U.S. patent application number 15/835063 was filed with the patent office on 2018-11-29 for nad biosynthesis and precursors for the treatment and prevention of cancer and proliferation.
This patent application is currently assigned to President and Fellows of Harvard College. The applicant listed for this patent is NewSouth Innovations Pty Limited, President and Fellows of Harvard College. Invention is credited to Ana P. Gomes, David A. Sinclair, Lindsay Wu.
Application Number | 20180338991 15/835063 |
Document ID | / |
Family ID | 50478056 |
Filed Date | 2018-11-29 |
United States Patent
Application |
20180338991 |
Kind Code |
A1 |
Sinclair; David A. ; et
al. |
November 29, 2018 |
NAD BIOSYNTHESIS AND PRECURSORS FOR THE TREATMENT AND PREVENTION OF
CANCER AND PROLIFERATION
Abstract
Disclosed herein are novel compositions and methods for the
treatment of age-related diseases, mitochondrial diseases, the
improvement of stress resistance, the improvement of resistance to
hypoxia and the extension of life span. Also described herein are
methods for the identification of agents useful in the foregoing
methods. Methods and compositions are provided for the treatment of
diseases or disorders associated with mitochondrial dysfunction.
The invention relates to methods for treatment and prevention of
cancer by administering agents that increase levels of NAD+, such
as NAD+ precursors or agents involved in NAD+ biosynthesis.
Inventors: |
Sinclair; David A.;
(Chestnut Hill, MA) ; Gomes; Ana P.; (New York,
NY) ; Wu; Lindsay; (Coogee, AU) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
President and Fellows of Harvard College
NewSouth Innovations Pty Limited |
Cambridge
Sydney |
MA |
US
AU |
|
|
Assignee: |
President and Fellows of Harvard
College
Cambridge
MA
NewSouth Innovations Pty Limited
Sydney
|
Family ID: |
50478056 |
Appl. No.: |
15/835063 |
Filed: |
December 7, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14434573 |
Apr 9, 2015 |
9877981 |
|
|
PCT/US2013/064154 |
Oct 9, 2013 |
|
|
|
15835063 |
|
|
|
|
61832414 |
Jun 7, 2013 |
|
|
|
61832203 |
Jun 7, 2013 |
|
|
|
61711552 |
Oct 9, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2227/105 20130101;
C12Y 204/02012 20130101; A61K 38/45 20130101; A61K 31/706 20130101;
A01K 2217/075 20130101; A61K 31/7064 20130101; A01K 2267/035
20130101; A61K 48/005 20130101; A61P 35/00 20180101; C12Y 207/07001
20130101 |
International
Class: |
A61K 31/7064 20060101
A61K031/7064; A61K 38/45 20060101 A61K038/45; A61K 48/00 20060101
A61K048/00 |
Goverment Interests
GOVERNMENT INTEREST
[0002] This invention was made with Government support under
National Institutes of Health Grant AG028730. The Government has
certain rights in this invention.
Claims
1.-7. (canceled)
8. A method for modulating cell proliferation in a subject in need
thereof, comprising administering to the subject an amount of
nicotinamide mononucleotide (NMN), or a salt thereof, or a prodrug
thereof, effective to increase the level of nicotinamide adenine
dinucleotide (NAD+) in the subject.
9. (canceled)
10. The method of claim 8, wherein the NMN or salt thereof, or
prodrug thereof, is administered orally.
11. The method of claim 8, wherein the NMN, or salt thereof, or
prodrug thereof, is administered at a dose of between 0.5-5 grams
per day.
12.-13. (canceled)
14. The method of claim 8, wherein the subject is a human.
15. The method of claim 8, wherein the NMN or salt thereof, or
prodrug thereof, is administered as a pharmaceutical composition
comprising a pharmaceutically acceptable carrier and the NMN or
salt thereof, or prodrug thereof.
16. The method of claim 15, wherein the pharmaceutical composition
is adapted for oral administration.
17. The method of claim 15, wherein the NMN or salt thereof, or
prodrug thereof, is administered orally.
18. The method of claim 15, wherein the subject is a human.
19. The method of claim 11, wherein the NMN or salt thereof, or
prodrug thereof, is administered orally.
20. The method of claim 11, wherein the subject is a human.
21. The method of claim 11, wherein the NMN or salt thereof, or
prodrug thereof, is administered as a pharmaceutical composition
comprising a pharmaceutically acceptable carrier and the NMN or
salt thereof, or prodrug thereof.
22. The method of claim 21, wherein the pharmaceutical composition
is adapted for oral administration.
23. The method of claim 21, wherein the NMN or salt thereof, or
prodrug thereof, is administered orally.
24. A method for modulating cell proliferation in a subject in need
thereof, comprising administering to the subject an amount of
nicotinamide mononucleotide (NMN), or a salt thereof, effective to
increase the level of nicotinamide adenine dinucleotide (NAD+) in
the subject.
25. The method of claim 24, wherein the NMN or salt thereof is
administered orally.
26. The method of claim 24, wherein the subject is a human.
27. The method of claim 24, wherein the NMN or salt thereof is
administered as a pharmaceutical composition comprising a
pharmaceutically acceptable carrier and the NMN or salt
thereof.
28. The method of claim 27, wherein the pharmaceutical composition
is adapted for oral administration.
29. The method of claim 27, wherein the NMN or salt thereof is
administered orally.
30. The method of claim 27, wherein the subject is a human.
31. The method of claim 24, wherein the NMN or salt thereof is
administered at a dose of between 0.5-5 grams per day.
32. The method of claim 31, wherein the NMN or salt thereof is
administered orally.
33. The method of claim 31, wherein the subject is a human.
34. The method of claim 31, wherein the NMN or salt thereof is
administered as a pharmaceutical composition comprising a
pharmaceutically acceptable carrier and the NMN or salt
thereof.
35. The method of claim 34, wherein the pharmaceutical composition
is adapted for oral administration.
36. The method of claim 34, wherein the NMN or salt thereof is
administered orally.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/434,573, filed Apr. 9, 2015, which is a
national stage filing under 35 U.S.C. .sctn. 371 of international
application PCT/US2013/064154, filed Oct. 9, 2013, entitled "NAD
Biosynthesis and Precursors for the Treatment and Prevention of
Cancer and Proliferation," which claims the benefit under 35 U.S.C.
.sctn. 119(e) of U.S. Provisional Application Ser. No. 61/711,552,
entitled "Treatment of Age-Related and Mitochondrial Diseases by
Inhibition of HIF-1.alpha. Function," filed on Oct. 9, 2012, U.S.
Provisional Application Ser. No. 61/832,414, entitled "NAD
Biosynthesis and NAD Precursors for the Treatment of Disease,"
filed on Jun. 7, 2013, and U.S. Provisional Application Ser. No.
61/832,203, entitled "NAD Biosynthesis and Precursors for the
Treatment and Prevention of Cancer and Proliferation," filed on
Jun. 7, 2013, the entire contents of each of which are herein
incorporated by reference in their entireties.
FIELD OF THE INVENTION
[0003] The invention relates to methods for treatment and
prevention of diseases or disorders associated with mitochondrial
dysfunction by administering inhibitors of HIF1-.alpha. and/or
agents that increase levels of NAD+. The invention relates to
methods for treatment and prevention of cancer by administering
agents that increase levels of NAD+.
BACKGROUND
[0004] Aging is characterized by a progressive decline in cellular
and tissue homeostasis leading to a variety of age-related diseases
that limit lifespan. Although improvements in sanitation, diet and
medicines over the past 100 years have produced dramatic
improvements in human health, maximum human lifespan has not
changed. The inability to impact the maximal lifespan is due, in
large part, to a limited understanding of why aging occurs and what
genes control these processes.
[0005] Mitochondria are highly dynamic organelles that move
throughout the cell and undergo structural transitions, changing
the length, morphology, shape and size. Moreover, mitochondria are
continuously eliminated and regenerated in a process known as
mitochondrial biogenesis. Over the past 2 billion years, since
eukaryotes subsumed the .alpha.-proteobacterial ancestor of
mitochondria, most mitochondrial genes have been transferred to the
nuclear genome, where regulation is better integrated. However, the
mitochondrial genome still encodes rRNAs, tRNAs, and 13 subunits of
the electron transport chain (ETC). Functional communication
between the nuclear and mitochondrial genomes is therefore
essential for mitochondrial biogenesis, efficient oxidative
phosphorylation, and normal health. Failure to maintain the
stoichiometry of ETC complexes is exemplified by mitochondrial
disorders such as Leber's hereditary optic neuropathy (LHON),
mitochondrial encephalomyopathy, lactic acidosis and stroke like
episode syndrome (MELAS), myoclonic epilepsy with ragged red fibers
(MERRF), and Leigh Syndrome.
[0006] One of the most conserved and robust phenomena in biology,
in organisms as diverse as yeast and humans, is a progressive
decline in mitochondrial function with age leading to a loss of
cellular homeostasis and organismal health. In mammals, there is a
large body of evidence implicating mitochondrial decline in aging
and age-related diseases, including type H diabetes, Parkinson's
disease, Alzheimer's disease, sarcopenia, lethargy, frailty,
hepatic steatosis and obesity. For example, mice with mutations
that impair the proofreading capacity of the mitochondrial DNA
polymerase gamma (Poly) exhibit a premature aging phenotype.
Conversely, targeting peroxisomal catalase to mitochondria (mCAT)
extends mouse lifespan. Recently, telomere erosion in mice was
found to disrupt mitochondrial function but the underlying
mechanism has not yet been established. Despite the apparent
importance of mitochondrial decline in aging and disease, there is
considerable debate about its underlying causes.
[0007] Deregulation of mitochondrial homeostasis is one of the
hallmarks of aging and disease in diverse species such as yeast and
humans. In mammals, disruption of mitochondrial homeostasis is
believed to be an underlying cause of aging and the etiology of
numerous age-related diseases (de Moura et al., 2010; Figueiredo et
al., 2009; Sahin et al., 2011; Schulz et al., 2007; Wallace et al.,
2010). Despite its importance, there is still a great deal of
controversy as to why age induces the disruption of mitochondrial
homeostasis and how this process might be slowed or reversed.
[0008] In light of the foregoing, there is great need for novel
compositions and methods for improving metabolism and mitochondrial
function in aging tissues. Such compositions and methods would be
useful for the treatment of age related and mitochondrial diseases,
as well as for increasing stress resistance, improving resistance
to hypoxia and extending the lifespan of organisms and cells.
[0009] NAD+ is an essential co-factor for several important enzymes
(Canto and Auwerx, 2011). In mammals, NAD+ is generated from
nicotinamide in a salvage pathway wherein nicotinamide
phosphoribosyltransferase (NAMPT) converts nicotinamide to
nicotinamide mononucleotide (NMN) which is then converted to NAD+
by nicotinamide mononucleotide adenylyltransferase (NMNAT) (Canto
and Auwerx, 2011).
SUMMARY
[0010] As described herein, Hypoxia-Inducible Factor 1.alpha.
(HIF-1.alpha.) interacts with the transcription factor c-Myc to
inhibit c-Myc activity, causing genome asynchrony and the decline
in mitochondrial function during aging. Reducing the ability of
HIF-1.alpha. to inhibit c-Myc activity, such as by disrupting the
formation of the complex containing HIF-1.alpha. and c-Myc,
therefore conveys beneficial effects on metabolism, cellular
fitness, survival (e.g., survival under hypoxic conditions) and
mitochondrial function in aged tissues. Thus, agents that reduce
inhibition of c-Myc activity by HIF-1.alpha. and/or disrupt the
formation of a complex between HIF-1.alpha. and c-Myc (e.g.,
anti-HIF-1.alpha. antibodies, HIF-1.alpha. decoy proteins, small
molecules), are useful for the treatment of age-related and
mitochondrial diseases, including Alzheimer's disease, diabetes
mellitus, heart disease, obesity, osteoporosis, Parkinson's disease
and stroke. Such agents are also therefore useful for extending the
life span, increasing the stress resistance and improving
resistance to hypoxia of a subject (e.g., a human, a non-human
animal and/or a plant) or a cell.
[0011] In certain embodiments, the instant invention relates to a
method of treating or preventing an age-related disease and/or a
mitochondrial disease by administration of an agent that reduces
inhibition of c-Myc activity by HIF-1.alpha.. In some embodiments,
the agent inhibits the formation of a complex between HIF-1.alpha.
and c-Myc. In some embodiments, the agent induces a conformational
change in HIF-1.alpha. or c-Myc that abrogates their interaction
and/or alters the ability of HIF-1.alpha. to affect c-Myc activity,
protein levels or cell localization. In certain embodiments the
age-related disease is Alzheimer's disease, amniotropic lateral
sclerosis, arthritis, atherosclerosis, cachexia, cancer, cardiac
hypertrophy, cardiac failure, cardiac hypertrophy, cardiovascular
disease, cataracts, colitis, chronic obstructive pulmonary disease,
dementia, diabetes mellitus, frailty, heart disease, hepatic
steatosis, high blood cholesterol, high blood pressure,
Huntington's disease, hyperglycemia, hypertension, infertility,
inflammatory bowel disease, insulin resistance disorder, lethargy,
metabolic syndrome, muscular dystrophy, multiple sclerosis,
neuropathy, nephropathy, obesity, osteoporosis, Parkinson's
disease, psoriasis, retinal degeneration, sarcopenia, sleep
disorders, sepsis and/or stroke. In some embodiments the
mitochondrial disease is mitochondrial myopathy, diabetes mellitus
and deafness (DAD), Leber's hereditary optic neuropathy (LHON),
Leigh syndrome, neuropathy, ataxia, retinitis pigmentosa and
petosis (NARP), myoclonic epilepsy with ragged red fibers (MERRF),
myoneurogenic gastrointestinal encephalopathy (MNGIE),
mitochondrial myopathy, encephalomyopathy, lactic acidosis,
stroke-like symptoms (MELAS), Kearns-Sayre syndrome (KSS), chronic
progressive external opthalmoplegia (CPEO) and/or mtDNA
depletion.
[0012] In certain embodiments, the instant invention relates to a
method of increasing the life span and/or increasing the stress
resistance of a subject by administration of an agent that reduces
inhibition of c-Myc activity by HIF-1.alpha.. In some embodiments
the agent inhibits the formation of a complex between HIF-1.alpha.
and c-Myc. In some embodiments, the agent induces a conformational
change in HIF-1.alpha. or c-Myc that abrogates their interaction
and/or alters the ability of HIF-1.alpha. to affect c-Myc activity,
protein levels or cell localization. For example, in some
embodiments, administration of the agent increases the resistance
of cells in the organism against stress (e.g., heat shock, osmotic
stress, DNA damaging agents and inadequate nitrogen levels). In
certain embodiments, the invention relates to extending the life
span or increasing the stress resistance of a cell by contacting
the cell with an agent that inhibits the formation of a complex
between HIF-1.alpha. and c-Myc.
[0013] In some embodiments, the present invention relates to a
method of improving the survival of a cell, organ and/or tissue
under hypoxic conditions. In certain embodiments the method
includes contacting the cell, organ and/or tissue with an agent
that reduces inhibition of c-Myc activity by HIF-1.alpha.. In some
embodiments the agent inhibits the formation of a complex between
HIF-1.alpha. and c-Myc. In some embodiments, the agent induces a
conformational change in HIF-1.alpha. or c-Myc that abrogates their
interaction and/or alters the ability of HIF-1.alpha. to affect
c-Myc activity, protein levels or cell localization. In some
embodiments, the cell, organ and/or tissue has been exposed to a
hypoxic environment. In certain embodiments the cell, organ and/or
tissue is within a subject (e.g., a subject suffering from
ischemia, cardiovascular diseases, myocardial infarction,
congestive heart disease, cardiomyopathy, myocarditis,
macrovascular disease, peripheral vascular disease, reperfusion or
stroke) who is administered the agent. In some embodiments, the
cell is being cultured in vitro. In some embodiments the cell is a
neuron, a cardiac myocyte, a skeletal myocyte, an iPS cell, blood
cell, germ cell or germ cell precursor.
[0014] In certain embodiments, the present invention relates to a
method of treating or preventing damage to a tissue or organ that
has been exposed to hypoxia in a subject by administering an agent
described herein to the subject. In some embodiments the subject is
suffering from or has suffered from ischemia, cardiovascular
diseases, myocardial infarction, congestive heart disease,
cardiomyopathy, myocarditis, macrovascular disease, peripheral
vascular disease reperfusion or a stroke.
[0015] In certain embodiments, the agent is an isolated antibody or
antigen binding fragment thereof that specifically binds to a
domain in HIF-1.alpha. that contributes to complex formation with
c-Myc. For example, in certain embodiments the antibody or antigen
binding fragment thereof binds to an epitope of human HIF-1.alpha.
located within amino acids 167-329 of the HIF-1.alpha. protein. In
some embodiments the antibody or antigen binding fragment thereof
can be monoclonal, polyclonal, chimeric, humanized and/or human. In
certain embodiments, the antibody or antigen binding fragment
thereof is a full length immunoglobulin molecule; an scFv; a Fab
fragment; an Fab' fragment; an F(ab')2; an Fv; a NANOBODY.RTM.; or
a disulfide linked Fv. In some embodiments the antibody or antigen
binding fragment thereof binds to HIF-1.alpha. with a dissociation
constant of no greater than about 10.sup.-6M, 10.sup.-7 M,
10.sup.-8 M or 10.sup.-9M. In certain embodiments the antibody or
antigen binding fragment thereof inhibits the formation of a
complex between HIF-1.alpha. and c-Myc.
[0016] In certain embodiments, the agent is an isolated soluble
polypeptide that includes at least 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 consecutive amino
acids of the HIF-1.alpha. domain that contributes to complex
formation with c-Myc. For example, in some embodiments the isolated
soluble polypeptide includes at least 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 consecutive
amino acids of one of SEQ ID NO: 11-20. In some embodiments, the
polypeptide comprises one of SEQ ID NO: 11-20. In certain
embodiments the polypeptide also includes an immunoglobulin
constant domain (e.g., a human immunoglobulin constant domain). In
some embodiments the polypeptide binds to c-Myc with a dissociation
constant of no greater than about 10.sup.-6 M, 10 M, 10.sup.-8 M or
10.sup.9 M.
[0017] In certain embodiments, the agent is a small molecule. In
some embodiments the small molecule binds the HIF-1.alpha. domain
that contributes to complex formation with c-Myc. In some
embodiments the small molecule binds to human HIF-1.alpha. at a
location within amino acids 167-329 of the HIF-1.alpha. protein. In
some embodiments, the small molecule is attached to an antibody,
protein or a peptide.
[0018] In some embodiments, the instant invention relates to a
method of determining whether a test agent is a candidate
therapeutic agent for the treatment of an age-related disease, for
the treatment of a mitochondrial disease, for increasing life span,
for improving resistance to hypoxia and/or for increasing stress
resistance. In certain embodiments, the method comprises forming a
test reaction mixture that includes a HIF-1.alpha. polypeptide or
fragment thereof, an c-Myc polypeptide or fragment thereof and a
test agent. In some embodiments the method includes the step of
incubating the test reaction mixture under conditions conducive for
the formation of a complex between the HIF-1.alpha. polypeptide or
fragment thereof and the c-Myc polypeptide or fragment thereof. In
certain embodiments, the test reaction includes a cell lysate. In
some embodiments, the method includes the step of determining the
amount of the complex in the test reaction mixture. In some
embodiments, a test agent that reduces the amount of the complex in
the test reaction mixture compared to the amount of the complex in
a control reaction mixture is a candidate therapeutic agent for the
treatment of an age-related disease, for the treatment of a
mitochondrial disease, for increasing life span, for improving
resistance to hypoxia and/or for increasing stress resistance. In
some embodiments, the HIF-1.alpha. polypeptide or fragment thereof
comprises an amino acid sequence of one of SEQ ID NO: 11-20. In
some embodiments the test agent is an antibody, a protein, a
peptide or a small molecule. In certain embodiments the test agent
is a member of a library of test agents.
[0019] In some embodiments, the control reaction mixture is
substantially identical to the test reaction mixture except that
the control reaction mixture does not comprise a test agent. In
certain embodiments the control reaction mixture is substantially
identical to the test reaction mixture except that the control
reaction mixture comprises a placebo agent instead of a test
agent.
[0020] In some embodiments, the test reaction mixture is formed by
adding the test agent to a mixture comprising the HIF-1.alpha.
polypeptide or fragment thereof and the c-Myc polypeptide or
fragment thereof. In certain embodiments the test reaction mixture
is formed by adding the HIF-1.alpha. polypeptide or fragment
thereof to a mixture comprising the test agent and the c-Myc
polypeptide or fragment thereof. In certain embodiments the test
reaction mixture is formed by adding the c-Myc polypeptide or
fragment thereof to a mixture comprising the test agent and the
HIF-1.alpha. polypeptide or fragment thereof.
[0021] In certain embodiments, the HIF-1.alpha. polypeptide or
fragment thereof is anchored to a solid support in the test
reaction mixture. In some embodiments the test reaction mixture is
incubated under conditions conducive to the binding of the c-Myc
polypeptide or fragment thereof to the anchored HIF-1.alpha.
polypeptide or fragment thereof. In some embodiments, the method
also includes the step of isolating c-Myc polypeptide or fragment
thereof bound to the HIF-1.alpha. polypeptide or fragment thereof
from c-Myc polypeptide or fragment thereof not bound to the
HIF-1.alpha. polypeptide or fragment thereof. In certain
embodiments, the amount of complex in the test reaction mixture is
determined by detecting the amount of c-Myc polypeptide or fragment
thereof bound to the HIF-1.alpha. polypeptide or fragment thereof.
In some embodiments the c-Myc polypeptide or fragment thereof is
linked (e.g. bound either directly or indirectly) to a detectable
moiety (e.g., a fluorescent moiety, a luminescent moiety, a
radioactive moiety, etc.).
[0022] In some embodiments, the c-Myc polypeptide or fragment
thereof is anchored to a solid support in the test reaction
mixture. In some embodiments the test reaction mixture is incubated
under conditions conducive to the binding of the HIF-1.alpha.
polypeptide or fragment thereof to the anchored c-Myc polypeptide
or fragment thereof. In certain embodiments the method also
includes the step of isolating HIF-1.alpha. polypeptide or fragment
thereof bound to the c-Myc polypeptide or fragment thereof from
HIF-1.alpha. polypeptide or fragment thereof not bound to the c-Myc
polypeptide or fragment thereof. In some embodiments the amount of
complex in the test reaction mixture is determined by detecting the
amount of HIF-1.alpha. polypeptide or fragment thereof bound to the
c-Myc polypeptide or fragment thereof. In certain embodiments the
HIF-1.alpha. polypeptide or fragment thereof is linked (e.g. bound
either directly or indirectly) to a detectable moiety (e.g., a
fluorescent moiety, a luminescent moiety, a radioactive moiety,
etc.).
[0023] In some embodiments, the instant invention relates to a
method of determining whether a test agent is a candidate
therapeutic agent for the treatment of an age-related disease, for
the treatment of a mitochondrial disease, for increasing life span,
for improving resistance to hypoxia and/or for increasing stress
resistance that includes contacting a polypeptide comprising a
sequence of one of SEQ ID NO: 11-20 with a test agent and
determining whether the test agent binds to the epitope; wherein a
test agent that binds to the epitope is a candidate therapeutic
agent for the treatment of an age-related disease, for the
treatment of a mitochondrial disease, for increasing life span, for
improving resistance to hypoxia and/or for increasing stress
resistance. In some embodiments the test agent is an antibody, a
protein, a peptide or a small molecule. In certain embodiments the
test agent is a member of a library of test agents. In some
embodiments the test agent is a small molecule.
[0024] In some embodiments the polypeptide is attached to a solid
substrate. In some embodiments, the method also includes the step
of isolating test agent that is bound to the epitope from test
agent that is not bound to the epitope. In some embodiments the
test agent is linked to a detectable moiety.
[0025] In some embodiments the test agent is attached to a solid
substrate. In certain embodiments the method also includes the step
of isolating polypeptide that is bound to the test agent from
polypeptide that is not bound to the test agent. In some
embodiments the polypeptide is linked to a detectable moiety. In
certain embodiments the test agent is a member of a library of test
agents. In some embodiments the test agent is a small molecule.
[0026] In some embodiments, the instant invention relates to a
method of determining whether a test agent is a candidate
therapeutic agent for the treatment of an age-related disease, for
the treatment of a mitochondrial disease, for increasing life span,
for improving resistance to hypoxia and/or for increasing stress
resistance, wherein the method includes the steps of contacting a
cell that expresses HIF-1.alpha. and c-Myc with a test agent, and
detecting the expression of a reporter gene that is
transcriptionally regulated by c-Myc. In some embodiments, the
reporter gene is a gene that controls mitochondrial function, such
as TFAM, ND1, ND2, ND3, ND4, ND4I, ND5, ND6, CYTB, COX1, COX2,
COX3, ATP6 or ATP8. In some embodiments, a test agent that
increases expression of the reporter gene in the cell as compared
to a cell that has not been contacted with the test agent is a
candidate therapeutic agent for the treatment of an age-related
disease, for the treatment of a mitochondrial disease, for
increasing life span, for improving resistance to hypoxia and/or
for increasing stress resistance.
[0027] In some embodiments, the reporter gene is operably linked to
the promoter of c-Myc target gene, such as the promoter of TFAM,
ND1, ND2, ND3, ND4, ND4I, ND5, ND6, CYTB, COX1, COX2, COX3, ATP6 or
ATP8. In some embodiments expression of the reporter gene is
detected by detecting the presence and/or amount of reporter gene
mRNA (e.g., by RT PCR, northern blot, a nucleic acid probe
hybridization assay and/or a gene expression array). In certain
embodiments expression of the reporter gene is detected by
detecting the presence and/or amount of reporter gene encoded
protein (e.g., by western blot, ELISA, an antibody hybridization
assay, etc.). In some embodiments, the cell is a mammalian cell
(e.g., a C2C12 cell). In certain embodiments, the cell is in an
organism. In some embodiments, the cell is a transgenic cell that
recombinantly expresses the reporter gene. In certain embodiments
the reporter gene encodes a detectable moiety, such as a
fluorescent protein (e.g., GFP, RFP, YFP, etc.), or an enzyme that
catalyzes a reaction that produces a change in luminescence,
opacity or color. In certain embodiments the test agent is a member
of a library of test agents. In some embodiments the agent is a
small molecule.
[0028] Aspects of the present disclosure relate to the surprising
discovery that HIF-1.alpha. is increased during aging and
mitochondrial disorders and that NAD.sup.+ precursors and NAD.sup.+
biosynthetic genes (e.g., NMNAT-1 and NAMPT) counteract
HIF-1.alpha. activity. Accordingly, provided herein are methods and
compositions for the treatment of diseases or disorders associated
with mitochondrial dysfunction.
[0029] Thus, in one embodiment, a method for treating or preventing
a disease associated with deregulation of mitochondrial homeostasis
in a subject in need thereof is provided. The method comprises
administering to the subject an effective amount of a HIF-1.alpha.
inhibitor. In some aspects, the disease associated with
deregulation of mitochondrial homeostasis is aging, an
aging-related disease, a mitochondrial disease, metabolic disorder,
cardiovascular disease, stroke, pulmonary hypertension, ischemia,
cachexia, sarcopenia, a neurodegenerative disease, dementia,
lipodystrophy, liver steatosis, hepatitis, cirrhosis, kidney
failure, preeclampsia, male infertility, diabetes, muscle wasting,
or combinations thereof. In some aspects, the HIF-1.alpha.
inhibitor is a small molecule, siRNA, or antisense oligonucleotide.
In some aspects, the small molecule is chrysin
(5,7-dihydroxyflavone), methyl
3-(2-(4-(adamantan-1-yl)phenoxy)acetamido)-4-hydroxybenzoate,
P3155, NSC 644221,
S-2-amino-3-[4'-N,N,-bis(chloroethyl)amino]phenyl propionic acid
N-oxide dihydrochloride, dimethyl-bisphenol A, vincristine,
apigenin, 2-methoxyestradiol, chetomin, or echinomycin.
[0030] In some embodiments, the method further comprises
administering to the subject an effective amount of an agent that
increases the level of NAD.sup.+ in the subject. In some aspects,
the agent is an NAD.sup.+ precursor, such as NMN or a salt thereof,
or an NMN prodrug. In some aspects, the agent is administered at a
dose of between 0.5-5 grams per day. In some embodiments, the agent
is an enzyme involved in NAD.sup.+ biosynthesis, or an
enzymatically active fragment thereof, or a nucleic acid encoding
an enzyme involved in NAD.sup.+ biosynthesis, or an enzymatically
active fragment thereof. In some aspects, the enzyme is NMNAT-1 or
NAMPT.
[0031] In another embodiment, a method for treating or preventing a
disease associated with deregulation of mitochondrial homeostasis
in a subject in need thereof is provided, comprising administering
to the subject an effective amount of an agent that increases the
level of NAD.sup.+ in the subject. In some aspects, the disease
associated with deregulation of mitochondrial homeostasis is aging,
an aging-related disease, a mitochondrial disease, metabolic
disorder, cardiovascular disease, stroke, pulmonary hypertension,
ischemia, cachexia, sarcopenia, a neurodegenerative disease,
dementia, lipodystrophy, liver steatosis, hepatitis, cirrhosis,
kidney failure, preeclampsia, male infertility, or combinations
thereof. In some aspects, the agent is an NAD.sup.+ precursor, such
as NMN or a salt thereof, or an NMN prodrug. In some aspects, the
agent is administered at a dose of between 0.5-5 grams per day. In
some embodiments, the agent is an enzyme involved in NAD+
biosynthesis, or an enzymatically active fragment thereof, or a
nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or
an enzymatically active fragment thereof. In some aspects, the
enzyme is NMNAT-1 or NAMPT.
[0032] In another embodiment, a screening method for identifying a
HIF-1.alpha. inhibitor is provided. The method comprises (a)
contacting a eukaryotic cell with a candidate compound; (b)
determining the level of expression of one or more mitochondrial
genes; (c) comparing the level of expression determined in (b) to a
reference level of expression, wherein the reference level is
determined in the absence of the candidate compound; and (d)
identifying the compound as a HIF-1.alpha. inhibitor if a
significantly decreased level of mitochondrial gene expression is
determined in (b), as compared to the reference level in (c). In
some aspects, the one or more mitochondrial genes is selected from
cytochrome b, cytochrome oxidase, NADH dehydrogenase, and ATP
synthase.
[0033] Aspects of the invention relate to methods for treating or
preventing cancer in a subject in need thereof comprising
administering to the subject an effective amount of an agent that
increases the level of NAD+ in the subject. In some embodiments,
the agent is an NAD+ precursor. In some embodiments, the NAD+
precursor is NMN or a salt thereof, or a prodrug thereof. In some
embodiments, the agent is administered at a dose of between 0.5-5
grams per day.
[0034] In some embodiments, the agent is an enzyme involved in NAD+
biosynthesis, or an enzymatically active fragment thereof, or a
nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or
an enzymatically active fragment thereof. In some embodiments, the
enzyme is NMNAT-1 or NAMPT. In some embodiments, the subject is a
human.
[0035] Further aspects of the invention relate to methods for
modulating cell proliferation in a subject in need thereof
comprising administering to the subject an effective amount of an
agent that increases the level of NAD+ in the subject. In some
embodiments, the agent is an NAD+ precursor. In some embodiments,
the NAD+ precursor is NMN or a salt thereof, or a prodrug thereof.
In some embodiments, the agent is administered at a dose of between
0.5-5 grams per day.
[0036] In some embodiments, the agent is an enzyme involved in NAD+
biosynthesis, or an enzymatically active fragment thereof, or a
nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or
an enzymatically active fragment thereof. In some embodiments, the
enzyme is NMNAT-1 or NAMPT. In some embodiments, the subject is a
human.
[0037] These and other aspects of the invention, as well as various
embodiments thereof, will become more apparent in reference to the
drawings and detailed description of the invention. Each of the
limitations of the invention can encompass various embodiments of
the invention. It is, therefore, anticipated that each of the
limitations of the invention involving any one element or
combinations of elements can be included in each aspect of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] The accompanying drawings are not intended to be drawn to
scale. In the drawings, each identical or nearly identical
component that is illustrated in various figures is represented by
a like numeral. For purposes of clarity, not every component may be
labeled in every drawing. In the drawings:
[0039] FIG. 1 provides exemplary HIF-1.alpha. amino acid sequences
(SEQ ID NOs: 1-10).
[0040] FIG. 2 provides exemplary amino acid sequences of the domain
of the HIF-1.alpha. protein that is required for complex formation
with c-Myc (SEQ ID NOs: 11-20).
[0041] FIG. 3 provides exemplary c-Myc amino acid sequences (SEQ ID
NOs: 21-30).
[0042] FIGS. 4A-4I show loss of SIRT1 causes a specific decrease in
the expression of mitochondrially-encoded genes resulting in genome
asynchrony and mitochondrial dysfunction. FIG. 4A depicts
mitochondrial membrane potential of isolated mitochondria from
skeletal muscle of WT and SIRT1 KO mice (n=4). FIG. 4B depicts ATP
content from gastrocnemius of WT and SIRT1 KO mice (n=4). FIG. 4C
depicts electronic microscopy analysis of gastrocnemius from WT and
SIRT1 KO mice and the respective mitochondrial area quantification
(n=4). FIGS. 4D-4E depict NDUFS8, NDUFAS, SDHb, SDHd, Uqcrc1,
Uqcrc2, COX5b, Cox6a1, ATP5a1, and ATPb1. FIG. 4D depicts ND1, ND2,
ND3, ND4, ND4l, ND5, ND6, CYTB, COX1, COX2, COX3, ATP6 and ATP8.
FIG. 4E depicts mRNA analyzed by qPCR in gastrocnemius of WT and
SIRT1 KO mice. Relative expression values were normalized to WT
mice (n=4). FIG. 4F depicts representative immunoblot for COX2 and
COX4 in gastrocnemius of WT and SIRT1 KO mice. FIG. 4G depicts
Cytochrome c Oxidase (COX) activity in gastrocnemius of WT and
SIRT1 KO mice (n=5). FIG. 4H depicts Succinate Dehydrogenase (SDH)
activity in gastrocnemius of WT and SIRT1 KO mice (n=5). FIG. 4I
depicts mitochondrial DNA content analyzed by qPCR in gastrocnemius
of WT and SIRT1 KO mice Relative amount was normalized to WT mice
(n=4). Values are expressed as mean.+-.SEM (*p<0.05 versus WT
animals).
[0043] FIGS. 5A-5I show aging leads to genome asynchrony and
impaired mitochondrial function. FIG. 5A depicts mitochondrial
membrane potential of isolated mitochondria from skeletal muscle of
6-, 22-, and 30-month-old mice (n=4). FIG. 5B depicts ATP content
from gastrocnemius of 6-, 22-, and 30-month-old mice (n=5). FIG. 5C
depicts Cytochrome c Oxidase (COX) activity in gastrocnemius of 6-,
22-, and 30-month-old mice (n=4). FIG. 5D depicts mitochondrial DNA
content analyzed by qPCR in gastrocnemius of 6-, 22-, and
30-month-old mice. Relative amount was normalized to 6 month old
mice (n=5). FIG. 5E depicts mitochondrial DNA integrity in
gastrocnemius of 6-, 22-, and 30-month-old mice. Relative amount
was normalized to 6 month old mice (n=5). FIG. 5F depicts SIRT1
mRNA analyzed by qPCR in gastrocnemius of 6-, 22-, and 30-month-old
mice. Relative expression values were normalized to 6 month old
mice (n=5). FIG. 5G depicts NAD.sup.+ levels in gastrocnemius of
6-, 22-, and 30-month-old mice (n=5). FIG. 5H depicts ND1, CYTB,
COX1, and ATP6. FIG. 5I depicts NDUFS8, SDHb, Uqcrc1, COX5b, and
ATP5a1. FIG. 5I depicts mRNA analyzed by qPCR in gastrocnemius of
6-, 22-, and 30-month-old mice. Relative expression values were
normalized to 6-month-old mice (n=5). (FIGS. 5H-I) Expression of
nuclear (NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus
mitochondrially-encoded genes (ND1, CYTB, COX1, ATP6) analysed by
qPCR in gastrocnemius of 6-, 22-, and 30-month-old mice. Relative
expression values were normalized to 6-month-old mice (N=5).
[0044] FIGS. 6A-6M show loss of SIRT1 disrupts mitochondrial
homeostasis through PGC-1.alpha.-independent regulation of
mitochonrially-encoded ETC subunits driven by HIF-1.alpha.
stabilization. FIG. 6A depicts ND1, CYTB, COX1 and ATP6 mRNA
analyzed by qPCR in WT and PGC-1.alpha./.beta. knockout myotubes
treated with adenovirus overexpressing SIRT1 or empty vector.
Relative expression values were normalized to WT control cells (n=4
experiments, *p<0.05 versus WT empty vector, #p<0.05 versus
PGC-1.alpha./.beta. KO empty vector). FIG. 6B depicts TFAM mRNA
analyzed by qPCR in gastrocnemius of WT and SIRT1 KO animals.
Relative expression values were normalized to WT mice (n=4,
*p<0.05 versus WT). FIG. 6C depicts TFAM promoter activity
measured by luciferase assay in primary myoblasts extracted from WT
and SIRT1 KO mice. Relative luciferase values were normalized to WT
(n=6, *p<0.05 versus control. FIG. 6D depicts representative
immunoblot for SIRT1, TFAM and tubulin in C2C12 cells infected with
nontargeting or SIRT1 shRNA with or without TFAM overexpression.
FIG. 6E depicts ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in
C2C12 cells infected with nontargeting or SIRT1 shRNA with or
without TFAM overexpression. Relative expression values were
normalized to control cells (n=4, *p<0.05 versus shCt1,
#p<0.05 versus shSIRT1). FIG. 6F depicts mitochondrial DNA
content analyzed by qPCR in C2C12 cells infected with nontargeting
or SIRT1 shRNA with or without TFAM overexpression. Relative amount
was normalized to control cells (n=4, *p<0.05 versus shCt1,
#p<0.05 versus shSIRT1). FIG. 6G depicts ATP content in C2C12
cells infected with nontargeting or SIRT1 shRNA with or without
TFAM overexpression (n=4, *p<0.05 versus shCt1, #p<0.05
versus shSIRT1). FIG. 6H depicts HK2, PKM, and PFKM mRNA analyzed
by qPCR in gastrocnemius of WT and SIRT1 KO mice. Relative
expression values were normalized to WT mice (n=5, *p<0.05
versus WT). FIG. 6I depicts LDHA mRNA analyzed by qPCR in
gastrocnemius of WT and SIRT1 KO mice. Relative expression values
were normalized to WT mice (n=5, *p<0.05 versus WT). FIG. 6J
depicts representative immunoblot for HIF1.alpha. and tubulin in
gastrocnemius of WT and SIRT1 KO mice. FIG. 6K depicts PGK-1,
Glut1, PKD1, and VEGFa mRNA analyzed by qPCR in gastrocnemius of WT
and SIRT1 KO mice. Relative expression values were normalized to WT
mice (n=4, *p<0.05 versus WT). FIG. 6L depicts Hypoxia response
element activity in primary myoblasts isolated from WT and SIRT1 KO
mice and treated with or without DMOG. Relative luciferase activity
was normalized to WT cells (n=6, *p<0.05 versus WT). FIG. 6M
depicts ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in
PGC-1.alpha./13 KO myotubes treated with adenovirus overexpressing
SIRT1 or empty vector as well as treatment with DMSO or with HIF
stabilizing compounds DMOG and DFO. Relative expression values were
normalized to control cells (n=5, *p<0.05 versus empty vector,
#p<0.05 versus SIRT1 OE). Values are expressed as
mean.+-.SEM.
[0045] FIGS. 7A-7I show that HIF-1.alpha., but not HIF-2.alpha.,
controls oxidative phosphorylation by regulating
mitochondrially-encoded ETC components in response to SIRT1. FIG.
7A depicts representative immunoblot for HA-tag and tubulin in
control C2C12 cells and cells overexpressing either HIF-1.alpha. or
HIF-2.alpha. with the proline residues mutated (HIF-1.alpha. DPA;
HIF-2.alpha. DPA). FIG. 7B depicts expression of nuclear (NDUFS8,
SDHb, Uqcrc1, COX5b, ATP5a1) versus mitochondrially-encoded genes
(ND1, CYTB, COX1, ATP6) analyzed by qPCR in control, HIF-1.alpha.
DPA or HIF-2.alpha. DPA C2C12 cells. Relative expression values
were normalized to control cells (n=6, *p<0.05 versus empty
vector). FIG. 7C depicts mitochondrial DNA content analyzed by qPCR
in control, HIF-1.alpha. DPA or HIF-2.alpha. DPA C2C12 cells
treated with adenovirus overexpressing SIRT1 or empty vector.
Relative amount was normalized to control cells (n=5, *p<0.05
versus empty vector, #p<0.05 versus SIRT1 OE). FIG. 7D depicts
ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in control,
HIF-1.alpha. DPA or HIF-2.alpha. DPA C2C12 cells treated with
adenovirus overexpressing SIRT1 or empty vector. Relative
expression values were normalized to control cells (n=4, *p<0.05
versus empty vector, #p<0.05 versus SIRT1 OE). FIG. 7E depicts
HIF-1.alpha. mRNA analyzed by qPCR in C2C12 cells infected with
HIF-1.alpha. or nontargeting shRNA. Relative expression values were
normalized to control cells (n=4, *p<0.05 versus control). FIG.
7F depicts mitochondrial DNA content analyzed by qPCR in C2C12
cells infected with HIF-1.alpha. or nontargeting shRNA treated with
EX-527. Relative amount was normalized to control cells (n=6,
*p<0.05 versus control, #p<0.05 versus control EX-527). FIG.
7G depicts ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in C2C12
cells infected with HIF-1.alpha. or nontargeting shRNA treated with
EX-527. Relative expression values were normalized to control cells
(n=6, *p<0.05 versus control, #p<0.05 versus control EX-527).
FIG. 7H depicts representative images of mitochondrial membrane
potential in C2C12 cells infected with HIF-1.alpha. or nontargeting
shRNA treated with EX-527 and analyzed by fluorescence microscopy.
FIG. 7I depicts ATP content in C2C12 cells infected with
HIF-1.alpha. or nontargeting shRNA treated with EX-527 (n=4,
*p<0.05 versus control, #p<0.05 versus control EX-527).
[0046] FIGS. 8A-8L show HIF1-.alpha. regulates genome synchrony by
modulation of TFAM promoter through c-Myc in response to changes in
SIRT1 activity. FIG. 8A depicts c-Myc activity in primary myoblasts
extracted from WT and SIRT1 KO animals. Relative luciferase values
were normalized to WT cells (n=3, *p<0.05 versus control). FIG.
8B depicts representative immunoblot for c-Myc and tubulin in C2C12
cells infected with c-Myc or nontargeting shRNA. FIG. 8C depicts
mitochondrial DNA content analyzed by qPCR in C2C12 cells infected
with c-Myc or nontargeting shRNA and treated with adenovirus
overexpressing SIRT1 or empty vector. Relative amount was
normalized to control cells (n=5, *p<0.05 versus empty vector,
#p<0.05 versus SIRT1 OE). FIG. 8D depicts TFAM promoter activity
in C2C12 cells infected with c-Myc or nontargeting shRNA and
treated with adenovirus overexpressing SIRT1 or empty vector (n=4,
*p<0.05 versus empty vector, #p<0.05 versus SIRT1 OE). FIG.
8E depicts ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in C2C12
cells infected with c-Myc or nontargeting shRNA and treated with
adenovirus overexpressing SIRT1 or empty vector. Relative
expression values were normalized to control cells (n=6, *p<0.05
versus empty vector, #p<0.05 versus SIRT1 OE). FIG. 8F depicts
representative immunoblot for c-Myc and tubulin in C2C12 cells
overexpressing c-Myc. FIG. 8G depicts mitochondrial DNA content
analyzed by qPCR in C2C12 cells overexpressing c-Myc. Relative
amount was normalized to control cells (n=5, *p<0.05 versus
empty vector, #p<0.05 versus c-Myc OE). FIG. 8H depicts ND1,
CYTB, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells
overexpressing c-Myc. Relative expression values were normalized to
control cells (n=6, *p<0.05 versus empty vector, #p<0.05
versus c-Myc OE). FIG. 8I depicts TFAM promoter activity in C2C12
cells overexpressing c-Myc. (n=6, *p<0.05 versus empty vector,
#p<0.05 versus c-Myc OE). FIG. 8J depicts ATP content in C2C12
cells overexpressing c-Myc. (n=6, *p<0.05 versus empty vector,
#p<0.05 versus c-Myc OE). FIG. 8K depicts TFAM promoter activity
in control or HIF-1.alpha. DPA C2C12 cells treated with adenovirus
overexpressing SIRT1 or empty vector (n=6, *p<0.05 versus empty
vector #p<0.05 versus SIRT1 OE). FIG. 8L depicts TFAM promoter
activity in C2C12 cells infected with HIF-1.alpha. or nontargeting
shRNA treated with EX-527 and c-Myc siRNA (n=6, *p<0.05 versus
DMSO, #p<0.05 versus Ex-527, +*p<0.05 versus HIF-1.alpha.
KD). Values are expressed as mean.+-.SEM.
[0047] FIGS. 9A-9I show caloric restriction protects from
age-related mitochondrial dysfunction in skeletal muscle by
preventing HIF-1.alpha. stabilization and loss of
mitochondrial-encoded ETC genes. FIG. 9A depicts NAD.sup.+ levels
in gastrocnemius of 6- and 22-month AL and 22-month old CR mice
(n=5, *p<0.05 versus 6-month-old animals #p<0.05 versus
22-month-old AL mice).
[0048] FIG. 9B depicts mitochondrial membrane potential of isolated
mitochondria from skeletal muscle of 6- and 22-month AL and
22-month old CR mice (n=5, *p<0.05 versus 6-month-old animals
#p<0.05 versus 22-month-old AL mice). FIG. 9C depicts ATP
content in skeletal muscle of 6- and 22-month AL and 22-month old
CR mice (n=5, *p<0.05 versus 6 month old animals #p<0.05
versus 22 month old AL mice). FIG. 9D depicts Cytochrome c Oxidase
Activity (Cox) activity in skeletal muscle of 6- and 22-month AL
and 22-month old CR mice (n=4, *p<0.05 versus 6-month-old
animals #p<0.05 versus 22-month-old AL mice). FIG. 9E depicts
mitochondrial DNA content analyzed by qPCR in gastrocnemius of 6-
and 22-month AL and 22-month old CR mice. Relative amount was
normalized to 6-month-old mice (n=5, *p<0.05 versus 6-month-old
animals #p<0.05 versus 22-month-old AL mice). FIG. 9F depicts
ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in gastrocnemius of
6- and 22-month AL and 22-month old CR mice. Relative expression
values were normalized to 6-month-old mice (n=5, *p<0.05 versus
6-month-old animals #p<0.05 versus 22-month-old AL mice). FIG.
9G depicts representative immunoblot for COX2, COX4, and tubulin in
gastrocnemius of 22-month-old AL and CR mice. FIG. 9H depicts
representative immunoblot for HIF1.alpha., and tubulin in
gastrocnemius of 6- and 22-month AL and 22-month old CR mice. FIG.
9I depicts PGK-1, Glut1, PKD1, and VEGFa mRNA analyzed by qPCR in
gastrocnemius o6- and 22-month AL and 22-month old CR mice.
Relative expression values were normalized to 6-month-old mice.
(n=5, *p<0.05 versus 6-month-old animals #p<0.05 versus
22-month-old AL mice). Values are expressed as mean.+-.SEM.
[0049] FIGS. 10A-10J show increasing NAD+ rescues age-related
mitochondrial dysfunction and genome asynchrony in skeletal muscle
through a SIRT1-HIF-1.alpha. pathway. FIG. 10A depicts NAD.sup.+
levels in gastrocnemius of 3- and 24-month-old mice treated with
either the vehicle (PBS) or NMN (n=5, *p<0.05 versus 3-month-old
PBS animals, #p<0.05 versus 24-month-old PBS animals). FIG. 10B
depicts mitochondrial membrane potential of isolated mitochondria
from skeletal muscle of 3- and 24-month-old mice treated with
either the vehicle (PBS) or NMN (n=4, *p<0.05 versus 3-month-old
PBS animals, #p<0.05 versus 24-months-old PBS animals). FIG. 10C
depicts ATP content in skeletal muscle of 3- and 24-month-old mice
treated with either the vehicle (PBS) or NMN (n=5, *p<0.05
versus 3-month-old PBS animals, #p<0.05 versus 24-month-old PBS
animals). FIG. 10D depicts Cytochrome c Oxidase (Cox) activity in
skeletal muscle of 3- and 24-month-old mice treated with either the
vehicle (PBS) or NMN (n=4, *p<0.05 versus 3-month-old animals,
#p<0.05 versus 24-month-old PBS animals). FIG. 10E depicts
representative immunoblot for HIF1.alpha., and tubulin in
gastrocnemius of 3- and 24-month-old mice treated with either the
vehicle (PBS) or NMN. FIG. 10F depicts PGK-1, Glut1, PKD1, and
VEGFa mRNA analyzed by qPCR in gastrocnemius of 3- and 24-month-old
mice treated with either the vehicle (PBS) or NMN. Relative
expression values were normalized to 3 month old PBS animals. (n=5,
*p<0.05 versus 3-month-old PBS animals, #p<0.05 versus
24-month-old PBS animals). FIG. 10G depicts ND1, CYTB, COX1 and
ATP6 mRNA analyzed by qPCR in PGC-1.alpha./.beta. KO myotubes
treated with PBS or NMN as well as treatment with DMSO or with DMOG
or DFO. Relative expression values were normalized to PBS treated
cells. (n=6, *p<0.05 versus PBS, #p<0.05 versus NMN). FIG.
10H depicts ND1, CYTB, COX1 and ATP6 mRNA analyzed by qPCR in
gastrocnemius of WT and SIRT1 KO mice treated with either the
vehicle (PBS) or NMN (n=4, *p<0.05 versus WT untreated animals).
FIG. 10I depicts mitochondrial membrane potential of isolated
mitochondria from skeletal muscle of WT and SIRT1 KO mice treated
with either the vehicle (PBS) or NMN (n=4, *p<0.05 versus WT PBS
animals). FIG. 10J depicts a model for age-related mitochondrial
dysfunction caused by genome asynchrony. A decline in NAD.sup.+
with age leads to HIF-1.alpha.-mediated inhibition of
nuclear-mitochondrial communication and a deficiency of
mitochondrially-encoded electron transport chain (ETC) subunits.
Values are expressed as mean.+-.SEM.
[0050] FIGS. 11A-11K reveal that aging leads to a specific decline
in mitochondrial-encoded genes and impairment in mitochondrial
homeostasis through decline in nuclear NAD.sup.+ levels. FIG. 11A
depicts ATP content from gastrocnemius of 6-, 22-, and 30-month-old
mice (n=5, *p<0.05 versus 6-month-old animals). FIG. 11B depicts
mitochondrial DNA content analyzed by qPCR in gastrocnemius of 6-,
22-, and 30-month-old mice. Relative amount was normalized to
6-month-old mice (n=5). FIG. 11C depicts mitochondrial DNA
integrity in gastrocnemius of 6-, 22-, and 30-month-old mice.
Relative amount was normalized to 6-month-old mice (n=5, *p<0.05
versus 6-month-old animals). FIG. 11D depicts expression of nuclear
(NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus mitochondrial-encoded
genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in gastrocnemius of
6-, 22-, and 30-month-old mice. Relative expression values were
normalized to 6-month-old mice (n=5, *p<0.05 versus 6-month-old
animals). FIG. 11E depicts a representative immunoblot for COX2 and
COX4 in gastrocnemius of 6-, 22-, and 30-month-old mice. FIG. 11F
depicts NAD.sup.+ levels in gastrocnemius of 6-, 22-, and
30-month-old mice (n=5, *p<0.05 versus 6-month-old animals).
FIG. 11G depicts expression of nuclear (NDUFS8, SDHb, Uqcrc1,
COX5b, ATP5a1) versus mitochondrial-encoded genes (ND1, Cytb, COX1,
ATP6) analysed by qPCR in primary myoblasts WT cells infected with
NMNAT1 or nontargeting shRNA. Relative amount was normalized to
control cells (n=4, *p<0.05 versus control). FIG. 11H depicts
expression of nuclear (NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus
mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by
qPCR in primary myoblasts WT cells infected with NMNAT2 or
nontargeting shRNA. Relative amount was normalized to control cells
(n=4, *p<0.05 versus control). FIG. 11I depicts expression of
nuclear (NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus
mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by
qPCR in primary myoblasts WT cells infected with NMNAT3 or
nontargeting shRNA. Relative amount was normalized to control cells
(n=4, *p<0.05 versus control). FIG. 11J depicts mitochondrial
DNA content analyzed by qPCR in primary myoblasts WT cells infected
with NMNAT1 or nontargeting shRNA. Relative amount was normalized
to control cells (n=4, *p<0.05 versus control). FIG. 11K depicts
ATP content in primary myoblasts WT cells infected with NMNAT1 or
nontargeting shRNA. Relative amount was normalized to control cells
(n=4, *p<0.05 versus control). Values are expressed as
mean.+-.SEM.
[0051] FIGS. 12A-121 reveal that loss of SIRT1 resembles the
specific decrease in the expression of mitochondrial-encoded genes
that occurs with aging and resulting in disruption mitochondrial
metabolism and impaired muscle health. FIG. 12A depicts ATP content
from gastrocnemius of WT and SIRT1 KO mice (n=5). FIG. 12B depicts
mitochondrial DNA content analyzed by qPCR in gastrocnemius of WT
and SIRT1 KO mice Relative amount was normalized to WT mice (n=5).
FIG. 12C depicts electronic microscopy analysis of gastrocnemius
from WT and SIRT1 KO mice and the respective mitochondrial area
quantification (n=4). FIG. 12D depicts expression of nuclear
(NDUFS8, NDUFAS, SDHb, SDHd, Uqcrc1, Uqcrc2, COX5b, Cox6a1, ATP5a1,
ATPc1) versus mitochondrial-encoded genes (ND1, ND2, ND3, ND4,
ND4l, ND5, ND6, Cytb, COX1, COX2, COX3, ATP6 and ATP8) analyzed by
qPCR in gastrocnemius of WT and SIRT1 KO mice. Relative expression
values were normalized to WT mice (n=5). FIG. 12E depicts a
representative immunoblot for COX2 and COX4 in gastrocnemius of WT
and SIRT1 KO mice. FIG. 12F depicts expression of
mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by
qPCR in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with
vehicle, or OHT to induce SIRT1 excision infected with NMNAT1 or
nontargeting shRNA. Relative amount was normalized to control cells
(n=4, *p<0.05 versus control). FIG. 12G depicts representative
immunoblot for MyHCHIIa, MyHCIIb and Tubulin in gastrocnemius of WT
and SIRT1 KO mice. FIG. 12H depicts a representative immunoblot for
Atrogin-1, MuRF1 and Tubulin in gastrocnemius of WT and SIRT1 KO
mice. FIG. 12I depicts a representative immunoblot for p-AKT, Total
AKT, p-IRS-1 and Total IRS-1 in soleus of WT and SIRT1 KO mice
under basal conditions and upon insulin stimulation. Values are
expressed as mean.+-.SEM (*p<0.05 versus WT animals).
[0052] FIGS. 13A-13M reveal that SIRT1 regulates mitochondrial
homeostasis through energy sensitive PGC-1.alpha.-dependent and
-independent mechanisms. FIG. 13A depicts expression of nuclear
(NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus mitochondrial-encoded
genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in WT and
PGC-1.alpha./.beta. knockout myotubes treated with adenovirus
overexpressing SIRT1 or empty vector. Relative expression values
were normalized to WT control cells (n=4 experiments). FIG. 13B
depicts expression of nuclear (NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1)
versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed
by qPCR in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with
vehicle, or OHT to induce SIRT1 excision for 6, 12, 24 and 48
hours. Relative expression values were normalized to control cells
(n=4). FIG. 13C depicts mitochondrial mass measured by staining of
the cells with NAO in SIRT1 flox/flox Cre-ERT2 primary myoblasts
treated with vehicle, or OHT to induce SIRT1 excision for 6, 12, 24
and 48 hours. FIG. 13D depicts a representative immunoblot for
p-AMPK (Thr172) and AMPK in SIRT1 flox/flox Cre-ERT2 primary
myoblasts treated with vehicle, or OHT to induce SIRT1 excision for
6, 12, 24 and 48 hours. FIG. 13E depicts expression of nuclear
(NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus mitochondrial-encoded
genes (ND1, Cytb, COX1, ATP6) analysed by qPCR in
PGC-1.alpha./.beta. knockout myotubes infected with adenovirus
expressing a flag-PGC-1.alpha. WT, PGC-1.alpha. T177A/S538A mutant
or empty and treated with vehicle (DMSO) or EX-527 for 48 h.
Relative expression values were normalized to control cells (n=4).
FIG. 13F depicts a representative immunoblot for p-ACC (Ser79) and
ACC in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with
vehicle, or OHT to induce SIRT1 excision for 48 h and infected with
empty or AMPK-DN adenovirus for the same period of time. FIG. 13G
depicts expression of nuclear (NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1)
versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed
by qPCR in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with
vehicle, or OHT to induce SIRT1 excision for 48 h and infected with
empty or AMPK-DN adenovirus for the same period of time. Relative
expression values were normalized to control cells (n=4). FIG. 13H
depicts TFAM mRNA analyzed by qPCR in gastrocnemius of WT and SIRT1
KO animals. Relative expression values were normalized to WT mice
(n=5, *p<0.05 versus WT). FIG. 13I depicts TFAM promoter
activity measured by luciferase assay in primary myoblasts
extracted from WT and SIRT1 KO mice. Relative luciferase values
were normalized to WT cells (n=6, *p<0.05 versus control). FIG.
13J depicts a representative immunoblot for SIRT1, TFAM ant Tubulin
in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with vehicle,
or OHT to induce SIRT1 excision for 24 h after which the cells were
added back TFAM by infection with a TFAM adenovirus, or for 48 h
hours and infected with empty or TFAM adenovirus for the same
period of time. FIG. 13K depicts expression of nuclear (NDUFS8,
SDHb, Uqcrc1, COX5b, ATP5a1) versus mitochondrial-encoded genes
(ND1, Cytb, COX1, ATP6) analysed by qPCR in SIRT1 flox/flox
Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce
SIRT1 excision for 24 h after which the cells were added back TFAM
by infection with a TFAM adenovirus, or for 48 h hours and infected
with empty or TFAM adenovirus for the same period of time. Relative
expression values were normalized to control cells (n=4). FIG. 13L
depicts ATP content in SIRT1 flox/flox Cre-ERT2 primary myoblasts
treated with vehicle, or OHT to induce SIRT1 excision for 24 h
after which the cells were added back TFAM by infection with a TFAM
adenovirus, or for 48 h hours and infected with empty or TFAM
adenovirus for the same period of time (n=4). FIG. 13M depicts a
representative immunoblot for p-AMPK (Thr172) and AMPK in SIRT1
flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT
to induce SIRT1 excision for 24 h after which the cells were added
back TFAM by infection with a TFAM adenovirus, or for 48 h hours
and infected with empty or TFAM adenovirus for the same period of
time.
[0053] FIGS. 14A-14N reveal that loss of SIRT1 induces a
psedohypoxic state that disrupts mitochondrial-encoded genes and
mitochondrial homeostasis. FIG. 14A depicts HK2, PKM, and PFKM mRNA
analyzed by qPCR in gastrocnemius of WT and SIRT1 KO mice. Relative
expression values were normalized to WT mice (n=5, *p<0.05
versus WT). FIG. 14B depicts LDHA mRNA analyzed by qPCR in
gastrocnemius of WT and SIRT1 KO mice. Relative expression values
were normalized to WT mice (n=5, *p<0.05 versus WT). FIG. 14C
depicts lactate levels measured in gastrocnemius of WT and SIRT1 KO
mice (n=5, *p<0.05 versus WT). FIG. 14D depicts a representative
immunoblot for HIF-1.alpha. and Tubulin in gastrocnemius of WT and
SIRT1 KO mice and in SIRT1 flox/flox Cre-ERT2 primary myoblasts
treated with vehicle, or OHT to induce SIRT1 excision for 24 h.
FIG. 14E depicts a representative immunoblot for HIF-1.alpha. and
Tubulin in gastrocnemius of WT and Egln1 KO mice. FIG. 14F depicts
expression of nuclear (NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus
mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analysed by
qPCR in gastrocnemius of WT and Egln1 KO mice (n=5). FIG. 14G
depicts mitochondrial DNA content analyzed by qPCR in gastrocnemius
of WT and Egln1 KO mice. Relative amount was normalized to WT mice
(n=5). FIG. 14H depicts expression of mitochondrial-encoded genes
(ND1, Cytb, COX1 and ATP6) analyzed by qPCR in PGC-1.alpha./.beta.
KO myotubes treated with adenovirus overexpressing SIRT1 or empty
vector as well as treatment with DMSO or with HIF stabilizing
compound DMOG. Relative expression values were normalized to
control cells (n=4). FIG. 14I depicts a representative immunoblot
for HA-tag and tubulin in control C2C12 cells and cells
overexpressing either HIF-1.alpha. or HIF-2.alpha. with the proline
residues mutated (HIF-1.alpha. DPA; HIF-2.alpha. DPA). FIG. 14J
depicts expression of nuclear (NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1)
versus mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analyzed
by qPCR in control, HIF-1.alpha. DPA or HIF-2.alpha. DPA C2C12
cells. Relative expression values were normalized to control cells
(n=6, *p<0.05 versus empty vector). FIG. 14K depicts expression
of mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) analyzed
by qPCR in control, HIF-1.alpha. DPA or HIF-2.alpha. DPA C2C12
cells treated with adenovirus overexpressing SIRT1 or empty vector.
Relative expression values were normalized to control cells (n=4).
FIG. 14L depicts a representative immunoblot for HIF-1.alpha. and
Tubulin in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with
vehicle, or OHT to induce SIRT1 excision infected with HIF-1.alpha.
or nontargeting shRNA and DMOG to promote HIF-1.alpha.
stabilization. FIG. 14M depicts mitochondrial DNA content analyzed
by qPCR in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with
vehicle, or OHT to induce SIRT1 excision infected with HIF-1.alpha.
or nontargeting shRNA. Relative amount was normalized to control
cells (n=4). FIG. 14N depicts ATP content in gastrocnemius of in
SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or
OHT to induce SIRT1 excision infected with HIF-1.alpha. or
nontargeting shRNA. Relative amount was normalized to control cells
(n=5). Values are expressed as mean.+-.SEM.
[0054] FIGS. 15A-15N reveal that SIRT1 regulates HIF-1.alpha.
stabilization in the skeletal muscle through regulation of VHL
expression. FIG. 15A depicts a representative immunoblot for VHL
and Tubulin in gastrocnemius of WT and SIRT1 KO mice. FIG. 15B
depicts a representative immunoblot for VHL and Tubulin is
gastrocnemius of WT and SIRT1-Tg overexpressing mice. FIG. 15C
depicts VHL mRNA analyzed by qPCR in gastrocnemius of WT and SIRT1
KO mice. Relative expression values were normalized to control WT
mice (n=5). FIG. 15D depicts VHL mRNA analyzed by qPCR in
gastrocnemius of WT and SIRT1-Tg mice. Relative expression values
were normalized to control WT mice (n=5). FIG. 15E depicts VHL
promoter activity measured by luciferase assay in SIRT1 flox/flox
Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24 h to
induce SIRT1 excision. Relative luciferase values were normalized
to vehicle. Relative luciferase values were normalized to control
cells (n=5, *p<0.05 versus control). FIG. 15F depicts VHL
promoter activity measured by luciferase assay in primary myoblasts
infected with adenovirus expressing SIRT1 or empty vector. Relative
luciferase values were normalized to empty vector (n=5, *p<0.05
versus control). FIG. 15G depicts a representative immunoblot for
VHL, HIF-1.alpha. and Tubulin in primary myoblasts WT cells
infected with NMNAT1 or nontargeting shRNA. FIG. 15H depicts VHL
mRNA analyzed by qPCR in primary WT myoblasts infected with NMNAT1
or nontargeting shRNA. Relative expression values were normalized
to control cells (n=4). FIG. 15I depicts a representative
immunoblot for VHL, HIF-1.alpha. and Tubulin in gastrocnemius of
6-, 22-, and 30-month-old mice. FIG. 15J depicts a representative
immunoblot for VHL, HIF-1.alpha., TFAM and Tubulin in SIRT1
flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT
to induce SIRT1 excision for 6, 12, 24 hours and in cells treated
with OHT for 24 h after which SIRT1 was added back by infection
with an adenovirus. FIG. 15K depicts a representative immunoblot
for VHL and Tubulin in SIRT1 flox/flox Cre-ERT2 primary myoblasts
infected with VHL or nontargeting shRNA. FIG. 15L depicts a
representative immunoblot for VHL and Tubulin in SIRT1 flox/flox
Cre-ERT2 primary myoblasts infected with VHL or nontargeting shRNA
and treated with OHT for 24 h after which SIRT1 was added back by
infection with an adenovirus. FIG. 15M depicts TFAM promoter
activity measured by luciferase assay in SIRT1 flox/flox Cre-ERT2
primary myoblasts infected with VHL or nontargeting shRNA and
treated with OHT for 24 h after which SIRT1 was added back by
infection with an adenovirus. Relative luciferase values were
normalized to control cells (n=4). FIG. 15N depicts expression of
mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) analyzed by
qPCR in primary WT myoblasts infected with VHL or nontargeting
shRNA and treated with adenovirus expressing SIRT1 or empty vector.
Relative expression values were normalized to control cells (n=5).
Values are expressed as mean.+-.SEM.
[0055] FIGS. 16A-16L reveal that HIF-1.alpha. regulates
mitochondrial homeostasis by modulation of TFAM promoter through
c-Myc in response to changes in SIRT1 activity. FIG. 16A depicts
c-Myc activity in SIRT1 flox/flox Cre-ERT2 primary myoblasts and
treated with vehicle, or OHT to induce SIRT1 excision for 6, 12, 24
hours. Relative luciferase values were normalized to control cells
(n=4). FIG. 16B depicts a representative immunoblot for c-Myc and
tubulin in C2C12 cells infected with c-Myc or nontargeting shRNA.
FIG. 16C depicts mitochondrial DNA content analyzed by qPCR in
C2C12 cells infected with c-Myc or nontargeting shRNA and treated
with adenovirus overexpressing SIRT1 or empty vector. Relative
amount was normalized to control cells (n=5, *p<0.05 versus
empty vector, #p<0.05 versus SIRT1 OE). FIG. 16D depicts ND1,
Cytb, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells infected
with c-Myc or nontargeting shRNA and treated with adenovirus
overexpressing SIRT1 or empty vector. Relative expression values
were normalized to control cells (n=6, *p<0.05 versus empty
vector, #p<0.05 versus SIRT1 UE). FIG. 16E depicts TFAM promoter
activity measured by luciferase assay in primary WT myoblasts
infected with c-Myc or nontargeting shRNA. Relative luciferase
values were normalized to control cells (n=4). FIG. 16F depicts
TFAM promoter activity full length or c-Myc consensus sequence
mutation measured by luciferase assay in primary WT myoblasts
infected with c-Myc or empty vector. Relative luciferase values
were normalized to control cells (n=4). FIG. 16G depicts TFAM
promoter activity full length or c-Myc consensus sequence mutation
measured by luciferase assay in primary WT myoblasts infected with
adenovirus expressing PGC-1.alpha. or empty vector. Relative
luciferase values were normalized to control cells (n=4). FIG. 16H
depicts TFAM promoter activity full length or c-Myc consensus
sequence mutation measured by luciferase assay in primary WT
myoblasts infected with adenovirus expressing SIRT1 or empty
vector. Relative luciferase values were normalized to control cells
(n=4). FIGS. 16I and 16J depict chromatin immunoprecipitation (FIG.
16I) and respective quantification by qPCR (FIG. 16J) of c-Myc and
HIF-1.alpha. to the TFAM promoter in SIRT1 flox/flox Cre-ERT2
primary myoblasts treated with vehicle, or OHT to induce SIRT1
excision for 24 hours. FIG. 16K depicts chromatin
immunoprecipitation of c-Myc to the TFAM promoter in SIRT1
flox/flox Cre-ERT2 primary myoblasts treated with vehicle, or OHT
to induce SIRT1 excision for 24 hours infected with HIF-1.alpha. or
nontargeting shRNA. FIG. 16L depicts TFAM promoter activity
measured by luciferase assay in SIRT1 flox/flox Cre-ERT2 primary
myoblasts treated with vehicle, or OHT to induce SIRT1 excision for
24 hours infected with HIF-1.alpha. or nontargeting shRNA. Relative
luciferase values were normalized to control cells (n=4). Values
are expressed as mean.+-.SEM.
[0056] FIGS. 17A-17L reveal that increasing NAD.sup.+ levels
rescues age-related mitochondrial and muscle dysfunction through a
SIRT1-HIF-1.alpha. pathway. FIG. 17A depicts NAD.sup.+ levels in
gastrocnemius of 3- and 24-month-old mice treated with either the
vehicle (PBS) or NMN (n=5, *p<0.05 versus 3-month-old PBS
animals, #p<0.05 versus 24-month-old PBS animals). FIG. 17B
depicts ATP content in gastrocnemius of 6- and 22-month-old mice
treated with either the vehicle (PBS) or NMN (n=6). FIG. 17C
depicts expression of mitochondrial-encoded genes (ND1, Cytb, COX1
and ATP6) analyzed by qPCR in gastrocnemius of 6- and 22-month-old
mice treated with either the vehicle (PBS) or NMN. Relative
expression values were normalized to 6-months old PBS mice (n=6).
FIG. 17D depicts a representative immunoblot for VHL, HIF-1.alpha.
and Tubulin in gastrocnemius of 6- and 22-month-old mice treated
with either the vehicle (PBS) or NMN. FIG. HE depicts lactate
levels in gastrocnemius of 6- and 22-month-old mice treated with
either the vehicle (PBS) or NMN (n=6). FIG. 17F depicts expression
of mitochondrial-encoded genes (ND1, Cytb, COX1 and ATP6) analyzed
by qPCR in gastrocnemius of WT and Egln1 KO mice treated with
either the vehicle (PBS) or NMN. Relative expression values were
normalized to WT PBS mice (n=5). Egln1 encodes the HIF-1
prolylhydroxylase that targets HIF-1 for degradation. FIG. 17G
depicts ATP content in gastrocnemius of WT and Egln1 KO mice
treated with either the vehicle (PBS) or NMN (n=5). FIG. 17H
depicts expression of mitochondrial-enoded genes (ND1, Cytb, COX1
and ATP6) analyzed by qPCR in primary myoblasts WT cells infected
with NMNAT1 or nontargeting shRNA treated with either the vehicle
(PBS) or NMN. Relative expression values were normalized to control
cells (n=4). FIG. 17I depicts expression of mitochondrial-encoded
genes (ND1, Cytb, COX1 and ATP6) analyzed by qPCR in gastrocnemius
of WT and SIRT1 KO mice treated with either the vehicle (PBS) or
NMN. Relative expression values were normalized to WT PBS mice
(n=4). FIG. 17J depicts a representative immunoblot for Atrogin-2,
MuRF1 and Tubulin in gastrocnemius of 6- and 22-month-old mice
treated with either the vehicle (PBS) or NMN. FIG. 17K depicts a
representative immunoblot for p-AKT, AKT, p-IRS-1, IRS-1in
gastrocnemius of 6- and 22-month-old mice treated with either the
vehicle (PBS) or NMN. FIG. 17L depicts a schematic which reveals
that the decline in nuclear NAD during aging elicits a biphasic
response mediated by SIRT1 to regulate mitochondrial homeostasis.
In normal energy supply condition SIRT1 regulates specifically
mitochondrial-encoded genes trough regulation of the TFAM promoter
by regulating HIF-1.alpha. stabilization and c-Myc activity. Under
conditions of low energy supply, like fasting or prolonged OXPHOS
inhibition, SIRT1 regulates mitochondrial biogenesis through
deacetylation of PGC-1.alpha.. Values are expressed as
mean.+-.SEM.
[0057] FIGS. 18A-18G provide additional data related to the content
of FIGS. 11A-11K. FIG. 18A depicts a representative immunoblot for
NMNAT1 and Tubulin in primary myoblasts WT cells infected with
NMNAT1 or nontargeting shRNA. Relative amount was normalized to
control cells. FIG. 18B depicts a representative immunoblot for
NMNAT2 and Tubulin in primary myoblasts WT cells infected with
NMNAT2 or nontargeting shRNA. Relative amount was normalized to
control cells. FIG. 18C depicts a representative immunoblot for
NMNAT3 and Tubulin in primary myoblasts WT cells infected with
NMNAT3 or nontargeting shRNA. Relative amount was normalized to
control cells. FIG. 18D depicts ATP content in primary myoblasts WT
cells infected with NMNAT2 or nontargeting shRNA (n=4). FIG. 18E
depicts ATP content in primary myoblasts WT cells infected with
NMNAT3 or nontargeting shRNA (n=4). FIG. 18F depicts SIRT1 mRNA
analyzed by qPCR in gastrocnemius of 6-, 22-, and 30-month-old
mice. Relative expression values were normalized to 6-month-old
mice (n=5, *p<0.05 versus 6-month-old animals). FIG. 18G depicts
a representative immunoblot for SIRT1 and tubulin in gastrocnemius
of 6-, 22-, and 30-month-old mice. Values are expressed as
mean.+-.SEM.
[0058] FIGS. 19A-19H provide additional data related to the content
of FIGS. 12A-12I. FIG. 19A depicts Cytochrome c Oxidase (COX)
activity in gastrocnemius of WT and SIRT1 KO mice (n=5). FIG. 19B
depicts Succinate Dehydrogenase (SDH) activity in gastrocnemius of
WT and SIRT1 KO mice (n=5). FIG. 19C depicts mitochondrial
ribosomal rRNA expression analyzed by qPCR in gastrocnemius of WT
and SIRT1 KO mice. Relative expression values were normalized to WT
mice (n=5). FIG. 19D depicts expression of nuclear (NDUFS8, SDHb,
Uqcrc1, COX5b, ATP5a1) versus mitochondrial-encoded genes (ND1,
Cytb, COX1, ATP6) analyzed by qPCR in liver of WT and SIRT1 KO
mice. Relative expression values were normalized to WT mice (n=4,
*p<0.05 versus control). FIG. 19E depicts expression of nuclear
(NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus mitochondrial-encoded
genes (ND1, Cytb, COX1, ATP6) analyzed by qPCR in white adipose
tissue of WT and SIRT1 KO mice. Relative expression values were
normalized to WT mice (n=5). FIG. 19F depicts expression of nuclear
(NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus mitochondrial-encoded
genes (ND1, Cytb, COX1, ATP6) analyzed by qPCR in brain of WT and
SIRT1 KO mice. Relative expression values were normalized to WT
mice (n=5). FIG. 19G depicts expression of nuclear (NDUFS8, SDHb,
Uqcrc1, COX5b, ATP5a1) versus mitochondrial-encoded genes (ND1,
Cytb, COX1, ATP6) analyzed by qPCR in heart of WT and SIRT1 KO
mice. Relative expression values were normalized to WT mice (n=5).
FIG. 19H depicts expression of inflammatory markers (TNF-.alpha.,
IL-6, IL-18 and Nlrp3) analyzed by qPCR in gastrocnemius of WT and
SIRT1 KO mice. Relative expression values were normalized to WT
mice (n=5). Values are expressed as mean.+-.SEM.
[0059] FIGS. 20A-20K provide additional data related to the content
of FIGS. 13A-13M. FIG. 20A depicts expression of nuclear (NDUFS8,
SDHb, Uqcrc1, COX5b, ATP5a1) versus mitochondrial-encoded genes
(ND1, Cytb, COX1, ATP6) analyzed by qPCR in gastrocnemius of WT and
SIRT1 KO mice under fed and fasted conditions. Relative expression
values were normalized to WT Fed mice (n=5). FIG. 20B depicts
mitochondrial DNA content analyzed by qPCR in SIRT1 flox/flox
Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce
SIRT1 excision for 6, 12, 24 and 48 hours. Relative amount was
normalized to control cells (n=5). FIG. 20C depicts mitochondrial
membrane potential analyzed by TMRM fluorescence in SIRT1 flox/flox
Cre-ERT2 primary myoblasts treated with vehicle, or OHT to induce
SIRT1 excision for 6, 12, 24 and 48 hours (n=5). FIG. 20D depicts a
representative immunoblot for Flag and Tubulin in
PGC-1.alpha./.beta. knockout myotubes infected with adenovirus
expressing a flag-PGC-1.alpha. WT, PGC-1.alpha. T177A/S538A mutant
or empty vector. FIG. 20E depicts a representative immunoblot for
p-AMPK (Thr172) and AMPK in gastrocnemius of WT and SIRT1 KO mice
under fed and fasted conditions. FIG. 20F depicts a representative
immunoblot for p-AMPK (Thr172) and AMPK in gastrocnemius of 6- and
22-months-old mice. FIG. 20G depicts PGC-1.alpha., PGC-1.beta.,
NRF-1, NRF-2m TFB1M, TFB2M, POLMRT and Twinkle expression in
gastrocnemius of WT and SIRT1 KO mice. Relative expression values
were normalized to WT mice (n=5). FIG. 20H depicts a representative
immunoblot for TFAm and Tubulin in primary WT myoblasts infected
with adenovirus expressing TFAM or empty vector. FIG. 20I depicts
expression of nuclear (NDUFS8, SDHb, Uqcrc1, COX5b, ATP5a1) versus
mitochondrial-encoded genes (ND1, Cytb, COX1, ATP6) analyzed by
qPCR in primary WT myoblasts infected with adenovirus expressing
TFAM or empty vector. Relative expression values were normalized to
control cells (n=4). FIG. 20J depicts mitochondrial DNA content
analyzed by qPCR in primary WT myoblasts infected with adenovirus
expressing TFAM or empty vector. Relative amount was normalized to
control cells (n=4). FIG. 20K depicts ATP content in primary WT
myoblasts infected with adenovirus expressing TFAM or empty vector
(n=4). Values are expressed as mean.+-.SEM.
[0060] FIGS. 21A-21N provide additional data related to the content
of FIGS. 14A-14N. FIG. 21A depicts HIF-1.alpha. target genes
(PGK-1, Glut1, PDK1 and Vegfa) expression in gastrocnemius of WT
and SIRT1 KO mice. Relative expression values were normalized to WT
mice (n=5). FIG. 21B depicts hypoxia response element activity in
primary myoblasts isolated from WT and SIRT1 KO mice and treated
with or without DMOG. Relative luciferase activity was normalized
to WT cells (n=6, *p<0.05 versus WT). FIG. 21C depicts a
representative immunoblot of HIF-1.alpha. and Tubulin in
PGC-1.alpha./.beta. KO myotubes treated with adenovirus
overexpressing SIRT1 or empty vector as well as treatment with DMSO
or with HIF stabilizing compound DMOG. FIG. 21D depicts NAD+/NADH
ration measured in primary WT myoblasts treated with either 10 mM
pyruvate, 10 mM lactate or vehicle for 24 h (n=4). FIG. 21E depicts
a representative immunoblot of HIF-1.alpha. and Tubulin in primary
WT myoblasts treated with 10 mM pyruvate, 10 mM lactate or vehicle
for 24 h. FIG. 21F depicts expression of mitochondrial-encoded
genes (ND1, Cytb, COX1 and ATP6) in PGC-1.alpha./.beta. KO myotubes
treated with 10 mM pyruvate, 10 mM lactate or vehicle for 24 h in
the presence or absence of DMOG. Relative expression values were
normalized to control cells (n=4). FIG. 21G depicts a
representative immunoblot for SIRT1, HIF-1.alpha. and Tubulin in
gastrocnemius of WT and SIRT1-tg mice treated with vehicle (PBS) or
DMOG. FIG. 21H depicts expression of mitochondrial-encoded genes
(ND1, Cytb, COX1 and ATP6) in gastrocnemius of WT and SIRT1-tg mice
treated with vehicle (PBS) or DMOG. Relative expression values were
normalized to WT PBS mice (n=5). FIG. 21I depicts ATP content in
gastrocnemius of WT and SIRT1-tg mice treated with vehicle (PBS) or
DMOG (n=5). FIG. 21J depicts mitochondrial DNA content analyzed by
qPCR in control, HIF-1.alpha. DPA or HIF-2.alpha. DPA C2C12 cells
treated with adenovirus overexpressing SIRT1 or empty vector.
Relative amount was normalized to control cells (n=5, *p<0.05
versus empty vector, #p<0.05 versus SIRT1 OE). FIG. 21K depicts
ARNT mRNA analyzed by qPCR in C2C12 cells infected with ARNT or
nontargeting shRNA. Relative expression values were normalized to
control cells (n=4, *p<0.05 versus control). FIG. 21L depicts
mitochondrial DNA content analyzed by qPCR in C2C12 cells infected
with ARNT or nontargeting shRNA. Relative amount was normalized to
control cells (n=5, *p<0.05 versus control). FIG. 21M depicts
ND1, Cytb, COX1 and ATP6 mRNA analyzed by qPCR in C2C12 cells
infected with ARNT or nontargeting shRNA. Relative levels were
normalized to control cells (n=6, *p<0.05 versus control). FIG.
21N depicts ATP content in C2C12 cells infected with ARNT or
nontargeting shRNA. Relative expression values were normalized to
control cells (n=4, *p<0.05 versus control). Values are
expressed as mean.+-.SEM.
[0061] FIGS. 22A-22F provide additional data related to the content
of FIGS. 15A-15N. FIG. 22A depicts a representative immunoblot for
COX2, SIRT1, HIF1-.alpha., VHL, TFAM and Tubulin in parental or
rho0 cells derived from SIRT1 flox/flox Cre-ERT2 primary myoblasts
treated with vehicle, or OHT for 24 h to induce SIRT1 excision.
FIG. 22B depicts ROS levels, measured by DHE fluorescence
intensity, in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated
with vehicle, or OHT for 6, 12, 24 and 48 hours to induce SIRT1
excision. Relative expression values were normalized to control
cells (n=4). FIG. 22C depicts a representative immunoblot for HA
and Tubulin in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated
with vehicle, or OHT for 24 h to induce SIRT1 excision and infected
with HA-HIF-1.alpha., the Q and R mutants of the K709 and Q mutant
of K674. FIG. 22D depicts a representative immunoblot for
HIF-1.alpha.-OH, HIF-1.alpha. and Tubulin in SIRT1 flox/flox
Cre-ERT2 primary myoblasts treated with vehicle, or OHT for 24 h to
induce SIRT1 excision in the presence and absence of the proteasome
inhibitor, MG-132. FIG. 22E depicts a representative immunoblot for
HIF-2.alpha. and Tubulin in gastrocnemius of WT and SIRT1 KO mice
and in SIRT1 flox/flox Cre-ERT2 primary myoblasts treated with
vehicle, or OHT for 24 h to induce SIRT1 excision or treated with
DMOG to stabilize HIF.alpha.. FIG. 22F depicts HIF-2.alpha. target
genes (Epo, Cacna1.alpha., Angpt2 and Ptplz1) expression in
gastrocnemius of WT and SIRT1 KO mice. Relative expression values
were normalized to WT mice (n=5).
[0062] FIGS. 23A-23H provide additional data related to the content
of FIGS. 16A-16L. FIG. 23A depicts a representative immunoblot for
c-Myc and tubulin in C2C12 cells overexpressing c-Myc. FIG. 23B
depicts mitochondrial DNA content analyzed by qPCR in C2C12 cells
overexpressing c-Myc. Relative amount was normalized to control
cells (n=5, *p<0.05 versus empty vector, #p<0.05 versus c-Myc
OE). FIG. 23C depicts ND1, Cytb, COX1 and ATP6 mRNA analyzed by
qPCR in C2C12 cells overexpressing c-Myc. Relative expression
values were normalized to control cells (n=6, *p<0.05 versus
empty vector, #p<0.05 versus c-Myc OE). FIG. 23D depicts ATP
content in C2C12 cells overexpressing c-Myc. (n=6, *p<0.05
versus empty vector, #p<0.05 versus c-Myc OE). FIG. 23E depicts
TFAM promoter activity full length or c-Myc consensus sequence
mutation measured by luciferase assay in primary WT myoblasts
treated with vehicle (DMSO) or DMOG. Relative luciferase values
were normalized to control cells (n=4). FIG. 23F depicts TFAM
promoter activity full length or c-Myc consensus sequence mutation
measured by luciferase assay in SIRT1 flox/flox Cre-ERT2 primary
myoblasts treated with vehicle, or OHT for 24 h to induce SIRT1
excision. Relative luciferase values were normalized to control
cells (n=4). FIGS. 23G and 23H depict chromatin immunoprecipitation
(FIG. 23G) and respective quantification by qPCR (FIG. 23H) of
HIF-1.alpha. to the LDHA gene in SIRT1 flox/flox Cre-ERT2 primary
myoblasts treated with vehicle, or OHT to induce SIRT1 excision for
24 hours.
[0063] FIGS. 24A-24J provide additional data related to the content
of FIG. 17A-17L. FIG. 24A depicts NAD+ levels in gastrocnemius of
6- and 22-month AL and 22-month old CR mice (n=5, *p<0.05 versus
6-month-old animals #p<0.05 versus 22-month-old AL mice). FIG.
24B depicts ATP content in skeletal muscle of 6- and 22-month AL
and 22-month old CR mice (n=5, *p<0.05 versus 6 month old
animals #p<0.05 versus 22 month old AL mice). FIG. 24C depicts
Cytochrome c Oxidase Activity (Cox) activity in skeletal muscle of
6- and 22-month AL and 22-month old CR mice (n=4, *p<0.05 versus
6-month-old animals #p<0.05 versus 22-month-old AL mice). FIG.
24D depicts mitochondrial DNA content analyzed by qPCR in
gastrocnemius of 6- and 22-month AL and 22-month old CR mice.
Relative amount was normalized to 6-month-old mice (n=5, *p<0.05
versus 6-month-old animals #p<0.05 versus 22-month-old AL mice).
FIG. 24E depicts ND1, Cytb, COX1 and ATP6 mRNA analyzed by qPCR in
gastrocnemius of 6- and 22-month AL and 22-month old CR mice.
Relative expression values were normalized to 6-month-old mice
(n=5, *p<0.05 versus 6-month-old animals #p<0.05 versus
22-month-old AL mice). FIG. 24F depicts a representative immunoblot
for COX2, COX4, and tubulin in gastrocnemius of 22-month-old AL and
CR mice. FIG. 24G depicts a representative immunoblot for
HER1.alpha., and tubulin in gastrocnemius of 6- and 22-month AL and
22-month old CR mice. FIG. 24H depicts Cytochrome c Oxidase
Activity (Cox) activity in gastrocnemius of 3- and 24-month-old
mice treated with either the vehicle (PBS) or NMN (n=5, *p<0.05
versus 3-month-old PBS animals, #p<0.05 versus 24-month-old PBS
animals). FIG. 24I depicts mitochondrial DNA content in
gastrocnemius of 6- and 22-month-old mice treated with either the
vehicle (PBS) or NMN. Relative amount was normalized to
6-months-old PBS mice (n=6). FIG. 24J depicts expression of
inflammatory markers (TNF-.alpha., IL-6 and IL-18) in gastrocnemius
of 6- and 22-month-old mice treated with either the vehicle (PBS)
or NMN. Relative expression levels were normalized to 6-months-old
PBS mice (n=6).
[0064] FIG. 25 presents a schematic depicting the connection
between NAD+ levels and cancer.
[0065] FIGS. 26A-26K depict HIF-1alpha levels and shows that that
the downstream effects on metabolism promote cancer proliferation
via the Warburg effect. FIG. 26A reveals that HIF-1alpha is
regulated at the protein levels by prolylhydroxylation and
proteasome degradation. EGNL1=prolylhydroxylase of HIF-1,
hydroxylated form of HIF-1 is recognized by VHL, an E3 ubiquitin
ligase. FIG. 26B reveals that HIF-1alpha stabilization promotes
cancer by activating angiogenesis and cell survival gene expression
programs, and that HIF-1alpha stabilization promotes cell
proliferation by inducing a metabolic reprogramming, the Warburg
effect, diverting the carbons away from oxidation by the
mitochondrial electron transport chain (ETC) and promoting
glycolysis. FIG. 26C demonstrates NAD+ levels in gastrocnemius of
3- and 24-month-old mice treated with either the vehicle (PBS) or
NMN (n=5, *p<0.05 versus 3-month-old PBS animals, #p<0.05
versus 24-month-old PBS animals). FIG. 26D demonstrates ATP content
in gastrocnemius of 3- and 24-month-old mice treated with either
the vehicle (PBS) or NMN (n=6). FIG. 26E demonstrates expression of
mitochondrial-encoded ETC genes (ND1, Cytb, COX1 and ATP6) analyzed
by qPCR in gastrocnemius of 6- and 22-month-old mice treated with
either the vehicle (PBS) or NMN. Relative expression values were
normalized to 6-months old PBS mice (n=6). FIG. 26F demonstrates
representative immunoblot for VHL, HIF-1.alpha. and Tubulin in
gastrocnemius of 6- and 22-month-old mice treated with either the
vehicle (PBS) or NMN. FIG. 26G demonstrates expression of
HIF-1.alpha. target genes (PGK-1, Glut1, PDK1 and Vegfa) analyzed
by qPCR in gastrocnemius of 3- and 24-month-old mice treated with
either the vehicle (PBS) or NMN. Relative expression values were
normalized to 6-months old PBS mice (n=5). FIG. 26H demonstrates
lactate levels in gastrocnemius of 6- and 22-month-old mice treated
with either the vehicle (PBS) or NMN (n=6). FIG. 26I demonstrates
expression of mitochondrial-encoded genes (ND1, Cytb, COX1 and
ATP6) analyzed by qPCR in gastrocnemius of WT and Egln1 KO mice
treated with either the vehicle (PBS) or NMN. Relative expression
values were normalized to WT PBS mice (n=5). FIG. 26J demonstrates
ATP content in gastrocnemius of WT and Egln1 KO mice treated with
either the vehicle (PBS) or NMN (n=5). FIG. 26K demonstrates
expression of mitochondrial-encoded ETC genes (ND1, Cytb, COX1 and
ATP6) analyzed by qPCR in gastrocnemius of WT and SIRT1 KO mice
treated with either the vehicle (PBS) or NMN. Relative expression
values were normalized to WT PBS mice (n=4). NMN treatment
consisted of IP injections of 500 mg/kg/day for 7 consecutive days
in C57BL6J mice.
[0066] FIGS. 27A and 27B demonstrate that HIF-1alpha stabilization
and target genes are modulated by NAD biosynthesis (NMNAT-1 and
NAMPT). The NAD+ biosynthetic pathway in mammals is depicted. There
are 3 NMNAT paralogs--NMNAT-1 is the nuclear form. NMNAT-1, a
nuclear adenylyltransferase, converts NaMN and NMN to NAAD and
NAD+. FIG. 27C provides a representative immunoblot for NMNAT1 and
Tubulin in primary WT myoblasts infected with NMNAT1 or
nontargeting shRNA. FIG. 27D demonstrates that VHL is a
prolyhydroxylase that modified HIF-1 so it can be recognized by VHL
mRNA analyzed by qPCR in primary WT myoblasts infected with NMNAT1
or nontargeting shRNA. Relative expression values were normalized
to control cells (n=4). FIG. 27E demonstrates a representative
immunoblot for VHL, HIF-1.alpha. and Tubulin in primary myoblasts
WT cells infected with NMNAT-1 or nontargeting shRNA. FIG. 27F
demonstrates expression of HIF-1alpha target genes (PGK-1, Glut1,
PDK1 and Vegfa) analyzed by qPCR in primary WT myoblasts infected
with NMNAT1 or nontargeting shRNA. Relative expression values were
normalized to control cells (n=4). FIG. 27G demonstrates NAMPT mRNA
analyzed by qPCR in C2C12 myoblasts infected with NAMPT or
nontargeting shRNA. Relative expression values were normalized to
control cells (n=4). FIG. 27H demonstrates hypoxia response element
activity in C2C23 myoblasts infected with NAMPT or nontargeting
shRNA. Relative luciferase activity was normalized to control cells
(n=4). In some embodiments, NaMN, NMN and/or NR (nicotinamide
riboside) are used as a starting material to raise NAD+.
[0067] FIGS. 28A-28C demonstrate that caloric restriction, a known
intervention that suppresses most cancers, maintains NAD+ levels
and shows the same effects as NMN on VHL/HIF1. FIG. 28A
demonstrates NAD+ levels in gastrocnemius of 6- and 22-month AL and
22-month old CR mice (n=5, *p<0.05 versus 6-month-old animals
#p<0.05 versus 22-month-old AL mice). FIG. 28B demonstrates a
representative immunoblot for HIF1.alpha., and tubulin in
gastrocnemius of 6- and 22-month AL and 22-month old CR mice. FIG.
28C demonstrates HIF-1 gene targets, PGK-1, Glut1, PKD1, and VEGFa
mRNA analyzed by qPCR in gastrocnemius 6- and 22-month AL and
22-month old CR mice. Relative expression values were normalized to
6-month-old mice. (n=5, *p<0.05 versus 6-month-old animals
#p<0.05 versus 22-month-old AL mice).
DETAILED DESCRIPTION OF THE INVENTION
[0068] Disclosed herein are novel compositions and methods for the
treatment of age-related diseases, the treatment of mitochondrial
diseases, the improvement of stress resistance, the improvement of
resistance to hypoxia and the extension of life span. Also
described herein are methods for the identification of agents
useful in the foregoing methods.
[0069] As disclosed herein, the instant inventors discovered that
HIF-1.alpha. interacts with c-Myc to inhibit c-Myc activity, which
results in mitochondrial dysfunction during the aging process.
Agents that reduce HIF-1.alpha.'s ability to inhibit c-Myc,
including, for example, agents that inhibit the formation of a
complex between HIF-1.alpha. and c-Myc, convey beneficial effects
on metabolism and mitochondrial function in aging tissues. Such
agents can, for example, inhibit complex formation by targeting the
domain of HIF-1.alpha. that is required for formation of a complex
with c-Myc (e.g., amino acids 167-329 of the human HIF-1.alpha.
protein). Such agents may also, for example, prevent HIF-1.alpha.
from altering c-Myc activity, abundance and/or its localization
within the cell.
[0070] Thus, in certain embodiments, the instant invention relates
to compositions and/or methods for the treatment of age-related
diseases, the treatment of mitochondrial diseases, the improvement
of the stress response, the improvement of hypoxia resistance
and/or the improvement of life span by administering an agent that
reduces HIF-1.alpha.'s inhibition of c-Myc. In some embodiments,
the agent reduces HIF-1.alpha.'s inhibition of c-Myc by acting to
inhibit of the formation of a HIF-1.alpha./c-Myc complex. In some
embodiments, the agent induces a conformational change in
HIF-1.alpha. or c-Myc that abrogates their interaction and/or
alters the ability of HIF-1.alpha. to affect c-Myc activity,
protein levels or cell localization. In some embodiments the agent
is an antibody, an antigen binding fragment thereof, a small
molecule and/or a polypeptide that binds to HIF-1.alpha. or c-Myc.
For example, in some embodiments the agents described herein bind
to the HIF-1.alpha. domain required for c-Myc complex
formation.
Definitions
[0071] For convenience, certain terms employed in the
specification, examples, and appended claims are collected
here.
[0072] As used herein, the term "administering" means providing a
pharmaceutical agent or composition to a subject, and includes, but
is not limited to, administering by a medical professional and
self-administering.
[0073] The term "agent" is used herein to denote a chemical
compound, a small molecule, a mixture of chemical compounds and/or
a biological macromolecule (such as a nucleic acid, an antibody, an
antibody fragment, a protein or a peptide). Agents may be
identified as having a particular activity by screening assays
described herein below. The activity of such agents may render them
suitable as a "therapeutic agent" which is a biologically,
physiologically, or pharmacologically active substance (or
substances) that acts locally or systemically in a subject.
[0074] The term "amino acid" is intended to embrace all molecules,
whether natural or synthetic, which include both an amino
functionality and an acid functionality and capable of being
included in a polymer of naturally-occurring amino acids. Exemplary
amino acids include naturally-occurring amino acids; analogs,
derivatives and congeners thereof; amino acid analogs having
variant side chains; and all stereoisomers of any of any of the
foregoing.
[0075] As used herein, the term "antibody" may refer to both an
intact antibody and an antigen binding fragment thereof. Intact
antibodies are glycoproteins that include at least two heavy (H)
chains and two light (L) chains inter-connected by disulfide bonds.
Each heavy chain includes a heavy chain variable region
(abbreviated herein as V.sub.H) and a heavy chain constant region.
Each light chain includes a light chain variable region
(abbreviated herein as V.sub.L) and a light chain constant region.
The V.sub.H and V.sub.L regions can be further subdivided into
regions of hypervariability, termed complementarity determining
regions (CDR), interspersed with regions that are more conserved,
termed framework regions (FR). Each V.sub.H and V.sub.L is composed
of three CDRs and four FRs, arranged from amino-terminus to
carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3,
CDR3, FR4. The variable regions of the heavy and light chains
contain a binding domain that interacts with an antigen. The
constant regions of the antibodies may mediate the binding of the
immunoglobulin to host tissues or factors, including various cells
of the immune system (e.g., effector cells) and the first component
(Clq) of the classical complement system. The term "antibody"
includes, for example, monoclonal antibodies, polyclonal
antibodies, chimeric antibodies, humanized antibodies, human
antibodies, multispecific antibodies (e.g., bispecific antibodies),
single-chain antibodies and antigen-binding antibody fragments. An
"isolated antibody," as used herein, refers to an antibody which is
substantially free of other antibodies having different antigenic
specificities. An isolated antibody may, however, have some
cross-reactivity to other, related antigens.
[0076] The terms "antigen binding fragment" and "antigen-binding
portion" of an antibody, as used herein, refers to one or more
fragments of an antibody that retain the ability to bind to an
antigen. Examples of binding fragments encompassed within the term
"antigen-binding fragment" of an antibody include Fab, Fab',
F(ab').sub.2, Fv, scFv, disulfide linked Fv, Fd, diabodies,
single-chain antibodies, NANOBODIES.RTM., isolated CDRH3, and other
antibody fragments that retain at least a portion of the variable
region of an intact antibody. These antibody fragments can be
obtained using conventional recombinant and/or enzymatic techniques
and can be screened for antigen binding in the same manner as
intact antibodies.
[0077] As used herein, the term "c-Myc" refers to the c-Myc
transcription factor originally identified as an oncogene in
Burkett's lymphoma patients. c-Myc is a highly conserved
transcriptional regulator present in many organisms. Exemplary
c-Myc amino acid sequences are provided in FIG. 3.
[0078] The terms "CDR", and its plural "CDRs", refer to a
complementarity determining region (CDR) of an antibody or antibody
fragment, which determine the binding character of an antibody or
antibody fragment. In most instances, three CDRs are present in a
light chain variable region (CDRL1, CDRL2 and CDRL3) and three CDRs
are present in a heavy chain variable region (CDRH1, CDRH2 and
CDRH3). CDRs contribute to the functional activity of an antibody
molecule and are separated by amino acid sequences that comprise
scaffolding or framework regions. Among the various CDRs, the CDR3
sequences, and particularly CDRH3, are the most diverse and
therefore have the strongest contribution to antibody specificity.
There are at least two techniques for determining CDRs: (1) an
approach based on cross-species sequence variability (i.e., Kabat
et al., Sequences of Proteins of Immunological Interest (National
Institute of Health, Bethesda, Md. (1987), incorporated by
reference in its entirety); and (2) an approach based on
crystallographic studies of antigen-antibody complexes (Chothia et
al., Nature, 342:877 (1989), incorporated by reference in its
entirety).
[0079] "Diabetes" refers to high blood sugar or ketoacidosis, as
well as chronic, general metabolic abnormalities arising from a
prolonged high blood sugar status or a decrease in glucose
tolerance. "Diabetes" encompasses both the type I and type II
(Non-Insulin Dependent Diabetes Mellitus or NIDDM) forms of the
disease. The risk factors for diabetes include the following
factors: waistline of more than 40 inches for men or 35 inches for
women, blood pressure of 130/85 mmHg or higher, triglycerides above
150 mg/dl, fasting blood glucose greater than 100 mg/dl or
high-density lipoprotein of less than 40 mg/dl in men or 50 mg/dl
in women.
[0080] The term "epitope" means a protein determinant capable of
specific binding to an antibody. Epitopes usually consist of
chemically active surface groupings of molecules such as amino
acids or sugar side chains. Certain epitopes can be defined by a
particular sequence of amino acids to which an antibody is capable
of binding, such as, for example, the interaction domain sequences
provided in FIG. 2.
[0081] As used herein, the term "HIF-1.alpha." refers to the
Hypoxia-Inducible Factor 1, alpha subunit protein. HIF-1.alpha. is
a highly conserved protein present in most, if not all, metazoa.
Exemplary HIF-1.alpha. amino acid sequences are provided in FIG. 1.
Under certain conditions, HIF-1.alpha. forms a complex with c-Myc.
A specific interaction domain of the HIF-1.alpha. protein is
required for this complex formation. Exemplary interaction domain
sequences are provided in FIG. 2.
[0082] As used herein, the term "humanized antibody" refers to an
antibody that has at least one CDR derived from a mammal other than
a human, and a FR region and the constant region of a human
antibody. A humanized antibody is useful as an effective component
in a therapeutic agent according to the present invention since
antigenicity of the humanized antibody in human body is
lowered.
[0083] An "insulin resistance disorder," as discussed herein,
refers to any disease or condition that is caused by or contributed
to by insulin resistance. Examples include: diabetes, gestational
diabetes, obesity, metabolic syndrome, insulin-resistance
syndromes, syndrome X, insulin resistance, high blood pressure,
hypertension, high blood cholesterol, dyslipidemia, hyperlipidemia,
dyslipidemia, atherosclerotic disease including stroke, coronary
artery disease or myocardial infarction, hyperglycemia,
hyperinsulinemia and/or hyperproinsulinemia, impaired glucose
tolerance, delayed insulin release, diabetic complications,
including coronary heart disease, angina pectoris, congestive heart
failure, stroke, cognitive functions in dementia, retinopathy,
peripheral neuropathy, nephropathy, glomerulonephritis,
glomerulosclerosis, nephrotic syndrome, hypertensive
nephrosclerosis some types of cancer (such as endometrial, breast,
prostate, and colon), complications of pregnancy, poor female
reproductive health (such as menstrual irregularities, infertility,
irregular ovulation, polycystic ovarian syndrome (PCOS)),
lipodystrophy, cholesterol related disorders, such as gallstones,
cholescystitis and cholelithiasis, gout, obstructive sleep apnea
and respiratory problems, osteoarthritis, and prevention and
treatment of bone loss, e.g. osteoporosis.
[0084] The term "isolated polypeptide" refers to a polypeptide, in
certain embodiments prepared from recombinant DNA or RNA, or of
synthetic origin, or some combination thereof, which (1) is not
associated with proteins that it is normally found with in nature,
(2) is isolated from the cell in which it normally occurs, (3) is
isolated free of other proteins from the same cellular source, (4)
is expressed by a cell from a different species, or (5) does not
occur in nature.
[0085] As used herein, the term "monoclonal antibody" refers to an
antibody obtained from a population of substantially homogeneous
antibodies that specifically bind to the same epitope, i.e., the
individual antibodies comprising the population are identical
except for possible naturally occurring mutations that may be
present in minor amounts. The modifier "monoclonal" indicates the
character of the antibody as being obtained from a substantially
homogeneous population of antibodies, and is not to be construed as
requiring production of the antibody by any particular method.
[0086] "Obese" individuals or individuals suffering from obesity
are generally individuals having a body mass index (BMI) of at
least 25 or greater. Obesity may or may not be associated with
insulin resistance.
[0087] The phrase "pharmaceutically-acceptable carrier" as used
herein means a pharmaceutically-acceptable material, composition or
vehicle, such as a liquid or solid filler, diluent, excipient, or
solvent encapsulating material, involved in carrying or
transporting the subject compound from one organ, or portion of the
body, to another organ, or portion of the body.
[0088] "Small molecule" as used herein, is meant to refer to a
composition, which has a molecular weight of less than about 5 kD
and most preferably less than about 4 kD. Small molecules can be
nucleic acids, peptides, polypeptides, peptidomimetics,
carbohydrates, lipids or other organic (carbon-containing) or
inorganic molecules. Many pharmaceutical companies have extensive
libraries of chemical and/or biological mixtures, often fungal,
bacterial, or algal extracts, which can be screened with any of the
assays described herein.
[0089] "Stress" refers to any non-optimal condition for growth,
development or reproduction. A "stress condition" can be exposure
to heatshock; osmotic stress; a DNA damaging agent; inadequate salt
level; inadequate nitrogen levels; inadequate nutrient level;
radiation or a toxic compound, e.g., a toxin or chemical warfare
agent (such as dirty bombs and other weapons that may be used in
bioterrorism). "Inadequate levels" refer to levels that result in
non-optimal condition for growth, development or reproduction.
[0090] As used herein, "specific binding" refers to the ability of
an antibody to bind to a predetermined antigen or the ability of a
polypeptide to bind to its predetermined binding partner.
Typically, an antibody or polypeptide specifically binds to its
predetermined antigen or binding partner with an affinity
corresponding to a K.sub.D of about 10.sup.-7 M or less, and binds
to the predetermined antigen/binding partner with an affinity (as
expressed by K.sub.D) that is at least 10 fold less, at least 100
fold less or at least 1000 fold less than its affinity for binding
to a non-specific and unrelated antigen/binding partner (e.g., BSA,
casein).
[0091] As used herein, the term "subject" means a human or
non-human animal selected for treatment or therapy.
[0092] The phrases "therapeutically-effective amount" and
"effective amount" as used herein means the amount of an agent
which is effective for producing the desired therapeutic effect in
at least a sub-population of cells in a subject at a reasonable
benefit/risk ratio applicable to any medical treatment.
[0093] "Treating" a disease in a subject or "treating" a subject
having a disease refers to subjecting the subject to a
pharmaceutical treatment, e.g., the administration of a drug, such
that at least one symptom of the disease is decreased or prevented
from worsening.
Anti-HIF-1.alpha. Antibodies
[0094] In certain embodiments, the present invention relates to
antibodies and antigen binding fragments thereof that bind
specifically to HIF-1.alpha. and uses thereof. In some embodiments,
the antibodies bind to a domain of HIF-1.alpha. required for
complex formation with c-Myc. In some embodiments, the HIF-1.alpha.
domain has an amino acid sequence selected from SEQ ID NOs 11-20.
Accordingly, in certain embodiments the antibodies described herein
are able to inhibit complex formation between HIF-1.alpha. and
c-Myc. Such antibodies can be polyclonal or monoclonal and can be,
for example, murine, chimeric, humanized or fully human.
[0095] Polyclonal antibodies can be prepared by immunizing a
suitable subject (e.g. a mouse) with a polypeptide immunogen (e.g.,
a polypeptide having an amino acid sequence selected from SEQ ID
NOs 11-20). The polypeptide antibody titer in the immunized subject
can be monitored over time by standard techniques, such as with an
enzyme linked immunosorbent assay (ELISA) using immobilized
polypeptide. If desired, the antibody directed against the antigen
can be isolated from the mammal (e.g., from the blood) and further
purified by well-known techniques, such as protein A chromatography
to obtain the IgG fraction.
[0096] At an appropriate time after immunization, e.g., when the
antibody titers are highest, antibody-producing cells can be
obtained from the subject and used to prepare monoclonal antibodies
using standard techniques, such as the hybridoma technique
originally described by Kohler and Milstein (1975) Nature
256:495-497) (see also Brown et al. (1981) J. Immunol. 127:539-46;
Brown et al. (1980) J. Biol. Chem. 255:4980-83; Yeh et al. (1976)
Proc. Natl. Acad. Sci. 76:2927-31; and Yeh et al. (1982) Int. J.
Cancer 29:269-75), the more recent human B cell hybridoma technique
(Kozbor et al. (1983) Immunol. Today 4:72), the EBV-hybridoma
technique (Cole et al. (1985) Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma techniques. The
technology for producing monoclonal antibody hybridomas is well
known (see generally Kenneth, R. H. in Monoclonal Antibodies: A New
Dimension In Biological Analyses, Plenum Publishing Corp., New
York, N.Y. (1980); Lerner, E. A. (1981) Yale J. Biol. Med.
54:387-402; Gefter, M. L. et al. (1977) Somatic Cell Genet.
3:231-36). Briefly, an immortal cell line (typically a myeloma) is
fused to lymphocytes (typically splenocytes) from a mammal
immunized with an immunogen as described above, and the culture
supernatants of the resulting hybridoma cells are screened to
identify a hybridoma producing a monoclonal antibody that binds to
the polypeptide antigen, preferably specifically.
[0097] As an alternative to preparing monoclonal antibody-secreting
hybridomas, a monoclonal specific for HIF-1.alpha. and/or a
polypeptide having an amino acid sequence selected from SEQ ID NOs
11-20 can be identified and isolated by screening a recombinant
combinatorial immunoglobulin library (e.g., an antibody phage
display library or an antibody yeast display library) with the
appropriate polypeptide (e.g. a polypeptide having an amino acid
sequence selected from SEQ ID NOs 11-20) to thereby isolate
immunoglobulin library members that bind the polypeptide.
[0098] Additionally, recombinant antibodies specific for
HIF-1.alpha. and/or a polypeptide having an amino acid sequence
selected from SEQ ID NOs 11-20, such as chimeric or humanized
monoclonal antibodies, can be made using standard recombinant DNA
techniques. Such chimeric and humanized monoclonal antibodies can
be produced by recombinant DNA techniques known in the art, for
example using methods described in U.S. Pat. No. 4,816,567; U.S.
Pat. No. 5,565,332; Better et al. (1988) Science 240:1041-1043; Liu
et al. (1987) Proc. Natl. Acad. Sci. USA 84:3439-3443; Liu et al.
(1987) J. Immunol. 139:3521-3526; Sun et al. (1987) Proc. Natl.
Acad. Sci. 84:214-218; Nishimura et al. (1987) Cancer Res.
47:999-1005; Wood et al. (1985) Nature 314:446-449; and Shaw et al.
(1988) J. Natl. Cancer Inst. 80:1553-1559); Morrison, S. L. (1985)
Science 229:1202-1207; Oi et al. (1986) Biotechniques 4:214; Winter
U.S. Pat. No. 5,225,539; Jones et al. (1986) Nature 321:552-525;
Verhoeyan et al. (1988) Science 239:1534; and Beidler et al. (1988)
J. Immunol. 141:4053-4060.
[0099] Human monoclonal antibodies specific for HIF-1.alpha. and/or
a polypeptide having an amino acid sequence selected from SEQ ID
NOs 11-20 can be generated using transgenic or transchromosomal
mice carrying parts of the human immune system rather than the
mouse system. For example, "HuMAb mice" which contain a human
immunoglobulin gene miniloci that encodes unrearranged human heavy
(.mu. and .gamma.) and .kappa. light chain immunoglobulin
sequences, together with targeted mutations that inactivate the
endogenous .mu. and .kappa. chain loci (Lonberg, N. et al. (1994)
Nature 368(6474): 856 859). Accordingly, the mice exhibit reduced
expression of mouse IgM or .kappa., and in response to
immunization, the introduced human heavy and light chain transgenes
undergo class switching and somatic mutation to generate high
affinity human IgG.kappa. monoclonal antibodies (Lonberg, N. et al.
(1994), supra; reviewed in Lonberg, N. (1994) Handbook of
Experimental Pharmacology 113:49 101; Lonberg, N. and Huszar, D.
(1995) Intern. Rev. Immunol. Vol. 13: 65 93, and Harding, F. and
Lonberg, N. (1995) Ann. N. Y Acad. Sci 764:536 546). The
preparation of HuMAb mice is described in Taylor, L. et al. (1992)
Nucleic Acids Research 20:6287 6295; Chen, J. et al. (1993)
International Immunology 5: 647 656; Tuaillon et al. (1993) Proc.
Natl. Acad. Sci USA 90:3720 3724; Choi et al. (1993) Nature
Genetics 4:117 123; Chen, J. et al. (1993) EMBO J. 12: 821 830;
Tuaillon et al. (1994) J. Immunol. 152:2912 2920; Lonberg et al.,
(1994) Nature 368(6474): 856 859; Lonberg, N. (1994) Handbook of
Experimental Pharmacology 113:49 101; Taylor, L. et al. (1994)
International Immunology 6: 579 591; Lonberg, N. and Huszar, D.
(1995) Intern. Rev. Immunol. Vol. 13: 65 93; Harding, F. and
Lonberg, N. (1995) Ann. N.Y. Acad. Sci 764:536 546; Fishwild, D. et
al. (1996) Nature Biotechnology 14: 845 851. See further, U.S. Pat.
Nos. 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,789,650;
5,877,397; 5,661,016; 5,814,318; 5,874,299; 5,770,429; and
5,545,807.
[0100] In certain embodiments, the antibodies of the instant
invention are able to bind to an epitope of HIF-1.alpha. in a
domain required for complex formation with c-Myc (e.g., a domain
having an amino acid sequence selected from SEQ ID NOs 11-20) with
a dissociation constant of no greater than 10.sup.-6, 10.sup.-7,
10.sup.-8 or 10.sup.-9 M. Standard assays to evaluate the binding
ability of the antibodies are known in the art, including for
example, ELISAs, Western blots and RIAs. The binding kinetics
(e.g., binding affinity) of the antibodies also can be assessed by
standard assays known in the art, such as by Biacore analysis. In
some embodiments, the binding of the antibody to HIF-1.alpha.
substantially inhibits the ability of c-Myc to form a complex with
HIF-1.alpha.. As used herein, an antibody substantially inhibits
the ability of c-Myc to form a complex with HIF-1.alpha. when an
excess of antibody reduces the quantity of complex formed to by at
least about 20%, 40%, 60% or 80%, 85% or 90% (as measured in an in
vitro competitive binding assay).
Soluble HIF-1.alpha. Polypeptides
[0101] In certain embodiments, the invention relates to isolated
polypeptides comprising a HIF-1.alpha. domain or fraction thereof
required for c-Myc to form a complex with HIF-1.alpha. (i.e.,
comprising a portion of an amino acid sequence selected from SEQ ID
NO: 11-20). Such polypeptides can be useful, for example, for
inhibiting the ability of c-Myc to form a complex with HIF-1.alpha.
and for identifying and/or generating antibodies that specifically
bind to the c-Myc interaction domain of HIF-1.alpha.. In some
embodiments, the polypeptide comprises at least 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60,
70, 80, 90 or 100 consecutive amino acids of an amino acid sequence
selected from SEQ ID NO: 11-20. In some embodiments the polypeptide
of the invention comprises less than 100, 90, 80, 70, 60, 50, 40,
30, 25 or 20 consecutive amino acids of the natural HIF-1.alpha.
protein (e.g., a protein having an amino acid sequence selected
from SEQ ID NO: 1-10). In some embodiments, the polypeptide of the
invention comprises an amino acid sequence selected from SEQ ID NO:
11-20.
[0102] In some embodiments, the polypeptide of the instant
invention is able to bind to c-Myc. In some embodiments, the
polypeptide binds to c-Myc with a dissociation constant of no
greater than 10.sup.-5 M, 10.sup.-6 M, 10.sup.-7 M, 10.sup.-8 M or
10.sup.-9 M. Standard assays to evaluate the binding ability of the
polypeptides are known in the art, including for example, ELISAs,
Western blots and RIAs and suitable assays are described in the
Examples. The binding kinetics (e.g., binding affinity) of the
polypeptides also can be assessed by standard assays known in the
art, such as by Biacore analysis. In some embodiments, the binding
of the polypeptide to c-Myc substantially inhibits the ability of
c-Myc to bind to HIF-1.alpha.. As used herein, a polypeptide
substantially inhibits adhesion of c-Myc to HIF-1.alpha. when an
excess of polypeptide reduces the quantity of c-Myc bound to
HIF-1.alpha. by at least about 20%, 40%, 60% or 80%, 85% or 90% (as
measured in an in vitro competitive binding assay).
[0103] In some embodiments, the polypeptides of the present
invention can be isolated from cells or tissue sources by an
appropriate purification scheme using standard protein purification
techniques. In another embodiment, polypeptides of the present
invention are produced by recombinant DNA techniques.
Alternatively, polypeptides of the present invention can be
chemically synthesized using standard peptide synthesis
techniques.
[0104] In some embodiments, polypeptides of the present invention
comprise an amino acid sequence substantially identical to a
sequence selected from SEQ ID NO: 11-20, or a fragment thereof.
Accordingly, in another embodiment, the polypeptides of the present
invention comprises an amino acid sequence at least about 80%, 85%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical
to a sequence selected from SEQ ID NO: 11-20, or a fragment
thereof.
[0105] In certain embodiments, the polypeptides of the present
invention comprise an amino acid identical to a sequence selected
from SEQ ID NO: 11-20, or a fragment thereof except for 1 or more
(e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) conservative sequence
modifications. As used herein, the term "conservative sequence
modifications" is intended to refer to amino acid modifications
that do not significantly affect or alter the binding
characteristics of the antibody containing the amino acid sequence.
Such conservative modifications include amino acid substitutions,
additions and deletions. Modifications can be introduced into an
antibody by standard techniques known in the art, such as
site-directed mutagenesis and PCR-mediated mutagenesis.
Conservative amino acid substitutions are ones in which the amino
acid residue is replaced with an amino acid residue having a
similar side chain. Families of amino acid residues having similar
side chains have been defined in the art. These families include
amino acids with basic side chains (e.g., lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic
acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine, threonine, tyrosine, cysteine, tryptophan),
nonpolar side chains (e.g., alanine, valine, leucine, isoleucine,
proline, phenylalanine, methionine), beta-branched side chains
(e.g., threonine, valine, isoleucine) and aromatic side chains
(e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one
or more amino acid residues of the polypeptides described herein
can be replaced with other amino acid residues from the same side
chain family and the altered antibody can be tested for retained
function using the functional assays described herein.
[0106] To determine the percent identity of two amino acid
sequences or of two nucleic acid sequences, the sequences are
aligned for optimal comparison purposes (e.g., gaps can be
introduced in one or both of a first and a second amino acid or
nucleic acid sequence for optimal alignment and non-identical
sequences can be disregarded for comparison purposes). The amino
acid residues or nucleotides at corresponding amino acid positions
or nucleotide positions are then compared. When a position in the
first sequence is occupied by the same amino acid residue or
nucleotide as the corresponding position in the second sequence,
then the molecules are identical at that position. The percent
identity between the two sequences is a function of the number of
identical positions shared by the sequences, taking into account
the number of gaps, and the length of each gap, which need to be
introduced for optimal alignment of the two sequences.
[0107] The invention also provides chimeric or fusion proteins. As
used herein, a "chimeric protein" or "fusion protein" comprises a
polypeptide(s) of the present invention (e.g., those comprising a
sequence selected from SEQ ID NO: 11-20, or a fragment thereof)
linked to a distinct polypeptide to which it is not linked in
nature. For example, the distinct polypeptide can be fused to the
N-terminus or C-terminus of the polypeptide either directly,
through a peptide bond, or indirectly through a chemical linker. In
some embodiments, the peptide of the instant invention is linked to
an immunoglobulin constant domain (e.g., an IgG constant domain,
such as a human IgG constant domain).
[0108] A chimeric or fusion polypeptide of the present invention
can be produced by standard recombinant DNA techniques. For
example, DNA fragments coding for the different polypeptide
sequences are ligated together in-frame in accordance with
conventional techniques, for example by employing blunt-ended or
stagger-ended termini for ligation, restriction enzyme digestion to
provide for appropriate termini, filling-in of cohesive ends as
appropriate, alkaline phosphatase treatment to avoid undesirable
joining, and enzymatic ligation. In another embodiment, the fusion
gene can be synthesized by conventional techniques including
automated DNA synthesizers. Alternatively, PCR amplification of
gene fragments can be carried out using anchor primers which give
rise to complementary overhangs between two consecutive gene
fragments which can subsequently be annealed and reamplified to
generate a chimeric gene sequence (see, for example, Current
Protocols in Molecular Biology, Ausubel et al., eds., John Wiley
& Sons: 1992). Moreover, many expression vectors are
commercially available that already encode a fusion moiety.
[0109] The polypeptides described herein can be produced in
prokaryotic or eukaryotic host cells by expression of
polynucleotides encoding a polypeptide(s) of the present invention.
Alternatively, such peptides can be synthesized by chemical
methods. Methods for expression of heterologous polypeptides in
recombinant hosts, chemical synthesis of polypeptides, and in vitro
translation are well known in the art and are described further in
Maniatis et al., Molecular Cloning: A Laboratory Manual (1989), 2nd
Ed., Cold Spring Harbor, N. Y.; Berger and Kimmel, Methods in
Enzymology, Volume 152, Guide to Molecular Cloning Techniques
(1987), Academic Press, Inc., San Diego, Calif.; Merrifield, J.
(1969) J. Am. Chem. Soc. 91:501; Chaiken I. M. (1981) CRC Crit.
Rev. Biochem. 11:255; Kaiser et al. (1989) Science 243:187;
Merrifield, B. (1986) Science 232:342; Kent, S. B. H. (1988) Annu.
Rev. Biochem. 57:957; and Offord, R. E. (1980) Semisynthetic
Proteins, Wiley Publishing, which are incorporated herein by
reference.
Other Inhibitors of HIF-1.alpha./c-Myc Complex Formation
[0110] Certain embodiments of the present invention relate to
methods of treating age-related and mitochondrial diseases,
enhancing stress response, improving resistance to hypoxia and/or
increasing life span. These methods include administering that
reduces HIF-1.alpha.'a ability to inhibit c-Myc function. For
example, in certain embodiments the agent inhibits complex
formation between HIF-1.alpha. and c-Myc. In some embodiments, the
agents induce a conformational change in HIF-1.alpha. or c-Myc that
abrogates their interaction and/or alters the ability of
HIF-1.alpha. to affect c-Myc activity, protein levels or cell
localization.
[0111] In some embodiments, any agent that reduces inhibition of
c-Myc by HIF-1.alpha. can be used to practice the methods of the
invention. In some embodiments, the agent inhibits complex
formation between HIF-1.alpha. and c-Myc. Such agents can be those
described herein or those identified through routine screening
assays (e.g. the screening assays described herein).
[0112] In some embodiments, assays used to identify agents useful
in the methods of the present invention include a reaction between
a polypeptide comprising a sequence selected from SEQ ID NO: 11-20
or a fragment thereof and one or more assay components. The other
components may be either a test compound (e.g. the potential
agent), or a combination of test compounds and a c-Myc protein or
fragment thereof. Agents identified via such assays, may be useful,
for example, for preventing or treating age-related and
mitochondrial diseases, enhancing stress response and/or improving
life span.
[0113] Agents useful in the methods of the present invention may be
obtained from any available source, including systematic libraries
of natural and/or synthetic compounds. Agents may also be obtained
by any of the numerous approaches in combinatorial library methods
known in the art, including: biological libraries; peptoid
libraries (libraries of molecules having the functionalities of
peptides, but with a novel, non-peptide backbone which are
resistant to enzymatic degradation but which nevertheless remain
bioactive; see, e.g., Zuckermann et al., 1994, J. Med. Chem.
37:2678-85); spatially addressable parallel solid phase or solution
phase libraries; synthetic library methods requiring deconvolution;
the `one-bead one-compound` library method; and synthetic library
methods using affinity chromatography selection. The biological
library and peptoid library approaches are limited to peptide
libraries, while the other four approaches are applicable to
peptide, non-peptide oligomer or small molecule libraries of
compounds (Lam, 1997, Anticancer Drug Des. 12:145).
[0114] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt et al. (1993) Proc.
Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl.
Acad. Sci. USA 91:11422; Zuckermann et al. (1994). J. Med. Chem.
37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994)
Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew.
Chem. Int. Ed. Engl. 33:2061; and in Gallop et al. (1994) J. Med.
Chem. 37:1233.
[0115] Libraries of agents may be presented in solution (e.g.,
Houghten, 1992, Biotechniques 13:412-421), or on beads (Lam, 1991,
Nature 354:82-84), chips (Fodor, 1993, Nature 364:555-556),
bacteria and/or spores, (Ladner, U.S. Pat. No. 5,223,409), plasmids
(Cull et al, 1992, Proc Natl Acad Sci USA 89:1865-1869) or on phage
(Scott and Smith, 1990, Science 249:386-390; Devlin, 1990, Science
249:404-406; Cwirla et al, 1990, Proc. Natl. Acad. Sci.
87:6378-6382; Felici, 1991, J. Mol. Biol. 222:301-310; Ladner,
supra.).
[0116] Agents useful in the methods of the present invention may be
identified, for example, using assays for screening candidate or
test compounds which inhibit complex formation between c-Myc and
HIF-1.alpha..
[0117] The basic principle of the assay systems used to identify
compounds that inhibit complex formation between c-Myc and
HIF-1.alpha. involves preparing a reaction mixture containing a
HIF-1.alpha. protein or fragment thereof and a c-Myc protein or
fragment thereof under conditions and for a time sufficient to
allow the HIF-1.alpha. protein or fragment thereof to form a
complex with the c-Myc protein or fragment thereof. In order to
test an agent for modulatory activity, the reaction mixture is
prepared in the presence and absence of the test compound. The test
compound can be initially included in the reaction mixture, or can
be added at a time subsequent to the addition of the HIF-1.alpha.
protein or fragment thereof and the c-Myc protein or fragment
thereof. Control reaction mixtures are incubated without the test
compound or with a placebo. The formation of any complexes between
the HIF-1.alpha. protein or fragment thereof and the c-Myc protein
or fragment thereof is then detected. The formation of a complex in
the control reaction, but less or no such formation in the reaction
mixture containing the test compound, indicates that the compound
interferes with the interaction of the HIF-1.alpha. protein or
fragment thereof and the c-Myc protein or fragment thereof.
[0118] The assay for compounds that modulate the interaction of the
HIF-1.alpha. protein or fragment thereof and the c-Myc protein or
fragment thereof may be conducted in a heterogeneous or homogeneous
format. Heterogeneous assays involve anchoring either the
HIF-1.alpha. protein or fragment thereof or the c-Myc protein or
fragment thereof onto a solid phase and detecting complexes
anchored to the solid phase at the end of the reaction. In
homogeneous assays, the entire reaction is carried out in a liquid
phase. In either approach, the order of addition of reactants can
be varied to obtain different information about the compounds being
tested. For example, test compounds that interfere with the
interaction between the HIF-1.alpha. protein or fragment thereof
and the c-Myc protein or fragment thereof (e.g., by competition)
can be identified by conducting the reaction in the presence of the
test substance, i.e., by adding the test substance to the reaction
mixture prior to or simultaneously with the HIF-1.alpha. protein or
fragment thereof and the c-Myc protein or fragment thereof.
Alternatively, test compounds that disrupt preformed complexes,
e.g., compounds with higher binding constants that displace one of
the components from the complex, can be tested by adding the test
compound to the reaction mixture after complexes have been formed.
The various formats are briefly described below.
[0119] In a heterogeneous assay system, either the HIF-1.alpha.
protein or fragment thereof or the c-Myc protein or fragment
thereof is anchored onto a solid surface or matrix, while the other
corresponding non-anchored component may be labeled, either
directly or indirectly. In practice, microtitre plates are often
utilized for this approach. The anchored species can be immobilized
by a number of methods, either non-covalent or covalent, that are
typically well known to one who practices the art. Non-covalent
attachment can often be accomplished simply by coating the solid
surface with a solution of the HIF-1.alpha. protein or fragment
thereof or the c-Myc protein or fragment thereof and drying.
Alternatively, an immobilized antibody specific for the assay
component to be anchored can be used for this purpose.
[0120] In related assays, a fusion protein can be provided which
adds a domain that allows one or both of the assay components to be
anchored to a matrix. For example, glutathione-S-transferase/marker
fusion proteins or glutathione-S-transferase/binding partner can be
adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
Louis, Mo.) or glutathione derivatized microtiter plates, which are
then combined with the test compound or the test compound and
either the non-adsorbed the HIF-1.alpha. protein or fragment
thereof or the c-Myc protein or fragment thereof, and the mixture
incubated under conditions conducive to complex formation (e.g.,
physiological conditions). Following incubation, the beads or
microtiter plate wells are washed to remove any unbound assay
components, the immobilized complex assessed either directly or
indirectly, for example, as described above.
[0121] A homogeneous assay may also be used to identify inhibitors
of complex formation. This is typically a reaction, analogous to
those mentioned above, which is conducted in a liquid phase in the
presence or absence of the test compound. The formed complexes are
then separated from unreacted components, and the amount of complex
formed is determined. As mentioned for heterogeneous assay systems,
the order of addition of reactants to the liquid phase can yield
information about which test compounds modulate (inhibit or
enhance) complex formation and which disrupt preformed
complexes.
[0122] In such a homogeneous assay, the reaction products may be
separated from unreacted assay components by any of a number of
standard techniques, including but not limited to: differential
centrifugation, chromatography, electrophoresis and
immunoprecipitation. In differential centrifugation, complexes of
molecules may be separated from uncomplexed molecules through a
series of centrifugal steps, due to the different sedimentation
equilibria of complexes based on their different sizes and
densities (see, for example, Rivas, G., and Minton, A. P., Trends
Biochem Sci 1993 August; 18(8):284-7). Standard chromatographic
techniques may also be utilized to separate complexed molecules
from uncomplexed ones. For example, gel filtration chromatography
separates molecules based on size, and through the utilization of
an appropriate gel filtration resin in a column format, for
example, the relatively larger complex may be separated from the
relatively smaller uncomplexed components. Similarly, the
relatively different charge properties of the complex as compared
to the uncomplexed molecules may be exploited to differentially
separate the complex from the remaining individual reactants, for
example through the use of ion-exchange chromatography resins. Such
resins and chromatographic techniques are well known to one skilled
in the art (see, e.g., Heegaard, 1998, J Mol. Recognit. 11:141-148;
Hage and Tweed, 1997, J. Chromatogr. B. Biomed. Sci. Appl.,
699:499-525). Gel electrophoresis may also be employed to separate
complexed molecules from unbound species (see, e.g., Ausubel et al
(eds.), In: Current Protocols in Molecular Biology, J. Wiley &
Sons, New York. 1999). In this technique, protein or nucleic acid
complexes are separated based on size or charge, for example. In
order to maintain the binding interaction during the
electrophoretic process, nondenaturing gels in the absence of
reducing agent are typically preferred, but conditions appropriate
to the particular interactants will be well known to one skilled in
the art. Immunoprecipitation is another common technique utilized
for the isolation of a protein-protein complex from solution (see,
e.g., Ausubel et al (eds.), In: Current Protocols in Molecular
Biology, J. Wiley & Sons, New York. 1999). In this technique,
all proteins binding to an antibody specific to one of the binding
molecules are precipitated from solution by conjugating the
antibody to a polymer bead that may be readily collected by
centrifugation. The bound assay components are released from the
beads (through a specific proteolysis event or other technique well
known in the art which will not disturb the protein-protein
interaction in the complex), and a second immunoprecipitation step
is performed, this time utilizing antibodies specific for the
correspondingly different interacting assay component. In this
manner, only formed complexes should remain attached to the beads.
Variations in complex formation in both the presence and the
absence of a test compound can be compared, thus offering
information about the ability of the compound to modulate
interactions between the HIF-1.alpha. protein or fragment thereof
and the c-Myc protein or fragment thereof.
[0123] Agents useful in the methods described herein may also be
identified, for example, using methods wherein a cell (e.g., a cell
that expresses c-Myc and HIF-1.alpha., such as a mammalian cell) is
contacted with a test compound, and the expression level of a c-Myc
target gene or a reporter gene under the transcriptional control of
the promoter of a c-Myc target gene is determined (collectively
referred to as c-Myc reporter genes). As used herein, the term
"c-Myc target gene" refers to a gene whose expression increases in
the presence of c-Myc. Examples of c-Myc target genes are well
known in the art and include, for example, TFAM, ND1, ND2, ND3,
ND4, ND4I, ND5, ND6, CYTB, COX1, COX2, COX3, ATP6 and ATP8. In some
embodiments, the c-Myc reporter gene encodes a readily detectable
protein (e.g., a fluorescent protein or a protein catalyzes a
reaction that produces a change in color, luminescence and/or
opacity). In some embodiments, the level of expression of the
reporter gene in the presence of the test compound is compared to
the level of expression of mRNA or protein in the absence of the
candidate compound. If the expression of the mRNA or protein
increases in the presence of the test compound, the test compound
an agent useful in the methods described herein.
Pharmaceutical Compositions
[0124] In certain embodiments the instant invention relates to a
composition, e.g., a pharmaceutical composition, containing at
least one agent described herein together with a pharmaceutically
acceptable carrier. In one embodiment, the composition includes a
combination of multiple (e.g., two or more) agents of the
invention.
[0125] As described in detail below, the pharmaceutical
compositions of the present invention may be specially formulated
for administration in solid or liquid form, including those adapted
for the following: (1) oral administration, for example, drenches
(aqueous or non-aqueous solutions or suspensions), tablets, e.g.,
those targeted for buccal, sublingual, and systemic absorption,
boluses, powders, granules, pastes for application to the tongue;
or (2) parenteral administration, for example, by subcutaneous,
intramuscular, intravenous or epidural injection as, for example, a
sterile solution or suspension, or sustained-release
formulation.
[0126] Methods of preparing these formulations or compositions
include the step of bringing into association an agent described
herein with the carrier and, optionally, one or more accessory
ingredients. In general, the formulations are prepared by uniformly
and intimately bringing into association an agent described herein
with liquid carriers, or finely divided solid carriers, or both,
and then, if necessary, shaping the product.
[0127] Pharmaceutical compositions of this invention suitable for
parenteral administration comprise one or more agents described
herein in combination with one or more pharmaceutically-acceptable
sterile isotonic aqueous or nonaqueous solutions, dispersions,
suspensions or emulsions, or sterile powders which may be
reconstituted into sterile injectable solutions or dispersions just
prior to use, which may contain sugars, alcohols, antioxidants,
buffers, bacteriostats, solutes which render the formulation
isotonic with the blood of the intended recipient or suspending or
thickening agents.
[0128] Examples of suitable aqueous and nonaqueous carriers which
may be employed in the pharmaceutical compositions of the invention
include water, ethanol, polyols (such as glycerol, propylene
glycol, polyethylene glycol, and the like), and suitable mixtures
thereof, vegetable oils, such as olive oil, and injectable organic
esters, such as ethyl oleate. Proper fluidity can be maintained,
for example, by the use of coating materials, such as lecithin, by
the maintenance of the required particle size in the case of
dispersions, and by the use of surfactants.
[0129] Regardless of the route of administration selected, the
agents of the present invention, which may be used in a suitable
hydrated form, and/or the pharmaceutical compositions of the
present invention, are formulated into pharmaceutically-acceptable
dosage forms by conventional methods known to those of skill in the
art.
Therapeutic Methods
[0130] Disclosed herein are novel methods of treating age-related
and mitochondrial diseases, enhancing stress response, improving
resistance to hypoxia and/or increasing life span. In certain
embodiments the agents described herein are administered to a
subject (e.g., a subject in need thereof). In some embodiments, the
agents are used to enhance stress response, improve hypoxia
resistance or increase the life span of a cell. In such
embodiments, the agent is contacted to the cell either in vitro or
in vivo.
[0131] In some embodiments, the present invention provides
therapeutic methods of treating an age-related disease. Age-related
diseases include, but are not limited to, Alzheimer's disease,
amniotropic lateral sclerosis, arthritis, atherosclerosis,
cachexia, cancer, cardiac hypertrophy, cardiac failure, cardiac
hypertrophy, cardiovascular disease, cataracts, colitis, chronic
obstructive pulmonary disease, dementia, diabetes mellitus,
frailty, heart disease, hepatic steatosis, high blood cholesterol,
high blood pressure, Huntington's disease, hyperglycemia,
hypertension, infertility, inflammatory bowel disease, insulin
resistance disorder, lethargy, metabolic syndrome, muscular
dystrophy, multiple sclerosis, neuropathy, nephropathy, obesity,
osteoporosis, Parkinson's disease, psoriasis, retinal degeneration,
sarcopenia, sleep disorders, sepsis and/or stroke.
[0132] In some embodiments, the present invention provides
therapeutic methods of treating a mitochondrial disease.
Mitochondrial diseases include, but are not limited to,
mitochondrial myopathy, diabetes mellitus and deafness (DAD),
Leber's hereditary optic neuropathy (LHON), Leigh syndrome,
neuropathy, ataxia, retinitis pigmentosa and petosis (NARP),
myoclonic epilepsy with ragged red fibers (MERRF), myoneurogenic
gastrointestinal encephalopathy (MNGIE), mitochondrial myopathy,
encephalomyopathy, lactic acidosis, stroke-like symptoms (MELAS),
Kearns-Sayre syndrome (KSS), chromic progressive external
opthalmoplegia (CPEO) and/or mtDNA depletion.
[0133] In certain embodiments, the methods described herein are
useful for increasing the life span of a cell or organism. All
animals typically go through a period of growth and maturation
followed by a period of progressive and irreversible physiological
decline ending in death. The length of time from birth to death is
known as the life span of an organism, and each organism has a
characteristic average life span. Aging is a physical manifestation
of the changes underlying the passage of time as measured by
percent of average life span.
[0134] In some cases, characteristics of aging can be quite
obvious. For example, characteristics of older humans include skin
wrinkling, graying of the hair, baldness, and cataracts, as well as
hypermelanosis, osteoporosis, altered adiposity, cerebral cortical
atrophy, lymphoid depletion, memory loss, thymic atrophy, increased
incidence of diabetes type H, atherosclerosis, cancer, muscle loss,
bone loss, and heart disease. Nehlin et al. (2000), Annals NY Acad
Sci 980:176-79. Other aspects of mammalian aging include weight
loss, lordokyphosis (hunchback spine), absence of vigor, lymphoid
atrophy, decreased bone density, dermal thickening and subcutaneous
adipose tissue, decreased ability to tolerate stress (including
heat or cold, wounding, anesthesia, and hematopoietic precursor
cell ablation), liver pathology, atrophy of intestinal villi, skin
ulceration, amyloid deposits, and joint diseases. Tyner et al.
(2002), Nature 415:45-53.
[0135] Careful observation reveals characteristics of aging in
other eukaryotes, including invertebrates. For example,
characteristics of aging in the model organism C. elegans include
slow movement, flaccidity, yolk accumulation, intestinal
autofluorescence (lipofuscin), loss of ability to eat food or
dispel waste, necrotic cavities in tissues, and germ cell
appearance.
[0136] Those skilled in the art will recognize that the aging
process is also manifested at the cellular level, as well as in
mitochondria. Cellular aging is manifested in reduced mitochondrial
function, loss of doubling capacity, increased levels of apoptosis,
changes in differentiated phenotype, and changes in metabolism,
e.g., decreased fatty acid oxidation, respiration, and protein
synthesis and turnover.
[0137] Given the programmed nature of cellular and organismal
aging, it is possible to evaluate the "biological age" of a cell or
organism by means of phenotypic characteristics that are correlated
with aging. For example, biological age can be deduced from
patterns of gene expression, resistance to stress (e.g., oxidative
or genotoxic stress), rate of cellular proliferation, and the
metabolic characteristics of cells (e.g., rates of protein
synthesis and turnover, mitochondrial function, ubiquinone
biosynthesis, cholesterol biosynthesis, ATP levels within the cell,
levels of a Krebs cycle intermediate in the cell, glucose
metabolism, nucleic acid metabolism, ribosomal translation rates,
etc.). As used herein, "biological age" is a measure of the age of
a cell or organism based upon the molecular characteristics of the
cell or organism. Biological age is distinct from "temporal age,"
which refers to the age of a cell or organism as measured by days,
months, and years.
[0138] The rate of aging of an organism, e.g., an invertebrate
(e.g., a worm or a fly) or a vertebrate (e.g., a rodent, e.g., a
mouse) can be determined by a variety of methods, e.g., by one or
more of: a) assessing the life span of the cell or the organism;
(b) assessing the presence or abundance of a gene transcript or
gene product in the cell or organism that has a biological
age-dependent expression pattern; (c) evaluating resistance of the
cell or organism to stress, e.g., genotoxic stress (e.g.,
etopocide, UV irradition, exposure to a mutagen, and so forth) or
oxidative stress; (d) evaluating one or more metabolic parameters
of the cell or organism; (e) evaluating the proliferative capacity
of the cell or a set of cells present in the organism; and (f)
evaluating physical appearance or behavior of the cell or organism.
In one example, evaluating the rate of aging includes directly
measuring the average life span of a group of animals (e.g., a
group of genetically matched animals) and comparing the resulting
average to the average life span of a control group of animals
(e.g., a group of animals that did not receive the test compound
but are genetically matched to the group of animals that did
receive the test compound). Alternatively, the rate of aging of an
organism can be determined by measuring an age-related parameter.
Examples of age-related parameters include: appearance, e.g.,
visible signs of age; the expression of one or more genes or
proteins (e.g., genes or proteins that have an age-related
expression pattern); resistance to oxidative stress; metabolic
parameters (e.g., protein synthesis or degradation, ubiquinone
biosynthesis, cholesterol biosynthesis, ATP levels, glucose
metabolism, nucleic acid metabolism, ribosomal translation rates,
etc.); and cellular proliferation (e.g., of retinal cells, bone
cells, white blood cells, etc.).
[0139] In certain embodiments, the methods described herein relate
to increasing the life span of cells and/or protecting cells
against at least certain stresses in vitro. For example, cells in
culture can be treated as described herein, such as to keep them
proliferating longer. This is particularly useful for primary cell
cultures (i.e., cells obtained from an organism, e.g., a human),
which are known to have only a limited life span in culture.
Treating such cells according to methods of the invention (e.g., by
contacting the cells with an agent that inhibits complex formation
between HIF-1.alpha. and c-Myc or the ability of HIF-1.alpha. to
inhibit c-Myc activity, levels or cell localization) will result in
increasing the amount of time that the cells are kept alive in
culture. Embryonic stem (ES) cells and pluripotent cells, and cells
differentiated therefrom, can also be modified according to the
methods of the invention such as to keep the cells or progeny
thereof in culture for longer periods of time. Primary cultures of
cells, ES cells, pluripotent cells and progeny thereof can be used,
e.g., to identify compounds having particular biological effects on
the cells or for testing the toxicity of compounds on the cells
(i.e., cytotoxicity assays).
[0140] In other embodiments, cells that are intended to be
preserved for long periods of time are treated as described herein.
The cells can be cells in suspension, e.g., blood cells, stem
cells, iPS cells, germ cells, germ cell precursors, or tissues or
organs. For example, blood collected from an individual for
administering to an individual can be treated according to the
invention, such as to preserve the blood cells or stem cells for
longer periods of time. Other cells that one may treat for
extending their lifespan and/or protect them against certain types
of stresses include cells for consumption, e.g., cells from
non-human mammals (such as meat), or plant cells (such as
vegetables). Cells may also be treated prior to implantation or
genetic or physical manipulation.
[0141] In another embodiment, cells obtained from a subject, e.g.,
a human or other mammal, are treated according to the methods of
the invention and then administered to the same or a different
subject. Accordingly, cells or tissues obtained from a donor for
use as a graft can be treated as described herein prior to
administering to the recipient of the graft. For example, bone
marrow cells can be obtained from a subject, treated ex vivo to
extend their life span and protect the cells against certain types
of stresses and then administered to a recipient. The graft can be
an organ, a tissue or loose cells.
[0142] In yet other embodiments, cells are treated in vivo to
increase their life span and/or protect them against certain types
of stresses. For example, skin can be protected from aging, e.g.,
developing wrinkles, by treating skin, e.g., epithelial cells, as
described herein. In an exemplary embodiment, skin is contacted
with a pharmaceutical or cosmetic composition comprising an agent
described herein.
[0143] In addition to applying the methods of the invention in
humans and non-human animals, the methods can also be applied to
plants and plant cells. Accordingly, the invention also provides
methods for extending the life span of plants and plant cells and
for rendering the plant and plant cells more resistant to stress,
e.g., excessive salt conditions. This can be achieved, e.g., by
inhibiting complex formation of proteins in the plant cells that
are essentially homologous to the proteins described herein in the
animal systems (i.e., HIF-1.alpha. and c-Myc) in order to increase
the life span and/or the stress resistance of cells.
[0144] Agents, such as those described herein, that extend the life
span of cells and protect them from stress can also be administered
to subjects for treatment of diseases, e.g., chronic diseases,
associated with cell death, such as to protect the cells from cell
death, e.g., diseases associated with neural cell death or muscular
cell death. In particular, the methods may be used to prevent or
alleviate neurodegeneration and peripheral neuropathies associated
with chemotherapy, such as cancer chemotherapy (e.g., taxol or
cisplatin treatment). Neurodegenerative diseases include
Parkinson's disease, Alzheimer's disease, multiple sclerosis,
amniotropic lateral sclerosis (ALS), retinal degeneration, macular
degeneration, Huntington's disease and muscular dystrophy. Thus,
the agents may be used as neuroprotective agents. The agent may be
administered in the tissue or organ likely to encounter cell
death.
[0145] In certain embodiments, the methods described herein relate
to improving the survival of a cell that has been exposed to
hypoxia. In some embodiments, the method includes contacting the
cell with an that reduces inhibition of c-Myc activity by
HIF-1.alpha.. In some embodiments, the cell has been exposed to a
hypoxic environment. In certain embodiments the cell is a neuron, a
cardiac myocyte, a skeletal myocyte, an iPS cell, blood cell, germ
cell or germ cell precursor. In some embodiments, the cell is being
cultured in vitro. In certain embodiments the cell is a part of a
tissue or organ of a subject who is administered the agent (e.g., a
subject suffering from ischemia, cardiovascular diseases,
myocardial infarction, congestive heart disease, cardiomyopathy,
myocarditis, macrovascular disease, peripheral vascular disease or
stroke).
[0146] In certain embodiments, the present invention relates to a
method of treating or preventing damage to a tissue or organ that
has been exposed to hypoxia in a subject by administering an agent
described herein to the subject. Tissues and organs are often
exposed to hypoxic conditions during a stroke, a myocardial
infarction or a peripheral vascular disease. Thus, in some
embodiments the methods the subject that may be treated include
patients suffering from a cardiac disease, e.g., ischemia,
cardiovascular diseases, myocardial infarction, congestive heart
disease. Cardiovascular diseases that can be treated or prevented
include cardiomyopathy or myocarditis; such as idiopathic
cardiomyopathy, metabolic cardiomyopathy, alcoholic cardiomyopathy,
drug-induced cardiomyopathy, ischemic cardiomyopathy, and
hypertensive cardiomyopathy. Also treatable or preventable using
methods described herein are atheromatous disorders of the major
blood vessels (macrovascular disease) such as the aorta, the
coronary arteries, the carotid arteries, the cerebrovascular
arteries, the renal arteries, the iliac arteries, the femoral
arteries, and the popliteal arteries. Other vascular diseases that
can be treated or prevented include those related to the retinal
arterioles, the glomerular arterioles, the vasa nervorum, cardiac
arterioles, and associated capillary beds of the eye, the kidney,
the heart, and the central and peripheral nervous systems. The
methods may also be used for increasing HDL levels in plasma of an
individual.
[0147] The pharmaceutical compositions of the present invention may
be delivered by any suitable route of administration, including
orally, nasally, as by, for example, a spray, rectally,
intravaginally, parenterally, intracisternally and topically, as by
powders, ointments or drops, including buccally and sublingually.
In certain embodiments the pharmaceutical compositions are
delivered generally (e.g., via oral or parenteral
administration).
[0148] Actual dosage levels of the active ingredients in the
pharmaceutical compositions of this invention may be varied so as
to obtain an amount of the active ingredient which is effective to
achieve the desired therapeutic response for a particular patient,
composition, and mode of administration, without being toxic to the
patient.
[0149] The selected dosage level will depend upon a variety of
factors including the activity of the particular agent employed,
the route of administration, the time of administration, the rate
of excretion or metabolism of the particular compound being
employed, the duration of the treatment, other drugs, compounds
and/or materials used in combination with the particular compound
employed, the age, sex, weight, condition, general health and prior
medical history of the patient being treated, and like factors well
known in the medical arts.
[0150] A physician or veterinarian having ordinary skill in the art
can readily determine and prescribe the effective amount of the
pharmaceutical composition required. For example, the physician or
veterinarian could prescribe and/or administer doses of the
compounds of the invention employed in the pharmaceutical
composition at levels lower than that required in order to achieve
the desired therapeutic effect and gradually increase the dosage
until the desired effect is achieved.
[0151] Conserved amongst organisms as diverse as yeast and humans
is a progressive decline in mitochondrial function with age,
leading to a loss of cellular homeostasis and organismal health
(Figueiredo et al., 2008; Figueiredo et al., 2009; Hartmann et al.,
2011; Lanza and Nair, 2010). Mitochondria are highly dynamic
organelles that are continuously eliminated and regenerated in a
process known as mitochondrial biogenesis (Michel et al., 2012).
Over the past 2 billion years, since eukaryotes subsumed the
.alpha.-proteobacterial ancestor of mitochondria, most
mitochondrial genes have been transferred to the nuclear genome,
where regulation is better integrated. However, the mitochondrial
genome still encodes rRNAs, tRNAs, and 13 subunits of the electron
transport chain (ETC) (Falkenberg et al., 2007; Larsson, 2010).
Functional communication between the nuclear and mitochondrial
genomes is therefore essential for mitochondrial biogenesis and
homeostasis, efficient oxidative phosphorylation, and normal health
(Scarpulla, 2011b). The major known regulatory pathway of
mitochondrial biogenesis involves the peroxisome
proliferator-activated receptor-.gamma. coactivators alpha and beta
(PGC-1.alpha. and PGC1-113), which induce Nuclear Respiratory
Factors 1 and 2 (NRF-1 and -2) (Evans and Scarpulla, 1990).
NRF-1/-2 binds to and promotes transcription of nuclear genes
encoding ETC components and the protein machinery needed to
replicate, transcribe, and translate mitochondrial DNA (mtDNA). One
of the key proteins that enable this coordination between the
nucleus and mitochondria is TFAM (mitochondrial transcription
factor A), a nuclear-encoded protein that promotes transcription of
mitochondrial-encoded genes and the replication of mtDNA (Parisi
and Clayton, 1991; Scarpulla, 2011a).
[0152] In mammals, there is a large body of evidence implicating
mitochondrial decline in aging, age-related diseases, and many
other diseases, disorders, or conditions. For example, mice with
mutations that impair the proofreading capacity of the
mitochondrial DNA polymerase gamma (Poly) exhibit a premature aging
phenotype (Trifunovic et al., 2005; Trifunovic et al., 2004;
Vermulst et al., 2008). Conversely, targeting peroxisomal catalase
to mitochondria (mCAT) extends mouse lifespan (Schriner et al.,
2005). Recently, telomere erosion in mice was found to disrupt
mitochondrial function but the underlying mechanism has not yet
been established (Sahin et al., 2011). Despite the apparent
importance of mitochondrial decline in aging and disease, there is
considerable debate about its underlying causes (Dutta et al.,
2012; Moslehi et al., 2012; Peterson et al., 2012). The original
idea of Harman (Harman, 1972), that reactive oxygen species (ROS)
from mitochondria are a primary cause of disruption of
mitochondrial homeostasis, has been challenged (Andziak and
Buffenstein, 2006; Andziak et al., 2006; Howes, 2006) (Lapointe and
Hekimi, 2010), leaving the primary causes of mitochondrial
disturbances during the aging process unresolved.
[0153] Mammalian sirtuins (SIRT1-7) are a conserved family of
NAD.sup.+-dependent lysine-modifying enzymes that modulate the
physiological response to dietary changes and can protect against
several age-related diseases (Haigis and Sinclair, 2010). The
expression of SIRT1, an NAD.sup.+-dependent protein deacetylase, is
elevated in a number of tissues following restriction of caloric
intake (CR) by 30-40% (Cohen et al., 2004), one intervention
generally accepted to extend lifespan. Overexpression or
pharmacological activation of SIRT1 reproduces many of the health
benefits of CR, including protection from metabolic decline (Banks
et al., 2008; Baur et al., 2006; Bordone et al., 2007; Lagouge et
al., 2006; Minor et al., 2011; Pfluger et al., 2008),
cardiovascular disease (Zhang et al., 2008), cancer (Herranz et
al., 2010; Oberdoerffer et al., 2008) and neurodegeneration (de
Oliveira et al., 2010; Donmez et al., 2010; Qin et al., 2006).
Studies have linked the health benefits of CR to increased
mitochondrial biogenesis (Cerqueira et al., 2011; Choi et al.,
2011; Civitarese et al., 2007; Lopez-Lluch et al., 2006) and
delayed mitochondrial decline (Niemann et al., 2010) mediated by
the deacetylation and activation of PGC-1.alpha. by SIRT1 (Baur et
al., 2006; Gerhart-Hines et al., 2007; Lagouge et al., 2006; Minor
et al., 2011; Rodgers et al., 2005).
[0154] While oxidative metabolism is critical for the health of
metazoans, in the case of cancer the opposite is true. Cancer cells
typically undergo a shift away from oxidative phosphorylation
towards anaerobic glycolysis, allowing them to generate substrates
for biomass, even in the presence of oxygen. This metabolic
reprogramming, known as the Warburg effect (Warburg, 1956), is
driven by several different pathways including the mTOR pathway,
the oncogene c-Myc, and hypoxia-inducible factor 1 (HIF-1.alpha.),
to induce a survival response in low oxygen conditions (Cadenas et
al., 2010). Interestingly, both SIRT1 and SIRT3 regulate
HIF-1.alpha.. SIRT1 regulates HIF-1.alpha. transcriptional activity
under hypoxic conditions (Lim et al., 2010) while SIRT3 regulates
HIF-1.alpha. protein stability (Bell et al., 2011; Finley et al.,
2011). In C. elegans, the Hif-1 gene regulates lifespan and may
also mediate the effects of CR (Chen et al., 2009; Leiser and
Kaeberlein, 2010), however, a role for HIF-1.alpha. in mammalian
aging has not been explored.
[0155] The present disclosure provides evidence that a cause of the
disruption in mitochondrial homeostasis during aging is a
pseudohypoxic response that disrupts the coordination between the
nuclear and mitochondrial genomes, eliciting a specific decline in
mitochondrial-encoded genes. The cause was traced to a decline in
nuclear NAD.sup.+ and SIRT1 activity with age, which triggers the
accumulation of HIF-1.alpha. that suppresses the ability of c-Myc
to regulate TFAM, independently of the canonical PGC-1.alpha.
pathway. The result is an imbalance between nuclear- and
mitochondrial-encoded ETC components and loss of oxidative
phosphorylation (OXPHOS) capacity, leading to mitochondrial
dysfunction and thus loss of cell health (which in turn results in
e.g., aging, age-related diseases, and other diseases or disorders
described herein).
[0156] Accordingly, provided herein are methods and compositions
for treating or preventing diseases or disorders associated with
mitochondrial dysfunction (e.g., resulting from the deregulation of
mitochondrial homeostasis). In some embodiments, "mitochondrial
dysfunction" or "deregulation of mitochondrial homeostasis" means
that one or more mitochondrial component (e.g., ETC component) is
depleted, for example by a decrease in mitochondrial gene
expression or mitochondrial DNA content, resulting in compromised
mitochondrial function (e.g., loss of or decreased oxidative
phosphorylation (OXPHOS) capacity). Examples of diseases,
disorders, or conditions associated with mitochondrial dysfunction
include, but are not limited to, aging, aging-related diseases,
mitochondrial diseases (e.g., Alper's disease, Barth syndrome,
beta-oxidation defects, carnitine-acyl-carnitine deficiency,
carnitine deficiency, creatine deficiency syndromes, co-enzyme Q10
deficiency, complex I deficiency, complex H deficiency, complex HI
deficiency, complex IV deficiency/COX deficiency, complex V
deficiency, chronic progressive external ophthalmoplegia syndrome,
CPT I deficiency, CPT II deficiency, Kearns-Sayre syndrome, lactic
acidosis, long-chain acyl-CoA dehydrongenase deficiency, Leigh
disease, Luft disease, glutaric aciduria type II, mitochondrial
cytopathy, mitochondrial DNA depletion, mitochondrial
encephalopathy, mitochondrial myopathy, and Pearson syndrome),
metabolic diseases and disorders (e.g., amino acid deficiency),
diseases resulting from mitochondrial and energy deficiency,
lethargy, heart disorders, cardiovascular disease, stroke,
infarction, pulmonary hypertension, ischemia, cachexia, sarcopenia,
neurodegenerative diseases (e.g., Alzherimer's disease, Parkinson's
disease, Huntington's disease), dementia, lipodystrophy, liver
steatosis, hepatitis, cirrhosis, kidney failure, preeclampsia, male
infertility, obesity, diabetes (e.g., diabetes type I), muscle
disorders, and muscle wasting. In some aspects, methods and
compositions provided herein are useful for promoting cell
viability (in various species), vascular remodeling, wound healing
and healing in general (e.g., treating wounds resulting from cuts,
scrapes, surgery, bodily insults, trauma, burns, abrasions,
sunburns, etc.). In some aspects, the methods and compositions are
useful for promoting iron homeostasis and/or erythropoiesis. In
some aspects, methods and compositions provided herein are useful
to promote successful organ and tissue transplantation, or to
promote recovery from organ and tissue transplantation. In some
aspects, provided methods and compositions are useful for
preserving cells and organs. In some aspects, methods and
compositions provided herein have cosmetic applications, for
example for treating conditions associated with mitochondrial
dysfunction which relate to the skin or scalp/hair, such as skin
aging (e.g., loss in volume and elasticity, discoloration, liver
spots (lentigo senislis)), wrinkles, baldness, and loss of hair
pigmentation. In some embodiments, agents or compositions described
herein are useful for products or methods relating to cosmetics,
energy drinks, and/or animal industries.
[0157] In some embodiments, the methods include administering to
the subject an effective amount of an agent that inhibits
HIF-1.alpha.. HIF-1.alpha. inhibitors can inhibit activity of the
protein including its binding to hypoxia-responsive elements,
promote degradation of HIF-1.alpha., reduce HIF-1.alpha. protein
stability, or inhibit HIF-1.alpha. protein synthesis. Small
molecule HIF-1.alpha. inhibitors include: chrysin
(5,7-dihydroxyflavone); methyl
3-(2-(4-(adamantan-1-yl)phenoxy)acetamido)-4-hydroxybenzoate (LW6;
see Biochem Pharmacol. 2010 Oct. 1; 80(7):982-9); P3155 (see BMC
Cancer 2011, 11:338); NSC 644221 (see Clin Cancer Res. 2007 Feb. 1;
13(3):1010-8); S-2-amino-3-[4'-N,N,-bis(chloroethyl)amino]phenyl
propionic acid N-oxide dihydrochloride (PX-478, see Mol Cancer
Ther. 2008 January; 7(1):90-100); dimethyl-bisphenol A;
vincristine; apigenin (see Mol Carcinog. 2008 September;
47(9):686-700); 2-methoxyestradiol; chetomin; and echinomycin.
HIF-1.alpha. inhibitors also can include siRNA molecules (see BMC
Cancer 2010, 10:605; U.S. Ser. No. 13/555,589) or antisense
oligonucleotides (e.g., EZN-2968--see Mol Cancer Ther. 2008
November; 7(11):3598-608). The subject is typically a subject
having, or suspected of having a disease, disorder, or condition
associated with mitochondrial dysfunction (e.g., as described
herein).
[0158] In some embodiments, the methods further comprise
administering to the subject an effective amount of an agent that
increases the levels of nicotinamide adenine dinucleotide (NAD+;
which may also be referred to herein as NAD) in the subject.
Examples of such agents include NAD precursor, such as nicotinic
acid, nicotinamide, nicotinamide mononucleotide (NMN), nicotinamide
riboside (NR), or a salt thereof or prodrug thereof. In some
embodiments, such an agent is administered at a dose of between
0.5-5 grams per day. In some embodiments, NMN is orally
administered in doses of between 250 mg-5 grams per day. NAD.sup.+
levels also can be increased by increasing the activity of enzymes
(or enzymatically active fragments thereof) involved in NAD.sup.+
biosynthesis (de novo synthesis or salvage pathways). Enzymes
involved in NAD.sup.+ biosynthesis such as nicotinate
phosphoribosyl transferase 1 (NPT1), pyrazinamidase/nicotinamidase
1 (PNC1), nicotinic acid mononucleotide adenylyltransferase 1
(NMA1), nicotinic acid mononucleotide adenylyltransferase 2 (NMA2),
nicotinamide N-methyltransferase (NNMT), nicotinamide
phosphoribosyl transferase (NAMPT or NAMPRT),
nicotinate/nicotinamide mononucleotide adenylyl transferase 1
(NMNAT-1), and nicotinamide mononucleotide adenylyl transferase 2
(NMNAT-2); are described in U.S. Pat. No. 7,977,049, which is
incorporated by reference herein. The HIF-1.alpha. inhibitor and
agent that increases the levels of NAD.sup.+ can be administered
simultaneously (e.g., as a single formulation) or sequentially
(e.g., as separate formulations).
[0159] In some embodiments, the methods include administering to a
subject an effective amount of an agent that increases the levels
of NAD+, without administering an inhibitor of HIF-1.alpha..
[0160] Aspects of the invention thus relate to compositions of
matter including NAD.sup.+ precursors, such as NMN or a salt
thereof or prodrug thereof. Further aspects of the invention relate
to compositions of matter including an enzyme involved in NAD+
biosynthesis, such as NMNAT-1 or NAMPT, or an enzymatically active
fragment thereof, or a nucleic acid encoding an enzyme involved in
NAD.sup.+ biosynthesis, or an enzymatically active fragment
thereof. In some embodiments, compositions include conjugates of
agents described herein, such as fish oil conjugates.
[0161] As used herein, the term "prodrug" means a derivative of a
compound that can hydrolyze, oxidize, or otherwise react under
biological conditions (in vitro or in vivo) to provide a compound
described herein as useful in the methods of the invention. While
prodrugs typically are designed to provide active compound upon
reaction under biological conditions, prodrugs may have similar
activity as a prodrug.
[0162] The references by Goodman and Gilman (The Pharmacological
Basis of Therapeutics, 8th Ed, McGraw-Hill, Int. Ed. 1992,
"Biotransformation of Drugs", p 13-15); T. Higuchi and V. Stella
(Pro-drugs as Novel Delivery Systems, Vol. 14 of the A.C.S.
Symposium Series); and Bioreversible Carriers in Drug Design (E. B.
Roche, ed., American Pharmaceutical Association and Pergamon Press,
1987) describing pro-drugs generally are hereby incorporated by
reference. Prodrugs of the compounds described herein can be
prepared by modifying functional groups present in said component
in such a way that the modifications are cleaved, either in routine
manipulation or in vivo, to the parent component. Typical examples
of prodrugs are described for instance in WO 99/33795, WO 99/33815,
WO 99/33793 and WO 99/33792, each of which is incorporated herein
by reference for these teachings. Prodrugs can be characterized by
increased bio-availability and are readily metabolized into the
active inhibitors in vivo.
[0163] Examples of prodrugs include, but are not limited to,
analogs or derivatives of the compounds described herein, further
comprising biohydrolyzable moieties such as biohydrolyzable amides,
biohydrolyzable esters, biohydrolyzable carbamates, biohydrolyzable
carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate
analogues. Other examples of prodrugs include derivatives of the
compounds described herein that comprise --NO, --NO.sub.2, --ONO,
or --ONO.sub.2 moieties. Prodrugs are prepared using methods known
to those of skill in the art, such as those described by BURGER'S
MEDICINAL CHEMISTRY AND DRUG DISCOVERY (1995) 172-178, 949-982
(Manfred E. Wolff ed., 5.sup.th ed), the entire teachings of which
are incorporated herein by reference.
[0164] As used herein, the terms "biohydrolyzable amide,"
"biohydrolyzable ester," "biohydrolyzable carbamate,"
"biohydrolyzable carbonate," "biohydrolyzable ureide" and
"biohydrolyzable phosphate analogue" mean an amide, ester,
carbamate, carbonate, ureide, or phosphate analogue, respectively,
that either: 1) does not destroy the biological activity of the
compound and confers upon that compound advantageous properties in
vivo, such as uptake, duration of action, or onset of action; or 2)
is itself biologically inactive but is converted in vivo to a
biologically active compound. Examples of biohydrolyzable amides
include, but are not limited to, lower alkyl amides, .alpha.-amino
acid amides, alkoxyacyl amides, and alkylaminoalkylcarbonyl amides.
Examples of biohydrolyzable esters include, but are not limited to,
lower alkyl esters, alkoxyacyloxy esters, alkyl acylamino alkyl
esters, and choline esters. Examples of biohydrolyzable carbamates
include, but are not limited to, lower alkylamines, substituted
ethylenediamines, aminoacids, hydroxyalkylamines, heterocyclic and
heteroaromatic amines, and polyether amines.
[0165] Prodrugs can include fatty acids or lipids linked to the
compounds described herein by the moieties described herein.
Exemplary fatty acids include the omega-3 fatty acids
eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Such
prodrugs and the preparation thereof will be clear to the skilled
person; reference is for instance made to the prodrug types and
preparations described in U.S. Pat. No. 5,994,392, U.S. Pat. No.
4,933,324 and U.S. Pat. No. 5,284,876.
[0166] As used herein, the term "salt" or "pharmaceutically
acceptable salt" refers to those salts which are, within the scope
of sound medical judgment, suitable for use in contact with the
tissues of humans and lower animals without undue toxicity,
irritation, allergic response and the like, and are commensurate
with a reasonable benefit/risk ratio. Pharmaceutically acceptable
salts are well known in the art. For example, Berge et al.,
describes pharmaceutically acceptable salts in detail in J.
Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable
salts of the compounds of this invention include those derived from
suitable inorganic and organic acids and bases. Examples of
pharmaceutically acceptable, nontoxic acid addition salts are salts
of an amino group formed with inorganic acids such as hydrochloric
acid, hydrobromic acid, phosphoric acid, sulfuric acid and
perchloric acid or with organic acids such as acetic acid, oxalic
acid, maleic acid, tartaric acid, citric acid, succinic acid or
malonic acid or by using other methods used in the art such as ion
exchange. Other pharmaceutically acceptable salts include adipate,
alginate, ascorbate, aspartate, benzenesulfonate, benzoate,
bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate,
cyclopentanepropionate, digluconate, dodecylsulfate,
ethanesulfonate, formate, fumarate, glucoheptonate,
glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate,
hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate,
laurate, lauryl sulfate, malate, maleate, malonate,
methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate,
oleate, oxalate, palmitate, pamoate, pectinate, persulfate,
3-phenylpropionate, phosphate, picrate, pivalate, propionate,
stearate, succinate, sulfate, tartrate, thiocyanate,
p-toluenesulfonate, undecanoate, valerate salts, and the like.
Salts derived from appropriate bases include alkali metal, alkaline
earth metal, ammonium and N.sup.+(C.sub.1-4alkyl).sub.4 salts.
Representative alkali or alkaline earth metal salts include sodium,
lithium, potassium, calcium, magnesium, and the like. Further
pharmaceutically acceptable salts include, when appropriate,
nontoxic ammonium, quaternary ammonium, and amine cations formed
using counterions such as halide, hydroxide, carboxylate, sulfate,
phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.
[0167] As used herein, the term "solvate" includes any combination
which may be formed by a compound of this invention with a suitable
inorganic solvent (e.g. hydrates) or organic solvent, such as but
not limited to alcohols, ketones, esters and the like. Such salts,
hydrates, solvates, etc. and the preparation thereof will be clear
to the skilled person; reference is for instance made to the salts,
hydrates, solvates, etc. described in U.S. Pat. No. 6,372,778, U.S.
Pat. No. 6,369,086, U.S. Pat. No. 6,369,087 and U.S. Pat. No.
6,372,733.
[0168] Thus, the invention includes methods for delivering agents
to a subject. As used herein, the term "subject" refers to a human
or non-human mammal. Non-human mammals include livestock animals,
companion animals, laboratory animals, and non-human primates.
Non-human subjects also specifically include, without limitation,
chickens, horses, cows, pigs, goats, dogs, cats, guinea pigs,
hamsters, mink, and rabbits. In some embodiments the subject is a
patient. As used herein, a "patient" refers to a subject who is
under the care of a physician, dentist, or other health care
worker, including someone who has consulted with, received advice
from or received a prescription or other recommendation from a
physician or other health care worker. A patient is typically a
subject having or at risk of having a disorder associated with
mitochondrial dysfunction.
Pharmaceutical Compositions
[0169] In some embodiments, pharmaceutical compositions comprising
one or more HIF-1.alpha. inhibitors and/or one or more agents that
increase the level of NAD.sup.+ in a subject are provided. In some
aspects, the HIF-1.alpha. inhibitors and additional agents are
collectively referred to as the "agents" or "active ingredient"s of
the pharmaceutical compositions provided herein. The compositions
comprising the agents can be mixed with a pharmaceutically
acceptable carrier, either taken alone or in combination with the
one or more additional therapeutic agents described above, to form
pharmaceutical compositions. A pharmaceutically acceptable carrier
is compatible with the active ingredient(s) of the composition (and
preferably, capable of stabilizing it). Such compositions are
delivered or administered in effective amounts to treat an
individual, such as a human having a disease or disorder resulting
from a nonsense mutation, for example those described herein. To
"treat" a disease, means to reduce or eliminate a sign or symptom
of the disease, to stabilize the disease, and/or to reduce or slow
further progression of the disease. In some embodiments, "treat",
"treatment" or "treating" is intended to include prophylaxis,
amelioration, prevention or cure from the disease.
[0170] Actual dosage levels of active ingredients in the
pharmaceutical compositions of the invention can be varied to
obtain an amount of the active HIF-1.alpha. inhibitor(s) and/or
other agent(s) that is effective to achieve the desired therapeutic
response for a particular patient, combination, and mode of
administration. The selected dosage level depends upon the activity
of the particular HIF-1.alpha. inhibitors and other agent(s), the
route of administration, the severity of the condition being
treated, the condition, and prior medical history of the patient
being treated. However, it is within the skill of one in the art to
start doses of the compositions described herein at levels lower
than required to achieve the desired therapeutic effort and to
gradually increase the dosage until the desired effect is achieved.
A "therapeutically effective amount," as used herein, refers to an
amount of a compound and/or an additional therapeutic agent, or a
composition thereof that results in improvement (complete or
partial) of a disease or disorder caused by mitochondrial
dysfunction (e.g., mitochondrial homeostasis deregulation). A
therapeutically effective amount also refers to an amount that
prevents or delays the onset of a disease or disorder caused by
mitochondrial dysfunction. The therapeutically effective amount
will vary with the particular condition being treated, the age and
physical condition of the subject being treated, the severity of
the condition, the duration of the treatment, the nature of the
concurrent therapy (if any), the specific route of administration,
and like factors are within the knowledge and expertise of the
health practitioner. For example, an effective amount can depend
upon the duration the subject has had the disease. In some aspects,
an effective amount of a composition described herein when
administered to a subject results in e.g., increased muscle
strength, increased motility, restoration of muscle function or
phenotype, decreased fatigue, decreased difficulty with motor
skills, decreased dementia, etc. In some aspects, the desired
therapeutic or clinical effect resulting from administration of an
effective amount of a composition described herein, may be measured
or monitored by methods known to those of ordinary skill in the art
e.g., by routine physical examination.
[0171] In the combination therapies, an effective amount can refer
to each individual agent or to the combination as a whole, wherein
the amounts of all agents administered are together effective, but
wherein the component agent of the combination may not be present
individually in an effective amount.
[0172] The pharmaceutical compositions described herein (e.g.,
those containing HIF-1.alpha. inhibitors and/or agents that
increase NAD.sup.+ levels), can be administered to a subject by any
suitable route. For example, compositions can be administered
orally, including sublingually, rectally, parenterally,
intracisternally, intravaginally, intraperitoneally, topically and
transdermally (as by powders, ointments, or drops), bucally, or
nasally. The term "parenteral" administration as used herein refers
to modes of administration other than through the gastrointestinal
tract, which include intravenous, intramuscular, intraperitoneal,
infrasternal, intramammary, intraocular, retrobulbar,
intrapulmonary, intrathecal, subcutaneous and intraarticular
injection and infusion. Surgical implantation also is contemplated,
including, for example, embedding a composition of the disclosure
in the body such as, for example, in the brain, in the abdominal
cavity, under the splenic capsule, brain, or in the cornea.
[0173] The pharmaceutical compositions described herein can also be
administered in the form of liposomes. As is known in the art,
liposomes generally are derived from phospholipids or other lipid
substances. Liposomes are formed by mono- or multi-lamellar
hydrated liquid crystals that are dispersed in an aqueous medium.
Any nontoxic, physiologically acceptable, and metabolizable lipid
capable of forming liposomes can be used. The present compositions
in liposome form can contain, in addition to an agent of the
present disclosure, stabilizers, preservatives, excipients, and the
like. The preferred lipids are the phospholipids and the
phosphatidyl cholines (lecithins), both natural and synthetic.
Methods to form liposomes are known in the art. See, for example,
Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press,
New York, N.Y. (1976), p. 33, et seq.
[0174] Dosage forms for topical administration of the
pharmaceutical compositions described herein include powders,
sprays, ointments, and inhalants as described herein. The active
agent(s) is mixed under sterile conditions with a pharmaceutically
acceptable carrier and any needed preservatives, buffers, or
propellants which may be required. Ophthalmic formulations, eye
ointments, powders, and solutions also are contemplated as being
within the scope of this disclosure.
[0175] Pharmaceutical compositions (e.g., those containing
HIF-1.alpha. inhibitors and/or agents that increase NAD.sup.+
levels) for parenteral injection comprise pharmaceutically
acceptable sterile aqueous or non-aqueous solutions, dispersions,
suspensions, or emulsions, as well as sterile powders for
reconstitution into sterile injectable solutions or dispersions
just prior to use. Examples of suitable aqueous and non-aqueous
carriers, diluents, solvents, or vehicles include water ethanol,
polyols (such as, glycerol, propylene glycol, polyethylene glycol,
and the like), and suitable mixtures thereof, vegetable oils (such,
as olive oil), and injectable organic esters such as ethyl oleate.
Proper fluidity can be maintained, for example, by the use of
coating materials such as lecithin, by the maintenance of the
required particle size in the case of dispersions, and by the use
of surfactants.
[0176] Compositions also can contain adjuvants such as
preservatives, wetting agents, emulsifying agents, and dispersing
agents. Prevention of the action of microorganisms can be ensured
by the inclusion of various antibacterial and antifungal agents,
for example, paraben, chlorobutanol, phenol sorbic acid, and the
like. It also may be desirable to include isotonic agents such as
sugars, sodium chloride, and the like. Prolonged absorption of the
injectable pharmaceutical form can be brought about by the
inclusion of agents which delay absorption, such as aluminum
monostearate and gelatin.
[0177] In some cases, in order to prolong the effect of the
pharmaceutical compositions described herein (e.g., those
containing HIF-1.alpha. inhibitors and/or agents that increase
NAD.sup.+ levels), it is desirable to slow the absorption of the
drug from subcutaneous or intramuscular injection. This result can
be accomplished by the use of a liquid suspension of crystalline or
amorphous materials with poor water solubility. The rate of
absorption of the active agent(s) then depends upon its rate of
dissolution which, in turn, may depend upon crystal size and
crystalline form. Alternatively, delayed absorption of a
parenterally administered active agent(s) is accomplished by
dissolving or suspending the agent(s) in an oil vehicle.
[0178] Injectable depot forms are made by forming microencapsule
matrices of the agent(s) in biodegradable polymers such a
polylactide-polyglycolide. Depending upon the ratio of agent(s) to
polymer and the nature of the particular polymer employed, the rate
of agent(s) release can be controlled. Examples of other
biodegradable polymers include poly(orthoesters) and
poly(anhydrides). Depot injectable formulations also are prepared
by entrapping the agent(s) in liposomes or microemulsions which are
compatible with body tissue.
[0179] The injectable formulations can be sterilized, for example,
by filtration through a bacterial- or viral-retaining filter, or by
incorporating sterilizing agents in the form of sterile solid
compositions which can be dissolved or dispersed in sterile water
or other sterile injectable medium just prior to use.
[0180] Also described here are methods for oral administration of
the pharmaceutical compositions described herein. Oral solid dosage
forms are described generally in Remington's Pharmaceutical
Sciences, 18th Ed., 1990 (Mack Publishing Co. Easton Pa. 18042) at
Chapter 89. Solid dosage forms for oral administration include
capsules, tablets, pills, powders, troches or lozenges, cachets,
pellets, and granules. Also, liposomal or proteinoid encapsulation
can be used to formulate the present compositions (as, for example,
proteinoid microspheres reported in U.S. Pat. No. 4,925,673).
Liposomal encapsulation may include liposomes that are derivatized
with various polymers (e.g., U.S. Pat. No. 5,013,556). In general,
the formulation includes the agent(s) and inert ingredients which
protect against degradation in the stomach and which permit release
of the biologically active material in the intestine. In some
embodiments, agents that increase levels of NAD.sup.+, for example
NMN, can be orally administered in dosages from 250 mg to 5 grams
per day.
[0181] In such solid dosage forms, the agent(s) is mixed with, or
chemically modified to include, a least one inert, pharmaceutically
acceptable excipient or carrier. The excipient or carrier
preferably permits (a) inhibition of proteolysis and/or nucleic
acid degradation, and (b) uptake into the blood stream from the
stomach or intestine. In a most preferred embodiment, the excipient
or carrier increases uptake of the agent(s), overall stability of
the agent(s) and/or circulation time of the agent(s) in the body.
Excipients and carriers include, for example, sodium citrate or
dicalcium phosphate and/or (a) fillers or extenders such as
starches, lactose, sucrose, glucose, cellulose, modified dextrans,
mannitol, and silicic acid, as well as inorganic salts such as
calcium triphosphate, magnesium carbonate and sodium chloride, and
commercially available diluents such as FAST-FLO.RTM., EMDEX.RTM.,
STA-RX 1500.RTM., EMCOMPRESS.RTM. and AVICEL.RTM., (b) binders such
as, for example, methylcellulose ethylcellulose,
hydroxypropyhnethyl cellulose, carboxymethylcellulose, gums (e.g.,
alginates, acacia), gelatin, polyvinylpyrrolidone, and sucrose, (c)
humectants, such as glycerol, (d) disintegrating agents, such as
agar-agar, calcium carbonate, potato or tapioca starch, alginic
acid, certain silicates, sodium carbonate, starch including the
commercial disintegrant based on starch, EXPLOTAB.RTM., sodium
starch glycolate, AMBERLITE.RTM., sodium carboxymethylcellulose,
ultramylopectin, gelatin, orange peel, carboxymethyl cellulose,
natural sponge, bentonite, insoluble cationic exchange resins, and
powdered gums such as agar, karaya or tragacanth; (e) solution
retarding agents such a paraffm, (f) absorption accelerators, such
as quaternary ammonium compounds and fatty acids including oleic
acid, linoleic acid, and linolenic acid (g) wetting agents, such
as, for example, cetyl alcohol and glycerol monosterate, anionic
detergent surfactants including sodium lauryl sulfate, dioctyl
sodium sulfosuccinate, and dioctyl sodium sulfonate, cationic
detergents, such as benzalkonium chloride or benzethonium chloride,
nonionic detergents including lauromacrogol 400, polyoxyl 40
stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60,
glycerol monostearate, polysorbate 40, 60, 65, and 80, sucrose
fatty acid ester, methyl cellulose and carboxymethyl cellulose; (h)
absorbents, such as kaolin and bentonite clay, (i) lubricants, such
as talc, calcium sterate, magnesium stearate, solid polyethylene
glycols, sodium lauryl sulfate, polytetrafluoroethylene (PTFE),
liquid paraffin, vegetable oils, waxes, CARBOWAX.RTM. 4000,
CARBOWAX.RTM. 6000, magnesium lauryl sulfate, and mixtures thereof;
(j) glidants that improve the flow properties of the drug during
formulation and aid rearrangement during compression that include
starch, talc, pyrogenic silica, and hydrated silicoaluminate. In
the case of capsules, tablets, and pills, the dosage form also can
comprise buffering agents.
[0182] Solid compositions of a similar type also can be employed as
fillers in soft and hard-filled gelatin capsules, using such
excipients as lactose or milk sugar, as well as high molecular
weight polyethylene glycols and the like.
[0183] The solid dosage forms of tablets, dragees, capsules, pills,
and granules can be prepared with coatings and shells, such as
enteric coatings and other coatings well known in the
pharmaceutical formulating art. They optionally can contain
opacifying agents and also can be of a composition that they
release the active ingredients(s) only, or preferentially, in a
part of the intestinal tract, optionally, in a delayed manner.
Exemplary materials include polymers having pH sensitive
solubility, such as the materials available as EUDRAGIT.RTM.
Examples of embedding compositions which can be used include
polymeric substances and waxes.
[0184] The agent(s) also can be in micro-encapsulated form, if
appropriate, with one or more of the above-mentioned
excipients.
[0185] Liquid dosage forms for oral administration include
pharmaceutically acceptable emulsions, solutions, suspensions,
syrups, and elixirs. In addition to the active ingredient(s), the
liquid dosage forms can contain inert diluents commonly used in the
art, such as, for example, water or other solvents, solubilizing
agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol
ethyl carbonate ethyl acetate, benzyl alcohol, benzyl benzoate,
propylene glycol, 1,3-butylene glycol, dimethyl formamide, oils (in
particular, cottonseed, groundnut, corn, germ, olive, castor, and
sesame oils), glycerol, tetrahydroflirfuryl alcohol, polyethylene
glycols, fatty acid esters of sorbitan, and mixtures thereof.
[0186] Besides inert diluents, the oral compositions also can
include adjuvants, such as wetting agents, emulsifying and
suspending agents, sweetening, coloring, flavoring, and perfuming
agents. Oral compositions can be formulated and further contain an
edible product, such as a beverage. Oral composition can also be
administered by oral gavage.
[0187] Suspensions, in addition to the active ingredient(s), can
contain suspending agents such as, for example ethoxylated
isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters,
microcrystalline cellulose, aluminum metahydroxide, bentonite,
agar-agar, tragacanth, and mixtures thereof.
[0188] Also contemplated herein is pulmonary delivery of the
HIF-1.alpha. inhibitors and/or agents that increase NAD.sup.+
levels. The agents are delivered to the lungs of a mammal while
inhaling, thereby promoting the traversal of the lung epithelial
lining to the blood stream. See, Adjei et al., Pharmaceutical
Research 7:565-569 (1990); Adjei et al., International Journal of
Pharmaceutics 63:135-144 (1990) (leuprolide acetate); Braquet et
al., Journal of Cardiovascular Pharmacology 13 (suppl. 5): s.
143-146 (1989)(endothelin-1); Hubbard et al., Annals of Internal
Medicine 3:206-212 (1989)(.alpha.1-antitrypsin); Smith et al., J.
Clin. Invest. 84:1145-1146 (1989) (.alpha.1-proteinase); Oswein et
al., "Aerosolization of Proteins," Proceedings of Symposium on
Respiratory Drug Delivery II, Keystone, Colo., March, 1990
(recombinant human growth hormone); Debs et al., The Journal of
Immunology 140:3482-3488 (1988) (interferon-.gamma. and tumor
necrosis factor .alpha.) and Platz et al., U.S. Pat. No. 5,284,656
(granulocyte colony stimulating factor).
[0189] Contemplated for use in the practice of this invention are a
wide range of mechanical devices designed for pulmonary delivery of
therapeutic products, including, but not limited to, nebulizers,
metered dose inhalers, and powder inhalers, all of which are
familiar to those skilled in the art.
[0190] Some specific examples of commercially available devices
suitable for the practice of the invention are the ULTRAVENT.RTM.
nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Mo.; the
ACORN II.RTM. nebulizer, manufactured by Marquest Medical Products,
Englewood, Colo.; the VENTOL.RTM. metered dose inhaler,
manufactured by Glaxo Inc., Research Triangle Park, N.C.; and the
SPINHALER.RTM. powder inhaler, manufactured by Fisons Corp.,
Bedford, Mass.
[0191] All such devices require the use of formulations suitable
for the dispensing of the agent(s) described herein. Typically,
each formulation is specific to the type of device employed and can
involve the use of an appropriate propellant material, in addition
to diluents, adjuvants, and/or carriers useful in therapy.
[0192] The composition is prepared in particulate form, preferably
with an average particle size of less than 10 .mu.m, and most
preferably 0.5 to 5 .mu.m, for most effective delivery to the
distal lung.
[0193] Carriers include carbohydrates such as trehalose, mannitol,
xylitol, sucrose, lactose, and sorbitol. Other ingredients for use
in formulations may include lipids, such as DPPC, DOPE, DSPC and
DOPC, natural or synthetic surfactants, polyethylene glycol (even
apart from its use in derivatizing the inhibitor itself), dextrans,
such as cyclodextran, bile salts, and other related enhancers,
cellulose and cellulose derivatives, and amino acids.
[0194] Also, the use of liposomes, microcapsules or microspheres,
inclusion complexes, or other types of carriers is
contemplated.
[0195] Formulations suitable for use with a nebulizer, either jet
or ultrasonic, typically comprise an agent of the invention
dissolved in water at a concentration of about 0.1 to 25 mg of
biologically active protein per mL of solution. The formulation
also can include a buffer and a simple sugar (e.g., for protein
stabilization and regulation of osmotic pressure). The nebulizer
formulation also can contain a surfactant to reduce or prevent
surface-induced aggregation of the inhibitor composition caused by
atomization of the solution in forming the aerosol.
[0196] Formulations for use with a metered-dose inhaler device
generally comprise a finely divided powder containing the agent
suspended in a propellant with the aid of a surfactant. The
propellant can be any conventional material employed for this
purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon, a
hydrofluorocarbon, or a hydrocarbon, including
trichlorofluoromethane, dichlorodifluoromethane,
dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or
combinations thereof. Suitable surfactants include sorbitan
trioleate and soya lecithin. Oleic acid also can be useful as a
surfactant.
[0197] Formulations for dispensing from a powder inhaler device
comprise a finely divided dry powder containing the agent(s) and
also can include a bulking agent, such as lactose, sorbitol,
sucrose, mannitol, trehalose, or xylitol, in amounts which
facilitate dispersal of the powder from the device, e.g., 50 to 90%
by weight of the formulation.
[0198] Nasal delivery of the agent(s) and compositions of the
invention also are contemplated. Nasal delivery allows the passage
of the agent(s) or composition to the blood stream directly after
administering the therapeutic product to the nose, without the
necessity for deposition of the product in the lung. Formulations
for nasal delivery include those with dextran or cyclodextran.
Delivery via transport across other mucous membranes also is
contemplated.
[0199] Compositions for rectal or vaginal administration are
preferably suppositories which can be prepared by mixing the
agent(s) with suitable nonirritating excipients or carriers, such
as cocoa butter, polyethylene glycol, or suppository wax, which are
solid at room temperature, but liquid at body temperature, and
therefore melt in the rectum or vaginal cavity and release the
active agent.
[0200] In order to facilitate delivery of agent(s) across cell
and/or nuclear membranes, compositions of relatively high
hydrophobicity are preferred. Agent(s) can be modified in a manner
which increases hydrophobicity, or the agents can be encapsulated
in hydrophobic carriers or solutions which result in increased
hydrophobicity.
[0201] In one aspect, the invention provides kits comprising a
pharmaceutical composition comprising a therapeutically effective
amount of one or more HIF-1.alpha. inhibitors and/or a
therapeutically effective amount of one or more agents that
increase NAD.sup.+ levels and instructions for administration of
the pharmaceutical composition. In some aspects of the invention,
the kit can include a pharmaceutical preparation vial, a
pharmaceutical preparation diluent vial, and the HIF-1.alpha.
inhibitors(s) and additional agent(s). The diluent vial contains a
diluent such as physiological saline for diluting what could be a
concentrated solution or lyophilized powder of the agent of the
invention. In some embodiments, the instructions include
instructions for mixing a particular amount of the diluent with a
particular amount of the concentrated pharmaceutical preparation,
whereby a final formulation for injection or infusion is prepared.
In some embodiments, the instructions include instructions for use
in a syringe or other administration device. In some embodiments,
the instructions include instructions for treating a patient with
an effective amount of the HIF-1.alpha. inhibitors(s) and optional
additional agent(s). It also will be understood that the containers
containing the preparations, whether the container is a bottle, a
vial with a septum, an ampoule with a septum, an infusion bag, and
the like, can contain indicia such as conventional markings which
change color when the preparation has been autoclaved or otherwise
sterilized.
[0202] In another embodiment, methods for screening for inhibitors
of HIF-1.alpha. are provided. As described herein, increased
HIF-1.alpha. activity or levels is causative of mitochondrial
dysfunction. Such dysfunction can be measured according to standard
methods, for example any of those described in the Examples
section. In one example, a readout of mitochondrial dysfunction
(e.g., resulting from increased levels or activity of HIF-1.alpha.)
is a decrease in mitochondrial gene expression. Thus, in some
aspects a screening method for identifying a HIF-1.alpha.
inhibitors comprises (a) contacting a eukaryotic cell with a
candidate compound; (b) determining the level of expression of one
or more mitochondrial genes; (c) comparing the level of expression
determined in (b) to a reference level of expression, wherein the
reference level is determined in the absence of the candidate
compound; and (d) identifying the compound as a HIF-1.alpha.
inhibitor if a significantly decreased level of mitochondrial gene
expression is determined in (b), as compared to the reference level
in (c). In some aspects, the reference level is a predetermined
level, for example the wild type level, or the level in a mutant
cell. In some aspects, the one or more mitochondrial genes is
selected from any of the 13 genes encoding protein in the
mitochondrial genome, for example cytochrome b, cytochrome oxidase,
NADH dehydrogenase, or ATP synthase. In some aspects, the
eukaryotic cell is any of the cells described in the Examples
section, including those genetically modified. For example, the
cell may comprise a knockout of SIRT1, which as described herein
has an accumulation of HIF1-.alpha., and thus mitochondrial
dysfunction. Thus, in this example, the method would comprise
contacting the cell with a candidate compound and identifying the
compound as a HIF-1.alpha. inhibitor if the candidate compound
increases mitochondrial gene expression, or otherwise improves or
restores mitochondrial function or homeostasis.
[0203] In some embodiments, the readout of mitochondrial
dysfunction (e.g., resulting from increased levels or activity of
HIF-1.alpha.) is a loss or depletion of mitochondrial DNA content.
Thus, in some aspects, the method comprises (a) contacting a
eukaryotic cell with a candidate compound; (b) determining the
amount of mitochondrial DNA in the cell; (c) comparing the amount
determined in (b) to a reference amount, wherein the reference
level is determined in the absence of the candidate compound; and
(d) identifying the compound as a HIF-1.alpha. inhibitor if a
significantly decreased amount of mitochondrial DNA is determined
in (b), as compared to the reference level in (c). In some aspects,
the reference level is a predetermined level, for example the wild
type level, or the level in a mutant cell. In some aspects, the
eukaryotic cell is any of the cells described in the Examples
section, including those genetically modified. For example, the
cell may comprise a knockout of SIRT1, which as described herein
has an accumulation of HIF1-.alpha., and thus mitochondrial
dysfunction (and depletion or loss of mitochondrial DNA). Thus, in
this example, the method would comprise contacting the cell with a
candidate compound and identifying the compound as a HIF-1.alpha.
inhibitor if the candidate compound increases the amount of
mitochondrial DNA in the cell.
[0204] Described herein are methods for rapidly reversing Warburg
metabolism that is known to drive tumorigenesis and tumor growth.
Methods can include administering a safe pharmacological agent,
such as NMN, or a salt or prodrug thereof. One of the main drivers
of cellular proliferation is HIF-1.alpha., a hypoxia responsive
transcription factor. It was observed that HIF-1.alpha. is
increased during aging and that NAD precursors and NAD biosynthetic
genes (e.g., NMNAT-1 and NAMPT) counteract HIE activity. It was
also observed that this is mediated, in part, by the repression of
VHL, an E3 ubiquitin ligase that promotes degradation of HIF-1 via
the proteasome. Demonstrated herein are methods for modulating gene
expression and metabolism of cells that would be beneficial in
cancer treatment and/or prevention. Thus, compounds and genes that
raise NAD will be beneficial for the prevention and treatment of
cancer and modulating cellular proliferation.
[0205] Aspects of the invention relate to administering compounds
such as NMN and NR, two precursors of NAD to treat most cancer
types. In some embodiments, the dose is in the range of 0.5-5 grams
per day.
[0206] This invention is not limited in its application to the
details of construction and the arrangement of components set forth
in the following description or illustrated in the drawings. The
invention is capable of other embodiments and of being practiced or
of being carried out in various ways. Also, the phraseology and
terminology used herein is for the purpose of description and
should not be regarded as limiting. The use of "including,"
"comprising," or "having," "containing," "involving," and
variations thereof herein, is meant to encompass the items listed
thereafter and equivalents thereof as well as additional items.
[0207] Provided herein are methods for treating or preventing
cancer in a subject in need thereof. The methods include
administering to the subject an effective amount of an agent that
increases the level of NAD+ in the subject. Examples of such agents
include NAD+ precursors, such as NMN or a salt thereof or prodrug
thereof. In some embodiments, such an agent is administered at a
dose of between 0.5-5 grams per day. Other examples of agents
include an enzyme involved in NAD+ biosynthesis, such as NMNAT-1 or
NAMPT, or an enzymatically active fragment thereof, or a nucleic
acid encoding an enzyme involved in NAD+ biosynthesis, or an
enzymatically active fragment thereof. In some embodiments the
subject is a human or non-human mammal.
[0208] Agents that increase levels of nicotinamide adenine
dinucleotide (NAD+; which may also be referred to herein as NAD)
include NAD+ precursors, such as nicotinic acid, nicotinamide,
nicotinamide mononucleotide (NMN) and nicotinamide riboside
(NR).
[0209] NAD+ levels also can be increased by increasing the activity
of enzymes involved in NAD+ biosynthesis (de novo synthesis or
salvage pathways). Enzymes involved in NAD+ biosynthesis such as
nicotinate phosphoribosyl transferase 1 (NPT1),
pyrazinamidase/nicotinamidase 1 (PNC1), nicotinic acid
mononucleotide adenylyltransferase 1 (NMA1), nicotinic acid
mononucleotide adenylyltransferase 2 (NMA2), nicotinamide
N-methyltransferase (NNMT), nicotinamide phosphoribosyl transferase
(NAMPT or NAMPRT), nicotinate/nicotinamide mononucleotide adenylyl
transferase 1 (NMNAT-1), and nicotinamide mononucleotide adenylyl
transferase 2 (NMNAT-2); are described in U.S. Pat. No. 7,977,049,
which is incorporated by reference herein.
[0210] As used herein, the term "prodrug" means a derivative of a
compound that can hydrolyze, oxidize, or otherwise react under
biological conditions (in vitro or in vivo) to provide a compound
described herein as useful in the methods of the invention. While
prodrugs typically are designed to provide active compound upon
reaction under biological conditions, prodrugs may have similar
activity as a prodrug.
[0211] The references by Goodman and Gilman (The Pharmacological
Basis of Therapeutics, 8th Ed, McGraw-Hill, Int. Ed. 1992,
"Biotransformation of Drugs", p 13-15); T. Higuchi and V. Stella
(Pro-drugs as Novel Delivery Systems, Vol. 14 of the A.C.S.
Symposium Series); and Bioreversible Carriers in Drug Design (E. B.
Roche, ed., American Pharmaceutical Association and Pergamon Press,
1987) describing pro-drugs generally are hereby incorporated by
reference. Prodrugs of the compounds described herein can be
prepared by modifying functional groups present in said component
in such a way that the modifications are cleaved, either in routine
manipulation or in vivo, to the parent component. Typical examples
of prodrugs are described for instance in WO 99/33795, WO 99/33815,
WO 99/33793 and WO 99/33792, each of which is incorporated herein
by reference for these teachings. Prodrugs can be characterized by
increased bio-availability and are readily metabolized into the
active inhibitors in vivo.
[0212] Examples of prodrugs include, but are not limited to,
analogs or derivatives of the compounds described herein, further
comprising biohydrolyzable moieties such as biohydrolyzable amides,
biohydrolyzable esters, biohydrolyzable carbamates, biohydrolyzable
carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate
analogues. Other examples of prodrugs include derivatives of the
compounds described herein that comprise --NO, --NO.sub.2, --ONO,
or --ONO.sub.2 moieties. Prodrugs are prepared using methods known
to those of skill in the art, such as those described by BURGER'S
MEDICINAL CHEMISTRY AND DRUG DISCOVERY (1995) 172-178, 949-982
(Manfred E. Wolff ed., 5.sup.th ed), the entire teachings of which
are incorporated herein by reference.
[0213] As used herein, the terms "biohydrolyzable amide,"
"biohydrolyzable ester," "biohydrolyzable carbamate,"
"biohydrolyzable carbonate," "biohydrolyzable ureide" and
"biohydrolyzable phosphate analogue" mean an amide, ester,
carbamate, carbonate, ureide, or phosphate analogue, respectively,
that either: 1) does not destroy the biological activity of the
compound and confers upon that compound advantageous properties in
vivo, such as uptake, duration of action, or onset of action; or 2)
is itself biologically inactive but is converted in vivo to a
biologically active compound. Examples of biohydrolyzable amides
include, but are not limited to, lower alkyl amides, .alpha.-amino
acid amides, alkoxyacyl amides, and alkylaminoalkylcarbonyl amides.
Examples of biohydrolyzable esters include, but are not limited to,
lower alkyl esters, alkoxyacyloxy esters, alkyl acylamino alkyl
esters, and choline esters. Examples of biohydrolyzable carbamates
include, but are not limited to, lower alkylamines, substituted
ethylenediamines, aminoacids, hydroxyalkylamines, heterocyclic and
heteroaromatic amines, and polyether amines.
[0214] Prodrugs can include fatty acids or lipids linked to the
compounds described herein by the moieties described herein.
Exemplary fatty acids include the omega-3 fatty acids
eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Such
prodrugs and the preparation thereof will be clear to the skilled
person; reference is for instance made to the prodrug types and
preparations described in U.S. Pat. No. 5,994,392, U.S. Pat. No.
4,933,324 and U.S. Pat. No. 5,284,876.
[0215] As used herein, the term "salt" or "pharmaceutically
acceptable salt" refers to those salts which are, within the scope
of sound medical judgment, suitable for use in contact with the
tissues of humans and lower animals without undue toxicity,
irritation, allergic response and the like, and are commensurate
with a reasonable benefit/risk ratio. Pharmaceutically acceptable
salts are well known in the art. For example, Berge et al.,
describes pharmaceutically acceptable salts in detail in J.
Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable
salts of the compounds of this invention include those derived from
suitable inorganic and organic acids and bases. Examples of
pharmaceutically acceptable, nontoxic acid addition salts are salts
of an amino group formed with inorganic acids such as hydrochloric
acid, hydrobromic acid, phosphoric acid, sulfuric acid and
perchloric acid or with organic acids such as acetic acid, oxalic
acid, maleic acid, tartaric acid, citric acid, succinic acid or
malonic acid or by using other methods used in the art such as ion
exchange. Other pharmaceutically acceptable salts include adipate,
alginate, ascorbate, aspartate, benzenesulfonate, benzoate,
bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate,
cyclopentanepropionate, digluconate, dodecylsulfate,
ethanesulfonate, formate, fumarate, glucoheptonate,
glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate,
hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate,
laurate, lauryl sulfate, malate, maleate, malonate,
methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate,
oleate, oxalate, palmitate, pamoate, pectinate, persulfate,
3-phenylpropionate, phosphate, picrate, pivalate, propionate,
stearate, succinate, sulfate, tartrate, thiocyanate,
p-toluenesulfonate, undecanoate, valerate salts, and the like.
Salts derived from appropriate bases include alkali metal, alkaline
earth metal, ammonium and N.sup.+(C.sub.1-4alkyl).sub.4 salts.
Representative alkali or alkaline earth metal salts include sodium,
lithium, potassium, calcium, magnesium, and the like. Further
pharmaceutically acceptable salts include, when appropriate,
nontoxic ammonium, quaternary ammonium, and amine cations formed
using counterions such as halide, hydroxide, carboxylate, sulfate,
phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.
[0216] As used herein, the term "solvate" includes any combination
which may be formed by a compound of this invention with a suitable
inorganic solvent (e.g. hydrates) or organic solvent, such as but
not limited to alcohols, ketones, esters and the like. Such salts,
hydrates, solvates, etc. and the preparation thereof will be clear
to the skilled person; reference is for instance made to the salts,
hydrates, solvates, etc. described in U.S. Pat. No. 6,372,778, U.S.
Pat. No. 6,369,086, U.S. Pat. No. 6,369,087 and U.S. Pat. No.
6,372,733.
[0217] Aspects of the invention relate to compositions of matter
including NAD+ precursors, such as NMN or a salt thereof or prodrug
thereof. Further aspects of the invention relate to compositions of
matter including an enzyme involved in NAD+ biosynthesis, such as
NMNAT-1 or NAMPT, or an enzymatically active fragment thereof, or a
nucleic acid encoding an enzyme involved in NAD+ biosynthesis, or
an enzymatically active fragment thereof. In some embodiments,
compositions include conjugates of agents described herein, such as
fish oil conjugates.
[0218] Aspects of the invention relate to treatment and/or
prevention of disorders associated with cell proliferation.
Non-limiting examples of disorders associated with cell
proliferation include cancer, bacterial infection, immune rejection
response of organ transplant, solid tumors, viral infection,
autoimmune disorders (such as arthritis, lupus, inflammatory bowel
disease, Sjogrens syndrome, multiple sclerosis) and aplastic
conditions.
[0219] As used herein, "cancer" refers to a diverse class of
diseases characterized by an abnormal proliferation of the diseased
cells. In the case of cancer, the therapeutically effective amount
of an agent may reduce the number of cancer cells; reduce the tumor
size; inhibit cancer cell infiltration into peripheral organs;
inhibit tumor metastasis; inhibit, to some extent, tumor growth;
and/or relieve to some extent one or more of the symptoms
associated with the disorder. Several non-limiting examples of
cancer include: carcinoma, lymphoma, blastoma, sarcoma, leukemia,
squamous cell cancer, lung cancer (including small-cell lung
cancer, non-small cell lung cancer, adenocarcinoma of the lung, and
squamous carcinoma of the lung), cancer of the peritoneum,
hepatocellular cancer, gastric or stomach cancer (including
gastrointestinal cancer), pancreatic cancer, glioblastoma, cervical
cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma,
breast cancer, colon cancer, colorectal cancer, endometrial or
uterine carcinoma, salivary gland carcinoma, kidney or renal
cancer, liver cancer, prostate cancer, vulval cancer, thyroid
cancer, hepatic carcinoma and various types of head and neck
cancer, as well as B-cell lymphoma (including low grade/follicular
non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL;
intermediate grade/follicular NHL; intermediate grade diffuse NHL;
high grade immunoblastic NHL; high grade lymphoblastic NHL; high
grade small non-cleaved cell NHL; bulky disease NHL; mantle cell
lymphoma; AIDS-related lymphoma; and Waldenstrom's
Macroglobulinemia); chronic lymphocytic leukemia (CLL); acute
lymphoblastic leukemia (ALL); Hairy cell leukemia; chronic
myeloblastic leukemia; and post-transplant lymphoproliferative
disorder (PTLD), as well as abnormal vascular proliferation
associated with phakomatoses, edema (such as that associated with
brain tumors), and Meigs' syndrome.
[0220] It should be appreciated that agents described herein can be
used in combination with other agents known in the art to treat or
prevent cancer or other disorders associated will cell
proliferation. For example, agents described herein could be
combined with any anti-neoplastic agent or chemotherapeutic agent
known in the art. Non-limiting examples of anti-neoplastic agents
and chemotherapeutic agents are described in, and incorporated by
reference from, US Patent Publication No. 20130028862.
[0221] Thus, the invention includes methods for delivering agents
to a subject. As used herein, the term "subject" refers to a human
or non-human mammal. Non-human mammals include livestock animals,
companion animals, laboratory animals, and non-human primates.
Non-human subjects also specifically include, without limitation,
chickens, horses, cows, pigs, goats, dogs, cats, guinea pigs,
hamsters, mink, and rabbits. In some embodiments the subject is a
patient. As used herein, a "patient" refers to a subject who is
under the care of a physician, dentist, or other health care
worker, including someone who has consulted with, received advice
from or received a prescription or other recommendation from a
physician or other health care worker. A patient is typically a
subject having or at risk of having a disorder associated with
cancer.
[0222] As used herein, the term treat, treated, or treating when
used with respect to an disorder such as cancer refers to a
prophylactic treatment which increases the resistance of a subject
to development of the disease or, in other words, decreases the
likelihood that the subject will develop the disease as well as a
treatment after the subject has developed the disease in order to
fight the disease or prevent the disease from becoming worse.
[0223] The term "effective amount" of an agent of the invention
refers to the amount necessary or sufficient to realize a desired
biologic effect. For example, an effective amount of an agent for
treating cancer is that amount sufficient to prevent an increase in
one or more symptoms of cancer or that amount necessary to decrease
one or more symptoms of cancer in the subject that would otherwise
occur in the absence of the agent. Combined with the teachings
provided herein, by choosing among the various active compounds and
weighing factors such as potency, relative bioavailability, patient
body weight, severity of adverse side-effects and preferred mode of
administration, an effective prophylactic or therapeutic treatment
regimen can be planned which does not cause substantial toxicity
and yet is entirely effective to treat the particular subject. The
effective amount for any particular application can vary depending
on such factors as the disease or condition being treated, the
particular composition being administered, the size of the subject,
or the severity of the disease or condition. One of ordinary skill
in the art can empirically determine the effective amount of a
particular composition of the invention without necessitating undue
experimentation.
[0224] The agents of the invention may be delivered to the subject
on an as needed or desired basis. For instance a subject may
self-administer the agents as desired or a physician may administer
the agents. Additionally a physician or other health care worker
may select a delivery schedule. In other embodiments of the
invention, the agents are administered on a routine schedule. A
"routine schedule" as used herein, refers to a predetermined
designated period of time. The routine schedule may encompass
periods of time which are identical or which differ in length, as
long as the schedule is predetermined. For instance, the routine
schedule may involve administration of the composition on a daily
basis, every two days, every three days, every four days, every
five days, every six days, a weekly basis, a monthly basis or any
set number of days or weeks there-between, every two months, three
months, four months, five months, six months, seven months, eight
months, nine months, ten months, eleven months, twelve months, etc.
Alternatively, the predetermined routine schedule may involve, for
example, administration of the composition on a daily basis for the
first week, followed by a monthly basis for several months, and
then every three months after that. Any particular combination
would be covered by the routine schedule as long as it is
determined ahead of time that the appropriate schedule involves
administration on a certain day.
[0225] The agents may be administered alone or in any appropriate
pharmaceutical carrier, such as a liquid, for example saline, or a
powder, for administration in vivo. They can also be co-delivered
with larger carrier particle or within administration devices. The
agents may be formulated. The formulations of the invention are
administered in pharmaceutically acceptable solutions, which may
routinely contain pharmaceutically acceptable concentrations of
salt, buffering agents, preservatives, compatible carriers,
adjuvants, and optionally other therapeutic ingredients.
[0226] For use in therapy, an effective amount of the agents can be
administered to a subject by any mode. Administering a
pharmaceutical composition of the present invention may be
accomplished by any means known to the skilled artisan. Routes of
administration include but are not limited to oral, parenteral,
intramuscular, intravenous, subcutaneous, mucosal, intranasal,
sublingual, intratracheal, inhalation, ocular, vaginal, dermal,
rectal, and by direct injection.
[0227] It is well known to those skilled in the art that agents may
be administered to patients using a full range of routes of
administration. As an example, agents may be blended with direct
compression or wet compression tableting excipients using standard
formulation methods. The resulting granulated masses may then be
compressed in molds or dies to form tablets and subsequently
administered via the oral route of administration. Alternately
particle granulates may be extruded, spheronized and administered
orally as the contents of capsules and caplets. Tablets, capsules
and caplets may be film coated to alter dissolution of the delivery
system (enteric coating) or target delivery of the particle to
different regions of the gastrointestinal tract. Additionally,
particles may be orally administered as suspensions in aqueous
fluids or sugar solutions (syrups) or hydroalcoholic solutions
(elixirs) or oils. The particles may also be administered directly
by the oral route without any further processing.
[0228] The agents of the invention may be systemically administered
in combination with a pharmaceutically acceptable vehicle such as
an inert diluent or an assimilable edible carrier. They may be
enclosed in hard or soft shell gelatin capsules or compressed into
tablets. For oral therapeutic administration, the active compound
may be combined with one or more excipients and used in the form of
ingestible tablets, buccal tablets, troches, capsules, elixirs,
suspensions, syrups, wafers, and the like. Such compositions and
preparations should contain at least 0.1% of an active compound,
e.g., calcium. The percentage of the compositions and preparations
may, of course, be varied and may conveniently be between about 2
to about 60% of the weight of a given unit dosage form. The amount
of active compound in such therapeutically useful compositions is
such that an effective dosage level will be obtained. In some
embodiments, agents described herein, such as NMN or a salt or
prodrug thereof, are administered at a dosage of 250 mg-5 grams per
day, by an oral route.
[0229] The tablets, troches, pills, capsules, and the like may also
contain the following: binders such as gum tragacanth, acacia, corn
starch or gelatin; excipients such as dicalcium phosphate; a
disintegrating agent such as corn starch, potato starch, alginic
acid and the like; a lubricant such as magnesium stearate; and a
sweetening agent such as sucrose, fructose, lactose or aspartame or
a flavoring agent such as peppermint, oil of wintergreen, or cherry
flavoring may be added. When the unit dosage form is a capsule, it
may contain, in addition to materials of the above type, a liquid
carrier, such as a vegetable oil or a polyethylene glycol. Various
other materials may be present as coatings or to otherwise modify
the physical form of the solid unit dosage form. For instance,
tablets, pills, or capsules may be coated with gelatin, wax,
shellac or sugar and the like. A syrup or elixir may contain the
active compound, sucrose or fructose as a sweetening agent, methyl
and propylparabens as preservatives, a dye and flavoring such as
cherry or orange flavor. Of course, any material used in preparing
any unit dosage form should be pharmaceutically acceptable and
substantially non-toxic in the amounts employed.
[0230] To ensure full gastric resistance a coating impermeable to
at least pH 5.0 can be helpful. Examples of the more common inert
ingredients that are used as enteric coatings are cellulose acetate
trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP),
HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit
L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L,
Eudragit S, and Shellac. These coatings may be used as mixed
films.
[0231] A coating or mixture of coatings can also be used on
tablets, which are not intended for protection against the stomach.
This can include sugar coatings, or coatings which make the tablet
easier to swallow. Capsules may consist of a hard shell (such as
gelatin) for delivery of dry therapeutic, e.g., powder; for liquid
forms, a soft gelatin shell may be used. The shell material of
cachets could be thick starch or other edible paper. For pills,
lozenges, molded tablets or tablet triturates, moist massing
techniques can be used.
[0232] The agents of the invention may also be administered
intravenously or intraperitoneally by infusion or injection.
Solutions of the active compound or its salts can be prepared in
water, optionally mixed with a nontoxic surfactant. Dispersions can
also be prepared in glycerol, liquid polyethylene glycols,
triacetin, and mixtures thereof and in oils. Under ordinary
conditions of storage and use, these preparations contain a
preservative to prevent the growth of microorganisms.
[0233] The pharmaceutical dosage forms suitable for injection or
infusion can include sterile aqueous solutions or dispersions or
sterile powders comprising the active ingredient which are adapted
for the extemporaneous preparation of sterile injectable or
infusible solutions or dispersions, optionally encapsulated in
liposomes. In some embodiments the compositions of the invention
are not encapsulated or formulated in liposomes. In all cases, the
ultimate dosage form should be sterile, fluid and stable under the
conditions of manufacture and storage. The liquid carrier or
vehicle can be a solvent or liquid dispersion medium comprising,
for example, water, ethanol, a polyol (for example, glycerol,
propylene glycol, liquid polyethylene glycols, and the like),
vegetable oils, nontoxic glyceryl esters, and suitable mixtures
thereof. The proper fluidity can be maintained, for example, by the
formation of liposomes, by the maintenance of the required particle
size in the case of dispersions or by the use of surfactants. The
prevention of the action of microorganisms can be brought about by
various antibacterial and antifungal agents, for example, parabens,
chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In
many cases, it will be preferable to include isotonic agents, for
example, sugars, buffers or sodium chloride. Prolonged absorption
of the injectable compositions can be brought about by the use in
the compositions of agents delaying absorption, for example,
aluminum monostearate and gelatin.
[0234] For topical administration, the agents of the invention will
generally be administered as compositions or formulations, in
combination with a dermatologically acceptable carrier, which may
be a solid or a liquid. Useful solid carriers include finely
divided solids such as talc, clay, microcrystalline cellulose,
silica, alumina and the like. Useful liquid carriers include water,
alcohols or glycols or water-alcohol/glycol blends, in which the
present compounds can be dissolved or dispersed at effective
levels, optionally with the aid of non-toxic surfactants.
Thickeners such as synthetic polymers, fatty acids, fatty acid
salts and esters, fatty alcohols, modified celluloses or modified
mineral materials can also be employed with liquid carriers to form
spreadable pastes, gels, ointments, soaps, and the like, for
application directly to the skin of the user.
[0235] The compositions of the inventions may include a
physiologically or pharmaceutically acceptable carrier, excipient,
or stabilizer mixed with the particles. The term "pharmaceutically
acceptable" means a non-toxic material that does not interfere with
the effectiveness of the biological activity of the active
ingredients. The term "pharmaceutically-acceptable carrier" means
one or more compatible solid or liquid filler, dilutants or
encapsulating substances which are suitable for administration to a
human or other vertebrate animal. The term "carrier" denotes an
organic or inorganic ingredient, natural or synthetic, with which
the active ingredient is combined to facilitate the application.
The components of the pharmaceutical compositions also are capable
of being commingled with the compounds of the present invention,
and with each other, in a manner such that there is no interaction
which would substantially impair the desired pharmaceutical
efficiency. A pharmaceutical preparation is a composition suitable
for administration to a subject. Such preparations are usually
sterile and prepared according to GMP standards, particularly if
they are to be used in human subjects. In general, a pharmaceutical
composition or preparation comprises the particles, and optionally
agents of the invention and a pharmaceutically-acceptable carrier,
wherein the agents are generally provided in effective amounts.
[0236] Agents may also be suspended in non-viscous fluids and
nebulized or atomized for administration of the dosage form to
nasal membranes. Agents may also be delivered parenterally by
either intravenous, subcutaneous, intramuscular, intrathecal,
intravitreal or intradermal routes as sterile suspensions in
isotonic fluids.
[0237] Finally, agents may be nebulized and delivered as dry
powders in metered-dose inhalers for purposes of inhalation
delivery. For administration by inhalation, the compounds for use
according to the present invention may be conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of for use in an inhaler or insufflator may be
formulated containing the microparticle and optionally a suitable
base such as lactose or starch. Those of skill in the art can
readily determine the various parameters and conditions for
producing aerosols without resort to undue experimentation. Several
types of metered dose inhalers are regularly used for
administration by inhalation. These types of devices include
metered dose inhalers (MDI), breath-actuated MDI, dry powder
inhaler (DPI), spacer/holding chambers in combination with MDI, and
nebulizers. Techniques for preparing aerosol delivery systems are
well known to those of skill in the art. Generally, such systems
should utilize components which will not significantly impair the
biological properties of the agent in the nanoparticle or
microparticle (see, for example, Sciarra and Cutie, "Aerosols," in
Remington's Pharmaceutical Sciences, 18th edition, 1990, pp.
1694-1712; incorporated by reference).
[0238] Some specific examples of commercially available devices
suitable for the practice of this invention are the Ultravent
nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Mo.; the
Acorn II nebulizer, manufactured by Marquest Medical Products,
Englewood, Colo.; the Ventolin metered dose inhaler, manufactured
by Glaxo Inc., Research Triangle Park, N.C.; and the Spinhaler
powder inhaler, manufactured by Fisons Corp., Bedford, Mass.
[0239] Agents, when it is desirable to deliver them systemically,
may be formulated for parenteral administration by injection, e.g.,
by bolus injection or continuous infusion. Formulations for
injection may be presented in unit dosage form, e.g., in ampoules
or in multi-dose containers, with an added preservative. The
compositions may take such forms as suspensions, solutions or
emulsions in oily or aqueous vehicles, and may contain formulatory
agents such as suspending, stabilizing and/or dispersing
agents.
[0240] Further aspects of the invention relate to kits comprising a
pharmaceutical composition comprising a therapeutically effective
amount of one or more agents that increase NAD+ levels and
instructions for administration of the pharmaceutical composition.
In some aspects of the invention, the kit can include a
pharmaceutical preparation vial, a pharmaceutical preparation
diluent vial, and the agent(s). The diluent vial can contain a
diluent such as physiological saline for diluting what could be a
concentrated solution or lyophilized powder of the agent of the
invention. In some embodiments, the instructions include
instructions for mixing a particular amount of the diluent with a
particular amount of the concentrated pharmaceutical preparation,
whereby a final formulation for injection or infusion is prepared.
In some embodiments, the instructions include instructions for use
in a syringe or other administration device. In some embodiments,
the instructions include instructions for treating a patient with
an effective amount of an agent. It also will be understood that
the containers containing the preparations, whether the container
is a bottle, a vial with a septum, an ampoule with a septum, an
infusion bag, and the like, can contain indicia such as
conventional markings which change color when the preparation has
been autoclaved or otherwise sterilized.
[0241] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated herein by
reference.
EXAMPLES
[0242] The present invention will be more specifically illustrated
by the following Examples. However, it should be understood that
the present invention is not limited by these examples in any
manner.
Experimental Procedures
Generation of a Whole Body Adult-Inducible SIRT1 Knockout Mouse
[0243] Whole body adult-inducible SIRT1 knockout mice were treated
with tamoxifen for 5 weeks and the efficiency of deletion in DNA
from tail samples was determined by PCR. Animals were then
maintained on regular diet for 4 months. For the fasting
experiments, mice were fasted for 16 hrs prior to sacrifice. All
animal care followed the guidelines and was approved by the
Institutional Animal Care and Use Committees (IACUCs) at Harvard
Medical School.
Aging Cohorts
[0244] C57BL/6J mice of 3, 6, 22, 24, or 30 months of age were
obtained from the National Institutes of Aging mouse aging colony.
Mice were acclimated for at least one-week prior to sacrifice. 3,
and 24-month-old mice were given interperitoneal (IP) injections of
500 mg NMN/kg body weight per day or the equivalent volume of PBS
for 7 consecutive days at 5:00 pm and 7:00 am on day 8 and
sacrificed 4 hr after last injection. All animal studies followed
the guidelines of and were approved by the Harvard Institutional
Animal Care and Use Committee
C2C12 Cell Cultures Treatments, Adenoviral Infections and SIRT1
Gene Silencing
[0245] Methods for cell culture treatments, adenoviral infections,
and gene silencing in C2C12 cells can be found in the supplemental
information.
Mitochondrial Function
[0246] Skeletal muscle mitochondria were isolated as described
previously (Frezza et al., Nat. Protoc. 2:287-295 (2007)).
Mitochondrial membrane potential, cytochrome c activity and
succinate dehydrogenase were determined as described (Brautigan et
al., Methods Enzymol. 53:128-164 (1978); Rolo et al., Biochim.
Biophys. Acta. 1637:127-132 (s003); Singer, T. P., Methods Biochem.
Anal. 22:123-175 (1974)). ATP content was measured with a
commercial kit according to the manufacturer's instructions
(Roche).
TFAM Promoter, HRE and c-Myc Activity
[0247] TFAM promoter, HRE and c-Myc activity were determined using
a luciferase-based system. Luciferase activity was measured using
the Dual-Luciferase Reporter Assay System (Promega) with Renilla as
the reference.
NAD.sup.+ Measurement
[0248] NAD.sup.+ from C2C12 cells and skeletal muscle was
quantified with a commercially available kit (BioVision) according
to the manufacturer's instructions and as described before (Gomes
et al., Biochim. Biophys. Acta. 1822:185-195 (2012)).
Statistical Analysis
[0249] Data were analyzed by a two-tailed Student's t-test. All
data are reported as mean.+-.SEM. Statistical analysis was
performed using Excel software.
Example 1: Knockout of SIRT1 in Adult Mice Causes an Imbalance
Between Nuclear and Mitochondrially-Encoded ETC Subunits
[0250] The biological importance of SIRT1 has limited the type and
interpretation of experiments that are possible in complex
organisms. One of the main obstacles to studying the role of this
enzyme in mammals is the fact that inbred SIRT1 knockout mice die
in utero or exhibit developmental abnormalities. In the case of
tissue-specific knockouts, which are viable, one cannot rule out
the possibility that artifacts have been introduced during the
selection pressures of development. To circumvent this obstacle, an
adult-inducible whole body SIRT1 knockout mouse strain (SIRT1 KO)
was developed that allows the testing of the effect of deleting
SIRT1 in adult animals.
[0251] At 6-8 weeks of age, male SIRT1 KO mice (C57BL/6J
Cre-ERT2.times.SIRT1.sup.flox.DELTA.E4/flox.DELTA.E4) and
"wildtype" (WT) controls (Cre-ERT2 or
SIRT1.sup.flox.DELTA.E4/flox.DELTA.E4) were placed on a tamoxifen
diet for 5 weeks, resulting in deletion of SIRT1 from major tissues
in the SIRT1 KO mice but not in controls. In contrast to the
germline knockout mice, deletion of SIRT1 in the adult did not
affect mortality and the SIRT1 KO mice appeared outwardly normal.
Upon closer examination of the muscle, however, a metabolic defect
was apparent. Mitochondria isolated from gastrocnemius muscle of
SIRT1 KO animals had significantly lower mitochondrial membrane
potential (FIG. 4A) and cellular ATP levels (FIG. 4B).
[0252] There was no difference in mitochondrial mass between SIRT1
KO and wildtype animals, as indicated by comparing the
cross-sectional area and number of mitochondria in electron
micrographs (FIG. 4C). Quantitative PCR was performed to determine
the mRNA levels of ETC subunits encoded by either the nuclear and
mitochondrial genome. The mRNA levels of all 13
mitochondrially-encoded ETC genes were reduced in the SIRT1 KO mice
compared to wildtype controls, but there was no decrease in the
expression of any of the nuclear-encoded components tested (FIGS.
4D and 4E). Consistent with this, protein levels of the
mitochondrially-encoded COX2 (cytochrome c oxidase subunit II)
subunit were significantly decreased but the nuclear-encoded COX4
(Cytochrome c oxidase subunit IV) was unaltered (FIG. 4F). The
specific loss of mitochondrial subunits predicts that Complex II of
the ETC, which is comprised of only nuclear-encoded subunits,
should be less affected by the SIRT1 deletion than other ETC
complexes. The activity of Complex H (SDH) in the KO mouse was not
significantly different from the wildtype, whereas the activity of
Complex IV (COX) was significantly decreased (FIGS. 4G and 4H). In
addition, mtDNA content was also reduced in the SIRT1 KO muscle
relative to wildtype (FIG. 4I) despite no difference in
mitochondrial mass (see FIG. 4C). To simplify discussion, the
discord between nuclear and mitochondrial ETC components is
referred to herein as "genome asynchrony."
Example 2: Age-Related Mitochondrial Dysfunction Resembles Genome
Asynchrony in SIRT1 KO Mice
[0253] It was tested whether genome asynchrony caused by the loss
of SIRT1 was relevant to normal aging. A progressive, age-dependent
decline in mitochondrial function with age was observed in our
C57BL/6J mice. By 22 months of age, mitochondrial membrane
potential, ATP content and COX activity were all decreased, a trend
that was extended even further by 30 months of age (FIG. 5A-5C),
while there was an equal decrease in mtDNA content at both ages
(FIG. 5D). The integrity of mitochondrial DNA in skeletal muscle of
6, 22 and 30 month old mice was quantified using a long-range
PCR-mediated detection method. mtDNA integrity at 30 months of age
was considerably lower than at 6 months. mtDNA integrity was not
significantly reduced in the 22-month-olds. (FIG. 5E). These data,
indicate that an alternative mechanism may be primarily responsible
for the mitochondrial dysfunction observed in 22-month-old
animals.
[0254] Whether the mitochondrial dysfunction in 22-month-old mice
was related to the phenomenon observed in SIRT1 KO mice was tested.
This possibility was supported by the fact that NAD.sup.+ levels
and SIRT1 activity decline with aging in a variety of tissues.
While SIRT1 expression was not altered under these experimental
conditions, NAD.sup.+ levels were reduced in skeletal muscle of
elderly mice (FIGS. 5F and 5G), indicating that SIRT1 activity may
be impaired. A comparison between the skeletal muscle of 22-month-
and 6-month-old mice showed that ETC genes encoded by the
mitochondrial genome (ND1, CYTB, COX1, ATP6) were all significantly
lower at 22 months, whereas ETC components encoded by the nuclear
genome (NDUFS8, SDHb, Uqcrc1, COX5, ATP5a) were not (FIGS. 5H and
5I). By 30 months, however, both the nuclear and the mitochondrial
ETC subunit mRNAs were lower relative to the 6-month-olds, with the
exception of SDHb, which did not decline during aging (FIG. 5I).
Mirroring the SIRT1 KO mice, levels of the mitochondrially-encoded
COX2 protein were decreased at 22 months but COX4, a
nuclear-encoded protein, was only slightly lower. By 30 months
however, both proteins were equally reduced relative to the young
mice (FIG. 11E).
Example 3: SIRT1 Regulates Mitochondrial Homeostasis Through
PGC-1.alpha.-Dependent and Independent Mechanisms
[0255] The adaptation of metabolic tissues to fasting involves
upregulation of SIRT1 and the targeted deacetylation of the
transcriptional co-activator PGC-1.alpha.. Consistent with this,
both the young SIRT1 KO and 22-month-old wildtype animals failed to
upregulate ETC genes in response to fasting. Hence, it was possible
that the phenotypes observed in the SIRT1 KO mice and the aged mice
were a defect in the SIRT1-PGC-1.alpha. pathway of mitochondrial
biogenesis. To test this, the expression of nuclear- and
mitochondrially-encoded ETC genes in primary myotubes from
PGC-1.alpha./.beta. KO mice and the effect of SIRT1 in this context
was examined. The ability of SIRT1 to induce nuclear-encoded ETC
genes was absent in the PGC-1.alpha./.beta. KO myotubes. However,
overexpression of SIRT1 induced the mitochondrial ETC genes even in
the absence of PGC-1.alpha. and PGC-1.beta. (FIG. 6A). Moreover,
genome asynchrony was not a phenotype of the PGC-1.alpha./.beta. KO
myotubes under basal conditions, as both the mitochondrial and
nuclear encoded components of the ETC were similarly affected by
the knockout. Together, these observations revealed that SIRT1 can
regulate mitochondrial gene expression independently of the
canonical PGC-1.alpha. pathway and raised the possibility that
genome asynchrony was due to an alternative mechanism.
[0256] To provide additional clues about the molecular basis of
genome asynchrony, the gene expression patterns of skeletal muscle
of SIRT1 KO mice was analyzed. Out of the mitochondrial biogenesis
genes that were analyzed, only TFAM was decreased (FIG. 6B).
Consistent with the in vivo findings, TFAM promoter activity was
50% lower in primary myoblasts isolated from SIRT1 KO mice than
from wildtype littermates (FIG. 6C). If genome asynchrony in cells
lacking SIRT1 is caused by a decrease in TFAM, restoring the
expression levels of TFAM should correct genome asynchrony, along
with mtDNA content and ATP levels. The restoration of TFAM levels
in SIRT1 knockdown cells (FIG. 6D) was sufficient to correct genome
asynchrony, mtDNA content, and ATP levels (FIG. 6E-6G). This
provided strong evidence that TFAM is a limiting factor that is
depleted in SIRT1 KO mice causing genome asynchrony and decreased
mitochondrial function.
Example 4: SIRT1 Regulates Mitochondrial Homeostasis Through
HIF-1.alpha.
[0257] How SIRT1 regulates TFAM independently of
PGC-1.alpha./.beta. was next examined. Expression analysis of
gastrocnemius tissue showed that genes involved in glycolysis are
more expressed in the SIRT1 KO animals, including hexokinase 2
(HK2), pyruvate kinase (PKM), phosphofructokinase (PFKM) and
lactate dehydrogenase A (LDHA) (FIGS. 6H and 6I), reminiscent of
Warburg remodeling of metabolism in cancer cells.
[0258] To test whether genome asynchrony and the resulting
mitochondrial dysfunction in the muscle might be due to ectopic
HIF-1.alpha. stabilization and the induction of a pseudohypoxic
response, protein levels of HIF-1.alpha. were examined by Western
blotting in skeletal muscle of SIRT1 KO mice. As shown in FIG. 6J,
the levels of HIF-1.alpha. were considerably higher in the KO
tissue, demonstrating that loss of SIRT1 leads to HIF-1.alpha.
accumulation. The SIRT1 KO animals exhibited a gene expression
pattern reminiscent of a shift towards non-oxidative metabolism,
including upregulation of HIF-1.alpha. target genes PGK-1, Glut1,
PDK1 and VEGFa (FIG. 6K). Consistently, primary myoblasts isolated
from SIRT1 KO animals showed increased activity of the hypoxia
response element (HRE), despite being cultured in normoxic
conditions (FIG. 6L).
[0259] To test if the normal hypoxic response reproduces the effect
of a SIRT1 deletion by causing genome asynchrony, C2C12 myoblasts
were grown under hypoxic conditions (1% oxygen) or treated with
dimethyloxaloylglycine (DMOG), a HIF.alpha. prolyl hydroxylase
inhibitor that stabilizes HIF. Both treatments resulted in a
specific decline in mtDNA content and the expression of
mitochondrially-encoded ETC genes but not the nuclear-encoded
components, paralleling the effect of a SIRT1 deletion.
[0260] Next whether the ability of SIRT1 to regulate mitochondrial
function independently of PGC-1.alpha./.beta. is mediated by
HIF-1.alpha. was tested. Overexpression of SIRT1 in
PGC-1.alpha./.beta. knockout myocytes induced the expression of
mitochondrial ETC genes (as shown above) but the induction was
completely blocked by the HIF-1.alpha.-stabilizing compounds DMOG
and desferrioxamine (DFO) (FIG. 6M). Furthermore, cells expressing
a mutant allele of HIF-1.alpha. that is constitutively stabilized
due to the replacement of the two hydroxylated prolines with
alanines (DPA) (FIG. 7A), caused genome asynchrony similar to
hypoxia and treatment with DMOG (FIG. 7B). The stabilized
HIF-1.alpha. also prevented SIRT1 from increasing the expression of
mitochondrially-encoded ETC subunits or mtDNA content (FIGS. 7C and
7D). Importantly, cells expressing a mutant allele of the related
factor HIF-2.alpha. (stabilized by mutation of prolines 405 and 531
to alanine) did not induce genome asynchrony and had no effect on
the ability of SIRT1 to promote the expression of mitochondrial ETC
genes or mtDNA content. (FIG. 7A-7D), indicating that this effect
of SIRT1 is specific to HIF-1.alpha..
[0261] Having shown that HIF-1.alpha. stabilization was sufficient
to induce genome asynchrony, it was next tested whether it was
necessary. Genome asynchrony was induced using the specific SIRT1
inhibitor EX-527 and HIF-1.alpha. was knocked down using an shRNA
against HIF-1.alpha. (FIG. 7E). Knockdown of HIF-1.alpha. in C2C12
cells treated with the SIRT1 inhibitor EX-527 prevented genome
asynchrony and decline in mitochondrial function, as evidenced by
the maintenance of mtDNA content (FIG. 7F), mitochondrial ETC gene
expression (FIG. 7G), mitochondrial membrane potential (FIG. 7H)
and ATP levels (FIG. 7I). Impairment of the transcriptional
activity of the HIF complex by knockdown of ARNT did not impair the
effects of SIRT1 inhibition with EX-527, indicating that the effect
of HIF-1.alpha. on mitochondrial homeostasis in response to SIRT1
is not mediated through changes in the HIF-1.alpha./ARNT
transcription complex but rather HIF-1.alpha.'s ability to regulate
the activity of other transcriptional mediators.
Example 5: c-Myc Links SIRT1 and HIF-1.alpha. to Genome
Asynchrony
[0262] Under certain circumstances, HIF-1.alpha. regulates c-Myc
independently of its transcriptional activity (Koshiji et al., EMBO
J. 23:1949-1956 (2004); Koshiji et al., Mol. Cell. 17:793-803
(2005), each of which is hereby incorporated by reference in its
entirety). It was tested whether c-Myc was the factor linking SIRT1
and HIF-1.alpha. to genome asynchrony. Myoblasts from the SIRT1 KO
mice were about half as active as wildtype cells in a c-Myc
reporter assay (FIG. 8A). Additionally, knockdown of c-Myc (FIG.
8B) completely blocked the ability of SIRT1 to increase mtDNA
content, the expression of mitochondrially-encoded ETC genes, and
TFAM promoter activity in C2C12 myoblasts (FIG. 8C-8E). Conversely,
in C2C12 myoblasts treated with EX-527, overexpression of c-Myc
(FIG. 8F) restored the level of mtDNA content, mitochondrial ETC
mRNA, TFAM promoter activity, and increased cellular ATP levels
(FIG. 8G-8J). A stabilized form of HIF-1.alpha. (DPA) inhibited
c-Myc reporter activity in C2C12 myoblasts and prevented the
increase in TFAM promoter caused by SIRT1 overexpression (FIG. 8K).
Furthermore, the ability of HIF-1.alpha. knockdown to prevent the
loss of TFAM promoter activity was completely prevented by c-Myc
knockdown (FIG. 8L). Together these data show that HIF-1.alpha.
inhibits TFAM by interfering with c-Myc, providing a link between
HIF-1.alpha. and the regulation of mitochondrially-encoded ETC
subunits The data also demonstrate that SIRT1 can regulate
mitochondrial function via a PGC-1.alpha./.beta.-independent
mechanism that involves Hif-1.alpha. and c-Myc.
Example 6: CR Delays Age-Related Mitochondrial Dysfunction by
Preventing HIF-1.alpha.-Induced Genome Asynchrony
[0263] In male C57BL/6 mice, instituting a 30-40% reduction in
caloric intake from 6 weeks to 22 months of age prevents an
age-associated decline in NAD.sup.+ levels (FIG. 9A) mitochondrial
membrane potential (FIG. 9B), ATP levels (FIG. 9C) and COX activity
(FIG. 9D). CR also prevented the decrease in mtDNA content (FIG.
9E) and mitochondrially-encoded ETC components (FIG. 9F) while
maintaining levels of COX subunits 2 and 4 (FIG. 9G).
[0264] If the SIRT1 KO mouse is a mimic of normal mitochondrial
decline, then muscle from old mice should also contain higher
levels of HIF-1.alpha. and CR should counteract this. As shown in
FIG. 9H, HIF-1.alpha. levels in the muscle of 22-month-old mice
were considerably higher than young controls, and CR prevented this
increase. CR also suppressed the increased expression of key target
genes downstream of HIF-1.alpha. that promote the shift towards
non-oxidative metabolism, paralleling the effects of SIRT1 KO (FIG.
9I).
Example 7: NMN Induces NAD.sup.+ Levels in Skeletal Muscle and
Reverses Age-Induced Genome Asynchrony and Mitochondrial
Dysfunction
[0265] To test whether a decline in NAD.sup.+ availability, invokes
a pseudohypoxic response in muscle that inhibits mitochondrial
function, we treated 3- and 24-month-old C57BL/6J mice for one week
by intraperitoneal injection of nicotinamide mononucleotide (NMN)
(500 mg/kg body weight), a compound that increases NAD.sup.+ levels
in a variety of tissues. After the treatment, levels of cellular
NAD.sup.+ in both the young and old mice were approximately 2-fold
higher, such that the treated 24-month-old mice resembled the
untreated 3-month-olds (FIG. 10A). In the treated old mice a
restoration of mitochondrial membrane potential to the levels of
the young mice (FIG. 10B), concomitant with increases in ATP levels
and COX activity (FIGS. 10C and 10D) were observed. Moreover, NMN
treatment reversed the age-induced increase in HIF-1.alpha. in
muscle and suppressed the expression of HIF-1.alpha. target genes
(FIGS. 10E and 10F).
[0266] As a functional test of whether NMN reverses genome
asynchrony by depleting cells of HIF-1.alpha., primary
PGC-1.alpha./.beta. KO myotubes were incubated with NMN in the
presence and absence of the HIF stabilizing compounds DMOG and DFO.
As shown in FIG. 10K, NMN induced expression of
mitochondrially-encoded ETC genes (ND1, CYTB, COX1, ATP6) but this
effect was completely abolished by DMOG and DFO, indicating that,
under these conditions, NMN improves mitochondrial function
independently of PGC-1.alpha./.beta. by depleting HIF-1.alpha.
(FIG. 10G).
[0267] The inducible SIRT1 KO mouse allowed the testing of the
involvement of SIRT1 in the effects of NMN in vivo. The ability of
NMN treatment to induce mitochondrially-encoded genes and improve
mitochondrial function was lost in animals lacking SIRT1 (FIGS. 10H
and 10I). Taken together, this result demonstrates that restoring
NAD.sup.+ levels in old animals is sufficient to restore
mitochondrial function and that the mechanism involves the
SIRT1-mediated suppression of a pseudohypoxic response that
disrupts nuclear-mitochondrial communication.
Example 8: Aging Leads to a Specific Decline in
Mitochondrial-Encoded Genes Through Decreased Nuclear NAD.sup.+
Levels
Materials and Methods
Aging Cohorts, SIRT1 KO, EGLN1 KO and SIRT1 OE Mice and NMNAT1
Electroporation
[0268] C57BL/6J mice of 6, 22, or 30 months of age were obtained
from the National Institutes of Aging mouse aging colony.
Additionally 22 months old caloric restricted mice were also
obtained from the National Institutes of Aging mouse aging colony.
EGLN1 KO, SIRT1 KO and SIRT1 OE mice were generated as previously
described (Minamishima et al., 2008; Price et al., 2012). Mice were
acclimated for at least one-week prior to sacrifice. 3, 6, 22 and
24-month-old mice were given interperitoneal (IP) injections of 500
mg NMN/kg body weight per day or the equivalent volume of PBS for 7
consecutive days at 5:00 pm and 7:00 am on day 8 and sacrificed 4
hr after last injection.
[0269] Whole body SIRT1 overexpressor (SIRT1-tg) mice of 6 months
of age were given interperitoneal (IP) injections of 300 mg DMOG/kg
body weight per day or the equivalent volume of PBS for 5
consecutive days.
[0270] Whole body adult-inducible Egln1 knockout mice (Minamishima
et al, 2007) were treated with IP injection of tamoxifen for 3 days
after which they were allowed to rest. The mice were given
interperitoneal (IP) injections of 500 mg NMN/kg body weight per
day or the equivalent volume of PBS for 7 consecutive days at 5:00
pm and 7:00 am on day 8 and sacrificed 4 hr after last injection.
All animal studies followed the guidelines of and were approved by
the Harvard Institutional Animal Care and Use Committee.
[0271] All animal care followed the guidelines and was approved by
the Institutional Animal Care and Use Committees (IACUCs) at
Harvard Medical School.
Adenovirus Generation and Mutagenesis
[0272] C2C12 cell line (ATCC) was cultured in low glucose
Dulbecco's modified eagle medium (DMEM) (Invitrogen) supplemented
with 10% FBS (Invitrogen) and a mix of antibiotic and antimycotic
(Invitrogen). To inhibit SIRT1, cells were treated the vehicle
(0.001% DMSO) or 10 .mu.M EX-527 (Tocris) for 12 h. C2C12 myoblasts
were infected with an empty or SIRT1 adenovirus as described before
(Gerhart-Hines et al., 2007) and the media was replaced with fresh
DMEM for additional 48 h, after that the cells were treated as
described before. To test the effects of hypoxia and HIF.alpha.
stabilization in genome asyncrony, C2C12 myoblasts were exposed to
1% oxygen for 16 h or treated with the vehicle (0.001% DMSO) or
DMOG (Cayman) for the same period of time.
Generation of Primary Myoblasts, Rho0 Cells, Cell Culture
Treatments, Adenoviral Infections and Gene Silencing
[0273] Primary myoblasts cells were isolated from WT, SIRT1 KO
(Price et al., 2012) and PGC-1.alpha./.beta. KO (Zechner et al.,
2010) mice as previously described (Price et al., 2012). WT and
PGC-1.alpha./.beta. KO primary myoblasts were plated and allowed to
differentiate into myotubes by replacing the media with low glucose
DMEM supplemented with 2% horse serum (Sigma-Aldrich) for 4 days.
After the differentiation the cells were infected with empty vector
or flag-SIRT1 adenovirus as described before (Gerhart-Hines et al.,
2007). Media was replaced with fresh DMEM supplemented with 2%
horse serum (Sigma-Aldrich) for an additional 48 hr and, after that
the cells were harvested for the different assays as described. To
investigate the role of HIF-1.alpha. in genome asynchrony,
PGC-1.alpha./.beta. KO primary myotubes were treated for 12 hours
with 1 mM DMOG (Sigma) or 10 .mu.M DFO (Sigma), 24 h after
infection with empty vector of flag-SIRT1 adenovirus or after 12 h
treatment with 500 mM NMN (Sigma).
Mitochondrial Function
[0274] Mitochondrial membrane potential was evaluated by
fluorescence of the potential dependent TMRM probe. Briefly, cells
were incubated with 100 nM TMRM for 15 minutes in the dark, after
which the media was replaced and the fluorescence was measure by
flow cytometry.
[0275] ROS and mitochondrial mass were evaluated by flow cytometry
using the fluorescent probes DHE and NAO respectively as described
before (Bell et a, 2011; Gomes et al, 2012).
[0276] Cytochrome c oxidase activity was polarographically
determined based on the 02 consumption upon cytochrome c oxidation,
as previously described (Brautigan et al., 1978). The reaction was
carried out at 25.degree. C. in 1.3 mL of standard respiratory
medium (as in mitochondrial respiration) supplemented with 2 .mu.M
rotenone, 10 .mu.M oxidized cytochrome c, 0.3 mg TritonX-100.
Following addition of the sample, the reaction was initiated by
adding 5 mM ascorbate plus 0.25 mM tetramethylphenylene-diamine
(TMPD).
[0277] Succinate dehydrogenase activity was polarographically
determined based on the 02 consumption using phenazine metasulphate
(PMS) as an artificial electron acceptor, as previously described
(Singer, 1974). The reaction was carried out at 25.degree. C. in
1.3 mL of standard respiratory medium (as in mitochondrial
respiration) supplemented with 5 mM succinate, 2 .mu.M rotenone,
0.1 .mu.g antimycin A, 1 mM KCN and 0.3 mg Triton X-100. After the
addition of the sample, the reaction was initiated with 1 mM
PMS.
[0278] ATP content was measured with a commercial kit according to
the manufacturer's instructions (Roche).
Electron Microscopy
[0279] Skeletal muscle from mice were fixed in 2.5% glutaraldehyde
and 2.5% paraformaldehyde in cacodylate buffer (Electron Microscopy
Sciences) then were removed, put directly into fixative, then were
embedded and photographed with an electron microscope (Tecnai G2
Spirit BioTWIN) and mitochondrial area quantified with Image J
software.
Gene Expression and mtDNA Analysis
[0280] RNA from skeletal muscle tissue and C2C12 cells were
extracted with RNeasy mini kit (Qiagen) according to the
instructions and quantified using the NanoDrop 1000
spectrophotometer (Thermo Scientific). cDNA was synthesized with
the iSCRIP cDNA synthesis kit (BioRad) using 600 ng of RNA.
Quantitative RT-PCR reactions were performed using 1 .mu.M of
primers and LightCycler.RTM. 480 SYBR Green Master (Roche) on an
LightCycler.RTM. 480 detection system (Roche). Calculations were
performed by a comparative method (2-ACT) using 18S as an internal
control. For mtDNA analysis, total DNA was extracted with DNeasy
blood and tissue kit (Qiagen). mtDNA was amplified using primers
specific for the mitochondrial cytochrome c oxidase subunit 2
(COX2) gene and normalized to genomic DNA by amplification of the
ribosomal protein s18 (rps18) nuclear gene. Primers were designed
using the IDT software (IDT) and the primer sequences can be found
in Table 1.
[0281] Total DNA was extracted with DNeasy blood and tissue kit
(Qiagen). Integrity of mtDNA was assessed using the long range PCR
mediated detection method as described previously (Santos et al.,
2006), using the following primer sequences:
TABLE-US-00001 (SEQ ID NO: 31) Fwd: GCCAGCCTGACCCATAGCCATAATAT (SEQ
ID NO: 32) Rev: GAGAGATTTTATGGGTGTAATGCGG
Chromatin Immunoprecipitation and Immunoblots
[0282] Protein extracts from tissue or C2C12 cells were obtained by
lysis in ice-cold lysis buffer (150 mM NaCl, 10 mM Tris HCl (pH
7.4), 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 0.5% NP-40)
supplemented with a cocktail of protease and phosphatase inhibitors
(Roche). Protein content was determined by the Bradford protein
assay (Biorad), and 50 .mu.g proteins were run on SDS-PAGE under
reducing conditions. The separated proteins were then
electrophoretically transferred to a polyvinylidene difluoride
membrane (Perkin-Elmer). Proteins of interest were revealed with
specific antibodies: anti-TFAM (Aviva biosciences), anti-COX2,
anti-COX4 (Mitosciences), anti-SIRT1, anti-.beta.-tubulin
(Sigma-Aldrich), anti-HIF1.alpha. (Cayman), anti-HA (Covance) and
anti-c-Myc (Cell Signaling) overnight at 4.degree. C. The
immunostaining was detected using horseradish peroxidase-conjugated
anti-rabbit or anti-mouse immunoglobulin for 1 h at room
temperature. Bands were revealed using Amersham ECL detection
system (GE Healthcare).
[0283] Chromatin immunoprecipitation was performed using a
commercial available kit (Millipore) according to the
manufacturer's instructions and using anti-HIF1.alpha. (Cayman) and
anti-c-Myc (Cell Signaling) antibodies.
TFAM Promoter, VHL Promoter, HRE and c-Myc Activity
[0284] TFAM promoter, VHL promoter, HRE and c-Myc activity were
determined using a luciferase-based system. Luciferase activity was
measured using the Dual-Luciferase Reporter Assay System (Promega)
with Renilla as the reference.
[0285] TFAM promoter activity was evaluated using a TFAM
promotes-luc plasmid. A fragment of the mouse Tfam promoter (1.4 kb
upstream of the coding sequence) was cloned into a pGL4.15 vector
(Promega). Luciferase activity was measured using the
Dual-Luciferase Reporter Assay System (Promega) with Renilla as the
reference 48 h after transfection.
[0286] HIF-mediated transcriptional activity was measured using an
HRE-luciferase plasmid (Bell et al., 2011). VHL promoter activity
was measured using a commercially available luciferase plasmid
(Affymetrix). c-Myc-mediated transcriptional activity was measured
using a luciferase plasmid containing CDK4 Myc binding sites
(Addgene plasmid 16564) and a mutated version as a negative control
(Addgene plasmid 16565). The plasmids were transfected using
X-tremeGENE HP (Roche) in accordance with the manufacturer's
protocol. Luciferase activity was measured using the
Dual-Luciferase Reporter Assay System (Promega) with Renilla as the
reference 48 h after transfection.
SIRT1, c-Myc, HF1.alpha. and ARNT gene silencing in C2C12 cells
[0287] SIRT1 knockdown cells were produced as described before
(Gomes et al., 2012). ShMyc#1 (TRCN0000042517; Open Biosystems)
ShMyc#2 (TRCN0000054885; Open Biosystems), shHIF1.alpha.
(TRCN0000054450; Open Biosystems), shARNT#1 and shANRT#2
(TRCN0000079930 and TRCN0000079931, respectively; Open Biosystems)
and control shGFP lentivirus were produced by co-transfection of
293T cells with plasmids encoding psPAX2 (Addgene plasmid 12260),
pMD2.G (Addgene plasmid 12259) using X-tremeGENE HP (Roche) in
accordance with the manufacturer's protocol. Media was changed 24
hours post-transfection and the virus harvested after 48 hours, was
filtered and used to infect C2C12 cells in the presence of 5
.mu.g/mL polybrene (Sigma-Aldrich) via spin infection (2500 rpm, 30
minutes). Selection of resistant colonies was initiated 24 hours
later using 2 .mu.g/mL puromycin (Invivogen).
c-Myc Overexpression and HIF1.alpha. and HIF2.alpha. DPA in C2C12
Cells
[0288] pMXsc-Myc (Addgene plasmid 13375) and empty as well as pBabe
empty (Addgene plasmid 1764), HIF1.alpha. DPA (Addgene plasmid
19005), and HIF2.alpha. DPA (Addgene plasmid 19006) retrovirus were
produced by co-transfection of 293T cells with plasmids encoding
gagpol (Addgene plasmid 14887) and vsvg (Addgene plasmid 8454)
using X-tremeGENE HP (Roche) in accordance with the manufacturer's
protocol. Media was changed 24 hours post-transfection and the
virus harvested after 48 hours, was filtered and used to infect
C2C12 cells in the presence of 5 .mu.g/mL polybrene (Sigma-Aldrich)
via spin infection (2500 rpm, 30 minutes). Selection of resistant
colonies was initiated 24 hours later using 2 .mu.g/mL puromycin
(Invivogen). For silencing c-Myc in HIF1.alpha. knockdown cells,
non-target or RNAi targeting c-Myc (Dharmacon) was transfected
using Lipofectamine RNAiMAX (Invitrogen) according to the
manufacturer's instructions. 24 hours after the first transfection,
the transfection was repeated, to enhance the knockdown, and after
24 h hours the media was replaced and the cells treated as
described previously.
TFAM Overexpression in C2C12 Cells Lacking SIRT1
[0289] To increase expression of TFAM in C2C12 cells lacking SIRT1,
mouse TFAM cDNA cloned into the pIRES2-EGFP (Clontech) backbone
with the EGFP cassette replaced with a hygromycin resistance
cassette, was transfected using Fugene HD (Roche) in accordance
with the manufacturer's instructions. Media was changed 24 h
post-transfection and the selection of resistant colonies was
initiated 48 h post-transfection using 100 .mu.g/mL hygromycin as
well as 2 .mu.g/mL puromycin to maintain SIRT1 silenced. After
selection the cells were maintained and treated as described before
with the addition of hygromycin and puromycin to the media.
NAD.sup.+ Measurement
[0290] NAD.sup.+ from skeletal muscle was quantified with a
commercially available kit (BioVision) according to the
manufacturer's instructions and as described before (Gomes et al.,
2012).
Statistical Analysis
[0291] Data were analyzed by a two-tailed Student's t-test. All
data are reported as mean.+-.SEM. Statistical analysis was
performed using Excel software.
TABLE-US-00002 TABLE 1 Mouse primers used for PCR analysis (SEO ID
NOs: 33-114) Gene Primer Sequence Ta(.degree. C.) PGC-1.alpha.
Forward CACCAAACCCACAGAAAACAG 60 Reverse GGGTCAGAGGAAGAGATAAAGTTG
NRF-1 Forward AATGTCCGCAGTGATGTCC 60 Reverse GCCTGAGTTTGTGTTTGCTG
NRF-2 Forward TGAAGTTCGCATTTTGATGGC 60 Reverse
CTTTGGTCCTGGCATCTCTAC TFAM Forward CACCCAGATGCAAAACTTTCAG 60
Reverse CTGCTCTTTATACTTGCTCACAG TFB1M Forward ATAGAGCCCAAGATCAAGCAG
60 Reverse TGTAACAGCCTTCCAGTGC TFB2M Forward ACCAAAACCCATCCCGTC 60
Reverse TCTGTAAGGGCTCCAAATGTG NDUFS8 Forward GTTCATAGGGTCAGAGGTCAAG
60 Reverse TCCATTAAGATGTCCTGTGCG SDHb Forward ACCCCTTCTCTGTCTACCG
60 Reverse AATGCTCGCTTCTCCTTGTAG Uqcrc1 Forward ATCAAGGCACTGTCCAAGG
60 Reverse TCATTTTCCTGCATCTCCCG COX5b Forward ACCCTAATCTAGTCCCGTCC
60 Reverse CAGCCAAAACCAGATGACAG ATP5a1 Forward CATTGGTGATGGTATTGCGC
60 Reverse TCCCAAACACGACAACTCC NDUFAB1 Forward
GGACCGAGTTCTGTATGTCTTG 60 Reverse AAACCCAAATTCGTCTTCCATG SDHd
Forward CTTGAATCCCTGCTCTGTGG 60 Reverse AAAGCTGAGAGTGCCAAGAG Uqcrc2
Forward TTCCAGTGCAGATGTCCAAG 60 Reverse CTGTTGAAGGACGGTAGAAGG
COX6a1 Forward GTTCGTTGCCTACCCTCAC 60 Reverse
TCTCTTTACTCATCTTCATAGCCG ATP5b1 Forward CCGTGAGGGCAATGATTTATAC 60
Reverse GTCAAACCAGTCAGAGCTACC ND1 Forward TGCACCTACCCTATCACTCA 60
Reverse GGCTCATCCTGATCATAGAATGG Ctyb Forward CCCACCCCATATTAAACCCG
60 Reverse GAGGTATGAAGGAAAGGTATAAGGG COX1 Forward
CCCAGATATAGCATTCCCACG 60 Reverse ACTGTTCATCCTGTTCCTGC ATP6 Forward
TCCCAATCGTTGTAGCCATC 60 Reverse TGTTGGAAAGAATGGAGTCGG ND2 Forward
ATACTAGCAATTACTTCTATTTTCATAGGG 60 Reverse GAGGGATGGGTTGTAAGGAAG ND3
Forward AAGCAAATCCATATGAATGCGG 60 Reverse GCTCATGGTAGTGGAAGTAGAAG
ND4 Forward CATCACTCCTATTCTGCCTAGC 60 Reverse
CCAACTCCATAAGCTCCATACC ND4I Forward CCAACTCCATAAGCTCCATACC 60
Reverse GATTTTGGACGTAATCTGTTCCG ND5 Forward ACGAAAATGACCCAGACCTC 60
Reverse GAGATGACAAATCCTGCAAAGATG ND6 Forward
TGTTGGAGTTATGTTGGAAGGAG 60 Reverse CAAAGATCACCCAGCTACTACC COX2
Forward AGTTGATAACCGAGTCGTTCTG 60 Reverse CTGTTGCTTGATTTAGTCGGC
COX3 Forward CGTGAAGGAACCTACCAAGG 60 Reverse CGCTCAGAAGAATCCTGCAA
ATP8 Forward GCCACAACTAGATACATCAACATG 60 Reverse
TGGTTGTTAGTGATTTTGGTGAAG HIF1.alpha. Forward GAACATCAAGTCAGCAACGTG
60 Reverse TTTGACGGATGAGGAATGGG ARNT Forward CGAGAATGGCTGTGGATGAG
60 Reverse GGATGGTGTTGGACAGTGTAG LDHA Forward
GCTCCCCAGAACAAGATTACAG 60 Reverse TCGCCCTTGAGTTTGTCTTC HK2 Forward
TCAAAGAGAACAAGGGCGAG 60 Reverse AGGAAGCGGACATCACAATC Glut1 Forward
TGCAGCCCAAGGATCTCTCT 60 Reverse CGGCTTGCCCGAGATCT PKM Forward
CCATTCTCTACCGTCCTGTTG 60 Reverse TCCATGTAAGCGTTGTCCAG VEGFa Forward
GGCAGCTTGAGTTAAACGAAC 60 Reverse TGGTGACATGGTTAATCGGTC PDK1 Forward
GACTGTGAAGATGAGTGACCG 60 Reverse CAATCCGTAACCAAACCCAG PGK-1 Forward
AACCTCCGCTTTCATGTAGAG 60 Reverse GACATCTCCTAGTTTGGACAGTG PFKM
Forward GATGGCTTTGAGGGTCTGG 60 Reverse CTTGGTTATGTTGGCACTGATC mtDNA
(RSP18) Forward TGTGTTAGGGGACTGGTGGACA 60 Reverse
CATCACCCACTTACCCCCAAAA mtDNA (COX2) Forward ATAACCGAGTCGTTCTGCCAAT
60 Reverse TTTCAGAGCATTGGCCATAGAA
[0292] Aging is associated with a decline in mitochondrial
homeostasis (Figueiredo et al., 2008; Figueiredo et al., 2009;
Hartmann et al., 2011; Lanza and Nair, 2010; Osiewacz, 2011) and
consistent with previous reports (Peterson et al., 2012), a
progressive, age-dependent decline in OXPHOS efficiency with age in
the C57BL/6J mice was observed. By 22 months of age, ATP content
was decreased, a trend that was extended even further by 30 months
of age (FIG. 11A), while there was an equal decrease in mtDNA
content at both ages (FIG. 11B). The integrity of mitochondrial DNA
in skeletal muscle of 6, 22 and 30 month old mice was quantified
using a long-range PCR-mediated detection method (Santos et al.,
2006). As expected, mtDNA integrity at 30 months of age was
considerably lower than at 6 months, consistent with the mtDNA
damage hypothesis of aging. Surprisingly, mtDNA integrity was not
significantly reduced in the 22-month-old mice. (FIG. 11C). This
data, together with previous reports (Andziak and Buffenstein,
2006; Andziak et al., 2006; Howes, 2006; Lapointe et al., 2009),
suggests that there is a mechanism that is independent of oxidative
damage to mtDNA which may be responsible for the decline in OXPHOS
observed in 22-month-old animals.
[0293] It has been previously shown that there is a correlation
with age and a decline in the activity of the OXPHOS complexes,
except for complex II, (Boffoli et al., 1994; Bowling et al., 1993;
Kwong and Sohal, 2000) which is the only complex of the ETC chain
that is composed of only nuclear-encoded subunits (Falkenberg et
al., 2007). As a decline in mtDNA content was observed, it was
reasoned that the impairment in OXHPOS observed in 22-month-old
mice could be due to a specific decline in mitochondrial-encoded
ETC complex subunits. A comparison between the skeletal muscle of
22-month- and 6-month-old mice showed that ETC genes encoded by the
mitochondrial genome (ND1, Cytb, COX1, ATP6) were all significantly
lower at 22 months, whereas those encoded by the nuclear genome
(NDUFS8, SDHb, Uqcrc1, COX5, ATP5a) remained unchanged (FIG. 11D).
By 30 months, however, both the nuclear and the
mitochondrial-encoded ETC subunit mRNAs were lower relative to the
6-month-old mice (FIG. 11D). Mirroring the effects at the mRNA
level, protein levels of the mitochondrial-encoded COX2 gene
(cytochrome c oxidase subunit II) was decreased at 22 months but
COX4 (Cytochrome c oxidase subunit IV), a nuclear-encoded protein
was only slightly lower. By 30 months however, both proteins were
equally reduced relative to the young mice (FIG. 11E).
[0294] NAD.sup.+ levels decline with aging in a variety of tissues
(Braidy et al., 2011; Massudi et al., 2012), and since NAD.sup.+ is
an essential co-factor for several important enzymes (Canto and
Auwerx, 2011) it was next determined whether the specific decline
in mitochondrial-encoded genes observed in 22-month-old mice was
related with NAD.sup.+ levels. Consistent with other reports
(Braidy et al., 2011; Massudi et al., 2012) observed a decline in
NAD.sup.+ levels was observed in the skeletal muscle of elderly
mice (FIG. 11F). In mammals NAD.sup.+ is generated from
nicotinamide in a salvage pathway where nicotinamide
phosphoribosyltransferase (NAMPT) converts nicotinamide to
nicotinamide mononucleotide (NMN) which is then converted to
NAD.sup.+ by nicotinamide mononucleotide adenylyltransferase
(NMNAT) (Canto and Auwerx, 2011). Interestingly, there are three
NMNAT isoforms in mammals, each with a specific subcellular
localization: NMNAT1 in the nucleus; NMNAT2 in the Golgi apparatus
and cytosol; and NMNAT3 in the mitochondria (Jayaram et al., 2011).
The different localizations of the NMNATs allows for the
differential regulation of NAD.sup.+ levels in different cellular
compartments (Falk et al., 2012; Zhang et al., 2009; Zhang et al.,
2012). To determine whether changes in compartmentalized NAD.sup.+
levels are responsible for the generation of the imbalance between
nuclear- and mitochondrial-encoded genes the different NMNATs were
targeted with shRNA in primary myoblasts. A decline in
mitochondrial-encoded genes was observed when NMNAT1 was knocked
down, but not NMNAT2 or NMNAT3 (FIG. 11G-11I and FIG. 18A-18C). The
specific knockdown of NMNAT1 also resulted in decline in mtDNA
content (FIG. 11J) as well as ATP levels (FIG. 11K) mirroring the
effects observed in 22-old-mice. Together, these data indicate that
age-associated impairment in mitochondrial homeostasis is caused,
at least in part, by a specific decline in mitochondrial-encoded
subunits of the ETC that is driven by decreased nuclear NAD.sup.+
levels.
Example 9: Knockout of SIRT1 in Adult Mice Causes a Specific
Decline in Mitochondrial-Encoded Genes Similar to Aging
[0295] SIRT1 is an NAD.sup.+-dependent deacetylase present in the
nucleus and known to be tightly regulated by nuclear energetics
(Canto and Auwerx, 2012; Yang and Sauve, 2006), and plays an
essential role in maintenance of cellular homeostasis (Haigis and
Sinclair, 2010). Both SIRT1 mRNA and protein levels were not
altered in 22-month-old mice (FIGS. 18F and 18G), but since a
specific decline in mitochondrial-encoded genes was observed which
could be driven by modulation of nuclear NAD.sup.+ levels, it was
hypothesized that this effect could be mediated by alterations in
SIRT1 activity. To test this an adult-inducible whole body SIRT1
knockout mouse strain was utilized (SIRT1 KO; Price et al., 2012),
circumventing the developmental abnormalities of germline SIRT1 KO
mice (Cheng et al., 2003; McBurney et al., 2003; Sequeira et al.,
2008). Interestingly, SIRT1 KO mice have a decline in cellular ATP
levels (FIG. 12A) as well as a decline in mtDNA content (FIG. 12B),
similar to what was observed in the skeletal muscle of 22-month-old
mice (FIG. 11A-11K). Surprisingly, there was no difference in
mitochondrial mass between SIRT1 KO and wild-type animals, as
indicated by comparing the cross-sectional area and number of
mitochondria in electron micrographs (FIG. 12C). Given that SIRT1
regulates PGC-1.alpha. activity, a master regulator of the
mitochondrial biogenesis program, a general decrease in the
expression of ETC components in the SIRT1 KO mice was expected.
However, the mRNA levels of all 13 mitochondrial-encoded ETC genes,
as well as the 2 rRNAs encoded by the mitochondrial genome, were
reduced in the SIRT1 KO mice compared to wild-type controls (FIG.
12D and FIG. 19C) without a decrease in the expression of any of
the nuclear-encoded components (FIG. 12D). Consistent with this,
protein levels of the mitochondrial-encoded COX2 subunit were
significantly decreased but the nuclear-encoded COX4 was unaltered
(FIG. 12E). The specific loss of mitochondrial subunits without a
change in nuclear encoded subunits suggests that Complex II of the
ETC, should be less affected by SIRT1 deletion than other ETC
complexes. Indeed, the activity of Complex II (SDH) in the KO mouse
was not significantly different from the wild-type, whereas the
activity of Complex IV (COX) was significantly decreased (FIGS. 19A
and 19B). This defect is not restricted to skeletal muscle as a
specific decline in mitochondrial-encoded genes was also observed
in the heart of SIRT1 KO mice (FIG. 19G). However, this effect of
SIRT1 does not seem to be systematic, as there was not this
difference in WAT and brain, but rather a general decline in both
nuclear- and mitochondrial-encoded genes in these tissues (FIG.
19D-19F). Overexpression of the nuclear specific NMNAT1 induces
mitochondrial-encoded genes in a SIRT1-dependent manner, as shown
by the inability of NMNAT1 to induce the expression of
mitochondrial-encoded genes in primary myoblasts lacking SIRT1.
These data suggest that the regulation of mitochondrial homeostasis
via nuclear energetics seen in aging may occur through SIRT1 (FIG.
12F).
[0296] Maintenance of mitochondrial function plays a critical role
in maintenance of cellular homeostasis and muscle health (Johnson
et al., 2013; Powers et al., 2012). As SIRT1 KO animals present
with altered mitochondrial homeostasis it was next determined
whether muscle physiology was also altered. In line with the
impairment in OXPHOS capacity, a reduction in markers of slow
twitch oxidative muscle fiber marker MyHCIIa was also observed, as
was a concomitant increase in fast twitch glycolytic fibers as
evidenced by increase in MyHCIIb content in the gastrocnemius of
the SIRT1 KO mice (FIG. 12G). In addition, the SIRT1 KO mice had a
striking increase in the muscle atrophy markers, (Atrogin-1 and
MuRF1) (FIG. 12H), (Gumucio and Mendias, 2013), as well as,
increased expression of inflammatory markers (IL-6, IL-18 and
Nlrp3) (FIG. 19H). A decline in insulin signaling pathway in the
soleus of SIRT1 KO animals under basal conditions was also
observed, as shown by a pronounced decline in phosphorylation of
AKT and IRS1. Similarly to what was observed under basal
conditions, the soleus from SIRT1 KO mice demonstrated decreased
phosphorylation of both AKT and IRS1 in response to insulin as
compared to WT mice (FIG. 12I).
[0297] Together, these data demonstrate that loss of SIRT1 mirrors
the specific decline in mitochondrial-encoded genes, disruption of
mitochondrial homeostasis and negatively impacts muscle health
similar to what occurs with age.
Example 10: SIRT1 Regulates Mitochondrial Homeostasis Through
PGC-1.alpha.-Dependent and Independent Mechanisms
[0298] SIRT1 has been previously shown to regulate mitochondrial
homeostasis under low energy conditions, by de-acetylating the
transcriptional co-activator PGC-1.alpha. to activate mitochondrial
biogenesis (Gerhart-Hines et al., 2007; Rodgers et al., 2005).
Consistent with this, it was observed that SIRT1 KO animals failed
to upregulate ETC genes in response to fasting (FIG. 20A). However,
as shown in FIGS. 12A-121, under basal conditions a general effect
of SIRT1 in the mitochondrial biogenesis program and mitochondrial
mass was not observed, but rather a specific decline in
mitochondrial-encoded genes only, suggesting that SIRT1 might
regulate mitochondrial-encoded genes independently of PGC-1.alpha..
To test this, the expression of nuclear- and mitochondrial-encoded
ETC genes in primary myotubes from PGC-1.alpha./.beta. KO mice and
the effect of SIRT1 in this context was examined. As expected, the
ability of SIRT1 to induce nuclear-encoded ETC genes was absent in
the PGC-1.alpha./.beta. KO myotubes (FIG. 13A). However,
overexpression of SIRT1 induced the mitochondrial ETC genes even in
the absence of PGC-1.alpha. and PGC-1.beta. (FIG. 13A),
demonstrating, for the first time, that SIRT1 can regulate
mitochondrial gene expression independently of the canonical
PGC-1.alpha. pathway.
[0299] Using myotubes isolated from the inducible SIRT1 KO mice
(Hubbard et al., 2013), time course experiments to determine when
mitochondrial homeostasis is disrupted were performed. The results
demonstrated that a specific decline in mitochondrial-encoded genes
(FIG. 13B), mtDNA content (FIG. 20B) and a decrease in
mitochondrial membrane potential occurs as early as 12 h after
excision of SIRT1 by the addition of 2-Hydroxytamoxifen (UHT) (FIG.
20C). These defects occurred without having any effect on either
nuclear-encoded genes (FIG. 13B) or mitochondrial mass (FIG. 13C),
resembling the effects observed in the skeletal muscle of SIRT1 KO
mice under basal conditions (FIG. 12A-12I). Interestingly, 48 hr
after excision there was a decline in both nuclear- and
mitochondrial-encoded genes, mitochondrial mass and a more
pronounced decrease in mitochondrial membrane potential (FIG.
13B-13C and FIG. 20B-20C). This data suggests that loss of SIRT1
results in a biphasic disruption of mitochondrial homeostasis,
possibly via two distinct mechanisms.
[0300] Regulation of PGC-1.alpha. activity is complex and depends
on many factors (Fernandez-Marcos and Auwerx, 2011). SIRT1
regulates PGC-1.alpha. acetylation status in conditions of low
energy when there is a need for increased mitochondrial metabolism,
while under basal conditions PGC-1.alpha. acetylation status is
primarily regulated by GCN5 (Dominy et al., 2012; Fernandez-Marcos
and Auwerx, 2011). Phosphorylation of PGC-1.alpha. by
AMPK-activated kinase (AMPK) can also play an important role in
regulating its activity. AMPK phosphorylation of PGC-1.alpha. on
T177 and 5538 (Jager et al., 2007) is required for SIRT1-mediated
deacetylation and activation of PGC-1.alpha. (Canto et al., 2009).
This raises the interesting possibility that the biphasic
disruption in mitochondrial homeostasis upon SIRT1 deletion is
mediated by AMPK activity. Consistent with this idea AMPK activity
(measured by T172 phosphorylation) was not altered up to 24 h of
OHT treatment (FIG. 13D). However, at 48 h of treatment with OHT,
the time point where SIRT1 effects on mitochondrial biogenesis were
observed (FIGS. 13B and 13C), AMPK phosphorylation was markedly
increased (FIG. 13D). Similarly, AMPK activity was unchanged in the
skeletal muscle of SIRT1KO mice under fed conditions and in
22-month-old mice, but markedly increased by fasting (FIGS. 20D and
20E). These experiments suggest that AMPK activity might be what
causes the biphasic response between one pathway versus the other
in response to SIRT1 loss
[0301] To further explore this idea, AMPK activity was blocked with
an AMPK dominant negative adenovirus (AMPK-DN), which efficiently
inhibited phosphorylation of the AMPK target ACC, (FIG. 13F).
AMPK-DN blocked the decrease in nuclear-encoded genes observed 48 h
after treatment with OHT, but not the decline in
mitochondrial-encoded genes (FIG. 13G). In order to determine if
this AMPK affect is through PGC-1.alpha. PGC-1.alpha./.beta. KO
myotubes were reconstituted with either a WT PGC-1.alpha. or an
AMPK insensitive version of PGC-1.alpha. (PGC-1.alpha. T177A/S538A)
(FIG. 20F). Reconstitution with either WT or the mutant version of
PGC-1.alpha. increased both nuclear- and mitochondrial-encoded
genes (FIG. 13E). Inhibition of SIRT1 function for 48 h with the
specific inhibitor EX-527 decreased both nuclear- and
mitochondrial-encoded genes in the presence of WT PGC-1.alpha.
while only the mitochondrial-encoded genes decreased in the
presence of the PGC-1.alpha. mutant (FIG. 13E). Together, these
results demonstrate that AMPK determines whether SIRT1 utilizes a
PGC-1.alpha.-dependent or independent mechanism to impact
mitochondrial homeostasis
[0302] To provide additional clues about the molecular basis of
this novel PGC-1.alpha.-independent regulation of
mitochondrial-encoded genes by SIRT1, gene expression patterns were
analyzed from skeletal muscle of SIRT1 KO mice. The only gene that
changed which is involved in the mtDNA transcription was TFAM (FIG.
13H and FIG. 20G). Consistent with the in vivo findings, TFAM
promoter activity was 50% lower in primary myoblasts isolated from
SIRT1 KO mice than from wild-type littermates (FIG. 13I). TFAM is
necessary for mtDNA stability, replication, and transcription
(Falkenberg et al., 2007), thus it was reasoned that if the
specific decline in mitochondrial-encoded genes in cells lacking
SIRT1 is caused by a decrease in TFAM, restoring the expression
levels of TFAM should correct this effect and restore mitochondrial
homeostasis. Restoring TFAM levels in primary myoblasts previously
treated with OHT for 24 h to induce SIRT1KO (FIG. 13J), was
sufficient to rescue mitochondrial-gene expression levels (FIG.
13K) and ATP levels (FIG. 13L). In addition, the decline in
mitochondrial biogenesis caused by prolonged loss of SIRT1 (48 h of
treatment with OHT) was completely absent in cells where TFAM
levels where maintained for that period of time (FIGS. 13K and 13L)
and accordingly, AMPK activity was also not induced (FIG. 13M).
Interestingly, a 2-3 fold overexpression of TFAM in primary
myoblasts (FIG. 20H), not only lead to the predictable increase in
the expression of mitochondrial-encoded genes and mtDNA content
(FIGS. 20I and 20J) but also to a similar increase in
nuclear-encoded genes (FIG. 20I) and as a result a global increase
in OXPHOS activity and ATP production (FIG. 20K). Together, these
results show that TFAM is the limiting factor that is depleted in
SIRT1 KO mice causing a specific decline in mitochondrially-encoded
genes and, as a consequence, impairing mitochondrial
homeostasis.
Example 11: SIRT1 Regulates Mitochondrial Homeostasis Through
HIF-1.alpha.
[0303] Next, experiments were performed to better understand how
SIRT1 regulates TFAM independently of PGC-1.alpha./13. The skeletal
muscle in SIRT1 KO animals have increased type II glycolytic fibers
(FIG. 12G) and expectedly gene expression analysis demonstrated
increased levels of genes involved in glycolysis, including
hexokinase 2 (HK2), pyruvate kinase (PKM), phosphofructokinase
(PFKM) and lactate dehydrogenase A (LDHA) (FIGS. 14A and 14B).
Accordingly, SIRT1 KO mice also presented increased lactate levels
in the skeletal muscle (FIG. 14C), reminiscent of Warburg
remodeling of metabolism in cancer cells.
[0304] The metabolic remodeling characteristic of cancer cells is
in part mediated by the stabilization of the transcription factor
HIF-1.alpha. (Majmundar et al., 2010). The similarity between the
gene expression of muscle from the SIRT1 KO mice and of cancer
cells prompted testing as to whether the specific decline in
mitochondrial-encoded genes and consequent disruption of OXPHOS
functionality might be due to a pseudohypoxic response and
HIF-1.alpha. stabilization. As shown in FIG. 14D, the levels of
HIF-1.alpha. were considerably higher in the KO tissue,
demonstrating that loss of SIRT1 leads to HIF-1.alpha.
accumulation. Moreover, the SIRT1 KO animals exhibited a gene
expression pattern reminiscent of cancer cells, including
upregulation of HIF-1.alpha. target genes PGK-1, Glut1, PDK1 and
VEGFa (FIG. 21A). Moreover, primary myoblasts also demonstrated
increased HIF-1.alpha. protein levels (FIG. 14D), as well as the
activity of the hypoxia response element (HRE), despite being
cultured in normoxic conditions (FIG. 21B). Consistent with the
idea that manipulation of cellular energetics by decreasing
NAD.sup.+/NADH ratio with lactate treatment also induces
HIF-1.alpha. protein stabilization in primary myoblasts (FIGS. 21D
and 21E).
[0305] To test if stabilization of HIF-1.alpha. is sufficient to
induce the observed decline in mitochondrial-encoded ETC genes
similar to the effect of SIRT1 deletion in the skeletal muscle,
Egln1 KO (PHD2) inducible-whole body KO mouse were used
(Minamishima et al., 2008). As expected, upon induction of Egln1
deletion HIF-1.alpha. was stabilized in the skeletal muscle (FIG.
14E). Strikingly, Egln1 deletion and consequent HIF-1.alpha.
stabilization resulted in a specific decline in mtDNA content and
decreased expression of mitochondrial-encoded ETC genes but not the
nuclear-encoded components, paralleling the effect of SIRT1
deletion in the skeletal muscle (FIGS. 14F and 14G). Moreover,
treatment of PGC-1.alpha./.beta. knockout myotubes with
dimethyloxaloylglycine (DMOG), a HIF.alpha. prolyl hydroxylase
inhibitor that stabilizes HIF-1.alpha. protein (FIG. 21C), induced
a decline in the expression of mitochondrial-encoded genes compared
to vehicle control (FIG. 14H). Overexpression of SIRT1 in
PGC-1.alpha./.beta. knockout myotubes induced the expression of
mitochondrial ETC genes (as shown above) but the induction was
completely blocked by DMOG (FIG. 14H). Furthermore, increasing
NAD.sup.+ levels by supplementation with pyruvate in the
PGC-1.alpha./.beta. KO cells increased mitochondrial-encoded genes
(FIG. 21F). Interestingly, the NAD.sup.+ mediated increases in
mitochondrial-encoded genes can be inhibited by stabilizing
HIF-1.alpha. with DMOG (FIG. 14I and FIG. 21F). SIRT1
overexpression in vivo induces an increase in OXPHOS capacity in
the skeletal muscle by increasing the mitochondrial biogenesis
program (Price et al., 2012). Therefore, it was next determined
whether HIF-1.alpha. stabilization in the whole body SIRT1
overexpressing mice (SIRT1-tg) (Price et al., 2012) would prevent
this increase. SIRT1-tg mice were treated with vehicle or DMOG to
increase HIF-1.alpha. (FIG. 21G) and this abolished the increase in
the expression of mitochondrial-encoded genes, as well as, the
increase in ATP levels observed in SIRT1-tg mice (FIGS. 21H and
21I).
[0306] To dissect which one of the HIF.alpha. proteins was
responsible for this increase, constitutively stabilized
HIF-1.alpha. or HIF-2.alpha. (DPA) were introduced into C2C12
myoblasts (FIG. 14I). Expression of the HIF-1.alpha. mutant caused
a specific decline in the expression of mitochondrial-encoded genes
similar to Egln1 KO and treatment with DMOG (FIG. 14J) and also
prevented SIRT1 overexpression from increasing the expression of
mitochondrial-encoded ETC subunits and mtDNA (FIG. 14K and FIG.
21J). Importantly, cells expressing a mutant allele of the related
factor HIF-2.alpha. did not alter the gene expression pattern of
both nuclear and mitochondrial-encoded ETC genes and had no effect
on the ability of SIRT1 to promote the expression of mitochondrial
ETC genes or mtDNA (FIG. 14L-14K and FIG. 21J), indicating that
this effect of SIRT1 is specific to HIF-1.alpha..
[0307] Since HIF-1.alpha. stabilization was sufficient to induce a
specific decline in mitochondrial-encoded genes, it was next
determined whether it was also necessary. Knockdown of HIF-1.alpha.
in primary myoblasts lacking SIRT1 (FIG. 14L) prevented the
disruption of mitochondrial homeostasis, as evidenced by the
maintenance of mtDNA content (FIG. 14M) and ATP levels (FIG. 14N).
In addition, impairment of the transcriptional activity of the HIF
complex by knockdown of ARNT did not impair the effects of SIRT1
inhibition with EX-527 (FIG. 21K-N), indicating that the effect of
HIF-1.alpha. on mitochondrial homeostasis in response to SIRT1 is
not mediated through changes in the HIF-1.alpha./ARNT transcription
complex, but rather HIF-1.alpha.'s ability to regulate the activity
of other transcriptional mediators. These data combined demonstrate
that the effects of SIRT1 in the specific regulation of
mitochondrial-encoded genes and maintenance of mitochondrial
homeostasis are mediated by HIF-1.alpha. both in vitro and in
vivo.
Example 12: HIF-1.alpha. Stabilization Induced by Loss of SIRT1 is
Independent of Retrograde Signaling and HIF-1.alpha. Deacetylation
and Mediated by Regulation of VHL Levels
[0308] SIRT1 has been implicated in the regulation of HIF-1.alpha.
transcriptional activity (Lim et al., 2010), but not protein
stabilization. Mitochondrial homeostasis plays an important role in
the regulation of HIF-1.alpha. protein stability through generation
of ROS from complex III (Bell et al., 2007; Chandel et al., 2000)
therefore it was determined whether ROS and retrograde signaling
were the cause of HIF-1.alpha. stabilization in response to loss of
SIRT1. Time course experiments demonstrate that ROS levels are only
upregulated 24 h after SIRT1 deletion by OHT (FIG. 22B), while the
impairment in mitochondrial homeostasis was observed at 12 h (FIG.
13A and FIG. 20B-20C) and HIF-1.alpha. stabilization at 6 h (FIG.
15J). This data indicates that increased ROS upon SIRT1 deletion
are not the cause of HIF-1.alpha. stabilization but rather a
consequence of impaired mitochondrial homeostasis. Further
supporting this idea, primary myoblasts depleted of mitochondrial
DNA (rho0), which are unable to produce ROS and signal to the
nucleus (Chandel and Schumacker, 1999), showed the same effects
upon loss of SIRT1 as their parental control cells, indicating that
the effects observed are also not due to retrograde signaling (FIG.
22A).
[0309] HIF-1.alpha. stability was also previously reported to be
regulated by acetylation, particularly acetylation of the lysine
709 (Geng et al., 2011). Since SIRT1 is a deacetylase it is
possible that it may regulate HIF-1.alpha. protein stability via
K709 deacetylation. To explore this possibility we K709 was mutated
to glutamine (acetylation mimetic) or arginine (non acetylated
form), as well as, K674. The latter mutations serve as a positive
control since this residue is deacetylated by SIRT1 but does not
affect HIF-1.alpha. stability (Lim et al., 2010). Under control
conditions, stabilization of HIF-1.alpha. in any of the mutants was
not detected. Moreover, SIRT1 deletion did not affect the mutants
(FIG. 22C), suggesting that SIRT1 does not regulate HIF-1.alpha.
protein stability acetylation.
[0310] HIF.alpha. protein abundance is tightly regulated by an
oxygen-dependent proteasomal degradation mechanism, involving the
Von Hippel-Lindau protein (VHL) E3 ubiquitin ligase recognizing
hydroxylated proline residues. (Kaelin, 2008). To determine whether
SIRT1 deletion impacts HIF-1.alpha. stability through proline
hydroxylation an antibody specific for HIF-1.alpha. proline
hydroxylation was used. When HIF-1.alpha. protein was stabilized
with MG132 no differences in hydroxylation were found between
control cells and cells lacking SIRT1 (FIG. 22D), indicating that
SIRT1 does not regulate HIF-1.alpha. hydroxylation. Interestingly,
both VHL protein and mRNA levels were reduced by 50% in the
skeletal muscle of SIRT1 KO mice (FIGS. 15A and 15C). Conversely,
in the skeletal muscle of SIRT1-tg mice VHL protein and mRNA levels
were increased (FIGS. 15B and 15D), demonstrating that SIRT1
regulates VHL abundance in the skeletal muscle. Consistent with
HIF-1.alpha. stabilization being caused by decreased VHL in the
absence of SIRT1, HIF-2.alpha. was also stabilized in both skeletal
muscle and primary myoblasts upon SIRT1 deletion (FIG. 22E).
However HIF-2.alpha. target genes were not upregulated (FIG. 22F),
suggesting that under these conditions HIF-2.alpha. is not
transcriptionally active. Interestingly, an effect on VHL promoter
activity upon SIRT1 deletion was not observed, suggesting that the
differences in VHL mRNA are independent of transcription (FIGS. 15E
and 15F).
[0311] Consistent with the data demonstrating that decreased
NAD.sup.+ during aging drives a pseudohypoxic response by inducing
HIF-1.alpha. stabilization, knockdown of NMNAT1 in primary
myoblasts lead to a decline in VHL mRNA and protein levels (FIGS.
15G and 15H) and consequent HIF-1.alpha. stabilization. VHL is also
decreased in the skeletal muscle of 22-month-old mice but not 6
month-old mice. To determine causality, time course experiments
were performed. As shown in FIG. 15J, VHL protein levels decline as
earlier as 6 h upon SIRT1 deletion, coinciding with the
accumulation of HIF-1.alpha.. In addition, TFAM levels decrease 12
h after SIRT1 deletion (FIG. 15J), further strengthening the idea
that loss of SIRT1 causes a decrease in TFAM and a specific decline
in mitochondrial-encoded genes due to HIF-1.alpha.
stabilization.
[0312] As VHL levels were correlated with HIF-1.alpha.
stabilization in several of the systems and animal models utilized,
next it was determined whether decreasing VHL levels is necessary
for SIRT1 to induce HIF-1.alpha. stabilization. VHL was knocked
down in primary myoblasts with and without SIRT1 (FIG. 15K). SIRT1
rescue in the SIRT1KO cells no longer reversed HIF-1.alpha.
accumulation as in cells with VHL (FIG. 15L). Accordingly,
knockdown of VHL significantly reduces the ability of SIRT1 to
induce TFAM promoter activity and consequently the expression of
mitochondrial-encoded genes (FIGS. 15M and 15N). Together, these
results show that SIRT1 regulates VHL to impact HIF-1.alpha.
protein stability.
Example 13: c-Myc Links SIRT1 and HIF-1.alpha. to the Specific
Decline in Mitochondrial-Encoded Gene Expression
[0313] A major transcriptional mediator that has been shown to aid
cancer cells to proliferate under hypoxic conditions is the
oncogene c-Myc (Gordan et al., 2007). This is partially due to a
crosstalk between HIF-1.alpha. and c-Myc, which together fine-tune
the adaptive responses to the hypoxic environment. Interestingly,
some reports suggest that c-Myc controls mitochondrial biogenesis
(Kim et al., 2008; Li et al., 2005) and that primary hepatocytes
from c-Myc knockout mice have reduced mitochondrial mass (Li et
al., 2005). Despite these reports suggesting the role of c-Myc in
the regulation of mitochondrial biogenesis, the relevance of c-Myc
aging or in the development of aging-related diseases, other than
cancer, remains unknown.
[0314] Based on the fact that HIF-1.alpha. regulates c-Myc
independently of its transcriptional activity (Koshiji et al.,
2004; Koshiji et al., 2005), it was postulated that c-Myc might be
the factor linking SIRT1 and HIF-1.alpha. to the specific
regulation of mitochondrial-encoded ETC genes. Consistent with
this, loss of SIRT1 in primary myoblasts lead to a 50% decrease in
c-Myc reporter activity, as early as 6 h after the deletion was
induced (FIG. 16A). Additionally, knockdown of c-Myc (FIG. 16B)
completely blocked the ability of SIRT1 to increase mtDNA, the
expression of mitochondrial-encoded ETC genes (FIGS. 16C and 16D).
Conversely, in C2C12 myoblasts treated with EX-527, overexpression
of c-Myc (FIG. 23A) restored the level of mtDNA, mitochondrial ETC
mRNA, and increased cellular ATP levels (FIG. 23B-D).
[0315] c-Myc was previously shown to directly bind to the TFAM
promoter in cancer cells (Li et al., 2005) and consistent with this
report, it was observed that knockdown of c-Myc in primary
myoblasts leads to decreased TFAM promoter activity (FIG. 16E).
Mutation of the c-Myc consensus sequence, CACGTG, present in the
TFAM promoter decreased the promoter activity by about half of the
full length promoter (FIG. 16F). Importantly, mutation of c-Myc
binding site blocks the effect of c-Myc in the TFAM promoter and
does not disrupt the activity of the TFAM promoter in response to
PGC-1.alpha. overexpression (FIGS. 16F and 16G). Next it was tested
whether c-Myc binding site was required for SIRT1's ability to
induce TFAM promoter activity. Overexpression of SIRT1 in primary
myoblasts lead to an increase in the full length TFAM promoter
activity, however disruption of c-Myc binding site was sufficient
to completely prevent the ability of SIRT1 to induce TFAM promoter
activity (FIG. 16H). Furthermore, chromatin immunoprecipitation
experiments showed that c-Myc binds to the TFAM promoter in primary
myoblasts and that this binding is markedly reduced upon loss of
SIRT1 induced by OHT (FIG. 16I and FIG. 16J). Interestingly,
stabilization of HIF-1.alpha. with DMOG in primary myoblasts
reduces the full length TFAM promoter activity (FIG. 23E) and does
not have an additive effect in the absence of the c-Myc binding
site (FIGS. 23E and 23F). Chromatin immunoprecipitation experiments
demonstrate that HIF-1.alpha. does not bind to the TFAM promoter
(FIG. 16I and FIG. 16J), however it can bind to its known target
LDHA upon SIRT1 loss (FIGS. 23G and 23H). These data suggests that
HIF-1.alpha. regulates c-Myc binding to the TFAM promoter, to
mediate SIRT1 regulation of mitochondrial homeostasis independently
of PGC-1.alpha.. To test if indeed SIRT1's effects on the activity
of the TFAM promoter require HIF-1.alpha./c-Myc, we used primary
myoblasts where HIF-1.alpha. was knockdown (FIG. 14M). Similarly to
what was observed before (as described above), c-Myc binds to the
TFAM promoter and its binding is dramatically decreased upon SIRT1
deletion with OHT, which also correlated with a decrease in
promoter activity (FIGS. 16K and 16L). However, in cells lacking
HIF-1.alpha. loss of SIRT1 does not lead to a reduction in c-Myc
binding to the TFAM promoter and consequently no alteration in the
TFAM promoter activity was observed (FIGS. 16K and 16L).
[0316] Together these data demonstrate that HIF-1.alpha. inhibits
TFAM transcription by interfering with c-Myc, providing the first
clear link between HIF-1.alpha. and the regulation of
mitochondrial-encoded ETC subunits. The data also demonstrate, for
the first time, that SIRT1 can regulate mitochondrial homeostasis
via a PGC-14-independent mechanism that involves Hif-1.alpha. and
c-Myc.
Example 14: Caloric Restriction (CR) and NAD.sup.+ Supplementation
Protects Against Pseudohypoxic Induced Decline in Mitochondrial
Homeostasis and Muscle Health During Aging
[0317] There are conflicting reports about the relationship between
CR and mitochondrial homeostasis (Boily et al., 2008; Civitarese et
al., 2007; Cohen et al., 2004; Hancock et al., 2011; Kaeberlein et
al., 2005; Lopez-Lluch et al., 2006). In male C57BL/6 mice, it was
found that instituting a 30-40% reduction in caloric intake from 6
weeks to 22 months of age prevents an age-associated decline in
NAD.sup.+ levels, ATP levels and COX activity (FIGS. 24A-24C). CR
also prevented the decrease in mtDNA and mitochondrial-encoded ETC
components (FIGS. 23D-23F). CR was also able to prevent the decline
in VHL protein levels and consequent increase in HIF-1.alpha.
protein levels in the muscle of 22-month-old mice (FIG. 24G),
suggesting that aging induces a pseudohypoxic state that can be
reversed by an intervention that activates SIRT1.
[0318] It was shown above that decreased levels of NAD' associated
with age invokes a SIRT1 dependent pseudohypoxic response that
disrupts mitochondrial homeostasis. Therefore, artificially
boosting NAD.sup.+ levels in old mice should restore mitochondrial
homeostasis by reducing HIF-1.alpha. levels and restoring the
expression of mitochondrial-encoded ETC components. Administration
of NMN, a compound recently shown to increase NAD.sup.+ levels in a
variety of tissues (Yoshino et al., 2011), to 6- and 22-month-old
C57BL/6J mice for one week increased levels of cellular NAD.sup.+
in both the young and old mice were by 2-fold. The boost in the
treated 22-month-old mice resembled the untreated 6-month-olds
(FIG. 17A). NMN treatment restored oxidative phosphorylation
capacity as demonstrated by an increase in ATP levels and COX
activity (FIG. 17B and FIG. 24H), as well as the expression of
mitochondrial-encoded genes in old mice (FIG. 17C). Moreover, NMN
treatment also reversed the age-induced decline in VHL and
consequent accumulation of HIF-1.alpha. (FIG. 17D), as well as
suppressed the increase in lactate levels in the skeletal muscle
(FIG. 17E). Interestingly, in Egln1 KO mice treated with NMN did
not restore mitochondrial-encoded genes and ATP levels in the
skeletal muscle when compared to WT controls, indicating that
HIF-1.alpha. protein stabilization inhibits the effects of NMN
(FIGS. 17F and 17G). Coming full circle, if the effects that were
observed with NMN are due to increase in NAD.sup.+ specific to the
nucleus and reestablishment of proper nuclear energetics as our
initial experiments suggested (FIG. 11A-11K), then impairment of
NAD.sup.+ production from NMN specifically in the nucleus should
prevent NMN effects on mitochondria. In primary myoblasts,
knockdown of NMNAT1completely abolishes the ability of NMN to
induce the expression of mitochondrial-encoded genes (FIG. 17H),
demonstrating that indeed these effects are mediated by changes in
nuclear energetics. In line with this, treatment of the inducible
SIRT1 KO mouse with NMN showed that the ability of NMN to increase
mitochondrial-encoded genes in the skeletal muscle is lost in
animals lacking SIRT1 (FIG. 17I), demonstrating that SIRT1 is the
mediator between changes in nuclear energetics and consequent
alterations in mitochondrial homeostasis.
[0319] As a functional test of whether the effects of NMN in
mitochondrial homeostasis were also relevant for global muscle
health, several markers were evaluated. Muscle wasting and
inflammation are markers of muscle aging and, as expected an
increase in the muscle wasting markers Atrogin-1 and MuRF1 (FIG.
17J) and in the expression of inflammation markers in the skeletal
muscle of old mice were observed (FIG. 24J). Strikingly, NMN
treatment completely reversed these markers (FIG. 17J and FIG.
24K), indicating that restoring NAD.sup.+ levels can improve
age-related muscle wasting and inflammation. In addition, NMN was
also able to reverse age-induced insulin resistance in the skeletal
muscle, as shown by its ability to restore insulin signaling in the
soleus of old mice treated with NMN via the increasing the
phosphorylation of two important downstream targets of the insulin
receptor, AKT and IRS-1 (FIG. 17L).
[0320] Taken together, these results provides convincing evidence
that restoring NAD.sup.+ levels in old animals is sufficient to
restore mitochondrial homeostasis in the skeletal muscle through
restoration of nuclear energetics and consequent SIRT1-mediated
suppression of a pseudohypoxic, as well as to improve global muscle
health.
DISCUSSION
[0321] Deregulation of mitochondrial homeostasis is one of the
hallmarks of aging in diverse species such as yeast and humans. In
mammals, disruption of mitochondrial homeostasis is believed to be
an underlying cause of aging and the etiology of numerous
age-related diseases (Coskun et al., 2011; de Moura et al., 2010;
Figueiredo et al., 2009; Finsterer, 2004; Sahin et al., 2011;
Schulz et al., 2007; Wallace et al., 2010). Despite its importance,
there is still a great deal of controversy as to why age induces
the disruption of mitochondrial homeostasis and how this process
might be slowed or reversed.
[0322] One of the more surprising findings in described herein was
that SIRT1 can regulate mitochondrial function independently of the
canonical PGC-1.alpha./.beta. pathway. The data demonstrates that
SIRT1 regulates mitochondrial homeostasis through two distinct
pathways that are activated in distinct energetic states, and
suggests that SIRT1 is involved in fine-tuning mitochondrial
metabolism to maintain cellular homeostasis. Under normal cellular
energetic conditions, SIRT1 regulates mitochondrial homeostasis
through the PGC-1.alpha./3-independent regulation of specifically
mitochondrial-encoded genes driven by HIF-1.alpha./c-Myc. However,
under conditions of low energy, such as fasting and prolonged ETC
decline, SIRT1 deacetylates and activates PGC-1.alpha. to induce
fatty acid oxidation and promote mitochondrial biogenesis
(Gerhart-Hines et al., 2007) (FIG. 17L). Mechanistically, the
ability of SIRT1 to induce one pathway versus the other is related
to AMPK activity and its ability to phosphorylate PGC-1.alpha.
(Canto et al., 2009). Indeed, it was found that in conditions of
energetic decline AMPK is active and signals PGC-1.alpha. to be
deacetylated by SIRT1 through phosphorylation, thus activating the
mitochondrial biogenesis program. However, under normal energetic
conditions the phosphorylation signal is not present as AMPK is not
active, thus SIRT1's effects on mitochondria are mainly mediated by
the PGC-1.alpha./.beta.-independent pathway.
[0323] The ability of SIRT1 to regulate mitochondrial homeostasis
independently of PGC-1.alpha./.beta. in SIRT1 KO and elderly mice
was traced to an accumulation of HIF-1.alpha. in the skeletal
muscle. This seems to occur in aerobic conditions, and it was
demonstrated that this accumulation impairs OXPHOS and
mitochondrial homeostasis in vitro and in vivo. Both CR and NMN
reduced the level of HIF-1.alpha. in muscle, coincident with
improvements in mitochondrial homeostasis. Conversely,
stabilization of HIF-1.alpha. by genetic or pharmacological means
induced an imbalance between nuclear- and mitochondrial-encoded ETC
genes, and prevented the ability of SIRT1 to induce expression of
mitochondrial-encoded genes. Different studies have previously
linked SIRT1 to the hypoxic regulation of HIF-1.alpha.. One study
demonstrated that inhibition of SIRT1 increases acetylation of
HIF-1.alpha., thereby increasing its transcriptional activity (Lim
et al., 2010), while another study, has reported that SIRT1
inhibition reduces the accumulation and transcriptional activity of
HIF-1.alpha. protein in hypoxic conditions (Laemmle et al., 2012).
Importantly, it was shown herein that deletion of SIRT1 in vivo
leads to an increase in HIF-1.alpha. protein levels in skeletal
muscle under normal oxygen conditions, indicating that under normal
physiological conditions SIRT1 acts as a negative regulator of
HIF-1.alpha. protein stability. Interestingly it was demonstrated
that the regulation of HIF-1.alpha. protein levels goes awry during
aging. This occurs through the ability of SIRT1 to regulate mRNA of
the E3 ubiquitin ligase VHL that is responsible for tagging
HIF-1.alpha. for degradation. The data provided herein indicates
that SIRT1 does not alter VHL promoter activity, thus suggesting
that this change likely due to regulation of mRNA stability.
However, further studies will be necessary to determine how SIRT1
regulates VHL mRNA levels in the skeletal muscle. Moreover, VHL
also targets to proteasomal degration HIF-2.alpha. in a similar
manner to HIF-1.alpha.. Interestingly, in addition to regulating
HIF-1.alpha. (Lim et al., 2010), SIRT1 has also previously reported
to regulate HIF-2.alpha. (Dioum et al., 2009). The expression of
HIF-2.alpha. (but not HIF-1.alpha.) is regulated by PGC-1.alpha.
and plays an important role in fiber type switching of skeletal
muscle (Rasbach et al., 2010). The metabolic and fiber type changes
that were observed are seemingly distinct from this pathway because
the ability of SIRT1 to increase expression of mitochondrial genes
or mtDNA content does not require PGC-1.alpha., nor is it affected
by stabilization of HIF-2.alpha..
[0324] HIF-1.alpha. was previously associated with changes in
mitochondrial biogenesis under conditions of obesity. High fat diet
feeding induced the expression of HIF1.alpha. as well as levels of
mtDNA in liver (Carabelli et al., 2011). HIF-1.alpha. was also
reported to be stabilized in white adipose tissue in animal models
of obesity, but upregulation of HIF-1.alpha. was found to be
correlated with a decline in mitochondrial related genes in this
tissue (Krishnan et al., 2012). Moreover, in the liver and
macrophages of the long lived Mclk+/- mouse HIF-1.alpha. was found
to be upregulated (Wang et al., 2010). The results herein also
demonstrated that different tissues have different responses,
suggesting that the role of HIF-1.alpha. in the regulation of
mitochondrial homeostasis is tissue specific, possibly acting in
accordance to the metabolic specificities of each tissue.
[0325] This metabolic state in the muscle of the SIRT1 KO and
22-month-old mice is referred to herein as pseudohypoxia, in part
because the pattern of gene expression is similar to the effects of
hypoxia and both involve HIF-1.alpha. and c-Myc. The other
compelling reason is that the increase in HIF-1.alpha. and the
shift towards non-oxidative pathways of the myoblasts occurs and
persists even in the presence of normal levels of oxygen, similar
to what has been described previously as a pseudohypoxic state
(Sanders, 2012; Williamson et al., 1993). As far as the inventors
are aware, this is the first report to suggest that
pseudohypoxia-induced metabolic reprogramming is triggered in
post-mitotic cells during aging and is responsible for the
age-related disruption in mitochondrial homeostasis and raises the
possibility that this mechanism might also be relevant to the
metabolic reprogramming characteristic of cancer cells.
[0326] The finding that aging leads to a pseudohypoxic response
driven by decline in nuclear energetics is particularly interesting
since numerous studies have examined the role of HIF-1.alpha. in
the regulation of life span in C. elegans. Although these studies
clearly point to HIF-1.alpha. as a player in the aging process, its
role is still a matter of debate with different lifespan outcomes
being reported (Leiser and Kaeberlein, 2010). The data herein
indicate that one possible explanation for the disparity is that
moderate Hif-1 overexpression induces mitochondrial dysfunction,
which, under certain conditions, has been shown to promote lifespan
in the worm (Dillin et al., 2002; Felkai et al., 1999; Feng et al.,
2001; Gallo et al., 2011).
[0327] In this study a series of genetic and pharmacological
experiments are presented that point to HIF-1.alpha.-mediated
inhibition of c-Myc as a cause of the specific decline in
mitochondrial-encoded genes in the skeletal muscle. Together these
findings clearly show that in addition to SIRT1's ability to
regulate PGC-1.alpha., it also regulates mitochondrial homeostasis
by preventing the HIF-1.alpha.-mediated inhibition of c-Myc and
TFAM expression, thereby providing the first link between
HIF-1.alpha./c-Myc and the disruption of mitochondrial homeostasis
in the skeletal muscle during aging. Recent reports have shown that
c-Myc and SIRT1 regulate each other via feedback loops, whether
these are positive or negative loops is still a question of debate
as different groups have reached different conclusions (Mao et al.,
2011; Marshall et al., 2011; Menssen et al., 2012; Yuan et al.,
2009). SIRT1 is known to directly regulate c-Myc transcriptional
activity in cancer cells, either by deacetylation of c-Myc (Menssen
et al., 2012) or by binding c-Myc and promoting its association
with Max (Mao et al., 2011). However, under these conditions the
effect of c-Myc on the TFAM promoter driven by SIRT1 requires
HIF-1.alpha., but a direct effect of SIRT1 on c-Myc under different
condition cannot be excluded and as such additional studies will be
required to elucidate how these feedback loops affect the
regulation of mitochondrial-encoded genes.
[0328] These observations beg the question: why does aging produce
a pseudohypoxic response that causes a selective loss of
mitochondrial-encoded genes? On one hand, the fact that two
different genomes encode different subunits of critical
multi-protein complexes certainly demands tight coordination
between the two genomes (Wallace et al., 2010), as such one can
speculate that increased survival at advanced ages is simply beyond
the force of natural selection, so that aged organisms simply
succumb to entropy. On the other hand, a more nuanced explanation
is based on the concept of antagonistic pleiotropy, the idea that
adaptations that help young individuals survive can be deleterious
later in life (Williams and Day, 2003). In this scenario, the
SIRT1-HIF-1.alpha.-Myc-TFAM pathway evolved to ensure optimal
mitochondrial function in response to nuclear energetics and oxygen
content. In later life, however, the chronic activation of a
pseudohypoxic response and the resulting disruption of normal
metabolism, may result in accelerating age-related diseases. In
line with this concept, disturbance in mitochondrial homeostasis
during development in C. elegans extends lifespan (Dillin et al.,
2002; Durieux et al., 2011). Moreover, mitochondrial homeostasis at
old age is protected in the long lived Mclk1+/- mouse, however
mitochondrial homeostasis was found to be disturbed in young ages
(Wang et al., 2009) and more recently, it was shown that a
mitonuclear protein imbalance can act as a conserved longevity
pathway by inducing mtUPR (Houtkooper et al., 2013). While it
cannot be excluded that when acutely induced this pseudohypoxia
pathway might elicit mtUPR and thus be beneficial, it can be
concluded that chronic induction of this pathway does not illicit
mtUPR in both SIRT1 KO and in 22-months-old mice.
[0329] Together, the work described herein lead the following
model, declining NAD.sup.+ specifically in the nucleus elicits a
pseudohypoxic state driven by loss of SIRT1 activity, which induces
an imbalance between nuclear- and mitochondrial-encoded genes and
consequently disrupts the stoichiometric OXPHOS complexes, thus
suggesting that a decline in nuclear energetics is, at least in
part one, of the causes of age-related disruption of mitochondrial
homeostasis and one of the means by which CR confers its beneficial
health effects. Moreover, the current dogma is that aging is
irreversible, but the data herein show that one week of treatment
with a compound that boosts NAD.sup.+ levels was sufficient to
restore the mitochondrial function, as well as global muscle health
of 22-month-old mice to levels similar to 6-month-olds. This study
also suggests that compounds that prevent HIF-1.alpha.
stabilization, or promote its degradation may also induce a similar
beneficial effect on metabolism and mitochondrial homeostasis in
aged tissues. In summary, these findings provide evidence for a new
pathway that drives the changes in carbon utilization and the
disruption in mitochondrial homeostasis that characterize aging, a
pathway that is rapidly reversible and potentially amenable to
treatment of a variety of age-related diseases.
Sequence CWU 1
1
1141826PRTHomo sapiens 1Met Glu Gly Ala Gly Gly Ala Asn Asp Lys Lys
Lys Ile Ser Ser Glu 1 5 10 15 Arg Arg Lys Glu Lys Ser Arg Asp Ala
Ala Arg Ser Arg Arg Ser Lys 20 25 30 Glu Ser Glu Val Phe Tyr Glu
Leu Ala His Gln Leu Pro Leu Pro His 35 40 45 Asn Val Ser Ser His
Leu Asp Lys Ala Ser Val Met Arg Leu Thr Ile 50 55 60 Ser Tyr Leu
Arg Val Arg Lys Leu Leu Asp Ala Gly Asp Leu Asp Ile 65 70 75 80 Glu
Asp Asp Met Lys Ala Gln Met Asn Cys Phe Tyr Leu Lys Ala Leu 85 90
95 Asp Gly Phe Val Met Val Leu Thr Asp Asp Gly Asp Met Ile Tyr Ile
100 105 110 Ser Asp Asn Val Asn Lys Tyr Met Gly Leu Thr Gln Phe Glu
Leu Thr 115 120 125 Gly His Ser Val Phe Asp Phe Thr His Pro Cys Asp
His Glu Glu Met 130 135 140 Arg Glu Met Leu Thr His Arg Asn Gly Leu
Val Lys Lys Gly Lys Glu 145 150 155 160 Gln Asn Thr Gln Arg Ser Phe
Phe Leu Arg Met Lys Cys Thr Leu Thr 165 170 175 Ser Arg Gly Arg Thr
Met Asn Ile Lys Ser Ala Thr Trp Lys Val Leu 180 185 190 His Cys Thr
Gly His Ile His Val Tyr Asp Thr Asn Ser Asn Gln Pro 195 200 205 Gln
Cys Gly Tyr Lys Lys Pro Pro Met Thr Cys Leu Val Leu Ile Cys 210 215
220 Glu Pro Ile Pro His Pro Ser Asn Ile Glu Ile Pro Leu Asp Ser Lys
225 230 235 240 Thr Phe Leu Ser Arg His Ser Leu Asp Met Lys Phe Ser
Tyr Cys Asp 245 250 255 Glu Arg Ile Thr Glu Leu Met Gly Tyr Glu Pro
Glu Glu Leu Leu Gly 260 265 270 Arg Ser Ile Tyr Glu Tyr Tyr His Ala
Leu Asp Ser Asp His Leu Thr 275 280 285 Lys Thr His His Asp Met Phe
Thr Lys Gly Gln Val Thr Thr Gly Gln 290 295 300 Tyr Arg Met Leu Ala
Lys Arg Gly Gly Tyr Val Trp Val Glu Thr Gln 305 310 315 320 Ala Thr
Val Ile Tyr Asn Thr Lys Asn Ser Gln Pro Gln Cys Ile Val 325 330 335
Cys Val Asn Tyr Val Val Ser Gly Ile Ile Gln His Asp Leu Ile Phe 340
345 350 Ser Leu Gln Gln Thr Glu Cys Val Leu Lys Pro Val Glu Ser Ser
Asp 355 360 365 Met Lys Met Thr Gln Leu Phe Thr Lys Val Glu Ser Glu
Asp Thr Ser 370 375 380 Ser Leu Phe Asp Lys Leu Lys Lys Glu Pro Asp
Ala Leu Thr Leu Leu 385 390 395 400 Ala Pro Ala Ala Gly Asp Thr Ile
Ile Ser Leu Asp Phe Gly Ser Asn 405 410 415 Asp Thr Glu Thr Asp Asp
Gln Gln Leu Glu Glu Val Pro Leu Tyr Asn 420 425 430 Asp Val Met Leu
Pro Ser Pro Asn Glu Lys Leu Gln Asn Ile Asn Leu 435 440 445 Ala Met
Ser Pro Leu Pro Thr Ala Glu Thr Pro Lys Pro Leu Arg Ser 450 455 460
Ser Ala Asp Pro Ala Leu Asn Gln Glu Val Ala Leu Lys Leu Glu Pro 465
470 475 480 Asn Pro Glu Ser Leu Glu Leu Ser Phe Thr Met Pro Gln Ile
Gln Asp 485 490 495 Gln Thr Pro Ser Pro Ser Asp Gly Ser Thr Arg Gln
Ser Ser Pro Glu 500 505 510 Pro Asn Ser Pro Ser Glu Tyr Cys Phe Tyr
Val Asp Ser Asp Met Val 515 520 525 Asn Glu Phe Lys Leu Glu Leu Val
Glu Lys Leu Phe Ala Glu Asp Thr 530 535 540 Glu Ala Lys Asn Pro Phe
Ser Thr Gln Asp Thr Asp Leu Asp Leu Glu 545 550 555 560 Met Leu Ala
Pro Tyr Ile Pro Met Asp Asp Asp Phe Gln Leu Arg Ser 565 570 575 Phe
Asp Gln Leu Ser Pro Leu Glu Ser Ser Ser Ala Ser Pro Glu Ser 580 585
590 Ala Ser Pro Gln Ser Thr Val Thr Val Phe Gln Gln Thr Gln Ile Gln
595 600 605 Glu Pro Thr Ala Asn Ala Thr Thr Thr Thr Ala Thr Thr Asp
Glu Leu 610 615 620 Lys Thr Val Thr Lys Asp Arg Met Glu Asp Ile Lys
Ile Leu Ile Ala 625 630 635 640 Ser Pro Ser Pro Thr His Ile His Lys
Glu Thr Thr Ser Ala Thr Ser 645 650 655 Ser Pro Tyr Arg Asp Thr Gln
Ser Arg Thr Ala Ser Pro Asn Arg Ala 660 665 670 Gly Lys Gly Val Ile
Glu Gln Thr Glu Lys Ser His Pro Arg Ser Pro 675 680 685 Asn Val Leu
Ser Val Ala Leu Ser Gln Arg Thr Thr Val Pro Glu Glu 690 695 700 Glu
Leu Asn Pro Lys Ile Leu Ala Leu Gln Asn Ala Gln Arg Lys Arg 705 710
715 720 Lys Met Glu His Asp Gly Ser Leu Phe Gln Ala Val Gly Ile Gly
Thr 725 730 735 Leu Leu Gln Gln Pro Asp Asp His Ala Ala Thr Thr Ser
Leu Ser Trp 740 745 750 Lys Arg Val Lys Gly Cys Lys Ser Ser Glu Gln
Asn Gly Met Glu Gln 755 760 765 Lys Thr Ile Ile Leu Ile Pro Ser Asp
Leu Ala Cys Arg Leu Leu Gly 770 775 780 Gln Ser Met Asp Glu Ser Gly
Leu Pro Gln Leu Thr Ser Tyr Asp Cys 785 790 795 800 Glu Val Asn Ala
Pro Ile Gln Gly Ser Arg Asn Leu Leu Gln Gly Glu 805 810 815 Glu Leu
Leu Arg Ala Leu Asp Gln Val Asn 820 825 2 826PRTPan troglodytes
2Met Glu Gly Ala Gly Gly Ala Asn Asp Lys Lys Lys Ile Ser Ser Glu 1
5 10 15 Arg Arg Lys Glu Lys Ser Arg Asp Ala Ala Arg Ser Arg Arg Ser
Lys 20 25 30 Glu Ser Glu Val Phe Tyr Glu Leu Ala His Gln Leu Pro
Leu Pro His 35 40 45 Asn Val Ser Ser His Leu Asp Lys Ala Ser Val
Met Arg Leu Thr Ile 50 55 60 Ser Tyr Leu Arg Val Arg Lys Leu Leu
Asp Ala Gly Asp Leu Asp Ile 65 70 75 80 Glu Asp Asp Met Lys Ala Gln
Met Asn Cys Phe Tyr Leu Lys Ala Leu 85 90 95 Asp Gly Phe Val Met
Val Leu Thr Asp Asp Gly Asp Met Ile Tyr Ile 100 105 110 Ser Asp Asn
Val Asn Lys Tyr Met Gly Leu Thr Gln Phe Glu Leu Thr 115 120 125 Gly
His Ser Val Phe Asp Phe Thr His Pro Cys Asp His Glu Glu Met 130 135
140 Arg Glu Met Leu Thr His Arg Asn Gly Leu Val Lys Lys Gly Lys Glu
145 150 155 160 Gln Asn Thr Gln Arg Ser Phe Phe Leu Arg Met Lys Cys
Thr Leu Thr 165 170 175 Ser Arg Gly Arg Thr Met Asn Ile Lys Ser Ala
Thr Trp Lys Val Leu 180 185 190 His Cys Thr Gly His Ile His Val Tyr
Asp Thr Asn Ser Asn Gln Pro 195 200 205 Gln Cys Gly Tyr Lys Lys Pro
Pro Met Thr Cys Leu Val Leu Ile Cys 210 215 220 Glu Pro Ile Pro His
Pro Ser Asn Ile Glu Ile Pro Leu Asp Ser Lys 225 230 235 240 Thr Phe
Leu Ser Arg His Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp 245 250 255
Glu Arg Ile Thr Glu Leu Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly 260
265 270 Arg Ser Ile Tyr Glu Tyr Tyr His Ala Leu Asp Ser Asp His Leu
Thr 275 280 285 Lys Thr His His Asp Met Phe Thr Lys Gly Gln Val Thr
Thr Gly Gln 290 295 300 Tyr Arg Met Leu Ala Lys Arg Gly Gly Tyr Val
Trp Val Glu Thr Gln 305 310 315 320 Ala Thr Val Ile Tyr Asn Thr Lys
Asn Ser Gln Pro Gln Cys Ile Val 325 330 335 Cys Val Asn Tyr Val Val
Ser Gly Ile Ile Gln His Asp Leu Ile Phe 340 345 350 Ser Leu Gln Gln
Thr Glu Cys Val Leu Lys Pro Val Glu Ser Ser Asp 355 360 365 Met Lys
Met Thr Gln Leu Phe Thr Lys Val Glu Ser Glu Asp Thr Ser 370 375 380
Ser Leu Phe Asp Lys Leu Lys Lys Glu Pro Asp Ala Leu Thr Leu Leu 385
390 395 400 Ala Pro Ala Ala Gly Asp Thr Ile Ile Ser Leu Asp Phe Gly
Ser Asn 405 410 415 Asp Thr Glu Thr Asp Asp Gln Gln Leu Glu Glu Val
Pro Leu Tyr Asn 420 425 430 Asp Val Met Leu Pro Ser Pro Asn Glu Lys
Leu Gln Asn Ile Asn Leu 435 440 445 Ala Met Ser Pro Leu Pro Thr Ala
Glu Thr Pro Lys Pro Leu Arg Ser 450 455 460 Ser Ala Asp Pro Ala Leu
Asn Gln Glu Val Ala Leu Lys Leu Glu Pro 465 470 475 480 Asn Pro Glu
Ser Leu Glu Leu Ser Phe Thr Met Pro Gln Ile Gln Asp 485 490 495 Gln
Thr Pro Ser Pro Ser Asp Gly Ser Thr Arg Gln Ser Ser Pro Glu 500 505
510 Pro Asn Ser Pro Ser Glu Tyr Cys Phe Tyr Val Asp Ser Asp Met Val
515 520 525 Asn Glu Phe Lys Leu Glu Leu Val Glu Lys Leu Phe Ala Glu
Asp Thr 530 535 540 Glu Ala Lys Asn Pro Phe Ser Thr Gln Asp Thr Asp
Leu Asp Leu Glu 545 550 555 560 Met Leu Ala Pro Tyr Ile Pro Met Asp
Asp Asp Phe Gln Leu Arg Ser 565 570 575 Phe Asp Gln Leu Ser Pro Leu
Glu Ser Ser Ser Ala Ser Pro Glu Ser 580 585 590 Ala Ser Pro Gln Ser
Thr Val Thr Val Phe Gln Gln Thr Gln Ile Gln 595 600 605 Glu Pro Thr
Ala Asn Ala Thr Thr Thr Thr Ala Thr Thr Asp Glu Leu 610 615 620 Lys
Thr Val Thr Lys Asp Cys Met Glu Asp Ile Lys Ile Leu Ile Ala 625 630
635 640 Ser Pro Ser Pro Thr His Ile His Lys Glu Thr Thr Ser Ala Thr
Ser 645 650 655 Ser Pro Tyr Arg Asp Thr Gln Ser Arg Thr Ala Ser Pro
Asn Arg Ala 660 665 670 Gly Lys Gly Val Ile Glu Gln Thr Glu Lys Ser
His Pro Arg Ser Pro 675 680 685 Asn Val Leu Ser Val Ala Leu Ser Gln
Arg Thr Thr Val Pro Glu Glu 690 695 700 Glu Leu Asn Pro Lys Ile Leu
Ala Leu Gln Asn Ala Gln Arg Lys Arg 705 710 715 720 Lys Met Glu His
Asp Gly Ser Leu Phe Gln Ala Val Gly Ile Gly Thr 725 730 735 Leu Leu
Gln Gln Pro Asp Asp His Ala Ala Thr Thr Ser Leu Ser Trp 740 745 750
Lys Arg Val Lys Gly Cys Lys Ser Ser Glu Gln Asn Gly Met Glu Gln 755
760 765 Lys Thr Ile Ile Leu Ile Pro Ser Asp Leu Ala Cys Arg Leu Leu
Gly 770 775 780 Gln Ser Met Asp Glu Ser Gly Leu Pro Gln Leu Thr Ser
Tyr Asp Cys 785 790 795 800 Glu Val Asn Ala Pro Ile Gln Gly Ser Arg
Asn Leu Leu Gln Gly Glu 805 810 815 Glu Leu Leu Arg Ala Leu Asp Gln
Val Asn 820 825 3826PRTMacaca mulatta 3Met Glu Gly Ala Gly Gly Ala
Asn Asp Lys Lys Lys Ile Ser Ser Glu 1 5 10 15 Arg Arg Lys Glu Lys
Ser Arg Asp Ala Ala Arg Ser Arg Arg Ser Lys 20 25 30 Glu Ser Glu
Val Phe Tyr Glu Leu Ala His Gln Leu Pro Leu Pro His 35 40 45 Asn
Val Ser Ser His Leu Asp Lys Ala Ser Val Met Arg Leu Thr Ile 50 55
60 Ser Tyr Leu Arg Val Arg Lys Leu Leu Asp Ala Gly Asp Leu Asp Ile
65 70 75 80 Glu Asp Glu Met Lys Ala Gln Met Asn Cys Phe Tyr Leu Lys
Ala Leu 85 90 95 Asp Gly Phe Val Met Val Leu Thr Asp Asp Gly Asp
Met Ile Tyr Ile 100 105 110 Ser Asp Asn Val Asn Lys Tyr Met Gly Leu
Thr Gln Phe Glu Leu Thr 115 120 125 Gly His Ser Val Phe Asp Phe Thr
His Pro Cys Asp His Glu Glu Met 130 135 140 Arg Glu Met Leu Thr His
Arg Asn Gly Pro Val Lys Lys Gly Lys Glu 145 150 155 160 Gln Asn Thr
Gln Arg Ser Phe Phe Leu Arg Met Lys Cys Thr Leu Thr 165 170 175 Ser
Arg Gly Arg Thr Met Asn Ile Lys Ser Ala Thr Trp Lys Val Leu 180 185
190 His Cys Thr Gly His Ile His Val Tyr Asp Thr Asn Ser Asn Gln Pro
195 200 205 Gln Cys Gly Tyr Lys Lys Pro Pro Met Thr Cys Leu Val Leu
Ile Cys 210 215 220 Glu Pro Ile Pro His Pro Ser Asn Ile Glu Ile Pro
Leu Asp Ser Lys 225 230 235 240 Thr Phe Leu Ser Arg His Ser Leu Asp
Met Lys Phe Ser Tyr Cys Asp 245 250 255 Glu Arg Ile Thr Glu Leu Met
Gly Tyr Glu Pro Glu Glu Leu Leu Gly 260 265 270 Arg Ser Ile Tyr Glu
Tyr Tyr His Ala Leu Asp Ser Asp His Leu Thr 275 280 285 Lys Thr His
His Asp Met Phe Thr Lys Gly Gln Val Thr Thr Gly Gln 290 295 300 Tyr
Arg Met Leu Ala Lys Arg Gly Gly Tyr Val Trp Val Glu Thr Gln 305 310
315 320 Ala Thr Val Ile Tyr Asn Thr Lys Asn Ser Gln Pro Gln Cys Ile
Val 325 330 335 Cys Val Asn Tyr Val Val Ser Gly Ile Ile Gln His Asp
Leu Ile Phe 340 345 350 Ser Leu Gln Gln Thr Glu Cys Val Leu Lys Pro
Val Glu Ser Ser Asp 355 360 365 Met Lys Met Thr Gln Leu Phe Thr Lys
Val Glu Ser Glu Asp Thr Ser 370 375 380 Ser Leu Phe Asp Lys Leu Lys
Lys Glu Pro Asp Ala Leu Thr Leu Leu 385 390 395 400 Ala Pro Ala Ala
Gly Asp Thr Ile Ile Ser Leu Asp Phe Gly Ser Asn 405 410 415 Asp Thr
Glu Thr Asp Asp Gln Gln Leu Glu Glu Val Pro Leu Tyr Asn 420 425 430
Asp Val Met Leu Pro Ser Ser Asn Glu Lys Leu Gln Asn Ile Asn Leu 435
440 445 Ala Met Ser Pro Leu Pro Thr Ser Glu Thr Pro Lys Pro Leu Arg
Ser 450 455 460 Ser Ala Asp Pro Ala Leu Asn Gln Glu Val Ala Leu Lys
Leu Glu Pro 465 470 475 480 Asn Pro Glu Ser Leu Glu Leu Ser Phe Thr
Met Pro Gln Ile Gln Asp 485 490 495 Gln Pro Pro Ser Pro Ser Asp Gly
Ser Thr Arg Gln Ser Ser Pro Glu 500 505 510 Pro Asn Ser Pro Ser Glu
Tyr Cys Phe Tyr Val Asp Ser Asp Met Val 515 520 525 Asn Glu Phe Lys
Leu Glu Leu Val Glu Lys Leu Phe Ala Glu Asp Thr 530 535 540 Glu Ala
Lys Asn Pro Phe Ser Thr Gln Asp Thr Asp Leu Asp Leu Glu 545 550 555
560 Met Leu Ala Pro Tyr Ile Pro Met Asp Asp Asp Phe Gln Leu Arg Ser
565 570 575 Phe Asp Gln Leu Ser Pro Leu Glu Ser Ser Ser Ala Ser Pro
Glu Ser 580 585 590 Ala Ser Pro Gln Ser Thr Val Thr Val Phe Gln Gln
Thr Gln Ile Gln 595 600 605 Glu Pro Thr Ala Asn Ala Thr Thr Thr Thr
Ala Thr Thr Asp Glu Leu 610 615 620 Lys Thr Val Thr Lys Asp Arg Met
Glu Asp Ile Lys Ile Leu Ile Ala 625 630 635 640 Ser Pro Ser Ser Thr
His Ile His Lys
Glu Thr Thr Ser Ala Thr Ser 645 650 655 Ser Pro Tyr Arg Asp Thr Gln
Ser Arg Thr Ala Ser Pro Asn Arg Ala 660 665 670 Gly Lys Gly Val Ile
Glu Gln Thr Glu Lys Ser His Pro Arg Ser Pro 675 680 685 Asn Val Leu
Ser Val Thr Leu Ser Gln Arg Thr Thr Val Pro Glu Glu 690 695 700 Glu
Leu Asn Pro Lys Ile Leu Ala Leu Gln Asn Ala Gln Arg Lys Arg 705 710
715 720 Lys Met Glu His Asp Gly Ser Leu Phe Gln Ala Val Gly Ile Gly
Thr 725 730 735 Leu Leu Gln Gln Pro Asp Asp His Ala Ala Thr Thr Ser
Leu Ser Trp 740 745 750 Lys Arg Val Lys Gly Cys Lys Ser Ser Glu Gln
Asn Gly Met Glu Gln 755 760 765 Lys Thr Ile Ile Leu Ile Pro Ser Asp
Leu Ala Cys Arg Leu Leu Gly 770 775 780 Gln Ser Met Asp Glu Ser Gly
Leu Pro Gln Leu Thr Ser Tyr Asp Cys 785 790 795 800 Glu Val Asn Ala
Pro Ile Gln Gly Ser Arg Asn Leu Leu Gln Gly Glu 805 810 815 Glu Leu
Leu Arg Ala Leu Asp Gln Val Asn 820 825 4823PRTCanis lupus
familiaris 4Met Glu Gly Ala Gly Gly Ala Asn Asp Lys Lys Lys Ile Ser
Ser Glu 1 5 10 15 Arg Arg Lys Glu Lys Ser Arg Asp Ala Ala Arg Ser
Arg Arg Ser Lys 20 25 30 Glu Ser Glu Val Phe Tyr Glu Leu Ala His
Gln Leu Pro Leu Pro His 35 40 45 Asn Val Ser Ser His Leu Asp Lys
Ala Ser Val Met Arg Leu Thr Ile 50 55 60 Ser Tyr Leu Arg Val Arg
Lys Leu Leu Asp Ala Gly Asp Leu Asp Ile 65 70 75 80 Glu Asp Glu Met
Lys Ala Gln Met Asn Cys Phe Tyr Leu Lys Ala Leu 85 90 95 Asp Gly
Phe Val Met Val Leu Thr Asp Asp Gly Asp Met Ile Tyr Ile 100 105 110
Ser Asp Asn Val Asn Lys Tyr Met Gly Leu Thr Gln Phe Glu Leu Thr 115
120 125 Gly His Ser Val Phe Asp Phe Thr His Pro Cys Asp His Glu Glu
Met 130 135 140 Arg Glu Met Leu Thr His Arg Asn Gly Leu Val Lys Lys
Gly Lys Glu 145 150 155 160 Gln Asn Thr Gln Arg Ser Phe Phe Leu Arg
Met Lys Cys Thr Leu Thr 165 170 175 Ser Arg Gly Arg Thr Met Asn Ile
Lys Ser Ala Thr Trp Lys Val Leu 180 185 190 His Cys Thr Gly His Ile
His Val Tyr Asp Thr Asn Ser Asn Gln Ser 195 200 205 Gln Cys Gly Tyr
Lys Lys Pro Pro Met Thr Cys Leu Val Leu Ile Cys 210 215 220 Glu Pro
Ile Pro His Pro Ser Asn Ile Glu Ile Pro Leu Asp Ser Lys 225 230 235
240 Thr Phe Leu Ser Arg His Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp
245 250 255 Glu Arg Ile Thr Glu Leu Met Gly Tyr Glu Pro Glu Glu Leu
Leu Gly 260 265 270 Arg Ser Ile Tyr Glu Tyr Tyr His Ala Leu Asp Ser
Asp His Leu Thr 275 280 285 Lys Thr His His Asp Met Phe Thr Lys Gly
Gln Val Thr Thr Gly Gln 290 295 300 Tyr Arg Met Leu Ala Lys Arg Gly
Gly Tyr Val Trp Val Glu Thr Gln 305 310 315 320 Ala Thr Val Ile Tyr
Asn Thr Lys Asn Ser Gln Pro Gln Cys Ile Val 325 330 335 Cys Val Asn
Tyr Val Val Ser Gly Ile Ile Gln His Asp Leu Ile Phe 340 345 350 Ser
Leu Gln Gln Thr Glu Cys Val Leu Lys Pro Val Glu Ser Ser Asp 355 360
365 Met Lys Met Thr Gln Leu Phe Thr Lys Val Glu Ser Glu Asp Thr Ser
370 375 380 Ser Leu Phe Asp Lys Leu Lys Lys Glu Pro Asp Ala Leu Thr
Leu Leu 385 390 395 400 Ala Pro Ala Ala Gly Asp Thr Ile Ile Ser Leu
Asp Phe Gly Ser Asn 405 410 415 Asp Thr Glu Thr Asp Asp Gln Gln Leu
Glu Glu Val Pro Leu Tyr Asn 420 425 430 Asp Val Met Leu Pro Ser Ser
Asn Glu Lys Leu Gln Asn Ile Asn Leu 435 440 445 Ala Met Ser Pro Leu
Pro Ala Ser Glu Thr Pro Lys Pro Leu Arg Ser 450 455 460 Ser Ala Asp
Pro Ala Leu Asn Gln Glu Val Ala Leu Lys Leu Glu Pro 465 470 475 480
Asn Pro Glu Ser Leu Glu Leu Ser Phe Thr Met Pro Gln Ile Gln Asp 485
490 495 Gln Pro Ala Ser Pro Ser Asp Gly Ser Thr Arg Gln Ser Ser Pro
Glu 500 505 510 Pro Asn Ser Pro Ser Glu Tyr Cys Phe Asp Val Asp Ser
Asp Met Val 515 520 525 Asn Glu Phe Lys Leu Glu Leu Val Glu Lys Leu
Phe Ala Glu Asp Thr 530 535 540 Glu Ala Lys Asn Pro Phe Ser Thr Gln
Asp Thr Asp Leu Asp Leu Glu 545 550 555 560 Met Leu Ala Pro Tyr Ile
Pro Met Asp Asp Asp Phe Gln Leu Arg Ser 565 570 575 Phe Asp Gln Leu
Ser Pro Leu Glu Ser Asn Ser Thr Ser Pro Gln Ser 580 585 590 Ala Ser
Thr Ile Thr Val Phe Gln Pro Thr Pro Met Gln Glu Pro Pro 595 600 605
Leu Thr Thr Thr Ser Thr Thr Ala Thr Thr Asp Glu Leu Lys Thr Val 610
615 620 Thr Lys Asp Gly Ile Glu Asp Ile Lys Ile Leu Ile Ala Ala Pro
Ser 625 630 635 640 Pro Thr His Val Pro Lys Val Thr Thr Ser Ala Thr
Thr Ser Pro Tyr 645 650 655 Ser Asp Thr Gly Ser Arg Thr Ala Ser Pro
Asn Arg Ala Gly Lys Gly 660 665 670 Val Ile Glu Gln Thr Glu Lys Ser
His Pro Arg Ser Pro Asn Val Leu 675 680 685 Ser Val Thr Leu Ser Gln
Arg Thr Thr Ile Pro Glu Glu Glu Leu Asn 690 695 700 Pro Lys Ile Leu
Ala Leu Gln Asn Ala Gln Arg Lys Arg Lys Ile Glu 705 710 715 720 His
Asp Gly Ser Leu Phe Gln Ala Val Gly Ile Gly Thr Leu Leu Gln 725 730
735 Gln Pro Asp Asp Arg Ala Thr Thr Thr Ser Leu Ser Trp Lys Arg Val
740 745 750 Lys Gly Cys Lys Ser Ser Glu Gln Asn Gly Met Glu Gln Lys
Thr Ile 755 760 765 Ile Leu Ile Pro Ser Asp Leu Ala Cys Arg Leu Leu
Gly Gln Ser Met 770 775 780 Asp Glu Ser Gly Leu Pro Gln Leu Thr Ser
Tyr Asp Cys Glu Val Asn 785 790 795 800 Ala Pro Ile Gln Gly Ser Arg
Asn Leu Leu Gln Gly Glu Glu Leu Leu 805 810 815 Arg Ala Leu Asp Gln
Val Asn 820 5823PRTBos Taurus 5Met Glu Gly Ala Gly Gly Ala Asn Asp
Lys Lys Lys Ile Ser Ser Glu 1 5 10 15 Arg Arg Lys Glu Lys Ser Arg
Asp Ala Ala Arg Ser Arg Arg Ser Lys 20 25 30 Glu Ser Glu Val Phe
Tyr Glu Leu Ala His Gln Leu Pro Leu Pro His 35 40 45 Asn Val Ser
Ser His Leu Asp Lys Ala Ser Val Met Arg Leu Thr Ile 50 55 60 Ser
Tyr Leu Arg Val Arg Lys Leu Leu Asp Ala Gly Asp Leu Asp Ile 65 70
75 80 Glu Asp Glu Met Lys Ala Gln Met Asn Cys Phe Tyr Leu Lys Ala
Leu 85 90 95 Asp Gly Phe Val Met Val Leu Thr Asp Asp Gly Asp Met
Ile Tyr Ile 100 105 110 Ser Asp Asn Val Asn Lys Tyr Met Gly Leu Thr
Gln Phe Glu Leu Thr 115 120 125 Gly His Ser Val Phe Asp Phe Thr His
Pro Cys Asp His Glu Glu Met 130 135 140 Arg Glu Met Leu Thr His Arg
Asn Gly Leu Val Lys Lys Gly Lys Glu 145 150 155 160 Gln Asn Thr Gln
Arg Ser Phe Phe Leu Arg Met Lys Cys Thr Leu Thr 165 170 175 Ser Arg
Gly Arg Thr Met Asn Ile Lys Ser Ala Thr Trp Lys Val Leu 180 185 190
His Cys Thr Gly His Ile His Val Tyr Asp Thr Asn Ser Asn Gln Ser 195
200 205 Gln Cys Gly Tyr Lys Lys Pro Pro Met Thr Cys Leu Val Leu Ile
Cys 210 215 220 Glu Pro Ile Pro His Pro Ser Asn Ile Glu Ile Pro Leu
Asp Ser Lys 225 230 235 240 Thr Phe Leu Ser Arg His Ser Leu Asp Met
Lys Phe Ser Tyr Cys Asp 245 250 255 Glu Arg Ile Thr Glu Leu Met Gly
Tyr Glu Pro Glu Glu Leu Leu Gly 260 265 270 Arg Ser Ile Tyr Glu Tyr
Tyr His Ala Leu Asp Ser Asp His Leu Thr 275 280 285 Lys Thr His His
Asp Met Phe Thr Lys Gly Gln Val Thr Thr Gly Gln 290 295 300 Tyr Arg
Met Leu Ala Lys Arg Gly Gly Tyr Val Trp Ile Glu Thr Gln 305 310 315
320 Ala Thr Val Ile Tyr Asn Thr Lys Asn Ser Gln Pro Gln Cys Ile Val
325 330 335 Cys Val Asn Tyr Val Val Ser Gly Ile Ile Gln His Asp Leu
Ile Phe 340 345 350 Ser Leu Gln Gln Thr Glu Cys Val Leu Lys Pro Val
Glu Ser Ser Asp 355 360 365 Met Lys Met Thr Gln Leu Phe Thr Lys Val
Glu Ser Glu Asp Thr Ser 370 375 380 Ser Leu Phe Asp Lys Leu Lys Lys
Glu Pro Asp Ala Leu Thr Leu Leu 385 390 395 400 Ala Pro Ala Ala Gly
Asp Thr Ile Ile Ser Leu Asp Phe Gly Ser Asn 405 410 415 Asp Thr Glu
Thr Asp Asp Gln Gln Leu Glu Glu Val Pro Leu Tyr Asn 420 425 430 Asp
Val Met Leu Pro Ser Ser Asn Glu Lys Leu Gln Asn Ile Asn Leu 435 440
445 Ala Met Ser Pro Leu Pro Ala Ser Glu Thr Pro Lys Pro Leu Arg Ser
450 455 460 Ser Ala Asp Pro Ala Leu Asn Gln Glu Val Ala Leu Lys Leu
Glu Pro 465 470 475 480 Asn Pro Glu Ser Leu Glu Leu Ser Phe Thr Met
Pro Gln Ile Gln Asp 485 490 495 Gln Pro Ala Ser Pro Ser Asp Gly Ser
Thr Arg Gln Ser Ser Pro Glu 500 505 510 Pro Asn Ser Pro Ser Glu Tyr
Cys Phe Asp Val Asp Ser Asp Met Val 515 520 525 Asn Glu Phe Lys Leu
Glu Leu Val Glu Lys Leu Phe Ala Glu Asp Thr 530 535 540 Glu Ala Lys
Asn Pro Phe Ser Thr Gln Asp Thr Asp Leu Asp Leu Glu 545 550 555 560
Met Leu Ala Pro Tyr Ile Pro Met Asp Asp Asp Phe Gln Leu Arg Ser 565
570 575 Phe Asp Gln Leu Ser Pro Leu Glu Asn Ser Ser Thr Ser Pro Gln
Ser 580 585 590 Ala Ser Thr Asn Thr Val Phe Gln Pro Thr Gln Met Gln
Glu Pro Pro 595 600 605 Ile Ala Thr Val Thr Thr Thr Ala Thr Ser Asp
Glu Leu Lys Thr Val 610 615 620 Thr Lys Asp Gly Met Glu Asp Ile Lys
Ile Leu Ile Ala Phe Pro Ser 625 630 635 640 Pro Pro His Val Pro Lys
Glu Pro Pro Cys Ala Thr Thr Ser Pro Tyr 645 650 655 Ser Asp Thr Gly
Ser Arg Thr Ala Ser Pro Asn Arg Ala Gly Lys Gly 660 665 670 Val Ile
Glu Gln Thr Glu Lys Ser His Pro Arg Ser Pro Asn Val Leu 675 680 685
Ser Val Ala Leu Ser Gln Arg Thr Thr Ala Pro Glu Glu Glu Leu Asn 690
695 700 Pro Lys Ile Leu Ala Leu Gln Asn Ala Gln Arg Lys Arg Lys Ile
Glu 705 710 715 720 His Asp Gly Ser Leu Phe Gln Ala Val Gly Ile Gly
Thr Leu Leu Gln 725 730 735 Gln Pro Asp Asp Arg Ala Thr Thr Thr Ser
Leu Ser Trp Lys Arg Val 740 745 750 Lys Gly Cys Lys Ser Ser Glu Gln
Asn Gly Met Glu Gln Lys Thr Ile 755 760 765 Ile Leu Ile Pro Ser Asp
Leu Ala Cys Arg Leu Leu Gly Gln Ser Met 770 775 780 Asp Glu Ser Gly
Leu Pro Gln Leu Thr Ser Tyr Asp Cys Glu Val Asn 785 790 795 800 Ala
Pro Ile Gln Gly Ser Arg Asn Leu Leu Gln Gly Glu Glu Leu Leu 805 810
815 Arg Ala Leu Asp Gln Val Asn 820 6 836PRTMus musculus 6Met Glu
Gly Ala Gly Gly Glu Asn Glu Lys Lys Lys Met Ser Ser Glu 1 5 10 15
Arg Arg Lys Glu Lys Ser Arg Asp Ala Ala Arg Ser Arg Arg Ser Lys 20
25 30 Glu Ser Glu Val Phe Tyr Glu Leu Ala His Gln Leu Pro Leu Pro
His 35 40 45 Asn Val Ser Ser His Leu Asp Lys Ala Ser Val Met Arg
Leu Thr Ile 50 55 60 Ser Tyr Leu Arg Val Arg Lys Leu Leu Asp Ala
Gly Gly Leu Asp Ser 65 70 75 80 Glu Asp Glu Met Lys Ala Gln Met Asp
Cys Phe Tyr Leu Lys Ala Leu 85 90 95 Asp Gly Phe Val Met Val Leu
Thr Asp Asp Gly Asp Met Val Tyr Ile 100 105 110 Ser Asp Asn Val Asn
Lys Tyr Met Gly Leu Thr Gln Phe Glu Leu Thr 115 120 125 Gly His Ser
Val Phe Asp Phe Thr His Pro Cys Asp His Glu Glu Met 130 135 140 Arg
Glu Met Leu Thr His Arg Asn Gly Pro Val Arg Lys Gly Lys Glu 145 150
155 160 Leu Asn Thr Gln Arg Ser Phe Phe Leu Arg Met Lys Cys Thr Leu
Thr 165 170 175 Ser Arg Gly Arg Thr Met Asn Ile Lys Ser Ala Thr Trp
Lys Val Leu 180 185 190 His Cys Thr Gly His Ile His Val Tyr Asp Thr
Asn Ser Asn Gln Pro 195 200 205 Gln Cys Gly Tyr Lys Lys Pro Pro Met
Thr Cys Leu Val Leu Ile Cys 210 215 220 Glu Pro Ile Pro His Pro Ser
Asn Ile Glu Ile Pro Leu Asp Ser Lys 225 230 235 240 Thr Phe Leu Ser
Arg His Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp 245 250 255 Glu Arg
Ile Thr Glu Leu Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly 260 265 270
Arg Ser Ile Tyr Glu Tyr Tyr His Ala Leu Asp Ser Asp His Leu Thr 275
280 285 Lys Thr His His Asp Met Phe Thr Lys Gly Gln Val Thr Thr Gly
Gln 290 295 300 Tyr Arg Met Leu Ala Lys Arg Gly Gly Tyr Val Trp Val
Glu Thr Gln 305 310 315 320 Ala Thr Val Ile Tyr Asn Thr Lys Asn Ser
Gln Pro Gln Cys Ile Val 325 330 335 Cys Val Asn Tyr Val Val Ser Gly
Ile Ile Gln His Asp Leu Ile Phe 340 345 350 Ser Leu Gln Gln Thr Glu
Ser Val Leu Lys Pro Val Glu Ser Ser Asp 355 360 365 Met Lys Met Thr
Gln Leu Phe Thr Lys Val Glu Ser Glu Asp Thr Ser 370 375 380 Cys Leu
Phe Asp Lys Leu Lys Lys Glu Pro Asp Ala Leu Thr Leu Leu 385 390 395
400 Ala Pro Ala Ala Gly Asp Thr Ile Ile Ser Leu Asp Phe Gly Ser Asp
405 410 415 Asp Thr Glu Thr Glu Asp Gln Gln Leu Glu Asp Val Pro Leu
Tyr Asn 420 425 430 Asp Val Met Phe Pro Ser Ser Asn Glu Lys Leu Asn
Ile Asn Leu Ala 435 440 445 Met Ser Pro Leu Pro Ser Ser Glu Thr Pro
Lys Pro Leu Arg Ser Ser 450 455 460 Ala Asp Pro Ala Leu
Asn Gln Glu Val Ala Leu Lys Leu Glu Ser Ser 465 470 475 480 Pro Glu
Ser Leu Gly Leu Ser Phe Thr Met Pro Gln Ile Gln Asp Gln 485 490 495
Pro Ala Ser Pro Ser Asp Gly Ser Thr Arg Gln Ser Ser Pro Glu Arg 500
505 510 Leu Leu Gln Glu Asn Val Asn Thr Pro Asn Phe Ser Gln Pro Asn
Ser 515 520 525 Pro Ser Glu Tyr Cys Phe Asp Val Asp Ser Asp Met Val
Asn Val Phe 530 535 540 Lys Leu Glu Leu Val Glu Lys Leu Phe Ala Glu
Asp Thr Glu Ala Lys 545 550 555 560 Asn Pro Phe Ser Thr Gln Asp Thr
Asp Leu Asp Leu Glu Met Leu Ala 565 570 575 Pro Tyr Ile Pro Met Asp
Asp Asp Phe Gln Leu Arg Ser Phe Asp Gln 580 585 590 Leu Ser Pro Leu
Glu Ser Asn Ser Pro Ser Pro Pro Ser Met Ser Thr 595 600 605 Val Thr
Gly Phe Gln Gln Thr Gln Leu Gln Lys Pro Thr Ile Thr Ala 610 615 620
Thr Ala Thr Thr Thr Ala Thr Thr Asp Glu Ser Lys Thr Glu Thr Lys 625
630 635 640 Asp Asn Lys Glu Asp Ile Lys Ile Leu Ile Ala Ser Pro Ser
Ser Thr 645 650 655 Gln Val Pro Gln Glu Thr Thr Thr Ala Lys Ala Ser
Ala Tyr Ser Gly 660 665 670 Thr His Ser Arg Thr Ala Ser Pro Asp Arg
Ala Gly Lys Arg Val Ile 675 680 685 Glu Gln Thr Asp Lys Ala His Pro
Arg Ser Leu Asn Leu Ser Ala Thr 690 695 700 Leu Asn Gln Arg Asn Thr
Val Pro Glu Glu Glu Leu Asn Pro Lys Thr 705 710 715 720 Ile Ala Ser
Gln Asn Ala Gln Arg Lys Arg Lys Met Glu His Asp Gly 725 730 735 Ser
Leu Phe Gln Ala Ala Gly Ile Gly Thr Leu Leu Gln Gln Pro Gly 740 745
750 Asp Cys Ala Pro Thr Met Ser Leu Ser Trp Lys Arg Val Lys Gly Phe
755 760 765 Ile Ser Ser Glu Gln Asn Gly Thr Glu Gln Lys Thr Ile Ile
Leu Ile 770 775 780 Pro Ser Asp Leu Ala Cys Arg Leu Leu Gly Gln Ser
Met Asp Glu Ser 785 790 795 800 Gly Leu Pro Gln Leu Thr Ser Tyr Asp
Cys Glu Val Asn Ala Pro Ile 805 810 815 Gln Gly Ser Arg Asn Leu Leu
Gln Gly Glu Glu Leu Leu Arg Ala Leu 820 825 830 Asp Gln Val Asn 835
7 823PRTRattus norvegicus 7Met Glu Gly Ala Gly Gly Glu Asn Glu Lys
Lys Asn Arg Met Ser Ser 1 5 10 15 Glu Arg Arg Lys Glu Lys Ser Arg
Asp Ala Ala Arg Ser Arg Arg Ser 20 25 30 Lys Glu Ser Glu Val Phe
Tyr Glu Leu Ala His Gln Leu Pro Leu Pro 35 40 45 His Asn Val Ser
Ser His Leu Asp Lys Ala Ser Val Met Arg Leu Thr 50 55 60 Ile Ser
Tyr Leu Arg Val Arg Lys Leu Leu Gly Ala Gly Asp Leu Asp 65 70 75 80
Ile Glu Asp Glu Met Lys Ala Gln Met Asn Cys Phe Tyr Leu Lys Ala 85
90 95 Leu Asp Gly Phe Val Met Val Leu Thr Asp Asp Gly Asp Met Ile
Tyr 100 105 110 Ile Ser Asp Asn Val Asn Lys Tyr Met Gly Leu Thr Gln
Phe Glu Leu 115 120 125 Thr Gly His Ser Val Phe Asp Phe Thr His Pro
Cys Asp His Glu Glu 130 135 140 Met Arg Glu Met Leu Thr His Arg Asn
Gly Pro Val Arg Lys Gly Lys 145 150 155 160 Glu Gln Asn Thr Gln Arg
Ser Phe Phe Leu Arg Met Lys Cys Thr Leu 165 170 175 Thr Ser Arg Gly
Arg Thr Met Asn Ile Lys Ser Ala Thr Trp Lys Val 180 185 190 Leu His
Cys Thr Gly His Ile His Val Tyr Asp Thr Ser Ser Asn Gln 195 200 205
Pro Gln Cys Gly Tyr Lys Lys Pro Pro Met Thr Cys Leu Val Leu Ile 210
215 220 Cys Glu Pro Ile Pro His Pro Ser Asn Ile Glu Ile Pro Leu Asp
Ser 225 230 235 240 Lys Thr Phe Leu Ser Arg His Ser Leu Asp Met Lys
Phe Ser Tyr Cys 245 250 255 Asp Glu Arg Ile Thr Glu Leu Met Gly Tyr
Glu Pro Glu Glu Leu Leu 260 265 270 Gly Arg Ser Ile Tyr Glu Tyr Tyr
His Ala Leu Asp Ser Asp His Leu 275 280 285 Thr Lys Thr His His Asp
Met Phe Thr Lys Gly Gln Val Thr Thr Gly 290 295 300 Gln Tyr Arg Met
Leu Ala Lys Arg Gly Gly Tyr Val Trp Val Glu Thr 305 310 315 320 Gln
Ala Thr Val Ile Tyr Asn Thr Lys Asn Ser Gln Pro Gln Cys Ile 325 330
335 Val Cys Val Asn Tyr Val Val Ser Gly Ile Ile Gln His Asp Leu Ile
340 345 350 Phe Ser Leu Gln Gln Thr Glu Ser Val Leu Lys Pro Val Glu
Ser Ser 355 360 365 Asp Met Lys Met Thr Gln Leu Phe Thr Lys Val Glu
Ser Glu Asp Thr 370 375 380 Ser Cys Leu Phe Asp Lys Leu Lys Lys Glu
Pro Asp Ala Leu Thr Leu 385 390 395 400 Leu Ala Pro Ala Ala Gly Asp
Thr Ile Ile Ser Leu Asp Phe Gly Ser 405 410 415 Asp Asp Thr Glu Thr
Glu Asp Gln Gln Leu Glu Asp Val Pro Leu Tyr 420 425 430 Asn Asp Val
Met Phe Pro Ser Ser Asn Glu Lys Leu Asn Ile Asn Leu 435 440 445 Ala
Met Ser Pro Leu Pro Ala Ser Glu Thr Pro Lys Pro Leu Arg Ser 450 455
460 Ser Ala Asp Pro Ala Leu Asn Gln Glu Val Ala Leu Lys Leu Glu Ser
465 470 475 480 Ser Pro Glu Ser Leu Gly Leu Ser Phe Thr Met Pro Gln
Ile Gln Asp 485 490 495 Gln Pro Ala Ser Pro Ser Asp Gly Ser Thr Arg
Gln Ser Ser Pro Glu 500 505 510 Pro Asn Ser Pro Ser Glu Tyr Cys Phe
Asp Val Asp Ser Asp Met Val 515 520 525 Asn Val Phe Lys Leu Glu Leu
Val Glu Lys Leu Phe Ala Glu Asp Thr 530 535 540 Glu Ala Lys Asn Pro
Phe Ser Ala Gln Asp Thr Asp Leu Asp Leu Glu 545 550 555 560 Met Leu
Ala Pro Tyr Ile Pro Met Asp Asp Asp Phe Gln Leu Arg Ser 565 570 575
Phe Asp Gln Leu Ser Pro Leu Glu Ser Asn Ser Pro Ser Pro Pro Ser 580
585 590 Val Ser Thr Val Thr Gly Phe Gln Gln Thr Gln Leu Gln Lys Pro
Thr 595 600 605 Ile Thr Val Thr Ala Thr Ala Thr Ala Thr Thr Asp Glu
Ser Lys Ala 610 615 620 Val Thr Lys Asp Asn Ile Glu Asp Ile Lys Ile
Leu Ile Ala Ser Pro 625 630 635 640 Pro Ser Thr Gln Val Pro Gln Glu
Met Thr Thr Ala Lys Ala Ser Ala 645 650 655 Tyr Ser Gly Thr His Ser
Arg Thr Ala Ser Pro Asp Arg Ala Gly Lys 660 665 670 Arg Val Ile Glu
Lys Thr Asp Lys Ala His Pro Arg Ser Leu Asn Leu 675 680 685 Ser Val
Thr Leu Asn Gln Arg Asn Thr Val Pro Glu Glu Glu Leu Asn 690 695 700
Pro Lys Thr Ile Ala Leu Gln Asn Ala Gln Arg Lys Arg Lys Met Glu 705
710 715 720 His Asp Gly Ser Leu Phe Gln Ala Ala Gly Ile Gly Thr Leu
Leu Gln 725 730 735 Gln Pro Gly Asp Arg Ala Pro Thr Met Ser Leu Ser
Trp Lys Arg Val 740 745 750 Lys Gly Tyr Ile Ser Ser Glu Gln Asp Gly
Met Glu Gln Lys Thr Ile 755 760 765 Phe Leu Ile Pro Ser Asp Leu Ala
Cys Arg Leu Leu Gly Gln Ser Met 770 775 780 Asp Glu Ser Gly Leu Pro
Gln Leu Thr Ser Tyr Asp Cys Glu Val Asn 785 790 795 800 Ala Pro Ile
Gln Gly Ser Arg Asn Leu Leu Gln Gly Glu Glu Leu Leu 805 810 815 Arg
Ala Leu Asp Gln Val Asn 820 8 811PRTGallus gallus 8Met Asp Ser Pro
Gly Gly Val Thr Asp Lys Lys Arg Ile Ser Ser Glu 1 5 10 15 Arg Arg
Lys Glu Lys Ser Arg Asp Ala Ala Arg Cys Arg Arg Ser Lys 20 25 30
Glu Ser Glu Val Phe Tyr Glu Leu Ala His Gln Leu Pro Leu Pro His 35
40 45 Thr Val Ser Ala His Leu Asp Lys Ala Ser Ile Met Arg Leu Thr
Ile 50 55 60 Ser Tyr Leu Arg Met Arg Lys Leu Leu Asp Ala Gly Glu
Leu Glu Thr 65 70 75 80 Glu Ala Asn Met Glu Lys Glu Leu Asn Cys Phe
Tyr Leu Lys Ala Leu 85 90 95 Asp Gly Phe Val Met Val Leu Ser Glu
Asp Gly Asp Met Ile Tyr Met 100 105 110 Ser Glu Asn Val Asn Lys Cys
Met Gly Leu Thr Gln Phe Asp Leu Thr 115 120 125 Gly His Ser Val Phe
Asp Phe Thr His Pro Cys Asp His Glu Glu Leu 130 135 140 Arg Glu Met
Leu Thr His Arg Asn Gly Pro Val Lys Lys Gly Lys Glu 145 150 155 160
Gln Asn Thr Glu Arg Ser Phe Phe Leu Arg Met Lys Cys Thr Leu Thr 165
170 175 Ser Arg Gly Arg Thr Val Asn Ile Lys Ser Ala Thr Trp Lys Val
Leu 180 185 190 His Cys Thr Gly His Ile Arg Val Tyr Asp Thr Cys Asn
Asn Gln Thr 195 200 205 His Cys Gly Tyr Lys Lys Pro Pro Met Thr Cys
Leu Val Leu Ile Cys 210 215 220 Glu Pro Ile Pro His Pro Ser Asn Ile
Glu Val Pro Leu Asp Ser Lys 225 230 235 240 Thr Phe Leu Ser Arg His
Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp 245 250 255 Glu Arg Ile Thr
Glu Leu Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly 260 265 270 Arg Ser
Ile Tyr Glu Tyr Tyr His Ala Leu Asp Ser Asp His Leu Thr 275 280 285
Lys Thr His His Asp Met Phe Thr Lys Gly Gln Val Thr Thr Gly Gln 290
295 300 Tyr Arg Met Leu Ala Lys Gln Gly Gly Tyr Val Trp Val Glu Thr
Gln 305 310 315 320 Ala Thr Val Ile Tyr Asn Thr Lys Asn Ser Gln Pro
Gln Cys Ile Val 325 330 335 Cys Val Asn Tyr Val Leu Ser Gly Ile Val
Gln Lys Asp Leu Ile Phe 340 345 350 Ser Leu Gly Gln Thr Glu Cys Met
Leu Lys Pro Val Glu Ser Pro Glu 355 360 365 Met Lys Met Thr Lys Ile
Phe Ser Lys Asp Asp Trp Asp Asp Thr Asn 370 375 380 Ser Leu Phe Glu
Lys Leu Lys Gln Glu Pro Asp Ala Leu Thr Val Leu 385 390 395 400 Ala
Pro Ala Ala Gly Asp Thr Ile Ile Ser Leu Asp Phe Ser Ser Asn 405 410
415 Glu Ser Asp Glu Gln Gln Cys Asp Glu Val Pro Leu Tyr Asn Asp Val
420 425 430 Met Leu Pro Ser Ser Ser Glu Lys Leu Gln Asn Ile Asn Ile
Ala Met 435 440 445 Ser Pro Leu Pro Ala Ser Glu Thr Thr Lys Pro Leu
Arg Ser Asn Ala 450 455 460 Asp Pro Ala Leu Asn Arg Glu Val Val Ser
Lys Leu Glu Pro Asn Thr 465 470 475 480 Glu Thr Leu Glu Leu Ser Phe
Thr Met Pro Gln Val Gln Glu Gln Pro 485 490 495 Thr Ser Pro Ser Asp
Ala Ser Thr Ser Gln Ser Ser Pro Glu Pro Ser 500 505 510 Ser Pro Asn
Asp Tyr Cys Phe Asp Val Asp Asn Asp Met Ala Asn Glu 515 520 525 Phe
Lys Leu Glu Leu Val Glu Lys Leu Phe Ala Ile Asp Thr Glu Ala 530 535
540 Lys Asn Pro Phe Ser Thr Gln Glu Thr Asp Leu Asp Leu Glu Met Leu
545 550 555 560 Ala Pro Tyr Ile Pro Met Asp Asp Asp Phe Gln Leu Arg
Ser Phe Asp 565 570 575 Gln Leu Ser Pro Leu Glu Ser Ser Ser Ser Gly
Ser Gln Asn Ala Ala 580 585 590 Thr Ile Thr Ile Leu Gln Gln Thr Gln
Thr Pro Ser Thr Ala Ala Asp 595 600 605 Glu Ile Lys Pro Val Ala Glu
Arg Val Asp Asp Val Lys Ala Leu Ile 610 615 620 Val Pro Ser Ser Pro
Val His Val Ile Asn Asp Thr Ser Ser Ala Pro 625 630 635 640 Ala Ser
Pro Tyr Ser Gly Asn Arg Ser Arg Thr Ala Ser Pro Ile Arg 645 650 655
Ala Gly Lys Gly Thr Leu Glu Gln Thr Glu Lys Ser Cys Pro Gly Ala 660
665 670 Pro Ser Leu Ile Thr Val Thr Leu Asn Lys Arg Ser Thr Ala Met
Asp 675 680 685 Glu Glu Leu Asn Pro Lys Met Leu Ala Leu His Asn Ala
Gln Arg Lys 690 695 700 Arg Lys Met Glu His Asp Gly Ser Leu Phe Gln
Ala Val Gly Ile Gly 705 710 715 720 Ser Leu Phe Gln Gln Thr Gly Asp
Arg Gly Gly Asn Ala Ser Leu Ala 725 730 735 Trp Lys Arg Val Lys Ala
Cys Lys Thr Asn Gly His Asn Gly Val Glu 740 745 750 Gln Lys Thr Ile
Ile Leu Leu Ser Thr Asp Ile Ala Ser Lys Leu Leu 755 760 765 Gly Gln
Ser Met Asp Glu Ser Gly Leu Pro Gln Leu Thr Ser Tyr Asp 770 775 780
Cys Glu Val Asn Ala Pro Ile Gln Gly Asn Arg Asn Leu Leu Gln Gly 785
790 795 800 Glu Glu Leu Leu Arg Ala Leu Asp Gln Val Asn 805 810
9533PRTDanio rerio 9Met Asp Thr Gly Val Val Thr Glu Lys Lys Arg Val
Ser Ser Glu Arg 1 5 10 15 Arg Lys Gly Lys Ser Arg Asp Ala Ala Arg
Ser Arg Arg Gly Lys Glu 20 25 30 Ser Glu Val Phe Tyr Glu Leu Ala
His Gln Leu Pro Leu Pro His Asn 35 40 45 Val Thr Ser His Leu Asp
Lys Ala Ser Ile Met Arg Leu Thr Ile Ser 50 55 60 Tyr Leu Arg Met
Arg Lys Leu Leu Asn Ser Asp Glu Lys Glu Glu Lys 65 70 75 80 Glu Glu
Asn Glu Leu Glu Ser Gln Leu Asn Gly Phe Tyr Leu Lys Ala 85 90 95
Leu Glu Gly Phe Leu Met Val Leu Ser Glu Asp Gly Asp Met Val Tyr 100
105 110 Leu Ser Glu Asn Val Ser Lys Ser Met Gly Leu Thr Gln Phe Asp
Leu 115 120 125 Thr Gly His Ser Ile Phe Glu Phe Ser His Pro Cys Asp
His Glu Glu 130 135 140 Leu Arg Glu Met Leu Val His Arg Thr Gly Ser
Lys Lys Thr Lys Glu 145 150 155 160 Gln Asn Thr Glu Arg Ser Phe Phe
Leu Arg Met Lys Cys Thr Leu Thr 165 170 175 Ser Arg Gly Arg Thr Val
Asn Ile Lys Ser Ala Thr Trp Lys Val Leu 180 185 190 His Cys Ala Gly
His Val Arg Val His Glu Gly Ser Glu Ala Ser Glu 195 200 205 Asp Ser
Gly Phe Lys Glu Pro Pro Val Thr Tyr Leu Val Leu Ile Cys 210 215 220
Glu Pro Ile Pro His Pro Ser Asn Ile Glu Val Pro Leu Asp Ser Lys 225
230 235 240 Thr Phe Leu Ser Arg His Thr Leu Asp Met Lys Phe Ser Tyr
Cys Asp 245 250 255 Glu Arg Ile Thr Glu Leu Met Gly Tyr Glu Pro Asp
Asp Leu Leu Asn 260 265 270 Arg Ser Val Tyr Glu Tyr Tyr His Ala Leu
Asp Ser Asp His Leu Thr 275 280 285 Lys Thr His His Asn Leu Phe
Ala Lys Gly Gln Ala Thr Thr Gly Gln 290 295 300 Tyr Arg Met Leu Ala
Lys Lys Gly Gly Phe Val Trp Val Glu Thr Gln 305 310 315 320 Ala Thr
Val Ile Tyr Asn Pro Lys Asn Ser Gln Pro Gln Cys Ile Val 325 330 335
Cys Val Asn Tyr Val Leu Ser Gly Ile Val Glu Gly Asp Val Val Leu 340
345 350 Ser Leu Gln Gln Thr Val Thr Glu Pro Lys Ala Val Glu Lys Glu
Ser 355 360 365 Glu Glu Thr Glu Glu Lys Thr Ser Glu Leu Asp Ile Leu
Lys Leu Phe 370 375 380 Lys Pro Glu Ser Leu Asn Cys Ser Leu Glu Ser
Ser Thr Leu Tyr Asn 385 390 395 400 Lys Leu Lys Glu Glu Pro Glu Ala
Leu Thr Val Leu Ala Pro Ala Ala 405 410 415 Gly Asp Ala Ile Ile Ser
Leu Asp Phe Asn Asn Ser Asp Ser Asp Ile 420 425 430 Gln Leu Leu Lys
Glu Val Pro Leu Tyr Asn Asp Val Met Leu Pro Ser 435 440 445 Ser Ser
Glu Lys Leu Pro Leu Ser Leu Ser Pro Leu Thr Pro Ser Asp 450 455 460
Ser Leu Ser Ser His Ala Thr Thr Ala Lys Ser Thr Leu Pro Cys Arg 465
470 475 480 Arg Arg His Pro Gly Pro Leu His Pro Tyr Thr Cys Cys Arg
Arg Cys 485 490 495 Ala Val His Leu Ser Arg Ser Ser Val Ala Val Gly
Met Pro His Leu 500 505 510 Phe Asp Pro Ala Pro His Arg Ala Ala Val
Ser Ser Thr Thr Glu Lys 515 520 525 Cys Leu Gln Arg Cys 530
10721PRTCaenorhabditis elegans 10Met Glu Asp Asn Arg Lys Arg Asn
Met Glu Arg Arg Arg Glu Thr Ser 1 5 10 15 Arg His Ala Ala Arg Asp
Arg Arg Ser Lys Glu Ser Asp Ile Phe Asp 20 25 30 Asp Leu Lys Met
Cys Val Pro Ile Val Glu Glu Gly Thr Val Thr His 35 40 45 Leu Asp
Arg Ile Ala Leu Leu Arg Val Ala Ala Thr Ile Cys Arg Leu 50 55 60
Arg Lys Thr Ala Gly Asn Val Leu Glu Asn Asn Leu Asp Asn Glu Ile 65
70 75 80 Thr Asn Glu Val Trp Thr Glu Asp Thr Ile Ala Glu Cys Leu
Asp Gly 85 90 95 Phe Val Met Ile Val Asp Ser Asp Ser Ser Ile Leu
Tyr Val Thr Glu 100 105 110 Ser Val Ala Met Tyr Leu Gly Leu Thr Gln
Thr Asp Leu Thr Gly Arg 115 120 125 Ala Leu Arg Asp Phe Leu His Pro
Ser Asp Tyr Asp Glu Phe Asp Lys 130 135 140 Gln Ser Lys Met Leu His
Lys Pro Arg Gly Glu Asp Thr Asp Thr Thr 145 150 155 160 Gly Ile Asn
Met Val Leu Arg Met Lys Thr Val Ile Ser Pro Arg Gly 165 170 175 Arg
Cys Leu Asn Leu Lys Ser Ala Leu Tyr Lys Ser Val Ser Phe Leu 180 185
190 Val His Ser Lys Val Ser Thr Gly Gly His Val Ser Phe Met Gln Gly
195 200 205 Ile Thr Ile Pro Ala Gly Gln Gly Thr Thr Asn Ala Asn Ala
Ser Ala 210 215 220 Met Thr Lys Tyr Thr Glu Ser Pro Met Gly Ala Phe
Thr Thr Arg His 225 230 235 240 Thr Cys Asp Met Arg Ile Thr Phe Val
Ser Asp Lys Phe Asn Tyr Ile 245 250 255 Leu Lys Ser Glu Leu Lys Thr
Leu Met Gly Thr Ser Phe Tyr Glu Leu 260 265 270 Val His Pro Ala Asp
Met Met Ile Val Ser Lys Ser Met Lys Glu Leu 275 280 285 Phe Ala Lys
Gly His Ile Arg Thr Pro Tyr Tyr Arg Leu Ile Ala Ala 290 295 300 Asn
Asp Thr Leu Ala Trp Ile Gln Thr Glu Ala Thr Thr Ile Thr His 305 310
315 320 Thr Thr Lys Gly Gln Lys Gly Gln Tyr Val Ile Cys Val His Tyr
Val 325 330 335 Leu Gly Ile Gln Gly Ala Glu Glu Ser Leu Val Val Cys
Thr Asp Ser 340 345 350 Met Pro Ala Gly Met Gln Val Asp Ile Lys Lys
Glu Val Asp Asp Thr 355 360 365 Arg Asp Tyr Ile Gly Arg Gln Pro Glu
Ile Val Glu Cys Val Asp Phe 370 375 380 Thr Pro Leu Ile Glu Pro Glu
Asp Pro Phe Asp Thr Val Ile Glu Pro 385 390 395 400 Val Val Gly Gly
Glu Glu Pro Val Lys Gln Ala Asp Met Gly Ala Arg 405 410 415 Lys Asn
Ser Tyr Asp Asp Val Leu Gln Trp Leu Phe Arg Asp Gln Pro 420 425 430
Ser Ser Pro Pro Pro Ala Arg Tyr Arg Ser Ala Asp Arg Phe Arg Thr 435
440 445 Thr Glu Pro Ser Asn Phe Gly Ser Ala Leu Ala Ser Pro Asp Phe
Met 450 455 460 Asp Ser Ser Ser Arg Thr Ser Arg Pro Lys Thr Ser Tyr
Gly Arg Arg 465 470 475 480 Ala Gln Ser Gln Gly Ser Arg Thr Thr Gly
Ser Ser Ser Thr Ser Ala 485 490 495 Ser Ala Thr Leu Pro His Ser Ala
Asn Tyr Ser Pro Leu Ala Glu Gly 500 505 510 Ile Ser Gln Cys Gly Leu
Asn Ser Pro Pro Ser Cys Ser Ile Lys Ser 515 520 525 Gly Gln Val Val
Tyr Gly Asp Ala Arg Ser Met Gly Arg Ser Cys Asp 530 535 540 Pro Ser
Asp Ser Ser Arg Arg Phe Ser Ala Leu Ser Pro Ser Asp Thr 545 550 555
560 Leu Asn Val Ser Ser Thr Arg Gly Ile Asn Pro Val Ile Gly Ser Asn
565 570 575 Asp Val Phe Ser Thr Met Pro Phe Ala Asp Ser Ile Ala Ile
Ala Glu 580 585 590 Arg Ile Asp Ser Ser Pro Thr Leu Thr Ser Gly Glu
Pro Ile Leu Cys 595 600 605 Asp Asp Leu Gln Trp Glu Glu Pro Asp Leu
Ser Cys Leu Ala Pro Phe 610 615 620 Val Asp Thr Tyr Asp Met Met Gln
Met Asp Glu Gly Leu Pro Pro Glu 625 630 635 640 Leu Gln Ala Leu Tyr
Asp Leu Pro Asp Phe Thr Pro Ala Val Pro Gln 645 650 655 Ala Pro Ala
Ala Arg Pro Val His Ile Asp Arg Ser Pro Pro Ala Lys 660 665 670 Arg
Met His Gln Ser Gly Pro Ser Asp Leu Asp Phe Met Tyr Thr Gln 675 680
685 His Tyr Gln Pro Phe Gln Gln Asp Glu Thr Tyr Trp Gln Gly Gln Gln
690 695 700 Gln Gln Asn Glu Gln Gln Pro Ser Ser Tyr Ser Pro Phe Pro
Met Leu 705 710 715 720 Ser 11163PRTHomo sapiens 11Phe Phe Leu Arg
Met Lys Cys Thr Leu Thr Ser Arg Gly Arg Thr Met 1 5 10 15 Asn Ile
Lys Ser Ala Thr Trp Lys Val Leu His Cys Thr Gly His Ile 20 25 30
His Val Tyr Asp Thr Asn Ser Asn Gln Pro Gln Cys Gly Tyr Lys Lys 35
40 45 Pro Pro Met Thr Cys Leu Val Leu Ile Cys Glu Pro Ile Pro His
Pro 50 55 60 Ser Asn Ile Glu Ile Pro Leu Asp Ser Lys Thr Phe Leu
Ser Arg His 65 70 75 80 Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp Glu
Arg Ile Thr Glu Leu 85 90 95 Met Gly Tyr Glu Pro Glu Glu Leu Leu
Gly Arg Ser Ile Tyr Glu Tyr 100 105 110 Tyr His Ala Leu Asp Ser Asp
His Leu Thr Lys Thr His His Asp Met 115 120 125 Phe Thr Lys Gly Gln
Val Thr Thr Gly Gln Tyr Arg Met Leu Ala Lys 130 135 140 Arg Gly Gly
Tyr Val Trp Val Glu Thr Gln Ala Thr Val Ile Tyr Asn 145 150 155 160
Thr Lys Asn 12163PRTPan troglodytes 12Phe Phe Leu Arg Met Lys Cys
Thr Leu Thr Ser Arg Gly Arg Thr Met 1 5 10 15 Asn Ile Lys Ser Ala
Thr Trp Lys Val Leu His Cys Thr Gly His Ile 20 25 30 His Val Tyr
Asp Thr Asn Ser Asn Gln Pro Gln Cys Gly Tyr Lys Lys 35 40 45 Pro
Pro Met Thr Cys Leu Val Leu Ile Cys Glu Pro Ile Pro His Pro 50 55
60 Ser Asn Ile Glu Ile Pro Leu Asp Ser Lys Thr Phe Leu Ser Arg His
65 70 75 80 Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp Glu Arg Ile Thr
Glu Leu 85 90 95 Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly Arg Ser
Ile Tyr Glu Tyr 100 105 110 Tyr His Ala Leu Asp Ser Asp His Leu Thr
Lys Thr His His Asp Met 115 120 125 Phe Thr Lys Gly Gln Val Thr Thr
Gly Gln Tyr Arg Met Leu Ala Lys 130 135 140 Arg Gly Gly Tyr Val Trp
Val Glu Thr Gln Ala Thr Val Ile Tyr Asn 145 150 155 160 Thr Lys Asn
13163PRTMacaca mulatta 13Phe Phe Leu Arg Met Lys Cys Thr Leu Thr
Ser Arg Gly Arg Thr Met 1 5 10 15 Asn Ile Lys Ser Ala Thr Trp Lys
Val Leu His Cys Thr Gly His Ile 20 25 30 His Val Tyr Asp Thr Asn
Ser Asn Gln Pro Gln Cys Gly Tyr Lys Lys 35 40 45 Pro Pro Met Thr
Cys Leu Val Leu Ile Cys Glu Pro Ile Pro His Pro 50 55 60 Ser Asn
Ile Glu Ile Pro Leu Asp Ser Lys Thr Phe Leu Ser Arg His 65 70 75 80
Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp Glu Arg Ile Thr Glu Leu 85
90 95 Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly Arg Ser Ile Tyr Glu
Tyr 100 105 110 Tyr His Ala Leu Asp Ser Asp His Leu Thr Lys Thr His
His Asp Met 115 120 125 Phe Thr Lys Gly Gln Val Thr Thr Gly Gln Tyr
Arg Met Leu Ala Lys 130 135 140 Arg Gly Gly Tyr Val Trp Val Glu Thr
Gln Ala Thr Val Ile Tyr Asn 145 150 155 160 Thr Lys Asn
14163PRTCanis lupus familiaris 14Phe Phe Leu Arg Met Lys Cys Thr
Leu Thr Ser Arg Gly Arg Thr Met 1 5 10 15 Asn Ile Lys Ser Ala Thr
Trp Lys Val Leu His Cys Thr Gly His Ile 20 25 30 His Val Tyr Asp
Thr Asn Ser Asn Gln Ser Gln Cys Gly Tyr Lys Lys 35 40 45 Pro Pro
Met Thr Cys Leu Val Leu Ile Cys Glu Pro Ile Pro His Pro 50 55 60
Ser Asn Ile Glu Ile Pro Leu Asp Ser Lys Thr Phe Leu Ser Arg His 65
70 75 80 Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp Glu Arg Ile Thr
Glu Leu 85 90 95 Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly Arg Ser
Ile Tyr Glu Tyr 100 105 110 Tyr His Ala Leu Asp Ser Asp His Leu Thr
Lys Thr His His Asp Met 115 120 125 Phe Thr Lys Gly Gln Val Thr Thr
Gly Gln Tyr Arg Met Leu Ala Lys 130 135 140 Arg Gly Gly Tyr Val Trp
Val Glu Thr Gln Ala Thr Val Ile Tyr Asn 145 150 155 160 Thr Lys Asn
15163PRTBos Taurus 15Phe Phe Leu Arg Met Lys Cys Thr Leu Thr Ser
Arg Gly Arg Thr Met 1 5 10 15 Asn Ile Lys Ser Ala Thr Trp Lys Val
Leu His Cys Thr Gly His Ile 20 25 30 His Val Tyr Asp Thr Asn Ser
Asn Gln Ser Gln Cys Gly Tyr Lys Lys 35 40 45 Pro Pro Met Thr Cys
Leu Val Leu Ile Cys Glu Pro Ile Pro His Pro 50 55 60 Ser Asn Ile
Glu Ile Pro Leu Asp Ser Lys Thr Phe Leu Ser Arg His 65 70 75 80 Ser
Leu Asp Met Lys Phe Ser Tyr Cys Asp Glu Arg Ile Thr Glu Leu 85 90
95 Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly Arg Ser Ile Tyr Glu Tyr
100 105 110 Tyr His Ala Leu Asp Ser Asp His Leu Thr Lys Thr His His
Asp Met 115 120 125 Phe Thr Lys Gly Gln Val Thr Thr Gly Gln Tyr Arg
Met Leu Ala Lys 130 135 140 Arg Gly Gly Tyr Val Trp Ile Glu Thr Gln
Ala Thr Val Ile Tyr Asn 145 150 155 160 Thr Lys Asn 16163PRTMus
musculus 16Phe Phe Leu Arg Met Lys Cys Thr Leu Thr Ser Arg Gly Arg
Thr Met 1 5 10 15 Asn Ile Lys Ser Ala Thr Trp Lys Val Leu His Cys
Thr Gly His Ile 20 25 30 His Val Tyr Asp Thr Asn Ser Asn Gln Pro
Gln Cys Gly Tyr Lys Lys 35 40 45 Pro Pro Met Thr Cys Leu Val Leu
Ile Cys Glu Pro Ile Pro His Pro 50 55 60 Ser Asn Ile Glu Ile Pro
Leu Asp Ser Lys Thr Phe Leu Ser Arg His 65 70 75 80 Ser Leu Asp Met
Lys Phe Ser Tyr Cys Asp Glu Arg Ile Thr Glu Leu 85 90 95 Met Gly
Tyr Glu Pro Glu Glu Leu Leu Gly Arg Ser Ile Tyr Glu Tyr 100 105 110
Tyr His Ala Leu Asp Ser Asp His Leu Thr Lys Thr His His Asp Met 115
120 125 Phe Thr Lys Gly Gln Val Thr Thr Gly Gln Tyr Arg Met Leu Ala
Lys 130 135 140 Arg Gly Gly Tyr Val Trp Val Glu Thr Gln Ala Thr Val
Ile Tyr Asn 145 150 155 160 Thr Lys Asn 17163PRTRattus norvegicus
17Phe Phe Leu Arg Met Lys Cys Thr Leu Thr Ser Arg Gly Arg Thr Met 1
5 10 15 Asn Ile Lys Ser Ala Thr Trp Lys Val Leu His Cys Thr Gly His
Ile 20 25 30 His Val Tyr Asp Thr Ser Ser Asn Gln Pro Gln Cys Gly
Tyr Lys Lys 35 40 45 Pro Pro Met Thr Cys Leu Val Leu Ile Cys Glu
Pro Ile Pro His Pro 50 55 60 Ser Asn Ile Glu Ile Pro Leu Asp Ser
Lys Thr Phe Leu Ser Arg His 65 70 75 80 Ser Leu Asp Met Lys Phe Ser
Tyr Cys Asp Glu Arg Ile Thr Glu Leu 85 90 95 Met Gly Tyr Glu Pro
Glu Glu Leu Leu Gly Arg Ser Ile Tyr Glu Tyr 100 105 110 Tyr His Ala
Leu Asp Ser Asp His Leu Thr Lys Thr His His Asp Met 115 120 125 Phe
Thr Lys Gly Gln Val Thr Thr Gly Gln Tyr Arg Met Leu Ala Lys 130 135
140 Arg Gly Gly Tyr Val Trp Val Glu Thr Gln Ala Thr Val Ile Tyr Asn
145 150 155 160 Thr Lys Asn 18163PRTGallus gallus 18Phe Phe Leu Arg
Met Lys Cys Thr Leu Thr Ser Arg Gly Arg Thr Val 1 5 10 15 Asn Ile
Lys Ser Ala Thr Trp Lys Val Leu His Cys Thr Gly His Ile 20 25 30
Arg Val Tyr Asp Thr Cys Asn Asn Gln Thr His Cys Gly Tyr Lys Lys 35
40 45 Pro Pro Met Thr Cys Leu Val Leu Ile Cys Glu Pro Ile Pro His
Pro 50 55 60 Ser Asn Ile Glu Val Pro Leu Asp Ser Lys Thr Phe Leu
Ser Arg His 65 70 75 80 Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp Glu
Arg Ile Thr Glu Leu 85 90 95 Met Gly Tyr Glu Pro Glu Glu Leu Leu
Gly Arg Ser Ile Tyr Glu Tyr 100 105 110 Tyr His Ala Leu Asp Ser Asp
His Leu Thr Lys Thr His His Asp Met 115 120 125 Phe Thr Lys Gly Gln
Val Thr Thr Gly Gln Tyr Arg Met Leu Ala Lys 130 135 140 Gln Gly Gly
Tyr Val Trp Val Glu Thr Gln Ala Thr Val Ile Tyr Asn 145 150 155 160
Thr Lys Asn 19166PRTDanio rerio 19Phe Phe Leu Arg Met Lys Cys Thr
Leu Thr Ser Arg Gly Arg Thr Val 1 5 10 15
Asn Ile Lys Ser Ala Thr Trp Lys Val Leu His Cys Ala Gly His Val 20
25 30 Arg Val His Glu Gly Ser Glu Ala Ser Glu Asp Ser Gly Phe Lys
Glu 35 40 45 Pro Pro Val Thr Tyr Leu Val Leu Ile Cys Glu Pro Ile
Pro His Pro 50 55 60 Ser Asn Ile Glu Val Pro Leu Asp Ser Lys Thr
Phe Leu Ser Arg His 65 70 75 80 Thr Leu Asp Met Lys Phe Ser Tyr Cys
Asp Glu Arg Ile Thr Glu Leu 85 90 95 Met Gly Tyr Glu Pro Asp Asp
Leu Leu Asn Arg Ser Val Tyr Glu Tyr 100 105 110 Tyr His Ala Leu Asp
Ser Asp His Leu Thr Lys Thr His His Asn Leu 115 120 125 Phe Ala Lys
Gly Gln Ala Thr Thr Gly Gln Tyr Arg Met Leu Ala Lys 130 135 140 Lys
Gly Gly Phe Val Trp Val Glu Thr Gln Ala Thr Val Ile Tyr Asn 145 150
155 160 Pro Lys Asn Ser Gln Pro 165 20161PRTCaenorhabditis elegans
20Met Val Leu Arg Met Lys Thr Val Ile Ser Pro Arg Gly Arg Cys Leu 1
5 10 15 Asn Leu Lys Ser Ala Leu Tyr Lys Ser Val Ser Phe Leu Val His
Ser 20 25 30 Lys Val Ser Thr Gly Gly His Val Ser Phe Met Gln Gly
Ile Thr Ile 35 40 45 Pro Ala Gly Gln Gly Thr Thr Asn Ala Asn Ala
Ser Ala Met Thr Lys 50 55 60 Tyr Thr Glu Ser Pro Met Gly Ala Phe
Thr Thr Arg His Thr Cys Asp 65 70 75 80 Met Arg Ile Thr Phe Val Ser
Asp Lys Phe Asn Tyr Ile Leu Lys Ser 85 90 95 Glu Leu Lys Thr Leu
Met Gly Thr Ser Phe Tyr Glu Leu Val His Pro 100 105 110 Ala Asp Met
Met Ile Val Ser Lys Ser Met Lys Glu Leu Phe Ala Lys 115 120 125 Gly
His Ile Arg Thr Pro Tyr Tyr Arg Leu Ile Ala Ala Asn Asp Thr 130 135
140 Leu Ala Trp Ile Gln Thr Glu Ala Thr Thr Ile Thr His Thr Thr Lys
145 150 155 160 Gly 21453PRTHomo sapiens 21Met Asp Phe Phe Arg Val
Val Glu Asn Gln Gln Pro Pro Ala Thr Met 1 5 10 15 Pro Leu Asn Val
Ser Phe Thr Asn Arg Asn Tyr Asp Leu Asp Tyr Asp 20 25 30 Ser Val
Gln Pro Tyr Phe Tyr Cys Asp Glu Glu Glu Asn Phe Tyr Gln 35 40 45
Gln Gln Gln Gln Ser Glu Leu Gln Pro Pro Ala Pro Ser Glu Asp Ile 50
55 60 Trp Lys Lys Phe Glu Leu Leu Pro Thr Pro Pro Leu Ser Pro Ser
Arg 65 70 75 80 Arg Ser Gly Leu Cys Ser Pro Ser Tyr Val Ala Val Thr
Pro Phe Ser 85 90 95 Leu Arg Gly Asp Asn Asp Gly Gly Gly Gly Ser
Phe Ser Thr Ala Asp 100 105 110 Gln Leu Glu Met Val Thr Glu Leu Leu
Gly Gly Asp Met Val Asn Gln 115 120 125 Ser Phe Ile Cys Asp Pro Asp
Asp Glu Thr Phe Ile Lys Asn Ile Ile 130 135 140 Ile Gln Asp Cys Met
Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu Val 145 150 155 160 Ser Glu
Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser Gly Ser 165 170 175
Pro Asn Pro Ala Arg Gly His Ser Val Cys Ser Thr Ser Ser Leu Tyr 180
185 190 Leu Gln Asp Leu Ser Ala Ala Ala Ser Glu Cys Ile Asp Pro Ser
Val 195 200 205 Val Phe Pro Tyr Pro Leu Asn Asp Ser Ser Ser Pro Lys
Ser Cys Ala 210 215 220 Ser Gln Asp Ser Ser Ala Phe Ser Pro Ser Ser
Asp Ser Leu Leu Ser 225 230 235 240 Ser Thr Glu Ser Ser Pro Gln Gly
Ser Pro Glu Pro Leu Val Leu His 245 250 255 Glu Glu Thr Pro Pro Thr
Thr Ser Ser Asp Ser Glu Glu Glu Gln Glu 260 265 270 Asp Glu Glu Glu
Ile Asp Val Val Ser Val Glu Lys Arg Gln Ala Pro 275 280 285 Gly Lys
Arg Ser Glu Ser Gly Ser Pro Ser Ala Gly Gly His Ser Lys 290 295 300
Pro Pro His Ser Pro Leu Val Leu Lys Arg Cys His Val Ser Thr His 305
310 315 320 Gln His Asn Tyr Ala Ala Pro Pro Ser Thr Arg Lys Asp Tyr
Pro Ala 325 330 335 Ala Lys Arg Val Lys Leu Asp Ser Val Arg Val Leu
Arg Gln Ile Ser 340 345 350 Asn Asn Arg Lys Cys Thr Ser Pro Arg Ser
Ser Asp Thr Glu Glu Asn 355 360 365 Val Lys Arg Arg Thr His Asn Val
Leu Glu Arg Gln Arg Arg Asn Glu 370 375 380 Leu Lys Arg Ser Phe Phe
Ala Leu Arg Asp Gln Ile Pro Glu Leu Glu 385 390 395 400 Asn Asn Glu
Lys Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr Ala 405 410 415 Tyr
Ile Leu Ser Val Gln Ala Glu Glu Gln Lys Leu Ile Ser Glu Glu 420 425
430 Asp Leu Leu Arg Lys Arg Arg Glu Gln Leu Lys His Lys Leu Glu Gln
435 440 445 Leu Arg Asn Ser Cys 450 22453PRTPan troglodytes 22Met
Asp Phe Phe Arg Ile Val Glu Asn Gln Gln Pro Pro Ala Thr Met 1 5 10
15 Pro Leu Asn Val Ser Phe Thr Asn Arg Asn Tyr Asp Leu Asp Tyr Asp
20 25 30 Ser Val Gln Pro Tyr Phe Tyr Cys Asp Glu Glu Glu Asn Phe
Tyr Gln 35 40 45 Gln Gln Gln Gln Ser Glu Leu Gln Pro Pro Ala Pro
Ser Glu Asp Ile 50 55 60 Trp Lys Lys Phe Glu Leu Leu Pro Thr Pro
Pro Leu Ser Pro Ser Arg 65 70 75 80 Arg Ser Gly Leu Cys Ser Pro Ser
Tyr Val Ala Val Thr Pro Phe Ser 85 90 95 Leu Arg Gly Asp Asn Asp
Gly Gly Gly Gly Ser Phe Ser Thr Ala Asp 100 105 110 Gln Leu Glu Met
Val Thr Glu Leu Leu Gly Gly Asp Met Val Asn Gln 115 120 125 Ser Phe
Ile Cys Asp Pro Asp Asp Glu Thr Phe Ile Lys Asn Ile Ile 130 135 140
Ile Gln Asp Cys Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu Val 145
150 155 160 Ser Glu Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser
Gly Ser 165 170 175 Pro Asn Pro Ala Arg Gly His Ser Val Cys Ser Thr
Ser Ser Leu Tyr 180 185 190 Leu Gln Asp Leu Ser Ala Ala Ala Ser Glu
Cys Ile Asp Pro Ser Val 195 200 205 Val Phe Pro Tyr Pro Leu Asn Asp
Ser Ser Ser Pro Lys Ser Cys Pro 210 215 220 Ser Gln Asp Ser Ser Ala
Phe Ser Pro Ser Ser Asp Ser Leu Leu Ser 225 230 235 240 Ser Thr Glu
Ser Ser Pro Gln Gly Ser Pro Glu Pro Leu Val Leu His 245 250 255 Glu
Glu Thr Pro Pro Thr Thr Ser Ser Asp Ser Glu Glu Glu Gln Glu 260 265
270 Asp Glu Glu Glu Ile Asp Val Val Ser Val Glu Lys Arg Gln Ala Pro
275 280 285 Gly Lys Arg Ser Glu Ser Gly Ser Pro Ser Ala Gly Gly His
Ser Lys 290 295 300 Pro Pro His Ser Pro Leu Val Leu Lys Arg Cys His
Val Ser Thr His 305 310 315 320 Gln His Asn Tyr Ala Ala Pro Pro Ser
Thr Arg Lys Asp Tyr Pro Ala 325 330 335 Ala Lys Arg Val Lys Leu Asp
Ser Val Arg Val Leu Arg Gln Ile Ser 340 345 350 Asn Asn Arg Lys Cys
Thr Ser Pro Arg Ser Ser Asp Thr Glu Glu Asn 355 360 365 Asp Lys Arg
Arg Thr His Asn Val Leu Glu Arg Gln Arg Arg Asn Glu 370 375 380 Leu
Lys Arg Ser Phe Phe Ala Leu Arg Asp Gln Ile Pro Glu Leu Glu 385 390
395 400 Asn Asn Glu Lys Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr
Ala 405 410 415 Tyr Ile Leu Ser Val Gln Ala Glu Glu Gln Lys Leu Ile
Ser Glu Glu 420 425 430 Asp Leu Leu Arg Lys Arg Arg Glu Gln Leu Lys
His Lys Leu Glu Gln 435 440 445 Leu Arg Asn Ser Cys 450
23438PRTMacaca mulatta 23Met Pro Leu Asn Val Ser Phe Thr Asn Arg
Asn Tyr Asp Leu Asp Tyr 1 5 10 15 Asp Ser Val Gln Pro Tyr Phe Tyr
Cys Asp Glu Glu Glu Asn Phe Tyr 20 25 30 Gln Gln Gln Gln Gln Ser
Glu Leu Gln Pro Pro Ala Pro Ser Glu Asp 35 40 45 Ile Trp Lys Lys
Phe Glu Leu Leu Pro Thr Pro Pro Leu Ser Pro Ser 50 55 60 Arg Arg
Ser Gly Leu Cys Ser Pro Ser Tyr Val Ala Val Thr Pro Phe 65 70 75 80
Ser Pro Arg Gly Asp Asn Asp Gly Gly Gly Gly Ser Phe Ser Thr Ala 85
90 95 Asp Gln Leu Glu Met Val Thr Glu Leu Leu Gly Gly Asp Met Val
Asn 100 105 110 Gln Ser Phe Ile Cys Asp Pro Asp Asp Glu Thr Phe Ile
Lys Asn Ile 115 120 125 Ile Ile Gln Asp Cys Met Trp Ser Gly Phe Ser
Ala Ala Ala Lys Leu 130 135 140 Val Ser Glu Lys Leu Ala Ser Tyr Gln
Ala Ala Arg Lys Asp Ser Gly 145 150 155 160 Ser Pro Asn Pro Ala Arg
Gly His Ser Val Cys Ser Thr Ser Ser Leu 165 170 175 Tyr Leu Gln Asp
Leu Ser Ala Ala Ala Ser Glu Cys Ile Asp Pro Ser 180 185 190 Val Val
Phe Pro Tyr Pro Leu Asn Asp Ser Ser Ser Pro Lys Ser Cys 195 200 205
Ala Ser Pro Asp Ser Ser Ala Phe Ser Pro Ser Ser Asp Ser Leu Leu 210
215 220 Ser Ser Thr Glu Ser Ser Pro Gln Ala Ser Pro Glu Pro Leu Val
Leu 225 230 235 240 His Glu Glu Thr Pro Pro Thr Thr Ser Ser Asp Ser
Glu Glu Glu Gln 245 250 255 Glu Glu Glu Glu Glu Ile Asp Val Val Ser
Val Glu Lys Arg Gln Ala 260 265 270 Pro Gly Lys Arg Ser Glu Ser Gly
Ser Pro Ser Ala Gly Gly His Ser 275 280 285 Lys Pro Pro His Ser Pro
Leu Val Leu Lys Arg Cys His Val Ser Thr 290 295 300 His Gln His Asn
Tyr Ala Ala Pro Pro Ser Thr Arg Lys Asp Tyr Pro 305 310 315 320 Ala
Ala Lys Arg Val Lys Leu Asp Ser Val Arg Val Leu Arg Gln Ile 325 330
335 Ser Asn Asn Arg Lys Cys Thr Ser Pro Arg Ser Ser Asp Thr Glu Glu
340 345 350 Asn Asp Lys Arg Arg Thr His Asn Val Leu Glu Arg Gln Arg
Arg Asn 355 360 365 Glu Leu Lys Arg Ser Phe Phe Ala Leu Arg Asp Gln
Ile Pro Glu Leu 370 375 380 Glu Asn Asn Glu Lys Ala Pro Lys Val Val
Ile Leu Lys Lys Ala Thr 385 390 395 400 Ala Tyr Ile Leu Ser Val Gln
Ala Glu Glu Gln Lys Leu Ile Ser Glu 405 410 415 Lys Asp Leu Leu Arg
Lys Arg Arg Glu Gln Leu Lys His Lys Leu Glu 420 425 430 Gln Leu Arg
Asn Ser Cys 435 24452PRTCanis lupus familiaris 24Met Asp Leu Leu
Arg Arg Val Glu Thr Pro Ala Ala Ala Met Pro Leu 1 5 10 15 Asn Val
Ser Phe Ala Asn Arg Asn Tyr Asp Leu Asp Tyr Asp Ser Val 20 25 30
Gln Pro Tyr Phe Tyr Cys Asp Glu Glu Glu Asn Phe Tyr Gln Gln Gln 35
40 45 Gln Gln Ser Glu Leu Gln Pro Pro Ala Pro Ser Glu Asp Ile Trp
Lys 50 55 60 Lys Phe Glu Leu Leu Pro Thr Pro Pro Leu Ser Pro Ser
Arg Arg Ser 65 70 75 80 Gly Leu Cys Ser Pro Ser Tyr Val Ala Val Ala
Ser Phe Ser Pro Arg 85 90 95 Gly Asp Asp Asp Gly Gly Gly Gly Ser
Phe Ser Thr Ala Asp Gln Leu 100 105 110 Glu Met Val Thr Glu Leu Leu
Gly Gly Asp Met Val Asn Gln Ser Phe 115 120 125 Ile Cys Asp Pro Asp
Asp Glu Thr Phe Ile Lys Asn Ile Ile Ile Gln 130 135 140 Asp Cys Met
Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu Val Ser Glu 145 150 155 160
Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser Gly Ser Pro Ser 165
170 175 Pro Ala Arg Gly Pro Gly Gly Cys Ser Thr Ser Ser Leu Tyr Leu
Gln 180 185 190 Asp Leu Ser Ala Ala Ala Ser Glu Cys Ile Asp Pro Ser
Val Val Phe 195 200 205 Pro Tyr Pro Leu Asn Asp Ser Ser Ser Pro Lys
Pro Cys Ala Ser Pro 210 215 220 Asp Ser Ala Ala Phe Ser Pro Ser Ser
Asp Ser Leu Leu Ser Ser Ala 225 230 235 240 Glu Ser Ser Pro Arg Ala
Ser Pro Glu Pro Leu Ala Leu His Glu Glu 245 250 255 Thr Pro Pro Thr
Thr Ser Ser Asp Ser Glu Glu Glu Gln Glu Asp Glu 260 265 270 Glu Glu
Ile Asp Val Val Ser Val Glu Lys Arg Gln Pro Pro Ala Lys 275 280 285
Arg Ser Glu Ser Gly Ser Pro Ser Ala Gly Gly His Ser Lys Pro Pro 290
295 300 His Ser Pro Leu Val Leu Lys Arg Cys His Val Ser Thr His Gln
His 305 310 315 320 Asn Tyr Ala Ala Pro Pro Ser Thr Arg Lys Asp Tyr
Pro Ala Ala Lys 325 330 335 Arg Ala Arg Leu Asp Ser Gly Arg Val Leu
Lys Gln Ile Ser Asn Asn 340 345 350 Arg Lys Cys Ala Ser Pro Arg Ser
Ser Asp Thr Glu Glu Asn Asp Lys 355 360 365 Arg Arg Thr His Asn Val
Leu Glu Arg Gln Arg Arg Asn Glu Leu Lys 370 375 380 Arg Ser Phe Phe
Ala Leu Arg Asp Gln Ile Pro Glu Leu Glu Asn Asn 385 390 395 400 Glu
Lys Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr Ala Tyr Ile 405 410
415 Leu Ser Val Gln Ala Glu Glu Gln Lys Leu Leu Ser Glu Lys Asp Leu
420 425 430 Leu Arg Lys Arg Arg Glu Gln Leu Lys His Lys Leu Glu Gln
Leu Arg 435 440 445 Asn Ser Gly Ala 450 25439PRTBos taurus 25Met
Pro Leu Asn Val Ser Phe Ala Asn Lys Asn Tyr Asp Leu Asp Tyr 1 5 10
15 Asp Ser Val Gln Pro Tyr Phe Tyr Cys Asp Glu Glu Glu Asn Phe Tyr
20 25 30 His Gln Gln Gln Gln Ser Glu Leu Gln Pro Pro Ala Pro Ser
Glu Asp 35 40 45 Ile Trp Lys Lys Phe Glu Leu Leu Pro Thr Pro Pro
Leu Ser Pro Ser 50 55 60 Arg Arg Ser Gly Leu Cys Ser Pro Ser Tyr
Val Ala Val Ala Ser Phe 65 70 75 80 Ser Pro Arg Gly Asp Asp Asp Gly
Gly Gly Gly Ser Phe Ser Ser Ala 85 90 95 Asp Gln Leu Glu Met Val
Thr Glu Leu Leu Gly Gly Asp Met Val Asn 100 105 110 Gln Ser Phe Ile
Cys Asp Pro Asp Asp Glu Thr Leu Ile Lys Asn Ile 115 120 125 Ile Ile
Gln Asp Cys Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu 130 135 140
Val Ser Glu Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Gly Gly 145
150 155 160 Ser Pro Ser Pro Ala Arg Gly His Gly Gly Cys Ser Thr Ser
Ser Leu 165 170 175 Tyr Leu Gln
Asp Leu Ser Ala Ala Ala Ser Glu Cys Ile Asp Pro Ser 180 185 190 Val
Val Phe Pro Tyr Pro Leu Asn Asp Ser Ser Ser Pro Lys Pro Cys 195 200
205 Ala Ser Pro Asp Ser Thr Ala Phe Ser Pro Ser Ser Asp Ser Leu Leu
210 215 220 Ser Ser Ala Glu Ser Ser Pro Arg Ala Ser Pro Glu Pro Leu
Ala Leu 225 230 235 240 His Glu Glu Thr Pro Pro Thr Thr Ser Ser Asp
Ser Glu Glu Glu Gln 245 250 255 Glu Asp Glu Glu Glu Ile Asp Val Val
Ser Val Glu Lys Arg Gln Pro 260 265 270 Pro Ala Lys Arg Ser Glu Ser
Gly Ser Pro Ser Ala Gly Ser His Ser 275 280 285 Lys Pro Pro His Ser
Pro Leu Val Leu Lys Arg Cys His Val Ser Thr 290 295 300 His Gln His
Asn Tyr Ala Ala Pro Pro Ser Thr Arg Lys Asp Tyr Pro 305 310 315 320
Ala Ala Lys Arg Ala Lys Leu Asp Ser Gly Arg Val Leu Lys Gln Ile 325
330 335 Ser Asn Asn Arg Lys Cys Ala Ser Pro Arg Ser Ser Asp Thr Glu
Glu 340 345 350 Asn Asp Lys Arg Arg Thr His Asn Val Leu Glu Arg Gln
Arg Arg Asn 355 360 365 Glu Leu Lys Arg Ser Phe Phe Ala Leu Arg Asp
Gln Ile Pro Glu Leu 370 375 380 Glu Asn Asn Glu Lys Ala Pro Lys Val
Val Ile Leu Lys Lys Ala Thr 385 390 395 400 Ala Tyr Ile Leu Ser Val
Gln Ala Glu Gln Gln Lys Leu Lys Ser Glu 405 410 415 Ile Asp Val Leu
Gln Lys Arg Arg Glu Gln Leu Lys Leu Lys Leu Glu 420 425 430 Gln Ile
Arg Asn Ser Cys Ala 435 26454PRTMus musculus 26Met Asp Phe Leu Trp
Ala Leu Glu Thr Pro Gln Thr Ala Thr Thr Met 1 5 10 15 Pro Leu Asn
Val Asn Phe Thr Asn Arg Asn Tyr Asp Leu Asp Tyr Asp 20 25 30 Ser
Val Gln Pro Tyr Phe Ile Cys Asp Glu Glu Glu Asn Phe Tyr His 35 40
45 Gln Gln Gln Gln Ser Glu Leu Gln Pro Pro Ala Pro Ser Glu Asp Ile
50 55 60 Trp Lys Lys Phe Glu Leu Leu Pro Thr Pro Pro Leu Ser Pro
Ser Arg 65 70 75 80 Arg Ser Gly Leu Cys Ser Pro Ser Tyr Val Ala Val
Ala Thr Ser Phe 85 90 95 Ser Pro Arg Glu Asp Asp Asp Gly Gly Gly
Gly Asn Phe Ser Thr Ala 100 105 110 Asp Gln Leu Glu Met Met Thr Glu
Leu Leu Gly Gly Asp Met Val Asn 115 120 125 Gln Ser Phe Ile Cys Asp
Pro Asp Asp Glu Thr Phe Ile Lys Asn Ile 130 135 140 Ile Ile Gln Asp
Cys Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu 145 150 155 160 Val
Ser Glu Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser Thr 165 170
175 Ser Leu Ser Pro Ala Arg Gly His Ser Val Cys Ser Thr Ser Ser Leu
180 185 190 Tyr Leu Gln Asp Leu Thr Ala Ala Ala Ser Glu Cys Ile Asp
Pro Ser 195 200 205 Val Val Phe Pro Tyr Pro Leu Asn Asp Ser Ser Ser
Pro Lys Ser Cys 210 215 220 Thr Ser Ser Asp Ser Thr Ala Phe Ser Pro
Ser Ser Asp Ser Leu Leu 225 230 235 240 Ser Ser Glu Ser Ser Pro Arg
Ala Ser Pro Glu Pro Leu Val Leu His 245 250 255 Glu Glu Thr Pro Pro
Thr Thr Ser Ser Asp Ser Glu Glu Glu Gln Glu 260 265 270 Asp Glu Glu
Glu Ile Asp Val Val Ser Val Glu Lys Arg Gln Thr Pro 275 280 285 Ala
Lys Arg Ser Glu Ser Gly Ser Ser Pro Ser Arg Gly His Ser Lys 290 295
300 Pro Pro His Ser Pro Leu Val Leu Lys Arg Cys His Val Ser Thr His
305 310 315 320 Gln His Asn Tyr Ala Ala Pro Pro Ser Thr Arg Lys Asp
Tyr Pro Ala 325 330 335 Ala Lys Arg Ala Lys Leu Asp Ser Gly Arg Val
Leu Lys Gln Ile Ser 340 345 350 Asn Asn Arg Lys Cys Ser Ser Pro Arg
Ser Ser Asp Thr Glu Glu Asn 355 360 365 Asp Lys Arg Arg Thr His Asn
Val Leu Glu Arg Gln Arg Arg Asn Glu 370 375 380 Leu Lys Arg Ser Phe
Phe Ala Leu Arg Asp Gln Ile Pro Glu Leu Glu 385 390 395 400 Asn Asn
Glu Lys Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr Ala 405 410 415
Tyr Ile Leu Ser Ile Gln Ala Asp Glu His Lys Leu Thr Ser Glu Lys 420
425 430 Asp Leu Leu Arg Lys Arg Arg Glu Gln Leu Lys His Lys Leu Glu
Gln 435 440 445 Leu Arg Asn Ser Gly Ala 450 27453PRTRattus
norvegicus 27Met Asn Phe Leu Trp Glu Val Glu Asn Pro Thr Val Thr
Thr Met Pro 1 5 10 15 Leu Asn Val Ser Phe Ala Asn Arg Asn Tyr Asp
Leu Asp Tyr Asp Ser 20 25 30 Val Gln Pro Tyr Phe Ile Cys Asp Glu
Glu Glu Asn Phe Tyr His Gln 35 40 45 Gln Gln Gln Ser Glu Leu Gln
Pro Pro Ala Pro Ser Glu Asp Ile Trp 50 55 60 Lys Lys Phe Glu Leu
Leu Pro Thr Pro Pro Leu Ser Pro Ser Arg Arg 65 70 75 80 Ser Gly Leu
Cys Ser Pro Ser Tyr Val Ala Val Ala Thr Ser Phe Ser 85 90 95 Pro
Arg Glu Asp Asp Asp Gly Gly Gly Gly Asn Phe Ser Thr Ala Asp 100 105
110 Gln Leu Glu Met Met Thr Glu Leu Leu Gly Gly Asp Met Val Asn Gln
115 120 125 Ser Phe Ile Cys Asp Pro Asp Asp Glu Thr Phe Ile Lys Asn
Ile Ile 130 135 140 Ile Gln Asp Cys Met Trp Ser Gly Phe Ser Ala Ala
Ala Lys Leu Val 145 150 155 160 Ser Glu Lys Leu Ala Ser Tyr Gln Ala
Ala Arg Lys Asp Ser Thr Ser 165 170 175 Leu Ser Pro Ala Arg Gly His
Ser Val Cys Ser Thr Ser Ser Leu Tyr 180 185 190 Leu Gln Asp Leu Thr
Ala Ala Ala Ser Glu Cys Ile Asp Pro Ser Val 195 200 205 Val Phe Pro
Tyr Pro Leu Asn Asp Ser Ser Ser Pro Lys Ser Cys Thr 210 215 220 Ser
Ser Asp Ser Thr Ala Phe Ser Ser Ser Ser Asp Ser Leu Leu Ser 225 230
235 240 Ser Glu Ser Ser Pro Arg Ala Thr Pro Glu Pro Leu Val Leu His
Glu 245 250 255 Glu Thr Pro Pro Thr Thr Ser Ser Asp Ser Glu Glu Glu
Gln Asp Asp 260 265 270 Glu Glu Glu Ile Asp Val Val Ser Val Glu Lys
Arg Gln Pro Pro Ala 275 280 285 Lys Arg Ser Glu Ser Gly Ser Ser Pro
Ser Arg Gly His Ser Lys Pro 290 295 300 Pro His Ser Pro Leu Val Leu
Lys Arg Cys His Val Ser Thr His Gln 305 310 315 320 His Asn Tyr Ala
Ala Pro Pro Ser Thr Arg Lys Asp Tyr Pro Ala Ala 325 330 335 Lys Arg
Ala Lys Leu Asp Ser Gly Arg Val Leu Lys Gln Ile Ser Asn 340 345 350
Asn Arg Lys Cys Ser Ser Pro Arg Ser Ser Asp Thr Glu Glu Asn Asp 355
360 365 Lys Arg Arg Thr His Asn Val Leu Glu Arg Gln Arg Arg Asn Glu
Leu 370 375 380 Lys Arg Ser Phe Phe Ala Leu Arg Asp Gln Ile Pro Glu
Leu Glu Asn 385 390 395 400 Asn Glu Lys Ala Pro Lys Val Val Ile Leu
Lys Lys Ala Thr Ala Tyr 405 410 415 Ile Leu Ser Val Gln Ala Asp Glu
His Lys Leu Ile Ser Glu Lys Asp 420 425 430 Leu Leu Arg Lys Arg Arg
Glu Gln Leu Lys His Lys Leu Glu Gln Leu 435 440 445 Arg Asn Ser Gly
Ala 450 28416PRTGallus gallus 28Met Pro Leu Ser Ala Ser Leu Pro Ser
Lys Asn Tyr Asp Tyr Asp Tyr 1 5 10 15 Asp Ser Val Gln Pro Tyr Phe
Tyr Phe Glu Glu Glu Glu Glu Asn Phe 20 25 30 Tyr Leu Ala Ala Gln
Gln Arg Gly Ser Glu Leu Gln Pro Pro Ala Pro 35 40 45 Ser Glu Asp
Ile Trp Lys Lys Phe Glu Leu Leu Pro Thr Pro Pro Leu 50 55 60 Ser
Pro Ser Arg Arg Ser Ser Leu Ala Ala Ala Ser Cys Phe Pro Ser 65 70
75 80 Thr Ala Asp Gln Leu Glu Met Val Thr Glu Leu Leu Gly Gly Asp
Met 85 90 95 Val Asn Gln Ser Phe Ile Cys Asp Pro Asp Asp Glu Ser
Phe Val Lys 100 105 110 Ser Ile Ile Ile Gln Asp Cys Met Trp Ser Gly
Phe Ser Ala Ala Ala 115 120 125 Lys Leu Glu Lys Val Val Ser Glu Lys
Leu Ala Thr Tyr Gln Ala Ser 130 135 140 Arg Arg Glu Gly Gly Pro Ala
Ala Ala Ser Arg Pro Gly Pro Pro Pro 145 150 155 160 Ser Gly Pro Pro
Pro Pro Pro Ala Gly Pro Ala Ala Ser Ala Gly Leu 165 170 175 Tyr Leu
His Asp Leu Gly Ala Ala Ala Ala Asp Cys Ile Asp Pro Ser 180 185 190
Val Val Phe Pro Tyr Pro Leu Ser Glu Arg Ala Pro Arg Ala Ala Pro 195
200 205 Pro Gly Ala Asn Pro Ala Ala Leu Leu Gly Val Asp Thr Pro Pro
Thr 210 215 220 Thr Ser Ser Asp Ser Glu Glu Glu Gln Glu Glu Asp Glu
Glu Ile Asp 225 230 235 240 Val Val Thr Leu Ala Glu Ala Asn Glu Ser
Glu Ser Ser Thr Glu Ser 245 250 255 Ser Thr Glu Ala Ser Glu Glu His
Cys Lys Pro His His Ser Pro Leu 260 265 270 Val Leu Lys Arg Cys His
Val Asn Ile His Gln His Asn Tyr Ala Ala 275 280 285 Pro Pro Ser Thr
Lys Val Glu Tyr Pro Ala Ala Lys Arg Leu Lys Leu 290 295 300 Asp Ser
Gly Arg Val Leu Lys Gln Ile Ser Asn Asn Arg Lys Cys Ser 305 310 315
320 Ser Pro Arg Thr Ser Asp Ser Glu Glu Asn Asp Lys Arg Arg Thr His
325 330 335 Asn Val Leu Glu Arg Gln Arg Arg Asn Glu Leu Lys Leu Ser
Phe Phe 340 345 350 Ala Leu Arg Asp Gln Ile Pro Glu Val Ala Asn Asn
Glu Lys Ala Pro 355 360 365 Lys Val Val Ile Leu Lys Lys Ala Thr Glu
Tyr Val Leu Ser Ile Gln 370 375 380 Ser Asp Glu His Arg Leu Ile Ala
Glu Lys Glu Gln Leu Arg Arg Arg 385 390 395 400 Arg Glu Gln Leu Lys
His Lys Leu Glu Gln Leu Arg Asn Ser Arg Ala 405 410 415
29419PRTDanio rerio 29Met Glu Arg His Ser Leu Asn Thr Ser Val Lys
Met Pro Val Ser Ala 1 5 10 15 Ser Leu Ala Cys Lys Asn Tyr Asp Tyr
Asp Tyr Asp Ser Ile Gln Pro 20 25 30 Tyr Phe Tyr Phe Asp Asn Asp
Asp Glu Asp Phe Tyr His His Gln Gln 35 40 45 Gly Gln Thr Gln Pro
Ser Ala Pro Ser Glu Asp Ile Trp Lys Lys Phe 50 55 60 Glu Leu Leu
Pro Thr Pro Pro Leu Ser Pro Ser Arg Arg Gln Ser Leu 65 70 75 80 Ser
Thr Ala Glu Gln Leu Glu Met Val Ser Glu Phe Leu Gly Asp Asp 85 90
95 Val Val Ser Gln Ser Phe Ile Cys Asp Asp Ala Asp Tyr Ser Gln Ser
100 105 110 Phe Ile Lys Ser Ile Ile Ile Gln Asp Cys Met Trp Ser Gly
Phe Ser 115 120 125 Ala Ala Ala Lys Leu Glu Lys Val Val Ser Glu Arg
Leu Ala Ser Leu 130 135 140 His Ala Glu Arg Lys Glu Leu Met Ser Asp
Ser Asn Ser Asn Arg Leu 145 150 155 160 Asn Ala Ser Tyr Leu Gln Asp
Leu Ser Thr Ser Ala Ser Glu Cys Ile 165 170 175 Asp Pro Ser Val Val
Phe Pro Tyr Pro Leu Thr Glu Cys Gly Lys Ala 180 185 190 Gly Lys Val
Ala Ser Pro Gln Pro Met Leu Val Leu Asp Thr Pro Pro 195 200 205 Asn
Ser Ser Ser Ser Ser Gly Ser Asp Ser Glu Asp Glu Glu Glu Glu 210 215
220 Asp Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu
225 230 235 240 Glu Glu Glu Ile Asp Val Val Thr Val Glu Lys Arg Gln
Lys Arg His 245 250 255 Glu Thr Asp Ala Ser Glu Ser Arg Tyr Pro Ser
Pro Leu Val Leu Lys 260 265 270 Arg Cys His Val Ser Thr His Gln His
Asn Tyr Ala Ala His Pro Ser 275 280 285 Thr Arg His Asp Gln Pro Ala
Val Lys Arg Leu Arg Leu Glu Ala Ser 290 295 300 Asn Asn His Ser Ile
Asn Ser Ser Ser Ser Asn Arg His Val Lys Gln 305 310 315 320 Arg Lys
Cys Ala Ser Pro Arg Thr Ser Asp Ser Glu Asp Asn Asp Lys 325 330 335
Arg Arg Thr His Asn Val Leu Glu Arg Gln Arg Arg Asn Glu Leu Lys 340
345 350 Leu Ser Phe Phe Ala Leu Arg Asp Glu Ile Pro Glu Val Ala Asn
Asn 355 360 365 Glu Lys Ala Ala Lys Val Val Ile Leu Lys Lys Ala Thr
Glu Cys Ile 370 375 380 His Ser Met Gln Leu Asp Glu Gln Arg Leu Leu
Ser Ile Lys Glu Gln 385 390 395 400 Leu Arg Arg Lys Ser Glu Gln Leu
Lys His Arg Leu Gln Gln Leu Arg 405 410 415 Ser Ser His
30396PRTDanio rerio 30Met Pro Leu Asn Ser Ser Met Glu Cys Lys Asn
Tyr Asp Tyr Asp Tyr 1 5 10 15 Asp Ser Tyr Gln Pro Tyr Phe Tyr Phe
Asp Asn Glu Asp Glu Asp Phe 20 25 30 Tyr Asn His Gln His Gly Gln
Pro Pro Ala Pro Ser Glu Asp Ile Trp 35 40 45 Lys Lys Phe Glu Leu
Leu Pro Thr Pro Pro Leu Ser Pro Ser Arg Arg 50 55 60 Pro Ser Leu
Ser Asp Pro Phe Pro Ser Thr Ala Asp Lys Leu Glu Met 65 70 75 80 Val
Ser Glu Phe Leu Gly Asp Asp Val Val Asn His Ser Ile Ile Cys 85 90
95 Asp Ala Asp Tyr Ser Gln Ser Phe Leu Lys Ser Ile Ile Ile Gln Asp
100 105 110 Cys Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu Glu Lys
Val Val 115 120 125 Ser Glu Arg Leu Ala Ser Leu Gln Ala Ala Arg Lys
Glu Ser Ser Arg 130 135 140 Thr Glu Ser Ala Asp Ile Cys Arg Ser Val
Gly Phe Leu Gln Asp Met 145 150 155 160 Ser Thr Pro Ala Ser Gln Cys
Ile Asp Pro Ser Val Val Phe Pro Phe 165 170 175 Pro Leu Thr Asp Ser
Thr Lys Pro Cys Lys Pro Ala Pro Thr Pro Ala 180 185 190 Ser Thr Thr
Leu Pro Leu Asp Thr Pro Pro Asn Ser Gly Ser Ser Ser 195 200 205 Ser
Ser Ser Asp Ser Glu Ser Asp Asp Glu Asp Asp Glu Asp Glu Glu 210 215
220 Glu Glu Glu Glu Ile Asp Val Val Thr Val Glu Lys Arg Lys Ser Val
225 230 235 240 Lys Lys Ser Asp Ala Asn Ala Thr His Gln Ser Pro Val
Val Leu Lys 245 250 255 Arg Cys His Val Asn Ile His Gln His Asn Tyr
Ala Ala His Pro Ser 260 265 270 Thr Arg Asn Glu Gln Pro Ala Val Lys
Arg Ile Lys Phe Glu Ser His 275 280 285 Ile Arg Val Phe Lys Gln
Ile
Ser His Asn Arg Lys Cys Ala Ser Pro 290 295 300 Arg Thr Ser Asp Ser
Glu Asp Asn Asp Lys Arg Arg Thr His Asn Val 305 310 315 320 Leu Glu
Arg Gln Arg Arg Asn Glu Leu Lys Leu Ser Phe Phe Ala Leu 325 330 335
Arg Asp Val Ile Pro Asp Val Ala Asn Asn Glu Lys Ala Ala Lys Val 340
345 350 Val Ile Leu Lys Lys Ala Thr Glu Cys Ile Ala Ser Met Gln Glu
Asp 355 360 365 Glu Gln Arg Leu Ile Ser Leu Lys Glu Gln Leu Arg Arg
Lys Cys Glu 370 375 380 His Leu Lys Gln Arg Leu Glu Gln Leu Ser Cys
Ser 385 390 395 3126DNAArtificial SequenceSynthetic oligonucleotide
31gccagcctga cccatagcca taatat 263225DNAArtificial
SequenceSynthetic oligonucleotide 32gagagatttt atgggtgtaa tgcgg
253321DNAArtificial SequenceSynthetic oligonucleotide 33caccaaaccc
acagaaaaca g 213424DNAArtificial SequenceSynthetic oligonucleotide
34gggtcagagg aagagataaa gttg 243519DNAArtificial SequenceSynthetic
oligonucleotide 35aatgtccgca gtgatgtcc 193620DNAArtificial
SequenceSynthetic oligonucleotide 36gcctgagttt gtgtttgctg
203721DNAArtificial SequenceSynthetic oligonucleotide 37tgaagttcgc
attttgatgg c 213821DNAArtificial SequenceSynthetic oligonucleotide
38ctttggtcct ggcatctcta c 213922DNAArtificial SequenceSynthetic
oligonucleotide 39cacccagatg caaaactttc ag 224023DNAArtificial
SequenceSynthetic oligonucleotide 40ctgctcttta tacttgctca cag
234121DNAArtificial SequenceSynthetic oligonucleotide 41atagagccca
agatcaagca g 214219DNAArtificial SequenceSynthetic oligonucleotide
42tgtaacagcc ttccagtgc 194318DNAArtificial SequenceSynthetic
oligonucleotide 43accaaaaccc atcccgtc 184421DNAArtificial
SequenceSynthetic oligonucleotide 44tctgtaaggg ctccaaatgt g
214522DNAArtificial SequenceSynthetic oligonucleotide 45gttcataggg
tcagaggtca ag 224621DNAArtificial SequenceSynthetic oligonucleotide
46tccattaaga tgtcctgtgc g 214719DNAArtificial SequenceSynthetic
oligonucleotide 47accccttctc tgtctaccg 194821DNAArtificial
SequenceSynthetic oligonucleotide 48aatgctcgct tctccttgta g
214919DNAArtificial SequenceSynthetic oligonucleotide 49atcaaggcac
tgtccaagg 195020DNAArtificial SequenceSynthetic oligonucleotide
50tcattttcct gcatctcccg 205120DNAArtificial SequenceSynthetic
oligonucleotide 51accctaatct agtcccgtcc 205220DNAArtificial
SequenceSynthetic oligonucleotide 52cagccaaaac cagatgacag
205320DNAArtificial SequenceSynthetic oligonucleotide 53cattggtgat
ggtattgcgc 205419DNAArtificial SequenceSynthetic oligonucleotide
54tcccaaacac gacaactcc 195522DNAArtificial SequenceSynthetic
oligonucleotide 55ggaccgagtt ctgtatgtct tg 225622DNAArtificial
SequenceSynthetic oligonucleotide 56aaacccaaat tcgtcttcca tg
225720DNAArtificial SequenceSynthetic oligonucleotide 57cttgaatccc
tgctctgtgg 205820DNAArtificial SequenceSynthetic oligonucleotide
58aaagctgaga gtgccaagag 205920DNAArtificial SequenceSynthetic
oligonucleotide 59ttccagtgca gatgtccaag 206021DNAArtificial
SequenceSynthetic oligonucleotide 60ctgttgaagg acggtagaag g
216119DNAArtificial SequenceSynthetic oligonucleotide 61gttcgttgcc
taccctcac 196224DNAArtificial SequenceSynthetic oligonucleotide
62tctctttact catcttcata gccg 246322DNAArtificial SequenceSynthetic
oligonucleotide 63ccgtgagggc aatgatttat ac 226421DNAArtificial
SequenceSynthetic oligonucleotide 64gtcaaaccag tcagagctac c
216520DNAArtificial SequenceSynthetic oligonucleotide 65tgcacctacc
ctatcactca 206623DNAArtificial SequenceSynthetic oligonucleotide
66ggctcatcct gatcatagaa tgg 236720DNAArtificial SequenceSynthetic
oligonucleotide 67cccaccccat attaaacccg 206825DNAArtificial
SequenceSynthetic oligonucleotide 68gaggtatgaa ggaaaggtat aaggg
256921DNAArtificial SequenceSynthetic oligonucleotide 69cccagatata
gcattcccac g 217020DNAArtificial SequenceSynthetic oligonucleotide
70actgttcatc ctgttcctgc 207120DNAArtificial SequenceSynthetic
oligonucleotide 71tcccaatcgt tgtagccatc 207221DNAArtificial
SequenceSynthetic oligonucleotide 72tgttggaaag aatggagtcg g
217330DNAArtificial SequenceSynthetic oligonucleotide 73atactagcaa
ttacttctat tttcataggg 307421DNAArtificial SequenceSynthetic
oligonucleotide 74gagggatggg ttgtaaggaa g 217522DNAArtificial
SequenceSynthetic oligonucleotide 75aagcaaatcc atatgaatgc gg
227623DNAArtificial SequenceSynthetic oligonucleotide 76gctcatggta
gtggaagtag aag 237722DNAArtificial SequenceSynthetic
oligonucleotide 77catcactcct attctgccta gc 227822DNAArtificial
SequenceSynthetic oligonucleotide 78ccaactccat aagctccata cc
227922DNAArtificial SequenceSynthetic oligonucleotide 79ccaactccat
aagctccata cc 228023DNAArtificial SequenceSynthetic oligonucleotide
80gattttggac gtaatctgtt ccg 238120DNAArtificial SequenceSynthetic
oligonucleotide 81acgaaaatga cccagacctc 208224DNAArtificial
SequenceSynthetic oligonucleotide 82gagatgacaa atcctgcaaa gatg
248323DNAArtificial SequenceSynthetic oligonucleotide 83tgttggagtt
atgttggaag gag 238422DNAArtificial SequenceSynthetic
oligonucleotide 84caaagatcac ccagctacta cc 228522DNAArtificial
SequenceSynthetic oligonucleotide 85agttgataac cgagtcgttc tg
228621DNAArtificial SequenceSynthetic oligonucleotide 86ctgttgcttg
atttagtcgg c 218720DNAArtificial SequenceSynthetic oligonucleotide
87cgtgaaggaa cctaccaagg 208820DNAArtificial SequenceSynthetic
oligonucleotide 88cgctcagaag aatcctgcaa 208924DNAArtificial
SequenceSynthetic oligonucleotide 89gccacaacta gatacatcaa catg
249024DNAArtificial SequenceSynthetic oligonucleotide 90tggttgttag
tgattttggt gaag 249121DNAArtificial SequenceSynthetic
oligonucleotide 91gaacatcaag tcagcaacgt g 219220DNAArtificial
SequenceSynthetic oligonucleotide 92tttgacggat gaggaatggg
209320DNAArtificial SequenceSynthetic oligonucleotide 93cgagaatggc
tgtggatgag 209421DNAArtificial SequenceSynthetic oligonucleotide
94ggatggtgtt ggacagtgta g 219522DNAArtificial SequenceSynthetic
oligonucleotide 95gctccccaga acaagattac ag 229620DNAArtificial
SequenceSynthetic oligonucleotide 96tcgcccttga gtttgtcttc
209720DNAArtificial SequenceSynthetic oligonucleotide 97tcaaagagaa
caagggcgag 209820DNAArtificial SequenceSynthetic oligonucleotide
98aggaagcgga catcacaatc 209920DNAArtificial SequenceSynthetic
oligonucleotide 99tgcagcccaa ggatctctct 2010017DNAArtificial
SequenceSynthetic oligonucleotide 100cggcttgccc gagatct
1710121DNAArtificial SequenceSynthetic oligonucleotide
101ccattctcta ccgtcctgtt g 2110220DNAArtificial SequenceSynthetic
oligonucleotide 102tccatgtaag cgttgtccag 2010321DNAArtificial
SequenceSynthetic oligonucleotide 103ggcagcttga gttaaacgaa c
2110421DNAArtificial SequenceSynthetic oligonucleotide
104tggtgacatg gttaatcggt c 2110521DNAArtificial SequenceSynthetic
oligonucleotide 105gactgtgaag atgagtgacc g 2110620DNAArtificial
SequenceSynthetic oligonucleotide 106caatccgtaa ccaaacccag
2010721DNAArtificial SequenceSynthetic oligonucleotide
107aacctccgct ttcatgtaga g 2110823DNAArtificial SequenceSynthetic
oligonucleotide 108gacatctcct agtttggaca gtg 2310919DNAArtificial
SequenceSynthetic oligonucleotide 109gatggctttg agggtctgg
1911022DNAArtificial SequenceSynthetic oligonucleotide
110cttggttatg ttggcactga tc 2211122DNAArtificial SequenceSynthetic
oligonucleotide 111tgtgttaggg gactggtgga ca 2211222DNAArtificial
SequenceSynthetic oligonucleotide 112catcacccac ttacccccaa aa
2211322DNAArtificial SequenceSynthetic oligonucleotide
113ataaccgagt cgttctgcca at 2211422DNAArtificial SequenceSynthetic
oligonucleotide 114tttcagagca ttggccatag aa 22
* * * * *