriction map of pDLHD0039.
[0018] FIG. 6 shows carnation stems dipped in tamarind seed
xyloglucan in the upper row, or not dipped in the lower row,
following 1 day of incubation at room temperature.
[0019] FIG. 7A shows apple slices dipped in tamarind seed
xyloglucan in the upper row, or not dipped in the lower row, after
2 days of incubation; FIG. 7B shows the same slices after 5 days of
incubation.
[0020] FIG. 8 shows the effect of dipping discs of Granny Smith
apples in 40 mM sodium citrate pH 5.5 containing 1 mg/ml tamarind
seed xyloglucan with or without 1.1 .mu.M Vigna angularis
xyloglucan endotransglycosylase16 (VaXET16) or 5 ml of deionized
water after incubation under ambient conditions for 3, 4, and 7
days. FIG. 8A shows the apple slices after 3 days of incubation.
FIG. 8B shows the apple slices after 4 days of incubation. FIG. 8C
shows the apple slices after 7 days of incubation.
[0021] FIG. 9 shows quantitative analysis of apple slice images to
determine the extent to which xyloglucan and VaXET16 prevent apple
oxidation. FIG. 9A shows a pixel intensity histogram of apple
slices not dipped after 4 days of incubation. FIG. 9B shows a pixel
intensity histogram of apple slices dipped in 40 mM sodium citrate
pH 5.5 after 4 days of incubation. FIG. 9C shows a pixel intensity
histogram of apple slices dipped in xyloglucan after 4 days of
incubation. FIG. 9D shows a pixel intensity histogram of apple
slices dipped in xyloglucan and VaXET16 after 4 days of incubation.
FIG. 9E shows a plot of the mean intensity vs. time for the
variously treated apple slices.
[0022] FIG. 10A shows photographs of culture plates containing
potato slices dipped in the indicated solutions. Photographs are
taken at 0, 2.5, 5, and 22 hours of incubation. FIG. 10B shows
photographs of culture plates containing avocado slices dipped in
the indicated solutions. Photographs were taken at 0 and 70 hours
of incubation.
[0023] FIG. 11A-11H shows a series of laser scanning confocal
microscope images that compare a fruit, flower, or vegetable
incubated with Arabidopsis thaliana xyloglucan endotransglycosylase
14 (AtXET14) in 150 mM sodium chloride-20 mM phosphate pH 7.2 to
incubated with AtXET14 and fluorescein isothiocyanate-labeled
xyloglucan (FITC-XG) in 150 mM sodium chloride-20 mM phosphate pH
7.2 overnight at ambient temperature. FIG. 11A shows a confocal
image of a section of an apple slice incubated with AtXET14. FIG.
11B shows a confocal image of a section of an apple slice incubated
with AtXET14 and FITC-XG. FIG. 11C shows a confocal image of a
section of a carnation stem incubated with AtXET14. FIG. 11D shows
a confocal image of a section of a carnation stem incubated with
AtXET14 and FITC-XG. FIG. 11E shows a confocal image of a section
of a banana stem incubated with AtXET14. FIG. 11F shows a confocal
image of a section of a banana stem incubated with AtXET14 and
FITC-XG. FIG. 11G shows a confocal image of a section of a squash
stem incubated with AtXET14. FIG. 11H shows a confocal image of a
section of a squash stem incubated with AtXET14 and FITC-XG.
DEFINITIONS
[0024] As used herein, the singular forms "a", "an", and "the" are
intended to include the plural forms as well, unless the context
clearly indicates otherwise.
[0025] Agricultural crop: The term "agricultural crop" means any
plant or product thereof that is harvested at some point in its
growth stage, such as fruits, vegetables, perishable plants,
flowers, grains and other staple crops, medicinal herbs and plants,
nuts or seeds, crops grown for spinning cloth or fibers, and
perishable foodstuffs derived directly therefrom, for use or
consumption by humans or animals.
[0026] Functionalized xyloglucan oligomer: The term "functionalized
xyloglucan oligomer" means a short chain xyloglucan
oligosaccharide, including single or multiple repeating units of
xyloglucan, which has been modified by incorporating a chemical
group. The xyloglucan oligomer is preferably 1 to 3 kDa in
molecular weight, corresponding to 1 to 3 repeating xyloglucan
units. The chemical group may be a compound of interest or a
reactive group such as an aldehyde group, an amino group, an
aromatic group, a carboxyl group, a halogen group, a hydroxyl
group, a ketone group, a nitrile group, a nitro group, a sulfhydryl
group, or a sulfonate group. The incorporated reactive groups can
be derivatized with a compound of interest to provide a direct
agricultural benefit or to coordinate metal cations and/or to bind
other chemical entities that interact (e.g., covalently,
hydrophobically, electrostatically, etc.) with the reactive groups.
The derivatization can be performed directly on a functionalized
xyloglucan oligomer comprising a reactive group or after the
functionalized xyloglucan oligomer comprising a reactive group is
incorporated into polymeric xyloglucan. Alternatively, the
xyloglucan oligomer can be functionalized by incorporating directly
a compound by using a reactive group contained in the compound,
e.g., an aldehyde group, an amino group, an aromatic group, a
carboxyl group, a halogen group, a hydroxyl group, a ketone group,
a nitrile group, a nitro group, a sulfhydryl group, or a sulfonate
group. The terms "functionalized xyloglucan oligomer" and
"functionalized xyloglucan oligomer comprising a chemical group"
are used interchangedly herein.
[0027] Polymeric xyloglucan: The term "polymeric xyloglucan" means
short, intermediate or long chain xyloglucan oligosaccharide or
polysaccharide encompassing more than one repeating unit of
xyloglucan, e.g., multiple repeating units of xyloglucan. Most
optimally, polymeric xyloglucan encompasses xyloglucan of 50-200
kDa number average molecular weight, corresponding to 50-200
repeating units. A repeating motif of xyloglucan is composed of a
backbone of four beta-(1-4)-D-glucopyranose residues, three of
which have a single alpha-D-xylopyranose residue attached at O-6.
Some of the xylose residues are beta-D-galactopyranosylated at O-2,
and some of the galactose residues are alpha-L-fucopyranosylated at
O-2. The term "xyloglucan" herein is understood to mean polymeric
xyloglucan.
[0028] Polymeric xyloglucan functionalized with a chemical group:
The term "polymeric xyloglucan functionalized with a chemical
group" means a polymeric xyloglucan that has been modified by
incorporating a chemical group. The polymeric xyloglucan is short,
intermediate or long chain xyloglucan oligosaccharide or
polysaccharide encompassing more than one repeating unit of
xyloglucan, e.g., multiple repeating units of xyloglucan. The
polymeric xyloglucan encompasses xyloglucan of 50-200 kDa number
average molecular weight, corresponding to 50-200 repeating units.
A repeating motif of xyloglucan is composed of a backbone of four
beta-(1-4)-D-glucopyranose residues, three of which have a single
alpha-D-xylopyranose residue attached at O-6. The chemical group
may be a compound of interest or a reactive group such as an
aldehyde group, an amino group, an aromatic group, a carboxyl
group, a halogen group, a hydroxyl group, a ketone group, a nitrile
group, a nitro group, a sulfhydryl group, or a sulfonate group. The
chemical group can be incorporated into a polymeric xylogucan by
reacting the polymeric xyloglucan with a functionalized xyloglucan
oligomer in the presence of xyloglucan endotransglycosylase. The
incorporated reactive groups can then be derivatized with a
compound of interest. The derivatization can be performed directly
on a functionalized polymeric xyloglucan comprising a reactive
group or after a functionalized xyloglucan oligomer comprising a
reactive group is incorporated into a polymeric xyloglucan.
Alternatively, the polymeric xyloglucan can be functionalized by
incorporating directly a compound by using a reactive group
contained in the compound, e.g., an aldehyde group, an amino group,
an aromatic group, a carboxyl group, a halogen group, a hydroxyl
group, a ketone group, a nitrile group, a nitro group, a sulfhydryl
group, or a sulfonate group.
[0029] Xyloglucan endotransglycosylase: The term "xyloglucan
endotransglycosylase" means a xyloglucan:xyloglucan
xyloglucanotransferase (EC 2.4.1.207) that catalyzes cleavage of a
.beta.-(1.fwdarw.4) bond in the backbone of a xyloglucan and
transfers the xyloglucanyl segment on to 0-4 of the non-reducing
terminal glucose residue of an acceptor, which can be a xyloglucan
or an oligosaccharide of xyloglucan. Xyloglucan
endotransglycosylases are also known as xyloglucan
endotransglycosylase/hydrolases or endo-xyloglucan transferases.
Some xylan endotransglycosylases can possess different activities
including xyloglucan and mannan endotransglycosylase activities.
For example, xylan endotransglycosylase from ripe papaya fruit can
use heteroxylans, such as wheat arabinoxylan, birchwood
glucuronoxylan, and others as donor molecules. These xylans can
potentially play a similar role as xyloglucan while being much
cheaper in cost since they can be extracted, for example, from pulp
mill spent liquors and/or future biomass biorefineries.
[0030] Xyloglucan endotransglycosylase activity can be assayed by
those skilled in the art using any of the following methods. The
reduction in the average molecular weight of a xyloglucan polymer
when incubated with a molar excess of xyloglucan oligomer in the
presence of xyloglucan endotransglycosylase can be determined via
liquid chromatography (Sulova et al., 2003, Plant Physiol. Biochem.
41: 431-437) or via ethanol precipitation (Yaanaka et al., 2000,
Food Hydrocolloids 14: 125-128) followed by gravimetric or
cellulose-binding analysis (Fry et al., 1992, Biochem. J. 282:
821-828), or can be assessed colorimetrically by association with
iodine under alkaline conditions (Sulova et al., 1995, Analytical
Biochemistry229: 80-85). Incorporation of a functionalized
xyloglucan oligomer into a xyloglucan polymer by incubation of the
functionalized oligomer with xyloglucan in the presence of
xyloglucan endotransglycosylase can be assessed, e.g., by
incubating a radiolabeled xyloglucan oligomer with xyloglucan and
xyloglucan endotransglycosylase, followed by filter paper-binding
and measurement of filter paper radioactivity, or incorporation of
a fluorescently or optically functionalized xyloglucan oligomer can
be assessed similarly, monitoring fluorescence or colorimetrically
analyzing the filter paper.
[0031] Xyloglucan oligomer: The term "xyloglucan oligomer" means a
short chain xyloglucan oligosaccharide, including single or
multiple repeating units of xyloglucan. Most optimally, the
xyloglucan oligomer will be 1 to 3 kDa in molecular weight,
corresponding to 1 to 3 repeating xyloglucan units.
DETAILED DESCRIPTION OF THE INVENTION
[0032] The present invention relates to methods for modifying an
agricultural crop comprising treating the agricultural crop with a
composition selected from the group consisting of (a) a composition
comprising a xyloglucan endotransglycosylase, a polymeric
xyloglucan, and a functionalized xyloglucan oligomer comprising a
chemical group; (b) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan functionalized with a
chemical group, and a functionalized xyloglucan oligomer comprising
a chemical group; (c) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan functionalized with a
chemical group, and a xyloglucan oligomer; (d) a composition
comprising a xyloglucan endotransglycosylase, a polymeric
xyloglucan, and a xyloglucan oligomer; (e) a composition comprising
a xyloglucan endotransglycosylase and a polymeric xyloglucan
functionalized with a chemical group; (f) a composition comprising
a xyloglucan endotransglycosylase and a polymeric xyloglucan; (g) a
composition comprising a xyloglucan endotransglycosylase and a
functionalized xyloglucan oligomer comprising a chemical group; (h)
a composition comprising a xyloglucan endotransglycosylase and a
xyloglucan oligomer, and (i) a composition of (a), (b), (c), (d),
(e), (f), (g), or (h) without a xyloglucan endotransglycosylase,
wherein the modified agricultural crop possesses an improved
property compared to the unmodified agricultural crop.
[0033] The present invention also relates to modified agricultural
crops obtained by such methods.
[0034] The present invention also relates to modified agricultural
crops comprising (a) a polymeric xyloglucan and a functionalized
xyloglucan oligomer comprising a chemical group; (b) a polymeric
xyloglucan functionalized with a chemical group and a
functionalized xyloglucan oligomer comprising a chemical group; (c)
a polymeric xyloglucan functionalized with a chemical group and a
xyloglucan oligomer; (d) a polymeric xyloglucan and a xyloglucan
oligomer; (e) a polymeric xyloglucan functionalized with a chemical
group; (f) a polymeric xyloglucan; (g) a functionalized xyloglucan
oligomer comprising a chemical group; or (h) a xyloglucan oligomer,
wherein the modified agricultural crop possesses an improved
property compared to the unmodified agricultural crop.
[0035] The present invention further relates to a composition
selected from the group consisting of (a) a composition comprising
a xyloglucan endotransglycosylase, a polymeric xyloglucan, and a
functionalized xyloglucan oligomer comprising a chemical group; (b)
a composition comprising a xyloglucan endotransglycosylase, a
polymeric xyloglucan functionalized with a chemical group, and a
functionalized xyloglucan oligomer comprising a chemical group; (c)
a composition comprising a xyloglucan endotransglycosylase, a
polymeric xyloglucan functionalized with a chemical group, and a
xyloglucan oligomer; (d) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan, and a xyloglucan
oligomer; (e) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan functionalized with
a chemical group; (f) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan; (g) a composition
comprising a xyloglucan endotransglycosylase and a functionalized
xyloglucan oligomer comprising a chemical group; (h) a composition
comprising a xyloglucan endotransglycosylase and a xyloglucan
oligomer, and (i) a composition of (a), (b), (c), (d), (e), (f),
(g), or (h) without a xyloglucan endotransglycosylase.
[0036] In one embodiment, the composition comprises a xyloglucan
endotransglycosylase, a polymeric xyloglucan, and a functionalized
xyloglucan oligomer comprising a chemical group. In another
embodiment, the composition comprises a xyloglucan
endotransglycosylase, a polymeric xyloglucan functionalized with a
chemical group, and a functionalized xyloglucan oligomer comprising
a chemical group. In another embodiment, the composition comprises
a xyloglucan endotransglycosylase, a polymeric xyloglucan
functionalized with a chemical group, and a xyloglucan oligomer. In
another embodiment, the composition comprises a xyloglucan
endotransglycosylase, a polymeric xyloglucan, and a xyloglucan
oligomer. In another embodiment, the composition comprises a
xyloglucan endotransglycosylase and a polymeric xyloglucan
functionalized with a chemical group. In another embodiment, the
composition comprises a xyloglucan endotransglycosylase and a
polymeric xyloglucan. In another embodiment, the composition
comprises a xyloglucan endotransglycosylase and a functionalized
xyloglucan oligomer comprising a chemical group. In another
embodiment, the composition comprises a xyloglucan
endotransglycosylase and a xyloglucan oligomer.
[0037] In another embodiment, the composition comprises a polymeric
xyloglucan and a functionalized xyloglucan oligomer comprising a
chemical group. In another embodiment, the composition comprises a
polymeric xyloglucan functionalized with a chemical group and a
functionalized xyloglucan oligomer comprising a chemical group. In
another embodiment, the composition comprises a polymeric
xyloglucan functionalized with a chemical group and a xyloglucan
oligomer. In another embodiment, the composition comprises a
polymeric xyloglucan and a xyloglucan oligomer. In another
embodiment, the composition comprises a polymeric xyloglucan
functionalized with a chemical group. In another embodiment, the
composition comprises a polymeric xyloglucan. In another
embodiment, the composition comprises a functionalized xyloglucan
oligomer comprising a chemical group. In another embodiment, the
composition comprises a xyloglucan oligomer.
[0038] The modification of an agricultural crop with a composition
of the present invention can be conducted in any useful medium. In
an embodiment, the medium is an aqueous medium. In another
embodiment, the medium is a partially aqueous medium. In another
aspect, the medium is a slurry. In another aspect, the medium is an
aqueous slurry. In another aspect, the medium is a non-aqueous
slurry. In another aspect, the medium is a partially aqueous
slurry. In another aspect, the medium is a waxy suspension. In
another aspect, the medium is an emulsion.
[0039] In one aspect, the agricultural crop is harvested. In
another aspect, the agricultural crop is not harvested.
[0040] The methods of the present invention prevent qualitative and
quantitative loss of agricultural crops and processed crops
thereof. Once harvested, produce rapidly undergoes senescence,
degrades in appearance, nutrition value, texture, firmness, and/or
desirability. In a related manner, once harvested, produce can be
spoiled by microbial degradation. Once the protective skins, peels,
or rinds of produce are pierced, the produce is subject to
oxidative damage, dehydration, loss of desirable appearance, and
potential microbial degradation. Following harvest, produce is
shipped to wholesalers, dealers, and/or aggregators, and then to
consumer markets. Sale must be necessarily expedited to minimize
loss, thereby increasing associated costs. Treating cut flowers,
fruits, vegetables or other agricultural crops with a solution of
polymeric xyloglucan, a naturally occurring plant polysaccharide,
or more preferably with a solution of polymeric xyloglucan and
xyloglucan endotransglycosylase provides protection of the treated
produce from, for example, degradation, spoilage, and the onset of
negative appearance. The polymeric xyloglucan can be functionalized
with a compound, for example, with preservatives or hydrophobic
chemical moieties, and the presence of xyloglucan
endotransglycosylase permits surface coating of the produce with
the introduced functionalization having, for example, the effect of
preventing loss of water and keeping the produce from drying out.
Food-safe anti-microbial compounds, such as bacteriostatic or
bacteriocidal compounds, can similarly be introduced in this
manner.
[0041] In one aspect, the functionalization can provide any
functionally useful chemical moiety.
[0042] The xyloglucan endotransglycosylase is preferably present at
about 0.1 nM to about 1 mM, e.g., about 10 nM to about 100 .mu.M or
about 0.5 .mu.M to about 5 .mu.M, in the composition.
[0043] The polymeric xyloglucan or polymeric xyloglucan
functionalized with a chemical group is preferably present at about
1 mg per g to about 1 g per g of the composition, e.g., about 10 mg
to about 950 mg or about 100 mg to about 900 mg per g of the
composition.
[0044] When the xyloglucan oligomer or the functionalized
xyloglucan oligomer is present without polymeric xyloglucan or
polymeric xyloglucan functionalized with a chemical group, the
xyloglucan oligomer or the functionalized xyloglucan oligomer is
preferably present at about 1 mg to about 1 g per g of the
composition, e.g., about 10 mg to about 950 mg or about 100 mg to
about 900 mg per g of the composition.
[0045] When present with the polymeric xyloglucan or polymeric
xyloglucan functionalized with a chemical group, the xyloglucan
oligomer or the functionalized xyloglucan oligomer is preferably
present with the polymeric xyloglucan at about 50:1 to about 0.5:1
molar ratio of xyloglucan oligomer or functionalized xyloglucan
oligomer to polymeric xyloglucan or polymeric xyloglucan
functionalized with a chemical group, e.g., about 10:1 to about 1:1
or about 5:1 to about 1:1 molar ratio of xyloglucan oligomer or
functionalized xyloglucan oligomer to polymeric xyloglucan or
polymeric xyloglucan functionalized with a chemical group.
[0046] The polymeric xyloglucan or polymeric xyloglucan
functionalized with a chemical group is preferably present at about
1 ng to about 1 g per g of the agricultural crop, e.g., about 10
.mu.g to about 100 mg or about 1 mg to about 50 mg per g of the
agricultural crop.
[0047] When the xyloglucan oligomer or the functionalized
xyloglucan oligomer is present without polymeric xyloglucan or
polymeric xyloglucan functionalized with a chemical group, the
xyloglucan oligomer or the functionalized xyloglucan oligomer is
preferably present at about 1 ng per g to about 1 g per g of the
agricultural crop, e.g., about 10 .mu.g to about 100 mg or about 1
mg to about 50 mg per g of the agricultural crop.
[0048] When present with the polymeric xyloglucan or polymeric
xyloglucan functionalized with a chemical group, the xyloglucan
oligomer or the functionalized xyloglucan oligomer is preferably
present with the polymeric xyloglucan at about 50:1 to about 0.5:1,
e.g., about 10:1 to about 1:1 or about 5:1 to about 1:1 molar ratio
of xyloglucan oligomer or functionalized xyloglucan oligomer to
polymeric xyloglucan or polymeric xyloglucan functionalized with a
chemical group.
[0049] The xyloglucan endotransglycosylase is preferably present at
about 0.1 nM to about 1 mM, e.g., about 10 nM to about 100 .mu.M or
about 0.5 .mu.M to about 5 .mu.M.
[0050] The concentration of polymeric xyloglucan, polymeric
xyloglucan functionalized with a chemical group, xyloglucan
oligomer, or functionalized xyloglucan oligomer comprising a
chemical group incorporated onto or into the agricultural crop is
about 1 pg to about 500 mg per g of the agricultural crop, e.g.
about 0.1 .mu.g to about 50 mg or about 1 to about 5 mg per g of
the agricultural crop.
Agricultural Crops
[0051] In the methods of the present invention, the agricultural
crops can be any plant, or part thereof, grown for human or animal
use or consumption.
[0052] In one aspect, the agricultural crops are grown for human
food. In another aspect, the agricultural crops are grown for
silage. In another aspect, the agricultural crops are grown for
animal or livestock feed. In another aspect, the agricultural crops
are grown for seedlings, saplings, or transplant. In another
aspect, the agricultural crops are ornamental. In another aspect,
the agricultural crops are trees. In another aspect, the
agricultural crops are trees grown for timber. In another aspect,
the agricultural crops are trees grown as Christmas trees. In
another aspect, the agricultural crops are trees grown for fruit,
vegetable, or nut production. In another aspect, the agricultural
crops are bushes or shrubs. In another aspect, the agricultural
crops are grasses. In another aspect, the agricultural crops are
flowers grown for the cut flower market. In another aspect, the
agricultural crops are flowers grown as houseplants. In another
aspect, the agricultural crops are grown for medicinal or
homeopathic compounds. In another aspect, the agricultural crops
are grown for fibers. In another aspect, the agricultural crop
grown for fibers is cotton. In another aspect, the agricultural
crop grown for fibers is hemp. In another aspect, the agricultural
crop grown for fibers is flax. In another aspect, the agricultural
crop grown for fibers is ramie. In another aspect, the agricultural
crop grown for fibers is bamboo. In another aspect, the
agricultural crops are grown for alcohol fermentation or beverage
production. In another aspect, the agricultural crops are grown for
dry distiller's grain.
[0053] In another aspect, the agricultural crop is a fruit. The
fruit can be any type of fruit. The fruit can be apples, avocado,
banana, berries, cucumbers, grape, tamarind, watermelon,
cantaloupe, pumpkin, peach, plum, olive, orange, lemon, lime,
pears, blackberry, pineapple, fig, mulberry, grains, sunflower,
nuts, and non-botanical fruit. In one aspect, the fruit are
berries, (e.g., raspberries, blueberries, grapes, lingonberries,
tomatoes, eggplant, cranberries, guava, pomegranate, chillies, and
cucumbers). In another aspect, the fruit are pepo (e.g.,
watermelon, cantaloupe, and pumpkin). In another aspect, the fruit
are drupe (e.g., peach, plum, and olive). In another aspect, the
fruit are follicles. In another aspect, the fruit are capsules
(e.g., horse chestnut, cotton, and eucalyptus). In another aspect,
the fruit are hesperidium (e.g., oranges, tangerines, grapefruits,
lemons, and limes). In another aspect, the fruit are accessory
fruit (e.g., apples and pears). In another aspect, the fruit are
aggregate fruit (e.g., blackberries, pineapples, and figs). In
another aspect, the fruit are multiple fruit (e.g., mulberries). In
another aspect, the fruit are Achene (e.g., sunflower). In another
aspect, the fruit are nuts (e.g., walnut, oak, peanut, and almond).
In another aspect, the fruit are non-botanical fruit (e.g., juniper
berries and rhubarb).
[0054] In another aspect, the agricultural crop is a vegetable. The
vegetable can be any edible plant or part thereof. The vegetables
can be artichokes, asparagus, barley, bean sprouts, beans, black
mustard, broccoli, Brussel sprouts, carrots, cauliflower, celery,
clover, flax, garlic, ginger, hemp, India mustard, kale, kohlrabi,
leek, lentil, lettuce, maize (corn), millet, oats, onion, pea,
peanut, poppy, potatoes, radish, rhubarb, rice, rye, shallots,
sorghum, soy, spinach, sweet potato, tamarind, triticale,
watercress, or wheat.
[0055] In another aspect, the vegetable arises from the flower bud
of a plant (e.g., broccoli, cauliflower, and artichokes). In
another aspect, the vegetable arises from plant leaves (e.g.,
spinach, lettuce, kale, and watercress). In another aspect, the
vegetable arises from plant buds (e.g., Brussel sprouts). In
another aspect, the vegetable arises from plant shoots (e.g.,
asparagus and bean sprouts). In another aspect, the vegetable
arises from plant stems (e.g., ginger and kohlrabi). In another
aspect, the vegetable arises from plant tubers (e.g., potatoes and
sweet potatoes). In another aspect, the vegetable arises from leaf
stems (e.g., celery and rhubarb). In another aspect, the vegetable
arises from plant roots (e.g., carrots and radishes). In another
aspect, the vegetable arises from plant bulbs (e.g., onions and
shallots).
[0056] The vegetables can be leguminous vegetables, including the
plants or seed of beans, soy, pea, lentil, clover, peanut,
tamarind, and wisteria.
[0057] In another aspect, the agricultural crop is a grain. In
another aspect, the grains are wheat, rice, oats, rye, triticale or
barley. In another aspect, the grains are millet, sorghum, or maize
(corn). In another aspect, the grains are mustards (e.g., black
mustard and India mustard). In another aspect, the grains are grain
legumes (e.g., peas, lentils, and beans). In another aspect, the
grains are flax, hemp, or poppy.
[0058] In another aspect, the agricultural crop is a flower. The
flower can be any flower. In one aspect, the flowers are field
grown cut flowers. In another aspect, the flowers are greenhouse
grown cut flowers. The flower can be Ageratum houstonianum, Ammi
majus, Antirrhinum majus, Callistephus chinensis, Celosia cristata,
Centaurea cyanus, Centaurea Americana, Clarkia amoena, Consolida
regalis, Dianthus barbatus, Eustoma grandiflorum, Gypsophila
elegans, Helianthus debilis cucumerifolius, Iberis amara, Limonium
sinuatum, Nigella damascena, Scabiosa atropurpurea, Zinnia elegans,
Achillea filipendulina, Artemisia ludoviciana, Asclepias incarnate,
Asclepias tuberosa, Aster novi-belgii, Aster ericoides, Astilbe,
Chrysanthemum x superbum, Echinops bannaticus, Echinops exaltatus,
Echinops ritro, Echinops sphaerocephalus, Eryngium amethystinum,
Eryngium planum, Eryngium alpinum, Gypsophila paniculata, Liatris,
Paeonia, Platycodon grandiflorum, Salvia farinacea, Scabiosa
caucasica, Solidago, Allium, Gladiolus, Lilium, Rosa, Antirrhinum,
Gerbera, Tulipa, or Gladiolus.
[0059] In one aspect, the cut flowers are annuals. The annual
flowers can be Ageratum houstonianum, Ammi majus, Antirrhinum
majus, Callistephus chinensis, Celosia cristata, Centaurea cyanus,
Centaurea Americana, Clarkia amoena, Consolida regalis, Dianthus
barbatus, Eustoma grandiflorum, Gypsophila elegans, Helianthus
debilis cucumerifolius, Iberis amara, Limonium sinuatum, Nigella
damascena, Scabiosa atropurpurea, and Zinnia elegans.
[0060] In another aspect, the cut flowers are perennials. The
perennial flowers can be Achillea filipendulina, Artemisia
ludoviciana, Asclepias incarnate, Asclepias tuberosa, Aster
novi-belgii, Aster ericoides, Astilbe, Chrysanthemum x superbum,
Echinops bannaticus, Echinops exaltatus, Echinops ritro, Echinops
sphaerocephalus, Eryngium amethystinum, Eryngium planum, Eryngium
alpinum, Gypsophila paniculata, Liatris, Paeonia, Platycodon
grandiflorum, Salvia farinacea, Scabiosa caucasica, and
Solidago.
[0061] In another aspect, the cut flowers are bulbs. The flower
bulbs can be Allium, Gladiolus, and Lilium. In another aspect, the
cut flowers are traditionally cut flowers such as chrysanthemums,
carnations, and roses. In another aspect, the cut flowers are
nontraditional cut flowers such as lilies (Lilium), snapdragons
(Antirrhinum), gerbera (Gerbera), tulips (Tulipa), and gladiolas
(Gladiolus). In another aspect, the cut flowers are shipped from
South America, Holland or the Caribbean. In another aspect, the cut
flowers are shipped from local farms.
[0062] In another aspect, the agricultural crop is a spice. The
spice can be Ajwain (Trachyspermum ammi), Akudjura (Solanum
centrale), Alexanders (Smyrnium olusatrum), Alkanet (Alkanna
tinctoria), Alligator pepper, Mbongo spice (mbongochobi), Hepper
pepper (Aframomum danielli, A. citratum, A. exscapum), Allspice
(Pimenta dioica), Angelica (Angelica archangelica), Anise
(Pimpinella anisum), Anise Hyssop (Agastache foeniculum), Aniseed
myrtle (Syzygium anisatum), Annatto (Bixa orellana), Apple mint
(Mentha suaveolens, Mentha x rotundifolia and Mentha x villosa),
Artemisia (Artemisia spp.), Asafoetida (Ferula assafoetida),
Asarabacca (Asarum europaeum), Avens (Geum urbanum), Avocado leaf
(Peresea americana), Barberry (Berberis vulgaris and other Berberis
spp.), Sweet basil (Ocimum basilicum), Lemon basil (Ocimum x
citriodorum), Thai basil (O. basilicum var. thyrsiflora), Holy
Basil (Ocimum tenuiflorum), Bay leaf (Laurus nobilis), Bee balm
(Monarda didyma), Boldo (Peumus boldus), Borage (Borago
officinalis), Black cardamom (Amomum subulatum, Amomum costatum),
Black mustard (Brassica nigra), Blue fenugreek, Blue melilot
(Trigonella caerulea), Brown mustard (Brassica juncea), Caraway
(Carum carvi), White mustard (Sinapis alba), White cardamom
(Elettaria cardamomum), Carob (Ceratonia siliqua), Catnip (Nepeta
cataria), Cassia (Cinnamomum aromaticum), Cayenne pepper (Capsicum
annuum), Celery leaf (Apium graveolens), Celery seed (Apium
graveolens), Chervil (Anthriscus cerefolium), Chicory (Cichorium
intybus), Chili pepper (Capsicum spp.), Chives (Allium
schoenoprasum), Sweet Cicely (Myrrhis odorata), Cilantro or
coriander (Coriandrum sativum), Cinnamon, (Cinnamomum burmannii,
Cinnamomum loureiroi, Cinnamomum verum, Cinnamomum zeylanicum),
White Cinnamon (Canella winterana), Myrtle Cinnamon (Backhousia
myrtifolia), Clary sage (Salvia sclarea), Clove (Syzygium
aromaticum), Costmary (Tanacetum balsamita), Cuban oregano
(Plectranthus amboinicus), Cubeb pepper (Piper cubeba), Cudweed
(Gnaphalium spp.), Culantro, culangot or long coriander (Eryngium
foetidum), Cumin (Cuminum cyminum), Curry leaf (Murraya koenigii),
Curry plant (Helichrysum italicum), Dill (Anethum graveolens),
Elderflower (Sambucus spp.), Epazote (Dysphania ambrosioides),
Fennel (Foeniculum vulgare), Fenugreek (Trigonella foenum-graecum),
File powder (Sassafras albidum), Fingerroot, Krachai or Temu kuntji
(Boesenbergia rotunda), Greater Galangal (Alpinia galanga), Lesser
Galangal (Alpinia officinarum), Galingale (Cyperus spp.), Garlic
chives (Allium tuberosum), Garlic (Allium sativum), Elephant Garlic
(Allium ampeloprasum var. ampeloprasum), Ginger (Zingiber
officinale), Torch Ginger (Etlingera elatior), Golpar (Heracleum
persicum), Grains of paradise (Aframomum melegueta), Grains of
Selim, Kani pepper (Xylopia aethiopica), Horseradish (Armoracia
rusticana), Houttuynia cordata, Huacatay, Mexican marigold, Mint
marigold (Tagetes minuta), Hyssop (Hyssopus officinalis),
Indonesian bay leaf, Daun salam (Syzygium polyanthum), Jasmine
flowers (Jasminum spp.), Jimbu (Allium hypsistum), Juniper berry
(Juniperus communis), Kaffir lime leaves (Citrus hystrix), Kala
zeera (or kala jira), Black cumin (Bunium persicum), Kawakawa seeds
(Macropiper excelsum), Kencur (Kaempferia galanga), Keluak (Pangium
edule), Vietnamese balm (Elsholtzia ciliata), Kokam seed (Garcinia
indica), Korarima, Ethiopian cardamom (Aframomum corrorima),
Koseret leaves (Lippia adoensis), Lavender (Lavandula spp.), Lemon
balm (Melissa officinalis), Lemongrass (Cymbopogon), Lemon ironbark
(Eucalyptus staigeriana), Lemon myrtle (Backhousia citriodora),
Lemon verbena (Lippia citriodora), Leptotes bicolor, Lesser
calamint (Calamintha nepeta), nipitella, Licorice (Glycyrrhiza
glabra), Lime flower (Tilia spp.), Lovage (Levisticum officinale),
Mace (Myristica fragrans), St. Lucie cherry (Prunus mahaleb),
Marjoram (Origanum majorana), Marsh mallow (Althaea officinalis),
Mastic (Pistacia lentiscus), Mint (Mentha spp.), Mountain horopito
(Pseudowintera colorata), Musk mallow, abelmosk (Abelmoschus
moschatus), Nasturtium (Tropaeolum majus), Nigella (Nigella
sativa), Njangsa (Ricinodendron heudelotii), Nutmeg (Myristica
fragrans), Neem, Olida (Eucalyptus olida), Oregano (Origanum),
Orris root (Iris), Pandan flower, kewra (Pandanus odoratissimus),
Pandan leaf (Pandanus amaryllifolius), Paprika (Capsicum annuum),
Paracress (Spilanthes acmella, Soleracea), Parsley (Petroselinum
crispum), Black pepper, White pepper or Green pepper (Piper
nigrum), Dorrigo pepper (Tasmannia stipitata), Long pepper (Piper
longum) Mountain pepper (Tasmannia lanceolata), Peppermint (Mentha
piperata), Peppermint gum leaf (Eucalyptus dives), Perilla (Perilla
spp.), Peruvian pepper (Schinus molle), Pandanus amaryllifolius,
Brazilian pepper (Schinus terebinthifolius), Quassia (Quassia
amara), Ramsons (Allium ursinum), Rice paddy herb (Limnophila
aromatica), Rosemary (Rosmarinus officinalis), Rue (Ruta
graveolens), Safflower (Carthamus tinctorius), Saffron (Crocus
sativus), Sage (Salvia officinalis), Saigon cinnamon (Cinnamomum
loureiroi), Salad burnet (Sanguisorba minor), Salep (Orchis
mascula), Sassafras (Sassafras albidum), Summer savory (Satureja
hortensis), Winter savory (Satureja montana), Shiso (Perilla
frutescens), Sorrel (Rumex acetosa), Sheep sorrel (Rumex
acetosella), Spearmint (Mentha spicata), Spikenard (Nardostachys
grandiflora or N. jatamansi), Star anise (Illicium verum), Sumac
(Rhus coriaria), Sweet woodruff (Galium odoratum), Szechuan pepper
(Zanthoxylum piperitum), Tarragon (Artemisia dracunculus), Thyme
(Thymus vulgaris), Lemon thyme (Thymus x citriodorus), Turmeric
(Curcuma longa), Vanilla (Vanilla planifolia), Vietnamese cinnamon
(Cinnamomum loureiroi), Vietnamese coriander (Persicaria odorata),
Voatsiperifery (Piper borbonense), Wasabi (Wasabia japonica),
Water-pepper (Polygonum hydropiper), Watercress (Rorippa
nasturtium-aquatica), Wattleseed (Acacia), Wild betel (Piper
sarmentosum), Wild thyme (Thymus serpyllum), Willow herb (Epilobium
parviflorum), Wintergreen (Gaultheria procumbens), Wood avens (Geum
urbanum), Woodruff (Galium odoratum), absinthe (Artemisia
absinthium), or Yerba buena.
[0063] The leaves, stems, stalks, shoots, seeds, roots, and/or
fruit of an agricultural crop may be treated according to the
methods of the present invention. The agricultural crop can be
subsequently prepared for display or consumption, either by
cutting, slicing, peeling, deseeding, dehusking, or other methods
known in the art.
Improved Properties
[0064] Treatment of an agricultural crop according to the methods
of the present invention imparts an improved property to the
agricultural crop, e.g., prior to harvest or post-harvest.
[0065] The improved property can be one or more improvements
including, but not limited to, reducing or preventing oxidative
browning, dehydration, desiccation, bacterial, fungal, microbial,
animal, or insect pest infestation, senescence, early ripening, and
softening. The one or more improved properties can also be physical
improvements including prevention of bruising, resistance to
crushing, prevention or enhancement of clustering, and aggregation
or association. The improved property can also be one or more
improvements including, but not limited to, appearance, e.g.,
enhanced color or artificial coloration. The one or more improved
properties can also be resistance to adverse environmental factors,
e.g., sun or UV damage. The improved property can also be improved
taste, e.g., by carbohydrate, salt or food additive
functionalization.
[0066] In one aspect, the improved property is reducing or
preventing oxidative browning. In another aspect, the improved
property is reducing or preventing dehydration. In another aspect,
the improved property is reducing or preventing desiccation. In
another aspect, the improved property is reducing or preventing
bacterial pest infestation. In another aspect, the improved
property is reducing or preventing fungal pest infestation. In
another aspect, the improved property is reducing or preventing
microbial pest infestation. In another aspect, the improved
property is reducing or preventing animal pest infestation. In
another aspect, the improved property is reducing or preventing
insect pest infestation. In another aspect, the improved property
is reducing or preventing senescence. In another aspect, the
improved property is reducing or preventing early ripening. In
another aspect, the improved property is reducing or preventing
softening. In another aspect, the improved property is prevention
of bruising, resistance to crushing, prevention or enhancement of
clustering, and aggregation or association. In another aspect, the
improved property is resistance to crushing. In another aspect, the
improved property is prevention or enhancement of clustering. In
another aspect, the improved property is aggregation or
association. In another aspect, the improved property is improved
appearance. In another aspect, the improved property is resistance
to adverse environmental factors. In another aspect, the improved
property is improved taste.
[0067] In one aspect, the improved property protects an
agricultural crop prior to harvest. In another aspect, the improved
property extends the transportation time to market. In another
aspect, the improved property extends the shelf-life of an
agricultural crop. In another aspect, the improved property
increases nutritional value of an agricultural crop for longer
periods.
Polymeric Xyloglucan
[0068] In the methods of the present invention, the polymeric
xyloglucan can be any xyloglucan. In one aspect, the polymeric
xyloglucan is obtained from natural sources. In another aspect, the
polymeric xyloglucan is synthesized from component carbohydrates,
UDP- or GDP-carbohydrates, or halogenated carbohydrates by any
means used by those skilled in the art. In another aspect, the
natural source of polymeric xyloglucan is tamarind seed or tamarind
kernel powder, nasturtium, or plants of the genus Tropaeolum,
particularly Tropaeolum majus. The natural source of polymeric
xyloglucan may be seeds of various dicotyledonous plants such as
Hymenaea courbaril, Leguminosae-Caesalpinioideae including the
genera Cynometreae, Amherstieae, and Sclerolobieae. The natural
source of polymeric xyloglucan may also be the seeds of plants of
the families Primulales, Annonaceae, Limnanthaceae, Melianthaceae,
Pedaliaceae, and Tropaeolaceae or subfamily Thunbergioideae. The
natural source of polymeric xyloglucan may also be the seeds of
plants of the families Balsaminaceae, Acanthaceae, Linaceae,
Ranunculaceae, Sapindaceae, and Sapotaceae or non-endospermic
members of family Leguminosae subfamily Faboideae. In another
aspect, the natural source of polymeric xyloglucan is the primary
cell walls of dicotyledonous plants. In another aspect, the natural
source of polymeric xyloglucan may be the primary cell walls of
nongraminaceous, monocotyledonous plants.
[0069] The natural source polymeric xyloglucan may be extracted by
extensive boiling or hot water extraction, or by other methods
known to those skilled in the art. In one aspect, the polymeric
xyloglucan may be subsequently purified, for example, by
precipitation in 80% ethanol. In another aspect, the polymeric
xyloglucan is a crude or enriched preparation, for example,
tamarind kernel powder. In another aspect, the synthetic xyloglucan
may be generated by automated carbohydrate synthesis (Seeberger,
Chem. Commun, 2003, 1115-1121), or by means of enzymatic
polymerization, for example, using a glycosynthase (Spaduit et al.,
2011, J. Am. Chem. Soc. 133: 10892-10900).
[0070] In one aspect, the average molecular weight of the polymeric
xyloglucan ranges from about 2 kDa to about 500 kDa, e.g., about 2
kDa to about 400 kDa, about 3 kDa to about 300 kDa, about 3 kDa to
about 200 kDa, about 5 kDa to about 100 kDa, about 5 kDa to about
75 kDa, about 7.5 kDa to about 50 kDa, or about 10 kDa to about 30
kDa. In another aspect, the number of repeating units is about 2 to
about 500, e.g., about 2 to about 400, about 3 to about 300, about
3 to about 200, about 5 to about 100, about 7.5 to about 50, or
about 10 to about 30. In another aspect, the repeating unit is any
combination of G, X, L, F, S, T and J subunits, according to the
nomenclature of Fry et al. (Physiologia Plantarum, 89: 1-3, 1993).
In another aspect, the repeating unit is either fucosylated or
non-fucosylated XXXG-type polymeric xyloglucan common to
dicotyledons and nongraminaceous monocots. In another aspect, the
polymeric xyloglucan is O-acetylated. In another aspect the
polymeric xyloglucan is not O-acetylated. In another aspect, side
chains of the polymeric xyloglucan may contain terminal fucosyl
residues. In another aspect, side chains of the polymeric
xyloglucan may contain terminal arabinosyl residues. In another
aspect, side chains of the polymeric xyloglucan may contain
terminal xylosyl residues.
[0071] For purposes of the present invention, references to the
term xyloglucan herein refer to polymeric xyloglucan.
Xyloglucan Oligomer
[0072] In the methods of the present invention, the xyloglucan
oligomer can be any xyloglucan oligomer. The xyloglucan oligomer
may be obtained by degradation or hydrolysis of polymeric
xyloglucan from any source. The xyloglucan oligomer may be obtained
by enzymatic degradation of polymeric xyloglucan, e.g., by
quantitative or partial digestion with a xyloglucanase or
endoglucanase (endo-.beta.-1-4-glucanase). The xyloglucan oligomer
may be synthesized from component carbohydrates, UDP- or
GDP-carbohydrates, or halogenated carbohydrates by any of the
manners commonly used by those skilled in the art.
[0073] In one aspect, the average molecular weight of the
xyloglucan oligomer ranges from 0.5 kDa to about 500 kDa, e.g.,
about 1 kDa to about 20 kDa, about 1 kDa to about 10 kDa, or about
1 kDa to about 3 kDa. In another aspect, the number of repeating
units is about 1 to about 500, e.g., about 1 to about 20, about 1
to about 10, or about 1 to about 3. In the methods of the present
invention, the xyloglucan oligomer is optimally as short as
possible (i.e., 1 repeating unit, or about 1 kDa in molecular
weight) to maximize the solubility and solution molarity per gram
of dissolved xyloglucan oligomer, while maintaining substrate
specificity for xyloglucan endotransglycosylase activity. In
another aspect, the xyloglucan oligomer comprises any combination
of G (.beta.-D glucopyranosyl-), X
(.alpha.-D-xylopyranosyl-(1.fwdarw.6)-.beta.-D-glucopyranosyl-), L
(.beta.-D-galactopyranosyl-(1.fwdarw.2)-.alpha.-D-xylopyranosyl-(1.fwdarw-
.6)-.beta.-D-glucopyranosyl-), F
(.alpha.-L-fuco-pyranosyl-(1.fwdarw.2)-.beta.-D-galactopyranosyl-(1.fwdar-
w.)-.alpha.-D-xylopyranosyl-(1.fwdarw.6)-.beta.-D-glucopyranosyl-),
S
(.alpha.-L-arabinofurosyl-(1.fwdarw.2)-.alpha.-D-xylopyranosyl-(1.fwdarw.-
6)-.beta.-D-glucopyranosyl-), T
(.alpha.-L-arabino-furosyl-(1.fwdarw.3)-.alpha.-L-arabinofurosyl-(1.fwdar-
w.2)-.alpha.-D-xylopyranosyl-(1.fwdarw.6)-.beta.-D-glucopyranosyl-),
and J
(.alpha.-L-galactopyranosyl-(1.fwdarw.2)-.beta.-D-galactopyranosyl-(1.fwd-
arw.2)-.alpha.-D-xylopyranosyl-(1.fwdarw.6)-.beta.-D-gluco-pyranosyl-)
subunits according to the nomenclature of Fry et al. (Physiologia
Plantarum 89: 1-3, 1993). In another aspect, the xyloglucan
oligomer is the XXXG heptasaccharide common to dicotyledons and
nongraminaceous monocots. In another aspect, the xyloglucan
oligomer is O-acetylated. In another aspect, the xyloglucan
oligomer is not O-acetylated. In another aspect, side chains of the
xyloglucan oligomer may contain terminal fucosyl residues. In
another aspect, side chains of the xyloglucan oligomer may contain
terminal arabinosyl residues. In another aspect, side chains of the
xyloglucan oligomer may contain terminal xylosyl residues.
Functionalization of Xyloglucan Oligomer and Polymeric
Xyloglucan
[0074] The xyloglucan oligomer can be functionalized by
incorporating any chemical group known to those skilled in the art.
The chemical group may be a compound of interest or a reactive
group such as an aldehyde group, an amino group, an aromatic group,
a carboxyl group, a halogen group, a hydroxyl group, a ketone
group, a nitrile group, a nitro group, a sulfhydryl group, or a
sulfonate group.
[0075] In one aspect, the chemical group is an aldehyde group.
[0076] In another aspect, the chemical group is an amino group. The
amino group can be incorporated into polymeric xyloglucan by
reductive amination. Alternatively, the amino group can be an
aliphatic amine or an aromatic amine (e.g., aniline). The aliphatic
amine can be a primary, secondary or tertiary amine. Primary,
secondary, and tertiary amines are nitrogens bound to one, two and
three carbons, respectively. In one aspect, the primary amine is
C.sub.1-C.sub.8, e.g., ethylamine. In another aspect, each carbon
in the secondary amine is C.sub.1-C.sub.8, e.g., diethylamine. In
another aspect, each carbon in the tertiary amine is
C.sub.1-C.sub.8, e.g., triethyamine.
[0077] In another aspect, the chemical group is an aromatic group.
The aromatic group can be an arene group, an aryl halide group, a
phenolic group, a phenylamine group, a diazonium group, or a
heterocyclic group.
[0078] In another aspect, the chemical group is a carboxyl group.
The carboxyl group can be an acyl halide, an amide, a carboxylic
acid, an ester, or a thioester.
[0079] In another aspect, the chemical group is a halogen group.
The halogen group can be fluorine, chlorine, bromine, or
iodine.
[0080] In another aspect, the chemical group is a hydroxyl
group.
[0081] In another aspect, the chemical group is a ketone group.
[0082] In another aspect, the chemical group is a nitrile
group.
[0083] In another aspect, the chemical group is a nitro group.
[0084] In another aspect, the chemical group is a sulfhydryl
group.
[0085] In another aspect, the chemical group is a sulfonate
group.
[0086] The chemical reactive group can itself be the chemical group
that imparts a desired physical or chemical property to an
agricultural crop.
[0087] By incorporation of chemical reactive groups in such a
manner, one skilled in the art can further derivatize the
incorporated reactive groups with compounds (e.g., macromolecules)
that will impart a desired physical or chemical property to an
agricultural crop. For example, the incorporated chemical group may
react with the compound that imparts the desired property to
incorporate that group into the xyloglucan oligomer via a covalent
bond. Alternatively, the chemical group may bind to the compound
that imparts the desired property in either a reversible or
irreversible manner, and incorporate the compound via a
non-covalent association. The derivatization can be performed
directly on the functionalized xyloglucan oligomer or after the
functionalized xyloglucan oligomer is incorporated into polymeric
xyloglucan.
[0088] Alternatively, the xyloglucan oligomer can be functionalized
by incorporating directly a compound that imparts a desired
physical or chemical property to a material by using a reactive
group contained in the compound or a reactive group incorporated
into the compound, such as any of the groups described above.
[0089] On the other hand, the polymeric xyloglucan can be directly
functionalized by incorporating a reactive chemical group as
described above. By incorporation of reactive chemical groups
directly into polymeric xyloglucan, one of skill in the art can
further derivatize the incorporated reactive groups with compounds
that will impart a desired physical or chemical property to a
material. By incorporation of a compound directly into the
polymeric xyloglucan, a desired physical or chemical property can
also be directly imparted to a material.
[0090] In one aspect, the functionalization is performed by
reacting the reducing end hydroxyl of the xyloglucan oligomer or
the polymeric xyloglucan. In another aspect, a non-reducing
hydroxyl group, other than the non-reducing hydroxyl at position 4
of the terminal glucose, can be reacted. In another aspect, the
reducing end hydroxyl and a non-reducing hydroxyl, other than the
non-reducing hydroxyl at position 4 of the terminal glucose, can be
reacted.
[0091] The chemical functional group can be added by enzymatic
modification of the xyloglucan oligomer or polymeric xyloglucan, or
by a non-enzymatic chemical reaction. In one aspect, enzymatic
modification is used to add the chemical functional group. In one
embodiment of enzymatic modification, the enzymatic
functionalization is oxidation to a ketone or carboxylate, e.g., by
galactose oxidase. In another embodiment of enzymatic modification,
the enzymatic functionalization is oxidation to a ketone or
carboxylate by AA9 Family oxidases (formerly glycohydrolase Family
61 enzymes).
[0092] In another aspect, the chemical functional group is added by
a non-enzymatic chemical reaction. In one embodiment of the
non-enzymatic chemical reaction, the reaction is incorporation of a
reactive amine group by reductive amination of the reducing end of
the carbohydrate as described by Roy et al., 1984, Can. J. Chem.
62: 270-275, or Dalpathado et al., 2005, Anal. Bioanal. Chem. 381:
1130-1137. In another embodiment of non-enzymatic chemical
reaction, the reaction is incorporation of a reactive ketone group
by oxidation of the reducing end hydroxyl to a ketone, e.g., by
copper (II). In another embodiment of non-enzymatic chemical
reaction, the reaction is oxidation of non-reducing end hydroxyl
groups (e.g., of the non-glycosidic bonded position 6 hydroxyls of
glucose or galactose) by (2,2,6,6-tetramethyl-piperidin-1-yl)oxyl
(TEMPO), or the oxoammonium salt thereof, to generate an aldehyde
or carboxylic acid as described in Bragd et al., 2002, Carbohydrate
Polymers 49: 397-406, or Breton et al., 2007, Eur. J. Org. Chem.
10: 1567-1570.
[0093] Xyloglucan oligomers or polymeric xyloglucan can be
functionalized by a chemical reaction with a compound containing
more than one (i.e. bifunctional or multifunctional) chemical
functional group comprising at least one chemical functional group
that is directly reactive with xyloglucan oligomer or polymeric
xyloglucan. In one aspect, the bifunctional chemical group is a
hydrocarbon containing a primary amine and a second chemical
functional group. The second functional group can be any of the
other groups described above. In some aspects, the two functional
groups are separated by hydrocarbon chains (linkers) of various
lengths as is well known in the art.
[0094] Xyloglucan oligomers or polymeric xyloglucan can be
functionalized with a compound of interest by step-wise or
concerted reaction wherein the xyloglucan oligomer or polymeric
xyloglucan is functionalized as described above, and the compound
is reactive to the functionalization introduced therein. In one
aspect of coupling via a functionalized xyloglucan oligomer, an
amino group is first incorporated into the xyloglucan oligomer by
reductive amination and a reactive carbonyl is secondarily coupled
to the introduced amino group. In another aspect of coupling via an
amino-modified xyloglucan oligomer, the second coupling step
incorporates a chemical group, compound or macromolecule via
coupling an N-hydroxysuccinimidyl (NHS) ester or imidoester to the
introduced amino group. In a preferred embodiment, the NHS ester
secondarily coupled to the introduced amino group is a component of
a mono or bi-functional crosslink reagent. In another aspect of
coupling to a functionalized xyloglucan or xyloglucan oligomer, the
first reaction step comprises functionalization with a sulfhydryl
group, either via reductive amination with an alkylthioamine
(NH.sub.2--(CH.sub.2).sub.n--SH) at elevated temperatures in the
presence of a reducing agent (Magid et al., 1996, J. Org. Chem. 61:
3849-3862), or via radical coupling (Wang et al., 2009, Arkivoc
xiv: 171-180), followed by reaction of a maleimide group to the
sulfhydryl. In some aspects, the reactive group in the compound
that imparts the desired property is separated from the rest of the
compound by a hydrocarbon chain of an appropriate length, as is
well described in the art.
[0095] Non-limiting examples of compounds of interest that can be
used to functionalize polymeric xyloglucan or xyloglucan oligomers,
either by direct reaction or via reaction with a
xyloglucan-reactive compound, include peptides, polypeptides,
proteins, hydrophobic groups, hydrophilic groups, flame retardants,
dyes, color modifiers, specific affinity tags, non-specific
affinity tags, metals, metal oxides, metal sulfides, minerals,
fungicides, herbicides, microbicides or microbiostatics, and
non-covalent linker molecules.
[0096] In one aspect, the compound is a peptide. The peptide can be
an antimicrobial peptide, a "self-peptide" designed to reduce
allergenicity and immunogenicity, a cyclic peptide, glutathione, or
a signaling peptide (such as a tachykinin peptide, vasoactive
intestinal peptide, pancreatic polypeptide related peptide,
calcitonin peptide, lipopeptide, cyclic lipopeptide, or other
peptide).
[0097] In another aspect, the compound is a polypeptide. The
polypeptide can be a non-catalytically active protein (i.e.,
structural or binding protein), or a catalytically active protein
(i.e., enzyme). The polypeptide can be an enzyme, an antibody, or
an abzyme.
[0098] In another aspect, the compound is a compound comprising a
hydrophobic group. The hydrophobic group can be polyurethane,
polytetrafluoroethylene, or polyvinylidene fluoride.
[0099] In another aspect, the compound is a compound comprising a
hydrophilic group. The hydrophilic group can be methacylate,
methacrylamide, or polyacrylate.
[0100] In another aspect, the compound is a flame retardant. The
flame-retardant can be aluminum hydroxide or magnesium hydroxide.
The flame-retardant can also be a compound comprising an
organohalogen group or an organophosphorous group.
[0101] In another aspect, the compound is a dye or pigment.
[0102] In another aspect, the compound is a specific affinity tag.
The specific affinity tag can be biotin, avidin, a chelating group,
a crown ether, a heme group, a non-reactive substrate analog, an
antibody, target antigen, or a lectin.
[0103] In another aspect, the compound is a non-specific affinity
tag. The non-specific affinity tag can be a polycation group, a
polyanion group, a magnetic particle (e.g., magnetite), a
hydrophobic group, an aliphatic group, a metal, a metal oxide, a
metal sulfide, or a molecular sieve.
[0104] In another aspect, the compound is a fungicide. The
fungicide can be a compound comprising a dicarboximide group (such
as vinclozolin), a phenylpyrrole group (such as fludioxonil), a
chlorophenyl group (such as quintozene), a chloronitrobenzene (such
as dicloran), a triadiazole group (such as etridiazole), a
dithiocarbamate group (such as mancozeb or
dimethyldithiocarbamate), or an inorganic molecule (such as copper
or sulfur). In another aspect, the fungicide is a bacterium or
bacterial spore such as Bacillus or a Bacillus spore.
[0105] In another aspect, the compound is a herbicide. The
herbicide can be glyphosate, a synthetic plant hormone (such as a
compound comprising a 2,4-dichloropenoxyacetic acid group, a
2,4,5-trichlorophenoxyacetic acid group, a
2-methyl-4-chlorophenoxyacetic acid group, a
2-(2-methyl-4-chlorophenoxy)propionic acid group, a
2-(2,4-dichlorophenoxy)propionic acid group, or a
(2,4-dichlorophenoxy)butyric acid group), or a compound comprising
a triazine group (such as atrazine
(2-chloro-4-(ethylamino)-6-isopropylamino)-s-triazine).
[0106] In another aspect, the compound is a bactericidal or
bacteriostatic compound. The bactericidal or bacteriostatic
compound can be a copper or copper alloy (such as brass, bronze,
cupronickel, or copper-nickel-zinc alloy), a sulfonamide group
(such as sulfamethoxazole, sulfisomidine, sulfacetamide or
sulfadiazine), a silver or organo-silver group, TiO.sub.2,
ZnO.sub.2, an antimicrobial peptide, or chitosan.
[0107] In another aspect, the compound is a UV resistant compound.
The UV resistant compound can be zinc or ZnO.sub.2, kaolin,
aluminum, aluminum oxides, or other UV-resistant compounds.
[0108] In another aspect, the compound is an anti-oxidant compound.
The anti-oxidant compound can be ascorbate, manganese, iodide,
retinol, a terpenoid, tocopherol, a flavonoid or other anti-oxidant
phenolic or polyphenolic or other anti-oxidant compounds.
[0109] In another aspect, the compound is a non-covalent linker
molecule.
[0110] In another aspect, the compound is a color modifier. The
color modifier can be a dye, fluorescent brightener, color
modifier, or mordant (e.g., alum, chrome alum).
Preparation of Modified Agricultural Crops
[0111] In the methods of the present invention, a modified
agricultural crop can be prepared by treating the agricultural crop
with (a) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan, and a functionalized
xyloglucan oligomer comprising a chemical group; (b) a composition
comprising a xyloglucan endotransglycosylase, a polymeric
xyloglucan functionalized with a chemical group, and a
functionalized xyloglucan oligomer comprising a chemical group; (c)
a composition comprising a xyloglucan endotransglycosylase, a
polymeric xyloglucan functionalized with a chemical group, and a
xyloglucan oligomer; (d) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan, and a xyloglucan
oligomer; (e) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan functionalized with
a chemical group; (f) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan; (g) a composition
comprising a xyloglucan endotransglycosylase and a functionalized
xyloglucan oligomer comprising a chemical group; (h) a composition
comprising a xyloglucan endotransglycosylase and a xyloglucan
oligomer, or (i) a composition of (a), (b), (c), (d), (e), (f),
(g), or (h) without a xyloglucan endotransglycosylase, in a medium
under conditions leading to a modified agricultural crop, wherein
the modified agricultural crop possesses an improved property
compared to the unmodified agricultural crop.
[0112] The methods are exemplified by, but are not limited to,
improved resistance to browning of apple and potato slices by
treating these agricultural crops, post harvest, with a solution
comprising xyloglucan and xyloglucan endotransglycosylase. The
xyloglucan can be any xyloglucan, for example, tamarind kernel
xyloglucan. The xyloglucan endotransglycosylase can be, for
example, Vigna angularis XET16 or Arabidopsis thaliana XET14. In
the methods of the present invention, slices of fruit or vegetable
(e.g., apple or potato) can be dipped in a pH-controlled solution
(e.g., a buffered solution such as sodium citrate) containing
xyloglucan and xyloglucan endotransglycosylase. The pH of the
buffered solution can be between about 3 and about 9, e.g., about 4
to about 8 or about 5 to about 7. The concentration of sodium
citrate can be about 1 mM to about 1 M, e.g., about 5 mM to about
500 mM, about 10 mM to about 100 mM, or about 20 mM to about 50 mM.
The concentration of xyloglucan can be about 10 mg/L to about 100
g/L, e.g., about 100 mg/L to about 10 g/L, about 500 mg/L to about
5 g/L, or about 1 g/L to about 2 g/L. The concentration of
xyloglucan endotransglycosylase can be about 1 nM to about 1 mM,
e.g. about 10 nM to about 100 .mu.M, about 100 nM to about 10
.mu.M, or about 500 nM to about 1.5 .mu.M. The time length of the
dip can be instantaneous to about 12 hours, e.g., about 1 second to
about 3 hours, about 10 seconds to about 30 minutes, or about 30
seconds to about 2 minutes. The time length of the dip can be
optimized to maximize the improved property, or can be optimized to
the method by one skilled in the art. The excess solution can be
removed, for instance, by washing in water, by dipping in a
pH-controlled solution not containing xyloglucan, xyloglucan
endotransglycosylase, or both, or by touching the slice of apple or
potato to the side of the container or to a paper towel or wipe.
Alternatively, the excess solution can be left on the agricultural
crop or left on the crop for an appropriate length of time prior to
washing. In the current example, the excess solution is removed by
touching the fruit or vegetable to the side of the container. In
one aspect, the xyloglucan and xyloglucan endotransglycosylase can
be separated into 2 solutions and the agricultural crop dipped into
each independently and sequentially. In another aspect, xyloglucan
oligomers or functionalized xyloglucan oligomers are added to the
solution of xyloglucan and xyloglucan endotransglycosylase, or to
one or the other or both solutions if the two components are
separated into 2 solutions. For example, xyloglucan oligomers can
be added to a solution of xyloglucan and xyloglucan
endotransglycosylase at a molar ratio to xyloglucan of about
10.sup.-4 to about 100, e.g., about 10.sup.-3 to about 10 or about
10.sup.-2 to about 1. In this manner, one of skill in the art can
use the transglycosylase activity of xyloglucan
endotransglycosylase to optimize the size of the xyloglucan polymer
and/or the degree of functionalization of the xyloglucan to affect
the optimal improved property.
Sources of Xyloglucan Endotransglycosylases
[0113] Any xyloglucan endotransglycosylase that possesses suitable
enzyme activity at a pH and temperature appropriate for the methods
of the present invention may be used. It is preferable that the
xyloglucan endotransglycosylase is active over a broad pH and
temperature range. In an embodiment, the xyloglucan
endotransglycosylase has a pH optimum in the range of about 3 to
about 10. In another embodiment, the xyloglucan
endotransglycosylase has a pH optimum in the range of about 4.5 to
about 8.5. In another embodiment, the xyloglucan
endotransglycosylase has a cold denaturation temperature less than
or equal to about 5.degree. C. or a melting temperature of about
100.degree. C. or higher. In another embodiment, the xyloglucan
endotransglycosylase has a cold denaturation temperature of less
than or equal to 20.degree. C. or a melting temperature greater
than or equal to about 75.degree. C.
[0114] The source of the xyloglucan endotransglycosylase used is
not critical in the present invention. Accordingly, the xyloglucan
endotransglycosylase may be obtained from any source such as a
plant, microorganism, or animal.
[0115] In one embodiment, the xyloglucan endotransglycosylase is
obtained from a plant source. Xyloglucan endotransglycosylase can
be obtained from cotyledons of the family Fabaceae (synonyms:
Leguminosae and Papilionaceae), preferably genus Phaseolus, in
particular, Phaseolus aureus. Preferred monocotyledons are
non-graminaceous monocotyledons and liliaceous monocotyledons.
Xyloglucan endotransglycosylase can also be extracted from moss and
liverwort, as described in Fry et al., 1992, Biochem. J. 282:
821-828. For example, the xyloglucan endotransglycosylase may be
obtained from cotyledons, i.e., a dicotyledon or a monocotyledon,
in particular a dicotyledon selected from the group consisting of
azuki beans, canola, cauliflowers, cotton, poplar or hybrid aspen,
potatoes, rapes, soy beans, sunflowers, thalecress, tobacco, and
tomatoes, or a monocotyledon selected from the group consisting of
wheat, rice, corn, and sugar cane. See, for example, WO 2003/033813
and WO 97/23683.
[0116] In another embodiment, the xyloglucan endotransglycosylase
is obtained from Arabidopsis thaliana (GENESEQP:AOE11231,
GENESEQP:AOE93420, GENESEQP: BAL03414, GENESEQP:BAL03622, or
GENESEQP:AWK95154); Carica papaya (GENESEQP:AZR75725); Cucumis
sativus (GENESEQP:AZV66490); Daucus carota (GENESEQP:AZV66139);
Festuca pratensis (GENESEQP:AZR80321); Glycine max
(GENESEQP:AWK95154 or GENESEQP:AYF92062); Hordeum vulgare
(GENESEQP:AZR85056, GENESEQP:AQY12558, GENESEQP:AQY12559, or
GENESEQP:AWK95180); Lycopersicon esculentum (GENESEQP:ATZ45232);
Medicago truncatula (GENESEQP:ATZ48025); Oryza sativa
(GENESEQP:ATZ42485, GENESEQP:ATZ57524, or GENESEQP:AZR76430);
Populus tremula (GENESEQP:AWK95036); Sagittaria pygmaea
(GENESEQP:AZV66468); Sorghum bicolor (GENESEQP:BAO79623 or
GENESEQP:BAO79007); Vigna angularis (GENESEQP:ATZ61320); or Zea
mays (GENESEQP:AWK94916).
[0117] In another embodiment, the xyloglucan endotransglycosylase
is a xyloglucan endotransglucosylase/hydrolase (XTH) with both
hydrolytic and transglycosylating activities. In a preferred
embodiment, the ratio of transglycosylation to hydrolytic rates is
at least 10.sup.-2 to 10.sup.7, e.g., 10.sup.-1 to 10.sup.6 or 10
to 1000.
Production of Xyloglucan Endotransglycosylases
[0118] Xyloglucan endotransglycosylase may be extracted from
plants. Suitable methods for extracting xyloglucan
endotransglycosylase from plants are described Fry et al., 1992,
Biochem. J. 282: 821-828; Sulova et al., 1998, Biochem. J. 330:
1475-1480; Sulova et al., 1995, Anal. Biochem. 229: 80-85; WO
95/13384; WO 97/23683; or EP 562 836.
[0119] Xyloglucan endotransglycosylase may also be produced by
cultivation of a transformed host organism containing the
appropriate genetic information from a plant, microorganism, or
animal. Transformants can be prepared and cultivated by methods
known in the art.
[0120] Techniques used to isolate or clone a gene are known in the
art and include isolation from genomic DNA or cDNA, or a
combination thereof. The cloning of the gene from genomic DNA can
be effected, e.g., by using the polymerase chain reaction (PCR) or
antibody screening of expression libraries to detect cloned DNA
fragments with shared structural features. See, e.g., Innis et al.,
1990, PCR: A Guide to Methods and Application, Academic Press, New
York. Other nucleic acid amplification procedures such as ligase
chain reaction (LCR), ligation activated transcription (LAT) and
polynucleotide-based amplification (NASBA) may be used.
[0121] A nucleic acid construct can be constructed to comprise a
gene encoding a xyloglucan endotransglycosylase operably linked to
one or more control sequences that direct the expression of the
coding sequence in a suitable host cell under conditions compatible
with the control sequences. The gene may be manipulated in a
variety of ways to provide for expression of the xyloglucan
endotransglycosylase. Manipulation of the gene prior to its
insertion into a vector may be desirable or necessary depending on
the expression vector. Techniques for modifying polynucleotides
utilizing recombinant DNA methods are well known in the art.
[0122] The control sequence may be a promoter, a polynucleotide
that is recognized by a host cell for expression of a
polynucleotide encoding a xyloglucan endotransglycosylase. The
promoter contains transcriptional control sequences that mediate
the expression of the xyloglucan endotransglycosylase. The promoter
may be any polynucleotide that shows transcriptional activity in
the host cell including mutant, truncated, and hybrid promoters,
and may be obtained from genes encoding extracellular or
intracellular polypeptides either homologous or heterologous to the
host cell.
[0123] Examples of suitable promoters for directing transcription
of the nucleic acid constructs in a bacterial host cell are the
promoters obtained from the Bacillus amyloliquefaciens
alpha-amylase gene (amyQ), Bacillus licheniformis alpha-amylase
gene (amyL), Bacillus licheniformis penicillinase gene (penP),
Bacillus stearothermophilus maltogenic amylase gene (amyM),
Bacillus subtilis levansucrase gene (sacB), Bacillus subtilis xylA
and xylB genes, Bacillus thuringiensis cryIIIA gene (Agaisse and
Lereclus, 1994, Molecular Microbiology 13: 97-107), E. coli lac
operon, E. coli trc promoter (Egon et al., 1988, Gene 69: 301-315),
Streptomyces coelicolor agarase gene (dagA), and prokaryotic
beta-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad.
Sci. USA 75: 3727-3731), as well as the tac promoter (DeBoer et
al., 1983, Proc. Natl. Acad. Sci. USA 80: 21-25). Further promoters
are described in "Useful proteins from recombinant bacteria" in
Gilbert et al., 1980, Scientific American 242: 74-94; and in
Sambrook et al., 1989, supra. Examples of tandem promoters are
disclosed in WO 99/43835.
[0124] Examples of suitable promoters for directing transcription
of the nucleic acid constructs in a filamentous fungal host cell
are promoters obtained from the genes for Aspergillus nidulans
acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus
niger acid stable alpha-amylase, Aspergillus niger or Aspergillus
awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase,
Aspergillus oryzae alkaline protease, Aspergillus oryzae triose
phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO
96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900),
Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn
(WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic
proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei
cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II,
Trichoderma reesei endoglucanase I, Trichoderma reesei
endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma
reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma
reesei xylanase II, Trichoderma reesei xylanase Ill, Trichoderma
reesei beta-xylosidase, and Trichoderma reesei translation
elongation factor, as well as the NA2-tpi promoter (a modified
promoter from an Aspergillus neutral alpha-amylase gene in which
the untranslated leader has been replaced by an untranslated leader
from an Aspergillus triose phosphate isomerase gene; non-limiting
examples include modified promoters from an Aspergillus niger
neutral alpha-amylase gene in which the untranslated leader has
been replaced by an untranslated leader from an Aspergillus
nidulans or Aspergillus oryzae triose phosphate isomerase gene);
and mutant, truncated, and hybrid promoters thereof. Other
promoters are described in U.S. Pat. No. 6,011,147.
[0125] In a yeast host, useful promoters are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1,
ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase
(TPI), Saccharomyces cerevisiae metallothionein (CUP1), and
Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful
promoters for yeast host cells are described by Romanos et al.,
1992, Yeast 8: 423-488.
[0126] The control sequence may also be a transcription terminator,
which is recognized by a host cell to terminate transcription. The
terminator is operably linked to the 3'-terminus of the
polynucleotide encoding the xyloglucan endotransglycosylase. Any
terminator that is functional in the host cell may be used in the
present invention.
[0127] Preferred terminators for bacterial host cells are obtained
from the genes for Bacillus clausii alkaline protease (aprH),
Bacillus licheniformis alpha-amylase (amyL), and Escherichia coli
ribosomal RNA (rrnB).
[0128] Preferred terminators for filamentous fungal host cells are
obtained from the genes for Aspergillus nidulans acetamidase,
Aspergillus nidulans anthranilate synthase, Aspergillus niger
glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus
oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease,
Trichoderma reesei beta-glucosidase, Trichoderma reesei
cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II,
Trichoderma reesei endoglucanase I, Trichoderma reesei
endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma
reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma
reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma
reesei beta-xylosidase, and Trichoderma reesei translation
elongation factor.
[0129] Preferred terminators for yeast host cells are obtained from
the genes for Saccharomyces cerevisiae enolase, Saccharomyces
cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae
glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators
for yeast host cells are described by Romanos et al., 1992,
supra.
[0130] The control sequence may also be an mRNA stabilizer region
downstream of a promoter and upstream of the coding sequence of a
gene which increases expression of the gene.
[0131] Examples of suitable mRNA stabilizer regions are obtained
from a Bacillus thuringiensis cryIIIA gene (WO 94/25612) and a
Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of
Bacteriology 177: 3465-3471).
[0132] The control sequence may also be a leader, a nontranslated
region of an mRNA that is important for translation by the host
cell. The leader is operably linked to the 5'-terminus of the
polynucleotide encoding the xyloglucan endotransglycosylase. Any
leader that is functional in the host cell may be used.
[0133] Preferred leaders for filamentous fungal host cells are
obtained from the genes for Aspergillus oryzae TAKA amylase and
Aspergillus nidulans triose phosphate isomerase.
[0134] Suitable leaders for yeast host cells are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae
alpha-factor, and Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
(ADH2/GAP).
[0135] The control sequence may also be a polyadenylation sequence,
a sequence operably linked to the 3'-terminus of the polynucleotide
and, when transcribed, is recognized by the host cell as a signal
to add polyadenosine residues to transcribed mRNA. Any
polyadenylation sequence that is functional in the host cell may be
used.
[0136] Preferred polyadenylation sequences for filamentous fungal
host cells are obtained from the genes for Aspergillus nidulans
anthranilate synthase, Aspergillus nigerglucoamylase, Aspergillus
niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and
Fusarium oxysporum trypsin-like protease.
[0137] Useful polyadenylation sequences for yeast host cells are
described by Guo and Sherman, 1995, Mol. Cellular Biol. 15:
5983-5990.
[0138] The control sequence may also be a signal peptide coding
region that encodes a signal peptide linked to the N-terminus of a
xyloglucan endotransglycosylase and directs the polypeptide into
the cell's secretory pathway. The 5'-end of the coding sequence of
the polynucleotide may inherently contain a signal peptide coding
sequence naturally linked in translation reading frame with the
segment of the coding sequence that encodes the polypeptide.
Alternatively, the 5'-end of the coding sequence may contain a
signal peptide coding sequence that is foreign to the coding
sequence. A foreign signal peptide coding sequence may be required
where the coding sequence does not naturally contain a signal
peptide coding sequence. Alternatively, a foreign signal peptide
coding sequence may simply replace the natural signal peptide
coding sequence in order to enhance secretion of the polypeptide.
However, any signal peptide coding sequence that directs the
expressed polypeptide into the secretory pathway of a host cell may
be used.
[0139] Effective signal peptide coding sequences for bacterial host
cells are the signal peptide coding sequences obtained from the
genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus
licheniformis subtilisin, Bacillus licheniformis beta-lactamase,
Bacillus stearothermophilus alpha-amylase, Bacillus
stearothermophilus neutral proteases (nprT, nprS, nprM), and
Bacillus subtilis prsA. Further signal peptides are described by
Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.
[0140] Effective signal peptide coding sequences for filamentous
fungal host cells are the signal peptide coding sequences obtained
from the genes for Aspergillus niger neutral amylase, Aspergillus
niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola
insolens cellulase, Humicola insolens endoglucanase V, Humicola
lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
[0141] Useful signal peptides for yeast host cells are obtained
from the genes for Saccharomyces cerevisiae alpha-factor and
Saccharomyces cerevisiae invertase. Other useful signal peptide
coding sequences are described by Romanos et al., 1992, supra.
[0142] The control sequence may also be a propeptide coding
sequence that encodes a propeptide positioned at the N-terminus of
a xyloglucan endotransglycosylase. The resultant polypeptide is
known as a proenzyme or propolypeptide (or a zymogen in some
cases). A propolypeptide is generally inactive and can be converted
to an active polypeptide by catalytic or autocatalytic cleavage of
the propeptide from the propolypeptide. The propeptide coding
sequence may be obtained from the genes for Bacillus subtilis
alkaline protease (aprE), Bacillus subtilis neutral protease
(nprT), Myceliophthora thermophila laccase (WO 95/33836),
Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae
alpha-factor.
[0143] Where both signal peptide and propeptide sequences are
present, the propeptide sequence is positioned next to the
N-terminus of a xyloglucan endotransglycosylase and the signal
peptide sequence is positioned next to the N-terminus of the
propeptide sequence.
[0144] The various nucleotide and control sequences may be joined
together to produce a recombinant expression vector that may
include one or more convenient restriction sites to allow for
insertion or substitution of the polynucleotide encoding the
xyloglucan endotransglycosylase at such sites. Alternatively, the
polynucleotide may be expressed by inserting the polynucleotide or
a nucleic acid construct comprising the polynucleotide into an
appropriate vector for expression. In creating the expression
vector, the coding sequence is located in the vector so that the
coding sequence is operably linked with the appropriate control
sequences for expression.
[0145] The recombinant expression vector may be any vector (e.g., a
plasmid or virus) that can be conveniently subjected to recombinant
DNA procedures and can bring about expression of the
polynucleotide. The choice of the vector will typically depend on
the compatibility of the vector with the host cell into which the
vector is to be introduced. The vector may be a linear or closed
circular plasmid.
[0146] The vector may be an autonomously replicating vector, i.e.,
a vector that exists as an extrachromosomal entity, the replication
of which is independent of chromosomal replication, e.g., a
plasmid, an extrachromosomal element, a minichromosome, or an
artificial chromosome. The vector may contain any means for
assuring self-replication. Alternatively, the vector may be one
that, when introduced into the host cell, is integrated into the
genome and replicated together with the chromosome(s) into which it
has been integrated. Furthermore, a single vector or plasmid or two
or more vectors or plasmids that together contain the total DNA to
be introduced into the genome of the host cell, or a transposon,
may be used.
[0147] The vector preferably contains one or more selectable
markers that permit easy selection of transformed, transfected,
transduced, or the like cells. A selectable marker is a gene the
product of which provides for biocide or viral resistance,
resistance to heavy metals, prototrophy to auxotrophs, and the
like.
[0148] Examples of bacterial selectable markers are Bacillus
licheniformis or Bacillus subtilis dal genes, or markers that
confer antibiotic resistance such as ampicillin, chloramphenicol,
kanamycin, neomycin, spectinomycin, or tetracycline resistance.
Suitable markers for yeast host cells include, but are not limited
to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable
markers for use in a filamentous fungal host cell include, but are
not limited to, adeA
(phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB
(phosphoribosylaminoimidazole synthase), amdS (acetamidase), argB
(ornithine carbamoyltransferase), bar (phosphinothricin
acetyltransferase), hph (hygromycin phosphotransferase), niaD
(nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase),
sC (sulfate adenyltransferase), and trpC (anthranilate synthase),
as well as equivalents thereof. Preferred for use in an Aspergillus
cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG
genes and a Streptomyces hygroscopicus bar gene. Preferred for use
in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG
genes.
[0149] The selectable marker may be a dual selectable marker system
as described in WO 2010/039889. In one aspect, the dual selectable
marker is an hph-tk dual selectable marker system.
[0150] The vector preferably contains an element(s) that permits
integration of the vector into the host cell's genome or autonomous
replication of the vector in the cell independent of the
genome.
[0151] For integration into the host cell genome, the vector may
rely on the polynucleotide's sequence encoding the xyloglucan
endotransglycosylase or any other element of the vector for
integration into the genome by homologous or non-homologous
recombination. Alternatively, the vector may contain additional
polynucleotides for directing integration by homologous
recombination into the genome of the host cell at a precise
location(s) in the chromosome(s). To increase the likelihood of
integration at a precise location, the integrational elements
should contain a sufficient number of nucleic acids, such as 100 to
10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base
pairs, which have a high degree of sequence identity to the
corresponding target sequence to enhance the probability of
homologous recombination. The integrational elements may be any
sequence that is homologous with the target sequence in the genome
of the host cell. Furthermore, the integrational elements may be
non-encoding or encoding polynucleotides. On the other hand, the
vector may be integrated into the genome of the host cell by
non-homologous recombination.
[0152] For autonomous replication, the vector may further comprise
an origin of replication enabling the vector to replicate
autonomously in the host cell in question. The origin of
replication may be any plasmid replicator mediating autonomous
replication that functions in a cell. The term "origin of
replication" or "plasmid replicator" means a polynucleotide that
enables a plasmid or vector to replicate in vivo.
[0153] Examples of bacterial origins of replication are the origins
of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184
permitting replication in E. coli, and pUB110, pE194, pTA1060, and
pAM.beta.1 permitting replication in Bacillus.
[0154] Examples of origins of replication for use in a yeast host
cell are the 2 micron origin of replication, ARS1, ARS4, the
combination of ARS1 and CEN3, and the combination of ARS4 and
CEN6.
[0155] Examples of origins of replication useful in a filamentous
fungal cell are AMA1 and ANSI (Gems et al., 1991, Gene 98: 61-67;
Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO
00/24883). Isolation of the AMA1 gene and construction of plasmids
or vectors comprising the gene can be accomplished according to the
methods disclosed in WO 00/24883.
[0156] More than one copy of a polynucleotide may be inserted into
a host cell to increase production of a xyloglucan
endotransglycosylase. An increase in the copy number of the
polynucleotide can be obtained by integrating at least one
additional copy of the sequence into the host cell genome or by
including an amplifiable selectable marker gene with the
polynucleotide where cells containing amplified copies of the
selectable marker gene, and thereby additional copies of the
polynucleotide, can be selected for by cultivating the cells in the
presence of the appropriate selectable agent.
[0157] The procedures used to ligate the elements described above
to construct the recombinant expression vectors are well known to
one skilled in the art (see, e.g., Sambrook et al., 1989,
supra).
[0158] The host cell may be any cell useful in the recombinant
production of a xyloglucan endotransglycosylase, e.g., a prokaryote
or a eukaryote.
[0159] The prokaryotic host cell may be any Gram-positive or
Gram-negative bacterium. Gram-positive bacteria include, but are
not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus,
Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus,
Streptococcus, and Streptomyces. Gram-negative bacteria include,
but are not limited to, Campylobacter, E. coli, Flavobacterium,
Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas,
Salmonella, and Ureaplasma.
[0160] The bacterial host cell may be any Bacillus cell including,
but not limited to, Bacillus alkalophilus, Bacillus
amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus
clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus,
Bacillus lentus, Bacillus licheniformis, Bacillus megaterium,
Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis,
and Bacillus thuringiensis cells.
[0161] The bacterial host cell may also be any Streptomyces cell
including, but not limited to, Streptomyces achromogenes,
Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces
griseus, and Streptomyces lividans cells.
[0162] The introduction of DNA into a Bacillus cell may be effected
by protoplast transformation (see, e.g., Chang and Cohen, 1979,
Mol. Gen. Genet. 168: 111-115), competent cell transformation (see,
e.g., Young and Spizizen, 1961, J. Bacteriol. 81: 823-829, or
Dubnau and Davidoff-Abelson, 1971, J. Mol. Biol. 56: 209-221),
electroporation (see, e.g., Shigekawa and Dower, 1988,
Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and
Thorne, 1987, J. Bacteriol. 169: 5271-5278). The introduction of
DNA into an E. coli cell may be effected by protoplast
transformation (see, e.g., Hanahan, 1983, J. Mol. Biol. 166:
557-580) or electroporation (see, e.g., Dower et al., 1988, Nucleic
Acids Res. 16: 6127-6145). The introduction of DNA into a
Streptomyces cell may be effected by protoplast transformation,
electroporation (see, e.g., Gong et al., 2004, Folia Microbiol.
(Praha) 49: 399-405), conjugation (see, e.g., Mazodier et al.,
1989, J. Bacteriol. 171: 3583-3585), or transduction (see, e.g.,
Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98: 6289-6294). The
introduction of DNA into a Pseudomonas cell may be effected by
electroporation (see, e.g., Choi et al., 2006, J. Microbiol.
Methods 64: 391-397) or conjugation (see, e.g., Pinedo and Smets,
2005, Appl. Environ. Microbiol. 71: 51-57). The introduction of DNA
into a Streptococcus cell may be effected by natural competence
(see, e.g., Perry and Kuramitsu, 1981, Infect. Immun. 32:
1295-1297), protoplast transformation (see, e.g., Catt and Jollick,
1991, Microbios 68: 189-207), electroporation (see, e.g., Buckley
et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804), or
conjugation (see, e.g., Clewell, 1981, Microbiol. Rev. 45:
409-436). However, any method known in the art for introducing DNA
into a host cell can be used.
[0163] The host cell may also be a eukaryote, such as a mammalian,
insect, plant, or fungal cell.
[0164] The host cell may be a fungal cell. "Fungi" as used herein
includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and
Zygomycota as well as the Oomycota and all mitosporic fungi (as
defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary
of The Fungi, 8th edition, 1995, CAB International, University
Press, Cambridge, UK).
[0165] The fungal host cell may be a yeast cell. "Yeast" as used
herein includes ascosporogenous yeast (Endomycetales),
basidiosporogenous yeast, and yeast belonging to the Fungi
Imperfecti (Blastomycetes). Since the classification of yeast may
change in the future, for the purposes of this invention, yeast
shall be defined as described in Biology and Activities of Yeast
(Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol.
Symposium Series No. 9, 1980).
[0166] The yeast host cell may be a Candida, Hansenula,
Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or
Yarrowia cell, such as a Kluyveromyces lactis, Saccharomyces
carlsbergensis, Saccharomyces cerevisiae, Saccharomyces
diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri,
Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia
lipolytica cell.
[0167] The fungal host cell may be a filamentous fungal cell.
"Filamentous fungi" include all filamentous forms of the
subdivision Eumycota and Oomycota (as defined by Hawksworth et al.,
1995, supra). The filamentous fungi are generally characterized by
a mycelial wall composed of chitin, cellulose, glucan, chitosan,
mannan, and other complex polysaccharides. Vegetative growth is by
hyphal elongation and carbon catabolism is obligately aerobic. In
contrast, vegetative growth by yeasts such as Saccharomyces
cerevisiae is by budding of a unicellular thallus and carbon
catabolism may be fermentative.
[0168] The filamentous fungal host cell may be an Acremonium,
Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis,
Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium,
Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora,
Neocallimastix, Neurospora, Paecilomyces, Penicillium,
Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum,
Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or
Trichoderma cell.
[0169] For example, the filamentous fungal host cell may be an
Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus,
Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger,
Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina,
Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis
pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa,
Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium
keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium,
Chrysosporium pannicola, Chrysosporium queenslandicum,
Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus,
Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis,
Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum,
Fusarium graminum, Fusarium heterosporum, Fusarium negundi,
Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium
sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides,
Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides,
Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor
miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium
purpurogenum, Phanerochaete chrysosporium, Phlebia radiata,
Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes
versicolor, Trichoderma harzianum, Trichoderma koningii,
Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma
viride cell.
[0170] Fungal cells may be transformed by a process involving
protoplast formation, transformation of the protoplasts, and
regeneration of the cell wall in a manner known per se. Suitable
procedures for transformation of Aspergillus and Trichoderma host
cells are described in EP 238023, Yelton et al., 1984, Proc. Natl.
Acad. Sci. USA 81: 1470-1474, and Christensen et al., 1988,
Bio/Technology 6: 1419-1422. Suitable methods for transforming
Fusarium species are described by Malardier et al., 1989, Gene 78:
147-156, and WO 96/00787. Yeast may be transformed using the
procedures described by Becker and Guarente, In Abelson, J. N. and
Simon, M. I., editors, Guide to Yeast Genetics and Molecular
Biology, Methods in Enzymology, Volume 194, pp. 182-187, Academic
Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153: 163;
and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75: 1920.
[0171] The host cells are cultivated in a nutrient medium suitable
for production of the xyloglucan endotransglycosylase using methods
known in the art. For example, the cells may be cultivated by shake
flask cultivation, or small-scale or large-scale fermentation
(including continuous, batch, fed-batch, or solid state
fermentations) in laboratory or industrial fermentors in a suitable
medium and under conditions allowing the xyloglucan
endotransglycosylase to be expressed and/or isolated. The
cultivation takes place in a suitable nutrient medium comprising
carbon and nitrogen sources and inorganic salts, using procedures
known in the art. Suitable media are available from commercial
suppliers or may be prepared according to published compositions
(e.g., in catalogues of the American Type Culture Collection). If
the xyloglucan endotransglycosylase is secreted into the nutrient
medium, the polypeptide can be recovered directly from the medium.
If the xyloglucan endotransglycosylase is not secreted, it can be
recovered from cell lysates.
[0172] The xyloglucan endotransglycosylase may be detected using
methods known in the art that are specific for the polypeptides.
These detection methods include, but are not limited to, use of
specific antibodies, formation of an enzyme product, or
disappearance of an enzyme substrate. For example, an enzyme assay
may be used to determine the activity of the polypeptide.
[0173] The xyloglucan endotransglycosylase may be recovered using
methods known in the art. For example, the polypeptide may be
recovered from the nutrient medium by conventional procedures
including, but not limited to, collection, centrifugation,
filtration, extraction, spray-drying, evaporation, or
precipitation. In one aspect, a whole fermentation broth comprising
the polypeptide is recovered. In a preferred aspect, xyloglucan
endotransglycosylase yield may be improved by subsequently washing
cellular debris in buffer or in buffered detergent solution to
extract biomass-associated polypeptide.
[0174] The xyloglucan endotransglycosylase may be purified by a
variety of procedures known in the art including, but not limited
to, chromatography (e.g., ion exchange, affinity, hydrophobic
interaction, mixed mode, reverse phase, chromatofocusing, and size
exclusion), electrophoretic procedures (e.g., preparative
isoelectric focusing), differential solubility (e.g., ammonium
sulfate precipitation), PAGE, membrane-filtration or extraction
(see, e.g., Protein Purification, Janson and Ryden, editors, VCH
Publishers, New York, 1989) to obtain substantially pure
polypeptide. In a preferred aspect, xyloglucan endotransglycosylase
may be purified by formation of a covalent acyl-enzyme intermediate
with xyloglucan, followed by precipitation with microcrystalline
cellulose or adsorption to cellulose membranes. Release of the
polypeptide is then effected by addition of xyloglucan oligomers to
resolve the covalent intermediate (Sulova and Farkas, 1999, Protein
Expression and Purification 16(2): 231-235, and Steele and Fry,
1999, Biochemical Journal 340: 207-211).
[0175] The present invention is further described by the following
examples that should not be construed as limiting the scope of the
invention.
EXAMPLES
Media and Solutions
[0176] COVE agar plates were composed of 342.3 g of sucrose, 252.54
g of CsCl, 59.1 g of acetamide, 520 mg of KCl, 520 mg of
MgSO.sub.4.7H.sub.2O, 1.52 g of KH.sub.2PO.sub.4, 0.04 mg of
Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 0.4 mg of CuSO.sub.4.5H.sub.2O,
1.2 mg of FeSO.sub.4.7H.sub.2O, 0.7 mg of MnSO.sub.4.2H.sub.2O, 0.8
mg of Na.sub.2MoO.sub.4.2H.sub.2O, 10 mg of ZnSO.sub.4.7H.sub.2O,
25 g of Noble agar, and deionized water to 1 liter.
[0177] LB medium was composed of 10 g of tryptone, 5 g of yeast
extract, 5 g of NaCl, and deionized water to 1 liter.
[0178] LB plates were composed of 10 g of tryptone, 5 g of yeast
extract, 5 g of NaCl, 15 g of bacteriological agar, and deionized
water to 1 liter.
[0179] Minimal medium agar plates were composed of 342.3 g of
sucrose, 10 g of glucose, 4 g of MgSO.sub.4.7H.sub.2O, 6 g of
NaNO.sub.3, 0.52 g of KCl, 1.52 g of KH.sub.2PO.sub.4, 0.04 mg of
Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 0.4 mg of CuSO.sub.4.5H.sub.2O,
1.2 mg of FeSO.sub.4.7H.sub.2O, 0.7 mg of MnSO.sub.4.2H.sub.2O, 0.8
mg of Na.sub.2MoO.sub.4.2H.sub.2O, 10 mg of ZnSO.sub.4.7H.sub.2O,
500 mg of citric acid, 4 mg of d-biotin, 20 g of Noble agar, and
deionized water to 1 liter.
[0180] Synthetic defined medium lacking uridine was composed of 18
mg of adenine hemisulfate, 76 mg of alanine, 76 mg of arginine
hydrochloride, 76 mg of asparagine monohydrate, 76 mg of aspartic
acid, 76 mg of cysteine hydrochloride monohydrate, 76 mg of
glutamic acid monosodium salt, 76 mg of glutamine, 76 mg of
glycine, 76 mg of histidine, myo-76 mg of inositol, 76 mg of
isoleucine, 380 mg of leucine, 76 mg of lysine monohydrochloride,
76 mg of methionine, 8 mg of p-aminobenzoic acid potassium salt, 76
mg of phenylalanine, 76 mg of proline, 76 mg of serine, 76 mg of
threonine, 76 mg of tryptophan, 76 mg of tyrosine disodium salt, 76
mg of valine, and deionized water to 1 liter.
[0181] TAE buffer was composed of 4.84 g of Tris base, 1.14 ml of
glacial acetic acid, 2 ml of 0.5 M EDTA pH 8.0, and deionized water
to 1 liter.
[0182] TBE buffer was composed of 10.8 g of Tris base, 5.5 g of
boric acid, 4 ml of 0.5 M EDTA pH 8.0, and deionized water to 1
liter.
[0183] 2.times.YT plus ampicillin plates were composed of 16 g of
tryptone, 10 g of yeast extract, 5 g of sodium chloride, 15 g of
Bacto agar, and deionized water to 1 liter. One ml of a 100 mg/ml
solution of ampicillin was added after the autoclaved medium was
tempered to 55.degree. C.
[0184] YP+2% glucose medium was composed of 10 g of yeast extract,
20 g of peptone, 20 g of glucose, and deionized water to 1
liter.
[0185] YP+2% maltodextrin medium was composed of 10 g of yeast
extract, 20 g of peptone, 20 g of maltodextrin, and deionized water
to 1 liter.
Example 1: Preparation of Vigna angularis Xyloglucan
Endotransglycosylase 16
[0186] Vigna angularis xyloglucan endotransglycosylase 16 (VaXET16;
SEQ ID NO: 1 [native DNA sequence], SEQ ID NO: 2 [synthetic DNA
sequence], and SEQ ID NO: 3 [deduced amino acid sequence]; also
referred to as XTH1) was recombinantly produced in Aspergillus
oryzae MT3568 according to the protocol described below.
Aspergillus oryzae MT3568 is an amdS (acetamidase) disrupted gene
derivative of Aspergillus oryzae JaL355 (WO 2002/40694), in which
pyrG auxotrophy was restored by disrupting the A. oryzae amdS gene
with the pyrG gene.
[0187] The vector pDLHD0012 was constructed to express the VaXET16
gene in multi-copy in Aspergillus oryzae. Plasmid pDLHD0012 was
generated by combining two DNA fragments using megaprimer cloning:
Fragment 1 containing the VaXET16 ORF and flanking sequences with
homology to vector pBM120 (US20090253171), and Fragment 2
consisting of an inverse PCR amplicon of vector pBM120.
[0188] Fragment 1 was amplified using primer 613788 (sense) and
primer 613983 (antisense) shown below. These primers were designed
to contain flanking regions of sequence homology to vector pBM120
(lower case) for ligation-free cloning between the PCR
fragments.
TABLE-US-00001 Primer 613788 (sense): (SEQ ID NO: 7)
ttcctcaatcctctatatacacaactggccATGGGCTCGTCCCTGGGAC Primer 613983
(antisense): (SEQ ID NO: 8)
tgtcagtcacctctagttaattaGATGTCCCTATCGCGTGTACACTCG
[0189] Fragment 1 was amplified by PCR in a reaction composed of 10
ng of a GENEART.RTM. vector pMA containing the VaXET16 synthetic
gene (SEQ ID NO: 3 [synthetic DNA sequence]) cloned between the Sac
I and Kpn I sites, 0.5 .mu.l of PHUSION.RTM. DNA Polymerase (New
England Biolabs, Inc., Ipswich, Mass., USA), 20 pmol of primer
613788, 20 pmol of primer 613983, 1 .mu.l of 10 mM dNTPs, 10 .mu.l
of 5.times. PHUSION.RTM. HF buffer (New England Biolabs, Inc.,
Ipswich, Mass., USA), and 35.5 .mu.l of water. The reaction was
incubated in an EPPENDORF.RTM. MASTERCYCLER.RTM. (Eppendorf AG,
Hamburg, Germany) programmed for 1 cycle at 98.degree. C. for 30
seconds; and 30 cycles each at 98.degree. C. for 10 seconds,
60.degree. C. for 10 seconds, and 72.degree. C. for 30 seconds. The
resulting 0.9 kb PCR product (Fragment 1) was treated with 1 .mu.l
of Dpn I (Promega, Fitchburg, Wis., USA) to remove plasmid template
DNA. The Dpn I was added directly to the PCR tube, mixed well, and
incubated at 37.degree. C. for 60 minutes, and then was
column-purified using a MINELUTE.RTM. PCR Purification Kit (QIAGEN
Inc., Valencia, Calif., USA) according to the manufacturer's
instructions.
[0190] Fragment 2 was amplified using primers 613786 (sense) and
613787 (antisense) shown below.
TABLE-US-00002 613786 (sense): taattaactagaggtgactgacacctggc (SEQ
ID NO: 9) 613787 (antisense): catggccagttgtgtatatagaggattgagg (SEQ
ID NO: 10)
[0191] Fragment 2 was amplified by PCR in a reaction composed of 10
ng of plasmid pBM120, 0.5 .mu.l of PHUSION.RTM. DNA Polymerase, 20
pmol of primer 613786, 20 pmol of primer 613787, 1 .mu.l of 10 mM
dNTPs, 10 .mu.l of 5.times. PHUSION.RTM. HF buffer, and 35.5 .mu.l
of water. The reaction was incubated in an EPPENDORF.RTM.
MASTERCYCLER.RTM. programmed for 1 cycle at 98.degree. C. for 30
seconds; and 30 cycles each at 98.degree. C. for 10 seconds,
60.degree. C. for 10 seconds, and 72.degree. C. for 4 minutes. The
resulting 6.9 kb PCR product (Fragment 2) was treated with 1 .mu.l
of Dpn I to remove plasmid template DNA. The Dpn I was added
directly to the PCR tube, mixed well, and incubated at 37.degree.
C. for 60 minutes, and then column-purified using a MINELUTE.RTM.
PCR Purification Kit according to the manufacturer's
instructions.
[0192] The following procedure was used to combine the two PCR
fragments using megaprimer cloning. Fragments 1 and 2 were combined
by PCR in a reaction composed of 5 .mu.l of each purified PCR
product, 0.5 .mu.l of PHUSION.RTM. DNA Polymerase, 1 .mu.l of 10 mM
dNTPs, 10 .mu.l of 5.times. PHUSION.RTM. HF buffer, and 28.5 .mu.l
of water. The reaction was incubated in an EPPENDORF.RTM.
MASTERCYCLER.RTM. programmed for 1 cycle at 98.degree. C. for 30
seconds; and 40 cycles each at 98.degree. C. for 10 seconds,
60.degree. C. for 10 seconds, and 72.degree. C. for 4 minutes. Two
.mu.l of the resulting PCR product DNA was then transformed into E.
coli ONE SHOT.RTM. TOP10 electrocompetent cells (Life Technologies,
Grand Island, N.Y., USA) according the manufacturer's instructions.
Fifty .mu.l of transformed cells were spread onto LB plates
supplemented with 100 .mu.g of ampicillin per ml and incubated at
37.degree. C. overnight. Individual transformants were picked into
3 ml of LB medium supplemented with 100 .mu.g of ampicillin per ml
and grown overnight at 37.degree. C. with shaking at 250 rpm. The
plasmid DNA was purified from the colonies using a QIAPREP.RTM.
Spin Miniprep Kit (QIAGEN Inc., Valencia, Calif., USA). DNA
sequencing using a 3130XL Genetic Analyzer (Applied Biosystems,
Foster City, Calif., USA) was used to confirm the presence of each
of both fragments in the final plasmid pDLHD0012 (FIG. 1).
[0193] Aspergillus oryzae strain MT3568 was transformed with
plasmid pDLHD0012 comprising the VaXET16 gene according to the
following protocol. Approximately 2-5.times.10.sup.7 spores of A.
oryzae strain MT3568 were inoculated into 100 ml of YP+2% glucose
medium in a 500 ml shake flask and incubated at 28.degree. C. and
110 rpm overnight. Ten ml of the overnight culture were filtered in
a 125 ml sterile vacuum filter, and the mycelia were washed twice
with 50 ml of 0.7 M KCl-20 mM CaCl.sub.2. The remaining liquid was
removed by vacuum filtration, leaving the mat on the filter.
Mycelia were resuspended in 10 ml of 0.7 M KCl-20 mM CaCl.sub.2 and
transferred to a sterile 125 ml shake flask containing 20 mg of
GLUCANEX.RTM. 200 G (Novozymes Switzerland AG, Neumatt,
Switzerland) per ml and 0.2 mg of chitinase (Sigma-Aldrich, St.
Louis, Mo., USA) per ml in 10 ml of 0.7 M KCl-20 mM CaCl.sub.2. The
mixture was incubated at 37.degree. C. and 100 rpm for 30-90
minutes until protoplasts were generated from the mycelia. The
protoplast mixture was filtered through a sterile funnel lined with
MIRACLOTH.RTM. (Calbiochem, San Diego, Calif., USA) into a sterile
50 ml plastic centrifuge tube to remove mycelial debris. The debris
in the MIRACLOTH.RTM. was washed thoroughly with 0.7 M KCl-20 mM
CaCl.sub.2, and centrifuged at 2500 rpm (537.times.g) for 10
minutes at 20-23.degree. C. The supernatant was removed and the
protoplast pellet was resuspended in 20 ml of 1 M sorbitol-10 mM
Tris-HCl (pH 6.5)-10 mM CaCl.sub.2. This step was repeated twice,
and the final protoplast pellet was resuspended in 1 M sorbitol-10
mM Tris-HCl (pH 6.5)-10 mM CaCl.sub.2 to obtain a final protoplast
concentration of 2.times.10.sup.7/ml.
[0194] Two micrograms of pDLHD0012 were added to the bottom of a
sterile 2 ml plastic centrifuge tube. Then 100 .mu.l of protoplasts
were added to the tube followed by 300 .mu.l of 60% PEG-4000 in 10
mM Tris-HCl (pH 6.5)-10 mM CaCl.sub.2. The tube was mixed gently by
hand and incubated at 37.degree. C. for 30 minutes. Two ml of 1 M
sorbitol-10 mM Tris-HCl (pH 6.5)-10 mM CaCl.sub.2 were added to
each transformation and the mixture was transferred onto 150 mm
COVE agar plates. Transformation plates were incubated at
34.degree. C. until colonies appeared.
[0195] Twenty-one transformant colonies were picked to fresh COVE
agar plates and cultivated at 34.degree. C. for four days until the
transformants sporulated. Fresh spores were transferred to 48-well
deep-well plates containing 2 ml of YP+2% maltodextrin, covered
with a breathable seal, and grown for 4 days at 34.degree. C. with
no shaking. After 4 days growth samples of the culture media were
assayed for xyloglucan endotransglycosylase activity using an
iodine stain assay and for xyloglucan endotransglycosylase
expression by SDS-PAGE.
[0196] The iodine stain assay for xyloglucan endotransglycosylase
activity was performed according to the following protocol. In a
96-well plate, 5 .mu.l of culture broth were added to a mixture of
5 .mu.l of xyloglucan (Megazyme, Bray, United Kingdom) (5 mg/ml in
water), 20 .mu.l of xyloglucan oligomers (Megazyme, Bray, United
Kingdom) (5 mg/ml in water), and 10 .mu.l of 400 mM sodium citrate
pH 5.5. The reaction mix was incubated at 37.degree. C. for thirty
minutes, quenched with 200 .mu.l of a solution containing 14% (w/v)
Na.sub.2SO.sub.4, 0.2% KI, 100 mM HCl, and 1% iodine (I.sub.2),
incubated in the dark for 30 minutes, and then the absorbance was
measured in a plate reader at 620 nm. The assay demonstrated the
presence of xyloglucan endotransglycosylase activity from several
transformants.
[0197] SDS-PAGE was performed using a 8-16% CRITERION.RTM. Stain
Free SDS-PAGE gel (Bio-Rad Laboratories, Inc., Hercules, Calif.,
USA), and imaging the gel with a Stain Free Imager (Bio-Rad
Laboratories, Inc., Hercules, Calif., USA) using the following
settings: 5-minute activation, automatic imaging exposure (intense
bands), highlight saturated pixels=ON, color=Coomassie, and band
detection, molecular weight analysis and reporting disabled.
SDS-PAGE analysis indicated that several transformants expressed a
protein of approximately 32 kDa corresponding to VaXET16.
Example 2: Construction of Plasmid pMMar27 as a Yeast Expression
Plasmid Vector
[0198] Plasmid pMMar27 was constructed for expression of the T.
terrestris Cel6A cellobiohydrolase II in yeast. The plasmid was
generated from a lineage of yeast expression vectors: plasmid
pMMar27 was constructed from plasmid pBM175b; plasmid pBM175b was
constructed from plasmid pBM143b (WO 2008/008950) and plasmid
pJLin201; and plasmid pJLin201 was constructed from pBM143b.
[0199] Plasmid pJLin201 is identical to pBM143b except an Xba I
site immediately downstream of a Thermomyces lanuginosus lipase
variant gene in pBM143b was mutated to a unique Nhe I site. A
QUIKCHANGE.RTM. II XL Site-Directed Mutagenesis Kit (Stratagene, La
Jolla, Calif., USA) was used to change the Xba I sequence (TCTAGA)
to a Nhe I sequence (gCTAGc) in pBM143b. Primers employed to mutate
the site are shown below.
TABLE-US-00003 Primer 999551 (sense): (SEQ ID NO: 11)
5'-ACATGTCTTTGATAAgCTAGcGGGCCGCATCATGTA-3' Primer 999552
(antisense): (SEQ ID NO: 12)
5'-TACATGATGCGGCCCgCTAGcTTATCAAAGACATGT-3'
Lower case represents mutated nucleotides.
[0200] The amplification reaction was composed of 125 ng of each
primer above, 20 ng of pBM143b, 1.times. QUIKCHANGE.RTM. Reaction
Buffer (Stratagene, La Jolla, Calif., USA), 3 .mu.l of
QUIKSOLUTION.RTM. (Stratagene, La Jolla, Calif., USA), 1 .mu.l of
dNTP mix, and 1 .mu.l of a 2.5 units/ml Pfu Ultra HF DNA polymerase
in a final volume of 50 .mu.l. The reaction was performed using an
EPPENDORF.RTM. MASTERCYCLER.RTM. thermocycler programmed for 1
cycle at 95.degree. C. for 1 minute; 18 cycles each at 95.degree.
C. for 50 seconds, 60.degree. C. for 50 seconds, and 68.degree. C.
for 6 minutes and 6 seconds; and 1 cycle at 68.degree. C. for 7
minutes. After the PCR, the tube was placed on ice for 2 minutes.
One microliter of Dpn I was directly added to the amplification
reaction and incubated at 37.degree. C. for 1 hour. A 2 .mu.l
volume of the Dpn I digested reaction was used to transform E. coli
XL10-GOLD.RTM. Ultracompetent Cells (Stratagene, La Jolla, Calif.,
USA) according to the manufacturer's instructions. E. coli
transformants were selected on 2.times.YT plus ampicillin plates.
Plasmid DNA was isolated from several of the transformants using a
BIOROBOT.RTM. 9600. One plasmid with the desired Nhe I change was
confirmed by restriction digestion and sequencing analysis and
designated plasmid pJLin201. To eliminate possible PCR errors
introduced by site-directed-mutagenesis, plasmid pBM175b was
constructed by cloning the Nhe I site containing fragment back into
plasmid pBM143b. Briefly, plasmid pJLin201 was digested with Nde I
and Nu I and the resulting fragment was cloned into pBM143b
previously digested with the same enzymes using a Rapid Ligation
Kit (Roche Diagnostics Corporation, Indianapolis, Ind., USA). Then,
7 .mu.l of the Nde I/Mlu I digested pJLin201 fragment and 1 .mu.l
of the digested pBM143b were mixed with 2 .mu.l of 5.times.DNA
dilution buffer (Roche Diagnostics Corporation, Indianapolis, Ind.,
USA), 10 .mu.l of 2.times.T4 DNA ligation buffer (Roche Diagnostics
Corporation, Indianapolis, Ind., USA), and 1 .mu.l of T4 DNA ligase
(Roche Diagnostics Corporation, Indianapolis, Ind., USA) and
incubated for 15 minutes at room temperature. Two microliters of
the ligation were transformed into XL1-Blue Subcloning-Grade
Competent Cells (Stratagene, La Jolla, Calif., USA) cells and
spread onto 2.times.YT plus ampicillin plates. Plasmid DNA was
purified from several transformants using a BIOROBOT.RTM. 9600 and
analyzed by DNA sequencing using a 3130XL Genetic Analyzer to
identify a plasmid containing the desired A. nidulans pyrG insert.
One plasmid with the expected DNA sequence was designated
pBM175b.
[0201] Plasmid pMMar27 was constructed from pBM175b and an
amplified gene of T. terrestris Cel6A cellobiohydrolase II with
overhangs designed for insertion into digested pBM175b. Plasmid
pBM175b containing the Thermomyces lanuginosus lipase variant gene
under control of the CUP I promoter contains unique Hind III and
Nhe I sites to remove the lipase gene. Plasmid pBM 175 was digested
with these restriction enzymes to remove the lipase gene. After
digestion, the empty vector was isolated by 1.0% agarose gel
electrophoresis using TBE buffer where an approximately 5,215 bp
fragment was excised from the gel and extracted using a
QIAQUICK.RTM. Gel Extraction Kit. The ligation reaction (20 .mu.l)
was composed of 1.times. IN-FUSION.RTM. Buffer (BD Biosciences,
Palo Alto, Calif., USA), 1.times.BSA (BD Biosciences, Palo Alto,
Calif., USA), 1 .mu.l of IN-FUSION.RTM. enzyme (diluted 1:10) (BD
Biosciences, Palo Alto, Calif., USA), 99 ng of pBM175b digested
with Hind III and Nhe I, and 36 ng of the purified T. terrestris
Cel6A cellobiohydrolase II PCR product. The reaction was incubated
at room temperature for 30 minutes. A 2 .mu.l volume of the
IN-FUSION.RTM. reaction was transformed into E. coli XL10-GOLD.RTM.
Ultracompetent Cells. Transformants were selected on LB plates
supplemented with 100 .mu.g of ampicillin per ml. A colony was
picked that contained the T. terrestris Cel6A inserted into the
pBM175b vector in place of the lipase gene, resulting in pMMar27
(FIG. 2). The plasmid chosen contained a PCR error at position 228
from the start codon, TCT instead of TCC, but resulted in a silent
change in the T. terrestris Cel6A cellobiohydrolase II.
Example 3: Construction of pEvFz1 Expression Vector
[0202] Expression vector pEvFz1 was constructed by modifying
pBM120a (U.S. Pat. No. 8,263,824) to comprise the NA2/NA2-tpi
promoter, A. niger amyloglucosidase terminator sequence (AMG
terminator), and Aspergillus nidulans orotidine-5'-phosphate
decarboxylase gene (pyrG) as a selectable marker.
[0203] Plasmid pEvFz1 was generated by cloning the A. nidulans pyrG
gene from pAILo2 (WO 2004/099228) into pBM120a. Plasmids pBM120a
and pAILo2 were digested with Nsi I overnight at 37.degree. C. The
resulting 4176 bp linearized pBM120a vector fragment and the 1479
bp pyrG gene insert from pAILo2 were each purified by 0.7% agarose
gel electrophoresis using TAE buffer, excised from the gel, and
extracted using a QIAQUICK.RTM. Gel Extraction Kit.
[0204] The 1479 bp pyrG gene insert was ligated to the Nsi I
digested pBM120a fragment using a QUICK LIGATION.TM. Kit (New
England Biolabs, Beverly, Mass., USA). The ligation reaction was
composed of 1.times. QUICK LIGATION.TM. Reaction Buffer (New
England Biolabs, Beverly, Mass., USA), 50 ng of Nsi I digested
pBM120a vector, 54 ng of the 1479 bp Nsi I digested pyrG gene
insert, and 1 .mu.l of T4 DNA ligase in a total volume of 20 .mu.l.
The ligation mixture was incubated at 37.degree. C. for 15 minutes
followed at 50.degree. C. for 15 minutes and then placed on
ice.
[0205] One .mu.l of the ligation mixture was transformed into ONE
SHOT.RTM. TOP10 chemically competent Escherichia coli cells.
Transformants were selected on 2.times.YT plus ampicillin plates.
Plasmid DNA was purified from several transformants using a
BIOROBOT.RTM. 9600 and analyzed by DNA sequencing using a 3130XL
Genetic Analyzer to identify a plasmid containing the desired A.
nidulans pyrG insert. One plasmid with the expected DNA sequence
was designated pEvFz1 (FIG. 3).
Example 4: Construction of the Plasmid pDLHD0006 as a Yeast/E.
coli/A. oryzae Shuttle Vector
[0206] Plasmid pDLHD0006 was constructed as a base vector to enable
A. oryzae expression cassette library building using yeast
recombinational cloning. Plasmid pDLHD0006 was generated by
combining three DNA fragments using yeast recombinational cloning:
Fragment 1 containing the E. coli pUC origin of replication, E.
coli beta-lactamase (ampR) selectable marker, URA3 yeast selectable
marker, and yeast 2 micron origin of replication from pMMar27
(Example 2); Fragment 2 containing the 10 amyR/NA2-tpi promoter (a
hybrid of the promoters from the genes encoding Aspergillus niger
neutral alpha-amylase and Aspergillus oryzae triose phosphate
isomerase and including 10 repeated binding sites for the
Aspergillus oryzae amyR transcription factor), Thermomyces
lanuginosus lipase open reading frame (ORF), and Aspergillus niger
glucoamylase terminator from pJaL1262 (WO 2013/178674); and
Fragment 3 containing the Aspergillus nidulans pyrG selection
marker from pEvFz1 (Example 3).
TABLE-US-00004 PCR pDLHD0006 PCR Contents Template Fragment 1 E.
coli ori/AmpR/URA/2 micron (4.1 kb) pMMar27 Fragment 2 10
amyR/NA2-tpi PR/lipase/Tamg (4.5 kb) pJaL1262 Fragment 3 pyrG gene
from pEvFz1 (1.7 kb) pEvFz1
[0207] Fragment 1 was amplified using primers 613017 (sense) and
613018 (antisense) shown below. Primer 613017 was designed to
contain a flanking region with sequence homology to Fragment 3
(lower case) and primer 613018 was designed to contain a flanking
region with sequence homology to Fragment 2 (lower case) to enable
yeast recombinational cloning between the three PCR fragments.
TABLE-US-00005 Primer 613017 (sense): (SEQ ID NO: 13)
ttaatcgccttgcagcacaCCGCTTCCTCGCTCACTGACTC 613018 (antisense): (SEQ
ID NO: 14) acaataaccctgataaatgcGGAACAACACTCAACCCTATCTCGGTC
[0208] Fragment 1 was amplified by PCR in a reaction composed of 10
ng of plasmid pMMar27, 0.5 .mu.l of PHUSION.RTM. DNA Polymerase
(New England Biolabs, Inc., Ipswich, Mass., USA), 20 pmol of primer
613017, 20 pmol of primer 613018, 1 .mu.l of 10 mM dNTPs, 10 .mu.l
of 5.times. PHUSION.RTM. HF buffer, and 35.5 .mu.l of water. The
reaction was incubated in an EPPENDORF.RTM. MASTERCYCLER.RTM.
programmed for 1 cycle at 98.degree. C. for 30 seconds; and 30
cycles each at 98.degree. C. for 10 seconds, 60.degree. C. for 10
seconds, and 72.degree. C. for 1.5 minutes. The resulting 4.1 kb
PCR product (Fragment 1) was used directly for yeast recombination
with Fragments 2 and 3 below.
[0209] Fragment 2 was amplified using primers 613019 (sense) and
613020 (antisense) shown below. Primer 613019 was designed to
contain a flanking region of sequence homology to Fragment 1 (lower
case) and primer 613020 was designed to contain a flanking region
of sequence homology to Fragment 3 (lower case) to enable yeast
recombinational cloning between the three PCR fragments.
TABLE-US-00006 613019 (sense): (SEQ ID NO: 15)
agatagggttgagtgttgttccGCATTTATCAGGGTTATTGTCTCATGAG CGG 613020
(antisense): (SEQ ID NO: 16)
ttctacacgaaggaaagagGAGGAGAGAGTTGAACCTGGACG
[0210] Fragment 2 was amplified by PCR in a reaction composed of 10
ng of plasmid pJaL1262, 0.5 .mu.l of PHUSION.RTM. DNA Polymerase,
20 pmol of primer 613019, 20 pmol of primer 613020, 1 .mu.l of 10
mM dNTPs, 10 .mu.l of 5.times. PHUSION.RTM. HF buffer, and 35.5
.mu.l of water. The reaction was incubated in an EPPENDORF.RTM.
MASTERCYCLER.RTM. programmed for 1 cycle at 98.degree. C. for 30
seconds; 30 cycles each at 98.degree. C. for 10 seconds, 60.degree.
C. for 10 seconds, and 72.degree. C. for 2 minutes; and a
20.degree. C. hold. The resulting 4.5 kb PCR product (Fragment 2)
was used directly for yeast recombination with Fragment 1 above and
Fragment 3 below.
[0211] Fragment 3 was amplified using primers 613022 (sense) and
613021 (antisense) shown below. Primer 613021 was designed to
contain a flanking region of sequence homology to Fragment 2 (lower
case) and primer 613022 was designed to contain a flanking region
of sequence homology to Fragment 1 (lower case) to enable yeast
recombinational cloning between the three PCR fragments.
TABLE-US-00007 613022 (sense): (SEQ ID NO: 17)
aggttcaactctctcctcCTCTTTCCTTCGTGTAGAAGACCAGACAG 613021 (antisense):
(SEQ ID NO: 18) tcagtgagcgaggaagcggTGTGCTGCAAGGCGATTAAGTTGG
[0212] Fragment 3 was amplified by PCR in a reaction composed of 10
ng of plasmid pEvFz1 (Example 3), 0.5 .mu.l of PHUSION.RTM. DNA
Polymerase, 20 pmol of primer 613021, 20 pmol of primer 613022, 1
.mu.l of 10 mM dNTPs, 10 .mu.l of 5.times. PHUSION.RTM. HF buffer,
and 35.5 .mu.l of water. The reaction was incubated in an
EPPENDORF.RTM. MASTERCYCLER.RTM. programmed for 1 cycle at
98.degree. C. for 30 seconds; 30 cycles each at 98.degree. C. for
10 seconds, 60.degree. C. for 10 seconds, and 72.degree. C. for 2
minutes; and a 20.degree. C. hold. The resulting 1.7 kb PCR product
(Fragment 3) was used directly for yeast recombination with
Fragments 1 and 2 above.
[0213] The following procedure was used to combine the three PCR
fragments using yeast homology-based recombinational cloning. A 20
.mu.l aliquot of each of the three PCR fragments was combined with
100 .mu.g of single-stranded deoxyribonucleic acid from salmon
testes (Sigma-Aldrich, St. Louis, Mo., USA), 100 .mu.l of competent
yeast cells of strain YNG318 (Saccharomyces cerevisiae ATCC
208973), and 600 .mu.l of PLATE Buffer (Sigma Aldrich, St. Louis,
Mo., USA), and mixed. The reaction was incubated at 30.degree. C.
for 30 minutes with shaking at 200 rpm. The reaction was then
continued at 42.degree. C. for 15 minutes with no shaking. The
cells were pelleted by centrifugation at 5,000.times.g for 1 minute
and the supernatant was discarded. The cell pellet was suspended in
200 .mu.l of autoclaved water and split over two agar plates
containing Synthetic defined medium lacking uridine and incubated
at 30.degree. C. for three days. The yeast colonies were isolated
from the plate using 1 ml of autoclaved water. The cells were
pelleted by centrifugation at 13,000.times.g for 30 seconds and a
100 .mu.l aliquot of glass beads were added to the tube. The cell
and bead mixture was suspended in 250 .mu.l of P1 buffer (QIAGEN
Inc., Valencia, Calif., USA) and then vortexed for 1 minute to lyse
the cells. The plasmid DNA was purified using a QIAPREP.RTM. Spin
Miniprep Kit. A 3 .mu.l aliquot of the plasmid DNA was then
transformed into E. coli ONE SHOT.RTM. TOP10 electrocompetent cells
according the manufacturer's instructions. Fifty .mu.l of
transformed cells were spread onto LB plates supplemented with 100
.mu.g of ampicillin per ml and incubated at 37.degree. C.
overnight. Transformants were each picked into 3 ml of LB medium
supplemented with 100 .mu.g of ampicillin per ml and grown
overnight at 37.degree. C. with shaking at 250 rpm. The plasmid DNA
was purified from colonies using a QIAPREP.RTM. Spin Miniprep Kit.
DNA sequencing with a 3130XL Genetic Analyzer was used to confirm
the presence of each of the three fragments in a final plasmid
designated pDLHD0006 (FIG. 4).
Example 5: Preparation of Arabidopsis thaliana Xyloglucan
Endotransglycosylase 14
[0214] Arabidopsis thaliana xyloglucan endotransglycosylase
(AtXET14; SEQ ID NO: 4 [native DNA sequence], SEQ ID NO: 5
[synthetic DNA sequence], and SEQ ID NO: 6 [deduced amino acid
sequence]) was recombinantly produced in Aspergillus oryzae JaL355
(WO 2008/138835).
[0215] The vector pDLHD0039 was constructed to express the AtXET14
gene in multi-copy in Aspergillus oryzae. Plasmid pDLHD0039 was
generated by combining two DNA fragments using restriction-free
cloning: Fragment 1 containing the AtXET14 ORF and flanking
sequences with homology to vector pDLHD0006 (Example 4), and
Fragment 2 consisting of an inverse PCR amplicon of vector
pDLHD0006.
[0216] Fragment 1 was amplified using primers AtXET14F (sense) and
AtXET14R (antisense) shown below, which were designed to contain
flanking regions of sequence homology to vector pDLHD0006 (lower
case) for ligation-free cloning between the PCR fragments.
TABLE-US-00008 Primer AtXET14F (sense): (SEQ ID NO: 19)
ttcctcaatcctctatatacacaactggccATGGCCTGTTTCGCAACCAA ACAG AtXET14R
(antisense): (SEQ ID NO: 20)
agctcgctagagtcgacctaGAGTTTACATTCCTTGGGGAGACCCTG
[0217] Fragment 1 was amplified by PCR in a reaction composed of 10
ng of a GENEART.RTM. vector pMA containing the AtXET14 synthetic
DNA sequence cloned between the Sac I and Kpn I sites, 0.5 .mu.l of
PHUSION.RTM. DNA Polymerase (New England Biolabs, Inc., Ipswich,
Mass., USA), 20 pmol of primer AtXET14F, 20 pmol of primer
AtXET14R, 1 .mu.l of 10 mM dNTPs, 10 .mu.l of 5.times. PHUSION.RTM.
HF buffer, and 35.5 .mu.l of water. The reaction was incubated in
an EPPENDORF.RTM. MASTERCYCLER.RTM. programmed for 1 cycle at
98.degree. C. for 30 seconds; and 30 cycles each at 98.degree. C.
for 10 seconds, 60.degree. C. for 10 seconds, and 72.degree. C. for
30 seconds. The resulting 0.9 kb PCR product (Fragment 1) was
treated with 1 .mu.l of Dpn Ito remove plasmid template DNA. The
Dpn I was added directly to the PCR tube, mixed well, and incubated
at 37.degree. C. for 60 minutes, and then column-purified using a
MINELUTE.RTM. PCR Purification Kit.
[0218] Fragment 2 was amplified using primers 614604 (sense) and
613247 (antisense) shown below.
TABLE-US-00009 614604 (sense): (SEQ ID NO: 21)
taggtcgactctagcgagctcgagatc 613247 (antisense): (SEQ ID NO: 22)
catggccagttgtgtatatagaggattgaggaaggaagag
[0219] Fragment 2 was amplified by PCR in a reaction composed of 10
ng of plasmid pDLHD0006, 0.5 .mu.l of PHUSION.RTM. DNA Polymerase,
20 pmol of primer 614604, 20 pmol of primer 613247, 1 .mu.l of 10
mM dNTPs, 10 .mu.l of 5.times. PHUSION.RTM. HF buffer, and 35.5
.mu.l of water. The reaction was incubated in an EPPENDORF.RTM.
MASTERCYCLER.RTM. programmed for 1 cycle at 98.degree. C. for 30
seconds; and 30 cycles each at 98.degree. C. for 10 seconds,
60.degree. C. for 10 seconds, and 72.degree. C. for 4 minutes. The
resulting 7.3 kb PCR product (Fragment 2) was treated with 1 .mu.l
of Dpn I to remove plasmid template DNA. Dpn I was added directly
to the PCR tube, mixed well, and incubated at 37.degree. C. for 60
minutes, and then column-purified using a MINELUTE.RTM. PCR
Purification Kit.
[0220] The two PCR fragments were combined using a GENEART.RTM.
Seamless Cloning and Assembly Kit (Invitrogen, Carlsbad, Calif.,
USA) according to manufacturer's instructions. Three .mu.l of the
resulting reaction product DNA were then transformed into E. coli
ONE SHOT.RTM. TOP10 electrocompetent cells. Fifty .mu.l of
transformed cells were spread onto LB plates supplemented with 100
.mu.g of ampicillin per ml and incubated at 37.degree. C.
overnight. Individual transformant colonies were picked into 3 ml
of LB medium supplemented with 100 .mu.g of ampicillin per ml and
grown overnight at 37.degree. C. with shaking at 250 rpm. The
plasmid DNA was purified from colonies using a QIAPREP.RTM. Spin
Miniprep Kit according to the manufacturer's instructions. DNA
sequencing with a 3130XL Genetic Analyzer was used to confirm the
presence of each of both fragments in the final plasmid pDLHD0039
(FIG. 5).
[0221] Aspergillus oryzae strain JaL355 was transformed with
plasmid pDLHD0039 comprising the AtXET14 gene according to the
following protocol. Approximately 2-5.times.10.sup.7 spores of
Aspergillus oryzae JaL355 were inoculated into 100 ml of YP+2%
glucose+10 mM uridine in a 500 ml shake flask and incubated at
28.degree. C. and 110 rpm overnight. Ten ml of the overnight
culture was filtered in a 125 ml sterile vacuum filter, and the
mycelia were washed twice with 50 ml of 0.7 M KCl-20 mM CaCl.sub.2.
The remaining liquid was removed by vacuum filtration, leaving the
mat on the filter. Mycelia were resuspended in 10 ml of 0.7 M
KCl-20 mM CaCl.sub.2) and transferred to a sterile 125 ml shake
flask containing 20 mg of GLUCANEX.RTM. 200 G per ml and 0.2 mg of
chitinase per ml in 10 ml of 0.7 M KCl-20 mM CaCl.sub.2. The
mixture was incubated at 37.degree. C. and 100 rpm for 30-90
minutes until protoplasts were generated from the mycelia. The
protoplast mixture was filtered through a sterile funnel lined with
MIRACLOTH.RTM. into a sterile 50 ml plastic centrifuge tube to
remove mycelial debris. The debris in the MIRACLOTH.RTM. was washed
thoroughly with 0.7 M KCl-20 mM CaCl.sub.2, and centrifuged at 2500
rpm (537.times.g) for 10 minutes at 20-23.degree. C. The
supernatant was removed and the protoplast pellet was resuspended
in 20 ml of 1 M sorbitol-10 mM Tris-HCl (pH 6.5)-10 mM CaCl.sub.2.
This step was repeated twice, and the final protoplast pellet was
resuspended in 1 M sorbitol-10 mM Tris-HCl (pH 6.5)-10 mM
CaCl.sub.2 to obtain a final protoplast concentration of
2.times.10.sup.7/ml.
[0222] Two micrograms of pDLHD0039 were added to the bottom of a
sterile 2 ml plastic centrifuge tube. Then 100 .mu.l of protoplasts
were added to the tube followed by 300 .mu.l of 60% PEG-4000 in 10
mM Tris-HCl (pH 6.5)-10 mM CaCl.sub.2. The tube was mixed gently by
hand and incubated at 37.degree. C. for 30 minutes. Two ml of 1 M
sorbitol-10 mM Tris-HCl (pH 6.5)-10 mM CaCl.sub.2 were added to
each transformation and the mixture was transferred onto 150 mm
Minimal medium agar plates. Transformation plates were incubated at
34.degree. C. until colonies appeared.
[0223] Thirty-five transformant colonies were picked to fresh
Minimal medium agar plates and cultivated at 34.degree. C. for four
days until the strains sporulated. Fresh spores were transferred to
48-well deep-well plates containing 2 ml of YP+2% maltodextrin,
covered with a breathable seal, and grown for 4 days at 28.degree.
C. with no shaking. After 4 days growth the culture medium was
assayed for xyloglucan endotransglycosylase activity and for
xyloglucan endotransglycosylase expression by SDS-PAGE.
[0224] Xyloglucan endotransglycosylase activity was measured using
the iodine stain assay described in Example 1. The assay
demonstrated the presence of xyloglucan endotransglycosylase
activity in several transformants.
[0225] SDS-PAGE was performed as described in Example 1. SDS-PAGE
analysis indicated that several transformants expressed a protein
of approximately 32 kDa corresponding to AtXET14.
Example 6: Generation of Fluorescein Isothiocyanate-Labeled
Xyloglucan
[0226] Fluorescein isothiocyanate-labeled xyloglucan oligomers
(FITC-XGOs) were generated by reductive amination of the reducing
ends of xyloglucan oligomers (XGOs) according to the procedure
described by Zhou et al., 2006, Biocatalysis and Biotransformation
24: 107-120), followed by conjugation of the amino groups of the
XGOs to fluorescein isothiocyanate isomer I (Sigma Aldrich, St.
Louis, Mo., USA) in 100 mM sodium bicarbonate pH 9.0 for 24 hours
at room temperature. Conjugation reaction products were
concentrated to dryness in vacuo, dissolved in 0.5 ml of deionized
water, and purified by silica gel chromatography, eluting with a
gradient from 100:0:0.04 to 70:30:1 acetonitrile:water:acetic acid
as mobile phase. Purity and product identity were confirmed by
evaporating the buffer, dissolving in D.sub.2O (Sigma Aldrich, St.
Louis, Mo., USA), and analysis by .sup.1H NMR using a Varian 400
MHz MercuryVx (Agilent, Santa Clara, Calif., USA). Dried FITC-XGOs
were stored at -20.degree. C. in the dark, and were desiccated
during thaw.
[0227] Twenty-four ml of 10 mg of tamarind seed xyloglucan
(Megazyme, Bray, UK) per ml of deionized water, 217 .mu.l of 7.9 mg
of FITC-XGOs per ml of deionized water, 1.2 ml of 400 mM sodium
citrate pH 5.5, and 600 .mu.l of 1.4 mg of VaXET16 per ml of 20 mM
sodium citrate pH 5.5 were mixed thoroughly and incubated overnight
at room temperature. Following overnight incubation, FITC-XG was
precipitated by addition of ice cold ethanol to a final volume of
110 ml, mixed thoroughly, and incubated at 4.degree. C. overnight.
The precipitated FITC-XG was washed with water and then transferred
to Erlenmeyer bulbs. Residual water and ethanol were removed by
evaporation using an EZ-2 Elite evaporator (SP Scientific/Genevac,
Stone Ridge, N.Y., USA) for 4 hours. Dried samples were dissolved
in water, and the volume was adjusted to 48 ml with deionized water
to generate a final FITC-XG concentration of 5 mg per ml with an
expected average molecular weight of 100 kDa.
Example 7: Fluorescence Polarization Assay for Xyloglucan
Endotransglycosylation Activity
[0228] Xyloglucan endotransglycosylation activity was assessed
using the following assay. Reactions of 200 .mu.l containing 1 mg
of tamarind seed xyloglucan per ml, 0.01 mg/ml FITC-XGOs prepared
as described in Example 6, and 10 .mu.l of appropriately diluted
XET were incubated for 10 minutes at 25.degree. C. in 20 mM sodium
citrate pH 5.5 in opaque 96-well microtiter plates. Fluorescence
polarization was monitored continuously over this time period,
using a SPECTRAMAX.RTM. M5 microplate reader (Molecular Devices,
Sunnyvale, Calif., USA) in top-read orientation with an excitation
wavelength of 490 nm, an emission wavelength of 520 nm, a 495
cutoff filter in the excitation path, high precision (100 reads),
and medium photomultiplier tube sensitivity. XET-dependent
incorporation of fluorescent XGOs into non-fluorescent xyloglucan
(XG) results in increasing fluorescence polarization over time. The
slope of the linear regions of the polarization time progress
curves was used to determine the activity.
Example 8: Purification of Vigna angularis Xyloglucan
Endotransglycosylase 16
[0229] One liter solutions of crude fermentation broth of Vigna
angularis were filtered using a 0.22 .mu.m STERICUP.RTM. filter
(Millipore, Bedford, Mass., USA) and the filtrates were stored at
4.degree. C. Cell debris was resuspended in 1 liter of 0.25%
TRITON.RTM. X-100 (4-(1,1,3,3-tetramethylbutyl)phenyl-polyethylene
glycol; Sigma Aldrich, St. Louis, Mo., USA)-20 mM sodium citrate pH
5.5, incubated at least 30 minutes at room temperature, and then
filtered using a 0.22 .mu.m STERICUP.RTM. filter. The filtrates
containing Vigna angularis xyloglucan endotransglycosylase 16
(VaXET16) were pooled and concentrated to a volume between 500 and
1500 ml using a VIVAFLOW.RTM. 200 tangential flow concentrator
(Millipore, Bedford, Mass., USA) equipped with a 10 kDa molecular
weight cutoff membrane.
[0230] The concentrated filtrates were loaded onto a 150 ml Q
SEPHAROSE.RTM. Big Beads column (GE Healthcare Lifesciences,
Piscataway, N.J., USA), pre-equilibrated with 20 mM sodium citrate
pH 5.5, and eluted isocratically with the same buffer. The eluent
was loaded onto a 75 ml Phenyl SEPHAROSE.RTM. HP column (GE
Healthcare Lifesciences, Piscataway, N.J., USA) pre-equilibrated in
20% ethylene glycol-20 mM sodium citrate pH 5.5. VaXET16 was eluted
using a linear gradient from 20% to 50% of 70% ethylene glycol in
20 mM sodium citrate pH 5.5 over 4 column volumes.
[0231] Purified VaXET16 was quantified using a BCA assay (Pierce,
Rockford, Ill., USA) in a 96-well plate format with bovine serum
albumin (Pierce, Rockford, Ill., USA) as a protein standard at
concentrations between 0 and 2 mg/ml and was determined to be 1.40
mg/ml. VaXET16 homogeneity was confirmed by the presence of a
single band at approximately 32 kDa using a 8-16% gradient
CRITERION.RTM. Stain Free SDS-PAGE gel, and imaging the gel with a
Stain Free Imager using the following settings: 5-minute
activation, automatic imaging exposure (intense bands), highlight
saturated pixels=ON, color=Coomassie, and band detection, molecular
weight analysis and reporting disabled.
[0232] The activity of the purified VaXET16 was determined by
measuring the rate of incorporation of fluorescein
isothiocyanate-labeled xyloglucan oligomers into tamarind seed
xyloglucan (Megazyme, Bray, UK) by fluorescence polarization (as
described in Example 7). The apparent activity was 18.5.+-.1.2 P
s.sup.-1mg.sup.-1.
[0233] The purified VaXET16 preparation was tested for background
enzyme activities including xylanase, amylase, cellulase,
beta-glucosidase, protease, amyloglucosidase, and lipase using
standard assays as shown below.
[0234] Xylanase activity was assayed using wheat arabinoxylan as
substrate at pH 6.0 and 50.degree. C. Xylan hydrolysis was assessed
colorimetrically at 405 nm by addition of alkaline solution
containing PHBAH. One FXU(S) is defined as the endoxylanase
activity using Shearzyme.RTM. (Novozymes A/S) as a standard.
[0235] Amylase activity was assayed using starch as substrate at pH
2.5 and 37.degree. C. Starch hydrolysis was assessed by measuring
the residual starch colorimetrically at 600 nm by addition of
iodine solution. One FAU(A) is defined as the acid alpha-amylase
activity using acid fungal alpha-amylase (available from Novozymes
A/S) as a standard.
[0236] Amylase activity was assayed using
(4,6-ethylidene(G7)-p-nitrophenyl(G1)-.alpha.,D-maltoheptaoside
(4,6-ethylidene-G7-pNP) as substrate at pH 7 and 37.degree. C.
Hydrolysis of the substrate produces p-nitrophenol, and was
assessed colorimetrically at 405 nm. One FAU(F) is defined as
fungal alpha-amylase units using Fungamyl.RTM. (Novozymes A/S) as a
standard.
[0237] Cellulase activity was assayed using carboxymethylcellulose
(CMC) as substrate at pH 5.0 and 50.degree. C. CMC hydrolysis was
assessed colorimetrically at 405 nm by addition of an alkaline
solution containing para-hydroxybenzoic add hydrazide (PHBAH). One
CNU(B) is defined as the cellulase activity using NS22084 enzyme
(Novozymes A/S) as a standard.
[0238] Beta-glucosidase activity was assayed using cellobiose as
substrate at pH 5.0 and 50.degree. C. Production of glucose from
cellobiose was assessed using a coupled enzyme assay with
hexokinase and glucose-6-phosphate dehydrogenase converting glucose
to 6-phosphoglucanate following reduction of NAD to NADH at 340 nm.
One CBU(B) is defined as the amount of enzyme which releases 2
pmole of glucose per minute using cellobiase as a standard.
[0239] The protease assay was performed using an EnzChek.RTM.
Protease Assay Kit (green fluorescence) (Life Technologies, Inc.,
Grand Island, N.Y., USA) with casein as substrate at pH 6 or 9 and
ambient temperature. One KMTU is defined as a kilo microbial
trypsin unit related to the amount of enzyme that produces 1 pmole
of p-nitroaniline per minute.
[0240] Amyloglucosidase activity was assayed using maltose as
substrate at pH 4.3 and 37.degree. C. Conversion of maltose to
glucose was assessed using a coupled enzyme assay with hexokinase
and glucose-6-phosphate dehydrogenase converting glucose to
6-phosphoglucanate following reduction of NAD to NADH at 340 nm.
One AGU is defined as amyloglucosidase units using AMG.RTM.
(Novozymes A/S) as a standard.
[0241] The 4-methylumbelliferyl beta-D-lactoside (MUL) assay was
performed at pH 7 and ambient temperature and measured
fluorometrically at 360 nm excitation and 465 nm emission.
[0242] Lipase activity was assayed using 4-nitropenyl butyrate
(pNP-butyrate) as substrate at pH 7.5 and ambient temperature.
pNP-butyrate hydrolysis was assessed colorimetrically following
p-nitrophenol release at 405 nm. One LU is defined as the amount of
enzyme which releases 1 .mu.mole of titratable butyric acid using
LIPOLASE.RTM. (Novozymes A/S) as a standard.
TABLE-US-00010 Additional Assay Activity Activity Assay Substrate
Dilution Units Units/ml Xylanase Wheat 4-fold FXU(S) ND FXU(S)
arabinoxylan Amylase FAU(A) Starch 4-fold FAU(A) ND Amylase FAU(F)
Ethylidene-G7- 4-fold FAU(F) ND pNp Cellulase CMC 4-fold CNU(B) ND
CNU(B) Beta-gluco- Cellobiose 4-fold CBU(B) ND sidase CBU(B)
Protease, pH 6 Casein none KMTU 740 (EnzCheck) Protease, pH 9
Casein none KMTU 332 (EnzCheck) Amylogluco- Maltose 4-fold AGU ND
sidase AGU MUL MUL none Unitless ND Lipase pNP-Butyrate none LU
0.02
Example 9: Purification of Arabidopsis thaliana Xyloglucan
Endotransglycosylase 14
[0243] The purification and quantification of the Arabidopsis
thaliana xyloglucan endotransglycosylase 14 (AtXET14) was performed
as described for VaXET16 in Example 8, except that elution from the
Phenyl SEPHAROSE.RTM. HP column was performed using a linear
gradient from 40% to 90% of 70% ethylene glycol in 20 mM sodium
citrate pH 5.5 over 4 column volumes.
[0244] AtXET14 homogeneity was confirmed by the presence of a
single band at approximately 32 kDa using a 8-16% CRITERION.RTM.
Stain Free SDS-PAGE gel, and imaging the gel with a Stain Free
Imager using the following settings: 5-minute activation, automatic
imaging exposure (intense bands), highlight saturated pixels=ON,
color=Coomassie, and band detection, molecular weight analysis and
reporting disabled.
[0245] Purified AtXET14 was quantified using a BCA assay in a
96-well plate format with bovine serum albumin as a protein
standard at concentrations between 0 and 2 mg/ml and was determined
to be 1.49 mg/ml.
[0246] The activity of the purified AtXET14 was determined as
described in Example 7. The apparent activity was 34.7.+-.0.9 P
s.sup.-1 mg.sup.-1.
[0247] The purified AtXET14 preparation was tested for background
activities including xylanase, amylase, cellulase,
beta-glucosidase, protease, amyloglucosidase, and lipase using
standard assays as shown below. The standard assays are described
in Example 8.
TABLE-US-00011 Additional Assay Activity Activity Assay Substrate
Dilution Units Units/ml Xylanase Wheat 4-fold FXU(S) ND FXU(S)
arabinoxylan Amylase FAU(A) Starch 4-fold FAU(A) ND Amylase FAU(F)
Ethylidene-G7- 4-fold FAU(F) ND pNp Cellulase CMC 4-fold CNU(B) ND
CNU(B) Beta-gluco- Cellobiose 4-fold CBU(B) ND sidase CBU(B)
Protease, pH 6 Casein none KMTU 82 (EnzCheck) Protease, pH 9 Casein
none KMTU 53 (EnzCheck) Amylogluco- Maltose 4-fold AGU ND sidase
AGU MUL MUL none Unitless ND Lipase pNP-Butyrate none LU 0.24
Example 10: Prevention of Fruit Dehydration by Xyloglucan and
Xyloglucan with Arabidopsis thaliana Xyloglucan
Endotransglycosylase 14
[0248] Carnation stems and banana stems (Chiquita organic) were cut
into thin sections and Granny Smith apples (Yakima Fresh) were cut
into small slices using a razor blade. A 0.5 cm length at the end
of each stem was discarded, and the remaining sections were either
dipped in a solution of 5 mg of tamarind seed xyloglucan (Megazyme,
Bray, UK) per ml of 20 mM sodium citrate pH 5.5 and the excess
xyloglucan removed by touching the stem to the side of the
container, or were not dipped. Several flower stems were used, and
sections from each stem were divided into both dipped and
not-dipped groups to control for stem to stem variation. Each
section was then incubated on its side, cut ends not touching the
bottom of the well, in either a CoStar 3513 12-well or CoStar 3524
24-well, flat bottomed, covered cell culture plate (Corning,
Tewksbury, Mass., USA). The samples were incubated at room
temperature for 5 days. Photographs were taken at 1, 2, and 5 days
to illustrate the extent of desiccation/oxidation.
[0249] FIG. 6 shows carnation stems dipped in xyloglucan in the
upper row, or not dipped in the lower row, following 1 day of
incubation at room temperature. The xyloglucan dipped carnation
stems appeared smooth and hydrated, whereas the carnation stems
that were not dipped appeared dessicated, with white, scaly, dry
patches. After 1 day of incubation, carnation stems that had been
dipped in xyloglucan appeared substantially more hydrated than
those that had not been dipped. By 2 days of incubation, both
dipped and not dipped stem slices appeared similarly dry, thus the
xyloglucan reduced the rate of carnation stem dehydration. No
qualitative differences between banana stems dipped and not dipped
were observed, though these were cut more thickly than the
carnations.
[0250] FIG. 7A shows apple slices dipped in xyloglucan in the upper
row, or not dipped in the lower row, after 2 days of incubation;
FIG. 7B shows the same slices after 5 days of incubation. A clear
reduction in the extent to which apple flesh was browned or
oxidized was observed in the slices dipped in xyloglucan after 2
days of incubation. By 5 days of incubation, the apple slices not
dipped showed indications of mold and substantial oxidation,
whereas xyloglucan dipped slices showed only modest oxidation. By
comparison, the extent of oxidation was similar between the dipped
apple slices at 5 days of incubation and the slices that were not
dipped at 2 days of incubation. These images indicate that
xyloglucan substantially slowed or prevented the oxidative damage
of cut fruit, and prevented the growth of microorganisms that
contribute to produce rot.
Example 11: Preservation of Apple Freshness by Xyloglucan and
Xyloglucan with Vigna angularis Xyloglucan Endotransglycosylase
16
[0251] To generate uniformly-sized apple slices without skins,
Granny Smith apples were pierced with a size 7 rubber stopper
boring tool. The apple inside was removed from the boring tool and
then sectioned into 1-2 mm thick discs with a razor blade. Six to
eight discs were then dipped into 5 ml of 40 mM sodium citrate pH
5.5 containing either 4.5 mg of xyloglucan per ml with 35 .mu.g of
VaXET16 per ml, 4.5 mg of xyloglucan per ml without VaXET16, or 5
ml of deionized water. The excess solution was removed from each
apple slice by touching the slice to the side of the container, and
the apple discs were transferred to CoStar #3513 12-well, flat
bottomed, covered cell culture plates using tweezers. The sample
plates were covered and incubated under ambient conditions. Images
of the slices were taken after 3, 4, and 7 days by inverting the
plates and photographing the slices through the bottom of the
plate.
[0252] FIG. 8A shows the apple slices after 3 days of
incubation.
[0253] FIG. 8B shows the apple slices after 4 days of
incubation.
[0254] FIG. 8C shows the apple slices after 7 days of
incubation.
[0255] By 3-4 days of incubation under ambient conditions after the
apple slices were prepared, substantial differences were apparent.
Apple slices, initially white, had browned and oxidized surfaces in
all cases and dark brown spots were evident on all slices to
various degrees. The apple slices dipped in a solution of
xyloglucan and VaXET16 showed the smallest extent of oxidation or
browning of the apple flesh, whereas the sodium citrate buffer
dipped and not dipped apple slices were most oxidized. The apples
not dipped appeared smaller in diameter than the other samples,
indicating that they were more dehydrated than the dipped
samples.
[0256] By 7 days of incubation, all slices appeared smaller in
diameter indicating they had dried out. The dark brown spots
covered most of the surface area of the xyloglucan dipped apple
slices, the buffer dipped slices appeared to be moldy, and the
slices that were not dipped appeared less oxidized than at previous
time points but highly desiccated. The xyloglucan and VaXET16
dipped apple slices, by comparison, were oxidized, but less so than
the xyloglucan or buffer dipped samples.
[0257] These images indicate that over 3 to 4 days, xyloglucan or
particularly xyloglucan and VaXET16 reduced the rate of apple
oxidation. Over longer time periods, xyloglucan or xyloglucan and
VaXET16 delayed spoilage of cut produce.
Example 12: Quantitative Analysis of Apple Slice Images to
Determine the Extent to which Xyloglucan and Vigna angularis
Xyloglucan Endotransglycosylase 16 Prevent Apple Oxidation
[0258] Photographs of the apple slices shown in FIGS. 9A, 9B, and
9C were quantitatively analyzed using MATLAB.RTM. (The Mathworks,
Natick, Mass., USA) to differentiate between the extent of
oxidation in the apple slices dipped in xyloglucan, xyloglucan with
VaXET16, 40 mM sodium citrate pH 5.5, or not dipped. Browning or
oxidation of the apple samples was apparent as both a
time-dependent browning of the white apple slice overall, and as an
increase in the number or size of much darker brown spots.
Additionally, in several of the images, particularly day 7 for
sodium citrate dipped apples, additional blackening was observed.
The extent of browning and its prevention by xyloglucan and VaXET16
were quantified according to the following protocol. Individual
color channels of the image files were examined, and the blue
channel was determined to have the greatest differences in
intensity between both the dark brown spots and the lighter regions
of the slices and the samples from the plates. Subsequent analysis
was performed using the blue channel only. Photographs were reduced
to blue channel intensity values and were inverted by subtraction
of the maximum pixel intensity over the image. Regions of interest
containing each apple sample were selected, and a threshold filter
was applied to remove non-sample pixels from the region of
interest. Threshold filters were held constant across all samples
in a single plate image, but were varied between images. For each
filtered region of interest, histograms of the
threshold-subtracted, non-zero pixel intensities were generated and
maximum likelihood estimations of best-fit parameters to single and
double normal distributions were determined. All non-zero pixel
intensities for the 8 apple slices treated in the same way were
combined, to generate a global intensity histogram for each
treatment. These histograms were similarly fit by maximum
likelihood estimation to single and double normal distributions.
The extent of browning was then determined in 2 ways. First, as the
samples show a tendency to darken or yellow overall, the mean of
the single normal distribution was used to determine the average
darkness in color of all the sample pixels above the threshold.
Second, to quantify the extent to which dark spots cover the
surface of the apple slices, the relative areas of dark spots to
total surface areas were determined. The probability distribution
was integrated over all intensities >1.times..sigma. above the
mean of the distribution to determine the relative surface area of
the darkest spots.
[0259] FIG. 9A shows the pixel intensity histogram of the apple
slices not dipped after 4 days of incubation. The histogram is fit
to a double normal distribution.
[0260] FIG. 9B shows the pixel intensity histogram of the apple
slices dipped in 40 mM sodium citrate pH 5.5 after 4 days of
incubation. The histogram is fit to a double normal
distribution.
[0261] FIG. 9C shows the pixel intensity histogram of the apple
slices dipped in xyloglucan after 4 days of incubation. The
histogram is fit to a double normal distribution.
[0262] FIG. 9D shows the pixel intensity histogram of the apple
slices dipped in xyloglucan and VaXET16 after 4 days of incubation.
The histogram is fit to a double normal distribution.
[0263] Comparing the histograms in FIG. 9, the samples treated with
xyloglucan and VaXET16 had a distribution of intensities that
peaked at the lowest intensity, hence were the least yellowed. It
was also evident that a substantial fraction of pixels had
intensities greater than 100 units in all samples except for those
dipped in xyloglucan and VaXET16; for the xyloglucan-dipped and
not-dipped apples these appeared as an additional overlapped
distribution. By 7 days, this additional distribution was more
evident, and was attributed to the onset of very dark spots, which
were most apparent in the buffer and xyloglucan-dipped samples
(FIG. 9C). This distribution was not present in the xyloglucan and
VaXET16-dipped apples, consistent with the lack of dark brown spots
on these apple slices.
[0264] FIG. 9E shows a plot of the mean of the single Gaussian
distribution as a function of time for the variously treated apple
slices. Apple slices not dipped are shown as circles, apple slices
dipped in 40 mM sodium citrate pH 5.5 are shown as squares, apple
slices dipped in xyloglucan are shown as diamonds, and apple slices
dipped in xyloglucan and VaXET16 are shown as triangles. With the
exception of the slices not dipped, the means increased over time,
indicating that the slices became darker in color with time. At the
3 day time point, the means of the sodium citrate dipped and not
dipped slices were much higher than were the xyloglucan and
xyloglucan with VaXET16 dipped slices. The mean intensities were
68.91.+-.0.0666 for not dipped slices, 69.48.+-.0.0526 for buffer
dipped slices, 47.57.+-.0.0436 for the xyloglucan dipped slices,
and 50.10.+-.0.0451 for xyloglucan and VaXET16 dipped slices. Thus
dipping in either xyloglucan or xyloglucan and VaXET16 reduced the
extent of browning by 45% and 38%, respectively.
[0265] From the fits of the double normal distributions, apple
slices treated in all manners had an intensity distribution mean
between 50-65 units and a standard deviation of 20-25. Thus pixel
intensities >90 were considered to be outliers or to belong to
the high-intensity distribution; they were attributed to the dark
brown spots. The total number of pixels exceeding this intensity
relative to the total number of pixels exceeding the threshold
filter gave the relative proportion of surface area covered by dark
brown oxidation spots. This was determined by integration of the
intensity distribution over those values of intensity, relative to
the integral over all intensities and the values are provided in
Table 1.
[0266] From the quantification of the dark brown spots, it is clear
that xyloglucan and particularly xyloglucan with VaXET16 prevented
the formation of dark brown oxidation spots. The relative surface
area covered with these spots was approximately 14-fold lower at 3
days, 17-fold lower at 4 days, and 7-fold lower at 7 days between
the xyloglucan+VaXET16 dipped apple slices and the average of the
buffer-dipped and not-dipped apple slices.
TABLE-US-00012 TABLE 1 Relative surface areas of dark brown
oxidation spots Day 3 Day 4 Day 7 (%) (%) (%) Not dipped 12.63
20.29 1.51 Citrate dipped 14.17 17.36 28.61 XG dipped 6.42 2.92
15.66 XG + XET dipped 1.77 2.03 1.87
Example 13: Preservation of Potato and Avocado Slices by Xyloglucan
and Xyloglucan with Arabidopsis thaliana Xyloglucan
Endotransglycosylase 14
[0267] Preservation of various fruits and vegetables was assessed
as described in Example 11 with the following exceptions.
Arabidopsis thaliana endotransglycosylase 14 (AtXET14) was purified
as described in Example 9. Eight replicate samples were dipped into
either 20 mM sodium citrate pH 5.5, 1 mg of tamarind seed
xyloglucan per ml in 20 mM sodium citrate pH 5.5, or 1 mg of
tamarind seed xyloglucan per ml with 1 .mu.M AtXET14 in 20 mM
sodium citrate pH 5.5. A size 7 rubber stopper boring tool was used
to generate uniformly sized cylinders of the fruit or vegetable
examined; potatoes were pierced through the entire thickness of the
potato, avocados had their pits removed and were pierced from the
pit hole to the skin. Cylinders were removed from the boring tool
and potatoes were sectioned into approximately 1 mm thick discs,
excluding the outer 1 cm of each cylinder. Avocado slices from
equivalent depths within the fruit were generated in the following
manner. Three cylinders of equivalent length were positioned
together aligned by distance from the pit, and sectioned
concurrently into 2 mm thick discs. The resulting 3 slices from
each depth were dipped differently and compared with each other to
account for potential differences in oxidation, browning, or
desiccation that may arise from differences in the fruit. At 0,
2.5, 5, 21 and 70 hours of incubation under ambient conditions,
culture plates were photographed to document the degree to which
the avocado and potato slices had oxidized.
[0268] FIG. 10A shows variously treated potato slices after 0, 2.5,
5 and 21 hours of incubation. From the photographs, it is evident
that at the beginning of the incubation (time=0 hour), all slices
are white. Within the first few hours, potato slices begin to turn
brown or oxidize and become increasingly darker in color with time.
The slices that were dipped in xyloglucan and AtXET14 show the
latest onset of browning, and the smallest extent of browning at
the longer incubation times.
[0269] FIG. 10B shows variously treated avocado slices after 0 and
70 hours of incubation. The avocado fruit transitions in color from
green through yellow at increasing depths from the skin to the pit.
Consequently, slices are compared at equivalent depths and hence
equivalent initial colors as is evident in the images taken at the
beginning of the incubation (time=0). After 70 hours of incubation,
the avocado slices have all browned and darkened; those dipped in
xyloglucan and particularly xyloglucan with AtXET14 are less
browned.
Example 14: Fluorescein Isothiocyanate-Labeled Xyloglucan Confirms
Association of Xyloglucan with Cut Fruit and Vegetables
[0270] To confirm that xyloglucan was associating with cut fruit,
20 .mu.l of FITC-XG or 40 mM sodium citrate pH 5.5 were applied to
carnation stem, banana stem, squash stem, or apple slices, prepared
as described in Example 6. Samples were incubated at room
temperature for 30 minutes and imaged using a hand-held UV lamp. By
visual inspection, fluorescence could only be delineated for the
squash stem that had FITC-XG applied. The other samples were too
reflective, too autofluorescent, or had insufficiently concentrated
fluorescent xyloglucan to differentiate FITC-XG fluorescence from
background.
[0271] Samples were each covered with 500 .mu.l of 40 mM sodium
citrate pH 5.5 and 10 .mu.l of 1.5 mg of AtXET14 per ml of 40 mM
sodium citrate pH 5.5 were added to each, generating 30 .mu.g per
ml final AtXET14 concentration. Samples were incubated overnight at
room temperature with shaking. Following overnight incubation,
samples were washed 3 times in 2 ml of 150 mM sodium chloride in 20
mM phosphate pH 7.2, over a period of 8 hours. Samples were then
incubated overnight in a minimum volume of 150 mM sodium chloride
in 20 mM phosphate pH 7.0.
[0272] Thin sections of each sample were cut using a razor blade
and laid onto a FisherFinest Premium 3''.times.1''.times.1 mm
microscope slide (Fisher Scientific, Inc., Pittsburgh, Pa., USA).
Approximately 20 .mu.l of deionized water were applied to the slide
around the sample and the sample was covered with a Fisherbrand
22.times.22-1.5 microscope coverslip (Fisher Scientific, Inc.,
Pittsburgh, Pa., USA) before sealing the coverslip to the slide
using nail polish.
[0273] Laser scanning confocal microscopy was performed using an
Olympus FV1000 laser scanning confocal microscope (Olympus, Center
Valley, Pa., USA). Data were acquired utilizing the 488 nm line of
an argon ion laser excitation source with either a 10.times. air
gap or a 40.times. oil immersion objective lens. All images were
obtained using the same excitation intensity and PMT voltage; hence
relative fluorescence intensities were comparable between
images.
[0274] FIG. 11 shows a series of laser scanning confocal microscope
images that compare a fruit, flower, or vegetable incubated with
AtXET14 in 150 mM sodium chloride in 20 mM phosphate pH 7.2 to
incubation with AtXET14 and FITC-XG in 150 mM sodium chloride in 20
mM phosphate pH 7.2. In each case, FITC-XG and AtXET14 incubated
samples showed much higher fluorescence intensity than did the
samples incubated with only AtXET14, indicating substantial FITC-XG
binding.
[0275] FIG. 11A shows a confocal image of a section of an apple
slice incubated with AtXET14.
[0276] FIG. 11B shows a confocal image of a section of an apple
slice incubated with AtXET14 with FITC-XG.
[0277] FIG. 11C shows a confocal image of a section of a carnation
stem incubated with AtXET14.
[0278] FIG. 11D shows a confocal image of a section of a carnation
stem incubated with AtXET14 with FITC-XG.
[0279] FIG. 11E shows a confocal image of a section of a banana
stem incubated with AtXET14.
[0280] FIG. 11F shows a confocal image of a section of a banana
stem incubated with AtXET14 with FITC-XG.
[0281] FIG. 11G shows a confocal image of a section of a squash
stem incubated with AtXET14.
[0282] FIG. 11H shows a confocal image of a section of a squash
stem incubated with AtXET14 and FITC-XG.
[0283] In each case the confocal microscopy image indicates that
the fluorescein isothiocyanate-labeled xyloglucan associated with
the cut fruit, flower or vegetable in the presence of AtXET14.
[0284] The present invention is further described by the following
numbered paragraphs:
[0285] [1] A method for modifying an agricultural crop comprising
treating the agricultural crop with a composition selected from the
group consisting of (a) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan, and a functionalized
xyloglucan oligomer comprising a chemical group; (b) a composition
comprising a xyloglucan endotransglycosylase, a polymeric
xyloglucan functionalized with a chemical group, and a
functionalized xyloglucan oligomer comprising a chemical group; (c)
a composition comprising a xyloglucan endotransglycosylase, a
polymeric xyloglucan functionalized with a chemical group, and a
xyloglucan oligomer; (d) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan, and a xyloglucan
oligomer; (e) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan functionalized with
a chemical group; (f) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan; (g) a composition
comprising a xyloglucan endotransglycosylase and a functionalized
xyloglucan oligomer comprising a chemical group; (h) a composition
comprising a xyloglucan endotransglycosylase and a xyloglucan
oligomer, and (i) a composition of (a), (b), (c), (d), (e), (f),
(g), or (h) without a xyloglucan endotransglycosylase, in a medium
under conditions leading to a modified agricultural crop possessing
an improved property compared to the unmodified agricultural
crop.
[0286] [2] The method of paragraph 1, wherein the agricultural crop
is harvested.
[0287] [3] The method of paragraph 1, wherein the agricultural crop
is not harvested.
[0288] [4] The method of any of paragraphs 1-3, wherein the
agricultural crop is a fruit.
[0289] [5] The method of any of paragraphs 1-3, wherein the
agricultural crop is a vegetable.
[0290] [6] The method of any of paragraphs 1-3, wherein the
agricultural crop is a flower.
[0291] [7] The method of any of paragraphs 1-3, wherein the
agricultural crop is a spice.
[0292] [8] The method of any of paragraphs 1-7, wherein the
improved property is one or more improvements selected from the
group consisting of reducing or preventing oxidative browning,
dehydration, desiccation, bacterial, fungal, microbial, animal, or
insect pest infestation, senescence, early ripening, and softening;
prevention of bruising, resistance to crushing, prevention or
enhancement of clustering, aggregation, or association; resistance
to adverse environmental factors; appearance, and taste, and
resistance to sun or UV damage.
[0293] [9] The method of any of paragraphs 1-8, wherein the average
molecular weight of the polymeric xyloglucan or the polymeric
xyloglucan functionalized with a chemical group ranges from 2 kDa
to about 500 kDa.
[0294] [10] The method of any of paragraphs 1-9, wherein the
average molecular weight of the xyloglucan oligomer or the
functionalized xyloglucan oligomer comprising a chemical group
ranges from 0.5 kDa to about 500 kDa
[0295] [11] The method of any of paragraphs 1-10, wherein the
xyloglucan endotransglycosylase is present at a concentration of
about 0.1 nM to about 1 mM.
[0296] [12] The method of any of paragraphs 1-11, wherein the
polymeric xyloglucan or the polymeric xyloglucan functionalized
with a chemical group is present at about 1 ng per g of the
agricultural crop to about 1 g per g of the agricultural crop.
[0297] [13] The method of any of paragraphs 1-12, wherein the
xyloglucan oligomer or the functionalized xyloglucan oligomer is
present with the polymeric xyloglucan at about 50:1 molar ratio to
about 0.5:1 xyloglucan oligomer or functionalized xyloglucan
oligomer to polymeric xyloglucan.
[0298] [14] The method of any of paragraphs 1-13, wherein the
concentration of polymeric xyloglucan, the polymeric xyloglucan
functionalized with a chemical group, the xyloglucan oligomer, or
the functionalized xyloglucan oligomer comprising a chemical group
incorporated into the material is about 0.01 g to about 500 mg per
g of the agricultural crop.
[0299] [15] The method of any of paragraphs 1-14, wherein the
xyloglucan oligomer or the functionalized xyloglucan oligomer is
present without polymeric xyloglucan or polymeric xyloglucan
functionalized with a chemical group at about 1 ng per g of the
material to about 1 g per g of the agricultural crop.
[0300] [16] The method of any of paragraphs 1-15, wherein the
chemical group is a compound of interest or a reactive group such
as an aldehyde group, an amino group, an aromatic group, a carboxyl
group, a halogen group, a hydroxyl group, a ketone group, a nitrile
group, a nitro group, a sulfhydryl group, or a sulfonate group.
[0301] [17] The method of any of paragraphs 1-16, wherein the
xyloglucan endotransglycosylase is obtainable from a plant.
[0302] [18] The method of paragraph 17, wherein the plant is
selected from the group consisting of a dicotyledon and a
monocotyledon.
[0303] [19] The method of paragraph 18, wherein the dicotyledon is
selected from the group consisting of azuki beans, cauliflowers,
cotton, poplar or hybrid aspen, potatoes, rapes, soy beans,
sunflowers, thalecress, tobacco, and tomatoes.
[0304] [20] The method of paragraph 18, wherein the monocotyledon
is selected from the group consisting of wheat, rice, corn and
sugar cane.
[0305] [21] The method of any of paragraphs 1-20, wherein the
xyloglucan endotransglycosylase is produced by aerobic cultivation
of a transformed host organism containing the appropriate genetic
information from a plant.
[0306] [22] A modified agricultural crop obtained by the method of
any of paragraphs 1-21.
[0307] [23] A modified agricultural crop comprising comprising (a)
a polymeric xyloglucan, and a functionalized xyloglucan oligomer
comprising a chemical group; (b) a polymeric xyloglucan
functionalized with a chemical group and a functionalized
xyloglucan oligomer comprising a chemical group; (c) a polymeric
xyloglucan functionalized with a chemical group, and a xyloglucan
oligomer; (d) a polymeric xyloglucan, and a xyloglucan oligomer;
(e) a polymeric xyloglucan functionalized with a chemical group;
(f) a polymeric xyloglucan; (g) a functionalized xyloglucan
oligomer comprising a chemical group; or (h) a xyloglucan oligomer,
wherein the modified agricultural crop possesses an improved
property compared to the unmodified agricultural crop.
[0308] [24] A composition selected from the group consisting of (a)
a composition comprising a xyloglucan endotransglycosylase, a
polymeric xyloglucan, and a functionalized xyloglucan oligomer
comprising a chemical group; (b) a composition comprising a
xyloglucan endotransglycosylase, a polymeric xyloglucan
functionalized with a chemical group, and a functionalized
xyloglucan oligomer comprising a chemical group; (c) a composition
comprising a xyloglucan endotransglycosylase, a polymeric
xyloglucan functionalized with a chemical group, and a xyloglucan
oligomer; (d) a composition comprising a xyloglucan
endotransglycosylase, a polymeric xyloglucan, and a xyloglucan
oligomer; (e) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan functionalized with
a chemical group; (f) a composition comprising a xyloglucan
endotransglycosylase and a polymeric xyloglucan; (g) a composition
comprising a xyloglucan endotransglycosylase and a functionalized
xyloglucan oligomer comprising a chemical group; (h) a composition
comprising a xyloglucan endotransglycosylase and a xyloglucan
oligomer, and (i) a composition of (a), (b), (c), (d), (e), (f),
(g), or (h) without a xyloglucan endotransglycosylase.
[0309] The inventions described and claimed herein are not to be
limited in scope by the specific aspects herein disclosed, since
these aspects are intended as illustrations of several aspects of
the invention. Any equivalent aspects are intended to be within the
scope of the inventions. Indeed, various modifications of the
inventions in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description. Such modifications are also intended to fall within
the scope of the appended claims. In the case of conflict, the
present disclosure including definitions will control.
Sequence CWU 1
1
221879DNAVigna angularis 1atgggttctt ctttgtggac ttgtctgatt
ctgttatcac tggcttctgc ttctttcgct 60gccaacccaa gaactccaat tgatgtacca
tttggcagaa actatgtgcc tacttgggcc 120tttgatcata tcaaatatct
caatggaggt tctgagattc agcttcatct cgataagtac 180actggtactg
gattccagtc caaagggtca tacttgtttg gtcacttcag catgtacata
240aaattggttc ctggtgattc agctggcaca gtcactgctt tctatttatc
gtccacaaac 300gcagaacatg atgaaataga cttcgagttc ttgggaaaca
gaactgggca accatacatt 360ttacaaacaa atgtgttcac cggaggcaaa
ggtgacagag agcagagaat ctacctctgg 420tttgacccta cgactcaata
ccacagatat tcagtgctat ggaacatgta ccagattgta 480ttctatgtgg
atgactaccc aataagggtg ttcaagaaca gcaatgactt gggagtgaag
540ttccccttca atcaaccaat gaaaatatac aacagtttgt ggaatgcaga
tgactgggct 600acaaggggtg gtttggagaa aacagattgg tccaaagccc
ccttcatagc ctcttacaag 660ggcttccaca ttgatgggtg tgaggcctca
gtgaatgcca agttctgtga cacacaaggc 720aagaggtggt gggatcaacc
agagtttcgt gaccttgatg ctgctcagtg gcaaaaactg 780gcttgggtac
gcaacaaata caccatctac aactactgca ctgatcgcaa acgctactct
840caagtccctc cagagtgcac cagagaccgt gacatttaa 8792876DNAVigna
angularis 2atgggctcgt ccctctggac ttgtttgatc ctcctctcct tggcatcggc
atccttcgca 60gcgaaccctc gaactccgat cgatgtgcct ttcggacgga actacgtgcc
gacatgggca 120ttcgaccaca ttaagtattt gaacggaggc tcggagatcc
agttgcatct cgacaagtac 180accggcactg gtttccagtc gaagggctcc
tacttgttcg gacatttctc catgtacatc 240aaattggtgc ctggtgactc
ggcaggaact gtcaccgcat tctacctctc gtcgacaaac 300gcagagcatg
acgaaatcga cttcgagttc ctcggcaaca ggacaggaca gccgtacatc
360ctccagacca acgtcttcac aggaggcaaa ggtgatcggg aacagcggat
ctacttgtgg 420ttcgatccca caacccagta ccataggtac tcggtgctct
ggaacatgta tcagatcgtc 480ttctacgtcg acgattatcc gatccgagtg
ttcaagaact ccaacgactt gggcgtcaaa 540ttccccttca accagcccat
gaagatttac aactcgttgt ggaacgccga cgattgggca 600accaggggtg
gtctcgagaa gacagattgg tcgaaagcac ctttcatcgc gtcgtacaag
660ggtttccaca tcgacggatg tgaagcctcc gtgaacgcca agttctgtga
cacccagggc 720aaacgatggt gggatcagcc ggaattccgg gatttggatg
cagcccagtg gcagaagctc 780gcgtgggtca ggaacaagta caccatctat
aactactgta ccgatcggaa acgatattcg 840caggtgcctc ccgagtgtac
acgcgatagg gacatc 8763292PRTVigna angularis 3Met Gly Ser Ser Leu
Trp Thr Cys Leu Ile Leu Leu Ser Leu Ala Ser 1 5 10 15 Ala Ser Phe
Ala Ala Asn Pro Arg Thr Pro Ile Asp Val Pro Phe Gly 20 25 30 Arg
Asn Tyr Val Pro Thr Trp Ala Phe Asp His Ile Lys Tyr Leu Asn 35 40
45 Gly Gly Ser Glu Ile Gln Leu His Leu Asp Lys Tyr Thr Gly Thr Gly
50 55 60 Phe Gln Ser Lys Gly Ser Tyr Leu Phe Gly His Phe Ser Met
Tyr Ile 65 70 75 80 Lys Leu Val Pro Gly Asp Ser Ala Gly Thr Val Thr
Ala Phe Tyr Leu 85 90 95 Ser Ser Thr Asn Ala Glu His Asp Glu Ile
Asp Phe Glu Phe Leu Gly 100 105 110 Asn Arg Thr Gly Gln Pro Tyr Ile
Leu Gln Thr Asn Val Phe Thr Gly 115 120 125 Gly Lys Gly Asp Arg Glu
Gln Arg Ile Tyr Leu Trp Phe Asp Pro Thr 130 135 140 Thr Gln Tyr His
Arg Tyr Ser Val Leu Trp Asn Met Tyr Gln Ile Val 145 150 155 160 Phe
Tyr Val Asp Asp Tyr Pro Ile Arg Val Phe Lys Asn Ser Asn Asp 165 170
175 Leu Gly Val Lys Phe Pro Phe Asn Gln Pro Met Lys Ile Tyr Asn Ser
180 185 190 Leu Trp Asn Ala Asp Asp Trp Ala Thr Arg Gly Gly Leu Glu
Lys Thr 195 200 205 Asp Trp Ser Lys Ala Pro Phe Ile Ala Ser Tyr Lys
Gly Phe His Ile 210 215 220 Asp Gly Cys Glu Ala Ser Val Asn Ala Lys
Phe Cys Asp Thr Gln Gly 225 230 235 240 Lys Arg Trp Trp Asp Gln Pro
Glu Phe Arg Asp Leu Asp Ala Ala Gln 245 250 255 Trp Gln Lys Leu Ala
Trp Val Arg Asn Lys Tyr Thr Ile Tyr Asn Tyr 260 265 270 Cys Thr Asp
Arg Lys Arg Tyr Ser Gln Val Pro Pro Glu Cys Thr Arg 275 280 285 Asp
Arg Asp Ile 290 4864DNAArabidopsis thaliana 4atggcgtgtt tcgcaaccaa
acagcctctg ttgttgtctc tcctccttgc cattggcttc 60tttgtggtgg ctgcatctgc
cggaaacttc tatgagagct ttgatatcac ttggggtaat 120ggtcgtgcca
acatattcga gaatggacag cttctcactt gtactcttga caaggtctcc
180ggctcaggtt ttcaatccaa gaaggagtac ttgtttggta agatcgacat
gaagctcaag 240cttgtcgctg gaaactctgc tggcaccgtc accgcctact
acctatcgtc aaaaggcacg 300gcatgggatg agattgactt cgagtttttg
ggaaatcgca caggacatcc ttacactatc 360cacaccaatg tgttcaccgg
aggtaaaggc gaccgtgaga tgcagttccg tctctggttc 420gatcccactg
cggatttcca cacctacacc gtccactgga accctgttaa catcatcttc
480cttgtggatg ggatcccaat tcgggtgttc aagaacaacg agaaaaatgg
ggtggcttac 540cctaagaacc agccgatgag gatatactca agcctttggg
aagccgatga ctgggctaca 600gaaggcggtc gcgtgaagat cgactggagc
aacgcaccat tcaaggcctc ttacagaaac 660ttcaacgacc aaagctcatg
cagcaggaca tcaagctcaa aatgggtgac ttgcgagcca 720aacagcaact
cgtggatgtg gacgactctc aatcctgccc agtacggaaa aatgatgtgg
780gtgcaacgag acttcatgat ctacaactat tgtaccgatt ttaagagatt
ccctcaaggc 840ctccccaagg agtgtaaact ttga 8645861DNAArabidopsis
thaliana 5atggcctgtt tcgcaaccaa acagccgttg ttgctctcct tgttgctcgc
catcggtttc 60ttcgtggtgg cagcctccgc aggaaacttc tatgagtcct tcgacatcac
ctggggcaac 120ggaagggcga acattttcga aaacggtcag ctcctcactt
gtacgctcga caaggtgtcc 180ggctccggtt tccagtcgaa gaaggagtac
ttgttcggca agatcgacat gaagctcaag 240ttggtggcag gtaactcggc
aggtaccgtc acagcgtact atttgtcgtc caagggaact 300gcgtgggacg
aaatcgactt cgagttcctc ggcaaccgta caggacaccc ctacactatt
360cacaccaacg tcttcaccgg aggcaagggt gatcgggaga tgcagttcag
gctctggttc 420gacccgacag cggatttcca tacttacacg gtgcattgga
accccgtcaa catcattttc 480ctcgtcgacg gaatccccat ccgagtcttc
aagaacaacg agaagaacgg tgtggcgtat 540cccaaaaacc agccgatgcg
catctactcc tcgttgtggg aagcggacga ctgggccaca 600gaaggcggac
gcgtcaagat cgactggtcg aacgcaccgt tcaaggcgtc gtaccggaac
660ttcaacgacc agtcgtcctg ttcgaggact tcgtcgtcca agtgggtcac
ctgtgaaccc 720aactcgaact cgtggatgtg gactactctc aaccctgccc
agtacggcaa gatgatgtgg 780gtgcagaggg acttcatgat ctacaactat
tgtaccgatt tcaaacgatt ccctcagggt 840ctccccaagg aatgtaaact c
8616287PRTArabidopsis thaliana 6Met Ala Cys Phe Ala Thr Lys Gln Pro
Leu Leu Leu Ser Leu Leu Leu 1 5 10 15 Ala Ile Gly Phe Phe Val Val
Ala Ala Ser Ala Gly Asn Phe Tyr Glu 20 25 30 Ser Phe Asp Ile Thr
Trp Gly Asn Gly Arg Ala Asn Ile Phe Glu Asn 35 40 45 Gly Gln Leu
Leu Thr Cys Thr Leu Asp Lys Val Ser Gly Ser Gly Phe 50 55 60 Gln
Ser Lys Lys Glu Tyr Leu Phe Gly Lys Ile Asp Met Lys Leu Lys 65 70
75 80 Leu Val Ala Gly Asn Ser Ala Gly Thr Val Thr Ala Tyr Tyr Leu
Ser 85 90 95 Ser Lys Gly Thr Ala Trp Asp Glu Ile Asp Phe Glu Phe
Leu Gly Asn 100 105 110 Arg Thr Gly His Pro Tyr Thr Ile His Thr Asn
Val Phe Thr Gly Gly 115 120 125 Lys Gly Asp Arg Glu Met Gln Phe Arg
Leu Trp Phe Asp Pro Thr Ala 130 135 140 Asp Phe His Thr Tyr Thr Val
His Trp Asn Pro Val Asn Ile Ile Phe 145 150 155 160 Leu Val Asp Gly
Ile Pro Ile Arg Val Phe Lys Asn Asn Glu Lys Asn 165 170 175 Gly Val
Ala Tyr Pro Lys Asn Gln Pro Met Arg Ile Tyr Ser Ser Leu 180 185 190
Trp Glu Ala Asp Asp Trp Ala Thr Glu Gly Gly Arg Val Lys Ile Asp 195
200 205 Trp Ser Asn Ala Pro Phe Lys Ala Ser Tyr Arg Asn Phe Asn Asp
Gln 210 215 220 Ser Ser Cys Ser Arg Thr Ser Ser Ser Lys Trp Val Thr
Cys Glu Pro 225 230 235 240 Asn Ser Asn Ser Trp Met Trp Thr Thr Leu
Asn Pro Ala Gln Tyr Gly 245 250 255 Lys Met Met Trp Val Gln Arg Asp
Phe Met Ile Tyr Asn Tyr Cys Thr 260 265 270 Asp Phe Lys Arg Phe Pro
Gln Gly Leu Pro Lys Glu Cys Lys Leu 275 280 285 750DNAArtificial
SequenceARTIFICIAL DNA PRIMER 7ttcctcaatc ctctatatac acaactggcc
atgggctcgt ccctctggac 50848DNAArtificial SequenceARTIFICIAL DNA
PRIMER 8tgtcagtcac ctctagttaa ttagatgtcc ctatcgcgtg tacactcg
48929DNAArtificial SequenceArtificial DNA Primer 9taattaacta
gaggtgactg acacctggc 291031DNAArtificial SequenceArtificial DNA
Primer 10catggccagt tgtgtatata gaggattgag g 311136DNAArtificial
SequenceArtificial DNA Primer 11acatgtcttt gataagctag cgggccgcat
catgta 361236DNAArtificial SequenceArtificial DNA Primer
12tacatgatgc ggcccgctag cttatcaaag acatgt 361341DNAArtificial
SequenceArtificial DNA Primer 13ttaatcgcct tgcagcacac cgcttcctcg
ctcactgact c 411447DNAArtificial SequenceArtificial DNA Primer
14acaataaccc tgataaatgc ggaacaacac tcaaccctat ctcggtc
471553DNAArtificial SequenceArtificial DNA Primer 15agatagggtt
gagtgttgtt ccgcatttat cagggttatt gtctcatgag cgg 531642DNAArtificial
SequenceArtificial DNA Primer 16ttctacacga aggaaagagg aggagagagt
tgaacctgga cg 421747DNAArtificial SequenceArtificial DNA Primer
17aggttcaact ctctcctcct ctttccttcg tgtagaagac cagacag
471843DNAArtificial SequenceArtificial DNA Primer 18tcagtgagcg
aggaagcggt gtgctgcaag gcgattaagt tgg 431954DNAArtificial
SequenceArtificial DNA Primer 19ttcctcaatc ctctatatac acaactggcc
atggcctgtt tcgcaaccaa acag 542047DNAArtificial SequenceArtificial
DNA Primer 20agctcgctag agtcgaccta gagtttacat tccttgggga gaccctg
472127DNAArtificial SequenceArtificial DNA Primer 21taggtcgact
ctagcgagct cgagatc 272240DNAArtificial SequenceArtificial DNA
Primer 22catggccagt tgtgtatata gaggattgag gaaggaagag 40
* * * * *