U.S. patent application number 16/051544 was filed with the patent office on 2018-11-29 for stabilized reverse transcriptase fusion proteins.
The applicant listed for this patent is Board of Regents, The University of Texas System. Invention is credited to Eman Ghanem, Alan M. Lambowitz, Georg Mohr, Sabine Mohr.
Application Number | 20180340158 16/051544 |
Document ID | / |
Family ID | 42710216 |
Filed Date | 2018-11-29 |
United States Patent
Application |
20180340158 |
Kind Code |
A1 |
Lambowitz; Alan M. ; et
al. |
November 29, 2018 |
STABILIZED REVERSE TRANSCRIPTASE FUSION PROTEINS
Abstract
Stabilized reverse transcriptase fusion proteins including a
thermostable reverse transcriptase connected to a stabilizer
protein are described. Attaching the stabilizer protein to the
thermostable reverse transcriptase stabilizes the fusion protein
and can aid in its purification, provide increased solubility,
allow for longer storage, or allow the fusion protein to be used
under more rigorous conditions such as higher temperature. The
stabilized reverse transcriptase fusion protein can also include a
linker between the stabilizer protein and the thermostable reverse
transcriptase. The stabilized reverse transcriptase fusion proteins
are suitable for use in nucleic acid amplification methods such as
the reverse transcription polymerase chain reaction and other
applications involving cDNA synthesis.
Inventors: |
Lambowitz; Alan M.; (Austin,
TX) ; Mohr; Sabine; (Austin, TX) ; Mohr;
Georg; (Austin, TX) ; Ghanem; Eman; (Raleigh,
NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Board of Regents, The University of Texas System |
Austin |
TX |
US |
|
|
Family ID: |
42710216 |
Appl. No.: |
16/051544 |
Filed: |
August 1, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13254223 |
Sep 1, 2011 |
|
|
|
PCT/US2010/026165 |
Mar 4, 2010 |
|
|
|
16051544 |
|
|
|
|
61157332 |
Mar 4, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 2319/00 20130101;
C12P 19/34 20130101; C12Y 207/07049 20130101; C07K 2319/24
20130101; C12N 9/1276 20130101 |
International
Class: |
C12N 9/12 20060101
C12N009/12; C12P 19/34 20060101 C12P019/34 |
Goverment Interests
GOVERNMENT FUNDING
[0002] This work was supported, at least in part, by grant number
GM37949-22 from the Department of Health and Human Services,
National Institutes of Health. The United States government may
have certain rights in this invention.
Claims
1. A stabilized reverse transcriptase fusion protein comprising a
group-II intron reverse transcriptase connected at its N-terminus
to the C-terminus of a stabilizer protein including 50 or more
amino acids, wherein the fusion protein exhibits increased
solubility and stability in solution.
2-3. (canceled)
4. The stabilized reverse transcriptase fusion protein of claim 1,
wherein the group-II intron reverse transcriptase is a Lactococcus
lactis reverse transcriptase, a Thermosynechococcus elongatus
reverse transcriptase, or Geobacillus stearothermophilus reverse
transcriptase.
5. (canceled)
6. The stabilized reverse transcriptase fusion protein of claim 1,
wherein the stabilizer protein comprises an affinity protein or a
solubility-enhancing protein.
7. The stabilized reverse transcriptase fusion protein of claim 6,
wherein the stabilizer protein comprises a maltose binding protein
or an N-utilization substance A protein.
8. The stabilized reverse transcriptase fusion protein of claim 6,
wherein the stabilizer protein has been modified by replacing
charged amino acids with uncharged amino acids.
9. The stabilized reverse transcriptase fusion protein of claim 1,
wherein the reverse transcriptase is connected to the stabilizer
protein by a linker peptide.
10. The stabilized reverse transcriptase fusion protein of claim 1,
wherein the linker peptide is a non-cleavable linker peptide.
11. The stabilized reverse transcriptase fusion protein of claim
10, wherein the non-cleavable linker peptide is a rigid linker
peptide.
12. The stabilized reverse transcriptase fusion protein of claim
10, wherein the linker peptide consists of 1 to 20 amino acids.
13. The stabilized reverse transcriptase fusion protein of claim
10, wherein the linker peptide consists of 1 to 5 amino acids.
14. The stabilized reverse transcriptase fusion protein of claim
10, wherein the linker peptide consists of 3 to 5 amino acids.
15. The stabilized reverse transcriptase fusion protein of claim
11, wherein the rigid linker peptide consists of SEQ ID NO: 12.
16. (canceled)
17. The stabilized reverse transcriptase fusion protein of claim 1,
wherein the stabilized reverse transcriptase fusion protein is
capable of carrying out reverse transcription of an RNA template
with processivity or fidelity greater than that of SuperScript
III.
18. A method for preparing a cDNA from an RNA molecule, comprising
the steps of: (a) adding a primer nucleotide sequence to the RNA
molecule (b) incubating the RNA molecule in the presence of one or
more deoxy or dideoxyribonucleoside triphosphates and a stabilized
reverse transcriptase fusion protein comprising a group-II intron
reverse transcriptase connected at its N-terminus to the C-terminus
of a stabilizer protein including 50 or more amino acids, wherein
the fusion protein exhibits increased solubility and stability in
solution under conditions sufficient to synthesize a cDNA molecule
complementary to all or a portion of the RNA molecule.
19. The method of claim 18, wherein the group II intron reverse
transcriptase is connected to the stabilizer protein by a linker
peptide.
20. The method of claim 18, wherein reverse transcription is
performed within a temperature range where the RNA has a
substantially decreased amount of obstructing stable secondary or
tertiary structure.
21. The method of claim 19, wherein the linker peptide is a
non-cleavable linker peptide.
22. The method of claim 19, wherein the group II intron reverse
transcriptase comprises a polypeptide with at least 85% amino acid
sequence identity to a sequence selected from the group consisting
of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ
ID NO: 5, the linker consists of 1 to 20 amino acids, and the
stabilizer protein comprises an affinity protein or a
solubility-enhancing protein.
23. The method of claim 18, wherein the reverse transcription is
performed with an error frequency of 2.0.times.10.sup.-5 or less at
a temperature from about 45.degree. C. to about 65.degree. C.
24. A DNA expression vector for producing a stabilized reverse
transcriptase fusion protein, comprising an isolated nucleic acid
that encodes a polypeptide comprising a group II intron reverse
transcriptase with at least 85% amino acid sequence identity to a
sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID
NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5.
25. A method of producing a stabilized reverse transcriptase fusion
protein, comprising the steps of (a) culturing a host cell
comprising the DNA expression vector of claim 24; (b) expressing
the stabilized reverse transcriptase fusion protein encoded by the
DNA expression vector; and (c) isolating the stabilized reverse
transcriptase fusion protein from the host cell.
26. The stabilized reverse transcriptase fusion protein of claim 1,
wherein the stabilizer protein includes an independent folding
domain and/or does not fold into long-lived misfolded
intermediates.
Description
CONTINUING APPLICATION DATA
[0001] This application claims the benefit of U.S. Provisional
Application Ser. No. 61/157,332, filed Mar. 4, 2009, which is
incorporated by reference herein.
BACKGROUND OF THE INVENTION
[0003] Reverse transcription polymerase chain reaction, abbreviated
as RT-PCR, is a well known technique for amplifying RNA. In RT-PCR,
an RNA strand is reverse transcribed into complementary DNA (cDNA),
which is then amplified using DNA polymerase in the polymerase
chain reaction. In the first step of this process, cDNA is made
from an RNA template using deoxyribonucleotide phosphates and
reverse transcriptase together with a DNA primer.
[0004] Synthesis of cDNA from the RNA template can be hindered by
RNA secondary and tertiary structures, which consist of helices and
various other kinds of kinks in the RNA strand. RNA secondary and
tertiary structure can be decreased by carrying out the reaction at
a higher temperature (e.g., above 50.degree. C.) or by adding
denaturing additives. However, the addition of denaturing additives
is undesirable because it often reduces reverse transcriptase
activity. Higher temperatures also provide the advantage of
increasing the specificity of DNA synthesis by decreasing
non-specific primer binding. Unfortunately, only a limited number
of reverse transcriptases capable of operating at high temperature
are currently available, and these exhibit relatively low fidelity
DNA polymerization. For example, commercially available Avian
Myeloblastosis Virus reverse transcriptase includes RNase H
activity and can function at 37.degree. C., but has a fidelity of
only about 1.7.times.10.sup.-4. RNase H activity competes with the
DNA polymerase activity and the primer binding site and, therefore,
cDNA yield is lower. Accordingly, there is a need for reverse
transcriptase enzymes that are able to carry out reverse
transcription at higher temperatures, including those that have
high fidelity and processivity. Such enzymes are beneficial because
higher temperatures decrease obstructing RNA secondary and tertiary
structure and increase the specificity of reverse transcription by
allowing the use of longer and more specific primers.
SUMMARY OF THE INVENTION
[0005] In one aspect, the invention provides a stabilized reverse
transcriptase (RT) fusion protein that includes a thermostable
reverse transcriptase connected to a stabilizer protein. In one
embodiment of the stabilized reverse transcriptase fusion protein,
the thermostable reverse transcriptase is a bacterial reverse
transcriptase. In a further embodiment, the bacterial reverse
transcriptase is a group II intron-derived reverse transcriptase.
Examples of thermostable bacterial reverse transcriptases include
Thermosynechococcus elongatus reverse transcriptase and Geobacillus
stearothermophilus reverse transcriptase. In another embodiment,
the thermostable reverse transcriptase exhibits high fidelity cDNA
synthesis. In yet another embodiment, the thermostable reverse
transcriptase includes a polypeptide with an amino acid sequence
identity that is substantially similar to a sequence selected from
the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3,
SEQ ID NO: 4, or SEQ ID NO: 5.
[0006] The stabilized reverse transcriptase fusion protein includes
a stabilizer protein that, when linked to the reverse
transcriptase, enhances the shelf life and/or the thermal stability
and/or the solubility of the thermostable reverse transcriptase. In
certain embodiments, the stabilizer protein is an affinity protein
or a solubility-enhancing protein (e.g., a maltose binding protein
or N-utilization substance A protein). In additional embodiments,
the stabilizer protein is modified by replacing certain charged
amino acids with uncharged amino acids.
[0007] The stabilized reverse transcriptase fusion protein can also
include a linker peptide that connects the thermostable reverse
transcriptase to the stabilizer protein. In some embodiments, this
linker peptide is a non-cleavable linker, while in other
embodiments it is a non-cleavable rigid linker. In some
embodiments, the linker peptide consists of 1 to 20 amino acids,
while in other embodiments the linker peptide consists of 1 to 5 or
3 to 5 amino acids. For example, a rigid non-cleavable linker
peptide can include 5 alanine amino acids.
[0008] In additional embodiments, the stabilized reverse
transcriptase fusion protein has an amino acid sequence that
includes a polypeptide with an amino acid sequence identity that is
substantially similar to a sequence selected from the group
consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, or SEQ ID NO: 10. In some embodiments, the stabilized reverse
transcriptase fusion protein is a high fidelity reverse
transcriptase capable of carrying out reverse transcription with an
error frequency of 2.0.times.10.sup.-5 or less at a temperature
from about 45.degree. to about 65.degree. C. In further
embodiments, the stabilized reverse transcriptase fusion protein is
capable of carrying out substantial levels of reverse transcription
at temperatures up to about 81.degree. C.
[0009] Another aspect of the invention provides a method for
preparing a cDNA from an RNA molecule that includes the steps of:
(a) adding a primer nucleotide sequence to an RNA molecule and (b)
incubating the RNA molecule in the presence of one or more modified
or unmodified deoxy or dideoxyribonucleoside triphosphates and a
stabilized reverse transcriptase fusion protein that includes a
thermostable reverse transcriptase connected to a stabilizer
protein under conditions sufficient to synthesize a cDNA molecule
complementary to all or a portion of the RNA molecule. In
particular embodiments, the thermostable reverse transcriptase is
connected to the stabilizer protein by a linker peptide (e.g., a
non-cleavable or rigid non-cleavable linker peptide). Preferably,
the reverse transcription is performed within a temperature range
where RNA includes a substantially decreased amount of obstructing
stable secondary or tertiary structure. Embodiments of this method
include ones in which the thermostable reverse transcriptase is a
group II intron-derived reverse transcriptase. In further
embodiments of the method, the thermostable reverse transcriptase
includes a polypeptide with an amino acid sequence identity that is
substantially similar to a sequence selected from the group
consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:
4, or SEQ ID NO: 5, a non-cleavable linker consists of 1 to 20
amino acids, and the stabilizer protein is an affinity protein or a
solubility-enhancing protein. In yet further embodiments of the
method, the reverse transcription is performed with an error
frequency of 2.0.times.10.sup.-5 or less at a temperature from
about 45.degree. to about 65.degree. C.
[0010] Another aspect of the invention provides a DNA expression
vector for producing a stabilized reverse transcriptase fusion
protein that includes a nucleic acid that encodes a polypeptide
with an amino acid sequence identity that is substantially similar
to a sequence selected from the group consisting of SEQ ID NO: 6,
SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10.
[0011] Another aspect of the invention provides a method of
producing a stabilized reverse transcriptase fusion protein that
includes the steps of: (a) culturing a host cell that includes a
DNA expression vector for producing a stabilized reverse
transcriptase fusion protein that includes a nucleic acid that
encodes a polypeptide with an amino acid sequence identity that is
substantially similar to a sequence selected from the group
consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, or SEQ ID NO: 10; (b) expressing the stabilized reverse
transcriptase fusion protein encoded by the DNA expression vector;
and (c) isolating the stabilized reverse transcriptase fusion
protein from the host cell.
[0012] The stabilized reverse transcriptase fusion protein can
facilitate cDNA synthesis at higher temperature, and/or with higher
processivity, and/or allow the use of longer, more stable, primers
that increase the specificity (i.e., fidelity) of reverse
transcription. The stabilized RT fusion protein of the invention
can therefore be useful for a number of applications, such as
research applications.
[0013] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed.
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIG. 1 is a listing of the amino acid sequence of a reverse
transcriptase from Thermosynechococcus elongatus bound to a maltose
binding protein by a rigid linker (SEQ ID NO: 6). Amino acid
residues 1-367 represent the modified maltose binding protein (SEQ
ID NO: 11); amino acid residues 368-372 represent the rigid linker
(SEQ ID NO: 12); and amino acid residues 373-935 represent the
TeI4c ORF (SEQ ID NO: 1).
[0015] FIG. 2 is a listing of the amino acid sequence of a reverse
transcriptase from Thermosynechococcus elongatus bound to a maltose
binding protein by a rigid linker (SEQ ID NO: 7). Amino acid
residues 1-367 represent the maltose binding protein (SEQ ID NO:
11); amino acid residues 368-372 represent the rigid linker (SEQ ID
NO: 12); and amino acid residues 373-935 represent the TeI4f ORF
(SEQ ID NO: 2).
[0016] FIG. 3 is a listing of the amino acid sequence of a reverse
transcriptase from Thermosynechococcus elongatus bound to a maltose
binding protein by a rigid linker (SEQ ID NO: 8). Amino acid
residues 1-367 represent the maltose binding protein (SEQ ID NO:
11); amino acid residues 368-372 represent the rigid linker (SEQ ID
NO: 12); and amino acid residues 373-935 represent the TeI4h*ORF
(SEQ ID NO: 3).
[0017] FIG. 4 is a listing of the amino acid sequence of a reverse
transcriptase from Geobacillus stearothermophilus bound to a
maltose binding protein by a rigid linker (SEQ ID NO: 9). Amino
acid residues 1-367 represent the maltose binding protein (SEQ ID
NO: 11); amino acid residues 368-372 represent the rigid linker
(SEQ ID NO: 12); and amino acid residues 373-1008 represent the
Geobacillus stearothermophilus GsI1 ORF (SEQ ID NO: 4).
[0018] FIG. 5 is a listing of the amino acid sequence of a reverse
transcriptase from Geobacillus stearothermophilus bound to a
maltose binding protein by a rigid linker (SEQ ID NO: 10). Amino
acid residues 1-367 represent the maltose binding protein (SEQ ID
NO: 11); amino acid residues 368-372 represent the rigid linker
(SEQ ID NO: 12); and amino acid residues 373-792 represent the
Geobacillus stearothermophilus GsI2 ORF (SEQ ID NO: 5).
[0019] FIG. 6 is a listing of the nucleotide sequence of the
MalE-TeI4c open reading frame (ORF) rigid fusion of reverse
transcriptase from Thermosynechococcus elongatus in the pMAL
expression construct (SEQ ID NO: 13).
[0020] FIG. 7 is a listing of the nucleotide sequence of the
MalE-TeI4f ORF rigid fusion of a reverse transcriptase from
Thermosynechococcus elongatus in the pMAL expression construct (SEQ
ID NO: 14).
[0021] FIG. 8 is a listing of the nucleotide sequence of the
MalE-TeI4h*ORF rigid fusion of a reverse transcriptase from
Thermosynechococcus elongatus in the pMAL expression construct (SEQ
ID NO: 15).
[0022] FIG. 9 is a listing of the nucleotide sequence of the
MalE-GsI1 ORF rigid fusion of a reverse transcriptase from
Geobacillus stearothermophilus in the pMAL expression construct
(SEQ ID NO: 16).
[0023] FIG. 10 is a listing of the nucleotide sequence of the
MalE-GsI2 ORF rigid fusion of a reverse transcriptase from
Geobacillus stearothermophilus in the pMAL expression construct
(SEQ ID NO: 17).
[0024] FIG. 11 provides a graph showing the
poly(rA)/oligo(dT).sub.42 assay of reverse transcriptase (RT)
activity at different temperatures. The enzymes assayed were
MalE-RF-GsI1, MalE-RF-GsI2, MalE-RF-TeI4c, MalE-RF-TeI4f,
MalE-RF-TeI4h*, LtrA, and MalE-RF-LtrA. Reactions were done by
incubating the RT (50 nM for TeI4c and 100 nM for all other RTs)
with 100 nM poly(rA)/oligo(dT).sub.42 and 5 .mu.l
[.alpha.-.sup.32P]-dTTP (3,000 Ci/mmol) in 75 mM KCl, 10 mM
MgCl.sub.2, 20 mM Tris-HCl, pH 7.5, and 1 mM DTT. After
preincubating the RT with poly(rA)/oligo(dT).sub.42 in the reaction
medium for 1 min at the indicated temperature, the reaction was
initiated by adding [.alpha.-.sup.32P]-dTTP, incubated for times
verified to be within the linear range (90 sec for TeI4c RT and 5
min for all other RTs), and stopped by adding EDTA to a final
concentration of 250 mM. The polymerization of
[.alpha.-.sup.32P]-dTTP into high-molecular weight material was
quantified by spotting the reaction products onto Whatman DE81
chromatography paper (GE Health care Biosciences Corp), washing
with 0.3 M NaCl and 0.03 M sodium citrate, and scanning with a
PhosphorImager to quantify radioactivity bound to the filter, as
described in Materials and Methods. The plot shows radioactivity
bound to the filter (PhosphorImager units) as a function of
reaction temperature.
[0025] FIG. 12 shows schematic representations of Group II intron
RTs and fusion proteins. Section 12(A) provides comparison of group
II intron-encoded and retroviral RTs. Group II intron RTs
exemplified by the LtrA protein encoded by the L1.LtrB intron
generally contains four major domains: RT, with conserved sequence
blocks RT-1-7; X/thumb; DNA binding (D), and DNA endonuclease (En).
The RT and thumb domains of group II intron RTs are homologous to
those of retroviral RTs exemplified by HIV-1 RT, but are larger due
to an N-terminal extension and insertions upstream (RT-0) and
between the conserved RT sequence blocks (e.g., RT-2a, 3a, 4a, and
7a and thumb domain insertion t.sub.i in LtrA; Blocker et al., RNA
11, 14-28, 2005). The positions of three .alpha.-helices
characteristic of the thumb domains of retroviral RTs are shown for
both LtrA and HIV-RT. The group II intron RTs used in this work all
contain the En domain, except for the GsI2 RT, which lacks the En
domain. Section 12(B) shows group II intron RT fusion proteins.
Group II intron RTs (IEPs) were expressed with fused N-terminal
MalE or NusA solubility tags. Initial constructs contained the MalE
solubility tag in expression vector pMalE-c2t fused to the
N-terminus of the RT via a flexible linker with a TEV protease
cleavage site (underlined). A variant of these initial constructs
tested in FIG. 11 contained the pMalE-c2t linker with the TEV
protease cleavage site deleted. Improved constructs used modified
MalE or NusA tags fused to the N-terminus of the RT via a rigid
linker containing 5 alanine residues (underlined). The modified
MalE tag has charged amino acid residues changed to alanines
(italics), and the modified NusA tag is missing the two C-terminal
amino acid residues.
[0026] FIG. 13 provides graphs showing the RT activity of
derivatives of MalE-RF-TeI4c RT with different rigid fusion linker
or solubility tag sequences. Panel 13(A) provides a bar graph
showing RT activity at 60.degree. C. Reaction with MalE-RF-TeI4c RT
(left bar) or variants containing different tag or linker sequences
(right bars) were done as in FIG. 11 using 50 nM protein and 100 nM
poly(rA)/oligo(dT).sub.42 and incubating for 90 sec. Values are the
mean for three determinations with error bars indicating the
standard deviation. Panel 13(B) provides a graph showing the
temperature profile of RT activity for NusA-RF-TeI4c RT. RT
activity was assayed as in FIG. 11 using 50 nM protein and 100 nM
poly(rA)/oligo(dT).sub.42 and incubating for 2 min at the indicated
temperature. The y-axis shows radioactivity bound to the filter
(PhosphorImager units) for each protein (panel A) or for
NusA-RF-TeI4c RT as a function of reaction temperature (panel
B).
[0027] FIG. 14 provides graphs and autoradiograms that provide a
comparison of cDNA synthesis by MalE-RF-TeI4c, MalE-RF-GsI2, and
SuperScript III RT activity at different temperatures. In panels
(A-C), the substrate was a 531-nt RNA transcribed from
AflIII-digested pBS KS(+) with an annealed 5'-labeled 37-nt primer,
and in panels (D-F), the substrate was a 1.2-kb kanR RNA with an
annealed 5'-labeled 44-nt DNA primer. Reactions were done by
incubating 100 nM of annealed template/primer with 200 nM enzyme in
100 mM KCl, 20 mM Tris HCl pH 7.5, 10 mM MgCl.sub.2 and 10 mM DTT
for MalE-RF-TeI4c RT (panels A and D) and MalE-RF-GsI2 RT (panels B
and E) and in the manufacturer's buffer for SuperScript III RT
(panels C and F). Reactions were initiated by adding dNTPs to a
final concentration of 1.25 mM, incubated for 30 min at the
indicated temperature, and terminated by adding 0.1% SDS/250 mM
EDTA (final concentrations) followed by phenol-CIA extraction. The
products were analyzed by electrophoresis in a denaturing 6%
polyacrylamide gel, which was dried and quantified with a
PhosphorImager. In each panel, the top and bottom autoradiograms
show portions of the gel containing the full-length product (arrow)
and unextended or partially extended primer, respectively, and the
bar graphs show the percentage of primer that was extended to
full-length cDNA based on PhosphorImager quantitation. "?"
indicates unidentified bands not used in quantitation of
full-length product. A 5'-labeled 10-bp ladder (Invitrogen.TM.) was
used as size markers. Schematics of two template primer substrates
are shown at the bottom of the figure.
[0028] FIG. 15 is a listing of the nucleotide sequence of the
1.2-kb kanR RNA template (SEQ ID NO: 21).
[0029] FIG. 16 provides semi-log plots obtained from qRT-PCR to
compare amounts of cDNA synthesis at different temperatures by
MalE-RF-TeI4c RT and SuperScript III RT. cDNA was synthesized with
MalE-RF-TeI4c RT or SuperScript III RT (SSIII RT) using the 1.2-kb
kanR RNA with annealed primer P078 (Tm=80.degree. C.) and detected
with primer/probe sets at nt 188-257 and nt 562-634 (the data for
detection with primer set nt 188-257 are shown in the figure; the
data obtained with the primer set nt 562-634 are shown in FIG. 17).
The qPCR amplification curves show a semi-log plot of fluorescence
(.DELTA.RN) versus cycle number. For each sample, duplicate wells
were analyzed and are depicted in each amplification plot. The
cycle threshold (C.sub.T) values (the cycle at which the
fluorescence crosses the threshold 0.4) for each cDNA synthesis
reaction by MalE-RF-TeI4c or SuperScript III RT are indicated below
the curves. Lower C.sub.T values indicate a larger number of cDNAs
synthesized
[0030] FIG. 17 provides semi-log plots obtained from qRT-PCR to
compare processivity of cDNA synthesis by MalE-RF-TeI4c RT and
SuperScript III RT. cDNA was synthesized with MalE-RF-TeI4c or
SuperScript III RT using the 1.2-kb kanR RNA with annealed primer
P078 (Tm=80.degree. C.) and detected with primer/probe sets at nt
188-257 and nt 562-634. cDNA samples were obtained at 60.degree. C.
(A, B) and 65.degree. C. (C, D). For each sample, triplicates were
analyzed and are depicted in each amplification plot. Average copy
numbers are derived from a standard curve of quantitated and
diluted pET9 plasmid. Detection of similar numbers of cDNA copies
with the two primer sets, as seen for MalE-RF-TeI4c RT, shows that
most cDNAs extend to near the end of the RNA template, indicative
of high processivity. A lower number of cDNA copies detected with
the primer set near the 5' end (nt 188-257) compared to the primer
set closer to the 3' end (nt 562-634), as seen for SuperScript III
RT, indicates that the RT falls off or is in some other way impeded
from reaching the 5' end of the RNA template.
[0031] FIG. 18 is a listing of the amino acid sequence of the NusA
solubility-enhancing protein (SEQ ID NO: 38).
DETAILED DESCRIPTION OF THE INVENTION
[0032] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. The
terminology used in the description of the invention herein is for
describing particular embodiments only and is not intended to be
limiting of the invention. All publications, patent applications,
patents, and other references mentioned herein are incorporated by
reference in their entirety.
Definitions
[0033] As used in the description of the invention and the appended
claims, the singular forms "a," "an," and "the" are intended to
include the plural forms as well, unless the context clearly
indicates otherwise. In addition, the recitations of numerical
ranges by endpoints include all numbers subsumed within that range
(e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
[0034] As used herein, "polypeptide" refers to a polymer of amino
acids and does not imply a specific length of a polymer of amino
acids. Thus, for example, the terms peptide, oligopeptide, protein,
antibody, and enzyme are included within the definition of
polypeptide. This term also includes polypeptides with
post-expression modification, such as glycosylation (e.g., the
addition of a saccharide), acetylation, phosphorylation, and the
like.
[0035] An "isolated" polypeptide or polynucleotide, as used herein,
means a polypeptide or polynucleotide that has been either removed
from its natural environment, produced using recombinant
techniques, or chemically or enzymatically synthesized. Preferably,
a polypeptide or polynucleotide of this invention is purified,
i.e., essentially free from any other polypeptide or polynucleotide
and associated cellular products or other impurities.
[0036] "Amino acid" is used herein to refer to a chemical compound
with the general formula: NH.sub.2--CRH--COOH, where R, the side
chain, is H or an organic group. Where R is organic, R can vary and
is either polar or nonpolar (i.e., hydrophobic). The following
abbreviations are used throughout the application: A=Ala=Alanine,
T=Thr=Threonine, V=Val=Valine, C=Cys=Cysteine, L=Leu=Leucine,
Y=Tyr=Tyrosine, I=Ile=Isoleucine, N=Asn=Asparagine, P=Pro=Proline,
Q=Gln=Glutamine, F=Phe=Phenylalanine, D=Asp=Aspartic Acid,
W=Trp=Tryptophan, E=Glu=Glutamic Acid, M=Met=Methionine,
K=Lys=Lysine, G=Gly=Glycine, R=Arg=Arginine, S=Ser=Serine,
H=His=Histidine. Unless otherwise indicated, the term "amino acid"
as used herein also includes amino acid derivatives that
nonetheless retain the general formula.
[0037] A nucleotide consists of a phosphate group linked by a
phosphoester bond to a pentose (ribose in RNA, and deoxyribose in
DNA) that is linked in turn to an organic base. The monomeric units
of a nucleic acid are nucleotides. Naturally occurring DNA and RNA
each contain four different nucleotides: nucleotides having
adenine, guanine, cytosine and thymine bases are found in naturally
occurring DNA, and nucleotides having adenine, guanine, cytosine
and uracil bases found in naturally occurring RNA. The bases
adenine, guanine, cytosine, thymine, and uracil often are
abbreviated A, G, C, T and U, respectively.
[0038] Nucleotides include free mono-, di- and triphosphate forms
(i.e., where the phosphate group has one, two or three phosphate
moieties, respectively). Thus, nucleotides include ribonucleoside
triphosphates (e.g., ATP, UTP, CTG and GTP) and deoxyribonucleoside
triphosphates (e.g., dATP, dCTP, dITP, dGTP and dTTP), and
derivatives thereof. Nucleotides also include dideoxyribonucleoside
triphosphates (ddNTPs, including ddATP, ddCTP, ddGTP, ddITP and
ddTTP), and derivatives thereof.
[0039] "Substantially similar" means that a given nucleic acid or
amino acid sequence shares at least 85%, more preferably at least
90%, and even more preferably at least 95% identity with a
reference sequence. Furthermore, only sequences describing or
encoding proteins in which only conservative substitutions are made
in the conserved regions are substantially similar overall.
Preferable, substantially similar sequences also retain the
distinctive activity of the polypeptide. Substitutions typically
seen as conservative substitutions are the replacements, one for
another, among the aliphatic amino acids Ala, Val, Leu and Ile;
interchange of the hydroxyl residues Ser and Thr, exchange of the
acidic residues Asp and Glu, substitution between the amide
residues Asn and Gln, exchange of the basic residues Lys and Arg
and replacements among the aromatic residues Phe, Tyr.
[0040] A "promoter," as used herein, refers to a sequence in DNA
that mediates the initiation of transcription by an RNA polymerase.
Transcriptional promoters may comprise one or more of a number of
different sequence elements as follows: 1) sequence elements
present at the site of transcription initiation; 2) sequence
elements present upstream of the transcription initiation site and;
3) sequence elements downstream of the transcription initiation
site. The individual sequence elements function as sites on the
DNA, where RNA polymerases and transcription factors that
facilitate positioning of RNA polymerases on the DNA bind.
[0041] As used herein, the term "polymerase chain reaction" ("PCR")
refers to a method for increasing the concentration of a segment of
a target sequence in a mixture of genomic DNA without cloning or
purification. See for example Bartlett et al., Methods Mol. Biol.
226:3-6 (2003), which provides an overview of PCR and its
development. This process for amplifying the target sequence
typically consists of introducing a large excess of two
oligonucleotide primers to the DNA mixture containing the desired
target sequence, followed by a precise sequence of thermal cycling
in the presence of a DNA polymerase. The two primers are
complementary to their respective strands of the double stranded
target sequence. To effect amplification, the mixture is denatured
and the primers then annealed to their complementary sequences
within the target molecule. Following annealing, the primers are
extended with a polymerase so as to form a new pair of
complementary strands. The steps of denaturation, primer annealing
and polymerase extension can be repeated many times to obtain a
high concentration of an amplified segment of the desired target
sequence. Unless otherwise noted, PCR, as used herein, also
includes variants of PCR such as allele-specific PCR, asymmetric
PCR, hot-start PCR, ligation-mediated PCR, multiplex-PCR, reverse
transcription PCR, or any of the other PCR variants known to those
skilled in the art.
[0042] As used in this specification, whether in a transitional
phrase or in the body of the claim, the terms "comprise(s)" and
"comprising" are to be interpreted as having an open-ended meaning.
That is, the terms are to be interpreted synonymously with the
phrases "having at least" or "including at least". When used in the
context of a process, the term "comprising" means that the process
includes at least the recited steps, but may include additional
steps. When used in the context of a compound or composition, the
term "comprising" means that the compound or composition includes
at least the recited features or components, but may also include
additional features or components.
[0043] A "fusion protein," as used herein, refers to a protein
having at least two heterologous polypeptides covalently linked in
which one polypeptide comes from one protein sequence or domain and
the other polypeptide comes from a second protein sequence or
domain.
Stabilized Reverse Transcriptase Fusion Protein
[0044] The invention provides a stabilized reverse transcriptase
fusion protein that includes a thermostable reverse transcriptase
connected to a stabilizer protein. In many embodiments, the
thermostable reverse transcriptase is connected to the stabilizer
protein via a linker peptide. However, the thermostable reverse
transcriptase and the stabilizer protein can also be directly fused
to one another. The polypeptides that comprise the fusion protein
are preferably linked N-terminus to C-terminus. However, the
reverse transcriptase and the stabilizer protein can be connected
together in either order. For example, the two peptide sequences
can be connected from the C-terminus to N-terminus or N-terminus to
the C-terminus. In some embodiments, a linker peptide is included
between the connecting C-terminus and N-terminus of the reverse
transcriptase and stabilizer protein.
[0045] Attaching a stabilizer protein to the thermostable reverse
transcriptase can provide one or more advantages. A stabilized
reverse transcriptase fusion protein can have one or more of the
following advantages: (a) increased stability at elevated
temperatures; (b) higher processivity, (c) increased solubility,
and/or (d) higher fidelity. In some embodiments, a reverse
transcriptase of the invention may have a plurality of the
properties listed above. For example, a stabilized reverse
transcriptase fusion protein may have increased thermostability and
increased fidelity. The advantages may sometimes derive from one
another. For example, by providing increased solubility, the
stabilized reverse transcriptase fusion protein can provide a
product able to provide increased fidelity of transcription as a
result of solubilizing a previously insoluble high fidelity
thermostable reverse transcriptase. The use of a stabilizer protein
in the fusion protein can also provide other advantages such as
increased protein expression and improved protein folding.
Inclusion of a linker peptide between the stabilizer protein and
the thermostable reverse transcriptase can further enhance these
advantages.
[0046] The stabilized reverse transcriptase fusion protein includes
a thermostable reverse transcriptase and a stabilizer protein, as
described herein. The stabilized reverse transcriptase fusion
protein can also includes a linker peptide. For example, the
stabilized reverse transcriptase fusion protein can have an amino
acid sequence as set forth in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID
NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10, shown in FIGS. 1-5,
respectively. Alternately, the stabilized reverse transcriptase
fusion protein can have an amino acid sequence that is
substantially similar to one or more of the sequences as set forth
in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ
ID NO: 10. A stabilized reverse transcriptase fusion protein amino
acid sequence that is "substantially similar" to the fusion
proteins provided by sequences 6-10 will share at least 85%
identity, more preferably 90% identity and even more preferably 95%
identity, and will include only conservative amino acid
substitutions in conserved regions.
Thermostable Reverse Transcriptases
[0047] The present invention provides a reverse transcriptase
fusion protein that includes a thermostable reverse transcriptase.
The term "reverse transcriptases" (i.e., RNA-directed DNA
polymerases) refers to a group of enzymes having reverse
transcriptase activity (i.e., that catalyze synthesis of DNA from
an RNA template). In general, such enzymes include, but are not
limited to, retroviral reverse transcriptase, retrotransposon
reverse transcriptase, and bacterial reverse transcriptases such as
group II intron-derived reverse transcriptase, and mutants,
variants or derivatives thereof. Examples of bacterial reverse
transcriptase include Lactococcus lactis reverse transcriptase,
Thermosynechococcus elongatus reverse transcriptase, or Geobacillus
stearothermophilus reverse transcriptase. Further bacterial reverse
transcriptases are described by Simon et al., Nucleic Acids
Research, 36, p. 7219-29 (2008), and Kojima and Kanehisa, Molecular
Biology and Evolution, 25, p. 1395-04 (2008) which describe many
classes of reverse transcriptases (i.e., retrons, group II introns,
and diversity-generating retroelements among others). Reverse
transcriptase has been used primarily to transcribe RNA into cDNA,
which can then be cloned into a vector for further manipulation or
used in various amplification methods such as polymerase chain
reaction, nucleic acid sequence-based amplification (NASBA),
transcription mediated amplification (TMA), self-sustained sequence
replication (3 SR), diverse primer extension reactions, 5'RACE,
detection of chemical modifications or other techniques that
require synthesis of DNA using an RNA template.
[0048] The term "thermostable" refers to the ability of an enzyme
or protein (e.g., reverse transcriptase) to be resistant to
inactivation by heat. Typically such enzymes are obtained from a
thermophilic organism (i.e., a thermophile) that has evolved to
grow in a high temperature environment. Thermophiles, as used
herein, are organisms with an optimum growth temperature of
45.degree. C. or more, and a typical maximum growth temperature of
70.degree. C. or more. In general, a thermostable enzyme is more
resistant to heat inactivation than a typical enzyme, such as one
from a mesophilic organism. Thus, the nucleic acid synthesis
activity of a thermostable reverse transcriptase may be decreased
by heat treatment to some extent, but not as much as would occur
for a reverse transcriptase from a mesophilic organism.
"Thermostable" also refers to an enzyme which is active at
temperatures greater than 38.degree. C., preferably between about
38-100.degree. C., and more preferably between about 40-81.degree.
C. A particularly preferred temperature range is from about
45.degree. C. to about 65.degree. C.
[0049] In some embodiments, a thermostable reverse transcriptase
retains at least 50% (e.g., at least 60%, at least 70%, at least
80%, at least 90%, or at least 95%) of its nucleic acid synthetic
activity after being heated in a nucleic acid synthesis mixture at
90.degree. C. for 30 seconds. In contrast, typical reverse
transcriptases will not work at elevated temperatures, and lose
most of their nucleic acid synthetic activity after such heat
treatment. Thermostable reverse transcriptases typically also have
a higher optimum nucleic acid polymerization temperature.
[0050] Some reverse transcriptases are thermostable and therefore
remain substantially active at temperatures commonly used in
PCR-based nucleic acid synthesis. This provides the advantage of
being able to carry out both reverse transcription and DNA
amplification in a single reaction environment. Such temperatures
vary depending upon reaction parameters, including pH, template and
primer nucleotide composition, primer length, and salt
concentration. Thermostable reverse transcriptases include
Thermosynechococcus elongatus (Te) RT, Geobacillus
stearothermophilus (Gs) RT, modified forms of these RTs, and
engineered variants of Avian myoblastosis virus (AMV) RT, Moloney
murine leukemia virus (M-MLV) RT, and Human immunodeficiency virus
(HIV) RT. A reverse transcriptase obtained from an organism living
in an elevated temperature environment (i.e., greater than
37.degree. C.) can be expected to be stable at the living
temperature of the organism, and to a reasonable degree above.
[0051] A class of reverse transcriptases that is particularly
suitable for use in stabilized reverse transcriptase fusion
proteins are group II intron-derived reverse transcriptases. A wide
variety of group II intron-derived reverse transcriptases are
known. See for example the Zimmerly Lab Website for Mobile Group II
Introns that describes 105 full length group II intron-derived
reverse transcriptases. The use of this website is described by Dai
et al., Nucleic Acids Research, 31, p. 424-26 (2003).
[0052] In certain embodiments the thermostable reverse
transcriptase is one that was encoded by a group II intron. Group
II intron RTs typically consist of four conserved domains: RT,
which contains seven conserved sequence blocks (RT1-7)
characteristic of the fingers and palm regions of retroviral RTs;
X, a region required for RNA splicing activity corresponding at
least in part to the thumb domain of retroviral RTs; D, a
DNA-binding domain involved in DNA target site recognition; and En,
a DNA endonuclease domain that cleaves the DNA target site to
generate the primer for reverse transcription (FIG. 12A; Blocker et
al., RNA 11, 14-28, 2005). The En domain is missing in some group
II intron RTs, which instead use nascent strands at DNA replication
forks to prime reverse transcription (Zhong et al., EMBO J. 22,
4555-4565, 2003). The RT and X/thumb domains of group II intron RTs
are larger than those of retroviral RTs due to an N-terminal
extension, an additional N-terminal conserved sequence block
(RT-0), and insertions between the conserved sequence blocks in the
RT and X/thumb domain, some of which are shared with
non-LTR-retrotransposon RTs. It has been suggested that the
larger-sized RT and thumb domains of group II intron and related
RTs enable tighter binding of template RNAs leading to higher
processivity and fidelity during reverse transcription. Unlike
retroviral RTs, group II intron RTs lack an RNase H domain and
typically have very low DNA-dependent DNA polymerase activity
(Smith et al., Genes and Development 19, 2477-2487, 2005).
[0053] Group II introns encode a class of RNAs known for their
self-splicing reaction. Under certain in vitro conditions, group II
intron-encoded RNAs can excise themselves from precursor mRNAs and
ligate together their flanking exons, without the aid of a protein.
The splicing reaction mechanism is similar to the splicing of
nuclear pre-mRNA introns. A number of group II introns also encode
reverse transcriptase (RT) open reading frames (ORF) and are active
mobile elements. The ORF is typically found in domain DIV of the
group II intron encoded RNA. The group II intron RT assists RNA
splicing by stabilizing the catalytically active RNA structure and
then remains bound to the excised intron RNA in a ribonucleoprotein
(RNP) that promotes intron mobility by a process termed
"retrohoming." Retrohoming occurs by a mechanism in which the
excised intron RNA in the RNPs inserts directly into a DNA target
site and is reverse transcribed by the RT. During retrohoming, in
which the group II intron facilitates targeting of the intron to
appropriate DNA sequences, the group II intron RT must produce an
accurate cDNA copy of the intron RNA, which is typically 2-2.5 kb
long and folds into highly stable and compact secondary and
tertiary structures. Thus, group II intron RTs must have high
processivity and fidelity in order to carry out their biological
function. Group II intron-derived RTs also lack RNase H activity,
which can be beneficial because RNase H specifically degrades the
RNA of RNA:DNA hybrids, which allows any RNA to be copied only once
and can lead to reduced yields of full length cDNA.
[0054] Based on the group II intron-derived reverse transcriptases
so far evaluated, these RTs typically exhibit relatively high
fidelity and high processivity. The fidelity of reverse
transcription refers to the reliability of nucleotide incorporation
during reverse transcription of RNA to DNA, with higher fidelity
describing nucleotide copying with a low number of errors (e.g.,
misincorporations). Higher specificity can be provided by using
longer and more specific primers, which requires the ability to
carry out reverse transcription at higher temperatures. For
example, a group II intron reverse transcriptase can provide
reverse transcription with an error frequency of
2.0.times.10.sup.-5 or less, wherein the error frequency represents
the proportion of nucleotide copying errors that occur relative to
the number of nucleotide copying events that occur without error.
Other examples of high fidelity transcription include error
frequencies of 1.times.10.sup.-4, 7.5.times.10.sup.-5,
5.times.10.sup.-5, 2.5.times.10.sup.-5, 1.times.10.sup.-5, and
5.times.10.sup.-6. For further description of the high fidelity of
group II intron-derived RTs, see Conlan et al., Nucleic Acids
Research, 33, p. 5262-70 (2005).
[0055] Examples of suitable group II-derived intron reverse
transcriptases include the reverse transcriptases set forth in SEQ
ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO:
5, which are obtained from Thermosynechococcus elongatus (TeI4c, f,
and h*) and Geobacillus stearothermophilus (GsI1 and GsI2). These
sequences are shown in FIGS. 1-5. The invention also encompasses
group II intron derived reverse transcriptases that are
substantially similar to those set forth in SEQ ID NO: 1, SEQ ID
NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. A reverse
transcriptase that is "substantially similar" to the reverse
transcriptases provided by sequences 1-5 will share at least 85%
identity, more preferably 90% identity and even more preferably 95%
identity, and will include only conservative amino acid
substitutions in conserved regions. The thermostability of a number
of group II intron-derived RTs is shown in FIG. 11, which
demonstrates that stabilized reverse transcriptase fusion proteins
including the reverse transcriptases as set forth in SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5 have
higher thermostability than mesophilic L1.LtrB reverse
transcriptase, whether or not it is part of a fusion protein, when
evaluated as shown in FIG. 11. The mesophilic L1.LtrB showed a
temperature optimum of about 35.degree. C. either alone or as part
of a fusion protein.
[0056] As noted herein, modified forms of thermostable group II
intron-derived RTs can also be used. For example, SEQ ID NO: 3, the
TeI4h*RT, does not represent a native form of reverse
transcriptase, but rather is a derivative in which the active site
was modified from the amino acid sequence YAGD to the amino acid
sequence YADD, to more closely resemble the active site of other
active group II intron-derived RTs.
[0057] The amount by which a given amino acid sequence is
"substantially similar" to a reference sequence can be determined
for example, by comparing sequence information using sequence
analysis software such as the Blastp program, version 2.2.10, of
the BLAST 2 search algorithm, as described by Tatusova et al. (FEMS
Microbiology Letters, 174, p. 247-50 (1999)), and available on the
world wide web at the National Center for Biotechnology Information
website, under BLAST in the Molecular Database section. Preferably,
the default values for all BLAST 2 search parameters are used,
including matrix=BLOSUM62; open gap penalty=11, extension gap
penalty=1, gap x_dropoff=50, expect=10, wordsize=3, and optionally,
filter on. In the comparison of two amino acid sequences using the
BLAST search algorithm, structural similarity is referred to as
"similarity" and identity is referred to as "identity."
[0058] Amino acid identity is defined in the context of a
comparison between a candidate polypeptides and a reference amino
acid sequence, and is determined by aligning the residues of the
two amino acid sequences (i.e., a candidate amino acid sequence and
the reference amino acid sequence) to optimize the number of
identical amino acids along the lengths of their sequences; gaps in
either or both sequences are permitted in making the alignment in
order to optimize the number of identical amino acids, although the
amino acids in each sequence must nonetheless remain in their
proper order.
[0059] Information is available to support a structure-function
correlation for group II intron-derived reverse transcriptases. See
for example Simon et al., Nucleic Acids Research, 36, p. 7219-29
(2008), which classifies and aligns the RT domains of bacterial
reverse transcriptases, and Xiong et al., EMBO J., 9, p. 3353-62
(1990), which provides an alignment of 82 RT sequences showing
seven conserved domains and 42 conserved positions. See also
Blocker et al, RNA, 11, p. 14-28 (2005), which provides a
three-dimensional model of Lactococcus lactis L1.LtrB intron RT
(the LtrA protein), describes the proteolytic cleavage sites and
conserved regions, and provides a sequence alignment analysis of
LtrA relative to HIV-1 RT. Accordingly, a variety of stabilized
reverse transcriptase fusion proteins that are substantially
similar to those set forth in SEQ ID NO. 6-10 can readily be
obtained by modification of amino acids outside of the conserved
regions, and only conservative modification of amino acids within
the known conserved regions.
[0060] In one embodiment, the present invention provides a
stabilized reverse transcriptase fusion protein having a reverse
transcriptase activity that has a half-life of greater than that of
the corresponding unbound reverse transcriptase at an elevated
temperature, i.e., greater than 37.degree. C. In some embodiments,
the half-life of a reverse transcriptase of the present invention
may be 5 minutes or greater and preferably 10 minutes or greater at
50.degree. C. In some embodiments, the reverse transcriptases of
the invention may have a half-life (e.g., at 50.degree. C.) equal
to or greater than about 25 minutes, preferably equal to or greater
than about 50 minutes, more preferably equal to or greater than
about 100 minutes, and most preferably, equal to or greater than
about 200 minutes.
Stabilizer Proteins
[0061] The stabilized reverse transcriptase fusion protein of the
present invention also includes a stabilizer protein. A stabilizer
protein, as defined herein, is a protein forming part of the fusion
protein that functions to increase the overall stability of the
fusion protein. Stability includes the ability of the protein to
retain its conformation and activity. In addition, the stabilizer
protein preferably enhances the solubility of the fusion protein,
as further described herein with regard to solubility-enhancing
proteins. This can be particularly helpful with regard to group II
intron RTs, which have been found to be poorly expressed and
insoluble in the absence of the intron RNA to which they are
ordinarily tightly bound in RNPs. (Vellore et al. Appl. Environ.
Microbiol. 70, 7140-7147, 2004; Ng et al., Gene 393, 137-144, 2007)
Effective stabilizer proteins include those that include an
independent folding domain and/or do not fold into long-lived
misfolded intermediates that can influence the propensity of
proteins to aggregate. Proteins that will provide an independent
folding domain are described by Janin et al., Progress in
Biophysics and Molecular Biology, 42, p. 21-78 (1983), and proteins
that do not fold into long-lived misfolded intermediates are
described by Idicula et al., Protein Science, 14, p. 582-592
(2005). For example, the stabilizer protein can be a protein that
includes 50 or more amino acids. In other embodiments, the
stabilizer protein can be a larger protein including 100 or more
amino acids. As exemplified by the maltose binding protein and NusA
proteins provided herein, the stabilizer proteins can also have a
size from about 250 amino acids to about 400 amino acids. The
stabilizer protein can also be a thermostable protein.
[0062] The stabilizer protein can also be or include an affinity
protein. The term affinity protein, as used herein, refers to a
protein for which there is a readily available ligand that exhibits
a high binding constant (i.e., "affinity") for the protein.
Affinity proteins are often used in the role of an affinity tag.
Affinity proteins, as is known to those skilled in the art, can be
provided in fusion proteins to facilitate the purification of the
protein connected or fused to the affinity protein by techniques
such as affinity purification, in which a tag binds to a ligand
within an affinity column. Suitable affinity proteins are known in
the art. See for example Waugh, D., Trends in Biotechnology, 23, p.
316-320 (2005), which describes a number of suitable affinity
proteins, including glutathione S-transferase, maltose-binding
protein, FLAG-tag peptide, biotin acceptor peptide,
streptavidin-binding peptide, and calmodulin-binding peptide. For
the preparation and use of fusion proteins that include an affinity
protein, see for example U.S. Pat. Nos. 5,643,758, 5,654,176, and
7,001,745.
[0063] The stabilizer protein can also be a solubility-enhancing
protein. Recombinantly-expressed fusion proteins can exhibit low
solubility in their host cells and/or in subsequent method
applications, which can be ameliorated through inclusion of a
solubility-enhancing protein in the fusion protein that
substantially increases the solubility of the fusion protein in
aqueous environments. Some solubility-enhancing proteins used are
also affinity proteins, and can therefore be described as
solubility-enhancing affinity proteins. Examples of
solubility-enhancing proteins include sugar binding proteins such
as arabinose binding protein, chitin binding protein, cellulose
binding protein, and maltose binding protein. Other examples of
solubility-enhancing proteins include the NusA and Dsb solubility
tags provided by Novagen.RTM., and the solubility enhancing tag
(SET) provided by Invitrogen.TM.. Harrison has demonstrated the
very high solubility provided by the NusA solubility tag, while the
solubility enhancement of Dsb is described by Collins-Racie. See
Harrison, R. G., inNovations, 11, p. 4-7 (2000), and Collins-Racie
et al., Biotechnology, 13, p. 982-87 (1995).
[0064] In some embodiments, stabilizer proteins such as
solubility-enhancing proteins or affinity proteins can be modified
to improve their performance. Modification can include providing
one or more substitutions, additions or deletions of amino acids
within the protein sequence of the stabilizer protein as compared
to the normal, wild-type sequence of the protein. For example, a
stabilizer protein such as an affinity protein or a
solubility-enhancing protein can be modified by replacing the
charged amino acids with uncharged amino acids in certain regions
of the protein. Charged amino acids include amino acids with
positively or negatively charged side chains. Examples of amino
acids with positively charged side chains include arginine,
histidine, lysine, and the like. Examples of amino acids with
negatively charged side chains include aspartic acid and glutamic
acid, and the like. Uncharged amino acids include, but are not
limited to, alanine, serine, threonine, glutamine, valine, leucine,
isoleucine, phenylalanine, and tyrosine. For example, a maltose
binding protein can be modified by replacing one or more of the
charged amino acids with alanine.
[0065] Examples of suitable affinity proteins include the maltose
binding protein amino acid sequence set forth in SEQ ID NO: 11,
shown in FIGS. 1-5, and sequences substantially similar to SEQ ID
NO: 11. Note that while modification of the affinity protein is not
necessary, the maltose binding protein set forth in SEQ ID NO: 11
was modified to replace three charged amino acids with alanine near
the C-terminus. Another suitable protein, in this case a
solubilizing protein, is the N-utilization substance A (NusA)
protein, which has the amino acid sequence set forth in SEQ ID NO:
38, shown in FIG. 18. In additional embodiments of the invention,
fusion proteins described herein that include the maltose binding
proteins can have the maltose binding protein replaced with
N-utilization substance A proteins.
Linker Peptides
[0066] In some embodiments, the stabilized reverse transcriptase
fusion protein also includes a linker peptide positioned between
the stabilizer protein and the thermostable reverse transcriptase.
Preferably, the linker peptide is a non-cleavable linker peptide.
By "positioned between," it is meant that the linker peptide is
connected by a chemical linkage (e.g., an amide linkage) to the N
or C terminal of each of the stabilizer protein and the reverse
transcriptase, as described in regard to fusion proteins herein.
For example, the linker peptide can be connected through an amide
linkage to the C terminal region of the stabilizer protein and the
N terminal region of the thermostable reverse transcriptase. By
non-cleavable, it is meant that the linker peptide is not readily
susceptible to cleavage by a protease.
[0067] In additional embodiments, the linker peptide is a rigid
linker peptide; i.e., a relatively non-flexible peptide linker.
Rigid linker peptides are not required to completely lack
flexibility, but rather are significantly less flexible than
flexible linker peptides such as glycine-rich peptide linkers.
Rigid linker peptides, as a result of their relative lack of
flexibility, decrease the movement of the two protein domains
attached together by the rigid linker peptide, which in the present
case are the stabilizer protein and the thermostable reverse
transcriptase. Linker peptides that provide ordered chains such as
alpha helical structure can provide rigid linker peptides. For
example, Arginine, Leucine, Glutamate, Glutamine, and Methionine
all show a relatively high propensity for helical linker formation.
However, a non-helical linker including many proline residues can
exhibit significant rigidity as well. Examples of rigid linkers
include polylysine and poly-DL-alaninepolylysine. Further
description of rigid peptide linkers is provided by Wriggers et
al., Biopolymers, 80, p. 736-46 (2005). In addition, rigid linker
peptides are described at the linker database described by George
et al., Protein Engineering, 15, p. 871-79 (2003). Preferably, the
rigid linker peptide is also a non-cleavable linker peptide; i.e.,
a non-cleavable, rigid linker peptide.
[0068] Relatively short polypeptides are preferred for use as
linker peptides. For example, linker peptides can include from 1 to
20 amino acids. Linker peptides can also include from 1 to 15, from
1 to 10, from 1 to 5, or from 3 to 5 amino acids. Examples of
specific sequences that can be used as linker peptides include
dipeptides, tripeptides, tetrapeptides, and pentapeptides formed of
alanine amino acids. One suitable rigid linker peptide is AAAAA
(SEQ ID NO: 12), while another suitable rigid linker peptide is
AAAEF (SEQ ID NO: 18). Use of a linker peptide (e.g., a rigid
linker peptide) in a fusion protein can provide one or more
advantages. For example, while not intending to be bound by theory,
it is believed that use of a rigid linker peptide can stabilize the
fusion protein by decreasing the amount of movement of the two
halves of the fusion protein relative to one another. While very
short (i.e., 1 or 2 amino acid) linkers can be used, it is
preferable to use linkers that include from 3 to 5 amino acids.
[0069] The linker peptide can be either cleavable or non-cleavable
by a protease. Affinity proteins are often associated to another
protein in a fusion protein using a cleavable peptide so that the
affinity protein can be removed. However, in the present invention
the stabilizer protein (e.g., an affinity protein) remains bound to
the reverse transcriptase, for the reasons described herein.
Accordingly, it is generally preferable that the linker peptide be
non-cleavable. However, cleavable linkers can be used in some
embodiments. For example, cleavable linkers, including rigid
cleavable linker peptides, that are susceptible to protease
cleavage can be used if it is desirable to remove the stabilizer
protein during a subsequent step and exposure to the cleaving
protease is avoided during use of the fusion protein.
Use of Stabilized Reverse Transcriptase Fusion Proteins
[0070] The invention also provides a method for preparing a cDNA
from an RNA (e.g., mRNA, rRNA, tRNA, and miRNA), which is required
for other methods such as the reverse transcription polymerase
chain reaction (RT-PCR). As used herein, the term "RT-PCR" refers
to the replication and amplification of RNA sequences. In this
method, reverse transcription is coupled to PCR, e.g., as described
in U.S. Pat. No. 5,322,770. In RT-PCR, the RNA template is
converted to cDNA due to the reverse transcriptase activity of an
enzyme, and then amplified using the polymerizing activity of the
same or a different enzyme.
[0071] In the practice of the invention, cDNA molecules may be
produced by mixing one or more nucleic acid molecules (e.g., RNA)
obtained from cells, tissues, or organs using methods that are well
known in the art, with the composition of the invention, under
conditions favoring the reverse transcription of the nucleic acid
molecule by the action of the enzymes of the compositions to form a
cDNA molecule (single-stranded or double-stranded). Thus, the
method of the invention comprises (a) mixing one or more nucleic
acid templates (preferably one or more RNA or mRNA templates, such
as a population of mRNA molecules) with stabilized RT fusion
protein of the invention and (b) incubating the mixture under
conditions sufficient to permit cDNA synthesis of all or a portion
of the one or more nucleic acid templates.
[0072] In one aspect, the method includes the steps of (a) adding a
primer to an RNA molecule and (b) incubating the RNA molecule in
the presence of one or more deoxy or dideoxyribonucleoside
triphosphates and a stabilized reverse transcriptase fusion protein
comprising a thermostable reverse transcriptase connected to a
stabilizer protein under conditions sufficient to synthesize a cDNA
molecule complementary to all or a portion of the RNA molecule.
Adding the primer to an RNA molecule may include hybridizing the
primer to the RNA molecule. In some embodiments, the stabilized
reverse transcriptase fusion protein can also include a linker
peptide connecting the stabilizer protein to the thermostable
reverse transcriptase. Preferably, the reverse transcription is
performed within a temperature range where the RNA includes a
substantially decreased amount of obstructing stable secondary or
tertiary structure. This can be a temperature from about 45.degree.
C. to about 81.degree. C., with a more preferred temperature range
being from about 45.degree. C. to about 65.degree. C. This can also
be described as a temperature range in which the RNA does not form
a significant amount of stable secondary or tertiary structure. Due
to the high fidelity and other advantages of group II
intron-derived RTs, their use may be preferred. For example, the
stabilized reverse transcriptase fusion protein can include a group
II intron-derived reverse transcriptase with an amino acid sequence
identity that is substantially similar to a sequence selected from
the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3,
SEQ ID NO: 4, or SEQ ID NO: 5, a non-cleavable linker consisting of
1 to 20 amino acids, and the stabilizer protein comprises a
solubility-enhancing or affinity protein. The stabilized reverse
transcriptase fusion protein can also include a linker peptide
between the stabilizer peptide and the reverse transcriptase, which
can have a length from 1-20 amino acids, can be a non-cleavable
linker, or can be rigid linker. Embodiments of the method can
perform reverse transcription with an error frequency of
2.0.times.10.sup.-5 or less. Particularly at a temperature from
about 45.degree. C. to about 65.degree. C.
[0073] The stabilized reverse transcriptase fusion proteins can
also be used in other applications. For example, stabilized RT
fusion proteins can be used for the cloning of differentially
expressed 5' ends of mRNAs; a process referred to as rapid
amplification of cDNA ends (RACE) and variations thereof such as
RNA ligase mediated RACE (RLM-RACE). Stabilized RT fusion proteins
can also be used for the mapping of chemical footprints in RNA,
differential display RT-PCR, which allows for the analysis of gene
expression among cell populations, and in-situ PCR for medical
diagnosis.
Preparation of Stabilized Reverse Transcriptase Fusion Proteins
[0074] An expression vector containing a stabilized reverse
transcriptase fusion protein-encoding nucleic acid molecule may be
used for high-level expression of stabilized reverse transcriptase
fusion protein in a recombinant host cell. Expression vectors may
include, but are not limited to, cloning vectors, modified cloning
vectors, specifically designed plasmids or viruses. A variety of
expression vectors may be used to express recombinant stabilized
reverse transcriptase fusion sequences in appropriate cell types.
For example, bacterial vectors, mammalian vectors, fungal vectors,
and insect vectors may be used for expression in bacteria,
mammalian cells, fungal cells, and insect cells, respectively.
[0075] Stabilized reverse transcriptase fusion proteins can be
prepared by obtaining a nucleotide sequence capable of expressing a
stabilized reverse transcriptase fusion protein and then expressing
that nucleotide sequence in a host cell. The stabilized reverse
transcriptase fusion proteins expressed by the host cell can then
be purified using a variety of techniques known to those skilled in
the art, depending in part on the nature of the host cell.
[0076] Nucleotide sequences capable of expressing stabilized
reverse transcriptase fusion proteins of the invention can be
prepared using a variety of methods known to those skilled in the
art. For example, the nucleotide sequences can be prepared using
recombinant plasmids in which various linkers, reverse
transcriptases, and stabilizer proteins are combined, as described
in Example 1 herein.
[0077] The present invention also relates to host cells transformed
or transfected with vectors comprising a nucleic acid molecule
capable of expressing a stabilized reverse transcriptase fusion
protein. Recombinant host cells may be prokaryotic or eukaryotic,
including but not limited to, bacteria such as E. coli, fungal
cells such as yeast, mammalian cells including, but not limited to,
cell lines of bovine, porcine, monkey and rodent origin; and insect
cells including but not limited to Drosophila and silkworm derived
cell lines. Such recombinant host cells can be cultured under
suitable conditions to produce a stabilized reverse transcriptase
fusion protein or a biologically equivalent form. As defined
herein, the term "host cell" is not intended to include a host cell
in the body of a transgenic human being, human fetus, or human
embryo.
[0078] As noted above, an expression vector containing DNA encoding
a stabilized reverse transcriptase fusion protein may be used for
expression of stabilized reverse transcriptase fusion protein in a
recombinant host cell. Therefore, another aspect of this invention
is a process for expressing a stabilized reverse transcriptase
fusion protein in a recombinant host cell, comprising: (a)
introducing a vector comprising a nucleic acid comprising a
sequence of nucleotides that encodes a stabilized reverse
transcriptase fusion protein into a suitable host cell, wherein the
stabilized reverse transcriptase fusion protein comprises a
thermostable reverse transcriptase connected to a stabilizer
protein directly or via a linker and (b) culturing the host cell
under conditions which allow expression of the stabilized reverse
transcriptase fusion protein. The stabilized reverse transcription
fusion protein can be varied to include any of the features
described herein, such as the inclusion of a linker peptide
connecting the thermostable reverse transcriptase and the
stabilizer protein.
[0079] Following expression of a stabilized reverse transcriptase
fusion protein in a host cell, the stabilized reverse transcriptase
fusion protein may be recovered to provide purified stable reverse
transcriptase fusion protein. Several protein purification
procedures are available and suitable for use. For instance, see
Example 2 provided herein. Recombinant protein may be purified from
cell lysates and extracts by various combinations of, or individual
application of salt fractionation, ion exchange chromatography,
size exclusion chromatography, hydroxylapatite adsorption
chromatography and hydrophobic interaction chromatography. The use
of affinity tags in some embodiments of the invention can
facilitate purification of the protein. For example, the stabilized
reverse transcriptase fusion protein can be separated from other
cellular proteins by use of an immunoaffinity column made with
monoclonal or polyclonal antibodies specific for the reverse
transcriptase or stabilizer protein portion of the fusion protein.
Heating can be used to separate the stabilized reverse
transcriptase fusion protein from host proteins, which are not
stable at elevated temperatures and will therefore precipitate.
[0080] The nucleic acids capable of expressing a stabilized RT
fusion protein may be assembled into an expression cassette which
comprises sequences designed to provide for efficient expression of
the fusion protein in a host cell. The cassette preferably contains
a stabilized reverse transcriptase fusion protein-encoding open
reading frame, with related transcriptional and translations
control sequences operatively linked to it, such as a promoter, and
termination sequences. For example, the open reading frame can
include a nucleic acid that encodes a polypeptide with an amino
acid sequence identity that is substantially similar to a sequence
selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7,
SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10, as shown in FIGS.
1-5, respectively. In a preferred embodiment, the promoter is a T7
or a tac promoter for expression in E. coli, although those skilled
in the art will recognize that any of a number of other known
promoters may be used. E. coli also has rho independent and
dependent terminators and can use T7 polymerase for rapid DNA
replication. In eukaryotic cells, inclusion of a polyadenylation
site will be helpful for the correct processing of mRNA.
[0081] The open reading frame can also include polynucleotide
sequences as set forth in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO:
15, SEQ ID NO: 16, and SEQ ID NO: 17, as shown in FIGS. 6-10,
respectively. Alternately, the open reading frame can include
polynucleotide sequences that are substantially similar to those
set forth in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID
NO: 16, and SEQ ID NO: 17. In this particular context, the term
"substantially similar" refers to variants in the nucleotide
sequence in which codons that encode the same amino acid can be
used interchangeably such that the nucleotide sequence will still
result in the translation of an amino acid sequence corresponding
to SEQ ID NO: 6-10. The stabilized reverse transcriptase fusion
protein open reading frame polynucleotide preferably has at least
about 80% identity, at least about 90% identity, at least about 95%
identity, or at least about 98% identity to a polynucleotide
sequence selected from the group consisting of SEQ ID NO: 13, SEQ
ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17.
[0082] Nucleotide identity is defined in the context of a
comparison between a candidate stabilized reverse transcriptase
fusion protein open reading frame and a polynucleotide sequence
selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 14,
SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, and is determined
by aligning the residues of the two polynucleotides to optimize the
number of identical nucleotides along the lengths of their
sequences; gaps in either or both sequences are permitted in making
the alignment in order to optimize the number of shared
nucleotides, although the nucleotides in each sequence must
nonetheless remain in their proper order. Preferably, two
nucleotide sequences are compared using the Blastn program of the
BLAST 2 search algorithm, as described by Tatusova, et al. (FEMS
Microbiology Letters, 174, p. 247-50 (1999)), and available on the
world wide web at the National Center for Biotechnology Information
website, under BLAST in the Molecular Database section. Preferably,
the default values for all BLAST 2 search parameters are used,
including reward for match=1, penalty for mismatch=-2, open gap
penalty=5, extension gap penalty=2, gap x dropoff=50, expect=10,
wordsize=11, and optionally, filter on. In the comparison of two
nucleotide sequences using the BLAST search algorithm, nucleotide
identity is referred to as "identities."
[0083] With regard to protein preparation from nucleotide
sequences, it is noted that a "triplet" codon of four possible
nucleotide bases can exist in over 60 variant forms. Because these
codons provide the message for only 20 different amino acids (as
well as transcription initiation and termination), some amino acids
can be coded for by more than one codon, a phenomenon known as
codon redundancy. Accordingly, the nucleotide sequences used to
prepare the particular amino acid sequences of stabilized reverse
transcriptase fusion proteins can vary considerably, depending on
the particular codons used. For reasons not completely understood,
alternative codons are not uniformly present in the endogenous DNA
of differing types of cells, and there exists a natural hierarchy
or "preference" for certain codons in certain types of cells.
Accordingly, in some embodiments the choice of codons used to
express a stabilized reverse transcriptase fusion protein may be
optimized through use of particular codons to result in higher
levels of expression.
[0084] In accordance with this invention, the stabilized reverse
transcriptase fusion protein expression cassette is inserted into a
vector. The vector is preferably a plasmid or adenoviral vector,
although linear DNA linked to a promoter, or other vectors, such as
adeno-associated virus or a modified vaccinia virus, retroviral or
lentiviral vector may also be used. In particular, the use of E.
coli plasmid vectors is preferred.
[0085] A detailed description of the work conducted by the
inventors to develop and evaluate stabilized reverse transcriptase
fusion proteins is provided below.
Expression and Purification of Group II Intron RTs as MalE Fusion
Proteins
[0086] The expression and solubility of poorly behaved proteins can
sometimes be improved by fusion of highly soluble proteins, like
maltose-binding protein (MalE) or N utilization substance A (NusA)
(Nallamsetty et al., Protein Expression and Purification 45,
175-182, 2005). The MalE tag additionally permits facile
purification of the protein via amylose-affinity chromatography.
The inventors therefore tested whether group II intron RTs could be
expressed and purified as MalE fusions. Initially, a MalE tag was
fused to the N-terminus of the RT via a TEV protease-cleavable
linker in the expression vector pMal-c2t (FIG. 12B). The MalE-RT
fusion proteins for several of the T. elongatus group II intron RTs
expressed well in E. coli and could be purified by a procedure that
involves polyethyleneimine (PEI)-precipitation to remove nucleic
acids, followed by amylose-affinity and heparin-Sepharose
chromatography. Further, the uncleaved MalE-RT fusion proteins
assayed soon after purification had high thermostable RT activity.
However, the yields of these proteins were <0.2 mg/l for the
Thermosynechococcus proteins. Additionally, when the MalE tag was
removed by cleavage with TEV protease, the RTs immediately formed
an insoluble precipitate, while if the tag was left uncleaved, the
MalE-RT fusion proteins progressively lost RT activity and were
degraded within days, even when stored on ice or flash frozen in
50% glycerol. The latter findings were surprising because proteins
that fold properly in the presence of a solubility tag tend to
remain soluble after cleavage of the tag (Nallamsetty et al.,
Protein Expression and Purification 45, 175-182, 2005). The group
II intron RTs, which were active with but not without the attached
MalE tag, appear to be an exception. The finding that the
stabilizer protein must remain attached to the thermostable reverse
transcriptase suggests that it plays an active role in keeping the
thermostable reverse transcriptase soluble and active.
[0087] To overcome these difficulties, the inventors tested whether
the group II intron RTs could be stabilized in active form by
attaching the MalE tag to the protein via a non-cleavable rigid
linker. Such MalE-rigid fusions typically have a linker region of 3
to 5 alanine residues combined with changes at the C-terminus of
the MalE tag to replace charged amino acid residues with alanines
(Smyth et al., Genes and Development 19, 2477-2487, 2003). These
rigid fusion linkers reduce conformational heterogeneity, enabling
crystallization of proteins with attached linkers for structure
determination (Smyth et al., ibid). For the MalE-RF-RT fusions
tested here, the MalE/linker region of pMal-c2t
TVDEALKDAQTNS.sub.3N.sub.10LENLYFQGEF (SEQ ID NO: 19) was modified
to TVDAALAAAQTAAAAA (SEQ ID NO: 20) and called a MalE-RF (rigid
fusion) tag (FIG. 12B).
[0088] To rapidly assess whether the MalE-RF tag affects the
activity of group II intron RTs, the inventors tested whether the
MalE-RF-RTs could support retrohoming in vivo. For initial tests,
the RTs chosen were the LtrA protein encoded by the L. lactis
L1.LtrB intron, and TeI4h*RT, an activated derivative of the RT
encoded by the thermostable T. elongatus TeI4h intron. In
retrohoming assays at 37.degree. C., the MalE-RF-LtrA protein
supported retrohoming at an efficiency of 20% compared to 86% for
native LtrA, while in retrohoming assays at 48.degree. C., the
MalE-RF-TeI4h*protein supported retrohoming at an efficiency of 87%
compared to 100% for the unfused TeI4h*protein; see Table 1. Thus
remarkably both MalE-RF-RTs retain the ability to support
retrohoming with high albeit somewhat reduced efficiencies despite
the presence of the attached maltose-binding protein rigid linker
sequence. These findings imply that the proteins retain substantial
levels of all activities required for retrohoming, including RT,
RNA splicing, and DNA endonuclease activity. This mobility assay
provides a convenient screen for active group II intron RTs.
TABLE-US-00001 TABLE 1 Retrohoming efficiencies for different RTs
RT Efficiency TeI4h* (48.degree. C.) 100% MalE-RF-TeI4h*
(48.degree. C.) 87% LtrA (37.degree. C.) 86% MalE-RF-LtrA
(37.degree. C.) 20%
[0089] Retrohoming assays were done in E. coli HMS174(DE3) as
described previously for the L1.LtrB intron (LtrA protein) (Guo et
al. Science 289, 452-457, 2000, Karberg et al. Nature Biotech. 19,
1162-1167, 2001) and TeI4h*. The Cap.sup.R intron-donor plasmids
use a T7lac promoter to express a .DELTA.ORF intron (I-.DELTA.ORF)
with short flanking 5' and 3' exons (E1 and E2, respectively) and a
T7 promoter in DIV, followed by the RT ORF downstream of E2. The
Amp.sup.R recipient plasmids contain a target site for the intron
(ligated E1-E2 sequences) cloned upstream of a promoterless
tet.sup.R gene. Intron expression was induced with IPTG (0.1 mM for
LtrA and MalE-RF-LtrA and 0.5 mM for TeI4h*and MalE-RF-TeI4h*) for
1 h at the indicated temperature. Retrohoming of the intron
carrying the T7 promoter into the target site activates the
expression of the tet.sup.R gene, enabling selection for
Tet.sup.R+Amp.sup.R colonies. Retrohoming efficiencies were
calculated as the ratio of (Amp.sup.R+Tet.sup.R)/Amp.sup.R
colonies.
[0090] Encouraged by these findings, the inventors constructed
plasmids in which several group II intron RTs were expressed with a
MalE tag fused to the N-terminus of the protein via a rigid linker
in the vector pMal-c2t. The RTs tested included several T.
elongatus group II intron RTs, whose ability to support retrohoming
had been tested previously using the above plasmid assay and two G.
stearothermophilus group II intron RTs related to group II intron
RTs that had previously been difficult to purify with high yield
and activity (Vellore et al., Appl. Environ. Microbiol. 70,
7140-7147, 2004; Ng et al., Gene 393, 137-144, 2007). In some
constructs, the inventors added an additional C-terminal His6-tag
to enrich for full-length protein in the purification. The
MalE-RF-RT fusion proteins were expressed in E. coli and purified
by a procedure that involves PEI-precipitation of nucleic acids
followed by amylose-affinity and heparin-Sepharose chromatography.
An additional Ni column chromatography step was included for
constructs with a C-terminal His6 tag. The proteins were dialyzed
against the purification buffer with 50% glycerol, flash frozen,
and stored at -80.degree. C. The final protein preparations were
>95% pure with yields of 0.5-2.2 mg/ml and their RT activity was
undiminished after storage for at least six months.
RT Assays
[0091] To assess their thermostability, the inventors first assayed
the RT activity of fusions MalE-RF-TeI4c, TeI4h*, and TeI4f from
Thermosynechococcus elongatus and MalE-RF-GsI1 and GsI2 from
Geobacillus stearothermophilus at temperatures between 25 and
77.degree. C. These initial assays were done by using
poly(rA)/oligo(dT).sub.42 as the template-primer substrate and
quantifying polymerization of .sup.32P-dTTP into high molecular
weight material. The relatively long 42-nt dT primer was used so
that it would remain annealed to the poly(rA) template at higher
temperatures (calculated Tm=69.degree. C.). The LtrA protein with
and without an N-terminal MalE-RF tag was assayed in parallel as a
mesophilic RT control (FIG. 11). Whereas the LtrA protein had a
temperature optimum of .about.35.degree. C. with or without the
MalE rigid fusion tag, the other five MalE-RF-RT's had higher
temperature optima ranging from 45-61.degree. C. The two most
active and thermostable RTs, MalE-RF-GsI2 and MalE-RF-TeI4c had
temperature optima of 61.degree. C. and retained substantial
activity at 70.degree. C. (where the assay may be limited by the
stability of the primer-template base pairing). Of the two RTs,
MalE-RF-TeI4c had the highest activity and was assayed at lower
protein concentrations (50 nM) and for shorter times (90 sec) than
the other RTs (100 nM, 5 min) in order to remain within the linear
range. Tests with the MalE-RF-TeI4c protein showed that inclusion
of maltose (10 .mu.M to 1 mM), which can affect the conformation of
the MalE tag, had little if any effect on RT activity.
Effect of Changing the Tag and Linker on RT Activity
[0092] To determine optimal properties of the tag and linker, the
inventors constructed variants of the MalE-RF-TeI4c RT. The
MalE-RT-TeI4c RT (left bar) and variant proteins (right bars) were
purified and assayed for RT activity with poly(rA)/oligo(dT).sub.42
as described above (FIG. 13A). MalE-RT-TeI4c has a modified MalE
tag (MalE (mod)) with 3 charged amino acid residues changed to
alanines and a linker of 5 alanine residues linked to the
N-terminus of the RT. Variants in which the 5 alanine-residue
linker was removed or shortened to 1 or 2 alanine residues had
substantial but reduced RT activity, as did a variant in which the
modified MalE tag was replaced with wild-type MalE (MalE (WT))
(FIG. 13A). A variant of TeI4c with the MalE (WT) tag followed by
the pMal-c2t linker deleted for the TEV protease cleavage site also
had substantial but reduced RT activity (FIG. 13A). A variant in
which the wild-type MalE tag was attached to the C-terminus of the
TeI4c RT did not express well in E. coli, presumably reflecting
that the nascent TeI4c RT cannot fold properly without prior
expression of the MalE tag. Finally, a variant with an N-terminal
rigid fusion to NusA (N utilization substance protein) instead of
MalE had substantial thermostable RT activity (FIGS. 13A and
B).
Temperature Profile for cDNA Synthesis
[0093] FIG. 14 shows assays of cDNA synthesis at different
temperatures using in vitro transcribed RNA templates with DNA
primers annealed to their 3' ends comparing two of the thermostable
group II intron RTs (MalE-RF-TeI4c and MalE-RF-GsI2) with a
commercially available RT, SuperScript III (Invitrogen.TM.), which
has been reported to be active at 55.degree. C. (Potter et al.
Focus (Invitrogen Newsletter) 25.1, 19-24, 2003). One template was
a 531-nt in vitro transcript synthesized from AflIII-digested pBS
KS(+) with a .sup.32P-labeled 37-nt DNA primer annealed (FIG.
14A-C) and the other was a 1.2-kb kanR RNA (SEQ ID NO: 21; shown in
FIG. 15) with a .sup.32P-labeled 44-nt DNA primer (FIG. 14D-E). The
reaction was incubated for 30 min at the indicated temperature, and
the products were analyzed by electrophoresis in a denaturing 6%
polyacrylamide gel. In each panel, the top and bottom
autoradiograms show portions of the gel containing the full-length
product and unextended or partially extended primers, respectively,
and the bar graphs show the percentage of primer that was extended
to full-length cDNA.
[0094] With the 531-nt RNA template, the MalE-RF-TeI4c RT had a
temperature optimum for full-length cDNA synthesis of 61-81.degree.
C. The MalE-RF-GsI2 RT synthesized full-length cDNA at temperatures
between 37 and 69.degree. C., whereas SuperScript III RT had no
activity at temperatures higher than 57.degree. C. (FIG. 14A-C).
With the 1.2-kb RNA template, the MalE-RF-TeI4c and MalE-RF-GsI2 RT
had temperature optima of 61-81.degree. C. and 61-69.degree. C.,
respectively, while SuperScript III RT again had no activity at
temperatures higher than 57.degree. C. (FIG. 14D-E).
Analysis of cDNA Synthesis by qRT-PCR
[0095] In addition to gel analysis, the inventors used qRT-PCR to
compare the amounts of cDNAs synthesized by the MalE-RF-TeI4c and
SuperScript III RTs using the 1.2-kb RNA template. The inventors
first compared the amounts of full-length cDNA produced at
temperatures between 50 and 75.degree. C. (FIG. 16). The cDNAs for
qPCR were synthesized in reactions containing 5.times.10.sup.8
copies of kanR RNA as a template, 200 nM MalE-RT-TeI4c or 200 U of
SuperScript III RT for 30 min at six different temperatures.
Reactions with SuperScript III were done according to the
manufacturer's specifications. The reaction mix containing all
components except for dNTPs was preincubated at the desired
temperatures for 2 min and started by adding the dNTPs. After 30
min, the reactions were terminated by quickly freezing on dry ice.
A 5-.mu.l portion of each cDNA synthesis was used in qPCR reactions
containing TaqMan.RTM. Gene Expression mix and two forward,
reverse, and dual-labeled primer probe mixes located at nt 188-257
and 562-634 of the kanamycin RNA. With the primer set closest to
the 5' end of the RNA (nt 188-257), the cycle threshold (C.sub.T)
values were significantly lower for the MalE-RF-TeI4c RT than for
SuperScript III RT at all temperatures tested (FIG. 16), indicating
that MalE-RF-TeI4c had synthesized larger amounts of cDNAs
extending to near the 5' end of the RNA template. Notably, the
difference in amounts of cDNAs synthesized was most pronounced at
temperatures between 55 and 65.degree. C., where the activity of
SuperScript III falls off rapidly.
[0096] To compare the processivity of cDNA synthesis by
MalE-RF-TeI4c and SuperScript III RTs, the same cDNA samples
obtained at 60 and 65.degree. C. were analyzed with two different
amplicon primer/probe sets: 188-257, which detects cDNAs that are
920-nt long, and 562-634, which detects cDNAs that are 546 nt long
(FIG. 17). In this case, cycle threshold results for cDNA samples
were plotted against a standard curve obtained with Novagen.RTM.
double-stranded DNA plasmid vector pET9a to determine copy numbers
equivalents. With the 188-257 amplicon primer/probe set, 972,815
copies were detected with the MalE-RF-4c TeI4c RT versus 64,456
copies with SuperScript RT at 60.degree. C. (.about.15 fold
difference), and that ratio increased to 732,559 versus 661 at
65.degree. C. (.about.1100 fold difference). Further, at both
temperatures, the MalE-RF-TeI4c RT shows little difference in the
copy numbers of cDNAs detected by the two primer sets, showing that
the MalE-RF-TeI4c RT synthesizes mostly full-length cDNAs,
indicative of high processivity. By contrast, SuperScript III RT
showed lower numbers of longer cDNAs detected by the 188-257 primer
set than the 562-634 primer set at both temperatures, indicating
that this RT falls off or is otherwise impeded before reaching the
5' end of the RNA, resulting in synthesis of shorter cDNAs.
Fidelity of Nucleotide Incorporation by TeI4c and TeI4h*RTs
[0097] The inherent fidelity of the TeI4h*and TeI4c RTs (i.e., the
native group II intron RT, not a stabilized RT fusion protein) was
assessed initially by sequencing introns that had undergone
retrohoming in E. coli plasmid assays (Table 2). The maximum error
frequencies for the TeI4h*RNA promoting retrohoming of a
TeI4h*-.DELTA.ORF intron RNA at 37 and 48.degree. C. were
1.6.times.10.sup.-5 and 4.1.times.10.sup.-6, respectively. The
TeI4c RT is encoded by the outer intron of a "twintron", a
configuration in which one group II intron (TeI3c) has inserted
into another (TeI4c), and can efficiently mobilize both introns.
The maximum error frequencies for the TeI4c RT promoting
retrohoming of TeI3c or TeI4c at 48.degree. C. were
1.1.times.10.sup.-5 and 2.2.times.10.sup.-5. These error
frequencies are comparable to that estimated previously for the
L1.LtrB intron RT (LtrA) promoting retrohoming of the L1.LtrB
intron, .about.10.sup.-5 at 37.degree. C. (Conlan et al., Nucl.
Acids Res. 33, 5262-5270, 2005).
TABLE-US-00002 TABLE 2 Fidelity of group II intron RTs as measured
by frequency of nucleotide misincorporation during retrohoming RT
TeI4h* TeI4h* TeI4c TeI4c Intron TeI4h*-.DELTA.ORF
TeI4h*-.DELTA.ORF TeI3c-.DELTA.ORF TeI4c-.DELTA.ORF Temp. 37 48 48
48 (.degree. C.) Nts 244,253 244,980 265,858 537,354 sequenced
Mutations 4 1 3 12 Error 1.6 .times. 10.sup.-5 4.1 .times.
10.sup.-6 1.1 .times. 10.sup.-5 2.2 .times. 10.sup.-5 Frequency
[0098] Retrohoming was done in E. coli HMS174(DE3) with donor
plasmids expressing the indicated intron and RT and recipient
plasmids containing the intron target site (ligated E1-E2)
sequences cloned upstream of a promoterless tet.sup.R gene. After
selection of Tet.sup.R colonies, introns that had integrated into
the target site in recipient plasmid were amplified by colony PCR
using the primers Rsense (5'-ACAAATAGGGGTTCCGCGCAC; SEQ ID NO: 22)
and Te680rc (5'-GTTGGTGACCGCACCAGT; SEQ ID NO: 23) and Te420f
(5'-AACGCGGTAAGCCCGTA; SEQ ID NO: 24) and Rev2pBRR
(5'-AATGGACGATATCCCGCA; SEQ ID NO: 25) for the 5'- and
3'-integration junctions, respectively. The PCR fragments were then
sequenced. Table 2 indicates the induction temperature for
retrohoming, the total number of intron nucleotides sequenced, the
number of mutations (errors), and the error frequency.
[0099] The following examples of methods for preparing and
characterizing stabilized RT fusion proteins are included for
purposes of illustration and are not intended to limit the scope of
the invention.
EXAMPLES
Example 1: Recombinant Plasmids
[0100] pMalE-TeI4c, pMalE-TeI4f, pMalE-TeI4h*contain the RT ORF of
the indicated mobile group II intron with a fused N-terminal MalE
tag cloned behind the tac promoter in the expression vector
pMal-c2t. The latter is a derivative of pMal-c2x (New England
Biolabs, Ipswich Mass.) in which the factor Xa protease-cleavage
site between MalE and the expressed protein was replaced by a TEV
protease-cleavage site (Kristelly et al., Acta Crystallogr D Biol
Crystallogr. 59, 1859-1862, 2003). The TeI4h*RT is a derivative of
the native TeI4h RT with the YAGD motif in RT-5 changed to YADD.
Recombinant plasmids containing group II introns from T. elongatus
strain BP1 cloned in pET11 (TeI4f), pUC19 (TeI4c), or pACD2X
(TeI4h*) were described previously. pMalE-RT plasmids were derived
from these initial constructs by PCR amplifying the RT ORF with
primers that append restriction sites, and then cloning the PCR
products into the corresponding sites of pMal-c2t (TeI4c RT, EcoRI
and PstI sites; TeI4f RT, BamHI site; TeI4h*RT, BamHI and PstI
sites). Recombinant plasmids denoted pMalE-RF-protein (e.g.,
pMalE-RF-TeI4c) were derived from the corresponding pMalE-RT
plasmids by replacing the TEV-protease cleavable linker
(TVDEALKDAQTNS.sub.3N.sub.10LENLYFQG; SEQ ID NO: 19) with a rigid
linker (TVDAALAAAQTAAAAA; SEQ ID NO: 20) by the QuikChange PCR
procedure using the Accuprime polymerase (Invitrogen, Makarova et
al., BioTechniques 29, 970-972, 2000).
[0101] Derivatives of pMalE-RF-TeI4c with different linkers were
constructed by PCR mutagenesis using the QuikChange procedure. The
MalE tag was fused to the C-terminus of the TeI4c ORF in pMal-c2t
by amplifying the MalE segment of pMal-c2t with primers that
introduce a 5' EcoRI site and a 3' PstI site, and the TeI4c ORF of
pMalE-TeI4c with gene specific primers that introduce a 5' NdeI
site and a 3' EcoRI site, respectively, and cloning the fragments
into pMal-c2t digested with NdeI and PstI.
[0102] pNusA-RF-TeI4c-His, which expresses the TeI4c RT with an
N-terminal NusA tag fused to the protein via a rigid linker and a
C-terminal His6 tag, was constructed by PCR amplifying the TeI4c RT
ORF from pMAL-TeI4c with primers that append SacII and KpnI sites
and cloning the resulting PCR product between the corresponding
sites of pET-50b(+) (Novagen). PCR mutagenesis was then used to
replace the last two charged residues (D and E) of NusA, the
existing linker, and one of the two N-terminal His6 tags
(NICWFGDEATSGSGH.sub.6; SEQ ID NO: 26) with a rigid linker sequence
(NICWFGAAAAA; SEQ ID NO: 27). The second N-terminal His6 tag was
removed by PCR mutagenesis and a His6 tag was fused to the
C-terminus of TeI4c RT by QuikChange PCR.
[0103] pMalE-GsI1 and pMalE-GsI2 were constructed by PCR amplifying
the RT ORFs from G. stearothermophilus strain 10 genomic DNA
(obtained from Greg Davis (Sigma-Aldrich)) by PCR with primers that
amplify the introns and appended BamHI and XbaI sites (GsI1) or
BamHI sites (GsI2) and then cloning the PCR products between the
corresponding sites of pMal-c2t. GsI1 is a subgroup IIB2 intron
that is inserted in the G. stearothermophilus recA gene and is
related to the previously described RT-encoding group II introns in
the recA genes of Geobacillus kaustophilus (Chee et al., Gene 363,
211-220, 2005) and Bacillus caldolyticus (Ng et al., Gene 393,
137-144, 2007). The cloned GsI1 RT ORF was verified to correspond
to the genomic sequence (CP001794). GsI2 is a group IIC intron
found in multiple copies in the G. stearothermophilus genome. The
cloned GsI2 RT ORF corresponds to the genomic sequence of one of
six full-length copies of GsI2 in the G. stearothermophilus genome
(CP001794) and has three amino acid sequence changes from the RT
ORF cloned by Vellore et al. (Appl. Environ. Microbiol. 70,
7140-7147, 2004). The corresponding pMalE-RF-RT constructs were
derived from the pMalE-RT constructs by QuikChange PCR, as
described above.
[0104] pMalE-LtrA was constructed by PCR amplifying the LtrA ORF of
pImp-2 (Saldanha et al., Biochemistry 38, 9069-9083, 1999) using
primers that append BamHI and HindIII sites and then cloning the
PCR product between the corresponding sites of pMal-c2t, and
pMalE-RF-LtrA was derived from pMalE-LtrA by QuikChange PCR, as
described above.
Example 2: Protein Purification
[0105] For expression of pMalE-RT or pMalE-RF-RT constructs, E.
coli Rosetta 2/pRARE (Novagen, EMD Biosciences, Gibbstown N.J.) or
ScarabXpress/pRARE T7lac (Scarabgenomics, Madison Wis.) were
transformed with the expression plasmid and grown at 37.degree. C.
in TB or LB medium to mid-log phase (O.D..sub.600=0.8). Expression
was induced either by adding isopropyl
.beta.-D-1-thiogalactopyranoside (IPTG; 1 mM final) to mid-log
phase cells (pMalE-RF-TeI4c, TeI4f, TeI4h*, GsI1, and GsI2) or by
growing cells in auto-induction medium (LB containing 0.2% lactose,
0.05% glucose, 0.5% glycerol, 24 mM (NH.sub.4).sub.2SO.sub.4, 50 mM
KH.sub.2PO.sub.4, 50 mM Na.sub.2HPO.sub.4) (pMalE-LtrA and
pMalE-RF-LtrA). In either case, induction was for .about.24 h at
18-25.degree. C., after which cells were pelleted by
centrifugation, resuspended in buffer A (20 mM Tris-HCl, pH 7.5,
0.5 M KCl or NaCl, 1 mM EDTA, 1 mM dithiothreitol (DTT)), and
frozen at -80.degree. C.
[0106] For purification of MalE-RF-TeI4c, TeI4f, TeI4h*and their
derivatives, the cell suspension was thawed, treated with lysozyme
(1 mg/ml; Sigma) for 15 min on ice, freeze-thawed three times on
dry ice, sonicated (Branson 450 Sonifier, Branson Ultrasonics,
Danbury Conn.) three or four 10 sec bursts or one 30 sec burst on
ice at an amplitude of 60%, with 10 sec between bursts, and
centrifuged for 30 min at 18,500.times.g at 4.degree. C. Nucleic
acids were precipitated by adding polyethyleneimine (PEI) to a
final concentration of 0.1% and centrifuging for 15 min at
15,000.times.g at 4.degree. C. in a J16.25 rotor in an Avanti J-E
centrifuge (Beckman Coulter, Brea Calif.). The resulting
supernatant was applied to an amylose column (10-ml column volume;
Amylose High-Flow (New England Biolabs), equilibrated in buffer A),
which was washed with five column volumes each of buffer A
containing 0.5 M, 1.5 M, or 0.5 M KCl, and then eluted with buffer
A containing 10 mM maltose. Protein fractions were pooled and
purified further via a heparin-Sepharose column (3 tandem 1-ml
columns; GE Healthcare Biosciences Corp.) which had been
pre-equilibrated in 20 mM Tris-HCl, pH 7.5 containing KCl (100 mM
for MalE-RF-4c, 4f, 4h*, MalE-LtrA and MalE-RF-LtrA; 50 mM for
MalE-RF-GsI1 or GsI2), 1 mM EDTA, 1 mM DTT, 10% glycerol. The
proteins were applied to the column in the same buffer and eluted
with a 40-column volume gradient from the loading concentration to
2 M KCl. The proteins eluted at .about.800 mM KCl. The peak
fractions were pooled and dialyzed against 20 mM Tris-HCl, pH 7.5,
0.5 M KCl, 1 mM EDTA, 1 mM DTT, and 50% glycerol for storage. The
frozen proteins showed no decrease in RT activity for at least six
months.
[0107] The MalE-RF-GsI1 protein, which has an N-terminal MalE tag
and a C-terminal His6-tag, was purified similarly, except that
nucleic acids were precipitated with 0.2% PEI, and the protein
eluted from the amylose column was purified further on a nickel
column prior to the final heparin-Sepharose column. The nickel
column (5 ml HisTrap.TM. HP Nickel Sepharose; GE Healthcare
Biosciences, Piscataway N.J.) equilibrated with binding buffer (500
mM KCl, 20 mM Tris-HCl pH 7.5, 40 mM imidazole, and 10% glycerol)
was loaded with pooled protein fractions from the amylose column,
washed with 10 column volumes of binding buffer, eluted with five
column volumes of elution buffer (500 mM KCl, 20 mM Tris-HCl pH
7.5, 400 mM imidazole and 10% glycerol), and the supernatant loaded
directly onto the heparin-Sepharose column. The peak fractions from
the heparin-Sepharose column were pooled, dialyzed against 20 mM
Tris-HCl, pH 7.5, 0.5 M KCl, 50% glycerol, and stored as described
above.
[0108] For the NusA fusions, E. coli ScarabXpress/pRARE T7lac cells
were induced with 0.5 mM IPTG for 48 h at 18.degree. C. and
resuspended in nickel buffer A (20 mM Tris pH 7.5, 500 mM KCl, 30
mM imidazole, 10% glycerol). After disrupting the cells as
described above, nucleic acids were precipitated from the lysate by
adding a final concentration of 0.2% polyethyleneimine, followed by
centrifugation at 10,000.times.g for 15 min. The supernatant was
applied to a 5-ml nickel-Sepharose column pre-equilibrated with
nickel buffer A, and then eluted with nickel buffer A containing
500 mM imidazole. The protein fractions were pooled and loaded
directly onto two connected 1-ml heparin-Sepharose columns that had
been pre-equilibrated in 20 mM Tris pH 7.5, 100 mM KCl, 1 mM DTT, 1
mM EDTA, and 20% glycerol. The protein was eluted with a 20-column
volume gradient of 0.1 to 1.5 M KCl, and peak fractions were
pooled, dialyzed against 20 mM Tris-HCl, pH 7.5, 0.5 M KCl, 1 mM
EDTA, 1 mM DTT, 50% glycerol, and stored as described above.
Example 3: Reverse Transcriptase Assays
[0109] RT activity at different temperatures was assayed by
quantifying incorporation of .sup.32P-dTTP using
poly(rA)/oligo(dT).sub.42 as the template-primer. The RT (50 nM
MalE-RF-TeI4c RT or 100 nM of all other RTs) was pre-incubated with
100 nM poly(rA)/oligo(dT).sub.42 in 1.times.RT buffer (75 mM KCl,
10 mM MgCl.sub.2, 20 mM Tris-HCl, pH 7.5, and 1 mM DTT) at
different temperatures (ranging from 25-77.degree. C.), and
reactions were initiated by adding 5 .mu.Ci [.alpha.-.sup.32P]-dTTP
(3,000 Ci/mmol; Perkin Elmer, Waltham Mass.). The reactions were
incubated for times within the linear range and stopped by adding
EDTA to a final concentration of 250 mM. Reaction products were
spotted onto Whatman DE81 chromatography paper (10.times.7.5-cm
sheets; GE Healthcare), washed 3 times in 0.3 M NaCl and 0.03 M
sodium citrate, and scanned with a PhosphorImager (Typhoon Trio
Variable Mode Imager; GE Healthcare) to quantify bound
radioactivity.
[0110] Other RT assays used RNA templates with annealed DNA
oligonucleotide primers. The RNA template was either a 531-nt in
vitro transcript synthesized from pBluescript KS (+) digested with
AflIII transcribed using T7 Megscript kits (Ambion, Applied
Biosystems, Austin, Tex.) or a 1.2-kb kanR RNA purchased from
Promega (Promega, Madison Wis.). In vitro transcription was done
according to the manufacturer's instructions for 4 h at 37.degree.
C. After digesting the DNA template with Turbo DNase I (5 min,
37.degree. C.), RNAs were extracted with phenol:chloroform:isoamyl
alcohol (25:24:1; phenol-CIA) and purified by two cycles of gel
filtration through Sephadex G-50 (Sigma, St Louis, Mo.) spin
columns. The RNA concentration was determined by using a Nanodrop
(Thermo Scientific, Wilmington, Del.). RNAs were stored in
Milli-Q-grade H.sub.2O and stored at -20.degree. C.
[0111] DNA oligonucleotide primers complementary to the 3' ends of
the RNAs were synthesized by IDT (Coralville, Iowa; AflIII primer:
5'-CCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCG; SEQ ID NO: 28; P078
Kanamycin Rev 5'-GGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAAC; SEQ
ID NO: 29). Primer concentrations were determined by A.sub.260. The
primers were 5' .sup.32P-labeled with T4 polynucleotide kinase (New
England Biolabs) according to the manufacturer's instructions, and
free nucleotides were removed by gel filtration through a Sephadex
G-25 column. The primers were mixed with the template at a molar
ratio of 1.0:1.1 and annealed by heating to 82.degree. C. for 2 min
and then cooling to room temperature in a GeneAmp 9700 PCR cycler
with the ramp setting of 10%.
[0112] For gel analysis of cDNA synthesis, 100 nM of annealed
template/primer was incubated with 200 nM enzyme in 100 mM KCl, 20
mM Tris HCl pH 7.5, 10 mM MgCl.sub.2 and 1 mM DTT for MalE-RF-TeI4c
RT and in 10 mM NaCl, 20 mM Tris HCl pH 7.5, 10 mM MgCl.sub.2 and 1
mM DTT for MalE-RF-GsI2 RT. Reactions were initiated by adding
dNTPs and MgCl.sub.2 to final concentrations of 1.25 mM and 10 mM,
respectively, incubated for 30 min at the indicated temperature,
and terminated by adding 0.1% SDS/250 mM EDTA (final
concentrations) followed by phenol-CIA extraction. The products
were analyzed by electrophoresis in a denaturing 6% polyacrylamide
gel, which was dried and quantified with a PhosphorImager. A
5'-labeled 10-bp ladder (Invitrogen.TM.) was used as size
markers.
Example 4: Quantitative Real-Time Polymerase Chain Reaction
(qPCR)
[0113] cDNAs for qPCR analysis were generated in 20 .mu.l reactions
containing 1.times. RT buffer (75 mM KCl, 10 mM MgCl.sub.2, 20 mM
Tris-HCl, pH 7.5), 1 mM DTT, 5.times.10.sup.8 copies of kanR RNA,
200 nM MalE-RF-TeI4c RT and 1 mM dNTPs for 30 min at temperatures
specified for individual experiments. Parallel reactions with
SuperScript III (Invitrogen) were done according to the
manufacturers specifications. Reactions were incubated at the
different temperatures for 2 min and started by adding dNTPs. After
incubating for 30 min, the reactions were quickly frozen on dry ice
to stop the reactions. 5 .mu.l of cDNA reaction were used for the
qPCR.
[0114] qPCR analysis was done in 96-well plates with optical caps
with each well containing 25 .mu.l of reaction mix consisting of
12.5 .mu.l of 2.times. TaqMan.RTM. Gene Expression Master Mix
(Applied Biosystems, Foster City, Calif.), 7.5 .mu.l of forward,
reverse, and dual-labeled probe mix (oligonucleotides purchased
individually from Integrated DNA Technologies, Coralville, Iowa),
and 5 .mu.l cDNA template. The mixture was incubated in the 7900HT
Fast Real-Time PCR System (Applied Biosystems), using the 9600
emulation mode protocol (50.degree. C. for 2 min, 95.degree. C. for
10 min, then cycled for a total of 45 cycles at 95.degree. C. for
15 sec and 60.degree. C. for 60 sec). Data were collected and
analyzed using the Applied Biosystems Sequence Detection System
Software, Versions 2.2 or 2.3.
[0115] The Novagen double-stranded DNA plasmid vector pET9a (EMD
Chemicals) was used to quantitate kanR cDNA levels. The pET9a
vector contains the kanR coding sequence (bases 3523-4335) and has
100% sequence homology at each primer/probe binding site with the
Promega 1.2-kb kanR RNA. Purified and quantitated pET9a DNA vector
was initially diluted to 1.times.10.sup.9 copies/.mu.l stock
aliquots and stored at -20.degree. C. For each run, fresh stocks
were thawed and then serially diluted to generate a quantitative
standard curve used in qPCR. Cycle threshold results for cDNA
samples were then plotted against the standard curve to determine
copy numbers equivalents.
[0116] Primers used were:
TABLE-US-00003 P078 Kanamycin RT-1107R SEQ ID NO: 29
5'-GGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAAC- 3'; (Tm = 80
C.)
primer sets nt 188-257:
TABLE-US-00004 Forward-P029 kan-188F: SEQ ID NO: 30
5'-GGGTATAAATGGGCTCGCG-3'; Reverse-P030 kan-257R: SEQ ID NO: 31
5'-CGGGCTTCCCATACAATCG-3'; Taqman Probe-P031 kan-213T: SEQ ID NO:
32 5'(6-carboxyfluorescein (6FAM))- TCGGGCAATCAGGTGCGACAATC-3';
(Iowa Black FQ; a dark non-fluorescent quencher); Amplicon 70 bp:
SEQ ID NO: 33 5'GGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAAT
CTATCGATTGTATGGGAAGCCCG-3';
Primer Set (nt 562-634):
TABLE-US-00005 [0117] Forward-P001 kan-562F: SEQ ID NO: 34
5'-CGCTCAGGCGCAATCAC-3'; Reverse-P002 kan-634R: SEQ ID NO: 35
5'-CCAGCCATTACGCTCGTCAT-3'; Taqman Probe-P003 kan-581T: SEQ ID NO:
36 5'(6-FAM)-ATGAATAACGGTTTGGTTGATGCGAGTGA-3'- (TAMRA); Amplicon 73
bp SEQ ID NO: 37 5'CGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGA
TTTTGATGACGAGCGTAATGGCTGG-3';
Example 5: Retrohoming Assays
[0118] Retrohoming assays were done in E. coli HMS174(DE3)
(Novagen.TM.) grown on LB medium, with antibiotics added at the
following concentrations: ampicillin, 100 .mu.g/ml;
chloramphenicol, 25 .mu.g/ml; tetracycline, 25 .mu.g/ml. The
intron-donor plasmids, derivatives of pACD2X (San Filippo et al.,
Journal of Molecular Biology, 324, 933-951, 2002), carry a
cap.sup.R marker and use a T7lac promoter to express a .DELTA.ORF
intron (I-.DELTA.ORF) with short flanking 5' and 3' exons (E1 and
E2, respectively) and a T7 promoter in DIV, followed by the RT ORF
downstream of E2. The recipient plasmids, derivatives of pBRR-tet
(Guo et al., Science 289, 452-457, 2000; Karberg et al., Nature
Biotech. 19, 1162-1167, 2001), carry an amp.sup.R marker and
contain a target site for the intron (ligated E1-E2 sequences)
cloned upstream of a promoterless tet.sup.R gene. The latter is
activated by insertion of the intron carrying the T7 promoter,
enabling selection for Tet.sup.R+Amp.sup.R colonies. For the
assays, cells were co-transformed with the Cap.sup.R donor and
Amp.sup.R recipient plasmids, inoculated into 5 ml of LB medium
containing chloramphenicol and ampicillin, and grown with shaking
(200 rpm) overnight at 37.degree. C. A small portion (50 .mu.l) of
the overnight culture was inoculated into 5 ml of fresh LB medium
containing the same antibiotics and grown for 1 h as above. The
cells were then induced with IPTG for 1 h under conditions
specified in the legend of Table 1 for individual experiments. The
cultures were then placed on ice, diluted with ice-cold LB, and
plated at different dilutions onto LB agar containing ampicillin or
ampicillin+tetracycline. After incubating the plates overnight at
37.degree. C., the mobility efficiency was calculated as the ratio
of (Tet.sup.R+Amp.sup.R)/Amp.sup.R colonies.
Sequence CWU 1
1
461562PRTThermosynechococcus elongatus 1Met Glu Thr Arg Gln Met Thr
Val Asp Gln Thr Thr Gly Ala Val Thr 1 5 10 15 Asn Gln Thr Glu Thr
Ser Trp His Ser Ile Asn Trp Thr Lys Ala Asn 20 25 30 Arg Glu Val
Lys Arg Leu Gln Val Arg Ile Ala Lys Ala Val Lys Glu 35 40 45 Gly
Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu Leu Thr His Ser 50 55
60 Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr Asp Asn Ser Gly
65 70 75 80 Ser Arg Thr Pro Gly Val Asp Gly Ile Thr Trp Ser Thr Gln
Glu Gln 85 90 95 Lys Thr Gln Ala Ile Lys Ser Leu Arg Arg Arg Gly
Tyr Lys Pro Gln 100 105 110 Pro Leu Arg Arg Val Tyr Ile Pro Lys Ala
Asn Gly Lys Gln Arg Pro 115 120 125 Leu Gly Ile Pro Thr Met Lys Asp
Arg Ala Met Gln Ala Leu Tyr Ala 130 135 140 Leu Ala Leu Glu Pro Val
Ala Glu Thr Thr Ala Asp Arg Asn Ser Tyr 145 150 155 160 Gly Phe Arg
Arg Gly Arg Cys Thr Ala Asp Ala Ala Gly Gln Cys Phe 165 170 175 Leu
Ala Leu Ala Lys Ala Lys Ser Ala Glu His Val Leu Asp Ala Asp 180 185
190 Ile Ser Gly Cys Phe Asp Asn Ile Ser His Glu Trp Leu Leu Ala Asn
195 200 205 Thr Pro Leu Asp Lys Gly Ile Leu Arg Lys Trp Leu Lys Ser
Gly Phe 210 215 220 Val Trp Lys Gln Gln Leu Phe Pro Thr His Ala Gly
Thr Pro Gln Gly 225 230 235 240 Gly Val Ile Ser Pro Val Leu Ala Asn
Ile Thr Leu Asp Gly Met Glu 245 250 255 Glu Leu Leu Ala Lys His Leu
Arg Gly Gln Lys Val Asn Leu Ile Arg 260 265 270 Tyr Ala Asp Asp Phe
Val Val Thr Gly Lys Asp Glu Glu Thr Leu Glu 275 280 285 Lys Ala Arg
Asn Leu Ile Gln Glu Phe Leu Lys Glu Arg Gly Leu Thr 290 295 300 Leu
Ser Pro Glu Lys Thr Lys Ile Val His Ile Glu Glu Gly Phe Asp 305 310
315 320 Phe Leu Gly Trp Asn Ile Arg Lys Tyr Asn Gly Val Leu Leu Ile
Lys 325 330 335 Pro Ala Lys Lys Asn Val Lys Ala Phe Leu Lys Lys Ile
Arg Asp Thr 340 345 350 Leu Arg Glu Leu Arg Thr Ala Thr Gln Glu Ile
Val Ile Asp Thr Leu 355 360 365 Asn Pro Ile Ile Arg Gly Trp Ala Asn
Tyr His Lys Gly Gln Val Ser 370 375 380 Lys Glu Thr Phe Asn Arg Val
Asp Phe Ala Thr Trp His Lys Leu Trp 385 390 395 400 Arg Trp Ala Arg
Arg Arg His Pro Asn Lys Pro Ala Gln Trp Val Lys 405 410 415 Asp Lys
Tyr Phe Ile Lys Asn Gly Ser Arg Asp Trp Val Phe Gly Met 420 425 430
Val Met Lys Asp Lys Asn Gly Glu Leu Arg Thr Lys Arg Leu Ile Lys 435
440 445 Thr Ser Asp Thr Arg Ile Gln Arg His Val Lys Ile Lys Ala Asp
Ala 450 455 460 Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr Phe Glu Lys
Arg Lys Lys 465 470 475 480 Leu Lys Lys Ala Pro Ala Gln Tyr Arg Arg
Ile Arg Arg Glu Leu Trp 485 490 495 Lys Lys Gln Gly Gly Ile Cys Pro
Val Cys Gly Gly Glu Ile Glu Gln 500 505 510 Asp Met Leu Thr Asp Ile
His His Ile Leu Pro Lys His Lys Gly Gly 515 520 525 Ser Asp Asp Leu
Asp Asn Leu Val Leu Ile His Ala Asn Cys His Lys 530 535 540 Gln Val
His Ser Arg Asp Gly Gln His Ser Arg Ser Leu Leu Lys Glu 545 550 555
560 Gly Leu 2562PRTThermosynechococcus elongatus 2Met Glu Thr Arg
Gln Met Ala Val Glu Gln Thr Thr Gly Ala Val Thr 1 5 10 15 Asn Gln
Thr Glu Thr Ser Trp His Ser Ile Asp Trp Ala Lys Ala Asn 20 25 30
Arg Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys Ala Val Lys Glu 35
40 45 Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu Leu Thr His
Ser 50 55 60 Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr Asp
Asn Ser Gly 65 70 75 80 Ser Lys Thr Pro Gly Val Asp Gly Ile Thr Trp
Ser Thr Gln Glu Gln 85 90 95 Lys Ala Gln Ala Ile Lys Ser Leu Arg
Arg Arg Gly Tyr Lys Pro Gln 100 105 110 Pro Leu Arg Arg Val Tyr Ile
Pro Lys Ala Asn Gly Lys Gln Arg Pro 115 120 125 Leu Gly Ile Pro Thr
Met Lys Asp Arg Ala Met Gln Ala Leu Tyr Ala 130 135 140 Leu Ala Leu
Glu Pro Val Ala Glu Thr Thr Ala Asp Arg Asn Ser Tyr 145 150 155 160
Gly Phe Arg Arg Gly Arg Cys Ile Ala Asp Ala Ala Thr Gln Cys His 165
170 175 Ile Thr Leu Ala Lys Thr Asp Arg Ala Gln Tyr Val Leu Asp Ala
Asp 180 185 190 Ile Ala Gly Cys Phe Asp Asn Ile Ser His Glu Trp Leu
Leu Ala Asn 195 200 205 Ile Pro Leu Asp Lys Arg Ile Leu Arg Lys Trp
Leu Lys Ser Gly Phe 210 215 220 Val Trp Lys Gln Gln Leu Phe Pro Ile
His Ala Gly Thr Pro Gln Gly 225 230 235 240 Gly Val Ile Ser Pro Met
Leu Ala Asn Met Thr Leu Asp Gly Met Glu 245 250 255 Glu Leu Leu Asn
Lys Phe Pro Arg Ala His Lys Val Lys Leu Ile Arg 260 265 270 Tyr Ala
Asp Asp Phe Val Val Thr Gly Glu Thr Lys Glu Val Leu Tyr 275 280 285
Ile Ala Gly Ala Val Ile Gln Ala Phe Leu Lys Glu Arg Gly Leu Thr 290
295 300 Leu Ser Lys Glu Lys Thr Lys Ile Val His Ile Glu Glu Gly Phe
Asp 305 310 315 320 Phe Leu Gly Trp Asn Ile Arg Lys Tyr Asp Gly Lys
Leu Leu Ile Lys 325 330 335 Pro Ala Lys Lys Asn Val Lys Ala Phe Leu
Lys Lys Ile Arg Asp Thr 340 345 350 Leu Arg Glu Leu Arg Thr Ala Pro
Gln Glu Ile Val Ile Asp Thr Leu 355 360 365 Asn Pro Ile Ile Arg Gly
Trp Thr Asn Tyr His Lys Asn Gln Ala Ser 370 375 380 Lys Glu Thr Phe
Val Gly Val Asp His Leu Ile Trp Gln Lys Leu Trp 385 390 395 400 Arg
Trp Ala Arg Arg Arg His Pro Ser Lys Ser Val Arg Trp Val Lys 405 410
415 Ser Lys Tyr Phe Ile Gln Ile Gly Asn Arg Lys Trp Met Phe Gly Ile
420 425 430 Trp Thr Lys Asp Lys Asn Gly Asp Pro Trp Ala Lys His Leu
Ile Lys 435 440 445 Ala Ser Glu Ile Arg Ile Gln Arg Arg Gly Lys Ile
Lys Ala Asp Ala 450 455 460 Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr
Phe Glu Gln Arg Lys Lys 465 470 475 480 Leu Lys Glu Ala Pro Ala Gln
Tyr Arg Arg Thr Arg Arg Glu Leu Trp 485 490 495 Lys Lys Gln Gly Gly
Ile Cys Pro Val Cys Gly Gly Glu Ile Glu Gln 500 505 510 Asp Met Leu
Thr Glu Ile His His Ile Leu Pro Lys His Lys Gly Gly 515 520 525 Thr
Asp Asp Leu Asp Asn Leu Val Leu Ile His Thr Asn Cys His Lys 530 535
540 Gln Val His Asn Arg Asp Gly Gln His Ser Arg Phe Leu Leu Lys Glu
545 550 555 560 Gly Leu 3562PRTThermosynechococcus elongatus 3Met
Glu Thr Arg Gln Met Ala Val Glu Gln Thr Thr Gly Ala Val Thr 1 5 10
15 Asn Gln Thr Glu Thr Ser Trp His Ser Ile Asp Trp Ala Lys Ala Asn
20 25 30 Arg Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys Ala Val
Lys Glu 35 40 45 Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu
Leu Thr His Ser 50 55 60 Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg
Val Thr Asp Asn Ser Gly 65 70 75 80 Ser Lys Thr Pro Gly Val Asp Gly
Ile Thr Trp Ser Thr Gln Glu Gln 85 90 95 Lys Ala Gln Ala Ile Lys
Ser Leu Arg Arg Arg Gly Tyr Lys Pro Gln 100 105 110 Pro Leu Arg Arg
Val Tyr Ile Pro Lys Ala Ser Gly Lys Gln Arg Pro 115 120 125 Leu Gly
Ile Pro Thr Thr Lys Asp Arg Ala Met Gln Ala Leu Tyr Ala 130 135 140
Leu Ala Leu Glu Pro Val Ala Glu Thr Thr Ala Asp Arg Asn Ser Tyr 145
150 155 160 Gly Phe Arg Gln Gly Arg Cys Thr Ala Asp Ala Ala Gly Gln
Cys Phe 165 170 175 Thr Val Leu Gly Arg Ser Asp Cys Ala Lys Tyr Ile
Leu Asp Ala Asp 180 185 190 Ile Thr Gly Cys Phe Asp Asn Ile Ser His
Glu Trp Leu Leu Asp Asn 195 200 205 Ile Pro Leu Asp Lys Glu Val Leu
Arg Lys Trp Leu Lys Ser Gly Phe 210 215 220 Val Trp Lys Gln Gln Leu
Phe Pro Thr His Ala Gly Thr Pro Gln Gly 225 230 235 240 Gly Val Ile
Ser Pro Met Leu Ala Asn Met Thr Leu Asp Gly Met Glu 245 250 255 Glu
Leu Leu Lys Lys His Leu Arg Lys Gln Lys Val Asn Leu Ile Arg 260 265
270 Tyr Ala Asp Asp Phe Val Val Thr Gly Glu Ser Lys Glu Thr Leu Glu
275 280 285 Lys Val Thr Thr Val Ile Gln Glu Phe Leu Lys Glu Arg Gly
Leu Thr 290 295 300 Leu Ser Glu Glu Lys Thr Lys Val Val His Ile Glu
Glu Gly Phe Asp 305 310 315 320 Phe Leu Gly Trp Asn Ile Arg Lys Tyr
Gly Glu Lys Leu Leu Ile Lys 325 330 335 Pro Ala Lys Lys Asn Ile Lys
Ala Phe His Lys Lys Ile Arg Asp Ala 340 345 350 Leu Lys Glu Leu Arg
Thr Ala Thr Gln Glu Ala Val Ile Asp Thr Leu 355 360 365 Asn Pro Ile
Ile Lys Gly Trp Ala Asn Tyr His Arg Asn Gln Val Ser 370 375 380 Lys
Arg Ile Phe Asn Arg Ala Asp Asp Asn Ile Trp His Lys Leu Trp 385 390
395 400 Arg Trp Ala Lys Arg Arg His Pro Asn Lys Pro Ala Arg Trp Thr
Lys 405 410 415 Asn Lys Tyr Phe Ile Lys Ile Gly Asn Arg His Trp Val
Phe Gly Thr 420 425 430 Trp Lys Lys Asp Lys Glu Gly Arg Leu Arg Ser
Arg Tyr Leu Ile Lys 435 440 445 Ala Gly Asp Thr Arg Ile Gln Arg His
Val Lys Ile Lys Ala Asp Ala 450 455 460 Asn Pro Phe Leu Pro Glu Trp
Ala Glu Tyr Phe Glu Glu Arg Lys Lys 465 470 475 480 Leu Lys Glu Ala
Pro Ala Gln Tyr Arg Arg Ile Arg Arg Glu Leu Trp 485 490 495 Lys Lys
Gln Gly Gly Ile Cys Pro Val Cys Gly Gly Glu Ile Glu Gln 500 505 510
Asp Met Leu Thr Glu Ile His His Ile Leu Pro Lys His Lys Gly Gly 515
520 525 Ser Asp Asp Leu Asp Asn Leu Val Leu Ile His Ala Asn Cys His
Lys 530 535 540 Gln Val His Ser Arg Asp Gly Gln His Ser Arg Phe Leu
Leu Lys Glu 545 550 555 560 Gly Leu 4635PRTGeobacillus
stearothermophilus 4Met Lys Val Asn Lys Leu Val Val Lys Ser Glu Gln
Asp Leu Arg Asn 1 5 10 15 Cys Leu Asp Leu Leu Tyr Gln Glu Ala Lys
Lys Gly Lys His Phe Tyr 20 25 30 Gly Met Leu Glu Leu Leu Gln Asn
Asp Val Val Ile Leu Glu Ala Ile 35 40 45 Arg Asn Ile Lys Ser Asn
Lys Gly Ser Lys Thr Ala Gly Ile Asp Gln 50 55 60 Lys Ile Val Asp
Asp Tyr Leu Leu Met Pro Thr Glu Lys Val Phe Gly 65 70 75 80 Met Ile
Lys Ala Lys Leu Asn Asp Tyr Lys Pro Ile Pro Val Arg Arg 85 90 95
Cys Asn Lys Pro Lys Gly Asn Ala Lys Ser Ser Lys Arg Lys Gly Asn 100
105 110 Ser Pro Asn Glu Glu Gly Glu Thr Arg Pro Leu Gly Ile Ser Ala
Val 115 120 125 Thr Asp Arg Ile Ile Gln Glu Met Leu Arg Ile Val Leu
Glu Pro Ile 130 135 140 Phe Glu Ala Gln Phe Tyr Pro His Ser Tyr Gly
Phe Arg Pro Tyr Arg 145 150 155 160 Ser Thr Glu His Ala Leu Ala Trp
Met Leu Lys Ile Ile Asn Gly Ser 165 170 175 Lys Leu Tyr Trp Val Val
Lys Gly Asp Ile Glu Ser Tyr Phe Asp His 180 185 190 Ile Asn His Lys
Lys Leu Leu Asn Ile Met Trp Asn Met Gly Val Arg 195 200 205 Asp Lys
Arg Val Leu Cys Ile Val Lys Lys Met Leu Lys Ala Gly Gln 210 215 220
Val Ile Gln Gly Lys Phe Tyr Pro Thr Ala Lys Gly Ile Pro Gln Gly 225
230 235 240 Gly Ile Ile Ser Pro Leu Leu Ala Asn Val Tyr Leu Asn Ser
Phe Asp 245 250 255 Trp Met Val Gly Gln Glu Tyr Glu Tyr His Pro Asn
Asn Ala Asn Tyr 260 265 270 Arg Glu Lys Lys Asn Ala Leu Ala Ala Leu
Arg Asn Lys Gly His His 275 280 285 Pro Val Phe Tyr Ile Arg Tyr Ala
Asp Asp Trp Val Ile Leu Thr Asp 290 295 300 Thr Lys Glu Tyr Ala Glu
Lys Ile Arg Glu Gln Cys Lys Gln Tyr Leu 305 310 315 320 Ala Cys Glu
Leu His Leu Thr Leu Ser Asp Glu Lys Thr Phe Ile Ala 325 330 335 Asp
Ile Arg Glu Gln Arg Val Lys Phe Leu Gly Phe Cys Ile Glu Ala 340 345
350 Gly Lys Arg Arg Phe His Lys Lys Gly Phe Ala Ala Arg Met Ile Pro
355 360 365 Asp Met Glu Lys Val Asn Ala Lys Val Lys Glu Ile Lys Arg
Asp Ile 370 375 380 Arg Leu Leu Arg Thr Arg Lys Ser Glu Leu Glu Lys
Ala Leu Asp Ile 385 390 395 400 Glu Asn Ile Asn Thr Lys Ile Ile Gly
Leu Ala Asn His Leu Lys Ile 405 410 415 Gly Ile Ser Lys Tyr Ile Met
Gly Lys Val Asp Arg Val Ile Glu Glu 420 425 430 Thr Ala Tyr Arg Thr
Trp Val Lys Met Tyr Gly Lys Glu Lys Ala Ala 435 440 445 Gln Tyr Lys
Arg Pro Val Ser Glu Phe His Asn Arg Ile Asp Arg His 450 455 460 Lys
Gly Tyr Gln Met Lys His Phe Ser Val Val Thr Glu Asp Gly Ile 465 470
475 480 Arg Val Gly Ile Thr His Ala Lys Ile Thr Pro Ile Gln Tyr Ala
Thr 485 490 495 Val Phe Lys Gln Glu Met Thr Pro Tyr Thr Ala Asp Gly
Arg Lys Met 500 505 510 Tyr Glu Glu Lys His Arg Lys Ile Arg Leu Pro
Asp Lys Met Ser Leu 515 520 525 Phe Asp His Asp Ser Ile Phe Ile Tyr
Ile Leu Ser Glu His Asn Asp 530 535 540 Gly Lys Tyr Asn Leu Glu Tyr
Phe Leu Asn Arg Val Asn Val Phe His 545 550 555 560 Arg Asp Lys Gly
Lys Cys Lys Ile Cys Ala Val Tyr Leu Ser Pro Gly 565 570 575 Asn Phe
His Cys His His Ile Asp Pro Ser Lys Pro Leu Ser Glu Ile 580 585 590
Asn Lys Thr Val Asn Leu Ile Ser Leu Cys Asn Gln Cys His Arg Leu
595
600 605 Val His Ser Asn Gln Glu Pro Pro Phe Thr Glu Arg Lys Met Phe
Asp 610 615 620 Lys Leu Thr Lys Tyr Arg Asn Lys Leu Lys Ile 625 630
635 5420PRTGeobacillus stearothermophilus 5Met Ala Leu Leu Glu Arg
Ile Leu Ala Arg Asp Asn Leu Ile Thr Ala 1 5 10 15 Leu Lys Arg Val
Glu Ala Asn Gln Gly Ala Pro Gly Ile Asp Gly Val 20 25 30 Ser Thr
Asp Gln Leu Arg Asp Tyr Ile Arg Ala His Trp Ser Thr Ile 35 40 45
His Ala Gln Leu Leu Ala Gly Thr Tyr Arg Pro Ala Pro Val Arg Arg 50
55 60 Val Glu Ile Pro Lys Pro Gly Gly Gly Thr Arg Gln Leu Gly Ile
Pro 65 70 75 80 Thr Val Val Asp Arg Leu Ile Gln Gln Ala Ile Leu Gln
Glu Leu Thr 85 90 95 Pro Ile Phe Asp Pro Asp Phe Ser Ser Ser Ser
Phe Gly Phe Arg Pro 100 105 110 Gly Arg Asn Ala His Asp Ala Val Arg
Gln Ala Gln Gly Tyr Ile Gln 115 120 125 Glu Gly Tyr Arg Tyr Val Val
Asp Met Asp Leu Glu Lys Phe Phe Asp 130 135 140 Arg Val Asn His Asp
Ile Leu Met Ser Arg Val Ala Arg Lys Val Lys 145 150 155 160 Asp Lys
Arg Val Leu Lys Leu Ile Arg Ala Tyr Leu Gln Ala Gly Val 165 170 175
Met Ile Glu Gly Val Lys Val Gln Thr Glu Glu Gly Thr Pro Gln Gly 180
185 190 Gly Pro Leu Ser Pro Leu Leu Ala Asn Ile Leu Leu Asp Asp Leu
Asp 195 200 205 Lys Glu Leu Glu Lys Arg Gly Leu Lys Phe Cys Arg Tyr
Ala Asp Asp 210 215 220 Cys Asn Ile Tyr Val Lys Ser Leu Arg Ala Gly
Gln Arg Val Lys Gln 225 230 235 240 Ser Ile Gln Arg Phe Leu Glu Lys
Thr Leu Lys Leu Lys Val Asn Glu 245 250 255 Glu Lys Ser Ala Val Asp
Arg Pro Trp Lys Arg Ala Phe Leu Gly Phe 260 265 270 Ser Phe Thr Pro
Glu Arg Lys Ala Arg Ile Arg Leu Ala Pro Arg Ser 275 280 285 Ile Gln
Arg Leu Lys Gln Arg Ile Arg Gln Leu Thr Asn Pro Asn Trp 290 295 300
Ser Ile Ser Met Pro Glu Arg Ile His Arg Val Asn Gln Tyr Val Met 305
310 315 320 Gly Trp Ile Gly Tyr Phe Arg Leu Val Glu Thr Pro Ser Val
Leu Gln 325 330 335 Thr Ile Glu Gly Trp Ile Arg Arg Arg Leu Arg Leu
Cys Gln Trp Leu 340 345 350 Gln Trp Lys Arg Val Arg Thr Arg Ile Arg
Glu Leu Arg Ala Leu Gly 355 360 365 Leu Lys Glu Thr Ala Val Met Glu
Ile Ala Asn Thr Arg Lys Gly Ala 370 375 380 Trp Arg Thr Thr Lys Thr
Pro Gln Leu His Gln Ala Leu Gly Lys Thr 385 390 395 400 Tyr Trp Thr
Ala Gln Gly Leu Lys Ser Leu Thr Gln Arg Tyr Phe Glu 405 410 415 Leu
Arg Gln Gly 420 6934PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 6Met Lys Ile Glu Glu Gly Lys Leu Val
Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu
Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr
Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val
Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His
Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70
75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp
Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile
Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu
Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp
Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn
Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala
Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp
Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190
Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195
200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr
Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp
Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr
Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser
Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys
Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu
Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys
Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315
320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln
325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn
Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu Ala Ala
Ala Gln Thr Ala 355 360 365 Ala Ala Ala Ala Met Glu Thr Arg Gln Met
Thr Val Asp Gln Thr Thr 370 375 380 Gly Ala Val Thr Asn Gln Thr Glu
Thr Ser Trp His Ser Ile Asn Trp 385 390 395 400 Thr Lys Ala Asn Arg
Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys 405 410 415 Ala Val Lys
Glu Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu 420 425 430 Leu
Thr His Ser Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr 435 440
445 Asp Asn Ser Gly Ser Arg Thr Pro Gly Val Asp Gly Ile Thr Trp Ser
450 455 460 Thr Gln Glu Gln Lys Thr Gln Ala Ile Lys Ser Leu Arg Arg
Arg Gly 465 470 475 480 Tyr Lys Pro Gln Pro Leu Arg Arg Val Tyr Ile
Pro Lys Ala Asn Gly 485 490 495 Lys Gln Arg Pro Leu Gly Ile Pro Thr
Met Lys Asp Arg Ala Met Gln 500 505 510 Ala Leu Tyr Ala Leu Ala Leu
Glu Pro Val Ala Glu Thr Thr Ala Asp 515 520 525 Arg Asn Ser Tyr Gly
Phe Arg Arg Gly Arg Cys Thr Ala Asp Ala Ala 530 535 540 Gly Gln Cys
Phe Leu Ala Leu Ala Lys Ala Lys Ser Ala Glu His Val 545 550 555 560
Leu Asp Ala Asp Ile Ser Gly Cys Phe Asp Asn Ile Ser His Glu Trp 565
570 575 Leu Leu Ala Asn Thr Pro Leu Asp Lys Gly Ile Leu Arg Lys Trp
Leu 580 585 590 Lys Ser Gly Phe Val Trp Lys Gln Gln Leu Phe Pro Thr
His Ala Gly 595 600 605 Thr Pro Gln Gly Gly Val Ile Ser Pro Val Leu
Ala Asn Ile Thr Leu 610 615 620 Asp Gly Met Glu Glu Leu Leu Ala Lys
His Leu Arg Gly Gln Lys Val 625 630 635 640 Asn Leu Ile Arg Tyr Ala
Asp Asp Phe Val Val Thr Gly Lys Asp Glu 645 650 655 Glu Thr Leu Glu
Lys Ala Arg Asn Leu Ile Gln Glu Phe Leu Lys Glu 660 665 670 Arg Gly
Leu Thr Leu Ser Pro Glu Lys Thr Lys Ile Val His Ile Glu 675 680 685
Glu Gly Phe Asp Phe Leu Gly Trp Asn Ile Arg Lys Tyr Asn Gly Val 690
695 700 Leu Leu Ile Lys Pro Ala Lys Lys Asn Val Lys Ala Phe Leu Lys
Lys 705 710 715 720 Ile Arg Asp Thr Leu Arg Glu Leu Arg Thr Ala Thr
Gln Glu Ile Val 725 730 735 Ile Asp Thr Leu Asn Pro Ile Ile Arg Gly
Trp Ala Asn Tyr His Lys 740 745 750 Gly Gln Val Ser Lys Glu Thr Phe
Asn Arg Val Asp Phe Ala Thr Trp 755 760 765 His Lys Leu Trp Arg Trp
Ala Arg Arg Arg His Pro Asn Lys Pro Ala 770 775 780 Gln Trp Val Lys
Asp Lys Tyr Phe Ile Lys Asn Gly Ser Arg Asp Trp 785 790 795 800 Val
Phe Gly Met Val Met Lys Asp Lys Asn Gly Glu Leu Arg Thr Lys 805 810
815 Arg Leu Ile Lys Thr Ser Asp Thr Arg Ile Gln Arg His Val Lys Ile
820 825 830 Lys Ala Asp Ala Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr
Phe Glu 835 840 845 Lys Arg Lys Lys Leu Lys Lys Ala Pro Ala Gln Tyr
Arg Arg Ile Arg 850 855 860 Arg Glu Leu Trp Lys Lys Gln Gly Gly Ile
Cys Pro Val Cys Gly Gly 865 870 875 880 Glu Ile Glu Gln Asp Met Leu
Thr Asp Ile His His Ile Leu Pro Lys 885 890 895 His Lys Gly Gly Ser
Asp Asp Leu Asp Asn Leu Val Leu Ile His Ala 900 905 910 Asn Cys His
Lys Gln Val His Ser Arg Asp Gly Gln His Ser Arg Ser 915 920 925 Leu
Leu Lys Glu Gly Leu 930 7934PRTArtificial SequenceDescription of
Artificial Sequence Synthetic polypeptide 7Met Lys Ile Glu Glu Gly
Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly
Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile
Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45
Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50
55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu
Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe
Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr
Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp
Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala
Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met
Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile
Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175
Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180
185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala
Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly
Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn
Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu
Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val
Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu
Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly
Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300
Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305
310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile
Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val
Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu
Ala Ala Ala Gln Thr Ala 355 360 365 Ala Ala Ala Ala Met Glu Thr Arg
Gln Met Ala Val Glu Gln Thr Thr 370 375 380 Gly Ala Val Thr Asn Gln
Thr Glu Thr Ser Trp His Ser Ile Asp Trp 385 390 395 400 Ala Lys Ala
Asn Arg Glu Val Lys Arg Leu Gln Val Arg Ile Ala Lys 405 410 415 Ala
Val Lys Glu Gly Arg Trp Gly Lys Val Lys Ala Leu Gln Trp Leu 420 425
430 Leu Thr His Ser Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr
435 440 445 Asp Asn Ser Gly Ser Lys Thr Pro Gly Val Asp Gly Ile Thr
Trp Ser 450 455 460 Thr Gln Glu Gln Lys Ala Gln Ala Ile Lys Ser Leu
Arg Arg Arg Gly 465 470 475 480 Tyr Lys Pro Gln Pro Leu Arg Arg Val
Tyr Ile Pro Lys Ala Asn Gly 485 490 495 Lys Gln Arg Pro Leu Gly Ile
Pro Thr Met Lys Asp Arg Ala Met Gln 500 505 510 Ala Leu Tyr Ala Leu
Ala Leu Glu Pro Val Ala Glu Thr Thr Ala Asp 515 520 525 Arg Asn Ser
Tyr Gly Phe Arg Arg Gly Arg Cys Ile Ala Asp Ala Ala 530 535 540 Thr
Gln Cys His Ile Thr Leu Ala Lys Thr Asp Arg Ala Gln Tyr Val 545 550
555 560 Leu Asp Ala Asp Ile Ala Gly Cys Phe Asp Asn Ile Ser His Glu
Trp 565 570 575 Leu Leu Ala Asn Ile Pro Leu Asp Lys Arg Ile Leu Arg
Lys Trp Leu 580 585 590 Lys Ser Gly Phe Val Trp Lys Gln Gln Leu Phe
Pro Ile His Ala Gly 595 600 605 Thr Pro Gln Gly Gly Val Ile Ser Pro
Met Leu Ala Asn Met Thr Leu 610 615 620 Asp Gly Met Glu Glu Leu Leu
Asn Lys Phe Pro Arg Ala His Lys Val 625 630 635 640 Lys Leu Ile Arg
Tyr Ala Asp Asp Phe Val Val Thr Gly Glu Thr Lys 645 650 655 Glu Val
Leu Tyr Ile Ala Gly Ala Val Ile Gln Ala Phe Leu Lys Glu 660 665 670
Arg Gly Leu Thr Leu Ser Lys Glu Lys Thr Lys Ile Val His Ile Glu 675
680 685 Glu Gly Phe Asp Phe Leu Gly Trp Asn Ile Arg Lys Tyr Asp Gly
Lys 690 695 700 Leu Leu Ile Lys Pro Ala Lys Lys Asn Val Lys Ala Phe
Leu Lys Lys 705 710 715 720 Ile Arg Asp Thr Leu Arg Glu Leu Arg Thr
Ala Pro Gln Glu Ile Val 725 730 735 Ile Asp Thr Leu Asn Pro Ile Ile
Arg Gly Trp Thr Asn Tyr His Lys 740 745 750 Asn Gln Ala Ser Lys Glu
Thr Phe Val Gly Val Asp His Leu Ile Trp 755 760 765 Gln Lys Leu Trp
Arg Trp Ala Arg Arg Arg His Pro Ser Lys Ser Val 770 775 780 Arg Trp
Val Lys Ser Lys Tyr Phe Ile Gln Ile Gly Asn Arg Lys Trp 785 790 795
800 Met Phe Gly Ile Trp Thr Lys Asp Lys Asn Gly Asp Pro Trp Ala Lys
805 810 815 His Leu Ile Lys Ala Ser Glu Ile Arg Ile Gln Arg Arg Gly
Lys Ile 820 825 830 Lys Ala Asp Ala Asn Pro Phe Leu Pro Glu Trp Ala
Glu Tyr Phe Glu 835 840 845 Gln Arg Lys Lys Leu Lys Glu Ala Pro Ala
Gln Tyr Arg Arg Thr Arg 850 855 860 Arg Glu Leu Trp Lys Lys Gln Gly
Gly Ile Cys Pro Val Cys Gly Gly 865 870 875 880 Glu Ile Glu Gln Asp
Met Leu Thr Glu Ile His His Ile Leu Pro Lys
885 890 895 His Lys Gly Gly Thr Asp Asp Leu Asp Asn Leu Val Leu Ile
His Thr 900 905 910 Asn Cys His Lys Gln Val His Asn Arg Asp Gly Gln
His Ser Arg Phe 915 920 925 Leu Leu Lys Glu Gly Leu 930
8934PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 8Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp
Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly
Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu
His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala
Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg
Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr
Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90
95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu
100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro
Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu
Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu
Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly
Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp
Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe
Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr
Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215
220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys
225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly
Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile
Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu
Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn
Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu
Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met
Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335
Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340
345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr
Ala 355 360 365 Ala Ala Ala Ala Met Glu Thr Arg Gln Met Ala Val Glu
Gln Thr Thr 370 375 380 Gly Ala Val Thr Asn Gln Thr Glu Thr Ser Trp
His Ser Ile Asp Trp 385 390 395 400 Ala Lys Ala Asn Arg Glu Val Lys
Arg Leu Gln Val Arg Ile Ala Lys 405 410 415 Ala Val Lys Glu Gly Arg
Trp Gly Lys Val Lys Ala Leu Gln Trp Leu 420 425 430 Leu Thr His Ser
Phe Tyr Gly Lys Ala Leu Ala Val Lys Arg Val Thr 435 440 445 Asp Asn
Ser Gly Ser Lys Thr Pro Gly Val Asp Gly Ile Thr Trp Ser 450 455 460
Thr Gln Glu Gln Lys Ala Gln Ala Ile Lys Ser Leu Arg Arg Arg Gly 465
470 475 480 Tyr Lys Pro Gln Pro Leu Arg Arg Val Tyr Ile Pro Lys Ala
Ser Gly 485 490 495 Lys Gln Arg Pro Leu Gly Ile Pro Thr Thr Lys Asp
Arg Ala Met Gln 500 505 510 Ala Leu Tyr Ala Leu Ala Leu Glu Pro Val
Ala Glu Thr Thr Ala Asp 515 520 525 Arg Asn Ser Tyr Gly Phe Arg Gln
Gly Arg Cys Thr Ala Asp Ala Ala 530 535 540 Gly Gln Cys Phe Thr Val
Leu Gly Arg Ser Asp Cys Ala Lys Tyr Ile 545 550 555 560 Leu Asp Ala
Asp Ile Thr Gly Cys Phe Asp Asn Ile Ser His Glu Trp 565 570 575 Leu
Leu Asp Asn Ile Pro Leu Asp Lys Glu Val Leu Arg Lys Trp Leu 580 585
590 Lys Ser Gly Phe Val Trp Lys Gln Gln Leu Phe Pro Thr His Ala Gly
595 600 605 Thr Pro Gln Gly Gly Val Ile Ser Pro Met Leu Ala Asn Met
Thr Leu 610 615 620 Asp Gly Met Glu Glu Leu Leu Lys Lys His Leu Arg
Lys Gln Lys Val 625 630 635 640 Asn Leu Ile Arg Tyr Ala Asp Asp Phe
Val Val Thr Gly Glu Ser Lys 645 650 655 Glu Thr Leu Glu Lys Val Thr
Thr Val Ile Gln Glu Phe Leu Lys Glu 660 665 670 Arg Gly Leu Thr Leu
Ser Glu Glu Lys Thr Lys Val Val His Ile Glu 675 680 685 Glu Gly Phe
Asp Phe Leu Gly Trp Asn Ile Arg Lys Tyr Gly Glu Lys 690 695 700 Leu
Leu Ile Lys Pro Ala Lys Lys Asn Ile Lys Ala Phe His Lys Lys 705 710
715 720 Ile Arg Asp Ala Leu Lys Glu Leu Arg Thr Ala Thr Gln Glu Ala
Val 725 730 735 Ile Asp Thr Leu Asn Pro Ile Ile Lys Gly Trp Ala Asn
Tyr His Arg 740 745 750 Asn Gln Val Ser Lys Arg Ile Phe Asn Arg Ala
Asp Asp Asn Ile Trp 755 760 765 His Lys Leu Trp Arg Trp Ala Lys Arg
Arg His Pro Asn Lys Pro Ala 770 775 780 Arg Trp Thr Lys Asn Lys Tyr
Phe Ile Lys Ile Gly Asn Arg His Trp 785 790 795 800 Val Phe Gly Thr
Trp Lys Lys Asp Lys Glu Gly Arg Leu Arg Ser Arg 805 810 815 Tyr Leu
Ile Lys Ala Gly Asp Thr Arg Ile Gln Arg His Val Lys Ile 820 825 830
Lys Ala Asp Ala Asn Pro Phe Leu Pro Glu Trp Ala Glu Tyr Phe Glu 835
840 845 Glu Arg Lys Lys Leu Lys Glu Ala Pro Ala Gln Tyr Arg Arg Ile
Arg 850 855 860 Arg Glu Leu Trp Lys Lys Gln Gly Gly Ile Cys Pro Val
Cys Gly Gly 865 870 875 880 Glu Ile Glu Gln Asp Met Leu Thr Glu Ile
His His Ile Leu Pro Lys 885 890 895 His Lys Gly Gly Ser Asp Asp Leu
Asp Asn Leu Val Leu Ile His Ala 900 905 910 Asn Cys His Lys Gln Val
His Ser Arg Asp Gly Gln His Ser Arg Phe 915 920 925 Leu Leu Lys Glu
Gly Leu 930 91007PRTArtificial SequenceDescription of Artificial
Sequence Synthetic polypeptide 9Met Lys Ile Glu Glu Gly Lys Leu Val
Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu
Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr
Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val
Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His
Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70
75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp
Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile
Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu
Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp
Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn
Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala
Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp
Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190
Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195
200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr
Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp
Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr
Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser
Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys
Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu
Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys
Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315
320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln
325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn
Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Ala Ala Leu Ala Ala
Ala Gln Thr Ala 355 360 365 Ala Ala Ala Ala Met Lys Val Asn Lys Leu
Val Val Lys Ser Glu Gln 370 375 380 Asp Leu Arg Asn Cys Leu Asp Leu
Leu Tyr Gln Glu Ala Lys Lys Gly 385 390 395 400 Lys His Phe Tyr Gly
Met Leu Glu Leu Leu Gln Asn Asp Val Val Ile 405 410 415 Leu Glu Ala
Ile Arg Asn Ile Lys Ser Asn Lys Gly Ser Lys Thr Ala 420 425 430 Gly
Ile Asp Gln Lys Ile Val Asp Asp Tyr Leu Leu Met Pro Thr Glu 435 440
445 Lys Val Phe Gly Met Ile Lys Ala Lys Leu Asn Asp Tyr Lys Pro Ile
450 455 460 Pro Val Arg Arg Cys Asn Lys Pro Lys Gly Asn Ala Lys Ser
Ser Lys 465 470 475 480 Arg Lys Gly Asn Ser Pro Asn Glu Glu Gly Glu
Thr Arg Pro Leu Gly 485 490 495 Ile Ser Ala Val Thr Asp Arg Ile Ile
Gln Glu Met Leu Arg Ile Val 500 505 510 Leu Glu Pro Ile Phe Glu Ala
Gln Phe Tyr Pro His Ser Tyr Gly Phe 515 520 525 Arg Pro Tyr Arg Ser
Thr Glu His Ala Leu Ala Trp Met Leu Lys Ile 530 535 540 Ile Asn Gly
Ser Lys Leu Tyr Trp Val Val Lys Gly Asp Ile Glu Ser 545 550 555 560
Tyr Phe Asp His Ile Asn His Lys Lys Leu Leu Asn Ile Met Trp Asn 565
570 575 Met Gly Val Arg Asp Lys Arg Val Leu Cys Ile Val Lys Lys Met
Leu 580 585 590 Lys Ala Gly Gln Val Ile Gln Gly Lys Phe Tyr Pro Thr
Ala Lys Gly 595 600 605 Ile Pro Gln Gly Gly Ile Ile Ser Pro Leu Leu
Ala Asn Val Tyr Leu 610 615 620 Asn Ser Phe Asp Trp Met Val Gly Gln
Glu Tyr Glu Tyr His Pro Asn 625 630 635 640 Asn Ala Asn Tyr Arg Glu
Lys Lys Asn Ala Leu Ala Ala Leu Arg Asn 645 650 655 Lys Gly His His
Pro Val Phe Tyr Ile Arg Tyr Ala Asp Asp Trp Val 660 665 670 Ile Leu
Thr Asp Thr Lys Glu Tyr Ala Glu Lys Ile Arg Glu Gln Cys 675 680 685
Lys Gln Tyr Leu Ala Cys Glu Leu His Leu Thr Leu Ser Asp Glu Lys 690
695 700 Thr Phe Ile Ala Asp Ile Arg Glu Gln Arg Val Lys Phe Leu Gly
Phe 705 710 715 720 Cys Ile Glu Ala Gly Lys Arg Arg Phe His Lys Lys
Gly Phe Ala Ala 725 730 735 Arg Met Ile Pro Asp Met Glu Lys Val Asn
Ala Lys Val Lys Glu Ile 740 745 750 Lys Arg Asp Ile Arg Leu Leu Arg
Thr Arg Lys Ser Glu Leu Glu Lys 755 760 765 Ala Leu Asp Ile Glu Asn
Ile Asn Thr Lys Ile Ile Gly Leu Ala Asn 770 775 780 His Leu Lys Ile
Gly Ile Ser Lys Tyr Ile Met Gly Lys Val Asp Arg 785 790 795 800 Val
Ile Glu Glu Thr Ala Tyr Arg Thr Trp Val Lys Met Tyr Gly Lys 805 810
815 Glu Lys Ala Ala Gln Tyr Lys Arg Pro Val Ser Glu Phe His Asn Arg
820 825 830 Ile Asp Arg His Lys Gly Tyr Gln Met Lys His Phe Ser Val
Val Thr 835 840 845 Glu Asp Gly Ile Arg Val Gly Ile Thr His Ala Lys
Ile Thr Pro Ile 850 855 860 Gln Tyr Ala Thr Val Phe Lys Gln Glu Met
Thr Pro Tyr Thr Ala Asp 865 870 875 880 Gly Arg Lys Met Tyr Glu Glu
Lys His Arg Lys Ile Arg Leu Pro Asp 885 890 895 Lys Met Ser Leu Phe
Asp His Asp Ser Ile Phe Ile Tyr Ile Leu Ser 900 905 910 Glu His Asn
Asp Gly Lys Tyr Asn Leu Glu Tyr Phe Leu Asn Arg Val 915 920 925 Asn
Val Phe His Arg Asp Lys Gly Lys Cys Lys Ile Cys Ala Val Tyr 930 935
940 Leu Ser Pro Gly Asn Phe His Cys His His Ile Asp Pro Ser Lys Pro
945 950 955 960 Leu Ser Glu Ile Asn Lys Thr Val Asn Leu Ile Ser Leu
Cys Asn Gln 965 970 975 Cys His Arg Leu Val His Ser Asn Gln Glu Pro
Pro Phe Thr Glu Arg 980 985 990 Lys Met Phe Asp Lys Leu Thr Lys Tyr
Arg Asn Lys Leu Lys Ile 995 1000 1005 10792PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
10Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1
5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp
Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu
Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp
Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln
Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln
Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn
Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser
Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr
Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135
140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro
145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu
Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala
Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys
Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu
Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly
Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn
Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255
Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260
265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr
Asp 275
280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val
Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg
Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile
Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val
Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val
Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala 355 360 365 Ala Ala Ala Ala
Met Ala Leu Leu Glu Arg Ile Leu Ala Arg Asp Asn 370 375 380 Leu Ile
Thr Ala Leu Lys Arg Val Glu Ala Asn Gln Gly Ala Pro Gly 385 390 395
400 Ile Asp Gly Val Ser Thr Asp Gln Leu Arg Asp Tyr Ile Arg Ala His
405 410 415 Trp Ser Thr Ile His Ala Gln Leu Leu Ala Gly Thr Tyr Arg
Pro Ala 420 425 430 Pro Val Arg Arg Val Glu Ile Pro Lys Pro Gly Gly
Gly Thr Arg Gln 435 440 445 Leu Gly Ile Pro Thr Val Val Asp Arg Leu
Ile Gln Gln Ala Ile Leu 450 455 460 Gln Glu Leu Thr Pro Ile Phe Asp
Pro Asp Phe Ser Ser Ser Ser Phe 465 470 475 480 Gly Phe Arg Pro Gly
Arg Asn Ala His Asp Ala Val Arg Gln Ala Gln 485 490 495 Gly Tyr Ile
Gln Glu Gly Tyr Arg Tyr Val Val Asp Met Asp Leu Glu 500 505 510 Lys
Phe Phe Asp Arg Val Asn His Asp Ile Leu Met Ser Arg Val Ala 515 520
525 Arg Lys Val Lys Asp Lys Arg Val Leu Lys Leu Ile Arg Ala Tyr Leu
530 535 540 Gln Ala Gly Val Met Ile Glu Gly Val Lys Val Gln Thr Glu
Glu Gly 545 550 555 560 Thr Pro Gln Gly Gly Pro Leu Ser Pro Leu Leu
Ala Asn Ile Leu Leu 565 570 575 Asp Asp Leu Asp Lys Glu Leu Glu Lys
Arg Gly Leu Lys Phe Cys Arg 580 585 590 Tyr Ala Asp Asp Cys Asn Ile
Tyr Val Lys Ser Leu Arg Ala Gly Gln 595 600 605 Arg Val Lys Gln Ser
Ile Gln Arg Phe Leu Glu Lys Thr Leu Lys Leu 610 615 620 Lys Val Asn
Glu Glu Lys Ser Ala Val Asp Arg Pro Trp Lys Arg Ala 625 630 635 640
Phe Leu Gly Phe Ser Phe Thr Pro Glu Arg Lys Ala Arg Ile Arg Leu 645
650 655 Ala Pro Arg Ser Ile Gln Arg Leu Lys Gln Arg Ile Arg Gln Leu
Thr 660 665 670 Asn Pro Asn Trp Ser Ile Ser Met Pro Glu Arg Ile His
Arg Val Asn 675 680 685 Gln Tyr Val Met Gly Trp Ile Gly Tyr Phe Arg
Leu Val Glu Thr Pro 690 695 700 Ser Val Leu Gln Thr Ile Glu Gly Trp
Ile Arg Arg Arg Leu Arg Leu 705 710 715 720 Cys Gln Trp Leu Gln Trp
Lys Arg Val Arg Thr Arg Ile Arg Glu Leu 725 730 735 Arg Ala Leu Gly
Leu Lys Glu Thr Ala Val Met Glu Ile Ala Asn Thr 740 745 750 Arg Lys
Gly Ala Trp Arg Thr Thr Lys Thr Pro Gln Leu His Gln Ala 755 760 765
Leu Gly Lys Thr Tyr Trp Thr Ala Gln Gly Leu Lys Ser Leu Thr Gln 770
775 780 Arg Tyr Phe Glu Leu Arg Gln Gly 785 790 11367PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
11Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1
5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp
Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu
Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp
Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln
Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln
Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn
Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser
Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr
Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135
140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro
145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu
Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala
Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys
Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu
Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly
Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn
Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255
Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260
265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr
Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly
Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp
Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly
Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr
Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln
Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr 355 360 365
125PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 12Ala Ala Ala Ala Ala 1 5 138260DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
13ccgacaccat cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga
60gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg
120gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt
tctgcgaaaa 180cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta
cattcccaac cgcgtggcac 240aacaactggc gggcaaacag tcgttgctga
ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc gcaaattgtc
gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc
gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc
420ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac
caggatgcca 480ttgctgtgga agctgcctgc actaatgttc cggcgttatt
tcttgatgtc tctgaccaga 540cacccatcaa cagtattatt ttctcccatg
aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt gggtcaccag
caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg
tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag
720cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg
caaatgctga 780atgagggcat cgttcccact gcgatgctgg ttgccaacga
tcagatggcg ctgggcgcaa 840tgcgcgccat taccgagtcc gggctgcgcg
ttggtgcgga tatctcggta gtgggatacg 900acgataccga agacagctca
tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg
gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga
1020agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg
gcgcccaata 1080cgcaaaccgc ctctccccgc gcgttggccg attcattaat
gcagctggca cgacaggttt 1140cccgactgga aagcgggcag tgagcgcaac
gcaattaatg taagttagct cactcattag 1200gcacaattct catgtttgac
agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc
atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg
1320tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat
cataacggtt 1380ctggcaaata ttctgaaatg agctgttgac aattaatcat
cggctcgtat aatgtgtgga 1440attgtgagcg gataacaatt tcacacagga
aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc aacaaggacc
atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560attaacggcg
ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat
1620accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt
cccacaggtt 1680gcggcaactg gcgatggccc tgacattatc ttctgggcac
acgaccgctt tggtggctac 1740gctcaatctg gcctgttggc tgaaatcacc
ccggacaaag cgttccagga caagctgtat 1800ccgtttacct gggatgccgt
acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860gaagcgttat
cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa
1920gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct
gatgttcaac 1980ctgcaagaac cgtacttcac ctggccgctg attgctgctg
acgggggtta tgcgttcaag 2040tatgaaaacg gcaagtacga cattaaagac
gtgggcgtgg ataacgctgg cgcgaaagcg 2100ggtctgacct tcctggttga
cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160tccatcgcag
aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg
2220gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact
gccgaccttc 2280aagggtcaac catccaaacc gttcgttggc gtgctgagcg
caggtattaa cgccgccagt 2340ccgaacaaag agctggcaaa agagttcctc
gaaaactatc tgctgactga tgaaggtctg 2400gaagcggtta ataaagacaa
accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460ttggcgaaag
atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg
2520ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt
gatcaacgcc 2580gccagcggtc gtcagactgt cgatgccgcc ctggccgccg
cgcagactgc cgccgccgcc 2640gccatggaga caaggcaaat gacggtggac
caaaccactg gtgcggtcac caaccaaacg 2700gaaacaagct ggcacagcat
aaactggacc aaagccaacc gtgaggtaaa gaggctgcaa 2760gtgcgtatcg
caaaggctgt gaaggaagga cgctggggca aagtgaaagc tttgcaatgg
2820ctcctgaccc actcgttcta cggcaaagcc ctcgccgtga aacgggtaac
tgacaactca 2880ggcagtagaa cacctggtgt ggacgggata acctggtcca
cacaagagca gaaaacccaa 2940gccataaagt ccctcaggag aagaggctat
aaaccccaac ccctgaggcg ggtatacatc 3000ccgaaagcaa acggcaaaca
gcgcccgcta ggaatcccga caatgaagga cagggcaatg 3060caggcactat
atgccctagc cctagaacca gtcgcggaaa ccacagcgga ccggaactcc
3120tatgggttcc gccgagggcg atgtacggca gatgcggcag gacaatgctt
ccttgctctg 3180gcaaaagcca agtcggctga acacgtcctt gacgctgaca
tatccggatg ctttgataac 3240atcagccatg agtggctact agccaacact
ccactggaca aagggatctt acggaaatgg 3300cttaaatctg ggttcgtctg
gaaacagcaa ctcttcccca cccatgctgg gacacctcag 3360ggaggggtaa
tctccccagt tcttgccaat ataaccctag atgggatgga agaactgttg
3420gccaaacacc tcagaggtca aaaagtcaac ctcatccgat atgctgacga
ttttgtcgtg 3480acgggaaaag atgaggaaac cctggagaaa gccagaaacc
taatccagga gttcctaaaa 3540gaacggggct tgaccctgtc ccccgagaag
acaaaaatcg tccatattga ggaaggcttc 3600gactttctcg gatggaacat
tcgcaagtac aacggggttc ttctcatcaa acccgcgaag 3660aagaacgtga
aagcgttcct caagaaaatc cgagacactc taagggaact taggacagca
3720acccaggaaa tcgtgataga cacactcaac ccaatcatta gaggttgggc
caactatcac 3780aaaggacaag tctctaagga aaccttcaac cgagtggact
tcgccacctg gcacaaattg 3840tggcgatggg caaggcgccg gcacccaaac
aaacctgccc aatgggtgaa ggacaaatac 3900ttcatcaaaa acggaagcag
agactgggtg ttcggtatgg tgatgaaaga caagaacggg 3960gaactgagga
ccaaacgcct aatcaaaacc tctgacaccc gaatccaacg ccacgtcaaa
4020atcaaggcag acgccaatcc gtttctccca gagtgggcag aatactttga
gaaacgcaag 4080aaactcaaaa aagcccctgc tcaatatcgg cgcatccgcc
gagaactatg gaagaaacag 4140ggtggtatct gtccagtatg cgggggtgaa
attgagcaag acatgctcac tgacatccac 4200cacatattgc ccaaacacaa
gggtggttct gacgacctgg ataatcttgt cttaatccac 4260gccaactgcc
acaaacaggt gcacagccga gatggtcagc acagccggtc cctcttgaaa
4320gaggggcttt gactgcaggc aagcttggca ctggccgtcg ttttacaacg
tcgtgactgg 4380gaaaaccctg gcgttaccca acttaatcgc cttgcagcac
atcccccttt cgccagctgg 4440cgtaatagcg aagaggcccg caccgatcgc
ccttcccaac agttgcgcag cctgaatggc 4500gaatggcagc ttggctgttt
tggcggatga gataagattt tcagcctgat acagattaaa 4560tcagaacgca
gaagcggtct gataaaacag aatttgcctg gcggcagtag cgcggtggtc
4620ccacctgacc ccatgccgaa ctcagaagtg aaacgccgta gcgccgatgg
tagtgtgggg 4680tctccccatg cgagagtagg gaactgccag gcatcaaata
aaacgaaagg ctcagtcgaa 4740agactgggcc tttcgtttta tctgttgttt
gtcggtgaac gctctcctga gtaggacaaa 4800tccgccggga gcggatttga
acgttgcgaa gcaacggccc ggagggtggc gggcaggacg 4860cccgccataa
actgccaggc atcaaattaa gcagaaggcc atcctgacgg atggcctttt
4920tgcgtttcta caaactcttt ttgtttattt ttctaaatac attcaaatat
gtatccgctc 4980atgagacaat aaccctgata aatgcttcaa taatattgaa
aaaggaagag tatgagtatt 5040caacatttcc gtgtcgccct tattcccttt
tttgcggcat tttgccttcc tgtttttgct 5100cacccagaaa cgctggtgaa
agtaaaagat gctgaagatc agttgggtgc acgagtgggt 5160tacatcgaac
tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt
5220tctccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc
ccgtgttgac 5280gccgggcaag agcaactcgg tcgccgcata cactattctc
agaatgactt ggttgagtac 5340tcaccagtca cagaaaagca tcttacggat
ggcatgacag taagagaatt atgcagtgct 5400gccataacca tgagtgataa
cactgcggcc aacttacttc tgacaacgat cggaggaccg 5460aaggagctaa
ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg
5520gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat
gcctgtagca 5580atggcaacaa cgttgcgcaa actattaact ggcgaactac
ttactctagc ttcccggcaa 5640caattaatag actggatgga ggcggataaa
gttgcaggac cacttctgcg ctcggccctt 5700ccggctggct ggtttattgc
tgataaatct ggagccggtg agcgtgggtc tcgcggtatc 5760attgcagcac
tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg
5820agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc
ctcactgatt 5880aagcattggt aactgtcaga ccaagtttac tcatatatac
tttagattga tttaccccgg 5940ttgataatca gaaaagcccc aaaaacagga
agattgtata agcaaatatt taaattgtaa 6000acgttaatat tttgttaaaa
ttcgcgttaa atttttgtta aatcagctca ttttttaacc 6060aataggccga
aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga
6120gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc
aacgtcaaag 6180ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga
accatcaccc aaatcaagtt 6240ttttggggtc gaggtgccgt aaagcactaa
atcggaaccc taaagggagc ccccgattta 6300gagcttgacg gggaaagccg
gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag 6360cgggcgctag
ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg
6420cgcttaatgc gccgctacag ggcgcgtaaa aggatctagg tgaagatcct
ttttgataat 6480ctcatgacca aaatccctta acgtgagttt tcgttccact
gagcgtcaga ccccgtagaa 6540aagatcaaag gatcttcttg agatcctttt
tttctgcgcg taatctgctg cttgcaaaca 6600aaaaaaccac cgctaccagc
ggtggtttgt ttgccggatc aagagctacc aactcttttt 6660ccgaaggtaa
ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg
6720tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc
tctgctaatc 6780ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc
ttaccgggtt ggactcaaga 6840cgatagttac cggataaggc gcagcggtcg
ggctgaacgg ggggttcgtg cacacagccc 6900agcttggagc gaacgaccta
caccgaactg agatacctac agcgtgagct atgagaaagc 6960gccacgcttc
ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca
7020ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag
tcctgtcggg 7080tttcgccacc tctgacttga gcgtcgattt ttgtgatgct
cgtcaggggg gcggagccta 7140tggaaaaacg ccagcaacgc ggccttttta
cggttcctgg ccttttgctg gccttttgct 7200cacatgttct ttcctgcgtt
atcccctgat tctgtggata accgtattac cgcctttgag 7260tgagctgata
ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa
7320gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat
ttcacaccgc 7380atatatggtg cactctcagt acaatctgct ctgatgccgc
atagttaagc cagtatacac 7440tccgctatcg ctacgtgact gggtcatggc
tgcgccccga cacccgccaa cacccgctga 7500cgcgccctga cgggcttgtc
tgctcccggc atccgcttac agacaagctg tgaccgtctc 7560cgggagctgc
atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga ggcagctgcg
7620gtaaagctca tcagcgtggt cgtgcagcga ttcacagatg tctgcctgtt
catccgcgtc 7680cagctcgttg agtttctcca gaagcgttaa tgtctggctt
ctgataaagc gggccatgtt 7740aagggcggtt ttttcctgtt tggtcactga
tgcctccgtg taagggggat ttctgttcat 7800gggggtaatg ataccgatga
aacgagagag gatgctcacg atacgggtta ctgatgatga 7860acatgcccgg
ttactggaac gttgtgaggg taaacaactg gcggtatgga tgcggcggga
7920ccagagaaaa atcactcagg gtcaatgcca gcgcttcgtt aatacagatg
taggtgttcc 7980acagggtagc cagcagcatc ctgcgatgca gatccggaac
ataatggtgc agggcgctga 8040cttccgcgtt tccagacttt acgaaacacg
gaaaccgaag accattcatg ttgttgctca 8100ggtcgcagac gttttgcagc
agcagtcgct tcacgttcgc tcgcgtatcg gtgattcatt 8160ctgctaacca
gtaaggcaac cccgccagcc tagccgggtc ctcaacgaca ggagcacgat
8220catgcgcacc cgtggccagg acccaacgct gcccgaaatt
8260148260DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 14ccgacaccat cgaatggtgc aaaacctttc
gcggtatggc atgatagcgc ccggaagaga 60gtcaattcag ggtggtgaat gtgaaaccag
taacgttata cgatgtcgca gagtatgccg 120gtgtctctta tcagaccgtt
tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa 180cgcgggaaaa
agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac
240aacaactggc gggcaaacag tcgttgctga ttggcgttgc cacctccagt
ctggccctgc 300acgcgccgtc gcaaattgtc gcggcgatta aatctcgcgc
cgatcaactg ggtgccagcg 360tggtggtgtc gatggtagaa cgaagcggcg
tcgaagcctg taaagcggcg gtgcacaatc 420ttctcgcgca acgcgtcagt
gggctgatca ttaactatcc gctggatgac caggatgcca 480ttgctgtgga
agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga
540cacccatcaa cagtattatt ttctcccatg aagacggtac gcgactgggc
gtggagcatc 600tggtcgcatt gggtcaccag caaatcgcgc tgttagcggg
cccattaagt tctgtctcgg 660cgcgtctgcg tctggctggc tggcataaat
atctcactcg caatcaaatt cagccgatag 720cggaacggga aggcgactgg
agtgccatgt ccggttttca acaaaccatg caaatgctga 780atgagggcat
cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa
840tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga tatctcggta
gtgggatacg 900acgataccga agacagctca tgttatatcc cgccgttaac
caccatcaaa caggattttc 960gcctgctggg gcaaaccagc gtggaccgct
tgctgcaact ctctcagggc caggcggtga 1020agggcaatca gctgttgccc
gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata 1080cgcaaaccgc
ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt
1140cccgactgga aagcgggcag tgagcgcaac gcaattaatg taagttagct
cactcattag 1200gcacaattct catgtttgac agcttatcat cgactgcacg
gtgcaccaat gcttctggcg 1260tcaggcagcc atcggaagct gtggtatggc
tgtgcaggtc gtaaatcact gcataattcg 1320tgtcgctcaa ggcgcactcc
cgttctggat aatgtttttt gcgccgacat cataacggtt 1380ctggcaaata
ttctgaaatg agctgttgac aattaatcat cggctcgtat aatgtgtgga
1440attgtgagcg gataacaatt tcacacagga aacagccagt ccgtttaggt
gttttcacga 1500gcacttcacc aacaaggacc atagcatatg aaaatcgaag
aaggtaaact ggtaatctgg 1560attaacggcg ataaaggcta taacggtctc
gctgaagtcg gtaagaaatt cgagaaagat 1620accggaatta aagtcaccgt
tgagcatccg gataaactgg aagagaaatt cccacaggtt 1680gcggcaactg
gcgatggccc tgacattatc ttctgggcac acgaccgctt tggtggctac
1740gctcaatctg gcctgttggc tgaaatcacc ccggacaaag cgttccagga
caagctgtat 1800ccgtttacct gggatgccgt acgttacaac ggcaagctga
ttgcttaccc gatcgctgtt 1860gaagcgttat cgctgattta taacaaagat
ctgctgccga acccgccaaa aacctgggaa 1920gagatcccgg cgctggataa
agaactgaaa gcgaaaggta agagcgcgct gatgttcaac 1980ctgcaagaac
cgtacttcac ctggccgctg attgctgctg acgggggtta tgcgttcaag
2040tatgaaaacg gcaagtacga cattaaagac gtgggcgtgg ataacgctgg
cgcgaaagcg 2100ggtctgacct tcctggttga cctgattaaa aacaaacaca
tgaatgcaga caccgattac 2160tccatcgcag aagctgcctt taataaaggc
gaaacagcga tgaccatcaa cggcccgtgg 2220gcatggtcca acatcgacac
cagcaaagtg aattatggtg taacggtact gccgaccttc 2280aagggtcaac
catccaaacc gttcgttggc gtgctgagcg caggtattaa cgccgccagt
2340ccgaacaaag agctggcaaa agagttcctc gaaaactatc tgctgactga
tgaaggtctg 2400gaagcggtta ataaagacaa accgctgggt gccgtagcgc
tgaagtctta cgaggaagag 2460ttggcgaaag atccacgtat tgccgccact
atggaaaacg cccagaaagg tgaaatcatg 2520ccgaacatcc cgcagatgtc
cgctttctgg tatgccgtgc gtactgcggt gatcaacgcc 2580gccagcggtc
gtcagactgt cgatgccgcc ctggccgccg cgcagactgc cgccgccgcc
2640gccatggaga caaggcaaat ggcagtggaa caaaccactg gtgcggtcac
caaccaaacg 2700gaaacaagct ggcacagcat agactgggcc aaagccaacc
gtgaggtaaa gaggctgcaa 2760gtgcgtatcg caaaggctgt gaaggaagga
cgctggggca aagtgaaagc tttgcaatgg 2820ctcctgaccc actcgttcta
cggcaaagcc ctcgccgtga aacgggtaac tgacaactcg 2880ggcagcaaaa
cacctggtgt ggacgggata acctggtcca cacaagagca gaaagcccaa
2940gccataaagt ccctcaggag aagaggctat aaaccccaac ccctgaggcg
ggtatacatc 3000ccgaaagcaa acggcaaaca gcgcccgcta ggaatcccga
caatgaagga cagggcaatg 3060caggcactat atgccctagc cctagaacca
gtcgcggaaa ccacagcaga ccggaactcc 3120tatgggttcc ggcgaggacg
atgcatagcc gatgcagcga cgcagtgtca catcacgcta 3180gccaaaacag
accgtgcaca atacgttctc gacgccgata ttgctgggtg ctttgacaac
3240atcagccatg agtggctact agctaacatt ccactagaca aaagaattct
acggaaatgg 3300cttaaatctg ggtttgtctg gaagcagcaa ctcttcccca
tccatgctgg aacacctcag 3360ggaggggtaa tctccccgat gcttgccaac
atgacactgg atgggatgga agaattgtta 3420aacaagtttc ccagggcgca
caaggtcaaa ctcatccgat atgccgacga cttcgtcgta 3480accggtgaaa
cgaaggaagt gctctatatt gccggtgcgg taatacaagc attcctcaag
3540gaaaggggcc ttaccctatc aaaggaaaag acgaagatcg tacacattga
agaagggttt 3600gactttctcg gatggaacat tcgcaaatat gatgggaaac
tgctcatcaa acctgcgaag 3660aagaacgtta aagcgttcct caagaaaatc
cgagacacct taagagaact taggacagca 3720ccccaggaga ttgtgataga
cacactcaac ccaatcatca gaggttggac taactatcac 3780aaaaatcagg
catccaaaga aaccttcgtc ggagtggacc acctcatatg gcaaaaatta
3840tggcgatggg caaggcgccg acacccaagc aaatctgtcc gatgggtgaa
gagtaagtac 3900ttcatccaaa tcgggaacag aaaatggatg ttcggaatat
ggacgaaaga caaaaacgga 3960gacccgtggg ccaagcattt aatcaaagcc
tcggaaatcc gaatccaacg tcgcggtaaa 4020atcaaggcag acgccaaccc
gtttctccca gaatgggcag aatactttga gcagcgcaag 4080aaactcaaag
aggcccctgc ccaataccgg cgcacccgtc gggaattgtg gaagaaacaa
4140ggcggcatct gtccagtatg tgggggagaa attgagcaag acatgctcac
cgaaatccac 4200cacatactgc ccaaacacaa gggtggtact gacgacctgg
acaatcttgt cctaatccac 4260actaactgcc acaaacaggt gcacaaccga
gatggtcagc acagccggtt cctcttgaaa 4320gaggggcttt gactgcaggc
aagcttggca ctggccgtcg ttttacaacg tcgtgactgg 4380gaaaaccctg
gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg
4440cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag
cctgaatggc 4500gaatggcagc ttggctgttt tggcggatga gataagattt
tcagcctgat acagattaaa 4560tcagaacgca gaagcggtct gataaaacag
aatttgcctg gcggcagtag cgcggtggtc 4620ccacctgacc ccatgccgaa
ctcagaagtg aaacgccgta gcgccgatgg tagtgtgggg 4680tctccccatg
cgagagtagg gaactgccag gcatcaaata aaacgaaagg ctcagtcgaa
4740agactgggcc tttcgtttta tctgttgttt gtcggtgaac gctctcctga
gtaggacaaa 4800tccgccggga gcggatttga acgttgcgaa gcaacggccc
ggagggtggc gggcaggacg 4860cccgccataa actgccaggc atcaaattaa
gcagaaggcc atcctgacgg atggcctttt 4920tgcgtttcta caaactcttt
ttgtttattt ttctaaatac attcaaatat gtatccgctc 4980atgagacaat
aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt
5040caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc
tgtttttgct 5100cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
agttgggtgc acgagtgggt 5160tacatcgaac tggatctcaa cagcggtaag
atccttgaga gttttcgccc cgaagaacgt 5220tctccaatga tgagcacttt
taaagttctg ctatgtggcg cggtattatc ccgtgttgac 5280gccgggcaag
agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac
5340tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt
atgcagtgct 5400gccataacca tgagtgataa cactgcggcc aacttacttc
tgacaacgat cggaggaccg 5460aaggagctaa ccgctttttt gcacaacatg
ggggatcatg taactcgcct tgatcgttgg 5520gaaccggagc tgaatgaagc
cataccaaac gacgagcgtg acaccacgat gcctgtagca 5580atggcaacaa
cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa
5640caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg
ctcggccctt 5700ccggctggct ggtttattgc tgataaatct ggagccggtg
agcgtgggtc tcgcggtatc 5760attgcagcac tggggccaga tggtaagccc
tcccgtatcg tagttatcta cacgacgggg 5820agtcaggcaa ctatggatga
acgaaataga cagatcgctg agataggtgc ctcactgatt 5880aagcattggt
aactgtcaga ccaagtttac tcatatatac tttagattga tttaccccgg
5940ttgataatca gaaaagcccc aaaaacagga agattgtata agcaaatatt
taaattgtaa 6000acgttaatat tttgttaaaa ttcgcgttaa atttttgtta
aatcagctca ttttttaacc 6060aataggccga aatcggcaaa atcccttata
aatcaaaaga atagaccgag atagggttga 6120gtgttgttcc agtttggaac
aagagtccac tattaaagaa cgtggactcc aacgtcaaag 6180ggcgaaaaac
cgtctatcag ggcgatggcc cactacgtga accatcaccc aaatcaagtt
6240ttttggggtc gaggtgccgt aaagcactaa atcggaaccc taaagggagc
ccccgattta 6300gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga
agggaagaaa gcgaaaggag 6360cgggcgctag ggcgctggca agtgtagcgg
tcacgctgcg cgtaaccacc acacccgccg 6420cgcttaatgc gccgctacag
ggcgcgtaaa aggatctagg tgaagatcct ttttgataat 6480ctcatgacca
aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa
6540aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg
cttgcaaaca 6600aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc
aagagctacc aactcttttt 6660ccgaaggtaa ctggcttcag cagagcgcag
ataccaaata ctgtccttct agtgtagccg 6720tagttaggcc accacttcaa
gaactctgta gcaccgccta catacctcgc tctgctaatc 6780ctgttaccag
tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga
6840cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg
cacacagccc 6900agcttggagc gaacgaccta caccgaactg agatacctac
agcgtgagct atgagaaagc 6960gccacgcttc ccgaagggag aaaggcggac
aggtatccgg taagcggcag ggtcggaaca 7020ggagagcgca cgagggagct
tccaggggga aacgcctggt atctttatag tcctgtcggg 7080tttcgccacc
tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta
7140tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg
gccttttgct 7200cacatgttct ttcctgcgtt atcccctgat tctgtggata
accgtattac cgcctttgag 7260tgagctgata ccgctcgccg cagccgaacg
accgagcgca gcgagtcagt gagcgaggaa 7320gcggaagagc gcctgatgcg
gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 7380atatatggtg
cactctcagt acaatctgct ctgatgccgc atagttaagc cagtatacac
7440tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa
cacccgctga 7500cgcgccctga cgggcttgtc tgctcccggc atccgcttac
agacaagctg tgaccgtctc 7560cgggagctgc atgtgtcaga ggttttcacc
gtcatcaccg aaacgcgcga ggcagctgcg 7620gtaaagctca tcagcgtggt
cgtgcagcga ttcacagatg tctgcctgtt catccgcgtc 7680cagctcgttg
agtttctcca gaagcgttaa tgtctggctt ctgataaagc gggccatgtt
7740aagggcggtt ttttcctgtt tggtcactga tgcctccgtg taagggggat
ttctgttcat 7800gggggtaatg ataccgatga aacgagagag gatgctcacg
atacgggtta ctgatgatga 7860acatgcccgg ttactggaac gttgtgaggg
taaacaactg gcggtatgga tgcggcggga 7920ccagagaaaa atcactcagg
gtcaatgcca gcgcttcgtt aatacagatg taggtgttcc 7980acagggtagc
cagcagcatc ctgcgatgca gatccggaac ataatggtgc agggcgctga
8040cttccgcgtt tccagacttt acgaaacacg gaaaccgaag accattcatg
ttgttgctca 8100ggtcgcagac gttttgcagc agcagtcgct tcacgttcgc
tcgcgtatcg gtgattcatt 8160ctgctaacca gtaaggcaac cccgccagcc
tagccgggtc ctcaacgaca ggagcacgat 8220catgcgcacc cgtggccagg
acccaacgct gcccgaaatt 8260158260DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 15ccgacaccat
cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga 60gtcaattcag
ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg
120gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt
tctgcgaaaa 180cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta
cattcccaac cgcgtggcac 240aacaactggc gggcaaacag tcgttgctga
ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc gcaaattgtc
gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc
gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc
420ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac
caggatgcca 480ttgctgtgga agctgcctgc actaatgttc cggcgttatt
tcttgatgtc tctgaccaga 540cacccatcaa cagtattatt ttctcccatg
aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt gggtcaccag
caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg
tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag
720cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg
caaatgctga 780atgagggcat cgttcccact gcgatgctgg ttgccaacga
tcagatggcg ctgggcgcaa 840tgcgcgccat taccgagtcc gggctgcgcg
ttggtgcgga tatctcggta gtgggatacg 900acgataccga agacagctca
tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg
gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga
1020agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg
gcgcccaata 1080cgcaaaccgc ctctccccgc gcgttggccg attcattaat
gcagctggca cgacaggttt 1140cccgactgga aagcgggcag tgagcgcaac
gcaattaatg taagttagct cactcattag 1200gcacaattct catgtttgac
agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc
atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg
1320tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat
cataacggtt 1380ctggcaaata ttctgaaatg agctgttgac aattaatcat
cggctcgtat aatgtgtgga 1440attgtgagcg gataacaatt tcacacagga
aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc aacaaggacc
atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560attaacggcg
ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat
1620accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt
cccacaggtt 1680gcggcaactg gcgatggccc tgacattatc ttctgggcac
acgaccgctt tggtggctac 1740gctcaatctg gcctgttggc tgaaatcacc
ccggacaaag cgttccagga caagctgtat 1800ccgtttacct gggatgccgt
acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860gaagcgttat
cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa
1920gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct
gatgttcaac 1980ctgcaagaac cgtacttcac ctggccgctg attgctgctg
acgggggtta tgcgttcaag 2040tatgaaaacg gcaagtacga cattaaagac
gtgggcgtgg ataacgctgg cgcgaaagcg 2100ggtctgacct tcctggttga
cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160tccatcgcag
aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg
2220gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact
gccgaccttc 2280aagggtcaac catccaaacc gttcgttggc gtgctgagcg
caggtattaa cgccgccagt 2340ccgaacaaag agctggcaaa agagttcctc
gaaaactatc tgctgactga tgaaggtctg 2400gaagcggtta ataaagacaa
accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460ttggcgaaag
atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg
2520ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt
gatcaacgcc 2580gccagcggtc gtcagactgt cgatgccgcc ctggccgccg
cgcagactgc cgccgccgcc 2640gccatggaga caaggcaaat ggcagtggaa
caaaccactg gtgcggtcac caaccaaacg 2700gaaacaagct ggcacagcat
agactgggcc aaagccaacc gtgaggtaaa gaggctgcaa 2760gtgcgtatcg
caaaggctgt gaaggaagga cgctggggca aagtgaaagc tttgcaatgg
2820ctcctgaccc actcgttcta cggcaaagcc ctcgccgtga aacgggtaac
tgacaactcg 2880ggcagcaaaa cacctggtgt ggacgggata acctggtcca
cacaagagca gaaagcccaa 2940gccataaagt ccctcaggag aagaggctac
aaaccccaac ccctgaggcg ggtatacatc 3000ccgaaagcaa gcggcaagca
gcgcccgcta ggaatcccga caacgaagga cagggcaatg 3060caggcattat
atgccctagc tctagaacct gtcgcggaaa ccacagcgga tcggaactca
3120tacgggttcc gtcaaggacg gtgcacggca gatgctgccg ggcagtgctt
cactgtgcta 3180ggccgatctg actgtgcaaa atatatcctt gatgctgaca
tcaccggatg ctttgacaac 3240attagccacg aatggctact agacaacatc
ccgctggaca aagaggttct gcggaagtgg 3300cttaaatctg ggttcgtctg
gaaacagcaa ctcttcccaa cccatgctgg gacacctcag 3360ggaggggtaa
tctccccaat gctggccaat atgaccctag atgggatgga agaattgctg
3420aagaaacacc tcagaaaaca aaaagtcaac ctcatacgat atgcagacga
ctttgtcgta 3480actggtgaat caaaggaaac cttggaaaag gttacaactg
taatccaaga attcctcaag 3540gaaaggggcc ttaccctatc agaagaaaag
acaaaggtcg ttcatatcga agaaggattt 3600gactttcttg gatggaacat
tcgcaaatat ggtgagaagc ttctcatcaa acctgcgaag 3660aagaacatca
aggcgttcca caagaaaatc cgagacgcac tgaaggaact cagaacagcc
3720acccaggaag ctgtgataga cacactcaac ccaattatca aaggctgggc
taactatcac 3780agaaaccagg tttccaaaag aatcttcaac agagcggatg
acaatatctg gcataaatta 3840tggcgatggg caaaacgtcg gcacccaaac
aaaccagccc gatggacaaa gaacaaatac 3900ttcatcaaaa tcgggaatag
gcactgggtg tttggcacat ggaaaaagga caaagaggga 3960aggttacggt
ccagatacct aattaaagcc ggagatactc gaatccaacg tcatgtcaaa
4020atcaaggcag acgccaatcc gtttctccca gagtgggcag aatactttga
ggaacgcaag 4080aaactcaaag aagcccctgc tcaatatcgg cgcatccgcc
gagaactatg gaagaaacag 4140ggtggtatct gtccagtatg cgggggtgaa
attgagcaag acatgctcac tgaaatccac 4200cacatattgc ccaaacacaa
gggtggttct gacgacctgg ataatcttgt cttaatccac 4260gccaactgtc
acaaacaggt gcacagccga gacggtcagc acagccggtt cctcttgaaa
4320gaggggcttt gactgcaggc aagcttggca ctggccgtcg ttttacaacg
tcgtgactgg 4380gaaaaccctg gcgttaccca acttaatcgc cttgcagcac
atcccccttt cgccagctgg 4440cgtaatagcg aagaggcccg caccgatcgc
ccttcccaac agttgcgcag cctgaatggc 4500gaatggcagc ttggctgttt
tggcggatga gataagattt tcagcctgat acagattaaa 4560tcagaacgca
gaagcggtct gataaaacag aatttgcctg gcggcagtag cgcggtggtc
4620ccacctgacc ccatgccgaa ctcagaagtg aaacgccgta gcgccgatgg
tagtgtgggg 4680tctccccatg cgagagtagg gaactgccag gcatcaaata
aaacgaaagg ctcagtcgaa 4740agactgggcc tttcgtttta tctgttgttt
gtcggtgaac gctctcctga gtaggacaaa 4800tccgccggga gcggatttga
acgttgcgaa gcaacggccc ggagggtggc gggcaggacg 4860cccgccataa
actgccaggc atcaaattaa gcagaaggcc atcctgacgg atggcctttt
4920tgcgtttcta caaactcttt ttgtttattt ttctaaatac attcaaatat
gtatccgctc 4980atgagacaat aaccctgata aatgcttcaa taatattgaa
aaaggaagag tatgagtatt 5040caacatttcc gtgtcgccct tattcccttt
tttgcggcat tttgccttcc tgtttttgct 5100cacccagaaa cgctggtgaa
agtaaaagat gctgaagatc agttgggtgc acgagtgggt 5160tacatcgaac
tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt
5220tctccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc
ccgtgttgac 5280gccgggcaag agcaactcgg tcgccgcata cactattctc
agaatgactt ggttgagtac 5340tcaccagtca cagaaaagca tcttacggat
ggcatgacag taagagaatt atgcagtgct 5400gccataacca tgagtgataa
cactgcggcc aacttacttc tgacaacgat cggaggaccg 5460aaggagctaa
ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg
5520gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat
gcctgtagca 5580atggcaacaa cgttgcgcaa actattaact ggcgaactac
ttactctagc ttcccggcaa 5640caattaatag actggatgga ggcggataaa
gttgcaggac cacttctgcg ctcggccctt 5700ccggctggct ggtttattgc
tgataaatct ggagccggtg agcgtgggtc tcgcggtatc 5760attgcagcac
tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg
5820agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc
ctcactgatt 5880aagcattggt aactgtcaga ccaagtttac tcatatatac
tttagattga tttaccccgg 5940ttgataatca gaaaagcccc aaaaacagga
agattgtata agcaaatatt taaattgtaa 6000acgttaatat tttgttaaaa
ttcgcgttaa atttttgtta aatcagctca ttttttaacc 6060aataggccga
aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga
6120gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc
aacgtcaaag 6180ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga
accatcaccc aaatcaagtt 6240ttttggggtc gaggtgccgt aaagcactaa
atcggaaccc taaagggagc ccccgattta 6300gagcttgacg gggaaagccg
gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag 6360cgggcgctag
ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg
6420cgcttaatgc gccgctacag ggcgcgtaaa aggatctagg tgaagatcct
ttttgataat 6480ctcatgacca aaatccctta acgtgagttt tcgttccact
gagcgtcaga ccccgtagaa 6540aagatcaaag gatcttcttg agatcctttt
tttctgcgcg taatctgctg cttgcaaaca 6600aaaaaaccac cgctaccagc
ggtggtttgt ttgccggatc aagagctacc aactcttttt 6660ccgaaggtaa
ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg
6720tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc
tctgctaatc 6780ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc
ttaccgggtt ggactcaaga 6840cgatagttac cggataaggc gcagcggtcg
ggctgaacgg ggggttcgtg cacacagccc 6900agcttggagc gaacgaccta
caccgaactg agatacctac agcgtgagct atgagaaagc 6960gccacgcttc
ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca
7020ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag
tcctgtcggg 7080tttcgccacc tctgacttga gcgtcgattt ttgtgatgct
cgtcaggggg gcggagccta 7140tggaaaaacg ccagcaacgc ggccttttta
cggttcctgg ccttttgctg gccttttgct 7200cacatgttct ttcctgcgtt
atcccctgat tctgtggata accgtattac cgcctttgag 7260tgagctgata
ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa
7320gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat
ttcacaccgc
7380atatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc
cagtatacac 7440tccgctatcg ctacgtgact gggtcatggc tgcgccccga
cacccgccaa cacccgctga 7500cgcgccctga cgggcttgtc tgctcccggc
atccgcttac agacaagctg tgaccgtctc 7560cgggagctgc atgtgtcaga
ggttttcacc gtcatcaccg aaacgcgcga ggcagctgcg 7620gtaaagctca
tcagcgtggt cgtgcagcga ttcacagatg tctgcctgtt catccgcgtc
7680cagctcgttg agtttctcca gaagcgttaa tgtctggctt ctgataaagc
gggccatgtt 7740aagggcggtt ttttcctgtt tggtcactga tgcctccgtg
taagggggat ttctgttcat 7800gggggtaatg ataccgatga aacgagagag
gatgctcacg atacgggtta ctgatgatga 7860acatgcccgg ttactggaac
gttgtgaggg taaacaactg gcggtatgga tgcggcggga 7920ccagagaaaa
atcactcagg gtcaatgcca gcgcttcgtt aatacagatg taggtgttcc
7980acagggtagc cagcagcatc ctgcgatgca gatccggaac ataatggtgc
agggcgctga 8040cttccgcgtt tccagacttt acgaaacacg gaaaccgaag
accattcatg ttgttgctca 8100ggtcgcagac gttttgcagc agcagtcgct
tcacgttcgc tcgcgtatcg gtgattcatt 8160ctgctaacca gtaaggcaac
cccgccagcc tagccgggtc ctcaacgaca ggagcacgat 8220catgcgcacc
cgtggccagg acccaacgct gcccgaaatt 8260168490DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
16ccgacaccat cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga
60gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg
120gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt
tctgcgaaaa 180cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta
cattcccaac cgcgtggcac 240aacaactggc gggcaaacag tcgttgctga
ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc gcaaattgtc
gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc
gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc
420ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac
caggatgcca 480ttgctgtgga agctgcctgc actaatgttc cggcgttatt
tcttgatgtc tctgaccaga 540cacccatcaa cagtattatt ttctcccatg
aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt gggtcaccag
caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg
tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag
720cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg
caaatgctga 780atgagggcat cgttcccact gcgatgctgg ttgccaacga
tcagatggcg ctgggcgcaa 840tgcgcgccat taccgagtcc gggctgcgcg
ttggtgcgga tatctcggta gtgggatacg 900acgataccga agacagctca
tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg
gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga
1020agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg
gcgcccaata 1080cgcaaaccgc ctctccccgc gcgttggccg attcattaat
gcagctggca cgacaggttt 1140cccgactgga aagcgggcag tgagcgcaac
gcaattaatg taagttagct cactcattag 1200gcacaattct catgtttgac
agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc
atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg
1320tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat
cataacggtt 1380ctggcaaata ttctgaaatg agctgttgac aattaatcat
cggctcgtat aatgtgtgga 1440attgtgagcg gataacaatt tcacacagga
aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc aacaaggacc
atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560attaacggcg
ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat
1620accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt
cccacaggtt 1680gcggcaactg gcgatggccc tgacattatc ttctgggcac
acgaccgctt tggtggctac 1740gctcaatctg gcctgttggc tgaaatcacc
ccggacaaag cgttccagga caagctgtat 1800ccgtttacct gggatgccgt
acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860gaagcgttat
cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa
1920gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct
gatgttcaac 1980ctgcaagaac cgtacttcac ctggccgctg attgctgctg
acgggggtta tgcgttcaag 2040tatgaaaacg gcaagtacga cattaaagac
gtgggcgtgg ataacgctgg cgcgaaagcg 2100ggtctgacct tcctggttga
cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160tccatcgcag
aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg
2220gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact
gccgaccttc 2280aagggtcaac catccaaacc gttcgttggc gtgctgagcg
caggtattaa cgccgccagt 2340ccgaacaaag agctggcaaa agagttcctc
gaaaactatc tgctgactga tgaaggtctg 2400gaagcggtta ataaagacaa
accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460ttggcgaaag
atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg
2520ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt
gatcaacgcc 2580gccagcggtc gtcagactgt cgatgccgcc ctggccgccg
cgcagactgc cgccgccgcc 2640gccatgaagg taaacaaact tgtcgtaaaa
agcgaacagg acttgagaaa ctgcttggat 2700cttctttatc aagaagctaa
aaagggaaaa catttttacg gcatgcttga gttgcttcaa 2760aatgatgttg
tcattttaga agctattcgc aatattaaaa gcaataaagg tagcaaaacg
2820gcggggattg atcagaaaat agtagatgat tatttgctta tgccaacgga
aaaggttttc 2880gggatgataa aagccaaact caatgactat aagcctatac
cagtgagaag gtgcaacaag 2940cccaaaggaa atgccaaaag ctcaaaaaga
aaaggcaata gtccgaatga ggaaggggaa 3000acgaggccct taggaatatc
cgcagtgacg gatagaatca tccaagagat gctacggata 3060gtgctcgagc
cgattttcga agcccaattc tatccgcaca gttatgggtt cagaccgtat
3120cgctccaccg aacatgcctt agcctggatg ctgaaaatca tcaacggaag
caaactgtat 3180tgggttgtaa aaggtgacat tgaaagttat tttgatcaca
tcaatcataa gaagcttctg 3240aacatcatgt ggaatatggg cgttagggat
aaacgggtac tatgcatcgt taagaaaatg 3300ctgaaggcgg ggcaagtgat
acaaggtaaa ttctatccaa ccgctaaggg gattcctcag 3360ggaggaatta
ttagcccgtt gttggctaat gtatatctca acagctttga ctggatggtt
3420ggccaagaat atgagtatca ccctaataac gcaaactatc gggaaaagaa
aaacgcatta 3480gcggcgttaa ggaacaaggg acatcatccc gtcttttaca
ttcgttatgc tgatgattgg 3540gttattctta cggatacgaa agaatatgcg
gaaaaaataa gggagcaatg taagcagtat 3600ttagcctgtg agttgcactt
aactctatcg gatgagaaaa cgttcattgc agatatccgc 3660gaacaacggg
ttaagtttct aggcttttgt attgaggcag gaaagcggcg ttttcataaa
3720aaaggattcg ccgctagaat gattcccgat atggaaaaag tcaatgccaa
ggtcaaagaa 3780attaagcgcg atattcgatt gttaagaacg agaaaatcgg
aattagagaa agcccttgat 3840attgaaaaca ttaacaccaa aattatagga
ttagccaatc atctaaaaat aggcatttcc 3900aagtacatta tgggcaaagt
agatcgcgtc attgaagaga cagcctaccg cacctgggtt 3960aaaatgtatg
ggaaagaaaa agcggcgcaa tataaaaggc ctgtgtcaga gtttcacaat
4020cggattgaca gacataaagg ctatcaaatg aaacattttt ctgtcgtcac
agaggatggc 4080ataagagtag ggattaccca tgcaaaaata acgcctatac
agtatgcaac agtattcaaa 4140caagaaatga ccccatacac tgcagacggc
agaaaaatgt atgaagaaaa gcatagaaaa 4200atacgattgc cggataaaat
gagtctgttc gatcacgatt cgatattcat ctacatttta 4260tctgagcata
atgatgggaa atataatctt gaatatttct taaatagggt gaatgtattt
4320cacagagata aaggaaaatg caaaatatgt gccgtatact taagtcccgg
taacttccac 4380tgccatcata ttgacccgag taaaccttta agtgagatca
ataagaccgt taatctaatt 4440agcttatgca accaatgcca taggcttgtc
catagcaacc aagaaccgcc gtttacagaa 4500cgaaaaatgt ttgacaaact
aacgaaatat aggaacaagc tgaaaatata aggatcctct 4560agctgcaggc
aagcttggca ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg
4620gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg
cgtaatagcg 4680aagaggcccg caccgatcgc ccttcccaac agttgcgcag
cctgaatggc gaatggcagc 4740ttggctgttt tggcggatga gataagattt
tcagcctgat acagattaaa tcagaacgca 4800gaagcggtct gataaaacag
aatttgcctg gcggcagtag cgcggtggtc ccacctgacc 4860ccatgccgaa
ctcagaagtg aaacgccgta gcgccgatgg tagtgtgggg tctccccatg
4920cgagagtagg gaactgccag gcatcaaata aaacgaaagg ctcagtcgaa
agactgggcc 4980tttcgtttta tctgttgttt gtcggtgaac gctctcctga
gtaggacaaa tccgccggga 5040gcggatttga acgttgcgaa gcaacggccc
ggagggtggc gggcaggacg cccgccataa 5100actgccaggc atcaaattaa
gcagaaggcc atcctgacgg atggcctttt tgcgtttcta 5160caaactcttt
ttgtttattt ttctaaatac attcaaatat gtatccgctc atgagacaat
5220aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt
caacatttcc 5280gtgtcgccct tattcccttt tttgcggcat tttgccttcc
tgtttttgct cacccagaaa 5340cgctggtgaa agtaaaagat gctgaagatc
agttgggtgc acgagtgggt tacatcgaac 5400tggatctcaa cagcggtaag
atccttgaga gttttcgccc cgaagaacgt tctccaatga 5460tgagcacttt
taaagttctg ctatgtggcg cggtattatc ccgtgttgac gccgggcaag
5520agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac
tcaccagtca 5580cagaaaagca tcttacggat ggcatgacag taagagaatt
atgcagtgct gccataacca 5640tgagtgataa cactgcggcc aacttacttc
tgacaacgat cggaggaccg aaggagctaa 5700ccgctttttt gcacaacatg
ggggatcatg taactcgcct tgatcgttgg gaaccggagc 5760tgaatgaagc
cataccaaac gacgagcgtg acaccacgat gcctgtagca atggcaacaa
5820cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa
caattaatag 5880actggatgga ggcggataaa gttgcaggac cacttctgcg
ctcggccctt ccggctggct 5940ggtttattgc tgataaatct ggagccggtg
agcgtgggtc tcgcggtatc attgcagcac 6000tggggccaga tggtaagccc
tcccgtatcg tagttatcta cacgacgggg agtcaggcaa 6060ctatggatga
acgaaataga cagatcgctg agataggtgc ctcactgatt aagcattggt
6120aactgtcaga ccaagtttac tcatatatac tttagattga tttaccccgg
ttgataatca 6180gaaaagcccc aaaaacagga agattgtata agcaaatatt
taaattgtaa acgttaatat 6240tttgttaaaa ttcgcgttaa atttttgtta
aatcagctca ttttttaacc aataggccga 6300aatcggcaaa atcccttata
aatcaaaaga atagaccgag atagggttga gtgttgttcc 6360agtttggaac
aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac
6420cgtctatcag ggcgatggcc cactacgtga accatcaccc aaatcaagtt
ttttggggtc 6480gaggtgccgt aaagcactaa atcggaaccc taaagggagc
ccccgattta gagcttgacg 6540gggaaagccg gcgaacgtgg cgagaaagga
agggaagaaa gcgaaaggag cgggcgctag 6600ggcgctggca agtgtagcgg
tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc 6660gccgctacag
ggcgcgtaaa aggatctagg tgaagatcct ttttgataat ctcatgacca
6720aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa
aagatcaaag 6780gatcttcttg agatcctttt tttctgcgcg taatctgctg
cttgcaaaca aaaaaaccac 6840cgctaccagc ggtggtttgt ttgccggatc
aagagctacc aactcttttt ccgaaggtaa 6900ctggcttcag cagagcgcag
ataccaaata ctgtccttct agtgtagccg tagttaggcc 6960accacttcaa
gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag
7020tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga
cgatagttac 7080cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg
cacacagccc agcttggagc 7140gaacgaccta caccgaactg agatacctac
agcgtgagct atgagaaagc gccacgcttc 7200ccgaagggag aaaggcggac
aggtatccgg taagcggcag ggtcggaaca ggagagcgca 7260cgagggagct
tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc
7320tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta
tggaaaaacg 7380ccagcaacgc ggccttttta cggttcctgg ccttttgctg
gccttttgct cacatgttct 7440ttcctgcgtt atcccctgat tctgtggata
accgtattac cgcctttgag tgagctgata 7500ccgctcgccg cagccgaacg
accgagcgca gcgagtcagt gagcgaggaa gcggaagagc 7560gcctgatgcg
gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atatatggtg
7620cactctcagt acaatctgct ctgatgccgc atagttaagc cagtatacac
tccgctatcg 7680ctacgtgact gggtcatggc tgcgccccga cacccgccaa
cacccgctga cgcgccctga 7740cgggcttgtc tgctcccggc atccgcttac
agacaagctg tgaccgtctc cgggagctgc 7800atgtgtcaga ggttttcacc
gtcatcaccg aaacgcgcga ggcagctgcg gtaaagctca 7860tcagcgtggt
cgtgcagcga ttcacagatg tctgcctgtt catccgcgtc cagctcgttg
7920agtttctcca gaagcgttaa tgtctggctt ctgataaagc gggccatgtt
aagggcggtt 7980ttttcctgtt tggtcactga tgcctccgtg taagggggat
ttctgttcat gggggtaatg 8040ataccgatga aacgagagag gatgctcacg
atacgggtta ctgatgatga acatgcccgg 8100ttactggaac gttgtgaggg
taaacaactg gcggtatgga tgcggcggga ccagagaaaa 8160atcactcagg
gtcaatgcca gcgcttcgtt aatacagatg taggtgttcc acagggtagc
8220cagcagcatc ctgcgatgca gatccggaac ataatggtgc agggcgctga
cttccgcgtt 8280tccagacttt acgaaacacg gaaaccgaag accattcatg
ttgttgctca ggtcgcagac 8340gttttgcagc agcagtcgct tcacgttcgc
tcgcgtatcg gtgattcatt ctgctaacca 8400gtaaggcaac cccgccagcc
tagccgggtc ctcaacgaca ggagcacgat catgcgcacc 8460cgtggccagg
acccaacgct gcccgaaatt 8490177834DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 17ccgacaccat
cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga 60gtcaattcag
ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg
120gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt
tctgcgaaaa 180cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta
cattcccaac cgcgtggcac 240aacaactggc gggcaaacag tcgttgctga
ttggcgttgc cacctccagt ctggccctgc 300acgcgccgtc gcaaattgtc
gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360tggtggtgtc
gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc
420ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac
caggatgcca 480ttgctgtgga agctgcctgc actaatgttc cggcgttatt
tcttgatgtc tctgaccaga 540cacccatcaa cagtattatt ttctcccatg
aagacggtac gcgactgggc gtggagcatc 600tggtcgcatt gggtcaccag
caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660cgcgtctgcg
tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag
720cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg
caaatgctga 780atgagggcat cgttcccact gcgatgctgg ttgccaacga
tcagatggcg ctgggcgcaa 840tgcgcgccat taccgagtcc gggctgcgcg
ttggtgcgga tatctcggta gtgggatacg 900acgataccga agacagctca
tgttatatcc cgccgttaac caccatcaaa caggattttc 960gcctgctggg
gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga
1020agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg
gcgcccaata 1080cgcaaaccgc ctctccccgc gcgttggccg attcattaat
gcagctggca cgacaggttt 1140cccgactgga aagcgggcag tgagcgcaac
gcaattaatg taagttagct cactcattag 1200gcacaattct catgtttgac
agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260tcaggcagcc
atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg
1320tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat
cataacggtt 1380ctggcaaata ttctgaaatg agctgttgac aattaatcat
cggctcgtat aatgtgtgga 1440attgtgagcg gataacaatt tcacacagga
aacagccagt ccgtttaggt gttttcacga 1500gcacttcacc aacaaggacc
atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560attaacggcg
ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat
1620accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt
cccacaggtt 1680gcggcaactg gcgatggccc tgacattatc ttctgggcac
acgaccgctt tggtggctac 1740gctcaatctg gcctgttggc tgaaatcacc
ccggacaaag cgttccagga caagctgtat 1800ccgtttacct gggatgccgt
acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860gaagcgttat
cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa
1920gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct
gatgttcaac 1980ctgcaagaac cgtacttcac ctggccgctg attgctgctg
acgggggtta tgcgttcaag 2040tatgaaaacg gcaagtacga cattaaagac
gtgggcgtgg ataacgctgg cgcgaaagcg 2100ggtctgacct tcctggttga
cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160tccatcgcag
aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg
2220gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact
gccgaccttc 2280aagggtcaac catccaaacc gttcgttggc gtgctgagcg
caggtattaa cgccgccagt 2340ccgaacaaag agctggcaaa agagttcctc
gaaaactatc tgctgactga tgaaggtctg 2400gaagcggtta ataaagacaa
accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460ttggcgaaag
atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg
2520ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt
gatcaacgcc 2580gccagcggtc gtcagactgt cgatgccgcc ctggccgccg
cgcagactgc cgccgccgcc 2640gccatggctt tgttggaacg catcttagcg
agagacaacc tcatcacggc gctcaaacgg 2700gtcgaagcca accaaggagc
accgggaatc gacggagtat caaccgatca actccgtgat 2760tacatccgcg
ctcactggag cacgatccac gcccaactct tggcgggaac ctaccggccg
2820gcgcctgtcc gcagggtcga aatcccgaaa ccgggcggcg gcacacggca
gctaggcatt 2880cccaccgtgg tggaccggct gatccaacaa gccattcttc
aagaactcac acccattttc 2940gatccagact tctcctcttc cagcttcgga
ttccgtccgg gccgcaacgc ccacgatgcc 3000gtgcggcaag cgcaaggcta
catccaggaa gggtatcggt acgtggtcga catggacctg 3060gaaaagttct
ttgatcgggt caaccatgac atcttgatga gtcgggtggc ccgaaaagtc
3120aaggataaac gcgtgctgaa actgatccgt gcctacctgc aagccggcgt
tatgatcgaa 3180ggggtgaagg tgcagacgga ggaagggacg ccgcaaggcg
gccccctcag ccccctgctg 3240gcgaacatcc ttctcgacga tttagacaag
gaattggaga agcgaggatt gaaattctgc 3300cgttacgcag atgactgcaa
catctatgtg aaaagtctgc gggcaggaca acgggtgaaa 3360caaagcatcc
aacggttctt ggagaaaacg ctcaaactca aagtaaacga ggagaaaagt
3420gcggtggacc gcccgtggaa acgggccttt ctggggttta gcttcacacc
ggaacgaaaa 3480gcgcgaatcc ggctcgcccc aaggtcgatt caacgtctga
aacagcggat tcgacagctg 3540accaacccaa actggagcat atcgatgcca
gaacgaattc atcgcgtcaa tcaatacgtc 3600atgggatgga tcgggtattt
tcggctcgtc gaaaccccgt ctgtccttca gaccatcgaa 3660ggatggattc
ggaggaggct tcgactctgt caatggcttc aatggaaacg ggtcagaacc
3720agaatccgtg agttaagagc gctggggctg aaagagacag cggtgatgga
gatcgccaat 3780acccgaaaag gagcttggcg aacaacgaaa acgccgcaac
tccaccaggc cctgggcaag 3840acctactgga ccgctcaagg gctcaagagt
ttgacgcaac gatatttcga actccgtcaa 3900ggttgactgc aggcaagctt
ggcactggcc gtcgttttac aacgtcgtga ctgggaaaac 3960cctggcgtta
cccaacttaa tcgccttgca gcacatcccc ctttcgccag ctggcgtaat
4020agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa
tggcgaatgg 4080cagcttggct gttttggcgg atgagataag attttcagcc
tgatacagat taaatcagaa 4140cgcagaagcg gtctgataaa acagaatttg
cctggcggca gtagcgcggt ggtcccacct 4200gaccccatgc cgaactcaga
agtgaaacgc cgtagcgccg atggtagtgt ggggtctccc 4260catgcgagag
tagggaactg ccaggcatca aataaaacga aaggctcagt cgaaagactg
4320ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc ctgagtagga
caaatccgcc 4380gggagcggat ttgaacgttg cgaagcaacg gcccggaggg
tggcgggcag gacgcccgcc 4440ataaactgcc aggcatcaaa ttaagcagaa
ggccatcctg acggatggcc tttttgcgtt 4500tctacaaact ctttttgttt
atttttctaa atacattcaa atatgtatcc gctcatgaga 4560caataaccct
gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat
4620ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt
tgctcaccca 4680gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg
gtgcacgagt gggttacatc 4740gaactggatc tcaacagcgg taagatcctt
gagagttttc gccccgaaga acgttctcca 4800atgatgagca cttttaaagt
tctgctatgt ggcgcggtat tatcccgtgt tgacgccggg 4860caagagcaac
tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca
4920gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag
tgctgccata 4980accatgagtg ataacactgc ggccaactta cttctgacaa
cgatcggagg accgaaggag 5040ctaaccgctt ttttgcacaa catgggggat
catgtaactc gccttgatcg ttgggaaccg 5100gagctgaatg aagccatacc
aaacgacgag cgtgacacca cgatgcctgt agcaatggca 5160acaacgttgc
gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta
5220atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc
ccttccggct 5280ggctggttta ttgctgataa atctggagcc ggtgagcgtg
ggtctcgcgg tatcattgca 5340gcactggggc cagatggtaa gccctcccgt
atcgtagtta tctacacgac ggggagtcag 5400gcaactatgg atgaacgaaa
tagacagatc gctgagatag gtgcctcact gattaagcat
5460tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttacc
ccggttgata 5520atcagaaaag ccccaaaaac aggaagattg tataagcaaa
tatttaaatt gtaaacgtta 5580atattttgtt aaaattcgcg ttaaattttt
gttaaatcag ctcatttttt aaccaatagg 5640ccgaaatcgg caaaatccct
tataaatcaa aagaatagac cgagataggg ttgagtgttg 5700ttccagtttg
gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa
5760aaaccgtcta tcagggcgat ggcccactac gtgaaccatc acccaaatca
agttttttgg 5820ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg
gagcccccga tttagagctt 5880gacggggaaa gccggcgaac gtggcgagaa
aggaagggaa gaaagcgaaa ggagcgggcg 5940ctagggcgct ggcaagtgta
gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta 6000atgcgccgct
acagggcgcg taaaaggatc taggtgaaga tcctttttga taatctcatg
6060accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt
agaaaagatc 6120aaaggatctt cttgagatcc tttttttctg cgcgtaatct
gctgcttgca aacaaaaaaa 6180ccaccgctac cagcggtggt ttgtttgccg
gatcaagagc taccaactct ttttccgaag 6240gtaactggct tcagcagagc
gcagatacca aatactgtcc ttctagtgta gccgtagtta 6300ggccaccact
tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta
6360ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc
aagacgatag 6420ttaccggata aggcgcagcg gtcgggctga acggggggtt
cgtgcacaca gcccagcttg 6480gagcgaacga cctacaccga actgagatac
ctacagcgtg agctatgaga aagcgccacg 6540cttcccgaag ggagaaaggc
ggacaggtat ccggtaagcg gcagggtcgg aacaggagag 6600cgcacgaggg
agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc
6660cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag
cctatggaaa 6720aacgccagca acgcggcctt tttacggttc ctggcctttt
gctggccttt tgctcacatg 6780ttctttcctg cgttatcccc tgattctgtg
gataaccgta ttaccgcctt tgagtgagct 6840gataccgctc gccgcagccg
aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa 6900gagcgcctga
tgcggtattt tctccttacg catctgtgcg gtatttcaca ccgcatatat
6960ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagtat
acactccgct 7020atcgctacgt gactgggtca tggctgcgcc ccgacacccg
ccaacacccg ctgacgcgcc 7080ctgacgggct tgtctgctcc cggcatccgc
ttacagacaa gctgtgaccg tctccgggag 7140ctgcatgtgt cagaggtttt
caccgtcatc accgaaacgc gcgaggcagc tgcggtaaag 7200ctcatcagcg
tggtcgtgca gcgattcaca gatgtctgcc tgttcatccg cgtccagctc
7260gttgagtttc tccagaagcg ttaatgtctg gcttctgata aagcgggcca
tgttaagggc 7320ggttttttcc tgtttggtca ctgatgcctc cgtgtaaggg
ggatttctgt tcatgggggt 7380aatgataccg atgaaacgag agaggatgct
cacgatacgg gttactgatg atgaacatgc 7440ccggttactg gaacgttgtg
agggtaaaca actggcggta tggatgcggc gggaccagag 7500aaaaatcact
cagggtcaat gccagcgctt cgttaataca gatgtaggtg ttccacaggg
7560tagccagcag catcctgcga tgcagatccg gaacataatg gtgcagggcg
ctgacttccg 7620cgtttccaga ctttacgaaa cacggaaacc gaagaccatt
catgttgttg ctcaggtcgc 7680agacgttttg cagcagcagt cgcttcacgt
tcgctcgcgt atcggtgatt cattctgcta 7740accagtaagg caaccccgcc
agcctagccg ggtcctcaac gacaggagca cgatcatgcg 7800cacccgtggc
caggacccaa cgctgcccga aatt 7834185PRTArtificial SequenceDescription
of Artificial Sequence Synthetic peptide 18Ala Ala Ala Glu Phe 1 5
1935PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 19Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr
Asn Ser Ser Ser Asn 1 5 10 15 Asn Asn Asn Asn Asn Asn Asn Asn Asn
Leu Glu Asn Leu Tyr Phe Gln 20 25 30 Gly Glu Phe 35
2016PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 20Thr Val Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala
Ala Ala Ala Ala 1 5 10 15 211200DNAArtificial SequenceDescription
of Artificial Sequence Synthetic polynucleotide 21gaatacaagc
ttgggcgtgt ctcaaaatct ctgatgttac attgcacaag ataaaaatat 60atcatcatga
acaataaaac tgtctgctta cataaacagt aatacaaggg gtgttatgag
120ccatattcaa cgggaaacgt cttgctcgag gccgcgatta aattccaaca
tggatgctga 180tttatatggg tataaatggg ctcgcgataa tgtcgggcaa
tcaggtgcga caatctatcg 240attgtatggg aagcccgatg cgccagagtt
gtttctgaaa catggcaaag gtagcgttgc 300caatgatgtt acagatgaga
tggtcagact aaactggctg acggaattta tgcctcttcc 360gaccatcaag
cattttatcc gtactcctga tgatgcatgg ttactcacca ctgcgatccc
420cgggaaaaca gcattccagg tattagaaga atatcctgag tcaggtgaaa
atattgttga 480tgcgctggca gtgttcctgc gccggttgca ttcgattcct
gtttgtaatt gtccttttaa 540cagcgatcgc gtatttcgtc tcgctcaggc
gcaatcacga atgaataacg gtttggttga 600tgcgagtgat tttgatgacg
agcgtaatgg ctggcctgtt gaacaagtct ggaaagaaat 660gcataagctt
ttgccattct caccggattc agtcgtcact catggtgatt tctcacttga
720taaccttatt tttgacgagg ggaaattaat aggttgtatt gatgttggac
gagtcggaat 780cgcagaccga taccaggatc ttgccatcct atggaactgc
ctcggtgagt tttctccttc 840attacagaaa cggctttttc aaaaatatgg
tattgataat cctgatatga ataaattgca 900gtttcatttg atgctcgatg
agtttttcta atcagaattg gttaattggt tgtaacactg 960gcagagcatt
acgctgactt gacgggacgg cggctttgtt gaataaatcg aacttttgct
1020gagttgaagg atcagatcac gcatcttccc gacaacgcag accgttccgt
ggcaaagcaa 1080aagttcaaaa tcaccaactg gtccacctac aacaaagctc
tcatcaaccg tggcgactct 1140agaggatccc cgggcgagct cccaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaccgaatt 12002221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22acaaataggg gttccgcgca c 212318DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 23gttggtgacc gcaccagt
182417DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 24aacgcggtaa gcccgta 172518DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25aatggacgat atcccgca 182620PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 26Asn Ile Cys Trp Phe Gly Asp
Glu Ala Thr Ser Gly Ser Gly His His 1 5 10 15 His His His His 20
2711PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 27Asn Ile Cys Trp Phe Gly Ala Ala Ala Ala Ala 1 5
10 2837DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 28ccgcctttga gtgagctgat accgctcgcc gcagccg
372944DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 29ggtggaccag ttggtgattt tgaacttttg ctttgccacg gaac
443019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 30gggtataaat gggctcgcg 193119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31cgggcttccc atacaatcg 193223DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 32tcgggcaatc aggtgcgaca atc
233370DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 33gggtataaat gggctcgcga taatgtcggg
caatcaggtg cgacaatcta tcgattgtat 60gggaagcccg 703417DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
34cgctcaggcg caatcac 173520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 35ccagccatta cgctcgtcat
203629DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 36atgaataacg gtttggttga tgcgagtga
293773DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 37cgctcaggcg caatcacgaa tgaataacgg
tttggttgat gcgagtgatt ttgatgacga 60gcgtaatggc tgg
7338492PRTArtificial SequenceDescription of Artificial Sequence
Synthetic polypeptide 38Met Asn Lys Glu Ile Leu Ala Val Val Glu Ala
Val Ser Asn Glu Lys 1 5 10 15 Ala Leu Pro Arg Glu Lys Ile Phe Glu
Ala Leu Glu Ser Ala Leu Ala 20 25 30 Thr Ala Thr Lys Lys Lys Tyr
Glu Gln Glu Ile Asp Val Arg Val Gln 35 40 45 Ile Asp Arg Lys Ser
Gly Asp Phe Asp Thr Phe Arg Arg Trp Leu Val 50 55 60 Val Asp Glu
Val Thr Gln Pro Thr Lys Glu Ile Thr Leu Glu Ala Ala 65 70 75 80 Arg
Tyr Glu Asp Glu Ser Leu Asn Leu Gly Asp Tyr Val Glu Asp Gln 85 90
95 Ile Glu Ser Val Thr Phe Asp Arg Ile Thr Thr Gln Thr Ala Lys Gln
100 105 110 Val Ile Val Gln Lys Val Arg Glu Ala Glu Arg Ala Met Val
Val Asp 115 120 125 Gln Phe Arg Glu His Glu Gly Glu Ile Ile Thr Gly
Val Val Lys Lys 130 135 140 Val Asn Arg Asp Asn Ile Ser Leu Asp Leu
Gly Asn Asn Ala Glu Ala 145 150 155 160 Val Ile Leu Arg Glu Asp Met
Leu Pro Arg Glu Asn Phe Arg Pro Gly 165 170 175 Asp Arg Val Arg Gly
Val Leu Tyr Ser Val Arg Pro Glu Ala Arg Gly 180 185 190 Ala Gln Leu
Phe Val Thr Arg Ser Lys Pro Glu Met Leu Ile Glu Leu 195 200 205 Phe
Arg Ile Glu Val Pro Glu Ile Gly Glu Glu Val Ile Glu Ile Lys 210 215
220 Ala Ala Ala Arg Asp Pro Gly Ser Arg Ala Lys Ile Ala Val Lys Thr
225 230 235 240 Asn Asp Lys Arg Ile Asp Pro Val Gly Ala Cys Val Gly
Met Arg Gly 245 250 255 Ala Arg Val Gln Ala Val Ser Thr Glu Leu Gly
Gly Glu Arg Ile Asp 260 265 270 Ile Val Leu Trp Asp Asp Asn Pro Ala
Gln Phe Val Ile Asn Ala Met 275 280 285 Ala Pro Ala Asp Val Ala Ser
Ile Val Val Asp Glu Asp Lys His Thr 290 295 300 Met Asp Ile Ala Val
Glu Ala Gly Asn Leu Ala Gln Ala Ile Gly Arg 305 310 315 320 Asn Gly
Gln Asn Val Arg Leu Ala Ser Gln Leu Ser Gly Trp Glu Leu 325 330 335
Asn Val Met Thr Val Asp Asp Leu Gln Ala Lys His Gln Ala Glu Ala 340
345 350 His Ala Ala Ile Asp Thr Phe Thr Lys Tyr Leu Asp Ile Asp Glu
Asp 355 360 365 Phe Ala Thr Val Leu Val Glu Glu Gly Phe Ser Thr Leu
Glu Glu Leu 370 375 380 Ala Tyr Val Pro Met Lys Glu Leu Leu Glu Ile
Glu Gly Leu Asp Glu 385 390 395 400 Pro Thr Val Glu Ala Leu Arg Glu
Arg Ala Lys Asn Ala Leu Ala Thr 405 410 415 Ile Ala Gln Ala Gln Glu
Glu Ser Leu Gly Asp Asn Lys Pro Ala Asp 420 425 430 Asp Leu Leu Asn
Leu Glu Gly Val Asp Arg Asp Leu Ala Phe Lys Leu 435 440 445 Ala Ala
Arg Gly Val Cys Thr Leu Glu Asp Leu Ala Glu Gln Gly Ile 450 455 460
Asp Asp Leu Ala Asp Ile Glu Gly Leu Thr Asp Glu Lys Ala Gly Ala 465
470 475 480 Leu Ile Met Ala Ala Arg Asn Ile Cys Trp Phe Gly 485 490
3942DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 39tttttttttt tttttttttt tttttttttt
tttttttttt tt 42404PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 40Tyr Ala Gly Asp 1 414PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 41Tyr
Ala Asp Asp 1 426PRTArtificial SequenceDescription of Artificial
Sequence Synthetic 6xHis tag 42His His His His His His 1 5
434PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 43Tyr Met Asp Asp 1 4426PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 44Thr
Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn Ser Ser Ser Asn 1 5 10
15 Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu 20 25 4516PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 45Thr
Val Asp Ala Ala Leu Ala Ala Ala Gln Thr Ala Ala Ala Ala Ala 1 5 10
15 4615PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 46Met Ala Ala Arg Asn Ile Cys Trp Phe Gly Ala Ala
Ala Ala Ala 1 5 10 15
* * * * *