U.S. patent application number 15/783156 was filed with the patent office on 2018-10-04 for compositions and methods for increasing telomerase activity.
This patent application is currently assigned to Telomerase Activation Sciences, Inc.. The applicant listed for this patent is Telomerase Activation Sciences, Inc.. Invention is credited to Steven FAUCE, Calvin Bruce HARLEY, Soo-Peang KHOR, Tong LIN, Zhu Z. PIROT, Mahesh RAMASESHAN, Premchandran H. RAMIYA.
Application Number | 20180280413 15/783156 |
Document ID | / |
Family ID | 43069009 |
Filed Date | 2018-10-04 |
United States Patent
Application |
20180280413 |
Kind Code |
A1 |
HARLEY; Calvin Bruce ; et
al. |
October 4, 2018 |
Compositions and Methods For Increasing Telomerase Activity
Abstract
The present invention relates to methods and compositions for
increasing telomerase activity in cells. Such compositions include
pharmaceutical formulations. The methods and compositions are
useful for treating diseases subject to treatment by an increase in
telomerase activity in cells or tissue of a patient. They are also
useful for enhancing replicative capacity of cells in culture, as
in ex vivo cell therapy and for enhancing proliferation of stem and
progenitor cells.
Inventors: |
HARLEY; Calvin Bruce;
(Murphys, CA) ; KHOR; Soo-Peang; (Saratoga,
CA) ; RAMASESHAN; Mahesh; (Sunnyvale, CA) ;
RAMIYA; Premchandran H.; (San Ramon, CA) ; PIROT; Zhu
Z.; (Redwood City, CA) ; FAUCE; Steven;
(Mountain View, CA) ; LIN; Tong; (Palo Alto,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Telomerase Activation Sciences, Inc. |
New York |
NY |
US |
|
|
Assignee: |
Telomerase Activation Sciences,
Inc.
New York
NY
|
Family ID: |
43069009 |
Appl. No.: |
15/783156 |
Filed: |
October 13, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14965333 |
Dec 10, 2015 |
9913851 |
|
|
15783156 |
|
|
|
|
13936823 |
Jul 8, 2013 |
9403866 |
|
|
14965333 |
|
|
|
|
12781515 |
May 17, 2010 |
8481721 |
|
|
13936823 |
|
|
|
|
61179305 |
May 18, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 35/00 20180101;
A61P 25/28 20180101; A61P 43/00 20180101; H05K 999/99 20130101;
A61P 25/00 20180101; A61K 31/56 20130101; A61P 7/00 20180101; A61P
31/12 20180101; A61P 31/18 20180101; A61P 1/16 20180101; A61P 17/02
20180101; A61P 27/02 20180101; A61P 7/06 20180101; A61P 11/06
20180101; C12N 9/1276 20130101; A61P 1/00 20180101; A61P 19/02
20180101; A61P 9/00 20180101; C07J 53/004 20130101; A61P 1/04
20180101; A61P 19/00 20180101; A61P 17/14 20180101; A61P 11/00
20180101; A61P 19/08 20180101; C07J 17/00 20130101; A61K 31/58
20130101; A61P 7/04 20180101; A61P 17/00 20180101 |
International
Class: |
A61K 31/58 20060101
A61K031/58; C07J 53/00 20060101 C07J053/00; A61K 31/56 20060101
A61K031/56; C07J 17/00 20060101 C07J017/00 |
Claims
1. A compound of formula I: ##STR00066## wherein X.sup.1, is
selected from keto, hydroxy, and ##STR00067## wherein X.sup.2 is
selected from keto, hydroxy, and ##STR00068## wherein X.sup.3 is
selected from keto, hydroxy, and ##STR00069## wherein at least one
of X.sup.1, X.sup.2, and X.sup.3 are ##STR00070## respectively;
wherein R.sup.1 or R.sup.2 are independently selected from
--CH(CH.sub.3).sub.2, and --CH(CH.sub.3)CH.sub.2CH.sub.3 and
pharmaceutically acceptable salts thereof.
2. The compound of claim 1, wherein X.sup.1 is ##STR00071## wherein
R.sup.1 is selected from the group consisting of
--CH(CH.sub.3).sub.2 or --CH(CH.sub.3)CH.sub.2CH.sub.3.
3. The compound of claim 1, wherein X.sup.2 is ##STR00072## wherein
R.sup.2 is selected from the group consisting of
--CH(CH.sub.3).sub.2 or --CH(CH.sub.3)CH.sub.2CH.sub.3.
4. The compound of claim 1, wherein X.sup.3 is ##STR00073##
5. The compound of claim 1, wherein at least one of X.sup.1,
X.sup.2 or X.sup.3 is ##STR00074##
6. The compound of claim 1, wherein both X.sup.1 and X.sup.2 are
##STR00075##
7. The compound of claim 1, wherein at least one of X.sup.1 or
X.sup.2 is --OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3.
8. The compound of claim 1, wherein both X.sup.1 and X.sup.2 are
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3.
10. The compound of claim 1, wherein X.sup.1 is a
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and X.sup.2 and X.sup.3 are
OH.
11. The compound of claim 1, wherein X.sup.1 is a
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and X.sup.2 and
X.sup.3 are --OH.
12. The compound of claim 1, wherein X.sup.2 is a
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and X.sup.1 and X.sup.3 are
OH.
13. The compound of claim 1, wherein X.sup.2 is a
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and X.sup.1 and
X.sup.3 are OH.
14. A compound selected from the group consisting of: ##STR00076##
and pharmaceutically acceptable salts thereof.
15. The compound of claim 14 wherein the pharmaceutically
acceptable salt is hydrochloride salt.
16. A compound selected from the group consisting of:
2-(L)-amino-3-methyl-butyric acid 6.alpha.,
16.beta.-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-f-
uran-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta-
[a]phenanthren-30-yl ester; 2-(L)-amino-3-methyl-butyric acid
6.alpha.-(2-amino-3-methyl-butyryloxy)-16.beta.-hydroxy-17-[5-(1-hydroxy--
1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetr-
adecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl
ester; 2-(L)-tert-butoxycarbonylamino-3-methyl-butyric acid
3b-acetoxy-16b-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahyd-
ro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclop-
enta[a]phenanthren-6a-yl ester; 2-(L),3-dimethyl-pentanoic acid
6.alpha.,16.beta.-di
hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]--
4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]phenanth-
ren-3.beta.-yl ester, 2-(L)-Amino-3-methyl-butyric acid,
16.beta.-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-fur-
an-2-yl]-4,4,13,14-tetramethyl-3-oxo-tetradecahydro-cyclopropa[9,10]cyclop-
enta[a]phenanthren-6.alpha.-yl ester;
2-(L)-Amino-3-methyl-pentanoic acid
6.alpha.-(2-amino-3-methyl-pentanoyloxy)-16.beta.-hydroxy-17-[5-(1-hydrox-
y-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-te-
tradecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl
ester; 2-(L)-Amino-3-methyl-butyric acid,
3.beta.,6.alpha.-dihydroxy-16-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2--
methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopr-
opa[9,10]cyclopenta[a]phenanthren-16.beta.-yl ester; and
pharmaceutically acceptable salts thereof.
17. The compound of claim 16 wherein the pharmaceutically
acceptable salt is hydrochloride salt.
18. The compound of claim 17 wherein the compound is selected from
the group consisting of: 2-(L)-amino-3-methyl-butyric acid
6.alpha.,16.beta.-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tet-
rahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]c-
yclopenta[a]phenanthren-3.beta.-yl ester hydrochloride salt;
2-(L)-amino-3-methyl-butyric acid
6.alpha.-(2-amino-3-methyl-butyryloxy)-16-hydroxy-17-[5-(1-hydroxy-1-meth-
yl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecah-
ydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl ester
hydrochloride salt; 2-(L)-tert-butoxycarbonylamino-3-methyl-butyric
acid
3b-acetoxy-16b-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahyd-
ro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclop-
enta[a]phenanthren-6.alpha.-yl ester hydrochloride salt; and
2-(L),3-dimethyl-pentanoic acid 6.alpha.,16.beta.-di
hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]--
4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]phenanth-
ren-3.beta.-yl ester hydrochloride salt.
19. A method of increasing telomerase activity in a cell or tissue
comprising contacting said cell or tissue with an isolated compound
of claim 1.
20. The method of claim 19 wherein the cell or tissue is identified
as requiring increased telomerase activity.
21. A pharmaceutical composition comprising the compound of claim 1
in a pharmaceutically acceptable vehicle
22. The composition of claim 21, wherein said compound is present
in said composition at a concentration of at least 0.1% (w/v).
23. The pharmaceutical composition comprising a topical formulation
of the compound of claim 1.
24. The composition of claim 23, wherein said topical formulation
comprises one or more components selected from the group consisting
of an emulsifier, a thickener, a carrier, and a skin emollient.
25. A method of enhancing replicative capacity of cells in vitro or
ex vivo, comprising contacting said cells with the compound of
claim 1, in an amount effect to increase telomerase activity in
said cells.
26. The method of claim 25, wherein said cells are explant cells
obtained from a patient.
Description
REFERENCE TO PRIOR APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 61/179,305 filed May 18, 2009, which is
incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to methods and compositions
for increasing telomerase activity in cells.
BACKGROUND OF THE INVENTION
[0003] Telomerase is a ribonucleoprotein that catalyzes the
addition of telomeric repeats to the ends of telomeres. Telomeres
are long stretches of repeated sequences that cap the ends of
chromosomes and are believed to stabilize the chromosome. In
humans, telomeres are typically 7-10 kb in length and comprise
multiple repeats of the sequence -TTAGGG-. Telomerase is not
expressed in most adult cells, and telomere length decreases with
successive rounds of replication. After a certain number of rounds
of replication, the progressive shortening of the telomeres results
in the cells entering a telomeric crisis stage, which in turn leads
to cellular senescence. Certain diseases are associated with rapid
telomeric loss, resulting in premature cell senescence. Expression
of the gene encoding the human telomerase protein in human cells
has been shown to confer an immortal phenotype, presumably through
bypassing the cells' natural senescence pathway. In addition,
expression of the telomerase gene in aging cells with short
telomeres has been shown to produce an increase in telomere length
and restore a phenotype typically associated with younger
cells.
[0004] Somatic cells, in contrast to tumor cells and certain stem
cells, have little or no telomerase activity and stop dividing when
the telomeric ends of at least some chromosomes have been shortened
to a critical length, leading to programmed cellular senescence
(cell death). Since the loss of telomeric repeats in somatic cells,
leading to senescence, is augmented by low telomerase activity,
induction of telomerase activity, which has the effect of adding
arrays of telomeric repeats to telomeres, thereby imparts to mortal
somatic cells increased replicative capacity, and imparts to
senescent cells the ability to proliferate and appropriately exit
the cell cycle upon repair of damaged tissue.
[0005] Methods of increasing telomerase activity therapeutically
have been investigated by, for example, Bodnar Science
279(5349):349-52 (Jan. 16, 1998)); White, PCT Int. Appl. Pubn. No.
WO 2000/08135 (February 2000)); Hannon et al. PCT Int. Appl. Pubn.
WO 99/35243 (July 1999) and PCT Int. Appl. Pubn. No. WO 2000/031238
(June 2000)); Franzese et al. Lifescience 69(13) 1509-20 (2001),
and Yudoh et al. J. Bone and Mineral Res. 16(8):1453-1464 (2001).
In these reports, telomerase activity is generally increased by
overexpression of hTERT, the gene encoding the protein component of
human telomerase, or by expression of proteins which mediate
assembly of telomerase, e.g. heat shock proteins (White, PCT No.
WO2000/08135). Franzese et al. reported that Saquinavir, a protease
inhibitor prescribed for treatment of HIV infection, increased
telomerase activity in peripheral blood mononuclear cells; Vasa et
al. Circ Res. 87(7) 540-2 (2000) described activation of
telomerase, and a resulting delay in endothelial senescence, by
administration of a nitric oxide (NO) precursor.
[0006] Various saponins of the astragaloside family have been
reported as having various biological effects including increasing
telomerase activity, Harley et al. PCT Int Appl. Pubn. No.
WO2005/000245. It would be beneficial to develop a compound which
was an effective telomerase activator.
SUMMARY OF THE INVENTION
[0007] The invention described herein is generally related to
compounds and methods for increasing telomerase activity in cells
and compositions for use in such methods. Such methods and
compositions may be used on cells in cell culture, i.e. in vitro or
ex vivo, or in vivo, such as cells growing in tissues of a subject,
including human subjects and non-human mammals.
[0008] Various saponins of the astragaloside family had previously
been reported as having various biological effects including
increasing telomerase activity, Harley et al. PCT Int Appl. Pubn.
No. WO2005/000245. However, the inventors have found that the
bioavailability of the naturally occurring compounds described
therein including cycloastragenol is very limited when administered
orally to certain mammalian species. It was not clear whether the
limited bioavailability was attributable to low uptake of the
compounds by the mammals, or high metabolism of the compounds in
certain species of mammals or a combination of both. Such low
bioavailability means that the compounds previously described were
very much less effective as an oral telomerase activator in certain
mammalian species.
[0009] It was a determined that there was a need for a new
compounds which would be potent telomerase activators and which
were also orally available across a number of mammalian species and
which had an improved half life in representative mammalian
species. The chemical compounds described herein possess these
desired properties.
[0010] In particular embodiments, the compositions comprise a
compound of formula I and pharmaceutical salts thereof as described
below. Aspects of the invention include formulations of such
compounds for use in pharmaceutical applications, in particular in
applications where increasing telomerase activity in cells is shown
to be, or expected to be, beneficial. Methods of using the
compounds and formulations thereof for such applications are also
provided, including methods for applying or administering such
formulations after the need for, or advantage of, increasing
telomerase activity in cells or tissues has been determined.
[0011] The present invention includes, in one aspect, a compound of
the formula I:
##STR00001##
wherein X.sup.1, is selected from keto (.dbd.O), hydroxy (--OH),
and
##STR00002##
wherein X.sup.2 is selected from keto (.dbd.O), hydroxy (--OH),
and
##STR00003##
wherein X.sup.3 is selected from keto (.dbd.O), hydroxy (--OH),
and
##STR00004##
wherein at least one of X.sup.1, X.sup.2 or X.sup.3 is
##STR00005##
respectively;
[0012] wherein R.sup.1 or R.sup.2 are independently selected from
--CH(CH.sub.3).sub.2, and --CH(CH.sub.3)CH.sub.2CH.sub.3;
[0013] and pharmaceutically acceptable salts thereof.
[0014] In one embodiment X.sup.1 is --OC(O)CH(NH2)R.sup.1 wherein
R.sup.1 is selected from the group consisting of
--CH(CH.sub.3).sub.2 or --CH(CH.sub.3)CH.sub.2CH.sub.3. In another
embodiment X.sup.2 is --OC(O)CH(NH.sub.2)R.sup.2 wherein R.sup.2 is
selected from the group consisting of --CH(CH.sub.3).sub.2 or
--CH(CH.sub.3)CH.sub.2CH.sub.3.
[0015] In one embodiment at least one of X.sup.1, X.sup.2 or
X.sup.3 is --OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2. In another
embodiment both X.sup.1 and X.sup.2 are
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2.
[0016] In one embodiment at least one of X.sup.1 or X.sup.2 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3. In another
embodiment both X.sup.1 and X.sup.2 are
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3.
[0017] In selected embodiments of formula I, X.sup.1 is a
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and X.sup.2 and X.sup.3 are
independently selected from hydroxy and keto. In further
embodiments, X.sup.2 is --OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and
X.sup.1 and X.sup.3 are independently selected from hydroxy and
keto. In further embodiments, X.sup.3 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and X.sup.1 and X.sup.2 are
independently selected from hydroxy and keto. In further
embodiments, X.sup.1 and X.sup.2 are both
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and X.sup.3 is OH. In still
further embodiments, X.sup.1 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and each of X.sup.2 and
X.sup.3 are OH. In still further embodiments, X.sup.2 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and each of X.sup.1 and
X.sup.3 are OH.
[0018] In selected embodiments of formula I, X.sup.1 is a
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and X.sup.2 and
X.sup.3 are independently selected from hydroxy and keto. In
further embodiments, X.sup.2 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and X.sup.1 and
X.sup.3 are independently selected from hydroxy and keto. In
further embodiments, X.sup.1 and X.sup.2 are both
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and X.sup.3 is OH.
In still further embodiments, X.sup.1 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and each of X.sup.2
and X.sup.3 are OH. In still further embodiments, X.sup.2 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and each of X.sup.1
and X.sup.3 are OH.
[0019] In some embodiments of formula I, the pharmaceutically
acceptable salt is a hydrochloride salt.
[0020] It is contemplated that the amino acid substituents are the
L or naturally occurring stereoisomer.
[0021] Exemplary compounds of formula I include those designated
herein as: 2-(L)-amino-3-methyl-butyric acid 6.alpha.,
16.beta.-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-f-
uran-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta-
[a]phenanthren-3.beta.-yl ester (designated herein as 4);
2-(L)-amino-3-methyl-butyric acid
6.alpha.-(2-amino-3-methyl-butyryloxy)-16.beta.-hydroxy-17-[5-(1-hydroxy--
1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetr-
adecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl
ester (designated herein as 7);
2-(L)-tert-butoxycarbonylamino-3-methyl-butyric acid
3b-acetoxy-16b-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tet-
rahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]c-
yclopenta[a]phenanthren-6a-yl ester (designated herein as 12)
2-(L),3-dimethyl-pentanoic acid 6.alpha.,16.beta.-di
hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]--
4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]phenanth-
ren-3.beta.-yl ester (designated herein as 14),
2-(L)-Amino-3-methyl-butyric acid,
16.beta.-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-fur-
an-2-yl]-4,4,13,14-tetramethyl-3-oxo-tetradecahydro-cyclopropa[9,10]cyclop-
enta[a]phenanthren-6.alpha.-yl ester (designated herein as 30),
2-(L)-Amino-3-methyl-pentanoic acid
6.alpha.-(2-amino-3-methyl-pentanoyloxy)-16.beta.-hydroxy-17-[5-(1-hydrox-
y-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-te-
tradecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl
ester (designated herein as 32), 2-(L)-Amino-3-methyl-butyric acid,
3.beta.,
6.alpha.-dihydroxy-16.beta.-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-me-
thyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cycloprop-
a[9,10]cyclopenta[a]phenanthren-16.beta.-yl ester (designated
herein as 36) and pharmaceutically acceptable salts thereof.
[0022] Exemplary compounds of formulas I include those designated
herein as: 2-(L)-amino-3-methyl-butyric acid 6.alpha.,
16.beta.-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-f-
uran-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta-
[a]phenanthren-3.beta.-yl ester hydrochloride salt;
2-(L)-amino-3-methyl-butyric acid
6.alpha.-(2-amino-3-methyl-butyryloxy)-16.beta.-hydroxy-17-[5-(1-hydroxy--
1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetr-
adecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl
ester hydrochloride salt;
2-(L)-tert-butoxycarbonylamino-3-methyl-butyric acid
3b-acetoxy-16b-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahyd-
ro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclop-
enta[a]phenanthren-6a-yl ester hydrochloride salt;
2-(L),3-dimethyl-pentanoic acid 6.alpha.,16.beta.-di
hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]--
4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]phenanth-
ren-3.beta.-yl ester hydrochloride salt,
2-(L)-Amino-3-methyl-butyric acid,
16.beta.-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahyd-
ro-furan-2-yl]-4,4,13,14-tetramethyl-3-oxo-tetradecahydro-cyclopropa[9,10]-
cyclopenta[a]phenanthren-6.alpha.-yl ester hydrochloride salt,
2-(L)-Amino-3-methyl-pentanoic acid
6.alpha.-(2-amino-3-methyl-pentanoyloxy)-16.beta.-hydroxy-17-[5-(1-hydrox-
y-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-te-
tradecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-30-yl ester
hydrochloride salt or 2-(L)-Amino-3-methyl-butyric acid,
3.beta.,6.alpha.-dihydroxy-16f-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-
-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclop-
ropa[9,10]cyclopenta[a]phenanthren-16.beta.-yl ester hydrochloride
salt.
[0023] A compound of formula I above, when formulated in a solvent,
is effective to produce a level of telomerase activity in
keratinocytes or PBMCs, as measured in a TRAP assay, at least 50%
greater, at least 70% greater, at least 80% greater, or at least
90% greater than the level in said cells treated with said solvent,
as measured in a TRAP assay as described herein. In further
embodiments, the compound is effective to produce a level of
telomerase activity in keratinocytes or PBMCs, as measured in a
TRAP assay, at least 100% greater than the level in said cells
treated with said solvent, as measured in a TRAP assay as described
herein.
[0024] The present invention includes, in one aspect, a method of
increasing telomerase activity in a cell or tissue. The method
comprises contacting the cell or tissue with an isolated compound
of formula I. The method may further comprise the preliminary step
of identifying a cell or tissue in which an increase in telomerase
activity is desired.
[0025] The method of contacting an isolated compound of formula I
with a cell or tissue may comprise, prior to said contacting,
identifying a cell or tissue in which an increase in telomerase
activity is desired. Benefits to be realized by increasing
telomerase activity in a cell or tissue include, for example,
enhancement of the replicative capacity and/or life span of said
cell or cells within said tissue.
[0026] The method may include identifying, determining or
diagnosing a condition in a subject such that increasing telomerase
activity in the cells or tissue of the subject is desired, and
administering the compound to the subject. The subject is a
mammalian subject, such as a domestic animal such as a dog, cat,
mouse, rat, monkey or a human subject or patient.
[0027] Such conditions or diseases for prevention or treatment may
include, for example, viral and opportunistic infections including
HIV, various degenerative diseases, such as neurodegenerative
disease, degenerative disease of the bones or joints, and
connective tissues, macular degeneration, diabetic retinopathy,
cardiovascular diseases including central and peripheral vascular
disease, Crohn's disease and other immunological conditions, liver
diseases including fibrosis and cirrhosis, lung diseases including
pulmonary fibrosis, asthma, emphysema, and COPD, hematopoietic
disorders (including anemia, thrombocytopenia, neutropenia and
other cytopenias), chronic inflammatory gastrointestinal diseases
such as Barretts esophagus, any disorder related to loss of
proliferative capacity in stem cell or progenitor cell populations.
Such conditions may include bone marrow failure syndrome, aplastic
anemia, myelodysplastic anemia or myelodysplastic syndrome. Such
conditions also include wounds or other acute or chronic conditions
of the skin and its appendages, such as, for example, a burn, an
abrasion, an incision, a graft, a lesion caused by an infectious
agent, a chronic venous ulcer, a diabetic ulcer, a compression or
decubitus ulcer, a mucosal ulcer, keloid formation, hair or pigment
loss, and other structural aberrations of the skin and its
appendages. Such conditions also include cancer and precancerous
conditions in which low telomerase or shortened telomeres are
associated with genomic instability, or increased mutation rates,
or loss of tumor suppressor functions, and consequently subjects
have an increased risk of tumor initiation, tumor progression, or
tumor recurrence.
[0028] The invention provides methods of preventing or treating a
condition in a patient, such as those noted above, by increasing
telomerase activity in cells or tissue of the patient, the method
comprising administering to a patient in need of such prevention or
treatment, an isolated compound of formula I as defined above. The
compositions may be administered by various routes, for example,
orally, topically, parenterally, subcutaneously, inhalation and
intravenously.
[0029] In a further embodiment, the invention provides a method of
treating an acute or chronic condition of the epidermis, comprising
contacting epidermal cells with a topical formulation of an
isolated compound of formula I as defined above.
[0030] The cells with which the formulation is contacted may also
include explant cells which are contacted ex vivo, e.g. for
cell-based therapies, or other cells in culture. Accordingly, the
invention provides a method of enhancing replicative capacity and
improved functional capacity of cells in vitro or ex vivo,
comprising contacting said cells with an effective amount of a
composition comprising a compound of formula I as defined above,
including selected embodiments of the compounds as defined above.
In general, the cells are mammalian cells; in selected embodiments,
the cells are stem cells, such as bone marrow stem or progenitor
cells, bone marrow stromal cells, epidermal and epithelial stem
cells from skin and other tissues including gut, liver, and
pancreas, islet precursor cells, neurosphere cells, adrenocortical
cells, muscle satellite cells, mesenchymal stem and progenitor
cells including osteoblast precursors, retinal pigmented epithelial
cells, endothelial precursor cells, pericytes, and immune cells
capable of clonal expansion including memory and naive T (CD4 and
CD8) and B cells.
[0031] In a further embodiment, the invention provides a method of
enhancing transplantation of a tissue from a living donor or
cadaver to a living patient comprising contacting the
transplantation tissue with an isolated compound of formula I as
defined above. In a further embodiment, the invention provides a
method of enhancing transplantation of a tissue from a donor to a
living patient comprising administering the isolated compound of
formula I as defined above to the patient either before,
simultaneous with, or for a period of time after the
transplantation of the tissue. The transplanted tissue may be solid
tissue, such as a kidney, heart, lungs etc., or hematopoietic
tissue such as, without limitation, blood cells such as leukocytes,
lymphocytes or hematopoietic precursor cells which may be derived
from bone marrow.
[0032] In one embodiment, the invention provides a pharmaceutical
composition comprising, in a pharmaceutically acceptable vehicle, a
compound of formula I as depicted above.
[0033] In another embodiment, the invention provides a topical
pharmaceutical formulation of an isolated compound of formula I, as
defined above. Selected embodiments of the compounds are also
defined above. The topical formulation typically comprises one or
more components selected from the group consisting of an
emulsifier, a carrier (e.g. liposomes), a thickener, and a skin
emollient. Such compositions may be used for treatment of wounds or
other acute or chronic conditions of the epidermis.
[0034] Use of an isolated compound of formula I as defined above,
including selected embodiments as described above, in the
manufacture of a medicament for preventing or treating disease or
condition. Use of an isolated compound of formula I as defined
above, including selected embodiments as described above, in the
manufacture of a medicament for preventing or treating disease
subject to prevention or treatment by increasing telomerase
activity in a cell or tissue. Use of an isolated compound of
formula I as defined above, including selected embodiments as
described above, for preventing or treating a disease or condition.
Use of an isolated compound of formula I as defined above,
including selected embodiments as described above, for preventing
or treating a disease subject to prevention or treatment by
increasing telomerase activity in a cell or tissue The use may
further comprise the preliminary step of identifying a cell or
tissue in which an increase in telomerase activity is desired.
Benefits to be realized by increasing telomerase activity in a cell
or tissue include, for example, enhancement of the replicative
capacity and/or life span of said cell or cells within said tissue
and enhancement of functional capacity.
[0035] The use may include identifying, determining or diagnosing a
condition or disease in a subject such that increasing telomerase
activity in the cells or tissue of the subject is desired. Such
conditions may include, for example, viral and opportunistic
infections including HIV, various degenerative diseases, such as
neurodegenerative disease, degenerative disease of the bones or
joints and connective tissues, diabetic retinopathy, macular
degeneration, cardiovascular diseases including central and
peripheral vascular disease, Crohn's disease and other
immunological conditions, liver diseases including fibrosis and
cirrhosis, lung diseases including pulmonary fibrosis, asthma,
emphysema, and COPD, hematopoietic disorders (including anemia,
thrombocytopenia, neutropenia and other cytopenias), chronic
inflammatory gastrointestinal diseases such as Barretts esophagus,
any disorder related to loss of proliferative capacity in stem cell
or progenitor cell populations. Such conditions may include bone
marrow failure syndrome, aplastic anemia, myelodysplastic anemia or
myelodysplastic syndrome. Such conditions also include wounds or
other acute or chronic conditions of the skin and its appendages,
such as, for example, a burn, an abrasion, an incision, a graft, a
lesion caused by an infectious agent, a chronic venous ulcer, a
diabetic ulcer, a compression or decubitus ulcer, a mucosal ulcer,
keloid formation, hair or pigment loss, and other structural
aberrations of the skin and its appendages. Such conditions also
include cancer and precancerous conditions in which low telomerase
or shortened telomeres are associated with genomic instability, or
increased mutation rates, or loss of tumor suppressor functions,
and consequently subjects have an increased risk of tumor
initiation, tumor progression, or tumor recurrence.
[0036] Similarly, use of an isolated compound of formula I, as
defined above, including selected embodiments as described above,
for the manufacture of a medicament for treatment of a chronic or
acute condition of the epidermis is contemplated. Another
embodiment is the use of an isolated compound of formula I, as
defined above, including selected embodiments as described above,
for the treatment of a of a chronic or acute condition of the
epidermis.
[0037] These and other objects and features of the invention will
become more fully apparent when the following detailed description
of the invention is read in conjunction with the accompanying
drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] FIG. 1 shows an increase of telomerase activity in mice
peripheral blood mononuclear cells (PBMC) after one dose of
compound 4 C3-(L)-valyl-cycloastragenol, as measured in a TRAP
assay.
[0039] FIG. 2 shows an increase of telomerase activity in mice
whiskers after one dose of compound 4 C3-(L)-valyl-cycloastragenol,
as measured in a TRAP assay.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0040] The following terms, as used herein, have the meanings given
below, unless indicated otherwise.
[0041] A general carbon atom numbering scheme used for nomenclature
of compounds described herein is shown below.
##STR00006##
[0042] Thus C3-(L) valyl cycloastragenol refers to the (L) valine
attached through an ester bond to carbon 3 of the compound
structure.
[0043] "C.sub.1-5 Alkyl" refers to a fully saturated acyclic
monovalent radical containing carbon and hydrogen, which may be
branched or linear having from 1 to 5 carbon atoms. Examples of
alkyl groups are methyl, ethyl, n-propyl, n-butyl, isopropyl,
iso-butyl, sec-butyl, tert-butyl.
[0044] "Keto" means .dbd.O.
[0045] "Hydroxy" means --OH.
[0046] The term "amino acid" comprises the residues of the natural
amino acids (e.g. Ala, Arg, Asn, Asp, Cys, Glu, Gin, Gly, His, Hyl,
Hyp, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val) in
D or L form, as well as unnatural amino acids. The term also
comprises natural and unnatural amino acids bearing a conventional
amino protecting group (e.g. acetyl or benzyloxycarbonyl). Other
suitable protecting amino protecting groups are known to those
skilled in the art (See for example, T. W. Green, Protecting Groups
in Organic Synthesis; Third Edition, Wiley New York 1999). Unless
otherwise stated amino acid substituents are attached to the
cycloastragenol through their carboxy groups via ester linkages.
Thus C3-(L) valyl cycloastragenol is C3-(L) valyl cycloastragenol
ester.
[0047] The term "isomer" includes, but is not limited to optical
isomers and analogs, structural isomers and analogs, conformational
isomers and analogs and the like.
[0048] It will be appreciated by those skilled in the art that
compounds of the invention having a chiral center may exist in and
be isolated in optically active and racemic forms. Some compounds
may exhibit polymorphism. It is to be understood that the present
invention encompasses any racemic, optically-active, polymorphic,
or stereoisomeric form or mixtures thereof, of a compound of the
invention which possess the useful properties described herein, it
being well known in the art how to prepare optically active forms
(for example, by resolution of the racemic form by
recrystallization techniques, by synthesis from optically-active
starting materials, by chiral synthesis, or by chromatographic
separation using a chiral stationary phase) and how to determine
the ability of the compounds to increase telomerase activity using
the tests described herein. In one embodiment the amino acids are
in the naturally occurring (L) form.
[0049] The invention includes "pharmaceutically acceptable salts"
of the compounds of this invention, which may be produced, in one
embodiment, to form alkali metal salts and to form free addition
salts of free acids or free bases. Suitable pharmaceutically
acceptable acid addition salts of compounds of this invention may
be prepared from an inorganic acid or from an organic acid. In one
embodiment, examples of inorganic acids are hydrochloric,
hydrobromic, hydroiodic, nitric, carbonic, sulfuric and phosphoric
acid. In one embodiment, organic acids may be selected from
aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic,
carboxylic and sulfonic classes of organic acids, examples of which
are formic acid, acetic, propionic, succinic, glycolic, gluconic,
lactic, malic, tartaric, citric, ascorbic, glucoronic, maleic,
fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, oxalic,
mesylic, salicylic, stearic and galacturonic acid. In one
embodiment, suitable pharmaceutically-acceptable base addition
salts of compounds of this invention include metallic salts made
from aluminum, calcium, lithium, magnesium, potassium, sodium and
zinc or organic salts made from N,N'-dibenzylethylenediamine,
choline, chloroprocaine, ethanolamine, ethylenediamine, and
procain. All of these salts may be prepared by conventional means
from the corresponding compounds. Pharmaceutically acceptable salts
can be prepared in other embodiments by treatment with inorganic
bases, for example, sodium hydroxide. In another embodiment, esters
of the compounds can be made with aliphatic and aromatic carboxylic
acids, for example, acetic acid and benzoic acid esters.
[0050] "Stem cells" refer to relatively undifferentiated cells of a
common lineage that retain the ability to divide and cycle
throughout postnatal life, to provide cells that can differentiate
further and become specialized (e.g., stem cells in basal layers of
skin or in haematopoetic tissue, such as primitive cells in the
bone marrow from which all the various types of blood cell are
derived).
[0051] By "effective to increase telomerase activity in a cell",
with reference to a compound, is meant that a composition
containing the compound at a concentration of 10 .mu.M or less is
effective to produce a level of telomerase activity in a
keratinocyte or fibroblast cell, as measured in a telomerase
activity assay (e.g. TRAP) assay as described herein, which is
greater, by a factor of at least 1.5 (i.e. at least 50% greater),
than the level produced by a similar formulation not containing the
compound, as measured in a TRAP assay. In some embodiments, the
compound is effective, at a concentration of 10 .mu.M or less, to
produce a level of telomerase activity in such a cell, as measured
in a TRAP assay as described herein, which is greater by a factor
of at least 2 (i.e. at least 100% greater) than the level produced
by a similar formulation not containing the compound.
[0052] A "subject" is a mammal. The subject may be a domestic
mammal for example a dog, cat mouse, rat, monkey etc. The subject
or patient may be a human.
[0053] In reference to administration of a compound to a patient,
an "effective amount" refers to an amount effective to increase
telomerase activity in the cells or tissue of the patient, such
that a desired therapeutic result is achieved. In reference to
treatment of cells in vitro or ex vivo, an "effective amount"
refers to an amount effective to increase telomerase activity in
the cells, thereby increasing the replicative capacity and/or life
span of the cells.
[0054] In concentrations expressed herein as % (w/v), 100% (w/v)
corresponds to 1 g solute/ml solvent. For example, 0.1% (w/v)=1
mg/ml.
[0055] A "formulation of an isolated compound" refers to a
formulation prepared by combining the isolated compound with one or
more other ingredients (which may be active or inactive
ingredients) to produce the formulation. The phrase "isolated
compound" refers to a compound that (prior to the formulation) has
been produced by a process involving one or more chemical synthesis
steps, resulting in a preparation of the compound that is of not
less than 80% (w/w) purity.
II. Methods and Compositions for Increasing Telomerase Activity
[0056] In accordance with the present invention, compositions and
methods are provided for increasing telomerase activity in a
cell.
[0057] It has been found that the compounds of the present
invention are able to increase telomerase activity in cells and are
readily biologically available when administered to mammals either
intravenously or orally.
[0058] In accordance with the method, a cell or tissue is contacted
with an isolated compound of formula I as disclosed herein, in an
amount effective to increase telomerase activity in the cell or
tissue, relative to the level of telomerase activity in the cell or
tissue in the absence of the compound. The method may also include
a preliminary step of identifying a cell or tissue in which an
increase in telomerase activity is desired.
[0059] The present invention includes, in one aspect, a compound of
the formula I:
##STR00007##
wherein X.sup.1, is selected from keto (.dbd.O), hydroxy, and
##STR00008##
wherein X.sup.2 is selected from keto (.dbd.O), hydroxy, and
##STR00009##
wherein X.sup.3 is selected from keto (.dbd.O), hydroxy, and
##STR00010##
wherein at least one of X.sup.1, X.sup.2 or X.sup.3 is
##STR00011##
respectively;
[0060] wherein R.sup.1 or R.sup.2 are independently selected from
--CH(CH.sub.3).sub.2, and --CH(CH.sub.3)CH.sub.2CH.sub.3;
[0061] and pharmaceutically acceptable salts thereof.
[0062] In one embodiment X.sup.1 is --OC(O)CH(NH.sub.2)R.sup.1
wherein R.sup.1 is selected from the group consisting of
--CH(CH.sub.3).sub.2 or --CH(CH.sub.3)CH.sub.2CH.sub.3. In another
embodiment X.sup.2 is --OC(O)CH(NH.sub.2)R.sup.2 wherein R.sup.2 is
selected from the group consisting of --CH(CH.sub.3).sub.2 or
--CH(CH.sub.3)CH.sub.2CH.sub.3.
[0063] In one embodiment at least one of X.sup.1, X.sup.2 or
X.sup.3 is --OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2. In another
embodiment both X.sup.1 and X.sup.2 are
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2.
[0064] In one embodiment at least one of X.sup.1 or X.sup.2 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3. In another
embodiment both X.sup.1 and X.sup.2 are
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3.
[0065] In selected embodiments of formula I, X.sup.1 is a
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and X.sup.2 and X.sup.3 are
independently selected from hydroxy and keto. In further
embodiments, X.sup.2 is --OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and
X.sup.1 and X.sup.3 are independently selected from hydroxy and
keto. In further embodiments, X.sup.3 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and X.sup.1 and X.sup.2 are
independently selected from hydroxy and keto. In further
embodiments, X.sup.1 and X.sup.2 are both
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and X.sup.3 is OH. In still
further embodiments, X.sup.1 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and each of X.sup.2 and
X.sup.3 are OH. In still further embodiments, X.sup.2 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 and each of X.sup.1 and
X.sup.3 are OH.
[0066] In selected embodiments of formula I, X.sup.1 is a
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and X.sup.2 and
X.sup.3 are independently selected from hydroxy and keto. In
further embodiments, X.sup.2 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and X.sup.1 and
X.sup.3 are independently selected from hydroxy and keto. In
further embodiments, X.sup.1 and X.sup.2 are both
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and X.sup.3 is OH.
In still further embodiments, X.sup.1 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and each of X.sup.2
and X.sup.3 are OH. In still further embodiments, X.sup.2 is
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 and each of X.sup.1
and X.sup.3 are OH.
[0067] In some embodiments of formula I, the pharmaceutically
acceptable salt is a hydrochloride salt.
[0068] Exemplary compounds of formula I include those designated
herein as: 2-(L)-amino-3-methyl-butyric acid
6.alpha.,16.beta.-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tet-
rahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]c-
yclopenta[a]phenanthren-3.beta.-yl ester (designated herein as 4);
2-(L)-amino-3-methyl-butyric acid
6.alpha.-(2-amino-3-methyl-butyryloxy)-16.beta.-hydroxy-17-[5-(1-hydroxy--
1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetr-
adecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl
ester (designated herein as 7);
2-(L)-tert-butoxycarbonylamino-3-methyl-butyric acid
3b-acetoxy-16b-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tet-
rahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]c-
yclopenta[a]phenanthren-6a-yl ester (designated herein as 12)
2-(L),3-dimethyl-pentanoic acid 6.alpha.,163-di
hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]--
4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]phenanth-
ren-3.beta.-yl ester (designated herein as 14),
2-(L)-Amino-3-methyl-butyric acid,
16.beta.-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-fur-
an-2-yl]-4,4,13,14-tetramethyl-3-oxo-tetradecahydro-cyclopropa[9,10]cyclop-
enta[a]phenanthren-6.alpha.-yl ester (designated herein as 30),
2-(L)-Amino-3-methyl-pentanoic acid
6.alpha.-(2-amino-3-methyl-pentanoyloxy)-16.beta.-hydroxy-17-[5-(1-hydrox-
y-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-te-
tradecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl
ester (designated herein as 32), 2-(L)-Amino-3-methyl-butyric acid,
3.beta.,6.alpha.-dihydroxy-16-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2--
methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopr-
opa[9,10]cyclopenta[a]phenanthren-16.beta.-yl ester (designated
herein as 36) and pharmaceutically acceptable salts thereof.
[0069] Exemplary compounds of formulas I include those designated
herein as: 2-(L)-amino-3-methyl-butyric acid
6.alpha.,16.beta.-dihydroxy-7-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetr-
ahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cy-
clopenta[a]phenanthren-30-yl ester hydrochloride salt;
2-(L)-amino-3-methyl-butyric acid
6.alpha.-(2-amino-3-methyl-butyryloxy)-16.beta.-hydroxy-17-[5-(1-hydroxy--
1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetr-
adecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl
ester hydrochloride salt;
2-(L)-tert-butoxycarbonylamino-3-methyl-butyric acid
3b-acetoxy-16b-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahyd-
ro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclop-
enta[a]phenanthren-6a-yl ester hydrochloride salt;
2-(L),3-dimethyl-pentanoic acid 6.alpha.,16.beta.-di
hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]--
4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]phenanth-
ren-6.alpha.-yl ester hydrochloride salt,
2-(L)-Amino-3-methyl-butyric acid,
16.beta.-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahyd-
ro-furan-2-yl]-4,4,13,14-tetramethyl-3-oxo-tetradecahydro-cyclopropa[9,10]-
cyclopenta[a]phenanthren-6.alpha.-yl ester hydrochloride salt,
2-(L)-Amino-3-methyl-pentanoic acid
6.alpha.-(2-amino-3-methyl-pentanoyloxy)-16.beta.-hydroxy-17-[5-(1-hydrox-
y-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-te-
tradecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-30-yl ester
hydrochloride salt or 2-(L)-Amino-3-methyl-butyric acid,
3.beta.,6.alpha.-dihydroxy-16.beta.-hydroxy-17-[5-(1-hydroxy-1-methyl-eth-
yl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-c-
yclopropa[9,10]cyclopenta[a]phenanthren-16.beta.-yl ester
hydrochloride salt.
[0070] In one embodiment, the compound is selected from the
following compounds of formula I:
##STR00012##
[0071] and pharmaceutically acceptable salts thereof.
[0072] Exemplary compounds of formula I include the compounds in
the following table, with reference to formula I:
TABLE-US-00001 ##STR00013## Com- pound num- ber Name X.sup.1
X.sup.2 X.sup.3 4 2-(L)-amino-3-methyl-butyric acid
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 --OH OH
6.alpha.,16.beta.-dihydroxy-17-[5-(1- hydroxy-1-methyl-ethyl)-2-
methyl-tetrahydro- furan-2-yl]-4,4,13,14-tetramethyl-
tetradecahydro-cyclopropa[9,10] cyclopenta[a]phenanthren-3.beta.-yl
ester 7 2-(L)-Amino-3-methyl-butyric acid
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 --OH
6.alpha.-(2-amino-3-methyl-butyryloxy)-
16.beta.-hydroxy-17-[5-(1-hydroxy-1-
methyl-ethyl)-2-methyl-tetrahydro-
furan-2-yl]-4,4,13,14-tetramethyl- tetradecahydro-cyclopropa[9,10]
cyclopenta[a]phenanthren-3.beta.-yl ester 12
2-(L)-tert-Butoxycarbonylamino-3- --OH
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 --OH methyl-butyric acid
3b-acetoxy- 16b-hydroxy-17-[5-(1-hydroxy-1- methyl-ethyl)-2-methyl-
tetrahydro-furan-2- yl]-4,4,13,14-tetramethyl-
tetradecahydro-cyclopropa[9,10] cyclopenta[a]phenanthren-6a-yl
ester 14 2-(L),3-Dimethyl-pentanoic acid
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 --OH --OH
6.alpha.,16.beta.-di hydroxy-17-[5- (1-hydroxy-1-methyl-ethyl)-2-
methyl-tetrahydro- furan-2-yl]-4,4,13,14-tetramethyl-
tetradecahydro-cyclopropa[9,10] cyclopenta[a]phenanthren-3.beta.-yl
ester 30 2-(L)-Amino-3-methyl-butyric .dbd.O
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 --OH
acid,16.beta.-hydroxy-17-[5-(1- hydroxy-1-methyl-ethyl)-2-
methyl-tetrahydro- furan-2-yl]-4,4,13,14-tetramethyl-
3-oxo-tetradecahydro- cyclopropa[9,10]cyclopenta[a]
phenanthren-6.alpha.-yl ester 32 2-(L)-Amino-3-methyl-pentanoic
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3
--OC(O)CH(NH.sub.2)CH(CH.sub.3)CH.sub.2CH.sub.3 --OH acid
6.alpha.-(2-amino-3-methyl- pentanoyloxy)-
16.beta.-hydroxy-17-[5-(1-hydroxy-1-
methyl-ethyl)-2-methyl-tetrahydro-
furan-2-yl]-4,4,13,14-tetramethyl- tetradecahydro-
cyclopropa[9,10]cyclopenta[a] phenanthren-3.beta.-yl ester 36
2-(L)-Amino-3-methyl-butyric acid, --OH --OH
--OC(O)CH(NH.sub.2)CH(CH.sub.3).sub.2 3.beta.,
6.alpha.-dihydroxy-16.beta.-hydroxy-
17-[5-(1-hydroxy-1-methyl-ethyl)- 2-methyl-
tetrahydro-furan-2-yl]-4,4,13,14- tetramethyl-tetradecahydro-
cyclopropa[9,10]cyclopenta[a] phenanthren-16.beta.-yl ester
[0073] A compound of formula I above, when formulated in a solvent,
is effective to produce a level of telomerase activity in
keratinocytes or fibroblasts, as measured in a TRAP assay, at least
50% greater, at least 70% greater, at least 80% greater, or at
least 90% greater than the level in said cells treated with said
solvent, as measured in a TRAP assay as described herein. In
further embodiments, the compound is effective to produce a level
of telomerase activity in keratinocytes or fibroblasts, as measured
in a TRAP assay, at least 100% greater than the level in said cells
treated with said solvent, as measured in a TRAP assay as described
herein.
[0074] The invention also provides pharmaceutical compositions
comprising one or more compounds of formula I.
[0075] In a further aspect, the invention provides a method of
increasing telomerase in a cell or tissue, by contacting the cell
or tissue with an isolated compound of formula I. Again, the method
may include the step of identifying a cell or tissue in which an
increase in telomerase activity is desired.
III. Sources and Syntheses of Compounds of Formula I
[0076] The compounds of formula can be synthesized as follows.
[0077] Astragalosides I-VII can be isolated from Astragalus
membranaceus root, as described, for example, in A. Kadota et al.,
JP Kokai No. 62012791 A2 (1987). As reported therein, the root
tissue (8 kg), which is commercially available from various sources
of beneficial herbs, is refluxed with MeOH, and the concentrated
extract (200 g) is redissolved in MeOH and fractionated by column
chromatography on silica gel, using CHCl.sub.3/MeOH/H.sub.2O
mixtures as eluants. Each fraction is worked up by reverse
chromatography on silica gel, using similar solvent mixtures, to
give the following approximate quantities of isolated compounds:
acetylastragaloside I (0.2 g), astragaloside 1(3.5 g),
isoastragaloside I (0.3 g), astragaloside 11(2.3 g), astragaloside
111 (1.0 g), astragaloside IV (0.8 g), astragaloside V (0.1 g),
astragaloside VI (0.3 g), and astragaloside VII (0.1 g). See also
Kitagawa et al., Chem. Pharm. Bull. 31(2):698-708 (1983b).
[0078] Cycloastragenol (2) can be prepared by treatment of
astragaloside IV (1) with methanolic HCl, followed by
neutralization, standard workup, and purification by
chromatography, as described in the Experimental section below
(Example 1). Cycloastragenol can also be obtained by oxidative
degradation (treatment with oxygen and elemental sodium) of a
butanol extract of Astragalus membranaceus, as described by P-H
Wang et al., J. Chinese Chem. Soc. 49:103-6 (2002).
[0079] Preparation of the various embodiments of formulas I, e.g.
compounds having varying degrees of esterification, alkylation or
acylation, or keto groups, can be prepared according to known
methods of organic synthesis, using naturally occurring and/or
commercially available starting materials such as cycloastragenol,
with separation of products as needed. Several examples are given
in the Experimental section below.
IV. Determination of Biological Activity
[0080] A. TRAP Assay Protocol
[0081] The ability of a compound to increase telomerase activity in
a cell can be determined using the TRAP (Telomeric Repeat
Amplification Protocol) assay, which is known in the art (e.g. Kim
et al., U.S. Pat. No. 5,629,154; Harley et al., U.S. Pat. No.
5,891,639). As used herein, "telomerase activity as measured in a
TRAP assay" refers to telomerase activity as measured in
keratinocytes or fibroblasts according to the following protocol.
The activity is typically compared to the activity similarly
measured in a control assay of such cells (e.g., a telomerase
activity 50% greater than observed in a solvent control).
[0082] Cell lines suitable for use in the assay, normal human
peripheral blood mononuclear cells (PBMCs) or Human Epidermal
Keratinocytes (neonatal) (HEKs), can be obtained from commercial
sources, such as Cascade Biologics, Portland, Oreg. or 4C Biotech,
Seneffe, Belgium, or from the ATCC (American Type Culture
Collection). ATCC normal human fibroblast cell lines, which can be
located on the ATCC web site, include, for example, CCL135, CCL137,
and CCL151.
[0083] For example, neonatal human epidermal keratinocytes (HEKs)
are plated into a 96-well microtiter plate at approx. 5000
cells/well, in growth medium (e.g. Epi-Life Medium+Keratinocyte
Growth Supplement supplied by Cascade Biologics, Inc.) and
incubated for one day. Test compositions in a suitable solvent,
such as 95% ethanol or DMSO, are added to selected wells in a range
of concentrations and incubated for a further 24+/-1 hours.
[0084] Compounds to be tested are first formulated at a 10.times.
desired final concentration in 10% DMSO. The formulated compound is
added to the 96-well culture along with a control of DMSO to
provide various concentrations of the compound. The final DMSO
concentration may be 1% in all wells. For other cell types or in
other situations, higher or lower concentrations of DMSO may be
desired.
[0085] A cytotoxicity assay may be performed in parallel with the
telomerase TRAP testing by preparing a duplicate cell culture plate
treated with the same compounds and using a metabolism responsive
dye such as Alamar Blue to asses the number of cells at the
beginning and the end of the incubations with the test
compounds.
[0086] If cytotoxicity of the test compounds is not objectively
measured, the morphology of treated cells can first be observed
under a microscope, to verify that there are no visual signs of
irregular growth.
[0087] To conduct the TRAP assay, media is removed from the wells,
and the cells are rinsed twice in PBS (Ca and Mg free). The dishes
are chilled on ice, and Nonidet P40 cell lysis buffer is added
(approx. 100 .mu.l per well) and triturated by pipetting up and
down several times. The cells are the incubated on ice for 1
hour.
[0088] Alternatively, cells may be harvested at 24 hr+/-1 hr by
removing the growth medium and washing once with PBS (phosphate
buffered saline) removing as much medium as possible. The cells are
then lysed by adding 50 .mu.L of M-Per buffer (Pierce Cat#78503
& 78501) and incubating on ice for 1 hr+/-15 min. The plate is,
optionally, centrifuged at 2000 RPM, 5 min. The lysate is carefully
collected from each well of the plate and transferred to a fresh
V-bottom storage 96-well plate, leaving the monolayer cells
intact.
[0089] Alternatively, cell lysing solution may be prepared by
addition of 3.0 mL Nonidet.RTM. P40, 1.0 mL CHAPS lysis buffer (see
below), and 1.0 mL 10.times.TRAP buffer (see below) to 5.0 mL
DNase-, RNase-free H.sub.2O. (DNase-, RNase-free water may be
generated by DEPC (diethylpyrocarbonate) treatment or purchased
from vendors such as Sigma.).
TABLE-US-00002 CHAPS Lysis Buffer Stock For 1 mL Final concn. 1M
Tris-HCl pH 7.5 10 .mu.l 10 mM 1M MgCl.sub.2 1 .mu.l 1 mM 0.5M EGTA
2 .mu.l 1 mM 100 mM AEBSF 1 .mu.l 0.1 mM 10% CHAPS.sup.a 50 .mu.l
0.5% BSA 1 mg 1 mg/ml 100% Glycerol 100 .mu.l 10% DNase-,
RNase-free H.sub.2O 936 .mu.l (to 1 mL) .sup.aThe CHAPS detergent
is added just before use of the lysis buffer. In addition, AEBSF
(4-(2-aminoethyl)-benzenesulfonyl fluoride HCl) is added to the
lysis buffer just prior to the extraction step.
[0090] The level of telomerase activity in the cell lysates is
measured using a TRAP assay.
TABLE-US-00003 10X TRAP Buffer Stock Final concn. 1M Tris-HCl, pH
8.3 200 mM 1M MgCl.sub.2 15 mM 1M KCl 650 mM Tween 20 (Boehringer
Mannheim) 0.5% 0.1M EGTA 10 mM 20 mg/ml BSA 1 mg/ml
[0091] The following materials are combined to generate a master
PCR Mix.
TABLE-US-00004 Stock Per Reaction (45 .mu.l) Final concn..sup.a 10X
TRAP Buffer 5.0 .mu.L 1X 2.5 mM dNTPs 1.0 .mu.L 50 .mu.M Cy5-TS
Primer (0.5 mg/ml) 0.1 .mu.L 1 ng/ml ACX Primer (0.1 mg/ml) 1.0
.mu.L 2 ng/ml Taq Polymerase (5 U/.mu.l) 0.4 .mu.L 0.04 units/.mu.l
Cell extract 5-10 .mu.L DNase-, RNase-free H.sub.2O 32.5-37.5 .mu.L
(to 45 .mu.L total) .sup.aBased on final volume of 40 .mu.l PCR mix
plus 10 .mu.l cell lysate = 50 .mu.l.
[0092] The PCR mix includes the following components: Cy5-TS
primer, a 5'-Cy5 labeled oligonucleotide having the sequence 5'-AAT
CCG TCG AGC AGA GTT-3' (SEQ ID NO: 1), is a telomerase substrate.
Depending on the telomerase activity in the medium, telomere
repeats (having the sequence (AGGGTT), will be added to the
substrate, to form telomerase extended products, also referred to
as telomerase products. The ACX primer, having the sequence 5'-GCG
CGG CTT ACC CTT ACC CTT ACC CTA ACC-3' (SEQ ID NO: 2), is an
anchored return primer that hybridizes to the telomerase extended
products.
[0093] A sample of cell lysate (e.g., 5 .mu.L) is added to the PCR
mix in a reaction tube, and the telomere extension and PCR
amplification is done in the bench top PCR machine at the following
cycle profiles: 30.degree. C. for 30 minutes, repeat 28 cycles of
the following 3 step reaction: 94.degree. C./30 sec, 60.degree.
C./30 sec, and 72.degree. C./1 min, followed by 72.degree. C./4
minutes and hold at 4.degree. C.
[0094] Loading dye containing e.g. bromophenol blue and xylene
cyanol is added, and the samples are subjected to 10-15%
non-denaturing PAGE in 1.times.TBE, until the bromophenol blue runs
off the gel. The TRAP reaction product is observed, e.g. by using a
fluoroimager for detection of CY5-labeled telomerase products
(maximal excitation at 650 nm; maximal emission at 670 nm).
[0095] Telomerase activity may be measured by captured total pixel
vol. (DNA ladder bands) above background for each gel lane. The
activity may be normalized by measuring the total RNA (ng/mL) by
using Ribogreen.RTM. RNA Quantitation Kit from Molecular Probes,
cat. # R-11490 and following commercially recommended conditions
with an RNA standard range of 0.8-200 ng/mL, 1:200 dilution of RG
dye, 100-250.times. dilution of sample.
Total Pixel Vol/RNA=Normalized Relative Telomerase Activity
[0096] Cells number (used to assess cytotoxicity) was directly
proportional to the Alamar Blue reading
[0097] Alternatively, a set of an internal standard and primer can
be added for quantitation purposes. The TSU2 internal standard an
oligonucleotide having the sequence 5'-AAT CCG TCG AGC AGA GTT AAA
AGG CCG AGA AGC GAT-3'; SEQ ID NO:3), an extension of the TS primer
sequence, is added in a small controlled quantity. The U2 primer,
having the sequence 5'-ATC GCT TCT CGG CCT TTT (SEQ ID NO:4), is a
return primer designed to hybridize to the 3' region of the
internal standard.
[0098] The final amount of TSU2 internal standard after
amplification is generally 5-10 pmol per 50 .mu.l reaction mixture.
This internal control gives a specific 36-mer PCR amplification
product that appears as a distinct band on the gel below the first
telomere addition product (that is, the product of one telomer
addition to the TS oligonucleotide, followed by amplification with
the ACX return primer). This internal control band can be used to
normalize the PCR amplifications from different samples.
[0099] The relative number of telomerase product molecules (TM)
generated in the assay is determined according to the formula
below:
TM=(T.sub.TRAP Products-T.sub.BKD1)/(T.sub.Int Std-T.sub.BKD2)
where: T.sub.TRAP Products is the total intensity measured on the
gel for all telomerase products, T.sub.BKD1 is the background
intensity measured in a blank lane for an area equivalent in size
to that encompassed by the telomerase products, T.sub.int Std is
the intensity for the internal standard band, and T.sub.BKD2 is the
background intensity measured in a blank lane for an area
equivalent in size to that encompassed by the internal standard
band. The resulting number is the number of molecules of telomerase
products generated for a given incubation time, which, for the
purposes of determining TM, is designated herein as 30 minutes.
[0100] Compounds of formulas I as described above are able to
produce, at a concentration of 1 .mu.M or less, a level of
telomerase activity in fibroblasts or keratinocytes at least 50%
greater than seen in a solvent control. Even more potent activities
may be appropriate for some applications, such as compounds that
produce telomerase activities at least about 75%, 100% or 500%
greater than the level of such activity seen in a solvent control,
as measured in the described TRAP assay, at a concentration of 10
.mu.M or less.
[0101] Effectiveness in increasing telomerase activity was
evaluated for compounds of formula I above in various
concentrations. Assays were carried out in HEKneoP cells (neonatal
keratinocytes), according to the protocol described above.
Concentrations typically ranged from approx. 0.001 .mu.M to 10
.mu.M in DMSO.
[0102] The ability of the compounds to increase the activity of
telomerase is shown in Table 2.
[0103] B. Wound Healing Assay Protocol
[0104] The compounds of formula I can be used to promote healing of
wounds, burns, abrasions or other acute or chronic conditions of
the epidermis, as discussed further below. As used herein, "wound
healing activity as measured in a scratch assay" refers to the
activity as measured in keratinocytes or fibroblasts according to
the following protocol, and expressed as the value of WH shown in
the formula below.
[0105] Cells are plated in flasks (5.times.10.sup.5 cells per
flask) and cultured for two days in a humidified chamber at 5%
CO.sub.2, 37.degree. C. To create the "wound", a 2 ml plastic
pipette is gently dragged to "scratch" the cell surface. The ideal
wound is approximately 2-3 mm wide and 50 mm long (along the long
axis of the tissue culture flask). The cells are retreated with
medium containing either vehicle (DMSO; control sample) or test
compositions at multiple concentrations. A wound area is
identified, the flask marked, and the appearance of the cells
documented photographically over 3-4 days continued culturing of
the cells.
[0106] Amount of wound closure is determined by measuring the width
of the wound over time for compound-treated samples relative to
vehicle-treated or other control cells. Measurements are made from
the photographs taken for each of the samples on days 1
(immediately after scratching), 2, 3, and 4. Percentage of wound
healing (also expressed as "wound healing activity") is calculated
by the following formula:
WH=100-[100.times.W.sub.n/W.sub.0],
where W.sub.n is the width of the wound on day n and W.sub.0 is the
width of the wound on day one (i.e. immediately after
scratching).
V. Therapeutic Indications and Treatment Methods
[0107] The present invention provides methods for increasing
telomerase activity in a cell, by contacting a cell or tissue with
a formulation of an isolated compound of formula I as disclosed in
Section II above, in an amount effective to increase telomerase
activity in the cell. The method may include the preliminary step
of identifying a cell or tissue in which an increase telomerase
activity is desired. The cell may be in culture, i.e. in vitro or
ex vivo, or within a subject or patient in vivo.
[0108] Benefits to be realized from an increase in telomerase
activity in a cell or tissue include, for example, enhancement of
the replicative capacity and/or life span of the contacted cells
and improved functional capacity of the cells (i.e. improved
expression of the normal differentiated functions of the cells).
The method may further comprise diagnosing a condition in a subject
or patient wherein an increase in telomerase activity in cells or
tissue of the patient is desired; e.g., diagnosing a disease
subject to treatment by an increase in telomerase activity in cells
or tissue. Accordingly, the invention provides methods of treating
a condition in a patient, by increasing telomerase activity in
cells or tissue of said patient, the method comprising
administering to a subject in need of such treatment an effective
amount of a compound of formula I as disclosed in Section II above.
An "effective amount" refers to an amount effective to increase
telomerase activity in the cells or tissue of the patient, such
that a therapeutic result is achieved.
[0109] Such conditions or diseases for treatment or prevention may
include, for example, conditions associated with cellular
senescence or with an increased rate of proliferation of a cell in
the absence of telomerase, which leads to accelerated telomere
repeat loss. By "increased rate of proliferation" is meant a higher
rate of cell division compared to normal cells of that cell type,
or compared to normal cells within other individuals of that cell
type. The senescence of those groups of cells at an abnormally
early age can eventually lead to disease (see West et al., U.S.
Pat. No. 6,007,989).
[0110] Various disease states exist in which an increase in
telomerase activity in certain cell types can be beneficial.
Accordingly, the invention provides methods of treating in a
patient a condition or disease selected from the following, by
increasing telomerase activity in the cells of the patient,
comprising administering to a subject in need of such treatment, an
effective amount of a compound of formula I as described above. In
some cases, the condition may also be subject to treatment by ex
vivo cell therapy, as described further below, employing the
associated cell types (indicated in parenthesis).
[0111] (a) Alzheimer's disease, Parkinson's disease, Huntington's
disease, and stroke (cells of the central nervous system, including
neurons, glial cells, e.g. astrocytes, endothelial cells,
fibroblasts),
[0112] (b) age-related diseases of the skin, such as dermal atrophy
and thinning, elastolysis and skin wrinkling, sebaceous gland
hyperplasia or hypoplasia, senile lentigo and other pigmentation
abnormalities, graying of hair and hair loss or thinning, or
chronic skin ulcers (fibroblasts, sebaceous gland cells,
melanocytes, keratinocytes, Langerhan's cells, microvascular
endothelial cells, hair follicle cells),
[0113] (c) degenerative joint disease (cells of the articular
cartilage, such as chondrocytes and lacunal and synovial
fibroblasts),
[0114] (d) osteoporosis and other degenerative conditions of the
skeletal system (cells of the skeletal system, such as osteoblasts,
bone marrow stromal or mesenchymal cells, osteoprogenitor
cells),
[0115] (e) age- and stress-related diseases of the vascular system
including atherosclerosis, calcification, thrombosis, and aneurysms
(cells of the heart and vascular system, including endothelial
cells, smooth muscle cells, and adventitial fibroblasts),
[0116] (f) age-related macular degeneration (cells of the eye, such
as pigmented epithelium and vascular endothelial cells),
[0117] (g) AIDS (HIV-restricted CD8.sup.+ cells);
[0118] (h) age- and stress-related immune system impairment,
including impairment of tissue turnover, which occurs with natural
aging, cancer, cancer therapy, acute or chronic infections, or with
genetic disorders causing accelerated cell turnover, and related
anemias and other degenerative conditions (other cells of the
immune system, including cells in the lymphoid, myeloid, and
erythroid lineages, such as B and T lymphocytes, monocytes,
circulating and specialized tissue macrophages, neutrophils,
eosinophils, basophils, NK cells, and their respective
progenitors); and
[0119] (i) pulmonary fibrosis or liver cirrhosis or liver
fibrosis;
[0120] j) chronic inflammatory gastrointestinal diseases such as
Barretts esophagus; and
[0121] k), bone marrow failure syndrome, aplastic anemia,
myelodysplastic anemia or myelodysplastic syndrome.
[0122] In addition to the cell types noted above, further cell
types in which an increase in telomerase activity can be
therapeutically beneficial include, but are not limited to, cells
of the liver, endocrine and exocrine glands, smooth musculature, or
skeletal musculature.
[0123] As an example, in the case of HIV-infected individuals,
CD8.sup.+ cell turnover is increased as these cells attempt to
control the level of HIV-infected CD4.sup.+ cells. In AIDS (item
(g) above), disease is believed to be caused by the early
senescence of HIV-restricted CD8.sup.+ cells. The aging of such
cells is attributed not simply to abnormal amount of loss of
telomere sequences per cell doubling, but, in addition, to the
increased replicative rate of the cells, such that telomere
attrition is greater than normal for that group of cells. The
invention thus provides methods of treating an HIV infected
subject, and more particularly of reducing early senescence of
HIV-restricted CD8.sup.+ cells in an HIV infected subject, by
administering to a subject in need of such treatment an effective
amount of a compound of formula I as disclosed in Section II
above.
[0124] An increase in telomerase activity can benefit non-dividing
cells as well as proliferating cells, e.g. in conditions associated
with increased susceptibility to cell death due to stress, such as
ischemia in heart failure or in stroke (see e.g. Oh and Schneider,
J Mol Cell Cardiol 34(7):717-24; Mattson, Exp Gerontol.
35(4):489-502). The invention thus provides methods of reducing
stress- or DNA-damage-induced cell death in a subject, such as a
subject experiencing ischemic conditions in tissue due to heart
failure or stroke, by increasing telomerase activity in cells of
the subject, comprising administering to a subject in need of such
treatment an effective amount of a compound of formula I as
disclosed in Section II above. As noted above, the method may
include the preliminary step of diagnosing in the subject the
indicated condition.
[0125] In another aspect, the compositions may be used for the
treatment of individuals in which one or more cell types are
limiting in that patient, and whose life can be extended by
extending the ability of those cells to continue replication or
resist stress-induced cell death. One example of such a group of
cells is lymphocytes present in Down's Syndrome patients. The
invention thus provides a method of enhancing replicative capacity
and/or life span of lymphocytes present in a Down's Syndrome
patient, by increasing telomerase activity in said cells of the
patient, comprising administering to such a patient an effective
amount of a compound of formula I as disclosed in Section II above.
The compositions may also be used to improve resistance to
stress-induced cell death occurring during normal aging.
[0126] In a further aspect of the invention, increasing telomerase
activity is effective to prevent pulmonary fibrosis or to promote
healing of pulmonary fibrosis. It has been determined that short
telomeres are a signature of idiopathic pulmonary fibrosis and of
cryptogenic liver cirrhosis (Alder et al., PNAS (2008) 105(35)
13051-13056). The present compounds may be used to treat pulmonary
fibrosis or liver cirrhosis.
[0127] In a further aspect, the invention provides a method of
enhancing transplantation of a tissue from a living donor or
cadaver to a living patient or subject comprising contacting the
transplantation tissue with an isolated compound of formula I as
defined above. In a further aspect, the invention provides a method
of enhancing transplantation of a tissue to a living patient or
subject comprising administering the isolated compound of formula I
as defined above to the patient either before, simultaneous with,
or for a period of time after the transplantation of the tissue
into the patient. The transplanted tissue may be solid tissue, such
as a kidney, heart, lungs etc., or hematopoietic tissue such as,
without limitation, blood cells such as leukocytes, lymphocytes or
hematopoietic precursor cells which may be derived from bone
marrow.
[0128] In a further aspect of the invention, increasing telomerase
activity is effective to promote healing of wounds, burns,
abrasions or other acute or chronic conditions of the epidermis.
The invention thus provides a method of treating an acute or
chronic condition of the epidermis, by administering to a patient
in need of such treatment, topically to the affected area, an
effective amount of a formulation of an isolated compound of
formula I as disclosed in Section II above.
[0129] As used herein, an "acute or chronic condition of the
epidermis" includes acute conditions such as lesions suffered in
trauma, burns, abrasions, surgical incisions, donor graft sites,
and lesions caused by infectious agents, and chronic conditions
such as chronic venous ulcer, diabetic ulcer, compression ulcer,
pressure sores, and ulcers or sores of the mucosal surface. Also
included are skin or epithelial surface lesions caused by a
persistent inflammatory condition or infection, or by a genetic
defect (such as keloid formation and coagulation abnormalities).
See, for example, PCT Pubn. No. WO 02/91999.
[0130] Desirable effects of an increase in telomerase activity in
such treatment include cell proliferation or migration at the
treatment site, epithelialization of the surface, closure of a
wound if present, or restoration of normal physiological function.
By "epithelialization" or "reepithelialization" of a treatment site
is meant an increase in density of epithelial cells at the site as
a result of the applied therapy.
[0131] The method may also be used to enhance growth of engrafted
cells. Desirable effects of an increase in telomerase activity in
such treatment include coverage of the treatment site, survival of
engrafted cells, lack of immune rejection, closure of a wound if
present, or restoration of normal physiological function. Engrafted
cells may participate in wound closure either by participating
directly in the healing process (for example, becoming part of the
healed tissue), or by covering the wound and thereby providing an
environment that promotes healing by host cells.
[0132] The invention also contemplates manipulation of the skin and
repair of any perceived defects in the skin surface.
[0133] In a further aspect, the methods and compositions of the
invention can be used to enhance replicative capacity and/or extend
life span of cells in culture, e.g. in ex vivo or in vitro cell
therapy or in monoclonal antibody production, by increasing
telomerase activity in the cells. Increasing telomerase activity
increases the replicative capacity of such cells by slowing
telomere repeat loss and/or improving resistance to stress-induced
cell death during cell proliferation.
[0134] In the case of ex vivo applications, an effective amount of
a compound of formula I as described above is added to explant
cells obtained from a subject. An "effective amount" refers to an
amount effective to increase telomerase activity in the cells,
thereby increasing the replicative capacity and/or life span of the
cells.
[0135] The explant cells may include, for example, stem cells, such
as bone marrow stem cells (U.S. Pat. No. 6,007,989), bone marrow
stromal cells (Simonsen et al., Nat Biotechnol 20(6):592-6, 2002),
or adrenocortical cells (Thomas et al, Nat Biotechnol 18(1):39-42,
2000). Disease conditions such as those noted in items (a)-(g)
above may also be subject to ex vivo cell-based therapy. Examples
include the use of muscle satellite cells for treatment of muscular
dystrophy, osteoblasts to treat osteoporosis, retinal pigmented
epithelial cells for age-related macular-degeneration, chondrocytes
for osteoarthritis, and so on.
[0136] For example, the recognition that functional CD8.sup.+ cells
are limiting in AIDS patients to control the expansion of infected
CD4+ cells allows a therapeutic protocol to be devised in which
HIV-restricted CD8.sup.+ cells are removed from an HIV-infected
individual at an early stage, when AIDS is first detected, stored
in a bank, and then reintroduced into the individual at a later
stage, when that individual no longer has the required CD8+ cells
available. Thus, an individual's life can be extended by a protocol
involving continued administration of that individual's limiting
cells at appropriate time points. These appropriate points can be
determined by following CD8+ cell senescence, or by determining the
length of telomeres within such CD8.sup.+ cells, as an indication
of when those cells will become senescent. In accordance with the
invention, the stored cells can be expanded in number in the
presence of an agent which slows telomere repeat loss, i.e.
compound of formula I as disclosed in Section II above.
[0137] Accordingly, the invention provides methods of ex vivo cell
based therapy, which include obtaining a cell population from a
subject, and expanding the cell population ex vivo, wherein the
cell population is treated with a compound of formula I as
disclosed in Section II above, in an amount effective to increase
telomerase activity and thereby enhance the replicative capacity
and/or life span of the cell population. The method generally
includes diagnosing in a subject a condition subject to treatment
by ex vivo cell based therapy, such as those noted above.
[0138] In a further embodiment, the invention provides a method of
stem cell proliferation, wherein a stem cell population is treated
with a compound of formula I as disclosed in Section II above, in
an amount effective to increase telomerase activity and thereby
enhance the replicative capacity and/or life span of the cell
population.
VI. Formulations and Methods of Administration
[0139] The invention encompasses methods of preparing
pharmaceutical compositions useful for increasing telomerase
activity in a cell and/or promoting wound healing. Accordingly, an
isolated compound of formula I as described in Section II is
combined with a pharmaceutical excipient, and optionally with other
medicinal agents, adjuvants, and the like, which may include active
and inactive ingredients. The compositions may take the form of
solid, semi-solid, lyophilized powder, or liquid dosage forms, such
as, for example, tablets, capsules, powders, sustained-release
formulations, solutions, suspensions, emulsions, suppositories,
creams, ointments, lotions, aerosols, or the like. The formulations
may be provided in unit dosage forms suitable for simple
administration of precise dosages.
[0140] An isolated compound of formula I may also be formulated for
oral administration. For an oral pharmaceutical formulation,
suitable excipients include pharmaceutical grades of carriers such
as mannitol, lactose, glucose, sucrose, starch, cellulose, gelatin,
magnesium stearate, sodium saccharine, and/or magnesium carbonate.
For use in oral liquid formulations, the composition may be
prepared as a solution, suspension, emulsion, or syrup, being
supplied either in solid or liquid form suitable for hydration in
an aqueous carrier, such as, for example, aqueous saline, aqueous
dextrose, glycerol, or ethanol, polyethylene glycol, macrogol-15
hydroxystearate or for example water or normal saline. If desired,
the composition may also contain minor amounts of non-toxic
auxiliary substances such as wetting agents, emulsifying agents, or
buffers.
[0141] For use in wound healing or treatment of other acute or
chronic conditions of the epidermis, a compound of formula I is
formulated for topical administration. The vehicle for topical
application may be in one of various forms, e.g. a lotion, cream,
gel, ointment, stick, spray, or paste. These product forms can be
formulated according to well known methods. They may comprise
various types of carriers, including, but not limited to,
solutions, aerosols, emulsions, gels, and liposomes. The carrier
may be formulated, for example, as an emulsion, having an
oil-in-water or water-in-oil base. Suitable hydrophobic (oily)
components employed in emulsions include, for example, vegetable
oils, animal fats and oils, synthetic hydrocarbons, and esters and
alcohols thereof, including polyesters, as well as
organopolysiloxane oils. Such emulsions also include an emulsifier
and/or surfactant, e.g. a nonionic surfactant, such as are well
known in the art, to disperse and suspend the discontinuous phase
within the continuous phase.
[0142] The topical formulation typically contains one or more
components selected from a structuring agent, a thickener or
gelling agent, and an emollient or lubricant. Frequently employed
structuring agents include long chain alcohols, such as stearyl
alcohol, and glyceryl ethers or esters and oligo(ethylene oxide)
ethers or esters thereof. Thickeners and gelling agents include,
for example, polymers of acrylic or methacrylic acid and esters
thereof, polyacrylamides, and naturally occurring thickeners such
as agar, carrageenan, gelatin, and guar gum. Examples of emollients
include triglyceride esters, fatty acid esters and amides, waxes
such as beeswax, spermaceti, or carnauba wax, phospholipids such as
lecithin, and sterols and fatty acid esters thereof. The topical
formulations may further include other components as known in the
art, e.g. astringents, fragrances, pigments, skin penetration
enhancing agents, sunscreens, etc.
[0143] The pharmaceutical compositions may also be formulated for
administration parenterally, transdermally, or by inhalation. An
injectable composition for parenteral administration typically
contains the active compound in a suitable IV solution, such as
sterile physiological saline. The composition may also formulated
as a suspension in a lipid or phospholipid, in a liposomal
suspension, or in an aqueous emulsion.
[0144] For administration by inhalation, the active compound is
formulated as solid or liquid aerosol particles. The formulation
may also include a propellant and/or a dispersant, such as lactose,
to facilitate aerosol formation. For transdermal administration,
the active compound is included in a transdermal patch, which
allows for slow delivery of compound to a selected skin region, and
which may also include permeation enhancing substances, such as
aliphatic alcohols or glycerol.
[0145] Methods for preparing such formulations are known or will be
apparent to those skilled in the art; for example, see Remington's
Pharmaceutical Sciences (19.sup.th Ed., Williams & Wilkins,
1995). The composition to be administered will contain a quantity
of the selected compound in a pharmaceutically safe and effective
amount for increasing telomerase activity in the target cells or
tissue.
[0146] The pharmaceutical composition contains at least 0.1% (w/v)
of a compound of formula I as described above, greater than 0.1%,
up to about 10%, up to about 5%, and up to about 1% (w/v). Choice
of a suitable concentration depends on factors such as the desired
dose, frequency and method of delivery of the active agent.
[0147] For treatment of a subject or patient, such as a mammal or a
human patient, dosages are determined based on factors such as the
weight and overall health of the subject, the condition treated,
severity of symptoms, etc. Dosages and concentrations are
determined to produce the desired benefit while avoiding any
undesirable side effects. Typical dosages of the subject compounds
are in the range of 1-50 mg/kg/day, 1-25 mg/kg/day, 1-20 mg/kg/day,
4-15 mg/kg/day. Typical dosages of the subject compounds are in the
range of about 1 to 1,500 mg/day for a human patient, about 1-500
mg/day. In specific embodiments, for example, the compound
designated herein as 4 is administered at a level of at least 1
mg/kg/day or at least 5 mg/kg/day.
[0148] Administration of the compounds of Formula I may be every
other day, on a daily basis, twice daily or more often.
Administration may be once, for 1-20 days, for 5-10 days or
continuously for as long as necessary to prevent or treat the
disease or condition being prevented or treated.
[0149] The following examples are offered by way of illustration
and not by way of limitation.
EXAMPLES
Example 1. Conversion of astragaloside IV (1) to
17-[5-(1-Hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,1-
4-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]phenanthrene-3.b-
eta.,6.alpha.,16.beta.-triol [cycloastragenol] (2)
##STR00014##
[0151] To astragaloside IV (1) (5.00 g, mmol) was added "HCl-MeOH
10" (TCI America) (500 mL) and the mixture was stirred at room
temperature for 7 days. The reaction mixture was concentrated to
about half volume under reduced pressure at 20.degree. C. (do not
heat). The mixture was partitioned into aqueous sodium bicarbonate
and ethyl acetate. The aqueous layer was extracted with ethyl
acetate again. The organic layers were combined, washed with
saturated sodium chloride, dried on anhydrous sodium sulfate, and
concentrated under reduced pressure. The residue was purified by
column chromatography (20:1.about.14:1 chloroform/methanol). In
order to replace the residual solvent with ethanol, the purified
material was dissolved in ethanol and the solvent was removed under
reduced pressure to afford 2 (2.1 g, 64%).
[0152] .sup.1H NMR (CDCl.sub.3) .delta. (ppm) 0.34 (d, J=4.7 Hz,
1H), 0.48 (d, J=4.3 Hz, 1H), 0.92 (s, 3H), 0.93 (s, 3H), 1.0-1.8
(m, 13H), 1.11 (s, 3H), 1.19 (s, 3H), 1.22 (s, 6H), 1.27 (s, 3H),
1.9-2.0 (m, 4H), 2.30 (d, J=7.8 Hz, 1H), 2.54 (q, J=11.8 Hz, 1H),
3.27 (m, 1H), 3.50 (m, 1H), 3.72 (t, J=7.4 Hz, 1H), 4.65 (q, J=7.4
Hz, 1H). ESI-MS m/z Positive 491 (M+H).sup.+, Negative 549
(M+AcO).sup.-. TLC (Merck, Kieselgel 60) Rf=0.33 (6:1
chloroform/methanol)
Example 2. Preparation of 2-(L)-Amino-3-methyl-butyric acid
6.alpha.,16.beta.-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tet-
rahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]c-
yclopenta[a]phenanthren-3.beta.-yl ester, Hydrochloride Salt
[C3-(L)-valyl-cycloastragenol] (4)
##STR00015##
[0154] Preparation of 3:
[0155] Boc-(L)-Valine-OH (18 g, 81.63 mmols) (Bachem, Torrance,
Calif.) was dissolved in 150 ml of dichloromethane (DCM). To this
was added 15 g (81.63 mmol) of pentafluorophenol. The reaction was
cooled in an ice-bath followed by slow addition of 12.8 ml (81.63
mmols) of 1,3 diisopropylcarbodiimide (DIC). After complete
addition the reaction mixture was stirred at room temperature for
30 minutes at which time the reaction mixture turned turbid
(diisopropylcarbodimide-urea precipitation). To this mixture was
then added 10 g (20.41 mmols) of (2) followed by 10 g (81.63 mmol)
of dimethylaminopyridine (DMAP) and the reaction was stirred at
room temperature for 24 hours. The reaction mixture was transferred
into a separatory funnel and washed with H.sub.2O (2.times.) 1% aq.
HCl (2.times.), 0.1N aq. NaOH (2.times.), sat. NaHCO.sub.3
(3.times.), H.sub.2O (1.times.) and brine (1.times.), the organic
layer was separated, dried over Na.sub.2SO.sub.4, filtered and the
solvent was evaporated under vacuum. The residue was purified using
flash chromatography with solvent gradient of 2%-5% MeOH in DCM to
furnish 7.0 g (50%) of the target product 3 together with 6.0 g,
(33%) of the bis product.
[0156] .sup.1HNMR for 3: (CDCl.sub.3) .delta. ppm: 0.38 (1H, bs),
0.52 (1H, bs), 0.90-1.38 (m, 30H), 1.39-1.45 (s, m 12H), 1.59-1.63
(m, 5H), 1.76-1.82 (m, 2H), 1.96-2.01 (m, 4H), 2.16-2.20 (m, 1H),
2.30-2.35 (d, 1H), 2.49-2.54 (q, 1H), 3.45-3.57 (t, 1H), 3.71-3.76
(t, 1H), 4. 19-4.21 (m, 1H), 4.53-4.61 (m, 1H), 4.69-4.71 (q, 1H),
5.0-5.2 (d, 1H. MS (M+H) 690.
##STR00016##
[0157] Preparation of 4:
[0158] To 1 g (1.45 mmol) of 3 was added 1.8 ml of 4.0M HCl/dioxane
and stirred for 4 hrs. The solvents were evaporated and the product
was precipitated in 10 ml of cold diethyl ether and the solids were
filtered. The solids were then dried under high vacuum for
overnight to yield 800 mg (88%) of the target product 4
(2-(L)-Amino-3-methyl-butyric acid 6.alpha.,
16.beta.-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-te-
trahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]-
cyclopenta[a]phenanthren-3.beta.-yl ester. hydrochloride salt) as a
white powder.
[0159] .sup.1HNMR for 4 (DMSOd.sub.6) .delta. ppm: 0.36 (bs, 1H),
0.49 (bs, 1H), 0.80-1.39 (m, 29H), 1.44-1.60 (m, 3H), 1.61-1.70 (m,
2H), 1.81-1.89 (m, 4H), 2.19-2.30 (m, 2H), 2.41-2.60 (m, 2H),
3.29-3.41 (m, 2H), 3.58-3.61 (t, 1H), 3.81-3.83 (m, 1H), 4.18-4.39
(bs, 4H), 4.49-4.51 (q, 2H), 4.54-4.59 (m, 1H), 8.40-8.58 (bs, 2H).
MS (M+H) 590.
Example 3. Preparation of 2-(D)-Amino-3-methyl-butyric acid
6.alpha..16.beta.-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tet-
rahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]c-
yclopenta[a]phenanthren-3.beta.-yl ester. Hydrochloride Salt
Hydrochloride Salt [C3-(D)-valyl-cycloastragenol] (5)
##STR00017##
[0161] Using the procedure of Example 2 with Boc-(D) Valine-OH
(Bachem, Torrance, Calif.) (18 g, 81.63 mmols) compound 5 was
prepared.
[0162] .sup.1HNMR for 5 (DMSOd.sub.6) .delta. ppm: 0.30 (bs, 1H),
0.50 (bs, 1H), 0.80-1.39 (m, 29H), 1.46-1.58 (m, 3H), 1.61-1.70 (m,
2H), 1.79-1.89 (m, 4H), 2.16-2.32 (m, 2H), 2.38-2.54 (m, 2H),
3.29-3.41 (m, 2H), 3.58-3.61 (t, 1H), 3.81-3.83 (m, 1H), 4.13-4.24
(bs, 4H), 4.50-4.52 (q, 2H), 4.54-4.59 (m, 1H), 8.43-8.60 (bs, 2H).
MS (M+H) 590.
Example 4: Preparation of 2-(L)-Amino-3-methyl-butyric acid
6.alpha.-(2-amino-3-methyl-butyryloxy)-16D-hydroxy-17-[5-(1-hydroxy-1-met-
hyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradeca-
hydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl Ester
Hydrochloride Salt [C3,C6-(L,L)-bisvalyl-cycloastragenol]-7
##STR00018##
[0164] Preparation of 6:
[0165] Boc-(L) Valine-OH (10 g, 46.08 mmols) was dissolved in 80 ml
of N-methylpyrrolidone (NMP). To this was added 8.5 g (46.08 mmol)
of pentafluorophenol. The reaction was cooled in an ice-bath
followed by slow addition of 7.2 ml (46.08 mmols) of DIC. After
complete addition the reaction mixture was stirred at room
temperature for 30 minutes at which time the reaction mixture
turned turbid (diisopropylcarbodimide-urea precipitation). To this
mixture was then added 3.2 g (6.60 mmols) of 2 followed by 5.5 g
(45 mmol) of DMAP and the reaction was stirred at room temperature
for 24 hours. The reaction mixture was transferred into a
separatory funnel and washed successively with H.sub.2O (6.times.),
1% aq. HCl (2.times.), 0.1N aq. NaOH (2.times.), sat. NaHCO.sub.3
(3.times.), H.sub.2O (1.times.) and brine (1.times.), the organic
layer was separated, dried over Na.sub.2SO.sub.4, filtered and the
solvent was evaporated under vacuum. The residue was purified using
flash chromatography with solvent gradient of 2%-5% MeOH in DCM to
furnish 4.8 g (83%) of the target product 6.
[0166] .sup.1HNMR for 6: (CDCl.sub.3) .delta. ppm: 0.38 (1H, bs),
0.60 (1H, bs), 0.80-1.0 (m, 24H), 1.15 (s, s 6H), 1.20 (s, s 6H),
1.31 (s, 6H), 1.35 (s, s 4H) 1.41 (s, s 18H), 1.56-1.60 (m, 4H),
1.79-1.83 (m, 3H), 3.71-3.76 (t, 1H), 4.08-4.21 (m, 2H), 4.58-4.60
(m, 1H), 4.61-4.70 (q, 1H), 4.72-4.80 (m, 1H), 4.82-4.84 (d, 1H),
4.9-5.0 (d, 1H). MS (M+H) 889.
##STR00019##
[0167] Preparation of 7:
[0168] To a 4.5 g (5.06 mmol) of the 6 was added 13 ml of 4.0M
HCl/dioxane and stirred for 4 hrs. The solvents were evaporated and
the product was precipitated with 40 ml of cold diethyl ether and
the solids filtered off. The solids were then dried under high
vacuum for overnight to yield 3.1 g (91%) of the target product 7
as a white powder. .sup.1HNMR for 7 (DMSOd.sub.6) .delta. ppm: 0.24
(bs, 1H), 0.59 (bs, 1H), 0.80-1.20 (m, 35H), 1.41-1.85 (m, 12H),
2.10-2.22 (m, 2H), 2.32-2.42 (m, 4H), 2.19-2.30 (m, 2H), 3.59-3.62
(m, 1H), 3.81-3.83 (m, 2H), 4.40-4.53 (m, 1H), 4.60-4.71 (m, 1H),
4.81-4.9 (m, 1H), 8.40-8.70 (d, 4H). MS (M+H) 689.
Example 5: Preparation of 2-(D)-Amino-3-methyl-butyric acid
6.alpha.-(2-amino-3-methyl-butyryloxy)-16D-hydroxy-17-[5-(1-hydroxy-1-met-
hyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradeca-
hydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3(3-yl Ester
Hydrochloride Salt [C3,C6-(D,D)-bisvalyl-cycloastragenol] 8
[0169] Using the same procedure of Example 4 and Boc-(D) Valine-OH
(Bachem, Torrance, Calif.), compound 8 was prepared.
##STR00020##
[0170] .sup.1HNMR for 8 (DMSOd.sub.6) .delta. ppm: 0.26 (bs, 1H),
0.60 (bs, 1H), 0.78-1.23 (m, 35H), 1.39-1.80 (m, 12H), 2.10-2.22
(m, 2H), 2.19-2.30 (m, 2H) 2.35-2.40 (m, 4H), 3.60-3.62 (m, 1H),
3.80-3.85 (m, 2H), 4.42-4.53 (m, 1H), 4.58-4.70 (m, 1H), 4.81-4.9
(m, 1H), 8.40-8.70 (d, 4H). MS (M+H) 689.
Example 6. Preparation of
2-(L)-tert-Butoxycarbonylamino-3-methyl-butyric acid
3b-acetoxy-16b-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl-2-methyl-tetr-
ahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cy-
clopenta[a]phenanthren-6.alpha.-yl Ester Hydrochloride Salt
[C6-(L)-valyl-cycloastragenol] 12
##STR00021## ##STR00022##
[0172] Preparation of 9:
[0173] To a 5 g (10.22 mmol) of 2 was added 40 ml of CHCl.sub.3 and
2.1 ml (26 mmol) of pyridine. The reaction mixture was cooled in an
ice-bath and to this was slowly added 2.5 ml (26 mmol) of acetic
anhydride. After complete addition the reaction was stirred at
4.degree. C. for 24 hrs. The TLC showed three spots corresponding
to 9, monoacetylated and bis acetylated products. The reaction
mixture was diluted with 100 ml of DCM and washed successively with
the following: sat. aq. NaHCO.sub.3, (2.times.), 1 M HCl
(1.times.), H.sub.2O (1.times.) and brine (1.times.). The organic
layer was separated, dried over Na.sub.2SO.sub.4, filtered and
evaporated under vacuum. The crude was purified by flash
chromatography with 2% MeOH in DCM to furnish 2.3 g (42%) of 9 as
white solids. .sup.1HNMR for 9: (CDCl.sub.3) .delta. ppm: 0.38 (1H,
bs), 0.49 (1H, bs), 0.90-1.25 (m, 32H), 1.39-1.45 (m 2H), 1.50-1.60
(m, 2H), 1.70-1.82 (m, 2H), 1.96-2.01 (m, 4H), 2.18-2.20 (s, 3H),
2.30-2.35 (d, 1H), 3.45-3.57 (m, 1H), 3.71-3.76 (m, 1H), 4.49-4.59
(m, 1H), 4.69-4.72 (m, 1H). MS (M+H) 533.
[0174] Preparation of 10:
[0175] 1.08 g (5.0 mmol) of Boc-(L)-Valine was dissolved in 5 ml of
DCM. To this was added 920 mg (5.0 mmols) of pentafluorophenol. The
reaction was cooled in an ice-bath followed by slow addition of
0.78 ml (5.0 mmols) of DIC. After complete addition the reaction
mixture was stirred at room temperature for 30 minutes. To this
mixture was then added 532 mg (1.0 mmol) of 9 followed by 490 mg
(4.0 mmol) of DMAP and the reaction was stirred at room temperature
for 24 hours. The reaction mixture was transferred into a
separatory funnel and washed with sat. NaHCO.sub.3 (3.times.), 0.1N
HCl (1.times.), H.sub.2O (3.times.) and brine (1.times.), the
organic layer was separated, dried over Na.sub.2SO.sub.4, filtered
and the solvent was evaporated under vacuum. 20 ml of Et.sub.2O was
added to the residue and the white precipitate was filtered under
suction. This operation was repeated once more and the filterate
was evaporated and the residue was purified using flash
chromatography with solvent gradient of 2%-5% MeOH in DCM to
furnish 590 mg (81%) of 10.
[0176] .sup.1HNMR for 10: (CDCl.sub.3) .delta. ppm: 0.35 (1H, bs),
0.53 (1H, bs), 0.75-1.30 (m, 38H), 1.45 (s 9H), 1.50-1.60 (m, 2H),
1.70-1.82 (m, 2H), 1.96-2.01 (m, 4H), 2.18-2.20 (s, 3H), 2.30-2.35
(d, 1H), 3.71-3.76 (m, 1H), 4.13-4.19 (m, 1H), 4.40-4.41 (m, 1H),
4.51-4.53 (m, 1H), 4.60-4.63 (m, 1H), 4.69-4.72 (m, 1H), 4.81-4.83
(m, 1H). MS (M+H) 731.
[0177] Preparation of 11:
[0178] 500 mg (0.68 mmols) of 10 was dissolved in 5.0 ml of dry
MeOH and 2.8 ml of 0.5M MeONa/MeOH was added to it. The reaction
was stirred at room temperature for 24 hrs. The reaction was
carefully neutralized (monitoring with pH meter) by dropwise
addition of IM HCl/MeOH and the solvents were evaporated under
vacuum. The residue was dissolved in 30 ml of DCM and successively
washed with sat. NaHCO.sub.3 (1.times.), H.sub.2O (1.times.), brine
(1.times.), dried over Na.sub.2SO.sub.4, filtered and the solvents
were evaporated under vacuum. The crude product was purified using
flash chromatography to furnish 403 mg (86%) of 11 as white solids.
The crude was carried over to the next step without any
purification. .sup.1HNMR for 11: (CDCl.sub.3) .delta. ppm: 0.39
(1H, bs), 0.58 (1H, bs), 0.86-1.35 (m, 38H), 1.47 (s 9H), 1.53-1.61
(m, 2H), 1.70-1.82 (m, 2H), 1.96-2.01 (m, 4H), 2.30-2.35 (d, 1H),
3.19-3.22 (m, 1H), 3.71-3.76 (m, 1H), 4.13-4.19 (m, 1H), 4.40-4.41
(m, 1H), 4.60-4.63 (m, 1H), 4.69-4.72 (m, 1H), 4.81-4.83 (m, 1H).
MS (M+H) 690.
[0179] Preparation of 12:
[0180] To 400 mg (0.58 mmol) of 10 was added 0.73 ml of 4.0M
HCl/dioxane and stirred for 4 hrs. The solvents were then
evaporated under vacuum and the residue was washed with 5 mL of
cold diethyl ether. The solids were filtered off and dried at high
vacuum for overnight to furnish 290 mg (80%) of 12 as white
solids.
[0181] .sup.1HNMR for 12 (DMSOd.sub.6) .delta. ppm: 0.30 (bs, 1H),
0.45 (bs, 1H), 0.80-1.19 (m, 29H), 1.47-1.58 (m, 3H), 1.61-1.70 (m,
2H), 1.81-1.89 (m, 4H), 2.19-2.30 (m, 2H), 2.43-2.60 (m, 2H),
3.03-3.05 (m, 1H), 3.56-3.60 (t, 1H), 3.73-3.75 (m, 1H), 3.80-4.09
(bs, 4H), 4.40-4.51 (m, 1H), 4.71-4.79 (m, 1H), 8.40-8.58 (bs, 2H).
MS (M+H) 590.
Example 7. Preparation of 2-(L),3-Dimethyl-pentanoic acid
6.alpha.,16.beta.-di
hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-ethyl-tetrahydro-furan-2-yl]-4-
,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]phenanthr-
en-3.beta.-yl ester Hydrochloride Salt
[C3-(L)-isoleucyl-cycloastragenol] 14
##STR00023##
[0183] Preparation of 13:
[0184] Boc-(L) Isoleucine --OH (Bachem, Torrance, Calif.) (1.9 g.
8.16 mmols) was dissolved in 25 ml of DCM. To this was added 1.5 g
(8.16 mmol) of pentafluorophenol. The reaction was cooled in an
ice-bath followed by slow addition of 1.3 ml (8.16 mmols) of DIC.
After complete addition the reaction mixture was stirred at room
temperature for 30 minutes at which time the reaction mixture
turned turbid (diisopropylcarbodimide-urea precipitation). To this
mixture was then added 1.0 g (2.04 mmols) of 2 followed by 976 mg
(8.0 mmol) of DMAP and the reaction was stirred at room temperature
for 24 hours. The reaction mixture was transferred into a
separatory funnel and washed with H.sub.2O (2.times.) 1% aq. HCl
(2.times.), 0.1N aq. NaOH (2.times.), sat. NaHCO.sub.3 (3.times.),
H.sub.2O (1.times.) and brine (1.times.), the organic layer was
separated, dried over Na.sub.2SO.sub.4, filtered and the solvent
was evaporated under vacuum. The residue was purified using flash
chromatography with solvent gradient of 2%-5% MeOH in DCM to
furnish 943 mg (67%) of the target product 13 together with 330 mg
of the bis product.
[0185] .sup.1HNMR for 13: (CDCl.sub.3) .delta. ppm: 0.38 (1H, bs),
0.52 (1H, bs), 0.93-1.28 (m, 33H), 1.39-1.45 (s, m 12H), 1.59-1.63
(m, 5H), 1.76-1.82 (m, 2H), 1.96-2.01 (m, 4H), 2.16-2.20 (m, 1H),
2.30-2.35 (d, 1H), 2.49-2.54 (q, 1H), 3.45-3.57 (m, 1H), 3.71-3.76
(t, 1H), 4.19-4.21 (dd, 1H), 4.53-4.61 (m, 1H), 4.69-4.71 (q, 1H),
5.0-5.2 (d, 1H. MS (M+H) 704.
##STR00024##
[0186] Preparation of 14:
[0187] To a 700 mg (1.0 mmol) of the 11 was added 1.25 ml of 4.0M
HCl/dioxane and stirred for 4 hrs. The solvents were evaporated and
the product was precipitated in 10 ml of cold diethyl ether and the
solids were filtered. The solids were then dried under high vacuum
for overnight to yield 512 mg (80%) of the target product 12 as a
white powder. .sup.1HNMR for 12 (DMSOd.sub.6) .delta. ppm: 0.36
(bs, 1H), 0.49 (bs, 1H), 0.80-1.39 (m, 32H), 1.44-1.60 (m, 3H),
1.61-1.70 (m, 2H), 1.81-1.89 (m, 4H), 2.19-2.30 (m, 2H), 2.41-2.60
(m, 2H), 3.29-3.41 (m, 1H), 3.58-3.61 (t, 1H), 3.86-3.90 (m, 1H),
4.18-4.39 (bs, 4H), 4.51-4.53 (m, 2H), 4.54-4.59 (m, 1H), 8.40-8.58
(bs, 2H). MS (M+H) 604.
Example 8: Preparation of a mixture of 2-(L)-Amino-hexanoic acid
6.alpha.,
16b-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan--
2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]ph-
enanthren-3b-yl ester, Hydrochloride Salt
[C3-(L)-ornithinyl-cycloastragenol] 16a; 2(L),5-Diamino-pentanoic
acid 3b,
16b-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-fu-
ran-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[-
a]phenanthren-6a-yl Ester. Hydrochloride Salt
[C6-(L)-ornithinyl-cycloastragenol] 16b and
2(L),5-Diamino-pentanoic acid
3b,6a-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-fura-
n-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]-
phenanthren-16b-yl ester. Hydrochloride Salt
[C16-(L)-ornithinyl-cycloastragenol] 16c
##STR00025## ##STR00026##
[0189] Preparation of 15a, 15b, 15c:
[0190] (Boc).sub.2-(L) Ornithine --OH (4.5 g, 13.6 mmols) (Bachem,
Torrance, Calif.) was dissolved in 15 ml of DCM. To this was added
2.5 g (13.6 mmol) of pentafluorophenol. The reaction was cooled in
an ice-bath followed by slow addition of 2.2 ml (13.6 mmols) of
DIC. After complete addition the reaction mixture was stirred at
room temperature for 30 minutes at which time the reaction mixture
turned turbid (diisopropylcarbodimide-urea precipitation). To this
mixture was then added 700 mg (1.43 mmols) of 2 followed by 1.6 g
(13.6 mmol) of DMAP and the reaction was stirred at room
temperature for 24 hours. The reaction mixture was transferred into
a separatory funnel and washed with H.sub.2O (2.times.) 1% aq. HCl
(2.times.), 0.1N aq. NaOH (2.times.), sat. NaHCO.sub.3 (3.times.),
H.sub.2O (1.times.) and brine (1.times.), the organic layer was
separated, dried over Na.sub.2SO.sub.4, filtered and the solvent
was evaporated under vacuum. To the residue was then added 25 ml of
diethylether and the urea was precipitated out. The filtrate was
evaporated and the residue was purified using flash chromatography
with solvent gradient of 2%-5% MeOH in DCM to furnish 690 mg (60%)
of a mixture of products 15a,15b,15c, and 120 mg (8%) of the C3, C6
bis product.
[0191] The .sup.1HNMR showed major amounts of 15a and 15b products
with 2% of the regioisomer 15c. .sup.1HNMR of the mixture (15a,15b
and 15c): (CDCl.sub.3) .delta. ppm: 0.38 (1H, bs), 0.52 (1H, bs),
0.90-1.38 (m, 26H), 1.39-1.45 (s, m 27H), 1.59-1.63 (m, 5H),
1.76-1.82 (m, 2H), 1.96-2.01 (m, 4H), 2.16-2.20 (m, 1H), 2.30-2.35
(d, 1H), 2.49-2.54 (q, 1H), 3.10-3.19 (m, 6H), 3.19-3.22 (m, 1H),
3.45-3.57 (t, 1H), 3.71-3.76 (m, 1H), 4.19-4.21 (m, 1H), 4.22-4.30
(m, 1H), 4.52-4.60 (m, 1H), 4.61-4.65 (m, 1H), 4.79-4.81 (m, 1H),
4.95-5.01 (m, 1H), 5.13-5.21 (m, 1H), 5.38-5.41 (m, 1H). MS (M+H)
804
##STR00027## ##STR00028##
[0192] Preparation of 16a, 16b, 16c
[0193] To a 200 mg (0.25 mmol) of the mixture of 15a, 15b, 15c, was
added 10 ml of 1.0 M HCl/diethylether and stirred for 16 hrs. The
white solids were filtered and washed with 10 ml of Et.sub.2O
(4.times.). The solids were then dried under high vacuum for
overnight to yield 160 mg (95%) of the target products 16a, 16b,
16c, as a white powder. The .sup.1HNMR showed major amounts of 16a
and 16b products with 2% of the C-16 (16c) regioisomer.
[0194] .sup.1HNMR of the mixture (16a, 16b and 16c): (D.sub.2O)
.delta. ppm: 0.26 (1H, bs), 0.52 (1H, bs), 0.90-1.18 (m, 26H),
1.49-1.74 (m, 5H), 1.83-2.10 (m, 2H), 2.20-2.31 (m, 4H), 2.81-2.92
(m, 2H), 3.19-3.20 (m, 1H), 3.39-3.42 (m, 1H), 3.62-3.71 (m, 1H),
3.88-4.00 (m, 1H), 4.08-4.12 (m, 1H), 4.52-4.57 (m, 1H), 4.61-4.65
(m, 1H), 4.79-4.81 (m, 1H). MS (M+H): 605.
Example 9: Preparation of a mixture of 2-(L)-Amino-pentanedioic
acid
1-{6a,16b-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro--
furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopent-
a[a]phenanthren-3b-yl} Ester. Hydrochloride Salt [C3
(L0-glutamate-cycloastragenol] 18a: 2-(L)-Amino-pentanedioic acid
1-{3b,
16b-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan--
2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta[a]ph-
enanthren-6a-yl} Ester. Hydrochloride Salt
[C6(L)-glutamate-cycloastragenol] 18b 2-(L)-Amino-pentanedioic acid
1-{3b,6a-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-f-
uran-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclopenta-
[a]phenanthren-16b-yl} Ester. Hydrochloride Salt [C16
(L)-glutamate-cycloastragenol] 18c
##STR00029##
[0196] Preparation of 17a, 17b, 17c:
[0197] Boc-(L)-Glutamic acid (Bachem, Torrance, Calif.) (O-tBu)
--OH (4.5 g, 14.82 mmols) was dissolved in 15 ml of DCM. To this
was added 2.73 g (14.82 mmol) of pentafluorophenol. The reaction
was cooled in an ice-bath followed by slow addition of 2.3 ml
(14.82 mmols) of DIC. After complete addition the reaction mixture
was stirred at room temperature for 30 minutes at which time the
reaction mixture turned turbid (diisopropylcarbodimide-urea
precipitation). To this mixture was then added 765 mg (1.56 mmols)
of cycloastragenol 2 followed by 1.8 g (14.82 mmol) of DMAP and the
reaction was stirred at room temperature for 24 hours. The reaction
mixture was transferred into a separatory funnel and washed with
H.sub.2O (2.times.) 1% aq. HCl (2.times.), 0.1N aq. NaOH
(2.times.), sat. NaHCO.sub.3 (3.times.), H.sub.2O (1.times.) and
brine (1.times.), the organic layer was separated, dried over
Na.sub.2SO.sub.4, filtered and the solvent was evaporated under
vacuum. To the residue was then added 50 ml of diethylether and the
urea was precipitated out. The filterate was evaporated and the
residue was purified using flash chromatography with solvent
gradient of 2%-5% MeOH in DCM to furnish 714 mg of (60%) of
in-separable mixture of products 17a, 17b, 17c, and 140 mg, (9%) of
the bis product (C3, C6). The .sup.1HNMR showed major amounts of
17a and 17b products with 2% of the regioisomer (17c).
[0198] .sup.1HNMR of the mixture (17a, 17b and 17c): (CDCl.sub.3)
.delta. ppm: 0.29 (1H, bs), 0.56 (1H, bs), 0.90-1.20 (m, 26H),
1.30-1.40 (s, m 25H), 1.48-1.65 (m, 3H), 1.82-1.92 (m, 2H),
2.16-2.22 (m, 2H), 2.42-2.50 (m, 2H), 3.20-3.40 (m, 1H), 3.55-3.61
(m, 1H), 3.82-3.96 (m, 1H), 4.42-4.50 (m, 1H), 4.62-4.71 (m, 1H),
4.79-4.81 (m, 1H), 4.95-5.01 (m, 1H), 5.13-5.21 (m, 1H), 5.38-5.41
(m, 1H). MS (M+H) 776.
##STR00030## ##STR00031##
[0199] Preparation of 18a, 18b, 18c:
[0200] To a 260 mg (0.34 mmol) of the mixture of 17a, 17b and 17c
was added 10 ml of 1.0 M HCl/diethylether and stirred for 16 hrs.
The white solids were filtered and washed with 10 ml of Et.sub.2O
(4.times.). The solids were then dried under high vacuum for
overnight to yield 210 mg (95%) of the target products 18 as a
white powder. The .sup.1HNMR showed major amounts of C-3 (18a) and
C-6 (18b) products with less than 2% of the C-16 (18c) regioisomer.
.sup.1HNMR of the mixture (18a, 18b and 18c): (D.sub.2O) .delta.
ppm: 0.26 (1H, bs), 0.49 (1H, bs), 0.90-1.18 (m, 26H), 1.49-1.74
(m, 4H), 1.83-2.10 (m, 2H), 2.20-2.31 (m, 4H), 2.39-2.50 (m, 4H),
2.81-2.92 (m, 2H), 3.29-3.30 (m, 1H), 3.39-3.42 (m, 1H), 3.62-3.71
(m, 1H), 3.88-4.02 (m, 3H), 4.52-4.57 (m, 1H), 4.61-4.65 (m, 1H),
4.79-4.81 (m, 1H). MS (M+H): 620.
Example 10: Preparation of a mixture of
2-(L)-Amino-3-phenyl-propionic acid
6.alpha.,16b-dihydroxy-7-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetr-
ahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cy-
clopenta[a]phenanthren-3a-yl Ester. Hydrochloride Salt
[C3-(L)-phenylalanyl-cycloastragenol] 20a:
2-(L)-Amino-3-phenyl-propionic acid
3b,16b-dihydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydr-
o-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]cyclope-
nta[a]phenanthren-6a-yl Ester. Hydrochloride Salt
[C6-(L)-phenylalanyl-cycloastragenol] 20b
##STR00032##
[0202] Preparation of 19a, 19b:
[0203] Boc-(L)-Phenylalanine-OH (Bachem, Torrance, Calif.)(5.0 g,
18.84 mmols) was dissolved in 30 ml of DCM. To this was added 3.5 g
(18.84 mmol) of pentafluorophenol. The reaction was cooled in an
ice-bath followed by slow addition of 2.9 ml (1.9 mmols) of DIC.
After complete addition the reaction mixture was stirred at room
temperature for 30 minutes at which time the reaction mixture
turned turbid (diisopropylcarbodimide-urea precipitation). To this
mixture was then added 1.0 g (1.56 mmols) of cycloastragenol 2
followed by 1.8 g (15 mmol) of DMAP and the reaction was stirred at
room temperature for 24 hours. The reaction mixture was transferred
into a separatory funnel and washed with H.sub.2O (2.times.) 1% aq.
HCl (2.times.), 0.1N aq. NaOH (2.times.), sat. NaHCO.sub.3
(3.times.), H.sub.2O (1.times.) and brine (1.times.), the organic
layer was separated, dried over Na.sub.2SO.sub.4, filtered and the
solvent was evaporated under vacuum. To the residue was then added
50 ml of diethylether and the urea was precipitated out. The
filterate was evaporated and the residue was purified using flash
chromatography with solvent gradient of 1%-2% MeOH in DCM to
furnish 950 mg of (68%) of in-separable mixture (C-3 and C-6) of
products and 290 mg (30%) of the bis product (C3 and C6). The
.sup.1HNMR showed major amounts of C-3 (19a) and C-6 product
(19b).
[0204] .sup.1HNMR of the mixture (19a and 19b): (CDCl.sub.3)
.delta. ppm: 0.32 (1H, bs), 0.60 (1H, bs), 0.70-1.20 (m, 14H),
1.30-1.40 (s, m 12H), 1.48-1.65 (m, 2H), 1.76-1.92 (m, 4H),
2.22-2.32 (m, 1H), 2.52-2.58 (m, 1H), 2.86-2.91 (m, 1H), 3.0-3.18
(m, 1H), 3.20-3.24 (m, 1H), 3.55-3.61 (m, 1H), 3.72-3.80 (m, 1H),
4.0-4.10 (m, 1H), 4.42-4.58 (m, 2H), 4.61-4.63 (m, 1H), 4.77-4.78
(m, 1H), 4.81-4.90 (m, 1H), 7.08-7.25 (m, 5H). MS (M+H) 738.
##STR00033##
[0205] Preparation of Mixture of 20a, 20b:
[0206] To a 330 mg (0.45 mmol) of the mixture of 19a and 19b was
added 10 ml of 1.0 M HCl/diethylether and stirred for 8 hrs. The
white solids were filtered and washed with 10 ml of cold Et.sub.2O
(3.times.). The solids were then dried under high vacuum for
overnight to yield 260 mg (86%) of the target products 20a and 20b
as a white powder.
[0207] .sup.1HNMR of the mixture (20a and 20b): (DMSOd.sub.6)
.delta. ppm: 0.22 (1H, bs), 0.55 (1H, bs), 0.70-1.10 (m, 24H),
1.20-1.30 (m, 3H), 1.42-1.55 (m, 2H), 1.61-1.80 (m, 2H), 1.87-1.89
(m, 2H), 2.19-2.20 (d, 1H), 2.42-2.50 (m, 1H), 2.92-3.10 (m, 2H),
3.20-3.21 (m, 2H), 3.30-3.34 (m, 1H), 3.55-3.61 (m, 1H), 3.78-3.88
(m, 1H), 4.12-4.20 (m, 2H), 4.42-4.45 (m, 1H), 4.48-4.53 (m, 1H),
4.80-4.82 (m, 1H), 7.08-7.25 (m, 5H), 8.62-8.80 (bs, 3H). MS (M+H)
638
Example 11. Preparation of 3-Methyl-2-(b)-methylamino-butyric acid
16-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-y-
l]-6.alpha.-methoxy-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,10]c-
yclopenta[a]phenanthren-3.beta.-yl Ester. Hydrochloride Salt
[C3-(L)-valyl-C6-methoxy-cycloastragenol] (22)
[0208] This analog was made starting from intermediate 3 by the
following procedure
##STR00034##
[0209] Preparation of 21:
[0210] 280 mg (0.41 mmols) of 3 was dissolved in 1.5 mL of NMP and
33 mg (0.82 mmols) of NaH (60% dispersion in oil) was added to it.
The reaction was stirred for 10 minutes followed by addition of 80
.mu.L of dimethylsulfate and stirred at the ambient temperature for
16 hrs. The reaction mixture was diluted with 25 mL of DCM and
washed with H.sub.2O (4.times.5 mL) and brine (lx 5 mL), dried over
Na2SO4 and filtered. The filterate was concentrated under reduced
pressure. The crude was purified purified using flash
chromatography with solvent gradient of 1%-3% MeOH in DCM to
furnish 170 mg (58%) of 21.
[0211] .sup.1HNMR for 21: (CDCl.sub.3) .delta. ppm: 0.38 (1H, bs),
0.52 (1H, bs), 0.90-1.38 (m, 30H), 1.39-1.45 (s, m 12H), 1.59-1.63
(m, 5H), 1.76-1.82 (m, 2H), 1.96-2.01 (m, 4H), 2.16-2.20 (m, 1H),
2.30-2.35 (d, 1H), 2.49-2.54 (q, 1H), 2.70-2.73 (s, s, 3H),
3.20-3.22 (s, s 3H), 3.26-3.28 (t, 1H), 3.70-3.75 (t, 1H),
4.19-4.21 (m, 1H), 4.53-4.61 (m, 1H), 4.70-4.73 (q, 1H). MS (M+H)
718.
##STR00035##
[0212] Preparation of 22:
[0213] To 150 mg (0.21 mmol) of the 21 was added 8 ml of 1.0 M
HCl/diethylether and stirred for 24 hrs. The white solids were
filtered and washed with diethyl ether (2.times.5 ml). The solids
were then dried under high vacuum for overnight to yield 115 mg
(85%) of the target product 22 as a white powder.
[0214] .sup.1HNMR for 22 (DMSOd.sub.6) .delta. ppm: 0.35 (bs, 1H),
0.48 (bs, 1H), 0.81-1.40 (m, 29H), 1.45-1.60 (m, 3H), 1.61-1.70 (m,
2H), 1.81-1.89 (m, 4H), 2.19-2.30 (m, 2H), 2.41-2.70 (m, 5H),
3.0-3.18 (m, 3H) 3.20-3.28 (m, 2H), 3.58-3.61 (t, 1H), 3.81-3.83
(m, 1H), 4.0-4.12 (bs, 4H), 4.49-4.51 (m, 1H), 4.62-4.70 (m, 1H),
9.20-9.42 (bs, 2H). MS (M+H) 618.
Example 12. Preparation of 2-(L)-Amino-3-methyl-butyric acid
6.alpha.,16.beta.-dimethoxy-17-[5-(1-methoxy-1-methyl-1-methyl)-2-methyl--
tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-cyclopropa[9,1-
0]cyclopenta[a]phenanthren-3.beta.-yl ester. Hydrochloride Salt
[C3-(L)-valyl-C6,C16-dimethoxy-cycloastragenol] 27
##STR00036## ##STR00037##
[0216] Preparation of 23:
[0217] 5.0 g (10.2 mmols) of 2 was dissolved in pyridine (50 ml)
and cooled to 0.degree. C. Benzoyl chloride (2.35 ml, 20.4 mmols)
was added and the reaction mixture was stirred at room temperature
for 24 hrs. The reaction mixture was diluted with 200 ml of diethyl
ether and washed with sat. NaHCO.sub.3 (2.times.), H.sub.2O
(2.times.) and brine (1.times.). Dried over MgSO.sub.4, filtered
and the solvents evaporated under vacuum. The crude was purified by
column chromatography using 1%-2% MeOH in DCM to furnish 1.6 g
(26%) of 23 as white solids.
[0218] .sup.1HNMR for 23: (CDCl.sub.3) .delta. ppm: 0.38 (bs, 1H),
0.55 (bs, 1H), 0.90-2.0 (m, 37H), 1.70-1.82 (m, 2H), 2.30-2.35 (m,
1H), 2.50-2.6 (m, 1H), 3.45-3.57 (m, 1H), 3.71-3.76 (m, 1H),
4.69-4.72 (m, 1H), 4.79-4.81 (m, 1H), 7.41 (t, 2H), 7.52 (t, 1H),
8.03 (d, 2H). MS (M+H) 595.
[0219] Preparation of 24:
[0220] 600 mg (1.01 mmols) of 23 was dissolved in THE (10 ml) and
NaH (323 mg, 8.08 mmols) was added and the reaction mixture was
stirred for 20 minutes. Dimethyl sulfate (509 mg, 4.04 mmols) was
added and the reaction mixture was stirred at room temperature for
16 hrs. The reaction mixture was diluted with 100 ml of diethyl
ether and quenched with H.sub.2O and successively washed with
H.sub.2O (2.times.) and brine (1.times.), dried over MgSO.sub.4,
filtered and the solvents evaporated under vacuum. The crude was
purified by column chromatography using 1%-2% MeOH in DCM to
furnish 460 mg of (72%) of 24 as white solids.
[0221] .sup.1HNMR for 24: (CDCl.sub.3) .delta. ppm: 0.30 (bs, 1H),
0.53 (bs, 1H), 0.90-2.0 (m, 37H), 2.40-2.45 (m, 2H), 2.92-2.96 (m,
1H), 3.10-3.14 (s, 3H), 3.22-3.24 (s, 3H), 3.80-3.82 (m, 1H),
3.9-4.10 (m, 1H), 4.69-4.79 (m, 1H), 7.43 (t, 2H), 7.52 (t, 1H),
8.04 (d, 2H). MS (M+H) 637.
[0222] Preparation of 25:
[0223] 460 mg (0.72 mmols) of 24 was dissolved in DCM (10 ml) and
to this was added 10 ml of 0.5M solution of NaOMe in MeOH and the
reaction mixture was stirred at 40.degree. C. for 48 hrs. The
reaction mixture was quenched with a solution of sat. NaHCO.sub.3
and the solvents were then evaporated under reduced pressure. The
crude was purified by column chromatography using 1%-2% MeOH in DCM
to furnish 210 mg of (55%) of 25 as white solids.
[0224] .sup.1HNMR for 25: (CDCl.sub.3) .delta. ppm: 0.24 (bs, 1H),
0.49 (bs, 1H), 0.90-2.0 (m, 37H), 2.40-2.45 (m, 2H), 2.92-2.96 (m,
1H), 3.10-3.14 (s, 3H), 3.22-3.24 (s, 3H), 3.26-3.28 (m, 1H),
3.80-3.82 (m, 1H), 3.9-4.10 (m, 1H). MS (M+H) 533.
[0225] Preparation of 26:
[0226] Boc-Val-OH (685 mg, 3.16 mmols) was dissolved in 3 ml of
DCM. To this was added 581 mg (3.16 mmol) of pentafluorophenol. The
reaction was cooled in an ice-bath followed by slow addition of
0.49 ml (3.16 mmols) of DIC. After complete addition the reaction
mixture was stirred at room temperature for 10 minutes at which
time the reaction mixture turned turbid
(diisopropylcarbodimide-urea precipitation). To this mixture was
added 210 mg (0.395 mmols) of 25 followed by 385 mg (3.16 mmol) of
DMAP and the reaction was stirred at room temperature for 48 hours.
The reaction mixture was transferred into a separatory funnel and
washed with H.sub.2O (2.times.) 1% aq. HCl (2.times.), 0.1N aq.
NaOH (2.times.), sat. NaHCO.sub.3 (3.times.), H.sub.2O (1.times.)
and brine (1.times.), the organic layer was separated, dried over
Na.sub.2SO.sub.4, filtered and the solvent was evaporated under
vacuum. To the residue was then added 10 ml of diethylether and the
urea was precipitated out. The filtrate was evaporated and the
residue was purified using flash chromatography with solvent
gradient of 2%-5% MeOH in DCM to furnish 277 mg (96%) of the target
product 26.
[0227] 1HNMR for 26: (CDCl.sub.3) .delta. ppm: 0.23 (bs, 1H), 0.49
(bs, 1H), 0.90-2.0 (m, 52H), 2.20-2.25 (m, 1H), 2.32-2.45 (m, 1H),
2.92-3.0 (m, 1H), 3.08-3.10 (s, 3H), 3.19-3.20 (s, 3H), 3.22-3.25
(s, 3H), 3.82-3.84 (m, 1H), 3.90-3.92 (m, 1H), 4.10-4.21 (m, 1H),
4.50-4.58 (m, 1H), 4.91-5.01 (m, 1H). MS (M+H) 732.
[0228] Preparation of 27
[0229] To 100 mg (0.14 mmol) of the 26 was added 8 ml of 1.0M
HCl/diethylether and stirred for 8 hrs. The white solids were
filtered and washed with diethyl ether (2.times.5 ml). The solids
were then dried under high vacuum for overnight to yield 65 mg
(70%) of the target product 27 as a white powder.
[0230] .sup.1HNMR for 27 (DMSOd.sub.6) .delta. ppm: 0.20 (bs, 1H),
0.38 (bs, 1H), 0.75-1.90 (m, 43H), 2.10-2.15 (m, 1H), 2.20-2.25 (m,
1H), 2.82-2.88 (m, 1H), 2.93-3.03 (s, 3H), 3.19-3.20 (s, 3H),
3.22-3.25 (s, 3H), 3.70-3.79 (m, 1H), 3.90-3.92 (m, 1H), 4.10-4.21
(m, 1H), 4.50-4.58 (m, 1H), 8.14-8.24 (bs, 3H). MS (M+H) 632.
Example 13: Preparation of 2-(L)-Amino-3-methyl-butyric acid,
16.beta.-hydroxy-17-[5-(1-hydroxy-1-methyl-ethyl)-2-methyl-tetrahydro-fur-
an-2-yl]-4,4,13,14-tetramethyl-3-oxo-tetradecahydro-cyclopropa[9,10]cyclop-
enta[a]phenanthren-6.alpha.-yl Ester. Hydrochloride Salt
[C6-(L)-valyl-cycloastragenone] (30): Preparation of 3-(L)
valyl-cycloastragenone
##STR00038## ##STR00039##
[0232] Preparation of 28:
[0233] To a stirred solution of DMSO (6.4 g, 4 equ, 100 mL of DCM)
at -60 to -70.degree. C., oxalyl chloride (5.2 g in 10 mL of DCM)
was added and it was stirred for 10 minutes. Compound 2 (10 g in
200 mL of DCM) was added over a period of 10 minutes and the
reaction mixture was stirred for 30 minutes followed by addition of
triethylamine (10.3 g over 5 min). The reaction was stirred at -60
to -70.degree. C. for 1-2 hrs until the reaction was complete. The
crude product 28 was purified by column chromatography. Eluted with
Petroleum ether:ethyl acetate=4:1 to get 8 g of mono-oxidation
product.
[0234] .sup.1HNMR for 28: (CDCl.sub.3) .delta. ppm: 0.38 (bs, 1H),
0.58 (bs, 1H), 0.80-1.32 (m, 25H), 1.50-2.20 (m, 12H), 2.30-2.70
(m, 4H), 2.50-2.6 (m, 1H), 3.45-3.52 (m, 1H), 3.71-3.76 (m, 1H),
4.69-4.72 (m, 1H), MS (M+H) 489.
[0235] Preparation of 29:
[0236] Boc-(L) Val-OH (0.54 g) was dissolved in 15 ml of DCM. To
this solution 0.45 g of pentafluorophenol was added. The reaction
was cooled in an ice-bath followed by slow addition of 0.4 ml of
DIC. After complete addition the reaction mixture was stirred at
room temperature for 30 minutes at which time the reaction mixture
turned turbid (diisopropylcarbodimide-urea precipitation). To this
mixture was then added 0.3 g of compound 28 followed by 0.3 g of
DMAP and the reaction was stirred at room temperature for 24 hours.
The reaction mixture was transferred into a separatory funnel and
washed with 0.1N aq. NaOH (2.times.), H.sub.2O (3.times.) and brine
(1.times.), the organic layer was separated, dried over
Na.sub.2SO.sub.4, filtered and the solvent was evaporated under
vacuum. The residue including compound 29 was not purified but
taken to the next step of deprotection.
[0237] Preparation of 30:
[0238] The above crude product was treated with HCl in ethyl
acetate for 12 hrs. The product was then isolated by extraction
with water and upon drying provided the crude HCl salt which was
purified by prep-HPLC with petroleum ether and ethyl acetate
mixture. The pure fractions were pooled to provide 120 mg of the
final product 30.
[0239] .sup.1HNMR for 30: (DMSOd.sub.6) .delta. ppm: 0.40 (bs, 1H),
0.80 (bs, 1H), 0.80-1.32 (m, 29H), 1.50-2.20 (m, 12H), 2.30-2.32
(m, 2H), 2.40-2.45 (m, 2H), 3.60-3.62 (m, 1H), 3.93-4.01 (m, 1H),
4.49-4.51 (m, 1H), 4.79-4.81 (m, 1H). MS (M+H) 588.
Example 14: Preparation of 2-(L)-Amino-3-methyl-pentanoic acid
6.alpha.-(2-amino-3-methyl-pentanoyloxy)-16.beta.-hydroxy-17-[5-(1-hydrox-
y-1-methyl-ethyl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-te-
tradecahydro-cyclopropa[9,10]cyclopenta[a]phenanthren-3.beta.-yl
ester hydrochloride salt
[C3,C6-(L,L)-bis-isoleucine-cycloastragenol]-32
##STR00040##
[0241] Preparation of 31:
[0242] Boc-(L)-Ile-OH (4.6 g, 20 mmols) was dissolved in 25 ml of
N-methylpyrrolidone (NMP). To this was added 3.7 g (20 mmol) of
pentafluorophenol. The reaction was cooled in an ice-bath followed
by slow addition of 3.1 ml (20 mmols) of DIC. After complete
addition the reaction mixture was stirred at room temperature for
30 minutes at which time the reaction mixture turned turbid
(diisopropylcarbodimide-urea precipitation). To this mixture was
then added 1.0 g (2.04 mmols) of 2 followed by 1.7 g (14 mmol) of
DMAP and the reaction was stirred at room temperature for 24 hours.
The reaction mixture was transferred into a separatory funnel and
washed successively with H.sub.2O (6.times.), 1% aq. HCl
(2.times.), 0.1N aq. NaOH (2.times.), sat. NaHCO.sub.3 (3.times.),
H.sub.2O (1.times.) and brine (1.times.), the organic layer was
separated, dried over Na.sub.2SO.sub.4, filtered and the solvent
was evaporated under vacuum. The residue was purified using flash
chromatography with solvent gradient of 2%-5% MeOH in DCM to
furnish 1.4 g (80%) of the target product 31.
[0243] .sup.1HNMR for 31: (CDCl.sub.3) .delta. ppm: 0.38 (1H, bs),
0.60 (1H, bs), 0.80-1.0 (m, 24H), 1.13 (s, s 6H), 1.20 (s, s 6H),
1.32 (s, 6H), 1.35 (s, s 4H) 1.41 (s, s 18H), 1.55-1.60 (m, 6H),
1.79-1.83 (m, 3H), 3.71-3.75 (t, 1H), 4.08-4.20 (m, 2H), 4.58-4.60
(m, 1H), 4.61-4.71 (q, 1H), 4.72-4.80 (m, 1H), 4.82-4.84 (d, 1H),
4.9-5.0 (d, 1H). MS (M+H) 915.
##STR00041##
[0244] Preparation of 32:
[0245] To a 1.5 g (1.6 mmol) of the 31 in 4 ml of dry Et.sub.2O was
added 3.5 ml of 4.0M HCl/dioxane and stirred for 4 hrs. The
solvents were evaporated and the product was precipitated with
three times of 40 ml of cold diethyl ether and the solids filtered
off. The solids were then dried under high vacuum for overnight to
yield 3.1 g (91%) of the target product 32 as a white powder.
.sup.1HNMR for 32 (DMSOd.sub.6) .delta. ppm: 0.22 (bs, 1H), 0.57
(bs, 1H), 0.80-1.20 (m, 35H), 1.41-1.80 (m, 14H), 2.10-2.21 (m,
2H), 2.34-2.42 (m, 4H), 2.20-2.30 (m, 2H), 3.59-3.62 (m, 1H),
3.81-3.83 (m, 2H), 4.42-4.53 (m, 1H), 4.61-4.71 (m, 1H), 4.81-4.9
(m, 1H), 8.40-8.70 (d, 4H). MS (M+H) 717.
Example 15: Preparation of 2-(L)-Amino-3-methyl-butyric acid,
3.beta.,6.alpha.-dihydroxy-16.beta.-hydroxy-17-[5-(1-hydroxy-1-methyl-eth-
yl)-2-methyl-tetrahydro-furan-2-yl]-4,4,13,14-tetramethyl-tetradecahydro-c-
yclopropa[9,10]cyclopenta[a]phenanthren-16.beta.-yl Ester
Hydrochloride Salt [C16-(L)-Valyl-cycloastragenol]-36
##STR00042## ##STR00043##
[0247] Preparation of 33:
[0248] To 4 g (8.2 mmol) of 2 was added 100 ml of pyridine and
cooled in an ice-bath. To this was slowly added 77 ml (820 mmol) of
acetic anhydride followed by 100 mg (0.81 mol) of DMAP. The
reaction mixture was stirred at for 16 hrs. The reaction mixture
was cooled in an ice bath and quenched with 3% aq. HCl and diluted
with 200 ml of DCM and washed successively with the following: sat.
aq. NaHCO.sub.3, (2.times.), H.sub.2O (3.times.) and brine
(1.times.). The organic layer was separated, dried over
Na.sub.2SO.sub.4, filtered and evaporated under vacuum. The crude
was purified by flash chromatography with 1% MeOH in DCM to furnish
4.2 g (89%) of 33 as white solids. .sup.1HNMR for 33: (CDCl.sub.3)
.delta. ppm: 0.38 (1H, bs), 0.49 (1H, bs), 0.90-1.25 (m, 32H),
1.39-1.45 (m 2H), 1.50-1.60 (m, 2H), 1.70-1.82 (m, 2H), 1.96-2.01
(m, 4H), 2.18-2.20 (s, s 6H), 2.30-2.35 (d, 1H), 3.71-3.76 (m, 1H),
4.49-4.59 (m, 1H), 4.69-4.72 (m, 2H). MS (M+H) 575.
[0249] Preparation of 34:
[0250] 1.54 g (2.7 mmol) of 33 was dissolved in 8.0 ml of NMP. To
the clear solution was added 800 mg (8.3 mmol) of potassium
tert-butoxide and stirred for 45 mins. To this was added 3.0 g (8.9
mmols) of Boc-Val-ONp followed by 245 mg (2 mmol) of DMAP and
stirred for 24 hrs. The reaction mixture was diluted with 100 ml of
DCM and washed successively with the following: H.sub.2O
(4.times.), 1% aq. HCl (Ix), (sat. aq. NaHCO.sub.3, (2.times.),
H.sub.2O (3.times.) and brine (1.times.). The organic layer was
separated, dried over Na.sub.2SO.sub.4, filtered and evaporated
under vacuum. The crude was purified by flash chromatography with
petroleum ether/ethyl acetate to furnish 1.0 g (48%) of 34 as white
solids. .sup.1HNMR for 34: (CDCl.sub.3) .delta. ppm: 0.38 (1H, bs),
0.49 (1H, bs), 0.90-1.25 (m, 38H), 1.39-1.45 (m, s 11H), 1.50-1.60
(m, 2H), 1.70-1.82 (m, 2H), 1.96-2.01 (m, 4H), 2.18-2.20 (s, s 6H),
2.30-2.35 (d, 1H), 3.71-3.76 (m, 1H), 4.13-4.18 (m, 1H), 4.49-4.59
(m, 1H), 4.62-4.72 (m, 1H), 5.12-5.17 (m, 1H), 5.38-5.42 (m, 1H).
MS (M+Na.sup.+) 796
[0251] Preparation of 35:
[0252] To 700 mg (0.91 mmol) of 34 was added 20 ml of 0.5M solution
of MeOH/MeONa and stirred for 16 hrs. The reaction was cooled in an
ice bath and quenched with a solution of 1% aq. HCl to a pH of 5.
The methanol was evaporated under reduced pressure and to the aq.
layer was added a solution of saturated aq. NaHCO.sub.3 and
extracted with DCM (4.times.), the combined organic layer was dried
over Na.sub.2SO.sub.4, filtered and evaporated under vacuum. The
crude was purified by flash chromatography with a gradient of 2% to
3% MeOH/DCM to furnish 360 mg (58%) of 35 as white solids.
.sup.1HNMR for 35: (CDCl.sub.3) .delta. ppm: 0.38 (1H, bs), 0.49
(1H, bs), 0.90-1.25 (m, 38H), 1.39-1.45 (m, s 11H), 1.50-1.60 (m,
2H), 1.70-1.82 (m, 2H), 2.10-2.20 (m, 2H), 2.30-2.35 (d, 1H),
3.20-3.25 (m, 1H), 3.41-3.50 (m, 1H), 3.71-3.76 (m, 1H), 4.13-4.18
(m, 1H), 5.12-5.17 (m, 1H), 5.38-5.42 (m, 1H). MS (M+Na.sup.+)
712
[0253] Preparation of 36:
[0254] To 350 mg (0.51 mmol) of 35 was added 10 ml of 1.0 M
solution of HCl/Et.sub.2O and stirred for 5 hrs. The solvents were
evaporated under reduced pressure and the residue was washed with
dry 10 ml of Et2O (3.times.) and filtered under vacuum. The white
solids were dried under high vacuum to furnish 250 mg (78%) of 36
as white solids. .sup.1HNMR for 36: (DMSO-d.sup.6) .delta. ppm:
0.38 (1H, bs), 0.49 (1H, bs), 0.80-1.25 (m, 29H), 1.39-1.83 (m,
4H), 2.10-2.20 (m, 2H), 2.30-2.40 (m, 4H), 3.18-3.21 (m, 1H),
3.38-3.40 (m, 1H), 3.71-3.76 (m, 1H), 4.13-4.17 (m, 1H), 5.40-5.42
(m, 1H), 8.38-8.53 (bs, 3H). MS (M+H) 590
Biological Example 1: Keratinocyte Cell/Telomerase Repeat
Amplification Protocol (TRAP) Assay
[0255] The ability of a compound to increase telomerase activity in
a cell can be determined using the TRAP (Telomeric Repeat
Amplification Protocol) assay, which is known in the art (e.g. Kim
et al., U.S. Pat. No. 5,629,154; Harley et al., U.S. Pat. No.
5,891,639). The activity is typically compared to the activity
similarly measured in a control assay of such cells (e.g., a
telomerase activity 50% greater than observed in a solvent
control).
[0256] Cell lines suitable for use in the assay, normal human
fibroblasts (NHF) or normal human keratinocytes (NHK), can be
obtained from commercial sources, such as Cascade Biologics,
Portland, Oreg. or 4C Biotech, Seneffe, Belgium, or from the ATCC
(American Type Culture Collection). ATCC normal human fibroblast
cell lines, which can be located on the ATCC web site, include, for
example, CCL135, CCL137, and CCL151.
[0257] Human epidermal keratinocyte (neonatal HEK) from three
individual donors (Cascade Biologics, Portland Oreg.) were pooled
together and a Work Cell Bank generated. The cells were cultured in
EpiLife Medium (Cascade Biologics, Cat.# M-EPI-500, Portland Oreg.)
supplemented with HKGS (Human Keratinocyte Growth Supplement)
(Cascade, Cat.# S-001-5). HEKneo-P cells were seeded in 96-well
plate 24 hr before treatment by trypsinizing the cells and
neutralizing the digestion by neutralization buffer TN.RTM.
(Cascade Biologics, Portland Oreg.) to make a cell suspension. The
cells were seeded at 5000 cells/100 uL/well in growth medium and
the plate incubated at a 37.degree. C., 5% CO.sub.2/95% air, in a
humidified tissue culture incubator. When the cells reach 75-80%
confluence, seeding density should be around
2.5.times.10.sup.3/cm.sup.2.
[0258] Compounds to be tested were formulated in 10% DMSO with
desired concentrations. 11 .mu.L of the formulated compound in a
concentration of 0.01 to 10 .mu.M was added to the 96-well culture
along with a control of 11 .mu.L 10% DMSO. Non-treatment control
(NT) was also included. Cells were harvested at 24 hr+/-1 hr by
removing the growth medium and washing once with PBS (phosphate
buffered saline) removing as much medium as possible. The cells
were lysed by adding 50 .mu.L of M-Per buffer (Pierce Cat#78503
& 78501) and incubating on ice for 1 hr+/-15 min. The plate
was, optionally, centrifuged at 2000 RPM, 5 min. The lysate was
carefully collected from each well of the plate and transferred to
a fresh V-bottom storage 96-well plate, leaving the monolayer cells
intact.
[0259] A cytotoxicity assay was performed in parallel with the cell
lysis by preparing a duplicate cell culture plate treated with the
same compounds. After 24 hours+/-1 hour of incubation with
compounds, 11 .mu.L 1.times. Alamar Blue was added to the duplicate
plate and the plate was incubated at 37.degree. C. The plate was
read at 1 and 3 hr with a fluorescence plate reader with excitation
wavelength at 530 nm and emission wavelength at 590 nm. Cell
viability (cytotoxicity) was directly proportional to the Alomar
Blue reading. 10.times.TRAP buffer:
TABLE-US-00005 Tris-HCl pH 8.3 200 mM MgCl2 15 mM KCl 650 mM Tween
20 0.5% EGTA 10 mM BSA 1 mg/ml
[0260] Primers:
TABLE-US-00006 Cy5-TS primer (SEQ ID NO: 1) (AAT CCG TCG AGC AGA
GTT) 5' end labeled ACX primer (SEQ ID NO: 2)
(GCGCGGCTTACCCTTACCCTTACCCTAACC)
[0261] Taq polymerase was AmpliTaq DNA Polymerase, (Applied
Biosystems, cat. #N8080171) and dNTP (Invitrogen, cat. #
R72501).
TABLE-US-00007 [0261] TABLE 1 TRAP assay set up Per Reaction Stock
concentration (.mu.L) Final con. 10x TRAP buffer w/ 5 1x BSA dNTP
2.5 mM 1 50 uM Cy5-TS Primer 0.5 mg/ml, 83 .mu.M 0.1 1 ng/.mu.L ACX
0.1 mg/ml, 11 .mu.M 1 2 ng/.mu.L Taq polymerase 5 U/ul 0.4 0.04
U/.mu.L cell extract 5-10 H.sub.2O 32.5-37.5 Total 45
[0262] The PCR mix includes the following components: Cy5-TS
primer, a 5'-Cy5 labeled oligonucleotide having the sequence 5'-AAT
CCG TCG AGC AGA GTT-3' (SEQ ID NO: 1), is a telomerase substrate.
Depending on the telomerase activity of the medium, telomer repeats
(having the sequence . . . AGGGTT . . . ) will be added to the
substrate, to form telomerase extended products, also referred to
as telomerase products or TRAP products. The ACX primer, having the
sequence 5'-GCG CGG CTT ACC CTT ACC CTT ACC CTA ACC-3' (SEQ ID NO:
2), is an anchored return primer that hybridizes to the telomerase
extended products.
[0263] A sample of cell lysate (5-10 .mu.L) was added to the PCR
mix in a reaction tube, and telomere extension/amplification is
carried out by incubating the mixture at the following temperatures
for the times indicated 30.degree. C. 30 min; then 28 cycles of the
3-step PCR reaction: 94.degree. C. for 30 seconds, 60.degree. C.
for 30 seconds, 72.degree. C. for 1 minute, followed by 72.degree.
C. for 4 minutes, and hold at 4.degree. C. The PCR reaction
products are ready to subject to run polyacrylamide gel
electrophoresis.
[0264] Loading dye containing e.g. bromophenol blue and xylene
cyanol was added to the reaction mixture, and the samples are
subjected to 10-15% non-denaturing Polyacrylamide gel
electrophoresis (PAGE) in 1.times.TBE. The TRAP reaction products
are observed, e.g. by using a fluoroimager for detection of
CY5-labeled telomerase products (maximal excitation at 650 nm;
maximal emission at 670 nm)
[0265] Telomerase activity was measured by captured total pixel
vol. (DNA ladder bands) above background for each gel lane. The
activity was normalized by measuring the total RNA (ng/mL) by using
Ribogreen.RTM. RNA Quantitation Kit from Molecular Probes, cat. #
R-11490 and following commercially recommended conditions with an
RNA standard range of 0.8-200 ng/mL, 1:2000 dilution of RG dye,
100-250.times. dilution of sample.
Total Pixel Vol/RNA=Normalized Relative Telomerase Activity
[0266] Cells viability (cytotoxicity) was directly proportional to
the AB reading.
[0267] The results are shown in table 2.
TABLE-US-00008 TABLE 2 Activity in in EC.sub.50 and vitro fold
Compound HEK increase of # Name Structure assay activity 2
cycloastragenol ##STR00044## + EC.sub.50 30 nM Max: 3.3 fold 4
C3-(L)-Valyl- cycloastragenol MW = 624.5 ##STR00045## + EC.sub.50
6-22 nM Max 4.5 fold 7 C3, C6-(L,L)- bisvalyl- cycloastragenol MW =
761 ##STR00046## + EC.sub.50 41- 50 nM; Max. 4.8 fold 12
C6-(L)-Valyl- cycloastragenol MW = 624.5 ##STR00047## + EC.sub.50
28- 32 nM: Max. 4.1 fold 14 C3-(L)- Isoleucyl- cycloastragenol MW =
639 ##STR00048## + EC.sub.50 9-21 nM; Max. 4.0 fold 18a, 18b, 18c
C3-(L)- Glutamate- cycloastragenol, C6-(L)- Glutamate-
cycloastragenol, L-Glutamate- C16- cycloastragenol MW = 654.5
##STR00049## ##STR00050## ##STR00051## Active in PBMC 16a, 16b, 16c
C3-(L)- Ornithinyl- cycloastragenol, C6-(L)- Ornithinyl-
cycloastragenol, C16-(L)- Ornithinyl- cycloastragenol MW = 677
##STR00052## ##STR00053## ##STR00054## - 20a, 20b C3-(L)-
phenylalanyl- cycloastragenol, C6-(L)- phenylalanyl-
cycloastragenol MW = 637.5 ##STR00055## ##STR00056## Active in PBMC
32 C3, 6 (L)- isoleucyl- cycloastragenol ##STR00057## + Max 3 fold
at 0.37-1.1 .mu.M 36 C16-(L)-valyl- cycloastragenol MW = 624.5
##STR00058## + Max. 3.0 fold at 0.01-0.12 .mu.M 30 C6-(L)-valyl-C3-
cycloastragenone ##STR00059## + EC.sub.50 31 .mu.M Max 3.5 22
C3-(L)-N- Methyl Valyl-C6 Methoxy- cycloastragenol MW = 652.5
##STR00060## - 8 C3,C6-(D,D)- bisvalyl- cycloastragenol MW = 761
##STR00061## - 5 C3-(D)-valyl- cycloastragenol MW = 624.5
##STR00062## - C16-(L)-valyl- C3,6-diacyl- cycloastragenol MW =
710.5 ##STR00063## - C6-(L)-valyl-C3- acyl- cycloastragenol MW =
667.5 ##STR00064## - 27 C3-(L)-valyl- C6,16- dimethoxy-
cycloastragenol MW = 652.5 ##STR00065## - + telomerase activation
is 2 fold or more in comparison with vehicle control at the peak of
the full dose curve.
Biological Example 2: Peripheral Blood Monocyte Cell/Telomerase
Repeat Amplification Protocol (TRAP) Assay
[0268] PBMC Isolation.
[0269] Blood was collected in sodium heparin vacutainers and pooled
into a single 50 mL polypropylene tube. Blood was diluted 1:1 with
1.times.PBS and mixed thoroughly by inversion. 25 mL of diluted
blood was layered over 12 mL of Lympholyte-H (Cedarlane
Laboratories) and centrifuged at room temperature for 20 min at 800
g. Using a pipette, lymphocyte layer at interface of Lympholyte-H
was carefully removed and transferred to a new 50 mL tube. The
transferred cells were diluted 1:1 with 1.times.PBS and centrifuged
at 800 g for 10 min to pellet the lymphocytes. The lymphocytes were
washed 2 times with "complete" media, which consists of RPMI
(Sigma, cat. No. R8758) that has been supplemented with 10%
heat-inactivated FBS and 10 mM Hepes.
[0270] Culture Conditions.
[0271] The cells were counted using Trypan Blue exclusion and
resuspended in complete media that is supplemented with 50 Units of
hIL-2/mL so that final concentration of cells is
1.times.10.sup.6/mL. To cell suspension, CD2/3/28 Ab-coated beads
from the T cell activation/expansion kit (Miltenyi, cat. No.
130-091-441) was added at a ratio of 1:2 (bead:cell). Cells were
grown in a flask and half of the media is changed every 2-3 days
(along with 20 Units of hIL-2/mL). At least once a week, cells are
counted and media level is adjusted to keep cells around
5.times.10.sup.5/mL.
[0272] Formulation of Analogs.
[0273] Analogs were formulated in pure culture-grade DMSO at a
concentration of 1 mM. From this stock, analogs are diluted to 100
.mu.M in complete RPMI medium. A portion of the 100 uM formulation
was diluted to 10 .mu.M in complete RPMI medium containing 10%
DMSO. Also, vehicle control was formulated by diluting DMSO in
complete RPMI media to obtain a 10% solution (this is equivalent to
the amount of DMSO in the analog dilutions).
[0274] Treatment with Analogs.
[0275] After 10-14 days in culture, cells were counted and
resuspended in conditioned media at a concentration of
1.times.10.sup.6/mL. 0.5 mL of this cell suspension was plated into
wells of a 24-well plate. Analog was diluted in fresh complete RPMI
media 1:50 as to obtain concentrations of 2 .mu.M (from 100 .mu.M
stock) and 0.2 .mu.M (from 10 .mu.M stock). Also, dilute the
vehicle control (10% DMSO in RPMI medium) 1:50 in fresh complete
RPMI media. Each well that contains 0.5 mL of cell suspension
(should be 5.times.10.sup.5 per well) receives 0.5 mL of diluted
analog or DMSO vehicle control. Final concentrations of analogs
were therefore 1 .mu.M and 0.1 .mu.M and final concentration of
DMSO in all wells (including the vehicle control) is 0.1%.
[0276] Cell Harvesting and Preparation of Cell Lysate.
[0277] 24 hours after addition of analogs and DMSO vehicle control
to culture, cells were removed from wells and added to microfuge
tubes. Cells were centrifuged at 14,000 rpm for 2 minutes and media
was aspirated, followed by resuspension in 0.5 mL of cold
1.times.PBS. Cells were centrifuged again for 2 minutes and PBS was
aspirated. Cell pellet was resuspended in 100 .mu.L of M-PER
(mammalian protein extraction reagent) and incubated on ice for 30
minutes. After incubation, suspension was centrifuged at 14,000 rpm
for 20 min at 4.degree. C. Following spin, 80 .mu.L of lysate was
transferred to a pre-chilled microfuge tube, being careful not to
transfer any cellular debris. Final concentration of cell lysate
was 5000 cells/.mu.L.
[0278] TRAP Reaction and Gel.
[0279] Samples were analyzed using a 1-step TRAP PCR reaction.
Before conducting the reaction, samples were diluted 1:5 in M-PER
buffer (1000 cells/.mu.L). For each reaction the following mixture
was used: 37.5 .mu.L of H.sub.2O, 5 .mu.L of 10.times.TRAP buffer
with BSA, 1 .mu.L of 2.5 mM dNTP, 1 .mu.L of 0.1 mg/mL ACX primer,
0.1 .mu.L of 0.5 mg/mL Cy5-labeled TS primer, 0.4 .mu.L of 5
U/.mu.L Taq Polymerase, and 5 .mu.L of diluted sample (50 .mu.L
total reaction). PCR reaction was as follows: 30.degree. C. for 30
minutes, 28 cycles of 94.degree. C. for 30 seconds, 60.degree. C.
for 30 seconds, and 72.degree. C. for 1 minute, followed by
72.degree. C. for 4 minutes. PCR products were separated on a 12.5%
polyacrylamide gel and analyzed using a STORM phosphorimager.
TABLE-US-00009 Activity in Fold increase Compound Name PBMC at 1
.mu.M 2 cycloastragenol ++ 1.6-20.7 4 C3-(L)-Valyl- ++ 1.4-19.4
cycloastragenol MW = 624.5 16a, 16b, 16c C3-(L)-Ornithinyl- +
1.2-8.1 mixture cycloastragenol, C6-(L)-Ornithinyl-
cycloastragenol, C16-(L)-Ornithinyl- cycloastragenol MW = 677 18a,
18b, 18c C3-(L)-Glutamate- + 0.9-6.8 mixture cycloastragenol,
C6-(L)-Glutamate- cycloastragenol, L-Glutamate-C16- cycloastragenol
MW = 654.5 20a, 20b C3-(L)-phenylalanyl- -/+ 2.0-4.1 mixture
cycloastragenol, C6-(L)-phenylalanyl- cycloastragenol MW =
637.5
Biological Example 3: Administration of Compounds to Mice and
Analysis of Plasma Levels and Telomerase Activity in Tissues
[0280] The plasma levels of a compound following a single
intravenous, oral, intra-peritoneal, or sub-cutaneous
administration in male C57BL/6 mice was determined. Plasma samples
were collected and used to determine the plasma concentration of
the compound and metabolites. In addition tissue samples, including
whisker samples, and peripheral blood mononuclear cells (PBMC)
cells were collected for telomerase activity analysis.
[0281] C57BLl6 mice were divided into treatment groups. The mice
were provided ad libitum SLAC-MO1 # W080208 (Shanghai Laboratories
Animal Center, Shanghai, China) throughout the in-life portion of
the study with the exception of the overnight fasting period prior
to oral dosing. Water was available ad libitum.
[0282] Environmental controls for the animal room were set to
maintain a temperature of 23.+-.2.degree. C., humidity of 50-70%,
and a 12-hour light/12-hour dark cycle. The 12-hour dark cycle may
be temporarily interrupted to accommodate study procedures. Animals
were acclimated to study procedures for 1-7 days prior to initial
dose administration.
[0283] Animals used in this study were selected based on body
weights that fall within .+-.20% of the mean body weight, overall
health and acclimation to caging. Animals were given free access to
both food and water during the whole course of study with the
exception of the overnight fasting period prior to oral dosing.
[0284] Doses were administered intravenously via tail vein, orally,
sub-cutaneous, or intra-peritoneally as indicated in Table 3. Body
weights were taken on the day of dose administration. Dose volume
was determined based on individual body weight taken on day of
dosing.
[0285] Blood samples (approximately 300 .mu.L) were collected via
cardiac puncture or via retro-orbital puncture after anesthesia
into tubes containing K2-EDTA anticoagulant and 1 mg/ml NaF at the
various time points after dosing. Blood was stored on ice and then
plasma separated via centrifugation (8000 rpm.times.6 minutes). The
plasma was stored at 20.degree. C. until LC-MS/MS analysis.
[0286] Euthanasia was done by carbon dioxide inhalation followed by
exsanguination. Whisker and peripheral blood mononuclear cells
(PBMC) were collected in some animals at 30 hrs and were stored at
-80.degree. C. after processing.
[0287] PBMCs were harvested from blood using K.sub.2EDTA as the
anticoagulant. After collection, the tube was gently inverted 8-10
times to mix. The tube was centrifuged at 12000 rpm for 30 sec. to
pellet cells, the supernatant was removed and the resulting PBMC
pellets were flash frozen in dry ice/methanol and were stored at
-80.degree. C. Cells were processed as indicated in Biological
Example 2. FIG. 1 shows the telomerase activity in PBMCs over time
after treatment with compound 4.
[0288] A single or group of whiskers were plucked and 10-20
whiskers/animal were placed in 200 .mu.L of M-Per buffer (Pierce
catalog #: 78503/78501/78505, submerging the follicles). The
samples were frozen in dry ice/methanol within 1 hour of plucking.
FIG. 2 shows the telomerase activity in whiskers over time after
treatment with compound 4.
[0289] It was determined that the mono-amino acid substituted
compounds of Formula I when administered to mice show some
conversion to cycloastragenol and the di-amino acid substituted
compounds may show a minor amount of conversion to monosubstituted
compounds.
[0290] The positional isomer mixtures,
C3-(L)-Ornithinyl-cycloastragenol,
C6-(L)-Ornithinyl-cycloastragenol,
C16-(L)-Ornithinyl-cycloastragenol (16a, 16b, 16c mixture) and
C3-(L)-Glutamate-cycloastragenol, C6-(L)-Glutamate-cycloastragenol,
L-Glutamate-C16-cycloastragenol (18a, 18b, 18c mixture) were not
bioavailable in mice.
[0291] The bioavailability of the compounds is shown in Table
3.
TABLE-US-00010 TABLE 3 Study and bioavailability in Mice Dose Test
Level Dosing Bioavailability compound (mg/kg) Vehicle route % F 4
10 2% EtOH/98% water PO 48 4 10 2% EtOH/98% water SC 66 7 10 2%
EtOH/98% water PO 25 7 10 2% EtOH/98% water SC 61 12 5 2% EtOH/98%
water PO 8 12 5 2% EtOH/98% water IP 42 14 10 5% PEG400/5% solutol
PO 42 HS-15/90% water
Biological Example 4: Administration of Compounds to Male Rats and
Analysis of Plasma Levels and Telomerase Activity in Tissues
[0292] The plasma levels of a compound following a single
intravenous and oral administration in carotid artery-cannulated
male Sprague Dawley rats was determined. Plasma samples were
collected and used to determine the plasma concentration of the
compound and metabolites. In addition tissue samples, including
whisker samples and PBMC cells were collected for telomerase
activity analysis.
[0293] Carotid artery-cannulated male Sprague Dawley rats were
divided into treatment groups according to Table 6. The rats were
provided ad libitum SLAC-MO1 #YY080208 (Shanghai Laboratories
Animal Center, Shanghai, China) throughout the in-life portion of
the study with the exception of the overnight fasting period prior
to oral dosing. Water was available ad libitum.
[0294] Environmental controls for the animal room were set to
maintain a temperature of 23.+-.2.degree. C., humidity of 50-70%,
and a 12-hour light/12-hour dark cycle. The 12-hour dark cycle may
be temporarily interrupted to accommodate study procedures. Animals
were acclimated to study procedures for 1-7 days prior to initial
dose administration.
[0295] Animals used in this study were selected based on body
weights that fall within .+-.20% of the mean body weight, overall
health and acclimation to caging. Animals were given free access to
both food and water during the whole course of study with the
exception of the overnight fasting period prior to oral dosing.
[0296] The compounds were dissolved in 2% EtOH/98% water to yield a
final concentration of 2.5 mg/ml and 1 mg/ml for both intravenous
and oral administration, respectively. The concentration of each
compound was confirmed by HPLC analysis.
[0297] Doses were administered intravenously via tail vein and
orally as indicated in Table 4. Body weights were taken on the day
of dose administration. Dose volume was determined based on
individual body weight taken on day of dosing.
[0298] Blood samples (approximately 250 .mu.L) were collected via
artery cannulae into tubes containing K.sub.2-EDTA anticoagulant
and 1 mg/ml NaF at appropriate time points. Blood was stored on ice
and then plasma separated via centrifugation (8000 rpm.times.6
minutes). The plasma was stored at 20.degree. C. until LC-MS/MS
analysis.
[0299] Tissue samples: Whisker samples were collected in some
animals at 30 hrs after dosing by hemostats and 10-20
whiskers/animal were placed in a 1.5 mL eppendorf tube that
contains 200 uL of M-Per buffer (Pierce catalog
#78503/78501/78505). The samples were frozen in dry ice/methanol
within 1 hour of plucking.
[0300] It was determined that the mono-amino acid substituted
compounds of Formula I when administered to rats show some
conversion to cycloastragenol and the di-amino acid substituted
compounds may show a minor amount of conversion to monosubstituted
compounds.
[0301] Percentage of bioavailability was calculated.
TABLE-US-00011 TABLE 4 Study and Bioavailability in Rats Dose Test
Level Dosing Bioavailability compound (mg/kg) Vehicle route % F 2
10 2% EtOH/98% water PO 22.6 4 10 2% EtOH/98% water PO 36 7 10 2%
EtOH/98% water PO 44 12 10 2% EtOH/98% water PO 27 14 10 5%
PEG400/5% solutol PO 93 HS-15/90% water 20a, 20b 10 2% EtOH/98%
water PO 0.68
Biological Example 5: Administration of Compounds to Male Beagle
Dogs and Analysis of Plasma Levels and Telomerase Activity in
Tissues
[0302] The plasma level of a compound following a single
intravenous and oral administration in male Beagle dogs was
determined. Plasma samples were collected and used to determine the
plasma concentration of the compound and metabolites. In addition
tissue samples, including whisker samples and PBMC cells were
collected for telomerase activity analysis.
[0303] Male Beagle dogs were divided into treatment groups
according to Table 5. The dogs were provided ad libitum SLAC-MO1
#080701 (Shanghai Laboratories Animal Center, Shanghai, China)
throughout the in-life portion of the study with the exception of
the overnight fasting period prior to oral dosing. Water was
available ad libitum.
[0304] Environmental controls for the animal room were set to
maintain a temperature of 23.+-.2.degree. C., humidity of 50-70%,
and a 12-hour light/12-hour dark cycle. The 12-hour dark cycle may
be temporarily interrupted to accommodate study procedures. Animals
were acclimated to study procedures for 1-7 days prior to initial
dose administration.
[0305] Animals used in this study were selected based on body
weights that fall within .+-.20% of the mean body weight, overall
health and acclimation to caging. Animals were given free access to
both food and water during the whole course of study with the
exception of the overnight fasting period prior to oral dosing.
[0306] The compounds were dissolved in 2% EtOH/98% water or a
solution of 5% PEG400, 5% solutol HS-15 (BASF, TX) 90% water to
yield a final concentration of 2.5 mg/ml and 1 mg/ml for both
intravenous and oral administration, respectively. The
concentration of each compound was confirmed by HPLC analysis.
[0307] Doses were administered intravenously via the left femoral
vein and then by oral dosing one week later. Body weights were
taken on the day of dose administration. Dose volume was determined
based on individual body weight taken on day of dosing.
[0308] Blood samples (approximately 250 .mu.L) were collected via
right femoral vein into tubes containing K.sub.2-EDTA anticoagulant
and 1 mg/ml NaF at appropriate time points. Blood was stored on ice
and then plasma separated via centrifugation (8000 rpm.times.6
minutes). The plasma was stored at 20.degree. C. until LC-MS/MS
analysis.
[0309] Percentage of bioavailability was calculated and is shown in
Table 5.
TABLE-US-00012 TABLE 5 Study and Bioavailability in Dogs Dose Test
Level Dosing Bioavailability compound (mg/kg) Vehicle route % F 2
10 2% EtOH/98% water PO 3 4 10 2% EtOH/98% water PO 47 14 10 5%
PEG400/5% solutol PO 55 HS-15/90% water
Biological Example 6: Upregulation of Bone Marrow Hematopoietic
Stem/Progenitor Cell Telomerase and Cell Proliferation
[0310] Human bone marrow-derived CD34+ hematopoietic progenitor
cells were obtained from a 47 year old healthy donor.
i) Telomerase Activation by Compound 4 in Short-Term Liquid Human
Cell Culture
[0311] Human bone marrow-derived CD34+ hematopoietic progenitor
cells were grown in Iscove's Modified Dulbecco's Medium (IMDM)
(Invitrogen, CA)+10% fetal bovine serum (FBS) for 3 days in the
presence of compound 4 (1 uM, 100 nM, 10 nM), vehicle (1% DMSO), or
nothing. Telomerase activity increased by .about.60-70% in the 100
nM compound 4 sample relative to the vehicle control (as assessed
by traditional gel-TRAP assay).
TABLE-US-00013 TABLE 6 Telomerase activity of huCD34+ cells: (Fold
of Vehicle Control) Telomerase activity increase 1 uM compound 4
1.3-fold 100 nM compound 4 1.8-fold 10 nM compound 4 1.4-fold
ii) Increase in Number of Colony Forming Units in Compound
4-Treated Human Cell Cultures (14 Days of Treatment)
[0312] Human hematopoietic progenitor CD34+ cells (47 year old
healthy donor) were plated into a standard colony formation assay
in the presence of compound 4 (100 nM), vehicle (0.1% DMSO), or
nothing. After 14 days, hematopoietic colonies were enumerated
(CFU-E, BFU-E, CFU-GM, and CFU-GEMM). The plates containing
compound 4 had 17% more colony forming units than vehicle alone.
(Total colony counts were: untreated, 106.5; vehicle-treated,
103.5; compound 4-treated, 121.5)
TABLE-US-00014 TABLE 7 Colony formation of huCD34+ cells: CFU-E
BFU-E CFU-GM CFU-GEMM Total 0.1% DMSO 5.5 16 79.5 2.5 103.5 vehicle
100 nM 11 25.5 80 5 121.5 compound 4
[0313] Mouse bone marrow-derived lineage-depleted cells (enriched
for hematopoietic stem and progenitor cells but not a pure
population) were obtained.
i) Increase in Number of Colony Forming Units in Compound 4-Treated
Mouse Bone Marrow Derived Cell Cultures from Normal Wild-Type Mice
HSC (12 Days of Treatment)
[0314] Wild-type mouse lineage-depleted bone marrow cells from two
separate mice were plated into a standard colony formation assay in
the presence of compound 4 (100 nM and 500 nM), vehicle (0.1%
DMSO), or nothing. After 12 days, hematopoietic colonies were
enumerated (BFU-E, CFU-GM, and CFU-GEMM).
[0315] In Mouse 1, total colony counts were: untreated, 136;
vehicle-treated, 122; 100 nM compound 4, 161; 500 nM compound 4,
162.
[0316] In Mouse 2, total colony counts were: untreated, 107;
vehicle-treated, 117; 100 nM compound 4, 121; 500 nM compound 4,
129.
TABLE-US-00015 TABLE 8 Colony formation of mouse cells: CFU- CFU-
BFU-E GM GEMM Total Mouse 1 0.1% DMSO 41 80 1 122 vehicle Mouse 1
100 nM 50 111 0 161 compound 4 Mouse 1 500 nM 38 124 1 162 compound
4 Mouse 2 0.1% DMSO 26 89 2 117 vehicle Mouse 2 100 nM 31 90 1 121
compound 4 Mouse 2 500 nM 29 98 2 129 compound 4
[0317] An increase in total colony counts was observed with
administration of compound 4.
ii) Telomerase Activation by Compound 4 in Short-Term Liquid
Culture in Mouse Bone Marrow-Derived Lineage-Depleted Cells from
mTERT Heterozygous Mice and Wild-Type Control (from the Same
Parents)
[0318] Lineage-depleted bone marrow cells from mTERT heterozygous
and wild type mice were grown in IMDM+15% FBS containing stem cell
factor (Kit1), IL-3, and IL-11 for three days in the presence of
compound 4 (1 uM, 100 nM, or 10 nM), vehicle (0.1% DMSO), or
nothing. Telomerase activity in the wild-type cells increased by
40-50% when treated with 100 nM and 1 uM compound 4, relative to
the vehicle-treated control.
[0319] Telomerase activity in the mTERT heterozygous cells
increased by 50% when treated with 1 uM compound 4, relative to the
vehicle-treated control.
iii) Increase in Number of Colony-Forming Units in Compound
4-Treated Cultures of mTERT Heterozygous Mouse Cells (12 Days of
Treatment).
[0320] mTERT heterozygous mouse lineage-depleted bone marrow cells
were plated into a standard colony formation assay in the presence
of compound 4 (100 nM and 500 nM), vehicle (0.1% DMSO), or nothing.
After 12 days, hematopoietic colonies were enumerated (BFU-E,
CFU-GM, and CFU-GEMM). Total colony counts were: untreated: 67;
vehicle-treated: 64; 100 nM compound 4: 68; and 500 nM compound 4:
77.
TABLE-US-00016 TABLE 9 Compound 4 promotes colony-forming units in
Lineage-depleted bone marrow cells from mTERT +/- mice BFU-E CFU-E
CFU-GEMM Total 0.1% DMSO 26 37 1 64 100 nM 22 43 3 68 compound 4
500 nM 27 48 1 77 compound 4
Biological Example 7: Effect of Compound 4 Administration to BALB/c
Mice on Telomerase Activity and Capillary Density in Matrigel Plugs
and Telomerase Activity in Bone Marrow Stem/Progenitor Cells
[0321] BALB/c mice (2-3 months) were dosed with compound 4 in 2%
ethanol at 10 mg/kg/day PO (BID). Mice were pre-dosed for 1 day
(Day-1). Matrigel.TM. (BDBiosciences, California) was injected
subcutaneously in the abdomen on Day 0, and the Matrigel.TM. plugs
were harvested on Day 12.
[0322] One half of the plug was analyzed for telomerase activity
(RBC cell buffer extraction, followed by M-PER extraction) using
the TRAP assay. A 1.9-fold increase (p<0.2) n=5/group in
telomerase activity was observed in the Matrigel.TM. plug after
treatment with compound 4.
[0323] Total RNA, which reflects cell number, was increased
1.6-fold (p<0.2) n=5/group in Matrigel.TM. plugs after treatment
with compound 4.
[0324] The other half of the Matrigel.TM. plug was used for
histology and CD31 immunostaining to analyze capillary density
(CD31 is a marker for endothelial cells, which line the
capillaries). A 1.3-fold increase in capillary density in (CD-31
immuno staining) (p<0.5) n=5/group was observed after treatment
with compound 4.
ii) Bone Marrow Cells Harvested
[0325] Bone marrow stem and progenitor cells were purified from the
treated mice using lineage depletion magnetic sorting technology
(Miltenyi MACS columns). A 1.3 to 1.5-fold increase in telomerase
activity as determined by the TRAP assay was observed in bone
marrow stem and progenitor cells (p<0.1) n=3/group which had
been treated with compound 4 as compared to the control.
Biological Example 8: Effect of Compound 4 Administration to
C57BL/6 Aging TERT (+/-) Mice on Telomerase Activity and Capillary
Density in Matrigel.TM. Plugs and Telomerase Activity and Number of
Bone Marrow Stem/Progenitor Cells
[0326] Aging Tert (+/-) mice on a C57BL/6 background (8-9 months)
were dosed with compound 4 at 10 mg/kg/day PO (BID) in 2% ethanol.
Mice were pre-dosed for 1 day (Day-1). Matrigel.TM. was injected
subcutaneously in the abdomen on Day 0, and plugs were harvested on
Day 12.
[0327] One half of the plug was analyzed for telomerase activity
and hemoglobin content, which is indicative of blood vessel
formation (RBC cell buffer extraction, followed by M-PER
extraction). The other half of the plug was processed for
histology.
[0328] The Matrigel.TM. plug had a 1.8-fold increase (p<0.02) or
a 2.6-fold increase (p<0.01), in telomerase activity as
determined by 2 repeat TRAP experiments. n=15/group for mice
treated with compound 4.
[0329] The Matrigel.TM. plug had a 1.2-fold increase in hemoglobin
levels (p<0.2) n=15/group for mice treated with compound 4.
[0330] Total RNA, which reflects cell number, was increased
1.5-fold (p<0.1) n=15/group in Matrigel.TM. plugs after
treatment with compound 4.
[0331] Bone marrow stem and progenitor cells were purified using
lineage depletion magnetic sorting technology (Miltenyi MACS
columns). The bone marrow showed a 1.3-fold increase (p<0.18) or
a 1.9-fold increase (p<0.03) in telomerase activity as
determined by 2 repeat TRAP experiments. n=6/group in the mice
treated with compound 4.
[0332] The number of purified bone marrow stem/progenitor cells
increased 1.5-fold (p<0.1) n=6/group in mice treated with
compound 4.
Biological Example 9: Effect of Compound 4 and Compound 7
Administration on Human Brain Pericytes
[0333] Human brain pericytes (27 year old female donor) at PD 10
were cultured for a total of 30 hr in 0.5 .mu.M compound 7
dissolved in water. Telomerase activity and tube formation were
analyzed.
[0334] Brain pericytes were first cultured for 24 hr in a T-75
flask in 0.5 .mu.M compound 7, and then split onto a 24 well plate
coated with Matrigel in order to promote tube formation (done in
triplicate). 0.5 .mu.M compound 7 was again included in the medium.
After 6 hr the samples were fixed and branch points were counted
using a microscope, 5 fields/well, with 3 wells/condition. Compound
7 treated pericytes had 1.9 times more branch points than the
control (p<0.15).
[0335] Cells were prepared and treated like above, but the 24 well
plate was not coated with Matrigel. After 6 hr the cells were
harvested for TRAP analysis (M-PER extract). A 2.8-fold increase in
telomerase activity was observed in compound 7 treated
pericytes.
[0336] Human brain pericytes (27 year old female donor) at PD 10
were plated and treated with 0.1 and 0.5 .mu.M compound 4 in 0.1%
DMSO 24 hr after seeding. Cells were incubated with drug for 30 hr
and harvested for TRAP analysis (M-PER extract). A 1.8 and 1.9-fold
increase in telomerase activity was observed with treatment of 0.1
and 0.5 uM, compound 4 respectively. Duplicate samples were
tested.
Biological Example 10: Effect of Compounds 4 and 12 Administration
on Human Small Airway Epithelial Cells
[0337] Human small airway epithelial cells (SAECs) and airway
derived fibroblasts (including the fetal lung fibroblast cell line
IMR-90) were used for in vitro experiments to test the effect of
compounds on telomerase activity.
[0338] SAECs and airway derived fibroblast cell line IMR-90 were
seeded in 24 well plates. They were treated with 1 .mu.M or 0.1
.mu.M of compound 12 for 48 hours in a final concentration of 0.2%
ethanol in the medium. The cells were washed with PBS and lysed
with M-Per lysis buffer. Gel TRAP assay was performed to evaluated
telomerase activity. It was found the compound 12 selectively
up-regulated telomerase activity 2-4 fold in the epithelium derived
cells (SAEC) but not in the fibroblast derived cell IMR-90.
Replicate experiments confirmed these findings. In similar studies
Compound 4 had similar properties and potency to compound 12.
[0339] SAECs were treated continuously with 0.1 .mu.M of compound 4
in a final concentration of 0.004% ethanol for 60 days in
continuous culture. Compound 4 increased the long-term replicative
capacity of SAECs by about 2 population doublings (4.times.
increase in calculated cell number). No effect was seem in lung
fibroblasts in the long-term culture with compound 4.
[0340] Human SAECs or human fibroblasts were grown in the presence
of different concentrations of compound 4 in a final concentration
of 1% DMSO in the medium. After 3 days the cells were harvested and
proliferation was measured using the Alamar Blue Proliferation
Assay. The SAECs showed increased proliferation by about 50% in
short term culture experiments. No effect was seen with compound 4
treatment in lung fibroblasts on short-term proliferation. The
senescence markers p16 and p21 were significantly reduced in SAECs
that were treated with compound 4 for only 3 days, and the
reduction of these markers in fibroblasts was very small.
[0341] SAECs were seeded in a 24 well plate and treated with
compound 12 at 1 .mu.M and 0.1 .mu.M in a final concentration of
0.2% ethanol in the medium. After 24 hours, media was changed and
cells were again treated with compound 12. In addition a portion of
the cells were treated with bleomycin (10 ug/ml) and TGF.beta. (10
ng/ml). Forty-eight hours after the second treatment, cells were
washed and lysed with M-Per lysis buffer. A gel TRAP assay was run
to evaluate the telomerase activity in the cells. In an in vitro
model of fibrosis using TGF.beta. and bleomycin treated SAECs,
myofibroblast/fibrosis biomarker alpha-smooth muscle actin (aSMA)
increased and the epithelial biomarker E-cadherin (E-CAD)
expression decreased. Both TGF.beta. and bleomycin suppressed SAEC
telomerase activity and addition of compound 4 partially restored
or protected telomerase activity against effects of these compounds
in culture.
[0342] Although the invention has been described with respect to
particular embodiments and applications, those skilled in the art
will appreciate the range of applications and method of the
invention disclosed herein.
Sequence CWU 1
1
4118DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1aatccgtcga gcagagtt 18230DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2gcgcggctta cccttaccct taccctaacc 30336DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 3aatccgtcga gcagagttaa aaggccgaga agcgat
36418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4atcgcttctc ggcctttt 18
* * * * *