U.S. patent application number 16/027686 was filed with the patent office on 2018-10-25 for method for assessing juice/cider quality and/or safety.
The applicant listed for this patent is The United States of America, as represented by the Secretary of Agriculture, Southern Gardens Citrus, The United States of America, as represented by the Secretary of Agriculture. Invention is credited to Jinhe Bai, Elizabeth A Baldwin, Michael S Irey, Anne Plotto, Wei Zhao.
Application Number | 20180305741 16/027686 |
Document ID | / |
Family ID | 51662342 |
Filed Date | 2018-10-25 |
United States Patent
Application |
20180305741 |
Kind Code |
A1 |
Zhao; Wei ; et al. |
October 25, 2018 |
METHOD FOR ASSESSING JUICE/CIDER QUALITY AND/OR SAFETY
Abstract
A novel method for isolating DNA from juices and ciders is
described. This method is low cost and yield large quantities of
highly purified DNA even though one uses a small quantity of juice
or cider. A method for determining if a juice or cider is safe to
consume and/or the quality of the juice or cider are also
described. For these methods, one can perform qPCR on the DNA which
can be obtained using the disclosed method or any other prior art
method, and comparing the amount of DNA from microorganisms is
present in the juice and/or cider to determine the safety and/or
quality of the juice and/or cider. These methods work even if the
liquid was pasteurized.
Inventors: |
Zhao; Wei; (Port St. Lucie,
FL) ; Baldwin; Elizabeth A; (Winter Haven, FL)
; Bai; Jinhe; (Port St. Lucie, FL) ; Plotto;
Anne; (Winter Haven, FL) ; Irey; Michael S;
(Clewiston, FL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The United States of America, as represented by the Secretary of
Agriculture
Southern Gardens Citrus |
Washington
Clewiston |
DC
FL |
US
US |
|
|
Family ID: |
51662342 |
Appl. No.: |
16/027686 |
Filed: |
July 5, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14499508 |
Sep 29, 2014 |
10047389 |
|
|
16027686 |
|
|
|
|
61884354 |
Sep 30, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6806 20130101;
C12Q 1/6888 20130101; C12Q 1/689 20130101; C12Q 1/6806 20130101;
C12Q 2531/113 20130101; C12Q 2561/113 20130101 |
International
Class: |
C12Q 1/6806 20060101
C12Q001/6806; C12Q 1/689 20060101 C12Q001/689; C12Q 1/6888 20060101
C12Q001/6888 |
Claims
1. A method for isolating nucleic acids from a pectin containing
juice or cider comprising: (a) separating solid components from
liquid components of said pectin containing juice or cider; (b)
lysing cells present in said solid components to release nucleic
acids, proteins, polysaccharides, lipids, and non-polar material
present in said cells; (c) generating an organic phase, an
interface, and an aqueous phase wherein said lipids are in said
organic phase; wherein said proteins are in said interface; and
wherein said nucleic acids and polysaccharides are in said aqueous
phase; (d) separating said aqueous phase from said organic phase
and said interface; (e) mixing an aqueous solution of cetyl
trimethyl ammonium bromide (CTAB) and salt with said
polysaccharides and nucleic acids, wherein said nucleic acids
precipitate out of said aqueous solution, and wherein said
polysaccharides remain dissolved in said aqueous solution; and (f)
separating said aqueous solution containing said dissolved
polysaccharides from said nucleic acids.
2. The method of claim 1 wherein said concentration of said salt in
said aqueous solution is between approximately 10 mM and
approximately 400 mM.
3. A method for isolating nucleic acids from a pectin containing
juice or cider comprising: (a) separating solid components present
in a sample of liquid components of said pectin containing juice or
cider; (b) exposing said solid components to a solution containing
Tris-base, EDTA, salt, PVP40, .beta.-mercaptoethanol, NaOH, and a
surfactant to dissolve said solid components and lyse cells present
in said solid material; (c) optionally heating said solution to
lyse said cells; (d) adding chloroform to generate an aqueous
phase, an interphase, and an organic phase, wherein lipids and
non-polar material are in said organic phase, wherein nucleic acids
and polysaccharides are in said aqueous phase, and wherein proteins
are in said interface; (e) separating said aqueous phase from said
organic phase and said interface; (f) adding CTAB to said aqueous
phase, wherein said nucleic acids present in said aqueous phase
precipitate out of said aqueous phase; (g) optionally heating said
aqueous phase and CTAB to enhance precipitation of said nucleic
acids; (h) separating said nucleic acids from said aqueous phase;
(i) optionally washing said nucleic acids in ethanol to remove any
remaining CTAB; and (j) optionally separating said washed nucleic
acids from said ethanol.
4. A method for determining quality of a pectin containing juice or
cider comprising: (a) isolating nucleic acids from said pectin
containing juice or cider using the method of claim 1; (b)
quantifying the amount of said nucleic acids belonging to one or
more microorganisms in said pectin containing juice or cider; and
(c) comparing amount of said nucleic acids belonging to one or more
said microorganisms in said pectin containing juice or cider to a
known value that indicates the quality of said pectin containing
juice or cider; wherein said one or more microorganisms negatively
impact said quality of said pectin containing juice or cider when
said one or more microorganisms are present in said pectin
containing juice or cider or in a plant from which said pectin
containing juice or cider is produced.
5. The method of claim 4, wherein said quantifying step further
comprises (i) amplifying said isolated nucleic acids in said pectin
containing juice or cider, and (ii) measuring amount of said
nucleic acids belonging to said one or more microorganisms.
6. The method of claim 4, wherein said quantifying step further
comprises (i) exposing said isolated nucleic acids to a first
primer, a second primer, and a label, wherein said first primer's
sequence and said second primer's sequence are complementary to
specific sequences in a microorganism's genome and bind to said
specific sequences in said microorganism's genome; (ii) amplifying
said microorganism's nucleic acids to generate an amplicon; and
(iii) determining Ct value of said amplified nucleic acids.
7. The method of claim 6, wherein said label is selected from the
group consisting of an intercalating dye, a fluorescent
composition, a spectroscopic label, a photochemical label, a
biochemical label, an immunochemical label, and a chemical
label.
8. The method of claim 4, wherein said quality is selected from the
group consisting of flavor, smell, color, safety, taste, mouth
feel, aftertaste, and a combination thereof.
9. The method of claim 4, wherein said microorganism is selected
from the group consisting of lactic acid bacteria, acetic acid
bacteria, Alicyclobacillus spp., Zygosaccharomyces spp.,
Rhodotorula ruba, Escherichia coli, Listeria spp., Shigella spp.,
Salmonella spp., Klebsiella spp., Candidatus Liberibacter africanus
(CLaf), and Candidatus Liberibacter americanus (CLam).
10. A method for determining if a pectin containing juice or cider
potentially contaminated with a microorganism is safe for
consumption by an animal, said method comprising: (a) isolating
nucleic acids from said pectin containing juice or cider using the
method of claim 1; (b) quantifying the amount of said nucleic acids
belonging to said microorganism in said pectin containing juice or
cider; and (c) comparing amount of said nucleic acids belonging to
said microorganism in said pectin containing juice or cider to a
known value that indicates maximum quantity of said microorganism
that is safe for consumption by said animal.
11. The method of claim 10, wherein said quantifying step further
comprises (i) exposing said isolated nucleic acids to a first
primer, a second primer, and a label, wherein said first primer's
sequence and said second primer's sequence are complementary to
specific sequences in said microorganism's genome and bind to said
specific sequences in said microorganism's genome; (ii) amplifying
said microorganism's nucleic acids to generate an amplicon; and
(iii) determining Ct value of said amplified nucleic acids.
12. The method of claim 11, wherein said label is selected from the
group consisting of an intercalating dye, a fluorescent
composition, a spectroscopic label, a photochemical label, a
biochemical label, an immunochemical label, and a chemical
label.
13. The method of claim 10, wherein said microorganism is selected
from the group consisting of lactic acid bacteria, acetic acid
bacteria, Alicyclobacillus spp., Zygosaccharomyces spp.,
Rhodotorula ruba, Escherichia coli, Listeria spp., Shigella spp.,
Salmonella spp., and Klebsiella spp.
Description
CROSS REFERENCE TO RELATED PATENT APPLICATIONS
[0001] This patent application claims priority to U.S. patent
application Ser. No. 14/499,508 filed on Sep. 29, 2014 (allowed)
which claims benefit of U.S. Patent Application 61/884,354 filed
Sep. 30, 2013 (expired), contents of both of which are expressly
incorporated by reference herein.
BACKGROUND OF THE INVENTION
Field of Invention
[0002] This invention relates to a novel method for assessing the
flavor quality of a juice and/or cider as well as the safety of a
juice and/or cider by determining the quantity of microorganisms'
DNA present in the juice and/or cider. This invention relates to a
novel method of isolating DNA from a juice and/or cider.
BRIEF DESCRIPTION OF THE PRIOR ART
[0003] Huanglongbing (HLB) disease in Florida is widespread and
associated with Candidatus Liberibacter asiaticus (CLas), a phloem
limited bacterium. This disease can kill a tree in 5-10 years, and
orange juice processed from HLB affected fruit is often associated
with bitter taste and/or off-flavor (Baldwin, et al., J. Agr. Food
Chem. 58:1247-1262 (2010); Plotto, et al., J. Food Sci.
75:S220-S230 (2010)). CLas population has been shown to correlate
with HLB symptoms in that leaves with serious symptoms had higher
CLas population (Gottwald, et al., Crop Protect. 36:73-82 (2012);
Stover and McCollum, HortScience 46:1344-1348 (2011); Trivedi, et
al., European J. Plant Pathol. 124:553-563 (2009)). Candidatus
Liberibacter africanus (CLaf) and Candidatus Liberibacter
americanus (CLam) also cause HLB disease in citrus trees in Africa
and Brazil, respectively.
[0004] Quantitative polymerase chain reaction (qPCR) is an
excellent diagnostic assay tool for determining if a plant is
infected with a pathogen. Prior to conducting qPCR, one must first
isolate and purify DNA. While many different methods of isolating
and purifying DNA exist, in general, the most commonly used methods
fall within one of two categories. One category uses SDS to lyse
the cells, then uses a high concentration of KoAC to precipitate
SDS and protein and thus is referred to as the SDS-KoAC method
(Dellaporta, et al., Plant Molecular Biology Reporter, 1(4):19-21
(1983)). The second category uses CTAB in the extraction procedure
and thus is referred to as the CTAB method (Allen, et al., Nat.
Protoc.,1(5):2320-2325 (2006)). Many additional methods exist
including, but not limited to, silica-based isolation kits,
magnetic particle separation technology, use of resins, etc. One of
the difficulties in isolating DNA from plant material and pathogen
cells in the presence of rigid polysaccharide cell wall and
capsules which physically inhibit DNA liberation (Gonzalez-Mendoza,
et al., Gen. Mol. Res. 9:162-166 (2010); Noor Adila, et al., Mal.
J. Microbiol. 3:7-13 (2007); Varma, et al., Biotechnol. J.
2:386-392 (2007)). The most widely used method for tissue
disruption for DNA extraction from plant tissue has been by
grinding tissue with mortar and pestle under liquid nitrogen: the
finer the grind, the greater the amount of DNA extracted (Rogstad,
et al., Plant Mol. Biol. Rep. 19:353-359 (2001)). When the
concentration of target DNA is low and the concentration of
interfering compounds (e.g., plant cell walls, pectin, other
sugars, proteins, secondary metabolites) is high, then additional
lysis steps (e.g., mechanical disruption, sonication, enzymatic
digestion) and/or additional purification steps (e.g., elution
column) may be required (Al-Samarrai and Schmid, Lett. Appl.
Microbiol. 30:53-56 (2000); Alaey, et al., Intl. J. Agr. Biol.
7:882-884 (2005); and Gonzalez-Mendoza, et al. (2010)). However,
when one uses orange tree leaves or more precisely, midribs of
orange tree leaves, which are rich in phloem vessels that harbor
the CLas bacteria, one is able to isolate and purify bacterial DNA
without using a sonicator, digestive enzymes or an elution column
because the concentration of CLas DNA is high in phloem vessels
compared to the concentration of the above described interfering
compounds.
[0005] In contrast to midribs of leaves, juice vesicles contain a
much lower amount of CLas cells (0.25% that of citrus leaf tissue)
(Li, et al., Plant Dis. 92:854-861 (2008); Liao and Burns, J. Expt.
Bot. 63:3307-3319 (2012)) and more interfering compounds (e.g.,
pectin, other sugars and secondary metabolites) (Baldwin et al.,
(2010)). Orange juice has extremely high pectin content compared to
leaves and even other juices, measured as galacturonic acid
(0.037-1.433 mg/g), depending on variety and harvest time (Baldwin,
et al. (2010)). The pectin and DNA often co-purify when using prior
art methods of DNA isolation (Scott and Playford, BioTechniques
20:974-978 (1996)). In addition, the other sugars in orange juice
(e.g., sucrose, glucose and fructose) interfere with DNA extraction
and isolation when using prior art isolation methods (Baldwin, et
al. (2010)). A number of DNA extraction methods have been developed
to avoid the co-precipitation of pectin/polysaccharides and DNA,
including the use of high NaCl concentration (Varma, et al. (2007))
in conjunction with modified cetyl trimethyl ammonium bromide
(CTAB) (Shepard and McLay, J. Plant Res. 124:311-314 (2011)),
phenol, ethylene glycol monoethyl ester and pectinase (Okada, et
al., Amer. J. Bot. 84:1236:1246 (1997); Rether, et al., Plant Mol.
Biol. Rep. 11:333-337 (1993); and Rogstad, et al. (2001)).
Unfortunately, although the CTAB plus high NaCL concentration
method works well for isolating and purifying CLas DNA from citrus
leaf tissue which has high CLas DNA concentration, this method does
not work well with citrus juice which has low CLas DNA
concentration and a high concentration of interfering
polysaccharides, especially pectin. Another method uses pectinase
to digest the pectin (Bai, et al., in press), however, only low
yields of DNA are obtained (see Table 1) perhaps because commercial
pectinase preparations contain low levels of DNase. Thus, it is
difficult to obtain high quantity and quality DNA (both
microorganism's DNA and plant DNA) from citrus juice. In fact,
prior attempts to isolate sufficient quantity of DNA at a
sufficient purity level from orange juice using Qiagen's DNeasy
Plant Mini Kit, Qiagen's mericon Food Kit, Qiagen's QIAamp DNA
Blood Mini Kit, or Promega's Wizard.RTM. Genomic DNA purification
kit were not successful (see infra).
[0006] As mentioned above, orange juice is rich in secondary
metabolites, including alkaloids, limonoids, and flavonoids, which
are not present in high concentrations in leaf tissue relative to
CLas DNA (Baldwin, et al. (2010); Justesen, et al., J. chromatogr.
A 799:101-110 (1998)). These secondary metabolites can inhibit PCR
reaction (Deng and Cliver, Intl. J. Food Microbiol. 54:155-162
(2000); Kim and Cho, Food Control 21:1419-1423 (2000); Ogunjimi and
Choudary, FEMS Immunol. Med. Microbiol. 23:213-220 (1999); Tsai and
Olson, Appl. Environ. Microbiol. 58:2292-2295 (1992); Wilson, I.
G., Appl. Environ. Microbiol. 63:3741-3751 (1997)). Appropriate ion
exchange columns or chelating agents can be used to remove these
contaminants (Saunders, G. C., DNA extraction, p 29-46. In: G. C.
Saunders and H. C. Parkers (eds.) Analytical molecular biology:
Quality and validation. Royal Soc. Chem. Cambridge). Kim and Cho
(2010) successfully removed PCR inhibitors from apple, grape, and
watermelon juices using Chelex treatment and Sephadex column
filtration. However, Kim and Cho were unsuccessful using this
method to isolate DNA free from secondary metabolites from orange
juice. In contrast, Li, et al. (J. Microbiol. Meth. 66:104-115
(2006)) showed that TaqMan.RTM. and other commercial "real-time"
PCR assays for CLas DNA were not inhibited when the samples were
extracted from citrus leaf tissue with the standard cetyl trimethyl
ammonium bromide (CTAB) method or the DNeasy.RTM. plant kit
(Qiagen, Gaithersburg, Md.), indicating that these qPCR assays with
a small amplicon (about 70 bp) perhaps are less vulnerable to
inhibitors of the amplification reaction in comparison with the
conventional PCR assays with a large amplicon (about 1200 bp)
(Mackay, et al., Nucl. Acid. Res. 30:1292-1305 (2002)). The
TaqMan.RTM. assay was also used with orange juice and successfully
amplified CLas DNA. However, as mentioned previously, these DNA
extraction methods yield too low a concentration of DNA to be of
practical use. Furthermore, standard deviations of the cycle
threshold (Ct) value in qPCT increases as the quantity of target
DNA decreases, indicating a higher risk of error at low target DNA
concentrations (Liu, et al., J. Microbiol. Meth. 65:21-31
(2006)).
[0007] In 2013, a new method for detecting CLas DNA in orange juice
was disclosed (Bai, et al., Proc. Fla. State Hort. Soc. 125:233-238
(2013)), however this method is too complicated for commercial use
by citrus processors, uses too much orange juice during the assay,
and is not consistently accurate because of the small amount of DNA
produced results in an increase of the standard deviation of Ct
value. As such, the need still exists for a simple, reliable assay
to detect CLas in citrus juice by assaying for CLas DNA in the
juice. Furthermore, this method enables one to isolate and purify
the DNA of other microorganisms in orange juice and other
juices.
[0008] Currently, orange juice quality is determined by a U.S.
Department of Agriculture grades as determined by an inspector who
tastes and grades the juice and by measurement of soluble solids,
titratable acidity and sometimes the bitter limonoid, limonin by
the juice processors. There is a need for a more quantitative assay
to determine whether the quality of a juice has been adversely
impacted by a microorganism, and if so, how much has the flavor
changed. This assay can also be used to determine if a juice is fit
for consumption.
BRIEF DESCRIPTION OF THE INVENTION
[0009] It is an object of this invention to have a method for
isolating nucleic acids from a liquid, the method involving the
steps of separating the solid components present in a sample of the
liquid from the liquid soluble components, lysing the cells present
in the solid components to release nucleic acids, proteins,
polysaccharides, lipids and non-polar material present in the
cells, separating the proteins, lipids, and non-polar material from
the nucleic acids and polysaccharides, separating the
polysaccharides from the nucleic acids, and washing the nucleic
acids. It is a further object of this invention that the liquid can
be a juice, cider, wine, or other liquid.
[0010] It is an object of this invention to have a method for
isolating nucleic acids from a liquid, the method involving the
steps of separating the solid components present in a sample of the
liquid from the liquid soluble components, lysing the cells present
in the solid components to release nucleic acids, proteins,
polysaccharides, lipids and non-polar material present in the
cells, separating the proteins, lipids, and non-polar material from
the nucleic acids and polysaccharides, separating the
polysaccharides from the nucleic acids, and washing the nucleic
acids. It is another object of this invention that the step of
separating the polysaccharides from the nucleic acids involves
mixing an aqueous solution of CTAB and salt with the
polysaccharides and nucleic acids such that the nucleic acids
precipitate out of solution of the aqueous solution and such that
the polysaccharides remain dissolved in the aqueous solution. It is
another object of this invention that the step of separating the
polysaccharides from the nucleic acids involves separating the
aqueous solution containing the dissolved polysaccharides from the
nucleic acids. It is a further object of this invention that the
liquid can be a juice, cider, wine, or other liquid.
[0011] It is an object of this invention to have a method for
isolating nucleic acids from a liquid, the method involving the
steps of separating the solid components present in a sample of the
liquid from the liquid soluble components, lysing the cells present
in the solid components to release nucleic acids, proteins,
polysaccharides, lipids and non-polar material present in the
cells, separating the proteins, lipids, and non-polar material from
the nucleic acids and polysaccharides, separating the
polysaccharides from the nucleic acids, and washing the nucleic
acids. It is another object of this invention that the step of
separating the polysaccharides from the nucleic acids involves
mixing an aqueous solution of CTAB and salt with the
polysaccharides and nucleic acids such that the nucleic acids
precipitate out of solution of the aqueous solution and such that
the polysaccharides remain dissolved in the aqueous solution. It is
another object of this invention that the step of separating the
polysaccharides from the nucleic acids involves separating the
aqueous solution containing the dissolved polysaccharides from the
nucleic acids. It is a further object of this invention that the
concentration of the salt in the aqueous solution is between
approximately 10 mM and approximately 400 mM. It is another object
of this invention that the salt concentration is between
approximately 100 mM and approximately 300 mM. It is yet another
object of this invention that the concentration of salt is
approximately 250 mM. It is a further object of this invention that
the liquid can be a juice, cider, wine, or other liquid.
[0012] It is an object of this invention to have a method for
isolating nucleic acids from a liquid, the method involving the
steps of separating the solid components present in a sample of the
liquid from the liquid soluble components, lysing the cells present
in the solid components to release nucleic acids, proteins,
polysaccharides, lipids and non-polar material present in the
cells, separating the proteins, lipids, and non-polar material from
the nucleic acids and polysaccharides, separating the
polysaccharides from the nucleic acids, and washing the nucleic
acids. It is another object of this invention that the mixture of
nucleic acids and polysaccharides contains salt. It is another
object of this invention that the step of separating the
polysaccharides from the nucleic acids involves mixing an aqueous
solution of CTAB with the polysaccharides nucleic acids and salt to
form a solution. It is another object of this invention that the
solution containing CTAB, salt, polysaccharides and nucleic acids
have a salt concentration such that the nucleic acids precipitate
out of solution of the solution and such that the polysaccharides
remain dissolved in the solution. It is another object of this
invention that the step of separating the polysaccharides from the
nucleic acids involves separating the solution containing the
dissolved polysaccharides from the nucleic acids. It is a further
object of this invention that the concentration of the salt in the
solution containing CTAB, salt, polysaccharides and nucleic acids
is between approximately 10 mM and approximately 400 mM. It is
another object of this invention that the salt concentration is
between approximately 100 mM and approximately 300 mM. It is yet
another object of this invention that the concentration of salt is
approximately 250 mM. It is a further object of this invention that
the liquid can be a juice, cider, wine, or other liquid.
[0013] It is an object of this invention to have an improved method
for isolating nucleic acids from a liquid having the steps of
separating the solid components present in a sample of the liquid
from the liquid soluble components, exposing the solid components
to a solution of Tris-base, EDTA, salt, PVP40,
.beta.-mercaptoethanol, NaOH, and a surfactant to dissolve the
solid components and lyse the cells; optionally heating the
solution to lyse the cells; adding chloroform to generate an
aqueous phase, an interphase, and organic phase, such that the
lipids and non-polar material dissolve in the organic phase and
such that denatured proteins are in the interface; separating the
aqueous phase from the organic phase and the interface; adding CTAB
to the aqueous phase, such that the nucleic acids present in the
aqueous phase precipitate out of solution from the aqueous phase;
optionally heating to assist in precipitation of the nucleic acids;
pelleting the precipitate; optionally resuspending the precipitate
in ethanol to remove any remaining CTAB yet allow the nucleic acids
to remain undissolved in the ethanol; and separating the nucleic
acids from the ethanol, such that the separating step involves
pelleting the nucleic acids and separating the ethanol from the
pelletted nucleic acids. It is a further object of this invention
that the step of exposing the solid components to a solution of
Tris-base, EDTA, salt, PVP40, .beta.-mercaptoethanol, NaOH, and a
surfactant to dissolve the solid components and lyse the cells
involves exposing the solid components to a first solution of
Tris-base, EDTA, salt, PVP40, and .beta.-mercaptoethanol, and then
adding NaOH and the surfactant to the first solution.
[0014] It is an object of this invention to have an improved method
for isolating nucleic acids from a liquid having the steps of
separating the solid components present in a sample of the liquid
from the liquid soluble components, exposing the solid components
to a solution of Tris-base, EDTA, salt, PVP40,
.beta.-mercaptoethanol, NaOH, and a surfactant to dissolve the
solid components and lyse the cells; optionally heating the
solution to lyse the cells; adding chloroform to generate an
aqueous phase, an interphase, and organic phase, such that the
lipids and non-polar material dissolve in the organic phase and
such that denatured proteins are in the interface; separating the
aqueous phase from the organic phase and the interface; adding CTAB
to the aqueous phase, such that the nucleic acids present in the
aqueous phase precipitate out of solution from the aqueous phase;
optionally heating to assist in precipitation of the nucleic acids;
pelleting the precipitate; optionally resuspending the precipitate
in ethanol to remove any remaining CTAB yet allow the nucleic acids
to remain undissolved in the ethanol; and separating the nucleic
acids from the ethanol, such that the separating step involves
pelleting the nucleic acids and separating the ethanol from the
pelletted nucleic acids. It is a further object of this invention
that the step of exposing the solid components to a solution of
Tris-base, EDTA, salt, PVP40, .beta.-mercaptoethanol, NaOH, and a
surfactant to dissolve the solid components and lyse the cells
involves exposing the solid components to a first solution of
Tris-base, EDTA, salt, PVP40, and .beta.-mercaptoethanol, and then
adding NaOH and the surfactant to the first solution. It is a
further object of the invention that the salt concentration of the
aqueous phase after adding CTAB is between approximately 100 mM and
approximately 300 mM. It is yet another object of this invention
that the salt concentration of the aqueous phase after adding CTAB
is approximately 250 mM. It is a further object of this invention
that the liquid can be a juice, cider, wine, or other liquid.
[0015] It is another object of this invention to have a method for
determining the quality of a juice or cider having the steps of
exposing DNA obtained from the juice or cider to a first primer, a
second primer, and to a fluorescent composition, such that the
sequence of the first primer and the sequence of the second primer
are complementary to specific sequences in a microorganism's DNA
and bind to the specific sequences in the microorganism's DNA;
amplifying the DNA to generate an amplicon such that the amplicon
has the first primer's sequence at one end of the amplicon and the
reverse complement of the second primer's sequence at the other end
of said amplicon; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values wherein
the one or more known Ct values indicate the quality of the juice
or cider. It is another object of the invention that the quality
can be flavor, smell, color, safety, or a combination thereof.
[0016] It is another object of this invention to have a method for
determining the quality of a juice or cider having the steps of
exposing DNA obtained from the juice or cider to a first primer, a
second primer, and to a fluorescent composition, such that the
sequence of the first primer and the sequence of the second primer
are complementary to specific sequences in a microorganism's DNA
and bind to the specific sequences in the microorganism's DNA;
amplifying the DNA to generate an amplicon such that the amplicon
has the first primer's sequence at one end of the amplicon and the
reverse complement of the second primer's sequence at the other end
of said amplicon; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values wherein
the one or more known Ct values indicate the quality of the juice
or cider. When the quality of the juice or cider is flavor, the
amount of DNA in the sample (as can be indicated by the Ct value of
the amplified DNA), can be correlated to a negative effect on the
taste/flavor of the juice or cider. One can then grade the favor
quality of the juice by knowing the Ct values and having them
compared to one or more known Ct values when the one or more known
Ct values indicates the flavor quality of the juice. For instance,
if a certain Ct value indicates a poor flavor quality, the juice
can be graded accordingly. Typical poor flavor quality descriptors
associated with a negative or poor taste of orange juice, for
example, include sourness, bitterness or having a metallic
taste.
[0017] It is another object of this invention to have a method for
determining the quality of a juice or cider having the steps of
exposing DNA obtained from the juice or cider to a first primer, a
second primer, and to a fluorescent composition, such that the
sequence of the first primer and the sequence of the second primer
are complementary to specific sequences in a microorganism's DNA
and bind to the specific sequences in the microorganism's DNA;
amplifying the DNA to generate an amplicon such that the amplicon
has the first primer's sequence at one end of the amplicon and the
reverse complement of the second primer's sequence at the other end
of said amplicon; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values wherein
the one or more known Ct values indicate the quality of the juice
or cider. It is a further object of this invention that the
fluorescent composition be either an intercalating dye or a
composition of a probe linked to a fluorescent dye and a quencher
dye such that the probe's sequence is between approximately 15
contiguous nucleotides and approximately 45 contiguous nucleotides
of the amplicon's sequence or the reverse complement of the
amplicon's sequence. It is another object of the invention that the
quality can be flavor, smell, color, safety, or a combination
thereof.
[0018] It is an object of this invention to have a method for
determining the quality of a juice or cider having the steps of
exposing DNA obtained from the juice or cider to a first primer, a
second primer, and to a fluorescent composition, such that the
sequence of the first primer and the sequence of the second primer
are complementary to specific sequences in a microorganism's DNA
and bind to the specific sequences in the microorganism's DNA;
amplifying the DNA to generate an amplicon such that the amplicon
has the first primer's sequence at one end of the amplicon and the
reverse complement of the second primer's sequence at the other end
of said amplicon; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values wherein
the one or more known Ct values indicate the quality of the juice
or cider. It is another object of the invention that the quality
can be flavor, smell, color, safety, or a combination thereof. It
is another object of this invention that the microorganism is CLas
or CLam, that the first primer's sequence is SEQ ID NO: 1, that the
second primer's sequence is SEQ ID NO: 2, and that when the CT
value is approximately 25 or less, or approximately 28 or less, or
approximately 30 or less, the juice or cider's flavor quality is a
poor flavor quality. It is an optional object of this invention
that the fluorescent composition be either an intercalating dye or
a composition of a probe linked to a fluorescent dye and a quencher
dye such that the probe's sequence is between approximately 15
contiguous nucleotides and approximately 45 contiguous nucleotides
of the amplicon's sequence or the reverse complement of the
amplicon's sequence.
[0019] It is an object of this invention to have a method for
determining the quality of a juice or cider having the steps of
isolating nucleic acids from the juice or cider, exposing isolated
DNA to a first primer, a second primer, and to a fluorescent
composition, such that the sequence of the first primer and the
sequence of the second primer are complementary to specific
sequences in a microorganism's DNA and bind to the specific
sequences in the microorganism's DNA; amplifying the DNA to
generate an amplicon such that the amplicon has the first primer's
sequence at one end of the amplicon and the reverse complement of
the second primer's sequence at the other end of said amplicon;
determining the Ct value of the amplified DNA; and comparing the Ct
value to one or more known Ct values wherein the one or more known
Ct values indicate the quality of the juice or cider. It is another
object of the invention that the quality can be flavor, smell,
color, safety, or a combination thereof. It is another object of
this invention of that the step of isolating nucleic acids from the
juice or cider involves separating the solid components present in
a sample of the juice or cider from the juice or cider, lysing the
cells present in the solid components to release nucleic acids,
proteins, polysaccharides, lipids and non-polar material present in
the cells, separating the proteins, lipids, and non-polar material
from the nucleic acids and polysaccharides, separating the
polysaccharides from the nucleic acids, and washing the nucleic
acids. It is another object of this invention that the
microorganism is CLas or CLam, that the first primer's sequence is
SEQ ID NO: 1, that the second primer's sequence is SEQ ID NO: 2,
and that when the CT value is approximately 25 or less, or
approximately 28 or less, or approximately 30 or less, the juice or
cider's flavor quality is a poor flavor quality. It is an optional
object of this invention that the fluorescent composition be either
an intercalating dye or a composition of a probe linked to a
fluorescent dye and a quencher dye such that the probe's sequence
is between approximately 15 contiguous nucleotides and
approximately 45 contiguous nucleotides of the amplicon's sequence
or the reverse complement of the amplicon's sequence.
[0020] It is an object of this invention to have a method for
determining the quality of a juice or cider having the steps of
isolating nucleic acids from the juice or cider, exposing isolated
DNA to a first primer, a second primer, and to a fluorescent
composition, such that the sequence of the first primer and the
sequence of the second primer are complementary to specific
sequences in a microorganism's DNA and bind to the specific
sequences in the microorganism's DNA; amplifying the DNA to
generate an amplicon such that the amplicon has the first primer's
sequence at one end of the amplicon and the reverse complement of
the second primer's sequence at the other end of said amplicon;
determining the Ct value of the amplified DNA; and comparing the Ct
value to one or more known Ct values wherein the one or more known
Ct values indicate the quality of the juice or cider. It is another
object of the invention that the quality can be flavor, smell,
color, safety, or a combination thereof. It is another object of
this invention of that the step of isolating nucleic acids from the
juice or cider involves separating the solid components present in
a sample of the juice or cider from the juice or cider, lysing the
cells present in the solid components to release nucleic acids,
proteins, polysaccharides, lipids and non-polar material present in
the cells, separating the proteins, lipids, and non-polar material
from the nucleic acids and polysaccharides, mixing an aqueous
solution of CTAB and salt with the polysaccharide and nucleic acids
such that the nucleic acids precipitate out of the aqueous solution
and the polysaccharides remain dissolved in the aqueous solution,
separating aqueous solution containing the dissolved
polysaccharides from the precipitated nucleic acids, and washing
the precipitated nucleic acids. It is another object of this
invention that the microorganism is CLas or CLam, that the first
primer's sequence is SEQ ID NO: 1, that the second primer's
sequence is SEQ ID NO: 2, and that when the CT value is
approximately 25 or less, or approximately 28 or less, or
approximately 30 or less, the juice or cider's flavor quality is a
poor flavor quality. It is an optional object of this invention
that the fluorescent composition be either an intercalating dye or
a composition of a probe linked to a fluorescent dye and a quencher
dye such that the probe's sequence is between approximately 15
contiguous nucleotides and approximately 45 contiguous nucleotides
of the amplicon's sequence or the reverse complement of the
amplicon's sequence.
[0021] It is an object of this invention to have a method for
determining the quality of a juice or cider having the steps of
exposing DNA obtained from the juice or cider to a first primer, a
second primer, and to a fluorescent composition, such that the
sequence of the first primer and the sequence of the second primer
are complementary to specific sequences in a microorganism's DNA
and bind to the specific sequences in the microorganism's DNA;
amplifying the DNA to generate an amplicon such that the amplicon
has the first primer's sequence at one end of the amplicon and the
reverse complement of the second primer's sequence at the other end
of said amplicon; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values wherein
the one or more known Ct values indicate the quality of the juice
or cider. It is another object of the invention that the quality
can be flavor, smell, color, safety, or a combination thereof. It
is another object of this invention that the microorganism is CLas,
that the first primer's sequence is SEQ ID NO: 3, that the second
primer's sequence is SEQ ID NO: 4, and that when the CT value is
approximately 30 or less, approximately 32 or less, or
approximately 35 or less, the juice or cider's flavor quality is a
poor flavor quality. It is an optional object of this invention
that the fluorescent composition be either an intercalating dye or
a composition of a probe linked to a fluorescent dye and a quencher
dye such that the probe's sequence is between approximately 15
contiguous nucleotides and approximately 45 contiguous nucleotides
of the amplicon's sequence or the reverse complement of the
amplicon's sequence.
[0022] It is an object of this invention to have a method for
determining the quality of a juice or cider having the steps of
isolating nucleic acids from the juice or cider, exposing isolated
DNA to a first primer, a second primer, and to a fluorescent
composition, such that the sequence of the first primer and the
sequence of the second primer are complementary to specific
sequences in a microorganism's DNA and bind to the specific
sequences in the microorganism's DNA; amplifying the DNA to
generate an amplicon such that the amplicon has the first primer's
sequence at one end of the amplicon and the reverse complement of
the second primer's sequence at the other end of said amplicon;
determining the Ct value of the amplified DNA; and comparing the Ct
value to one or more known Ct values wherein the one or more known
Ct values indicate the quality of the juice or cider. It is another
object of the invention that the quality can be flavor, smell,
color, safety, or a combination thereof. It is another object of
this invention of that the step of isolating nucleic acids from the
juice or cider involves separating the solid components present in
a sample of the juice or cider from the juice or cider, lysing the
cells present in the solid components to release nucleic acids,
proteins, polysaccharides, lipids and non-polar material present in
the cells, separating the proteins, lipids, and non-polar material
from the nucleic acids and polysaccharides, separating the
polysaccharides from the nucleic acids, and washing the nucleic
acids. It is another object of this invention that the
microorganism is CLas, that the first primer's sequence is SEQ ID
NO: 3, that the second primer's sequence is SEQ ID NO: 4, and that
when the CT value is approximately 30 or less, or approximately 32
or less, or approximately 35 or less, the juice or cider's flavor
quality is a poor flavor quality. It is an optional object of this
invention that the fluorescent composition be either an
intercalating dye or a composition of a probe linked to a
fluorescent dye and a quencher dye such that the probe's sequence
is between approximately 15 contiguous nucleotides and
approximately 45 contiguous nucleotides of the amplicon's sequence
or the reverse complement of the amplicon's sequence.
[0023] It is an object of this invention to have a method for
determining the quality of a juice or cider having the steps of
isolating nucleic acids from the juice or cider, exposing isolated
DNA to a first primer, a second primer, and to a fluorescent
composition, such that the sequence of the first primer and the
sequence of the second primer are complementary to specific
sequences in a microorganism's DNA and bind to the specific
sequences in the microorganism's DNA; amplifying the DNA to
generate an amplicon such that the amplicon has the first primer's
sequence at one end of the amplicon and the reverse complement of
the second primer's sequence at the other end of said amplicon;
determining the Ct value of the amplified DNA; and comparing the Ct
value to one or more known Ct values wherein the one or more known
Ct values indicate the quality of the juice or cider. It is another
object of the invention that the quality can be flavor, smell,
color, safety, or a combination thereof. It is another object of
this invention of that the step of isolating nucleic acids from the
juice or cider involves separating the solid components present in
a sample of the juice or cider from the juice or cider, lysing the
cells present in the solid components to release nucleic acids,
proteins, polysaccharides, lipids and non-polar material present in
the cells, separating the proteins, lipids, and non-polar material
from the nucleic acids and polysaccharides, mixing an aqueous
solution of CTAB and salt with the polysaccharide and nucleic acids
such that the nucleic acids precipitate out of the aqueous solution
and the polysaccharides remain dissolved in the aqueous solution,
separating aqueous solution containing the dissolved
polysaccharides from the precipitated nucleic acids, and washing
the precipitated nucleic acids. It is another object of this
invention that the microorganism is CLas, that the first primer's
sequence is SEQ ID NO: 3, that the second primer's sequence is SEQ
ID NO: 4, and that when the CT value is approximately 30 or less,
or approximately 32 or less, or approximately 35 or less, the juice
or cider's flavor quality is a poor flavor quality. It is an
optional object of this invention that the fluorescent composition
be either an intercalating dye or a composition of a probe linked
to a fluorescent dye and a quencher dye such that the probe's
sequence is between approximately 15 contiguous nucleotides and
approximately 45 contiguous nucleotides of the amplicon's sequence
or the reverse complement of the amplicon's sequence.
[0024] It is an object of this invention to have a method for
determining the quality of a juice or cider having the steps of
exposing DNA obtained from the juice or cider to a first primer, a
second primer, and to a fluorescent composition, such that the
sequence of the first primer and the sequence of the second primer
are complementary to specific sequences in a microorganism's DNA
and bind to the specific sequences in the microorganism's DNA;
amplifying the DNA to generate an amplicon such that the amplicon
has the first primer's sequence at one end of the amplicon and the
reverse complement of the second primer's sequence at the other end
of said amplicon; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values wherein
the one or more known Ct values indicate the quality of the juice
or cider. It is another object of the invention that the quality
can be flavor, smell, color, safety, or a combination thereof. It
is another object of this invention that the DNA is be obtained
from a lactic acid bacteria, an acetic acid bacteria,
Alicyclobacillus spp., Zygosaccharomyces spp., Rhodotorula ruba,
Escherichia coli, Listeria spp., Shigella spp., Salmonella spp.,
Klebsiella spp., Candidatus Liberibacter asiaticus (CLas),
Candidatus Liberibacter africanus (CLaf), and Candidatus
Liberibacter americanus (CLam).
[0025] It is an object of this invention to have a method for
identifying the quantity of a microorganism in a liquid having the
steps of exposing DNA obtained from the liquid to a first primer, a
second primer, and to a fluorescent composition, such that the
first primer's sequence and the second primer's sequence are
complementary to specific sequences in a microorganism's DNA and
bind to those specific sequences; amplifying the DNA to generate an
amplicon such that the amplicon's sequence at one end is the same
as the first primer's sequence and the amplicon's sequence at the
other end is the same as the reverse complement of the second
primer's sequence; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values such that
the one or more known Ct values indicate the quantity of the
microorganism in the liquid. It is a further object of this
invention that the liquid can be a juice, cider, wine, or other
liquid.
[0026] It is another object of this invention to have a method for
identifying the quantity of a microorganism in a liquid having the
steps of exposing DNA obtained from the liquid to a first primer, a
second primer, and to a fluorescent composition, such that the
first primer's sequence and the second primer's sequence are
complementary to specific sequences in a microorganism's DNA and
bind to those specific sequences; amplifying the DNA to generate an
amplicon such that the amplicon's sequence at one end is the same
as the first primer's sequence and the amplicon's sequence at the
other end is the same as the reverse complement of the second
primer's sequence; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values such that
the one or more known Ct values indicate the quantity of the
microorganism in the liquid. It is a further object of this
invention that the liquid can be a juice, cider, wine, or other
liquid. It is a further object of this invention that the
fluorescent composition be either an intercalating dye or a
composition of a probe linked to a fluorescent dye and a quencher
dye, and that the probe's sequence is between approximately 15
contiguous nucleotides and approximately 45 contiguous nucleotides
of the amplicon's sequence or the reverse complement of the
amplicon's sequence.
[0027] It is an object of this invention to have a method for
identifying the quantity of a microorganism in a liquid having the
steps of exposing DNA obtained from the liquid to a first primer, a
second primer, and to a fluorescent composition, such that the
first primer's sequence and the second primer's sequence are
complementary to specific sequences in a microorganism's DNA and
bind to those specific sequences; amplifying the DNA to generate an
amplicon such that the amplicon's sequence at one end is the same
as the first primer's sequence and the amplicon's sequence at the
other end is the same as the reverse complement of the second
primer's sequence; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values such that
the one or more known Ct values indicate the quantity of the
microorganism in the liquid. It is a further object of this
invention that the liquid can be a juice, cider, wine, or other
liquid. It is another object of this invention that the
microorganism be a lactic acid bacteria, an acetic acid bacteria,
Alicyclobacillus spp., Zygosaccharomyces spp., Rhodotorula ruba,
Escherichia coli, Listeria spp., Shigella spp., Salmonella spp.,
Klebsiella spp., Candidatus Liberibacter asiaticus (CLas),
Candidatus Liberibacter africanus (CLaf), and Candidatus
Liberibacter americanus (CLam).
[0028] It is an object of this invention to have a method for
identifying the quantity of a microorganism in a liquid having the
steps of exposing DNA obtained from the liquid to a first primer, a
second primer, and to a fluorescent composition, such that the
first primer's sequence and the second primer's sequence are
complementary to specific sequences in a microorganism's DNA and
bind to those specific sequences; amplifying the DNA to generate an
amplicon such that the amplicon's sequence at one end is the same
as the first primer's sequence and the amplicon's sequence at the
other end is the same as the reverse complement of the second
primer's sequence; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values such that
the one or more known Ct values indicate the quantity of the
microorganism in the liquid. It is a further object of this
invention that the liquid can be a juice, cider, wine, or other
liquid. It is another object of this invention that the
microorganism be a lactic acid bacteria, an acetic acid bacteria,
Alicyclobacillus spp., Zygosaccharomyces spp., Rhodotorula ruba,
Escherichia coli, Listeria spp., Shigella spp., Salmonella spp.,
Klebsiella spp., Candidatus Liberibacter asiaticus (CLas),
Candidatus Liberibacter africanus (CLaf), and Candidatus
Liberibacter americanus (CLam). It is a further object of this
invention that the fluorescent composition is either an
intercalating dye or a composition of a probe linked to a
fluorescent dye and a quencher dye, and that the probe's sequence
is between approximately 15 contiguous nucleotides and
approximately 45 contiguous nucleotides of the amplicon's sequence
or the reverse complement of the amplicon's sequence.
[0029] It is an object of this invention to have a method for
identifying the quantity of CLas or CLam in a liquid having the
steps of exposing DNA obtained from the liquid to a first primer, a
second primer, and to a fluorescent composition, such that the
first primer's sequence and the second primer's sequence are
complementary to specific sequences in CLas' DNA or CLam's DNA and
bind to those specific sequences; amplifying the DNA to generate an
amplicon such that the amplicon's sequence at one end is the same
as the first primer's sequence and the amplicon's sequence at the
other end is the same as the reverse complement of the second
primer's sequence; determining the Ct value of the amplified DNA;
and comparing the Ct value to one or more known Ct values such that
the one or more known Ct values indicate the quantity of the
microorganism in the liquid. It is a further object of this
invention that the liquid can be a juice, cider, wine, or other
liquid. It is another object of this invention that the first
primer's sequence is SEQ ID NO: 1 and the second primer's sequence
is SEQ ID NO: 2, and that which the Ct value is approximately 25 or
less, or approximately 28 or less, or approximately 30 or less,
then the amount of CLas or CLam in the liquid is too high. It is
optional to have another object of this invention that the
fluorescent composition is either an intercalating dye or a
composition of a probe linked to a fluorescent dye and a quencher
dye, and that the probe's sequence is between approximately 15
contiguous nucleotides and approximately 45 contiguous nucleotides
of the amplicon's sequence or the reverse complement of the
amplicon's sequence.
[0030] It is an object of this invention to have a method for
identifying the quantity of CLas or CLam in a liquid having the
steps of isolating nucleic acids from the liquid, exposing DNA
obtained from the liquid to a first primer, a second primer, and to
a fluorescent composition, such that the first primer's sequence
and the second primer's sequence are complementary to specific
sequences in CLas' DNA or CLam's DNA and bind to those specific
sequences; amplifying the DNA to generate an amplicon such that the
amplicon's sequence at one end is the same as the first primer's
sequence and the amplicon's sequence at the other end is the same
as the reverse complement of the second primer's sequence;
determining the Ct value of the amplified DNA; and comparing the Ct
value to one or more known Ct values such that the one or more
known Ct values indicate the quantity of the microorganism in the
liquid. It is a further object of this invention that the liquid
can be a juice, cider, wine, or other liquid. It is another object
of this invention that the first primer's sequence is SEQ ID NO: 1
and the second primer's sequence is SEQ ID NO: 2, and that which
the Ct value is approximately 25 or less, approximately 28 or less,
or approximately 30 or less, then the amount of CLas or CLam in the
liquid is too high. It is a further object of this invention that
the step of isolating nucleic acids from the liquid involves
separating the solid components present in a sample of the liquid
from the liquid, lysing the cells present in the solid components
to release nucleic acids, proteins, polysaccharides, lipids and
non-polar material present in the cells, separating the proteins,
lipids, and non-polar material from the nucleic acids and
polysaccharides, separating the polysaccharides from the nucleic
acids, and washing the nucleic acids. It is optional to have
another object of this invention that the fluorescent composition
is either an intercalating dye or a composition of a probe linked
to a fluorescent dye and a quencher dye, and that the probe's
sequence is between approximately 15 contiguous nucleotides and
approximately 45 contiguous nucleotides of the amplicon's sequence
or the reverse complement of the amplicon's sequence.
[0031] It is an object of this invention to have a method for
identifying the quantity of CLas or CLam in a liquid having the
steps of isolating nucleic acids from the liquid, exposing DNA
obtained from the liquid to a first primer, a second primer, and to
a fluorescent composition, such that the first primer's sequence
and the second primer's sequence are complementary to specific
sequences in CLas' DNA or CLam's DNA and bind to those specific
sequences; amplifying the DNA to generate an amplicon such that the
amplicon's sequence at one end is the same as the first primer's
sequence and the amplicon's sequence at the other end is the same
as the reverse complement of the second primer's sequence;
determining the Ct value of the amplified DNA; and comparing the Ct
value to one or more known Ct values such that the one or more
known Ct values indicate the quantity of the microorganism in the
liquid. It is a further object of this invention that the liquid
can be a juice, cider, wine, or other liquid. It is another object
of this invention that the first primer's sequence is SEQ ID NO: 1
and the second primer's sequence is SEQ ID NO: 2, and that which
the Ct value is approximately 25 or less, approximately 28 or less,
or approximately 30 or less, then the amount of CLas or CLam in the
liquid is too high. It is another object of this invention of that
the step of isolating nucleic acids from the liquid involves
separating the solid components present in a sample of the liquid
from the liquid soluble components, lysing the cells present in the
solid components to release nucleic acids, proteins,
polysaccharides, lipids and non-polar material present in the
cells, separating the proteins, lipids, and non-polar material from
the nucleic acids and polysaccharides, mixing an aqueous solution
of CTAB and salt with the polysaccharide and nucleic acids such
that the nucleic acids precipitate out of the aqueous solution and
the polysaccharides remain dissolved in the aqueous solution,
separating aqueous solution containing the dissolved
polysaccharides from the precipitated nucleic acids, and washing
the precipitated nucleic acids. It is optional to have another
object of this invention that the fluorescent composition is either
an intercalating dye or a composition of a probe linked to a
fluorescent dye and a quencher dye, and that the probe's sequence
is between approximately 15 contiguous nucleotides and
approximately 45 contiguous nucleotides of the amplicon's sequence
or the reverse complement of the amplicon's sequence.
[0032] It is an object of this invention to have a method for
identifying the quantity of CLas in a liquid having the steps of
exposing DNA obtained from the liquid to a first primer, a second
primer, and to a fluorescent composition, such that the first
primer's sequence and the second primer's sequence are
complementary to specific sequences in CLas' DNA and bind to those
specific sequences; amplifying the DNA to generate an amplicon such
that the amplicon's sequence at one end is the same as the first
primer's sequence and the amplicon's sequence at the other end is
the same as the reverse complement of the second primer's sequence;
determining the Ct value of the amplified DNA; and comparing the Ct
value to one or more known Ct values such that the one or more
known Ct values indicate the quantity of the microorganism in the
liquid. It is a further object of this invention that the liquid
can be a juice, cider, wine, or other liquid. It is another object
of this invention that the first primer's sequence is SEQ ID NO: 3
and the second primer's sequence is SEQ ID NO: 4, and that which
the Ct value is approximately 30 or less, approximately 32 or less,
or approximately 35 or less, then the amount of CLas in the liquid
is too high. It is optional to have another object of this
invention that the fluorescent composition is either an
intercalating dye or a composition of a probe linked to a
fluorescent dye and a quencher dye, and that the probe's sequence
is between approximately 15 contiguous nucleotides and
approximately 45 contiguous nucleotides of the amplicon's sequence
or the reverse complement of the amplicon's sequence.
[0033] It is an object of this invention to have a method for
identifying the quantity of CLas in a liquid having the steps of
isolating nucleic acids from the liquid, exposing DNA obtained from
the liquid to a first primer, a second primer, and to a fluorescent
composition, such that the first primer's sequence and the second
primer's sequence are complementary to specific sequences in CLas'
DNA and bind to those specific sequences; amplifying the DNA to
generate an amplicon such that the amplicon's sequence at one end
is the same as the first primer's sequence and the amplicon's
sequence at the other end is the same as the reverse complement of
the second primer's sequence; determining the Ct value of the
amplified DNA; and comparing the Ct value to one or more known Ct
values such that the one or more known Ct values indicate the
quantity of the microorganism in the liquid. It is a further object
of this invention that the liquid can be a juice, cider, wine, or
other liquid. It is another object of this invention that the first
primer's sequence is SEQ ID NO: 3 and the second primer's sequence
is SEQ ID NO: 4, and that which the Ct value is approximately 30 or
less, approximately 32 or less, or approximately 35 or less, then
the amount of CLas in the liquid is too high. It is a further
object of this invention that the step of isolating nucleic acids
from the liquid involves separating the solid components present in
a sample of the liquid from the liquid soluble components, lysing
the cells present in the solid components to release nucleic acids,
proteins, polysaccharides, lipids and non-polar material present in
the cells, separating the proteins, lipids, and non-polar material
from the nucleic acids and polysaccharides, separating the
polysaccharides from the nucleic acids, and washing the nucleic
acids. It is optional to have another object of this invention that
the fluorescent composition is either an intercalating dye or a
composition of a probe linked to a fluorescent dye and a quencher
dye, and that the probe's sequence is between approximately 15
contiguous nucleotides and approximately 45 contiguous nucleotides
of the amplicon's sequence or the reverse complement of the
amplicon's sequence.
[0034] It is an object of this invention to have a method for
identifying the quantity of CLas in a liquid having the steps of
isolating nucleic acids from the liquid, exposing DNA obtained from
the liquid to a first primer, a second primer, and to a fluorescent
composition, such that the first primer's sequence and the second
primer's sequence are complementary to specific sequences in CLas'
DNA and bind to those specific sequences; amplifying the DNA to
generate an amplicon such that the amplicon's sequence at one end
is the same as the first primer's sequence and the amplicon's
sequence at the other end is the same as the reverse complement of
the second primer's sequence; determining the Ct value of the
amplified DNA; and comparing the Ct value to one or more known Ct
values such that the one or more known Ct values indicate the
quantity of the microorganism in the liquid. It is a further object
of this invention that the liquid can be a juice, cider, wine, or
other liquid. It is another object of this invention that the first
primer's sequence is SEQ ID NO: 3 and the second primer's sequence
is SEQ ID NO: 4, and that which the Ct value is approximately 30 or
less, approximately 32 or less, or approximately 35 or less, then
the amount of CLas in the liquid is too high. It is another object
of this invention of that the step of isolating nucleic acids from
the liquid involves separating the solid components present in a
sample of the liquid from the liquid soluble components, lysing the
cells present in the solid components to release nucleic acids,
proteins, polysaccharides, lipids and non-polar material present in
the cells, separating the proteins, lipids, and non-polar material
from the nucleic acids and polysaccharides, mixing an aqueous
solution of CTAB and salt with the polysaccharide and nucleic acids
such that the nucleic acids precipitate out of the aqueous solution
and the polysaccharides remain dissolved in the aqueous solution,
separating aqueous solution containing the dissolved
polysaccharides from the precipitated nucleic acids, and washing
the precipitated nucleic acids. It is optional to have another
object of this invention that the fluorescent composition is either
an intercalating dye or a composition of a probe linked to a
fluorescent dye and a quencher dye, and that the probe's sequence
is between approximately 15 contiguous nucleotides and
approximately 45 contiguous nucleotides of the amplicon's sequence
or the reverse complement of the amplicon's sequence.
[0035] It is an object of this invention to have a method for
determining if a juice or cider is unsafe for consumption having
the steps of exposing DNA obtained from the juice or cider to a
first primer, a second primer, and to a fluorescent composition,
such that the first primer's sequence and the second primer's
sequence are complementary to specific sequences in a
microorganism's DNA and bind to those specific sequences;
amplifying the DNA to generate an amplicon such that the amplicon's
sequence at one end is the same as the first primer's sequence and
the amplicon's sequence at the other end is the same as the reverse
complement of the second primer's sequence; determining the Ct
value of the amplified DNA; and comparing the Ct value to one or
more known Ct values such that the one or more known Ct values
indicate the juice or cider contain too much of the microorganism
and is unsafe for consumption.
[0036] It is an object of this invention to have a method for
determining if a juice or cider is unsafe for consumption having
the steps of exposing DNA obtained from the juice or cider to a
first primer, a second primer, and to a fluorescent composition,
such that the first primer's sequence and the second primer's
sequence are complementary to specific sequences in a
microorganism's DNA and bind to those specific sequences;
amplifying the DNA to generate an amplicon such that the amplicon's
sequence at one end is the same as the first primer's sequence and
the amplicon's sequence at the other end is the same as the reverse
complement of the second primer's sequence; determining the Ct
value of the amplified DNA; and comparing the Ct value to one or
more known Ct values such that the one or more known Ct values
indicate the juice or cider contain too much of the microorganism
and is unsafe for consumption. It is a further object of this
invention that the fluorescent composition is either an
intercalating dye or a composition of a probe linked to a
fluorescent dye and a quencher dye, and that the probe's sequence
is between approximately 15 contiguous nucleotides and
approximately 45 contiguous nucleotides of the amplicon's sequence
or the reverse complement of the amplicon's sequence.
[0037] It is an object of this invention to have a method for
determining if a juice or cider is unsafe for consumption having
the steps of exposing DNA obtained from the juice or cider to a
first primer, a second primer, and to a fluorescent composition,
such that the first primer's sequence and the second primer's
sequence are complementary to specific sequences in a
microorganism's DNA and bind to those specific sequences;
amplifying the DNA to generate an amplicon such that the amplicon's
sequence at one end is the same as the first primer's sequence and
the amplicon's sequence at the other end is the same as the reverse
complement of the second primer's sequence; determining the Ct
value of the amplified DNA; and comparing the Ct value to one or
more known Ct values such that the one or more known Ct values
indicate the juice or cider contain too much of the microorganism
and is unsafe for consumption. It is a further object of this
invention that the microorganism can be a lactic acid bacteria, an
acetic acid bacteria, Alicyclobacillus spp., Zygosaccharomyces
spp., Rhodotorula ruba, Escherichia coli, Listeria spp., Shigella
spp., Salmonella spp., Klebsiella spp., Candidatus Liberibacter
asiaticus (CLas), Candidatus Liberibacter africanus (CLaf), and
Candidatus Liberibacter americanus (CLam).
[0038] It is an object of this invention to have a method for
determining the quality of a juice or cider having the steps of
quantifying the amount of nucleic acids in the juice or cider
belonging to one or more microorganisms that impacts the quality of
the juice or cider by being present in the juice or cider or by
infecting the plant from which the juice or cider is produced, and
comparing the amount of nucleic acids in the juice or cider that
belong to one or more microorganisms with known values that
indicate the quality of the juice or cider. It is another object of
the invention that the quantifying step includes amplifying the
nucleic acids in the juice or cider belonging to the one or more
microorganisms and measuring the amount of the amplified nucleic
acids. It is another object of the invention that the quality can
be flavor, smell, color, safety, or a combination thereof.
[0039] It is another object of this invention to have a method of
determining if the quantity of a microorganism is too high in a
juice or cider having the steps of quantifying the amount of the
microorganism's nucleic acids in the juice or cider and comparing
the amount of the microorganism's nucleic acids present in the
juice or cider with known values that indicate the quantity of the
microorganism. It is yet a further object of the invention that the
quantifying step includes amplifying the microorganism's nucleic
acids in the juice or cider and measuring the amount of the
amplified nucleic acids.
[0040] It is a further object of this invention to have a method of
determining if a juice or cider is unsafe for consumption by
quantifying the amount of one or more microorganisms' nucleic acids
present in the juice or cider and comparing the amount of the one
or more microorganisms' nucleic acids present in the juice or cider
with known values that indicate the safety of the juice or cider
for consumption. It is yet another object of the invention that the
quantifying step includes amplifying the one or more
microorganism's nucleic acids in the juice or cider and measuring
the amount of the amplified nucleic acids.
BRIEF DESCRIPTION OF THE FIGURES
[0041] FIG. 1 illustrates a Nano-Drop Spectrophotometer
(ThermoFisher Scientific, Waltham, Mass.) reading of isolated and
purified DNA extracted from 0.5 ml orange juice and finally
dissolved in 30 .mu.l of water.
[0042] FIG. 2A illustrates the Ct value vs. umami taste score. FIG.
2B illustrates the Ct value vs. orange flavor score. FIG. 2C
illustrates the Ct value vs. sweet taste score.
[0043] FIG. 3A illustrates the Ct value vs. HLB off-flavor score.
FIG. 3B illustrates the Ct value vs. the sum of desirable
descriptor scores. FIG. 3C illustrates the Ct value vs. the sum of
undesirable descriptor scores.
[0044] FIG. 4 illustrates the Ct value of E. coli amplified DNA in
orange juice vs. the number of E. coli cells per ml of juice (in
log.sub.10).
[0045] FIG. 5 illustrates the Ct value of Alicyclobacillus
acidoterrestris amplified DNA in orange juice vs. the number of A.
acidoterrestris cells per ml of juice (in log.sub.10).
[0046] FIG. 6 illustrates the Ct value of Saccharomyces spp.
amplified DNA in orange juice vs. the number of Saccharomyces spp.
cells per ml of juice (in log.sub.10).
[0047] FIG. 7 illustrates the Ct value of Aspergillus spp.
amplified DNA in orange juice vs. the number of Aspergillus spp.
cells per ml of juice (in log.sub.10).
[0048] FIG. 8 illustrates the Ct value of E. coli amplified DNA in
apple cider vs. the number of E. coli cells per ml of juice (in
log.sub.10).
DETAILED DESCRIPTION OF THE INVENTION
[0049] A need exists for a simple DNA isolation method that yields
sufficient highly purified DNA from juice or cider while using
small quantity of juice or cider and not using environmentally
harsh reagents. Furthermore, there is a need to be able to
determine the quality and/or safety of juice and/or cider by
assaying the DNA purified by this method or any other DNA
purification method. The quality of the juice or cider can be
flavor, smell, color, safety, taste, mouth feel, and aftertaste, or
a combination thereof. In one embodiment, this method of
determining the quality and/or safety of a juice and/or cider uses
any method for quantifying the amount of one or more
microorganisms' nucleic acids present in the juice and/or cider. In
a second embodiment, this method uses polymerase chain reaction
(PCR) amplification to quantify the amount of one or more
microorganisms' nucleic acids present in the juice and/or cider. In
a third embodiment, this method uses quantitative PCR (qPCR) to
quantify the amount of one or more microorganisms' nucleic acids
present in the juice and/or cider by obtaining the threshold cycle
(Ct) value for one or more microorganisms' nucleic acids present in
the juice and/or cider. The obtained Ct value is compared to a
known Ct value which indicates (1) the juice and/or cider is safe
for consumption and/or (2) the juice and/or cider's quality is
impaired. After obtaining a Ct value for the juice or cider, one
can grade the juice or cider (based on the liquid's qualities) by
comparing the obtained Ct value to known Ct values. Surprisingly,
the novel methods of this invention work with unpasteurized juices
and ciders, as well as with pasteurized juices and ciders. By
"safety", it is meant that the juice and/or cider is safe for
consumption by humans or other animals. By "determining the
quality" refers to determining if the quality of the juice and/or
cider has been adversely impacted by a microorganism's presence in
or infection of the plant or fruit or contamination of the juice
and/or cider. The quality characteristics of a juice or cider
include, but are not limited to, flavor, taste, mouth feel,
aftertaste, color, and smell. For citrus juices, flavor
qualities/descriptors include orange, grapefruit,
fruity-non-citrus, orange peel, green, stale, oxidized oil and
typical HLB off-flavor; taste quality/descriptors include
sweetness, sourness, umami, bitterness and metallic; mouth feel
qualities/descriptors include body, tingling, astringent, and
burning; and aftertaste qualities/descriptors include bitter and
astringent burning. For juices and ciders made from non-citrus
fruit, the flavor, mouth feel, and aftertaste qualities can be
similar to some or all of the qualities for citrus juices.
[0050] The novel methods of this invention can be used on juice or
cider obtained from any fruit or vegetable. Non-limiting examples
of fruit and vegetables include orange, grapefruit, lemon, lime,
apple, grape, pear, peach, plum, pomegranate, celery, cucumber,
onion, carrot, lettuce, spinach, beets, watercress, rhubarb,
pumpkin, and tomato. For simplicity, the term "fruit" refers to
both fruits and vegetables.
[0051] Fresh squeezed juices and ciders may be contaminated with
harmful microorganisms (harmful to the animal (including human)
consuming the liquid or harmful to the plant and/or fruit). These
pathogens remain in the juice or cider because the juice or cider
does not undergo pasteurization. As such, a need exists to be able
to assay for these harmful microorganisms. Nucleic acid
amplification assays are highly sensitive and extremely accurate
methods of determining the presence or absence of an organism's
nucleic acids in a sample. As such, it would be useful to have a
nucleic acid amplification assay to determine if these harmful
microorganisms' nucleic acids are present in the juice or cider and
to be able to determine if the amount of nucleic acids present
indicate that the amount of microorganisms are harmful (either to
the animal consuming the juice or cider, or to the plant from which
the juice or cider was obtained). Further, a need exists for
nucleic acid isolation method which can obtain sufficiently pure
nucleic acids in sufficient quantity from juice or cider. One
reason for this need is to determine if the pasteurization process
kills sufficient quantity of the microorganisms. Also, it is
possible that even though sufficient numbers of microorganisms are
killed during pasteurization, the dead microorganisms or their
metabolites alter the quality (flavor, taste, smell, color, safety,
mouth feel, and aftertaste or a combination thereof) of the juice
or cider. A third reason is that a pasteurized juice or cider can
become contaminated with microorganisms after pasteurization,
thereby adversely affecting the quality and/or safety of the juice
or cider. One can utilize any method to isolate nucleic acids or
the nucleic acid isolation method described herein to obtain the
nucleic acids from the liquid in a cost-effective manner. Then one
can perform any assay which quantifies the amount of nucleic acids
present. Alternatively, one can perform PCR to amplify the amount
of one or more microorganisms' nucleic acids. Or, alternatively,
one can perform qPCR on the isolated nucleic acids using primers
that are specific for the one or more microorganism for which one
is screening. Next one determines the Ct value, and by comparing
the obtained Ct value to a known Ct value, one can determine if the
juice or cider is safe to consume or if the quality of the juice or
cider (e.g., flavor, taste, smell, mouth feel, aftertaste, or
color) has been adversely impacted. One can assign grades to the
juice or cider based on the Ct value obtained by performing qPCR on
a sample of the liquid and comparing the obtained Ct value to known
values which indicate the quality of the juice or cider for a
particular quality or safety. Non-limiting examples of pathogens
that may exist in juices or ciders include Escherichia coli,
Listeria spp., Shigella spp., Salmonella spp., Klebsiella spp.,
Candidatus Liberibacter asiaticus (CLas), Candidatus Liberibacter
africanus (CLaf), and Candidatus Liberibacter americanus
(CLam).
[0052] CLas, CLaf, and CLam cause HLB disease in citrus trees. The
juice obtained from the fruit of infected trees can have an "off"
taste. Prior art methods of determining the quality of juice is to
have people taste the juice and/or measure soluble solids (mostly
sugars) and titratable acids. However, these prior art assays do
not cover all the off-flavor characteristics imparted by the
bacterial disease. There is a need for a quantitative and fast
method for assessing the quality of the juice. One can use the
nucleic acids isolation methods described herein, or any other
isolation method, to isolate the nucleic acids present in the
juice. Then one can use any nucleic acid quantification method, or
alternatively, can use any nucleic acid amplification method, or
alternatively performs qPCR on the isolated nucleic acids to
quantify the amount of Candidatus Liberbacter nucleic acids present
in the juice. Based on the quantify of Candidatus Liberbacter
nucleic acids present in the juice, one can determine if the
quality of the juice has been adversely impacted by the Candidatus
Liberbacter infection and the degree of impact. To determine the
quantify of Candidatus Liberbacter present in the juice using qPCR,
and possibly other DNA quantification methods, one uses primers
specific for the particular Candidatus Liberbacter species for
which one is assaying, or use a universal primer that will bind to
any Candidatus Liberbacter species. Then, for qPCR, one determines
the Ct value of the amplified DNA and compares the obtained value
to a known Ct value to determine the quality of the juice. The
quality can be flavor, smell, color, safety, taste, mouth feel,
aftertaste, or a combination thereof.
[0053] In addition, other microorganisms present on the fruit, in
the juice, or in a tree can decrease the quality of the juice
obtained from fruit. One can use the methods of this invention to
isolate DNA from the juice and determine the quality of the juice.
Non-limiting examples of such microorganism include lactic acid
bacteria (Parish, M E, Food Technol. 45(4):128-132 (1991)), acetic
acid bacteria (Murdock, DI, Microbiology of Citrus Products (Chap.
11) in Citrus Science and Technology v2 Shaw and Veldhuis (eds)
Westport, Conn. (1977)), Alicyclobacillus spp. (Pettipher, et al.,
Letters in Applied Microbiology 24:185-189 (1997)),
Zygosaccharomyces spp. (Arias, et al., Appl. Environ. Microb.
68:1955-1961 (2002)), and Rhodotorula ruba (Sutherland, et al., J.
Food Protection 58(11):1260-1262 (1995)). Non-limiting examples of
lactic acid bacteria are Lactobacillus spp., Leuconostoc spp.,
Pediococcus spp., Lactococcus spp., Streptococcus spp., Aerococcus
spp., Carnobacterium spp., Enterococcus spp., Oenococcus spp.,
Sporolactobacillus spp., Tetragenococcus spp., Vagococcus spp., and
Weisella spp. Non-limiting examples of acetic acid bacteria are
Acetobacter spp., Acidicaldus spp., Acidiphilium spp., Acidisphaera
spp., Acidocella spp., Acidomonas spp., Asaia spp., Belnapia spp.,
Craurococcus spp., Gluconacetobacter spp., Gluconobacter spp.,
Granulibacter spp., Kozakia spp., Leahibacter spp., Muricoccus
spp., Neoasaia spp., Oleomonas spp., Paracraurococcus spp.,
Rhodopila spp., Roseococcus spp., Rubritepida spp., Saccharibacter
spp., Stella spp., Swaminathania spp., Teichococcus spp., and
Zavarzinia spp.
[0054] The quality of the juice can be determined by quantifying
the amount of the microorganism's nucleic acids which can be used
to determine the adverse impact of the microorganism had on the
juice's quality. One can use any method to isolate nucleic acids
present in the juice or the method described herein. After the
nucleic acids have been isolated, in one embodiment, one can use
any method for quantifying the amount of a microorganism's nucleic
acid present in the isolated nucleic acids. In another embodiment,
one can use any nucleic acid amplification method to quantify the
amount of the microorganism's nucleic acids present in the isolated
nucleic acids. In another embodiment, one can use qPCR to quantify
the amount of the microorganism's nucleic acids present in the
isolated nucleic acids. After quantifying the amount of a
microorganism's nucleic acids present in the isolated nucleic
acids, one can determine the quality of the juice or cider.
[0055] Microorganism-specific primers for qPCR or for other nucleic
acid amplification methods can be generated based on each
microorganism's nucleic acids sequences. For qPCR, each primer set
should generate an amplicon of a specific size, and the amplicon's
nucleotide sequence should be specific to the microorganism. In
general, the amplicon generated by qPCR can range from
approximately 70 bp to approximately 250 bp. In one embodiment, the
amplicon can range in size between approximately 100 bp to
approximately 200 bp. In another embodiment, the amplicon can range
in size between 125 bp and 180 bp.
[0056] One aspect of this invention involves a novel method for
isolating nucleic acids which are present in a liquid, where the
liquid can be a juice, a cider, a fermented beverage, or any other
liquid obtained from a fruit or vegetable. This nucleic acid
isolation method involves separating the solid components (plant
material and microorganism material) from the liquid (or from the
liquid soluble components), lysing the cells present in the solid
components to release nucleic acids and other cellular components,
and separating the non-nucleic acid cellular components (proteins,
polysaccharides, salts, lipids, etc.) from the nucleic acids.
[0057] In another embodiment, one separates the solid components
(plant material and microorganism material) from the liquid (or
from the liquid soluble components) by centrifuging the liquid so
that a pellet of solid components is formed and then decanting the
liquid from the tube, leaving the pellet of solid components in the
tube. Next, one resuspends the solid components in the tube using
the extraction buffer. The extraction buffer contains various
chemicals (Tris-base, EDTA, a salt (NaCl or other similar salts),
polyvinylpyrrolidone, and water) to help disperse the solid
components throughout the extraction buffer and to protect nucleic
acids from degradation at a generally neutral or slightly basic pH.
The extraction buffer also contains .beta.-mercaptoethanol which
helps lyse the cells. Then one adds additional chemicals (NaOH and
a surfactant (non-ionic surfactant or cationic surfactant)) that
further assist in lysing the cells to the tube containing the
extraction buffer and the resuspended material. After thoroughly
mixing, one can optionally heat the mixture to assist in lysing the
cells. Next, one adds chloroform or a similar compound (such as
chloroform and isoamylalcohol or phenol and chloroform) to create
an organic phase, an interface, and an aqueous phase, thereby
separating out the proteins, lipids, and non-polar compounds from
the nucleic acids present in the tube. The denatured proteins are
present in the interface; the lipids and non-polar compounds are in
the organic phase; and the nucleic acids and polysaccharides are
present in the aqueous phase. One may optionally mix the contents
of the tube to assist in the dissolution of substances into the
organic phase. Then one may optionally centrifuge the tube to
separate the aqueous phase from the organic phase and the
interface. Next one separates the aqueous phase from the organic
phase and interface; but alternatively one can separate the organic
phase and interface from the aqueous phase. In some embodiments,
one puts the aqueous phase into a new tube. Then one adds
hexadecetyl trimethyl ammonium bromide (CTAB) to the aqueous phase
and mixes thoroughly. The salt concentration of the aqueous
solution containing CTAB can be approximately 400 mM or less. One
can optionally heat the aqueous solution containing CTAB. CTAB
helps precipitate nucleic acids when the salt concentration is
approximately 400 mM or less, yet the polysaccharides (including
pectin) present in the aqueous phase remains dissolved in the
aqueous phase. Thus, the addition of CTAB into the aqueous phase at
the appropriate salt concentration allows one to separate nucleic
acids from polysaccharides. Next one can separate the nucleic acids
from the aqueous solution containing CTAB and polysaccharides by
centrifuging the tube to pellet the nucleic acids and then
separating the liquid from the pellet, leaving the isolated nucleic
acids in the tube. In some embodiments, one may want to wash the
isolated nucleic acids in alcohol (or a solution of alcohol and
other liquids) to remove any remaining salts and any CTAB that may
be present with the isolated nucleic acids. To wash the nucleic
acids, one adds alcohol, resuspends the isolated nucleic acids
pellet, then centrifuges the tube to pellet the isolated nucleic
acids and decants the alcohol. Again, in some embodiments, one may
dissolve the pelletted, isolated nucleic acids in a salt solution
for further purification of the nucleic acids using alcohol.
Optional heating the solution helps dissolve the nucleic acids.
Next one adds alcohol (such as 2-propanol) to the tube and mixes.
Then one centrifuges the tube to pellet the nucleic acids (which do
not dissolve in the alcohol) and decants the solution of salt and
alcohol from the pelletted, isolated nucleic acids. Next, one can
optionally remove any remaining salts and other compounds from the
isolated nucleic acids by resuspending the pelletted, isolated
nucleic acids again in alcohol (such as ethanol) (or a solution of
alcohol and other liquids) and then centrifuging again and then
decanting the liquid from the pelletted, isolated nucleic acids.
One then has highly purified, isolated nucleic acids in a pellet at
the bottom of a tube, and one can resuspend the nucleic acids in
the any desired liquid (e.g., nuclease-free water).
[0058] In one embodiment, one first separates the liquid soluble
components from the solid components of the juice or cider (or vice
versa). Various methods of separating out the liquid soluble
components and the solid components of juice are known in the art.
Centrifugation followed by retention of the pellet (the solid
components) is one method of separating the two components. Next
one adds the appropriate amount of extraction buffer (described
infra) and 3-mercaptoethanol to the isolated solid components. In
an alternative embodiment, one first makes the extraction buffer
(described infra). Then one separates the solid components and the
liquid soluble components in the juice. And then one adds
.beta.-mercaptoethanol to the extraction buffer prior to adding of
the extraction buffer to the isolated solid components.
[0059] In one embodiment, one liter of the extraction buffer
contains approximately 12.1 g Tris-base (final concentration:
approximately 100 mM), approximately 18.61 g EDTA (final
concentration: approximately 50 mM), approximately 29.22 g NaCl
(final concentration: approximately 500 mM), approximately 25 g
polyvinylpyrrolidone (PVP40) (final concentration: approximately
2.5%), and approximately 800 mL water to dissolve the components.
The pH of the extraction buffer is adjusted, if necessary, by
adding sufficient 1 M HCl or 1 M NaOH to bring the pH to
approximately 8.0. One adds sufficient water to bring the total
volume to one liter. One adds approximately 2 .mu.L of
.beta.-mercaptoethanol per ml of extraction buffer (the final
3-mercaptoethanol concentration is approximately 0.2% (v/v)) to the
extraction buffer immediately prior to using the extraction buffer.
In an alternative embodiment, the components of the extraction
buffer may have the following ranges of concentrations: from
approximately 1 mM to approximately 500 mM Tris or any buffer
similar to Tris; approximately 1 mM to approximately 500 mM EDTA;
approximately 10 mM to approximately 1.4 M NaCl; approximately 0.5%
to approximately 10% PVP40; sufficient HCl or sufficient NaOH to
bring the pH to approximately 7 to approximately 9; and
approximately 0.05% to approximately 3% 3-mercaptoethanol. Of note,
the salt concentration after one adds CTAB (infra) should not
exceed approximately 400 mM so that the nucleic acids can
precipitate out of solution and not co-isolate with
polysaccharides. Thus, if the concentration of salt in the
extraction buffer is exceeds 800 mM, then the volume of CTAB would
also increase in order to reduce the salt concentration to the
desired range.
[0060] Add approximately 400 .mu.L of the extraction buffer
(already containing .beta.-mercaptoethanol) to the tube.
Alternatively, one can add .beta.-mercaptoethanol directly to the
tube prior to or after adding the extraction buffer.
[0061] After the extraction buffer, .beta.-mercaptoethanol, and the
solid components are combined, one resuspends the pellet (the solid
component) thoroughly by vortexing or gently shaking. Next, one
adds approximately 4 .mu.L of 10 M NaOH and approximately 40 .mu.L
of 40% TWEEN 20 to the tube to lyse the cells (prokaryotic and
eukaryotic) that are present in the tube. In an alternative
embodiment, one can use between approximately 0.05% (final
concentration) and approximately 10% (final concentration) TWEEN
20, TWEEN 40, TWEEN 60, TWEEN 80, Triton X-100, Nonidet P-40, or
any similar non-ionic surfactant; and between approximately 10 mM
(final concentration) and approximately 1 M NaOH (final
concentration). While one can add NaOH and the non-ionic surfactant
to the extraction buffer immediately prior to using the extraction
buffer, adding NaOH and non-ionic surfactant after resuspending the
solid component in the juice in the extraction buffer provides
better results. Lysing cells releases nucleic acids,
polysaccharides, lipids, proteins and polar material.
[0062] Cap the tube tightly and mix well with a vortex to lyse the
cells present in the tube. Incubate the tube at approximately
65.degree. C. for between approximately 30 minutes to approximately
1 hour to thoroughly lyse the cells. Allow the tube to cool at room
temperature for approximately 5 minutes. Next, the nucleic acids
and polysaccharides are separated from the non-polar material,
proteins, and lipids (or the non-polar material, proteins and
lipids are separated from the nucleic acids and polysaccharides).
This separation step is accomplished by adding approximately 444 tl
chloroform:isoamylalcohol (24:1, v/v) or an equivalent amount of
chloroform to the tube, vortexing for 10 seconds or between 5
seconds and 5 minutes, and centrifuging at approximately 13,000 rpm
(or between approximately 7,000 rpm and approximately 25,000 rpm)
for approximately 10 minutes (or between approximately 5 minutes to
2 hours) to separate the aqueous phase (nucleic acids and
polysaccharides) from the organic phase (non-polar material and
lipids) and from the interface (proteins) (or to separate the
organic phase and interface from the aqueous phase). Further
separation occurs by transferring the aqueous phase (approximately
300 .mu.L) to a new tube, leaving the organic phase and interface
in the original tube. Add approximately 300 .mu.L of pre-warmed 4%
hexadecetyl trimethyl ammonium bromide (CTAB) (final concentration:
2%) (or approximately 1:1 volume of the isolated aqueous phase and
CTAB) to separate the nucleic acids from the polysaccharides (or
the polysaccharides from the nucleic acids). DNA and other nucleic
acids are not soluble in the aqueous phase containing CTAB and the
salt at a concentration of approximately 400 mM or less. Yet,
pectin and other polysaccharides remain soluble in the aqueous
phase in the presence of CTAB. If the salt concentration is greater
than approximately 800 mM in the extraction buffer, then one should
add sufficient quantity of CTAB solution to reduce the final salt
concentration to approximately 400 mM or less. Alternatively the
final CTAB concentration can range between approximately 0.5% and
approximately 5%.
[0063] Mix well by inverting the tube between approximately 1 and
approximately 100 times. Incubate the tube at approximately
65.degree. C. (or between approximately 60.degree. C. and
approximately 80.degree. C.) for approximately 30 minutes (or
between approximately 10 minutes and approximately 60 minutes) to
help nucleic acids come out of solution from the aqueous phase.
Next, centrifuge the tube at approximately 13,000 rpm (or
approximately 7,000 rpm to approximately 25,000 rpm) for
approximately 15 minutes (or approximately 5 minutes to
approximately 1 hour) and discard the supernatant (aqueous phase)
containing the polysaccharides, leaving pelletted nucleic acids in
the tube. Add approximately 1 ml of 70% ethanol (or approximately 1
ml of between approximately 60% and approximately 100% ethanol, or
approximately 1 ml of between approximately 60% and approximately
100% ethanol prepared in TE buffer (10 mM Tris, 1 mM EDTA) or
prepared in 10 mM Tris-HCl) to the pellet. Invert the tubes between
1 and approximately 100 times, and allow the tube to remain at room
temperature for approximately 10 second to approximately 240
minutes to dissolve and remove excess CTAB. Centrifuge the tube
again at approximately 13,000 rpm (or from approximately 7,500 rpm
to approximately 25,000 rpm) for approximately 10 minutes (or from
approximately 2 minutes to approximately 2 hours) at approximately
20.degree. C. (or between approximately 0.degree. C. to
approximately 40.degree. C.) to pellet the nucleic acids and again
discard the supernatant.
[0064] Re-suspend the pelletted nucleic acids in approximately 500
.mu.L of 1 M NaCl (or alternatively between approximately 50 mM
NaCl and approximately 5 M NaCl) and incubate at approximately
65.degree. C. (or between approximately 25.degree. C. and
approximately 85.degree. C.) for approximately 5 minutes (or
approximately 10 seconds and approximately 240 minutes). Add
approximately 400 .mu.L of 2-propanol (concentration can range from
between approximately 10% to approximately 100%) to the tube and
invert the tube repeatedly for approximately 30 seconds (or between
approximately 5 seconds and approximately 240 minutes), then allow
to remain up-right at room temperature for approximately 5 minutes
(or between approximately 5 seconds and approximately 240 minutes)
to precipitate the nucleic acids. Any remaining CTAB dissolves in
the alcohol while the nucleic acids precipitate out of solution.
Centrifuge the tube at approximately 13,000 rpm (or from
approximately 7,500 rpm to approximately 25,000 rpm) for
approximately 15 minutes (or from approximately 2 minutes to
approximately 2 hours) at 20.degree. C. (or from approximately
0.degree. C. to approximately 50.degree. C.) to pellet the nucleic
acids, discard the supernatant and retain the pelletted, isolated
nucleic acids. Next add approximately 1 ml of 70% ethanol
(concentration can range between approximately 60% to approximately
100%) to the tube, or alternatively add approximately 1 ml of
between approximately 60% and approximately 100% ethanol prepared
in TE buffer (10 mM Tris, 1 mM EDTA) or prepared in 10 mM Tris-HCl,
to the tube to wash the pelletted, isolated nucleic acids again and
to remove non-nucleic acid substances. Invert the tube once, twice,
three or more times to wash the isolated nucleic acids and remove
any remaining salts. Centrifuge the tube again at 13,000 rpm (or
from approximately 7,500 rpm to approximately 25,000 rpm) for
approximately 10 minutes (or from approximately 2 minutes to
approximately 2 hours) at 20.degree. C. (or from approximately
0.degree. C. to approximately 50.degree. C.) and discard the
supernatant to remove the liquids from the pelletted, isolated
nucleic acids. Air dry the isolated nucleic acid pellet at
approximately 30.degree. C. (or from approximately 0.degree. C. to
approximately 70.degree. C.) for approximately 30 minutes (or from
approximately 2 minutes to approximately 12 hours). Dissolve the
nucleic acids in approximately 30 .mu.L of DNA nuclease-free and
RNA nuclease-free water or in TE buffer (10 mM Tris and 1 mM EDTA,
pH 8) or in 10 mM Tris-HCl, pH between 7.5 and 8.0.
[0065] To assist in the practice of the invention's nucleic acid
isolation method, another aspect of this invention is a kit
containing the extraction buffer in a first container, a second
container containing .beta.-mercaptoethanol, which can be added to
the extraction buffer prior to use, and instructions for use of the
material in the containers. In another embodiment, the kit could
also have a third container which holds a mixture of NaOH and a
surfactant (non-ionic or cationic surfactant) or these two
compounds can be separate containers (thus the kit would have a
third and fourth container).
[0066] In yet another embodiment, one can have a kit with a
plurality of containers that contain, individually or in
combination, the components of the extraction buffer, one or two
containers to hold NaOH and a surfactant (non-ionic or cationic
surfactant) either together or individually, optionally a container
to hold CTAB, optionally another container to hold the chloroform
or similar compounds, optionally one or more containers to hold the
alcohol solutions, and instructions on use of the materials in the
kit for isolation of nucleic acids.
[0067] Because the inventions described and claimed herein use
biotechnology methods, a brief description of some of these methods
is provided.
[0068] Polymerase chain reaction (or PCR) is a technique to copy
(or amplify) a small quantity of nucleic acids. Using PCR, one can
generate greater than 100,000,000 or even one billion copies of the
desired nucleic acid within a couple of hours. To amplify a segment
of DNA using PCR, the sample is first heated so the DNA denatures
(separates into two pieces of single-stranded DNA). Next, the
sample is cooled to a temperature lower than the melting (or
denaturing) temperature of the DNA but still substantially higher
than room temperature. At this temperature, Taq polymerase (a DNA
polymerase active at high temperatures) synthesizes two new strands
of DNA, using the original strands as templates and primers that
bind to the original strands of DNA as initiation points for DNA
extension by Taq polymerase. Of course, sufficient amounts of free
nucleic acids are added to the reaction mixture for use by Taq
polymerase to generate the new DNA. This process results in the
duplication of a section of the original DNA based on the binding
location of the primers. Each new DNA segment (also referred to as
an amplicon) contains one old and one new strand of DNA. The sample
is heated again to denature the DNA again and allowed to cool so
that Taq polymerase can generate new amplicons. The cycle of
denaturing and synthesizing new DNA is repeated as many as thirty
or forty times, leading to approximately one billion or more
amplicons. A thermocycler is a programmable apparatus that
automates the temperature changes utilized in PCR, controlling DNA
denaturation and synthesis. PCR can be completed in a few hours.
Some early U.S. patents on PCR include U.S. Pat. No. 4,683,195;
U.S. Pat. No. 4,683,202; and U.S. Pat. No. 4,800,159.
[0069] Quantitative PCR (qPCR), also called real-time PCR, involves
monitoring DNA amplification during each cycle of PCR using a
fluorescent label. When the DNA is in the log linear phase of
amplification, the amount of fluorescence increases above the
background. The point at which the fluorescence becomes measurable
is called the Cycle Threshold (Ct) or crossing point. By using
multiple dilutions of a known amount of standard DNA, a standard
curve can be generated of log concentration against Ct. The amount
of nucleic acids in an unknown sample can then be calculated from
its Ct value. For this invention, the higher the Ct value, the
smaller the quantity of a microorganism's DNA is present in the
assayed liquid. Conversely, the lower the Ct value, the higher the
quantity of a microorganism's DNA is present in the assayed liquid.
For this invention, as it relates to CLas, Ct value of
approximately 35 to approximately 36 or less obtained using Li
primers indicates that the citrus tree or trees from which the
juice is obtained is infected with CLas. For this invention, as it
relates to CLas, a Ct value of approximately 30 to approximately 32
or less using LJ primers indicates that the citrus tree or trees
from which the juice is obtained is infected with CLas. For the Li
primers (SEQ ID NO: 3 and SEQ ID NO: 4), Ct values between
approximately 30 and approximately 35 indicate some decrease in
juice quality, but Ct values of approximately 30 and below,
indicate very poor juice quality. For the LJ primers (SEQ ID NO: 1
and SEQ ID NO: 2), Ct values between approximately 25 and
approximately 30 indicate some decrease in juice quality, but Ct
values of approximately 25 and below indicate very poor juice
quality.
[0070] Two types of fluorescent labels can be used with qPCR. One
label is an intercalating dye that incorporates into
double-stranded DNA, such as SYBR.RTM. Green. An intercalating dye
is appropriate when a single amplicon is being studied. The second
type of fluorescent label is a probe that binds specifically to the
target DNA, such as TaqMan.RTM. probes, Molecular Beacons.TM., or
Scorpion primers. The probe is an oligonucleotide with a
fluorescent dye (such as Texas Red.RTM., FAM, TET, HEX, TAMRA, JOE,
and ROX) and a quencher (such as Dabcyl, Dabsyl, and the minor
groove binding nonfluorescent quencher (MGBNFQ)) chemically
attached to the oligonucleotide. The oligonucleotide itself has no
significant fluorescence, but fluoresces either when annealed to
the template (as in Molecular Beacons.TM.) or when the dye is
clipped from the oligonucleotide during extension (as in
TaqMan.RTM. probes). The fluorescent compositions described herein
are simply examples of compositions for imaging, identifying,
and/or quantifying DNA. Instead of the fluorescent compositions
described herein, one can label DNA with compositions that are
known in the art (some of which are described infra) or that are
developed in the future. These labels can be used to image,
identify, and/or quantify DNA using similar methods as described
herein. The fluorescent compositions are simply one well-known and
well-accepted compositions for imaging, identifying, and/or
quantifying DNA for the methods described herein. The
oligonucleotide for a probe is at least approximately 8 nucleotides
in length. In some embodiments, the oligonucleotide for a probe is
between approximately 8 bases and approximately 50 bases long. In
other embodiments, the oligonucleotide for a probe is between
approximately 15 bases and approximately 45 bases long.
[0071] In addition to qPCR, one can use multiplex PCR to quantify
the nucleic acids from several different microorganisms
simultaneously. Multiplex PCR is similar to qPCR but uses dyes with
distinct fluorescent emissions for each probe used during the
amplification process. Alternatively, instead of using fluorescent
emissions in qPCR or multiplex PCR to determine the quantity of
amplified DNA, one can use other methods known in the field to
measure the amplified DNA, some of which is described infra. The
ranges of Ct values for each primer described above are applicable
for multiplex PCR.
[0072] The term "nucleic acid" as used herein, refers to a polymer
of ribonucleotides or deoxyribonucleotides. Typically, "nucleic
acid" polymers occur in either single- or double-stranded form, but
are also known to form structures comprising three or more strands.
The term "nucleic acid" includes naturally occurring nucleic acid
polymers as well as nucleic acids comprising known nucleotide
analogs or modified backbone residues or linkages, which are
synthetic, naturally occurring, and non-naturally occurring, which
have similar binding properties as the reference nucleic acid, and
which are metabolized in a manner similar to the reference
nucleotides. Exemplary analogs include, without limitation,
phosphorothioates, phosphoramidates, methyl phosphonates,
chiral-methyl phosphonates, 2-O-methyl ribonucleotides,
peptide-nucleic acids (PNAs). "DNA", "RNA", "polynucleotides",
"polynucleotide sequence", "oligonucleotide", "nucleotide",
"nucleic acid", "nucleic acid molecule", "nucleic acid sequence",
"nucleic acid fragment", and "isolated nucleic acid fragment" are
used interchangeably herein.
[0073] The term "label" as used herein, refers to a composition
detectable by spectroscopic, photochemical, biochemical,
immunochemical, or chemical means. Exemplary labels include
.sup.32P (or other isotopes), fluorescent dyes, electron-dense
reagents, enzymes (e.g., as commonly used in an ELISA), biotin,
digoxigenin, or haptens and proteins for which antisera or
monoclonal antibodies are available.
[0074] As used herein a nucleic acid "probe", oligonucleotide
"probe", or simply a "probe" refers to a nucleic acid capable of
binding to a target nucleic acid of complementary sequence through
one or more types of chemical bonds, usually through complementary
base pairing, usually through hydrogen bond formation. As used
herein, a probe may include natural (i.e., A, G, C, or T) or
modified bases (e.g., 7-deazaguanosine, inosine, etc.). In
addition, the bases in a probe may be joined by a linkage other
than a phosphodiester bond, so long as it does not interfere with
hybridization. Thus, for example, probes may be peptide nucleic
acids in which the constituent bases are joined by peptide bonds
rather than phosphodiester linkages. It will be understood by one
of skill in the art that probes may bind target sequences lacking
complete complementarity with the probe sequence depending upon the
stringency of the hybridization conditions. In one exemplary
embodiment, probes are directly labeled as with isotopes,
chromophores, lumiphores, chromogens etc. In other exemplary
embodiments probes are indirectly labeled e.g., with biotin to
which a streptavidin complex may later bind. By assaying for the
presence or absence of the probe, one can detect the presence or
absence of the select sequence or subsequence.
[0075] Thus, the term "probe" as used herein refers to a probe that
is bound, either covalently, through a linker or a chemical bond,
or noncovalently, through ionic, van der Waals, electrostatic, or
hydrogen bonds to a label such that the presence of the probe may
be detected by detecting the presence of the label bound to the
probe.
[0076] The term "primer" as used herein, refers to short nucleic
acids, typically a DNA oligonucleotide of at least approximately 8
nucleotides in length. In some embodiments, a primer is between
approximately 8 bases and approximately 50 bases long. In other
embodiments, a primer is between approximately 15 bases and
approximately 45 bases long. In an exemplary embodiment, primers
are annealed to a complementary target DNA strand by nucleic acid
hybridization to form a hybrid between the primer and the target
DNA strand. Annealed primers are then extended along the target DNA
strand by a DNA polymerase enzyme. Primer pairs can be used for
amplification of a nucleic acid sequence, e.g., by the polymerase
chain reaction (PCR) or other nucleic-acid amplification methods
known in the art.
[0077] PCR primer pairs are typically derived from a known
sequence, for example, by using computer programs intended for that
purpose such as Primer (Version 0.5 .COPYRGT.1991, Whitehead
Institute for Biomedical Research, Cambridge, Mass.). One of
ordinary skill in the art will appreciate that the specificity of a
particular probe or primer increases with its length. Thus, for
example, a primer comprising 20 consecutive nucleotides of a
promoter complex sequence will anneal to a related target sequence
with a higher specificity than a corresponding primer of only 15
nucleotides. Thus, in an exemplary embodiment, greater specificity
of a nucleic acid primer or probe is attained with probes and
primers selected to comprise 20, 25, 30, 35, 40, 50 or more
consecutive nucleotides of a selected sequence.
[0078] Nucleic acid probes and primers are readily prepared based
on the nucleic acid sequences disclosed herein. Methods for
preparing and using probes and primers and for labeling and
guidance in the choice of labels appropriate for various purposes
are discussed, e.g., in Sambrook et al., Molecular Cloning, A
Laboratory Manual 2nd ed. 1989, Cold Spring Harbor Laboratory; and
Current Protocols in Molecular Biology, Ausubel et al., eds., 1994,
John Wiley & Sons).
[0079] The term "capable of hybridizing under stringent
hybridization conditions" as used herein, refers to annealing a
first nucleic acid to a second nucleic acid under stringent
hybridization conditions (defined below). In an exemplary
embodiment, the first nucleic acid is a test sample, and the second
nucleic acid is the sense or antisense strand of a nucleic acid of
interest. Hybridization of the first and second nucleic acids is
conducted under standard stringent conditions, e.g., high
temperature and/or low salt content, which tend to disfavor
hybridization of dissimilar nucleotide sequences.
Example 1 DNA Isolation from Juice
[0080] It is useful to make a stock solution of the extraction
buffer. One liter of the extraction buffer contains approximately
12.1 g Tris-base (final concentration: approximately 100 mM),
approximately 18.61 g EDTA (final concentration: approximately 50
mM), approximately 29.22 g NaCl (final concentration: approximately
500 mM), approximately 25 g polyvinylpyrrolidone (PVP40) (final
concentration: approximately 2.5%), add approximately 800 mL water
to dissolve the components. The pH of the extraction buffer is
adjusted, if necessary, by adding sufficient 1 M HCl or 1 M NaOH to
bring the pH to approximately 8.0. One should add sufficient water
to bring the total volume to one liter. Next, one adds
approximately 2 .mu.L of .beta.-mercaptoethanol per ml of
extraction buffer (the final 3-mercaptoethanol concentration is
approximately 0.2% (v/v)) to the extraction buffer immediately
prior to using the extraction buffer. The salt concentration after
one adds CTAB (infra) should not exceed approximately 400 mM so
that the nucleic acids can precipitate out of solution and not
co-isolate with polysaccharides. Thus, if the concentration of salt
in the extraction buffer is exceeds 800 mM, then the volume of CTAB
would also increase in order to reduce the salt concentration to
the desired range.
[0081] Place approximately 0.5 ml orange juice into a 1.5 ml tube
and centrifuge at 13,000 rpm for approximately 15 minutes at
20.degree. C. to separate the solid components (plant material and
microorganism material) in the juice from the liquid (liquid
soluble components). Discard the supernatant and retain the solid
components. Add approximately 400 .mu.L of the extraction buffer
(already containing .beta.-mercaptoethanol) to the tube. The
extraction buffer, especially the 3-mercaptoethanol, helps lyse
cells (prokaryotic and eukaryotic) present in the solid components
present in the juice. The extraction buffer also protects the
nucleic acids from degradation.
[0082] Resuspend the pellet (the solid components of the juice)
thoroughly via vortexing or gently shaking. Next, add approximately
4 .mu.L of 10 M NaOH and approximately 40 .mu.L of 40% TWEEN 20 to
the tube to lyse the cells (prokaryotic and eukaryotic) that are
present in the tube. Cap the tube tightly and mix well with a
vortex to lyse the cells present in the tube. Incubate the tube at
approximately 65.degree. C. for between approximately 30 minutes to
approximately 1 hour to thoroughly lyse the cells. Allow the tube
to cool at room temperature for approximately 5 minutes. Next, add
approximately 444 .mu.l chloroform:isoamylalcohol (24:1, v/v). The
addition of chloroform:isoamylalcohol denatures proteins and
creates an organic phase into which the lipids and non-polar
material dissolve, an interface in which the denatured proteins
present, and an aqueous solution into which DNA, pectin, and other
polar material dissolves. Vortex for 10 seconds, and centrifuge at
13,000 rpm for approximately 10 minutes to separate the aqueous
phase (extraction buffer, NaOH, and non-ionic surfactant)
containing DNA and pectin/polysaccharides from the organic phase
(chloroform:isoamylalcohol) containing lipids and non-polar
material, the interface containing denatured proteins. Transfer the
aqueous phase (approximately 300 .mu.L) to a new tube and leave the
organic phase and interface in the original tube.
[0083] Add approximately 300 .mu.L of pre-warmed 4% hexadecetyl
trimethyl ammonium bromide (CTAB) (final concentration: 2%). DNA
and other nucleic acids are not soluble in the aqueous phase
containing CTAB and the salt at a concentration of approximately
400 mM or less. Yet, pectin and other polysaccharides remain
soluble in the aqueous phase in the presence of CTAB. Thus, this
step allows one to separate nucleic acids and polysaccharides. Mix
well by inverting the tube several times and incubate at 65.degree.
C. for approximately 30 minutes to help nucleic acids come out of
solution from the aqueous phase. Next, centrifuge the tube at
13,000 rpm for approximately 15 minutes and discard the supernatant
(aqueous phase) containing the polysaccharides, leaving pelletted
nucleic acids in the tube. Add approximately 1 ml of 70% ethanol to
the pellet. Invert the tubes twice and allow the tube to remain at
room temperature for approximately one to approximately two minutes
to dissolve and remove excess CTAB. Centrifuge the tube again at
13,000 rpm for approximately 10 minutes at 20.degree. C. to pellet
the nucleic acids and again discard the supernatant. Re-suspend the
pelletted nucleic acids in approximately 500 .mu.L of 1 M NaCl, and
incubate at 65.degree. C. for approximately 5 minutes. Add
approximately 400 .mu.L of 2-propanol to the tube and invert the
tube repeatedly for approximately 30 seconds, then allow to remain
up-right at room temperature for approximately 5 minutes. Any
remaining CTAB dissolves in the alcohol while the nucleic acids
precipitate out of solution. Centrifuge the tube at 13,000 rpm for
approximately 15 minutes at 20.degree. C. to pellet the nucleic
acids, discard the supernatant and retain the pelletted, isolated
nucleic acids. Next add approximately 1 ml of 70% ethanol to the
tube to the tube to wash the pelletted, isolated nucleic acids.
Invert the tube once, twice, three or more times to wash the
isolated nucleic acids and remove any remaining salts. Centrifuge
the tube again at 13,000 rpm for approximately 10 minutes at
20.degree. C. and discard the supernatant to remove the liquids
from the pelletted, isolated nucleic acids. Air dry the isolated
nucleic acid pellet at 30.degree. C. for approximately 30 minutes.
Dissolve the nucleic acids in 30 .mu.L of DNA nuclease-free and RNA
nuclease-free water or in TE buffer (10 mM Tris and 1 mM EDTA, pH
8) or in 10 mM Tris-HCl, pH between 7.5 and 8.0.
[0084] Of the two categories of DNA isolation and purification
methods discussed supra, the protocol described herein uses CTAB
but not SDS and KoAC, so it belongs to the CTAB category. The
present invention differs from the published CTAB DNA extraction
method (Allen, et al., (2006)) as follows: 1) Using NaOH and Tween
20 (or similar compositions) to help lyse the cells, resulting in
an increased DNA yield. 2) PVP40 is in the Extraction Buffer to
absorb polyphenols present in the juice and lysed cells, resulting
in cleaner DNA. 3) CTAB precipitates and separates DNA from the
extraction buffer, prior to using any alcohol (including
isopropanol) to precipitate DNA. This step efficiently removes
polysaccharides (including pectin) and dramatically improves the
DNA A260/A230 ratio (>2.2), indicating that the DNA is free from
polysaccharide contamination. 4) The NaCl concentration in the
Extraction Buffer can range from approximately 10 mM to
approximately 800 mM, in some embodiments, which is less than the
NaCl concentration in the prior art methods (however the
concentration can range up to 1.4 M on the condition that one
accordingly increases the volume of CTAB added in order to bring
the final salt concentration to approximately 400 mM or less). 5)
CTAB is not in extraction buffer, but is used during at a later
step (after removal of proteins and other polar material via
addition of chloroform to create an organic phase) to separate DNA
from polysaccharides. Nucleic acids are not soluble in an aqueous
solution containing CTAB when the NaCl concentration in the aqueous
solution is approximately 400 mM or less. Thus, in one embodiment,
the salt concentration in the extraction buffer is approximately
500 mM so that after separation of the organic phase (containing
lipids and non-polar components dissolved in chloroform) and the
interface (containing denatured proteins) from the aqueous phase
(containing nucleic acids and polysaccharides) (alternatively, the
aqueous phase is separated from the interface and the organic
phase), and upon addition of the CTAB solution to the aqueous
phase, the salt concentration is approximately 250 mM.
[0085] This DNA isolation and purification method produces highly
purified DNA (A260/A280=2.02.+-.0.03, which means the DNA is free
of protein contamination; and A260/A230=2.29.+-.0.05, which means
the DNA is free of polysaccharide, salts or solvents contamination)
with high yield (approximately 10 .mu.g DNA per 0.5 ml of orange
juice). See FIG. 1 which illustrates the purity of DNA as measured
by a Nano-Drop spectrophotometer (ThermoFisher Scientific, Waltham,
Mass.). Further, the cost for performing this DNA isolation and
purification method is extremely low (less than $0.10/sample).
Table 1 contains information about the DNA yield and purity of the
novel method of this invention, some prior art methods, and several
other methods that were used but did not generate results
comparable to this method described herein.
TABLE-US-00001 TABLE 1 DNA Isolation & DNA yield A260/ A260/
Purification Method (.mu.g/0.5 ml juice) A280 A230 Protocol
described in Experiment 1 10.02 .+-. 1.50 2.02 .+-. 0.03 2.29 .+-.
0.05 CTAB method (Allen, et al., 4.39 .+-. 1.15 1.95 .+-. 0.11 1.16
.+-. 0.15 Nat. Protoc., 1(5): 2320-2325 (2006)) SDS-KoAC method
(Dellaporta, et al., Plant 3.71 .+-. 1.23 1.88 .+-. 0.09 0.65 .+-.
0.11 Molecular Biology Reporter, 1(4): 19-21(1983)) Combined kits
method (Bai, et al., 0.58 .+-. 0.06 1.94 .+-. 0.12 1.62 .+-. 0.10
J. Agric. Food Chem. In press (2013)) Bio Sprint 96 DNA plant kit
3.55 .+-. 2.58 1.29 .+-. 0.15 0.30 .+-. 0.08 (Qiagen, Cat# 941557
(Germantown, MD)) Protocol described in Experiment 1 no DNA
extracted N/A N/A except used SDS instead of Tween 20 CTAB protocol
(above) modified 6.85 .+-. 1.21 1.96 .+-. 0.15 1.25 .+-. 0.07 by
adding PVP, NaOH and Tween 20 to the extraction buffer
Example 2 CLas DNA Detection
[0086] To detect CLas DNA in orange juice obtained from two major
orange varieties (Hamlin and Valencia), DNA from the orange juice
is isolated and purified using the protocol described in Example 1.
Hamlin oranges are obtained from three different healthy trees (one
tree received no foliar nutritional spray treatment (U); one tree
received a wettable powder nutritional treatment ("WP"); and one
tree received a nutritional treatment K ("K")) and five different
trees exhibiting HLB disease (one infected tree receiving no foliar
nutritional spray treatment ("U"); one infected tree that received
the wettable powder nutritional treatment ("WP"); one infected tree
that received the nutritional treatment K ("K"); mildly (as defined
below in Table 5) infected tree that received the nutritional
treatment K ("K"); and severely (as defined in Table 5 below)
infected tree that received the nutritional treatment K ("K")).
[0087] Valencia oranges are obtained from three different healthy
trees (one that received no foliar nutritional spray treatment (U);
one that received nutritional treatment MB ("MB"); and one that
received nutritional treatment K("K")). The oranges used are either
HLB asymptomatic or HLB symptomatic. Thus, asymptomatic oranges and
symptomatic oranges are obtained from trees that received no foliar
nutritional spray treatment (U); asymptomatic oranges and
symptomatic oranges are obtained from trees that received MB
nutritional treatment ("MB"); and asymptomatic oranges and
symptomatic oranges are obtained from trees that received the
nutritional treatment K ("K")).
[0088] Juice samples from each type of tree/fruit are obtained by
squeezing, separately, the oranges from each type of tree. DNA is
isolated and purified from each juice sample using the protocol
described in Example 1 above and resuspended in 30 .mu.l of DNA
nuclease-free and RNA nuclease-free water. However, any DNA
isolation protocol could be used.
[0089] After isolating and purifying DNA from each juice sample,
qPCR is performed. The primers and probe listed in Table 2 are used
in the qPCR of this experiment. The LJ primers which target CLas
and CLam hyv.sub.1 are described in Morgan, et al., Mol. and Cell.
Probes, 26:90-98 (2012) and are synthesized by Integrated DNA
Technologies, Inc. (Coralville, Iowa). The LJ primer working
solution contains 10 .mu.M LJ-F and 10 .mu.M LJ-R. The Li primers
(HLBas (F) and HLBr (R)) which target CLas 16S rDNA are described
in Li, et al., J. of Microbiol. Methods, 66:104-115 (2006) and are
synthesized by Applied Biosystems, Inc. (Carlsbad, Calif.). The Li
primer working solution contains 5 .mu.M HLBas (F) and 5 .mu.M HLBr
(R). The Li probe working solution that is used with the Li primers
contains 5 .mu.M HLBp (probe).
TABLE-US-00002 TABLE 2 Primer/ Probe Name Sequence LJ-F
5'-GCCGTTTTAACACAAAAGATGAATATC-3' (SEQ ID NO: 1) LJ-R
5'-ATAAATCAATTTGTTCTAGTTTACGAC-3' (SEQ ID NO: 2) HLBas (F)
5'-TCGAGCGCGTATGCAATACG-3' (SEQ ID NO: 3) HLBr (R)
5'-GCGTTATCCCGTAGAAAAAGGTAG-3' (SEQ ID NO: 4) HLBp (probe)
6-FAM-AGACGGGTGAGTAACGCG-TAMRA (or- MGBNFQ) (SEQ ID NO: 5) 6-FAM =
6-carboxyfluorescein TAMRA = carboxytetramethylrhodamine MGBNFQ =
the minor groove binding nonfluorescent quencher
[0090] For each qPCR reaction, 2 .mu.L of each isolated and
purified DNA samples obtained from each orange juice sample are
used per 15 .mu.L reaction. For qPCR reactions using LJ primers,
each 15 .mu.L reaction contains 4.75 .mu.L of DNA/RNA nuclease-free
water, 0.75 .mu.L of LJ primer working solution, 7.5 .mu.L of
SYBR.RTM. Green PCR Master Mix (Applied Biosystems, Inc., Carlsbad,
Calif.) and 2 .mu.L of isolated and purified DNA (obtained from one
orange juice sample). For qPCR reactions using Li primers, each 15
.mu.L reaction contains 4.3 .mu.L of DNA/RNA nuclease-free water,
0.75 .mu.L of Li primer working solution, 0.45 .mu.L of Li probe
working solution, 7.5 .mu.L of TaqMan.RTM. Universal Master Mix
(Applied Biosystems, Inc., Carlsbad, Calif.) and 2 .mu.L of
isolated and purified DNA (obtained from one orange juice sample).
See Table 3 infra.
[0091] To make the reaction mixture for all samples, the total
reaction number needs to be calculated based on the DNA sample
number, the replications for each DNA sample (usually triplicate
for each DNA sample, at least duplicate), positive control,
negative control (no template control ("NTC")), etc. Plus it is
helpful, but not necessary, for one to increase the total reaction
number slightly (such as by two, three, or four; or such as by one
for every ten samples to be performed) in order to have sufficient
amount of reagents for the assays. The number of .mu.L for each
component (except DNA) is added to the reaction mixture based on
the number of qPCR reactions to be performed and the volume of each
component for one qPCR reaction ((qPCR reaction
number).times.(number of .mu.L per reaction for each component as
described above)=number of .mu.L of each component). After
assembling all the components together (excluding the DNA), mix
well gently (for example, by gently pipetting up and down several
times) and spin down briefly. Aliquot the reaction mixture into a
96-well PCR reaction plate, 13 .mu.L per well; and then add 2 .mu.L
of DNA to each well (for NTC, add 2 .mu.L of water). Seal the plate
with an optical adhesive film, and spin the plate in a mini plate
spinner for approximately 1 minute. The qPCR reaction reagents and
quantities for each LJ primer 15 .mu.L reaction and for each Li
primer 15 .mu.L reaction are summarized in Table 3 below.
TABLE-US-00003 TABLE 3 1 Rx (.mu.L) LJ primer 15 .mu.L reaction:
SYBR .RTM. Green PCR Master Mix 7.5 LJ primer set (LJ-F and LJ-R,
10 .mu.M each) 0.75 Water 4.75 Isolated and purified DNA (from
orange juice) 2 Li primer 15 .mu.L reaction: TaqMan .RTM. Universal
Master Mix II, no UNG 7.5 Li primer set (HLBas (F) and HLBr (R), 5
.mu.M each) 0.75 Probe (HLBp) 0.45 Water 4.3 Isolated and purified
DNA (from orange juice) 2
[0092] 7500 Real-Time PCR system (Applied Biosystems, Inc.,
Carlsbad, Calif.) is used for the qPCR reaction. The qPCR
parameters are as follows: 95.degree. C. for 10 minutes, followed
by 40 cycles at 95.degree. C. for 15 seconds, and 60.degree. C. for
1 minute, with fluorescence signal capture at each stage of
60.degree. C. For the SYBR.RTM. Green Real-Time PCR reaction (for
LJ primers), the default Melt Curve (disassociation) stage is
continued after the 40 cycles of PCR reaction. Cycle threshold (Ct)
values are analyzed using ABI 7500 Software version 2.0.6 (Applied
Biosystems, Inc., Carlsbad, Calif.)) with a manually set threshold
at 0.02 and automated baseline settings. The qPCR parameters are
summarized in Table 4, infra. If performing the SYBR.RTM. Green
reaction (for LJ primers), continue to the default Melt Curve
(disassociation) stage after the 40 cycles of PCR reaction. The Li
primers generate an amplicon of 70 bp (Li, et al. 2006)). The LJ
primers generate an amplicon of 100 bp (Morgan, et al. (2012)).
TABLE-US-00004 TABLE 4 Cycles 1 40 Temp (.degree. C.) 95 95 60 Time
10 minutes 15 seconds 1 minute (collect data)
[0093] The Ct values for the isolated and purified DNA obtained
from juice obtained from each type of Hamlin orange tree and from
each type of Valencia orange tree are shown in Table 5, infra. In
qPCR using Li primers, Ct value of 36 or less is the considered by
USDA as indicative of the citrus tree being infected with CLas (see
Li, et al., (2006)), however the Ct value of 35 or less is used for
this example. In the qPCR using LJ primers, USDA has not determined
a Ct value that is indicative of a citrus tree being infected with
CLas. For the purposes of this invention, a Ct value of
approximately 30 to approximately 31 or less is considered
indicative of the citrus tree being infected with CLas.
TABLE-US-00005 TABLE 5 Sample Li primer LJ primer ID (16S rDNA)
C.sub.T (prophage) C.sub.T Hamlin orange juice U-healthy ND ND
WP-healthy ND ND K-healthy 36.1 .+-. 0.1 30.5 .+-. 0.1 U-HLB 29.7
.+-. 0.2 26.8 .+-. 0.1 WP-HLB 34.3 .+-. 0.08 27.8 .+-. 0.5 K-HLB
31.2 .+-. 0.1 28.4 .+-. 0.5 K-HLB mild 35.5 .+-. 0.7 30.4 .+-. 0.3
K-HLB severe 29.5 .+-. 0.1 26.7 .+-. 0.1 Valencia orange juice U
Healthy 35.8 .+-. 0.4 32.8 .+-. 0.3 U Asymp (HLB) 33.4 .+-. 0.5
29.6 .+-. 0.2 U Symp (HLB) 32.8 .+-. 0.2 27.5 .+-. 0.2 MB Healthy
34.9 .+-. 0.1 30.2 .+-. 0.4 MB Asymp (HLB) 34.1 .+-. 0.3 29.1 .+-.
0.4 MB Symp (HLB) 32.3 .+-. 0.3 27.7 .+-. 0.8 K Healthy 34.1 .+-.
1.0 29.5 .+-. 0.7 K Asymp (HLB) 33.0 .+-. 0.5 27.7 .+-. 0.02 K Symp
(HLB) 30.7 .+-. 0.1 26.0 .+-. 0.1 ND: No amplification detected U:
no foliar nutritional spray treatment; WP: a wettable powder
nutritional treatment; MB: nutritional treatment MB; K: nutritional
treatment K; Mild: trees rated as 2 on scale of 4 where 4
represents most symptomatic infected trees; Severe: trees rated as
3 or 4. Asymp: juice from HLB asymptomatic fruits; Symp: juice from
HLB symptomatic fruits.
[0094] The foliar nutritional spray treatments (WP, K and MB) are
known in the art field treatments that growers are using to
mitigate the effects of HLB disease on the deterioration of
infected trees. The oranges obtained from "healthy" trees are trees
that were initially considered healthy because the trees were not
symptomatic for HLB. However, based on the data obtained, some of
the "healthy" trees are infected with CLas. See Ct value for MB
Healthy and K Healthy in Table 5 above. Even the trees indicated as
"U Healthy" had a Ct value that is borderline (if one uses Ct 36 as
the cut-off value) and thus are probably infected with CLas.
Example 3 Detection of CLas DNA in Commercial Orange Juice
[0095] Five brands of juice are purchased at a local store: Orange
juice 1, Orange juice 2, Orange juice 3, Orange juice 4, and Orange
juice 5. DNA isolation and purification is performed as described
in Example 1 for each brand of juice. Next, qPCR is performed as
described in Example 2 supra on each isolated and purified DNA
obtained from each juice brand using Li primers and LJ primers. Ct
value is determined for each sample, in triplicate. The results are
in Table 6.
TABLE-US-00006 TABLE 6 Juice Li primers LJ primer Brand (16S rDNA)
C.sub.T (hyv.sub.1) C.sub.T Orange juice 1 30.6 30.2 Orange juice 1
30.6 30.8 Orange juice 1 30.8 31.0 Orange juice 2 31.6 30.0 Orange
juice 2 31.9 30.1 Orange juice 2 31.6 30.3 Orange juice 3 31.6 28.5
Orange juice 3 32.2 29.2 Orange juice 3 31.8 28.7 Orange juice 4
30.9 26.9 Orange juice 4 30.6 27.0 Orange juice 4 30.8 26.7 Orange
juice 5 32.1 30.9 Orange juice 5 32.9 30.4 Orange juice 5 32.0
31.1
[0096] Ct is cycle value using two primers. As discussed supra, any
Ct value under 35 using Li primers indicates that the citrus trees
from which a majority of the juice is obtain are infected with CLas
and any Ct value under 31 using LJ primers indicates that the
citrus trees from which a majority of the juice is obtained are
infected with CLas.
Example 4 Quality Control Assay to Predict Juice Flavor Quality
[0097] This experiment is performed to determine if the HLB
off-flavor of orange juice (as assessed by ten to twelve people
trained for descriptive sensory analysis) can be determined by the
Ct values obtained by qPCR of isolated and purified DNA for CLas
(one of the causal organism for HLB disease) from orange juice. The
ten to twelve people are trained to evaluate samples of orange
juice and determine the flavor of the juice. Orange juice samples
are obtained from 53 HLB-affected groups of oranges (.about.400-500
fruit per group) of different varieties and harvest dates, from
oranges from healthy or infected trees (some trees had received
nutritional treatments) that were symptomatic (fruit were small
green or lopsided) or asymptomatic for the disease to get a wide
range of orange juice flavor quality. DNA from the juice samples is
isolated and purified using the protocol of Example 1. qPCR is
performed, and Ct values obtained, on the isolated and purified DNA
using the Li primers and LJ primers per the methods of Example 2.
Flavor rating of flavor descriptors (orange, grapefruit,
fruity-non-citrus, orange peel, green, stale, oxidized oil and
typical HLB off-flavor), taste descriptors (sweetness, sourness,
umami, bitterness and metallic), mouth feel descriptors (body,
tingling, astringent, burning) and aftertaste descriptors (bitter,
astringent burning) is on a scale of 0 to 15, where 15 is the
highest intensity rating of a descriptor. The data is presented in
Tables 7, 8, 9, 10 and 11 below.
[0098] For Tables 7, 8, 9, 10 and 11, Hamlin or Valencia oranges
harvested in December, January or April (as indicated) of different
years are obtained from healthy trees (receiving no foliar
nutritional spray treatment (U); receiving a wettable powder
nutritional treatment WP ("WP"); and receiving nutritional
treatment KP ("KP")), and trees exhibiting HLB disease (receiving
no foliar nutritional spray treatment (U); receiving a wettable
powder nutritional treatment WP ("WP"); receiving nutritional
treatment KP ("KP"); and mildly infected trees (MILD: trees
receiving nutritional treatment KP ("KP"), rated as 2 on scale of 4
where 4 represents most symptomatic infected trees)). Some samples
are juice blends of healthy and HLB fruit, as indicated in the
tables.
TABLE-US-00007 TABLE 7 Table 7 Flavor descriptors Sample Orange
Grapefruit Fruity-non-citrus Orange peel Green Stale Oxidized oil
Typical HLB Hamlin December Healthy 5.2 2.2 1.6 2.6 1.6 1.5 1.1 2.4
Hamlin Decmber HLBa 2.5 6.3 0.4 3.5 2.3 3.1 3.5 7.7 Hamlin December
HLBs 2.2 6.7 0.3 4.8 3.0 3.6 3.9 8.8 Hamlin January Healthy 4.8 1.3
2.8 2.0 2.1 3.1 2.2 3.4 Hamlin January HLBa 3.7 2.0 1.3 2.3 2.3 2.7
2.0 4.0 Hamlin January HLBs 3.1 3.0 1.3 2.9 2.3 3.3 2.5 5.9
Valencia April Healthy 5.8 1.5 2.6 2.8 1.5 1.0 1.0 1.9 Valencia
April HLBa 6.3 1.4 2.1 2.7 1.5 0.9 1.0 1.7 Valencia April HLBs 5.3
2.1 2.1 2.9 1.5 1.3 1.2 2.9 Hamlin April U-Healthy 3.6 1.6 2.0 1.4
2.4 2.4 1.3 3.2 Hamlin January U-HLBa 2.9 2.4 1.4 2.4 2.0 3.1 2.0
5.0 Hamlin January U-HBLs 2.8 2.5 1.2 2.3 2.5 4.0 2.5 5.8 Hamlin
January KP-Healthy 3.5 1.8 1.8 2.1 2.0 3.1 2.2 3.7 Hamlin January
KP-HLBs 3.8 2.0 1.9 1.9 2.0 2.8 2.0 3.7 Hamlin January WP-Healthy
3.1 2.0 1.1 2.1 2.1 2.6 1.5 4.2 Hamlin January WP-HLBa 2.5 2.2 0.8
2.0 2.3 2.7 1.4 4.5 Hamlin January WP-HLBs 3.1 2.1 0.9 2.2 2.4 2.8
1.7 4.9 Valencia April U-Healthy 6.2 1.2 3.1 2.1 1.5 0.9 1.0 1.2
Valencia April U-HLBa 5.6 1.2 2.7 2.2 1.3 1.1 1.3 1.6 Valencia
April U-HLBs 6.4 1.2 3.3 2.6 1.5 0.3 0.5 0.9 Valencia April
KP-Healthy 6.6 1.1 2.7 2.7 1.3 1.2 1.0 1.7 Valencia April KP-HLBa
6.5 1.0 3.3 2.7 1.1 1.3 1.2 1.7 Valencia April KP-HLBs 5.5 2.5 1.8
3.4 1.9 1.8 1.3 3.4 Valencia April MB-Healthy 7.2 0.7 3.2 2.3 1.6
0.7 0.5 1.1 Valencia April MB-HLBa 6.0 1.0 3.3 1.9 1.3 1.4 1.0 1.5
Valencia April MB-HLBs 5.8 1.7 2.2 2.7 1.7 1.5 1.5 2.4 Hamlin
U-Healthy 5.0 1.5 1.9 2.0 1.5 1.8 1.0 2.4 Hamlin U-HLB 3.5 2.0 1.3
2.0 2.2 2.8 2.3 4.2 Hamlin KP-HLB Mild 3.6 2.3 1.0 2.7 2.5 2.5 1.9
4.0 Valencia Healthy 6.3 1.2 2.4 2.2 1.5 1.2 1.0 1.7 Valencia HLBa
5.7 1.5 2.1 2.7 2.0 1.3 1.2 2.0 Valencia HLBs 6.0 1.8 2.3 2.7 2.1
1.5 1.3 2.2 Hamlin WP-Healthy 4.1 1.7 1.8 1.8 2.0 1.9 1.3 3.1
Hamlin WP-HLB 4.0 1.5 1.6 1.8 2.2 2.3 1.4 3.2 Valencia Blend 25%
Healthy/ 4.8 2.2 1.5 3.0 1.9 1.9 1.4 2.7 75% HLB Valencia Blend 75%
Healthy/ 5.0 2.8 1.6 2.7 2.0 1.8 1.4 2.7 25% HLB Valencia
MB-Healthy 5.8 1.5 1.8 2.5 1.4 1.5 1.0 1.7 Valencia MB-HLB 5.4 2.3
1.6 3.1 1.8 1.3 1.3 2.5 Hamlin Blend 67% healthy/33% HLB 4.5 1.7
1.5 2.4 2.0 2.2 1.4 3.3 Hamlin KP-Healthy 4.8 1.0 2.2 1.9 1.8 1.9
1.3 2.2 Hamlin KP-HLB 3.6 1.8 1.0 2.1 2.0 2.7 1.5 4.2 Hamlin
KP-Healthy 4.8 1.4 2.2 2.0 1.5 1.6 1.2 1.8 Hamlin KP-HLB 3.8 2.3
1.0 2.2 2.0 1.9 1.4 4.0 Hamlin KP-HLB Severe 3.2 2.5 0.6 2.8 2.5
2.5 2.0 4.8 Hamlin U-Healthy 4.4 1.4 1.7 1.7 2.3 2.6 1.2 3.3 Hamlin
U-HLB 4.1 1.8 1.5 2.1 2.3 2.4 1.6 3.3 Hamlin KP-HLB mild 3.7 1.7
1.3 2.0 2.4 2.8 1.4 4.5 Valencia Blend 50% Healthy/ 4.9 2.5 1.3 2.6
2.0 2.3 1.8 3.9 50% HLB Valencia U-Healthy 5.0 2.5 1.6 2.3 1.9 1.6
1.5 3.5 Valencia U-HLB 4.5 2.7 1.4 2.4 2.1 1.8 1.4 3.5 Hamlin
KP-HLB Severe 3.4 1.8 1.0 2.0 2.3 2.4 1.5 4.7 Hamlin WP-Healthy 4.3
1.6 1.1 2.0 2.0 2.1 1.7 3.4 Hamlin WP-HLB 3.5 1.6 0.9 2.0 2.0 2.4
1.9 4.6
TABLE-US-00008 TABLE 8 Table 8 Taste descriptors Sample Sweetness
Sourness Umami Bitterness Metallic Hamlin December Healthy 5.5 4.8
1.0 2.0 1.9 Hamlin Decmber HLBa 3.7 5.3 2.4 6.0 3.8 Hamlin December
HLBs 2.8 6.2 2.8 6.6 4.9 Hamlin January Healthy 6.8 4.1 1.4 1.4 1.7
Hamlin January HLBa 5.2 4.1 1.8 2.4 2.2 Hamlin January HLBs 4.8 4.5
2.4 3.5 3.1 Valencia April Healthy 6.0 6.1 1.3 2.0 1.8 Valencia
april HLBa 6.1 6.4 1.3 2.0 1.5 Valencia April HLBs 5.7 7.2 1.3 2.3
2.2 Hamlin April U-Healthy 5.2 3.5 1.7 1.5 1.8 Hamlin January
U-HLBa 4.2 3.6 1.9 3.6 2.3 Hamlin January U-HBLs 4.0 3.8 1.9 3.2
2.2 Hamlin January KP-Healthy 4.9 3.3 1.4 2.1 2.0 Hamlin January
KP-HLBs 5.6 3.6 1.8 2.0 2.0 Hamlin January WP-Healthy 4.0 3.6 1.5
2.3 2.1 Hamlin January WP-HLBa 3.6 3.5 1.6 3.0 2.2 Hamlin January
WP-HLBs 4.1 3.7 2.0 2.1 2.2 Valencia April U-Healthy 6.3 5.1 0.6
1.7 1.2 Valencia April U-HLBa 6.4 5.5 0.8 1.7 1.3 Valencia April
U-HLBs 6.5 5.8 0.9 1.8 0.9 Valencia April KP-Healthy 7.2 6.0 0.9
1.9 1.7 Valencia April KP-HLBa 6.9 5.8 0.9 1.9 1.8 Valencia April
KP-HLBs 6.0 7.3 1.4 2.4 2.8 Valencia April MB-Healthy 7.7 5.0 0.5
1.5 0.8 Valencia April MB-HLBa 7.0 5.0 0.8 1.6 1.5 Valencia April
MB-HLBs 6.4 5.8 1.3 2.2 2.2 Hamlin U-Healthy 5.7 4.2 1.2 1.4 1.2
Hamlin U-HLB 4.4 4.0 1.8 2.8 2.2 Hamlin KP-HLB Mild 4.2 4.3 1.4 2.3
1.9 Valencia Healthy 6.5 4.9 1.0 1.9 1.5 Valencia HLBa 5.6 5.8 1.4
2.2 1.8 Valencia HLBs 5.9 6.2 1.9 2.9 2.4 Hamlin WP-Healthy 5.7 4.5
1.5 2.0 1.1 Hamlin WP-HLB 5.1 4.3 1.7 2.2 1.3 Vaencia Blend 25%
Healthy/75% HLB 4.9 7.3 1.4 3.1 2.1 Valencia Blend 75% Healthy/25%
HLB 5.0 6.8 1.3 2.8 2.0 Valencia MB-Healthy 6.0 6.7 1.1 2.1 1.8
Valencia MB-HLB 5.8 7.4 1.0 2.6 1.7 Hamlin Blend 67% healthy/33%
HLB 5.3 4.4 1.8 2.3 1.3 Hamlin KP-Healthy 6.2 3.9 1.2 1.8 1.0
Hamlin KP-HLB 4.5 3.9 1.7 3.1 2.0 Hamlin KP-Healthy 5.9 4.3 1.4 1.8
0.8 Hamlin KP-HLB 4.1 4.4 1.5 3.3 1.8 Hamlin KP-HLB Severe 4.1 4.3
2.3 3.2 1.9 Hamlin U-Healthy 6.1 4.1 1.6 2.0 1.5 Hamlin U-HLB 5.4
4.2 1.7 2.8 1.9 Hamlin KP-HLB mild 5.0 4.1 1.7 3.1 1.6 Valencia
Blend 50% Healthy/50% HLB 4.4 7.3 1.7 3.0 2.5 Valencia U-Healthy
5.1 6.8 1.3 2.4 1.8 Valencia U-HLB 4.4 7.5 1.5 2.8 2.2 Hamlin
KP-HLB Severe 4.4 4.3 1.9 3.6 1.9 Hamlin WP-Healthy 5.3 4.0 1.5 2.5
1.0 Hamlin WP-HLB 4.7 3.8 1.6 3.3 1.5
TABLE-US-00009 TABLE 9 Table 9 Mouthfeel descriptors Tin- Astrin-
Sample Body gling gent Burning Hamlin December Healthy 4.8 1.8 1.7
2.1 Hamlin December HLBa 4.4 3.2 2.9 3.3 Hamlin December HLBs 4.3
3.2 3.8 3.2 Hamlin January Healthy 5.6 1.0 1.0 1.5 Hamlin January
HLBa 5.1 1.4 1.6 1.4 Hamlin January HLBs 5.2 2.0 2.5 2.2 Valencia
April Healthy 5.9 1.9 1.6 2.4 Valencia april HLBa 6.1 1.6 1.7 2.5
Valencia April HLBs 6.1 2.6 2.3 3.3 Hamlin April U-Healthy 4.5 1.0
1.3 1.3 Hamlin January U-HLBa 4.5 1.4 1.8 1.8 Hamlin January U-HBLs
4.1 1.8 1.9 1.8 Hamlin January KP-Healthy 4.7 1.4 1.8 1.5 Hamlin
January KP-HLBs 4.5 1.5 1.3 1.3 Hamlin January WP-Healthy 4.2 1.5
1.7 1.8 Hamlin January WP-HLBa 3.7 1.3 1.8 1.3 Hamlin January
WP-HLBs 3.9 1.4 1.6 1.3 Valencia April U-Healthy 6.4 1.3 1.3 1.8
Valencia April U-HLBa 6.5 1.4 1.5 1.8 Valencia April U-HLBs 6.5 1.3
1.9 1.6 Valencia April KP-Healthy 7.0 1.8 1.5 2.6 Valencia April
KP-HLBa 6.6 1.7 1.5 2.1 Valencia April KP-HLBs 6.0 3.0 2.3 3.1
Valencia April MB-Healthy 6.7 0.9 1.3 1.4 Valencia April MB-HLBa
6.0 1.3 1.5 2.0 Valencia April MB-HLBs 6.2 2.0 1.9 2.3 Hamlin
U-Healthy 5.4 0.9 1.0 1.1 Hamlin U-HLB 5.1 1.5 2.0 1.5 Hamlin
KP-HLB Mild 5.0 1.3 1.5 1.3 Valencia Healthy 6.2 1.2 1.6 1.9
Valencia HLBa 6.0 1.6 2.0 2.6 Valencia HLBs 5.8 2.4 2.5 2.9 Hamlin
WP-Healthy 5.4 1.0 1.4 1.0 Hamlin WP-HLB 5.5 1.2 1.5 1.5 Vaencia
Blend 25% Healthy/75% HLB 5.3 2.0 2.5 2.8 Valencia Blend 75%
Healthy/25% HLB 5.7 1.8 2.2 2.6 Valencia MB-Healthy 6.0 1.5 2.0 2.3
Valencia MB-HLB 5.6 1.9 2.5 2.9 Hamlin Blend 67% healthy/33% HLB
4.6 1.4 1.7 1.5 Hamlin KP-Healthy 5.6 1.2 1.3 0.9 Hamlin KP-HLB 5.1
1.7 2.4 1.7 HamlinKP-Healthy 5.3 1.0 1.1 1.2 Hamlin KP-HLB 4.8 1.8
1.8 1.5 Hamlin KP-HLB Severe 4.6 1.8 2.0 1.7 Hamlin U-Healthy 5.5
1.0 1.2 1.1 Hamlin U-HLB 5.3 1.3 1.8 1.5 Hamlin KP-HLB mild 5.1 1.1
1.8 1.0 Valencia Blend 50% Healthy/50% HLB 5.7 2.5 2.7 3.2 Valencia
U-Healthy 5.8 1.9 2.3 2.5 Val U-HLB 5.4 1.8 2.4 2.8 Hamlin KP-HLB
Severe 5.1 1.7 2.2 1.7 Hamlin WP-Healthy 5.2 1.2 1.6 1.4 Hamlin
WP-HLB 4.9 1.4 2.2 1.3
TABLE-US-00010 TABLE 10 Table 10 Aftertaste descriptors Sample
Bitter Astringent Burning Hamlin December Healthy 1.8 1.7 1.9
Hamlin Decmber HLBa 5.2 2.8 2.7 Hamlin December HLBs 5.3 3.2 2.8
Hamlin January Healthy 1.1 1.2 1.0 Hamlin January HLBa 1.5 1.5 1.3
Hamlin January HLBs 2.8 2.3 2.1 Valencia April Healthy 1.6 1.4 2.5
Valencia april HLBa 1.6 1.4 2.0 Valencia April HLBs 1.9 1.8 2.5
Hamlin April U-Healthy 1.3 1.1 0.9 Hamlin January U-HLBa 2.3 1.7
1.4 Hamlin January U-HBLs 2.8 2.2 1.7 Hamlin January KP-Healthy 1.4
1.3 1.1 Hamlin January KP-HLBs 1.7 1.0 1.0 Hamlin January
WP-Healthy 1.7 1.5 1.3 Hamlin January WP-HLBa 1.8 1.2 0.8 Hamlin
January WP-HLBs 1.8 1.6 1.3 Valencia April U-Healthy 1.3 1.1 1.3
Valencia April U-HLBa 1.5 1.5 1.8 Valencia April U-HLBs 1.4 1.5 1.5
Valencia April KP-Healthy 1.6 1.5 1.8 Valencia April KP-HLBa 1.4
1.2 1.7 Valencia April KP-HLBs 2.0 1.8 2.2 Valencia April
MB-Healthy 1.1 1.0 1.3 Valencia April MB-HLBa 1.5 1.2 1.5 Valencia
April MB-HLBs 1.6 1.6 1.8 Hamlin U-Healthy 1.2 0.8 0.7 Hamlin U-HLB
2.1 1.4 1.1 Hamlin KP-HLB Mild 1.5 1.1 1.1 Valencia Healthy 1.0 1.1
1.2 Valencia HLBa 1.5 1.5 1.8 Valencia HLBs 1.7 1.7 1.9 Hamlin
WP-Healthy 1.0 1.1 1.0 Hamlin WP-HLB 1.1 1.2 1.3 Vaencia Blend 25%
Healthy/75% HLB 1.8 2.0 1.8 Valencia Blend 75% Healthy/25% HLB 1.7
2.0 2.0 Valencia MB-Healthy 1.4 1.6 1.8 Valencia MB-HLB 1.8 2.0 1.9
Hamlin Blend 67% healthy/33% HLB 1.8 1.3 1.0 Hamlin KP-Healthy 1.1
1.0 0.7 Hamlin KP-HLB 2.0 1.7 1.2 HamlinKP-Healthy 1.1 0.9 0.9
Hamlin KP-HLB 2.3 1.5 1.0 Hamlin KP-HLB Severe 2.0 1.2 1.3 Hamlin
U-Healthy 1.3 1.3 1.3 Hamlin U-HLB 1.6 1.8 1.1 Hamlin KP-HLB mild
2.4 1.8 1.0 Valencia Blend 50% Healthy/50% HLB 1.9 2.0 2.2 Valencia
U-Healthy 1.8 2.1 2.0 Val U-HLB 2.0 1.9 2.1 Hamlin KP-HLB Severe
2.3 2.1 1.5 Hamlin WP-Healthy 1.8 1.8 1.2 Hamlin WP-HLB 2.5 1.9
1.3
TABLE-US-00011 TABLE 11 Table 11 Li Primer LJ Primer Sample Ct
value Ct value Hamlin December Healthy 33.4 28.9 Hamlin Decmber
HLBa 27.5 24.7 Hamlin December HLBs 27.0 24.1 Hamlin January
Healthy 32.6 27.5 Hamlin January HLBa 30.7 26.9 Hamlin January HLBs
29.4 24.9 Valencia April Healthy 33.9 29.8 Valencia April HLBa 33.7
29.9 Valencia April HLBs 30.2 27.3 Hamlin April U-Healthy 34.6 28.3
Hamlin January U-HLBa 32.6 26.2 Hamlin January U-HBLs 31.2 25.1
Hamlin January KP-Healthy 32.8 29.1 Hamlin January KP-HLBs 32.1
28.5 Hamlin January WP-Healthy 31.2 27.2 Hamlin January WP-HLBa
30.8 26.4 Hamlin January WP-HLBs 29.3 25.6 Valencia April U-Healthy
35.7 32.9 Valencia April U-HLBa 32.9 30.5 Valencia April U-HLBs
32.7 29.6 Valencia April KP-Healthy 33.6 30.2 Valencia April
KP-HLBa 33 29.8 Valencia April KP-HLBs 30.7 27.1 Valencia April
MB-Healthy 35.8 31.2 Valencia April MB-HLBa 34.9 30.8 Valencia
April MB-HLBs 32.3 28.7 Hamlin U-Healthy 40.0 33.4 Hamlin U-HLB
29.3 26.0 Hamlin KP-HLB Mild 30.4 26.5 Valencia Healthy 34.5 30.3
Valencia HLBa 31.2 29.3 Valencia HLBs 30.9 27.2 Hamlin WP-Healthy
40.0 30.5 Hamlin WP-HLB 33.8 27.8 Vaencia Blend 25% Healthy/75% HLB
33.2 29.5 Valencia Blend 75% Healthy/25% HLB 34.9 30.1 Valencia
MB-Healthy 35.9 32.7 Valencia MB-HLB 32.3 27.5 Hamlin Blend 67%
healthy/33% HLB 30.5 27.2 Hamlin KP-Healthy 36.3 31.5 Hamlin KP-HLB
29.2 25.0 HamlinKP-Healthy 36.1 30.4 Hamlin KP-HLB 30.2 26.4 Hamlin
KP-HLB Severe 29.1 26.0 Hamlin U-Healthy 40.0 32.3 Hamlin U-HLB
30.4 27.0 Hamlin KP-HLB mild 30.0 25.1 Valencia Blend 50%
Healthy/50% HLB 34.9 30.5 Valencia U-Healthy 35.7 31.6 Valencia
U-HLB 32.4 28.4 Hamlin KP-HLB Severe 29.7 25.0 Hamlin WP-Healthy
33.2 30.9 Hamlin WP-HLB 31.1 25.5
[0099] In Table 11, the higher the Ct value, the less CLas DNA in
the juice sample, and the lower the Ct value, the higher the CLas
DNA in the juice sample. However, because the relative Ct values
and the abundance of the target DNA (in this example, the CLas
titer/load in orange juice) is an exponential relationship, an
exponential (logistic) regression is used to fit Ct values to
sensory descriptor ratings because an exponential regression shows
slightly better curve fit than linear (see FIGS. 2A, 2B, 2C and 3A,
3B, 3C). The LJ primers give a slightly better regression fit to
the sensory data than did the Li primers, so correlations to the
sensory descriptors ("umami", "orange", and "sweet") scores are
shown for the LJ primer with R=(-) 0.74 for Ct value versus "umami"
taste score (FIG. 2A), R=(+) 0.70 for Ct value vs. "orange" flavor
score (FIG. 2B), and R=(+) 0.68 for Ct value vs. "sweet" taste
score (FIG. 2C). Correlations to the sensory descriptors ("typical
HLB off-flavor", combination of desirable orange juice descriptors,
and combined undesirable descriptors) scores are shown for the LJ
primer with R=(-) 0.78 for Ct value vs. "typical HLB off-flavor"
score (FIG. 3A), R=(+) 0.71 for combined ratings for desirable
orange juice descriptors score that had significant correlations
individually (sweet, fruity-noncitrus, and orange) (FIG. 3B), and
R=(-) 0.76 for combined undesirable descriptors for orange juice
flavor score that had significant correlations individually (HLB,
bitter, metallic, stale, green, oxidized oil, umami and burning)
(FIG. 3C). These correlations show that higher Ct values,
indicating less CLas DNA in the juice, correlates with desirable
orange juice flavor descriptors, and lower Ct values, indicating
more CLas DNA in the juice, correlate positively with undesirable
orange juice flavor descriptors including typical HLB off-flavor,
and therefore, could be used to predict flavor quality of orange
juice.
[0100] Thus, one can use qPCR and the indicated primers to
determine the amount of off-flavor in the orange juice caused by
CLas. With this knowledge orange juice processors will be able to
make informed decisions as to grading and blending the incoming
juice based on the quality indication of how much CLas DNA is in
the juice. Having a quick, routine and objective measure, such as
CLas Ct value, would be much cheaper and less time consuming than
running a sensory panel on each truckload of fruit juice. Running
sensory panels (also called tasting panels) requires constantly
training of panelists, who must be paid, and then suffering
inconsistent panel ratings because of illness (such as colds that
interfere with tasting ability), fatigue, personal distractions,
etc. Humans on sensory panel cannot be completely objective as each
person's tasting abilities are not consistent.
Example 5 Quality Control Assay to Identify Microorganism in
Juice/Cider
[0101] Individual samples of orange juice (healthy) are separately
inoculated with Alicyclobacillus acidoterrestris, Saccharomyces
spp., Aspergillus spp., and E. coli to the concentration of
1.times.10.sup.6 CFU/ml. The inoculated juice samples are then 5
fold serially diluted into new orange juice until the most diluted
juice sample reaches the concentration of 2.56 CFU/ml. Isolation of
nucleic acids from the juice occurs using the methods described in
Example 1, supra. qPCR parameters are used as described in Example
2, supra, but using the primers in Table 12, infra, for the
indicated microorganism at 250 nM. Standard curves for each
inoculated microorganism are generated based on the concentrations
of microorganism and their corresponding Ct values generated by
qPCR analysis (see FIGS. 4 (E. coli), 5 (A. acidoterrestris), 6
(Saccharomyces spp.), and 7 (Aspergillus spp.)). For E. coli, a Ct
value of approximately 35 or less when using SEQ ID NOs: 12 and 13
as primers indicates the presence of E. coli in a juice or cider.
For A. acidoterrestris, a Ct value of approximately 33 or less when
using SEQ ID NOs: 6 and 7 as primers indicates the presence of A.
acidoterrestris in a juice or cider. For Saccharomyces spp., a Ct
value of approximately 34 or less when using SEQ ID NOs: 8 and 9 as
primers indicates the presence of Saccharomyces spp. in a juice or
cider. For Aspergillus spp., a Ct value of approximately 34 or less
when using SEQ ID NOs: 10 and 11 indicates presence of Aspergillus
spp. in a juice or cider. These Ct values can serve has the
reference.
[0102] To detect these microorganisms in orange juice, a sample of
orange juice is processed using the methods described in Example 1
to isolate the nucleic acids in the juice. Then the isolated
nucleic acids are processed using the qPCR methods set forth in
Example 2 to amplify DNA using the primers in Table 12 for the
indicated microorganism. The concentration of each primer is 250 nM
for the qPCR reaction. Upon obtaining the Ct value for a particular
microorganism, that value is compared to the known standards to
determine if the particular microorganism is present in the juice.
A sample of the juice is also added to medium suitable for growing
the particular microorganism and incubated at their suitable
growing temperatures. The culture is also tested for the presence
of the particular microorganism to confirm the results of the qPCR.
For each microorganism tested, the results from qPCR and the
confirmatory incubation matched.
TABLE-US-00012 TABLE 12 Microorganism Primers Target Source
Alicyclobacillus forward: ATGCAGAGTTCGAACG (SEQ ID squalenehopene 1
acidoterrestris NO: 6) cyclase (SHC) reverse: AAGCTGCCGAAGCACTC
(SEQ ID encoding gene, NO: 7) shc Saccharomyces forward:
GAAAACTCCACAGTGTGTTG internal 2 spp. (SEQ ID NO: 8) transcribed
reverse: GCTTAAGTGCGCGGTCTTG (SEQ spacers ITS ID NO: 9) (rDNA)
Aspergillus spp. forward: CTTGGATTTGCTGAAGACTAAC 18S rRNA gene 3
(SEQ I D NO: 10) reverse: CTAACTTTCGTTCCCTGATTAATG (SEQ ID NO: 11)
E. coli forward: ATGGAATTTCGCCGATTTTGC uidA 4 (SEQ ID NO:12)
reverse: ATTGTTTGCCTCCCTGCTGC (SEQ ID NO: 13) 1. Luo, et al.,
Letters in Applied Microbiology 39:376-382 (2004) 2. Zott, et al.,
Food Microbiol. 27(5):559-567 (2010) 3. Gemma, et al., PLoS One
7(7): e40022 (2012) 4. Heijnen and Medema, J. Water Health 4:487-98
(2006)
[0103] To assay for presence of E. coli in apple cider, Zeigler's
Old-Fashioned Apple Cider.RTM. is purchased from a local store. E.
coli is added to the cider to a concentration of 1.times.10.sup.6
CFU/ml. Next, the inoculated apple cider is serially diluted five
fold into new apple cider until the most diluted cider sample
contain 2.56 CFU/ml E. coli. DNA is extracted from the inoculated
cider using the DNA extraction method described supra in Example 1.
Next, qPCR is performed using 250 mM each of forward primer (SEQ ID
NO: 12) and reverse primer (SEQ ID NO: 13) with the other reaction
parameters as described supra in Example 2. A standard curve is
generated based on the concentrations of E. coli and the
corresponding Ct values generated by qPCR analysis (see FIG.
8).
[0104] Many modifications and other embodiments of the inventions
set forth herein will come to mind to one skilled in the art to
which these inventions pertain having the benefit of the teachings
presented in the foregoing descriptions and the associated
drawings. Therefore, it is to be understood that the inventions are
not to be limited to the specific embodiments disclosed and that
modifications and other embodiments are intended to be included
within the scope of the appended claims. Although specific terms
are employed herein, they are used in a generic and descriptive
sense only and not for purposes of limitation. All documents cited
herein are incorporated by reference. All numeric values provided
herein include a 10% increase and a 10% decrease of that value. So,
"ten" includes all numbers between "nine" and "eleven"; "one
hundred" includes all numbers between "ninety" and "one hundred
ten". All documents cited herein are incorporated by reference.
Sequence CWU 1
1
13127DNACandidatus Liberibacter asiaticus 1gccgttttaa cacaaaagat
gaatatc 27227DNACandidatus Liberibacter asiaticus 2ataaatcaat
ttgttctagt ttacgac 27320DNACandidatus Liberibacter asiaticus
3tcgagcgcgt atgcaatacg 20424DNACandidatus Liberibacter asiaticus
4gcgttatccc gtagaaaaag gtag 24518DNACandidatus Liberibacter
asiaticus 5agacgggtga gtaacgcg 18616DNAAlicyclobacillus
acidoterrestris 6atgcagagtt cgaacg 16717DNAAlicyclobacillus
acidoterrestris 7aagctgccga agcactc 17820DNASaccharomyces spp.
8gaaaactcca cagtgtgttg 20919DNASaccharomyces spp. 9gcttaagtgc
gcggtcttg 191022DNAAspergillus spp. 10cttggatttg ctgaagacta ac
221124DNAAspergillus spp. 11ctaactttcg ttccctgatt aatg
241221DNAEscherichia coli 12atggaatttc gccgattttg c
211320DNAEscherichia coli 13attgtttgcc tccctgctgc 20
* * * * *