U.S. patent application number 15/935759 was filed with the patent office on 2018-10-04 for methods of treating liver disease.
The applicant listed for this patent is Gilead Sciences, Inc.. Invention is credited to Jamie Geier Bates, David Gordon Clarkson Breckenridge, John T. Liles.
Application Number | 20180280394 15/935759 |
Document ID | / |
Family ID | 61972244 |
Filed Date | 2018-10-04 |
United States Patent
Application |
20180280394 |
Kind Code |
A1 |
Bates; Jamie Geier ; et
al. |
October 4, 2018 |
METHODS OF TREATING LIVER DISEASE
Abstract
The present disclosure relates to a method of preventing and/or
treating liver disease comprising administering an ACC inhibitor in
combination with an FXR agonist to a patient in need thereof.
Inventors: |
Bates; Jamie Geier;
(Burlingame, CA) ; Breckenridge; David Gordon
Clarkson; (San Mateo, CA) ; Liles; John T.;
(San Jose, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Gilead Sciences, Inc. |
Foster City |
CA |
US |
|
|
Family ID: |
61972244 |
Appl. No.: |
15/935759 |
Filed: |
March 26, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62586354 |
Nov 15, 2017 |
|
|
|
62482105 |
Apr 5, 2017 |
|
|
|
62477697 |
Mar 28, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 31/4439 20130101;
A61K 31/519 20130101; A61P 1/16 20180101; A61K 31/519 20130101;
A61K 2300/00 20130101; A61K 31/4439 20130101; A61K 2300/00
20130101 |
International
Class: |
A61K 31/519 20060101
A61K031/519; A61P 1/16 20060101 A61P001/16; A61K 31/4439 20060101
A61K031/4439 |
Claims
1. A method of treating and/or preventing a liver disease in a
patient in need thereof, comprising administering to the patient a
therapeutically effective amount of an ACC inhibitor in combination
with a therapeutically effective amount of an FXR agonist, wherein
the ACC inhibitor is a compound of Formula (I): ##STR00005## or a
pharmaceutically acceptable salt thereof; and the FXR agonist is a
compound of Formula (III): ##STR00006## or a pharmaceutically
acceptable salt thereof.
2. A method of treating and/or preventing a liver disease in a
patient in need thereof, comprising administering to the patient a
therapeutically effective amount of an ACC inhibitor in combination
with a therapeutically effective amount of an FXR agonist, wherein
the ACC inhibitor is a compound of Formula (I): ##STR00007## or a
pharmaceutically acceptable salt thereof; and the FXR agonist is a
compound of Formula (IV): ##STR00008## or a pharmaceutically
acceptable salt thereof.
3. A method of treating and/or preventing a liver disease in a
patient in need thereof, comprising administering to the patient a
therapeutically effective amount of an ACC inhibitor in combination
with a therapeutically effective amount of an FXR agonist, wherein
the ACC inhibitor is a compound of Formula (II): ##STR00009## or a
pharmaceutically acceptable salt thereof; and the FXR agonist is a
compound of Formula (III): ##STR00010## or a pharmaceutically
acceptable salt thereof.
4. A method of treating and/or preventing a liver disease in a
patient in need thereof, comprising administering to the patient a
therapeutically effective amount of an ACC inhibitor in combination
with a therapeutically effective amount of an FXR agonist, wherein
the ACC inhibitor is a compound of Formula (II): ##STR00011## or a
pharmaceutically acceptable salt thereof; and the FXR agonist is a
compound of Formula (IV): ##STR00012## or a pharmaceutically
acceptable salt thereof.
5. The method of claim 1, wherein the liver disease is
non-alcoholic steatohepatitis (NASH).
6. The method of claim 2, wherein the liver disease is
non-alcoholic steatohepatitis (NASH).
7. The method of claim 3, wherein the liver disease is
non-alcoholic steatohepatitis (NASH).
8. A pharmaceutical composition comprising a therapeutically
effective amount of an ACC inhibitor, a therapeutically effective
amount of an FXR agonist, and a pharmaceutically acceptable
carrier; wherein the ACC inhibitor is a compound of Formula (I):
##STR00013## or a pharmaceutically acceptable salt thereof; and the
FXR agonist is a compound of Formula (III): ##STR00014## or a
pharmaceutically acceptable salt thereof.
9. A pharmaceutical composition comprising a therapeutically
effective amount of an ACC inhibitor, a therapeutically effective
amount of an FXR agonist, and a pharmaceutically acceptable
carrier; wherein the ACC inhibitor is a compound of Formula (I):
##STR00015## or a pharmaceutically acceptable salt thereof; and the
FXR agonist is a compound of Formula (IV): ##STR00016## or a
pharmaceutically acceptable salt thereof.
10. A pharmaceutical composition comprising a therapeutically
effective amount of an ACC inhibitor, a therapeutically effective
amount of an FXR agonist, and a pharmaceutically acceptable
carrier; wherein the ACC inhibitor is a compound of Formula (II):
##STR00017## or a pharmaceutically acceptable salt thereof; and the
FXR agonist is a compound of Formula (III): ##STR00018## or a
pharmaceutically acceptable salt thereof.
11. A pharmaceutical composition comprising a therapeutically
effective amount of an ACC inhibitor, a therapeutically effective
amount of an FXR agonist, and a pharmaceutically acceptable
carrier; wherein the ACC inhibitor is a compound of Formula (II):
##STR00019## or a pharmaceutically acceptable salt thereof; and the
FXR agonist is a compound of Formula (IV): ##STR00020## or a
pharmaceutically acceptable salt thereof.
12. The pharmaceutical composition of claim 8, further comprising a
pharmaceutically acceptable carrier.
13. The pharmaceutical composition of claim 9, further comprising a
pharmaceutically acceptable carrier.
14. The pharmaceutical composition of claim 10, further comprising
a pharmaceutically acceptable carrier.
15. The pharmaceutical composition of claim 11, further comprising
a pharmaceutically acceptable carrier.
16. The method of claim 4, wherein the liver disease is
non-alcoholic steatohepatitis (NASH).
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of: U.S. Provisional
Application Ser. No. 62/477,697, filed Mar. 28, 2017; U.S.
Provisional Application Ser. No. 62/482,105, filed Apr. 5, 2017;
and, U.S. Provisional Application Ser. No. 62/586,354, filed Nov.
15, 2017. The entireties of these applications are incorporated
herein by reference.
SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy, and is hereby
incorporated by reference into the specification. The name of the
text file containing the Sequence Listing is
1212P3C_2018-03-26_Seq_Listing_ST25.txt. The text file created on
Mar. 26, 2018, is 2.32 KB in size and submitted electronically via
EFS-Web.
FIELD
[0003] The present disclosure relates to methods of preventing
and/or treating liver diseases.
BACKGROUND
[0004] Liver disease is generally classified as acute or chronic
based upon the duration of the disease. Liver disease may be caused
by infection, injury, exposure to drugs or toxic compounds,
alcohol, impurities in foods, and the abnormal build-up of normal
substances in the blood, an autoimmune process, a genetic defect
(such as haemochromatosis), or unknown cause(s).
[0005] Liver disease is a leading cause of death world wide. In
particular, it has been seen that a diet high in fat damages the
liver in ways that are surprisingly similar to hepatitis. The
American Liver Foundation estimates that more than 20 percent of
the population has non-alcoholic fatty liver disease (NAFLD). It is
suggested that obesity, unhealthy diets, and sedentary lifestyles
may contribute to the high prevalence of NAFLD. When left
untreated, NAFLD can progess to non-alcoholic steatohepatitis
(NASH) causing serious adverse effects. Once NASH develops, it
causes the liver to swell and scar (i.e. cirrhosis) over time.
[0006] Although preliminary reports suggest positive lifestyle
changes could prevent or reverse liver damage, there are no
effective medical treatments for NAFLD or NASH. Accordingly, there
remains a need to provide new effective pharmaceutical agents to
treat liver diseases.
SUMMARY
[0007] Disclosed herein are methods of treating and/or preventing
liver disease in a patient in need thereof, comprising
administering to the patient a therapeutically effective amount of
an acetyl-CoA carboxylase (ACC) inhibitor in combination with a
therapeutically effective amount of farnesoid X receptor (FXR)
agonist. The liver disease can be any liver disease, including, but
not limited to, chronic and/or metabolic liver diseases,
nonalcoholic fatty liver disease (NAFLD), and nonalcoholic
steatohepatitis (NASH).
[0008] In certain embodiments, provided herein is a method of
treating and/or preventing nonalcoholic steatohepatitis (NASH) in a
patient in need thereof, comprising administering to the patient a
therapeutically effective amount of an ACC inhibitor in combination
with a therapeutically effective amount of a FXR agonist.
[0009] In the methods provided herein, the ACC inhibitor and the
FXR agonist can be coadministered. In such embodiments, the ACC
inhibitor and the FXR agonist can be administered together as a
single pharmaceutical composition, or separately in more than one
pharmaceutical composition. Accordingly, also provided herein is a
pharmaceutical composition comprising a therapeutically effective
amount of an ACC inhibitor and a therapeutically effective amount
of a FXR agonist.
DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1. Liver triglycerides in umol/g in the murine FFD
model. (*p<0.05; **p<0.01; ***p<0.001;****p<0.0001
significantly different from vehicle by ANOVA). Graph shows
mean.+-.SEM.
[0011] FIG. 2. ALT IU/L in the murine FFD model. (*** p<0.001;
significantly different from vehicle by ANOVA). Graph shows
mean.+-.SEM.
[0012] FIG. 3. Hepatic expression of liver fibrosis gene Col1a1
measured by quantitative RT-PCR in the murine FFD model.
(**p<0.01; ****p<0.0001 significantly different from vehicle
by ANOVA; # significantly different from either single agent by
t-test). Graph shows mean.+-.SEM.
[0013] FIG. 4. Hepatic expression of liver fibrosis gene Timp1
measured by quantitative RT-PCR in the murine FFD model.
(*p<0.05; ****p<0.0001 significantly different from vehicle
by ANOVA; # significantly different from either single agent by
t-test). Graph shows mean.+-.SEM.
[0014] FIG. 5. Percent PSR positive area by quantitative image
analysis in the rat CDHFD model. (**p<0.01, ***p<0.001,
****p<0.0001 significantly different from vehicle by t-test;
& p<0.001 significantly different from start of treatment by
t-test). Graph shows mean.+-.SEM.
[0015] FIG. 6. Percent .alpha.-SMA positive area by quantitative
image analysis in the rat CDHFD model. (**p<0.01 significantly
different from vehicle by t-test; & p<0.001 significantly
different from start of treatment by t-test; # p<0.05
significantly different from either single agent by t-test). Graph
shows mean.+-.SEM.
[0016] FIG. 7. Timp1 protein measured in plasma by ELISA in the rat
CDHFD model. (*p<0.05 significantly different from vehicle by
t-test; & p<0.001 significantly different from start of
treatment by t-test). Graph shows mean.+-.SEM.
[0017] FIG. 8. Hyaluronic acid (HA) measured in plasma by ELISA in
the rat CDHFD model. **p<0.01, ***p<0.001, ****p<0.0001
significantly different from vehicle by t-test). Graph shows
mean.+-.SEM.
[0018] FIG. 9. N-terminal propeptide of Type III Collagen (PIIINP)
measured in plasma by ELISA in the rat CDHFD model.
(*p<0.05,**p<0.01, ****p<0.0001 significantly different
from vehicle by t-test; & p<0.001 significantly different
from start of treatment by t-test; # p<0.05 significantly
different from either single agent by t-test). Graph shows
mean.+-.SEM.
DETAILED DESCRIPTION
Definitions and General Parameters
[0019] As used in the present specification, the following terms
and phrases are generally intended to have the meanings as set
forth below, except to the extent that the context in which they
are used indicates otherwise.
[0020] As used herein, the term "about" used in the context of
quantitative measurements means the indicated amount .+-.10%, or
alternatively the indicated amount .+-.5% or .+-.1%.
[0021] The term "pharmaceutically acceptable salt" refers to a salt
of a compound disclosed herein that retains the biological
effectiveness and properties of the underlying compound, and which
is not biologically or otherwise undesirable. There are acid
addition salts and base addition salts. Pharmaceutically acceptable
acid addition salts may be prepared from inorganic and organic
acids.
[0022] Acids and bases useful for reaction with an underlying
compound to form pharmaceutically acceptable salts (acid addition
or base addition salts respectively) are known to one of skill in
the art. Similarly, methods of preparing pharmaceutically
acceptable salts from an underlying compound (upon disclosure) are
known to one of skill in the art and are disclosed in for example,
Berge, at al. Journal of Pharmaceutical Science, January 1977 vol.
66, No. 1, and other sources.
[0023] As used herein, "pharmaceutically acceptable carrier"
includes excipients or agents such as solvents, diluents,
dispersion media, coatings, antibacterial and antifungal agents,
isotonic and absorption delaying agents and the like that are not
deleterious to the disclosed compound or use thereof. The use of
such carriers and agents to prepare compositions of
pharmaceutically active substances is well known in the art (see,
e.g., Remington's Pharmaceutical Sciences, Mace Publishing Co.,
Philadelphia, Pa. 17th Ed. (1985); and Modern Pharmaceutics, Marcel
Dekker, Inc. 3rd Ed. (G. S. Banker & C. T. Rhodes, Eds.).
[0024] The terms "therapeutically effective amount" and "effective
amount" are used interchangibly and refer to an amount of a
compound that is sufficient to effect treatment as defined below,
when administered to a patient (e.g., a human) in need of such
treatment in one or more doses. The therapeutically effective
amount will vary depending upon the patient, the disease being
treated, the weight and/or age of the patient, the severity of the
disease, or the manner of administration as determined by a
qualified prescriber or care giver.
[0025] The term "treatment" or "treating" means administering a
compound or pharmaceutically acceptable salt thereof for the
purpose of: (i) delaying the onset of a disease, that is, causing
the clinical symptoms of the disease not to develop or delaying the
development thereof; (ii) inhibiting the disease, that is,
arresting the development of clinical symptoms; and/or (iii)
relieving the disease, that is, causing the regression of clinical
symptoms or the severity thereof.
Liver Diseases
[0026] Liver diseases are acute or chronic damages to the liver
based on the duration of the disease. The liver damage may be
caused by infection, injury, exposure to drugs or toxic compounds
such as alcohol or impurities in foods, an abnormal build-up of
normal substances in the blood, an autoimmune process, a genetic
defect (such as haemochromatosis), or other unknown causes.
Exemplary liver diseases include, but are not limited to,
cirrhosis, liver fibrosis, non-alcoholic fatty liver disease
(NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic
steatohepatitis (ASH), hepatic ischemia reperfusion injury, primary
biliary cirrhosis (PBC), primary sclerosing cholangitis (PSC), and
hepatitis, including both viral and alcoholic hepatitis.
[0027] Non-alcoholic fatty liver disease (NAFLD) is the build up of
extra fat in liver cells that is not caused by alcohol. NAFLD may
cause the liver to swell (i.e. steatohepatitis), which in turn may
cause scarring (i.e. cirrhosis) over time and may lead to liver
cancer or liver failure. NAFLD is characterized by the accumulation
of fat in hepatocyes and is often associated with some aspects of
metabolic syndrome (e.g. type 2 diabetes mellitus, insulin
resistance, hyperlipidemia, hypertension). The frequency of this
disease has become increasingly common due to consumption of
carbohydrate-rich and high fat diets. A subset (.about.20%) of
NAFLD patients develop nonalcoholic steatohepatitis (NASH).
[0028] NASH, a subtype of fatty liver disease, is the more severe
form of NAFLD. It is characterized by macrovesicular steatosis,
balloon degeneration of hepatocytes, and/or inflammation ultimately
leading to hepatic scarring (i.e. fibrosis). Patients diagnosed
with NASH progress to advanced stage liver fibrosis and eventually
cirrhosis. The current treatment for cirrhotic NASH patients with
end-stage disease is liver transplant.
[0029] Another common liver disease is primary sclerosing
cholangitis (PSC). It is a chronic or long-term liver disease that
slowly damages the bile ducts inside and outside the liver. In
patients with PSC, bile accumulates in the liver due to blocked
bile ducts, where it gradually damages liver cells and causes
cirrhosis, or scarring of the liver. Currently, there is no
effective treatment to cure PSC. Many patients having PSC
ultimately need a liver transplant due to liver failure, typically
about 10 years after being diagnosed with the disease. PSC may also
lead to bile duct cancer.
[0030] Liver fibrosis is the excessive accumulation of
extracellular matrix proteins, including collagen, that occurs in
most types of chronic liver diseases. Advanced liver fibrosis
results in cirrhosis, liver failure, and portal hypertension and
often requires liver transplantation.
Methods
[0031] Disclosed herein is a method of treating and/or preventing
liver disease in a patient in need thereof, comprising
administering to the patient a therapeutically effective amount of
an ACC inhibitor in combination with a therapeutically effective
amount of a FXR agonist. The presence of active liver disease can
be detected by the existence of elevated enzyme levels in the
blood. Specifically, blood levels of alanine aminotransferase (ALT)
and aspartate aminotransferase (AST) above clinically accepted
normal ranges are known to be indicative of on-going liver damage.
Routine monitoring of liver disease patients for blood levels of
ALT and AST is used clinically to measure progress of the liver
disease while on medical treatment. Reduction of elevated ALT and
AST to within the accepted normal range is taken as clinical
evidence reflecting a reduction in the severity of the patient's
on-going liver damage.
[0032] In certain embodiments, the liver disease is a chronic liver
disease. Chronic liver diseases involve the progressive destruction
and regeneration of the liver parenchyma, leading to fibrosis and
cirrhosis. In general, chronic liver diseases can be caused by
viruses (such as hepatitis B, hepatitis C, cytomegalovirus (CMV),
or Epstein Barr Virus (EBV)), toxic agents or drugs (such as
alcohol, methotrexate, or nitrofurantoin), a metabolic disease
(such as non-alcoholic fatty liver disease (NAFLD), non-alcoholic
steatohepatitis (NASH), haemochromatosis, or Wilson's Disease), an
autoimmune disease (such as Autoimmune Chronic Hepatitis, Primary
Biliary Cholangitis (formerly known as Primary Biliary Cirrhosis),
or Primary Sclerosing Cholangitis, or other causes (such as right
heart failure).
[0033] In one embodiment, provided herein is a method for reducing
the level of cirrhosis. In one embodiment, cirrhosis is
characterized pathologically by loss of the normal microscopic
lobular architecture, with fibrosis and nodular regeneration.
Methods for measuring the extent of cirrhosis are well known in the
art. In one embodiment, the level of cirrhosis is reduced by about
5% to about 100%. In one embodiment, the level of cirrhosis is
reduced by at least about 5%, at least about 10%, at least about
15%, at least about 20%, at least about 25%, at least about 30%, at
least about 35%, at least about 40%, at least about 45%, at least
50%, at least about 55%, at least about 60%, at least about 65%, at
least about 70%, at least about 75%, at least about 80%, at least
about 85%, at least about 90%, or at least about 95% in the
subject.
[0034] In certain embodiments, the liver disease is a metabolic
liver disease. In one embodiment, the liver disease is
non-alcoholic fatty liver disease (NAFLD). NAFLD is associated with
insulin resistance and metabolic syndrome (obesity, combined
hyperlipidemia, diabetes mellitus (type II) and high blood
pressure). NAFLD is considered to cover a spectrum of disease
activity, and begins as fatty accumulation in the liver (hepatic
steatosis).
[0035] It has been shown that both obesity and insulin resistance
probably play a strong role in the disease process of NAFLD. In
addition to a poor diet, NAFLD has several other known causes. For
example, NAFLD can be caused by certain medications, such as
amiodarone, antiviral drugs (e.g., nucleoside analogues), aspirin
(rarely as part of Reye's syndrome in children), corticosteroids,
methotrexate, tamoxifen, or tetracycline. NAFLD has also been
linked to the consumption of soft drinks through the presence of
high fructose corn syrup which may cause increased deposition of
fat in the abdomen, although the consumption of sucrose shows a
similar effect (likely due to its breakdown into fructose).
Genetics has also been known to play a role, as two genetic
mutations for this susceptibility have been identified.
[0036] If left untreated, NAFLD can develop into non-alcoholic
steatohepatitis (NASH), which is the most extreme form of NAFLD, a
state in which steatosis is combined with inflammation and
fibrosis. NASH is regarded as a major cause of cirrhosis of the
liver. Accordingly, provided herein is a method of treating and/or
preventing nonalcoholic steatohepatitis (NASH) in a patient in need
thereof, comprising administering to the patient a therapeutically
effective amount of an ACC inhibitor in combination with a
therapeutically effective amount of a a FXR agonist.
[0037] Also provided herein is a method of treating and/or
preventing liver fibrosis in a patient in need thereof, comprising
administering to the patient a therapeutically effective amount of
an ACC inhibitor in combination with a therapeutically effective
amount of a FXR agonist. Liver fibrosis is the excessive
accumulation of extracellular matrix proteins including collagen
that occurs in most types of chronic liver diseases. In certain
embodiments, advanced liver fibrosis results in cirrhosis and liver
failure. Methods for measuring liver histologies, such as changes
in the extent of fibrosis, lobular hepatitis, and periportal
bridging necrosis, are well known in the art.
[0038] In one embodiment, the level of liver fibrosis, which is the
formation of fibrous tissue, fibroid or fibrous degeneration, is
reduced by more that about 90%. In one embodiment, the level of
fibrosis, which is the formation of fibrous tissue, fibroid or
fibrous degeneration, is reduced by at least about 90%, at least
about 80%, at least about 70%, at least about 60%, at least about
50%, at least about 40%, at least about 30%, at least about 20%, at
least about 10%, at least about 5% or at least about 2%.
[0039] In one embodiment, the compounds provided herein reduce the
level of fibrogenesis in the liver. Liver fibrogenesis is the
process leading to the deposition of an excess of extracellular
matrix components in the liver known as fibrosis. It is observed in
a number of conditions such as chronic viral hepatitis B and C,
alcoholic liver disease, drug-induced liver disease,
hemochromatosis, auto-immune hepatitis, Wilson disease, Primary
Biliary Cholangitis (formerly known as Primary Biliary Cirrhosis),
sclerosing cholangitis, liver schistosomiasis and others. In one
embodiment, the level of fibrogenesis is reduced by more that about
90%. In one embodiment, the level of fibrogenesis is reduced by at
least about 90%, at least about 80%, at least about 70%, at least
about 60%, at least about 50%, at least 40%, at least about 30%, at
least about 20%, at least about 10%, at least about 5% or at least
2%.
[0040] In still other embodiments, provided herein is a method of
treating and/or preventing primary sclerosing cholangitis (PSC) in
a patient in need thereof, comprising administering to the patient
a therapeutically effective amount of an ACC inhibitor in
combination with a therapeutically effective amount of a FXR
agonist.
[0041] It has been observed that patients having NASH are on
average about 2.8 years older than healthy patients in epigenetic
testing. Thus, in one embodiment, compounds useful for the
treatment of NASH would be useful for slowing, improving or
reversing epigenetic age or effects of aging due to NASH. In
another embodiment, combination therapies for the treatment of NASH
such as, for example, the combination of an ACC inhibitor with an
an FXR agonist as disclosed herein may be useful for improvement or
reversal of aging effects due to NASH.
[0042] In one embodiment, the ACC inhibitor and the FXR agonist may
be administered together in a combination formulation or in
seperate pharmaceutical compositions, where each inhibitor may be
formulated in any suitable dosage form. In certain embodiments, the
methods provided herein comprise administering separately a
pharmaceutical composition comprising an ACC inhibitor and a
pharmaceutically acceptable carrier or excipient and a
pharmaceutical composition comprising a FXR agonist and a
pharmaceutically acceptable carrier or excipient. Combination
formulations according to the present disclosure comprise an ACC
inhibitor and a FXR agonist together with one or more
pharmaceutically acceptable carriers or excipients and optionally
other therapeutic agents. Combination formulations containing the
active ingredient may be in any form suitable for the intended
method of administration.
ACC Inhibitors
[0043] In certain embodiments of the methods and pharmaceutical
compositions disclosed herein, the ACC inhibitor is a compound
having the structure of Formula (I):
##STR00001##
or a pharmaceutically acceptable salt thereof.
[0044] In certain embodiments of the methods and pharmaceutical
compositions disclosed herein, the ACC inhibitor is a compound
having the structure of Formula (II):
##STR00002##
or a pharmaceutically acceptable salt thereof.
[0045] The compounds of Formula (I) and Formula (II) may be
synthesized and characterized using methods known to those of skill
in the art, such as those described in PCT International
Application Publication No. WO 2013/071169. In one embodiment, the
ACC inhibitor is the compound of Formula (I) or a pharmaceutically
acceptable salt thereof. In one embodiment, the ACC inhibitor is
the compound of Formula (II) or a pharmaceutically acceptable salt
thereof.
FXR Agonist
[0046] In certain embodiments of the methods and pharmaceutical
compositions disclosed herein, the FXR agonist is a compound having
the structure of Formula (III):
##STR00003##
or a pharmaceutically acceptable salt thereof.
[0047] In certain embodiments of the methods and pharmaceutical
compositions disclosed herein, the FXR agonist is a compound having
the structure of Formula (IV):
##STR00004##
or a pharmaceutically acceptable salt thereof.
[0048] The compounds of Formula (III) and Formula (IV) may be
synthesized and characterized using methods known to those of skill
in the art, such as those described in U.S. Publication No.
2014/0221659.
Dosing and Administration
[0049] While it is possible for an active ingredient to be
administered alone, it may be preferable to present them as
pharmaceutical formulations or pharmaceutical compositions as
described below. The formulations, both for veterinary and for
human use, of the disclosure comprise at least one of the active
ingredients, together with one or more acceptable carriers therefor
and optionally other therapeutic ingredients. The carrier(s) must
be "acceptable" in the sense of being compatible with the other
ingredients of the formulation and physiologically innocuous to the
recipient thereof.
[0050] Each of the active ingredients can be formulated with
conventional carriers and excipients, which will be selected in
accord with ordinary practice. Tablets can contain excipients,
glidants, fillers, binders and the like. Aqueous formulations are
prepared in sterile form, and when intended for delivery by other
than oral administration generally will be isotonic. All
formulations will optionally contain excipients such as those set
forth in the Handbook of Pharmaceutical Excipients (1986).
Excipients include ascorbic acid and other antioxidants, chelating
agents such as EDTA, carbohydrates such as dextrin,
hydroxyalkylcellulose, hydroxyalkylmethylcellulose, stearic acid
and the like. The pH of the formulations ranges from about 3 to
about 11, but is ordinarily about 7 to 10.
[0051] The therapeutically effective amount of active ingredient
can be readily determined by a skilled clinician using conventional
dose escalation studies. Typically, each active ingredient will be
administered in a dose from 0.01 milligrams to 1 gram. In one
embodiment, the dosage will be from about 10 milligrams to 450
milligrams. In another embodiment, the dosage will be from about 25
to about 250 milligrams. In another embodiment, the dosage will be
about 50 or 100 milligrams. In one embodiment, the dosage will be
about 100 milligrams. In one embodiment, 20 mg of an ACC inhibitor
is administered. In a specific embodiment, 20 mg of a compound of
Formula (II) is administered. In one embodiment, 30 mg of an FXR
agonist is administered. In a specific embodiment, 30 mg of a
compound of Formula (III) is administered. It is contemplated that
the active ingredients may be administered once, twice or three
times a day. Also, the active ingredients may be administered once
or twice a week, once every two weeks, once every three weeks, once
every four weeks, once every five weeks, or once every six
weeks.
[0052] The pharmaceutical composition for the active ingredient can
include those suitable for the foregoing administration routes. The
formulations can conveniently be presented in unit dosage form and
may be prepared by any of the methods well known in the art of
pharmacy. Techniques and formulations generally are found in
Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton,
Pa.). Such methods include the step of bringing into association
the active ingredient with the carrier which constitutes one or
more accessory ingredients. In general the formulations are
prepared by uniformly and intimately bringing into association the
active ingredient with liquid carriers or finely divided solid
carriers or both, and then, if necessary, shaping the product.
[0053] Formulations suitable for oral administration can be
presented as discrete units such as capsules, cachets or tablets
each containing a predetermined amount of the active ingredient; as
a powder or granules; as a solution or a suspension in an aqueous
or non-aqueous liquid; or as an oil-in-water liquid emulsion or a
water-in-oil liquid emulsion. The active ingredient may also be
administered as a bolus, electuary or paste. In certain
embodiments, the active ingredient may be administered as a
subcutaneous injection.
[0054] A tablet can be made by compression or molding, optionally
with one or more accessory ingredients. Compressed tablets can be
prepared by compressing in a suitable machine the active ingredient
in a free-flowing form such as a powder or granules, optionally
mixed with a binder, lubricant, inert diluent, preservative, or
surface active agent. Molded tablets may be made by molding in a
suitable machine a mixture of the powdered active ingredient
moistened with an inert liquid diluent. The tablets may optionally
be coated or scored and optionally are formulated so as to provide
slow or controlled release of the active ingredient therefrom.
[0055] The active ingredient can be administered by any route
appropriate to the condition. Suitable routes include oral, rectal,
nasal, topical (including buccal and sublingual), vaginal and
parenteral (including subcutaneous, intramuscular, intravenous,
intradermal, intrathecal and epidural), and the like. It will be
appreciated that the preferred route may vary with for example the
condition of the recipient. In certain embodiments, the active
ingredients are orally bioavailable and can therefore be dosed
orally. In one embodiment, the patient is human.
[0056] When used in combination in the methods disclosed herein,
the ACC inhibitor and the FXR agonist can be administered together
in a single pharmaceutical composition, e.g. a fixed dose
combination, or seperately (either concurrently or sequentially) in
more than one pharmaceutical composition. In certain embodiments,
the ACC inhibitor and the FXR agonist are administered together. In
other embodiments, the ACC inhibitor and the FXR agonist are
administered separately. In some aspects, the ACC inhibitor is
administered prior to the FXR agonist. In some aspects, the FXR
agonist is administered prior to the ACC inhibitor. When
administered separately, the ACC inhibitor and the FXR agonist can
be administered to the patient by the same or different routes of
delivery.
Pharmaceutical Compositions
[0057] The pharmaceutical compositions of the disclosure comprise
an effective amount of an ACC inhibitor selected from the group
consisting of a compound of Formula (I) and a compound of Formula
(II), or a pharmaceutically acceptable salt thereof, and an
effective amount of a FXR agonist selected from the group
consisting of a compound of Formula (III) and a compound of Formula
(IV), or a pharmaceutically acceptable salt thereof.
[0058] When used for oral use for example, tablets, troches,
lozenges, aqueous or oil suspensions, dispersible powders or
granules, emulsions, hard or soft capsules, syrups or elixirs may
be prepared. Compositions intended for oral use may be prepared
according to any method known to the art for the manufacture of
pharmaceutical compositions and such compositions may contain one
or more agents including sweetening agents, flavoring agents,
coloring agents and preserving agents, in order to provide a
palatable preparation. Tablets containing the active ingredient in
admixture with non-toxic pharmaceutically acceptable excipient
which are suitable for manufacture of tablets are acceptable. These
excipients may be, for example, inert diluents, such as, for
example, calcium or sodium carbonate, lactose, lactose monohydrate,
croscarmellose sodium, povidone, calcium or sodium phosphate;
granulating and disintegrating agents, such as, for example, maize
starch, or alginic acid; binding agents, such as, for example,
cellulose, microcrystalline cellulose, starch, gelatin or acacia;
and lubricating agents, such as, for example, magnesium stearate,
stearic acid or talc. Tablets may be uncoated or may be coated by
known techniques including microencapsulation to delay
disintegration and adsorption in the gastrointestinal tract and
thereby provide a sustained action over a longer period. For
example, a time delay material such as, for example, glyceryl
monostearate or glyceryl distearate alone or with a wax may be
employed.
[0059] Formulations for oral use may be also presented as hard
gelatin capsules where the active ingredient is mixed with an inert
solid diluent, for example calcium phosphate or kaolin, or as soft
gelatin capsules wherein the active ingredient is mixed with water
or an oil medium, such as, for example, peanut oil, liquid paraffin
or olive oil.
[0060] Aqueous suspensions of the disclosure contain the active
materials in admixture with excipients suitable for the manufacture
of aqueous suspensions. Such excipients include a suspending agent,
such as, for example, sodium carboxymethylcellulose,
methylcellulose, hydroxypropyl methylcelluose, sodium alginate,
polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing
or wetting agents such as, for example, a naturally occurring
phosphatide (e.g., lecithin), a condensation product of an alkylene
oxide with a fatty acid (e.g., polyoxyethylene stearate), a
condensation product of ethylene oxide with a long chain aliphatic
alcohol (e.g., heptadecaethyleneoxycetanol), a condensation product
of ethylene oxide with a partial ester derived from a fatty acid
and a hexitol anhydride (e.g., polyoxyethylene sorbitan
monooleate). The aqueous suspension may also contain one or more
preservatives such as, for example, ethyl or n-propyl
p-hydroxy-benzoate, one or more coloring agents, one or more
flavoring agents and one or more sweetening agents, such as, for
example, sucrose or saccharin.
[0061] Oil suspensions may be formulated by suspending the active
ingredient in a vegetable oil, such as, for example, arachis oil,
olive oil, sesame oil or coconut oil, or in a mineral oil such as,
for example, liquid paraffin. The oral suspensions may contain a
thickening agent, such as, for example, beeswax, hard paraffin or
cetyl alcohol. Sweetening agents, such as, for example, those set
forth above, and flavoring agents may be added to provide a
palatable oral preparation. These compositions may be preserved by
the addition of an antioxidant such as, for example, ascorbic
acid.
[0062] Dispersible powders and granules of the disclosure suitable
for preparation of an aqueous suspension by the addition of water
provide the active ingredient in admixture with a dispersing or
wetting agent, a suspending agent, and one or more preservatives.
Suitable dispersing or wetting agents and suspending agents are
exemplified by those disclosed above. Additional excipients, for
example sweetening, flavoring and coloring agents, may also be
present.
[0063] The pharmaceutical compositions of the disclosure may also
be in the form of oil-in-water emulsions. The oily phase may be a
vegetable oil, such as, for example, olive oil or arachis oil, a
mineral oil, such as, for example, liquid paraffin, or a mixture of
these. Suitable emulsifying agents include naturally-occurring
gums, such as, for example, gum acacia and gum tragacanth,
naturally occurring phosphatides, such as, for example, soybean
lecithin, esters or partial esters derived from fatty acids and
hexitol anhydrides, such as, for example, sorbitan monooleate, and
condensation products of these partial esters with ethylene oxide,
such as, for example, polyoxyethylene sorbitan monooleate. The
emulsion may also contain sweetening and flavoring agents. Syrups
and elixirs may be formulated with sweetening agents, such as, for
example, glycerol, sorbitol or sucrose. Such formulations may also
contain a demulcent, a preservative, a flavoring or a coloring
agent.
[0064] The pharmaceutical compositions of the disclosure may be in
the form of a sterile injectable preparation, such as, for example,
a sterile injectable aqueous or oleaginous suspension. This
suspension may be formulated according to the known art using those
suitable dispersing or wetting agents and suspending agents which
have been mentioned above. The sterile injectable preparation may
also be a sterile injectable solution or suspension in a non-toxic
parenterally acceptable diluent or solvent, such as, for example, a
solution in 1,3-butane-diol or prepared as a lyophilized powder.
Among the acceptable vehicles and solvents that may be employed are
water, Ringer's solution and isotonic sodium chloride solution. In
addition, sterile fixed oils may conventionally be employed as a
solvent or suspending medium. For this purpose any bland fixed oil
may be employed including synthetic mono- or diglycerides. In
addition, fatty acids such as, for example, oleic acid may likewise
be used in the preparation of injectables.
[0065] The amount of active ingredient that may be combined with
the carrier material to produce a single dosage form will vary
depending upon the host treated and the particular mode of
administration, such as oral administration or subcutaneous
injection. For example, a time-release formulation intended for
oral administration to humans may contain approximately 1 to 1000
mg of active material compounded with an appropriate and convenient
amount of carrier material which may vary from about 5 to about 95%
of the total compositions (weight:weight). The pharmaceutical
composition can be prepared to provide easily measurable amounts
for administration. For example, an aqueous solution intended for
intravenous infusion may contain from about 3 to 500 .mu.g of the
active ingredient per milliliter of solution in order that infusion
of a suitable volume at a rate of about 30 mL/hr can occur. When
formulated for subcutaneous administration, the formulation is
typically administered about twice a month over a period of from
about two to about four months.
[0066] Formulations suitable for parenteral administration include
aqueous and non-aqueous sterile injection solutions which may
contain anti-oxidants, buffers, bacteriostats and solutes which
render the formulation isotonic with the blood of the intended
recipient; and aqueous and non-aqueous sterile suspensions which
may include suspending agents and thickening agents.
[0067] The formulations can be presented in unit-dose or multi-dose
containers, for example sealed ampoules and vials, and may be
stored in a freeze-dried (lyophilized) condition requiring only the
addition of the sterile liquid carrier, for example water for
injection, immediately prior to use. Extemporaneous injection
solutions and suspensions are prepared from sterile powders,
granules and tablets of the kind previously described. Preferred
unit dosage formulations are those containing a daily dose or unit
daily sub-dose, as herein above recited, or an appropriate fraction
thereof, of the active ingredient.
Examples
Example 1. Efficacy in a Mouse Model of NASH
[0068] The following study was conducted to evaluate the efficacy
of the combination of an ACC inhibitor and an FXR agonist in a
mouse model of non-alcoholic steatohepatitis (NASH), relative to
the efficacy of the individual agents alone in the model. NASH was
induced in male C57BL/6 mice by chronic administration of a "fast
food" diet (FFD) high in saturated fats, cholesterol and sugars for
a total of 6 months, whereas lean control animals were maintained
on a normal chow diet. A NASH phenotype was established in FFD mice
compared to control mice after 6 months, and was characterized by
macrovesicular steatosis, elevated ALT and AST, and increased
levels of transcripts associated with hepatic stellate cell
activation. See Charlton M, et al. Fast food diet mouse: novel
small animal model of NASH with ballooning, progressive fibrosis,
and high physiological fidelity to the human condition. American
Journal of Physiology. Gastrointestinal and Liver Physiology 2011;
301 (5):G825-34.
[0069] After 5 months, FFD mice were subsequently treated with
placebo (vehicle), an ACC inhibitor (Formula (I)), an FXR agonist
(Formula (III)), or with the combination of Formula (I) and Formula
(III) for 1 month. Control mice remained on a normal chow diet for
the entire 6 month study period. Endpoint analyses included
biochemical quantification of liver triglycerides, plasma ALT, and
measurement of the pro-fibrotic transcripts Timp1 and Col1A1 in
liver.
Methods
Animals
[0070] Male C57CL/6 mice (aged 12 weeks at study inception) were
used in this study. All procedures used to study the animals were
in the compliance with the U.S. Department of Agriculture's Animal
Welfare Act (9 CFR Parts 1, 2, and 3); the Guide for the Care and
Use of Laboratory Animals (Institute for Laboratory Animal
Research, The National Academies Press, Washington, D.C.); and the
National Institutes of Health, Office of Laboratory Animal
Welfare.
In-Life Experimental Protocol for the FFD Mouse Model
[0071] The experimental design is shown in Table 1. Study animals
were administered either a standard chow diet (Harlan Teklad Global
Diets 2014, TD2014) or a commercially available high fat, high
cholesterol diet (Research Diets Inc, DB12079B) (the FFD). Animals
receiving the FFD were administered fructose/glucose in drinking
water formulated as follows: 23.1 g fructose (Sigma, F2543) and
17.2 g of glucose (Sigma, 49158) was mixed into 1000 mL of drinking
water.
[0072] The compound of Formula (I) or the compound of Formula (III)
alone, or the combination of the compounds of Formula (I) and
Formula (III), were administered for the final month of the study
(month 5-month 6). The compound of Formula (I) and the compound of
Formula (III) were formulated in 0.5% sodium carboxymethylcellulose
(medium viscosity), 1% w/w ethanol, 98.5% w/w 50 mM Tris Buffer, pH
8 in reverse osmosis water. The compound of Formula (I) was
formulated at either 0.1 or 0.2 mg/mL and given in the dose
provided in Table 1, and the compound of Formula (III) was
formulated at 2 mg/mL and given in the dose provided in Table
1.
[0073] Starting seven days before PO dosing, animals in groups 1-6
were sham dosed with vehicle BID. The sham dosing was designed to
acclimate animals to oral gavage dose administration. Starting at
Day 1 of the study, animals in all dose groups were dosed three
times daily; twice sequentially in the AM (7:00+/-1 hour), and once
in the evening (19:00+/-1 hr), with the same volume of formulation
containing no compound (group 1, vehicle) or the appropriate
compounds as outlined below (Table 1) for 28 days (until dosing Day
29). Each group was split into two and half were sacrificed 2 hours
post dose, and half were sacrificed 8 hours post dose on Day
29.
TABLE-US-00001 TABLE 1 Experimental Design and Dose Groups Dose
Number Dosing Dosing Dose Vol Concentration of Frequency Duration
Group Test Article (mg/kg) (mL/kg) (mg/mL) Animals (x/day) (days)
Route 1 Vehicle 0 5 0 15 TID 29 PO 2 Vehicle 0 5 0 15 QD 29 PO
Formula (I) .5 5 0.1 BID 29 PO 3 Vehicle 0 5 0 15 BID 29 PO Formula
(III) 10 5 2 QD 4 Formula (I) 0.5 5 0.1 16 BID 29 PO Formula (III)
10 5 2 QD PO 5 Vehicle (age- 0 5 0 10 TID 29 PO matched lean)
Quantification of Triglycerides from Murine Liver
[0074] Tissue Extraction:
[0075] Mouse liver tissue samples (25.+-.10 mg, accurately weighed
in frozen state) were homogenized and extracted with a water
immiscible organic solvent mixture that extracts the
triacylglyceride fraction as well as the free and esterified
cholesterol fractions into the organic phase. After centrifugation,
an aliquot of the organic upper layer, containing the
triacylglycerides, cholesterol and cholesterol esters was diluted
either 10-fold or 25-fold with ethanol. Two separate aliquots of
this dilution were taken. One aliquot was analyzed for
triacylglycerides, the second aliquot was used for the total
cholesterol determination.
[0076] Triacylglyceride Determination:
[0077] For the triacylglyceride determination, one aliquot of the
25-fold dilution (or no dilution in the case of samples which have
low triacylglyceride content) was evaporated under a stream of
nitrogen. The dried extract was reconstituted stepwise with a 0.1%
sodium dodecyl sulfate in PBS solution under ultrasonication
followed by mixing with the Triacylglyceride Determination Reagent
(Infinity.TM. Triglycerides Liquid Stable Reagent, Thermo
Scientific, Product Data Sheet, Infinity.TM., Triglycerides Liquid
Stable Reagent).
This reagent solution contained several enzymes, cofactors and the
chromogenic reagent 4-aminoantipyrine. The determination of
triacylglycerides (TAG) with this reagent was based on the method
of Wako, Product Data Sheet, Triacylglyceride-G Code No. 997-69801,
Wako Pure Chemical Industries Ltd., Dallas, Tex., and the
modifications by McGowan et al, (McGowan, M W, et al., Clin. Chem
1983:29:538) and Fossati et al (Fosseti, P. Prenciple L. Clin Chem.
1892:28:2077-80) as follows: [0078] 1. Triglycerides are
enzymatically hydrolyzed by lipase to free fatty acids and
glycerol. [0079] 2. The glycerol is phosphorylated by adenosine
triphosphate (ATP) with glycerol kinase (GK) to produce
glycerol-3-phosphate and adenosine diphosphate. [0080] 3.
Glycerol-3-phosphate is oxidized by dihydroxyacetone phosphate
(DAP) by glycerol phosphate oxidase producing hydrogen peroxide
(H.sub.2O.sub.2). [0081] 4. In a Trinder.sup.5-type colour reaction
catalyzed by peroxidase, the H.sub.2O.sub.2 reacts with
4-aminoantipyrine (4-AAP) and 3,5-dichloro-2-hydroxybenzene
sulfonate (DHBS) to produce a red colored dye. The absorbance of
this dye is proportional to the concentration of triglycerides
present in the sample.
[0082] After incubation with the Triacylglyceride Determination
Reagent for 30 min at 37.degree. C., samples were transferred into
a microtiter plate, and the absorbance is measured at 540 nm in a
microplate reader (SpectraMax M2, Molecular Devices). Quantitation
was performed using a linear least squares regression analysis
generated from fortified calibration standards using glyceryl
trioleate (triolein) as triacylglyceride reference standard.
Calibration standard samples were taken through the same extraction
and incubation steps as the tissue samples. Weight corrections and
concentration calculations were performed using Microsoft Excel
2013. Final tissue contents were given in .mu.mol Triacylglyceride
(TAG)/g Liver Tissue.
ALT
[0083] Serum was collected from all mice at terminal necroscopy.
Serum ALT was measured by Pyruvate with pyridoxal-5'-phosphate and
analyzed on the Cobas Hitachi 6000 Chemistry System, Roche
Diagnostics.
Gene Expression
[0084] An approximately 100 mg chunk of frozen left lateral lobe
was sent to DC3 Therapeutics, LLC for lysing and RNA extraction.
NanoString assays were carried out with all reagents and
consumables contained in an nCounter master kit (NanoString)
according to manufacturer instructions to measure RNA transcripts.
Briefly, the color coded reporter probe targeting 110 liver
fibrosis related genes and 6 control housekeeping genes (Table 2)
were hybridized overnight in a pre-heated 65.degree. C.
thermocycler for 16 to 22 hours with 100 ng RNA samples in a
reaction that includes a hybridization buffer and a capture probe.
Following incubation, samples were placed on a prep station where
excess probes were removed and the probe-transcript complexes were
immobilized on a streptavidin coated cartridge. Finally, the
cartridges were imaged in the nCounter Digital Analyzer (NanoString
Technologies, Seattle, Wash.). All transcripts were normalized to
the geometric mean of 6 housekeeping genes (B2m, Hprt, Pgk1,
Rpl13a, Rpn1, and Sfrs4) with nSover 3.0 software.
TABLE-US-00002 TABLE 2 Nanostring Probes Gene Symbol Accession
Number Target Sequence TIMP1 NM_011593.2
AAGCCTCTGTGGATATGCCCACAAGTCCCAGAACCGCAGTGAAGAGTTTCTCATC
ACGGGCCGCCTAAGGAACGGAAATTTGCACATCAGTGCCTGCAGC COL1A1 NM_007742.3
CAATGGTGAGACGTGGAAACCCGAGGTATGCTTGATCTGTATCTGCCACAATG
GCACGGCTGTGTGCGATGACGTGCAATGCAATGAAGAACTGGACTGT B2M NM_009735.3
CATACGCCTGCAGAGTTAAGCATGCCAGTATGGCCGAGCCCAAGACCGTCTAC
TGGGATCGAGACATGTGATCAAGCATCATGATGCTCTGAAGATTCAT HPRT NM_013556.2
TGCTGAGGCGGCGAGGGAGAGCGTTGGGCTTACCTCACTGCTTTCCGGAGCG
GTAGCACCTCCTCCGCCGGCTTCCTCCTCAGACCGCTTTTTGCCGCGA PGK1 NM_008828.2
CCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTC
ATCTCCGGGCCTTTCGACCTCACGGTGTTGCCAAAATGTCGCTT RPL13a NM_009438.5
ATGGGATCCCTCCACCCTATGACAAGAAAAAGCGGATGGTGGTCCCTGCTGCT
CTCAAGGTTGTTTCGGCTGAAGCCTACCAGAAAGTTTGCTTACCTGGG RPN1 NM_133933.3
GGCAGCCTGACAGTGGGATCTCCTCCATTCGTTCTTTTAAGACCATCCTTCCTG
CTGCCGCCCAGGATGTCTATTACCGGGATGAGATTGGTAATGTTTC SFRS4 NM_020587.2
GATGCTCACAAGGGACGCAAAAACGAAGGAGTGATTGAATTTGTGTCTTACTCT
GATATGAAAAGAGCTTTGGAAAAGCTGGACGGAACTGAAGTCAACG
Results
[0085] Example 1 demonstrates that a combined treatment with an ACC
inhibitor and an FXR agonist results in greater efficacy than
either agent administered alone in the mouse model of NASH. In
particular, FIG. 1 shows a significant reduction in liver
triglycerides with the combination of the compound of Formula (I)
and the compound of Formula (III) relative to the individual
agents, FIG. 2 shows a significant reduction in serum ALT with the
combination of the compound of Formula (I) and the compound of
Formula (III) relative to the individual agents, and FIG. 3 and
FIG. 4 show a significant reduction in liver expression of Col1a1
and Timp1 with the combination of the compound of Formula (I) and
the compound of Formula (III) relative to the individual agents,
respectively.
Example 2. Efficacy in a Rat Model of NASH
[0086] The following study was conducted to evaluate the efficacy
of the combination of an ACC inhibitor and an FXR agonist in a
rodent model of non-alcoholic steatohepatitis (NASH) with fibrosis
relative to the efficacy of the individual agents alone in the
model. In this model, NASH with fibrosis was induced in male Wistar
rats by administration of a choline-deficient high fat diet
(CDHFD).
Animals
[0087] Male Wistar (Crl:Wi(Han)) rats (aged 8-9 weeks at arrival)
were acquired from Charles River, Raleigh, N.C., and used in the
current studies. This study complied with all applicable sections
of the Final Rules of the Animal Welfare Act regulations (Code of
Federal Regulations, Title 9), the Public Health Service Policy on
Humane Care and Use of Laboratory Animals from the Office of
Laboratory Animal Welfare, and the Guide for the Care and Use of
Laboratory Animals from the National Research Council.
Vehicle Preparation
[0088] The vehicle, w/v 50 mM tris buffer, pH 8 in deionized water,
was prepared prior to use and stored in a refrigerator set to
maintain 2-8.degree. C. To prepare 1 L, 800 mL of hot water
(.about.80.degree. C.) was added to an appropriate container and
stirred vigorously until a steep vortex formed. 5.0 grams of sodium
methylcellulose was slowly added to the sodium
carboxymethylcellulose to the vortex. Stirring was continued until
all carboxymethylcellulose was dissolved and the solution cooled
down to ambient temperature. 5.12 g of Tris HCl was added to the
container. 2.12 g of Tris base was added to the container. 10 g of
ethanol was added to the container. The components were stirred for
approximately 15 minutes, ensuring all solids have dissolved. QS
water was added to 1 L with gentle mixing.
Study Design
[0089] Food was pro libitum and all animals on study were given a
choline-deficient, high fat, high cholesterol diet (CDHFD; Research
Diets, A16092003) on Day 1 of study except for group 1, the control
chow group, which received standard diet (5CR4), as outlined in
Table 3. On the day of sacrifice, liver was harvested and paraffin
embedded, and plasma was collected and frozen. Animals were not
dosed the day of sacrifice.
TABLE-US-00003 TABLE 3 Experimental Design and Dose Groups Group
Group name n Diet (weeks) Treatment (PO) 1 Control 10 Standard Diet
(0-12) N/A 2 Start of Treatment 10 CDHFD (0-6) N/A 3 Vehicle 15
CDHFD (1-12) N/A 4 Compound of 15 CDHFD (1-12) 10 mg/kg QD Formula
(I) 5 Compound of 15 CDHFD (1-12) 30 mg/kg QD Formula (III) 6
Compound of 15 CDHFD (1-12) 10 mg/kg QD + Formula (I) + 30 mg/kg QD
Compound of Formula (III)
[0090] Tissues were collected by Charles River in Reno, Nev.,
processed and embedded in paraffin at Histo-tec in Hayward, Calif.
and then shipped to Gilead Sciences in Foster City. Samples were
sectioned at 5 .mu.m and sections were mounted on glass slides for
subsequent staining.
[0091] Picrosirius Red Staining:
[0092] Sections were pretreated in 0.2% Phosphomolybdic Acid (EMS,
Cat#26357-01) and then subsequently incubated in 0.1% (W/V) Sirius
Red 88-89-1 in saturated Picric acid solution (EMS, Cat#26357-02)
for 1 hour at room temperature. This was followed by
differentiation in 0.01N HCl (EMS, Cat#26357) and dehydration in
graded alcohols.
[0093] Whole slide images of Picrosirius Red (PSR) stained slides
were captured using a Leica AT2 scanner at 40.times. magnification.
Digital slide images were checked for scanning quality, annotated
and exported to appropriate network folders within Leica Digital
Image Hub archive. Quantitative image analysis was performed on the
whole slide images using Visiopharm image analysis software
(Visiopharm, Hoersholm, Denmark) to determine the extent and
intensity of PSR. The total PSR-stained area was measured and
expressed as a percentage of total liver area stained. Results are
shown in FIG. 7.
[0094] .alpha.-SMA:
[0095] Sections were deparaffinized in 3 changes of xylene for 5
minutes each, and subsequently rehydrated in 3 changes of 100%
EtOH, 1 change of 95% EtOH, 1 change of 80% EtOH for 3 minutes
each; followed by 2 successive rinses in distilled water. The
sections were then incubated in Peroxidazed 1 (Biocare Medical,
Cat# PX968) endogenous peroxidase blocker for 5 minutes and rinsed
in distilled water. Heat induced epitope retrieval was then
performed using Reveal Decloaker (Biocare Medical, Cat# RV1000M) at
95.degree. C. for 40 minutes with a Decloaking Chamber NxGen
(Biocare Medical, Cat# DC2012), followed by gradual cooling with
replacement of retrieval buffer with distilled water and placed in
tris buffered saline (TBS). Immunohistochemistry was perfomed on
prepared slides using an Intellipath autostainer (Biocare Medical,
Cat# IPS0001) using the following steps: [0096] 1. Apply 300 uL of
Background Punisher (Biocare Medical, Cat# IP974G20) to slides and
incubate for 10 minutes; followed by TBS wash. [0097] 2. Apply 300
uL primary antibody of mouse monoclonal SMA, clone 1A4, (Biocare
Medical, Cat# CM001) diluted 1:50 in Da Vinci Green diluent
(Biocare Medical, Cat# PD900L). Incubate for 30 Minutes at room
temperature; followed by TBS wash. [0098] 3. Apply 300 uL of Mouse
on Rat HRP Polymer (Biocare Medical, Cat# MRT621H) and incubate for
30 minutes; followed by TBS wash. [0099] 4. Prepare DSB: 1 drop of
DSB Chromogen/1 ml Substrate Buffer (Biocare Medical, Cat# BRI
4014C/BRI 4013 respectfully). Apply 300 uL Deep Space Black (DSB)
Chromogen for 5 minutes; followed by distilled water wash. [0100]
5. Counterstain with Nuclear Fast Red (Biocare Medical, Cat#
STNFRLT) for 1 minute; followed by distilled water wash.
[0101] Slides were removed from the instrument and dehydrated
through a series of graded histological grade alcohols to xylene
and coverslipped.
[0102] Whole slide images of .alpha.-SMA stained slides were
captured using a Leica AT2 scanner at 40.times. magnification.
Digital slide images were checked for scanning quality, annotated
and exported to appropriate network folders within Leica Digital
Image Hub archive. Quantitative image analysis was performed on the
whole slide images using Visiopharm image analysis software
(Visiopharm, Hoersholm, Denmark) to determine the extent and
intensity of .alpha.-SMA. The total .alpha.-SMA-stained area was
measured and expressed as a percentage of total liver area
stained.
[0103] Plasma TIMP-1 ELISA:
[0104] Plasma TIMP-1 concentrations were determined in duplicate
using a commercially available rat TIMP-1 specific ELISA kit
(R&D Systems, Minneapolis, Minn., Cat # RTM100). TIMP-1 was
assayed in plasma according to the manufacturer's specifications
with minor modifications. Buffer RD1-21 (50 .mu.l) was added to
ELISA plate wells pre-coated with mouse anti-TIMP-1. Prior to
ELISA, a seven point standard curve of rat TIMP-1 (NS0-expressed
recombinant TIMP-1: 2400-37.5 pg/mL) was generated and plasma
samples were diluted 1:20 in buffer RD5-17. Samples and standards
(50 .mu.l each) were added in duplicate to wells containing RD1-21
and incubated (room temperature) for 2 hours on an orbital plate
shaker (300 rpm). Following antigen capture, plates were washed 5
times (350 .mu.L/well/wash) with Wash Buffer using an automated
plate washer. Following washing, rat TIMP-1 conjugate (100 .mu.l)
was added to each well and plates were incubated (room temperature)
for 2 hours on an orbital plate shaker (300 rpm). Plates were then
washed 5 times and Substrate Solution (100 .mu.l) was added to each
well. Plates were incubated at room temperature for 30 minutes
protected from light. Finally, Stop Solution (100 .mu.l) was added
to each well. Optical Density (O.D.) absorbance was immediately
determined at 450 nm on a SpectraMax 190 microplate reader
(Molecular Devices, Sunnyvale Calif.). Relative O.D.s for each
standard and sample were background corrected against blank
samples, and standard curves for conversion of O.D.s to TIMP-1
concentration were generated using a 4 Parameter curve fit method.
Unknown sample TIMP-1 concentrations were determined using SoftMax
ProS software using a dilution factor of 20. Results are shown in
FIG. 7.
[0105] Plasma PIIINP:
[0106] Plasma PIIINP concentrations were determined in duplicate
using a commercially available rat Procollagen III N-Terminal
Propeptide (PIIINP) ELISA Kit (Biomatik, Wilmington, Del., Cat#
EKU06788). PIIINP was assayed in plasma diluted 50 fold in PBS
according to the manufacturer's specifications with minor
modifications. 7 standards (2,000 pg/mL, 1,000 pg/mL, 500 pg/mL,
250 pg/mL, 125 pg/mL, 62.5 pg/mL, 31.2 pg/mL) were prepared from
standard stock which was reconstituted in Standard Diluent. 100
.mu.L each of standards, blank and samples were added into the
appropriate wells. The plate was covered with the plate sealer and
incubated for 1 hour at 37.degree. C. After removing liquid from
each well, 100 .mu.L of Detection Reagent A working solution was
added to each well and covered with the plate sealer then incubated
for 1 hour at 37.degree. C. The wells were washed with 350 .mu.L of
1.times. Wash and sit for 1.about.2 minutes for 3 times. After the
last wash, any remaining wash buffer was removed by decanting and
blotting against absorbent paper. Then 100 .mu.L of Detection
Reagent B working solution was added to each well, plate was
covered with the plate sealer and incubated for 30 minutes at
37.degree. C. The aspiration/wash process was repeated for total 5
times. 90 .mu.L of Substrate Solution was added to each well, plate
was covered with a new plate sealer and incubated for 10-20 minutes
at 37.degree. C. protecting from light. The liquid turned blue by
the addition of Substrate Solution Finally 50 .mu.L of Stop
Solution was added to each well. The liquid then turned yellow. Mix
the liquid by gently tapping the side of the plate. Optical Density
(O.D.) absorbance was immediately determined at 450 nm on a
SpectraMax 190 microplate reader (Molecular Devices, Sunnyvale
Calif.). Relative O.D.s for each standard and sample were
background corrected against blank samples, and standard curves for
conversion of O.D.s to PIIINP concentration were generated using a
4 Parameter curve fit method. Unknown sample PIIINP concentrations
were determined using SoftMax ProS software using a dilution factor
of 50. Results are shown in FIG. 9.
[0107] Plasma Hyaluronic Acid (HA) Assay:
[0108] Plasma HA concentrations were determined in duplicate using
a commercially available HA Test Kit (Corgenix, Inc., Broomfield,
Colo., Cat#029-001). HA was assayed in plasma according to the
manufacturer's specifications with minor modifications. Prior to
assay, a seven point standard curve of HA reference solution
(800-12.5 ng/mL) was generated and each reference sample and plasma
sample was diluted 1 part to 10 parts Reaction Buffer (30 .mu.l
reference/sample to 300 .mu.l Reaction Buffer). Samples and
standards (100 .mu.l) were added in duplicate to microplate wells
pre-coated with HA binding protein (HABP) and incubated (room
temperature) for 60 minutes on an orbital plate shaker (300 rpm).
Following antigen capture, plates were washed 4 times (350
.mu.L/well/wash) with PBS using an automated plate washer.
Following washing, HRP-conjugated HABP (100 .mu.l) was added to
each well and plates were incubated (room temperature) for 30
minutes on an orbital plate shaker (300 rpm). Plates were then
washed 4 times and the one-component Substrate Solution (100 .mu.l)
was added to each well. Plates were incubated at room temperature
for 30 minutes protected from light. Finally, Stop Solution (100
.mu.l) was added to each well. Optical Density (O.D.) absorbance
was immediately determined at 450 nm on a SpectraMax 190 microplate
reader (Molecular Devices, Sunnyvale Calif.). Relative O.D.s for
each standard and sample was background corrected against blank
samples, and standard curves for conversion of O.D.s to HA
concentration was generated using a 4 Parameter curve fit method.
Undiluted unknown sample HA concentrations were determined using
SoftMax ProS software. Results are shown in FIG. 8.
Results
[0109] Example 2 demonstrates that a combined treatment with an ACC
inhibitor and an FXR agonist results in greater efficacy than
either agent administered alone in the rat model of NASH. In
particular, FIG. 5-9 shows a significant reduction markers of
fibrosis including percent picrosirius positive area, percent
.alpha.-SMA positive area, and three plasma markers associated with
fibrosis, TIMP1, HA, and PIIINP with the combination of the
compound of Formula (I) and the compound of Formula (III) relative
to the vehicle. FIG. 6 and FIG. 9 show a significant reduction
.alpha.-SMA and PIIINP with the combination of the compound of
Formula (I) and the compound of Formula (III) relative to the
individual agents, respectively.
Sequence CWU 1
1
81100DNAArtificial SequenceSynthetic 1aagcctctgt ggatatgccc
acaagtccca gaaccgcagt gaagagtttc tcatcacggg 60ccgcctaagg aacggaaatt
tgcacatcag tgcctgcagc 1002100DNAArtificial SequenceSynthetic
2caatggtgag acgtggaaac ccgaggtatg cttgatctgt atctgccaca atggcacggc
60tgtgtgcgat gacgtgcaat gcaatgaaga actggactgt 1003100DNAArtificial
SequenceSynthetic 3catacgcctg cagagttaag catgccagta tggccgagcc
caagaccgtc tactgggatc 60gagacatgtg atcaagcatc atgatgctct gaagattcat
1004100DNAArtificial SequenceSynthetic 4tgctgaggcg gcgagggaga
gcgttgggct tacctcactg ctttccggag cggtagcacc 60tcctccgccg gcttcctcct
cagaccgctt tttgccgcga 1005100DNAArtificial SequenceSynthetic
5ccggcattct gcacgcttca aaagcgcacg tctgccgcgc tgttctcctc ttcctcatct
60ccgggccttt cgacctcacg gtgttgccaa aatgtcgctt 1006100DNAArtificial
SequenceSynthetic 6atgggatccc tccaccctat gacaagaaaa agcggatggt
ggtccctgct gctctcaagg 60ttgttcggct gaagcctacc agaaagtttg cttacctggg
1007100DNAArtificial SequenceSynthetic 7ggcagcctga cagtgggatc
tcctccattc gttcttttaa gaccatcctt cctgctgccg 60cccaggatgt ctattaccgg
gatgagattg gtaatgtttc 1008101DNAArtificial SequenceSynthetic
8gatgctcaca agggacgcaa aaacgaagga gtgattgaat ttgtgtctta ctctgatatg
60aaaagagctt tggaaaagct ggacggaact gaagtcaacg g 101
* * * * *