U.S. patent application number 15/972331 was filed with the patent office on 2018-11-01 for oligonucleotide detection method.
The applicant listed for this patent is AXOLABS GMBH. Invention is credited to Ingo ROEHL, Markus SCHUSTER, Stephan SEIFFERT.
Application Number | 20180312909 15/972331 |
Document ID | / |
Family ID | 41319548 |
Filed Date | 2018-11-01 |
United States Patent
Application |
20180312909 |
Kind Code |
A1 |
ROEHL; Ingo ; et
al. |
November 1, 2018 |
OLIGONUCLEOTIDE DETECTION METHOD
Abstract
The invention relates to a method for the detection of
oligonucleotides using anion exchange high performance liquid
chromatography. Fluorescently labelled peptide nucleic acid
oligomers, complementary to the oligonucleotide are hybridized to
the oligonucleotides. Anion exchange high performance liquid
chromatography is then performed and the hybridized moieties
detected and quantitated. The invention also relates to a method
for the simultaneous detection of both strands of an
oligonucleotide in parallel from one sample, and a kit for use in
qualitative and quantitative detection of one or two strands of an
oligonucleotide.
Inventors: |
ROEHL; Ingo; (Memmelsdorf,
DE) ; SCHUSTER; Markus; (Bayreuth, DE) ;
SEIFFERT; Stephan; (Kulmbach, CH) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
AXOLABS GMBH |
Kulmbach |
|
DE |
|
|
Family ID: |
41319548 |
Appl. No.: |
15/972331 |
Filed: |
May 7, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13124411 |
Apr 15, 2011 |
|
|
|
PCT/EP2009/062926 |
Oct 6, 2009 |
|
|
|
15972331 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 1/6816 20130101; C12Q 2525/107 20130101; C12Q 2525/207
20130101; C12Q 2563/107 20130101; C12Q 2565/137 20130101 |
International
Class: |
C12Q 1/6816 20060101
C12Q001/6816 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 15, 2008 |
EP |
08166721.4 |
Claims
1. A method for detecting an oligonucleotide and its
oligonucleotide metabolites, wherein the oligonucleotide is an RNA
oligonucleotide selected from the group consisting of short
interfering RNAs (siRNAs) and microRNAs (miRNAs), comprising the
steps of (a) selecting a biological sample containing or suspected
of containing said RNA oligonucleotide, wherein the sample is
tissue lysate or plasma, (b) combining said biological sample with
a fluorescently labeled peptide nucleic acid (PNA) probe which is
fully complementary to at least 10 nucleotides of said RNA
oligonucleotide thereby forming hybridized moieties between said
RNA oligonucleotide sequence and said PNA probe, (c) separating
said hybridized moieties from unhybridized moieties by anion
exchange high performance liquid chromatography (HPLC) under
conditions where unhybridized PNA probe elutes in the void volume,
and (d) quantitatively detecting said hybridized moieties by
fluorescence spectroscopy.
2. The method according to claim 1, wherein the RNA oligonucleotide
is a siRNA oligonucleotide, wherein both strands of a siRNA
oligonucleotide from one sample are detected in parallel, and
wherein said sample is contacted with a fluorescently labelled PNA
probe fully complementary to a least 10 nucleotides of the sense
strand of said RNA oligonucleotide and a fluorescently labelled PNA
probe fully complementary to at least 10 nucleotides of the
antisense strand of said RNA oligonucleotide in step (b) and then
performing steps (c) to (d), wherein (i) the two PNA probes are
designed so that hybridization leads to different retention times
of the two single strands, or (ii) two different fluorescence
labels are used.
3. The method according to claim 1, wherein the RNA oligonucleotide
is therapeutic siRNA and derivatives thereof, and wherein the
method further comprises qualitative analysis of the in vivo
metabolism of the therapeutic siRNA and derivatives thereof.
4. The method according to claim 2, wherein the RNA oligonucleotide
is therapeutic siRNA and derivatives thereof, and wherein the
method further comprises qualitative analysis of the in vivo
metabolism of the therapeutic siRNA and derivatives thereof.
5. The method according to claim 1, wherein quantitatively
detecting detects RNA oligonucleotides that are extracellular and
intracellular delivered siRNA.
6. The method according to claim 2, wherein quantitatively
detecting detects RNA oligonucleotides that are extracellular and
intracellular delivered siRNA.
7. The method according to claim 1, wherein a known concentration
of the RNA oligonucleotide that should be detected is added to the
sample.
8. The method according to claim 2, wherein a known concentration
of the RNA oligonucleotide that should be detected is added to the
sample.
9. The method according to claim 1, wherein the PNA probe is
labeled with Atto 610, Atto 425 or Atto 520.
10. The method according to claim 2, wherein the PNA probe is
labeled with Atto 610, Atto 425 or Atto 520.
Description
[0001] The present application is a continuation of U.S.
application Ser. No. 13/124,411, filed Apr. 15, 2011, which is a
U.S. National Phase Entry of PCT/EP2009/062926, filed Oct. 6, 2009,
which claims benefit of European Patent Application No. 08166721.4,
the disclosures of each of which are incorporated by reference
herein in their entireties.
[0002] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Apr. 26, 2018, is named 0073AX01US2seqlist.txt and is 7,119
bytes in size.
[0003] The present invention relates to a new simplified method for
the detection of oligonucleotides, including RNA, DNA and mixed
oligonucleotides, antisense oligonucleotides, short interfering RNA
(siRNA), microRNAs (miRNAs), aptamers and also spiegelmers. In
addition, the present invention relates to a method for the
simultaneous detection of both strands of a double stranded
oligonucleotide in a single measurement, e.g. for siRNA.
[0004] Oligonucleotides of known sequences are commonly used in a
wide variety of chemical and biological applications, and have also
gained high importance in the diagnosis and treatment of diseases.
In particular, antisense oligonucleotides, short interfering RNA
(siRNA) and aptamers are promising pharmalogical tools and
therapeutic agents. The qualitative and quantitative detection of
these oligonucleotides in samples like cells, tissue, blood or
plasma is a prerequisite to assess their therapeutic use and to
monitor their stability in vivo.
[0005] Different methods for the detection of oligonucleotides are
cited in the literature and disclosed in published patent
applications, e.g. WO/2008/046645. Most established procedures for
quantitative and qualitative detection of oligonucleotides are
based on hybridisation with complementary oligonucleotides via
Watson-Crick base pairing. Peptide nucleic acids (PNAs) are
oligonucleotide mimics in which the sugar-backbone is replaced by a
pseudopeptide chain of N-aminoethylglycine monomers. They are often
used in probe-based oligonucleotide detection methods as they bind
to complementary DNA or RNA sequences with high affinity, specifity
and stability (U.S. Pat. No. 6,395,474). WO/2008/046645 mentions
the use of PNA probes in a RT-PCR-based oligonucleotide detection
assay. U.S. Pat. No. 6,045,995 describes the qualitative and
quantitative detection of oligonucleotides by capillary gel
electrophoresis. Rossi et al describe the identification of
PCR-amplified oligonucleotides by PNA probes in anion-exchange high
performance liquid chromatography (HPLC) (J. Agric. Food Chem.
2007, 55, 2509-2516).
[0006] However most of the existing assays to determine
oligonucleotides in biological samples are not able to detect
metabolites or to separate metabolites signals from the signal
generated by the intact oligonucleotide. For example in PCR-based
methods signals are usually generated of the intact drug only or as
the sum of various metabolites together with the intact drug.
Capillary gel electrophoresis with fluorescence detection leads to
quantitative separation of intact oligonucleotide from its
metabolites, but this methodology needs extraction and desalting
steps during sample preparation. In addition, recoveries of the
analyte molecules are variable and an internal standard is needed
for normalization. Another major limitation of the currently used
oligonucleotide detection methods is that only one of the two
strands can be detected in one measurement, which is particularly
disadvantageous for oligonucleotide duplex determination (e.g.
siRNA).
[0007] Thus it would be of great advantage to have a reproducible
and quick method for oligonucleotide detection in samples which is
capable of analysing oligonucleotides and its metabolites in a
sample. Moreover, in view of the rising importance of siRNA and its
derivatives in therapy and diagnostics, there is a need for a
reproducible and quick method capable of detecting both strands of
the oligonucleotide and its metabolites in one measurement.
[0008] Disclosed is a method for qualitative and quantitative
detection of an oligonucleotide comprising the steps of selecting a
sample containing or suspected of containing said oligonucleotide,
forming a hybridization mixture by contacting the sample with a
fluorescently labeled peptide nucleic acid (PNA) probe which is
fully complementary to at least 10 or more nucleotides of said
oligonucleotide, separating hybridized moieties formed between said
oligonucleotide and said PNA probe from unhybridized moieties by
anion exchange high performance liquid chromatography (aIEX-HPLC),
and qualitatively and/or quantitatively detecting said hybridized
moieties by fluorescence spectroscopy. A major advantage of the
present invention over other oligonucleotide detection methods is
the simple sample preparation prior to detection, e.g. no clean-up
procedures, amplification or extraction steps are required.
Therefore any variability regarding the recovery of the analyte is
avoided. In preferred embodiments the sample is treated with
Proteinase K in a buffer containing SDS, followed by precipitation
of the SDS with a saturated KCl solution. Thereby degradation of
the oligonucleotides in the sample is efficiently prevented.
[0009] Excess non-hybridized PNA-probe elutes in the void volume of
the HPLC and no interfering signals during the gradient separation
are expected from the probe. Therefore a high excess of the
PNA-probe can be used to kinetically control the hybridization
process without establishing a step to extract the excess probe
from the sample. The use of the PNA probe also eliminates the
complete background fluorescence from the biological matrix, as it
elutes with the void volume of the aIEX-HPLC. Also signals
generated from unspecific hybridization of the PNA-probe with RNA
or DNA coming from the biological matrix is eluted separately in
the washing step of the HPLC gradient. Therefore only analyte
specific signals can be detected during HPLC gradient with high
selectivity. Hence the aIEX-HPLX setup works very robust even if
loaded with high biological background.
[0010] Due to the uncharged backbone of the PNA it shows high
affinity to the corresponding oligonucleotide strand (no
electrostatic repulsion as for DNA/DNA, DNA/RNA and RNA/RNA
duplexes) which leads to a thermodynamically controlled
hybridization even in presence of a competing RNA strand as in the
case of siRNA duplexes. Another major improvement of this method
over other methods is the capability to detect metabolites and to
separate metabolite signals from the signal generated by the intact
oligonucleotide. The higher separation power for the metabolites is
another result of the uncharged backbone of the PNA-probe. Elution
depends strongly on the metabolite length, the shorter the
metabolite, the earlier it elutes from the HPLC column within the
gradient. Also a 5'-phosphorylated oligonucleotide can be separated
from the non-phosphorylated identical sequence of the same length.
As the 5'-phosphorylation only occurs after the delivery of the
siRNA into the cell this can be used to distinguish extracellular
from intracellular delivered siRNA in tissues. Then the
intracellular 5'-phosphorylated siRNA can serve as a marker for the
amount of active drug in tissue compared to the overall amount of
drug delivered into the organ.
[0011] Sensitivity and reproducibility of the herein described
oligonucleotide detection method: For a model sequence (RD-1003)
the lower limit of quantitation (LLOQ) in plasma is about 250 amol
of the oligonucleotide with the stock calibration approach. The
assay works with high reproducibility (variation <5%).
[0012] The major advantages of the present invention over other
published HPLC-based oligonucleotide quantitation methods are the
quick and simple sample preparation, the lack of amplification
steps prior to detection, the high sensitivity and reproducibility,
the robustness of the assay, the high-throughput capability and the
capability to detect both strands of the oligonucleotide and its
metabolites in one measurement. Rossi et al describe the
identification of oligonucleotides in anion-exchange HPLC (J.
Agric. Food Chem. 2007, 55, 2509-2516). In contrast to the present
invention, additional sample preparation steps and amplification of
the oligonucleotides by PCR are necessary prior to detection.
Further, a simultaneous detection of both strands is impossible, as
the hybridisation protocol requires nucleolytic cleavage of one of
the strands.
[0013] Most of the previously described assays require individual
calibration curves due to the variable unspecific background from
different tissues or plasma. In contrast, unspecific background
signals do not interfere with the assay of the present invention.
Hence, in preferred embodiments of the invention, calibration
curves generated from a dilution series in buffer can be used for
tissue and plasma samples.
[0014] In another aspect of the invention methods are provided for
qualitative and quantitative detection of both strands of an
oligonucleotide duplex in parallel from one sample, comprising the
steps of selecting a sample containing or suspected of containing
said oligonucleotide; forming a hybridization mixture by contacting
the sample with a fluorescently labeled peptide nucleic acid (PNA)
probe which is fully complementary to at least 10 or more
nucleotides of the sense strand of said oligonucleotide, contacting
the hybridization mixture with a second fluorescently labeled PNA
probe, which is fully complementary to at least 10 or more
nucleotides of the antisense strand of said oligonucleotide,
separating hybridized moieties formed between said oligonucleotide
strands and said PNA probes from unhybridized moieties by
aIEX-HPLC, qualitatively and/or quantitatively detecting said
hybridized moieties by fluorescence spectroscopy. This is the first
procedure that allows detection of both strands of an
oligonucleotide duplex in parallel from one sample.
[0015] In the most preferred embodiment two fluorescently labeled
PNA-probes are used for the detection of oligonucleotide duplexes.
Each probe hybridizes specifically to either the sense or antisense
strand of the oligonucleotide. In one embodiment, the same
fluorescence label is used for detection of both strands. The
duplex is designed of two strands with different length or the two
probes are thus designed that hybridization leads to different
retention times of the two single strands in the aIEX-HPLC
analysis. In another embodiment, two different fluorescence labels
are used for detection of both strands with two fluorescence
detectors in one HPLC setup.
[0016] This opens new possibilities not only for quantification
from biological samples but also for CMC characterization of
oligonucleotide duplexes, e.g. to directly characterize the ratio
of the two single strands in a siRNA duplex as the ratio of peak
areas for the individual strands. The signal intensity only depends
on the fluorescence signal after the hybridization procedure and is
independent from the single strand specific UV extinction
coefficients.
[0017] In a preferred embodiment, a known concentration of the
oligonucleotide that should be detected is added to the unknown
sample, and is also added to the calibration and blank sample. This
so-called stock calibration approach improves the sensitivity of
the assay as detailed in the example section.
[0018] In another preferred embodiment the sample 1 s plasma, m yet
another preferred embodiment the sample is tissue.
[0019] In another preferred embodiment, the method is used for
quantitative and qualitative detection of siRNA and derivatives. In
yet another embodiment the method can be used for the quantitative
and qualitative detection of the in vivo metabolism of therapeutic
or diagnostic siRNA.
[0020] In one embodiment said siRNA is detected from in vitro cell
cultures that have been transfected with said siRNA.
[0021] In one embodiment the method is used for quantitative and
qualitative detection of microRNA and derivatives. Preferably said
microRNAs are detected from tissue lysates.
[0022] In another embodiment the method is used for quantitative
and qualitative detection of aptamers. Preferably, said aptamers
are spiegelmers with L-ribose (L-RNA) or L-deoxyribose (L-DNA). In
one embodiment, said aptamer is pegylated.
[0023] In yet another embodiment the method can be used to
distinguish extracellular from intracellular delivered siRNA in
tissues.
[0024] A number of dyes have been described for fluorescently
labeling oligonucleotides. Preferred fluorescence labels include
Atto 610, Atto 425 and Atto 520, but any other fluorescence labels
known to a person skilled in the art can be used in the method.
[0025] In yet another embodiment, this invention is directed to
kits suitable for performing an assay which detects the presence,
absence or number of one or two strands of an oligonucleotide and
its metabolites in a sample. The kits of this invention comprise a
ready-to-use plate preparation comprising one or more PNA probes
and all other reagents or compositions necessary to perform the
assay. The use of the kit simplifies the performance of the assay
and improves the reproducibility of the assay. Preferred kits of
the invention make use of a fully automated robotic system for
oligonucleotide detection, where all reagents are added by a
pipetting robot. Thus the reproducibility of the assay is further
improved. In addition, this setup can be used for high-throughput
analysis of oligonucleotides in different samples. In one preferred
embodiment, the kits comprise a 96 well-plate preparation, in yet
another embodiment the kits comprise a 384 well plate
preparation.
[0026] For convenience, the meaning of certain terms and phrases
used in the specifications, examples and claims are provided below.
If there is an apparent discrepancy between the usage of a term in
other parts of this specification and its definition provided in
this section, the definition provided in this section shall
prevail.
[0027] The term "oligonucleotide" as used herein refers to an
oligomer or polymer of either ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA), as well as non-naturally occurring
oligonucleotides. Non-naturally occurring oligonucleotides are
oligomers or polymers which contain nucleobase sequences which do
not occur in nature, or species which contain functional
equivalents of naturally occurring nucleobases, sugars, or
inter-sugar linkages, like aptamers, spiegelmers, peptide nucleic
acids (PNA), threose nucleic acids (TNA), locked nucleic acids
(LNA), or glycerol nucleic acids (GNA). This term includes
oligomers that contain the naturally occurring nucleic acid
nucleobases adenine (A), guanine (G), thymine (T), cytosine (C) and
uracil (U), as well as oligomers that contain base analogs or
modified nucleobases. Therefore the person skilled in the art
understands that the term "oligonucleotide" comprises but is not
limited to RNA, DNA and mixed oligonucleotides, antisense
oligonucleotides, short interfering RNA (siRNA), microRNAs
(miRNAs), aptamers and also spiegelmers.
[0028] Oligonucleotides can derive from a variety of natural
sources such as viral, bacterial and eukaryotic DNAs and RNAs.
Other oligonucleotides can be derived from synthetic sources, and
include any of the multiple oligonucleotides that are being
manufactured for use as research reagents, diagnostic agents or
potential and definite therapeutic agents. The term includes
oligomers comprising of a single strand nucleic acid or a double
strand nucleic acid. The two strands of a double strand nucleic
acid are defined as "sense strand" and "antisense strand".
[0029] As used herein, the term "strand comprising a sequence"
refers to an oligonucleotide comprising a chain of nucleotides that
is described by the sequence referred to using the standard
nucleotide nomenclature. However, as detailed herein, such a
"strand comprising a sequence" may also comprise modifications,
like modified nucleotides. As used herein, and unless otherwise
indicated, the term "complementary," when used to describe a first
nucleotide sequence in relation to a second nucleotide sequence,
refers to the ability of an oligonucleotide or polynucleotide
comprising the first nucleotide sequence to hybridize and form a
duplex structure under certain conditions with an oligonucleotide
or polynucleotide comprising the second nucleotide sequence, as
will be understood by the skilled person. "Complementary"
sequences, as used herein, may also include, or be formed entirely
from, non-Watson-Crick base pairs and/or base pairs formed from
non-natural and modified nucleotides, in as far as the above
requirements with respect to their ability to hybridize are
fulfilled.
[0030] This includes base-pairing of the oligonucleotide or
polynucleotide comprising the first nucleotide sequence to the
oligonucleotide or polynucleotide comprising the second nucleotide
sequence over the entire length of the first and second nucleotide
sequence. Such sequences can be referred to as "fully
complementary" with respect to each other herein.
[0031] The term "hybridized moieties" refers to any oligonucleotide
or any of its metabolites which are hybridized to the PNA probe
whereas "unhybridized moieties" refer to any oligonucleotide or any
of its metabolites which are not hybridized to the PNA probe. The
term "siRNA" refers to a double stranded RNA molecule that is
capable of blocking gene expression in a highly conserved
regulatory mechanism known as RNA interference (RNAi).
[0032] Hence the term "therapeutic siRNA" refers to a double
stranded RNA molecule used as a compound to treat, prevent or
manage disorders and diseases of a subject by blocking expression
of specific disease or disorder related genes. Preferably, such
subject is a mammal, most preferably a human patient.
[0033] The term "oligonucleotide metabolite" includes
oligonucleotides from which 1 or more nucleotides are deleted from
the 3' and/or the 5' end. The term "oligonucleotide metabolite"
further includes any naturally or synthetically modified
oligonucleotide, for example oligonucleotides comprising
phosphorylated 3' or 5' ends.
[0034] Also claimed are the methods and kits as hereinbefore
described, especially with reference to the examples below. The
following examples, references, sequence listing and figures are
provided to aid the understanding of the present invention, the
true scope of which is set forth in the appended claims. It is
understood that modifications can be made in the procedures set
forth without departing from the spirit of the invention.
SHORT DESCRIPTION OF THE FIGURES
[0035] FIG. 1 shows a chromatogram for the detection of one strand
of the siRNA.
[0036] FIG. 2 shows a simultaneous analysis of both strands using
two PNA probes with the same dye.
[0037] FIG. 3 shows calibration curves for the simultaneous
analysis of both strands using two PNA probes with the same
dye.
[0038] FIG. 4A-4B shows simultaneous analysis of both strands using
two PNA probes with different fluorescence labels, detection with
two fluorescence detectors.
[0039] FIG. 5A-5G shows separation of drug metabolites.
[0040] FIG. 6A-6C shows a chromatogram for the detection of
miRNAs.
[0041] FIG. 7A-7B shows a chromatogram for detection of spiegelmer
in lung tissue.
[0042] FIG. 8A-8C shows retention time shift by 3'-elongated
as-strand sequences.
[0043] FIG. 9A-9B shows increase in sensitivity by higher tissue
loading.
EXAMPLES
Example 1: Detection of GFP-siRNA by PNA-probe HPLC
[0044] This material and method section describes the assay
procedure how to determine a GFP-siRNA from biological samples.
Additionally this procedure can be also used with small variations
for all other oligonucleotides that can form Watson-crick base
pairs. The procedure allows the determination of only one strand in
the case of single- and double stranded oligonucleotides and the
quantification of both strands in parallel from double stranded
oligonucleotides, e.g. siRNA. The dye-probe is a fluorescently
labeled PNA (Peptide Nucleic Acid) strand that is fully
complementary to at least 10 or more nucleotides of the
oligonucleotide that should be quantified (complementary is defined
as perfect Watson-Crick base pairing).
[0045] Plasma, serum or tissue samples are shipped on dry ice and
stored at -80.degree. C. until used. Prior to the analysis plasma
samples are thawed on ice and processed by a proteinase K treatment
in Epicentre Cell and Tissue Lysis Solution at 65.degree. C. for 25
min. For the proteinase K treatment 30 .mu.l plasma are mixed with
30 .mu.l Epicentre Cell and Tissue Lysis Solution, 4 .mu.l
proteinase K solution and 36 .mu.l H.sub.2O to a final volume of
100 .mu.l.
[0046] Tissues samples are pulverized in frozen state and up to 100
mg frozen powder were suspended in 1 mL Epicentre Cell and Tissue
Lysis Solution, treated with an ultrasonic stick and subsequently
lysed with a proteinase K treatment at 65.degree. C. All proteinase
K treated samples are further diluted with Epicentre Cell and
Tissue Lysis Solution before employed in the HPLC sample
preparation step.
[0047] After the proteinase K treatment 20 .mu.l of a 3M KCl
solution is added to 200 .mu.l of the plasma or tissue samples to
precipitate the SDS. Subsequently the samples are centrifuged for
15 min and the supernatant is further used for siRNA
determination.
[0048] For hybridization, 100 .mu.l of the diluted supernatant
containing between 0.5 and 250 fmol siRNA, is mixed in 96-PCR well
plates with 5 .mu.l of a 1 .mu.M Atto610-PNA-probe solution
targeting the antisense strand. Hybridization buffer is added to a
final volume of 200 .mu.l (to 190 .mu.l if the sense strand of the
siRNA duplex should be detected also). The plate is sealed and
incubated at 95.degree. C. for 15 min in a PCR instrument.
[0049] The temperature of the PCR instrument is lowered to
50.degree. C. If the sense strand of the siRNA duplex should be
detected 10 .mu.l of a 1 .mu.M Atto425-PNA-probe (or of the
Atto610-PNA-probe) targeting the sense strand is added to each well
for a final volume of 200 .mu.l After shaking for additional 15 min
at 50.degree. C. are cooled to room temperature and the samples are
put into the HPLC autosampler.
[0050] Calibration curves are generated from a siRNA dilution
series under identical conditions. A representative chromatogram of
the calibration curve used in the analysis of both strands of an
oligonucleotide is provided in FIG. 3.
TABLE-US-00001 TABLE 1 Sequences of PNA-Probes used for detection
of a siRNA targeting GFP GFP-siRNA probe set Seq.Id. No. 1 5'-
Atto425-(OO)-TCG TGC TGC TTC ATG -3' Sense Seq.Id. No. 2 5'-
Atto610-(OO)-TCG TGC TGC TTC ATG -3' Sense Seq.Id. No. 3 5'-
Atto610-(OO)-ACA TGA AGC AGC ACG -3' Antisense
HPLC Analysis with Fluorescence Detection of the Probe/Antisense
Strand Duplex
[0051] 100 .mu.l of each hybridized sample (1/2) are injected into
the HPLC system connected to a Dionex RF2000 fluorescence detector.
For detection of both siRNA strands with the two different
fluorescence dyes a second Dionex RF2000 fluorescence detector is
used connected in a row after the first detector. The
chromatography is conducted at 50.degree. C. under native
conditions with NaClO4 as eluent salt on a Dionex DNA Pac PA100
column.
[0052] A typical chromatogram for the detection of one strand is
shown in FIG. 1, a typical chromatogram for the simultaneous
analysis of both strands using two PNA probes with the same dye is
provided in FIG. 2. A representative chromatogram of the
calibration curve used in the analysis of both strands of an
oligonucleotide is provided in FIG. 3. In FIG. 4 a typical
chromatogram of the simultaneous analysis of both strands using two
PNA probes with different fluorescence labels and their detection
with two fluorescence detectors is shown.
[0053] HPLC-Conditions:
[0054] Column: Dionex DNAPac PA100 (4.times.250 mm analytical
column) Temp.: 50.degree. C.
[0055] Flow: 1 ml/min
[0056] Injection: 100 ul
[0057] Detection: Excitation: 612 nm; Emission: 642 nm (first
detector)
[0058] Excitation: 436 nm; Emission: 484 nm (second detector if
needed)
TABLE-US-00002 TABLE 2 HPLC Gradient Table Time % A % B -1.00 min
91 9 1.00 min 91 9 9.0 min 80 20 9.5 min 0 100 12.5 min 0 100 13.0
min 91 9 16.0 min 91 9
[0059] The concentrations of the GFP-siRNA in plasma and tissue
samples are determined using ion-exchange HPLC to separate the
analytes and quantify the area under the peak with fluorescence
detection. Under the native IEX-HPLC conditions used, interfering
matrix compounds as well as excess of the fluorescence labeled
probes elute in the void volume of the column. Non-specific signals
from hybridization of the fluorescence labeled probes with matrix
RNA/DNA are shifted to higher retention times allowing for good
resolution of signal with little co-eluting background. The
specific signals generated by the duplexes consisting of
fluorescent labeled probes and the corresponding intact siRNA
strand typically elutes between 5 to 7 min.
[0060] Quantitation is performed based on an external calibration
curve generated from a standard siRNA dilution series (from 0.5 to
250 fmol siRNA) which is hybridized and analyzed as described
above. The linear range of this assay is from 0.5 to 250 fmol siRNA
on the column with an LLOQ of .about.0.6 ng siRNA in 1 mL plasma
and .about.5 ng siRNA in tissue.
[0061] Reagents: [0062] 50 .mu.M Standard GFP-siRNA stock solution
(in house prep) [0063] Hybridization Buffer: 50 mM TRIS-Cl; 10% ACN
(in house prep.) [0064] Proteinase K (20 mg/ml): Peqlab No.
04-1075; Lot: 11024 [0065] Lysis buffer: Epicentre Cell and tissue
lysis solution (# MTC096H) [0066] MilliQ-water: 18.2M.OMEGA. [0067]
PNA-Probes: see Table 1 [0068] KCl: 3M solution in H.sub.2O (in
house prep) [0069] HPLC-System A for fluorescence detection: [0070]
HPLC Eluent A: 25 mM TRIS-HCl; 1 mM EDTA; 50% ACN; pH=8 [0071] HPLC
Eluent B: 800 mM NaClO4 in A
[0072] Material: [0073] Ultrasonic stick, Bandelin Sonoplus
(Berlin), HD 2070 MS72 with UW 2070 [0074] 1.5 ml Eppendorf tubes
[0075] Eppendorftwin.tec PCRplate 96 (#951020389) [0076]
EppendorfMastercycler gradient [0077] Ultra Clear cap-Stripes,
Peqlab (#82-0866-A) [0078] Dionex Ultimate3000 HPLC: Solvent Rack
[0079] Dual Pump Ultimate 3000 [0080] Autosampler Ultimate 3000
[0081] Column Oven Ultimate 3000 with 10 port switch valve [0082]
UV-Detector VWD 3000 [0083] Fluorescence-Detector RF2000
[0084] Alternatively, the following HPLC conditions were used for
the detection of oligonucleotides, especially for detection of
miRNAs and siRNAs: [0085] Column: Dionex DNA Pac PAIO0 (250.times.4
mm) [0086] Temperature: 50.degree. C. [0087] Eluent A: 10 mM
Sodiumphosphate; 100 mM NaCl; 5% ACN [0088] Eluent B: 10 mM
Sodiumphosphate; IM NaCl; 5% ACN [0089] Eluent C: 90% CAN
TABLE-US-00003 [0089] TABLE 3 HPLC Gradient Table - alternative
protocol (Standard conditions for detection of miRNAs and siRNAs)
Time Flow EluentA Eluent B Eluent C [min] [mL/min] [%] [%] [%] 0.00
1.00 40 20 37 1.00 1.00 40 20 37 10.00 1.00 8 55 37 10.50 1.00 0 90
10 13.50 1.00 0 90 10 14.00 1.00 40 20 37 17.00 1.00 40 20 37
Example 2: Automated 96-Well Plate Preparation
[0090] This section describes a new sample preparation protocol
making use of microtiter plates. Therein, manual handling steps are
reduced to a minimum to improve the reproducibility of the assay.
All components of the mixture including hybridization buffer,
dye-probe and the siRNA spike are added by a pipetting robot to a
96-well plate. Also the preceding SDS precipitation of the samples
can be performed in a microtiter plated based setup.
[0091] With this procedure it is possible to prepare 96-well plates
on stock for a defined oligonucleotide, wherein only the sample
solution has to be added. Accordingly, this ready-to-use
preparation works like a kit and can be used for quick
high-throughput analysis of samples containing or suspected of
containing defined oligonucleotides.
Plate Preparation
[0092] In a 96 well microtiter plate the wells form a rectangular
grid of 8 rows (labeled A through H and 12 columns (labeled 1
through 12). For an automated 96 well plate preparation, a
mastermix is prepared manually according to table 4 and 100 .mu.l
are added to each well of the plate by a pipetting robot. To wells
in row 1-10, 50 .mu.l water is added. Row 1-9 serve for sample
analysis, row 10 serves as control for the 1 fmol spike and rows
1-12 for the calibration curves. To wells 11-12, 50 .mu.l medium
and 50 .mu.l of a siRNA dilution are added. The siRNA dilutions are
prepared by the pipetting robot starting with a 100 nM siRNA
solution and are listed below. This 96-well plate is further
referred to as "prepared plate".
TABLE-US-00004 TABLE 4 Mastermix for plate preparation Mastermix
substance per vial (=.times.500) Water 31 .mu.l 15500 .mu.l
PNAProbe 5 .mu.l 2500 .mu.l 1 pmol/.mu.l 1 fmol- 4 .mu.l 2000 .mu.l
siRNA-Spike: 0.5 fmol/.mu.l Acetonitril 20 .mu.l 10000 .mu.l 1M
Tris pH 8.0 40 .mu.l 20000 .mu.l siRNA dilutions for calibration
curves
TABLE-US-00005 20 nM (500 fmol) 10 nM (250 fmol) 4 nM (100 fmol) 2
nM (50 fmol) 1 nM (25 fmol) 0.4 nM (10 fmol) 0.2 nM (5 fmol) 0.1 nM
(2.5 fmol) 0.02 nM (0.5 fmol) 0.01 nM (0.25 fmol)
Addition of Samples to Prepared Plate/SDS Precipitation Step
[0093] 100 .mu.l aliquots of samples are pipetted to wells into all
rows (A-H) of columns 1 to 9 of a precooled 96 well microtiter
plate, and to these wells 10 .mu.l 3M KCl are added by a pipetting
robot. After 15 minutes of centrifugation at 3800 U/min and
4.degree. C., 50 .mu.l of the supernatant are transferred by the
pipetting robot to the according columns of a prepared plate.
[0094] For the control, lysis buffer or medium is precipitated with
3M KCl and 50 .mu.l of the supernatant added to column 10-12 of the
prepared plate. 100 .mu.l of each well are injected onto
aIEX-HPLC.
Example 3: Separation of Drug Metabolites
[0095] For separation of different drug metabolites purified 3' end
(3' n-2, 3' n-4, 3' n-5, 3' n-6) and 5' end (5' n-1, 5'n-2, 5'n-3)
metabolites of the as strand of GFP-siRNA, from which 1 to 6
nucleotides were deleted from the 3' or 5' end, respectively, were
analysed according to the assay procedure described in Example 1.
Metabolites are given in table 5, a typical chromatogram for
separation of metabolites is given in FIG. 5.
TABLE-US-00006 TABLE 5 Representative metabolites of GFP-siRNA
GFP-siRNA Seq. Name Sequence Id Sense GFP-siRNA-s-
5'-CCACAUGAAGCAGCACGACUU-3' 4 strand Antisense GFP-siRNA-as-
5'-AAGUCGUGCUGCUUCAUGUGGUC-3' 5 strand GFP-siRNA-as-
5'-AGUCGUGCUGCUUCAUGUGGUC-3' 6 strand-5'-(n-1) GFP-siRNA-as-
5'-GUCGUGCUGCUUCAUGUGGUC-3' 7 strand-5'-(n-2) GFP-siRNA-as-
5'-UCGUGCUGCUUCAUGUGGUC-3' 8 strand-5'-(n-3) GFP-siRNA-as-
5'-AAGUCGUGCUGCUUCAUGUGG-3' 9 strand-3'-(n-2) GFP-siRNA-as-
5'-AAGUCGUGCUGCUUCAUGU-3' 10 strand-3'-(n-4) GFP-siRNA-as-
5'-AAGUCGUGCUGCUUCAUG-3' 11 strand-3'-(n-5) GFP-siRNA-as-
5'-AAGUCGUGCUGCUUCAU-3' 12 strand-3'-(n-6)
Example 4: Detection of miRNA
[0096] The assay was used under standard conditions to evaluate the
possibility to detect miRNA from tissue lysates. As an example the
mouse liver specific miRNA-122 was detected from mouse tissue
lysate (positive control), jejunum (negative control) and from
lysate spiked with synthetically generated miRNA-122 strands
(Lagos-Quintana, et al. Current Biology, Vol. 12, 735-739.). From
literature it is known, that in liver of mice three different types
of miRNA-122 sequences are expressed:
TABLE-US-00007 (Seq. ID. No. 13) miRNA-122a:
5'-UGGAGUGUGACAAUGGUGUUUG-3' (Seq. ID. No. 14) miRNA-122b:
5'-UGGAGUGUGACAAUGGUGUUUGU-3' (Seq. ID. No. 15) miRNA-122c:
5'-UGGAGUGUGACAAUGGUGUUUGA-3'
[0097] All synthetic standards were synthesized as 5'-OH and as
5'-Phosphate sequence. As the three species showed small variations
at the 3'-end the PNA-Probe was designed in way that it fully
matches with all three miRNA-122 sequences, starting at the third
base of the 5'-end of the miRNA-122 with 17 bases in length:
TABLE-US-00008 (Seq. ID. No. 16) PNA-Probe:
5'-Atto425-OO-AACACCATTGTCACACT-3'
[0098] HPLC was performer with the conditions as described in the
alternative protocol detailed in example 1 and shown in table 3.
HPLC-traces generated from mouse lung lysate (miRNA122 negative
tissue) spiked with synthetically generated miRNA-122 showed three
separated peaks. The retention time of this peaks fully match with
signals, that were found in lysates from liver (1 mg liver
injected). The quantitation of the total peak area and calculation
of the total miRNA-122 concentration in liver lead to approximately
.about.35 ng/g. The miRNA-122 negative control from jejunum or lung
tissue samples showed no signal for miRNA-122 as expected (FIG.
6).
Example 5: Detection of Spiegelmer-DNA (L-DNA) with and without
Pegylation
[0099] Spiegelmers are aptamer molecules with non-natural L-ribose
(L-RNA) or L-deoxyribose (L-DNA) sugar backbone that show no
Watson-Crick base pair interaction with the natural
D-oligonucleotides. As PNA is a non-chiral mimick of
oligonucleotides with Watson-Crick base pair properties it was
expected, that the PNA-probes can also be used to detect this
non-natural oligonucleotide species. To increase the circulation
half life of spiegelmers or aptamers this molecules are often
pegylated with branched 40 kDa PEG, that usually hampers the
analyis of this complex molecules.
[0100] As a proof of concept for the detection of this
therapeutically interesting molecule class a pegylated and a
non-pegylated version of the following L-DNA sequence were
synthesized and analysed with the here described assay after
orotrachael administration in mice:
TABLE-US-00009 Non-PEG-Spiegelmer: (Seq. ID. No. 17)
(NH2C6)-CCAGCCACCTACTCCACCAGTGCCAGGACTGCTTGAGGGT PEG-Spiegelmer:
(Seq.ID. No. 18) PEG(40kDa)-(NHC6)-
CAGCCACCTACTCCACCAGTGCCAGGACTGCTTGAGGGT
[0101] The following 17mer-PNA-Probe was used for hybridization and
detection of the spiegelmer from plasma, lung, liver and kidney
samples:
TABLE-US-00010 (Seq. ID. No. 19)
5'-Atto425-OO-GTCCTGGCACTGGTGGA-3'
[0102] Gradient conditions were adjusted to the longer
oligonucleotide sequences compared with to the siRNA strands to
elute the spiegelmer-PNA-duplex within the gradient of the HPLC
method.
[0103] The following HPLC conditions were applied: [0104] Column:
Dionex DNA Pac PA100 (250.times.4 mm) [0105] Temperature:
50.degree. C. [0106] Eluent A: 10 mM Sodiumphosphate; 100 mM NaCl;
5% CAN [0107] Eluent B: 10 mM Sodiumphosphate; 1M NaCl; 5% ACN
[0108] Eluent C: 90% ACN
TABLE-US-00011 [0108] TABLE 6 HPLC gradient conditions for
pegylated spiegelmer Time Flow EluentA Eluent B Eluent C [min]
[mL/min] [%] [%] [%] 0.00 1.00 40 20 40 1.00 1.00 40 20 40 10.00
1.00 5 55 40 10.50 1.00 0 60 40 13.50 1.00 0 60 40 14.00 1.00 40 20
40 17.00 1.00 40 20 40
TABLE-US-00012 TABLE 7 HPLC gradient conditions for Spiegelmer Time
Flow EluentA Eluent B Eluent C [min] [mL/min] [%] [%] [%] 0.00 1.00
35 25 40 1.00 1.00 35 25 40 10.00 1.00 0 60 40 10.50 1.00 0 60 40
13.50 1.00 0 60 40 14.00 1.00 35 25 40 17.00 1.00 35 25 40
[0109] Sensitivity of the method was a little bit compromised for
the pegylated Spiegelmer due to peak broadening induced by the
polydisperity of the 40 kDa PEG-moiety. Lower limit of detection
was increased to .about.1 fmol L-DNA on column. Resolution of
shorter impurities was not tested, but expected to be lower
compared to the shorter siRNA or miRNA strands.
[0110] Sample preparation was done according to the standard
protocol. The Spiegelmers could be easily detected by this
procedure from plasma and all tissue tested, as a sharp single
peaks with nearly no biological background interference as shown in
FIG. 7.
Example 6: Detection of siRNA from In Vitro Transfection
Experiments
[0111] Detection of unlabeled siRNA from in vitro cell culture
experiments was limited by the fact of the high sensitivity needed
and therefore only approaches with amplification step like PCR were
successful for unmodified molecules.
[0112] The PNA-HPLC assay sensitivity was in range to measure siRNA
from cell culture experiments. An 19 base pair siRNA with 2 nt
overhang at the 3'-end of both strands was used for transfection of
primary hepatocytes at a 30 nM siRNA concentration. Various
versions of this duplex with identical sequences, only differing at
their 5'-end of the antisense strand were transfected. After
transfection the cells were washed with PBS and then lysed by a
proteinase K treatment with a concentration of .about.2500 cells
per uL lysate.
[0113] The cell culture lysate was used for the PNA-HPLC assay
procedure and .about.50000 cells per HPLC run were injected onto
the column after hybridization with the complementary antisense
strand PNA-probe. Under this assay conditions the intact as-strand
and also the 5'-phosphorylated species of the antisense strand
could be detected down to approximately 8000 siRNA copies per cell
(data not shown).
Example 7: Use of Internal Standards for Normalization (Higher
Accuracy)
[0114] To further increase the accuracy of the method, especially
when used m a G.times.P environment it is maybe necessary to
implement an internal standard for normalization. As a proof of
concept a 21mer RNA-strand was elongated with 3 up to 8 desoxy-T
nucleotides at its 3'-end. This normalization standards, together
with the 21mer and its 5'-phosphorylated species were spiked into
plasma and then analysed under standard assay and HPLC conditions
(see example 1, especially the alternative protocol for HPLC and
table 3) for siRNAs.
[0115] All elongated standards eluted fully baseline resolved from
the 21mer as well as from the 5'-phosphorylated 21mer with higher
retention times. Some peak interferences were observed with the
3-dT-nucleotide elongated sequence and the 5'-phosphorylated 21mer,
as some synthesis impurities of the elongated strand co-eluted with
the 5'-phosphorylated 21mer.
[0116] The example shown here is a chromatogram overlay of samples
containing the as-strand and the 5'-phosphorylated as-strand mixed
with the 3'-elongated as-strand with 3, 4 and 5 desoxythymidine
nucleotides at its 5'-end (see FIG. 8). The following sequences
were used for the example chromatograms (Letters in capitals
represent RNA nucleotides, lower case letters"c", "g", "a" and "u"
represent 2' O-methyl-modified nucleotides, "s" represents
phosphorothioate and "dT" deoxythymidine.):
TABLE-US-00013 as-strand: (Seq. ID. No. 20)
5'-UCGAAGuACUcAGCGuAAGdTsdT-3' as-strand-5'-PO.sub.4: (Seq. ID. No.
21) 5'-pUCGAAGuACUcAGCGuAAGdTsdT-3' as-strand -(dT)n: (Seq. ID. No.
22, Seq. ID. No. 23, Seq. ID. No. 24)
5'-UCGAAGuACUcAGCGuAAGdTdT-(dT)n-3' with n = 3, 4, 5 PNA-Probe:
(Seq. ID. No. 25) 5'-Atto425-OO-CTT ACG CTG AGT ACT TC-3'
TABLE-US-00014 TABLE 8 Peak resolution calculated according to the
USP Retention Time Resolution to Sequence [min] 5'-P04 (USP)
as-strand 6.23 1.70 as-strand - 5'-PO4 6.54 -- as-strand + 3x 3'-dT
6.68 <1 as-strand + 4x 3'-dT 6.88 2.25 as-strand + 5x 3'-dT 7.04
2.75
[0117] With this experiment it was also proven, that under standard
miRNA and siRNA assay conditions baseline resolution can be
achieved for oligonucleotides up to 29mers, that differ only by one
nucleotide in length.
Example 8: Increase of Assay Sensitivity in Tissues
[0118] The sensitivity of the assay as described above was
restricted to .about.2 ng siRNA per g tissue. This limitation was
given by the fact that the maximal loaded tissue amount on the
column was 2-3 mg per injection, as the baseline noise increased at
higher tissue loadings. Switching from the Atto610 dye to the
Atto425 dye allows much higher column loadings up to 11 mg without
loss of signal sensitivity and chromatographic resolution power.
The absolute amount of siRNA at the LOD is still 250 amol
oligonucleotide on column. This lead to a lower limit of detection
in respect to siRNA tissue concentration of .about.400 pg/g (FIG.
9).
[0119] In table 9 below a comparison between two chromatographic
runs of the same tissue sample, but two separate tissue
preparations is shown. In the upper chromatogram 3 mg liver was
loaded onto the HPLC column, in the lower chromatogram 11.2 mg was
loaded.
[0120] Although the results were generated from two different
tissue lysate, the calculated tissue siRNA and metabolite
concentrations show only minor variation:
TABLE-US-00015 TABLE 9 Signal/Noise-Values of identical tissue
sample; different tissue amounts loaded on HPLC column 3 mg Tissue
11 mg Tissue loaded on HPLC loaded on HPLC Tissue Ret. Tissue Ret.
Tissue Cone. Peak Time Cone. Time Cone. Delta No. min ng/g S/N min
ng/g S/N [ng/g] 1 4.67 17.1 67 4.59 13.5 26.8 3.5 2 5.10 4.8 18
5.02 4.3 8.3 0.6 3 5.55 20.6 87 5.47 17.5 22.8 3.1 4 5.86 19.4 81
5.80 16.3 17.9 3.0 5 6.16 10.4 44 6.09 9.0 8.7 1.3 6 6.47 14.3 61
6.42 12.5 15.7 1.8 7 6.88 7.7 33 6.83 6.8 9.8 0.9
Sequence CWU 1
1
25115DNAArtificial SequenceDescription of Artificial Sequence
Synthetic backbone peptide nucleic acid 1tcgtgctgct tcatg
15215DNAArtificial SequenceDescription of Artificial Sequence
Synthetic backbone peptide nucleic acid 2tcgtgctgct tcatg
15315DNAArtificial SequenceDescription of Artificial Sequence
Synthetic backbone peptide nucleic acid 3acatgaagca gcacg
15421RNAArtificial SequenceDescription of Artificial Sequence
Synthetic GFP-siRNA-s-strand 4ccacaugaag cagcacgacu u
21523RNAArtificial SequenceDescription of Artificial Sequence
Synthetic GFP-siRNA-as-strand 5aagucgugcu gcuucaugug guc
23622RNAArtificial SequenceDescription of Artificial Sequence
Synthetic metabolite of GFP-siRNA-as-strand-5'-(n-1) 6agucgugcug
cuucaugugg uc 22721RNAArtificial SequenceDescription of Artificial
Sequence Synthetic metabolite of GFP-siRNA-as-strand-5'-(n-2)
7gucgugcugc uucauguggu c 21820RNAArtificial SequenceDescription of
Artificial Sequence Synthetic metabolite of
GFP-siRNA-as-strand-5'-(n-3) 8ucgugcugcu ucaugugguc
20921RNAArtificial SequenceDescription of Artificial Sequence
Synthetic metabolite of GFP-siRNA-as-strand-3'-(n-2) 9aagucgugcu
gcuucaugug g 211019RNAArtificial SequenceDescription of Artificial
Sequence Synthetic metabolite of GFP-siRNA-as-strand-3'-(n-4)
10aagucgugcu gcuucaugu 191118RNAArtificial SequenceDescription of
Artificial Sequence Synthetic metabolite of
GFP-siRNA-as-strand-3'-(n-5) 11aagucgugcu gcuucaug
181217RNAArtificial SequenceDescription of Artificial Sequence
Synthetic metabolite of GFP-siRNA-as-strand-3'-(n-6) 12aagucgugcu
gcuucau 171322RNAMus musculus 13uggaguguga caaugguguu ug
221423RNAMus musculus 14uggaguguga caaugguguu ugu 231523RNAMus
musculus 15uggaguguga caaugguguu uga 231617DNAArtificial
SequenceDescription of Artificial Sequence Synthetic backbone
peptide nucleic acid 16aacaccattg tcacact 171740DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Spiegelmer
with L-deoxyribose backbone 17ccagccacct actccaccag tgccaggact
gcttgagggt 401839DNAArtificial SequenceDescription of Artificial
Sequence Synthetic Spiegelmer with L-deoxyribose backbone
18cagccaccta ctccaccagt gccaggactg cttgagggt 391917DNAArtificial
SequenceDescription of Artificial Sequence Synthetic backbone
peptide nucleic acid 19gtcctggcac tggtgga 172021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic antisense
strand of internal standard siRNADescription of Combined DNA/RNA
Molecule Synthetic antisense strand of internal standard siRNA
20ucgaaguacu cagcguaagt t 212121DNAArtificial SequenceDescription
of Artificial Sequence Synthetic antisense strand of internal
standard siRNADescription of Combined DNA/RNA Molecule Synthetic
antisense strand of internal standard siRNA 21ucgaaguacu cagcguaagt
t 212224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic antisense strand of internal standard siRNADescription of
Combined DNA/RNA Molecule Synthetic antisense strand of internal
standard siRNA 22ucgaaguacu cagcguaagt tttt 242325DNAArtificial
SequenceDescription of Artificial Sequence Synthetic antisense
strand of internal standard siRNADescription of Combined DNA/RNA
Molecule Synthetic antisense strand of internal standard siRNA
23ucgaaguacu cagcguaagt ttttt 252426DNAArtificial
SequenceDescription of Artificial Sequence Synthetic antisense
strand of internal standard siRNADescription of Combined DNA/RNA
Molecule Synthetic antisense strand of internal standard siRNA
24ucgaaguacu cagcguaagt tttttt 262517DNAArtificial
SequenceDescription of Artificial Sequence Synthetic backbone
peptide nucleic acidDescription of Combined DNA/RNA Molecule
Synthetic backbone peptide nucleic acid 25cttacgctga gtacttc 17
* * * * *