Stabilized Reverse Transcriptase Fusion Proteins

Lambowitz; Alan M. ;   et al.

Patent Application Summary

U.S. patent application number 16/051544 was filed with the patent office on 2018-11-29 for stabilized reverse transcriptase fusion proteins. The applicant listed for this patent is Board of Regents, The University of Texas System. Invention is credited to Eman Ghanem, Alan M. Lambowitz, Georg Mohr, Sabine Mohr.

Application Number20180340158 16/051544
Document ID /
Family ID42710216
Filed Date2018-11-29

United States Patent Application 20180340158
Kind Code A1
Lambowitz; Alan M. ;   et al. November 29, 2018

STABILIZED REVERSE TRANSCRIPTASE FUSION PROTEINS

Abstract

Stabilized reverse transcriptase fusion proteins including a thermostable reverse transcriptase connected to a stabilizer protein are described. Attaching the stabilizer protein to the thermostable reverse transcriptase stabilizes the fusion protein and can aid in its purification, provide increased solubility, allow for longer storage, or allow the fusion protein to be used under more rigorous conditions such as higher temperature. The stabilized reverse transcriptase fusion protein can also include a linker between the stabilizer protein and the thermostable reverse transcriptase. The stabilized reverse transcriptase fusion proteins are suitable for use in nucleic acid amplification methods such as the reverse transcription polymerase chain reaction and other applications involving cDNA synthesis.


Inventors: Lambowitz; Alan M.; (Austin, TX) ; Mohr; Sabine; (Austin, TX) ; Mohr; Georg; (Austin, TX) ; Ghanem; Eman; (Raleigh, NC)
Applicant:
Name City State Country Type

Board of Regents, The University of Texas System

Austin

TX

US
Family ID: 42710216
Appl. No.: 16/051544
Filed: August 1, 2018

Related U.S. Patent Documents

Application Number Filing Date Patent Number
13254223 Sep 1, 2011
PCT/US2010/026165 Mar 4, 2010
16051544
61157332 Mar 4, 2009

Current U.S. Class: 1/1
Current CPC Class: C07K 2319/00 20130101; C12P 19/34 20130101; C12Y 207/07049 20130101; C07K 2319/24 20130101; C12N 9/1276 20130101
International Class: C12N 9/12 20060101 C12N009/12; C12P 19/34 20060101 C12P019/34

Goverment Interests



GOVERNMENT FUNDING

[0002] This work was supported, at least in part, by grant number GM37949-22 from the Department of Health and Human Services, National Institutes of Health. The United States government may have certain rights in this invention.
Claims



1. A stabilized reverse transcriptase fusion protein comprising a group-II intron reverse transcriptase connected at its N-terminus to the C-terminus of a stabilizer protein including 50 or more amino acids, wherein the fusion protein exhibits increased solubility and stability in solution.

2-3. (canceled)

4. The stabilized reverse transcriptase fusion protein of claim 1, wherein the group-II intron reverse transcriptase is a Lactococcus lactis reverse transcriptase, a Thermosynechococcus elongatus reverse transcriptase, or Geobacillus stearothermophilus reverse transcriptase.

5. (canceled)

6. The stabilized reverse transcriptase fusion protein of claim 1, wherein the stabilizer protein comprises an affinity protein or a solubility-enhancing protein.

7. The stabilized reverse transcriptase fusion protein of claim 6, wherein the stabilizer protein comprises a maltose binding protein or an N-utilization substance A protein.

8. The stabilized reverse transcriptase fusion protein of claim 6, wherein the stabilizer protein has been modified by replacing charged amino acids with uncharged amino acids.

9. The stabilized reverse transcriptase fusion protein of claim 1, wherein the reverse transcriptase is connected to the stabilizer protein by a linker peptide.

10. The stabilized reverse transcriptase fusion protein of claim 1, wherein the linker peptide is a non-cleavable linker peptide.

11. The stabilized reverse transcriptase fusion protein of claim 10, wherein the non-cleavable linker peptide is a rigid linker peptide.

12. The stabilized reverse transcriptase fusion protein of claim 10, wherein the linker peptide consists of 1 to 20 amino acids.

13. The stabilized reverse transcriptase fusion protein of claim 10, wherein the linker peptide consists of 1 to 5 amino acids.

14. The stabilized reverse transcriptase fusion protein of claim 10, wherein the linker peptide consists of 3 to 5 amino acids.

15. The stabilized reverse transcriptase fusion protein of claim 11, wherein the rigid linker peptide consists of SEQ ID NO: 12.

16. (canceled)

17. The stabilized reverse transcriptase fusion protein of claim 1, wherein the stabilized reverse transcriptase fusion protein is capable of carrying out reverse transcription of an RNA template with processivity or fidelity greater than that of SuperScript III.

18. A method for preparing a cDNA from an RNA molecule, comprising the steps of: (a) adding a primer nucleotide sequence to the RNA molecule (b) incubating the RNA molecule in the presence of one or more deoxy or dideoxyribonucleoside triphosphates and a stabilized reverse transcriptase fusion protein comprising a group-II intron reverse transcriptase connected at its N-terminus to the C-terminus of a stabilizer protein including 50 or more amino acids, wherein the fusion protein exhibits increased solubility and stability in solution under conditions sufficient to synthesize a cDNA molecule complementary to all or a portion of the RNA molecule.

19. The method of claim 18, wherein the group II intron reverse transcriptase is connected to the stabilizer protein by a linker peptide.

20. The method of claim 18, wherein reverse transcription is performed within a temperature range where the RNA has a substantially decreased amount of obstructing stable secondary or tertiary structure.

21. The method of claim 19, wherein the linker peptide is a non-cleavable linker peptide.

22. The method of claim 19, wherein the group II intron reverse transcriptase comprises a polypeptide with at least 85% amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, the linker consists of 1 to 20 amino acids, and the stabilizer protein comprises an affinity protein or a solubility-enhancing protein.

23. The method of claim 18, wherein the reverse transcription is performed with an error frequency of 2.0.times.10.sup.-5 or less at a temperature from about 45.degree. C. to about 65.degree. C.

24. A DNA expression vector for producing a stabilized reverse transcriptase fusion protein, comprising an isolated nucleic acid that encodes a polypeptide comprising a group II intron reverse transcriptase with at least 85% amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5.

25. A method of producing a stabilized reverse transcriptase fusion protein, comprising the steps of (a) culturing a host cell comprising the DNA expression vector of claim 24; (b) expressing the stabilized reverse transcriptase fusion protein encoded by the DNA expression vector; and (c) isolating the stabilized reverse transcriptase fusion protein from the host cell.

26. The stabilized reverse transcriptase fusion protein of claim 1, wherein the stabilizer protein includes an independent folding domain and/or does not fold into long-lived misfolded intermediates.
Description



CONTINUING APPLICATION DATA

[0001] This application claims the benefit of U.S. Provisional Application Ser. No. 61/157,332, filed Mar. 4, 2009, which is incorporated by reference herein.

BACKGROUND OF THE INVENTION

[0003] Reverse transcription polymerase chain reaction, abbreviated as RT-PCR, is a well known technique for amplifying RNA. In RT-PCR, an RNA strand is reverse transcribed into complementary DNA (cDNA), which is then amplified using DNA polymerase in the polymerase chain reaction. In the first step of this process, cDNA is made from an RNA template using deoxyribonucleotide phosphates and reverse transcriptase together with a DNA primer.

[0004] Synthesis of cDNA from the RNA template can be hindered by RNA secondary and tertiary structures, which consist of helices and various other kinds of kinks in the RNA strand. RNA secondary and tertiary structure can be decreased by carrying out the reaction at a higher temperature (e.g., above 50.degree. C.) or by adding denaturing additives. However, the addition of denaturing additives is undesirable because it often reduces reverse transcriptase activity. Higher temperatures also provide the advantage of increasing the specificity of DNA synthesis by decreasing non-specific primer binding. Unfortunately, only a limited number of reverse transcriptases capable of operating at high temperature are currently available, and these exhibit relatively low fidelity DNA polymerization. For example, commercially available Avian Myeloblastosis Virus reverse transcriptase includes RNase H activity and can function at 37.degree. C., but has a fidelity of only about 1.7.times.10.sup.-4. RNase H activity competes with the DNA polymerase activity and the primer binding site and, therefore, cDNA yield is lower. Accordingly, there is a need for reverse transcriptase enzymes that are able to carry out reverse transcription at higher temperatures, including those that have high fidelity and processivity. Such enzymes are beneficial because higher temperatures decrease obstructing RNA secondary and tertiary structure and increase the specificity of reverse transcription by allowing the use of longer and more specific primers.

SUMMARY OF THE INVENTION

[0005] In one aspect, the invention provides a stabilized reverse transcriptase (RT) fusion protein that includes a thermostable reverse transcriptase connected to a stabilizer protein. In one embodiment of the stabilized reverse transcriptase fusion protein, the thermostable reverse transcriptase is a bacterial reverse transcriptase. In a further embodiment, the bacterial reverse transcriptase is a group II intron-derived reverse transcriptase. Examples of thermostable bacterial reverse transcriptases include Thermosynechococcus elongatus reverse transcriptase and Geobacillus stearothermophilus reverse transcriptase. In another embodiment, the thermostable reverse transcriptase exhibits high fidelity cDNA synthesis. In yet another embodiment, the thermostable reverse transcriptase includes a polypeptide with an amino acid sequence identity that is substantially similar to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5.

[0006] The stabilized reverse transcriptase fusion protein includes a stabilizer protein that, when linked to the reverse transcriptase, enhances the shelf life and/or the thermal stability and/or the solubility of the thermostable reverse transcriptase. In certain embodiments, the stabilizer protein is an affinity protein or a solubility-enhancing protein (e.g., a maltose binding protein or N-utilization substance A protein). In additional embodiments, the stabilizer protein is modified by replacing certain charged amino acids with uncharged amino acids.

[0007] The stabilized reverse transcriptase fusion protein can also include a linker peptide that connects the thermostable reverse transcriptase to the stabilizer protein. In some embodiments, this linker peptide is a non-cleavable linker, while in other embodiments it is a non-cleavable rigid linker. In some embodiments, the linker peptide consists of 1 to 20 amino acids, while in other embodiments the linker peptide consists of 1 to 5 or 3 to 5 amino acids. For example, a rigid non-cleavable linker peptide can include 5 alanine amino acids.

[0008] In additional embodiments, the stabilized reverse transcriptase fusion protein has an amino acid sequence that includes a polypeptide with an amino acid sequence identity that is substantially similar to a sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. In some embodiments, the stabilized reverse transcriptase fusion protein is a high fidelity reverse transcriptase capable of carrying out reverse transcription with an error frequency of 2.0.times.10.sup.-5 or less at a temperature from about 45.degree. to about 65.degree. C. In further embodiments, the stabilized reverse transcriptase fusion protein is capable of carrying out substantial levels of reverse transcription at temperatures up to about 81.degree. C.

[0009] Another aspect of the invention provides a method for preparing a cDNA from an RNA molecule that includes the steps of: (a) adding a primer nucleotide sequence to an RNA molecule and (b) incubating the RNA molecule in the presence of one or more modified or unmodified deoxy or dideoxyribonucleoside triphosphates and a stabilized reverse transcriptase fusion protein that includes a thermostable reverse transcriptase connected to a stabilizer protein under conditions sufficient to synthesize a cDNA molecule complementary to all or a portion of the RNA molecule. In particular embodiments, the thermostable reverse transcriptase is connected to the stabilizer protein by a linker peptide (e.g., a non-cleavable or rigid non-cleavable linker peptide). Preferably, the reverse transcription is performed within a temperature range where RNA includes a substantially decreased amount of obstructing stable secondary or tertiary structure. Embodiments of this method include ones in which the thermostable reverse transcriptase is a group II intron-derived reverse transcriptase. In further embodiments of the method, the thermostable reverse transcriptase includes a polypeptide with an amino acid sequence identity that is substantially similar to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, a non-cleavable linker consists of 1 to 20 amino acids, and the stabilizer protein is an affinity protein or a solubility-enhancing protein. In yet further embodiments of the method, the reverse transcription is performed with an error frequency of 2.0.times.10.sup.-5 or less at a temperature from about 45.degree. to about 65.degree. C.

[0010] Another aspect of the invention provides a DNA expression vector for producing a stabilized reverse transcriptase fusion protein that includes a nucleic acid that encodes a polypeptide with an amino acid sequence identity that is substantially similar to a sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10.

[0011] Another aspect of the invention provides a method of producing a stabilized reverse transcriptase fusion protein that includes the steps of: (a) culturing a host cell that includes a DNA expression vector for producing a stabilized reverse transcriptase fusion protein that includes a nucleic acid that encodes a polypeptide with an amino acid sequence identity that is substantially similar to a sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10; (b) expressing the stabilized reverse transcriptase fusion protein encoded by the DNA expression vector; and (c) isolating the stabilized reverse transcriptase fusion protein from the host cell.

[0012] The stabilized reverse transcriptase fusion protein can facilitate cDNA synthesis at higher temperature, and/or with higher processivity, and/or allow the use of longer, more stable, primers that increase the specificity (i.e., fidelity) of reverse transcription. The stabilized RT fusion protein of the invention can therefore be useful for a number of applications, such as research applications.

[0013] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

BRIEF DESCRIPTION OF THE FIGURES

[0014] FIG. 1 is a listing of the amino acid sequence of a reverse transcriptase from Thermosynechococcus elongatus bound to a maltose binding protein by a rigid linker (SEQ ID NO: 6). Amino acid residues 1-367 represent the modified maltose binding protein (SEQ ID NO: 11); amino acid residues 368-372 represent the rigid linker (SEQ ID NO: 12); and amino acid residues 373-935 represent the TeI4c ORF (SEQ ID NO: 1).

[0015] FIG. 2 is a listing of the amino acid sequence of a reverse transcriptase from Thermosynechococcus elongatus bound to a maltose binding protein by a rigid linker (SEQ ID NO: 7). Amino acid residues 1-367 represent the maltose binding protein (SEQ ID NO: 11); amino acid residues 368-372 represent the rigid linker (SEQ ID NO: 12); and amino acid residues 373-935 represent the TeI4f ORF (SEQ ID NO: 2).

[0016] FIG. 3 is a listing of the amino acid sequence of a reverse transcriptase from Thermosynechococcus elongatus bound to a maltose binding protein by a rigid linker (SEQ ID NO: 8). Amino acid residues 1-367 represent the maltose binding protein (SEQ ID NO: 11); amino acid residues 368-372 represent the rigid linker (SEQ ID NO: 12); and amino acid residues 373-935 represent the TeI4h*ORF (SEQ ID NO: 3).

[0017] FIG. 4 is a listing of the amino acid sequence of a reverse transcriptase from Geobacillus stearothermophilus bound to a maltose binding protein by a rigid linker (SEQ ID NO: 9). Amino acid residues 1-367 represent the maltose binding protein (SEQ ID NO: 11); amino acid residues 368-372 represent the rigid linker (SEQ ID NO: 12); and amino acid residues 373-1008 represent the Geobacillus stearothermophilus GsI1 ORF (SEQ ID NO: 4).

[0018] FIG. 5 is a listing of the amino acid sequence of a reverse transcriptase from Geobacillus stearothermophilus bound to a maltose binding protein by a rigid linker (SEQ ID NO: 10). Amino acid residues 1-367 represent the maltose binding protein (SEQ ID NO: 11); amino acid residues 368-372 represent the rigid linker (SEQ ID NO: 12); and amino acid residues 373-792 represent the Geobacillus stearothermophilus GsI2 ORF (SEQ ID NO: 5).

[0019] FIG. 6 is a listing of the nucleotide sequence of the MalE-TeI4c open reading frame (ORF) rigid fusion of reverse transcriptase from Thermosynechococcus elongatus in the pMAL expression construct (SEQ ID NO: 13).

[0020] FIG. 7 is a listing of the nucleotide sequence of the MalE-TeI4f ORF rigid fusion of a reverse transcriptase from Thermosynechococcus elongatus in the pMAL expression construct (SEQ ID NO: 14).

[0021] FIG. 8 is a listing of the nucleotide sequence of the MalE-TeI4h*ORF rigid fusion of a reverse transcriptase from Thermosynechococcus elongatus in the pMAL expression construct (SEQ ID NO: 15).

[0022] FIG. 9 is a listing of the nucleotide sequence of the MalE-GsI1 ORF rigid fusion of a reverse transcriptase from Geobacillus stearothermophilus in the pMAL expression construct (SEQ ID NO: 16).

[0023] FIG. 10 is a listing of the nucleotide sequence of the MalE-GsI2 ORF rigid fusion of a reverse transcriptase from Geobacillus stearothermophilus in the pMAL expression construct (SEQ ID NO: 17).

[0024] FIG. 11 provides a graph showing the poly(rA)/oligo(dT).sub.42 assay of reverse transcriptase (RT) activity at different temperatures. The enzymes assayed were MalE-RF-GsI1, MalE-RF-GsI2, MalE-RF-TeI4c, MalE-RF-TeI4f, MalE-RF-TeI4h*, LtrA, and MalE-RF-LtrA. Reactions were done by incubating the RT (50 nM for TeI4c and 100 nM for all other RTs) with 100 nM poly(rA)/oligo(dT).sub.42 and 5 .mu.l [.alpha.-.sup.32P]-dTTP (3,000 Ci/mmol) in 75 mM KCl, 10 mM MgCl.sub.2, 20 mM Tris-HCl, pH 7.5, and 1 mM DTT. After preincubating the RT with poly(rA)/oligo(dT).sub.42 in the reaction medium for 1 min at the indicated temperature, the reaction was initiated by adding [.alpha.-.sup.32P]-dTTP, incubated for times verified to be within the linear range (90 sec for TeI4c RT and 5 min for all other RTs), and stopped by adding EDTA to a final concentration of 250 mM. The polymerization of [.alpha.-.sup.32P]-dTTP into high-molecular weight material was quantified by spotting the reaction products onto Whatman DE81 chromatography paper (GE Health care Biosciences Corp), washing with 0.3 M NaCl and 0.03 M sodium citrate, and scanning with a PhosphorImager to quantify radioactivity bound to the filter, as described in Materials and Methods. The plot shows radioactivity bound to the filter (PhosphorImager units) as a function of reaction temperature.

[0025] FIG. 12 shows schematic representations of Group II intron RTs and fusion proteins. Section 12(A) provides comparison of group II intron-encoded and retroviral RTs. Group II intron RTs exemplified by the LtrA protein encoded by the L1.LtrB intron generally contains four major domains: RT, with conserved sequence blocks RT-1-7; X/thumb; DNA binding (D), and DNA endonuclease (En). The RT and thumb domains of group II intron RTs are homologous to those of retroviral RTs exemplified by HIV-1 RT, but are larger due to an N-terminal extension and insertions upstream (RT-0) and between the conserved RT sequence blocks (e.g., RT-2a, 3a, 4a, and 7a and thumb domain insertion t.sub.i in LtrA; Blocker et al., RNA 11, 14-28, 2005). The positions of three .alpha.-helices characteristic of the thumb domains of retroviral RTs are shown for both LtrA and HIV-RT. The group II intron RTs used in this work all contain the En domain, except for the GsI2 RT, which lacks the En domain. Section 12(B) shows group II intron RT fusion proteins. Group II intron RTs (IEPs) were expressed with fused N-terminal MalE or NusA solubility tags. Initial constructs contained the MalE solubility tag in expression vector pMalE-c2t fused to the N-terminus of the RT via a flexible linker with a TEV protease cleavage site (underlined). A variant of these initial constructs tested in FIG. 11 contained the pMalE-c2t linker with the TEV protease cleavage site deleted. Improved constructs used modified MalE or NusA tags fused to the N-terminus of the RT via a rigid linker containing 5 alanine residues (underlined). The modified MalE tag has charged amino acid residues changed to alanines (italics), and the modified NusA tag is missing the two C-terminal amino acid residues.

[0026] FIG. 13 provides graphs showing the RT activity of derivatives of MalE-RF-TeI4c RT with different rigid fusion linker or solubility tag sequences. Panel 13(A) provides a bar graph showing RT activity at 60.degree. C. Reaction with MalE-RF-TeI4c RT (left bar) or variants containing different tag or linker sequences (right bars) were done as in FIG. 11 using 50 nM protein and 100 nM poly(rA)/oligo(dT).sub.42 and incubating for 90 sec. Values are the mean for three determinations with error bars indicating the standard deviation. Panel 13(B) provides a graph showing the temperature profile of RT activity for NusA-RF-TeI4c RT. RT activity was assayed as in FIG. 11 using 50 nM protein and 100 nM poly(rA)/oligo(dT).sub.42 and incubating for 2 min at the indicated temperature. The y-axis shows radioactivity bound to the filter (PhosphorImager units) for each protein (panel A) or for NusA-RF-TeI4c RT as a function of reaction temperature (panel B).

[0027] FIG. 14 provides graphs and autoradiograms that provide a comparison of cDNA synthesis by MalE-RF-TeI4c, MalE-RF-GsI2, and SuperScript III RT activity at different temperatures. In panels (A-C), the substrate was a 531-nt RNA transcribed from AflIII-digested pBS KS(+) with an annealed 5'-labeled 37-nt primer, and in panels (D-F), the substrate was a 1.2-kb kanR RNA with an annealed 5'-labeled 44-nt DNA primer. Reactions were done by incubating 100 nM of annealed template/primer with 200 nM enzyme in 100 mM KCl, 20 mM Tris HCl pH 7.5, 10 mM MgCl.sub.2 and 10 mM DTT for MalE-RF-TeI4c RT (panels A and D) and MalE-RF-GsI2 RT (panels B and E) and in the manufacturer's buffer for SuperScript III RT (panels C and F). Reactions were initiated by adding dNTPs to a final concentration of 1.25 mM, incubated for 30 min at the indicated temperature, and terminated by adding 0.1% SDS/250 mM EDTA (final concentrations) followed by phenol-CIA extraction. The products were analyzed by electrophoresis in a denaturing 6% polyacrylamide gel, which was dried and quantified with a PhosphorImager. In each panel, the top and bottom autoradiograms show portions of the gel containing the full-length product (arrow) and unextended or partially extended primer, respectively, and the bar graphs show the percentage of primer that was extended to full-length cDNA based on PhosphorImager quantitation. "?" indicates unidentified bands not used in quantitation of full-length product. A 5'-labeled 10-bp ladder (Invitrogen.TM.) was used as size markers. Schematics of two template primer substrates are shown at the bottom of the figure.

[0028] FIG. 15 is a listing of the nucleotide sequence of the 1.2-kb kanR RNA template (SEQ ID NO: 21).

[0029] FIG. 16 provides semi-log plots obtained from qRT-PCR to compare amounts of cDNA synthesis at different temperatures by MalE-RF-TeI4c RT and SuperScript III RT. cDNA was synthesized with MalE-RF-TeI4c RT or SuperScript III RT (SSIII RT) using the 1.2-kb kanR RNA with annealed primer P078 (Tm=80.degree. C.) and detected with primer/probe sets at nt 188-257 and nt 562-634 (the data for detection with primer set nt 188-257 are shown in the figure; the data obtained with the primer set nt 562-634 are shown in FIG. 17). The qPCR amplification curves show a semi-log plot of fluorescence (.DELTA.RN) versus cycle number. For each sample, duplicate wells were analyzed and are depicted in each amplification plot. The cycle threshold (C.sub.T) values (the cycle at which the fluorescence crosses the threshold 0.4) for each cDNA synthesis reaction by MalE-RF-TeI4c or SuperScript III RT are indicated below the curves. Lower C.sub.T values indicate a larger number of cDNAs synthesized

[0030] FIG. 17 provides semi-log plots obtained from qRT-PCR to compare processivity of cDNA synthesis by MalE-RF-TeI4c RT and SuperScript III RT. cDNA was synthesized with MalE-RF-TeI4c or SuperScript III RT using the 1.2-kb kanR RNA with annealed primer P078 (Tm=80.degree. C.) and detected with primer/probe sets at nt 188-257 and nt 562-634. cDNA samples were obtained at 60.degree. C. (A, B) and 65.degree. C. (C, D). For each sample, triplicates were analyzed and are depicted in each amplification plot. Average copy numbers are derived from a standard curve of quantitated and diluted pET9 plasmid. Detection of similar numbers of cDNA copies with the two primer sets, as seen for MalE-RF-TeI4c RT, shows that most cDNAs extend to near the end of the RNA template, indicative of high processivity. A lower number of cDNA copies detected with the primer set near the 5' end (nt 188-257) compared to the primer set closer to the 3' end (nt 562-634), as seen for SuperScript III RT, indicates that the RT falls off or is in some other way impeded from reaching the 5' end of the RNA template.

[0031] FIG. 18 is a listing of the amino acid sequence of the NusA solubility-enhancing protein (SEQ ID NO: 38).

DETAILED DESCRIPTION OF THE INVENTION

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for describing particular embodiments only and is not intended to be limiting of the invention. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

Definitions

[0033] As used in the description of the invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. In addition, the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0034] As used herein, "polypeptide" refers to a polymer of amino acids and does not imply a specific length of a polymer of amino acids. Thus, for example, the terms peptide, oligopeptide, protein, antibody, and enzyme are included within the definition of polypeptide. This term also includes polypeptides with post-expression modification, such as glycosylation (e.g., the addition of a saccharide), acetylation, phosphorylation, and the like.

[0035] An "isolated" polypeptide or polynucleotide, as used herein, means a polypeptide or polynucleotide that has been either removed from its natural environment, produced using recombinant techniques, or chemically or enzymatically synthesized. Preferably, a polypeptide or polynucleotide of this invention is purified, i.e., essentially free from any other polypeptide or polynucleotide and associated cellular products or other impurities.

[0036] "Amino acid" is used herein to refer to a chemical compound with the general formula: NH.sub.2--CRH--COOH, where R, the side chain, is H or an organic group. Where R is organic, R can vary and is either polar or nonpolar (i.e., hydrophobic). The following abbreviations are used throughout the application: A=Ala=Alanine, T=Thr=Threonine, V=Val=Valine, C=Cys=Cysteine, L=Leu=Leucine, Y=Tyr=Tyrosine, I=Ile=Isoleucine, N=Asn=Asparagine, P=Pro=Proline, Q=Gln=Glutamine, F=Phe=Phenylalanine, D=Asp=Aspartic Acid, W=Trp=Tryptophan, E=Glu=Glutamic Acid, M=Met=Methionine, K=Lys=Lysine, G=Gly=Glycine, R=Arg=Arginine, S=Ser=Serine, H=His=Histidine. Unless otherwise indicated, the term "amino acid" as used herein also includes amino acid derivatives that nonetheless retain the general formula.

[0037] A nucleotide consists of a phosphate group linked by a phosphoester bond to a pentose (ribose in RNA, and deoxyribose in DNA) that is linked in turn to an organic base. The monomeric units of a nucleic acid are nucleotides. Naturally occurring DNA and RNA each contain four different nucleotides: nucleotides having adenine, guanine, cytosine and thymine bases are found in naturally occurring DNA, and nucleotides having adenine, guanine, cytosine and uracil bases found in naturally occurring RNA. The bases adenine, guanine, cytosine, thymine, and uracil often are abbreviated A, G, C, T and U, respectively.

[0038] Nucleotides include free mono-, di- and triphosphate forms (i.e., where the phosphate group has one, two or three phosphate moieties, respectively). Thus, nucleotides include ribonucleoside triphosphates (e.g., ATP, UTP, CTG and GTP) and deoxyribonucleoside triphosphates (e.g., dATP, dCTP, dITP, dGTP and dTTP), and derivatives thereof. Nucleotides also include dideoxyribonucleoside triphosphates (ddNTPs, including ddATP, ddCTP, ddGTP, ddITP and ddTTP), and derivatives thereof.

[0039] "Substantially similar" means that a given nucleic acid or amino acid sequence shares at least 85%, more preferably at least 90%, and even more preferably at least 95% identity with a reference sequence. Furthermore, only sequences describing or encoding proteins in which only conservative substitutions are made in the conserved regions are substantially similar overall. Preferable, substantially similar sequences also retain the distinctive activity of the polypeptide. Substitutions typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and Ile; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gln, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.

[0040] A "promoter," as used herein, refers to a sequence in DNA that mediates the initiation of transcription by an RNA polymerase. Transcriptional promoters may comprise one or more of a number of different sequence elements as follows: 1) sequence elements present at the site of transcription initiation; 2) sequence elements present upstream of the transcription initiation site and; 3) sequence elements downstream of the transcription initiation site. The individual sequence elements function as sites on the DNA, where RNA polymerases and transcription factors that facilitate positioning of RNA polymerases on the DNA bind.

[0041] As used herein, the term "polymerase chain reaction" ("PCR") refers to a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. See for example Bartlett et al., Methods Mol. Biol. 226:3-6 (2003), which provides an overview of PCR and its development. This process for amplifying the target sequence typically consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing and polymerase extension can be repeated many times to obtain a high concentration of an amplified segment of the desired target sequence. Unless otherwise noted, PCR, as used herein, also includes variants of PCR such as allele-specific PCR, asymmetric PCR, hot-start PCR, ligation-mediated PCR, multiplex-PCR, reverse transcription PCR, or any of the other PCR variants known to those skilled in the art.

[0042] As used in this specification, whether in a transitional phrase or in the body of the claim, the terms "comprise(s)" and "comprising" are to be interpreted as having an open-ended meaning. That is, the terms are to be interpreted synonymously with the phrases "having at least" or "including at least". When used in the context of a process, the term "comprising" means that the process includes at least the recited steps, but may include additional steps. When used in the context of a compound or composition, the term "comprising" means that the compound or composition includes at least the recited features or components, but may also include additional features or components.

[0043] A "fusion protein," as used herein, refers to a protein having at least two heterologous polypeptides covalently linked in which one polypeptide comes from one protein sequence or domain and the other polypeptide comes from a second protein sequence or domain.

Stabilized Reverse Transcriptase Fusion Protein

[0044] The invention provides a stabilized reverse transcriptase fusion protein that includes a thermostable reverse transcriptase connected to a stabilizer protein. In many embodiments, the thermostable reverse transcriptase is connected to the stabilizer protein via a linker peptide. However, the thermostable reverse transcriptase and the stabilizer protein can also be directly fused to one another. The polypeptides that comprise the fusion protein are preferably linked N-terminus to C-terminus. However, the reverse transcriptase and the stabilizer protein can be connected together in either order. For example, the two peptide sequences can be connected from the C-terminus to N-terminus or N-terminus to the C-terminus. In some embodiments, a linker peptide is included between the connecting C-terminus and N-terminus of the reverse transcriptase and stabilizer protein.

[0045] Attaching a stabilizer protein to the thermostable reverse transcriptase can provide one or more advantages. A stabilized reverse transcriptase fusion protein can have one or more of the following advantages: (a) increased stability at elevated temperatures; (b) higher processivity, (c) increased solubility, and/or (d) higher fidelity. In some embodiments, a reverse transcriptase of the invention may have a plurality of the properties listed above. For example, a stabilized reverse transcriptase fusion protein may have increased thermostability and increased fidelity. The advantages may sometimes derive from one another. For example, by providing increased solubility, the stabilized reverse transcriptase fusion protein can provide a product able to provide increased fidelity of transcription as a result of solubilizing a previously insoluble high fidelity thermostable reverse transcriptase. The use of a stabilizer protein in the fusion protein can also provide other advantages such as increased protein expression and improved protein folding. Inclusion of a linker peptide between the stabilizer protein and the thermostable reverse transcriptase can further enhance these advantages.

[0046] The stabilized reverse transcriptase fusion protein includes a thermostable reverse transcriptase and a stabilizer protein, as described herein. The stabilized reverse transcriptase fusion protein can also includes a linker peptide. For example, the stabilized reverse transcriptase fusion protein can have an amino acid sequence as set forth in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10, shown in FIGS. 1-5, respectively. Alternately, the stabilized reverse transcriptase fusion protein can have an amino acid sequence that is substantially similar to one or more of the sequences as set forth in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. A stabilized reverse transcriptase fusion protein amino acid sequence that is "substantially similar" to the fusion proteins provided by sequences 6-10 will share at least 85% identity, more preferably 90% identity and even more preferably 95% identity, and will include only conservative amino acid substitutions in conserved regions.

Thermostable Reverse Transcriptases

[0047] The present invention provides a reverse transcriptase fusion protein that includes a thermostable reverse transcriptase. The term "reverse transcriptases" (i.e., RNA-directed DNA polymerases) refers to a group of enzymes having reverse transcriptase activity (i.e., that catalyze synthesis of DNA from an RNA template). In general, such enzymes include, but are not limited to, retroviral reverse transcriptase, retrotransposon reverse transcriptase, and bacterial reverse transcriptases such as group II intron-derived reverse transcriptase, and mutants, variants or derivatives thereof. Examples of bacterial reverse transcriptase include Lactococcus lactis reverse transcriptase, Thermosynechococcus elongatus reverse transcriptase, or Geobacillus stearothermophilus reverse transcriptase. Further bacterial reverse transcriptases are described by Simon et al., Nucleic Acids Research, 36, p. 7219-29 (2008), and Kojima and Kanehisa, Molecular Biology and Evolution, 25, p. 1395-04 (2008) which describe many classes of reverse transcriptases (i.e., retrons, group II introns, and diversity-generating retroelements among others). Reverse transcriptase has been used primarily to transcribe RNA into cDNA, which can then be cloned into a vector for further manipulation or used in various amplification methods such as polymerase chain reaction, nucleic acid sequence-based amplification (NASBA), transcription mediated amplification (TMA), self-sustained sequence replication (3 SR), diverse primer extension reactions, 5'RACE, detection of chemical modifications or other techniques that require synthesis of DNA using an RNA template.

[0048] The term "thermostable" refers to the ability of an enzyme or protein (e.g., reverse transcriptase) to be resistant to inactivation by heat. Typically such enzymes are obtained from a thermophilic organism (i.e., a thermophile) that has evolved to grow in a high temperature environment. Thermophiles, as used herein, are organisms with an optimum growth temperature of 45.degree. C. or more, and a typical maximum growth temperature of 70.degree. C. or more. In general, a thermostable enzyme is more resistant to heat inactivation than a typical enzyme, such as one from a mesophilic organism. Thus, the nucleic acid synthesis activity of a thermostable reverse transcriptase may be decreased by heat treatment to some extent, but not as much as would occur for a reverse transcriptase from a mesophilic organism. "Thermostable" also refers to an enzyme which is active at temperatures greater than 38.degree. C., preferably between about 38-100.degree. C., and more preferably between about 40-81.degree. C. A particularly preferred temperature range is from about 45.degree. C. to about 65.degree. C.

[0049] In some embodiments, a thermostable reverse transcriptase retains at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%) of its nucleic acid synthetic activity after being heated in a nucleic acid synthesis mixture at 90.degree. C. for 30 seconds. In contrast, typical reverse transcriptases will not work at elevated temperatures, and lose most of their nucleic acid synthetic activity after such heat treatment. Thermostable reverse transcriptases typically also have a higher optimum nucleic acid polymerization temperature.

[0050] Some reverse transcriptases are thermostable and therefore remain substantially active at temperatures commonly used in PCR-based nucleic acid synthesis. This provides the advantage of being able to carry out both reverse transcription and DNA amplification in a single reaction environment. Such temperatures vary depending upon reaction parameters, including pH, template and primer nucleotide composition, primer length, and salt concentration. Thermostable reverse transcriptases include Thermosynechococcus elongatus (Te) RT, Geobacillus stearothermophilus (Gs) RT, modified forms of these RTs, and engineered variants of Avian myoblastosis virus (AMV) RT, Moloney murine leukemia virus (M-MLV) RT, and Human immunodeficiency virus (HIV) RT. A reverse transcriptase obtained from an organism living in an elevated temperature environment (i.e., greater than 37.degree. C.) can be expected to be stable at the living temperature of the organism, and to a reasonable degree above.

[0051] A class of reverse transcriptases that is particularly suitable for use in stabilized reverse transcriptase fusion proteins are group II intron-derived reverse transcriptases. A wide variety of group II intron-derived reverse transcriptases are known. See for example the Zimmerly Lab Website for Mobile Group II Introns that describes 105 full length group II intron-derived reverse transcriptases. The use of this website is described by Dai et al., Nucleic Acids Research, 31, p. 424-26 (2003).

[0052] In certain embodiments the thermostable reverse transcriptase is one that was encoded by a group II intron. Group II intron RTs typically consist of four conserved domains: RT, which contains seven conserved sequence blocks (RT1-7) characteristic of the fingers and palm regions of retroviral RTs; X, a region required for RNA splicing activity corresponding at least in part to the thumb domain of retroviral RTs; D, a DNA-binding domain involved in DNA target site recognition; and En, a DNA endonuclease domain that cleaves the DNA target site to generate the primer for reverse transcription (FIG. 12A; Blocker et al., RNA 11, 14-28, 2005). The En domain is missing in some group II intron RTs, which instead use nascent strands at DNA replication forks to prime reverse transcription (Zhong et al., EMBO J. 22, 4555-4565, 2003). The RT and X/thumb domains of group II intron RTs are larger than those of retroviral RTs due to an N-terminal extension, an additional N-terminal conserved sequence block (RT-0), and insertions between the conserved sequence blocks in the RT and X/thumb domain, some of which are shared with non-LTR-retrotransposon RTs. It has been suggested that the larger-sized RT and thumb domains of group II intron and related RTs enable tighter binding of template RNAs leading to higher processivity and fidelity during reverse transcription. Unlike retroviral RTs, group II intron RTs lack an RNase H domain and typically have very low DNA-dependent DNA polymerase activity (Smith et al., Genes and Development 19, 2477-2487, 2005).

[0053] Group II introns encode a class of RNAs known for their self-splicing reaction. Under certain in vitro conditions, group II intron-encoded RNAs can excise themselves from precursor mRNAs and ligate together their flanking exons, without the aid of a protein. The splicing reaction mechanism is similar to the splicing of nuclear pre-mRNA introns. A number of group II introns also encode reverse transcriptase (RT) open reading frames (ORF) and are active mobile elements. The ORF is typically found in domain DIV of the group II intron encoded RNA. The group II intron RT assists RNA splicing by stabilizing the catalytically active RNA structure and then remains bound to the excised intron RNA in a ribonucleoprotein (RNP) that promotes intron mobility by a process termed "retrohoming." Retrohoming occurs by a mechanism in which the excised intron RNA in the RNPs inserts directly into a DNA target site and is reverse transcribed by the RT. During retrohoming, in which the group II intron facilitates targeting of the intron to appropriate DNA sequences, the group II intron RT must produce an accurate cDNA copy of the intron RNA, which is typically 2-2.5 kb long and folds into highly stable and compact secondary and tertiary structures. Thus, group II intron RTs must have high processivity and fidelity in order to carry out their biological function. Group II intron-derived RTs also lack RNase H activity, which can be beneficial because RNase H specifically degrades the RNA of RNA:DNA hybrids, which allows any RNA to be copied only once and can lead to reduced yields of full length cDNA.

[0054] Based on the group II intron-derived reverse transcriptases so far evaluated, these RTs typically exhibit relatively high fidelity and high processivity. The fidelity of reverse transcription refers to the reliability of nucleotide incorporation during reverse transcription of RNA to DNA, with higher fidelity describing nucleotide copying with a low number of errors (e.g., misincorporations). Higher specificity can be provided by using longer and more specific primers, which requires the ability to carry out reverse transcription at higher temperatures. For example, a group II intron reverse transcriptase can provide reverse transcription with an error frequency of 2.0.times.10.sup.-5 or less, wherein the error frequency represents the proportion of nucleotide copying errors that occur relative to the number of nucleotide copying events that occur without error. Other examples of high fidelity transcription include error frequencies of 1.times.10.sup.-4, 7.5.times.10.sup.-5, 5.times.10.sup.-5, 2.5.times.10.sup.-5, 1.times.10.sup.-5, and 5.times.10.sup.-6. For further description of the high fidelity of group II intron-derived RTs, see Conlan et al., Nucleic Acids Research, 33, p. 5262-70 (2005).

[0055] Examples of suitable group II-derived intron reverse transcriptases include the reverse transcriptases set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, which are obtained from Thermosynechococcus elongatus (TeI4c, f, and h*) and Geobacillus stearothermophilus (GsI1 and GsI2). These sequences are shown in FIGS. 1-5. The invention also encompasses group II intron derived reverse transcriptases that are substantially similar to those set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. A reverse transcriptase that is "substantially similar" to the reverse transcriptases provided by sequences 1-5 will share at least 85% identity, more preferably 90% identity and even more preferably 95% identity, and will include only conservative amino acid substitutions in conserved regions. The thermostability of a number of group II intron-derived RTs is shown in FIG. 11, which demonstrates that stabilized reverse transcriptase fusion proteins including the reverse transcriptases as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5 have higher thermostability than mesophilic L1.LtrB reverse transcriptase, whether or not it is part of a fusion protein, when evaluated as shown in FIG. 11. The mesophilic L1.LtrB showed a temperature optimum of about 35.degree. C. either alone or as part of a fusion protein.

[0056] As noted herein, modified forms of thermostable group II intron-derived RTs can also be used. For example, SEQ ID NO: 3, the TeI4h*RT, does not represent a native form of reverse transcriptase, but rather is a derivative in which the active site was modified from the amino acid sequence YAGD to the amino acid sequence YADD, to more closely resemble the active site of other active group II intron-derived RTs.

[0057] The amount by which a given amino acid sequence is "substantially similar" to a reference sequence can be determined for example, by comparing sequence information using sequence analysis software such as the Blastp program, version 2.2.10, of the BLAST 2 search algorithm, as described by Tatusova et al. (FEMS Microbiology Letters, 174, p. 247-50 (1999)), and available on the world wide web at the National Center for Biotechnology Information website, under BLAST in the Molecular Database section. Preferably, the default values for all BLAST 2 search parameters are used, including matrix=BLOSUM62; open gap penalty=11, extension gap penalty=1, gap x_dropoff=50, expect=10, wordsize=3, and optionally, filter on. In the comparison of two amino acid sequences using the BLAST search algorithm, structural similarity is referred to as "similarity" and identity is referred to as "identity."

[0058] Amino acid identity is defined in the context of a comparison between a candidate polypeptides and a reference amino acid sequence, and is determined by aligning the residues of the two amino acid sequences (i.e., a candidate amino acid sequence and the reference amino acid sequence) to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of identical amino acids, although the amino acids in each sequence must nonetheless remain in their proper order.

[0059] Information is available to support a structure-function correlation for group II intron-derived reverse transcriptases. See for example Simon et al., Nucleic Acids Research, 36, p. 7219-29 (2008), which classifies and aligns the RT domains of bacterial reverse transcriptases, and Xiong et al., EMBO J., 9, p. 3353-62 (1990), which provides an alignment of 82 RT sequences showing seven conserved domains and 42 conserved positions. See also Blocker et al, RNA, 11, p. 14-28 (2005), which provides a three-dimensional model of Lactococcus lactis L1.LtrB intron RT (the LtrA protein), describes the proteolytic cleavage sites and conserved regions, and provides a sequence alignment analysis of LtrA relative to HIV-1 RT. Accordingly, a variety of stabilized reverse transcriptase fusion proteins that are substantially similar to those set forth in SEQ ID NO. 6-10 can readily be obtained by modification of amino acids outside of the conserved regions, and only conservative modification of amino acids within the known conserved regions.

[0060] In one embodiment, the present invention provides a stabilized reverse transcriptase fusion protein having a reverse transcriptase activity that has a half-life of greater than that of the corresponding unbound reverse transcriptase at an elevated temperature, i.e., greater than 37.degree. C. In some embodiments, the half-life of a reverse transcriptase of the present invention may be 5 minutes or greater and preferably 10 minutes or greater at 50.degree. C. In some embodiments, the reverse transcriptases of the invention may have a half-life (e.g., at 50.degree. C.) equal to or greater than about 25 minutes, preferably equal to or greater than about 50 minutes, more preferably equal to or greater than about 100 minutes, and most preferably, equal to or greater than about 200 minutes.

Stabilizer Proteins

[0061] The stabilized reverse transcriptase fusion protein of the present invention also includes a stabilizer protein. A stabilizer protein, as defined herein, is a protein forming part of the fusion protein that functions to increase the overall stability of the fusion protein. Stability includes the ability of the protein to retain its conformation and activity. In addition, the stabilizer protein preferably enhances the solubility of the fusion protein, as further described herein with regard to solubility-enhancing proteins. This can be particularly helpful with regard to group II intron RTs, which have been found to be poorly expressed and insoluble in the absence of the intron RNA to which they are ordinarily tightly bound in RNPs. (Vellore et al. Appl. Environ. Microbiol. 70, 7140-7147, 2004; Ng et al., Gene 393, 137-144, 2007) Effective stabilizer proteins include those that include an independent folding domain and/or do not fold into long-lived misfolded intermediates that can influence the propensity of proteins to aggregate. Proteins that will provide an independent folding domain are described by Janin et al., Progress in Biophysics and Molecular Biology, 42, p. 21-78 (1983), and proteins that do not fold into long-lived misfolded intermediates are described by Idicula et al., Protein Science, 14, p. 582-592 (2005). For example, the stabilizer protein can be a protein that includes 50 or more amino acids. In other embodiments, the stabilizer protein can be a larger protein including 100 or more amino acids. As exemplified by the maltose binding protein and NusA proteins provided herein, the stabilizer proteins can also have a size from about 250 amino acids to about 400 amino acids. The stabilizer protein can also be a thermostable protein.

[0062] The stabilizer protein can also be or include an affinity protein. The term affinity protein, as used herein, refers to a protein for which there is a readily available ligand that exhibits a high binding constant (i.e., "affinity") for the protein. Affinity proteins are often used in the role of an affinity tag. Affinity proteins, as is known to those skilled in the art, can be provided in fusion proteins to facilitate the purification of the protein connected or fused to the affinity protein by techniques such as affinity purification, in which a tag binds to a ligand within an affinity column. Suitable affinity proteins are known in the art. See for example Waugh, D., Trends in Biotechnology, 23, p. 316-320 (2005), which describes a number of suitable affinity proteins, including glutathione S-transferase, maltose-binding protein, FLAG-tag peptide, biotin acceptor peptide, streptavidin-binding peptide, and calmodulin-binding peptide. For the preparation and use of fusion proteins that include an affinity protein, see for example U.S. Pat. Nos. 5,643,758, 5,654,176, and 7,001,745.

[0063] The stabilizer protein can also be a solubility-enhancing protein. Recombinantly-expressed fusion proteins can exhibit low solubility in their host cells and/or in subsequent method applications, which can be ameliorated through inclusion of a solubility-enhancing protein in the fusion protein that substantially increases the solubility of the fusion protein in aqueous environments. Some solubility-enhancing proteins used are also affinity proteins, and can therefore be described as solubility-enhancing affinity proteins. Examples of solubility-enhancing proteins include sugar binding proteins such as arabinose binding protein, chitin binding protein, cellulose binding protein, and maltose binding protein. Other examples of solubility-enhancing proteins include the NusA and Dsb solubility tags provided by Novagen.RTM., and the solubility enhancing tag (SET) provided by Invitrogen.TM.. Harrison has demonstrated the very high solubility provided by the NusA solubility tag, while the solubility enhancement of Dsb is described by Collins-Racie. See Harrison, R. G., inNovations, 11, p. 4-7 (2000), and Collins-Racie et al., Biotechnology, 13, p. 982-87 (1995).

[0064] In some embodiments, stabilizer proteins such as solubility-enhancing proteins or affinity proteins can be modified to improve their performance. Modification can include providing one or more substitutions, additions or deletions of amino acids within the protein sequence of the stabilizer protein as compared to the normal, wild-type sequence of the protein. For example, a stabilizer protein such as an affinity protein or a solubility-enhancing protein can be modified by replacing the charged amino acids with uncharged amino acids in certain regions of the protein. Charged amino acids include amino acids with positively or negatively charged side chains. Examples of amino acids with positively charged side chains include arginine, histidine, lysine, and the like. Examples of amino acids with negatively charged side chains include aspartic acid and glutamic acid, and the like. Uncharged amino acids include, but are not limited to, alanine, serine, threonine, glutamine, valine, leucine, isoleucine, phenylalanine, and tyrosine. For example, a maltose binding protein can be modified by replacing one or more of the charged amino acids with alanine.

[0065] Examples of suitable affinity proteins include the maltose binding protein amino acid sequence set forth in SEQ ID NO: 11, shown in FIGS. 1-5, and sequences substantially similar to SEQ ID NO: 11. Note that while modification of the affinity protein is not necessary, the maltose binding protein set forth in SEQ ID NO: 11 was modified to replace three charged amino acids with alanine near the C-terminus. Another suitable protein, in this case a solubilizing protein, is the N-utilization substance A (NusA) protein, which has the amino acid sequence set forth in SEQ ID NO: 38, shown in FIG. 18. In additional embodiments of the invention, fusion proteins described herein that include the maltose binding proteins can have the maltose binding protein replaced with N-utilization substance A proteins.

Linker Peptides

[0066] In some embodiments, the stabilized reverse transcriptase fusion protein also includes a linker peptide positioned between the stabilizer protein and the thermostable reverse transcriptase. Preferably, the linker peptide is a non-cleavable linker peptide. By "positioned between," it is meant that the linker peptide is connected by a chemical linkage (e.g., an amide linkage) to the N or C terminal of each of the stabilizer protein and the reverse transcriptase, as described in regard to fusion proteins herein. For example, the linker peptide can be connected through an amide linkage to the C terminal region of the stabilizer protein and the N terminal region of the thermostable reverse transcriptase. By non-cleavable, it is meant that the linker peptide is not readily susceptible to cleavage by a protease.

[0067] In additional embodiments, the linker peptide is a rigid linker peptide; i.e., a relatively non-flexible peptide linker. Rigid linker peptides are not required to completely lack flexibility, but rather are significantly less flexible than flexible linker peptides such as glycine-rich peptide linkers. Rigid linker peptides, as a result of their relative lack of flexibility, decrease the movement of the two protein domains attached together by the rigid linker peptide, which in the present case are the stabilizer protein and the thermostable reverse transcriptase. Linker peptides that provide ordered chains such as alpha helical structure can provide rigid linker peptides. For example, Arginine, Leucine, Glutamate, Glutamine, and Methionine all show a relatively high propensity for helical linker formation. However, a non-helical linker including many proline residues can exhibit significant rigidity as well. Examples of rigid linkers include polylysine and poly-DL-alaninepolylysine. Further description of rigid peptide linkers is provided by Wriggers et al., Biopolymers, 80, p. 736-46 (2005). In addition, rigid linker peptides are described at the linker database described by George et al., Protein Engineering, 15, p. 871-79 (2003). Preferably, the rigid linker peptide is also a non-cleavable linker peptide; i.e., a non-cleavable, rigid linker peptide.

[0068] Relatively short polypeptides are preferred for use as linker peptides. For example, linker peptides can include from 1 to 20 amino acids. Linker peptides can also include from 1 to 15, from 1 to 10, from 1 to 5, or from 3 to 5 amino acids. Examples of specific sequences that can be used as linker peptides include dipeptides, tripeptides, tetrapeptides, and pentapeptides formed of alanine amino acids. One suitable rigid linker peptide is AAAAA (SEQ ID NO: 12), while another suitable rigid linker peptide is AAAEF (SEQ ID NO: 18). Use of a linker peptide (e.g., a rigid linker peptide) in a fusion protein can provide one or more advantages. For example, while not intending to be bound by theory, it is believed that use of a rigid linker peptide can stabilize the fusion protein by decreasing the amount of movement of the two halves of the fusion protein relative to one another. While very short (i.e., 1 or 2 amino acid) linkers can be used, it is preferable to use linkers that include from 3 to 5 amino acids.

[0069] The linker peptide can be either cleavable or non-cleavable by a protease. Affinity proteins are often associated to another protein in a fusion protein using a cleavable peptide so that the affinity protein can be removed. However, in the present invention the stabilizer protein (e.g., an affinity protein) remains bound to the reverse transcriptase, for the reasons described herein. Accordingly, it is generally preferable that the linker peptide be non-cleavable. However, cleavable linkers can be used in some embodiments. For example, cleavable linkers, including rigid cleavable linker peptides, that are susceptible to protease cleavage can be used if it is desirable to remove the stabilizer protein during a subsequent step and exposure to the cleaving protease is avoided during use of the fusion protein.

Use of Stabilized Reverse Transcriptase Fusion Proteins

[0070] The invention also provides a method for preparing a cDNA from an RNA (e.g., mRNA, rRNA, tRNA, and miRNA), which is required for other methods such as the reverse transcription polymerase chain reaction (RT-PCR). As used herein, the term "RT-PCR" refers to the replication and amplification of RNA sequences. In this method, reverse transcription is coupled to PCR, e.g., as described in U.S. Pat. No. 5,322,770. In RT-PCR, the RNA template is converted to cDNA due to the reverse transcriptase activity of an enzyme, and then amplified using the polymerizing activity of the same or a different enzyme.

[0071] In the practice of the invention, cDNA molecules may be produced by mixing one or more nucleic acid molecules (e.g., RNA) obtained from cells, tissues, or organs using methods that are well known in the art, with the composition of the invention, under conditions favoring the reverse transcription of the nucleic acid molecule by the action of the enzymes of the compositions to form a cDNA molecule (single-stranded or double-stranded). Thus, the method of the invention comprises (a) mixing one or more nucleic acid templates (preferably one or more RNA or mRNA templates, such as a population of mRNA molecules) with stabilized RT fusion protein of the invention and (b) incubating the mixture under conditions sufficient to permit cDNA synthesis of all or a portion of the one or more nucleic acid templates.

[0072] In one aspect, the method includes the steps of (a) adding a primer to an RNA molecule and (b) incubating the RNA molecule in the presence of one or more deoxy or dideoxyribonucleoside triphosphates and a stabilized reverse transcriptase fusion protein comprising a thermostable reverse transcriptase connected to a stabilizer protein under conditions sufficient to synthesize a cDNA molecule complementary to all or a portion of the RNA molecule. Adding the primer to an RNA molecule may include hybridizing the primer to the RNA molecule. In some embodiments, the stabilized reverse transcriptase fusion protein can also include a linker peptide connecting the stabilizer protein to the thermostable reverse transcriptase. Preferably, the reverse transcription is performed within a temperature range where the RNA includes a substantially decreased amount of obstructing stable secondary or tertiary structure. This can be a temperature from about 45.degree. C. to about 81.degree. C., with a more preferred temperature range being from about 45.degree. C. to about 65.degree. C. This can also be described as a temperature range in which the RNA does not form a significant amount of stable secondary or tertiary structure. Due to the high fidelity and other advantages of group II intron-derived RTs, their use may be preferred. For example, the stabilized reverse transcriptase fusion protein can include a group II intron-derived reverse transcriptase with an amino acid sequence identity that is substantially similar to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, a non-cleavable linker consisting of 1 to 20 amino acids, and the stabilizer protein comprises a solubility-enhancing or affinity protein. The stabilized reverse transcriptase fusion protein can also include a linker peptide between the stabilizer peptide and the reverse transcriptase, which can have a length from 1-20 amino acids, can be a non-cleavable linker, or can be rigid linker. Embodiments of the method can perform reverse transcription with an error frequency of 2.0.times.10.sup.-5 or less. Particularly at a temperature from about 45.degree. C. to about 65.degree. C.

[0073] The stabilized reverse transcriptase fusion proteins can also be used in other applications. For example, stabilized RT fusion proteins can be used for the cloning of differentially expressed 5' ends of mRNAs; a process referred to as rapid amplification of cDNA ends (RACE) and variations thereof such as RNA ligase mediated RACE (RLM-RACE). Stabilized RT fusion proteins can also be used for the mapping of chemical footprints in RNA, differential display RT-PCR, which allows for the analysis of gene expression among cell populations, and in-situ PCR for medical diagnosis.

Preparation of Stabilized Reverse Transcriptase Fusion Proteins

[0074] An expression vector containing a stabilized reverse transcriptase fusion protein-encoding nucleic acid molecule may be used for high-level expression of stabilized reverse transcriptase fusion protein in a recombinant host cell. Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses. A variety of expression vectors may be used to express recombinant stabilized reverse transcriptase fusion sequences in appropriate cell types. For example, bacterial vectors, mammalian vectors, fungal vectors, and insect vectors may be used for expression in bacteria, mammalian cells, fungal cells, and insect cells, respectively.

[0075] Stabilized reverse transcriptase fusion proteins can be prepared by obtaining a nucleotide sequence capable of expressing a stabilized reverse transcriptase fusion protein and then expressing that nucleotide sequence in a host cell. The stabilized reverse transcriptase fusion proteins expressed by the host cell can then be purified using a variety of techniques known to those skilled in the art, depending in part on the nature of the host cell.

[0076] Nucleotide sequences capable of expressing stabilized reverse transcriptase fusion proteins of the invention can be prepared using a variety of methods known to those skilled in the art. For example, the nucleotide sequences can be prepared using recombinant plasmids in which various linkers, reverse transcriptases, and stabilizer proteins are combined, as described in Example 1 herein.

[0077] The present invention also relates to host cells transformed or transfected with vectors comprising a nucleic acid molecule capable of expressing a stabilized reverse transcriptase fusion protein. Recombinant host cells may be prokaryotic or eukaryotic, including but not limited to, bacteria such as E. coli, fungal cells such as yeast, mammalian cells including, but not limited to, cell lines of bovine, porcine, monkey and rodent origin; and insect cells including but not limited to Drosophila and silkworm derived cell lines. Such recombinant host cells can be cultured under suitable conditions to produce a stabilized reverse transcriptase fusion protein or a biologically equivalent form. As defined herein, the term "host cell" is not intended to include a host cell in the body of a transgenic human being, human fetus, or human embryo.

[0078] As noted above, an expression vector containing DNA encoding a stabilized reverse transcriptase fusion protein may be used for expression of stabilized reverse transcriptase fusion protein in a recombinant host cell. Therefore, another aspect of this invention is a process for expressing a stabilized reverse transcriptase fusion protein in a recombinant host cell, comprising: (a) introducing a vector comprising a nucleic acid comprising a sequence of nucleotides that encodes a stabilized reverse transcriptase fusion protein into a suitable host cell, wherein the stabilized reverse transcriptase fusion protein comprises a thermostable reverse transcriptase connected to a stabilizer protein directly or via a linker and (b) culturing the host cell under conditions which allow expression of the stabilized reverse transcriptase fusion protein. The stabilized reverse transcription fusion protein can be varied to include any of the features described herein, such as the inclusion of a linker peptide connecting the thermostable reverse transcriptase and the stabilizer protein.

[0079] Following expression of a stabilized reverse transcriptase fusion protein in a host cell, the stabilized reverse transcriptase fusion protein may be recovered to provide purified stable reverse transcriptase fusion protein. Several protein purification procedures are available and suitable for use. For instance, see Example 2 provided herein. Recombinant protein may be purified from cell lysates and extracts by various combinations of, or individual application of salt fractionation, ion exchange chromatography, size exclusion chromatography, hydroxylapatite adsorption chromatography and hydrophobic interaction chromatography. The use of affinity tags in some embodiments of the invention can facilitate purification of the protein. For example, the stabilized reverse transcriptase fusion protein can be separated from other cellular proteins by use of an immunoaffinity column made with monoclonal or polyclonal antibodies specific for the reverse transcriptase or stabilizer protein portion of the fusion protein. Heating can be used to separate the stabilized reverse transcriptase fusion protein from host proteins, which are not stable at elevated temperatures and will therefore precipitate.

[0080] The nucleic acids capable of expressing a stabilized RT fusion protein may be assembled into an expression cassette which comprises sequences designed to provide for efficient expression of the fusion protein in a host cell. The cassette preferably contains a stabilized reverse transcriptase fusion protein-encoding open reading frame, with related transcriptional and translations control sequences operatively linked to it, such as a promoter, and termination sequences. For example, the open reading frame can include a nucleic acid that encodes a polypeptide with an amino acid sequence identity that is substantially similar to a sequence selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10, as shown in FIGS. 1-5, respectively. In a preferred embodiment, the promoter is a T7 or a tac promoter for expression in E. coli, although those skilled in the art will recognize that any of a number of other known promoters may be used. E. coli also has rho independent and dependent terminators and can use T7 polymerase for rapid DNA replication. In eukaryotic cells, inclusion of a polyadenylation site will be helpful for the correct processing of mRNA.

[0081] The open reading frame can also include polynucleotide sequences as set forth in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, as shown in FIGS. 6-10, respectively. Alternately, the open reading frame can include polynucleotide sequences that are substantially similar to those set forth in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17. In this particular context, the term "substantially similar" refers to variants in the nucleotide sequence in which codons that encode the same amino acid can be used interchangeably such that the nucleotide sequence will still result in the translation of an amino acid sequence corresponding to SEQ ID NO: 6-10. The stabilized reverse transcriptase fusion protein open reading frame polynucleotide preferably has at least about 80% identity, at least about 90% identity, at least about 95% identity, or at least about 98% identity to a polynucleotide sequence selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.

[0082] Nucleotide identity is defined in the context of a comparison between a candidate stabilized reverse transcriptase fusion protein open reading frame and a polynucleotide sequence selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, and is determined by aligning the residues of the two polynucleotides to optimize the number of identical nucleotides along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of shared nucleotides, although the nucleotides in each sequence must nonetheless remain in their proper order. Preferably, two nucleotide sequences are compared using the Blastn program of the BLAST 2 search algorithm, as described by Tatusova, et al. (FEMS Microbiology Letters, 174, p. 247-50 (1999)), and available on the world wide web at the National Center for Biotechnology Information website, under BLAST in the Molecular Database section. Preferably, the default values for all BLAST 2 search parameters are used, including reward for match=1, penalty for mismatch=-2, open gap penalty=5, extension gap penalty=2, gap x dropoff=50, expect=10, wordsize=11, and optionally, filter on. In the comparison of two nucleotide sequences using the BLAST search algorithm, nucleotide identity is referred to as "identities."

[0083] With regard to protein preparation from nucleotide sequences, it is noted that a "triplet" codon of four possible nucleotide bases can exist in over 60 variant forms. Because these codons provide the message for only 20 different amino acids (as well as transcription initiation and termination), some amino acids can be coded for by more than one codon, a phenomenon known as codon redundancy. Accordingly, the nucleotide sequences used to prepare the particular amino acid sequences of stabilized reverse transcriptase fusion proteins can vary considerably, depending on the particular codons used. For reasons not completely understood, alternative codons are not uniformly present in the endogenous DNA of differing types of cells, and there exists a natural hierarchy or "preference" for certain codons in certain types of cells. Accordingly, in some embodiments the choice of codons used to express a stabilized reverse transcriptase fusion protein may be optimized through use of particular codons to result in higher levels of expression.

[0084] In accordance with this invention, the stabilized reverse transcriptase fusion protein expression cassette is inserted into a vector. The vector is preferably a plasmid or adenoviral vector, although linear DNA linked to a promoter, or other vectors, such as adeno-associated virus or a modified vaccinia virus, retroviral or lentiviral vector may also be used. In particular, the use of E. coli plasmid vectors is preferred.

[0085] A detailed description of the work conducted by the inventors to develop and evaluate stabilized reverse transcriptase fusion proteins is provided below.

Expression and Purification of Group II Intron RTs as MalE Fusion Proteins

[0086] The expression and solubility of poorly behaved proteins can sometimes be improved by fusion of highly soluble proteins, like maltose-binding protein (MalE) or N utilization substance A (NusA) (Nallamsetty et al., Protein Expression and Purification 45, 175-182, 2005). The MalE tag additionally permits facile purification of the protein via amylose-affinity chromatography. The inventors therefore tested whether group II intron RTs could be expressed and purified as MalE fusions. Initially, a MalE tag was fused to the N-terminus of the RT via a TEV protease-cleavable linker in the expression vector pMal-c2t (FIG. 12B). The MalE-RT fusion proteins for several of the T. elongatus group II intron RTs expressed well in E. coli and could be purified by a procedure that involves polyethyleneimine (PEI)-precipitation to remove nucleic acids, followed by amylose-affinity and heparin-Sepharose chromatography. Further, the uncleaved MalE-RT fusion proteins assayed soon after purification had high thermostable RT activity. However, the yields of these proteins were <0.2 mg/l for the Thermosynechococcus proteins. Additionally, when the MalE tag was removed by cleavage with TEV protease, the RTs immediately formed an insoluble precipitate, while if the tag was left uncleaved, the MalE-RT fusion proteins progressively lost RT activity and were degraded within days, even when stored on ice or flash frozen in 50% glycerol. The latter findings were surprising because proteins that fold properly in the presence of a solubility tag tend to remain soluble after cleavage of the tag (Nallamsetty et al., Protein Expression and Purification 45, 175-182, 2005). The group II intron RTs, which were active with but not without the attached MalE tag, appear to be an exception. The finding that the stabilizer protein must remain attached to the thermostable reverse transcriptase suggests that it plays an active role in keeping the thermostable reverse transcriptase soluble and active.

[0087] To overcome these difficulties, the inventors tested whether the group II intron RTs could be stabilized in active form by attaching the MalE tag to the protein via a non-cleavable rigid linker. Such MalE-rigid fusions typically have a linker region of 3 to 5 alanine residues combined with changes at the C-terminus of the MalE tag to replace charged amino acid residues with alanines (Smyth et al., Genes and Development 19, 2477-2487, 2003). These rigid fusion linkers reduce conformational heterogeneity, enabling crystallization of proteins with attached linkers for structure determination (Smyth et al., ibid). For the MalE-RF-RT fusions tested here, the MalE/linker region of pMal-c2t TVDEALKDAQTNS.sub.3N.sub.10LENLYFQGEF (SEQ ID NO: 19) was modified to TVDAALAAAQTAAAAA (SEQ ID NO: 20) and called a MalE-RF (rigid fusion) tag (FIG. 12B).

[0088] To rapidly assess whether the MalE-RF tag affects the activity of group II intron RTs, the inventors tested whether the MalE-RF-RTs could support retrohoming in vivo. For initial tests, the RTs chosen were the LtrA protein encoded by the L. lactis L1.LtrB intron, and TeI4h*RT, an activated derivative of the RT encoded by the thermostable T. elongatus TeI4h intron. In retrohoming assays at 37.degree. C., the MalE-RF-LtrA protein supported retrohoming at an efficiency of 20% compared to 86% for native LtrA, while in retrohoming assays at 48.degree. C., the MalE-RF-TeI4h*protein supported retrohoming at an efficiency of 87% compared to 100% for the unfused TeI4h*protein; see Table 1. Thus remarkably both MalE-RF-RTs retain the ability to support retrohoming with high albeit somewhat reduced efficiencies despite the presence of the attached maltose-binding protein rigid linker sequence. These findings imply that the proteins retain substantial levels of all activities required for retrohoming, including RT, RNA splicing, and DNA endonuclease activity. This mobility assay provides a convenient screen for active group II intron RTs.

TABLE-US-00001 TABLE 1 Retrohoming efficiencies for different RTs RT Efficiency TeI4h* (48.degree. C.) 100% MalE-RF-TeI4h* (48.degree. C.) 87% LtrA (37.degree. C.) 86% MalE-RF-LtrA (37.degree. C.) 20%

[0089] Retrohoming assays were done in E. coli HMS174(DE3) as described previously for the L1.LtrB intron (LtrA protein) (Guo et al. Science 289, 452-457, 2000, Karberg et al. Nature Biotech. 19, 1162-1167, 2001) and TeI4h*. The Cap.sup.R intron-donor plasmids use a T7lac promoter to express a .DELTA.ORF intron (I-.DELTA.ORF) with short flanking 5' and 3' exons (E1 and E2, respectively) and a T7 promoter in DIV, followed by the RT ORF downstream of E2. The Amp.sup.R recipient plasmids contain a target site for the intron (ligated E1-E2 sequences) cloned upstream of a promoterless tet.sup.R gene. Intron expression was induced with IPTG (0.1 mM for LtrA and MalE-RF-LtrA and 0.5 mM for TeI4h*and MalE-RF-TeI4h*) for 1 h at the indicated temperature. Retrohoming of the intron carrying the T7 promoter into the target site activates the expression of the tet.sup.R gene, enabling selection for Tet.sup.R+Amp.sup.R colonies. Retrohoming efficiencies were calculated as the ratio of (Amp.sup.R+Tet.sup.R)/Amp.sup.R colonies.

[0090] Encouraged by these findings, the inventors constructed plasmids in which several group II intron RTs were expressed with a MalE tag fused to the N-terminus of the protein via a rigid linker in the vector pMal-c2t. The RTs tested included several T. elongatus group II intron RTs, whose ability to support retrohoming had been tested previously using the above plasmid assay and two G. stearothermophilus group II intron RTs related to group II intron RTs that had previously been difficult to purify with high yield and activity (Vellore et al., Appl. Environ. Microbiol. 70, 7140-7147, 2004; Ng et al., Gene 393, 137-144, 2007). In some constructs, the inventors added an additional C-terminal His6-tag to enrich for full-length protein in the purification. The MalE-RF-RT fusion proteins were expressed in E. coli and purified by a procedure that involves PEI-precipitation of nucleic acids followed by amylose-affinity and heparin-Sepharose chromatography. An additional Ni column chromatography step was included for constructs with a C-terminal His6 tag. The proteins were dialyzed against the purification buffer with 50% glycerol, flash frozen, and stored at -80.degree. C. The final protein preparations were >95% pure with yields of 0.5-2.2 mg/ml and their RT activity was undiminished after storage for at least six months.

RT Assays

[0091] To assess their thermostability, the inventors first assayed the RT activity of fusions MalE-RF-TeI4c, TeI4h*, and TeI4f from Thermosynechococcus elongatus and MalE-RF-GsI1 and GsI2 from Geobacillus stearothermophilus at temperatures between 25 and 77.degree. C. These initial assays were done by using poly(rA)/oligo(dT).sub.42 as the template-primer substrate and quantifying polymerization of .sup.32P-dTTP into high molecular weight material. The relatively long 42-nt dT primer was used so that it would remain annealed to the poly(rA) template at higher temperatures (calculated Tm=69.degree. C.). The LtrA protein with and without an N-terminal MalE-RF tag was assayed in parallel as a mesophilic RT control (FIG. 11). Whereas the LtrA protein had a temperature optimum of .about.35.degree. C. with or without the MalE rigid fusion tag, the other five MalE-RF-RT's had higher temperature optima ranging from 45-61.degree. C. The two most active and thermostable RTs, MalE-RF-GsI2 and MalE-RF-TeI4c had temperature optima of 61.degree. C. and retained substantial activity at 70.degree. C. (where the assay may be limited by the stability of the primer-template base pairing). Of the two RTs, MalE-RF-TeI4c had the highest activity and was assayed at lower protein concentrations (50 nM) and for shorter times (90 sec) than the other RTs (100 nM, 5 min) in order to remain within the linear range. Tests with the MalE-RF-TeI4c protein showed that inclusion of maltose (10 .mu.M to 1 mM), which can affect the conformation of the MalE tag, had little if any effect on RT activity.

Effect of Changing the Tag and Linker on RT Activity

[0092] To determine optimal properties of the tag and linker, the inventors constructed variants of the MalE-RF-TeI4c RT. The MalE-RT-TeI4c RT (left bar) and variant proteins (right bars) were purified and assayed for RT activity with poly(rA)/oligo(dT).sub.42 as described above (FIG. 13A). MalE-RT-TeI4c has a modified MalE tag (MalE (mod)) with 3 charged amino acid residues changed to alanines and a linker of 5 alanine residues linked to the N-terminus of the RT. Variants in which the 5 alanine-residue linker was removed or shortened to 1 or 2 alanine residues had substantial but reduced RT activity, as did a variant in which the modified MalE tag was replaced with wild-type MalE (MalE (WT)) (FIG. 13A). A variant of TeI4c with the MalE (WT) tag followed by the pMal-c2t linker deleted for the TEV protease cleavage site also had substantial but reduced RT activity (FIG. 13A). A variant in which the wild-type MalE tag was attached to the C-terminus of the TeI4c RT did not express well in E. coli, presumably reflecting that the nascent TeI4c RT cannot fold properly without prior expression of the MalE tag. Finally, a variant with an N-terminal rigid fusion to NusA (N utilization substance protein) instead of MalE had substantial thermostable RT activity (FIGS. 13A and B).

Temperature Profile for cDNA Synthesis

[0093] FIG. 14 shows assays of cDNA synthesis at different temperatures using in vitro transcribed RNA templates with DNA primers annealed to their 3' ends comparing two of the thermostable group II intron RTs (MalE-RF-TeI4c and MalE-RF-GsI2) with a commercially available RT, SuperScript III (Invitrogen.TM.), which has been reported to be active at 55.degree. C. (Potter et al. Focus (Invitrogen Newsletter) 25.1, 19-24, 2003). One template was a 531-nt in vitro transcript synthesized from AflIII-digested pBS KS(+) with a .sup.32P-labeled 37-nt DNA primer annealed (FIG. 14A-C) and the other was a 1.2-kb kanR RNA (SEQ ID NO: 21; shown in FIG. 15) with a .sup.32P-labeled 44-nt DNA primer (FIG. 14D-E). The reaction was incubated for 30 min at the indicated temperature, and the products were analyzed by electrophoresis in a denaturing 6% polyacrylamide gel. In each panel, the top and bottom autoradiograms show portions of the gel containing the full-length product and unextended or partially extended primers, respectively, and the bar graphs show the percentage of primer that was extended to full-length cDNA.

[0094] With the 531-nt RNA template, the MalE-RF-TeI4c RT had a temperature optimum for full-length cDNA synthesis of 61-81.degree. C. The MalE-RF-GsI2 RT synthesized full-length cDNA at temperatures between 37 and 69.degree. C., whereas SuperScript III RT had no activity at temperatures higher than 57.degree. C. (FIG. 14A-C). With the 1.2-kb RNA template, the MalE-RF-TeI4c and MalE-RF-GsI2 RT had temperature optima of 61-81.degree. C. and 61-69.degree. C., respectively, while SuperScript III RT again had no activity at temperatures higher than 57.degree. C. (FIG. 14D-E).

Analysis of cDNA Synthesis by qRT-PCR

[0095] In addition to gel analysis, the inventors used qRT-PCR to compare the amounts of cDNAs synthesized by the MalE-RF-TeI4c and SuperScript III RTs using the 1.2-kb RNA template. The inventors first compared the amounts of full-length cDNA produced at temperatures between 50 and 75.degree. C. (FIG. 16). The cDNAs for qPCR were synthesized in reactions containing 5.times.10.sup.8 copies of kanR RNA as a template, 200 nM MalE-RT-TeI4c or 200 U of SuperScript III RT for 30 min at six different temperatures. Reactions with SuperScript III were done according to the manufacturer's specifications. The reaction mix containing all components except for dNTPs was preincubated at the desired temperatures for 2 min and started by adding the dNTPs. After 30 min, the reactions were terminated by quickly freezing on dry ice. A 5-.mu.l portion of each cDNA synthesis was used in qPCR reactions containing TaqMan.RTM. Gene Expression mix and two forward, reverse, and dual-labeled primer probe mixes located at nt 188-257 and 562-634 of the kanamycin RNA. With the primer set closest to the 5' end of the RNA (nt 188-257), the cycle threshold (C.sub.T) values were significantly lower for the MalE-RF-TeI4c RT than for SuperScript III RT at all temperatures tested (FIG. 16), indicating that MalE-RF-TeI4c had synthesized larger amounts of cDNAs extending to near the 5' end of the RNA template. Notably, the difference in amounts of cDNAs synthesized was most pronounced at temperatures between 55 and 65.degree. C., where the activity of SuperScript III falls off rapidly.

[0096] To compare the processivity of cDNA synthesis by MalE-RF-TeI4c and SuperScript III RTs, the same cDNA samples obtained at 60 and 65.degree. C. were analyzed with two different amplicon primer/probe sets: 188-257, which detects cDNAs that are 920-nt long, and 562-634, which detects cDNAs that are 546 nt long (FIG. 17). In this case, cycle threshold results for cDNA samples were plotted against a standard curve obtained with Novagen.RTM. double-stranded DNA plasmid vector pET9a to determine copy numbers equivalents. With the 188-257 amplicon primer/probe set, 972,815 copies were detected with the MalE-RF-4c TeI4c RT versus 64,456 copies with SuperScript RT at 60.degree. C. (.about.15 fold difference), and that ratio increased to 732,559 versus 661 at 65.degree. C. (.about.1100 fold difference). Further, at both temperatures, the MalE-RF-TeI4c RT shows little difference in the copy numbers of cDNAs detected by the two primer sets, showing that the MalE-RF-TeI4c RT synthesizes mostly full-length cDNAs, indicative of high processivity. By contrast, SuperScript III RT showed lower numbers of longer cDNAs detected by the 188-257 primer set than the 562-634 primer set at both temperatures, indicating that this RT falls off or is otherwise impeded before reaching the 5' end of the RNA, resulting in synthesis of shorter cDNAs.

Fidelity of Nucleotide Incorporation by TeI4c and TeI4h*RTs

[0097] The inherent fidelity of the TeI4h*and TeI4c RTs (i.e., the native group II intron RT, not a stabilized RT fusion protein) was assessed initially by sequencing introns that had undergone retrohoming in E. coli plasmid assays (Table 2). The maximum error frequencies for the TeI4h*RNA promoting retrohoming of a TeI4h*-.DELTA.ORF intron RNA at 37 and 48.degree. C. were 1.6.times.10.sup.-5 and 4.1.times.10.sup.-6, respectively. The TeI4c RT is encoded by the outer intron of a "twintron", a configuration in which one group II intron (TeI3c) has inserted into another (TeI4c), and can efficiently mobilize both introns. The maximum error frequencies for the TeI4c RT promoting retrohoming of TeI3c or TeI4c at 48.degree. C. were 1.1.times.10.sup.-5 and 2.2.times.10.sup.-5. These error frequencies are comparable to that estimated previously for the L1.LtrB intron RT (LtrA) promoting retrohoming of the L1.LtrB intron, .about.10.sup.-5 at 37.degree. C. (Conlan et al., Nucl. Acids Res. 33, 5262-5270, 2005).

TABLE-US-00002 TABLE 2 Fidelity of group II intron RTs as measured by frequency of nucleotide misincorporation during retrohoming RT TeI4h* TeI4h* TeI4c TeI4c Intron TeI4h*-.DELTA.ORF TeI4h*-.DELTA.ORF TeI3c-.DELTA.ORF TeI4c-.DELTA.ORF Temp. 37 48 48 48 (.degree. C.) Nts 244,253 244,980 265,858 537,354 sequenced Mutations 4 1 3 12 Error 1.6 .times. 10.sup.-5 4.1 .times. 10.sup.-6 1.1 .times. 10.sup.-5 2.2 .times. 10.sup.-5 Frequency

[0098] Retrohoming was done in E. coli HMS174(DE3) with donor plasmids expressing the indicated intron and RT and recipient plasmids containing the intron target site (ligated E1-E2) sequences cloned upstream of a promoterless tet.sup.R gene. After selection of Tet.sup.R colonies, introns that had integrated into the target site in recipient plasmid were amplified by colony PCR using the primers Rsense (5'-ACAAATAGGGGTTCCGCGCAC; SEQ ID NO: 22) and Te680rc (5'-GTTGGTGACCGCACCAGT; SEQ ID NO: 23) and Te420f (5'-AACGCGGTAAGCCCGTA; SEQ ID NO: 24) and Rev2pBRR (5'-AATGGACGATATCCCGCA; SEQ ID NO: 25) for the 5'- and 3'-integration junctions, respectively. The PCR fragments were then sequenced. Table 2 indicates the induction temperature for retrohoming, the total number of intron nucleotides sequenced, the number of mutations (errors), and the error frequency.

[0099] The following examples of methods for preparing and characterizing stabilized RT fusion proteins are included for purposes of illustration and are not intended to limit the scope of the invention.

EXAMPLES

Example 1: Recombinant Plasmids

[0100] pMalE-TeI4c, pMalE-TeI4f, pMalE-TeI4h*contain the RT ORF of the indicated mobile group II intron with a fused N-terminal MalE tag cloned behind the tac promoter in the expression vector pMal-c2t. The latter is a derivative of pMal-c2x (New England Biolabs, Ipswich Mass.) in which the factor Xa protease-cleavage site between MalE and the expressed protein was replaced by a TEV protease-cleavage site (Kristelly et al., Acta Crystallogr D Biol Crystallogr. 59, 1859-1862, 2003). The TeI4h*RT is a derivative of the native TeI4h RT with the YAGD motif in RT-5 changed to YADD. Recombinant plasmids containing group II introns from T. elongatus strain BP1 cloned in pET11 (TeI4f), pUC19 (TeI4c), or pACD2X (TeI4h*) were described previously. pMalE-RT plasmids were derived from these initial constructs by PCR amplifying the RT ORF with primers that append restriction sites, and then cloning the PCR products into the corresponding sites of pMal-c2t (TeI4c RT, EcoRI and PstI sites; TeI4f RT, BamHI site; TeI4h*RT, BamHI and PstI sites). Recombinant plasmids denoted pMalE-RF-protein (e.g., pMalE-RF-TeI4c) were derived from the corresponding pMalE-RT plasmids by replacing the TEV-protease cleavable linker (TVDEALKDAQTNS.sub.3N.sub.10LENLYFQG; SEQ ID NO: 19) with a rigid linker (TVDAALAAAQTAAAAA; SEQ ID NO: 20) by the QuikChange PCR procedure using the Accuprime polymerase (Invitrogen, Makarova et al., BioTechniques 29, 970-972, 2000).

[0101] Derivatives of pMalE-RF-TeI4c with different linkers were constructed by PCR mutagenesis using the QuikChange procedure. The MalE tag was fused to the C-terminus of the TeI4c ORF in pMal-c2t by amplifying the MalE segment of pMal-c2t with primers that introduce a 5' EcoRI site and a 3' PstI site, and the TeI4c ORF of pMalE-TeI4c with gene specific primers that introduce a 5' NdeI site and a 3' EcoRI site, respectively, and cloning the fragments into pMal-c2t digested with NdeI and PstI.

[0102] pNusA-RF-TeI4c-His, which expresses the TeI4c RT with an N-terminal NusA tag fused to the protein via a rigid linker and a C-terminal His6 tag, was constructed by PCR amplifying the TeI4c RT ORF from pMAL-TeI4c with primers that append SacII and KpnI sites and cloning the resulting PCR product between the corresponding sites of pET-50b(+) (Novagen). PCR mutagenesis was then used to replace the last two charged residues (D and E) of NusA, the existing linker, and one of the two N-terminal His6 tags (NICWFGDEATSGSGH.sub.6; SEQ ID NO: 26) with a rigid linker sequence (NICWFGAAAAA; SEQ ID NO: 27). The second N-terminal His6 tag was removed by PCR mutagenesis and a His6 tag was fused to the C-terminus of TeI4c RT by QuikChange PCR.

[0103] pMalE-GsI1 and pMalE-GsI2 were constructed by PCR amplifying the RT ORFs from G. stearothermophilus strain 10 genomic DNA (obtained from Greg Davis (Sigma-Aldrich)) by PCR with primers that amplify the introns and appended BamHI and XbaI sites (GsI1) or BamHI sites (GsI2) and then cloning the PCR products between the corresponding sites of pMal-c2t. GsI1 is a subgroup IIB2 intron that is inserted in the G. stearothermophilus recA gene and is related to the previously described RT-encoding group II introns in the recA genes of Geobacillus kaustophilus (Chee et al., Gene 363, 211-220, 2005) and Bacillus caldolyticus (Ng et al., Gene 393, 137-144, 2007). The cloned GsI1 RT ORF was verified to correspond to the genomic sequence (CP001794). GsI2 is a group IIC intron found in multiple copies in the G. stearothermophilus genome. The cloned GsI2 RT ORF corresponds to the genomic sequence of one of six full-length copies of GsI2 in the G. stearothermophilus genome (CP001794) and has three amino acid sequence changes from the RT ORF cloned by Vellore et al. (Appl. Environ. Microbiol. 70, 7140-7147, 2004). The corresponding pMalE-RF-RT constructs were derived from the pMalE-RT constructs by QuikChange PCR, as described above.

[0104] pMalE-LtrA was constructed by PCR amplifying the LtrA ORF of pImp-2 (Saldanha et al., Biochemistry 38, 9069-9083, 1999) using primers that append BamHI and HindIII sites and then cloning the PCR product between the corresponding sites of pMal-c2t, and pMalE-RF-LtrA was derived from pMalE-LtrA by QuikChange PCR, as described above.

Example 2: Protein Purification

[0105] For expression of pMalE-RT or pMalE-RF-RT constructs, E. coli Rosetta 2/pRARE (Novagen, EMD Biosciences, Gibbstown N.J.) or ScarabXpress/pRARE T7lac (Scarabgenomics, Madison Wis.) were transformed with the expression plasmid and grown at 37.degree. C. in TB or LB medium to mid-log phase (O.D..sub.600=0.8). Expression was induced either by adding isopropyl .beta.-D-1-thiogalactopyranoside (IPTG; 1 mM final) to mid-log phase cells (pMalE-RF-TeI4c, TeI4f, TeI4h*, GsI1, and GsI2) or by growing cells in auto-induction medium (LB containing 0.2% lactose, 0.05% glucose, 0.5% glycerol, 24 mM (NH.sub.4).sub.2SO.sub.4, 50 mM KH.sub.2PO.sub.4, 50 mM Na.sub.2HPO.sub.4) (pMalE-LtrA and pMalE-RF-LtrA). In either case, induction was for .about.24 h at 18-25.degree. C., after which cells were pelleted by centrifugation, resuspended in buffer A (20 mM Tris-HCl, pH 7.5, 0.5 M KCl or NaCl, 1 mM EDTA, 1 mM dithiothreitol (DTT)), and frozen at -80.degree. C.

[0106] For purification of MalE-RF-TeI4c, TeI4f, TeI4h*and their derivatives, the cell suspension was thawed, treated with lysozyme (1 mg/ml; Sigma) for 15 min on ice, freeze-thawed three times on dry ice, sonicated (Branson 450 Sonifier, Branson Ultrasonics, Danbury Conn.) three or four 10 sec bursts or one 30 sec burst on ice at an amplitude of 60%, with 10 sec between bursts, and centrifuged for 30 min at 18,500.times.g at 4.degree. C. Nucleic acids were precipitated by adding polyethyleneimine (PEI) to a final concentration of 0.1% and centrifuging for 15 min at 15,000.times.g at 4.degree. C. in a J16.25 rotor in an Avanti J-E centrifuge (Beckman Coulter, Brea Calif.). The resulting supernatant was applied to an amylose column (10-ml column volume; Amylose High-Flow (New England Biolabs), equilibrated in buffer A), which was washed with five column volumes each of buffer A containing 0.5 M, 1.5 M, or 0.5 M KCl, and then eluted with buffer A containing 10 mM maltose. Protein fractions were pooled and purified further via a heparin-Sepharose column (3 tandem 1-ml columns; GE Healthcare Biosciences Corp.) which had been pre-equilibrated in 20 mM Tris-HCl, pH 7.5 containing KCl (100 mM for MalE-RF-4c, 4f, 4h*, MalE-LtrA and MalE-RF-LtrA; 50 mM for MalE-RF-GsI1 or GsI2), 1 mM EDTA, 1 mM DTT, 10% glycerol. The proteins were applied to the column in the same buffer and eluted with a 40-column volume gradient from the loading concentration to 2 M KCl. The proteins eluted at .about.800 mM KCl. The peak fractions were pooled and dialyzed against 20 mM Tris-HCl, pH 7.5, 0.5 M KCl, 1 mM EDTA, 1 mM DTT, and 50% glycerol for storage. The frozen proteins showed no decrease in RT activity for at least six months.

[0107] The MalE-RF-GsI1 protein, which has an N-terminal MalE tag and a C-terminal His6-tag, was purified similarly, except that nucleic acids were precipitated with 0.2% PEI, and the protein eluted from the amylose column was purified further on a nickel column prior to the final heparin-Sepharose column. The nickel column (5 ml HisTrap.TM. HP Nickel Sepharose; GE Healthcare Biosciences, Piscataway N.J.) equilibrated with binding buffer (500 mM KCl, 20 mM Tris-HCl pH 7.5, 40 mM imidazole, and 10% glycerol) was loaded with pooled protein fractions from the amylose column, washed with 10 column volumes of binding buffer, eluted with five column volumes of elution buffer (500 mM KCl, 20 mM Tris-HCl pH 7.5, 400 mM imidazole and 10% glycerol), and the supernatant loaded directly onto the heparin-Sepharose column. The peak fractions from the heparin-Sepharose column were pooled, dialyzed against 20 mM Tris-HCl, pH 7.5, 0.5 M KCl, 50% glycerol, and stored as described above.

[0108] For the NusA fusions, E. coli ScarabXpress/pRARE T7lac cells were induced with 0.5 mM IPTG for 48 h at 18.degree. C. and resuspended in nickel buffer A (20 mM Tris pH 7.5, 500 mM KCl, 30 mM imidazole, 10% glycerol). After disrupting the cells as described above, nucleic acids were precipitated from the lysate by adding a final concentration of 0.2% polyethyleneimine, followed by centrifugation at 10,000.times.g for 15 min. The supernatant was applied to a 5-ml nickel-Sepharose column pre-equilibrated with nickel buffer A, and then eluted with nickel buffer A containing 500 mM imidazole. The protein fractions were pooled and loaded directly onto two connected 1-ml heparin-Sepharose columns that had been pre-equilibrated in 20 mM Tris pH 7.5, 100 mM KCl, 1 mM DTT, 1 mM EDTA, and 20% glycerol. The protein was eluted with a 20-column volume gradient of 0.1 to 1.5 M KCl, and peak fractions were pooled, dialyzed against 20 mM Tris-HCl, pH 7.5, 0.5 M KCl, 1 mM EDTA, 1 mM DTT, 50% glycerol, and stored as described above.

Example 3: Reverse Transcriptase Assays

[0109] RT activity at different temperatures was assayed by quantifying incorporation of .sup.32P-dTTP using poly(rA)/oligo(dT).sub.42 as the template-primer. The RT (50 nM MalE-RF-TeI4c RT or 100 nM of all other RTs) was pre-incubated with 100 nM poly(rA)/oligo(dT).sub.42 in 1.times.RT buffer (75 mM KCl, 10 mM MgCl.sub.2, 20 mM Tris-HCl, pH 7.5, and 1 mM DTT) at different temperatures (ranging from 25-77.degree. C.), and reactions were initiated by adding 5 .mu.Ci [.alpha.-.sup.32P]-dTTP (3,000 Ci/mmol; Perkin Elmer, Waltham Mass.). The reactions were incubated for times within the linear range and stopped by adding EDTA to a final concentration of 250 mM. Reaction products were spotted onto Whatman DE81 chromatography paper (10.times.7.5-cm sheets; GE Healthcare), washed 3 times in 0.3 M NaCl and 0.03 M sodium citrate, and scanned with a PhosphorImager (Typhoon Trio Variable Mode Imager; GE Healthcare) to quantify bound radioactivity.

[0110] Other RT assays used RNA templates with annealed DNA oligonucleotide primers. The RNA template was either a 531-nt in vitro transcript synthesized from pBluescript KS (+) digested with AflIII transcribed using T7 Megscript kits (Ambion, Applied Biosystems, Austin, Tex.) or a 1.2-kb kanR RNA purchased from Promega (Promega, Madison Wis.). In vitro transcription was done according to the manufacturer's instructions for 4 h at 37.degree. C. After digesting the DNA template with Turbo DNase I (5 min, 37.degree. C.), RNAs were extracted with phenol:chloroform:isoamyl alcohol (25:24:1; phenol-CIA) and purified by two cycles of gel filtration through Sephadex G-50 (Sigma, St Louis, Mo.) spin columns. The RNA concentration was determined by using a Nanodrop (Thermo Scientific, Wilmington, Del.). RNAs were stored in Milli-Q-grade H.sub.2O and stored at -20.degree. C.

[0111] DNA oligonucleotide primers complementary to the 3' ends of the RNAs were synthesized by IDT (Coralville, Iowa; AflIII primer: 5'-CCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCG; SEQ ID NO: 28; P078 Kanamycin Rev 5'-GGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAAC; SEQ ID NO: 29). Primer concentrations were determined by A.sub.260. The primers were 5' .sup.32P-labeled with T4 polynucleotide kinase (New England Biolabs) according to the manufacturer's instructions, and free nucleotides were removed by gel filtration through a Sephadex G-25 column. The primers were mixed with the template at a molar ratio of 1.0:1.1 and annealed by heating to 82.degree. C. for 2 min and then cooling to room temperature in a GeneAmp 9700 PCR cycler with the ramp setting of 10%.

[0112] For gel analysis of cDNA synthesis, 100 nM of annealed template/primer was incubated with 200 nM enzyme in 100 mM KCl, 20 mM Tris HCl pH 7.5, 10 mM MgCl.sub.2 and 1 mM DTT for MalE-RF-TeI4c RT and in 10 mM NaCl, 20 mM Tris HCl pH 7.5, 10 mM MgCl.sub.2 and 1 mM DTT for MalE-RF-GsI2 RT. Reactions were initiated by adding dNTPs and MgCl.sub.2 to final concentrations of 1.25 mM and 10 mM, respectively, incubated for 30 min at the indicated temperature, and terminated by adding 0.1% SDS/250 mM EDTA (final concentrations) followed by phenol-CIA extraction. The products were analyzed by electrophoresis in a denaturing 6% polyacrylamide gel, which was dried and quantified with a PhosphorImager. A 5'-labeled 10-bp ladder (Invitrogen.TM.) was used as size markers.

Example 4: Quantitative Real-Time Polymerase Chain Reaction (qPCR)

[0113] cDNAs for qPCR analysis were generated in 20 .mu.l reactions containing 1.times. RT buffer (75 mM KCl, 10 mM MgCl.sub.2, 20 mM Tris-HCl, pH 7.5), 1 mM DTT, 5.times.10.sup.8 copies of kanR RNA, 200 nM MalE-RF-TeI4c RT and 1 mM dNTPs for 30 min at temperatures specified for individual experiments. Parallel reactions with SuperScript III (Invitrogen) were done according to the manufacturers specifications. Reactions were incubated at the different temperatures for 2 min and started by adding dNTPs. After incubating for 30 min, the reactions were quickly frozen on dry ice to stop the reactions. 5 .mu.l of cDNA reaction were used for the qPCR.

[0114] qPCR analysis was done in 96-well plates with optical caps with each well containing 25 .mu.l of reaction mix consisting of 12.5 .mu.l of 2.times. TaqMan.RTM. Gene Expression Master Mix (Applied Biosystems, Foster City, Calif.), 7.5 .mu.l of forward, reverse, and dual-labeled probe mix (oligonucleotides purchased individually from Integrated DNA Technologies, Coralville, Iowa), and 5 .mu.l cDNA template. The mixture was incubated in the 7900HT Fast Real-Time PCR System (Applied Biosystems), using the 9600 emulation mode protocol (50.degree. C. for 2 min, 95.degree. C. for 10 min, then cycled for a total of 45 cycles at 95.degree. C. for 15 sec and 60.degree. C. for 60 sec). Data were collected and analyzed using the Applied Biosystems Sequence Detection System Software, Versions 2.2 or 2.3.

[0115] The Novagen double-stranded DNA plasmid vector pET9a (EMD Chemicals) was used to quantitate kanR cDNA levels. The pET9a vector contains the kanR coding sequence (bases 3523-4335) and has 100% sequence homology at each primer/probe binding site with the Promega 1.2-kb kanR RNA. Purified and quantitated pET9a DNA vector was initially diluted to 1.times.10.sup.9 copies/.mu.l stock aliquots and stored at -20.degree. C. For each run, fresh stocks were thawed and then serially diluted to generate a quantitative standard curve used in qPCR. Cycle threshold results for cDNA samples were then plotted against the standard curve to determine copy numbers equivalents.

[0116] Primers used were:

TABLE-US-00003 P078 Kanamycin RT-1107R SEQ ID NO: 29 5'-GGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAAC- 3'; (Tm = 80 C.)

primer sets nt 188-257:

TABLE-US-00004 Forward-P029 kan-188F: SEQ ID NO: 30 5'-GGGTATAAATGGGCTCGCG-3'; Reverse-P030 kan-257R: SEQ ID NO: 31 5'-CGGGCTTCCCATACAATCG-3'; Taqman Probe-P031 kan-213T: SEQ ID NO: 32 5'(6-carboxyfluorescein (6FAM))- TCGGGCAATCAGGTGCGACAATC-3'; (Iowa Black FQ; a dark non-fluorescent quencher); Amplicon 70 bp: SEQ ID NO: 33 5'GGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAAT CTATCGATTGTATGGGAAGCCCG-3';

Primer Set (nt 562-634):

TABLE-US-00005 [0117] Forward-P001 kan-562F: SEQ ID NO: 34 5'-CGCTCAGGCGCAATCAC-3'; Reverse-P002 kan-634R: SEQ ID NO: 35 5'-CCAGCCATTACGCTCGTCAT-3'; Taqman Probe-P003 kan-581T: SEQ ID NO: 36 5'(6-FAM)-ATGAATAACGGTTTGGTTGATGCGAGTGA-3'- (TAMRA); Amplicon 73 bp SEQ ID NO: 37 5'CGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGA TTTTGATGACGAGCGTAATGGCTGG-3';

Example 5: Retrohoming Assays

[0118] Retrohoming assays were done in E. coli HMS174(DE3) (Novagen.TM.) grown on LB medium, with antibiotics added at the following concentrations: ampicillin, 100 .mu.g/ml; chloramphenicol, 25 .mu.g/ml; tetracycline, 25 .mu.g/ml. The intron-donor plasmids, derivatives of pACD2X (San Filippo et al., Journal of Molecular Biology, 324, 933-951, 2002), carry a cap.sup.R marker and use a T7lac promoter to express a .DELTA.ORF intron (I-.DELTA.ORF) with short flanking 5' and 3' exons (E1 and E2, respectively) and a T7 promoter in DIV, followed by the RT ORF downstream of E2. The recipient plasmids, derivatives of pBRR-tet (Guo et al., Science 289, 452-457, 2000; Karberg et al., Nature Biotech. 19, 1162-1167, 2001), carry an amp.sup.R marker and contain a target site for the intron (ligated E1-E2 sequences) cloned upstream of a promoterless tet.sup.R gene. The latter is activated by insertion of the intron carrying the T7 promoter, enabling selection for Tet.sup.R+Amp.sup.R colonies. For the assays, cells were co-transformed with the Cap.sup.R donor and Amp.sup.R recipient plasmids, inoculated into 5 ml of LB medium containing chloramphenicol and ampicillin, and grown with shaking (200 rpm) overnight at 37.degree. C. A small portion (50 .mu.l) of the overnight culture was inoculated into 5 ml of fresh LB medium containing the same antibiotics and grown for 1 h as above. The cells were then induced with IPTG for 1 h under conditions specified in the legend of Table 1 for individual experiments. The cultures were then placed on ice, diluted with ice-cold LB, and plated at different dilutions onto LB agar containing ampicillin or ampicillin+tetracycline. After incubating the plates overnight at 37.degree. C., the mobility efficiency was calculated as the ratio of (Tet.sup.R+Amp.sup.R)/Amp.sup.R colonies.

Sequence CWU 1

1

461562PRTThermosynechococcus elongatus 1Met Glu Thr Arg Gln Met Thr Val Asp Gln Thr Thr Gly Ala Val Thr 1 5 10 15 Asn Gln Thr Glu Thr Ser Trp His Ser Ile Asn Trp Thr Lys Ala Asn 20 25 30 Arg Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys Ala Val Lys Glu 35 40 45 Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu Leu Thr His Ser 50 55 60 Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr Asp Asn Ser Gly 65 70 75 80 Ser Arg Thr Pro Gly Val Asp Gly Ile Thr Trp Ser Thr Gln Glu Gln 85 90 95 Lys Thr Gln Ala Ile Lys Ser Leu Arg Arg Arg Gly Tyr Lys Pro Gln 100 105 110 Pro Leu Arg Arg Val Tyr Ile Pro Lys Ala Asn Gly Lys Gln Arg Pro 115 120 125 Leu Gly Ile Pro Thr Met Lys Asp Arg Ala Met Gln Ala Leu Tyr Ala 130 135 140 Leu Ala Leu Glu Pro Val Ala Glu Thr Thr Ala Asp Arg Asn Ser Tyr 145 150 155 160 Gly Phe Arg Arg Gly Arg Cys Thr Ala Asp Ala Ala Gly Gln Cys Phe 165 170 175 Leu Ala Leu Ala Lys Ala Lys Ser Ala Glu His Val Leu Asp Ala Asp 180 185 190 Ile Ser Gly Cys Phe Asp Asn Ile Ser His Glu Trp Leu Leu Ala Asn 195 200 205 Thr Pro Leu Asp Lys Gly Ile Leu Arg Lys Trp Leu Lys Ser Gly Phe 210 215 220 Val Trp Lys Gln Gln Leu Phe Pro Thr His Ala Gly Thr Pro Gln Gly 225 230 235 240 Gly Val Ile Ser Pro Val Leu Ala Asn Ile Thr Leu Asp Gly Met Glu 245 250 255 Glu Leu Leu Ala Lys His Leu Arg Gly Gln Lys Val Asn Leu Ile Arg 260 265 270 Tyr Ala Asp Asp Phe Val Val Thr Gly Lys Asp Glu Glu Thr Leu Glu 275 280 285 Lys Ala Arg Asn Leu Ile Gln Glu Phe Leu Lys Glu Arg Gly Leu Thr 290 295 300 Leu Ser Pro Glu Lys Thr Lys Ile Val His Ile Glu Glu Gly Phe Asp 305 310 315 320 Phe Leu Gly Trp Asn Ile Arg Lys Tyr Asn Gly Val Leu Leu Ile Lys 325 330 335 Pro Ala Lys Lys Asn Val Lys Ala Phe Leu Lys Lys Ile Arg Asp Thr 340 345 350 Leu Arg Glu Leu Arg Thr Ala Thr Gln Glu Ile Val Ile Asp Thr Leu 355 360 365 Asn Pro Ile Ile Arg Gly Trp Ala Asn Tyr His Lys Gly Gln Val Ser 370 375 380 Lys Glu Thr Phe Asn Arg Val Asp Phe Ala Thr Trp His Lys Leu Trp 385 390 395 400 Arg Trp Ala Arg Arg Arg His Pro Asn Lys Pro Ala Gln Trp Val Lys 405 410 415 Asp Lys Tyr Phe Ile Lys Asn Gly Ser Arg Asp Trp Val Phe Gly Met 420 425 430 Val Met Lys Asp Lys Asn Gly Glu Leu Arg Thr Lys Arg Leu Ile Lys 435 440 445 Thr Ser Asp Thr Arg Ile Gln Arg His Val Lys Ile Lys Ala Asp Ala 450 455 460 Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr Phe Glu Lys Arg Lys Lys 465 470 475 480 Leu Lys Lys Ala Pro Ala Gln Tyr Arg Arg Ile Arg Arg Glu Leu Trp 485 490 495 Lys Lys Gln Gly Gly Ile Cys Pro Val Cys Gly Gly Glu Ile Glu Gln 500 505 510 Asp Met Leu Thr Asp Ile His His Ile Leu Pro Lys His Lys Gly Gly 515 520 525 Ser Asp Asp Leu Asp Asn Leu Val Leu Ile His Ala Asn Cys His Lys 530 535 540 Gln Val His Ser Arg Asp Gly Gln His Ser Arg Ser Leu Leu Lys Glu 545 550 555 560 Gly Leu 2562PRTThermosynechococcus elongatus 2Met Glu Thr Arg Gln Met Ala Val Glu Gln Thr Thr Gly Ala Val Thr 1 5 10 15 Asn Gln Thr Glu Thr Ser Trp His Ser Ile Asp Trp Ala Lys Ala Asn 20 25 30 Arg Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys Ala Val Lys Glu 35 40 45 Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu Leu Thr His Ser 50 55 60 Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr Asp Asn Ser Gly 65 70 75 80 Ser Lys Thr Pro Gly Val Asp Gly Ile Thr Trp Ser Thr Gln Glu Gln 85 90 95 Lys Ala Gln Ala Ile Lys Ser Leu Arg Arg Arg Gly Tyr Lys Pro Gln 100 105 110 Pro Leu Arg Arg Val Tyr Ile Pro Lys Ala Asn Gly Lys Gln Arg Pro 115 120 125 Leu Gly Ile Pro Thr Met Lys Asp Arg Ala Met Gln Ala Leu Tyr Ala 130 135 140 Leu Ala Leu Glu Pro Val Ala Glu Thr Thr Ala Asp Arg Asn Ser Tyr 145 150 155 160 Gly Phe Arg Arg Gly Arg Cys Ile Ala Asp Ala Ala Thr Gln Cys His 165 170 175 Ile Thr Leu Ala Lys Thr Asp Arg Ala Gln Tyr Val Leu Asp Ala Asp 180 185 190 Ile Ala Gly Cys Phe Asp Asn Ile Ser His Glu Trp Leu Leu Ala Asn 195 200 205 Ile Pro Leu Asp Lys Arg Ile Leu Arg Lys Trp Leu Lys Ser Gly Phe 210 215 220 Val Trp Lys Gln Gln Leu Phe Pro Ile His Ala Gly Thr Pro Gln Gly 225 230 235 240 Gly Val Ile Ser Pro Met Leu Ala Asn Met Thr Leu Asp Gly Met Glu 245 250 255 Glu Leu Leu Asn Lys Phe Pro Arg Ala His Lys Val Lys Leu Ile Arg 260 265 270 Tyr Ala Asp Asp Phe Val Val Thr Gly Glu Thr Lys Glu Val Leu Tyr 275 280 285 Ile Ala Gly Ala Val Ile Gln Ala Phe Leu Lys Glu Arg Gly Leu Thr 290 295 300 Leu Ser Lys Glu Lys Thr Lys Ile Val His Ile Glu Glu Gly Phe Asp 305 310 315 320 Phe Leu Gly Trp Asn Ile Arg Lys Tyr Asp Gly Lys Leu Leu Ile Lys 325 330 335 Pro Ala Lys Lys Asn Val Lys Ala Phe Leu Lys Lys Ile Arg Asp Thr 340 345 350 Leu Arg Glu Leu Arg Thr Ala Pro Gln Glu Ile Val Ile Asp Thr Leu 355 360 365 Asn Pro Ile Ile Arg Gly Trp Thr Asn Tyr His Lys Asn Gln Ala Ser 370 375 380 Lys Glu Thr Phe Val Gly Val Asp His Leu Ile Trp Gln Lys Leu Trp 385 390 395 400 Arg Trp Ala Arg Arg Arg His Pro Ser Lys Ser Val Arg Trp Val Lys 405 410 415 Ser Lys Tyr Phe Ile Gln Ile Gly Asn Arg Lys Trp Met Phe Gly Ile 420 425 430 Trp Thr Lys Asp Lys Asn Gly Asp Pro Trp Ala Lys His Leu Ile Lys 435 440 445 Ala Ser Glu Ile Arg Ile Gln Arg Arg Gly Lys Ile Lys Ala Asp Ala 450 455 460 Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr Phe Glu Gln Arg Lys Lys 465 470 475 480 Leu Lys Glu Ala Pro Ala Gln Tyr Arg Arg Thr Arg Arg Glu Leu Trp 485 490 495 Lys Lys Gln Gly Gly Ile Cys Pro Val Cys Gly Gly Glu Ile Glu Gln 500 505 510 Asp Met Leu Thr Glu Ile His His Ile Leu Pro Lys His Lys Gly Gly 515 520 525 Thr Asp Asp Leu Asp Asn Leu Val Leu Ile His Thr Asn Cys His Lys 530 535 540 Gln Val His Asn Arg Asp Gly Gln His Ser Arg Phe Leu Leu Lys Glu 545 550 555 560 Gly Leu 3562PRTThermosynechococcus elongatus 3Met Glu Thr Arg Gln Met Ala Val Glu Gln Thr Thr Gly Ala Val Thr 1 5 10 15 Asn Gln Thr Glu Thr Ser Trp His Ser Ile Asp Trp Ala Lys Ala Asn 20 25 30 Arg Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys Ala Val Lys Glu 35 40 45 Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu Leu Thr His Ser 50 55 60 Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr Asp Asn Ser Gly 65 70 75 80 Ser Lys Thr Pro Gly Val Asp Gly Ile Thr Trp Ser Thr Gln Glu Gln 85 90 95 Lys Ala Gln Ala Ile Lys Ser Leu Arg Arg Arg Gly Tyr Lys Pro Gln 100 105 110 Pro Leu Arg Arg Val Tyr Ile Pro Lys Ala Ser Gly Lys Gln Arg Pro 115 120 125 Leu Gly Ile Pro Thr Thr Lys Asp Arg Ala Met Gln Ala Leu Tyr Ala 130 135 140 Leu Ala Leu Glu Pro Val Ala Glu Thr Thr Ala Asp Arg Asn Ser Tyr 145 150 155 160 Gly Phe Arg Gln Gly Arg Cys Thr Ala Asp Ala Ala Gly Gln Cys Phe 165 170 175 Thr Val Leu Gly Arg Ser Asp Cys Ala Lys Tyr Ile Leu Asp Ala Asp 180 185 190 Ile Thr Gly Cys Phe Asp Asn Ile Ser His Glu Trp Leu Leu Asp Asn 195 200 205 Ile Pro Leu Asp Lys Glu Val Leu Arg Lys Trp Leu Lys Ser Gly Phe 210 215 220 Val Trp Lys Gln Gln Leu Phe Pro Thr His Ala Gly Thr Pro Gln Gly 225 230 235 240 Gly Val Ile Ser Pro Met Leu Ala Asn Met Thr Leu Asp Gly Met Glu 245 250 255 Glu Leu Leu Lys Lys His Leu Arg Lys Gln Lys Val Asn Leu Ile Arg 260 265 270 Tyr Ala Asp Asp Phe Val Val Thr Gly Glu Ser Lys Glu Thr Leu Glu 275 280 285 Lys Val Thr Thr Val Ile Gln Glu Phe Leu Lys Glu Arg Gly Leu Thr 290 295 300 Leu Ser Glu Glu Lys Thr Lys Val Val His Ile Glu Glu Gly Phe Asp 305 310 315 320 Phe Leu Gly Trp Asn Ile Arg Lys Tyr Gly Glu Lys Leu Leu Ile Lys 325 330 335 Pro Ala Lys Lys Asn Ile Lys Ala Phe His Lys Lys Ile Arg Asp Ala 340 345 350 Leu Lys Glu Leu Arg Thr Ala Thr Gln Glu Ala Val Ile Asp Thr Leu 355 360 365 Asn Pro Ile Ile Lys Gly Trp Ala Asn Tyr His Arg Asn Gln Val Ser 370 375 380 Lys Arg Ile Phe Asn Arg Ala Asp Asp Asn Ile Trp His Lys Leu Trp 385 390 395 400 Arg Trp Ala Lys Arg Arg His Pro Asn Lys Pro Ala Arg Trp Thr Lys 405 410 415 Asn Lys Tyr Phe Ile Lys Ile Gly Asn Arg His Trp Val Phe Gly Thr 420 425 430 Trp Lys Lys Asp Lys Glu Gly Arg Leu Arg Ser Arg Tyr Leu Ile Lys 435 440 445 Ala Gly Asp Thr Arg Ile Gln Arg His Val Lys Ile Lys Ala Asp Ala 450 455 460 Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr Phe Glu Glu Arg Lys Lys 465 470 475 480 Leu Lys Glu Ala Pro Ala Gln Tyr Arg Arg Ile Arg Arg Glu Leu Trp 485 490 495 Lys Lys Gln Gly Gly Ile Cys Pro Val Cys Gly Gly Glu Ile Glu Gln 500 505 510 Asp Met Leu Thr Glu Ile His His Ile Leu Pro Lys His Lys Gly Gly 515 520 525 Ser Asp Asp Leu Asp Asn Leu Val Leu Ile His Ala Asn Cys His Lys 530 535 540 Gln Val His Ser Arg Asp Gly Gln His Ser Arg Phe Leu Leu Lys Glu 545 550 555 560 Gly Leu 4635PRTGeobacillus stearothermophilus 4Met Lys Val Asn Lys Leu Val Val Lys Ser Glu Gln Asp Leu Arg Asn 1 5 10 15 Cys Leu Asp Leu Leu Tyr Gln Glu Ala Lys Lys Gly Lys His Phe Tyr 20 25 30 Gly Met Leu Glu Leu Leu Gln Asn Asp Val Val Ile Leu Glu Ala Ile 35 40 45 Arg Asn Ile Lys Ser Asn Lys Gly Ser Lys Thr Ala Gly Ile Asp Gln 50 55 60 Lys Ile Val Asp Asp Tyr Leu Leu Met Pro Thr Glu Lys Val Phe Gly 65 70 75 80 Met Ile Lys Ala Lys Leu Asn Asp Tyr Lys Pro Ile Pro Val Arg Arg 85 90 95 Cys Asn Lys Pro Lys Gly Asn Ala Lys Ser Ser Lys Arg Lys Gly Asn 100 105 110 Ser Pro Asn Glu Glu Gly Glu Thr Arg Pro Leu Gly Ile Ser Ala Val 115 120 125 Thr Asp Arg Ile Ile Gln Glu Met Leu Arg Ile Val Leu Glu Pro Ile 130 135 140 Phe Glu Ala Gln Phe Tyr Pro His Ser Tyr Gly Phe Arg Pro Tyr Arg 145 150 155 160 Ser Thr Glu His Ala Leu Ala Trp Met Leu Lys Ile Ile Asn Gly Ser 165 170 175 Lys Leu Tyr Trp Val Val Lys Gly Asp Ile Glu Ser Tyr Phe Asp His 180 185 190 Ile Asn His Lys Lys Leu Leu Asn Ile Met Trp Asn Met Gly Val Arg 195 200 205 Asp Lys Arg Val Leu Cys Ile Val Lys Lys Met Leu Lys Ala Gly Gln 210 215 220 Val Ile Gln Gly Lys Phe Tyr Pro Thr Ala Lys Gly Ile Pro Gln Gly 225 230 235 240 Gly Ile Ile Ser Pro Leu Leu Ala Asn Val Tyr Leu Asn Ser Phe Asp 245 250 255 Trp Met Val Gly Gln Glu Tyr Glu Tyr His Pro Asn Asn Ala Asn Tyr 260 265 270 Arg Glu Lys Lys Asn Ala Leu Ala Ala Leu Arg Asn Lys Gly His His 275 280 285 Pro Val Phe Tyr Ile Arg Tyr Ala Asp Asp Trp Val Ile Leu Thr Asp 290 295 300 Thr Lys Glu Tyr Ala Glu Lys Ile Arg Glu Gln Cys Lys Gln Tyr Leu 305 310 315 320 Ala Cys Glu Leu His Leu Thr Leu Ser Asp Glu Lys Thr Phe Ile Ala 325 330 335 Asp Ile Arg Glu Gln Arg Val Lys Phe Leu Gly Phe Cys Ile Glu Ala 340 345 350 Gly Lys Arg Arg Phe His Lys Lys Gly Phe Ala Ala Arg Met Ile Pro 355 360 365 Asp Met Glu Lys Val Asn Ala Lys Val Lys Glu Ile Lys Arg Asp Ile 370 375 380 Arg Leu Leu Arg Thr Arg Lys Ser Glu Leu Glu Lys Ala Leu Asp Ile 385 390 395 400 Glu Asn Ile Asn Thr Lys Ile Ile Gly Leu Ala Asn His Leu Lys Ile 405 410 415 Gly Ile Ser Lys Tyr Ile Met Gly Lys Val Asp Arg Val Ile Glu Glu 420 425 430 Thr Ala Tyr Arg Thr Trp Val Lys Met Tyr Gly Lys Glu Lys Ala Ala 435 440 445 Gln Tyr Lys Arg Pro Val Ser Glu Phe His Asn Arg Ile Asp Arg His 450 455 460 Lys Gly Tyr Gln Met Lys His Phe Ser Val Val Thr Glu Asp Gly Ile 465 470 475 480 Arg Val Gly Ile Thr His Ala Lys Ile Thr Pro Ile Gln Tyr Ala Thr 485 490 495 Val Phe Lys Gln Glu Met Thr Pro Tyr Thr Ala Asp Gly Arg Lys Met 500 505 510 Tyr Glu Glu Lys His Arg Lys Ile Arg Leu Pro Asp Lys Met Ser Leu 515 520 525 Phe Asp His Asp Ser Ile Phe Ile Tyr Ile Leu Ser Glu His Asn Asp 530 535 540 Gly Lys Tyr Asn Leu Glu Tyr Phe Leu Asn Arg Val Asn Val Phe His 545 550 555 560 Arg Asp Lys Gly Lys Cys Lys Ile Cys Ala Val Tyr Leu Ser Pro Gly 565 570 575 Asn Phe His Cys His His Ile Asp Pro Ser Lys Pro Leu Ser Glu Ile 580 585 590 Asn Lys Thr Val Asn Leu Ile Ser Leu Cys Asn Gln Cys His Arg Leu 595

600 605 Val His Ser Asn Gln Glu Pro Pro Phe Thr Glu Arg Lys Met Phe Asp 610 615 620 Lys Leu Thr Lys Tyr Arg Asn Lys Leu Lys Ile 625 630 635 5420PRTGeobacillus stearothermophilus 5Met Ala Leu Leu Glu Arg Ile Leu Ala Arg Asp Asn Leu Ile Thr Ala 1 5 10 15 Leu Lys Arg Val Glu Ala Asn Gln Gly Ala Pro Gly Ile Asp Gly Val 20 25 30 Ser Thr Asp Gln Leu Arg Asp Tyr Ile Arg Ala His Trp Ser Thr Ile 35 40 45 His Ala Gln Leu Leu Ala Gly Thr Tyr Arg Pro Ala Pro Val Arg Arg 50 55 60 Val Glu Ile Pro Lys Pro Gly Gly Gly Thr Arg Gln Leu Gly Ile Pro 65 70 75 80 Thr Val Val Asp Arg Leu Ile Gln Gln Ala Ile Leu Gln Glu Leu Thr 85 90 95 Pro Ile Phe Asp Pro Asp Phe Ser Ser Ser Ser Phe Gly Phe Arg Pro 100 105 110 Gly Arg Asn Ala His Asp Ala Val Arg Gln Ala Gln Gly Tyr Ile Gln 115 120 125 Glu Gly Tyr Arg Tyr Val Val Asp Met Asp Leu Glu Lys Phe Phe Asp 130 135 140 Arg Val Asn His Asp Ile Leu Met Ser Arg Val Ala Arg Lys Val Lys 145 150 155 160 Asp Lys Arg Val Leu Lys Leu Ile Arg Ala Tyr Leu Gln Ala Gly Val 165 170 175 Met Ile Glu Gly Val Lys Val Gln Thr Glu Glu Gly Thr Pro Gln Gly 180 185 190 Gly Pro Leu Ser Pro Leu Leu Ala Asn Ile Leu Leu Asp Asp Leu Asp 195 200 205 Lys Glu Leu Glu Lys Arg Gly Leu Lys Phe Cys Arg Tyr Ala Asp Asp 210 215 220 Cys Asn Ile Tyr Val Lys Ser Leu Arg Ala Gly Gln Arg Val Lys Gln 225 230 235 240 Ser Ile Gln Arg Phe Leu Glu Lys Thr Leu Lys Leu Lys Val Asn Glu 245 250 255 Glu Lys Ser Ala Val Asp Arg Pro Trp Lys Arg Ala Phe Leu Gly Phe 260 265 270 Ser Phe Thr Pro Glu Arg Lys Ala Arg Ile Arg Leu Ala Pro Arg Ser 275 280 285 Ile Gln Arg Leu Lys Gln Arg Ile Arg Gln Leu Thr Asn Pro Asn Trp 290 295 300 Ser Ile Ser Met Pro Glu Arg Ile His Arg Val Asn Gln Tyr Val Met 305 310 315 320 Gly Trp Ile Gly Tyr Phe Arg Leu Val Glu Thr Pro Ser Val Leu Gln 325 330 335 Thr Ile Glu Gly Trp Ile Arg Arg Arg Leu Arg Leu Cys Gln Trp Leu 340 345 350 Gln Trp Lys Arg Val Arg Thr Arg Ile Arg Glu Leu Arg Ala Leu Gly 355 360 365 Leu Lys Glu Thr Ala Val Met Glu Ile Ala Asn Thr Arg Lys Gly Ala 370 375 380 Trp Arg Thr Thr Lys Thr Pro Gln Leu His Gln Ala Leu Gly Lys Thr 385 390 395 400 Tyr Trp Thr Ala Gln Gly Leu Lys Ser Leu Thr Gln Arg Tyr Phe Glu 405 410 415 Leu Arg Gln Gly 420 6934PRTArtificial SequenceDescription of Artificial Sequence Synthetic polypeptide 6Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala 355 360 365 Ala Ala Ala Ala Met Glu Thr Arg Gln Met Thr Val Asp Gln Thr Thr 370 375 380 Gly Ala Val Thr Asn Gln Thr Glu Thr Ser Trp His Ser Ile Asn Trp 385 390 395 400 Thr Lys Ala Asn Arg Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys 405 410 415 Ala Val Lys Glu Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu 420 425 430 Leu Thr His Ser Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr 435 440 445 Asp Asn Ser Gly Ser Arg Thr Pro Gly Val Asp Gly Ile Thr Trp Ser 450 455 460 Thr Gln Glu Gln Lys Thr Gln Ala Ile Lys Ser Leu Arg Arg Arg Gly 465 470 475 480 Tyr Lys Pro Gln Pro Leu Arg Arg Val Tyr Ile Pro Lys Ala Asn Gly 485 490 495 Lys Gln Arg Pro Leu Gly Ile Pro Thr Met Lys Asp Arg Ala Met Gln 500 505 510 Ala Leu Tyr Ala Leu Ala Leu Glu Pro Val Ala Glu Thr Thr Ala Asp 515 520 525 Arg Asn Ser Tyr Gly Phe Arg Arg Gly Arg Cys Thr Ala Asp Ala Ala 530 535 540 Gly Gln Cys Phe Leu Ala Leu Ala Lys Ala Lys Ser Ala Glu His Val 545 550 555 560 Leu Asp Ala Asp Ile Ser Gly Cys Phe Asp Asn Ile Ser His Glu Trp 565 570 575 Leu Leu Ala Asn Thr Pro Leu Asp Lys Gly Ile Leu Arg Lys Trp Leu 580 585 590 Lys Ser Gly Phe Val Trp Lys Gln Gln Leu Phe Pro Thr His Ala Gly 595 600 605 Thr Pro Gln Gly Gly Val Ile Ser Pro Val Leu Ala Asn Ile Thr Leu 610 615 620 Asp Gly Met Glu Glu Leu Leu Ala Lys His Leu Arg Gly Gln Lys Val 625 630 635 640 Asn Leu Ile Arg Tyr Ala Asp Asp Phe Val Val Thr Gly Lys Asp Glu 645 650 655 Glu Thr Leu Glu Lys Ala Arg Asn Leu Ile Gln Glu Phe Leu Lys Glu 660 665 670 Arg Gly Leu Thr Leu Ser Pro Glu Lys Thr Lys Ile Val His Ile Glu 675 680 685 Glu Gly Phe Asp Phe Leu Gly Trp Asn Ile Arg Lys Tyr Asn Gly Val 690 695 700 Leu Leu Ile Lys Pro Ala Lys Lys Asn Val Lys Ala Phe Leu Lys Lys 705 710 715 720 Ile Arg Asp Thr Leu Arg Glu Leu Arg Thr Ala Thr Gln Glu Ile Val 725 730 735 Ile Asp Thr Leu Asn Pro Ile Ile Arg Gly Trp Ala Asn Tyr His Lys 740 745 750 Gly Gln Val Ser Lys Glu Thr Phe Asn Arg Val Asp Phe Ala Thr Trp 755 760 765 His Lys Leu Trp Arg Trp Ala Arg Arg Arg His Pro Asn Lys Pro Ala 770 775 780 Gln Trp Val Lys Asp Lys Tyr Phe Ile Lys Asn Gly Ser Arg Asp Trp 785 790 795 800 Val Phe Gly Met Val Met Lys Asp Lys Asn Gly Glu Leu Arg Thr Lys 805 810 815 Arg Leu Ile Lys Thr Ser Asp Thr Arg Ile Gln Arg His Val Lys Ile 820 825 830 Lys Ala Asp Ala Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr Phe Glu 835 840 845 Lys Arg Lys Lys Leu Lys Lys Ala Pro Ala Gln Tyr Arg Arg Ile Arg 850 855 860 Arg Glu Leu Trp Lys Lys Gln Gly Gly Ile Cys Pro Val Cys Gly Gly 865 870 875 880 Glu Ile Glu Gln Asp Met Leu Thr Asp Ile His His Ile Leu Pro Lys 885 890 895 His Lys Gly Gly Ser Asp Asp Leu Asp Asn Leu Val Leu Ile His Ala 900 905 910 Asn Cys His Lys Gln Val His Ser Arg Asp Gly Gln His Ser Arg Ser 915 920 925 Leu Leu Lys Glu Gly Leu 930 7934PRTArtificial SequenceDescription of Artificial Sequence Synthetic polypeptide 7Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala 355 360 365 Ala Ala Ala Ala Met Glu Thr Arg Gln Met Ala Val Glu Gln Thr Thr 370 375 380 Gly Ala Val Thr Asn Gln Thr Glu Thr Ser Trp His Ser Ile Asp Trp 385 390 395 400 Ala Lys Ala Asn Arg Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys 405 410 415 Ala Val Lys Glu Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu 420 425 430 Leu Thr His Ser Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr 435 440 445 Asp Asn Ser Gly Ser Lys Thr Pro Gly Val Asp Gly Ile Thr Trp Ser 450 455 460 Thr Gln Glu Gln Lys Ala Gln Ala Ile Lys Ser Leu Arg Arg Arg Gly 465 470 475 480 Tyr Lys Pro Gln Pro Leu Arg Arg Val Tyr Ile Pro Lys Ala Asn Gly 485 490 495 Lys Gln Arg Pro Leu Gly Ile Pro Thr Met Lys Asp Arg Ala Met Gln 500 505 510 Ala Leu Tyr Ala Leu Ala Leu Glu Pro Val Ala Glu Thr Thr Ala Asp 515 520 525 Arg Asn Ser Tyr Gly Phe Arg Arg Gly Arg Cys Ile Ala Asp Ala Ala 530 535 540 Thr Gln Cys His Ile Thr Leu Ala Lys Thr Asp Arg Ala Gln Tyr Val 545 550 555 560 Leu Asp Ala Asp Ile Ala Gly Cys Phe Asp Asn Ile Ser His Glu Trp 565 570 575 Leu Leu Ala Asn Ile Pro Leu Asp Lys Arg Ile Leu Arg Lys Trp Leu 580 585 590 Lys Ser Gly Phe Val Trp Lys Gln Gln Leu Phe Pro Ile His Ala Gly 595 600 605 Thr Pro Gln Gly Gly Val Ile Ser Pro Met Leu Ala Asn Met Thr Leu 610 615 620 Asp Gly Met Glu Glu Leu Leu Asn Lys Phe Pro Arg Ala His Lys Val 625 630 635 640 Lys Leu Ile Arg Tyr Ala Asp Asp Phe Val Val Thr Gly Glu Thr Lys 645 650 655 Glu Val Leu Tyr Ile Ala Gly Ala Val Ile Gln Ala Phe Leu Lys Glu 660 665 670 Arg Gly Leu Thr Leu Ser Lys Glu Lys Thr Lys Ile Val His Ile Glu 675 680 685 Glu Gly Phe Asp Phe Leu Gly Trp Asn Ile Arg Lys Tyr Asp Gly Lys 690 695 700 Leu Leu Ile Lys Pro Ala Lys Lys Asn Val Lys Ala Phe Leu Lys Lys 705 710 715 720 Ile Arg Asp Thr Leu Arg Glu Leu Arg Thr Ala Pro Gln Glu Ile Val 725 730 735 Ile Asp Thr Leu Asn Pro Ile Ile Arg Gly Trp Thr Asn Tyr His Lys 740 745 750 Asn Gln Ala Ser Lys Glu Thr Phe Val Gly Val Asp His Leu Ile Trp 755 760 765 Gln Lys Leu Trp Arg Trp Ala Arg Arg Arg His Pro Ser Lys Ser Val 770 775 780 Arg Trp Val Lys Ser Lys Tyr Phe Ile Gln Ile Gly Asn Arg Lys Trp 785 790 795 800 Met Phe Gly Ile Trp Thr Lys Asp Lys Asn Gly Asp Pro Trp Ala Lys 805 810 815 His Leu Ile Lys Ala Ser Glu Ile Arg Ile Gln Arg Arg Gly Lys Ile 820 825 830 Lys Ala Asp Ala Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr Phe Glu 835 840 845 Gln Arg Lys Lys Leu Lys Glu Ala Pro Ala Gln Tyr Arg Arg Thr Arg 850 855 860 Arg Glu Leu Trp Lys Lys Gln Gly Gly Ile Cys Pro Val Cys Gly Gly 865 870 875 880 Glu Ile Glu Gln Asp Met Leu Thr Glu Ile His His Ile Leu Pro Lys

885 890 895 His Lys Gly Gly Thr Asp Asp Leu Asp Asn Leu Val Leu Ile His Thr 900 905 910 Asn Cys His Lys Gln Val His Asn Arg Asp Gly Gln His Ser Arg Phe 915 920 925 Leu Leu Lys Glu Gly Leu 930 8934PRTArtificial SequenceDescription of Artificial Sequence Synthetic polypeptide 8Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala 355 360 365 Ala Ala Ala Ala Met Glu Thr Arg Gln Met Ala Val Glu Gln Thr Thr 370 375 380 Gly Ala Val Thr Asn Gln Thr Glu Thr Ser Trp His Ser Ile Asp Trp 385 390 395 400 Ala Lys Ala Asn Arg Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys 405 410 415 Ala Val Lys Glu Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu 420 425 430 Leu Thr His Ser Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr 435 440 445 Asp Asn Ser Gly Ser Lys Thr Pro Gly Val Asp Gly Ile Thr Trp Ser 450 455 460 Thr Gln Glu Gln Lys Ala Gln Ala Ile Lys Ser Leu Arg Arg Arg Gly 465 470 475 480 Tyr Lys Pro Gln Pro Leu Arg Arg Val Tyr Ile Pro Lys Ala Ser Gly 485 490 495 Lys Gln Arg Pro Leu Gly Ile Pro Thr Thr Lys Asp Arg Ala Met Gln 500 505 510 Ala Leu Tyr Ala Leu Ala Leu Glu Pro Val Ala Glu Thr Thr Ala Asp 515 520 525 Arg Asn Ser Tyr Gly Phe Arg Gln Gly Arg Cys Thr Ala Asp Ala Ala 530 535 540 Gly Gln Cys Phe Thr Val Leu Gly Arg Ser Asp Cys Ala Lys Tyr Ile 545 550 555 560 Leu Asp Ala Asp Ile Thr Gly Cys Phe Asp Asn Ile Ser His Glu Trp 565 570 575 Leu Leu Asp Asn Ile Pro Leu Asp Lys Glu Val Leu Arg Lys Trp Leu 580 585 590 Lys Ser Gly Phe Val Trp Lys Gln Gln Leu Phe Pro Thr His Ala Gly 595 600 605 Thr Pro Gln Gly Gly Val Ile Ser Pro Met Leu Ala Asn Met Thr Leu 610 615 620 Asp Gly Met Glu Glu Leu Leu Lys Lys His Leu Arg Lys Gln Lys Val 625 630 635 640 Asn Leu Ile Arg Tyr Ala Asp Asp Phe Val Val Thr Gly Glu Ser Lys 645 650 655 Glu Thr Leu Glu Lys Val Thr Thr Val Ile Gln Glu Phe Leu Lys Glu 660 665 670 Arg Gly Leu Thr Leu Ser Glu Glu Lys Thr Lys Val Val His Ile Glu 675 680 685 Glu Gly Phe Asp Phe Leu Gly Trp Asn Ile Arg Lys Tyr Gly Glu Lys 690 695 700 Leu Leu Ile Lys Pro Ala Lys Lys Asn Ile Lys Ala Phe His Lys Lys 705 710 715 720 Ile Arg Asp Ala Leu Lys Glu Leu Arg Thr Ala Thr Gln Glu Ala Val 725 730 735 Ile Asp Thr Leu Asn Pro Ile Ile Lys Gly Trp Ala Asn Tyr His Arg 740 745 750 Asn Gln Val Ser Lys Arg Ile Phe Asn Arg Ala Asp Asp Asn Ile Trp 755 760 765 His Lys Leu Trp Arg Trp Ala Lys Arg Arg His Pro Asn Lys Pro Ala 770 775 780 Arg Trp Thr Lys Asn Lys Tyr Phe Ile Lys Ile Gly Asn Arg His Trp 785 790 795 800 Val Phe Gly Thr Trp Lys Lys Asp Lys Glu Gly Arg Leu Arg Ser Arg 805 810 815 Tyr Leu Ile Lys Ala Gly Asp Thr Arg Ile Gln Arg His Val Lys Ile 820 825 830 Lys Ala Asp Ala Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr Phe Glu 835 840 845 Glu Arg Lys Lys Leu Lys Glu Ala Pro Ala Gln Tyr Arg Arg Ile Arg 850 855 860 Arg Glu Leu Trp Lys Lys Gln Gly Gly Ile Cys Pro Val Cys Gly Gly 865 870 875 880 Glu Ile Glu Gln Asp Met Leu Thr Glu Ile His His Ile Leu Pro Lys 885 890 895 His Lys Gly Gly Ser Asp Asp Leu Asp Asn Leu Val Leu Ile His Ala 900 905 910 Asn Cys His Lys Gln Val His Ser Arg Asp Gly Gln His Ser Arg Phe 915 920 925 Leu Leu Lys Glu Gly Leu 930 91007PRTArtificial SequenceDescription of Artificial Sequence Synthetic polypeptide 9Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala 355 360 365 Ala Ala Ala Ala Met Lys Val Asn Lys Leu Val Val Lys Ser Glu Gln 370 375 380 Asp Leu Arg Asn Cys Leu Asp Leu Leu Tyr Gln Glu Ala Lys Lys Gly 385 390 395 400 Lys His Phe Tyr Gly Met Leu Glu Leu Leu Gln Asn Asp Val Val Ile 405 410 415 Leu Glu Ala Ile Arg Asn Ile Lys Ser Asn Lys Gly Ser Lys Thr Ala 420 425 430 Gly Ile Asp Gln Lys Ile Val Asp Asp Tyr Leu Leu Met Pro Thr Glu 435 440 445 Lys Val Phe Gly Met Ile Lys Ala Lys Leu Asn Asp Tyr Lys Pro Ile 450 455 460 Pro Val Arg Arg Cys Asn Lys Pro Lys Gly Asn Ala Lys Ser Ser Lys 465 470 475 480 Arg Lys Gly Asn Ser Pro Asn Glu Glu Gly Glu Thr Arg Pro Leu Gly 485 490 495 Ile Ser Ala Val Thr Asp Arg Ile Ile Gln Glu Met Leu Arg Ile Val 500 505 510 Leu Glu Pro Ile Phe Glu Ala Gln Phe Tyr Pro His Ser Tyr Gly Phe 515 520 525 Arg Pro Tyr Arg Ser Thr Glu His Ala Leu Ala Trp Met Leu Lys Ile 530 535 540 Ile Asn Gly Ser Lys Leu Tyr Trp Val Val Lys Gly Asp Ile Glu Ser 545 550 555 560 Tyr Phe Asp His Ile Asn His Lys Lys Leu Leu Asn Ile Met Trp Asn 565 570 575 Met Gly Val Arg Asp Lys Arg Val Leu Cys Ile Val Lys Lys Met Leu 580 585 590 Lys Ala Gly Gln Val Ile Gln Gly Lys Phe Tyr Pro Thr Ala Lys Gly 595 600 605 Ile Pro Gln Gly Gly Ile Ile Ser Pro Leu Leu Ala Asn Val Tyr Leu 610 615 620 Asn Ser Phe Asp Trp Met Val Gly Gln Glu Tyr Glu Tyr His Pro Asn 625 630 635 640 Asn Ala Asn Tyr Arg Glu Lys Lys Asn Ala Leu Ala Ala Leu Arg Asn 645 650 655 Lys Gly His His Pro Val Phe Tyr Ile Arg Tyr Ala Asp Asp Trp Val 660 665 670 Ile Leu Thr Asp Thr Lys Glu Tyr Ala Glu Lys Ile Arg Glu Gln Cys 675 680 685 Lys Gln Tyr Leu Ala Cys Glu Leu His Leu Thr Leu Ser Asp Glu Lys 690 695 700 Thr Phe Ile Ala Asp Ile Arg Glu Gln Arg Val Lys Phe Leu Gly Phe 705 710 715 720 Cys Ile Glu Ala Gly Lys Arg Arg Phe His Lys Lys Gly Phe Ala Ala 725 730 735 Arg Met Ile Pro Asp Met Glu Lys Val Asn Ala Lys Val Lys Glu Ile 740 745 750 Lys Arg Asp Ile Arg Leu Leu Arg Thr Arg Lys Ser Glu Leu Glu Lys 755 760 765 Ala Leu Asp Ile Glu Asn Ile Asn Thr Lys Ile Ile Gly Leu Ala Asn 770 775 780 His Leu Lys Ile Gly Ile Ser Lys Tyr Ile Met Gly Lys Val Asp Arg 785 790 795 800 Val Ile Glu Glu Thr Ala Tyr Arg Thr Trp Val Lys Met Tyr Gly Lys 805 810 815 Glu Lys Ala Ala Gln Tyr Lys Arg Pro Val Ser Glu Phe His Asn Arg 820 825 830 Ile Asp Arg His Lys Gly Tyr Gln Met Lys His Phe Ser Val Val Thr 835 840 845 Glu Asp Gly Ile Arg Val Gly Ile Thr His Ala Lys Ile Thr Pro Ile 850 855 860 Gln Tyr Ala Thr Val Phe Lys Gln Glu Met Thr Pro Tyr Thr Ala Asp 865 870 875 880 Gly Arg Lys Met Tyr Glu Glu Lys His Arg Lys Ile Arg Leu Pro Asp 885 890 895 Lys Met Ser Leu Phe Asp His Asp Ser Ile Phe Ile Tyr Ile Leu Ser 900 905 910 Glu His Asn Asp Gly Lys Tyr Asn Leu Glu Tyr Phe Leu Asn Arg Val 915 920 925 Asn Val Phe His Arg Asp Lys Gly Lys Cys Lys Ile Cys Ala Val Tyr 930 935 940 Leu Ser Pro Gly Asn Phe His Cys His His Ile Asp Pro Ser Lys Pro 945 950 955 960 Leu Ser Glu Ile Asn Lys Thr Val Asn Leu Ile Ser Leu Cys Asn Gln 965 970 975 Cys His Arg Leu Val His Ser Asn Gln Glu Pro Pro Phe Thr Glu Arg 980 985 990 Lys Met Phe Asp Lys Leu Thr Lys Tyr Arg Asn Lys Leu Lys Ile 995 1000 1005 10792PRTArtificial SequenceDescription of Artificial Sequence Synthetic polypeptide 10Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275

280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala 355 360 365 Ala Ala Ala Ala Met Ala Leu Leu Glu Arg Ile Leu Ala Arg Asp Asn 370 375 380 Leu Ile Thr Ala Leu Lys Arg Val Glu Ala Asn Gln Gly Ala Pro Gly 385 390 395 400 Ile Asp Gly Val Ser Thr Asp Gln Leu Arg Asp Tyr Ile Arg Ala His 405 410 415 Trp Ser Thr Ile His Ala Gln Leu Leu Ala Gly Thr Tyr Arg Pro Ala 420 425 430 Pro Val Arg Arg Val Glu Ile Pro Lys Pro Gly Gly Gly Thr Arg Gln 435 440 445 Leu Gly Ile Pro Thr Val Val Asp Arg Leu Ile Gln Gln Ala Ile Leu 450 455 460 Gln Glu Leu Thr Pro Ile Phe Asp Pro Asp Phe Ser Ser Ser Ser Phe 465 470 475 480 Gly Phe Arg Pro Gly Arg Asn Ala His Asp Ala Val Arg Gln Ala Gln 485 490 495 Gly Tyr Ile Gln Glu Gly Tyr Arg Tyr Val Val Asp Met Asp Leu Glu 500 505 510 Lys Phe Phe Asp Arg Val Asn His Asp Ile Leu Met Ser Arg Val Ala 515 520 525 Arg Lys Val Lys Asp Lys Arg Val Leu Lys Leu Ile Arg Ala Tyr Leu 530 535 540 Gln Ala Gly Val Met Ile Glu Gly Val Lys Val Gln Thr Glu Glu Gly 545 550 555 560 Thr Pro Gln Gly Gly Pro Leu Ser Pro Leu Leu Ala Asn Ile Leu Leu 565 570 575 Asp Asp Leu Asp Lys Glu Leu Glu Lys Arg Gly Leu Lys Phe Cys Arg 580 585 590 Tyr Ala Asp Asp Cys Asn Ile Tyr Val Lys Ser Leu Arg Ala Gly Gln 595 600 605 Arg Val Lys Gln Ser Ile Gln Arg Phe Leu Glu Lys Thr Leu Lys Leu 610 615 620 Lys Val Asn Glu Glu Lys Ser Ala Val Asp Arg Pro Trp Lys Arg Ala 625 630 635 640 Phe Leu Gly Phe Ser Phe Thr Pro Glu Arg Lys Ala Arg Ile Arg Leu 645 650 655 Ala Pro Arg Ser Ile Gln Arg Leu Lys Gln Arg Ile Arg Gln Leu Thr 660 665 670 Asn Pro Asn Trp Ser Ile Ser Met Pro Glu Arg Ile His Arg Val Asn 675 680 685 Gln Tyr Val Met Gly Trp Ile Gly Tyr Phe Arg Leu Val Glu Thr Pro 690 695 700 Ser Val Leu Gln Thr Ile Glu Gly Trp Ile Arg Arg Arg Leu Arg Leu 705 710 715 720 Cys Gln Trp Leu Gln Trp Lys Arg Val Arg Thr Arg Ile Arg Glu Leu 725 730 735 Arg Ala Leu Gly Leu Lys Glu Thr Ala Val Met Glu Ile Ala Asn Thr 740 745 750 Arg Lys Gly Ala Trp Arg Thr Thr Lys Thr Pro Gln Leu His Gln Ala 755 760 765 Leu Gly Lys Thr Tyr Trp Thr Ala Gln Gly Leu Lys Ser Leu Thr Gln 770 775 780 Arg Tyr Phe Glu Leu Arg Gln Gly 785 790 11367PRTArtificial SequenceDescription of Artificial Sequence Synthetic polypeptide 11Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr 355 360 365 125PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 12Ala Ala Ala Ala Ala 1 5 138260DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 13ccgacaccat cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga 60gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg 120gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa 180cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac 240aacaactggc gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc 420ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca 480ttgctgtgga agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga 540cacccatcaa cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag 720cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga 780atgagggcat cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa 840tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga tatctcggta gtgggatacg 900acgataccga agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga 1020agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata 1080cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt 1140cccgactgga aagcgggcag tgagcgcaac gcaattaatg taagttagct cactcattag 1200gcacaattct catgtttgac agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg 1320tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat cataacggtt 1380ctggcaaata ttctgaaatg agctgttgac aattaatcat cggctcgtat aatgtgtgga 1440attgtgagcg gataacaatt tcacacagga aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc aacaaggacc atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560attaacggcg ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat 1620accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt cccacaggtt 1680gcggcaactg gcgatggccc tgacattatc ttctgggcac acgaccgctt tggtggctac 1740gctcaatctg gcctgttggc tgaaatcacc ccggacaaag cgttccagga caagctgtat 1800ccgtttacct gggatgccgt acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860gaagcgttat cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa 1920gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct gatgttcaac 1980ctgcaagaac cgtacttcac ctggccgctg attgctgctg acgggggtta tgcgttcaag 2040tatgaaaacg gcaagtacga cattaaagac gtgggcgtgg ataacgctgg cgcgaaagcg 2100ggtctgacct tcctggttga cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160tccatcgcag aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg 2220gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact gccgaccttc 2280aagggtcaac catccaaacc gttcgttggc gtgctgagcg caggtattaa cgccgccagt 2340ccgaacaaag agctggcaaa agagttcctc gaaaactatc tgctgactga tgaaggtctg 2400gaagcggtta ataaagacaa accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460ttggcgaaag atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg 2520ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt gatcaacgcc 2580gccagcggtc gtcagactgt cgatgccgcc ctggccgccg cgcagactgc cgccgccgcc 2640gccatggaga caaggcaaat gacggtggac caaaccactg gtgcggtcac caaccaaacg 2700gaaacaagct ggcacagcat aaactggacc aaagccaacc gtgaggtaaa gaggctgcaa 2760gtgcgtatcg caaaggctgt gaaggaagga cgctggggca aagtgaaagc tttgcaatgg 2820ctcctgaccc actcgttcta cggcaaagcc ctcgccgtga aacgggtaac tgacaactca 2880ggcagtagaa cacctggtgt ggacgggata acctggtcca cacaagagca gaaaacccaa 2940gccataaagt ccctcaggag aagaggctat aaaccccaac ccctgaggcg ggtatacatc 3000ccgaaagcaa acggcaaaca gcgcccgcta ggaatcccga caatgaagga cagggcaatg 3060caggcactat atgccctagc cctagaacca gtcgcggaaa ccacagcgga ccggaactcc 3120tatgggttcc gccgagggcg atgtacggca gatgcggcag gacaatgctt ccttgctctg 3180gcaaaagcca agtcggctga acacgtcctt gacgctgaca tatccggatg ctttgataac 3240atcagccatg agtggctact agccaacact ccactggaca aagggatctt acggaaatgg 3300cttaaatctg ggttcgtctg gaaacagcaa ctcttcccca cccatgctgg gacacctcag 3360ggaggggtaa tctccccagt tcttgccaat ataaccctag atgggatgga agaactgttg 3420gccaaacacc tcagaggtca aaaagtcaac ctcatccgat atgctgacga ttttgtcgtg 3480acgggaaaag atgaggaaac cctggagaaa gccagaaacc taatccagga gttcctaaaa 3540gaacggggct tgaccctgtc ccccgagaag acaaaaatcg tccatattga ggaaggcttc 3600gactttctcg gatggaacat tcgcaagtac aacggggttc ttctcatcaa acccgcgaag 3660aagaacgtga aagcgttcct caagaaaatc cgagacactc taagggaact taggacagca 3720acccaggaaa tcgtgataga cacactcaac ccaatcatta gaggttgggc caactatcac 3780aaaggacaag tctctaagga aaccttcaac cgagtggact tcgccacctg gcacaaattg 3840tggcgatggg caaggcgccg gcacccaaac aaacctgccc aatgggtgaa ggacaaatac 3900ttcatcaaaa acggaagcag agactgggtg ttcggtatgg tgatgaaaga caagaacggg 3960gaactgagga ccaaacgcct aatcaaaacc tctgacaccc gaatccaacg ccacgtcaaa 4020atcaaggcag acgccaatcc gtttctccca gagtgggcag aatactttga gaaacgcaag 4080aaactcaaaa aagcccctgc tcaatatcgg cgcatccgcc gagaactatg gaagaaacag 4140ggtggtatct gtccagtatg cgggggtgaa attgagcaag acatgctcac tgacatccac 4200cacatattgc ccaaacacaa gggtggttct gacgacctgg ataatcttgt cttaatccac 4260gccaactgcc acaaacaggt gcacagccga gatggtcagc acagccggtc cctcttgaaa 4320gaggggcttt gactgcaggc aagcttggca ctggccgtcg ttttacaacg tcgtgactgg 4380gaaaaccctg gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg 4440cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag cctgaatggc 4500gaatggcagc ttggctgttt tggcggatga gataagattt tcagcctgat acagattaaa 4560tcagaacgca gaagcggtct gataaaacag aatttgcctg gcggcagtag cgcggtggtc 4620ccacctgacc ccatgccgaa ctcagaagtg aaacgccgta gcgccgatgg tagtgtgggg 4680tctccccatg cgagagtagg gaactgccag gcatcaaata aaacgaaagg ctcagtcgaa 4740agactgggcc tttcgtttta tctgttgttt gtcggtgaac gctctcctga gtaggacaaa 4800tccgccggga gcggatttga acgttgcgaa gcaacggccc ggagggtggc gggcaggacg 4860cccgccataa actgccaggc atcaaattaa gcagaaggcc atcctgacgg atggcctttt 4920tgcgtttcta caaactcttt ttgtttattt ttctaaatac attcaaatat gtatccgctc 4980atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt 5040caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct 5100cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt 5160tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt 5220tctccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtgttgac 5280gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac 5340tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct 5400gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg 5460aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg 5520gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca 5580atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa 5640caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt 5700ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc 5760attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg 5820agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt 5880aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaccccgg 5940ttgataatca gaaaagcccc aaaaacagga agattgtata agcaaatatt taaattgtaa 6000acgttaatat tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc 6060aataggccga aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga 6120gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag 6180ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga accatcaccc aaatcaagtt 6240ttttggggtc gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta 6300gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag 6360cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg 6420cgcttaatgc gccgctacag ggcgcgtaaa aggatctagg tgaagatcct ttttgataat 6480ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa 6540aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca 6600aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt 6660ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg 6720tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc 6780ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga 6840cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc 6900agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc 6960gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca 7020ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg 7080tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta 7140tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct 7200cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag 7260tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa 7320gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 7380atatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagtatacac 7440tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa cacccgctga 7500cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc 7560cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga ggcagctgcg 7620gtaaagctca tcagcgtggt cgtgcagcga ttcacagatg tctgcctgtt catccgcgtc 7680cagctcgttg agtttctcca gaagcgttaa tgtctggctt ctgataaagc gggccatgtt 7740aagggcggtt ttttcctgtt tggtcactga tgcctccgtg taagggggat ttctgttcat 7800gggggtaatg ataccgatga aacgagagag gatgctcacg atacgggtta ctgatgatga 7860acatgcccgg ttactggaac gttgtgaggg taaacaactg gcggtatgga tgcggcggga 7920ccagagaaaa atcactcagg gtcaatgcca gcgcttcgtt aatacagatg taggtgttcc 7980acagggtagc cagcagcatc ctgcgatgca gatccggaac ataatggtgc agggcgctga 8040cttccgcgtt tccagacttt acgaaacacg gaaaccgaag accattcatg ttgttgctca 8100ggtcgcagac gttttgcagc agcagtcgct tcacgttcgc tcgcgtatcg gtgattcatt 8160ctgctaacca gtaaggcaac cccgccagcc tagccgggtc ctcaacgaca ggagcacgat 8220catgcgcacc cgtggccagg acccaacgct gcccgaaatt 8260148260DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 14ccgacaccat cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga 60gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg 120gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa 180cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac 240aacaactggc gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc 420ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca 480ttgctgtgga agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga 540cacccatcaa cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg tctggctggc tggcataaat

atctcactcg caatcaaatt cagccgatag 720cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga 780atgagggcat cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa 840tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga tatctcggta gtgggatacg 900acgataccga agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga 1020agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata 1080cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt 1140cccgactgga aagcgggcag tgagcgcaac gcaattaatg taagttagct cactcattag 1200gcacaattct catgtttgac agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg 1320tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat cataacggtt 1380ctggcaaata ttctgaaatg agctgttgac aattaatcat cggctcgtat aatgtgtgga 1440attgtgagcg gataacaatt tcacacagga aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc aacaaggacc atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560attaacggcg ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat 1620accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt cccacaggtt 1680gcggcaactg gcgatggccc tgacattatc ttctgggcac acgaccgctt tggtggctac 1740gctcaatctg gcctgttggc tgaaatcacc ccggacaaag cgttccagga caagctgtat 1800ccgtttacct gggatgccgt acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860gaagcgttat cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa 1920gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct gatgttcaac 1980ctgcaagaac cgtacttcac ctggccgctg attgctgctg acgggggtta tgcgttcaag 2040tatgaaaacg gcaagtacga cattaaagac gtgggcgtgg ataacgctgg cgcgaaagcg 2100ggtctgacct tcctggttga cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160tccatcgcag aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg 2220gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact gccgaccttc 2280aagggtcaac catccaaacc gttcgttggc gtgctgagcg caggtattaa cgccgccagt 2340ccgaacaaag agctggcaaa agagttcctc gaaaactatc tgctgactga tgaaggtctg 2400gaagcggtta ataaagacaa accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460ttggcgaaag atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg 2520ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt gatcaacgcc 2580gccagcggtc gtcagactgt cgatgccgcc ctggccgccg cgcagactgc cgccgccgcc 2640gccatggaga caaggcaaat ggcagtggaa caaaccactg gtgcggtcac caaccaaacg 2700gaaacaagct ggcacagcat agactgggcc aaagccaacc gtgaggtaaa gaggctgcaa 2760gtgcgtatcg caaaggctgt gaaggaagga cgctggggca aagtgaaagc tttgcaatgg 2820ctcctgaccc actcgttcta cggcaaagcc ctcgccgtga aacgggtaac tgacaactcg 2880ggcagcaaaa cacctggtgt ggacgggata acctggtcca cacaagagca gaaagcccaa 2940gccataaagt ccctcaggag aagaggctat aaaccccaac ccctgaggcg ggtatacatc 3000ccgaaagcaa acggcaaaca gcgcccgcta ggaatcccga caatgaagga cagggcaatg 3060caggcactat atgccctagc cctagaacca gtcgcggaaa ccacagcaga ccggaactcc 3120tatgggttcc ggcgaggacg atgcatagcc gatgcagcga cgcagtgtca catcacgcta 3180gccaaaacag accgtgcaca atacgttctc gacgccgata ttgctgggtg ctttgacaac 3240atcagccatg agtggctact agctaacatt ccactagaca aaagaattct acggaaatgg 3300cttaaatctg ggtttgtctg gaagcagcaa ctcttcccca tccatgctgg aacacctcag 3360ggaggggtaa tctccccgat gcttgccaac atgacactgg atgggatgga agaattgtta 3420aacaagtttc ccagggcgca caaggtcaaa ctcatccgat atgccgacga cttcgtcgta 3480accggtgaaa cgaaggaagt gctctatatt gccggtgcgg taatacaagc attcctcaag 3540gaaaggggcc ttaccctatc aaaggaaaag acgaagatcg tacacattga agaagggttt 3600gactttctcg gatggaacat tcgcaaatat gatgggaaac tgctcatcaa acctgcgaag 3660aagaacgtta aagcgttcct caagaaaatc cgagacacct taagagaact taggacagca 3720ccccaggaga ttgtgataga cacactcaac ccaatcatca gaggttggac taactatcac 3780aaaaatcagg catccaaaga aaccttcgtc ggagtggacc acctcatatg gcaaaaatta 3840tggcgatggg caaggcgccg acacccaagc aaatctgtcc gatgggtgaa gagtaagtac 3900ttcatccaaa tcgggaacag aaaatggatg ttcggaatat ggacgaaaga caaaaacgga 3960gacccgtggg ccaagcattt aatcaaagcc tcggaaatcc gaatccaacg tcgcggtaaa 4020atcaaggcag acgccaaccc gtttctccca gaatgggcag aatactttga gcagcgcaag 4080aaactcaaag aggcccctgc ccaataccgg cgcacccgtc gggaattgtg gaagaaacaa 4140ggcggcatct gtccagtatg tgggggagaa attgagcaag acatgctcac cgaaatccac 4200cacatactgc ccaaacacaa gggtggtact gacgacctgg acaatcttgt cctaatccac 4260actaactgcc acaaacaggt gcacaaccga gatggtcagc acagccggtt cctcttgaaa 4320gaggggcttt gactgcaggc aagcttggca ctggccgtcg ttttacaacg tcgtgactgg 4380gaaaaccctg gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg 4440cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag cctgaatggc 4500gaatggcagc ttggctgttt tggcggatga gataagattt tcagcctgat acagattaaa 4560tcagaacgca gaagcggtct gataaaacag aatttgcctg gcggcagtag cgcggtggtc 4620ccacctgacc ccatgccgaa ctcagaagtg aaacgccgta gcgccgatgg tagtgtgggg 4680tctccccatg cgagagtagg gaactgccag gcatcaaata aaacgaaagg ctcagtcgaa 4740agactgggcc tttcgtttta tctgttgttt gtcggtgaac gctctcctga gtaggacaaa 4800tccgccggga gcggatttga acgttgcgaa gcaacggccc ggagggtggc gggcaggacg 4860cccgccataa actgccaggc atcaaattaa gcagaaggcc atcctgacgg atggcctttt 4920tgcgtttcta caaactcttt ttgtttattt ttctaaatac attcaaatat gtatccgctc 4980atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt 5040caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct 5100cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt 5160tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt 5220tctccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtgttgac 5280gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac 5340tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct 5400gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg 5460aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg 5520gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca 5580atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa 5640caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt 5700ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc 5760attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg 5820agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt 5880aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaccccgg 5940ttgataatca gaaaagcccc aaaaacagga agattgtata agcaaatatt taaattgtaa 6000acgttaatat tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc 6060aataggccga aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga 6120gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag 6180ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga accatcaccc aaatcaagtt 6240ttttggggtc gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta 6300gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag 6360cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg 6420cgcttaatgc gccgctacag ggcgcgtaaa aggatctagg tgaagatcct ttttgataat 6480ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa 6540aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca 6600aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt 6660ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg 6720tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc 6780ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga 6840cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc 6900agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc 6960gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca 7020ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg 7080tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta 7140tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct 7200cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag 7260tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa 7320gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 7380atatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagtatacac 7440tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa cacccgctga 7500cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc 7560cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga ggcagctgcg 7620gtaaagctca tcagcgtggt cgtgcagcga ttcacagatg tctgcctgtt catccgcgtc 7680cagctcgttg agtttctcca gaagcgttaa tgtctggctt ctgataaagc gggccatgtt 7740aagggcggtt ttttcctgtt tggtcactga tgcctccgtg taagggggat ttctgttcat 7800gggggtaatg ataccgatga aacgagagag gatgctcacg atacgggtta ctgatgatga 7860acatgcccgg ttactggaac gttgtgaggg taaacaactg gcggtatgga tgcggcggga 7920ccagagaaaa atcactcagg gtcaatgcca gcgcttcgtt aatacagatg taggtgttcc 7980acagggtagc cagcagcatc ctgcgatgca gatccggaac ataatggtgc agggcgctga 8040cttccgcgtt tccagacttt acgaaacacg gaaaccgaag accattcatg ttgttgctca 8100ggtcgcagac gttttgcagc agcagtcgct tcacgttcgc tcgcgtatcg gtgattcatt 8160ctgctaacca gtaaggcaac cccgccagcc tagccgggtc ctcaacgaca ggagcacgat 8220catgcgcacc cgtggccagg acccaacgct gcccgaaatt 8260158260DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 15ccgacaccat cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga 60gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg 120gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa 180cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac 240aacaactggc gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc 420ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca 480ttgctgtgga agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga 540cacccatcaa cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag 720cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga 780atgagggcat cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa 840tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga tatctcggta gtgggatacg 900acgataccga agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga 1020agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata 1080cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt 1140cccgactgga aagcgggcag tgagcgcaac gcaattaatg taagttagct cactcattag 1200gcacaattct catgtttgac agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg 1320tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat cataacggtt 1380ctggcaaata ttctgaaatg agctgttgac aattaatcat cggctcgtat aatgtgtgga 1440attgtgagcg gataacaatt tcacacagga aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc aacaaggacc atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560attaacggcg ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat 1620accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt cccacaggtt 1680gcggcaactg gcgatggccc tgacattatc ttctgggcac acgaccgctt tggtggctac 1740gctcaatctg gcctgttggc tgaaatcacc ccggacaaag cgttccagga caagctgtat 1800ccgtttacct gggatgccgt acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860gaagcgttat cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa 1920gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct gatgttcaac 1980ctgcaagaac cgtacttcac ctggccgctg attgctgctg acgggggtta tgcgttcaag 2040tatgaaaacg gcaagtacga cattaaagac gtgggcgtgg ataacgctgg cgcgaaagcg 2100ggtctgacct tcctggttga cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160tccatcgcag aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg 2220gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact gccgaccttc 2280aagggtcaac catccaaacc gttcgttggc gtgctgagcg caggtattaa cgccgccagt 2340ccgaacaaag agctggcaaa agagttcctc gaaaactatc tgctgactga tgaaggtctg 2400gaagcggtta ataaagacaa accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460ttggcgaaag atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg 2520ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt gatcaacgcc 2580gccagcggtc gtcagactgt cgatgccgcc ctggccgccg cgcagactgc cgccgccgcc 2640gccatggaga caaggcaaat ggcagtggaa caaaccactg gtgcggtcac caaccaaacg 2700gaaacaagct ggcacagcat agactgggcc aaagccaacc gtgaggtaaa gaggctgcaa 2760gtgcgtatcg caaaggctgt gaaggaagga cgctggggca aagtgaaagc tttgcaatgg 2820ctcctgaccc actcgttcta cggcaaagcc ctcgccgtga aacgggtaac tgacaactcg 2880ggcagcaaaa cacctggtgt ggacgggata acctggtcca cacaagagca gaaagcccaa 2940gccataaagt ccctcaggag aagaggctac aaaccccaac ccctgaggcg ggtatacatc 3000ccgaaagcaa gcggcaagca gcgcccgcta ggaatcccga caacgaagga cagggcaatg 3060caggcattat atgccctagc tctagaacct gtcgcggaaa ccacagcgga tcggaactca 3120tacgggttcc gtcaaggacg gtgcacggca gatgctgccg ggcagtgctt cactgtgcta 3180ggccgatctg actgtgcaaa atatatcctt gatgctgaca tcaccggatg ctttgacaac 3240attagccacg aatggctact agacaacatc ccgctggaca aagaggttct gcggaagtgg 3300cttaaatctg ggttcgtctg gaaacagcaa ctcttcccaa cccatgctgg gacacctcag 3360ggaggggtaa tctccccaat gctggccaat atgaccctag atgggatgga agaattgctg 3420aagaaacacc tcagaaaaca aaaagtcaac ctcatacgat atgcagacga ctttgtcgta 3480actggtgaat caaaggaaac cttggaaaag gttacaactg taatccaaga attcctcaag 3540gaaaggggcc ttaccctatc agaagaaaag acaaaggtcg ttcatatcga agaaggattt 3600gactttcttg gatggaacat tcgcaaatat ggtgagaagc ttctcatcaa acctgcgaag 3660aagaacatca aggcgttcca caagaaaatc cgagacgcac tgaaggaact cagaacagcc 3720acccaggaag ctgtgataga cacactcaac ccaattatca aaggctgggc taactatcac 3780agaaaccagg tttccaaaag aatcttcaac agagcggatg acaatatctg gcataaatta 3840tggcgatggg caaaacgtcg gcacccaaac aaaccagccc gatggacaaa gaacaaatac 3900ttcatcaaaa tcgggaatag gcactgggtg tttggcacat ggaaaaagga caaagaggga 3960aggttacggt ccagatacct aattaaagcc ggagatactc gaatccaacg tcatgtcaaa 4020atcaaggcag acgccaatcc gtttctccca gagtgggcag aatactttga ggaacgcaag 4080aaactcaaag aagcccctgc tcaatatcgg cgcatccgcc gagaactatg gaagaaacag 4140ggtggtatct gtccagtatg cgggggtgaa attgagcaag acatgctcac tgaaatccac 4200cacatattgc ccaaacacaa gggtggttct gacgacctgg ataatcttgt cttaatccac 4260gccaactgtc acaaacaggt gcacagccga gacggtcagc acagccggtt cctcttgaaa 4320gaggggcttt gactgcaggc aagcttggca ctggccgtcg ttttacaacg tcgtgactgg 4380gaaaaccctg gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg 4440cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag cctgaatggc 4500gaatggcagc ttggctgttt tggcggatga gataagattt tcagcctgat acagattaaa 4560tcagaacgca gaagcggtct gataaaacag aatttgcctg gcggcagtag cgcggtggtc 4620ccacctgacc ccatgccgaa ctcagaagtg aaacgccgta gcgccgatgg tagtgtgggg 4680tctccccatg cgagagtagg gaactgccag gcatcaaata aaacgaaagg ctcagtcgaa 4740agactgggcc tttcgtttta tctgttgttt gtcggtgaac gctctcctga gtaggacaaa 4800tccgccggga gcggatttga acgttgcgaa gcaacggccc ggagggtggc gggcaggacg 4860cccgccataa actgccaggc atcaaattaa gcagaaggcc atcctgacgg atggcctttt 4920tgcgtttcta caaactcttt ttgtttattt ttctaaatac attcaaatat gtatccgctc 4980atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt 5040caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct 5100cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt 5160tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt 5220tctccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtgttgac 5280gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac 5340tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct 5400gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg 5460aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg 5520gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca 5580atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa 5640caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt 5700ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc 5760attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg 5820agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt 5880aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaccccgg 5940ttgataatca gaaaagcccc aaaaacagga agattgtata agcaaatatt taaattgtaa 6000acgttaatat tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc 6060aataggccga aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga 6120gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag 6180ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga accatcaccc aaatcaagtt 6240ttttggggtc gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta 6300gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag 6360cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg 6420cgcttaatgc gccgctacag ggcgcgtaaa aggatctagg tgaagatcct ttttgataat 6480ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa 6540aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca 6600aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt 6660ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg 6720tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc 6780ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga 6840cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc 6900agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc 6960gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca 7020ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg 7080tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta 7140tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct 7200cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag 7260tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa 7320gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc

7380atatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagtatacac 7440tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa cacccgctga 7500cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc 7560cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga ggcagctgcg 7620gtaaagctca tcagcgtggt cgtgcagcga ttcacagatg tctgcctgtt catccgcgtc 7680cagctcgttg agtttctcca gaagcgttaa tgtctggctt ctgataaagc gggccatgtt 7740aagggcggtt ttttcctgtt tggtcactga tgcctccgtg taagggggat ttctgttcat 7800gggggtaatg ataccgatga aacgagagag gatgctcacg atacgggtta ctgatgatga 7860acatgcccgg ttactggaac gttgtgaggg taaacaactg gcggtatgga tgcggcggga 7920ccagagaaaa atcactcagg gtcaatgcca gcgcttcgtt aatacagatg taggtgttcc 7980acagggtagc cagcagcatc ctgcgatgca gatccggaac ataatggtgc agggcgctga 8040cttccgcgtt tccagacttt acgaaacacg gaaaccgaag accattcatg ttgttgctca 8100ggtcgcagac gttttgcagc agcagtcgct tcacgttcgc tcgcgtatcg gtgattcatt 8160ctgctaacca gtaaggcaac cccgccagcc tagccgggtc ctcaacgaca ggagcacgat 8220catgcgcacc cgtggccagg acccaacgct gcccgaaatt 8260168490DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 16ccgacaccat cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga 60gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg 120gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa 180cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac 240aacaactggc gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc 420ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca 480ttgctgtgga agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga 540cacccatcaa cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag 720cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga 780atgagggcat cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa 840tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga tatctcggta gtgggatacg 900acgataccga agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga 1020agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata 1080cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt 1140cccgactgga aagcgggcag tgagcgcaac gcaattaatg taagttagct cactcattag 1200gcacaattct catgtttgac agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg 1320tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat cataacggtt 1380ctggcaaata ttctgaaatg agctgttgac aattaatcat cggctcgtat aatgtgtgga 1440attgtgagcg gataacaatt tcacacagga aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc aacaaggacc atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560attaacggcg ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat 1620accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt cccacaggtt 1680gcggcaactg gcgatggccc tgacattatc ttctgggcac acgaccgctt tggtggctac 1740gctcaatctg gcctgttggc tgaaatcacc ccggacaaag cgttccagga caagctgtat 1800ccgtttacct gggatgccgt acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860gaagcgttat cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa 1920gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct gatgttcaac 1980ctgcaagaac cgtacttcac ctggccgctg attgctgctg acgggggtta tgcgttcaag 2040tatgaaaacg gcaagtacga cattaaagac gtgggcgtgg ataacgctgg cgcgaaagcg 2100ggtctgacct tcctggttga cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160tccatcgcag aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg 2220gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact gccgaccttc 2280aagggtcaac catccaaacc gttcgttggc gtgctgagcg caggtattaa cgccgccagt 2340ccgaacaaag agctggcaaa agagttcctc gaaaactatc tgctgactga tgaaggtctg 2400gaagcggtta ataaagacaa accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460ttggcgaaag atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg 2520ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt gatcaacgcc 2580gccagcggtc gtcagactgt cgatgccgcc ctggccgccg cgcagactgc cgccgccgcc 2640gccatgaagg taaacaaact tgtcgtaaaa agcgaacagg acttgagaaa ctgcttggat 2700cttctttatc aagaagctaa aaagggaaaa catttttacg gcatgcttga gttgcttcaa 2760aatgatgttg tcattttaga agctattcgc aatattaaaa gcaataaagg tagcaaaacg 2820gcggggattg atcagaaaat agtagatgat tatttgctta tgccaacgga aaaggttttc 2880gggatgataa aagccaaact caatgactat aagcctatac cagtgagaag gtgcaacaag 2940cccaaaggaa atgccaaaag ctcaaaaaga aaaggcaata gtccgaatga ggaaggggaa 3000acgaggccct taggaatatc cgcagtgacg gatagaatca tccaagagat gctacggata 3060gtgctcgagc cgattttcga agcccaattc tatccgcaca gttatgggtt cagaccgtat 3120cgctccaccg aacatgcctt agcctggatg ctgaaaatca tcaacggaag caaactgtat 3180tgggttgtaa aaggtgacat tgaaagttat tttgatcaca tcaatcataa gaagcttctg 3240aacatcatgt ggaatatggg cgttagggat aaacgggtac tatgcatcgt taagaaaatg 3300ctgaaggcgg ggcaagtgat acaaggtaaa ttctatccaa ccgctaaggg gattcctcag 3360ggaggaatta ttagcccgtt gttggctaat gtatatctca acagctttga ctggatggtt 3420ggccaagaat atgagtatca ccctaataac gcaaactatc gggaaaagaa aaacgcatta 3480gcggcgttaa ggaacaaggg acatcatccc gtcttttaca ttcgttatgc tgatgattgg 3540gttattctta cggatacgaa agaatatgcg gaaaaaataa gggagcaatg taagcagtat 3600ttagcctgtg agttgcactt aactctatcg gatgagaaaa cgttcattgc agatatccgc 3660gaacaacggg ttaagtttct aggcttttgt attgaggcag gaaagcggcg ttttcataaa 3720aaaggattcg ccgctagaat gattcccgat atggaaaaag tcaatgccaa ggtcaaagaa 3780attaagcgcg atattcgatt gttaagaacg agaaaatcgg aattagagaa agcccttgat 3840attgaaaaca ttaacaccaa aattatagga ttagccaatc atctaaaaat aggcatttcc 3900aagtacatta tgggcaaagt agatcgcgtc attgaagaga cagcctaccg cacctgggtt 3960aaaatgtatg ggaaagaaaa agcggcgcaa tataaaaggc ctgtgtcaga gtttcacaat 4020cggattgaca gacataaagg ctatcaaatg aaacattttt ctgtcgtcac agaggatggc 4080ataagagtag ggattaccca tgcaaaaata acgcctatac agtatgcaac agtattcaaa 4140caagaaatga ccccatacac tgcagacggc agaaaaatgt atgaagaaaa gcatagaaaa 4200atacgattgc cggataaaat gagtctgttc gatcacgatt cgatattcat ctacatttta 4260tctgagcata atgatgggaa atataatctt gaatatttct taaatagggt gaatgtattt 4320cacagagata aaggaaaatg caaaatatgt gccgtatact taagtcccgg taacttccac 4380tgccatcata ttgacccgag taaaccttta agtgagatca ataagaccgt taatctaatt 4440agcttatgca accaatgcca taggcttgtc catagcaacc aagaaccgcc gtttacagaa 4500cgaaaaatgt ttgacaaact aacgaaatat aggaacaagc tgaaaatata aggatcctct 4560agctgcaggc aagcttggca ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg 4620gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg cgtaatagcg 4680aagaggcccg caccgatcgc ccttcccaac agttgcgcag cctgaatggc gaatggcagc 4740ttggctgttt tggcggatga gataagattt tcagcctgat acagattaaa tcagaacgca 4800gaagcggtct gataaaacag aatttgcctg gcggcagtag cgcggtggtc ccacctgacc 4860ccatgccgaa ctcagaagtg aaacgccgta gcgccgatgg tagtgtgggg tctccccatg 4920cgagagtagg gaactgccag gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc 4980tttcgtttta tctgttgttt gtcggtgaac gctctcctga gtaggacaaa tccgccggga 5040gcggatttga acgttgcgaa gcaacggccc ggagggtggc gggcaggacg cccgccataa 5100actgccaggc atcaaattaa gcagaaggcc atcctgacgg atggcctttt tgcgtttcta 5160caaactcttt ttgtttattt ttctaaatac attcaaatat gtatccgctc atgagacaat 5220aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt caacatttcc 5280gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct cacccagaaa 5340cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt tacatcgaac 5400tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt tctccaatga 5460tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtgttgac gccgggcaag 5520agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac tcaccagtca 5580cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct gccataacca 5640tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg aaggagctaa 5700ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg gaaccggagc 5760tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca atggcaacaa 5820cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa caattaatag 5880actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt ccggctggct 5940ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc attgcagcac 6000tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg agtcaggcaa 6060ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt aagcattggt 6120aactgtcaga ccaagtttac tcatatatac tttagattga tttaccccgg ttgataatca 6180gaaaagcccc aaaaacagga agattgtata agcaaatatt taaattgtaa acgttaatat 6240tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc aataggccga 6300aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga gtgttgttcc 6360agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac 6420cgtctatcag ggcgatggcc cactacgtga accatcaccc aaatcaagtt ttttggggtc 6480gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta gagcttgacg 6540gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgctag 6600ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc 6660gccgctacag ggcgcgtaaa aggatctagg tgaagatcct ttttgataat ctcatgacca 6720aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag 6780gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac 6840cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa 6900ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc 6960accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag 7020tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac 7080cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc 7140gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc 7200ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca 7260cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc 7320tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg 7380ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct 7440ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata 7500ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc 7560gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atatatggtg 7620cactctcagt acaatctgct ctgatgccgc atagttaagc cagtatacac tccgctatcg 7680ctacgtgact gggtcatggc tgcgccccga cacccgccaa cacccgctga cgcgccctga 7740cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc 7800atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga ggcagctgcg gtaaagctca 7860tcagcgtggt cgtgcagcga ttcacagatg tctgcctgtt catccgcgtc cagctcgttg 7920agtttctcca gaagcgttaa tgtctggctt ctgataaagc gggccatgtt aagggcggtt 7980ttttcctgtt tggtcactga tgcctccgtg taagggggat ttctgttcat gggggtaatg 8040ataccgatga aacgagagag gatgctcacg atacgggtta ctgatgatga acatgcccgg 8100ttactggaac gttgtgaggg taaacaactg gcggtatgga tgcggcggga ccagagaaaa 8160atcactcagg gtcaatgcca gcgcttcgtt aatacagatg taggtgttcc acagggtagc 8220cagcagcatc ctgcgatgca gatccggaac ataatggtgc agggcgctga cttccgcgtt 8280tccagacttt acgaaacacg gaaaccgaag accattcatg ttgttgctca ggtcgcagac 8340gttttgcagc agcagtcgct tcacgttcgc tcgcgtatcg gtgattcatt ctgctaacca 8400gtaaggcaac cccgccagcc tagccgggtc ctcaacgaca ggagcacgat catgcgcacc 8460cgtggccagg acccaacgct gcccgaaatt 8490177834DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 17ccgacaccat cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga 60gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg 120gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa 180cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac 240aacaactggc gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc 420ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca 480ttgctgtgga agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga 540cacccatcaa cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag 720cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga 780atgagggcat cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa 840tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga tatctcggta gtgggatacg 900acgataccga agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga 1020agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata 1080cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt 1140cccgactgga aagcgggcag tgagcgcaac gcaattaatg taagttagct cactcattag 1200gcacaattct catgtttgac agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg 1320tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat cataacggtt 1380ctggcaaata ttctgaaatg agctgttgac aattaatcat cggctcgtat aatgtgtgga 1440attgtgagcg gataacaatt tcacacagga aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc aacaaggacc atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560attaacggcg ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat 1620accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt cccacaggtt 1680gcggcaactg gcgatggccc tgacattatc ttctgggcac acgaccgctt tggtggctac 1740gctcaatctg gcctgttggc tgaaatcacc ccggacaaag cgttccagga caagctgtat 1800ccgtttacct gggatgccgt acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860gaagcgttat cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa 1920gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct gatgttcaac 1980ctgcaagaac cgtacttcac ctggccgctg attgctgctg acgggggtta tgcgttcaag 2040tatgaaaacg gcaagtacga cattaaagac gtgggcgtgg ataacgctgg cgcgaaagcg 2100ggtctgacct tcctggttga cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160tccatcgcag aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg 2220gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact gccgaccttc 2280aagggtcaac catccaaacc gttcgttggc gtgctgagcg caggtattaa cgccgccagt 2340ccgaacaaag agctggcaaa agagttcctc gaaaactatc tgctgactga tgaaggtctg 2400gaagcggtta ataaagacaa accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460ttggcgaaag atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg 2520ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt gatcaacgcc 2580gccagcggtc gtcagactgt cgatgccgcc ctggccgccg cgcagactgc cgccgccgcc 2640gccatggctt tgttggaacg catcttagcg agagacaacc tcatcacggc gctcaaacgg 2700gtcgaagcca accaaggagc accgggaatc gacggagtat caaccgatca actccgtgat 2760tacatccgcg ctcactggag cacgatccac gcccaactct tggcgggaac ctaccggccg 2820gcgcctgtcc gcagggtcga aatcccgaaa ccgggcggcg gcacacggca gctaggcatt 2880cccaccgtgg tggaccggct gatccaacaa gccattcttc aagaactcac acccattttc 2940gatccagact tctcctcttc cagcttcgga ttccgtccgg gccgcaacgc ccacgatgcc 3000gtgcggcaag cgcaaggcta catccaggaa gggtatcggt acgtggtcga catggacctg 3060gaaaagttct ttgatcgggt caaccatgac atcttgatga gtcgggtggc ccgaaaagtc 3120aaggataaac gcgtgctgaa actgatccgt gcctacctgc aagccggcgt tatgatcgaa 3180ggggtgaagg tgcagacgga ggaagggacg ccgcaaggcg gccccctcag ccccctgctg 3240gcgaacatcc ttctcgacga tttagacaag gaattggaga agcgaggatt gaaattctgc 3300cgttacgcag atgactgcaa catctatgtg aaaagtctgc gggcaggaca acgggtgaaa 3360caaagcatcc aacggttctt ggagaaaacg ctcaaactca aagtaaacga ggagaaaagt 3420gcggtggacc gcccgtggaa acgggccttt ctggggttta gcttcacacc ggaacgaaaa 3480gcgcgaatcc ggctcgcccc aaggtcgatt caacgtctga aacagcggat tcgacagctg 3540accaacccaa actggagcat atcgatgcca gaacgaattc atcgcgtcaa tcaatacgtc 3600atgggatgga tcgggtattt tcggctcgtc gaaaccccgt ctgtccttca gaccatcgaa 3660ggatggattc ggaggaggct tcgactctgt caatggcttc aatggaaacg ggtcagaacc 3720agaatccgtg agttaagagc gctggggctg aaagagacag cggtgatgga gatcgccaat 3780acccgaaaag gagcttggcg aacaacgaaa acgccgcaac tccaccaggc cctgggcaag 3840acctactgga ccgctcaagg gctcaagagt ttgacgcaac gatatttcga actccgtcaa 3900ggttgactgc aggcaagctt ggcactggcc gtcgttttac aacgtcgtga ctgggaaaac 3960cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag ctggcgtaat 4020agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg 4080cagcttggct gttttggcgg atgagataag attttcagcc tgatacagat taaatcagaa 4140cgcagaagcg gtctgataaa acagaatttg cctggcggca gtagcgcggt ggtcccacct 4200gaccccatgc cgaactcaga agtgaaacgc cgtagcgccg atggtagtgt ggggtctccc 4260catgcgagag tagggaactg ccaggcatca aataaaacga aaggctcagt cgaaagactg 4320ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc ctgagtagga caaatccgcc 4380gggagcggat ttgaacgttg cgaagcaacg gcccggaggg tggcgggcag gacgcccgcc 4440ataaactgcc aggcatcaaa ttaagcagaa ggccatcctg acggatggcc tttttgcgtt 4500tctacaaact ctttttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga 4560caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat 4620ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca 4680gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc 4740gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttctcca 4800atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtgt tgacgccggg 4860caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca 4920gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata 4980accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag 5040ctaaccgctt ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg 5100gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca 5160acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta 5220atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct 5280ggctggttta ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca 5340gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag 5400gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat

5460tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttacc ccggttgata 5520atcagaaaag ccccaaaaac aggaagattg tataagcaaa tatttaaatt gtaaacgtta 5580atattttgtt aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg 5640ccgaaatcgg caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg 5700ttccagtttg gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa 5760aaaccgtcta tcagggcgat ggcccactac gtgaaccatc acccaaatca agttttttgg 5820ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt 5880gacggggaaa gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg 5940ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 6000atgcgccgct acagggcgcg taaaaggatc taggtgaaga tcctttttga taatctcatg 6060accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc 6120aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa 6180ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag 6240gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta 6300ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta 6360ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag 6420ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg 6480gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg 6540cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag 6600cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc 6660cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa 6720aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg 6780ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct 6840gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa 6900gagcgcctga tgcggtattt tctccttacg catctgtgcg gtatttcaca ccgcatatat 6960ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagtat acactccgct 7020atcgctacgt gactgggtca tggctgcgcc ccgacacccg ccaacacccg ctgacgcgcc 7080ctgacgggct tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag 7140ctgcatgtgt cagaggtttt caccgtcatc accgaaacgc gcgaggcagc tgcggtaaag 7200ctcatcagcg tggtcgtgca gcgattcaca gatgtctgcc tgttcatccg cgtccagctc 7260gttgagtttc tccagaagcg ttaatgtctg gcttctgata aagcgggcca tgttaagggc 7320ggttttttcc tgtttggtca ctgatgcctc cgtgtaaggg ggatttctgt tcatgggggt 7380aatgataccg atgaaacgag agaggatgct cacgatacgg gttactgatg atgaacatgc 7440ccggttactg gaacgttgtg agggtaaaca actggcggta tggatgcggc gggaccagag 7500aaaaatcact cagggtcaat gccagcgctt cgttaataca gatgtaggtg ttccacaggg 7560tagccagcag catcctgcga tgcagatccg gaacataatg gtgcagggcg ctgacttccg 7620cgtttccaga ctttacgaaa cacggaaacc gaagaccatt catgttgttg ctcaggtcgc 7680agacgttttg cagcagcagt cgcttcacgt tcgctcgcgt atcggtgatt cattctgcta 7740accagtaagg caaccccgcc agcctagccg ggtcctcaac gacaggagca cgatcatgcg 7800cacccgtggc caggacccaa cgctgcccga aatt 7834185PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 18Ala Ala Ala Glu Phe 1 5 1935PRTArtificial SequenceDescription of Artificial Sequence Synthetic polypeptide 19Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn Ser Ser Ser Asn 1 5 10 15 Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Glu Asn Leu Tyr Phe Gln 20 25 30 Gly Glu Phe 35 2016PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 20Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala Ala Ala Ala Ala 1 5 10 15 211200DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 21gaatacaagc ttgggcgtgt ctcaaaatct ctgatgttac attgcacaag ataaaaatat 60atcatcatga acaataaaac tgtctgctta cataaacagt aatacaaggg gtgttatgag 120ccatattcaa cgggaaacgt cttgctcgag gccgcgatta aattccaaca tggatgctga 180tttatatggg tataaatggg ctcgcgataa tgtcgggcaa tcaggtgcga caatctatcg 240attgtatggg aagcccgatg cgccagagtt gtttctgaaa catggcaaag gtagcgttgc 300caatgatgtt acagatgaga tggtcagact aaactggctg acggaattta tgcctcttcc 360gaccatcaag cattttatcc gtactcctga tgatgcatgg ttactcacca ctgcgatccc 420cgggaaaaca gcattccagg tattagaaga atatcctgag tcaggtgaaa atattgttga 480tgcgctggca gtgttcctgc gccggttgca ttcgattcct gtttgtaatt gtccttttaa 540cagcgatcgc gtatttcgtc tcgctcaggc gcaatcacga atgaataacg gtttggttga 600tgcgagtgat tttgatgacg agcgtaatgg ctggcctgtt gaacaagtct ggaaagaaat 660gcataagctt ttgccattct caccggattc agtcgtcact catggtgatt tctcacttga 720taaccttatt tttgacgagg ggaaattaat aggttgtatt gatgttggac gagtcggaat 780cgcagaccga taccaggatc ttgccatcct atggaactgc ctcggtgagt tttctccttc 840attacagaaa cggctttttc aaaaatatgg tattgataat cctgatatga ataaattgca 900gtttcatttg atgctcgatg agtttttcta atcagaattg gttaattggt tgtaacactg 960gcagagcatt acgctgactt gacgggacgg cggctttgtt gaataaatcg aacttttgct 1020gagttgaagg atcagatcac gcatcttccc gacaacgcag accgttccgt ggcaaagcaa 1080aagttcaaaa tcaccaactg gtccacctac aacaaagctc tcatcaaccg tggcgactct 1140agaggatccc cgggcgagct cccaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaccgaatt 12002221DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 22acaaataggg gttccgcgca c 212318DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 23gttggtgacc gcaccagt 182417DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 24aacgcggtaa gcccgta 172518DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 25aatggacgat atcccgca 182620PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 26Asn Ile Cys Trp Phe Gly Asp Glu Ala Thr Ser Gly Ser Gly His His 1 5 10 15 His His His His 20 2711PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 27Asn Ile Cys Trp Phe Gly Ala Ala Ala Ala Ala 1 5 10 2837DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 28ccgcctttga gtgagctgat accgctcgcc gcagccg 372944DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 29ggtggaccag ttggtgattt tgaacttttg ctttgccacg gaac 443019DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 30gggtataaat gggctcgcg 193119DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 31cgggcttccc atacaatcg 193223DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 32tcgggcaatc aggtgcgaca atc 233370DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 33gggtataaat gggctcgcga taatgtcggg caatcaggtg cgacaatcta tcgattgtat 60gggaagcccg 703417DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 34cgctcaggcg caatcac 173520DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 35ccagccatta cgctcgtcat 203629DNAArtificial SequenceDescription of Artificial Sequence Synthetic probe 36atgaataacg gtttggttga tgcgagtga 293773DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 37cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga 60gcgtaatggc tgg 7338492PRTArtificial SequenceDescription of Artificial Sequence Synthetic polypeptide 38Met Asn Lys Glu Ile Leu Ala Val Val Glu Ala Val Ser Asn Glu Lys 1 5 10 15 Ala Leu Pro Arg Glu Lys Ile Phe Glu Ala Leu Glu Ser Ala Leu Ala 20 25 30 Thr Ala Thr Lys Lys Lys Tyr Glu Gln Glu Ile Asp Val Arg Val Gln 35 40 45 Ile Asp Arg Lys Ser Gly Asp Phe Asp Thr Phe Arg Arg Trp Leu Val 50 55 60 Val Asp Glu Val Thr Gln Pro Thr Lys Glu Ile Thr Leu Glu Ala Ala 65 70 75 80 Arg Tyr Glu Asp Glu Ser Leu Asn Leu Gly Asp Tyr Val Glu Asp Gln 85 90 95 Ile Glu Ser Val Thr Phe Asp Arg Ile Thr Thr Gln Thr Ala Lys Gln 100 105 110 Val Ile Val Gln Lys Val Arg Glu Ala Glu Arg Ala Met Val Val Asp 115 120 125 Gln Phe Arg Glu His Glu Gly Glu Ile Ile Thr Gly Val Val Lys Lys 130 135 140 Val Asn Arg Asp Asn Ile Ser Leu Asp Leu Gly Asn Asn Ala Glu Ala 145 150 155 160 Val Ile Leu Arg Glu Asp Met Leu Pro Arg Glu Asn Phe Arg Pro Gly 165 170 175 Asp Arg Val Arg Gly Val Leu Tyr Ser Val Arg Pro Glu Ala Arg Gly 180 185 190 Ala Gln Leu Phe Val Thr Arg Ser Lys Pro Glu Met Leu Ile Glu Leu 195 200 205 Phe Arg Ile Glu Val Pro Glu Ile Gly Glu Glu Val Ile Glu Ile Lys 210 215 220 Ala Ala Ala Arg Asp Pro Gly Ser Arg Ala Lys Ile Ala Val Lys Thr 225 230 235 240 Asn Asp Lys Arg Ile Asp Pro Val Gly Ala Cys Val Gly Met Arg Gly 245 250 255 Ala Arg Val Gln Ala Val Ser Thr Glu Leu Gly Gly Glu Arg Ile Asp 260 265 270 Ile Val Leu Trp Asp Asp Asn Pro Ala Gln Phe Val Ile Asn Ala Met 275 280 285 Ala Pro Ala Asp Val Ala Ser Ile Val Val Asp Glu Asp Lys His Thr 290 295 300 Met Asp Ile Ala Val Glu Ala Gly Asn Leu Ala Gln Ala Ile Gly Arg 305 310 315 320 Asn Gly Gln Asn Val Arg Leu Ala Ser Gln Leu Ser Gly Trp Glu Leu 325 330 335 Asn Val Met Thr Val Asp Asp Leu Gln Ala Lys His Gln Ala Glu Ala 340 345 350 His Ala Ala Ile Asp Thr Phe Thr Lys Tyr Leu Asp Ile Asp Glu Asp 355 360 365 Phe Ala Thr Val Leu Val Glu Glu Gly Phe Ser Thr Leu Glu Glu Leu 370 375 380 Ala Tyr Val Pro Met Lys Glu Leu Leu Glu Ile Glu Gly Leu Asp Glu 385 390 395 400 Pro Thr Val Glu Ala Leu Arg Glu Arg Ala Lys Asn Ala Leu Ala Thr 405 410 415 Ile Ala Gln Ala Gln Glu Glu Ser Leu Gly Asp Asn Lys Pro Ala Asp 420 425 430 Asp Leu Leu Asn Leu Glu Gly Val Asp Arg Asp Leu Ala Phe Lys Leu 435 440 445 Ala Ala Arg Gly Val Cys Thr Leu Glu Asp Leu Ala Glu Gln Gly Ile 450 455 460 Asp Asp Leu Ala Asp Ile Glu Gly Leu Thr Asp Glu Lys Ala Gly Ala 465 470 475 480 Leu Ile Met Ala Ala Arg Asn Ile Cys Trp Phe Gly 485 490 3942DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 39tttttttttt tttttttttt tttttttttt tttttttttt tt 42404PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 40Tyr Ala Gly Asp 1 414PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 41Tyr Ala Asp Asp 1 426PRTArtificial SequenceDescription of Artificial Sequence Synthetic 6xHis tag 42His His His His His His 1 5 434PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 43Tyr Met Asp Asp 1 4426PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 44Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn Ser Ser Ser Asn 1 5 10 15 Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu 20 25 4516PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 45Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala Ala Ala Ala Ala 1 5 10 15 4615PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 46Met Ala Ala Arg Asn Ile Cys Trp Phe Gly Ala Ala Ala Ala Ala 1 5 10 15

* * * * *


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed