U.S. patent application number 15/835188 was filed with the patent office on 2018-10-04 for aav virions with decreased immunoreactivity and uses therefor.
This patent application is currently assigned to Genzyme Corporation. The applicant listed for this patent is Genzyme Corporation. Invention is credited to Alejandra Elena Arbetman, Peter C. Colosi, Michael A. Lochrie, Richard T. Surosky.
Application Number | 20180280540 15/835188 |
Document ID | / |
Family ID | 33545345 |
Filed Date | 2018-10-04 |
United States Patent
Application |
20180280540 |
Kind Code |
A1 |
Arbetman; Alejandra Elena ;
et al. |
October 4, 2018 |
AAV VIRIONS WITH DECREASED IMMUNOREACTIVITY AND USES THEREFOR
Abstract
Methods of making and using recombinant AAV virions with
decreased immunoreactivity are described. The recombinant AAV
virions include mutated capsid proteins or are derived from
non-primate mammalian AAV serotypes and isolates that display
decreased immunoreactivity relative to AAV-2.
Inventors: |
Arbetman; Alejandra Elena;
(Westborough, MA) ; Colosi; Peter C.;
(Westborough, MA) ; Lochrie; Michael A.;
(Westborough, MA) ; Surosky; Richard T.;
(Westborough, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Genzyme Corporation |
Cambridge |
MA |
US |
|
|
Assignee: |
Genzyme Corporation
Cambridge
MA
|
Family ID: |
33545345 |
Appl. No.: |
15/835188 |
Filed: |
December 7, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15296817 |
Oct 18, 2016 |
|
|
|
15835188 |
|
|
|
|
11825798 |
Jul 9, 2007 |
9506083 |
|
|
15296817 |
|
|
|
|
10873632 |
Jun 21, 2004 |
7259151 |
|
|
11825798 |
|
|
|
|
60480395 |
Jun 19, 2003 |
|
|
|
60567310 |
Apr 30, 2004 |
|
|
|
60576501 |
Jun 3, 2004 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 21/04 20180101;
A61K 48/0075 20130101; C12N 15/86 20130101; C12N 2750/14162
20130101; C12N 7/00 20130101; A61P 11/00 20180101; A61P 35/00
20180101; A61P 3/00 20180101; A61K 38/4846 20130101; A61K 48/0066
20130101; A61P 37/02 20180101; C12N 2750/14122 20130101; A61K 48/00
20130101; C12N 2830/008 20130101; C12N 2830/85 20130101; A61P 7/06
20180101; A61P 9/10 20180101; A61P 13/12 20180101; C12N 2750/14143
20130101; A61P 25/16 20180101; A61P 29/00 20180101; C07K 14/005
20130101; A61P 3/08 20180101; A61P 37/04 20180101; A61K 48/0058
20130101; A61P 7/04 20180101; C12N 2750/14121 20130101; C12Y
304/21022 20130101; A61P 19/06 20180101; A61P 3/06 20180101; A61P
3/10 20180101; A61P 7/02 20180101; A61P 9/04 20180101 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C07K 14/005 20060101 C07K014/005; C12N 7/00 20060101
C12N007/00; A61K 38/48 20060101 A61K038/48; C12N 15/86 20060101
C12N015/86 |
Claims
1. A mutated adeno-associated virus (AAV) capsid protein that when
present in an AAV virion imparts decreased immunoreactivity to the
virion as compared to the corresponding wild-type virion.
2. The protein of claim 1, wherein the mutation comprises at least
one amino acid substitution, deletion or insertion to the native
protein.
3. The protein of claim 2, wherein the mutation comprises at least
one amino acid substitution.
4. The protein of claim 3, wherein the at least one amino acid
substitution is in the spike or plateau region of the AAV virion
surface.
5. The protein of claim 4, wherein the amino acid substitution
comprises a substitution of one or more of the amino acids
occurring at a position corresponding to a position of the AAV-2
VP2 capsid selected from the group consisting of amino acid 126,
127, 128, 130, 132, 134, 247, 248, 315, 334, 354, 357, 360, 361,
365, 372, 375, 377, 390, 393, 394, 395, 396, 407, 411, 413, 418,
437, 449, 450, 568, 569, and 571.
6. The protein of claim 5, wherein the naturally occurring amino
acid at the position is substituted with an alanine.
7. The protein of claim 6, wherein the protein further comprises a
substitution of histidine for the amino acid occurring at the
position corresponding to the amino acid found at position 360 of
AAV-2 VP2.
8. The protein of claim 5, wherein the protein comprises a
substitution of lysine for the amino acid occurring at the position
corresponding to the amino acid found at position 571 of AAV-2
VP2.
9. A polynucleotide encoding the mutated protein of claim 1.
10. A polynucleotide encoding the mutated protein of claim 5.
11. A polynucleotide encoding the mutated protein of claim 6.
12. A polynucleotide encoding the mutated protein of claim 8.
13. A recombinant AAV virion comprising the mutated protein of
claim 1.
14. A recombinant AAV virion comprising the mutated protein of
claim 5.
15. A recombinant AAV virion comprising the mutated protein of
claim 6.
16. A recombinant AAV virion comprising the mutated protein of
claim 8.
17. The recombinant AAV virion of claim 13, wherein said virion
comprises a heterologous nucleic acid molecule encoding an
antisense RNA or a ribozymes.
18. The recombinant AAV virion of claim 13, wherein said virion
comprises a heterologous nucleic acid molecule encoding a
therapeutic protein operably linked to control elements capable of
directing the in vivo transcription and translation of said
protein.
19. The recombinant AAV virion of claim 14, wherein said virion
comprises a heterologous nucleic acid molecule encoding a
therapeutic protein operably linked to control elements capable of
directing the in vivo transcription and translation of said
protein.
20. The recombinant AAV virion of claim 15, wherein said virion
comprises a heterologous nucleic acid molecule encoding a
therapeutic protein operably linked to control elements capable of
directing the in vivo transcription and translation of said
protein.
21. The recombinant AAV virion of claim 16, wherein said virion
comprises a heterologous nucleic acid molecule encoding a
therapeutic protein operably linked to control elements capable of
directing the in vivo transcription and translation of said
protein.
22. A method of delivering a recombinant AAV virion to a cell or
tissue of a vertebrate subject, said method comprising: (a)
providing a recombinant AAV virion according to claim 13; (b)
delivering said recombinant AAV virion to said cell or tissue,
whereby said protein is expressed at a level that provides a
therapeutic effect.
23. The method of claim 22, wherein said cell or tissue is a muscle
cell or tissue.
24. The method of claim 23, wherein said muscle cell or tissue is
derived from skeletal muscle.
25. The method of claim 22, wherein said recombinant AAV virion is
delivered into said cell or tissue in vivo.
26. The method of claim 25, wherein said recombinant AAV virion is
delivered by intramuscular injection.
27. The method of claim 22, wherein said recombinant AAV virion is
delivered into said cell or tissue in vitro.
28. The method of claim 22, wherein said recombinant AAV virion is
delivered into the bloodstream.
29. The method of claim 28, wherein said recombinant AAV virion is
delivered intravenously.
30. The method of claim 28, wherein said recombinant AAV virion is
delivered intraarterially.
31. The method of claim 22, wherein said recombinant AAV virion is
delivered to the liver.
32. The method of claim 22, wherein said recombinant AAV virion is
delivered to the brain.
33. A method of delivering a recombinant AAV virion to a cell or
tissue of a vertebrate subject, said method comprising: (a)
providing a recombinant AAV virion, wherein said AAV virion
comprises (i) a non-primate, mammalian adeno-associated virus (AAV)
capsid protein that when present in an AAV virion imparts decreased
immunoreactivity to the virion as compared to immunoreactivity of
primate AAV-2; and (ii) a heterologous nucleic acid molecule
encoding a therapeutic protein operably linked to control elements
capable of directing the in vivo transcription and translation of
said protein; (b) delivering said recombinant AAV virion to said
cell or tissue, whereby said protein is expressed at a level that
provides a therapeutic effect.
34. The method of claim 33, wherein said cell or tissue is a muscle
cell or tissue.
35. The method of claim 34, wherein said muscle cell or tissue is
derived from skeletal muscle.
36. The method of claim 33, wherein said recombinant AAV virion is
delivered into said cell or tissue in vivo.
37. The method of claim 36, wherein said recombinant AAV virion is
delivered by intramuscular injection.
38. The method of claim 33, wherein said recombinant AAV virion is
delivered into said cell or tissue in vitro.
39. The method of claim 33, wherein said recombinant AAV virion is
delivered into the bloodstream.
40. The method of claim 39, wherein said recombinant AAV virion is
delivered intravenously.
41. The method of claim 39, wherein said recombinant AAV virion is
delivered intraarterially.
42. The method of claim 33, wherein said recombinant AAV virion is
delivered to the liver.
43. The method of claim 33, wherein said recombinant AAV virion is
delivered to the brain.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. application Ser.
No. 15/296,817, filed Oct. 18, 2016, which is a continuation of
Ser. No. 11/825,798, filed Jul. 9, 2007, now U.S. Pat. No.
9,506,083, which is a continuation of U.S. application Ser. No.
10/873,632, filed Jun. 21, 2004, now U.S. Pat. No. 7,259,151, from
which applications priority is claimed pursuant to 35 U.S.C. .sctn.
120. U.S. application Ser. No. 10/873,632 claims the benefit under
35 U.S.C. .sctn. 119(e) of provisional application serial nos.
60/480,395, filed Jun. 19, 2003; 60/567,310, filed Apr. 30, 2004;
and 60/576,501, filed Jun. 3, 2004. All of the foregoing
applications are hereby incorporated by reference in their
entireties.
TECHNICAL FIELD
[0002] The present invention relates generally to compositions and
methods for delivering recombinant adeno-associated virus (rAAV)
virions to cells. In particular, the present invention pertains to
rAAV virions with decreased immunoreactivity, such as mutant rAAV
virions, and methods of making and using the same.
BACKGROUND
[0003] Scientists are continually discovering genes that are
associated with human diseases such as diabetes, hemophilia, and
cancer. Research efforts have also uncovered genes, such as
erythropoietin (which increases red blood cell production), that
are not associated with genetic disorders but instead code for
proteins that can be used to treat numerous diseases. Despite
significant progress in the effort to identify and isolate genes,
however, a major obstacle facing the biopharmaceutical industry is
how to safely and persistently deliver therapeutically effective
quantities of gene products to patients.
[0004] Generally, the protein products of these genes are
synthesized in cultured bacterial, yeast, insect, mammalian, or
other cells and delivered to patients by direct injection.
Injection of recombinant proteins has been successful but suffers
from several drawbacks. For example, patients often require weekly,
and sometimes daily, injections in order to maintain the necessary
levels of the protein in the bloodstream. Even then, the
concentration of protein is not maintained at physiological
levels--the level of the protein is usually abnormally high
immediately following the injection, and far below optimal levels
prior to the injection. Additionally, injected delivery of
recombinant protein often cannot deliver the protein to the target
cells, tissues, or organs in the body. And, if the protein
successfully reaches its target, it may be diluted to a
non-therapeutic level. Furthermore, the method is inconvenient and
often restricts the patient's lifestyle.
[0005] These shortcomings have fueled the desire to develop gene
therapy methods for delivering sustained levels of specific
proteins into patients. These methods are designed to allow
clinicians to introduce deoxyribonucleic acid (DNA) coding for a
nucleic acid, such as a therapeutic gene, directly into a patient
(in vivo gene therapy) or into cells isolated from a patient or a
donor (ex vivo gene therapy). The introduced nucleic acid then
directs the patient's own cells or grafted cells to produce the
desired protein product. Gene delivery, therefore, obviates the
need for frequent injections. Gene therapy may also allow
clinicians to select specific organs or cellular targets (e.g.,
muscle, blood cells, brain cells, etc.) for therapy.
[0006] DNA may be introduced into a patient's cells in several
ways. There are transfection methods, including chemical methods
such as calcium phosphate precipitation and liposome-mediated
transfection, and physical methods such as electroporation. In
general, transfection methods are not suitable for in vivo gene
delivery. There are also methods that use recombinant viruses.
Current viral-mediated gene delivery vectors include those based on
retrovirus, adenovirus, herpes virus, pox virus, and
adeno-associated virus (AAV). Like the retroviruses, and unlike
adenovirus, AAV has the ability to integrate its genome into a host
cell chromosome.
[0007] Adeno-Associated Virus-Mediated Gene Therapy
[0008] AAV is a parvovirus belonging to the genus Dependovirus, and
has several attractive features not found in other viruses. For
example, AAV can infect a wide range of host cells, including
non-dividing cells. AAV can also infect cells from different
species. Importantly, AAV has not been associated with any human or
animal disease, and does not appear to alter the physiological
properties of the host cell upon integration. Furthermore, AAV is
stable at a wide range of physical and chemical conditions, which
lends itself to production, storage, and transportation
requirements.
[0009] The AAV genome, a linear, single-stranded DNA molecule
containing approximately 4700 nucleotides (the AAV-2 genome
consists of 4681 nucleotides), generally comprises an internal
non-repeating segment flanked on each end by inverted terminal
repeats (ITRs). The ITRs are approximately 145 nucleotides in
length (AAV-1 has ITRs of 143 nucleotides) and have multiple
functions, including serving as origins of replication, and as
packaging signals for the viral genome.
[0010] The internal non-repeated portion of the genome includes two
large open reading frames (ORFs), known as the AAV replication
(rep) and capsid (cap) regions. These ORFs encode replication and
capsid gene products, respectively: replication and capsid gene
products (i.e., proteins) allow for the replication, assembly, and
packaging of a complete AAV virion. More specifically, a family of
at least four viral proteins are expressed from the AAV rep region:
Rep 78, Rep 68, Rep 52, and Rep 40, all of which are named for
their apparent molecular weights. The AAV cap region encodes at
least three proteins: VP1, VP2, and VP3.
[0011] In nature, AAV is a helper virus-dependent virus, i.e., it
requires co-infection with a helper virus (e.g., adenovirus,
herpesvirus, or vaccinia virus) in order to form functionally
complete AAV virions. In the absence of co-infection with a helper
virus, AAV establishes a latent state in which the viral genome
inserts into a host cell chromosome or exists in an episomal form,
but infectious virions are not produced. Subsequent infection by a
helper virus "rescues" the integrated genome, allowing it to be
replicated and packaged into viral capsids, thereby reconstituting
the infectious virion. While AAV can infect cells from different
species, the helper virus must be of the same species as the host
cell. Thus, for example, human AAV will replicate in canine cells
that have been co-infected with a canine adenovirus.
[0012] To construct infectious recombinant AAV (rAAV) containing a
nucleic acid, a suitable host cell line is transfected with an AAV
vector containing a nucleic acid. AAV helper functions and
accessory functions are then expressed in the host cell. Once these
factors come together, the HNA is replicated and packaged as though
it were a wild-type (wt) AAV genome, forming a recombinant virion.
When a patient's cells are infected with the resulting rAAV, the
HNA enters and is expressed in the patient's cells. Because the
patient's cells lack the rep and cap genes, as well as the
adenovirus accessory function genes, the rAAV are replication
defective; that is, they cannot further replicate and package their
genomes. Similarly, without a source of rep and cap genes, wtAAV
cannot be formed in the patient's cells.
[0013] There are several AAV serotypes that infect humans as well
as other primates and mammals. Eight major serotypes have been
identified, AAV-1 through AAV-8, including two serotypes recently
isolated from rhesus monkeys. Gao et al. (2002) Proc. Natl. Acad.
Sci. USA 99:11854-11859. Of those serotypes, AAV-2 is the best
characterized, having been used to successfully deliver transgenes
to several cell lines, tissue types, and organs in a variety of in
vitro and in vivo assays. The various serotypes of AAV can be
distinguished from one another using monoclonal antibodies or by
employing nucleotide sequence analysis; e.g., AAV-1, AAV-2, AAV-3,
and AAV-6 are 82% identical at the nucleotide level, while AAV-4 is
75 to 78% identical to the other serotypes (Russell et al. (1998)
J. Virol. 72:309-319). Significant nucleotide sequence variation is
noted for regions of the AAV genome that code for capsid proteins.
Such variable regions may be responsible for differences in
serological reactivity to the capsid proteins of the various AAV
serotypes.
[0014] After an initial treatment with a given AAV serotype,
anti-AAV capsid neutralizing antibodies are often made which
prevent subsequent treatments by the same serotype. For example,
Moskalenko et al. J. Virol. (2000) 74:1761-1766 showed that mice
with pre-existing anti-AAV-2 antibodies, when administered Factor
IX in a recombinant AAV-2 virion, failed to express the Factor IX
transgene, suggesting that the anti-AAV-2 antibodies blocked
transduction of the rAAV-2 virion. Halbert et al. J. Virol. (1998)
72:9795-9805 reported similar results. Others have demonstrated
successful readministration of rAAV-2 virions into experimental
animals, but only after immune suppression is achieved (see, e.g.,
Halbert et al., supra).
[0015] Thus, using rAAV for human gene therapy is potentially
problematic because anti-AAV antibodies are prevalent in human
populations. Infection of humans by a variety of AAV serotypes
occurs in childhood, and possibly even in utero. In fact, one study
estimated that at least 80% of the general population has been
infected with AAV-2 (Berns and Linden (1995) Bioessays 17:237-245).
Neutralizing anti-AAV-2 antibodies have been found in at least
20-40% of humans. Our studies have shown that out of a group of 50
hemophiliacs, approximately 40% had AAV-2 neutralizing capacities
exceeding 1e13 viral particles/ml, or about 6e16 viral
particles/total blood volume. Furthermore, the majority of the
group with high anti-AAV-2 titers also had significant titers
against other AAV serotypes, such as AAV-1, AAV-3, AAV-4, AAV-5 and
AAV-6. Therefore, identification of AAV mutants with reduced
immunoreactivity, such as mutants that are not neutralized by
pre-existing anti-AAV antibodies, would be a significant
advancement in the art. Such AAV mutants are described herein.
SUMMARY OF THE INVENTION
[0016] The present invention is based on the discovery of novel AAV
sequences, such as mutated AAV sequences, that provide for
recombinant AAV virions with decreased immunoreactivity as compared
with the corresponding native serotype but which retain the ability
to efficiently transduce cells and tissues. The rAAV virions with
decreased immunoreactivity are especially useful for delivering
heterologous nucleic acid molecules (HNAs) to subjects that have
been previously exposed to AAV, either by natural infection or due
to previous gene therapy or nucleic acid immunization treatments,
and have therefore developed anti-AAV antibodies. The rAAV virions
described herein are therefore useful for treating or preventing a
wide variety of disorders, as described further below, in
vertebrate subjects that have been previously exposed to any of the
various AAV serotypes. In accordance with the present invention,
then, methods and AAV vectors for use therein are provided for the
efficient delivery of HNAs to the cells or tissue of a vertebrate
subject, such as a mammal, using recombinant AAV virions.
[0017] In certain preferred embodiments, the present invention
provides for the use of AAV virions containing altered capsid
proteins to deliver an HNA encoding antisense RNA, ribozymes, or
one or more genes that express proteins, wherein expression of said
antisense RNA, ribozymes, or one or more genes provides for a
biological effect in a mammalian subject. In one embodiment, the
rAAV virions containing an HNA are injected directly into a muscle
(e.g., cardiac, smooth and/or skeletal muscle). In another
embodiment, the rAAV virions containing an HNA are administered
into the vasculature via injection into veins, arteries, or other
vascular conduits, or by using techniques such as isolated limb
perfusion.
[0018] In additional embodiments, the virions contain a gene
encoding a blood coagulation protein which, when expressed at a
sufficient concentration, provides for a therapeutic effect, such
as improved blood-clotting efficiency of a mammal suffering from a
blood-clotting disorder. The blood-clotting disorder can be any
disorder adversely affecting the organism's ability to coagulate
the blood. Preferably, the blood clotting disorder is hemophilia.
In one embodiment, then, the gene encoding a blood coagulation
protein is a Factor VIII gene, such as the human Factor VIII gene
or a derivation thereof. In another embodiment, the gene encoding a
blood coagulation protein is a Factor IX gene, such as the human
Factor IX (hF.IX) gene.
[0019] Accordingly, in one embodiment, the present invention is
directed to a mutated AAV capsid protein that when present in an
AAV virion imparts decreased immunoreactivity to the virion as
compared to the corresponding wild-type virion. The mutation may
comprise at least one amino acid substitution, deletion or
insertion to the native protein, such as a substitution is in the
spike or plateau region of the AAV virion surface.
[0020] In certain embodiments, the amino acid substitution
comprises a substitution of one or more of the amino acids
occurring at a position corresponding to a position of the AAV-2
VP2 capsid selected from the group consisting of amino acid 126,
127, 128, 130, 132, 134, 247, 248, 315, 334, 354, 357, 360, 361,
365, 372, 375, 377, 390, 393, 394, 395, 396, 407, 411, 413, 418,
437, 449, 450, 568, 569, and 571. In additional embodiments, the
naturally occurring amino acid at one or more of these positions is
substituted with an alanine. In further embodiments, the protein
further comprises a substitution of histidine for the amino acid
occurring at the position corresponding to the amino acid found at
position 360 of AAV-2 VP2 and/or a substitution of lysine for the
amino acid occurring at the position corresponding to the amino
acid found at position 571 of AAV-2 VP2.
[0021] In additional embodiments, the invention is directed to a
polynucleotide encoding any of the mutated proteins described
above.
[0022] In further embodiments, the invention is directed to a
recombinant AAV virion comprising any of the mutated proteins
described above. The recombinant AAV virion can comprise a
heterologous nucleic acid molecule encoding an antisense RNA or a
ribozymes, or a heterologous nucleic acid molecule encoding a
therapeutic protein operably linked to control elements capable of
directing the in vivo transcription and translation of said
protein.
[0023] In yet further embodiments, the invention is directed to a
method of delivering a recombinant AAV virion to a cell or tissue
of a vertebrate subject. The method comprises:
[0024] (a) providing a recombinant AAV virion as above;
[0025] (b) delivering the recombinant AAV virion to the cell or
tissue, whereby the protein is expressed at a level that provides a
therapeutic effect.
[0026] In certain embodiments, the cell or tissue is a muscle cell
or tissue. The muscle cell or tissue can be derived from skeletal
muscle.
[0027] In further embodiments, the recombinant AAV virion is
delivered into the cell or tissue in vivo.
[0028] In certain embodiments, the recombinant AAV virion is
delivered by intramuscular injection, or into the bloodstream, such
as intravenously or intraarterially. In additional embodiments, the
recombinant AAV virion is delivered to the liver or to the
brain.
[0029] In further embodiments, the recombinant AAV virion is
delivered into said cell or tissue in vitro.
[0030] In yet an additional embodiment, the invention is directed
to a method of delivering a recombinant AAV virion to a cell or
tissue of a vertebrate subject. The method comprises:
[0031] (a) providing a recombinant AAV virion, wherein the AAV
virion comprises [0032] (i) a non-primate, mammalian
adeno-associated virus (AAV) capsid protein that when present in an
AAV virion imparts decreased immunoreactivity to the virion as
compared to immunoreactivity of primate AAV-2; and [0033] (ii) a
heterologous nucleic acid molecule encoding a therapeutic protein
operably linked to control elements capable of directing the in
vivo transcription and translation of the protein;
[0034] (b) delivering the recombinant AAV virion to the cell or
tissue, whereby the protein is expressed at a level that provides a
therapeutic effect.
[0035] In certain embodiments, the cell or tissue is a muscle cell
or tissue, such as a muscle cell or tissue is derived from skeletal
muscle.
[0036] The recombinant AAV virion is delivered into said cell or
tissue in vivo or in vitro and can be delivered to the subject by
intramuscular injection, or into the bloodstream, such as
intravenously or intraarterially. In additional embodiments, the
recombinant AAV virion is delivered to the liver or to the
brain.
[0037] These and other embodiments of the subject invention will
readily occur to those of skill in the art in view of the
disclosure herein.
BRIEF DESCRIPTION OF THE FIGURES
[0038] FIG. 1 illustrates the location of an asymmetrical
structural unit (white triangle) of AAV-2 on the surface of the
entire virus (taken from FIG. 3a of Xie et al. Proc. Natl. Acad.
Sci. USA (2002) 99:10405-10410). There are 60 identical asymmetric
structural units per AAV virion. At least 145 amino acids out of a
total of 735 in each AAV-2 capsomere are exposed, to varying
degrees, on the surface.
[0039] FIG. 2 illustrates the location of some of the amino acids
that were mutated as described in the examples within an asymmetric
unit (black triangle) of the AAV-2 structure. The amino acids that
were mutated are shown as black space-filling models, while those
that were not mutated are shown as white stick models. The location
of major surface features (spike, cylinder, plateau, canyon) is
indicated and the approximate boundaries of these features are
shown by thin circular black lines. The "canyon" regions, predicted
to be relatively inaccessible to antibody binding, are located in
the areas between the spike, cylinder, and plateau. The numbers 2,
3 and 5 represent the 2-, 3-, and 5-fold axes of symmetry,
respectively.
[0040] FIG. 3 indicates the location of mutations that have
<10-fold effect on in vitro transduction. Mutations located at
black space-filling amino acids, <10% wild type transduction.
The numbers 2, 3 and 5 represent 2-, 3- and 5-fold axes of
symmetry, respectively.
[0041] FIG. 4 indicates the location of mutations that have
>10-fold effect on in vitro transduction. Mutations located at
black space-filling amino acids, <10% wild type transduction.
The numbers 2, 3 and 5 represent 2-, 3- and 5-fold axes of
symmetry, respectively. The approximate boundaries of two dead
zones spanning the 2-fold axis of symmetry is indicated.
[0042] FIG. 5 illustrates the location of some of the AAV-2 capsid
mutants defective in heparin binding. Black amino acids designate
heparin-defective mutants identified herein. Black amino acids
illustrated as space-filling models (347, 350, 356, 375, 395, 448,
451) are on the surface. Grey amino acids illustrated as
space-filling models (495, 592) are just under the surface. The
numbers 2, 3 and 5 represent the 2-, 3- and 5-fold axes of
symmetry, respectively. Mutants that have more than a 100-fold
effect on heparin binding are enclosed in circles.
[0043] FIG. 6 illustrates the location of some of the amino acids
(black space-filling model) on the surface of the AAV-2 capsid that
confer resistance to neutralization by a mouse monoclonal antibody
when they are individually mutated. The rectangular box represents
the approximate size of an antibody binding site (25 .ANG..times.35
.ANG.). The numbers 2, 3, and 5 represent the 2-, 3- and 5-fold
axes of symmetry, respectively.
[0044] FIG. 7 illustrates the location of some of the amino acids
(black space-filling model) on the surface of the AAV-2 capsid that
confer resistance to neutralization by multiple human antisera. The
rectangular box represents the approximate size of an antibody
binding site (25 .ANG..times.35 .ANG.). The numbers 2, 3, and 5
represent the 2-, 3- and 5-fold axes of symmetry, respectively.
[0045] FIG. 8 shows mouse monoclonal antibody titration properties
of four AAV-2 capsid mutants compared to AAV-2 with a wild-type
capsid.
[0046] FIG. 9 shows the amino acid sequence of an AAV-2 VP2 (SEQ ID
NO:12).
[0047] FIG. 10 shows the amino acid sequence of an AAV-2 VP1 (SEQ
ID NO:13).
[0048] FIG. 11 shows the relative positions of AAV-2 capsid
proteins VP1, VP2 and VP3. As shown in the figure, VP1, VP2 and VP3
share the same 533 C-terminal amino acids which make up VP3. As
shown in the figure, all capsid mutants described herein fall
within the shared area.
[0049] FIGS. 12A-12B show a comparison of the nucleotide sequence
encoding the AAV VP1 protein from a primate AAV-5 (SEQ ID NO:14)
and a caprine AAV (SEQ ID NO:15). Numbering is relative to the
AAV-5 full-length sequence.
[0050] FIG. 13 shows a comparison of the amino acid sequence of VP1
from a primate AAV-5 (SEQ ID NO:16) and a caprine AAV (SEQ ID
NO:17). Amino acid differences are shaded. Conservative changes are
shown in light grey; non-conservative changes are shown in dark
grey.
[0051] FIGS. 14A-14H show a comparison of the amino acid sequence
of VP1s from AAVs that are sensitive or resistant to antibody
neutralization as follows: primate AAV-2 (SEQ ID NO:13), primate
AAV-3B (SEQ ID NO:18), primate AAV-6 (SEQ ID NO:19), primate AAV-1
(SEQ ID NO:20), primate AAV-8 (SEQ ID NO:21), primate AAV-4 (SEQ ID
NO:22), primate AAV-5 (SEQ ID NO:16) and caprine (goat) AAV (SEQ ID
NO:17). Parvovirus line: *, conserved in almost all parvoviruses.
Neutralization line: #, location of single mutations in AAV-2
capsid identified as resistant to neutralization by human sera.
Accessibility line: B, amino acid is buried between the inside and
outside surface; I, amino acid is found on the inside surface; 0,
amino acid is found on the outside surface. Surface feature line:
C, cylinder; P, plateau; S, spike; Y, canyon. DNA line: B, possible
base contact; D, likely required for DNA binding but may not
directly contact DNA; P, possible phosphate contact; R, possible
ribose contact. Other line: A, location of single mutations that
decrease binding and neutralization by mouse monoclonal antibody
A20; H, heparin contact in AAV-2; M, possible Mg2+ contact; P,
phospholipase A2 domain.
[0052] FIG. 15 (SEQ ID NOS: 16 and 17) shows the positions of the
amino acid differences between AAV-5 and caprine AAV, relative to
the surface of the AAV capsid.
[0053] FIG. 16 shows the predicted location of the surface amino
acids that differ between AAV-5 and caprine AAV, based on the
surface structure of the AAV-2 capsid. The 3 filled triangles
represent insertions in caprine AAV, relative to AAV-2, that are
likely to be located on the surface.
[0054] FIG. 17 shows transduction of muscle in IVIG-treated SCID
mice following intramuscular administration of various rAAV hFIX
virions.
[0055] FIG. 18 shows transduction of liver in IVIG-treated SCID
mice following tail vein administration of various rAAV hFIX
virions.
[0056] FIG. 19 shows the biodistribution of human factor IX (hFIX)
follow intravenous administration of a recombinant caprine AAV
vector encoding the same.
[0057] FIGS. 20A (SEQ ID NO:25) and 20B (SEQ ID NO:26) show the
nucleotide sequence and amino acid sequence respectively, of a
bovine AAV VP1, from AAV-C1.
[0058] FIGS. 21A-21H show a comparison of the amino acid sequence
of VP1s from AAVs that are sensitive or resistant to antibody
neutralization as follows: primate AAV-2 (SEQ ID NO:13), primate
AAV-3B (SEQ ID NO:18), primate AAV-6 (SEQ ID NO:19), primate AAV-1
(SEQ ID NO:20), primate AAV-8 (SEQ ID NO:21), primate AAV-4 (SEQ ID
NO:22), bovine (cow) AAV ("AAV-C1" (SEQ ID NO:26), primate AAV-5
(SEQ ID NO:16) and caprine (goat) AAV ("AAV-C1" SEQ ID NO:17).
Parvovirus line: *, conserved in almost all parvoviruses.
Neutralization line: #, location of single mutations in AAV-2
capsid identified as resistant to neutralization by human sera.
Accessibility line: B, amino acid is buried between the inside and
outside surface; I, amino acid is found on the inside surface; O,
amino acid is found on the outside surface. Surface feature line:
C, cylinder; P, plateau; S, spike; Y, canyon. DNA line: B, possible
base contact; D, likely required for DNA binding but may not
directly contact DNA; P, possible phosphate contact; R, possible
ribose contact. Other line: A, location of single mutations that
decrease binding and neutralization by mouse monoclonal antibody
A20; H, heparin contact in AAV-2; M, possible Mg2+ contact; P,
phospholipase A2 domain.
DETAILED DESCRIPTION OF THE INVENTION
[0059] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of chemistry,
biochemistry, recombinant DNA techniques and immunology, within the
skill of the art. Such techniques are explained fully in the
literature. See, e.g., Fundamental Virology, 2nd Edition, vol. I
& II (B. N. Fields and D. M. Knipe, eds.); Handbook of
Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell
eds., Blackwell Scientific Publications); T. E. Creighton,
Proteins: Structures and Molecular Properties (W.H. Freeman and
Company, 1993); A. L. Lehninger, Biochemistry (Worth Publishers,
Inc., current addition); Sambrook, et al., Molecular Cloning: A
Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S.
Colowick and N. Kaplan eds., Academic Press, Inc.).
[0060] All publications, patents and patent applications cited
herein, whether supra or infra, are hereby incorporated by
reference in their entirety.
1. Definitions
[0061] In describing the present invention, the following terms
will be employed, and are intended to be defined as indicated
below.
[0062] It must be noted that, as used in this specification and the
appended claims, the singular forms "a", "an" and "the" include
plural referents unless the content clearly dictates otherwise.
Thus, for example, reference to "a polypeptide" includes a mixture
of two or more polypeptides, and the like.
[0063] The following amino acid abbreviations are used throughout
the text:
TABLE-US-00001 Alanine: Ala (A) Arginine: Arg (R) Asparagine: Asn
(N) Aspartic acid: Asp (D) Cysteine: Cys (C) Glutamine: Gln (Q)
Glutamic acid: Glu (E) Glycine: Gly (G) Histidine: His (H)
Isoleucine: Ile (I) Leucine: Leu (L) Lysine: Lys (K) Methionine:
Met (M) Phenylalanine: Phe (F) Proline: Pro (P) Serine: Ser (S)
Threonine: Thr (T) Tryptophan: Trp (W) Tyrosine: Tyr (Y) Valine:
Val (V)
[0064] By "vector" is meant any genetic element, such as a plasmid,
phage, transposon, cosmid, chromosome, virus, virion, etc., which
is capable of replication when associated with the proper control
elements and which can transfer gene sequences between cells. Thus,
the term includes cloning and expression vehicles, as well as viral
vectors.
[0065] By an "AAV vector" is meant a vector derived from any
adeno-associated virus serotype isolated from any animal species,
including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5,
AAV-6, AAV-7, AAV-8, AAV-G1 and AAV-C1. AAV vectors can have one or
more of the AAV wild-type genes deleted in whole or part,
preferably the rep and/or cap genes, but retain functional flanking
ITR sequences. Functional ITR sequences are necessary for the
rescue, replication and packaging of the AAV virion. Thus, an AAV
vector is defined herein to include at least those sequences
required in cis for replication and packaging (e.g., functional
ITRs) of the virus. The ITRs need not be the wild-type nucleotide
sequences, and may be altered, e.g., by the insertion, deletion or
substitution of nucleotides, so long as the sequences provide for
functional rescue, replication and packaging.
[0066] "AAV helper functions" refer to AAV-derived coding sequences
which can be expressed to provide AAV gene products that, in turn,
function in trans for productive AAV replication. Thus, AAV helper
functions include both of the major AAV open reading frames (ORFs),
rep and cap. The Rep expression products have been shown to possess
many functions, including, among others: recognition, binding and
nicking of the AAV origin of DNA replication; DNA helicase
activity; and modulation of transcription from AAV (or other
heterologous) promoters. The Cap expression products supply
necessary packaging functions. AAV helper functions are used herein
to complement AAV functions in trans that are missing from AAV
vectors.
[0067] The term "AAV helper construct" refers generally to a
nucleic acid molecule that includes nucleotide sequences providing
AAV functions deleted from an AAV vector which is to be used to
produce a transducing vector for delivery of a nucleotide sequence
of interest. AAV helper constructs are commonly used to provide
transient expression of AAV rep and/or cap genes to complement
missing AAV functions that are necessary for lytic AAV replication;
however, helper constructs lack AAV ITRs and can neither replicate
nor package themselves. AAV helper constructs can be in the form of
a plasmid, phage, transposon, cosmid, virus, or virion. A number of
AAV helper constructs and vectors that encode Rep and/or Cap
expression products have been described. See, e.g., U.S. Pat. Nos.
6,001,650, 5,139,941 and 6,376,237, all incorporated herein by
reference in their entireties; Samulski et al. (1989) J. Virol.
63:3822-3828; and McCarty et al. (1991) J. Virol. 65:2936-2945.
[0068] The term "accessory functions" refers to non-AAV derived
viral and/or cellular functions upon which AAV is dependent for its
replication. Thus, the term captures proteins and RNAs that are
required in AAV replication, including those moieties involved in
activation of AAV gene transcription, stage specific AAV mRNA
splicing, AAV DNA replication, synthesis of Cap expression products
and AAV capsid assembly. Viral-based accessory functions can be
derived from any of the known helper viruses such as adenovirus,
herpesvirus (other than herpes simplex virus type-1) and vaccinia
virus.
[0069] The term "accessory function vector" refers generally to a
nucleic acid molecule that includes nucleotide sequences providing
accessory functions. An accessory function vector can be
transfected into a suitable host cell, wherein the vector is then
capable of supporting AAV virion production in the host cell.
Expressly excluded from the term are infectious viral particles as
they exist in nature, such as adenovirus, herpesvirus or vaccinia
virus particles. Thus, accessory function vectors can be in the
form of a plasmid, phage, transposon or cosmid.
[0070] It has been demonstrated that the full-complement of
adenovirus genes are not required for accessory helper functions.
In particular, adenovirus mutants incapable of DNA replication and
late gene synthesis have been shown to be permissive for AAV
replication. Ito et al., (1970) J. Gen. Virol. 9:243; Ishibashi et
al, (1971) Virology 45:317. Similarly, mutants within the E2B and
E3 regions have been shown to support AAV replication, indicating
that the E2B and E3 regions are probably not involved in providing
accessory functions. Carter et al., (1983) Virology 126:505.
However, adenoviruses defective in the E1 region, or having a
deleted E4 region, are unable to support AAV replication. Thus, E1A
and E4 regions are likely required for AAV replication, either
directly or indirectly. Laughlin et al., (1982) J. Virol. 41:868;
Janik et al., (1981) Proc. Natl. Acad. Sci. USA 78:1925; Carter et
al., (1983) Virology 126:505. Other characterized Ad mutants
include: E1B (Laughlin et al. (1982), supra; Janik et al. (1981),
supra; Ostrove et al., (1980) Virology 104:502); E2A (Handa et al.,
(1975) J. Gen. Virol. 29:239; Strauss et al., (1976) J. Virol.
17:140; Myers et al., (1980) J. Virol. 35:665; Jay et al., (1981)
Proc. Natl. Acad. Sci. USA 78:2927; Myers et al., (1981) J. Biol.
Chem. 256:567); E2B (Carter, Adeno-Associated Virus Helper
Functions, in I CRC Handbook of Parvoviruses (P. Tijssen ed.,
1990)); E3 (Carter et al. (1983), supra); and E4 (Carter et al.
(1983), supra; Carter (1995)). Although studies of the accessory
functions provided by adenoviruses having mutations in the E1B
coding region have produced conflicting results, Samulski et al.,
(1988) J. Virol. 62:206-210, recently reported that E1B55k is
required for AAV virion production, while E1B19k is not. In
addition, International Publication WO 97/17458 and Matshushita et
al., (1998) Gene Therapy 5:938-945, describe accessory function
vectors encoding various Ad genes. Particularly preferred accessory
function vectors comprise an adenovirus VA RNA coding region, an
adenovirus E4 ORF6 coding region, an adenovirus E2A 72 kD coding
region, an adenovirus E1A coding region, and an adenovirus E1B
region lacking an intact E1B55k coding region. Such vectors are
described in International Publication No. WO 01/83797.
[0071] By "recombinant virus" is meant a virus that has been
genetically altered, e.g., by the addition or insertion of a
heterologous nucleic acid construct into the particle.
[0072] By "AAV virion" is meant a complete virus particle, such as
a wild-type (wt) AAV virus particle (comprising a linear,
single-stranded AAV nucleic acid genome associated with an AAV
capsid protein coat). In this regard, single-stranded AAV nucleic
acid molecules of either complementary sense, e.g., "sense" or
"antisense" strands, can be packaged into any one AAV virion and
both strands are equally infectious.
[0073] A "recombinant AAV virion," or "rAAV virion" is defined
herein as an infectious, replication-defective virus including an
AAV protein shell, encapsidating a heterologous nucleotide sequence
of interest which is flanked on both sides by AAV ITRs. A rAAV
virion is produced in a suitable host cell which has had an AAV
vector, AAV helper functions and accessory functions introduced
therein. In this manner, the host cell is rendered capable of
encoding AAV polypeptides that are required for packaging the AAV
vector (containing a recombinant nucleotide sequence of interest)
into infectious recombinant virion particles for subsequent gene
delivery.
[0074] A "caprine recombinant AAV virion" or "caprine rAAV virion"
is a rAAV virion as described above that has been produced using
AAV helper functions that include a gene encoding a caprine capsid
protein, such as caprine VP1.
[0075] A "bovine recombinant AAV virion" or "bovine rAAV virion" is
a rAAV virion as described above that has been produced using AAV
helper functions that include a gene encoding a bovine capsid
protein, such as a bovine VP1.
[0076] The term "transfection" is used to refer to the uptake of
foreign DNA by a cell, and a cell has been "transfected" when
exogenous DNA has been introduced inside the cell membrane. A
number of transfection techniques are generally known in the art.
See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al.
(1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor
Laboratories, New York, Davis et al. (1986) Basic Methods in
Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197.
Such techniques can be used to introduce one or more exogenous DNA
moieties, such as a nucleotide integration vector and other nucleic
acid molecules, into suitable host cells.
[0077] The term "host cell" denotes, for example, microorganisms,
yeast cells, insect cells, and mammalian cells, that can be, or
have been, used as recipients of an AAV helper construct, an AAV
vector plasmid, an accessory function vector, or other transfer
DNA. The term includes the progeny of the original cell which has
been transfected. Thus, a "host cell" as used herein generally
refers to a cell which has been transfected with an exogenous DNA
sequence. It is understood that the progeny of a single parental
cell may not necessarily be completely identical in morphology or
in genomic or total DNA complement as the original parent, due to
natural, accidental, or deliberate mutation.
[0078] As used herein, the term "cell line" refers to a population
of cells capable of continuous or prolonged growth and division in
vitro. Often, cell lines are clonal populations derived from a
single progenitor cell. It is further known in the art that
spontaneous or induced changes can occur in karyotype during
storage or transfer of such clonal populations. Therefore, cells
derived from the cell line referred to may not be precisely
identical to the ancestral cells or cultures, and the cell line
referred to includes such variants.
[0079] "Homology" refers to the percent identity between two
polynucleotide or two polypeptide moieties. Two DNA, or two
polypeptide sequences are "substantially homologous" to each other
when the sequences exhibit at least about 50%, preferably at least
about 75%, more preferably at least about 80%-85%, preferably at
least about 90%, and most preferably at least about 95%-98%
sequence identity over a defined length of the molecules. As used
herein, substantially homologous also refers to sequences showing
complete identity to the specified DNA or polypeptide sequence.
[0080] In general, "identity" refers to an exact
nucleotide-to-nucleotide or amino acid-to-amino acid correspondence
of two polynucleotides or polypeptide sequences, respectively.
Percent identity can be determined by a direct comparison of the
sequence information between two molecules by aligning the
sequences, counting the exact number of matches between the two
aligned sequences, dividing by the length of the shorter sequence,
and multiplying the result by 100. Readily available computer
programs can be used to aid in the analysis, such as ALIGN,
Dayhoff, M. O. in Atlas of Protein Sequence and Structure M. O.
Dayhoff ed., 5 Suppl. 3:353-358, National Biomedical Research
Foundation, Washington, D.C., which adapts the local homology
algorithm of Smith and Waterman Advances in Appl. Math. 2:482-489,
1981 for peptide analysis. Programs for determining nucleotide
sequence identity are available in the Wisconsin Sequence Analysis
Package, Version 8 (available from Genetics Computer Group,
Madison, Wis.) for example, the BESTFIT, FASTA and GAP programs,
which also rely on the Smith and Waterman algorithm. These programs
are readily utilized with the default parameters recommended by the
manufacturer and described in the Wisconsin Sequence Analysis
Package referred to above. For example, percent identity of a
particular nucleotide sequence to a reference sequence can be
determined using the homology algorithm of Smith and Waterman with
a default scoring table and a gap penalty of six nucleotide
positions.
[0081] Another method of establishing percent identity in the
context of the present invention is to use the MPSRCH package of
programs copyrighted by the University of Edinburgh, developed by
John F. Collins and Shane S. Sturrok, and distributed by
IntelliGenetics, Inc. (Mountain View, Calif.). From this suite of
packages the Smith-Waterman algorithm can be employed where default
parameters are used for the scoring table (for example, gap open
penalty of 12, gap extension penalty of one, and a gap of six).
From the data generated the "Match" value reflects "sequence
identity." Other suitable programs for calculating the percent
identity or similarity between sequences are generally known in the
art, for example, another alignment program is BLAST, used with
default parameters. For example, BLASTN and BLASTP can be used
using the following default parameters: genetic code=standard;
filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62;
Descriptions=50 sequences; sort by=HIGH SCORE;
Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS
translations+Swiss protein+Spupdate+PIR. Details of these programs
are well known in the art.
[0082] Alternatively, homology can be determined by hybridization
of polynucleotides under conditions which form stable duplexes
between homologous regions, followed by digestion with
single-stranded-specific nuclease(s), and size determination of the
digested fragments. DNA sequences that are substantially homologous
can be identified in a Southern hybridization experiment under, for
example, stringent conditions, as defined for that particular
system. Defining appropriate hybridization conditions is within the
skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning,
supra; Nucleic Acid Hybridization, supra.
[0083] By the term "degenerate variant" is intended a
polynucleotide containing changes in the nucleic acid sequence
thereof, that encodes a polypeptide having the same amino acid
sequence as the polypeptide encoded by the polynucleotide from
which the degenerate variant is derived.
[0084] A "coding sequence" or a sequence which "encodes" a selected
polypeptide, is a nucleic acid molecule which is transcribed (in
the case of DNA) and translated (in the case of mRNA) into a
polypeptide in vivo when placed under the control of appropriate
regulatory sequences. The boundaries of the coding sequence are
determined by a start codon at the 5' (amino) terminus and a
translation stop codon at the 3' (carboxy) terminus. A
transcription termination sequence may be located 3' to the coding
sequence.
[0085] The term "heterologous" as it relates to nucleic acid
sequences such as coding sequences and control sequences, denotes
sequences that are not normally joined together, and/or are not
normally associated with a particular cell. Thus, a "heterologous"
region of a nucleic acid construct or a vector is a segment of
nucleic acid within or attached to another nucleic acid molecule
that is not found in association with the other molecule in nature.
For example, a heterologous region of a nucleic acid construct
could include a coding sequence flanked by sequences not found in
association with the coding sequence in nature. Another example of
a heterologous coding sequence is a construct where the coding
sequence itself is not found in nature (e.g., synthetic sequences
having codons different from the native gene). Similarly, a cell
transformed with a construct which is not normally present in the
cell would be considered heterologous for purposes of this
invention. Allelic variation or naturally occurring mutational
events do not give rise to heterologous DNA, as used herein.
[0086] A "nucleic acid" sequence refers to a DNA or RNA sequence.
The term captures sequences that include any of the known base
analogues of DNA and RNA such as, but not limited to
4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine,
pseudoisocytosine, 5-(carboxyhydroxyl-methyl) uracil,
5-fluorouracil, 5-bromouracil,
5-carboxymethylaminomethyl-2-thiouracil,
5-carboxymethyl-aminomethyluracil, dihydrouracil, inosine,
N6-isopentenyladenine, 1-methyladenine, 1-methylpseudo-uracil,
1-methylguanine, 1-methylinosine, 2,2-dimethyl-guanine,
2-methyladenine, 2-methylguanine, 3-methyl-cytosine,
5-methylcytosine, N6-methyladenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxy-amino-methyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
oxybutoxosine, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
[0087] The term DNA "control sequences" refers collectively to
promoter sequences, polyadenylation signals, transcription
termination sequences, upstream regulatory domains, origins of
replication, internal ribosome entry sites ("IRES"), enhancers, and
the like, which collectively provide for the replication,
transcription and translation of a coding sequence in a recipient
cell. Not all of these control sequences need always be present so
long as the selected coding sequence is capable of being
replicated, transcribed and translated in an appropriate host
cell.
[0088] The term "promoter" is used herein in its ordinary sense to
refer to a nucleotide region comprising a DNA regulatory sequence,
wherein the regulatory sequence is derived from a gene which is
capable of binding RNA polymerase and initiating transcription of a
downstream (3'-direction) coding sequence. Transcription promoters
can include "inducible promoters" (where expression of a
polynucleotide sequence operably linked to the promoter is induced
by an analyte, cofactor, regulatory protein, etc.), "repressible
promoters" (where expression of a polynucleotide sequence operably
linked to the promoter is induced by an analyte, cofactor,
regulatory protein, etc.), and "constitutive promoters".
[0089] "Operably linked" refers to an arrangement of elements
wherein the components so described are configured so as to perform
their usual function. Thus, control sequences operably linked to a
coding sequence are capable of effecting the expression of the
coding sequence. The control sequences need not be contiguous with
the coding sequence, so long as they function to direct the
expression thereof. Thus, for example, intervening untranslated yet
transcribed sequences can be present between a promoter sequence
and the coding sequence and the promoter sequence can still be
considered "operably linked" to the coding sequence.
[0090] By "isolated" when referring to a nucleotide sequence, is
meant that the indicated molecule is present in the substantial
absence of other biological macromolecules of the same type. Thus,
an "isolated nucleic acid molecule which encodes a particular
polypeptide" refers to a nucleic acid molecule which is
substantially free of other nucleic acid molecules that do not
encode the subject polypeptide; however, the molecule may include
some additional bases or moieties which do not deleteriously affect
the basic characteristics of the composition.
[0091] For the purpose of describing the relative position of
nucleotide sequences in a particular nucleic acid molecule
throughout the instant application, such as when a particular
nucleotide sequence is described as being situated "upstream,"
"downstream," "3 prime (3')" or "5 prime (5')" relative to another
sequence, it is to be understood that it is the position of the
sequences in the "sense" or "coding" strand of a DNA molecule that
is being referred to as is conventional in the art.
[0092] A "functional homologue," or a "functional equivalent" of a
given AAV polypeptide includes molecules derived from the native
polypeptide sequence, as well as recombinantly produced or
chemically synthesized polypeptides which function in a manner
similar to the reference AAV molecule to achieve a desired result.
Thus, a functional homologue of AAV Rep68 or Rep78 encompasses
derivatives and analogues of those polypeptides--including any
single or multiple amino acid additions, substitutions and/or
deletions occurring internally or at the amino or carboxy termini
thereof--so long as integration activity remains.
[0093] By "capable of efficient transduction" is meant that the
mutated constructs of the invention provide for rAAV vectors or
virions that retain the ability to transfect cells in vitro and/or
in vivo at a level that is within 1-10% of the transfection
efficiency obtained using the corresponding wild-type sequence.
Preferably, the mutant retains the ability to transfect cells or
tissues at a level that is within 10-100% of the corresponding
wild-type sequence. The mutated sequence may even provide for a
construct with enhanced ability to transfect cells and tissues.
Transduction efficiency is readily determined using techniques well
known in the art, including the in vitro transduction assay
described in the Examples.
[0094] By "reduced immunoreactivity" is meant that the mutated AAV
construct reacts with anti-AAV antibodies at a reduced level as
compared to the corresponding wild-type AAV construct. The term
"antibody" as used herein includes antibodies obtained from both
polyclonal and monoclonal preparations, as well as, the following:
hybrid (chimeric) antibody molecules (see, for example, Winter et
al. (1991) Nature 349:293-299; and U.S. Pat. No. 4,816,567);
F(ab')2 and F(ab) fragments; Fv molecules (non-covalent
heterodimers, see, for example, Inbar et al. (1972) Proc Natl Acad
Sci USA 69:2659-2662; and Ehrlich et al. (1980) Biochem
19:4091-4096); single-chain Fv molecules (sFv) (see, for example,
Huston et al. (1988) Proc Natl Acad Sci USA 85:5879-5883); dimeric
and trimeric antibody fragment constructs; minibodies (see, e.g.,
Pack et al. (1992) Biochem 31:1579-1584; Cumber et al. (1992) J
Immunology 149B:120-126); humanized antibody molecules (see, for
example, Riechmann et al. (1988) Nature 332:323-327; Verhoeyan et
al. (1988) Science 239:1534-1536; and U.K. Patent Publication No.
GB 2,276,169, published 21 Sep. 1994); and, any functional
fragments obtained from such molecules, wherein such fragments
retain immunological binding properties of the parent antibody
molecule.
[0095] The mutated constructs of the present invention can have
reduced immunoreactivity as determined using in vitro and/or in
vivo assays using any of the above types of antibodies that have
been generated against the corresponding wild-type AAV construct.
Preferably, the mutated AAV construct will react with such
antibodies at a level at least 1.5 times lower than the
corresponding wild-type construct, preferably at a level at least 2
times lower, such as at least 5-10 times lower, even at a level at
least 50-100 times or at least 1000 times lower than the
corresponding wild-type construct.
[0096] Preferably, the mutated AAV construct reacts at a reduced
level with anti-AAV neutralizing antibodies. For example, the
mutated constructs will preferably be at least 1.5 times more
neutralization-resistant than the corresponding wild-type,
preferably at least 2 times more neutralization-resistant, even
more preferably at least 5-10 times or more, such as at least
50-100 times or more neutralization-resistant than the
corresponding wild-type, as determined using standard assays, such
as the in vitro neutralization assays described herein
[0097] The terms "subject", "individual" or "patient" are used
interchangeably herein and refer to a vertebrate, preferably a
mammal. Mammals include, but are not limited to, murines, rodents,
simians, humans, farm animals, sport animals and pets.
[0098] The terms "effective amount" or "therapeutically effective
amount" of a composition or agent, as provided herein, refer to a
nontoxic but sufficient amount of the composition or agent to
provide the desired response. The exact amount required will vary
from subject to subject, depending on the species, age, and general
condition of the subject, the severity of the condition being
treated, and the particular macromolecule of interest, mode of
administration, and the like. An appropriate "effective" amount in
any individual case may be determined by one of ordinary skill in
the art using routine experimentation.
[0099] "Treating" or "treatment" of a disease includes: (1)
preventing the disease, i.e. causing the clinical symptoms of the
disease not to develop in a subject that may be exposed to or
predisposed to the disease but does not yet experience or display
symptoms of the disease, (2) inhibiting the disease, i.e.,
arresting the development of the disease or its clinical symptoms,
or (3) relieving the disease, i.e., causing regression of the
disease or its clinical symptoms.
2. Modes of Carrying Out the Invention
[0100] Before describing the present invention in detail, it is to
be understood that this invention is not limited to particular
formulations or process parameters as such may, of course, vary. It
is also to be understood that the terminology used herein is for
the purpose of describing particular embodiments of the invention
only, and is not intended to be limiting.
[0101] Although a number of methods and materials similar or
equivalent to those described herein can be used in the practice of
the present invention, the preferred materials and methods are
described herein.
[0102] Central to the present invention is the discovery of novel
mutant AAV sequences useful in the production of rAAV virions that
display reduced immunoreactivity as compared to the corresponding
wild-type virions. Furthermore, the mutants preferably retain other
properties of the corresponding wild-type, such as DNA packaging,
receptor binding, chromatographic purification, and the ability to
transduce cells in vitro and in vivo. Preferably, such properties
are within at least 1-10% of the values measured for the
corresponding AAV wild-type. More preferably such properties are
within 10-100% of the values measured for the corresponding AAV
wild-type. Most preferably such properties are at least 100% or
more of the values measured for the corresponding AAV wild-type.
Thus, for example, if the mutation is in an AAV-2 capsid sequence,
the comparison of these attributes would be between an AAV-2 virion
with the mutated capsid sequence versus an AAV-2 virion with the
same components as the mutated virion except with the AAV-2
wild-type capsid protein sequence.
[0103] As explained above, the AAV mutants of the subject invention
preferably display decreased immunoreactivity relative to
neutralizing antibodies that may be present in the host to which
the mutant virions are administered. In this way, cells and tissues
of subjects that have either been naturally infected with AAV
(i.e., due to previous natural infection) or artificially infected
with AAV (i.e., due to previous gene therapy or nucleic acid
immunization) may be more efficiently transfected with recombinant
AAV virions in order to treat or prevent new or on-going
disease.
[0104] A well-studied mechanism for neutralization is that a
neutralizing antibody physically blocks a region on the virus
required to bind to receptors that are required for infection.
Previous studies with other viruses have shown that the receptors
and neutralizing antibodies bind to a distinct set of amino acids
and that it is possible to identify mutants at particular positions
on viral capsids that affect the binding of neutralizing
antibodies, but not receptors or other functions needed for viral
infection. Experiments in which wild-type replicating viruses are
selected to be resistant to neutralizing antibodies have shown that
mutations, even in single amino acids, such as those described
here, can result in significant increases in resistance to antibody
neutralization.
[0105] The ability or inability of an AAV mutant virion to bind AAV
antisera is partially a function of the sequence of the capsid
proteins (encoded by AAV cap gene). Thus, the invention
contemplates single, double, triple, quadruple and more amino acid
changes made on the surface of the AAV virion, as well as deletions
and/or insertions, in order to decrease immunoreactivity, e.g., to
alter the ability of the AAV virion to bind AAV antisera. Such
mutants may be assessed for resistance to neutralization and, if
necessary, more drastic or multiple changes can be made.
[0106] Methods of identifying portions of the AAV virion amenable
to mutation with a resulting functional rAAV virion are described
in the examples below. As detailed therein, mutations to amino
acids on the viral surface, such as mutations to protruding
features of the capsid, including portions of the capsid known as
the "spike," "cylinder" and "plateau" are preferred. Mutations are
preferably to the VP2 region, more preferably to the VP3 region,
and in particular, within the region of overlap between VP1, VP2
and VP3 as shown in FIG. 11. Particularly preferred mutations are
found within positions 80-598 of VP2 (corresponding to amino acids
217-735 of VP1 and amino acids 15-533 of VP3).
[0107] The sequence of a representative VP2 is shown in FIG. 9
herein (SEQ ID NO:12). The major coat protein, VP3 spans amino
acids 203-735 of VP1. The mutation comprises at least one amino
acid substitution, deletion or insertion to the native protein.
Representative mutations include one or more substitutions of the
amino acids occurring at a position corresponding to a position of
the AAV-2 VP2 capsid protein selected from the group consisting of
amino acids 126, 127, 128, 130, 132, 134, 247, 248, 315, 334, 354,
357, 360, 361, 365, 372, 375, 377, 390, 393, 394, 395, 396, 407,
411, 413, 418, 437, 449, 450, 568, 569, and 571.
[0108] Generally, the naturally occurring amino acid is substituted
with an amino acid that has a small side-chain and/or is uncharged
and is therefore less immunogenic. Such amino acids include,
without limitation, alanine, valine, glycine, serine, cysteine,
proline, as well as analogs thereof, with alanine preferred.
Moreover, additional mutations can be present. Representative
combinations include any combination of the amino acids identified
immediately above, such as but not limited to a mutation of amino
acid 360 to histidine and amino acid 361 to alanine; amino acid 334
to alanine and amino acid 449 to alanine; amino acid 334 to alanine
and amino acid 568 to alanine, amino acid 568 to alanine and amino
acid 571 to alanine; amino acid 334 to alanine, amino acid 449 to
alanine and amino acid 568 to alanine; amino acid 571 to lysine and
any of the amino acids specified above. The above combinations are
merely illustrative and of course numerous other combinations are
readily determined based on the information provided herein.
[0109] As described further in the examples, certain amino acids in
the capsid are adjacent to the heparin-binding site. This region is
termed the "dead zone" or "DZ" herein and includes amino acids
G128, N131, D132, H134, N245, N246, D356, D357, H372, G375, D391,
D392, E393 and E394. Amino acids in the dead zone are important for
function of AAV and are thus also targets for the binding of
neutralizing antibodies. As this region is important for AAV
function, conservative amino acid substitutions, such as Q for H, D
for E, E or N for D, and the like, are preferred in the dead zone
region and result in a more functional dead zone mutant.
[0110] The various amino acid positions occurring in the capsid
protein are numbered herein with reference to the AAV-2 VP2
sequence described in NCBI Accession No. AF043303 and shown in FIG.
9 herein. FIG. 10 shows the amino acid sequence of AAV-2 VP1.
However, it is to be understood that mutations of amino acids
occurring at corresponding positions in any of the AAV serotypes
are encompassed by the present invention. The sequences for the
capsid from various AAV serotypes isolated from multiple species
are known and described in, e.g., Gao et al. (2002) Proc. Natl.
Acad. Sci. USA 99:11854-11859; Rutledge et al. (1998) J. Virol.
72:309-319; NCBI Accession Nos. NC001863; NC004828; NC001862;
NC002077; NC001829; NC001729; U89790; U48704; AF369963; AF028705;
AF028705; AF028704; AF513852; AF513851; AF063497; AF085716;
AF43303; Y18065; AY186198; AY243026; AY243025; AY243024; AY243023;
AY243022; AY243021; AY243020; AY243019; AY243018; AY243017;
AY243016; AY243015; AY243014; AY243013; AY243012; AY243011;
AY243010; AY243009; AY243008; AY243007; AY243006; AY243005;
AY243004; AY243003; AY243002; AY243001; AY243000; AY242999;
AY242998; and AY242997, all of which are incorporated herein in
their entireties.
[0111] Moreover, the inventors herein have discovered a new caprine
AAV, isolated from goat, termed "AAV-G1" herein. The caprine AAV
VP1 sequence is highly homologous to the VP1 sequence of AAV-5, but
is approximately 100 times more resistant to neutralization by
existing AAV antibodies than the native AAV-5 sequence. More
particularly, a 2805 bp PCR fragment of the caprine AAV described
herein, encoding 603 bp of rep, the central intron, and all of cap,
shows 94% homology to the corresponding AAV-5 sequence. The DNA and
protein homologies for the partial rep are 98% and 99%,
respectively. A comparison of the caprine VP1 coding sequence with
a primate AAV-5 VP1 coding sequence is shown in FIGS. 12A-12B. The
DNA for the cap region of the caprine AAV is 93% homologous to that
of AAV-5. The amino acid sequences for the caprine VP1 versus a
primate AAV-5 is shown in FIG. 13. The caprine sequence encodes a
VP1 protein of 726 amino acids, while AAV-5 VP1 is 724 amino acids
in length. Additionally, the sequences display 94% sequence
identity and 96% sequence similarity. There are 43 amino acid
differences between the caprine and the primate AAV-5 VP1 sequence.
With respect to the linear amino acid sequence of VP1, the
distribution of the amino acid differences between AAV-5 and
caprine AAV is highly polar. All of the amino acid differences
occur exclusively in the C-terminal hypervariable region of VP1 in
a scattered fashion. This region relative to AAV-5 and caprine
includes approximately 348 amino acids from amino acid 386 to the
C-terminus, numbered relative to AAV-5 VP1. The corresponding
hypervariable regions in other AAV serotypes are readily
identifiable and the region from a number of AAV serotypes is shown
in the figures herein.
[0112] Without being bound by a particular theory, the fact that
all of the amino acid differences in VP1 of AAV-5 and caprine AAV
occur in regions that are probably surface exposed, implies that
capsid evolution is being driven primarily by the humoral immune
system of the new host and/or by adaptation to ruminant
receptors.
[0113] A comparison of the VP1 sequence from caprine AAV with a
number of other primate VP1 sequences, including AAV-1, AAV-2,
AAV-3B, AAV-4, AAV-6, AAV-8 and AAV-5, is shown in FIGS. 14A-14H.
The accessibility of the various amino acid positions based on the
crystal structure is also shown in the figures. Moreover, the
surface features of the amino acids, the location of single
mutations that decrease binding and neutralization; the heparin
binding sites; possible Mg2+ contact; the phospholipase A2 domain;
as well as positions likely for base contact and DNA binding,
possible phosphate and ribose contact are also shown. As can be
seen in the figure, AAV-5 and caprine AAV are identical to each
other at 17 positions that differ in both AAV-2 and AAV-8.
[0114] Similarly, the inventors herein have discovered a new bovine
AAV, isolated from cow, termed "AAV-C1" herein. The AAV-C1 VP1
nucleotide and amino acid sequences are shown in FIGS. 20A and 20B,
respectively. FIGS. 21A-21H show a comparison of the amino acid
sequence of VP1 from AAV-C1 with primate AAV-1, AAV-2, AAV-3B,
AAV-4, AAV-6, AAV-8, AAV-5 and caprine AAV (AAV-G1). The
accessibility of the various amino acid positions based on the
crystal structure is also shown in the figures. Moreover, the
surface features of the amino acids, the location of single
mutations that decrease binding and neutralization; the heparin
binding sites; possible Mg2+ contact; the phospholipase A2 domain;
as well as positions likely for base contact and DNA binding,
possible phosphate and ribose contact are also shown.
[0115] As can be seen in the figure, VP1 from AAV-C1 shows
approximately 76% identity with AAV-4. The sequence differences
between AAV-4 and AAV-C1 are scattered throughout the capsid.
AAV-C1 VP1 displays approximately 54% identity with AAV-5 VP1, with
high homology in the Rep protein, the first 137 amino acids of
AAV-5 VP1 and the non translated region after the stop of AAV-5 VP1
(not shown). Thus, AAV-C1 appears to be a natural hybrid between
AAV-5 and AAV-4. AAV-C1 also displayed approximately 58% sequence
identity with VP1s from AAV-2 and AAV-8, approximately 59% sequence
identity with VP1s from AAV-1 and AAV-6, and approximately 60%
sequence identity with VP1 from AAV-3B.
[0116] As described in more detail in the examples, the bovine AAV
is approximately 16 times more resistant to neutralization by
existing AAV antibodies than the native AAV-2 sequence. Thus, the
caprine and bovine sequences, and other such non-primate mammalian
sequences, can be used to produce recombinant AAV virions with
decreased immunoreactivity relative to primate AAV sequences, such
as relative to AAV-2 and AAV-5. Additionally, regions of AAV
capsids that can be mutated to provide AAV virions with reduced
immunoreactivity from non-caprine and non-bovine AAV isolates and
strains, such as any of the AAV serotypes, can be reasonably
predicted based on the caprine and bovine AAV sequences provided
herein and a comparison of these sequences and immunoreactive
properties with those of other isolates and serotypes.
[0117] Based on the above discussion, and the examples provided
herein, one of skill in the art can reasonably predict mutations
that can be made to wild-type AAV sequences in order to generate
AAV virions with decreased immunoreactivity. Amino acid changes to
amino acids found on the AAV capsid surface, and especially those
in the hypervariable region, are expected to provide AAV virions
with decreased immunoreactivity. Moreover, based on the knowledge
provided by the caprine and bovine AAV sequences, other non-primate
mammalian AAVs can be identified to provide non-mutated AAV
sequences for use in preparing recombinant AAV virions with
decreased immunoreactivity relative to primate AAVs, such as AAV-2
and AAV-5. For example, as shown in the examples below, positions
in AAV-2 mutants that correlate to neutralization resistance and
that are in common between the AAV-2 mutants and caprine AAV
include changes to positions 248, 354, 360, 390, 407, 413 and 449
of AAV-2.
[0118] The AAV mutants of the present invention can be generated by
site-directed mutagenesis of the AAV cap gene region. The mutated
cap region can then be cloned into a suitable helper function
vector, and rAAV virions generated using the mutated helper
function vector and any suitable transfection method, including the
triple transfection method described herein. Mutants suitable for
use with the present invention are identified by their reduced
immunoreactivity, as defined above. Preferably, the mutants of the
present invention have a reduced ability to be neutralized by
anti-AAV antisera, preferably anti-AAV-2 antisera, while
maintaining other biological functions such as the ability to
assemble intact virions, package viral DNA, bind cellular
receptors, and transduce cells.
[0119] Thus, the present invention involves the identification and
use of mutated AAV sequences, as well as wild-type non-primate
mammalian AAV sequences, displaying decreased immunoreactivity for
incorporation into rAAV virions. Such rAAV virions can be used to
deliver a "heterologous nucleic acid" (an "HNA") to a vertebrate
subject, such as a mammal. As explained above, a "recombinant AAV
virion" or "rAAV virion" is an infectious virus composed of an AAV
protein shell (i.e., a capsid) encapsulating a "recombinant AAV
(rAAV) vector," the rAAV vector comprising the HNA and one or more
AAV inverted terminal repeats (ITRs). AAV vectors can be
constructed using recombinant techniques that are known in the art
and include one or more HNAs flanked by functional ITRs. The ITRs
of the rAAV vector need not be the wild-type nucleotide sequences,
and may be altered, e.g., by the insertion, deletion, or
substitution of nucleotides, so long as the sequences provide for
proper function, i.e., rescue, replication, and packaging of the
AAV genome.
[0120] Recombinant AAV virions may be produced using a variety of
techniques known in the art, including the triple transfection
method (described in detail in U.S. Pat. No. 6,001,650, the
entirety of which is incorporated herein by reference). This system
involves the use of three vectors for rAAV virion production,
including an AAV helper function vector, an accessory function
vector, and a rAAV vector that contains the HNA. One of skill in
the art will appreciate, however, that the nucleic acid sequences
encoded by these vectors can be provided on two or more vectors in
various combinations. As used herein, the term "vector" includes
any genetic element, such as a plasmid, phage, transposon, cosmid,
chromosome, artificial chromosome, virus, virion, etc., which is
capable of replication when associated with the proper control
elements and which can transfer gene sequences between cells. Thus,
the term includes cloning and expression vehicles, as well as viral
vectors.
[0121] The AAV helper function vector encodes the "AAV helper
function" sequences (i.e., rep and cap), which function in trans
for productive AAV replication and encapsidation. Preferably, the
AAV helper function vector supports efficient AAV vector production
without generating any detectable wild-type AAV virions (i.e., AAV
virions containing functional rep and cap genes). Examples of
vectors suitable for use with the present invention include pHLP19,
described in U.S. Pat. No. 6,001,650 and pRep6cap6 vector,
described in U.S. Pat. No. 6,156,303, the entirety of both
incorporated by reference herein.
[0122] The accessory function vector encodes nucleotide sequences
for non-AAV derived viral and/or cellular functions upon which AAV
is dependent for replication (i.e., "accessory functions"). The
accessory functions include those functions required for AAV
replication, including, without limitation, those moieties involved
in activation of AAV gene transcription, stage specific AAV mRNA
splicing, AAV DNA replication, synthesis of cap expression
products, and AAV capsid assembly. Viral-based accessory functions
can be derived from any of the known helper viruses such as
adenovirus, herpesvirus (other than herpes simplex virus type-1),
and vaccinia virus. In a preferred embodiment, the accessory
function plasmid pladeno5 is used (details regarding pLadeno5 are
described in U.S. Pat. No. 6,004,797, the entirety of which is
hereby incorporated by reference). This plasmid provides a complete
set of adenovirus accessory functions for AAV vector production,
but lacks the components necessary to form replication-competent
adenovirus.
[0123] The rAAV vector containing the heterologous nucleic acid
(HNA) may be constructed using ITRs from any of the various AAV
serotypes. The HNA comprises nucleic acid sequences joined together
that are otherwise not found together in nature, this concept
defining the term "heterologous." To illustrate the point, an
example of an HNA is a gene flanked by nucleotide sequences not
found in association with that gene in nature. Another example of
an HNA is a gene that itself is not found in nature (e.g.,
synthetic sequences having codons different from the native gene).
Allelic variation or naturally occurring mutational events do not
give rise to HNAs, as used herein. An HNA can comprise an
anti-sense RNA molecule, a ribozyme, or a gene encoding a
polypeptide.
[0124] The HNA is operably linked to a heterologous promoter
(constitutive, cell-specific, or inducible) such that the HNA is
capable of being expressed in the patient's target cells under
appropriate or desirable conditions. Numerous examples of
constitutive, cell-specific, and inducible promoters are known in
the art, and one of skill could readily select a promoter for a
specific intended use, e.g., the selection of the muscle-specific
skeletal .alpha.-actin promoter or the muscle-specific creatine
kinase promoter/enhancer for muscle cell-specific expression, the
selection of the constitutive CMV promoter for strong levels of
continuous or near-continuous expression, or the selection of the
inducible ecdysone promoter for induced expression. Induced
expression allows the skilled artisan to control the amount of
protein that is synthesized. In this manner, it is possible to vary
the concentration of therapeutic product. Other examples of well
known inducible promoters are: steroid promoters (e.g., estrogen
and androgen promoters) and metallothionein promoters.
[0125] The invention includes novel mutant virions comprising HNAs
coding for one or more anti-sense RNA molecules, the rAAV virions
preferably administered to one or more muscle cells or tissue of a
mammal. Antisense RNA molecules suitable for use with the present
invention in cancer anti-sense therapy or treatment of viral
diseases have been described in the art. See, e.g., Han et al.,
(1991) Proc. Natl. Acad. Sci. USA 88:4313-4317; Uhlmann et al.,
(1990) Chem. Rev. 90:543-584; Helene et al., (1990) Biochim.
Biophys. Acta. 1049:99-125; Agarawal et al., (1988) Proc. Natl.
Acad. Sci. USA 85:7079-7083; and Heikkila et al., (1987) Nature
328:445-449. The invention also encompasses the delivery of
ribozymes using the methods disclosed herein. For a discussion of
suitable ribozymes, see, e.g., Cech et al., (1992) J. Biol. Chem.
267:17479-17482 and U.S. Pat. No. 5,225,347.
[0126] The invention preferably encompasses mutant rAAV virions
comprising HNAs coding for one or more polypeptides, the rAAV
virions preferably administered to one or more cells or tissue of a
mammal. Thus, the invention embraces the delivery of HNAs encoding
one or more peptides, polypeptides, or proteins, which are useful
for the treatment or prevention of disease states in a mammalian
subject. Such DNA and associated disease states include, but are
not limited to: DNA encoding glucose-6-phosphatase, associated with
glycogen storage deficiency type 1A; DNA encoding
phosphoenolpyruvate-carboxykinase, associated with Pepck
deficiency; DNA encoding galactose-1 phosphate uridyl transferase,
associated with galactosemia; DNA encoding phenylalanine
hydroxylase, associated with phenylketonuria; DNA encoding branched
chain alpha-ketoacid dehydrogenase, associated with Maple syrup
urine disease; DNA encoding fumarylacetoacetate hydrolase,
associated with tyrosinemia type 1; DNA encoding methylmalonyl-CoA
mutase, associated with methylmalonic acidemia; DNA encoding medium
chain acyl CoA dehydrogenase, associated with medium chain acetyl
CoA deficiency; DNA encoding ornithine transcarbamylase, associated
with ornithine transcarbamylase deficiency; DNA encoding
argininosuccinic acid synthetase, associated with citrullinemia;
DNA encoding low density lipoprotein receptor protein, associated
with familial hypercholesterolemia; DNA encoding
UDP-glucouronosyltransferase, associated with Crigler-Najjar
disease; DNA encoding adenosine deaminase, associated with severe
combined immunodeficiency disease; DNA encoding hypoxanthine
guanine phosphoribosyl transferase, associated with Gout and
Lesch-Nyan syndrome; DNA encoding biotinidase, associated with
biotinidase deficiency; DNA encoding beta-glucocerebrosidase,
associated with Gaucher disease; DNA encoding beta-glucuronidase,
associated with Sly syndrome; DNA encoding peroxisome membrane
protein 70 kDa, associated with Zellweger syndrome; DNA encoding
porphobilinogen deaminase, associated with acute intermittent
porphyria; DNA encoding alpha-1 antitrypsin for treatment of
alpha-1 antitrypsin deficiency (emphysema); DNA encoding
erythropoietin for treatment of anemia due to thalassemia or to
renal failure; DNA encoding vascular endothelial growth factor, DNA
encoding angiopoietin-1, and DNA encoding fibroblast growth factor
for the treatment of ischemic diseases; DNA encoding thrombomodulin
and tissue factor pathway inhibitor for the treatment of occluded
blood vessels as seen in, for example, atherosclerosis, thrombosis,
or embolisms; DNA encoding aromatic amino acid decarboxylase
(AADC), and DNA encoding tyrosine hydroxylase (TH) for the
treatment of Parkinson's disease; DNA encoding the beta adrenergic
receptor, DNA encoding anti-sense to, or DNA encoding a mutant form
of, phospholamban, DNA encoding the sarco(endo)plasmic reticulum
adenosine triphosphatase-2 (SERCA2), and DNA encoding the cardiac
adenylyl cyclase for the treatment of congestive heart failure; DNA
encoding a tumor suppessor gene such as p53 for the treatment of
various cancers; DNA encoding a cytokine such as one of the various
interleukins for the treatment of inflammatory and immune disorders
and cancers; DNA encoding dystrophin or minidystrophin and DNA
encoding utrophin or miniutrophin for the treatment of muscular
dystrophies; and, DNA encoding insulin for the treatment of
diabetes.
[0127] The invention also includes novel mutant virions comprising
a gene or genes coding for blood coagulation proteins, which
proteins may be delivered, using the methods of the present
invention, to the cells of a mammal having hemophilia for the
treatment of hemophilia. Thus, the invention includes: delivery of
the Factor IX gene to a mammal for treatment of hemophilia B,
delivery of the Factor VIII gene to a mammal for treatment of
hemophilia A, delivery of the Factor VII gene for treatment of
Factor VII deficiency, delivery of the Factor X gene for treatment
of Factor X deficiency, delivery of the Factor XI gene for
treatment of Factor XI deficiency, delivery of the Factor XIII gene
for treatment of Factor XIII deficiency, and, delivery of the
Protein C gene for treatment of Protein C deficiency. Delivery of
each of the above-recited genes to the cells of a mammal is
accomplished by first generating a rAAV virion comprising the gene
and then administering the rAAV virion to the mammal. Thus, the
invention includes rAAV virions comprising genes encoding any one
of Factor IX, Factor VIII, Factor X, Factor VII, Factor XI, Factor
XIII or Protein C.
[0128] Delivery of the recombinant virions containing one or more
HNAs to a mammalian subject may be by intramuscular injection or by
administration into the bloodstream of the mammalian subject.
Administration into the bloodstream may be by injection into a
vein, an artery, or any other vascular conduit the mutant virions
into the bloodstream by way of isolated limb perfusion, a technique
well known in the surgical arts, the method essentially enabling
the artisan to isolate a limb from the systemic circulation prior
to administration of the rAAV virions. A variant of the isolated
limb perfusion technique, described in U.S. Pat. No. 6,177,403 and
herein incorporated by reference, can also be employed by the
skilled artisan to administer the mutant virions into the
vasculature of an isolated limb to potentially enhance transduction
into muscle cells or tissue. Moreover, for certain conditions, it
may be desirable to deliver the mutant virions to the CNS of a
subject. By "CNS" is meant all cells and tissue of the brain and
spinal cord of a vertebrate. Thus, the term includes, but is not
limited to, neuronal cells, glial cells, astrocytes, cereobrospinal
fluid (CSF), interstitial spaces, bone, cartilage and the like.
Recombinant AAV virions or cells transduced in vitro may be
delivered directly to the CNS or brain by injection into, e.g., the
ventricular region, as well as to the striatum (e.g., the caudate
nucleus or putamen of the striatum), spinal cord and neuromuscular
junction, or cerebellar lobule, with a needle, catheter or related
device, using neurosurgical techniques known in the art, such as by
stereotactic injection (see, e.g., Stein et al., J Virol
73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000;
Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and
Davidson, Hum. Gene Ther. 11:2315-2329, 2000).
[0129] The dose of rAAV virions required to achieve a particular
"therapeutic effect," e.g., the units of dose in vector genomes/per
kilogram of body weight (vg/kg), will vary based on several factors
including, but not limited to: the route of rAAV virion
administration, the level of gene (or anti-sense RNA or ribozyme)
expression required to achieve a therapeutic effect, the specific
disease or disorder being treated, a host immune response to the
rAAV virion, a host immune response to the gene (or anti-sense RNA
or ribozyme) expression product, and the stability of the gene (or
anti-sense RNA or ribozyme) product. One of skill in the art can
readily determine a rAAV virion dose range to treat a patient
having a particular disease or disorder based on the aforementioned
factors, as well as other factors that are well known in the
art.
[0130] Generally speaking, by "therapeutic effect" is meant a level
of expression of one or more HNAs sufficient to alter a component
of a disease (or disorder) toward a desired outcome or clinical
endpoint, such that a patient's disease or disorder shows clinical
improvement, often reflected by the amelioration of a clinical sign
or symptom relating to the disease or disorder. Using hemophilia as
a specific disease example, a "therapeutic effect" for hemophilia
is defined herein as an increase in the blood-clotting efficiency
of a mammal afflicted with hemophilia, efficiency being determined,
for example, by well known endpoints or techniques such as
employing assays to measure whole blood clotting time or activated
prothromboplastin time. Reductions in either whole blood clotting
time or activated prothromboplastin time are indications of an
increase in blood-clotting efficiency. In severe cases of
hemophilia, hemophiliacs having less than 1% of normal levels of
Factor VIII or Factor IX have a whole blood clotting time of
greater than 60 minutes as compared to approximately 10 minutes for
non-hemophiliacs. Expression of 1% or greater of Factor VIII or
Factor IX has been shown to reduce whole blood clotting time in
animal models of hemophilia, so achieving a circulating Factor VIII
or Factor IX plasma concentration of greater than 1% will likely
achieve the desired therapeutic effect of an increase in
blood-clotting efficiency.
[0131] The constructs of the present invention may alternatively be
used to deliver an HNA to a host cell in order to elucidate its
physiological or biochemical function(s). The HNA can be either an
endogenous gene or heterologous. Using either an ex vivo or in vivo
approach, the skilled artisan can administer the mutant virions
containing one or more HNAs of unknown function to an experimental
animal, express the HNA(s), and observe any subsequent functional
changes. Such changes can include: protein-protein interactions,
alterations in biochemical pathways, alterations in the
physiological functioning of cells, tissues, organs, or organ
systems, and/or the stimulation or silencing of gene
expression.
[0132] Alternatively, the skilled artisan can of over-express a
gene of known or unknown function and examine its effects in vivo.
Such genes can be either endogenous to the experimental animal or
heterologous in nature (i.e., a transgene).
[0133] By using the methods of the present invention, the skilled
artisan can also abolish or significantly reduce gene expression,
thereby employing another means of determining gene function. One
method of accomplishing this is by way of administering antisense
RNA-containing rAAV virions to an experimental animal, expressing
the antisense RNA molecule so that the targeted endogenous gene is
"knocked out," and then observing any subsequent physiological or
biochemical changes.
[0134] The methods of the present invention are compatible with
other well-known technologies such as transgenic mice and knockout
mice and can be used to complement these technologies. One skilled
in the art can readily determine combinations of known technologies
with the methods of the present invention to obtain useful
information on gene function.
[0135] Once delivered, in many instances it is not enough to simply
express the HNA; instead, it is often desirable to vary the levels
of HNA expression. Varying HNA expression levels, which varies the
dose of the HNA expression product, is frequently useful in
acquiring and/or refining functional information on the HNA. This
can be accomplished, for example by incorporating a heterologous
inducible promoter into the rAAV virion containing the HNA so that
the HNA will be expressed only when the promoter is induced. Some
inducible promoters can also provide the capability for refining
HNA expression levels; that is, varying the concentration of
inducer will fine-tune the concentration of HNA expression product.
This is sometimes more useful than having an "on-off" system (i.e.,
any amount of inducer will provide the same level of HNA expression
product, an "all or none" response). Numerous examples of inducible
promoters are known in the art including the ecdysone promoter,
steroid promoters (e.g., estrogen and androgen promoters) and
metallothionein promoters.
3. Experimental
[0136] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way.
[0137] Efforts have been made to ensure accuracy with respect to
numbers used (e.g., amounts, temperatures, etc.), but some
experimental error and deviation should, of course, be allowed
for.
Example 1
Recombinant AAV-LacZ Mutant Virion Preparation and Properties
Thereof
[0138] Recombinant AAV-2 virions containing the
.beta.-galactosidase gene (rAAV-2 lacZ) were prepared using a
triple-transfection procedure described in U.S. Pat. No. 6,001,650,
incorporated herein by reference in its entirety. The complete cDNA
sequence for .beta.-gal is available under GenBank Accession No. NC
000913 REGION: complement (362455 . . . 365529).
I. Vector Construction
A. Mutant AAV Helper Function Vector
[0139] Based on the structure of AAV-2 (see, Xie et al. Proc. Natl.
Acad. Sci. USA (2002) 99:10405-10410), 61 mutants were constructed
by oligonucleotide-directed, site-specific mutagenesis. The entire
surface of AAV is composed of 60 identical asymmetrical structural
units arranged in an icosahedral shape. This has two important
implications. First, any single amino acid mutation that is made
will be found at 60 places on the virus all at the same position
relative to other amino acids within the asymmetrical structural
unit. Second, by studying a single asymmetrical structural unit one
can understand the entire surface of the virus.
[0140] AAV-2 structure was determined as follows. Coordinates for
the monomeric AAV-2 capsid protein (VP1 amino acids 217-735; VP2
amino acids 80-598) were obtained from the Protein Data Bank
(identification number 1LP3). The structure was analyzed using
Swiss PDB Viewer version 3.7, Vector NTI 3D-Mol version 8.0
(Invitrogen, Inc.), or Chime (MDL Information Systems, Inc.
Multimeric structures of the AAV-2 capsid were generated using the
oligomer generator program on the Virus Particle Explorer (VIPER)
website, using the coordinate transformation functions of Swiss PDB
viewer in conjunction with matrix coordinates in the PBD (1LP3)
file, or downloaded from the protein quaternary structure database
at the European Bioinformatics Institute (filename=11p3). Possible
antibody binding sites on AAV-2 capsid multimers were analyzed by
constructing the asymmetric structural unit of AAV-2 capsid and
then manually docking an IgG structure (murine IgG2a monoclonal
antibody; PDB ID number 1IGT) to that structure or to other
multimeric units of the AAV-2 capsid using Swiss PDB Viewer.
Distances, amino acid clashes, and contact areas between the IgG
and the AAV-2 capsid could be assessed using the appropriate tools
within the Swiss PDB Viewer program.
[0141] Several criteria were applied to select which amino acids
out of a total of about 145 external, surface-exposed amino acids
(within each of the 60 identical asymmetric structural units, see
FIG. 1) to mutate. Mutations were made only in external
"surface-exposed" amino acids, although it is possible for amino
acids under the external surface or on the internal surface to
influence antibody binding. The amino acids that were mutated were
those with side-chains predicted to be the most accessible to
antibody binding. This included amino acids on protruding features
of the capsid, known as the "spike", "cylinder", and "plateau."
Such protruding features are often targets for the binding of
neutralizing antibodies. Amino acids in areas that were not wide
enough to accommodate an antibody ("canyon", "dimple", center of
3-fold symmetry axis, center of 5-fold symmetry axis) were not
mutated. Furthermore the amino acid side-chain was selected based
on an exposed area of at least 20 .ANG..sup.2, because decreases of
20 .ANG..sup.2 or more in the contact area between an antigen and
an antibody (out of a total contact area of approximately 600
.ANG..sup.2 to 900 .ANG..sup.2) can have a measurable effect on
antibody-antigen affinity and therefore on the neutralizing titer
of the antibody. Amino acids selected were those with the
side-chain (and not just the peptide backbone) exposed. It was
assumed that if only the peptide backbone was exposed then an
antibody that bound to such an amino acid may not be able to
discriminate various amino acids well, since all amino acids have
the same peptide backbone. Finally, relatively flat areas of
protein antigens often interact with relatively flat areas of
antibodies so amino acids chosen for mutation were in a relatively
flat area (side of spike, top of cylinder, top of plateau).
Applying all of the above criteria to the approximately 145 capsid
amino acids located on the external surface of AAV-2 resulted in
the selection of 72 positions that would be most likely to affect
the binding of neutralizing antibodies when changed to other amino
acids. The location of these amino acids is indicated in FIG. 2 and
listed in Tables 1, 4 and 5.
[0142] Most of the 127 mutants (at 72 positions) that were made
changed single amino acids to alanine, using techniques known by
those skilled in the art of molecular biology. Alanine was chosen
because it has been determined that, of all mutations that could be
made, alanine is the least disruptive to protein structure. Also,
since alanine only has a methyl side-chain, changing most other
amino acids to alanine are likely to disrupt antibody binding. That
is, compared to other amino acids, alanine is less immunogenic
because it lacks a side-chain that significantly contributes to
antigen/antibody contact areas and hence to antigen/antibody
affinity. Note that the numbering that follows is based on the
AAV-2 VP2 sequence as depicted in FIG. 9. A few positions were
changed to an amino acid other than alanine. For example at
position 356 where there already is an alanine, an arginine was
inserted. Arginine is polar enough to remain on the AAV surface and
large enough that it could interfere with binding of antibodies.
There are five glycines that may be accessible to antibodies.
Glycines are often found where a peptide chain turns and thus can
be a critical component of structure. Mutation of glycines can be
problematic because of the possibility that structure may be
dramatically altered. Therefore each of the five glycines on the
AAV-2 surface were considered on a case-by-case basis in order to
decide what to change them to. G128 was changed to aspartate
because glycine 128 is found in AAV-1 through 6 except for AAV-5
where position 128 is an aspartic acid. G191 was changed to serine
because glycine 191 is found in AAV-1 through 6 except for AAV-5
where position 191 is a serine. G329 was changed to arginine
because glycine 329 is found in AAV-1 through 6 except for AAV-4
where position 329 is an arginine. G375 was changed to proline
because glycine 375 is conserved in AAV-1 through 6 and it was
thought that proline might preserve a turn in the peptide chain
found at that position. G449 was changed to alanine because,
although it is serine or asparagine in other AAVs, it is between
R448 and R451 in AAV-2, which are critical for heparin binding and
transduction. Therefore position 449 was mutated to an amino acid
closest in size to glycine (i.e., alanine). In some cases double
mutants were isolated (S130A/N131A, N360H/S361A, S361A/N358K,
S361A/S494P, S361A/R592K) in addition to the desired mutant. These
were presumably a result of polymerase errors introduced during the
mutagenesis, but were assayed like the other mutants.
[0143] AAV helper function vectors were constructed using pHLP19
(described in U.S. Pat. No. 6,001,650, incorporated herein by
reference in its entirety), 116 mutagenic oligodeoxynucleotides,
and an in vitro mutagenesis kit (Quik Change XL, Stratagene, San
Diego, Calif.). Briefly, two complementary oligodeoxynucleotides
that contain each desired mutant sequence and have a melting
temperature between 74-83.degree. C. (calculated using the
equation: Tm=81.5+0.41 (% G+C)-(675/N)-% mismatch, where G is
guanosine, C is cytosine, N is primer length in nucleotides) were
mixed separately with pHLP19. Three cycles of PCR were done using
the following conditions: denaturation was performed at 95.degree.
C. for 1 min, annealing was performed at 60.degree. C. for 1 min,
and extension was performed at 68.degree. C. for 1 min. Then the
two separate reactions were mixed and subjected to 18 additional
cycles of PCR using the following conditions: denaturation was
performed at 95.degree. C. for 1 min, annealing was performed at
60.degree. C. for 1 min, and extension was performed at 68.degree.
C. for 15 min. The PCR products were digested with the Dpn I
restriction enzyme to destroy fully methylated or hemi-methylated
(i.e., non-mutant) plasmids, and then transformed into the E. coli
strain XL-10 (Stratagene). One colony was picked from each
mutagenesis reaction, 500 ng of plasmid DNA were prepared, and
subjected to DNA sequencing. A subset of the mutagenic
oligodeoxynucleotides were used as sequencing primers to confirm
the sequences of mutants. The entire capsid gene was sequenced in
each case. Most mutants could be isolated in this manner. If a
mutant was not isolated by the first round of DNA sequencing, 1-3
more colonies were picked and 500 ng of plasmid DNA was prepared
and subjected to DNA sequencing.
B. pLadeno5 Accessory Function Vector
[0144] The accessory function vector pLadeno5 was constructed as
follows. DNA fragments encoding the E2a, E4, and VA RNA regions
isolated from purified adenovirus serotype-2 DNA (obtained from
Gibco/BRL) were ligated into a plasmid called pAmpscript. The
pAmpscript plasmid was assembled as follows.
Oligonucleotide-directed mutagenesis was used to eliminate a 623-bp
region including the polylinker and alpha complementation
expression cassette from pBSII s/k+(obtained from Stratagene), and
replaced with an EcoRV site. The sequence of the mutagenic oligo
used on the oligonucleotide-directed mutagenesis was
5'-CCGCTACAGGGCGCGATATCAGCTCACTCAA-3' (SEQ ID NO:1).
[0145] A polylinker (containing the following restriction sites:
Bam HI; KpnI; SrfI; XbaI; ClaI; Bst1107I; SalI; PmeI; and NdeI) was
synthesized and inserted into the EcoRV site created above such
that the BamHI side of the linker was proximal to the fl origin in
the modified plasmid to provide the pAmpscript plasmid. The
sequence of the polylinker was
5'-GGATCCGGTACCGCCCGGGCTCTAGAATCGATGTATACGTCGACGTTTAA ACCATATG-3'
(SEQ ID NO:2).
[0146] DNA fragments comprising the adenovirus serotype-2 E2a and
VA RNA sequences were cloned directly into pAmpscript. In
particular, a 5962-bp SrfI-KpnI(partial) fragment containing the
E2a region was cloned between the SrfI and KpnI sites of
pAmpscript. The 5962-bp fragment comprises base pairs 21,606-27,568
of the adenovirus serotype-2 genome. The complete sequence of the
adenovirus serotype-2 genome is accessible under GenBank No.
9626158.
[0147] The DNA comprising the adenovirus serotype-2 E4 sequences
was modified before it was inserted into the pAmpscript polylinker.
Specifically, PCR mutagenesis was used to replace the E4 proximal,
adenoviral terminal repeat with a SrfI site. The location of this
SrfI site is equivalent to base pairs 35,836-35,844 of the
adenovirus serotype-2 genome. The sequences of the oligonucleotides
used in the mutagenesis were:
5'-AGAGGCCCGGGCGTTTTAGGGCGGAGTAACTTGC-3' (SEQ ID NO:3) and
5'-ACATACCCGCAGGCGTAGAGAC-3' (SEQ ID NO:4). A 3,192 bp E4 fragment,
produced by cleaving the above-described modified E4 gene with SrfI
and SpeI, was ligated between the SrfI and XbaI sites of pAmpscript
which already contained the E2a and VA RNA sequences to result in
the pLadeno5 plasmid. The 3,192-bp fragment is equivalent to base
pairs 32,644-35,836 of the adenovirus serotype-2 genome.
C. rAAV-2 hF.IX Vector
[0148] The rAAV-2 hF.IX vector is an 11,442-bp plasmid containing
the cytomegalovirus (CMV) immediate early promoter, exon 1 of
hF.IX, a 1.4-kb fragment of hF.IX intron 1, exons 2-8 of h.FIX, 227
bp of h.FIX 3' UTR, and the SV40 late polyadenylation sequence
between the two AAV-2 inverted terminal repeats (see, U.S. Pat. No.
6,093,392, herein incorporated by reference). The 1.4-kb fragment
of hF.IX intron 1 consists of the 5' end of intron 1 up to
nucleotide 1098 and the sequence from nucleotide 5882 extending to
the junction with exon 2. The CMV immediate early promoter and the
SV40 late polyadenylation signal sequences can be obtained from the
published sequence of pCMV-Script.RTM., which is available from the
Stratagene catalog, Stratagene, La Jolla, Calif.
D. rAAV-2 Lac Z Vector Construction of the Recombinant AAV Plasmid
pVmLacZ
[0149] 1. A 4311 bp Xba I DNA fragment was excised from pSUB201
which contains AAV rep/cap sequences. The Xba I ends were
reannealed with a 10 bp Not I synthetic oligonucleotide
(5'-AGCGGCCGCT-3') (SEQ ID NO:5) to give a plasmid intermediate
pUC/ITR-Not I that has both AAV ITR's (inverted terminal repeats)
separated by 116 bp of residual AAV sequence and Not I linker
DNA.
[0150] 2. A 1319 bp Not I DNA fragment was excised from p1.1c
containing CMV promoter and hGH intron sequences. This DNA sequence
was inserted into the Not I site of pUC/ITR-Not I, to give the
intermediate pSUB201N.
[0151] 3. A 1668 bp Pvu II (5131-1493) ITR bound CMV expression
cassette was excised from pSUB201N and inserted at the Pvu II site
(position 12) of pWee.1a, to give the plasmid intermediate pWee.1b.
The excision of the 1668 bp PvuII fragment from pSUB201N removed 15
bp from the outside of each ITR, in the "A" palindromic region.
[0152] 4. A 4737 bp Not I/Eco RV "AAVrep/cap" DNA sequence was
excised from pGN1909 and the ends were rendered blunt by filling in
the 3' recessed ends using Klenow DNA polymerase. Asc I linkers
were ligated to both ends, followed by cloning this "pGN1909/AscI"
DNA fragment into the backbone of pWee.1b at an Asc I site (2703),
to give the intermediate pWee1909 (8188 bp). This plasmid has the
ITR-bound CMV expression cassette with an AAV rep/cap gene
backbone.
[0153] 5. A 3246 bp Sma I/Dra I LacZ gene was excised from
pCMV-beta and Asc I linkers were ligated to the blunt-ended
fragment. This LacZ/Asc I fragment was cloned into p1.1c between
Bss HII sites, to give p1.1cADHLacZ, that has the LacZ gene driven
by the CMV promoter.
[0154] 6. A 4387 bp Not I DNA fragment was excised from
p1.1cADHLacZ, that has the LacZ gene driven by the CMV promoter.
This fragment was inserted between the Not I sites of pWee1909,
after removing a 1314b p "CMV promoter/hGH intron" expression
cassette. The resulting construct, pW1909ADHLacZ, has the
.beta.-galactosidase gene under the control of the CMV promoter and
bounded by ITRs. The backbone of the plasmid carries the "rep" and
"cap" genes providing AAV helper functions and the .beta.-lactamase
(ampicillin) gene confers antibiotic resistance.
[0155] 7. A 4772 bp Sse I DNA fragment containing a "CMV/LacZ"
cassette was excised from pW1909ADHLacZ and inserted into the Sse I
site of pUC19, to give Pre-pVLacZ. This construct still contains
approximately 50 bp of remnant 5' and 3' pSUB201 sequences internal
to each ITR.
[0156] 8. The remnant pSUB201 sequences were removed by excising a
2912 bp Msc I "pUC/.DELTA.ITR" DNA fragment from Pre-pVLacZ, that
also removes approximately 35 bp of the "D" region of each ITR. A
synthetic linker "145NA/NB" (5'-CCAACTCCATCACTAGGGGTTCCTGCGGCC-3')
(SEQ ID NO:6) containing an Msc I restriction site, the ITR "D"
region and a Not I site was used to clone in a 4384 bp Not I
fragment from pW1909ADHLacZ, that has the "CMV/LacZ" expression
cassette. The resulting plasmid pVLacZ, is has the
.beta.-galactosidase gene under the control of an alcohol
dehydrogenase enhancer sequence and the CMV promoter, all bounded
by AAV ITRs.
[0157] 9. pVLacZ was further modified by removing LacZ elements and
polylinker sequence outside of the ITR bound LacZ expression
cassette as follows. A 534 bp Ehe I/Afl III LacZ/polylinker
sequence was excised from pUC119, the ends were blunted using
Klenow DNA polymerase and the plasmid was ligated to a Sse I linker
(5'-CCTGCAGG-3') (SEQ ID NO:7), to produce pUC119/SseI. The
"AAVLacZ" DNA sequence was removed from pVLacZ by cutting out a
4666 bp Sse I fragment. This SseI fragment was cloned into the Sse
I site of pUC119/SseI to generate pVmLacZ. pVmLacZ has the CMV
promoter/ADH enhancer/.beta.-galactosidase gene bounded by AAV ITRs
in a pUC119-derived backbone that confers ampicillin resistance and
has a high copy number origin of replication.
II. Triple Transfection Procedure
[0158] The various mutated AAV helper function vectors (described
above), the accessory function vector pLadeno5 (described in U.S.
Pat. No. 6,004,797, incorporated herein by reference in its
entirety), and the rAAV2-lacZ vector, pVmLacZ (described above)
were used to produce recombinant virions.
[0159] Briefly, human embryonic kidney cells type 293 (American
Type Culture Collection, catalog number CRL-1573) were seeded in 10
cm tissue culture-treated sterile dishes at a density of
3.times.10.sup.6 cells per dish in 10 mL of cell culture medium
consisting of Dulbeco's modified Eagle's medium supplemented with
10% fetal calf serum and incubated in a humidified environment at
37.degree. C. in 5% CO.sub.2. After overnight incubation, 293 cells
were approximately eighty-percent confluent. The 293 cells were
then transfected with DNA by the calcium phosphate precipitate
method, a transfection method well known in the art. 10 .mu.g of
each vector (mutated pHLP19, pLadeno5, and pVm lacZ.) were added to
a 3-mL sterile, polystyrene snap cap tube using sterile pipette
tips. 1.0 mL of 300 mM CaCl.sub.2 (JRH grade) was added to each
tube and mixed by pipetting up and down. An equal volume of
2.times.HBS (274 mM NaCl, 10 mM KCl, 42 mM HEPES, 1.4 mM
Na.sub.2PO.sub.4, 12 mM dextrose, pH 7.05, JRH grade) was added
with a 2-mL pipette, and the solution was pipetted up and down
three times. The DNA mixture was immediately added to the 293
cells, one drop at a time, evenly throughout the dish. The cells
were then incubated in a humidified environment at 37.degree. C. in
5% CO.sub.2 for six hours. A granular precipitate was visible in
the transfected cell cultures. After six hours, the DNA mixture was
removed from the cells, which were then provided with fresh cell
culture medium without fetal calf serum and incubated for an
additional 72 hours.
[0160] After 72 hours, the cells were lysed by 3 cycles of freezing
on solid carbon dioxide and thawing in a 37.degree. C. water bath.
Such freeze-thaw lysates of the transfected cells were
characterized with respect to total capsid synthesis (by Western
blotting), DNA packaging (by Q-PCR), heparin binding, in vitro
transduction (on HeLa or HepG2 cells plus adenovirus-2 or
etoposide), and neutralization by antibodies.
III. Properties of the Mutant Virions
A. Capsid Synthesis Assay
[0161] Mutations in proteins can render them unstable and more
susceptible than normal to degradation by proteases. In order to
determine the level of capsids made by the mutants described
herein, western blotting of crude lysates was performed. One
microliter of each crude lysate was denatured by incubation in 20
mM Tris, pH 6.8, 0.1% SDS at 80.degree. C. for 5 minutes. Proteins
were fractionated by SDS-PAGE using 10% polyacrylamide gels
(Invitrogen, Inc., Carlsbad, Calif.) and then detected by western
blotting as follows. The proteins were electrophoretically blotted
(Xcell II blot module, Invitrogen, Carlsbad, Calif.) onto nylon
membranes (Hybond-P, Amersham Biosciences, Piscataway, N.J.). The
membranes were probed with an anti-AAV antibody (monoclonal clone
B1, Maine Biotechnology Services, Inc. Portland, Me.) at a dilution
of 1:20 and then with a sheep anti-mouse antibody coupled to
horseradish peroxidase (Amersham Biosciences, Piscataway, N.J.) at
a dilution of 1:12000. The B1 antibody-binding proteins were
detected using the ECL Plus western blotting detection system
(Amersham Biosciences, Piscataway, N.J.). The membranes were
exposed to x-ray film Biomax MS, Kodak, Rochester, N.Y.) for 1-5
minutes and the signals were quantified using an AlphaImager 3300
(Alpha Innotech Corp., San Leandro, Calif.)
B. DNA Packaging Assay.
[0162] Quantitative polymerase chain reaction (Q-PCR) was used to
assess DNA packaging by AAV-2 virions with mutant capsids. In this
procedure the crude lysate was digested with DNAse I prior to PCR
amplification to remove any plasmid (used in transfection) that
might result in a false positive signal. The crude lysates were
diluted 100 fold (5 .mu.l crude lysate plus 495 .mu.l buffer) in 10
mM Tris, pH 8.0, 10 .mu.g/ml yeast tRNA. An aliquot of the dilution
(10 .mu.l) was digested with 10 units DNAse I (Roche Molecular
Biochemicals, Indianapolis, Ind.) in 25 mM Tris, pH 8.0, 1 mM
MgCl.sub.2 at 37.degree. C. for 60 minutes in a final volume of 50
.mu.l. The DNAse I was inactivated by heating at 95.degree. C. for
30 minutes. One microliter (20 .mu.g) of Proteinase K (Roche
Molecular Biochemicals, Indianapolis, Ind.) was added and incubated
55.degree. C. for 30 minutes. The Proteinase K was inactivated by
heating at 95.degree. C. for 20 minutes. At this point, the sample
was diluted in 10 mM Tris, pH 8.0, 10 .mu.g/ml yeast tRNA if
necessary. Ten microliters of DNAse 1 and proteinase K-treated
sample was added to 40 .mu.l Q-PCR master mix, which consisted
of:
TABLE-US-00002 4 .mu.l H.sub.20 5 .mu.l 9 .mu.M lac Z primer
#LZ-1883F (5'-TGCCACTCGCTTTAATGAT-3', (SEQ ID NO: 8) Operon, Inc.,
Alameda, CA) 5 .mu.l 9 .mu.M lac Z primer #LZ-1948R
(5'-TCGCCGCACATCTGAACTT-3', (SEQ ID NO: 9) Operon, Inc., Alameda,
CA) 1 .mu.l 10 .mu.M lacZ probe #LZ-1906T
(5'-6FAM-AGCCTCCAGTACAGCGCGGCTGA-TAMRA-3', (SEQ ID NO: 10) Applied
Biosystems, Inc. Foster City, CA) 25 .mu.l TaqMan Universal PCR
Master Mix (Applied Biosystems, Inc. Foster City, CA)
[0163] Q-PCR amplification was done using an Applied Biosystems
model 7000 Sequence Detection System according to the following
program. There were two initial incubations at 50.degree. C. for 2
minutes and 95.degree. C. for 10 minutes to activate Taq polymerase
and denature the DNA template, respectively. Then the DNA was
amplified by incubation at 95.degree. C. for 15 sec, then
60.degree. C. for 60 seconds for 40 cycles. A standard curve was
constructed using 4-fold dilutions of linearized pVm lac Z ranging
from a copy number of 61 to 1,000,000. The copy number of packaged
rAAV-lacZ genomes in each sample was calculated from the C.sub.t
values obtained from the Q-PCR using the Applied Biosystems Prism
7000 Sequence Detection System version 1.0 software.
C. Heparin-Binding Assay
[0164] Heparin binding of viruses in crude lysates was performed as
follows. Twenty microliters of crude cell lysate containing AAV-2
virions with wild-type or mutant capsids were mixed with 25 .mu.l
of a 50% slurry of heparin beads. The heparin beads (Ceramic
Hyper-DM Hydrogel-Heparin, Biosepra, Cergy-Saint-Christophe,
France) were 80 .mu.m in diameter and had 1000 .ANG. pores to allow
AAV (which is .about.300 .ANG. in diamater) access to the heparin.
The beads were washed thoroughly in phosphate-buffered saline prior
to use. The beads and virions were incubated at 37.degree. C. for
60 minutes. The beads were pelleted. The supernatant containing
unbound virions was saved. The beads were washed 2 times with 500
.mu.l PBS. The supernatants were combined and unbound capsid
proteins were precipitated with trichloroacetic acid at a final
concentration of 10%. Precipitated proteins were denatured by
incubation in 20 mM Tris, pH 6.8, 0.1% SDS at 80.degree. C. for 5
minutes. Virions bound to heparin beads were released by incubation
of the beads in 20 mM Tris, pH 6.8, 0.1% SDS at 80.degree. C. for 5
minutes. All protein samples prepared in this manner were
fractionated by molecular weight by SDS-PAGE using 10%
polyacrylamide gels (Invitrogen, Inc., Carlsbad, Calif.) and then
detected by western blotting as follows. The proteins were
electrophoretically blotted onto nylon membranes (Hybond-P,
Amersham Biosciences, Piscataway, N.J.). The membranes were probes
with an anti-AAV antibody (monoclonal clone B1, Maine Biotechnology
Services, Inc. Portland, Me.) at a dilution of 1:20 and then with a
sheep anti-mouse antibody coupled to horseradish peroxidase
(Amersham Biosciences, Piscataway, N.J.) at a dilution of 1:12000.
The B1 antibody-binding proteins were detected using the ECL Plus
western blotting detection system (Amersham Biosciences,
Piscataway, N.J.). The membranes were exposed to x-ray film Biomax
MS, Kodak, Rochester, N.Y.) for 1-5 minutes and the signals were
quantitated using an AlphaImager 3300 (Alpha Innotech Corp., San
Leandro, Calif.)
D. In Vitro Transduction Assay.
[0165] HeLa cells (American Type Culture Collection, catalog #
CCL-2) were plated in 24-well dishes at 5e4 cells per well. Cells
were grown for 24 hr in Dulbecco's Modified Eagle Medium (DMEM)
(Gibco) supplemented with 10% fetal bovine serum (Gibco) and
penicillin-streptomycin (Gibco) at 37.degree. C. Ten-fold dilutions
of crude lysates containing the control wild type and mutant
viruses were made in DME/10% FBS. The virus dilutions were added to
the cells along with wild type adenovirus-5 (American Type Culture
Collection, catalog # VR-5). The amount of adenovirus used was 0.1
.mu.l per well, which was titered previously and shown to maximally
stimulate rAAV-2 lac Z transduction of HeLa cells. After 24 hours
at 37.degree. C. the cells were fixed using 2% formaldehyde and
0.2% glutaraldehyde and stained for .beta.-galactosidase activity
using 1 mg/ml (2.5 mM) 5-bromo-4-chloro-3-indolyl 13-D
galactopyranoside in PBS, 2 mM MgCl.sub.2, 5 mM potassium
ferricyanide, 5 mM potassium ferrocyanide, pH 7.2. After another 24
hours, the number of blue cells in four random microscopic fields
were counted and averaged for each well. Instead of using HeLa
cells and adenovirus-5, HepG2 cells and 20 .mu.M etoposide could
also be used and similar results were obtained.
E. Antibody and Serum Neutralization Assays.
[0166] Hep G2 cells (American Type Culture Collection, catalog #
HB-8065) were plated in 24-well dishes at 1.5e5 cells per well.
Cells were grown for 24 hr in Minimum Essential Medium (Eagle's)
(KMEM) (ATCC) supplemented with 10% fetal bovine serum and
penicillin-streptomycin at 37.degree. C. Two-fold dilutions of the
A20 antibody (Maine Biotechnology, Portland, Me.) were made using
PBS. Wild-type and mutant virus was diluted by mixing 1 microliter
of crude lysate of the viral preparation with 15 microliters of
KMEM/0.1% Bovine Serum Albumin (BSA). Samples of KMEM/0.1% BSA and
PBS were included as a negative controls. A total of 16 .mu.l of
A20 dilution was mixed with 16 .mu.l of virus and incubated at
37.degree. C. for one hour. Ten microliters of virus/A20 mixture
was added to each of three wells of cells. After one hour
incubation at 37.degree. C., etoposide (20 mM stock solution in
dimethyl sulfoxide, Calbiochem) was added to each well at a final
concentration of 20 .mu.M. After 24 hours the cells were fixed
using 2% formaldehyde and 0.2% glutaraldehyde and stained for
.beta.-galactosidase activity using 1 mg/ml (2.5 mM)
5-bromo-4-chloro-3-indolyl .beta.-D galactopyranoside in PBS, 2 mM
MgCl.sub.2, 5 mM potassium ferricyanide, 5 mM potassium
ferrocyanide, pH 7.2. After another 24 hours, the number of blue
cells in four random microscopic fields were counted and averaged
for each well. The neutralizing titer of an antibody is defined as
the dilution of antibody at which there is a 50% reduction in the
number of viral transduction events (i. e., blue cells) compared to
transduction in the absence of antibody.
[0167] Neutralization of mutants by human sera collected from
hemophiliacs or to purified human IgG from >10,000 donors
(Panglobulin, ZLB Bioplasma AG, Berne, Switzerland) was assayed in
the same manner. For purified human IgG, a concentration of 10
mg/ml was considered to be equivalent to undiluted sera since the
normal concentration of IgG in human sera varies from 5-13
mg/ml.
F. ELISAs.
[0168] (A) A20 ELISA:
[0169] An ELISA kit (American Research Products, Belmont, Mass.)
that uses a monoclonal antibody (A20) to capture and detect AAV-2
was used to quantitate particle numbers. The kit was used according
to the manufacturer's instructions. Optical density was measured in
a Spectramax 340PC plate reader (Molecular Devices, Sunnyvale,
Calif.) at 450 nm wavelength. The concentration of virus needed to
result in a half maximal optical density reading was calculated and
used to compare the results from different samples.
[0170] (b) IgG/A20 ELISA:
[0171] Microtiter plates (96-well EIA/RIA flat bottom, high-binding
polystyrene, Costar, Corning, N.Y.) were coated using 100 .mu.l (10
.mu.g) Panglobulin in 0.1 M sodium bicarbonate buffer, pH 9.2 for
16 hours at 20.degree. C. Plates were blocked with 200 .mu.l PBS,
1% BSA, 0.05% Tween-20 for 1 hour at 20.degree. C. Increasing
amounts of CsCl gradient-purified native or mutant AAV-2 ranging
from 3.0.sup.8 to 1.0.sup.10 vector genomes per well were added and
incubated for 16 hours at 20.degree. C. Unbound virus was washed
off using 3-200 .mu.l aliquots of PBS, 0.1% Tween-20 buffer.
A20-biotin from the AAV-2 ELISA kit was diluted 1:50, 100 .mu.l was
added per well, and incubated for 1 hours at 37.degree. C. Unbound
A20-biotin was washed off using 3 200 .mu.l aliquots of PBS, 0.1%
Tween-20 buffer. Then streptavidin coupled to horseradish
peroxidase was diluted 1:20 and incubated for 1 hours at 37.degree.
C. Unbound streptavidin-HRP was washed off using 3 200 .mu.l
aliquots of PBS, 0.1% Tween-20 buffer. Horseradish peroxidase
substrates (Immunopure TMB substrate kit Pierce, Rockford, Ill.)
were added and incubated for 15 min at 20.degree. C. The reaction
was stopped with 100 .mu.l 2M sulfuric acid and optical density was
measured in a Spectramax 340PC plate reader (Molecular Devices,
Sunnyvale, Calif.) at 450 nm wavelength. The concentration of virus
needed to result in a half maximal optical density reading was
calculated and used to compare the results from different
samples.
[0172] (c) IgG ELISA:
[0173] Microtiter plates (96-well EIA/RIA flat bottom, high-binding
polystyrene, Costar, Corning, N.Y.) were coated with increasing
amounts of CsCl gradient-purified native or mutant AAV-2 ranging
from 3.0.sup.8 to 1.0.sup.10 vector genomes per well for 16 hours
at 20.degree. C. in 0.1 M sodium bicarbonate buffer, pH 9.2 for 16
hours at 20.degree. C. Plates were blocked with 200 .mu.l PBS, 1%
BSA, 0.05% Tween-20 for 1 hour at 20.degree. C. Unbound virus was
washed off using 3-200 .mu.l aliquots of PBS, 0.1% Tween-20 buffer.
Panglobulin was added and incubated for 1 hour at 37.degree. C.
Unbound Panglobulin was washed off using 3-200 .mu.l aliquots of
PBS, 0.1% Tween-20 buffer. Then donkey, anti-human IgG coupled to
horseradish peroxidase (Amersham Biosciences, Piscataway, N.J.) was
added and incubated for 1 hours at 37.degree. C. Unbound secondary
antibody was washed off using 3-200 .mu.l aliquots of PBS, 0.1%
Tween-20 buffer. Horseradish peroxidase substrates (Immunopure TMB
substrate kit Pierce, Rockford, Ill.) were added and incubated for
15 min at 20.degree. C. The reaction was stopped with 100 .mu.l of
2M sulfuric acid and optical density was measured in a Spectramax
340PC plate reader (Molecular Devices, Sunnyvale, Calif.) at 450 nm
wavelength. The concentration of virus needed to result in a half
maximal optical density reading was calculated and used to compare
the results from different samples.
[0174] The DNA packaging, heparin-binding, and transduction
properties of mutants described here are summarized in Table 1. The
antibody neutralization properties of some of the mutants described
here are summarized in Tables 2 and 3.
TABLE-US-00003 TABLE 1 Properties of AAV-2 capsid mutants. Capsid
DNA Heparin Mutant .sup.1 synthesis .sup.2 packaging .sup.3
binding.sup.4 Transduction.sup.5 wild type 100 100 >95 100 Q126A
65 67 >95 55 Q126A/S127L 78 4 >95 0.02 S127A 68 98 >95 53
G128D 100 674 >95 0.02 .DELTA.128ins1 77 777 >95 0.02
S130A/N131A 55 nt >95 0.02 N131A 67 563 >95 0.005 D132A 75 23
>95 0.04 H134A 44 540 >95 2 Q188A 55 16 >95 0.36 D190A 60
51 >95 95 G191S 108 18 >95 22 T193A 38 7 >95 6 S247A 18 83
>95 24 Q248A 60 374 >95 280 S315A 101 122 >95 232 T317A
101 111 >95 208 T318A 100 132 >95 224 Q320A 97 89 >95 68
R322A 100 560 >95 106 G329R 43 21 >95 0.24 S331A 168 80
>95 158 D332A 85 474 >95 8 R334A 169 601 >95 79 D335A 136
127 >95 38 T354A 132 301 >95 93 S355A 69 353 >95 38 S355T
110 183 >95 88 A356R 85 18 25 13 D357A 39 166 >95 4 N359A 24
365 >95 89 N360A 8 246 >95 33 N360H/S361A 145 472 >95 38
S361A 81 608 >95 89 S361A/N358K 59 nt >95 0.45 S361A/S494P 87
nt 90 0.02 S361A/R592K 108 nt 90 180 E362A 149 56 >95 12 W365A
195 60 >95 4 T366A 151 8 >95 0.01 G375P 221 82 50 0.01 D377A
211 80 >95 20 K390A 155 267 >95 189 D392A 98 48 >95 0.01
E393A 54 81 >95 2 E394A 29 108 >95 22 K395A 34 2046 >95 14
F396A 178 nt >95 148 K407A 220 112 >95 32 E411A 90 513 >95
20 T413A 233 34 >95 252 E418A 264 74 >95 37 K419A 81 806
>95 160 E437A 239 94 >95 24 Q438A 28 101 >95 92 G449A 104
106 >95 196 N450A 217 144 >95 207 Q452A 313 533 >95 473
N568A 439 412 >95 536 K569A 831 333 >95 20 V571A 98 251
>95 142 .sup.1 Mutants are named as follows: The first letter is
the amino acid in wild type AAV-2 capsid, the number is the
position in capsid that was mutated (numbered according to the
AAV-2 VP2 sequence), and the last letter is the mutant amino acid.
.DELTA.128ins1 has amino acid 128 deleted and the sequence
DASNDNLSSQSD inserted in its place. .sup.2 As determined by western
blotting of crude lysates. Expressed as a percentage of wild type
capsid synthesis. .sup.3 DNAse-resistant, vector-specific DNA,
quantified by Q-PCR and expressed as a percentage of wild type,
which was normalized to 100%. Average of 2 experiments, each done
in triplicate. nt, not tested. .sup.3 Heparin-binding, expressed as
a percentage of wild type. Single determinations except for wild
type, which is an average of three determinations, normalized to
100%. .sup.4Transduction on human 293 cells expressed as a
percentage of wild type. Average of 2 experiments.
TABLE-US-00004 TABLE 2 Antibody neutralization properties of AAV-2
capsid mutants. Fold Transduction blue cells blue cells
neutralization Serum.sup.1 Mutant (% of wt) (-serum) (+serum) %
Neut. resistant HA2 wild type 100 13275 3 99.98 1.0 R334A 114 15102
146 99.04 42.7 N450A 89 11802 14 99.88 5.2 wild type 100 25960 8
99.97 1.0 E394A 6 1593 6 99.64 11.2 T413A 21 5505 15 99.73 8.5
N360H/S361A 41 10691 7 99.94 2.0 HA151 wild type 100 11965 16 99.87
1.0 R334A 185 22125 459 97.93 15.8 E394A 16 1947 14 99.27 5.6 V571A
73 8732 39 99.56 3.4 G449A 218 26137 121 99.54 3.5 N568A 122 14632
36 99.75 1.9 N450A 95 11387 53 99.54 3.5 wild type 100 15989 13
99.92 1.0 E411A 18 2876 13 99.54 5.7 N360H/S361A 100 15989 21 99.87
1.6 HA165 wild type 100 22833 14 99.94 1.0 N360A 16 3717 9 99.75
4.0 R334A 74 16872 162 99.04 15.3 E394A 11 2566 2 99.91 1.4 N568A
102 23246 30 99.87 2.1 N450A 64 14514 26 99.82 2.9 N360H/S361A 49
9558 8 99.92 1.3 .sup.1Mutants were rapidly screened by comparing
the number of transduced cells resulting from infection of HepG2
cells by rAAV-2 lac Z with mutant or wild type capsids in the
presence or absence of a monoclonal (A20) antibody at a dilution of
1:80 or human polyclonal serum at a dilution of 1:100.
TABLE-US-00005 TABLE 3 Antibody titration properties of 4
antibodies against AAV-2 capsid mutants. Fold decrease in
neutralizing titer.sup.1 Antibody.sup.2: Mutant .sup.3 A20 151 165
HA2 wild type 1.0 1.0 1.0 1.0 Q126A 2.5 NR NR NR S127A 57.0 NR NR
NR S247A 2.8 NR NR NR Q248A 5.7 NR NR NR R334A NR 3.6 2.4 2.0
N360H/S361A NR 2.2 1.2 1.3 E394A NR 2.1 1.2 1.9 N450A NR 1.7 1.6
1.3 Predicted multiplicative resistance: 2415 29 6 11 .sup.1Titers
were determined by using 2-fold dilutions of monoclonal antibody
and fitting the data to a four-parameter logistic curve using Sigma
Plot graphing software. Values reported in the table are the fold
decrease in titer of the mutant relative to wild type capsid. NR,
not resistant to neutralization by indicated antibody. .sup.2A20 is
a protein A-purified anti-AAV-2 mouse monoclonal antibody. Sera
151, 165, and HA2 are 3 unpurified human sera. .sup.3 Mutants are
named as follows: The first letter is the amino acid in wild type
AAV-2 capsid, the number is the position in capsid that was mutated
(numbered according to the AAV-2 VP2 sequence), and the last letter
is the mutant amino acid. .DELTA.128ins1 has amino acid 128 deleted
and the sequence DASNDNLSSQSD (SEQ ID NO: 11) inserted in its
place.
[0175] As can be seen, by changing single amino acids on the
surface of AAV-2 32 mutants out of 61 were identified that had
nearly normal properties with respect to capsid synthesis, DNA
packaging, heparin binding, and transduction of cells in vitro. Ten
mutants were more resistant to neutralization by antibodies.
[0176] The mutants made capsid protein at a level between 5-fold
lower to 8-fold higher than wild type. They packaged DNA at a level
between 25-fold lower to 20-fold higher than wild type. With regard
to transduction, 28 of the mutants transduced at least 50% as well
as wild type, 16 transduced 10-50% of wild type, 6 transduced 1-10%
of wild type, and 11 transduced less than 1% of wild type (Table
1). There were no significant differences in transduction of human
cervical carcinoma-derived HeLa cells or human liver-derived Hep G2
cells, or when either adenovirus or etoposide was used to enhance
transduction. Several mutants reproducibly had up to 5-fold more
transducing activity than wild type (Table 1).
[0177] Most of the mutants with <1% transduction activity were
clustered in a single area, on one side of the (proposed)
heparin-binding site (Table 1, compare FIG. 4 with FIG. 5). Without
being bound by a particular theory, the mutations cover an area
that may be a protein-binding site. The mutant that was most
defective for transduction was N131A. A function for N131 has not
been described, but it is conserved in 40 out of 42 known AAV
subtypes.
[0178] Four mutations affected heparin binding more noticeably than
the others (A356R, G375A, S361A/S494P, S361A/R592K). Each of these
is near R347, R350, K390, R448 and R451, which have been previously
identified as amino acids that are important for heparin binding
(FIG. 5).
[0179] Forty five of the mutants (Q126A, S127A, D190A, G191S,
S247A, Q248A, S315A, T317A, T318A, Q320A, R322A, S331A, D332A,
R334A, D335A, T354A, S355A, S355T, A356R, D357A, N359A, N360A,
N360H/S361A, S361A, S361A/R592K, E362A, D377A, K390A, E393A, E394A,
K395A, F396A, K407A, E411A, T413A, E418A, K419A, E437A, Q438A,
G449A, N450A, Q452A, N568A, K569A, V571A) with more than
approximately 10% of the transduction activity of wild-type AAV-2
capsid were screened for neutralization by the murine A20
monoclonal antibody. Four mutants (Q126A, S127A, S247A, Q248A) were
significantly more resistant to neutralization by A20 than was AAV2
with a wild type capsid (see Table 3). The titer of these mutants
(Q126A, S127A, S247A, Q248A) was 1:203, 1:9, 1:180 and 1:89,
respectively (FIG. 8), which is 2.5, 57, 2.8, and 5.7-fold greater
than the neutralizing titer of the A20 monoclonal antibody against
wild type AAV-2 capsid (1:509). These 4 mutants are located
immediately adjacent to each other on the surface of the AAV-2
capsid (FIG. 6).
[0180] Three (Q126A, S127A, Q248A) of the four mutations that
reduce neutralization by A20 were essentially normal with regard to
capsid synthesis, DNA packaging, heparin binding, and transduction.
Capsid synthesis and transduction by mutant S247A was 4- to 5-fold
less than wild-type AAV-2 capsid. Thus it is possible to have a
virus that is normal in several important properties but has
increased resistance to antibody neutralization.
[0181] The mutant rAAV virions Q126A, S127A, S247A, Q248A yielded
an unexpected 2.5- to 57-fold resistance to neutralizing antibody
while maintaining transduction efficiency in 2 different human cell
lines (HeLa and HepG2). These four amino acids are immediately
adjacent to each other on the surface of AAV-2 (FIG. 6).
Furthermore, they are in an area that had been previously
implicated in binding the A20 antibody, based on peptide
competition and insertional mutagenesis experiments. Based on these
observations it is possible the A20 antibody blocks one or more
functions necessary for AAV-2 to transduce cells. In a previous
study it has been shown that A20 does not block binding of AAV-2 to
heparin (Wobus et al (2000) J. Virol. 74:9281-93). The results
reported here support this data since mutations that affect heparin
binding are located far from mutations that affect A20 binding.
Although A20 does not block heparin binding, it does prevent AAV-2
from entering cells. It is possible that A20 does not interfere
with binding to a "docking receptor" such as heparin, but instead
interferes with binding of AAV-2 to an "entry receptor". Two
proteins have been described that are required for AAV-2
transduction which may be entry receptors: the basic fibroblast
growth factor receptor (bFGF.sup.R) and .alpha..sub.v.beta..sub.5
integrin. The areas on AAV-2 that these receptors may bind have not
been identified. It is possible .alpha..sub.v.beta..sub.5 integrin,
bFGF.sup.R, or both may bind to the localized area described herein
that has a high concentration of mutants that are significantly
defective in transduction (<1% of normal). Note that the area
that is most defective for transduction is located adjacent to the
mutants that affect A20 binding.
[0182] The same 45 mutants (Q126A, S127A, D190A, G191S, S247A,
Q248A, S315A, T317A, T318A, Q320A, R322A, S331A, D332A, R334A,
D335A, T354A, S355A, S355T, A356R, D357A, N359A, N360A,
N360H/S361A, S361A, S361A/R592K, E362A, D377A, K390A, E393A, E394A,
K395A, F396A, K407A, E411A, T413A, E418A, K419A, E437A, Q438A,
G449A, N450A, Q452A, N568A, K569A, V571A) with more than
approximately 10% of the transduction activity of wild type AAV-2
capsid were screened for neutralization by 3 human neutralizing
antisera. Four mutants (R334A, N360H/S361A, E394A, N450A) were
identified in an initial screen that were more resistant to
neutralization by all three human antisera, than was AAV2 with a
wild-type capsid (see Table 2). The titer of antisera when tested
on these mutants ranged from 1.3 to 3.6-fold greater than the
neutralizing titer of the three human antisera against wild type
AAV-2 capsid (Table 3). Six other mutants (N360A, E411A, T413A,
G449A, N568A, V571A) had increased levels of resistance to
neutralization by 1 or 2 of the 3 sera tested (Table 2).
[0183] The location of the mutations that confer antibody
neutralization resistance is informative. First, mutants that
confer resistance to a mouse monoclonal antibody are located
immediately adjacent to each other on the surface of the AAV-2
capsid whereas those that confer resistance to human antisera are
spread over a larger area (FIG. 7). This suggests the human
antisera are polyclonal, which is not surprising. Second, both sets
of mutants are located on the plateau and spike but not on the
cylinder, even though the cylinder would be readily accessible to
antibody binding. Third, mutations that affect neutralization are
near areas important for AAV function. Several mutants that affect
neutralization by human antisera (at positions 360, 394, 449, 450)
are located within 2 amino acids of the heparin binding site, which
is likely to be a functionally important target for binding by
neutralizing antibodies. Other mutants (at positions 126, 127, 247,
248, 334, 568, 571) are located at the periphery of the large
region on the plateau (dead zone) that contains most of the mutants
that had <10% of wild type transduction activity (FIG. 4). Like
the heparin-binding site, this area presumably has an important
function and is likely to be a functionally important target for
binding by neutralizing antibodies.
[0184] When multiple mutations that confer resistance to antibody
neutralization are combined the cumulative resistance to antibody
neutralization is often multiplicative, especially when the
individual mutations result in low levels of resistance. Therefore,
it is likely that if the mutants described here are combined into
one capsid, those capsids could be 5-fold to over 1000-fold more
resistant to neutralization compared to a wild-type capsid (Table
3). Dilutions of A20 greater than 1:1000 neutralize <3% of
wild-type AAV-2. Thus a mutant with a combination of the 4 single
amino acids that provide some resistance to neutralization by A20
could be almost completely resistant to neutralization even by
undiluted A20 antisera.
[0185] Although mutants with <10% wild type transduction
activity may also be resistant to antibody neutralization they were
not tested because the neutralization assay, as described here,
works best when used to assay mutants that have >.about.10% of
wild-type transduction activity (FIG. 3). This is because it is
desirable to be able to detect neutralization over a wide range of
antibody concentrations so that a titer can be accurately
calculated. However, mutants with <10% wild-type transduction
activity could still be tested for their ability to bind
neutralizing antibody using a modification of the assay described
here in which a transduction defective mutant would be used as a
competitor. For example a wild-type "reporter" rAAV-2 lacZ virus
could be mixed with a transduction defective "competititor" AAV-2
that lacks any genome ("empty virus") or with an AAV-2 virus that
has packaged another gene (e.g., green fluorescent protein). If a
"competititor" AAV-2 protects a reporter AAV-2 from neutralization
then the "competititor" capsid should be able to bind neutralizing
antibody and thus would not be resistant to neutralization. If a
"competititor" AAV-2 does not protect a reporter AAV-2 from
neutralization then the "competititor" capsid may not be able to
bind neutralizing antibody and thus could be resistant to
neutralization as long as it was shown to make a normal amount of
capsid. In this way even mutants that are transduction defective
but resistant to antibody neutralization could be identified. In
order to make such mutants useful as vehicles for delivering genes
in the presence of neutralizing antibodies, it would be desirable
to find an amino acid substitution other than alanine that would
restore normal transducing activity, but still retain decreased
susceptibility to neutralization.
[0186] 66 more mutants were made and tested using the protocols
described above. The DNA packaging, heparin-binding, and
transduction properties of the additional mutants are summarized in
Table 4.
TABLE-US-00006 TABLE 4 Properties of Additional AAV-2 capsid
mutants. Capsid DNA Heparin Mutant synthesis .sup.2 packaging
binding Transduction G128A + 207 >95% 1.5 S130A + 172 >95% 92
S130T + 232 >95% 1164 N131Q + 113 >95% 0.01 D132E + 202
>95% 4 D132N + 188 >95% 75 N133A + 187 >95% 418 H134F +
180 >95% 0.2 H134Q + 340 >95% 17 H134T + 102 >95% 0.4
N245A + 145 >95% 1.8 G246A + 353 >95% 0.6 R350K + 52 >95%
16 D357E + 222 >95% 427 D357N + 157 >95% 28 D357Q + 204
>95% 1.6 N360H + 129 >95% 37 N360K + 59 >95% 0.06 W365F +
253 >95% 6 T366S + 251 >95% 18 H372F + 130 >95% 4.1 H372K
+ 154 >95% 72 H372N + 221 >95% 122 H372Q + 248 >95% 73
G375A + 55 >95% 2.4 D391A + 140 >95% 1.21 D392E + 158 >95%
15 D392I + 411 >95% 0.5 D392N + 236 >95% 0.2 D392V + 247
>95% 0.001 E393D + 218 >95% 80 E393K + 123 >95% 0.02 E393Q
+ 92 >95% 1.2 E394K + 190 >95% 6.0 E411K + 28 >95% 4.6
T413K + 196 >95% 57 R448A + 3255 <1% 0.3 R448K + 768 >95%
80 G449K + 270 >95% 3.1 N450K + 281 >95% 0.7 R451A + 2971
<1% 0.07 R451K + 10 >95% 133 N568K + 488 >95% 16 V571K +
614 >95% 40 R334A/N360K + 380 >95% 0.6 R334A/G449A + 87
>95% 91 R334A/N450A + 738 >95% 238 R334A/N568A + 150 >95%
147 N360K/N450A + 166 >95% 0.2 E411A/T413A + 548 >95% 74
G449A/N450A + 94 >95% 111 G449A/N568A + 102 >95% 105
G449K/N568K + 284 >95% 0.02 N568A/V571A + 139 >95% 59
R334A/N360K/ + 38 >95% 0.8 E394A R334A/N360K/ + 21 >95% 0.001
E394A ins2.sup.1 R334A/N360K/ + 320 >95% 0.01 G449K R334A/G449A/
+ 746 >95% 424 N568A R334A/G449K/ + 50 >95% 2.0 N568K
R347C/G449A/ + 102 50% 0.02 N450A R334A/N360K/ + 26 >95% 0.3
N450A R334A/N360K/ + 445 >95% 0.9 E394A/N450A R334A/N360K/ + 26
>95% 0.001 G449K/N568K E411A/T413A/ + 372 >95% 74 G449A/N450A
E411A/T413A/ + 437 >95% 14 G449A/N450A/ N568A/V571A R334A/N360K/
+ 152 >95% 0.006 E394A/E411A/ T413A/G449A N450A/N568A/ V571A
.sup.1ins2 is an insertion of the sequence HKDDEAKFFPQ after VP2
amino acid 399. .sup.2 + = within 10-fold of wild type.
[0187] As shown in Table 4, several mutants were obtained with
increased transduction as compared to wild-type capsids. For
example, mutants S130T, N133A, D357E, H372N, R451K, G449A/N450A,
R334A/N450A, R334A/G449A/N568A, R334A/N568A, G449A/N568A displayed
increased transduction. Mutant S130T was the best transducer, with
approximately 11 times over wild-type levels. This was remarkable
because the only difference between S (serine) and T (threonine) is
a CH.sub.2 group. Also as seen in Table 4, combination mutants
usually transduced at the same level as that of the single mutant
with the lowest level of transduction.
[0188] Certain amino acids in the capsid overlap the
heparin-binding site. This region is termed the "dead zone" or "DZ"
herein. Mutations in the dead zone can result in capsids that still
bind one of the AAV-2 receptors (e.g., heparin) but do not
transduce cells. Amino acid substitutions were made in dead zone
amino acids and these substitutions were compared to substitution
of the same amino acid with alanine. Results are shown in Table
5.
TABLE-US-00007 TABLE 5 Effect of non-alanine substitutions in dead
zone. Dead zone position Substitution Transduction (% of wild type)
G128 A 1.5 D 0.02 N131 A 0.005 Q 0.01 D132 A 0.04 E 4 N 75 H134 A 2
F 0.2 Q 17 T 0.4 D357 A 4 E 427 N 128 Q 1.6 H372 A 0.008 .sup.a F 4
K 72 N 122 Q 73 G375 A 2.4 P 0.01 D392 A 0.01 E 15 I 0.5 N 0.2 V
0.001 E393 A 2 D 80 K 0.2 Q 1.2 .sup.a Data from Opie, S. R., et
al., J. Virology 77, 6995-7006, (2003)
[0189] As shown above, the more conservative the substitution the
more functional the dead zone mutant was. For example Q was a good
substitute for H. D was a good substitute for E. E or N were good
substitutes for D. It was not a surprise that glycine, which has
several unique properties was difficult to substitute.
[0190] The heparin binding properties of mutant G375P (transduction
0.01% of wild-type) and G375A (transduction 2.4% of wild-type) were
compared. Mutant G375P bound heparin at 50% and G375A at 95%.
Position 375 might be required for both dead zone and heparin
binding site function. Substitution of glycine with alanine in the
G375A mutant results in a phenotype that is the same as other dead
zone mutants--it binds heparin normally but displays <10% of
normal transduction. However, substitution of glycine with proline
in the G375P mutant results in a phenotype more similar to a mutant
defective in heparin binding (such as R347C/G449A/N450A). Without
being bound by a particular theory, the differences in structure
between glycine, alanine, and proline imply that the side chain of
glycine may be required for dead zone function, since substitution
with alanine reduces transduction. The amine group may be required
for heparin binding since substitution with proline, which does not
have an amine group, affects heparin binding. Alternatively proline
substitution may disrupt the structure of the heparin binding site
from a distance. There were three mutants (R448A, R451A,
R347C/G449A/N450A) that didn't bind heparin, but these were in
positions previously known to be required for heparin binding (347,
448, 451).
[0191] Neutralization activity of several of these mutants by
murine monoclonal antibody (A20) and also by a purified, pooled
human IgG was determined. The pooled human IgG preparation was used
as it is well characterized, commercially available, highly
purified, and it is believed to represent nearly all antigen
specificities that would be found in the United States which was
the source of blood used to purify the IgG. Results are shown in
Table 6.
TABLE-US-00008 TABLE 6 Neutralization by purified, pooled human IgG
and murine monoclonal antibody A20 Fold decrease in Fold decrease
in Mutant neutralizing titer.sup.1 A20 titer WT 1.0 S127A .sup. 2.2
* G128A .sup. 4.1 * S130A 1.4 S130T 1.8 D132N .sup. 3.8 * N133A 0.9
H134Q 1.5 R334A .sup. 2.2 * T354A .sup. 2.9 * D357E 1.7 D357N 1.8
N360H/S361A .sup. 2.1 * W365A 10.4 * 0.5 H372K 1.1 G375P 1.9 D377A
1.9 K390A .sup. 2.3 * E394A 1.5 E394K .sup. 2.3 * 0.9 K395A .sup.
4.9 * 0.9 F396A 1.6 K407A .sup. 3.3 * 1.6 E411A 2.7 * T413K .sup.
2.6 * E418A 1.5 E437A .sup. 2.0 * 0.8 * Q438A 1.3 R448K 1.0 G449A
.sup. 2.5 * N450A 1.6 Q452A 1.3 N568A .sup. 2.0 * K569A .sup. 4.0 *
1.7 V571A .sup. 3.9 * 1.4 V571K 1.0 217 * R334A/G449A .sup. 3.9 *
R334A/N568A .sup. 2.4 * G449A/N568A 1.7 N568A/V571A .sup. 2.5 *
R334A/G449A/N568A .sup. 3.0 * E411A/T413A/G449A/ 1.0 N450A
E411A/T413A/G449A/ N450A/N568A/V571A 1.3 .sup.1* = statistically
significant, p < 0.05. Titers were determined by doing 2-fold
dilutions of IgG. The data was plotted using Sigma Plot software
and the reciprocal of the dilution at which 50% neutralization
occurred is defined as the titer.
[0192] As shown in the table, 21 mutants (S127A, G128A, D132N,
R334A, T354A, N360H/S361A, W365A, K390A, E394K, K395A, K407A,
T413K, E437A, G449A, N568A, K569A, V571A, R334A/G449A, R334A/N568A,
N568A/V571A, R334A/G449A/N568A) were from 2-10 fold more resistant
to neutralization by a large pool of human IgG compared to native
AAV-2 capsid. As would be expected, some of the mutants that were
resistant to neutralization by pooled human IgG were also resistant
to neutralization by individual human sera (e.g., R334A,
N360H/S361A, G449A, N568A, V571A). Without being bound by a
particular theory, epitopes that contain those amino acids may bind
antibody with high affinity or at high frequency. However, some
mutants resistant to neutralization by pooled human IgG were not
identified as resistant to individual sera, possibly because
epitopes that contain those amino acids are more rarely found in
the human population. In addition, some mutants were resistant to
neutralization by individual sera but not to pooled human IgG
(e.g., E394A, N450A). In these cases it is possible the antibodies
that bind to epitopes that contain these amino acids are low
affinity or low abundance such that mutations that affect their
binding are not detectable in the context of a large complex
mixture of IgG.
[0193] As can be seen in FIG. 7, these mutations are scattered at
various locations across the surface of AAV-2. The size of the area
they cover is 2-3 times the size of an average epitope, implying
there may be at least 2-3 epitopes involved in neutralization by
the sum total of all human IgGs.
[0194] Combinations of single, neutralization resistance mutants
sometimes resulted in a slightly higher degree of neutralization
resistance compared to the single mutants that comprised a multiple
mutant. However the degree of the effect clearly is not
multiplicative for these mutants at these levels of neutralization
resistance.
[0195] Two more mutants resistant to neutralization by the murine
monoclonal antibody A20 were also identified: E411A which is
2.7-fold resistant and V571K which is 217-fold resistant to
neutralization by A20. The V571K mutant provides evidence for a
concept termed by the present inventors as "lysine scanning".
Rather than removing part of an antibody binding site by changing
an amino acid with a large side chain to one with a smaller side
chain such as alanine, the concept of lysine scanning is to
substitute an amino acid that has a small side chain (e.g., V571)
with lysine which has a large side chain. Rather than removing part
of an antibody binding site as might be the case for alanine
substitutions, the aim of lysine scanning is to insert larger amino
acids that could sterically interfere with antibody binding. Lysine
was chosen since it is commonly found on the surface of AAV-2 and
thus likely to be an accepted substitution. However, other large
amino acids such as arginine, trytophan, phenylalanine, tyrosine,
or glutamine may also result in a similar effect without
compromising biological activity. Note that while V571A is not
resistant to neutralization by the murine A20 antibody, V571K is
217 fold more resistant to neutralization by A20 than is native
V571 AAV-2 capsid.
[0196] V571K is located on the plateau, immediately adjacent to the
four other mutants identified as resistant to A20 neutralization
(Q126A, S127A, S247A, Q248A; Table 3). However E411A is located on
the spike, albeit close enough to Q126A, S127A, S247A, Q248A and
V571K to be within the same epitope. Inclusion of E411 in the A20
epitope evidences that A20 may bind to both the plateau and the
spike, i.e. across the canyon. Molecular modeling suggests that one
of AAV-2 receptors, the basic FGF receptor (PDB ID: 1FQ9), could
fit very well in the AAV-2 canyon (in a manner and location
remarkably similar to the way the transferrin receptor is thought
to bind to canine parvovirus). If the basic FGF receptor binds to
the AAV-2 canyon, then binding of A20 across the canyon would block
binding of the basic FGF receptor and explain the observation that
A20 neutralizes AAV-2 by blocking entry, a step in transduction
that the basic FGF receptor is likely to mediate.
[0197] The plateau and spike area may bind antibodies that
neutralize other AAVs by preventing receptor binding. For example
AAV-5 has been shown to require the PDGF receptor for entry into
cells (Di Pasquale et al., Nature Medicine (2003) 9:1306-1312).
Although the structure of the PDGF receptor is not known, it is
homologous in amino acid sequence to the basic FGF receptor. For
example, both are composed of similar repetitive Ig-like sequence
domains and thus would be expected to have similar 3-dimensional
structures. Thus, it is possible that the PDGF receptor may bind to
the AAV-5 canyon.
[0198] V571A, but not V571K is resistant to neutralization by
pooled human IgG. Conversely V571K, but not V571A is resistant to
neutralization by murine monoclonal A20. It is possible that
antibodies in the human IgG pool bind directly to V571.
Substitution of the valine side chain for the smaller alanine side
chain may result in less binding by human IgG. The lysine side
chain may still provide enough hydrophobic contacts to allow
binding to occur, but not be so large as to prevent binding. A20
may not bind directly to V571 (explaining the absence of an effect
of the V571A mutant on binding or neutralization by A20). However
A20 clearly binds in the vicinity of V571. It is possible that
V571K indirectly interferes with A20 binding, for example by steric
interference.
[0199] An IgG ELISA was also done. There are many potential
mechanisms of neutralization, especially in vivo. Binding of an IgG
to AAV in a region that is not required for the function of AAV
could still lead to reduction of the ability of AAV to deliver
genes. For example, the primary function of macrophages is to bind
foreign organisms that are bound to antibodies. When an
antibody-bound organism is bound to a macrophage (via Fc receptors)
the foreign organism is engulfed and destroyed. Another potential
route that antibodies could use in order to neutralize AAV is by
cross-linking. Antibodies are bivalent and AAV would likely have 60
antibody binding sites per epitope (and possibly multiple
epitopes). Thus, as is well documented in the scientific
literature, at certain antibody and virus concentrations, a
cross-linked network of AAVs and antibodies can form. Such immune
complexes can become so large that they precipitate or become
lodged in the vasculature prior to reaching a target organ. For
this reason, antibodies that bind AAV in vivo, on areas of AAV that
are not functionally significant, can result in reduced
transduction as much as antibodies that do bind to functionally
significant areas. Results are shown in Table 7.
TABLE-US-00009 TABLE 7 IgG ELISA Fold decrease in binding Fold
decrease in binding Mutant of human IgG of murine A20 Wild type 1 1
S130A 1 1 S130T 1 1 D132N 1 1 H134Q 1 1 G246A 1 1 R334A 1 1 D357E 1
1 N360H 1 1 H372K 1 1 H372Q 1 1 E393D 1 1 T413K 1 1 G449A 1 1 N568K
1 1 N568A 1 1 V571K 10 10 E411A, T413A 1 1 N568A, N571A 1 1 E411A,
T413A, 1 1 G449A, N450A R334A, G449A, 1 1 N568A R334A, G449A 1 1
R334A, N568A 1 1 G449A, N568A 1 1
[0200] As shown in Table 7, one mutant (V571K) was identified that
bound both A20 and a pool of human IgG 10 times worse than native
AAV-2. In the all-A20 ELISA binding of mutant V571K was reduced
10-fold. In an all-human IgG ELISA binding of mutant V571K was
reduced 10-fold. When an A20/IgG sandwich ELISA format was used,
binding of mutant V571K was reduced 100-fold. Position (571) is
immediately adjacent to positions 126, 127, 247 and 248 on the
surface of the AAV-2 capsid. Positions 126, 127, 247 and 248 were
identified as important for neutralization by the mouse monoclonal
antibody A20. Therefore this region may be antigenic in both mice
and humans.
[0201] To summarize, several mutations to the external surface of
AAV-2 capsid that reduced neutralization by antibodies, but had
minimal effects on biological properties were identified. In
particular, 127 mutations were made at 72 positions (55% of surface
area) deemed most likely to be accessible to antibody binding based
on manual docking of IgG and AAV-2 structures. Single alanine
substitutions (57), single non-alanine substitutions (41), multiple
mutations (27), and insertions (2) were made. All mutants made
capsid proteins and packaged DNA at levels within 10-fold of wild
type. All mutants bound heparin as well as wild-type, except for
six which were close to or within the heparin binding site. 42 of
98 single mutants transduced at least as well as wild-type. Several
mutants had increased transducing activity. One, an S to T mutant,
had 11-fold greater transducing activity than wild type.
Combination (up or down) mutants usually transduced at the same
level as that of the single mutants with the lowest level of
transduction.
[0202] 13 of 15 single alanine substitution mutants with <10%
transduction activity were adjacent to each other in an area (10%
of surface) that overlaps the heparin-binding site. Although these
"dead zone (DZ)" mutants had from 0.001%-10% of normal transduction
activity, all of them bound heparin as efficiently as wild-type.
Transduction by DZ mutants could be increased, and in three cases
restored to wild-type levels, by making conservative
substitutions.
[0203] Five mutants had reduced binding to a mouse monoclonal
antibody (A20) in an ELISA and were 2.5-217 fold more resistant to
neutralization by A20 in vitro. These 5 mutants were adjacent to
each other and to the DZ. A total of 21 single mutants were 2-10
fold resistant to neutralization by three human sera or by a large
pool of purified human IgG (IVIG, Panglobulin) compared to
wild-type. Different sets of mutations conferred resistance to
different human sera. The location of these mutations was
widespread. The size of the area they covered suggested human sera
neutralize AAV-2 by binding at least two epitopes. Three mutants
were resistant to all sera tested, but combinations of these three
mutants did not increase resistance to neutralization by IVIG. One
(V to K) mutant was identified that bound IVIG 10-fold worse than
wild-type in an all-IVIG ELISA. However, this mutant was not
resistant to IVIG neutralization.
[0204] In summary, mutations in the "dead zone" affect
transduction, but not heparin binding. Mutations around the DZ can
increase transduction or decrease binding of antibodies. The DZ is
very acidic (6 acidic, 0 basic amino acids). Without being bound by
a particular theory, it may be a binding site for a basic protein,
such as bFGF or the bFGF receptor. Since the dead zone is adjacent
to the heparin binding site on AAV-2 it may be that if a protein
binds to the dead zone, then that protein may also bind heparin.
Both bFGF and the bFGF receptor bind heparin.
Example 2
Factor IX Expression in Mice Using Mutant AAV-hF.IX
[0205] rAAV-F.IX is prepared using the rAAV-2 hF.IX vector and the
methods described above. Freeze-thaw lysates of the transfected
cells are precipitated, rAAV virions are purified by two cycles of
isopycnic centrifugation; and fractions containing rAAV virions are
pooled, dialysed, and concentrated. The concentrated virions are
formulated, sterile filtered (0.22 .mu.M) and aseptically filled
into glass vials. Vector genomes are quantified by the "Real Time
Quantitative Polymerase Chain Reaction" method (Real Time
Quantitative PCR. Heid C. A., Stevens J., Livak K. J., and Williams
P. M. 1996. Genome Research 6:986-994. Cold Spring Harbor
Laboratory Press).
[0206] Female mice 4-6 weeks old are injected with mutant
rAAV-hF.IX virions. Mice are anesthetized with an intraperitoneal
injection of ketamine (70 mg/kg) and xylazine (10 mg/kg), and a 1
cm longitudinal incision is made in the lower extremity. Mutant
recombinant AAV-hF.IX (2.times.10.sup.11 viral vector genomes/kg in
HEPES-Buffered-Saline, pH 7.8) virions is injected into the
tibialis anterior (25 .mu.L) and the quadriceps muscle (50 .mu.L)
of each leg using a Hamilton syringe. Incisions are closed with 4-0
Vicryl suture. Blood samples are collected at seven-day intervals
from the retro-orbital plexus in microhematocrit capillary tubes
and plasma assayed for hF.IX by ELISA. Human F.IX antigen in mouse
plasma is assessed by ELISA as described by Walter et al. (Proc
Natl Acad Sci USA (1996) 3:3056-3061). The ELISA does not
cross-react with mouse F.IX. All samples are assessed in duplicate.
Protein extracts obtained from injected mouse muscle are prepared
by maceration of muscle in PBS containing leupeptin (0.5 mg/mL)
followed by sonication. Cell debris is removed by
microcentrifugation, and 1:10 dilutions of the protein extracts are
assayed for hF.IX in the ELISA. Circulating plasma concentrations
of hF.IX is measured by ELISA at various time points post-IM
injection (e.g., zero, three, seven, and eleven weeks).
Example 3
Hemophilia B Treatment in Dogs with Mutant AAV-cF.IX
[0207] A colony of dogs having severe hemophilia B comprising males
that are hemizygous and females that are homozygous for a point
mutation in the catalytic domain of the canine factor IX (cF.IX)
gene, is used to test the efficacy of cF.IX delivered by mutant
rAAV virions (rAAV-cF.IX). The severe hemophilic dogs lack plasma
cF.IX, which results in an increase in whole blood clotting time
(WBCT) to >60 minutes (normal dogs have a WBCT between 6-8
minutes), and an increase in activated partial thromboplastin time
(aPTT) to 50-80 seconds (normal dogs have an aPTT between 13-18
seconds). These dogs experience recurrent spontaneous hemorrhages.
Typically, significant bleeding episodes are successfully managed
by the single intravenous infusion of 10 mL/kg of normal canine
plasma; occasionally, repeat infusions are required to control
bleeding.
[0208] Under general anesthesia, hemophilia B dogs are injected
intramuscularly with rAAV1-cF.IX virions at a dose of
1.times.10.sup.12 vg/kg. The animals are not given normal canine
plasma during the procedure.
[0209] Whole blood clotting time is assessed for cF.IX in plasma.
Activated partial thromboplastin time is measured. A coagulation
inhibitor screen is also performed. Plasma obtained from a treated
hemophilic dog and from a normal dog is mixed in equal volumes and
is incubated for 2 hours at 37.degree. C. The inhibitor screen is
scored as positive if the aPTT clotting time is 3 seconds longer
than that of the controls (normal dog plasma incubated with
imidazole buffer and pre-treatment hemophilic dog plasma incubated
with normal dog plasma). Neutralizing antibody titer against AAV
vector is assessed.
Example 4
Hemophilia B Treatment in Humans with Mutant AAV-hF.IX
A. Muscle Delivery
[0210] On Day 0 of the protocol patients are infused with hF.IX
concentrate to bring factor levels up to .about.100%, and, under
ultrasound guidance, mutant rAAV-h.FIX virions are injected
directly into 10-12 sites in the vastus lateralis of either or both
anterior thighs. Injectate volume at each site is 250-500 .mu.L,
and sites are at least 2 cm apart. Local anesthesia to the skin is
provided by ethyl chloride or eutectic mixture of local
anesthetics. To facilitate subsequent muscle biopsy, the skin
overlying several injection sites is tattooed and the injection
coordinates recorded by ultrasound. Patients are observed in the
hospital for 24 h after injection; routine isolation precautions
will be observed during this period to minimize any risk of
horizontal transmission of virions. Patients are discharged and
seen daily in outpatient clinic daily for three days after
discharge, then weekly at the home hemophilia center for the next
eight weeks, then twice monthly up to five months, them monthly for
the remainder of the year, then annually in follow-up. Circulating
plasma levels of hF.IX are quantified using ELISA as described
above.
B. Liver Delivery
[0211] Using the standard Seldinger technique, the common femoral
artery is cannulated with an angiographic introducer sheath. The
patient is then heparinized by IV injection of 100 U/kg of heparin.
A pigtail catheter is then advanced into the aorta and an abdominal
aortogram is performed. Following delineation of the celiac and
hepatic arterial anatomy, the proper HA is selected using a
standard selective angiography catheter (Simmons, Sos-Omni, Cobra
or similar catheters). Prior to insertion into the patient, all
catheters are flushed with normal saline. Selective arteriogram is
then performed using a non-ionic contrast material (Omnipaque or
Visipaque). The catheter is removed over a 0.035 wire (Bentsen,
angled Glide, or similar wire). A 6F Guide-sheath (or guide
catheter) is then advanced over the wire into the common HA. The
wire is then exchanged for a 0.018 wire (FlexT, Microvena Nitenol,
or similar wire) and a 6.times.2 Savvy balloon is advanced over the
wire into the proper HA distal to the gastrodoudenal artery. The
wire is then removed, the catheter tip position confirmed by hand
injection of contrast into the balloon catheter, and the lumen
flushed with 15 ml of heparinized normal saline (NS) to fully clear
the contrast. Prior to infusion of the AAV-hFIX, the balloon is
inflated to 2 atm to occlude the flow lumen of the HA. AAV-hFIX, at
a dose of 8.times.10E10-2.times.10E12, is brought to a final volume
of approximately less than or equal to 40 ml (depending on dose and
weight of patient) and is then infused over 10-12 minutes using an
automatic volumetric infusion pump. Three milliliters (ml) of
normal saline (NS) are then infused (at the same rate as the
AAV-hFIX), to clear the void volume of the catheter. The balloon
remains inflated for 2 minutes at which time the balloon is
deflated and the catheter removed. A diagnostic arteriogram of the
femoral puncture site is then performed in the ipsilateral anterior
oblique projection. The puncture site is closed by standard
methods, e.g., utilizing a percutaneous closure device using either
a 6 F Closer (Perclose Inc., Menlo Park, Calif.) or a 6 F
Angioseal, or by manual compression applied for 15 to 30 minutes at
the site of catheter removal.
Example 5
Isolation and Characterization of a New Caprine AAV
A. Cell Culture and Virus Isolation
[0212] Ovine adenovirus preparations with evidence of parvovirus
contamination were isolated from caprine ileum as follows. Tissue
was homogenized in Eagle's MEM medium containing Earles salts (PH
7.2) and gentomycin. The homogenate was clarified by low speed
centrifugation (1,500.times.g) for 20 minutes and filter-sterilized
though a 0.45 .mu.m device. Supernatant (500 .mu.l) was inoculated
onto a 25 cm.sup.2 flask containing primary cultures of fetal lamb
kidney cells at passage 3 and incubated with fetal bovine serum
(USA) and lactalbumin hydrolysate (USA) at 37.degree. C. in humid,
5% CO.sub.2 incubator for one week. Cells were trypsinized, split,
and incubated again as described above and finally assayed for
typical adenoviral cytophatic effect (CPE). Flasks showing CPE were
frozen at -70.degree. C., thawed and layered onto other cell types.
These flasks were later incubated and tested for CPE.
[0213] Other cell types used included non-immortalized (passage 8)
ovine fetal turbinate cells derived from fetal ovine tissue and
Maden Darby bovine kidney cells, maintained by long-term passage
(used at passage 160). Porcine trypsine (USA) was used in all
tissue culture processes and no human cell cultures or products
were used.
B. Viral DNA Isolation and AAV Sequence Identification and
Comparison Four preparations from different cell cultures and
passages were processed individually for DNA extraction.
Virus-containing supernatant was treated with proteinase K (200
.mu.g) in digestion buffer (10 mM Tris-HCl (PH 8.0), 10 mM EDTA (PH
8.0) and 0.5% SDS) and incubated at 37.degree. C. for 1 hour.
Following phenol chloroform extraction and ethanol precipitation
the viral DNA was resuspended in TE.
[0214] The DNA content of each preparation was determined by
PicoGreen DNA quantitation (Molecular Probes, Eugene, Oreg.) and
the preparations were diluted to 20 ng/.mu.l to standardize DNA
concentration for subsequent PCR assays.
[0215] Oligonucleotide Primers
[0216] Oligonucleotide primers were selected on the basis of
sequence alignments from segments that were highly conserved among
known AAVs.
The forward primer 1 (GTGCCCTTCTACGGCTGCGTCAACTGGACCAATGAGAACTTTCC)
(SEQ ID NO:23), was complementary to the helicase domain and the
reverse primer 2 (GGAATCGCAATGCCAATTTCCTGAGGCATTAC) (SEQ ID NO:24),
was complementary to the DNA binding domain. The expected size of
PCR fragments was 1.5 kb.
[0217] PCR Amplifications
[0218] All reactions were performed in 50 .mu.l in an automated
Eppendorf Mastercycler Gradient thermocycler (PerkinElmer, Boston,
Mass.). Each reaction mixture contained 200 ng of template DNA, 1
.mu.M each oligonucleotide primer, 1 mM Mn(Oac).sub.2, 200 .mu.M
each deoxynucleoside triphosphate (dATP, dCTP, dGTP, and dTTP), and
1.0 unit of rTth polymerase, XL (Applied Biosystems, Foster City,
Calif.) in 1.times.XL Buffer II. Ampliwax PCR gem 100 was used to
facilitate hot start (Applied Biosystems, Foster City, Calif.).
Cycling conditions were as follows: 2 min of denaturation at
94.degree. C., followed by 35 cycles of 15 s of denaturation at
94.degree. C., 30 s of annealing at 45.degree. C., and 2 min of
elongation at 72.degree. C.
[0219] PCR products (10 .mu.l) were electrophoretically separated
in a 1% NuSieve agarose gel (FMC BioProducts, Rockland, Minn.),
stained with ethidium bromide, and visualized by UV light. DNA
molecular markers were used on each gel to facilitate the
determination of the sizes of the reaction products.
[0220] To control for specificity of the assay, PCR was also
performed with 100 ng of DNA from a plasmid containing AAV2
sequences.
[0221] DNA Sequencing
[0222] PCR products were purified on 1% low-melting agarose gels
(FMC Bioproducts, Rockland, Me.), and the sequences were determined
using primers designed from AAV-5 sequences.
[0223] Sequence data was analyzed with the NTI vector suite
software package (InforMax, Frederick, Md.).
[0224] Virus preparations from different cell cultures and passages
were processed individually for DNA extraction and PCR analysis.
PCR amplification using primers forward 1 and reverse 2 revealed
the presence of parvovirus-like sequences in all four preparations.
Sequence analysis revealed the presence of AAV sequences. The VP1
ORF of caprine AAV, corresponding to nucleotides 2,207 to 4,381 of
AAV-5 genome, has 93% nucleotide identity (2,104/2,266, Gaps
6/2,266) with primate AAV-5 (see FIGS. 12A-12B) isolated from
humans (J. Virol 1999; 73:1309-1319). Protein comparison showed 94%
identity (682/726) and 96% similarity (698/726) between the primate
AAV-5 and caprine AAV VP1 proteins (see, FIG. 13). Most if not all
mutations appeared to be on the surface (see, FIG. 15). FIG. 16
shows the predicted location of the surface amino acids that differ
between AAV-5 and caprine AAV, based on the surface structure of
the AAV-2 capsid. The 3 filled triangles represent insertions in
caprine AAV, relative to AAV-2, that are likely to be located on
the surface.
[0225] Without being bound by a particular theory, surface
mutations were probably driven by selective pressure due to the
humoral immune system and/or adaptation to ruminant receptors. The
lack of changes in non-surface exposed areas may imply a lack of
pressure from the cellular immune response. These mutated regions
in the caprine virus may improve the resistance to pre-existing
human anti-AAV5 antibodies.
[0226] The caprine AAV sequence was compared to other AAV serotypes
and these serotypes were compared with each other in order to
analyze the differences in the non-conserved region. In particular,
FIGS. 14A-14H show a comparison of the amino acid sequence of VP1
from primate AAV-1, AAV-2, AAV-3B, AAV-4, AAV-6, AAV-8, AAV-5 and
caprine AAV. Conserved amino acids in the sequences are indicated
by * and the accessibility of the various amino acid positions
based on the crystal structure is shown. B indicates that the amino
acid is buried between the inside and outside surface. I indicates
the amino acid is found on the inside surface and O indicates the
amino acid is found on the outside surface.
[0227] The non-conserved region between AAV-5 and caprine AAV
includes 43 mutations. 17 of these 43 mutations are non-conserved
between AAV-2 and AAV-8. Only one of these mutations originated in
the same amino acid in caprine AAV and AAV-8. The non-conserved
region between AAV-5 and caprine AAV includes 348 amino acids. This
non-conserved region is compressed to 157 amino acids when
analyzing the region containing the 17 joint mutations.
[0228] Tables 8-11 show the results of the comparisons.
TABLE-US-00010 TABLE 8 Mutations in surface (O) residues of AAV-2
vs. AAV-8 and AAV-5 vs. Caprine -AAV AAV-2 vs. AAV-8 AAV-5 vs.
Caprine-AAV mutations (x)/surface mutations (*)/surface Region
residues (O) residues (O) 100-200 04/19 (+2 insertions) 00/19
200-300 01/20 01/20 300-400 16/31 03/30 400-500 20/46 (+1
insertion) 11/43 (+1 insertion) 500-600 13/27 04/30 700-750 05/24
01/24 100-750 59/167 (35%) 20/167 (12%) 65% identity 88%
identity
TABLE-US-00011 TABLE 9 Mutations in surface (O) residues of AAV-2
vs. all AAVs. AAV2 vs. AAV2 vs. AAV2 vs. AAV2 vs. AAV2 vs. AAV2 vs.
AAV2 vs. AAV2 vs. AAV1 AAV3a AAV4 AAV5 AAV6 AAV7 AAV8 Caprine AAV
Region mut/surface mut/surface mut/surface mut/surface mut/surface
mut/surface mut/surface mut/surface 100-200 01/19 00/19 08/19 10/19
01/19 05/19 04/19 10/19 (1 ins) (1 ins) (3 del) (1 ins) (1 ins) (2
ins) 200-300 02/20 02/20 07/20 06/20 01/20 03/20 01/20 06/20 (2
ins) (3 ins) (2 ins) (1 ins) 300-400 15/31 11/31 24/31 17/30 17/31
14/31 16/31 18/30 (6 del) (6 del) 400-500 21/46 14/46 36/46 36/44
21/46 22/46 20/46 37/44 (3 ins) (ins, 1del) (3 ins) (1 del) (1 ins)
500-600 10/27 07/27 15/27 15/30 10/27 10/27 13/27 17/30 700-750
06/24 00/24 13/24 11/24 06/24 07/24 05/24 11/24 100-750 55/167
34/167 (20%) 103/167 95/167 56/167 61/167 59/167 99/167 (59%) (33%)
80% identity (62%) (57%) (34%) (37%) (35%) 41% identity 67% 38% 43%
66% 63% 65% identity identity identity identity identity
identity
TABLE-US-00012 TABLE 10 Surface identity Caprine (%) AAV1 AAV3a
AAV4 AAV5 AAV6 AAV7 AAV8 AAV AAV2 67 80 38 43 66 63 65 41 AAV5
88
TABLE-US-00013 TABLE 11 Capsid similarity Caprine (%) AAV1 AAV3a
AAV4 AAV5 AAV6 AAV7 AAV8 AAV AAV2 83 87 59 56 83 82 83 56
Example 6
Immunoreactivity of Caprine AAV and Comparison to Other AAVs
A. Neutralization Activity of Primate AAV Serotypes
[0229] The neutralization activity of the primate AAV serotypes
indicated in Table 12 was assessed using the methods described
above. Immunoreactivity was determined using a purified pooled
human IgG (designated IVIg 8 in Tables 12 and 13).
[0230] As shown in Tables 12 and 13, most serotypes were
neutralized by the pooled human IgG at clinically relevant
concentrations. AAV-4 and AAV-8 were more resistant to
neutralization than AAV-1, AAV-2 and AAV-6, which were more
resistant to neutralization than AAV-3, which was more resistant to
neutralization than AAV-5.
B. Neutralization Activity of Caprine AAV Vs. Primate AAV
Serotypes
[0231] The neutralization activity of goat AAV was compared to
primate AAV-5 using the methods described above. Immunoreactivity
was determined using a purified pooled human IgG (designated IVIg 8
in Table 14). As shown in Table 14, caprine AAV displayed more
resistance to neutralization than AAV-5. Table 14 also shows the
neutralization activity of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6
and AAV-8, as determined in the above example, relative to the
caprine AAV.
[0232] In another experiment, the neutralization activity of
caprine AAV relative to AAV-8 was examined using three different
purified pools of human IgG, designated IVIg 3, IVIg 6 and IVIg 8,
respectively, in Tables 15 and 16. As shown in the tables, caprine
AAV was more resistant to neutralization than AAV-8 using all three
pools of human IgG.
TABLE-US-00014 TABLE 13 Lowest concentration of IVIG (mg/ml)
showing >50% neutralization of the virus Vector IVIG
(Panglobulin, ZLB Bioplasma, lot# 1838-00351)) AAV1 10 AAV2 10
AAV3B 1 AAV4 50 AAV5 0.1 AAV6 10 AAV8 50
TABLE-US-00015 TABLE 14 Lowest concentration of IVIG (mg/ml)
showing >50% neutralization of the virus Vector IVIG
(Panglobulin, ZLB Bioplasma, lot# 1838-00351)) AAV5 0.1 Caprine- 50
AAV
TABLE-US-00016 TABLE 16 Lowest concentration of IVIG (mg/ml)
showing >50% neutralization of the virus. IVIG (Panglobulin,
IVIG (Panglobulin, IVIG (Baxter, ZLB Bioplasma, ZLB Bioplasma,
Polygam S/D, Vector lot# 1838-00299) lot# 1838-00351) lot#
02J06AX11) AAV8 10 10 10 Caprine- 40 40 40 AAV
Example 7
Ability of Caprine AAV to Transduce Striatal Neurons and Glial
Cells and Comparison to Other AAVs
[0233] In order to examine the ability of the various AAVs to
transduce striatal neurons and glial cells, the following
experiment was done. Primary cultures of dissociated striatal
neurons were prepared from embryonic day 18 Sprague-Dawley rat
embryos. Dissected striatal tissue was minced into small pieces and
was incubated in trypsin for 30 min. The tissue was then triturated
through a Pasteur pipette and cells were plated at a density of
350,000 per well in 12-well culture dishes containing round glass
18 mm coverslips coated with poly-D-lysine. The culture medium was
neurobasal medium supplemented with 2% B-27, 0.5 mM L-glutamine and
25 mM L-glutamic acid. Cultures were maintained at 37.degree. C. in
5% CO.sub.2 and were used in experiments two to three weeks after
dissociation. At this stage, dopaminegic and striatal neurons are
distinguished both morphologically and by expression of biological
markers.
[0234] The striatal cultures were incubated for five days with
10.sup.4 MOI rAAV virions derived from AAV-2, AAV-4, AAV-5, AAV-6,
AAV-8, and caprine AAV that contained the .beta.-galactosidase gene
(LacZ), prepared using the triple transfection method described in
Example 1. For caprine AAV, the capsid coding sequence present in
pHLP19 (described in U.S. Pat. No. 6,001,650, incorporated herein
by reference in its entirety) was substituted with the caprine VP1
coding sequence as follows. Briefly, plasmid pHLP19 was digested
with SwaI and AgeI (New England Biolabs, Beverly, Mass.
01915-5599), the fragment of interest was purified on a 1%
low-melting agarose gel (FMC Bioproducts, Rockland, Me.), and used
for ligation with the PCR fragment containing the caprine capsid.
The caprine capsid PCR fragment was amplified using a forward
primer: AAATCAGGTATGTCTTTTGTTGATCACCC (SEQ ID NO:27) and a reverse
primer: ACACGAATTAACCGGTTTATTGAGGGTATGCGACATGAATGGG (SEQ ID NO:28).
The PCR fragment was digested with the enzyme AgeI (New England
Biolabs, Beverly, Mass. 01915-5599) and used for ligation with the
digested plasmid.
[0235] Efficient and sustained expression of the .beta.-gal protein
was seen in striatal neurons following transduction with the
vectors. Expression efficiency was highest in AAV6 followed by
AAV8, AAV2, AAV5, caprine AAV and AAV4. AAV6 transduced neurons
exclusively, whereas AAV5-mediated gene transfer was inefficient in
neurons but transduced the glial cells. All other vectors
transduced both neurons and glial cells.
Example 8
Ability of Caprine AAV to Transduce Muscle and Comparison to Other
AAVs
[0236] In order to determine the ability of the various AAVs to
transduce muscle in the presence or absence of IVIG, the following
experiment was done. Male SCID mice (15-25 g) were injected
intramuscularly with 2e11 vector genomes of caprine rAAV virions,
rAAV-1 virions, or rAAV-8 virions (5 mice per group), each of said
virions encoding human factor IX. These virions were made using the
triple transfection method described in Example 1. The capsid
coding sequence present in pHLP19 was substituted with the caprine
VP1 coding sequence as described above. Retro-orbital blood was
collected 1, and 2 weeks after vector injection and plasma was
extracted. Mice tested with IVIG (Carimune: purified immunoglobulin
from a pool of human serum, ZLB Bioplasma, lot#03287-00117) were
injected via the tail vein (250 .mu.l), 24 hours before the vector
injection. Human FIX was measured in the plasma samples using a
hFIX ELISA.
[0237] As shown in FIG. 17, caprine rAAV virions did not transduce
muscle. the rAAV-8 and rAAV-1 virions displayed similar levels of
expression of hFIX. AAV-1 was more resistant to neutralization than
AAV-8 in vivo.
Example 9
Ability of Caprine AAV to Transduce Liver and Comparison to Other
AAVs and Biodistribution of Proteins Expressed from Genes Delivered
by Caprine AAV Virions
[0238] In order to determine the ability of the various AAVs to
transduce liver in the presence or absence of IVIG, the following
experiment was done. Male SCID mice (15-25 g) were injected via the
tail vein with 5e11 vector genomes of caprine rAAV virions or
rAAV-8 virions (5 mice per group). The virions included the gene
encoding human factor IX (hFIX). The rAAV-2 virion data below was
from another experiment. In particular, the virions were generated
using plasmid pAAV-hFIX16, containing the human factor IX gene
under the control of a liver-specific promoter (described in Miao
et al., Mol. Ther. (2000) 1:522-532). Plasmid pAAV-hFIX16 is an
11,277 bp plasmid encoding a human Factor IX minigene. In this
construct, the FIX cDNA is interrupted between exons 1 and 2 with a
deleted form of intron 1 which has been shown to increase
expression of FIX. FIX expression is under the transcriptional
control of the ApoE hepatic control region (HCR) and the human
alpha 1 antitrypsin promoter (hAAT), as well as a bovine growth
hormone polyadenylation signal (gGH PA). The backbone of plasmid
pAAV-hFIX16 contains the .beta.-lactamase gene, conferring
ampicillin resistance, a bacterial origin of replication, a M13/F1
origin of replication, and a fragment of bacteriophage lambda DNA.
The lambda DNA increases the size of the plasmid backbone to 6,966
bp, which prevents its packaging during AAV vector production.
[0239] The recombinant AAV virions were produced using the triple
transfection method described above. For the caprine rAAV virions,
the VP1 coding sequence present in plasmid pHLP19 was substituted
with the caprine VP1 coding sequence as described above.
[0240] After injection, retro-orbital blood was collected 1, 2, 4
(5 mice per group) and 8 weeks (2 mice per group) after injection
and plasma was extracted. Mice tested with IVIG (Panglobulin:
purified immunoglobulin from a pool of human serum, ZLB Bioplasma,
lot#1838-00299) were injected via the tail vein (250 .mu.l), 24
hours before the vector injection. Human FIX was measured in the
plasma samples by a hFIX ELISA.
[0241] As shown in FIG. 18, transdution of liver with the
recombinant caprine AAV virions after intravenous administration
was low. Higher hFIX expression was seen using the rAAV-8 virions
than with the rAAV-2 virions, and rAAV-2 virions showed higher
expression than the caprine rAAV virions. The caprine rAAV virions
were more resistant to neutralization than the rAAV-2 virions in
vivo. Human FIX expression was reduced in the caprine rAAV-injected
mice with preexisting IVIG neutralizing titers of 120 while the
expression of hFIX was completely blocked in the rAAV-2-injected
mice with preexisting IVIG neutralizing titers of 10.
[0242] For biodistribution analysis, mice (2 mice per group) were
sacrificed and organs were collected 4 weeks after vector
injection. Organs collected included brain, testis, muscle
(quadriceps), kidney, spleen, lung, heart, and liver. To measure
hFIX, quantitative-PCR was done on DNA samples extracted from
different tissues. As shown in FIG. 19, biodistribution of
intravenously-administered caprine rAAV virions in male SCID mice
showed that the caprine rAAV virions had lung tropism.
Example 10
Isolation and Characterization of a New Bovine AAV
[0243] Evidence of parvovirus contamination was seen in bovine
adenovirus (BAV) type 8, strain Misk/67 (available from the ATCC,
Manassas, Va., Accession no. VR-769) isolated from calf lungs,
using techniques known in the art. This new isolate was named
"AAV-C1." AAV-C1 was partially amplified by PCR, and sequenced.
FIGS. 20A and 20B show the nucleotide sequence and amino acid
sequence respectively, of VP1 from AAV-C1. The VP1 amino acid
sequence from AAV-C1 was compared with other AAV VP1s. In
particular, FIGS. 21A-21H show a comparison of the amino acid
sequence of VP1 from AAV-C1 with primate AAV-1, AAV-2, AAV-3B,
AAV-4, AAV-6, AAV-8, AAV-5 and caprine AAV. Conserved amino acids
in the sequences are indicated by * and the accessibility of the
various amino acid positions based on the crystal structure is
shown. B indicates that the amino acid is buried between the inside
and outside surface. I indicates the amino acid is found on the
inside surface and O indicates the amino acid is found on the
outside surface.
[0244] VP1 from AAV-C1 displayed approximately 76% identity with
AAV-4. AAV-C1 displayed approximately 54% identity with AAV-5 VP1,
with high homology in the Rep protein, the first 137 amino acids of
AAV-5 VP1 and the non translated region after the stop of AAV-5 VP1
(not shown). Thus, AAV-C1 appears to be a natural hybrid between
AAV-5 and AAV-4. AAV-C1 also displayed approximately 58% sequence
identity with VP1s from AAV-2 and AAV-8, approximately 59% sequence
identity with VP1s from AAV-1 and AAV-6, and approximately 60%
sequence identity with VP1 from AAV-3B.
[0245] The sequence differences between AAV-4 and AAV-C1 were
scattered throughout the capsid, unlike the differences between
AAV-5 and caprine AAV (AAV-G1), wherein the changes were
exclusively in the C-terminal hypervariable region of VP1. The
similarity with the AAV-4 sequence was from the VP2 start to the
capsid stop. AAV-C1 appears to be one of the most divergent of the
mammalian AAVs with approximately 58% sequence homology with AAV-2.
In particular, the bovine AAV described in Schmidt et at. was
partially amplified from bovine adenovirus type 2. Comparison of
the nucleotide sequence of VP1 from AAV-C1 and the bovine AAV
described in Schmidt et al. showed 12 nucleotide changes 5 amino
acid differences. These differences occurred at positions 334 (Q
substituted for H present in AAV-C1 VP1), 464 (K substituted for N
present in AAV-C1 VP1), 465 (T substituted for K present in AAV-C1
VP1), 499 (R substituted for G present in AAV-C1 VP1) and 514 (G
substituted for R present in AAV-C1 VP1).
[0246] The full capsid of AAV-C1 was cloned in a plasmid that was
used to produce pseudotyped AAV-2 vectors. An AAV-C1 vector
containing the LacZ gene (AAV-C1-LacZ) was produced for further
characterization, using the triple transfection techniques
described above with the exception that the capsid sequence present
in pHLP19 was replaced with the bovine capsid sequence. The titer
of AAV-C1-LacZ (vg/ml) was calculated using quantitative PCR
(Q-PCR) as described above. As shown in Table 17, AAV-C1 LacZ
vector was produced efficiently; high titers of vector (2.45e10
vg/ml) were detected by Q-PCR. AAV-C1 LacZ vector showed efficient
transduction of cells in vitro (cells expressing LacZ were present
in numbers comparable to other AAVs).
TABLE-US-00017 TABLE 17 Q-PCR analysis of AAV-C1-LacZ vector.
Average Std dev Sample (vg/mL) (vg/mL) % CV AAV2-lacZ 1.11E+11
1.09E+10 9.9 AAV-C1-LacZ 2.45E+10 1.88E+09 7.7 LacZ reference
9.96E+12 7.11E+11 7.1
Example 11
Immunoreactivity of Bovine AAV and Comparison to Other AAVs
[0247] The neutralization activity of bovine AAV-C1 relative to
primate AAV-2 was assessed using the methods described above in
Example 6. Immunoreactivity was determined using a purified pooled
human IgG (IVIG-8, Panglobulin Lot #1838-00351, ZLB Bioplasma AG,
Berne, Switzerland). Neutralizing assays in vitro showed that
AAV-C1 was 16 times more resistant to neutralization by human WIG
than AAV-2. The lowest concentration of IVIG (mg/ml) showing more
than 50% neutralization of AAV-2 was 0.2 mg/ml while AAV-C1 was
3.25 mg/ml.
[0248] Thus, methods for making and using mutant AAV virions with
decreased immunoreactivity are described. Although preferred
embodiments of the subject invention have been described in some
detail, it is understood that obvious variations can be made
without departing from the spirit and the scope of the invention as
defined by the claims herein.
Sequence CWU 1
1
29131DNAArtificial Sequencechemically synthesized mutagenic oligo
1ccgctacagg gcgcgatatc agctcactca a 31258DNAArtificial
Sequencechemically synthesized polylinker 2ggatccggta ccgcccgggc
tctagaatcg atgtatacgt cgacgtttaa accatatg 58334DNAArtificial
Sequencechemically synthesized oligonucleotide used in the
mutagenesis 3agaggcccgg gcgttttagg gcggagtaac ttgc
34422DNAArtificial Sequencechemically synthesized oligonucleotide
used in the mutagenesis 4acatacccgc aggcgtagag ac
22510DNAArtificial Sequencechemically synthesized Not I
oligonucleotide 5agcggccgct 10630DNAArtificial Sequencechemically
synthesized linker "145NA/NB" 6ccaactccat cactaggggt tcctgcggcc
3078DNAArtificial Sequencechemically synthesized Sse I linker
7cctgcagg 8819DNAArtificial Sequencechemically synthesized lac Z
primer #LZ-1883F 8tgccactcgc tttaatgat 19919DNAArtificial
Sequencechemically synthesized lac Z primer #LZ-1948R 9tcgccgcaca
tctgaactt 191023DNAArtificial Sequencechemically synthesized lacZ
probe # LZ-1906T 10agcctccagt acagcgcggc tga 231112PRTArtificial
Sequencechemically synthesized inserted sequence 11Asp Ala Ser Asn
Asp Asn Leu Ser Ser Gln Ser Asp 1 5 10 12598PRTadeno-associated
virus 2 12Met Ala Pro Gly Lys Lys Arg Pro Val Glu His Ser Pro Val
Glu Pro 1 5 10 15 Asp Ser Ser Ser Gly Thr Gly Lys Ala Gly Gln Gln
Pro Ala Arg Lys 20 25 30 Arg Leu Asn Phe Gly Gln Thr Gly Asp Ala
Asp Ser Val Pro Asp Pro 35 40 45 Gln Pro Leu Gly Gln Pro Pro Ala
Ala Pro Ser Gly Leu Gly Thr Asn 50 55 60 Thr Met Ala Thr Gly Ser
Gly Ala Pro Met Ala Asp Asn Asn Glu Gly 65 70 75 80 Ala Asp Gly Val
Gly Asn Ser Ser Gly Asn Trp His Cys Asp Ser Thr 85 90 95 Trp Met
Gly Asp Arg Val Ile Thr Thr Ser Thr Arg Thr Trp Ala Leu 100 105 110
Pro Thr Tyr Asn Asn His Leu Tyr Lys Gln Ile Ser Ser Gln Ser Gly 115
120 125 Ala Ser Asn Asp Asn His Tyr Phe Gly Tyr Ser Thr Pro Trp Gly
Tyr 130 135 140 Phe Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg
Asp Trp Gln 145 150 155 160 Arg Leu Ile Asn Asn Asn Trp Gly Phe Arg
Pro Lys Arg Leu Asn Phe 165 170 175 Lys Leu Phe Asn Ile Gln Val Lys
Glu Val Thr Gln Asn Asp Gly Thr 180 185 190 Thr Thr Ile Ala Asn Asn
Leu Thr Ser Thr Val Gln Val Phe Thr Asp 195 200 205 Ser Glu Tyr Gln
Leu Pro Tyr Val Leu Gly Ser Ala His Gln Gly Cys 210 215 220 Leu Pro
Pro Phe Pro Ala Asp Val Phe Met Val Pro Gln Tyr Gly Tyr 225 230 235
240 Leu Thr Leu Asn Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr
245 250 255 Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg Thr Gly Asn
Asn Phe 260 265 270 Thr Phe Ser Tyr Thr Phe Glu Asp Val Pro Phe His
Ser Ser Tyr Ala 275 280 285 His Ser Gln Ser Leu Asp Arg Leu Met Asn
Pro Leu Ile Asp Gln Tyr 290 295 300 Leu Tyr Tyr Leu Ser Arg Thr Asn
Thr Pro Ser Gly Thr Thr Thr Gln 305 310 315 320 Ser Arg Leu Gln Phe
Ser Gln Ala Gly Ala Ser Asp Ile Arg Asp Gln 325 330 335 Ser Arg Asn
Trp Leu Pro Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser 340 345 350 Lys
Thr Ser Ala Asp Asn Asn Asn Ser Glu Tyr Ser Trp Thr Gly Ala 355 360
365 Thr Lys Tyr His Leu Asn Gly Arg Asp Ser Leu Val Asn Pro Gly Pro
370 375 380 Ala Met Ala Ser His Lys Asp Asp Glu Glu Lys Phe Phe Pro
Gln Ser 385 390 395 400 Gly Val Leu Ile Phe Gly Lys Gln Gly Ser Glu
Lys Thr Asn Val Asp 405 410 415 Ile Glu Lys Val Met Ile Thr Asp Glu
Glu Glu Ile Arg Thr Thr Asn 420 425 430 Pro Val Ala Thr Glu Gln Tyr
Gly Ser Val Ser Thr Asn Leu Gln Arg 435 440 445 Gly Asn Arg Gln Ala
Ala Thr Ala Asp Val Asn Thr Gln Gly Val Leu 450 455 460 Pro Gly Met
Val Trp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile 465 470 475 480
Trp Ala Lys Ile Pro His Thr Asp Gly His Phe His Pro Ser Pro Leu 485
490 495 Met Gly Gly Phe Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile
Lys 500 505 510 Asn Thr Pro Val Pro Ala Asn Pro Ser Thr Thr Phe Ser
Ala Ala Lys 515 520 525 Phe Ala Ser Phe Ile Thr Gln Tyr Ser Thr Gly
Gln Val Ser Val Glu 530 535 540 Ile Glu Trp Glu Leu Gln Lys Glu Asn
Ser Lys Arg Trp Asn Pro Glu 545 550 555 560 Ile Gln Tyr Thr Ser Asn
Tyr Asn Lys Ser Val Asn Val Asp Phe Thr 565 570 575 Val Asp Thr Asn
Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg 580 585 590 Tyr Leu
Thr Arg Asn Leu 595 13735PRTadeno-associated virus 2 13Met Ala Ala
Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser 1 5 10 15 Glu
Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro 20 25
30 Lys Pro Ala Glu Arg His Lys Asp Asp Ser Arg Gly Leu Val Leu Pro
35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly
Glu Pro 50 55 60 Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp
Lys Ala Tyr Asp 65 70 75 80 Arg Gln Leu Asp Ser Gly Asp Asn Pro Tyr
Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu
Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val
Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val
Glu Glu Pro Val Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val
Glu His Ser Pro Val Glu Pro Asp Ser Ser Ser Gly Thr Gly 145 150 155
160 Lys Ala Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr
165 170 175 Gly Asp Ala Asp Ser Val Pro Asp Pro Gln Pro Leu Gly Gln
Pro Pro 180 185 190 Ala Ala Pro Ser Gly Leu Gly Thr Asn Thr Met Ala
Thr Gly Ser Gly 195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala
Asp Gly Val Gly Asn Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser
Thr Trp Met Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg
Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln
Ile Ser Ser Gln Ser Gly Ala Ser Asn Asp Asn His Tyr 260 265 270 Phe
Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His 275 280
285 Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp
290 295 300 Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile
Gln Val 305 310 315 320 Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr
Ile Ala Asn Asn Leu 325 330 335 Thr Ser Thr Val Gln Val Phe Thr Asp
Ser Glu Tyr Gln Leu Pro Tyr 340 345 350 Val Leu Gly Ser Ala His Gln
Gly Cys Leu Pro Pro Phe Pro Ala Asp 355 360 365 Val Phe Met Val Pro
Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly Ser 370 375 380 Gln Ala Val
Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe Pro Ser 385 390 395 400
Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe Glu 405
410 415 Asp Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp
Arg 420 425 430 Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu
Ser Arg Thr 435 440 445 Asn Thr Pro Ser Gly Thr Thr Thr Gln Ser Arg
Leu Gln Phe Ser Gln 450 455 460 Ala Gly Ala Ser Asp Ile Arg Asp Gln
Ser Arg Asn Trp Leu Pro Gly 465 470 475 480 Pro Cys Tyr Arg Gln Gln
Arg Val Ser Lys Thr Ser Ala Asp Asn Asn 485 490 495 Asn Ser Glu Tyr
Ser Trp Thr Gly Ala Thr Lys Tyr His Leu Asn Gly 500 505 510 Arg Asp
Ser Leu Val Asn Pro Gly Pro Ala Met Ala Ser His Lys Asp 515 520 525
Asp Glu Glu Lys Phe Phe Pro Gln Ser Gly Val Leu Ile Phe Gly Lys 530
535 540 Gln Gly Ser Glu Lys Thr Asn Val Asp Ile Glu Lys Val Met Ile
Thr 545 550 555 560 Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala
Thr Glu Gln Tyr 565 570 575 Gly Ser Val Ser Thr Asn Leu Gln Arg Gly
Asn Arg Gln Ala Ala Thr 580 585 590 Ala Asp Val Asn Thr Gln Gly Val
Leu Pro Gly Met Val Trp Gln Asp 595 600 605 Arg Asp Val Tyr Leu Gln
Gly Pro Ile Trp Ala Lys Ile Pro His Thr 610 615 620 Asp Gly His Phe
His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu Lys 625 630 635 640 His
Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asn 645 650
655 Pro Ser Thr Thr Phe Ser Ala Ala Lys Phe Ala Ser Phe Ile Thr Gln
660 665 670 Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu
Gln Lys 675 680 685 Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr
Thr Ser Asn Tyr 690 695 700 Asn Lys Ser Val Asn Val Asp Phe Thr Val
Asp Thr Asn Gly Val Tyr 705 710 715 720 Ser Glu Pro Arg Pro Ile Gly
Thr Arg Tyr Leu Thr Arg Asn Leu 725 730 735
142172DNAadeno-associated virus 5 14atgtcttttg ttgatcaccc
tccagattgg ttggaagaag ttggtgaagg tcttcgcgag 60tttttgggcc ttgaagcggg
cccaccgaaa ccaaaaccca atcagcagca tcaagatcaa 120gcccgtggtc
ttgtgctgcc tggttataac tatctcggac ccggaaacgg tctcgatcga
180ggagagcctg tcaacagggc agacgaggtc gcgcgagagc acgacatctc
gtacaacgag 240cagcttgagg cgggagacaa cccctacctc aagtacaacc
acgcggacgc cgagtttcag 300gagaagctcg ccgacgacac atccttcggg
ggaaacctcg gaaaggcagt ctttcaggcc 360aagaaaaggg ttctcgaacc
ttttggcctg gttgaagagg gtgctaagac ggcccctacc 420ggaaagcgga
tagacgacca ctttccaaaa agaaagaagg ctcggaccga agaggactcc
480aagccttcca cctcgtcaga cgccgaagct ggacccagcg gatcccagca
gctgcaaatc 540ccagcccaac cagcctcaag tttgggagct gatacaatgt
ctgcgggagg tggcggccca 600ttgggcgaca ataaccaagg tgccgatgga
gtgggcaatg cctcgggaga ttggcattgc 660gattccacgt ggatggggga
cagagtcgtc accaagtcca cccgaacctg ggtgctgccc 720agctacaaca
accaccagta ccgagagatc aaaagcggct ccgtcgacgg aagcaacgcc
780aacgcctact ttggatacag caccccctgg gggtactttg actttaaccg
cttccacagc 840cactggagcc cccgagactg gcaaagactc atcaacaact
actggggctt cagaccccgg 900tccctcagag tcaaaatctt caacattcaa
gtcaaagagg tcacggtgca ggactccacc 960accaccatcg ccaacaacct
cacctccacc gtccaagtgt ttacggacga cgactaccag 1020ctgccctacg
tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc tccgcaggtc
1080tttacgctgc cgcagtacgg ttacgcgacg ctgaaccgcg acaacacaga
aaatcccacc 1140gagaggagca gcttcttctg cctagagtac tttcccagca
agatgctgag aacgggcaac 1200aactttgagt ttacctacaa ctttgaggag
gtgcccttcc actccagctt cgctcccagt 1260cagaacctgt tcaagctggc
caacccgctg gtggaccagt acttgtaccg cttcgtgagc 1320acaaataaca
ctggcggagt ccagttcaac aagaacctgg ccgggagata cgccaacacc
1380tacaaaaact ggttcccggg gcccatgggc cgaacccagg gctggaacct
gggctccggg 1440gtcaaccgcg ccagtgtcag cgccttcgcc acgaccaata
ggatggagct cgagggcgcg 1500agttaccagg tgcccccgca gccgaacggc
atgaccaaca acctccaggg cagcaacacc 1560tatgccctgg agaacactat
gatcttcaac agccagccgg cgaacccggg caccaccgcc 1620acgtacctcg
agggcaacat gctcatcacc agcgagagcg agacgcagcc ggtgaaccgc
1680gtggcgtaca acgtcggcgg gcagatggcc accaacaacc agagctccac
cactgccccc 1740gcgaccggca cgtacaacct ccaggaaatc gtgcccggca
gcgtgtggat ggagagggac 1800gtgtacctcc aaggacccat ctgggccaag
atcccagaga cgggggcgca ctttcacccc 1860tctccggcca tgggcggatt
cggactcaaa cacccaccgc ccatgatgct catcaagaac 1920acgcctgtgc
ccggaaatat caccagcttc tcggacgtgc ccgtcagcag cttcatcacc
1980cagtacagca ccgggcaggt caccgtggag atggagtggg agctcaagaa
ggaaaactcc 2040aagaggtgga acccagagat ccagtacaca aacaactaca
acgaccccca gtttgtggac 2100tttgccccgg acagcaccgg ggaatacaga
accaccagac ctatcggaac ccgatacctt 2160acccgacccc tt
2172152181DNAadeno-associated virus 15atgtcttttg ttgatcaccc
tccagattgg ttggaagaag ttggtgaagg tcttcgcgag 60tttttgggcc ttgaagcggg
cccaccgaaa ccaaaaccca atcagcagca tcaagatcaa 120gcccgtggtc
ttgtgctgcc tggttataac tatctcggac ccggaaacgg tctcgatcga
180ggagagcctg tcaacagggc agacgaggtc gcgcgagagc acgacatctc
gtacaacgag 240cagcttgagg cgggagacaa cccctacctc aagtacaacc
acgcggacgc cgagtttcag 300gagaagctcg ccgacgacac atccttcggg
ggaaacctcg gaaaggcagt ctttcaggcc 360aagaaaaggg ttctcgaacc
ttttggcctg gttgaagagg gtgctaagac ggcccctacc 420ggaaagcgga
tagacgacca ctttccaaaa agaaagaagg ctcggaccga agaggactcc
480aagccttcca cctcgtcaga cgccgaagct ggacccagcg gatcccagca
gctgcaaatc 540ccagcacaac cagcctcaag tttgggagct gatacaatgt
ctgcgggagg tggcggccca 600ttgggcgaca ataaccaagg tgccgatgga
gtgggcaatg cctcgggaga ttggcattgc 660gattccacgt ggatggggga
cagagtcgtc accaagtcca cccgcacctg ggtgctgccc 720agctacaaca
accaccagta ccgagagatc aaaagcggct ccgtcgacgg aagcaacgcc
780aacgcctact ttggatacag caccccctgg gggtactttg actttaaccg
cttccacagc 840cactggagcc cccgagactg gcaaagactc atcaacaact
attggggctt cagaccccgg 900tctctcagag tcaaaatctt caacatccaa
gtcaaagagg tcacggtgca ggactccacc 960accaccatcg ccaacaacct
cacctccacc gtccaagtgt ttacggacga cgactaccaa 1020ctcccgtacg
tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc cccgcaggtc
1080tttacgctgc cgcagtacgg ctacgcgacg ctgaaccgag acaacggaga
caacccgaca 1140gagcggagca gcttcttttg cctagagtac tttcccagca
agatgctgag gacgggcaac 1200aactttgagt ttacctacag ctttgaagag
gtgcccttcc actgcagctt cgccccgagc 1260cagaacctct ttaagctggc
caacccgctg gtggaccagt acctgtaccg cttcgtgagc 1320acctcggcca
cgggcgccat ccagttccaa aagaacctgg cgggcagata cgccaacacc
1380tacaaaaact ggttcccggg gcccatgggc cgaacccagg gctggaacac
gagctctggg 1440gtcagcagca ccaacagagt cagcgtcaac aacttttccg
tctcaaaccg gatgaacctg 1500gagggggcca gctaccaagt gaacccccag
cccaacggga tgacaaacac gctccaaggc 1560agcaaccgct acgcgctgga
aaacaccatg atcttcaacg ctcaaaacgc cacgccggga 1620actacctcgg
tgtacccaga ggacaatcta ctgctgacca gcgagagcga gactcagccc
1680gtcaaccggg tggcttacaa cacgggcggt cagatggcca ccaacgccca
gaacgccacc 1740acggctccca cggtcgggac ctacaacctc caggaagtgc
ttcctggcag cgtatggatg 1800gagagggacg tgtacctcca aggacccatc
tgggccaaga tcccagagac gggggcgcac 1860tttcacccct ctccggccat
gggcggattc ggactcaaac acccgccgcc catgatgctc 1920atcaaaaaca
cgccggtgcc cggcaacatc accagcttct cggacgtgcc cgtcagcagc
1980ttcatcaccc agtacagcac cgggcaggtc accgtggaga tggaatggga
gctcaaaaag 2040gaaaactcca agaggtggaa cccagagatc cagtacacca
acaactacaa cgacccccag 2100tttgtggact ttgctccaga cggctccggc
gaatacagaa ccaccagagc catcggaacc 2160cgatacctca cccgacccct t
218116724PRTadeno-associated virus 5 16Met Ser Phe Val Asp His Pro
Pro Asp Trp Leu Glu Glu Val Gly Glu 1 5 10 15 Gly Leu Arg Glu Phe
Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20 25 30 Pro Asn Gln
Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr
Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu
Pro Val 50 55 60 Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile
Ser Tyr Asn Glu 65 70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu
Lys Tyr Asn His Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu Ala
Asp Asp Thr Ser Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val Phe
Gln Ala Lys Lys Arg Val Leu Glu Pro Phe 115 120 125 Gly Leu Val Glu
Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile 130 135 140 Asp Asp
His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser 145 150 155
160 Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln
165 170 175 Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala
Asp Thr 180 185 190 Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn
Asn Gln Gly Ala 195 200 205 Asp Gly Val Gly Asn Ala Ser Gly Asp Trp
His Cys Asp Ser Thr Trp 210 215 220 Met Gly Asp Arg Val Val Thr Lys
Ser Thr Arg Thr Trp Val Leu Pro 225 230 235 240 Ser Tyr Asn Asn His
Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp 245 250 255 Gly Ser Asn
Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr 260 265 270 Phe
Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln 275 280
285 Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val
290 295 300 Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp
Ser Thr 305 310 315 320 Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val
Gln Val Phe Thr Asp 325 330 335 Asp Asp Tyr Gln Leu Pro Tyr Val Val
Gly Asn Gly Thr Glu Gly Cys 340 345 350 Leu Pro Ala Phe Pro Pro Gln
Val Phe Thr Leu Pro Gln Tyr Gly Tyr 355 360 365 Ala Thr Leu Asn Arg
Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser 370 375 380 Phe Phe Cys
Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn 385 390 395 400
Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser 405
410 415 Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val
Asp 420 425 430 Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly
Gly Val Gln 435 440 445 Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn
Thr Tyr Lys Asn Trp 450 455 460 Phe Pro Gly Pro Met Gly Arg Thr Gln
Gly Trp Asn Leu Gly Ser Gly 465 470 475 480 Val Asn Arg Ala Ser Val
Ser Ala Phe Ala Thr Thr Asn Arg Met Glu 485 490 495 Leu Glu Gly Ala
Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr 500 505 510 Asn Asn
Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile 515 520 525
Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu 530
535 540 Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn
Arg 545 550 555 560 Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn
Asn Gln Ser Ser 565 570 575 Thr Thr Ala Pro Ala Thr Gly Thr Tyr Asn
Leu Gln Glu Ile Val Pro 580 585 590 Gly Ser Val Trp Met Glu Arg Asp
Val Tyr Leu Gln Gly Pro Ile Trp 595 600 605 Ala Lys Ile Pro Glu Thr
Gly Ala His Phe His Pro Ser Pro Ala Met 610 615 620 Gly Gly Phe Gly
Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn 625 630 635 640 Thr
Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser 645 650
655 Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met Glu
660 665 670 Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu
Ile Gln 675 680 685 Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp
Phe Ala Pro Asp 690 695 700 Ser Thr Gly Glu Tyr Arg Thr Thr Arg Pro
Ile Gly Thr Arg Tyr Leu 705 710 715 720 Thr Arg Pro Leu
17726PRTadeno-associated virus 5 17Met Ser Phe Val Asp His Pro Pro
Asp Trp Leu Glu Glu Val Gly Glu 1 5 10 15 Gly Leu Arg Glu Phe Leu
Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20 25 30 Pro Asn Gln Gln
His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr Asn
Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val 50 55 60
Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu 65
70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His
Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser
Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val Phe Gln Ala Lys Lys
Arg Val Leu Glu Pro Phe 115 120 125 Gly Leu Val Glu Glu Gly Ala Lys
Thr Ala Pro Thr Gly Lys Arg Ile 130 135 140 Asp Asp His Phe Pro Lys
Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser 145 150 155 160 Lys Pro Ser
Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln 165 170 175 Gln
Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr 180 185
190 Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala
195 200 205 Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys Asp Ser
Thr Trp 210 215 220 Met Gly Asp Arg Val Val Thr Lys Ser Thr Arg Thr
Trp Val Leu Pro 225 230 235 240 Ser Tyr Asn Asn His Gln Tyr Arg Glu
Ile Lys Ser Gly Ser Val Asp 245 250 255 Gly Ser Asn Ala Asn Ala Tyr
Phe Gly Tyr Ser Thr Pro Trp Gly Tyr 260 265 270 Phe Asp Phe Asn Arg
Phe His Ser His Trp Ser Pro Arg Asp Trp Gln 275 280 285 Arg Leu Ile
Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val 290 295 300 Lys
Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr 305 310
315 320 Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr
Asp 325 330 335 Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr
Glu Gly Cys 340 345 350 Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu
Pro Gln Tyr Gly Tyr 355 360 365 Ala Thr Leu Asn Arg Asp Asn Gly Asp
Asn Pro Thr Glu Arg Ser Ser 370 375 380 Phe Phe Cys Leu Glu Tyr Phe
Pro Ser Lys Met Leu Arg Thr Gly Asn 385 390 395 400 Asn Phe Glu Phe
Thr Tyr Ser Phe Glu Glu Val Pro Phe His Cys Ser 405 410 415 Phe Ala
Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp 420 425 430
Gln Tyr Leu Tyr Arg Phe Val Ser Thr Ser Ala Thr Gly Ala Ile Gln 435
440 445 Phe Gln Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn
Trp 450 455 460 Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Thr
Ser Ser Gly 465 470 475 480 Ser Ser Thr Asn Arg Val Ser Val Asn Asn
Phe Ser Val Ser Asn Arg 485 490 495 Met Asn Leu Glu Gly Ala Ser Tyr
Gln Val Asn Pro Gln Pro Asn Gly 500 505 510 Met Thr Asn Thr Leu Gln
Gly Ser Asn Arg Tyr Ala Leu Glu Asn Thr 515 520 525 Met Ile Phe Asn
Ala Gln Asn Ala Thr Pro Gly Thr Thr Ser Val Tyr 530 535 540 Pro Glu
Asp Asn Leu Leu Leu Thr Ser Glu Ser Glu Thr Gln Pro Val 545 550 555
560 Asn Arg Val Ala Tyr Asn Thr Gly Gly Gln Met Ala Thr Asn Ala Gln
565 570 575 Asn Ala Thr Thr Ala Pro Thr Val Gly Thr Tyr Asn Leu Gln
Glu Val 580 585 590 Leu Pro Gly Ser Val Trp Met Glu Arg Asp Val Tyr
Leu Gln Gly Pro 595 600 605 Ile Trp Ala Lys Ile Pro Glu Thr Gly Ala
His Phe His Pro Ser Pro 610 615 620 Ala Met Gly Gly Phe Gly Leu Lys
His Pro Pro Pro Met Met Leu Ile 625 630 635 640 Lys Asn Thr Pro Val
Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro 645 650 655 Val Ser Ser
Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu 660 665 670 Met
Glu Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu 675 680
685 Ile Gln Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp Phe Ala
690 695 700 Pro Asp Gly Ser Gly Glu Tyr Arg Thr Thr Arg Ala Ile Gly
Thr Arg 705 710 715 720 Tyr Leu Thr Arg Pro Leu 725
18736PRTadeno-associated virus 3B 18Met Ala Ala Asp Gly Tyr Leu Pro
Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp
Trp Ala Leu Lys Pro Gly Pro Pro Gln Pro 20 25 30 Lys Ala Ala Glu
Arg His Lys Asp Asp Ser Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr
Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60
Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65
70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn
His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr
Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys
Lys Arg Ile Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Ala Ala
Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Asp Gln Ser Pro
Gln Glu Pro Asp Ser Ser Ser Gly Val Gly 145 150 155 160 Lys Ser Gly
Lys Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly
Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180 185
190 Ala Ala Pro Thr Ser Leu Gly Ser Asn Thr Met Ala Ser Gly Gly Gly
195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly
Asn Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly
Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu
Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser Gln
Ser Gly Ala Ser Asn Asp Asn His Tyr 260 265 270 Phe Gly Tyr Ser Thr
Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe His 275 280 285 Cys His Phe
Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn Trp 290 295 300 Gly
Phe Arg Pro Lys Lys Leu Ser Phe Lys Leu Phe Asn Ile Gln Val 305 310
315 320 Lys Glu Val Thr Gln Asn Asp Gly Thr Thr Thr Ile Ala Asn Asn
Leu 325 330 335 Thr Ser Thr Val Gln Val Phe Thr Asp Ser Glu Tyr Gln
Leu Pro Tyr 340 345 350 Val Leu Gly Ser Ala His Gln Gly Cys Leu Pro
Pro Phe Pro Ala Asp 355 360 365 Val Phe Met Val Pro Gln Tyr Gly Tyr
Leu Thr Leu Asn Asn Gly Ser 370 375 380 Gln Ala Val Gly Arg Ser Ser
Phe Tyr Cys Leu Glu Tyr Phe Pro Ser 385 390 395 400 Gln Met Leu Arg
Thr Gly Asn Asn Phe Gln Phe Ser Tyr Thr Phe Glu 405 410 415 Asp Val
Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp Arg 420 425 430
Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg Thr 435
440 445 Gln Gly Thr Thr Ser Gly Thr Thr Asn Gln Ser Arg Leu Leu Phe
Ser 450 455 460 Gln Ala Gly Pro Gln Ser Met Ser Leu Gln Ala Arg Asn
Trp Leu Pro 465 470 475 480 Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser
Lys Thr Ala Asn Asp Asn 485 490 495 Asn Asn Ser Asn Phe Pro Trp Thr
Ala Ala Ser Lys Tyr His Leu Asn 500 505 510 Gly Arg Asp Ser Leu Val
Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525 Asp Asp Glu Glu
Lys Phe Phe Pro Met His Gly Asn Leu Ile Phe Gly 530 535 540 Lys Glu
Gly Thr Thr Ala Ser Asn Ala Glu Leu Asp Asn Val Met Ile 545 550 555
560 Thr Asp Glu Glu Glu Ile Arg Thr Thr Asn Pro Val Ala Thr Glu Gln
565 570 575 Tyr Gly Thr Val Ala Asn Asn Leu Gln Ser Ser Asn Thr Ala
Pro Thr 580 585 590 Thr Arg Thr Val Asn Asp Gln Gly Ala Leu Pro Gly
Met Val Trp Gln 595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile
Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly His Phe His Pro Ser
Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys His Pro Pro Pro
Gln Ile Met Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asn Pro Pro
Thr Thr Phe Ser Pro Ala Lys Phe Ala Ser Phe Ile Thr 660 665 670 Gln
Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680
685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn
690 695 700 Tyr Asn Lys Ser Val Asn Val Asp Phe Thr Val Asp Thr Asn
Gly Val 705 710 715 720 Tyr Ser Glu Pro Arg Pro Ile Gly Thr Arg Tyr
Leu Thr Arg Asn Leu 725 730 735 19736PRTadeno-associated virus 6
19Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1
5 10 15 Glu Gly Ile Arg Glu Trp Trp Asp Leu Lys Pro Gly Ala Pro Lys
Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu
Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu
Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu
Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp
Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln
Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly
Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Phe
Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135
140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly
145 150 155 160 Lys Thr Gly Gln Gln Pro Ala Lys Lys Arg Leu
Asn Phe Gly Gln Thr 165 170 175 Gly Asp Ser Glu Ser Val Pro Asp Pro
Gln Pro Leu Gly Glu Pro Pro 180 185 190 Ala Thr Pro Ala Ala Val Gly
Pro Thr Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Met Ala Asp
Asn Asn Glu Gly Ala Asp Gly Val Gly Asn Ala 210 215 220 Ser Gly Asn
Trp His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val Ile 225 230 235 240
Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245
250 255 Tyr Lys Gln Ile Ser Ser Ala Ser Thr Gly Ala Ser Asn Asp Asn
His 260 265 270 Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe
Asn Arg Phe 275 280 285 His Cys His Phe Ser Pro Arg Asp Trp Gln Arg
Leu Ile Asn Asn Asn 290 295 300 Trp Gly Phe Arg Pro Lys Arg Leu Asn
Phe Lys Leu Phe Asn Ile Gln 305 310 315 320 Val Lys Glu Val Thr Thr
Asn Asp Gly Val Thr Thr Ile Ala Asn Asn 325 330 335 Leu Thr Ser Thr
Val Gln Val Phe Ser Asp Ser Glu Tyr Gln Leu Pro 340 345 350 Tyr Val
Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe Pro Ala 355 360 365
Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asn Gly 370
375 380 Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe
Pro 385 390 395 400 Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Thr Phe
Ser Tyr Thr Phe 405 410 415 Glu Asp Val Pro Phe His Ser Ser Tyr Ala
His Ser Gln Ser Leu Asp 420 425 430 Arg Leu Met Asn Pro Leu Ile Asp
Gln Tyr Leu Tyr Tyr Leu Asn Arg 435 440 445 Thr Gln Asn Gln Ser Gly
Ser Ala Gln Asn Lys Asp Leu Leu Phe Ser 450 455 460 Arg Gly Ser Pro
Ala Gly Met Ser Val Gln Pro Lys Asn Trp Leu Pro 465 470 475 480 Gly
Pro Cys Tyr Arg Gln Gln Arg Val Ser Lys Thr Lys Thr Asp Asn 485 490
495 Asn Asn Ser Asn Phe Thr Trp Thr Gly Ala Ser Lys Tyr Asn Leu Asn
500 505 510 Gly Arg Glu Ser Ile Ile Asn Pro Gly Thr Ala Met Ala Ser
His Lys 515 520 525 Asp Asp Lys Asp Lys Phe Phe Pro Met Ser Gly Val
Met Ile Phe Gly 530 535 540 Lys Glu Ser Ala Gly Ala Ser Asn Thr Ala
Leu Asp Asn Val Met Ile 545 550 555 560 Thr Asp Glu Glu Glu Ile Lys
Ala Thr Asn Pro Val Ala Thr Glu Arg 565 570 575 Phe Gly Thr Val Ala
Val Asn Leu Gln Ser Ser Ser Thr Asp Pro Ala 580 585 590 Thr Gly Asp
Val His Val Met Gly Ala Leu Pro Gly Met Val Trp Gln 595 600 605 Asp
Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His 610 615
620 Thr Asp Gly His Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Leu
625 630 635 640 Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro
Val Pro Ala 645 650 655 Asn Pro Pro Ala Glu Phe Ser Ala Thr Lys Phe
Ala Ser Phe Ile Thr 660 665 670 Gln Tyr Ser Thr Gly Gln Val Ser Val
Glu Ile Glu Trp Glu Leu Gln 675 680 685 Lys Glu Asn Ser Lys Arg Trp
Asn Pro Glu Val Gln Tyr Thr Ser Asn 690 695 700 Tyr Ala Lys Ser Ala
Asn Val Asp Phe Thr Val Asp Asn Asn Gly Leu 705 710 715 720 Tyr Thr
Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Pro Leu 725 730 735
20736PRTadeno-associated virus 1 20Met Ala Ala Asp Gly Tyr Leu Pro
Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp
Trp Asp Leu Lys Pro Gly Ala Pro Lys Pro 20 25 30 Lys Ala Asn Gln
Gln Lys Gln Asp Asp Gly Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr
Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60
Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65
70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Arg Tyr Asn
His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Gln Glu Asp Thr
Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys
Lys Arg Val Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Gly Ala
Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro
Gln Glu Pro Asp Ser Ser Ser Gly Ile Gly 145 150 155 160 Lys Thr Gly
Gln Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly
Asp Ser Glu Ser Val Pro Asp Pro Gln Pro Leu Gly Glu Pro Pro 180 185
190 Ala Thr Pro Ala Ala Val Gly Pro Thr Thr Met Ala Ser Gly Gly Gly
195 200 205 Ala Pro Met Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly
Asn Ala 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Thr Trp Leu Gly
Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu
Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Ser Ala
Ser Thr Gly Ala Ser Asn Asp Asn His 260 265 270 Tyr Phe Gly Tyr Ser
Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg Phe 275 280 285 His Cys His
Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn Asn 290 295 300 Trp
Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile Gln 305 310
315 320 Val Lys Glu Val Thr Thr Asn Asp Gly Val Thr Thr Ile Ala Asn
Asn 325 330 335 Leu Thr Ser Thr Val Gln Val Phe Ser Asp Ser Glu Tyr
Gln Leu Pro 340 345 350 Tyr Val Leu Gly Ser Ala His Gln Gly Cys Leu
Pro Pro Phe Pro Ala 355 360 365 Asp Val Phe Met Ile Pro Gln Tyr Gly
Tyr Leu Thr Leu Asn Asn Gly 370 375 380 Ser Gln Ala Val Gly Arg Ser
Ser Phe Tyr Cys Leu Glu Tyr Phe Pro 385 390 395 400 Ser Gln Met Leu
Arg Thr Gly Asn Asn Phe Thr Phe Ser Tyr Thr Phe 405 410 415 Glu Glu
Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu Asp 420 425 430
Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Asn Arg 435
440 445 Thr Gln Asn Gln Ser Gly Ser Ala Gln Asn Lys Asp Leu Leu Phe
Ser 450 455 460 Arg Gly Ser Pro Ala Gly Met Ser Val Gln Pro Lys Asn
Trp Leu Pro 465 470 475 480 Gly Pro Cys Tyr Arg Gln Gln Arg Val Ser
Lys Thr Lys Thr Asp Asn 485 490 495 Asn Asn Ser Asn Phe Thr Trp Thr
Gly Ala Ser Lys Tyr Asn Leu Asn 500 505 510 Gly Arg Glu Ser Ile Ile
Asn Pro Gly Thr Ala Met Ala Ser His Lys 515 520 525 Asp Asp Glu Asp
Lys Phe Phe Pro Met Ser Gly Val Met Ile Phe Gly 530 535 540 Lys Glu
Ser Ala Gly Ala Ser Asn Thr Ala Leu Asp Asn Val Met Ile 545 550 555
560 Thr Asp Glu Glu Glu Ile Lys Ala Thr Asn Pro Val Ala Thr Glu Arg
565 570 575 Phe Gly Thr Val Ala Val Asn Phe Gln Ser Ser Ser Thr Asp
Pro Ala 580 585 590 Thr Gly Asp Val His Ala Met Gly Ala Leu Pro Gly
Met Val Trp Gln 595 600 605 Asp Arg Asp Val Tyr Leu Gln Gly Pro Ile
Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly His Phe His Pro Ser
Pro Leu Met Gly Gly Phe Gly Leu 625 630 635 640 Lys Asn Pro Pro Pro
Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asn Pro Pro
Ala Glu Phe Ser Ala Thr Lys Phe Ala Ser Phe Ile Thr 660 665 670 Gln
Tyr Ser Thr Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln 675 680
685 Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Val Gln Tyr Thr Ser Asn
690 695 700 Tyr Ala Lys Ser Ala Asn Val Asp Phe Thr Val Asp Asn Asn
Gly Leu 705 710 715 720 Tyr Thr Glu Pro Arg Pro Ile Gly Thr Arg Tyr
Leu Thr Arg Pro Leu 725 730 735 21738PRTadeno-associated virus 8
21Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1
5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Lys
Pro 20 25 30 Lys Ala Asn Gln Gln Lys Gln Asp Asp Gly Arg Gly Leu
Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu
Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu
Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Gln Ala Gly Asp
Asn Pro Tyr Leu Arg Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln
Glu Arg Leu Gln Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly
Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro 115 120 125 Leu
Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135
140 Pro Val Glu Pro Ser Pro Gln Arg Ser Pro Asp Ser Ser Thr Gly Ile
145 150 155 160 Gly Lys Lys Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn
Phe Gly Gln 165 170 175 Thr Gly Asp Ser Glu Ser Val Pro Asp Pro Gln
Pro Leu Gly Glu Pro 180 185 190 Pro Ala Ala Pro Ser Gly Val Gly Pro
Asn Thr Met Ala Ala Gly Gly 195 200 205 Gly Ala Pro Met Ala Asp Asn
Asn Glu Gly Ala Asp Gly Val Gly Ser 210 215 220 Ser Ser Gly Asn Trp
His Cys Asp Ser Thr Trp Leu Gly Asp Arg Val 225 230 235 240 Ile Thr
Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His 245 250 255
Leu Tyr Lys Gln Ile Ser Asn Gly Thr Ser Gly Gly Ala Thr Asn Asp 260
265 270 Asn Thr Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe
Asn 275 280 285 Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg
Leu Ile Asn 290 295 300 Asn Asn Trp Gly Phe Arg Pro Lys Arg Leu Ser
Phe Lys Leu Phe Asn 305 310 315 320 Ile Gln Val Lys Glu Val Thr Gln
Asn Glu Gly Thr Lys Thr Ile Ala 325 330 335 Asn Asn Leu Thr Ser Thr
Ile Gln Val Phe Thr Asp Ser Glu Tyr Gln 340 345 350 Leu Pro Tyr Val
Leu Gly Ser Ala His Gln Gly Cys Leu Pro Pro Phe 355 360 365 Pro Ala
Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn 370 375 380
Asn Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr 385
390 395 400 Phe Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe
Thr Tyr 405 410 415 Thr Phe Glu Asp Val Pro Phe His Ser Ser Tyr Ala
His Ser Gln Ser 420 425 430 Leu Asp Arg Leu Met Asn Pro Leu Ile Asp
Gln Tyr Leu Tyr Tyr Leu 435 440 445 Ser Arg Thr Gln Thr Thr Gly Gly
Thr Ala Asn Thr Gln Thr Leu Gly 450 455 460 Phe Ser Gln Gly Gly Pro
Asn Thr Met Ala Asn Gln Ala Lys Asn Trp 465 470 475 480 Leu Pro Gly
Pro Cys Tyr Arg Gln Gln Arg Val Ser Thr Thr Thr Gly 485 490 495 Gln
Asn Asn Asn Ser Asn Phe Ala Trp Thr Ala Gly Thr Lys Tyr His 500 505
510 Leu Asn Gly Arg Asn Ser Leu Ala Asn Pro Gly Ile Ala Met Ala Thr
515 520 525 His Lys Asp Asp Glu Glu Arg Phe Phe Pro Ser Asn Gly Ile
Leu Ile 530 535 540 Phe Gly Lys Gln Asn Ala Ala Arg Asp Asn Ala Asp
Tyr Ser Asp Val 545 550 555 560 Met Leu Thr Ser Glu Glu Glu Ile Lys
Thr Thr Asn Pro Val Ala Thr 565 570 575 Glu Glu Tyr Gly Ile Val Ala
Asp Asn Leu Gln Gln Gln Asn Thr Ala 580 585 590 Pro Gln Ile Gly Thr
Val Asn Ser Gln Gly Ala Leu Pro Gly Met Val 595 600 605 Trp Gln Asn
Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile 610 615 620 Pro
His Thr Asp Gly Asn Phe His Pro Ser Pro Leu Met Gly Gly Phe 625 630
635 640 Gly Leu Lys His Pro Pro Pro Gln Ile Leu Ile Lys Asn Thr Pro
Val 645 650 655 Pro Ala Asn Pro Ser Thr Thr Phe Ser Ala Ala Lys Phe
Ala Ser Phe 660 665 670 Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val
Glu Ile Glu Trp Glu 675 680 685 Leu Gln Lys Glu Asn Ser Lys Arg Trp
Asn Pro Glu Ile Gln Tyr Thr 690 695 700 Ser Asn Tyr Tyr Lys Ser Thr
Ser Val Asp Phe Ala Val Asn Thr Glu 705 710 715 720 Gly Val Tyr Ser
Glu Pro Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg 725 730 735 Asn Leu
22733PRTadeno-associated virus 4 22Met Thr Asp Gly Tyr Leu Pro Asp
Trp Leu Glu Asp Asn Leu Ser Glu 1 5 10 15 Gly Val Arg Glu Trp Trp
Ala Leu Gln Pro Gly Ala Pro Lys Pro Lys 20 25 30 Ala Asn Gln Gln
His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr Lys
Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro Val 50 55 60
Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp Gln 65
70 75 80 Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His
Ala Asp 85 90 95 Ala Glu Phe Gln Gln Arg Leu Gln Gly Asp Thr Ser
Phe Gly Gly Asn 100 105 110 Leu Gly Arg Ala Val Phe Gln Ala Lys Lys
Arg Val Leu Glu Pro Leu 115 120 125 Gly Leu Val Glu Gln Ala Gly Glu
Thr Ala Pro Gly Lys Lys Arg Pro 130 135 140 Leu Ile Glu Ser Pro Gln
Gln Pro Asp Ser Ser Thr Gly Ile Gly Lys 145 150 155 160 Lys Gly Lys
Gln Pro Ala Lys Lys Lys Leu Val Phe Glu Asp Glu Thr 165 170 175 Gly
Ala Gly Asp Gly Pro Pro Glu Gly Ser Thr Ser Gly Ala Met Ser 180 185
190 Asp Asp Ser Glu Met Arg Ala Ala Ala Gly Gly Ala Ala Val Glu Gly
195 200 205 Gly Gln Gly Ala Asp Gly Val Gly Asn Ala Ser Gly Asp Trp
His Cys 210 215 220 Asp Ser Thr Trp Ser Glu Gly His Val Thr Thr Thr
Ser Thr Arg Thr 225 230 235 240 Trp Val Leu Pro Thr
Tyr Asn Asn His Leu Tyr Lys Arg Leu Gly Glu 245 250 255 Ser Leu Gln
Ser Asn Thr Tyr Asn Gly Phe Ser Thr Pro Trp Gly Tyr 260 265 270 Phe
Asp Phe Asn Arg Phe His Cys His Phe Ser Pro Arg Asp Trp Gln 275 280
285 Arg Leu Ile Asn Asn Asn Trp Gly Met Arg Pro Lys Ala Met Arg Val
290 295 300 Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Thr Ser Asn
Gly Glu 305 310 315 320 Thr Thr Val Ala Asn Asn Leu Thr Ser Thr Val
Gln Ile Phe Ala Asp 325 330 335 Ser Ser Tyr Glu Leu Pro Tyr Val Met
Asp Ala Gly Gln Glu Gly Ser 340 345 350 Leu Pro Pro Phe Pro Asn Asp
Val Phe Met Val Pro Gln Tyr Gly Tyr 355 360 365 Cys Gly Leu Val Thr
Gly Asn Thr Ser Gln Gln Gln Thr Asp Arg Asn 370 375 380 Ala Phe Tyr
Cys Leu Glu Tyr Phe Pro Ser Gln Met Leu Arg Thr Gly 385 390 395 400
Asn Asn Phe Glu Ile Thr Tyr Ser Phe Glu Lys Val Pro Phe His Ser 405
410 415 Met Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro Leu
Ile 420 425 430 Asp Gln Tyr Leu Trp Gly Leu Gln Ser Thr Thr Thr Thr
Thr Leu Asn 435 440 445 Ala Gly Thr Ala Thr Thr Asn Phe Thr Lys Leu
Arg Pro Thr Asn Phe 450 455 460 Ser Asn Phe Lys Lys Asn Trp Leu Pro
Gly Pro Ser Ile Lys Gln Gln 465 470 475 480 Gly Phe Ser Lys Thr Ala
Asn Gln Asn Tyr Lys Ile Pro Ala Thr Gly 485 490 495 Ser Asp Ser Leu
Ile Lys Tyr Glu Thr His Ser Thr Leu Asp Gly Arg 500 505 510 Trp Ser
Ala Leu Thr Pro Gly Pro Pro Met Ala Thr Ala Gly Pro Ala 515 520 525
Asp Ser Lys Phe Ser Asn Ser Gln Leu Ile Phe Ala Gly Pro Lys Gln 530
535 540 Asn Gly Asn Thr Ala Thr Val Pro Gly Thr Leu Ile Phe Thr Ser
Glu 545 550 555 560 Glu Glu Leu Ala Ala Thr Asn Ala Thr Asp Thr Asp
Met Trp Gly Asn 565 570 575 Leu Pro Gly Gly Asp Gln Ser Asn Ser Asn
Leu Pro Thr Val Asp Arg 580 585 590 Leu Thr Ala Leu Gly Ala Val Pro
Gly Met Val Trp Gln Asn Arg Asp 595 600 605 Ile Tyr Tyr Gln Gly Pro
Ile Trp Ala Lys Ile Pro His Thr Asp Gly 610 615 620 His Phe His Pro
Ser Pro Leu Ile Gly Gly Phe Gly Leu Lys His Pro 625 630 635 640 Pro
Pro Gln Ile Phe Ile Lys Asn Thr Pro Val Pro Ala Asn Pro Ala 645 650
655 Thr Thr Phe Ser Ser Thr Pro Val Asn Ser Phe Ile Thr Gln Tyr Ser
660 665 670 Thr Gly Gln Val Ser Val Gln Ile Asp Trp Glu Ile Gln Lys
Glu Arg 675 680 685 Ser Lys Arg Trp Asn Pro Glu Val Gln Phe Thr Ser
Asn Tyr Gly Gln 690 695 700 Gln Asn Ser Leu Leu Trp Ala Pro Asp Ala
Ala Gly Lys Tyr Thr Glu 705 710 715 720 Pro Arg Ala Ile Gly Thr Arg
Tyr Leu Thr His His Leu 725 730 2344DNAArtificial
Sequencechemically synthesized forward primer 1 23gtgcccttct
acggctgcgt caactggacc aatgagaact ttcc 442432DNAArtificial
Sequencechemically synthesized reverse primer 2 24ggaatcgcaa
tgccaatttc ctgaggcatt ac 32252211DNAadeno-associated virus C1
25atgtcttttg ttgaccaccc tccagattgg ttggaatcga tcggcgacgg ctttcgtgaa
60tttctcggcc ttgaggcggg tcccccgaaa cccaaggcca atcaacagaa gcaagataac
120gctcgaggtc ttgtgcttcc tgggtacaag tatcttggtc ctgggaacgg
ccttgataag 180ggcgatcctg tcaattttgc tgacgaggtt gcccgagagc
acgacctctc ctaccagaaa 240cagcttgagg cgggcgataa cccttacctc
aagtacaacc acgcggacgc agagtttcag 300gagaaactcg cttctgacac
ttcttttgga ggaaaccttg ggaaggctgt tttccaggct 360aaaaagagga
ttctcgaacc tcttggcctg gttgagacgc cggataaaac ggcgcctgcg
420gcaaaaaaga ggcctctaga gcagagtcct caagagccag actcctcgag
cggagttggc 480aagaaaggca aacagcctgc cagaaagaga ctcaactttg
acgacgaacc tggagccgga 540gacgggcctc ccccagaagg accatcttcc
ggagctatgt ctactgagac tgaaatgcgt 600gcagcagctg gcggaaatgg
tggcgatgcg ggacaaggtg ccgagggagt gggtaatgcc 660tccggtgatt
ggcattgcga ttccacttgg tcagagagcc acgtcaccac cacctcaacc
720cgcacctggg tcctgccgac ctacaacaac cacctgtacc tgcggctcgg
ctcgagcaac 780gccagcgaca ccttcaacgg attctccacc ccctggggat
actttgactt taaccgcttc 840cactgccact tctcgccaag agactggcaa
aggctcatca acaaccactg gggactgcgc 900cccaaaagca tgcaagtccg
catcttcaac atccaagtta aggaggtcac gacgtctaac 960ggggagacga
ccgtatccaa caacctcacc agcacggtcc atatctttgc ggacagcacg
1020tacgagctcc cgtacgtgat ggatgcaggt caggagggca gcttgcctcc
tttccccaac 1080gacgtgttca tggtgcctca gtacgggtac tgcggactgg
taaccggagg cagctctcaa 1140aaccagacag acagaaatgc cttctactgt
ctggagtact ttcccagcca gatgctgaga 1200accggaaaca actttgagat
ggtgtacaag tttgaaaacg tgcccttcca ctccatgtac 1260gctcacagcc
agagcctgga taggctgatg aacccgctgc tggaccagta cctgtgggaa
1320ctccagtcta ccacctctgg aggaactctc aaccagggca attcagccac
caactttgcc 1380aagctgacca acaaaaactt ttctggctac cgcaaaaact
ggctcccggg gcccatgatg 1440aagcagcaga gattctccaa gactgccagt
caaaactaca agattcccca gggaggaaac 1500aacagtctgc tccattatga
gaccagaact accctcgaca gaagatggag caattttgcc 1560ccgggaacgg
ccatggcaac cgcagccaac gacgccaccg acttctctca ggcccagctc
1620atctttgcgg ggcccaacat caccggcaac accaccacag atgccaataa
tctgatgttc 1680acttcagaag atgaacttag ggccaccaac ccccgggaca
ctgacctgtt tggccacctg 1740gcaaccaacc agcaaaacgc caccaccgtt
cctaccgtag acgacgtgga cggagtcggc 1800gtgtacccgg gaatggtgtg
gcaggacaga gacatttact accaagggcc catttgggcc 1860aaaattccac
acacggatgg acactttcac ccgtctcctc tcattggcgg atttggactg
1920aaaagcccgc ctccacaaat attcatcaaa aacactcctg tacccgccaa
tcccgcaacg 1980accttctctc cggccagaat caacagcttc atcacccagt
acagcaccgg acaggtggct 2040gtcaaaatag aatgggaaat ccagaaggag
cggtccaaga gatggaaccc agaggtccag 2100ttcacgtcca actacggagc
acaggactcg cttctctggg ctcccgacaa cgccggagcc 2160tacaaagagc
ccagggccat tggatcccga tacctcacca accacctcta g
221126736PRTadeno-associated virus C1 26Met Ser Phe Val Asp His Pro
Pro Asp Trp Leu Glu Ser Ile Gly Asp 1 5 10 15 Gly Phe Arg Glu Phe
Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys 20 25 30 Ala Asn Gln
Gln Lys Gln Asp Asn Ala Arg Gly Leu Val Leu Pro Gly 35 40 45 Tyr
Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Asp Pro Val 50 55
60 Asn Phe Ala Asp Glu Val Ala Arg Glu His Asp Leu Ser Tyr Gln Lys
65 70 75 80 Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His
Ala Asp 85 90 95 Ala Glu Phe Gln Glu Lys Leu Ala Ser Asp Thr Ser
Phe Gly Gly Asn 100 105 110 Leu Gly Lys Ala Val Phe Gln Ala Lys Lys
Arg Ile Leu Glu Pro Leu 115 120 125 Gly Leu Val Glu Thr Pro Asp Lys
Thr Ala Pro Ala Ala Lys Lys Arg 130 135 140 Pro Leu Glu Gln Ser Pro
Gln Glu Pro Asp Ser Ser Ser Gly Val Gly 145 150 155 160 Lys Lys Gly
Lys Gln Pro Ala Arg Lys Arg Leu Asn Phe Asp Asp Glu 165 170 175 Pro
Gly Ala Gly Asp Gly Pro Pro Pro Glu Gly Pro Ser Ser Gly Ala 180 185
190 Met Ser Thr Glu Thr Glu Met Arg Ala Ala Ala Gly Gly Asn Gly Gly
195 200 205 Asp Ala Gly Gln Gly Ala Glu Gly Val Gly Asn Ala Ser Gly
Asp Trp 210 215 220 His Cys Asp Ser Thr Trp Ser Glu Ser His Val Thr
Thr Thr Ser Thr 225 230 235 240 Arg Thr Trp Val Leu Pro Thr Tyr Asn
Asn His Leu Tyr Leu Arg Leu 245 250 255 Gly Ser Ser Asn Ala Ser Asp
Thr Phe Asn Gly Phe Ser Thr Pro Trp 260 265 270 Gly Tyr Phe Asp Phe
Asn Arg Phe His Cys His Phe Ser Pro Arg Asp 275 280 285 Trp Gln Arg
Leu Ile Asn Asn His Trp Gly Leu Arg Pro Lys Ser Met 290 295 300 Gln
Val Arg Ile Phe Asn Ile Gln Val Lys Glu Val Thr Thr Ser Asn 305 310
315 320 Gly Glu Thr Thr Val Ser Asn Asn Leu Thr Ser Thr Val His Ile
Phe 325 330 335 Ala Asp Ser Thr Tyr Glu Leu Pro Tyr Val Met Asp Ala
Gly Gln Glu 340 345 350 Gly Ser Leu Pro Pro Phe Pro Asn Asp Val Phe
Met Val Pro Gln Tyr 355 360 365 Gly Tyr Cys Gly Leu Val Thr Gly Gly
Ser Ser Gln Asn Gln Thr Asp 370 375 380 Arg Asn Ala Phe Tyr Cys Leu
Glu Tyr Phe Pro Ser Gln Met Leu Arg 385 390 395 400 Thr Gly Asn Asn
Phe Glu Met Val Tyr Lys Phe Glu Asn Val Pro Phe 405 410 415 His Ser
Met Tyr Ala His Ser Gln Ser Leu Asp Arg Leu Met Asn Pro 420 425 430
Leu Leu Asp Gln Tyr Leu Trp Glu Leu Gln Ser Thr Thr Ser Gly Gly 435
440 445 Thr Leu Asn Gln Gly Asn Ser Ala Thr Asn Phe Ala Lys Leu Thr
Asn 450 455 460 Lys Asn Phe Ser Gly Tyr Arg Lys Asn Trp Leu Pro Gly
Pro Met Met 465 470 475 480 Lys Gln Gln Arg Phe Ser Lys Thr Ala Ser
Gln Asn Tyr Lys Ile Pro 485 490 495 Gln Gly Gly Asn Asn Ser Leu Leu
His Tyr Glu Thr Arg Thr Thr Leu 500 505 510 Asp Arg Arg Trp Ser Asn
Phe Ala Pro Gly Thr Ala Met Ala Thr Ala 515 520 525 Ala Asn Asp Ala
Thr Asp Phe Ser Gln Ala Gln Leu Ile Phe Ala Gly 530 535 540 Pro Asn
Ile Thr Gly Asn Thr Thr Thr Asp Ala Asn Asn Leu Met Phe 545 550 555
560 Thr Ser Glu Asp Glu Leu Arg Ala Thr Asn Pro Arg Asp Thr Asp Leu
565 570 575 Phe Gly His Leu Ala Thr Asn Gln Gln Asn Ala Thr Thr Val
Pro Thr 580 585 590 Val Asp Asp Val Asp Gly Val Gly Val Tyr Pro Gly
Met Val Trp Gln 595 600 605 Asp Arg Asp Ile Tyr Tyr Gln Gly Pro Ile
Trp Ala Lys Ile Pro His 610 615 620 Thr Asp Gly His Phe His Pro Ser
Pro Leu Ile Gly Gly Phe Gly Leu 625 630 635 640 Lys Ser Pro Pro Pro
Gln Ile Phe Ile Lys Asn Thr Pro Val Pro Ala 645 650 655 Asn Pro Ala
Thr Thr Phe Ser Pro Ala Arg Ile Asn Ser Phe Ile Thr 660 665 670 Gln
Tyr Ser Thr Gly Gln Val Ala Val Lys Ile Glu Trp Glu Ile Gln 675 680
685 Lys Glu Arg Ser Lys Arg Trp Asn Pro Glu Val Gln Phe Thr Ser Asn
690 695 700 Tyr Gly Ala Gln Asp Ser Leu Leu Trp Ala Pro Asp Asn Ala
Gly Ala 705 710 715 720 Tyr Lys Glu Pro Arg Ala Ile Gly Ser Arg Tyr
Leu Thr Asn His Leu 725 730 735 2729DNAArtificial
Sequencechemically synthesized forward primer 27aaatcaggta
tgtcttttgt tgatcaccc 292843DNAArtificial Sequencechemically
synthesized reverse primer 28acacgaatta accggtttat tgagggtatg
cgacatgaat ggg 432911PRTArtificial SequenceChemically synthesized
inserted sequence 29His Lys Asp Asp Glu Ala Lys Phe Phe Pro Gln 1 5
10
* * * * *