U.S. patent application number 15/844245 was filed with the patent office on 2018-10-11 for antagonist anti-notch3 antibodies and their use in the prevention and treatment of notch3-related diseases.
This patent application is currently assigned to GENENTECH, INC.. The applicant listed for this patent is GENENTECH, INC.. Invention is credited to Sek Chung Fung, Kang Li, Yucheng Li, Sanjaya Singh, Bin-Bing Stephen Zhou.
Application Number | 20180291090 15/844245 |
Document ID | / |
Family ID | 39367005 |
Filed Date | 2018-10-11 |
United States Patent
Application |
20180291090 |
Kind Code |
A1 |
Fung; Sek Chung ; et
al. |
October 11, 2018 |
ANTAGONIST ANTI-NOTCH3 ANTIBODIES AND THEIR USE IN THE PREVENTION
AND TREATMENT OF NOTCH3-RELATED DISEASES
Abstract
The present invention relates to antagonist antibodies that
specifically bind to Notch 3 and inhibit its activation. The
present invention includes antibodies binding to a conformational
epitope comprising the first Lin12 domain and the second
dimerization domain. The present invention also includes uses of
these antibodies to treat or prevent Notch 3 related diseases or
disorders.
Inventors: |
Fung; Sek Chung;
(Gaithersburg, MD) ; Li; Kang; (San Diego, CA)
; Li; Yucheng; (San Diego, CA) ; Singh;
Sanjaya; (Sandy Hook, CT) ; Zhou; Bin-Bing
Stephen; (Ho Hokus, NJ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GENENTECH, INC. |
South San Francisco |
CA |
US |
|
|
Assignee: |
GENENTECH, INC.
South San Francisco
CA
|
Family ID: |
39367005 |
Appl. No.: |
15/844245 |
Filed: |
December 15, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13669230 |
Nov 5, 2012 |
9873734 |
|
|
15844245 |
|
|
|
|
13353173 |
Jan 18, 2012 |
8329868 |
|
|
13669230 |
|
|
|
|
13023128 |
Feb 8, 2011 |
8148106 |
|
|
13353173 |
|
|
|
|
11958099 |
Dec 17, 2007 |
7935791 |
|
|
13023128 |
|
|
|
|
60875597 |
Dec 18, 2006 |
|
|
|
60879218 |
Jan 6, 2007 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 19/02 20180101;
A61P 37/00 20180101; C07K 2317/56 20130101; C07K 2319/30 20130101;
A61P 1/16 20180101; C07K 14/705 20130101; C07K 16/28 20130101; A61P
3/10 20180101; C07K 16/18 20130101; A61P 3/00 20180101; A61P 29/00
20180101; C07K 2317/76 20130101; A61P 3/04 20180101; A61K 2039/505
20130101; A61P 3/06 20180101; A61P 35/00 20180101; A61P 35/02
20180101 |
International
Class: |
C07K 16/18 20060101
C07K016/18; C07K 14/705 20060101 C07K014/705 |
Claims
1.-23. (canceled)
24. A method of treating a Notch 3 related disease or disorder
comprising administering to a mammal a monoclonal antibody that
specifically binds to Notch3, wherein the antibody specifically
binds to a conformational epitope of a Notch3 fragment consisting
of amino acids 1378-1640 of SEQ ID NO:1, and wherein the antibody
inhibits Notch3 signaling.
25. The method of claim 24, wherein the antibody binds to amino
acid residues in the LIN12 domain (SEQ ID NO:9) and the
dimerization domain (SEQ ID NO:18).
26. The method of claim 24, wherein the antibody comprises a
variable heavy ("VH") chain region comprising CDR-H1 of SEQ ID
NO:32, CDR-H2 of SEQ ID NO:33, and CDR-H3 of SEQ ID NO:34, and a
variable light ("VL") chain region comprising CDR-L1 of SEQ ID
NO:35, CDR-L2 of SEQ ID NO:36, and CDR-L3 of SEQ ID NO:37.
27. The method of claim 26, wherein the VH chain region comprises
SEQ ID NO:2, and the VL chain region comprises SEQ ID NO:3.
28. The method of claim 24, wherein the antibody comprises a VH
chain region comprising CDR-H1 of SEQ ID NO:38, CDR-H2 of SEQ ID
NO:39, and CDR-H3 of SEQ ID NO:40, and a VL chain region comprising
CDR-L 1 of SEQ ID NO:41, CDR-L2 of SEQ ID NO:42, and CDR-L3 of SEQ
ID NO:43.
29. The method of claim 28, wherein the VH chain region comprises
SEQ ID NO:4, and the VL chain region comprises SEQ ID NO:5.
30. The method of claim 24, wherein the antibody is an
antigen-binding antibody fragment.
31. The method of claim 24, wherein the antibody is a human,
humanized, or chimeric antibody.
32. The method of claim 24, wherein the disease or disorder is a
cancer.
33. The method of claim 32, wherein the cancer is selected from the
group consisting of non-small cell lung cancer, ovarian cancer,
T-cell acute lymphoblastic leukemia, pancreatic cancer, prostate
cancer, plasma cell neoplasms, neuroblastoma and extramedullary
plasmacytoma.
34. The method of claim 24, wherein the disease or disorder is
selected from the group consisting of liver disease involving
aberrant vascularization, diabetes, diseases or disorders involving
vascular cell fate, and rheumatoid arthritis.
35. A method of inhibiting Notch3 signaling in a cell comprising
the step of contacting the cell with a monoclonal antibody that
specifically binds to Notch3, wherein the antibody specifically
binds to a conformational epitope of a Notch3 fragment consisting
of amino acids 1378-1640 of SEQ ID NO:1, and wherein the antibody
inhibits Notch3 signaling.
36. The method of claim 35, wherein the antibody binds to amino
acid residues in the LIN12 domain (SEQ ID NO:9) and the
dimerization domain (SEQ ID NO:18).
37. The method of claim 35, wherein the antibody comprises a VH
chain region comprising CDR-H1 of SEQ ID NO:32, CDR-H2 of SEQ ID
NO:33, and CDR-H3 of SEQ ID NO:34, and a VL chain region comprising
CDR-L 1 of SEQ ID NO:35, CDR-L2 of SEQ ID NO:36, and CDR-L3 of SEQ
ID NO:37.
38. The method of claim 37, wherein the VH chain region comprises
SEQ ID NO:2, and the VL chain region comprises SEQ ID NO:3.
39. The method of claim 37, wherein the antibody comprises a VH
chain region comprising CDR-H1 of SEQ ID NO:38, CDR-H2 of SEQ ID
NO:39, and CDR-H3 of SEQ ID NO:40, and a VL chain region comprising
CDR-L 1 of SEQ ID NO:41, CDR-L2 of SEQ ID NO:42, and CDR-L3 of SEQ
ID NO:43.
40. The method of claim 39, wherein the VH chain region comprises
SEQ ID NO:4, and the VL chain region comprises SEQ ID NO:5.
41. The method of claim 35, wherein the antibody is an
antigen-binding antibody fragment.
42. The method of claim 35, wherein the antibody is a human,
humanized, or chimeric antibody.
Description
RELATED APPLICATIONS
[0001] This application is a divisional application of U.S. patent
application Ser. No. 13/669,230, filed Nov. 5, 2012, which is a
continuation application of U.S. patent application Ser. No.
13/353,173, now U.S. Pat. No. 8,329,868, filed Jan. 18, 2012, which
is a divisional application of U.S. patent application Ser. No.
13/023,128, now U.S. Pat. No. 8,148,106, filed Feb. 8, 2011, which
is a divisional application of U.S. patent application Ser. No.
11/958,099, now U.S. Pat. No. 7,935,791, filed Dec. 17, 2007, which
claims the benefit of U.S. Provisional Patent Application No.
60/875,597, filed Dec. 18, 2006, and U.S. Provisional Patent
Application No. 60/879,218, filed Jan. 6, 2007. The disclosures of
the foregoing applications are incorporated herein by reference in
their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to antagonist anti-Notch3
antibodies and their use in the amelioration, treatment, or
prevention of a Notch3-related disease or disorder.
BACKGROUND OF THE INVENTION
[0003] The Notch gene was first described in 1917 when a strain of
the fruit fly Drosophila melanogaster was found to have notched
wing blades (Morgan, Am Nat 51:513 (1917)). The gene was cloned
almost seventy years later and was determined to be a cell surface
receptor playing a key role in the development of many different
cell types and tissues in Drosophila (Wharton et al., Cell 43:567
(1985)). The Notch signaling pathway was soon found to be a
signaling mechanism mediated by cell-cell contact and has been
evolutionarily conserved from Drosophila to human. Notch receptors
have been found to be involved in many cellular processes, such as
differentiation, cell fate decisions, maintenance of stem cells,
cell motility, proliferation, and apoptosis in various cell types
during development and tissue homeostasis (For review, see
Artavanis-Tsakonas, et al., Science 268:225 (1995)).
[0004] Mammals possess four Notch receptor proteins (designated
Notch1 to Notch4) and five corresponding ligands (designated
Delta-1 (DLL-1), Delta-3 (DLL-3), Delta-4 (DLL-4), Jagged-1 and
Jagged-2). The mammalian Notch receptor genes encode .about.300 kD
proteins that are cleaved during their transport to the cell
surface and exist as heterodimers. The extracellular portion of the
Notch receptor has thirty-four epidermal growth factor (EGF)-like
repeats and three cysteine-rich Notch/LIN12 repeats. The
association of two cleaved subunits is mediated by sequences lying
immediately N-terminal and C-terminal of the cleavage site, and
these two subunits constitute the Notch heterodimerization (HD)
domains (Wharton, et al., Cell 43:567 (1985); Kidd, et al., Mol
Cell Biol 6:3431 (1986); Kopczynski, et al., Genes Dev 2:1723
(1988); Yochem, et al., Nature 335:547 (1988)).
[0005] At present, it is still not clear how Notch signaling is
regulated by different receptors or how the five ligands differ in
their signaling or regulation. The differences in signaling and/or
regulation may be controlled by their expression patterns in
different tissues or by different environmental cues. It has been
documented that Notch ligand proteins, including Jagged/Serrate and
Delta/Delta-like, specifically bind to the EGF repeat region and
induce receptor-mediated Notch signaling (reviewed by Bray, Nature
Rev Mol Cell Biol. 7:678 (2006), and by Kadesch, Exp Cell Res.
260:1 (2000)). Among the EGF repeats, the 10th to 12th repeats are
required for ligand binding to the Notch receptor, and the other
EGF repeats may enhance receptor-ligand interaction (Xu, et al., J
Biol Chem. 280:30158 (2005); Shimizu, et al., Biochem Biophys Res
Comm. 276:385 (2000)). Although the LIN12 repeats and the
dimerization domain are not directly involved in ligand binding,
they play important roles in maintaining the heterodimeric protein
complex, preventing ligand-independent protease cleavage and
receptor activation (Sanche-Irizarry, et al., Mol Cell Biol.
24:9265 (2004); Vardar et al., Biochem. 42:7061 (2003)).
[0006] The expression of mutant forms of Notch receptors in
developing Xenopus embryos interferes profoundly with normal
development (Coffman, et al., Cell 73: 659 (1993)). A Notch1
knockout was found to be embryonic lethal in mice (Swiatek, et al.,
Genes & Dev 8:707 (1994)). In humans, there have been several
genetic diseases, including cancer, linked to different Notch
receptor mutations (Artavanis-Tsakonas, et al., Science 284:770
(1999)). For instance, aberrant activation of Notch1 receptor
caused by translocation can lead to T cell lymphoblastic leukemia
(Ellisen, et al., Cell 66:649 (1991)). Certain mutations in the HD
domains of Notch1 receptor enhance signaling without ligand binding
(Malecki, et al., Mol Cell Biol 26:4642 (2006)), further
implicating their roles in Notch receptor activation. The signal
induced by ligand binding is transmitted to the nucleus by a
process involving two proteolytic cleavages of the receptor
followed by nuclear translocation of the intracellular domain
(Notch-IC). Although LIN12 repeats and HD domains were thought to
prevent signaling in the absence of ligands, it is still unclear
how ligand binding facilitates proteolytic cleavage events.
[0007] Notch receptors have been linked to a wide range of diseases
including cancer, neurological disorders, and immune diseases, as
evidenced by reports of the over-expression of Notch receptors in
various human disease tissues and cell lines as compared to normal
or nonmalignant cells (Joutel, et al. Cell & Dev Biol 9:619
(1998); Nam, et al., Curr Opin Chem Biol 6:501 (2002)). The Notch3
receptor is over-expressed in various solid tumors, including
non-small cell lung cancer (NSCLC) and ovarian cancer (Haruki, et
al., Cancer Res 65:3555 (2005); Park, et al., Cancer Res 66:6312
(2006); Lu, et al., Clin Cancer Res 10:3291 (2004)), suggesting the
significance of Notch3 receptor expression in solid tumors.
Furthermore, Notch3 receptor expression is upregulated in plasma
cell neoplasms, including multiple myeloma, plasma cell leukemia,
and extramedullary plasmacytoma (Hedvat, et al., Br J Haematol
122:728 (2003); pancreatic cancer (Buchler, et al., Ann Surg
242:791 (2005)); and T cell acute lymphoblastic leukemias (T-ALL)
(Bellavia, et al., Proc Natl Acad Sci USA 99:3788 (2002);
Screpanti, et al., Trends Mol Med 9:30 (2003)). Notch3 receptor is
also expressed in a subset of neuroblastoma cell lines and serves
as a marker for this type of tumor that has constitutional or
tumor-specific mutations in the homeobox gene Phox2B (van Limpt, et
al., Cancer Lett 228:59 (2005)). Other indications and diseases
that have been linked to Notch3 receptor expression include
neurological disorders (Joutel, et al., Nature 383:707 (1996)),
diabetes (Anastasi, et al., J Immunol 171:4504 (2003), rheumatoid
arthritis (Yabe, et al., J Orthop Sci 10:589 (2005)), vascular
related diseases (Sweeney, et al., FASEB J 18:1421 (2004)), and
Alagille syndrome (Flynn, et al., J Pathol 204:55 (2004)).
[0008] Although Notch3 receptor over-expression (including gene
amplification) has been observed in various cancers, no activating
mutations have yet been reported. It is plausible that an increased
level of Notch3 receptors in tumors can be activated by different
ligands in stromal cells or tumor cells and lead to enhanced Notch3
signaling. Particularly, Notch ligands have been localized to the
vascular endothelium during both development and tumorigenesis
(Mailhos, et al., Differentiation 69:135 (2001); Taichman, et al.,
Dev Dyn 225: 166 (2002)), suggesting endothelial cells could
provide the ligands for Notch3 receptor activation in tumors.
Similar tumor-stroma cross-talk mediated by Notch ligand and
receptor have been demonstrated in different type of cancers
(Houde, et al., Blood 104: 3697 (2004); Jundt, et al., Blood 103:
3511 (2004); Zeng, et al., Cancer Cell 8: 13 (2005)). Increased
Notch3 signaling caused by over-expression of intracellular Notch3
(Notch3-IC) can lead to tumorigenesis in T-ALL and breast cancer
animal models (Vacca, et al., The EMBO J 25: 1000 (2006); Hu, et
al., Am J Pathol 168: 973 (2006)).
[0009] Notch signaling and its role in cell self-renewal have been
implicated in cancer stem cells, which are a minority population in
tumors and can initiate tumor formation (Reya, et al., Nature
414:105 (2001)). Normal stem cells from many tissues, including
intestinal and neuronal stem cells, depend on Notch signaling for
self-renewal and fate determination (Fre, et al., Nature, 435: 964
(2005); van Es, et al., Nature, 435:959 (2005);
Androutsellis-Theotokis, et al., Nature, 442: 823 (2006)). Similar
mechanisms could exist in cancer stem cells, and inhibition of
Notch signaling by .gamma.-secretase inhibitors was shown to
deplete cancer stem cells and block engraftment in embryonal brain
tumors (Fan, et al., Cancer Res 66:7445 (2006)).
[0010] Inhibition of Notch signaling by .gamma.-secretase inhibitor
has striking antineoplastic effects in Notch-expressing transformed
cells in vitro and in xenograft models (Weijzen, et al., Nat
Medicine 8: 879 (2002); Bocchetta, et al., Oncogene 22:81 (2003);
Weng, et al., Science, 306:269 (2004)). More recently, a
.gamma.-secretase inhibitor has been shown to efficaciously kill
colon adenomas in Apc (min+) mice (van Es, et al., Nature, 435: 959
(2005)), although the therapeutic window, due to its effect on
normal stem cells and the inhibition of multiple Notch pathways, is
very narrow. Different from Notch1, a Notch3 gene knockout in mice
was not embryonically lethal and had few defects (Domenga, et al.,
Genes & Dev 18: 2730 (2004)), suggesting that Notch 3 provides
a potentially better therapeutic target than Notch1.
[0011] Tournier-Lasserve et al. (U.S. Application 2003/0186290)
teach the association of Notch3 receptor and CADASIL. The
application discloses various mutations in the Notch3 gene and
their possible association with the disease CADASIL. The
application suggests the use of diagnostic antibodies to detect
such mutations. The application also suggests therapeutic
antibodies to treat CADASIL, i.e. agonistic antibodies, but no
specific antibodies are disclosed nor how to make such
antibodies.
[0012] In view of the large number of human diseases associated
with the Notch3 signaling pathway, it is important that new ways of
preventing and treating these diseases be identified. The current
invention provides novel anti-Notch3 antibodies useful for this
unmet medical need.
SUMMARY OF THE INVENTION
[0013] The present invention provides novel antibodies and
fragments thereof that specifically bind to a conformational
epitope of the human Notch3 receptor, the epitope comprising the
LIN12 domain and the heterodimerization domain. Another aspect of
the invention includes the epitope binding site and antibodies that
bind this same epitope as the antibodies of the present invention.
The antibodies of the present invention inhibit ligand-induced
signaling through the Notch3 receptor.
[0014] The invention includes the amino acid sequences of the
variable heavy and light chain of the antibodies and their
corresponding nucleic acid sequences. Another embodiment of the
invention includes the CDR sequences of these antibodies. Another
embodiment includes humanized forms of these antibodies.
[0015] Another embodiment of the present invention includes the
cell lines and vectors harboring the antibody sequences of the
present invention.
[0016] The present invention also includes the conformational
epitope recognized by the antagonist antibodies of the invention.
The present invention also includes antibodies that bind this
conformational epitope. The embodiments include a Notch 3
conformational epitope comprising the LIN12 domain having at least
80%, 85%, 90%, or 95% sequence identity with SEQ ID NO. 9 and the
dimerization domain 2 having at least 80%, 85%, 90%, or 95%
sequence identity with SEQ ID NO. 18. More particularly, the Notch
3 conformational epitope comprising amino acid residues 1395-1396,
1402-1404 and 1420-1422 of the L1 LIN12 domain and amino acid
residues 1576-1578 and 1626-1628 of the D2 dimerization domain. The
present invention includes antibodies that bind this conformational
epitope.
[0017] Another embodiment of the preset invention is the use of any
of these antibodies for the preparation of a medicament or
composition for the treatment of diseases and disorders associated
with Notch 3 receptor activation.
[0018] Another embodiment of the preset invention is the use of any
of these antibodies in the treatment of disorders associated with
Notch 3 activation comprising the inhibition of said activation by,
e.g., inhibiting Notch 3 signaling, or neutralization of the
receptor by blocking ligand binding. Notch 3 related disorders may
include, but are not limited to, T-cell acute lymphoblastic
leukemia, lymphoma, liver disease involving aberrant
vascularization, diabetes, ovarian cancer, diseases involving
vascular cell fate, rheumatoid arthritis, pancreatic cancer,
non-small cell lung cancer, plasma cell neoplasms (such as multiple
myeloma, plasma cell leukemia, and extramedullary plasmacytoma),
and neuroblastoma.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIG. 1 depicts the amino acid sequence of Notch3. The EGF
repeat region extends from amino acid residue 43 to 1383; the LIN12
domain extends from amino acid residue 1384 to 1503; and the
dimerization domain extends from amino acid residue 1504 to
1640.
[0020] FIGS. 2A-2H depict the amino acid sequence comparison
between human Notch 1 (SEQ ID NO:44), Notch 2 (SEQ ID NO:45), Notch
3 (SEQ ID NO:1), and Notch 4 (SEQ ID NO:46).
[0021] FIG. 3 depicts the percent identity of Notch 1, Notch 2,
Notch 3, and Notch 4.
[0022] FIGS. 4A and 4B depict the heavy and light chain variable
region sequences of anti-Notch3 monoclonal antibody MAb 256A-4 (SEQ
ID NO:2 and SEQ ID NO:3, respectively), with CDR regions
underlined.
[0023] FIGS. 5A and 5B depict the heavy and light chain variable
region sequences of anti-Notch3 monoclonal antibody MAb 256A-8 (SEQ
ID NO: 4 and SEQ ID NO:5, respectively), with CDR regions
underlined.
[0024] FIG. 6 depicts a luciferase reporter assay of Example 5
showing inhibitory effects by anti-Notch3 MAbs on the Notch3 ligand
Jagged 1.
[0025] FIG. 7 depicts the luciferase reporter assay showing
inhibitory effects by anti-Notch3 MAbs on the Notch3 ligand Jagged
2.
[0026] FIG. 8 depicts the luciferase reporter assay showing
inhibitory effects by anti-Notch3 MAbs on the Notch3 ligand
DLL4.
[0027] FIGS. 9A and 9B depict the luciferase reporter assay showing
inhibitory effects to native Notch3 in ovarian cancer cells by
anti-Notch3 MAbs. (9A) Human ovarian cancer cell line, OV/CAR3 and
(9B) Human ovarian cancer cell line, A2780.
[0028] FIG. 10 depicts the apoptosis assay of Example 6 showing
that cell survival effect induced by Jagged1 was inhibited by
anti-Notch3 MAbs.
[0029] FIGS. 11A and 11B depict the inhibitory effect of
anti-Notch3 MAbs on cell migration (11A) and invasion (11B) of
Example 7.
[0030] FIG. 12 depicts a schematic diagram of the Notch1-Notch3
domain-swap protein expressed as a fusion protein with human IgG/Fc
linked to C-terminus.
[0031] FIG. 13A depicts an ELISA using anti-human Fc control
antibody as the detection antibody showing that the proteins of
FIG. 12 were expressed in conditioned medium.
[0032] FIG. 13B depicts an ELISA using 256A-4 as the detection
antibody.
[0033] FIG. 13C depicts an ELISA using 256A-8 as the detection
antibody.
[0034] FIG. 13D depicts an ELISA using a positive control antibody
256A-13 as the detection antibody.
[0035] FIGS. 14A and 14B depict the comparison of the engineered
Notch3 leader peptide coding sequence (SEQ ID NO:47) to the native
Notch3 leader peptide coding sequence (SEQ ID NO:48) (NCBI
GENBANK.RTM. Accession No. NM_000435) showing the changes of
nucleotides (14A) and the translated amino acid sequence of the
engineered Notch leader peptide sequence (SEQ ID NO:6) (14B).
[0036] FIG. 15 depicts the generation of domain swap construct by
PCR-SOE method. Arrow bars represent PCR primers. Open bar, Notch3
sequence. Filled bar, Notch1 sequence.
[0037] FIG. 16 depicts the amino acid sequences used in the Notch3
LIN12 domain epitope mapping of the MAb 256A-4 and 256A-8.
[0038] FIG. 17 depicts the amino acid sequences used in the Notch3
dimerization domain epitope mapping of the MAb 256A-4 and
256A-8.
[0039] FIG. 18 depicts a schematic of the epitope binding site for
MAb 256A-4 and 256A-8.
DETAILED DESCRIPTION
[0040] This invention is not limited to the particular methodology,
protocols, cell lines, vectors, or reagents described herein
because they may vary. Further, the terminology used herein is for
the purpose of describing particular embodiments only and is not
intended to limit the scope of the present invention. As used
herein and in the appended claims, the singular forms "a", "an",
and "the" include plural reference unless the context clearly
dictates otherwise, e.g., reference to "a host cell" includes a
plurality of such host cells. Unless defined otherwise, all
technical and scientific terms and any acronyms used herein have
the same meanings as commonly understood by one of ordinary skill
in the art in the field of the invention. Although any methods and
materials similar or equivalent to those described herein can be
used in the practice of the present invention, the exemplary
methods, devices, and materials are described herein.
[0041] All patents and publications mentioned herein are
incorporated herein by reference to the extent allowed by law for
the purpose of describing and disclosing the proteins, enzymes,
vectors, host cells, and methodologies reported therein that might
be used with the present invention. However, nothing herein is to
be construed as an admission that the invention is not entitled to
antedate such disclosure by virtue of prior invention.
Definitions
[0042] Terms used throughout this application are to be construed
with ordinary and typical meaning to those of ordinary skill in the
art. However, Applicants desire that the following terms be given
the particular definitions as defined below.
[0043] The phrase "substantially identical" with respect to an
antibody chain polypeptide sequence may be construed as an antibody
chain exhibiting at least 70%, or 80%, or 90%, or 95% sequence
identity to the reference polypeptide sequence. The term with
respect to a nucleic acid sequence may be construed as a sequence
of nucleotides exhibiting at least about 85%, or 90%, or 95%, or
97% sequence identity to the reference nucleic acid sequence.
[0044] The term "identity" or "homology" shall be construed to mean
the percentage of amino acid residues in the candidate sequence
that are identical with the residue of a corresponding sequence to
which it is compared, after aligning the sequences and introducing
gaps, if necessary to achieve the maximum percent identity for the
entire sequence, and not considering any conservative substitutions
as part of the sequence identity. Neither N- nor C-terminal
extensions nor insertions shall be construed as reducing identity
or homology. Methods and computer programs for the alignment are
well known in the art. Sequence identity may be measured using
sequence analysis software.
[0045] The term "antibody" is used in the broadest sense, and
specifically covers monoclonal antibodies (including full length
monoclonal antibodies), polyclonal antibodies, and multispecific
antibodies (e.g., bispecific antibodies), and antibody fragments so
long as they exhibit the desired biological activity. Antibodies
(Abs) and immunoglobulins (Igs) are glycoproteins having the same
structural characteristics. While antibodies exhibit binding
specificity to a specific target, immunoglobulins include both
antibodies and other antibody-like molecules which lack target
specificity. The antibodies of the invention can be of any type
(e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2,
IgG3, IgG4, IgA1 and IgA2) or subclass. Native antibodies and
immunoglobulins are usually heterotetrameric glycoproteins of about
150,000 Daltons, composed of two identical light (L) chains and two
identical heavy (H) chains. Each heavy chain has at one end a
variable domain (V.sub.H) followed by a number of constant domains.
Each light chain has a variable domain at one end (V.sub.L) and a
constant domain at its other end.
[0046] As used herein, "anti-Notch3 antibody" means an antibody
which binds specifically to human Notch3 in such a manner so as to
inhibit or substantially reduce the binding of Notch3 to its
ligands or to inhibit Notch 3 signaling.
[0047] The term "variable" in the context of variable domain of
antibodies, refers to the fact that certain portions of the
variable domains differ extensively in sequence among antibodies
and are used in the binding and specificity of each particular
antibody for its particular target. However, the variability is not
evenly distributed through the variable domains of antibodies. It
is concentrated in three segments called complementarity
determining regions (CDRs; i.e., CDR1, CDR2, and CDR3) also known
as hypervariable regions both in the light chain and the heavy
chain variable domains. The more highly conserved portions of
variable domains are called the framework (FR). The variable
domains of native heavy and light chains each comprise four FR
regions, largely a adopting a 8-sheet configuration, connected by
three CDRs, which form loops connecting, and in some cases forming
part of, the .beta.-sheet structure. The CDRs in each chain are
held together in close proximity by the FR regions and, with the
CDRs from the other chain, contribute to the formation of the
target binding site of antibodies (see Kabat, et al. Sequences of
Proteins of Immunological Interest, National Institute of Health,
Bethesda, Md. (1987)). As used herein, numbering of immunoglobulin
amino acid residues is done according to the immunoglobulin amino
acid residue numbering system of Kabat, et al., unless otherwise
indicated.
[0048] The term "antibody fragment" refers to a portion of a
full-length antibody, generally the target binding or variable
region. Examples of antibody fragments include F(ab), F(ab'),
F(ab').sub.2 and Fv fragments. The phrase "functional fragment or
analog" of an antibody is a compound having qualitative biological
activity in common with a full-length antibody. For example, a
functional fragment or analog of an anti-Notch3 antibody is one
which can bind to a Notch3 receptor in such a manner so as to
prevent or substantially reduce the ability of the receptor to bind
to its ligands or initiate signaling. As used herein, "functional
fragment" with respect to antibodies, refers to Fv, F(ab) and
F(ab').sub.2 fragments. An "Fv" fragment consists of a dimer of one
heavy and one light chain variable domain in a tight, non-covalent
association (V.sub.H-V.sub.L dimer). It is in this configuration
that the three CDRs of each variable domain interact to define a
target binding site on the surface of the V.sub.H-V.sub.L dimer.
Collectively, the six CDRs confer target binding specificity to the
antibody. However, even a single variable domain (or half of an Fv
comprising only three CDRs specific for a target) has the ability
to recognize and bind target, although at a lower affinity than the
entire binding site.
[0049] "Single-chain Fv" or "sFv" antibody fragments comprise the
V.sub.H and V.sub.L domains of an antibody, wherein these domains
are present in a single polypeptide chain. Generally, the Fv
polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains which enables the sFv to form the
desired structure for target binding.
[0050] The term "diabodies" refers to small antibody fragments with
two antigen-binding sites, which fragments comprise a heavy chain
variable domain (V.sub.H) connected to a light chain variable
domain (V.sub.L) in the same polypeptide chain. By using a linker
that is too short to allow pairing between the two domains on the
same chain, the domains are forced to pair with the complementary
domains of another changing and create two antigen-binding
sites.
[0051] The F(ab) fragment contains the constant domain of the light
chain and the first constant domain (CH1) of the heavy chain.
F(ab') fragments differ from F(ab) fragments by the addition of a
few residues at the carboxyl terminus of the heavy chain CH1 domain
including one or more cysteines from the antibody hinge region.
F(ab') fragments are produced by cleavage of the disulfide bond at
the hinge cysteines of the F(ab').sub.2 pepsin digestion product.
Additional chemical couplings of antibody fragments are known to
those of ordinary skill in the art.
[0052] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies herein specifically include "chimeric" antibodies
(immunoglobulins) in which a portion of the heavy and/or light
chain is identical with or homologous to corresponding sequences in
antibodies derived from a particular species or belonging to a
particular antibody class or subclass, while the remainder of the
chain(s) is identical with or homologous to corresponding sequences
in antibodies derived from another species or belonging to another
antibody class or subclass, as well as fragments of such
antibodies, so long as they exhibit the desired biological activity
(U.S. Pat. No. 4,816,567; and Morrison, et al., Proc Natl Aced Sci
USA 81:6851 (1984)). Monoclonal antibodies are highly specific,
being directed against a single target site. Furthermore, in
contrast to conventional (polyclonal) antibody preparations which
typically include different antibodies directed against different
determinants (epitopes), each monoclonal antibody is directed
against a single determinant on the target. In addition to their
specificity, monoclonal antibodies are advantageous in that they
may be synthesized by the hybridoma culture, uncontaminated by
other immunoglobulins. The modifier "monoclonal" indicates the
character of the antibody as being obtained from a substantially
homogeneous population of antibodies, and is not to be construed as
requiring production of the antibody by any particular method. For
example, the monoclonal antibodies for use with the present
invention may be isolated from phage antibody libraries using well
known techniques. The parent monoclonal antibodies to be used in
accordance with the present invention may be made by the hybridoma
method first described by Kohler, et al., Nature 256:495 (1975), or
may be made by recombinant methods.
[0053] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
target-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. In general, the
humanized antibody will comprise substantially all of at least one,
and typically two, variable domains, in which all or substantially
all of the CDR regions correspond to those of a non-human
immunoglobulin and all or substantially all of the FR regions are
those of a human immunoglobulin template sequence. The humanized
antibody may also comprise at least a portion of an immunoglobulin
constant region (Fc), typically that of a human immunoglobulin
template chosen.
[0054] The terms "cell," "cell line," and "cell culture" include
progeny. It is also understood that all progeny may not be
precisely identical in DNA content, due to deliberate or
inadvertent mutations. Variant progeny that have the same function
or biological property, as screened for in the originally
transformed cell, are included. The "host cells" used in the
present invention generally are prokaryotic or eukaryotic
hosts.
[0055] "Transformation" of a cellular organism, cell, or cell line
with DNA means introducing DNA into the target cell so that the DNA
is replicable, either as an extrachromosomal element or by
chromosomal integration. "Transfection" of a cell or organism with
DNA refers to the taking up of DNA, e.g., an expression vector, by
the cell or organism whether or not any coding sequences are in
fact expressed. The terms "transfected host cell" and "transformed"
refer to a cell in which DNA was introduced. The cell is termed
"host cell" and it may be either prokaryotic or eukaryotic. Typical
prokaryotic host cells include various strains of E. coli. Typical
eukaryotic host cells are mammalian, such as Chinese hamster ovary
or cells of human origin. The introduced DNA sequence may be from
the same species as the host cell or a different species from the
host cell, or it may be a hybrid DNA sequence, containing some
foreign and some homologous DNA.
[0056] The term "vector" means a DNA construct containing a DNA
sequence which is operably linked to a suitable control sequence
capable of effecting the expression of the DNA sequence in a
suitable host. Such control sequences include a promoter to effect
transcription, an optional operator sequence to control such
transcription, a sequence encoding suitable mRNA ribosome binding
sites, and sequences which control the termination of transcription
and translation. The vector may be a plasmid, a phage particle, or
simply a potential genomic insert. Once transformed into a suitable
host, the vector may replicate and function independently of the
host genome, or may in some instances, integrate into the genome
itself. In the present specification, "plasmid" and "vector" are
sometimes used interchangeably, as the plasmid is the most commonly
used form of vector. However, the invention is intended to include
such other forms of vectors which serve equivalent function as and
which are, or become, known in the art.
[0057] "Mammal" for purposes of treatment refers to any animal
classified as a mammal, including human, domestic and farm animals,
nonhuman primates, and zoo, sports, or pet animals, such as dogs,
horses, cats, cows, etc.
[0058] The word "label" when used herein refers to a detectable
compound or composition which can be conjugated directly or
indirectly to a molecule or protein, e.g., an antibody. The label
may itself be detectable (e.g., radioisotope labels or fluorescent
labels) or, in the case of an enzymatic label, may catalyze
chemical alteration of a substrate compound or composition which is
detectable.
[0059] As used herein, "solid phase" means a non-aqueous matrix to
which the antibody of the present invention can adhere. Examples of
solid phases encompassed herein include those formed partially or
entirely of glass (e.g., controlled pore glass), polysaccharides
(e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol,
and silicones. In certain embodiments, depending on the context,
the solid phase can comprise the well of an assay plate; in others
it is a purification column (e.g., an affinity chromatography
column).
[0060] As used herein, the term "Notch3-mediated disorder" means a
condition or disease which is characterized by the overexpression
and/or hypersensitivity of the Notch3 receptor. Specifically it
would be construed to include conditions associated with cancers
such as non-small cell lung cancer, ovarian cancer, and T-cell
acute lymphoblastic leukemia. Other cancers including pancreatic,
prostate cancer, plasma cell neoplasms (e.g., multiple myeloma,
plasma cell leukemia and extramedullary plasmacytoma),
neuroblastoma and extramedullary plasmacytoma are also encompassed
under the scope of this term. Other types of diseases include
lymphoma, Alagille syndrome, liver disease involving aberrant
vascularization, neurologic diseases, diabetes, diseases involving
vascular cell fate, and rheumatoid arthritis.
Notch 3 Receptor Immunogen for Generating Antibodies
[0061] Soluble targets or fragments thereof can be used as
immunogens for generating antibodies. The antibody is directed
against the target of interest. Preferably, the target is a
biologically important polypeptide and administration of the
antibody to a mammal suffering from a disease or disorder can
result in a therapeutic benefit in that mammal. Whole cells may be
used as the immunogen for making antibodies. The immunogen may be
produced recombinantly or made using synthetic methods. The
immunogen may also be isolated from a natural source.
[0062] For transmembrane molecules, such as receptors, fragments of
these (e.g., the extracellular domain of a receptor) can be used as
the immunogen. Alternatively, cells expressing the transmembrane
molecule can be used as the immunogen. Such cells can be derived
from a natural source (e.g., cancer cell lines) or may be cells
which have been transformed by recombinant techniques to
over-express the transmembrane molecule. Other forms of the
immunogen useful for preparing antibodies will be apparent to those
in the art.
[0063] Alternatively, a gene or a cDNA encoding human Notch3
receptor may be cloned into a plasmid or other expression vector
and expressed in any of a number of expression systems according to
methods well known to those of skill in the art. Methods of cloning
and expressing Notch3 receptor and the nucleic acid sequence for
human Notch3 receptor are known (see, for example, U.S. Pat. Nos.
5,821,332 and 5,759,546). Because of the degeneracy of the genetic
code, a multitude of nucleotide sequences encoding Notch3 receptor
protein or polypeptides may be used. One may vary the nucleotide
sequence by selecting combinations based on possible codon choices.
These combinations are made in accordance with the standard triplet
genetic code as applied to the nucleotide sequence that codes for
naturally occurring Notch3 receptor and all such variations may be
considered. Any one of these polypeptides may be used in the
immunization of an animal to generate antibodies that bind to human
Notch3 receptor.
[0064] Recombinant Notch3 proteins from other species may also be
used as immunogen to generate antibodies because of the high degree
of conservation of the amino acid sequence of Notch3. A comparison
between human and mouse Notch3 showed over 90% amino acid sequence
identity between the two species.
[0065] The immunogen Notch3 receptor may, when beneficial, be
expressed as a fusion protein that has the Notch3 receptor attached
to a fusion segment. The fusion segment often aids in protein
purification, e.g., by permitting the fusion protein to be isolated
and purified by affinity chromatography, but can also be used to
increase immunogenicity. Fusion proteins can be produced by
culturing a recombinant cell transformed with a fusion nucleic acid
sequence that encodes a protein including the fusion segment
attached to either the carboxyl and/or amino terminal end of the
protein. Fusion segments may include, but are not limited to,
immunoglobulin Fc regions, glutathione-S-transferase,
.beta.-galactosidase, a poly-histidine segment capable of binding
to a divalent metal ion, and maltose binding protein.
[0066] Recombinant Notch3 receptor protein as described in Example
1 was used to immunize mice to generate the hybridomas that produce
the monoclonal antibodies of the present invention. Exemplary
polypeptides comprise all or a portion of SEQ ID NO. 1 or variants
thereof.
Antibody Generation
[0067] The antibodies of the present invention may be generated by
any suitable method known in the art. The antibodies of the present
invention may comprise polyclonal antibodies. Methods of preparing
polyclonal antibodies are known to the skilled artisan (Harlow, et
al., Antibodies: a Laboratory Manual, Cold spring Harbor Laboratory
Press, 2nd ed. (1988), which is hereby incorporated herein by
reference in its entirety).
[0068] For example, an immunogen as described in Example 1 may be
administered to various host animals including, but not limited to,
rabbits, mice, rats, etc., to induce the production of sera
containing polyclonal antibodies specific for the antigen. The
administration of the immunogen may entail one or more injections
of an immunizing agent and, if desired, an adjuvant. Various
adjuvants may be used to increase the immunological response,
depending on the host species, and include but are not limited to,
Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide, surface active substances such as lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet
hemocyanins, dinitrophenol, and potentially useful human adjuvants
such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
Additional examples of adjuvants which may be employed include the
MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose
dicorynomycolate). Immunization protocols are well known in the art
and may be performed by any method that elicits an immune response
in the animal host chosen. Adjuvants are also well known in the
art.
[0069] Typically, the immunogen (with or without adjuvant) is
injected into the mammal by multiple subcutaneous or
intraperitoneal injections, or intramuscularly or through IV. The
immunogen may include a Notch3 polypeptide, a fusion protein, or
variants thereof. Depending upon the nature of the polypeptides
(i.e., percent hydrophobicity, percent hydrophilicity, stability,
net charge, isoelectric point etc.), it may be useful to conjugate
the immunogen to a protein known to be immunogenic in the mammal
being immunized. Such conjugation includes either chemical
conjugation by derivatizing active chemical functional groups to
both the immunogen and the immunogenic protein to be conjugated
such that a covalent bond is formed, or through fusion-protein
based methodology, or other methods known to the skilled artisan.
Examples of such immunogenic proteins include, but are not limited
to, keyhole limpet hemocyanin, ovalbumin, serum albumin, bovine
thyroglobulin, soybean trypsin inhibitor, and promiscuous T helper
peptides. Various adjuvants may be used to increase the
immunological response as described above.
[0070] The antibodies of the present invention comprise monoclonal
antibodies. Monoclonal antibodies are antibodies which recognize a
single antigenic site. Their uniform specificity makes monoclonal
antibodies much more useful than polyclonal antibodies, which
usually contain antibodies that recognize a variety of different
antigenic sites. Monoclonal antibodies may be prepared using
hybridoma technology, such as those described by Kohler, et al.,
Nature 256:495 (1975); U.S. Pat. No. 4,376,110; Harlow, et al.,
Antibodies: A Laboratory Manual, Cold spring Harbor Laboratory
Press, 2nd ed. (1988) and Hammerling, et al., Monoclonal Antibodies
and T-Cell Hybridomas, Elsevier (1981), recombinant DNA methods, or
other methods known to the artisan. Other examples of methods which
may be employed for producing monoclonal antibodies include, but
are not limited to, the human B-cell hybridoma technique (Kosbor,
et al., Immunology Today 4:72 (1983); Cole, et al., Proc Natl Acad
Sci USA 80:2026 (1983)), and the EBV-hybridoma technique (Cole, et
al., Monoclonal Antibodies and Cancer Therapy, pp. 77-96, Alan R.
Liss (1985)). Such antibodies may be of any immunoglobulin class
including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The
hybridoma producing the mAb of this invention may be cultivated in
vitro or in vivo.
[0071] In the hybridoma model, a host such as a mouse, a humanized
mouse, a mouse with a human immune system, hamster, rabbit, camel,
or any other appropriate host animal, is immunized to elicit
lymphocytes that produce or are capable of producing antibodies
that will specifically bind to the protein used for immunization.
Alternatively, lymphocytes may be immunized in vitro. Lymphocytes
then are fused with myeloma cells using a suitable fusing agent,
such as polyethylene glycol, to form a hybridoma cell (Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press, pp.
59-103 (1986)).
[0072] Generally, in making antibody-producing hybridomas, either
peripheral blood lymphocytes ("PBLs") are used if cells of human
origin are desired, or spleen cells or lymph node cells are used if
non-human mammalian sources are desired. The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent,
such as polyethylene glycol, to form a hybridoma cell (Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press, pp.
59-103 (1986)). Immortalized cell lines are usually transformed
mammalian cells, particularly myeloma cells of rodent, bovine or
human origin. Typically, a rat or mouse myeloma cell line is
employed. The hybridoma cells may be cultured in a suitable culture
medium that preferably contains one or more substances that inhibit
the growth or survival of the unfused, immortalized cells. For
example, if the parental cells lack the enzyme hypoxanthine guanine
phosphoribosyl transferase (HGPRT or HPRT), the culture medium for
the hybridomas typically will include hypoxanthine, aminopterin,
and thymidine ("HAT medium"), substances that prevent the growth of
HGPRT-deficient cells.
[0073] Preferred immortalized cell lines are those that fuse
efficiently, support stable high-level production of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. Among these myeloma cell lines are
murine myeloma lines, such as those derived from the MOPC-21 and
MPC-11 mouse tumors available from the Salk Institute Cell
Distribution Center, San Diego, Calif., and SP2/0 or X63-Ag8-653
cells available from the American Type Culture Collection (ATCC),
Manassas, Va., USA. Human myeloma and mouse-human heteromyeloma
cell lines also have been described for the production of human
monoclonal antibodies (Kozbor, J Immunol 133:3001 (1984); Brodeur,
et al., Monoclonal Antibody Production Techniques and Applications,
Marcel Dekker, Inc, pp. 51-63 (1987)). The mouse myeloma cell line
NSO may also be used (European Collection of Cell Cultures,
Salisbury, Wilshire, UK).
[0074] The culture medium in which hybridoma cells are grown is
assayed for production of monoclonal antibodies directed against
Notch3. The binding specificity of monoclonal antibodies produced
by hybridoma cells may be determined by immunoprecipitation or by
an in vitro binding assay, such as radioimmunoassay (RIA) or
enzyme-linked immunoabsorbent assay (ELISA). Such techniques are
known in the art and within the skill of the artisan. The binding
affinity of the monoclonal antibody to Notch3 can, for example, be
determined by a Scatchard analysis (Munson, et al., Anal Biochem
107:220 (1980)).
[0075] After hybridoma cells are identified that produce antibodies
of the desired specificity, affinity, and/or activity, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods (Goding, Monoclonal Antibodies: Principles and
Practice, Academic Press, pp. 59-103 (1986)). Suitable culture
media for this purpose include, for example, Dulbecco's Modified
Eagle's Medium (D-MEM) or RPMI-1640 medium. In addition, the
hybridoma cells may be grown in vivo as ascites tumors in an
animal.
[0076] The monoclonal antibodies secreted by the subclones are
suitably separated or isolated from the culture medium, ascites
fluid, or serum by conventional immunoglobulin purification
procedures such as, for example, protein A-SEPHAROSE.RTM. affinity
media, hydroxylaptite chromatography, gel exclusion chromatography,
gel electrophoresis, dialysis, or affinity chromatography.
[0077] A variety of methods exist in the art for the production of
monoclonal antibodies and thus, the invention is not limited to
their sole production in hybridomas. For example, the monoclonal
antibodies may be made by recombinant DNA methods, such as those
described in U.S. Pat. No. 4,816,567. In this context, the term
"monoclonal antibody" refers to an antibody derived from a single
eukaryotic, phage, or prokaryotic clone. DNA encoding the
monoclonal antibodies of the invention is readily isolated and
sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains of murine antibodies, or
such chains from human, humanized, or other sources) (Innis, et al.
In PCR Protocols. A Guide to Methods and Applications, Academic
(1990), Sanger, et al., Proc Natl Acad Sci 74:5463 (1977)). The
hybridoma cells serve as a source of such DNA. Once isolated, the
DNA may be placed into expression vectors, which are then
transfected into host cells such as E. coli cells, NSO cells,
Simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma
cells that do not otherwise produce immunoglobulin protein, to
obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also may be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences (U.S.
Pat. No. 4,816,567; Morrison, et al., Proc Natl Acad Sci USA
81:6851 (1984)) or by covalently joining to the immunoglobulin
coding sequence all or part of the coding sequence for a
non-immunoglobulin polypeptide. Such a non-immunoglobulin
polypeptide can be substituted for the constant domains of an
antibody of the invention, or can be substituted for the variable
domains of one antigen-combining site of an antibody of the
invention to create a chimeric bivalent antibody.
[0078] The antibodies may be monovalent antibodies. Methods for
preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy chain. The heavy
chain is truncated generally at any point in the Fc region so as to
prevent heavy chain cross-linking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent cross-linking.
[0079] Antibody fragments which recognize specific epitopes may be
generated by known techniques. Traditionally, these fragments were
derived via proteolytic digestion of intact antibodies (see, e.g.,
Morimoto, et al., J Biochem Biophys Methods 24:107 (1992); Brennan,
et al., Science 229:81 (1985)). For example, Fab and F(ab').sub.2
fragments of the invention may be produced by proteolytic cleavage
of immunoglobulin molecules, using enzymes such as papain (to
produce Fab fragments) or pepsin (to produce F(ab').sub.2
fragments). F(ab').sub.2 fragments contain the variable region, the
light chain constant region and the CH1 domain of the heavy chain.
However, these fragments can now be produced directly by
recombinant host ells. For example, the antibody fragments can be
isolated from an antibody phage library. Alternatively,
F(ab').sub.2-SH fragments can be directly recovered from E. coli
and chemically coupled to form F(ab').sub.2 fragments (Carter, et
al., Bio/Technology 10:163 (1992). According to another approach,
F(ab').sub.2 fragments can be isolated directly from recombinant
host cell culture. Other techniques for the production of antibody
fragments will be apparent to the skilled practitioner. In other
embodiments, the antibody of choice is a single chain Fv fragment
(Fv) (PCT patent application WO 93/16185).
[0080] For some uses, including in vivo use of antibodies in humans
and in vitro detection assays, it may be preferable to use
chimeric, humanized, or human antibodies. A chimeric antibody is a
molecule in which different portions of the antibody are derived
from different animal species, such as antibodies having a variable
region derived from a murine monoclonal antibody and a human
immunoglobulin constant region. Methods for producing chimeric
antibodies are known in the art. See e.g., Morrison, Science
229:1202 (1985); Oi, et al., Bio Techniques 4:214 (1986); Gillies,
et al., J Immunol Methods 125:191 (1989); U.S. Pat. Nos. 5,807,715;
4,816,567; and 4,816397, which are incorporated herein by reference
in their entirety.
[0081] A humanized antibody is designed to have greater homology to
a human immunoglobulin than animal-derived monoclonal antibodies.
Humanization is a technique for making a chimeric antibody wherein
substantially less than an intact human variable domain has been
substituted by the corresponding sequence from a non-human species.
Humanized antibodies are antibody molecules generated in a
non-human species that bind the desired antigen having one or more
complementarity determining regions (CDRs) from the non-human
species and framework (FR) regions from a human immunoglobulin
molecule. Often, framework residues in the human framework regions
will be substituted with the corresponding residue from the CDR
donor antibody to alter, preferably improve, antigen binding. These
framework substitutions are identified by methods well known in the
art, e.g., by modeling of the interactions of the CDR and framework
residues to identify framework residues important for antigen
binding and sequence comparison to identify unusual framework
residues at particular positions. See, e.g., U.S. Pat. No.
5,585,089; Riechmann, et al., Nature 332:323 (1988), which are
incorporated herein by reference in their entireties. Antibodies
can be humanized using a variety of techniques known in the art
including, for example, CDR-grafting (EP 239,400; PCT publication
WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and 5,585,089),
veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular
Immunology 28:489 (1991); Studnicka, et al., Protein Engineering
7:805 (1994); Roguska, et al., Proc Natl Acad Sci USA 91:969
(1994)), and chain shuffling (U.S. Pat. No. 5,565,332).
[0082] Generally, a humanized antibody has one or more amino acid
residues introduced into it from a source that is non-human. These
non-human amino acid residues are often referred to as "import"
residues, which are typically taken from an "import" variable
domain. Humanization can be essentially performed following the
methods of Winter and co-workers (Jones, et al., Nature 321:522
(1986); Riechmann, et al., Nature 332:323 (1988); Verhoeyen, et
al., Science 239:1534 (1988)), by substituting non-human CDRs or
CDR sequences for the corresponding sequences of a human antibody.
Accordingly, such "humanized" antibodies are chimeric antibodies
(U.S. Pat. No. 4,816,567), wherein substantially less than an
intact human variable domain has been substituted by the
corresponding sequence from a non-human species. In practice,
humanized antibodies are typically human antibodies in which some
CDR residues and possible some FR residues are substituted from
analogous sites in rodent antibodies.
[0083] It is further important that humanized antibodies retain
high affinity for the antigen and other favorable biological
properties. To achieve this goal, according to a preferred method,
humanized antibodies are prepared by a process of analysis of the
parental sequences and various conceptual humanized products using
three-dimensional models of the parental and humanized sequences.
Three-dimensional immunoglobulin models are commonly available and
are familiar to those skilled in the art. Computer programs are
available which illustrate and display probable three-dimensional
conformational structures of selected candidate immunoglobulin
sequences. Inspection of these displays permits analysis of the
likely role of certain residues in the functioning of the candidate
immunoglobulin sequence, i.e., the analysis of residues that
influence the ability of the candidate immunoglobulin sequences,
i.e., the analysis of residues that influence the ability of the
candidate immunoglobulin to bind its antigen. In this way, FR
residues can be selected and combined from the recipient and import
sequences so that the desired antibody characteristic, such as
increased affinity for the target antigen(s), is maximized,
although it is the CDR residues that directly and most
substantially influence antigen binding.
[0084] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is important to
reduce antigenicity. According to an exemplary method, the
so-called "best-fit" method, the sequence of the variable domain of
a non-human antibody is screened against the entire library of
known human variable-domain sequences. The human sequence which is
closest to that of that of the non-human parent antibody is then
accepted as the human FR for the humanized antibody (Sims, et al.,
J Immunol 151:2296 (1993); Chothia, et al., J Mol Biol 196:901
(1987)). Another method uses a particular framework derived from
the consensus sequence of all human antibodies of a particular
subgroup of light or heavy chains. The same framework may be used
for several different humanized antibodies (Carter, et al., Proc
Natl Acad Sci USA 89:4285 (1992); Presta, et al., J Immunol
151:2623 (1993)).
[0085] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also, U.S. Pat. Nos.
4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and
WO 91/10741; each of which is incorporated herein by reference in
its entirety. The techniques of Cole, et al. and Boerder, et al.
are also available for the preparation of human monoclonal
antibodies (Cole, et al., Monoclonal Antibodies and Cancer Therapy,
Alan R. Riss (1985); and Boerner, et al., J Immunol 147:86
(1991)).
[0086] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non-functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then bred to produce
homozygous offspring which express human antibodies. See, e.g.,
Jakobovits, et al., Proc Natl Acad Sci USA 90:2551 (1993);
Jakobovits, et al., Nature 362:255 (1993); Bruggermann, et al.,
Year in Immunol 7:33 (1993); Duchosal, et al., Nature 355:258
(1992)). The transgenic mice are immunized in the normal fashion
with a selected antigen, e.g., all or a portion of a polypeptide of
the invention. Monoclonal antibodies directed against the antigen
can be obtained from the immunized, transgenic mice using
conventional hybridoma technology. The human immunoglobulin
transgenes harbored by the transgenic mice rearrange during B cell
differentiation, and subsequently undergo class switching and
somatic mutation. Thus, using such a technique, it is possible to
produce therapeutically useful IgG, IgA, IgM and IgE antibodies.
For an overview of this technology for producing human antibodies,
see Lonberg, et al., Int Rev Immunol 13:65-93 (1995). For a
detailed discussion of this technology for producing human
antibodies and human monoclonal antibodies and protocols for
producing such antibodies, see, e.g., PCT publications WO 98/24893;
WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598
877; U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825;
5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; and
5,939,598, which are incorporated by reference herein in their
entirety. In addition, companies such as Abgenix, Inc. (Freemont,
Calif.), Genpharm (San Jose, Calif.), and Medarex, Inc. (Princeton,
N.J.) can be engaged to provide human antibodies directed against a
selected antigen using technology similar to that described
above.
[0087] Also human mAbs could be made by immunizing mice
transplanted with human peripheral blood leukocytes, splenocytes or
bone marrows (e.g., Trioma techniques of XTL). Completely human
antibodies which recognize a selected epitope can be generated
using a technique referred to as "guided selection." In this
approach a selected non-human monoclonal antibody, e.g., a mouse
antibody, is used to guide the selection of a completely human
antibody recognizing the same epitope (Jespers, et al.,
Bio/technology 12:899 (1988)).
[0088] Further, antibodies to the polypeptides of the invention
can, in turn, be utilized to generate anti-idiotype antibodies that
"mimic" polypeptides of the invention using techniques well known
to those skilled in the art (See, e.g., Greenspan, et al., FASEB J
7:437 (1989); Nissinoff, J Immunol 147:2429 (1991)). For example,
antibodies which bind to and competitively inhibit polypeptide
multimerization and/or binding of a polypeptide of the invention to
a ligand can be used to generate anti-idiotypes that "mimic" the
polypeptide multimerization and/or binding domain and, as a
consequence, bind to and neutralize polypeptide and/or its ligand.
Such neutralizing anti-idiotypes or Fab fragments of such
anti-idiotypes can be used in therapeutic regimens to neutralize
polypeptide ligand. For example, such anti-idiotypic antibodies can
be used to bind a polypeptide of the invention and/or to bind its
ligands/receptors, and thereby block its biological activity.
[0089] The antibodies of the present invention may be bispecific
antibodies. Bispecific antibodies are monoclonal, preferably human
or humanized, antibodies that have binding specificities for at
least two different antigens. In the present invention, one of the
binding specificities may be directed towards Notch3, the other may
be for any other antigen, and preferably for a cell-surface
protein, receptor, receptor subunit, tissue-specific antigen,
virally derived protein, virally encoded envelope protein,
bacterially derived protein, or bacterial surface protein, etc.
[0090] Methods for making bispecific antibodies are well known.
Traditionally, the recombinant production of bispecific antibodies
is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities (Milstein, et al., Nature 305:537 (1983)).
Because of the random assortment of immunoglobulin heavy and light
chains, these hybridomas (quadromas) produce a potential mixture of
ten different antibody molecules, of which only one has the correct
bispecific structure. The purification of the correct molecule is
usually accomplished by affinity chromatography steps. Similar
procedures are disclosed in WO 93/08829 and in Traunecker, et al.,
EMBO J 10:3655 (1991).
[0091] Antibody variable domains with the desired binding
specificities (antibody-antigen combining sites) can be fused to
immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin heavy-chain constant domain, comprising at
least part of the hinge, CH2, and CH3 regions. It may have the
first heavy-chain constant region (CH1) containing the site
necessary for light-chain binding present in at least one of the
fusions. DNAs encoding the immunoglobulin heavy-chain fusions and,
if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transformed into a suitable
host organism. For further details of generating bispecific
antibodies see, for example Suresh, et al., Meth In Enzym 121:210
(1986).
[0092] Heteroconjugate antibodies are also contemplated by the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells (U.S.
Pat. No. 4,676,980). It is contemplated that the antibodies may be
prepared in vitro using known methods in synthetic protein
chemistry, including those involving cross-linking agents. For
example, immunotoxins may be constructed using a disulfide exchange
reaction or by forming a thioester bond. Examples of suitable
reagents for this purpose include iminothiolate and
methyl-4-mercaptobutyrimidate and those disclosed, for example, in
U.S. Pat. No. 4,676,980.
[0093] In addition, one can generate single-domain antibodies to
Notch3. Examples of this technology have been described in
WO94/25591 for antibodies derived from Camelidae heavy chain Ig, as
well in US2003/0130496 describing the isolation of single domain
fully human antibodies from phage libraries.
[0094] One can also create a single peptide chain binding molecules
in which the heavy and light chain Fv regions are connected. Single
chain antibodies ("scFv") and the method of their construction are
described in U.S. Pat. No. 4,946,778. Alternatively, Fab can be
constructed and expressed by similar means. All of the wholly and
partially human antibodies are less immunogenic than wholly murine
mAbs, and the fragments and single chain antibodies are also less
immunogenic.
[0095] Antibodies or antibody fragments can be isolated from
antibody phage libraries generated using the techniques described
in McCafferty, et al., Nature 348:552 (1990). Clarkson, et al.,
Nature 352:624 (1991) and Marks, et al., J Mol Biol 222:581 (1991)
describe the isolation of murine and human antibodies,
respectively, using phage libraries. Subsequent publications
describe the production of high affinity (nM range) human
antibodies by chain shuffling (Marks, et al., Bio/Technology 10:779
(1992)), as well as combinatorial infection and in vivo
recombination as a strategy for constructing very large phage
libraries (Waterhouse, et al., Nuc Acids Res 21:2265 (1993)). Thus,
these techniques are viable alternatives to traditional monoclonal
antibody hybridoma techniques for isolation of monoclonal
antibodies.
[0096] The DNA also may be modified, for example, by substituting
the coding sequence for human heavy- and light-chain constant
domains in place of the homologous murine sequences (U.S. Pat. No.
4,816,567; Morrison, et al., Proc Natl Acad Sci USA 81:6851
(1984)).
[0097] Another alternative is to use electrical fusion rather than
chemical fusion to form hybridomas. This technique is well
established. Instead of fusion, one can also transform a B cell to
make it immortal using, for example, an Epstein Barr Virus, or a
transforming gene. See, e.g., "Continuously Proliferating Human
Cell Lines Synthesizing Antibody of Predetermined Specificity,"
Zurawaki, et al., in Monoclonal Antibodies, ed. by Kennett, et al.,
Plenum Press, pp. 19-33. (1980)). Anti-Notch3 mAbs can be raised by
immunizing rodents (e.g., mice, rats, hamsters, and guinea pigs)
with Notch3 protein, fusion protein, or its fragments expressed by
either eukaryotic or prokaryotic systems. Other animals can be used
for immunization, e.g., non-human primates, transgenic mice
expressing immunoglobulins, and severe combined immunodeficient
(SCID) mice transplanted with human B lymphocytes. Hybridomas can
be generated by conventional procedures by fusing B lymphocytes
from the immunized animals with myeloma cells (e.g., Sp2/0 and
NSO), as described earlier (Kohler, et al., Nature 256:495 (1975)).
In addition, anti-Notch3 antibodies can be generated by screening
of recombinant single-chain Fv or Fab libraries from human B
lymphocytes in phage-display systems. The specificity of the mAbs
to Notch3 can be tested by ELISA, Western immunoblotting, or other
immunochemical techniques. The inhibitory activity of the
antibodies on complement activation can be assessed by hemolytic
assays, using sensitized chicken or sheep RBCs for the classical
complement pathway. The hybridomas in the positive wells are cloned
by limiting dilution. The antibodies are purified for
characterization for specificity to human Notch3 by the assays
described above.
Identification of Anti-Notch-3 Antibodies
[0098] The present invention provides antagonist monoclonal
antibodies that inhibit and neutralize the action of Notch3. In
particular, the antibodies of the present invention bind to and
inhibit the activation of Notch3. The antibodies of the present
invention include the antibodies designated 256A-4 and 256A-8,
which are disclosed herein. The present invention also includes
antibodies that bind to the same epitope as one of these
antibodies.
[0099] Candidate anti-Notch3 antibodies were tested by enzyme
linked immunosorbent assay (ELISA), Western immunoblotting, or
other immunochemical techniques. Assays performed to characterize
the individual antibodies are described in the Examples.
[0100] Antibodies of the invention include, but are not limited to,
polyclonal, monoclonal, monovalent, bispecific, heteroconjugate,
multispecific, human, humanized or chimeric antibodies, single
chain antibodies, single-domain antibodies, Fab fragments, F(ab')
fragments, fragments produced by a Fab expression library,
anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id
antibodies to antibodies of the invention), and epitope-binding
fragments of any of the above.
[0101] The antibodies may be human antigen-binding antibody
fragments of the present invention and include, but are not limited
to, Fab, Fab' and F(ab').sub.2, Fd, single-chain Fvs (scFv),
single-chain antibodies, disulfide-linked Fvs (sdFv) and
single-domain antibodies comprising either a VL or VH domain.
Antigen-binding antibody fragments, including single-chain
antibodies, may comprise the variable region(s) alone or in
combination with the entirety or a portion of the following: hinge
region, CH1, CH2, and CH3 domains. Also included in the invention
are antigen-binding fragments comprising any combination of
variable region(s) with a hinge region, CH1, CH2, and CH3 domains.
The antibodies of the invention may be from any animal origin
including birds and mammals. Preferably, the antibodies are from
human, non-human primates, rodents (e.g., mouse and rat), donkey,
sheep, rabbit, goat, guinea pig, camel, horse, or chicken.
[0102] As used herein, "human" antibodies" include antibodies
having the amino acid sequence of a human immunoglobulin and
include antibodies isolated from human immunoglobulin libraries or
from animals transgenic for one or more human immunoglobulin and
that do not express endogenous immunoglobulins, as described infra
and, for example in, U.S. Pat. No. 5,939,598 by Kucherlapati, et
al.
[0103] The antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
Notch3 or may be specific for both Notch3 as well as for a
heterologous epitope, such as a heterologous polypeptide or solid
support material. See, e.g., PCT publications WO 93/17715; WO
92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J Immunol 147:60
(1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920;
5,601,819; Kostelny, et al., J Immunol 148:1547 (1992).
[0104] Antibodies of the present invention may be described or
specified in terms of the epitope(s) or portion(s) of Notch3 which
they recognize or specifically bind. The epitope(s) or polypeptide
portion(s) may be specified as described herein, e.g., by
N-terminal and C-terminal positions, by size in contiguous amino
acid residues, or listed in the Tables and Figures.
[0105] Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that bind
Notch3 polypeptides, which have at least 95%, at least 90%, at
least 85%, at least 80%, at least 75%, at least 70%, at least 65%,
at least 60%, at least 55%, and at least 50% identity (as
calculated using methods known in the art and described herein) to
Notch3 are also included in the present invention. Anti-Notch3
antibodies may also bind with a K.sub.D of less than about
10.sup.-7 M, less than about 10.sup.-6 M, or less than about
10.sup.-5 M to other proteins, such as anti-Notch3 antibodies from
species other than that against which the anti-Notch3 antibody is
directed.
[0106] In specific embodiments, antibodies of the present invention
cross-react with monkey homologues of human Notch3 and the
corresponding epitopes thereof. In a specific embodiment, the
above-described cross-reactivity is with respect to any single
specific antigenic or immunogenic polypeptide, or combination(s) of
the specific antigenic and/or immunogenic polypeptides disclosed
herein.
[0107] Further included in the present invention are antibodies
which bind polypeptides encoded by polynucleotides which hybridize
to a polynucleotide encoding Notch3 under stringent hybridization
conditions. Antibodies of the present invention may also be
described or specified in terms of their binding affinity to a
polypeptide of the invention. Preferred binding affinities include
those with an equilibrium dissociation constant or K.sub.D from
10.sup.-8 to 10.sup.-15 M, 10.sup.-8 to 10.sup.-12 M, 10.sup.-8 to
10.sup.-10 M, or 10.sup.-10 to 10.sup.-12 M. The invention also
provides antibodies that competitively inhibit binding of an
antibody to an epitope of the invention as determined by any method
known in the art for determining competitive binding, for example,
the immunoassays described herein. In preferred embodiments, the
antibody competitively inhibits binding to the epitope by at least
95%, at least 90%, at least 85%, at least 80%, at least 75%, at
least 70%, at least 60%, or at least 50%.
Vectors and Host Cells
[0108] In another aspect, the present invention provides isolated
nucleic acid sequences encoding an antibody as disclosed herein,
vector constructs comprising a nucleotide sequence encoding the
antibodies of the present invention, host cells comprising such a
vector, and recombinant techniques for the production of the
antibody.
[0109] For recombinant production of an antibody, the nucleic acid
encoding it is isolated and inserted into a replicable vector for
further cloning (amplification of the DNA) or for expression. DNA
encoding the antibody is readily isolated and sequenced using
conventional procedures (e.g., by using oligonucleotide probes that
are capable of binding specifically to genes encoding the heavy and
light chains of the antibody). Standard techniques for cloning and
transformation may be used in the preparation of cell lines
expressing the antibodies of the present invention.
Vectors
[0110] Many vectors are available. The vector components generally
include, but are not limited to, one or more of the following: a
signal sequence, an origin of replication, one or more marker
genes, an enhancer element, a promoter, and a transcription
termination sequence. Recombinant expression vectors containing a
nucleotide sequence encoding the antibodies of the present
invention can be prepared using well known techniques. The
expression vectors include a nucleotide sequence operably linked to
suitable transcriptional or translational regulatory nucleotide
sequences such as those derived from mammalian, microbial, viral,
or insect genes. Examples of regulatory sequences include
transcriptional promoters, operators, enhancers, mRNA ribosomal
binding sites, and/or other appropriate sequences which control
transcription and translation initiation and termination.
Nucleotide sequences are "operably linked" when the regulatory
sequence functionally relates to the nucleotide sequence for the
appropriate polypeptide. Thus, a promoter nucleotide sequence is
operably linked to, e.g., the antibody heavy chain sequence if the
promoter nucleotide sequence controls the transcription of the
appropriate nucleotide sequence.
[0111] In addition, sequences encoding appropriate signal peptides
that are not naturally associated with antibody heavy and/or light
chain sequences can be incorporated into expression vectors. For
example, a nucleotide sequence for a signal peptide (secretory
leader) may be fused in-frame to the polypeptide sequence so that
the antibody is secreted to the periplasmic space or into the
medium. A signal peptide that is functional in the intended host
cells enhances extracellular secretion of the appropriate antibody.
The signal peptide may be cleaved from the polypeptide upon
secretion of antibody from the cell. Examples of such secretory
signals are well known and include, e.g., those described in U.S.
Pat. Nos. 5,698,435; 5,698,417; and 6,204,023.
[0112] The vector may be a plasmid vector, a single or
double-stranded phage vector, or a single or double-stranded RNA or
DNA viral vector. Such vectors may be introduced into cells as
polynucleotides by well known techniques for introducing DNA and
RNA into cells. The vectors, in the case of phage and viral vectors
also may be introduced into cells as packaged or encapsulated virus
by well known techniques for infection and transduction. Viral
vectors may be replication competent or replication defective. In
the latter case, viral propagation generally will occur only in
complementing host cells. Cell-free translation systems may also be
employed to produce the protein using RNAs derived from the present
DNA constructs. Such vectors may include the nucleotide sequence
encoding the constant region of the antibody molecule (see, e.g.,
PCT Publications WO 86/05807 and WO 89/01036; and U.S. Pat. No.
5,122,464) and the variable domain of the antibody may be cloned
into such a vector for expression of the entire heavy or light
chain.
[0113] Host Cells
[0114] The antibodies of the present invention can be expressed
from any suitable host cell. Examples of host cells useful in the
present invention include prokaryotic, yeast, or higher eukaryotic
cells and include but are not limited to microorganisms such as
bacteria (e.g., E. coli, B. subtilis) transformed with recombinant
bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors
containing antibody coding sequences; yeast (e.g., Saccharomyces,
Pichia) transformed with recombinant yeast expression vectors
containing antibody coding sequences; insect cell systems infected
with recombinant virus expression vectors (e.g., Baculovirus)
containing antibody coding sequences; plant cell systems infected
with recombinant virus expression vectors (e.g., cauliflower mosaic
virus, CaMV; tobacco mosaic virus, TMV) or transformed with
recombinant plasmid expression vectors (e.g., Ti plasmid)
containing antibody coding sequences; or mammalian cell systems
(e.g., COS, CHO, BHK, 293, 3T3 cells) harboring recombinant
expression constructs containing promoters derived from the genome
of mammalian cells (e.g., metallothionein promoter) or from
mammalian viruses (e.g., the adenovirus late promoter; the vaccinia
virus 7.5K promoter).
[0115] Prokaryotes useful as host cells in the present invention
include gram negative or gram positive organisms such as E. coli,
B. subtilis, Enterobacter, Erwinia, Klebsiella, Proteus,
Salmonella, Serratia, and Shigella, as well as Bacilli,
Pseudomonas, and Streptomyces. One preferred E. coli cloning host
is E. coli 294 (ATCC 31,446), although other strains such as E.
coli B, E. coli X1776 (ATCC 31,537), and E. coli W3110 (ATCC
27,325) are suitable. These examples are illustrative rather than
limiting.
[0116] Expression vectors for use in prokaryotic host cells
generally comprise one or more phenotypic selectable marker genes.
A phenotypic selectable marker gene is, for example, a gene
encoding a protein that confers antibiotic resistance or that
supplies an autotrophic requirement. Examples of useful expression
vectors for prokaryotic host cells include those derived from
commercially available plasmids such as the pKK223-3 vector
(Pharmacia Fine Chemicals, Uppsala, Sweden), PGEM.RTM.1 vector
(Promega Biotec, Madison, Wis., USA), and the pET (Novagen,
Madison, Wis., USA) and pRSET (Invitrogen, Carlsbad, Calif.) series
of vectors (Studier, J Mol Biol 219:37 (1991); Schoepfer, Gene
124:83 (1993)). Promoter sequences commonly used for recombinant
prokaryotic host cell expression vectors include T7, (Rosenberg, et
al., Gene 56:125 (1987)), .beta.-lactamase (penicillinase), lactose
promoter system (Chang, et al., Nature 275:615 (1978); Goeddel, et
al., Nature 281:544 (1979)), tryptophan (trp) promoter system
(Goeddel, et al., Nucl Acids Res 8:4057 (1980)), and tac promoter
(Sambrook, et al., Molecular Cloning, A Laboratory Manual, 2nd ed.,
Cold Spring Harbor Laboratory (1990)).
[0117] Yeasts or filamentous fungi useful in the present invention
include those from the genus Saccharomyces, Pichia, Actinomycetes,
Kluyveromyces, Schizosaccharomyces, Candida, Trichoderma,
Neurospora, and filamentous fungi such as Neurospora, Penicillium,
Tolypocladium, and Aspergillus. Yeast vectors will often contain an
origin of replication sequence from a 2p yeast plasmid, an
autonomously replicating sequence (ARS), a promoter region,
sequences for polyadenylation, sequences for transcription
termination, and a selectable marker gene. Suitable promoter
sequences for yeast vectors include, among others, promoters for
metallothionein, 3-phosphoglycerate kinase (Hitzeman, et al., J
Biol Chem 255:2073 (1980)) or other glycolytic enzymes (Holland, et
al., Biochem 17:4900 (1978)) such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase. Other
suitable vectors and promoters for use in yeast expression are
further described in Fleer, et al., Gene 107:285 (1991). Other
suitable promoters and vectors for yeast and yeast transformation
protocols are well known in the art. Yeast transformation protocols
are well known. One such protocol is described by Hinnen, et al.,
Proc Natl Acad Sci 75:1929 (1978). The Hinnen protocol selects for
Trp.sup.+ transformants in a selective medium.
[0118] Mammalian or insect host cell culture systems may also be
employed to express recombinant antibodies. In principle, any
higher eukaryotic cell culture is workable, whether from vertebrate
or invertebrate culture. Examples of invertebrate cells include
plant and insect cells (Luckow, et al., Bio/Technology 6:47 (1988);
Miller, et al., Genetics Engineering, Setlow, et al., eds. Vol. 8,
pp. 277-9, Plenam Publishing (1986); Mseda, et al., Nature 315:592
(1985)). For example, Baculovirus systems may be used for
production of heterologous proteins. In an insect system,
Autographa californica nuclear polyhedrosis virus (AcNPV) may be
used as a vector to express foreign genes. The virus grows in
Spodoptera frugiperda cells. The antibody coding sequence may be
cloned individually into non-essential regions (for example the
polyhedrin gene) of the virus and placed under control of an AcNPV
promoter (for example the polyhedrin promoter). Other hosts that
have been identified include Aedes, Drosophila melanogaster, and
Bombyx mori. A variety of viral strains for transfection are
publicly available, e.g., the L-1 variant of AcNPV and the Bm-5
strain of Bombyx mori NPV, and such viruses may be used as the
virus herein according to the present invention, particularly for
transfection of Spodoptera frugiperda cells. Moreover, plant cells
cultures of cotton, corn, potato, soybean, petunia, tomato, and
tobacco and also be utilized as hosts.
[0119] Vertebrate cells, and propagation of vertebrate cells, in
culture (tissue culture) has become a routine procedure. See Tissue
Culture, Kruse, et al., eds., Academic Press (1973). Examples of
useful mammalian host cell lines are monkey kidney; human embryonic
kidney line; baby hamster kidney cells; Chinese hamster ovary
cells/-DHFR (CHO, Urlaub, et al., Proc Natl Acad Sci USA 77:4216
(1980)); mouse sertoli cells; human cervical carcinoma cells
(HELA); canine kidney cells; human lung cells; human liver cells;
mouse mammary tumor; and NSO cells.
[0120] Host cells are transformed with the above-described vectors
for antibody production and cultured in conventional nutrient media
modified as appropriate for inducing promoters, transcriptional and
translational control sequences, selecting transformants, or
amplifying the genes encoding the desired sequences. Commonly used
promoter sequences and enhancer sequences are derived from polyoma
virus, Adenovirus 2, Simian virus 40 (SV40), and human
cytomegalovirus (CMV). DNA sequences derived from the SV40 viral
genome may be used to provide other genetic elements for expression
of a structural gene sequence in a mammalian host cell, e.g., SV40
origin, early and late promoter, enhancer, splice, and
polyadenylation sites. Viral early and late promoters are
particularly useful because both are easily obtained from a viral
genome as a fragment which may also contain a viral origin of
replication. Exemplary expression vectors for use in mammalian host
cells are commercially available.
[0121] The host cells used to produce an antibody of this invention
may be cultured in a variety of media. Commercially available media
such as Ham's F10 (Sigma, St Louis, Mo.), Minimal Essential Medium
(MEM, Sigma, St Louis, Mo.), RPMI-1640 (Sigma, St Louis, Mo.), and
Dulbecco's Modified Eagle's Medium (DMEM, Sigma, St Louis, Mo.) are
suitable for culturing host cells. In addition, any of the media
described in Ham, et al., Meth Enzymol 58:44 (1979), Barnes, et
al., Anal Biochem 102:255 (1980), and U.S. Pat. Nos. 4,767,704;
4,657,866; 4,560,655; 5,122,469; 5,712,163; or 6,048,728 may be
used as culture media for the host cells. Any of these media may be
supplemented as necessary with hormones and/or other growth factors
(such as insulin, transferrin, or epidermal growth factor), salts
(such as X-chlorides, where X is sodium, calcium, magnesium; and
phosphates), buffers (such as HEPES), nucleotides (such as
adenosine and thymidine), antibiotics (such as gentamicin), trace
elements (defined as inorganic compounds usually present at final
concentrations in the micromolar range), and glucose or an
equivalent energy source. Any other necessary supplements may also
be included at appropriate concentrations that would be known to
those skilled in the art. The culture conditions, such as
temperature, pH, and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
Polynucleotides Encoding Antibodies
[0122] The invention further provides polynucleotides or nucleic
acids, e.g., DNA, comprising a nucleotide sequence encoding an
antibody of the invention and fragments thereof. Exemplary
polynucleotides include those encoding antibody chains comprising
one or more of the amino acid sequences described herein. The
invention also encompasses polynucleotides that hybridize under
stringent or lower stringency hybridization conditions to
polynucleotides that encode an antibody of the present
invention.
[0123] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. For example, if the nucleotide sequence of the antibody is
known, a polynucleotide encoding the antibody may be assembled from
chemically synthesized oligonucleotides (e.g., as described in
Kutmeier, et al., Bio/Techniques 17:242 (1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing
portions of the sequence encoding the antibody, annealing and
ligating of those oligonucleotides, and then amplification of the
ligated oligonucleotides by PCR.
[0124] Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly A.sup.+ RNA, isolated from, any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention) by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence or by cloning using an oligonucleotide probe specific for
the particular gene sequence to identify, e.g., a cDNA clone from a
cDNA library that encodes the antibody. Amplified nucleic acids
generated by PCR may then be cloned into replicable cloning vectors
using any method well known in the art.
[0125] Once the nucleotide sequence and corresponding amino acid
sequence of the antibody is determined, the nucleotide sequence of
the antibody may be manipulated using methods well known in the art
for the manipulation of nucleotide sequences, e.g., recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example,
the techniques described in Sambrook, et al., Molecular Cloning, A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory (1990);
Ausubel, et al., eds., Current Protocols in Molecular Biology, John
Wiley & Sons (1998), which are both incorporated by reference
herein in their entireties), to generate antibodies having a
different amino acid sequence, for example to create amino acid
substitutions, deletions, and/or insertions.
[0126] In a specific embodiment, the amino acid sequence of the
heavy and/or light chain variable domains may be inspected to
identify the sequences of the CDRs by well known methods, e.g., by
comparison to known amino acid sequences of other heavy and light
chain variable regions to determine the regions of sequence
hypervariability. Using routine recombinant DNA techniques, one or
more of the CDRs may be inserted within framework regions, e.g.,
into human framework regions to humanize a non-human antibody, as
described supra. The framework regions may be naturally occurring
or consensus framework regions, and preferably human framework
regions (see, e.g., Chothia, et al., J Mol Biol 278: 457 (1998) for
a listing of human framework regions). Preferably, the
polynucleotide generated by the combination of the framework
regions and CDRs encodes an antibody that specifically binds a
polypeptide of the invention. Preferably, as discussed supra, one
or more amino acid substitutions may be made within the framework
regions, and, preferably, the amino acid substitutions improve
binding of the antibody to its antigen. Additionally, such methods
may be used to make amino acid substitutions or deletions of one or
more variable region cysteine residues participating in an
intrachain disulfide bond to generate antibody molecules lacking
one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are encompassed by the present invention and within
the skill of the art.
[0127] In addition, techniques developed for the production of
"chimeric antibodies" (Morrison, et al., Proc Natl Acad Sci 81:851
(1984); Neuberger, et al., Nature 312:604 (1984); Takeda, et al.,
Nature 314:452 (1985)) by splicing genes from a mouse antibody
molecule of appropriate antigen specificity together with genes
from a human antibody molecule of appropriate biological activity
can be used. As described supra, a chimeric antibody is a molecule
in which different portions are derived from different animal
species, such as those having a variable region derived from a
murine mAb and a human immunoglobulin constant region, e.g.,
humanized antibodies.
[0128] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,946,778; Bird, Science
242:423 (1988); Huston, et al., Proc Natl Acad Sci USA 85:5879
(1988); and Ward, et al., Nature 334:544 (1989)) can be adapted to
produce single chain antibodies. Single chain antibodies are formed
by linking the heavy and light chain fragments of the Fv region via
an amino acid bridge, resulting in a single chain polypeptide.
Techniques for the assembly of functional Fv fragments in E. coli
may also be used (Skerra, et al., Science 242:1038 (1988)).
Methods of Producing Anti-Notch3 Antibodies
[0129] The antibodies of the invention can be produced by any
method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis or preferably, by recombinant
expression techniques.
[0130] Recombinant expression of an antibody of the invention, or
fragment, derivative, or analog thereof, (e.g., a heavy or light
chain of an antibody of the invention or a single chain antibody of
the invention), requires construction of an expression vector
containing a polynucleotide that encodes the antibody or a fragment
of the antibody. Once a polynucleotide encoding an antibody
molecule has been obtained, the vector for the production of the
antibody may be produced by recombinant DNA technology. An
expression vector is constructed containing antibody coding
sequences and appropriate transcriptional and translational control
signals. These methods include, for example, in vitro recombinant
DNA techniques, synthetic techniques, and in vivo genetic
recombination.
[0131] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the invention.
In one aspect of the invention, vectors encoding both the heavy and
light chains may be co-expressed in the host cell for expression of
the entire immunoglobulin molecule, as detailed below.
[0132] A variety of host-expression vector systems may be utilized
to express the antibody molecules of the invention as described
above. Such host-expression systems represent vehicles by which the
coding sequences of interest may be produced and subsequently
purified, but also represent cells which may, when transformed or
transfected with the appropriate nucleotide coding sequences,
express an antibody molecule of the invention in situ. Bacterial
cells such as E. coli, and eukaryotic cells are commonly used for
the expression of a recombinant antibody molecule, especially for
the expression of whole recombinant antibody molecule. For example,
mammalian cells such as CHO, in conjunction with a vector such as
the major intermediate early gene promoter element from human
cytomegalovirus, are an effective expression system for antibodies
(Foecking, et al., Gene 45:101 (1986); Cockett, et al.,
Bio/Technology 8:2 (1990)).
[0133] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include, but are not limited to, CHO, COS, 293, 3T3, or
myeloma cells.
[0134] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody molecule may be engineered.
Rather than using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for one to two days in
an enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compounds that interact directly or indirectly
with the antibody molecule.
[0135] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler, et
al., Cell 11:223 (1977)), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska, et al., Proc Natl Acad Sci
USA 48:202 (1992)), and adenine phosphoribosyltransferase (Lowy, et
al., Cell 22:817 (1980)) genes can be employed in tk, hgprt or
aprt-cells, respectively. Also, antimetabolite resistance can be
used as the basis of selection for the following genes: dhfr, which
confers resistance to methotrexate (Wigler, et al., Proc Natl Acad
Sci USA 77:357 (1980); O'Hare, et al., Proc Natl Acad Sci USA
78:1527 (1981)); gpt, which confers resistance to mycophenolic acid
(Mulligan, et al., Proc Natl Acad Sci USA 78:2072 (1981)); neo,
which confers resistance to the aminoglycoside G-418 (Wu, et al.,
Biotherapy 3:87 (1991)); and hygro, which confers resistance to
hygromycin (Santerre, et al., Gene 30:147 (1984)). Methods commonly
known in the art of recombinant DNA technology may be routinely
applied to select the desired recombinant clone, and such methods
are described, for example, in Ausubel, et al., eds., Current
Protocols in Molecular Biology, John Wiley & Sons (1993);
Kriegler, Gene Transfer and Expression, A Laboratory Manual,
Stockton Press (1990); and in Chapters 12 and 13, Dracopoli, et
al., eds, Current Protocols in Human Genetics, John Wiley &
Sons (1994); Colberre-Garapin, et al., J Mol Biol 150:1 (1981),
which are incorporated by reference herein in their entireties.
[0136] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington, et
al., "The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells," DNA Cloning, Vol.
3. Academic Press (1987)). When a marker in the vector system
expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number
of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse, et al., Mol Cell Biol 3:257 (1983)).
[0137] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes, and is capable of expressing, both heavy and light
chain polypeptides. In such situations, the light chain should be
placed before the heavy chain to avoid an excess of toxic free
heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc Natl
Acad Sci USA 77:2197 (1980)). The coding sequences for the heavy
and light chains may comprise cDNA or genomic DNA.
[0138] Once an antibody molecule of the invention has been produced
by an animal, chemically synthesized, or recombinantly expressed,
it may be purified by any method known in the art for purification
of an immunoglobulin molecule, for example, by chromatography
(e.g., ion exchange, affinity, particularly by affinity for the
specific antigen after Protein A, and size-exclusion
chromatography), centrifugation, differential solubility, or by any
other standard technique for the purification of proteins. In
addition, the antibodies of the present invention or fragments
thereof can be fused to heterologous polypeptide sequences
described herein or otherwise known in the art, to facilitate
purification.
[0139] The present invention encompasses antibodies recombinantly
fused or chemically conjugated (including both covalently and
non-covalently conjugations) to a polypeptide. Fused or conjugated
antibodies of the present invention may be used for ease in
purification. See e.g., PCT publication WO 93/21232; EP 439,095;
Naramura, et al., Immunol Lett 39:91 (1994); U.S. Pat. No.
5,474,981; Gillies, et al., Proc Natl Acad Sci USA 89:1428 (1992);
Fell, et al., J Immunol 146:2446 (1991), which are incorporated by
reference in their entireties.
[0140] Moreover, the antibodies or fragments thereof of the present
invention can be fused to marker sequences, such as a peptide to
facilitate purification. In preferred embodiments, the marker amino
acid sequence is a hexa-histidine peptide, such as the tag provided
in a pQE vector (QIAGEN, Inc., Valencia, Calif.), among others,
many of which are commercially available. As described in Gentz, et
al., Proc Natl Acad Sci USA 86:821 (1989), for instance,
hexa-histidine provides for convenient purification of the fusion
protein. Other peptide tags useful for purification include, but
are not limited to, the "HA" tag, which corresponds to an epitope
derived from the influenza hemagglutinin protein (Wilson, et al.,
Cell 37:767 (1984)) and the "flag" tag.
Antibody Purification
[0141] When using recombinant techniques, an antibody can be
produced intracellularly, in the periplasmic space, or directly
secreted into the medium. If the antibody is produced
intracellularly, as a first step, the particulate debris, either
host cells or lysed fragments, may be removed, for example, by
centrifugation or ultrafiltration. Carter, et al., Bio/Technology
10:163 (1992) describe a procedure for isolating antibodies which
are secreted to the periplasmic space of E. coli. Briefly, cell
paste is thawed in the presence of sodium acetate (pH 3.5), EDTA,
and phenylmethylsulfonylfluoride (PMSF) over about 30 minutes. Cell
debris can be removed by centrifugation. Where the antibody is
secreted into the medium, supernatants from such expression systems
are generally first concentrated using a commercially available
protein concentration filter, for example, an Amicon or Millipore
Pellicon ultrafiltration unit. A protease inhibitor such as PMSF
may be included in any of the foregoing steps to inhibit
proteolysis and antibiotics may be included to prevent the growth
of adventitious contaminants.
[0142] The antibody composition prepared from the cells can be
purified using, for example, hydroxylapatite chromatography, gel
elecrophoresis, dialysis, and affinity chromatography, with
affinity chromatography being the preferred purification technique.
The suitability of protein A as an affinity ligand depends on the
species and isotype of any immunoglobulin Fc domain that is present
in the antibody. Protein A can be used to purify antibodies that
are based on human IgG1, IgG2 or IgG4 heavy chains (Lindmark, et
al., J Immunol Meth 62:1 (1983)). Protein G is recommended for all
mouse isotypes and for human IgG3 (Guss, et al., EMBO J 5:1567
(1986)). The matrix to which the affinity ligand is attached is
most often agarose, but other matrices are available. Mechanically
stable matrices such as controlled pore glass or
poly(styrenedivinyl)benzene allow for faster flow rates and shorter
processing times than can be achieved with agarose. Where the
antibody comprises a CH3 domain, the Bakerbond ABX.TM. resin (J. T.
Baker; Phillipsburg, N.J.) is useful for purification. Other
techniques for protein purification such as fractionation on an
ion-exchange column, ethanol precipitation, Reverse Phase HPLC,
chromatography on silica, chromatography on heparin SEPHAROSE.RTM.
chromatography on an anion or cation exchange resin (such as a
polyaspartic acid column), chromatofocusing, SDS-PAGE, and ammonium
sulfate precipitation are also available depending on the antibody
to be recovered.
[0143] Following any preliminary purification step(s), the mixture
comprising the antibody of interest and contaminants may be
subjected to low pH hydrophobic interaction chromatography using an
elution buffer at a pH between about 2.5-4.5, preferably performed
at low salt concentrations (e.g., from about 0-0.25M salt).
Pharmaceutical Formulation
[0144] Therapeutic formulations of the polypeptide or antibody may
be prepared for storage as lyophilized formulations or aqueous
solutions by mixing the polypeptide having the desired degree of
purity with optional "pharmaceutically-acceptable" carriers,
excipients or stabilizers typically employed in the art (all of
which are termed "excipients"), i.e., buffering agents, stabilizing
agents, preservatives, isotonifiers, non-ionic detergents,
antioxidants, and other miscellaneous additives. See Remington's
Pharmaceutical Sciences, 16th edition, Osol, Ed. (1980). Such
additives must be nontoxic to the recipients at the dosages and
concentrations employed.
[0145] Buffering agents help to maintain the pH in the range which
approximates physiological conditions. They are preferably present
at concentration ranging from about 2 mM to about 50 mM. Suitable
buffering agents for use with the present invention include both
organic and inorganic acids and salts thereof such as citrate
buffers (e.g., monosodium citrate-disodium citrate mixture, citric
acid-trisodium citrate mixture, citric acid-monosodium citrate
mixture, etc.), succinate buffers (e.g., succinic acid-monosodium
succinate mixture, succinic acid-sodium hydroxide mixture, succinic
acid-disodium succinate mixture, etc.), tartrate buffers (e.g.,
tartaric acid-sodium tartrate mixture, tartaric acid-potassium
tartrate mixture, tartaric acid-sodium hydroxide mixture, etc.),
fumarate buffers (e.g., fumaric acid-monosodium fumarate mixture,
fumaric acid-disodium fumarate mixture, monosodium
fumarate-disodium fumarate mixture, etc.), gluconate buffers (e.g.,
gluconic acid-sodium glyconate mixture, gluconic acid-sodium
hydroxide mixture, gluconic acid-potassium glyconate mixture,
etc.), oxalate buffer (e.g., oxalic acid-sodium oxalate mixture,
oxalic acid-sodium hydroxide mixture, oxalic acid-potassium oxalate
mixture, etc.), lactate buffers (e.g., lactic acid-sodium lactate
mixture, lactic acid-sodium hydroxide mixture, lactic
acid-potassium lactate mixture, etc.) and acetate buffers (e.g.,
acetic acid-sodium acetate mixture, acetic acid-sodium hydroxide
mixture, etc.). Additionally, there may be mentioned phosphate
buffers, histidine buffers and trimethylamine salts such as
Tris.
[0146] Preservatives may be added to retard microbial growth, and
may be added in amounts ranging from 0.2%-1% (w/v). Suitable
preservatives for use with the present invention include phenol,
benzyl alcohol, meta-cresol, methyl paraben, propyl paraben,
octadecyldimethylbenzyl ammonium chloride, benzalconium halides
(e.g., chloride, bromide, iodide), hexamethonium chloride, and
alkyl parabens such as methyl or propyl paraben, catechol,
resorcinol, cyclohexanol, and 3-pentanol.
[0147] Isotonicifiers sometimes known as "stabilizers" may be added
to ensure isotonicity of liquid compositions of the present
invention and include polhydric sugar alcohols, preferably
trihydric or higher sugar alcohols, such as glycerin, erythritol,
arabitol, xylitol, sorbitol and mannitol.
[0148] Stabilizers refer to a broad category of excipients which
can range in function from a bulking agent to an additive which
solubilizes the therapeutic agent or helps to prevent denaturation
or adherence to the container wall. Typical stabilizers can be
polyhydric sugar alcohols (enumerated above); amino acids such as
arginine, lysine, glycine, glutamine, asparagine, histidine,
alanine, ornithine, L-leucine, 2-phenylalanine, glutamic acid,
threonine, etc.; organic sugars or sugar alcohols, such as lactose,
trehalose, stachyose, mannitol, sorbitol, xylitol, ribitol,
myoinisitol, galactitol, glycerol and the like, including cyclitols
such as inositol; polyethylene glycol; amino acid polymers; sulfur
containing reducing agents, such as urea, glutathione, thioctic
acid, sodium thioglycolate, thioglycerol, alpha.-monothioglycerol
and sodium thio sulfate; low molecular weight polypeptides (i.e.
<10 residues); proteins such as human serum albumin, bovine
serum albumin, gelatin or immunoglobulins; hydrophylic polymers,
such as polyvinylpyrrolidone monosaccharides, such as xylose,
mannose, fructose, glucose; disaccharides such as lactose, maltose,
sucrose and trisaccacharides such as raffinose; and polysaccharides
such as dextran. Stabilizers may be present in the range from 0.1
to 10,000 weights per part of weight active protein.
[0149] Non-ionic surfactants or detergents (also known as "wetting
agents") may be added to help solubilize the therapeutic agent as
well as to protect the therapeutic protein against
agitation-induced aggregation, which also permits the formulation
to be exposed to shear surface stressed without causing
denaturation of the protein. Suitable non-ionic surfactants include
polysorbates (20, 80, etc.), polyoxamers (184, 188 etc.),
PLURONIC.RTM. polyols, polyoxyethylene sorbitan monoethers
(TWEEN-20.RTM., TWEEN-80.RTM., etc.). Non-ionic surfactants may be
present in a range of about 0.05 mg/ml to about 1.0 mg/ml,
preferably about 0.07 mg/ml to about 0.2 mg/ml.
[0150] Additional miscellaneous excipients include bulking agents,
(e.g., starch), chelating agents (e.g., EDTA), antioxidants (e.g.,
ascorbic acid, methionine, vitamin E), and cosolvents. The
formulation herein may also contain more than one active compound
as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. For example, it may be desirable to
further provide an immunosuppressive agent. Such molecules are
suitably present in combination in amounts that are effective for
the purpose intended. The active ingredients may also be entrapped
in microcapsule prepared, for example, by coascervation techniques
or by interfacial polymerization, for example,
hydroxymethylcellulose or gelatin-microcapsule and
poly-(methylmethacylate) microcapsule, respectively, in colloidal
drug delivery systems (for example, liposomes, albumin micropheres,
microemulsions, nano-particles and nanocapsules) or in
macroemulsions. Such techniques are disclosed in Remington's
Pharmaceutical Sciences, 16th edition, Osal, Ed. (1980).
[0151] The formulations to be used for in vivo administration
should be sterile. This is readily accomplished, for example, by
filtration through sterile filtration membranes. Sustained-release
preparations may be prepared. Suitable examples of
sustained-release preparations include semi-permeable matrices of
solid hydrophobic polymers containing the antibody, which matrices
are in the form of shaped articles, e.g., films, or microcapsules.
Examples of sustained-release matrices include polyesters,
hydrogels (for example, poly(2-hydroxyethyl-methacrylate),
poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919),
copolymers of L-glutamic acid and ethyl-L-glutamate, non-degradable
ethylene-vinyl acetate, degradable lactic acid-glycolic acid
copolymers such as the LUPRON DEPOT.TM. (injectable microspheres
composed of lactic acid-glycolic acid copolymer and leuprolide
acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such
as ethylene-vinyl acetate and lactic acid-glycolic acid enable
release of molecules for over 100 days, certain hydrogels release
proteins for shorter time periods. When encapsulated antibodies
remain in the body for a long time, they may denature or aggregate
as a result of exposure to moisture at 37.degree. C. resulting in a
loss of biological activity and possible changes in immunogenicity.
Rational strategies can be devised for stabilization depending on
the mechanism involved. For example, if the aggregation mechanism
is discovered to be intermolecular S--S bond formation through
thio-disulfide interchange, stabilization may be achieved by
modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives, and
developing specific polymer matrix compositions.
[0152] The amount of therapeutic polypeptide, antibody, or fragment
thereof which will be effective in the treatment of a particular
disorder or condition will depend on the nature of the disorder or
condition, and can be determined by standard clinical techniques.
Where possible, it is desirable to determine the dose-response
curve and the pharmaceutical compositions of the invention first in
vitro, and then in useful animal model systems prior to testing in
humans.
[0153] In a preferred embodiment, an aqueous solution of
therapeutic polypeptide, antibody or fragment thereof is
administered by subcutaneous injection. Each dose may range from
about 0.5 .mu.g to about 50 .mu.g per kilogram of body weight, or
more preferably, from about 3 .mu.g to about 30 .mu.g per kilogram
body weight.
[0154] The dosing schedule for subcutaneous administration may vary
from once a month to daily depending on a number of clinical
factors, including the type of disease, severity of disease, and
the subject's sensitivity to the therapeutic agent.
Therapeutic Uses of Anti-Notch-3 Antibodies
[0155] It is contemplated that the antibodies of the present
invention may be used to treat a mammal. In one embodiment, the
antibody is administered to a nonhuman mammal for the purposes of
obtaining preclinical data, for example. Exemplary nonhuman mammals
to be treated include nonhuman primates, dogs, cats, rodents and
other mammals in which preclinical studies are performed. Such
mammals may be established animal models for a disease to be
treated with the antibody or may be used to study toxicity of the
antibody of interest. In each of these embodiments, dose escalation
studies may be performed on the mammal.
[0156] An antibody, with or without a therapeutic moiety conjugated
to it, administered alone or in combination with cytotoxic
factor(s) can be used as a therapeutic. The present invention is
directed to antibody-based therapies which involve administering
antibodies of the invention to an animal, a mammal, or a human, for
treating a Notch3-mediated disease, disorder, or condition. The
animal or subject may be a mammal in need of a particular
treatment, such as a mammal having been diagnosed with a particular
disorder, e.g., one relating to Notch3. Antibodies directed against
Notch3 are useful against cancer and other Notch3-associated
diseases including neurological disorders, diabetes, rheumatoid
arthritis, vascular related diseases, and Alagille symdrome in
mammals, including but not limited to cows, pigs, horses, chickens,
cats, dogs, non-human primates etc., as well as humans. For
example, by administering a therapeutically acceptable dose of an
anti-Notch3 antibody, or antibodies, of the present invention, or a
cocktail of the present antibodies, or in combination with other
antibodies of varying sources, disease symptoms may be ameliorated
or prevented in the treated mammal, particularly humans.
[0157] Therapeutic compounds of the invention include, but are not
limited to, antibodies of the invention (including fragments,
analogs and derivatives thereof as described herein) and nucleic
acids encoding antibodies of the invention as described below
(including fragments, analogs and derivatives thereof and
anti-idiotypic antibodies as described herein). The antibodies of
the invention can be used to treat, inhibit, or prevent diseases,
disorders, or conditions associated with aberrant expression and/or
activity of Notch3, including, but not limited to, any one or more
of the diseases, disorders, or conditions described herein. The
treatment and/or prevention of diseases, disorders, or conditions
associated with aberrant expression and/or activity of Notch3
includes, but is not limited to, alleviating at least one symptom
associated with those diseases, disorders, or conditions.
Antibodies of the invention may be provided in pharmaceutically
acceptable compositions as known in the art or as described
herein.
[0158] Anti-Notch3 antibodies of the present invention may be used
therapeutically in a variety of diseases. The present invention
provides a method for preventing or treating Notch3-mediated
diseases in a mammal. The method comprises administering a disease
preventing or treating amount of anti-Notch3 antibody to the
mammal. The anti-Notch3 antibody binds to Notch3 and antagonizes
its function. Notch3 signaling has been linked to various diseases
such as various cancers (Haruki, et al., Cancer Res 65:3555 (2005);
Park, et al., Cancer Res 66:6312 (2006); Lu, et al., Clin Cancer
Res 10:3291 (2004)); Hedvat, et al., Br J Haematol 122:728 (2003);
Buchler, et al., Ann Surg 242:791 (2005)); Bellavia, et al., Proc
Natl Acad Sci USA 99:3788 (2002); Screpanti, et al., Trends Mol Med
9:30 (2003)); van Limpt, et al., Cancer Lett 228:59 (2005)),
neurological disorders (Joutel, et al., Nature 383:707 (1996)),
diabetes (Anastasi, et al., J Immunol 171:4504 (2003), rheumatoid
arthritis (Yabe, et al., J Orthop Sci 10:589 (2005)), vascular
related diseases (Sweeney, et al., FASEB J 18:1421 (2004)), and
Alagille syndrome (Flynn, et al., J Pathol 204:55 (2004)).
Anti-Notch3 antibodies will also be effective to prevent the above
mentioned diseases.
[0159] The amount of the antibody which will be effective in the
treatment, inhibition, and prevention of a disease or disorder
associated with aberrant expression and/or activity of Notch3 can
be determined by standard clinical techniques. The dosage will
depend on the type of disease to be treated, the severity and
course of the disease, whether the antibody is administered for
preventive or therapeutic purposes, previous therapy, the patient's
clinical history and response to the antibody, and the discretion
of the attending physician. The antibody can be administered in
treatment regimes consistent with the disease, e.g., a single or a
few doses over one to several days to ameliorate a disease state or
periodic doses over an extended time to inhibit disease progression
and prevent disease recurrence. In addition, in vitro assays may
optionally be employed to help identify optimal dosage ranges. The
precise dose to be employed in the formulation will also depend on
the route of administration, and the seriousness of the disease or
disorder, and should be decided according to the judgment of the
practitioner and each patient's circumstances. Effective doses may
be extrapolated from dose-response curves derived from in vitro or
animal model test systems.
[0160] For antibodies, the dosage administered to a patient is
typically 0.1 mg/kg to 150 mg/kg of the patient's body weight.
Preferably, the dosage administered to a patient is between 0.1
mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half-life within the human body than
antibodies from other species due to the immune response to the
foreign polypeptides. Thus, lower dosages of human antibodies and
less frequent administration is often possible. Further, the dosage
and frequency of administration of antibodies of the invention may
be reduced by enhancing uptake and tissue penetration (e.g., into
the brain) of the antibodies by modifications such as, for example,
lipidation. For repeated administrations over several days or
longer, depending on the condition, the treatment is sustained
until a desired suppression of disease symptoms occurs. However,
other dosage regimens may be useful. The progress of this therapy
is easily monitored by conventional techniques and assays.
[0161] The antibody composition will be formulated, dosed and
administered in a manner consistent with good medical practice.
Factors for consideration in this context include the particular
disorder being treated, the particular mammal being treated, the
clinical condition of the individual patient, the cause of the
disorder, the site of delivery of the agent, the method of
administration, the scheduling of administration, and other factors
known to medical practitioners. The "therapeutically effective
amount" of the antibody to be administered will be governed by such
considerations, and is the minimum amount necessary to prevent,
ameliorate, or treat a disease or disorder. The antibody need not
be, but is optionally formulated with one or more agents currently
used to prevent or treat the disorder in question. The effective
amount of such other agents depends on the amount of antibody
present in the formulation, the type of disorder or treatment, and
other factors discussed above. These are generally used in the same
dosages and with administration routes as used hereinbefore or
about from 1 to 99% of the heretofore employed dosages.
[0162] The antibodies of the invention may be administered alone or
in combination with other types of cancer treatments including
conventional chemotherapeutic agents (paclitaxel, carboplatin,
cisplatin and doxorbicin), anti-EG FR agents (gefitinib, erlotinib
and cetuximab), anti-angiogenesis agents (bevacizumab and
sunitinib), as well as immuno-modulating agents such as
interferon-.alpha. and thalidomide.
[0163] In a preferred aspect, the antibody is substantially
purified (e.g., substantially free from substances that limit its
effect or produce undesired side-effects).
[0164] Various delivery systems are known and can be used to
administer an antibody of the present invention, including
injection, e.g., encapsulation in liposomes, microparticles,
microcapsules, recombinant cells capable of expressing the
compound, receptor-mediated endocytosis (see, e.g., Wu, et al., J
Biol Chem 262:4429 (1987)), construction of a nucleic acid as part
of a retroviral or other vector, etc.
[0165] The anti-Notch3 antibody can be administered to the mammal
in any acceptable manner. Methods of introduction include but are
not limited to parenteral, subcutaneous, intraperitoneal,
intrapulmonary, intranasal, epidural, inhalation, and oral routes,
and if desired for immunosuppressive treatment, intralesional
administration. Parenteral infusions include intramuscular,
intradermal, intravenous, intraarterial, or intraperitoneal
administration. The antibodies or compositions may be administered
by any convenient route, for example by infusion or bolus
injection, by absorption through epithelial or mucocutaneous
linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and
may be administered together with other biologically active agents.
Administration can be systemic or local. In addition, it may be
desirable to introduce the therapeutic antibodies or compositions
of the invention into the central nervous system by any suitable
route, including intraventricular and intrathecal injection;
intraventricular injection may be facilitated by an
intraventricular catheter, for example, attached to a reservoir,
such as an Ommaya reservoir. In addition, the antibody is suitably
administered by pulse infusion, particularly with declining doses
of the antibody. Preferably the dosing is given by injections, most
preferably intravenous or subcutaneous injections, depending in
part on whether the administration is brief or chronic.
[0166] Pulmonary administration can also be employed, e.g., by use
of an inhaler or nebulizer, and formulation with an aerosolizing
agent. The antibody may also be administered into the lungs of a
patient in the form of a dry powder composition (See e.g., U.S.
Pat. No. 6,514,496).
[0167] In a specific embodiment, it may be desirable to administer
the therapeutic antibodies or compositions of the invention locally
to the area in need of treatment; this may be achieved by, for
example, and not by way of limitation, local infusion, topical
application, by injection, by means of a catheter, by means of a
suppository, or by means of an implant, said implant being of a
porous, non-porous, or gelatinous material, including membranes,
such as sialastic membranes, or fibers. Preferably, when
administering an antibody of the invention, care must be taken to
use materials to which the protein does not absorb.
[0168] In another embodiment, the antibody can be delivered in a
vesicle, in particular a liposome (see Langer, Science 249:1527
(1990); Treat, et al., in Liposomes in the Therapy of Infectious
Disease and Cancer, Lopez-Berestein, et al., eds., pp. 353-365
(1989); Lopez-Berestein, ibid., pp. 317-27; see generally
ibid.).
[0169] In yet another embodiment, the antibody can be delivered in
a controlled release system. In one embodiment, a pump may be used
(see Langer, Science 249:1527 (1990); Sefton, CRC Crit Ref Biomed
Eng 14:201 (1987); Buchwald, et al., Surgery 88:507 (1980); Saudek,
et al., N Engl J Med 321:574 (1989)). In another embodiment,
polymeric materials can be used (see Medical Applications of
Controlled Release, Langer, et al., eds., CRC Press (1974);
Controlled Drug Bioavailability, Drug Product Design and
Performance, Smolen, et al., eds., Wiley (1984); Ranger, et al., J
Macromol Sci Rev Macromol Chem 23:61 (1983); see also Levy, et al.,
Science 228:190 (1985); During, et al., Ann Neurol 25:351 (1989);
Howard, et al., J Neurosurg 71:105 (1989)). In yet another
embodiment, a controlled release system can be placed in proximity
of the therapeutic target.
[0170] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically
effective amount of the antibody and a physiologically acceptable
carrier. In a specific embodiment, the term "physiologically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient, or vehicle with which the therapeutic is
administered. Such physiological carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable, or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The composition, if desired, can also contain
minor amounts of wetting or emulsifying agents, or pH buffering
agents. These compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, capsules, powders,
sustained-release formulations and the like. The composition can be
formulated as a suppository, with traditional binders and carriers
such as triglycerides. Oral formulation can include standard
carriers such as pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate, etc. Examples of suitable carriers are described in
"Remington's Pharmaceutical Sciences" by E. W. Martin. Such
compositions will contain an effective amount of the antibody,
preferably in purified form, together with a suitable amount of
carrier so as to provide the form for proper administration to the
patient. The formulation should suit the mode of
administration.
[0171] In one embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
compositions for intravenous administration are solutions in
sterile isotonic aqueous buffer. Where necessary, the composition
may also include a solubilizing agent and a local anesthetic such
as lignocaine to ease pain at the site of the injection. Generally,
the ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0172] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use or
sale for human administration.
[0173] In addition, the antibodies of the present invention may be
conjugated to various effector molecules such as heterologous
polypeptides, drugs, radionucleotides, or toxins. See, e.g., PCT
publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Pat. No.
5,314,995; and EP 396,387. An antibody or fragment thereof may be
conjugated to a therapeutic moiety such as a cytotoxin (e.g., a
cytostatic or cytocidal agent), a therapeutic agent, or a
radioactive metal ion (e.g., alpha-emitters such as, for example,
213Bi). A cytotoxin or cytotoxic agent includes any agent that is
detrimental to cells. Examples include paclitaxol, cytochalasin B,
gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin,
daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin,
actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine, lidocaine, propranolol, and puromycin and analogs or
homologues thereof. Therapeutic agents include, but are not limited
to, antimetabolites (e.g., methotrexate, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating
agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan,
carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and
cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines
(e.g., daunorubicin (formerly daunomycin) and doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and vinblastine).
[0174] Techniques for conjugating such therapeutic moieties to
antibodies are well known, see, e.g., Arnon, et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies and Cancer Therapy, Reisfeld, et al. (eds.),
pp. 243-56 Alan R. Liss (1985); Hellstrom, et al., "Antibodies For
Drug Delivery", in Controlled Drug Delivery, 2nd ed., Robinson, et
al., eds., pp. 623-53, Marcel Dekker (1987); Thorpe, "Antibody
Carriers Of Cytotoxic Agents In Cancer Therapy: A Review," in
Monoclonal Antibodies '84: Biological And Clinical Applications,
Pinchera, et al., eds., pp. 475-506 (1985); "Analysis, Results, And
Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody
In Cancer Therapy," in Monoclonal Antibodies For Cancer Detection
and Therapy, Baldwin, et al., eds., pp. 303-16, Academic Press
(1985); and Thorpe, et al., Immunol Rev 62:119 (1982).
Alternatively, an antibody can be conjugated to a second antibody
to form an antibody heteroconjugate. See, e.g., U.S. Pat. No.
4,676,980.
[0175] The conjugates of the invention can be used for modifying a
given biological response, the therapeutic agent or drug moiety is
not to be construed as limited to classical chemical therapeutic
agents. For example, the drug moiety may be a protein or
polypeptide possessing a desired biological activity. Such proteins
may include, for example, a toxin such as abrin, ricin A,
pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor
necrosis factor, .alpha.-interferon, .beta.-interferon, nerve
growth factor, platelet derived growth factor, tissue plasminogen
activator, an apoptotic agent, e.g., TNF-.alpha., TNF-.beta., AIM I
(See, International Publication No. WO 97/33899), AIM II (See,
International Publication No. WO 97/34911), Fas Ligand (Takahashi,
et al., Int Immunol, 6:1567 (1994)), VEGI (See, International
Publication No. WO 99/23105); a thrombotic agent; an
anti-angiogenic agent, e.g., angiostatin or endostatin; or
biological response modifiers such as, for example, lymphokines,
interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6
("IL-6"), granulocyte macrophage colony stimulating factor
("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or
other growth factors.
Articles of Manufacture
[0176] In another embodiment of the invention, an article of
manufacture containing materials useful for the treatment of the
disorders described above is provided. The article of manufacture
comprises a container and a label. Suitable containers include, for
example, bottles, vials, syringes, and test tubes. The containers
may be formed from a variety of materials such as glass or plastic.
The container holds a composition which is effective for preventing
or treating the condition and may have a sterile access port (for
example, the container may be an intravenous solution bag or a vial
having a stopper pierceable by a hypodermic injection needle). The
active agent in the composition is the antibody. The label on, or
associated with, the container indicates that the composition is
used for treating the condition of choice. The article of
manufacture may further comprise a second container comprising a
pharmaceutically acceptable buffer, such as phosphate-buffered
saline, Ringer's solution, and dextrose solution. It may further
include other materials desirable from a commercial and user
standpoint, including other buffers, diluents, filters, needles,
syringes, and package inserts with instructions for use.
Antibody-Based Gene Therapy
[0177] In a another aspect of the invention, nucleic acids
comprising sequences encoding antibodies or functional derivatives
thereof, are administered to treat, inhibit or prevent a disease or
disorder associated with aberrant expression and/or activity of
Notch3, by way of gene therapy. Gene therapy refers to therapy
performed by the administration to a subject of an expressed or
expressible nucleic acid. In this embodiment of the invention, the
nucleic acids produce their encoded protein that mediates a
therapeutic effect. Any of the methods for gene therapy available
can be used according to the present invention. Exemplary methods
are described below.
[0178] For general reviews of the methods of gene therapy, see
Goldspiel, et al., Clinical Pharmacy 12:488 (1993); Wu, et al.,
Biotherapy 3:87 (1991); Tolstoshev, Ann Rev Pharmacol Toxicol
32:573 (1993); Mulligan, Science 260:926 (1993); Morgan, et al.,
Ann Rev Biochem 62:191 (1993); May, TIBTECH 11:155 (1993).
[0179] In a one aspect, the compound comprises nucleic acid
sequences encoding an antibody, said nucleic acid sequences being
part of expression vectors that express the antibody or fragments
or chimeric proteins or heavy or light chains thereof in a suitable
host. In particular, such nucleic acid sequences have promoters
operably linked to the antibody coding region, said promoter being
inducible or constitutive, and, optionally, tissue-specific.
[0180] In another particular embodiment, nucleic acid molecules are
used in which the antibody coding sequences and any other desired
sequences are flanked by regions that promote homologous
recombination at a desired site in the genome, thus providing for
intrachromosomal expression of the antibody encoding nucleic acids
(Koller, et al., Proc Natl Acad Sci USA 86:8932 (1989); Zijlstra,
et al., Nature 342:435 (1989)). In specific embodiments, the
expressed antibody molecule is a single chain antibody;
alternatively, the nucleic acid sequences include sequences
encoding both the heavy and light chains, or fragments thereof, of
the antibody.
[0181] Delivery of the nucleic acids into a patient may be either
direct, in which case the patient is directly exposed to the
nucleic acid or nucleic acid-carrying vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in
vitro, then transplanted into the patient. These two approaches are
known, respectively, as in vivo or ex vivo gene therapy.
[0182] In a specific embodiment, the nucleic acid sequences are
directly administered in vivo, where it is expressed to produce the
encoded product. This can be accomplished by any of numerous
methods known in the art, e.g., by constructing them as part of an
appropriate nucleic acid expression vector and administering it so
that they become intracellular, e.g., by infection using defective
or attenuated retrovirals or other viral vectors (see U.S. Pat. No.
4,980,286), or by direct injection of naked DNA, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, encapsulation in liposomes, microparticles, or
microcapsules, or by administering them in linkage to a peptide
which is known to enter the nucleus, by administering it in linkage
to a ligand subject to receptor-mediated endocytosis (see, e.g.,
Wu, et al., J Biol Chem 262:4429 (1987)) (which can be used to
target cell types specifically expressing the receptors), etc. In
another embodiment, nucleic acid-ligand complexes can be formed in
which the ligand comprises a fusogenic viral peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be
targeted in vivo for cell specific uptake and expression, by
targeting a specific receptor (see, e.g., PCT Publications WO
92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221).
Alternatively, the nucleic acid can be introduced intracellularly
and incorporated within host cell DNA for expression, by homologous
recombination (Koller, et al., Proc Natl Acad Sci USA 86:8932
(1989); Zijlstra, et al., Nature 342:435 (1989)).
[0183] In a specific embodiment, viral vectors that contain nucleic
acid sequences encoding an antibody of the invention are used. For
example, a retroviral vector can be used (see Miller, et al., Meth
Enzymol 217:581 (1993)). These retroviral vectors contain the
components necessary for the correct packaging of the viral genome
and integration into the host cell DNA. The nucleic acid sequences
encoding the antibody to be used in gene therapy are cloned into
one or more vectors, which facilitate the delivery of the gene into
a patient. More detail about retroviral vectors can be found in
Boesen, et al., Biotherapy 6:291 (1994), which describes the use of
a retroviral vector to deliver the mdrl gene to hematopoietic stem
cells in order to make the stem cells more resistant to
chemotherapy. Other references illustrating the use of retroviral
vectors in gene therapy are: Clowes, et al., J Clin Invest 93:644
(1994); Kiem, et al., Blood 83:1467 (1994); Salmons, et al., Human
Gene Therapy 4:129 (1993); and Grossman, et al., Curr Opin Gen and
Dev 3:110 (1993).
[0184] Adenoviruses may also be used in the present invention.
Adenoviruses are especially attractive vehicles in the present
invention for delivering antibodies to respiratory epithelia.
Adenoviruses naturally infect respiratory epithelia. Other targets
for adenovirus-based delivery systems are liver, the central
nervous system, endothelial cells, and muscle. Adenoviruses have
the advantage of being capable of infecting non-dividing cells.
Kozarsky, et al., Curr Opin Gen Dev 3:499 (1993) present a review
of adenovirus-based gene therapy. Bout, et al., Human Gene Therapy
5:3 (1994) demonstrated the use of adenovirus vectors to transfer
genes to the respiratory epithelia of rhesus monkeys. Other
instances of the use of adenoviruses in gene therapy can be found
in Rosenfeld, et al., Science 252:431 (1991); Rosenfeld, et al.,
Cell 68:143 (1992); Mastrangeli, et al., J Clin Invest 91:225
(1993); PCT Publication WO94/12649; Wang, et al., Gene Therapy
2:775 (1995). Adeno-associated virus (AAV) has also been proposed
for use in gene therapy (Walsh, et al., Proc Soc Exp Biol Med
204:289 (1993); U.S. Pat. Nos. 5,436,146; 6,632,670; and
6,642,051).
[0185] Another approach to gene therapy involves transferring a
gene to cells in tissue culture by such methods as electroporation,
lipofection, calcium phosphate mediated transfection, or viral
infection. Usually, the method of transfer includes the transfer of
a selectable marker to the cells. The cells are then placed under
selection to isolate those cells that have taken up and are
expressing the transferred gene. Those cells are then delivered to
a patient.
[0186] In this embodiment, the nucleic acid is introduced into a
cell prior to administration in vivo of the resulting recombinant
cell. Such introduction can be carried out by any method known in
the art, including but not limited to transfection,
electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene
transfer, spheroplast fusion, etc. Numerous techniques are known in
the art for the introduction of foreign genes into cells (see,
e.g., Loeffler, et al., Meth Enzymol 217:599 (1993); Cohen, et al.,
Meth Enzymol 217:618 (1993); Cline, Pharmac Ther 29:69 (1985)) and
may be used in accordance with the present invention, provided that
the necessary developmental and physiological functions of the
recipient cells are not disrupted. The technique should provide for
the stable transfer of the nucleic acid to the cell, so that the
nucleic acid is expressible by the cell and preferably heritable
and expressible by its cell progeny.
[0187] The resulting recombinant cells can be delivered to a
patient by various methods known in the art. Recombinant blood
cells (e.g., hernatopoietic stem or progenitor cells) are
preferably administered intravenously. The amount of cells
envisioned for use depends on the desired effect, patient state,
etc., and can be determined by one skilled in the art.
[0188] Cells into which a nucleic acid can be introduced for
purposes of gene therapy encompass any desired, available cell
type, and include but are not limited to epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells,
hepatocytes; blood cells such as T lymphocytes, B lymphocytes,
monocytes, macrophages, neutrophils, eosinophils, megakaryocytes,
granulocytes; various stem or progenitor cells, in particular
hematopoietic stem or progenitor cells, e.g., as obtained from bone
marrow, umbilical cord blood, peripheral blood, fetal liver,
etc.
[0189] In one embodiment, the cell used for gene therapy is
autologous to the patient. Nucleic acid sequences encoding an
antibody of the present invention are introduced into the cells
such that they are expressible by the cells or their progeny, and
the recombinant cells are then administered in vivo for therapeutic
effect. In a specific embodiment, stem or progenitor cells are
used. Any stem and/or progenitor cells which can be isolated and
maintained in vitro can potentially be used in accordance with this
embodiment of the present invention (see e.g. PCT Publication WO
94/08598; Stemple, et al., Cell 71:973 (1992); Rheinwald, Meth Cell
Bio 21A:229 (1980); Pittelkow, et al., Mayo Clinic Proc 61:771
(1986)).
EXAMPLES
Example 1: Generation of Immunogen: Notch3 Extracellular Domain-FC
Fusion Protein
[0190] Anti-Notch3 monoclonal antibodies that specifically bind to
the LIN12/dimerization domain (herein after "LD") of human Notch3
were generated using a recombinant Notch3-Fc fusion protein as
immunogen comprising Notch3 LD fused to a gamma 1 Fc region at the
carboxy terminal end. Specifically, the immunogen comprised amino
acid residues 1378 to 1640 of Notch3 LD (See FIG. 1) and human
.gamma.1Fc fusion protein (Notch3 LD/Fc). A control antibody was
generated comprising the Notch3 EGF repeat region from amino acid
residues 43 to 1377 (designated 255A-79).
[0191] Notch3 protein sequence was analyzed using an internet-based
research software and service (Motif Search). Human liver and
pancreatic RNAs (Ambion, Inc. Austin, Tex.) were used as templates
to synthesize the first strand of cDNA using a standard
commercially available cDNA synthesis kit. The cDNAs encoding the
Notch3 LD and the EGF repeat region were PCR-amplified in the
presence of Betaine (1-2M) and DMSO (5%). The PCR-synthesized
Notch3-LD DNA fragment (.about.0.8 kb) and Notch3-EGF repeat DNA
fragment (.about.4 kb) were cloned into expression vectors
comprising a His-.gamma.1Fc in the commercially available vector
pSec or in the commercially available vector pCD3.1, each bearing a
different antibiotic marker. This cloning resulted in two
expression plasmids, one expressing a Notch3-LD/Fc fusion protein
and the other expressing a Notch3-EGF/Fc fusion protein.
[0192] To facilitate the plasmid construction and to enhance the
expression of the various Notch 3 recombinant proteins,
oligonucleotides corresponding to the leader peptide sequence
comprising the first 135 base pairs of the Notch3 nucleic acid
coding sequence were generated. These oligonucleotides contained
some changes in the wobble coding positions to lower the GC
content. All nucleotide sequence changes were silent, i.e., no
amino acid sequence changes (FIG. 14A). After annealing the
oligonucleotides together, the engineered leader peptide coding
sequence was linked to the rest of the coding sequence by PCR-SOE
(Ho, et al., Gene 77:51 (1989); Horton, et al., Bio Techniques
8:528 (1990)) (See FIG. 15). This leader peptide coding sequence
was used in Notch3-LD/Fc and Notch3 expression constructs.
Therefore, both of the Fc fusion proteins comprise a signal peptide
linked to the N-terminus, and a human .gamma.1Fc sequence fused to
the C-terminus. The amino acid sequence of Notch3-LD, including the
leader peptide, is shown in FIG. 14 and SEQ ID NO:6.
[0193] Expression of Notch3-EGF/Fc and Notch3-LD/Fc fusion proteins
was verified by transient transfection of the Notch3 expression
plasmids into 293T (ATCC Number CRL-11268, Manassas, Va.) and CHO
cells (Invitrogen, Carlsbad, Calif.), respectively. Prior to
transfection, cells were cultured in DMEM (Invitrogen, Carlsbad,
Calif.) growth medium containing 10% fetal calf serum (FCS), 2 mM
of glutamine, and 1.times. essential amino acid solution followed
by seeding about 3-5.times.10.sup.5 cells per well in 6-well plate
and growing for approximately 24 hours. Three micrograms each of
the Notch3 fusion protein expression plasmids were transfected into
cells in each well using a LIPOFECTAMINE.TM. 2000 transfection
system (Invitrogen, Carlsbad, Calif.) following the manufacturer's
protocol. After transfection, the cells were cultured in fresh
growth medium and cultured in a CO.sub.2 incubator for
approximately 40-48 hours before subjecting to Notch3 fusion
protein expression analysis. Alternatively, after transfection, the
cells were cultured in growth medium for 3-4 hours, then switched
to DMEM medium containing 2% FCS and cultured for approximately
60-66 hours before drawing conditioned medium for secreted protein
analysis.
[0194] Stable cell lines were generated for both Notch3-LD/Fc
(His-Fc.gamma./pSec vector) and Notch3-EGF/Fc (His-Fc.gamma./pSec
vector). Each plasmid was transfected into CHO cells. After
transfection, the cells were cultured in DMEM growth medium
overnight, then switched to growth medium with 800 .mu.g/ml
hygromycin and cultured at least two weeks until the cells not
carrying Notch3 expression plasmid were eliminated by the
antibiotics. Conditioned media from the stable cell lines were
subjected to Western blot analysis.
[0195] Stable or transient transfected cells were assayed for
expression and secretion of Notch3-LD/Fc or Notch3-EGF/Fc fusion
protein. Transfected cells harvested from culture dishes were
washed once with phosphate buffered saline (PBS) and resuspended in
deionized water, mixed with an equal volume of 2.times. protein
sample loading buffer (BioRad, Hercules, Calif.) and then heated at
about 100.degree. C. for 10 minutes. Secreted protein was analyzed
using conditioned medium mixed with an equal volume of 2.times.
protein sample loading buffer and heated at 100.degree. C. for 10
minutes. The samples were separated using 4-15% gradient SDS-PAGE.
The proteins were transferred from the gel to a PVDF membrane
(BioRad, Hercules, Calif.), which was blocked in 5% non-fat dry
milk in PBST (PBS with 0.05% TWEEN-20.RTM.) for at least one hour
prior to transfer of protein.
[0196] Notch3-EGF/Fc and Notch3-LD/Fc fusion proteins were detected
by incubating with .gamma.Fc-specific, HRP-conjugated antibody
(Sigma, St Louis, Mo.) in blocking buffer for one hour at room
temperature. The membrane was washed three times in PBST and
developed with a chemiluminescent substrate.
[0197] For Notch3 domain/Fc fusion protein purification, CHO stable
cell lines as described above were cultured in DMEM with 2% FCS for
up to 5 days. One liter of conditioned medium was collected and
subjected to protein-A bead-packed column chromatography for
affinity binding. The column was washed with PBS, and the bound
proteins were eluted in 50 mM citrate buffer (pH 2.8), and the pH
was brought to neutral by adding 1 M Tris-HCl buffer (pH 8). Purity
of the protein was assessed by protein gel analysis using 4-15%
gradient SDS-PAGE. Protein concentration was assayed using
Coomassie blue reagent following the manufacturer's protocol
(Pierce, Rockford, Ill.). Through this procedure, milligram
quantities of Notch3-LD/Fc and Notch3-EGF/Fc protein were purified
for immunization and ELISA binding assays.
Example 2: Generation of Anti-Notch3 MAbs
[0198] Male A/J mice (Harlan, Houston, Tex.), 8-12 weeks old, were
injected subcutaneously with 25 .mu.g of Notch3-EGF/Fc or
Notch3-LD/Fc in complete Freund's adjuvant (Difco Laboratories,
Detroit, Mich.) in 200 .mu.l of PBS. Two weeks after the injections
and three days prior to sacrifice, the mice were again injected
intraperitoneally with 25 .mu.g of the same antigen in PBS. For
each fusion, single cell suspensions were prepared from spleen of
an immunized mouse and used for fusion with Sp2/0 myeloma cells;
5.times.10.sup.8 of Sp2/0 and 5.times.10.sup.8 of spleen cells were
fused in a medium containing 50% polyethylene glycol (M.W. 1450)
(Kodak, Rochester, N.Y.) and 5% dimethylsulfoxide (Sigma, St.
Louis, Mo.). The cells were then adjusted to a concentration of
1.5.times.10.sup.5 spleen cells per 200 .mu.l of the suspension in
Iscove medium (Invitrogen, Carlsbad, Calif.), supplemented with 10%
fetal bovine serum, 100 units/ml of penicillin, 100 .mu.g/ml of
streptomycin, 0.1 .mu.M hypoxanthine, 0.4 .mu.M aminopterin, and 16
.mu.M thymidine. Two hundred microliters of the cell suspension
were added to each well of about sixty 96-well plates. After around
ten days, culture supernatants were withdrawn for screening their
antibody-binding activity using ELISA.
[0199] The 96-well flat bottom IMMULON.RTM. II microtest plates
(Dynatech Laboratories, Chantilly, Va.) were coated using 100 .mu.l
of Notch3-EGF/Fc or Notch3-LD/Fc (0.1 .mu.g/ml) in (PBS) containing
1.times. Phenol Red and 3-4 drops pHix/liter (Pierce, Rockford,
Ill.) and incubated overnight at room temperature. After the
coating solution was removed by flicking of the plate, 200 .mu.l of
blocking buffer containing 2% BSA in PBST containing 0.1%
merthiolate was added to each well for one hour to block
non-specific binding. The wells were then washed with PBST. Fifty
microliters of culture supernatant from each fusion well were
collected and mixed with 50 .mu.l of blocking buffer and then added
to the individual wells of the microtiter plates. After one hour of
incubation, the wells were washed with PBST. The bound murine
antibodies were then detected by reaction with horseradish
peroxidase (HRP)-conjugated, Fc-specific goat anti-mouse IgG
(Jackson ImmunoResearch Laboratories, West Grove, Pa.). HRP
substrate solution containing 0.1% 3,3,5,5-tetramethyl benzidine
and 0.0003% hydrogen peroxide was added to the wells for color
development for 30 minutes. The reaction was terminated by the
addition of 50 ml of 2 M H.sub.2SO.sub.4/well. The OD at 450 nm was
read with an ELISA plate reader (Molecular Devices, Sunnyvale,
Calif.).
[0200] Among 185 hybridomas isolated and analyzed, two hybridoma
clones from mice immunized with Notch3-LD/Fc generated Notch3
antagonizing antibodies, which were further characterized. The
ELISA using supernatant from the two hybridoma clones producing
MAbs 256A-4 and 256A-8 showed strong binding activity to the
purified Notch3 LD/FC fusion protein to which it was generated and
did not bind to human Notch1-LD/Fc (LIN/dimerization domain fused
to Fc region at the carboxyl terminus) or a control human Fc
protein (data not shown) (Table 1). Later studies using functional
assays also demonstrated that MAbs 256A-4 and 256A-8 specifically
antagonize Notch3 relative to Notch1 and Notch2 (data not
shown).
TABLE-US-00001 TABLE 1 ELISA OD readings of anti-Notch3 Mabs using
hybridoma supernatant Notch3-LD/Fc Notch1-LD/Fc Mean S.D. Mean S.D.
256A-4 4.000 0.000 0.106 0.004 256A-8 4.000 0.000 0.115 0.014
Control IgG1* 0.064 0.006 0.066 0.006 *Control IgG was an
irrelevant IgG1 monoclonal antibody.
[0201] The positive hybridoma clones from this primary ELISA
screening were further isolated by single colony-picking and a
second ELISA assay as described above was done to verify specific
binding to the chosen immunogen. The confirmed hybridoma clones
were expanded in larger scale cultures. The monoclonal antibodies
(MAbs) were purified from the medium of these large scale cultures
using a protein A affinity column. The anti-Notch3 MAbs were then
characterized using cell-based binding assays, microscopy, Western
blot, and FACS analysis.
Example 3: Cell-Based Binding Assays for Anti-Notch3 MAbs
[0202] The cell-based binding assays used to characterize the
anti-Notch3 MAbs required cloning a full-length human Notch3 open
reading frame into a vector, in this case PCDNA.TM.3.1/Hygro
(Invitrogen, Carlsbad, Calif.). The Notch3-coding region was
synthesized by RT-PCR using human liver tumor RNA (Ambion, Inc.,
Austin, Tex.) as a template. The final plasmid construct,
Notch3/Hygro, expressed a full-length Notch3 protein as depicted in
FIG. 1. A stable cell line expressing Notch3 was generated by
transfection of Notch3/Hygro plasmid construct into 293T cells
(ATCC No. CRL-11268) using a LIPOFECTAMINE.TM. 2000 kit following
the same procedure as described in Example 1. After transfection,
the cells were cultured in DMEM growth medium overnight, then
reseeded in growth medium with 200 .mu.g/ml hygromycin and cultured
for 12-14 days. Well-isolated single colonies were picked and grown
in separate wells until enough clonal cells were amplified. Stable
293T clones that were resistant to hygromycin selection and
expressed high levels of Notch3 protein were identified by Western
blot analysis, and by fluorescent electromicroscopy using
polyclonal anti-Notch3 antibodies (R&D Systems, Minneapolis,
Minn.).
[0203] A partial Notch3 expression plasmid containing only the
Notch LIN12/dimerization (LD) domain and the transmembrane (TM)
domain was also constructed by PCR and subcloning into PCDNA.TM.3.1
vector (Invitrogen, Carlsbad, Calif.). This plasmid construct also
contains a V5 tag at its C-terminus and was termed
Notch3-LD.TM./V5. A stable cell line expressing this plasmid,
Notch3-LD.TM./V5, was generated according to the procedure
described in Example 1.
[0204] Human Sup-T1 cell line (ATCC No. CRL-1942) naturally
expressing Notch3 was also confirmed by Western blot. Sup-T1 cells
were grown in RPMI1640 media containing 10% fetal calf serum, 2 mM
of glutamine and 1.times. essential amino acid solution.
[0205] Cell-based antibody-binding was assessed using FMAT.TM.
(fluorescence macro-confocal high-throughput screening) 8100 HTS
System (Applied Biosystems, Foster City, Calif.) following the
protocol provided by the manufacturer. Cell lines naturally
expressing Notch3 or stably transfected with Notch3 expression
constructs were seeded in 96-well plates. Alternatively,
transiently transfected 293T or CHO cells were seeded in the
96-well plate. The cells were seeded at a density of 30,000-50,000
cells per well. After 20-24 hours, anti-Notch3 MAbs and 1.times.PBS
reaction buffer were added to the wells and incubated for one hour
at 37.degree. C. Cy-5-conjugated anti-mouse IgG antibody was added
in the wells after removal of primary antibodies.
[0206] Cell-based antibody-binding was also assessed by
fluorescence-activated cell sorter (FACS) using an internally
generated 293T/Notch3-stable cell line and two cancer lines, human
Sup-T1 and A2780 cell lines (UK ECACC No. Cat. No. 93112519), which
both naturally express Notch3 (data not shown). Cells were first
incubated with anti-Notch3 MAbs in 1.times.PBS. After three washes,
the cells were incubated with fluorescent molecule-conjugated
secondary antibody. The cells were resuspended, fixed in
1.times.PBS with 0.1% paraformaldehyde, and analyzed by FACS (BD
Sciences, Palo Alto, Calif.). The results indicated that both MAbs
bind to Notch3 receptor expressed either from recombinant plasmid
constructs or as native protein in cultured cells (Table 2).
However, Western blot showed that when the Notch3 receptor or the
Notch3-LD/Fc fusion protein are denatured in SDS-PAGE and
transferred to nylon blot membrane, the anti-Notch3 MAbs no longer
bind, suggesting a conformational epitope. Transiently transfected
293T cells containing a Notch3/Hygro plasmid were also stained with
immunofluorescence as described above and observed by fluorescent
microscopy.
TABLE-US-00002 TABLE 2 Binding activity of anti-Notch3 MAbs in
cell-based FACS analysis shown as mean fluorescent intensity
Monoclonal Antibody 293T/Notch3-stable cell line Sup-T1 256A-4 195
43 256A-8 189 45 negative control* 21 23 positive control** 198
74
[0207] The cell-based FMAT.TM. and FACS analyses confirmed that
both MAbs 256A-4 and 256A-8 indeed bind to the Notch3 receptor
expressed either from recombinant plasmid constructs or as native
protein in cultured cells (Table 2 and Table 3).
TABLE-US-00003 TABLE 3 Summary of anti-Notch3 MAbs binding activity
in cell-based FMAT .TM. mAb 256A-4 mAb 256A-8 mAb G3 Notch3 + + -
(full-length)/ 293T
[0208] G3 is a negative control human IgG1 Mab. A positive binding
signal was determined based on the FMAT.TM. signal read-out that
was significantly higher than G3 and other negative hybridoma
clones (p>0.01). The negative signal of G3 FMAT.TM. binding
read-out was considered background. Transiently transfected 293T
cells with Notch3/Hygro plasmid were also stained with
immunofluorescence as described above and observed by fluorescent
microscopy.
Example 4: Western Blot Analysis of Anti-Notch3 MAb Binding
Activity
[0209] Western blot was performed to assess the anti-Notch3 MAbs'
binding activity to Notch3 under denaturing conditions, as well as
expression levels of Notch3 and other Notch-related proteins in
human cell lines. Purified Notch3-LD/Fc fusion protein was combined
with protein loading buffer. Protein samples were also prepared
from the transiently or stably transfected cells described in
Example 1, which were harvested from culture dishes, washed once
with PBS, resuspended in total cellular protein extract buffer
(Pierce, Rockford, Ill.), and heated at 100.degree. C. for 10
minutes after adding equal volume of 2.times. protein sample
loading buffer. All samples were separated by electrophoresis in a
4-15% gradient SDS-PAGE. The proteins were transferred from gel to
PVDF membrane and anti-Notch3 MAbs were applied to the Western blot
membrane as the primary detection antibody. An HRP-conjugated
secondary antibody was used for detection and the signal generated
using a chemiluminescent substrate as described above. Positive
control antibodies against human Fc, V5 tag, Notch3 and Notch1 were
purchased from Invitrogen, R&D Systems, Santa Cruz
Biotechnologies, and Orbigen.
[0210] Western blot analysis showed that MAbs 256A-4 and 256A-8 do
not bind to Notch3-LD/Fc under denaturing conditions, which is in
distinct contrast to the results observed in ELISA and FAGS
analyses where Notch3 LIN12/heterodimerization domains are
maintained in native molecular conformation. Therefore, it is
concluded that MAbs 256A-4 and 256A-8 bind to multiple epitopes in
Notch3-LD that have to be maintained in their native conformation.
This conclusion was confirmed by the results from epitope mapping
discussed in Example 8 below.
Example 5: Assessing Functionality of Anti-Notch3 MAbs by
Luciferase Reporter Assay
[0211] A. Plasmid Constructs
[0212] The full length Notch3 expression construct described in
Example 3 above was confirmed by sequencing, and is identical to
the published sequence depicted in FIG. 1. Human Jagged1 plasmid
was obtained from OriGene (Rockville, Md.), and verified by
sequencing as identical to NM_000214 (NCBI/GENBANK.RTM. accession
number). Because the OriGene Jagged1 plasmid did not have an
antibiotic selection marker, the Not I fragment containing Jagged1
coding sequence was transferred into PCDNA.TM.3.1/Hygromycin. A 3.7
Kb subclone of human Jagged2 cDNA was generated by first strand
cDNA synthesis from human T-cell leukemia cell line, HH (ATCC No.
CRL-2105) and PCR-amplified. The Jagged2 cDNA was subsequently
subcloned. The expression of Notch3, Jagged1, and Jagged2 was
verified by transient transfection and Western blot as described in
Example 4.
[0213] To generate a luciferase reporter plasmid for Notch
signaling, two complementary oligonucleotide primers containing
tandem repeats of CBF1 binding motif were synthesized having the
following sequences:
TABLE-US-00004 (SEQ ID NO 7)
5'GCTCGAGCTCGTGGGAAAATACCGTGGGAAAATGAAC CGTGGGAAAATCTCGTGG (SEQ ID
NO 8) 5'GCTCGAGATTTTCCCACGAGATTTTCCCACGGTTC
[0214] These two oligoprimers were annealed at 65.degree. C. in 100
mM of NaCl with each oligo at a concentration of 4 mM. After
annealing to each other, the primers were extended by PCR. The PCR
product was cloned into a commercially available vector. The insert
was verified by sequencing, which contains four tandem repeats of
CBF1 binding motif and two flanking Xho I sites. The insert was
excised using Xho I and ligated downstream of the firefly
luciferase reporter coding sequence. After luciferase reporter
assay and sequencing analysis, plasmid clones with eight repeats of
CBF1 binding motifs were selected and designated CBF1-Luc.
[0215] B. Stable Cell Line Generation
[0216] Two stable cell lines were generated for functional assays
using human embryonic kidney cell lines (HEK293). One cell line
contained the Notch3-expressing plasmid and CBF1-Luc reporter
plasmid integrated into the nuclear genome. This cell line was
generated by cotransfecting Notch3/hygromycin and CBF1-Luc plasmids
into 293T cells using LIPOFECTAMINE.TM. 2000 transfection system
according to the manufacturer's protocol. Stable transfection cell
clones were selected against 200 .mu.g/ml hygromycin in DMEM growth
medium, and screened by luciferase reporter assay and Western blot.
A cell line with relatively high level of Notch3 expression (based
on Western blot) and luciferase activity was selected for use in
functional assay, and designated NC85.
[0217] The second stable cell line contained a Notch ligand
expression construct, such as Jagged1 or Jagged2, or PCDNA.TM.3.1
as negative control. Stable cell lines expressing human Jagged1 or
harboring PCDNA.TM.3.1 were generated by transfection into 293T
cells and selection against hygromycin as described above. Jagged2
was subcloned, transfected into a 293T cell line and expected to be
integrated into a specific locus in the genome.
Hygromycin-resistant cells were selected as above.
[0218] C. Luciferase Reporter Assay Under Coculture Conditions
[0219] NC85 cells were mixed and cocultured with another 293T cell
line stably expressing human Jagged1 (Jagged1/293T), Jagged2/293F,
or PCDNA.TM.3.1/293 T, respectively, for 24 to 48 hours. At the end
of the co-culture, the media was removed by aspiration, cells were
lysed in 1.times. Passive Lysis Buffer (E1501, Promega, Madison,
Wis.) and luciferase activities were assayed using the Luciferase
Assay System following manufacturer's protocol (E1501, Promega,
Madison, Wis.) in TD-20/20 luminometer (Turner Designs Instrument,
Sunnyvale, Calif.). As illustrated in FIG. 6 and FIG. 7, when NC85
cells were cocultured with Jagged1/293T or with Jagged2/293F, the
luciferase activity was increased 2-4 fold as compared to that of
coculturing with PCDNA.TM.3.1/293 T cells. To assess the inhibitory
effect of anti-Notch3 MAbs, the antibodies were added to the cell
culture at beginning of seeding and mixing of cocultured cells.
(256-A, 256A-8 and an EGF-Repeat Domain control 255A-79).
[0220] D. Luciferase Reporter Assay by Culturing Cells on Notch
Ligand-Coated Plates
[0221] Regular 96-well tissue culture plates from Becton Dickinson
Labware (#18779, Palo Alto, Calif.) were coated with rat
Jagged1/Fc, human DLL-4 (R&D Systems, Minneapolis, Minn.) or
Human Fc (Jackson ImmunoResearch, West Grove, Pa.), bovine serum
albumin (Sigma, St Louis, Mo.). One hundred microliters of each
protein (3 .mu.g/ml in PBS) was distributed in a well and
maintained at room temperature or 4.degree. C. for at least 8 hours
until the coating solution was removed before use. NC85 cells or
cancer cells were seeded at 3-5.times.10.sup.4 cells per well and
allowed to grow for 28-48 hours. The luciferase reporter assay and
antibody inhibition assay were performed as described in Section C
above. The luciferase reporter assay demonstrated the two MAbs
256A-4 and 256A-8 binding to LIN12/dimerization domain almost
completely blocked Jagged1 and Jagged2-induced luciferase reporter
activity (FIGS. 6 and 7). In contrast, a MAb specifically binding
to Notch3-EGF domain (255A-79), as a control, only inhibited
Jagged1-induced luciferase reporter activity (about 60% inhibition,
FIG. 6), but not Jagged2-induced luciferase reporter activity (FIG.
7). The ability of MAbs 256A-4 and 256A-8 to block DLL-4-induced
luciferase reporter activity is shown in FIG. 8.
[0222] Additional functional assays demonstrated that MAbs 256A-4
and 256A-8 inhibited ligand-induced up-regulation of Notch target
genes. 293T cells expressing recombinant Notch3 were cultured on
Jagged-1-coated plates. In the presence of MAbs 256A-4 and 256A-8,
up-regulation of HES5 and HEY2, two Notch target genes, was
inhibited, as measured by quantitative RT-PCR (data not shown).
[0223] To verify whether the anti-Notch3 MAbs can bind to native
Notch3 expressed in human cancer cells and block the receptor
signaling, a reporter assay was performed using two ovarian cancer
cell lines, OV/CAR3 and A2780. Both 256A-4 and 256A-8 significantly
blocked Jagged1-induced Notch signaling mediated by native Notch3
in OV/CAR3 cells (FIG. 9a). Similarly, both MAbs inhibited about
50% of luciferase activity induced by D114 coated on the plate
(FIG. 9b). The latter result is consistent with the fact that both
Notch1 and Notch3 are expressed in A2780 cells. These results
suggest that the anti-Notch3 MAbs can inhibit native
Notch3-mediated signaling in cancer cells.
Example 6: Apoptosis Assay
[0224] Annexin V is an early apoptotic marker on the cell surface,
and the apoptotic cell population can be marked by
fluorophore-labeled anti-Annexin V antibody and quantified by FACS
analysis. NC85 cells were seeded at 5-6.times.10.sup.4 cells per
well in Fc- or Jagged1/Fc-coated 96-well plate as described above
and maintained in serum-free DMEM medium for 24 hours. Apoptotic
cells were stained by FITC-labeled anti-Annexin V antibody (BD
Biosciences, Palo Alto, Calif.) and analyzed by FACS. Cells
cultured on Jagged1/Fc-coated surface had significantly lower
apoptotic cell population comparing to those cultured on Fc-coated
plate (FIG. 10). To study the antibody's functional effect,
anti-Notch3 MAbs were added in cell culture at the beginning of the
study. As shown in FIG. 10, anti-Notch3 MAbs 256A-4 and 256A-8
blocked about 50-65% of the cell survival effect induced by
Jagged1.
Example 7: Cell Migration Assays, Invasion Assays, and Morphology
Assays
[0225] In vitro cell migration and invasion assays are frequently
used to assess metastasis potential of cancer cells. These assays
were performed to assay the inhibitory effect exerted by the
anti-Notch3 MAbs on the tumorgenic 293T/Notch3-stable cell line
(NC85). The invasion assay was performed using COSTAR.RTM. 48-well
insert plate (Sigma-Aldrich, St. Louis, Mo.). The insert divides
the well into upper and lower chambers which are separated by a
porous membrane (pore diameter=8 .mu.m) at the bottom of the
insert. Notch ligands, Jagged1/Fc, DLL-4, or human Fc, were
immobilized on the membrane surface as describe in above sections.
NC85 cells were seeded at 100,000 cells per well and maintained in
serum-free DMEM in the upper chamber and 10% FCS/DMEM in the lower
chamber. After 10-24 hours, cells that remained on the top surface
of the insert membrane were removed, and the cells that passed the
membrane adhering on the bottom of the insert membrane were stained
by 0.05% crystal velvet in PBS. The dye was extracted from the
cells by 30% acetic acid and absorption readings at 590 nm were
recorded. The anti-Notch3 MAbs were added to cell culture 24 hours
before seeding NC85 cells in the COSTAR.RTM. assay plate and all
MAbs were added to the cell culture 24 hours before seeding NC85
cells in the COSTAR.RTM. assay plate. Fresh MAbs were added to
maintain the same concentration in the migration assay plate.
Experimental results are shown in FIG. 11A.
[0226] The invasion assay was performed using Becton Dickinson
48-well MATRIGEL.TM. plate (BD Labware, Palo Alto, Calif.). The
cell culture well was divided by an insert well into upper and
lower chambers, which are separated by a porous membrane (pore
diameter=8 .mu.m) at the bottom of the insert well. An optimized
density of MATRIGEL.TM. matrix was coated on the membrane top
surface and fibronectin was coated on the membrane bottom surface
by the manufacturer. NC85, Jagged1/293T, and pcDNA3.1/293T cells
were mixed pair-wise such as indicated in FIG. 11B. A total of
6-10.times.10.sup.4 cells were seeded in each well in the 48-well
MATRIGEL.TM. plate and cultured in growth medium for 24 hours. The
cells that remained on top of the insert membrane in the upper
chamber were removed and the cells that passed the membrane
adhering on the bottom of the insert membrane were stained by 0.05%
crystal velvet in PBS. The dye was extracted and absorption
measurements were as described in the previous section. MAbs were
added at the beginning of the mixed cell culture. The results are
shown in FIG. 11B.
[0227] The cell migration assay results showed that when NC85 cells
were cultured on Jagged1-coated membrane, the activation of Notch3
signaling significantly increased cell migration, and MAbs 256A-4
and 256A-8 clearly inhibited the migration (FIG. 11A). The invasion
experiment showed a similar trend (FIG. 11B).
[0228] Additionally, the effect of MAbs 256A-4 and 256A-8 on
Jagged-1-induced formation of cell "spheres" was examined. When
293T cells over-expressing Notch3 were cultured on Jagged-1-coated
plates, the cells formed loosely attached "cell balls" or
"spheres." In the presence of MAbs 256A-4 and 256A-8, however,
formation of these cell spheres was inhibited (data not shown).
Example 8: Mapping the Binding Epitope of Anti-Notch3 MAbs
[0229] A. Domain Swap Strategy and Rationale
[0230] First, the antagonist Notch3 MAbs bind to Notch3
LIN12/dimerization domain (LD), but not to the homologous human
Notch1 LIN12/dimerization domain (See FIGS. 12 and 13). Second, the
anti-Notch3 MAbs do not bind to denatured Notch3 protein in Western
blot as discussed in Example 4, indicating the MAbs bind to
conformational epitopes. Third, Notch3 and Notch1 share
approximately 55% amino acid sequence homology in the
LIN12/dimerization domain, and therefore it was concluded that a
domain swap between Notch3 and Notch1 within this region would not
disrupt the protein conformation.
[0231] B. Generating Domain Swap Fusion Protein Constructs
[0232] Sequence analysis indicated that Notch3 has three LIN12
repeats and its dimerization domain is divided into two segments.
Therefore, five domain swap protein constructs were generated with
each of the three LIN12 repeats and the two dimerization segments
replaced by the corresponding domains of Notch1. The domain swap
constructs were generated using PCR-SOE (Ho, et al., Gene 77:51
(1989); Horton, et al., BioTechniques 8:528 (1990)) as illustrated
in FIG. 12. PCR and PCR-SOE reactions were performed using PCR with
1M Betaine and 5% DMSO added to the reaction. PCR thermocycling was
almost same for PCR and PCR-SOE except that the annealing step of
each PCR cycle was extended one minute in PCR-SOE. The final
PCR-SOE product was subcloned and verified by sequencing. The
plasmid clone with the correct insert sequence was cleaved with Nhe
I and Xho I to excise the insert, which was gel-purified and
subcloned. The five Notch3/Notch1 domain swap constructs are
illustrated in FIG. 12. To facilitate the epitope mapping, the
human IgG kappa chain signaling peptide was used as leader peptide
in the domain swap constructs. The amino acid sequences are shown
in FIGS. 16 and 17.
[0233] Notch1-LD cDNA was PCR-amplified using PCR and methods
described in the above section. The first strand cDNA template was
synthesized from PA-1 cell total RNA (ATCC No. CRL-1572). The human
IgG kappa chain leader peptide coding sequence was PCR-amplified,
used as leader peptide to link to the 5' of Notch1-LD by PCR-SOE
and subcloned in His-.gamma.1Fc/pSec.
[0234] Based on ELISA analysis results, target domains LI, D1 and
D2 were further divided into subdomains. ELISA binding analysis
using the subdomain expression constructs showed that only L1 and
D2 were required for the Notch3 MAb binding. The D1 domain was not
required. Therefore, L1 and D2 domains were divided into clusters
of amino acid mutations for further analysis of the specific
binding site. Constructs containing L1 and D2 subdomain swap or
clusters of amino acid mutations as shown in FIG. 16 and FIG. 17
were generated.
[0235] C. Expression of Notch3/Notch1 Domain Swap Fusion
Protein
[0236] Notch3/Notch1-LD domain swap plasmids were transiently
transfected in CHO cells using LIPOFECTAMINE.TM. 2000 transfection
system. CHO cells were seeded in DMEM growth medium with 10% FCS at
0.8-1.times.10.sup.6 cells per well in 6-well plate, maintained in
CO.sub.2 incubator overnight before transfection. The cells were
recovered after transfection in the growth medium for about 3
hours, then switched to DMEM with 2% FCS, and cultured for three
days. The conditioned media were harvested and centrifuged at 3500
rpm for 10 minutes. The supernatant containing Notch3-LD domain
swap protein secreted from CHO was collected and prepared for
Western blot and ELISA binding analyses. ELISA showed that all the
domain-swap fusion proteins were expressed and secreted in
conditioned medium (Table 4), which was further confirmed by
Western blot analysis (data not shown).
[0237] The ELISA readings used anti-human Fc antibody as detection
antibody showing all the proteins were expressed in conditioned
medium. Human IgG/Fc was used as a control. The starting point of
human IgG/Fc coated in each well is 100 ng.
TABLE-US-00005 TABLE 4 ELISA Readings Dilution N1-LD N3-LD L1-swap
L2-swap L3-swap D1-swap D2-swap hIgG-Fc Statistics: mean 1 3.2000
3.3445 3.4380 3.0970 3.2910 3.2870 3.4110 3.5510 0.250000 3.1305
2.7625 2.9890 2.7390 2.9050 3.0225 2.9570 3.4995 0.062500 2.3785
1.3870 2.8145 1.2835 2.6855 2.2575 2.3240 3.5805 0.015625 1.0085
0.3960 1.5245 0.3865 1.7350 0.9110 0.8800 3.2355 0.003906 0.3300
0.1075 0.4755 0.1220 0.5970 0.3450 0.2130 1.8585 0.000977 0.2095
0.0400 0.1640 0.1105 0.1780 0.1635 0.0615 0.5865 0.000244 0.1340
0.0225 0.0500 0.0595 0.0575 0.1045 0.0275 0.1445 6.104E-05 0.1000
0.0135 0.0405 0.0505 0.0230 0.0575 0.0305 0.0315 1.526E-05 0.0975
0.0165 0.0205 0.0430 0.0180 0.0400 0.0155 0.0220 3.815E-06 0.0580
0.0140 0.0135 0.0300 0.0150 0.0425 0.0235 0.0230 9.537E-07 0.0540
0.0125 0.0155 0.0245 0.0215 0.0480 0.0145 0.0165 2.384E-07 0.0415
0.0125 0.0145 0.0305 0.0155 0.0370 0.0150 0.0190 Statistics: S.D. 1
0.0778 0.0290 0.0679 0.0255 0.0933 0.1018 0.0283 0.0071 0.250000
0.0191 0.0304 0.0354 0.0396 0.0693 0.1619 0.1202 0.0148 0.062500
0.0898 0.0919 0.0007 0.1096 0.0318 0.0021 0.0071 0.0290 0.015625
0.0474 0.0354 0.0106 0.0417 0.1075 0.0071 0.0325 0.1450 0.003906
0.0523 0.0177 0.0460 0.0113 0.0453 0.0339 0.0057 0.0573 0.000977
0.0092 0.0057 0.0042 0.0191 0.0156 0.0205 0.0007 0.0955 0.000244
0.0226 0.0092 0.0014 0.0106 0.0064 0.0035 0.0049 0.0276 6.104E-05
0.0113 0.0007 0.0064 0.0035 0.0057 0.0134 0.0064 0.0064 1.526E-05
0.0021 0.0035 0.0049 0.0042 0.0000 0.0028 0.0007 0.0028 3.815E-06
0.0113 0.0028 0.0021 0.0000 0.0042 0.0064 0.0007 0.0057 9.537E-07
0.0014 0.0007 0.0007 0.0007 0.0064 0.0057 0.0021 0.0078 2.384E-07
0.0120 0.0035 0.0049 0.0021 0.0007 0.0113 0.0014 0.0127
[0238] Abbreviations for proteins used in the ELISA binding assays
of Table 4 include: N1-LD, Notch1-LD/Fc. N3-LD, Notch3-LD/Fc.
L1-swap: 1st LIN12 domain swap. L2-swap: 2nd LIN12 domain swap.
L3-swap: 3rd LIN12 domain swap. D1-swap: 1st dimerization domain
swap. D2-swap: 2nd dimerization domain swap. hIgG-Fc, human IgG
Fc.
[0239] D. Epitope Binding Analysis Using ELISA
[0240] The 96-well flat bottom IMMULON II microtest plates
(Dynatech Laboratories, Chantilly, Va.) were coated with anti-human
Fc antibody (Jackson ImmunoResearch) by adding 100 .mu.l of the
antibody (0.1 .mu.g/ml) in phosphate buffered saline (PBS)
containing 1.times. Phenol Red and 3-4 drops pHix/liter (Pierce,
Rockford, Ill.), and incubated overnight at room temperature. After
the coating solution was removed by flicking of the plate, 200
.mu.l of blocking buffer containing 2% BSA in PBST and 0.1%
merthiolate was added to each well for one hour to block
non-specific binding. The wells were then washed with PBST. Fifty
microliters of the above conditioned medium from each transfection
of Notch3/Notch1 domain swap construct were collected, mixed with
50 .mu.l of blocking buffer, and added to the individual wells of
the microtiter plates. After one hour of incubation, the
Notch3/Notch1-LD domain swap protein was captured by the coated
anti-Fc antibody, and the wells were washed with PBST. Anti-Notch3
MAbs and isotype-matched control MAbs were serially diluted in
blocking buffer as above, and 50 .mu.l of the diluted MAbs were
added in each well to assess binding to the bound Notch3/Notch1
domain swap protein. Horseradish peroxidase (HRP)-conjugated,
Fc-specific goat anti-mouse IgG was used for detection. HRP
substrate solution containing 0.1% 3,3,5,5-tetramethyl benzidine
and 0.0003% hydrogen peroxide was added to the wells for color
development for 30 minutes. The reaction was terminated by addition
of 50 ml of 2 M H2SO.sub.4/well. The OD at 450 nm was read with an
ELISA reader. Subdomain swap constructs and clusters of mutations
were similarly examined by ELISA analysis above.
[0241] ELISA binding experiments using MAbs 256A-4 and 256A-8
against the domain-swap proteins showed that the swap of the 1st
LIN12 domain (L1) and 2nd dimerization domain (D2) completely
abolished all the three MAbs binding, while the swap of 1st
dimerization domain (D1) abolished binding of MAbs 256A-4 and
256A-8 (FIGS. 13 B&C). Swap of the 3rd LIN12 domain (L3)
significantly weakened the binding. Nevertheless, both MAbs were
still able to bind to the fusion protein. The swap of the 2nd LIN12
domain had no interference with the binding of the MAbs (FIGS. 13B
and C). A positive control antibody, which was previously mapped to
bind to the 1st LIN12 domain, bound to all domain swap fusion
protein except L1 (FIG. 13D). In contrast, isotype control negative
antibody, G3, does not bind to any of the domain swap fusion
proteins in the ELISA assay (data not shown). It was concluded from
the above experiments that the 1st LIN12 domain and 2nd
dimerization domain were required for MAbs 256A-4 and 256A-8
binding.
[0242] To further map the epitopes in the 1st LIN12 domain (L1) to
which anti-Notch3 MAbs bind, the L1 domain was further divided into
three subdomains, L1-sub1, L1-sub2 and L1-sub3, and swapped with
the corresponding sequences in Notch1 (FIG. 16). An ELISA binding
assay showed that L1-sub1 swap has no inhibitory effects on binding
activity, and L1-sub2 and L1-sub3 swap abolished binding (FIG. 16).
In L1-sub2 and L1-sub3 regions, there are five clusters of amino
acid residues that differ between Notch3 and Notch1. Therefore,
swap fusion protein constructs were generated within these five
clusters of amino acids (FIG. 16). ELISA analysis demonstrated that
L1-cluster4 swap had no inhibition on all three MAbs binding. The
remaining four clusters of swap partially or completely abolished
the anti-Notch MAbs binding. Thus, those four clusters of amino
acid residues represented four different epitopes to which the MAbs
bind. L1-cluster3 (amino acids: DRE) and L1-cluster5 (amino acids:
SVG) are required. L1-cluster1 (amino acids: AKR) and cluster2
(amino acids: DQR) also played a role in anti-Notch3 MAb binding,
whose mutations significantly weakened the MAb binding.
[0243] To map the epitopes in the 2.sup.nd dimerization (D2) domain
of Notch3 to which anti-Notch3 MAbs bind, the D2 domain was further
divided into five subdomains, D2-sub1, D2-sub2, D2-sub3, D2-sub4
and D2-sub5. The sequences in those subdomains were swapped with
the corresponding sequences in Notch1 (FIG. 17). An ELISA binding
assay showed that MAbs 256A-4 and 256A-8 have strong binding to
D1-sub2 and D2-sub3 swap, but not to D2-sub1 and D2-sub4 swap. Both
MAbs showed weak binding to D2-sub5 (FIG. 17). Therefore, the data
suggested that D2-sub1 and D2-sub4 are required for the anti-Notch3
MAb binding and D2-sub5 may help the binding activity.
[0244] Both MAbs 256A-4 and 256A-8 are antagonistic antibodies
binding to the conformational epitope comprising L1 and D2, while
another antibody 256A-13 that binds only to L1 is agonistic (See
co-pending U.S. application Ser. No. 11/874,682, filed Oct. 18,
2007). Furthermore, agonistic 256A-13 competes with antagonistic
256A-4 for an epitope within L1, and the epitope mapping studies
suggest that they bind to an overlapping epitope on L1. The major
difference is that the antagonistic antibodies also bind to D2,
while the agonistic antibody does not. To test the hypothesis that
simultaneous binding to L1 and D2 is responsible for the
antagonistic activity, an antibody, 256A-2 binding to a similar
epitope in D2 as 256A-4 was analyzed. MAb 256A-2 is neither
antagonistic nor agonistic (data not shown). Studies showed that
256A-2 does not compete with 256A-13 and can bind to Notch3
simultaneously. Furthermore, 256A-2 and 256A-13 individually can
partially compete with 256A-4, however, in combination these two
antibodies completely block binding of 256A-4 to Notch3 (data not
shown). Studies also showed that separate binding of two antibodies
to the epitopes in L1 and D2 does not lead to the inhibition of
ligand-dependent Notch3 activation, suggesting that the
antagonistic antibodies form a bridge, possibly locking and
stabilizing the L1 and D2 interaction, and preventing the ligand
induced conformational changes. (See FIG. 18)
Example 9: Sequencing of Anti-Notch3 MAbs
[0245] Because antibody binding properties are dependent on the
variable regions of both heavy chain and light chain, the variable
sequences of 256A-4 and 256A-8 were subtyped and sequenced. The
antibody IgG subtype was determined using an ISOSTRIP.TM. mouse
monoclonal antibody isotyping kit (Roche Diagnostics, Indianapolis,
Ind.). The results showed that both MAbs, 256A-4 and 256A-8 have an
IgG.sub.1 heavy chain and a kappa light chain.
[0246] The variable region sequences of heavy chain and light chain
were decoded through RT-PCR and cDNA cloning. Total RNAs from
hybridoma clones 256A-4 and 256A-8 were isolated using an RNeasy
Mini kit following the manufacturer's protocol (QIAGEN, Valencia,
Calif.). The first strand cDNA was synthesized using the RNA
template and SUPERSCRIPT.RTM. III reverse transcriptase kit. The
variable region of light chain and heavy chain cDNAs were
PCR-amplified from the first strand cDNA using degenerative forward
primers covering the 5'-end of mouse kappa chain coding region and
a reverse primer matching the constant region at the juncture to
the 3'-end of the variable region, or using degenerative forward
primers covering the 5'-end of mouse heavy chain coding region and
a constant region reverse primer in mouse heavy chain. The PCR
product was cloned into a commercially available vector and
sequenced by Lone Star Lab (Houston, Tex.). The nucleotide
sequences were analyzed utilizing the DNASTAR.RTM. computer
software program (DNASTAR, Inc., Madison, Wis.). Each anti-Notch3
MAb sequence was determined by sequences from multiple PCR clones
derived from the same hybridoma clone.
[0247] MAb 256A-4 contains 123 and 116 amino acid residues,
respectively, in its variable region of heavy chain and light chain
(FIGS. 4A and 4B). MAb 256A-8 consists of 122 and 123 amino acid
residues in heavy chain and light chain variable regions,
respectively (FIGS. 5A and 5B).
Example 10: Impact of Notch3 Antagonistic Antibodies on
Metalloprotease Cleavage of Notch3
[0248] Notch receptor activation involves ligand induced
metalloprotease cleavage at juxtamembrane site (S2) generating an
extracellular subunit. This cleavage is an essential prerequisite
to S3 cleavage to release the activated Notch intracellular region.
Both 256A-4 and 256A-8 were found to require the presence of at
least a portion of the Notch3 L1 and D2 domains for their bindings.
These two domains are not located in close proximity in the linear
sequence, but rather are on two separate polypeptides, suggesting
these antibodies may stabilize an inactive, autoinhibited Notch
configuration. To test whether the antagonizing antibodies can
inhibit sequential Notch activation events, including two
proteolytic cleavages, 293T cells stably expressing a recombinant
Notch3 receptor (NC85 cells) are treated with either immobilized
recombinant Jagged-1 or cocultured with 293T cells expressing
Jagged-1. The soluble extracellular subunits generated by
proteolytic cleavage in the culture medium are detected by an ELISA
assay using an antibody bound to a solid surface that recognizes
the Notch3 cleavage product. Notch3 antagonistic MAbs are expected
to decrease the generation of soluble Notch3 extracellular subunits
in the conditioned medium, whereas non-functional Notch3 binding
antibodies would not.
[0249] To directly detect the S2 cleavage fragment, an 7.5% SDS
PAGE electrophoresis and Western blot with Notch3 C-terminal
antibody are performed. The S2 fragment is 57 amino acids residues
smaller and migrates slightly faster than the non-cleaved Notch3
small subunit (transmembrane subunit).
[0250] To examine whether Notch3 antagonistic MAbs inhibit
ligand-induced metalloprotease cleavage of Notch3 at S2, 293T cells
expressing recombinant Notch3 were treated with the
.gamma.secretase inhibitor compound E (1 .mu.M) for 4 hours, which
stabilizes the product of cleavage at site S2, allowing it to
accumulate. In the presence of MAbs 256A-4 and 256A-8,
Jagged-1-induced metalloprotease cleavage of Notch3 at S2 was
inhibited (data not shown).
Example 11: Efficacy Study Using Human Cancer Models in Xenograft
Mice
[0251] A. Human Cancer Cells and Tumorigenic Cells
[0252] Human cancer cell lines with Notch3 expression such as
HCC2429, HCC95 may be obtained from Academic Institutes, or from
the ATCC. The 293T/PCDNA.TM.3.1, and 293T/Notch3 (NC85) cells are
generated by transfecting 293T with related genes and selecting
with hygromycin as describe in previous sections. All cells are
cultured in DMEM or RPMI 1640 medium with 10% fetal bovine serum,
sodium pyruvate, nonessential amino acids, L-glutamine, vitamin
solution, and penicillin-streptomycin (Flow Laboratories,
Rockville, Md.). Cell lines are incubated in a mixture of 5%
CO.sub.2 and 95% air at 37'C in an incubator. Cultures are
maintained for no longer than 3 weeks after recovery from frozen
stocks. Logarithmically growing single-cell suspensions cells with
.gtoreq.90% viability are used for tumor cells injection after
washing with PBS.
[0253] B. Animals
[0254] Mice are obtained from, for example, the Animal Production
Area of the National Cancer Institute at Frederick Cancer Research
and Development Center, Frederick, Md. The animals are purpose-bred
and are experimentally naive at the outset of the study. Mice
selected for use in the studies are chosen to be as uniform in age
and weight as possible. They are 6-8 weeks of age and their body
weights at initiation of weight range from approximately 18 to 25
grams. Records of the dates of birth for the animals used in this
study are retained in the study raw data, and the weight range at
the time of group assignment is specified in the report. Each
animal is identified by a numbered ear tag. The animals are group
housed by treatment group (4 mice/cage) in polystyrene disposable
shoe-box cages containing cellulose bedding, meeting or exceeding
NIH guidelines. During the course of the study, the environmental
conditions in the animal room is monitored and maintained within a
temperature range of 18-26.degree. C., and the relative humidity is
recorded daily. A 12-hour light/dark illumination cycle is
maintained throughout the study. Animals have irradiated food. No
contaminants are known to be present in the food at levels that
would interfere with the results of this study. Autoclaved water is
available to each animal via water bottles. No contaminants are
known to be present in the water at levels that would interfere
with the results of this study. Prior to assignment to the study,
all study animals are acclimatized to their designated housing for
at least 7 days prior to the first day of dosing.
[0255] C. Tumor Models and Efficacy Studies
[0256] Mice are anesthetized using sodium pentobarbital (50 mg/kg
body weight) and placed in the right lateral decubitus position.
Cancer cells, such as non-small cell lung cancer (NSCLC) cell
lines, HCC2429 (Haruki, et al. Cancer Res. 65:3555 (2005)), HCC95
(From Dr. John Mina), and H2122 (ATCC No. CRL5985), in 50 .mu.l
Hank's containing 10% MATRIGEL.TM. matrix are injected into the
left lobe of the lungs. After the tumor-cell injection, the mice
are turned to the left lateral decubitus position and observed for
45-60 min until they recover fully. Records of tumor cell
injections are maintained in the raw study data.
[0257] All animals are observed within their cages at least once
daily during study and clinical findings recorded in the study raw
data. Animals that show pronounced detrimental effects may be
removed from the study should it be deemed necessary. Body weight
is measured once each week during the treatment. Cancer tissues
from each mouse, where available, are harvested and stored for
potential future biological characterization.
Example 12: Assay for Notch3 Related Diseases
[0258] To identify other Notch3 related diseases, one can sequence
the Notch3 gene from patient samples, perform FISH (fluorescence in
situ hybridization) and CGH (comparative genomic hybridization)
analysis to look for translocation and gene amplification using
patient cells, or perform immunohistochemistry to check for the
over-expression of Notch3 receptor using patient tissue or tumor
sections. In addition, one can isolate and culture cells from a
patient suspected of having a Notch3 associated disease and study
the impact of an antagonistic antibody of the present invention on
cell migration, invasion, survival and proliferation. Protocols for
cell migration and invasion assay are described in Example 7 and
the protocol for an apoptosis assay is described in Example 6. For
the cell proliferation assay, cells cultured from patient samples
are be seeded in 96-well plate coated with and without Notch
ligands. Antagonistic antibodies are added at the beginning of the
culture. Cell numbers are counted at specific time points using
trypan blue staining. Notch3 FISH and CGH analysis may be performed
using the published protocols of Park, et al. (Cancer Res, 66: 12
(2006)).
[0259] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
4812321PRTHomo sapiens 1Met Gly Pro Gly Ala Arg Gly Arg Arg Arg Arg
Arg Arg Pro Met Ser 1 5 10 15 Pro Pro Pro Pro Pro Pro Pro Val Arg
Ala Leu Pro Leu Leu Leu Leu 20 25 30 Leu Ala Gly Pro Gly Ala Ala
Ala Pro Pro Cys Leu Asp Gly Ser Pro 35 40 45 Cys Ala Asn Gly Gly
Arg Cys Thr Gln Leu Pro Ser Arg Glu Ala Ala 50 55 60 Cys Leu Cys
Pro Pro Gly Trp Val Gly Glu Arg Cys Gln Leu Glu Asp 65 70 75 80 Pro
Cys His Ser Gly Pro Cys Ala Gly Arg Gly Val Cys Gln Ser Ser 85 90
95 Val Val Ala Gly Thr Ala Arg Phe Ser Cys Arg Cys Pro Arg Gly Phe
100 105 110 Arg Gly Pro Asp Cys Ser Leu Pro Asp Pro Cys Leu Ser Ser
Pro Cys 115 120 125 Ala His Gly Ala Arg Cys Ser Val Gly Pro Asp Gly
Arg Phe Leu Cys 130 135 140 Ser Cys Pro Pro Gly Tyr Gln Gly Arg Ser
Cys Arg Ser Asp Val Asp 145 150 155 160 Glu Cys Arg Val Gly Glu Pro
Cys Arg His Gly Gly Thr Cys Leu Asn 165 170 175 Thr Pro Gly Ser Phe
Arg Cys Gln Cys Pro Ala Gly Tyr Thr Gly Pro 180 185 190 Leu Cys Glu
Asn Pro Ala Val Pro Cys Ala Pro Ser Pro Cys Arg Asn 195 200 205 Gly
Gly Thr Cys Arg Gln Ser Gly Asp Leu Thr Tyr Asp Cys Ala Cys 210 215
220 Leu Pro Gly Phe Glu Gly Gln Asn Cys Glu Val Asn Val Asp Asp Cys
225 230 235 240 Pro Gly His Arg Cys Leu Asn Gly Gly Thr Cys Val Asp
Gly Val Asn 245 250 255 Thr Tyr Asn Cys Gln Cys Pro Pro Glu Trp Thr
Gly Gln Phe Cys Thr 260 265 270 Glu Asp Val Asp Glu Cys Gln Leu Gln
Pro Asn Ala Cys His Asn Gly 275 280 285 Gly Thr Cys Phe Asn Thr Leu
Gly Gly His Ser Cys Val Cys Val Asn 290 295 300 Gly Trp Thr Gly Glu
Ser Cys Ser Gln Asn Ile Asp Asp Cys Ala Thr 305 310 315 320 Ala Val
Cys Phe His Gly Ala Thr Cys His Asp Arg Val Ala Ser Phe 325 330 335
Tyr Cys Ala Cys Pro Met Gly Lys Thr Gly Leu Leu Cys His Leu Asp 340
345 350 Asp Ala Cys Val Ser Asn Pro Cys His Glu Asp Ala Ile Cys Asp
Thr 355 360 365 Asn Pro Val Asn Gly Arg Ala Ile Cys Thr Cys Pro Pro
Gly Phe Thr 370 375 380 Gly Gly Ala Cys Asp Gln Asp Val Asp Glu Cys
Ser Ile Gly Ala Asn 385 390 395 400 Pro Cys Glu His Leu Gly Arg Cys
Val Asn Thr Gln Gly Ser Phe Leu 405 410 415 Cys Gln Cys Gly Arg Gly
Tyr Thr Gly Pro Arg Cys Glu Thr Asp Val 420 425 430 Asn Glu Cys Leu
Ser Gly Pro Cys Arg Asn Gln Ala Thr Cys Leu Asp 435 440 445 Arg Ile
Gly Gln Phe Thr Cys Ile Cys Met Ala Gly Phe Thr Gly Thr 450 455 460
Tyr Cys Glu Val Asp Ile Asp Glu Cys Gln Ser Ser Pro Cys Val Asn 465
470 475 480 Gly Gly Val Cys Lys Asp Arg Val Asn Gly Phe Ser Cys Thr
Cys Pro 485 490 495 Ser Gly Phe Ser Gly Ser Thr Cys Gln Leu Asp Val
Asp Glu Cys Ala 500 505 510 Ser Thr Pro Cys Arg Asn Gly Ala Lys Cys
Val Asp Gln Pro Asp Gly 515 520 525 Tyr Glu Cys Arg Cys Ala Glu Gly
Phe Glu Gly Thr Leu Cys Asp Arg 530 535 540 Asn Val Asp Asp Cys Ser
Pro Asp Pro Cys His His Gly Arg Cys Val 545 550 555 560 Asp Gly Ile
Ala Ser Phe Ser Cys Ala Cys Ala Pro Gly Tyr Thr Gly 565 570 575 Thr
Arg Cys Glu Ser Gln Val Asp Glu Cys Arg Ser Gln Pro Cys Arg 580 585
590 His Gly Gly Lys Cys Leu Asp Leu Val Asp Lys Tyr Leu Cys Arg Cys
595 600 605 Pro Ser Gly Thr Thr Gly Val Asn Cys Glu Val Asn Ile Asp
Asp Cys 610 615 620 Ala Ser Asn Pro Cys Thr Phe Gly Val Cys Arg Asp
Gly Ile Asn Arg 625 630 635 640 Tyr Asp Cys Val Cys Gln Pro Gly Phe
Thr Gly Pro Leu Cys Asn Val 645 650 655 Glu Ile Asn Glu Cys Ala Ser
Ser Pro Cys Gly Glu Gly Gly Ser Cys 660 665 670 Val Asp Gly Glu Asn
Gly Phe Arg Cys Leu Cys Pro Pro Gly Ser Leu 675 680 685 Pro Pro Leu
Cys Leu Pro Pro Ser His Pro Cys Ala His Glu Pro Cys 690 695 700 Ser
His Gly Ile Cys Tyr Asp Ala Pro Gly Gly Phe Arg Cys Val Cys 705 710
715 720 Glu Pro Gly Trp Ser Gly Pro Arg Cys Ser Gln Ser Leu Ala Arg
Asp 725 730 735 Ala Cys Glu Ser Gln Pro Cys Arg Ala Gly Gly Thr Cys
Ser Ser Asp 740 745 750 Gly Met Gly Phe His Cys Thr Cys Pro Pro Gly
Val Gln Gly Arg Gln 755 760 765 Cys Glu Leu Leu Ser Pro Cys Thr Pro
Asn Pro Cys Glu His Gly Gly 770 775 780 Arg Cys Glu Ser Ala Pro Gly
Gln Leu Pro Val Cys Ser Cys Pro Gln 785 790 795 800 Gly Trp Gln Gly
Pro Arg Cys Gln Gln Asp Val Asp Glu Cys Ala Gly 805 810 815 Pro Ala
Pro Cys Gly Pro His Gly Ile Cys Thr Asn Leu Ala Gly Ser 820 825 830
Phe Ser Cys Thr Cys His Gly Gly Tyr Thr Gly Pro Ser Cys Asp Gln 835
840 845 Asp Ile Asn Asp Cys Asp Pro Asn Pro Cys Leu Asn Gly Gly Ser
Cys 850 855 860 Gln Asp Gly Val Gly Ser Phe Ser Cys Ser Cys Leu Pro
Gly Phe Ala 865 870 875 880 Gly Pro Arg Cys Ala Arg Asp Val Asp Glu
Cys Leu Ser Asn Pro Cys 885 890 895 Gly Pro Gly Thr Cys Thr Asp His
Val Ala Ser Phe Thr Cys Thr Cys 900 905 910 Pro Pro Gly Tyr Gly Gly
Phe His Cys Glu Gln Asp Leu Pro Asp Cys 915 920 925 Ser Pro Ser Ser
Cys Phe Asn Gly Gly Thr Cys Val Asp Gly Val Asn 930 935 940 Ser Phe
Ser Cys Leu Cys Arg Pro Gly Tyr Thr Gly Ala His Cys Gln 945 950 955
960 His Glu Ala Asp Pro Cys Leu Ser Arg Pro Cys Leu His Gly Gly Val
965 970 975 Cys Ser Ala Ala His Pro Gly Phe Arg Cys Thr Cys Leu Glu
Ser Phe 980 985 990 Thr Gly Pro Gln Cys Gln Thr Leu Val Asp Trp Cys
Ser Arg Gln Pro 995 1000 1005 Cys Gln Asn Gly Gly Arg Cys Val Gln
Thr Gly Ala Tyr Cys Leu 1010 1015 1020 Cys Pro Pro Gly Trp Ser Gly
Arg Leu Cys Asp Ile Arg Ser Leu 1025 1030 1035 Pro Cys Arg Glu Ala
Ala Ala Gln Ile Gly Val Arg Leu Glu Gln 1040 1045 1050 Leu Cys Gln
Ala Gly Gly Gln Cys Val Asp Glu Asp Ser Ser His 1055 1060 1065 Tyr
Cys Val Cys Pro Glu Gly Arg Thr Gly Ser His Cys Glu Gln 1070 1075
1080 Glu Val Asp Pro Cys Leu Ala Gln Pro Cys Gln His Gly Gly Thr
1085 1090 1095 Cys Arg Gly Tyr Met Gly Gly Tyr Met Cys Glu Cys Leu
Pro Gly 1100 1105 1110 Tyr Asn Gly Asp Asn Cys Glu Asp Asp Val Asp
Glu Cys Ala Ser 1115 1120 1125 Gln Pro Cys Gln His Gly Gly Ser Cys
Ile Asp Leu Val Ala Arg 1130 1135 1140 Tyr Leu Cys Ser Cys Pro Pro
Gly Thr Leu Gly Val Leu Cys Glu 1145 1150 1155 Ile Asn Glu Asp Asp
Cys Gly Pro Gly Pro Pro Leu Asp Ser Gly 1160 1165 1170 Pro Arg Cys
Leu His Asn Gly Thr Cys Val Asp Leu Val Gly Gly 1175 1180 1185 Phe
Arg Cys Thr Cys Pro Pro Gly Tyr Thr Gly Leu Arg Cys Glu 1190 1195
1200 Ala Asp Ile Asn Glu Cys Arg Ser Gly Ala Cys His Ala Ala His
1205 1210 1215 Thr Arg Asp Cys Leu Gln Asp Pro Gly Gly Gly Phe Arg
Cys Leu 1220 1225 1230 Cys His Ala Gly Phe Ser Gly Pro Arg Cys Gln
Thr Val Leu Ser 1235 1240 1245 Pro Cys Glu Ser Gln Pro Cys Gln His
Gly Gly Gln Cys Arg Pro 1250 1255 1260 Ser Pro Gly Pro Gly Gly Gly
Leu Thr Phe Thr Cys His Cys Ala 1265 1270 1275 Gln Pro Phe Trp Gly
Pro Arg Cys Glu Arg Val Ala Arg Ser Cys 1280 1285 1290 Arg Glu Leu
Gln Cys Pro Val Gly Val Pro Cys Gln Gln Thr Pro 1295 1300 1305 Arg
Gly Pro Arg Cys Ala Cys Pro Pro Gly Leu Ser Gly Pro Ser 1310 1315
1320 Cys Arg Ser Phe Pro Gly Ser Pro Pro Gly Ala Ser Asn Ala Ser
1325 1330 1335 Cys Ala Ala Ala Pro Cys Leu His Gly Gly Ser Cys Arg
Pro Ala 1340 1345 1350 Pro Leu Ala Pro Phe Phe Arg Cys Ala Cys Ala
Gln Gly Trp Thr 1355 1360 1365 Gly Pro Arg Cys Glu Ala Pro Ala Ala
Ala Pro Glu Val Ser Glu 1370 1375 1380 Glu Pro Arg Cys Pro Arg Ala
Ala Cys Gln Ala Lys Arg Gly Asp 1385 1390 1395 Gln Arg Cys Asp Arg
Glu Cys Asn Ser Pro Gly Cys Gly Trp Asp 1400 1405 1410 Gly Gly Asp
Cys Ser Leu Ser Val Gly Asp Pro Trp Arg Gln Cys 1415 1420 1425 Glu
Ala Leu Gln Cys Trp Arg Leu Phe Asn Asn Ser Arg Cys Asp 1430 1435
1440 Pro Ala Cys Ser Ser Pro Ala Cys Leu Tyr Asp Asn Phe Asp Cys
1445 1450 1455 His Ala Gly Gly Arg Glu Arg Thr Cys Asn Pro Val Tyr
Glu Lys 1460 1465 1470 Tyr Cys Ala Asp His Phe Ala Asp Gly Arg Cys
Asp Gln Gly Cys 1475 1480 1485 Asn Thr Glu Glu Cys Gly Trp Asp Gly
Leu Asp Cys Ala Ser Glu 1490 1495 1500 Val Pro Ala Leu Leu Ala Arg
Gly Val Leu Val Leu Thr Val Leu 1505 1510 1515 Leu Pro Pro Glu Glu
Leu Leu Arg Ser Ser Ala Asp Phe Leu Gln 1520 1525 1530 Arg Leu Ser
Ala Ile Leu Arg Thr Ser Leu Arg Phe Arg Leu Asp 1535 1540 1545 Ala
His Gly Gln Ala Met Val Phe Pro Tyr His Arg Pro Ser Pro 1550 1555
1560 Gly Ser Glu Pro Arg Ala Arg Arg Glu Leu Ala Pro Glu Val Ile
1565 1570 1575 Gly Ser Val Val Met Leu Glu Ile Asp Asn Arg Leu Cys
Leu Gln 1580 1585 1590 Ser Pro Glu Asn Asp His Cys Phe Pro Asp Ala
Gln Ser Ala Ala 1595 1600 1605 Asp Tyr Leu Gly Ala Leu Ser Ala Val
Glu Arg Leu Asp Phe Pro 1610 1615 1620 Tyr Pro Leu Arg Asp Val Arg
Gly Glu Pro Leu Glu Pro Pro Glu 1625 1630 1635 Pro Ser Val Pro Leu
Leu Pro Leu Leu Val Ala Gly Ala Val Leu 1640 1645 1650 Leu Leu Val
Ile Leu Val Leu Gly Val Met Val Ala Arg Arg Lys 1655 1660 1665 Arg
Glu His Ser Thr Leu Trp Phe Pro Glu Gly Phe Ser Leu His 1670 1675
1680 Lys Asp Val Ala Ser Gly His Lys Gly Arg Arg Glu Pro Val Gly
1685 1690 1695 Gln Asp Ala Leu Gly Met Lys Asn Met Ala Lys Gly Glu
Ser Leu 1700 1705 1710 Met Gly Glu Val Ala Thr Asp Trp Met Asp Thr
Glu Cys Pro Glu 1715 1720 1725 Ala Lys Arg Leu Lys Val Glu Glu Pro
Gly Met Gly Ala Glu Glu 1730 1735 1740 Ala Val Asp Cys Arg Gln Trp
Thr Gln His His Leu Val Ala Ala 1745 1750 1755 Asp Ile Arg Val Ala
Pro Ala Met Ala Leu Thr Pro Pro Gln Gly 1760 1765 1770 Asp Ala Asp
Ala Asp Gly Met Asp Val Asn Val Arg Gly Pro Asp 1775 1780 1785 Gly
Phe Thr Pro Leu Met Leu Ala Ser Phe Cys Gly Gly Ala Leu 1790 1795
1800 Glu Pro Met Pro Thr Glu Glu Asp Glu Ala Asp Asp Thr Ser Ala
1805 1810 1815 Ser Ile Ile Ser Asp Leu Ile Cys Gln Gly Ala Gln Leu
Gly Ala 1820 1825 1830 Arg Thr Asp Arg Thr Gly Glu Thr Ala Leu His
Leu Ala Ala Arg 1835 1840 1845 Tyr Ala Arg Ala Asp Ala Ala Lys Arg
Leu Leu Asp Ala Gly Ala 1850 1855 1860 Asp Thr Asn Ala Gln Asp His
Ser Gly Arg Thr Pro Leu His Thr 1865 1870 1875 Ala Val Thr Ala Asp
Ala Gln Gly Val Phe Gln Ile Leu Ile Arg 1880 1885 1890 Asn Arg Ser
Thr Asp Leu Asp Ala Arg Met Ala Asp Gly Ser Thr 1895 1900 1905 Ala
Leu Ile Leu Ala Ala Arg Leu Ala Val Glu Gly Met Val Glu 1910 1915
1920 Glu Leu Ile Ala Ser His Ala Asp Val Asn Ala Val Asp Glu Leu
1925 1930 1935 Gly Lys Ser Ala Leu His Trp Ala Ala Ala Val Asn Asn
Val Glu 1940 1945 1950 Ala Thr Leu Ala Leu Leu Lys Asn Gly Ala Asn
Lys Asp Met Gln 1955 1960 1965 Asp Ser Lys Glu Glu Thr Pro Leu Phe
Leu Ala Ala Arg Glu Gly 1970 1975 1980 Ser Tyr Glu Ala Ala Lys Leu
Leu Leu Asp His Phe Ala Asn Arg 1985 1990 1995 Glu Ile Thr Asp His
Leu Asp Arg Leu Pro Arg Asp Val Ala Gln 2000 2005 2010 Glu Arg Leu
His Gln Asp Ile Val Arg Leu Leu Asp Gln Pro Ser 2015 2020 2025 Gly
Pro Arg Ser Pro Pro Gly Pro His Gly Leu Gly Pro Leu Leu 2030 2035
2040 Cys Pro Pro Gly Ala Phe Leu Pro Gly Leu Lys Ala Ala Gln Ser
2045 2050 2055 Gly Ser Lys Lys Ser Arg Arg Pro Pro Gly Lys Ala Gly
Leu Gly 2060 2065 2070 Pro Gln Gly Pro Arg Gly Arg Gly Lys Lys Leu
Thr Leu Ala Cys 2075 2080 2085 Pro Gly Pro Leu Ala Asp Ser Ser Val
Thr Leu Ser Pro Val Asp 2090 2095 2100 Ser Leu Asp Ser Pro Arg Pro
Phe Gly Gly Pro Pro Ala Ser Pro 2105 2110 2115 Gly Gly Phe Pro Leu
Glu Gly Pro Tyr Ala Ala Ala Thr Ala Thr 2120 2125 2130 Ala Val Ser
Leu Ala Gln Leu Gly Gly Pro Gly Arg Ala Gly Leu 2135 2140 2145 Gly
Arg Gln Pro Pro Gly Gly Cys Val Leu Ser Leu Gly Leu Leu 2150 2155
2160 Asn Pro Val Ala Val Pro Leu Asp Trp Ala Arg Leu Pro Pro Pro
2165 2170 2175 Ala Pro Pro Gly Pro Ser Phe Leu Leu Pro Leu Ala Pro
Gly Pro 2180 2185 2190 Gln Leu Leu Asn Pro Gly Thr Pro Val Ser Pro
Gln Glu Arg Pro 2195 2200 2205 Pro Pro Tyr Leu Ala Val Pro Gly His
Gly Glu Glu Tyr Pro Val 2210 2215 2220 Ala Gly Ala His Ser Ser Pro
Pro Lys Ala Arg Phe Leu Arg Val 2225 2230 2235 Pro Ser Glu His Pro
Tyr Leu
Thr Pro Ser Pro Glu Ser Pro Glu 2240 2245 2250 His Trp Ala Ser Pro
Ser Pro Pro Ser Leu Ser Asp Trp Ser Glu 2255 2260 2265 Ser Thr Pro
Ser Pro Ala Thr Ala Thr Gly Ala Met Ala Thr Thr 2270 2275 2280 Thr
Gly Ala Leu Pro Ala Gln Pro Leu Pro Leu Ser Val Pro Ser 2285 2290
2295 Ser Leu Ala Gln Ala Gln Thr Gln Leu Gly Pro Gln Pro Glu Val
2300 2305 2310 Thr Pro Lys Arg Gln Val Leu Ala 2315 2320
2122PRTArtificial sequenceHEAVY CHAIN VARIABLE REGION OF MAB 256A-4
2Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1
5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser His
Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu
Glu Trp Val 35 40 45 Ala Tyr Ile Ser Asn Gly Gly Gly Arg Thr Asp
Tyr Pro Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp
Asn Ala Lys Asn Thr Leu His 65 70 75 80 Leu Gln Met Ser Ser Leu Lys
Ser Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Thr Arg Leu Asp Tyr
Phe Gly Gly Ser Pro Tyr Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr
Thr Leu Thr Val Ser Ser Ala 115 120 3114PRTArtificial sequenceLIGHT
CHAIN VARIABLE REGION OF MAB 256 A-4 3Glu Ile Val Leu Thr Gln Ser
Pro Ala Ile Thr Ala Ala Ser Leu Gly 1 5 10 15 Gln Lys Val Thr Ile
Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met 20 25 30 His Trp Tyr
Gln Gln Lys Ser Gly Thr Ser Pro Lys Pro Trp Ile Tyr 35 40 45 Glu
Ile Ser Lys Leu Ala Ser Gly Val Pro Pro Arg Phe Ser Gly Ser 50 55
60 Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu
65 70 75 80 Asp Ala Ala Ile Tyr Tyr Cys Gln Gln Trp Asn Tyr Pro Leu
Ile Thr 85 90 95 Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Arg Ala
Asp Ala Ala Pro 100 105 110 Thr Val 4122PRTArtificial sequenceHEAVY
CHAIN VARIABLE REGION OF MAB 256 A-8 4Glu Val Gln Leu Val Glu Ser
Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser
Cys Ala Ala Ser Gly Phe Thr Phe Ser His Tyr 20 25 30 Tyr Met Ser
Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val 35 40 45 Ala
Tyr Ile Asn Ser Gly Gly Gly Arg Thr Asp Tyr Pro Asp Ser Val 50 55
60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu His
65 70 75 80 Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Met Tyr
Tyr Cys 85 90 95 Ala Arg Leu Asp Tyr Tyr Gly Gly Ser Pro Tyr Phe
Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Thr Leu Thr Val Ser Ser Ala
115 120 5114PRTArtificial sequenceLIGHT CHAIN VARIABLE REGION OF
MAB 256 A-8 5Glu Ile Val Leu Thr Gln Ser Pro Ala Ile Thr Ala Ala
Ser Leu Gly 1 5 10 15 Gln Lys Val Thr Ile Thr Cys Ser Ala Ser Ser
Ser Val Ser Tyr Met 20 25 30 His Trp Tyr Gln Gln Lys Ser Gly Thr
Ser Pro Lys Pro Trp Ile Tyr 35 40 45 Glu Ile Ser Lys Leu Ala Ser
Gly Val Pro Ala Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Ser
Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu 65 70 75 80 Asp Ala Ala
Ile Tyr Tyr Cys Gln Gln Trp Asn Tyr Pro Leu Ile Thr 85 90 95 Phe
Gly Ser Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala Pro 100 105
110 Thr Val 645PRTArtificial sequenceMODIFIED NOTCH 3 LEADER
SEQUENCE 6Met Gly Pro Gly Ala Arg Gly Arg Arg Arg Arg Arg Arg Pro
Met Ser 1 5 10 15 Pro Pro Pro Pro Pro Pro Pro Val Arg Ala Leu Pro
Leu Leu Leu Leu 20 25 30 Leu Ala Gly Pro Gly Ala Ala Ala Pro Pro
Cys Leu Asp 35 40 45 755DNAArtificial sequenceOLIGONUCLEOTIDE
PRIMER 7gctcgagctc gtgggaaaat accgtgggaa aatgaaccgt gggaaaatct
cgtgg 55835DNAArtificial sequenceOLIGONUCLEOTIDE PRIMER 8gctcgagatt
ttcccacgag attttcccac ggttc 35939PRTArtificial sequenceNOTCH 3 LIN
12 DOMAIN 9Glu Pro Arg Cys Pro Arg Ala Ala Cys Gln Ala Lys Arg Gly
Asp Gln 1 5 10 15 Arg Cys Asp Arg Glu Cys Asn Ser Pro Gly Cys Gly
Trp Asp Gly Gly 20 25 30 Asp Cys Ser Leu Ser Val Gly 35
1039PRTArtificial sequenceNOTCH 3/ NOTCH1 LIN 12 DOMAIN SWAP (FIG
16 L1-SUB1) 10Glu Glu Ala Cys Glu Leu Pro Glu Cys Gln Ala Lys Arg
Gly Asp Gln 1 5 10 15 Arg Cys Asp Arg Glu Cys Asn Ser Pro Gly Cys
Gly Trp Asp Gly Gly 20 25 30 Asp Cys Ser Leu Ser Val Gly 35
1139PRTArtificial sequenceNOTCH 3 / NOTCH 1 LIN 12 DOMAIN SWAP
(FIG. 16 L1-SUB2) 11Glu Pro Arg Cys Pro Arg Ala Ala Cys Gln Glu Asp
Ala Gly Asn Lys 1 5 10 15 Val Cys Ser Arg Glu Cys Asn Ser Pro Gly
Cys Gly Trp Asp Gly Gly 20 25 30 Asp Cys Ser Leu Ser Val Gly 35
1239PRTArtificial sequenceNOTCH 3 / NOTCH 1 LIN 12 DOMAIN SWAP
(FIG. 16 L1-SUB3) 12Glu Pro Arg Cys Pro Arg Ala Ala Cys Gln Ala Lys
Arg Gly Asp Gln 1 5 10 15 Arg Cys Asp Leu Gln Cys Asn Asn His Ala
Cys Gly Trp Asp Gly Gly 20 25 30 Asp Cys Ser Leu Asn Phe Asn 35
1339PRTArtificial sequenceNOTCH 3/ NOTCH 1 LIN12 AMINO ACID SWAP
(FIG 16 L1-AA SWAP 1) 13Glu Pro Arg Cys Pro Arg Ala Ala Cys Gln Glu
Asp Ala Gly Asp Gln 1 5 10 15 Arg Cys Asp Arg Glu Cys Asn Ser Pro
Gly Cys Gly Trp Asp Gly Gly 20 25 30 Asp Cys Ser Leu Ser Val Gly 35
1439PRTArtificial sequenceNOTCH 3/ NOTCH 1 LIN12 AMINO ACID SWAP
(FIG 16 L1-AA SWAP 2) 14Glu Pro Arg Cys Pro Arg Ala Ala Cys Gln Ala
Lys Arg Gly Asn Lys 1 5 10 15 Val Cys Asp Arg Glu Cys Asn Ser Pro
Gly Cys Gly Trp Asp Gly Gly 20 25 30 Asp Cys Ser Leu Ser Val Gly 35
1539PRTArtificial sequenceNOTCH 3/ NOTCH 1 LIN12 AMINO ACID SWAP
(FIG 16 L1-AA SWAP 3) 15Glu Pro Arg Cys Pro Arg Ala Ala Cys Gln Ala
Lys Arg Gly Asp Gln 1 5 10 15 Arg Cys Ser Leu Gln Cys Asn Ser Pro
Gly Cys Gly Trp Asp Gly Gly 20 25 30 Asp Cys Ser Leu Ser Val Gly 35
1639PRTArtificial sequenceNOTCH 3/ NOTCH 1 LIN12 AMINO ACID SWAP
(FIG 16 L1-AA SWAP 4) 16Glu Pro Arg Cys Pro Arg Ala Ala Cys Gln Ala
Lys Arg Gly Asp Gln 1 5 10 15 Arg Cys Asp Arg Glu Cys Asn Asn His
Ala Cys Gly Trp Asp Gly Gly 20 25 30 Asp Cys Ser Leu Ser Val Gly 35
1739PRTArtificial sequenceNOTCH 3/ NOTCH 1 LIN12 AMINO ACID SWAP
(FIG 16 L1-AA SWAP 5) 17Glu Pro Arg Cys Pro Arg Ala Ala Cys Gln Ala
Lys Arg Gly Asp Gln 1 5 10 15 Arg Cys Asp Arg Glu Cys Asn Ser Pro
Gly Cys Gly Trp Asp Gly Gly 20 25 30 Asp Cys Ser Leu Asn Phe Asn 35
1869PRTArtificial sequenceNOTCH 3 DIMERIZATION DOMAIN 2 (FIG 17 D2)
18Glu Leu Ala Pro Glu Val Ile Gly Ser Val Val Met Leu Glu Ile Asp 1
5 10 15 Asn Arg Leu Cys Leu Gln Ser Pro Glu Asn Asp His Cys Phe Pro
Asp 20 25 30 Ala Gln Ser Ala Ala Asp Tyr Leu Gly Ala Leu Ser Ala
Val Glu Arg 35 40 45 Leu Asp Phe Pro Tyr Pro Leu Arg Asp Val Arg
Gly Glu Pro Leu Glu 50 55 60 Pro Pro Glu Pro Ser 65
1969PRTArtificial sequenceNOTCH 3/ NOTCH 1 DIMERIZATION DOMAIN SWAP
(FIG 17 D2-SUB1) 19Glu Leu Ala Pro Asp Val Arg Gly Ser Ile Val Tyr
Leu Glu Ile Asp 1 5 10 15 Asn Arg Leu Cys Leu Gln Ser Pro Glu Asn
Asp His Cys Phe Pro Asp 20 25 30 Ala Gln Ser Ala Ala Asp Tyr Leu
Gly Ala Leu Ser Ala Val Glu Arg 35 40 45 Leu Asp Phe Pro Tyr Pro
Leu Arg Asp Val Arg Gly Glu Pro Leu Glu 50 55 60 Pro Pro Glu Pro
Ser 65 2069PRTArtificial sequenceNOTCH 3/ NOTCH 1 DIMERIZATION
DOMAIN SWAP (FIG 17 D2-SUB2) 20Glu Leu Ala Pro Glu Val Ile Gly Ser
Val Val Met Leu Glu Ile Asp 1 5 10 15 Asn Arg Gln Cys Val Gln Ala
Ala Ala Ser Ser Gln Cys Phe Pro Asp 20 25 30 Ala Gln Ser Ala Ala
Asp Tyr Leu Gly Ala Leu Ser Ala Val Glu Arg 35 40 45 Leu Asp Phe
Pro Tyr Pro Leu Arg Asp Val Arg Gly Glu Pro Leu Glu 50 55 60 Pro
Pro Glu Pro Ser 65 2169PRTArtificial sequenceNOTCH 3/ NOTCH 1
DIMERIZATION DOMAIN SWAP (FIG 17 D2-SUB3) 21Glu Leu Ala Pro Glu Val
Ile Gly Ser Val Val Met Leu Glu Ile Asp 1 5 10 15 Asn Arg Leu Cys
Leu Gln Ser Pro Glu Asn Asp His Cys Phe Gln Ser 20 25 30 Ala Thr
Asp Ala Ala Ala Phe Leu Gly Ala Leu Ser Ala Val Glu Arg 35 40 45
Leu Asp Phe Pro Tyr Pro Leu Arg Asp Val Arg Gly Glu Pro Leu Glu 50
55 60 Pro Pro Glu Pro Ser 65 2269PRTArtificial sequenceNOTCH 3/
NOTCH 1 DIMERIZATION DOMAIN SWAP (FIG 17 D2-SUB4) 22Glu Leu Ala Pro
Glu Val Ile Gly Ser Val Val Met Leu Glu Ile Asp 1 5 10 15 Asn Arg
Leu Cys Leu Gln Ser Pro Glu Asn Asp His Cys Phe Pro Asp 20 25 30
Ala Gln Ser Ala Ala Asp Tyr Leu Gly Ala Leu Ala Ser Leu Gly Ser 35
40 45 Leu Asn Ile Pro Tyr Pro Leu Arg Asp Val Arg Gly Glu Pro Leu
Glu 50 55 60 Pro Pro Glu Pro Ser 65 2369PRTArtificial sequenceNOTCH
3/ NOTCH 1 DIMERIZATION DOMAIN SWAP (FIG 17 D2-SUB5) 23Glu Leu Ala
Pro Glu Val Ile Gly Ser Val Val Met Leu Glu Ile Asp 1 5 10 15 Asn
Arg Leu Cys Leu Gln Ser Pro Glu Asn Asp His Cys Phe Pro Asp 20 25
30 Ala Gln Ser Ala Ala Asp Tyr Leu Gly Ala Leu Ser Ala Val Glu Arg
35 40 45 Leu Asp Phe Pro Tyr Lys Ile Glu Ala Val Gln Ser Glu Thr
Val Glu 50 55 60 Pro Pro Ala Pro Ser 65 2469PRTArtificial
sequenceNOTCH 3/ NOTCH 1 DIMERIZATION DOMAIN AMINO ACID SWAP (FIG
17 D2-AA SWAP1) 24Glu Leu Ala Pro Asp Val Arg Gly Ser Val Val Met
Leu Glu Ile Asp 1 5 10 15 Asn Arg Leu Cys Leu Gln Ser Pro Glu Asn
Asp His Cys Phe Pro Asp 20 25 30 Ala Gln Ser Ala Ala Asp Tyr Leu
Gly Ala Leu Ser Ala Val Glu Arg 35 40 45 Leu Asp Phe Pro Tyr Pro
Leu Arg Asp Val Arg Gly Glu Pro Leu Glu 50 55 60 Pro Pro Glu Pro
Ser 65 2569PRTArtificial sequenceNOTCH 3/ NOTCH 1 DIMERIZATION
DOMAIN AMINO ACID SWAP (FIG 17 D2-AA SWAP2) 25Glu Leu Ala Pro Glu
Val Ile Gly Ser Ile Val Tyr Leu Glu Ile Asp 1 5 10 15 Asn Arg Leu
Cys Leu Gln Ser Pro Glu Asn Asp His Cys Phe Pro Asp 20 25 30 Ala
Gln Ser Ala Ala Asp Tyr Leu Gly Ala Leu Ser Ala Val Glu Arg 35 40
45 Leu Asp Phe Pro Tyr Pro Leu Arg Asp Val Arg Gly Glu Pro Leu Glu
50 55 60 Pro Pro Glu Pro Ser 65 2669PRTArtificial sequenceNOTCH 3/
NOTCH 1 DIMERIZATION DOMAIN AMINO ACID SWAP (FIG 17 D2-AA SWAP3)
26Glu Leu Ala Pro Glu Val Ile Gly Ser Val Val Met Leu Glu Ile Asp 1
5 10 15 Asn Arg Leu Cys Leu Gln Ser Pro Glu Asn Asp His Cys Phe Pro
Asp 20 25 30 Ala Gln Ser Ala Ala Asp Tyr Leu Gly Ala Leu Ala Ser
Leu Glu Arg 35 40 45 Leu Asp Phe Pro Tyr Pro Leu Arg Asp Val Arg
Gly Glu Pro Leu Glu 50 55 60 Pro Pro Glu Pro Ser 65
2769PRTArtificial sequenceNOTCH 3/ NOTCH 1 DIMERIZATION DOMAIN
AMINO ACID SWAP (FIG 17 D2-AA SWAP4) 27Glu Leu Ala Pro Glu Val Ile
Gly Ser Val Val Met Leu Glu Ile Asp 1 5 10 15 Asn Arg Leu Cys Leu
Gln Ser Pro Glu Asn Asp His Cys Phe Pro Asp 20 25 30 Ala Gln Ser
Ala Ala Asp Tyr Leu Gly Ala Leu Ser Ala Val Gly Ser 35 40 45 Leu
Asp Phe Pro Tyr Pro Leu Arg Asp Val Arg Gly Glu Pro Leu Glu 50 55
60 Pro Pro Glu Pro Ser 65 2869PRTArtificial sequenceNOTCH 3/ NOTCH
1 DIMERIZATION DOMAIN AMINO ACID SWAP (FIG 17 D2-AA SWAP5) 28Glu
Leu Ala Pro Glu Val Ile Gly Ser Val Val Met Leu Glu Ile Asp 1 5 10
15 Asn Arg Leu Cys Leu Gln Ser Pro Glu Asn Asp His Cys Phe Pro Asp
20 25 30 Ala Gln Ser Ala Ala Asp Tyr Leu Gly Ala Leu Ser Ala Val
Glu Arg 35 40 45 Leu Asn Ile Pro Tyr Pro Leu Arg Asp Val Arg Gly
Glu Pro Leu Glu 50 55 60 Pro Pro Glu Pro Ser 65 2969PRTArtificial
sequenceNOTCH 3/ NOTCH 1 DIMERIZATION DOMAIN AMINO ACID SWAP (FIG
17 D2-AA SWAP6) 29Glu Leu Ala Pro Glu Val Ile Gly Ser Val Val Met
Leu Glu Ile Asp 1 5 10 15 Asn Arg Leu Cys Leu Gln Ser Pro Glu Asn
Asp His Cys Phe Pro Asp 20 25 30 Ala Gln Ser Ala Ala Asp Tyr Leu
Gly Ala Leu Ser Ala Val Glu Arg 35 40 45 Leu Asp Phe Pro Tyr Lys
Ile Glu Asp Val Arg Gly Glu Pro Leu Glu 50 55 60 Pro Pro Glu Pro
Ser 65 3069PRTArtificial sequenceNOTCH 3/ NOTCH 1 DIMERIZATION
DOMAIN AMINO ACID SWAP (FIG 17 D2-AA SWAP7) 30Glu Leu Ala Pro Glu
Val Ile Gly Ser Val Val Met Leu Glu Ile Asp 1 5 10 15 Asn Arg Leu
Cys Leu Gln Ser Pro Glu Asn Asp His Cys Phe Pro Asp 20 25 30 Ala
Gln Ser Ala Ala Asp Tyr Leu Gly Ala Leu Ser Ala Val Glu Arg 35 40
45 Leu Asp Phe Pro Tyr Pro Leu Arg Ala Val Gln Ser Glu Pro Leu Glu
50 55 60 Pro Pro Glu Pro Ser 65 3169PRTArtificial sequenceNOTCH 3/
NOTCH 1 DIMERIZATION DOMAIN AMINO ACID SWAP (FIG 17 D2-AA SWAP8)
31Glu Leu Ala Pro Glu Val Ile Gly Ser Val Val Met Leu Glu Ile Asp 1
5 10 15 Asn Arg Leu Cys Leu Gln Ser Pro Glu Asn Asp His Cys Phe Pro
Asp 20 25 30 Ala Gln Ser Ala Ala Asp Tyr Leu Gly Ala Leu Ser Ala
Val Glu Arg 35 40 45 Leu Asp Phe Pro Tyr Pro Leu Arg Asp Val Arg
Gly Glu Thr Val Glu 50 55 60 Pro Pro Ala Pro Ser 65
3210PRTArtificial sequenceCDR-H1 OF MAB 256A-4 32Gly Phe Thr Phe
Ser His Tyr Tyr Met Ser 1 5 10 3312PRTArtificial
sequenceCDR-H2 OF MAB 256A-4 33Ile Ser Asn Gly Gly Gly Arg Thr Asp
Tyr Pro Asp 1 5 10 3413PRTArtificial sequenceCDR-H3 OF MAB 256A-4
34Arg Leu Asp Tyr Phe Gly Gly Ser Pro Tyr Phe Asp Tyr 1 5 10
3510PRTArtificial sequenceCDR-L1 OF MAB 256A-4 35Ser Ala Ser Ser
Ser Val Ser Tyr Met His 1 5 10 367PRTArtificial sequenceCDR-L2 OF
MAB 256A-4 36Glu Ile Ser Lys Leu Ala Ser 1 5 379PRTArtificial
sequenceCDR-L3 OF MAB 256A-4 37Gln Gln Trp Asn Tyr Pro Leu Ile Thr
1 5 3810PRTArtificial sequenceCDR-H1 OF MAB 256A-8 38Gly Phe Thr
Phe Ser His Tyr Tyr Met Ser 1 5 10 3912PRTArtificial sequenceCDR-H2
OF MAB 256A-8 39Tyr Ile Asn Ser Gly Gly Gly Arg Thr Asp Tyr Pro 1 5
10 4012PRTArtificial sequenceCDR-H3 OF MAB 256A-8 40Leu Asp Tyr Tyr
Gly Gly Ser Pro Tyr Phe Asp Tyr 1 5 10 4110PRTArtificial
sequenceCDR-L1 OF MAB 256A-8 41Ser Ala Ser Ser Ser Val Ser Tyr Met
His 1 5 10 428PRTArtificial sequenceCDR-L2 OF MAB 256A-8 42Tyr Glu
Ile Ser Lys Leu Ala Ser 1 5 439PRTArtificial sequenceCDR-L3 OF MAB
256A-8 43Gln Gln Trp Asn Tyr Pro Leu Ile Thr 1 5 442556PRTHomo
sapiens 44Met Pro Pro Leu Leu Ala Pro Leu Leu Cys Leu Ala Leu Leu
Pro Ala 1 5 10 15 Leu Ala Ala Arg Gly Pro Arg Cys Ser Gln Pro Gly
Glu Thr Cys Leu 20 25 30 Asn Gly Gly Lys Cys Glu Ala Ala Asn Gly
Thr Glu Ala Cys Val Cys 35 40 45 Gly Gly Ala Phe Val Gly Pro Arg
Cys Gln Asp Pro Asn Pro Cys Leu 50 55 60 Ser Thr Pro Cys Lys Asn
Ala Gly Thr Cys His Val Val Asp Arg Arg 65 70 75 80 Gly Val Ala Asp
Tyr Ala Cys Ser Cys Ala Leu Gly Phe Ser Gly Pro 85 90 95 Leu Cys
Leu Thr Pro Leu Asp Asn Ala Cys Leu Thr Asn Pro Cys Arg 100 105 110
Asn Gly Gly Thr Cys Asp Leu Leu Thr Leu Thr Glu Tyr Lys Cys Arg 115
120 125 Cys Pro Pro Gly Trp Ser Gly Lys Ser Cys Gln Gln Ala Asp Pro
Cys 130 135 140 Ala Ser Asn Pro Cys Ala Asn Gly Gly Gln Cys Leu Pro
Phe Glu Ala 145 150 155 160 Ser Tyr Ile Cys His Cys Pro Pro Ser Phe
His Gly Pro Thr Cys Arg 165 170 175 Gln Asp Val Asn Glu Cys Gly Gln
Lys Pro Gly Leu Cys Arg His Gly 180 185 190 Gly Thr Cys His Asn Glu
Val Gly Ser Tyr Arg Cys Val Cys Arg Ala 195 200 205 Thr His Thr Gly
Pro Asn Cys Glu Arg Pro Tyr Val Pro Cys Ser Pro 210 215 220 Ser Pro
Cys Gln Asn Gly Gly Thr Cys Arg Pro Thr Gly Asp Val Thr 225 230 235
240 His Glu Cys Ala Cys Leu Pro Gly Phe Thr Gly Gln Asn Cys Glu Glu
245 250 255 Asn Ile Asp Asp Cys Pro Gly Asn Asn Cys Lys Asn Gly Gly
Ala Cys 260 265 270 Val Asp Gly Val Asn Thr Tyr Asn Cys Arg Cys Pro
Pro Glu Trp Thr 275 280 285 Gly Gln Tyr Cys Thr Glu Asp Val Asp Glu
Cys Gln Leu Met Pro Asn 290 295 300 Ala Cys Gln Asn Gly Gly Thr Cys
His Asn Thr His Gly Gly Tyr Asn 305 310 315 320 Cys Val Cys Val Asn
Gly Trp Thr Gly Glu Asp Cys Ser Glu Asn Ile 325 330 335 Asp Asp Cys
Ala Ser Ala Ala Cys Phe His Gly Ala Thr Cys His Asp 340 345 350 Arg
Val Ala Ser Phe Tyr Cys Glu Cys Pro His Gly Arg Thr Gly Leu 355 360
365 Leu Cys His Leu Asn Asp Ala Cys Ile Ser Asn Pro Cys Asn Glu Gly
370 375 380 Ser Asn Cys Asp Thr Asn Pro Val Asn Gly Lys Ala Ile Cys
Thr Cys 385 390 395 400 Pro Ser Gly Tyr Thr Gly Pro Ala Cys Ser Gln
Asp Val Asp Glu Cys 405 410 415 Ser Leu Gly Ala Asn Pro Cys Glu His
Ala Gly Lys Cys Ile Asn Thr 420 425 430 Leu Gly Ser Phe Glu Cys Gln
Cys Leu Gln Gly Tyr Thr Gly Pro Arg 435 440 445 Cys Glu Ile Asp Val
Asn Glu Cys Val Ser Asn Pro Cys Gln Asn Asp 450 455 460 Ala Thr Cys
Leu Asp Gln Ile Gly Glu Phe Gln Cys Ile Cys Met Pro 465 470 475 480
Gly Tyr Glu Gly Val His Cys Glu Val Asn Thr Asp Glu Cys Ala Ser 485
490 495 Ser Pro Cys Leu His Asn Gly Arg Cys Leu Asp Lys Ile Asn Glu
Phe 500 505 510 Gln Cys Glu Cys Pro Thr Gly Phe Thr Gly His Leu Cys
Gln Tyr Asp 515 520 525 Val Asp Glu Cys Ala Ser Thr Pro Cys Lys Asn
Gly Ala Lys Cys Leu 530 535 540 Asp Gly Pro Asn Thr Tyr Thr Cys Val
Cys Thr Glu Gly Tyr Thr Gly 545 550 555 560 Thr His Cys Glu Val Asp
Ile Asp Glu Cys Asp Pro Asp Pro Cys His 565 570 575 Tyr Gly Ser Cys
Lys Asp Gly Val Ala Thr Phe Thr Cys Leu Cys Arg 580 585 590 Pro Gly
Tyr Thr Gly His His Cys Glu Thr Asn Ile Asn Glu Cys Ser 595 600 605
Ser Gln Pro Cys Arg His Gly Gly Thr Cys Gln Asp Arg Asp Asn Ala 610
615 620 Tyr Leu Cys Phe Cys Leu Lys Gly Thr Thr Gly Pro Asn Cys Glu
Ile 625 630 635 640 Asn Leu Asp Asp Cys Ala Ser Ser Pro Cys Asp Ser
Gly Thr Cys Leu 645 650 655 Asp Lys Ile Asp Gly Tyr Glu Cys Ala Cys
Glu Pro Gly Tyr Thr Gly 660 665 670 Ser Met Cys Asn Ile Asn Ile Asp
Glu Cys Ala Gly Asn Pro Cys His 675 680 685 Asn Gly Gly Thr Cys Glu
Asp Gly Ile Asn Gly Phe Thr Cys Arg Cys 690 695 700 Pro Glu Gly Tyr
His Asp Pro Thr Cys Leu Ser Glu Val Asn Glu Cys 705 710 715 720 Asn
Ser Asn Pro Cys Val His Gly Ala Cys Arg Asp Ser Leu Asn Gly 725 730
735 Tyr Lys Cys Asp Cys Asp Pro Gly Trp Ser Gly Thr Asn Cys Asp Ile
740 745 750 Asn Asn Asn Glu Cys Glu Ser Asn Pro Cys Val Asn Gly Gly
Thr Cys 755 760 765 Lys Asp Met Thr Ser Gly Tyr Val Cys Thr Cys Arg
Glu Gly Phe Ser 770 775 780 Gly Pro Asn Cys Gln Thr Asn Ile Asn Glu
Cys Ala Ser Asn Pro Cys 785 790 795 800 Leu Asn Gln Gly Thr Cys Ile
Asp Asp Val Ala Gly Tyr Lys Cys Asn 805 810 815 Cys Leu Leu Pro Tyr
Thr Gly Ala Thr Cys Glu Val Val Leu Ala Pro 820 825 830 Cys Ala Pro
Ser Pro Cys Arg Asn Gly Gly Glu Cys Arg Gln Ser Glu 835 840 845 Asp
Tyr Glu Ser Phe Ser Cys Val Cys Pro Thr Gly Trp Gln Ala Gly 850 855
860 Gln Thr Cys Glu Val Asp Ile Asn Glu Cys Val Leu Ser Pro Cys Arg
865 870 875 880 His Gly Ala Ser Cys Gln Asn Thr His Gly Gly Tyr Arg
Cys His Cys 885 890 895 Gln Ala Gly Tyr Ser Gly Arg Asn Cys Glu Thr
Asp Ile Asp Asp Cys 900 905 910 Arg Pro Asn Pro Cys His Asn Gly Gly
Ser Cys Thr Asp Gly Ile Asn 915 920 925 Thr Ala Phe Cys Asp Cys Leu
Pro Gly Phe Arg Gly Thr Phe Cys Glu 930 935 940 Glu Asp Ile Asn Glu
Cys Ala Ser Asp Pro Cys Arg Asn Gly Ala Asn 945 950 955 960 Cys Thr
Asp Cys Val Asp Ser Tyr Thr Cys Thr Cys Pro Ala Gly Phe 965 970 975
Ser Gly Ile His Cys Glu Asn Asn Thr Pro Asp Cys Thr Glu Ser Ser 980
985 990 Cys Phe Asn Gly Gly Thr Cys Val Asp Gly Ile Asn Ser Phe Thr
Cys 995 1000 1005 Leu Cys Pro Pro Gly Phe Thr Gly Ser Tyr Cys Gln
His Asp Val 1010 1015 1020 Asn Glu Cys Asp Ser Gln Pro Cys Leu His
Gly Gly Thr Cys Gln 1025 1030 1035 Asp Gly Cys Gly Ser Tyr Arg Cys
Thr Cys Pro Gln Gly Tyr Thr 1040 1045 1050 Gly Pro Asn Cys Gln Asn
Leu Val His Trp Cys Asp Ser Ser Pro 1055 1060 1065 Cys Lys Asn Gly
Gly Lys Cys Trp Gln Thr His Thr Gln Tyr Arg 1070 1075 1080 Cys Glu
Cys Pro Ser Gly Trp Thr Gly Leu Tyr Cys Asp Val Pro 1085 1090 1095
Ser Val Ser Cys Glu Val Ala Ala Gln Arg Gln Gly Val Asp Val 1100
1105 1110 Ala Arg Leu Cys Gln His Gly Gly Leu Cys Val Asp Ala Gly
Asn 1115 1120 1125 Thr His His Cys Arg Cys Gln Ala Gly Tyr Thr Gly
Ser Tyr Cys 1130 1135 1140 Glu Asp Leu Val Asp Glu Cys Ser Pro Ser
Pro Cys Gln Asn Gly 1145 1150 1155 Ala Thr Cys Thr Asp Tyr Leu Gly
Gly Tyr Ser Cys Lys Cys Val 1160 1165 1170 Ala Gly Tyr His Gly Val
Asn Cys Ser Glu Glu Ile Asp Glu Cys 1175 1180 1185 Leu Ser His Pro
Cys Gln Asn Gly Gly Thr Cys Leu Asp Leu Pro 1190 1195 1200 Asn Thr
Tyr Lys Cys Ser Cys Pro Arg Gly Thr Gln Gly Val His 1205 1210 1215
Cys Glu Ile Asn Val Asp Asp Cys Asn Pro Pro Val Asp Pro Val 1220
1225 1230 Ser Arg Ser Pro Lys Cys Phe Asn Asn Gly Thr Cys Val Asp
Gln 1235 1240 1245 Val Gly Gly Tyr Ser Cys Thr Cys Pro Pro Gly Phe
Val Gly Glu 1250 1255 1260 Arg Cys Glu Gly Asp Val Asn Glu Cys Leu
Ser Asn Pro Cys Asp 1265 1270 1275 Ala Arg Gly Thr Gln Asn Cys Val
Gln Arg Val Asn Asp Phe His 1280 1285 1290 Cys Glu Cys Arg Ala Gly
His Thr Gly Arg Arg Cys Glu Ser Val 1295 1300 1305 Ile Asn Gly Cys
Lys Gly Lys Pro Cys Lys Asn Gly Gly Thr Cys 1310 1315 1320 Ala Val
Ala Ser Asn Thr Ala Arg Gly Phe Ile Cys Lys Cys Pro 1325 1330 1335
Ala Gly Phe Glu Gly Ala Thr Cys Glu Asn Asp Ala Arg Thr Cys 1340
1345 1350 Gly Ser Leu Arg Cys Leu Asn Gly Gly Thr Cys Ile Ser Gly
Pro 1355 1360 1365 Arg Ser Pro Thr Cys Leu Cys Leu Gly Pro Phe Thr
Gly Pro Glu 1370 1375 1380 Cys Gln Phe Pro Ala Ser Ser Pro Cys Leu
Gly Gly Asn Pro Cys 1385 1390 1395 Tyr Asn Gln Gly Thr Cys Glu Pro
Thr Ser Glu Ser Pro Phe Tyr 1400 1405 1410 Arg Cys Leu Cys Pro Ala
Lys Phe Asn Gly Leu Leu Cys His Ile 1415 1420 1425 Leu Asp Tyr Ser
Phe Gly Gly Gly Ala Gly Arg Asp Ile Pro Pro 1430 1435 1440 Pro Leu
Ile Glu Glu Ala Cys Glu Leu Pro Glu Cys Gln Glu Asp 1445 1450 1455
Ala Gly Asn Lys Val Cys Ser Leu Gln Cys Asn Asn His Ala Cys 1460
1465 1470 Gly Trp Asp Gly Gly Asp Cys Ser Leu Asn Phe Asn Asp Pro
Trp 1475 1480 1485 Lys Asn Cys Thr Gln Ser Leu Gln Cys Trp Lys Tyr
Phe Ser Asp 1490 1495 1500 Gly His Cys Asp Ser Gln Cys Asn Ser Ala
Gly Cys Leu Phe Asp 1505 1510 1515 Gly Phe Asp Cys Gln Arg Ala Glu
Gly Gln Cys Asn Pro Leu Tyr 1520 1525 1530 Asp Gln Tyr Cys Lys Asp
His Phe Ser Asp Gly His Cys Asp Gln 1535 1540 1545 Gly Cys Asn Ser
Ala Glu Cys Glu Trp Asp Gly Leu Asp Cys Ala 1550 1555 1560 Glu His
Val Pro Glu Arg Leu Ala Ala Gly Thr Leu Val Val Val 1565 1570 1575
Val Leu Met Pro Pro Glu Gln Leu Arg Asn Ser Ser Phe His Phe 1580
1585 1590 Leu Arg Glu Leu Ser Arg Val Leu His Thr Asn Val Val Phe
Lys 1595 1600 1605 Arg Asp Ala His Gly Gln Gln Met Ile Phe Pro Tyr
Tyr Gly Arg 1610 1615 1620 Glu Glu Glu Leu Arg Lys His Pro Ile Lys
Arg Ala Ala Glu Gly 1625 1630 1635 Trp Ala Ala Pro Asp Ala Leu Leu
Gly Gln Val Lys Ala Ser Leu 1640 1645 1650 Leu Pro Gly Gly Ser Glu
Gly Gly Arg Arg Arg Arg Glu Leu Asp 1655 1660 1665 Pro Met Asp Val
Arg Gly Ser Ile Val Tyr Leu Glu Ile Asp Asn 1670 1675 1680 Arg Gln
Cys Val Gln Ala Ser Ser Gln Cys Phe Gln Ser Ala Thr 1685 1690 1695
Asp Val Ala Ala Phe Leu Gly Ala Leu Ala Ser Leu Gly Ser Leu 1700
1705 1710 Asn Ile Pro Tyr Lys Ile Glu Ala Val Gln Ser Glu Thr Val
Glu 1715 1720 1725 Pro Pro Pro Pro Ala Gln Leu His Phe Met Tyr Val
Ala Ala Ala 1730 1735 1740 Ala Phe Val Leu Leu Phe Phe Val Gly Cys
Gly Val Leu Leu Ser 1745 1750 1755 Arg Lys Arg Arg Arg Gln His Gly
Gln Leu Trp Phe Pro Glu Gly 1760 1765 1770 Phe Lys Val Ser Glu Ala
Ser Lys Lys Lys Arg Arg Glu Pro Leu 1775 1780 1785 Gly Glu Asp Ser
Val Gly Leu Lys Pro Leu Lys Asn Ala Ser Asp 1790 1795 1800 Gly Ala
Leu Met Asp Asp Asn Gln Asn Glu Trp Gly Asp Glu Asp 1805 1810 1815
Leu Glu Thr Lys Lys Phe Arg Phe Glu Glu Pro Val Val Leu Pro 1820
1825 1830 Asp Leu Asp Asp Gln Thr Asp His Arg Gln Trp Thr Gln Gln
His 1835 1840 1845 Leu Asp Ala Ala Asp Leu Arg Met Ser Ala Met Ala
Pro Thr Pro 1850 1855 1860 Pro Gln Gly Glu Val Asp Ala Asp Cys Met
Asp Val Asn Val Arg 1865 1870 1875 Gly Pro Asp Gly Phe Thr Pro Leu
Met Ile Ala Ser Cys Ser Gly 1880 1885 1890 Gly Gly Leu Glu Thr Gly
Asn Ser Glu Glu Glu Glu Asp Ala Pro 1895 1900 1905 Ala Val Ile Ser
Asp Phe Ile Tyr Gln Gly Ala Ser Leu His Asn 1910 1915 1920 Gln Thr
Asp Arg Thr Gly Glu Thr Ala Leu His Leu Ala Ala Arg 1925 1930 1935
Tyr Ser Arg Ser Asp Ala Ala Lys Arg Leu Leu Glu Ala Ser Ala 1940
1945 1950 Asp Ala Asn Ile Gln Asp Asn Met Gly Arg Thr Pro Leu His
Ala 1955 1960 1965 Ala Val Ser Ala Asp Ala Gln Gly Val Phe Gln Ile
Leu Ile Arg 1970 1975 1980 Asn Arg Ala Thr Asp Leu Asp Ala Arg Met
His Asp Gly Thr Thr 1985 1990 1995 Pro Leu Ile Leu Ala Ala Arg Leu
Ala Val Glu Gly Met Leu Glu 2000 2005 2010 Asp Leu Ile Asn Ser His
Ala Asp Val Asn Ala Val Asp Asp Leu 2015 2020 2025 Gly Lys Ser Ala
Leu His Trp Ala Ala Ala Val Asn Asn Val Asp 2030 2035 2040 Ala Ala
Val Val Leu Leu Lys Asn Gly Ala Asn Lys Asp Met Gln 2045 2050 2055
Asn Asn Arg Glu Glu Thr Pro Leu Phe Leu Ala Ala Arg Glu Gly 2060
2065
2070 Ser Tyr Glu Thr Ala Lys Val Leu Leu Asp His Phe Ala Asn Arg
2075 2080 2085 Asp Ile Thr Asp His Met Asp Arg Leu Pro Arg Asp Ile
Ala Gln 2090 2095 2100 Glu Arg Met His His Asp Ile Val Arg Leu Leu
Asp Glu Tyr Asn 2105 2110 2115 Leu Val Arg Ser Pro Gln Leu His Gly
Ala Pro Leu Gly Gly Thr 2120 2125 2130 Pro Thr Leu Ser Pro Pro Leu
Cys Ser Pro Asn Gly Tyr Leu Gly 2135 2140 2145 Ser Leu Lys Pro Gly
Val Gln Gly Lys Lys Val Arg Lys Pro Ser 2150 2155 2160 Ser Lys Gly
Leu Ala Cys Gly Ser Lys Glu Ala Lys Asp Leu Lys 2165 2170 2175 Ala
Arg Arg Lys Lys Ser Gln Asp Gly Lys Gly Cys Leu Leu Asp 2180 2185
2190 Ser Ser Gly Met Leu Ser Pro Val Asp Ser Leu Glu Ser Pro His
2195 2200 2205 Gly Tyr Leu Ser Asp Val Ala Ser Pro Pro Leu Leu Pro
Ser Pro 2210 2215 2220 Phe Gln Gln Ser Pro Ser Val Pro Leu Asn His
Leu Pro Gly Met 2225 2230 2235 Pro Asp Thr His Leu Gly Ile Gly His
Leu Asn Val Ala Ala Lys 2240 2245 2250 Pro Glu Met Ala Ala Leu Gly
Gly Gly Gly Arg Leu Ala Phe Glu 2255 2260 2265 Thr Gly Pro Pro Arg
Leu Ser His Leu Pro Val Ala Ser Gly Thr 2270 2275 2280 Ser Thr Val
Leu Gly Ser Ser Ser Gly Gly Ala Leu Asn Phe Thr 2285 2290 2295 Val
Gly Gly Ser Thr Ser Leu Asn Gly Gln Cys Glu Trp Leu Ser 2300 2305
2310 Arg Leu Gln Ser Gly Met Val Pro Asn Gln Tyr Asn Pro Leu Arg
2315 2320 2325 Gly Ser Val Ala Pro Gly Pro Leu Ser Thr Gln Ala Pro
Ser Leu 2330 2335 2340 Gln His Gly Met Val Gly Pro Leu His Ser Ser
Leu Ala Ala Ser 2345 2350 2355 Ala Leu Ser Gln Met Met Ser Tyr Gln
Gly Leu Pro Ser Thr Arg 2360 2365 2370 Leu Ala Thr Gln Pro His Leu
Val Gln Thr Gln Gln Val Gln Pro 2375 2380 2385 Gln Asn Leu Gln Met
Gln Gln Gln Asn Leu Gln Pro Ala Asn Ile 2390 2395 2400 Gln Gln Gln
Gln Ser Leu Gln Pro Pro Pro Pro Pro Pro Gln Pro 2405 2410 2415 His
Leu Gly Val Ser Ser Ala Ala Ser Gly His Leu Gly Arg Ser 2420 2425
2430 Phe Leu Ser Gly Glu Pro Ser Gln Ala Asp Val Gln Pro Leu Gly
2435 2440 2445 Pro Ser Ser Leu Ala Val His Thr Ile Leu Pro Gln Glu
Ser Pro 2450 2455 2460 Ala Leu Pro Thr Ser Leu Pro Ser Ser Leu Val
Pro Pro Val Thr 2465 2470 2475 Ala Ala Gln Phe Leu Thr Pro Pro Ser
Gln His Ser Tyr Ser Ser 2480 2485 2490 Pro Val Asp Asn Thr Pro Ser
His Gln Leu Gln Val Pro Glu His 2495 2500 2505 Pro Phe Leu Thr Pro
Ser Pro Glu Ser Pro Asp Gln Trp Ser Ser 2510 2515 2520 Ser Ser Pro
His Ser Asn Val Ser Asp Trp Ser Glu Gly Val Ser 2525 2530 2535 Ser
Pro Pro Thr Ser Met Gln Ser Gln Ile Ala Arg Ile Pro Glu 2540 2545
2550 Ala Phe Lys 2555 452471PRTHomo sapiens 45Met Pro Ala Leu Arg
Pro Ala Leu Leu Trp Ala Leu Leu Ala Leu Trp 1 5 10 15 Leu Cys Cys
Ala Ala Pro Ala His Ala Leu Gln Cys Arg Asp Gly Tyr 20 25 30 Glu
Pro Cys Val Asn Glu Gly Met Cys Val Thr Tyr His Asn Gly Thr 35 40
45 Gly Tyr Cys Lys Cys Pro Glu Gly Phe Leu Gly Glu Tyr Cys Gln His
50 55 60 Arg Asp Pro Cys Glu Lys Asn Arg Cys Gln Asn Gly Gly Thr
Cys Val 65 70 75 80 Ala Gln Ala Met Leu Gly Lys Ala Thr Cys Arg Cys
Ala Ser Gly Phe 85 90 95 Thr Gly Glu Asp Cys Gln Tyr Ser Thr Ser
His Pro Cys Phe Val Ser 100 105 110 Arg Pro Cys Leu Asn Gly Gly Thr
Cys His Met Leu Ser Arg Asp Thr 115 120 125 Tyr Glu Cys Thr Cys Gln
Val Gly Phe Thr Gly Lys Glu Cys Gln Trp 130 135 140 Thr Asp Ala Cys
Leu Ser His Pro Cys Ala Asn Gly Ser Thr Cys Thr 145 150 155 160 Thr
Val Ala Asn Gln Phe Ser Cys Lys Cys Leu Thr Gly Phe Thr Gly 165 170
175 Gln Lys Cys Glu Thr Asp Val Asn Glu Cys Asp Ile Pro Gly His Cys
180 185 190 Gln His Gly Gly Thr Cys Leu Asn Leu Pro Gly Ser Tyr Gln
Cys Gln 195 200 205 Cys Pro Gln Gly Phe Thr Gly Gln Tyr Cys Asp Ser
Leu Tyr Val Pro 210 215 220 Cys Ala Pro Ser Pro Cys Val Asn Gly Gly
Thr Cys Arg Gln Thr Gly 225 230 235 240 Asp Phe Thr Phe Glu Cys Asn
Cys Leu Pro Gly Phe Glu Gly Ser Thr 245 250 255 Cys Glu Arg Asn Ile
Asp Asp Cys Pro Asn His Arg Cys Gln Asn Gly 260 265 270 Gly Val Cys
Val Asp Gly Val Asn Thr Tyr Asn Cys Arg Cys Pro Pro 275 280 285 Gln
Trp Thr Gly Gln Phe Cys Thr Glu Asp Val Asp Glu Cys Leu Leu 290 295
300 Gln Pro Asn Ala Cys Gln Asn Gly Gly Thr Cys Ala Asn Arg Asn Gly
305 310 315 320 Gly Tyr Gly Cys Val Cys Val Asn Gly Trp Ser Gly Asp
Asp Cys Ser 325 330 335 Glu Asn Ile Asp Asp Cys Ala Phe Ala Ser Cys
Thr Pro Gly Ser Thr 340 345 350 Cys Ile Asp Arg Val Ala Ser Phe Ser
Cys Met Cys Pro Glu Gly Lys 355 360 365 Ala Gly Leu Leu Cys His Leu
Asp Asp Ala Cys Ile Ser Asn Pro Cys 370 375 380 His Lys Gly Ala Leu
Cys Asp Thr Asn Pro Leu Asn Gly Gln Tyr Ile 385 390 395 400 Cys Thr
Cys Pro Gln Gly Tyr Lys Gly Ala Asp Cys Thr Glu Asp Val 405 410 415
Asp Glu Cys Ala Met Ala Asn Ser Asn Pro Cys Glu His Ala Gly Lys 420
425 430 Cys Val Asn Thr Asp Gly Ala Phe His Cys Glu Cys Leu Lys Gly
Tyr 435 440 445 Ala Gly Pro Arg Cys Glu Met Asp Ile Asn Glu Cys His
Ser Asp Pro 450 455 460 Cys Gln Asn Asp Ala Thr Cys Leu Asp Lys Ile
Gly Gly Phe Thr Cys 465 470 475 480 Leu Cys Met Pro Gly Phe Lys Gly
Val His Cys Glu Leu Glu Ile Asn 485 490 495 Glu Cys Gln Ser Asn Pro
Cys Val Asn Asn Gly Gln Cys Val Asp Lys 500 505 510 Val Asn Arg Phe
Gln Cys Leu Cys Pro Pro Gly Phe Thr Gly Pro Val 515 520 525 Cys Gln
Ile Asp Ile Asp Asp Cys Ser Ser Thr Pro Cys Leu Asn Gly 530 535 540
Ala Lys Cys Ile Asp His Pro Asn Gly Tyr Glu Cys Gln Cys Ala Thr 545
550 555 560 Gly Phe Thr Gly Val Leu Cys Glu Glu Asn Ile Asp Asn Cys
Asp Pro 565 570 575 Asp Pro Cys His His Gly Gln Cys Gln Asp Gly Ile
Asp Ser Tyr Thr 580 585 590 Cys Ile Cys Asn Pro Gly Tyr Met Gly Ala
Ile Cys Ser Asp Gln Ile 595 600 605 Asp Glu Cys Tyr Ser Ser Pro Cys
Leu Asn Asp Gly Arg Cys Ile Asp 610 615 620 Leu Val Asn Gly Tyr Gln
Cys Asn Cys Gln Pro Gly Thr Ser Gly Val 625 630 635 640 Asn Cys Glu
Ile Asn Phe Asp Asp Cys Ala Ser Asn Pro Cys Ile His 645 650 655 Gly
Ile Cys Met Asp Gly Ile Asn Arg Tyr Ser Cys Val Cys Ser Pro 660 665
670 Gly Phe Thr Gly Gln Arg Cys Asn Ile Asp Ile Asp Glu Cys Ala Ser
675 680 685 Asn Pro Cys Arg Lys Gly Ala Thr Cys Ile Asn Gly Val Asn
Gly Phe 690 695 700 Arg Cys Ile Cys Pro Glu Gly Pro His His Pro Ser
Cys Tyr Ser Gln 705 710 715 720 Val Asn Glu Cys Leu Ser Asn Pro Cys
Ile His Gly Asn Cys Thr Gly 725 730 735 Gly Leu Ser Gly Tyr Lys Cys
Leu Cys Asp Ala Gly Trp Val Gly Ile 740 745 750 Asn Cys Glu Val Asp
Lys Asn Glu Cys Leu Ser Asn Pro Cys Gln Asn 755 760 765 Gly Gly Thr
Cys Asp Asn Leu Val Asn Gly Tyr Arg Cys Thr Cys Lys 770 775 780 Lys
Gly Phe Lys Gly Tyr Asn Cys Gln Val Asn Ile Asp Glu Cys Ala 785 790
795 800 Ser Asn Pro Cys Leu Asn Gln Gly Thr Cys Phe Asp Asp Ile Ser
Gly 805 810 815 Tyr Thr Cys His Cys Val Leu Pro Tyr Thr Gly Lys Asn
Cys Gln Thr 820 825 830 Val Leu Ala Pro Cys Ser Pro Asn Pro Cys Glu
Asn Ala Ala Val Cys 835 840 845 Lys Glu Ser Pro Asn Phe Glu Ser Tyr
Thr Cys Leu Cys Ala Pro Gly 850 855 860 Trp Gln Gly Gln Arg Cys Thr
Ile Asp Ile Asp Glu Cys Ile Ser Lys 865 870 875 880 Pro Cys Met Asn
His Gly Leu Cys His Asn Thr Gln Gly Ser Tyr Met 885 890 895 Cys Glu
Cys Pro Pro Gly Phe Ser Gly Met Asp Cys Glu Glu Asp Ile 900 905 910
Asp Asp Cys Leu Ala Asn Pro Cys Gln Asn Gly Gly Ser Cys Met Asp 915
920 925 Gly Val Asn Thr Phe Ser Cys Leu Cys Leu Pro Gly Phe Thr Gly
Asp 930 935 940 Lys Cys Gln Thr Asp Met Asn Glu Cys Leu Ser Glu Pro
Cys Lys Asn 945 950 955 960 Gly Gly Thr Cys Ser Asp Tyr Val Asn Ser
Tyr Thr Cys Lys Cys Gln 965 970 975 Ala Gly Phe Asp Gly Val His Cys
Glu Asn Asn Ile Asn Glu Cys Thr 980 985 990 Glu Ser Ser Cys Phe Asn
Gly Gly Thr Cys Val Asp Gly Ile Asn Ser 995 1000 1005 Phe Ser Cys
Leu Cys Pro Val Gly Phe Thr Gly Ser Phe Cys Leu 1010 1015 1020 His
Glu Ile Asn Glu Cys Ser Ser His Pro Cys Leu Asn Glu Gly 1025 1030
1035 Thr Cys Val Asp Gly Leu Gly Thr Tyr Arg Cys Ser Cys Pro Leu
1040 1045 1050 Gly Tyr Thr Gly Lys Asn Cys Gln Thr Leu Val Asn Leu
Cys Ser 1055 1060 1065 Arg Ser Pro Cys Lys Asn Lys Gly Thr Cys Val
Gln Lys Lys Ala 1070 1075 1080 Glu Ser Gln Cys Leu Cys Pro Ser Gly
Trp Ala Gly Ala Tyr Cys 1085 1090 1095 Asp Val Pro Asn Val Ser Cys
Asp Ile Ala Ala Ser Arg Arg Gly 1100 1105 1110 Val Leu Val Glu His
Leu Cys Gln His Ser Gly Val Cys Ile Asn 1115 1120 1125 Ala Gly Asn
Thr His Tyr Cys Gln Cys Pro Leu Gly Tyr Thr Gly 1130 1135 1140 Ser
Tyr Cys Glu Glu Gln Leu Asp Glu Cys Ala Ser Asn Pro Cys 1145 1150
1155 Gln His Gly Ala Thr Cys Ser Asp Phe Ile Gly Gly Tyr Arg Cys
1160 1165 1170 Glu Cys Val Pro Gly Tyr Gln Gly Val Asn Cys Glu Tyr
Glu Val 1175 1180 1185 Asp Glu Cys Gln Asn Gln Pro Cys Gln Asn Gly
Gly Thr Cys Ile 1190 1195 1200 Asp Leu Val Asn His Phe Lys Cys Ser
Cys Pro Pro Gly Thr Arg 1205 1210 1215 Gly Leu Leu Cys Glu Glu Asn
Ile Asp Asp Cys Ala Arg Gly Pro 1220 1225 1230 His Cys Leu Asn Gly
Gly Gln Cys Met Asp Arg Ile Gly Gly Tyr 1235 1240 1245 Ser Cys Arg
Cys Leu Pro Gly Phe Ala Gly Glu Arg Cys Glu Gly 1250 1255 1260 Asp
Ile Asn Glu Cys Leu Ser Asn Pro Cys Ser Ser Glu Gly Ser 1265 1270
1275 Leu Asp Cys Ile Gln Leu Thr Asn Asp Tyr Leu Cys Val Cys Arg
1280 1285 1290 Ser Ala Phe Thr Gly Arg His Cys Glu Thr Phe Val Asp
Val Cys 1295 1300 1305 Pro Gln Met Pro Cys Leu Asn Gly Gly Thr Cys
Ala Val Ala Ser 1310 1315 1320 Asn Met Pro Asp Gly Phe Ile Cys Arg
Cys Pro Pro Gly Phe Ser 1325 1330 1335 Gly Ala Arg Cys Gln Ser Ser
Cys Gly Gln Val Lys Cys Arg Lys 1340 1345 1350 Gly Glu Gln Cys Val
His Thr Ala Ser Gly Pro Arg Cys Phe Cys 1355 1360 1365 Pro Ser Pro
Arg Asp Cys Glu Ser Gly Cys Ala Ser Ser Pro Cys 1370 1375 1380 Gln
His Gly Gly Ser Cys His Pro Gln Arg Gln Pro Pro Tyr Tyr 1385 1390
1395 Ser Cys Gln Cys Ala Pro Pro Phe Ser Gly Ser Arg Cys Glu Leu
1400 1405 1410 Tyr Thr Ala Pro Pro Ser Thr Pro Pro Ala Thr Cys Leu
Ser Gln 1415 1420 1425 Tyr Cys Ala Asp Lys Ala Arg Asp Gly Val Cys
Asp Glu Ala Cys 1430 1435 1440 Asn Ser His Ala Cys Gln Trp Asp Gly
Gly Asp Cys Ser Leu Thr 1445 1450 1455 Met Glu Asn Pro Trp Ala Asn
Cys Ser Ser Pro Leu Pro Cys Trp 1460 1465 1470 Asp Tyr Ile Asn Asn
Gln Cys Asp Glu Leu Cys Asn Thr Val Glu 1475 1480 1485 Cys Leu Phe
Asp Asn Phe Glu Cys Gln Gly Asn Ser Lys Thr Cys 1490 1495 1500 Lys
Tyr Asp Lys Tyr Cys Ala Asp His Phe Lys Asp Asn His Cys 1505 1510
1515 Asp Gln Gly Cys Asn Ser Glu Glu Cys Gly Trp Asp Gly Leu Asp
1520 1525 1530 Cys Ala Ala Asp Gln Pro Glu Asn Leu Ala Glu Gly Thr
Leu Val 1535 1540 1545 Ile Val Val Leu Met Pro Pro Glu Gln Leu Leu
Gln Asp Ala Arg 1550 1555 1560 Ser Phe Leu Arg Ala Leu Gly Thr Leu
Leu His Thr Asn Leu Arg 1565 1570 1575 Ile Lys Arg Asp Ser Gln Gly
Glu Leu Met Val Tyr Pro Tyr Tyr 1580 1585 1590 Gly Glu Lys Ser Ala
Ala Met Lys Lys Gln Arg Met Thr Arg Arg 1595 1600 1605 Ser Leu Pro
Gly Glu Gln Glu Gln Glu Val Ala Gly Ser Lys Val 1610 1615 1620 Phe
Leu Glu Ile Asp Asn Arg Gln Cys Val Gln Asp Ser Asp His 1625 1630
1635 Cys Phe Lys Asn Thr Asp Ala Ala Ala Ala Leu Leu Ala Ser His
1640 1645 1650 Ala Ile Gln Gly Thr Leu Ser Tyr Pro Leu Val Ser Val
Val Ser 1655 1660 1665 Glu Ser Leu Thr Pro Glu Arg Thr Gln Leu Leu
Tyr Leu Leu Ala 1670 1675 1680 Val Ala Val Val Ile Ile Leu Phe Ile
Ile Leu Leu Gly Val Ile 1685 1690 1695 Met Ala Lys Arg Lys Arg Lys
His Gly Ser Leu Trp Leu Pro Glu 1700 1705 1710 Gly Phe Thr Leu Arg
Arg Asp Ala Ser Asn His Lys Arg Arg Glu 1715 1720 1725 Pro Val Gly
Gln Asp Ala Val Gly Leu Lys Asn Leu Ser Val Gln 1730 1735 1740 Val
Ser Glu Ala Asn Leu Ile Gly Thr Gly Thr Ser Glu His Trp 1745
1750
1755 Val Asp Asp Glu Gly Pro Gln Pro Lys Lys Val Lys Ala Glu Asp
1760 1765 1770 Glu Ala Leu Leu Ser Glu Glu Asp Asp Pro Ile Asp Arg
Arg Pro 1775 1780 1785 Trp Thr Gln Gln His Leu Glu Ala Ala Asp Ile
Arg Arg Thr Pro 1790 1795 1800 Ser Leu Ala Leu Thr Pro Pro Gln Ala
Glu Gln Glu Val Asp Val 1805 1810 1815 Leu Asp Val Asn Val Arg Gly
Pro Asp Gly Cys Thr Pro Leu Met 1820 1825 1830 Leu Ala Ser Leu Arg
Gly Gly Ser Ser Asp Leu Ser Asp Glu Asp 1835 1840 1845 Glu Asp Ala
Glu Asp Ser Ser Ala Asn Ile Ile Thr Asp Leu Val 1850 1855 1860 Tyr
Gln Gly Ala Ser Leu Gln Ala Gln Thr Asp Arg Thr Gly Glu 1865 1870
1875 Met Ala Leu His Leu Ala Ala Arg Tyr Ser Arg Ala Asp Ala Ala
1880 1885 1890 Lys Arg Leu Leu Asp Ala Gly Ala Asp Ala Asn Ala Gln
Asp Asn 1895 1900 1905 Met Gly Arg Cys Pro Leu His Ala Ala Val Ala
Ala Asp Ala Gln 1910 1915 1920 Gly Val Phe Gln Ile Leu Ile Arg Asn
Arg Val Thr Asp Leu Asp 1925 1930 1935 Ala Arg Met Asn Asp Gly Thr
Thr Pro Leu Ile Leu Ala Ala Arg 1940 1945 1950 Leu Ala Val Glu Gly
Met Val Ala Glu Leu Ile Asn Cys Gln Ala 1955 1960 1965 Asp Val Asn
Ala Val Asp Asp His Gly Lys Ser Ala Leu His Trp 1970 1975 1980 Ala
Ala Ala Val Asn Asn Val Glu Ala Thr Leu Leu Leu Leu Lys 1985 1990
1995 Asn Gly Ala Asn Arg Asp Met Gln Asp Asn Lys Glu Glu Thr Pro
2000 2005 2010 Leu Phe Leu Ala Ala Arg Glu Gly Ser Tyr Glu Ala Ala
Lys Ile 2015 2020 2025 Leu Leu Asp His Phe Ala Asn Arg Asp Ile Thr
Asp His Met Asp 2030 2035 2040 Arg Leu Pro Arg Asp Val Ala Arg Asp
Arg Met His His Asp Ile 2045 2050 2055 Val Arg Leu Leu Asp Glu Tyr
Asn Val Thr Pro Ser Pro Pro Gly 2060 2065 2070 Thr Val Leu Thr Ser
Ala Leu Ser Pro Val Ile Cys Gly Pro Asn 2075 2080 2085 Arg Ser Phe
Leu Ser Leu Lys His Thr Pro Met Gly Lys Lys Ser 2090 2095 2100 Arg
Arg Pro Ser Ala Lys Ser Thr Met Pro Thr Ser Leu Pro Asn 2105 2110
2115 Leu Ala Lys Glu Ala Lys Asp Ala Lys Gly Ser Arg Arg Lys Lys
2120 2125 2130 Ser Leu Ser Glu Lys Val Gln Leu Ser Glu Ser Ser Val
Thr Leu 2135 2140 2145 Ser Pro Val Asp Ser Leu Glu Ser Pro His Thr
Tyr Val Ser Asp 2150 2155 2160 Thr Thr Ser Ser Pro Met Ile Thr Ser
Pro Gly Ile Leu Gln Ala 2165 2170 2175 Ser Pro Asn Pro Met Leu Ala
Thr Ala Ala Pro Pro Ala Pro Val 2180 2185 2190 His Ala Gln His Ala
Leu Ser Phe Ser Asn Leu His Glu Met Gln 2195 2200 2205 Pro Leu Ala
His Gly Ala Ser Thr Val Leu Pro Ser Val Ser Gln 2210 2215 2220 Leu
Leu Ser His His His Ile Val Ser Pro Gly Ser Gly Ser Ala 2225 2230
2235 Gly Ser Leu Ser Arg Leu His Pro Val Pro Val Pro Ala Asp Trp
2240 2245 2250 Met Asn Arg Met Glu Val Asn Glu Thr Gln Tyr Asn Glu
Met Phe 2255 2260 2265 Gly Met Val Leu Ala Pro Ala Glu Gly Thr His
Pro Gly Ile Ala 2270 2275 2280 Pro Gln Ser Arg Pro Pro Glu Gly Lys
His Ile Thr Thr Pro Arg 2285 2290 2295 Glu Pro Leu Pro Pro Ile Val
Thr Phe Gln Leu Ile Pro Lys Gly 2300 2305 2310 Ser Ile Ala Gln Pro
Ala Gly Ala Pro Gln Pro Gln Ser Thr Cys 2315 2320 2325 Pro Pro Ala
Val Ala Gly Pro Leu Pro Thr Met Tyr Gln Ile Pro 2330 2335 2340 Glu
Met Ala Arg Leu Pro Ser Val Ala Phe Pro Thr Ala Met Met 2345 2350
2355 Pro Gln Gln Asp Gly Gln Val Ala Gln Thr Ile Leu Pro Ala Tyr
2360 2365 2370 His Pro Phe Pro Ala Ser Val Gly Lys Tyr Pro Thr Pro
Pro Ser 2375 2380 2385 Gln His Ser Tyr Ala Ser Ser Asn Ala Ala Glu
Arg Thr Pro Ser 2390 2395 2400 His Ser Gly His Leu Gln Gly Glu His
Pro Tyr Leu Thr Pro Ser 2405 2410 2415 Pro Glu Ser Pro Asp Gln Trp
Ser Ser Ser Ser Pro His Ser Ala 2420 2425 2430 Ser Asp Trp Ser Asp
Val Thr Thr Ser Pro Thr Pro Gly Gly Ala 2435 2440 2445 Gly Gly Gly
Gln Arg Gly Pro Gly Thr His Met Ser Glu Pro Pro 2450 2455 2460 His
Asn Asn Met Gln Val Tyr Ala 2465 2470 462002PRTHomo sapiens 46Met
Gln Pro Pro Ser Leu Leu Leu Leu Leu Leu Leu Leu Leu Leu Cys 1 5 10
15 Val Ser Val Val Arg Pro Arg Gly Leu Leu Cys Gly Ser Phe Pro Glu
20 25 30 Pro Cys Ala Asn Gly Gly Thr Cys Leu Ser Leu Ser Leu Gly
Gln Gly 35 40 45 Thr Cys Gln Cys Ala Pro Gly Phe Leu Gly Glu Thr
Cys Gln Phe Pro 50 55 60 Asp Pro Cys Gln Asn Ala Gln Leu Cys Gln
Asn Gly Gly Ser Cys Gln 65 70 75 80 Ala Leu Leu Pro Ala Pro Leu Gly
Leu Pro Ser Ser Pro Ser Pro Leu 85 90 95 Thr Pro Ser Phe Leu Cys
Thr Cys Leu Pro Gly Phe Thr Gly Glu Arg 100 105 110 Cys Gln Ala Lys
Leu Glu Asp Pro Cys Pro Pro Ser Phe Cys Ser Lys 115 120 125 Arg Gly
Arg Cys His Ile Gln Ala Ser Gly Arg Pro Gln Cys Ser Cys 130 135 140
Met Pro Gly Trp Thr Gly Glu Gln Cys Gln Leu Arg Asp Phe Cys Ser 145
150 155 160 Ala Asn Pro Cys Val Asn Gly Gly Val Cys Leu Ala Thr Tyr
Pro Gln 165 170 175 Ile Gln Cys His Cys Pro Pro Gly Phe Glu Gly His
Ala Cys Glu Arg 180 185 190 Asp Val Asn Glu Cys Phe Gln Asp Pro Gly
Pro Cys Pro Lys Gly Thr 195 200 205 Ser Cys His Asn Thr Leu Gly Ser
Phe Gln Cys Leu Cys Pro Val Gly 210 215 220 Gln Glu Gly Pro Arg Cys
Glu Leu Arg Ala Gly Pro Cys Pro Pro Arg 225 230 235 240 Gly Cys Ser
Asn Gly Gly Thr Cys Gln Leu Met Pro Glu Lys Asp Ser 245 250 255 Thr
Phe His Leu Cys Leu Cys Pro Pro Gly Phe Ile Gly Pro Gly Cys 260 265
270 Glu Val Asn Pro Asp Asn Cys Val Ser His Gln Cys Gln Asn Gly Gly
275 280 285 Thr Cys Gln Asp Gly Leu Asp Thr Tyr Thr Cys Leu Cys Pro
Glu Thr 290 295 300 Trp Thr Gly Trp Asp Cys Ser Glu Asp Val Asp Glu
Cys Glu Ala Gln 305 310 315 320 Gly Pro Pro His Cys Arg Asn Gly Gly
Thr Cys Gln Asn Ser Ala Gly 325 330 335 Ser Phe His Cys Val Cys Val
Ser Gly Trp Gly Gly Thr Ser Cys Glu 340 345 350 Glu Asn Leu Asp Asp
Cys Ile Ala Ala Thr Cys Ala Pro Gly Ser Thr 355 360 365 Cys Ile Asp
Arg Val Gly Ser Phe Ser Cys Leu Cys Pro Pro Gly Arg 370 375 380 Thr
Gly Leu Leu Cys His Leu Glu Asp Met Cys Leu Ser Gln Pro Cys 385 390
395 400 His Gly Asp Ala Gln Cys Ser Thr Asn Pro Leu Thr Gly Ser Thr
Leu 405 410 415 Cys Leu Cys Gln Pro Gly Tyr Ser Gly Pro Thr Cys His
Gln Asp Leu 420 425 430 Asp Glu Cys Leu Met Ala Gln Gln Gly Pro Ser
Pro Cys Glu His Gly 435 440 445 Gly Ser Cys Leu Asn Thr Pro Gly Ser
Phe Asn Cys Leu Cys Pro Pro 450 455 460 Gly Tyr Thr Gly Ser Arg Cys
Glu Ala Asp His Asn Glu Cys Leu Ser 465 470 475 480 Gln Pro Cys His
Pro Gly Ser Thr Cys Leu Asp Leu Leu Ala Thr Phe 485 490 495 His Cys
Leu Cys Pro Pro Gly Leu Glu Gly Gln Leu Cys Glu Val Glu 500 505 510
Thr Asn Glu Cys Ala Ser Ala Pro Cys Leu Asn His Ala Asp Cys His 515
520 525 Asp Leu Leu Asn Gly Phe Gln Cys Ile Cys Leu Pro Gly Phe Ser
Gly 530 535 540 Thr Arg Cys Glu Glu Asp Ile Asp Glu Cys Arg Ser Ser
Pro Cys Ala 545 550 555 560 Asn Gly Gly Gln Cys Gln Asp Gln Pro Gly
Ala Phe His Cys Lys Cys 565 570 575 Leu Pro Gly Phe Glu Gly Pro Arg
Cys Gln Thr Glu Val Asp Glu Cys 580 585 590 Leu Ser Asp Pro Cys Pro
Val Gly Ala Ser Cys Leu Asp Leu Pro Gly 595 600 605 Ala Phe Phe Cys
Leu Cys Pro Ser Gly Phe Thr Gly Gln Leu Cys Glu 610 615 620 Val Pro
Leu Cys Ala Pro Asn Leu Cys Gln Pro Lys Gln Ile Cys Lys 625 630 635
640 Asp Gln Lys Asp Lys Ala Asn Cys Leu Cys Pro Asp Gly Ser Pro Gly
645 650 655 Cys Ala Pro Pro Glu Asp Asn Cys Thr Cys His His Gly His
Cys Gln 660 665 670 Arg Ser Ser Cys Val Cys Asp Val Gly Trp Thr Gly
Pro Glu Cys Glu 675 680 685 Ala Glu Leu Gly Gly Cys Ile Ser Ala Pro
Cys Ala His Gly Gly Thr 690 695 700 Cys Tyr Pro Gln Pro Ser Gly Tyr
Asn Cys Thr Cys Pro Thr Gly Tyr 705 710 715 720 Thr Gly Pro Thr Cys
Ser Glu Glu Met Thr Ala Cys His Ser Gly Pro 725 730 735 Cys Leu Asn
Gly Gly Ser Cys Asn Pro Ser Pro Gly Gly Tyr Tyr Cys 740 745 750 Thr
Cys Pro Pro Ser His Thr Gly Pro Gln Cys Gln Thr Ser Thr Asp 755 760
765 Tyr Cys Val Ser Ala Pro Cys Phe Asn Gly Gly Thr Cys Val Asn Arg
770 775 780 Pro Gly Thr Phe Ser Cys Leu Cys Ala Met Gly Phe Gln Gly
Pro Arg 785 790 795 800 Cys Glu Gly Lys Leu Arg Pro Ser Cys Ala Asp
Ser Pro Cys Arg Asn 805 810 815 Arg Ala Thr Cys Gln Asp Ser Pro Gln
Gly Pro Arg Cys Leu Cys Pro 820 825 830 Thr Gly Tyr Thr Gly Gly Ser
Cys Gln Thr Leu Met Asp Leu Cys Ala 835 840 845 Gln Lys Pro Cys Pro
Arg Asn Ser His Cys Leu Gln Thr Gly Pro Ser 850 855 860 Phe His Cys
Leu Cys Leu Gln Gly Trp Thr Gly Pro Leu Cys Asn Leu 865 870 875 880
Pro Leu Ser Ser Cys Gln Lys Ala Ala Leu Ser Gln Gly Ile Asp Val 885
890 895 Ser Ser Leu Cys His Asn Gly Gly Leu Cys Val Asp Ser Gly Pro
Ser 900 905 910 Tyr Phe Cys His Cys Pro Pro Gly Phe Gln Gly Ser Leu
Cys Gln Asp 915 920 925 His Val Asn Pro Cys Glu Ser Arg Pro Cys Gln
Asn Gly Ala Thr Cys 930 935 940 Met Ala Gln Pro Ser Gly Tyr Leu Cys
Gln Cys Ala Pro Gly Tyr Asp 945 950 955 960 Gly Gln Asn Cys Ser Lys
Glu Leu Asp Ala Cys Gln Ser Gln Pro Cys 965 970 975 His Asn His Gly
Thr Cys Thr Pro Lys Pro Gly Gly Phe His Cys Ala 980 985 990 Cys Pro
Pro Gly Phe Val Gly Leu Arg Cys Glu Gly Asp Val Asp Glu 995 1000
1005 Cys Leu Asp Gln Pro Cys His Pro Thr Gly Thr Ala Ala Cys His
1010 1015 1020 Ser Leu Ala Asn Ala Phe Tyr Cys Gln Cys Leu Pro Gly
His Thr 1025 1030 1035 Gly Gln Trp Cys Glu Val Glu Ile Asp Pro Cys
His Ser Gln Pro 1040 1045 1050 Cys Phe His Gly Gly Thr Cys Glu Ala
Thr Ala Gly Ser Pro Leu 1055 1060 1065 Gly Phe Ile Cys His Cys Pro
Lys Gly Phe Glu Gly Pro Thr Cys 1070 1075 1080 Ser His Arg Ala Pro
Ser Cys Gly Phe His His Cys His His Gly 1085 1090 1095 Gly Leu Cys
Leu Pro Ser Pro Lys Pro Gly Phe Pro Pro Arg Cys 1100 1105 1110 Ala
Cys Leu Ser Gly Tyr Gly Gly Pro Asp Cys Leu Thr Pro Pro 1115 1120
1125 Ala Pro Lys Gly Cys Gly Pro Pro Ser Pro Cys Leu Tyr Asn Gly
1130 1135 1140 Ser Cys Ser Glu Thr Thr Gly Leu Gly Gly Pro Gly Phe
Arg Cys 1145 1150 1155 Ser Cys Pro His Ser Ser Pro Gly Pro Arg Cys
Gln Lys Pro Gly 1160 1165 1170 Ala Lys Gly Cys Glu Gly Arg Ser Gly
Asp Gly Ala Cys Asp Ala 1175 1180 1185 Gly Cys Ser Gly Pro Gly Gly
Asn Trp Asp Gly Gly Asp Cys Ser 1190 1195 1200 Leu Gly Val Pro Asp
Pro Trp Lys Gly Cys Pro Ser His Ser Arg 1205 1210 1215 Cys Trp Leu
Leu Phe Arg Asp Gly Gln Cys His Pro Gln Cys Asp 1220 1225 1230 Ser
Glu Glu Cys Leu Phe Asp Gly Tyr Asp Cys Glu Thr Pro Pro 1235 1240
1245 Ala Cys Thr Pro Ala Tyr Asp Gln Tyr Cys His Asp His Phe His
1250 1255 1260 Asn Gly His Cys Glu Lys Gly Cys Asn Thr Ala Glu Cys
Gly Trp 1265 1270 1275 Asp Gly Gly Asp Cys Arg Pro Glu Asp Gly Asp
Pro Glu Trp Gly 1280 1285 1290 Pro Ser Leu Ala Leu Leu Val Val Leu
Ser Pro Pro Ala Leu Asp 1295 1300 1305 Gln Gln Leu Phe Ala Leu Ala
Arg Val Leu Ser Leu Thr Leu Arg 1310 1315 1320 Val Gly Leu Trp Val
Arg Lys Asp Arg Asp Gly Arg Asp Met Val 1325 1330 1335 Tyr Pro Tyr
Pro Gly Ala Arg Ala Glu Glu Lys Leu Gly Gly Thr 1340 1345 1350 Arg
Asp Pro Thr Tyr Gln Glu Arg Ala Ala Pro Gln Thr Gln Pro 1355 1360
1365 Leu Gly Lys Glu Thr Asp Ser Leu Ser Ala Gly Phe Val Val Val
1370 1375 1380 Met Gly Val Asp Leu Ser Arg Cys Gly Pro Asp His Pro
Ala Ser 1385 1390 1395 Arg Cys Pro Trp Asp Pro Gly Leu Leu Leu Arg
Phe Leu Ala Ala 1400 1405 1410 Met Ala Ala Val Gly Ala Leu Glu Pro
Leu Leu Pro Gly Pro Leu 1415 1420 1425 Leu Ala Val His Pro His Ala
Gly Thr Ala Pro Pro Ala Asn Gln 1430 1435 1440 Leu Pro Trp Pro Val
Leu Cys Ser Pro Val Ala Gly Val Ile Leu 1445 1450 1455 Leu Ala Leu
Gly Ala Leu Leu Val Leu Gln Leu Ile Arg Arg Arg 1460 1465 1470 Arg
Arg Glu His Gly Ala Leu Trp Leu Pro Pro Gly Phe Thr Arg 1475 1480
1485 Arg Pro Arg Thr Gln Ser Ala Pro His Arg Arg Arg Pro Pro Leu
1490 1495 1500 Gly Glu Asp Ser Ile Gly Leu Lys Ala Leu Lys Pro Lys
Ala Glu 1505 1510 1515 Val Asp Glu Asp Gly Val Val Met Cys Ser Gly
Pro
Glu Glu Gly 1520 1525 1530 Glu Glu Val Gly Gln Ala Glu Glu Thr Gly
Pro Pro Ser Thr Cys 1535 1540 1545 Gln Leu Trp Ser Leu Ser Gly Gly
Cys Gly Ala Leu Pro Gln Ala 1550 1555 1560 Ala Met Leu Thr Pro Pro
Gln Glu Ser Glu Met Glu Ala Pro Asp 1565 1570 1575 Leu Asp Thr Arg
Gly Pro Asp Gly Val Thr Pro Leu Met Ser Ala 1580 1585 1590 Val Cys
Cys Gly Glu Val Gln Ser Gly Thr Phe Gln Gly Ala Trp 1595 1600 1605
Leu Gly Cys Pro Glu Pro Trp Glu Pro Leu Leu Asp Gly Gly Ala 1610
1615 1620 Cys Pro Gln Ala His Thr Val Gly Thr Gly Glu Thr Pro Leu
His 1625 1630 1635 Leu Ala Ala Arg Phe Ser Arg Pro Thr Ala Ala Arg
Arg Leu Leu 1640 1645 1650 Glu Ala Gly Ala Asn Pro Asn Gln Pro Asp
Arg Ala Gly Arg Thr 1655 1660 1665 Pro Leu His Ala Ala Val Ala Ala
Asp Ala Arg Glu Val Cys Gln 1670 1675 1680 Leu Leu Leu Arg Ser Arg
Gln Thr Ala Val Asp Ala Arg Thr Glu 1685 1690 1695 Asp Gly Thr Thr
Pro Leu Met Leu Ala Ala Arg Leu Ala Val Glu 1700 1705 1710 Asp Leu
Val Glu Glu Leu Ile Ala Ala Gln Ala Asp Val Gly Ala 1715 1720 1725
Arg Asp Lys Trp Gly Lys Thr Ala Leu His Trp Ala Ala Ala Val 1730
1735 1740 Asn Asn Ala Arg Ala Ala Arg Ser Leu Leu Gln Ala Gly Ala
Asp 1745 1750 1755 Lys Asp Ala Gln Asp Asn Arg Glu Gln Thr Pro Leu
Phe Leu Ala 1760 1765 1770 Ala Arg Glu Gly Ala Val Glu Val Ala Gln
Leu Leu Leu Gly Leu 1775 1780 1785 Gly Ala Ala Arg Glu Leu Arg Asp
Gln Ala Gly Leu Ala Pro Ala 1790 1795 1800 Asp Val Ala His Gln Arg
Asn His Trp Asp Leu Leu Thr Leu Leu 1805 1810 1815 Glu Gly Ala Gly
Pro Pro Glu Ala Arg His Lys Ala Thr Pro Gly 1820 1825 1830 Arg Glu
Ala Gly Pro Phe Pro Arg Ala Arg Thr Val Ser Val Ser 1835 1840 1845
Val Pro Pro His Gly Gly Gly Ala Leu Pro Arg Cys Arg Thr Leu 1850
1855 1860 Ser Ala Gly Ala Gly Pro Arg Gly Gly Gly Ala Cys Leu Gln
Ala 1865 1870 1875 Arg Thr Trp Ser Val Asp Leu Ala Ala Arg Gly Gly
Gly Ala Tyr 1880 1885 1890 Ser His Cys Arg Ser Leu Ser Gly Val Gly
Ala Gly Gly Gly Pro 1895 1900 1905 Thr Pro Arg Gly Arg Arg Phe Ser
Ala Gly Met Arg Gly Pro Arg 1910 1915 1920 Pro Asn Pro Ala Ile Met
Arg Gly Arg Tyr Gly Val Ala Ala Gly 1925 1930 1935 Arg Gly Gly Arg
Val Ser Thr Asp Asp Trp Pro Cys Asp Trp Val 1940 1945 1950 Ala Leu
Gly Ala Cys Gly Ser Ala Ser Asn Ile Pro Ile Pro Pro 1955 1960 1965
Pro Cys Leu Thr Pro Ser Pro Glu Arg Gly Ser Pro Gln Leu Asp 1970
1975 1980 Cys Gly Pro Pro Ala Leu Gln Glu Met Pro Ile Asn Gln Gly
Gly 1985 1990 1995 Glu Gly Lys Lys 2000 47135DNAArtificial
sequenceEngineered Notch3 leader peptide coding sequence
47atgggtccag gtgcaagagg tagaaggcgt agaaggagac caatgagccc acctcctccg
60ccacctccag tgagagcact gcctttgctg ttgctgctgg ctggacctgg tgcagcagct
120cctccttgcc tggac 13548135DNAArtificial sequenceNative Notch3
leader peptide coding sequence 48atggggccgg gggcccgtgg ccgccgccgc
cgccgtcgcc cgatgtcgcc gccaccgcca 60ccgccacccg tgcgggcgct gcccctgctg
ctgctgctag cggggccggg ggctgcagcc 120cccccttgcc tggac 135
* * * * *