U.S. patent application number 15/850957 was filed with the patent office on 2018-11-08 for regulated expression of antigen and/or regulated attenuation to enhance vaccine immunogenicity and/or safety.
The applicant listed for this patent is The Arizona Board of Regents for and on Behalf of Arizona State University, The Washington University. Invention is credited to Roy Curtiss, III, Wei Kong, Soo-young Wanda, Shifeng Wang.
Application Number | 20180320189 15/850957 |
Document ID | / |
Family ID | 40378885 |
Filed Date | 2018-11-08 |
United States Patent
Application |
20180320189 |
Kind Code |
A1 |
Curtiss, III; Roy ; et
al. |
November 8, 2018 |
REGULATED EXPRESSION OF ANTIGEN AND/OR REGULATED ATTENUATION TO
ENHANCE VACCINE IMMUNOGENICITY AND/OR SAFETY
Abstract
The invention relates to compositions and methods for making and
using recombinant bacteria that are capable of regulated
attenuation and/or regulated expression of one or more antigens of
interest.
Inventors: |
Curtiss, III; Roy;
(Gainesville, FL) ; Wang; Shifeng; (Gainesville,
FL) ; Wanda; Soo-young; (Gainesville, FL) ;
Kong; Wei; (Phoenix, AZ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Arizona Board of Regents for and on Behalf of Arizona State
University
The Washington University |
Scottsdale
St. Louis |
AZ
MO |
US
US |
|
|
Family ID: |
40378885 |
Appl. No.: |
15/850957 |
Filed: |
December 21, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15040005 |
Feb 10, 2016 |
9885051 |
|
|
15850957 |
|
|
|
|
13789665 |
Mar 7, 2013 |
9297015 |
|
|
15040005 |
|
|
|
|
12615872 |
Nov 10, 2009 |
8445254 |
|
|
13789665 |
|
|
|
|
PCT/US2008/063293 |
May 9, 2008 |
|
|
|
12615872 |
|
|
|
|
60917313 |
May 10, 2007 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 37/04 20180101;
C12N 1/36 20130101; A61K 39/00 20130101; A61K 35/74 20130101; A61K
2039/523 20130101; A61K 2035/11 20130101; A61K 2039/522 20130101;
C12N 15/74 20130101 |
International
Class: |
C12N 15/74 20060101
C12N015/74; A61K 39/00 20060101 A61K039/00; C12N 1/36 20060101
C12N001/36 |
Goverment Interests
GOVERNMENTAL RIGHTS
[0002] This invention was made with government support under Grant
Nos. 5RO1DE006669, 5RO1A1056289, RO1A124533, and RO1A1057885
awarded by the National institutes of Health, and Grant Nos.
99-35204-8572, 2001-02994, and 2003-35204-13748, awarded by the
United States Department of Agriculture. The government has certain
rights in the invention.
Claims
1. A recombinant bacterium capable of regulated expression of at
least one nucleic acid sequence encoding an antigen of interest,
wherein the bacterium comprises: a. at least one chromosomally
integrated nucleic acid sequence encoding a repressor operably
linked to a regulatable promoter, wherein the nucleic acid sequence
encoding the repressor and/or promoter have been modified from the
wild-type nucleic acid sequence so as to optimize the expression
level of the nucleic acid sequence encoding the repressor; b. a
vector comprising at least one nucleic acid sequence encoding an
antigen of interest operably linked to a promoter regulated by the
repressor, such that the expression of the nucleic acid sequence
encoding the antigen is repressed during in vitro growth of the
bacterium, but the bacterium is capable of high level expression of
the nucleic acid sequence encoding the antigen in a host; and c. a
deletion in sifA, a deletion in pabA, a deletion in pabB, a
deletion in both pabA and pabB, or a deletion in pmi.
2. The recombinant bacterium of claim 1, wherein the bacterium
further comprises the mutation .DELTA.asdA::TT araC P.sub.BAD
c2.
3. The recombinant bacterium of claim 1, wherein the bacterium
further comprises the mutation .DELTA.relA::araC P.sub.BAD lacI
TT.
4. A recombinant bacterium capable of regulated expression of at
least one nucleic acid sequence encoding an antigen of interest,
wherein the bacterium comprises: a. at least one chromosomally
integrated nucleic acid sequence encoding a repressor operably
linked to a regulatable promoter, wherein the nucleic acid sequence
encoding the repressor and/or promoter have been modified from the
wild-type nucleic acid sequence so as to optimize the expression
level of the nucleic acid sequence encoding the repressor, b. a
vector comprising at least one nucleic acid sequence encoding an
antigen of interest operably linked to a promoter regulated by the
repressor, such that the expression of the nucleic acid sequence
encoding the antigen is repressed during in vitro growth of the
bacterium, but the bacterium is capable of high level expression of
the nucleic acid sequence encoding the antigen in a host; and c.
the mutation .DELTA.P.sub.murA::TT araC P.sub.BAD murA.
5. The recombinant bacterium of claim 4, wherein the bacterium
further comprises a deletion in asd.
6. The recombinant bacterium of claim 4, wherein the bacterium
further comprises the mutation .DELTA.asdA::TT araC P.sub.BAD
c2.
7. The recombinant bacterium of claim 1, wherein the repressor is
selected from the group consisting of LacI, C2, and C1.
8. The recombinant bacterium of claim 1, wherein the nucleic acid
sequence encoding the repressor comprises a modified Shine-Dalgarno
sequence and optimized codons so as to optimize the expression
level of the nucleic acid sequence encoding the repressor.
9. The recombinant bacterium of claim 1, wherein the vector is a
plasmid.
10. The recombinant bacterium of claim 1, wherein the nucleic acid
encoding the antigen of interest is operably linked to a P.sub.trc
promoter.
11. The recombinant bacterium of claim 1, wherein the antigen of
interest is toxic.
12. The recombinant bacterium of claim 1, wherein the vector
further comprises a nucleic acid sequence encoding a secretion
signal for the antigen of interest.
13. The recombinant bacterium of claim 1, wherein the bacterium is
capable of eliciting a protective immune response in the host.
14. The recombinant bacterium of claim 1, wherein the bacterium
comprises more than one means of attenuation.
15. The recombinant bacterium of claim 1, wherein the repressor is
LacI; the regulatable promoter is selected from the group
consisting of P.sub.rhaBAD, P.sub.xylAB, and P.sub.xylFGH; the
vector is a plasmid; and the nucleic acid sequence encoding the
antigen of interest is operably linked to the P.sub.trc
promoter.
16. A vaccine composition comprising the recombinant bacterium of
claim 1.
17. A method for eliciting an immune response in a host, the method
comprising administering to the host an effective amount of a
vaccine composition comprising a recombinant bacterium of claim 1.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 13/789,665, filed Mar. 7, 2013, which is a continuation of U.S.
application Ser. No. 12/615,872, filed Nov. 10, 2009, which is a
continuation-in part of application number PCT/US2008/063293, filed
May 9, 2008, which claims the priority of U.S. provisional
application No. 60/917,313, filed May 10, 2007, each of which is
hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0003] The invention relates to compositions and methods for making
and using recombinant bacteria that are capable of regulated
attenuation and/or regulated expression of at least one nucleic
acid encoding an antigen of interest.
BACKGROUND OF THE INVENTION
[0004] Recombinant microorganisms have widespread utility and
importance. One use of these microorganisms is as live vaccines to
produce an immune response. Live vaccines are most effective when
they produce high levels of antigen. However, the synthesis of a
recombinant antigen encoded by a highly expressed nucleic acid
sequence may be deleterious to the microorganism. Because of this,
regulated (as opposed to constitutive) expression systems have been
identified and utilized where the recombinant nucleic acid sequence
of interest is operably linked to control elements that allow
expression of significant amounts of the recombinant nucleic acid
sequence only when it is induced, derepressed or activated.
Examples include the cspA nucleic acid sequence promoter, the phoA
nucleic acid sequence promoter, P.sub.BAD (in an araC-P.sub.BAD
system), the trp promoter, the tac promoter, the trc promoter,
.lamda. P.sub.L, P22 P.sub.R, mal promoters, rha promoter, xyl
promoter, and the lac promoter. These promoters may mediate
transcription at low temperature, at low phosphate levels, in the
presence of arabinose, in the presence of at low tryptophan levels,
in the presence of rhamanose, in the presence of xylose, and in the
presence of lactose (or other lac inducers).
[0005] When the recombinant microorganism is used as a vertebrate
live vaccine, certain considerations must be taken into account. To
provide a benefit beyond that of a nonliving vaccine, the live
vaccine microorganism must attach to, invade, and survive in
lymphoid tissues of the vertebrate and expose these immune effector
sites to antigen for an extended period of time. Through this
continual stimulation, the vertebrate's immune system becomes more
highly reactive to the antigen than with a nonliving vaccine.
Therefore, preferred live vaccines are attenuated pathogens of the
vertebrate, particularly pathogens that colonize the gut-associated
lymphoid tissue (GALT), nasopharynx-associated lymphoid tissue
(NALT) or bronchial-associated lymphoid tissue (BALT). An
additional advantage of these attenuated pathogens over nonliving
vaccines is that these pathogens have elaborate mechanisms to gain
access to lymphoid tissues, and thus efficient exposure to the
vertebrate's immune system can be expected. In contrast, nonliving
vaccines will only provide an immune stimulus if the vaccine is
passively exposed to the immune system, or if host mechanisms bring
the vaccine to the immune system.
[0006] Pathogenic bacteria may be attenuated by mutation so that
upon infection, host disease symptomology is not elicited. Most
means of attenuation, however, make live vaccine strains more
susceptible than wild-type strains to environmental stresses
encountered after inoculation into the animal or human host.
Consequently, fewer bacteria survive to colonize the GALT, NALT
and/or BALT with a reduction in effective immunogenicity of the
vaccine. Thus these attenuation mechanisms hyperattenuate the
vaccine, precluding the candidate vaccine from either reaching or
persisting in lymphoid tissues to a sufficient extent or duration
to permit induction of a protective immune response against the
wild-type pathogen of interest. Thus, there is a need in the art
for methods of regulating the expression of the attenuated
phenotype. This allows the live vaccine strain to display abilities
similar to a wild-type virulent parental pathogen in order to
successfully colonize effector lymphoid tissues prior to the
display and imposition of the full attenuated phenotype to preclude
induction of disease symptoms.
[0007] Since immune responses induced against foreign antigens are
proportional to the levels of antigen synthesized by the
recombinant attenuated bacterial vaccine (1,3), the placement of
the nucleic acid sequence for the foreign antigen on a multi-copy
plasmid vector is much preferable to the insertion of the nucleic
acid sequence for the foreign antigen into the chromosome of the
attenuated bacterial vaccine vector. This is because the level of
foreign antigen synthesis is generally proportional to the number
of copies of the nucleic acid sequence for the foreign antigen
expressed within the attenuated bacterial host.
[0008] Since plasmid-containing recombinant attenuated bacterial
vaccines overproduce large amounts of antigen that provide no
advantage to the vaccine, the plasmid vectors are often lost over
time after immunization. In many cases, ten percent or less of the
recombinant attenuated bacterial vaccine isolated from the
immunized vertebrate retains the plasmid after three or four days.
When this plasmid loss occurs, the immune response is directed more
against the attenuated bacterial host vaccine itself rather than
against the expressed foreign antigen.
[0009] As stated above, the level of immune response to a foreign
antigen is generally proportional to the level of expression of the
nucleic acid sequence encoding the antigen. Encoding the protective
antigen on a plasmid vector is important in maximizing the
production of that protective antigen, which is very much
correlated with the ability to induce high level protective immune
responses by production of mucosal and systemic antibodies against
the protective antigen. Unfortunately, overexpression of nucleic
acid encoding a foreign antigen is often toxic such that it reduces
the rate of growth and therefore the ability of the attenuated
bacterial vaccine to colonize lymphoid tissues. As a consequence,
the ultimate immunogenicity is sharply diminished. For this reason,
it is necessary to balance the ability of the vaccine to colonize
and grow in lymphoid tissues with the ability to synthesize the
foreign antigen.
SUMMARY OF THE INVENTION
[0010] One aspect of the present invention encompasses a
recombinant bacterium capable of the regulated expression of at
least one nucleic acid sequence encoding an antigen of interest,
and capable of regulated attenuation. The bacterium comprises at
least one chromosomally integrated nucleic acid sequence encoding a
repressor operably linked to a regulatable promoter and a vector
comprising a nucleic acid sequence encoding at least one antigen of
interest operably linked to a promoter regulated by the repressor,
such that the expression of the nucleic acid sequence encoding the
antigen is repressed during in vitro growth of the bacterium, but
the bacterium is capable of high level expression of the nucleic
acid sequence encoding the antigen in a host. The bacterium further
comprises a regulatable promoter chromosomally integrated so as to
replace the native promoter of, and be operably-linked to, at least
one nucleic acid sequence of an attenuation protein.
[0011] Another aspect of the invention encompasses a recombinant
bacterium capable of regulated expression of at least one nucleic
acid sequence encoding an antigen of interest. The bacterium
comprises at least one chromosomally integrated nucleic acid
sequence encoding a repressor operably linked to a regulatable
promoter, wherein the nucleic acid sequence encoding the repressor
and/or promoter have been modified from the wild-type nucleic acid
sequence so as to optimize the expression level of the nucleic acid
sequence encoding the repressor, and a vector comprising at least
one nucleic acid sequence encoding an antigen of interest operably
linked to a promoter regulated by the repressor, such that the
expression of the nucleic acid sequence encoding the antigen is
repressed during in vitro growth of the bacterium, but the
bacterium is capable of high level expression of the nucleic acid
sequence encoding the antigen in a host.
[0012] Yet another aspect of the invention encompasses a
recombinant bacterium capable of regulated attenuation. The
bacterium comprises a modified regulatable promoter chromosomally
integrated so as to replace the native promoter of, and be operably
linked to, at least one nucleic acid sequence encoding an
attenuation protein.
[0013] Other aspects and iterations of the invention are described
more thoroughly below.
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIG. 1 depicts an illustration of various deletion-insertion
mutations of relA and various embodiments of lacI optimization. The
schematic shows the deletion of 2247 bp (relA-12 to relA 2235/2235)
and insertion of 2429 bp of araC P.sub.BAD lacI TT. The optimized
sequences of .DELTA.relA196::araC P.sub.BAD lacI TT (SEQ ID NO:1),
.DELTA.relA197::araC P.sub.BAD lacI TT (SEQ ID NO:2), and
.DELTA.relA198::araC P.sub.BAD (SEQ ID NO:3) lacI* TT show
variations of SD sequences and start codons. lacI*: codon
optimized.
[0015] FIG. 2 depicts an illustration of a chromosomal map of the
deletion-insertion mutation of endA and various embodiments of lacI
optimization. The schematic shows the deletion of 719 bp (endA-11
to endA 708/708) and insertion of 2429 bp of araC P.sub.BAD lacI
TT. The optimized sequences of .DELTA.endA19::araC P.sub.BAD lacI
TT (SEQ ID NO:4), .DELTA.endA20::araC P.sub.BAD lacI TT (SEQ ID
NO:5), and .DELTA.endA21::araC P.sub.BAD lacI* TT (SEQ ID NO:6)
show variations of SD sequences and start codons.
[0016] FIG. 3A and FIG. 3B depict an illustration of nucleic acid
sequence modification analyses of SD-lacI in .DELTA.endA19 and
.DELTA.relA196 (SEQ ID NO:7), SD-lacI in .DELTA.endA20 and
.DELTA.relA197 (SEQ ID NO:8), and SD-lacI in .DELTA.endA21 and
.DELTA.relA198 (SEQ ID NO:9). The amino acid sequence of LacI is
included (SEQ ID NO:10).
[0017] FIG. 4 depicts an illustration of a chromosomal map of
various deletion-insertion mutations of asdA and various
embodiments of c2 optimization. The schematic shows the deletion of
1104 bp from the asd nucleic acid sequence (1 to 1104 not including
TAG stop codon) and the insertion of 1989 bp of c2 P.sub.BAD araC
TT. The optimized sequences of .DELTA.asdA18::TT araC P.sub.BAD c2
(SEQ ID NO:11), .DELTA.asdA20::TT araC P.sub.BAD c2* (SEQ ID
NO:12), .DELTA.asdA21::TT araC P.sub.BAD c2* (SEQ ID NO:13), and
.DELTA.asdA27::TT araC P.sub.BAD* c2** (SEQ ID NO:14) show
variations of SD sequences and start codons. P.sub.BAD*: the -10
sequence is improved from TACTGT to TATAAT; c2*: SD-codon
optimized; c2**: SD-codon optimized and second codon is modified to
AAA from AAT.
[0018] FIG. 5 depicts an illustration of c2 original sequence (SEQ
ID NO:15) aligned with the optimized sequence (SEQ ID NO:16). The
amino acid sequence of the optimized sequence is shown (SEQ ID
NO:17). According to the actual DNA sequence data, the amino acid
at position 49 has been altered to serine (S) from aspartic acid
(N) (AAC to AGC).
[0019] FIG. 6 depicts an illustration of the original (SEQ ID
NO:18) and the modified (SEQ ID NO:19) P.sub.BAD region and the
original (SEQ ID NO:20) and modified (SEQ ID NO:21) c2 sequence.
The original C2 amino acid sequence (SEQ ID NO:22) is compared to
the optimized sequence (SEQ ID NO:23).
[0020] FIG. 7 depicts an illustration of a chromosomal map of the
deletion-insertion mutation of the crp promoter region. The
schematic shows the deletion of the crp promoter region (-15 to
-109) and the insertion of 1335 bp of TT araC P.sub.BAD. TT: T4
ipIII Transcription Terminator
[0021] FIG. 8 depicts an illustration of a chromosomal map of
various deletion-insertion mutations of the fur promoter region.
The schematic shows the deletion of the fur promoter region (-15 to
-253; including Fur consensus, Crp binding, and OxyR binding sites)
and the insertion of 1335 bp of P.sub.BAD araC TT. The optimized
sequences of .DELTA.P.sub.fur33::TT araC P.sub.BAD fur (SEQ ID
NO:24), .DELTA.P.sub.fur77::TT araC P.sub.BAD fur (SEQ ID NO:25),
and .DELTA.P.sub.fur81::TT araC P.sub.BAD fur (SEQ ID NO:26) show
variations of SD sequences and start codons.
[0022] FIG. 9 depicts an illustration of a chromosomal map of
various deletion-insertion mutations of the phoPQ promoter region.
The schematic shows the deletion of the phoPQ promoter region (-12
to -109) and the insertion of 1335 bp of P.sub.BAD araC TT. The
optimized sequences of .DELTA.P.sub.phoPQ107::TT araC P.sub.BAD
phoPQ (SEQ ID NO:27), .DELTA.P.sub.phoPQ173::TT araC P.sub.BAD
phoPQ (SEQ ID NO:28), and .DELTA.P.sub.phoPQ177::TT araC P.sub.BAD
phoPQ (SEQ ID NO:29), .DELTA.P.sub.phoPQ174::TT araC P.sub.BAD
phoPQ (SEQ ID NO:30), .DELTA.P.sub.phoPQ175::TT araC P.sub.BAD
.DELTA.GAG-phoPQ (SEQ ID NO:31), and .DELTA.P.sub.phoPQ176::TT araC
P.sub.BAD .OMEGA.CTC-phoPQ (SEQ ID NO:32) show variations of SD
sequences and start codons.
[0023] FIG. 10 depicts an illustration of a chromosomal map of the
deletion-insertion mutation of the rpoS promoter region. The
schematic shows the deletion of 36 bp of the rpoS promoter region
(rpoS-13 to -48) and the insertion of 1335 bp of P.sub.BAD araC
TT.
[0024] FIG. 11 depicts an illustration of a chromosomal map of the
deletion-insertion mutation of the murA promoter region. The
schematic shows the deletion of 42 bp between murA and yrbA and the
insertion of 1335 bp of P.sub.BAD araC TT.
[0025] FIG. 12 depicts an illustration of the pYA3493 plasmid.
[0026] FIG. 13 depicts an illustration of the pYA3634 plasmid.
[0027] FIG. 14 depicts an illustration of the pYA3681 plasmid.
[0028] FIG. 15 depicts a photograph and a graph showing results
from a western blot analysis on Salmonella UK-1 .DELTA.relA::araC
P.sub.BAD lacI (GTG vs ATG vs ATG codon) TT mutations using rabbit
LacI antiserum.
[0029] FIG. 16 depicts a photograph showing results from a western
blot analysis on Salmonella UK-1 .DELTA.asdA::TT araC P.sub.BAD c2
mutants using polyclonal C2 antiserum.
[0030] FIG. 17 depicts an illustration of a chromosomal map of the
deletion-insertion mutation of the araC P.sub.BAD region and the
DNA sequence of P22 P.sub.R araB region (SEQ ID NO: 33). The
schematic shows the deletion of 1169 bp including 846 bp of araC
and 323 bp of the P.sub.BAD region and the insertion of 91 bp of
P22 P.sub.R sequence.
[0031] FIG. 18 depicts a graph showing survival after S. pneumoniae
challenge.
[0032] FIG. 19A, FIG. 19B and FIG. 19C depict principle of
regulated delayed expression and constructions of strains with
.DELTA.relA::araC P.sub.BAD lacI TT cassette. (FIG. 19A) Principle
of regulated delayed expression. This system includes a chromosomal
repressor gene, lacI, expressed from the arabinose-regulated araC
P.sub.BAD promoter. LacI regulates expression from a plasmid
promoter, P.sub.trc that directs antigen synthesis. In the presence
of arabinose, LacI is produced which binds to P.sub.trc, blocking
antigen encoding sequence expression. In host tissues, an arabinose
poor environment, the concentration of LacI will decrease with each
cell division allowing increased antigen synthesis, thus inducing
an immune response. (FIG. 19B) Strains with different levels of
LacI encoding sequence expression due to altered SD-sequence, start
codon and codon usage in the lacI gene were inserted into the relA
gene site of the Salmonella genome. The deletion-insertion deleted
2247 bp in relA (relA-12 to relA 2235) and inserted 2429 bp of araC
P.sub.BAD lacI TT cassette. These mutations were also introduced
into strains with the .DELTA.pabA .DELTA.pabB .DELTA.asdA
.DELTA.araBAD genotype to provide attenuation, selection for a
balanced-lethal vector (Asd.sup.+) and to block arabinose
metabolism. (FIG. 19C) Western blot analysis of .DELTA.relA::araC
P.sub.BAD lacI (GTG vs. ATG vs. ATG codon optimized) mutations
using rabbit anti-LacI antiserum. The strains were grown in 3XD
media with different concentrations of arabinose. The samples were
normalized by cell number. Densitometry was measured by Quantityone
software. The number shows the relative densitometry.
[0033] FIG. 20A and FIG. 20B depict two graphs showing that higher
expression of LacI encoding sequence does not change growth. The
strains were grown in LB media with 0% (dashed line) and 0.2%
arabinose (solid line). The OD.sub.600 was measured at 40 min
intervals.*, .chi.9097, .tangle-solidup., .chi.9095,
.circle-solid., .chi.9101, .box-solid., .chi.9241 (FIG. 20A)
Strains without antigen encoding sequence expression plasmid. DAP
was included in the growth medium for these strains. (FIG. 20B)
Strains with antigen encoding sequence expression plasmid
pYA4088.
[0034] FIG. 21A, FIG. 21B and FIG. 21C depict a series of graphs
illustrating the effect of arabinose on gfp expression and the
kinetics of LacI decrease and PspA antigen increase. (FIG. 21A)
Different repression levels of GFP synthesis achieved by varied
concentrations of arabinose. These strains have plasmid pYA4090
expressing GFP with P.sub.trc promoter. Overnight nutrient broth
cultures grown without arabinose were diluted 1:100 into pre-warmed
nutrient broth with 2%, 0.2%, 0.02%, 0.002% and 0% arabinose. When
OD.sub.600 reached 0.4, samples were diluted 1:100 into PBS and
subjected to FACS analysis. (FIG. 21B) Kinetics of GFP synthesis.
Overnight cultures with different concentrations of arabinose were
diluted 1:100 into pre-warmed nutrient broth with arabinose; grown
to OD600 of 0.6, and diluted 1:100 into the same pre-warmed media
without arabinose. The process was repeated two more times. At each
time point of OD.sub.600 about 0.6, samples were diluted 1:200 into
PBS and subjected to FACS analysis. (FIG. 21C) Kinetics of LacI
decrease and PspA antigen increase. Overnight cultures with 0.2%
arabinose were diluted 1:100 into pre-warmed LB media with 0.2%
arabinose, grown to an OD.sub.600 of 0.6, and then diluted 1:10
into pre-warmed LB media without arabinose. The process was
repeated four times. At each time point of OD.sub.600 about 0.6,
equal numbers of samples were taken for western blot analysis using
anti-LacI and anti-PspA antisera. The densitometry was measured by
Quantityone software.
[0035] FIG. 22 depicts a graph showing the stability of LacI
protein in different strains. XL1-Blue (lacI.sup.q E. coli) was
grown in LB media. Strains .chi.8990, .chi.9080 and .chi.9226 were
grown in 3XD media with 0.2% arabinose to OD.sub.600 of 0.6 and
washed 2 times with 3XD media without arabinose. Chloramphenicol
were added to 50 .mu.g/ml. Samples were taken before washing (pre
0), just after adding chloramphenicol (0), and at 1, 2, 4, 6, 8, 24
h and subjected to western blot analysis. The samples were
normalized by cell number. The densitometry was measured by
Quantityone software.
[0036] FIG. 23A and FIG. 23B depict a graph showing antibody titers
against LPS and PspA. These strains were transformed with plasmid
pYA4088 expressing S. pneumoniae PspA Rx1 antigen and vector
plasmid pYA3493. Strains were grown with 0.2% arabinose in LB
medium before inoculating mice. (FIG. 23A) anti-LPS antibody
titers; (FIG. 23B) anti-PspA antibody titers.
[0037] FIG. 24 depicts a graph showing a survival curve after
challenge with virulent S. pneumonia WU2 strain. Female BALB/c mice
were immunized with a single dose of the indicated strains grown in
LB containing 0.2% arabinose. Eight weeks after immunization, mice
were challenged with 250 LD.sub.50 of virulent S. pneumoniae WU2.
All mice immunized with PspA-expressing strains were significantly
protected (p<0.05). Mice vaccinated with strain
.chi.9101(pYA4088) showed significantly higher protection than mice
vaccinated with the other strains (p<0.05). The remaining
vaccinated groups were not significantly different from each other
(p>0.05).
[0038] FIG. 25A, FIG. 25B, FIG. 25C and FIG. 25D depict schematics
illustrating different deletion-insertion mutations resulting in
arabinose-regulated virulence trait. (FIG. 25A) The schematic shows
the deletion of the fur promoter region (-15 to -253; including Fur
consensus, Crp binding, and OxyR binding sites) and the insertion
of 1335 bp of P.sub.BAD araC TT to create the
.DELTA.P.sub.fur33::TT araC P.sub.BAD fur insertion-deletion
mutation. (FIG. 25B) The schematic shows the deletion of the phoPQ
promoter region (-12 to -109) and the insertion of 1335 bp of
P.sub.BAD araC TT to create the .DELTA.P.sub.phoPQ107::TT araC
P.sub.BAD phoPQ deletion-insertion mutation. (FIG. 25C) The
schematic shows the deletion of 36 bp of the rpoS promoter region
(-13 to -48) and the insertion of 1335 bp of P.sub.BAD araC TT to
create the .DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS
deletion-insertion mutation. (FIG. 25D) The schematic shows the
deletion of the crp promoter region (-15 to -109) and the insertion
of 1335 bp of TT araC P.sub.BAD to create the
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp insertion-mutation.
[0039] FIG. 26A, FIG. 26B, FIG. 26C and FIG. 26D depict several
photographs illustrating the phenotypes of strains with
deletion-insertion mutations to enable arabinose-dependent
expression of virulence traits. (FIG. 26A) .chi.9021 with
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp mutation streaked on
MacConkey maltose agar without and with 0.2 percent arabinose.
(FIG. 26B) .chi.8848 with .DELTA.P.sub.fur33::TT araC P.sub.BAD fur
and .chi.9107 with .DELTA.P.sub.fur33::TT araC P.sub.BAD fur and
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp mutations spotted on CAS
agar plates without and with 0.2 percent arabinose to visualize
siderophore production. (FIG. 26C) .chi.8918 with
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ and .chi.9108 with
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ and
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp mutations streaked on
X-P plates without and with 0.2 percent arabinose to reveal acid
phosphatase activity. (FIG. 26D) .chi.8956 with
.DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS and .chi.9064 with
.DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS and
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp mutations streaked on
glycogen-indicator agar without and with 0.2 percent arabinose and
sprayed with iodine indicator solution.
[0040] FIG. 27A and FIG. 27B depict an illustration of deletion
mutations precluding breakdown of arabinose and enhancing retention
of arabinose taken up by bacterial cells. (FIG. 27A) The schematic
shows the deletion of a total of 4110 bp (araB.sub.2 to
araD.sub.+52) and the insertion of 22 bp of SD, NcoI and PmeI at
araB2 to create the .DELTA.araBAD23 mutation. (FIG. 27B) The
schematic shows the deletion of a total of 1432 bp (araE-5 to
araE+8) to create the .DELTA.araE25 mutation.
[0041] FIG. 28 depicts several photographs illustrating the
stability of Crp, Fur, RpoS and PhoP proteins during incubation of
cultures induced for synthesis of these proteins prior to addition
of 30 and 200 .mu.g chloramphenicol/ml of culture. Rabbit
antibodies raised against His-tagged Crp, Fur and PhoP were used
for western blot analyses. Mouse monoclonal antibodies for RpoS was
purchased from Neoclone. .chi.9021 (.DELTA.P.sub.crp527).sub.,
.chi.8848 (.DELTA.P.sub.fur33), .chi.8956 (.DELTA.P.sub.rpoS183)
and .chi.8918 (.DELTA.P.sub.phoPQ107) were grown in LB broth with
0.2 percent arabinose for these studies.
[0042] FIG. 29 depicts several photographs illustrating the
decrease in amounts of Crp, Fur, RpoS and PhoP proteins as a
consequence of growth of .chi.9021 (.DELTA.P.sub.crp527), .chi.8848
(.DELTA.P.sub.fur33), .chi.8956 (.DELTA.P.sub.rpoS183) and
.chi.8918 (.DELTA.P.sub.phoPQ107) in the absence of arabinose. The
same bacterial strains as used for the results shown in FIG. 47,
were grown in nutrient broth with 0.2 percent arabinose and at the
commencement of sampling to measure the amounts of proteins, the
cultures were diluted 1:4 into prewarmed nutrient broth lacking
arabinose. Rabbit antibodies raised against His-tagged Crp, Fur and
PhoP were used for western blot analyses. Mouse monoclonal antibody
against RpoS was purchased from Neoclone. Synthesis of the Crp, Fur
and PhoP proteins continues until after the third 1:4 dilution
whereas the amount of the RpoS protein decreases considerably after
the first 1:4 dilution.
[0043] FIG. 30 depicts a photograph of the LPS profiles of vaccine
strains in silver-stained SDS-PAGE. Bacteria were lysed with SDS,
treated with proteinase K, and analyzed by SDS-PAGE followed by
LPS-specific silver staining. Lane 1,.quadrature.
.chi.9088(pYA3634) (grown in nutrient broth without mannose); Lane
2, .chi.9558(pYA3634) (grown in nutrient broth without mannose);
Lane 3, .chi.9088(pYA3634) (grown in nutrient broth with 0.5%
mannose); Lane 4, .chi.9558(pYA3634) (grown in nutrient broth with
0.5% mannose); Lane 5,.quadrature. .chi.9088(pYA3634) (grown in LB
broth); Lane 6, .chi.9558(pYA3634) (grown in LB broth).
[0044] FIG. 31 depicts an illustration showing different regulated
delayed attenuation constructs in vaccine strains. To create the
.DELTA.pmi-2426 mutation, 1176 bp of the pmi nucleic acid sequence
was deleted (from ATG to TAG). To create the
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp mutation, 95 bp of the
crp promoter region (-15 to -109) was deleted and 1335 bp of
P.sub.BAD araC TT was inserted. To create the
.DELTA.P.sub.fur33::TT araC P.sub.BAD fur mutation, 239 bp of the
fur promoter region (-15 to -253; including Fur consensus, Crp
binding, and OxyR binding sites) was deleted and 1335 bp of
P.sub.BAD araC TT was inserted.
[0045] FIG. 32 depicts a photograph showing western blot data of
the synthesis of PspA Rx1 by different S. Typhimurium mutants. Cell
lysates of S. Typhimurium mutants containing PspA Rx1 were
subjected to SDS-PAGE, and the proteins were transferred to
nitrocellulose, which was subsequently probed with a polyclonal
antibody specific for PspA Lanes: 1, molecular mass markers
(positions are indicated in kilodaltons); 2, .chi.8133(pYA3493);
3,.quadrature. .chi.8133(pYA3634); 4,.quadrature.
.chi.9088(pYA3493); 5,.quadrature. .chi.9088(pYA3634); 6,
.chi.9558(pYA3493); 7,.quadrature. .chi.9558(pYA3634). Due to the
presence of arabinose in LB broth, the PspA synthesis of
.chi.9558(pYA3634) has been suppressed partly.
[0046] FIG. 33A, FIG. 33B and FIG. 33C depict a series of graphs
showing serum IgG responses to rPspA (FIG. 33A) and to S.
Typhimurium LPS (FIG. 33B) and SOMPs (FIG. 33C) measured by ELISA.
The data represent IgG antibody levels in mice orally immunized
with .chi.8133(pYA3493) (vector control), .chi.8133(pYA3634)
(expressing rPspA), .chi.9088(pYA3493) (vector control),
.chi.9088(pYA3634) (expressing rPspA), .chi.9558(pYA3493) (vector
control) and .chi.9558(pYA3634) (expressing rPspA) at the indicated
weeks after immunization. p<0.05 for anti-rPspA serum IgG
antibody levels of .chi.9558(pYA3634) and .chi.9088(pYA3634)
immunized mice with that of the .chi.8133(pYA3634) immunized mice
at week 8. p<0.01 for the anti-rPspA serum IgG antibody levels
of .chi.9558(pYA3634) immunized mice compared to .chi.8133(pYA3634)
immunized mice at week 10 and 12. p<0.05 for the anti-rPspA
serum IgG levels of .chi.9558(pYA3634) immunized mice compared to
.chi.9088(pYA3634) immunized mice at week 8, 10 and 12.
[0047] FIG. 34A, FIG. 34B and FIG. 34C depict a series of graphs
showing serum IgG2a and IgG1 responses to rPspA measure by ELISA.
The data represent IgG2a and IgG1 subclass antibody levels to rPspA
in sera of BALB/c mice orally immunized with the indicated strains
at various times after immunization. The ratios of IgG1: IgG2a at
12 weeks are 1:8.3 for .chi.8133(pYA3634) immunized mice (FIG.
34A), 1:9.4 for .chi.9088(pYA3634) immunized mice (FIG. 34B) and
1:1.5 for .chi.9558(pYA3634) immunized mice (FIG. 34C).
[0048] FIG. 35A and FIG. 35B depict a series of graphs showing
antigen-specific stimulation of IFN-.gamma. (FIG. 35A) or IL-4
(FIG. 35B) production. Splenectomies were performed on euthanized
BALB/c mice at 8 weeks following immunization. BSG controls were
also included. Splenocytes were harvested from three mice per
group. ELISPOT analyses were performed as described in Materials
and Methods. The results are presented as ELISPOTS per million
splenocytes minus any background ELISPOTS from unpulsed mock
controls. One-way ANOVA and LSD methods were adopted to compare the
secretion levels of IL-4 or IFN-.gamma. between different groups.
p<0.001 when compare .chi.9558(pYA3634) and .chi.9088(pYA3634)
with .chi.8133(pYA3634) for both secretion levels of IL-4 and
IFN-.gamma.. p<0.01 when compare .chi.9558(pYA3634) with
.chi.9088(pYA3634) for the secretion levels of IFN-.gamma..
[0049] FIG. 36A and FIG. 36B depict photomicrographs of
conventional light microscopy of H&E-stained lung tissue
samples of WU2 challenged mice (10.times.40). (FIG. 36A) S.
pneumoniae caused focal consolidation with extensive mononuclear
and polymorphonuclear infiltration and loss of alveolar structure
in mice that succumbed to the infection. (FIG. 36B) Lungs from
survivors appeared normal without extensive cellular
infiltration.
[0050] FIG. 37A and FIG. 37B depict the synthesis of Asd protein
from the asd gene with ATG or GTG start codon and muramic acid-less
death assay. (FIG. 37A) The western blot was performed with cell
lysates of S. Typhimurium strain .chi.8276 (.DELTA.asdA16) and its
derivatives cultured in LB broth with 0.2% arabinose. DAP was
included in the medium for strain .chi.8276. Asd protein was
detected using rabbit anti-Asd serum. The 39 kDa Asd protein is
indicated by an arrow. (FIG. 37B) Growth of Salmonella strain
.chi.8645 (.DELTA.P.sub.murA7::araC P.sub.BAD murA) with and
without arabinose in the indicated media.
[0051] FIG. 38A and FIG. 38B depict an illustration and a series of
photographs showing the defined deletion mutations of strain
.chi.8937 and nutritional requirements. (FIG. 38A) The defined
deletion chromosomal mutations in wild-type Salmonella UK-1 and in
strain .chi.8937. P: promoter, TT: transcriptional terminator.
(FIG. 38B) The growth of host strain .chi.8937 alone or strain
.chi.8937 harboring pYA3681 on LB agar plates with or without
supplementations.
[0052] FIG. 39 depicts a diagram illustrating the regulatory
interactions in the programmed lysis system.
[0053] FIG. 40A, FIG. 40B and FIG. 40C depict a series of graphs
illustrating the in vitro and in vivo lysis of the programmed lysis
system in the absence of arabinose. (FIG. 40A) The growth curves of
strain .chi.8937(pYA3681) with arabinose-regulated asdA and murA
expression in LB broth with or without the addition of 0.02%
arabinose. (FIG. 40B) The ratio of released .beta.-galactosidase
versus total .beta.-galactosidase when strain .chi.9380(pYA3681)
with arabinose-regulated asdA and murA expression and constitutive
lacZ expression was grown in LB broth with or without 0.02%
arabinose; the wild-type strain .chi.9379 modified to express lacZ
acts as a non-lysis system control. (FIG. 40C) Colonization of mice
with S. Typhimurium .chi.8937(pYA3681) following P.O. inoculation
with 10.sup.9 CFU bacteria. The limits of detection for this assay
were 10 CFU/PP or g of tissue.
[0054] FIG. 41A, FIG. 41B and FIG. 41C depict the synthesis of PspA
Rx1 and arabinose-dependent growth of .chi.8937(pYA3685). (FIG.
41A) Map of plasmid pYA3685. Plasmid sequences include the trpA,
rrfG and 5S ribosomal RNA transcriptional terminators, the
P.sub.BAD, P.sub.trc and P22 P.sub.R promoters, the araC gene and
start codon-modified murA and asdA genes, and the b/a-pspA fusion
protein. (FIG. 41B) The synthesis of rPspA Rx1 in the programmed
lysis S. Typhimurium strain .chi.8937(pYA3685) grown in LB broth
with 0.02% arabinose at 37.degree. C. Aliquots of mid-log phase
cultures were subjected to SDS-PAGE or immunoblot analysis. The
immunoblot was probed with anti-PspA antibody. PspA proteins are
indicated by arrows. Lanes 1 and 2, protein from .chi.8937(pYA3685)
and .chi.8937(pYA3681), respectively. (FIG. 41C) Growth curves of
PspA-producing strain .chi.8937(pYA3685) in LB broth with or
without the addition of 0.02% arabinose.
[0055] FIG. 42A and FIG. 42B depict a series of graphs showing
Immune responses in mice after oral immunization with
.chi.8937(pYA3685) (rPspA Rx1) and .chi.8937(pYA3681) (vector
control) as determined by ELISA. (FIG. 42A) IgG antibody against S.
Typhimurium SOMPs and rPspA Rx1 in a 1:1280 dilution of serum.
(FIG. 42B) Anti-SOMP and -rPspA Rx1 IgA antibody levels in a 1:10
dilution of vaginal secretions.
[0056] FIG. 43 depicts a graph showing IgG isotype analyses. Serum
IgG2a and IgG1 responses to SOMPs and rPspA. IgG2a (gray bars) and
IgG1 (dark bars). Serum was diluted 1:400.
[0057] FIG. 44A, FIG. 44B and FIG. 44C depict a series of graphs
showing the sensitivity of (FIG. 44A) .chi.9633(pYA4088), (FIG.
44B) .chi.9639(pYA4088) and (FIG. 44C) .chi.9640(pYA4088) RASV-Sp
strains to low pH.
[0058] FIG. 45 depicts a graph showing the stability of RASV-Sp
vaccine in Ensure nutrition shakes at 37.degree. C.
[0059] FIG. 46 depicts a graph showing the stability of RASV-Sp
strains in PBS at room temperature.
[0060] FIG. 47A, FIG. 47B and FIG. 47C depict a series of graphs
showing the colonization of the S. Typhi strains in (FIG. 47A)
intestine, (FIG. 47B) spleen, and (FIG. 47C) liver of newborn
mice.
[0061] FIG. 48A and FIG. 48B depict a series of graphs showing the
(FIG. 48A) weights of guinea pigs administered sterile and
cell-free PBS wash, and (FIG. 48B) weights of mice administered
sterile and cell-free PBS wash.
[0062] FIG. 49A, FIG. 49B and FIG. 49C depict a schematic of PspA
expression plasmids (FIG. 49A) pYA4088 and (FIG. 49B) pYA3634 with
empty control vector (FIG. 49C) pYA3493.
[0063] FIG. 50A and FIG. 50B depict a series of graphs showing the
total serum IgG from mice orally vaccinated with
.chi.8133(pYA3634), .chi.9088(pYA3634) and .chi.9558(pYA3634) to
(FIG. 50A) PspA and to (FIG. 50B) S. Typhimurium LPS.
[0064] FIG. 51 depicts a graph showing immunization with
.chi.9558(pYA3634) protects mice against challenge with virulent S.
pneumoniae strain WU2.
[0065] FIG. 52A, FIG. 52B and FIG. 52C depict a series of graphs
showing (FIG. 52A) the total IgG antibody response to PspA, (FIG.
52B) the total IgG antibody response to S. Typhi LPS, and (FIG.
52C) the total antibody response to S. Typhi outer membrane
proteins.
[0066] FIG. 53A, FIG. 53B and FIG. 53C depict a series of graphs
showing the survival of (FIG. 53A) S. Typhi ISP1820 derivatives,
(FIG. 53B) Ty2 RpoS.sup.- derivatives, and (FIG. 53C) Ty2
RpoS.sup.+ derivatives in active (A) and heat-inactivated (HI)
whole human blood including .chi.8110 and Ty21a as controls.
[0067] FIG. 54 depicts a graph showing the resistance of RASV-Sp
strains compared to wild-type S. Typhi strains to guinea pig
complement.
[0068] FIG. 55A, FIG. 55B and FIG. 55C depict a series of graphs
showing the survival of (FIG. 55A) S. Typhi ISP1820 derivatives,
(FIG. 55B) Ty2 RpoS.sup.- derivatives, and (FIG. 55C) Ty2
RpoS.sup.+ derivatives in peripheral blood mononuclear cells.
[0069] FIG. 56 depicts the survival of S. Typhi in human stool.
[0070] FIG. 57A, FIG. 57B and FIG. 57C depict the survival of
RASV-Sp strains and wild-type S. Typhi in (FIG. 57A) chlorinated
water, (FIG. 57B) untreated canal water, and (FIG. 57C) raw
sewage.
[0071] FIG. 58A, FIG. 58B, FIG. 58C and FIG. 58D depict the serum
IgG responses to rPspA (FIG. 58A), to S. Typhi LPS (FIG. 58B), to
OMPs (FIG. 58C) and sIgA (FIG. 58D) in immunized mice. Serum IgG
responses against rPspA (FIG. 58A) S. Typhi LPS (FIG. 58B), and
SOMPS (FIG. 58C) and mucosal IgA responses to rPspA (FIG. 58D) were
measured by ELISA using pooled sera from BALB/c mice intranasally
immunized with the indicated strains carrying either plasmid
pYA3493 (negative control) or pYA4088 (PspA). Error bars represent
variation between triplicate wells. Mice were boosted at week 6.
Statistical significance was determined at week 8. *, P<0.05;
**, P<0.01 for .chi.9633(pYA4088), .chi.9639(pYA4088) and
.chi.9640(pYA4088) were compared each other.
[0072] FIG. 59 depicts a schematic of the phase I safety and
tolerability clinical study design.
DETAILED DESCRIPTION OF THE INVENTION
[0073] The present invention provides, in some embodiments, a
recombinant bacterium capable of regulated expression of at least
one nucleic acid sequence encoding an antigen of interest. In other
embodiments, the invention provides a recombinant bacterium capable
of regulated attenuation. In exemplary embodiments, the invention
provides a recombinant bacterium capable of both regulated
expression of at least one nucleic acid sequence encoding an
antigen of interest and regulated attenuation.
[0074] In each of the embodiments herein, the recombinant bacterium
typically belongs to the Enterobaceteriaceae. The Enterobacteria
family comprises species from the following genera: Alterococcus,
Aquamonas, Aranicola, Arsenophonus, Brenneria, Budvicia,
Buttiauxella, Candidatus Phlomobacter, Cedeceae, Citrobacter,
Edwardsiella, Enterobacter, Erwinia, Escherichia, Ewingella,
Hafnia, Klebsiella, Kluyvera, Leclercia, Leminorella, Moellerella,
Morganella, Obesumbacterium, Pantoea, Pectobacterium, Photorhabdus,
Plesiomonas, Pragia, Proteus, Providencia, Rahnella, Raoultella,
Salmonella, Samsonia, Serratia, Shigella, Sodalis, Tatumella,
Trabulsiella, Wigglesworthia, Xenorhbdus, Yersinia, Yokenella. In
certain embodiments, the recombinant bacterium is typically a
pathogenic species of the Enterobaceteriaceae. Due to their
clinical significance, Escherichia coli, Shigella, Edwardsiella,
Salmonella, Citrobacter, Klebsiella, Enterobacter, Serratia,
Proteus, Morganella, Providencia and Yersinia are considered to be
particularly useful. In other embodiments, the recombinant
bacterium may be a species or strain commonly used for a
vaccine.
[0075] Some embodiments of the instant invention comprise a species
or subspecies of the Salmonella genera. For instance, the
recombinant bacterium may be a Salmonella enterica serovar. In an
exemplary embodiment, a bacterium of the invention may be derived
from S. typhimurium, S. typhi, S. paratyphi, S. gallinarum, S.
enteritidis, S. choleraesius, S. arizona, or S. dublin.
[0076] A recombinant bacterium of the invention derived from
Salmonella may be particularly suited to use as a vaccine.
Infection of a host with a Salmonella strain typically leads to
colonization of the gut-associated lymphoid tissue (GALT) or
Peyer's patches, which leads to the induction of a generalized
mucosal immune response to the recombinant bacterium. Further
penetration of the bacterium into the mesenteric lymph nodes, liver
and spleen may augment the induction of systemic and cellular
immune responses directed against the bacterium. Thus the use of
recombinant Salmonella for oral immunization stimulates all three
branches of the immune system, which is particularly important for
immunizing against infectious disease agents that colonize on
and/or invade through mucosal surfaces.
[0077] In an alternative embodiment, a bacterium of the invention
may be a bacterium included in Table 1 below.
TABLE-US-00001 TABLE 1 Strain Genotype or relevant characteristics
Escherichia coli .chi.289 F.sup.- .lamda..sup.- glnV42 T3.sup.r
.chi.6097 F.sup.- araD139 .DELTA.(proAB-lac) .lamda..sup.-
.PHI.80dlacZ.DELTA.M15 rpsL .DELTA.asdA4 .DELTA.(zhf- 2::Tn10)
thi-1 .chi.6212 F.sup.- .DELTA.(argF-lacZYA)-U169 glnV44
.lamda..sup.- deoR .PHI.80dlacZ.DELTA.M15 gyrA96 recA1 relA1 endA1
.DELTA.asdA4 .DELTA.(zhf-2::Tn10) thi-1 hsdR17 .chi.7213 thr-1
leuB6 fhuA21 lacY1 glnV44 recA1 .DELTA.asdA4 .DELTA.(zhf-2::Tn10)
thi-1 RP4-2-Tc::Mu [.lamda.pir]; Km.sup.r .chi.7232 endA1 thr-1
hsdR17(r.sub.K.sup.-, m.sub.K.sup.+) supE44 gyrA recA1 .DELTA.relA1
.DELTA.(argF- lacZYA)-U169 [.lamda.pir] deoR .PHI.80dlacZ.DELTA.M15
.chi.7370 F.sup.- araD139 .DELTA.(ara-leu)-7697 .DELTA.lacX74
.DELTA.lon-4 galK deoR .DELTA.csgA4 mcrA galU 80dlacZ.DELTA.M15
.DELTA.fliC38 .DELTA.(wcaL-wza)-19 recA1 endA1 nupG rpsl
.DELTA.(fimA-H) .DELTA.(mcrBC-hsdRMS-mrr) .chi.7385 F.sup.- araD139
.DELTA.(ara-leu)-7697 .DELTA.(lacAYZOPI)-X74 .DELTA.lon-4
.DELTA.ompT0523::TT araC P.sub.BAD T7 pol TT galK deoR .DELTA.csgA4
mcrA galU .PHI.80dlacZ.DELTA.M15 .DELTA.fliC38 .DELTA.(wcaL-wza)-19
recA1 endA1 nupG rpsL .DELTA.(fimA-H) .DELTA.(mcrBC-hsdRMS-mrr)
.DELTA.asdA99 BL21 (DE3) F.sup.- ompT
hsdS.sub.B(r.sub.B.sup.-.sub., m.sub.B.sup.-) gal dcm (DE3) Top 10
F.sup.- mcrA .DELTA.(mrr-hsdRMS-mcrBC) .PHI.80dlacZ.DELTA.M15
.DELTA.lacX74 recA1 araD139 .DELTA.(ara-leu)7697 galU galK rpsL
(Str.sup.r) endA1 nupG XL1-blue recA1 endA1 gyrA96 thi-1 hsdR17
supE44 relA1 lac [F' proAB lacI.sup.qZ.DELTA.M15 Tn10 (Tet.sup.r)].
Salmonella enterica Typhimurium UK-1 .chi.3761 UK-1 wild type
.chi.8060 .DELTA.pabA1516 .chi.8133 .DELTA.cya-27 .DELTA.crp-27
.DELTA.asdA16 .chi.8276 .DELTA.asdA16 .chi.8289
.DELTA.asdA19::TTaraC P.sub.BAD c2 .chi.8442 .DELTA.pabA1516
.DELTA.pabB232 .chi.8477 .DELTA.araE25 .chi.8645
.DELTA.P.sub.murA7::TT araC P.sub.BAD murA .chi.8767
.DELTA.araBAD23 .chi.8831 .DELTA.(gmd-fcl)-26 .chi.8844
.DELTA.endA2311 .chi.8848 .DELTA.P.sub.fur33::TT araC P.sub.BAD fur
.chi.8854 .DELTA.endA2311 .DELTA.asdA19::TT araC P.sub.BAD c2
.DELTA.P.sub.murA7::TT araC P.sub.BAD murA .DELTA.araE25
.DELTA.araBAD1923 .chi.8882 .DELTA.relA1123 .chi.8914
.DELTA.pabA1516 .DELTA.pabB232 .DELTA.asdA16 .chi.8918
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ .chi.8937
.DELTA.asdA19::araC P.sub.BAD c2 .DELTA.P.sub.murA7::araC P.sub.BAD
murA .DELTA.(gmd-fcl)-26 .DELTA.relA1123 .DELTA.endA2311 .chi.8956
.DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS .chi.8960
.DELTA.asdA18::TT araC P.sub.BAD c2 .chi.8989 .DELTA.endA19::araC
P.sub.BAD lacI TT .chi.8990 .DELTA.relA196::araC P.sub.BAD lacI TT
.chi.9000 .DELTA.P.sub.fur33::TT araC P.sub.BAD fur
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ .chi.9021
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp .chi.9064
.DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp .chi.9080
.DELTA.relA197::araC P.sub.BAD lacI TT .chi.9088 .DELTA.pmi-2426
.DELTA.(gmd-fcl)-26 .DELTA.P.sub.fur33::TT araC .sub.BAD fur
.DELTA.asdA33 .chi.9095 .DELTA.pabA1516 .DELTA.pabB232
.DELTA.asdA16 .DELTA.relA196::araC P.sub.BAD lacI TT
.DELTA.araBAD23 .chi.9097 .DELTA.pabA1516 .DELTA.pabB232
.DELTA.asdA16 .DELTA.araBAD23 .chi.9101 .DELTA.pabA1516
.DELTA.pabB232 .DELTA.asdA16 .DELTA.relA197::araC P.sub.BAD lacI TT
.DELTA.araBAD23 .chi.9107 .DELTA.P.sub.fur33::TT araC P.sub.BAD fur
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp .chi.9108
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp .chi.9109
.DELTA.P.sub.fur33::TT araC P.sub.BAD fur .DELTA.P.sub.phoPQ107::TT
araC P.sub.BAD phoPQ .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
.chi.9225 .DELTA.endA21::araC P.sub.BAD lacI TT .chi.9226
.DELTA.relA198::araC P.sub.BAD lacI TT .chi.9241 .DELTA.pabA1516
.DELTA.pabB232 .DELTA.asdA16 .DELTA.araBAD23 .DELTA.relA198::araC
P.sub.BAD lacI TT .chi.9269 .DELTA.P.sub.fur81::TT araC P.sub.BAD
fur .chi.9273 .DELTA.P.sub.fur77::TT araC P.sub.BAD fur .chi.9275
.DELTA.asdA21::TT araC P.sub.BAD c2 .chi.9302 .DELTA.asdA20::TT
araC P.sub.BAD c2 .chi.9339 .DELTA.sifA26 .DELTA.asdA18::TT araC
P.sub.BAD c2 .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
.DELTA.araBAD23 .chi.9340 .DELTA.alr-3 .DELTA.dadB4
.DELTA.P.sub.phoPQ107 ::TT araC P.sub.BAD phoPQ .DELTA.recJ1516
.DELTA.recF126 .DELTA.asdA18::TT araC P.sub.BAD c2 .chi.9362
.DELTA.pmi-2426 .DELTA. (gmd-fcl)-26 .DELTA.P.sub.phoPQ107::TT araC
P.sub.BAD phoPQ .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
.DELTA.asdA18::TT araC P.sub.BAD c2 .DELTA.araE25 .DELTA.araBAD23
.DELTA.relA198::araC P.sub.BAD lacI TT .chi.9371
.DELTA.P.sub.phoPQ173::TT araC P.sub.BAD phoPQ .chi.9372
.DELTA.P.sub.phoPQ177::TT araC P.sub.BAD phoPQ .chi.9373
.DELTA.pmi-2426 .DELTA.(gmd-fcl)-26 .DELTA.P.sub.fur81::TT araC
P.sub.BAD fur .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
.DELTA.asdA21::TT araC P.sub.BAD c2 .DELTA.araE25 .DELTA.araBAD23
.DELTA.relA198::araC P.sub.BAD lacI TT .chi.9379 .chi.3761
.DELTA.atrB13::MudJ .chi.9380 .chi.9379 .DELTA.atrB13::MudJ
.chi.9382 .DELTA.P.sub.phoPQ173::TT araC P.sub.BAD phoPQ
.DELTA.araBAD23 .chi.9383 .DELTA.P.sub.phoPQ177::TT araC P.sub.BAD
phoPQ .DELTA.araBAD23 .chi.9402 .DELTA.pmi-2426 .DELTA.(gmd-fcl)-26
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur .DELTA.P.sub.crp527::TT
araC P.sub.BAD crp .DELTA.asdA21::TT araC P.sub.BAD c2
.DELTA.araE25 .DELTA.araBAD23 .DELTA.relA198::araC P.sub.BAD lacI
TT .DELTA.sopB1925 .chi.9412 .DELTA.pmi-2426 .DELTA.(gmd-fcl)-26
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur .DELTA.P.sub.crp527::TT
araC P.sub.BAD crp .DELTA.asdA21::TT araC P.sub.BAD c2
.DELTA.araE25 .DELTA.araBAD23 .DELTA.relA198::araC P.sub.BAD lacI
TT .DELTA.P.sub.murA7::TT araC P.sub.BAD murA .chi.9413
.DELTA.pmi-2426 .DELTA.(gmd-fcl)-26 .DELTA.P.sub.phoPQ107::TT araC
P.sub.BAD phoPQ .DELTA.P.sub.crp527::TT araC P.sub.BAD crp .DELTA.
asdA18::TT araC P.sub.BAD c2 .DELTA. araE25 .DELTA. araBAD23
.DELTA. relA198::araC P.sub.BAD lacI TT .DELTA. P.sub.murA7::TT
araC P.sub.BAD murA .chi.9442 .DELTA. P.sub.murA12::TT araC
P.sub.BAD murA .chi.9443 .DELTA. (araC P.sub.BAD)-5::P22 P.sub.R
araBAD .chi.9444 .DELTA. asdA34::TT .chi.9477 .DELTA. asdA27::TT
araC P.sub.BAD c2 .chi.9509 .DELTA. relA198::araC P.sub.BAD lacI TT
.DELTA. araBAD23 .chi.9521 .DELTA. P.sub.murA12::TT araC P.sub.BAD
murA .DELTA. (araC P.sub.BAD)-5::P22 P.sub.R araBAD .chi.9527
.DELTA. P.sub.fur77::TT araC P.sub.BAD fur .DELTA. (araC
P.sub.BAD)-5::P22 P.sub.R araBAD .chi.9533 .DELTA. P.sub.crp527::TT
araC P.sub.BAD crp .DELTA. (araC P.sub.BAD)-5::P22 P.sub.R araBAD
.chi.9541 .DELTA. P.sub.phoPQ176::TT araC P.sub.BAD phoPQ .chi.9542
.DELTA. P.sub.phoPQ175::TT araC P.sub.BAD phoPQ .chi.9543 .DELTA.
P.sub.phoPQ174::TT araC P.sub.BAD phoPQ .chi.9548 .DELTA.
P.sub.phoPQ175::TT araC P.sub.BAD phoPQ .DELTA. araBAD23 .chi.9549
.DELTA. P.sub.phoPQ174::TT araC P.sub.BAD phoPQ .DELTA. araBAD23
.chi.9550 .DELTA. P.sub.fur77::TT araC P.sub.BAD fur .DELTA.
P.sub.crp527::TT araC P.sub.BAD crp .chi.9551 .DELTA. asdA34::TT
.DELTA. P.sub.phoPQ107::TT araC P.sub.BAD phoPQ .chi.9552 .DELTA.
asdA34::TT .DELTA. P.sub.phoPQ173::TT araC P.sub.BAD phoPQ
.chi.9553 .DELTA. asdA34::TT .DELTA. P.sub.phoPQ177::TT araC
P.sub.BAD phoPQ .quadrature..quadrature..chi.9558 .DELTA.pmi-2426
.DELTA.(gmd-fcl)-26 .DELTA.P.sub.fur81::TT araC P.sub.BAD fur
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp .DELTA.asdA27::TT araC
P.sub.BAD c2 .DELTA.araE25 .DELTA.araBAD23 .DELTA.relA198::araC
P.sub.BAD lacI TT .DELTA.sopB1925 .DELTA.agfBAC811 .chi.9569
.DELTA. endA20::araC P.sub.BAD lacI TT Salmonella enterica Typhi
ISP1820 .chi.9421 .DELTA. P.sub.crp527::TT araC P.sub.BAD crp
.DELTA. P.sub.fur81::TT araC P.sub.BAD fur .DELTA.
P.sub.phoPQ107::TT araC P.sub.BAD phoPQ .DELTA. pmi-2426 .DELTA.
(gmd-fcl)-26 .DELTA. sopB1925 .DELTA. relA198::araC P.sub.BAD lacI
TT .DELTA. araE25 .DELTA.araBAD23 .DELTA. tviABCDE10 .DELTA.
agfBAC811 .chi.9633 .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur .DELTA.pmi-2426
.DELTA.(gmd-fcl)-26 .DELTA.sopB1925 .DELTA.relA198::araC P.sub.BAD
lacI TT .DELTA.araE25 .DELTA.araBAD23 .DELTA.tviABCDE10
.DELTA.agfBAC811 PhoP.sup.+ .DELTA.asdA33 Salmonella enterica Typhi
Ty2 .chi.9205 .DELTA. P.sub.crp527::TT araC P.sub.BAD crp .DELTA.
P.sub.fur33::TT araC P.sub.BAD fur RpoS.sup.- .chi.9114 .DELTA.
P.sub.phoPQ107::TT araC P.sub.BAD phoPQ .DELTA.
P.sub.crp527::TTaraC P.sub.BAD crp RpoS.sup.- .chi.9213 .DELTA.
P.sub.crp527::TT araC P.sub.BAD crp .DELTA. P.sub.fur33::TT araC
P.sub.BAD fur .DELTA. P.sub.phoPQ107::TT araC P.sub.BAD phoPQ
RpoS.sup.- .chi.9369 .DELTA. P.sub.crp527::TT araC P.sub.BAD crp
.DELTA. P.sub.fur33::TT araC P.sub.BAD fur .DELTA.
P.sub.phoPQ107::TT araC P.sub.BAD phoPQ .DELTA. pmi-2426 .DELTA.
gmd-fcl-26 .DELTA. relA198::araC P.sub.BAD lacI TT RpoS.sup.-
.chi.9639 .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur .DELTA.pmi-2426
.DELTA.(gmd-fcl)-26 .DELTA.sopB1925 .DELTA.relA198::araC P.sub.BAD
lacI TT .DELTA.araE25 .DELTA.tviABCDE10 .DELTA.agfBAC811 PhoP.sup.+
.DELTA.asdA33 RpoS.sup.- .chi.9640 .DELTA.P.sub.crp527::TT araC
P.sub.BAD crp .DELTA.P.sub.fur81::TT araC P.sub.BAD fur
.DELTA.pmi-2426 .DELTA.(gmd-fcl)-26 .DELTA.sopB1925
.DELTA.relA198::araC P.sub.BAD lacI TT .DELTA.araE25
.DELTA.tviABCDE10 .DELTA.agfBAC811 PhoP.sup.+ RpoS.sup.+
.DELTA.asdA33 Salmonella enterica Paratyphi A .chi.9515 .DELTA.
P.sub.crp527::TT araC P.sub.BAD crp .DELTA. P.sub.fur81::TT araC
P.sub.BAD fur .DELTA. P.sub.phoPQ107::TT araC P.sub.BAD phoPQ
.DELTA. pmi-2426 .DELTA. (gmd-fcl)-26 .DELTA. sopB1925 .DELTA.
agfBAC811 .DELTA. relA198::araC P.sub.BAD lacI TT .chi.9608 .DELTA.
P.sub.crp527::TT araC P.sub.BAD crp .DELTA. P.sub.fur81::TT araC
P.sub.BAD fur .DELTA. P.sub.phoPQ107::TT araC P.sub.BAD phoPQ
.DELTA. pmi-2426 .DELTA. (gmd-fcl)-26 .DELTA.agfBAC811 .DELTA.
relA198::araC P.sub.BAD lacI TT .DELTA. sopB1925 .DELTA.araE25
.DELTA.araBAD23 .DELTA.asdA33 .chi.9651 .DELTA.P.sub.crp527::TT
araC P.sub.BAD crp .DELTA.P.sub.fur81::TT araC P.sub.BAD fur
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ .DELTA.pmi-2426
.DELTA.(gmd-fcl)-26 .DELTA.agfBAC811 .DELTA.relA198::araC P.sub.BAD
lacI TT .DELTA.sopB1925 .DELTA.araE25 .DELTA.(araC
P.sub.BAD)-5::P22 P.sub.R araBAD .chi.9763 .DELTA. P.sub.crp527::TT
araC P.sub.BAD crp .DELTA. P.sub.fur81::TT araC P.sub.BAD fur
.DELTA. pmi-2426 .DELTA. (gmd-fcl)-26 .DELTA. agfBAC811 .DELTA.
relA198::araC P.sub.BAD lacI TT .DELTA. sopB1925 .DELTA.araE25
.DELTA.araBAD23 PhoP.sup.+ .chi.9857 .DELTA. P.sub.crp527::TT araC
P.sub.BAD crp .DELTA. P.sub.fur81::TT araC P.sub.BAD fur .DELTA.
pmi-2426 .DELTA. (gmd-fcl)-26 .DELTA. agfBAC811 .DELTA.
relA198::araC P.sub.BAD lacI TT .DELTA. sopB1925 .DELTA.araE25
.DELTA.araBAD23 PhoP.sup.+ .DELTA.asdA33 Streptococcus pneumoniae
Rx1 PspA Clade 2, Capsule Type Rough WU2 PspA Clade 2, Capsule Type
3 D39 PspA Clade 2, Capsule Type 2 .DELTA. = deletion P = promoter
p = plasmid TT = transcription terminator
I. Regulated Expression
[0078] The present invention encompasses a recombinant bacterium
capable of regulated expression of at least one nucleic acid
sequence encoding an antigen of interest. Generally speaking, the
bacterium comprises a chromosomally integrated nucleic acid
sequence encoding a repressor and a vector. Each is discussed in
more detail below.
(a) Chromosomally Integrated Nucleic Acid Sequence Encoding a
Repressor
[0079] A recombinant bacterium of the invention that is capable of
the regulated expression of at least one nucleic acid sequence
encoding an antigen comprises, in part, at least one chromosomally
integrated nucleic acid sequence encoding a repressor. Typically,
the nucleic acid sequence encoding a repressor is operably linked
to a regulatable promoter. The nucleic acid sequence encoding a
repressor and/or the promoter may be modified from the wild-type
nucleic acid sequence so as to optimize the expression level of the
nucleic acid sequence encoding the repressor.
[0080] Methods of chromosomally integrating a nucleic acid sequence
encoding a repressor operably-linked to a regulatable promoter are
known in the art and detailed in the examples. Generally speaking,
the nucleic acid sequence encoding a repressor should not be
integrated into a locus that disrupts colonization of the host by
the recombinant bacterium, or attenuates the bacterium. In one
embodiment, the nucleic acid sequence encoding a repressor may be
integrated into the relA nucleic acid sequence. In another
embodiment, the nucleic acid sequence encoding a repressor may be
integrated into the endA nucleic acid sequence.
[0081] In some embodiments, at least one nucleic acid sequence
encoding a repressor is chromosomally integrated. In other
embodiments, at least two, or at least three nucleic acid sequences
encoding repressors may be chromosomally integrated into the
recombinant bacterium. If there is more than one nucleic acid
sequence encoding a repressor, each nucleic acid sequence encoding
a repressor may be operably linked to a regulatable promoter, such
that each promoter is regulated by the same compound or condition.
Alternatively, each nucleic acid sequence encoding a repressor may
be operably linked to a regulatable promoter, each of which is
regulated by a different compound or condition.
i. Repressor
[0082] As used herein, "repressor" refers to a biomolecule that
represses transcription from one or more promoters. Generally
speaking, a suitable repressor of the invention is synthesized in
high enough quantities during the in vitro growth of the bacterial
strain to repress the transcription of the nucleic acid encoding an
antigen of interest on the vector, as detailed below, and not
impede the in vitro growth of the strain. Additionally, a suitable
repressor will generally be substantially stable, i.e. not subject
to proteolytic breakdown. Furthermore, a suitable repressor will be
diluted by about half at every cell division after expression of
the repressor ceases, such as in a non-permissive environment (e.g.
an animal or human host).
[0083] The choice of a repressor depends, in part, on the species
of the recombinant bacterium used. For instance, the repressor is
usually not derived from the same species of bacteria as the
recombinant bacterium. For instance, the repressor may be derived
from E. coli if the recombinant bacterium is from the genus
Salmonella. Alternatively, the repressor may be from a
bacteriophage.
[0084] Suitable repressors are known in the art, and may include,
for instance, LacI of E. coli, C2 encoded by bacteriophage P22, or
C1 encoded by bacteriophage A. Other suitable repressors may be
repressors known to regulate the expression of a regulatable
nucleic acid sequence, such as nucleic acid sequences involved in
the uptake and utilization of sugars. In one embodiment, the
repressor is LacI. In another embodiment, the repressor is C2. In
yet another embodiment, the repressor is C1.
ii. Regulatable Promoter
[0085] The chromosomally integrated nucleic acid sequence encoding
a repressor is operably linked to a regulatable promoter. The term
"promoter", as used herein, may mean a synthetic or
naturally-derived molecule that is capable of conferring,
activating or enhancing expression of a nucleic acid. A promoter
may comprise one or more specific transcriptional regulatory
sequences to further enhance expression and/or to alter the spatial
expression and/or temporal expression of a nucleic acid. The term
"operably linked," as used herein, means that expression of a
nucleic acid is under the control of a promoter with which it is
spatially connected. A promoter may be positioned 5' (upstream) of
the nucleic acid under its control. The distance between the
promoter and a nucleic acid to be expressed may be approximately
the same as the distance between that promoter and the native
nucleic acid sequence it controls. As is known in the art,
variation in this distance may be accommodated without loss of
promoter function.
[0086] The regulated promoter used herein generally allows
transcription of the nucleic acid sequence encoding a repressor
while in a permissive environment (i.e. in vitro growth), but
ceases transcription of the nucleic acid sequence encoding a
repressor while in a non-permissive environment (i.e. during growth
of the bacterium in an animal or human host). For instance, the
promoter may be sensitive to a physical or chemical difference
between the permissive and non-permissive environment. Suitable
examples of such regulatable promoters are known in the art.
[0087] In some embodiments, the promoter may be responsive to the
level of arabinose in the environment. Generally speaking,
arabinose may be present during the in vitro growth of a bacterium,
while typically absent from host tissue. In one embodiment, the
promoter is derived from an araC-P.sub.BAD system. The
araC-P.sub.BAD system is a tightly regulated expression system
which has been shown to work as a strong promoter induced by the
addition of low levels of arabinose (5). The araC-araBAD promoter
is a bidirectional promoter controlling expression of the araBAD
nucleic acid sequences in one direction, and the araC nucleic acid
sequence in the other direction. For convenience, the portion of
the araC-araBAD promoter that mediates expression of the araBAD
nucleic acid sequences, and which is controlled by the araC nucleic
acid sequence product, is referred to herein as P.sub.BAD. For use
as described herein, a cassette with the araC nucleic acid sequence
and the araC-araBAD promoter may be used. This cassette is referred
to herein as araC-P.sub.BAD. The AraC protein is both a positive
and negative regulator of P.sub.BAD. In the presence of arabinose,
the AraC protein is a positive regulatory element that allows
expression from P.sub.BAD. In the absence of arabinose, the AraC
protein represses expression from P.sub.BAD. This can lead to a
1,200-fold difference in the level of expression from
P.sub.BAD.
[0088] Other enteric bacteria contain arabinose regulatory systems
homologous to the araC araBAD system from E. coll. For example,
there is homology at the amino acid sequence level between the E.
coli and the S. Typhimurium AraC proteins, and less homology at the
DNA level. However, there is high specificity in the activity of
the AraC proteins. For example, the E. coli AraC protein activates
only E. coli P.sub.END (in the presence of arabinose) and not S.
Typhimurium P.sub.BAD. Thus, an arabinose regulated promoter may be
used in a recombinant bacterium that possesses a similar arabinose
operon, without substantial interference between the two, if the
promoter and the operon are derived from two different species of
bacteria.
[0089] Generally speaking, the concentration of arabinose necessary
to induce expression is typically less than about 2%. In some
embodiments, the concentration is less than about 1.5%, 1%, 0.5%,
0.2%, 0.1%, or 0.05%. In other embodiments, the concentration is
0.05% or below, e.g. about 0.04%, 0.03%, 0.02%, or 0.01%. In an
exemplary embodiment, the concentration is about 0.05%.
[0090] In other embodiments, the promoter may be responsive to the
level of maltose in the environment. Generally speaking, maltose
may be present during the in vitro growth of a bacterium, while
typically absent from host tissue. The malT nucleic acid encodes
MalT, a positive regulator of four maltose-responsive promoters
(P.sub.PQ, P.sub.EFG, P.sub.KBM, and P.sub.S). The combination of
malT and a mal promoter creates a tightly regulated expression
system that has been shown to work as a strong promoter induced by
the addition of maltose (6). Unlike the araC-P.sub.BAD system, malT
is expressed from a promoter (P.sub.T) functionally unconnected to
the other mal promoters. P.sub.T is not regulated by MalT. The
malEFG-malKBM promoter is a bidirectional promoter controlling
expression of the malKBM nucleic acid sequences in one direction,
and the malEFG nucleic acid sequences in the other direction. For
convenience, the portion of the malEFG-malKBM promoter that
mediates expression of the malKBM nucleic acid sequence, and which
is controlled by the malT nucleic acid sequence product, is
referred to herein as P.sub.KBM, and the portion of the
malEFG-malKBM promoter that mediates expression of the malEFG
nucleic acid sequence, and that is controlled by the malT nucleic
acid sequence product, is referred to herein as P.sub.EFG. Full
induction of P.sub.KBM requires the presence of the MalT binding
sites of P.sub.EFG. For use in the vectors and systems described
herein, a cassette with the malT nucleic acid sequence and one of
the mal promoters may be used. This cassette is referred to herein
as malT-P.sub.mal. In the presence of maltose, the MalT protein is
a positive regulatory element that allows expression from
P.sub.mal.
[0091] In still other embodiments, the promoter may be sensitive to
the level of rhamnose in the environment. Analogous to the
araC-P.sub.BAD system described above, the rhaRS-P.sub.rhaB
activator-promoter system is tightly regulated by rhamnose.
Expression from the rhamnose promoter (P.sub.rha) is induced to
high levels by the addition of rhamnose, which is common in
bacteria but rarely found in host tissues. The nucleic acid
sequences rhaBAD are organized in one operon that is controlled by
the P.sub.rhaBAD promoter. This promoter is regulated by two
activators, RhaS and RhaR, and the corresponding nucleic acid
sequences belong to one transcription unit that is located in the
opposite direction of the rhaBAD nucleic acid sequences. If
L-rhamnose is available, RhaR binds to the P.sub.rhaRS promoter and
activates the production of RhaR and RhaS. RhaS together with
L-rhamnose in turn binds to the P.sub.rhaBAD and the P.sub.rhaT
promoter and activates the transcription of the structural nucleic
acid sequences (7). Full induction of rhaBAD transcription also
requires binding of the Crp-cAMP complex, which is a key regulator
of catabolite repression (7).
[0092] Although both L-arabinose and L-rhamnose act directly as
inducers for expression of regulons for their catabolism, important
differences exist in regard to the regulatory mechanisms.
L-Arabinose acts as an inducer with the activator AraC in the
positive control of the arabinose regulon. However, the L-rhamnose
regulon is subject to a regulatory cascade; it is therefore subject
to even tighter control than the araC P.sub.BAD system. L-Rhamnose
acts as an inducer with the activator RhaR for synthesis of RhaS,
which in turn acts as an activator in the positive control of the
rhamnose regulon. In the present invention, rhamnose may be used to
interact with the RhaR protein and then the RhaS protein may
activate transcription of a nucleic acid sequence operably-linked
to the P.sub.rhaBAD promoter.
[0093] In still other embodiments, the promoter may be sensitive to
the level of xylose in the environment. The xylR-P.sub.xylA system
is another well-established inducible activator-promoter system.
Xylose induces xylose-specific operons (xylE, xylFGHR, and xylAB)
regulated by XylR and the cyclic AMP-Crp system. The XylR protein
serves as a positive regulator by binding to two distinct regions
of the xyl nucleic acid sequence promoters. As with the
araC-P.sub.BAD system described above, the xylR-P.sub.xylAB and/or
xylR-P.sub.xylFGH regulatory systems may be used in the present
invention. In these embodiments, xylR P.sub.xylAB xylose
interacting with the XylR protein activates transcription of
nucleic acid sequences operably-linked to either of the two
P.sub.xyl promoters.
[0094] The nucleic acid sequences of the promoters detailed herein
are known in the art, and methods of operably-linking them to a
chromosomally integrated nucleic acid sequence encoding a repressor
are known in the art and detailed in the examples.
iii. Modification to Optimize Expression
[0095] A nucleic acid sequence encoding a repressor and regulatable
promoter detailed above, for use in the present invention, may be
modified so as to optimize the expression level of the nucleic acid
sequence encoding the repressor. The optimal level of expression of
the nucleic acid sequence encoding the repressor may be estimated,
or may be determined by experimentation (see the Examples). Such a
determination should take into consideration whether the repressor
acts as a monomer, dimer, trimer, tetramer, or higher multiple, and
should also take into consideration the copy number of the vector
encoding the antigen of interest, as detailed below. In an
exemplary embodiment, the level of expression is optimized so that
the repressor is synthesized while in the permissive environment
(i.e. in vitro growth) at a level that substantially inhibits the
expression of the nucleic acid encoding an antigen of interest, and
is substantially not synthesized in a non-permissive environment,
thereby allowing expression of the nucleic acid encoding an antigen
of interest.
[0096] As stated above, the level of expression may be optimized by
modifying the nucleic acid sequence encoding the repressor and/or
promoter. As used herein, "modify" refers to an alteration of the
nucleic acid sequence of the repressor and/or promoter that results
in a change in the level of transcription of the nucleic acid
sequence encoding the repressor, or that results in a change in the
level of synthesis of the repressor. For instance, in one
embodiment, modify may refer to altering the start codon of the
nucleic acid sequence encoding the repressor. Generally speaking, a
GTG or TTG start codon, as opposed to an ATG start codon, may
decrease translation efficiency ten-fold. In another embodiment,
modify may refer to altering the Shine-Dalgarno (SD) sequence of
the nucleic acid sequence encoding the repressor. The SD sequence
is a ribosomal binding site generally located 6-7 nucleotides
upstream of the start codon. The SD consensus sequence is AGGAGG,
and variations of the consensus sequence may alter translation
efficiency. In yet another embodiment, modify may refer to altering
the distance between the SD sequence and the start codon. In still
another embodiment, modify may refer to altering the -35 sequence
for RNA polymerase recognition. In a similar embodiment, modify may
refer to altering the -10 sequence for RNA polymerase binding. In
an additional embodiment, modify may refer to altering the number
of nucleotides between the -35 and -10 sequences. In an alternative
embodiment, modify may refer to optimizing the codons of the
nucleic acid sequence encoding the repressor to alter the level of
translation of the mRNA encoding the repressor. For instance, non-A
rich codons initially after the start codon of the nucleic acid
sequence encoding the repressor may not maximize translation of the
mRNA encoding the repressor. Similarly, the codons of the nucleic
acid sequence encoding the repressor may be altered so as to mimic
the codons from highly synthesized proteins of a particular
organism. In a further embodiment, modify may refer to altering the
GC content of the nucleic acid sequence encoding the repressor to
change the level of translation of the mRNA encoding the
repressor.
[0097] In some embodiments, more than one modification or type of
modification may be performed to optimize the expression level of
the nucleic acid sequence encoding the repressor. For instance, at
least one, two, three, four, five, six, seven, eight, or nine
modifications, or types of modifications, may be performed to
optimize the expression level of the nucleic acid sequence encoding
the repressor.
[0098] By way of non-limiting example, when the repressor is LacI,
then the nucleic acid sequence of LacI and the promoter may be
altered so as to increase the level of LacI synthesis. In one
embodiment, the start codon of the LacI repressor may be altered
from GTG to ATG. In another embodiment, the SD sequence may be
altered from AGGG to AGGA. In yet another embodiment, the codons of
lacI may be optimized according to the codon usage for highly
synthesized proteins of Salmonella. In a further embodiment, the
start codon of lacI may be altered, the SD sequence may be altered,
and the codons of lacI may be optimized.
[0099] Methods of modifying the nucleic acid sequence encoding the
repressor and/or the regulatable promoter are known in the art and
detailed in the examples.
iv. Transcription Termination Sequence
[0100] In some embodiments, the chromosomally integrated nucleic
acid sequence encoding the repressor further comprises a
transcription termination sequence. A transcription termination
sequence may be included to prevent inappropriate expression of
nucleic acid sequences adjacent to the chromosomally integrated
nucleic acid sequence encoding the repressor and regulatable
promoter.
(b) Vector
[0101] A recombinant bacterium of the invention that is capable of
the regulated expression of at least one nucleic acid sequence
encoding an antigen comprises, in part, a vector. The vector
comprises a nucleic acid sequence encoding at least one antigen of
interest operably linked to a promoter. The promoter is regulated
by the chromosomally encoded repressor, such that the expression of
the nucleic acid sequence encoding an antigen is repressed during
in vitro growth of the bacterium, but the bacterium is capable of
high level synthesis of the antigen in an animal or human host.
[0102] As used herein, "vecto0r" refers to an autonomously
replicating nucleic acid unit. The present invention can be
practiced with any known type of vector, including viral, cosmid,
phasmid, and plasmid vectors. The most preferred type of vector is
a plasmid vector.
[0103] As is well known in the art, plasmids and other vectors may
possess a wide array of promoters, multiple cloning sequences,
transcription terminators, etc., and vectors may be selected so as
to control the level of expression of the nucleic acid sequence
encoding an antigen by controlling the relative copy number of the
vector. In some instances in which the vector might encode a
surface localized adhesin as the antigen, or an antigen capable of
stimulating T-cell immunity, it may be preferable to use a vector
with a low copy number such as at least two, three, four, five,
six, seven, eight, nine, or ten copies per bacterial cell. A
non-limiting example of a low copy number vector may be a vector
comprising the pSC101 ori.
[0104] In other cases, an intermediate copy number vector might be
optimal for inducing desired immune responses. For instance, an
intermediate copy number vector may have at least 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or
30 copies per bacterial cell. A non-limiting example of an
intermediate copy number vector may be a vector comprising the p15A
ori.
[0105] In still other cases, a high copy number vector might be
optimal for the induction of maximal antibody responses. A high
copy number vector may have at least 31, 35, 40, 45, 50, 55, 60,
65, 70, 75, 80, 85, 90, 95, or 100 copies per bacterial cell. In
some embodiments, a high copy number vector may have at least 100,
125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400
copies per bacterial cell. Non-limiting examples of high copy
number vectors may include a vector comprising the pBR ori or the
pUC ori.
[0106] Additionally, vector copy number may be increased by
selecting for mutations that increase plasmid copy number. These
mutations may occur in the bacterial chromosome but are more likely
to occur in the plasmid vector.
[0107] Preferably, vectors used herein do not comprise antibiotic
resistance markers to select for maintenance of the vector.
i. Antigen
[0108] As used herein, "antigen" refers to a biomolecule capable of
eliciting an immune response in a host. In some embodiments, an
antigen may be a protein, or fragment of a protein, or a nucleic
acid. In an exemplary embodiment, the antigen elicits a protective
immune response. As used herein, "protective" means that the immune
response contributes to the lessening of any symptoms associated
with infection of a host with the pathogen the antigen was derived
from or designed to elicit a response against. For example, a
protective antigen from a pathogen, such as Mycobacterium, may
induce an immune response that helps to ameliorate symptoms
associated with Mycobacterium infection or reduce the morbidity and
mortality associated with infection with the pathogen. The use of
the term "protective" in this invention does not necessarily
require that the host is completely protected from the effects of
the pathogen.
[0109] Antigens may be from bacterial, viral, mycotic and parasitic
pathogens, and may be designed to protect against bacterial, viral,
mycotic, and parasitic infections, respectively. Alternatively,
antigens may be derived from gametes, provided they are gamete
specific, and may be designed to block fertilization. In another
alternative, antigens may be tumor antigens, and may be designed to
decrease tumor growth. It is specifically contemplated that
antigens from organisms newly identified or newly associated with a
disease or pathogenic condition, or new or emerging pathogens of
animals or humans, including those now known or identified in the
future, may be expressed by a bacterium detailed herein.
Furthermore, antigens for use in the invention are not limited to
those from pathogenic organisms. The selection and recombinant
synthesis of antigens has been previously described by Schodel (9)
and Curtiss (10). Immunogenicity of the bacterium may be augmented
and/or modulated by constructing strains that also express
sequences for cytokines, adjuvants, and other immunomodulators.
[0110] Some examples of microorganisms useful as a source for
antigen are listed below. These may include microorganisms for the
control of plague caused by Yersinia pestis and other Yersinia
species such as Y. pseudotuberculosis and Y. enterocolitica, for
the control of gonorrhea caused by Neisseria gonorrhoea, for the
control of syphilis caused by Treponema pallidum, and for the
control of venereal diseases as well as eye infections caused by
Chlamydia trachomatis. Species of Streptococcus from both group A
and group B, such as those species that cause sore throat or heart
diseases, Erysipelothrix rhusiopathiae, Neisseria meningitidis,
Mycoplasma pneumoniae and other Mycoplasma-species, Hemophilus
influenza, Bordetella pertussis, Mycobacterium tuberculosis,
Mycobacterium leprae, other Bordetella species, Escherichia coli,
Streptococcus equi, Streptococcus pneumoniae, Brucella abortus,
Pasteurella hemolytica and P. multocida, Vibrio cholera, Shigella
species, Borrellia species, Bartonella species, Heliobacter pylori,
Campylobacter species, Pseudomonas species, Moraxella species,
Brucella species, Francisella species, Aeromonas species,
Actinobacillus species, Clostridium species, Rickettsia species,
Bacillus species, Coxiella species, Ehrlichia species, Listeria
species, and Legionella pneumophila are additional examples of
bacteria within the scope of this invention from which antigen
nucleic acid sequences could be obtained. Viral antigens may also
be used. Viral antigens may be used in antigen delivery
microorganisms directed against viruses, either DNA or RNA viruses,
for example from the classes Papovavirus, Adenovirus, Herpesvirus,
Poxvirus, Parvovirus, Reovirus, Picornavirus, Myxovirus,
Paramyxovirus, Flavivirus or Retrovirus. Antigens may also be
derived from pathogenic fungi, protozoa and parasites.
[0111] Certain embodiments encompass an allergen as an antigen.
Allergens are substances that cause allergic reactions in a host
that is exposed to them. Allergic reactions, also known as Type I
hypersensitivity or immediate hypersensitivity, are vertebrate
immune responses characterized by IgE production in conjunction
with certain cellular immune reactions. Many different materials
may be allergens, such as animal dander and pollen, and the
allergic reaction of individual hosts will vary for any particular
allergen. It is possible to induce tolerance to an allergen in a
host that normally shows an allergic response. The methods of
inducing tolerance are well-known and generally comprise
administering the allergen to the host in increasing dosages.
[0112] It is not necessary that the vector comprise the complete
nucleic acid sequence of the antigen. It is only necessary that the
antigen sequence used be capable of eliciting an immune response.
The antigen may be one that was not found in that exact form in the
parent organism. For example, a sequence coding for an antigen
comprising 100 amino acid residues may be transferred in part into
a recombinant bacterium so that a peptide comprising only 75, 65,
55, 45, 35, 25, 15, or even 10, amino acid residues is produced by
the recombinant bacterium. Alternatively, if the amino acid
sequence of a particular antigen or fragment thereof is known, it
may be possible to chemically synthesize the nucleic acid fragment
or analog thereof by means of automated nucleic acid sequence
synthesizers, PCR, or the like and introduce said nucleic acid
sequence into the appropriate copy number vector.
[0113] In another alternative, a vector may comprise a long
sequence of nucleic acid encoding several nucleic acid sequence
products, one or all of which may be antigenic. In some
embodiments, a vector of the invention may comprise a nucleic acid
sequence encoding at least one antigen, at least two antigens, at
least three antigens, or more than three antigens. These antigens
may be encoded by two or more open reading frames operably linked
to be expressed coordinately as an operon, wherein each antigen is
synthesized independently. Alternatively, the two or more antigens
may be encoded by a single open reading frame such that the
antigens are synthesized as a fusion protein.
[0114] In certain embodiments, an antigen of the invention may
comprise a B cell epitope or a T cell epitope. Alternatively, an
antigen to which an immune response is desired may be expressed as
a fusion to a carrier protein that contains a strong promiscuous T
cell epitope and/or serves as an adjuvant and/or facilitates
presentation of the antigen to enhance, in all cases, the immune
response to the antigen or its component part. This can be
accomplished by methods known in the art. Fusion to tenus toxin
fragment C, CT-B, LT-B and hepatitis virus B core are particularly
useful for these purposes, although other epitope presentation
systems are well known in the art.
[0115] In further embodiments, a nucleic acid sequence encoding an
antigen of the invention may comprise a secretion signal. In other
embodiments, an antigen of the invention may be toxic to the
recombinant bacterium.
ii. Promoter Regulated by Repressor
[0116] The vector comprises a nucleic acid sequence encoding at
least one antigen operably-linked to a promoter regulated by the
repressor, encoded by a chromosomally integrated nucleic acid
sequence. One of skill in the art would recognize, therefore, that
the selection of a repressor dictates, in part, the selection of
the promoter operably-linked to a nucleic acid sequence encoding an
antigen of interest. For instance, if the repressor is LacI, then
the promoter may be selected from the group consisting of LacI
responsive promoters, such as P.sub.trc, P.sub.lac, P.sub.T7lac and
P.sub.tac. If the repressor is C2, then the promoter may be
selected from the group consisting of C2 responsive promoters, such
as P22 promoters P.sub.L and P.sub.R. If the repressor is C1, then
the promoter may be selected from the group consisting of C1
responsive promoters, such as .lamda. promoters P.sub.L and
P.sub.R.
[0117] In each embodiment herein, the promoter regulates expression
of a nucleic acid sequence encoding the antigen, such that
expression of the nucleic acid sequence encoding an antigen is
repressed when the repressor is synthesized (i.e. during in vitro
growth of the bacterium), but expression of the nucleic acid
sequence encoding an antigen is high when the repressor is not
synthesized (i.e. in an animal or human host). Generally speaking,
the concentration of the repressor will decrease with every cell
division after expression of the nucleic acid sequence encoding the
repressor ceases. In some embodiments, the concentration of the
repressor decreases enough to allow high level expression of the
nucleic acid sequence encoding an antigen after about 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, or 12 divisions of the bacterium. In an
exemplary embodiment, the concentration of the repressor decreases
enough to allow high level expression of the nucleic acid sequence
encoding an antigen after about 5 divisions of the bacterium in an
animal or human host.
[0118] In certain embodiments, the promoter may comprise other
regulatory elements. For instance, the promoter may comprise lacO
if the repressor is LacI. This is the case with the lipoprotein
promoter P.sub.lpp that is regulated by LacI since it possesses the
LacI binding domain lacO.
[0119] In one embodiment, the repressor is a LacI repressor and the
promoter is P.sub.trc.
iii. Expression of the Nucleic Acid Sequence Encoding an
Antigen
[0120] As detailed above, generally speaking the expression of the
nucleic acid sequence encoding the antigen should be repressed when
the repressor is synthesized. For instance, if the repressor is
synthesized during in vitro growth of the bacterium, expression of
the nucleic acid sequence encoding the antigen should be repressed.
Expression may be "repressed" or "partially repressed" when it is
about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or even
less than 1% of the expression under non-repressed conditions. Thus
although the level of expression under conditions of "complete
repression" might be exceeding low, it is likely to be detectable
using very sensitive methods since repression can never by
absolute.
[0121] Conversely, the expression of the nucleic acid sequence
encoding the antigen should be high when the expression of the
nucleic acid sequence encoding the repressor is repressed. For
instance, if the nucleic acid sequence encoding the repressor is
not expressed during growth of the recombinant bacterium in the
host, the expression of the nucleic acid sequence encoding the
antigen should be high. As used herein, "high level" expression
refers to expression that is strong enough to elicit an immune
response to the antigen. Consequently, the copy number correlating
with high level expression can and will vary depending on the
antigen and the type of immune response desired. Methods of
determining whether an antigen elicits an immune response such as
by measuring antibody levels or antigen-dependant T cell
populations or antigen-dependant cytokine levels are known in the
art, and methods of measuring levels of expression of antigen
encoding sequences by measuring levels of mRNA transcribed or by
quantitating the level of antigen synthesis are also known in the
art. For more details, see the examples.
(c) Crp Cassette
[0122] In some embodiments, a recombinant bacterium of the
invention may also comprise a .DELTA.P.sub.crp::TT araC P.sub.BAD
crp deletion-insertion mutation. Since the araC P.sub.BAD cassette
is dependent both on the presence of arabinose and the binding of
the catabolite repressor protein Crp, a .DELTA.P.sub.crp::TT araC
P.sub.BAD crp deletion-insertion mutation may be included as an
additional means to reduce expression of any nucleic acid sequence
under the control of the P.sub.BAD promoter. This means that when
the bacterium is grown in a non-permissive environment (i.e. no
arabinose) both the repressor itself and the Crp protein cease to
be synthesized, consequently eliminating both regulating signals
for the araC P.sub.BAD regulated nucleic acid sequence. This double
shut off of araC P.sub.BAD may constitute an additional safety
feature ensuring the genetic stability of the desired
phenotypes.
[0123] Generally speaking, the activity of the Crp protein requires
interaction with cAMP, but the addition of glucose, which may
inhibit synthesis of cAMP, decreases the ability of the Crp protein
to regulate transcription from the araC P.sub.BAD promoter.
Consequently, to avoid the effect of glucose on cAMP, glucose may
be substantially excluded from the growth media, or variants of crp
may be isolated that synthesize a Crp protein that is not dependent
on cAMP to regulate transcription from P.sub.BAD. This strategy may
also be used in other systems responsive to Crp, such as the
systems responsive to rhamnose and xylose described above.
(d) Attenuation
[0124] In each of the above embodiments, a recombinant bacterium of
the invention capable of regulated expression may also be
attenuated. "Attenuated" refers to the state of the bacterium
wherein the bacterium has been weakened from its wild type fitness
by some form of recombinant or physical manipulation. This includes
altering the genotype of the bacterium to reduce its ability to
cause disease. However, the bacterium's ability to colonize the gut
(in the case of Salmonella) and induce immune responses is,
preferably, not substantially compromised.
[0125] In an exemplary embodiment, a recombinant bacterium may be
attenuated as described in section II below. In which case, both
regulated attenuation and regulated expression of an antigen
encoding sequence may be dependent upon an arabinose regulatable
system. Consequently, the concentration of arabinose needed for
optimal expression of the regulated antigen encoding sequence may
not be the same as the concentration for optimal expression of
attenuation. In an exemplary embodiment, the concentration of
arabinose for the optimization of both regulated attenuation and
regulated expression of sequences encoding antigen will be
substantially the same.
[0126] Accordingly, the promoter and/or the nucleic acid sequence
encoding an attenuation protein may be modified to optimize the
system. Methods of modification are detailed above. Briefly, for
example, the SD ribosome binding sequence may be altered, and/or
the start codon may be altered from ATG to GTG for the nucleic acid
sequences fur and phoPQ, so that the production levels of Fur and
PhoPQ are optimal for both the regulated attenuation phenotype and
the regulated expression when growing strains with a given
concentration of arabinose. One of skill in the art will appreciate
that other nucleic acid sequences, in addition to fur and phoPQ,
may also be altered as described herein in combination with other
well-known protocols. In addition, these attenuating nucleic acid
sequences may be regulated by other systems using well-established
protocols known to one of skill in the art. For example, they may
be regulated using with promoters dependent on addition of maltose,
rhamnose, or xylose rather than arabinose.
[0127] Other methods of attenuation are known in the art. For
instance, attenuation may be accomplished by altering (e.g.,
deleting) native nucleic acid sequences found in the wild type
bacterium. For instance, if the bacterium is Salmonella,
non-limiting examples of nucleic acid sequences which may be used
for attenuation include: a pab nucleic acid sequence, a pur nucleic
acid sequence, an aro nucleic acid sequence, asd, a dap nucleic
acid sequence, nadA, pncB, galE, pmi, fur, rpsL, ompR, htrA, hemA,
cdt, cya, crp, dam, phoP, phoQ, rfc, poxA, galU, mviA, sodC, recA,
ssrA, sirA, inv, hilA, rpoE, flgM, tonB, slyA, and any combination
thereof. Exemplary attenuating mutations may be aroA, aroC, aroD,
cdt, cya, crp, phoP, phoQ, ompR, galE, and htrA.
[0128] In certain embodiments, the above nucleic acid sequences may
be placed under the control of a sugar regulated promoter wherein
the sugar is present during in vitro growth of the recombinant
bacterium, but substantially absent within an animal or human host.
The cessation in transcription of the nucleic acid sequences listed
above would then result in attenuation and the inability of the
recombinant bacterium to induce disease symptoms.
[0129] In another embodiment, the recombinant bacterium may contain
one and in some embodiments, more than one, deletion and/or
deletion-insertion mutation present in the strains listed in Table
1 above. Furthermore, suicide vectors, as listed in Table 2, and ss
described in the Examples below, along with other plasmid vectors,
may be used to introduce these deletion and deletion-insertion
mutations into strains during their construction.
TABLE-US-00002 TABLE 2 Plasmid Properties Suicide vector pMEG-375
sacRB mobRP4 R6K ori Cm.sup.r Ap.sup.r pMEG-443 .DELTA.asdA16
pRE112 SacB mobRP4 R6K ori Cm.sup.r pYA3438 .DELTA.pabB232 in
pMEG-375 pYA3485 .DELTA.araE25 in pMEG-375 pYA3599 .DELTA.araBAD23
in pMEG-375 pYA3629 .DELTA.(gmd-fcl)-26 in pMEG-375 pYA3652
.DELTA.endA2311 in pMEG-375 pYA3679 .DELTA.relA1123 in pMEG-375
pYA3722 .DELTA.P.sub.fur33::TT araC P.sub.BAD fur in pMEG-375
pYA3723 .DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ in pRE112
pYA3735 .DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS in pRE112
pYA3736 .DELTA.asdA33 in pRE112 pYA3737 .DELTA.asdA18::TT araC
P.sub.BAD P22 c2 in pRE112 pYA3783 pRE112 derived suicide vector to
generate GTG-lacI, .DELTA.endA19::araC P.sub.BAD lacI TT mutation,
Cm.sup.r pYA3784 pRE112 derived suicide vector to generate
GTG-lacI, .DELTA.relA196::araC P.sub.BAD lacI TT mutation, Cm.sup.r
pYA3832 .DELTA.P.sub.crp527::TT araC P.sub.BAD crp in pRE112
pYA3871 pRE112 derived suicide vector to generate ATG-lacI,
.DELTA.endA20::araC P.sub.BAD lacI TT mutation, Cm.sup.r pYA3879
pRE112 derived suicide vector to generate ATG-lacI,
.DELTA.relA197::araC P.sub.BAD lacI TT mutation, Cm.sup.r pYA4062
.DELTA.P.sub.phoPQ173::TT araC P.sub.BAD phoPQ in pRE112 pYA4063
pRE112 derived suicide vector to generate improved SD ATG-lacI,
.DELTA.endA21::araC P.sub.BAD lacI (improved codon) TT mutation,
Cm.sup.r pYA4064 pRE112 derived suicide vector to generate codon
optimized lacI, .DELTA.relA198::araC P.sub.BAD lacI TT mutation,
Cm.sup.r pYA4109 .DELTA.P.sub.phoPQ177::TT araC P.sub.BAD phoPQ in
pRE112 pYA4138 .DELTA.asdA27::TT araC P.sub.BAD P22 c2 in pRE112
pYA4177 .DELTA.asdA21::TT araC P.sub.BAD P22 c2 in pRE112 pYA4180
.DELTA.P.sub.fur77::TT araC P.sub.BAD fur in pRE112 pYA4181
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur in pRE112 pYA4213
.DELTA.asdA20::TT araC P.sub.BAD P22 c2 in pRE112 pYA4235
.DELTA.P.sub.murA12::TT araC P.sub.BAD murA in pRE112 pYA4280
.DELTA.(araC P.sub.BAD)-5: P22 P.sub.R araBAD in pRE112 pYA4343
.DELTA.P.sub.phoPQ176::TT araC P.sub.BAD phoPQ in pRE112 pYA4344
.DELTA.P.sub.phoPQ175::TT araC P.sub.BAD phoPQ in pRE112 pYA4345
.DELTA.P.sub.phoPQ174::TT araC P.sub.BAD phoPQ in pRE112
Recombinant vector pGEM-3Z Ap.sup.r, Cloning vector, pUC ori
pYA3342 pBR ori Asd.sup.+, 3012 bp pYA3450 p15A ori araC
.sup..sctn. P.sub.BAD SD-ATG asdA pYA3493 pBR ori bla SS,
Asd.sup.+, 3113 bp, pYA3530 p15A ori araC .sup..sctn. P.sub.BAD
SD-GTG asdA pYA3552 Asd.sup.+ vector expression gfp3, pBR ori
pYA3620 pBR ori Asd.sup.+, bla SS bla CT, 3169 bp pYA3624 Plasmid
with tightly regulated araC P.sub.BAD cassette, p15A ori pYA3634
pBR ori bla SS, Asd.sup.+ PspA Rx1 aa 3-257 pYA3635 pBR ori bla SS,
Asd.sup.+ PspA Rx1 aa 3-257 (codon optimized) pYA3681 pBR ori araC
P.sub.BAD SD-GTG asdA SD-GTG murA P22 P.sub.R anti-sense mRNA
pYA3685 pBR ori araC P.sub.BAD SD-GTG asdA SD-GTG murA P22 P.sub.R
anti-sense mRNA, rPspA Rx1 pYA3698 pGEM-3Z with T4 ipIII
transcription terminator, Ap.sup.r pYA3699 pGEM-3Z with araC
P.sub.BAD cassette, Ap.sup.r pYA3700 AraC P.sub.BAD TT cassette
plasmid, Ap.sup.r pYA3782 P.sub.BAD regulated lacI (GTG) in
pYA3700-PCR-Topo-Blunt II pYA3789 Runaway vector harboring araC
P.sub.BAD P22 c2, GTG-MurA.sup.+, GTG-Asd.sup.+, P.sub.trc, pSC101
ori, pUC ori pYA3856 pBAD-HisA with GTG start codon lacI,
His-tagged, Ap.sup.r pYA4050 pUC ori araC P.sub.BAD SD-GTG murA
SD-GTF asd, P22P.sub.R antisense RNA with DNA nuclear Targeting
sequence and poly A from SV40, 6941 bp pYA4088 pBR ori bla SS,
Asd.sup.+ PspA Rx1 aa 3-285 (codon optimized) pYA4090 Asd.sup.+
vector, P.sub.trc gfp3, pBR ori p = plasmid P = promoter SD =
Shine-Dalgarno sequence araC .sup..sctn. P.sub.BAD = E. coli B/r aa
= amino acid SS = signal sequence Ap.sup.r = ampicillin resistance
Cm.sup.r = chloramphenicol resistance
[0130] The bacterium may also be modified to create a
balanced-lethal host-vector system, although other types of systems
may also be used (e.g., creating complementation heterozygotes).
For the balanced-lethal host-vector system, the bacterium may be
modified by manipulating its ability to synthesize various
essential constituents needed for synthesis of the rigid
peptidoglycan layer of its cell wall. In one example, the
constituent is diaminopimelic acid (DAP). Various enzymes are
involved in the eventual synthesis of DAP. In one example, the
bacterium is modified by using a .DELTA.asdA mutation to eliminate
the bacterium's ability to produce .beta.-aspartate semialdehyde
dehydrogenase, an enzyme essential for the synthesis of DAP. One of
skill in the art can also use the teachings of U.S. Pat. No.
6,872,547 for other types of mutations of nucleic acid sequences
that result in the abolition of the synthesis of DAP. These nucleic
acid sequences may include, but are not limited to, dapA, dapB,
dapC, dapD, dapE, dapF, and asd. Other modifications that may be
employed include modifications to a bacterium's ability to
synthesize D-alanine or to synthesize D-glutamic acid (e.g.,
.DELTA.murI mutations), which are both unique constituents of the
peptidoglycan layer of the bacterial cell wall
[0131] Yet another balanced-lethal host-vector system comprises
modifying the bacterium such that the synthesis of an essential
constituent of the rigid layer of the bacterial cell wall is
dependent on a nutrient (e.g., arabinose) that can be supplied
during the growth of the microorganism. For example, a bacterium
may be comprise the .DELTA.P.sub.murA::TT araC P.sub.BAD murA
deletion-insertion mutation. This type of mutation makes synthesis
of muramic acid (another unique essential constituent of the
peptidoglycan layer of the bacterial cell wall) dependent on the
presence of arabinose that can be supplied during growth of the
bacterium in vitro.
[0132] However, when arabinose is absent as it is in an animal or
human host, the essential constitutent of the peptidoglycan layer
of the cell wall is not synthesized. This mutation represents an
arabinose dependant lethal mutation. In the absence of arabinose,
synthesis of muramic acid ceases and lysis of the bacterium occurs
because the peptidoglycan layer of the cell wall is not
synthesized. It is not possible to generate .DELTA.murA mutations
because they are lethal. The necessary nutrient, a phosphorylated
muramic acid, can not be exogenously supplied because enteric
bacteria cannot take the nutrient up from the media. Recombinant
bacteria with a .DELTA.P.sub.murA::TT araC P.sub.BAD murA
deletion-insertion mutation grown in the presence of arabinose
exhibit effective colonization of effector lymphoid tissues after
oral vaccination prior to undergoing lysis due to the inability to
synthesize muramic acid.
[0133] Similarly, various embodiments may comprise the araC
P.sub.BAD c2 cassette inserted into the asd nucleic acid sequence
that encodes aspartate semialdehyde dehydrogenase. Since the araC
nucleic acid sequence is transcribed in a direction that could lead
to interference in the expression of adjacent nucleic acid
sequences and adversely affect vaccine strain performance, a
transcription termination (TT) sequence is generally inserted 3' to
the araC nucleic acid sequence. The chromosomal asd nucleic acid
sequence is typically inactivated to enable use of plasmid vectors
encoding the wild-type asd nucleic acid sequence in the balanced
lethal host-vector system. This allows stable maintenance of
plasmids in vivo in the absence of any drug resistance attributes
that are not permissible in live bacterial vaccines. In some of
these embodiments, the wild-type asd nucleic acid sequence may be
encoded by the vector described above. The vector enables the
regulated expression of an antigen encoding sequence through the
repressible promoter. For instance, in one embodiment shown in FIG.
13, pYA3634 has the Asd.sup.+ vector specifying the antigen PspA
Rx1.
[0134] In one embodiment shown in FIG. 4, .DELTA.asdA271::TT araC
P.sub.BAD c2 has an improved SD sequence and a codon optimized c2
nucleic acid sequence (FIG. 5). The C2 repressor synthesized in the
presence of arabinose is used to repress nucleic acid sequence
expression from P22 P.sub.R and P.sub.L promoters. In another
embodiment shown in FIG. 4, .DELTA.asdA27::TT araC P.sub.BAD c2
(the preferred embodiment) has the 1104 base-pair asd nucleic acid
sequence deleted (1 to 1104, but not including the TAG stop codon)
and the 1989 base-pair fragment containing T4 ipIII TT araC
P.sub.BAD c2 inserted. The c2 nucleic acid sequence in
.DELTA.asdA27::TT araC P.sub.BAD c2 has a SD sequence that was
optimized to TAAGGAGGT. It also has an improved P.sub.BAD promoter
such that the -10 sequence is improved from TACTGT to TATAAT.
Furthermore, it has a codon optimized c2 nucleic acid sequence, in
which the second codon was modified from AAT to AAA (FIG. 6).
[0135] In further embodiments, the bacterium may be attenuated by
regulating the murA nucleic acid sequence encoding the first enzyme
in muramic acid synthesis and the asd nucleic acid sequence
essential for DAP synthesis. These embodiments may comprise the
chromosomal deletion-insertion mutations .DELTA.asdA19::TT araC
P.sub.BAD c2 or .DELTA.asdA27::TT araC P.sub.BAD c2 and
.DELTA.P.sub.murA7::TT araC P.sub.BAD or .DELTA.P.sub.murA12::TT
araC P.sub.BAD murA. This host-vector grows in LB broth with 0.1%
L-arabinose, but is unable to grow in or on media devoid of
arabinose since it undergoes cell wall-less death by lysis. In some
embodiments of the invention, the recombinant bacterium may
comprise araBAD and araE mutations to preclude breakdown and
leakage of internalized arabinose such that asd and murA nucleic
acid sequence expression continues for a cell division or two after
oral immunization into an environment that is devoid of external
arabinose. (For example a strain with the .DELTA.P.sub.murA7::TT
araC P.sub.BAD murA deletion-insertion mutation undergoes about two
cell divisions and then commences to lyse in media made of mouse or
chicken feed or chicken breast meat, unless they are supplemented
with arabinose.) Either GTG or TTG start codons for the murA and
asd nucleic acid sequences are important to decrease translation
efficiency on multi-copy plasmids. This embodiment is illustrated
by FIG. 14, which shows the plasmid vector pYA3681. This vector
contains the murA nucleic acid sequence (with altered start codon
sequences to decrease translation efficiency) under the control of
an araC P.sub.BAD promoter. Also the second nucleic acid sequence
under the direction of this promoter is the asd nucleic acid
sequence (with altered start codon sequences to decrease
translation efficiency). The P22 P.sub.R promoter is in the
anti-sense direction of both the asd nucleic acid sequence and the
murA nucleic acid sequence. The P22 P.sub.R is repressed by the C2
repressor made during growth of the strain in media with arabinose
(due to the .DELTA.asdA19::TT araC P.sub.BAD c2
deletion-insertion). However C2 concentration decreases due to cell
division in vivo to cause P.sub.R directed synthesis of anti-sense
mRNA to further block translation of asd and murA mRNA. The araC
P.sub.BAD sequence is also not from E. coli B/r as originally
described (5) but represents a sequence derived from E. coli K-12
strain .chi.289 with tighter control and less leakiness in the
absence of arabinose. In the preferred embodiment, transcription
terminators (TT) flank all of the domains for controlled lysis,
replication, and expression so that expression in one domain does
not affect the activities of another domain. As a safety feature,
the plasmid asd nucleic acid sequence does not replace the
chromosomal asd mutation since they have a deleted sequence in
common, consequently, the E. coli murA nucleic acid sequence was
used in the plasmid instead of using the Salmonella murA nucleic
acid sequence. The recombinant bacterium of this embodiment is
avirulent at oral doses in excess of 10.sup.9 CFU to BALB/c mice.
In addition to being fully attenuated, this construction exhibits
complete biological containment with no in vivo recombinant
bacteria survivors detectable after 21 days and no recombinant
bacteria survivors during or after excretion. This property
enhances vaccine safety and minimizes the potential for vaccination
of individuals not intended for vaccination.
II. Regulated Attenuation
[0136] The present invention also encompasses a recombinant
bacterium capable of regulated attenuation. Generally speaking, the
bacterium comprises a chromosomally integrated regulatable
promoter. The promoter replaces the native promoter of, and is
operably linked to, at least one nucleic acid sequence encoding an
attenuation protein, such that the absence of the function of the
protein renders the bacterium attenuated. In some embodiments, the
promoter is modified to optimize the regulated attenuation.
[0137] In each of the above embodiments described herein, more than
one method of attenuation may be used. For instance, a recombinant
bacterium of the invention may comprise a regulatable promoter
chromosomally integrated so as to replace the native promoter of,
and be operably linked to, at least one nucleic acid sequence
encoding an attenuation protein, such that the absence of the
function of the protein renders the bacterium attenuated, and the
bacterium may comprise another method of attenuation detailed in
section I above.
(a) Attenuation Protein
[0138] Herein, "attenuation protein" is meant to be used in its
broadest sense to encompass any protein the absence of which
attenuates a bacterium. For instance, in some embodiments, an
attenuation protein may be a protein that helps protect a bacterium
from stresses encountered in the gastrointestinal tract or
respiratory tract. Non-limiting examples may be the RpoS, PhoPQ,
OmpR, Fur, and Crp proteins. In other embodiments, the protein may
be a necessary component of the cell wall of the bacterium, such as
the protein encoded by murA. In still other embodiments, the
protein may be listed in Section I(d) above.
[0139] The native promoter of at least one, two, three, four, five,
or more than five attenuation proteins may be replaced by a
regulatable promoter as described herein. In one embodiment, the
promoter of one of the proteins selected from the group comprising
RpoS, PhoPQ, OmpR, Fur, and Crp may be replaced. In another
embodiment, the promoter of two, three, four or five of the
proteins selected from the group comprising RpoS, PhoPQ, OmpR, Fur,
and Crp may be replaced.
[0140] If the promoter of more than one attenuation protein is
replaced, each promoter may be replaced with a regulatable
promoter, such that the expression of each attenuation protein
encoding sequence is regulated by the same compound or condition.
Alternatively, each promoter may be replaced with a different
regulatable promoter, such that the expression of each attenuation
protein encoding sequence is regulated by a different compound or
condition such as by the sugars arabinose, maltose, rhamnose or
xylose.
(b) Regulatable Promoter
[0141] The native promoter of a nucleic acid encoding an
attenuation protein is replaced with a regulatable promoter
operably linked to the nucleic acid sequence encoding an
attenuation protein. The term "operably linked," is defined
above.
[0142] The regulatable promoter used herein generally allows
transcription of the nucleic acid sequence encoding the attenuation
protein while in a permissive environment (i.e. in vitro growth),
but cease transcription of the nucleic acid sequence encoding an
attenuation protein while in a non-permissive environment (i.e.
during growth of the bacterium in an animal or human host). For
instance, the promoter may be responsive to a physical or chemical
difference between the permissive and non-permissive environment.
Suitable examples of such regulatable promoters are known in the
art and detailed above.
[0143] In some embodiments, the promoter may be responsive to the
level of arabinose in the environment, as described above. In other
embodiments, the promoter may be responsive to the level of
maltose, rhamnose, or xylose in the environment, as described
above. The promoters detailed herein are known in the art, and
methods of operably linking them to a nucleic acid sequence
encoding an attenuation protein are known in the art.
[0144] In certain embodiments, a recombinant bacterium of the
invention may comprise any of the following: P.sub.fur::TT araC
P.sub.BAD fur, P.sub.crp::TT araC P.sub.BAD crp,
.DELTA.P.sub.phoPQ::TT araC P.sub.BAD phoPQ, or a combination
thereof. (P stands for promoter and TT stands for transcription
terminator). Growth of such strains in the presence of arabinose
leads to transcription of the fur, phoPQ, and/or crp nucleic acid
sequences, but nucleic acid sequence expression ceases in a host
because there is no free arabinose. Attenuation develops as the
products of the fur, phoPQ, and/or the crp nucleic acid sequences
are diluted at each cell division. Strains with the
.DELTA.P.sub.fur and/or the .DELTA.P.sub.phoPQ mutations are
attenuated at oral doses of 10.sup.9 CFU, even in three-week old
mice at weaning. Generally speaking, the concentration of arabinose
necessary to induce expression is typically less than about 2%. In
some embodiments, the concentration is less than about 1.5%, 1%,
0.5%, 0.2%, 0.1%, or 0.05%. In certain embodiments, the
concentration may be about 0.04%, 0.03%, 0.02%, or 0.01%. In an
exemplary embodiment, the concentration is about 0.05%. Higher
concentrations of arabinose or other sugars may lead to acid
production during growth that may inhibit desirable cell densities.
The inclusion of mutations such as .DELTA.araBAD or mutations that
block the uptake and/or breakdown of maltose, rhamnose, or xylose,
however, may prevent such acid production and enable use of higher
sugar concentrations with no ill effects.
[0145] When the regulatable promoter is responsive to arabinose,
the onset of attenuation may be delayed by including additional
mutations, such as .DELTA.araBAD23, which prevents use of arabinose
retained in the cell cytoplasm at the time of oral immunization,
and/or .DELTA.araE25 that enhances retention of arabinose. Thus,
inclusion of these mutations may be beneficial in at least two
ways: first, enabling higher culture densities, and second enabling
a further delay in the display of the attenuated phenotype that may
result in higher densities in effector lymphoid tissues to further
enhance immunogenicity.
(c) Modifications
[0146] Attenuation of the recombinant bacterium may be optimized by
modifying the nucleic acid sequence encoding an attenuation protein
and/or promoter. Methods of modifying a promoter and/or a nucleic
acid sequence encoding an attenuation protein are the same as those
detailed above with respect to repressors in Section I.
[0147] In some embodiments, more than one modification may be
performed to optimize the attenuation of the bacterium. For
instance, at least one, two, three, four, five, six, seven, eight
or nine modifications may be performed to optimize the attenuation
of the bacterium.
[0148] In various exemplary embodiments of the invention, the SD
sequences and/or the start codons for the fur and/or the phoPQ
virulence nucleic acid sequences may be altered so that the
production levels of these nucleic acid products are optimal for
regulated attenuation. FIG. 8 depicts .DELTA.P.sub.fur77::TT araC
P.sub.BAD fur, whose start codon is changed from ATG to GTG, and
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur, that has a weakened SD
sequence as well as the start codon changed from ATG to GTG. FIG. 9
depicts .DELTA.P.sub.phoPQ173::TT araC P.sub.BAD phoPQ, that has
modifications to the start codon as well as the second codon, which
was changed from ATG to GTG. FIG. 9 also depicts
.DELTA.P.sub.phoPQ177::TT araC P.sub.BAD phoPQ, wherein the SD
sequence has been changed to the weaker AAGG sequence, the start
codon was modified, and the second codon was modified from ATG to
GTG.
(d) Crp Cassette
[0149] In some embodiments, a recombinant bacterium of the
invention may also comprise a .DELTA.P.sub.crp::TT araC P.sub.BAD
crp deletion-insertion mutation (FIG. 7), as described above. Since
the araC P.sub.BAD cassette is dependent both on the presence of
arabinose and the binding of the catabolite repressor protein Crp,
a .DELTA.P.sub.crp::TT araC P.sub.BAD crp deletion-insertion
mutation may be included as an additional control on the expression
of the nucleic acid sequence encoding an attenuation protein.
[0150] Generally speaking, the activity of the Crp protein requires
interaction with cAMP, but the addition of glucose, which may
inhibit synthesis of cAMP, decreases the ability of the Crp protein
to regulate transcription from the araC P.sub.BAD promoter.
Consequently, to avoid the effect of glucose on cAMP, glucose may
be substantially excluded from the growth media, or variants of crp
may be isolated that synthesize a Crp protein that is not dependent
on cAMP to regulate transcription from P.sub.BAD. This strategy may
also be used in other systems responsive to Crp, such as the
systems responsive to rhamnose and xylose described above
(e) Regulated Expression
[0151] In each of the above embodiments, a bacterium capable of
regulated attenuation may also be capable of regulated expression
of at least one nucleic acid encoding an antigen as detailed in
section I above.
[0152] For instance, various embodiments of the present invention
may encompass a recombinant pathogenic Enterobacteriaceae species
comprising deletion-insertion mutations conferring regulated
attenuation and regulated expression of a nucleic acid sequence
encoding an antigen. In some embodiments, the recombinant bacterium
may further comprise at least one chromosomal nucleic acid sequence
containing a mutation conferring a lethal phenotype. The mutated
chromosomal nucleic acid sequence may be complemented by a plasmid
vector containing a functional nucleic acid sequence corresponding
to the mutated chromosomal nucleic acid sequence.
III. Vaccine Compositions and Administration
[0153] A recombinant bacterium of the invention may be administered
to a host as a vaccine composition. As used herein, a vaccine
composition is a composition designed to elicit an immune response
to the recombinant bacterium, including any antigens that may be
expressed by the bacterium. In an exemplary embodiment, the immune
response is protective, as described above. Immune responses to
antigens are well studied and widely reported. A survey of
immunology is given by aul, WE, Stites D et. al. and Ogra P L. et.
al. (11-13). Mucosal immunity is also described by Ogra P L et. al.
(14).
[0154] Vaccine compositions of the present invention may be
administered to any host capable of mounting an immune response.
Such hosts may include all vertebrates, for example, mammals,
including domestic animals, agricultural animals, laboratory
animals, and humans, and various species of birds, including
domestic birds and birds of agricultural importance. Preferably,
the host is a warm-blooded animal. The vaccine can be administered
as a prophylactic or for treatment purposes.
[0155] In exemplary embodiments, the recombinant bacterium is alive
when administered to a host in a vaccine composition of the
invention. Suitable vaccine composition formulations and methods of
administration are detailed below.
(a) Vaccine Composition
[0156] A vaccine composition comprising a recombinant bacterium of
the invention may optionally comprise one or more possible
additives, such as carriers, preservatives, stabilizers, adjuvants,
and other substances.
[0157] In one embodiment, the vaccine comprises an adjuvant.
Adjuvants, such as aluminum hydroxide or aluminum phosphate, are
optionally added to increase the ability of the vaccine to trigger,
enhance, or prolong an immune response. In exemplary embodiments,
the use of a live attenuated recombinant bacterium may act as a
natural adjuvant. The vaccine compositions may further comprise
additional components known in the art to improve the immune
response to a vaccine, such as T cell co-stimulatory molecules or
antibodies, such as anti-CTLA4. Additional materials, such as
cytokines, chemokines, and bacterial nucleic acid sequences
naturally found in bacteria, like CpG, are also potential vaccine
adjuvants.
[0158] In another embodiment, the vaccine may comprise a
pharmaceutical carrier (or excipient). Such a carrier may be any
solvent or solid material for encapsulation that is non-toxic to
the inoculated host and compatible with the recombinant bacterium.
A carrier may give form or consistency, or act as a diluent.
Suitable pharmaceutical carriers may include liquid carriers, such
as normal saline and other non-toxic salts at or near physiological
concentrations, and solid carriers not used for humans, such as
talc or sucrose, or animal feed. Carriers may also include
stabilizing agents, wetting and emulsifying agents, salts for
varying osmolarity, encapsulating agents, buffers, and skin
penetration enhancers. Carriers and excipients as well as
formulations for parenteral and nonparenteral drug delivery are set
forth in Remington's Pharmaceutical Sciences 19th Ed. Mack
Publishing (1995). When used for administering via the bronchial
tubes, the vaccine is preferably presented in the form of an
aerosol.
[0159] Care should be taken when using additives so that the live
recombinant bacterium is not killed, or have its ability to
effectively colonize lymphoid tissues such as the GALT, NALT and
BALT compromised by the use of additives. Stabilizers, such as
lactose or monosodium glutamate (MSG), may be added to stabilize
the vaccine formulation against a variety of conditions, such as
temperature variations or a freeze-drying process.
[0160] The dosages of a vaccine composition of the invention can
and will vary depending on the recombinant bacterium, the regulated
antigen, and the intended host, as will be appreciated by one of
skill in the art. Generally speaking, the dosage need only be
sufficient to elicit a protective immune response in a majority of
hosts. Routine experimentation may readily establish the required
dosage. Typical initial dosages of vaccine for oral administration
could be about 1.times.10.sup.7 to 1.times.10.sup.10 CFU depending
upon the age of the host to be immunized. Administering multiple
dosages may also be used as needed to provide the desired level of
protective immunity.
(b) Methods of Administration
[0161] In order to stimulate a preferred response of the GALT, NALT
or BALT cells, administration of the vaccine composition directly
into the gut, nasopharynx, or bronchus is preferred, such as by
oral administration, intranasal administration, gastric intubation
or in the form of aerosols, although other methods of administering
the recombinant bacterium, such as intravenous, intramuscular,
subcutaneous injection or intramammary, intrapenial, intrarectal,
vaginal administration, or other parenteral routes, are
possible.
[0162] In some embodiments, these compositions are formulated for
administration by injection (e.g., intraperitoneally,
intravenously, subcutaneously, intramuscularly, etc.). Accordingly,
these compositions are preferably combined with pharmaceutically
acceptable vehicles such as saline, Ringer's solution, dextrose
solution, and the like.
IV. Kits
[0163] The invention also encompasses kits comprising any one of
the compositions above in a suitable aliquot for vaccinating a host
in need thereof. In one embodiment, the kit further comprises
instructions for use. In other embodiments, the composition is
lyophilized such that addition of a hydrating agent (e.g., buffered
saline) reconstitutes the composition to generate a vaccine
composition ready to administer, preferably orally.
[0164] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples that
follow represent techniques discovered by the inventors to function
well in the practice of the invention. Those of skill in the art
should, however, in light of the present disclosure, appreciate
that many changes can be made in the specific embodiments that are
disclosed and still obtain a like or similar result without
departing from the spirit and scope of the invention, therefore all
matter set forth or shown in the accompanying drawings is to be
interpreted as illustrative and not in a limiting sense.
V. Methods of Use
[0165] A further aspect of the invention encompasses methods of
using a recombinant bacterium of the invention. For instance, in
one embodiment the invention provides a method for modulating a
host's immune system. The method comprises administering to the
host an effective amount of a composition comprising a recombinant
bacterium of the invention. One of skill in the art will appreciate
that an effective amount of a composition is an amount that will
generate the desired immune response (e.g., mucosal, humoral or
cellular). Methods of monitoring a host's immune response are
well-known to physicians and other skilled practitioners. For
instance, assays such as ELISA, and ELISPOT may be used.
Effectiveness may be determined by monitoring the amount of the
antigen of interest remaining in the host, or by measuring a
decrease in disease incidence caused by a given pathogen in a host.
For certain pathogens, cultures or swabs taken as biological
samples from a host may be used to monitor the existence or amount
of pathogen in the individual.
[0166] In another embodiment, the invention provides a method for
eliciting an immune response against an antigen in a host. The
method comprises administering to the host an effective amount of a
composition comprising a recombinant bacterium of the invention
[0167] In still another embodiment, a recombinant bacterium of the
invention may be used in a method for eliciting an immune response
against a pathogen in an individual in need thereof. The method
comprises administrating to the host an effective amount of a
composition comprising a recombinant bacterium as described herein.
In a further embodiment, a recombinant bacterium described herein
may be used in a method for ameliorating one or more symptoms of an
infectious disease in a host in need thereof. The method comprises
administering an effective amount of a composition comprising a
recombinant bacterium as described herein.
REFERENCES (TO PREVIOUS ABOVE TEXT)
[0168] 1. Doggett T A, Jagusztyn-Krynicka E K, & Curtiss R,
III. (1993) Immune responses to Streptococcus sobrinus surface
protein antigen A expressed by recombinant Salmonella typhimurium.
Infect Immun 61: 1859-1866. [0169] 2. Schoedel F, Kelly S M,
Peterson D L, Milich D R, & Curtiss R, III. (1994) Hybrid
hepatitis B virus core-pre-S proteins synthesized in avirulent
Salmonella typhimurium and Salmonella typhi for oral vaccination.
Infect Ummun 62: 1669-1676. [0170] 3. Srinivasan J, Tinge S, Wright
R, Herr J C, & Curtiss R, III. (1995) Oral immunization with
attenuated Salmonella expressing human sperm antigen induces
antibodies in serum and the reproductive tract. Biol Reprod 53:
462-471. [0171] 4. Curtiss R, Ill, Goldschmidt R M, Fletchall N B,
& Kelly S M (1988) Avirulent Salmonella typhimurium delta cya
delta crp oral vaccine strains expressing a streptococcal
colonization and virulence antigen. Vaccine 6: 155-160. [0172] 5.
Guzman L M, Belin D, Carson M J, & Beckwith J (1995) Tight
regulation, modulation, and high-level expression by vectors
containing the arabinose PBAD promoter. J Bacteriol 177: 4121-4130.
[0173] 6. Schleif R F (1996) in Escherichia coli and Salmonella,
cellular and molecular biology, eds. F. C. Neidhardt, R. Curtiss
III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S.
Reznikoff, M. Riley, Schaechter M, & Umbarger H E (ASM Press,
Washington, D.C.), pp. pp. 1300-1309. [0174] 7. Egan S M &
Schleif R F (1993) A regulatory cascade in the induction of rhaBAD.
J Mol Biol 234: 87-98. [0175] 8. Song S & Park C (1997)
Organization and regulation of the D-xylose operons in Escherichia
coli K-12: XylR acts as a transcriptional activator. J Bacteriol
179: 7025-7032. [0176] 9. Schodel F (1992) Recombinant avirulent
Salmonellae as oral vaccine carriers. Infection 20: 1-8. [0177] 10.
Curtiss R, Ill, Galan J E, Nakayama K, & Kelly S M (1990)
Stabilization of recombinant avirulent vaccine strains in vivo. Res
Microbiol 141: 797-805. [0178] 11. Paul W E (1999) Fundamental
immunology (Lippincott-Raven, Philadelphia). [0179] 12. Stites D P
& Stobo J D (1994) Basic & clinical immunology (Lange
Medical Publications, Los Altos, Calif.). [0180] 13. Ogra P L
(1994) Handbook of mucosal immunology (Academic Press, Inc., San
Diego). [0181] 14. Ogra P L (1999) Mucosal immunology (Academic
Press, San Diego).
EXAMPLES
[0182] The following examples illustrate various iterations of the
invention.
Example 1: Regulated Expression of Antigen Encoding Nucleic Acid
Sequences
[0183] Antigens, delivered by recombinant attenuated Salmonella
vaccine strains (RASVs), induce strong systemic and mucosal immune
responses that are dependent on several factors including route of
immunization [1, 2], expression level [3], cellular location [4],
presentation [5], strain background [6, 7] and the inherent
immunogenic properties of antigen. Generally, achieving maximal
immune responses to the foreign antigen is directly correlated with
the amount of the antigen produced [3, 8], thus it is important
that the immunizing bacterial strain produce adequate levels of
antigen. However, for RASV, this need must be weighed against the
fact that high level antigen production can be a drain on the
energy resources of the bacterium, leading to reduced growth rates
and a compromised ability to colonize and stimulate effector
lymphoid tissues [9]. In addition, some antigens are inherently
toxic to vaccine strains for other reasons, leading to a severe
inhibition of growth rate and host colonizing potential and, in
some cases, death of the RASV. Sometimes, overexpression of foreign
proteins can also result in mutations in the promoter or coding
sequence of the nucleic acid sequence encoding the antigen, leading
to unwanted changes in the level of antigen synthesis or character,
thus reducing or compromising the desired immune response. Several
approaches have been used to address this problem, including
adopting in vivo inducible promoters, including those from the pagC
[13], nirB [14], spy and dps [15] nucleic acid sequences. In
principle, the advantage of using inducible promoters is that only
low levels of antigen are produced during in vitro growth and the
initial stages of infection. These promoters then upregulate
antigen expression once the bacteria reach immunocompetent sites
within the host, thus inducing the desired antigen-specific immune
response. However, inducible promoters, as they are presently known
in the art, are often either too weak in vivo or too strong in
vitro, and may be limited by the mode of attenuation [14, 16].
Therefore, there is a need in the art for a system with a promoter
that is weakly active in vitro, is capable of strong expression in
vivo and whose function is not influenced by the mode of
attenuation.
[0184] In this example, the construction of such a system is
described utilizing the strong P.sub.trc promoter for antigen
expression and attenuated Salmonella enterica serovar Typhimurium
strains expressing different levels of LacI under the control of an
arabinose-regulated promoter. Two test antigens were used to
evaluate the system. The green fluorescent protein (GFP) was used
for in vitro evaluation of the system and the .alpha.-helical
fragment of the Streptococcus pneumoniae pspA nucleic acid sequence
[4, 17, 18] was used as the test antigen for immunogenicity
studies. Salmonella strains were constructed and evaluated for
level of LacI synthesis, antigen synthesis and the ability to
induce a protective immune response in mice.
Materials and Methods for Example 1
[0185] Bacterial Strains, Plasmids, Media and Growth
Conditions:
[0186] Bacterial strains and plasmids used are listed in above
Table 1 and Table 2, respectively. Bacteria were grown statically
overnight at 37.degree. C. in LB broth [19], 3XD broth, a buffered
Casamino acids medium that includes glycerol as the carbon source
[20] or nutrient broth (Difco) as indicated. The second day, the
cultures were diluted 1:100 into pre-warmed media with aeration at
37.degree. C. When required, antibiotics and supplements were added
at the following concentrations: chloramphenicol, 30 .mu.g/ml;
Diaminopimelic acid (DAP), 50 .mu.g/ml [21]; p-aminobenzoic acid
(pABA), 10 .mu.g/ml. LB agar without NaCl and containing 5% sucrose
was used for sacB nucleic acid sequence-based counter selection in
allelic exchange experiments [22]. S. pneumoniae WU2 was cultured
on brain heart infusion agar containing 5% sheep blood or in
Todd-Hewitt broth plus 0.5% yeast extract[17].
[0187] General DNA Procedures:
[0188] DNA manipulations were carried out as described by Sambrook
et al. [51]. Transformation of bacterial strains was routinely done
by electroporation [52] using Nucleic acid sequence Pulser Xcell
System (BioRad, Hercules, Calif.). Transformants containing
Asd.sup.+ plasmids were selected on LB agar plates without DAP.
Only clones containing the recombinant plasmids were able to grow
under these conditions. Suicide vector and P22-mediated
transduction was used to generate defined
deletion/deletion-insertion mutation [53, 54]. Transfer of
recombinant suicide plasmids to Salmonella was accomplished by
conjugation using E. coli .chi.7213 (Asd.sup.-) as the plasmid
donor [48]. Bacteriophage P22HT int-mediated general transduction
was performed by standard methods [55]. PCR amplification was
employed to obtain DNA fragments for cloning and for verification
of chromosomal deletion mutations. Nucleotide sequencing reactions
were performed by the DNA lab in Arizona State University.
[0189] Construction of Plasmid pYA3700:
[0190] Plasmid pYA3700 carried a tightly regulated araC P.sub.BAD
TT cassette. To construct this plasmid, two oligonucleotides,
TABLE-US-00003 (SEQ ID NO: 34) 5'-
CCTGGTACCTAGGCCTCTAGATAAATAAAAGCAGTTTACAACTCCTAGAA
TTGTGAATATATTATCACAATTCTAGGATAGAATAATAAAAGATCTCTGC AGGGC-3'
and its complement, corresponding to the T4 ipIII transcription
terminator [56] and additional enzyme site (underlined) were
annealed, cut with KpnI-PstI, and cloned into pGEM3Z cut with the
same enzymes to create plasmid pYA3698 (Table 2). The araC
P.sub.BAD cassette was amplified using plasmid pYA3624 [57] as
template with primer pair 1pBADaraCKpnI
(5'-AGAGGTACCCTCGAGGCTAGCCCAAAAAAACGGG-3') (SEQ ID NO:35) and
1pBADaraCXbaI (5'-TGGTCTAGAGTCAAGCCGTCAATTGTCTGATTCG-3') (SEQ ID
NO:36). The PCR fragment was cut with KpnI-XbaI and cloned into
plasmid pGEM3Z to generate plasmid pYA3699 and into pYA3698 to
generate the plasmid pYA3700.
[0191] Construction of Suicide Vector pYA3784:
[0192] The GTG-lacI nucleic acid sequences were amplified from the
.chi.289 genome using the primer pairs, lacI
EcoRI-3'(5'-GGAATTCTCACTGCCCGCTTTCCAGTCGGG-3') (SEQ ID NO:37) and
GTG lacI XhoI-5' (5'-CCGCTCGAGAGGGTGGTGAATGTGAAACCAGTAACGTT-3')
(SEQ ID NO:38). The resulting 1.1 kb PCR fragment was cloned into
pCR-Blunt II-TOPO to create pCR-Blunt II-TOPO-LacI(E-X). The relA
upstream homology region from the .chi.3761 genome was amplified
using the primer pairs RelA N-HindIIISacI-5'
(5'-CCCAAGCTTGAGCTCGAGGGCGTTCCGGCGCTGGTAGAA-3') (SEQ ID NO:39) and
RelA N-BglII-3' (5'-GAAGATCTAAGGGACCAGGCCTACCGAAG-3') (SEQ ID
NO:40). The fragment was cut with HindIII-BglII and ligated into
plasmid pYA3700 at the same restriction sites to generate plasmid
pGEM3Z-pBADaraCT4ipIIIrelA-N. Plasmid pYA3700 was cut with
XhoI-XbaI and ligated into pCR-Blunt II-TOPO-LacI(E-X) to generate
the plasmid pCR-Blunt II-TOPO-LacIpBADaraC. This plasmid was cut
with EcoRI, blunted with Mungbean nuclease and then cut with
HindIII. Plasmid pGEM3Z-pBADaraCT4ipIIIrelA-N was cut with XbaI,
blunted with Mungbean nuclease and then cut with HindIII. These two
fragments were ligated to form the plasmid pCR-Blunt
II-TOPO-LacI(GTG)pBADaraC-relAN. The relA downstream homology
region was amplified from .chi.3761 genome using the primer pairs
RelA C-EcoRI-5' (5'-CGGAATTCACCCCAGACAGTAATCATGTAGCGGCT-3') (SEQ ID
NO:41) and RelA C-KpnI-3' (5'-CGGGTACCCCAGATATTTTCCAGATCTTCAC-3')
(SEQ ID NO:42). The fragment was ligated with the pCR-Blunt
II-TOPO-LacI(GTG)pBADaraC-relAN, cut with XbaI and blunted with
Mungbean nuclease, to generate plasmid pYA3782. The relA::araC
P.sub.BAD lacI TT cassette was cut with KpnI-SacI and cloned into
pRE112 to generate the suicide plasmid pYA3784 harboring the
GTG-lacI. The ATG-lacI was amplified using primers pairs, lacI
EcoRI-3' (5'-GGAATTCTCACTGCCCGCTTTCCAGTCGGG-3') (SEQ ID NO:43) and
XhoI SD*-ATG lacI-5' (5'-CCGCTCGAGAGGATGGTGAATATGAAACCAGTAACGTT-3')
(SEQ ID NO:44) and cloned into pCR-Blunt-II-Topo vector. The codon
optimization of ATG-lacI was done by the PCR method. Briefly, 22
pairs of overlapping primers covering 15 non-optomized codons used
in the lacI nucleic acid sequence were PCR amplified. The
overlapping PCR products were used as template to be amplified
again to get codon optimized ATG-lacI. The 15 codons are 35th CGG
to CGT, 49th CCC to CCG, 101th CGA to CGT, 155th CCC to CCG, 168th
CGA to CGT, 213th ATA to ATC, 216th CGG to CGT, 239th CCC to CCG,
272th GGA to GGT, 320th CCC to CCG, 326th AGA to CGT, 332th CCC to
CCG, 339th CCC to CCG, 351th CGA to CGT and 355th CGA to CGT. The
codon optimized ATG-lacI was also cloned into the pCR-Blunt-II-Topo
plasmid. Then the similar strategies were used to generate suicide
plasmid pYA3789 with the ATG-lacI and suicide plasmid pYA4064 with
codon optimized lacI.
[0193] Construction of Expression Plasmid pYA4088:
[0194] Plasmid pYA3494 carries amino acids 3-257 of native pspA Rx1
fused to the first 23 amino acids of bla [23]. Nine codons that are
rare in Salmonella were converted to highly used codons without
changing the amino acid sequence to create plasmid pYA3635 using
PCR methods [58]. The 9 codons are 2nd CCC to CCG, 57th CTA to CTG,
77th CTA to CTG, 95th ATA to ATC, 113th CGA to CGT, 144th CTA to
CTG, 185th AGA to CGT, 186th CTA to CTG, 221st CTA to CTG. Two
additional codons, 23rd GCG to GCT and 124th GCT to GCG were also
changed to keep the GC content the same. Generally, the overlapping
primers covering the 9 non-optimized codons used in the pspA Rx1
nucleic acid sequence were PCR amplified. The overlapping PCR
products were used as template to be amplified again to get the
codon optimized pspA Rx1. The final PCR product was cloned into
pYA3493 to generate pYA3635. Using pYA3635 as the starting
material, the optimized pspA sequence was extended an additional 28
amino acids to include a recently identified B cell epitope (S.
Hollingshead, personal communication). The extended codon-optimized
pspA Rx-1 nucleic acid sequence was constructed in 3 steps. First,
the optimized pspA sequence was amplified using primer set PspA Rx1
forward (5'-TCTCCGGTAGCCAGTCAGTCTAAAGCTGAG-3') (SEQ ID NO:45) and
PspA RX1-a1
(5'-CTAATTCAGCTTTTTTAGCAGCAATAGTTTTCTCTAAACCTTCTTTAAAGTAGTCTTC
TACATTATTGTTTTCTTC-3') (SEQ ID NO:46). The resulting 820-bp PCR
fragment was used as template in a second PCR reaction using primer
set PspA Rx1 forward (5'-TCTCCGGTAGCCAGTCAGTCTAAAGCTGAG-3') (SEQ ID
NO:47) and PspA Rx1-a2
(5'-TGCTTTCTTAAGGTCAGCTTCAGTTTTTTCTAATTCAGCTTTTTTAGCAGCAATAGTT
TTCTC-3') (SEQ ID NO:48) PspA Rx1-EcoRI-s. The resulting 849-bp PCR
product was used as template for a third amplification with the
primer set PspA Rx1-EcoRI-s (5'-GGAATTCTCTCCGGTAGCCAGTCAGTCT-3')
(SEQ ID NO:49) and PspA Rx1-HindIII-a
(5'-TTCAAGCTTATTATGCTTTCTTAAGGTCAGCTTC-3') (SEQ ID NO:50). The
869-bp PCR product from that reaction was cloned into plasmid
pYA3493 [23] using EcoRI-HindIII restriction sites to generate
pYA4088. The sequence was verified by sequencing and enzyme
digestion.
[0195] Construction of Plasmid pYA4090:
[0196] Plasmid pYA3552 comprises the gfp3 nucleic acid sequence,
which is a kind gift from Dr. Ho-Young Kang. Plasmid pYA4090 was
constructed by PCR amplification of the 740-bp gfp3 nucleic acid
sequence using plasmid pYA3552 as template with the primer set
GFP-EcoRI-s (5'-GGGAATTCCGATGAGTAAAGGAGAAGAACTTTTC-3') (SEQ ID
NO:51) and GFP-HindIII-a
(5'-CGGTGCAAGCTTATTATTTGTATAGTTCATCCATG-3') (SEQ ID NO:52) and then
cloned into pYA3342 using EcoRI-HindIII.
[0197] Construction of Plasmid pYA3438:
[0198] The plasmid containing the 1.5 kb pabB nucleic acid homology
was cloned into the XbaI-BamHI site of pMEG375. The pabB nucleic
acid sequence had 106 bp deleted between the two internal EcoRV
sites.
[0199] Construction of plasmid pYA3599: The suicide plasmid pYA3599
was used to delete the araBAD operon. A 360 bp fragment of the 3'
end of araD was generated by PCR using primers araD-BamHI
(5'-CGGGATCCTGGTAGGGAACGAC-3'; add BamHI underlined) (SEQ ID NO:53)
and araD-NcoI (5'-GATGCCATGGTTTAAACTATATTCAGCAAATGCG-3'; add NcoI
underlined) (SEQ ID NO:54), and a 500 bp fragment of 5' end of the
araB nucleic acid sequence was nucleic acid generated by PCR using
primers araC-NcoI (5'-GATGCCATGGTCTGTTTCCTCGTCTTACTCCATCC-3'; add
NcoI underlined) (SEQ ID NO:55) and araC-SphI
(5'-ACATGCATGCGGACGATCGATAA-3'; add SphI underlined) (SEQ ID
NO:56). These two fragments were cloned into the BamHI and SphI
site of pMEG-375 to result in the suicide vector pYA3599.
[0200] Construction of .chi.9097:
[0201] The strain .chi.8060 is from Megan Health, Inc. and harbors
a pabA1516 mutation. The .chi.8442 strain was constructed by
conjugation of .chi.7213, harboring plasmid pYA3599, with
.chi.8060. The .chi.8914 strain was constructed by conjugation of
.chi.7213, harboring plasmid pMEG-443, with .chi.8060.
The.quadrature. .chi.8767 was constructed by conjugation of
.chi.7213 harboring plasmid pYA3599. The P22 lysate was made on the
single cross over by conjugation .chi.7213, harboring plasmid
pYA3599, with .quadrature. .chi.8767 according to Kang's method
[59]. The .DELTA.araBAD23 mutation was introduced into strain
.chi.8914 by P22 transduction from (.chi.8767:pYA3599) to generate
strain .chi.9097. The mutation was verified by PCR and formation of
a white colony phenotype on MacConkey agar supplemented with 1%
arabinose. Minimal agar with/without pABA was used to detect the
phenotype associated with the pabA pabB mutations. The presence of
the asdA mutation in Salmonella was confirmed by its dependence on
DAP for growth [21]. The presence of the 3.3 kb deletion-insertion
of relA was confirmed by PCR with primer set RelA N-HindIIISacI-5'
(5'-CCCAAGCTTGAGCTCGAGGGCGTTCCGGCGCTGGTAGAA-3') (SEQ ID NO:57) and
RelA C-KpnI-3' (5'-CGGGTACCCCAGATATTTTCCAGATCTTCAC-3') (SEQ ID
NO:58) and western-blot using anti-LacI antiserum as described
below. Lipopolysaccharide (LPS) profiles of Salmonella strains were
examined as described [60].
[0202] Construction of Vectors and Strains:
[0203] Similar strategies to those described above were used to
construct pYA3789 and pYA4064 to generate the ATG-lacI mutation
.DELTA.relA197::araC P.sub.BAD lacI TT and the codon optimized
ATG-lacI mutation .DELTA.relA198::araC P.sub.BAD lacI TT,
respectively. Plasmid pYA3342 is an Asd+ expression vector with
promoter P.sub.trc [23]. Plasmid pYA4090 is a pYA3342 derivative
that codes for gfp3 expression from the P.sub.trc promoter. Details
for the construction of plasmid pYA4090 are described herein.
Plasmid pYA3493 is a pYA3342 derivative that encodes the first 23
amino acids of .beta.-lactamase [23]. Plasmid pYA4088, derived from
pYA3493, carries a cloned fragment of the S. pneumoniae pspA
nucleic acid sequence, encoding aa 3-285, that has been
codon-optimized for expression in Salmonella, and fused to the
nucleic acid sequence encoding amino acids 1-23 of
.beta.-lactamase.
[0204] Construction and Phenotypic Characterization of S.
Typhimurium Vaccine Strains:
[0205] The .DELTA.relA196::araC P.sub.BAD lacI TT,
.DELTA.relA197::araC P.sub.BAD lacI TT and .DELTA.relA198::araC
P.sub.BAD lacI TT mutations were introduced into the S. Typhimurium
strain .chi.3761 by allelic exchange using .chi.7213 harboring the
suicide vectors pYA3784, pYA3789 and pYA4064 to yield .chi.8990,
.chi.9080 and .chi.9226, respectively, and into RASV strain
.chi.9097 to generate .chi.9095, .chi.9101 and .chi.9241. The
presence of the 3.3 kb deletion-insertion was confirmed by PCR and
western-blot as described below.
[0206] Western Blot Analysis:
[0207] Protein samples were prepared from equal numbers of cells,
separated on a 12% SDS-PAGE gel, and transferred to a
nitrocellulose membrane using Trans-Blot SD Semi-Dry Transfer Cell
(Bio Rad). LacI, PspA and GroEL were detected using rabbit
polyclonal anti-LacI, anti-PspA and anti-GroEL primary antiserum,
respectively, at 1:10,000 dilutions, and a secondary anti-rabbit
alkaline phosphatase-conjugated antibody (Sigma, St Louis, Mo.) at
1:10,000 dilution. Bands were visualized using NBT/BCIP (Sigma,).
The bands were scanned and densitometry was measured using Quantity
One software (Bio-Rad).
[0208] Growth Curves:
[0209] Standing overnight 37.degree. C. cultures of RASV strains
.chi.9095, .chi.9097, .chi.9101 and .chi.9241, with and without
plasmid pYA4088, were grown in LB or LB plus DAP, respectively,
containing 0.2% arabinose. The culture was adjusted to the same OD
with pre-warmed medium, and then diluted 1:100 into pre-warmed LB
or LB-DAP broth with 0.2% arabinose. The optical density at 600 nm
(OD.sub.600) was measured every 40 min. At the final time point,
samples of each strain were taken and used for western blot
analysis with anti-LacI and/or anti-PspA antisera.
[0210] Protein Stability Analysis:
[0211] S. Typhimurium strains .chi.8990, .chi.9080 and x 9226 were
grown in 3XD medium containing 0.2% arabinose and E. coli strain
XL1-Blue was grown in LB without arabinose. Standing overnights of
each strain were grown at 37.degree. C., diluted 1:100 into fresh
media and grown with aeration to an OD.sub.600 of 0.6. Cells were
washed 2 times with fresh medium. Chloramphenicol was added to 50
.mu.g/ml. Samples taken before adding chloramphenicol (pre 0), just
after adding chloramphenicol (0), and at 1, 2, 4, 6, 8, 24 h were
analyzed by western blot. The samples were normalized by cell
number before loading onto the gel.
[0212] Flow Cytometry Analysis:
[0213] Standing overnight cultures of .chi.9095(pYA4090),
.chi.9097(pYA4090), .chi.9101(pYA4090) and .chi.9241(pYA4090) were
grown at 37.degree. C. in Nutrient Broth without arabinose. Then,
3.times.10.sup.5 CFU of each strain were added to 3 ml of fresh
medium containing 0%, 2%, 0.2%, 0.02% or 0.002% arabinose and grown
to an OD.sub.600 of 0.4. The cultures were diluted 1:10 in PBS and
subjected to flow cytometry analysis using Cytomics FC500 (Beckman
Coulter, Inc., Fullerton, Calif., USA). The data were analized by
CXP analysis software (Beckman Coulter, Inc.)
[0214] Kinetics of LacI Loss and Antigen Synthesis in Pre-Induced
Cultures Grown without Arabinose:
[0215] Overnight cultures of strains .chi.9095, .chi.9097,
.chi.9101 and .chi.9241 carrying either plasmid pYA4088 or plasmid
pYA4090 were grown in Nutrient broth with or without 0.2%
arabinose. Each culture was adjusted to OD.sub.600=0.6 and diluted
1:100 into the same pre-warmed medium at 37.degree. C. When
cultures reached an OD.sub.600 of 0.6, the cultures were washed
once with nutrient broth without arabinose and diluted 1:100 (for
plasmid pYA4090) or 1:10 (for plasmid pYA4088) into pre-warmed
nutrient broth without arabinose and grown to an OD.sub.600=0.6.
The cultures were diluted into fresh media and the process was
repeated twice (for pYA4090 cultures) or three times more (for
pYA4088 cultures). Samples were taken at the end of each growth
cycle. Samples of strains .chi.9095(pYA4088), .chi.9097(pYA4088),
.chi.9101(pYA4088) and .chi.9241(pYA4088) were normalized according
to cell number and analyzed by western blot. Bands were scanned and
densitometry was measured using Quantity One software (Bio-Rad,
Hercules, Calif.). Samples of strains .chi.9095(pYA4090),
.chi.9097(pYA4090), .chi.9101(pYA4090) and .chi.9241(pYA4090) were
analyzed by flow cytometry.
[0216] Tests of Immunogenicity and Protection in Mice:
[0217] Strains were grown in LB medium supplemented with 0.2%
arabinose to an OD.sub.600 of 0.8, sedimented by room temperature
centrifugation at 6,000.times.g for 15 minutes and resuspended in
phosphate-buffered saline containing gelatin (BSG) [24]. Groups of
female BALB/c mice were orally immunized with 10.sup.9 CFU of the
RASV. Food and water was removed 4 h before inoculation and
restored 30 min after inoculation. The inoculum was diluted for
titer determination on LB agar plates. Mice were bled at 0, 2, 4,
6, and 8 weeks. Anti-LPS and anti-PspA Rx1 serum IgG was evaluated
by ELISA. Mice were challenged by intraperitoneal injection with
250 LD.sub.50 of virulent S. pneumoniae WU2 eight weeks after
immunization. The mice were observed daily for 21 days after
challenge. All animal protocols were approved by ASU IACUC and
complied with rules and regulations by American Association for
Accreditation of Laboratory Animal Care.
[0218] ELISA:
[0219] rPspA Rx1 protein was purified as described by Kang et al.
[23]. S. Typhimurium LPS was obtained from Sigma. The procedure for
ELISA has been described [23]. Briefly, polystyrene 96-well
flat-bottom microtiter plates (Nunc, Roskilde, Denmark) were coated
with 100 ng/well of either S. Typhimurium LPS or rPspA Rx1 in 100
ml sodium carbonate-bicarbonate coating buffer (pH 9.6). The sera
were serially diluted in two-fold steps for detection of IgG. A 100
ml of diluted sample was added to triplicate wells. Plates were
treated with biotinylated goat anti-mouse IgG (Southern
Biotechnology Inc., Birmingham) and then alkaline
phosphatase-labeled streptavidin (Southern Biotechnology Inc.,
Birmingham). After adding p-nitrophenylphosphate substrate solution
in diethanolamine buffer (pH 9.8) (Sigma, St. Louis, Mo.),
absorbance was read at 405 nm.
[0220] Statistics:
[0221] Statistical analyses were performed by using the SPSS
software package (SPSS, Chicago, Ill.). p values of .ltoreq.0.05
were considered significant. Antibody titers were expressed as
means.+-.standard error. The means were evaluated with One-way
Anova and the LSD tests were used for multiple comparisons among
groups.
Rationale for the Regulated Delayed Antigen Synthesis System
[0222] The P.sub.trc promoter is commonly used for constitutive
expression of nucleic acid sequences encoding antigens [25, 26].
P.sub.trc is a strong promoter in vivo [27], constitutive under
most environmental conditions, and is more transcriptionally active
both anaerobically and aerobically than the nirB promoter [14].
Although the P.sub.trc promoter has been widely used in bacterial
expression vectors and in mammalian cell expression systems
[28-30], it has been reported that constitutive antigen expression
from the similar P.sub.tac promoter can affect the colonization
capability of RASV [16]. Thus regulating antigen expression from
P.sub.trc would be beneficial. The P.sub.trc promoter can be
repressed by LacI. In Escherichia coli, the LacI repressor is
typically produced at approximately 8 copies per cell [31, 32] and
regulates expression of the lactose metabolic nucleic acid
sequences [33] by binding to the lacO operator sequence, blocking
RNA polymerase from binding to the lac promoter. Generally,
induction of expression from LacI-repressed promoters is
accomplished by the addition of chemical agents, either lactose or
IPTG which bind to LacI causing an allosteric change in the protein
that leads to its release from lacO. However, this is not a
practical method of induction for RASVs. Instead, the production of
LacI was regulated by placing it under the control of the regulated
arabinose-inducible promoter P.sub.BAD (FIG. 19A). Transcription
from P.sub.BAD can be regulated by varying the concentration of
arabinose [34, 35]. When the RASV is grown in culture and arabinose
is added to the growth medium, LacI is produced which represses
transcription from P.sub.trc. Once in the host, the transcription
from P.sub.BAD would cease because free arabinose is very rarely
encountered in animal tissues [36], and subsequently, no additional
LacI would be produced. The concentration of LacI should then
decrease by dilution as the RASV cells divide and antigen
production would increase to levels high enough to induce the
desired immune response.
Construction of Strains with High Expression of LacI
[0223] Based on this concept, a tightly-regulated araC P.sub.BAD
lacI TT cassette was integrated into the chromosome in the relA
nucleic acid sequence (FIG. 19B), nucleic acid sequencing defining
the re/A196 allele in strain, .chi.8990. relA was chosen as the
integration site because the relA mutation is not attenuating nor
does it have an effect on colonization [37, 38]. The native lacI
nucleic acid sequence has a GTG start codon and an AGGG
Shine-Dalgarno sequence, leading to expression of only 5-10
molecules each generation [31] and the functional form of LacI
repressor is a tetramer [32]. Plasmids with a ColE1 (pBR) replicon
are present at 20-30 copies per cell. Thus, it was estimated that
at least 80-120 copies of LacI are needed to repress the operator
sequences in the expression plasmid to achieve adequate repression.
Therefore, in addition to strain .chi.8990, which encodes the
native lacI sequence (GTG-lacI), the start codon of lacI was
modified from GTG to ATG, and the SD sequence was modified from
AGGG to the canonical ribosome binding site sequence, AGGA,
resulting in the re/A197 allele in strain .chi.9080. This
modification increased LacI levels about 2 fold (FIG. 19C). To
enhance expression further, the codons of lacI were optimized
according to the codon usage for highly expressed nucleic acid
sequences in Salmonella, yielding the re/A198 allele in strain
.chi.9226. This modification increased LacI levels approximately
4-8 fold over re/A196 (FIG. 19C). The expression levels of LacI for
GTG-lacI, ATG-lacI, and codon optimized-lacI were proportional to
the arabinose concentration (FIG. 19C). It is anticipated that
different antigens may require different levels of repression, so
these constructs provide the flexibility needed to produce
different amounts of repressor to meet varied requirements.
High Expression of LacI does not Affect Growth.
[0224] The Salmonella chromosome does not encode the lac operon.
Consequently, the effect of LacI production or overproduction on
growth was investigated, because this might translate to a
reduction in immunogenicity. The growth of all three of the above
strains was evaluated in LB broth with or without 0.2% arabinose,
and compared to a strain that does not produce LacI. All four
strains had similar growth rates, including strain .chi.9241
(relA198), which produces the most LacI (FIG. 20). Although one of
the LacI-producing strains, .chi.9101 (relA197), grew better than
the other strains, there were no large differences in doubling
times. Growth at lower concentrations of arabinose gave similar
results, but 2% arabinose led to reduced growth of all the
LacI-producing strains.
Codon Optimized lacI Provides the Highest Repression
[0225] To evaluate the relationship between antigen synthesis and
arabinose concentration, plasmid pYA4090, which encodes the gfp3
nucleic acid sequence under transcriptional control of P.sub.trc,
was introduced into S. Typhimurium strains .chi.9097, .chi.9095,
.chi.9101 and .chi.9241. Transformants were grown in LB at varying
arabinose concentrations and subjected to FACS analysis. The
P.sub.BAD promoter is subject to autocatalytic regulation, and
therefore we were able to evaluate the fraction of cells expressing
GFP as a measure of induction [39]. As expected, there was no
effect of arabinose on gfp3 nucleic acid expression in strain
.chi.9097(pYA4090), which does not encode lacI (FIG. 21A). When
strains .chi.9095(pYA4090), .chi.9101(pYA4090) and
.chi.9241(pYA4090) were grown without arabinose, nearly all the
cells expressed GFP. No decrease in the number of GFP-positive
cells was observed when 0.002% arabinose was included in the growth
medium but repression was evident at 0.02% arabinose for all
strains. As the arabinose concentration was increased, the number
of GFP positive cells dropped substantially for all strains with
arabinose-regulated expression of lacI. The greatest level of
repression was seen in strain .chi.9241 (relA198), with only 7.6%
GFP positive cells in the presence of 2% arabinose. These results
are consistent with the expectation that antigen synthesis should
be inversely proportional to arabinose concentration and inversely
proportional to LacI synthesis (FIG. 21A). Although the lacI
constructs in .chi.9095 (relA196) and .chi.9101 (relA19 produced
different amounts of LacI (FIG. 19), there was no difference in gfp
nucleic acid expression between the two strains.
LacI is a Stable Protein
[0226] Because LacI is not normally synthesized in S. Typhimurium
and in E. coli it is only expressed at low levels and because of
the central role LacI plays in the system, the stability of LacI
was investigated in these strains, as that could have an impact on
the timing of antigen synthesis in vivo. Chloramphenicol was added
to mid-exponential phase cultures of Salmonella strains .chi.8990,
.chi.9080 and .chi.9226 and E. coli strain XL1-Blue. The stability
of LacI was similar for all strains (FIG. 22). The amount of LacI
declined by 50% over the first 2-4 hours in all strains, after
which the amount declined very slowly, reaching approximately 20%
of the starting levels by 24 hours for the S. Typhimurium strains
and 40% for the E. coli strain. These results indicate that LacI
stability is essentially the same in S. Typhimurium and E. coli,
and that the protein is relatively stable. Thus it is expected that
the concentration of LacI in these strains, in the absence of
arabinose, will decrease primarily due to dilution as a result of
cell division.
Time Course for the Induction of GFP Synthesis.
[0227] To evaluate the kinetics of the induction of antigen
synthesis after growth in arabinose, the GFP-producing strains were
grown in nutrient broth with 0.2% arabinose. Nutrient broth was
chosen as the growth medium because it is derived from animal
tissue and should mimic the low arabinose conditions found in host
tissues better than LB broth. The arabinose-grown cells were
diluted 1:100 into fresh nutrient broth without arabinose and grown
to an OD.sub.600 of 0.6. The cells were diluted and grown twice
more in the same way. Each round of growth represented
approximately 4.3 cell divisions, for a total of 13.8 nucleic acid
sequencerations of growth in the absence of arabinose. Samples were
taken at the end of each growth cycle and analyzed by FACS (FIG.
21B). The results indicated that although some strains were not
fully repressed by growth in arabinose, the kinetics of induction
was similar in all strains leading to nearly full induction for
synthesis of GFP by 9.2 nucleic acid sequencerations of growth.
Time Course for the Induction of PspA Antigen Synthesis
[0228] As shown above, the system worked as expected using gfp3 as
a model. The system was next evaluated in the context of a vaccine
with a clinically relevant antigen, the S. pneumoniae PspA Rx1
protein that has been shown to be a potent and protective immunogen
[23]. Plasmid pYA4088 was introduced into the strains and their
growth rates in LB broth were compared. All of the LacI-producing
strains had a growth advantage over strain .chi.9097 (pYA4088) in
the presence of 0.2% arabinose (FIG. 20B), indicating that
repressing the expression of the nucleic acid sequence encoding
antigen results in faster growth. The LacI-producing strains also
grew faster than .chi.9097(pYA4088) in the absence of added
arabinose. This may be due to trace amounts of arabinose present in
the yeast extract used to prepare the LB broth medium,
approximately 0.0034% (K. Ameiss, personal communication). Although
the amount of LacI produced under these conditions was undetectable
by western blot (FIG. 19C), there may have been sufficient LacI
present to account for the observed growth advantage.
[0229] Next LacI and PspA synthesis were directly evaluated in
cells grown in 0.2% arabinose. This concentration was chosen
because there was only a small difference in repression levels
between 2% and 0.2% arabinose, (FIG. 21A) and the addition of 2%
arabinose resulted in a growth rate reduction. The amount of PspA
synthesis was inversely correlated with LacI synthesis, as expected
(FIG. 21C). PspA synthesis levels in strain .chi.9241(pYA4088),
which produced the most LacI, were approximately 8-fold less than
the .chi.9097(pYA4088) control. The kinetics of induction was
evaluated as described above for the GFP-producing strains and it
was found that all of the strains produced the same amount of PspA
as .chi.9097(pYA4088) after 9.2 nucleic acid sequencerations of
growth, indicating full derepression of P.sub.trc (FIG. 21C). For
most strains, the maximum PspA synthesis was achieved by 6.9
nucleic acid generations.
Regulated Delayed Expression Provides Better Protection than
Constitutive Expression
[0230] Strains .chi.9097(pYA4088), .chi.9095(pYA4088),
.chi.9101(pYA4088) and .chi.9241(pYA4088) were then evaluated for
immunogenicity in mice in two separate experiments. The results of
both experiments were similar, so the results were pooled. After a
single dose, all immunized mice developed high titers against S.
Typhimurium LPS (FIG. 23A). Compared with vector controls, the
strains synthesizing PspA elicited lower LPS titers, although the
synthesis of LacI abrogated this effect somewhat. While all the
RASV strains carrying pYA4088 induced a strong anti-PspA serum IgG
response (FIG. 23B), those strains, .chi.9095, .chi.9101 and
.chi.9241 that produced LacI induced significantly higher anti-PspA
titers than strain .chi.9097(pYA4088) (p<0.05). Strain
.chi.9241(pYA4088) vaccinates produced higher anti-PspA antibodies
than the other strains at 6 and 8 weeks (p<0.05). Overall, the
serum antibody response was roughly proportional to the amount of
LacI produced by each strain. No anti-PspA antibody response was
detected in mice vaccinated with the vector only controls.
[0231] When vaccinated mice were challenged with virulent S.
pneumoniae WU2, all groups that received PspA-producing strains
were protected (p<0.01; FIG. 24). Among the protected groups,
mice vaccinated with strain .chi.9101(pYA4088) showed significantly
higher protection than mice vaccinated with the other strains
(p<0.05). The remaining vaccinated groups were not significantly
different from each other (p>0.05). Interestingly,
.chi.9241(pYA4088), the strain that induced the highest anti-PspA
antibody titer (FIG. 23B), provided the poorest protection. These
results illustrate the need to optimize the amount of LacI and
antigen to attain an optimal immune response and indicate that
protection may not be closely correlated with induced antibody
titer levels.
Discussion for Example 1
[0232] A regulated delayed expression system has been developed to
minimize the negative effects of antigen expression on the host
strain and to enhance immunity. An araC P.sub.BAD lacI TT cassette
was engineered to synthesize different levels of LacI when grown in
the presence of arabinose (FIG. 19C). The amount of LacI produced
by the strains was proportional to the amount of arabinose present
in the medium, up to 2%, the maximum concentration tested (FIG.
19C). These results differ from what has been observed in E. coli
where protein synthesis from P.sub.BAD reached a maximum at 0.2%
arabinose [34]. There are several possible reasons for this
difference. First, the source of the araC P.sub.BAD
promoter/activator cassette was E. coli K-12, while in the previous
studies, the promoter was derived from E. coli B/r. Tighter
regulation has been observed with a K-12 cassette than with a B/r
cassette. Additionally, the previous studies were performed using
plasmid copies of P.sub.BAD, while herein the P.sub.BAD was
chromosomally integrated. Moreover, differences in regulation have
been observed for a number of promoters when they are present in
multiple copies (Kenneth Roland, personal communication). Finally,
differences in the arabinose-transport system between E. coli and
Salmonella may have also played a role. Salmonella only has one
L-arabinose transport system encoded by araE [40, 41], which has a
low affinity for arabinose, while E. coli has both araE and the
high affinity transport system encoded by araFGH [40, 42].
Therefore, in Salmonella, higher concentrations of arabinose are
likely to be required for full P.sub.BAD promoter induction than in
E. coli[40].
[0233] Although 2% arabinose can induce the maximum LacI synthesis,
repression of antigen synthesis was not complete (FIG. 21). One
reason for this problem is undoubtedly the fact that the P.sub.trc
promoter is present on a multicopy plasmid, while LacI is specified
by a single nucleic acid sequence on the chromosome. Another reason
may be that the binding affinity of the lactose operator sequence
in P.sub.trc is 10-fold less than the ideal one [43]. An additional
consideration is that in the native E. coli lac operon, there are 3
adjacent operator sequences, facilitating cooperative binding
interactions between three LacI tetramers [44], while there is only
one operator in our plasmid [45-47]. Consistent with this
hypothesis is the fact that only in strain .chi.9241, which
produced 3-4 times the amount of LacI as the other strains, was
antigen expression nearly shut off completely. Thus it is likely
possible to improve the efficiency of antigen repression by
modifying lacO for tighter repressor binding. In addition, one can
also modify the system by adjusting the amount of arabinose in the
growth medium, thereby varying the amount of LacI in the cell.
[0234] In this example, three strains were developed with the idea
that different antigens may require more or less LacI to achieve an
appropriate balance between the health of the RASV and the optimal
antigen expression required for induction of protective immune
responses. Antigen expression was reduced in vitro, which led to a
faster growth rate by the RASV (FIG. 20). While all the RASV
strains described in this example grew faster than the control
strain that constitutively expressed PspA, the results from each
strain were different with respect to the serum immune response and
protective immunity (FIG. 23, FIG. 24). It was anticipated that
strain .chi.9241 with the relA198 allele would elicit the highest
antibody titers and provide the best protection. This strain did,
in fact, yield the highest anti-PspA serum IgG titers (FIG. 23),
but it did the poorest job of providing protection against S.
pneumoniae challenge (FIG. 24). This may be a reflection of
differences in the amount of antigen produced by each strain and
the timing of the induction of antigen synthesis or that other
factors such as cellular immunity might be more important than
antibodies for conferring protective immunity.
[0235] In conclusion, a regulated delayed antigen expression system
has been developed. This system reduces the negative effects of
antigen expression during in vitro growth thereby improving the
overall health of the vaccine strain, while allowing for maximum
antigen expression in host tissues. This technology should be
particularly useful for inducing immune responses to antigens that
are toxic to the vaccine strain synthesizing them.
REFERENCES FOR EXAMPLE 1
[0236] 1. Fooks, A. R., Development of oral vaccines for human use.
Curr Opin Mol Ther, 2000. 2(1): p. 80-6. [0237] 2. Shalaby, W. S.,
Development of oral vaccines to stimulate mucosal and systemic
immunity: barriers and novel strategies. Clin Immunol Immunopathol,
1995. 74(2): p. 127-34. [0238] 3. Anderson, R., G. Dougan, and M.
Roberts, Delivery of the Pertactin/P.69 polypeptide of Bordetella
pertussis using an attenuated Salmonella typhimurium vaccine
strain: expression levels and immune response. Vaccine, 1996.
14(14): p. 1384-90. [0239] 4. Kang, H. Y. and Curtiss, R., III,
Immune responses dependent on antigen location in recombinant
attenuated Salmonella typhimurium vaccines following oral
immunization. FEMS Immunol Med Microbiol, 2003. 37(2-3): p. 99-104.
[0240] 5. Neutra, M. R., E. Pringault, and J. P. Kraehenbuhl,
Antigen sampling across epithelial barriers and induction of
mucosal immune responses. Annu Rev Immunol, 1996. 14: p. 275-300.
[0241] 6. Dusek, D. M., A. Progulske-Fox, and T. A. Brown, Systemic
and mucosal immune responses in mice orally immunized with
avirulent Salmonella typhimurium expressing a cloned Porphyromonas
gingivalis hemagglutinin. Infect Immun, 1994. 62(5): p. 1652-7.
[0242] 7. Lee, J. S., et al, Surface-displayed viral antigens on
Salmonella carrier vaccine. Nat Biotechnol, 2000. 18(6): p. 645-8.
[0243] 8. Zinkernagel, R. M., et al., Antigen localisation
regulates immune responses in a dose- and time-dependent fashion: a
geographical view of immune reactivity. Immunol Rev, 1997. 156: p.
199-209. [0244] 9. Galen, J. E. and M. M. Levine, Can a `flawless`
live vector vaccine strain be engineered? Trends Microbiol, 2001.
9(8): p. 372-6. [0245] 10. Isoda, R., et al., Expression of a
Porphyromonas gingivalis hemagglutinin on the surface of a
Salmonella vaccine vector. Vaccine, 2007. 25(1): p. 117-26. [0246]
11. Zahn, K., Overexpression of an mRNA dependent on rare codons
inhibits protein synthesis and cell growth. J Bacteriol, 1996.
178(10): p. 2926-33. [0247] 12. Gentschev, I., G. Dietrich, and W.
Goebel, The E. coli alpha-hemolysin secretion system and its use in
vaccine development. Trends Microbiol, 2002. 10(1): p. 39-45.
[0248] 13. Hohmann, E. L., et al., Macrophage-inducible expression
of a model antigen in Salmonella typhimurium enhances
immunogenicity. Proc Natl Acad Sci USA, 1995. 92(7): p. 2904-8.
[0249] 14. Chatfield, S. N., et al., Use of the nirB promoter to
direct the stable expression of heterologous antigens in Salmonella
oral vaccine strains: development of a single-dose oral tetanus
vaccine. Biotechnology (N Y), 1992. 10(8): p. 888-92. [0250] 15.
Marshall, D. G., et al., Use of the stationary phase inducible
promoters, spv and dps, to drive heterologous antigen expression in
Salmonella vaccine strains. Vaccine, 2000. 18(14): p. 1298-306.
[0251] 16. Bumann, D., Regulated antigen expression in live
recombinant Salmonella enterica serovar Typhimurium strongly
affects colonization capabilities and specific CD4(+)-T-cell
responses. Infect Immun, 2001. 69(12): p. 7493-500. [0252] 17.
Briles, D. E., et al., PspA, a protection-eliciting pneumococcal
protein: immunogenicity of isolated native PspA in mice. Vaccine,
1996. 14(9): p. 858-67. [0253] 18. Nayak, A. R., et al., A live
recombinant avirulent oral Salmonella vaccine expressing
pneumococcal surface protein A induces protective responses against
Streptococcus pneumoniae. Infect Immun, 1998. 66(8): p. 3744-51.
[0254] 19. Bertani, G., Studies on lysonucleic acid sequencesis. I.
The mode of phage liberation by lysogenic Escherichia coli. J
Bacteriol, 1951. 62(3): p. 293-300. [0255] 20. Fraser, D. and E. A.
Jerrel, The amino acid composition of T3 bacteriophage. J Biol
Chem, 1953. 205(1): p. 291-5. [0256] 21. Nakayama, K., M. Kelly,
and Curtiss, R., Ill., Construction of an Asd+ expression-cloning
vector: stable maintenance and high level expression of cloned
nucleic acid sequences in a Salmonella vaccine strain.
BioTechnology 1988. 6: p. 693-697. [0257] 22. Gay, P., et al.,
Positive selection procedure for entrapment of insertion sequence
elements in gram-negative bacteria. J Bacteriol, 1985. 164(2): p.
918-21. [0258] 23. Kang, H. Y., J. Srinivasan, and Curtiss, R.,
Ill, Immune responses to recombinant pneumococcal PspA antigen
delivered by live attenuated Salmonella enterica serovar
Typhimurium vaccine. Infect Immun, 2002. 70(4): p. 1739-49. [0259]
24. Curtiss, R., Ill., Chromosomal Aberrations Associated with
Mutations to Bacteriophage Resistance in Escherichia Coll. J
Bacteriol, 1965. 89: p. 28-40. [0260] 25. Nakayama, K., M. Kelly,
and Curtiss, R. Ill., Construction of an Asd+ expression-cloning
vector: stable maintenance and high level expression of cloned
nucleic acid sequences in a Salmonella vaccine strain.
BioTechnology, 1988. 6: p. 693-697. [0261] 26. Schodel, F., et al.,
Hybrid hepatitis B virus core-pre-S proteins synthesized in
avirulent Salmonella typhimurium and Salmonella typhi for oral
vaccination. Infect Immun, 1994. 62(5): p. 1669-76. [0262] 27.
Brosius, J., M. Erfle, and J. Storella, Spacing of the -10 and -35
regions in the tac promoter. Effect on its in vivo activity. J Biol
Chem, 1985. 260(6): p. 3539-41. [0263] 28. Amann, E., B. Ochs, and
K. J. Abel, Tightly regulated tac promoter vectors useful for the
expression of unfused and fused proteins in Escherichia coli.
Nucleic acid sequence, 1988. 69(2): p. 301-15. [0264] 29. Hu, M. C.
and N. Davidson, The inducible lac operator-repressor system is
functional in mammalian cells. Cell, 1987. 48(4): p. 555-66. [0265]
30. Hu, M. C. and N. Davidson, The inducible lac operator-repressor
system is functional for control of expression of injected DNA in
Xenopus oocytes. Nucleic acid sequence, 1988. 62(2): p. 301-13.
[0266] 31. Muller-Hill, B., L. Crapo, and W. Gilbert, Mutants that
mke more lac repressor. Proc Natl Acad Sci USA, 1968. 59(4): p.
1259-64. [0267] 32. Muller-Hill, B., Lac repressor and lac
operator. Prog Biophys Mol Biol, 1975. 30(2-3): p. 227-52. [0268]
33. Lewis, M., The lac repressor. C R Biol, 2005. 328(6): p.
521-48. [0269] 34. Guzman, L. M., et al., Tight regulation,
modulation, and high-level expression by vectors containing the
arabinose P.sub.BAD promoter. J Bacteriol, 1995. 177(14): p.
4121-30. [0270] 35. Zhang, X., T. Reeder, and R. Schleif,
Transcription activation parameters at ara pBAD. J Mol Biol, 1996.
258(1): p. 14-24. [0271] 36. Katzman, R. L., E. Lisowska, and R. W.
Jeanloz, Invertebrate connective tissue. Isolation of D-arabinose
from sponge acidic polysaccharide. Biochem J, 1970. 119(1): p.
17-9. [0272] 37. Pizarro-Cerda, J. and K. Tedin, The bacterial
signal molecule, ppGpp, regulates Salmonella virulence nucleic acid
sequence expression. Mol Microbiol, 2004. 52(6): p. 1827-44. [0273]
38. Huang, Y., et al., Genome-wide screen of Salmonella nucleic
acid sequences expressed during infection in pigs, using in vivo
expression technology. Appl Environ Microbiol, 2007. 73(23): p.
7522-30. [0274] 39. Siegele, D. A. and J. C. Hu, Nucleic acid
sequence expression from plasmids containing the araBAD promoter at
subsaturating inducer concentrations represents mixed populations.
Proc Natl Acad Sci USA, 1997. 94(15): p. 8168-72. [0275] 40. Lee,
J. H., et al., Regulation of L-arabinose transport in Salmonella
typhimurium LT2. Mol Gen Nucleic acid sequencet, 1982. 185(1): p.
136-41. [0276] 41. McClelland, M., et al., Complete genome sequence
of Salmonella enterica serovar Typhimurium LT2. Nature, 2001.
413(6858): p. 852-6. [0277] 42. Kolodrubetz, D. and R. Schleif,
Regulation of the L-arabinose transport operons in Escherichia
coli. J Mol Biol, 1981. 151(2): p. 215-27. [0278] 43. Sadler, J.
R., H. Sasmor, and J. L. Betz, A perfectly symmetric lac operator
binds the lac repressor very tightly. Proc Natl Acad Sci USA, 1983.
80(22): p. 6785-9. [0279] 44. Gilbert, W., The lac repressor and
the lac operator. Ciba Found Symp, 1972. 7: p. 245-59. [0280] 45.
Muller, J., S. Oehler, and B. Muller-Hill, Repression of lac
promoter as a function of distance, phase and quality of an
auxiliary lac operator. J Mol Biol, 1996. 257(1): p. 21-9. [0281]
46. Mossing, M. C. and M. T. Record, Jr., Upstream operators
enhance repression of the lac promoter. Science, 1986. 233(4766):
p. 889-92. [0282] 47. Oehler, S., et al., The three operators of
the lac operon cooperate in repression. EMBO J, 1990. 9(4): p.
973-9. [0283] 48. Roland, K., Curtiss, R. Ill., and D. Sizemore,
Construction and evaluation of a delta cya delta crp Salmonella
typhimurium strain expressing avian pathogenic Escherichia coli 078
LPS as a vaccine to prevent airsacculitis in chickens. Avian Dis,
1999. 43(3): p. 429-41. [0284] 49. Curtiss, R., Ill., Colonization
Control of Human Bacterial Enteropathogens in Poultry, J. Bailey,
Cox N A, Stern N J. Meinersmann R J, Editor. 1991, Academic Press,
New York p. 169-198. [0285] 50. Curtiss, R., Ill. and S. A. Tinge,
Regulated antigen delivery system (RADS), in U.S. Pat. No.
6,780,405. 2004: US. [0286] 51. Sambrook, J. and D. W. Russell,
Molecular cloning: a laboratory manual. 3rd ed. 2001, Cold Spring
Harbor, N.Y.: Cold Spring Harbor Laboratory Press. [0287] 52.
O'Callaghan, D. and A. Charbit, High efficiency transformation of
Salmonella typhimurium and Salmonella typhi by electroporation. Mol
Gen Nucleic acid sequencet, 1990. 223(1): p. 156-8. [0288] 53.
Schmieger, H. and H. Backhaus, Altered cotransduction frequencies
exhibited by HT-mutants of Salmonella-phage P22. Mol Gen Nucleic
acid sequencet, 1976. 143(3): p. 307-9. [0289] 54. Edwards, R. A.,
L. H. Keller, and D. M. Schifferli, Improved allelic exchange
vectors and their use to analyze 987P fimbria nucleic acid sequence
expression. Nucleic acid sequence, 1998. 207(2): p. 149-57. [0290]
55. Sternberg, N. L. and R. Maurer, Bacteriophage-mediated nucleic
acid sequenceralized transduction in Escherichia coli and
Salmonella typhimurium. Methods Enzymol, 1991. 204: p. 18-43.
[0291] 56. Miller, E. S., et al., Bacteriophage T4 genome.
Microbiol Mol Biol Rev, 2003. 67(1): p. 86-156, [0292] 57. Curtiss,
R., Ill. and W. Kong, Regulated bacterial lysis for nucleic acid
sequence vaccine vector delivery and antigen release, in United
States 20060140975. 2006. [0293] 58. Curtiss, R., Ill. and H. Y.
Kang, Immunogenic compositions and vaccines comprising carrier
bacteria that secrete antigens, in United States Patent Application
Publication 20040101531, 2004: US. [0294] 59. Kang, H. Y., et al.,
Transduction-mediated transfer of unmarked deletion and point
mutations through use of counterselectable suicide vectors. J
Bacteriol, 2002. 184(1): p. 307-12. [0295] 60. Hitchcock, P. J. and
T. M. Brown, Morphological heteronucleic acid sequenceity among
Salmonella lipopolysaccharide chemotypes in silver-stained
polyacrylamide gels. J Bacteriol, 1983. 154(1): p. 269-77.
Example 2: Regulated Attenuation
[0296] Attenuation of Salmonella vaccine vectors should decrease,
if not eliminate, undesirable disease symptoms, but the nutritional
status and health of the population to be vaccinated should be
considered. The attenuation should be (i) an inherent property of
the vaccine and not depend on fully functional host defenses and
immune responses, (ii) not be reversible by diet or by host or
microbial modification of diet constituents, and (iii) not permit
development of a persistent carrier state. The attenuated vaccine
should be sufficiently invasive and persistent to stimulate both
strong primary and lasting memory immune responses and should be
designed to minimize unnecessary tissue damage. As even attenuated
vaccines may cause disease in unlucky individuals, the vaccine
should be susceptible to clinically useful antibiotics. Many means
to attenuate Salmonella vaccines make them less able to tolerate
stresses encountered after oral administration including exposure
to acid, bile, increasing osmolarity and iron, and decreasing
O.sub.2, and/or reduced invasion of the gut associated lymphoid
tissue (GALT). The doses of recombinant Salmonella vaccines to
elicit maximal immune responses are lower for intranasal
immunization than they are for oral immunization (1,2). This may be
due, in part, to killing of orally administered vaccines by the
acid stress of the stomach (3) quickly followed by exposure to bile
in the duodenum. We have determined that these two stresses in
succession are more effective in causing bacterial cell death than
the sum of killing by each stress alone. Salmonella possesses a
large constellation of genes that confer acid tolerance and
resistance to acid stress (4,5) and inactivation of these genes or
their inability to be expressed by induction, reduces virulence
(6). In this regard, the regulatory proteins RpoS (7), Fur (8),
PhoPQ (9) and OmpR (10, 11) are all necessary to confer resistance
to acid stress and/or shock in S. Typhimurium. Similarly, many
genes are turned on in response to exposure to bile and some of
these gene products transiently repress invasion while bacteria
reside in the intestinal lumen (12-14).
[0297] It is important to have mutations contributing to
attenuation or other beneficial vaccine attributes that do not
impair the abilities of the vaccine to adjust to and/or withstand a
diversity of stresses encountered at any location within the
gastrointestinal tract if administered orally or in the respiratory
tract if administered intranasally. Likewise, the vaccine strain
should have wild-type abilities not compromised by attenuating or
other mutations to penetrate through mucin, to attach to cells in
the mucosal epithelium and be invasive into those cells. To achieve
these objectives, means have been developed herein to achieve
regulated delayed attenuation in vivo such that the vaccine at the
time of immunization exhibits almost the same abilities as a fully
virulent wild-type strain to contend with stresses and successfully
reach effector lymphoid tissues before display of attenuation to
preclude onset of any disease symptoms. The means described herein
confer high-level attenuation and superior immunogenicity compared
to traditional mutationally attenuated strains.
Materials and Methods for Example 2
[0298] Bacterial Strains, Media and Bacterial Growth:
[0299] All strains for testing in mice are derived from the highly
virulent S. Typhimurium strain UK-1 (15). All bacterial strains for
this example are listed above in Table 1. LB broth and agar (16)
are used as complex media for propagation and plating of bacteria.
Nutrient broth and agar (Difco), which are devoid of arabinose and
mannose, and minimal salts medium and agar (17) were also used.
Some studies were done with bacterial strains grown in tissue
culture medium to simulate environments to be encountered in vivo.
MacConkey agar with 0.5% lactose (Lac), 0.2 or 0.5% arabinose (Ara)
or 0.5% maltose (Mal) were used to indicate fermentation of sugars
and enumerate bacteria from mice. CAS plates (Schwyn B, Neilands J
B, 1987. Universal chemical assay for the detection and
determination of siderophores. Anal Biochem. 1987 January;
160(1):47-56), which were used to determine siderophore production,
were made by addition of chrome azurol S mixed with Fe.sup.+3 and
hexadecyltrimethyl ammonium bromide (HDTMA) to MOPS basal agar. X-P
plates to detect phosphatase activity were made by addition of 50
mg/ml of 5-bromo-4-chloro-3-indolyl-phosphate (BCIP or XP) to
Nutrient agar. Kornberg agar medium plates were prepared as a
glycogen indicator agar (18-20). Selenite broth, with or without
supplements, was used for enrichment of Salmonella from tissues,
although later results demonstrated that enrichment with
tetrathionate broth gave better results when vaccine strains had
multiple mutations. Bacterial growth was monitored
spectrophotometrically and by plating for colony counts.
[0300] Molecular and Genetic Procedures:
[0301] Methods for DNA isolation, restriction enzyme digestion, DNA
cloning and use of PCR for construction and verification of vectors
are standard (21). DNA sequence analysis was performed in the DNA
Sequence Laboratory in the School of Life Sciences at ASU. All
oligonucleotide and/or gene segment syntheses were done
commercially. Overlapping PCR amplification with primers designed
for specific modifications was used to optimize codons for
translational efficiency in Salmonella or to alter promoter,
ribosome binding/Shine-Dalgarno (SD) and start codon sequences.
Conjugational transfer of suicide vectors for generation of
unmarked deletion and deletion-insertion mutations was performed by
standard methods (22, 23) using the suicide vector donor strain
.chi.7213 (Table 1). Since live vaccine strains cannot display
resistance to antibiotics, means were used to generate defined
deletion mutations using suicide vector technologies that did not
use drug-resistance markers or leave molecular scars. Subsequently,
these unmarked defined deletion mutations with and without specific
insertions were introduced into strains using P22HTint (24, 25)
transduction of suicide vectors integrated into the deletion or
deletion-insertion mutation followed by selection for sucrose
resistance as described (26). Whenever insertion of a regulatory
sequence might adversely effect expression of an adjoining gene, a
transcription terminator (TT) was included to prevent such
consequences. Strong TTs from bacteriophages were generally used.
Plasmid constructs were evaluated by DNA sequencing, ability to
complement various S. Typhimurium mutant strains (Table 1) and for
ability to specify synthesis of proteins using gel electrophoresis
and western blot analyses. His- or GST-tagged proteins have been
produced and used to obtain anti-protein rabbit antisera for
western blot analyses.
[0302] Strain Characterizations:
[0303] Exquisite care was taken in strain construction and complete
biochemical and genetic characterizations were performed after
every step in strain construction. This includes running an LPS gel
to make sure rough variants were not selected. Comparative growth
analyses were conducted since the objective is to have single and
multiple mutant strains grow at similar rates and to the same
density as the wild-type parental strains when grown under
permissive conditions. Vaccine strain stability was also evaluated,
due to possible recombinational and/or mutational events as
described below. Strains are also evaluated for biochemical and
metabolic attributes, sensitivity to antibiotics and drugs,
serological properties and resistance compared to wild-type
parental strains to stresses associated with exposure to acid and
bile.
[0304] Cell Biology:
[0305] The ability of various constructed Salmonella strains to
attach to, invade into and survive in various murine and human
epithelial and/or macrophage cell lines are quantitated by well
established methods (27, 28) that are used routinely.
[0306] Animal Experimentation:
[0307] BALB/c and C57BL/6 female mice, six to eight weeks of age,
were used for most experiments. Mice are held in quarantine
one-week before use in experiments. They are deprived of food and
water 6 h before oral immunization. No bicarbonate is administered.
Food and water are returned 30 min after immunization. Candidate
vaccine strains are quantitatively enumerated in various tissues as
a function of time after inoculation (29, 30). The inoculation
procedures are the same as in the immunization studies. All animals
are housed in BL2 containment with filter bonnet covered cages. If
high immunogenicity is observed in initial tests after primary
immunization, subsequent studies are done to determine the lowest
level of vaccine inocula to induce a significant protective immune
response to oral or intraperitoneal challenge with the wild-type S.
Typhimurium UK-1 parental strain .chi.3761.
Construction of Deletion-Insertion Mutations to Achieve Regulated
Delayed Attenuation.
[0308] Four means are described to permit a regulated delayed
attenuation phenotype so that vaccine strains at the time of
immunization exhibit nearly wild-type attributes for survival and
colonization of lymphoid tissues and after five to ten cell
divisions become avirulent. These means to achieve regulated
delayed attenuation rely on using an araC P.sub.BAD
activator-promoter that is more tightly regulated by arabinose (31)
than the original sequence from the E. coli B/r strain (32). The
promoter was deleted, including all sequences that interact with
activator or repressor proteins, for the fur, phoPQ, rpoS and crp
nucleic acid sequences and substituted by insertion of the improved
araC P.sub.BAD cassette (31) to yield Salmonella strains with the
.DELTA.P.sub.fur33::TT araC P.sub.BAD fur,
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ,
.DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS and
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp deletion-insertion
mutations (P stands for promoter and TT stands for transcription
terminator). The suicide vectors used to generate these four
deletion-insertion mutations are depicted in FIG. 25 and are listed
in Table 2. A strong phage-derived TT was included at the 3' end of
the araC nucleic acid sequence in all these constructions since its
transcription in the presence of arabinose could often lead to
altered over expression of downstream adjacent nucleic acid
sequences with the same transcriptional orientation as the araC
nucleic acid sequence or to diminished expression when the
downstream adjacent nucleic acid sequence is in opposite
orientation resulting in synthesis of anti-sense mRNA from
P.sub.araC.
Phenotypic Characterization of Mutant Strains.
[0309] Growth of these strains in the presence of arabinose leads
to transcription of the fur, phoPQ, rpoS and/or crp nucleic acid
sequences but nucleic acid sequence expression ceases in the
absence of arabinose. These activities can be readily observed by
appropriate tests. Thus .chi.9021 with the .DELTA.P.sub.crp527::TT
araC P.sub.BAD crp deletion-insertion mutation can only ferment
maltose when grown in the presence of arabinose and not in the
absence of arabinose as revealed by streaking cultures on MacConkey
maltose agar without and with 0.2 percent arabinose (FIG. 26A).
Similarly, .chi.8848 with the .DELTA.P.sub.fur33::TT araC P.sub.BAD
fur and .chi.9107 with .DELTA.P.sub.fur33::TT araC P.sub.BAD fur
and .DELTA.P.sub.crp527::TT araC P.sub.BAD crp mutations reveal
siderophore production when streaked on CAS plates without
arabinose and no siderophore production when grown in the presence
of arabinose (FIG. 26B). .chi.8918 with the
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ and .chi.9108 with
the .DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ and
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp mutations when streaked
on X-P plates without and with 0.2 percent arabinose reveal acid
phosphatase activity due to expression of the PhoP-activated phoN
nucleic acid sequence only when grown in the presence of arabinose
(FIG. 26C). .chi.8956 with the .DELTA.P.sub.rpoS183::TT araC
P.sub.BAD rpoS and .chi.9064 with the .DELTA.P.sub.rpoS183::TT araC
P.sub.BAD rpoS and .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
mutations reveal glycogen accumulation when streaked on
glycogen-indicator agar with 0.2 percent arabinose and sprayed with
iodine indicator solution (FIG. 26D). The presence or absence of
RpoS in these strains can also be revealed by adding hydrogen
peroxide to cultures to detect the activity of the RpoS-dependant
catalase, KatE, (33-36) when arabinose is present during strain
growth. Since Crp positively enhances transcription from P.sub.BAD,
the inclusion of the .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
mutation with other araC P.sub.BAD regulated nucleic acid sequences
causes a tighter cessation of transcription in the absence of
arabinose. This is seen by close examination of the photographs in
FIG. 26. For this reason, the .DELTA.P.sub.crp527::TT araC
P.sub.BAD crp mutation is included in all vaccine strains when
using araC P.sub.BAD regulation of virulence nucleic acid
sequences.
Stability of Crp, Fur, RpoS and PhoP Proteins and their Decline
During Growth in the Absence of Arabinose.
[0310] Growth of strains with araC P.sub.BAD regulated nucleic acid
sequences in the presence of arabinose results in acid production
that can cause cessation of growth. We have therefore included the
.DELTA.araBAD23 mutation (FIG. 27) that prevents use of arabinose.
Inclusion of this mutation also prevents breakdown of arabinose
retained in the cell cytoplasm at the time of oral immunization and
inclusion of the .DELTA.araE25 mutation (FIG. 27), which enhances
retention of arabinose further delays cessation in expression of
araC P.sub.BAD regulated nucleic acid sequences for an additional
cell division or so. The suicide vectors for introducing the
.DELTA.araBAD23 and .DELTA.araE25 mutations are listed in Table
2.
[0311] The stability of virulence gene products in strains with
each of the araC P.sub.BAD regulated virulence genes was determined
by growing cultures to an OD.sub.600 of 0.8 in LB broth with 0.2
percent arabinose and then adding 30 .mu.g chloramphenicol/ml (37)
for Crp, Fur and PhoP and 200 .mu.g chloramphenicol/ml for RpoS
(38) to arrest further protein synthesis. As can be seen by the
results presented in FIG. 28, the Crp, Fur and PhoP proteins are
very stable and not significantly degraded, whereas the RpoS
protein displays no stability in the log phase (39). However, the
RpoS protein seemed to be stable when 50 .mu.g chloramphenicol/ml
was added to saturated overnight stationery phase cultures. When
these mutant strains were grown in Nutrient broth with 0.2 percent
arabinose to an OD.sub.600 of 0.8 and then diluted 1 to 4 into
Nutrient broth with no added arabinose and these 1 to 4 dilutions
continued after each culture again reached an OD.sub.600 of 0.8, we
observed no significant reductions in the amounts of Crp, Fur and
PhoP proteins until a final dilution of 1 to 16 with an arabinose
concentration of 0.0125 percent or until a final dilution of 1 to
64 with an arabinose concentration of 0.003125 percent. Thereafter
the amount of these proteins decreased by a factor of four for each
subsequent 1 to 4 dilution of the culture (FIG. 29). In the case of
RpoS protein, we observed a significant amount of reduction within
a dilution of 1 to 4 with an arabinose concentration of 0.05
percent (FIG. 29). The decline in the amounts of these proteins in
vivo would be expected to be more accelerated since there is no
arabinose present in tissues upon invasion of Salmonella into the
GALT. In other experiments, strains grown in Nutrient broth with
0.2 percent arabinose were sedimented by centrifugation and
resuspended at a density one-fourth of the original culture. In
this case after growth to the original density, the amounts of each
of the four virulence gene proteins was three to four times less
than in the culture grown with arabinose. In other experiments, it
was determined that the levels of Fur, PhoP, RpoS and Crp synthesis
were nearly the same when mutant cultures were grown in LB broth
with either 0.05 percent or 0.2 percent arabinose.
Attenuation of Mutant Strains in Orally Immunized Female BALB/c
Mice.
[0312] Levels of attenuation were evaluated in S. Typhimurium UK-1
strains with different araC P.sub.BAD regulated virulence nucleic
acid sequences by oral inoculation of female BALB/c mice with doses
approximating 10.sup.7, 10.sup.8 and 10.sup.9 CFU from cultures
grown in LB broth with 0.0, 0.05 and 0.2 percent arabinose. It
should be noted, that LB broth contains arabinose in the yeast
extract equivalent to a concentration of 0.003 percent based on
mass spec analysis. The collective results presented in Table 3
indicate that the strains with the .DELTA.P.sub.phoPQ107::TT araC
P.sub.BAD phoPQ, .DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS and
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp deletion-insertion
mutations were highly attenuated whereas the strain with the
.DELTA.P.sub.fur33::TT araC P.sub.BAD fur mutation was less
attenuated. In this regard, a higher level of attenuation was noted
when .chi.8848 was grown in LB broth with no added arabinose and a
greater virulence when grown in LB broth with 0.2 percent
arabinose. It is evident, however, from the collective results
(Table 3) that attenuation develops as the products of the fur,
phoPQ, rpoS and/or crp nucleic acid sequences are diluted at each
cell division.
TABLE-US-00004 TABLE 3 Attenuation of mutant strains in orally
immunized female BALB/c mice .sup.a Survivors/ Percent/ Strain
Genotype Dose .sup.b range total survivors .chi.8848
.DELTA.P.sub.fur33 9.0 .times. 10.sup.6-2.2 .times. 10.sup.9
138/189 73.0 .chi.8918 .DELTA.P.sub.phoPQ107 9.0 .times.
10.sup.6-1.2 .times. 10.sup.9 182/185 98.4 .chi.8956
.DELTA.P.sub.rpoS183 9.4 .times. 10.sup.6-1.5 .times. 10.sup.9
179/184 97.3 .chi.9021 .DELTA.P.sub.crp527 9.5 .times. 10.sup.6-1.5
.times. 10.sup.9 163/164 99.4 .sup.a Mice were seven to eight weeks
of age. Bacterial strains were grown in LB broth with 0, 0.05 or
0.2 percent arabinose that did not have a significant effect on
levels of attenuation on strains with the .DELTA.P.sub.phoPQ107::TT
araC P.sub.BAD phoPQ, .DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS
and .DELTA.P.sub.crp527::TT araC P.sub.BAD crp deletion-insertion
mutations but did effect the results for .chi.8848 with the
.DELTA.P.sub.fur33::TT araC P.sub.BAD fur mutation (see Results).
.sup.b Doses are in CFU.
Abilities of Orally Administered Strains with araC P.sub.BAD
Regulated Virulence Nucleic Acid Sequences to Induce Protective
Immunity to Oral Challenge with Wild-Type S. Typhimurium UK-1.
[0313] Strains with each of the araC P.sub.BAD regulated virulence
nucleic acid sequences were next evaluated for induction of
protective immunity against a challenge with the highly virulent S.
Typhimurium UK-1 strain .chi.3761 (oral LD.sub.50 of
1-2.times.10.sup.4 CFU). The results in Table 4 reveal that
.chi.8848 with the .DELTA.P.sub.fur33::TT araC P.sub.BAD fur
mutation displayed some virulence even at low doses when grown in
LB broth with 0.2 percent arabinose. However, for immunizing doses
of 10.sup.7 CFU and higher 100 percent of the survivors developed
protective immunity to challenges with 10.sup.8 and 10.sup.9 CFU
doses of .chi.3761. Thus the .DELTA.P.sub.fur33::TT araC P.sub.BAD
fur mutation while displaying moderate attenuation is highly
immunogenic. This is a very important attribute of an attenuating
mutation to include in a vaccine strain. It was previously reported
(40) that .chi.8848 with the .DELTA.P.sub.fur33::TT araC P.sub.BAD
fur mutation was completely attenuated even at high 10.sup.9 CFU
doses when grown in LB broth with no added arabinose. This
observation implies that production of too much Fur protein may
diminish attenuation.
TABLE-US-00005 TABLE 4 Oral immunization of mice with .chi.8848
(.DELTA.P.sub.fur33) and with survivors challenged orally with
wild-type .chi.3761 thirty days later .sup.a Survivors/ Survivors/
Immunizing dose .sup.b total Challenge dose .sup.b total Exp. 1
Exp. 2 Exp. 1 Exp. 2 Exp. 1 Exp. 2 Exp. 1 Exp. 2 9.0 .times.
10.sup.8 1.1 .times. 10.sup.9 6/10 4/10 1.0 .times. 10.sup.9 1.5
.times. 10.sup.9 3/3 2/2 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8
3/3 2/2 9.0 .times. 10.sup.7 1.1 .times. 10.sup.8 7/10 7/10 1.0
.times. 10.sup.9 1.5 .times. 10.sup.9 2/2 4/4 1.0 .times. 10.sup.8
1.5 .times. 10.sup.8 5/5 3/3 9.0 .times. 10.sup.6 1.1 .times.
10.sup.7 7/10 5/10 1.0 .times. 10.sup.9 1.5 .times. 10.sup.9 4/4
2/2 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8 3/3 3/3 9.0 .times.
10.sup.5 1.1 .times. 10.sup.6 5/10 8/10 1.0 .times. 10.sup.9 1.5
.times. 10.sup.9 1/2 1/4 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8
0/3 2/4 9.0 .times. 10.sup.4 1.1 .times. 10.sup.5 10/10 7/10 1.0
.times. 10.sup.9 1.5 .times. 10.sup.9 0/5 2/4 1.0 .times. 10.sup.8
1.5 .times. 10.sup.8 0/5 3/3 Total (all doses) 66/100 45/66 68.2%
Total (10.sup.7-10.sup.9 doses) 36/60 36/36 100% .sup.a Female
BALB/c mice were six to eight weeks of age. .chi.8848 was grown in
LB broth with 0.2% arabinose. .sup.b Doses are in CFU.
[0314] The results in Table 5 reveal that .chi.8918 with the
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ deletion-insertion
mutation is very attenuated but displays more moderate
immunogenicity in regard to inducing protection against challenge
with .chi.3761. These results suggest that some of the attenuation
may be due to a reduced ability of .chi.8918 to effectively
colonize lymphoid tissues, quite possibly due to the over
expression of the phoPQ nucleic acid sequences when .chi.8918 is
grown in LB broth with 0.2 percent arabinose. In accord with this
expectation, .chi.8918 is better able to colonize Peyer's patches,
mesenteric lymph nodes and spleens in orally immunized mice when
grown in LB broth without added arabinose than when grown in LB
broth with 0.2 percent arabinose. Nevertheless, .chi.8918 is still
less capable of colonizing these lymphoid tissues than .chi.9021
with the .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
deletion-insertion mutation, which colonizes equally well
independent of arabinose concentration in the LB broth.
TABLE-US-00006 TABLE 5 Oral immunization of mice with .chi.8918
(.DELTA.P.sub.phoPQ107) and with survivors challenged orally with
wild-type .chi.3761 thirty days later .sup.a Survivors/ Survivors/
Immunizing dose .sup.b total Challenge dose .sup.b total Exp. 1
Exp. 2 Exp. 1 Exp. 2 Exp. 1 Exp. 2 Exp. 1 Exp. 2 9.0 .times.
10.sup.8 1.2 .times. 10.sup.9 10/10 9/10 1.0 .times. 10.sup.9 1.5
.times. 10.sup.9 4/5 5/5 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8
4/5 4/4 9.0 .times. 10.sup.7 1.2 .times. 10.sup.8 10/10 10/10 1.0
.times. 10.sup.9 1.5 .times. 10.sup.9 3/5 4/5 1.0 .times. 10.sup.8
1.5 .times. 10.sup.8 3/5 5/5 9.0 .times. 10.sup.6 1.2 .times.
10.sup.7 10/10 9/10 1.0 .times. 10.sup.9 1.5 .times. 10.sup.9 2/4
1/4 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8 2/5 2/5 9.0 .times.
10.sup.5 1.1 .times. 10.sup.6 10/10 10/10 1.0 .times. 10.sup.9 1.5
.times. 10.sup.9 3/5 0/5 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8
0/5 3/5 9.0 .times. 10.sup.4 1.1 .times. 10.sup.5 10/10 10/10 1.0
.times. 10.sup.9 1.5 .times. 10.sup.9 0/5 0/5 1.0 .times. 10.sup.8
1.5 .times. 10.sup.8 0/5 0/5 Total (all doses) 98/100 45/98 45.9%
Total (10.sup.7-10.sup.9 doses) 58/60 39/58 67.2% .sup.a Female
BALB/c mice were six to eight weeks of age. .chi.8918 was grown in
LB broth with 0.2% arabinose. .sup.b Doses are CFU.
[0315] The results in Table 6 confirm the oral avirulence of
.chi.8956 with the .DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS
deletion-insertion mutation. However, the two experiments give very
different results on the ability of this strain to induce
protective immunity to oral challenge with wild-type S.
Typhimurium. We therefore repeated the experiment giving oral doses
of .chi.8956 (.DELTA.P.sub.rpoS183) of 1.4.times.(10.sup.7,
10.sup.8 and 10.sup.9) CFU with 15 survivors at each dose and after
challenge with 3.1.times.10.sup.9 CFU of .chi.3761 observed 13, 13
and 14 survivors, respectively, out of 15 mice challenged. It thus
appears that the data in the second experiment in Table 6 are more
indicative of the correct attenuating and immunogenic phenotype. No
differences in results were observed when .chi.8956
(.DELTA.P.sub.rpoS183) was grown in LB broth with or without
arabinose.
TABLE-US-00007 TABLE 6 Oral immunization of mice with .chi.8956
(.DELTA.P.sub.rpoS183) and with survivors challenged orally with
wild-type-.chi.3761 thirty days later .sup.a Survivors/ Survivors/
Immunizing dose .sup.b total Challenge dose .sup.b total Exp. 1
Exp. 2 Exp. 1 Exp. 2 Exp. 1 Exp. 2 Exp. 1 Exp. 2 9.4 .times.
10.sup.8 1.5 .times. 10.sup.9 9/10 9/10 1.0 .times. 10.sup.9 1.5
.times. 10.sup.9 0/4 4/4 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8
1/5 5/5 9.4 .times. 10.sup.7 1.5 .times. 10.sup.8 10/10 10/10 1.0
.times. 10.sup.9 1.5 .times. 10.sup.9 0/5 5/5 1.0 .times. 10.sup.8
1.5 .times. 10.sup.8 0/5 3/5 9.4 .times. 10.sup.6 1.5 .times.
10.sup.7 10/10 9/10 1.0 .times. 10.sup.9 1.5 .times. 10.sup.9 2/5
5/5 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8 0/5 2/4 9.4 .times.
10.sup.5 1.5 .times. 10.sup.6 10/10 10/10 1.0 .times. 10.sup.9 1.5
.times. 10.sup.9 0/5 4/5 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8
0/5 2/5 9.4 .times. 10.sup.4 1.5 .times. 10.sup.5 10/10 10/10 1.0
.times. 10.sup.9 1.5 .times. 10.sup.9 0/5 0/5 1.0 .times. 10.sup.8
1.5 .times. 10.sup.8 0/5 0/5 Total (all doses) 97/100 33/97 34.0%
Total (10.sup.7-10.sup.9 doses) 57/60 27/57 47.4% .sup.a Female
BALB/c mice were six to eight weeks of age. .chi.8956 was grown in
LB broth with 0.2% arabinose. .sup.b Doses are in CFU.
[0316] The results in Table 7 indicate that .chi.9021 with the
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp deletion-insertion
mutation is both highly attenuated and also very immunogenic.
Neither of these attributes was altered when the strain was grown
in LB broth with or without arabinose.
TABLE-US-00008 TABLE 7 Oral immunization of mice with .chi.9021
(.DELTA.P.sub.crp527) and with survivors challenged orally with
wild-type .chi.3761 thirty days later .sup.a Survivors/ Survivors/
Immunizing dose .sup.b total Challenge dose .sup.b total Exp. 1
Exp. 2 Exp. 1 Exp. 2 Exp. 1 Exp. 2 Exp. 1 Exp. 2 9.5 .times.
10.sup.8 1.6 .times. 10.sup.9 10/10 10/10 1.0 .times. 10.sup.9 1.5
.times. 10.sup.9 5/5 5/5 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8
5/5 5/5 9.5 .times. 10.sup.7 1.6 .times. 10.sup.8 10/10 10/10 1.0
.times. 10.sup.9 1.5 .times. 10.sup.9 5/5 5/5 1.0 .times. 10.sup.8
1.5 .times. 10.sup.8 5/5 5/5 9.5 .times. 10.sup.6 1.6 .times.
10.sup.7 10/10 10/10 1.0 .times. 10.sup.9 1.5 .times. 10.sup.9 4/5
5/5 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8 5/5 5/5 9.5 .times.
10.sup.5 1.6 .times. 10.sup.6 10/10 9/10 1.0 .times. 10.sup.9 1.5
.times. 10.sup.9 5/5 3/5 1.0 .times. 10.sup.8 1.5 .times. 10.sup.8
3/5 2/4 9.5 .times. 10.sup.4 1.6 .times. 10.sup.5 10/10 10/10 1.0
.times. 10.sup.9 -- 4/5 -- 1.0 .times. 10.sup.8 -- 3/5 -- Total
(all doses) 99/100 78/89 87.6% Total (10.sup.7-10.sup.9 doses)
60/60 59/60 98.3% .sup.a Female BALB/c mice were six to eight weeks
of age. .chi.9021 was grown in LB broth with 0.2% arabinose. .sup.b
Doses are in CFU.
Alterations in Strains with the .DELTA.P.sub.fur::TT araC P.sub.BAD
fur and .DELTA.P.sub.phoPQ::TT araC P.sub.BAD phoPQ
Deletion-Insertion Mutations to Increase the Attenuation of the
Former and Increase the Immunogenicity of the Latter.
[0317] As noted above, .chi.8848 with the .DELTA.P.sub.fur33::TT
araC P.sub.BAD fur mutation was more attenuated when grown in LB
broth without arabinose and more virulent when grown in LB broth
with 0.2 percent arabinose prior to oral inoculation of mice. This
implied that overproduction of Fur, which would require more cell
divisions in vivo to dilute out, reduced attenuation without
adversely altering immunogenicity in mice surviving immunization.
Consequently, two derivatives were constructed in which the ATG
start codon for the fur nucleic acid sequence was changed to GTG,
and in one of these, the SD sequence was changed from AGGA to AAGG.
The structure of these two mutations, .DELTA.P.sub.fur77::TT araC
P.sub.BAD fur and .DELTA.P.sub.fur81::TT araC P.sub.BAD fur, are
diagrammed in FIG. 8. .chi.9273 with the .DELTA.P.sub.fur77::TT
araC P.sub.BAD fur mutation and .chi.9269 with the P.sub.fur81::TT
araC P.sub.BAD fur mutation both synthesize much less Fur as
reveled by western blot analysis when grown in LB broth with 0.2
percent arabinose than does .chi.8848 with the
.DELTA.P.sub.fur33::TT araC P.sub.BAD fur mutation.
[0318] It was also noted above that the immunogenicity of .chi.8918
with the .DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ mutation
was decreased when the strain was grown in LB broth with 0.2
percent arabinose although its attenuation was independent of the
arabinose concentration in LB broth. This implied that over
production of PhoP and/or PhoQ decreased induction of immunity to
challenge. This inference was also supported by studies that
demonstrated that .chi.8918 was less able to colonize Peyer's
patches, mesenteric lymph nodes and spleen when grown in LB broth
with 0.2 percent arabinose than when grown with no added arabinose.
Two derivatives were therefore constructed in which the ATG start
codon for the phoP nucleic acid sequence was changed to GTG and in
one of these also changed the SD sequence from AGGA to AAGG. The
structure of these two mutations, .DELTA.P.sub.phoPQ173::TT araC
P.sub.BAD phoPQ and P.sub.phoPQ177::TT araC P.sub.BAD phoPQ, are
diagrammed in FIG. 9. .chi.9382 with the P.sub.phoPQ173::TT araC
P.sub.BAD phoPQ mutation and .chi.9383 with the
.DELTA.P.sub.phoPQ177::TT araC P.sub.BAD phoPQ mutation both
synthesize much less PhoP as reveled by western blot analysis when
grown in LB broth with 0.2 percent arabinose than does .chi.8918
with the .DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ
mutation.
[0319] Table 8 below contains results that demonstrate the high
immunogenicity of .chi.9273 with the .DELTA.P.sub.fur77::TT araC
P.sub.BAD fur mutation and .chi.9269 with the
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur mutation with .chi.9269
with the .DELTA.P.sub.fur81::TT araC P.sub.BAD fur mutation
demonstrating much better attenuation when grown in LB broth with
0.2 percent arabinose. The data in Table 8 also indicates that both
.chi.9382 with the .DELTA.P.sub.phoPQ173::TT araC P.sub.BAD phoPQ
mutation and .chi.9383 with the .DELTA.P.sub.phoPQ177::TT araC
P.sub.BAD phoPQ mutation are completely attenuated when grown in LB
broth with 0.2 percent arabinose and display essentially the same
immunogenicity that is much improved over that exhibited by
.chi.8918 with the .DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ
mutation when it is grown in LB broth with 0.2 percent
arabinose.
TABLE-US-00009 TABLE 8 Oral immunization of mice with strains with
modified .DELTA.P.sub.fur and .DELTA.P.sub.phoPQ mutations and with
survivors challenged orally with wild-type .chi.3761 thirty days
later..sup.a Immunizing Survivors/ Challenge Survivors/
Strain.sup.b Genotype dose.sup.c total dose.sup.c total .chi.9273
.DELTA.P.sub.fur77 1.5 .times. 10.sup.9 6/10 1.7 .times. 10.sup.9
6/6 1.7 .times. 10.sup.9 6/10 1.6 .times. 10.sup.9 6/6 .chi.9269
.DELTA.P.sub.fur81 1.0 .times. 10.sup.9 11/15 8.7 .times. 10.sup.8
11/11 1.0 .times. 10.sup.8 15/15 8.7 .times. 10.sup.8 15/15 1.8
.times. 10.sup.9 10/10 1.3 .times. 10.sup.9 10/10 1.7 .times.
10.sup.9 19/20 1.6 .times. 10.sup.9 19/19 .chi.9382
.DELTA.P.sub.phoPQ173 1.0 .times. 10.sup.9 15/15 1.8 .times.
10.sup.9 11/15 1.0 .times. 10.sup.8 15/15 1.8 .times. 10.sup.9
11/15 1.0 .times. 10.sup.7 15/15 1.8 .times. 10.sup.9 12/15
.chi.9383 .DELTA.P.sub.phoPQ177 1.1 .times. 10.sup.9 15/15 1.8
.times. 10.sup.9 10/15 1.1 .times. 10.sup.8 15/15 1.8 .times.
10.sup.9 11/15 1.1 .times. 10.sup.7 15/15 1.8 .times. 10.sup.9
13/15 .sup.aFemale BALB/c mice were six to eight weeks of age.
Strains were grown in LB broth with no added arabinose or with
0.05% or 0.2% arabinose with no significant differences noted.
.sup.b.chi.9382 and .chi.9383 have the .DELTA.araBAD23 deletion
(Table 1) in addition to the .DELTA.P.sub.phoPQ insertion-deletion
mutations the .DELTA.araBAD23 deletion (Table 5). .sup.cDoses are
in CFU.
Abilities of Intraperitoneally Administered Strains with araC
P.sub.BAD Regulated Virulence Nucleic Acid Sequences to Induce
Protective Immunity to Oral Challenge with Wild-Type S. Typhimurium
UK-1.
[0320] Although the vaccines were designed for oral administration,
it was worthwhile to determine if strains with these mutations,
when administered intraperitoneally (i.p.), would also display
attenuation and induce immunity to challenge with orally
administered wild-type .chi.3761. The S. Typhimurium UK-1 strain
.chi.3761 has an LD.sub.50 by the i.p. route of less than 10 CFU.
Table 9 demonstrates that strains with .DELTA.P.sub.fur::TT araC
P.sub.BAD fur mutations retain considerable virulence by this route
of administration although .chi.9269 with the
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur mutation displays the
highest attenuation of the three strains evaluated and yet induces
complete protective immunity to all survivors when challenged with
about 10.sup.9 CFU of .chi.3761. .chi.8918 with the
.DELTA.P.sub.phoPQ107::TT araC P.sub.BAD phoPQ mutation displays
fairly good attenuation by this route. On the other hand, .chi.8956
with the .DELTA.P.sub.rpoS183::TT araC P.sub.BAD rpoS mutation and
.chi.9021 with the .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
mutation are the most attenuated and induce a very high level of
protective immunity when delivered at i.p doses in the 10.sup.2 to
10.sup.4 CFU range (Table 9).
TABLE-US-00010 TABLE 9 Intraperitoneal immunization of mice with
strains with various deletion-insertion mutations conferring
regulated delayed oral attenuation and with survivors orally
challenged with wild-type .chi.3761 thirty days later. Immunizing
Survivors/ Challenge Survivors/ Strain Genotype dose.sup.b total
dose.sup.b total .chi.8848 .DELTA.P.sub.fur33 1.2 .times. 10.sup.4
0/5 -- 1.2 .times. 10.sup.3 0/5 -- 1.2 .times. 10.sup.2 0/5 -- 1.2
.times. 10.sup.1 0/5 -- .chi.9273 .DELTA.P.sub.fur77 1.6 .times.
10.sup.4 0/5 1.6 .times. 10.sup.3 0/5 1.6 .times. 10.sup.2 0/5 1.6
.times. 10.sup.1 1/5 1.6 .times. 10.sup.9 1/1 .chi.9269
.DELTA.P.sub.fur81 1.7 .times. 10.sup.4 1/10 1.6 .times. 10.sup.9
1/1 1.7 .times. 10.sup.3 7/10 1.6 .times. 10.sup.9 7/7 1.7 .times.
10.sup.2 4/10 1.6 .times. 10.sup.9 4/4 1.7 .times. 10.sup.1 6/10
1.6 .times. 10.sup.9 6/6 .chi.8918 .DELTA.P.sub.phoPQ107 1.2
.times. 10.sup.5 0/5 -- 9.6 .times. 10.sup.4 6/10 1.5 .times.
10.sup.9 4/6 1.2 .times. 10.sup.4 5/5 9.6 .times. 10.sup.8 5/5 9.6
.times. 10.sup.3 8/10 1.5 .times. 10.sup.9 6/8 1.3 .times. 10.sup.3
5/5 9.6 .times. 10.sup.8 2/5 9.6 .times. 10.sup.2 5/5 1.5 .times.
10.sup.9 2/5 1.2 .times. 10.sup.2 5/5 9.6 .times. 10.sup.8 3/5
.chi.8956 .DELTA.P.sub.rpoS183 1.5 .times. 10.sup.4 5/5 1.0 .times.
10.sup.9 5/5 1.5 .times. 10.sup.3 5/5 1.0 .times. 10.sup.9 5/5 1.5
.times. 10.sup.2 5/5 1.0 .times. 10.sup.9 3/5 1.5 .times. 10.sup.1
5/5 1.0 .times. 10.sup.9 3/5 .chi.9021 .DELTA.P.sub.crp527 1.4
.times. 10.sup.5 0/5 -- 1.4 .times. 10.sup.4 4/10 1.5 .times.
10.sup.9 4/4 1.4 .times. 10.sup.3 10/10 1.5 .times. 10.sup.9 10/10
1.4 .times. 10.sup.2 10/10 1.5 .times. 10.sup.9 10/10 1.4 .times.
10.sup.1 9/10 1.5 .times. 10.sup.9 8/9 .sup.aFemale BALB/C mice
were six to eight weeks of age. All strains were grown in LB broth
with 0.2% arabinose. .sup.bDoses are in CFU.
Enhanced Control Over araC P.sub.BAD Regulated Virulence Nucleic
Acid Sequences In Vivo by Inclusion of the .DELTA.P.sub.crp527::TT
araC P.sub.BAD Crp Mutation.
[0321] Maximum levels of transcription of nucleic acid sequences
regulated by the araC P.sub.BAD system require not only arabinose
to interact with the AraC protein but also the Crp protein (41).
Thus the .DELTA.P.sub.crp527::TT araC P.sub.BAD crp mutation was
included in vaccine strains whenever other araC P.sub.BAD regulated
nucleic acid sequences are included. The benefit of this addition
is readily observed by the results previously presented in FIG. 7
that demonstrate this tighter regulation in the absence of
arabinose in strains that also have the .DELTA.P.sub.crp527::TT
araC P.sub.BAD crp mutation. This also acts as a backup and should
enhance safety and efficacy of vaccine strains.
[0322] Means for delay in the in vivo timing of onset of regulated
delayed attenuation. As noted by Guzman et al. (32), the inclusion
of mutations that abolish utilization of arabinose can prolong
expression of nucleic acid sequences under the control of the araC
P.sub.BAD system. Onset of attenuation can therefore by delayed by
including .DELTA.araBAD23, which prevents use of arabinose retained
in the cell cytoplasm at the time of oral immunization, and/or
.DELTA.araE25 that enhances retention of arabinose. These mutations
are diagrammed in FIG. 27.
Discussion for Example 2
[0323] Four different means have been described to achieve
regulated delayed attenuation of S. Typhimurium vaccine strains
such that vaccines at the time of immunization will be better able
to withstand the host defense imposed stresses following oral
immunization. Some of these constructs have been modified to
optimize attenuation and improve immunogenicity. Although
comparative studies with vaccine strains having defined deletion
mutations in the fur, phoPQ, rpoS and crp nucleic acid sequences
might resolve doubt, such comparative studies become difficult to
justify based on animal use. These mutations are being included in
strains with multiple attenuating mutations.
REFERENCES FOR EXAMPLE 2
[0324] 1. Hopkins S, Kraehenbuhl J P, Schodel F, Potts A, Peterson
D, de Grandi P, & Nardelli-Haefliger D (1995) A recombinant
Salmonella typhimurium vaccine induces local immunity by four
different routes of immunization. Infect Immun 63: 3279-3286.
[0325] 2. Nardelli-Haefliger D, Roden R B, Benyacoub J, Sahli R,
Kraehenbuhl J P, Schiller J T, Lachat P, Potts A, & De Grandi P
(1997) Human papillomavirus type 16 virus-like particles expressed
in attenuated Salmonella typhimurium elicit mucosal and systemic
neutralizing antibodies in mice. Infect Immun 65: 3328-3336. [0326]
3. Giannella R A, Broitman S A, & Zamcheck N (1973) Gastric
acidity and cholera. Ann Intern Med 78: 780. [0327] 4. Foster J W
& Spector M P (1995) How Salmonella survive against the odds.
Annu Rev Microbiol 49: 145-174. [0328] 5. Audia J P, Webb C C,
& Foster J W (2001) Breaking through the acid barrier: an
orchestrated response to proton stress by enteric bacteria. Int J
Med Microbiol 291: 97-106. [0329] 6. Wilmes-Riesenberg M R, B.
Bearson, J. W. Foster, and R. Curtiss, III. (1996) Role of acid
tolerance response in virulence of Salmonella typhimurium. Infect.
Immun 64: 1085-1092. [0330] 7. In Soo Lee J L, Holly K Hall,
Bradley Bearson, John W Foster (1995) The stationary-phase sigma
factor sS (RpoS) is required for a sustained acid tolerance
response in virulent Salmonella typhimurium. Molecular Microbiology
17: 155-167. [0331] 8. Hall H K & Foster J W (1996) The role of
fur in the acid tolerance response of Salmonella typhimurium is
physiologically and genetically separable from its role in iron
acquisition. J Bacteriol 178: 5683-5691. [0332] 9. Bearson B L,
Wilson L, & Foster J W (1998) A low pH-inducible,
PhoPQ-dependent acid tolerance response protects Salmonella
typhimurium against inorganic acid stress. J Bacteriol 180:
2409-2417. [0333] 10. Bang I S, Audia J P, Park Y K, & Foster J
W (2002) Autoinduction of the ompR response regulator by acid shock
and control of the Salmonella enterica acid tolerance response. Mol
Microbiol 44: 1235-1250. [0334] 11. Bang I S, Kim B H, Foster J W,
& Park Y K (2000) OmpR regulates the stationary-phase acid
tolerance response of Salmonella enterica serovar Typhimurium. J
Bacteriol 182: 2245-2252. [0335] 12. Prouty A M & Gunn J S
(2000) Salmonella enterica serovar Typhimurium invasion is
repressed in the presence of bile. Infect Immun 68: 6763-6769.
[0336] 13. van Velkinburgh J C & Gunn J S (1999)
PhoP-PhoQ-regulated loci are required for enhanced bile resistance
in Salmonella spp. Infect Immun 67: 1614-1622. [0337] 14. Gunn J S
(2000) Mechanisms of bacterial resistance and response to bile.
Microbes Infect 2: 907-913. [0338] 15. Curtiss R, Ill & Hassan
J O (1996) Nonrecombinant and recombinant avirulent Salmonella
vaccines for poultry. Vet Immunol Immunopathol 54: 365-372. [0339]
16. Bertani G (1951) Studies on lysogenesis. I. The mode of phage
liberation by lysogenic Escherichia coli. J Bacteriol 62: 293-300.
[0340] 17. Curtiss R, III (1965) Chromosomal Aberrations Associated
with Mutations to Bacteriophage Resistance in Escherichia coli. J
Bacteriol 89: 28-40. [0341] 18. Romeo T & Preiss J (1989)
Genetic regulation of glycogen biosynthesis in Escherichia coli: in
vitro effects of cyclic AMP and guanosine 5'-diphosphate
3'-diphosphate and analysis of in vivo transcripts. J Bacteriol
171: 2773-2782. [0342] 19. Lange R & Hengge-Aronis R (1991)
Identification of a central regulator of stationary-phase gene
expression in Escherichia coli. Mol Microbiol 5: 49-59. [0343] 20.
Hengge-Aronis R & Fischer D (1992) Identification and molecular
analysis of glgS, a novel growth-phase-regulated and rpoS-dependent
gene involved in glycogen synthesis in Escherichia coli. Mol
Microbiol 6: 1877-1886. [0344] 21. Sambrook J, Fritsch E F, &
Maniatis T (1989) (Cold Spring Harbor Lab. Press, Plainview).
[0345] 22. Roland K, Curtiss R, Ill, & Sizemore D (1999)
Construction and evaluation of a delta cya delta crp Salmonella
typhimurium strain expressing avian pathogenic Escherichia coli 078
LPS as a vaccine to prevent airsacculitis in chickens. Avian Dis
43: 429-441. [0346] 23. Miller V L & Mekalanos J J (1988) A
novel suicide vector and its use in construction of insertion
mutations: osmoregulation of outer membrane proteins and virulence
determinants in Vibrio cholerae requires toxR. J Bacteriol 170:
2575-2583. [0347] 24. Schmieger H (1972) Phage P22-mutants with
increased or decreased transduction abilities. Mol Gen Genet 119:
75-88. [0348] 25. Schmieger H & Backhaus H (1976) Altered
cotransduction frequencies exhibited by HT-mutants of
Salmonella-phage P22. Mol Gen Genet 143: 307-309. [0349] 26. Kang H
Y, Dozois C M, Tinge S A, Lee T H, & Curtiss, R., III (2002)
Transduction-mediated transfer of unmarked deletion and point
mutations through use of counterselectable suicide vectors. J
Bacteriol 184: 307-312. [0350] 27. Daigle F, Graham J E, &
Curtiss, R., III (2001) Identification of Salmonella typhi genes
expressed within macrophages by selective capture of transcribed
sequences (SCOTS). Mol Microbiol 41: 1211-1222. [0351] 28. Galan J
E & Curtiss R, III (1989) Cloning and molecular
characterization of genes whose products allow Salmonella
typhimurium to penetrate tissue culture cells. Proc Natl Acad Sci
USA 86: 6383-6387. [0352] 29. Curtiss R, III & Kelly S M (1987)
Salmonella typhimurium deletion mutants lacking adenylate cyclase
and cyclic AMP receptor protein are avirulent and immunogenic.
Infect Immun 55: 3035-3043. [0353] 30. Gulig P A & Curtiss R,
III (1987) Plasmid-associated virulence of Salmonella typhimurium.
Infect Immun 55: 2891-2901. [0354] 31. Kong W, Wanda S-Y, Zhang X,
Bollen W, Tinge S A, Roland K L, & Curtiss, R., Ill (2008)
Regulated programmed lysis of recombinant Salmonella within host
tissues to release protective antigens and confer biological
containment. Proc Natl Acad Sci USA accepted. [0355] 32. Guzman L
M, Belin D, Carson M J, & Beckwith J (1995) Tight regulation,
modulation, and high-level expression by vectors containing the
arabinose PBAD promoter. J Bacteriol 177: 4121-4130. [0356] 33.
Loewen P C & Triggs B L (1984) Genetic mapping of katF, a locus
that with katE affects the synthesis of a second catalase species
in Escherichia coli. J Bacteriol 160: 668-675. [0357] 34. Nickerson
C A & Curtiss R, III (1997) Role of sigma factor RpoS in
initial stages of Salmonella typhimurium infection. Infect Immun
65: 1814-1823. [0358] 35. Buchmeier N A, Libby S J, Xu Y, Loewen P
C, Switala J, Guiney D G, & Fang F C (1995) DNA repair is more
important than catalase for Salmonella virulence in mice. J Clin
Invest 95: 1047-1053. [0359] 36. Mulvey M R, Switala J, Borys A,
& Loewen P C (1990) Regulation of transcription of katE and
katF in Escherichia coli. J Bacteriol 172: 6713-6720. [0360] 37.
Lee H C & Bernstein H D (2002) Trigger factor retards protein
export in Escherichia coli. J Biol Chem 277: 43527-43535. [0361]
38. Tu X, Latifi T, Bougdour A, Gottesman S, & EA. G (2006) The
PhoP/PhoQ two-component system stabilizes the alternative sigma
factor RpoS in Salmonella enterica. Proc Natl Acad Sci USA. 103:
13503-13508. [0362] 39. Peterson C N, Ruiz N, & Silhavy T J
(2004) RpoS proteolysis is regulated by a mechanism that does not
require the SprE (RssB) response regulator phosphorylation site. J
Bacteriol 186: 7403-7410. [0363] 40. Curtiss R. Ill et al. (2007)
Virulence Mechanisms of Bacterial Pathogens (ASM Press, Washington
D.C.). [0364] 41. Lobell R B & Schleif R F (1991) AraC-DNA
looping: orientation and distance-dependent loop breaking by the
cyclic AMP receptor protein. J Mol Biol 218: 45-54.
Example 3: Improved Immune Responses Induced by RASVs with
Regulated Delayed Attenuation and Regulated Delayed Synthesis of
Protective Antigen
[0365] Generating a Salmonella strain that is safe and also retains
its immunogenicity is the biggest challenge in the development of
live vaccine candidates (1). An ideal Salmonella vaccine strain
should exhibit wild-type abilities to withstand all stresses
(enzymatic, acid, osmotic, ionic, etc.) and host defenses (bile,
antibacterial peptides, etc.) encountered following oral or
intranasal immunization and should exhibit wild-type abilities to
colonize and invade host lymphoid tissues while remaining
avirulent. A variety of attenuated Salmonella strains have been
used as live vaccines to induce mucosal and systemic immunity
against either the carrier itself or to a vectored antigen (2).
More recently developed Salmonella vaccine strains carry defined
nonreverting mutations that fall into two general categories:
metabolic functions and virulence factors (3). Different means for
attenuating Salmonella have been investigated to develop ideal
immune responses (4, 5). Many previously utilized means for
Salmonella attenuation either reduced vaccine survival due to
host-induced stresses and/or reduced colonization of lymphoid
effector tissues leading to less than optimal immunogenicity (6,
7). To circumvent these problems, a system for regulated delayed in
vivo expression of attenuation has been developed (8). Thus vaccine
strains are phenotypically wild-type for host invasion at the time
of immunization and become attenuated after colonization of host
tissues (8).
[0366] PspA is an important virulence factor found on the surface
of all pneumococci (9). It plays a role in colonization of the host
and contributes to the ability of pneumococcus to cause invasive
disease (10). The N-terminal half of the protein is the
.alpha.-helical domain which contains protective epitopes based on
immunization studies with the full length and truncated PspA
fragments (11, 12). Humans naturally infected or colonized with
pneumococcus, develop anti-PspA antibodies in both serum and
mucosal secretions, with antibody to the .alpha.-helical domain of
PspA also implicated in preventing pneumococcal carriage.
[0367] Previous work has demonstrated that oral vaccination of mice
with a .DELTA.crp Salmonella vaccine strain expressing a secreted
PspA fusion protein could protect the immunized mice from virulent
S. pneumoniae WU2 challenge (13). The protection rate was about 60%
against a 50 LD.sub.50 challenge (13). To increase the effective
protective immunity against S. pneumoniae, we designed and
constructed a new generation of Salmonella enterica serovar
Typhimurium strains with delayed regulated attenuation (see Example
2) and for one strain with regulated delayed expression of antigen
encoding sequences in vivo (Example 1).
[0368] In this example, the immunogenicity is evaluated of two new
attenuated S. Typhimurium strains transformed with Asd.sup.+
balanced-lethal plasmids encoding a secreted form of the
.alpha.-helical region of PspA. Antibody responses, cytokine
responses and protective immunity against S. pneumoniae WU2
challenge were evaluated. The results attained confirm the
hypothesis that vaccine strains with regulated delayed in vivo
attenuation including the strain that also exhibited regulated
delayed protective antigen synthesis confer a more superior immune
response than a vaccine strain with a more traditional means of
attenuation.
Materials and Methods for Example 3
[0369] Bacterial Strains, Plasmids, Media, and Growth
Conditions:
[0370] The bacterial strains and plasmids used in this example are
listed in Table 1 and 2, respectively. Bacteriophage P22HTint was
used for generalized transduction. S. Typhimurium cultures were
grown at 37.degree. C. in LB broth or on LB agar (14). For animal
experiments, plasmid-containing .chi.9088 and .chi.9558 cultures
were supplemented with 0.2% mannose or 0.2% mannose and 0.05%
arabinose, respectively. No additions were made to the media for
growing plasmid-containing .chi.8133 cultures. MacConkey agar
(Difco, Detroit, Mich.) supplemented with 1% sugar was used for
fermentation assays. DAP was added (50 .mu.g/ml) for the growth of
Asd-strains (15). S. pneumoniae WU2 was cultured on brain heart
infusion agar containing 5% sheep blood or in Todd-Hewitt broth
plus 0.5% yeast extract (12).
[0371] Strain Construction and Characterization:
[0372] MacConkey agar supplemented with 1% maltose was used to
confirm the phenotype of crp mutants (13). Chrome Azurol S (CAS)
plates were used to confirm the constitutive synthesis of
siderophores characteristic of fur mutants (16). The presence of
the .DELTA.asdA33 and .DELTA.asdA16 mutations in Salmonella was
confirmed by inability of the strain to grow on media without DAP
(15). Lipopolysaccharide (LPS) profiles of Salmonella strains were
examined as described (17). Plasmid stability was determined as
previously described (18). All plasmids were found to be stable for
50 generations of growth in the presence of DAP.
[0373] SDS-PAGE and Immunoblot Analyses:
[0374] Protein samples were boiled for 5 min and subsequently
separated by SDS-PAGE. For immunoblotting, proteins separated by
SDS-PAGE were transferred to nitrocellulose membranes. After
blocking membranes with 3% skim milk in 10 mM Tris-0.9% NaCl (pH
7.4), PspA was detected with rabbit polycolonal antibody specific
for PspA (University of Alabama at Birmingham) followed by the
addition of an AP-conjugated goat anti-rabbit immunoglobulin G
(IgG) (Sigma). Immunoreactive bands were visualized by the addition
of BCIP/NBT solution (Sigma). The reaction was stopped after 2 min
by washing with large volumes of deionized water several times.
[0375] Immunization of Mice:
[0376] Female BALB/c mice, 6-7 weeks old, were obtained from
Charles River Laboratories. All animal procedures were approved by
the Arizona State University Animal Care and Use Committee. Mice
were acclimated for 7 days before starting experiments.
[0377] Recombinant attenuated Salmonella vaccine (RASV) strains
were grown statically overnight in LB broth containing the
appropriate supplements at 37.degree. C. The following day, an
overnight culture of 1 ml was inoculated into 100 ml of LB broth
containing the appropriate supplements and grown with aeration at
37.degree. C. to an OD.sub.600 of 0.8 to 0.9. Cells were pelleted
by centrifugation at room temperature (6,000.times.g for 15 min),
and the pellet resuspended in 1 ml of buffered saline with gelatin
(BSG). To determine the titer of RASV strains used to inoculate
mice, dilutions of the RASV strains were plated onto MacConkey agar
supplemented with 1% lactose. Mice were orally inoculated with 20
.mu.l of BSG containing 1.times.10.sup.9 CFU of an RASV strain.
Blood was obtained by mandibular vein puncture at biweekly
intervals. Following centrifugation, the serum was removed from the
whole blood and stored at -20.degree. C.
[0378] Antigen Preparation:
[0379] rPspA protein and S. Typhimurium outer membrane proteins
(SOMPs) were purified as described (13). S. Typhimurium LPS was
obtained from Sigma. The rPspA clone and purified protein were kind
gifts from Dr. Susan Hollingshead at the University of Alabama at
Birmingham (19).
[0380] Enzyme Linked Immunosorbent Assay (ELISA):
[0381] ELISA was used to assay antibodies in serum to S.
Typhimurium LPS, SOMPs and to rPspA. Polystyrene 96-well
flat-bottom microtiter plates (Dynatech Laboratories Inc.,
Chantilly, Va.) were coated with LPS (100 ng/well; Sigma), SOMP
(100 ng/well, our lab), or purified rPspA (100 ng/well). Antigens
suspended in sodium carbonate-bicarbonate coating buffer (pH 9.6)
were applied with 100-.mu.l volumes in each well. Plates were
incubated overnight at 4.degree. C. Free binding sites were blocked
with phosphate-buffered saline (pH 7.4) containing 0.1% Tween 20,
and 1% bovine serum albumin. A 100-.mu.l volume of series diluted
sample was added to individual wells in triplicate and incubated
for 1 h at 37.degree. C. Plates were treated with biotinylated goat
anti-mouse IgG, IgG1, or IgG2a (Southern Biotechnology Inc.,
Birmingham, Ala.) Wells were developed with streptavidin-alkaline
phosphatase conjugate (Southern Biotechnology) followed by
p-nitrophenylphosphate substrate (Sigma) in diethanolamine buffer
(pH 9.8). Color development (absorbance) was recorded at 405 nm
using an automated ELISA plate (model EL311SX; Biotek, Winooski,
Vt.). Absorbance readings 0.1 higher than PBS control values were
considered positive reactions.
[0382] Passive Transfer of Cells and Sera:
[0383] At week 12, sera and spleen cells were harvested from 5 mice
per group. The sera were pooled and CD4.sup.+ T cells were isolated
using T-cell enrichment columns (R&D Systems Inc, Minneapolis,
Minn.), according to the manufacturer's instructions. Spleen cells
(1.times.10.sup.7) or purified CD4.sup.+ T cells (5.times.10.sup.6)
were suspended in PBS and injected into the lateral tail veins of
naive, syngeneic BALB/c mice. Naive syngeneic BALB/c mice received
100 .mu.l of serum from a different group of mice through the tail
vein. All groups were challenged intraperitoneally after 12 h with
5.times.10.sup.4 CFU of S. pneumoniae in 200 .mu.l of BSG.
[0384] IL-4 and IFN-.gamma. ELISPOTs:
[0385] At week 8, spleen cells were harvested from 3 mice of each
group. ELISPOTs were performed as previously described (20).
Briefly, PVDF membrane plates (Millipore, Bedford, Mass., USA) were
pre-wetted with ethyl alcohol, washed with sterile H.sub.2O and
coated with 100 .mu.l of mAbs IL-4 or IFN-.gamma. (BD PharMingen,
San Diego, Calif.) at 2 .mu.g/ml, in PBS overnight at 4.degree. C.
The wells were washed with PBS and blocked with RPMI with 10% FCS.
After that, 50 .mu.l cell medium (RPMI-1640 supplemented with 10%
FCS, 2 mM L-glutamine, 100 IU/ml penicillin and streptomycin and 1%
HEPES, with or without stimuli and 50 .mu.l of cells (100,000 per
well) in cell medium were added per well and incubated in the
plates overnight in 5% CO.sub.2 at 37.degree. C. The next day, the
cell suspensions were discarded and the plates washed with PBS.
Biotinylated mAb IL-4 or IFN-.gamma. (BD PharMingen, San Diego,
Calif.) at 0.5 .mu.g/ml in PBS with 1% FCS was added and incubated
at room temperature for 2 h. After washing with PBS, 100 .mu.l/well
of avidin peroxidase diluted 1:1000 (v/v) in PBS-T containing 1%
FCS were added followed by incubation for 1 hour at room
temperature. AEC (3-amina-9-ethycarbazole) substrate was prepared
according to manufacturer's (Vector Laboratories, Burlingame,
Calif.) specifications, and 100 .mu.l of substrate was added per
well. Spots were developed for 15 minutes at room temperature.
Plates were dried and analyzed by using an automated CTL ELISPOT
Reader System (Cellular Technology LTD, Cleveland, Ohio).
[0386] Measurement of Cytokine Concentrations:
[0387] Cytokine concentrations were determined using the Bio-Plex
Protein Array System (Bio-Rad, Hercules, Calif., USA).
Cytokine-specific antibody-coated beads (Bio-Rad) were used for
these experiments. The assay quantitates cytokines over a broad
range (2-32,000 .mu.g/ml) and eliminates multiple dilutions of
high-concentration samples. The samples were prepared and incubated
with the antibody-coupled beads for 1 h with continuous shaking.
The beads were washed three times with wash buffer to remove
unbound protein and then incubated with biotinylated detection
cytokine-specific antibody for 1 h with continuous shaking. The
beads were washed once more and were then incubated with
streptavidin-phycoerythrin for 10 min. After incubation, the beads
were washed and resuspended in assay buffer, and the constituents
of each well were drawn up into the flow-based Bio-Plex Suspension
Array System, which identifies each different color bead as a
population of protein and quantifies each protein target based on
secondary antibody fluorescence. Cytokine concentrations were
automatically calculated by Bio-Plex Manager software using a
standard curve derived from a recombinant cytokine standard. Many
readings were made on each bead set, further validating the
results.
[0388] Pneumococcal Challenge:
[0389] At week 12 the ability of the Salmonella-PspA vaccine to
protect immunized mice against S. pneumoniae was assessed by
intraperitoneal challenge with 5.times.10.sup.4 CFU of S.
pneumoniae WU2 in 200 .mu.l of BSG (21). The 50% lethal dose
(LD.sub.50) of S. pneumoniae WU2 in BALB/c mice was
2.times.10.sup.2 CFU by intraperitoneal administration. Twenty-four
hours after intraperitoneal challenge, mice were marked and bled by
mandibular vein puncture, and blood samples with 10-fold serial
dilutions in saline were plated on brain heart infusion agar
containing 5% sheep blood. Bacterial colonies were enumerated after
overnight incubation at 37.degree. C.
[0390] Histological Examinations:
[0391] After challenge, mice were euthanized just before dying and
survivors were euthanized after 15 days of observation. Fixed lung,
spleen and liver specimens were embedded in paraffin wax,
sectioned, and stained with hematoxylin and eosin (H&E).
Micrographs were taken with a digital camera.
[0392] Statistical Analysis:
[0393] Most data were expressed as means.+-.standard error. The
means were evaluated with One-way ANOVA and LSD tests for multiple
comparisons among groups. p<0.05 was considered statistically
significant.
Regulated Attenuation of fur, crp and pmi in .chi.9088
(.DELTA.P.sub.fur33::TT araC P.sub.BAD fur .DELTA.pmi-2426
.DELTA.(gmd-fcl)-26 .DELTA.asdA33) and .chi.9558 (.DELTA.pmi-2426
.DELTA.(gmd-fcl)-26 .DELTA.P.sub.fur81::TT araC P.sub.BADfur
.DELTA.P.sub.crp527::TT araC P.sub.BADcrp .DELTA.asdA27::TT araC
P.sub.BADc2 .DELTA.araE25 .DELTA.araBAD23
.DELTA.relA198::araCP.sub.BADlacI TT .DELTA.sopB1925
.DELTA.agfBAC811).
[0394] Regulated delayed attenuation attributes distinguish
.chi.9088 and .chi.9558 from other attenuated Salmonella strains
due to a unique combination of arabinose-regulated expression of
Fur, Crp and mannose-regulated expression of O-antigen synthesis.
Salmonella with pmi mutations are attenuated and immunogenic (22).
Strains with the .DELTA.pmi-2426 mutation lack phosphomannose
isomerase needed to interconvert fructose-6-P and mannose-6-P but
synthesize a complete LPS O-antigen when grown in the presence of
mannose (FIG. 30). Note that LPS synthesis is dependent on the
addition of mannose when cells are grown in nutrient broth, but
there is enough mannose in LB broth to enable O-antigen
production.
[0395] The other means used to achieve regulated delayed in vivo
attenuation was to replace the promoter/operator regions of the fur
and crp nucleic acid sequences with the tightly-regulated,
arabinose-dependent araC P.sub.BAD activator-promoter. (FIG. 31)
Growth of these mutant strains in the presence of arabinose leads
to transcription of the fur and crp nucleic acid sequences but
nucleic acid sequence expression ceases in the absence of
arabinose. Since free arabinose is not found in mammalian tissues,
the arabinose-regulated fur and crp nucleic acid sequences will not
be expressed.
Expression of rPspA in Salmonella.
[0396] The recombinant plasmid pYA3634 (pBR ori) was constructed
for the periplasmic secretion of the .alpha.-helical region of the
PspARx1 (8) (Table 2). Plasmid pYA3493 (vector control) and pYA3634
(encoding .beta.-lactamase (bla) SS-pspA) were electroporated into
S. Typhimurium strains .chi.8133, .chi.9088 and .chi.9558. The RASV
electroporants containing pYA3634 expressed a protein with an
approximate molecular mass of 37 kDa, the expected size of the Bla
SS-PspA fusion protein encoded by pYA3634, that reacts specifically
with an anti-PspA polyclonal antibody (FIG. 32). Plasmid stability
was evaluated as described in the Material and Methods. Plasmids
were maintained and protein expression was shown to be stable when
strains were grown in the presence of DAP for 50 nucleic acid
sequencerations.
Antibody Responses in Mice after Oral Immunization with the
Recombinant S. enterica Serovar Typhimurium Vaccines.
[0397] A dose of RASV .chi.8133 (pYA3634) (1.9.times.10.sup.9 CFU),
.chi.9088(pYA3634) (1.7.times.10.sup.9 CFU), .chi.9558(pYA3634)
(1.5.times.10.sup.9 CFU), .chi.8133(pYA3493) (1.8.times.10.sup.9
CFU), .chi.9088(pYA3493) (2.0.times.10.sup.9 CFU) or .chi.9558
(pYA3493) (1.5.times.10.sup.9 CFU/mouse) was orally administered to
7-week-old female BALB/c mice. Mice were boosted with the same dose
of the same strain eight weeks later. All immunized mice survived,
and no signs of disease were observed in the immunized mice during
the entire experimental period. The antibody responses to
Salmonella LPS, SOMPs and rPspA in the sera of immunized mice were
measured (FIG. 33). High serum IgG titers against all antigens,
including PspA, were observed by 2 weeks after the primary
immunization. The maximum preboost anti-LPS, -SOMP, and -rPspA IgG
levels were detected by 6 weeks post immunization. The serum
anti-rPspA IgG antibody levels of .chi.9558 (pYA3634) and
.chi.9088(pYA3634) immunized mice were significantly higher than
the levels in .chi.8133(pYA3634) immunized mice (p<0.01,
p<0.05).
IgG Isotype Analyses
[0398] The types of immune responses to rPspA were further examined
by measuring the levels of IgG isotype subclasses IgG1 and IgG2a
(FIG. 34). The Th1-helper cells direct cell-mediated immunity and
promote class switching to IgG2a, and Th2 cells provide potent help
for B-cell antibody production and promote class switching to IgG1
(23, 24). Th1-type dominant immune responses are frequently
observed after immunization with attenuated Salmonella (25-27). A
Th1- and Th2-type mixed response was observed for the rPspA
antigen. Although the IgG1 levels were almost the same as IgG2a
levels in the early phase, the level of anti-rPspA IgG2a isotype
antibodies gradually increased after boosting at 8 weeks. After 12
weeks postimmunization, the ratios of IgG1: IgG2a are 1:8.3 for
.chi.8133(pYA3634) immunized mice, 1:9.4 for .chi.9088 (pYA3634)
immunized mice and 1:1.5 for .chi.9558 (pYA3634) immunized mice.
The serum anti-rPspA IgG1 and IgG2a antibody levels of
.chi.9558(pYA3634) and .chi.9088 (pYA3634) immunized mice are both
significantly higher than those of the .chi.8133(pYA3634) immunized
mice (p<0.01) (FIG. 34).
Antigen-Specific Stimulation of IL-4 or IFN-g Production.
[0399] ELISPOT was used to compare PspA antigen stimulation of IL-4
or IFN-g production by cells from spleens of immunized control mice
(FIG. 35). Spleen lymphocytes from .chi.9088 (pYA3634) immunized
mice had (114.0.+-.28.8) antigen specific IL-4 secreting cells per
10.sup.6 cells and (315.9.+-.31.5) antigen specific IFN-g secreting
cells per 10.sup.6 cells which were both significantly higher than
those of the spleen lymphocytes from .chi.8133(pYA3634) immunized
mice (p<0.001) The spleen lymphocytes from .chi.9558 (pYA3634)
immunized mice had (108.1.+-.90.25) antigen specific IL-4 secreting
cells per 10.sup.6 cells and (280.1.+-.47.10) antigen specific
IFN-g secreting cells per 10.sup.6 cells which were also
significantly higher than those of the spleen lymphocytes from
.chi.8133(pYA3634) immunized mice (p<0.001).
Status of Systemic Cytokine Environment.
[0400] At 2 weeks after immunization, sera from each group of mice
were subjected to Bio-Plex analyses. The secretion profiles were
compared (Table 10). The sera from .chi.8133(pYA3634),
.chi.9088(pYA3634), .chi.9558(pYA3634) immunized mice have
increased levels of cytokine concentrations compared with the BSG
control group (p<0.01). .chi.9558(pYA3634) immunized mice have
an increased level of cytokines including both Th1 and Th2
cytokines compared with the .chi.8133(pYA3634) group (p<0.05),
which suggested that the RASV strains caused mixed Th1 and Th2
responses and our regulated delayed attenuation strain
.chi.9558(pYA3634) stimulated stronger cellular immunity and
cytokine secretion than .chi.8133(pYA3634), which will facilitate
antigen presentation and activation of T and B cells.
TABLE-US-00011 TABLE 10 S. Typhimurium vaccine strains with
regulated delayed attenuation stimulate higher systemic cytokine
production. Mouse Cytokines concentrations (pg/ml) groups IL-2 IL-4
IL-5 IL-10 IL-12 GM-CSF TNF-.alpha. BSG 6.5 .+-. 0.71 13.4 .+-.
1.27 8.5 .+-. 1.41 7.8 .+-. 1.06 15.0 .+-. 0.71 12.5 .+-. 1.41 9.9
.+-. 0.14 .chi. 8133 7.3 .+-. 0.35 18.3 .+-. 0.35 10.2 .+-. 1.20
8.5 .+-. 0.00 17.7 .+-. 0.92 13.8 .+-. 1.06 11.3 .+-. 0.35
(pYA3493) .chi. 8133 ** 12.0 .+-. 1.27 27.7 .+-. 5.44 21.8 .+-.
3.89 21.7 .+-. 3.04 42.3 .+-. 9.55 28.0 .+-. 2.12 32.3 .+-. 3.18
(pYA3634) .chi. 9088 9.5 .+-. 0.00 27.4 .+-. 1.56 17.0 .+-. 0.00
14.0 .+-. 1.41 29.9 .+-. 3.39 20.9 .+-. 0.57 18.8 .+-. 1.77
(pYA3493) .chi.9088 ** 11.5 .+-. 0.71 37.3 .+-. 1.41 24.5 .+-. 2.12
22.5 .+-. 0.71 49.7 .+-. 1.20 31.7 .+-. 3.75 31.0 .+-. 2.12
(pYA3634) .chi.9558 11.8 .+-. 0.35 34.8 .+-. 1.06 30.5 .+-. 2.12
25.8 .+-. 1.06 53.3 .+-. 1.41 39.2 .+-. 1.02 37.8 .+-. 1.06
(pYA3493) .chi.9558 ** .sup.# 15.0 .+-. 1.41 46.3 .+-. 1.06 32.0
.+-. 1.41 26.5 .+-. 1.48 59.0 .+-. 8.13 39.8 .+-. 7.78 39.7 .+-.
3.32 (pYA3634) ** Compared with BSG group of mice all three vaccine
strains stimulate significant higher systemic cytokine production p
< 0.01. .sup.# Compared with .chi.8133(pYA3634) group of mice,
.chi.9558(pYA3634) group of mice stimulate significantly higher
systemic cytokine production p < 0.05.
Evaluation of Protective Immunity.
[0401] To examine the ability of Salmonella-rPspA vaccines to
protect against pneumococcal infection, mice were challenged
intraperitoneally with 5.times.10.sup.4 CFU (250 times the
LD.sub.50) of S. pneumoniae WU2 four weeks after they were boosted.
Eighty-six percent of the mice immunized with .chi.9088(pYA3634),
seventy-one percent of the mice immunized with .chi.9558 (pYA3634),
and twenty-nine percent of the mice immunized with
.chi.8133(pYA3634) were protected from pneumococcal challenge, with
statistical significance (p<0.01). This challenge dose killed
100% of the non-immunized, and .chi.8133(pYA3493), .chi.9088
(pYA3493) and .chi.9558 (pYA3493) immunized mice (Table 11).
Following challenge, non-immunized mice, and mice immunized with
.chi.8133(pYA3493) or .chi.9088 (pYA3493) or .chi.9558 (pYA3493)
died rapidly.
TABLE-US-00012 TABLE 11 Oral immunization with PspA-expressing
Salmonella strains protects BALB/c mice against i.p. challenge with
5 .times. 10.sup.4 CFU of capsular type 3 S. pneumoniae WU2 Number
of Protec- PspA chal- tion Vaccine expres- lenged rate strain.sup.a
sion.sup.b mice Days to death.sup.c (%) BSG NA 10 2, 2, 2, 2, 2, 2,
2, 2, 3, 3 0 .chi.8133(pYA3493) - 10 2, 2, 2, 2, 2, 2, 2, 2, 2, 2 0
.chi.9088(pYA3493) - 10 2, 2, 2, 2, 2, 2, 2, 2, 2, 3 0
.chi.9558(pYA3493) - 10 2, 2, 2, 2, 2, 2, 2, 2, 2, 3 0
.chi.8133(pYA3634) + 14 2, 2, 2, 2, 2, 2, 2, 2, 3, 3, 21 3, >15,
>15, >15 .chi.9088(pYA3634) + 14 2, 3, >15, >15,
>15, >15, 86* >15, >15, >15, >15, >15, >15,
>15, >15 .chi.9558(pYA3634) + 14 2, 2, 3, 3, >15, >15,
>15, .sup. 71 .sup.# >15, >15, >15, >15, >15,
>15, >15 .sup.aMice were orally immunized twice at 8-weeks
intervals with the indicated vaccine strains. .sup.b+, PspA
expressed; -, PspA not expressed; NA, not applicable. .sup.cFour
weeks after the second oral immunization, mice were challenged in
two experiments with approximately 5 .times. 10.sup.4 CFU of S.
pneumoniae WU2. Both experiments gave similar results, and the data
have been pooled for presentation and analysis. The LD.sub.50 of
WU2 in nonimmunized BALB/c mice is 2 .times. 10.sup.2 (data not
shown). *p < 0.001 versus survival of mice immunized with the
.chi.8133(pYA3634); .sup.# p = 0.001 versus survival of mice
immunized with the .chi.8133(pYA3634).
Passive-Immunization Studies.
[0402] A passive-immunization study was conducted to evaluate the
roles of antibody and T-cell mediated immunity afforded by
immunization of mice with the recombinant attenuated Salmonella
vaccines. One hundred microliters of pooled sera, spleen
lymphocytes (1.times.10.sup.7) or purified CD4+ T cells
(5.times.10.sup.6) taken from immunized mice or controls were
administered by tail vein injection into groups of 5 naive mice.
This was followed 12 hours later by intraperitoneal challenge with
5.times.10.sup.4 CFU WU2. Mice receiving sera or cells transferred
from .chi.8133(pYA3493), .chi.9088(pYA3493), .chi.9558(pYA3493) or
BSG immunized mice died with a mean time of 2 days (Table 12). The
sera transferred from both .chi.9088 (pYA3634) immunized mice and
.chi.9558(pYA3634) immunized mice protected all 5 naive mice from
challenge; while the sera transferred from .chi.8133(pYA3634)
immunized mice protected 4 mice from challenge, the other mouse
died 4 days after challenge. Passive transfer of spleen lymphocytes
from .chi.9088 (pYA3634) immunized mice protected all 5 naive mice
from challenge; spleen lymphocytes from .chi.9558 (pYA3634)
immunized mice protected 3 out of 5 mice from challenge; while the
spleen cell transfer from .chi.8133(pYA3634) immunized mice showed
no protection. All the mice receiving CD4+ T cells from any group
of immunized mice all died in 2 or 3 days (Table 12).
TABLE-US-00013 TABLE 12 Passive transfer of pneumococcal immunity
by serum or lymphocytes from donors immunized with PspA Salmonella
vaccines % survival of recipients of .sup.b Vaccine strain used to
Pooled Spleen Purified CD.sub.4.sup.+ T immunize donors.sup.a
serum.sup.c cells.sup.d cells.sup.e BSG 0 0 0 .chi.8133(pYA3493) 0
0 0 .chi.9088(pYA3493) 0 0 0 .chi.9558(pYA3493) 0 0 0
.chi.8133(pYA3634) 80 0 0 .chi.9088(pYA3634) 100 100* 0
.chi.9558(pYA3634) 100 60.sup.# 0 .sup.aMice were orally immunized
at day 0 and boosted 8 weeks later with the indicated vaccine
strains. Serum and cells were collected 4 weeks after boosting and
transferred to groups of 5 naive mice. .sup.b All recipient mice
were challenged by i.p with 5 .times. 10.sup.4 CFU WU2 at 12 h
after transfer. Survival was calculated 15 days postchallenge.
.sup.c0.1 ml of serum intravenously. .sup.d1 .times. 10.sup.7
viable spleen cells intravenously. .sup.e5 .times. 10.sup.6 viable
CD.sub.4.sup.+ T cells intravenously. *p < 0.001, compared to
groups of mice receiving passive transfer from .chi.8133(pYA3634)
immunized or control donors. .sup.#p = 0.001, compared to groups of
mice receiving passive transfer from .chi.8133(pYA3634) immunized
or control donors.
Isolation of S. pneumoniae from Blood and Histological Examinations
of Challenged Mice.
[0403] Twenty-four hours after intraperitoneal challenge, each
mouse was marked and bled. S. pneumoniae was recovered from the
blood of mice which showed significant signs of weakness and
listlessness and died within 7 days (6833.3.+-.321.5 CFU/ml), but
not from mice that appeared to be healthy and survived past 15 days
(p<0.001). Histological analyses showed severe tissue damage to
the lung tissue in mice that died after challenge (FIG. 56). Gross
visual examination of the lungs of the dead mice from challenge but
not the survivors' lungs showed lobar regions of consolidation and
hemorrhage. Conventional light microscopy of H&E-stained lung
tissue samples of dead mice from challenge demonstrated that S.
pneumoniae caused focal consolidation with extensive mononuclear
and polymorphonuclear infiltration and loss of alveolar structure,
which are characteristic of pneumonia.
Discussion of Example 3
[0404] Few infectious pathogens can match the global impact of
Streptococcus pneumoniae (S. pneumoniae) on illness, complications,
sequelae, health care costs, and death (28). S. pneumoniae is the
most common cause of community-acquired pneumonia, bacterial
meningitis, and acute otitis media (29, 30). The current 23-valent
polysaccharide vaccine has been shown to prevent pneumococcal
pneumonia in immunocompetent young adults, but not in elderly
persons (31). A 7-valent conjugated polysaccharide vaccine is
licensed for use in children. However, the low serotype coverage,
need for repeated doses, and high price, may decrease the
usefulness of the conjugate vaccine, especially in the developing
world (32). Developing an inexpensive, safe and effective vaccine
against this pathogen is still an urgent demand.
[0405] The new regulated delayed attenuation strains
.chi.9088(pYA3634) and .chi.9558(pYA3634) induced stronger immune
responses to PspA as judged by PspA-specific serum antibody levels,
PspA specific lymphocytes cytokine secretion levels, systemic
cytokine secretion levels and protection from virulent S.
pneumoniae challenge. In this example a 10-fold higher challenge
dose of S. pneumoniae WU2 was used compared to earlier studies
(13), while the protection rate increased more than twenty
percent.
[0406] Mixed Th1- and Th2-type immune responses were observed for
rPspA. The mechanisms stimulating these types of immune responses
by the Salmonella-rPspA vaccine remain unknown. Host defense
against encapsulated bacteria, such as S. pneumoniae, depends on
the presence of opsonic antibodies specific for capsular
polysaccharide (33-35). Therefore, antibody levels measured by
ELISA may not adequately reflect the presence of protective
antibodies that are capable of triggering leukocyte effector
functions (36). Other investigators have suggested that IgG2a is
protective during infection with encapsulated bacteria, including
pneumococcal infection (36-38). It is possible that under
conditions of limiting expression of antibody, in the mouse, IgG2a
is highly effective at fixing complement and promoting
opsonophagocytosis (39). It is consistent with our result that
after boosting, IgG2a becomes the dominant antibody type. Some
investigators reported that CD4.sup.+ T cells are very important
for the protection against virulent S. pneumoniae challenge
(40-41). Our results showed that CD4.sup.+ T cells from both groups
of immunized mice did not confer protection. It might be that for
our Salmonella-rPspA vaccines, PspA specific antibodies are the
most important factors in protection. T cells are important in
helping the production of effective antibodies (23, 42, 43), but T
cells themselves did not have the ability to protect, at least in
this experiment.
[0407] All the control mice challenged intraperitoneally with S.
pneumoniae WU2 died of septicemia. In surviving mice from the
immunized group no bacteria were recovered from blood and also no
signs of lung damage were detected, indicating that these vaccines
can protect mice from both fatal bacteremia and the pneumonia
caused by S. pneumoniae.
[0408] Although .chi.9558(pYA3436) possesses the
.DELTA.relA198::araC P.sub.BAD lacI TT deletion-insertion mutation
to provide regulated delayed synthesis of the PspA antigen, this
feature did not show any benefit to the level of immunogenicity
over that induced by .chi.9088 that does not have this attribute
that was shown to be highly beneficial in Example 1. There are two
probable reasons for this. First, the segment of the Rx1 PspA
specified by pYA3634 is shorter and less stressful on recombinant
Salmonella than the Rx1 PspA specified by the codon optimized
sequence in pYA4088 used in the studies reported in Example 1.
Second, .chi.9558 possesses some 10 genetic alterations and has a
genotype almost identical to S. Typhi candidate vaccine strains
that will soon be evaluated in human volunteers. This is in
contrast to the presence of only four genetic alterations in
.chi.9088. The additional mutations in .chi.9558 are present to
render it safe for newborn mice and thus probably result in some
degree of overattenuation to reduce immunogenicity. Nevertheless,
these constructions are important to evaluate since the historical
fact is that almost all single mutations that render S. Typhimurium
totally avirulent and highly immunogenic in mice when introduced
into S. Typhi strains and tested in humans are still partially
virulent and cause disease. It will thus be important to evaluate
isogenic strains that only differ by the presence or absence of the
.DELTA.relA198::araC P.sub.BAD lacI TT deletion-insertion mutation.
Nevertheless, .chi.9558(pYA3436) was still far superior to
.chi.8133(pYA3634) in regard to immunogenicity and in inducing
protective immunity to pneumococcal challenge.
[0409] In conclusion, the results of this example demonstrated that
the Salmonella vaccine strains .chi.9088(pYA3436) and
.chi.9558(pYA3436) featuring the novel regulated delayed in vivo
attenuation system are superior not only in inducing PspA specific
antibody responses but also in eliciting cellular immunity and
cytokine secretion resulting in significant protection of mice
against pneumococcal challenge.
REFERENCES FOR EXAMPLE 3
[0410] 1. Kwon Y M, Cox M M, & Calhoun L N (2007)
Salmonella-based vaccines for infectious diseases. Expert Review of
Vaccines 6: 147-152. [0411] 2. Medina E & Guzman C A (2001) Use
of live bacterial vaccine vectors for antigen delivery: potential
and limitations. Vaccine 19: 1573-1580. [0412] 3. Raupach B &
Kaufmann S H E (2001) Bacterial virulence, proinflammatory
cytokines and host immunity: how to choose the appropriate
Salmonella vaccine strain? Microbes and Infection 3: 1261. [0413]
4. Dunstan S J, Simmons C P, & Strugnell R A (1998) Comparison
of the Abilities of Different Attenuated Salmonella Typhimurium
Strains To Elicit Humoral Immune Responses against a Heterologous
Antigen. Infect. Immun. 66: 732-740. [0414] 5. Garmory H S, Leary S
E C, Griffin K F, Williamson E D, Brown K A, & Titball R W
(2003) The Use of Live Attenuated Bacteria as a Delivery System for
Heterologous Antigens. Journal of Drug Targeting 11: 471. [0415] 6.
Hohmann E L, Oletta C A, & Miller S I (1996) Evaluation of a
phoP/phoQ-deleted, aroA-deleted live oral Salmonella typhi vaccine
strain in human volunteers. Vaccine 14: 19-24. [0416] 7. Tacket C
O, Kelly S M, Schodel F, Losonsky G, Nataro J P, Edelman R, Levine
M M, & Curtiss R, III (1997) Safety and immunogenicity in
humans of an attenuated Salmonella typhi vaccine vector strain
expressing plasmid-encoded hepatitis B antigens stabilized by the
asd-balanced lethal vector system. Infect Immun 65: 3381-3385.
[0417] 8. Curtiss R, Ill, Zhang X, Wanda S Y, Kang H Y, Konjufca V,
Li Y, Gunn B, Wang S, Scarpellini G, & Lee. IS (2007) in
Virulence Mechanisms of Bacterial Pathogens, ed. K. A. Brogden F C
M, N. Cornick, T. B. Stanton, Q. Zhang, L. K. Nolan, and M. J.
Wannemuehler (ASM Press, Washington D.C.), pp. 297-313. [0418] 9.
McDaniel L S, Yother J, Vijayakumar M, McGarry L, Guild W R, &
Briles D E (1987) Use of insertional inactivation to facilitate
studies of biological properties of pneumococcal surface protein A
(PspA). J. Exp. Med. 165: 381-394. [0419] 10. Ogunniyi A D,
LeMessurier K S, Graham R M A, Watt J M, Briles D E, Stroeher U H,
& Paton J C (2007) Contributions of Pneumolysin, Pneumococcal
Surface Protein A (PspA), and PspC to Pathogenicity of
Streptococcus pneumoniae D39 in a Mouse Model. Infect. Immun. 75:
1843-1851. [0420] 11. Moore Q C, Bosarge J R, Quin L R, &
McDaniel L S (2006) Enhanced protective immunity against
pneumococcal infection with PspA DNA and protein. Vaccine 24: 5755.
[0421] 12. Briles D E, King J D, Gray M A, McDaniel L S, Swiatlo E,
& Benton K A (1996) PspA, a protection-eliciting pneumococcal
protein: immunogenicity of isolated native PspA in mice. Vaccine
14: 858-867. [0422] 13. Kang H Y, Srinivasan J, & Curtiss R,
III (2002) Immune Responses to Recombinant Pneumococcal PspA
Antigen Delivered by Live Attenuated Salmonella enterica Serovar
Typhimurium Vaccine. Infect. Immun. 70: 1739-1749. [0423] 14.
Bertani G (1951) STUDIES ON LYSOGENESIS. I. The Mode of Phage
Liberation by Lysogenic Escherichia coli. J. Bacteriol. 62:
293-300. [0424] 15. Nakayama K, Kelly S M, & Curtiss R, III
(1988) Construction of an asd+ Expression-Cloning Vector: Stable
Maintenance and High Level Expression of Cloned Genes in a
Salmonella Vaccine Strain. 6: 693-697. [0425] 16. Schwyn B &
Neilands J B (1987) Universal chemical assay for the detection and
determination of siderophores. Analytical Biochemistry 160: 47.
[0426] 17. Hitchcock P J & Brown T.sub.M (1983) Morphological
heterogeneity among Salmonella lipopolysaccharide chemotypes in
silver-stained polyacrylamide gels. J. Bacteriol. 154: 269-277.
[0427] 18. Konjufca V, Wanda S-Y, Jenkins M C, & Curtiss R, III
(2006) A Recombinant Attenuated Salmonella enterica Serovar
Typhimurium Vaccine Encoding Eimeria acervulina Antigen Offers
Protection against E. acervulina Challenge. Infect. Immun. 74:
6785-6796. [0428] 19. Nabors G S, Braun P A, Herrmann D J, Heise M
L, Pyle D J, Gravenstein S, Schilling M, Ferguson L M, Hollingshead
S K, Briles D E, et al. (2000) Immunization of healthy adults with
a single recombinant pneumococcal surface protein A (PspA) variant
stimulates broadly cross-reactive antibodies to heterologous PspA
molecules. Vaccine 18: 1743. [0429] 20. Sedgwick J D & Holt P G
(1983) A solid-phase immunoenzymatic technique for the enumeration
of specific antibody-secreting cells. Journal of Immunological
Methods 57: 301. [0430] 21. Nayak A R, Tinge S A, Tart R C,
McDaniel L S, Briles D E, & Curtiss R, III (1998) A Live
Recombinant Avirulent Oral Salmonella Vaccine Expressing
Pneumococcal Surface Protein A Induces Protective Responses against
Streptococcus pneumoniae. Infect. Immun. 66: 3744-3751. [0431] 22.
Collins L V, Attridge S, & Hackett J (1991) Mutations at rfc or
pmi attenuate Salmonella Typhimurium virulence for mice. Infect.
Immun. 59: 1079-1085. [0432] 23. DeKruyff R H, Rizzo L V, &
Umetsu D T (1993) Induction of immunoglobulin synthesis by CD4+ T
cell clones. Seminars in Immunology 5: 421-430. [0433] 24. Gor D O,
Rose N R, & Greenspan N S (2003) TH1-TH2: a Procrustean
paradigm. Nat Immunol 4: 503. [0434] 25. Pascual D W, Hone D M,
Hall S, van Ginkel F W, Yamamoto M, Walters N, Fujihashi K, Powell
R J, Wu S, Vancott J L, et al. (1999) Expression of Recombinant
Enterotoxigenic Escherichia coli Colonization Factor Antigen I by
Salmonella Typhimurium Elicits a Biphasic T Helper Cell Response.
Infect. Immun. 67: 6249-6256. [0435] 26. Pashine A, John B, Rath S,
George A, & Bal V (1999) Th1 dominance in the immune response
to live Salmonella Typhimurium requires bacterial invasiveness but
not persistence. Int. Immunol. 11: 481-489. [0436] 27. Ramarathinam
L, Niesel D W, & Klimpel G R (1993) Salmonella Typhimurium
induces IFN-gamma production in murine splenocytes. Role of natural
killer cells and macrophages. J Immunol 150: 3973-3981. [0437] 28.
Greenwood B (1999) The epidemiology of pneumococcal infection in
children in the developing world. Philos Trans R Soc Lond B Biol
Sci 354: 777-785. [0438] 29. Del Beccaro M A, Mendelman P M, Inglis
A F, Richardson M A, Duncan N O, Clausen C R, & Stull T L
(1992) Bacteriology of acute otitis media: a new perspective. J
Pediatr 120: 81-84. [0439] 30. Schuchat A, Robinson K, Wenger J D,
Harrison L H, Farley M, Reingold A L, Lefkowitz L, & Perkins B
A (1997) Bacterial meningitis in the United States in 1995. Active
Surveillance Team. N Engl J Med 337: 970-976. [0440] 31. Ortqvist
A, Hedlund J, Burman L A, Elbel E, Hofer M, Leinonen M, Lindblad I,
Sundelof B, & Kalin M (1998) Randomised trial of 23-valent
pneumococcal capsular polysaccharide vaccine in prevention of
pneumonia in middle-aged and elderly people. Swedish Pneumococcal
Vaccination Study Group. Lancet 351: 399-403. [0441] 32. Hicks L A,
Harrison L H, Flannery B, Hadler J L, Schaffner W, Craig A S,
Jackson D, Thomas A, Beall B, Lynfield R, et al. (2007) Incidence
of pneumococcal disease due to non-pneumococcal conjugate vaccine
(PCV7) serotypes in the United States during the era of widespread
PCV7 vaccination, 1998-2004. J Infect Dis 196: 1346-1354. [0442]
33. Alonso De Velasco E, Dekker B A, Verheul A F, Feldman R G,
Verhoef J, & Snippe H (1995) Anti-polysaccharide immunoglobulin
isotype levels and opsonic activity of antisera: relationships with
protection against Streptococcus pneumoniae infection in mice. J
Infect Dis 172: 562-565. [0443] 34. Matthay K K, Mentzer W C, Wara
D W, Preisler H K, Lameris N B, & Ammann A J (1981) Evaluation
of the opsonic requirements for phagocytosis of Streptococcus
pneumoniae serotypes VII, XIV, and XIX by chemiluminescence assay.
Infect Immun 31: 228-235. [0444] 35. Saeland E, Jakobsen H,
Ingolfsdottir G, Sigurdardottir S T, & Jonsdottir I (2001)
Serum samples from infants vaccinated with a pneumococcal conjugate
vaccine, PncT, protect mice against invasive infection caused by
Streptococcus pneumoniae serotypes 6A and 6B. J Infect Dis 183:
253-260. [0445] 36. Arulanandam B P, Lynch J M, Briles D E,
Hollingshead S, & Metzger D W (2001) Intranasal vaccination
with pneumococcal surface protein A and interleukin-12 augments
antibody-mediated opsonization and protective immunity against
Streptococcus pneumoniae infection. Infect Immun 69: 6718-6724.
[0446] 37. Khan M N, Bansal A, Shukla D, Paliwal P, Sarada S K,
Mustoori S R, & Banerjee P K (2006) Immunogenicity and
protective efficacy of DnaJ (hsp40) of Streptococcus pneumoniae
against lethal infection in mice. Vaccine 24: 6225-6231. [0447] 38.
Lefeber D J, Benaissa-Trouw B, Vliegenthart J F, Kamerling J P,
Jansen W T, Kraaijeveld K, & Snippe H (2003) Th1-directing
adjuvants increase the immunogenicity of oligosaccharide-protein
conjugate vaccines related to Streptococcus pneumoniae type 3.
Infect Immun 71: 6915-6920. [0448] 39. Buchanan R M, Arulanandam B
P, & Metzger D W (1998) IL-12 Enhances Antibody Responses to
T-Independent Polysaccharide Vaccines in the Absence of T and NK
Cells. J Immunol 161: 5525-5533. [0449] 40. Malley R, Trzcinski K,
Srivastava A, Thompson C M, Anderson P W, & Lipsitch M (2005)
CD4+ T cells mediate antibody-independent acquired immunity to
pneumococcal colonization. PNAS 102: 4848-4853. [0450] 41. Van
Rossum A M, Lysenko E S, & Weiser J N (2005) Host and bacterial
factors contributing to the clearance of colonization by
Streptococcus pneumoniae in a murine model. Infect Immun 73:
7718-7726. [0451] 42. Wu Z Q, Shen Y, Khan A Q, Chu C L, Riese R,
Chapman H A, Kanagawa O, & Snapper C M (2002) The mechanism
underlying T cell help for induction of an antigen-specific in vivo
humoral immune response to intact Streptococcus pneumoniae is
dependent on the type of antigen. J Immunol 168: 5551-5557. [0452]
43. Snapper C M, Shen Y, Khan A Q, Colino J, Zelazowski P, Mond J
J, Gause W C, & Wu Z Q (2001) Distinct types of T-cell help for
the induction of a humoral immune response to Streptococcus
pneumoniae. Trends Immunol 22: 308-311.
Example 4: Design and Construction of S. Typhi and S. Paratyphi A
Vaccine Strains with Regulated Delayed Attenuation and Regulated
Delayed Synthesis of Plasmid Encoded Protective Antigens
[0453] Attenuated mutants of Salmonella enterica serovar Typhi (S.
Typhi) and Salmonella enterica serovar Typhimurium (S. Typhimurium)
have been extensively studied as multivalent vectors expressing
more than 50 different bacterial, viral and protozoan antigens in
preclinical and clinical trials (1-5). Recombinant S. Typhimurium
vaccines (RASVs) administered orally can colonize the
gut-associated lymphoid tissue (GALT) and the secondary lymphatic
tissues, including the liver and spleen, and elicit mucosal,
humoral and cellular immune responses against Salmonella and
heterologous antigens during infection of the mouse (1, 2). There
is also good reason to consider use of attenuated derivatives of S.
Paratyphi A as vaccine vectors since infections with this pathogen
causing enteric fever have been increasing in recent years due to
the cessation in use of the killed TAB vaccine. This has been
contributed to by immunization against S. Typhi by use of the live
Ty21A or conjugate Vi antigen vaccines.
[0454] A number of factors may affect the immune response to
protective antigens including the ability of vaccine strains to
invade and colonize the host GALT, the stability of the plasmid
expression system and the antigen sub-cellular location (1, 2, 6).
High-level expression of protective antigens by RASV strains often
impose an energy demand that decreases the growth, fitness and
ability to colonize lymphoid tissues resulting in further
attenuation and a reduction in immunogenicity (2, 7, 8). Means have
been developed, such as regulated delayed in vivo antigen synthesis
(Example 1), to enhance the ability of vaccine strains to
efficiently invade and colonize GALT after oral immunization
(7-10). Another strategy to improve the immune response is to
construct strains with regulated delayed in vivo attenuation such
that vaccine strains are better able to withstand the stresses and
host defence means that generally reduce survival especially of
attenuated vaccine strains. We have addressed this problem by
developing means for regulated delayed in vivo attenuations such
that vaccine strains are more able to survive these host induced
stresses and behave more like wild-type infectious Salmonella
pathogens at the time of immunization. Thus, the combined use of
regulated delayed in vivo attenuation and regulated delayed in vivo
synthesis of protective antigens both afford means for the RASV to
more efficiently colonize to a higher vaccine cell density effector
lymphoid tissues to enhance induction of effective protective
immunity.
[0455] We have thus constructed S. Typhimurium strains to evaluate
in mice with a constellation of mutations to not only provide
regulated delayed in vivo attenuation and regulated delayed in vivo
synthesis of plasmid-specified protective antigens but to also
provide inability to establish persistent carrier states, inability
to induce fluid secretion in the intestine, and engender safety for
newborns. S. Typhimurium UK-1 strains with each of the mutations
present in some of these strains and not presented in detail in
Examples 1 and 2 are listed in Table 13 along with data from
infection of female BALB/c mice to indicate the contributions of
these mutations to the level of virulence/attenuation. The suicide
vectors used to introduce these mutations into Salmonella strains
are listed in Table 2 and the methods for these constructions are
given in Examples 1 and 2.
TABLE-US-00014 TABLE 13 Virulence of S. Typhimurium UK-1 mutants
with single deletion or deletion-insertion mutations CFU/ Survival/
Strain Genotype dose total .chi.3761 Wild-type UK-1 4.7 .times.
10.sup.8 0/5 4.7 .times. 10.sup.7 0/5 4.7 .times. 10.sup.5 0/5 4.7
.times. 10.sup.4 0/5 4.7 .times. 10.sup.3 3/5 .chi.3761 Wild-type
UK-1 1.0 .times. 10.sup.6 0/5 1.0 .times. 10.sup.5 0/5 1.0 .times.
10.sup.4 4/5 1.0 .times. 10.sup.3 5/5 .chi.8767 .DELTA.araBAD23 1.9
.times. 10.sup.5 1/5 UK-1 1.9 .times. 10.sup.4 1/5 1.9 .times.
10.sup.3 5/5 .chi.8477 .DELTA.araE25 1.1 .times. 10.sup.8 0/4 UK-1
1.1 .times. 10.sup.7 1/4 1.1 .times. 10.sup.6 1/4 1.1 .times.
10.sup.5 2/4 .chi.8276 .DELTA.asdA16 6.0 .times. 10.sup.8 5/5 UK-1
9.8 .times. 10.sup.8 4/4 .chi.8960 .DELTA.asdA18::TT araC P.sub.BAD
c2 5.5 .times. 10.sup.8 5/5 UK-1 .chi.8289 .DELTA.asdA19::TT araC
P.sub.BADc2 1.0 .times. 10.sup.9 4/4 UK-1 .chi.8958 .DELTA.asdA33
6.4 .times. 10.sup.8 5/5 UK-1 .chi.8844 .DELTA.endA2311 8.6 .times.
10.sup.6 0/4 UK-1 8.6 .times. 10.sup.5 2/4 8.6 .times. 10.sup.4 2/2
.chi.8844 .DELTA.endA2311 3.0 .times. 10.sup.5 0/2 UK-1 3.0 .times.
10.sup.4 1/2 .chi.8989 .DELTA.endA19::araC P.sub.BAD lacI TT 1.0
.times. 10.sup.6 0/5 UK-1 1.0 .times. 10.sup.5 2/5 1.0 .times.
10.sup.4 2/5 .chi.8831 .DELTA.(gmd-fcl)-26 5.9 .times. 10.sup.5 1/4
UK-1 5.9 .times. 10.sup.4 4/4 5.9 .times. 10.sup.3 4/4 5.9 .times.
10.sup.2 4/4 .chi.8831 .DELTA.(gmd-fcl)-26 8.6 .times. 10.sup.6 0/4
UK-1 8.6 .times. 10.sup.5 0/4 8.6 .times. 10.sup.4 0/4 8.6 .times.
10.sup.3 1/4 .chi.8650 .DELTA.pmi-2426 1.7 .times. 10.sup.9 8/8
UK-1 1.7 .times. 10.sup.8 8/8 Nutrient Broth 1.7 .times. 10.sup.7
7/8 1.7 .times. 10.sup.6 4/4 1.7 .times. 10.sup.5 4/4 .chi.8650
.DELTA.pmi-2426 1.5 .times. 10.sup.9 3/8 UK-1 1.5 .times. 10.sup.8
7/8 Nutrient Broth + 1.5 .times. 10.sup.7 7/8 0.5% mannose + 1.5
.times. 10.sup.6 4/4 0.5% glucose 1.5 .times. 10.sup.5 4/4
.chi.8882 .DELTA.relA1123 8.0 .times. 10.sup.7 0/4 UK-1 8.0 .times.
10.sup.6 1/5 8.0 .times. 10.sup.5 1/4 8.0 .times. 10.sup.4 3/4 8.0
.times. 10.sup.3 4/4 .chi.8990 .DELTA.relA196::araC P.sub.BAD lacI
TT 1.0 .times. 10.sup.5 1/5 UK-1 1.0 .times. 10.sup.4 4/5 1.0
.times. 10.sup.3 5/5 .chi.8923 .DELTA.sopB1925 1.2 .times. 10.sup.7
1/5 UK-1 1.2 .times. 10.sup.6 2/5 1.2 .times. 10.sup.5 5/5 1.2
.times. 10.sup.4 5/5
[0456] Strain .chi.9558 .DELTA.pmi-2426 .DELTA.(gmd-fcl)-26
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur .DELTA.P.sub.crp527::TT
araC P.sub.BAD crp .DELTA.asdA27::TT araC P.sub.BAD c2
.DELTA.araE25 .DELTA.araBAD23 .DELTA.relA198::araC P.sub.BAD lacI
TT .DELTA.sopB1925 .DELTA.agfBAC811 was used in Example 3 to
deliver heterologous antigens such as the S. pneumoniae
.alpha.-helical domain of the Rx1 PspA antigen encoded by pYA3634
either secreted into the extra-cellular environment or displayed on
the vaccine carrier surface. Such approaches are based on
observations that antigens localized on the surface of Salmonella
cells or extracellularly secreted produce greater immune responses
and protection (6, 11-13). In addition, secretion of heterologous
antigens by RASV may decrease the toxicity of the protein to the
bacterial vector, facilitate bacterial growth and antigen uptake by
antigen-presenting cells (APC) and continuously stimulate the host
immune system during the colonization of lymphatic tissues by
Salmonella, so as to enhance the immune response against the
heterologous antigens (5, 14).
[0457] Streptococcus pneumoniae, a gram-positive human pathogen,
causes serious health problems, including community-acquired
pneumonia, otitis media, meningitis, and bacteremia in persons of
all ages. S. pneumoniae is a leading agent of childhood pneumonia
worldwide, resulting in about 3 million deaths per year (15). The
pneumococcal surface protein A (PspA) and pneumococcal surface
protein C (PspC) have been considered as pneumococcal subunit
vaccine candidates. PspA and PspC/Hic are expressed in all
clinically isolated pneumococcal strains (16-18). Immune responses
to PspA and PspC can protect mice against virulent S. pneumoniae
challenge (6, 17, 19-23).
[0458] Toward this end of making a suitable vaccine to prevent
pneumococcal disease in newborns and infants, we have introduced
the improved Asd.sup.+ vector pYA4088 (Example 1) that expresses at
high level the longer Rx1 PspA specified by a codon-optimized
sequence into .chi.9558. In addition to repeating the
immunogenicity and protection studies described in Example 3 with
superior results, we have demonstrated that this recombinant strain
can be orally administered to newborn mice only a few hours old at
doses of 10.sup.8 CFU or more with no deaths, disease symptoms or
impairment in growth. Furthermore, when the .chi.9558(pYA4088)
strain is inoculated intranasally into six-week old BALB/c mice,
there is no colonization of the olfactory lobe or brain and no
development of meningitis as found after intranasal inoculation of
other Salmonella strains.
[0459] Based on the above successes, we have generated S. Typhi
vaccine vectors as listed in Table 1 that have most all of the
mutations present in .chi.9558. Since there has been a lack of
success of recombinant attenuated S. Typhi vaccines derived from
the widely used Ty2 strain, we have generated recombinant strains
that have the rpoS mutation in the Ty2 strain replaced with the
wild-type rpoS allele and have also derived a vaccine strain from
the Chilean clinical isolate ISP1820..quadrature. .chi.9639 is the
S. Typhi Ty2 derived strain that is RpoS.sup.- and has the genotype
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp .DELTA.P.sub.fur81::TT
araC P.sub.BAD fur .DELTA.pmi-2426 .DELTA.(gmd-fcl)-26
.DELTA.sopB1925 .DELTA.relA198::araC P.sub.BAD lacI TT
.DELTA.araE25 .DELTA.tviABCDE10 .DELTA.agfBAC811 .DELTA.asdA33 and
.chi.9640 is the Ty2 RpoS.sup.+ derivative with the identical
genotype as in .chi.9639. .chi.9633 is the S. Typhi ISP1820
derivative is RpoS.sup.+ and has the geneotype
.DELTA.P.sub.crp527::TT araC P.sub.BAD crp .DELTA.P.sub.fur81::TT
araC P.sub.BAD fur .DELTA.pmi-2426 .DELTA.(gmd-fcl)-26
.DELTA.sopB1925 .DELTA.relA198::araC P.sub.BAD lacI TT
.DELTA.araE25 .DELTA.araBAD23 .DELTA.tviABCDE10 .DELTA.agfBAC811
.DELTA.asdA33. .chi.9639 and .chi.9640 do not have the
.DELTA.araBAD23 mutation present in .chi.9633 since the parental
Ty2 strain is already unable to use arabinose for growth or as a
fermentation substrate. All three strains possess the attenuating
.DELTA.tviABCDE10 mutation that eliminates synthesis of the
capsular Vi antigen that is unique to S. Typhi strains and is not
made by S. Typhimurium. The .DELTA.(gmd-fcl)-26 and
.DELTA.agfBAC811 mutations block synthesis of colanic acid and thin
aggregative fimbriae (curli), respectively, that prevent formation
of biofilms and preclude persistent colonization of gallstones in
the gall bladder. The .DELTA.sopB1925 mutation reduces the
potential to induce fluid secretion in the intestinal track and
also eliminates a means by which Salmonella suppresses induction of
immune responses. Thus, this mutation increases the immunogenicity
of these S. Typhi antigen delivery vaccine vectors.
[0460] We have also designed and constructed vaccine vector
derivatives in S. Paratyphi A and note that .chi.9857 (Table 1)
with the genotype .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur .DELTA.pmi-2426
.DELTA.(gmd-fcl)-26 .DELTA.agfBAC811 .DELTA.relA198::araC P.sub.BAD
lacI TT .DELTA.sopB1925 .DELTA.araE25 .DELTA.araBAD23 .DELTA.asdA33
has much the same properties as .chi.9558 and the three S. Typhi
vaccine vectors described above.
REFERENCES FOR EXAMPLE 4
[0461] 1. Curtiss R. III (2005) in Mucosal Immunology, ed. J.
Mestecky M E L, W. Strober, J. Bienenstock, J. R. McGhee, and L.
Mayer (ed) (Academic Press, San Diego). [0462] 2. Curtiss R, III,
Zhang X, Wanda S Y, Kang H Y, Konjufca V, Li Y, Gunn B, Wang S,
Scarpellini G, & Lee. IS (2007) in Virulence Mechanisms of
Bacterial Pathogens, ed. K. A. Brogden F C M, N. Cornick, T. B.
Stanton, Q. Zhang, L. K. Nolan, and M. J. Wannemuehler (ASM Press,
Washington D.C.), pp. 297-313. [0463] 3. Curtiss R, III, Kelly S M,
& Hassan J O (1993) Live oral avirulent Salmonella vaccines.
Vet. Microbiol. 37: 397-405. [0464] 4. Doggett T A & Curtiss R,
III (1992) Delivery of antigens by recombinant avirulent Salmonella
strains. Adv. Exp. Med. Biol. 327: 165-173. [0465] 5. Spreng S,
Dietrich G, & Weidinger G (2006) Rational design of
Salmonella-based vaccination strategies. Methods 38: 133-143.
[0466] 6. Kang H Y & Curtiss R, III, (2003) Immune responses
dependent on antigen location in recombinant attenuated Salmonella
typhimurium vaccines following oral immunization. FEMS Immunol.
Med. Microbiol. 37: 99-104. [0467] 7. Chatfield S N, Charles I G,
Makoff A J, Oxer M D, Dougan G, Pickard D, Slater D, &
Fairweather N F (1992) Use of the nirB promoter to direct the
stable expression of heterologous antigens in Salmonella oral
vaccine strains: development of a single-dose oral tetanus vaccine.
Biotechnology (N Y) 10: 888-892. [0468] 8. Roberts M, Li J, Bacon
A, & Chatfield S (1998) Oral vaccination against tetanus:
comparison of the immunogenicities of Salmonella strains expressing
fragment C from the nirB and htrA promoters. Infect. Immun. 66:
3080-3087. [0469] 9. Curtiss R, Ill, S-Y. Wanda, X. Zhang, B. Gunn.
(2007) Salmonella vaccine vectors displaying regulated delayed in
vivo attenuation to enhance immunogenicity, abstr. E-061, p 278.
Abstr. 107th Gen. Meet. Am. Soc. Microbiol. American Society for
Microbiology, Washington, D.C. [0470] 10. Wang S, Y. Li, G.
Scarpellini, W. Kong, Curtiss R, III (2007) Salmonella vaccine
vectors displaying regulated delayed antigen expression in vivo to
enhance immunogenicity, Abstr. E-064, p 278. Abstr. 107th Gen.
Meet. Am. Soc. Microbiol. American Society for Microbiology,
Washington, D.C. [0471] 11. Kaufmann S H & Hess J (1999) Impact
of intracellular location of and antigen display by intracellular
bacteria: implications for vaccine development. Immunol. Lett. 65:
81-84. [0472] 12. Hess J, Gentschev I, Miko D, Welzel M, Ladel C,
Goebel W, & Kaufmann S H (1996) Superior efficacy of secreted
over somatic antigen display in recombinant Salmonella vaccine
induced protection against listeriosis. Proc. Natl. Acad. Sci. USA
93: 1458-1463. [0473] 13. Hess J, Grode L, Gentschev I, Fensterle
J, Dietrich G, Goebel W, & Kaufmann S H (2000) Secretion of
different listeriolysin cognates by recombinant attenuated
Salmonella typhimurium: superior efficacy of haemolytic over
non-haemolytic constructs after oral vaccination. Microbes Infect.
2: 1799-1806. [0474] 14. Gentschev I, Glaser I, Goebel W, McKeever
D J, Musoke A, & Heussler V T (1998) Delivery of the p67
sporozoite antigen of Theileria parva by using recombinant
Salmonella dublin: secretion of the product enhances specific
antibody responses in cattle. Infect. Immun. 66: 2060-2064. [0475]
15. Greenwood B (1999) The epidemiology of pneumococcal infection
in children in the developing world. Philos. Trans. R. Soc. Lond.
B. Biol. Sci. 354: 777-785. [0476] 16. Iannelli F, Oggioni M R,
& Pozzi G (2002) Allelic variation in the highly polymorphic
locus pspC of Streptococcus pneumoniae. Gene 284: 63-71. [0477] 17.
Brooks-Walter A, Briles D E, & Hollingshead S K (1999) The pspC
gene of Streptococcus pneumoniae encodes a polymorphic protein,
PspC, which elicits cross-reactive antibodies to PspA and provides
immunity to pneumococcal bacteremia. Infect. Immun. 67: 6533-6542.
[0478] 18. Hollingshead S K, Becker R, & Briles D E (2000)
Diversity of PspA: mosaic genes and evidence for past recombination
in Streptococcus pneumoniae. Infect. Immun. 68: 5889-5900. [0479]
19. Briles D E, Hollingshead S K, King J, Swift A, Braun P A, Park
M K, Ferguson L M, Nahm M H, & Nabors G S (2000) Immunization
of humans with recombinant pneumococcal surface protein A (rPspA)
elicits antibodies that passively protect mice from fatal infection
with Streptococcus pneumoniae bearing heterologous PspA. J. Infect.
Dis. 182: 1694-1701. [0480] 20. Briles D E, Hollingshead S K,
Nabors G S, Paton J C, & Brooks-Walter A (2000)
[0481] The potential for using protein vaccines to protect against
otitis media caused by Streptococcus pneumoniae. Vaccine 19 Suppl
1: S87-S95. [0482] 21. Briles D E, King J D, Gray M A, McDaniel L
S, Swiatlo E, & Benton K A (1996) PspA, a protection-eliciting
pneumococcal protein: immunogenicity of isolated native PspA in
mice. Vaccine 14: 858-867. [0483] 22. Kang H Y, Srinivasan J, &
Curtiss R, III, (2002) Immune responses to recombinant pneumococcal
PspA antigen delivered by live attenuated Salmonella enterica
serovar Typhimurium vaccine. Infect. Immun. 70: 1739-1749. [0484]
23. Nayak A R, Tinge S A, Tart R C, McDaniel L S, Briles D E, &
Curtiss R, III, (1998) A live recombinant avirulent oral Salmonella
vaccine expressing pneumococcal surface protein A induces
protective responses against Streptococcus pneumoniae. Infect.
Immun. 66: 3744-3751.
Example 5: Biological Containment
[0485] Live attenuated pathogens such as Salmonella enterica have
been developed as homologous vaccines to protect against Salmonella
infections and as carriers of heterologous antigens because of
their capacity for efficient mucosal antigen delivery (1, 2). A
variety of attenuating mutations and antibiotic-free
balanced-lethal plasmid stabilization systems has been developed
for this purpose (1, 3-5). However, biological containment systems
are required to address the potential risk posed by the
unintentional release of these genetically modified organisms into
the environment, a subject of considerable concern (6, 7). Such
release can lead to unintentional immunizations and the possible
transfer of cloned genes that might represent virulence attributes
in some cases. A number of mutations have been identified in S.
Typhimurium, including shdA, misL and rata, that reduce
environmental shedding in mice without negatively influencing
immunogenicity (8). While these mutations lead to a reduction in
fecal shedding, it is not clear how long these strains will persist
in the environment. Therefore, more effective systems need to be
developed. Our approach has been to develop a biological
containment system that will allow the vaccine strain time to
colonize the host lymphoid tissues, a requirement for inducing a
robust immune response (9, 10) and eventually lead to cell death by
lysis, thus preventing spread of the vaccine strain into the
environment.
[0486] The intracellular location of antigens in a recombinant
attenuated Salmonella vaccine (RASV) can significantly influence
the level of induced immune response upon immunization (11). Thus,
if the antigen is retained in the cytoplasm and must be released by
the actions of the immunized host, the immune response to the
antigen is not as strong as when the antigen is secreted (11, 12).
We hypothesize that the release of an expressed antigen by a RASV
delivery strain within the lymphoid tissues of an immunized animal
by programmed lysis would further enhance the immune response to
the expressed antigen.
[0487] In this example, a RASV programmed bacterial lysis system
vectoring the .beta.-lactamase-PspA fusion protein was constructed.
It was previously shown that this fusion protein is directed to the
periplasm, but only about 10 to 20% is released into the
extracellular environment (13). This new system combines the
features of a previously described antigen expression plasmid with
a novel programmed bacterial lysis system designed to release
antigen into the host tissues to induce an efficacious immune
response and to provide biological containment of the RASV.
Materials and Methods for Example 5
[0488] Bacterial Strains, Plasmids, Media, and Growth
Conditions:
[0489] Bacterial strains and plasmids used in this example are
listed in Tables 1 and 2, respectively. S. Typhimurium strains with
asdA gene deletions were grown at 37.degree. C. in LB broth or on
LB agar (14) supplemented with 50 .mu.g/ml DAP (3). Transformants
containing araC P.sub.BAD asdA murA plasmids were selected on LB
agar plates containing 0.2% arabinose. We used 0.02% arabinose in
LB broth cultures to prevent pH changes in the medium caused by
metabolism of arabinose that may affect the physiology of the
bacterial cells. LB agar containing 5% sucrose, no sodium chloride,
was used for sacB gene-based counterselection in allelic exchange
experiments (15). For mouse inoculation, Salmonella strains were
grown with aeration after inoculated with a 1/20 dilution of a
non-aerated static overnight culture.
[0490] Strain Characterization:
[0491] Vaccine strains were compared with vector controls for
stability of plasmid maintenance, arabinose-dependent growth and
antigen synthesis. Molecular genetic attributes were confirmed by
PCR with appropriate primers. Lipopolysaccharide (LPS) profiles of
Salmonella strains were examined by described methods (16). For
detection of PspA in RASV, 12 .mu.l or 2 .mu.l of cultures at an
OD.sub.600 of 0.8 were subjected to SDS-PAGE or immunoblot
analysis, respectively.
[0492] Construction of a Regulated Programmed Lysis S. Typhimurium
Vaccine Host-Vector System:
[0493] The .DELTA.P.sub.murA7::araC P.sub.BAD murA
deletion-insertion mutation was constructed by standard methods and
introduced into wild-type strain .chi.3761 to yield .chi.8645. The
.DELTA.asdA19::araC P.sub.BAD c2 deletion-insertion mutation was
introduced into .chi.8645 by P22HT int transduction from .chi.8290
(.DELTA.asdA19::TT araC P.sub.BAD c2). As described in Example 4
and presented in Table 13, these two types of mutations render
Salmonella totally avirulent. However, as noted in the Background
to the Invention, the .DELTA.P.sub.murA7::araC P.sub.BAD murA
deletion-insertion mutation represents an example of a mutation
conferring a regulated delayed attenuation phenotype since a strain
with this mutation would be expected to grow and divide a
generation or two before undergoing muramic acid-less death by
lysis. The .DELTA.endA2311, .DELTA.(gmd-fcl)-26 and .DELTA.relA1123
mutations were added sequentially using suicide vectors (see Table
2) resulting in vaccine strain .chi.8937. The presence of mutations
and absence of suicide vector sequences were confirmed by PCR using
suitable primer sets (Table 14). The primers and steps used to
construct plasmids are described as follows. The E. coli B/r araC
P.sub.BAD activator-promoter was derived from pBAD18 (17). The E.
coli K-12 araC P.sub.BAD activator-promoter was PCR amplified using
primers araC-NsiI and EaraBAD-EcoRI from strain .chi.289. The
SD-GTG mutation in pYA3530 was introduced into the asdA gene by
PCR. The ATG-murA gene was amplified by PCR from E. coli K-12
strain .chi.289 (glnV42 .lamda..sup.- T3.sup.r) using primers
EmurA-EcoRI 5' and EmurA-EcoRI 3', then the ATG start codon of the
murA gene was changed to GTG by PCR. The P22 P.sub.R promoter was
derived from plasmid pMEG104. The P.sub.trc-5ST1T2-P.sub.BR ori
fragment came from plasmid pYA3342. The fragment including in-frame
fusion of the rPspA Rx1 (.alpha.-helical region of PspA from amino
acid residue 3 to 257 of mature PspA.sub.Rx1) to the
.beta.-lactamase signal sequence was derived from pYA3634 (18).
Expression of the rPspA Rx1 antigen was verified by SDS-PAGE and
western blot analysis with the anti-PspA monoclonal antibody Xi126
(19).
TABLE-US-00015 TABLE 14 Primers used in this example Primer Name
Sequence A. Construction of plasmid pYA3681 GTG asd GTG cag gaa aaa
aac gct gtg aaa aat gtt gg asd 5' GTG gtc ctt ttt ttg cga cac ttt
tta caa cc asd 3' araC P.sub.BAD GTG asd araC- cga ccc ggg atc gat
ctg tgc ggt att tca SmaI cac cg asd- gca ccc ggg tcg aca gat cct
tgg cgg cga SmaI gaa ag araC* P.sub.BAD (from .chi.289) EaraC- cca
atg cat aat gtg cct gtc aaa tgg NsiI EaraBAD- cgg aat tcg cta gcc
caa aaa aac g EcoRI MurA EmurA- cgg aat tct gag aac aaa cta aat gg
EcoRI 5' EmurA- cgg aat tct tat tcg cct ttc aca cgc EcoRI 3' GTG
murA EMGTGRV- cat gcc atg gag ctc ggt acc cgg gga t NcoI EMGTG- cat
gcc atg gaa ttc tga gaa caa act aag NcoI- tgg ata aat ttc gtg ttc
ag EcoRI P.sub.trc-PBR ori cassette P.sub.trc- agc ttt gtt taa acg
gat ctt ccg gaa gac PmeI ctt cca ttc XbaI- gct cta gac tgt cag acc
aag ttt act cat pBR a Synthetic rrfG TT rrfG aac tgc agt cta gat
tat gcg aaa ggc cat TT cct gac gga tgg cct ttt tgt tta aac gga tcc
gc B. Construction of plasmid pYA3685 NcoI-bla- cat gcc atg ggt att
caa cat ttc cgt gtc PspA gcc ctt att c SmaI-TAA- tcc ccc ggg cta
tta ttc tac att att gtt PspA ttc T C. Construction of suicide
vectors .DELTA.relA1123 relA C- aca tgc atg ccc aga tat ttt cca gat
ctt SphI cac relA C- cgg aat tca ccc cag aca gta atc atg tag EcoRI
cgg relA N- cgg aat tca agg gac cag gcc tac cga ag EcoRI relA N-
cgg gat ccg agg gcg ttc cgg cgc tgg tag BamHI aa
.DELTA.(gmd-fcl)-26 wcaF- gct cta gat cct caa ata gtc ccg tta gg
XbaI wcaF- tcc ccc ggg caa aat att gta tcg ctg g SmaI gmm- gcacgc
atg ctc agg cag gcg taa atc gct SphI ct gmm- cct cta gac aat gtt
ttt acg tca gga aga XbaI tt .DELTA.endA2311 endAN- cgg gat ccg cta
cga aat ccg cct caa c BamHI endAN- ccc aag ctt agc aaa acg agc ccg
caa cg HindIII endAC- ccc aag ctt cct aca cta gcg gga ttc ttg
HindIII endAC- aca tgc atg ccg cag cgc tca gag SphI
[0494] Strain Characterization:
[0495] Vaccine strains were compared with vector controls for
stability of plasmid maintenance, arabinose-dependent growth and
antigen synthesis. Molecular genetic attributes were confirmed by
PCR with appropriate primers. Lipopolysaccharide (LPS) profiles of
Salmonella strains were examined by described methods (16). For
detection of PspA in RASV, 12 .mu.l or 2 .mu.l of cultures at an
OD.sub.600 of 0.8 were subjected to SDS-PAGE or immunoblot
analysis, respectively.
[0496] Examination of Cell Lysis In Vitro:
[0497] Overnight cultures of strains were grown in LB broth
supplemented with 0.002% arabinose. We used 0.002% arabinose to
prevent the accumulation of arabinose within bacterial cells to
allow us to detect cell lysis during the short time frame used for
this experiment. Cultures were diluted 1: 400 into fresh pre-warmed
LB broth supplemented with or without 0.02% arabinose
.beta.-galactosidase activity in supernatant and cell-pellet
fractions were assayed at indicated time points as described
(20).
[0498] Colonization of Mice with the Regulated Programmed Lysis
Salmonella Vaccine Strain:
[0499] Seven-week-old female BALB/c mice (3 mice for each time
point) were deprived of food and water for 4 h before oral
administration of Salmonella vaccine strains. These strains were
grown with aeration in LB broth supplemented with 0.02% arabinose
to an optical density at 600 nm (OD.sub.600) of 0.85 from a
non-aerated static overnight culture. 1.3.times.10.sup.9 CFU of
.chi.8937(pYA3681) in 20 .mu.l of phosphate-buffered saline
containing 0.01% gelatin (BSG) was orally administered to the mice
at the back of the mouth with a pipette tip. Food and water were
returned to the animals 30 to 45 min later. Mice were euthanized at
indicated times and their Peyer's patches, spleens, and livers were
collected aseptically. Tissues were homogenized and plated on LB
agar with 0.2% arabinose to evaluate colonization and persistence,
and onto LB agar plates without arabinose to screen for
arabinose-independent mutants.
[0500] Immunization of Mice:
[0501] Groups of 5 seven-week-old female BALB/c mice were orally
vaccinated with either 1.3.times.10.sup.9 CFU S. Typhimurium
vaccine strain .chi.8937(pYA3685) (expressing rPspA Rx1) or
1.1.times.10.sup.9 CFU host-vector controls .chi.8937(pYA3681) as
described above. A second oral dose of 1.2.times.10.sup.9 CFU
.chi.8937(pYA3685) or 1.1.times.10.sup.9 CFU .chi.8937(pYA3681) was
given one week later. The immunized mice were monitored for 60 days
for evidence of illness by observing them daily for evidence of
diarrhea, ruffled (ungroomed) fur, or irritability. None of these
symptoms of infection were observed in any of the mice. Blood was
collected at weeks 2, 4, 6, 8 after immunization. Serum fractions
were stored at -20.degree. C. Vaginal secretion specimens were
collected by wash with 50 .mu.l BSG, solid material was removed by
centrifugation and secretion samples were stored at -20.degree. C.
(21).
[0502] Antigen Preparation:
[0503] rPspA Rx1 protein and S. Typhimurium SOMPs were purified as
described (13).
[0504] Enzyme Linked Immunosorbent Assay (ELISA):
[0505] The procedures used for detection of antibody have been
described elsewhere (13, 22). Briefly, polystyrene 96-well
flat-bottom microtiter plates (Nunc, Roskilde, Denmark) were coated
with S. Typhimurium SOMPs (100 ng/well) or purified rPspA Rx1 (100
ng/well). Antigens suspended in sodium carbonate-bicarbonate
coating buffer (pH 9.6) were applied with 100 .mu.l volumes in each
well. Vaginal secretions obtained from the same experimental group
were pooled and diluted 1: 10, and sera were diluted 1: 1280 for
detection of IgG and 1: 400 for IgG1 and IgG2a, respectively. A 100
.mu.l volume of diluted sample was added to individual wells in
duplicate. Plates were treated with biotinylated goat anti-mouse
IgG, IgG1, or IgG2a (Southern Biotechnology Inc., Birmingham) for
sera and IgA for vaginal secretions.
[0506] Statistical Analysis:
[0507] Most data were expressed as means.+-.standard error. The
means were evaluated with One-way ANOVA and LSD tests for multiple
comparisons among groups. p<0.05 was considered statistically
significant.
Construction of a Regulated Programmed Lysis System.
[0508] Diaminopimelic acid (DAP) and muramic acid are essential
components of the peptidoglycan layer of the bacterial cell wall
(23). The asdA gene encodes an enzyme essential for DAP synthesis
and the murA gene encodes the first enzyme in muramic acid
synthesis (24, 25). To test the feasibility of an
arabinose-regulated asdA-based lysis system, we introduced the
.DELTA.asdA16 deletion mutation into S. Typhimurium UK-1 resulting
in strain .chi.8276. We then introduced plasmid pYA3450, which
carries the asdA gene with an ATG start codon transcribed from the
P.sub.BAD promoter which is activated by the AraC protein in the
presence of arabinose (26), into .chi.8276 to yield
.chi.8276(pYA3450). However, we found that growth of this strain
was not arabinose-dependent, indicating that the level of residual
transcription from the P.sub.BAD promoter in the absence of
arabinose was sufficient to produce enough Asd for growth. In
addition, .chi.8276(pYA3450) also retained wild-type virulence in
mice. To reduce translational efficiency, we changed the asdA start
codon from ATG to GTG, generating plasmid pYA3530. The GTG start
codon significantly decreased the level of Asd expression (FIG.
37A). However, strain .chi.8276(pYA3530) still exhibited
arabinose-independent growth and did not lyse in media devoid of
arabinose. This problem was overcome by additional modifications
described below, including addition of the murA gene.
[0509] Unlike lethal asdA deletions, which can be overcome by the
addition of DAP to the growth medium, murA deletions, also lethal,
cannot be overcome by nutritional supplements. Therefore, a
conditional-lethal murA mutation was created by replacing the
chromosomal murA promoter with the araC P.sub.BAD
activator-promoter. We introduced the .DELTA.P.sub.murA7::araC
P.sub.BAD murA mutation into wild-type S. Typhimurium resulting in
strain .chi.8645. To evaluate the predicted arabinose-dependent
murA transcription, the strain was inoculated with and without
arabinose into several media containing nutritional components that
are likely to be encountered by a vaccine strain, including 1%
rodent chow, 1% chicken feed or 1% chicken breast meat in minimal
medium (27). As expected, growth was not only dependent on the
presence of arabinose, but bacterial titers dropped in the absence
of arabinose, indicative of cell lysis (FIG. 37B). These results
confirm that the .DELTA.P.sub.murA7::araC P.sub.BAD murA mutation
confers a regulated delayed attenuation phenotype since some growth
was possible prior to onset of death by lysis.
[0510] We combined the asdA and murA systems, providing redundant
mechanisms to ensure cell death. However, as described above, we
first needed to reduce the amount of Asd produced from our plasmid.
The araC P.sub.BAD promoter-activator we used for all the
previously described constructs was derived from an E. coli B/r
strain (17). We discovered that when we substituted the araC
P.sub.BAD promoter-activator from E. coli K-12 strain .chi.289,
transcription from the plasmid was more tightly regulated and
arabinose-dependent growth was achieved. We then inserted a murA
gene in between the P.sub.BAD promoter and the asdA gene to further
decrease the transcription level of asdA. Finally, we introduced
P22 P.sub.R, a C2-regulated promoter, with opposite polarity at the
3' end of the asd gene to interfere with transcription of the
plasmid asdA and murA genes and to direct synthesis of antisense
mRNA to block translation of mRNA transcribed from these genes
during programmed lysis when arabinose is absent. Transcription
terminators (TT) flank all plasmid domains so that expression in
one domain does not affect the transcriptional activities of any
other domain. The resulting plasmid was designated pYA3681 (FIG.
14).
[0511] The host strain for this system was constructed by
introducing a .DELTA.asdA mutation into the .DELTA..sub.murA7::araC
P.sub.BAD murA mutant strain .chi.8645. To facilitate regulation of
P22 P.sub.R in plasmid pYA3681, we introduced the .DELTA.asdA19
deletion/insertion mutation, in which the P22 phage C2 repressor
gene under transcriptional control of the P.sub.BAD promoter was
inserted into the .DELTA.asdA16 deletion (FIG. 38A). Three
additional mutations designed to enhance lysis and facilitate
antigen delivery were also included in this strain (FIG. 38A). The
.DELTA.(gmd-fcl)-26 mutation deletes genes encoding enzymes for
GDP-fucose synthesis, thereby precluding the formation of colanic
acid, a polysaccharide made in response to stress associated with
cell wall damage (28). This mutation was included because we have
observed that under some conditions, asdA mutants can survive if
they produce copious amounts of colanic acid (29). Therefore, by
deleting the genes required for colanic acid synthesis, we
circumvent this possibility. The Are/A1123 mutation uncouples cell
wall-less death from dependence on protein synthesis to further
ensure that the bacteria do not survive in vivo or after excretion
and to allow for maximum antigen production in the face of amino
acid starvation resulting from a lack of aspartate semi-aldehyde
synthesis due to the asdA mutation (30, 31). This regulated lysis
system S. Typhimurium strain also has potential for use as a DNA
vaccine delivery vector. Therefore, we included a .DELTA.endA
mutation which eliminates the periplasmic endonuclease I enzyme
(32), to increase plasmid survival upon its release into the host
cell. The resulting strain, .chi.8937 (.DELTA.asdA19::araC
P.sub.BAD c2 .DELTA.P.sub.murA7::araC P.sub.BAD murA
.DELTA.(gmd-fcl)-26 .DELTA.relA1123 .DELTA.endA2311), requires both
arabinose and DAP for growth (FIG. 38B).
[0512] pYA3681 was introduced into S. Typhimurium .chi.8937. Growth
of the resulting strain .chi.8937(pYA3681) required arabinose (FIG.
38B). The plasmid was stably maintained for 50 or more generations
when grown in the presence of arabinose and DAP. In the presence of
arabinose, the plasmid-encoded copies of asdA and murA and the
chromosomally encoded copies of murA and c2 are transcribed from
their respective P.sub.BAD promoters, allowing for bacterial growth
and repression of the P22 P.sub.R promoter by C2 (FIG. 39). In the
absence of arabinose, the P.sub.BAD promoters cease to be active,
with no further synthesis of Asd and MurA or C2. The concentrations
of Asd, MurA and C2 decrease due to cell division. The decreased
concentration of Asd and MurA leads to reduced synthesis of DAP and
muramic acid and imbalanced synthesis of the peptidoglycan layer of
the cell wall. As the C2 concentration drops, P22 P.sub.R is
derepressed resulting in P.sub.R-directed synthesis of anti-sense
mRNA which blocks translation of residual asdA and murA mRNA. These
concerted activities lead to cell lysis.
Regulated Programmed Lysis and Biological Containment Properties
after Colonization of Lymphoid Tissues.
[0513] The regulated lysis vaccine strain .chi.8937(pYA3681) grew
well in LB broth supplemented with 0.02% arabinose, but began to
die after one hour of incubation in LB broth without arabinose
(FIG. 40A). To evaluate cell lysis, release of the cytoplasmic
enzyme .beta.-galactosidase into culture supernatants was used as
an indicator. The atrB13::MudJ allele which directs constitutive
expression of .beta.-galactosidase (13) was transduced into S.
Typhimurium wild-type as a non-lysis control and into vaccine
strain .chi.8937, resulting in strains .chi.9379 and .chi.9380,
respectively. We then introduced plasmid pYA3681 into .chi.9380 to
yield .chi.9380(pYA3681). The ratio of .beta.-galactosidase
activity in the supernatant (released .beta.-galactosidase) or cell
pellet (retained cell-associated .beta.-galactosidase) versus total
.beta.-galactosidase activity (supernatant plus cell pellet)
indicated the extent of cell lysis. Release of .beta.-galactosidase
by strain .chi.9380(pYA3681) occurred only in medium lacking
arabinose (FIG. 40B). Conversely, the amount of cell-associated
.beta.-galactosidase decreased over time when .chi.9380(pYA3681)
was grown in medium without arabinose, but no decrease was seen in
media containing arabinose. .beta.-galactosidase release was not
observed when the wild-type control strain .chi.9379 was grown
without arabinose. These results are consistent with our
expectations for the arabinose-regulated cell lysis phenotype.
[0514] To evaluate virulence, BALB/c mice were orally inoculated
with doses in excess of 10.sup.9 CFU of the host-vector strain
.chi.8937(pYA3681), a dose 50,000 times the LD.sub.50 of the
wild-type parent strain, .chi.3761. During the 30 days observation
period after dosing, we observed no deaths or signs of illness in
any of the mice. Colonization by strain .chi.8937(pYA3681) was
evaluated in eight-week old female mice orally inoculated with
10.sup.9 CFU. The strain transiently colonized lymphoid tissues
(FIG. 40C) and no bacteria were recovered by four weeks
post-inoculation. No arabinose-independent Salmonella mutants were
recovered at any time during this experiment. These results
indicate that a wild-type Salmonella strain engineered with this
programmed lysis system is attenuated and is efficiently cleared
from the host following colonization of lymphoid tissues.
Construction of the rPspA Rx1-Expressing Plasmid.
[0515] It was previously shown that a recombinant protein fusing
the first 35 amino acids of .beta.-lactamase to the .alpha.-helical
region of PspA (rPspA Rx1) is highly immunogenic when delivered by
a recombinant avirulent S. Typhimurium (13). We utilized a similar
fusion to evaluate the ability of our regulated lysis strain to
deliver an antigen to host tissues. A DNA fragment encoding the
in-frame fusion of the .beta.-lactamase leader sequence from
plasmid pBR322 to rPspA Rx1 (.alpha.-helical region of PspA from
amino acid residue 3 to 257 of mature PspA.sub.Rx1) was inserted
into pYA3681 to yield pYA3685 (FIG. 41A). The nucleic acid encoding
the antigen is constitutively expressed from the P.sub.trc
promoter. Production of rPspA Rx1 in S. Typhimurium
.chi.8937(pYA3685) grown in media with arabinose was detected by
western blot analysis with the anti-PspA monoclonal antibody (FIG.
41B), and we confirmed that the fraction of antigen secreted to the
periplasm was similar to that reported previously (13). The strain
did not grow on LB agar without arabinose and expression of the
recombinant antigen did not interfere with programmed lysis when
.chi.8937(pYA3685) was grown in LB broth without arabinose (FIG.
41C).
Immune Responses in Mice after Oral Immunization with the Regulated
Programmed Lysis Host-Vector System.
[0516] The antibody responses to Salmonella outer membrane proteins
(SOMPs) and to the foreign antigen rPspA Rx1 in sera and vaginal
secretions of the immunized mice were measured (FIG. 42). The
maximum serum IgG response to PspA was observed at 6 weeks and
responses at all time points were significantly greater than in the
control group, where no response was detected (p<0.05)(FIG.
42A). The anti-SOMP IgG response was slower to develop in mice
vaccinated with .chi.8937(pYA3685) than in the control group, with
significant differences between groups at weeks 2 and 6
(p<0.05). This could be a result of differences in the ability
of the two strains to survive systemically brought about by the
antigen load in .chi.8937(pYA3685). However, both
.chi.8937(pYA3681) and .chi.8937(pYA3685) elicited equivalent
anti-SOMP IgA responses in vaginal secretions, with no significant
differences between groups after two weeks, while rPspA
Rx1-specific IgA was detected only in samples from mice immunized
with vaccine strain .chi.8937(pYA3685) (p<0.05) (FIG. 42B).
IgG Isotype Analyses
[0517] The type of immune responses to SOMPs and the rPspA Rx1 were
further examined by measuring the levels of IgG isotype subclasses
IgG2a and IgG1 (FIG. 43). The Th1-helper cells direct cell-mediated
immunity and promote class switching to IgG2a, and Th2 cells
provide potent help for B-cell antibody production and promote
class switching to IgG1 (33). IgG2a isotype dominant responses were
observed for the SOMP antigens indicating that the vaccine induced
a strong cellular immune response against Salmonella. In contrast
to the strong Th1 responses to SOMPs, a Th1- and Th2-type mixed
response was observed for the rPspA Rx1 antigen (FIG. 43).
Discussion of Example 5
[0518] Our long-term goals are to develop RASVs for oral
administration, protecting humans and animals against a variety of
mucosal pathogens. Immunization with live Salmonella vaccines
introduces the potential for release of the bacteria into the
environment, possibly leading to unintended immunizations. The
objective of this example was to construct and evaluate a
biological containment system that would be consistent with the
requirements for efficacious vaccination, in particular,
colonization of host lymphoid tissues for an amount of time
sufficient for optimal antigen delivery. RASV are capable of
delivering a variety of bacterial, viral, fungal, and parasitic
antigens thereby eliciting humoral and cellular immunity in the
immunized host (1, 34-36). Immune responses, especially antibody
responses, are enhanced when the antigen is released into the
extracellular environment as opposed to being sequestered in the
bacterial cytoplasm (11, 12).
[0519] These considerations led us to develop a RASV
containment/delivery system capable of releasing antigen by cell
lysis within the immunized animal. We utilized the tightly
regulated araC P.sub.BAD activator-promoter system to construct a
strain/plasmid system that directs regulated arabinose-dependent,
programmed lysis. An arabinose-regulated cell lysis system should
not be undermined by release into the environment, where stream and
groundwater levels of arabinose are in the sub-micromolar range
(37). Studies in our laboratory have shown that in our Salmonella
strains, P.sub.BAD is not activated by 13 .mu.M (0.0002%) arabinose
(S. Wang, personal communication).
[0520] We chose the asdA gene as the primary driver of cell lysis,
since it is known that, unlike some lethal mutations, a lack of Asd
not only results in cell death, but also cell lysis (38). To
further facilitate containment, we also included the murA gene in
our scheme. The plasmid copy of murA was derived from E. coli to
reduce the potential for recombination with the S. Typhimurium
chromosomal copy, a possible escape strategy for the cell. Finally,
we included the P22 P.sub.R promoter driving transcription of
anti-sense mRNA to silence any residual mRNA transcripts that may
arise from the plasmid copies of asdA or murA in the absence of
arabinose. In our system, the C2 repressor, which inhibits P22
P.sub.R transcription, is only synthesized in the presence of
arabinose. Thus, in the arabinose-limiting environment in host
tissues, C2 is not made and anti-sense mRNA is transcribed.
[0521] The data of this example show that the system we have
devised results in cell lysis in the absence of arabinose and
clearance of the strain from host tissues. More importantly, our
strain was fully capable of delivering a test antigen and inducing
a robust immune response comparable to that of a vaccine strain
without this containment system, thereby demonstrating that this
system has all the features required for biological containment of
a RASV. This plasmid-host system of regulated delayed lysis in vivo
depends on regulated delayed shut off in the synthesis of enzymes
essential for peptidoglycan synthesis results in complete
avirulence in the complete absence of any other attenuating
mutations. As such this is another means to confer a regulated
delayed attenuation phenotype.
[0522] This system can be modified to suit a number of different
needs for antigen delivery. We can add mutations that will delay
lysis to allow additional time for the RASV to colonize host
tissues. For example, we have deleted additional genes from the
arabinose operon to prevent arabinose metabolism, thereby
maintaining an effective arabinose concentration in the cytoplasm
for a longer period of time. Strains with these arabinose gene
deletions are currently being evaluated for use as antigen or DNA
delivery vectors.
[0523] The regulated lysis system also has potential as a DNA
vaccine vector delivery system. An asdA deletion mutant of Shigella
flexneri has been used to deliver DNA in animals (39), but the
immune responses were weak, presumably because the cells did not
persist long enough to efficiently invade host tissues. A
.DELTA.asdA mutant of E. coli has also been used to deliver DNA in
tissue culture (40). However, our system, whether used for
Shigella, E. coli or Salmonella (41), provides the vaccine with
adequate time to establish itself in host tissues before lysis
occurs, thereby enhancing the probability of efficient DNA
delivery.
[0524] Lastly, this system could be modified to provide effective
biological containment for genetically engineered bacteria used for
a diversity of purposes in addition to vaccines
REFERENCES FOR EXAMPLE 5
[0525] 1. Cardenas L, Clements J D (1992) Oral immunization using
live attenuated Salmonella spp. as carriers of foreign antigens.
Clin. Microbiol. Rev. 5: 328-42. [0526] 2. Curtiss R, III (2005) in
Mucosal Immunology, eds Mestecky J et al (Academic Press, San
Diego), pp 1009-1037. [0527] 3. Nakayama K, Kelly S M, Curtiss R,
III (1988) Construction of an Asd+ expression-cloning vector:
stable maintenance and high level expression of cloned genes in a
Salmonella vaccine strain. Bio/Technology 6: 693-697. [0528] 4.
Galen J E et al. (1999) Optimization of Plasmid Maintenance in the
Attenuated Live Vector Vaccine Strain Salmonella typhi CVD
908-htrA. Infect. Immun. 67: 6424-6433. [0529] 5. Garmory H S et
al. (2005) Antibiotic-free plasmid stabilization by
operator-repressor titration for vaccine delivery by using live
Salmonella enterica serovar Typhimurium. Infect. Immun.
73:2005-2011. [0530] 6. Davison J E (2002) Towards safer vectors
for the field release of recombinant bacteria. Environ. Biosafety
Res. 1: 9-18. [0531] 7. Kotton C N, Hohmann E L (2004) Enteric
pathogens as vaccine vectors for foreign antigen delivery. Infect.
Immun. 72: 5535-5547. [0532] 8. Abd El Ghany M et al. (2007)
Candidate live, attenuated Salmonella enterica serotype Typhimurium
vaccines with reduced fecal shedding are immunogenic and effective
oral vaccines. Infect. Immun. 75: 1835-1842. [0533] 9. Curtiss R,
III, Doggett T, Nayak A, Srinivasan J (1996) in Essentials of
mucosal immunology, eds Kagnoff M F, Kiyono H (Academic Press, San
Diego), pp 499-511. [0534] 10. Medina E, Guzman C A (2001) Use of
live bacterial vaccine vectors for antigen delivery: potential and
limitations. Vaccine 19: 1573-1580. [0535] 11. Kang H Y, Curtiss R,
III (2003) Immune responses dependent on antigen location in
recombinant attenuated Salmonella typhimurium vaccines following
oral immunization. FEMS Immunol. Med. Microbiol. Lett. 37: 99-104.
[0536] 12. Hess J et al. (1996) Superior efficacy of secreted over
somatic antigen display in recombinant Salmonella vaccine induced
protection against listeriosis. Proc. Natl. Acad. Sci. U.S.A 93:
1458-63. [0537] 13. Kang H Y, Srinivasan J, Curtiss R, III (2002)
Immune responses to recombinant pneumococcal PspA antigen delivered
by live attenuated Salmonella enterica serovar Typhimurium vaccine.
Infect. Immun. 70: 1739-49. [0538] 14. Bertani G (1951) Studies on
lysogenesis. I. The mode of phage liberation by lysogenic
Escherichia coli. J. Bacteriol. 62: 293-300. [0539] 15. Gay P, Le
Coq D, Steinmetz M, Berkelman T, Kado C I (1985) Positive selection
procedure for entrapment of insertion sequence elements in
gram-negative bacteria. J. Bacteriol. 164:918-921. [0540] 16.
Hitchcock P J, Brown T.sub.M (1983) Morphological heterogeneity
among Salmonella lipopolysaccharide chemotypes in silver-stained
polyacrylamide gels. J. Bacteriol. 154: 269-277. [0541] 17. Guzman
L M, Belin D, Carson M J, Beckwith J (1995) Tight regulation,
modulation, and high-level expression by vectors containing the
arabinose P.sub.BAD promoter. J. Bacteriol. 177: 4121-4130. [0542]
18. Curtiss R, Ill et al. (2007) in Virulence Mechanisms of
Bacterial Pathogens, eds Brogden K A (ASM Press, Washington D.C.),
pp 297-313. [0543] 19. McDaniel L S, Scott G, Kearney, J F, Briles
D E (1984) Monoclonal antibodies against protease sensitive
pneumococcal antigens can protect mice from fatal infection with
Streptococcus pneumoniae. J. Exp. Med. 160: 386-397. [0544] 20.
Miller J H (1972) in Experiments in Molecular Genetics (Cold Spring
Harbor Lab. Press, Plainview). [0545] 21. Zhang X, Kelly S M,
Bollen W S, Curtiss R, III (1997) Characterization and
immunogenicity of Salmonella typhimurium SL1344 and UK-1 crp and
cdt deletion mutants. Infect. Immun. 65: 5381-5387. [0546] 22.
Nayak A R et al. (1998) A live recombinant avirulent oral
Salmonella vaccine expressing pneumococcal surface protein A
induces protective responses against Streptococcus pneumoniae.
Infect. Immun. 66: 3744-3751. [0547] 23. Van Heijenoort J (1994) in
Bacterial Cell Wall, eds Ghuysen J M, Hackenbeck R (Elsevier,
Amsterdam), pp 39-54. [0548] 24. Black S, Wright N G (1955)
Aspartic .beta.-semialdehyde dehydrogenase and aspartic
.beta.-semialdehyde. J. Biol. Chem. 213: 39-50. [0549] 25. Brown E
D, Vivas El, Walsh C T, Kolter R (1995) MurA (MurZ), the enzyme
that catalyzes the first committed step in peptidoglycan
biosynthesis, is essential in Escherichia coli. J. Bacteriol. 177:
4194-4197. [0550] 26. Lee N L, Gieliw W O, Wallace R G (1981)
Mechanism of araC autoregulation and the domains of two overlapping
promoters, P.sub.C and P.sub.BAD, in the L-arabinose regulatory
region of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A 78:
752-756. [0551] 27. Curtiss R, III (1965) Chromosomal aberrations
associated with mutations to bacteriophage resistance in
Escherichia coli. J. Bacteriol. 89: 28-40. [0552] 28. Whitfield C
(2006) Biosynthesis and assembly of capsular polysaccharides in
Escherichia coli. Annu Rev. Biochem. 75: 39-68. [0553] 29. Curtiss
R, Ill et al. (1976) in Recombinant Molecules: Impact on Science
and Society, eds Beers R F, Jr, Bassett E G (Raven Press, New
York), pp 45-56. [0554] 30. Torok I, Kari C (1980) Accumulation of
ppGpp in a relA mutant of Escherichia coli during amino acid
starvation. J. Biol. Chem. 255: 3838-3840. [0555] 31. De Groote M
A, Testerman T, Xu Y, Stauffer G, Fang F C (1996) Homocysteine
antagonism of nitric oxide-related cytostasis in Salmonella
typhimurium. Science 272: 414-417. [0556] 32. Dubnau D (1999) DNA
uptake in bacteria. Annu. Rev. Microbiol. 53: 217-244. [0557] 33.
Spellberg B, Edwards J E, Jr (2001) Type 1/type 2 immunity in
infectious diseases. Clin. Infect. Dis. 32: 76-102. [0558] 34.
Formal S B et al. (1981) Construction of a potential bivalent
vaccine strain: introduction of Shigella sonnei form I antigen
genes into the galE Salmonella typhi Ty21a typhoid vaccine strain.
Infect. Immun. 34: 746-750. [0559] 35. Curtiss R, Ill et al. (1994)
Recombinant Salmonella vectors in vaccine development. Dev Biol
Stand. 82: 23-33. [0560] 36. Curtiss R, III (2002) Bacterial
infectious disease control by vaccine development. J. Clin.
Investig. 110: 1061-1066. [0561] 37. Cheng X, Kaplan L A (2003)
Simultaneous analyses of neutral carbohydrates and amino sugars in
freshwaters with HPLC-PAD. J. Chromatogr. Sci. 41: 434-438. [0562]
38. Loessner H, Endmann A, Rhode M, Curtiss R, Ill, Weiss S (2006)
Differential effect of auxotrophies on the release of
macromolecules by Salmonella enterica vaccine strains. FEMS
MicrobioL Lett. 265: 81-88. [0563] 39. Sizemore D R, Branstrom A A,
Sadoff J C (1997) Attenuated bacteria as a DNA delivery vehicle for
DNA-mediated immunization. Vaccine 15: 804-7. [0564] 40.
Grillot-Courvalin C, Goussard S, Huetz F, Ojcius D M, Courvalin P
(1998) Functional gene transfer from intracellular bacteria to
mammalian cells. Nat. Biotechnol. 16: 862-866. [0565] 41. Loessner
H, Weiss S (2004) Bacteria-mediated DNA transfer in gene therapy
and vaccination. Expert. Opin. Biol. Ther. 4: 157-68
Example 6: Preparation of Vaccine Product
[0566] Master seed and working seed banks of each vaccine organism
in separate vials have been prepared for frozen storage in
vegetable-based cryopreservative. Purity of the seed banks was
established following standard operating procedures Full
characterization of the seed banks includes phenotypic evaluation
on selective media, PCR, antigenic agglutination, colorimetric
assays, LPS gel analysis, production of catalase to reveal the RpoS
phenotype and demonstrated to reflect the correct and anticipated
phenotype and genotype of the three vaccine strains. Antibiotic
sensitivity testing has confirmed that these strains are sensitive
to ciprofloxacin, ampicillin, ceftriaxone,
trimethoprim/sulfamethoxazole (Table 15). Ampicillin,
ciprofloxacin, ceftriaxone and trimethoprim/sulfamethoxazole are
typically tested for minimum inhibitory concentrations (MICs) for
Salmonella.
TABLE-US-00016 TABLE 15 Minimum inhibitory concentrations of
antibiotics for RASV-Sp strains. Salmonella Typhi strain (.mu.g/ml)
Antibiotic .chi.9633(pYA4088) .chi.9639(pYA4088) .chi.9640(pYA4088)
ampicillin <2 <2 <2 ciprofloxacin <0.25 <0.25
<0.25 ceftriaxone <0.25 <1 <1 trimethroprim- <20
<20 <20 sulfa- methoxazole
[0567] The vials of vaccine Working Seed are maintained frozen in
designated boxes and entered into the freezers' inventory logs. The
Working Seed vials are stored in duplicate freezers maintained
between -65.degree. and -75.degree. C. Vaccine stability is
determined by titration of representative vials of each of the
RASV-Sp Master and Working Seed banks at 0, 3, 6, 12, 24 months and
every 6 months thereafter. Table 16 shows the stability of the
RASV-Sp Master Seed and Working Seed stocks as determined by
quarterly viable titration.
TABLE-US-00017 TABLE 16 Stability of RASV-Sp Master Seed (MS) and
Working Seed (WS) banks .chi.9633(pYA4088) .chi.9639(pYA4088)
.chi.9640(pYA4088) Date of CFU/ml CFU/ml CFU/ml Titer MS WS MS WS
MS WS Nov. 17, 2007 1.95 .times. 10.sup.10 3.20 .times. 10.sup.10
1.60 .times. 10.sup.10 2.63 .times. 10.sup.10 1.76 .times.
10.sup.10 3.00 .times. 10.sup.10 Feb. 22, 2008 1.98 .times.
10.sup.10 3.40 .times. 10.sup.10 1.66 .times. 10.sup.10 3.20
.times. 10.sup.10 1.69 .times. 10.sup.10 3.53 .times. 10.sup.10 May
17, 2008 1.62 .times. 10.sup.10 4.23 .times. 10.sup.10 1.58 .times.
10.sup.10 3.08 .times. 10.sup.10 1.54 .times. 10.sup.10 3.01
.times. 10.sup.10 Sep. 8, 2008 1.44 .times. 10.sup.10 2.70 .times.
10.sup.10 1.11 .times. 10.sup.10 3.55 .times. 10.sup.10 1.43
.times. 10.sup.10 1.30 .times. 10.sup.10
[0568] Live, whole bacteria constitute the unformulated active
immunogenic substance that when fermented in permissive conditions
will be formulated with sterile PBS pH 7.4 to produce the final
vaccine product.
[0569] The final vaccine products will be prepared on the day of
administration to the volunteers in the clinical trial to optimize
immunogenicity and fitness of the strains.
[0570] Briefly, a 37.degree. C. overnight culture of each vaccine
strain is prepared from a frozen vial of RASV-Sp Working Seed. The
next morning, the cultures are subcultured 1:20 into fresh,
prewarmed media and shaken gently at 37.degree. C. to an optical
density (OD) at 600 nm ideally between 2.0-2.3. The cells are
harvested by centrifugation and resuspended gently in sterile PBS
to the final dosage prescribed. Data collected from production runs
of the vaccine dosages conducted prior to the start of the clinical
trial will be used to correlate the OD.sub.600 of the final PBS
cell suspension to CFU/ml (GCGH-ASU-SOP-096-00, see CMC section of
the IND application). This data will be used to confirm the target
range of the final dosage prior to releasing the vaccine dosages to
the clinic.
[0571] Table 17 shows the production record of three consecutive
dosages of the RASV-Sp inocula for producing 10-ml final liquid
dosages of live vaccine for oral administration to adult
volunteers. The data provide assurance that the RASV-Sp vaccine
inocula can be consistently produced within the target range of the
dosage required on the start date of the clinical trial.
TABLE-US-00018 TABLE 17 RASV-Sp final dosage preparation record
Hours to Production RASV-Sp Harvest culture Vaccine Dosage/ date
Strain OD.sub.600 harvest 10 ml.sup.1 Aug. 11, .chi.9633(pYA4088)
2.83 4 h 37 min 2.14 .times. 10.sup.7 2008 .chi.9639(pYA4088) 2.20
4 h 24 min 3.04 .times. 10.sup.7 .chi.9640(pYA4088) 2.38 4 h 2.30
.times. 10.sup.7 Aug. 19, .chi.9633(pYA4088) 2.11 3 h 58 min 1.14
.times. 10.sup.7 2008 .chi.9639(pYA4088) 2.08 4 h 40 min 2.22
.times. 10.sup.7 .chi.9640(pYA4088) 2.14 3 h 57 min 1.29 .times.
10.sup.7 Aug. 21, .chi.9633(pYA4088) 2.15 3 h 48 min 1.37 .times.
10.sup.7 2008 .chi.9639(pYA4088) 2.01 4 h 30 min 2.09 .times.
10.sup.7 .chi.9640(pYA4088) 2.14 3 h 42 min 1.51 .times. 10.sup.7
.sup.1Each lot produced passed purity and identity testing
following standard operating procedures.
Formulation
[0572] The human fasting stomach can reach pH levels as low as 1.5.
Low pH tolerance of the RASV-Sp strains was tested after suspending
cells in medium at pH 7, 4.5 or 3 for 1 hour at 37.degree. C.
Viability of the samples after incubation was assessed by plate
counts. Data shown are the average number of CFU/ml recovered. In
these studies, we included the parental wild-type S. Typhi strains
.chi.3744 (ISP1820), .chi.3769 (Ty2) and .chi.8438 (Ty2
RpoS.sup.+). We also included an attenuated S. Typhi ISP1820 strain
(.chi.8110) that had been used in a previous trial in which
reactogenicity was observed. In all cases, the vaccine
constructions .chi.9633(pYA4088), .chi.9639(pYA4088) and
.chi.9640(pYA4088) were more acid sensitive than their wild-type
parents or than the attenuated ISP1820 strain .chi.8110 (FIG.
44).
[0573] The PBS used as the diluent is unlikely to provide
sufficient buffering activity. Since the stomach pH rises
dramatically upon ingestion of food, we plan to increase the
stomach pH of volunteers by administering Ensure nutrition shakes
prior to administering the vaccine dosages. FIG. 45 shows the
stability after one hour of the RASV-Sp vaccines suspended in three
different flavors of Ensure.RTM. nutrition shake.
Stability of RASV-Sp Strains
[0574] The RASV-Sp vaccine dosages maintain a stable titer
suspended in the PBS at room temperature for a period of less than
2 hours. FIG. 46 shows that the initial cell suspensions hold
titers near 1.times.10.sup.10 CFU for up to an hour and then
maintain stably after dilution in PBS for an additional hour. The
RASV-Sp final dosages will be administered to volunteers within two
hours of resuspension in PBS to ensure optimal immunogenicity.
Example 7: Nonclinical Studies
[0575] It should be noted that S. Typhi is an obligate human
pathogen and no animal models are available for a full evaluation
of the S. Typhi-based vaccines. Inoculation of newborn mice with
high doses of wild-type virulent strains of S. Typhi, even when
modified to express the S. Typhimurium virulence plasmid needed by
S. Typhimurium to cause disseminated disease in mice, fails to
infect or cause any signs of disease or any weight loss. We
constructed, in parallel of the engineering of S. Typhi, S.
Typhimurium strains bearing essentially identical mutations as the
S. Typhi-based vaccines for pre-clinical safety and immunogenicity
evaluation in mice.
Safety of S. Typhimurium .chi.9558(pYA4088) in Newborn Mice.
[0576] A relevant safety test was to evaluate the safety in newborn
and infant mice of S. Typhimurium strain .chi.9558(pYA4088)
[(.DELTA.pmi-2426 .DELTA.(gmd-fcl)-26 .DELTA.P.sub.fur81::TT araC
P.sub.BAD fur .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
.DELTA.asdA27::TT araC P.sub.BAD c2 .DELTA.araE25 .DELTA.araBAD23
.DELTA.relA198::araC P.sub.BAD lacI TT .DELTA.sopB1925
.DELTA.agfBAC811], which carries mutations nearly identical to the
S. Typhi vaccine strains and the same plasmid to enable PspA
expression. Newborn mice are highly susceptible to wild-type S.
Typhimurium infection and succumb at oral doses lower than 100
CFU.
[0577] Newborn and infant mice were orally inoculated with 5 .mu.l
containing 1-3.times.10.sup.8 CFU of the strain .chi.9558(pYA4088)
at 0, 2, 4 or 7 days of age. Table 18 shows the health status and
survivors over a 10-week period. No disease symptoms or death
occurred in any of the mice at any time after oral inoculation with
over 10.sup.6 times the wild-type LD.sub.50.
TABLE-US-00019 TABLE 18 Safety of .chi.9558(pYA4088) in
newborn/infant BALB/c mice Age of Health status mice Oral dosage 10
weeks post- Survivors/ (days) CFU vaccination total 0 1.0 .times.
10.sup.8 Healthy 9/9 2 1.2 .times. 10.sup.8 Healthy 12/12 4 3.0
.times. 10.sup.8 Healthy 11/11 7 3.5 .times. 10.sup.8 Healthy 13/13
The oral LD.sub.50 for the wild-type parent strain .chi.3761 is
less than 100 CFU.
Distribution of S. Typhimurium .chi.9558(pYA4088) in Tissues of
Newborn Mice
[0578] Colonization of tissues from newborn and infant mice was
evaluated 3 and 7 days after oral inoculation with the S.
Typhimurium strain .chi.9558(pYA4088). Homogenized tissue samples
from euthanized mice were spread onto agar plates and CFU/g
enumerated. In addition, samples of homogenized tissues were also
subjected to enrichment culture to reveal presence or absence of
Salmonella. Table 19 shows the tissue distribution of the
attenuated S. Typhimurium strain .chi.9558(pYA4088) in newborn mice
to 7 days of age.
[0579] The levels of colonization of the intestinal tract by S.
Typhimurium .chi.9558(pYA4088) were quite good. In this regard, it
should be noted that isolation of Peyer's patch tissue in these
infant mice to determine Salmonella titers is not feasible. Titers
in liver and spleen were lower than expected but this was
interpreted as an indication of the safety of .chi.9558(pYA4088)
for newborn and infant mice.
[0580] These data in Table 16 and Table 17 show that the attenuated
S. Typhimurium vaccine strain with mutations nearly identical to
the S. Typhi vaccine strains is safe for newborn and infant mice.
Therefore, it can be extrapolated from these data that these
mutations provide an equivalent level of safety to the S. Typhi
vaccines.
TABLE-US-00020 TABLE 19 Colonization data of .chi.9558(pYA4088) in
tissues (CFU/gram) 3 and 7 days post inoculation in infant mice Age
of Oral Spleen Liver Intestine* Mice dosage Number (CFU/g) (CFU/g)
(CFU/g) (day) (CFU) of mice Day 3 Day 7 Day 3 Day 7 Day 3 Day 7 0
1.0 .times. 10.sup.8 1 <10 5.9 .times. 10.sup.3 <10 6.8
.times. 10.sup.3 2.7 .times. 10.sup.6 6.3 .times. 10.sup.4 2 <10
7.3 .times. 10.sup.3 <10 5.0 .times. 10.sup.4 5.9 .times.
10.sup.5 3.1 .times. 10.sup.5 3 <10 2.4 .times. 10.sup.3 3.0
.times. 10.sup.3 2.5 .times. 10.sup.4 1.6 .times. 10.sup.6 2.4
.times. 10.sup.5 2 1.2 .times. 10.sup.8 1 0 << 10 1.1 .times.
10.sup.3 2.9 .times. 10.sup.3 1.1 .times. 10.sup.3 6.1 .times.
10.sup.5 5.0 .times. 10.sup.5 2 0 << 10 1.4 .times. 10.sup.3
5.9 .times. 10.sup.2 1.7 .times. 10.sup.3 2.3 .times. 10.sup.5 5.4
.times. 10.sup.3 3 2.5 .times. 10.sup.3 1.7 .times. 10.sup.3 5.7
.times. 10.sup.3 3.3 .times. 10.sup.3 2.7 .times. 10.sup.6 3.1
.times. 10.sup.5 4 3.0 .times. 10.sup.8 1 3.3 .times. 10.sup.3
<10 5.2 .times. 10.sup.3 <10 1.1 .times. 10.sup.8 5.4 .times.
10.sup.6 2 <10 8.5 .times. 10.sup.3 2.4 .times. 10.sup.3 8.0
.times. 10.sup.3 1.1 .times. 10.sup.8 1.8 .times. 10.sup.7 3 8.1
.times. 10.sup.4 2.7 .times. 10.sup.3 1.2 .times. 10.sup.4 2.1
.times. 10.sup.4 7.1 .times. 10.sup.6 2.8 .times. 10.sup.7 7 3.5
.times. 10.sup.8 1 <10 <10 2.4 .times. 10.sup.2 <10 7.0
.times. 10.sup.6 1.5 .times. 10.sup.7 2 <10 <10 5.0 .times.
10.sup.2 <10 1.1 .times. 10.sup.7 6.0 .times. 10.sup.6 3 <10
<10 3.2 .times. 10.sup.2 <10 1.8 .times. 10.sup.7 3.9 .times.
10.sup.6 *Entire small intestine and contents
Evaluation of Safety of S. Typhi Vaccine Strains in Young Mice.
[0581] Newborn mice (<24 h) were each orally inoculated with 10
.mu.l containing 1.times.10.sup.9 CFU of each of the S. Typhi
vaccine strains. Table 20 shows the health status and survivors
over a six-week period. No disease symptoms or death occurred in
any of the mice at any time after oral inoculation.
TABLE-US-00021 TABLE 20 Safety of S. Typhi .chi.9633(pYA4088),
.chi.9639(pYA4088) and .chi.9640(pYA4088) in newborn mice Health
status Oral dosage 6-weeks post- Survivors/ Strain (CFU)
inoculation total .chi.9633(pYA4088) 1.2 .times. 10.sup.9 healthy
3/3 .chi.9639(pYA4088) 6.0 .times. 10.sup.8 healthy 3/3
.chi.9640(pYA4088) 7.5 .times. 10.sup.8 healthy 3/3
Distribution of S. Typhi Strains in Tissues of Newborn Mice.
[0582] Although S. Typhi can invade murine cells with low
efficiency (compared to S. Typhimurium), they do not survive well
or multiply and quickly decline in titer following oral
administration. For this reason, the ability of S. Typhi to
colonize (or not colonize) murine tissues is not necessarily
indicative of the ability of the strain to colonize human tissue.
However, the distribution of S. Typhi cells in tissues from newborn
mice was evaluated as an addition to the data from the S.
Typhimurium RASV-Sp strain .chi.9558(pYA4088) (see Table 19).
[0583] Colonization was assessed 3 and 7 days after oral
inoculation with the S. Typhi vaccine and wild-type strains. The
attenuated ISP1820 strain used in a previous trial (.chi.8110) and
the typhoid vaccine strain Ty21a were also included for comparative
purposes. Homogenized tissue samples from euthanized mice were
spread onto agar plates and CFU/g enumerated. In addition, samples
of homogenized tissues were also subjected to enrichment culture to
reveal the presence or absence of Salmonella. FIG. 47 shows the
distribution of the S. Typhi vaccine and wild-type strains in the
intestine, spleen and liver tissues 3 and 7 days after inoculation.
Data shown are the geometric means+standard deviations of two
separate colonization experiments.
[0584] These data demonstrate that the mutant vaccine candidate S.
Typhi strains colonize mouse tissues no better than the wild-type
parental strains. The additional strains Ty21a and .chi.8110 showed
similarly poor levels of colonization. These results were not
unexpected, since mice are unable to support an infection with S.
Typhi strains even when infected soon after birth.
Reactogenicity of PBS Diluent with and without S. Typhi
[0585] The general safety test as directed in 21 CFR 610.11 was
performed to address concerns raised of the possibility that
residual media components might be reactogenic in volunteers.
[0586] The RASV-Sp PBS cell suspensions were filter-sterilized and
these cell-free solutions, along with sterile PBS and sterile
growth medium were injected intraperitonneally into mice and guinea
pigs. The weight, health and general well-being of study animals
were monitored daily for 7 days. At the conclusion of the study,
animals were euthanized and necropsied, and observable differences
of the internal organs (including alterations in size, shape,
coloration and vascularization) were photographed for comparative
analysis.
[0587] All animals survived for the duration of the general safety
test (7 days after injection). No unexpected or nonspecific
responses were observed with any of the RASV-Sp strains as compared
to the PBS controls. The average weights for each group throughout
the course of the study are shown in FIGS. 48A and B. For each
group, the animals weigh the same or more on Day 7 than they did on
the day of injection.
[0588] No diminishment of the health and general well-being, and no
change in the character of internal organs of mice and guinea pigs
were noted.
[0589] These data provide evidence to support the conclusion that
the trace amount of residual media components present in the final
vaccine preparation is unlikely to be reactogenic in human
volunteers.
Immunogenicity Assessment of S. pneumoniae Antigen
[0590] The immunogenicity of the PspA antigen of S. pneumoniae was
assessed using the Asd.sup.+ plasmid vector pYA3634. The pYA3634
plasmid is a precursor of pYA4088 and encodes aa 3-257 of the
PspA-Rx1 protein (pYA4088 spans aa 3-285) (See FIG. 49). Cultures
of the RASV-Sp strains grown in the presence of arabinose
synthesize the LacI repressor at high levels to repress
transcription from P.sub.trc on the Asd.sup.+ plasmid vector
pYA3634 to minimize synthesis of PspA until after immunization when
the vaccine strain is already colonizing internal lymphoid tissues.
0.05% arabinose and 0.2% mannose were used to prepare S.
Typhimurium .chi.9558(pYA3634) (.DELTA.pmi-2426 .DELTA.(gmd-fcl)-26
.DELTA.P.sub.fur81::TT araC P.sub.BAD fur .DELTA.P.sub.crp527::TT
araC P.sub.BAD crp .DELTA.asdA27::TT araC P.sub.BAD c2
.DELTA.araE25 .DELTA.araBAD23 .DELTA.relA198::araC P.sub.BAD lacI
TT .DELTA.sopB1925 .DELTA.agfBAC811) to evaluate relative IgG
response to PspA-Rx1 expressed from .chi.9558(pYA3634) in BALB/c
mice compared to .chi.9088(pYA3634) (.DELTA.P.sub.fur33::TT araC
P.sub.BAD fur .DELTA.pmi-2426 .DELTA.(gmd-fcl)-26 .DELTA.asdA33)
and .chi.8133(pYA3634) (.DELTA.cya-27 .DELTA.crp-27 .DELTA.asdA16).
Groups of 7-week-old female BALB/c mice were orally administered
approximately 10.sup.9 CFU of each strain and boosted with the same
dose at 8 weeks. Blood was obtained by mandibular vein puncture
with heparinized capillary tubes at biweekly intervals. ELISA was
performed to determine IgG antibody titers to PspA, S. Typhimurium
LPS. FIG. 50 shows total serum IgG titers to the PspA protein and
to S. Typhimurium LPS.
[0591] Four weeks after the second oral immunization, mice were
challenged in two experiments with approximately 5.times.10.sup.4
CFU of S. pneumoniae WU2. Both experiments gave similar results,
and the data have been pooled for presentation and analysis. This
challenge dose resulted in the deaths of 100% of the unvaccinated
mice, with a mean time to death of 2-3 days.
[0592] The percent protection rate and the number of days of
survival after challenge with virulent S. pneumoniae strain WU2 are
shown in FIG. 51. Seventy-one percent of the mice immunized with
.chi.9558(pYA3634) were protected from pneumococcal challenge. This
is significantly higher than the level of protection observed for
the .DELTA.cya .DELTA.crp strain .chi.8133(pYA3634) (p=0.0063).
Passive Transfer of Pneumococcal Immunity.
[0593] An experiment to demonstrate passive-antibody transfer of
protective immunity to pneumococcal challenge was conducted in
mice. Mice were orally inoculated with 1.times.10.sup.9 CFU of a
RASV-Sp strain containing either the empty vector pYA3493 or the
vector pYA3634 and boosted with the same strain and dose 8 weeks
after primary immunization. At week 12, sera from immunized mice
were collected and pooled.
[0594] Naive, syngeneic BALB/c mice received 100 .mu.l in the tail
vein of undiluted serum from pooled serum of immunized mice. All
groups were challenged intraperitoneally 12 h later with S.
pneumoniae WU2. The percent survival of mice receiving pooled serum
was assessed 15 days after challenge with S. pneumoniae WU2. Table
21 shows the percent survival of mice that were protected by
passive-antibody transfer from challenge with more than 250
LD.sub.50 doses of the virulent S. pneumoniae WU2.
[0595] Sera from mice immunized with S. Typhimurium
.chi.9558(pYA3634) passively protected 100% of mice challenged with
over 250 LD.sub.50 doses of the virulent S. pneumoniae WU2.
TABLE-US-00022 TABLE 21 Passive transfer of pneumococcal immunity
by serum from donors immunized with S. Typhimurium vaccines
expressing PspA Volume of % survival the donor of Strain No. serum
(.mu.l) pooled Donors immunized with expresses of administered
serum vaccine strain PspA mice IV recipients.sup.1 Saline control
-- 5 100 0 .chi.8133(pYA3493) No 5 100 0 .DELTA.cya-27
.DELTA.crp-27 .DELTA.asdA16 .chi.9088(pYA3493) No 5 100 0
.DELTA.pmi-2426 .DELTA.(gmd-fcl)-26 .DELTA.P.sub.fur81::TT araC
P.sub.BAD fur .DELTA.asdA33 .chi.9558(pYA3493) No 5 100 0
.DELTA.pmi-2426 .DELTA.(gmd-fcl)-26 .DELTA.P.sub.fur33::TT araC
P.sub.BAD fur .DELTA.P.sub.crp527::TT araC P.sub.BAD crp
.DELTA.asdA27::TT araC P.sub.BAD c2 .DELTA.araE25 .DELTA.araBAD23
.DELTA.relA198::araC P.sub.BAD lacI TT .DELTA.sopB1925
.DELTA.agfBAC811 .chi.8133(pYA3634) Yes 5 100 80 .chi.9088(pYA3634)
Yes 5 100 100 .chi.9558(pYA3634) Yes 5 100 100 .sup.1Mice were
challenged IP 12 h after receiving donor immune serum with >250
LD.sub.50 doses of S. pneumoniae WU2
Immunogenicity of .chi.9633(pYA4088), .chi.9639(pYA4088), and
.chi.9640(pYA4088) in Female 6- to 7-Week-Old BALB/c Mice.
[0596] The ability of the S. Typhi RASV-Sp strains administered
intranasally to BALB/c to induce serum antibody titers to PspA was
assessed (GCGH-ASU-SOP-074-00, see CMC section of the IND
application). Mice were inoculated intranasally with 10 .mu.l of
approximately 10.sup.9 CFU of a RASV strain with either the empty
vector pYA3493 or the PspA.sup.+ vector pYA4088. Sera were
collected 2, 4, 6 and 8 weeks after vaccination and anti-PspA, -LPS
and -OMP IgG titers determined by ELISA.
[0597] It should be noted that this type of immunogenicity assay
has been used by others even though we believe it is of marginal
value. This is because S. Typhi (wild-type or mutant) is unable to
successfully invade and persist in murine cells or lymphoid tissues
as is S. Typhimurium. FIGS. 52A-C show the total IgG response to
PspA, LPS and OMP from sera collected over an 8-week period after
intranasal administration of the RASV strains with the PspA plasmid
pYA4088 or the empty vector pYA3493. All RASV strains harboring
either pYA3493 or pYA4088 equally induced significant anti-LPS and
anti-OMP IgG titers as soon as two weeks post-inoculation. PspA IgG
titers gradually increased over the eight-week period from mice
administered the RASV-Sp strains. Although the group size was
small, the RASV-Sp Ty2 RpoS.sup.+ strain .chi.9640(pYA4088) induced
a slightly higher anti-PspA IgG titer than the ISP1820 derivative
.chi.9633(pYA4088).
Complement Deposition Assay and Passive Protection of Mice Using
Serum from Human Vaccine Volunteers.
[0598] Sera from the vaccine volunteers which test positive for
PspA will be evaluated for their ability to passively protect mice
from pneumococcal infection. Passive transfer of protective
immunity to pneumococcal challenge will be demonstrated by transfer
of pre- and post-immune serum and the antibodies it contains to
naive unimmunized mice followed by intravenous challenge with
virulent S. pneumoniae.
[0599] As an additional measure of the protective capacity of the
anti-PspA response in volunteers, sera may be further evaluated by
the complement deposition assay. This test will quantitatively
evaluate the ability of antibody in pre- and post-immune sera to
facilitate deposition of complement C3 onto S. pneumoniae.
Immunization of humans with PspA has been shown to lead to elevated
levels of antibody to PspA, increases in the ability of the sera to
mediate complement deposition on S. pneumoniae, and increases in
the ability of human sera to protect mice from fatal pneumococcal
infection. The deposition of complement on S. pneumoniae has been
shown to correlate inversely with the ability of S. pneumoniae to
cause invasive disease.
Example 8: Non-Clinical Assessment of Safety
[0600] Additional safety tests were conducted to address concerns
raised regarding the apparent lack of adequate safety data for the
ISP1820 derivative strain .chi.9633(pYA4088). Another ISP1820
derivative, .chi.8110 .DELTA.cfs), (.DELTA.cya-27
.DELTA.crp-pabA-40 Acts), was shown to be safe in Phase I clinical
trials. To bridge the previous human data with .chi.8110 to the
present vaccine candidate .chi.9633(pYA4088), additional safety
data were generated to demonstrate that .chi.9633(pYA4088) is
equivalent to or more attenuated than .chi.8110 as evaluated by
survival in human blood and peripheral blood monocytes. Comparisons
to the Ty21a vaccine Vivotif.RTM. which is the gold standard for
live Salmonella vaccine safety were also included in the following
non-clinical assessment of safety.
Survival of RASV-Sp Strains in Human Blood
[0601] The bactericidal effects of heat-treated and untreated whole
blood were compared by incubating the RASV-Sp strains and wild-type
S. Typhi counterparts in the presence of normal whole blood
(GCGH-ASU-SOP-081-01, see CMC section of the IND application).
[0602] Approximately 1.times.10.sup.6 CFU of each RASV-Sp strain,
.chi.8110, Ty21a and their wild-type counterparts were added to
duplicate 1.5 ml blood aliquots from volunteers. Blood was
collected in accordance with the ASU human use protocol
#0804002872. Survival of the Salmonella strains was assayed in
blood that had been heat inactivated (HI) by incubation at
55.degree. C. for one hour prior to inoculation, or in untreated,
active (A) blood. Viability of the Salmonella strains was measured
by plating samples on permissive media 0, 3, 6 and 18 hours after
inoculation. FIG. 53 shows the geometric mean of the CFU recovered
of at least 3 trials.+-.the standard deviation.
[0603] The RASV-Sp candidates are severely attenuated in their
ability to survive in whole human blood as compared to wild-type S.
Typhi and .chi.8110. Vaccine strain levels drop below the threshold
of detection within 3 hours and the strains did not regrow at the
later timepoints of the assay. This is in contrast to .chi.3744,
.chi.3769 and .chi.8110, which are not only present at
significantly higher levels, but also replicate in the blood at the
later timepoints of the assay. The RASV-Sp candidates, including
the ISP1820 derivative .chi.9633(pYA4088), are as attenuated as
Ty21a and more attenuated than the ISP1820 RASV .chi.8110 used in a
previous clinical trial.
Sensitivity of RASV-Sp Strains to Native Guinea Pig Serum
Complement.
[0604] The bactericidal properties of guinea pig serum complement
were determined for the RASV-Sp strains and their wild-type
counterparts. Guinea pig complement was used for this assay because
of its high level of bacteriocidal activity.
[0605] The S. Typhi strains .chi.3744 (wild-type ISP1820),
.chi.3769 (wild-type Ty2), .chi.8438 (RpoS.sup.+ wild-type Ty2),
.chi.9633(pYA4088), .chi.9639(pYA4088) and .chi.9640(pYA4088) were
prepared following GCGH-ASU-SOP-062-01 Preparation of RASV-Sp
dosages for adult volunteers. The sensitivity of the cells to
complement was assayed following GCGH-ASU-SOP-091-00 Resistance of
RASV-Sp strains to guinea pig complement. Strains were assayed in
PBS only, complement (purified from guinea pig serum) only, and
complement with anti-S. Typhi O-antigen D.sub.1 opsonizing
antibody. Reactions were incubated for 3 hours at 37.degree. C.,
and then the viability of the Salmonella strains was measured by
plating on permissive media. Data shown in FIG. 54 represent the
average CFU/ml.
[0606] Both the wild-type Salmonella Typhi strains and the RASV-Sp
strains are sensitive to killing by complement in the presence of
Salmonella Typhi O-antigen specific D.sub.1 antibody. The vaccine
strains are killed to a moderately higher degree than the wild-type
strains. In the absence of S. Typhi-specific antibody, the
wild-type strains are resistant to complement-mediated killing.
However, the RASV-Sp strains exhibit a high level of sensitivity to
complement-mediated killing even in the absence of opsonizing
antibody.
Survival of RASV-Sp Strains in Peripheral Human Mononuclear
Cells.
[0607] Rubin et al. demonstrated that in patients with typhoid
fever, circulating S. Typhi cells are associated with mononuclear
cell-platelet fraction of whole blood. Because this serovar does
not typically cause disease in mice or other animals, the
development of rapid ex-vivo assays using freshly elutriated
peripheral blood mononuclear cells (PBMCs) have been demonstrated
as reliable tools for determining attenuation of S. Typhi for
vaccine research and development.
[0608] PBMCs derived from blood of 3 different volunteers were
elutriated following GCGH-ASU-SOP-082-01 Survival of RASV-Sp
strains in peripheral human mononuclear cells. After incubation of
PBMCs and bacteria in 24-well culture plates for 1, 3 and 23
additional hours, PBMCs were lysed and cell lysates were plated
onto permissive media to determine viable CFU. Survivability of the
RASV-Sp strains .chi.9633(pYA4088), .chi.9639(pYA4088) and
.chi.9640(pYA4088) compared to .chi.8110 (ISP1820 .DELTA.cya-27
.DELTA.crp-pabA-40 .DELTA.cfs), Ty21a and to wild-type S. Typhi
.chi.3744 (wild-type ISP1820), .chi.3769 (wild-type Ty2), .chi.8438
(RpoS.sup.+ wild-type Ty2) are shown in FIGS. 55A-C. The data shown
are the geometric means+standard deviations of three separate
assays.
[0609] The peripheral blood mononuclear cell assay used to measure
the invasion and persistence of the S. Typhi strains readily
distinguished between virulent S. Typhi and the attenuated RASV-Sp
strains and Ty21a, known to survive poorly both in vitro and in
vivo. The wild-type Ty2 and ISP1820 strains invaded and persisted
at a significantly higher rate than the RASV-Sp strains and Ty21a
(p<0.05).
[0610] Both .chi.9639(pYA4088) and Ty21a were the least fit to
survive and persist in PBMCs compared to the wild-type Ty2
RpoS.sup.- strain (p=0.0022 and 0.0022 at 24 hours, respectively),
which may be a consequence of possessing the rpoS mutation. These
results are consistent with the RpoS.sup.- phenotype in that null
mutants are susceptible to killing by macrophage and exhibit
increased sensitivity to environmental stress.
[0611] The ISP1820 derivative .chi.9633(pYA4088) was equivalent to
.chi.8110 in surviving within PBMCs at 2, 4 and 24 hours (p=1.00,
0.505 and 0.878, respectively) and both strains were significantly
reduced in their ability to invade and persist within PBMCs
compared to the wild-type ISP1820 at all timepoints.
[0612] Together these data demonstrate further safety of the
RASV-Sp strains. Additionally the ability of the ISP1820 derivative
.chi.9633(pYA4088) to invade to a lesser degree than the wild-type
ISP1820 but persist at a low level in PBMCs demonstrates that this
strain is not compromised to reach host target cells to deliver the
PspA for antigen processing.
[0613] Taken collectively, the RASV-Sp strains are adequately
attenuated due to their extreme sensitivity to complement-mediated
killing, their poor survival in whole human blood and in fresh
elutriated peripheral blood mononuclear cells. The ISP1820
derivative .chi.9633(pYA4088), although sufficiently attenuated by
the data presented here, may display the best attributes for
antigen presentation to the appropriate antigen-presenting cells of
the host immune system.
RASV-Sp Shedding and Survival in Human Stool
[0614] A consequence of oral administration of live Salmonella
vaccine organisms is that they can be shed transiently in the stool
of vaccine recipients. An important aspect of the potential impact
of environmental release of a live vaccine is to evaluate the
duration, rate of shedding and the survival rate. Endeavors to
develop live vaccines that reduce shedding have been met with
variable success. The licensed live oral typhoid vaccine, serovar
Typhi Ty21a, is shed at low rates in the stools of most vaccinees
for 1 to 4 days. Ideally, it is desirable to limit the number of
genetically modified microorganisms entering the environment,
without decreasing vaccine immunogenicity or efficacy.
[0615] An initial assessment of the duration of shedding following
oral inoculation was conducted in 6-week old adult mice. The S.
Typhi RASV-Sp strains .chi.9633(pYA4088), .chi.9639(pYA4088), and
.chi.9640(pYA4088), the S. Typhimurium RASV-Sp counterpart
.chi.9558(pYA4088) and the S. Typhi wild-type strains .chi.3744,
.chi.3769 and .chi.8438 were grown. Approximately 1.times.10.sup.9
CFU of each strain was administered orally to groups of 3 mice.
Shedding was monitored for 6 days after inoculation by homogenizing
fecal pellets and plating on selectively differential media. The
data shown in Table 22 represent the average number of CFU/ml
detected for each group. None of the S. Typhi strains (wild-type or
RASV-Sp) were detected more than 3 hours following the inoculation.
The S. Typhimurium RASV-Sp strain .chi.9558(pYA4088) was also not
detected after the initial day of inoculation. These data indicate
that significant levels of vaccine organism shedding are confined
to the initial day of immunization. Low-level shedding (less than
10.sup.3 CFU/ml) may occur for a slightly longer period.
TABLE-US-00023 TABLE 22 Fecal shedding of RASV-Sp strains and S.
Typhi wild-type strains following oral inoculation of mice. 3 Hours
18 Hours Day 2 Day 4 Day 6 (CFU/ (CFU/ (CFU/ (CFU/ (CFU/ Strain ml)
ml) ml) ml) ml) .chi.9558(pYA4088) 1.7 .times. 10.sup.7
<10.sup.3 <10.sup.3 <10.sup.3 <10.sup.3 .chi.3744 1.7
.times. 10.sup.7 <10.sup.3 <10.sup.3 <10.sup.3
<10.sup.3 .chi.9633(pYA4088) 8.0 .times. 10.sup.6 <10.sup.3
<10.sup.3 <10.sup.3 <10.sup.3 .chi.3769 1.0 .times.
10.sup.7 <10.sup.3 <10.sup.3 <10.sup.3 <10.sup.3
.chi.9639(pYA4088) 1.6 .times. 10.sup.7 <10.sup.3 <10.sup.3
<10.sup.3 <10.sup.3 .chi.8438 1.8 .times. 10.sup.7
<10.sup.3 <10.sup.3 <10.sup.3 <10.sup.3
.chi.9640(pYA4088) 1.6 .times. 10.sup.6 <10.sup.3 <10.sup.3
<10.sup.3 <10.sup.3 Limit of detection for this assay was
10.sup.3 CFU/ml
[0616] Since S. Typhi is unable to efficiently attach to and invade
to the intestinal epithelial cells of mice, the results of the
previous study may not accurately represent the duration of
shedding from a human host. In order to gather data about the
competitive fitness of the strains in the human intestinal
environment, the RASV-Sp and wild-type S. Typhi strains were
evaluated in anaerobic human stool samples. Viability of the S.
Typhi strains was assessed by plating dilutions onto selective
media 1, 3, 7 and 10 days after inoculation of fresh stool
suspensions with approximately 1.times.10.sup.8 CFU/ml. Inoculated
samples were incubated at 37.degree. C. in an anaerobic
environment. The limit of detection for recovering the S. Typhi
strains was 10.sup.4 CFU/ml.
[0617] FIG. 56 shows the survival of the S. Typhi wild-type
.chi.3744 (wild-type ISP1820), .chi.3769 (wild-type Ty2), .chi.8438
(RpoS.sup.+ wild-type Ty2) and RASV-Sp strains .chi.9633(pYA4088),
.chi.9639(pYA4088) and .chi.9640(pYA4088) in human stool over the
10-day period of evaluation. The RASV-Sp strains were not
recoverable 24 hours after inoculation of the stool samples and
remained below the threshold of detection (10.sup.4 CFU) throughout
the remainder of the study. The wild-type strains, however,
persisted through day 3 at measurable titers above 10.sup.4 CFU and
then fell below the level of detection through day 10 of the
study.
[0618] These data represent the worst case scenario as the RASV-Sp
strains were prepared in this study to allow the regulated-delayed
expression of the near wild-type attributes that would endow the
strains with characteristics that would make them most fit for
survival. In reality, once ingested by volunteers, the strains will
eventually lose and no longer display these protective attributes
due to the absence of exogenous arabinose and mannose and would
rapidly succumb to the harsh and competitive environment present in
stool.
Survival of S. Typhi in Canal Water, Chlorinated Water and
Sewage
[0619] The aim of this study was to compare the survivability of
the RASV-Sp strains and S. Typhi wild-type counterparts in several
conditions that mimic the environment and to address concerns
regarding the impact of releasing live attenuated,
genetically-modified organisms into the environment.
[0620] Three environmental conditions were prepared to serve as
test material for assessing survivability of the S. Typhi strains.
Chlorinated water was prepared to contain approximately 3 to 5 ppm
chlorine. The S. Typhi test strains were washed twice to remove
residual media and approximately 1.times.10.sup.8 CFU of each
strain were added to triplicate tubes containing the test solution.
Raw sewage was retrieved from a local waste water treatment plant
in Phoenix, Ariz. Untreated canal water was collected from the
Phoenix metropolitan area. Viability of the S. Typhi strains was
assessed by plating dilutions onto selective media 1, 3, 7 and 10
days after inoculation of the triplicate test solutions with
approximately 1.times.10.sup.8 CFU/ml. The limit of detection for
recovering the S. Typhi strains was 10.sup.4 CFU/ml.
[0621] FIG. 57A-C shows the survival of the S. Typhi wild-type
.chi.3744 (wild-type ISP1820), .chi.3769 (wild-type Ty2), .chi.8438
(RpoS.sup.+ wild-type Ty2) and RASV-Sp strains .chi.9633(pYA4088),
.chi.9639(pYA4088) and .chi.9640(pYA4088) in the environmental test
solutions. The RASV-Sp and wild-type strains were extremely
sensitive to chlorinated water experiencing several logs of killing
after a 30-minute exposure (FIG. 57A). The RASV-Sp strains were
less fit than the wild-type strains to persist in canal water
decreasing more than 3 logs in titer over the 10-day evaluation
period (FIG. 57B). Titers of the RASV-Sp strains in raw sewage
dropped steadily decreasing more than 3 logs in titer over the
10-day period (FIG. 57C). These data show that the RASV-Sp strains
did not display any enhanced attributes to survive in these
environmental test solutions over the Ty2 or ISP1820 wild-type
strains.
[0622] In summary, the data show that the RASV-Sp strains do not
have a competitive advantage in chlorinated water, untreated
surface water or sewage over naturally-occurring organisms and are
no more likely to persist in these conditions than the wild-type
Salmonella Typhi.
Example 9. Response to S. Typhi Vaccines in Adult Mice Immunized by
Intranasal Response
Immune Response to S. Typhi Vaccines in Adult Mice Immunized by
Intranasal Response.
[0623] Adult BALB/c mice (7 weeks) were inoculated intranasally
with approximately 1.times.10.sup.9 CFU of RAStyV strains carrying
either rPspA expression plasmid pYA4088 or control plasmid pYA3493
in 10 .mu.l, and boosted with the same dose of the same strain six
weeks later. Sera were collected 2, 4, 6 and 8 weeks after
vaccination and serum IgG responses to rPspA, S. Typhi LPS and S.
Typhi OMPs were measured by ELISA. This experiment was performed
twice, with each group (8 mice) receiving approximately the same
dose of vaccine. Sera from all mice in a group were pooled for
analysis. Absorbance levels of a secondary anti-mouse antibody
conjugated to HRP was recorded at 405 nm using an automated ELISA
plate reader (model EL311SX; Biotek, Winooski, Vt.). Absorbance
readings that were 0.1 higher than PBS control values were
considered positive. The results from both experiments were similar
and have been pooled for analysis.
[0624] Results:
[0625] All mice immunized with strains expressing pspA developed
anti-PspA antibodies (FIG. 58A). Anti-PspA titers were boosted
after the second immunization at 6 weeks. Strain .chi.9640(pYA4088)
(Ty2 RpoS.sup.+) induced a significantly higher anti-rPspA IgG
titer in mice than those of either the ISP1820 derivative
.chi.9633(pYA4088), or the Ty2 derivative .chi.9639(pYA4088) at all
time points (P<0.01). After boosting, the anti-rPspA IgG
antibody levels in .chi.9639(pYA4088) immunized mice were
significantly higher than the mice immunized with
.chi.9633(pYA4088) (P<0.05). No anti-PspA IgG was detected in
mice immunized with PBS or strains carrying pYA3493.
[0626] All RAStyV strains induced significant anti-LPS titers (FIG.
58B) and OMPs (FIG. 58C) as early as two weeks post inoculation.
After the second immunization, significant boosting of serum
antibody responses to LPS and OMPs was observed (P<0.01).
[0627] Mucosal IgA anti-PspA responses were slow to develop, but
reached high titers after boosting (FIG. 58D).
Protection of Adult Mice Immunized with S. Typhi Vaccines Against
Challenge with Virulent S. pneumoniae.
[0628] Method: At week 10, mice were challenged by intraperitoneal
injection with 1.0.times.10.sup.4 CFU of S. pneumoniae WU2 (50
LD.sub.50) in 100 .mu.l BSG. Challenged mice were monitored daily
for 30 days.
[0629] Result:
[0630] All mice immunized with three S. Typhi vaccine strains
expressing pspA were significantly protected compared with controls
(FIG. 41). The protection afforded by the Ty2 derivatives,
.chi.9639 (pYA4088) and .chi.9640 (pYA4088) was significantly
greater than that the protective effects of .chi.9633 (pYA4088)
(**, P<0.01).
Example 10. Comparative Phase I Protocol to Test Safety and
Immunogenicity in Adult Volunteers of Three Recombinant Attenuated
Salmonella Typhi Vaccine Vectors Producing Streptococcus pneumoniae
Surface Protein Antigen PspA
[0631] This trial was conducted in compliance with the protocol,
International Conference on Harmonisation Good Clinical Practice E6
(ICH-GCP) and the applicable Food and Drug Administration and other
Department of Health and Human Services regulatory requirements.
Study design is summarized below and in FIG. 59.
Objectives:
[0632] Objective 1.
[0633] To evaluate maximum safe tolerable single dose levels of the
three recombinant attenuated S. Typhi vaccine vectors
(.chi.9639(pYA4088) S. Typhi Ty2 RpoS.sup.-, .chi.9640(pYA4088) S.
Typhi Ty2 RpoS.sup.+ and .chi.9633(pYA4088) S. Typhi ISP1820) using
dose escalation studies in healthy adult volunteers.
[0634] Objective 2.
[0635] To evaluate immunogenicity of the three recombinant
attenuated S. Typhi vaccine vectors [.chi.9639(pYA4088) S. Typhi
Ty2 RpoS.sup.-, .chi.9640(pYA4088) S. Typhi Ty2 RpoS.sup.+ and
.chi.9633(pYA4088) S. Typhi ISP1820] with regard to their abilities
to induce mucosal and systemic antibody and cellular immune
responses to the S. pneumoniae PspA antigen and to Salmonella LPS
and outer membrane protein (OMP) antigens.
Study Outcome Measures
[0636] Primary Outcome Measures:
[0637] Safety and tolerability will be measured by assessment of
reactogenicity and Adverse Events following vaccination. Escalation
to the next dose level will occur only after review of the safety
data from day 28 post-inoculation of the previous Arm.
[0638] Secondary Outcome Measures:
[0639] Immunogenicity testing will include antibody and/or cellular
responses to vaccine at Days 0, 7, 28, 84 and 168.
Hypotheses Tested
[0640] The recombinant attenuated .chi.9639(pYA4088) S. Typhi Ty2
RpoS.sup.-, .chi.9640(pYA4088) S. Typhi Ty2 RpoS.sup.+ and
.chi.9633(pYA4088) S. Typhi ISP1820 vaccine vectors will be safe
when given orally to healthy adult human volunteers.
[0641] The .chi.9640(pYA4088) S. Typhi Ty2 RpoS+ recombinant
attenuated vaccine vector will induce higher titers of antibodies
to the Streptococcus pneumoniae PspA antigen than will the parental
.chi.9639(pYA4088) S. Typhi Ty2 RpoS.sup.- vector.
[0642] The .chi.9633(pYA4088) S. Typhi ISP1820 recombinant
attenuated vaccine vector will induce higher titers of antibodies
to the Streptococcus pneumoniae PspA antigen than will either the
parental .chi.9639(pYA4088) S. Typhi Ty2 RpoS.sup.- or
.chi.9640(pYA4088) S. Typhi Ty2 RpoS.sup.+ vaccine.
Study Design
[0643] The study was a dose escalating study divided into four Arms
(1-4). Each Arm will consist of 3 groups (A-C) of 5 healthy young
adults 18-40 years of age and each group (A-C) will be administered
one of three different vaccine vectors. Each subject will receive
an oral dose of vaccine on day 0 and be followed closely to
determine the safety, tolerability and immunogenicity of the
vector. The vaccine vector found to be both safe and immunogenic
with maximum immunogenicity and ease of genetic manipulation will
be selected as the parent for second generation vaccine vectors to
deliver multiple S. pneumoniae protective antigens.
[0644] Arm 1 will evaluate the attenuated strains of
.chi.9639(pYA4088) S. Typhi Ty2 RpoS.sup.-, .chi.9640(pYA4088) S.
Typhi Ty2 RpoS.sup.+ and .chi.9633(pYA4088) S. Typhi ISP1820 in an
initial single oral dose (10.sup.7 CFU), evaluating safety and
immunogenicity of the recombinant attenuated strains. An escalation
in dose will proceed only after demonstrating the safety and
tolerability of the lower vaccine dose through Day 28.
[0645] Arm 2 will evaluate an escalation of dose (10.sup.8 CFU) for
safety and immunogenicity in 3 groups of 5 new volunteers. An
escalation dose will proceed only after demonstrating the safety
and tolerability of the lower vaccine dose through Day 28.
[0646] Arm 3 will evaluate an escalation of dose (10.sup.9 CFU) for
safety and immunogenicity in 3 groups of 5 new volunteers. An
escalation dose will proceed only after demonstrating the safety
and tolerability of the lower vaccine dose through Day 28.
[0647] Arm 4 will evaluate an escalation of dose (10.sup.10 CFU)
for safety and immunogenicity in 3 groups of 5 new volunteers. This
is the highest dose to be tested
[0648] The dose escalation schedule is provided below:
TABLE-US-00024 TABLE 23 Vaccination Schedule Vaccine Groups and
Dose A B C (n = 5/ .chi.9639(pYA4088) .chi.9640(pYA4088)
.chi.9633(pYA4088) group) Ty2 RpoS.sup.- Ty2 RpoS.sup.+ ISP1820 Arm
1 10.sup.7 CFU 10.sup.7 CFU 10.sup.7 CFU Arm 2 10.sup.8 CFU
10.sup.8 CFU 10.sup.8 CFU Arm 3 10.sup.9 CFU 10.sup.9 CFU 10.sup.9
CFU Arm 4 10.sup.10 CFU 10.sup.10 CFU 10.sup.10 CFU
[0649] The study will enroll Arms 1 through Arms 4 in succession as
data are reviewed following each Arm and the Safety Monitoring
Committee (SMC) authorizes the next Arm to enroll based on review
of 28-day safety data including final blood and stool culture
results obtained from previous Arm. This review cycle allows for an
interval of a minimum of 35 days of review of all data from the
current Arm, after enrollment of the last subjects in the current
Arm, before proceeding to the next higher dosage Arm of the
study.
Maximum Limit of Tolerability and Dose Escalation of a Specific
Strain
[0650] Escalation to the next dose level of any of the three
vaccine vectors will occur only if the safety data in the preceding
dose level cohort for a specific vaccine are acceptable to the SMC
and the PI. Escalation to higher dose levels for each of the three
vaccines shall proceed in this manner until the highest dose level
is reached, or dose-limiting toxicity (maximum limit of
tolerability) prevents further dose escalation. Dose escalation of
a specific strain shall not proceed in the event that: 3 or more
individuals within 1 dose level develop the same severe laboratory
abnormality and the abnormality is deemed medically significant by
the SMC and is determined to be associated with vaccine; or if 2 or
more individuals develop a severe systemic reaction that is
determined to be associated with the vaccine; or if 1 individual
develops an SAE determined to be associated with vaccine.
Subject Selection Criteria
[0651] Volunteers will be healthy 18-40 year old male or
non-pregnant female adults who fully understand the purpose and
details of the study. Subject exclusion criteria include history of
Salmonella infection or vaccination, and a history of pneumococcal
vaccine.
Sequence CWU 1
1
58115DNAArtificial SequenceSALMONELLA 1agggtggtga atgtg
15215DNAArtificial SequenceSALMONELLA 2aggatggtga atatg
15314DNAArtificial SequenceSALMONELLA 3aggatggtga atag
14415DNAArtificial SequenceSALMONELLA 4agggtggtga atgtg
15515DNAArtificial SequenceSALMONELLA 5aggatggtga atatg
15615DNAArtificial SequenceSALMONELLA 6aggatggtga atatg
1571094DNAArtificial SequenceSALMONELLA 7agggtggtga atgtgaaacc
agtaacgtta tacgatgtcg cagagtatgc cggtgtctct 60tatcagaccg tttcccgcgt
ggtgaaccag gccagccacg ttctgcgaaa acgcgggaaa 120aagtggaagc
ggcgatggcg gagctgaatt acattcccaa ccgcgtggca caacaactgg
180cgggcaaaca gtcgttgctg attggcgttg ccacctccag tctggccctg
cacgcgccgt 240cgcaaattgt cgcggcgatt aaatctcgcg ccgatcaact
gggtgccagc gtggtggtgt 300cgatggtaga acgaagcggc gtcgaagcct
gtaaagcggc ggtgcacaat cttctcgcgc 360aacgcgtcag tgggctgatc
attaactatc cgctggatga ccaggatgcc attgctgtgg 420aagctgcctg
cactaatgtt ccggcgttat ttcttgatgt ctctgaccag acacccatca
480acagtattat tttctcccat gaagacggta cgcgactggg cgtggagcat
ctggtcgcat 540tgggtcacca gcaaatcgcg ctgttagcgg gcccattaag
ttctgtctcg gcgcgtctgc 600gtctggctgg ctggcataaa tatctcactc
gcaatcaaat tcagccgata gcggaacggg 660aaggcgactg gagtgccatg
tccggttttc aacaaaccat gcaaatgctg aatgagggca 720tcgttcccac
tgcgatgctg gttgccaacg atcagatggc gctgggcgca atgcgcgcca
780ttaccgagtc cgggctgcgc gttggtgcgg atatctcggt agtgggatac
gacgataccg 840aagacagctc atgttatatc ccgccgttaa ccaccatcaa
acaggatttt cgcctgctgg 900ggcaaaccag cgtggaccgc ttgctgcaac
tctctcaggg ccaggcggtg aagggcaatc 960agctgttgcc cgtctcactg
gtaaaaagaa aaaccaccct ggcgcccaat acgcaaaccg 1020cctctccccg
cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg
1080aaagcgggca gtga 109481094DNAArtificial SequenceSALMONELLA
8aggatggtga atatgaaacc agtaacgtta tacgatgtcg cagagtatgc cggtgtctct
60tatcagaccg tttcccgcgt ggtgaaccag gccagccacg ttctgcgaaa acgcgggaaa
120aagtggaagc ggcgatggcg gagctgaatt acattcccaa ccgcgtggca
caacaactgg 180cgggcaaaca gtcgttgctg attggcgttg ccacctccag
tctggccctg cacgcgccgt 240cgcaaattgt cgcggcgatt aaatctcgcg
ccgatcaact gggtgccagc gtggtggtgt 300cgatggtaga acgaagcggc
gtcgaagcct gtaaagcggc ggtgcacaat cttctcgcgc 360aacgcgtcag
tgggctgatc attaactatc cgctggatga ccaggatgcc attgctgtgg
420aagctgcctg cactaatgtt ccggcgttat ttcttgatgt ctctgaccag
acacccatca 480acagtattat tttctcccat gaagacggta cgcgactggg
cgtggagcat ctggtcgcat 540tgggtcacca gcaaatcgcg ctgttagcgg
gcccattaag ttctgtctcg gcgcgtctgc 600gtctggctgg ctggcataaa
tatctcactc gcaatcaaat tcagccgata gcggaacggg 660aaggcgactg
gagtgccatg tccggttttc aacaaaccat gcaaatgctg aatgagggca
720tcgttcccac tgcgatgctg gttgccaacg atcagatggc gctgggcgca
atgcgcgcca 780ttaccgagtc cgggctgcgc gttggtgcgg atatctcggt
agtgggatac gacgataccg 840aagacagctc atgttatatc ccgccgttaa
ccaccatcaa acaggatttt cgcctgctgg 900ggcaaaccag cgtggaccgc
ttgctgcaac tctctcaggg ccaggcggtg aagggcaatc 960agctgttgcc
cgtctcactg gtaaaaagaa aaaccaccct ggcgcccaat acgcaaaccg
1020cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt
tcccgactgg 1080aaagcgggca gtga 109491094DNAArtificial
SequenceSALMONELLA 9aggatggtga atatgaaacc agtaacgtta tacgatgtcg
cagagtatgc cggtgtctct 60tatcagaccg tttcccgcgt ggtgaaccag gccagccacg
ttctgcgaaa acgcgtgaaa 120aagtggaagc ggcgatggcg gagctgaatt
acattccgaa ccgcgtggca caacaactgg 180cgggcaaaca gtcgttgctg
attggcgttg ccacctccag tctggccctg cacgcgccgt 240cgcaaattgt
cgcggcgatt aaatctcgcg ccgatcaact gggtgccagc gtggtggtgt
300cgatggtaga acgtagcggc gtcgaagcct gtaaagcggc ggtgcacaat
cttctcgcgc 360aacgcgtcag tgggctgatc attaactatc cgctggatga
ccaggatgcc attgctgtgg 420aagctgcctg cactaatgtt ccggcgttat
ttcttgatgt ctctgaccag acaccgatca 480acagtattat tttctcccat
gaagacggta cgcgtctggg cgtggagcat ctggtcgcat 540tgggtcacca
gcaaatcgcg ctgttagcgg gcccattaag ttctgtctcg gcgcgtctgc
600gtctggctgg ctggcataaa tatctcactc gcaatcaaat tcagccgatc
gcggaacgtg 660aaggcgactg gagtgccatg tccggttttc aacaaaccat
gcaaatgctg aatgagggca 720tcgttccgac tgcgatgctg gttgccaacg
atcagatggc gctgggcgca atgcgcgcca 780ttaccgagtc cgggctgcgc
gttggtgcgg atatctcggt agtgggttac gacgataccg 840aagacagctc
atgttatatc ccgccgttaa ccaccatcaa acaggatttt cgcctgctgg
900ggcaaaccag cgtggaccgc ttgctgcaac tctctcaggg ccaggcggtg
aagggcaatc 960agctgttgcc cgtctcactg gtaaaacgta aaaccaccct
ggcgcccaat acgcaaaccg 1020cctctccgcg cgcgttggcc gattcattaa
tgcagctggc acgtcaggtt tcccgtctgg 1080aaagcgggca gtga
109410360PRTArtificial SequenceSALMONELLA 10Val Lys Pro Val Thr Leu
Tyr Asp Val Ala Glu Tyr Ala Gly Val Ser 1 5 10 15 Tyr Gln Thr Val
Ser Arg Val Val Asn Gln Ala Ser His Val Ser Ala 20 25 30 Lys Thr
Arg Glu Lys Val Glu Ala Ala Met Ala Glu Leu Asn Tyr Ile 35 40 45
Pro Asn Arg Val Ala Gln Gln Leu Ala Gly Lys Gln Ser Leu Leu Ile 50
55 60 Gly Val Ala Thr Ser Ser Leu Ala Leu His Ala Pro Ser Gln Ile
Val 65 70 75 80 Ala Ala Ile Lys Ser Arg Ala Asp Gln Leu Gly Ala Ser
Val Val Val 85 90 95 Ser Met Val Glu Arg Ser Gly Val Glu Ala Cys
Lys Ala Ala Val His 100 105 110 Asn Leu Leu Ala Gln Arg Val Ser Gly
Leu Ile Ile Asn Tyr Pro Leu 115 120 125 Asp Asp Gln Asp Ala Ile Ala
Val Glu Ala Ala Cys Thr Asn Val Pro 130 135 140 Ala Leu Phe Leu Asp
Val Ser Asp Gln Thr Pro Ile Asn Ser Ile Ile 145 150 155 160 Phe Ser
His Glu Asp Gly Thr Arg Leu Gly Val Glu His Leu Val Ala 165 170 175
Leu Gly His Gln Gln Ile Ala Leu Leu Ala Gly Pro Leu Ser Ser Val 180
185 190 Ser Ala Arg Leu Arg Leu Ala Gly Trp His Lys Tyr Leu Thr Arg
Asn 195 200 205 Gln Ile Gln Pro Ile Ala Glu Arg Glu Gly Asp Trp Ser
Ala Met Ser 210 215 220 Gly Phe Gln Gln Thr Met Gln Met Leu Asn Glu
Gly Ile Val Pro Thr 225 230 235 240 Ala Met Leu Val Ala Asn Asp Gln
Met Ala Leu Gly Ala Met Arg Ala 245 250 255 Ile Thr Glu Ser Gly Leu
Arg Val Gly Ala Asp Ile Ser Val Val Gly 260 265 270 Tyr Asp Asp Thr
Glu Asp Ser Ser Cys Tyr Ile Pro Pro Leu Thr Thr 275 280 285 Ile Lys
Gln Asp Phe Arg Leu Leu Gly Gln Thr Ser Val Asp Arg Leu 290 295 300
Leu Gln Leu Ser Gln Gly Gln Ala Val Lys Gly Asn Gln Leu Leu Pro 305
310 315 320 Val Ser Leu Val Lys Arg Lys Thr Thr Leu Ala Pro Asn Thr
Gln Thr 325 330 335 Ala Ser Pro Arg Ala Leu Ala Asp Ser Leu Met Gln
Leu Ala Arg Gln 340 345 350 Val Ser Arg Leu Glu Ser Gly Gln 355 360
1119DNAArtificial SequenceSALMONELLA 11aggagactta actatgaat
191219DNAArtificial SequenceSALMONELLA 12aggagactta actatgaat
191321DNAArtificial SequenceSALMONELLA 13taaggaggtt taactatgaa t
211421DNAArtificial SequenceSALMONELLA 14taaggaggtt taactatgaa a
2115651DNAArtificial SequenceSALMONELLA 15atgaatacac aattgatggg
tgagcgtatt cgcgctcgaa gaaaaaaact caagattaga 60caagccgctc ttggtaagat
ggtgggagtg tctaatgttg caatatcgca atgggagcgc 120tcggagactg
agccaaatgg ggagaacctg ttggcacttt cgaaggctct tcagtgctcc
180cctgactatt tgctgaaagg agatttaagc cagacaaacg ttgcctatca
tagtaggcat 240gagccaagag gatcataccc tcttatcagt tgggtaagcg
cagggcaatg gatggaagct 300gtagaacctt atcacaagcg cgcgatagag
aactggcacg acaccactgt agattgttca 360gaagattcat tttggcttga
tgtccaaggt gactctatga cagcaccggc agggttaagc 420attccagaag
gaatgataat tctggttgat cccgaagtcg aaccaagaaa cggcaagctg
480gttgttgcaa aattagaagg tgaaaacgag gccacattca aaaaattagt
tatggatgca 540ggccgaaagt ttttaaaacc attaaaccca caatatccga
tgatagaaat caacggaaac 600tgcaaaatca ttggcgtagt tgttgacgca
aaactcgcaa atcttccata a 65116651DNAArtificial SequenceSALMONELLA
16atgaatacac aattgatggg tgagcgtatt cgcgctcgtc gtaaaaaact caagattcgt
60caagccgctc ttggtaagat ggtgggtgtg tctaatgttg caatctcgca atgggagcgc
120tcggagactg agccaaatgg ggagaacctg ttggcacttt cgaaggctct
tcagtgctcc 180cctgactatt tgctgaaagg tgatttaagc cagacaaacg
ttgcctatca tagtcgtcat 240gagccacgtg gttcataccc tcttatcagt
tgggtaagcg cagggcaatg gatggaagct 300gtagaacctt atcacaagcg
cgcgatcgag aactggcacg acaccactgt agattgttca 360gaagattcat
tttggcttga tgtccaaggt gactctatga cagcaccggc agggttaagc
420attccagaag gtatgatcat tctggttgat ccggaagtcg aaccacgtaa
cggcaagctg 480gttgttgcaa aattagaagg tgaaaacgag gccacattca
aaaaattagt tatggatgca 540ggccgtaagt ttttaaaacc attaaaccca
caatatccga tgatcgaaat caacggtaac 600tgcaaaatca ttggcgtagt
tgttgacgca aaactcgcaa atcttccata a 65117216PRTArtificial
SequenceSALMONELLA 17Met Asn Thr Gln Leu Met Gly Glu Arg Ile Arg
Ala Arg Lys Lys Leu 1 5 10 15 Lys Leu Ile Arg Gln Ala Ala Leu Gly
Lys Met Val Gly Val Ser Asn 20 25 30 Val Ala Ile Ser Gln Trp Glu
Arg Ser Glu Thr Glu Pro Asn Gly Glu 35 40 45 Asn Leu Leu Ala Leu
Ser Lys Ala Leu Gln Cys Ser Pro Asp Tyr Leu 50 55 60 Leu Lys Gly
Asp Leu Ser Gln Thr Asn Val Ala Tyr His Ser Arg His 65 70 75 80 Glu
Pro Arg Gly Ser Tyr Pro Leu Ile Ser Trp Val Ser Ala Gly Gln 85 90
95 Trp Met Glu Ala Val Glu Pro Tyr His Lys Arg Ala Ile Glu Asn Trp
100 105 110 His Asp Thr Thr Val Asp Cys Ser Glu Asp Ser Phe Trp Leu
Asp Val 115 120 125 Gln Gly Asp Ser Met Thr Ala Pro Ala Gly Leu Ser
Ile Pro Glu Gly 130 135 140 Met Ile Ile Leu Val Asp Pro Glu Val Glu
Pro Arg Asn Gly Lys Leu 145 150 155 160 Val Val Ala Lys Leu Glu Gly
Glu Asn Glu Ala Thr Phe Lys Lys Leu 165 170 175 Val Met Asp Ala Gly
Arg Lys Phe Leu Lys Pro Leu Asn Pro Gln Tyr 180 185 190 Pro Met Ile
Glu Ile Asn Gly Asn Cys Lys Ile Ile Gly Val Val Val 195 200 205 Asp
Ala Lys Leu Ala Asn Leu Pro 210 215 18112DNAArtificial
SequenceSALMONELLA 18tttatccata agattagcgg atcctacctg acgcttttta
tcgcaactct ctactgtttc 60tccatacccg tttttttggg ctagcctcga gggtacctaa
ggaggtttaa ct 11219112DNAArtificial SequenceSALMONELLA 19tttatccata
agattagcgg atcctacctg acgcttttta tcgcaactct ctataatttc 60tccatacccg
tttttttggg ctagcctcga gggtacctaa ggaggtttaa ct 1122060DNAArtificial
SequenceSALMONELLA 20atgaatacac aattgatggg tgagcgtatt cgcgctcgtc
gtaaaaaact caagattcgt 602160DNAArtificial SequenceSALMONELLA
21atgaatacac aattgatggg tgagcgtatt cgcgctcgtc gtaaaaaact caagattcgt
602220PRTArtificial SequenceSALMONELLA 22Met Asn Thr Gln Leu Met
Gly Glu Arg Ile Arg Ala Arg Arg Lys Lys 1 5 10 15 Leu Lys Ile Arg
20 2320PRTArtificial SequenceSALMONELLA 23Met Lys Thr Gln Leu Met
Gly Glu Arg Ile Arg Ala Arg Arg Lys Lys 1 5 10 15 Leu Lys Ile Arg
20 2423DNAArtificial SequenceSALMONELLA 24aggacagatt ccgcatgact gac
232523DNAArtificial SequenceSALMONELLA 25aggacagatt ccgcgtgact gac
232623DNAArtificial SequenceSALMONELLA 26aaggcagatt ccgcgtgact gac
232723DNAArtificial SequenceSALMONELLA 27agggagaaga gatgatgcgc gta
232823DNAArtificial SequenceSALMONELLA 28agggagaaga ggtggtgcgc gta
232923DNAArtificial SequenceSALMONELLA 29aaggcgaaga ggtggtgcgc gta
233023DNAArtificial SequenceSALMONELLA 30aaggcgaaga ggtgatgcgc gta
233120DNAArtificial SequenceSALMONELLA 31aaggcgagat gatgcgcgta
203226DNAArtificial SequenceSALMONELLA 32aaggcctcga agagatgatg
cgcgta 2633114DNAArtificial SequenceSALMONELLA 33attcatagtt
aagtcatctt aaataaactt gactaaagat tcctttagta gataatttaa 60gtgttcttta
atttcggagc gagtctatgt ggatggagta agacgmtggc aatt
11434105DNAArtificial SequenceSALMONELLA 34cctggtacct aggcctctag
ataaataaaa gcagtttaca actcctagaa ttgtgaatat 60attatcacaa ttctaggata
gaataataaa agatctctgc agggc 1053534DNAArtificial SequenceSALMONELLA
35agaggtaccc tcgaggctag cccaaaaaaa cggg 343634DNAArtificial
SequenceSALMONELLA 36tggtctagag tcaagccgtc aattgtctga ttcg
343730DNAArtificial SequenceSALMONELLA 37ggaattctca ctgcccgctt
tccagtcggg 303838DNAArtificial SequenceSALMONELLA 38ccgctcgaga
gggtggtgaa tgtgaaacca gtaacgtt 383939DNAArtificial
SequenceSALMONELLA 39cccaagcttg agctcgaggg cgttccggcg ctggtagaa
394029DNAArtificial SequenceSALMONELLA 40gaagatctaa gggaccaggc
ctaccgaag 294135DNAArtificial SequenceSALMONELLA 41cggaattcac
cccagacagt aatcatgtag cggct 354231DNAArtificial SequenceSALMONELLA
42cgggtacccc agatattttc cagatcttca c 314330DNAArtificial
SequenceSALMONELLA 43ggaattctca ctgcccgctt tccagtcggg
304438DNAArtificial SequenceSALMONELLA 44ccgctcgaga ggatggtgaa
tatgaaacca gtaacgtt 384530DNAArtificial SequenceSALMONELLA
45tctccggtag ccagtcagtc taaagctgag 304676DNAArtificial
SequenceSALMONELLA 46ctaattcagc ttttttagca gcaatagttt tctctaaacc
ttctttaaag tagtcttcta 60cattattgtt ttcttc 764730DNAArtificial
SequenceSALMONELLA 47tctccggtag ccagtcagtc taaagctgag
304863DNAArtificial SequenceSALMONELLA 48tgctttctta aggtcagctt
cagttttttc taattcagct tttttagcag caatagtttt 60ctc
634928DNAArtificial SequenceSALMONELLA 49ggaattctct ccggtagcca
gtcagtct 285034DNAArtificial SequenceSALMONELLA 50ttcaagctta
ttatgctttc ttaaggtcag cttc 345134DNAArtificial SequenceSALMONELLA
51gggaattccg atgagtaaag gagaagaact tttc 345235DNAArtificial
SequenceSALMONELLA 52cggtgcaagc ttattatttg tatagttcat ccatg
355322DNAArtificial SequenceSALMONELLA 53cgggatcctg gtagggaacg ac
225434DNAArtificial SequenceSALMONELLA 54gatgccatgg tttaaactat
attcagcaaa tgcg 345535DNAArtificial SequenceSALMONELLA 55gatgccatgg
tctgtttcct cgtcttactc catcc 355623DNAArtificial SequenceSALMONELLA
56acatgcatgc ggacgatcga taa 235739DNAArtificial SequenceSALMONELLA
57cccaagcttg agctcgaggg cgttccggcg ctggtagaa 395831DNAArtificial
SequenceSALMONELLA 58cgggtacccc agatattttc cagatcttca c 31
* * * * *