U.S. patent application number 15/774208 was filed with the patent office on 2018-11-08 for a method for regulating cancer stem cell growth by inhibiting phosphorylation of 120th threonine residue of tspyl5 protein, a composition containing the peptide sequence functioning to inhibit the phosphorylation and a use thereof.
The applicant listed for this patent is Korea Atomic Energy Research Institute. Invention is credited to Soo Im Choi, Uhee Jung, In Gyu Kim, Jung Yul Kim, Min Sik Kim, Seo Yeon Kim, Jei Ha Lee, Byungchul Shin.
Application Number | 20180318378 15/774208 |
Document ID | / |
Family ID | 60664216 |
Filed Date | 2018-11-08 |
United States Patent
Application |
20180318378 |
Kind Code |
A1 |
Kim; In Gyu ; et
al. |
November 8, 2018 |
A METHOD FOR REGULATING CANCER STEM CELL GROWTH BY INHIBITING
PHOSPHORYLATION OF 120TH THREONINE RESIDUE OF TSPYL5 PROTEIN, A
COMPOSITION CONTAINING THE PEPTIDE SEQUENCE FUNCTIONING TO INHIBIT
THE PHOSPHORYLATION AND A USE THEREOF
Abstract
The present invention relates to a peptide suppressing the
phosphorylation of threonine(T120), the 120th residue of TSPYL5
(testis-specific Y-like protein 5), which is specifically as
follows. The present inventors constructed T120D, the mutant of the
120th residue threonine(T120) of TSPYL5, and T120A-TSPYL5 gene and
then transfected cells with them in order to investigate the effect
of phosphorylation on T120 residue. As a result, wild-type TSPYL5
and T120D moved into nucleus and stayed there. But in the case of
T120A-TSPYL5, TSPYL5 did not move into nucleus and instead it was
expressed only in cytoplasm. The protein could not bind to AKT,
either. Instead, ubiquitination of TSPYL5 was increased but
SUMOylation was inhibited. Also, the expressions of ALDH1-A1, -A3,
CD44 gene and protein were reduced, and thereby the growth and
metastasis of lung cancer cells were suppressed and sphere
formation was reduced. Based on the observation above, the
inventors constructed the peptide composed of the amino acid
sequences represented by SEQ. ID. NO: 43 or NO: 44 that could
inhibit phosphorylation of the 120th residue threonine of TSPYL5.
The said peptide can be effectively used as a composition for the
inhibition of cancer cell growth, metastasis, and cancer stem cell
growth.
Inventors: |
Kim; In Gyu; (Daejeon,
KR) ; Kim; Seo Yeon; (Daejeon, KR) ; Lee; Jei
Ha; (Daejeon, KR) ; Choi; Soo Im; (Daejeon,
KR) ; Kim; Min Sik; (Sejong, KR) ; Kim; Jung
Yul; (Daejeon, KR) ; Shin; Byungchul; (Seoul,
KR) ; Jung; Uhee; (Gyeonggi-do, KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Korea Atomic Energy Research Institute |
Daejeon |
|
KR |
|
|
Family ID: |
60664216 |
Appl. No.: |
15/774208 |
Filed: |
June 15, 2017 |
PCT Filed: |
June 15, 2017 |
PCT NO: |
PCT/KR2017/006240 |
371 Date: |
May 7, 2018 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 38/00 20130101;
A61P 35/04 20180101; A61K 38/02 20130101; C07K 7/08 20130101; C07K
14/4702 20130101 |
International
Class: |
A61K 38/02 20060101
A61K038/02; C07K 14/47 20060101 C07K014/47; C07K 7/08 20060101
C07K007/08; A61P 35/04 20060101 A61P035/04 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 15, 2016 |
KR |
10-2016-0074655 |
Claims
1. A peptide composed of the amino acid sequence of SEQ ID NO: 43
or SEQ ID NO: 44.
2. The peptide according to claim 1, wherein the peptide inhibits
cancer cell proliferation, metastasis, or sphere formation.
3. The peptide according to claim 1, wherein the peptide inhibits
the phosphorylation of the 120th amino acid of
TSPYL5_(testis-specific protein, Y-encoded-like 5).
4. The peptide according to claim 1, wherein the peptide
accelerates ubiquitination but inhibits SUMOylation of TSPYL5.
5. A method for preventing or treating cancer, comprising
administering to a patient in need thereof a therapeutically
effective amount of the peptide of claim 1.
6. A method for preventing or inhibiting cancer metastasis,
comprising administering to a patient in need thereof a
therapeutically effective amount of the peptide of claim 1.
7. A method for inhibiting the growth of cancer stem cells,
comprising administering to a patient in need thereof a
therapeutically effective amount of the peptide of claim 1.
8. The method of claim 7, wherein the cancer stem cell is selected
by one of those cancer stem cell selection markers selected from
the group consisting of CD133_(prominin-1; AC133),
CD44_(hyaluronate receptor; Pglycoprotein 1), and ALDH1_(Aldehyde
dehydrogenase 1).
9-14. (canceled)
Description
TECHNICAL FIELD
[0001] The present invention relates to a peptide inhibiting
phosphorylation of the 120th residue threonine of
TSPYL5(testis-specific protein, Y-encoded-like 5) and a composition
comprising the same for the inhibition of cancer cell growth,
metastasis, or cancer stem cell growth.
BACKGROUND ART
[0002] Cancer stem cells are a self-renewal small cell group
displaying pluripotent potency enabling the differentiation into
various tissues and cells like general stem cells. So, with a small
number of these cells, a tumor can be induced in an experimental
animal model. Cancer stem cells are also highly resistant against
chemotherapy and radiotherapy (B. M. Boman, M. S. Wicha, Cancer
stem cells: A step toward the cure, J. Clin. Oncol.(2008)
26:2795-2799).
[0003] Cancer stem cells were first reported in acute myeloid
leukemia, and later were found in general solid cancers including
breast cancer, leading to the identification of solid cancer stem
cells(D. Bonnet, J. E. Dick, Human acute myeloid leukemia is
organized as hierarchy that originates from a primitive
hematopoietic cell. Nat. Med. (1997) 3:730-737; M. Al-Hajj, M. F.
Clarke, Self-renewal and tumor stem cells. Oncogene.
(2003)23:7274-7284).
[0004] The cancer stem cell specific expression markers have been
reported for the identification of cancer stem cells. Among them,
CD133, a membrane protein, has been used as a marker to recognize
and isolate cancer stem cells in brain tumor. It has been reported
that a new tumor can be developed by transplanting about 100 CD133+
cells in a nude mouse(S. K. Singh, C. Hawkins, I. D. Clarke, et al,
Identification of human brain tumor initiating cells. Nature (2004)
432:396-401). Another membrane protein CD44 was also proposed as a
cancer stem cell marker. According to a previous report, the cells
separated with CD44(+)/CD24(-)/Lineage(-) in breast cancer were
grown into a xenograft tumor(M. Al-Hajj, M. S. Wicha, A.
Bentino-Hernandez et al, Proc. Natl. Acad. Sci. USA(2003)
100:3983-3988). ALDH1(aldehydrogeanse 1), the detox enzyme that can
oxidize intracellular aldehyde is also a cancer cell marker(M.
Magni, S. Shammah, R. Schiro. et al, Blood (1996) 87:1097-1103;
N.A. Sophos, V. Vasiliou, Chem. Biol. Interact. (2003)
143-144:5-22). The activity of ALDH1 is important for isolating the
population of cancer stem cells in lung cancer cell line(F. Jiang,
Q. Qiu, A. Khanna et al, Mol. Cancer. Res. (2009) 7:330-338). It
has been reported that the cells demonstrating high ALDH1 activity
were highly self-renewal, which is the characteristics of cancer
stem cells, and were actively differentiated in such cancers as
breast cancer and lung cancer. The prognosis is poor in cancer
patients having the tumor cells showing high ALDH1 activity(E.
Charafe-Jauffret et al, Clin. Cancer. Res. (2010) 16: 45-55).
[0005] In spite of the discovery of all those cancer stem cell
specific markers, the cancer stem cell specific network and
mechanism have not been known yet. Thus, to prevent the recurrence
and metastasis of cancer and to eliminate cancer completely, it is
necessary to develop an anticancer agent that removes cancer stem
cells by targeting the cancer stem cells having the characteristics
of stem cells in addition to the current cancer treatment method
targeting cancer cells.
[0006] TSPYL5 gene belongs to TSPYL(testis-specific protein,
Y-encoded-like) family, which is highly expressed in breast cancer
and is expected to play an important role in the carcinogenesis
process of breast cancer(L. J. van't Veer, et al, Nature. (2002)
415:530-536). TSPYL5 is also over-expressed in lung cancer cell
line, activates PTEN/AKT pathway, accelerates cell growth, and
increases radiation resistance(E. J. Kim. et al., Biochem. Biophys.
Res. Commun. (2010) 392(3):448-453). USP7(deubiquitylation enzyme
for p53 activation) has been reported as an interacting protein of
TSPYL5. It has been found that TSPYL5 acts as an inhibitor of USP7,
and thereby increases p53 degradation, which results in the poor
cancer prognosis(M. T. Epping, et al., Nat. Cell Biol.(2011)
13(1):102-108). It has also been reported that TSPYL5 is associated
with transcription factors of various genes including aromatase,
which catalyzes the aromatization of estradiol from testosterone
involved in post-menopausal breast cancer(Liu Ml, et al., Mol
Endocrinol. (2013) 27(4):657-70).
[0007] Currently, the cellular physiological aspects of TSPYL5 gene
and cancer stem cells have been largely identified, and a method
using shRNA or siRNA to inhibit the functions of TSPYL5 protein
involved in radiation resistance and cancer stem cell
characteristics has been used. However, there is a still technical
limit in developing an inhibitor of radiation-sensitive or
radiation-resistant cancer stem cells.
[0008] Thus, the present inventors tried to establish a method to
control cancer stem cells by identifying a specific amino acid
residue and its variants involved in cancer stem cell
characteristics and radiation resistance in TSPYL5 protein. In the
course of the study, the inventors confirmed that the
phosphorylation of threonine, the 120th amino acid residue of
TSPYL5, was regulated by PETM/AKT and further succeeded in the
construction of the mutant of the 120th residue threonine(T120) of
TSPYL5, T120D- or T120A-TSPYL5. Then, cells were transfected with
the constructed mutants. As a result, the present inventors
confirmed that the wild-type TSPYL5 and T120D moved into nucleus
and stayed there but T120A-TSPYL5 did not moved in nucleus and
instead was only expressed in cytoplasm and accordingly did not
bind to AKT. When the phosphorylation was not induced,
ubiquitination of TSPYL5 protein was increased but SUMOylation was
suppressed. Also, the expressions of the representative cancer stem
cell markers ALDH1A1, ALDH1A3, and CD44 genes and proteins were
reduced. In addition, the growth and metastasis of lung cancer
cells were also reduced and sphere formation was suppressed. As
explained hereinbefore, the inventors proved that the growth or
metastasis of cancer cells or the growth of cancer stem cells could
be suppressed by inhibiting the phosphorylation of threonine, the
120th residue of TSPYL5. At last, the present inventors confirmed
that the TS120T peptide represented by SEQ. ID. NO: 43 comprising
the phosphorylation region 120T and its phosphorylation analogue
TS120D peptide represented by SEQ. ID. NO: 44 could be effectively
used as an inhibitor for the growth or metastasis of cancer cells
or the growth of cancer stem cells, leading to the completion of
this invention.
DISCLOSURE OF INVENTION
Technical Problem
[0009] It is an object of the present invention to provide a cancer
cell control mechanism based on the control of
TSPYL5(testis-specific protein, Y-encoded-like 5) functions, and to
provide a composition for inhibiting the growth or metastasis of
cancer cells or cancer stem cells by suppressing phosphorylation of
threonine, the 120th residue of TSPYL5 protein using the peptide or
its derivatives constructed by the present inventors.
[0010] It is another object of the present invention to provide a
method for treating cancer and a method for inhibiting cancer
metastasis comprising the step of administering the peptide of the
invention to a subject having cancer.
[0011] It is also an object of the present invention to provide a
use of the peptide of the invention as a composition for preventing
or treating cancer, a composition for inhibiting cancer metastasis,
and a composition for inhibiting cancer stem cell growth.
Solution to Problem
[0012] To achieve the above objects, the present invention provides
a peptide composed of the amino acid sequences represented by SEQ.
ID. NO: 43 or SEQ. ID. NO: 44.
[0013] The present invention also provides a pharmaceutical
composition for preventing or treating cancer comprising the
peptide above as an active ingredient.
[0014] The present invention also provides a composition for
preventing or inhibiting cancer metastasis comprising the peptide
above as an active ingredient.
[0015] The present invention also provides a composition for
inhibiting cancer stem cell growth comprising the peptide above as
an active ingredient.
[0016] The present invention also provides a method for treating
cancer containing the step of administering the peptide above to a
subject having cancer.
[0017] The present invention also provides a method for preventing
cancer containing the step of administering the peptide above to a
subject
[0018] The present invention also provides a use of the peptide
above as a composition for preventing or treating cancer.
[0019] The present invention also provides a method for inhibiting
cancer metastasis containing the step of administering the peptide
above to a subject having cancer.
[0020] The present invention also provides a use of the peptide
above as a composition for inhibiting cancer metastasis.
[0021] In addition, the present invention provides a use of the
peptide above as a composition for inhibiting cancer stem cell
growth.
Advantageous Effects of Invention
[0022] The present invention relates to a peptide inhibiting the
phosphorylation of threonine, the 120th residue of
TSPYL5(testis-specific Y-like protein 5). The said peptide was
confirmed to inhibit the growth and metastasis of lung cancer cells
and the sphere formation as well, so that the peptide composed of
the nucleotide sequence represented by SEQ. ID. NO: 43 or NO: 44
that can inhibit the phosphorylation of threonine, the 120th
residue of TSPYL5, can be effectively used as an inhibitor of
cancer cell growth, metastasis, or cancer stem cell growth.
BRIEF DESCRIPTION OF DRAWINGS
[0023] The application of the preferred embodiments of the present
invention is best understood with reference to the accompanying
drawings, wherein:
[0024] FIG. 1a is a diagram illustrating the changes of the
expression patterns of the cancer stem cell markers ALDH1 and CD44
caused by the over-expression of PTEN gene in the lung cancer cell
line H460, analyzed by flow cytometry.
[0025] FIG. 1b is a diagram illustrating the changes of the
expression patterns of the cancer stem cell markers ALDH1 and CD44
caused by the over-expression of PTEN gene in the lung cancer cell
line A549, analyzed by flow cytometry.
[0026] FIG. 1c is a diagram illustrating the results of analysis of
the expression patterns of ALDH1 isozyme A1, A3, CD44, and TSPYL5
by RT-PCR in order to confirm the relationship between TSPYL5 gene
and protein expression.
[0027] FIG. 1d is a diagram illustrating the results of analysis of
the expression patterns of ALDH1 isozyme A1, A3, CD44, and TSPYL5
by Western blotting in order to confirm the relationship between
TSPYL5 gene and protein expression.
[0028] FIG. 2a is a diagram illustrating the changes of the
expression patterns of TSPYL5, ALDH1, and CD44 genes and proteins
according to the increase or decrease of AKT expression in lung
cancer cell lines H460 and A549.
[0029] FIG. 2b is a diagram illustrating the changes of the
expression patterns of TSPYL5 gene and protein according to the
treatment of MK2206, the AKT protein activity inhibitor.
[0030] FIG. 3a is a diagram illustrating the intracellular
distribution pattern and expression of TPSYL5 according to the
treatment of AKT activity inhibitor(MK2206) or PI3K activity
inhibitor(LY294002).
[0031] FIG. 3b is a diagram illustrating the expression sites of
TSPYL5 protein in lung cancer cells over-expressing
pcDNA3.1/TSPYL5(wild-type), pcDNA3.1/TSPYL5-120A,
pcDNA3.1/TSPYL5-409A, or pcDNA3.1/TSPYL5-120D, observed by
fluorescence microscope, and the changes of the expression levels
of TSPLY5 and HDAC1, measured by Western blotting.
[0032] FIG. 3c is a diagram illustrating the expression sites of
TSPYL5 protein in lung cancer cells over-expressing
pcDNA3.1/TSPYL5-326A or pcDNA3.1/TSPYL5-177A, observed by
fluorescence microscope, and the changes of the expression levels
of ALDH1A1, CD44, and TSPYL5, measured by Western blotting.
[0033] FIG. 4 is a diagram illustrating the interaction of TSPYL5
protein and AKT protein in lung cancer cells over-expressing
pcDNA3.1/TSPYL5(wild-type) and pcDNA3.1/TSPYL5-120A, investigated
by immunoprecipitation.
[0034] FIG. 5 is a diagram illustrating the changes of
ubiquitination according to the modification of threonine, the
120th residue of TSPYL5, in lung cancer cells over-expressing
pcDNA3.1/TSPYL5(wild-type) and pcDNA3.1/TSPYL5-120A.
[0035] FIG. 6a is a diagram illustrating the changes of SUMOylation
according to the modification of threonine, the 120th residue of
TSPYL5, in lung cancer cells over-expressing
pcDNA3.1/TSPYL5(wild-type) and pcDNA3.1/TSPYL5-120A.
[0036] FIG. 6b is a diagram illustrating the inhibition of TSPYL5
expression in the nucleus according to the treatment of a
SUMOylation inhibitor(ginkgolic acid) in the lung cancer cell line
A549.
[0037] FIG. 7a is a diagram illustrating the changes of the
expression patterns of the cancer stem cell markers, ALDH1 isozymes
according to the modification of threonine, the 120th residue of
TSPYL5, in the cells over-expressing pcDNA3.1/TSPYL5(wild-type),
pcDNA3.1/TSPYL5-120A, or pcDNA3.1/TSPYL5-12D, investigated by
immunoprecipitation.
[0038] FIG. 7b is a diagram illustrating the changes of the
expression patterns of the cancer stem cell markers, CD44 according
to the modification of threonine, the 120th residue of TSPYL5, in
the cells over-expressing pcDNA3.1/TSPYL5(wild-type),
pcDNA3.1/TSPYL5-120A, or pcDNA3.1/ TSPYL5-12D, investigated by
immunoprecipitation.
[0039] FIG. 7c is a diagram illustrating the changes of the
expression patterns of the cancer stem cell markers, ALDH1 isozymes
and CD44 according to the modification of threonine, the 120th
residue of TSPYL5, in the cells over-expressing
pcDNA3.1/TSPYL5(wild-type), pcDNA3.1/TSPYL5-120A, or
pcDNA3.1/TSPYL5-12D, investigated by RT-PCR and Western
blotting.
[0040] FIG. 8a is a diagram illustrating the cancer cell
proliferation, metastatic ability and sphere formation according to
the modification of threonine, the 120th residue of TSPYL5, in the
cells over-expressing pcDNA3.1/TSPYL5(wild-type),
pcDNA3.1/TSPYL5-120A, or pcDNA3.1/ TSPYL5-12D.
[0041] FIG. 8b is a diagram illustrating the cancer cell
proliferation and radiation resistance according to the
modification of threonine, the 120th residue of TSPYL5, in the
cells over-expressing pcDNA3.1/TSPYL5(wild-type),
pcDNA3.1/TSPYL5-120A, or pcDNA3.1/ TSPYL5-12D.
[0042] FIG. 9 is a diagram illustrating the function of TSPYL5 as a
transcriptional activator, investigated by by chromatin
precipitation.
[0043] FIG. 10 is a diagram illustrating the CFA(colony-forming
ability), invasion/migration, and sphere formation ability(SFA)
according to the treatment of TS120T, TS120A, and TS120D.
[0044] FIG. 11 is a diagram illustrating the sphere formation in
ALDH negative cells separated from H460(ALDH-H460) according to the
over-expression of pcDNA3.1/TSPYL5(wild-type),
pcDNA3.1/TSPYL5-120D, or pcDNA3.1/TSPYL5-120A.
[0045] FIG. 12 is a diagram illustrating the increase mechanism of
cancer stem cell formation by the phosphorylation of threonine, the
120th residue of TSPYL5.
BEST MODE FOR CARRYING OUT THE INVENTION
[0046] Hereinafter, the present invention is described in
detail.
[0047] The amino acid sequences used in this invention are
described as follows according to the IUPAC-IUB nomenclature.
[0048] Threonine: T,
[0049] Aspartic acid: D,
[0050] Alanine: A.
[0051] The present invention provides a peptide composed of the
amino acid sequence represented by SEQ. ID. NO: 43 or NO: 44.
[0052] The said peptide characteristically inhibits the cancer cell
proliferation, metastasis, or sphere formation, suppresses the
phosphorylation of the 120th amino acid of TSPYL5, accelerates the
ubiquitination of TSPYL5, and inhibits the SUMOylation thereof.
[0053] In a preferred embodiment of the present invention, when the
peptide composed of the amino acid sequence represented by SEQ. ID.
NO: 43 or NO: 44 was treated to cancer cells, the cancer cell
growth and metastasis were reduced and the sphere formation was
inhibited(see FIG. 10).
[0054] Therefore, the peptide of the invention can be effectively
used as an inhibitor of cancer cell growth, metastasis, or cancer
stem cell growth.
[0055] The peptide of the present invention can be synthesized by a
method well known to those in the art, for example, can be
synthesized by using an automatic peptide synthesizer, or can be
produced by genetic engineering techniques. Particularly, a fusion
gene encoding a fusion protein comprising a fusion partner and the
peptide of the present invention is produced through gene
manipulation. Then, a host microorganism is transfected with the
fusion protein, wherein the fusion gene is expressed as a fusion
protein. The peptide of the invention was cut out and separated
from the fusion protein by using a protease or a necessary
compound, resulting in the preparation of the target peptide. To do
so, a DNA sequence encoding the amino acid residue that can be cut
by such proteases as Factor Xa and enterokinase or such compounds
as CNB4 and hydroxylamine can be inserted in between the fusion
partner and the peptide gene of the invention.
[0056] The present invention also provides a pharmaceutical
composition for preventing or treating cancer comprising the
peptide composed of the amino acid sequence represented by SEQ. ID.
NO: 43 or NO: 44 as an active ingredient.
[0057] The present invention also provides a composition for
preventing or inhibiting cancer metastasis comprising the peptide
composed of the amino acid sequence represented by SEQ. ID. NO: 43
or NO: 44 as an active ingredient.
[0058] In a preferred embodiment of the present invention, when the
peptide of the invention was treated to cancer cells, the cancer
cell growth and metastasis were reduced and the sphere formation
was inhibited. Therefore, the composition comprising the peptide of
the invention as an active ingredient can be effectively used for
the prevention or treatment of cancer, or the prevention or
inhibition of cancer metastasis.
[0059] The present invention also provides a composition for
inhibiting cancer stem cell growth comprising the peptide composed
of the amino acid sequence represented by SEQ. ID. NO: 43 or NO: 44
as an active ingredient.
[0060] The cancer stem cell above is selected by one of those
cancer stem cell markers selected from the group consisting of
CD133(prominin-1; AC133), CD44(hyaluronate receptor; Pglycoprotein
1), and ALDH1(aldehyde dehydrogenase 1).
[0061] The pharmaceutical composition of the present invention can
contain the peptide of the invention alone or in combination with
one or more pharmaceutically acceptable carriers, excipients or
diluents.
[0062] The said pharmaceutically acceptable carrier can include,
for example, a carrier for oral administration or a carrier for
parenteral administration. The carrier for oral administration can
include lactose, starch, cellulose derivatives, magnesium stearate,
stearic acid, etc.
[0063] In addition, the pharmaceutical composition of the present
invention can contain various drug delivery materials used for oral
administration. The carrier for parenteral administration can
contain water, suitable oil, saline, aqueous glucose and glycol,
and can further contain a stabilizer and a preservative. The
suitable stabilizer includes an antioxidant such as sodium hydrogen
sulfite, sodium sulfite or ascorbic acid. The suitable preservative
includes benzalkonium chloride, methyl- or propyl-paraben and
chlorobutanol. The pharmaceutical composition of the present
invention can additionally contain a lubricant, a wetting agent, a
sweetener, a flavoring agent, an emulsifying agent, and a
suspending agent in addition to the above components. As other
pharmaceutically acceptable carriers, it is possible to refer to
what is described in the following document(Remington's
Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton,
Pa., 1995).
[0064] The composition of the present invention can be administered
to mammals including humans by any method. For example, the
composition can be administered orally or parenterally. Parenteral
administration indicates any route of administration that does not
involve the digestive tract, including injection. Parenteral
administration includes intravenous, intramuscular, intra-arterial,
intramedullary, intradermal, intracardiac, transdermal,
subcutaneous, intraperitoneal, intranasal, enteral, topical,
sublingual or intrarectal administration, but not always limited
thereto. Topical administration includes all routes of
administration through the skin including creams, ointments, gels,
and transdermal patches, but not always limited thereto.
[0065] The pharmaceutical composition of the present invention can
be formulated into oral or parenteral administration preparations
according to the administration route as described above.
[0066] The preparations for oral administration are exemplified by
powders, granules, tablets, pills, sugar-coated tablets, capsules,
liquids, gels, syrups, slurries, and suspensions, which can be
formulated by the methods known to those in the art. For example,
the preparations for oral administration can be obtained by
combining the active ingredient with a solid excipient, then
pulverizing thereof, adding suitable additives, and then processing
the mixture into granules, tablets, or sugar-coated tablets. The
suitable excipient is exemplified by sugars including lactose,
dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and
maltitol; starches including corn starch, wheat starch, rice starch
and potato starch; cellulose derivatives including cellulose,
methyl cellulose, sodium carboxymethyl cellulose and
hydroxypropylmethyl cellulose; and fillers including gelatin and
polyvinylpyrrolidone. In addition, cross-linked
polyvinylpyrrolidone, agar, alginic acid or sodium alginate can be
added as a disintegrant. Further, the pharmaceutical composition of
the present invention can additionally include an anti-coagulant, a
lubricant, a wetting agent, a flavoring agent, an emulsifying
agent, and an antiseptic agent, etc.
[0067] The preparations for parenteral administration are
exemplified by injections, creams, lotions, external ointments, oil
agents, moisturizers, gels, eye drops, aerosols, and nasal
inhalers, which can be formulated by the methods known to those in
the art.
[0068] A preferred sterile injectable preparation can be a solution
or suspension in a non-toxic parenterally acceptable solvent or a
diluent. The pharmaceutically acceptable carriers or vehicles are
exemplified by saline, buffered saline, isotonic saline(ex,
monosodium phosphate, disodium phosphate, sodium chloride,
potassium chloride, calcium chloride, magnesium chloride, or the
mixtures thereof), Ringer's solution, dextrose, water, sterile
water, glycerol, ethanol, and the mixtures thereof. Preferably,
1,3-butanediol and sterilized immobilized oil can be used as a
solvent or a suspending medium. Fatty acid such as oleic acid can
also be used in the preparation of injectable solutions.
[0069] Those formulations are described in the
literature(Remington's Pharmaceutical Science, 15thEdition, 1975.
Mack Publishing Company, Easton, Pa. 18042, Chapter 87: Blaug,
Seymour), the formulary commonly known in all pharmaceutical
chemistries.
[0070] The total effective dose of the composition of the invention
can be administered to a patient in a single dose and can be
administered by a fractionated treatment protocol administered over
a prolonged period of time in multiple doses. The pharmaceutical
composition of the present invention can vary in the amount of the
active ingredient depending on the severity of disease. The
effective dose of the peptide of the present invention is
preferably 0.0001 .mu.g.about.500 mg, and more preferably 0.01
.mu.g.about.100 mg per kg of patient body weight per day. However,
the effective dose of the peptide is generally determined by
considering not only the administration pathway and administration
times but also age, weight, health condition, gender, severity of
disease, diet, and excretion. Therefore, those who have general
knowledge of this field can determine the effective dose of the
composition of the invention according to a specific purpose. The
pharmaceutical composition of the present invention is not limited
to a specific formulation, administration pathway, and
administration method, as long as they do not change the effect of
the invention.
[0071] The present invention also provides a method for treating
cancer containing the step of administering the peptide composed of
the amino acid sequence represented by SEQ. ID. NO: 43 or NO: 44 to
a subject having cancer.
[0072] The present invention also provides a method for preventing
cancer containing the step of administering the peptide composed of
the amino acid sequence represented by SEQ. ID. NO: 43 or NO: 44 to
a subject.
[0073] The present invention also provides a use of the peptide
composed of the amino acid sequence represented by SEQ. ID. NO: 43
or NO: 44 as a composition for preventing or treating cancer.
[0074] The present invention also provides a method for inhibiting
cancer metastasis containing the step of administering the peptide
composed of the amino acid sequence represented by SEQ. ID. NO: 43
or NO: 44 to a subject having cancer.
[0075] The present invention also provides a use of the peptide
composed of the amino acid sequence represented by SEQ. ID. NO: 43
or NO: 44 as a composition for inhibiting cancer metastasis.
[0076] In addition, the present invention provides a use of the
peptide composed of the amino acid sequence represented by SEQ. ID.
NO: 43 or NO: 44 as a composition for inhibiting cancer stem cell
growth.
Mode for the Invention
[0077] Practical and presently preferred embodiments of the present
invention are illustrative as shown in the following Examples.
[0078] However, it will be appreciated that those skilled in the
art, on consideration of this disclosure, may make modifications
and improvements within the spirit and scope of the present
invention.
EXAMPLE 1
Construction of Over-Expressing Cells
[0079] <1-1> Construction of Vectors Over-Expressing TSPYL5,
PTEN, and AKT1 Genes
[0080] The cells over-expressing TSPYL5, PTEN, and AKT1 genes were
constructed as follows. First, the TSPYL5, PTEN, and AKT1 genes
were obtained by reverse transcription from the mRNA originated
from the lung cancer cell line A549 or H460.
[0081] Particularly, 1 ml of trisol was added to the lung cancer
cell line A549 or H460, which was well mixed for 5 minutes. 200
.mu.l of chloroform reagent was added thereto, which was well mixed
again for 5 minutes. The mixture was centrifuged at 4.degree. C.
for 10 minutes. 200 .mu.l of the supernatant was transferred into a
new tube. 500 .mu.l of isopropanol was added thereto, followed by
reaction for 10 minutes at room temperature. Centrifugation was
performed again at 4.degree. C. to eliminate the supernatant. The
precipitate was washed with DEPC solution containing 75% ethanol,
followed by centrifugation again to eliminate the supernatant. The
precipitate was dissolved in DEPC solution to obtain mRNA. The
obtained mRNA was quantified by using cDNA kit(iNtRON
Biotechnology). cDNA was synthesized from 1 .mu.g of the quantified
RNA by the reaction at 45.degree. C. for 1 hour and at 95.degree.
C. for 5 minutes. PCR was performed with I-taq polymerase(iNtRON)
and the prepared TSPYL5, PTEN, and AKT1 primers(Table 1) using the
synthesized cDNA as a template. PCR was performed as follows;
predenaturation at 94.degree. C. for 5 minutes, denaturation at
94.degree. C. for 1 minute, annealing at 56.degree. C. for 1
minute, polymerization at 72.degree. C. for 1 minute 30 seconds, 30
cycles from de-naturation to polymerization, and final extension at
72.degree. C. for 5 minutes.
TABLE-US-00001 TABLE 1 SEQ. Gene Direction Sequence(5'-3') ID. NO
TSPYL5 Forward CTTAAGCTTATGAGCGGCCGAAG 1 TCGG Reverse
TGGAATTCGTGTTGGATTGGCTC 2 ACCCC PTEN Forward
ATATAAGCTTATGACAGCCATCA 3 TCAAAG Reverse ATATGAATTCTCAGACTTTGTAA 4
TTTGTGTATG AKT1 Forward ATGAGCGACGTGGCTATTG 5 Reverse
TCAGGCCGTGCCGCTGGCCG 6
[0082] The TSPYL5, PTEN, and AKT genes obtained from PCR above and
pcDNA3.1(Invitrogen, USA) vector were digested with restriction
enzyme and mixed, followed by ligation using a ligase. The prepared
vector was selected by cloning, resulting in the construction of
the over-expression vectors pcDNA3.1/TSPYL5, pcDNA3.1/PTEN, and
pcDNA3.1/AKT1.
[0083] <1-2> Construction of Vectors Over-Expressing TSPYL5
Mutant
[0084] Gene mutation was induced in pcDNA3.1/TSPYL5 vector by using
QuickChange MultiSite-Directed Mutagenesis kit(Agilent
Technologies) in order to substitute the 120th residue threonine
with alanine(120A) and with aspartic acid(120D) in TSPYL5.
Particularly, PCR was performed with I-taq polymerase(iNtRON) and
the primers listed in Table 2 using the pcDNA3.1/TSPYL5 vector as a
template. PCR was performed as follows; predenaturation at
95.degree. C. for 5 minutes, denaturation at 95.degree. C. for 1
minute, annealing at 58.degree. C. for 1 minute, polymerization at
72.degree. C. for 15 minutes, 20 cycles from denaturation to
polymerization, and final extension at 72.degree. C. for 7 minutes.
30 .mu.l of the obtained PCR product was added with 1 .mu.l of Dpnl
and 3.5 .mu.l of 10.times. buffer, followed by reaction at
37.degree. C. for 1 hour. Then, the reactant was ligated to
pcDNA3.1 by the same manner as described in Example <1-1>. As
a result, [0085] pcDNA3.1/TSPYL5-T120A, pcDNA3.1/TSPYL5-T120D,
[0086] pcDNA3.1/TSPYL5-T177A, pcDNA3.1/TSPYL5-T326A, [0087]
andpcDNA3.1/TSPYL5-T409A were constructed.
TABLE-US-00002 [0087] TABLE 2 TSPYL5 SEQ. ID. primer Direction
Sequence(5'-3') NO T120A Forward gagcgcctggccgcagacg 7
ctgtcttcgtgggaacagc Reverse gctgttcccacgaagacag 8
cgtctgcggccaggcgctc T120D Forward gagcgcctggccgcagacc 9
atgtcttcgtgggaacagc Reverse gctgttcccacgaagacat 10
cgtctgcggccaggcgctc T177A Forward ggcggcaggggagaatgcc 11
tcggtgtcagctgg Reverse ccagctgacaccgaggcat 12 tctcccctgccgcc T326A
Forward ggtggtgtctcgttctgct 13 ccaatccagtggctc Reverse
gagccactggattggagca 14 gaacgagacaccacc T409A Forward
gcagccaatggagactgct 15 cagcctggggtgag Reverse tcaccccaggctgagcagt
16 ctccattggctgc
[0088] <1-3> Construction of Over-Expressing Cells
[0089] 2.times.10.sup.5cell/ml of H460 cells were transfected with
4 .mu.g of TSPYL5 and AKT over-expressing vector, and
2.times.10.sup.5 cell/mt of A549 cells were transfected with 4
.mu.g of PTEN over-expressing vector in penicillin-streptomycin
solution(Hyclone) free medium by using Lipofectamine 2000. After
4.about.6 hour reaction, the medium was replaced with the medium
supplemented with 100 units/ml of penicillin-streptomycin, followed
by culture for 48 hours.
EXAMPLE 2
Inhibition of the Expressions of TSPYL5, AKT, and PTEN
[0090] The following experiment using siRNA was performed to
inhibit the intracellular expressions of TSPYL5, AKT, and PTEN.
[0091] Particularly, the expressions of TSPYL5 and AKT were
inhibited in A549 cells, and the expression of PTEN was inhibited
in H460 cells. 2.times.10.sup.5 cells were transfected with 100 nM
of each gene specific siRNA and Scrambled Stealth.TM. RNA
molecule(negative control: siControl) in penicillin-streptomycin
solution free medium using Lipofectamine RNAi MAX(Invitrogen)
according to the manufacturer's protocol. After 4.about.6 hour
reaction, the medium was replaced with the medium supplemented with
100 units/mt of penicillin-streptomycin, followed by culture for 72
hours.
TABLE-US-00003 TABLE 3 SEQ. Primer Size Sequence(5'-3') ID. NO
siTSPYL5 25 mer AAAGGUAGAACUGCA 17 Invitrogen AGGGAUUGGG
CCCAAUCCCUUGCAG 18 UUCUACCUUU siPTEN 21 mer GAUAUCAAGAGGAUG 19
Bioneer GAUU(dTdT) AAUCCAUCCUCUUGA 20 UAUC(dTdT) siAKT 21 mer
GACUGACACCAGGUA 21 Bioneer UUUU(dTdT) AAAUACCUGGUGUCA 22
GUC(dTdT)
[0092] In addition, 20 .mu.M of MK2206(Santa Cruze Biotechnology),
the AKT(serine/threonine protein kinase) inhibitor, was treated
thereto, followed by investigation of the inhibition of AKT
phosphorylation and the inhibition of TSPYL5 expression.
Experimental Example 1
Regulation Effect of PTEN on TSPYL5 Expression
[0093] <1-1> Changes in the Expressions of ALDH and CD44
According to the Over-Expression or Inhibition of PTEN
[0094] The expressions of the cancer stem cell markers ALDH1 and
CD44 were measured by flow cytometry after ALDEFLUOR staining and
CD44 antibody staining to investigate the changes of cancer stem
cell characteristics according to the over-expression or inhibition
of PTEN.
[0095] Particularly, A549 cells(VC), PTEN over-expressing A549
cells(PTEN(+)), H460 cells(si-CTL), and PTEN suppressed H460
cells(si-PTEN) were added with 0.5 ml of ALDEFLUOR assay buffer,
resulting in 1.times.10.sup.6cell/ml of mixture. 5 .mu.l of the
lysed cells and the activated ALDEFLUOR substrate was loaded
respectively in two empty tubes. 500 .mu.l of the mixture was
loaded in the control tube. 5 .mu.l of
DEAB(diethylaminobenzaldehyde), the ALDH1 activity inhibitor, was
added only to the control. Then, reaction was induced at 37.degree.
C. for 30 minutes. Centrifugation was performed to eliminate the
supernatant. 500 .mu.l of ALDEFLUOR assay buffer was added thereto
and analyzed using FACScan at 4.degree. C(FIGS. 1a and 1b).
[0096] In order to compare the CD44 expression in A549 cells, cell
surface staining was performed with anti-CD44 antibody-APC,
followed by flow cytometry. 1.times.10.sup.6cell/ml of A549 cells,
500 .mu.l of PBS, and 10 .mu.l of Anti-CD44 antibody-APC reagent
were mixed, followed by reaction at 4 for 30 minutes. At this time,
10 .mu.l of mouse F(ab').sub.2 IgG1-APC was reacted under the same
conditions to be the control group for the non-specific antibody
reaction. At this time, 10 .mu.l of mouse F(ab').sub.2 IgG1-APC was
reacted by the same conditions as the above, leading to the
non-specific antibody reaction control. The regions displaying APC
fluorescence over the control range were analyzed as CD44
expressing cells(FIGS. 1a and 1b).
[0097] As a result of the experiment above, it was confirmed that
ALDEFLUOR staining and CD44 staining were reduced or increased by
the over-expression or inhibition of PTEN, suggesting that the
expressions of the cancer stem cell markers ALDH1 and CD44 were
regulated by the over-expression or inhibition of PTEN(FIGS. 1a and
1b).
[0098] <1-2> Changes in the expression of TSPYL5 according to
the over-expression or inhibition of PTEN
[0099] The expressions of the cancer stem cell markers ALDH1 and
CD44 mRNAs and proteins were measured in A549 cells(VC), A549 cells
over-expressing PTEN(PTEN(+)), H460 cells(si-CTL), and
PTEN-suppressed H460 cells(si-PTEN) to investigate the changes in
the expressions of TSPYL5 gene and protein according to the
over-expression or inhibition of PTEN.
[0100] Particularly, mRNA was extracted from the cells, to which 1
ml of trisol was added, followed by mixing for 5 minutes. 200 .mu.l
of chloroform reagent was added thereto, followed by mixing for 5
minutes. The mixture was centrifuged at 4.degree. C. for 10
minutes. 200 .mu.l of the supernatant was transferred into a new
tube. Then, 500 .mu.l of isopropanol was added thereto, followed by
reaction at room temperature for 10 minutes. The mixture was
centrifuged at 4.degree. C. to remove the supernatant. The
precipitate was washed with 75% ethanol containing DEPC.
Centrifugation was performed again to eliminate the supernatant.
The remaining precipitate was dissolved in DEPC solution, followed
by quantification. cDNA was synthesized from 1 .mu.g of the
quantified RNA by the reaction at 45.degree. C. for 1 hour and at
95.degree. C. for 5 minutes by using a cDNA kit(iNtRON
Biotechnology). PCR was performed with I-taq polymerase(iNtRON) and
the primers listed in Table 4 using the synthesized cDNA as a
template. PCR was performed as follows; predenaturation at
94.degree. C. for 5 minutes, denaturation at 94.degree. C. for 30
seconds, annealing at 56.degree. C. for 30 seconds, polymerization
at 72.degree. C. for 30 seconds, 30 cycles from denaturation to
polymerization, and final extension at 72.degree. C. for 10
minutes. The product was loaded on 1% agarose gel to be
confirmed.
TABLE-US-00004 TABLE 4 SEQ. Gene Direction Sequence (5'-3') ID. NO
Tm/cycle PTEN Forward CGAACTGGTGTAATGA 23 57.degree. C./30 TATGT
Reverse CATGAACTTGTCTTCC 24 CGG ALDH1A1 Forward TGTTAGCTGATGCCGA 25
58.degree. C./30 CTTG Reverse TTCTTAGCCCGCTCAA 26 CACT ALDH1A3
Forward TCTCGACAAAGCCCTG 27 58.degree. C./30 AAGT Reverse
TATTCGGCCAAAGCGT 28 ATTC CD44 Forward ATGGACAAGTTTTGGT 29
57.degree. C./30 GGCACGCA Reverse TCACCCCAATCTTCAT 30 GTCCACAT
TSPYL5 Forward TTCGGCTCTCCAGGAA 31 57.degree. C./30 GTTT Reverse
GGGGATGGTTCTGAAA 32 TGCT GAPDH Forward AAGGGTCATCATCTCT 33
56.degree. C./25 GCCC Reverse AGGGGTGCTAAGCAGT 34 TGGT
[0101] Western blotting was performed as follows in order to
investigate the protein expression. Lysis buffer(0.05 M
Tris-C1(pH7.4), 0.15 M NaC1, 0.25% deoxycholic acid, 1% NP-40, 1 mM
EDTA, and protease inhibitor cocktail) was added to the target
cells, followed by reaction at 4.degree. C. for 30 minutes. The
cell lysate was centrifuged at 4.degree. C. to obtain the
supernatant. The supernatant was quantified. 40 .mu.g of each
protein was loaded on SDS-gel, followed by electrophoresis. The
proteins were transferred onto nitrocellulose membrane, followed by
blocking with BSA containing buffer at room temperature for 30
minutes. Then, the membrane was reacted with the primary antibody
PTEN(1:1000), TSPYL5(Santa Cruz), ALDH1A1, ALDH1A3(Abcam), CD44,
and .beta.-actin, or GAPDH(CST) for 4 hours. Then, the membrane was
reacted with the secondary antibody(l:10000). The nitrocellulose
membrane was washed 5 times with PBS, followed by sensitization on
the film with the detection solution.
[0102] As a result, as shown in FIGS. 1c and 1d, when PTEN was
over-expressed in the lung cancer cell line A549, the cancer stem
cell markers such as ALDH1A1, ALDH1A3, and CD44 genes and proteins
were significantly down-regulated. In the meantime, when the PTEN
expression was suppressed in the lung cancer cell line H460, the
cancer stem cell markers such as ALDH1A1, ALDH1A3, and CD44 genes
and proteins were up-regulated(FIGS. 1c and 1d).
[0103] The PTEN dependent changes in the expressions of TSPYL5 gene
and protein were investigated in the cells. As a result, the TSPYL5
protein expression was increased or decreased by PTEN, but the
TSPYL5 gene expression was not affected by PTEN.
[0104] Therefore, it was confirmed that the regulation of PTEN
expression was closely related to the expressions of the cancer
stem cell markers such as ALDH1A1, ALDH1A3, and CD44, and could
also affect the TSPYL5 expression at the protein level.
Experimental Example 2
Regulation of TSPYL5 Expression Through the Regulation of AKT gene
Expression or the Inhibition of AKT Phosphorylation
[0105] To investigate the changes in the expressions of TSPYL5 gene
and protein according to the regulation of AKT gene expression and
the inhibition of AKT activity in a non-small cell lung cancer cell
line, the present inventors treated 20 .mu.M of MK2206(Santa Cruze
Biotechnology), the AKT(serine/threonine protein kinase) inhibitor,
to A549 cells or inhibited AKT1 by using siRNA. Then, PCR and
Western blotting were performed by the same manner as described in
Experimental Example 1 to investigate the changes in the expression
patterns of AKT and TSPYL5 genes and proteins. In the meantime, the
vector over-expressing AKT was constructed by the same manner as
described in Example <1-1>, which was used for the
transfection of the lung cancer cell line H460 by the same manner
as described in Example <1-3>. The same experiment as
described in Experimental Example 1 was performed with the
transfected cells.
[0106] As a result, as shown in FIG. 2a, the expression of TSPYL5
gene was not changed by the expression of AKT1 gene, but the
expressions of TSPLY5, ALDH1A1, ALDH1A3, and CD44 were changed by
AKT(FIG. 2a).
[0107] As shown in FIG. 2b, when the AKT phosphorylation was
suppressed by MK2206, the expression of TSPYL5 protein was
inhibited in proportion to the suppression time of AKT
phosphorylation, suggesting that the TSPYL5 expression could be
regulated by AKT(FIG. 2b).
Experimental Example 3
Location of TSPYL5 Expression in Cells
[0108] <3-1> Changes in the Location of TSPYL5 Expression
According to the Treatment of AKT/PI3K Inhibitor
[0109] 1.times.10.sup.5 A549 cells placed on the culture dish with
the cover glass were treated with 10 .mu.M of MK2206(AKT inhibitor)
and 50 .mu.M of LY294002(PI3K inhibitor) for 4 hours. The cells
were fixed in 4% paraformaldehyde solution for 20 minutes. Then,
the cover glass was washed with PBS three times and then treated
with 0.5% TritonX-100 solution for 5 minutes. The cover glass was
washed again with PBS three times. The cells were treated with 1%
BSA for 2 hours, followed by reaction with the primary antibody
TSPYL5(Santa Cruz) diluted in PBS buffer at the ratio of 1:100 for
2 hours. Then, the cells were reacted with the secondary antibody
Rabbit(Cell Signaling Technology) diluted at the ratio of 1:1000
for 1 hour. The cells were washed with PBS three times, and then
the nucleus was stained with DAPI solution for 5 minutes. The
location and the amount of TSPYL5 expression were investigated
under fluorescent microscope.
[0110] As a result, as shown in FIG. 3a, TSPYL5 protein was
expressed in the nucleus and cytoplasm of A549 cells. However, when
the cells were treated with AKT or PI3K inhibitor, TSPYL was not
expressed in the nucleus. Western blotting was also performed by
the same manner as described in Experimental Example <1-1>.
As a result, when AKT or PI3K inhibitor was treated to the cells,
the expressions of TSPYL5, phosphorylated AKT, CD44, ALDH1A3, and
ALDH 1A1 were reduced.
[0111] <3-2> Location of TSPYL5 Mutant Expression in
Cells
[0112] To investigate the location of the expression of the TSPYTL5
mutant constructed in Example <1-2> in cells,
1.times.10.sup.5 H460 cells were transfected with 5 .mu.g of each
pcDNA3.1/TSPYL5, pcDNA3.1/TSPYL5-120A, and pcDNA3.1/TSPYL5-120D by
using Lipofectamine 2000(Invitrogen). The expression pattern of
TSPYL5 in cells was examined by the same manner as described in
Experimental Example <3-1>.
[0113] As a result, as shown in FIG. 3b, it was confirmed that
TSPYL5 was expressed in the nucleus and cytoplasm in the cells
introduced with pcDNA3.1/TSPYL5(wild-type) or
pcDNA3.1/TSPYL5-120D(phosphorylation mimic). However, in the cells
introduced with pcDNA3.1/TSPYL5-120A, the TSPYL5 expression was not
observed in the nucleus. From the above results, it was confirmed
that the 120th amino acid of TSPYL5 protein was phosphorylated and
the phosphorylated TSPYL5 moved into the nucleus and was
functioning as a transcription factor therein.
[0114] In addition, cell fractionation was performed to investigate
the expression pattern of TSPYL5 in the cytoplasm and the nucleus.
1.times.10.sup.6H460 cells in a 10 cm culture plate were
transfected with 5 .mu.g of each pcDNA3.1/TSPYL5(wild-type),
pcDNA3.1/TSPYL5-120A, and pcDNA3.1/TSPYL5-120D by using
Lipofectamine 2000(Invitrogen), followed by culture for 72 hours.
Then, the cultured cells were collected by using trypsin-EDTA. The
cells were washed with PBS twice and suspended in 5 ml of cold
buffer A(10 mM HEPES(pH7.9), 1.5 mM MgCl.sub.2, 10 mM KCl, 0.5 mM
DTT) and then stayed in ice for 5 minutes. The cells were
pulverized by Ultra Sonic(Pulse on: 2 sec, Pulse off: 8 sec, Total
working time 30 sec), followed by centrifugation at 3500 rpm at 4
for 10 minutes to obtain the supernatant. The obtained supernatant
was transferred in a new tube. The supernatant was added with RIPA
buffer composed of 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% NP-40,
and 0.5% deoxycholate, diluted at 10.times., which was used as a
cytoplasmic protein fraction. At this time, there were nuclei and
by-products together in the centrifugation pellet. 3 ml of S1
buffer(0.25 M sucrose, 10 mM MgCl2) was added to the pellet, and 3
ml of S3 buffer(0.88 M sucrose, 0.5 mM MgCl2) was carefully added
thereto, in order to separate layers. Centrifugation was performed
again at 3500 rpm at 4.degree. C. for 10 minutes to eliminate the
supernatant. The remaining pellet was added with RIPA buffer, which
stood in ice for 30 minutes. Centrifugation was performed at 2000
rpm at 4.degree. C. for 30 minutes to collect the supernatant,
which was transferred into a new tube. The obtained supernatant was
used as a nucleus fraction. The obtained cytoplasmic fraction and
the nucleus fraction were quantified, followed by Western blotting.
At this time, tubulin, the protein which is present only in the
cytoplasm, was used as a marker to confirm the cell fraction.
[0115] As a result, as shown in FIG. 3b, the TSPYL5-120A mutant
wherein the 120th threonine residue was substituted with alanine
could not move in the nucleus and stayed only in the cytoplasm. In
the meantime, TSPYL5(wild-type) and the threonine residue analogue
TSPYL5-120D were expressed in the nucleus(FIG. 3b).
[0116] Other phosphorylation sites, the 326th threonine and the
409th threonine residues, were substituted with alanine, resulting
in TSPYL5-326A and TSPYL5-409A mutants. Those mutants were
introduced in H460 cells. As a result, as shown in FIG. 3c, they
were all expressed in the nucleus(FIG. 3c). Western blotting was
performed by the same manner as described in Experimental Example
1. As a result, as shown in FIG. 3c, the expression levels of CD44,
TSPYL5, and ALDH1A1 were all increased (FIG. 3c).
Experimental Example 4
Binding Between TSPYL5 and AKT
[0117] To confirm the binding between TSPYL5 and AKT, the lung
cancer cell line A549 or H460 was transfected with wild-type TSPYL5
or TSPYL5-120A, from which proteins were separated. TSPYL or AKT
specific antibody was diluted at the ratio of 200:1, which was
placed in a 4 rotator, followed by reaction for at least 12 hours.
The prepared A+G agarose beads were added thereto, followed by
further reaction for 5 hours. Centrifugation was performed at 2000
rpm, at 4.degree. C., for 3 minutes. The supernatant was discarded
and the remaining beads were washed with a protein extraction
solution three times. The protein was heated at 95 and the protein
binding was confirmed by Western blotting.
[0118] As a result, as shown in FIG. 4, the wild-type TSPYL5
protein was bound to AKT but the TSPYL5-120A mutant was not linked
to AKT(FIG. 4). Therefore, it was suggested that AKT was bound to
TSPYL5 to phosphorylate threonine, the 120th residue of TSPYL5.
Experimental Example 5
Ubiquitination Assay of TSPYL5
[0119] The ubiquitin proteasome mechanism is a proteolysis
mechanism in eukaryotes, one of the post-translational
modifications wherein the activity of a protein synthesized in
cells can be regulated. Most (about 80%) of cellular proteins are
degraded in proteasomes after ubiquitin labeling.
[0120] H460 cells were transfected with pcDNA3.1/TSPYL5(wild-type)
and pcDNA3.1/TSPYL5-120A constructed in Example 1. 48 hours later,
10 .mu.M MK2206 was treated to the cells for 1 hour and then the
cells were recovered. A protease inhibitor was added to a cell
lysis solution(2% SDS, 150 mM NaCl, 10 mM Tris-HCl, pH 8.0),
followed by mixing. 100 .mu.l of the solution was added to the
cells. The cells were lysed by using a sonicator. Centrifugation
was performed at 13000 rpm. The supernatant was obtained, which was
diluted in a diluting solution(0.01% SDS, 1.1% Triton X-100, 1.2 mM
EDTA, 16.7 mM Tris-HCl (pH8.1), 167 mM NaCl) at 1/10, followed by
reaction at 4.degree. C. for 30 minutes. TSPYL5 or ubiquitin
specific antibody was added thereto, followed by reaction for
overnight to induce protein binding. Protein A/G agarose beads were
added thereto, followed by reaction for 4 hours. The protein was
washed with washing buffer(10 mM Tris-HCl pH 8.0, 1 M NaCl, 1 mM
EDTA, 1% NP40) twice. The protein was mixed with loading buffer and
heated at 95.degree. C. Samples were loaded, followed by reaction
with TSPYL5 or ubiquitin specific antibody to confirm the protein
expression.
[0121] As a result, as shown in FIG. 5, when AKT inhibitor was
treated, the phosphorylation of TSPYL5 was inhibited but the
ubiquitination was increased. When TSPYL5-120A was over-expressed,
the ubiquitination of TSPYL5-T120A protein was induced regardless
of the AKT activity. When the proteosome inhibitor MG132 was
treated, and accordingly when the 120th amino acid of TSPYL5 was
phosphorylated, the protein degradation was suppressed and the
non-phosphorylated TSPYL5-120A was decomposed by
ubiquitin-proteosome mechanism(FIG. 5).
Experimental Example 6
SUMOylation Assay of TSPYL5
[0122] Ubiquitin protein is functioning to decompose a specific
protein. Other proteins having similar structure to the ubiquitin
protein, which are SUMO proteins, are involved in the regulation of
protein functions including movement of the intracellular protein
into the nucleus, changes of the binding protein, and changes of
the DNA binding and transcription ability of the DNA transcription
factor, etc. The present inventors performed SUMOylation assay in
order to investigate the interaction between the TSPYL5 SUMOylation
and the movement of TSPYL5 protein into the nucleus.
[0123] Particularly, the H460 cells transfected with
pcDNA3.1/TSPYL5(wild-type) and pcDNA3.1/TSPYL5-120A and
additionally with His-tagged SUMO-expression vector were lysed in
RIPA buffer. The supernatant was collected and reacted with His-tag
affinity beads 4 hours. Then, the beads were was collected and
treated with the sample buffer. Western blotting was performed,
followed by TSPYL5 antibody reaction.
[0124] As a result, as shown in FIG. 6, in the lung cancer cell
line H460 transfected with pcDNA3.1/TSPYL5(wild-type), the
SUMOylation was confirmed. However, in the cells expressing
pcDNA3.1/TSPYL5-120A, the SUMOylation was not observed. To confirm
the SUMOylation inhibition, the SUMO1 inhibitor ginkgolic
acid(Abcam) was treated to A549 cells at the concentration of 3 uM
for 2 hours. As a result, TSPYL5 protein was not expressed in the
nucleus. The above results indicate that the ubiquitination and the
SUMOylation of TSPYL5 were regulated by the phosphorylation of
threonine, the 120th residue, and the migration of TSPYL5 into the
nucleus was regulated by the SUMOylation(FIG. 6).
Experimental Example 7
Changes in the expression patterns of ALDH1 Isozyme and CD44
According to the Modification of Threonine, the 120th Amino Acid
Residue of TSPYL5
[0125] In H460 cells, pcDNA3.1/TSPYL5(wild-type) and
pcDNA3.1/TSPYL5-120A or pcDNA3.1/TSPYL5-120D was over-expressed by
the same manner as described in Experimental Example 1. Then, the
expressions of the cancer stem cell markers ALDH1 and CD44 were
investigated.
[0126] As a result, as shown in FIGS. 7a to 7c, in the cells
wherein pcDNA3.1/TSPYL5-120A was over-expressed, the expressions of
ALDH1A1, ALDH1A3, and CD44 genes and proteins were reduced. The
activity of ALDH and the expression of CD44 were investigated by
FACScan using ALDEFLUOR and CD44-APC. As a result, the expression
amount of ALDH1 in the cells expressing TSPYL5(wild-type) was 19%,
while it was reduced to 12.8% in the cells expressing
pcDNA3.1/TSPYL5-120A. The expression amount of CD44 in the cells
expressing TSPYL5(wild-type) was 51.7%, while it was reduced to
38.1% in the cells over-expressing pcDNA3.1/TSPYL5-120A(FIG 7a to
7c).
[0127] Therefore, it was confirmed that the expression levels of
ALDH1 isozyme and CD44 genes and proteins could be increased by the
phosphorylation of threonine, the 120th amino acid residue of
TPSYL5.
Experimental Example 8
Cancer Cell Metastatic Ability According to the Modification of
Threonine, the 120th Amino Acid Residue of TPSYL5
[0128] To investigate the cancer cell metastatic ability according
to the modification of threonine, the 120th amino acid residue of
TPSYL5, migration assay was performed by using transwell(Falcon,
USA) having the pore size of 0.8 .mu.m.
[0129] Particularly, 5.times.10.sup.4 H460 cells and
5.times.10.sup.4 H460 cells over-expressing
pcDNA3.1/TSPYL5(wild-type), pcDNA3.1/TSPYL5-120A, or
pcDNA3.1/TSPYL5-120D constructed in Example 1 were mixed with 100
.mu.l of serum free RPMI-1640, which were loaded in the transwell
upper chamber. In the lower chamber, 500 .mu.l of RPMI1640
supplemented with 7% FBS was loaded. Then, the two chambers were
combined together. The cells were maintained in a 37.degree. C., 5%
CO.sub.2 incubator for about 40 hours. Then, the membrane of the
upper chamber was wiped with cotton swabs, followed by staining
with crystal violet. The cells were observed under microscope.
[0130] For invasion assay, the transwell upper chamber was coated
with 100 .mu.l of matrigel(20 .mu.g/well; BD Biosciences). Then,
the rest of the process was the same as described in the migration
assay above. The cells stained with crystal violet were eluted with
500 .mu.l of 10% acetic acid. OD.sub.600 was measured to calculate
the relative migration/invasion value of H460 cells.
[0131] As a result, as shown in FIG. 8a, in the cells
over-expressing TSPYL5(wild-type) and pcDNA3.1/TSPYL5-120D, the
cancer cell metastasis was well induced. However, in the cells
over-expressing pcDNA3.1/TSPYL5-120A, the cancer cell metastasis
was reduced, compared with that in the control H460 cells(FIG.
8a).
Experimental Example 9
Changes of sphere formation according to the modification of
Threonine, the 120th Amino Acid Residue of TPSYL5
[0132] To investigation the sphere formation in H460 cells
over-expressing pcDNA3.1/TSPYL5(wild-type), pcDNA3.1/TSPYL5-120A,
or pcDNA3.1/TSPYL5-120D constructed in Example 1, 2.times.10.sup.4
non-small cell lung cancer cells were suspended in DMEM(Invitrogen)
supplemented with stem cell-permissive medium. 20 ng/mL of EGF, 20
ng/mL of basic fibroblast growth factor(bFGF), and B27 serum-free
supplement(50.times.; Invitrogen) were added to
DMEM-F12(Invitrogen), which was cultured on the 60 mm plate
pre-coated with 0.8% agar. The cells were cultured in a 37.degree.
C., 5% CO.sub.2 incubator for 10 days. Then, the sphere formation
was measured.
[0133] As a result, as shown in FIG. 8, the sphere formation was
confirmed in the cells over-expressing TSPYL5(wild-type) and
pcDNA3.1/TSPYL5-120D, while the sphere formation or growth was
suppressed in the cells over-expressing pcDNA3.1/TSPYL5-120A(FIG.
8a).
Experimental Example 10
Cancer cell Proliferation and radiation sensitivity according to
the modification of threonine, the 120th amino acid residue of
TPSYL5
[0134] 1.times.10.sup.3 H460 cells either normal or over-expressing
pcDNA3.1/TSPYL5, pcDNA3.1/TSPYL5 -120A, or pcDNA3.1/TSPYL5-120D
constructed in Example 1 were distributed on a 35 mm plate,
followed by culture in a 37.degree. C. 5% CO.sub.2 incubator for 8
days. The cells were stained with 0.5% crystal violet for 10
minutes, followed by washing with PBS several times. Then, the cell
proliferation was observed.
[0135] As a result, as shown in FIG. 8b, the cell proliferation was
increased in H460 cells over-expressing TSPYL5(wild-type) or
pcDNA3.1/TSPYL5-120D, while the cell proliferation was suppressed
in those cells over-expressing pcDNA3.1/TSPYL5-120A, compared with
the control H460 cells. When the cells were irradiated(cobalt-60,
2Gy), the cells over-expressing pcDNA3.1/TSPYL5-120A demonstrated
the suppressed cell proliferation, compared with the control H460
cells(FIG. 8b).
Experimental Example 11
Function of TSPYL5 as a Transcriptional Regulatory Factor
[0136] Chromatin precipitation was performed to investigate the
function of TSPYL5 as a transcriptional regulatory factor.
[0137] Particularly, A549 cells were cultured on a 100 mm plate.
Before the collection, formaldehyde was treated thereto at the
concentration of 1% by the volume of the medium. Reaction was
induced in an incubator for 20 minutes and then the cells were
washed with PBS containing a protease inhibitor twice. The cells
were collected, and centrifuged. The collected cells were fixed and
treated with SDS lysis buffer, followed by reaction in ice. The
cells were disrupted with an ultrasonicator and the supernatant was
obtained. A diluting solution(0.01% SDS, 1.1% Triton X-100, 1.2 mM
EDTA, 16.7 mM Tris-HC1(pH8.1), 167 mM NaCl) was added to the cells
above, followed by reaction for 30 minutes. The cells were reacted
with TSPYL5 antibody for overnight. Protein A/G agarose beads were
added thereto, followed by further reaction for 4 hours. The beads
were collected by centrifugation, which were washed with a buffer
several times and then reacted with elution buffer(20% SDS, 1 M
NaHCO.sub.3), followed by separation. The cells were treated with 5
M NaCl, followed by reaction at 65 for 4 hours. 2 .mu.l of
proteinase K(10 mg/ml), 0.5 M EDTA, and 1 M Tris-HCl(pH 6.5) were
added thereto, followed by reaction at 45.degree. C. for 1 hour.
PCR was performed using the reactant as a template with the primers
listed in Table 5. The PCR product was analyzed by agarose gel
electrophoresis.
[0138] As a result, as shown in FIG. 9, the ALDH1A1, ALDH1A3, CD44,
and PTEN genes affected by the TSPYL5 expression were confirmed as
bound to TSPYL5, suggesting that the expressions of those genes
were regulated by the TSPYL5 expressed in the nucleus(FIG. 9).
TABLE-US-00005 TABLE 5 ChIP SEQ. primer Direction Sequence (5'-3')
ID. NO pALDH1A1 Forward ATTTAGGGCTTCTGAG 35 ATCACAG Reverse
ACTTCTCATGCTTTTT 36 AATGCTAC pALDH1A3 Forward GCCTCAGCTGTGCACT 37
CCAGGCC Reverse TGGAACAAAGACCGGA 38 GGCACGGA pCD44 Forward
AATGATGGATGAGAAG 39 TTGTATGG Reverse GATAGGGCTGGCATTT 40 GGCTCAGC
pPTEN Forward TTTGGGCCCTTGAAAT 41 TCAACGGC Reverse GACTGCATTCGCTCTT
42 TCCTTTTG
Experimental Example 12
Inhibition of Cancer Cell Proliferation According to the Treatment
of TPSYL5 Peptide
[0139] From the above results, it was confirmed that the
phosphorylation of TSPYL5 is an important factor to regulate the
transcriptions of those genes that play an important role in cancer
stem cell characteristics. Therefore, to inhibit the cancer stem
cell proliferation, the inhibitor of the phosphorylation of
threonine, the 120th residue of TSPYL5, can be efficient. So, the
present inventors synthesized the peptide composed of 15 mer amino
acids containing the 120th residue threonine of TSPYL5 shown in
Table 6 and its derivatives, followed by investigation of the
cancer cell proliferation inhibition effect thereof.
[0140] The TSPYL5 function inhibiting peptide contained 7 amino
acid residues back and forth around the 120th T, and a mutant
peptide in which T was substituted with D or A as the 120th
threonine mutant was synthesized. Generally, since peptides do not
have cell permeability, PEGylation was induced at the C-terminal of
the peptide sequence, resulting in the synthesis of a TSPYL5
originated peptide having cell permeability, which was used for the
efficacy test.
TABLE-US-00006 TABLE 6 Peptide Amino acid sequence SEQ. ID. NO
TS120T SERSAADTVFVGTAG 43 TS120D SERSAADDVFVGTAG 44 TS120A
SERSSADAVFVGTAG 45
[0141] Particularly, 1.times.10.sup.3 A549 cells were distributed
on a 35 mm plate, which were treated with 10 .mu.M of each peptide.
As for the control, DMSO was treated thereto, followed by culture
in a 37.degree. C. 5% CO.sub.2 incubator for 8 days. The cells were
stained with 0.5% crystal violet for 10 minutes. The cells were
washed with PBS several times and then cell proliferation was
investigated.
[0142] As a result, as shown in FIG. 10, the cell proliferation was
significantly inhibited in those cells treated with TS120T and
TS120D peptides, compared with the control. However, the cell
proliferation in the cells treated with TS120A was not changed and
was similar to that of the control(FIG. 10).
Experimental Example 13
Decrease of Cancer Cell Metastasis and Invasion According to the
Treatment of TSPYL5 Peptide
[0143] 5.times.10.sup.4 A549 cells were mixed with 100 .mu.l of
serum-free RPMI-1640 and 10 .mu.M of those peptides listed in Table
6. The mixture was loaded in the transwell upper chamber.In the
lower chamber, 500 .mu.l of RPMI1640 supplemented with 7% FBS was
loaded. Then, the two chambers were combined together. The cells
were cultured in a 37.degree. C. 5% CO.sub.2 incubator for 40
hours. The upper chamber membrane was wiped with cotton swabs,
stained with crystal violet, and then observed under
microscope.
[0144] For invasion assay, the transwell upper chamber was coated
with 100 .mu.l of matrigel(20 .mu.g/well; BD Biosciences). Then,
the rest of the process was the same as described in the migration
assay above. The cells stained with crystal violet were eluted with
500 .mu.l of 10% acetic acid. OD.sub.600 was measured to calculate
the relative migration/invasion value of A549 cells.
[0145] As a result, as shown in FIG. 10, in the cells
over-expressing TSPYL5(wild-type) and pcDNA3.1/TSPYL5-120D, the
cancer cell metastasis was well induced. However, in the cells
over-expressing pcDNA3.1/TSPYL5-120A, the cancer cell metastasis
was reduced, compared with that in the control H460 cells(FIG.
8a).
[0146] As a result, as shown in FIG. 10, the metastasis and
invasion were reduced according to the treatment of TS120T and
TS120D peptides, compared with the control. However, the treatment
of TS120A peptide did not make any big difference with the
control(FIG. 10).
Experimental Example 14
Inhibition of Sphere Formation by TSPYL5 Peptide
[0147] To investigate the capacity of TSPYL5 peptide to inhibit the
sphere formation, 2.times.10.sup.4 A549 cells(non-small cell lung
cancer cells) were suspended in DMEM(Invitrogen) containing stem
cell-permissive medium. 20 ng/ml of EGF, 20 ng/ml of basic
fibroblast growth factor(bFGF) and B27 serum-free
supplement(Invitrogen) were mixed with DMEM-F12(Invitrogen). The
cells were distributed in the 96 well plate pre-coated with 0.8%
agar(one cell/well), to which 10 .mu.M of each peptide was treated,
followed by culture. The cells were cultured in a 37.degree. C. 5%
CO.sub.2 incubator for 10 days. Then, the sphere formation was
observed.
[0148] As a result, as shown in FIG. 10, the sphere formation was
not much changed in the cells treated with TS120A peptide, compared
with the control. However, in the cells treated with TS120T and
TS120D peptides, the sphere formation was suppressed, compared with
the control(FIG. 10).
[0149] Those skilled in the art will appreciate that the
conceptions and specific embodiments disclosed in the foregoing
description may be readily utilized as a basis for modifying or
designing other embodiments for carrying out the same purposes of
the present invention. Those skilled in the art will also
appreciate that such equivalent embodiments do not depart from the
spirit and scope of the invention as set forth in the appended
claims.
Sequence CWU 1
1
45127DNAArtificial SequenceTSPYL5_primer F 1cttaagctta tgagcggccg
aagtcgg 27228DNAArtificial SequenceTSPYL5_primer R 2tggaattcgt
gttggattgg ctcacccc 28329DNAArtificial SequencePTEN_primer R
3atataagctt atgacagcca tcatcaaag 29433DNAArtificial
SequencePTEN_primer R 4atatgaattc tcagactttg taatttgtgt atg
33519DNAArtificial SequenceAKT1_primer F 5atgagcgacg tggctattg
19620DNAArtificial SequenceAKT1_primer R 6tcaggccgtg ccgctggccg
20738DNAArtificial SequenceT120A_primer F 7gagcgcctgg ccgcagacgc
tgtcttcgtg ggaacagc 38838DNAArtificial SequenceT120A_primer R
8gctgttccca cgaagacagc gtctgcggcc aggcgctc 38938DNAArtificial
SequenceT120D_primer F 9gagcgcctgg ccgcagacca tgtcttcgtg ggaacagc
381038DNAArtificial SequenceT120D_primer R 10gctgttccca cgaagacatc
gtctgcggcc aggcgctc 381133DNAArtificial SequenceT177A_primer F
11ggcggcaggg gagaatgcct cggtgtcagc tgg 331233DNAArtificial
SequenceT177A_primer R 12ccagctgaca ccgaggcatt ctcccctgcc gcc
331334DNAArtificial SequenceT326A_primer F 13ggtggtgtct cgttctgctc
caatccagtg gctc 341434DNAArtificial SequenceT326A_primer R
14gagccactgg attggagcag aacgagacac cacc 341533DNAArtificial
SequenceT409A_primer F 15gcagccaatg gagactgctc agcctggggt gag
331632DNAArtificial SequenceT409A_primer R 16tcaccccagg ctgagcagtc
tccattggct gc 321725RNAArtificial SequenceTSPYL5_primer F1
17aaagguagaa cugcaaggga uuggg 251825RNAArtificial
SequenceTSPYL5_primer R1 18cccaaucccu ugcaguucua ccuuu
251919RNAArtificial SequencePTEN_primer F1 19gauaucaaga ggauggauu
192019RNAArtificial SequencePTEN_primer R1 20aauccauccu cuugauauc
192119RNAArtificial SequenceAKT_primer F 21gacugacacc agguauuuu
192218RNAArtificial SequenceAKT_primer R 22aaauaccugg ugucaguc
182321DNAArtificial SequencePTEN_primer F2 23cgaactggtg taatgatatg
t 212419DNAArtificial SequencePTEN_primer R2 24catgaacttg tcttcccgg
192520DNAArtificial SequenceALDH1A1_primer F 25tgttagctga
tgccgacttg 202620DNAArtificial SequenceALDH1A1_primer R
26ttcttagccc gctcaacact 202720DNAArtificial SequenceALDH1A3_primer
F 27tctcgacaaa gccctgaagt 202820DNAArtificial
SequenceALDH1A3_primer R 28tattcggcca aagcgtattc
202924DNAArtificial SequenceCD44_primer F 29atggacaagt tttggtggca
cgca 243024DNAArtificial SequenceCD44_primer R 30tcaccccaat
cttcatgtcc acat 243120DNAArtificial SequenceTSPYL5_primer F2
31ttcggctctc caggaagttt 203220DNAArtificial SequenceTSPYL5_primer
R2 32ggggatggtt ctgaaatgct 203320DNAArtificial SequenceGAPDH_primer
F 33aagggtcatc atctctgccc 203420DNAArtificial SequenceGAPDH_primer
R 34aggggtgcta agcagttggt 203523DNAArtificial
SequencepALDH1A1_primer F 35atttagggct tctgagatca cag
233624DNAArtificial SequencepALDH1A1_primer R 36acttctcatg
ctttttaatg ctac 243723DNAArtificial SequencepALDH1A3_primer F
37gcctcagctg tgcactccag gcc 233824DNAArtificial
SequencepALDH1A3_primer R 38tggaacaaag accggaggca cgga
243924DNAArtificial SequencepCD44_primer F 39aatgatggat gagaagttgt
atgg 244024DNAArtificial SequencepCD44_primer R 40gatagggctg
gcatttggct cagc 244124DNAArtificial SequencepPTEN_primer F
41tttgggccct tgaaattcaa cggc 244224DNAArtificial
SequencepPTEN_primer R 42gactgcattc gctctttcct tttg
244315PRTArtificial SequenceTS120T 43Ser Glu Arg Ser Ala Ala Asp
Thr Val Phe Val Gly Thr Ala Gly 1 5 10 15 4415PRTArtificial
SequenceTS120D 44Ser Glu Arg Ser Ala Ala Asp Asp Val Phe Val Gly
Thr Ala Gly 1 5 10 15 4515PRTArtificial SequenceTS120A 45Ser Glu
Arg Ser Ala Ala Asp Ala Val Phe Val Gly Thr Ala Gly 1 5 10 15
* * * * *