U.S. patent application number 16/043639 was filed with the patent office on 2018-11-15 for methods of controlling cell fate and consequences for disease.
This patent application is currently assigned to THE GENERAL HOSPITAL CORPORATION. The applicant listed for this patent is THE GENERAL HOSPITAL CORPORATION. Invention is credited to Sihem CHELOUFI, Konrad HOCHEDLINGER.
Application Number | 20180327745 16/043639 |
Document ID | / |
Family ID | 55400812 |
Filed Date | 2018-11-15 |
United States Patent
Application |
20180327745 |
Kind Code |
A1 |
HOCHEDLINGER; Konrad ; et
al. |
November 15, 2018 |
METHODS OF CONTROLLING CELL FATE AND CONSEQUENCES FOR DISEASE
Abstract
Provided herein are methods for performing cellular
reprogramming that include treatment of somatic cells with an
inhibitor of CAF-1, Sumo2, Nutd21, or combinations thereof prior to
or during a reprogramming procedure. Such inhibitors can improve
both the speed and efficiency of cellular reprogramming. Inhibitors
of the CAF-1 complex can also be used in the treatment of
cancer.
Inventors: |
HOCHEDLINGER; Konrad;
(Boston, MA) ; CHELOUFI; Sihem; (Boston,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE GENERAL HOSPITAL CORPORATION |
Boston |
MA |
US |
|
|
Assignee: |
THE GENERAL HOSPITAL
CORPORATION
Boston
MA
|
Family ID: |
55400812 |
Appl. No.: |
16/043639 |
Filed: |
July 24, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15443632 |
Feb 27, 2017 |
10059945 |
|
|
16043639 |
|
|
|
|
PCT/US2015/046903 |
Aug 26, 2015 |
|
|
|
15443632 |
|
|
|
|
62041960 |
Aug 26, 2014 |
|
|
|
62041968 |
Aug 26, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/14 20130101;
C12N 2501/60 20130101; C12N 2501/604 20130101; C12N 2501/606
20130101; C12N 2330/31 20130101; C12N 2501/998 20130101; C12N
5/0696 20130101; C12N 2310/14 20130101; C12N 2310/141 20130101;
C12N 15/113 20130101; C12N 2310/531 20130101; C12N 2320/12
20130101; C12N 2501/602 20130101; C12N 2506/1307 20130101; C12N
2506/30 20130101; C12N 2310/531 20130101; C12N 2501/603
20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; C12N 5/074 20060101 C12N005/074 |
Claims
1. A method of inducing differentiation of a cancer cell or cancer
stem cell in vivo, the method comprising: administering an
inhibitor of the CAF-1 complex to a subject having, or suspected of
having cancer, thereby inducing differentiation of the cancer cell
or cancer stem cell in vivo.
2. The method of claim 1, wherein the cancer comprises
leukemia.
3. The method of claim 1, wherein the inhibitor comprises an RNA
interference molecule or an antibody.
4. The method of claim 3, wherein the RNA interference molecule
comprises an siRNA or an shRNA.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This Application is a Divisional of U.S. patent application
Ser. No. 15/443,632 filed Feb. 27, 2017, which claims benefit under
35 U.S.C. .sctn. 120 and is a Continuation of International PCT
Application No. PCT/US2015/046903 filed Aug. 26, 2015, which claims
benefit under 35 U.S.C. .sctn. 119(e) of the U.S. Provisional
Application No. 62/041,960 filed Aug. 26, 2014, and U.S.
Provisional Application No. 62/041,968 filed Aug. 26, 2014, the
contents of which are incorporated herein by reference in their
entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in it entirety. Said ASCII copy, created
on Sep. 22, 2015, is name 030258-085430-PCT_SL.txt and is 5,639
bytes in size.
FIELD OF THE INVENTION
[0003] The field of the invention relates to methods and
compositions for enhancing cellular reprogramming and for modifying
cell fate for the treatment of disease.
BACKGROUND
[0004] Mammalian development is a unidirectional process that
depends on the proper establishment and maintenance of
lineage-specific transcriptional programs to generate a multitude
of differentiated cell types (1-3). Genome-wide analyses of gene
expression, chromatin structure and associated modifications during
distinct stages of development and across different somatic cell
types support the notion that cell identity is maintained by stable
and conserved chromatin pathways (4). However, the regulators and
mechanisms responsible for preserving these cellular states remain
poorly understood.
[0005] Ectopic expression of transcription factors is sufficient to
override stable epigenetic programs and hence alter cell fate (5).
For example, forced expression of pluripotency-related
transcription factors in somatic cells yields induced pluripotent
stem cells (iPSCs), which are transcriptionally, epigenomically,
and functionally equivalent to embryonic stem cells (ESCs) (6).
Similarly, forced expression of lineage-specific transcription
factors drives conversion of heterologous cells into cardiac,
neuronal, myeloid and other specialized cell types (7).
Reprogramming transcription factors such as Oct4 and Sox2 are
thought to act as "pioneer factors", which bind to nucleosomal DNA
and gradually remodel local chromatin structure to activate target
genes (8). However, the reprogramming process is generally slow and
inefficient, coinciding with multiple rounds of cell division and
recruitment of additional cofactors.
SUMMARY
[0006] The methods and treatments described herein are based, in
part, on the discovery that inhibitors of the CAF-1 complex,
inhibitors of Sumo2, and inhibitors of Nutd21 can be used in a
cellular reprogramming protocol, and surprisingly can increase the
speed and/or efficiency of cellular reprogramming of somatic cells
to induced pluripotent stem cells (iPSCs).
[0007] Accordingly, provided herein in one aspect is a method for
performing cellular reprogramming, the method comprising: (a)
contacting a somatic cell with an inhibitor of the CAF-1 complex,
Nudt21, or Sumo2, and (b) subjecting the somatic cell to a
reprogramming protocol, thereby reprogramming the somatic cell to
an induced pluripotent stem cell (iPSC).
[0008] In one embodiment of this aspect and all other aspects
described herein, the speed and/or efficiency of cellular
reprogramming to iPSCs is increased in the presence of the
inhibitor as compared to the speed and/or efficiency of cellular
reprogramming performed in the absence of the inhibitor.
[0009] In another embodiment of this aspect and all other aspects
described herein, the measure of efficiency of cellular
reprogramming comprises an increase in the total number of
reprogrammed cells relative to reprogramming in the absence of a
said inhibitor.
[0010] In another embodiment of this aspect and all other aspects
described herein, the measure of speed of cellular reprogramming
comprises the appearance of reprogrammed cells at an earlier time
point than occurs when reprogramming in the absence of said
inhibitor.
[0011] In another embodiment of this aspect and all other aspects
described herein, the inhibitor comprises an RNA interference
molecule or an antibody.
[0012] In another embodiment of this aspect and all other aspects
described herein, the RNA interference molecule comprises an siRNA
or an shRNA.
[0013] In another embodiment of this aspect and all other aspects
described herein, step (a) is performed before or during step
(b).
[0014] In another embodiment of this aspect and all other aspects
described herein, the reprogramming of step (b) comprises induction
of Oct-4/Klf4/Sox-2/c-Myc (OKSM) expression.
[0015] In another embodiment of this aspect and all other aspects
described herein, the reprogramming step does not comprise forced
expression of c-Myc.
[0016] In another embodiment of this aspect and all other aspects
described herein, the somatic cell comprises a fibroblast.
[0017] In another embodiment of this aspect and all other aspects
described herein, the inhibitor of the CAF-1 complex inhibits the
Chaf1a and/or Chaf1b subunit of said complex.
[0018] Another aspect provided herein relates to a method of
inducing differentiation of a cancer cell or cancer stem cell in
vivo, the method comprising: administering an inhibitor of the
CAF-1 complex to a subject having, or suspected of having cancer,
thereby inducing differentiation of the cancer cell or cancer stem
cell in vivo.
[0019] In one embodiment of this aspect and all other aspects
provided herein, the cancer comprises leukemia.
[0020] In another embodiment of this aspect and all other aspects
described herein, the inhibitor comprises an RNA interference
molecule or an antibody.
[0021] In another embodiment of this aspect and all other aspects
described herein, the RNA interference molecule comprises an siRNA
or an shRNA.
[0022] In another embodiment of this aspect and all other aspects
described herein, the inhibitor inhibits the Chaf1a and/or Chaf1b
subunit of the CAF-1 complex.
[0023] Also provided herein in another aspect is a composition
comprising: one or more inhibitors of the CAF-1 complex, Nudt21, or
Sumo2 and a pharmaceutically acceptable carrier.
[0024] In one embodiment of this aspect and all other aspects
described herein, the composition comprises inhibitors or any two
or all of the CAF-1 complex, Nudt21 and Sumo2.
[0025] Another aspect provided herein relates to a composition for
use in cellular reprogramming, the composition comprising an
inhibitor of the CAF-1 complex, Nudt21, or Sumo2.
[0026] In one embodiment of this aspect and all other aspects
provided herein, the composition further comprises a
pharmaceutically acceptable carrier.
[0027] In another embodiment of this aspect and all other aspects
described herein, the inhibitor increases the total number of
reprogrammed cells relative to reprogramming in the absence of the
inhibitor.
[0028] In another embodiment of this aspect and all other aspects
described herein, the inhibitor promotes the appearance of
reprogrammed cells at an earlier time point than occurs when cells
are reprogrammed in the absence of the inhibitor.
[0029] In another embodiment of this aspect and all other aspects
described herein, the inhibitor comprises an RNA interference
molecule or an antibody.
[0030] In another embodiment of this aspect and all other aspects
described herein, the RNA interference molecule comprises an siRNA
or an shRNA.
[0031] In another embodiment of this aspect and all other aspects
described herein, cellular reprogramming comprises induction of
Oct-4/Klf4/Sox-2/c-Myc (OKSM) expression.
[0032] In another embodiment of this aspect and all other aspects
described herein, cellular reprogramming does not comprise forced
expression of c-Myc.
[0033] In another embodiment of this aspect and all other aspects
described herein, cellular reprogramming comprises reprogramming of
a fibroblast.
[0034] In another embodiment of this aspect and all other aspects
described herein, the inhibitor of the CAF-1 complex inhibits the
Chaf1a and/or Chaf1b subunit of the complex.
[0035] Another aspect provided herein relates to the use of an
inhibitor of the CAF-1 complex, Nudt21, or Sumo2 for cellular
reprogramming.
[0036] In one embodiment of this aspect and all other aspects
described herein, the inhibitor increases the speed and/or
efficiency of cellular reprogramming.
[0037] In another embodiment of this aspect and all other aspects
described herein, the inhibitor comprises an RNA interference
molecule or an antibody.
[0038] In another embodiment of this aspect and all other aspects
described herein, the RNA interference molecule comprises an siRNA
or an shRNA.
[0039] In another embodiment of this aspect and all other aspects
described herein, cellular reprogramming comprises induction of
Oct-4/Klf4/Sox-2/c-Myc (OKSM) expression.
[0040] In another embodiment of this aspect and all other aspects
described herein, the cellular reprogramming does not comprise
forced expression of c-Myc.
[0041] In another embodiment of this aspect and all other aspects
described herein, cellular reprogramming comprises reprogramming of
a fibroblast.
[0042] In another embodiment of this aspect and all other aspects
described herein, the inhibitor of the CAF-1 complex inhibits the
Chaf1a and/or Chaf1b subunit of the complex.
[0043] Another aspect provided herein relates to a composition for
use in the treatment of cancer, the composition comprising an
inhibitor of the CAF-1 complex.
[0044] In one embodiment of this aspect and all other aspects
provided herein, the composition induces the differentiation of a
cancer cell or cancer stem cell in vivo when administered to an
individual having cancer.
[0045] In another embodiment of this aspect and all other aspects
described herein, the composition further comprises a
pharmaceutically acceptable carrier.
[0046] In another embodiment of this aspect and all other aspects
described herein, the inhibitor comprises an RNA interference
molecule or an antibody.
[0047] In another embodiment of this aspect and all other aspects
described herein, the RNA interference molecule comprises an siRNA
or an shRNA.
[0048] In another embodiment of this aspect and all other aspects
described herein, the cancer comprises a leukemia.
[0049] In another embodiment of this aspect and all other aspects
described herein, the inhibitor inhibits the Chaf1a and/or Chaf1b
subunit of the CAF-1 complex.
[0050] Also provided herein in another aspect is the use of an
inhibitor of the CAF-1 complex for the treatment of cancer, the use
comprising administering said inhibitor of the CAF-1 complex to an
individual having cancer.
[0051] In one embodiment of this aspect and all other aspects
provided herein, the administering induces the differentiation of a
cancer cell or cancer stem cell, thereby treating said cancer.
[0052] In another embodiment of this aspect and all other aspects
described herein, the inhibitor comprises an RNA interference
molecule or an antibody.
[0053] In another embodiment of this aspect and all other aspects
described herein, the RNA interference molecule comprises an siRNA
or an shRNA.
[0054] In another embodiment of this aspect and all other aspects
described herein, the cancer comprises a leukemia.
[0055] In another embodiment of this aspect and all other aspects
described herein, the inhibitor inhibits the Chaf1a and/or Chaf1b
subunit of the CAF-1 complex.
[0056] Also provided herein, in another aspect, is a method for
performing cellular transdifferentiation, the method comprising:
(a) contacting a somatic cell with an inhibitor of the CAF-1
complex, and (b) subjecting the somatic cell to a
transdifferentiation protocol, thereby transdifferentiating the
somatic cell to a different cell type.
[0057] In one embodiment of this aspect and all other aspects
provided herein, the speed and/or efficiency of cellular
transdifferentiation is increased in the presence of the inhibitor
as compared to the speed and/or efficiency of cellular
reprogramming performed in the absence of the inhibitor.
[0058] In another embodiment of this aspect and all other aspects
provided herein, the measure of efficiency of cellular
transdifferentiation comprises an increase in the total number of
transdifferentiated cells relative to transdifferentiation in the
absence of a said inhibitor.
[0059] In another embodiment of this aspect and all other aspects
provided herein, the measure of speed of cellular
transdifferentiation comprises the appearance of
transdifferentiated cells at an earlier time point than occurs when
cells are transdifferentiated in the absence of said inhibitor.
[0060] In another embodiment of this aspect and all other aspects
provided herein, the inhibitor comprises an RNA interference
molecule or an antibody.
[0061] In another embodiment of this aspect and all other aspects
provided herein, the RNA interference molecule comprises an siRNA
or an shRNA.
[0062] In another embodiment of this aspect and all other aspects
provided herein, step (a) is performed before or during step
(b).
[0063] In another embodiment of this aspect and all other aspects
provided herein, the transdifferentiation of step (b) comprises
transdifferentiation of a fibroblast to a neuron or
transdifferentiation of a B-cell to a macrophage.
[0064] In another embodiment of this aspect and all other aspects
provided herein, transdifferentiation of a fibroblast to a neuron
comprises overexpression (e.g., forced expression) of the
transcription factor Ascl1 in a fibroblast.
[0065] In another embodiment of this aspect and all other aspects
provided herein, transdifferentiation of a B-cell to a macrophage
comprises overexpression (e.g., forced expression) of the myeloid
transcription factor C/EBP.alpha. in a B-cell.
[0066] In another embodiment of this aspect and all other aspects
provided herein, the inhibitor of the CAF-1 complex inhibits the
Chaf1a and/or Chaf1b subunit of said complex.
BRIEF DESCRIPTION OF THE FIGURES
[0067] FIGS. 1A-1K. FIG. 1 describes a serial genome-wide shRNA
enrichment screen during iPSC generation. FIG. 1A, Fluorescence
microscopy image of a primary iPSC colony showing lentiviral tRFP
expression and activation of the endogenous Oct4-GFP pluripotency
reporter. FIG. 1B, Flow cytometric analysis of tRFP (y axis) and
Oct4-GFP (x-axis) expression of MEFs having undergone reprogramming
with gating strategy to purify Oct4-GFP+ cells. FIG. 1C, Timeline
of reprogramming experiments and strategy to collect control and
experimental samples for subsequent analysis of shRNA library
representation. FIG. 1D Schematic representation of steps required
for every reprogramming and shRNA enrichment cycle. FIG. 1E
Overview of serial enrichment screen and validation experiments.
FIG. 1F Change in shRNA library complexity during initial screen,
i.e., number of unique shRNAs at the start of rounds 1-3. FIG. 1G,
Enrichment of candidate shRNAs during the first 3 rounds of
reprogramming from screen #1. Lines depict hairpins that enhanced
iPSC formation more than 2-fold. FIG. 1H, Validation experiments
screen #1. FIG. 1I, Gradual loss of shRNA library complexity during
repeat screen; i.e., number of unique shRNAs at the start of rounds
1-5. FIG. 1J, Heatmap depicting fold-change enrichment of shRNAs
during 5 rounds of reprogramming from screen #2. Note that blue
bars represent shRNA that were lost whereas red bars represent
shRNA that became enriched relative to controls (see text and
methods section for details). FIG. 1K, Validation experiments
screen #2.
[0068] FIGS. 2A-2J. FIG. 2 demonstrates that suppression of Nudt21
and Sumo2 strongly enhances and accelerates reprogramming. FIG. 2A,
Flow cytometric analysis of Oct4-GFP expression in reprogrammable
MEFs after 8 days or OKSM expression in the presence of hairpins
against Firefly luciferase (control), Sumo2 or Nudt21. tRFP
expression depicts cells carrying lentiviral shRNA vector. FIG. 2B,
Quantification of data shown in FIG. 2A; shown is percentage of
Oct4-GFP+ cells per total number of cells using three replicates.
FIG. 2C, Alkaline Phosphatase (AP) staining for iPSC colonies
derived from reprogrammable MEFs transfected once with siRNAs
targeting Renilla (control), Nudt21 or Sumo2 during reprogramming.
FIG. 2D, Quantification of data shown in FIG. 2C; data obtained
from three independent replicates. FIGS. 2E-2F, Western blot
analyses for Nudt21 (FIG. 2E) and Sumo2 (FIG. 2F) expression in
reprogrammable MEFs infected with respective shRNA vectors and
treated with doxycycline (dox) for 3 days. FIG. 2G, Expression
dynamics of Nudt21 and Sumo2 in MEFs, iPSCs and intermediate stages
of reprogramming. Note that expression of either gene does not
change dramatically compared to controls (Thy1, fibroblast marker;
Nanog, pluripotency marker). FIG. 2H, Scheme to determine minimal
duration of OKSM expression (in days) required to achieve
transgene-independent iPSC colonies. FIG. 2I, Data obtained from
experiments depicted in FIG. 2G using shRNAs targeting Firefly
luciferase (control), Nudt21 or Sumo2. Shown is quantification of
AP+ transgene-independent colonies after 3-10 days of dox exposure,
followed by at least 4 days of dox withdrawal. FIG. 2J, Expression
levels of epigenetic regulators (Dnmt3b, Tet1) and
pluripotency-associated genes (EpCAM, Cdh1, Sal14) in indicated
samples at day 6 of OKSM expression or in established iPSCs.
[0069] FIGS. 3A-3E. FIG. 3 demonstrates the effect of Nudt21 and
Sumo2 suppression on defined reprogramming intermediates. FIG. 3A,
Overview of surface markers and reporter alleles used to
distinguish between early, mid and late stages of reprogramming.
FIG. 3B, Flow cytometry analysis of indicated markers (SSEA1, EpCAM
and Oct4-GFP) at intermediate stages of reprogramming in the
presence of shRNAs targeting Firefly luciferase, Sumo2 or Nudt21.
Note that tRFP expression identifies lentivirally transduced cells.
FIG. 3C, Quantification of data shown in FIG. 3B using 3
independent replicates. FIG. 3D, AP+ transgene-independent iPSC
colonies obtained upon transfection of reprogrammable MEFs with
siRNAs targeting Renilla control, Sumo2 or Nudt21 either once (day
0) or twice (day 0 and day 3) in the presence of dox for 6 days;
iPSC colonies were scored after 4 days of dox withdrawal to capture
stable iPSC. FIG. 3E, Quantification of data shown in FIG. 3D.
[0070] FIGS. 4A-4F. FIG. 4 demonstrates that Nudt21 and Sumo2
suppression act independently of c-Myc expression and in parallel
with small molecule enhancers of reprogramming. FIG. 4A, Scheme
depicting 3-factor reprogrammable MEFs carrying
Col1a1-tetOP-OKS-mCherry and Rosa26-M2rtTA alleles to assess effect
of c-Myc expression on iPSC formation. FIG. 4B, Generation of AP+
transgene-independent iPSC colonies obtained from 3-factor
reprogrammable MEF transfected with shRNAs targeting Renilla
control, Nudt21 or Sumo2 after exposure to dox and small molecules
for 9 days; data generated from 3 independent replicates. FIG. 4C,
Quantification of data shown in FIG. 4B, dox only samples as well
as additional time points. FIG. 4D, Oct4-GFP expression of 3-factor
reprogrammable MEFs treated with indicated siRNAs and dox for 9
days, followed by 5 days of dox-independent growth. Note that no
Oct4-GFP+ iPSCs could be recovered at this time point without Sumo2
or Nudt21 suppression. FIG. 4E, Comparison of iPSC formation
efficiencies from reprogrammable (4-factor) MEFs in the presence of
either small molecules or siRNAs targeting Sumo2 and Nudt21. Note
the strong effect of Sumo2 or Nudt21 suppression relative to
well-characterized small molecules on iPSC formation efficiencies.
FIG. 4F, Combination treatment of reprogrammable MEFs with siRNA
targeting Sumo2 or Nudt21 and indicated small molecule enhancers of
iPSC generation. Note the additive effect of Sumo2 or Nudt21
suppression and small molecule treatment on reprogramming
efficiencies.
[0071] FIGS. 5A-5F. FIG. 5 demonstrates Generation of iPSCs after
as little as 36-48 hours of OKSM expression. FIG. 5A, Treatment
with ascorbate (AA), Dot11 inhibitor (Dot11i) and Gsk3b inhibitor
(Gsk3bi) facilitates the recovery of transgene-independent AP+ iPSC
colonies from control and Sumo2 or Nudt21 siRNA transfected MEFs
after 72 hours of OKSM expression. FIG. 5B, Quantification of data
shown in FIG. 5A using three independent replicates. FIG. 5C,
Suppression of Sumo2 enables generation of Oct4-GFP+
transgene-independent iPSCs after 38 hours of OKSM expression
whereas suppression of Nudt21 facilitates generation of iPSCs after
48 hours of OKSM expression in the presence of small molecules.
FIG. 5D, Expression of endogenous Oct4, Nanog and Sox2 by
immunofluorescence in iPSCs generated after Sumo2 suppression and
OKSM expression for 38 hours. FIG. 5E, iPSCs shown in FIG. 5C are
pluripotent as determined by their potential to differentiate into
all three germlayers in teratomas. FIG. 5F, iPSCs produced with
Sumo2 siRNAs and small molecules following 38 hours of OKSM
expression give rise to coat color chimeras.
[0072] FIG. 6. FIG. 6 schematically shows the workflow to obtain
experimental and control samples for deep sequencing during initial
serial shRNA screens.
[0073] FIG. 7. FIG. 7 shows the results of experiments providing
confirmation of reprogramming phenotype with independent shRNAs
targeting Sumo2 (left panel) or Nudt21 (right panel). Shown are
iPSC formation efficiencies after infecting reprogrammable MEFs
with additional shRNAs targeting different seed sequences within
Sumo2 and Nudt21 mRNAs. iPSC colonies were determined after 10 days
of dox treatment.
[0074] FIG. 8. FIG. 8 shows that shRNAs against Nudt21 and Sumo2
reduce transcript levels of their respective target mRNAs. qPCR
analysis for Nudt21 or Sumo2 transcripts normalized to Gapdh
levels.
[0075] FIGS. 9A-9B. FIG. 9 shows that Sumo2 or Nudt21 knockdown do
not affect cell proliferation or viability. FIG. 9A, Growth curve
of reprogrammable MEFs expressing shRNAs against Firefly, Nudt21 or
Sumo2 in the presence or absence of dox (i.e., OKSM expression).
Cell counts were normalized to the cell number at day 1 (data
obtained from 3 replicates). FIG. 9B, Parallel cultures as shown in
FIG. 10A were stained for Annexin V (apoptosing cells) and DAPI
(dead cells) (data obtained from 3 replicates).
[0076] FIGS. 10A-10B. FIG. 10 shows the schematic approach and
results using arrayed and multiplexed shRNAmir screening strategies
to identify suppressors of reprogramming. FIG. 10A, Arrayed screen
design using a combination of retroviral GFP shRNAmir (pLMN)
chromatin library (n=247 genes) and Col1A1-OKSM; Rosa26-M2rtTA
double transgenic reprogrammable MEFs. Effects of individual shRNAs
were tested by counting number of alkaline phosphatase-positive
(AP+), doxycycline (dox) independent iPSCs. FIG. 10B, Compilation
of arrayed screen results showing average reprogramming efficiency
ratios of two biological replicates normalized to Renilla shRNA
control.
[0077] FIGS. 11A-11C. FIG. 11 shows that CAF-1 suppression
accelerates reprogramming and yields developmentally competent
iPSCs. FIG. 11A, Validation of screening result: measurement of
Oct4-GFP+ iPSC colonies obtained after knockdown of either Chaf1a,
Chaf1b, or both Chaf1a and Chaf1b (pool). FIG. 11B, Expression
dynamics of early reprogramming marker Epcam (empty circle, solid
line) and late reprogramming marker Oct4-tomato (full circle dotted
line) in CAF-1 depleted and control cells after four and six days
of OKSM expression. FIG. 11C, Alkaline phosphatase-positive,
transgene-independent iPSC colonies obtained at day 10, following
four or six days of dox treatment in the presence of indicated
Chaf1a or Renilla shRNAs and ascorbate.
[0078] FIGS. 12A-12E. FIG. 12 demonstrates that reprogramming
phenotype depends on optimal CAF-1 and OKSM dose. FIG. 12A,
Comparison of reprogramming efficiency upon CAF-1 knockdown when
using MEFs heterozygous or homozygous for the Col1a1::tetOP-OKSM
and R26-M2rtTA alleles. Shown are alkaline phosphatase-positive,
transgene-independent colonies after six days of dox treatment and
four days of dox withdrawal. FIG. 12B, Quantification of data shown
in FIG. 12A. FIG. 12C, Schematic of Col1a1::tetOP-miR30-Chaf1a
knockin allele. FIG. 12D, MEFs carrying the
Col1a1::tetOP-miR30-Chaf1a shRNA and R26-M2rtTA alleles were
infected with constitutive pHAGE (Efla-OKSM) lentiviral expression
vector and exposed to either high (2 m/ml, top row) or low (0.2
m/ml, bottom row) doses of dox for indicated time windows before
scoring iPSC colonies on day nine by immunostaining for Nanog. FIG.
12E, Quantification of data shown in FIG. 12D.
[0079] FIGS. 13A-13I. FIG. 13 shows that CAF-1 suppression enhances
reprogramming in different cell conversion systems. FIG. 13A,
Strategy to assess effect of CAF-1 suppression on reprogramming
fetal hematopoietic stem and progenitor cells (HSPCs) into iPSCs.
FIG. 13B, Flow cytometric analysis for Pecam expression during the
reprogramming of HSPCs into iPSCs upon Chaf1a suppression using two
independent shRNAs. FIG. 13C, Quantification of flow cytometry data
shown in FIG. 13B based on geometric means. FIG. 13D, Schematic of
transdifferentiation assay of MEFs into induced neurons (iNs) upon
viral Ascl1 expression in the presence of a dox-inducible Chaf1a
shRNA allele. FIG. 13E, Representative image of MAP2+ iNs detected
after 13 days of transdifferentiation. Scale bars: 100 um. FIG.
13F, Quantification of transdifferentiation efficiency, depicted as
average number of MAP2+ iNs per 10 frames for each independent
experiment (n=5; values are mean+/-S.D; **, unpaired t-test;
p=0.0075). FIG. 13G, Assay outline to study transdifferentiation of
pre-B cells into macrophages using an estradiol-inducible
C/EBP.alpha. allele, in the presence of CAF-1 or control shRNAs.
FIG. 13H, Representative histograms (n=2) showing activation of
macrophage markers Cd14 (left) and Mac1 (right) in control (empty
vector; "Null ctrl") and Chaf1a and Chaf1b knockdown cells after 0,
24 and 48 hours of transdifferentiation (estradiol exposure). FIG.
13I, Differences in Cd14 and Mac1 expression levels between
Chaf1a/Chaf1b knockdown samples and empty vector control at 0, 24
and 48 hours of transdifferentiation. Shown are fold-change
expression differences between experimental and control samples
based on geometric means calculated from histogram plots (n=2
independent viral transductions).
[0080] FIGS. 14A-14F. FIG. 14 shows that CAF-1 suppression primes
pluripotency loci for transcriptional activation by promoting
chromatin accessibility and Sox2 binding at regulatory elements.
FIG. 14A, ATAC-Seq analysis of CAF-1 and control cells at day three
of reprogramming to measure global chromatin accessibility across
ESC-active enhancers (n=14265) and promoters (n=5513). Shown are
merged data for Chaf1a.164 and Chaf1a.2120 shRNA infected cells.
FIG. 14B, Meta gene analysis of Sox2 ChIP-Seq data across all
ESC-active promoters and enhancers at day three of reprogramming.
Note that cells infected with the weaker shRNA vector (Chaf1a.2120)
exhibit a chromatin state that is in between that of cells infected
with the Renilla shRNA vector and cells infected with the stronger
(Chaf1a.164) shRNA vector. FIG. 14C, Comparison of ATAC-Seq and
ChIP-Seq data at the Sal11 super-enhancer. Shaded grey bars
highlight enhanced Sox2 binding and concomitant accessible
chromatin structure at days three and six of reprogramming upon
depletion of CAF-1. Blue tracks depict ATAC-seq signatures of iPSCs
and Sox2 binding patterns in ESCs. FIG. 14D, Analysis of
H3K9me3-dependent reprogramming-resistant regions (RRRs) as defined
by Matoba et al. 45 in CAF-1 depleted and control MEFs (day 0) and
reprogramming intermediates (day 3). Left panel: heatmap showing
the changes in H3K9me3 enrichment over reprogramming resistant
(RRR) regions at day 0 and 3 of control (Ren.713) and Chaf1a shRNA
knockdown experiments (Chaf1a.164 and Chaf1a.2120). For each RRR
(rows), values reflect the averaged H3K9me3 signal between 5 kb
intervals spanning the entire region. Right panel: examples of RRRs
where the average H3K9me3 signal significantly decreases between
day 0 and 3 in the Chaf1a knockdown cells (p<0.05 for both
shRNAs after Benjamin-Hochberg correction). Boxplots show the
distributions of H3K9me3 signal values for 5 kb intervals spanning
across the RRR in each condition and time point. FIG. 14E,
Correlation of ATAC-Seq data with gene expression data during
reprogramming time course. Shown are ATAC-seq signals for chromatin
regions proximal to genes that become upregulated in CAF-1
knockdown intermediates at day 6 by microarray or RNA-seq analysis.
ATAC-Seq data are presented for each time point (day 0, 3 and 6)
and genotype (Renilla and two independent Chaf1a shRNAs). Note that
upregulated genes in CAF-1 KD cells at day 6 already show a more
accessible chromatin structure at day 3. FIG. 14F, Model:
Suppression of CAF-1 during iPSC formation promotes a more
accessible chromatin structure at enhancer elements and increased
Sox2 binding to ESC-specific targets upon overexpression of
reprogramming factors, giving rise to intermediate cells that are
more permissive to undergo cell fate change.
[0081] FIGS. 15A-15B. FIG. 15 demonstrates the validation of hits
from chromatin-focused shRNA screens. FIG. 15A, RT-PCR analysis to
confirm knockdown of Chaf1a and Chaf1b expression with Mir30-based
vectors from arrayed screen. FIG. 15B, Western blot analysis to
confirm knockdown of CAF-1 complex using the top-scoring
MiR30-based shRNAs from arrayed screen.
[0082] FIGS. 16A-16C. FIG. 16 shows the results of experiments that
confirm CAF-1 levels were suppressed during HSPC reprogramming and
transdifferentiation. FIG. 16A, Transgene independence assay during
HSPC reprogramming in the presence of CAF-1 or control hairpins.
Dox pulses were given for 3 or 6 days and AP+ colonies were scored
5 days post Dox withdrawal. FIG. 16B, RT-qPCR analysis for Chaf1a
expression to confirm knockdown at day 3 post dox induction
(shRNAmir and Ascl1 expression) (n=3; mean+/-S.D.). FIG. 16C,
RT-qPCR analysis for Chaf1a and Chaf1b expression to confirm
knockdown in transduced pre-B cells prior to induction of
transdifferentiation.
[0083] FIGS. 17A-17C. FIG. 17 shows the results of experiments that
demonstrate that CAF-1 promotes accessible chromatin structure at
enhancer elements. FIG. 17A, Experimental outline and assays
(SONO-seq, ATAC-seq, Sox2 ChIP-seq) to dissect effect of CAF-1
suppression on chromatin accessibility and transcription factor
binding, performed at days 3 and 6 of reprogramming as well as in
established iPSCs. FIG. 17B, Metagene analysis for ESC-specific
promoters and enhancers using ATAC-seq profiles at day 3 of
reprogramming. FIG. 17C, Genome snap shots of representative
ATAC-seq accessibility maps at super-enhancer elements (close to
Sox2 and Sal14 loci). Shaded grey bars highlight more accessible
sites in CAF-1 knockdown samples at days 3 and 6 of reprogramming
compared to Renilla shRNA controls.
DETAILED DESCRIPTION
[0084] Provided herein are methods for performing cellular
reprogramming that include treatment of somatic cells with an
inhibitor of CAF-1, Sumo2, Nutd21, or combinations thereof prior to
or during a reprogramming procedure. Such inhibitors can improve
both the speed and efficiency of cellular reprogramming. Also
described herein are methods in which, rather than reversing cell
differentiation, inhibitors of CAF-1 also surprisingly promote
differentiation, including transdifferentiation and cancer cell
differentiation. Thus, CAF-1 inhibition can also be used in the
treatment of cancer.
Definitions
[0085] As used herein, the term "cellular reprogramming" refers to
a process that alters or reverses the differentiation state of a
differentiated cell (e.g., a somatic cell). Stated another way,
reprogramming refers to a process of driving the differentiation of
a cell backwards to a more undifferentiated or more primitive type
of cell. It should be noted that placing many primary cells in
culture can lead to some loss of fully differentiated
characteristics. Thus, simply culturing such cells included in the
term differentiated cells does not render these cells
non-differentiated cells (e.g., undifferentiated cells) or
pluripotent cells. The transition of a differentiated cell to
pluripotency requires a reprogramming stimulus beyond the stimuli
that lead to partial loss of differentiated character in culture.
Reprogrammed cells also have the characteristic of the capacity of
extended passaging without loss of growth potential, relative to
primary cell parents, which generally have capacity for only a
limited number of divisions in culture. The cell to be reprogrammed
can be either partially or terminally differentiated prior to
reprogramming. In some embodiments, reprogramming encompasses
reversion of the differentiation state of a differentiated cell
(e.g., a somatic cell) to a pluripotent state or a multipotent
state. In some embodiments, reprogramming encompasses complete or
partial reversion of the differentiation state of a differentiated
cell (e.g., a somatic cell) to an undifferentiated cell (e.g., an
embryonic-like cell). The resulting cells are referred to as
"reprogrammed cells;" when the reprogrammed cells are pluripotent,
they are referred to as "induced pluripotent stem cells (iPSCs or
iPS cells)."
[0086] Many varying reprogramming methods are known, and it is
reasonable to expect that the removal of the barriers identified
herein will permit increased speed and/or efficiency for any such
method that re-programs cells. For the avoidance of doubt, the term
"cellular reprogramming in the absence of the inhibitor" refers to
a comparison of, e.g., reprogramming speed and/or efficiency,
between any given reprogramming regimen and that same regimen
performed in the presence of an inhibitor of a factor identified
herein as a roadblock to reprogramming. Thus, any given
reprogramming regimen can serve as the basis for comparison. The
same is also true with regard to comparisons for the speed or
efficiency of transdifferentiation.
[0087] As used herein, the term "speed" when used in reference to
cellular reprogramming refers to the appearance of reprogrammed
cells at an earlier time point in the presence of an inhibitor or
agent as described herein as compared to the emergence of
reprogrammed cells in the absence of the inhibitor or agent.
[0088] As used herein, the term "earlier time point" means that the
emergence of reprogrammed cells in the presence of an inhibitor or
agent as described herein occurs at least 6 h earlier, at least 12
h earlier, at least 18 h earlier, at least 24 h earlier, at least
30 h earlier, at least 36 h earlier, at least 4 days earlier, at
last 5 days earlier, at least 6 days earlier or more relative to
the emergence of reprogrammed cells in the absence of the inhibitor
or agent.
[0089] As used herein, the term "efficiency of cellular
reprogramming" refers to the percentage or number of reprogrammed
cells at a given time point. Accordingly, efficiency means that the
number of reprogrammed cells in the presence of an inhibitor or
agent is increased at least 10%, at least 20%, at least 25%, at
least 30%, at least 40%, at least 50%, at least 60%, at least 70%,
at least 75%, at least 80%, at least 90%, at least 95%, or even 99%
compared to the number of reprogrammed cells generated in the
absence of the inhibitor or agent. In some embodiments, the number
of reprogrammed cells produced in the presence of an inhibitor or
agent is increased by at least 1-fold, at least 2-fold, at least
5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at
least 100-fold, or more compared to the number of reprogrammed
cells produced in the absence of the inhibitor or agent.
[0090] The terms "decrease", "reduced", "reduction", or "inhibit"
are all used herein to mean a decrease by a statistically
significant amount. In some embodiments, "reduce," "reduction" or
"decrease" or "inhibit" typically means a decrease by at least 10%
as compared to a reference level (e.g., the absence of a given
treatment) and can include, for example, a decrease by at least
about 10%, at least about 20%, at least about 25%, at least about
30%, at least about 35%, at least about 40%, at least about 45%, at
least about 50%, at least about 55%, at least about 60%, at least
about 65%, at least about 70%, at least about 75%, at least about
80%, at least about 85%, at least about 90%, at least about 95%, at
least about 98%, at least about 99%, or more. As used herein,
"reduction" or "inhibition" does not encompass a complete
inhibition or reduction as compared to a reference level. "Complete
inhibition" is a 100% inhibition as compared to a reference level.
A decrease can be preferably down to a level accepted as within the
range of normal for an individual without a given disorder.
[0091] The terms "increased", "increase" or "enhance" or "activate"
are all used herein to generally mean an increase by a statically
significant amount; for the avoidance of any doubt, the terms
"increased", "increase" or "enhance" or "activate" means an
increase of at least 10% as compared to a reference level, for
example an increase of at least about 20%, or at least about 30%,
or at least about 40%, or at least about 50%, or at least about
60%, or at least about 70%, or at least about 80%, or at least
about 90% or up to and including a 100% increase or any increase
between 10-100% as compared to a reference level, or at least about
a 2-fold, or at least about a 3-fold, or at least about a 4-fold,
or at least about a 5-fold or at least about a 10-fold increase, at
least about a 20-fold increase, at least about a 50-fold increase,
at least about a 100-fold increase, at least about a 1000-fold
increase or more as compared to a reference level.
[0092] The term "pharmaceutically acceptable" refers to compounds
and compositions which may be administered to mammals without undue
toxicity. The term "pharmaceutically acceptable carriers" excludes
tissue culture medium. Exemplary pharmaceutically acceptable salts
include but are not limited to mineral acid salts such as
hydrochlorides, hydrobromides, phosphates, sulfates, and the like,
and the salts of organic acids such as acetates, propionates,
malonates, benzoates, and the like.
[0093] As used herein, the term "comprising" means that other
elements can also be present in addition to the defined elements
presented. The use of "comprising" indicates inclusion rather than
limitation.
[0094] As used herein the term "consisting essentially of" refers
to those elements required for a given embodiment. The term permits
the presence of additional elements that do not materially affect
the basic and novel or functional characteristic(s) of that
embodiment of the invention.
[0095] The term "consisting of" refers to compositions, methods,
and respective components thereof as described herein, which are
exclusive of any element not recited in that description of the
embodiment.
[0096] Further, unless otherwise required by context, singular
terms shall include pluralities and plural terms shall include the
singular.
[0097] Other than in the operating examples, or where otherwise
indicated, all numbers expressing quantities of ingredients or
reaction conditions used herein should be understood as modified in
all instances by the term "about." The term "about" when used in
connection with percentages can mean.+-.1%.
[0098] Unless otherwise defined herein, scientific and technical
terms used in connection with the present application shall have
the meanings that are commonly understood by those of ordinary
skill in the art to which this disclosure belongs. It should be
understood that this invention is not limited to the particular
methodology, protocols, and reagents, etc., described herein and as
such can vary. The terminology used herein is for the purpose of
describing particular embodiments only, and is not intended to
limit the scope of the present invention, which is defined solely
by the claims. Definitions of common terms in molecular biology can
be found in The Merck Manual of Diagnosis and Therapy, 19th
Edition, published by Merck Sharp & Dohme Corp., 2011 (ISBN
978-0-911910-19-3); Robert S. Porter et al. (eds.), The
Encyclopedia of Molecular Cell Biology and Molecular Medicine,
published by Blackwell Science Ltd., 1999-2012 (ISBN
9783527600908); and Robert A. Meyers (ed.), Molecular Biology and
Biotechnology: a Comprehensive Desk Reference, published by VCH
Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner
Luttmann, published by Elsevier, 2006; Lewin's Genes XI, published
by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael
Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory
Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic
Methods in Molecular Biology, Elsevier Science Publishing, Inc.,
New York, USA (2012) (ISBN 044460149X); Laboratory Methods in
Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542);
Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel
(ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385),
and Current Protocols in Protein Science (CPPS), John E. Coligan
(ed.), John Wiley and Sons, Inc., 2005 (ISBN 0471142735), the
contents of which are all incorporated by reference herein in their
entireties.
Cellular Reprogramming
[0099] Reprogramming can involve alteration, e.g., reversal, of at
least some of the heritable patterns of nucleic acid modification
(e.g., methylation), chromatin condensation, epigenetic changes,
genomic imprinting, etc., that occur during cellular
differentiation. Reprogramming is distinct from simply maintaining
the existing undifferentiated state of a cell that is already
pluripotent or maintaining the existing less than fully
differentiated state of a cell that is already a multipotent cell
(e.g., a hematopoietic stem cell). Reprogramming is also distinct
from promoting the self-renewal or proliferation of cells that are
already pluripotent or multipotent. The specific reprogramming
approach or method used to generate pluripotent stem cells from
somatic cells is not critical to the claimed invention. Thus, any
method that re-programs a somatic cell to the pluripotent phenotype
would be appropriate for use in the methods described herein.
Non-limiting examples of reprogramming approaches are discussed in
the following.
[0100] Reprogramming methodologies using defined combinations of
transcription factors have been described for generating induced
pluripotent stem cells. Yamanaka and Takahashi converted mouse
somatic cells to ES cell-like cells with expanded developmental
potential by the direct transduction of genes encoding Oct4, Sox2,
Klf4, and c-Myc (Takahashi and Yamanaka, 2006).
[0101] Subsequent studies have shown that human iPS cells can be
obtained using similar transduction methods and the transcription
factor quartet, OCT4, SOX2, LIN28 and NANOG. The production of iPS
cells can be achieved by the introduction of nucleic acid sequences
encoding stem cell-associated genes into an adult, somatic cell,
historically using viral vectors.
[0102] iPS cells can be generated or derived from terminally
differentiated somatic cells, as well as from adult stem cells, or
somatic stem cells. That is, a non-pluripotent progenitor cell can
be rendered pluripotent or multipotent by reprogramming. In such
instances, it may not be necessary to include as many reprogramming
factors as required to reprogram a terminally differentiated cell.
Further, reprogramming can be induced by the non-viral introduction
of reprogramming factors, e.g., by introducing the proteins
themselves, or by introducing nucleic acids that encode the
reprogramming factors, or by introducing messenger RNAs that upon
translation produce the reprogramming factors (see e.g., Warren et
al., Cell Stem Cell, 2010 Nov. 5; 7(5):618-30). Reprogramming can
be achieved by introducing combinations of nucleic acids encoding
stem cell-associated genes including, for example Oct-4 (also known
as Oct-3/4 or Pouf51), Sox1, Sox2, Sox3, Sox 15, Sox 18, NANOG,
Klf1, Klf2, Klf4, Klf5, NR5A2, c-Myc, 1-Myc, n-Myc, Rem2, Tert, and
LIN28. In one embodiment, reprogramming using the methods and
compositions described herein can comprise introducing one or more
of Oct-3/4, a member of the Sox family, a member of the Klf family,
and a member of the Myc family to a somatic cell. In one
embodiment, the methods and compositions described herein further
comprise introducing one or more of each of Oct-4, Sox2, Nanog,
c-MYC and Klf4 for reprogramming. In some embodiments, the
reprogramming can occur in the absence of forced expression of
c-Myc. Methods and factors for reprogramming are reviewed by
Theunissen and Jaenisch (2014) Cell-Stem Cell 14:720-734.
[0103] As noted above, the exact method used for reprogramming is
not necessarily critical to the methods and compositions described
herein. However, where cells differentiated from the reprogrammed
cells are to be used in, e.g., human therapy, in one embodiment the
reprogramming is not effected by a method that alters the genome.
Thus, in such embodiments, reprogramming is achieved, e.g., without
the use of viral or plasmid vectors. In addition to the
protein-based and the RNA-based methods (see e.g., Warren et al.,
supra), recent evidence indicates somatic cells may be
re-programmed by e.g., exposure of the cells to unphysiological
stress, e.g., in culture (see e.g., WO2013/163296, which is
incorporated herein by reference in its entirety). Methods such as
these that do not permanently modify the genome may be preferred
for cells to be used for therapeutic purposes, as they are less
likely to provoke genomic damage likely to promote, e.g.,
cancer.
[0104] The efficiency of reprogramming (i.e., the number of
reprogrammed cells) derived from a population of starting cells can
be enhanced by the addition of various small molecules, as shown by
Shi, Y., et al (2008) Cell-Stem Cell 2:525-528, Huangfu, D., et al
(2008) Nature Biotechnology 26(7):795-797, and Marson, A., et al
(2008) Cell-Stem Cell 3:132-135. An agent or combination of agents
that enhance the efficiency or rate of induced pluripotent stem
cell production can be helpful in any reprogramming situation, but
can be particularly advantageous, for example, in the production of
patient-specific or disease-specific iPSCs. In addition to the
factors disclosed herein, some non-limiting examples of agents that
enhance reprogramming efficiency include soluble Wnt, Wnt
conditioned media, BIX-01294 (a G9a histone methyltransferase),
PD0325901 (a MEK inhibitor), DNA methyltransferase inhibitors,
histone deacetylase (HDAC) inhibitors, valproic acid,
5'-azacytidine, dexamethasone, suberoylanilide, hydroxamic acid
(SAHA), vitamin C, and trichostatin (TSA), among others.
[0105] Other non-limiting examples of reprogramming enhancing
agents include: Suberoylanilide Hydroxamic Acid (SAHA (e.g.,
MK0683, vorinostat) and other hydroxamic acids), BML-210, Depudecin
(e.g., (-)-Depudecin), HC Toxin, Nullscript
(4-(1,3-Dioxo-1H,3H-benzo[de]isoquinolin-2-yl)-N-hydroxybutanamide),
Phenylbutyrate (e.g., sodium phenylbutyrate) and Valproic Acid
((VPA) and other short chain fatty acids), Scriptaid, Suramin
Sodium, Trichostatin A (TSA), APHA Compound 8, Apicidin, Sodium
Butyrate, pivaloyloxymethyl butyrate (Pivanex, AN-9), Trapoxin B,
Chlamydocin, Depsipeptide (also known as FR901228 or FK228),
benzamides (e.g., CI-994 (e.g., N-acetyl dinaline) and MS-27-275),
MGCD0103, NVP-LAQ-824, CBHA (m-carboxycinnaminic acid bishydroxamic
acid), JNJ16241199, Tubacin, A-161906, proxamide, oxamflatin,
3-Cl-UCHA (e.g., 6-(3-chlorophenylureido)caproic hydroxamic acid),
AOE (2-amino-8-oxo-9,10-epoxydecanoic acid), CHAP31 and CHAP 50.
Other reprogramming enhancing agents include, for example, dominant
negative forms of the HDACs (e.g., catalytically inactive forms),
siRNA inhibitors of the HDACs, and antibodies that specifically
bind to the HDACs. Such inhibitors are available, e.g., from BIOMOL
International, Fukasawa, Merck Biosciences, Novartis, Gloucester
Pharmaceuticals, Aton Pharma, Titan Pharmaceuticals, Schering AG,
Pharmion, MethylGene, and Sigma Aldrich.
[0106] To confirm the induction of pluripotent stem cells for use
with the methods described herein, isolated clones can be tested
for the expression of a stem cell marker. Such expression in a cell
derived from a somatic cell identifies the cells as induced
pluripotent stem cells. Stem cell markers can be selected from the
non-limiting group including SSEA3, SSEA4, CD9, Nanog, Fbx15,
Ecat1, Esg1, Eras, Gdf3, Fgf4, Cripto, Dax1, Zpf296, Slc2a3, Rex1,
Utf1, and Nat1. In one embodiment, a cell that expresses Oct4 or
Nanog is identified as pluripotent. Methods for detecting the
expression of such markers can include, for example, RT-PCR and
immunological methods that detect the presence of the encoded
polypeptides, such as Western blots or flow cytometric analyses. In
some embodiments, detection does not involve only RT-PCR, but also
includes detection of protein markers. Intracellular markers may be
best identified via RT-PCR, while cell surface markers are readily
identified, e.g., by immunocytochemistry. It can also be
advantageous in appropriate circumstances to use a reporter
construct, e.g., driven by the regulatory elements for a stem cell
marker to identify a reprogrammed cell.
[0107] The pluripotent stem cell character of isolated cells can be
confirmed by tests evaluating the ability of the iPSCs to
differentiate to cells of each of the three germ layers. As one
example, teratoma formation in nude mice can be used to evaluate
the pluripotent character of the isolated clones. The cells are
introduced to nude mice and histology and/or immunohistochemistry
is performed on a tumor arising from the cells. The growth of a
tumor comprising cells from all three germ layers, for example,
further indicates that the cells are pluripotent stem cells.
[0108] Further, cells undergoing reprogramming pass through defined
intermediate stages that can be tracked and isolated based on
combinations of surface markers and reporter alleles (see e.g.,
Polo et al. (2012) Cell 151:1617-1632; Stadtfeld et al. (2008) Cell
Stem Cell 2:23-240). Briefly, cells initially downregulate THY1 and
then upregulate SSEA1, followed by EPCAM and eventually Oct4 (or
PECAM) activation. Only cells that follow this transition in a
timely manner will give rise to iPSCs. Thus, one of skill in the
art can assess changes in these surface markers and reporter
alleles to precisely detect or confirm the process of
reprogramming.
[0109] Somatic Cells for Reprogramming to iPSCs:
[0110] Somatic cells, as that term is used herein, refers to any
cells forming the body of an organism, excluding germline cells.
Every cell type in the mammalian body--apart from the sperm and
ova, the cells from which they are made (gametocytes) and
undifferentiated stem cells--is a differentiated somatic cell. For
example, internal organs, skin, bones, blood, and connective tissue
are all made up of differentiated somatic cells. It is contemplated
herein that somatic cells from any of these tissues can be
reprogrammed while taking advantage of the methods and compositions
described herein.
[0111] Some non-limiting examples of differentiated somatic cells
include, but are not limited to, epithelial, endothelial, neuronal,
adipose, cardiac, skeletal muscle, immune cells, hepatic, splenic,
lung, circulating blood cells, gastrointestinal, renal, bone
marrow, and pancreatic cells. In some embodiments, a somatic cell
can be a primary cell isolated from any somatic tissue including,
but not limited to brain, liver, lung, gut, stomach, intestine,
fat, muscle, uterus, skin, spleen, endocrine organ, bone, etc.
Further, the somatic cell can be from any mammalian species, with
non-limiting examples including a murine, bovine, simian, porcine,
equine, ovine, or human cell. In some embodiments, the somatic cell
is a human somatic cell.
[0112] When reprogrammed cells are used in the therapeutic
treatment of disease, it is desirable, but not required, to use
somatic cells isolated from the patient being treated. In some
embodiments, a method for selecting the reprogrammed cells from a
heterogeneous population comprising reprogrammed cells and somatic
cells they were derived or generated from can be performed by any
known means. For example, a drug resistance gene or the like, such
as a selectable marker gene can be used to isolate the reprogrammed
cells using the selectable marker as an index. It is emphasized
that such a selectable marker is not required--that is, in some
embodiments reprogrammed pluripotent stem cells can be identified
on the basis of morphology (see e.g., US2010/0184051).
Transdifferentiation
[0113] Transdifferentiation, also known as lineage reprogramming or
direct conversion, is a process where cells convert from one
differentiated cell type to another without undergoing an
intermediate pluripotent state or progenitor cell type.
Transdifferentiation has been proposed as an approach for disease
modeling, drug discovery, gene therapy and regenerative
medicine.
[0114] Provided herein are methods for inducing
transdifferentiation that include inhibiting or depleting CAF-1.
Effects of CAF-1 inhibition treatment on transdifferentiation can
be assessed during "fibroblast-to-neuron" or "B-cell to macrophage"
transdifferentiation using e.g., defined transcription factors as
detailed in the Examples herein. However, the effects of CAF-1
inhibition are expected to be broadly applicable to any cell
transdifferentiation, particularly since CAF-1-mediated in
chromatin assembly and DNA packaging necessarily occur in all cell
types.
[0115] Transdifferentiation can be performed with the methods and
compositions described herein, using any means known in the art. In
one approach, termed the "lineage instructive approach"
transcription factors from progenitor cells of the target cell type
are transfected into a somatic cell to induce transdifferentiation.
One of skill in the art can determine which transcription factors
to use by starting with a large pool of factors and narrowing down
to a specific target cell type transcription factor, or vice
versa.
[0116] Another approach to transdifferentiation is the "initial
epigenetic activation phase approach," where somatic cells are
first transfected with pluripotent reprogramming factors
temporarily (Oct4, Sox2, Nanog, etc.) before being transfected with
the desired inhibitory or activating factors.
[0117] Transdifferentiation can also be induced using
pharmacological agents, particularly demethylating agents such as
5-azacytidine, or 5-aza-2-deoxycytidine, zebularine, procaine,
epigallocatechin-3-gallate, RG108,
1-.beta.-D-arabinofuranosyl-5-azacytosine, dihydro-5-azacytidine or
L-ethionine. 5-azacytidine has been shown to promote phenotypic
transdifferentiation of cardiac cells to skeletal myoblasts. In
some embodiments, growth factors can be included during
transdifferentiation, Exemplary growth factors include
granulocyte-macrophage stimulating factor (GM-CSF), stem cell
factor (SCF), G-CSF, M-CSF, thrombopoietin, IL-2, IL-4, fibroblast
growth factor (FGF), epidermal growth factor (EGF) and/or vascular
endothelial growth factor. In some embodiments, more than one
growth factor will be included.
[0118] Further examples of methods for transdifferentiation can be
found in e.g., Vierbuchen and Wernig (2012) Molecular Cell
47:827-838.
[0119] Successful transdifferentiation can be determined using the
presence or the absence of the expression of a marker that is
specific to a target cell as an indicator. The expression of such
marker can be detected by biochemical or immunochemical techniques
known by persons skilled in the art. For example, immunochemical
techniques such as enzyme-linked immunosorbent assay (ELISA),
immunofluorescent assay (IFA), immunoelectrophoresis,
immunochromatography assay, and immunohistochemical staining method
can be used. In these methods, marker-specific polyclonal or
monoclonal antibodies or fragments thereof, which selectively bind
to antigens of various target cells, are used. Antibodies against
various specific markers are marketed and can be properly obtained
by persons skilled in the art. The expression of a marker that is
specific to a target cell can also be detected by a molecular
biological method such as RT-PCR, transcription mediated
amplification (TMA), reverse transcriptase-ligase chain reaction
(RT-LCR), or hybridization analysis. Alternatively, the expression
of such marker can also be specifically detected by a tissue
staining technique such as alizarin red staining, alcian blue
staining, Oil-Red-O staining, Von Kossa staining, or indocyanine
green staining using metabolic products of differentiated cells,
cellular drug metabolism, or properties such as dyeing properties
(e.g., a dye exclusion assay).
CAF-1 Complex
[0120] DNA is packaged into chromatin, in part to control gene
expression. In order for DNA replication to occur, chromatin is
disassembled and nucleosomes are transiently removed from the DNA
strand. Nucleosomes quickly reassemble behind the DNA replication
fork to re-package the DNA. New nucleosomes are generated at the
replication fork in a reaction catalyzed by chromatin assembly
factor 1 (CAF-1; NCBI Gene ID: 41836). CAF-1 consists of three
polypeptides with molecular weights of 150 (i.e., Chaf1a; NCBI Gene
ID: 10036), 60 (i.e., Chaf1b; NCBI Gene ID: 8208), and 48 kDa that
bind histones H3 and H4. Inhibition of the expression or activity
of any or all of these subunits or an inhibitor that targets the
complex (or subunits thereof) can be employed in the methods and
compositions disclosed herein.
[0121] CAF-1 is also thought to play a role in depositing the
histone tetramer onto replicating DNA. In addition, CAF-1 has been
associated with the restoration of chromatin structure after DNA
repair, and with the maintenance of heterochromatin.
Sumo2
[0122] Small ubiquitin-like modifier (Sumo) proteins are a group of
small proteins that bind lysine residues of target proteins and
thereby modify target protein activity, stability, and sub-cellular
localization. There are several different Sumo isoforms, including
Sumo1, Sumo2 (NCBI Gene ID: 6613), and Sumo 3. Sumo2 and Sumo3
proteins share a high degree of similarity (95% sequence identity),
but are relatively distinct from Sumo1 (only 50% sequence
identity). Like ubiquitin, the Sumo protein is synthesized as a
larger precursor protein that is processed by sentrin-specific
proteases to expose the two C-terminal glycine residues that
provide for conjugation. Sumo conjugation (or "sumoylation") is a
highly volatile process, with various enzymes involved in the
conjugation, e.g., E1, E2 and Ubc9, and de-conjugating (or
"de-sumoylation") e.g., SENPs, processes. A number of known Sumo
conjugation targets transcription factors and other nuclear
proteins involved in gene expression. A major change in levels of
Sumo conjugated proteins may have a major impact on the fate of
cells.
Nutd21
[0123] The Nudix (nucleoside diphosphate linked moiety X)-type
motif 21 gene (NCBI Gene ID: 11051) encodes the protein "cleavage
and polyadenylation specificity factor subunit 5." The gene product
is one subunit of a cleavage factor required for 3' RNA cleavage
and polyadenylation processing. Interaction of the protein with RNA
is one of the earliest steps in the assembly of the 3' end
processing complex and facilitates the recruitment of other
processing factors. This gene encodes the 25kD subunit of the
protein complex, which is composed of four polypeptides.
Inhibitors of CAF-1, Sumo2 and Nutd21
[0124] Essentially any inhibitor of CAF-1, Sumo2, and/or Nutd21 can
be used with the methods and treatments described herein. An
inhibitor can be an RNA interference agent (e.g., shRNA, siRNA), an
antibody or antigen binding agent, a small molecule, etc. One of
skill in the art can readily identify inhibitors of CAF-1, Sumo2,
and/or Nutd21 using cellular screening assays that are routine in
the art.
[0125] As used herein, the term "inhibitor of the CAF-1 complex,
Sumo2 or Nutd1" refers to a molecule or agent that significantly
blocks, inhibits, reduces, or interferes with the CAF-1 complex,
Sumo2, or Nutd1 biological activity in vitro, in situ, and/or in
vivo, including activity of downstream pathways mediated by CAF-1,
Sumo2, or Nutd1 signaling, such as, for example, RNA or protein
upregulation, and/or elicitation of a cellular response to CAF-1,
Sumo2, or Nutd1. Exemplary inhibitors contemplated for use in the
various aspects and embodiments described herein include, but are
not limited to, antibodies or antigen-binding fragments thereof
that specifically bind to one or more members of the CAF-1 complex,
Sumo2, Nutd1 or their isoforms; anti-sense molecules directed to a
nucleic acid encoding one of the targets; short interfering RNA
("siRNA") molecules directed to a nucleic acid encoding a member of
the CAF-1 complex, Sumo2, or Nutd21; an inhibitory compound; RNA or
DNA aptamers that bind one or more members of the CAF-1 complex,
Sumo2, Nutd1 or their isoforms, and inhibit/reduce/block activity
or signaling; inhibitory soluble CAF-1, Sumo2, or Nutd21 proteins
or fusion polypeptides thereof (e.g., dominant negative
mutants).
[0126] As used herein, an inhibitor or antagonist has the ability
to reduce the activity and/or expression of the CAF-1 complex,
Sumo2, or Nutd21 in a cell by at least 5%, at least 10%, at least
20%, at least 30%, at least 40%, at least 50%, at least 60%, at
least 70%, at least 80%, at least 90%, at least 95%, at least 98%,
at least 99%, or more, relative to the activity or expression level
in the absence of the inhibitor or antagonist. At a minimum, an
inhibitor will interfere with the inhibitory effect of these
factors in a reprogramming assay as described in the Examples--that
is, an inhibitor will increase the speed or efficiency of
reprogramming in an assay as described herein. In some embodiments,
the activity or expression of the CAF-1 complex can be assessed
using a commercial ELISA kit (e.g., from LIFESPAN BIOSCIENCES) or
as described in Verreault et al. (1996) 87(1):95-104. In some
embodiments, the activity or expression of Sumo2 can be assessed
using a commercial Sumoylation assay kit, for example, Sumo2-FP
(UBIQ.TM.), or SUMOylation assay kit (ABCAM.TM.). In some
embodiments, the activity of expression of Nutd21 can be assessed
using Real-Time PCR primers from e.g., BIORAD, TAQMAN, etc.
[0127] In some embodiments, particularly with regard to inhibition
of the CAF-1 complex, it is not desirable to inhibit the target
completely. One of skill in the art can readily determine or
titrate a dose of the inhibitor to achieve a desired result to be
used in combination with a cellular reprogramming protocol or for
administration to a subject.
[0128] RNA Interference Agents:
[0129] The use of RNA interference agents is well within the
abilities of one of skill in the art and is not described in detail
herein. RNA interference (RNAi) uses e.g., small interfering RNA
(siRNA) duplexes that target the messenger RNA encoding the target
polypeptide for selective degradation via the RNA-induced silencing
complex (RISC). siRNA-dependent post-transcriptional silencing of
gene expression involves cleaving the target messenger RNA molecule
at a site guided by e.g., the siRNA. As used herein, "inhibition of
target gene expression" includes any decrease in expression or
protein activity or level of the target gene or protein encoded by
the target gene as compared to a situation wherein no RNA
interference has been induced. The decrease will be of at least
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more as
compared to the expression of a target gene or the activity or
level of the protein encoded by a target gene which has not been
targeted by an RNA interfering agent.
[0130] The terms "RNA interference agent" and "RNA interference"
can comprise a short interfering RNA (siRNA), miRNA, shRNA or other
double-stranded RNA molecule that targets a gene of interest. Such
agents can be chemically synthesized, produced by in vitro
transcription, or produced within a host cell. In one embodiment,
siRNA is a double stranded RNA (dsRNA) molecule of about 15 to
about 40 nucleotides in length, preferably about 15 to about 28
nucleotides, more preferably about 19 to about 25 nucleotides in
length, and more preferably about 19, 20, 21, 22, or 23 nucleotides
in length, and may contain a 3' and/or 5' overhang on each strand
having a length of about 0, 1, 2, 3, 4, or 5 nucleotides. The
length of the overhang is independent between the two strands,
i.e., the length of the overhang on one strand is not dependent on
the length of the overhang on the second strand. Preferably the
siRNA is capable of promoting RNA interference through degradation
or specific post-transcriptional gene silencing (PTGS) of the
target messenger RNA (mRNA).
[0131] siRNAs also include small hairpin (also called stem loop)
RNAs (shRNAs). In one embodiment, shRNAs are composed of a short
(e.g., about 19 to about 25 nucleotide) antisense strand, followed
by a nucleotide loop of about 5 to about 9 nucleotides, and the
analogous sense strand. Alternatively, the sense strand may precede
the nucleotide loop structure and the antisense strand may follow.
Sequences encoding these shRNAs can be contained in plasmids,
retroviruses, and lentiviruses and expressed from, for example, the
pol III U6 promoter, or another promoter. The target gene or
sequence of the RNA interfering agent can be a cellular gene or
genomic sequence, e.g. a Chaf1a, Chaf1b, Sumo2, or Nutd21 sequence.
An siRNA can be substantially homologous to the target gene or
genomic sequence, or a fragment thereof. As used in this context,
the term "homologous" is defined as being substantially identical,
sufficiently complementary, or similar to the target mRNA, or a
fragment thereof, to effect RNA interference of the target. In
addition to native RNA molecules, RNA suitable for inhibiting or
interfering with the expression of a target sequence includes RNA
derivatives and analogs that permit RNA-mediated gene silencing.
Preferably, one strand of the siRNA is identical to its target. The
siRNA preferably targets only one sequence. Each of the RNA
interfering agents, such as siRNAs, can be screened for potential
off-target effects by, for example, expression profiling. Such
methods are known to one skilled in the art. In addition to
expression profiling, one can also screen the potential target
sequences for similar sequences in the sequence databases to
identify potential sequences which may have off-target effects.
Therefore, one may initially screen the proposed siRNAs to avoid
potential off-target silencing using sequence identity analysis by
any known sequence comparison methods, such as BLAST. siRNA
sequences can also be chosen to maximize the uptake of the
antisense (guide) strand of the siRNA into RISC and thereby
maximize the ability of RISC to target an mRNA for degradation.
siRNA molecules need not be limited to those molecules containing
only RNA, but, for example, further encompasses chemically modified
nucleotides and non-nucleotides, and also include molecules wherein
a ribose sugar molecule is substituted for another sugar molecule
or a molecule which performs a similar function.
[0132] siRNA sequences to target the CAF-1 complex (e.g., Chaf1a,
Chaf1b etc.), Sumo2, Nutd21, can also be obtained commercially from
e.g., INVITROGEN.TM., THERMO SCIENTIFIC.TM., and ORIGENE.TM., among
others.
[0133] Antibodies and Antigen Binding Agents:
[0134] Antibodies for binding and/or inhibition of a member of the
CAF-1 complex, Sumo2, or Nutd21 suitable for use in practicing the
methods described herein are preferably monoclonal, and can
include, but are not limited to, human, humanized or chimeric
antibodies, comprising single chain antibodies, Fab fragments,
F(ab') fragments, fragments produced by a Fab expression library,
and/or binding fragments of any of the above. Antibodies also refer
to immunoglobulin molecules and immunologically active portions of
immunoglobulin molecules, i.e., molecules that contain antigen or
target binding sites or "antigen-binding fragments." The
immunoglobulin molecules described herein can be of any type (e.g.,
IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3,
IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule, as is
understood by one of skill in the art.
[0135] It is noted that antibodies are widely perceived to be
ineffective for targeting intracellular proteins due to relative
difficulty in crossing cellular membranes. However, recent evidence
indicates that unmodified antibodies can cross the plasma or cell
membrane to bind and inhibit intracellular targets (see e.g., US
2014/0286937; Guo et al. (2011) Science Translational Medicine
3:99ra85). As such, antibodies or antibody fragments as known in
the art and as described herein can be used to inhibit
intracellular factors, including CAF-1 complex, Sumo2 and Nutd21.
Examples of antibody fragments encompassed by the terms antibody
fragment or antigen-binding fragment include: (i) the Fab fragment,
having V.sub.L, C.sub.L, V.sub.H and C.sub.H1 domains; (ii) the
Fab' fragment, which is a Fab fragment having one or more cysteine
residues at the C-terminus of the C.sub.H1 domain; (iii) the Fd
fragment having V.sub.H and C.sub.H1 domains; (iv) the Fd' fragment
having V.sub.H and C.sub.H1 domains and one or more cysteine
residues at the C-terminus of the C.sub.H1 domain; (v) the Fv
fragment having the V.sub.L and V.sub.H domains of a single arm of
an antibody; (vi) a dAb fragment, which consists of a V.sub.H
domain or a V.sub.L domain; (vii) isolated CDR regions; (viii)
F(ab').sub.2 fragments, a bivalent fragment including two Fab'
fragments linked by a disulphide bridge at the hinge region; (ix)
single chain antibody molecules (e.g. single chain Fv; scFv), (x)
"diabodies" with two antigen binding sites, comprising a heavy
chain variable domain (V.sub.H) connected to a light chain variable
domain (V.sub.L) in the same polypeptide chain, (xi) "linear
antibodies" comprising a pair of tandem Fd segments
(V.sub.H-C.sub.H1-V.sub.H-C.sub.H1) which, together with
complementary light chain polypeptides, form a pair of antigen
binding region; and modified versions of any of the foregoing
(e.g., modified by the covalent attachment of polyalkylene glycol
(e.g., polyethylene glycol, polypropylene glycol, polybutylene
glycol) or other suitable polymer). Although CAF-1, Sumo2, and
Nutd21 are intracellular proteins, it is now accepted that antibody
agents can be used to target intracellularly (see e.g., U.S. Pat.
No. 8,715,674).
[0136] Small Molecule Inhibitors:
[0137] In some embodiments of the compositions, methods, and uses
described herein, an inhibitor of the CAF-1 complex, Sumo2, or
Nutd21 is a small molecule inhibitor, including, but not limited
to, small peptides or peptide-like molecules, soluble peptides, and
synthetic non-peptidyl organic or inorganic compounds. A small
molecule inhibitor or antagonist can have a molecular weight of any
of about 100 to about 20,000 daltons (Da), about 500 to about
15,000 Da, about 1000 to about 10,000 Da. In some embodiments, an
inhibitor comprises a small molecule that binds to a member of the
CAF-1 complex, Sumo2, or Nutd21 and inhibits its biological
activity.
[0138] Combination Treatment:
[0139] In some embodiments, inhibitors of the CAF-1 complex, Sumo2,
and Nutd21 can be used in combination. For example, inhibitors
targeting at least two of the CAF-1 complex, Sumo2, and/or Nutd21
can be used in combination. In other embodiments, inhibitors
targeting all three of the CAF-1 complex, Sumo2, and Nutd21 can be
used in combination.
Promoting Cancer Cell Differentiation
[0140] Germline deletion of CAF-1 in mice results in early
embryonic lethality, whereas CAF-1 loss in embryonic stem cells
causes cell cycle arrest and apoptosis. In the working examples,
CAF-1 is shown to act as a general stabilizer of cell identity
during normal development and differentiation, in part by
maintaining epigenetic patterns in somatic cells. CAF-1 depletion
in several pre-leukemic tumor cell lines, which were generated by
viral expression of HoxA9, or HoxB8 in myeloid progenitor cells,
triggered differentiation and subsequently growth arrest.
[0141] Accordingly, inhibitors of CAF-1 can be used to promote
differentiation of a cancer cell in vivo. In other embodiments, a
CAF-1 inhibitor is administered to a subject for the treatment of
cancer. It is expected that a decrease of CAF-1 expression and/or
activity will be effective against any cancer type that involves
cancer stem cells. Cancers in general often behave like earlier
developmental forms of the tissues from which they originate, such
that promotion of differentiation will limit the uncontrolled
proliferation that is characteristic of cancer. As such, inhibition
of CAF-1 is expected to do so with broad applicability.
[0142] Some non-limiting examples of cancer that can be treated
with a CAF-1 inhibitor include, but are not limited to, carcinoma,
lymphoma, blastoma, sarcoma, and leukemia. Other exemplary cancers
include, but are not limited to, basal cell carcinoma, biliary
tract cancer; bladder cancer; bone cancer; brain and CNS cancer;
breast cancer; cancer of the peritoneum; cervical cancer;
choriocarcinoma; colon and rectum cancer; connective tissue cancer;
cancer of the digestive system; endometrial cancer; esophageal
cancer; eye cancer; cancer of the head and neck; gastric cancer
(including gastrointestinal cancer); glioblastoma; hepatic
carcinoma; hepatoma; intra-epithelial neoplasm; kidney or renal
cancer; larynx cancer; leukemia; liver cancer; lung cancer (e.g.,
small-cell lung cancer, non-small cell lung cancer, adenocarcinoma
of the lung, and squamous carcinoma of the lung); lymphoma
including Hodgkin's and non-Hodgkin's lymphoma; melanoma; myeloma;
neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and
pharynx); ovarian cancer; pancreatic cancer; prostate cancer;
retinoblastoma; rhabdomyosarcoma; rectal cancer; cancer of the
respiratory system; salivary gland carcinoma; sarcoma; skin cancer;
squamous cell cancer; stomach cancer; testicular cancer; thyroid
cancer; uterine or endometrial cancer; cancer of the urinary
system; vulval cancer; as well as other carcinomas and sarcomas; as
well as B-cell lymphoma (including low grade/follicular
non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL;
intermediate grade/follicular NHL; intermediate grade diffuse NHL;
high grade immunoblastic NHL; high grade lymphoblastic NHL; high
grade small non-cleaved cell NHL; bulky disease NHL; mantle cell
lymphoma; AIDS-related lymphoma; and Waldenstrom's
Macroglobulinemia); chronic lymphocytic leukemia (CLL); acute
lymphoblastic leukemia (ALL); Hairy cell leukemia; chronic
myeloblastic leukemia; and post-transplant lymphoproliferative
disorder (PTLD), as well as abnormal vascular proliferation
associated with phakomatoses, edema (such as that associated with
brain tumors), and Meigs' syndrome.
[0143] In some embodiments, the carcinoma or sarcoma includes, but
is not limited to, carcinomas and sarcomas found in the anus,
bladder, bile duct, bone, brain, breast, cervix, colon/rectum,
endometrium, esophagus, eye, gallbladder, head and neck, liver,
kidney, larynx, lung, mediastinum (chest), mouth, ovaries,
pancreas, penis, prostate, skin, small intestine, stomach, spinal
marrow, tailbone, testicles, thyroid and uterus. The types of
carcinomas include but are not limited to papilloma/carcinoma,
choriocarcinoma, endodermal sinus tumor, teratoma,
adenoma/adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma,
rhabdomyoma, mesothelioma, angioma, osteoma, chondroma, glioma,
lymphoma/leukemia, squamous cell carcinoma, small cell carcinoma,
large cell undifferentiated carcinomas, basal cell carcinoma and
sinonasal undifferentiated carcinoma. The types of sarcomas include
but are not limited to, for example, soft tissue sarcoma such as
alveolar soft part sarcoma, angiosarcoma, dermatofibrosarcoma,
desmoid tumor, desmoplastic small round cell tumor, extraskeletal
chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma,
hemangiopericytoma, hemangiosarcoma, Kaposi's sarcoma,
leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma,
malignant fibrous histiocytoma, neurofibrosarcoma,
rhabdomyosarcoma, synovial sarcoma, and Askin's tumor, Ewing's
sarcoma (primitive neuroectodermal tumor), malignant
hemangioendothelioma, malignant schwannoma, osteosarcoma, and
chondrosarcoma.
[0144] In one embodiment of the methods, the subject having the
tumor, cancer or malignant condition is undergoing, or has
undergone, treatment with a conventional cancer therapy. In some
embodiments, the cancer therapy is chemotherapy, radiation therapy,
immunotherapy or a combination thereof.
[0145] Inhibitors of CAF-1 can be used alone or in combination with
other therapies, including chemotherapy, radiation, cancer
immunotherapy, or combinations thereof. Such therapies can either
directly target a tumor (e.g., by inhibition of a tumor cell
protein or killing of highly mitotic cells) or provoke or
accentuate an anti-tumor immune response.
[0146] Exemplary anti-cancer agents that can be used in combination
with a CAF-1 inhibitor include alkylating agents such as thiotepa
and CYTOXAN.TM.; cyclosphosphamide; alkyl sulfonates such as
busulfan, improsulfan and piposulfan; aziridines such as benzodopa,
carboquone, meturedopa, and uredopa; ethylenimines and
methylamelamines including altretamine, triethylenemelamine,
trietylenephosphoramide, triethiylenethiophosphoramide and
trimethylolomelamine; acetogenins (especially bullatacin and
bullatacinone); a camptothecin (including the synthetic analogue
topotecan); bryostatin; callystatin; CC-1065 (including its
adozelesin, carzelesin and bizelesin synthetic analogues);
cryptophycins (particularly cryptophycin 1 and cryptophycin 8);
dolastatin; duocarmycin (including the synthetic analogues, KW-2189
and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin;
spongistatin; nitrogen mustards such as chlorambucil,
chlornaphazine, cholophosphamide, estramustine, ifosfamide,
mechlorethamine, mechlorethamine oxide hydrochloride, melphalan,
novembichin, phenesterine, prednimustine, trofosfamide, uracil
mustard; nitrosureas, such as carmustine, chlorozotocin,
fotemustine, lomustine, nimustine, and ranimnustine; antibiotics
such as the enediyne antibiotics (e.g., calicheamicin, especially
calicheamicin gammalI and calicheamicin omegaI1); dynemicin,
including dynemicin A; bisphosphonates, such as clodronate; an
esperamicin; as well as neocarzinostatin chromophore and related
chromoprotein enediyne antibiotic chromophores), aclacinomysins,
actinomycin, authramycin, azaserine, bleomycins, cactinomycin,
carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin,
daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine,
ADRIAMYCIN.TM., doxorubicin (including morpholino-doxorubicin,
cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and
deoxydoxorubicin), epirubicin, esorubicin, idarubicin,
marcellomycin, mitomycins such as mitomycin C, mycophenolic acid,
nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin,
quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin,
ubenimex, zinostatin, zorubicin; anti-metabolites such as
methotrexate and 5-fluorouracil (5-FU); folic acid analogues such
as denopterin, methotrexate, pteropterin, trimetrexate; purine
analogs such as fludarabine, 6-mercaptopurine, thiamiprine,
thioguanine; pyrimidine analogs such as ancitabine, azacitidine,
6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine,
enocitabine, floxuridine; androgens such as calusterone,
dromostanolone propionate, epitiostanol, mepitiostane,
testolactone; anti-adrenals such as aminoglutethimide, mitotane,
trilostane; folic acid replenisher such as frolinic acid;
aceglatone; aldophosphamide glycoside; aminolevulinic acid;
eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate;
defofamine; demecolcine; diaziquone; elformithine; elliptinium
acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea;
lentinan; lonidainine; maytansinoids such as maytansine and
ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine;
pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic
acid; 2-ethylhydrazide; procarbazine; PSK. polysaccharide complex
(JHS Natural Products.TM., Eugene, Oreg.); razoxane; rhizoxin;
sizofuran; spirogermanium; tenuazonic acid; triaziquone;
2,2',2''-trichlorotriethylamine; trichothecenes (especially T-2
toxin, verracurin A, roridin A and anguidine); urethan; vindesine;
dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman;
gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa;
taxoids, e.g., TAXOL.TM. paclitaxel (Bristol-Myers Squibb.TM.
Oncology, Princeton, N.J.), ABRAXANE.TM. Cremophor-free,
albumin-engineered nanoparticle formulation of paclitaxel (American
Pharmaceutical Partners.TM., Schaumberg, Ill.), and TAXOTERE.TM.
doxetaxel (Rhone-Poulenc Rorer.TM., Antony, France); chloranbucil;
GEMZAR.TM., gemcitabine; 6-thioguanine; mercaptopurine;
methotrexate; platinum analogs such as cisplatin, oxaliplatin and
carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide;
mitoxantrone; vincristine; NAVELBINE.TM., vinorelbine; novantrone;
teniposide; edatrexate; daunomycin; aminopterin; xeloda;
ibandronate; irinotecan (Camptosar, CPT-11) (including the
treatment regimen of irinotecan with 5-FU and leucovorin);
topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO);
retinoids such as retinoic acid; capecitabine; combretastatin;
leucovorin (LV); oxaliplatin, including the oxaliplatin treatment
regimen (FOLFOX.TM.); lapatinib (Tykerb.TM.); inhibitors of
PKC-alpha, Raf, H-Ras, EGFR (e.g., erlotinib (Tarceva.TM.)) and
VEGF-A that reduce cell proliferation and pharmaceutically
acceptable salts, acids or derivatives of any of the above. In
addition, the methods of treatment can further include the use of
radiation.
Dosage and Administration
[0147] In some aspects, the methods described herein provide a
method for inducing cellular differentiation in vivo or a method
for treating cancer in a subject. In one embodiment of this aspect
and all other aspects described herein, the cancer is leukemia. In
one embodiment, the subject can be a mammal. In another embodiment,
the mammal can be a human, although the approach is effective with
respect to all mammals. The methods comprise administering to the
subject an effective amount of a pharmaceutical composition
comprising an inhibitor that binds a member of the CAF-1 complex
(e.g., Chaf1a, Chaf1b), or a combination thereof in a
pharmaceutically acceptable carrier.
[0148] The dosage range for the agent depends upon the potency, and
includes amounts large enough to produce the desired effect, e.g.,
cellular differentiation or treatment of cancer. The dosage should
not be so large as to cause unacceptable adverse side effects.
Generally, the dosage will vary with the type of inhibitor (e.g.,
an antibody or fragment, small molecule, siRNA, etc.), and with the
age, condition, and sex of the patient. The dosage can be
determined by one of skill in the art and can also be adjusted by
the individual physician in the event of any complication.
[0149] Typically, the dosage ranges from 0.001 mg/kg body weight to
5 g/kg body weight. In some embodiments, the dosage range is from
0.001 mg/kg body weight to 1 g/kg body weight, from 0.001 mg/kg
body weight to 0.5 g/kg body weight, from 0.001 mg/kg body weight
to 0.1 g/kg body weight, from 0.001 mg/kg body weight to 50 mg/kg
body weight, from 0.001 mg/kg body weight to 25 mg/kg body weight,
from 0.001 mg/kg body weight to 10 mg/kg body weight, from 0.001
mg/kg body weight to 5 mg/kg body weight, from 0.001 mg/kg body
weight to 1 mg/kg body weight, from 0.001 mg/kg body weight to 0.1
mg/kg body weight, from 0.001 mg/kg body weight to 0.005 mg/kg body
weight. Alternatively, in some embodiments the dosage range is from
0.1 g/kg body weight to 5 g/kg body weight, from 0.5 g/kg body
weight to 5 g/kg body weight, from 1 g/kg body weight to 5 g/kg
body weight, from 1.5 g/kg body weight to 5 g/kg body weight, from
2 g/kg body weight to 5 g/kg body weight, from 2.5 g/kg body weight
to 5 g/kg body weight, from 3 g/kg body weight to 5 g/kg body
weight, from 3.5 g/kg body weight to 5 g/kg body weight, from 4
g/kg body weight to 5 g/kg body weight, from 4.5 g/kg body weight
to 5 g/kg body weight, from 4.8 g/kg body weight to 5 g/kg body
weight. In one embodiment, the dose range is from 5 .mu.g/kg body
weight to 30 .mu.g/kg body weight. Alternatively, the dose range
will be titrated to maintain serum levels between 5 .mu.g/mL and 30
.mu.g/mL.
[0150] Administration of the doses recited above can be repeated
for a limited period of time. In some embodiments, the doses are
given once a day, or multiple times a day, for example but not
limited to three times a day. In a preferred embodiment, the doses
recited above are administered daily for several weeks or months.
The duration of treatment depends upon the subject's clinical
progress and responsiveness to therapy. Continuous, relatively low
maintenance doses are contemplated after an initial higher
therapeutic dose.
[0151] A therapeutically effective amount is an amount of an agent
that is sufficient to produce a statistically significant,
measurable change in immune response (see "Efficacy Measurement"
below). Such effective amounts can be gauged in clinical trials as
well as animal studies for a given agent.
[0152] Agents useful in the methods and compositions described
herein can be administered topically, intravenously (by bolus or
continuous infusion), orally, by inhalation, intraperitoneally,
intramuscularly, subcutaneously, intracavity, and can be delivered
by peristaltic means, if desired, or by other means known by those
skilled in the art. The agent can be administered systemically, if
so desired.
[0153] Therapeutic compositions containing at least one agent can
be conventionally administered in a unit dose. The term "unit dose"
when used in reference to a therapeutic composition refers to
physically discrete units suitable as unitary dosage for the
subject, each unit containing a predetermined quantity of active
material calculated to produce the desired therapeutic effect in
association with the required physiologically acceptable diluent,
i.e., carrier, or vehicle.
[0154] The compositions are administered in a manner compatible
with the dosage formulation, and in a therapeutically effective
amount. The quantity to be administered and timing depends on the
subject to be treated, capacity of the subject's system to utilize
the active ingredient, and degree of therapeutic effect desired. An
agent can be targeted by means of a targeting moiety, such as e.g.,
an antibody or targeted liposome technology. In some embodiments,
an agent can be targeted to a tissue by using bispecific
antibodies, for example produced by chemical linkage of an
anti-ligand antibody (Ab) and an Ab directed toward a specific
target. To avoid the limitations of chemical conjugates, molecular
conjugates of antibodies can be used for production of recombinant
bispecific single-chain Abs directing ligands and/or chimeric
inhibitors at cell surface molecules. The addition of an antibody
to an agent permits the agent to accumulate additively at the
desired target site (e.g., a tumor). Antibody-based or
non-antibody-based targeting moieties can be employed to deliver a
ligand or the inhibitor to a target site. Preferably, a natural
binding agent for an unregulated or disease associated antigen is
used for this purpose.
[0155] Precise amounts of active ingredient required to be
administered depend on the judgment of the practitioner and are
particular to each individual. However, suitable dosage ranges for
systemic application are disclosed herein and depend on the route
of administration. Suitable regimes for administration are also
variable, but are typified by an initial administration followed by
repeated doses at one or more intervals by a subsequent injection
or other administration. Alternatively, continuous intravenous
infusion sufficient to maintain concentrations in the blood in the
ranges specified for in vivo therapies are contemplated.
Pharmaceutical Compositions
[0156] The present disclosure includes, but is not limited to,
therapeutic compositions useful for practicing the therapeutic
methods described herein. Therapeutic compositions contain a
physiologically tolerable carrier together with an active agent as
described herein, dissolved or dispersed therein as an active
ingredient. In a preferred embodiment, the therapeutic composition
is not immunogenic when administered to a mammal or human patient
for therapeutic purposes. As used herein, the terms
"pharmaceutically acceptable", "physiologically tolerable" and
grammatical variations thereof, as they refer to compositions,
carriers, diluents and reagents, are used interchangeably and
represent that the materials are capable of administration to or
upon a mammal without the production of undesirable physiological
effects such as nausea, dizziness, gastric upset and the like. A
pharmaceutically acceptable carrier will not promote the raising of
an immune response to an agent with which it is admixed, unless so
desired. The preparation of a pharmacological composition that
contains active ingredients dissolved or dispersed therein is well
understood in the art and need not be limited based on formulation.
Typically such compositions are prepared as injectable either as
liquid solutions or suspensions, however, solid forms suitable for
solution, or suspensions, in liquid prior to use can also be
prepared. The preparation can also be emulsified or presented as a
liposome composition. The active ingredient can be mixed with
excipients which are pharmaceutically acceptable and compatible
with the active ingredient and in amounts suitable for use in the
therapeutic methods described herein. Suitable excipients include,
for example, water, saline, dextrose, glycerol, ethanol or the like
and combinations thereof. In addition, if desired, the composition
can contain minor amounts of auxiliary substances such as wetting
or emulsifying agents, pH buffering agents and the like which
enhance the effectiveness of the active ingredient. The therapeutic
composition of the present invention can include pharmaceutically
acceptable salts of the components therein. Pharmaceutically
acceptable salts include the acid addition salts (formed with the
free amino groups of the polypeptide) that are formed with
inorganic acids such as, for example, hydrochloric or phosphoric
acids, or such organic acids as acetic, tartaric, mandelic and the
like. Salts formed with the free carboxyl groups can also be
derived from inorganic bases such as, for example, sodium,
potassium, ammonium, calcium or ferric hydroxides, and such organic
bases as isopropylamine, trimethylamine, 2-ethylamino ethanol,
histidine, procaine and the like. Physiologically tolerable
carriers are well known in the art. Exemplary liquid carriers are
sterile aqueous solutions that contain no materials in addition to
the active ingredients and water, or contain a buffer such as
sodium phosphate at physiological pH value, physiological saline or
both, such as phosphate-buffered saline. Still further, aqueous
carriers can contain more than one buffer salt, as well as salts
such as sodium and potassium chlorides, dextrose, polyethylene
glycol and other solutes. Liquid compositions can also contain
liquid phases in addition to and to the exclusion of water.
Exemplary of such additional liquid phases are glycerin, vegetable
oils such as cottonseed oil, and water-oil emulsions. The amount of
an active agent used in the methods described herein that will be
effective in the treatment of a particular disorder or condition
will depend on the nature of the disorder or condition, and can be
determined by standard clinical techniques.
Efficacy Measurement
[0157] The efficacy of a given treatment for a cancer (including,
but not limited to, leukemia) can be determined by the skilled
clinician. However, a treatment is considered "effective
treatment," as the term is used herein, if any one or all of the
signs or symptoms of the cancer is/are altered in a beneficial
manner, or other clinically accepted symptoms or markers of disease
are improved, or ameliorated, e.g., by at least 10% following
treatment with an agent that comprises an inhibitor that binds a
member of the CAF-1 complex, Sumo2, or Nutd21. Efficacy can also be
measured by failure of an individual to worsen as assessed by
stabilization of the disease, or the need for medical interventions
(i.e., progression of the disease is halted or at least slowed).
Methods of measuring these indicators are known to those of skill
in the art and/or described herein. Treatment includes any
treatment of a disease in an individual or an animal (some
non-limiting examples include a human, or a mammal) and includes:
(1) inhibiting the disease, e.g., arresting, or slowing progression
of the cancer; or (2) relieving the disease, e.g., causing
regression of symptoms; and (3) preventing or reducing the
likelihood of the development of the disease, or preventing
secondary diseases/disorders associated with the cancer (e.g.,
cancer metastasis).
[0158] An effective amount for the treatment of a disease means
that amount which, when administered to a mammal in need thereof,
is sufficient to result in effective treatment as that term is
defined herein, for that disease. Efficacy of an agent can be
determined by assessing physical indicators of the disease, such as
e.g., pain, tumor size, tumor growth rate, blood cell count,
etc.
Kits
[0159] Also provided herein are kits for inducing cellular
reprogramming. At a minimum, the kit(s) described herein comprise
at least one inhibitor of the CAF-1 complex, Sumo2, or Nutd21. In
one embodiment, the inhibitor comprises an inhibitor of Chaf1a
and/or Chaf1b. The inhibitor can be an RNA interference agent, an
antibody or antigen binding agent, a small molecule, an aptamer, an
antisense molecule, a dominant negative etc. The kit can comprise a
single vial of the inhibitor or can comprise individual aliquots
(e.g., a unit dose).
[0160] In some embodiments, the kits comprise at least two
inhibitors, at least 3, at least 4, at least 5 or more. In some
embodiments, the plurality of inhibitors are packaged in separate
vials. In other embodiments, the plurality of inhibitors are
formulated together as a cocktail.
[0161] The kit may also comprise components for inducing cellular
reprogramming, such as at least one virus, plasmid or vector
comprising a nucleic acid sequence encoding a reprogramming factor
(e.g., Oct4, Sox2, Klf4, c-Myc, Lin-28, Nanog, etc.). In some
embodiments, the kit comprises one or more agents known to enhance
efficiency of reprogramming. In some embodiments, the kit further
comprises cell growth media and/or reprogramming media.
[0162] In some embodiments, the kit comprises primers for detecting
cell surface markers on reprogrammed cells.
[0163] The kit will typically be provided with its various elements
included in one package, e.g., a fiber-based, e.g., a cardboard, or
polymeric, e.g., a Styrofoam box. The enclosure can be configured
so as to maintain a temperature differential between the interior
and the exterior, e.g., it can provide insulating properties to
keep the reagents at a preselected temperature for a preselected
time. Instructions for use of the components of the kit is packaged
therein.
[0164] The present invention may be as defined in any one of the
following numbered paragraphs or in any combination of the
following numbered paragraphs.
[0165] 1. A method for performing cellular reprogramming, the
method comprising:
[0166] (a) contacting a somatic cell with an inhibitor of the CAF-1
complex, Nudt21, or Sumo2, and (b) subjecting the somatic cell to a
reprogramming protocol, thereby reprogramming the somatic cell to
an induced pluripotent stem cell (iPSC).
[0167] 2. The method of paragraph 1, wherein the speed and/or
efficiency of cellular reprogramming to iPSCs is increased in the
presence of the inhibitor as compared to the speed and/or
efficiency of cellular reprogramming performed in the absence of
the inhibitor.
[0168] 3. The method of paragraph 1 or 2, wherein the measure of
efficiency of cellular reprogramming comprises an increase in the
total number of reprogrammed cells relative to reprogramming in the
absence of a the inhibitor.
[0169] 4. The method of paragraph 1, 2 or 3, wherein the measure of
speed of cellular reprogramming comprises the appearance of
reprogrammed cells at an earlier time point than occurs when
reprogramming in the absence of the inhibitor.
[0170] 5. The method of any one of paragraphs 1-4, wherein the
inhibitor comprises an RNA interference molecule or an
antibody.
[0171] 6. The method of any one of paragraphs 1-5, wherein the RNA
interference molecule comprises an siRNA or an shRNA.
[0172] 7. The method of any one of paragraphs 1-6, wherein step (a)
is performed before or during step (b).
[0173] 8. The method of any one of paragraphs 1-7, wherein the
reprogramming of step (b) comprises induction of
Oct-4/Klf4/Sox-2/c-Myc (OKSM) expression.
[0174] 9. The method of any one of paragraphs 1-8, wherein the
reprogramming step does not comprise forced expression of
c-Myc.
[0175] 10. The method of any one of paragraphs 1-9, wherein the
somatic cell comprises a fibroblast.
[0176] 11. The method of any one of paragraphs 1-10, wherein the
inhibitor of the CAF-1 complex inhibits the Chaf1a and/or Chaf1b
subunit of the complex.
[0177] 12. A method of inducing differentiation of a cancer cell or
cancer stem cell in vivo, the method comprising: administering an
inhibitor of the CAF-1 complex to a subject having, or suspected of
having cancer, thereby inducing differentiation of the cancer cell
or cancer stem cell in vivo.
[0178] 13. The method of paragraph 12, wherein the cancer comprises
leukemia.
[0179] 14. The method of paragraph 12 or 13, wherein the inhibitor
comprises an RNA interference molecule or an antibody.
[0180] 15. The method of paragraph 12, 13, or 14, wherein the RNA
interference molecule comprises an siRNA or an shRNA.
[0181] 16. The method of any one of paragraphs 12-15, wherein the
inhibitor inhibits the Chaf1a and/or Chaf1b subunit of the CAF-1
complex.
[0182] 17. A composition comprising: one or more inhibitors of the
CAF-1 complex, Nudt21, or Sumo2 and a pharmaceutically acceptable
carrier.
[0183] 18. The composition of paragraph 17, comprising inhibitors
of any two or all of the CAF-1 complex, Nudt21 and Sumo2.
[0184] 19. A composition for use in cellular reprogramming, the
composition comprising an inhibitor of the CAF-1 complex, Nudt21,
or Sumo2.
[0185] 20. The composition for use of paragraph 19, further
comprising a pharmaceutically acceptable carrier.
[0186] 21. The composition for use of paragraph 19 or 20, wherein
the inhibitor increases the total number of reprogrammed cells
relative to reprogramming in the absence of a the inhibitor.
[0187] 22. The composition for use of paragraph 19, 20 or 21,
wherein the inhibitor promotes the appearance of reprogrammed cells
at an earlier time point than occurs when cells are reprogrammed in
the absence of the inhibitor.
[0188] 23. The composition for use of any one of paragraphs 19-22,
wherein the inhibitor comprises an RNA interference molecule or an
antibody.
[0189] 24. The composition for use of any one of paragraphs 19-23,
wherein the RNA interference molecule comprises an siRNA or an
shRNA.
[0190] 25. The composition for use of any one of paragraphs 19-24,
wherein cellular reprogramming comprises induction of
Oct-4/Klf4/Sox-2/c-Myc (OKSM) expression.
[0191] 26. The composition for use of any one of paragraphs 19-25,
wherein cellular reprogramming does not comprise forced expression
of c-Myc.
[0192] 27. The composition for use of any one of paragraphs 19-26,
wherein cellular reprogramming comprises reprogramming of a
fibroblast.
[0193] 28. The composition for use of any one of paragraphs 19-27,
wherein the inhibitor of the CAF-1 complex inhibits the Chaf1a
and/or Chaf1b subunit of the complex.
[0194] 29. Use of an inhibitor of the CAF-1 complex, Nudt21, or
Sumo2 for cellular reprogramming.
[0195] 30. The use of paragraph 29, wherein the inhibitor increases
the speed and/or efficiency of cellular reprogramming.
[0196] 31. The use of paragraph 29 or 30, wherein the inhibitor
comprises an RNA interference molecule or an antibody.
[0197] 32. The use of paragraph 29, 30 or 31, wherein the RNA
interference molecule comprises an siRNA or an shRNA.
[0198] 33. The use of any one of paragraphs 29-32, wherein cellular
reprogramming comprises induction of Oct-4/Klf4/Sox-2/c-Myc (OKSM)
expression.
[0199] 34. The use of any one of paragraphs 29-33, wherein cellular
reprogramming does not comprise forced expression of c-Myc.
[0200] 35. The use of any one of paragraphs 29-34, wherein cellular
reprogramming comprises reprogramming of a fibroblast.
[0201] 36. The use of any one of paragraphs 29-35, wherein the
inhibitor of the CAF-1 complex inhibits the Chaf1a and/or Chaf1b
subunit of the complex.
[0202] 37. A composition for use in the treatment of cancer, the
composition comprising an inhibitor of the CAF-1 complex.
[0203] 38. The composition for use of paragraph 37, wherein the
composition induces the differentiation of a cancer cell or cancer
stem cell in vivo when administered to an individual having
cancer.
[0204] 39. The composition for use of paragraph 37 or 38, further
comprising a pharmaceutically acceptable carrier.
[0205] 40. The composition for use of paragraph 37, 38, or 39,
wherein the inhibitor comprises an RNA interference molecule or an
antibody.
[0206] 41. The composition for use of any one of paragraphs 37-40,
wherein the RNA interference molecule comprises an siRNA or an
shRNA.
[0207] 42. The composition for use of any one of paragraphs 37-41,
wherein the cancer comprises a leukemia.
[0208] 43. The composition for use of any one of paragraphs 37-42,
wherein the inhibitor inhibits the Chaf1a and/or Chaf1b subunit of
the CAF-1 complex.
[0209] 44. Use of an inhibitor of the CAF-1 complex for the
treatment of cancer, the use comprising administering the inhibitor
of the CAF-1 complex to an individual having cancer.
[0210] 45. The use of paragraph 44, wherein the administering
induces the differentiation of a cancer cell or cancer stem cell,
thereby treating the cancer.
[0211] 46. The use of paragraph 44 or 45, wherein the inhibitor
comprises an RNA interference molecule or an antibody.
[0212] 47. The use of paragraph 44, 45, or 46, wherein the RNA
interference molecule comprises an siRNA or an shRNA.
[0213] 48. The use of any one of paragraphs 44-47, wherein the
cancer comprises a leukemia.
[0214] 49. The use of any one of paragraphs 44-48, wherein the
inhibitor inhibits the Chaf1a and/or Chaf1b subunit of the CAF-1
complex.
[0215] 50. A method for performing cellular transdifferentiation,
the method comprising: (a) contacting a somatic cell with an
inhibitor of the CAF-1 complex, and (b) subjecting the somatic cell
to a transdifferentiation protocol, thereby transdifferentiating
the somatic cell to a different cell type.
[0216] 51. The method of paragraph 50, wherein the speed and/or
efficiency of cellular transdifferentiation is increased in the
presence of the inhibitor as compared to the speed and/or
efficiency of cellular reprogramming performed in the absence of
the inhibitor.
[0217] 52. The method of paragraph 50 or 51, wherein the measure of
efficiency of cellular transdifferentiation comprises an increase
in the total number of transdifferentiated cells relative to
transdifferentiation in the absence of a said inhibitor.
[0218] 53. The method of paragraph 50, 51, or 52, wherein the
measure of speed of cellular transdifferentiation comprises the
appearance of transdifferentiated cells at an earlier time point
than occurs when cells are transdifferentiated in the absence of
said inhibitor.
[0219] 54. The method of any one of paragraphs 50-53, wherein the
inhibitor comprises an RNA interference molecule or an
antibody.
[0220] 55. The method of any one of paragraphs 50-54, wherein the
RNA interference molecule comprises an siRNA or an shRNA.
[0221] 56. The method of any one of paragraphs 50-55, wherein step
(a) is performed before or during step (b).
[0222] 57. The method of any one of paragraphs 50-56, wherein the
transdifferentiation of step (b) comprises transdifferentiation of
a fibroblast to a neuron or transdifferentiation of a B-cell to a
macrophage.
[0223] 58. The method of any one of paragraphs 50-57, wherein
transdifferentiation of a fibroblast to a neuron comprises
overexpression of the transcription factor Ascl1 in a
fibroblast.
[0224] 59. The method of any one of paragraphs 50-58, wherein
transdifferentiation of a B-cell to a macrophage comprises
overexpression of the myeloid transcription factor C/EBP.alpha. in
a B-cell.
[0225] 60. The method of any one of paragraphs 50-59, wherein the
inhibitor of the CAF-1 complex inhibits the Chaf1a and/or Chaf1b
subunit of said complex.
EXAMPLES
Example 1: Sumo2 and Nutd21 as Roadblocks to Reprogramming
[0226] The goal of this study was to identify novel, potent
roadblocks to reprogramming by performing a serial genome-wide
shRNA enrichment screen in combination with a well-defined
transgenic reprogramming system. Unexpectedly, this screening
strategy uncovered two post-transcriptional mechanisms, protein
sumoylation and alternative polyadenylation, as strong repressors
of iPSC formation.
Serial shRNA Screen for Roadblocks to Reprogramming
[0227] To identify roadblocks to iPSC formation in an unbiased
manner, the inventors combined a well-defined transgenic
reprogramming system with a genome-wide shRNA library targeting
27,478 genes with 62,877 hairpins. The inventors utilized murine
embryonic fibroblasts (MEFs) carrying a doxycycline (dox)-inducible
polycistronic cassette encompassing the open reading frames for
Oct4, Klf4, Sox2 and c-Myc (OKSM) in the Col1a1 locus, the M2-rtTA
transactivator in the Rosa26 locus and an EGFP reporter in the
endogenous Pou5f1 (Oct4) locus (Stadtfeld et al., 2010). These
transgenic MEFs are referred to herein as "reprogrammable cells"
and the genotype as "Col1a1-tetOP-OKSM; R26-M2rtTA; Oct4-GFP". The
shRNA library was generated by cloning shRNAs into the pHAGE-Mir
lentiviral vector carrying a puromycin resistance gene and an tRFP
reporter (Plank et al., 2013). Transduction of reprogrammable MEFs
with an identical empty vector gave rise to Oct4-GFP+, tRFP+ iPSC
colonies upon exposure to dox, albeit at slightly lower frequencies
than uninfected cells (FIGS. 1A, 1B and data not shown),
demonstrating the feasibility of a screen to identify roadblocks to
iPSC generation using this lentiviral shRNA vector system.
[0228] To identify shRNAs that potently enhance reprogramming with
low background signal from passenger shRNAs, pooled screening
strategy using serial enrichment of hairpin libraries was devised.
Briefly, the inventors infected reprogrammable MEFs with the pooled
shRNA library 2 days before dox induction to ensure effective
suppression of targets prior to initiation of reprogramming. After
10 days of OKSM expression, dox was withdrawn for 4 days to select
for stably reprogrammed, transgene-independent colonies, followed
by purification of emerging Oct4-GFP+ cells by flow cytometry (FIG.
1C). Enriched hairpins were amplified by PCR from genomic DNA and
subsequently re-cloned into the original viral backbone before
initiating another round of viral transduction and reprogramming
(FIG. 1D). In total, between 3 and 5 rounds of shRNA enrichment and
iPSC generation were performed (FIG. 1E). Parallel cultures of
reprogrammable MEFs were exposed to dox alone or transduced with
the viral library in the absence of dox before extracting genomic
DNA (FIG. 1C and FIG. 6); these samples served as controls for
possible passenger hairpins that became passively enriched in
expanding iPSC colonies or hairpins that merely affected the growth
of non-induced reprogrammable MEFs. Library representation was
determined in all samples by deep (Solexa.TM.) sequencing of
genomic DNA. To identify potential hits, the inventors utilized a
set of criteria based on absolute shRNA sequence reads and shRNA
enrichment scores between experimental and control samples (FIG.
6).
Nudt21 and Sumo2 Emerge as Top Candidate Roadblocks to
Reprogramming
[0229] The inventors observed a steep drop in library complexity
(i.e., the number of unique shRNAs detected by Solexa.TM.
sequencing) after the first round of reprogramming but a more
gradual decline in subsequent rounds (FIG. 1F, left panel).
Critically, shRNA libraries prepared from rounds 1-3 enhanced the
formation of iPSCs compared to uninfected controls, indicating a
progressive enrichment of functional hairpins that promoted
reprogramming (FIG. 1F, right panel). The inventors next determined
candidate hairpins that may promote reprogramming based on (i)
their enrichment across all libraries relative to controls and (ii)
absolute shRNA sequence representation per library (FIG. 6). To
validate candidates, the inventors recovered multiple top-scoring
shRNAs by PCR from enriched shRNA libraries, subcloned hairpins
into the pHAGE-Mir vector and infected reprogrammable cells
individually with these constructs or a control shRNA vector
targeting Firefly luciferase. FIG. 1G depicts the enrichment of 26
selected candidate shRNAs across 3 rounds of screening. Of these
shRNAs, 3 hairpins enhanced iPSC formation more than 2-fold
(Nudt21, Eif2a, Izumo4) in initial validation experiments with
Nudt21 showing the strongest effect (FIG. 1H).
[0230] To obtain a better coverage of the library and to minimize
the loss of potentially functional hairpins during the first round
of reprogramming, the serial screen was repeated with a higher
number of starting cells and 2 additional rounds of reprogramming
and shRNA enrichment. This modification of the protocol indeed
resulted in a more gradual reduction of library complexity after
the first round of reprogramming and a concomitant enrichment of
hundreds of hairpins that enhanced iPSC formation as a pool (FIG.
1I). Analysis of shRNAs that were consistently enriched across all
5 rounds of reprogramming using two different algorithms revealed
several additional candidate barriers to reprogramming such as
Fgf5, Dnmt3a, Smpd13a and Sumo2 (FIG. 1J). Of 27 validated shRNAs,
7 showed a more than 2-fold increase in iPSC formation (Gstt4,
Gm719, Sqrd1, Dnmt3a, BTBD10, Smpd3a, Sumo2) (FIG. 1K) with Sumo2
shRNA exhibiting the strongest phenotype. Given the prominent
effects on reprogramming of shRNAs targeting Nudt21 from the first
screen and Sumo2 from the second screen, the inventors focused on
these genes for the remainder of the study.
[0231] Nudt21 (nucleoside diphosphate linked moiety X-type motif
21; also termed Cpsf5 or Cfim25) is part of the cleavage factor
involved in 3' RNA cleavage and polyadenylation processing (Di
Giammartino et al., 2011) while Sumo2 (small ubiquitin-like
modifier 2) plays an important role in lysine sumoylation of
proteins (Hickey et al., 2012).
Suppression of Nudt21 or Sumo2 Promotes Pluripotency Gene
Activation in Nascent iPSCs without Compromising Growth or
Pluripotency
[0232] Using more quantitative reprogramming assays, the inventors
found that suppression of either Sumo2 or Nudt21 increased the
number of transgene-independent alkaline phosphatase-positive (AP+)
iPSC-like colonies up to 15-fold and the fraction of Oct4-GFP+
cells up to 25-fold (50% with Nudt21 shRNA; 16% with Sumo2 shRNA;
2% with control shRNA at day 8) (FIGS. 2A, 2B). The inventors were
able to recapitulate enhanced reprogramming with 4-6 independent
shRNAs as well as siRNA pools targeting Nudt21 and Sumo2,
documenting the consistency of the observed phenotype using either
permanent or transient knockdown approaches. (FIGS. 2C, 2D and FIG.
7). Importantly, suppression of Sumo2 and Nudt21 led to reduced
transcript and protein levels of either factor, demonstrating the
specificity of knockdown (FIG. 2E, 2F and FIG. 8). Moreover, iPSC
generated with these shRNAs could be stably propagated over many
passages and gave rise to well-differentiated teratomas,
documenting that suppression of Sumo2 or Nudt21 does not compromise
the self-renewal or pluripotency of iPSCs. It is noteworthy that
endogenous Nudt21 and Sumo2 mRNA levels were comparable between
MEFs and iPSCs and barely changed during the reprogramming process,
indicating that these factors are important in both somatic and
pluripotent cell types (FIG. 2G).
[0233] To complement the aforementioned marker-based assays of
reprogramming with a functional assay, it was determined whether
suppression of Sumo2 or Nudt21 could promote the formation of
transgene-independent iPSC colonies after short pulses of OKSM
expression (FIG. 2H). Consistent with AP and Oct4-GFP-based assays,
it was found that knockdown of either molecule yielded
transgene-independent iPSC colonies after only 5 days of OKSM
expression, whereas stable iPSC colonies only emerged by day 8 in
controls (FIG. 2I). In agreement with this observation, the
inventors detected transcriptional upregulation of key
ESC-associated genes (e.g., Epcam, Cdh1 and Sal14) and epigenetic
regulators (e.g., Dnmt3b and Tet1) exclusively in cells expressing
OKSM and either Nudt21 or Sumo2 shRNAs at day 6 of reprogramming
(FIG. 2J). Critically, knockdown of neither molecule had a
discernible effect on cell proliferation or apoptosis of bulk
cultures, thus excluding the possibility that the observed
phenotypes are due to accelerated growth or reduced cell death.
Together, these results demonstrate that transient or constitutive
suppression of Sumo2 and Nudt21 markedly enhances and accelerates
the formation of iPSCs from somatic cells.
Nudt21 and Sumo2 Suppression Act During Early-to-Mid Stages of
Reprogramming
[0234] In order to understand how Sumo2 and Nudt21 suppression
influences the dynamics of iPSC formation, surface markers and a
reporter allele were utilized to distinguish between early, mid and
late stages of reprogramming. The inventors previously showed that
cells undergoing successful reprogramming initially upregulate
SSEA1 (early stage), followed by sequential activation of EpCAM
(mid stage) and Oct4-GFP (late stage) (Polo et al., 2012).
Remarkably, Nudt21 suppression showed a noticeable increase in the
fraction of SSEA1+ and EpCAM+ cells relative to controls as early
as day 3 of reprogramming (14% vs. 6% for SSEA1; 19% vs. 1% for
EpCAM)(FIGS. 3A, 3B). This trend continued at later stages of iPSC
formation when 56% EpCAM+ cells were detectable by day 5 (8% in
controls) and 49% Oct4-GFP+ cells by day 8 (2% in controls). In
contrast, Sumo2 depletion had no pronounced effects on the earliest
intermediates of reprogramming, as shown by comparable fractions of
SSEA1+ and EpCAM+ cells at day 3 relative to controls (5% vs. 6%
for SSEA1; 4% vs. 1% for EpCAM)(FIG. 3A, 3B). However, the
inventors observed a 3-fold increase in the fraction of SSEA1+
cells and a 5-fold increase in the fraction of EpCAM+ cells by day
5 as well as an 8-fold increase in the fraction of Oct4-GFP+ cells
by day 8 of reprogramming. A relative comparison of SSEA1+, EpCAM+
and Oct4-GFP+ cells between virally transduced (tRFP+) and
untransduced (tRFP-) reprogrammable cells confirmed these
observations and further demonstrated that the enhancing effect of
Sumo2 and Nudt21 suppression on iPSC generation is cell-autonomous
(FIG. 3C).
[0235] To functionally corroborate the notion that Sumo2 and Nudt21
are required during early-to-mid stages of reprogramming, the
inventors determined iPSC colony formation efficiencies after
transfecting reprogrammable MEFs with siRNAs against Sumo2 or
Nudt21 either once (on day 0) or twice (on day 0 and day 3)(FIGS.
3D, 3E). iPSC colony formation was essentially the same when Sumo2
or Nudt21 were suppressed initially or continuously during a 6-day
reprogramming period. Collectively, these phenotypic and functional
assays indicate that Nudt21 suppression promotes very early stages
while Sumo2 suppression promotes early-to-mid stages of
reprogramming, ultimately leading to a dramatic increase in the
formation of Oct4+ transgene-independent iPSCs.
Nudt21 and Sumo2 Suppression Act Independently of c-Myc Expression
and in Parallel with Small Molecule Enhancers of Reprogramming
[0236] It was next investigated whether exogenous c-Myc expression
was required for the enhancement of iPSC formation by Sumo2 shRNAs
and Nudt21 shRNAs, as was previously observed for Mbd3 depletion
(Rais et al., 2013). To this end, reprogrammable MEFs were derived
from mice carrying the Col1a1-tetOP-OKS-mCherry allele (lacking the
c-Myc transgene) in combination with the R26-M2rtTA allele (FIG.
4A). Exposure of these MEFs to dox alone gave rise to extremely
few, if any, AP+ colonies after 9-21 days of OKSM expression, and
no Oct4-GFP positive cells could be detected by day 9 of
reprogramming (FIGS. 4B-4D). In stark contrast, depletion of Sumo2
or Nudt21 in these cells using transient transfection of siRNA
pools readily yielded iPSC colonies and stable Oct4-GFP+ cells by
flow cytometry after as little as 9 days of OKSM expression. It was
concluded that suppression of Nudt21 or Sumo2 enhances
reprogramming independently of exogenous c-Myc expression, thus
enabling iPSC formation from cells under conditions that bypass the
use of this potent oncogene.
[0237] To determine whether Nudt21 and Sumo2 suppression act in
parallel with small molecules that were previously shown to enhance
reprogramming, the inventors treated reprogrammable cells harboring
shRNAs against Sumo2, Nudt21 or Firefly luciferase with doxycycline
in the presence or absence of ascorbic acid (AA)(Esteban et al.,
2010), a Dot11 inhibitor (Dot11i)(Onder et al., 2012) and a Gsk3
inhibitor (Gsk3i)(Silva et al., 2008)(FIG. 4E). Consistent with
previous reports, it was found that exposure of reprogrammable
cells to each of these compounds significantly enhanced the
generation of AP+ iPSC colonies, with combined ascorbate/GSK3
inhibitor treatment (AGi) exhibiting the strongest effect.
Strikingly, Nudt21 suppression alone was as effective as AGi
treatment while Sumo2 depletion alone even surpassed the effect of
AGi on AP+ colony formation (FIG. 4E). Moreover, suppression of
either Sumo2 or Nudt21 further enhanced iPSC formation in the
presence of ascorbate, Gsk3i or Dot11i (FIG. 4F). These results
underscore the strong effects of individual Nudt21 and Sumo2
suppression on the reprogramming process and indicate that the
sumoylation and polyadenylation pathways may act in parallel to
previously described mediators of iPSC formation including ascorbic
acid, H3K79 methylation and Gsk3 signaling.
Generation of iPSCs after as Little as 36-48 Hours of OKSM
Expression
[0238] Given the additive effect of Nudt21 and Sumo2 suppression
with small molecule enhancers of reprogramming, the inventors
tested whether this combination treatment would allow them to
further reduce the minimal time period of OKSM expression required
to produce stable transgene-independent iPSCs. Early passage
reprogrammable MEFs (passage 2) carrying two copies each of the
Col1a1-tetOP-OKSM and R26-M2rtTA alleles were used to achieve
optimal reprogramming efficiencies. MEFs exposed to Dot11i, Gsk3i
and AA required at least 3 days of OKSM expression to produce
dox-independent AP+ iPSCs, which is faster than any previously
reported protocol. Remarkably, suppression of either Nudt21 or
Sumo2 further reduced this time window to 36 h using Sumo2 shRNAs
and 48 h using Nudt21 shRNAs (FIGS. 5A-5C). Emerging iPSC colonies
activated the endogenous Oct4-GFP reporter, expressed Nanog and
Sox2, gave rise to well-differentiated teratomas and supported the
formation of coat-color chimeras, indicating that these are
authentic iPSCs (FIGS. 5C-5F). These results show that 1-2 days of
OKSM expression are sufficient to produce stable, pluripotent iPSCs
when either Nudt21 or Sumo2 expression is transiently
suppressed.
[0239] The inventors identified Sumo2 and Nudt21 as novel
roadblocks to iPSC generation by combining a well-defined
transgenic reprogramming system with a genome-wide shRNA screening
approach. In contrast to recent shRNA or siRNA screens conducted
during iPSC formation, the inventors employed a serial shRNA
enrichment strategy, which may reduce the number of false positive
hits and allow for selection of shRNAs with a stronger phenotype.
Indeed, suppression of the top candidates, Sumo2 and Nudt21,
markedly enhanced and accelerated iPSC formation compared to
individual hits that emerged from previous large-scale screens or
candidates that were selected based on gene expression differences
between somatic and pluripotent cells. In agreement with this
notion, the expression of Sumo2 and Nudt21 did not dramatically
change during reprogramming. To the inventors' knowledge, OKSM
expression for 36-48 hours represents the shortest time period that
has been reported to generate authentic iPSCs from differentiated
cells. In addition to Sumo2 and Nudt21, this screen uncovered a
number of other candidate barriers to iPSC formation, which provide
a rich resource for future mechanistic studies of the reprogramming
process.
[0240] Both Nudt21 and Sumo2 affect post-transcriptional
mechanisms, i.e., alternative polyadenylation (APA)(Di Giammartino
et al., 2011) and lysine sumoylation (Hickey et al., 2012), which
have not previously been recognized as roadblocks to reprogramming.
While these data indicate that both proteins function during
early-to-mid stages of reprogramming in a Myc-independent manner,
the precise molecular mechanisms by which each factor suppresses
iPSC formation remains to be elucidated. Nudt21 reportedly
suppresses the switch from distal to proximal polyadenylation sites
in glioblastoma cells, leading to increased expression of
transcripts involved in cellular proliferation and tumorigenicity
(Masamha et al., 2014). Of interest, a global switch from distal to
proximal polyadenylation sites has also been observed during
cellular reprogramming of MEFs into iPSCs (Ji and Tian, 2009), thus
pointing to intriguing parallels between reprogramming and cancer
and providing a potential mechanism by which Nudt21 may enhance
iPSC generation. Without wishing to be bound by theory, the
inventors surmise that Nudt21 promotes the silencing of somatic
transcripts harboring distal APA sites and the expression of
pluripotency-associated transcripts harboring proximal APA sites.
It should be informative to follow dynamic changes in APA usage
during reprogramming in the presence and absence of Nudt21 to test
this hypothesis.
[0241] The present findings have practical implications for basic
science and cell therapy. The ease with which Sumo2 and Nudt21 can
be inhibited using transient siRNA delivery can facilitate the
mechanistic dissection of the reprogramming process in more
homogeneous cell cultures. The observation that Sumo2 and Nudt21
depletion cooperate with small molecule enhancers of reprogramming
but do not require exogenous c-Myc expression can further
facilitate the efficient and safe generation of patient-specific
iPSCs from rare donor cells.
Methods and Materials
Tissue Culture and Virus Production
[0242] Reprogrammable Mouse Embryonic Fibroblasts (repMEF) were
derived from day E13.5-15.5 mouse embryos carrying the
Col1a1-tetOP-OKSM and Rosa26-M2rtTA alleles (Stadtfeld et al.,
2010). MEFs with a Col1a1-tetOP-OKS-mCherry allele were used in
some experiments (Bar-Nur et al., 2014). Reprogramming was
initiated in RepMEFs by adding 20 ng/ml doxycyline (dox) and, where
indicated, 25 ug/ml L-Ascorbic acid (Sigma.TM. A4544-25G), 3 uM
GSK3 inhibitor (CHIR99021, Stemgent.TM. or Tocris.TM.), Alk5
inhibitor (RepSox, R0158, Sigma-Aldrich.TM.), 1 uM MEK inhibitor
(PD0325901, Stemgent.TM.) or Dot11 inhibitor. RepMEFs were
typically expanded under hypoxic (4% oxygen) conditions until dox
induction. MEFs were infected with shRNA vectors at passage 4
unless noted otherwise, allowed to recover for 48-60 hours,
harvested, counted and seeded at a density of 20K cells per well of
a 6-well plate. Media was changed every 2 to 3 days. Dox was
withdrawn by removing media, washing with 1.times.PBS, and
continuing culture in ESC media (Knockout DMEM, 1,000 U/ml LIF, 20%
FBS). For phage or GipZ virus preparation, 293T cells were seeded
and transfected at 50% confluency with PEI (Polyethylenimine) and
DNA (vector+psPax2 and pDM2.G) at a ratio of 3:1 in Optimem.TM.
media (Life Technologies.TM.). After 24 hours, supernatant was
collected through a 0.4 um filter and mixed 3:1 with fresh MEF
media and polybrene (10 ug/ml) for direct infection or precipitated
with PEG (Polyethylglycol) and kept at -80 C for later infections.
Viral transductions were performed by spin infection for 30 minutes
at 2,150 rpm at room temperature. Fresh media was added .about.16
hours after infections.
siRNA Transfections
[0243] Transfections of RepMEFs with siRNAs were performed in
12-well plates at the time of dox administration. Per 12-well
plate, 2 ul of Lipofectamine.TM. 2000 was added to 75 ul of
Optimem.TM. (Life Technologies.TM.) and 1.5 ul of siRNA (esiRNA,
Sigma.TM.) was added to 75 ul of Optimem.TM.; both mixtures were
separately incubated at room temperature for 5 minutes, then
combined and incubated for another 15 minutes before adding the
solution to the reprogramming media (normal media lacking
antibiotics). After overnight incubation, the transfection media
was replaced with regular reprogramming media.
Flow Cytometry
[0244] To determine viral infection efficiency and cell numbers
before initiation of reprogramming, infected MEFs were harvested
using 0.25% trypsin-EDTA (Life Technologies.TM.) and kept at
4.degree. C. A small aliquot was analyzed on the MACSQuant
cytometer to determine the number of cells/ml and the percentage of
tRFP+ cells. To prepare growth curves, 3 replicates were harvested
at each time point to measure cell counts (DAPI-negative live
cells). Intermediates of reprogramming were analyzed by staining
with Thy1-Viogreen (BD.TM.), SSEA1-APC (Biolegend.TM.),
SSEA1-PE-Cy7 (Miltenyi Biotec.TM.), and/or Epcam-PE-Cy7
(eBioscience.TM.) (1:200 for 30 min at 4.degree. C.). To measure
the fraction of dying cells, BD.TM.'s Annexin V kit was used
according to manufacturers' instructions. All cytometry data was
analyzed and plotted using FlowJo software. Fluorescence-activated
cell sorting (FACS) was performed by harvesting cells with
Trypsin-EDTA (Gibco.TM.) before resuspending cells in MEF media and
subsequent filtration through 100 um and 40 um filters. For
isolation of Oct4-GFP+ iPSCs, SSEA1+ cells were enriched by
labeling with SSEA1 antibody coated magnetic beads and MACS
sorting. The positive fraction was then purified for Oct4-GFP+
cells by FACS. For analyses of pre-MACS and post-MACS samples,
aliquots were stained using Thy1-Pacific Blue (eBioscience.TM.) and
SSEA1-APC (Biolegend.TM.) antibodies, 1:200 in 1% FBS:PBS, 30 min
at 4.degree. C. Analysis was done using the FACS Diva software.
Cell Cycle Analysis
[0245] To determine cell cycle dynamics, repMEFs treated with dox
for 48 h were exposed to 20 uM BrdU (Sigma.TM.) for 30 minutes in
regular media, trypsinized and kept on ice in 100 ul 1.times.PBS.
To fix cells, 2 ml of cold EtOH was added dropwise, incubated for
30 minutes, followed by addition of 2 ml 4N HCl and another 30
minutes of incubation. Cells were then spun down at 500 rpm for 5
min. at 4 C and resuspended in 1 ml of 0.1N Na.sub.2B.sub.4O.sub.7,
pH 8.5 and washed with staining buffer (2% FBS and 0.5% Tween 20 in
PBS). Antibody for BrdU (mouse, DAKO M074401-8) was added to cells
for 30 min at room temperature (RT) at a concentration of 5 ug/ml,
followed by 3 washes in 1.times.PBS and incubation with anti-mouse
FITC secondary antibody (BD Biosciences.TM., 55434) for 30 min at
RT at a dilution of 1:100. After 3 additional washes with
1.times.PBS, the pellet was resuspended for analysis in 2% FBS/PBS
containing 5 ug/ml propidium iodide. Resuspension volume was used
to normalize for cell count of each sample. Samples were analyzed
immediately on the MACSQuant cytometer.
Quantification of Reprogramming Efficiencies
[0246] For macroscopic detection of iPSC colonies, Alkaline
Phosphatase (AP) staining was carried out according to
manufacturer's instructions using the Vector Labs.TM. AP staining
kit (#5100). AP staining was always performed 2 to 4 days after dox
withdrawal to eliminate partially reprogrammed colonies and score
for transgene independent iPSCs. Colonies were counted manually or
by custom-made Nikon.TM. software (CL-Quant.TM.).
Teratoma and Chimera Formation
[0247] For teratoma generation, iPSC lines (passage 6 or higher)
were harvested and resuspended in 600 ul media per confluent
6-well. Mice were anesthetized with Avertin and injected with 150
ul cell suspension subcutaneously. Tumors were harvested 3 to 4
weeks after injection and analyzed histologically. For chimera
production, iPSC lines were injected as single cell suspension into
day 3.5 blastocysts isolated from intercrosses of C57Bl/6xBDF1
mice. Blastocysts were transferred into pseudo-pregnant Swiss
Webster recipient animals.
Immunofluorescence Analysis
[0248] iPSC lines (passage 6 or higher) were seeded in a 24-well
plate at a low density. Once small colonies emerged, wells were
washed with 1.times.PBS and fixed by a 5-10 minute incubation in
10% formalin at room temperature. After washes in 1.times.PBS,
cells were blocked in 1.times.PBS containing 2% BSA and 0.1%
Triton-X 100. Primary and secondary antibodies were diluted in
blocking solution at a concentration of 1:200 and added for 1 hour
at RT or overnight at 4 C. Primary antibodies were anti-mouse Nanog
(Abcam.TM.), Sox2 and Oct4 (Santa Cruz.TM.); secondary antibodies
were donkey anti-goat IgG or donkey anti-rabbit IgG Alexa Fluor
546-conjugated antibodies (Life Technologies.TM.) After 2 washes in
1.times.PBS, cells were immobilized on slides in mounting media
containing DAPI (Vectashield.TM., Vector Labs.TM.) and
analyzed.
RNA Expression Analysis
[0249] Total RNA was isolated from repMEFs in triplicates exposed
to dox for 3 or 6 days using the QIAGEN.TM. RNeasy.TM. Mini kit and
sequencing libraries were prepared as described (Shepard et al.,
2011) and sequenced at the Tufts University Genomics core.
Activation of pluripotency-associated genes at day 6 of
reprogramming was determined based on these expression data. For
quantitative PCR analysis, Brilliant III SYBR-green based master
mix was used according to the manual (Agilent.TM.), following RNA
isolation (RNeasy.TM. kit, QIAGEN.TM.) and reverse transcription
(Transcriptor First Strand cDNA Synthesis Kit, Roche.TM.) of
Nudt21, Sumo2, or control knockdown samples two days after
initiation of reprogramming. Samples were run in triplicate on the
Lightcycler 480 (Roche.TM.).
Western Blot Analysis
[0250] Protein lysates were run on 4-20% Mini Protean TGX gels
(Bio-Rad.TM.), blotted onto Immobilon-P membrane (EMD
Millipore.TM.) and stained with anti-Nudt21 (Santa Cruz.TM.),
anti-Sumo2 (Life Technologies.TM.) or anti-Actin (Abcam.TM.)
antibodies.
shRNA Screen and Hits Identification
[0251] RepMEFs were expanded until passage 4 in 4% oxygen, switched
to atmospheric oxygen, and infected with the pooled shRNA library
as described above. For each shRNA (621,000 shRNAs in total),
1-2.times.10.sup.3 cells were infected to achieve good coverage.
Infected cells were passaged onto gelatinized 15 cm cell culture
dishes (Falcon.TM.) in reprogramming media (ESC media supplemented
with ascorbic acid and doxycycline) for 10 days, and in
doxycycline/ascorbic acid-free ESC media for an additional 4 days.
Cells were harvested, pooled, and purified with SSEA1-linked
magnetic beads using an AutoMACS sorter (Miltenyi.TM.).
SSEA1-enriched cells were then FACS-sorted for endogenous Oct4-GFP
expression.
[0252] Genomic DNA was extracted from collected Oct4-GFP+ cells by
lysing the cells in 10 mM Tris pH 8.0, 10 mM EDTA, 10 mM NaCl, 0.5%
Sarkosyl. Lysates were treated with 0.1 mg/ml Rnase A at 37.degree.
C. for 30 min, 0.5 mg/ml Proteinase K at 55.degree. C. for 1-2 hr,
and then phenol chloroform extracted, ethanol precipitated, and
resuspended in 10 mM Tris-HCl pH 8.0. For each sample, all of the
genomic DNA was used as template for shRNA PCR, usually in multiple
PCR reactions. Each 50 .mu.l PCR reaction contained: 2.5 .mu.g
genomic DNA template, 200 uM dNTPs, 400 nM of each PCR primer
(pHAGE-Mir-PCR: 5'-GCAAACTGGGGCACAGATGATGCGG; BC1R L:
5'-CGCCTCCCCTACCCGGTAGA), 1.times. Q5 reaction buffer, 1.times. Q5
high GC buffer, and 0.5 .mu.l Q5 polymerase (NEB.TM.). PCR was
performed with the following program: 94.degree. C. 4 min, 35
cycles of (94.degree. C. 30 sec, 60.degree. C. 30 sec, 72.degree.
C. 45 sec), 72.degree. C. 10 min. PCR products (.about.700 bp) for
each sample were pooled, ethanol precipitated, resuspended, and
gel-purified using the QIAquick.TM. Gel Extraction Kit
(Qiagen.TM.). The purified shRNA PCR products were used to: 1)
generate sublibraries for the next round of shRNA library screens;
2) generate sequencing libraries for Solexa sequencing.
[0253] For sub-library generation, the purified PCR product was
digested with NotI and MluI, and the .about.400 bp fragment that
contains the shRNAs was gel-purified. Separately, the pHAGE-Mir
plasmid was also digested with NotI and MluI to recover the
.about.9 kb vector backbone. 25-50 ng of the purified shRNA
fragment and 125-250 ng of the vector backbone were ligated in 5 ul
ligation reaction using NEB.TM. T4 ligase. 1 ul ligation reaction
was used to transform 20 ul Electromax competent cells DH10b (Life
Technology.TM.) with electroporation. 1 ul of the transformation
reaction was plated on one 10-cm LB-Amp (100 ug/ml) plate to
estimate the total number of colonies, and the rest of the
transformation reaction was plated on two 15-cm LB-Carbenicillin
(100 ug/ml) plates and grown overnight at 37.degree. C. To maintain
the representation of the library, at least 100.times. coverage was
needed (i.e., colony number=100.times.number of shRNAs in the
library). When necessary, the entire ligation reaction may be used
for transformation in multiple electroporation reactions to
increase the number of colonies. The next day, lawn formed on the
two 15-cm plates were scraped off and cultured in 300 ml
LB-Carbenicillin (100 ug/ml) medium and grown at 30.degree. C. for
2-3 hrs. The bacteria was collected and the cloned sub-library DNA
was extracted by the Genelute.TM. Maxiprep kit (Sigma.TM.).
[0254] For Solexa sequencing, the purified shRNA PCR product was
used as template for another round of PCR: 500 ng purified shRNA
PCR product, 200 uM dNTPs, 2 uM of each PCR primer (p5 and p7),
1.times. Q5 reaction buffer, 1.times. Q5 high GC buffer, and 1
.mu.l Q5 polymerase (NEB.TM.) in 100 ul PCR reaction. PCR was
performed with the following program: 94.degree. C. 4 min, 2 cycles
of (94.degree. C. 30 sec, 50.degree. C. 20 sec, 72.degree. C. 30
sec), 20 cycles of (94.degree. C. 30 sec, 60.degree. C. 20 sec,
72.degree. C. 30 sec), 72.degree. C. 10 min. PCR products
(.about.120 bp) were and gel-purified using the QIAquick.TM. Gel
Extraction Kit (Qiagen.TM.). Gel-purified products were submitted
for Solexa.TM. sequencing on the Illumina.TM. MiSeq instrument,
using a custom sequencing primer: mir30-EcoRI:
5'-TAGCCCCTTGAATTCCGAGGCAGTAGGCA
PCR Primers:
TABLE-US-00001 [0255] p5-miSeq:
5'-ATGATACGGCGACCACCGAGATCTACACCTAAAGTAGCCCCTTGAAT TC; p7-miSeq-1:
5'-CAAGCAGAAGACGGCATACGAGACGATAGTGAAGCCACAGATGTA p7-miSeq-2:
5'-CAAGCAGAAGACGGCATACGAGACACTAGTGAAGCCACAGATGTA p7-miSeq-3:
5'-CAAGCAGAAGACGGCATACGAGACTATAGTGAAGCCACAGATGTA p7-miSeq-4:
5'-CAAGCAGAAGACGGCATACGAGACCTTAGTGAAGCCACAGATGTA
[0256] Different p7 primers were used for multiplexing purpose.
[0257] Single-end 51 bp reads were obtained using the Illumina
HiSeq or MiSeq instrument. The reads are expected to have an
initial 22 nucleotides that identify the shRNA, followed by a
constant region that is the same for all shRNAs and a 2 nucleotide
barcode to identify the sample. Reads that contain perfect matches
at the following 6 nucleotides were first extracted from the
sequencing data: the 2 nucleotides adjacent to the initial 22 base
sequence and the 2 nucleotides adjacent to the barcode on both
sides. The shRNAs were then identified by requiring an exact match
of the 22 nucleotides to the sequences in the shRNA library
annotation file. The samples were identified by the 2 nucleotide
barcodes.
[0258] The total number of reads that were identified for each
shRNA, sample, and round were counted. The counts were normalized
to be directly comparable between samples and rounds by first
dividing by the total number of counts for that sample and round
and then multiplying by the total number of shRNAs in the initial
library. A pseudocount of 1 was added to each normalized count to
downweight enrichment derived from low read counts and to avoid
division by zero in calculating fold-changes.
[0259] The enrichment for each shRNA in each round was calculated
as the log 2 fold change of the Oct4-GFP+ normalized counts over
the maximum of the normalized counts of the controls (TO, No-Dox,
and Oct4-GFP-). The cumulative enrichment for each shRNA in each
round was calculated as the sum of the log 2 fold changes for that
round and all previous rounds. The overall enrichment of each shRNA
was defined as the maximum of the cumulative enrichment scores
among all rounds.
[0260] The heat map for FIG. 1J was plotted using the cumulative
enrichment scores. Only shRNAs that have at least one read in the
Oct4-GFP+ sample in at least two rounds were used in the plot,
resulting a total of 23,853 shRNAs.
TABLE-US-00002 TABLE 1 List of Primers Target Purpose Forward oligo
Reverse Oligo Nudt21 qPCR CGGCTTCTTTTACTTC GGGGTATGGACCCATC TGCATAC
ATTT Sumo2 qPCR AAGGAAGGAGTCAAGACT CGGAATCTGATCTGCC GAGAA TCATTG
GAPDH qPCR AGG TCG GTG TGA TGT AGA CCA TGT AGT ACG GAT TTG TGA GGT
CA phage vector recloning shRNA PCR5-3: BC1R: GCAAACTGGGGCACA
CGCCTCCCCTACCCGG GATGATGCGG TAGA phage vector sequencing
TAGCCCCTTGAATTCC N/A shRNA GAGGCAGTAGGCA phage vector half hairpin
JH353F: BC1R: amplification for TAGTGAAGCCACAGA CGCCTCCCCTACCCGG
sequencing library TGTA TAGA half hairpin adaptor addition P5 +
mir3: P7 + loop: amplicon for Solexa AATGATACGGCGACC Barcode xx =
GA, TG or sequencing ACCGACTAAAGTAGC AT: CCCTTGAATTC
CAAGCAGAAGACGGCA TACGAxxTAGTGAAGCC ACAGATGTA
REFERENCES FOR EXAMPLE 1
[0261] Apostolou, E., and Hochedlinger, K. (2013). Chromatin
dynamics during cellular reprogramming. Nature 502, 462-471. [0262]
Di Giammartino, D. C., Nishida, K., and Manley, J. L. (2011).
Mechanisms and consequences of alternative polyadenylation.
Molecular cell 43, 853-866. [0263] Esteban, M. A., Wang, T., Qin,
B., Yang, J., Qin, D., Cai, J., Li, W., Weng, Z., Chen, J., Ni, S.,
et al. (2010). Vitamin C enhances the generation of mouse and human
induced pluripotent stem cells. Cell stem cell 6, 71-79. [0264]
Hickey, C. M., Wilson, N. R., and Hochstrasser, M. (2012). Function
and regulation of SUMO proteases. Nature reviews Molecular cell
biology 13, 755-766. [0265] Jackson-Grusby, L., Beard, C.,
Possemato, R., Tudor, M., Fambrough, D., Csankovszki, G., Dausman,
J., Lee, P., Wilson, C., Lander, E., et al. (2001). Loss of genomic
methylation causes p53-dependent apoptosis and epigenetic
deregulation. Nature genetics 27, 31-39. [0266] Ji, Z., and Tian,
B. (2009). Reprogramming of 3' untranslated regions of mRNAs by
alternative polyadenylation in generation of pluripotent stem cells
from different cell types. PloS one 4, e8419. [0267] Kawamura, T.,
Suzuki, J., Wang, Y. V., Menendez, S., Morera, L. B., Raya, A.,
Wahl, G. M., and Izpisua Belmonte, J. C. (2009). Linking the p53
tumour suppressor pathway to somatic cell reprogramming. Nature
460, 1140-1144. [0268] Li, H., Collado, M., Villasante, A., Strati,
K., Ortega, S., Canamero, M., Blasco, M. A., and Serrano, M.
(2009). The Ink4/Arf locus is a barrier for iPS cell reprogramming.
Nature 460, 1136-1139. [0269] Masamha, C. P., Xia, Z., Yang, J.,
Albrecht, T. R., Li, M., Shyu, A. B., Li, W., and Wagner, E. J.
(2014). CFIm25 links alternative polyadenylation to glioblastoma
tumour suppression. Nature 510, 412-416. [0270] Mikkelsen, T. S.,
Hanna, J., Zhang, X., Ku, M., Wernig, M., Schorderet, P.,
Bernstein, B. E., Jaenisch, R., Lander, E. S., and Meissner, A.
(2008). Dissecting direct reprogramming through integrative genomic
analysis. Nature 454, 49-55. [0271] Neyret-Kahn, H., Benhamed, M.,
Ye, T., Le Gras, S., Cossec, J. C., Lapaquette, P., Bischof, O.,
Ouspenskaia, M., Dasso, M., Seeler, J., et al. (2013). Sumoylation
at chromatin governs coordinated repression of a transcriptional
program essential for cell growth and proliferation. Genome
research 23, 1563-1579. [0272] Onder, T. T., Kara, N., Cherry, A.,
Sinha, A. U., Zhu, N., Bernt, K. M., Callan, P., Marcarci, B. O.,
Unternaehrer, J., Gupta, P. B., et al. (2012). Chromatin-modifying
enzymes as modulators of reprogramming. Nature 483, 598-602. [0273]
Plank, M., Hu, G., Silva, A. S., Wood, S. H., Hesketh, E. E.,
Janssens, G., Macedo, A., de Magalhaes, J. P., and Church, G. M.
(2013). An analysis and validation pipeline for large-scale
RNAi-based screens. Scientific reports 3, 1076. [0274] Poleshko,
A., Kossenkov, A. V., Shalginskikh, N., Pecherskaya, A., Einarson,
M. B., Marie Skalka, A., and Katz, R. A. (2014). Human factors and
pathways essential for mediating epigenetic gene silencing.
Epigenetics: official journal of the DNA Methylation Society 9,
1280-1289. [0275] Polo, J. M., Anderssen, E., Walsh, R. M.,
Schwarz, B. A., Nefzger, C. M., Lim, S. M., Borkent, M., Apostolou,
E., Alaei, S., Cloutier, J., et al. (2012). A molecular roadmap of
reprogramming somatic cells into iPS cells. Cell 151, 1617-1632.
[0276] Qin, H., Diaz, A., Blouin, L., Lebbink, R. J., Patena, W.,
Tanbun, P., LeProust, E. M., McManus, M. T., Song, J. S., and
Ramalho-Santos, M. (2014). Systematic identification of barriers to
human iPSC generation. Cell 158, 449-461. [0277] Rais, Y., Zviran,
A., Geula, S., Gafni, O., Chomsky, E., Viukov, S., Mansour, A. A.,
Caspi, I., Krupalnik, V., Zerbib, M., et al. (2013). Deterministic
direct reprogramming of somatic cells to pluripotency. Nature 502,
65-70. [0278] Samavarchi-Tehrani, P., Golipour, A., David, L.,
Sung, H. K., Beyer, T. A., Datti, A., Woltjen, K., Nagy, A., and
Wrana, J. L. (2010). Functional genomics reveals a BMP-driven
mesenchymal-to-epithelial transition in the initiation of somatic
cell reprogramming. Cell stem cell 7, 64-77. [0279] Silva, J.,
Barrandon, O., Nichols, J., Kawaguchi, J., Theunissen, T. W., and
Smith, A. (2008). Promotion of reprogramming to ground state
pluripotency by signal inhibition. PLoS Biol 6, e253. [0280]
Stadtfeld, M., and Hochedlinger, K. (2010). Induced pluripotency:
history, mechanisms, and applications. Genes Dev 24, 2239-2263.
[0281] Stadtfeld, M., Maherali, N., Borkent, M., and Hochedlinger,
K. (2010). A reprogrammable mouse strain from gene-targeted
embryonic stem cells. Nat Methods 7, 53-55. [0282] Tahmasebi, S.,
Ghorbani, M., Savage, P., Gocevski, G., and Yang, X. J. (2014). The
SUMO conjugating enzyme Ubc9 is required for inducing and
maintaining stem cell pluripotency. Stem Cells 32, 1012-1020.
[0283] Tahmasebi, S., Ghorbani, M., Savage, P., Yan, K., Gocevski,
G., Xiao, L., You, L., and Yang, X. J. (2013). Sumoylation of
Kruppel-like factor 4 inhibits pluripotency induction but promotes
adipocyte differentiation. The Journal of biological chemistry 288,
12791-12804. [0284] Takahashi, K., and Yamanaka, S. (2006).
Induction of pluripotent stem cells from mouse embryonic and adult
fibroblast cultures by defined factors. Cell 126, 663-676. [0285]
Tsuruzoe, S., Ishihara, K., Uchimura, Y., Watanabe, S., Sekita, Y.,
Aoto, T., Saitoh, H., Yuasa, Y., Niwa, H., Kawasuji, M., et al.
(2006). Inhibition of DNA binding of Sox2 by the SUMO conjugation.
Biochemical and biophysical research communications 351, 920-926.
[0286] Utikal, J., Polo, J. M., Stadtfeld, M., Maherali, N.,
Kulalert, W., Walsh, R. M., Khalil, A., Rheinwald, J. G., and
Hochedlinger, K. (2009). Immortalization eliminates a roadblock
during cellular reprogramming into iPS cells. Nature 460,
1145-1148. [0287] Wang, L., Wansleeben, C., Zhao, S., Miao, P.,
Paschen, W., and Yang, W. (2014). SUMO2 is essential while SUMO3 is
dispensable for mouse embryonic development. EMBO reports 15,
878-885. [0288] Wang, T., Chen, K., Zeng, X., Yang, J., Wu, Y.,
Shi, X., Qin, B., Zeng, L., Esteban, M. A., Pan, G., et al. (2011).
The histone demethylases Jhdm 1a/1b enhance somatic cell
reprogramming in a vitamin-C-dependent manner. Cell stem cell 9,
575-587. [0289] Wu, Y., Guo, Z., Wu, H., Wang, X., Yang, L., Shi,
X., Du, J., Tang, B., Li, W., Yang, L., et al. (2012). SUMOylation
represses Nanog expression via modulating transcription factors
Oct4 and Sox2. PloS one 7, e39606. [0290] Yang, C. S., Chang, K.
Y., and Rana, T. M. (2014). Genome-wide functional analysis reveals
factors needed at the transition steps of induced reprogramming.
Cell reports 8, 327-337.
Example 2: The Histone Chaperone CAF-1 Safeguards Somatic Cell
Identity During Transcription Factor-Induced Reprogramming
[0291] The generation of iPSCs from somatic cells upon forced
expression of the transcription factors Oct4, Klf4, Sox2 and c-Myc
(OKSM) is a highly dynamic and lengthy process that proceeds
through heterogeneous intermediate cell populations, which poses
challenges for genetic and biochemical dissection of the underlying
mechanisms (9,10). Previous efforts to identify chromatin
modulators of iPSC formation included gain and loss of function
screens as well as transcriptional profiling of bulk or
FACS-enriched cell populations undergoing reprogramming. While
informative, these approaches remain limited in several ways. For
example, iPSC modulators that do not change transcriptionally are
typically overlooked when analyzing expression dynamics in
reprogramming intermediates (11). Moreover, known repressors of
iPSC formation such as p53, Mbd3, Dot11, and Dnmt1 were either
predicted or identified from small sets of candidate gene lists,
leaving open the possibility that major roadblocks to reprogramming
remain to be discovered (12-15). Genome-wide RNAi screens are
challenging due to various technical limitations such as lack of
effective shRNAs when expressed from a single genomic copy,
prevalent off-target effects, as well as biases in the library
representation or the screening readout (11, 16, 17). Indeed,
previous RNAi screens identified a number of chromatin regulators
of iPSC formation with little to no overlap among independent
studies. Furthermore, certain chromatin regulators reportedly have
opposing effects on iPSC generation when tested in different
cellular contexts and culture conditions, indicating that they may
not act as universal barriers to reprogramming (14, 18-23).
Although these functional and molecular analyses of iPSC formation
provided important insights into transcription factor-induced
reprogramming, the cellular and molecular mechanisms inherent to
the induction of pluripotency and their parallels to other types of
cell fate change remain largely elusive (24,25).
[0292] To systematically explore chromatin factors involved in the
maintenance of somatic cell identity, the inventors assembled
custom-designed microRNA-based shRNA libraries targeting known and
predicted chromatin regulators. 243 known chromatin regulators were
used in an arrayed screening approach during the reprogramming of
fibroblasts into iPSCs (26). This screen validated previously
implicated chromatin pathways and revealed novel, more potent
repressors of reprogramming. Through a series of cellular and
molecular studies, the inventors demonstrate that suppression of a
histone chaperone complex most dramatically enhances and
accelerates iPSC reprogramming as well as other cell fate
transitions. It is proposed that this complex functions as a key
determinant of cell identity by influencing chromatin structure and
transcription factor binding.
Chromatin Focused shRNAmir Screens Systematically Identify Global
Suppressors of Reprogramming.
[0293] To explore chromatin barriers to induced pluripotency in a
systematic and comprehensive manner, the inventors used a
chromatin-focused screening method to identify microRNA-based shRNA
(shRNAmir) libraries in a highly standardized reprogramming assay.
Specifically, they utilized transgenic ("reprogrammable") mouse
embryonic fibroblasts (MEF) harboring a doxycycline (dox)-inducible
polycistronic OKSM cassette and a constitutive M2-rtTA driver (26).
By ensuring controllable and homogeneous factor expression, this
system enables the generation of stable, transgene-independent
iPSCs with reproducible kinetics and frequencies. The screening
platform further provides a means to study changes in the temporal
requirement for OKSM overexpression while suppressing candidate
chromatin barriers during induced pluripotency.
[0294] An arrayed screening strategy was designed using a
previously described miR30-based shRNA library targeting 243 known
chromatin regulators (27) (FIG. 12A). A total of 1,071 experimental
and four control shRNAmirs were cloned into a constitutive
retroviral expression vector (pLMN) and transduced one-by-one into
reprogrammable MEFs (FIG. 10A). Cells were induced to reprogram by
addition of dox, followed by a period of dox withdrawal to select
for transgene-independent iPSC colonies. Alkaline phosphatase
positive (AP+) iPSC-like colonies were quantified using customized
image analysis software, and reprogramming efficiency ratios were
calculated relative to a control shRNA targeting Renilla luciferase
(Ren.713).
Nucleosome Assembly as a Major Roadblock to iPSC Formation
[0295] The screen identified shRNAs that strongly and consistently
promoted iPSC formation. The most prominent hits that emerged from
the screen were Chaf1a and Chaf1b, two subunits of the chromatin
assembly factor complex CAF-1. Among the 22 shRNAs that enhanced
iPSC formation more than four-fold in the arrayed screen, the
inventors identified six shRNAs targeting Chaf1a or Chaf1b (three
shRNAs each) including the three top-scoring shRNAs overall (FIG.
10B, 11A). Importantly, all tested top-scoring shRNAs targeting
Chaf1a and Chaf1b reduced the expression of their predicted target
genes (FIGS. 15A, 15B).
Suppression of CAF-1 Accelerates iPSC Formation
[0296] To gain insights into the dynamics of reprogramming in the
absence of the identified chromatin barriers, the inventors
followed the emergence of Epcam+ (early programming marker) and
Oct4-tomato (late reprogramming marker) cells over time. This
showed that Chaf1a suppression increased the fraction of both
Epcam+ and Oct4-tomato+ cells at day four and six of reprogramming
(FIG. 11B).
[0297] To complement these reporter and marker-based assays with a
functional readout, the inventors examined the ability of candidate
hairpins to facilitate transgene-independent clonal growth, a
hallmark of authentic iPSCs. Suppression of Chaf1a indeed gave rise
to transgene-independent AP+ cells after as little as four days of
OSKM expression when no iPSCs were yet detectable in control
shRNA-treated cells (FIG. 11C). Based on the identification of
Chaf1a and Chaf1b as the top hits in two independent
chromatin-focused reprogramming screens and their dramatic effects
on both the dynamics and efficiency of iPSC formation, further
analyses were focused on these two components of the CAF-1
complex.
[0298] It was ensured that suppression of CAF-1 subunits does not
significantly influence expression of the Col1a1::tetOP-OKSM;
R26-M2rtTA system at the RNA or protein level, ruling out the
possibility that the observed phenotype is due to direct modulation
of the reprogramming transgenes. Moreover, the reprogramming
increase elicited by Chaf1b shRNAs could be rescued by
overexpression of an shRNA-resistant version of human CHAF1B cDNA,
demonstrating specificity of the effect. Lastly, knockdown of
either CAF-1 subunit did not increase cell proliferation rates in
the presence of OKSM induction, thus excluding that the dramatic
increase in Oct4-GFP+ cells upon CAF-1 suppression is simply due to
an expansion of reprogrammed cells or a loss of unreprogrammed
cells.
Reprogramming Phenotype Depends on Optimal CAF-1 and OKSM Dose
[0299] To determine whether CAF-1's effect on reprogramming depends
on OKSM expression levels, iPSC formation efficiencies between
reprogrammable MEFs carrying either one or two copies of the
Col1a1::tetOP-OKSM and R26-M2rtTA alleles were compared; it was
previously shown that increasing the dose of OKSM and M2-rtTA using
this transgenic system profoundly influences reprogramming
efficiency and speed.sup.6,16. While CAF-1 suppression in
heterozygous MEFs increased iPSC formation by orders of magnitude,
CAF-1 suppression in homozygous MEFs resulted in a more modest
increase in iPSC numbers (FIG. 12A, 12B). Consistently, it was
observed that CAF-1 knockdown had a much stronger effect on
reprogramming efficiency when infecting MEFs with viral vectors
achieving either temporally restricted or moderate OKSM expression
compared to vectors achieving high OKSM expression levels over
prolonged periods of time Enhanced iPSC formation upon CAF-1
knockdown was further observed with an independent transgenic
reprogramming system producing OKSM at different stoichiometries
compared to our Col1a1::tetOP-OKSM cassette.sup.30. These results
show that the reprogramming phenotype upon CAF-1 suppression is
influenced by both the levels and the duration of OKSM
expression.
[0300] CAF-1 is essential for embryonic growth and the viability of
cultured cells.sup.27-29,31. In line with this observation, it was
found that the top-scoring shRNAs targeting CAF-1 components
compromised the growth of NIH3T3 cells in the absence of OKSM
expression. To test whether the duration and degree of CAF-1
suppression also affects reprogramming efficiency, transgenic MEFs
carrying a dox-inducible Chaf1a shRNA linked to an RFP reporter in
the Col1a1 locus were generated. When exposing these cells to
either low or high concentrations of dox, a concomitant change in
RFP reporter signal and Chaf1a protein levels (data not shown) was
observed. Infection of transgenic MEFs with a constitutive
lentiviral vector expressing OKSM in the presence of low doses of
dox for 2, 4, 6, 8 or 9 days resulted in a progressive increase in
the formation of Nanog+ iPSC colonies, which plateaued by day 6. In
contrast, exposure of replicate cultures to high doses of dox
increased reprogramming efficiency until day 4 but decreased iPSC
colony numbers thereafter. Collectively, these data indicate that
enhanced reprogramming is also dependent on CAF-1 dose, with early
CAF-1 suppression being beneficial but long term, potent
suppression being detrimental to iPSC derivation.
CAF-1 Depletion Enhances Reprogramming and Direct Lineage
Conversion of Different Cell Types
[0301] To investigate whether CAF-1 acts as a gatekeeper of
cellular identity across different cell types, the inventors
expanded their analysis from fibroblasts to blood progenitors. To
this end, the inventors tested the effect of Chaf1a knockdown on
the reprogramming potential of hematopoietic stem and progenitors
cells (HSPCs) isolated from fetal livers of reprogrammable mice
(FIG. 13A). The inventors monitored expression of the surface
molecule Pecam over time, which coincides with activation of the
Oct4-GFP reporter during reprogramming (10). After four days of
OKSM induction, Pecam expression was detectable in 56% of control
HSPCs, while Chaf1a suppression by two independent shRNAs enhanced
this fraction to over 90% (FIG. 13B, 13C). By day six, essentially
all Chaf1a shRNA treated cells (97%) had completed reprogramming as
judged by Pecam surface expression, whereas only 76% of control
cells had acquired a Pecam+ iPSC-like state. Consistently,
suppression of Chaf1a gave rise to more transgene-independent
colonies compared to controls at each examined time point. Hence,
CAF-1 also functions as a barrier to iPSC formation in a cell type
that is less differentiated and intrinsically more amenable to
reprogramming compared to MEFs.
[0302] To assess whether CAF-1 stabilizes somatic cell identity in
cell fate-conversion systems other than OKSM-mediated
reprogramming, the inventors first examined the
transdifferentiation of fibroblasts into induced neuronal (iN)
cells upon overexpression of the transcription factor Ascl1 in MEFs
(40). The inventors transduced transgenic MEFs harboring
dox-inducible shRNAs targeting Renilla luciferase or Chaf1a with a
dox-inducible Ascl1-expressing lentivirus and measured iN formation
at day 13. CAF-1 knockdown consistently resulted in a two-fold
increase (P=0.003) in the number of Map2+ neurons in four
independent experiments (FIGS. 13E, 13F).
[0303] The inventors next tested the effect of CAF-1 suppression
during the conversion of pre-B cells into macrophages upon
overexpression of the myeloid transcription factor C/EBP.alpha.
(FIG. 13G). Exposure of a C/EBP.alpha.-inducible pre-B cell line to
estradiol reportedly triggers conversion into macrophages within 48
hours at 100% efficiency (41). Remarkably, knockdown of CAF-1 in
this cell line resulted in an up to five-fold increase in the
expression of the myeloid markers Cd14 and Mac1 after as little as
24 hours of estradiol treatment (FIG. 13H, 13I). Although the
fractions of Cd14+ and Mac1+ cells were comparable between CAF-1
shRNA and control shRNA conditions at 48 hours, the expression
levels of both differentiation markers were noticeably higher in
CAF-1 depleted cells (FIG. 13H). Taken together, these data
demonstrate that CAF-1 suppression not only enhances the induction
of pluripotency from different cell types but also facilitates
cellular transdifferentiation, indicating that reduced expression
of CAF-1 generally promotes cellular plasticity during
transcription factor-induced cell fate conversions.
Depletion of CAF-1 Promotes Chromatin Accessibility at Enhancer
Elements and Facilitates Transcription Factor Binding
[0304] Since CAF-1 functions as a histone chaperone that assembles
nascent nucleosomes during DNA replication (42), it was reasoned
that its reduced levels may result in a more accessible chromatin
structure and thus facilitate transcription factor binding to their
target loci. To interrogate possible differences in chromatin
structure between CAF-1 depleted and control cells undergoing
reprogramming, the inventors first performed SONO-Seq (43)
analysis, which allows mapping of accessible chromatin regions due
to their increased susceptibility to sonication. The inventors
analyzed bulk cultures expressing OKSM for three days when no
stable iPSCs are yet present. Given the importance of regulatory
elements in defining cell identity (44), the study focused analysis
on all annotated ESC-specific promoter and enhancer regions, as
defined by recent ChIP-Seq analyses of post-translational histone
modifications and p300 occupancy (45). Notably, while promoter
elements showed no discernible difference in accessibility (P
value=0.51), the inventors observed a significant enrichment of
SONO-seq signal at ESC-specific enhancer elements in CAF-1 depleted
cells at day three of OKSM expression (value
<2.64.times.10.sup.-12). This observation indicates that CAF-1
suppression results in a more accessible local chromatin
environment over ESC-specific enhancer elements early in
reprogramming.
[0305] To validate these observations and generate a higher
resolution map of chromatin accessibility in early reprogramming
intermediates, the inventors performed an assay for transposase
accessible chromatin using sequencing (ATAC-seq), which detects
integrations of the Tn5-tagged transposase in open chromatin
regions (46). In agreement with the SONO-seq data, ATAC-Seq
analysis of early reprogramming intermediates show a more
accessible chromatin configuration at ESC-specific enhancers upon
CAF-1 depletion compared to controls (P value
<3.61.times.10.sup.-5). The inventors next interrogated
"super-enhancers", a recently described class of major
lineage-specific regulatory elements in ESCs and other cell types
(47-49). CAF-1 knockdown caused a significant increase in chromatin
accessibility when considering all 231 reported ESC-specific
super-enhancers compared to controls at day three of iPSC formation
(P value <1.28.times.10.sup.-5). This difference became much
more pronounced at day six of reprogramming, consistent with
transitioning of the cells towards a pluripotent state.
[0306] When focusing on individual super-enhancers, it was observed
that some loci (e.g., Sox2 and Sal14; 42 super-enhancers in total)
but not others were significantly more accessible by ATAC-seq
analysis in CAF-1 depleted cells compared to controls. Taken
together, these results show that CAF-1 suppression facilitates a
more accessible local chromatin structure at pluripotency-specific
enhancer elements, including super-enhancers. Lastly, the inventors
performed ChIP-Seq analysis for Sox2 at day three of OKSM
expression in order to test the hypothesis that increased chromatin
accessibility at enhancer elements influences reprogramming factor
binding. Indeed, the inventors detected a significant increase in
Sox2 binding to ESC-specific regulatory elements in CAF-1 knockdown
cells compared to controls (FIG. 13C; P value <2.2e.sup.-16).
While the majority of Sox2 binding sites (around 90%) were shared
between CAF-1 knockdown and control cells, roughly 10% were
significantly enriched in cells expressing either CAF-1 shRNA
(1,329 peaks) or Renilla shRNA (1,806 peaks) (FIG. 13D, left
panel). Remarkably, binding sites unique to CAF-1 depleted cells
were strongly enriched for ESC-specific Sox2 targets (50) relative
to control cells (FIG. 13D, right panel). Consistently,
ESC-specific super-enhancer elements were three-fold more abundant
among the unique Sox2 sites in CAF-1 knockdown cells compared to
controls (15 vs. 5). Of the 15 Sox2-bound super-enhancers unique to
CAF-1 knockdown cells, seven (47%) also showed a more accessible
chromatin structure by ATAC-Seq analysis (e.g., Sal11 and Mycn
loci; FIG. 13E). Collectively, these results indicate that loss of
CAF-1 contributes to reprogramming, at least in part, by increasing
chromatin accessibility at pluripotency-specific enhancer elements
and by promoting binding of reprogramming transcription factors
such as Sox2 to its target genes.
CAF-1 Suppression Alters Local Heterochromatin Domains and Primes
Pluripotency Genes for Transcriptional Activation
[0307] Considering that CAF-1 plays crucial roles not only in
histone exchange but also heterochromatin maintenance.sup.27,31,44,
the global distribution of the heterochromatin mark H3K9me3 during
reprogramming was examined. Significant differences were not
detected in H3K9me3 levels across pluripotency-associated enhancers
or transposable elements, which represent abundant and prototypical
heterochromatic regions. Likewise, RNA-Seq analysis of the same
intermediates failed to show differential expression of
transposable elements between control and CAF-1 knockdown cells
throughout the reprogramming time course. However, a local
depletion of H3K9 trimethylation was detected at a subset of
somatic heterochromatin areas termed "reprogramming-resistant
regions", which have recently been linked to the low efficiency of
somatic cell nuclear transfer.sup.45 (FIG. 14D). It is inferred
from these data that CAF-1 inhibition, in concert with OKSM
expression, causes local changes in this key repressive histone
modification, which may prime chromatin structure for efficient
transcriptional activation.
[0308] Finally, it was investigated whether the observed CAF-1
shRNA-induced chromatin changes affect gene expression of
associated genes. Of note, no major gene expression differences
were detectable between control and CAF-1 shRNA samples at day
three of reprogramming (data not shown). However, a subset of genes
with increased chromatin accessibility at day three was
transcriptionally upregulated by day six of reprogramming in CAF-1
knockdown intermediates (e.g., Utf1, Epcam, NrOb1, Tdgf1, Sa114),
supporting the view that CAF-1 suppression primes the genome for
subsequent transcriptional activation. Altogether, these
genome-wide assays support the conclusion that CAF-1 suppression,
in collaboration with potent coactivators, facilitates the
transcriptional activation of somatically silenced genes.
[0309] The inventors have combined a highly standardized iPSC
reprogramming assay and two innovative shRNA screening approaches
to systematically explore chromatin barriers to cellular
reprogramming. Remarkably, the most potent roadblocks emerging from
these screens was the nucleosome assembly complex CAF-1, which has
not been identified in previous genome-wide or focused screens for
iPSC reprogramming barriers (11, 13, 14, 16, 17). Of note, CAF-1
and several other roadblocks uncovered in our screens (e.g. Brd4,
Dnmt1) are essential genes (51-56), that would not have been
identified with alternative screening methods involving the
complete and permanent ablation of gene function.
[0310] Together, these findings highlight the advantage of RNAi
technology for generating hypomorphic states of gene function in
order to dissect basic cellular processes with a comprehensive
functional genetics approach.
[0311] In addition to identifying CAF-1 as the most prominent
roadblock to iPSC formation in two independent screens, this study
provides evidence that CAF-1 suppression facilitates transcription
factor-driven cell fate changes in at least two additional systems:
direct conversion of fibroblasts to neurons and B cells to
macrophages. Consistent with the role of CAF-1 in
replication-coupled nucleosome assembly, it was found that its
suppression has a more pronounced effect on cellular plasticity in
systems that involve multiple rounds of cell division (i.e., iPSC
formation from MEFs) compared to those that require only 1-3
divisions (i.e., direct lineage conversion) or those that exhibit
intrinsically high proliferation rates (i.e., iPSC induction from
HSPCs). Based on these observations, it is tempting to speculate
that a tolerable reduction in the expression of other components
associated with the DNA replication machinery may also facilitate
cell fate change. In support of this idea, hypomorphic alleles of
the essential proliferating cell nuclear antigen (PCNA) gene, which
acts as a scaffold for proteins involved in DNA replication,
suppress position effect variegation in flies (57). The
methyltransferase Dnmt1 represents another fork component that is
involved in the maintenance of cell identity (3) and scores in the
present screen as a chromatin barrier. Although knockdown or
pharmacological inhibition of Dnmt1 also facilitates iPSC formation
and transdifferentiation of MEFs into myogenic cells (12, 58, 59),
the screens described herein indicate that interference with
nucleosome assembly may represent a more potent and broadly
applicable strategy to facilitate cell fate change.
[0312] Without wishing to be bound by theory, the inventors propose
that CAF-1 contributes to the maintenance of somatic cell identity
in replicative cells by safeguarding chromatin structure. According
to this model, suppression of CAF-1 triggers dilution of newly
assembled nucleosomes at key enhancer elements and loosening of
chromatin structure in conjunction with forced expression of
lineage-specifying transcription factors. These combined changes
may generate an accessible chromatin landscape for efficient
transcription factor binding and subsequent robust activation of
key target genes. Other histone chaperones may compensate for the
loss of CAF-1 during reprogramming.
[0313] Indeed, suppression of the CAF-1 subunit p60 in human cells
triggers compensatory deposition of the histone variant H3.3 by the
chaperone HIRA (60,61). Of interest, H3.3 deposition on chromatin
has recently been associated with enhanced reprogramming in the
context of somatic cell nuclear transfer (62-64). Given that CAF-1
associates with regulators of heterochromatin, it will further be
interesting to ascertain whether its suppression during iPSC
formation also influences heterochromatin domains, which are
thought to resist reprogramming (29-31, 65).
[0314] The present study provides fundamental insight into
chromatin-associated mechanisms regulating somatic cell identity,
and indicates novel strategies for controlling cell fate
transitions for therapeutic purposes. For example, the inventors
anticipate that some of the chromatin barriers to iPSC formation
identified here also contribute to normal development and
tumorigenesis. Targeting of these chromatin factors in diseased or
damaged tissues can thus help to eliminate aberrant cells or
promote cellular regeneration, respectively. The dose dependency of
the top hits indicates that one can accomplish this goal with
inhibitors that trigger such cell fate changes in vitro or in vivo
with low cellular toxicity.
Methods and Materials
Cell Culture and Media
[0315] Packaging cells (Platinum-E.TM. Retroviral Packaging Cell
Line) for producing Retrovirus were cultured in DMEM supplemented
with 15% FBS, 100 U ml-1 penicillin, 100 .mu.g ml-1 streptomycin,
sodium pyruvate (1 mM) and L-glutamine (4 mM) at 37.degree. C. with
5% CO.sub.2. Mouse embryonic fibroblasts (MEF) were cultured in
DMEM supplemented with 15% FBS, 100 U ml-1 penicillin, 100 .mu.g
ml-1 streptomycin, sodium pyruvate (1 mM), L-glutamine (4 mM),
L-ascorbic acid (50 uM) at 37.degree. C. with low oxygen (4.5%
O.sub.2). iPSCs were derived in DMEM supplemented with 15% FBS, 100
U ml-1 penicillin, 100 .mu.g ml-1 streptomycin, sodium pyruvate (1
mM), L-glutamine (4 mM), 1000 U/ml LIF, 0.1 mM 2-mercaptoethanol,
and 50 .mu.g ml-1 ascorbic acid at 37.degree. C. with 5% CO.sub.2
and 4.5% O.sub.2. iPSCs for blastocyst injection were cultured on
feeders in DMEM supplemented with 13% Knockout Serum Replacement
(Gibco.TM.), 2% FBS, 100 U ml-1 penicillin, 100 .mu.g ml-1
streptomycin, sodium pyruvate (1 mM), L-glutamine (4 mM),
L-ascorbic acid (50 uM), 1000 U/ml LIF, beta mercaptoethanol, MEK
inhibitor (104) and GSK3 inhibitor (304) at 37.degree. C. with 5%
CO.sub.2. Conventional reprogramming media consisted of DMEM
supplemented with 15% FBS, 100 U ml-1 penicillin, 100 .mu.g ml-1
streptomycin, sodium pyruvate (1 mM), L-glutamine (4 mM), 1000 U/ml
LIF, 0.1 mM 2-mercaptoethanol unless otherwise noted. For some
experiments, media was supplemented with MEK inhibitor (104), GSK3
inhibitor (304), Dot11 inhibitor (1 uM) or ascorbate (50
ug/ml).
[0316] Primary MEFs were derived from E13.5 embryos isolated from
intercrosses between mice homozygous for Col1a1::tetOP-OKSM;
Oct4-GFP and Rosa26 M2rtTA, respectively. Embryos were dissected
carefully excluding internal organs, heads, limbs and tails and
only carcasses were used for MEF derivation. Tissues were chopped
into small clumps using scalpels, trypsinized and cultured in MEF
medium at low O.sub.2 (4%). MEFs were frozen at passage 0 upon
derivation and used at passage 1 for all downstream transduction
and reprogramming experiments. All MEFs were cultured at low
O.sub.2 (4%) and supplemented with ascorbate to prevent replicative
senescence before OKSM overexpression.
[0317] Reprogramming experiments were initiated at low oxygen
levels during dox induction and completed at normal oxygen levels
(20%) for mir-E experiments. Mir-30 assays were performed
continuously at normal oxygen levels. HSPCs were isolated from
fetal livers of the same mid-gestation reprogrammable transgenic
embryos used for MEFs derivation, dissociated by vigorous pipetting
with a 1 ml tip, filtered using 35 .mu.m nylon mesh, followed by
red blood cell lysis and cultured in RPMI/FBS media supplemented
with stem cell factor (SCF), I13 and I16 cytokines and transduced
as indicated in the schematic (FIG. 13A).
Arrayed shRNA Library and Screen
[0318] Single shRNA clones were picked from the master library at
CSHL, arrayed in 12.times.96 well plates and sequence-verified
individually using miR30 backbone primers. An additional 200
unmatched clones were re-picked and sequenced to allow maximum
coverage of the library. Double transgenic reprogrammable MEFs
carrying the OKSM inducible cassette and constitutive rtTA
(Col1a1::tetOP-OKSM; R26-M2rtTA) were seeded at 10e4 cells per well
in 96 well plates in duplicates and infected with the corresponding
retroviral virus particles freshly produced and filtered in 96 well
format.
[0319] 48 hrs post transduction, MEFs from each row were
trypsinized and transposed into 6 well dished coated with 0.2%
gelatin in standard reprogramming media supplemented with dox and
G418 at 0.2 mg/ml for the first six days of OKSM expression. Dox
was withdrawn at day 12, allowing stable iPSCs to form. iPSC
colonies were then stained for alkaline phosphatase expression
using Vector Red.TM. Alkaline Phosphatase Substrate Kit
(VectorLabs.TM.) according to the supplier's protocol. Plates were
scanned with a Perfection V500 Photo scanner (Epson.TM.) and
automated counting was performed using a proprietary
image-processing algorithm by Nikon.TM.. Reprogramming efficiency
was calculated based on infection efficiency and normalized to
infections with control shRNAs targeting the luciferase Renilla
transcript.
Retrovirus Production, Transduction of MEFs and Derivation of
iPSCs
[0320] Retroviral constructs were introduced into Platinum-E.TM.
Retroviral Packaging cells using calcium phosphate transfection or
lipofection as previously described (Zuber, J. et al. (2011) Nature
Biotechnology 29:79-83). shRNAs were transduced into primary MEFs
carrying the Col1a1::tetOP-OKSM and R26-M2rtTA alleles as well as a
Pou5f1-EGFP reporter at single copies. For transduction, 180,000
cells were plated per well of a 6-well dish; all vectors were
transduced in biological triplicate. After 36 hrs, transduced cells
were selected with 0.5 mg ml-1 G418 for 3 days and 0.25 mg ml-1
G418 for an additional 3 days. 3 days after shRNA transduction,
infected cells were washed with PBS (1.times.) and trypsinized with
Trypsin-EDTA (1.times.) and 20,000 cells were plated into a 6-well.
OSKM expression was induced for 7 days and cells were cultured in
DMEM supplemented with 15% FBS, 100 U ml-1 penicillin, 100 .mu.g
ml-1 streptomycin, sodium pyruvate (1 mM), L-glutamine (4 mM), 1000
U/ml LIF, 0.1 mM 2-Mercaptoethanol, 50 .mu.g ml-1 sodium ascorbate
and 1 .mu.g ml-1 doxycycline at 37.degree. C. with lox oxygen (4.5%
O.sub.2) and 5% CO.sub.2. After 7 days of OSKM expression, cells
were cultured for an additional 4 days without doxycycline to
withdraw OSKM transgene expression at 37.degree. C. with 5%
CO.sub.2, ambient oxygen. Following trypsinization, cells were
analyzed for Oct4-GFP expression using a FACS BD LSRFortessa.TM.
(BD Biosciences.TM.), data were analyzed using FlowJo.TM..
Phenotypic Characterization of iPSCs
[0321] Alkaline phosphatase activity was measured using an
enzymatic assay for alkaline phosphatase (VECTOR Red.TM. Alkaline
Phosphatase (AP) Substrate Kit) according to the manufacturer's
protocol.
Flow Cytometry Analysis of Reprogramming Intermediates
[0322] Reprogramming intermediates and Pecam stains were performed
as previously described.sup.6. All samples were analyzed on a
MACSQuant.TM. fluorescence cytometer (Miltenyi.TM.).
Transdifferentiation Assays
[0323] Induced neurons were generated as described in the
experimental scheme (FIG. 13D). CAF-1 or Renilla RNAi inducible
transgenic MEFs were transduced with Ascl1-inducible lentivirus,
exposed to dox 24 hrs post induction, cultured in MEF media for the
first 48 hrs and switched to serum-free neuronal media (N3B27)
supplemented with dox for an additional 11 days. Cultures were
fixed and stained for MAP2 as previously described.sup.33. Pre-B
cells (C10 line) were cultured in RPMI Medium, 10% charcoal
stripped FBS (Invitrogen.TM.), 2 mM L-Glutamine, 100 unit/ml
penicillin, 1000 ug/ml streptomycin), 55 uM beta-mercaptoethanol.
Pre-B cells were transduced 48 hrs before initiating macrophage
transdifferentiation with estradiol (E2). For transdifferentiation
assays, cultures were transduced with lentiviral pLKO vectors
obtained from the Broad Institute's RNAi consortium (empty vector
"null control" or vector carrying stem-loop shRNAs targeting Chaf1a
and Chaf1b subunits). Following selection of transduced cells with
puromycin, cells were seeded at le6 cells/ml and supplemented with
E2 and macrophage cytokines (IL3 and CSF) as previously
described.sup.34. All time points were analyzed for Cd14 and Mac1
expression by flow cytometry on the same day.
Quantitative RT-PCR
[0324] RNA was extracted (Qiagen RNeasy.TM. mini kit) and reverse
transcribed (GE Illustra.TM. ready-to-go RT-PCR beads) according to
the supplier's instruction. Quantitative PCR was performed using
SybrGreen.TM. mix and a BIO-RAD.TM. CFX connect cycler. Primers
used were:
TABLE-US-00003 b-Act-F GCTGTATTCCCCTCCATCGTG b-Act-R
CACGGTTGGCCTTAGGGTTCAG Chaf1b-R GGCTCCTTGCTGTCATTCATCTTCCAC
Chaf1b-F CACCGCCGTCAGGATCTGGAAGTTGG Chaf1a-R
GTGTCTTCCTCAACTTTCTCCTTGG Chaf1a-F CGCGGACAGCCGCGGCCGTGGATTGC.
SDS-PAGE and Western Blot Analysis
[0325] Whole-cell lysates from reprogramming intermediates were run
on 4-20% gradient SDS-polyacrylamide gels and transferred to
nitrocellulose membrane (Bio-Rad.TM.) by standard methods.
Membranes were blocked for 1 h in 5% non-fat dry milk in
1.times.TBS with 0.05% Tween-20 (TBST), rinsed, and incubated with
primary antibody diluted in 3% BSA in TBST overnight at 4.degree.
C. The following primary antibodies were used: anti-Chaf1a
(sc-10206, Santa Cruz.TM.), anti-Chaf1b (sc-393662, Santa
Cruz.TM.), anti-TBP (ab818, Abcam.TM.), HRP conjugate anti actin
(AC-15, Sigma.TM.) Blots were washed in TBST, incubated with
HRP-conjugated secondary antibodies for semi-quantitative Western
blot analysis and IR dye 800CW or IR dye 680RD for quantitative
westerns, as indicated. Secondary antibodies for both methods were
incubated in 5% milk in TBST for 1 hour at room temperature (except
for anti-.beta.-ACTIN-Peroxidase antibody, which was incubated for
15 min), and washed again. HRP signal was detected by Enhanced
ChemiLuminescence.TM. (Perkin Elmer.TM.) Fluorescent infrared
signal was detected using LI-COR Odyssey.TM. imaging system.
ATAC-Seq Chromatin Assay
[0326] To generate ATAC-seq libraries, 50,000 cells were used and
libraries were constructed as previously described.sup.39. Briefly,
cells were washed in PBS twice, counted and nuclei were isolated
from 100,000 cells using 100 ul hypotonic buffer (10 mM Tris pH
7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP40) to generate two independent
transposition reactions. Nuclei were split in half and treated with
2.5 .mu.L Tn5 Transposase (Illumina.TM.) for 30 min at 37.degree.
C. DNA from transposed nuclei was then isolated and PCR-amplified
using barcoded Nextera.TM. primers (Illumina.TM.). Library QC was
carried out using high sensitivity DNA bioanalyzer assay and qubit
measurement and sequenced using paired end sequencing (PESO) on
Illumina.TM. Hi-Seq 2500 platform.
Sono-Seq and ChIP-Seq Chromatin Assays
[0327] For all ChIP experiments, 10e7 reprogramming intermediates
were collected per library. Chromatin precipitation assays were
performed as previously described (Bernstein, B. et al. (2005) Cell
120:169-181) using goat polyclonal anti-Sox2 antibody (AF2018,
R&D.TM.). Briefly, cells were cross-linked on plate in 1%
methanol-free formaldehyde and snap-frozen in liquid nitrogen until
processed.
[0328] Nuclei were isolated using 1 ml of cell lysis buffer (20 mM
Tris pH8, 85 mM KCL, 0.5% NP40 and 1.times.HALT protease inhibitor
cocktail), resuspended in nuclear lysis buffer (10 mM Tris-HCL
pH7.5, 1% NP40, 0.5% Na deoxycholate, 0.1% SDS, 1.times.HALT
protease inhibitor cocktail) and sonicated using optimized pulses
of a Branson sonifier (1 min ON/OFF pulses for 5 cycles) for
ChIP-seq libraries and S220 Covaris.TM. sonicator (Settings: duty
cycle 5%, intensity 6, cycles/burst 200, pulse length 60 s, 20
cycles, 8.degree. C.) for sono-seq input preparations. Sonications
were verified for both methods using the 2100 Bioanalyzer.TM..
Immunoprecipitations were carried out by first adjusting salt
concentration in sheared chromatin to 167 mM NaCl and adding
antibodies (bug of Sox2 antibody) and incubated for 3-4 hrs at 4 C.
50 .mu.l Protein G Dynabeads (Invitrogen.TM.) were prepared for
each IP reaction by washing 2-3 times in ChIP dilution buffer (16.7
mM Tris-HCl pH 8.1, 167 mM NaCl, 0.01% SDS, 1.1% Triton X-100, 1.2
mM EDTA) and added for an additional hour to pull down bound
chromatin. Bead complexes were then washed 6 times in RIPA buffer
(20 mM Tris-HCL pH8.1, 1 mM EDTA, 140 mM NaCl, 1% Triton X-100,
0.1% SDS, 0.1% Na deoxycholate), then two times with RIPA with high
salt concentration (500 mM), then 2 washes in LiCL buffer (10 mM
tris-HCL pH 8.1, 1 mM EDTA, 1% DOC, 1% NP40, 250 mM LiCL) and 2
final washes in TE buffer. Complexes were then eluted and reverse
cross-linked in 50 ul ChIP elution buffer (10 mM Tris-HCL pH8, 5 mM
EDTA, 300 mM NaCl, 01% SDS) and 8 ul of reverse crosslinking buffer
(250 mM Tris-HCl pH 6.5, 1.25M NaCl, 62.5 mM EDTA, 5 mg/mL
Proteinase K, 62.5 ug/mL RNAse A) by incubation at 65.degree. C.
for 6 h. DNA was isolated using Ampure.TM. SPRI beads and yield
quantified using Qubit.TM. fluorometer. ChIP-seq libraries were
constructed from 10 ng of immunoprecipitated DNA using the
NEBNext.TM. ChIP-Seq Library Prep Reagent Set for Illumina.TM. (New
England Biolabs.TM.), following the supplier's protocol. Briefly,
purified DNA was end-repaired and dA-tailed. Following subsequent
ligation of sequencing adaptors, ligated DNA was size-selected to
isolate fragments in the range of 300-550 bp in length using Egels.
Adaptor-ligated fragments were enriched in a 14-cycle PCR using
Illumina.TM. multiplexing primers. Libraries were purified,
analyzed for correct size distribution using dsDNA High Sensitivity
Chips on a 2100 Bioanalyzer.TM. (Agilent.TM.), pooled and submitted
for single-end 50 bp Illumina.TM. GAII high-throughput
sequencing.
Sono-Seq Bioinformatics Analysis
[0329] The reads were aligned to mm9 using Bowtie with a unique
mapping option (Langmead et al. (2009) Genome Biology 10:R25). The
smoothed tag density profiles were generated using
get.smoothed.tag.density function of the SPP R package with a
100-bp Gaussian kernel, 50-bp step and library size normalization
(Kharchenko, P et al. (2008) Nature Biotechnology 26:1351-1359).
The positions of promoters and enhancers in ESCs and MEFs were
obtained from publicly available data set.sup.38. To access the
significance of the difference in the enrichment values between
CAF-1 and Renilla knockdown samples, a paired Wilcoxon rank sum
test was used.
ATAC-Seq Bioinformatics Analysis
[0330] The reads were aligned to the mouse genome mm9 using BWA
version 0.7.8 with -q 5-1 32-k 2 and paired option (Li and Durbin.
(2009) Bioinformatics 25:1754-1760). Non-primary mapping, failed
QC, duplicates and non-paired reads were filtered. Reads from
different chromosomes and chrM were also filtered. Only uniquely
mapped reads were used for the analysis. The read density profiles
were generated using 150 bp window with a 20 bp step and were
normalized by the library size. For the comparison between
Chaf1a.166 mutant and Renilla mutant, the read density profiles
were further normalized using the mean values of all annotated
promoters from mm9. The positions of promoters and enhancers in
mESC and MEF were obtained from publicly available data sets in
Sono-seq analyses.sup.38. The coordinates of the metagene plot in
super-enhancers were used from recently published datasets.sup.42.
For each superenhancer region, the tag density signals were
averaged into 101 bins, with the margin of 5 kb outside of
super-enhancers. Significantly enriched regions were detected using
Hotspot with FDR=0.01 74. The differential sites between CAF-1 KD
and Renilla KD were identified using DiffBind with p=0.05 for the
consensus ATAC-seq peaks (Ross-Innes et al (2012) Nature
481:389-393). DiffBind uses statistical routines developed in edgeR
(Robinson, M D et al. (2010) Bioinformatics 26:139-140. A one-sided
paired Wilcoxon rank sum test was used for the comparison in the
enrichment values between CAF-1 KD and Renilla KD.
Sox2 ChIP-Seq Bioinformatics Analysis
[0331] The reads were aligned to mm9 using Bowtie with a unique
mapping option (Langmead et al. (2009) Genome Biology 10:R25). The
smoothed tag density profiles for Sox2 were generated using
get.smoothed.tag.density function of the SPP R package with a
100-bp window, 50-bp step and library size normalization as in
Sono-seq analyses. The log 2 fold enrichment profiles were
generated using get.smoothed.enrichment.mle in SPP R package. The
same coordinates of promoters and enhancers in mESC and MEF were
used as in Sono-seq and ATAC-seq analyses. A paired Wilcoxon rank
sum test was used for the comparison in the enrichment values
between CAF-1 KD and Renilla KD for Sox2. For the peak comparison
in Sox2 between CAF-1 KD and Renilla KD, first the reads were
subsampled to make the sequencing depth the same from each
condition as the number of peaks called tends to increase as
sequencing depth is deeper. The significantly enriched peaks
compared inputs were detected using SPP find.binding.positions
function with e-value+10 (Kharchenko, P et al. (2008), supra). The
overlapped peaks were compared with a margin of 200 bp distance.
For the unique peaks, peaks which were present only from one
condition (CAF-1 KD or Renilla KD) were first identified. For the
peaks which were present from one condition, the enrichment values
(input-subtracted tag counts) were compared between CAF-1 KD and
Renilla KD. If the ratios between the enrichment values between
conditions were >2 fold, the peaks were considered as "unique"
for one of the conditions. mESC Sox2 data was used from publicly
available data sets.sup.43 and analyzed as described above.
H3K9Me3 ChIP-Seq Bioinformatics Analyses
[0332] ChIP sequencing data was mapped to the mouse genome (mm9)
with Bowtie 0.12.7 allowing up to three mismatches, and retaining
uniquely mapping reads. To assess H3K9me3 signal distribution
genome-wide, we divided the genome in 5 Kb intervals, and for each
interval, the ratio of RPM normalized signal in the IP and input
samples was calculated. Intervals with less than 10 reads in the
input samples (.about.10% of all) were excluded from further
analyses due to low coverage. Intervals overlapping specific
regions were extracted using the bedtools suite (Quinlan et al.
(2010) Bioinformatics 26:841-842. RRR region annotations were
obtained from Matoba et al.sup.45, and signal across all included 5
Kb intervals was averaged.
[0333] For H3K9me3 enrichment over TE bodies, the mm10 genome
version was used, as this release contains the most recent TE
annotations. The genomic regions corresponding to TE families
annotated in the mm10 RepeatMasker track in the UCSC genome browser
were extracted, and the normalized read counts in IP to input
samples were calculated for each family. Due to the repetitive
nature of TEs, all results were further validated considering reads
that map to multiple (up to 10000) positions in the genome, and
scaling read counts by the number of valid alignments. This
threshold for multiple mapping positions was chosen as it was
previously shown to approximate results obtained allowing unlimited
mapping positions, but at a significantly improved computation
speed (Pezic et al. (2014) Genes & Development 28:1410-1428).
In all analyses, signal estimates based on uniquely mapping reads,
and based on reads mapping to multiple genomic positions, produced
similar results.
RNA-Seq Analysis of Genes and Transposable Element Bioinformatics
Analysis
[0334] RNA sequencing data was first pre-processed using Reaper
(Davis, M P et al. (2013) Methods 63:41-49) to remove any Illumina
adapter sequences and computationally depleted of ribosomal RNA
sequences (GenBank identifiers: 18S, NR_003278.3; 28S, NR_003279.1;
5S, D14832.1; and 5.8S, K01367.1) using Bowtie 0.12.7 allowing 3
mismatches 71. For protein-coding gene expression analyses,
pre-processed data was mapped to the mouse genome (mm10) using
Bowtie 0.12.7 71 allowing 3 mismatches, and retaining uniquely
mapping reads. Mouse transcript annotations were obtained from
RefSeq, and reads corresponding to the exonic regions of each gene
were calculated using a custom phyton script. For overlapping
genes, reads corresponding to overlapping regions were divided
equally. Gene differential expression was analysed using the DESeq
R package80.
[0335] For TE expression analyses, data was mapped to the mm10
genome with 0 mismatches and considering reads that map to up to
10000 genomic positions as in ChIP sequencing analyses. The number
of reads corresponding to TE regions annotated by the UCSC
RepeatMasker track were calculated, scaling by the number of valid
alignments for each read. Scaled reads for each TE family were
summed, and normalized as RPM. Heatmaps were generated using the
gplots R package, and differential expression analyses were
performed using the DESeq R package (Anders and Huber. (2010)
Genome Biology 11:R106). Comparisons of RNA-sequencing results from
analyses based on uniquely mapping reads, and based on reads
mapping to multiple genomic positions, showed very similar
results.
Statistical Analyses
[0336] Unpaired student t test was used for statistical analysis in
replicates of cell biology experiments. All error bars represent
means.+-.SEM or STDEV of independent biological replicates as
indicated. A probability value of p<0.05 was considered
statistically significant. Numbers of replicate experiments (n) are
shown in figure legends. All graphs with no error bars represent
n=1. To assess significant differences in signal enrichment at ESC
promoters, enhancers or super-enhancers by Sono-seq, ATAC-seq and
ChIP-seq analysis upon CAF-1 knockdown or Renilla knockdown, a
paired Wilcoxon rank sum test was used, where it is assumed that
populations do not follow normal distributions. To identify
differential ATAC-seq peaks between CAF-1 and Renilla knockdown
samples, negative binomial models were used.
REFERENCES FOR BACKGROUND AND EXAMPLE 2
[0337] 1 Burton, A. & Torres-Padilla, M. E. Chromatin dynamics
in the regulation of cell fate allocation during early
embryogenesis. Nature reviews. Molecular cell biology 15, 723-734,
doi:10.1038/nrm3885 (2014). [0338] 2 Levine, M., Cattoglio, C.
& Tjian, R. Looping back to leap forward: transcription enters
a new era. Cell 157, 13-25, doi:10.1016/j.cell.2014.02.009 (2014).
[0339] 3 Margueron, R. & Reinberg, D. Chromatin structure and
the inheritance of epigenetic information. Nature reviews. Genetics
11, 285-296, doi:10.1038/nrg2752 (2010). [0340] 4 Yue, F. et al. A
comparative encyclopedia of DNA elements in the mouse genome.
Nature 515, 355-364, doi:10.1038/nature13992 (2014). [0341] 5 Lee,
T. I. & Young, R. A. Transcriptional regulation and its
misregulation in disease. Cell 152, 1237-1251,
doi:10.1016/j.cell.2013.02.014 (2013). [0342] 6 Takahashi, K. &
Yamanaka, S. Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell
126, 663-676, doi:10.1016/j.cell.2006.07.024 (2006). [0343] 7
Vierbuchen, T. & Wernig, M. Molecular roadblocks for cellular
reprogramming. Molecular cell 47, 827-838,
doi:10.1016/j.molcel.2012.09.008 (2012). [0344] 8 Iwafuchi-Doi, M.
& Zaret, K. S. Pioneer transcription factors in cell
reprogramming. Genes & development 28, 2679-2692,
doi:10.1101/gad.253443.114 (2014). [0345] 9 Stadtfeld, M. &
Hochedlinger, K. Induced pluripotency: history, mechanisms, and
applications. Genes & development 24, 2239-2263,
doi:10.1101/gad.1963910 (2010). [0346] 10 Polo, J. M. et al. A
molecular roadmap of reprogramming somatic cells into iPS cells.
Cell 151, 1617-1632, doi:10.1016/j.cell.2012.11.039 (2012). [0347]
11 Yang, C. S., Chang, K. Y. & Rana, T. M. Genome-wide
functional analysis reveals factors needed at the transition steps
of induced reprogramming. Cell reports 8, 327-337,
doi:10.1016/j.celrep.2014.07.002 (2014). [0348] 12 Mikkelsen, T. S.
et al. Dissecting direct reprogramming through integrative genomic
analysis. Nature 454, 49-55, doi:10.1038/nature07056 (2008). [0349]
13 Onder, T. T. et al. Chromatin-modifying enzymes as modulators of
reprogramming. Nature 483, 598-602, doi:10.1038/nature10953 (2012).
[0350] 14 Rais, Y. et al. Deterministic direct reprogramming of
somatic cells to pluripotency. Nature 502, 65-70,
doi:10.1038/nature12587 (2013). [0351] 15 Krizhanovsky, V. &
Lowe, S. W. Stem cells: The promises and perils of p53. Nature 460,
1085-1086, doi:10.1038/4601085a (2009). [0352] 16 Dejosez, M., Ura,
H., Brandt, V. L. & Zwaka, T. P. Safeguards for cell
cooperation in mouse embryogenesis shown by genome-wide cheater
screen. Science 341, 1511-1514, doi:10.1126/science.1241628 (2013).
[0353] 17 Qin, H. et al. Systematic identification of barriers to
human iPSC generation. Cell 158, 449-461,
doi:10.1016/j.cell.2014.05.040 (2014). [0354] 18 dos Santos, R. L.
et al. MBD3/NuRD facilitates induction of pluripotency in a
context-dependent manner. Cell stem cell 15, 102-110,
doi:10.1016/j.stem.2014.04.019 (2014). [0355] 19 Luo, M. et al.
NuRD blocks reprogramming of mouse somatic cells into pluripotent
stem cells. Stem cells 31, 1278-1286, doi:10.1002/stem.1374 (2013).
[0356] 20 Schwarz, B. A., Bar-Nur, O., Silva, J. C. &
Hochedlinger, K. Nanog is dispensable for the generation of induced
pluripotent stem cells. Current biology: CB 24, 347-350,
doi:10.1016/j.cub.2013.12.050 (2014). [0357] 21 Stuart, H. T. et
al. NANOG amplifies STAT3 activation and they synergistically
induce the naive pluripotent program. Current biology: CB 24,
340-346, doi:10.1016/j.cub.2013.12.040 (2014). [0358] 22 Carter, A.
C., Davis-Dusenbery, B. N., Koszka, K., Ichida, J. K. & Eggan,
K. Nanog-independent reprogramming to iPSCs with canonical factors.
Stem cell reports 2, 119-126, doi:10.1016/j.stemcr.2013.12.010
(2014). [0359] 23 Theunissen, T. W. et al. Nanog overcomes
reprogramming barriers and induces pluripotency in minimal
conditions. Current biology: CB 21, 65-71,
doi:10.1016/j.cub.2010.11.074 (2011). [0360] 24 Apostolou, E. &
Hochedlinger, K. Chromatin dynamics during cellular reprogramming.
Nature 502, 462-471, doi:10.1038/nature12749 (2013). [0361] 25
Suva, M. L., Riggi, N. & Bernstein, B. E. Epigenetic
reprogramming in cancer. Science 339, 1567-1570,
doi:10.1126/science.1230184 (2013). [0362] 26 Stadtfeld, M.,
Maherali, N., Borkent, M. & Hochedlinger, K. A reprogrammable
mouse strain from gene-targeted embryonic stem cells. Nature
methods 7, 53-55, doi:10.1038/nmeth.1409 (2010). [0363] 27 Zuber,
J. et al. RNAi screen identifies Brd4 as a therapeutic target in
acute myeloid leukaemia. Nature 478, 524-528,
doi:10.1038/nature10334 (2011). [0364] 28 Fellmann, C. et al. An
optimized microRNA backbone for effective single-copy RNAi. Cell
reports 5, 1704-1713, doi:10.1016/j.celrep.2013.11.020 (2013).
[0365] 29 Chen, J. et al. H3K9 methylation is a barrier during
somatic cell reprogramming into iPSCs. Nature genetics 45, 34-42,
doi:10.1038/ng.2491 (2013). [0366] 30 Soufi, A., Donahue, G. &
Zaret, K. S. Facilitators and impediments of the pluripotency
reprogramming factors' initial engagement with the genome. Cell
151, 994-1004, doi:10.1016/j.cell.2012.09.045 (2012). [0367] 31
Sridharan, R. et al. Proteomic and genomic approaches reveal
critical functions of H3K9 methylation and heterochromatin
protein-1gamma in reprogramming to pluripotency. Nature cell
biology 15, 872-882, doi:10.1038/ncb2768 (2013). [0368] 32 Hong, H.
et al. Suppression of induced pluripotent stem cell generation by
the p53-p21 pathway. Nature 460, 1132-1135, doi:10.1038/nature08235
(2009). [0369] 33 Kawamura, T. et al. Linking the p53 tumour
suppressor pathway to somatic cell reprogramming. Nature 460,
1140-1144, doi:10.1038/nature08311 (2009). [0370] 34 Li, H. et al.
The Ink4/Arf locus is a barrier for iPS cell reprogramming. Nature
460, 1136-1139, doi:10.1038/nature08290 (2009). [0371] 35 Marion,
R. M. et al. A p53-mediated DNA damage response limits
reprogramming to ensure iPS cell genomic integrity. Nature 460,
1149-1153, doi:10.1038/nature08287 (2009). [0372] 36 Utikal, J. et
al. Immortalization eliminates a roadblock during cellular
reprogramming into iPS cells. Nature 460, 1145-1148,
doi:10.1038/nature08285 (2009). [0373] 37 Quivy, J. P., Gerard, A.,
Cook, A. J., Roche, D. & Almouzni, G. The HP1-p150/CAF-1
interaction is required for pericentric heterochromatin replication
and S-phase progression in mouse cells. Nature structural &
molecular biology 15, 972-979 (2008). [0374] 38 Hoek, M. &
Stillman, B. Chromatin assembly factor 1 is essential and couples
chromatin assembly to DNA replication in vivo. Proceedings of the
National Academy of Sciences of the United States of America 100,
12183-12188, doi:10.1073/pnas.1635158100 (2003). [0375] 39 Ye, X.
et al. Defective S phase chromatin assembly causes DNA damage,
activation of the S phase checkpoint, and S phase arrest. Molecular
cell 11, 341-351 (2003). [0376] 40 Chanda, S. et al. Generation of
induced neuronal cells by the single reprogramming factor ASCL1.
Stem cell reports 3, 282-296, doi:10.1016/j.stemcr.2014.05.020
(2014). [0377] 41 Bussmann, L. H. et al. A robust and highly
efficient immune cell reprogramming system. Cell stem cell 5,
554-566, doi:10.1016/j.stem.2009.10.004 (2009). [0378] 42 Smith, S.
& Stillman, B. Purification and characterization of CAF-I, a
human cell factor required for chromatin assembly during DNA
replication in vitro. Cell 58, 15-25 (1989). [0379] 43 Auerbach, R.
K. et al. Mapping accessible chromatin regions using Sono-Seq.
Proceedings of the National Academy of Sciences of the United
States of America 106, 14926-14931, doi:10.1073/pnas.0905443106
(2009). [0380] 44 Heinz, S., Romanoski, C. E., Benner, C. &
Glass, C. K. The selection and function of cell type-specific
enhancers. Nature reviews. Molecular cell biology,
doi:10.1038/nrm3949 (2015). [0381] 45 Shen, Y. et al. A map of the
cis-regulatory sequences in the mouse genome. Nature 488, 116-120,
doi:10.1038/nature11243 (2012). [0382] 46 Buenrostro, J. D.,
Giresi, P. G., Zaba, L. C., Chang, H. Y. & Greenleaf, W. J.
Transposition of native chromatin for fast and sensitive epigenomic
profiling of open chromatin, DNA-binding proteins and nucleosome
position. Nature methods 10, 1213-1218, doi:10.1038/nmeth.2688
(2013). [0383] 47 Hnisz, D. et al. Super-enhancers in the control
of cell identity and disease. Cell 155, 934-947,
doi:10.1016/j.cell.2013.09.053 (2013). [0384] 48 Pott, S. &
Lieb, J. D. What are super-enhancers? Nature genetics 47, 8-12,
doi:10.1038/ng.3167 (2014). [0385] 49 Whyte, W. A. et al. Master
transcription factors and mediator establish super enhancers at key
cell identity genes. Cell 153, 307-319,
doi:10.1016/j.cell.2013.03.035 (2013). [0386] 50 Marson, A. et al.
Connecting microRNA genes to the core transcriptional regulatory
circuitry of embryonic stem cells. Cell 134, 521-533,
doi:10.1016/j.cell.2008.07.020 (2008). [0387] 51 Tahmasebi, S.,
Ghorbani, M., Savage, P., Gocevski, G. & Yang, X. J. The SUMO
conjugating enzyme Ubc9 is required for inducing and maintaining
stem cell pluripotency. Stem cells 32, 1012-1020,
doi:10.1002/stem.1600 (2014). [0388] 52 Bilodeau, S., Kagey, M. H.,
Frampton, G. M., Rahl, P. B. & Young, R. A. SetDB1 contributes
to repression of genes encoding developmental regulators and
maintenance of ES cell state. Genes & development 23,
2484-2489, doi:10.1101/gad.1837309 (2009). [0389] 53 Mochizuki, K.
et al. The bromodomain protein Brd4 stimulates G1 gene
transcription and promotes progression to S phase. The Journal of
biological chemistry 283, 9040-9048, doi:10.1074/jbc.M707603200
(2008). [0390] 54 Houlard, M. et al. CAF-1 is essential for
heterochromatin organization in pluripotent embryonic cells. PLoS
genetics 2, e181, doi:10.1371/journal.pgen.0020181 (2006). [0391]
55 Nacerddine, K. et al. The SUMO pathway is essential for nuclear
integrity and chromosome segregation in mice. Developmental cell 9,
769-779, doi:10.1016/j.devcel.2005.10.007 (2005). [0392] 56
Schmidt, C. S. et al. Global DNA hypomethylation prevents
consolidation of differentiation programs and allows reversion to
the embryonic stem cell state. PloS one 7, e52629,
doi:10.1371/journal.pone.0052629 (2012). [0393] 57 Henderson, D.
S., Banga, S. S., Grigliatti, T. A. & Boyd, J. B. Mutagen
sensitivity and suppression of position-effect variegation result
from mutations in mus209, the Drosophila gene encoding PCNA. The
EMBO journal 13, 1450-1459 (1994). [0394] 58 Ng, R. K. et al.
Epigenetic restriction of embryonic cell lineage fate by
methylation of Elf5. Nature cell biology 10, 1280-1290,
doi:10.1038/ncb1786 (2008). [0395] 59 Davis, R. L., Weintraub, H.
& Lassar, A. B. Expression of a single transfected cDNA
converts fibroblasts to myoblasts. Cell 51, 987-1000 (1987). [0396]
60 Ray-Gallet, D. et al. Dynamics of histone H3 deposition in vivo
reveal a nucleosome gap-filling mechanism for H3.3 to maintain
chromatin integrity. Molecular cell 44, 928-941,
doi:10.1016/j.molcel.2011.12.006 (2011). [0397] 61 Zentner, G. E.
& Henikoff, S. Regulation of nucleosome dynamics by histone
modifications. Nature structural & molecular biology 20,
259-266, doi:10.1038/nsmb.2470 (2013). [0398] 62 Skene, P. J. &
Henikoff, S. Chromatin roadblocks to reprogramming 50 years on. BMC
biology 10, 83, doi:10.1186/1741-7007-10-83 (2012). [0399] 63
Jullien, J. et al. HIRA dependent H3.3 deposition is required for
transcriptional reprogramming following nuclear transfer to Xenopus
oocytes. Epigenetics & chromatin 5, 17,
doi:10.1186/1756-8935-5-17 (2012). [0400] 64 Wen, D., Banaszynski,
L. A., Rosenwaks, Z., Allis, C. D. & Rafii, S. H3.3 replacement
facilitates epigenetic reprogramming of donor nuclei in somatic
cell nuclear transfer embryos. Nucleus 5, 369-375,
doi:10.4161/nucl.36231 (2014). [0401] 65 Matoba, S. et al.
Embryonic development following somatic cell nuclear transfer
impeded by persisting histone methylation. Cell 159, 884-895,
doi:10.1016/j.cell.2014.09.055 (2014). [0402] 66 Consortium, S. G.
Epigenetics Probes Collection [0403] 67 Bar-Nur, O. et al. Small
molecules facilitate rapid and synchronous iPSC generation. Nature
methods 11, 1170-1176, doi:10.1038/nmeth.3142 (2014). [0404] 68
Zuber, J. et al. Toolkit for evaluating genes required for
proliferation and survival using tetracycline-regulated RNAi.
Nature biotechnology 29, 79-83, doi:10.1038/nbt.1720 (2011). [0405]
69 Bernstein, B. E. et al. Genomic maps and comparative analysis of
histone modifications in human and mouse. Cell 120, 169-181,
doi:10.1016/j.cell.2005.01.001 (2005). [0406] 70 Langmead, B.,
Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory
efficient alignment of short DNA sequences to the human genome.
Genome biology 10, R25, doi:10.1186/gb-2009-10-3-r25 (2009). [0407]
71 Kharchenko, P. V., Tolstorukov, M. Y. & Park, P. J. Design
and analysis of ChIPseq experiments for DNA-binding proteins.
Nature biotechnology 26, 1351-1359, doi:10.1038/nbt.1508 (2008).
[0408] 72 Li, H. & Durbin, R. Fast and accurate short read
alignment with Burrows-Wheeler transform. Bioinformatics 25,
1754-1760, doi:10.1093/bioinformatics/btp324 (2009). [0409] 73
Sabo, P. J. et al. Discovery of functional noncoding elements by
digital analysis of chromatin structure. Proceedings of the
National Academy of Sciences of the United States of America 101,
16837-16842, doi:10.1073/pnas.0407387101 (2004). [0410] 74
Ross-Innes, C. S. et al. Differential oestrogen receptor binding is
associated with clinical outcome in breast cancer. Nature 481,
389-393, doi:10.1038/nature10730 (2012)
Sequence CWU 1
1
23125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1gcaaactggg gcacagatga tgcgg 25220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2cgcctcccct acccggtaga 20329DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3tagccccttg aattccgagg
cagtaggca 29449DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 4atgatacggc gaccaccgag atctacacct
aaagtagccc cttgaattc 49545DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 5caagcagaag acggcatacg
agacgatagt gaagccacag atgta 45645DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 6caagcagaag acggcatacg
agacactagt gaagccacag atgta 45745DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 7caagcagaag acggcatacg
agactatagt gaagccacag atgta 45845DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 8caagcagaag acggcatacg
agaccttagt gaagccacag atgta 45923DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 9cggcttcttt tacttctgca tac
231023DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10aaggaaggag tcaagactga gaa 231121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11aggtcggtgt gaacggattt g 211219DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 12tagtgaagcc acagatgta
191341DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13aatgatacgg cgaccaccga ctaaagtagc cccttgaatt c
411420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 14ggggtatgga cccatcattt 201522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
15cggaatctga tctgcctcat tg 221623DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 16tgtagaccat gtagttgagg tca
231742DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primermisc_feature(22)..(23)This region may be "ga" or
"tg" or "at" 17caagcagaag acggcatacg addtagtgaa gccacagatg ta
421821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 18gctgtattcc cctccatcgt g 211922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
19cacggttggc cttagggttc ag 222027DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 20ggctccttgc tgtcattcat
cttccac 272126DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 21caccgccgtc aggatctgga agttgg
262225DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 22gtgtcttcct caactttctc cttgg 252326DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23cgcggacagc cgcggccgtg gattgc 26
* * * * *