U.S. patent application number 16/035411 was filed with the patent office on 2018-11-01 for production of fmdv-resistant livestock by allele substitution.
The applicant listed for this patent is Recombinetics, Inc.. Invention is credited to Daniel F. Carlson, Scott C. Fahrenkrug.
Application Number | 20180310536 16/035411 |
Document ID | / |
Family ID | 50026918 |
Filed Date | 2018-11-01 |
United States Patent
Application |
20180310536 |
Kind Code |
A1 |
Carlson; Daniel F. ; et
al. |
November 1, 2018 |
PRODUCTION OF FMDV-RESISTANT LIVESTOCK BY ALLELE SUBSTITUTION
Abstract
A genetically modified livestock animal comprising a genomic
modification to an eIF4G gene. Cells, genes, and proteins
encompassing a protease-resistant eIF4G protein or gene.
Inventors: |
Carlson; Daniel F.; (Inver
Grove Heights, MN) ; Fahrenkrug; Scott C.;
(Minneapolis, MN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Recombinetics, Inc. |
St. Paul |
MN |
US |
|
|
Family ID: |
50026918 |
Appl. No.: |
16/035411 |
Filed: |
July 13, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13836860 |
Mar 15, 2013 |
10058078 |
|
|
16035411 |
|
|
|
|
61677904 |
Jul 31, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01K 2217/05 20130101;
A01K 2227/101 20130101; A01K 2227/108 20130101; C07K 14/47
20130101; A01K 67/0275 20130101; A01K 2267/02 20130101 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C07K 14/47 20060101 C07K014/47 |
Claims
1. A gene edited livestock animal whose genome comprises a genome
edited eIF4GI gene, wherein the genome edited eIF4GI gene expresses
an altered eIF4GI protein relative to a wild type eIF4GI protein
such that the gene edited livestock animal is resistant to cleavage
by a proteinase of foot-and-mouth disease virus enzyme wherein the
livestock animal is a cow or pig.
2. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene comprises an insertion, a deletion, or a
substitution of one or more bases of the eIF4GI gene.
3. The gene livestock animal of claim 1, wherein the livestock
animal is from a first breed and the genome edited eIF4GI gene
comprises a natural allele of the eIF4GI gene found in another
breed of the livestock animal.
4. The gene edited livestock animal of claim 1, wherein the
livestock animal is from a first species and the genome edited
eIF4GI gene comprises an allele of the eIF4GI gene in a second
species.
5. The gene edited livestock animal of claim 1, wherein the
livestock animal is homozygous for the genome edited eIF4GI
gene.
6. The gene edited livestock animal of claim 1, wherein the cow or
pig is a founder animal.
7. The gene edited livestock animal of claim 1, wherein the altered
eIF4GI protein is edited to prevent binding of (i) a leader
proteinase (L.sub.Pro), (ii) a 3C protease (C.sub.Pro), or (iii)
L.sub.Pro and C.sub.Pro of foot-and-mouth disease virus enzyme.
8. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO: 2 and
the livestock animal is the cow.
9. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO: 3.
10. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO: 4.
11. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO: 5.
12. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO: 6.
13. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO: 7.
14. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO: 8.
15. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO: 9.
16. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO:
10.
17. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene has the nucleotide sequence of SEQ ID NO:
11.
18. The gene edited livestock animal of claim 1, wherein the genome
edited eIF4GI gene is the only edit to the genome of the livestock
animal.
19. A method of producing a gene edited cow or pig whose genome
comprises a genome edited eIF4GI gene, wherein the genome edited
eIF4GI gene expresses an altered eIF4GI protein relative to a wild
type eIF4GI protein such that the gene edited cow or pig is
resistant to cleavage by a proteinase of foot-and-mouth disease
virus enzyme , the method comprising the steps of: (a) introducing
into a cow or pig fibroblast (i) a TALEN pair that specifically
binds to the endogenous eIF4GI gene and causes a double-stranded
DNA break to inactivate the eIF4GI gene in the cow or pig
fibroblast and (ii) a Homology-dependent repair (HDR) template; (b)
permitting to occur homologous recombination events in the cow or
pig fibroblast; (c) transferring the transfected fibroblast into an
enucleated cow or pig recipient oocyte to generate a transgenic
nuclear transfer embryo and activating the nuclear transfer embryo;
and (d) transplanting the nuclear transfer embryo into a surrogate
mother cow or pig and permitting the implanted embryo to develop
such that the transgenic cow or pig whose genome comprises a genome
edited eIF4GI gene is produced, wherein the cow or pig expresses
the genome edited eIF4GI gene and is resistant to cleavage by the
leader proteinase.
20. The method of claim 19, wherein the genome edited eIF4GI gene
is the only edit to the genome of the cow or pig fibroblast.
21. The method of claim 19, wherein the genome edited eIF4GI gene
has the nucleotide sequence selected from the group consisting of
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11.
22. The method of claim 19, wherein the genome edited eIF4GI gene
has the nucleotide sequence of SEQ ID NO: 2 and the livestock
animal is cow.
23. The method of claim 19, wherein the altered eIF4GI protein is
edited to prevent binding of (i) the leader proteinase (L.sub.Pro),
(ii) 3C protease (C.sub.Pro), or (iii) L.sub.Pro and C.sub.Pro of
foot-and-mouth disease virus enzyme.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This patent application is a continuation of U.S.
application Ser. No. 13/836,860, filed Mar. 15, 2013 which claims
priority to U.S. Provisional Application No. 61/677,904 filed Jul.
31, 2012, which is hereby incorporated by reference herein.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Jul. 11, 2018, is named 53545_710_301_SL.txt and is 4,179 bytes
in size.
TECHNICAL FIELD
[0003] The technical field relates to genetically modified animals
and associated techniques.
BACKGROUND
[0004] Cloven-hoofed animals infected by Foot and Mouth Disease
Virus (FMDV) become rapidly incapacitated by acute vesicular
disease. FMD infection of cattle and pigs causes fever, painful
blistering, lameness and loss of appetite. As suggested by the name
of the infectious agent, secondary infections of the feet often
occur, causing chronic lameness and delayed healing and similarly
mastitis may be a common sequel in dairy cattle. The acute phase of
the disease lasts for approximately a week receding in the face of
a mounting immune response of which the antibody response appears
to be of particular importance as it is highly efficient in
clearing virus from the blood stream. Mortality can occur in young
animals due to infection of the heart muscle causing circulatory
failure. The disease is so highly contagious that infection in a
single animal calls for the destruction and burial of the entire
herd. Hence FMDV is considered by some to be the world's most
important pathogen of domesticated farm animals. In 2001 an FMD
outbreak in Great Britain resulted in total losses of about $12-4
billion [1] and more than a decade ago, the University of
California Davis estimated that an FMD outbreak just in California
could cost from $6-14 billion in control costs and lost markets due
to restrictions in movement and sales of animals. Sales of milk and
other products, as well as meat, would be halted and jobs of
producers and workers in related industries would be lost or
severely curtailed. The economic effects in other countries are
proportional.
SUMMARY OF THE INVENTION
[0005] Animals that are resistant to FMDV are described herein. The
animals may be made with only a minimal nucleotide change and with
the change being made at an exact location without making other
changes to the animals' genome.
[0006] An embodiment of the invention is a genetically modified
animal comprising a genomic modification to an eIF4G gene. The
modification may comprise, for example an insertion, a deletion, or
a substitution of one or more bases of an eIF4G gene. The eIF4G
gene may be altered so that it is expressing an eIF4G protein
altered relative to a wild type eIF4G protein of the animal to be
resistant to cleavage by a proteinase of a foot-and-mouth disease
virus enzyme, e.g., one or both of a leader proteinase of
foot-and-mouth disease virus enzyme (Lpro) and a virus encoded 3C
protease of foot-and-mouth disease virus enzyme (3Cpro). The animal
may be a mammal. The animal may be a laboratory research animal
(e.g., mouse, rat, dog or species of pig used in laboratories,
e.g., miniature swine). The animal may be a livestock animal, e.g.,
selected from a group consisting of pig, fish, rabbit, cow,
chicken, goat, and sheep. In some case, the animal is from a first
breed and the genomic modification is a natural allele of the eIF4G
gene found in another breed of the animal. In another case, the
animal is from a first species and the genomic modification is an
allele of the eIF4G gene in another breed of a second species
(human or non-human animal). The allele is, in general, not an
entire gene, but is a portion of a gene that codes for a protein
portion that mediates binding and proteolysis by a FMDV protease.
The animal may be homozygous or heterozygous for the modified eIF4G
gene. The animal may be a founder animal or a progeny of a founder
animal, i.e., a new breed or line of animals may be created. The
animal may be comprising the eIF4G protein expressed by the
modified eIF4G gene. The animal may be resistant to foot and mouth
disease. The modified eIF4G protein may be modified to prevent
binding of one of, or both of, Lpro and Cpro.
[0007] An embodiment of the invention is a method of creating a
genetically modified organism comprising altering a native eIF4G
gene of a primary cell or an embryo in vitro (or in the womb in the
case of an embryo) and cloning the primary cell or implanting the
embryo into a mother animal (surrogate), with the eIF4G gene being
altered to express an eIF4G isoform that resists proteolysis by a
foot and mouth disease protease. The method can involve
transfecting the primary cell or the embryo with a site-specific
nuclease that specifically cleaves a site in the native eIF4G gene,
and a nucleic acid template that comprises at least a portion of
the eIF4G gene, with the template providing an alternative allele
for the native eIF4G gene, said alternative allele encoding an
eIF4G isoform that is resistant to cleavage by a proteinase of a
foot-and-mouth disease virus enzyme. An example of a site-specific
nuclease is a nuclease-based system chosen from the group
consisting of a zinc finger nucleases (ZFN), transcriptional
activator-like effector nucleases (TALEN) and a Clustered Regularly
Interspaced Short Palindromic Repeat (CRISPR or sometimes referred
to as CRISPR/Cas9).
[0008] An embodiment is an in vitro cell comprising a genomic
modification to an eIF4G gene. The eIF4G gene may be expressing an
eIF4G protein altered relative to a wild type eIF4G protein of the
animal to be resistant to cleavage by a proteinase of a
foot-and-mouth disease virus enzyme. The cell may be selected from
a group consisting of mouse, rat, horse, mini-pig, pig, fish,
rabbit, cow, chicken, goat, artiodactyl, ungulate, and sheep. The
cell may further comprising the eIF4G protein expressed by the
modified eIF4G gene.
[0009] Embodiments of the invention include an isolated nucleic
acid encoding an isoform of any of the eIF4G proteins, such as an
eIF4G protein that is resistant to cleavage by a proteinase of a
foot-and-mouth disease virus enzyme.
[0010] Embodiments of the invention include cells, organisms, or
animals that include an exogenous gene that expresses an EIF4G
protein or a portion of said protein that is bound by an FMDV
protease. The exogenous gene expression competes for FMDV virus
binding so that native protein cleavage is reduced. Alternatively,
the exogenous gene expression of a protease-resisting EIF4G
provides continued cellular function with the cell is infected. An
embodiment is a method of creating a genetically modified organism
comprising adding expression of an exogenous eIF4G gene to a
primary cell or an embryo in vitro and cloning the primary cell or
implanting the embryo into a mother animal, with the exogenous
eIF4G gene expressing an eIF4G isoform that resists proteolysis by
a foot and mouth disease protease. An embodiment is an in vitro
cell comprising a genomic modification to an eIF4G gene or a
nucleic acid that expresses an exogenous eIF4G gene.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1 is a radioautography of electrophoresis profiles of
total cellular protein in vivo; the .sup.35S-labeled total proteins
from cells are imaged as a function of time post-picornaviral
infection in hours at the bottom; complete cell lysis (after 6.5
hr) shows the time course for shutoff of host proteins and the near
total takeover of polypeptide synthesis by picornaviral proteins.
The prominent bands at 5 hr are viral proteins cleaved by L.sup.pro
from the polyprotein precursor (heavy band at the top of the gel).
The strong bands near the bottom of the gel are histones that
derive from non-polyadenylated mRNA and thus not eIF4G-dependent
and sensitive to viral proteinase activity.
[0012] FIG. 2 shows experimental results for altering a portion of
a EIF4GI gene. A sequence for a portion of a porcine EIF4GI is
shown in panel A. The wild type sequence has asparagine and leucine
residues in the minus 3 and 2 positions relative to the Lpro
cleavage site (arrowhead). In this example, the a template is
provided to guide replacement of the minus 3 and 2 residues with
aspartic acid and phenylalanine so as to render the modified EIF4GI
resistant to L.sup.pro cleavage. Two pairs of TALENs (top) were
designed to cut the wild type EIF4GI to stimulate homologous
recombination. Panel B) depicts results of a Surveyor (Cel-I) assay
of pig fibroblasts transfected with each TALEN pair. Panel C)
depicts RFLP assay to determine the efficiency of homologous
recombination. The Figure includes left TALEN CCGTCCTTTGCCAACCTT
(SEQ ID NO:12), right TALEN AGCAACCGTGGGCCCCCA (SEQ ID NO:13); left
TALEN TGGCCGACCAGCCCTT (SEQ ID NO:14); right TALEN CCCAAGGGGTGGGCC
(SEQ ID NO:15); EIF4GI gene portion
CAGACTTCACTCCGTCCTTTGCCAACCTTGGCCGACCAGCCCTTAGCAACCGTGGGC
CCCCAAGGGGTGGGCC (SEQ ID NO:16); and HDR
CAGACTTCACTCCGTCCTTTGCCGACTTCGGCCGACCAGCCCTTAGCAACCGTGGGC
CCCCAAGGGGTGGGCC (SEQ ID NO:17).
DETAILED DESCRIPTION
[0013] This disclosure explains how to make animals that are
resistant to FMDV. The animals are genetically modified so that
their eukaryotic translation initiation factor 4G proteins (eIF4G)
are resistant to cleavage by one or both of the FMDV proteases
L.sup.pro and 3C.sup.pro (collectively referred to herein as the
FMDV proteases). These are proteases made by FMDV that attack eIF4G
proteins. The working examples include the generation of a
livestock primary cell modified to resist attack by one of the FMDV
proteases. Animals can be cloned from these cells using techniques
proven by the inventors to be effective to make founder animals.
The modification may be made in a site-specific manner so that the
native gene allele is modified to make a modified allele that
expresses FMDV protease-resistant eIF4G proteins.
FMDV Resistance
[0014] FMDV belongs to the Aphthovirus genus of the picornaviridae
family, the smallest of animal viruses that include poliovirus,
rhinovirus (common cold), and hepatitis A. There are seven
serotypes with multiple subtypes [2]. Like other picornaviruses,
the FMDV genome is a single-stranded RNA of about 8,500 nucleotides
that can be directly translated (positive-strand genome) that
encodes a single polyprotein in excess of 100 KDa. Encoded in the
N-terminal region of the FMDV RNA is a papain-like protease, called
L.sup.prothat has two isoforms, Lab and Lb of which Lb is the
important product [3]. L.sup.pro is both exceptionally small and
exceptionally specific. The L.sup.prosequence first cleaves the
FMDV polyprotein, while it is being synthesized, to liberate itself
from the polyprotein. Then the free L.sup.profurther cuts the
remaining polyprotein into individual functional polypeptides that
produce massive numbers of progeny virus. L.sup.pro has several
other target sites of which the most important appears to be
eukaryotic translation initiation factor 4G (eIF4G) [4, 5] that
when cleaved by L.sup.pro is unable to promote initiation of the
.sup.4mG-capped mRNAs of mammalian cells. EIF4G, which comes in two
isoforms eIF4GI and eIF4GII, is a scaffold protein that brings
together several eIF4 RNA-binding proteins that attach to
structures at the 5' and 3' ends of all capped and polyadenylated
mRNAs. In some picornaviruses, e.g., poliovirus, the 2A.sup.pro
protease has the equivalent activities as L.sup.pro.
[0015] The net effect of eIF4G is to non-covalently bridge the
termini eukaryotic mRNAs that have .sup.7mGcap-binding eIF4E bound
to their 5'-ends and poly(A)-binding protein (PABP) at their
3'-ends [6, 7]. These additions to the termini of mRNAs allow the
translational machinery to differentiate completely processed mRNAs
from the myriad of other RNA molecules in a cell to coordinate
their translation into proteins. The critical activity of eIF4G
proteins makes them attractive targets for cleavage by viral
invaders that have evolved to subjugate the translational machinery
of the cell to produce exclusively viral proteins [8-12]. Once cut
into two or more peptides, eIF4G is incapable of bridging the 5'
and 3' ends of mRNAs, and host protein synthesis come to a halt
over a few hours (FIG. 1). The proteases have side activities that
target proteins such as interferons and its regulators [13-16] as
well as nuclear factor kappa B [17] that are involved with immune
responses to viruses, especially viruses that have a
double-stranded RNA intermediate (or final) product over the course
of their replication. Interaction of cleaved eIF4G peptides with
the FMDV internal ribosome initiation site appears to be important
for expression of FMDV genes [18-21].
[0016] Picornaviral genomes are not capped and hence do not require
the assistance of eIF4G to initiate translation of their encoded
polyproteins. Rather, initiation of translation of the polyprotein
precursor occurs at internal ribosome entry site (IRES). As a
result, nearly all synthesis of host-cell proteins is shutoff
leaving the protein synthetic machinery almost exclusively
available for the production of viral proteins. This feature is the
key to the rapid spread and onset of symptoms in virally infected
animals. There is a second protease, 3C.sup.pro that also attacks
eIF4G, PABP and the RNA helicase eIF4A [22]. However, the activity
of 3C.sup.pro is delayed and generally has a lesser role than
L.sup.proin subversion of host protein synthesis [11, 23, 24].
These two features of L.sup.pro and 3C.sup.pro are essential to
virus debilitation and spread. Although one study using cultured
BHK-21 cells showed that FMDV lacking to L.sup.pro replicated at a
slightly lower rate [25], FMDV lacking to L.sup.pro was markedly
non-virulent when injected into cattle and pigs and was unable to
spread to co-housed animals [26, 27]. The L.sup.pro-deficient virus
was susceptible to interferon-mediated cell defenses in the whole
animal but not in the cultured cells [27, 28].
[0017] The effective strategy of picornaviruses is therefore:
inactivate host protein synthesis by attacking its weakest point,
the bridging function of eIF4G, using the same viral proteases that
are necessary for polyprotein cleavage into mature proteins. As
this is done, the viral genome replicates via a double-stranded
intermediate that will not induce significant intra-cellular immune
responses because 1) synthesis of the necessary host proteins is
compromised and 2) several host defense proteins have amino acid
sequences that are targeted by the viral proteases. The virus is
cytocidal due to subversion of normal cellular activities;
infectious virions appear 4-6 hours post-infection.
[0018] An embodiment of the invention is an animal with an eIF4G
gene encoding an eIF4G protein that resists proteases made by FMDV.
One FMDV resistant embodiment is to make only one or only a few
nucleotide-specific changes in the eIF4G genes that will confer an
eIF4G protein with resistance to C.sup.pro and/or to L.sup.pro.
Such precision genetic changes to an animal genome may be made with
site-specific nucleases such as zinc finger nucleases (ZFNs),
transcriptional activator-like effector nucleases (TALENs), or
Clustered Regularly Interspaced Short Palindromic Repeats
(CRISPRs). TALENs are a more versatile platform than ZFNs [34, 35].
CRISPR is a recent and effective tool (Cong et al., Science
express, Jan. 3, 2013 . 1-7; Mali et al., Science 15 Feb. 2013:
Vol. 339, pp. 823-826). Example 2 describes primary cells that have
been genomically modified to make its EIF4G into an FMDV-protease
resistant gene. These cells may be used to make cloned animals
using conventional techniques.
[0019] One embodiment of the animal has the resistant gene in the
genome of the animal. An alternative embodiment adds an exogenous
gene to the animal, which expresses the exogenous gene in some or
all cells. The exogenous gene resists FMDV activity. Embodiments of
the invention include cells, organisms, or animals that include an
exogenous gene that expresses an EIF4G protein or a portion of said
protein that is bound by an FMDV protease. Another alternative
embodiment places the eIF4G gene under control of an inducible
promoter. In use, for instance, a group of animals can receive an
additive in their feed or otherwise to activate the gene to create
resistance. Founder animals and breeds may be established with one
or more of these features.
[0020] By substituting specific amino acids in the eIF4GI and
eIF4GII sequences that retain translational function but are
resistant to protease digestion, host protein synthesis can
continue to outcompete synthesis of viral proteins due to the
massive excess of host mRNAs, which are not degraded in
picornavirus-infected cells [36]. Moreover, IRES-mediated
translation of FMDV RNA may be attenuated due to lack of eIF4G
cleavage products [20, 21]. This approach provides resistance to
FMDV replication and is better than merely adding
protease-resistant eIF4G genes into genomes with
protease-susceptible eIF4G genes [19, 36]. This strategy does not
involve transgenesis; rather it is equivalent to gene conversion, a
standard genetic activity in animal cells.
TABLE-US-00001 TABLE 1 Porcine, bovine and ovine eIF4G sequence and
FMDV resistant isoforms Version Sequence Wildtype PSFANLGRPALS SEQ
ID NO: 1 Isoform 1 PSFADFGRPALS SEQ ID NO: 2 Isoform 2 PSFANLGPPALS
SEQ ID NO: 3 Isoform 3 PSFANFGRPALS SEQ ID NO: 4 Isoform 4
PSFANDGRPALS SEQ ID NO: 5 Isoform 5 PSFANPGRPALS SEQ ID NO: 6
Isoform 6 PSFANYGRPALS SEQ ID NO: 7 Isoform 7 PSFANWGRPALS SEQ ID
NO: 8 Isoform 8 PSFADLGRPALS SEQ ID NO: 9 Isoform 9 PSFPNLGRPALS
SEQ ID NO: 10 Isoform 10 PSFDNLGRPALS SEQ ID NO: 11
[0021] By way of example, Table 1 shows the amino acid sequence
form 668-679 for the portion of a porcine eIF4G gene (100% identity
to bovine and ovine) that is bound by L.sup.pro and is cleaved by
L.sup.pro. Table 1 further shows alterations of one or two amino
acids that are expected to cause resistance to degradation and
create FMDV resistance, with the alterations being emphasized by
underlining. The alternative amino acid sequences are isoforms of
the eIF4G protein; the genes that encode the various isoforms are
alleles of each other. Amino acids 668-679 are of wild type (Wt)
porcine EIF4GI as translated from NM_001246253. Alternative
isoforms to confer resistance to the FMDV L.sup.pro protease are
predicted from (see Santos et al 2009 describing viral polypeptide
sites; Biochemistry 48, 7948). Isoform 1 is based on alignment with
human EIF4GII at this site. The human EIF4GII is not cleaved here
and is functional. Isoforms 2 and 8 are similarly based on
alignment with human EIF4GII. The remaining isoforms are
accordingly chosen based on their likelihood to inhibit the
proteases and maintain normal function. Artisans can easily create
nucleic acid sequences to make the indicated isoforms and the wild
type gene sequence is readily and publicly available. Homologous
recombination (HR) templates may be generated to code the various
isoforms along with silent RFLP mutations to aid in colony
screening. These templates will have 90-mer oligonucleotides
spanning the EIF4G14.1 TALEN binding sites (FIG. 2). Each HR
template (typically from about 0.025 to about 0.8 nMole) along with
EIF4G14.1 TALENs (typically from about 0.1 to about 10 micrograms)
will be introduced into early passage fibroblasts, and individual
colonies will be screened for introgression of the mutant alleles.
Cells will be taken from colonies that incorporate the desired
allele and used to clone founder animals.
[0022] Table 2 shows sources for sequences of various eIF4G genes
in various livestock species. Artisans can readily obtain
information for these and other livestock eIF4G genes.
TABLE-US-00002 TABLE 2 EIF4G orthologs and homologs in livestock
Gene Ensembl ID NCBI ID (mRNA) Pig EIF4G1 ENSSSCG00000030255
EIF4G3* ENSSSCG00000003512 Novel ENSSSCG00000026340 uncharac-
terized Cow EIF4G1 ENSBTAG00000012881 EIF4G3* ENSBTAG00000040215
Sheep EIF4G1 XM_004003088.1 *Note that the EIF4G3 gene encodes the
EiF4GII protein.
[0023] Accordingly, embodiments of the invention include an EIF4G
that is resistant to an FMDV proteinase, e.g., L.sup.pro and/or
CP.sup.pro. Embodiments include isoforms having changes to one or
more residues (amino acid or nucleic acid) of the wild type, and
also nucleic acid sequences encoding the same. The one or more
altered residues may be in a position wherein an FMDV proteinase
binds, or in a nucleic acid sequence corresponding to the same.
Alternatively, the mutation may be at the point where the
proteinase makes its cut in the protein. The number of changes
relative to a wild type typically would encompasses from 1 to about
50 changes; artisans will immediately understand that all ranges
and values between 1 and 50 are contemplated, e.g., from 1 to 5,
from 1 to 10, and so forth. The changes are such that the EIF4G is
operable to carry out normal (meaning non-FMDV) functions. Animals
with the improved EIF4G animal will be resistant to foot and mouth
disease. One form of resistance is immunity, meaning that the
animal is essentially not affected by the disease. Another form or
resistance is that the animal recovers more readily once it is
infected. Another form of resistance is that the animal is harder
to infect in the first place--as a result of the virus having
difficulty spreading. A consequence of resistance can include a
decreased likelihood of spreading the disease because viral titers
in the host are greatly decreased.
[0024] Embodiments also include the genes, the proteins, the
nucleic acids encoding the proteins, and the cells or animals with
such genes and proteins. The animals are useful as livestock and as
research animals to study FMDV. The cells are useful for making
animals as livestock or as research animals and are also of use for
FMDV research. Cells that resist FMDV proteolysis are useful for
testing drugs and treatments that interfere with other aspects of
the FMDV lifecycle. One reason is that the animals and cell will
persist longer so that the effects of these other interventions can
be assayed. Another reason is that the results of studies with
other therapies can quickly determine if their mode of action is
FMDV proteolysis, or not. The genes and the proteins, by
themselves, are of further use for assaying FMDV testing and
effects.
Genetically Modified Animals
[0025] Animals may be made that are mono-allelic or bi-allelic for
a chromosomal modification, using methods that either leave a
marker in place, allow for it to be bred out of an animal, or by
methods that do not place a marker in the animal. For instance, the
inventors have used methods of homologous dependent recombination
(HDR) to make changes to, or insertion of exogenous genes into,
chromosomes of animals. Tools such as siste-specific nucleases,
e.g., TALENs, zinc finger nucleases (ZFN), or CRISPR, and
recombinase fusion proteins, as well as conventional methods, are
available.
[0026] The term natural allele in the context of genetic
modification means an allele found in nature in the same species of
organism that is being modified. The term novel allele means a
non-natural allele. A human allele placed into a goat is a novel
allele. Thus a natural allele is a variation already existing
within a species that can be interbred. And a novel allele is one
that does not exist within a species that can be interbred.
Movement of an allele interspecies means from one species of animal
to another and movement intraspecies means movement between animals
of the same species.
[0027] Moving an allele from one breed to another by conventional
breeding processes involves swapping many alleles between the
breeds. Recombination during meiosis inevitably exchanges genetic
loci between the breeds. In contrast, site-specific nuclease
modified livestock and other animals are free of genetic changes
that result from meiotic recombination events since the cells or
embryos are modified at a time when cells are exclusively mitotic.
As a result, a TALEN-modified animal can easily be distinguished
from an animal created by sexual reproduction.
[0028] The processes herein provide for editing the genomes of
existing animals. The animal has a fixed phenotype and cloning the
animal, e.g., by somatic cell cloning, effectively preserves that
phenotype. Making a specific change or changes in a cellular genome
during cloning allows for a known phenotype to be altered.
Processes herein alternatively provide for altering a genome of an
embryo that has yet to develop into an animal with fixed traits.
Embryos with sound genetics may nonetheless not express all of the
traits that are within the genetic potential of their genetics,
i.e., animals do not always express the traits that their line is
bred for.
[0029] The inventors have previously demonstrated effective cloning
efficiency when cloning from polygenic populations of modified
cells (Carlson et al., 2011). Additionally, however, TALEN-mediated
genome modification, as well as modification by recombinase fusion
molecules, provides for a bi-allelic alteration to be accomplished
in a single generation. For example, an animal homozygous for a
knocked-out gene may be made by SCNT and without inbreeding to
produce homozygosity. Gestation length and maturation to
reproduction age for livestock such as pigs and cattle is a
significant barrier to research and to production. For example,
generation of a homozygous knockout from heterozygous mutant cells
(both sexes) by cloning and breeding would require 16 and 30 months
for pigs and cattle respectively.
[0030] The inventors have previously shown that transgenic primary
fibroblasts can be effectively expanded and isolated as colonies
when plated with non-transgenic fibroblasts and subjected to drug
selection using a transposon co-selection technique (Carlson et
al., 2011, U.S. Pub. No. 2011/0197290). It was further shown (see
US 2012/0222143) that puromycin resistant colonies were isolated
for cells treated with six TALEN pairs and evaluated their
genotypes by SURVEYOR assay or direct sequencing of PCR products
spanning the target site. In general, the proportion of indel
positive clones was similar to predictions made based on day 3
modification levels. Bi-allelic knockout clones were identified for
5 of 6 TALEN pairs, occurring in up to 35% of indel positive cells.
Notably, the frequency of bi-allelic knockout clones for the
majority of TALEN pairs exceeds what would be predicted if the
cleavage of each chromosome is treated as an independent event.
[0031] TALEN-induced homologous recombination eliminates the need
for linked selection markers. TALENs may be used to precisely
transfer specific alleles into a livestock genome by homology
dependent repair (HDR). In a pilot study, a specific 11 bp deletion
(the Belgian Blue allele) (Grobet et al., 1997; Kambadur et al.,
1997) was introduced into the bovine GDF8 locus (see US
2012/0222143). When transfected alone, the btGDF8.1 TALEN pair
cleaved up to 16% of chromosomes at the target locus.
Co-transfection with a supercoiled homologous DNA repair template
harboring the 11 bp deletion resulted in a gene conversion
frequency (HDR) of up to 5% at day 3 without selection for the
desired event. Gene conversion was identified in 1.4% of isolated
colonies that were screened.
TALENs
[0032] TALENs are genetic engineering tools. Inactivation of a gene
is one of many uses of TALENs. The term TALEN, as used herein, is
broad and includes a monomeric TALEN that can cleave double
stranded DNA without assistance from another TALEN. The term TALEN
is also used to refer to one or both members of a pair of TALENs
that are engineered to work together to cleave DNA at the same
site. TALENs that work together may be referred to as a left-TALEN
and a right-TALEN, which references the handedness of DNA.
[0033] Miller et al. (Miller et al. (2011) Nature Biotechnol
29:143) reported making TALENs for site-specific nuclease
architecture by linking TAL truncation variants to the catalytic
domain of FokI nuclease. The resulting TALENs were shown to induce
gene modification in immortalized human cells by means of the two
major eukaryotic DNA repair pathways, non-homologous end joining
(NHEJ) and homology directed repair. The TALENs can be engineered
for specific binding. Improvements of the Miller et al. TALENS are
described in U.S. Ser. No. 13/594,694 filed Aug. 24, 2012. Specific
binding, as that term is commonly used in the biological arts,
refers to a molecule that binds to a target with a relatively high
affinity compared to non-target tissues, and generally involves a
plurality of non-covalent interactions, such as electrostatic
interactions, van der Waals interactions, hydrogen bonding, and the
like. Specific binding interactions characterize antibody-antigen
binding, enzyme-substrate binding, and specifically binding
protein-receptor interactions.
[0034] The cipher for TALs has been reported (PCT Application WO
2011/072246) wherein each DNA binding repeat is responsible for
recognizing one base pair in the target DNA sequence. The residues
may be assembled to target a DNA sequence, with: (a) HD for
recognition of C/G; (b) NI for recognition of A/T; (c) NG for
recognition of T/A; (d) NS for recognition of C/G or A/T or T/A or
G/C; (e) NN for 30 recognition of G/C or A/T; (f) IG for
recognition of T/A; (g) N for recognition of C/G; (h) HG for
recognition of C/G or T/A; (i) H for recognition of T/A; and (j) NK
for recognition of G/C. In brief, a target site for binding of a
TALEN is determined and a fusion molecule comprising a nuclease and
a series of RVDs that recognize the target site is created. Upon
binding, the nuclease cleaves the DNA so that cellular repair
machinery can operate to make a genetic modification at the cut
ends. The term TALEN means a protein comprising a Transcription
Activator-like (TAL) effector binding domain and a nuclease domain
and includes monomeric TALENs that are functional per se as well as
others that require dimerization with another monomeric TALEN. The
dimerization can result in a homodimeric TALEN when both monomeric
TALEN are identical or can result in a heterodimeric TALEN when
monomeric TALEN are different.
[0035] In some embodiments, a monomeric TALEN can be used. TALEN
typically function as dimers across a bipartite recognition site
with a spacer, such that two TAL effector domains are each fused to
a catalytic domain of the FokI restriction enzyme, the
DNA-recognition sites for each resulting TALEN are separated by a
spacer sequence, and binding of each TALEN monomer to the
recognition site allows FokI to dimerize and create a double-strand
break within the spacer. Monomeric TALENs also can be constructed,
however, such that single TAL effectors are fused to a nuclease
that does not require dimerization to function. One such nuclease,
for example, is a single-chain variant of FokI in which the two
monomers are expressed as a single polypeptide. Other naturally
occurring or engineered monomeric nucleases also can serve this
role. The DNA recognition domain used for a monomeric TALEN can be
derived from a naturally occurring TAL effector. Alternatively, the
DNA recognition domain can be engineered to recognize a specific
DNA target. Engineered single-chain TALENs may be easier to
construct and deploy, as they require only one engineered DNA
recognition domain. A dimeric DNA sequence-specific nuclease can be
generated using two different DNA binding domains (e.g., one TAL
effector binding domain and one binding domain from another type of
molecule). TALENs may function as dimers across a bipartite
recognition site with a spacer. This nuclease architecture also can
be used for target-specific nucleases generated from, for example,
one TALEN monomer and one zinc finger nuclease monomer. In such
cases, the DNA recognition sites for the TALEN and zinc finger
nuclease monomers can be separated by a spacer of appropriate
length. Binding of the two monomers can allow FokI to dimerize and
create a double-strand break within the spacer sequence. DNA
binding domains other than zinc fingers, such as homeodomains, myb
repeats or leucine zippers, also can be fused to FokI and serve as
a partner with a TALEN monomer to create a functional nuclease.
[0036] In some embodiments, a TAL effector can be used to target
other protein domains (e.g., non-nuclease protein domains) to
specific nucleotide sequences. For example, a TAL effector can be
linked to a protein domain from, without limitation, a DNA 20
interacting enzyme (e.g., a methylase, a topoisomerase, an
integrase, a transposase, or a ligase), a transcription activators
or repressor, or a protein that interacts with or modifies other
proteins such as histones. Applications of such TAL effector
fusions include, for example, creating or modifying epigenetic
regulatory elements, making site-specific insertions, deletions, or
repairs in DNA, controlling gene expression, and modifying
chromatin structure.
[0037] The spacer of the target sequence can be selected or varied
to modulate TALEN specificity and activity. The flexibility in
spacer length indicates that spacer length can be chosen to target
particular sequences with high specificity. Further, the variation
in activity has been observed for different spacer lengths
indicating that spacer length can be chosen to achieve a desired
level of TALEN activity.
[0038] The term nuclease includes exonucleases and endonucleases.
The term endonuclease refers to any wild-type or variant enzyme
capable of catalyzing the hydrolysis (cleavage) of bonds between
nucleic acids within a DNA or RNA molecule, preferably a DNA
molecule. Non-limiting examples of endonucleases include type II
restriction endonucleases such as FokI, HhaI, HindlII, NotI, BbvCl,
EcoRI, BglII, and AlwI. Endonucleases comprise also rare-cutting
endonucleases when having typically a polynucleotide recognition
site of about 12-45 basepairs (bp) in length, more preferably of
14-45 bp. Rare-cutting endonucleases induce DNA double-strand
breaks (DSBs) at a defined locus. Rare-cutting endonucleases can
for example be a homing endonuclease, a chimeric Zinc-Finger
nuclease (ZFN) resulting from the fusion of engineered zinc-finger
domains with the catalytic domain of a restriction enzyme such as
FokI or a chemical endonuclease. In chemical endonucleases, a
chemical or peptidic cleaver is conjugated either to a polymer of
nucleic acids or to another DNA recognizing a specific target
sequence, thereby targeting the cleavage activity to a specific
sequence. Chemical endonucleases also encompass synthetic nucleases
like conjugates of orthophenanthroline, a DNA cleaving molecule,
and triplex-forming oligonucleotides (TFOs), known to bind specific
DNA sequences. Such chemical endonucleases are comprised in the
term "endonuclease" according to the present invention. Examples of
such endonuclease include I-See I, I-Chu L I-Cre I, I-Csm I, PI-See
L PI-Tti L PI-Mtu I, I-Ceu I, I-See IL 1-See III, HO, PI-Civ I,
PI-Ctr L PI-Aae I, PI-Bsu I, PI-Dha I, PI-Dra L PI-Mav L PI-Meh I,
PI-Mfu L PI-Mfl I, PI-Mga L PI-Mgo I, PI-Min L PI-Mka L PI-Mle I,
PI-Mma I, PI-30 Msh L PI-Msm I, PI-Mth I, PI-Mtu I, PI-Mxe I,
PI-Npu I, PI-Pfu L PI-Rma I, PI-Spb I, PI-Ssp L PI-Fae L PI-Mja I,
PI-Pho L PI-Tag L PI-Thy I, PI-Tko I, PI-Tsp I, I-MsoI.
[0039] A genetic modification made by TALENs or other tools may be,
for example, chosen from the list consisting of an insertion, a
deletion, insertion of an exogenous nucleic acid fragment, and a
substitution. The term "insertion" is used broadly to mean either
literal insertion into the chromosome or use of the exogenous
sequence as a template for repair. In general, a target DNA site is
identified and a TALEN-pair is created that will specifically bind
to the site. The TALEN is delivered to the cell or embryo, e.g., as
a protein, mRNA or by a vector that encodes the TALEN. The TALEN
cleaves the DNA to make a double-strand break that is then
repaired, often resulting in the creation of an indel, or
incorporating sequences or polymorphisms contained in an
accompanying exogenous nucleic acid that is either inserted into
the chromosome or serves as a template for repair of the break with
a modified sequence. This template-driven repair is a useful
process for changing a chromosome, and provides for effective
changes to cellular chromosomes.
[0040] The term exogenous nucleic acid means a nucleic acid that is
added to the cell or embryo, regardless of whether the nucleic acid
is the same or distinct from nucleic acid sequences naturally in
the cell. The term nucleic acid or nucleic acid fragment or nucleic
acid sequence is broad and includes a chromosome, expression
cassette, gene, DNA, RNA, mRNA, or portion thereof. The cell or
embryo may be, for instance, chosen from the group consisting of
livestock, an artiodactyl, a cow, a swine, a sheep, a goat, a
chicken, a rabbit, and a fish. The term livestock means
domesticated animals that are raised as commodities for food or
biological material. The term artiodactyl means a hoofed mammal of
the order Artiodactyla, which includes cattle, deer, camels,
hippopotamuses, sheep, and goats, that have an even number of toes,
usually two or sometimes four, on each foot.
[0041] Some embodiments involve a composition or a method of making
a genetically modified livestock and/or artiodactyl comprising
introducing a TALEN-pair into livestock and/or an artiodactyl cell
or embryo that makes a genetic modification to DNA of the cell or
embryo at a site that is specifically bound by the TALEN-pair, and
producing the livestock animal/artiodactyl from the cell. Direct
injection may be used for the cell or embryo, e.g., into a zygote,
blastocyst, or embryo. Alternatively, the TALEN and/or other
factors may be introduced into a cell using any of many known
techniques for introduction of proteins, RNA, mRNA, DNA, or
vectors. Genetically modified animals may be made from the embryos
or cells according to known processes, e.g., implantation of the
embryo into a gestational host, or various cloning methods. The
phrase "a genetic modification to DNA of the cell at a site that is
specifically bound by the TALEN", or the like, means that the
genetic modification is made at the site cut by the nuclease on the
TALEN when the TALEN is specifically bound to its target site. The
nuclease does not cut exactly where the TALEN-pair binds, but
rather at a defined site between the two binding sites.
[0042] Some embodiments involve a composition or a treatment of a
cell that is used for cloning the animal. The cell may be a
livestock and/or artiodactyl cell, a cultured cell, a primary cell,
a primary somatic cell, a zygote, a germ cell, a primordial germ
cell, or a stem cell. For example, an embodiment is a composition
or a method of creating a genetic modification comprising exposing
a plurality of primary cells in a culture to TALEN proteins or a
nucleic acid encoding a TALEN or TALENs. The TALENs may be
introduced as proteins or as nucleic acid fragments, e.g., encoded
by mRNA or a DNA sequence in a vector.
[0043] Genetic modification of cells may also include insertion of
a reporter. The reporter may be, e.g., a florescent marker, e.g.,
green fluorescent protein and yellow fluorescent protein. The
reporter may be a selection marker, e.g., puromycin, ganciclovir,
adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo,
G418, APH), dihydrofolate reductase (DHFR),
hygromycin-B-phosphtransferase, thymidine kinase (TK), or
xanthin-guanine phosphoribosyltransferase (XGPRT). Vectors for the
reporter, selection marker, and/or one or more TALEN may be a
plasmid, transposon, transposase, viral, or other vectors, e.g., as
detailed herein.
[0044] TALENs may be directed to a plurality of DNA sites. The
sites may be separated by several thousand or many thousands of
base pairs. The DNA can be rejoined by cellular machinery to
thereby cause the deletion of the entire region between the sites.
Embodiments include, for example, sites separated by a distance
between 1-5 megabases or between 50% and 80% of a chromosome, or
between about 100 and about 1,000,000 basepairs; artisans will
immediately appreciate that all the ranges and values within the
explicitly stated ranges are contemplated, e.g., from about 1,000
to about 10,000 basepairs or from about 500 to about 500,000
basepairs. Alternatively, exogenous DNA may be added to the cell or
embryo for insertion of the exogenous DNA, or template-driven
repair of the DNA between the sites. Modification at a plurality of
sites may be used to make genetically modified cells, embryos,
artiodactyls, and livestock.
Zinc Finger Nucleases
[0045] Zinc-finger nucleases (ZFNs) are artificial restriction
enzymes generated by fusing a zinc finger DNA-binding domain to a
DNA-cleavage domain. Zinc finger domains can be engineered to
target desired DNA sequences and this enables zinc-finger nucleases
to target unique sequences within complex genomes. By taking
advantage of endogenous DNA repair machinery, these reagents can be
used to alter the genomes of higher organisms. ZFNs may be used in
method of inactivating genes.
[0046] A zinc finger DNA-binding domain has about 30 amino acids
and folds into a stable structure. Each finger primarily binds to a
triplet within the DNA substrate. Amino acid residues at key
positions contribute to most of the sequence-specific interactions
with the DNA site. These amino acids can be changed while
maintaining the remaining amino acids to preserve the necessary
structure. Binding to longer DNA sequences is achieved by linking
several domains in tandem. Other functionalities like non-specific
FokI cleavage domain (N), transcription activator domains (A),
transcription repressor domains (R) and methylases (M) can be fused
to a ZFPs to form ZFNs respectively, zinc finger transcription
activators (ZFA), zinc finger transcription repressors (ZFR, and
zinc finger methylases (ZFM). Materials and methods for using zinc
fingers and zinc finger nucleases for making genetically modified
animals are disclosed in, e.g., U.S. Pat. No. 8,106,255
US20120192298, US20110023159, and US20110281306.
Clustered Regularly Interspaced Short Palindromic Repeats
[0047] Clustered regularly interspaced short palindromic repeats
(CRISPR) are derived from bacterial/archea adaptive immune
defenses. CRISPR activity involves integration of "spacers" from
invading virus or plasmid DNA into the CRISPR locus, expression and
processing of short guiding CRISPR RNAs (crRNAs) consisting of
spacer-repeat units, and cleavage of nucleic acids complementary to
the spacer. The nuclease Cas9 searches for sequences matching the
crRNA to cleave. Cas9 cuts the DNA only if a correct protospacer
adjacent motif (PAM) is also present at the 3' end. As a genome
engineering tool, the specificity of gRNA-directed Cas9 cleavage is
very helpful.
[0048] For instance, DiCarlo et al. (Nucl. Acids Res. 41 (5)
(2013)) reported that the CRISPR-Cas components, Cas9 gene and a
designer genome targeting CRISPR guide RNA (gRNA), showed robust
and specific RNA-guided endonuclease activity at targeted
endogenous genomic loci in yeast. Using constitutive Cas9
expression and a transient gRNA cassette, they showed that targeted
double-strand breaks increased homologous recombination rates of
single- and double-stranded oligonucleotide donors by 5-fold and
130-fold, respectively. In addition, co-transformation of a gRNA
plasmid and a donor DNA in cells constitutively expressing Cas9
resulted in near 100% donor DNA recombination frequency. The term
CRISPR herein is used to refer to the genetic engineering tools
that use these techniques.
[0049] And Cong et al. reported that CRISPR systems and associated
Cas9 nucleases could be directed by short RNAs to induce precise
cleavage at endogenous genomic loci in human and mouse cells. Cas9
were also converted into a nicking enzyme to facilitate
homology-directed repair with minimal mutagenic activity. Finally,
multiple guide sequences were capable of being encoded into a
single CRISPR array to enable simultaneous editing of several sites
within the mammalian genome, demonstrating easy programmability and
wide applicability of the CRISPR technology.
Vectors and Nucleic Acids
[0050] A variety of nucleic acids may be introduced into the
artiodactyl or other cells, for knockout purposes, for inactivation
of a gene, to obtain expression of a gene, or for other purposes.
As used herein, the term nucleic acid includes DNA, RNA, and
nucleic acid analogs, and nucleic acids that are double-stranded or
single-stranded (i.e., a sense or an antisense single strand).
Nucleic acid analogs can be modified at the base moiety, sugar
moiety, or phosphate backbone to improve, for example, stability,
hybridization, or solubility of the nucleic acid. Modifications at
the base moiety include deoxyuridine for deoxythymidine, and
5-methyl-2'-deoxycytidine and 5-bromo-2'-doxycytidine for
deoxycytidine. Modifications of the sugar moiety include
modification of the 2' hydroxyl of the ribose sugar to form
2'-O-methyl or 2'-O-allyl sugars. The deoxyribose phosphate
backbone can be modified to produce morpholino nucleic acids, in
which each base moiety is linked to a six membered, morpholino
ring, or peptide nucleic acids, in which the deoxyphosphate
backbone is replaced by a pseudopeptide backbone and the four bases
are retained. See, Summerton and Weller (1997) Antisense Nucleic
Acid Drug Dev. 7 (3):187; and Hyrup et al. (1996) Bioorgan. Med.
Chem. 4:5. In addition, the deoxyphosphate backbone can be replaced
with, for example, a phosphorothioate or phosphorodithioate
backbone, a phosphoroamidite, or an alkyl phosphotriester
backbone.
[0051] The target nucleic acid sequence can be operably linked to a
regulatory region such as a promoter. Regulatory regions can be
porcine regulatory regions or can be from other species. As used
herein, operably linked refers to positioning of a regulatory
region relative to a nucleic acid sequence in such a way as to
permit or facilitate transcription of the target nucleic acid.
[0052] Any type of promoter can be operably linked to a target
nucleic acid sequence. Examples of promoters include, without
limitation, tissue-specific promoters, constitutive promoters,
inducible promoters, and promoters responsive or unresponsive to a
particular stimulus. Suitable tissue specific promoters can result
in preferential expression of a nucleic acid transcript in beta
cells and include, for example, the human insulin promoter. Other
tissue specific promoters can result in preferential expression in,
for example, hepatocytes or heart tissue and can include the
albumin or alpha-myosin heavy chain promoters, respectively. In
other embodiments, a promoter that facilitates the expression of a
nucleic acid molecule without significant tissue- or
temporal-specificity can be used (i.e., a constitutive promoter).
For example, a beta-actin promoter such as the chicken beta-actin
gene promoter, ubiquitin promoter, miniCAGs promoter,
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter, or
3-phosphoglycerate kinase (PGK) promoter can be used, as well as
viral promoters such as the herpes simplex virus thymidine kinase
(HSV-TK) promoter, the SV40 promoter, or a cytomegalovirus (CMV)
promoter. In some embodiments, a fusion of the chicken beta actin
gene promoter and the CMV enhancer is used as a promoter. See, for
example, Xu et al. (2001) Hum. Gene Ther. 12:563; and Kiwaki et al.
(1996) Hum. Gene Ther. 7:821.
[0053] An example of an inducible promoter is the tetracycline
(tet)-on promoter system, which can be used to regulate
transcription of the nucleic acid. In this system, a mutated Tet
repressor (TetR) is fused to the activation domain of herpes
simplex virus VP16 trans-activator protein to create a
tetracycline-controlled transcriptional activator (tTA), which is
regulated by tet or doxycycline (dox). In the absence of
antibiotic, transcription is minimal, while in the presence of tet
or dox, transcription is induced. Alternative inducible systems
include the ecdysone or rapamycin systems. Ecdysone is an insect
molting hormone whose production is controlled by a heterodimer of
the ecdysone receptor and the product of the ultraspiracle gene
(USP). Expression is induced by treatment with ecdysone or an
analog of ecdysone such as muristerone A. The agent that is
administered to the animal to trigger the inducible system is
referred to as an induction agent.
[0054] Additional regulatory regions that may be useful in nucleic
acid constructs, include, but are not limited to, polyadenylation
sequences, translation control sequences (e.g., an internal
ribosome entry segment, IRES), enhancers, inducible elements, or
introns. Such regulatory regions may not be necessary, although
they may increase expression by affecting transcription, stability
of the mRNA, translational efficiency, or the like. Such regulatory
regions can be included in a nucleic acid construct as desired to
obtain optimal expression of the nucleic acids in the cell(s).
Sufficient expression, however, can sometimes be obtained without
such additional elements.
[0055] A nucleic acid construct may be used that encodes signal
peptides or selectable markers. Signal peptides can be used such
that an encoded polypeptide is directed to a particular cellular
location (e.g., the cell surface). Non-limiting examples of
selectable markers include puromycin, ganciclovir, adenosine
deaminase (ADA), aminoglycoside phosphotransferase (neo, G418,
APH), dihydrofolate reductase (DHFR),
hygromycin-B-phosphtransferase, thymidine kinase (TK), and
xanthin-guanine phosphoribosyltransferase (XGPRT). Such markers are
useful for selecting stable transformants in culture. Other
selectable markers include fluorescent polypeptides, such as green
fluorescent protein or yellow fluorescent protein.
[0056] In some embodiments, a sequence encoding a selectable marker
can be flanked by recognition sequences for a recombinase such as,
e.g., Cre or Flp. For example, the selectable marker can be flanked
by loxP recognition sites (34-bp recognition sites recognized by
the Cre recombinase) or FRT recognition sites such that the
selectable marker can be excised from the construct. See, Orban, et
al., Proc. Natl. Acad. Sci. (1992) 89:6861, for a review of Cre/lox
technology, and Brand and Dymecki, Dev. Cell (2004) 6:7. A
transposon containing a Cre- or Flp-activatable transgene
interrupted by a selectable marker gene also can be used to obtain
transgenic animals with conditional expression of a transgene. For
example, a promoter driving expression of the marker/transgene can
be either ubiquitous or tissue-specific, which would result in the
ubiquitous or tissue-specific expression of the marker in F0
animals (e.g., pigs). Tissue specific activation of the transgene
can be accomplished, for example, by crossing a pig that
ubiquitously expresses a marker-interrupted transgene to a pig
expressing Cre or Flp in a tissue-specific manner, or by crossing a
pig that expresses a marker-interrupted transgene in a
tissue-specific manner to a pig that ubiquitously expresses Cre or
Flp recombinase. Controlled expression of the transgene or
controlled excision of the marker allows expression of the
transgene.
[0057] In some embodiments, the exogenous nucleic acid encodes a
polypeptide. A nucleic acid sequence encoding a polypeptide can
include a tag sequence that encodes a "tag" designed to facilitate
subsequent manipulation of the encoded polypeptide (e.g., to
facilitate localization or detection). Tag sequences can be
inserted in the nucleic acid sequence encoding the polypeptide such
that the encoded tag is located at either the carboxyl or amino
terminus of the polypeptide. Non-limiting examples of encoded tags
include glutathione S-transferase (GST) and FLAG.TM. tag (Kodak,
New Haven, Conn.).
[0058] Nucleic acid constructs can be methylated using an SssI CpG
methylase (New England Biolabs, Ipswich, Mass.). In general, the
nucleic acid construct can be incubated with S-adenosylmethionine
and SssI CpG-methylase in buffer at 37.degree. C. Hypermethylation
can be confirmed by incubating the construct with one unit of
HinP1I endonuclease for 1 hour at 37.degree. C. and assaying by
agarose gel electrophoresis.
[0059] Nucleic acid constructs can be introduced into embryonic,
fetal, or adult artiodactyl cells of any type, including, for
example, germ cells such as an oocyte or an egg, a progenitor cell,
an adult or embryonic stem cell, a primordial germ cell, a kidney
cell such as a PK-15 cell, an islet cell, a beta cell, a liver
cell, or a fibroblast such as a dermal fibroblast, using a variety
of techniques. Non-limiting examples of techniques include the use
of transposon systems, recombinant viruses that can infect cells,
or liposomes or other non-viral methods such as electroporation,
microinjection, or calcium phosphate precipitation, that are
capable of delivering nucleic acids to cells.
[0060] In transposon systems, the transcriptional unit of a nucleic
acid construct, i.e., the regulatory region operably linked to an
exogenous nucleic acid sequence, is flanked by an inverted repeat
of a transposon. Several transposon systems, including, for
example, Sleeping Beauty (see, U.S. Pat. No. 6,613,752 and U.S.
Publication No. 2005/0003542); Frog Prince (Miskey et al. (2003)
Nucleic Acids Res. 31:6873); Tol2 (Kawakami (2007) Genome Biology 8
(Suppl.1):S7; Minos (Pavlopoulos et al. (2007) Genome Biology 8
(Suppl.1):S2); Hsmar1 (Miskey et al. (2007)) Mol Cell Biol.
27:4589); and Passport have been developed to introduce nucleic
acids into cells, including mice, human, and pig cells. The
Sleeping Beauty transposon is particularly useful. A transposase
can be delivered as a protein, encoded on the same nucleic acid
construct as the exogenous nucleic acid, can be introduced on a
separate nucleic acid construct, or provided as an mRNA (e.g., an
in vitro-transcribed and capped mRNA).
[0061] Insulator elements also can be included in a nucleic acid
construct to maintain expression of the exogenous nucleic acid and
to inhibit the unwanted transcription of host genes. See, for
example, U.S. Publication No. 2004/0203158. Typically, an insulator
element flanks each side of the transcriptional unit and is
internal to the inverted repeat of the transposon. Non-limiting
examples of insulator elements include the matrix attachment
region-(MAR) type insulator elements and border-type insulator
elements. See, for example, U.S. Pat. Nos. 6,395,549, 5,731,178,
6,100,448, and 5,610,053, and U.S. Publication No.
2004/0203158.
[0062] Nucleic acids can be incorporated into vectors. A vector is
a broad term that includes any specific DNA segment that is
designed to move from a carrier into a target DNA. A vector may be
referred to as an expression vector, or a vector system, which is a
set of components needed to bring about DNA insertion into a genome
or other targeted DNA sequence such as an episome, plasmid, or even
virus/phage DNA segment. Vector systems such as viral vectors
(e.g., retroviruses, adeno-associated virus and integrating phage
viruses), and non-viral vectors (e.g., transposons) used for gene
delivery in animals have two basic components: 1) a vector
comprised of DNA (or RNA that is reverse transcribed into a cDNA)
and 2) a transposase, recombinase, or other integrase enzyme that
recognizes both the vector and a DNA target sequence and inserts
the vector into the target DNA sequence. Vectors most often contain
one or more expression cassettes that comprise one or more
expression control sequences, wherein an expression control
sequence is a DNA sequence that controls and regulates the
transcription and/or translation of another DNA sequence or mRNA,
respectively.
[0063] Many different types of vectors are known. For example,
plasmids and viral vectors, e.g., retroviral vectors, are known.
Mammalian expression plasmids typically have an origin of
replication, a suitable promoter and optional enhancer, and also
any necessary ribosome binding sites, a polyadenylation site,
splice donor and acceptor sites, transcriptional termination
sequences, and 5' flanking non-transcribed sequences. Examples of
vectors include: plasmids (which may also be a carrier of another
type of vector), adenovirus, adeno-associated virus (AAV),
lentivirus (e.g., modified HIV-1, SIV or FIV), retrovirus (e.g.,
ASV, ALV or MoMLV), and transposons (e.g., Sleeping Beauty,
P-elements, Tol-2, Frog Prince, piggyBac).
[0064] As used herein, the term nucleic acid refers to both RNA and
DNA, including, for example, cDNA, genomic DNA, synthetic (e.g.,
chemically synthesized) DNA, as well as naturally occurring and
chemically modified nucleic acids, e.g., synthetic bases or
alternative backbones. A nucleic acid molecule can be
double-stranded or single-stranded (i.e., a sense or an antisense
single strand). The term transgenic is used broadly herein and
refers to a genetically modified organism or genetically engineered
organism whose genetic material has been altered using genetic
engineering techniques. A knockout artiodactyl is thus transgenic
regardless of whether or not exogenous genes or nucleic acids are
expressed in the animal or its progeny.
Genetically Modified Animals
[0065] Animals may be modified using TALENs, Zinc Fingers,
CRISPR/Cas9, or other genetic engineering tools, including
recombinase fusion proteins, or various vectors that are known.
Materials and methods of genetically modifying animals are further
detailed in US 2012/0222143, US 2012/0220037 and 2010/0251395 filed
Nov. 10, 2009 which are hereby incorporated herein by reference for
all purposes; in case of conflict, the instant specification is
controlling. The term trans-acting refers to processes acting on a
target gene from a different molecule (i.e., intermolecular). A
trans-acting element is usually a DNA sequence that contains a
gene. This gene codes for a protein (or microRNA or other
diffusible molecule) that is used in the regulation the target
gene. The trans-acting gene may be on the same chromosome as the
target gene, but the activity is via the intermediary protein or
RNA that it encodes. Inactivation of a gene using a dominant
negative generally involves a trans-acting element. The term
cis-regulatory or cis-acting means an action without coding for
protein or RNA; in the context of gene inactivation, this generally
means inactivation of the coding portion of a gene, or a promoter
and/or operator that is necessary for expression of the functional
gene.
[0066] Various techniques known in the art can be used to introduce
nucleic acid constructs into animals to produce founder animals and
to make animal lines, nucleic acid construct (or a knock-out of a
gene) is integrated into the genome. Such techniques include,
without limitation, pronuclear microinjection (U.S. Pat. No.
4,873,191), retrovirus mediated gene transfer into germ lines (Van
der Putten et al. (1985) Proc. Natl. Acad. Sci. USA 82, 6148-1652),
gene targeting into embryonic stem cells (Thompson et al. (1989)
Cell 56, 313-321), electroporation of embryos (Lo (1983) Mol. Cell.
Biol. 3, 1803-1814), sperm-mediated gene transfer (Lavitrano et al.
(2002) Proc. Natl. Acad. Sci. USA 99, 14230-14235; Lavitrano et al.
(2006) Reprod. Fert. Develop. 18, 19-23), and in vitro
transformation of somatic cells, such as cumulus or mammary cells,
or adult, fetal, or embryonic stem cells, followed by nuclear
transplantation (Wilmut et al. (1997) Nature 385, 810-813; and
Wakayama et al. (1998) Nature 394, 369-374). Pronuclear
microinjection, sperm mediated gene transfer, and somatic cell
nuclear transfer are particularly useful techniques. An animal that
is genomically modified is an animal wherein all of its cells have
the genetic modification, including its germ line cells. When
methods are used that produce an animal that is mosaic in its
genetic modification, the animals may be inbred and progeny that
are genomically modified may be selected. Cloning, for instance,
may be used to make a mosaic animal if its cells are modified at
the blastocyst state, or genomic modification can take place when a
single-cell is modified. Animals that are modified so they do not
sexually mature can be homozygous or heterozygous for the
modification, depending on the specific approach that is used. If a
particular gene is inactivated by a knock out modification,
homozygousity would normally be required. If a particular gene is
inactivated by an RNA interference or dominant negative strategy,
then heterozygosity is often adequate.
[0067] Typically, in pronuclear microinjection, a nucleic acid
construct is introduced into a fertilized egg; 1 or 2 cell
fertilized eggs are used as the pronuclei containing the genetic
material from the sperm head and the egg are visible within the
protoplasm. Pronuclear staged fertilized eggs can be obtained in
vitro or in vivo (i.e., surgically recovered from the oviduct of
donor animals). In vitro fertilized eggs can be produced as
follows. For example, swine ovaries can be collected at an
abattoir, and maintained at 22-28.degree. C. during transport.
Ovaries can be washed and isolated for follicular aspiration, and
follicles ranging from 4-8 mm can be aspirated into 50 mL conical
centrifuge tubes using 18 gauge needles and under vacuum.
Follicular fluid and aspirated oocytes can be rinsed through
pre-filters with commercial TL-HEPES (Minitube, Verona, Wis.).
Oocytes surrounded by a compact cumulus mass can be selected and
placed into TCM-199 OOCYTE MATURATION MEDIUM (Minitube, Verona,
Wis.) supplemented with 0.1 mg/mL cysteine, 10 ng/mL epidermal
growth factor, 10% porcine follicular fluid, 50 .mu.M
2-mercaptoethanol, 0.5 mg/ml cAMP, 10 IU/mL each of pregnant mare
serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG)
for approximately 22 hours in humidified air at 38.7.degree. C. and
5% CO.sub.2. Subsequently, the oocytes can be moved to fresh
TCM-199 maturation medium, which will not contain cAMP, PMSG or hCG
and incubated for an additional 22 hours. Matured oocytes can be
stripped of their cumulus cells by vortexing in 0.1% hyaluronidase
for 1 minute.
[0068] For swine, mature oocytes can be fertilized in 500
.mu.Minitube PORCPRO IVF MEDIUM SYSTEM (Minitube, Verona, Wis.) in
Minitube 5-well fertilization dishes. In preparation for in vitro
fertilization (IVF), freshly-collected or frozen boar semen can be
washed and resuspended in PORCPRO IVF Medium to 4.times.10.sup.5
sperm. Sperm concentrations can be analyzed by computer assisted
semen analysis (SPERMVISION, Minitube, Verona, Wis.). Final in
vitro insemination can be performed in a 10 .mu.l volume at a final
concentration of approximately 40 motile sperm/oocyte, depending on
boar. Incubate all fertilizing oocytes at 38.7.degree. C. in 5.0%
CO.sub.2 atmosphere for 6 hours. Six hours post-insemination,
presumptive zygotes can be washed twice in NCSU-23 and moved to 0.5
mL of the same medium. This system can produce 20-30% blastocysts
routinely across most boars with a 10-30% polyspermic insemination
rate.
[0069] Linearized nucleic acid constructs can be injected into one
of the pronuclei. Then the injected eggs can be transferred to a
recipient female (e.g., into the oviducts of a recipient female)
and allowed to develop in the recipient female to produce the
transgenic animals. In particular, in vitro fertilized embryos can
be centrifuged at 15,000.times.g for 5 minutes to sediment lipids
allowing visualization of the pronucleus. The embryos can be
injected with using an Eppendorf FEMTOJET injector and can be
cultured until blastocyst formation. Rates of embryo cleavage and
blastocyst formation and quality can be recorded.
[0070] Embryos can be surgically transferred into uteri of
asynchronous recipients. Typically, 100-200 (e.g., 150-200) embryos
can be deposited into the ampulla-isthmus junction of the oviduct
using a 5.5-inch TOMCAT.RTM. catheter. After surgery, real-time
ultrasound examination of pregnancy can be performed.
[0071] In somatic cell nuclear transfer, a transgenic artiodactyl
cell (e.g., a transgenic pig cell or bovine cell) such as an
embryonic blastomere, fetal fibroblast, adult ear fibroblast, or
granulosa cell that includes a nucleic acid construct described
above, can be introduced into an enucleated oocyte to establish a
combined cell. Oocytes can be enucleated by partial zona dissection
near the polar body and then pressing out cytoplasm at the
dissection area. Typically, an injection pipette with a sharp
beveled tip is used to inject the transgenic cell into an
enucleated oocyte arrested at meiosis 2. In some conventions,
oocytes arrested at meiosis-2 are termed eggs. After producing a
porcine or bovine embryo (e.g., by fusing and activating the
oocyte), the embryo is transferred to the oviducts of a recipient
female, about 20 to 24 hours after activation. See, for example,
Cibelli et al. (1998) Science 280, 1256-1258 and U.S. Pat. No.
6,548,741. For pigs, recipient females can be checked for pregnancy
approximately 20-21 days after transfer of the embryos. Other
livestock have comparable processes.
[0072] Standard breeding techniques can be used to create animals
that are homozygous for the exogenous nucleic acid from the initial
heterozygous founder animals. Homozygosity may not be required,
however. Modified animals pigs described herein can be bred with
other animals of interest.
[0073] In some embodiments, a nucleic acid of interest and a
selectable marker can be provided on separate transposons and
provided to either embryos or cells in unequal amount, where the
amount of transposon containing the selectable marker far exceeds
(5-10 fold excess) the transposon containing the nucleic acid of
interest. Transgenic cells or animals expressing the nucleic acid
of interest can be isolated based on presence and expression of the
selectable marker. Because the transposons will integrate into the
genome in a precise and unlinked way (independent transposition
events), the nucleic acid of interest and the selectable marker are
not genetically linked and can easily be separated by genetic
segregation through standard breeding. Thus, transgenic animals can
be produced that are not constrained to retain selectable markers
in subsequent generations, an issue of some concern from a public
safety perspective.
[0074] Once transgenic animal have been generated, expression of an
exogenous nucleic acid can be assessed using standard techniques.
Initial screening can be accomplished by Southern blot analysis to
determine whether or not integration of the construct has taken
place. For a description of Southern analysis, see sections
9.37-9.52 of Sambrook et al., 1989, Molecular Cloning, A Laboratory
Manual, second edition, Cold Spring Harbor Press, Plainview; N.Y.
Polymerase chain reaction (PCR) techniques also can be used in the
initial screening. PCR refers to a procedure or technique in which
target nucleic acids are amplified. Generally, sequence information
from the ends of the region of interest or beyond is employed to
design oligonucleotide primers that are identical or similar in
sequence to opposite strands of the template to be amplified. PCR
can be used to amplify specific sequences from DNA as well as RNA,
including sequences from total genomic DNA or total cellular RNA.
Primers typically are 14 to 40 nucleotides in length, but can range
from 10 nucleotides to hundreds of nucleotides in length. PCR is
described in, for example PCR Primer: A Laboratory Manual, ed.
Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press,
1995. Nucleic acids also can be amplified by ligase chain reaction,
strand displacement amplification, self-sustained sequence
replication, or nucleic acid sequence-based amplified. See, for
example, Lewis (1992) Genetic Engineering News 12,1; Guatelli et
al. (1990) Proc. Natl. Acad. Sci. USA 87:1874; and Weiss (1991)
Science 254:1292. At the blastocyst stage, embryos can be
individually processed for analysis by PCR, Southern hybridization
and splinkerette PCR (see, e.g., Dupuy et al. Proc Natl Acad Sci
USA (2002) 99:4495).
[0075] Expression of a nucleic acid sequence encoding a polypeptide
in the tissues of transgenic animals can be assessed using
techniques that include, for example, Northern blot analysis of
tissue samples obtained from the animal, in situ hybridization
analysis, Western analysis, immunoassays such as enzyme-linked
immunosorbent assays, and reverse-transcriptase PCR (RT-PCR).
Founder Animals, Animal Lines, Traits, and Reproduction
[0076] Founder animals may be produced by cloning and other methods
described herein. The founders can be homozygous for a genetic
modification, as in the case where a zygote or a primary cell
undergoes a homozygous modification. Similarly, founders can also
be made that are heterozygous. The founders may be genomically
modified, meaning that all of the cells in their genome have
undergone modification. Founders can be mosaic for a modification,
as may happen when vectors are introduced into one of a plurality
of cells in an embryo, typically at a blastocyst stage. Progeny of
mosaic animals may be tested to identify progeny that are
genomically modified. An animal line is established when a pool of
animals has been created that can be reproduced sexually or by
assisted reproductive techniques, with heterogeneous or homozygous
progeny consistently expressing the modification.
[0077] In livestock, many alleles are known to be linked to various
traits such as production traits, type traits, workability traits,
and other functional traits. Artisans are accustomed to monitoring
and quantifying these traits, e.g., Visscher et al., Livestock
Production Science, 40 (1994) 123-137, U.S. Pat. No. 7,709,206, US
2001/0016315, US 2011/0023140, and US 2005/0153317. An animal line
may include a trait chosen from a trait in the group consisting of
a production trait, a type trait, a workability trait, a fertility
trait, a mothering trait, and a disease resistance trait. Further
traits include expression of a recombinant gene product.
Recombinases
[0078] Embodiments of the invention include administration of a
TALEN or TALENs or a Zinc finger nuclease with a recombinase or
other DNA-binding protein associated with DNA recombination.
Embodiments also include administration of a recombinase fusion
protein to create a double stranded break in a cellular chromosome,
e.g., a RecA-ga14 fusion, as in U.S. Pub. No 2011/0059160.
[0079] A recombinase forms a filament with a nucleic acid fragment
and, in effect, searches cellular DNA to find a DNA sequence
substantially homologous to the sequence. An embodiment of a
TALEN-recombinase embodiment comprises combining a recombinase with
a nucleic acid sequence that serves as a template. The template
sequence has substantial homology to a site that is targeted for
cutting by the TALEN/TALEN pair. As described herein, the template
sequence provides for a change to the native DNA, by placement of
an allele, creation of an indel, insertion of exogenous DNA, or
with other changes. The TALEN is placed in the cell or embryo by
methods described herein as a protein, mRNA, or by use of a vector.
The recombinase is combined with the template sequence to form a
filament and placed into the cell. The recombinase and/or template
sequence that combines with the recombinase may be placed in the
cell or embryo as a protein, an mRNA, or with a vector that encodes
the recombinase. The disclosure of U.S. Pub 2011/0059160 is hereby
incorporated herein by reference for all purposes; in case of
conflict, the specification is controlling. The term recombinase
refers to a genetic recombination enzyme that enzymatically
catalyzes, in a cell, the joining of relatively short pieces of DNA
between two relatively longer DNA strands. Recombinases include Cre
recombinase, Hin recombinase, RecA, RAD51, Cre, and FLP. Cre
recombinase is a Type I topoisomerase from P1 bacteriophage that
catalyzes site-specific recombination of DNA between loxP sites.
Hin recombinase is a 21 kD protein composed of 198 amino acids that
is found in the bacteria Salmonella. Hin belongs to the serine
recombinase family of DNA invertases in which it relies on the
active site serine to initiate DNA cleavage and recombination.
RAD51 is a human gene. The protein encoded by this gene is a member
of the RAD51 protein family which assist in repair of DNA double
strand breaks. RAD51 family members are homologous to the bacterial
RecA and yeast Rad51. Cre recombinase is an experimental enzyme
that in lab tests has successfully removed DNA inserted by HIV from
infected cells. The enzyme was derived from Cre recombinase through
selective mutation for the purposes of identifying HIV markers,
which are not bounded by loxP sites and therefore disallow attempts
at Cre-Lox recombination. FLP refers to Flippase recombination
enzyme (FLP or Flp) derived from the 2.mu. plasmid of the baker's
yeast Saccharomyces cerevisiae.
[0080] A eukaryotic homologue of RecA, also possessing recombinase
activity, is the Rad51 protein, first identified in the yeast
Saccharomyces cerevisiae. See Bishop et al., (1992) Cell 69: 439-56
and Shinohara et al, (1992) Cell: 457-70 Aboussekhra, et al.,
(1992) Mol. Cell. Biol. 72, 3224-3234. Basile et al., (1992) Mol.
Cell. Biol. 12, 3235-3246. Plant Rad51 sequences are described in
U.S. Pat. Nos. 6,541,684; 6,720,478; 6,905,857 and 7,034,117.
Another yeast protein that is homologous to RecA is the Dmc1
protein. RecA/Rad51 homologues in organisms other than E. coli and
S. cerevisiae have been described. Morita et al. (1993) Proc. Natl.
Acad. Sci. USA 90:6577-6580; Shinohara et al. (1993) Nature Genet.
4:239-243; Heyer (1994) Experientia 50:223-233; Maeshima et al.
(1995) Gene 160:195-200; U.S. Pat. Nos. 6,541,684 and
6,905,857.
[0081] Herein, "RecA" or "RecA protein" refers to a family of
RecA-like recombination proteins having essentially all or most of
the same functions, particularly: (i) the ability to position
properly oligonucleotides or polynucleotides on their homologous
targets for subsequent extension by DNA polymerases; (ii) the
ability topologically to prepare duplex nucleic acid for DNA
synthesis; and, (iii) the ability of RecA/oligonucleotide or
RecA/polynucleotide complexes efficiently to find and bind to
complementary sequences. The best characterized RecA protein is
from E. coli; in addition to the original allelic form of the
protein a number of mutant RecA-like proteins have been identified,
for example, RecA803. Further, many organisms have RecA-like
strand-transfer proteins including, for example, yeast, Drosophila,
mammals including humans, and plants. These proteins include, for
example, Rec1, Rec2, Rad51, Rad51B, Rad51C, Rad51D, Rad51E, XRCC2
and DMC1. An embodiment of the recombination protein is the RecA
protein of E. coli. Alternatively, the RecA protein can be the
mutant RecA-803 protein of E. coli, a RecA protein from another
bacterial source or a homologous recombination protein from another
organism.
[0082] A nucleoprotein filament, or "filament" may be formed. The
term filament, in the context of forming a structure with a
recombinase, is a term known to artisans in these fields. The
nucleoprotein filament so formed can then be, e.g., contacted with
another nucleic acid or introduced into a cell. Methods for forming
nucleoprotein filaments, wherein the filaments comprise polypeptide
sequences having recombinase activity and a nucleic acid, are
well-known in the art. See, e.g., Cui et al. (2003) Marine
Biotechnol. 5:174-184 and U.S. Pat. Nos. 4,888,274; 5,763,240;
5,948,653 and 7,199,281, the disclosures of which are incorporated
by reference for the purposes of disclosing exemplary techniques
for binding recombinases to nucleic acids to form nucleoprotein
filaments.
[0083] In general, a molecule having recombinase activity is
contacted with a linear, single-stranded nucleic acid. The linear,
single-stranded nucleic acid may be a probe. The methods of
preparation of such single stranded nucleic acids are known. The
reaction mixture typically contains a magnesium ion. Optionally,
the reaction mixture is buffered and optionally also contains ATP,
dATP or a nonhydrolyzable ATP analogue, such as, for example,
.gamma.-thio-ATP (ATP-.gamma.-S) or .gamma.-thio-GTP
(GTP-.gamma.-S). Reaction mixtures can also optionally contain an
ATP-generating system. Double-stranded DNA molecules can be
denatured (e.g., by heat or alkali) either prior to, or during,
filament formation. Optimization of the molar ratio of recombinase
to nucleic acid is within the skill of the art. For example, a
series of different concentrations of recombinase can be added to a
constant amount of nucleic acid, and filament formation assayed by
mobility in an agarose or acrylamide gel. Because bound protein
retards the electrophoretic mobility of a polynucleotide, filament
formation is evidenced by retarded mobility of the nucleic acid.
Either maximum degree of retardation, or maximum amount of nucleic
acid migrating with a retarded mobility, can be used to indicate
optimal recombinase: nucleic acid ratios. Protein-DNA association
can also be quantitated by measuring the ability of a
polynucleotide to bind to nitrocellulose.
Polypeptides
[0084] In some cases a determination of the percent identity of a
peptide to a sequence set forth herein may be required. In such
cases, the percent identity is measured in terms of the number of
residues of the peptide, or a portion of the peptide. A polypeptide
of, e.g., 90% identity, may also be a portion of a larger peptide.
Embodiments include such polypeptides that have the indicated
identity and/or conservative substitution of sequence set forth
herein.
[0085] The term isolated as used herein with reference to a
polypeptide refers to a polypeptide that either has no naturally
occurring counterpart (e.g., a peptidomimetic), or has been
chemically synthesized and is thus substantially uncontaminated by
other polypeptides, or has been separated or purified from other
most cellular components by which it is naturally accompanied
(e.g., other cellular proteins, polynucleotides, or cellular
components.
REFERENCES
[0086] All of the following references are hereby incorporated
herein by reference. Patents and patent applications set forth in
this document are also hereby incorporated herein by reference. In
case of conflict, the instant specification is controlling.
[0087] 1. Thompson, D., et al., Economic costs of the foot and
mouth disease outbreak in the United Kingdom in 2001. Rev. Sci.
Tech., 2002. 21: p. 657-687.
[0088] 2. Grubman, M. J. and B. Baxt, Foot-and-mouth disease. Clin.
Microbiol. Rev., 2004. 17: p. 465-493.
[0089] 3. Cao, X., et al., Functional analysis of the two
alternative translation initiation sites of foot-and-mouth disease
virus. J. Virol., 1995. 69: p. 560-563.
[0090] 4. Glaser, W. and T. Skern, Extremely efficient cleavage of
eIF4G by picornaviral proteinases L and 2A in vitro. FEBS Lett.,
2000. 480: p. 151-155.
[0091] 5. Gradi, A., et al., Cleavage of eukaryotic translation
initiation factor 4GII within foot-and-mouth disease virus-infected
cells: identification of the L-protease cleavage site in vitro. J.
Virol., 2004. 78: p. 3271-3278.
[0092] 6. Hinton, T. M., et al., Functional analysis of individual
binding activities of the scaffold protein eIF4G. J. biol. Chem.,
2007. 282: p. 1695-1708.
[0093] 7. Aitken, C. E. and J. R. Lorsch, A mechanistic overview of
translation initiation in eukaryotes. Nature Rev. Struc. Mol.
Biol., 2012. 19: p. 568-576.
[0094] 8. Kerekatte, V., et al., Cleavage of Poly(A)-binding
protein by coxsackievirus 2A protease in vitro and in vivo: another
mechanism for host protein synthesis shutoff? J. Virol., 1999. 73:
p. 709-717.
[0095] 9. Foeger, N., et al., The binding of foot-and-mouth disease
virus leader proteinase to eIF4GI involves conserved ionic
interactions. FEBS J., 2005. 272: p. 2602-2611.
[0096] 10. Prevot, D., J. L. Darlix, and T. Ohlmann, Conducting the
initiation of protein synthesis: the role of eIF4G. Biol. Cell.,
2003. 95: p. 141-156.
[0097] 11. Lloyd, R. E., Translational control by viral
proteinases. Virus Res., 2006. 119: p. 76-88.
[0098] 12. Truniger, V. and M. A. Aranda, Recessive resistance to
plant viruses. Adv. Virus Res., 2009. 75: p. 120-159.
[0099] 13. de los Santos, T., et al., The leader proteinase of
foot-and-mouth disease virus inhibits the induction of beta
interferon mRNA and blocks the host innate immune response. J.
Virol., 2006. 80: p. 1906-1914.
[0100] 14. Perez-Martin, E., et al., Bovine type III interferon
significantly delays and reduces the severity of foot-and-mouth
disease in cattle. J. Virol., 2012. 86: p. 4477-4487.
[0101] 15. Wang, D., et al., The leader proteinase of
foot-and-mouth disease virus negatively regulates the interferon
pathway by acting as a viral deubiquitinase. J. Virol., 2011. 85:
p. 3758-3766.
[0102] 16. Wang, D., et al., Foot-and-mouth disease virus leader
proteinase inhibits dsRNA-induced type I interferon transcription
by decreasing interferon regulatory factor 3/7 in protein levels.
Biochem. Biophys. Res. Comm., 2010. 399: p. 72-78.
[0103] 17. de los Santos, T., F. Diaz-San Segundo, and M. J.
Grubman, Degradation of nuclear factor kappa B during
foot-and-mouth disease virus infection. J. Virol., 2007. 81: p.
12803-12815.
[0104] 18. Borman, A. M., et al., elF4G and its proteolytic
cleavage products: effect on initiation of protein synthesis from
capped, uncapped, and IRES-containing mRNAs. RNA, 1997. 3: p.
186-196.
[0105] 19. Zhao, X., et al., Protection of cap-dependent protein
synthesis in vivo and in vitro with an eIF4G-1 variant highly
resistant to cleavage by Coxsackievirus 2A protease. J. Biol.
Chem., 2003. 278: p. 4449-4457.
[0106] 20. Lopez de Quinto, S. and E. Martinez-Salas, Interaction
of the eIF4G initiation factor with the aphthovirus IRES is
essential for internal translation initiation in vivo. RNA, 2000.
6: p. 1380-1392.
[0107] 21. Saleh, L., et al., Functional interaction of translation
initiation factor eIF4G with the foot-and-mouth disease virus
internal ribosome entry site. J. Gen. Virol., 2001. 82: p.
757-763.
[0108] 22. Hinton, T. M., et al., Conservation of L and 3C
proteinase activities across distantly related aphthoviruses. J.
Gen. Virol., 2002. 83: p. 3111-3121.
[0109] 23. Belsham, G. J., G. M. McInerney, and N. Ross-Smith,
Foot-and-mouth disease virus 3C protease induces cleavage of
translation initiation factors eIF4A and eIF4G within infected
cells. J. Virol., 2000. 74: p. 272-280.
[0110] 24. Strong, R. and G. J. Belsham, Sequential modification of
translation initiation factor eIF4GI by two different
foot-and-mouth disease virus proteases within infected baby hamster
kidney cells: identification of the 3Cpro cleavage site. J. Gen.
Virol., 2004. 85: p. 2953-2962.
[0111] 25. Piccone, M. E., et al., The foot-and-mouth disease virus
leader proteinase gene is not required for viral replication. J.
Virol., 1995. 69: p. 5372-5382.
[0112] 26. Mason, P. W., et al., Evaluation of a live-attenuated
foot-and-mouth disease virus as a vaccine candidate. Virology,
1997. 227: p. 96-102.
[0113] 27. Chinsangaram, J., P. W. Mason, and M. J. Grubman,
Protection of swine by live and inactivated vaccines prepared from
a leader proteinase-deficient serotype A12 foot-and-mouth disease
virus. Vaccine, 1998. 16: p. 1516-1522.
[0114] 28. Chinsangaram, J., M. Koster, and M. J. Grubman,
Inhibition of L-deleted foot-and-mouth disease virus replication by
alpha/beta interferon involves double-stranded RNA-dependent
protein kinase. J. Virol., 2001. 75: p. 5498-5503.
[0115] 29. Fabian, M. R. and N. Sonenberg, The mechanics of
miRNA-mediated gene silencing: a look under the hood of miRISC.
Nature Rev. Struc. Mol. Biol., 2012. 19: p. 586-593.
[0116] 30. Drake, J. W. and J. J. Holland, Mutation rates among RNA
viruses. Proc Natl Acad Sci USA, 1999. 96: p. 13910-13913.
[0117] 31. Pfeiffer, J. K. and K. Kirkegaard, Increased fidelity
reduces poliovirus fitness and virulence under selective pressure
in mice. PLoS Pathog., 2005. 1: p. e11.
[0118] 32. Freistadt, M. S., J. A. Vaccaro, and K. E. Eberle,
Biochemical characterization of the fidelity of poliovirus
RNA-dependent RNA polymerase. Virol. J., 2007. 4: p. 44.
[0119] 33. Lee, S. W., et al., Attenuated vaccines can recombine to
form virulent field viruses. Science, 2012. 337: p. 188.
[0120] 34. Carlson, D. F., S. C. Fahrenkrug, and P. B. Hackett,
Targeting DNA with fingers and TALENs. Mol. Ther. Nuc. Acids, 2012.
1: p. e3.
[0121] 35. Tan, S., et al., Precision editing of large animal
genomes. Adv. Genet., 2012. 80: p. (in press).
[0122] 36. Lamphear, B. J. and R. E. Rhoads, A single amino acid
change in protein synthesis initiation factor 4G renders
cap-dependent translation resistant to picornaviral 2A proteases.
Biochemistry, 1996. 35: p. 15726-15733.
[0123] 37. A. M. GEURTS, et al., Knockout rats via embryo
microinjection of zinc-finger nucleases, 325 Science (2009).
[0124] 38. I. D. CARBERY, et al., Targeted genome modification in
mice using zinc-finger nucleases, 186 Genetics (2010).
[0125] 39. Carlson, D. F., J. R. Garbe, et al. (2011). "Strategies
for selection marker-free swine transgenesis using the Sleeping
Beauty transposon system." Transgenic research 20 (5):
1125-1137.
[0126] 40. Carlson, D. F., W. Tan, et al. (2012). "Efficient
TALEN-mediated gene knockout in livestock." Proceedings of the
National Academy of Sciences of the United States of America 109
(43): 17382-17387.
[0127] 41. Guschin, D. Y., A. J. Waite, et al. (2010). "A rapid and
general assay for monitoring endogenous gene modification." Methods
in molecular biology 649: 247-256.
[0128] Patent applications: US 2010/0146655, US 2010/0105140, US
2011/0059160, US 2011/0197290, US 2010/0146655, US 2011/0197290, US
2012/0222143 and U.S. Ser. No. 61/662,767
EXAMPLES
[0129] Materials and methods, including making of TALENs, are
generally as described in U.S. Ser. No. 13/594,694 filed Aug. 24,
2012, unless otherwise indicated. These processes have been
demonstrated to be effective to change alleles in primary cells
that are then used to make genetically modified founder animals
that have the alleles and pass them to their progeny.
Example 1
[0130] Referring to FIG. 2, a portion of porcine EIF4GI is shown in
panel A. The wild type sequence has asparagine and leucine residues
in the minus 3 and 2 positions relative to the L.sup.pro cleavage
site (arrowhead). In this example, the HDR template replaces the
minus 3 and 2 residues with aspartic acid and phenylalanine to
render the modified EIF4GI resistant to L.sup.pro cleavage. Two
pairs of TALENs (top) were designed to cut the wild type EIF4GI to
stimulate homologous recombination. Panel B: Surveyor (Cel-I) assay
of pig fibroblasts transfected with each TALEN pair. Panel C: RFLP
assay to determine the efficiency of homologous recombination.
[0131] Transfections were performed in early passage (<2
passages) primary pig fibroblasts. Fibroblasts at 70-90% confluence
were harvested by for use in transfections. Two micrograms of TALEN
mRNA ssEIF4G14.1 or ssEIF4G14.2 along with 0.2 nMole of a 90-mer
homologous oligonucleotide
(5'-cccagacttcactccgtectttgccgactteggccgaccagccatagcaaccgtgggcccccaaggggt-
gggccaggtggggagctgc c) (SEQ ID NO: 18) were transfected into
500,000 fibroblasts using the NEON nucleofection system (Life
Technologies) with the following settings: 1 pulse, 1800 v; 20 ms
width and a 100 .mu.l tip. Transfected cells were cultured 3 days
at either 30 degrees Celsius prior to indel analysis by the
Surveyor assay (Transgenomic) (Carlson, Tan et al. 2012) and
quantitative RFPL analysis using Eagl. Products are resolved on a
10% PAGE gel and cleavage products are measured by densitometry.
Percent NHEJ was calculated as described in Guischin et al.
(Guschin, Waite et al. 2010) and displayed below. Percent
homologous recombination was calculated by dividing the sum of
cleavage product density by the sum of all products.
[0132] Additional L.sup.pro cleavage site mutations to EIF4GI may
be introduced by the same methods in the future.
Example 2
[0133] For colony isolation, cells will be enumerated and plated at
a range of densities 1-20 cells/cm.sup.2 on 10 cm dishes. Cells
will be cultured for 10-15 days until individual colonies of 3-4 mm
in diameter are present. Individual colonies are aspirated with a
p-200 pipettor under gentle aspiration and expelled into a well of
24-well plate with 500 .mu.l of growth medium (Carlson, Garbe et
al. 2011). Plates with clearly defined colonies
(.about.10-30/plate) will be chosen for colony aspiration to limit
the chance of aspirating cells from multiple colonies. Once a
colony reaches 70-90 percent confluent in the 24-well dish, a
portion will be harvested for RFPL analysis and the remainder will
be cryopreserved. Cells will be taken from colonies that have been
determined to have successfully acquired the intended features and
used for cloning to make founder animals.
[0134] The specific embodiments above are intended to be
illustrative and not limiting. Additional embodiments are within
the broad concepts described herein. In addition, although the
invention has been described with reference to particular
embodiments, those skilled in the art will recognize that changes
can be made in form and detail without departing from the spirit
and scope of the invention. Any incorporation by reference of
documents herein is limited such that no subject matter is
incorporated that is contrary to the explicit disclosure herein.
Sequence CWU 1
1
18112PRTSus scrofa 1Pro Ser Phe Ala Asn Leu Gly Arg Pro Ala Leu Ser
1 5 10 212PRTArtificial Sequenceisoform for eIF4G 2Pro Ser Phe Ala
Asp Phe Gly Arg Pro Ala Leu Ser 1 5 10 312PRTArtificial
Sequenceisoform of eIF4G 3Pro Ser Phe Ala Asn Leu Gly Pro Pro Ala
Leu Ser 1 5 10 412PRTArtificial Sequenceisoform of eIF4G 4Pro Ser
Phe Ala Asn Phe Gly Arg Pro Ala Leu Ser 1 5 10 512PRTArtificial
Sequenceisoform for eIF4G 5Pro Ser Phe Ala Asn Asp Gly Arg Pro Ala
Leu Ser 1 5 10 612PRTArtificial Sequenceisoform for eIF4G 6Pro Ser
Phe Ala Asn Pro Gly Arg Pro Ala Leu Ser 1 5 10 712PRTArtificial
Sequenceisoform for eIF4G 7Pro Ser Phe Ala Asn Tyr Gly Arg Pro Ala
Leu Ser 1 5 10 812PRTArtificial Sequenceisoform eIF4G 8Pro Ser Phe
Ala Asn Trp Gly Arg Pro Ala Leu Ser 1 5 10 912PRTArtificial
Sequenceisoform eIF4G 9Pro Ser Phe Ala Asp Leu Gly Arg Pro Ala Leu
Ser 1 5 10 1012PRTArtificial Sequenceisoform eIF4G 10Pro Ser Phe
Pro Asn Leu Gly Arg Pro Ala Leu Ser 1 5 10 1112PRTArtificial
Sequenceisoform eIF4G 11Pro Ser Phe Asp Asn Leu Gly Arg Pro Ala Leu
Ser 1 5 10 1218DNAArtificial SequenceTALEN portion 12ccgtcctttg
ccaacctt 181318DNAArtificial SequenceTALEN portion 13agcaaccgtg
ggccccca 181416DNAArtificial SequenceTALEN portion 14tggccgacca
gccctt 161515DNAArtificial SequenceTALEN portion 15cccaaggggt gggcc
151673DNAArtificial Sequenceportion of EIF4GI gene 16cagacttcac
tccgtccttt gccaaccttg gccgaccagc ccttagcaac cgtgggcccc 60caaggggtgg
gcc 731773DNAArtificial SequenceEIF4GI gene portion isoform
17cagacttcac tccgtccttt gccgacttcg gccgaccagc ccttagcaac cgtgggcccc
60caaggggtgg gcc 731890DNAArtificial SequenceEIF4GI gene portion
18cccagacttc actccgtcct ttgccgactt cggccgacca gcccttagca accgtgggcc
60cccaaggggt gggccaggtg gggagctgcc 90
* * * * *