U.S. patent application number 15/880838 was filed with the patent office on 2018-11-08 for increased production of ginsenosides through yeast cell organelle improvement.
The applicant listed for this patent is INTELLIGENT SYNTHETIC BIOLOGY CENTER, KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY. Invention is credited to In Seung JANG, Jong Geon JEGAL, Suk Chea JUNG, Seohyun KIM, Sun-Chang KIM, Ju Young LEE.
Application Number | 20180319852 15/880838 |
Document ID | / |
Family ID | 61692175 |
Filed Date | 2018-11-08 |
United States Patent
Application |
20180319852 |
Kind Code |
A1 |
LEE; Ju Young ; et
al. |
November 8, 2018 |
Increased production of ginsenosides through yeast cell organelle
improvement
Abstract
Provided are a recombinant yeast having improved ability to
produce ginsenoside, which is prepared by overexpressing INO2 and
INO4 or deleting OPT1 in a yeast having ability to produce
ginsenoside, a method of preparing the yeast, and a method of
producing ginsenoside by using the yeast.
Inventors: |
LEE; Ju Young; (Gyeonggi-do,
KR) ; JANG; In Seung; (Busan, KR) ; KIM;
Seohyun; (Busan, KR) ; KIM; Sun-Chang;
(Daejeon, KR) ; JUNG; Suk Chea; (Daejeon, KR)
; JEGAL; Jong Geon; (Ulsan, KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
INTELLIGENT SYNTHETIC BIOLOGY CENTER
KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY |
Daejeon
Daejeon |
|
KR
KR |
|
|
Family ID: |
61692175 |
Appl. No.: |
15/880838 |
Filed: |
January 26, 2018 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 14/395 20130101;
C12N 2501/60 20130101; C12P 33/20 20130101; C12P 19/56 20130101;
C12N 15/81 20130101 |
International
Class: |
C07K 14/395 20060101
C07K014/395; C12P 33/20 20060101 C12P033/20; C12P 19/56 20060101
C12P019/56 |
Foreign Application Data
Date |
Code |
Application Number |
May 2, 2017 |
KR |
10-2017-0056258 |
Claims
1. A recombinant yeast for producing ginsenoside or a precursor
thereof, wherein an expression level of a transcription factor of a
phospholipid biosynthetic gene is changed, as compared with its
intrinsic expression level,
2. The recombinant yeast of claim 1, wherein the transcription
factor of the phospholipid biosynthetic gene is one or more
selected from the group consisting of INO2(INOsitol requiring 2),
INO4(INOsitol requiring 4), and OPI1(OverProducer of Inositol
1).
3. The recombinant yeast of claim 2, wherein an expression level of
INO2 (INOsitol requiring 2) or INO4 (INOsitol requiring 4) or
expression levels of both of them is/are increased, as compared
with their intrinsic expression levels, or an expression level of
OPI1 (OverProducer of Inositol 1) is decreased, as compared with
its intrinsic expression level.
4. The recombinant yeast of claim 3, wherein the INO2 (INOsitol
requiring 2) gene is composed of a nucleotide sequence of SEQ ID
NO: 1, the INO4 (INOsitol requiring 4) gene is composed of a
nucleotide sequence of SEQ ID NO: 2, and the OPI1 (OverProducer of
Inositol 1) gene is composed of a nucleotide sequence of SEQ ID NO:
3,
5. The recombinant yeast of claim 1, wherein the yeast is selected
from the group consisting of Saccharomyces cerevisiae (S.
cerevisiae),Saccharomyces bayanus (S. bayanus), Saccharomyces
boulardii (S. boulardii), Saccharomyces bulderi (S. bulderi),
Saccharomyces cariocanus (S. cariocanus), Saccharomyces cariocus
(S. cariocus), Saccharomyces chevalieri (S. chevalieri),
Saccharomyces dairenensis (S. dairenensis), Saccharomyces
ellipsoideus (S. ellipsoideus), Saccharomyces eubayanus (S.
eubayanus), Saccharomyces exiguus (S. exiguus), Saccharomyces
florentinus (S. florentinus), Saccharomyces kluyveri (S. kluyveri),
Saccharomyces martiniae (S. martiniae), Saccharomyces monacensis
(S. monacensis), Saccharomyces norbensis (S. norbensis),
Saccharomyces paradoxus (S. paradoxus), Saccharomyces pastorianus
(S. pastorianus), Saccharomyces spencerorum (S. spencerorum),
Saccharomyces turicensis (S. turicensis), Saccharomyces unisporus
(S. unisporus), Saccharomyces uvarum (S. uvarum), and Saccharomyces
zonatus (S. zonatus)
6. The recombinant yeast of claim 1, wherein an expression level of
a gene involved in ginsenoside synthesis is increased, as compared
with its intrinsic expression level.
7. The recombinant yeast of claim 6, wherein the gene is one or
more genes selected from the group consisting of PgDDS (Panax
ginseng, dammarenediol-II synthase), PgPPDS (Panax ginseng
cytochrome P450 CYP716A47), PgCPR (Panax ginseng NADPH-cytochrome
P450 reductase), tHMG1 (S. cerevisiae HMG-CoA reductase), and PgSE
(Panax ginseng, squalene epoxidase).
8. The recombinant yeast of claim 1, wherein the precursor is
squalene or 2,3-oxidosqualene.
9. A method of preparing a recombinant yeast having improved
ability to produce ginsenoside, the method comprising the step of
changing an expression level of a transcription factor of a
phospholipid biosynthetic gene in a ginsenoside-producing yeast
strain.
10. The method of claim 9, wherein an expression level of the
phospholipid biosynthetic gene, INO2(INOsitol requiring 2) or INO4
(INOsitol requiring 4), or expression levels of both of them is/are
increased, as compared with their intrinsic expression levels, or
an expression level of OPI1(OverProducer of Inositol 1) is
decreased, as compared with its intrinsic expression level,
11. The method of claim 9, wherein the ginsenoside-producing yeast
strain has increased expression levels of one or more genes
selected from the group consisting of PgDDS (Panax ginseng,
dammarenediol-II synthase), PgPPDS (Panax ginseng cytochrome P450
CYP716A47), PgCPR (Panax ginseng NADPH-cytochrome P450 reductase),
tHMG1 (S. cerevisiae HMG-CoA reductase), and PgSE (Panax ginseng,
squalene epoxidase), as compared with their intrinsic expression
levels.
12. A method of preparing a recombinant yeast having improved
ability to produce a ginsenoside precursor, the method comprising
the step of changing an expression level of a transcription factor
of a phospholipid biosynthetic gene in a ginsenoside
precursor-producing yeast strain.
13. The method of preparing the recombinant yeast of claim 12,
wherein the ginsenoside precursor includes squalene and
2,3-oxidosqualene.
14. The method of preparing the recombinant yeast of claim 12,
wherein an expression level of the phospholipid biosynthetic gene,
INO2 (INOsitol requiring 2) or INO4 (INOsitol requiring 4), or
expression levels of both of them is/are increased, as compared
with their intrinsic expression levels, or an expression level of
OPI1 (OverProducer of Inositol 1) is decreased, as compared with
its intrinsic expression level.
15. A method of preparing ginsenoside or a precursor thereof, the
method comprising the step of culturing the recombinant yeast of
claim 1.
Description
BACKGROUND OF THE INVENTION
1. Field of the Invention
[0001] The present invention relates to a recombinant yeast for
enhancing ginsenoside production, and a method of producing
ginsenoside by using the same.
2. Description of the Related Art
[0002] Saponins, glycosides widely distributed in the plant
kingdom, refer to substances composed of diverse ring compounds
formed by the non-sugar portion thereof. Triterpene saponin, which
is a saponin contained in ginseng or red ginseng as a major
physiologically active ingredient, is named ginsenoside, which
means ginseng glycoside, to distinguish it from other vegetables'
saponin based on a different chemical structure.
[0003] Ginsenosides are classified into three groups based on their
aglycone structure: protopanaxadiol-type (PPD-type) ginsenosides,
protopanaxatriol-type (PPT-type) ginsenosides, and oleanolic
acid-type ginsenosides. These three groups are further classified
based on the position and number of sugar moieties (aglycones)
attached by a glycosidic bond at the C-3, C-6, and C-20 positions
of the rings in the chemical structure. The oleanolic acid-type
ginsenoside has a pentacyclic backbone and ginsenoside Ro is the
only saponin having oleanolic acid as aglycone. To date, more than
40ginsenosides have been isolated, and most of them are PPD-type
ginsenosides. PPD-type ginsenosides include Rb1, Rb2, Rb3, Rc, Rd,
Gypenoside XVII, Compound O, Compound Mol, F2, Compound Y, Compound
Mc, Rg3, Rh2, and C-K. PPT-type ginsenosides include Re, Rg1, Rf,
Rg2, Rh1, etc.
[0004] It is known that a representative pharmacological effect of
ginseng is attributed to ginsenosides, and up to now, about 30
different kinds of ginsenosides have been isolated from ginseng and
ginseng products (Shibata, 2001), and reported to have different
pharmacological actions such as anti-diabetic activity,
anti-inflammatory action, anti-aging action, anti-cancer action,
etc. In addition to ginsenosides, phenolic compounds,
polyacetylenes, alkaloids, and polysaccharides are known as other
physiologically active ingredients. More than 10 kinds of
antioxidative phenolic substances are revealed as an active
ingredient for anti-aging, and they are also known to have
physiological anticancer activity, antioxidant activity, whitening
activity, etc. Anti-stress effect that nonspecifically maintains
physical and mental stability against various stresses is also
reported in recent studies (Lee et al., 2008).
[0005] Worldwide, ginseng is commercially cultivated in Korea,
China, Japan, the United States, Canada, Europe, etc. By the end of
1980, about 46% of all ginsengs produced in the world had been
produced in Korea. However, Korea's market share decreased to about
39% in the 1990s, and China accounted for more than 50%. American
ginseng of the United States and Canada accounted for 10%.
Recently, Korean ginseng have rapidly decreased in share of the
world market. One of the biggest reasons is that Korean ginseng is
very excellent in its efficacy, but it is very weak in price
competitiveness. Since Korean ginseng has very excellent
characteristics and advantages, there is an urgent need for efforts
to improve international competitiveness of ginseng products
against the current rapidly changing world situation and WTO, major
investment in bio-industry and economic crisis.
[0006] Pharmacological studies of ginseng have increased interest
in ginsenoside which is a ginseng saponin component, and there is a
growing need for their mass-production. However, mass-production of
useful substance of ginseng through general cultivation methods
includes problems such as a long growing period of 4-6 years,
difficulty in pest control due to shading culture, rotation
agriculture, etc., and therefore, development of a new alternative
production method is urgently required.
[0007] Recently, a large number of ginseng saponin-related genes
have been identified on the basis of biotechnology, and development
of a technology for mass-production of ginsenoside in yeast by
using these genes has been receiving attention. Since ginsenoside
is biosynthesized via an isoprenoid synthetic pathway including a
mevalonic acid biosynthetic pathway in plants (Cristensen, 2008),
synthetic biology studies nave been attempted to develop
ginsenoside-producing strains by redesigning an ergosterol
biosynthetic pathway in yeast. Recently, China's Huang and Zhang
joint research team reported that protopanaxadiol dammarenediol-II
synthase and protopanaxadiol synthase genes of ginseng, together
with a NADPH-cytochrome P450 reductase gene of Arabidopsis
thaliana, were introduced into yeast Saccharomyces cerevisiae,
resulting in successful production of protopanaxadiol. They
increased squalene and 2,3-oxidosqualene supplies through
overexpressing tHMG1 which is an N-terminal HMG gene, and they also
amplified precursor supply for protopanaxadiol production by
overexpressing FPP synthase gene (ERG20), squalene synthase gene
(EPG9), and 2,3-oxidosqualene synthase gene (ERG1) at the same
time. Further, conversion efficiency of protopanaxadiol was further
increased by synthesis of protopanaxadiol synthase gene through
yeast codon optimization. Finally, a ginsenoside biosynthetic
pathway was completed by introduction of uridin diphosphate
glycosyl-transferase gene. (Dai et al., 2013). It is expected that
the ginsenoside-producing synthetic yeast may serve as the basis
for creating an economic alternative way for production of
ginsenosides in place of a complex process of extraction from plant
sources.
[0008] Under this background, the present inventors have made many
efforts to improve ginsenoside production by using a yeast. As a
result, they developed a recombinant yeast in which expressions of
genes improving a cell organelle of a ginsenoside-producing yeast
is controlled, and a method of preparing the recombinant yeast, and
they found that the recombinant yeast shows increased production of
protopanaxadiol which is an intermediate product in ginsenoside
biosynthesis, as compared with a known yeast having ability to
produce ginsenoside, thereby completing the present invention.
SUMMARY OF THE INVENTION
[0009] An object of the present invention is to provide a
recombinant yeast for producing ginsenoside or a precursor
thereof.
[0010] Another object of the present invention is to provide a
method of preparing the recombinant yeast.
[0011] Still another object of the present invention is to provide
a method of producing ginsenoside or a precursor thereof with a
high yield by using the recombinant yeast.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] FIG. 1 is a schematic illustration showing regulation of
phospholipid biosynthesis-related genes by transcription factors,
INO2, INO4, and OPI1 and intracellular functions related
thereto;
[0013] FIG. 2 shows a ginsenoside biosynthesis metabolic
pathway;
[0014] FIG. 3 is a vector map of pUC57-URA3HA-PGK1 which is a
vector for overexpressing INO2 or INO4 gene; and
[0015] FIG. 4 is a graph showing comparison of production of
squalene, 2,3-oxidosqualene, and protopanaxadiol between INO2 or
INO4 overexpressior; or OPI1 deletion and a control group.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0016] The present invention will be described in detail as
follows. Meanwhile, each description and embodiment disclosed in
this application may be applied to other descriptions and
embodiments. That is, all combinations of various elements
disclosed in this application fall within the scope of the present
application. Farther, the scope of the present application is not
limited by the specific description described below.
[0017] An aspect to achieve the objects of the present invention
provides a recombinant yeast for producing ginsenoside or a
precursor thereof, in which an expression level of a transcription
factor of a phospholipid biosynthetic gene is changed, as compared
with an intrinsic expression level.
[0018] The present invention is characterized in that among yeast
cell's organelles, endoplasmic reticulum (ER) which functions in
protein synthesis, formation of a secondary structure of proteins,
and transport of proteins to the intracellular position responsible
for each function is improved to increase the space of endoplasmic
reticulum or to control a membrane composition and a stress
response against unfolded proteins, thereby increasing production
of ginsenoside or a precursor thereof.
[0019] In the present invention, expressions of genes involved in
phospholipid biosynthesis are regulated, and specifically,
expression levels of transcription factors regulating expressions
of the genes involved in phospholipid biosynthesis are changed, in
order to improve the endoplasmic reticulum of the yeast. More
specifically, transcription factors of the genes involved in
phospholipid biosynthesis may be one or more selected from the
group consisting of INO2, INO4, and OPI1.
[0020] As used herein, the term "INO2 (INOsitol requiring 2)" and
"INO4 (INOsitol requiring 4)" are transcription factors that
regulate expressions of 70 or more genes responsible for various
functions such as formation of protein structures, including genes
involved in phospholipid biosynthesis. Overexpression of the
transcription factors increases expressions of the genes involved
in phospholipid biosynthesis, thereby increasing the size of
endoplasmic reticulum, controlling cell membrane components, and
inducing stress responses against unfolded proteins, INO2 and INO4
are transcription factors that function as a complex, but unlike
INO4, INO2 was reported to plays a critical role in transcriptional
regulation (Influence of gene dosage and autoregulation of the
regulatory genes INO2 and INO4 on inositol/choline-repressible gene
transcription in the yeast Saccharomyces cerevisiae. Curr Genet.
1997Jun.; 31 (6):462-8, Schwank S, Hoffmann B, Sch-uller H J.).
[0021] Information of INO2 and a gene encoding INO2 may be obtained
from database such as GenBank at US NIH, and for example, the INO2
gene may have a nucleotide sequence of SEQ ID NO: 1, but is not
limited thereto.
[0022] Further, the INO2 gene may include not only the nucleotide
sequence of SEQ ID NO: 1 but also a nucleotide sequence having 80%
or more, specifically 90% or more, more specifically 95% or more,
and much more specifically 99% or more homology with the above
sequence and encoding a transcription factor which shows effects
substantially identical or corresponding to those of the
transcription factor, without limitation. Further, it is apparent
that any nucleotide sequence having a deletion, modification,
substitution, or addition of some sequence may be within the scope
of the present invention, as long as the nucleotide sequence has
the above homology.
[0023] Information of INO4 and a gene encoding INO4 may be obtained
from database such as GenBank at US NIH, and for example, the INO4
gene may have a nucleotide sequence of SEQ ID NO: 2, but is not
limited thereto.
[0024] Further, the INO4 gene may include not only the nucleotide
sequence of SEQ ID NO: 2 but also a nucleotide sequence having 80%
or more, specifically 90% or more, more specif ically 95% or more,
and much more specifically 99% or more homology with the above
sequence and encoding a transcription factor which shows effects
substantially identical or corresponding to those of the
transcription factor, without limitation. Further, it is apparent
that any nucleotide sequence having a deletion, modification.
substitution, or addition of some sequence may be within the scope
of the present invention, as long as the nucleotide sequence has
the above homology.
[0025] As used herein, the term "OPI1 (OverProducer of Inositol I)"
is a transcription repressor of the transcriptional complex
INO2-INO4 in response to phospholipid precursor availability. When
precursors become limiting, OPI1 is retained at the endoplasmic
reticulum (ER) and INO2-INO4 complex activates INO1 and other genes
required for phospholipid biosynthesis, whereas abundant precursor
availability results in targeting of OPI1 to the nucleus to repress
transcription of these genes. OPI1 binds directly to phosphatidic
acid, which is required for ER targeting and may act as a sensing
mechanism for precursor availability, as phosphatidic acid becomes
rapidly depleted upon phospholipid biosynthesis.
[0026] Information of OPI1 and a gene encoding OPI1 may be obtained
from database such as GenBank at US NIH, and for example, the OPI1
gene may have a nucleotide sequence of SEQ ID NO: 3, but is not
limited thereto.
[0027] Further, the OPI1 gene may include not only the nucleotide
sequence of SEQ ID NO: 3 but also a nucleotide sequence having 80%
or more, specifically 90% or more, more specifically 95% or more,
and much more specifically 99% or more homology with the above
sequence and encoding a transcription factor which shows effects
substantially identical or corresponding to those of the
transcription factor, without limitation. Further, it is apparent
that any nucleotide sequence having a deletion, modification,
substitution, or addition of some sequence may be within the scope
of the present invention, as long as the nucleotide sequence has
the above homology.
[0028] As used herein, the term "homology" refers to identity to a
given amino acid sequence or nucleotide sequence and may be
expressed as percentage. In the specification, a homologous
sequence having activity equal or similar to a given amino acid
sequence or nucleotide sequence is expressed as "% homology". For
example, homology may be identified using a standard software
program which calculates parameters of score, identity and
similarity, specifically, BLAST 2.0, or by comparing sequences in a
Southern hybridization experiment under stringent conditions as
defined. Defining appropriate hybridization conditions are within
the skill of the art and may be determined by a method known to
those skilled in the art (e.g., J. Sambrook et al., Molecular
Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor
Laboratory press, Cold Spring Harbor, N. Y., 1989; F. M. Ausubel et
al., Current Protocols in Molecular Biology, John Wiley & Sons,
Inc., New York).
[0029] As used herein, the term "intrinsic expression level" refers
to an expression level of mRNA or a protein which is expressed in a
parent strain at a natural state or before modification of the
expression level of the corresponding gene. This is intrinsically
the production degree of a given mRNA or protein in a cell such as
a microorganism or a tissue under normal situation or prior to
regulating expression of a particular gene. The intrinsic
expression level may be compared between kinds of strains, types of
cells, and tissues, or compared with an expression level induced by
some stimulation. Specifically, the intrinsic expression level may
be an mRNA expression level or a protein expression level in a
microorganism in which expression of the transcription factor of
the phospholipid biosynthetic gene is not regulated.
[0030] Another aspect of the present invention provides a
recombinant yeast having an increased expression level of INO2 or
INO4 or increased expression levels of both of them, as compared
with their intrinsic expression levels, or having a decreased
expression level of OPI1, as compared with its intrinsic expression
level.
[0031] As used herein, the term "increased expression level, as
compared with the intrinsic expression level" means that a gene
encoding a corresponding polypeptide is expressed at a higher level
than that under a natural state or before modification, and as a
result, a large number of the functional corresponding polypeptide
are produced.
[0032] In the present invention, specifically, the increased
expression levels of INO2 and INO4 may be achieved by, but are not
limited to:
[0033] 1) increasing the copy numbers of the polynucleotides
encoding the transcription factors,
[0034] 2) modifying expression regulatory sequences to increase the
expressions of the polynucleotides,
[0035] 3) modifying the polynucleotide sequences on the chromosome
to enhance activities of the transcription factors, or
[0036] 4) a combination thereof.
[0037] 1) The increasing of the copy numbers of the polynucleotides
may be achieved, but is not limited to, in a form of being operably
linked to a vector or in a form of being integrated into the
chromosome of a host cell. Specifically, the copy number of the
polynucleotide in the chromosome of the host cell may be achieved
by introducing into the host cell the vector which is operably
linked to the polynucleotide encoding the enzyme of the present
invention and replicates and functions independently of the host
cell or by introducing into the host cell the vector which is
operably linked to the polynucleotide and is able to integrate the
polynucleotide into the chromosome of the host cell.
[0038] As used herein, the term "vector" refers to a DNA construct
including a nucleotide sequence encoding the desired protein, which
is operably linked to an appropriate expression regulatory sequence
to express the desired protein in a suitable host cell. The
regulatory sequence may include a promoter that may initiate
transcription, any operator sequence for regulating the
transcription, a sequence encoding a suitable mRNA ribosome binding
site, and a sequence regulating the termination of transcription
and translation. After the vector is introduced into the suitable
host cell, it may replicate or function independently of the host
genome, and may be integrated into the genome itself.
[0039] The vector used in the present invention is not particularly
limited, as long as it is able to replicate in the host cell, and
any vector known in the art may be used. Examples of commonly used
vectors may include a natural or recombinant, plasmid which may
include a replication origin, a promoter, and a terminator. The
replication origin may include an autonomous replication sequence
(ARS) of yeast. The autonomous replication sequence of yeast may be
stabilized by a centromeric sequence (CEN). The promoter may be
selected from the group consisting of a CYC promoter, a TEF
promoter, a GPD promoter, a PGK promoter, and an ADH promoter. The
terminator may be selected from the group consisting of PGK1, CYC1,
and GAL1.The vector may further include a selection marker.
[0040] As such, the polynucleotide encoding the desired protein in
the chromosome may be replaced by a mutated polynucleotide by using
a vector for intracellular chromosomal insertion. The insertion of
the polynucleotide into the chromosome may be performed by any
method known in the art, for example, homologous recombination, but
is not limited thereto.
[0041] As used herein, the term "transformation" means the
introduction of a vector including a polynucleotide encoding a
target protein into a host cell in such a way that the protein
encoded by the polynucleotide is expressed in the host cell. As
long as the transformed polynucleotide may be expressed in the host
cell, it may be integrated into and placed in the chromosome of the
host cell, or it may exist extrachromosomally. Further, the
polynucleotide includes DNA and RNA encoding the target protein.
The polynucleotide may be introduced in any form, as long as it may
be introduced into the host cell and expressed therein. For
example, the polynucleotide may be introduced into the host cell in
the form of an expression cassette, which is a gene construct
including all elements required for its autonomous expression.
Commonly, the expression cassette includes a promoter operably
linked to the polynucleotide, transcriptional termination signals,
ribosome binding sites, and translation termination signals. The
expression cassette may be in the form of a self-replicable
expression vector. Also, the polynucleotide as it is may be
introduced into the host cell and operably linked to sequences
required for expression in the host cell, but is not limited
thereto.
[0042] As used herein, the term "operably linked" means a
functional linkage between a polynucleotide sequence encoding the
desired protein of the present invention and a promoter sequence
which initiates and mediates transcription of the polynucleotide
sequence.
[0043] Next, 2) the modifying of the expression regulatory
sequences to increase the expressions of the polynucleotides may be
achieved, but is not particularly limited to, by inducing a
modification on the sequence by deletion, insertion,
non-conservative or conservative substitution of nucleotide
sequence, or a combination thereof in order to further enhance the
activity of expression regulatory sequence, or by replacing the
expression regulatory sequence with a nucleotide sequence having
stronger activity. The expression regulatory sequence may include,
but is not particularly limited to, a promoter, an operator
sequence, a sequence coding for a ribosome-binding site, and a
sequence regulating the termination of transcription and
translation.
[0044] A strong heterologous promoter instead of the original
promoter may be linked upstream of the polynucleotide expression
unit, and examples of the strong promoter may include a GPD
promoter, a TEF promoter, an ADH promoter, CCW12, a GAL promoter.
More specifically, a Saccharomyces cerevisiae-derived promoter,
PGK1 is operably linked to the polynucleotide encoding the enzyme
so that its expression rate may be increased, but is not limited
thereto.
[0045] Furthermore, 3) the modifying of the polynucleotide
sequences on the chromosome may be achieved, but is not
particularly limited to, by inducing a modification on the
expression regulatory sequence by deletion, insertion,
non-conservative or conservative substitution of nucleotide
sequence, or a combination thereof to further enhance the activity
of the polynucleotide sequence, or by replacing the polynucleotide
sequence with a polynucleotide sequence having stronger
activity.
[0046] In an embodiment of the present invention, a PGK1 promoter
substitution vector was prepared in order to replace the promoter
of the gene by a PGK1 promoter, which is a strong constitutive
promoter, for induction of overexpression of INO2 or INO4, and a
substitution cassette prepared by using this vector was transformed
into a PPD yeast mutant strain to prepare an INO2 or
INO4-overxpressing recombinant yeast (Example 2).
[0047] As used herein, the term "decreased expression level, as
compared, with the intrinsic expression level" means that a gene
encoding a corresponding polypeptide is not expressed or is
expressed at a lower level than that, under a natural state or
before modification, or the corresponding polypeptide is not
functional even though it is expressed.
[0048] The term "decreased expression level, as compared with the
intrinsic expression level" also means that the gene encoding the
corresponding polypeptide is completely inactivated, or its
expression level is weak or remarkably low, as compared with the
intrinsic expression level, and therefore, the gene is not
substantially expressed. The gene inactivation may be either
complete (knock-out) or partial (e.g., the gene is a hypomorphic
gene which shows an expression level lower than the intrinsic
expression level or a product of a mutant gene showing a partial
reduction in activity affected thereby).
[0049] Specifically, inactivation of OPI1 in the present invention
may be achieved by
[0050] 1) deletion of part or all of the polynucleotide encoding
the protein,
[0051] 2) modification of the expression regulatory sequence to
decrease the expression of the polynucleotide,
[0052] 3) modification of the polynucleotide sequence on the
chromosome to weaken the activity of the protein, or
[0053] 4) a combination thereof, but is not particularly limited
thereto.
[0054] 1) The method of deleting part or all of the polynucleotide
encoding the protein may be performed by replacing the
polynucleotide encoding the endogenous target protein in the
chromosome by a polynucleotide with a partial deletion of a
nucleotide sequence or by a marker gene, through a vector for
chromosomal gene insertion. The "part" may differ depending on the
kind of the polynucleotide, but is specifically 1 bp to 300 bp,
more specifically 1 bp to 100 bp, and much more specifically 1 bp
to 50 bp.
[0055] Next, 2) the method of modifying the expression regulatory
sequence to decrease the expression of the polynucleotide may be
achieved, but is not particularly limited to, by inducing mutations
in the expression regulatory sequence through deletion, insertion,
conservative or non-conservative substitution of nucleotide
sequence or a combination thereof to further weaken the activity of
the expression regulatory sequence, or by replacing the expression
regulatory sequence with a nucleotide sequence having weaker
activity. The expression regulatory sequence includes a promoter,
an operator sequence, a sequence encoding a ribosomal binding site,
and a sequence regulating the termination of transcription and
translation, but is not limited thereto.
[0056] Furthermore, 3) the method of modifying the polynucleotide
sequence on the chromosome may be achieved by inducing mutations in
the sequence through deletion, insertion, conservative or
non-conservative substitution of nucleotide sequence or a
combination thereof to further weaken the activity of the protein,
or by replacing the polynucleotide sequence with a polynucleotide
sequence which is improved to have weaker activity, but is not
limited thereto.
[0057] In an embodiment of the present invention, a deletion
cassette for removing OPI1 was prepared and transformed into a PPD
yeast mutant strain to prepare an OPI1-deleted recombinant yeast
(Example 3).
[0058] According to a specific embodiment, the recombinant yeast
was used to compare the production of squalene, 2,3-oxidosqualene,
and protopanaxadiol, which are intermediate products in ginsenoside
biosynthesis, with that of a control group. As a result, the
production was increased in both the INO2- and INO4-overexpressed
recombinant yeasts and the OPI1-deleted recombinant yeast, as
compared with the control group, and in particular, the greatest
production was observed in the INO2-overexpressed recombinant yeast
(Example 4, Table 5, Table 6, and FIG. 4).
[0059] The recombinant yeast of the present invention may increase
production of ginsenoside, squalene and 2,3-oxidosqualene.
[0060] As used herein, the term "ginsenoside-producing recombinant
yeast" refers to a yeast that naturally has the ability to produce
ginsenoside or a yeast prepared by providing a parent strain having
no ability to produce ginsenoside with the ability to produce
ginsenoside.
[0061] As used herein, the term "ginsenoside" refers to a
dammarane-type saponin derived from ginseng, or a derivative
thereof, and has a unique chemical structure that is different from
saponin found in other plants. Examples of the ginsenoside may
include, but are not particularly limited to, PPD
(protopanaxadiol)-type ginsenoside, PPT (protopanaxatriol)-type
ginsenoside, etc. For another example, PPD, PPT, Ra3, Rb1, Rb2,
Rb3, Rc, Rd, Re, Rg1, Rg2, Rg3, Rh1, Rh2, Rs1, C--O, C--Y, C-Mc1,
C-Mc, F1, F2, compound K, gypenoside XVII, gypenoside LXXV, Rs2,
PPD, Re, Rg1, Rf, F1, Rg2, PPT and Rh1 may be used alone or in
combination. For still another example, PPD, PPT, compound K, Rb1,
Rb2, Rb3, Rc, Rd, Re, F1, F2, Rg1, Rg2, Rg3, Rh1, Rb2 may be used
alone or in combination. Specifically, the ginsenoside may be
protopanaxadiol-type ginsenoside.
[0062] As used herein, the term "ginsenoside precursor-producing
recombinant yeast" refers to a yeast that naturally has the ability
to produce a ginsenoside precursor or a yeast prepared by providing
a parent strain having no ability to produce a ginsenoside
precursor with the ability to produce a ginsenoside precursor.
[0063] As used herein, the term "ginsenoside precursor" refers to
an intermediate product in the ginsenoside biosynthesis. In the
ginsenoside biosynthesis, isopentenyl diphosphate and dimethylallyl
diphosphate are produced by a mevalonic acid metabolic pathway, and
converted to squalene and 2,3-oxidosqualene which is an oxidized
form of squalene. Dammarenediol-II is produced by cyclization of
2,3-oxidosqualene, and various ginsenosides are synthesized from
dammarenediol-II. The ginsenoside precursor may include all these
intermediate products. The ginsenoside precursor may also include
other types of saponin produced through these precursors. The
ginsenoside precursor may also include .beta.-amyrin or
oleanate.
[0064] Specifically, the ginsenoside precursor-producing
recombinant yeast may produce squalene or 2,3-oxidosqualene.
[0065] In a specific embodiment of the present invention, provided
is the recombinant yeast, in which the ginsenoside precursor
includes squalene and 2,3-oxidosqualene.
[0066] As used herein, the term "squalene" refers to a compound
belonging to an isoprenoid-type or a terpenoid-type, and is a
polyunsaturated lipid having 6 double bonds and has a chemical
formula of C.sub.30H.sub.50. Squalen is an intermediate product in
the ginsenoside biosynthesis, and produced via a mevalonic acid
pathway. Further, squalene has a strong antioxidant action in the
body, and used in biosynthesis of steroid hormones, vitamin D, bile
acid, and cholesterol which, is a component of cell membrane, and
also used as an adjuvant for swine flu vaccine, etc.
[0067] As used herein, the term "2, 3-oxidosqualene" is an
intermediate in the synthesis of lanosterol and cycloartenol which
are the cell membrane sterol precursors, as well as saponins
including ginsenosides. 2,3-oxidosqualene is produced by oxidation
of squalene by squalene epoxidase.
[0068] The yeast may be a strain belonging to Saccharomyces,
Sygosaccharomyces, Pichia, Kluyveromyces, Candida,
Schizosaccharomyces, Issatchenkia, Yarrowia, or Hansenula.
[0069] The strain belonging to Saccharomyces may be, for example,
Saccharomyces cerevisiae (S. cerevisiae), Saccharomyces bayanus (S.
bayanus), Saccharomyces boulardii (S. boulardii), Saccharomyces
bulderi (S. bulderi), Saccharomyces cariocanus (S. cariocanus),
Saccharomyces cariocus (S. cariocus), Saccharomyces chevalieri (S.
chevalieri), Saccharomyces dairenensis (S. dairenensis),
Saccharomyces ellipsoideus (S. ellipsoideus), Saccharomyces
eubayanus (S. eubayanus), Saccharomyces exiguus (S. exiguus),
Saccharomyces florentinus (S. florentinus), Saccharomyces kluyveri
(S. kulyveri), Saccharomyces martiniae (S. martiniae),
Saccharomyces monacensis (S. monacensis), Saccharomyces norbensis
(S. norbensis), Saccharomyces paradoxus (S. paradoxus),
Saccharomyces pastorianus (S. pastorianus), Saccharomyces
spencerorum (S. spencerorum), Saccharomyces turicensis (S.
turicensis), Saccharomyces unisporus (S. unisporus), Saccharomyces
uvarum (S. uvarum), or Saccharomyces zonatus (S. zonatus).
[0070] In a specific embodiment of the present invention, the yeast
may be Saccharomyces cerevisiae (S. cerevisiae), but is not limited
thereto.
[0071] In general, the Saccharomyces cerevisiae is known as one of
yeasts used in various fermentation processes, and known to have
ability to convert sugars into ethanol.
[0072] The ginsenoside-producing yeast may be, but is not
particularly limited to, a yeast which is modified to have
increased activity of HMG-CoA reductase (tHMG1) which converts
HMG-CoA to mevalonic acid and increased activity Panax
ginseng-derived squalene epoxidase (PgSE) which converts squalene
to 2,3-oxidosqualene, as compared with mevalonic acid metabolic
pathway for increasing the biosynthesis of squalene which is a
precursor essential for ginsenoside biosynthesis, and modified to
have activity of Panax ginseng-derived dammarenediol-II synthase
(PgDDS) which converts 2,3-oxidosqualene to dammarenediol-II, and
activities of Panax ginseng-derived cytochrome P450CYP716A47
(PgPPDS) and Panax ginseng-derived NADPH-cytochrome P450 reductase
(PgCPR) which convert dammarenediol-II to protopanaxadiol in order
to introduce the ginsenoside biosynthetic pathway.
[0073] Still another aspect of the present invention provides the
recombinant yeast, in which expression of a gene involved in
ginsenoside synthesis is increased, as compared with the intrinsic
expression level.
[0074] Still another aspect of the present invention provides the
recombinant yeast, in which the gene is one or more selected from
the group consisting of PgDDS (Panax ginseng, dammarenediol-II
synthase), PgPPDS (Panax ginseng cytochrome P450 CYP716A47), PgCPR
(P NADPH-cytochrome P450 reductase), tHMG1 (S. cerevisiae HMG-CoA
reductase) and PgSE (Panax ginseng, squalene epoxidase).
[0075] In an embodiment of the present invention, the enzymes
involved in the ginsenoside biosynthetic pathway were introduced by
transformation, and the enzymes involved in the mevalonic acid
metabolic pathway were transcribed from a GPD1(TDH3) promoter which
is a strong constitutive promoter, and thus their expression levels
were increased, as compared with their intrinsic expression levels
(Example 1).
[0076] In this regard, genes encoding the enzymes may include, but
are not particularly limited to, specifically nucleotide sequences
having 70% or more, more specifically 80% or more, more
specifically 90% or more homology with nucleotide sequences of SEQ
ID NOS: 4 to 8, respectively.
[0077] Still another aspect of the present invention provides a
method of preparing the recombinant yeast having improved ability
to produce ginsenoside, the method including the step of changing
the expression level of the transcription factor of the
phospholipid biosynthetic gene in the ginsenoside-producing yeast
strain.
[0078] In a specific embodiment of the present invention, provided
is the method of preparing the recombinant yeast, in which the
expression level of the phospholipid biosynthetic gene, INO2 or
INO4, or the expression levels of both of them is/are increased, as
compared with their intrinsic expression levels, or the expression
level of OPI1is decreased, as compared with its intrinsic
expression level.
[0079] The ginsenoside-producing yeast strain, the transcription
factor of the phospholipid biosynthetic gene, INO2, INO4, OPI1 and
the intrinsic expression level are the same as described above.
[0080] In another specific embodiment of the present invention, the
ginsenoside-producing yeast strain may have increased expression
levels of one or more genes selected from the group consisting of
PgDDS (Panax ginseng, dammarenediol-II synthase), PgPPDS (Panax
ginseng cytochrome P450 CYP716A47), PgCPR (P NADPH-cytochrome P450
reductase), tHMG1 (S. cerevisiae HMG-CoA reductase) and PgSE (Panax
ginseng, squalene epoxidase), as compared with their intrinsic
expression levels.
[0081] Still another aspect of the present invention provides a
method of preparing the recombinant yeast having improved ability
to produce the ginsenoside precursor, the method including the step
of changing the expression level of the transcription factor of the
phospholipid biosynthetic gene in the ginsenoside
precursor-producing yeast strain
[0082] In a specific embodiment of the present invention, provided
is the method of preparing the recombinant yeast, in which the
ginsenoside precursor includes squalene and 2,3-oxidosqualene.
[0083] In another specific embodiment of the present invention,
provided is the method of preparing the recombinant yeast, in which
the expression level of the phospholipid biosynthetic gene, INO2 or
INO4, or the expression levels of both of them is/are increased, as
compared with their intrinsic expression levels, or the expression
level of OPI1 is decreased, as compared with its intrinsic
expression level.
[0084] The transcription factor of the phospholipid biosynthetic
gene, INO2, INO4, OPI1, and intrinsic expression level are the same
as described above.
[0085] Still another aspect of the present invention provides a
method of producing ginsenoside or a precursor thereof, the method
including the step of culturing the recombinant yeast.
[0086] In the method, the step of culturing the yeast may be
performed by, but is not particularly limited to, a known batch,
continuous, or fed-batch culturing method. With regard to culture
conditions, basic compounds (e.g., sodium hydroxide, potassium
hydroxide, or ammonia) or acidic compounds (e.g. phosphoric acid or
sulfuric acid) may be used to adjust pH at an appropriate level
(e.g., pH 5 to pH 9, specifically pH 6 to pH 8, most specifically
pH 6.8), and aerobic conditions may be maintained by introducing
oxygen or oxygen-containing gas mixtures into the culture, but are
not limited thereto. The culture temperature may be maintained at
20.degree. C. to 45.degree. C., specifically at 25.degree. C. to
40.degree. C. Culturing may be performed for about 10 hours to 160
hours. The ginsenoside produced by the above culture may be
secreted into the medium or may remain in the cells.
[0087] Furthermore, sugar sources that may be used in the culture
medium may include sugars and carbohydrates (e.g., glucose,
sucrose, lactose, fructose, maltose, molasses, starch, and
cellulose), oils and fats (e.g., soybean oil, sunflower oil, peanut
oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic
acid, and linoleic acid), alcohols (e.g., glycerol and ethanol),
and organic acids (e.g., acetic acid). These substances may be used
individually or in a mixture, but are not limited thereto. Nitrogen
sources may include nitrogen-containing organic compounds (e.g.,
peptone, yeast extract, meat extract, malt extract, corn steep
liquor, soybean meal, and urea) or inorganic compounds (e.g.,
ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium
carbonate, and ammonium nitrate). These nitrogen sources may also
be used individually or in a mixture, but are not limited thereto.
Phosphorus sources which may be used include potassium dihydrogen
phosphate, dipotassium hydrogen phosphate, or the corresponding
sodium salts. These nitrogen sources may also be used individually
or in a mixture, but are not limited thereto. The culture medium
may include essential growth stimulators, such as metal salts
(e.g., magnesium sulfate or iron sulfate), amino acids, and
vitamins.
[0088] The method may further include the step of recovering the
produced ginsenoside. This recovering process may be a step of
recovering cultured cells or a supernatant thereof, and a process
suitable for the recovery may be selected by those skilled in the
art.
[0089] The method of recovering the ginsenoside produced in the
culturing step of the present invention may be performed by an
appropriate method known in the art, for example, in a batch,
continuous, or fed-batch manner, to collect the desired product
from the culture.
[0090] Hereinafter, the present invention will be described in more
detail with reference to Examples and Experimental Examples.
However, these Examples and Experimental Examples are for
illustrative purposes only, and the scope of the present invention
is not intended to be limited by these Examples and Experimental
Examples.
EXAMPLE 1
Preparation of PPD Mutant Yeast Strain
[0091] To prepare a yeast cell of the present invention,
Saccharomyces cerevisiae (S. cerevisiae) CEN.PK2-1D wild-type
strain [(MAT.alpha. ura3-52; trp1-289; leu2-3,112; his3.DELTA. 1;
MAL2-8; SUC2), EUROSCARF accession number: 30000B] was introduced
with a ginsenoside biosynthetic pathway and enhanced a mevalonic
acid metabolic pathway to enhance biosynthesis of squalene which is
an essential precursor in ginsenoside biosynthesis to prepare
protopanaxadiol (PPD) producing yeast strain. This yeast strain was
designated as a PPD mutant yeast strain.
[0092] Genotype of the PPD strain was S. cerevisiae CEN.PK2-1D
.DELTA.trp1::P.sub.GPD tHMG1+P.sub.GPD1 PgSE
.DELTA.lea2::P.sub.GPD1 PgDDS+P.sub.GPD1 PgPPDS+P.sub.GPD1 PgCPR.
Respective genes encoding PgDDS (Panax ginseng, dammarenediol-II
synthase, SEQ ID NO: 4), PgPPDS (Panax ginseng cytochrome P450
CYP716A47, SEQ ID NO: 5) and PgCPR (Panax ginseng NADPH-cytochrome
P4 50 reductase, SEQ ID NO: 6) which, are ginsenoside biosynthetic
enzymes and tHMG1 (S. cerevisiae HMG-CoA reductase, SEQ ID NO: 7)
and PgSE (Panax ginseng, squalene epoxidase, SEQ ID NO: 8) which
are enzymes in a metabolic pathway for enhancing the mevalonic acid
metabolic pathway were transcribed and expressed from GPD1 (TDH3)
promoter which is a strong constitutive promoter.
EXAMPLE 2
Preparation of INO2 or INO4--Overexpressing Mutant Yeast Strain
[0093] In order to examine whether overexpression of INO2 or INO4,
which is involved in phospholipid biosynthesis to increase the size
of endoplasmic reticulum, to control cell membrane components, and
to induce a stress response against unfolded proteins, in the PPD
mutant yeast strain, is involved in growth and PPD producing
ability of the mutant yeast strain, mutant yeast strains
overexpressing the genes were prepared. First, in order to induce
overexpression of INO2 or INO4, a PGK1 promoter substitution vector
was prepared for substitution of the promoter of the gene with a
strong constitutive PGK1 promoter, and a substitution cassette
prepared by using the vector was transformed into the PPD mutant
yeast strain to prepare an INO2 or INO4-overexpressing mutant yeast
strain.
[0094] In detail, to prepare the PGK1 promoter substitution vector,
the strong constitutive PGK1 promoter region sequence from genomic
DNA of S. cerevisiae CEN.PK2-1D were made to have restriction
enzyme recognition sites SacI and XbaI at the 5'- and 3''-ends by
PCR (Polymerase Chain Reaction) using a primer combination of PGK1
pro F and PGK1pro R (Table 1). After amplification, the PCR product
was subjected to electrophoresis to obtain a desired fragment. In
this regard, PCR was repeated for 25 cycles of denaturation at
95.degree. C. for 30 seconds, annealing at 56.degree. C. for 30
seconds, and elongation at 72.degree. C. for 30 seconds. The
amplified fragment was treated with SacI and XbaI, and ligated with
a pUC57-URA3HA vector (Ju Young Lee, Chang Duk Kang, Seung Hyun
Lee, Young Kyoung Park and Kwang Myung Cho (2015) Engineering
cellular redox balance in Saccharomyces cerevisiae for improved
production of L-lactic acid. Biotechnol. Bioeng., 112, 751-758)
treated with the same restriction enzymes, thereby preparing a
pUC57-URA3HA-PGK1 vector (FIG. 3).
TABLE-US-00001 TABLE 1 Primer sequences and restriction enzymes for
preparation of pUC57-URA3HA-PGK1 vector SEQ Restric- ID tion Primer
Primer sequence NO: enzyme PGK pro F 5'-CGAGCTCAGACGCGAATT 9 SacI
TTTCGAAGAAG-3' PGK pro R 5'-GACTAGTTCTAGATGTTT 10 xbaI
TATATTTGTTGTAAAAAGTAG ATAATTACTTCC-3'
[0095] PCR was performed by using the prepared pUC57-URA3HA-PGK1
vector as a template and a primer combination of P_INO2F and P_INO2
R which are homologous recombination sequences of the INO2 promoter
region to prepare a cassette for replacing the INO2 promoter by the
PGK1 promoter. In the same manner, PCR was performed by using a
primer combination of P_INO4 F and P_INO4 R which are homologous
recombination sequences of the INO4 promoter region to prepare a
cassette for replacing the INO4 promoter by the PGK1 promoter. In
this regard, PCR was repeated for 25 cycles of denaturation at
95.degree. C. for 30 seconds, annealing at 56.degree. C. for 30
seconds, and elongation at 72.degree. C. for 2 minutes.
[0096] The prepared cassette for INO2 promoter or INO4promoter
substitution was introduced into the PPD mutant yeast strain,
respectively. The introduction was performed by a general heat
shock transformation method, and after transformation, the cells
were cultured in a uracil dropout medium (6.7 g of Yeast Nitrogen
Ease without amino acids, 0.77 g of CSM minus uracil, 20 g of
Glucose per 1 L) to substitute the INO2 promoter or INO4 promoter
on the genome; with PGK1 promoter by the cassette.
[0097] To confirm substitution of the PGK1 promoter in the obtained
mutant yeast strain, PCR was performed by using the genome of the
cells as a template and a primer combination of INO2 to PGK1 F and
INO2 to PGK1 R. As a result, substitution of the PGK1 promoter for
the INO2 promoter was confirmed. Further, PCR was performed by
using a primer combination of INO4 to PGK1 F and INO4 to PGK1 R. As
a result, substitution of the PGK1 promoter for the INO4promoter
was confirmed. Finally, PPD-INO2 (P.sub.INO2::P.sub.PGK1) and
PPD-INO4 ((P.sub.INO4::P.sub.PGK1) mutant yeast strains were
prepared.
TABLE-US-00002 TABLE 2 Primer sequences for preparation of PGK1
promoter substitution cassette and substitution confirmation SEQ
Primer Primer sequence ID NO: P_INO2 F
5'-CATTTAGCAGCGCCAGCGCCCTTCTA 11 AGCTCTTCCATACCTATACGCATGAGGTT
TCCCGACTGGAAAGC-3' P_INO2 R 5'-TTATCCAGATCTAGGATACCCAGTAA 12
TTCGTTCCCAGTTGCTTGTTGCATTGTTT TATATTTGTTGTAAAAAGTAGATAA-3' P_INO4 F
5'-AAAAATGAATCCGGGATATTCAATTC 13 TAGGAACCTCGAACTATATTGCATAGGTT
TCCCGACTGGAAAGC-3' P_INO4 R 5'-TCGGACAATCCCGGCTGTATTGTTTG 14
TATCTCCTTAATATCGTTCGTCATTGTTT TATATTTGTTGTAAAAAGTAGATAA-3' INO2 to
5'-GCGCCCTTCTAAGCTCTTCC-3' 15 PGK1 F INO2 to
5'-ACCCAGTAATTCGTTCCCAGTTG-3' 16 PGK1 R INO4 to
5'-CCGGGATATTCAATTCTAGGAACCT-3' 17 PGK1 F INO4 to
5'-TTTCTTCACATTAGCCAGTTCACCC-3' 18 PGK1 R
EXAMPLE 3
Preparation of OPI1-Deleted Mutant Yeast Strain
[0098] In order to examine whether deletion of OPI1, which is a
repressor to repress expression of the genes involved in
phospholipid biosynthesis to increase the size of endoplasmic
reticulum, to control cell membrane components, and to induce a
stress response against unfolded proteins, in the PPD mutant yeast
strain, is involved in growth and PPD producing ability of the
mutant yeast strain, a mutant yeast strain where the gene was
deleted was prepared. First, a deletion cassette for OPI1 deletion
was prepared and transformed into the PDD mutant yeast strain to
prepare an OPI1-deleted mutant yeast strain.
[0099] In detail, to prepare the cassette for OPI1 deletion, PCR
was performed by using the pUC57-URA3HA vector as a template and a
primer combination (Table 3) of Del OPI1 P and Del OPI1 R which are
OPI1 homologous recombination sequences, thereby preparing the
cassette for OPI1 deletion. In this regard, PCR was repeated for 25
cycles of denaturation at 95.degree. C. for 30 seconds, annealing
at 56.degree. C. for 30 seconds, and elongation at 72.degree. C.
for 1 minute.
TABLE-US-00003 TABLE 3 Primer sequences for preparation of OPI1
deletion cassette SEQ Primer Primer sequence ID NO: Del
5'-TTAAAGCGTGTGTATCAGGACAGTGT 19 OPI1 F
TTTTAACGAAGATACTAGTCATTGCCAGT CACGACGTTGTAAAA-3' Del
5'-TATAATATTATTACTGGTGGTAATGC 20 OPI1 R
ATGAAAGACCTCAATCTGTCTCGGAGGTT TCCCGACTGGAAAGC-3'
[0100] The prepared cassette for OPI1 deletion was introduced into
the PPD mutant yeast strain. The introduction was performed by a
general heat shock transformation method, and after transformation,
the cells were cultured in a uracil dropout medium (6.7 g of Yeast
Nitrogen Base without amino acids, 0.77 g of CSM minus uracil, 20 g
of Glucose per 1 L) to substitute OPI1 ORF on the genome by the
cassette. To confirm deletion of OPI1 in the obtained strain, PCR
was performed by using the genome of the cells as a template and a
primer combination of OPI1 F and OPI1 R (Table 4). Finally,
PPD.DELTA.OPI1(.DELTA.opi1) mutant yeast strain was prepared.
TABLE-US-00004 TABLE 4 Primer sequence for OPI1 deletion. Primer
Primer sequence SEQ ID NO: OPI1 F 5'-GCGTGTGTATCAGGACAGTGT-3' 21
OPI1 R 5'-CTGGTGGTAATGCATGAAAGACCTC-3' 22
EXAMPLE 4
Examination of Growth and PPD Production of Transformed Mutant
Yeast Strain
[0101] Each of the transformed mutant yeast strains was inoculated
in 50 ml of a minimal URA drop-out medium containing 2% glucose so
that OD.sub.600 value was 0.5, and each of them was cultured under
shaking at 30 rpm to 250 rpm for 144 hours under aerobic
conditions. Cell growth during culture was examined by measuring
OD.sub.600 values with a spectrophotometer. Intracellular
metabolites (squalene, 2,3-oxidosqualene, Protopanaxadiol) were
analyzed by HPLC (High performance liquid chromatography).
[0102] As a result of culturing (144 h), cell growth, i.e.,
OD.sub.600 values of the culture, and concentrations of the
intracellular metabolites are as shown in the following Tables 5
and 6, and FIG. 4.
TABLE-US-00005 TABLE 5 Metabolite concentration according to
culturing of transformed mutant yeast strain Cell 2,3- growth
Squalene Oxidosqualene Protopanaxadiol Strain (OD.sub.600) (mg/L)
(mg/L) (mg/L) Control group 13.59 2.03 0.56 5.35 INO2- 16.47 494.50
20.23 42.32 overexpressing strain INO4- 14.60 1.72 0.65 11.94
overexpressing strain OPI1-deleted 13.35 3.44 0.33 2.21 strain
TABLE-US-00006 TABLE 6 Fold change of metabolite concentration
according to culturing of transformed mutant yeast strain 2,3-
Squalene Oxidosqualene Protopanaxadiol Strain (mg/L) (mg/L) (mg/L)
Control group 1 1 1 INO2-overexpressing 243.01 35.81 7.90 strain
INO4-overexpressing 0.85 1.15 2.23 strain OPI1-deleted strain 1.69
0.58 0.41
[0103] In Tables 5 and 6, the control group represents the PPD
mutant yeast strain (S. cerevisiae CEN.PK2-1D
.DELTA.trp1::P.sub.GPD1 tHMG1+P.sub.GPD1 PgSE
.DELTA.leu2::P.sub.GPD1 PgDDS+P.sub.GPD1 PgPPDS+P.sub.GPD1 PgCPR),
the INO2-overexpressing mutant yeast strain represents PPD-INO2
(P.sub.INO::P.sub.PGK1), the INO4-overexpressing mutant yeast
strain represents PPD-INO4 (P.sub.INO4::P.sub.PCK1), and the
OPI1-delted mutant yeast strain represents PPD.DELTA.OPI1
(.DELTA.opi1). The values in Table 6 represent fold change of each
metabolite produced in each prepared mutant yeast strain when a
production concentration of each metabolite (squalene,
2,3-oxidosqualene, protopnanxadiol) produced in the control yeast
strain was taken as 1.
[0104] The above results showed that transformation of the mutant
yeast strains did not greatly influence the cell growth. Further,
the results of measuring the (concentrations of the intracellular
metabolites showed that increased phospholipid biosynthesis by INO2
and INO4 overexpression or OPI1 deletion led to increased size of
endoplasmic reticulum to increase metabolites of ginsenoside
biosynthesis, finally indicating improvement of ginsenoside
producing ability.
Effect of the Invention
[0105] A recombinant yeast having improved ability to produce
ginsenoside of the present invention is modified to have an
increased expression level of INO2 having a nucleotide sequence of
SEQ ID NO: 1 or INO4 having a nucleotide sequence of SEQ ID NO: 2
or increased expression levels of both of them, as compared with
their intrinsic expression levels, or to have a decreased
expression level of OPI1 having a nucleotide sequence of SEQ ID NO:
3, as compared with its intrinsic expression level, and as a
result, it has improved ability to produce ginsenoside.
Accordingly, the recombinant yeast may be effectively used in the
production of ginsenosides.
Sequence CWU 1
1
221915DNASaccharomyces cerevisiae 1atgcaacaag caactgggaa cgaattactg
ggtatcctag atctggataa cgatatagac 60tttgaaactg cttaccaaat gctcagcagt
aacttcgacg accaaatgtc tgcgcacata 120catgaaaaca cgtttagtgc
aacttcccct cctctgttaa cacacgagct cggcataatt 180cctaacgtgg
caaccgtgca accctctcac gtagaaacta tacctgccga taaccaaact
240catcatgctc ctttgcatac tcatgctcac tatctaaatc acaaccctca
tcaaccaagc 300atgggttttg atcaaacgct tggtctcaag ttgtctcctt
ccagttcggg gttgttgagc 360acgaatgaat cgaatgccat tgaacagttt
ttagacaatc taatatcaca ggatatgatg 420tcttccaacg cttccatgaa
ctccgattca catctacata taagatcacc aaaaaagcag 480cataggtata
ccgaattaaa tcaaagatat cctgaaacac atccacacag taacacaggg
540gagttaccca caaacacagc agatgtgcca actgagttca ccacgaggga
aggacctcat 600cagcctatcg gcaatgacca ctacaacccg ccaccgtttt
cagtacctga gatacgaatc 660ccagactctg atattccagc caatatcgag
gacgaccctg tgaaggtacg gaaatggaaa 720cacgttcaaa tggagaagat
acgaagaata aacaccaaag aagcctttga aaggctcatt 780aaatcagtaa
ggaccccacc aaaggaaaac gggaaaagaa ttcccaagca tattctttta
840acttgtgtaa tgaacgatat caagtccatt agaagcgcaa atgaagcact
acagcacata 900ctggatgatt cctga 9152456DNASaccharomyces cerevisiae
2atgacgaacg atattaagga gatacaaaca atacagccgg gattgtccga gattaaggag
60ataaagggtg aactggctaa tgtgaagaaa aggaaacgca ggtctaagaa gattaataaa
120ttgactgatg gtcaaatacg tataaatcat gtttcgtctg aaaaaaaaag
gagagaattg 180gaaagagcta tatttgacga actggtagca gtagtacctg
acctgcaacc ccaggaaagt 240cggtcagaac taatcatata cctgaaaagc
ttgagttact taagttggtt gtatgaaagg 300aatgaaaagc tgagaaaaca
aatcatagct aagcatgagg caaaaaccgg cagcagcagc 360agcagcgatc
ccgtacaaga acaaaatgga aacattcggg atttagtacc gaaggagtta
420atttgggagc tgggtgatgg acagagtggt cagtga 45631215DNASaccharomyces
cerevisiae 3atgtctgaaa atcaacgttt aggattatca gaggaagagg tagaagcggc
tgaagtactt 60ggggtgttga aacaatcatg cagacagaag tcgcagcctt cagaggacgt
ctcacaagct 120gacaaaatgc cggcaagtga gtcgtctacg acgccgctaa
acattttgga tcgcgtaagt 180aacaaaatta tcagtaacgt agtgacattc
tacgatgaaa taaacaccaa caagaggcca 240ctgaaatcaa tagggaggct
gctagacgat gacgatgacg agcatgatga ttacgactac 300aacgacgatg
agttcttcac caacaagaga cagaagctgt cgcgggcgat tgccaagggg
360aaggacaact tgaaagagta caagctgaac atgtccatcg agtctaagaa
gaggcttgta 420acgtgcttgc atcttttaaa gctggccaat aagcagcttt
ccgataaaat ctcgtgttta 480caggaccttg ttgaaaagga gcaggtgcat
cctttgcaca agcaagatgg aaatgctagg 540acgaccactg gagctggcga
ggacgagaca tcgtcagacg aagacgacga cgatgaggag 600ttttttgatg
cctcagagca ggtcaacgcc agcgagcagt ctattgtggt gaaaatggag
660gtggtcggca cagtcaagaa agtctactcg ctgatatcga agttcacagc
aaattcgctg 720ccggagcccg caagatctca ggttcgggaa agtcttctaa
acttacccac aaattggttc 780gacagcgtcc acagtacatc actgccgcat
catgcttcgt ttcattatgc caactgtgaa 840gaacaaaaag tggagcaaca
gcaacagcaa cagcaacagc agcagcagca gcaacttttg 900cagcagcaac
tcctgcaaca gcaacagcaa aaaaggaaca aggatggcga cgactcagcc
960tcgccgtcct cctccgtaac tgcgaatggg aaagtactca ttctcgccaa
agaatccctg 1020gaaatggtga gaaatgtcat gggcgtagtc gactccacgt
tgggcaaggc tgaagaatgg 1080gtgaagcaga aacaggaggt aaaagaaatg
atcagggagc gtttcttgca acagcagcaa 1140cagtacaggc agcaacagca
gaaggatggc aattacgtaa agccctctca ggacaacgtg 1200gatagcaagg actaa
12154769PRTPanax ginseng 4Met Trp Lys Gln Lys Gly Ala Gln Gly Asn
Asp Pro Tyr Leu Tyr Ser 1 5 10 15 Thr Asn Asn Phe Val Gly Arg Gln
Tyr Trp Glu Phe Gln Pro Asp Ala 20 25 30 Gly Thr Pro Glu Glu Arg
Glu Glu Val Glu Lys Ala Arg Lys Asp Tyr 35 40 45 Val Asn Asn Lys
Lys Leu His Gly Ile His Pro Cys Ser Asp Met Leu 50 55 60 Met Arg
Arg Gln Leu Ile Lys Glu Ser Gly Ile Asp Leu Leu Ser Ile 65 70 75 80
Pro Pro Leu Arg Leu Asp Glu Asn Glu Gln Val Asn Tyr Asp Ala Val 85
90 95 Thr Thr Ala Val Lys Lys Ala Leu Arg Leu Asn Arg Ala Ile Gln
Ala 100 105 110 His Asp Gly His Trp Pro Ala Glu Asn Ala Gly Ser Leu
Leu Tyr Thr 115 120 125 Pro Pro Leu Ile Ile Ala Leu Tyr Ile Ser Gly
Thr Ile Asp Thr Ile 130 135 140 Leu Thr Lys Gln His Lys Lys Glu Leu
Ile Arg Phe Val Tyr Asn His 145 150 155 160 Gln Asn Glu Asp Gly Gly
Trp Gly Ser Tyr Ile Glu Gly His Ser Thr 165 170 175 Met Ile Gly Ser
Val Leu Ser Tyr Val Met Leu Arg Leu Leu Gly Glu 180 185 190 Gly Leu
Ala Glu Ser Asp Asp Gly Asn Gly Ala Val Glu Arg Gly Arg 195 200 205
Lys Trp Ile Leu Asp His Gly Gly Ala Ala Gly Ile Pro Ser Trp Gly 210
215 220 Lys Thr Tyr Leu Ala Val Leu Gly Val Tyr Glu Trp Glu Gly Cys
Asn 225 230 235 240 Pro Leu Pro Pro Glu Phe Trp Leu Phe Pro Ser Ser
Phe Pro Phe His 245 250 255 Pro Ala Lys Met Trp Ile Tyr Cys Arg Cys
Thr Tyr Met Pro Met Ser 260 265 270 Tyr Leu Tyr Gly Lys Arg Tyr His
Gly Pro Ile Thr Asp Leu Val Leu 275 280 285 Ser Leu Arg Gln Glu Ile
Tyr Asn Ile Pro Tyr Glu Gln Ile Lys Trp 290 295 300 Asn Gln Gln Arg
His Asn Cys Cys Lys Glu Asp Leu Tyr Tyr Pro His 305 310 315 320 Thr
Leu Val Gln Asp Leu Val Trp Asp Gly Leu His Tyr Phe Ser Glu 325 330
335 Pro Phe Leu Lys Arg Trp Pro Phe Asn Lys Leu Arg Lys Arg Gly Leu
340 345 350 Lys Arg Val Val Glu Leu Met Arg Tyr Gly Ala Thr Glu Thr
Arg Phe 355 360 365 Ile Thr Thr Gly Asn Gly Glu Lys Ala Leu Gln Ile
Met Ser Trp Trp 370 375 380 Ala Glu Asp Pro Asn Gly Asp Glu Phe Lys
His His Leu Ala Arg Ile 385 390 395 400 Pro Asp Phe Leu Trp Ile Ala
Glu Asp Gly Met Thr Val Gln Ser Phe 405 410 415 Gly Ser Gln Leu Trp
Asp Cys Ile Leu Ala Thr Gln Ala Ile Ile Ala 420 425 430 Thr Asn Met
Val Glu Glu Tyr Gly Asp Ser Leu Lys Lys Ala His Phe 435 440 445 Phe
Ile Lys Glu Ser Gln Ile Lys Glu Asn Pro Arg Gly Asp Phe Leu 450 455
460 Lys Met Cys Arg Gln Phe Thr Lys Gly Ala Trp Thr Phe Ser Asp Gln
465 470 475 480 Asp His Gly Cys Val Val Ser Asp Cys Thr Ala Glu Ala
Leu Lys Cys 485 490 495 Leu Leu Leu Leu Ser Gln Met Pro Gln Asp Ile
Val Gly Glu Lys Pro 500 505 510 Glu Val Glu Arg Leu Tyr Glu Ala Val
Asn Val Leu Leu Tyr Leu Gln 515 520 525 Ser Arg Val Ser Gly Gly Phe
Ala Val Trp Glu Pro Pro Val Pro Lys 530 535 540 Pro Tyr Leu Glu Met
Leu Asn Pro Ser Glu Ile Phe Ala Asp Ile Val 545 550 555 560 Val Glu
Arg Glu His Ile Glu Cys Thr Ala Ser Val Ile Lys Gly Leu 565 570 575
Met Ala Phe Lys Cys Leu His Pro Gly His Arg Gln Lys Glu Ile Glu 580
585 590 Asp Ser Val Ala Lys Ala Ile Arg Tyr Leu Glu Arg Asn Gln Met
Pro 595 600 605 Asp Gly Ser Trp Tyr Gly Phe Trp Gly Ile Cys Phe Leu
Tyr Gly Thr 610 615 620 Phe Phe Thr Leu Ser Gly Phe Ala Ser Ala Gly
Arg Thr Tyr Asp Asn 625 630 635 640 Ser Glu Ala Val Arg Lys Gly Val
Lys Phe Phe Leu Ser Thr Gln Asn 645 650 655 Glu Glu Gly Gly Trp Gly
Glu Ser Leu Glu Ser Cys Pro Ser Glu Lys 660 665 670 Phe Thr Pro Leu
Lys Gly Asn Arg Thr Asn Leu Val Gln Thr Ser Trp 675 680 685 Ala Met
Leu Gly Leu Met Phe Gly Gly Gln Ala Glu Arg Asp Pro Thr 690 695 700
Pro Leu His Arg Ala Ala Lys Leu Leu Ile Asn Ala Gln Met Asp Asn 705
710 715 720 Gly Asp Phe Pro Gln Gln Glu Ile Thr Gly Val Tyr Cys Lys
Asn Ser 725 730 735 Met Leu His Tyr Ala Glu Tyr Arg Asn Ile Phe Pro
Leu Trp Ala Leu 740 745 750 Gly Glu Tyr Arg Lys Arg Val Trp Leu Pro
Lys His Gln Gln Leu Lys 755 760 765 Ile 5482PRTPanax ginseng 5Met
Val Leu Phe Phe Ser Leu Ser Leu Leu Leu Leu Pro Leu Leu Leu 1 5 10
15 Leu Phe Ala Tyr Phe Ser Tyr Thr Lys Arg Ile Pro Gln Lys Glu Asn
20 25 30 Asp Ser Lys Ala Pro Leu Pro Pro Gly Gln Thr Gly Trp Pro
Leu Ile 35 40 45 Gly Glu Thr Leu Asn Tyr Leu Ser Cys Val Lys Ser
Gly Val Ser Glu 50 55 60 Asn Phe Val Lys Tyr Arg Lys Glu Lys Tyr
Ser Pro Lys Val Phe Arg 65 70 75 80 Thr Ser Leu Leu Gly Glu Pro Met
Ala Ile Leu Cys Gly Pro Glu Gly 85 90 95 Asn Lys Phe Leu Tyr Ser
Thr Glu Lys Lys Leu Val Gln Val Trp Phe 100 105 110 Pro Ser Ser Val
Glu Lys Met Phe Pro Arg Ser His Gly Glu Ser Asn 115 120 125 Ala Asp
Asn Phe Ser Lys Val Arg Gly Lys Met Met Phe Leu Leu Lys 130 135 140
Val Asp Gly Met Lys Lys Tyr Val Gly Leu Met Asp Arg Val Met Lys 145
150 155 160 Gln Phe Leu Glu Thr Asp Trp Asn Arg Gln Gln Gln Ile Asn
Val His 165 170 175 Asn Thr Val Lys Lys Tyr Thr Val Thr Met Ser Cys
Arg Val Phe Met 180 185 190 Ser Ile Asp Asp Glu Glu Gln Val Thr Arg
Leu Gly Ser Ser Ile Gln 195 200 205 Asn Ile Glu Ala Gly Leu Leu Ala
Val Pro Ile Asn Ile Pro Gly Thr 210 215 220 Ala Met Asn Arg Ala Ile
Lys Thr Val Lys Leu Leu Thr Arg Glu Val 225 230 235 240 Glu Ala Val
Ile Lys Gln Arg Lys Val Asp Leu Leu Glu Asn Lys Gln 245 250 255 Ala
Ser Gln Pro Gln Asp Leu Leu Ser His Leu Leu Leu Thr Ala Asn 260 265
270 Gln Asp Gly Gln Phe Leu Ser Glu Ser Asp Ile Ala Ser His Leu Ile
275 280 285 Gly Leu Met Gln Gly Gly Tyr Thr Thr Leu Asn Gly Thr Ile
Thr Phe 290 295 300 Val Leu Asn Tyr Leu Ala Glu Phe Pro Asp Val Tyr
Asn Gln Val Leu 305 310 315 320 Lys Glu Gln Val Glu Ile Ala Asn Ser
Lys His Pro Lys Glu Leu Leu 325 330 335 Asn Trp Glu Asp Leu Arg Lys
Met Lys Tyr Ser Trp Asn Val Ala Gln 340 345 350 Glu Val Leu Arg Ile
Ile Pro Pro Gly Val Gly Thr Phe Arg Glu Ala 355 360 365 Ile Thr Asp
Phe Thr Tyr Ala Gly Tyr Leu Ile Pro Lys Gly Trp Lys 370 375 380 Met
His Leu Ile Pro His Asp Thr His Lys Asn Pro Thr Tyr Phe Pro 385 390
395 400 Ser Pro Glu Lys Phe Asp Pro Thr Arg Phe Glu Gly Asn Gly Pro
Ala 405 410 415 Pro Tyr Thr Phe Thr Pro Phe Gly Gly Gly Pro Arg Met
Cys Pro Gly 420 425 430 Ile Glu Tyr Ala Arg Leu Val Ile Leu Ile Phe
Met His Asn Val Val 435 440 445 Thr Asn Phe Arg Trp Glu Lys Leu Ile
Pro Asn Glu Lys Ile Leu Thr 450 455 460 Asp Pro Ile Pro Arg Phe Ala
His Gly Leu Pro Ile His Leu His Pro 465 470 475 480 His Asn
6709PRTPanax ginseng 6Met Leu Lys Val Ser Pro Phe Asp Leu Met Thr
Glu Ile Leu Arg Gly 1 5 10 15 Gly Ser Ile Asp Pro Pro Asn Ser Ser
Val Ser Ala Ala Gly Ala Ser 20 25 30 Met Gln Pro Ser Leu Ala Met
Leu Val Val Asn Arg Glu Leu Leu Met 35 40 45 Leu Leu Thr Thr Ser
Val Ala Val Leu Ile Gly Cys Val Val Val Leu 50 55 60 Val Trp Arg
Lys Ser Ser Ser Gln Lys His Ala Lys Ser Phe Glu Ala 65 70 75 80 Pro
Lys Leu Leu Ile Pro Lys Ile Glu Pro Glu Glu Val Val Asp Asp 85 90
95 Gly Lys Lys Lys Val Thr Ile Phe Phe Gly Thr Gln Thr Gly Thr Ala
100 105 110 Glu Gly Phe Ala Lys Ala Leu Ala Glu Glu Ala Lys Ala Arg
Tyr Glu 115 120 125 Lys Ala Ile Phe Lys Val Ile Asp Leu Asp Asp Tyr
Ala Pro Glu Asp 130 135 140 Asp Asp Tyr Glu Thr Lys Leu Lys Lys Glu
Ser Leu Ala Phe Phe Phe 145 150 155 160 Leu Ala Thr Tyr Gly Asp Gly
Glu Pro Thr Asp Asn Ala Ala Arg Phe 165 170 175 Tyr Lys Trp Phe Thr
Glu Gly Lys Glu Lys Arg Glu Trp Leu Asn Asn 180 185 190 Leu Gln Tyr
Gly Val Phe Gly Leu Gly Asn Arg Gln Tyr Glu His Phe 195 200 205 Asn
Lys Ile Ala Lys Val Val Asp Asp Gly Leu Ala Glu Gln Gly Ala 210 215
220 Lys Arg Leu Val Pro Val Gly Met Gly Asp Asp Asp Gln Cys Ile Glu
225 230 235 240 Asp Asp Phe Thr Ala Trp Arg Glu Leu Val Trp Pro Glu
Leu Asp Gln 245 250 255 Leu Leu Leu Asp Glu Glu Asp Thr Ala Ala Ala
Thr Pro Tyr Thr Ala 260 265 270 Ala Val Leu Glu Tyr Arg Val Val Phe
His Asp Arg Thr Asp Ser Ser 275 280 285 Thr Leu Leu Asn Gly Thr Thr
Ser Val Ser Asn Gly His Ala Phe Tyr 290 295 300 Asp Ala Gln His Pro
Cys Arg Ala Asn Val Ala Val Lys Arg Glu Leu 305 310 315 320 His Thr
Leu Glu Ser Asp Arg Ser Cys Thr His Leu Glu Phe Asp Ile 325 330 335
Ser Ser Thr Gly Leu Ala Tyr Glu Thr Gly Asp His Val Gly Val Tyr 340
345 350 Thr Glu Asn Leu Ile Glu Ile Val Glu Glu Ala Glu Arg Leu Leu
Ala 355 360 365 Ile Ser Pro Asp Thr Tyr Phe Ser Ile His Thr Glu Lys
Glu Asp Gly 370 375 380 Ser Pro Val Ser Gly Ser Ser Leu Gln Pro Pro
Phe Pro Pro Cys Thr 385 390 395 400 Leu Arg Glu Ala Leu Arg Arg Tyr
Ala Asp Leu Leu Ser Ser Pro Lys 405 410 415 Lys Ser Ala Leu Leu Ala
Leu Ala Ala His Ala Ser Asp Pro Ser Glu 420 425 430 Ala Asp Arg Leu
Arg Phe Leu Ala Ser Pro Ala Gly Lys Asp Glu Tyr 435 440 445 Ala Gln
Trp Ile Val Ala Asn Gln Arg Ser Leu Leu Glu Val Leu Ala 450 455 460
Glu Phe Pro Ser Ala Lys Pro Pro Leu Gly Val Phe Phe Ala Ser Val 465
470 475 480 Ala Pro Arg Leu Gln Pro Arg Tyr Tyr Ser Ile Ser Ser Ser
Pro Arg 485 490 495 Met Ala Pro Ser Arg Ile His Val Thr Cys Ala Leu
Val Phe Glu Arg 500 505 510 Thr Pro Ala Gly Arg Ile His Lys Gly Val
Cys Ser Thr Trp Met Lys 515 520 525 Asn Ala Val Ser Leu Glu Glu Gly
Asn Asp Cys Ser Arg Ala Pro Ile 530 535 540 Phe Val Arg Gln Ser Asn
Phe Lys Leu Pro Ser Asp Ser Arg Met Pro 545 550 555 560 Ile Ile Met
Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe Arg Gly Phe 565 570 575 Leu
Gln Glu Arg Leu Ala Leu Lys Glu Ala Gly Ala Glu Leu Gly Pro 580 585
590 Ala Val Leu Tyr Phe Gly Cys Arg Asn Arg Lys Leu Asp Phe Ile Tyr
595 600 605 Glu Asp Glu Leu Asn Asn Phe Val Glu Ser Gly Ala Ile Ser
Glu Met 610 615 620
Val Val Ala Phe Ser Arg Glu Gly Pro Thr Lys Glu Tyr Val Gln His 625
630 635 640 Lys Met Ser Gln Lys Ala Ser Glu Ile Trp Asn Met Ile Ser
Glu Gly 645 650 655 Ala Tyr Ile Tyr Val Cys Gly Asp Ala Lys Gly Met
Ala Arg Asp Val 660 665 670 His Arg Thr Leu His Thr Ile Ala Gln Glu
Gln Gly Ala Leu Asp Ser 675 680 685 Ser Lys Ala Glu Ser Leu Val Lys
Asn Leu Gln Met Thr Gly Arg Tyr 690 695 700 Leu Arg Asp Val Trp 705
7527PRTSaccharomyces cerevisiae 7Met Ala Ala Asp Gln Leu Val Lys
Thr Glu Val Thr Lys Lys Ser Phe 1 5 10 15 Thr Ala Pro Val Gln Lys
Ala Ser Thr Pro Val Leu Thr Asn Lys Thr 20 25 30 Val Ile Ser Gly
Ser Lys Val Lys Ser Leu Ser Ser Ala Gln Ser Ser 35 40 45 Ser Ser
Gly Pro Ser Ser Ser Ser Glu Glu Asp Asp Ser Arg Asp Ile 50 55 60
Glu Ser Leu Asp Lys Lys Ile Arg Pro Leu Glu Glu Leu Glu Ala Leu 65
70 75 80 Leu Ser Ser Gly Asn Thr Lys Gln Leu Lys Asn Lys Glu Val
Ala Ala 85 90 95 Leu Val Ile His Gly Lys Leu Pro Leu Tyr Ala Leu
Glu Lys Lys Leu 100 105 110 Gly Asp Thr Thr Arg Ala Val Ala Val Arg
Arg Lys Ala Leu Ser Ile 115 120 125 Leu Ala Glu Ala Pro Val Leu Ala
Ser Asp Arg Leu Pro Tyr Lys Asn 130 135 140 Tyr Asp Tyr Asp Arg Val
Phe Gly Ala Cys Cys Glu Asn Val Ile Gly 145 150 155 160 Tyr Met Pro
Leu Pro Val Gly Val Ile Gly Pro Leu Val Ile Asp Gly 165 170 175 Thr
Ser Tyr His Ile Pro Met Ala Thr Thr Glu Gly Cys Leu Val Ala 180 185
190 Ser Ala Met Arg Gly Cys Lys Ala Ile Asn Ala Gly Gly Gly Ala Thr
195 200 205 Thr Val Leu Thr Lys Asp Gly Met Thr Arg Gly Pro Val Val
Arg Phe 210 215 220 Pro Thr Leu Lys Arg Ser Gly Ala Cys Lys Ile Trp
Leu Asp Ser Glu 225 230 235 240 Glu Gly Gln Asn Ala Ile Lys Lys Ala
Phe Asn Ser Thr Ser Arg Phe 245 250 255 Ala Arg Leu Gln His Ile Gln
Thr Cys Leu Ala Gly Asp Leu Leu Phe 260 265 270 Met Arg Phe Arg Thr
Thr Thr Gly Asp Ala Met Gly Met Asn Met Ile 275 280 285 Ser Lys Gly
Val Glu Tyr Ser Leu Lys Gln Met Val Glu Glu Tyr Gly 290 295 300 Trp
Glu Asp Met Glu Val Val Ser Val Ser Gly Asn Tyr Cys Thr Asp 305 310
315 320 Lys Lys Pro Ala Ala Ile Asn Trp Ile Glu Gly Arg Gly Lys Ser
Val 325 330 335 Val Ala Glu Ala Thr Ile Pro Gly Asp Val Val Arg Lys
Val Leu Lys 340 345 350 Ser Asp Val Ser Ala Leu Val Glu Leu Asn Ile
Ala Lys Asn Leu Val 355 360 365 Gly Ser Ala Met Ala Gly Ser Val Gly
Gly Phe Asn Ala His Ala Ala 370 375 380 Asn Leu Val Thr Ala Val Phe
Leu Ala Leu Gly Gln Asp Pro Ala Gln 385 390 395 400 Asn Val Glu Ser
Ser Asn Cys Ile Thr Leu Met Lys Glu Val Asp Gly 405 410 415 Asp Leu
Arg Ile Ser Val Ser Met Pro Ser Ile Glu Val Gly Thr Ile 420 425 430
Gly Gly Gly Thr Val Leu Glu Pro Gln Gly Ala Met Leu Asp Leu Leu 435
440 445 Gly Val Arg Gly Pro His Ala Thr Ala Pro Gly Thr Asn Ala Arg
Gln 450 455 460 Leu Ala Arg Ile Val Ala Cys Ala Val Leu Ala Gly Glu
Leu Ser Leu 465 470 475 480 Cys Ala Ala Leu Ala Ala Gly His Leu Val
Gln Ser His Met Thr His 485 490 495 Asn Arg Lys Pro Ala Glu Pro Thr
Lys Pro Asn Asn Leu Asp Ala Thr 500 505 510 Asp Ile Asn Arg Leu Lys
Asp Gly Ser Val Thr Cys Ile Lys Ser 515 520 525 8545PRTPanax
ginseng 8Met Glu Leu Glu Arg Ser Tyr Arg Glu Asn Asp Glu Tyr Phe
Leu Met 1 5 10 15 Phe Ala Ala Thr Leu Leu Phe Gly Phe Val Leu Tyr
Leu Phe Thr Leu 20 25 30 Arg Arg Arg Arg Arg Arg Arg Glu Lys Lys
Gly Gly Ala Gly Ser Met 35 40 45 Glu Ile Ile Asn Gly Ala Tyr Lys
Met Thr Ser Ser Ser Glu Val Asn 50 55 60 Gly His Cys Thr Pro Glu
Asp Ile Ala Gly Ser Ser Asp Asp Val Ile 65 70 75 80 Ile Val Gly Ala
Gly Val Ala Gly Ser Ala Leu Ala Tyr Thr Leu Ala 85 90 95 Lys Asp
Gly Arg Arg Val His Val Ile Glu Arg Asp Leu Thr Glu Gln 100 105 110
Asp Arg Ile Val Gly Glu Leu Leu Gln Pro Gly Gly Tyr Leu Lys Leu 115
120 125 Val Glu Leu Gly Leu Glu Asp Cys Val Asn Glu Ile Asp Ala Gln
Arg 130 135 140 Val Phe Gly Tyr Ala Leu Tyr Met Asp Gly Lys Asn Thr
Arg Leu Ser 145 150 155 160 Tyr Pro Leu Glu Lys Phe His Ala Asp Val
Ala Gly Arg Ser Phe His 165 170 175 Asn Gly Arg Phe Ile Gln Arg Met
Arg Glu Lys Ala Ala Ser Leu Pro 180 185 190 Asn Val Arg Met Glu Gln
Gly Thr Val Thr Ser Leu Val Glu Gln Lys 195 200 205 Gly Thr Val Lys
Gly Val Arg Tyr Lys Thr Lys Asn Gly Gln Glu Met 210 215 220 Ser Ala
Ala Tyr Ala Pro Leu Thr Ile Val Cys Asp Gly Cys Phe Ser 225 230 235
240 Asn Leu Arg His Ser Leu Cys Asn Pro Lys Val Asp Val Pro Ser Cys
245 250 255 Phe Val Gly Leu Ile Leu Glu Asn Ile Asp Leu Pro His Ile
Asn His 260 265 270 Gly His Val Ile Leu Ala Asp Pro Ser Pro Ile Leu
Phe Tyr Lys Ile 275 280 285 Ser Ser Thr Glu Ile Arg Cys Leu Val Asp
Val Pro Gly Gln Lys Val 290 295 300 Pro Ser Ile Ala Asn Gly Glu Leu
Ala His Tyr Leu Lys Thr Ser Val 305 310 315 320 Ala Pro Gln Ile Pro
Pro Glu Leu Tyr Lys Ser Phe Ile Ala Ala Ile 325 330 335 Asp Lys Gly
Lys Ile Lys Thr Met Pro Asn Arg Ser Met Pro Ala Asp 340 345 350 Pro
His Ser Thr Pro Gly Ala Leu Leu Leu Gly Asp Ala Phe Asn Met 355 360
365 Arg His Pro Leu Thr Gly Gly Gly Met Thr Val Ala Leu Ser Asp Ile
370 375 380 Val Leu Ile Arg Asp Leu Leu Arg Pro Leu Arg Asp Leu His
Asp Ser 385 390 395 400 Ser Thr Leu Cys Lys Tyr Leu Glu Ser Phe Tyr
Thr Leu Arg Lys Pro 405 410 415 Val Ala Ser Thr Ile Asn Thr Leu Ala
Gly Ala Leu Tyr Lys Val Phe 420 425 430 Cys Ala Ser Pro Asp Lys Ala
Arg Gln Glu Met Arg Asp Ala Cys Phe 435 440 445 Asp Tyr Leu Ser Leu
Gly Gly Ile Cys Ser Glu Gly Pro Ile Ala Leu 450 455 460 Leu Ser Gly
Leu Asn Pro Arg Pro Met Ser Leu Phe Phe His Phe Phe 465 470 475 480
Ala Val Ala Ile Tyr Gly Val Gly Arg Leu Leu Ile Pro Phe Pro Ser 485
490 495 Pro Arg Lys Met Trp Leu Gly Ala Arg Leu Ile Ser Gly Ala Ser
Gly 500 505 510 Ile Ile Phe Pro Ile Ile Lys Ser Glu Gly Val Arg Gln
Met Phe Phe 515 520 525 Pro Ala Thr Val Pro Ala Tyr Tyr Arg Ala Pro
Pro Ile Thr Lys Lys 530 535 540 Met 545 929DNAArtificial
SequenceSynthetic oligonucleotide (PGK pro F) 9cgagctcaga
cgcgaatttt tcgaagaag 291051DNAArtificial SequenceSynthetic
oligonucleotide (PGK pro F) 10gactagttct agatgtttta tatttgttgt
aaaaagtaga taattacttc c 511170DNAArtificial SequenceSynthetic
oligonucleotide (P_INO2 F) 11catttagcag cgccagcgcc cttctaagct
cttccatacc tatacgcatg aggtttcccg 60actggaaagc 701280DNAArtificial
sequenceSynthetic oligonucleotide (P_INO2 R) 12ttatccagat
ctaggatacc cagtaattcg ttcccagttg cttgttgcat tgttttatat 60ttgttgtaaa
aagtagataa 801370DNAArtificial SequenceSynthetic oligonucleotide
(P_INO4 F) 13aaaaatgaat ccgggatatt caattctagg aacctcgaac tatattgcat
aggtttcccg 60actggaaagc 701480DNAArtificial SequenceSynthetic
oligonucleotide (P_INO4 R) 14tcggacaatc ccggctgtat tgtttgtatc
tccttaatat cgttcgtcat tgttttatat 60ttgttgtaaa aagtagataa
801520DNAArtificial SequenceSynthetic oligonucleotide (INO2 to PGK1
F) 15gcgcccttct aagctcttcc 201623DNAArtificial SequenceSynthetic
oligonucleotide (INO2 to PGK1 R) 16acccagtaat tcgttcccag ttg
231725DNAArtificial SequenceSynthetic oligonucleotide (INO4 to PGK1
F) 17ccgggatatt caattctagg aacct 251825DNAArtificial
SequenceSynthetic oligonucleotide (INO4 to PGK1 R) 18tttcttcaca
ttagccagtt caccc 251970DNAArtificial SequenceSynthetic
oligonucleotide (Del OPI1 F) 19ttaaagcgtg tgtatcagga cagtgttttt
aacgaagata ctagtcattg ccagtcacga 60cgttgtaaaa 702070DNAArtificial
SequenceSynthetic oligonucleotide (Del OPI1 R) 20tataatatta
ttactggtgg taatgcatga aagacctcaa tctgtctcgg aggtttcccg 60actggaaagc
702121DNAArtificial SequenceSynthetic oligonucleotide (OPI1 F)
21gcgtgtgtat caggacagtg t 212225DNAArtificial SequenceSynthetic
oligonucleotide (OPI1 R) 22ctggtggtaa tgcatgaaag acctc 25
* * * * *