Novel Organic Acid Pathway

PUNT; Peter Jan ;   et al.

Patent Application Summary

U.S. patent application number 15/849465 was filed with the patent office on 2018-09-27 for novel organic acid pathway. This patent application is currently assigned to DUTCH DNA BIOTECH B.V.. The applicant listed for this patent is DUTCH DNA BIOTECH B.V.. Invention is credited to Martinus Petrus Maria CASPERS, An LI, Peter Jan PUNT.

Application Number20180273986 15/849465
Document ID /
Family ID48190403
Filed Date2018-09-27

United States Patent Application 20180273986
Kind Code A1
PUNT; Peter Jan ;   et al. September 27, 2018

NOVEL ORGANIC ACID PATHWAY

Abstract

The invention relates to the use of a cytosolic citric acid synthase for the heterologous production of citrate outside the mitochondrion of a micro-organism or algae, wherein the protein is selected from A. niger An08g10920, An01g09940, An09g03570 ,or an ortholog of these genes. Such production is achieved by introducing the nucleic acid encoding such a protein into a suitable host cell. Preferably the protein is A. niger An08g10920, An01g09940, An09g03570 or an ortholog thereof, more particularly, wherein such an ortholog is chosen from the group of proteins listed in FIG. 9 and proteins having a percentage identity of 70%, more preferably 75%, more preferably 80%, more preferably 85%, more preferably 90%, more preferably 95%, more preferably 98%, more preferably 99% with An08g10920, An01g09940 or An09g03570.


Inventors: PUNT; Peter Jan; (Zeist, NL) ; LI; An; ('s-Gravenhage, NL) ; CASPERS; Martinus Petrus Maria; ('s-Gravenhage, NL)
Applicant:
Name City State Country Type

DUTCH DNA BIOTECH B.V.

Zeist

NL
Assignee: DUTCH DNA BIOTECH B.V.
Zeist
NL

Family ID: 48190403
Appl. No.: 15/849465
Filed: December 20, 2017

Related U.S. Patent Documents

Application Number Filing Date Patent Number
14888410 Oct 30, 2015 9885066
PCT/NL2014/050284 May 2, 2014
15849465

Current U.S. Class: 1/1
Current CPC Class: C12N 9/1025 20130101; C12Y 401/01006 20130101; C12Y 203/03001 20130101; C12P 7/48 20130101; C12P 7/44 20130101
International Class: C12P 7/48 20060101 C12P007/48; C12N 9/10 20060101 C12N009/10; C12P 7/44 20060101 C12P007/44

Foreign Application Data

Date Code Application Number
May 2, 2013 EP 13166305.6

Claims



1. A method for producing a derivative of citric acid which method comprises modifying a eukaryotic host cell wherein said modifying consists of providing said host cell with a gene encoding a citric acid synthase that lacks a signal for expression in the mitochondrion, wherein the citric acid synthase is that encoded by an A. niger gene designated An08g10920 (SEQ ID NO: 18), or An01g09940 (SEQ ID NO: 50), or An09g03570 (SEQ ID NO: 49), or is an ortholog thereof, wherein the ortholog is a protein that has citric acid synthase activity and a percentage identity of at least 95% with that encoded by An08g10920 (SEQ ID NO: 18), or An01g09940 (SEQ ID NO: 50) or An09g03570 (SEQ ID NO: 49); with a nucleic acid that expresses one or more genes that encode derivatizing enzymes that convert citric acid into said derivative of citric acid in a suitable host cell.

2. The method of claim 1, wherein said modifying is effected by transforming the host cell with a vector comprising said nucleic acid that expresses sequence encoding said citric acid synthase and a vector comprising said nucleic acid that expresses one or more genes that encode derivatizing enzymes that convert citric acid into said derivative of citric acid.

3. The method of claim 1, wherein said host cell is a fungus or a yeast or a plant or algal cell.

4. The method of claim 1, wherein said host cell is selected from the group of Aspergillus spp., Neurospora spp., Sclerotina, Gibberella, Coniothyrium, Psiticum, Magnaporthe, Podospora, Chaetomium, Phaeosphaeria, Botryotinia, Neosartorya, Pyrenophora, Panicum, Aureococcus, Penicillium, Trichoderma, Sordaria, Colleotrichum, Verticillium, Arthrobotrys, Nectria, Leptosphaeria, Fusarium, Glomerella, Geomyces, Myceliophthora, Pichia, Saccharomyces spp., Zygosaccharomyces, Schizosaccharomyces pombe, Kluyveromyces spp., Yarrowia lipolytica, Monascus spp., Penicillium spp., Hansenula spp., Torulaspora delbrueckii, Hypomyces spp., Dotatomyces spp., Issatchenko orientalis, Phoma spp., Eupenicillium spp., Gymnoascus spp., Pichia labacensis, Pichia anomala, Wickerhamomyces anomalus, Candida cariosilognicola, Paecilomyces virioti, Scopulariopsis brevicaulis, Brettanomyces spp., Dekkera bruxellensis, Dekkera anoma and Trichoderma spp.

5. The method of claim 1, wherein said one or more genes encoding derivatizing enxymes is selected from the group comprising An08g10860 (fatty acid synthase subunit beta), An08g10870 (2-methylcitrate dehydratase, prpD) ( ); An08g10880 (GAL4; GAL4-like Zn2Cys6 binuclear), An08g10930 (3-oxoacyl-[acyl-carrier-protein] synthase); An08g10970 (MFS multidrug transporter); An08g10980 (transcription factor acetate regulatory DNA binding protein facB), An01g09950, An09g06220, An15g01780.

6. The method of claim 1, wherein said derivative is itaconic acid and the method comprises overexpressing a gene encoding said citric acid synthase and a gene encoding a protein that is involved in the production or transport of itaconate or any precursor thereof selected from the group consisting of cis-aconitic acid decarboxylase (CAD), ATEG_09969.1, ATEG_09970.1 and ATEG_09972.1.
Description



CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This Application is a divisional of application Ser. No. 14/888,410, having an international filing date of 2 May 2014, now allowed, which is national phase of PCT application PCT/NL2014/050284 having an international filing date of 2 May 2014, which claims benefit of European patent application No. 13166305.6 filed 2 May 2013. The contents of the above patent applications are incorporated by reference herein in their entirety.

SUBMISSION OF SEQUENCE LISTING ON ASCII TEXT FILE

[0002] The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: 313632019910SeqList.txt, date recorded: Dec. 13, 2017, size: 284,896 KB).

[0003] The invention relates to the field of microbial production, more specifically production of organic acids, such as citric acid and its derivatives, such as oxaloacetic acid, itaconic acid (itaconate) and metacrylic acid, more specifically the production thereof in micro-organisms.

[0004] One of the most fundamental and ubiquitous metabolic pathways in living organisms is the citric acid cycle, or Krebs cycle, named after the discoverer. In eukaryotes this process takes place in the mitochondrion and is fed mainly by pyruvate and acetyl-CoA that are transported from the cytoplasm into the mitochondrion. Some of the constituents of the Krebs cycle or derivatives thereof may be transported back to the cytoplasm by active transport mechanisms, in general by tricarboxylic acid transporters. This basically means that cytoplasmatic metabolic routes that are dependent on, or starting from organic acids such as citric acid (citrate), malic acid (malate) oxaloacetic acid (oxaloacetate) heavily depend, and in general are limited by the activity within the Krebs cycle and the availability of the tricarboxylic acid transporters.

[0005] Hitherto no specific metabolic route for the production of extramitochondrial citric acid was elucidated. Yet, the availability of citric acid in the cytoplasm is extremely useful for the production of this acid itself and, even more importantly, for the production of derivatives and metabolites of citric acid. Citric acid is the starting point for many metabolic routes. One important metabolic route is the production of itaconic acid.

[0006] Production and metabolism of itaconic acid in microbial cells has been studied extensively for several decades (Calam, C. T. et al., 1939, Thom. J. Biochem., 33:1488-1495; Bentley, R. and Thiessen, C. P., 1956, J. Biol. Chem. 226:673-720; Cooper, R. A. and Kornberg, H. L., 1964, Biochem. J., 91:82-91; Bonnarme, P. et al., 1995, J. Bacteriol. 117:3573-3578; Dwiarti, L. et al., 2002, J. Biosci. Bioeng. 1:29-33), but the metabolic pathway for itaconic acid has not been unequivocally established (Wilke, Th. and Vorlop, K.-D., 2001, Appl. Microbiol. Biotechnol. 56:289-295; Bonnarme, P. et al., 1995, J. Bacteriol. 177:3573-3578). Two complicating factors in this respect are that the biosynthesis route for itaconic acid is thought to occur both in the cytosol and the mitochondria (Jaklitsch, W. M. et al., 1991, J. Gen. Microbiol. Appl. 6:51-61) and that aconitase, the enzyme that interconverts citric acid into cis-aconitate, and vice versa, and other enzymes in the metabolic pathway have been found to be present in many isoforms in microbial cells.

[0007] The general scheme currently envisioned for itaconic acid biosynthesis is given in FIG. 1, wherein clearly the existence of the biosynthetic route both in the cytosol and the mitochondria is depicted and the putative connection between these two compartments. At several point of this scheme possibilities exist to try to improve the existing commercial production of itaconic acid in micro-organisms.

[0008] The production of itaconic acid from citrate has been achieved in Aspergillus (and also other micro-organisms) with technology as described in WO 2009/014437, WO 2009/104958 and WO 2009/110796.

[0009] However, next to itaconate, citrate can also be used as a starting point for the production of malate, succinate, glutamate and metacrylic acid.

[0010] Further, citric acid can also lead to a metabolic route for lysine and from there to penicillin and similar compounds. Alternatively, citric acid can lead to the synthesis of fatty acids and thus be a source for biodiesel production. Moreover metabolites of citric acid, in particular acetyl-CoA, form the basis of biosynthetic routes towards fatty acids, polyketides and the mevalonate pathway towards terpenoids and other compounds

[0011] Yet, however, there is still need for an enzyme capable of production or overproduction of citric acid.

SUMMARY OF THE INVENTION

[0012] The present inventors now have elucidated a gene coding for an enzyme that is able to catalyze the reaction from oxaloacetate to citric acid, a so-called citrate synthase enzyme, which is present and functional outside the mitochondrion (and probably in the cytoplasm) of eukaryotic organisms.

[0013] The invention therefore comprises the use of a protein having cytosolic citric acid synthase activity for the heterologous production of citrate in the cytosol of a micro-organism or algae, preferably wherein said micro-organism is a fungus or a yeast or a plant or algal cell, more preferably when said micro-organism is selected from the group of Aspergillus spp., more particularly, A. niger, A. nidulans, A. terreus, A. clavatus, A. oryzae or A. flavus, Neurospora spp., more particularly N. crassa or N. tetrasperma, Sclerotina, Gibberella, Coniothyrium, Psiticum, Magnaporthe, Podospora, Chaetomium, Phaeosphaeria, Botryotinia, Neosartorya, Pyrenophora, Panicum, Aureococcus, Penicillium, Trichoderma, Sordaria, Colleotrichum, Verticillium, Arthrobotrys, Nectria, Leptosphaeria, Fusarium, Glomerella, Geomyces, Myceliophthora, Pichia, Saccharomyces spp., such as S. pastorianus, S. cerevisiae, S. boulardii, S. carlsbergensis, S. kudriavzevii, and S. paradoxus, Zygosaccharomyces, Schizosaccharomyces pombe, Kluyveromyces spp., Yarrowia lipolytica, Monascus spp. (such as M. rubber, M. purpureus, M. pilosus, M. vitreus and M. pubigerus), Penicillium spp. (such as P. citrinum, P. chrysogenum), Hansenula spp., Torulaspora delbrueckii, Hypomyces spp., Dotatomyces spp. (such as D. stemonitis), Issatchenko orientalis, Phoma spp., Eupenicillium spp., Gymnoascus spp., Pichia labacensis, Pichia anomala, Wickerhamomyces anomalus, Candida cariosilognicola, Paecilomyces virioti, Scopulariopsis brevicaulis, Brettanomyces spp., such as B. bruxellensis, B. anomalus, B. custersianus, B. naardenensis and Brettanomyces nanus, Dekkera bruxellensis, Dekkera anoma and Trichoderma spp. (such as T. viride).

[0014] Preferably in said use the protein is derived from A. niger. It is also preferred when the protein is A. niger An08g10920 or an ortholog thereof, more particularly, wherein such an ortholog is chosen from the group of CAK45764.1/An08g10920, XP001393195.2/ANTI1_1474074, EHA18674.1/Aspni5_176409, NP_001142237.1, GAA88109.1/ AKAW_06223, EIT75413.1/Ao3042_08560, XP_001827205.1/AOR_1_298024, AO090010000170, XP_002384448.1/AFLA_117410, AFL2G_11427, XP_002148678.1/PMAA_091390, Aspfo1_0085419, Acar5010_212258, Acar5010_171837, Aspbr1_0068777, Asptu1_0164827, and proteins having a percentage identity of 70%, more preferably 75%, more preferably 80%, more preferably 85%, more preferably 90%, more preferably 95%, more preferably 98%, more preferably 99% with An08g10920.

[0015] Further part of the invention is a vector for transforming a micro-organism comprising a nucleic acid sequence coding for a protein as defined above. Also part of the invention is a transgenic organism transformed with such a vector or comprising a heterologous citric acid synthase as defined above.

[0016] The invention also comprises a method for the production of citric acid comprising overexpression of a gene coding for a citric acid synthase as defined above.

[0017] In a further preferred embodiment, the invention comprises a method for the production of itaconic acid comprising overexpression of a gene coding for a citric acid synthase as defined above and overexpression of a gene coding for the enzyme cis-aconitic acid decarboxylase (CAD) in a suitable host cell.

[0018] In an also preferred embodiment of the present invention, the invention also comprises a method for the production of a derivative of citric acid comprising overexpression of a gene coding for a citric acid synthase as defined in any of claim 1, 2 or 3 and overexpression of one or more genes that encode enzymes that are capable of converting citric acid into said derivative of citric acid in a suitable host cell. Preferably in such a method said one or more genes are selected from the group comprising An08g10860 (fatty acid synthase subunit beta), An08g10870 (2-methylcitrate dehydratase, prpD) ( ); An08g10880 (GAL4; GAL4-like Zn2Cys6 binuclear), An08g10930 (3-oxoacyl-[acyl-carrier-protein] synthase); An08g10970 (MFS multidrug transporter); An08g10980 (transcription factor acetate regulatory DNA binding protein facB), An01g09950, An09g06220, An15g01780, An02g14730 (cytosolic prpD family)', An05g02230 and An08g10530 (cytosolic aconitases) An02g12430, (non-mitochondrial isocitrate dehydrogenase) An04g06210 (homocitrate synthase), Anl1g00510 and An11g00530 (citrate lyase). Further preferred in such a method said suitable host cell is a micro-organism or algae, more preferably a fungus or a yeast or a plant or algal cell, preferably selected from the group of Aspergillus spp., more particularly, A. niger, A. nidulans, A. terreus, A. clavatus, A. oryzae or A. flavus, Neurospora spp., more particularly N. crassa or N. tetrasperma, Sclerotina, Gibberella, Coniothyrium, Psiticum, Magnaporthe, Podospora, Chaetomium, Phaeosphaeria, Botryotinia, Neosartorya, Pyrenophora, Panicum, Aureococcus, Penicillium, Trichoderma, Sordaria, Colleotrichum, Verticillium, Arthrobotrys, Nectria, Leptosphaeria, Fusarium, Glomerella, Geomyces, Myceliophthora, Pichia, Saccharomyces spp., such as S. pastorianus, S. cerevisiae, S. boulardii, S. carlsbergensis, S. kudriavzevii, and S. paradoxus, Zygosaccharomyces, Schizosaccharomyces pombe, Kluyveromyces spp., Yarrowia lipolytica, Monascus spp. (such as M. rubber, M. purpureus, M. pilosus, M. vitreus and M. pubigerus), Penicillium spp. (such as P. citrinum, P. chrysogenum), Hansenula spp., Torulaspora delbrueckii, Hypomyces spp., Dotatomyces spp. (such as D. stemonitis), Issatchenko orientalis, Phoma spp., Eupenicillium spp., Gymnoascus spp., Pichia labacensis, Pichia anomala, Wickerhamomyces anomalus, Candida cariosilognicola, Paecilomyces virioti, Scopulariopsis brevicaulis, Brettanomyces spp., such as B. bruxellensis, B. anomalus, B. custersianus, B. naardenensis and Brettanomyces nanus, Dekkera bruxellensis, Dekkera anoma and Trichoderma spp. (such as T. viride), most preferably wherein said micro-organism is chosen from the group consisting of Aspergillus niger, A.acidus, A.tubigensis, A. oryzae, A. kawachii, A. flavus, A. acidus, A. carbonarius, A. brasiliensis, S.cerevisiae, Talaromyces marneffei, Zea mays, Pichia anomala and Dekkera bruxellensis.

[0019] The invention als comprises a method for the production of a derivative of citric acid, preferably wherein said derivative is itaconic acid comprising overexpression of a gene coding for a citric acid synthase as defined in any of claim 1, 2 or 3 and a gene encoding for protein that is involved in the production or transport of itaconate or any precursor thereof, preferably wherein the gene is selected from the group of cis-aconitic acid decarboxylase (CAD), ATEG_09969.1, ATEG_09970.1 and ATEG_09972.1.

[0020] In a further preferred embodiment the invention comprises a method as defined above, wherein said host cell is cultured under anaerobic conditions. Alternatively or additionally, the invention comprises a method as defined above, wherein said host cell is cultured under anaerobic conditions in the presence of nitrate as N-source.

LEGENDS TO THE FIGURES

[0021] FIG. 1: Postulated biosynthesis route(s) for itaconic acid in A. terreus. 1, Citrate synthase; 2, Aconitase; 3, cis-aconitic acid decarboxylase (itaconate-forming); 4, cis-aconitic acid decarboxylase (citraconate-forming); 5, citraconate isomerase; 6, mitochondrial dicarboxylate-tricarboxylate antiporter; 7, mitochondrial tricarboxylate transporter; 8, dicarboxylate transporter; 9, 2-methylcitrate dehydratase.

[0022] FIG. 2: Schematic projection of the lysine biosynthetic pathway.

[0023] FIG. 3: CitB cluster analysis of five Aspergillus species (citB gene indicated in the fifth column from the left and as identified as AFL2G_11427, A0090010000170, An08g10920, 176409-mRNA, Aspfo1_0085419, Aspbr1_0068777 and Asptu1_0164827). From top to bottom A. flavus NRRL 3357, A. oryzae RIB40/ATCC 42149, A. niger CBS 51388, A. niger ATCC 1015, A. acidus, A. carbonarius ITEM 5010. The "black Aspergilli", A. niger, A. acidus and A. carbonarius, show similar clustering of the genes surrounding the citB gene, whereas the genomic region in A. oryzae and A. flavus only contains the citB (An08g10920) ortholog and the orthologs of An08g10880 and An08g10930. For A. terreus (not depicted) no corresponding gene cluster was found at all.

[0024] FIG. 4: Mevalonate pathway.

[0025] FIG. 5A-B: Nucleotide sequence of the Aspergillus expression vector pABgpd-I.

[0026] FIG. 6: Glucose consumption and organic acid production of A. niger CitB #99.

[0027] FIG. 7: Glucose consumption and organic acid production of A. niger CAD+MTT+MFS.

[0028] FIG. 8: Growth and itaconic acid production of A. niger AB1.13 CitB #99 on glycerol.

[0029] FIG. 9A-L: Amino acid sequences of orthologous citB citrate synthase like proteins.

[0030] FIG. 10: A. Homology tree of Aspergillus citrate synthase like proteins; B. Homology tree of Aspergillus niger, A. kawachii, A. ruber citrate synthase like proteins.

DETAILED DESCRIPTION OF THE INVENTION

[0031] "Fungi" are herein defined as eukaryotic microorganisms and include all species of the subdivision Eumycotina (Alexopoulos, C. J., 1962, In: Introductory Mycology, John Wiley & Sons, Inc., New York). The term fungus thus includes both filamentous fungi and yeast. "Filamentous fungi" are herein defined as eukaryotic microorganisms that include all filamentous forms of the subdivision Eumycotina. These fungi are characterized by a vegetative mycelium composed of chitin, cellulose, and other complex polysaccharides. The filamentous fungi used in the present invention are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism of most filamentous fungi are obligately aerobic. "Yeasts" are herein defined as eukaryotic microorganisms and include all species of the subdivision Eumycotina that predominantly grow in unicellular form. Yeasts may either grow by budding of a unicellular thallus or may grow by fission of the organism.

[0032] The term "fungal", when referring to a protein or nucleic acid molecule thus means a protein or nucleic acid whose amino acid or nucleotide sequence, respectively, naturally occurs in a fungus.

[0033] The core of the invention resides in the discovery of a new, alternative parallel pathway for the production of citric acid from oxaloacetic acid. Most surprisingly, said production takes place outside of the mitochondrion, and probably in the cytoplasm. Accordingly, this route is active even under conditions where the mitochondrial citric acid cycle is inactive, which means that production of citric acid can advantageously take place in the absence of an active TCA cycle under anaerobic or low oxygen conditions. Further, it has appeared that the enzyme is expressed during the stationary phase, which means that an overexpression of citric acid can be achieved without any biomass growth of the producing organism. Moreover, previous research (Rafledge C., 2000, FEMS Microbiol. Lett. 189(2):317-319; Ruijter G. et al., 2000, FEMS Microbiol. Lett. 184(1): 35-40; Murray, S. and Hynes, M. 2010, Eukaryotic Cell 9(4):656-666) has shown that improvement of product fluxes through rational manipulation of the central metabolism (citrate synthase) has not been successful, which is in contrast to the results obtained in the present invention

[0034] For sake of easy reference, the enzyme will be addressed in this specification as the citrate synthase B or citB-enzyme, or just citB.

[0035] The citB gene as originally isolated was derived from Aspergillus niger. However, also comprised in the invention are homologous proteins that are derived from other micro-organisms (also called orthologs) and the nucleotide sequences coding for these. It will be clear for a person skilled in the art that on basis of the nucleotide sequences coding for the CitB enzyme of A. niger orthologs from other micro-organism species can be easily found through database searching in the NCBI GenBank based on sequence similarity and alignment analysis using minimal gap size in the alignment. A list of these orthologs is presented in Table 1a.

[0036] Table 1a List of citB orthologs found in the NCBI GenBank database and orthologous genes in Aspergillus species (AspGD database, Broad institute). The sequences of these genes are given in FIG. 9. [0037] Accession Species [0038] CAK45764.1/An08g10920 Aspergillus niger [0039] XP001393195.2/ANI1_1474074 Aspergillus niger [0040] EHA18674.1/Aspni5_176409 Aspergillus niger [0041] NP_001142237.1 Zea mays [0042] GAA88109.1/AKAW_06223 Aspergillus kawachii [0043] EIT75413.1/Ao3042_08560 Aspergillus oryzae [0044] XP_001827205.1/AOR_1_298024 Aspergillus oryzae [0045] AO090010000170 A. oryzae [0046] XP_002384448.1/AFLA_117410 Aspergillus flavus [0047] AFL2G_11427 Aspergillus flavus [0048] XP_002148678.1/PMAA_091390 Talaromyces marneffei [0049] Aspfo1_0085419 A. acidus [0050] Acar5010_212258 A. carbonarius [0051] Acar5010_171837 A. carbonarius [0052] Aspbr1_0068777 A. brasiliensis [0053] Asptu1_0164827 A. tubingensis [0054] ETS77643.1 Pestalotiopsis fici [0055] EOD45286.1 Neofusicoccum parvum [0056] EMR70107.1 Eutypa lata

[0057] Also part of the invention are nucleotide sequences which are conservatively modified variants of the above mentioned sequences or polymorphic variants thereof. Those of skill in the art will recognize that the degeneracy of the genetic code allows for a plurality of polynucleotides to encode the identical amino acid. Such "silent variations" can be used, for example, to selectively hybridize and detect allelic variants of the nucleotide sequences of the present invention. Additionally, the present invention provides isolated nucleotide sequences comprising one or more polymorphic (allelic) variants of the above nucleotide sequences. Further part of the invention are polynucleotides still coding for a protein which has a biological function identical to the function of the CitB enzyme, which are the product of amplification from a nucleotide library using primer pairs which selectively hybridize under stringent conditions to loci within the above mentioned nucleotide sequences. The primer length in nucleotides is selected from the group of integers consisting of from at least 15 to 50. Those of skill in the art will recognize that a lengthened primer sequence can be employed to increase specificity of binding (i.e. annealing) to a target sequence. Stringent conditions in this respect means a reaction at a temperature of between 60.degree. C. and 65.degree. C. in 0.3 strength citrate buffered saline containing 0.1% SDS followed by rinsing at the same temperature with 0.3 strength citrate buffered saline containing 0.1% SDS.

[0058] Thus, also part of the invention are polynucleotides which selectively hybridize, under selective hybridization conditions, to one or more of the above discussed nucleotide sequences, and which code for an amino acid sequence which has a biological function similar to the function of the CitB enzyme disclosed in the present invention. With "a biological function similar to the function of CitB" it is meant the ability to convert oxaloacetate into citrate and to perform this conversion outside the mitochondrion, in the cytoplasm.

[0059] Another way to indicate hybridization potential is on sequence identity. In this sense, the present invention provides also for nucleotide sequences which have a percentage of identity related to the above mentioned sequences of 65% to 95%. Thus, for example, the percentage of identity can be at least, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. Sequence identity on nucleotide sequences can be calculated by using the BLASTN computer program (which is publicly available, for instance through the National Center for Biotechnological Information, accessible via the interne on http://www.ncbi.nlm.nih.gov/) using the default settings of 11 for wordlength (W), 10 for expectation (E), 5 as reward score for a pair of matching residues (M), -4 as penalty score for mismatches (N) and a cutoff of 100.

[0060] Similarly, the homology can be calculated on basis of the amino acid sequence of the enzyme encoded by said nucleotide sequences. For amino acids, the sequence identity can be calculated through the BLASTP computer program (also available through http://www.ncbi.nlm.nih.gov/). On the amino acid level homologues or orthologs are defined as amino acid sequences having a biological function similar to the CitB enzyme and having a sequence identity of at least 50%, preferably at least 55%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95% to the amino acid sequence of the A. niger CitB enzyme as depicted in FIG. 3.

[0061] Further included in the invention are enzymes, and nucleotide sequences coding for such enzymes, with a functional citrate synthase activity, but which lack the signal sequence that normally would cause them to be expressed or to be functional in the mitochondrion. Further included in the present invention and within the definition of citB according to the invention are mitochondrial citrate synthase enzymes in which the signal sequence has been replaced with the signal sequences of the A. niger citB enzyme (An08g10920).

[0062] As is shown in the Examples, also the enzymes with annotation An01g09940 and An09g03570 lack the mitochondrial signal protein part. It is thus envisaged that these proteins and orthologs of these proteins would also qualify as citB enzymes according to the invention. These enzymes and their orthologs, listed in the Table 1b below, are also depicted in FIG. 9.

TABLE-US-00001 TABLE 1b Protein sequences of predicted non-mitochondrial citrate synthases homologous to An09g03570 and An01g09940 (these also consists of several citB homologues) Homology to GAA91575 (besthit of An09g03570 citrate synthase [Aspergillus kawachii IFO 4308] An09g03570 BEST hit 100% GAA91575.1 citrate synthase [Neosartorya fischeri NRRL 181] >gb|EAW19096.1| citrate synthase [Neosartorya 71% XP_001260993.1 fischeri NRRL 181] citrate synthase [Aspergillus fumigatus Af293] >gb|EBA27504.1| citrate synthase, putative 69% XP_001481680.1 [Aspergillus fumigatus Af293] >gb|EDP55036.1| citrate synthase [Aspergillus fumigatus A1163] citrate synthase, putative [Aspergillus flavus NRRL3357] >gb|EED54329.1| citrate synthase, 68% XP_002375601.1 putative [Aspergillus flavus NRRL3357] citrate synthase [Aspergillus oryzae RIB40] 68% XP_001727354.2 TPA: citrate synthase, putative (AFU_orthologue; AFUA_2G15312) [Aspergillus nidulans FGSC 69% CBF79704.1 A4] hypothetical protein AN7593.2 [Aspergillus nidulans FGSC A4] >gb|EAA62173.1| hypothetical 69% XP_680862.1 protein AN7593.2 [Aspergillus nidulans FGSC A4] Citrate synthase-like [Penicillium roqueforti] 61% CDM33221.1 Pc12g00660 [Penicillium chrysogenum Wisconsin 54-1255] >emb|CAP79693.1| Pc12g00660 61% XP_002556968.1 [Penicillium chrysogenum Wisconsin 54-1255] hypothetical protein COCCADRAFT_104929 [Bipolaris zeicola 26-R-13] 59% EUC30035.1 hypothetical protein COCMIDRAFT_107988 [Bipolaris oryzae ATCC 44560] 59% EUC40740.1 citrate synthase, putative [Aspergillus clavatus NRRL 1] >gb|EAW14389.1| citrate synthase, 67% XP_001275815.1 putative [Aspergillus clavatus NRRL 1] hypothetical protein COCVIDRAFT_107070 [Bipolaris victoriae FI3] 59% EUN24125.1 citrate synthase [Aspergillus ruber CBS 135680] 59% EYE90286.1 hypothetical protein COCHEDRAFT_1118493 [Bipolaris maydis C5] >gb|ENH99968.1| 58% EMD85580.1 hypothetical protein COCC4DRAFT_151813 [Bipolaris maydis ATCC 48331] citrate synthase, putative [Talaromyces stipitatus ATCC 10500] >gb|EED18839.1| citrate synthase, 52% XP_002482831.1 putative [Talaromyces stipitatus ATCC 10500] citrate synthase, putative [Talaromyces stipitatus ATCC 10500] >gb|EED15409.1| citrate synthase, 42% XP_002485362.1 putative [Talaromyces stipitatus ATCC 10500] conserved hypothetical protein [Aspergillus terreus NIH2624] >gb|EAU32144.1| conserved 68% XP_001216503.1 hypothetical protein [Aspergillus terreus NIH2624] Citrate synthase [Penicillium digitatum PHI26] >gb|EKV21626.1| Citrate synthase [Penicillium 61% EKV06554.1 digitatum Pd1] citrate synthase [Colletotrichum graminicola M1.001] 39% EFQ27732.1 citrate synthase [Auricularia delicata TFB-10046 SS5] >gb|EJD44900.1| citrate synthase 39% XP_007347043.1 [Auricularia delicata TFB-10046 SS5] citrate synthase [Aspergillus oryzae RIB40] >dbj|BAE66072.1| unnamed protein product 38% XP_001827205.1 [Aspergillus oryzae RIB40] citrate synthase [Aspergillus oryzae 3.042] 38% EIT75413.1 citrate synthase [Aspergillus kawachii IFO 4308] 38% GAA88109.1 uncharacterized protein LOC100274406 [Zea mays] >gb|ACF87962.1| unknown [Zea mays] 38% NP_001142237.1 citrate synthase [Aspergillus niger CBS 513.88] An08g10920= citB 37% XP_001393195.2 unnamed protein product [Aspergillus niger] An08g10920= citB 37% CAK45764.1 citrate synthase [Aspergillus niger ATCC 1015] 37% EHA18674.1 citrate synthase, putative [Talaromyces marneffei ATCC 18224] >gb|EEA22511.1| citrate synthase, 38% XP_002148678.1 putative [Talaromyces marneffei ATCC 18224] citrate synthase, putative [Aspergillus flavus NRRL3357] >gb|EED45512.1| citrate synthase, 37% XP_002384448.1 putative [Aspergillus flavus NRRL3357] putative citrate synthase protein [Eutypa lata UCREL1] 38% EMR66249.1 putative citrate synthase protein [Neofusicoccum parvum UCRNP2] 36% EOD45286.1 putative citrate synthase protein [Eutypa lata UCREL1] 36% EMR70107.1 unnamed protein product [Aspergillus niger] >gb|EHA26823.1| citrate synthase [Aspergillus niger 36% CAK37177.1 ATCC 1015] citrate synthase [Aspergillus kawachii IFO 4308] 35% GAA82055.1 citrate synthase [Aspergillus niger CBS 513.88] An01g09940 36% XP_001389414.2

[0063] All of these proteins, and orthologs and homologs as defined, are deemed to be encompassed in the term "citB protein" or "citB enzyme" as used herein.

[0064] It is further contemplated that overexpression of the gene in a heterologous organism, which in nature does not or hardly produce extramitochondrial citric acid, is able to provide such an organism with a functional pathway for expression of citric acid outside the mitochondrion, and preferably in the cytoplasm. Preferably such overexpression is accomplished in filamentous fungi, yeasts and/or bacteria, such as, but not limited to, Aspergillus sp., such as the fungi A. terreus, A. itaconicus, A. oryzae and A niger, Ustilago zeae, Ustilago maydis, Ustilago sp., Candida sp., Mortierella sp., Yarrowia sp., Rgizopus sp. Yarrowia lipolytica, Rhodotorula sp. and Pseudozyma Antarctica, the bacterium E.coli and the yeast Saccharomyces sp, e.g. S. cerevisiae, Pichia sp, e.g. P. pastoris or P. anomala. Also plant cells and algal cells and cell cultures may be used as host. Especially preferred are heterologous organisms in which the substrate oxaloacetate is abundantly available in the host organism. Also applicable in the present invention are hosts that may grow anaerobically while using NO.sub.3 als source of nitrogen, such as the yeasts P. anomala and Dekkera bruxellensis. In such a case the acceptor nitrate can yield reductive compounds in the same was as oxygen produces reductive compounds in aerobic fermentation. Similarly also Aspergillus species, such as A. terreus can grow at very low oxygen levels using dissimilatory nitrate reduction (Stief, P., Fuchs-Ocklenburg, S., Kamp, A., Manohar, C.-S., Houbraken, J., Boekhout, T., De Beer, D., Stoeck, T.Dissimilatory nitrate reduction by Aspergillus terreus isolated from the seasonal oxygen minimum zone in the Arabian Sea(2014) BMC Microbiology, 14 (1), art. no. 35) allowing the production of organic acids as described in the present invention under these conditions.

[0065] Further preferred are host organisms which next to the heterologous citB enzyme further contain enzymes that specifically metabolize citric acid further. One of the pathways which is very suitable for this is the pathway to form itaconic acid, wherein from citric acid cis-aconitate is formed by the enzyme aconitase or the enzyme (2-methyl)citrate dehydratase, which enzymes are considered to be functional in the cytosol (see FIG. 1). The production of itaconic acid the can be achieved by the enzyme CAD, which provides cis-aconitic acid decarboxylase activity, thereby converting cis-aconitate into itaconic acid. An advantageous method of producing itaconic acid, the enzymes used therein and the sequences thereof and/or hosts for performing this metabolic pathway have been described in WO 2009/014437. Further optimisation of the present invention in the aspect of the invention dealing with the production of itaconic acid can be achieved by modulating the activity of the regulator protein that comprises a zinc finger and a fungal specific transcription factor domain as can be found on the gene cluster that also comprises ATEG_09970, wherein this regulator protein is indicated as ATEG_09969.1 Further, overexpression of a nucleic acid sequence encoding an itaconate transporting Major Facilitator Superfamily Transporter (MFST) gene sequence (hereinafter "the itaconate transporter") enhances the production/transport of itaconate as described herein as described in WO 2009/104958 and WO 2009/110796. Also the sequences of these enzymes may be found in these references. Preferably said nucleic acid comprises the ATEG_09972.1 sequence of Aspergillus terreus or a nucleic acid that shares more than about 70%, preferably more than about 80%, preferably more than about 90% sequence identity with the sequence of ATEG_09972.1. This process can be even further optimised by combining the overexpression of a CAD gene as described in WO 2009/014437, with overexpression of di/tricarboxylate transporters, capable of transporting, among others, cis-aconitate, citrate or isocitrate from the mitochondrion to the cytosol, preferably the gene encoded by the nucleic acid sequence of ATEG_09970.1. Overexpression of this transporter will lead to an increase in cis-aconitate in the cytosol, which can be further converted to itaconic acid (see also WO 2009/104958).

[0066] Accordingly, the combination of an heterologous citB gene and a gene selected from the group of di/tricarboxylate transporters is not only advantageous for the production of itaconate, but it may also cause an increase in the expression of other citrate derivatives as discussed above.

[0067] Of course, ideally, combinations of citB with one or more and preferably all of the genes that have been specified above as enhancing the production of itaconic acid maybe applied to act in concert to boost the production and transport of itaconic acid and/or its derivatives.

[0068] Recombinant host cells can be obtained using methods known in the art for providing cells with recombinant nucleic acids. These include transformation, transconjugation, transfection or electroporation of a host cell with a suitable plasmid (also referred to as vector) comprising the nucleic acid construct of interest operationally coupled to a promoter sequence to drive expression. Host cells of the invention are preferably transformed with a nucleic acid construct as further defined below and may comprise a single but preferably comprises multiple copies of the nucleic acid construct. The nucleic acid construct may be maintained episomally and thus comprise a sequence for autonomous replication, such as an ARS sequence. Suitable episomal nucleic acid constructs may e.g. be based on the yeast 2.mu. or pKD1 (Fleer et al., 1991, Biotechnology 9: 968-975) plasmids. Preferably, however, the nucleic acid construct is integrated in one or more copies into the genome of the host cell. Integration into the host cell's genome may occur at random by illegitimate recombination but preferably the nucleic acid construct is integrated into the host cell's genome by homologous recombination as is well known in the art of fungal molecular genetics (see e.g. WO 90/14423, EP-A-0 481 008, EP-A-0 635 574 and U.S. Pat. No. 6,265,186).

[0069] Transformation of host cells with the nucleic acid constructs of the invention and additional genetic modification of the fungal host cells of the invention as described above may be carried out by methods well known in the art. Such methods are e.g. known from standard handbooks, such as Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, or F. Ausubel et al, eds., "Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York (1987). Methods for transformation and genetic modification of fungal host cells are known from e.g. EP-A-0 635 574, WO 98/46772, WO 99/60102 and WO 00/37671.

[0070] In another aspect the invention relates to a nucleic acid construct comprising a nucleotide sequence encoding a CitB enzyme or homolog or ortholog thereof as defined above and used for transformation of a host cell as defined above. In the nucleic acid construct, the nucleotide sequence encoding the CitB protein preferably is operably linked to a promoter for control and initiation of transcription of the nucleotide sequence in a host cell as defined below. The promoter preferably is capable of causing sufficient expression of the CitB enzyme in the host cell. Promoters useful in the nucleic acid constructs of the invention include the promoter that in nature provides for expression of the CitB gene. Further, both constitutive and inducible natural promoters as well as engineered promoters can be used. Promoters suitable to drive expression of the CitB gene in the hosts of the invention include e.g. GALT, GAL10, or GAL 1, CYC1, HIS3, PGL, PH05, ADC1 , TRP1 , URA3, LEU2, ENO, TPI, and A0X1. Other suitable promoters include PDC, GPD1, PGK1, TEF, TDH, promoters from glycolytic genes (e.g. from a glyceraldehyde-3-phosphate dehydrogenase gene), ribosomal protein encoding gene promoters, alcohol dehydrogenase promoters (ADH1, ADH4, and the like), promoters from genes encoding amylo- or cellulolytic enzymes (glucoamylase, TAKA-amylase and cellobiohydrolase). Other promoters, both constitutive and inducible and enhancers or upstream activating sequences will be known to those of skill in the art. The promoters used in the nucleic acid constructs of the present invention may be modified, if desired, to affect their control characteristics. Preferably, the promoter used in the nucleic acid construct for expression of the CitB gene is homologous to the host cell in which the CitB protein is expressed.

[0071] In the nucleic acid construct, the 3'-end of the nucleotide acid sequence encoding the CitB enzyme preferably is operably linked to a transcription terminator sequence. Preferably the terminator sequence is operable in a host cell of choice. In any case the choice of the terminator is not critical; it may e.g. be from any fungal gene, although terminators may sometimes work if from a non-fungal, eukaryotic, gene. The transcription termination sequence further preferably comprises a polyadenylation signal.

[0072] Optionally, a selectable marker may be present in the nucleic acid construct. As used herein, the term "marker" refers to a gene encoding a trait or a phenotype which permits the selection of, or the screening for, a host cell containing the marker. A variety of selectable marker genes are available for use in the transformation of fungi. Suitable markers include auxotrophic marker genes involved in amino acid or nucleotide metabolism, such as e.g. genes encoding ornithine-transcarbamylases (argB), orotidine-5'-decaboxylases (pyrG, URA3) or glutamine-amido-transferase indoleglycerol-phosphate-synthase phosphoribosyl-anthranilate isomerases (trpC), or involved in carbon or nitrogen metabolism, such e.g. niaD or facA, and antibiotic resistance markers such as genes providing resistance against phleomycin, bleomycin or neomycin (G418). Preferably, bidirectional selection markers are used for which both a positive and a negative genetic selection is possible. Examples of such bidirectional markers are the pyrG (URA3), facA and amdS genes. Due to their bidirectionality these markers can be deleted from transformed filamentous fungus while leaving the introduced recombinant DNA molecule in place, in order to obtain fungi that do not contain selectable markers. This essence of this MARKER GENE FREE.TM. transformation technology is disclosed in EP-A-0 635 574, which is herein incorporated by reference. Of these selectable markers the use of dominant and bidirectional selectable markers such as acetamidase genes like the amdS genes of A. nidulans, A. niger and P. chrysogenum is most preferred. In addition to their bidirectionality these markers provide the advantage that they are dominant selectable markers that, the use of which does not require mutant (auxotrophic) strains, but which can be used directly in wild type strains.

[0073] Optional further elements that may be present in the nucleic acid constructs of the invention include, but are not limited to, one or more leader sequences, enhancers, integration factors, and/or reporter genes, intron sequences, centromers, telomers and/or matrix attachment (MAR) sequences. The nucleic acid constructs of the invention may further comprise a sequence for autonomous replication, such as an ARS sequence. Suitable episomal nucleic acid constructs may e.g. be based on the yeast 2.mu. or pKD1 (Fleer et al., 1991, Biotechnology 9: 968-975) plasmids. Alternatively the nucleic acid construct may comprise sequences for integration, preferably by homologous recombination (see e.g. WO98/46772). Such sequences may thus be sequences homologous to the target site for integration in the host cell's genome. The nucleic acid constructs of the invention can be provided in a manner known per se, which generally involves techniques such as restricting and linking nucleic acids/nucleic acid sequences, for which reference is made to the standard handbooks, such as Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, or F. Ausubel et al, eds., "Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York (1987).

[0074] In a further aspect the invention relates to fermentation processes in which the transformed host cells of the invention are used for the production of citric acid and products that can be derived from further metabolic routes from citric acid. Such a fermentation process may be an aerobic fermentation process, but since the location of the enzyme is outside the mitochondrion advantageously an oxygen-limited or anaerobic fermentation process may be applied. This enables a lot of possible circumstances or conditions under which production of the citric acid can still occur. In particular circumstances with an inactive TCA cycle which are normally believed to be incompatible with citric acid production. In particular various yeast species are able to grow anaerobically by fermentation. For pertaining a suitable cofactor balance in particular yeast strains able to use NO.sub.3 such as Dekkera bruxellensis and Pichia anomola are preferred. The fermentation process may either be a submerged or a solid state fermentation process.

[0075] In a solid state fermentation process (sometimes referred to as semi-solid state fermentation) the transformed host cells are fermenting on a solid medium that provides anchorage points for the fungus in the absence of any freely flowing substance. The amount of water in the solid medium can be any amount of water. For example, the solid medium could be almost dry, or it could be slushy. A person skilled in the art knows that the terms "solid state fermentation" and "semi-solid state fermentation" are interchangeable. A wide variety of solid state fermentation devices have previously been described (for review see, Larroche et al., "Special Transformation Processes Using Fungal Spores and Immobilized Cells", Adv. Biochem. Eng. Biotech., (1997), Vol 55, pp. 179; Roussos et al., "Zymotis: A large Scale Solid State Fermenter", Applied Biochemistry and Biotechnology, (1993), Vol. 42, pp. 37-52; Smits et al., "Solid-State Fermentation-A Mini Review, 1998), Agro-Food-Industry Hi-Tech, March/April, pp. 29-36). These devices fall within two categories, those categories being static systems and agitated systems. In static systems, the solid media is stationary throughout the fermentation process. Examples of static systems used for solid state fermentation include flasks, petri dishes, trays, fixed bed columns, and ovens. Agitated systems provide a means for mixing the solid media during the fermentation process. One example of an agitated system is a rotating drum (Larroche et al., supra). In a submerged fermentation process on the other hand, the transformed fungal host cells are fermenting while being submerged in a liquid medium, usually in a stirred tank fermenter as are well known in the art, although also other types of fermenters such as e.g. airlift-type fermenters may also be applied (see e.g. U.S. Pat. No. 6,746,862).

[0076] Preferred in the invention is a submerged fermentation process, which is performed in batch or fed-batch . This means that there is a continuous input of feed containing a carbon source and/or other relevant nutrients in order to improve citric acid yields. The input of the feed can, for example, be at a constant rate or when the concentration of a specific substrate or fermentation parameter falls below some set point.

[0077] There are also fermentation processes where a fungus grows on a solid support in an aqueous phase in so-called biofilm processes. In those conditions there will be an oxygen limitation meaning that the metabolism in such a case at least partially will be anaerobically. Biofilms have been used for a long time in water treatment facilities where they were called slime, mats or sludge, but no other practical use was seen until recently. This has brought that most of the available information is on bacterial and, in recent years, on yeast biofilms. Filamentous fungi are naturally adapted to growth on surfaces and in these conditions they show a particular physiological behaviour which it is different to that in a submerged culture; thus, they can be considered as biofilm forming organisms according to the above concept. Differential physiological behaviour of most attached fungi corresponds principally to a higher production and secretion of enzymes and also to a morphological differentiation which is absent in submerged cultures (Akao, T. et al.,Curr. Genet. 41:275-281, 2002; Biesebeke, R. et al., FEMS Yeast Res. 2:245-248, 2002). The advantages of this form of growth have been industrially exploited by two culture systems: SSF and cell immobilization (Gutierrez-Correa, M. and Villena, G., Rev. peru. Boil. 10(2):113-124, 2003). Once citric acid is produced in the host cell this citric acid can be used as a substrate for further metabolic processes. One of these metabolic processes is the production of itaconic acid. For this a conversion from citric acid via cis-aconitate to itaconic acid has to be performed via the enzymes aconitase and CAD (cis-aconitate decarboxylase). Such a conversion and further methods of additionally increasing the production of itaconic acid from cis-aconitate has been described in WO 2009/014437, WO 2009/104958 and WO 2009/110796.

[0078] Next to a pathway to itaconic acid, citric acid can also be used as a starting point for other metabolic routes. One of the most commercially interesting routes is the production of methacrylic acid. Methacrylic acid can be produced directly by decarboxylation of itaconic acid, but it can also be produced through other metabolic routes (see Carlsson, M. et al., Ind. Eng. Chem. Res. 33:1989-1996, 1994). Citric acid is also one of the basic building blocks in the biosynthesis of fatty acids and triglycerides. Fatty acids form important storage molecules for energy, which energy later can be used, e.g. when fatty acids have been used as a source of biodiesel. The exact nature of the fatty acid is--for use as biofuel--less relevant, since all types of plant fatty acids may be used as such. Fatty acids can, of course, also be used as such, e.g. as food additives. This is especially important in the case of the essential fatty acids, like linoleic acid and a-linolenic acid. for the production of other compounds, such as biodegradable plastics.

[0079] Further, citric acid can be used to be a starting point for the biosynthesis of lysine (via homocitrate and homo-cis-aconitate). FIG. 2 gives an overview of the chemical reactions and pathways that can be used to convert citrate into lysine.

[0080] This pathway is also required for the biosynthetic production of aminoadipate which is an intermediate for penicillin and other antibiotic compounds. Lysine, in turn, may be used as a starting point for the production of caprolactam (see US 2009/005532, and from there be used for the production of plastics (such as nylon-6, a polyamide).

[0081] Further, citrate can also be used as a precursor for the mevalonate pathway (see FIG. 4). This can lead to the production of terpenoids. Lastly, citrate (and acetyl CoA) may function as precursor for a polyketide pathway, resembling fatty acid biosynthesis. Polyketide antibiotics, antifungals, cytostatics, anticholesteremic, antiparasitics, coccidiostats, animal growth promoters and natural insecticides that may be produced following such a pathway are commercially important compounds.

[0082] It has further been found that the cluster in which the citB gene is residing contains other genes that have a relation with the pathways in which citrate is involved. In the citB (An08g10920) cluster that is present in a particular A. niger strain the following genes can be found: An08g10860 (fatty acid synthase) An08g10870 (2-methylcitrate dehydratase (prpD)),); An08g10880 (GAL4; GAL4-like Zn2Cys6 binuclear), An08g10930 (3-oxoacyl-[acyl-carrier-protein] synthase, fatty acid synthase); An08g10970 (MFS multidrug transporter); An08g10980 (transcription factor acetate regulatory DNA binding protein facB). . (Over)expression of any of these genes, next to the expression of citB is thought to be especially favorable to increase the production and usurpation of intracellular citrate.

EXAMPLES

Example 1

Enzyme Analysis in Itaconic Acid Producing Strain

[0083] The table 2 below gives an overview of proteins/genes in Aspergillus niger and S. cerevisiae belonging to the enzyme classes citrate synthase, aconitase and cis-aconitase decarboxylase. For all members in A. niger the results of expression analysis is given by RNA sequencing results in the WT strain and an itaconic acid producing strain (transgenic for CAD by carrying extra gene copies of the cis-aconitate decarboxylase from A. terreus as described in WO 2009/014437). This shows that An08g10920, tentatively called citB, encoding a citrate synthase without a predicted mitochondrial localization, is highly induced in the itaconic acid production strain. This gene has no homologue in S. cerevisiae. Only in closely related black Aspergilli homologues are present (see below under genome mining citB gene cluster). Also one of the predicted cytosolic cis-aconitase decarboxylase (prpD) genes from A. niger, An08g10870 which is clustered with citB is highly induced. Also the canonical cytosolic aconitase An08g10530 more distantly linked is induced in the CAD strain.

[0084] In S. cerevisiae all three citrate synthase proteins and the single prpD gene are mitochondrial, while both aconitases are cytosolic as predicted for the common metabolic pathways.

TABLE-US-00002 TABLE 2 Citrate synthase, aconitase and cis-aconitate decarboxylase (prpD) genes in A. niger. In bold the genes induced in the CAD-expressing strain. BG = expression values are at background levels, thus calculation of ratio value (R; expressed as 2LogR) is not relevant. Subcell. Loc. RNAseq results Gene_ID Protein WolfPsort CAD WT 2LogR An09g06680/ANI_1_876084 citrate synthase citA mito: 19.0 9501 8977 -0.02 An15g01920/ANI_1_1226134 citrate synthase mito: 22.0 345 616 -0.87 An09g03570 citrate synthase unknown 0 4 BG An08g10920/ANI.sub.--1.sub.--1474074 citrate synthase citB cyto: 10.0 9515 917 3.34 An01g09940/ANI_1_2950014 citrate synthase cysk: 11, cyto: 8 11 62 BG An02g11040/ANI_1_3018024 aconitase mito: 20.5 0 0 BG An08g10530/ANI.sub.--1.sub.--1410074 aconitase cyto: 19.0 11203 5897 0.89 An09g03870/ANI_1_470084 aconitase mito: 26.5 571 1254 -1.17 An16g05760/ANI_1_1808144 aconitase mito: 24.0 22 16 BG An05g02230/ANI.sub.--1.sub.--578044 aconitase cyto: 12.5 234 89 1.36 An01g09950/ANI_1_2952014 prpD cyto: 13.0 50 59 BG An09g06220/ANI_1_1536084 prpD cyto: 12.5 67 318 -2.28 An15g01780/ANI_1_306134 prpD cyto: 13.5 1565 1632 -0.1 An08g10870/ANI.sub.--1.sub.--2490074 prpD cyto: 16.5 6099 570 3.38 An02g14730/ANI_1_3352024 prpD cyto: 13.5 48 47 BG An01g09930/ANI_1_29480 prpD mito: 10.0 12 45 BG

[0085] From this Table it appears that two of the A. niger proteins are clearly located in the mitochondrion (An09g09980 and An15g01920), while two A. niger genes are located outside the mitochondrion (An01g09940 and An08g10920), while the location of one protein is undecided (An09g03570).

[0086] In a homology tree (see FIG. 10) it appears that a distinction can also be made between mitochondrial and non-mitochondrial citrate synthase enzymes on basis of homology.

Example 2

RNA Sequence Analysis of A. niger CAD Transformant in Comparison to the Wildtype Strain

[0087] RNAseq is a new transcriptomics platform which allows direct sequencing of mRNAs. This means that no arrays are required and all expressed RNA is measured (non-coding, non annotated). Shake flask cultures in fermentation medium described below were grown for 46 hours at 33.degree. C. from which biomass samples were harvested. Total RNA was isolated from biomass samples using Trizol (Invitrogen). The total RNA was send to BaseClear (The Netherlands). Before random mRNA sequencing could be performed, mRNA purification was performed via oligo-dT beads (Illumina TruSeq RNA samp.prep), followed by first-strand cDNA synthesis with random primers. Adaptor ligation, adding 120 bp, was carried out, followed by .about.270 bp gel-isolation (cDNA inserts .about.150 bp). Subsequently, paired-end sequencing was performed, resulting in Illumina HiSeq data (28-29 M reads/sample). Data analysis was performed to obtain output files of RNA-Seq alignments (*.clc, *,sam) and RNA-Seq expression tables (*.csv, *.clc, *.xlsx). Sample-normalised expression values were expressed as RKPM/sample (=Reads per Kilobase of exon model per Million mapped reads (Mortazavi et. al 2008)). The data analysis performed at TNO comprised of defining the "Floor" of RPKM values (Excel) (S<1 was defined as S=1). After introducing the "Floor" the differentials of the expression values of the CAD transformant and wildtype were calculated in Excel (R=Sx/Sref; 2logR ratios). Below table 2 provides the RNAseq data (counts and 2logR ratios) of the genes directly surrounding the citrate synthase genes which might belong to the putative citrate synthase/prpD gene clusters. AB1.13 data refer to the WT A. niger host strain, while AB1.13CAD refer to the itaconic acid producing strain (CAD) carrying extra gene copies of the cis-aconitate decarboxylase from A. terreus as described in WO 2009/014437. Note that RNAseq values lower than 100-200 represent very low expression. Of the related genes/gene cxlusters only the citB cluster (An08g10860-An08g1011030, in bold and italics) shows significantly induced expression in the AB1.13CAD strain (Table 3) The other gene regions containing citrate synthase, aconitase and cis-aconitate decarboxylase genes (underlined) show no induction (Table 3).

TABLE-US-00003 TABLE 3 RNAseq analysis value value AB1.13CAD AB1.13 value gene name (Sx) (Sref) 2log CBS 513.88 ATCC 1015 count count (Sx/Sref) code code Protein 60113 12 12.26 -- -- ATEG_09971_A. terreus cad gene 0 0 0.00 An08g10760 ANI_1_2472074 hypothetical protein 574 1409 -1.33 An08g10780 ANI_1_2476074 glycosyl hydrolase family 43 protein 0 3 0.00 An08g10800 ANI_1_2480074 L-amino acid oxidase LaoA 26 34 -0.42 An08g10810 ANI_1_2482074 appr-1-p processing enzyme family protein 126 146 -0.25 An08g10820 ANI_1_2484074 aldehyde dehydrogenase 19 135 -2.86 An08g10830 ANI_1_2486074 geranylgeranyl pyrophosphate synthase -- 287 408 -0.54 An08g11040 ANI_1_1488074 zinc finger protein ZPR1 157 330 -1.11 An08g11060 ANI_1_2506074 hypothetical protein 6 11 0.00 An08g11070 ANI_1_2508074 extracellular invertase 1386 1163 0.22 An01g09730 ANI_1_2924014 choline transport protein 2 1 0.00 An01g09740 ANI_1_2926014 3-hydroxyacyl-CoA dehyrogenase 1 7 0.00 An01g09750 ANI_1_1318014 cytochrome B5 31 30 0.01 An01g09760 ANI_1_1320014 cytochrome P450 monooxygenase 37 55 -0.61 An01g09770 ANI_1_2928014 Zn(II)2Cys6 transcription factor ANI_1_2930014 calcium/calmodulin dependent protein kinase 434 1331 -1.65 An01g09780 ANI_1_2932014 D-lactate dehydrogenase 356 597 -0.78 An01g09800 ANI_1_1328014 acylamide-delta3(E)-desaturase 342 226 0.56 An01g09810 ANI_1_2934014 glycosyl transferase 595 313 0.89 An01g09820 ANI_1_2936014 udp-glucose 6-dehydrogenase 267 304 -0.22 An01g09830 ANI_1_1332014 glutathione S-transferase 634 677 -0.13 An01g09840 ANI_1_1334014 NADH: ubiquinone oxidoreductase 6.6 kD subunit 90 84 0.06 An01g09850 ANI_1_2938014 sin3-associated polypeptide Sap18 155 137 0.14 An01g09860 ANI_1_1338014 mRNA splicing factor (Prp18) 0 1 0.00 An01g09870 ANI_1_2940014 hypothetical protein 303 168 0.82 An01g09880 ANI_1_2942014 hypothetical protein 248 182 0.41 An01g09890 ANI_1_1344014 ADP-ribosylation factor family protein 63 73 -0.25 An01g09900 ANI_1_2944014 hypothetical protein 236 215 0.10 An01g09910 ANI_1_2946014 phosphatidylinositol N-acetylglucosaminyl- transferase gpi3 subunit 169 138 0.26 An01g09920 ANI_1_1350014 ATP-dependent RNA helicase dbp6 12 45 -1.94 An01g09930 ANI.sub.--1.sub.--2948014 2-methylcitrate dehydratase (prpD) 11 62 -2.53 An01g09940 ANI.sub.--1.sub.--2950014 citrate synthase 50 59 -0.27 An01g09950 ANI.sub.--1.sub.--2952014 immune-responsive protein (prpD) 11 18 -0.01 An01g09960 ANI_1_1358014 exo-1,4-beta-xylosidase xlnD 12 62 -2.40 An01g09970 ANI_1_2954014 hypothetical protein 7 57 -3.06 An01g09980 ANI_1_1362014 Asp-hemolysin 1106 845 0.35 An01g10000 ANI_1_2956014 ABC multidrug transporter 123 359 -1.58 An01g10010 ANI_1_2958014 cystathionine gamma-synthase 1237 3533 -1.55 An01g10030 ANI_1_1368014 sphinganine hydroxylase BasA 4824 4664 0.01 An01g10050 ANI_1_1370014 hypothetical protein 229 170 0.39 An01g10060 ANI.sub.--1.sub.--2962014 Zn(II)2Cys6 transcription factor 94 109 -0.25 An01g10070 ANI_1_1374014 signal recognition particle protein 3 6 0.00 An15g01770 ANI_1_1208134 C-5 cytosine methyltransferase DmtA 1565 1632 -0.10 An15g01780 ANI.sub.--1.sub.--306134 2-methylcitrate dehydratase (prpD) 0 7 0.00 An15g01790 ANI_1_1210134 pantothenate transporter 5 12 -0.41 An15g01800 ANI_1_1212134 amidohydrolase 144 86 0.71 An15g01810 ANI.sub.--1.sub.--1214134 C6 zinc finger domain protein 19 18 0.00 An15g01830 ANI_1_1216134 sodium transport ATPase 5 222 186 0.22 An15g01840 ANI_1_1218134 short-chain dehydrogenase/reductase family 398 460 -0.24 An15g01850 ANI_1_318134 glutamine synthetase 455 1272 -1.52 An15g01860 ANI_1_320134 malate synthase, glyoxysomal 19 14 0.41 An15g01870 ANI_1_1220134 hypothetical protein 1 0 0.00 An15g01880 ANI_1_1222134 hypothetical protein 1283 808 0.63 An15g01890 ANI_1_1224134 beta-glucosidase E 51 117 -1.23 An15g01900 ANI_1_326134 choline transport protein 1392 1000 0.44 An15g01910 ANI_1_328134 [NU+] prion formation protein 1 345 616 -0.87 An15g01920 ANI.sub.--1.sub.--1226134 citrate synthase 2 65 -2.57 An15g01930 ANI_1_1228134 hypothetical protein 68 75 -0.18 An15g01940 ANI_1_1230134 FAD binding domain protein 50 31 0.65 An15g01950 ANI_1_1232134 very-long-chain acyl-CoA synthetase family protein (CefD1) 174 250 -0.56 An15g01960 ANI_1_1234134 sarcosine oxidase 236 357 -0.63 An15g01970 ANI_1_340134 hypothetical protein 116 153 -0.43 An15g01980 ANI_1_342134 8-amino-7-oxononanoate synthase 461 509 -0.18 An15g01990 ANI_1_344134 onanonoxo-7-onima-8-eninoihtemlysoneda 1537 1798 -0.26 An15g02000 ANI_1_1238134 biotin synthase 0 4 0.00 An09g03570 -- similarity to citrate synthase citA 67 318 -2.28 An09g06220 ANI.sub.--1.sub.--1536084 immune-responsive protein (prpD) 295 853 -1.57 An09g06460 ANI_1_842084 hypothetical protein 2156 2686 -0.35 An09g06480 ANI_1_844084 phosphatidylinositol transfer protein sfh5 756 652 0.18 An09g06490 ANI_1_846084 lanosterol synthase 328 574 -0.84 An09g06500 ANI_1_1562084 SGT1 and CS domain protein 151 210 -0.51 An09g06510 ANI_1_1564084 PQ loop repeat protein 287 286 -0.03 An09g06520 ANI_1_852084 sir2 family transcriptional regulator 657 500 0.36 An09g06530 ANI_1_1566084 negative regulator of the PHO system 48 70 -0.58 An09g06540 ANI_1_856084 spindle pole protein Nnf1 344 278 0.27 An09g06550 ANI_1_858084 hypothetical protein 1482 877 0.72 An09g06570 ANI_1_862084 hypothetical protein 403 513 -0.38 An09g06580 ANI_1_864084 NTF2 and RRM domain protein 10266 15839 -0.66 An09g06590 ANI_1_860084 heat shock protein 90 594 1492 -1.36 An09g06610 ANI_1_866084 hypothetical protein 1424 1100 0.34 An09g06630 ANI_1_868084 HLH transcription factor (PalcA) 289 325 -0.20 An09g06640 ANI_1_870084 DNA-directed RNA polymerase III subunit RPC-3 3021 3534 -0.26 An09g06650 ANI_1_872084 ubiquinol-cytochrome C reductase complex core protein 2 2866 3756 -0.43 An09g06670 ANI_1_874084 DNA replication protein YHM2 9051 8977 -0.02 An09g06680 ANI.sub.--1.sub.--876084 citrate synthase citA 833 715 0.19 An09g06700 ANI_1_878084 RNA binding protein Nrd1 345 1089 -1.69 An09g06710 ANI_1_1568084 O-acetylhomoserine (thiol)-lyase 187 463 -1.34 An09g06720 ANI_1_1568084 hypothetical protein 283 3532 -3.68 An09g06730 ANI_1_882084 arginine permease 609 607 -0.03 An09g06740 ANI_1_886084 AMP-binding enzyme 460 470 -0.07 An09g06750 ANI_1_1570084 hypothetical protein 1035 698 0.53 An09g06760 ANI_1_1572084 WW domain protein 288 315 -0.16 An09g06770 ANI_1_1574084 WD repeat protein 391 624 -0.71 An09g06780 ANI_1_894084 peroxisomal membrane protein Pmp47 3632 3045 0.22 An09g06790 ANI_1_896084 GTP-binding protein ypt1 751 1026 -0.49 An09g06800 ANI_1_898084 aminopeptidase 375 296 0.31 An09g06810 ANI_1_1576084 TFIIH basal transcription factor complex p47 subunit 290 214 0.40 An09g06820 ANI_1_902084 hypothetical protein 6 7 0.00 An09g06830 ANI_1_1578084 pumilio-family RNA binding repeat protein 1396 963 0.50 An09g06840 ANI_1_906084 hypothetical protein 3021 2861 0.04 An09g06850 ANI_1_908084 NADH-ubiquinone oxidoreductase subunit 255 244 0.03 An09g06860 ANI_1_1580084 hypothetical protein 964 796 0.24 An09g06870 ANI_1_1582084 cytokinesis regulator (Byr4) 2 11 -1.76 An09g06890 ANI_1_1584084 hypothetical protein

Example 3

Isolation of RNA from Fermentation Samples and Shake Flask Samples

[0088] A. niger strains were cultured under different fermentation conditions (see table 4). Five-Liter controlled batch fermentations were performed in New Brunswick Scientific Bioflow 3000 fermentors.

[0089] The following conditions were used unless stated otherwise:

[0090] Temp. 37.degree. C.

[0091] pH start 3.5 set point 2.3

[0092] DO set points Day 1: 75%

[0093] Day 2,3,4: 50%

[0094] Subsequent days: 25% [0095] Preculture: 100 ml of the same medium as used in the fermentation medium (10.sup.7 spores/ml) in 500 ml baffeled Erlenmeyer flasks, overnight, 37 .degree. C., 150 rpm. [0096] pH control: 4M KOH (Base), 1.5M H.sub.3PO.sub.4 (Acid) [0097] Antifoam: Struktol (Schill & Seilacher) [0098] Fermentation medium compositions: [0099] Per litre: 2.36 g of NH.sub.4SO.sub.4, 0.11 g of KH.sub.2PO.sub.4, 2.08 g of MgSO.sub.4*7H.sub.2O, 0.13 g of CaCl.sub.2*2H.sub.2O, 0.074 of NaCl, 0.2 mg of CuSO.sub.4*5H.sub.2O, 5.5 mg of Fe(III)SO.sub.4*7H.sub.2O, 0.7 mg of MnCl.sub.2*4H.sub.2O and 1.3 mg of ZnSO.sub.4*7H.sub.2O and 100 g of glucose as a carbon source.

[0100] All media were prepared in demineralized water.

TABLE-US-00004 TABLE 4 fermentation conditions of A. niger strains Biomass sample Strain medium fermentation condition glucose biomass ita/DWT 1 2010 exp2 N201 M12 100-25% DO, pH start 60.0 12,460 -- F12 T3 3.5 control 2.3 (70 h) 2 2011 exp2 N201 CAD02 M12 + Cu 100-25% DO, pH start 204 16,930 0.052 F8 T6 3.5 control 2.3 (88.5 h) 3 2011 exp2 N201 CAD02 M12 + Cu 25% DO, pH start 3.5 204 17,970 0.101 F9 T6 control 2.3 (88.5 h) 4 2011 exp4 N201 CAD02 M12 + Cu 10% DO, pH start 3.5 201 20,790 0.102 F9 T2 control 2.3 (27 h) 5 2011 exp7 N201 CAD02 M12 + Cu 15% DO, pH start 3.5 213 18,670 0.100 F8 T5 control 2.3 (68 h) 6 2011 exp4 N201 CAD02 M12 + Cu 20% DO, pH start 3.5 201 18,250 0.137 F8 T2 control 2.3 (27 h) 7 2010 exp2 AB1.13 wt M12 100-25% DO, pH start 60.0 11,600 -- F11 T3 pyr+ (Cora) 3.5 control 2.3 (70 h) 8 2010 exp2 AB1.13 M12 100-25% DO, pH start 60.0 8,880 -- F13 T3 .DELTA.oahA#76 3.5 control 2.3 (70 h) 9 2011 exp2 AB1.13 M12 + Cu 100-25% DO, pH start 204 15,070 0.110 F10 T6 .DELTA.oahA#76 3.5 control 2.3 (88.5 h) CAD 05 10 2011 exp1 AB1.13 CAD M12 - Cu 100-25% DO, pH start 210 14,937 0.152 F8 T5 pyr+ 3.5 control 2.3 (49 h) 11 2011 exp1 AB1.13 CAD M12 100-25% DO, pH start 210 17,339 0.106 F9 T5 pyr+ 3.5 control 2.3 (49 h) 12 2011 exp1 AB1.13 CAD M12 + Cu 100-25% DO, pH start 210 27,350 0.081 F10 T5 pyr+ 3.5 control 2.3 (49 h) 13 2011 exp4 AB 1.13 M12 + Cu 10% DO, pH start 3.5 201 15,200 0.205 F10 T2 CAD+ FHB control 2.3 (27 h) 2.5 14 2011 exp7 AB1.13 M12 + Cu 20% DO, pH start 3.5 213 16,780 0.153 F10 T5 CAD+ FHB control 2.3 (68 h) 2.5 15 2011 exp6 AB 1.13 M12 + Cu 5% DO, pH start 3.5 210 12,026 0.191 F10 T3 CAD+ FHB control 2.3 (27 h) 2.5

[0101] For the shake flask cultures the fermentation medium described above was used. The cultures were grown for 46 hours at 33.degree. C. from which biomass samples were harvested.

[0102] RNA was isolated from biomass samples using Trizol from Invitrogen. Equal amounts of RNA (8 micrograms) were loaded on a RNA gel and blotted on Hybond N+ membrane from GE Healthcare.

Example 4

Northern Analysis

[0103] From the RNAseq data it was shown that several genes in a gene cluster, including the citB gene, were upregulated in the TNO-CAD strain compared to the TNO-WT strain.

[0104] To confirm the RNAseq results and to analyze different strains and different fermentation conditions, Northern analysis was carried out.

[0105] Primers were designed to amplify gene fragments by PCR of four upregulated genes from the gene cluster (citB, MFS, citR and prpD, seeTable 5) and other interesting genes (gpdA, citA, CAD). The labeling of the gene fragments was carried out using the PCR DIG Probe Synthesis Kit (Roche). Hybridization was performed using the DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche).

TABLE-US-00005 TABLE 5 Primers for Northern analysis o5886-CitA forward TGTTGTCGCCGTAGCCGAGC o5887-CitA reverse AGCTCCTCCCCAAGGCTCCC o5888-CitB forward GCGACGCGGTCCACCTCAAA o5889-CitB reverse GCACAGGACTGCCCAACCCC o5890-An08g10880 forward GCTTCGCGGCCCATACTGCT o5891-An08g10880 reverse TGAAGCTGCCAACACCCCGC o5892-An08g10870 forward GATGGACGGCCACCCACTGC o5893-An08g10870 reverse TGCGCTCCCTTCAGCAGCAC o5894-An08g10970 forward GCAAAGGGTGCCAGGCCGAT o5895-An08g10970 reverse CTGGGTGCTGGTCATCGCGG cadA forward GGTCTTAGCCGAGCAAGGC cadA reverse GCGACACTCATCTGCCCTG gpdA forward ATCGAGACCTACGAGGAGGG gpdA reverse CCGGGAGTTCCTGCGAAGG

[0106] The results of the Northern analysis of the fermentation samples are shown in the table 6 below.

TABLE-US-00006 TABLE 6 Results Northern analysis citB (RT- qPCR citA citB citB/gp (An09 (An08 dA An08 An08 An08 Strain gpdA cadA g06680) g10920) ratio) g10880 g10870 g10970 Shake flask culture AB1.13pyr+ NA NA NA NA 0.2 NA NA NA AB1.13 CAD pyr+ NA NA NA NA 5.0 NA NA NA Controlled fermentation AB1.13 CAD pyr+ +++ +++ + - 0.2-0.5 - - - AB1.13.CAD/MTT/MFS#3 NA NA NA NA 0.8 NA NA NA AB 1.13 CAD+ FHB 2,5 +++ +++ + -/+ 0.8 - - + N201 +++ - + - 0.2 - - -/+ N201 CAD02 ++++ +++ + - 1.0 - - -

[0107] From the Northern analysis it was concluded that the expression of the genes from the gene cluster showed low expression levels, or no expression was detected, or were below detection limits.

Example 5

Quantitative RT-PCR

[0108] Northern analysis revealed very low expression levels, most likely below the detection limit of the method. Therefore, quantitative RT-PCR was carried out using the Superscript III platinum One Step Quantitative RT-PCR kit (Life Technologies) to analyze the expression of the citB gene (seeTable 6). A primer-probe combination for the citB gene was designed using the software Primer Express 2.0 (Applied Biosystems). To compare the expression level of citB with a highly expressed gene, also gpdA primers were designed. For the normalization of the citB and gpdA data, also a quantitative RT-PCR was carried out using 18S primers. The quantitative PCR was performed on the 7500 Fast Real time PCR system (Applied Biosystems). The total RNA isolated from biomass of fermentation experiments, which was used in the Northern analysis, was analyzed in this method. Also the total RNA used for the RNAseq experiment was analyzed and total RNA isolated from A. niger strains grown in a new shakeflask culture experiment was analyzed. In the normalized RT-qPCR results can been seen that the citB gene is induced in certain conditions. For the samples used for RNAseq RT-qPCR confirmed the RNAseq results.

Example 6

Genome Mining citB Gene Cluster

[0109] In table 7 the results of a genome mining effort of the citB gene cluster is given.

[0110] Sequences were obtained from NCBI. Alignments were performed using BLASTX with a BLOSUM62 matrix and the default settings for BLASTX (http://www.ncbi.nlm.nih.gov/blast/b12seq/wblast2.cgi).

TABLE-US-00007 TABLE 7 Blast results of genes from the CitB genome cluster Query BLASTX best hits Gene Accession nr. Description Accession nr. Strain E value An08g10860 ang:ANI_1_2488074 sterigmatocystin GAA88112.1 Aspergillus kawachii 0 biosynthesis fatty acid XP_002149767.1 Penicillium marneffei 0 synthase subunit beta XP_002340041.1 Talaromyces stipitatus 0 XP_002384436.1 Aspergillus flavus 0 XP_001827193.1 Aspergillus oryzae 0 An08g10870 ang:ANI_1_2490074 2-methylcitrate GAA88111.1 Aspergillus kawachii 0 dehydratase XP_002384435.1 Aspergillus flavus 0 XP_001827192.1 Aspergillus oryzae 0 An08g10880 ang:ANI_1_2492074 GAL4; GAL4-like GAA88110.1 Aspergillus kawachii 0 Zn2Cys6 binuclear EDP52162.1 Aspergillus fumigatus E-127 cluster DNA-binding XP_001259243.1 Neosartorya fischeri E-124 domain; found in XP_001274697.1 Aspergillus clavatus E-122 transcription AAD34561.1 Aspergillus terreus E-50 regulators like GAL4 An08g10920 ang:ANI_1_1474074 citrate synthase NP_001142237.1 Zea mays 0 GAA88109.1 Aspergillus kawachii 0 XP_002384448.1 Aspergillus flavus E-164 XP_001827205.1 Aspergillus oryzae E-164 XP_002148678.1 Penicillium marneffei E-137 An08g10930 ang:ANI_1_2494074 3-oxoacyl-[acyl- GAA88108.1 Aspergillus kawachii 0 carrier-protein] XP_001827206.1 Aspergillus oryzae 0 synthase XP_002384449.1 Aspergillus flavus 0 EFQ31023.1 Glomerella graminicola 0 XP_002836001.1 Tuber melanosporum 0 An08g10970 ang:ANI_1_2500074 MFS multidrug GAA88107.1 Aspergillus kawachii 0 transporter EHK20962.1 Trichoderma virens E-171 EGR44089.1 Trichoderma reesei E-168 EHK50986.1 Trichoderma atroviride E-167 XP_002376688.1 Aspergillus flavus E-166 XP_001820954.1 Aspergillus oryzae E-166 An08g10980 ang:ANI_1_2502074 similarity to acetate GAA88106.1 Aspergillus kawachii 0 regulatory DNA XP_001820955.2 Aspergillus oryzae E-132 binding protein facB XP_002376689.1 Aspergillus flavus E-123 An08g10990 ang:ANI_1_1484074 dienelactone GAA88105.1 Aspergillus kawachii E-109 hydrolase family EHY59914.1 Exophiala dermatitidis E-77 protein XP_002481994.1 Talaromyces stipitatus E-64 XP_002150690.1 Penicillium marneffei E-61

[0111] It appears that the genes as depicted in NP_001142237.1, GAA88109.1, XP_002384448.1, XP_001827205.1 and XP_002148678.1 can be considered to be orthologs of the Aspergillus niger citrate synthase.

[0112] Using the search tool Sybil on the AspGD website (Broad Institute) (http://aspgd.broadinstitute.org/cgi-bin/asp2_v3/shared/show_protein_clus- ter.cgi?site=asp2_v8) orthologous clusters from multiple genomes can be depicted as shown in FIG. 3.

[0113] The citrate synthase gene (An08g10920) was further used to search for the ortholog clusters in other Aspergillus genomes. As can be seen in FIG. 3, the "black Aspergilli", A. niger (2 genomes) A. acidus, A. tubigensis and A. brasiliensis, show similar clustering of the genes surrounding the citB gene, whereas the genomic region in A. oryzae and A. flavus only contain the citB (An08g10920) ortholog and the orthologs of An08g10880 and An08g10930. For A. terreus no corresponding gene cluster was found at all.

Example 7A

Overexpression of the A. niger citB Gene in Aspergillus niger

[0114] To establish the overexpression of the citB gene in A. niger, a PCR generated copy of the gene was generated. For this purpose two sets of primers were generated as shown below. PCR amplification based on A.niger genomic DNA resulted in the isolation of PCR fragments from which the complete coding region of the citB gene could be isolated as a BsmBI-NcoI fragment.

TABLE-US-00008 Translation of citB genomic seq (1-1874) Universal code BsmBI citB-F3-ATG + BsmBI 5'-CGTCTCCCATGCCCGACATCGCATCCAAC-3'_ ' citB-F1-6 5'-ATCACTATGCCCGACATCGC-3 1 ATGCCCGACATCGCATCCAACGGTGCCCGCAACGGCGCCTCCCAGAATGCAGAGACCAAG 1 M P D I A S N G A R N G A S Q N A E T K 61 CCAGAACCCCCCGTTCTCCATGTGGTAGACAGCCGCACGGGGAAGTACTTCCCCATCCCT 21 P E P P V L H V V D S R T G K Y F P I P 121 ATCGTGCGCAACGCCATCAACGCAAGCGAATTCAAGAAACTCAAGTCCCCCGAGGATCCC 41 I V R N A I N A S E F K K L K S P E D P 181 GCACATCCTGAAGATCAGAACGAGCAGGGCATCCGGGTGTTTGACCCCGGATACTCCAAC 61 A H P E D Q N E Q G I R V F D P G Y S N 241 ACGGCTGTTAGTGAGAGCCAGGTTACCTACATgtgcgttttctctgctgcataggattga 81 T A V S E S Q V T Y I 301 tcatggcgaagagtaactgataacggggcgcagCGATGGCCTGAAGGGAACCATCCAGTA D G L K G T I Q Y 361 CCGTGGTTACAACATCGAGGATATTGTGGGCAAGAAGAAGTTTATTGACACGGCACACCT 121 R G Y N I E D I V G K K K F I D T A H L 421 GCTCATTTGGGGAGAATGGCCGACGCCGGAACAGGCCAAATCTCTGCAGGAGAAGCTCTC 141 L I W G E W P T P E Q A K S L Q E K L S 481 CAGCGTACCTGTCCTGGATGAATCCGTCTTCAAAGTCATTCAGGCATTCCCgtaagtttc 161 S V P V L D E S V F K V I Q A F P 541 accctagttttagcctctagtcctttcccccacggtctaacggctccagTCCCAACTCGT P N S 601 CCATTATCGGCATGATGATCGCCGCTCTGTCAGCTGTCCAGAGTACCCAGATGGATCGCA 200 S I I G M M I A A L S A V Q S T Q M D R 661 TCCCCGCCCATGCGGCCAAGAACCTCTACTTGGGCAATCCTAAGGCCGTCGATGATGAGA 220 I P A H A A K N L Y L G N P K A V D D E 721 TCGTCCGTCTGATGGGCTCGCTGTCCATGATCACCGCTGCTGTCTACTGCCACCATACCG 240 I V R L M G S L S M I T A A V Y C H H T 781 GACGGGAATTTACCCCGCCACGTCCGGAACTTTCCTACATCGAGAACTTCCTGTTGATGA 260 G R E F T P P R P E L S Y I E N F L L M 841 TGGGCCACGTCGAGTCTAGCACAGGACTGCCCAACCCCCAGTACGTCGACCGCATTGAGC 280 M G H V E S S T G L P N P Q Y V D R I E 901 GTCTCTGGGTCCTCATTGCCGATCACGAGATGACCTGCTCGACTGCCGCGTTCTTGCAGA 300 R L W V L I A D H E M T C S T A A F L Q 961 CAGCCTCCTCCCTGCCGGATGTATTCTCCTGTATGATCTCCGCACTGTCGGCGCTCTATG 320 T A S S L P D V F S C M I S A L S A L Y 1021 GTCCGCTGCATGGTGGGGCCATTGAGGTAGCTTACAAAAATTTCGAGGAGATTGGCTCGG 340 G P L H G G A I E V A Y K N F E E I G S 1081 TTGAGAACGTCGCGGCCAAGATAGAACGTGTCAAGGCCGGTAAGGAGCGTCTGTACGGCT 360 V E N V A A K I E R V K A G K E R L Y G 1141 ACGGTCACCGCATCTACCGCGTCACAGACCCGCGCTTCATCTTCATCCGCCAGATCTTAG 380 Y G H R I Y R V T D P R F I F I R Q I L 1201 ACGAGTTGAAGGAAGAGATCGCCCGGAACCCGCTGCTGAAGGTGGCGTTTGAGGTGGACC 400 D E L K E E I A R N P L L K V A F E V D 1261 GCGTCGCCTCGGAGGATGAATACTTTGTCACCCGGAAGCTACGGCCCAACGCCGATCTCT 420 R V A S E D E Y F V T R K L R P N A D L 1321 TTGCGGCGCTTGTGTATAGTGCCATgtaggccttccgtgaagtagtggtttcagacatca 440 F A A L V Y S A M 1381 gacccgctaacgcattgggaatagGGGCTTCCCGACTGAGTTTATTCTACCGTTGTCGCT G F P T E F I L P L S L 1441 GTTGTCCCGCACGCAGGGATTCATGGCCCACTGGAAAGAAGCCATGTgtaagtggcccat 481 L S R T Q G F M A H W K E A M 1501 tttgccactgcgtgtcccactctgagactaacgatgtgacagCGAGCACGGCACGTATCT S S T A R I 3'-ATCCGTC 3'-ATCCGTC 1561 GGCGGCCCGGCCAGATCTACACCGGACACTTGAACCGCGAGATGGCGTAGgtctaggcag 520 W R P G Q I Y T G H L N R E M A * NcoI citB-R1 + NcoI AAAGCGAGAGTGGTACC-5' citB-R1 + 1631 AAAGCGAGAT-5' 1621 tttcgctctcatcggtg Overview primers citB-F1-6 ATCACTATGCCCGACATCGC 50.6.degree. C. citB-F3-ATG + BsmBI CGTCTCCCATGCCCGACATCGCATCCAAC 63.3.degree. C. citB-R1 + 1631 TGAGAGCGAAACTGCCTA 54.1.degree. C. citB-R1 + NcoI CCATGGTGAGAGCGAAACTGCCTA 54.1.degree. C. citB-F3-ATG + BsmBI; 29-mer, 63.3.degree. C. 5'-CGTCTCCCATGCCCGACATCGCATCCAAC-3' Primer ||||||||||||||||||||| 3'- TACGGGCTGTAGCGTAGGTTG-5' (21) Strand - citB-F1-6; 20-mer; 50.6.degree. C. 5'-ATCACTATGCCCGACATCGC-3' Primer |||||||||||||| 3'- TACGGGCTGTAGCG-5' (14) Strand - citB-R1 + NcoI; 24-mer; 54.1.degree. C. 5'-CCATGGTGAGAGCGAAACTGCCTA-3' Primer | | |||||||||||||||||| 3'-GTGGCTACTCTCGCTTTGACGGAT-3' (1614) Strand + 5'-TGAGAGCGAAACTGCCTA-3' Primer |||||||||||||||||| 3'-ACTCTCGCTTTGACGGAT-5' (1614) Strand +

[0115] The resulting BsmBI-NcoI fragment was cloned in the NcoI site of the Aspergillus expression vector pABgpd-I (FIG. 5). In a derivative of this vector also the Aspergillus auxotrophic selection marker pyrG was cloned.

[0116] Subsequently, an itaconic acid producing Aspergillus niger strain (Li, A. et al., Appl. Microbial. Biotechnol. 1-11, 2013; Li, A. et al. Fungal Genet. Biol. 48:602-611, 2011) was transformed with the citB overexpression vector. PyrG+ transformants were purified by single colony purification and retested for their PyrG+ phenotype. Several PyrG+ transformants were subsequently cultured in shake flask cultures from which the expression of the introduced citB expression cassette was analyzed using quantitative RT-PCR. In addition Southern analysis was carried out to confirm the presence of intact copies of the expression cassette in the transformants.

[0117] The transformants with the highest copy number and/or highest citB expression level were cultured in batch fermentations. Following up, the media samples were analyzed by HPLC for the amount of itaconic acid produced by the A. niger transformants. Besides this, other organic acids like citric acid and oxalic acid were also analyzed due to their relevance in the assumed itaconate production pathway in Aspergillus niger.

Cultivation Conditions

[0118] For the screening and selection of A. niger transformants, our previously developed screening assay was used (Li et al. 2012). After seeding, all plates were directly sealed with an oxygen permeable film (Sealing film sterile, breathable M20193, Dispolab the Netherlands), placed in a plastic air bag and cultivated in a 33 .degree. C., 850 rpm incubator (Microtron, Infos-ht) forfor 60 h,. In the end of the cultivation, culture medium was harvested and used for HPLC analysis.

[0119] For shakeflask and controlled batch fermentations, the production medium

[0120] (M12) described in our previous study (Li et al. 2012) with the following composition was used (per liter): 100 g glucose, 2.36 g (NH.sub.4).sub.2SO.sub.4, 0.11 g KH.sub.2PO.sub.4, 0.5 g MgSO.sub.4.7H.sub.2O, 0.6 mg FeSO.sub.4.7H.sub.2O, 2.5 mg CuSO.sub.4.5H.sub.2O, 0.6 mg ZnSO.sub.4.7H.sub.2O, 0.074 g NaCl, and 0.13 g CaCl.sub.2.2H.sub.2O. This medium was prepared in demineralised water. The production medium M12+Cu has an extra addition of 2.5 mg CuSO.sub.4.5H.sub.2O (0.01 mM). For controlled fermentation pre-cultures were prepared by inoculation of 106 spores per milliliter in 2.times.100-mL production medium in two 500 mL baffled Erlenmeyer flasks. After 64 h at 33.degree. C. and shaking at 125 rpm, the pre-cultures were used for inoculation of the fermenters. Fermentations were performed in 5-L Benchtop Fermentors (BioFlo 3000, New Brunswick Scientific Co., Inc.) at 33.degree. C. The basic pH regime was initiated at 3.5 and subsequently regulated at 2.3, by addition of 4 M KOH (base). Struktol was applied as antifoam agent (Schill & Seilacher) in all cultures throughout the fermentation. Air was used for sparging the bioreactor at a constant flow of 0.25 vvm [(vol.liquid).sup.-1 min.sup.-1]. The solubility of oxygen in the medium is around 225 .mu.Mol at 33 .degree. C. Pure air sparging was calibrated as 100% D.O., whereas pure nitrogen sparging was calibrated as 0% D.O. In the basic D.O. regime, D.O. was set at 100% from the start of the fermentation. As soon as due to mycelial growth D.O. levels dropped below 25%, stirrer agitation was increased automatically to maintain D.O. at 25%. For studying the influence of oxygen availability on itaconic acid production, D.O was fixed throughout the whole fermentation at 10, 15, 20, and 25% for strain N201 CAD and at 5, 10, and 20% for strain HBD 2.5. The different percentage of D.O. was obtained by varying the mixture of air/nitrogen in the inlet gas.

[0121] The cultured transformants were analysed for the presence of citric acid and derivatives in microplate cultures. Based on these cultures several transformants producing increased itaconic acid levels were selected for further research.

[0122] Based on the results obtained in microplate screening a selection of transformants was grown in shakeflask cultures as described by Li et al., 2012, 2013 and analysed for itaconic acid productivity and yield

TABLE-US-00009 Itaconic acid Itaconic acid Productivity Yield (mg/g Glucose)Shake Strain (mg/L/hr) flask culture CAD 7.8 CAD + citB#49 8.8 CAD + citB#53 11.4 CAD + citB#71 10.4 CAD + citB#84A 8.7 CAD MFS/MTT#48 17.9 CAD MFS/MTT#49 31.2 CAD MFS/MTT#63 26.7 Controlled fermentation CAD 8.9 30 CAD 11.2 CAD + citB#53 15.4 42 CAD MFS/MTT#8 20.9 CAD MFS/MTT#63 50.2

[0123] As shown the introduction of the citB gene into an A. niger strain already expressing cadA resulted in increased productivity and yields of secreted itaconic acid.

[0124] Introduction of two previously identified organic acid transporters (MTT/MFS;) as described in WO 2009/104958 and WO 2009/110796 in a single host strain also resulted in increased productivity of itaconic acid.

Example 7B

Overexpression of A. niger citB in a Host Strain Expressing All Three Genes of the Itaconic Acid Gene Cluster

Strain Construction

[0125] In a strain already simultaneously expressing the A.terreus cadA, mfsA and mttA genes, which genes and strains have been described in WO 2009/014437, WO 2009/104958 and WO 2009/110796 as shown in the table in Example 7A, above, (strains CADMFSMTT#63 or #49), the A. niger citB expression vector was introduced by cotransformation using the phleomycin resistence marker for transformant selection. From the resulting tranosformants strain CitB #99 was selected for further analysis

Fermentation Conditions

[0126] Controlled batch cultivations were performed in 5 liter batch fermentors (BioFlo 3000, New Brunswick Scientific Co., Inc.). The production medium, as published earlier by An Li et al., 2012, consists of the following (per litre): 100 g glucose, 2.36 g (NH.sub.4).sub.2SO.sub.4, 0.11 g KH.sub.2PO.sub.4, 0.5 g MgSO.sub.4.7H.sub.2O, 0.6 g FeSO.sub.4.7H.sub.2O, 2.5 mg CuSO.sub.4.5H.sub.2O, 0.6 mg ZnSO.sub.4.7H.sub.2O, 0.074 g NaCl and 0.13 g CaCl.sub.2.2H.sub.2O. This medium was prepared in demineralized water. Inoculum was prepared with 1.0-10.sup.6 spores/mL in 100 mL production medium in 500 mL baffled Erlenmeyer flasks. Inoculum was then incubated at 33.degree. C. for 72 hours and shaking at 125 rpm. Temperature was kept stable at 33.degree. C. throughout the fermentation. The fermentation starts with a pH of 3.5 and afterwards is kept stable at 2.3 by addition of 4M KOH. The bioreactor was sparged with a constant flow of 1.25 vvm [(vol.liquid).sup.-1 min.sup.-1] air. The system was calibrated as 100% D.O. by sparging the bioreactor with pure air whereas pure nitrogen sparging was calibrated as 0% D.O. Throughout the course of the fermentation the D.O. was kept at 20%, which is achieved by applying various mixtures of air and nitrogen in the inlet gas. Struktol (Schill & Seilacher) was used as antifoaming agent. Autosamples were taken every six hours using a 0.22 .mu.M filter (Applikon Biotechnology, USA).

HPLC Analysis

[0127] Filter-sterilized fermentation samples were analyzed by high-performance liquid chromatography (HPLC) to quantify metabolites and assess organic acid production. Samples were loaded on a WATERS e2695 Separations Module outfitted with an Aminex HPX-87H column (Bio-Rad) and 5 mM H.sub.2SO.sub.4 as eluent. Metabolites were detected by a refractive index detector (WATERS 2414) and a dual-wavelength detector (WATERS UV/Vis 2489) simultaneously. Empower Pro was used as software for the processing of data (Empower 2 Software, copyright 2005-2008, Waters Corporation, Milford, Mass., USA).

Results

[0128] In order to compare the organic acid production capacity of the CitB #99 strain with the AB1.13 CAD+MTT+MFS strain, controlled batch fermentations were performed. The glucose consumption and organic acid production capacity of the two strains is depicted in FIG. 6 (CitB #99) and FIG. 7 (AB1.13 CAD+MTT+MFS). As can be seen in FIG. 6 and FIG. 7, CitB #99 produces more itaconic acid (higher yield) and has a higher production rate. CitB #99 produces itaconic acid up to 25 grams per litre and, unexpectedly, no citric acid. This shows that the conversion of citric acid to itaconic acid is very efficient in our transformed strain. Furthermore, the improved production rate of itaconic acid is a major step forwards; maximum yield is achieved after 5 days of fermentation, whereas the AB1.13 CAD+MTT+MFS strain needs 7 days to achieve maximum yield of around 12 grams per litre.

Example 7C

Itaconic Acid Production on Crude Second Generation Feedstocks

[0129] Shakeflask cultures

[0130] Cultivations in shakeflasks were performed in order to assess if the CitB #99 strain can grow on second generation feedstocks e.g. glycerol. For this experiment crude waste glycerol was acquired fro a biodiesel production plant. In the biodiesel process a waste product containing glycerol as mayor carbon source is produced as waste product. The experiment was performed in 500 mL baffled Erlenmeyer shakeflasks with a volume of 100 mL. Medium was prepared by adding 10 mL of crude glycerol from the company to 90 mL demineralized water. Preculture was prepared by inoculating 1.0-10.sup.6 spores/mL in 100 mL production medium in 500 mL baffled Erlenmeyer flasks and grown overnight at 33.degree. C. and shaking at 125 rpm. From this preculture 2 mL was used as inoculum.

Results

[0131] In order to assess if the CitB #99 strain can grow on second-generation feedstock, shakeflask cultivations were performed with glycerol as C-source (FIG. 8). The flasks were incubated at 33.degree. C. for 216 hours. In FIG. 8 it can be seen that glycerol consumption starts after 96 hours together with the production of itaconic acid. The first 96 hours of incubation appear to be necessary for the organism to adapt to the environment. This phenomenon may partly be caused due to the fact that the preculture was grown on production medium, which has glucose as C-source, rather than glycerol. Production level of itaconic acid leads up to approximately 1.5 grams per litre indicating that this strain can produce itaconic acid when grown on a second generation feedstocks, such as crude glycerol. For future purposes the CitB #99 strain can be cultivated in controlled batch fermentations to achieve optimal itaconic acid production.

Example 8

Overexpression of the A. niger citB Gene and A. terreus cadA Gene in Saccharomyces cerevisiae

[0132] For the overexpression of A. niger citB and A. terreus cadA in Saccharomyces cerevisiae an expression vector was synthesized at Geneart (Life technologies Europe, Bleiswijk, The Netherlands) containing two expression cassettes. The Saccharomyces codon optimized gene encoding the A. niger CitB protein was inserted between the gpd promotor and CYC1 terminator of Saccharomyces. The Saccharomyces codon optimized gene encoding the A. terreus CAD protein was inserted between the tef promotor and ADH1 terminator of Saccharomyces. In between both expression cassettes the URA3 marker was placed in antisense. The complete fragment was surrounded with URA3 flanking regions for integration at the URA3 locus in Saccaromyces cerevisiae.

TABLE-US-00010 5' URA3 flank-GPD promoter-citB gene (codon optimized for Saccharomyces cerevisiae)-CYC1 terminator-URA3 marker- TEF promoter-CAD gene (codon optimized for Saccharomyces cerevisiae)- ADH1 terminator-3' URA3 flank NotI 1 GCGGCCGCGATAAGTTTTGACCATCAAAGAAGGTTAATGTGGCTGTGGTTTCAGGGTCCA 61 TAAAGCTTTCAGTTTATCATTATCAATACTCGCCATTTCAAAGAATACGTAAATAATTAA 121 TAGTAGTGATTTTCCTAACTTTATTTAGTCAAAAAATTAGCCTTTTAATTCTGCTGTAAC 181 CCGTACATGCCCAAAATAGGGGGCGGGTTACACAGAATATATAACATCGTAGGTGTCTGG 241 GTGAACAGTTTATTCCTGGCATCCACTAAATATAATGGAGCCCGCTTTTTAAGCTGGCAT 301 CCAGAAAAAAAAAGAATCCCAGCACCAAAATATTGTTTTCTTCACCAACCATCAGTTCAT 361 AGGTCCATTCTCTTAGCGCAACTACAGAGAACAGGGGCACAAACAGGCAAAAAACGGGCA 421 CAACCTCAATGGAGTGATGCAACCTGCCTGGAGTAAATGATGACACAAGGCAATTGACCC 481 ACGCATGTATCTATCTCATTTTCTTACACCTTCTATTACCTTCTGCTCTCTCTGATTTGG 541 AAAAAGCTGAAAAAAAAGGTTGAAACCAGTTCCCTGAAATTATTCCCCTACTTGACTAAT 601 AAGTATATAAAGACGGTAGGTATTGATTGTAATTCTGTAAATCTATTTCTTAAACTTCTT 661 AAATTCTACTTTTATAGTTAGTCTTTTTTTTAGTTTTAAAACACCAGAACTTAGTTTCGA XbaI 721 CGGATTCTAGAATGCCAGATATTGCTTCTAATGGTGCTAGAAATGGTGCTTCTCAAAACG M P D I A S N G A R N G A S Q N 781 CTGAAACAAAACCAGAACCACCAGTTTTACACGTTGTTGATTCAAGAACTGGTAAGTACT 260 A E T K P E P P V L H V V D S R T G K Y 841 TCCCAATCCCAATCGTTAGAAATGCTATTAACGCCTCCGAGTTCAAGAAGTTGAAATCTC 280 F P I P I V R N A I N A S E F K K L K S 901 CAGAAGATCCAGCTCATCCAGAAGATCAAAACGAACAAGGTATCAGAGTTTTCGATCCAG 300 P E D P A H P E D Q N E Q G I R V F D P 961 GTTACTCTAATACCGCTGTTTCTGAATCTCAAGTTACCTACATTGATGGTTTGAAGGGTA 320 G Y S N T A V S E S Q V T Y I D G L K G 1021 CTATCCAATACAGAGGTTACAACATCGAAGATATCGTCGGTAAGAAGAAGTTCATTGATA 340 T I Q Y R G Y N I E D I V G K K K F I D 1081 CCGCCCATTTGTTGATTTGGGGTGAATGGCCAACTCCAGAACAAGCTAAATCATTGCAAG 360 T A H L L I W G E W P T P E Q A K S L Q 1141 AAAAGTTGTCCTCCGTTCCAGTTTTGGATGAATCTGTTTTCAAGGTTATTCAAGCCTTCC 380 E K L S S V P V L D E S V F K V I Q A F 1201 CACCAAACTCCTCTATTATTGGTATGATGATTGCTGCTTTGTCCGCTGTTCAATCTACTC 400 P P N S S I I G M M I A A L S A V Q S T 1261 AAATGGATAGAATACCAGCTCATGCTGCTAAGAACTTGTATTTGGGTAATCCAAAAGCCG 420 Q M D R I P A H A A K N L Y L G N P K A 1321 TTGATGACGAAATCGTTAGATTGATGGGTTCCTTGTCTATGATTACTGCTGCTGTTTACT 440 V D D E I V R L M G S L S M I T A A V Y 1381 GTCATCATACCGGTAGAGAATTTACTCCACCAAGACCAGAATTGTCCTACATCGAAAATT 460 C H H T G R E F T P P R P E L S Y I E N 1441 TCTTGTTGATGATGGGTCACGTCGAATCTTCTACTGGTTTGCCAAATCCACAATACGTTG 480 F L L M M G H V E S S T G L P N P Q Y V 1501 ACAGAATTGAAAGATTGTGGGTTTTGATTGCCGATCACGAAATGACTTGTTCTACTGCTG 500 D R I E R L W V L I A D H E M T C S T A 1561 CTTTCTTGCAAACTGCTTCTTCATTGCCAGATGTTTTCTCTTGTATGATCTCTGCTTTGT 520 A F L Q T A S S L P D V F S C M I S A L 1621 CTGCATTATACGGTCCATTGCATGGTGGTGCTATTGAAGTTGCTTACAAGAACTTCGAAG 540 S A L Y G P L H G G A I E V A Y K N F E 1681 AAATCGGTTCCGTTGAAAATGTTGCTGCCAAAATCGAAAGAGTTAAGGCCGGTAAAGAAA 560 E I G S V E N V A A K I E R V K A G K E 1741 GATTATACGGTTACGGTCATAGAATCTACAGAGTTACTGATCCAAGATTCATCTTCATCA 580 R L Y G Y G H R I Y R V T D P R F I F I 1801 GACAAATCTTGGATGAATTGAAAGAAGAAATCGCCAGAAACCCTTTGTTGAAGGTTGCTT 600 R Q I L D E L K E E I A R N P L L K V A 1861 TTGAAGTTGATAGAGTCGCCTCTGAAGATGAATACTTCGTTACCAGAAAGTTAAGACCAA 620 F E V D R V A S E D E Y F V T R K L R P 1921 ACGCTGATTTGTTTGCTGCCTTGGTTTATTCTGCTATGGGTTTTCCAACCGAGTTCATCT 640 N A D L F A A L V Y S A M G F P T E F I 1981 TGCCATTGTCTTTGTTGTCAAGAACCCAAGGTTTTATGGCCCATTGGAAAGAAGCTATGT 660 L P L S L L S R T Q G F M A H W K E A M 2041 CATCTACTGCTAGAATTTGGAGACCTGGTCAAATCTATACTGGTCACTTGAATAGAGAAA 680 S S T A R I W R P G Q I Y T G H L N R E XhoI 2101 TGGCTTAACTCGAGTCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCAC 700 M A * 2161 ATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTT 2221 TTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCT 2281 GTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGG BamHI 2341 ACGCTCGAAGGCTTTAATTTGCGGCCGGTGGATCCTTTTCTTTCCAATTTTTTTTTTTTC 2401 GTCATTATAAAAATCATTACGACCGAGATTCCCGGGTAATAACTGATATAATTAAATTGA * N Q TCGAGATTAAACACTCAAATCATATGTACGTAAATGAATATTATGTCAAAAAATCAAAAC 2461 AGCTCTAATTTGTGAGTTTAGTATACATGCATTTACTTATAATACAGTTTTTTAGTTTTG Q G C R R L Y A E W G A K R Y R E G E V GACCGGCGTAGAAGAGTTTATACGAAGGGTCGGACGAAAAGACATTGCAAGTGGGAGATG 2521 CTGGCCGCATCTTCTCAAATATGCTTCCCAGCCTGCTTTTCTGTAACGTTCACCCTCTAC K A D R G K A F L G R G V I I I D S G T GAATCGTAGGGAAGGGAAACGTTTATCAGGAGAAGGTTGTTATTATTACAGTCTAGGACA 2581 CTTAGCATCCCTTCCCTTTGCAAATAGTCCTCTTCCAACAATAATAATGTCAGATCCTGT S V V D D V T R Y Q Q G L A D G K D D L TCTCTGGTGTAGTAGGTGCCAAGATATGACAACTGGGTTACGCAGAGGGAACAGTAGATT 2641 AGAGACCACATCATCCACGGTTCTATACTGTTGACCCAATGCGTCTCCCTTGTCATCTAA G V G P T M I L W D Y G E D R G G M D R TGGGTGTGGCCCACAGTATTAGTTGGTTAGCATTGGAAGTAGAGAAGGTGGGTACAGAGA 2701 ACCCACACCGGGTGTCATAATCAACCAATCGTAACCTTCATCTCTTCCACCCATGTCTCT Q A I F G I V F D K D S K A I D V T G K AACTCGTTATTTCGGCTATTGTTTTAGAAACAGCGAGAAGCGTTACAGTTGTCATGGGAA 2761 TTGAGCAATAAAGCCGATAACAAAATCTTTGTCGCTCTTCGCAATGTCAACAGTACCCTT T Y E G T S L S G K C S L E A L M L L G TCATATAAGAGGTCATCTATCCCTCGGGAACGTACTGTTAAGACGATTGTAGTTTTCCGG 2821 AGTATATTCTCCAGTAGATAGGGAGCCCTTGCATGACAATTCTGCTAACATCAAAAGGCC R P E K T V E E A A Q K L G S V I G P G AGATCCAAGGAAACAATGAAGAAGACGGCGGACGAAGTTTGGCGATTGTTATGGACCCGG 2881 TCTAGGTTCCTTTGTTACTTCTTCTGCCGCCTGCTTCAAACCGCTAACAATACCTGGGCC V V G H A N T I D A W E A I R Y V G A S GTGGTGTGGCACACGTAAGCATTACAGACGGGTAAGACGATAAGACATATGTGGGCGTCT 2941 CACCACACCGTGTGCATTCGTAATGTCTGCCCATTCTGCTATTCTGTATACACCCGCAGA Y Q L K V T N G I D A F K R D E F L L F CATGACGTTAAACTGACATAATGGTTACAGTCGTTTAAAAGACAGAAGCTTCTCATTTTT 3001 GTACTGCAATTTGACTGTATTACCAATGTCAGCAAATTTTCTGTCTTCGAAGAGTAAAAA N Y K A S L A K L P K V T G E M S F D T TAACATGAACCGCCTATTACGGAAATCGCCGAATTGACACGGGAGGTACCTTTTTAGTCA 3061 ATTGTACTTGGCGGATAATGCCTTTAGCGGCTTAACTGTGCCCTCCATGGAAAAATCAGT L I D V H T K L L C I K P G L A E V L E GTTCTATAGGTGTACACAAAAATCATTTGTTTAAAACCCTGGATTACGAAGTTGATTGAG 3121 CAAGATATCCACATGTGTTTTTAGTAAACAAATTTTGGGACCTAATGCTTCAACTAACTC L L E K T T R V D L S A C L N T Q K E H GTCATTAAGGAACCACCATGCTTGTAGGTTACTTCGTGTGTTCAAACAAACGAAAAGCAC 3181 CAGTAATTCCTTGGTGGTACGAACATCCAATGAAGCACACAAGTTTGTTTGCTTTTCGTG M I N F L K A A V P S P H T A A R E K Y GTACTATAATTTATCGAACCGTCGTTGTCCTGATCCTACTCATCGTCGTGCAAGGAATAT 3241 CATGATATTAAATAGCTTGGCAGCAACAGGACTAGGATGAGTAGCAGCACGTTCCTTATA T A K S M ACATCGAAAGCTGTA 3301 TGTAGCTTTCGACATGATTTATCTTCGTTTCCTGCAGGTTTTTGTTCTGTGCAGTTGGGT 3361 TAAGAATACTGGGCAATTTCATGTTTCTTCAACACTACATATGCGTATATATACCAATCT 3421 AAGTCTGTGCTCCTTCCTTCGTTCTTCCTTCTGTTCGGAGATTACCGAATCAAAAAAATT EcoRI 3481 TCAAAGAAACCGAAATCAAAAAAAAGAATAAAAAAAAAATGATGAATTGAAGAATTCTTA 3541 CCCATAAGGTTGTTTGTGACGGCGTCGTACAAGAGAACGTGGGAACTTTTTAGGCTCACC 3601 AAAAAAGAAAGAAAAAATACGAGTTGCTGACAGAAGCCTCAAGAAAAAAAAAATTCTTCT 3661 TCGACTATGCTGGAGGCAGAGATGATCGAGCCGGTAGTTAACTATATATAGCTAAATTGG 3721 TTCCATCACCTTCTTTTCTGGTGTCGCTCCTTCTAGTGCTATTTCTGGCTTTTCCTATTT 3781 TTTTTTTTCCATTTTTCTTTCTCTCTTTCTAATATATAAATTCTCTTGCATTTTCTATTT 3841 TTCTCTCTATCTATTCTACTTGTTTATTCCCTTCAAGGTTTTTTTTTAAGGAGTACTTGT XbaI 3901 TTTTAGAATATACGGTCAACGAACTATAATTAACTAAACTCTAGAATGACCAAGCAATCC M T K Q S 3961 GCTGATTCTAATGCTAAATCTGGTGTTACCGCTGAAATTTGTCATTGGGCTTCTAATTTG 1321 A D S N A K S G V T A E I C H W A S N L 4021 GCCACCGATGATATTCCATCTGATGTTTTGGAAAGAGCCAAGTACTTGATCTTGGATGGT 1341 A T D D I P S D V L E R A K Y L I L D G 4081 ATTGCTTGTGCTTGGGTTGGTGCTAGAGTTCCATGGTCTGAAAAGTATGTTCAAGCTACC 1361 I A C A W V G A R V P W S E K Y V Q A T 4141 ATGTCTTTTGAACCACCAGGTGCTTGTAGAGTTATTGGTTATGGTCAAAAATTGGGTCCA 1381 M S F E P P G A C R V I G Y G Q K L G P 4201 GTTGCTGCTGCTATGACTAATTCTGCTTTTATTCAAGCCACCGAATTGGATGATTACCAT 1401 V A A A M T N S A F I Q A T E L D D Y H 4261 TCTGAAGCTCCATTGCATTCTGCTTCTATAGTTTTGCCAGCTGTTTTTGCTGCTTCTGAA 1421 S E A P L H S A S I V L P A V F A A S E 4321 GTTTTGGCTGAACAAGGTAAAACCATCTCCGGTATTGATGTTATTTTGGCTGCTATCGTT 1441 V L A E Q G K T I S G I D V I L A A I V 4381 GGTTTCGAATCTGGTCCAAGAATTGGTAAAGCTATCTACGGTTCTGACTTGTTGAACAAT 1461 G F E S G P R I G K A I Y G S D L L N N 4441 GGTTGGCATTGTGGTGCTGTTTATGGTGCTCCAGCTGGTGCTTTGGCTACTGGTAAGTTG 1481 G W H C G A V Y G A P A G A L A T G K L 4501 TTGGGTTTGACTCCAGATTCTATGGAAGATGCTTTGGGTATTGCATGTACTCAAGCTTGT 1501 L G L T P D S M E D A L G I A C T Q A C 4561 GGTTTGATGTCTGCTCAATATGGTGGTATGGTTAAGAGAGTTCAACACGGTTTTGCTGCA 1521 G L M S A Q Y G G M V K R V Q H G F A A 4621 AGAAATGGTTTGTTGGGTGGTTTGTTGGCTTATGGTGGTTATGAAGCTATGAAGGGTGTA 1541 R N G L L G G L L A Y G G Y E A M K G V 4681 TTGGAAAGATCTTACGGTGGTTTCTTGAAGATGTTCACTAAGGGTAATGGTAGAGAACCA 1561 L E R S Y G G F L K M F T K G N G R E P 4741 CCATACAAAGAAGAAGAAGTTGTTGCTGGTTTGGGTTCTTTTTGGCATACTTTCACCATC 1581 P Y K E E E V V A G L G S F W H T F T I 4801 AGAATCAAGTTGTATGCTTGTTGCGGTTTGGTTCATGGTCCAGTTGAAGCTATTGAAAAG 1601 R I K L Y A C C G L V H G P V E A I E K 4861 TTGCAAAGAAGATACCCAGAATTATTGAACAGAGCCAACTTGTCCAACATCAGACATGTT 1621 L Q R R Y P E L L N R A N L S N I R H V 4921 TACGTTCAATTGTCTACCGCCTCTAATTCTCATTGTGGTTGGATTCCAGAAGAAAGACCA 1641 Y V Q L S T A S N S H C G W I P E E R P

4981 ATTTCTTCTATTGCCGGTCAAATGTCCGTTGCTTACATTTTGGCTGTTCAATTGGTTGAC 1661 I S S I A G Q M S V A Y I L A V Q L V D 5041 CAACAATGTTTGTTGGCCCAATTCTCCGAATTTGATGACAATTTGGAAAGACCAGAAGTT 1681 Q Q C L L A Q F S E F D D N L E R P E V 5101 TGGGATTTGGCTAGAAAAGTTACTCCATCCCACTCCGAAGAATTTGATCAAGATGGTAAC 1701 W D L A R K V T P S H S E E F D Q D G N 5161 TGTTTGTCCGCTGGTAGAGTTAGAATTGAGTTCAACGATGGTTCCTCTGTTACCGAAACT 1721 C L S A G R V R I E F N D G S S V T E T 5221 GTTGAAAAACCATTGGGTGTCAAAGAACCTATGCCAAACGAAAGAATCTTGCACAAGTAT 1741 V E K P L G V K E P M P N E R I L H K Y 5281 AGAACTTTGGCTGGTTCTGTTACCGATGAATCAAGAGTCAAAGAAATCGAAGATTTGGTC 1761 R T L A G S V T D E S R V K E I E D L V 5341 TTGTCCTTGGATAGATTGACTGATATTACCCCTTTGTTGGAATTATTGAATTGCCCAGTT 1781 L S L D R L T D I T P L L E L L N C P V XhoI 5401 AAGTCCCCATTGGTCTAACTCGAGGCGAATTTCTTATGATTTATGATTTTTATTATTAAA 1801 K S P L V * 5461 TAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGA 5521 AAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCAT 5581 GAGGTCGCTCTTATTGACCACACCTCTACCGGCATGCCGAGCAAATGCCTGCAAATCGCT 5641 CCCCATTTCACCCAATTGTAGATATGCTAACTCCAGCAATGAGTTGATGAATCTCGGTGT 5701 CTATTTTATGTCCTCAGAGGACAACACCTGTTGTAATCGTTCTTCCACACTCATGGCCTT NotI 5761 TATAAAAAGGAACTATCCAATACCTCGCCAGAACCAAGTAACAGTATTTTGCGGCCGC

[0133] The citB expression fragment was isolated from the synthesized vector using BamHI-SstI and cloned into the pFL61 yeast expression vector (ATCC77215; http://www.lgcstandards-atcc.org/Products/All/77215.aspx; Minet M. et al. Complementation of Sacchammyces cerevisiae auxotrophic mutants by Arabidopsis cDNA. Plant J. 2: 417-422, 1992.), which was digested with BamHI and SstI. The cadA expression fragment was isolated using Acc65I-EcoRI and cloned into the pFL61 yeast expression vector. The resulting citB and cadA expression vectors were transformed to the Saccharomyces cerevisiae strain CEN.PK113-5D using the electroporation protocol as described in (Transformation of commercial baker's yeast strains by electroporation., Gysler et al. , Biotechnology Techniques Vol 4 No 4 285-290 (1990)) The yeast transformants were purified by single colony purification and analyzed with PCR for the presence of the expression vector.

[0134] Subsequently, the transformants carrying citB or cadA genecopies were cultured in microtitreplate cultures under aerobic and anaerobic conditions and analyzed for the organic acid production using HPLC.In cadA expressing strains under both anaerobic and aerobic conditions itaconic acid production was detected in the culture medium.

Sequence CWU 1

1

86120DNAArtificial Sequenceprimer 1tgttgtcgcc gtagccgagc 20220DNAArtificial Sequenceprimer 2agctcctccc caaggctccc 20320DNAArtificial Sequenceprimer 3gcgacgcggt ccacctcaaa 20420DNAArtificial Sequenceprimer 4gcacaggact gcccaacccc 20520DNAArtificial Sequenceprimer 5gcttcgcggc ccatactgct 20620DNAArtificial Sequenceprimer 6tgaagctgcc aacaccccgc 20720DNAArtificial Sequenceprimer 7gatggacggc cacccactgc 20820DNAArtificial Sequenceprimer 8tgcgctccct tcagcagcac 20920DNAArtificial Sequenceprimer 9gcaaagggtg ccaggccgat 201020DNAArtificial Sequenceprimer 10ctgggtgctg gtcatcgcgg 201119DNAArtificial Sequenceprimer 11ggtcttagcc gagcaaggc 191219DNAArtificial Sequenceprimer 12gcgacactca tctgccctg 191320DNAArtificial Sequenceprimer 13atcgagacct acgaggaggg 201419DNAArtificial Sequenceprimer 14ccgggagttc ctgcgaagg 191529DNAArtificial SequencecitB-F3-ATG+BsmBI primer 15cgtctcccat gcccgacatc gcatccaac 291620DNAArtificial SequencecitB-F1-6 primer 16atcactatgc ccgacatcgc 20171620DNAAspergillus nigerCDS(1)..(272)CDS(334)..(531)CDS(590)..(1346)CDS(1406)..(1487)CDS(154- 3)..(1607) 17atg ccc gac atc gca tcc aac ggt gcc cgc aac ggc gcc tcc cag aat 48Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Ala Ser Gln Asn 1 5 10 15 gca gag acc aag cca gaa ccc ccc gtt ctc cat gtg gta gac agc cgc 96Ala Glu Thr Lys Pro Glu Pro Pro Val Leu His Val Val Asp Ser Arg 20 25 30 acg ggg aag tac ttc ccc atc cct atc gtg cgc aac gcc atc aac gca 144Thr Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 agc gaa ttc aag aaa ctc aag tcc ccc gag gat ccc gca cat cct gaa 192Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 gat cag aac gag cag ggc atc cgg gtg ttt gac ccc gga tac tcc aac 240Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 acg gct gtt agt gag agc cag gtt acc tac at gtgcgttttc tctgctgcat 292Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile 85 90 aggattgatc atggcgaaga gtaactgata acggggcgca g c gat ggc ctg aag 346 Asp Gly Leu Lys 95 gga acc atc cag tac cgt ggt tac aac atc gag gat att gtg ggc aag 394Gly Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys 100 105 110 aag aag ttt att gac acg gca cac ctg ctc att tgg gga gaa tgg ccg 442Lys Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro 115 120 125 acg ccg gaa cag gcc aaa tct ctg cag gag aag ctc tcc agc gta cct 490Thr Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro 130 135 140 gtc ctg gat gaa tcc gtc ttc aaa gtc att cag gca ttc cc 531Val Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro 145 150 155 gtaagtttca ccctagtttt agcctctagt cctttccccc acggtctaac ggctccag t 590ccc aac tcg tcc att atc ggc atg atg atc gcc gct ctg tca gct gtc 638Pro Asn Ser Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val 160 165 170 cag agt acc cag atg gat cgc atc ccc gcc cat gcg gcc aag aac ctc 686Gln Ser Thr Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu 175 180 185 tac ttg ggc aat cct aag gcc gtc gat gat gag atc gtc cgt ctg atg 734Tyr Leu Gly Asn Pro Lys Ala Val Asp Asp Glu Ile Val Arg Leu Met 190 195 200 205 ggc tcg ctg tcc atg atc acc gct gct gtc tac tgc cac cat acc gga 782Gly Ser Leu Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly 210 215 220 cgg gaa ttt acc ccg cca cgt ccg gaa ctt tcc tac atc gag aac ttc 830Arg Glu Phe Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe 225 230 235 ctg ttg atg atg ggc cac gtc gag tct agc aca gga ctg ccc aac ccc 878Leu Leu Met Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro 240 245 250 cag tac gtc gac cgc att gag cgt ctc tgg gtc ctc att gcc gat cac 926Gln Tyr Val Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His 255 260 265 gag atg acc tgc tcg act gcc gcg ttc ttg cag aca gcc tcc tcc ctg 974Glu Met Thr Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu 270 275 280 285 ccg gat gta ttc tcc tgt atg atc tcc gca ctg tcg gcg ctc tat ggt 1022Pro Asp Val Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly 290 295 300 ccg ctg cat ggt ggg gcc att gag gta gct tac aaa aat ttc gag gag 1070Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu 305 310 315 att ggc tcg gtt gag aac gtc gcg gcc aag ata gaa cgt gtc aag gcc 1118Ile Gly Ser Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala 320 325 330 ggt aag gag cgt ctg tac ggc tac ggt cac cgc atc tac cgc gtc aca 1166Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr 335 340 345 gac ccg cgc ttc atc ttc atc cgc cag atc tta gac gag ttg aag gaa 1214Asp Pro Arg Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu 350 355 360 365 gag atc gcc cgg aac ccg ctg ctg aag gtg gcg ttt gag gtg gac cgc 1262Glu Ile Ala Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg 370 375 380 gtc gcc tcg gag gat gaa tac ttt gtc acc cgg aag cta cgg ccc aac 1310Val Ala Ser Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn 385 390 395 gcc gat ctc ttt gcg gcg ctt gtg tat agt gcc atg taggccttcc 1356Ala Asp Leu Phe Ala Ala Leu Val Tyr Ser Ala Met 400 405 gtgaagtagt ggtttcagac atcagacccg ctaacgcatt gggaatagg ggc ttc ccg 1414 Gly Phe Pro 410 act gag ttt att cta ccg ttg tcg ctg ttg tcc cgc acg cag gga ttc 1462Thr Glu Phe Ile Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe 415 420 425 atg gcc cac tgg aaa gaa gcc atg t gtaagtggcc cattttgcca 1507Met Ala His Trp Lys Glu Ala Met 430 435 ctgcgtgtcc cactctgaga ctaacgatgt gacag cg agc acg gca cgt atc 1559 Ser Ser Thr Ala Arg Ile 440 tgg cgg ccc ggc cag atc tac acc gga cac ttg aac cgc gag atg gcg 1607Trp Arg Pro Gly Gln Ile Tyr Thr Gly His Leu Asn Arg Glu Met Ala 445 450 455 taggtctagg cag 162018458PRTAspergillus niger 18Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Ala Ser Gln Asn 1 5 10 15 Ala Glu Thr Lys Pro Glu Pro Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Val 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Thr 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Lys Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 1924DNAArtificial SequencecitB-R1+NcoI primer 19ccatggtgag agcgaaactg ccta 242018DNAArtificial SequencecitB-R1+1631 primer 20tgagagcgaa actgccta 182121DNAArtificial Sequenceoverlap with primer 21gttggatgcg atgtcgggca t 212214DNAArtificial Sequenceoverlap with primer 22gcgatgtcgg gcat 142324DNAArtificial Sequenceoverlap with primer 23taggcagttt cgctctcatc ggtg 242418DNAArtificial Sequenceoverlap withprimer 24taggcagttt cgctctca 18255818DNAArtificial SequenceS. cerevisiae expression construct 5' URA3 flank- GPD promoter-citB gene (codon optimized for Saccharomyces cerevisiae)-CYC1 terminator - URA3 marker - TEF promoter-CAD gene (codon optimized for Saccharomyces cerevisiae) -ADH1 terminator -CDS(732)..(2105)citB gene codon optimisedmisc_feature(2455)..(3315)URA3 marker (coded on complimentary strand)CDS(3946)..(5415)CAD gene codon optimised 25gcggccgcga taagttttga ccatcaaaga aggttaatgt ggctgtggtt tcagggtcca 60taaagctttc agtttatcat tatcaatact cgccatttca aagaatacgt aaataattaa 120tagtagtgat tttcctaact ttatttagtc aaaaaattag ccttttaatt ctgctgtaac 180ccgtacatgc ccaaaatagg gggcgggtta cacagaatat ataacatcgt aggtgtctgg 240gtgaacagtt tattcctggc atccactaaa tataatggag cccgcttttt aagctggcat 300ccagaaaaaa aaagaatccc agcaccaaaa tattgttttc ttcaccaacc atcagttcat 360aggtccattc tcttagcgca actacagaga acaggggcac aaacaggcaa aaaacgggca 420caacctcaat ggagtgatgc aacctgcctg gagtaaatga tgacacaagg caattgaccc 480acgcatgtat ctatctcatt ttcttacacc ttctattacc ttctgctctc tctgatttgg 540aaaaagctga aaaaaaaggt tgaaaccagt tccctgaaat tattccccta cttgactaat 600aagtatataa agacggtagg tattgattgt aattctgtaa atctatttct taaacttctt 660aaattctact tttatagtta gtcttttttt tagttttaaa acaccagaac ttagtttcga 720cggattctag a atg cca gat att gct tct aat ggt gct aga aat ggt gct 770 Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Ala 1 5 10 tct caa aac gct gaa aca aaa cca gaa cca cca gtt tta cac gtt gtt 818Ser Gln Asn Ala Glu Thr Lys Pro Glu Pro Pro Val Leu His Val Val 15 20 25 gat tca aga act ggt aag tac ttc cca atc cca atc gtt aga aat gct 866Asp Ser Arg Thr Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala 30 35 40 45 att aac gcc tcc gag ttc aag aag ttg aaa tct cca gaa gat cca gct 914Ile Asn Ala Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala 50 55 60 cat cca gaa gat caa aac gaa caa ggt atc aga gtt ttc gat cca ggt 962His Pro Glu Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly 65 70 75 tac tct aat acc gct gtt tct gaa tct caa gtt acc tac att gat ggt 1010Tyr Ser Asn Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly 80 85 90 ttg aag ggt act atc caa tac aga ggt tac aac atc gaa gat atc gtc 1058Leu Lys Gly Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val 95 100 105 ggt aag aag aag ttc att gat acc gcc cat ttg ttg att tgg ggt gaa 1106Gly Lys Lys Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu 110 115 120 125 tgg cca act cca gaa caa gct aaa tca ttg caa gaa aag ttg tcc tcc 1154Trp Pro Thr Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser 130 135 140 gtt cca gtt ttg gat gaa tct gtt ttc aag gtt att caa gcc ttc cca 1202Val Pro Val Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro 145 150 155 cca aac tcc tct att att ggt atg atg att gct gct ttg tcc gct gtt 1250Pro Asn Ser Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val 160 165 170 caa tct act caa atg gat aga ata cca gct cat gct gct aag aac ttg 1298Gln Ser Thr Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu 175 180 185 tat ttg ggt aat cca aaa gcc gtt gat gac gaa atc gtt aga ttg atg 1346Tyr Leu Gly Asn Pro Lys Ala Val Asp Asp Glu Ile Val Arg Leu Met 190 195 200 205 ggt tcc ttg tct atg att act gct gct gtt tac tgt cat cat acc ggt 1394Gly Ser Leu Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly 210 215 220 aga gaa ttt act cca cca aga cca gaa ttg tcc tac atc gaa aat ttc 1442Arg Glu Phe Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe 225 230 235 ttg ttg atg atg ggt cac gtc gaa tct tct act ggt ttg cca aat cca 1490Leu Leu Met Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro 240 245 250 caa tac gtt gac aga att gaa aga ttg tgg gtt ttg att gcc gat cac 1538Gln Tyr Val Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His

255 260 265 gaa atg act tgt tct act gct gct ttc ttg caa act gct tct tca ttg 1586Glu Met Thr Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu 270 275 280 285 cca gat gtt ttc tct tgt atg atc tct gct ttg tct gca tta tac ggt 1634Pro Asp Val Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly 290 295 300 cca ttg cat ggt ggt gct att gaa gtt gct tac aag aac ttc gaa gaa 1682Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu 305 310 315 atc ggt tcc gtt gaa aat gtt gct gcc aaa atc gaa aga gtt aag gcc 1730Ile Gly Ser Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala 320 325 330 ggt aaa gaa aga tta tac ggt tac ggt cat aga atc tac aga gtt act 1778Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr 335 340 345 gat cca aga ttc atc ttc atc aga caa atc ttg gat gaa ttg aaa gaa 1826Asp Pro Arg Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu 350 355 360 365 gaa atc gcc aga aac cct ttg ttg aag gtt gct ttt gaa gtt gat aga 1874Glu Ile Ala Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg 370 375 380 gtc gcc tct gaa gat gaa tac ttc gtt acc aga aag tta aga cca aac 1922Val Ala Ser Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn 385 390 395 gct gat ttg ttt gct gcc ttg gtt tat tct gct atg ggt ttt cca acc 1970Ala Asp Leu Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr 400 405 410 gag ttc atc ttg cca ttg tct ttg ttg tca aga acc caa ggt ttt atg 2018Glu Phe Ile Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met 415 420 425 gcc cat tgg aaa gaa gct atg tca tct act gct aga att tgg aga cct 2066Ala His Trp Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro 430 435 440 445 ggt caa atc tat act ggt cac ttg aat aga gaa atg gct taactcgagt 2115Gly Gln Ile Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 catgtaatta gttatgtcac gcttacattc acgccctccc cccacatccg ctctaaccga 2175aaaggaagga gttagacaac ctgaagtcta ggtccctatt tattttttta tagttatgtt 2235agtattaaga acgttattta tatttcaaat ttttcttttt tttctgtaca gacgcgtgta 2295cgcatgtaac attatactga aaaccttgct tgagaaggtt ttgggacgct cgaaggcttt 2355aatttgcggc cggtggatcc ttttctttcc aatttttttt ttttcgtcat tataaaaatc 2415attacgaccg agattcccgg gtaataactg atataattaa attgaagctc taatttgtga 2475gtttagtata catgcattta cttataatac agttttttag ttttgctggc cgcatcttct 2535caaatatgct tcccagcctg cttttctgta acgttcaccc tctaccttag catcccttcc 2595ctttgcaaat agtcctcttc caacaataat aatgtcagat cctgtagaga ccacatcatc 2655cacggttcta tactgttgac ccaatgcgtc tcccttgtca tctaaaccca caccgggtgt 2715cataatcaac caatcgtaac cttcatctct tccacccatg tctctttgag caataaagcc 2775gataacaaaa tctttgtcgc tcttcgcaat gtcaacagta cccttagtat attctccagt 2835agatagggag cccttgcatg acaattctgc taacatcaaa aggcctctag gttcctttgt 2895tacttcttct gccgcctgct tcaaaccgct aacaatacct gggcccacca caccgtgtgc 2955attcgtaatg tctgcccatt ctgctattct gtatacaccc gcagagtact gcaatttgac 3015tgtattacca atgtcagcaa attttctgtc ttcgaagagt aaaaaattgt acttggcgga 3075taatgccttt agcggcttaa ctgtgccctc catggaaaaa tcagtcaaga tatccacatg 3135tgtttttagt aaacaaattt tgggacctaa tgcttcaact aactccagta attccttggt 3195ggtacgaaca tccaatgaag cacacaagtt tgtttgcttt tcgtgcatga tattaaatag 3255cttggcagca acaggactag gatgagtagc agcacgttcc ttatatgtag ctttcgacat 3315gatttatctt cgtttcctgc aggtttttgt tctgtgcagt tgggttaaga atactgggca 3375atttcatgtt tcttcaacac tacatatgcg tatatatacc aatctaagtc tgtgctcctt 3435ccttcgttct tccttctgtt cggagattac cgaatcaaaa aaatttcaaa gaaaccgaaa 3495tcaaaaaaaa gaataaaaaa aaaatgatga attgaagaat tcttacccat aaggttgttt 3555gtgacggcgt cgtacaagag aacgtgggaa ctttttaggc tcaccaaaaa agaaagaaaa 3615aatacgagtt gctgacagaa gcctcaagaa aaaaaaaatt cttcttcgac tatgctggag 3675gcagagatga tcgagccggt agttaactat atatagctaa attggttcca tcaccttctt 3735ttctggtgtc gctccttcta gtgctatttc tggcttttcc tatttttttt tttccatttt 3795tctttctctc tttctaatat ataaattctc ttgcattttc tatttttctc tctatctatt 3855ctacttgttt attcccttca aggttttttt ttaaggagta cttgttttta gaatatacgg 3915tcaacgaact ataattaact aaactctaga atg acc aag caa tcc gct gat tct 3969 Met Thr Lys Gln Ser Ala Asp Ser 460 465 aat gct aaa tct ggt gtt acc gct gaa att tgt cat tgg gct tct aat 4017Asn Ala Lys Ser Gly Val Thr Ala Glu Ile Cys His Trp Ala Ser Asn 470 475 480 ttg gcc acc gat gat att cca tct gat gtt ttg gaa aga gcc aag tac 4065Leu Ala Thr Asp Asp Ile Pro Ser Asp Val Leu Glu Arg Ala Lys Tyr 485 490 495 ttg atc ttg gat ggt att gct tgt gct tgg gtt ggt gct aga gtt cca 4113Leu Ile Leu Asp Gly Ile Ala Cys Ala Trp Val Gly Ala Arg Val Pro 500 505 510 tgg tct gaa aag tat gtt caa gct acc atg tct ttt gaa cca cca ggt 4161Trp Ser Glu Lys Tyr Val Gln Ala Thr Met Ser Phe Glu Pro Pro Gly 515 520 525 530 gct tgt aga gtt att ggt tat ggt caa aaa ttg ggt cca gtt gct gct 4209Ala Cys Arg Val Ile Gly Tyr Gly Gln Lys Leu Gly Pro Val Ala Ala 535 540 545 gct atg act aat tct gct ttt att caa gcc acc gaa ttg gat gat tac 4257Ala Met Thr Asn Ser Ala Phe Ile Gln Ala Thr Glu Leu Asp Asp Tyr 550 555 560 cat tct gaa gct cca ttg cat tct gct tct ata gtt ttg cca gct gtt 4305His Ser Glu Ala Pro Leu His Ser Ala Ser Ile Val Leu Pro Ala Val 565 570 575 ttt gct gct tct gaa gtt ttg gct gaa caa ggt aaa acc atc tcc ggt 4353Phe Ala Ala Ser Glu Val Leu Ala Glu Gln Gly Lys Thr Ile Ser Gly 580 585 590 att gat gtt att ttg gct gct atc gtt ggt ttc gaa tct ggt cca aga 4401Ile Asp Val Ile Leu Ala Ala Ile Val Gly Phe Glu Ser Gly Pro Arg 595 600 605 610 att ggt aaa gct atc tac ggt tct gac ttg ttg aac aat ggt tgg cat 4449Ile Gly Lys Ala Ile Tyr Gly Ser Asp Leu Leu Asn Asn Gly Trp His 615 620 625 tgt ggt gct gtt tat ggt gct cca gct ggt gct ttg gct act ggt aag 4497Cys Gly Ala Val Tyr Gly Ala Pro Ala Gly Ala Leu Ala Thr Gly Lys 630 635 640 ttg ttg ggt ttg act cca gat tct atg gaa gat gct ttg ggt att gca 4545Leu Leu Gly Leu Thr Pro Asp Ser Met Glu Asp Ala Leu Gly Ile Ala 645 650 655 tgt act caa gct tgt ggt ttg atg tct gct caa tat ggt ggt atg gtt 4593Cys Thr Gln Ala Cys Gly Leu Met Ser Ala Gln Tyr Gly Gly Met Val 660 665 670 aag aga gtt caa cac ggt ttt gct gca aga aat ggt ttg ttg ggt ggt 4641Lys Arg Val Gln His Gly Phe Ala Ala Arg Asn Gly Leu Leu Gly Gly 675 680 685 690 ttg ttg gct tat ggt ggt tat gaa gct atg aag ggt gta ttg gaa aga 4689Leu Leu Ala Tyr Gly Gly Tyr Glu Ala Met Lys Gly Val Leu Glu Arg 695 700 705 tct tac ggt ggt ttc ttg aag atg ttc act aag ggt aat ggt aga gaa 4737Ser Tyr Gly Gly Phe Leu Lys Met Phe Thr Lys Gly Asn Gly Arg Glu 710 715 720 cca cca tac aaa gaa gaa gaa gtt gtt gct ggt ttg ggt tct ttt tgg 4785Pro Pro Tyr Lys Glu Glu Glu Val Val Ala Gly Leu Gly Ser Phe Trp 725 730 735 cat act ttc acc atc aga atc aag ttg tat gct tgt tgc ggt ttg gtt 4833His Thr Phe Thr Ile Arg Ile Lys Leu Tyr Ala Cys Cys Gly Leu Val 740 745 750 cat ggt cca gtt gaa gct att gaa aag ttg caa aga aga tac cca gaa 4881His Gly Pro Val Glu Ala Ile Glu Lys Leu Gln Arg Arg Tyr Pro Glu 755 760 765 770 tta ttg aac aga gcc aac ttg tcc aac atc aga cat gtt tac gtt caa 4929Leu Leu Asn Arg Ala Asn Leu Ser Asn Ile Arg His Val Tyr Val Gln 775 780 785 ttg tct acc gcc tct aat tct cat tgt ggt tgg att cca gaa gaa aga 4977Leu Ser Thr Ala Ser Asn Ser His Cys Gly Trp Ile Pro Glu Glu Arg 790 795 800 cca att tct tct att gcc ggt caa atg tcc gtt gct tac att ttg gct 5025Pro Ile Ser Ser Ile Ala Gly Gln Met Ser Val Ala Tyr Ile Leu Ala 805 810 815 gtt caa ttg gtt gac caa caa tgt ttg ttg gcc caa ttc tcc gaa ttt 5073Val Gln Leu Val Asp Gln Gln Cys Leu Leu Ala Gln Phe Ser Glu Phe 820 825 830 gat gac aat ttg gaa aga cca gaa gtt tgg gat ttg gct aga aaa gtt 5121Asp Asp Asn Leu Glu Arg Pro Glu Val Trp Asp Leu Ala Arg Lys Val 835 840 845 850 act cca tcc cac tcc gaa gaa ttt gat caa gat ggt aac tgt ttg tcc 5169Thr Pro Ser His Ser Glu Glu Phe Asp Gln Asp Gly Asn Cys Leu Ser 855 860 865 gct ggt aga gtt aga att gag ttc aac gat ggt tcc tct gtt acc gaa 5217Ala Gly Arg Val Arg Ile Glu Phe Asn Asp Gly Ser Ser Val Thr Glu 870 875 880 act gtt gaa aaa cca ttg ggt gtc aaa gaa cct atg cca aac gaa aga 5265Thr Val Glu Lys Pro Leu Gly Val Lys Glu Pro Met Pro Asn Glu Arg 885 890 895 atc ttg cac aag tat aga act ttg gct ggt tct gtt acc gat gaa tca 5313Ile Leu His Lys Tyr Arg Thr Leu Ala Gly Ser Val Thr Asp Glu Ser 900 905 910 aga gtc aaa gaa atc gaa gat ttg gtc ttg tcc ttg gat aga ttg act 5361Arg Val Lys Glu Ile Glu Asp Leu Val Leu Ser Leu Asp Arg Leu Thr 915 920 925 930 gat att acc cct ttg ttg gaa tta ttg aat tgc cca gtt aag tcc cca 5409Asp Ile Thr Pro Leu Leu Glu Leu Leu Asn Cys Pro Val Lys Ser Pro 935 940 945 ttg gtc taactcgagg cgaatttctt atgatttatg atttttatta ttaaataagt 5465Leu Val tataaaaaaa ataagtgtat acaaatttta aagtgactct taggttttaa aacgaaaatt 5525cttattcttg agtaactctt tcctgtaggt caggttgctt tctcaggtat agcatgaggt 5585cgctcttatt gaccacacct ctaccggcat gccgagcaaa tgcctgcaaa tcgctcccca 5645tttcacccaa ttgtagatat gctaactcca gcaatgagtt gatgaatctc ggtgtgtatt 5705ttatgtcctc agaggacaac acctgttgta atcgttcttc cacactcatg gcctttataa 5765aaaggaacta tccaatacct cgccagaacc aagtaacagt attttgcggc cgc 581826458PRTArtificial SequenceSynthetic Construct 26Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Ala Ser Gln Asn 1 5 10 15 Ala Glu Thr Lys Pro Glu Pro Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Val 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Thr 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Lys Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 27490PRTArtificial SequenceSynthetic Construct 27Met Thr Lys Gln Ser Ala Asp Ser Asn Ala Lys Ser Gly Val Thr Ala 1 5 10 15 Glu Ile Cys His Trp Ala Ser Asn Leu Ala Thr Asp Asp Ile Pro Ser 20 25 30 Asp Val Leu Glu Arg Ala Lys Tyr Leu Ile Leu Asp Gly Ile Ala Cys 35 40 45 Ala Trp Val Gly Ala Arg Val Pro Trp Ser Glu Lys Tyr Val Gln Ala 50 55 60 Thr Met Ser Phe Glu Pro Pro Gly Ala Cys Arg Val Ile Gly Tyr Gly 65 70 75 80 Gln Lys Leu Gly Pro Val Ala Ala Ala Met Thr Asn Ser Ala Phe Ile 85 90 95 Gln Ala Thr Glu Leu Asp Asp Tyr His Ser Glu Ala Pro Leu His Ser 100 105 110 Ala Ser Ile Val Leu Pro Ala Val Phe Ala Ala Ser Glu Val Leu Ala 115 120 125 Glu Gln Gly Lys Thr Ile Ser Gly Ile Asp Val Ile Leu Ala Ala Ile 130 135 140 Val Gly Phe Glu Ser Gly Pro Arg Ile Gly Lys Ala Ile Tyr Gly Ser 145 150 155 160 Asp Leu Leu Asn Asn Gly Trp His Cys Gly Ala Val Tyr Gly Ala Pro 165 170 175 Ala Gly Ala Leu Ala Thr Gly Lys Leu Leu Gly Leu Thr Pro Asp Ser 180 185 190 Met Glu Asp Ala Leu Gly Ile Ala Cys Thr Gln Ala Cys Gly Leu Met 195 200 205 Ser Ala Gln Tyr Gly Gly Met Val Lys Arg Val Gln His Gly Phe Ala 210 215 220 Ala Arg Asn Gly Leu Leu Gly Gly Leu Leu Ala Tyr Gly Gly Tyr Glu 225 230 235 240 Ala Met Lys Gly Val Leu Glu Arg Ser Tyr Gly Gly Phe Leu Lys Met 245 250 255 Phe Thr Lys Gly Asn Gly Arg Glu Pro Pro Tyr Lys Glu Glu Glu Val 260 265 270 Val Ala Gly Leu Gly Ser Phe Trp His Thr Phe Thr Ile Arg Ile Lys 275 280 285 Leu Tyr Ala Cys Cys Gly Leu

Val His Gly Pro Val Glu Ala Ile Glu 290 295 300 Lys Leu Gln Arg Arg Tyr Pro Glu Leu Leu Asn Arg Ala Asn Leu Ser 305 310 315 320 Asn Ile Arg His Val Tyr Val Gln Leu Ser Thr Ala Ser Asn Ser His 325 330 335 Cys Gly Trp Ile Pro Glu Glu Arg Pro Ile Ser Ser Ile Ala Gly Gln 340 345 350 Met Ser Val Ala Tyr Ile Leu Ala Val Gln Leu Val Asp Gln Gln Cys 355 360 365 Leu Leu Ala Gln Phe Ser Glu Phe Asp Asp Asn Leu Glu Arg Pro Glu 370 375 380 Val Trp Asp Leu Ala Arg Lys Val Thr Pro Ser His Ser Glu Glu Phe 385 390 395 400 Asp Gln Asp Gly Asn Cys Leu Ser Ala Gly Arg Val Arg Ile Glu Phe 405 410 415 Asn Asp Gly Ser Ser Val Thr Glu Thr Val Glu Lys Pro Leu Gly Val 420 425 430 Lys Glu Pro Met Pro Asn Glu Arg Ile Leu His Lys Tyr Arg Thr Leu 435 440 445 Ala Gly Ser Val Thr Asp Glu Ser Arg Val Lys Glu Ile Glu Asp Leu 450 455 460 Val Leu Ser Leu Asp Arg Leu Thr Asp Ile Thr Pro Leu Leu Glu Leu 465 470 475 480 Leu Asn Cys Pro Val Lys Ser Pro Leu Val 485 490 28804DNASaccharomyces cerevisiaeCDS(1)..(804)URA3 28atg tcg aaa gct aca tat aag gaa cgt gct gct act cat cct agt cct 48Met Ser Lys Ala Thr Tyr Lys Glu Arg Ala Ala Thr His Pro Ser Pro 1 5 10 15 gtt gct gcc aag cta ttt aat atc atg cac gaa aag caa aca aac ttg 96Val Ala Ala Lys Leu Phe Asn Ile Met His Glu Lys Gln Thr Asn Leu 20 25 30 tgt gct tca ttg gat gtt cgt acc acc aag gaa tta ctg gag tta gtt 144Cys Ala Ser Leu Asp Val Arg Thr Thr Lys Glu Leu Leu Glu Leu Val 35 40 45 gaa gca tta ggt ccc aaa att tgt tta cta aaa aca cat gtg gat atc 192Glu Ala Leu Gly Pro Lys Ile Cys Leu Leu Lys Thr His Val Asp Ile 50 55 60 ttg act gat ttt tcc atg gag ggc aca gtt aag ccg cta aag gca tta 240Leu Thr Asp Phe Ser Met Glu Gly Thr Val Lys Pro Leu Lys Ala Leu 65 70 75 80 tcc gcc aag tac aat ttt tta ctc ttc gaa gac aga aaa ttt gct gac 288Ser Ala Lys Tyr Asn Phe Leu Leu Phe Glu Asp Arg Lys Phe Ala Asp 85 90 95 att ggt aat aca gtc aaa ttg cag tac tct gcg ggt gta tac aga ata 336Ile Gly Asn Thr Val Lys Leu Gln Tyr Ser Ala Gly Val Tyr Arg Ile 100 105 110 gca gaa tgg gca gac att acg aat gca cac ggt gtg gtg ggc cca ggt 384Ala Glu Trp Ala Asp Ile Thr Asn Ala His Gly Val Val Gly Pro Gly 115 120 125 att gtt agc ggt ttg aag cag gcg gca gaa gaa gta aca aag gaa cct 432Ile Val Ser Gly Leu Lys Gln Ala Ala Glu Glu Val Thr Lys Glu Pro 130 135 140 aga ggc ctt ttg atg tta gca gaa ttg tca tgc aag ggc tcc cta tct 480Arg Gly Leu Leu Met Leu Ala Glu Leu Ser Cys Lys Gly Ser Leu Ser 145 150 155 160 act gga gaa tat act aag ggt act gtt gac att gcg aag agc gac aaa 528Thr Gly Glu Tyr Thr Lys Gly Thr Val Asp Ile Ala Lys Ser Asp Lys 165 170 175 gat ttt gtt atc ggc ttt att gct caa aga gac atg ggt gga aga gat 576Asp Phe Val Ile Gly Phe Ile Ala Gln Arg Asp Met Gly Gly Arg Asp 180 185 190 gaa ggt tac gat tgg ttg att atg aca ccc ggt gtg ggt tta gat gac 624Glu Gly Tyr Asp Trp Leu Ile Met Thr Pro Gly Val Gly Leu Asp Asp 195 200 205 aag gga gac gca ttg ggt caa cag tat aga acc gtg gat gat gtg gtc 672Lys Gly Asp Ala Leu Gly Gln Gln Tyr Arg Thr Val Asp Asp Val Val 210 215 220 tct aca gga tct gac att att att gtt gga aga gga cta ttt gca aag 720Ser Thr Gly Ser Asp Ile Ile Ile Val Gly Arg Gly Leu Phe Ala Lys 225 230 235 240 gga agg gat gct aag gta gag ggt gaa cgt tac aga aaa gca ggc tgg 768Gly Arg Asp Ala Lys Val Glu Gly Glu Arg Tyr Arg Lys Ala Gly Trp 245 250 255 gaa gca tat ttg aga aga tgc ggc cag caa aac taa 804Glu Ala Tyr Leu Arg Arg Cys Gly Gln Gln Asn 260 265 29267PRTSaccharomyces cerevisiae 29Met Ser Lys Ala Thr Tyr Lys Glu Arg Ala Ala Thr His Pro Ser Pro 1 5 10 15 Val Ala Ala Lys Leu Phe Asn Ile Met His Glu Lys Gln Thr Asn Leu 20 25 30 Cys Ala Ser Leu Asp Val Arg Thr Thr Lys Glu Leu Leu Glu Leu Val 35 40 45 Glu Ala Leu Gly Pro Lys Ile Cys Leu Leu Lys Thr His Val Asp Ile 50 55 60 Leu Thr Asp Phe Ser Met Glu Gly Thr Val Lys Pro Leu Lys Ala Leu 65 70 75 80 Ser Ala Lys Tyr Asn Phe Leu Leu Phe Glu Asp Arg Lys Phe Ala Asp 85 90 95 Ile Gly Asn Thr Val Lys Leu Gln Tyr Ser Ala Gly Val Tyr Arg Ile 100 105 110 Ala Glu Trp Ala Asp Ile Thr Asn Ala His Gly Val Val Gly Pro Gly 115 120 125 Ile Val Ser Gly Leu Lys Gln Ala Ala Glu Glu Val Thr Lys Glu Pro 130 135 140 Arg Gly Leu Leu Met Leu Ala Glu Leu Ser Cys Lys Gly Ser Leu Ser 145 150 155 160 Thr Gly Glu Tyr Thr Lys Gly Thr Val Asp Ile Ala Lys Ser Asp Lys 165 170 175 Asp Phe Val Ile Gly Phe Ile Ala Gln Arg Asp Met Gly Gly Arg Asp 180 185 190 Glu Gly Tyr Asp Trp Leu Ile Met Thr Pro Gly Val Gly Leu Asp Asp 195 200 205 Lys Gly Asp Ala Leu Gly Gln Gln Tyr Arg Thr Val Asp Asp Val Val 210 215 220 Ser Thr Gly Ser Asp Ile Ile Ile Val Gly Arg Gly Leu Phe Ala Lys 225 230 235 240 Gly Arg Asp Ala Lys Val Glu Gly Glu Arg Tyr Arg Lys Ala Gly Trp 245 250 255 Glu Ala Tyr Leu Arg Arg Cys Gly Gln Gln Asn 260 265 304920DNAArtificial SequenceAspergillus expression vector pABgpd-I 30ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120gatagggttg agtggccgct acagggcgct cccattcgcc attcaggctg cgcaactgtt 180gggaagggcg tttcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt 240gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg 300acggccagtg agcgcgacgt aatacgactc actatagggc gaattggcgg aaggccgtca 360aggccgcggc cgctcaggag gcgaatagat aattttgaaa tccctactga tacggcttcc 420caacgaggta ggagcggaaa ggatgatgag tggccaagta cctgccgatg ctttgttgtc 480tcacgacttg agtctcctga tataccaaca tcggtggccg gtgaagacaa tgaagacata 540tttctaagca atatgggctg tggccactcc gtgccacttg ctcgaagtaa cctgttgcat 600ttaccccatg taaggctgga ggctggatgg ggccactttg cagcagtatg tagaaagtac 660tagaaccatc ttccggtctc cgagacactg gtcaatattg acacggcagc atgatcatga 720aacccgagtc agaccagagc cgttcggatt gtgctatacc ccaagtcacg ttgtccataa 780ttgaataaat atgagcagtc ctttgtggcg tggaaacata cttagcatgt agagacaaac 840cttggtgcgc ggcttcaggc gggcatagtt agtatgctac ggtaccaccg atcttattgt 900accagaaaaa gtcccagcca gtccaatccc cattctaagc cacatgcatc cgttcgcatg 960catctgacat atcagattcg tccatctggt gcagtatcta acagaggcca gagcatcacc 1020aacatgggta ccctcagcaa taatatgcat gcattgtgcc ccccctatgg agccgtagct 1080ttcaagcaat tagacacgcg cccggccgaa tgagatgaac cgttggagcc atcatcccac 1140tcatcccgct ccagaaagga gagaaagaaa aaaaaaaaat atgaccgagc gcgtgatgac 1200cggtgaggac tccggtgaat tgatttgggt gacgggagag acccaagagg ggccagaata 1260ataagaatgg ggaaggcgaa ggtaccgcct ttggggtcca gccacgcgac tccaacatgg 1320aggggcactg gactaacatt attccagcac cgggatcacg ggccgaaagc ggcaaggccg 1380cgcactgccc ctctttttgg gtgaaagagc tggcagtaac ttaactgtac tttctggagt 1440gaataatact actactatga aagaccgcga tgggccgata gtagtagtta cttccattac 1500atcatctcat ccgcccggtt cctcgcctcc gcggcagtct acgggtagga tcgtagcaaa 1560aacccggggg atagacccgt cgtcccgagc tggagttccg tataacctag gtagaaggta 1620tcaattgaac ccgaacaact ggcaaaacat tctcgagatc gtaggagtga gtacccggcg 1680tgatggaggg ggagcacgct cattggtccg tacggcagct gccgaggggg agcaggagat 1740ccaaatatcg tgagtctcct gctttgcccg gtgtatgaaa ccggaaagga tccaaatatc 1800gtgagtctcc tgctttgccc ggtgtatgaa accggaaagg actgctgggg aactggggag 1860cggcgcaagc cgggaatccc agctgacaat tgacccatcc tcatgccgtg gcagagcttg 1920aggtagcttt tgccccgtct gtctccccgg tgtgcgcatt cgactgggcg cggcatctgt 1980gcctcctcca ggagcggagg acccagtagt aagtaggcct gacctggtcg ttgcgtcagt 2040ccagaggttc cctcccctac cctttttcta cttcccctcc cccgccgctc aacttttctt 2100tcccttttac tttctctctc tcttcctctt catccatcct ctcttcatca cttccctctt 2160cccttcatcc aattcatctt ccaagtgagt cttcctcccc atctgtccct ccatctttcc 2220catcatcatc tcccctccca gctcctcccc tcctctcgtc tcctcacgaa gcttgactaa 2280ccattacccc gccacataga cacatctaaa ccatggacgt agttaattaa agatctaatc 2340aggacggcaa actcaattca gaagtgtgct gtgagtgaga ctgattgccg agcgcagacg 2400actctcgtgg aacccggctt gtggagaagc ttgagaaggt cttaactcct agcgtaaaag 2460ctcatgatga cgtacaattt aatgaaatga tacaatgttc atatttcccg ttcaaatttc 2520cggccttggt cagtgcgtaa gatgtccacg attgaatact aactcagtat gggtttggta 2580gcattggcaa tgtagttata agcatgcacc ggttgaagac gtcggcccca gatgcaatgc 2640tgcggtggtg actaagctct gcagtgaatg gaatgcgttt ctttgatcga cttcggcgtg 2700ccgcgggatt ttctcggcgc ttctactggt gcagaaagga cgataccact ggctttcggt 2760ccatgccaca tcccagtctc ccgggaaatt cattgcatac tttaagaaac aaactgatct 2820ccataatttc cgtctttaga gttcacttgg tacttttggg tggatcgagg ggtgtccgcg 2880gccatccaag tcacgtggag ggcagctaga ccacggattt tagagctaca ttgatccaag 2940actcctggac cggcctcatg ggccttccgc tcactgcccg ctttccagtc gggaaacctg 3000tcgtgccagc tgcattaaca tggtcatagc tgtttccttg cgtattgggc gctctccgct 3060tcctcgctca ctgactcgct gcgctcggtc gttcgggtaa agcctggggt gcctaatgag 3120caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata 3180ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 3240cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg 3300ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc 3360tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg 3420gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc 3480ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga 3540ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg 3600gctacactag aagaacagta tttggtatct gcgctctgct gaagccagtt accttcggaa 3660aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg 3720tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt 3780ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat 3840tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct 3900aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta 3960tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa 4020ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagaaccac 4080gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa 4140gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag 4200taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg 4260tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag 4320ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg 4380tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc 4440ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat 4500tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata cgggataata 4560ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa 4620aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca 4680actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc 4740aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc 4800tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg 4860aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac 492031458PRTAspergillus niger 31Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Ala Ser Gln Asn 1 5 10 15 Ala Glu Thr Lys Pro Glu Pro Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Val 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Thr 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Lys Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 32458PRTAspergillus niger 32Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Ala Ser Gln Asn 1 5 10 15 Ala Glu Thr Lys Pro Glu Pro Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser

Val Pro Val 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Thr 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Lys Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Leu Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 33458PRTZea mays 33Met Pro Asp Ile Ala Pro Asn Val Ala Arg Asn Gly Ser Ser Lys His 1 5 10 15 Ala Glu Thr Lys Pro Glu Thr Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Asn Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Ile 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Ser 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Gln Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 34458PRTAspergillus kawachii 34Met Pro Asp Ile Ala Pro Asn Val Ala Arg Asn Gly Ser Ala Lys Asn 1 5 10 15 Ala Glu Asn Lys Pro Glu Thr Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Asn Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Arg Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Ile 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Ser 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Gln Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Leu Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Ser Arg Glu Met Ala 450 455 35447PRTAspergillus oryzae 35Met Thr Val Thr Gln Glu Ala Ser Pro Lys Arg Glu Ser Leu His Ile 1 5 10 15 Ile Asp Asp Arg Thr Gly Ser Tyr Tyr Ser Ile Pro Ile Val Asn Asn 20 25 30 Ala Ile Asn Ala Ser Asp Phe Lys Lys Val Thr Ala Pro Glu Asp Lys 35 40 45 Ala Tyr Pro Ala Asn Gln Thr Glu Asn Gly Leu Arg Val Tyr Asp Pro 50 55 60 Gly Tyr Ser Asn Thr Ala Val Ser His Ser Lys Ile Thr Tyr Ile Asp 65 70 75 80 Gly Leu Lys Gly Thr Ile Gln Tyr Arg Gly Tyr Ser Ile Asn Asp Ile 85 90 95 Val Gly Arg Lys Thr Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly 100 105 110 His Trp Pro Ser Ala Ala Glu Ala Glu Thr Leu Gln Gln Arg Leu Asp 115 120 125 Gln Val Pro Val Pro Gln Asp Phe Val Phe Asn Val Ile Lys Ser Phe 130 135 140 Pro Arg Asp Gly Ser Leu Met Gly Met Val Ile Ala Gly Leu Ser Ala 145 150 155 160 Leu Gln Ser Ser Asp Met Asn Ala Ile Pro Ala His Val Gly Lys Thr 165 170 175 Ile Tyr Leu Asn Asn Pro Glu Leu Ala Asp Gln Gln Ile Ile Arg Val 180 185 190 Met Ala Asn Met Ser Met Leu Thr Ala Ala Ala Tyr Cys His His Ile 195 200 205 Gly Arg Asp Phe Thr Pro Pro Arg Ala Gly Leu Ser Tyr Ile Glu Asn 210 215 220 Phe Leu Leu Met Thr Gly His Val Glu Ala Ala Thr Gly Leu Pro Asn 225 230 235 240 Pro Arg Tyr Val Asn Ala Ile Glu Arg Leu Trp Val Leu Ile Ala Asp 245 250 255 His Glu Met Thr Cys Ser Thr Ala Ala Leu Leu Gln Thr Ala Ser Ala 260 265 270 Leu Pro Asp Val Ile Ser Cys Met Val Ser Ala Ile Ser Ala Leu Tyr 275 280 285 Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Ile Glu 290 295 300 Ser Ile Gly Ser Ile Ser Asn Val Pro Ala Lys Ile Ala Arg Val Lys 305 310 315 320 Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Val Tyr Arg Val 325 330 335 Thr Asp Pro Arg Phe Val Phe Ile Arg Glu Ile Leu Asn Glu Leu Ser 340 345 350 Glu Glu Val Glu Lys Asp Pro Leu Leu Lys Val Ala Phe Glu Val Asp 355 360 365 Arg Val Ala Ser Glu Asp Glu Tyr Phe Thr Ser Arg Asn Leu Arg Pro 370 375 380 Asn Ala Asp Leu Phe Ala Ala Phe Val Tyr Lys Ala Leu Gly Phe Pro 385 390 395 400 Pro Glu Phe Ile Leu Pro Leu Ser Ile Leu Ser Arg Thr Gln Gly Phe 405 410 415 Met Ala His Trp Arg Glu Ala Met Gly Asn Pro Pro Arg Ile Trp Arg 420 425 430 Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn Lys Ser Met Asp Glu 435 440 445 36447PRTAspergillus oryzae 36Met Thr Val Thr Gln Glu Ala Ser Pro Lys Arg Glu Ser Leu His Ile 1 5 10 15 Ile Asp Asp Arg Thr Gly Ser Tyr Tyr Ser Ile Pro Ile Val Asn Asn 20 25 30 Ala Ile Asn Ala Ser Asp Phe Lys Lys Val Thr Ala Pro Glu Asp Lys 35 40 45 Ala Tyr Pro Ala Asn Gln Thr Glu Asn Gly Leu Arg Val Tyr Asp Pro 50 55 60 Gly Tyr Ser Asn Thr Ala Val Ser His Ser Lys Ile Thr Tyr Ile Asp 65 70 75 80 Gly Leu Lys Gly Thr Ile Gln Tyr Arg Gly Tyr Ser Ile Asn Asp Ile 85 90 95 Val Gly Arg Lys Thr Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly 100 105 110 His Trp Pro Ser Thr Ala Glu Ala Glu Thr Leu Gln Gln Arg Leu Asp 115 120 125 Gln Val Pro Val Pro Gln Asp Phe Val Phe Asn Val Ile Lys Ser Phe 130 135 140 Pro Arg Asp Gly Ser Leu Met Gly Met Val Ile Ala Gly Leu Ser Ala 145 150 155 160 Leu Gln Ser Ser Asp Met Asn Ala Ile Pro Ala His Val Gly Lys Thr 165 170 175 Ile Tyr Leu Asn Asn Pro Glu Leu Ala Asp Gln Gln Ile Ile Arg Val 180 185 190 Met Ala Asn Met Ser Met Leu Thr Ala Ala Ala Tyr Cys His His Ile 195 200 205 Gly Arg Asp Phe Thr Pro Pro Arg Ala Gly Leu Ser Tyr Ile Glu Asn 210 215 220 Phe Leu Leu Met Thr Gly His Val Glu Ala Ala Thr Gly Leu Pro Asn 225 230 235 240 Pro Arg Tyr Val Asn Ala Ile Glu Arg Leu Trp Val Leu Ile Ala Asp 245 250 255 His Glu Met Thr Cys Ser Thr Ala Ala Leu Leu Gln Thr Ala Ser Ala 260 265 270 Leu Pro Asp Val Ile Ser Cys Met Val Ser Ala Ile Ser Ala Leu Tyr 275 280 285 Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Ile Glu 290 295 300 Ser Ile Gly Ser Ile Ser Asn Val Pro Ala Lys Ile Ala Arg Val Lys 305 310 315 320 Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Val Tyr Arg Val 325 330 335 Thr Asp Pro Arg Phe Val Phe Ile Arg Glu Ile Leu Asn Glu Leu Ser 340 345 350 Glu Glu Val Glu Lys Asp Pro Leu Leu Lys Val Ala Phe Glu Val Asp 355 360 365 Arg Val Ala Ser Glu Asp Glu Tyr Phe Thr Ser Arg Asn Leu Arg Pro 370 375 380 Asn Ala Asp Leu Phe Ala Ala Phe Val Tyr Lys Ala Leu Gly Phe Pro 385 390 395 400 Pro Glu Phe Ile Leu Pro Leu Ser Ile Leu Ser Arg Thr Gln Gly Phe 405 410 415 Met Ala His Trp Arg Glu Ala Met Gly Asn Pro Pro Arg Ile Trp Arg 420 425 430 Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn Lys Ser Met Asp Glu 435 440 445 37447PRTAspergillus oryzae 37Met Thr Val Thr Gln Glu Ala Ser Pro Lys Arg Glu Ser Leu His Ile 1 5 10 15 Ile Asp Asp Arg Thr Gly Ser Tyr Tyr Ser Ile Pro Ile Val Asn Asn 20 25 30 Ala Ile Asn Ala Ser Asp Phe Lys Lys Val Thr Ala Pro Glu Asp Lys 35 40 45 Ala Tyr Pro Ala Asn Gln Thr Glu Asn Gly Leu Arg Val Tyr Asp Pro 50 55 60 Gly Tyr Ser Asn Thr Ala Val Ser His Ser Lys Ile Thr Tyr Ile Asp 65 70 75 80 Gly Leu Lys Gly Thr Ile Gln Tyr Arg Gly Tyr Ser Ile Asn Asp Ile 85 90 95 Val Gly Arg Lys Thr Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly 100 105 110 His Trp Pro Ser Thr Ala Glu Ala Glu Thr Leu Gln Gln Arg Leu Asp 115 120 125 Gln Val Pro Val Pro Gln Asp Phe Val Phe Asn Val Ile Lys Ser Phe 130 135 140 Pro Arg Asp Gly Ser Leu Met Gly Met Val Ile Ala Gly Leu Ser Ala 145 150

155 160 Leu Gln Ser Ser Asp Met Asn Ala Ile Pro Ala His Val Gly Lys Thr 165 170 175 Ile Tyr Leu Asn Asn Pro Glu Leu Ala Asp Gln Gln Ile Ile Arg Val 180 185 190 Met Ala Asn Met Ser Met Leu Thr Ala Ala Ala Tyr Cys His His Ile 195 200 205 Gly Arg Asp Phe Thr Pro Pro Arg Ala Gly Leu Ser Tyr Ile Glu Asn 210 215 220 Phe Leu Leu Met Thr Gly His Val Glu Ala Ala Thr Gly Leu Pro Asn 225 230 235 240 Pro Arg Tyr Val Asn Ala Ile Glu Arg Leu Trp Val Leu Ile Ala Asp 245 250 255 His Glu Met Thr Cys Ser Thr Ala Ala Leu Leu Gln Thr Ala Ser Ala 260 265 270 Leu Pro Asp Val Ile Ser Cys Met Val Ser Ala Ile Ser Ala Leu Tyr 275 280 285 Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Ile Glu 290 295 300 Ser Ile Gly Ser Ile Ser Asn Val Pro Ala Lys Ile Ala Arg Val Lys 305 310 315 320 Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Val Tyr Arg Val 325 330 335 Thr Asp Pro Arg Phe Val Phe Ile Arg Glu Ile Leu Asn Glu Leu Ser 340 345 350 Glu Glu Val Glu Lys Asp Pro Leu Leu Lys Val Ala Phe Glu Val Asp 355 360 365 Arg Val Ala Ser Glu Asp Glu Tyr Phe Thr Ser Arg Asn Leu Arg Pro 370 375 380 Asn Ala Asp Leu Phe Ala Ala Phe Val Tyr Lys Ala Leu Gly Phe Pro 385 390 395 400 Pro Glu Phe Ile Leu Pro Leu Ser Ile Leu Ser Arg Thr Gln Gly Phe 405 410 415 Met Ala His Trp Arg Glu Ala Met Gly Asn Pro Pro Arg Ile Trp Arg 420 425 430 Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn Lys Ser Met Asp Glu 435 440 445 38466PRTAspergillus flavus 38Met Thr Val Thr Gln Glu Ala Ser Pro Lys Arg Glu Ser Leu His Ile 1 5 10 15 Ile Asp Asp Arg Thr Gly Ser Tyr Tyr Ser Ile Pro Ile Val Asn Asn 20 25 30 Ala Ile Asn Ala Ser Asp Phe Lys Lys Val Thr Ala Pro Glu Asp Lys 35 40 45 Ala Tyr Pro Ala Asn Gln Thr Glu Asn Gly Leu Arg Val Tyr Asp Pro 50 55 60 Gly Tyr Ser Asn Thr Ala Val Ser His Ser Lys Ile Thr Tyr Ile Asp 65 70 75 80 Gly Leu Lys Gly Thr Ile Gln Tyr Arg Gly Tyr Ser Ile Asn Asp Ile 85 90 95 Val Gly Arg Lys Thr Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly 100 105 110 His Trp Pro Ser Thr Ala Glu Ala Glu Thr Leu Gln Gln Arg Leu Asp 115 120 125 Gln Val Pro Val Pro Gln Asp Phe Val Phe Asn Val Ile Lys Ser Phe 130 135 140 Pro Arg Asp Gly Ser Leu Met Gly Met Val Ile Ala Gly Leu Ser Ala 145 150 155 160 Leu Gln Ser Ser Asp Met Asn Ala Ile Pro Ala His Val Gly Lys Thr 165 170 175 Ile Tyr Leu Asn Asn Pro Glu Leu Ala Asp Gln Gln Ile Ile Arg Val 180 185 190 Met Ala Asn Met Ser Met Leu Thr Ala Ala Ala Tyr Cys His His Ile 195 200 205 Gly Arg Asp Phe Thr Pro Pro Arg Ala Gly Leu Ser Tyr Ile Glu Asn 210 215 220 Phe Leu Leu Met Thr Gly His Val Glu Ala Ala Thr Gly Leu Pro Asn 225 230 235 240 Pro Arg Tyr Val Asn Ala Ile Glu Arg Leu Trp Val Leu Ile Ala Asp 245 250 255 His Glu Met Thr Cys Ser Thr Ala Ala Leu Leu Gln Thr Ala Ser Ala 260 265 270 Leu Pro Asp Val Ile Ser Cys Met Val Ser Ala Ile Ser Ala Leu Tyr 275 280 285 Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Ile Glu 290 295 300 Ser Ile Gly Ser Ile Ser Asn Val Pro Ala Lys Ile Ala Arg Val Lys 305 310 315 320 Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Val Tyr Arg Val 325 330 335 Thr Asp Pro Arg Phe Val Phe Ile Arg Glu Ile Leu Asn Glu Leu Ser 340 345 350 Glu Glu Val Glu Lys Asp Pro Leu Leu Lys Val Ala Phe Glu Val Asp 355 360 365 Arg Val Ala Ser Glu Asp Glu Tyr Phe Thr Ser Arg Asn Leu Arg Pro 370 375 380 Asn Ala Asp Leu Phe Ala Ala Phe Val Tyr Lys Ala Leu Gly Phe Pro 385 390 395 400 Pro Glu Phe Ile Leu Pro Leu Ser Ile Leu Ser Arg Thr Gln Gly Phe 405 410 415 Met Ala His Trp Arg Glu Ala Met Gly Met Pro Glu Ser Thr Leu Asn 420 425 430 Ser Ser Arg Ser Ile Cys Pro Asp Thr Asn Ile Gly Asn Pro Pro Arg 435 440 445 Ile Trp Arg Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn Lys Ser Met 450 455 460 Asp Glu 465 39447PRTAspergillus flavus 39Met Thr Val Thr Gln Glu Ala Ser Pro Lys Arg Glu Ser Leu His Ile 1 5 10 15 Ile Asp Asp Arg Thr Gly Ser Tyr Tyr Ser Ile Pro Ile Val Asn Asn 20 25 30 Ala Ile Asn Ala Ser Asp Phe Lys Lys Val Thr Ala Pro Glu Asp Lys 35 40 45 Ala Tyr Pro Ala Asn Gln Thr Glu Asn Gly Leu Arg Val Tyr Asp Pro 50 55 60 Gly Tyr Ser Asn Thr Ala Val Ser His Ser Lys Ile Thr Tyr Ile Asp 65 70 75 80 Gly Leu Lys Gly Thr Ile Gln Tyr Arg Gly Tyr Ser Ile Asn Asp Ile 85 90 95 Val Gly Arg Lys Thr Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly 100 105 110 His Trp Pro Ser Thr Ala Glu Ala Glu Thr Leu Gln Gln Arg Leu Asp 115 120 125 Gln Val Pro Val Pro Gln Asp Phe Val Phe Asn Val Ile Lys Ser Phe 130 135 140 Pro Arg Asp Gly Ser Leu Met Gly Met Val Ile Ala Gly Leu Ser Ala 145 150 155 160 Leu Gln Ser Ser Asp Met Asn Ala Ile Pro Ala His Val Gly Lys Thr 165 170 175 Ile Tyr Leu Asn Asn Pro Glu Leu Ala Asp Gln Gln Ile Ile Arg Val 180 185 190 Met Ala Asn Met Ser Met Leu Thr Ala Ala Ala Tyr Cys His His Ile 195 200 205 Gly Arg Asp Phe Thr Pro Pro Arg Ala Gly Leu Ser Tyr Ile Glu Asn 210 215 220 Phe Leu Leu Met Thr Gly His Val Glu Ala Ala Thr Gly Leu Pro Asn 225 230 235 240 Pro Arg Tyr Val Asn Ala Ile Glu Arg Leu Trp Val Leu Ile Ala Asp 245 250 255 His Glu Met Thr Cys Ser Thr Ala Ala Leu Leu Gln Thr Ala Ser Ala 260 265 270 Leu Pro Asp Val Ile Ser Cys Met Val Ser Ala Ile Ser Ala Leu Tyr 275 280 285 Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Ile Glu 290 295 300 Ser Ile Gly Ser Ile Ser Asn Val Pro Ala Lys Ile Ala Arg Val Lys 305 310 315 320 Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Val Tyr Arg Val 325 330 335 Thr Asp Pro Arg Phe Val Phe Ile Arg Glu Ile Leu Asn Glu Leu Ser 340 345 350 Glu Glu Val Glu Lys Asp Pro Leu Leu Lys Val Ala Phe Glu Val Asp 355 360 365 Arg Val Ala Ser Glu Asp Glu Tyr Phe Thr Ser Arg Asn Leu Arg Pro 370 375 380 Asn Ala Asp Leu Phe Ala Ala Phe Val Tyr Lys Ala Leu Gly Phe Pro 385 390 395 400 Pro Glu Phe Ile Leu Pro Leu Ser Ile Leu Ser Arg Thr Gln Gly Phe 405 410 415 Met Ala His Trp Arg Glu Ala Met Gly Asn Pro Pro Arg Ile Trp Arg 420 425 430 Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn Lys Ser Met Asp Glu 435 440 445 40463PRTTalaromyces marneffei 40Met Ser Pro Ala Ala Ile Ile Ser Ser Asp Asp Ala Ala Lys Ser Val 1 5 10 15 Asp Ala Lys Ala Ser Ala Lys Thr Ile Ser Arg Asn Phe Leu His Val 20 25 30 Ile Asp Glu Arg Thr Gly Gln Tyr Tyr Gln Ile Pro Ile His His Asn 35 40 45 Ala Ile Ser Ala Asn Glu Phe Lys Lys Ile Lys Ala Pro Asp Ser Glu 50 55 60 Tyr Tyr Ala Asp Gln Asn Glu Asn Gly Ile Arg Val Phe Asp Pro Gly 65 70 75 80 Phe Thr Asn Thr Ala Val Val Glu Ser Lys Val Thr Tyr Val Asp Gly 85 90 95 Lys Arg Gly Lys Ile Gln Tyr Arg Gly Tyr Asp Leu Ala Asp Val Val 100 105 110 Ala Asn Asn Lys Lys Phe Ile Asp Thr Ala His Leu Met Val Phe Gly 115 120 125 Phe Trp Pro Thr Ala Glu Glu Gly Ala Gly Phe Gln Gln Lys Leu Phe 130 135 140 Asp Ala Met His Ile Glu Gln Cys Val Ile Asp Thr Ile His Ala Phe 145 150 155 160 Pro Arg Thr Ala Ser Thr Thr Leu Met Leu Thr Ala Gly Leu Ala Ala 165 170 175 Val Gln Ala Thr Gln Met Asp Arg Ile Pro Ala His Met Ala Lys Asn 180 185 190 Leu Tyr Leu Gly Asn Pro Thr Leu Val Asp Glu Gln Ile Val Arg Leu 195 200 205 Met Gly Val Leu Pro Ile Val Ser Ala Val Ala Tyr Cys His His Thr 210 215 220 Gly Arg Glu Phe Lys Ser Pro Arg Ser Asp Leu Thr Tyr Ile Glu Asn 225 230 235 240 Phe Leu Tyr Met Cys Gly His Val Gln Glu Glu Thr Gly Leu Pro Asn 245 250 255 Pro Arg Tyr Val Gln Asn Phe Glu Arg Leu Trp Ser Leu Val Ala Asp 260 265 270 His Glu Met Thr Cys Ser Thr Ala Ala Val Leu Leu Thr Ala Ser Ser 275 280 285 Leu Pro Asp Pro Ile Ser Cys Ile Ile Ser Gly Ile Gly Ala Ser Tyr 290 295 300 Gly Pro Leu His Gly Gly Ala Ile Glu Phe Ala Tyr Lys Asp Met Ala 305 310 315 320 Asp Ile Gly Ser Val Asp Asn Cys Gln Thr Lys Ile Asp Arg Val Lys 325 330 335 Ser Gly Lys Glu Arg Leu Phe Gly Tyr Gly His Arg Val Tyr Lys Val 340 345 350 Thr Asp Pro Arg Ser Glu His Ile Gln Ala Val Leu Glu Thr Leu Lys 355 360 365 Glu Glu Ile Asp Asn Asp Pro Leu Leu Lys Val Ala Phe Glu Leu Asn 370 375 380 Arg Ile Ala Gln Glu Asp Glu Tyr Phe Val Ser Arg Gly Leu Lys Pro 385 390 395 400 Asn Ala Asp Leu Phe Ala Ala Phe Thr Tyr Gly Ala Met Gly Phe Pro 405 410 415 Pro Asp Phe Ile Leu Thr Ile Ser Thr Ile Ser Arg Thr Gln Gly Leu 420 425 430 Met Ala His Trp Lys Glu Ala Met Ser Gly Lys Pro Leu Ile Trp Arg 435 440 445 Pro Thr Gln Val Tyr Thr Gly Lys Leu Asp Leu Lys Met Glu Val 450 455 460 41458PRTAspergillus acidus 41Met Pro Asp Ile Ala Pro Asn Val Ala Arg Asn Gly Ser Ala Lys Asn 1 5 10 15 Ala Glu Asn Lys Pro Glu Thr Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Asn Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Ile 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Ser 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Gln Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Leu Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 42458PRTAspergillus carbonarius 42Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Thr Ser Ala His 1 5 10 15 Ala Glu Asp Lys Pro Asp Thr Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Lys Tyr His Ser Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Thr Pro Glu Asp Pro Glu His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Lys Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Arg Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Asp Trp Pro Thr 115 120 125 Pro Glu Gln Ala Gln Thr Leu His Glu Lys Leu Ala Ser Val Pro Val 130 135 140 Ile Asn Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ala 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser

Ala Val Gln Ser Ser 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Val Pro Lys Ala Val Asp Asp Glu Ile Ile Arg Leu Met Gly Thr Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Ile Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Asp Ala Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Thr 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Thr Phe Ile Ser Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Ile Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Ser Arg Arg Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Thr Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Gly Ser Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Glu 450 455 43451PRTAspergillus carbonarius 43Met Thr Thr Asn Gly Ile Asn Gly Thr Asn Gly Val Asp Ala Val Pro 1 5 10 15 Ser Leu His Val Val Asp Ser Arg Thr Gly Gln Tyr Tyr Glu Ile Pro 20 25 30 Ile Val His Asn Ala Ile His Ala Ser Glu Phe Lys Arg Ile Lys Ala 35 40 45 Pro Leu Asn Glu Asp Tyr Tyr Pro Asp Gln Thr Glu Asn Gly Ile Arg 50 55 60 Val Phe Asp Pro Gly Phe Ser Asn Thr Ala Val Lys Glu Ser Lys Ile 65 70 75 80 Thr Tyr Ile Asp Gly Thr Lys Gly Ile Ile Gln Tyr Arg Gly Tyr Ser 85 90 95 Ile Asp Asp Ile Ile Arg Gln Gly Lys Ser Phe Ile Asp Thr Val His 100 105 110 Leu Leu Ile Trp Gly His Trp Pro Ser Pro Ile Glu Ala Lys Lys Leu 115 120 125 Gln Ile Arg Ile Ser Asp Ala Met Thr Leu Asp Gly Ser Val Tyr Gln 130 135 140 Val Ile Arg Ser Phe Pro Pro Ser Gly Ser Ile Met Gly Met Ile Ile 145 150 155 160 Ala Gly Leu Ser Ala Leu Gln Ser Thr Gln Met His Thr Val Pro Ala 165 170 175 His Ala Ala Lys Asn Leu Tyr Leu Gly Asn Pro Glu Ala Val Asp Glu 180 185 190 Gln Ile Ile Thr Val Leu Ala Ala Leu Pro Met Ile Ser Ala Ile Ala 195 200 205 Tyr Cys His His Leu Asn Arg Pro Phe Thr Pro Pro Arg Arg Asp Leu 210 215 220 Ser Tyr Ile Glu Asn Leu Phe Leu Met Thr Gly His Val Asp Pro Gln 225 230 235 240 Thr Ser Leu Pro Asn Pro Arg Tyr Val Gly Tyr Phe Glu Arg Leu Trp 245 250 255 Val Leu Ile Ala Asp His Glu Met Thr Cys Ser Thr Ala Ala Met Leu 260 265 270 Gln Thr Ala Ser Ser Leu Pro Asp Ala Ile Ser Ser Leu Ile Ser Ala 275 280 285 Ile Ser Ala Met Tyr Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala 290 295 300 Tyr Arg Asp Ile Ala Ala Ile Gly Ser Ile Pro Ala Cys Gln Glu Lys 305 310 315 320 Ile Asp Arg Val Lys Ser Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His 325 330 335 Arg Val Tyr Arg Val Thr Asp Pro Arg Ala Val His Ile Gln Ala Val 340 345 350 Leu Ala Glu Leu Gln Glu Glu Ile Ala Gln Asp Pro Leu Leu Lys Val 355 360 365 Ala Phe Glu Leu Asn Arg Leu Ala Ala Asp Asp Glu Tyr Phe Val Lys 370 375 380 Arg Lys Leu Lys Pro Asn Ala Asp Leu Phe Ala Ala Phe Thr Tyr Gly 385 390 395 400 Ala Met Gly Phe Pro Glu Glu Phe Ile Leu Pro Ile Ser Ile Ile Ser 405 410 415 Arg Thr Gln Gly Phe Leu Ala His Trp Lys Glu Ala Met Gly Gly Thr 420 425 430 Ala Lys Ile Trp Arg Pro Gly Gln Val Tyr Val Gly Glu Val Asp Arg 435 440 445 Lys Phe Glu 450 44462PRTAspergillus brasiliensis 44Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Thr Ser Gln His 1 5 10 15 Ala Asp Lys Pro Glu Pro Pro Val Leu His Val Val Asp Ser Arg Thr 20 25 30 Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala Ser 35 40 45 Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu Asp 50 55 60 Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn Thr 65 70 75 80 Ala Val Ser Glu Ser Gln Ile Thr Tyr Ile Asp Gly Leu Lys Gly Thr 85 90 95 Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asn Ile Val Gly Lys Lys Lys 100 105 110 Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr Pro 115 120 125 Glu Glu Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Val Leu 130 135 140 Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Leu Thr Ala Pro 145 150 155 160 Ser Pro Asn Ser Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala 165 170 175 Val Gln Ser Ser Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn 180 185 190 Leu Tyr Leu Gly Asn Pro Lys Ala Val Asp Asp Glu Ile Ile Arg Leu 195 200 205 Met Gly Ser Leu Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr 210 215 220 Gly Arg Glu Phe Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn 225 230 235 240 Phe Leu Leu Met Met Gly His Val Glu Ser Thr Thr Gly Leu Pro Asn 245 250 255 Pro Gln Tyr Val Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp 260 265 270 His Glu Met Thr Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser 275 280 285 Leu Pro Asp Val Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr 290 295 300 Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu 305 310 315 320 Glu Ile Gly Ser Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys 325 330 335 Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val 340 345 350 Thr Asp Pro Arg Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys 355 360 365 Glu Glu Ile Ala Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp 370 375 380 Arg Val Ala Ser Glu Asp Glu Tyr Phe Val Ser Arg Lys Leu Arg Pro 385 390 395 400 Asn Ala Asp Leu Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro 405 410 415 Thr Glu Phe Ile Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe 420 425 430 Met Ala His Trp Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg 435 440 445 Pro Gly Gln Ile Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 460 45458PRTAspergillus tubingensis 45Met Pro Asp Ile Ala Pro Asn Val Ala Arg Asn Gly Ser Ser Lys His 1 5 10 15 Ala Glu Thr Lys Pro Glu Thr Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Asn Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Ala 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Ile 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Ser 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Gln Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 46457PRTPestalotiopsis fici 46Met Ser Pro Ala Val Ile Ser Gln Thr Asn Gly Ala Asn Gly Thr Asn 1 5 10 15 Gly Ala Lys Ala Gln Leu Gly Asp Val Leu His Ile Ile Asp Ser Arg 20 25 30 Thr Gly Gln Tyr His Ala Ile Asn Ile His Gln Asn Ala Ile Asn Ala 35 40 45 Ser Asp Leu Lys Val Leu Lys Ala Pro Lys Asp Ala Asn His Pro Glu 50 55 60 Tyr Gln Asn Asp Gln Gly Ile Arg Val Tyr Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Leu Val Ser Glu Ser Lys Ile Thr Tyr Ile Asp Gly Leu Glu Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Ser Ile Asp Asp Ile Ile Gly Lys Lys 100 105 110 Lys Phe Val Asp Val Ser His Leu Leu Ile Trp Gly Lys Trp Pro Ser 115 120 125 Ala Asp Glu Ala Gln Thr Tyr Gln Gln Arg Leu Asn Asp Val Pro Leu 130 135 140 Ile Asn Glu Thr Val Phe Asn Val Ile Arg Ser Phe Pro Lys Asp Gly 145 150 155 160 Ser Ile Leu Gly Met Met Ile Ala Gly Leu Ser Ala Leu Gln Ser Ser 165 170 175 Asp Met Ser Ala Val Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Gln Pro Lys Asn Val Asp Asp Gln Ile Ile Arg Val Met Ala Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Ala Tyr Cys His His Ser Asp Arg Thr Phe 210 215 220 Thr Pro Pro Arg Lys Asp Phe Ser Tyr Val Gly Asn Phe Leu Leu Met 225 230 235 240 Thr Gly His Val Glu Glu Ser Thr Gly Val Pro Asn Pro Arg Tyr Val 245 250 255 Asp Ala Ile Glu Arg Leu Trp Ala Thr Val Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Leu Leu Gln Thr Ala Ser Ala Leu Pro Asp Val 275 280 285 Ile Ser Ser Leu Ile Ser Ala Leu Ser Ala Ser Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Ile Glu Glu Ile Gly Thr 305 310 315 320 Val Glu Asp Val Pro Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Val Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Thr Tyr Ile Ser Asp Ile Leu Asp Glu Leu Ser Asp Glu Ile Glu 355 360 365 Lys Asp Pro Leu Leu Arg Val Ala Phe Ala Leu Asp Arg Ala Ala Ala 370 375 380 Gln Asp Glu Tyr Phe Ile Ser Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Phe Ala Tyr Lys Ala Ile Gly Phe Pro Ala Asn Phe Ile 405 410 415 Leu Pro Ile Ser Ala Val Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Glu Gly Ala Pro Arg Ile Trp Arg Pro Gly Gln Lys 435 440 445 Tyr Thr Gly Asn Leu Asn Gln Thr Glu 450 455 47452PRTNeofusicoccum parvum 47Met Ala Thr Thr Thr Ile Thr Ala Pro Ala Asn Gly Arg Val Ser Lys 1 5 10 15 Asp Ser Leu Thr Val Thr Asp Asn Arg Thr Gly Ser Thr Phe Thr Phe 20 25 30 Pro Ile Thr His Asn Ala Val Asn Ala Ser Asn Phe Lys Gln Ile Lys 35 40 45 Ala Pro Glu Asp Pro Asp Asn Ile Ala Asp Gln Asn Glu Gln Gly Leu 50 55 60 Arg Val Phe Asp Pro Gly Phe Gly Asn Thr Cys Val Ser Glu Ser Lys 65 70 75 80 Ile Thr Phe Ile Asp Gly Leu Lys Gly Ile Ile Gln Tyr Arg Gly Tyr 85 90 95 Asp Ile Gly Asp Leu Ile Glu Ala Lys Lys Gly Phe Val Asp Thr Ala 100 105 110 His Leu Leu Trp Phe Gly Thr Leu Pro Ser Pro Lys Glu Lys Gln Glu 115 120 125 Leu Gln Asp Arg Leu Asn Ala Val Pro Leu Ile Asp Asp His Val Phe 130 135 140 Asn Thr Ile Arg Ser Phe Pro Lys Asn Gly Ser Pro Phe Gly Met Ile 145 150 155 160 Ile Ala Gly

Leu Met Ala Leu Gln Ser Ser Glu Met Asp Leu Ile Pro 165 170 175 Ala His Ala Ala Lys Asn Ile Tyr Leu Gly Asn Leu Ser Leu Val Asp 180 185 190 Ser Gln Leu Ile Arg Val Met Gln Ser Leu Ser Gln Ile Cys Ala Val 195 200 205 Ala Tyr Cys His Gln Thr Gly Arg Thr Phe Thr Pro Pro Arg Ala Asp 210 215 220 Leu Thr Phe Ile Glu Asn Phe Leu Leu Met Met Gly His Thr Glu Ala 225 230 235 240 Ala Thr Gly Leu Pro Asn Pro Ala Tyr Val Ala Lys Phe Glu Arg Leu 245 250 255 Trp Leu Leu Ile Ala Asp His Glu Met Thr Cys Ser Thr Ala Ala Met 260 265 270 Leu Gln Thr Ala Ser Ala Met Pro Asp Ala Leu Ser Cys Leu Ala Ser 275 280 285 Ala Thr Ser Ala Leu Tyr Gly Pro Leu His Gly Gly Ala Ile Glu Val 290 295 300 Ala Tyr Lys Asn Ile Ala Glu Ile Gly Ser Val Asp Asn Ile Pro Pro 305 310 315 320 Lys Ile Ala Arg Val Lys Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly 325 330 335 His Arg Val Tyr Arg Val Pro Asp Pro Arg Tyr Arg His Ile Lys Glu 340 345 350 Val Leu Glu Asp Leu Thr Ala Glu Ile Glu Asp Asp Pro Leu Leu Lys 355 360 365 Val Ala Phe Glu Leu Asp Arg Val Ala Arg Thr Asp Glu Tyr Phe Thr 370 375 380 Ser Arg Lys Leu Asn Pro Asn Ala Asp Leu Phe Ala Ala Leu Ala Tyr 385 390 395 400 Asn Ala Met Gly Phe Glu Pro Glu Trp Ile Leu Pro Ile Ser Leu Met 405 410 415 Ser Arg Ser Gln Gly Leu Leu Ala His Trp Lys Glu Ala Met Ser Gly 420 425 430 Ser Ala Arg Ile Trp Arg Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn 435 440 445 Lys Lys Ile Glu 450 48467PRTEutypa lata 48Met Ala Thr Ala Ala Pro Thr Ala Thr Lys Ser Thr Ala Ala Asn Asn 1 5 10 15 Pro Met Thr Ser Ser Gln Ser Glu Ile Asn Val Ala Val Glu Lys Arg 20 25 30 Asp Val Leu His Ala Val Asp Gly Arg Thr Gly Leu Tyr Tyr Ser Ile 35 40 45 Pro Ile Asn Lys Asn Ala Val Asn Ala Gly Asp Phe Lys Lys Ile Lys 50 55 60 Ser Pro Ala Asp Arg Lys His Pro Ala Tyr Gln Asn Glu Leu Gly Leu 65 70 75 80 Arg Ile Tyr Asp Pro Gly Phe Ser Asn Thr Thr Val Ser Glu Ser Lys 85 90 95 Ile Thr Tyr Ile Asp Gly Ile Glu Gly Thr Ile Gln Tyr Arg Gly Tyr 100 105 110 Ser Ile His Asp Ile Phe Gly Lys Lys Gly Trp Ile Asp Val Ser His 115 120 125 Leu Leu Ile Trp Gly Asn Trp Pro Ser Ser Ala Glu Ala Lys Glu Tyr 130 135 140 Gln Glu Arg Leu Asn Gly Val Pro Leu Leu Asp Gln His Val Leu Asp 145 150 155 160 Val Ile His Ser Phe Pro Lys Asp Gly Val Ile Thr Gly Met Met Ile 165 170 175 Ala Gly Leu Ser Ala Leu Gln Ser Cys Asn Leu Asp Ala Val Pro Ala 180 185 190 Tyr Val Gly Asp Asn Leu Tyr Val Gly His Pro Asp Arg Val Asp Lys 195 200 205 Gln Ile Ile His Leu Leu Gln Ser Phe Ala Met Ile Thr Ala Ala Cys 210 215 220 Tyr Cys His Ser Thr Ser Arg Glu Phe Thr Gln Pro Arg Gln Asp Phe 225 230 235 240 Ser Tyr Val Glu Asn Phe Leu Leu Met Val Gly His Val Asp Ala Thr 245 250 255 Thr Gly Leu Pro Ser Pro Arg His Val Asp Ala Leu Glu Arg Leu Trp 260 265 270 Gly Val Val Ala Asp His Glu Met Thr Cys Ser Thr Ala Ala Phe Leu 275 280 285 His Thr Ala Ser Ser Leu Pro Asp Ile Ile Ser Cys Phe Ile Thr Ala 290 295 300 Ile Cys Ala Ala Thr Gly Pro Leu His Gly Gly Ala Ile Ser Val Ala 305 310 315 320 His Lys His Ile Lys Ala Ile Gly Thr Val Ala Asn Val Pro Ala Lys 325 330 335 Ile Glu Arg Val Lys Ser Gly Lys Glu Leu Leu Tyr Gly Tyr Gly His 340 345 350 Arg Val Tyr Arg Thr Thr Asp Pro Arg Tyr Thr Tyr Ile Asn Gln Val 355 360 365 Leu Asp Gly Leu Thr Glu Glu Val Ala Arg Asp Pro Leu Leu Gln Val 370 375 380 Ala Leu Ala Leu Asp Lys Ala Ala Ser Glu Asp Glu Tyr Phe Thr Ser 385 390 395 400 Arg Lys Leu Phe Pro Asn Ala Asp Leu Phe Ala Ala Phe Ala Tyr Gln 405 410 415 Ala Leu Gly Phe Pro Pro Asp Phe Val Leu Pro Met Ser Cys Leu Ser 420 425 430 Arg Leu Gln Gly Phe Ala Ala His Trp Lys Glu Gly Leu Gln Gly Lys 435 440 445 Pro Lys Ile Trp Arg Pro Gly Gln Ile Tyr Thr Gly Asp Leu Glu Lys 450 455 460 Thr Met Gly 465 49353PRTAspergillus niger 49Met Ser Lys Thr Arg Thr Pro Met Arg Asn Met Arg Ser Gln Phe Glu 1 5 10 15 Glu Arg Arg Ser Gln Pro Trp Thr Ser Arg Arg Ser Glu Pro Gln Glu 20 25 30 Arg Glu Pro Thr Ala Gln Ile Arg Ser Arg Val Ala Ser Gly Glu Ile 35 40 45 Asp Leu Glu Asp Val Leu His Arg Leu Val Ser Gly Ser Tyr Pro Thr 50 55 60 Met Pro His Met Asp Gly Leu Ser His Lys Leu Thr Glu Ala Met Leu 65 70 75 80 Ala Val Pro Asp Asp Val Gln Arg Thr Val Trp Thr His Pro His Pro 85 90 95 Asp Met Ile Thr Ala Ser His Asp Ala Asn Met Phe Arg Lys Ser Pro 100 105 110 Glu Asp Thr Asp Arg Val Met Ile Arg Thr Val Ala Ala Tyr Ala Val 115 120 125 Val Ser Gly Leu Ala Asn Ser His Arg Lys Gly Leu Arg Phe Thr Pro 130 135 140 Pro Thr Arg Gly Arg Ser Tyr Tyr Glu Lys Ser Phe Val Met Ala Gly 145 150 155 160 Leu Val Pro Arg Thr Gly Arg Pro Gly Arg Val Lys Leu Ser Cys Phe 165 170 175 Arg His Gln Arg Val Lys Gln Gly Arg Val Lys Val Phe Glu Tyr Gly 180 185 190 His Arg Ser Tyr Lys Gly Ile Asn Pro Arg Val Pro Pro Ile Gln Ser 195 200 205 Ile Leu Lys Asn Leu Asp Leu Ser Ala Asp Asn Pro Leu Lys Leu Ala 210 215 220 Glu Arg Glu Phe Val Gln Leu Met Pro Thr Ser Lys Ser Arg Gly Tyr 225 230 235 240 Ala Asp Thr Ser Asn Gly Phe Tyr Pro Lys Ile Ile Ser Met Ala Met 245 250 255 Leu Ala Gln Arg Ile Met Gly Ile Met Thr His Trp Arg Glu Tyr Met 260 265 270 Leu Met Arg Gly Lys Leu Leu Arg Pro Ser His Ile Tyr Thr Gly Glu 275 280 285 Ala Glu Gly Gly Val Leu Pro Gly Ile Arg Thr Asp Arg Ala Ser Tyr 290 295 300 Val Lys Val Ser Leu Ala Ser Ala Val Ala Ala Asp Val Leu Thr Ser 305 310 315 320 Ala Glu Arg Gly Pro Tyr Met Asn Ile Thr Ser Leu Gly Ile Met Leu 325 330 335 Val Pro Ser Ile Gly Pro Leu Leu Gly Gly Leu Leu Ser Gln Gln Pro 340 345 350 Gly 50540PRTAspergillus niger 50Met Asp Gln Ser Leu Thr Val Tyr Leu Gly Val Ser Ile Arg Pro Phe 1 5 10 15 Glu Leu Phe Arg Pro Arg Leu His Gly Leu Gly Gln Met Ala Ala Ala 20 25 30 Met Pro Asp Lys Val Gln Ile Cys Ala Ser Glu Pro Asp Lys Pro Gln 35 40 45 Gln Asn Gln Asp Asn Ser Ser Asp Asn Pro Ser Gln Thr His Pro Ile 50 55 60 Pro Phe Tyr Asn Met Ala Tyr Thr Leu Ala Ser Trp Leu Gly Arg Leu 65 70 75 80 Phe Asp Ala Gly Lys Ser Leu Leu Pro Leu Gln Gly Asn Tyr Ile Asn 85 90 95 Ala Leu Leu Glu Gln Glu Leu Pro Gly Glu Arg Glu Gly Thr Leu Thr 100 105 110 Val Arg Asp Asn Arg Thr Gly Ser Lys Tyr Thr Ile Pro Ile Val Arg 115 120 125 Asn Ser Val Pro Ala Met Gly Phe Arg Gln Ile Cys Val Asp Arg Ala 130 135 140 Gly Lys Ser Pro Arg Gln Gln Phe Glu Asp Gly Leu Arg Leu Ile Asp 145 150 155 160 Pro Gly Tyr Arg Asn Thr Ala Val Lys Met Ser Ser Ile Thr Tyr Ile 165 170 175 Asn Gly Asn Glu Gly Val Ile Leu Tyr Arg Gly His Pro Leu Ala Ser 180 185 190 Leu Ile Gly Lys Ser Tyr Glu Glu Ile Thr His Leu Leu Ile Trp Gly 195 200 205 Ser Leu Pro Thr Pro Glu Gln Arg Leu Arg Phe Gln Arg Arg Ile Ala 210 215 220 Glu Ala Met Met Val Val Pro Glu Asn Val Lys Gln Leu Val Ala Thr 225 230 235 240 Phe Pro Arg Asn Thr Pro Pro Met Val Ile Leu Cys Ala Val Leu Thr 245 250 255 Gly Tyr Leu Ala Asp Gln Pro Glu Leu Ile Pro Ala His Ala Gly Ala 260 265 270 Asn Leu Tyr Asn Arg Arg Pro Glu Met Val Asp Glu Gln Ile Ile Arg 275 280 285 Thr Leu Ala Val Thr Ala Ile Ala Gly Ser Ile Ala His Cys His Met 290 295 300 Lys Gly Glu Glu Leu Arg Met Ala Asp Pro Asn Leu Ser Tyr Ile Glu 305 310 315 320 Asn Ile Leu Trp Met Gly Arg Tyr Val Asp Asn Asn Pro Ala Val Thr 325 330 335 Arg Glu Lys Ala Ala Glu Ile Leu Thr Lys Ala Trp Ser Leu Tyr Ala 340 345 350 Asp His Glu Met Thr Asn Ser Thr Ser Ala Phe Leu His Val Ser Ser 355 360 365 Ser Leu Ala Asp Pro Leu Ser Ala Met Ala Ala Cys Cys Met Ser Gly 370 375 380 Tyr Gly Leu Leu His Gly Gly Ala Ile Asp Ala Ala Tyr Arg Gly Met 385 390 395 400 Arg Glu Ile Gly Gly Pro Gln Asn Val Pro Lys Leu Ile Glu Lys Val 405 410 415 Ile Asn Lys Glu Cys Arg Leu Ser Gly Tyr Gly His Arg Ile Tyr Lys 420 425 430 Gln Val Asp Pro Arg Ala Lys Tyr Val Arg Glu Met Leu Asp Glu Leu 435 440 445 Thr Arg Asp Arg Asp Ile Arg Glu Met Asp Pro Val Leu Gln Val Ala 450 455 460 Met Glu Ile Asp Arg Ile Ala Ser Thr His Glu Tyr Phe Val Lys Arg 465 470 475 480 Asn Leu Gln Ala Asn Ala Asp Leu Tyr Gly Ser Phe Val Tyr Thr Ala 485 490 495 Leu Gly Ile Asp Ser Gln Phe Ala Thr Val Leu Ala Ala Thr Ala Arg 500 505 510 Val Ser Gly Val Met Ala His Trp Lys Glu Gln Thr Glu Arg Ala Pro 515 520 525 Asp Leu Trp Arg Pro Leu Gln Val Tyr Val Pro Asn 530 535 540 511128PRTAspergillus kawachii 51Met Ser Ser Gly Ile Leu Tyr Val Lys Asp Ser Arg Thr Asp Val Gln 1 5 10 15 Tyr Glu Ile Pro Ile Arg Arg Asn Ala Val Ser Ala Val Asp Phe Lys 20 25 30 Lys Ile Lys Gly Pro Gly Thr Gly Ala Asp Arg Ala Asp Gln Val Ala 35 40 45 Gly Gly Leu Arg Val His Asp Pro Gly Leu Arg Asn Thr Thr Val Val 50 55 60 Glu Thr Ala Ile Ser Phe Ser Asp His Glu Arg Ser Leu Leu Leu Phe 65 70 75 80 Arg Gly Tyr Ser Leu Glu Gln Leu Trp Gln Ser Asp Phe Glu Asp Val 85 90 95 Leu His Leu Leu Val Trp Gly Ser Tyr Pro Thr Val Pro Gln Arg Asn 100 105 110 Asn Leu Ser His Arg Leu Thr Glu Ala Met Leu Ala Val Pro Asp Asp 115 120 125 Val Gln Arg Thr Ile Trp Gly Leu Pro Gly Thr Ser Ser Pro Leu Pro 130 135 140 Leu Ile Val Ala Gly Leu Ser Ala Cys Leu Ala Ser His Pro Asp Met 145 150 155 160 Ile Pro Ala Ser His Asp Ala Asn Met Tyr Arg Asn Asn Pro Glu Asp 165 170 175 Thr Asp Arg Ala Ile Ile Gln Thr Val Ala Ala Tyr Ala Val Val Phe 180 185 190 Gly Leu Val Asn Ser His Arg Lys Gly Leu Arg Phe Ser Pro Pro Ser 195 200 205 Arg Gly Arg Ser Tyr Tyr Glu Asn Leu Phe Val Met Ala Gly Leu Val 210 215 220 Asp Ser Arg Thr Gly Arg Pro Asp Arg Val Lys Leu Ser Cys Phe Arg 225 230 235 240 Arg Phe Ser Ile Leu Asn Ser Asp His Gly Met Ala Leu Thr Val Phe 245 250 255 Ser Ala Leu Ala Thr Ser Ser Ser Leu Thr Asp Pro Ile Ser Cys Leu 260 265 270 Ile Thr Ala Ile Gly Ser Ala Trp Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ser Ala Lys Arg Thr Leu Arg Glu Ile Gly Glu Ala Lys Asn Ile 290 295 300 Pro Gly Tyr Ile His Asn Val Lys Gln Gly His Val Lys Val Phe Gly 305 310 315 320 Tyr Gly His Arg Ser Tyr Lys Gly Ile Asp Pro Arg Val Pro Pro Ile 325 330 335 Arg Ser Ile Leu Lys Asp Leu Asp Met Ser Ala Asp Lys Leu Phe Lys 340 345 350 Leu Ala Glu Arg Ile Glu Ser Ala Cys Ser Asn Asp Ala Tyr Phe Thr 355 360 365 Glu Arg Gly Leu Tyr Val Asn Gly Asp Phe Tyr Gly His Phe Ile Phe 370 375 380 Thr Ala Ile Gly Phe Asp Pro Glu Ile Ile Pro Ala Ala Met Leu Ala 385 390 395 400 Gln Arg Ile Met Gly Ile Met Ala His Trp Arg Glu Tyr Met Leu Thr 405 410 415 Arg Gly Lys Leu Leu Arg Pro Ser His Ile Tyr Thr Gly Glu Ala Glu 420 425 430 Glu Arg Leu Leu Pro Lys Phe Gln Gln Tyr Gln Ala Thr Leu Val Ala 435 440 445 Ala Asn Gln Pro Ala Thr Glu Gly Thr Pro Leu Leu Ala Glu Gln Pro 450 455 460 Ala Lys Lys Pro Tyr Ser Ile Phe Thr Pro Gly Gln Lys Arg Leu Ile 465 470 475 480 Ile Val Thr Ala Ala Leu Ala Ser Ser Phe Ser Pro Leu Ser Ala Asn 485 490 495 Ile Tyr Tyr Pro Ala Leu Asn Ser Ile Ala Ala Asp Leu His Val Thr 500 505 510 Ser Ser Gln Ile Asn Leu Thr Ile Thr Thr Tyr Met Leu Cys Gln Gly 515 520 525 Leu Ala Pro Ala Phe Met Gly Ser Phe Ala Asp Gln Ala Gly Arg Arg 530 535 540 Pro Ala Tyr Ile Leu Cys Phe Ala Val Tyr Ile Thr Gly Asn Ile Ala 545 550 555 560 Leu Ala Leu Gln His Ser Tyr Pro Ala Leu Leu Ile Leu Arg Ala Ile 565 570 575 Gln Ser Cys Gly Ser Ser Gly Thr Val Ala Leu Ala Ser Ala Val Thr 580 585 590 Ala Asp Val Ile Thr Ser Ala Glu Arg Gly Thr Tyr Met Gly Ile Thr 595 600 605 Ser Leu Gly Ile Ile Leu Ala Pro Ser Val Gly Pro Leu Val Gly Gly 610 615 620 Ile Leu Thr Pro Ala Ile Thr Ser Thr Pro Gly Gln Lys Ser Ser Arg 625 630 635 640 Ile Ala Leu Pro Asn Pro Leu Thr Thr Leu Ser

Leu Leu Ser His Arg 645 650 655 Pro Thr Gly Leu Val Leu Leu Ser Asn Gly Leu Leu Phe Ala Ser Tyr 660 665 670 Tyr Ala Val Thr Ala Gly Ile Pro Ser Gln Phe Lys Glu Thr Tyr His 675 680 685 Leu Asn Asp Ser Val Ile Gly Leu Val Phe Val Pro Ala Gly Val Gly 690 695 700 Ser Leu Leu Ser Thr Thr Phe Asn Gly Leu Leu Leu Asp Trp Asn Tyr 705 710 715 720 Arg Arg Leu Arg Glu Gln Phe Arg Ser Pro Ile Leu Gln Ala His His 725 730 735 His Gly Ala Phe Pro Ile Glu Arg Ala Arg Ile Gln Ile Cys Leu Pro 740 745 750 Leu Thr Leu Leu Ala Ala Leu Ser Ile Leu Ser Tyr Ser Ala Leu Met 755 760 765 Ser Leu Ala Thr Pro Thr Leu Ser His Ala Leu Val Leu Ile Phe Ala 770 775 780 Ile Ser Phe Ser Ile Thr Ala Ala Tyr Asn Ile Met Asn Ile Leu Ile 785 790 795 800 Val Asp Leu Tyr Tyr Ser Thr Pro Ala Thr Ala Met Ala Ala Asn Asn 805 810 815 Leu Val Arg Cys Phe Leu Gly Ala Ala Ala Thr Gly Leu Val His Pro 820 825 830 Ala Met Val Arg Trp Gly Thr Gly Trp Thr Thr Ile Met Asn Tyr His 835 840 845 Leu Leu Ile Ser Leu Leu Ile Pro Leu Ile Thr Thr Gln Ile Ile Asp 850 855 860 Pro Leu Pro His Tyr Pro Gln Thr Leu His Leu Tyr Tyr Pro Asn Thr 865 870 875 880 Pro Trp Ile Gln Pro Gly Asp Thr Leu Gln Ile Leu Asp Thr Lys Pro 885 890 895 Leu Pro Ile Leu Ser Thr Gln His Pro Pro Leu His Gln Thr Tyr Thr 900 905 910 Ile Leu Phe Leu Asp Leu Asp Val Leu Tyr Asn His Thr Thr Ala Thr 915 920 925 Val Ile Leu His Trp Tyr Gln Pro Asp Leu Ile Pro Tyr Pro Asn Asn 930 935 940 Thr Asn Ile Leu Leu Pro Asn Pro Gln Val Pro Thr Arg Lys Pro Ala 945 950 955 960 Pro Tyr Ile Ala Pro Gln Pro Pro Thr Asn Ser His His Arg Tyr Leu 965 970 975 Tyr Leu Leu Tyr Thr Gln Pro Pro Asn Tyr Thr Phe Pro Glu Cys Phe 980 985 990 Glu His Ile Phe Pro Pro Thr Ala Glu Ala Arg Ala Gly Phe Asp Met 995 1000 1005 Lys Ile Phe Thr Asp Ala Ala Gly Leu Gly Thr Pro Val Ala Gly 1010 1015 1020 Asn Trp Phe Tyr Val Arg Asn Glu Val Asp Leu Pro Thr Gly Ser 1025 1030 1035 Gly Ser Gly Ser Lys Gly Gly Val Ala Thr Ser Thr Ser Met Asn 1040 1045 1050 Thr Ala Thr Thr Thr Thr Thr Ser Met Arg Trp Val Glu Cys Asp 1055 1060 1065 Leu Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ile Ser Thr Ser 1070 1075 1080 Val Leu Thr Thr Ser Thr Ala Ile Val Ala Thr Thr Thr Thr Thr 1085 1090 1095 His Arg Pro Thr Asp Ser Pro Thr Glu Thr Thr Leu Ala Met Ser 1100 1105 1110 Asn Asn Ile Asp Glu Ser Gln Val Gln Ala Gln Ala Arg Leu Ser 1115 1120 1125 52433PRTNeosartorya fischeri 52Met Ser Ser Gly Thr Leu Tyr Ile Arg Asp Ser Arg Thr Asn Ala Glu 1 5 10 15 Tyr Glu Ile Pro Ile Arg Arg Asn Ala Val Ser Ala Met Asp Phe Lys 20 25 30 Arg Ile Lys Ala Pro Ala Ala Gly Ala Asp Arg Ala Asp Gln Val Ala 35 40 45 Ser Gly Leu Arg Val His Asp Pro Gly Leu Gln Asn Thr Thr Val Val 50 55 60 Glu Thr Arg Ile Ser Phe Ser Asp His Glu Lys Gly Leu Leu Leu Phe 65 70 75 80 Arg Gly Tyr Thr Leu Glu Gln Leu Trp Asp Ser Asp Phe Glu Asp Met 85 90 95 Leu His Leu Leu Val Trp Gly Ser Tyr Pro Thr Ala Leu Gln Lys Lys 100 105 110 Glu Leu Ser Arg Lys Leu Ser Glu Glu Met Thr Met Val Pro Lys Ser 115 120 125 Val His Arg Thr Ile Glu Thr Leu Pro Arg Thr Thr Ser Pro Leu Pro 130 135 140 Leu Met Leu Ala Gly Leu Ser Ala Cys Leu Ala Tyr Ala Pro Glu Ser 145 150 155 160 Ile Pro Ala Ser Thr Lys Pro Asp Leu Tyr Gln Ser Asn Ser Asn Val 165 170 175 Val Asp Arg Ala Ile Ile Arg Thr Val Ala Ala Tyr Ala Val Val Phe 180 185 190 Gly Leu Val Asn Cys His Arg Arg Gly Ile Pro Phe Ala Gln Pro Ser 195 200 205 Arg His Lys Ser Tyr Leu Glu Asn Leu Phe Gln Met Ala Gly Leu Val 210 215 220 Asp Gln Thr Thr Gly Arg Pro Asp Pro Thr Lys Leu Ser Cys Phe Arg 225 230 235 240 Arg Phe Ala Met Leu Asn Ala Asp His Gly Met Ala Leu Ser Val Phe 245 250 255 Ser Ala Leu Val Thr Thr Ser Ser Leu Thr Asp Pro Ile Ser Cys Leu 260 265 270 Ile Thr Ala Thr Gly Ala Ala Phe Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ser Ala Asn Leu Ala Leu Arg Glu Ile Gly Thr Pro Glu Lys Val 290 295 300 Pro Lys Phe Ile Glu Glu Val Lys Gln Gly Lys Arg Arg Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Ser Tyr Lys Gly Leu Asp Pro Arg Val Ala Pro Ile 325 330 335 Arg Ser Ile Leu Lys Asp Leu Asp Thr Ser Ser Asn Ser Leu Ile Lys 340 345 350 Val Ala Glu Arg Ile Glu Gln Val Ala Ser Ala Asp Gly Tyr Phe Arg 355 360 365 Ser Arg Gly Leu Tyr Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe 370 375 380 Thr Gly Ile Gly Phe Glu Pro Glu Leu Ile Pro Ala Ala Met Met Ser 385 390 395 400 Gln Arg Ile Met Gly Val Met Ala His Trp Arg Glu Tyr Met Cys Lys 405 410 415 Ser Leu Gln Glu Ser Val Arg Tyr Arg Arg Val Ser Asp Leu Lys Tyr 420 425 430 Val 53433PRTAspergillus fumigatus 53Met Ser Phe Gly Thr Leu His Ile Arg Asp Ser Arg Thr Asn Ala Glu 1 5 10 15 Tyr Glu Ile Pro Ile Arg Arg Asn Ala Val Val Ala Met Asp Phe Lys 20 25 30 Arg Ile Lys Ala Pro Ala Ala Gly Ala Asp Arg Ala Asp Gln Val Asp 35 40 45 Ser Gly Leu Arg Val His Asp Pro Gly Leu Gln Asn Thr Thr Val Val 50 55 60 Glu Thr Glu Ile Ser Phe Ser Asp His Trp Lys Arg Leu Leu Leu Tyr 65 70 75 80 Arg Gly Tyr Thr Leu Glu Gln Leu Trp Asp Ser Asp Phe Glu Asp Met 85 90 95 Leu His Leu Leu Val Trp Gly Ser Tyr Pro Thr Ala Leu Gln Lys Lys 100 105 110 Glu Leu Ser Arg Lys Leu Ser Glu Glu Met Thr Met Val Pro Lys Ser 115 120 125 Val His Arg Thr Ile Glu Thr Leu Pro Arg Thr Thr Ser Pro Leu Pro 130 135 140 Leu Met Leu Val Gly Leu Ser Ala Cys Leu Ala Tyr Val Pro Glu Ser 145 150 155 160 Ile Pro Ala Ser Thr Lys Pro Asp Leu Tyr Gln Ser Asn Ser Asn Val 165 170 175 Leu Asp Arg Ala Ile Ile Arg Thr Val Ala Ala Tyr Ala Val Val Phe 180 185 190 Gly Leu Val Asn Cys His Arg Arg Gly Ile Pro Phe Ala Gln Pro Ser 195 200 205 Arg His Thr Ser Tyr Leu Glu Asn Leu Phe His Leu Ala Gly Leu Val 210 215 220 Asp Gln Thr Thr Gly Arg Pro Asp Pro Thr Lys Leu Ser Cys Phe Gln 225 230 235 240 Arg Phe Ala Met Leu Asn Ala Asp His Gly Met Ala Leu Ser Val Phe 245 250 255 Ser Ala Leu Val Thr Ala Ser Ser Leu Thr Asp Pro Ile Ser Cys Leu 260 265 270 Ile Thr Ala Thr Gly Ala Ala Phe Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ser Ala Asn Leu Ala Leu Arg Val Ile Gly Thr Pro Glu Asn Val 290 295 300 Pro Asn Phe Ile Glu Glu Val Lys Gln Gly Lys Gln Arg Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Ser Tyr Lys Gly Val Asp Pro Arg Val Ala Pro Ile 325 330 335 Arg Ser Ile Leu Lys Asp Leu Asp Met Ser Ser Asn Ser Leu Leu Lys 340 345 350 Val Ala Glu Arg Ile Glu Gln Val Ala Ser Ala Asp Asp Tyr Phe Arg 355 360 365 Asn Arg Gly Leu Tyr Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe 370 375 380 Thr Glu Ile Gly Phe Glu Pro Asp Met Ile Pro Ala Ala Met Met Ala 385 390 395 400 Gln Arg Ile Met Gly Val Met Ala His Trp Arg Glu Tyr Met Cys Lys 405 410 415 Pro Leu Gln Gln Ser Val Arg Tyr Arg Arg Val Ser His Ile Asp Tyr 420 425 430 Ile 54426PRTAspergillus flavus 54Met Tyr Gln Lys Ser Leu Glu Pro Pro Met Ser Ser Gly Val Leu His 1 5 10 15 Ile Val Asp Ser Arg Thr Lys Gln Lys Tyr Glu Ile Pro Ile Arg Arg 20 25 30 Asn Val Ile Ser Ala Ile Asp Leu Lys Ser Ile Lys Ala Pro Ala Ala 35 40 45 Gly Thr Asp Arg Ala Asp His Val Ala Asp Gly Leu Arg Val His Asp 50 55 60 Pro Gly Leu Gln Asn Thr Thr Val Ile Glu Ser Ala Ile Ser Tyr Ser 65 70 75 80 Asp His Glu Arg Gly Val Leu Leu Phe His Gly Tyr Thr Leu Ser Gln 85 90 95 Leu Trp Asp Ser Asp Phe Glu Asp Met Leu His Leu Leu Val Trp Gly 100 105 110 Thr Tyr Pro Thr Met Gln Gln Lys Lys Asp Leu Asn Arg Lys Leu Thr 115 120 125 Glu Gln Met Leu Ala Val Pro Asp Ser Val His Arg Thr Ile Arg Gly 130 135 140 Leu Pro Arg Thr Thr Ser Pro Leu Pro Leu Ile Leu Ala Gly Leu Ser 145 150 155 160 Ala Tyr Leu Ala Cys Phe Pro Asp Thr Ile Pro Ala Ser Thr His Ala 165 170 175 Ser Leu Tyr Gln Gly Asn Leu Arg Asn Val Asp His Ala Val Ile Arg 180 185 190 Thr Val Ala Ala Tyr Gly Val Ile Phe Gly Leu Val Asn Ser His Arg 195 200 205 Lys Gly Ile Asp Phe Gln Pro Pro Ser Gln Glu Asn Ser Tyr Cys Ala 210 215 220 Asn Leu Phe Ile Met Ala Gly Leu Leu Asp Arg His Ser Ser Arg Pro 225 230 235 240 Asp Pro Thr Lys Leu Ser Cys Phe Arg Arg Phe Ala Met Leu Asn Ala 245 250 255 Asp His Gly Met Ala Leu Thr Val Phe Ser Ala Leu Val Thr Ala Ser 260 265 270 Ser Leu Thr Asp Pro Ile Ser Cys Leu Ile Ser Ala Val Ala Ala Ala 275 280 285 Tyr Gly Pro Leu His Phe Gly Ala Thr Val Ser Ala Gln Arg Thr Leu 290 295 300 Arg Glu Ile Gly Ser Thr Asp Lys Val Pro Glu Phe Ile Glu Gly Val 305 310 315 320 Lys Asn Arg Arg Thr Lys Leu Phe Gly Tyr Gly His Arg Ser Tyr Lys 325 330 335 Gly Leu Asp Pro Arg Val Arg Pro Ile Gln Ser Ile Leu Lys Asp Leu 340 345 350 Asp Leu Ser Lys Asn Asp Tyr Leu Lys Ile Thr Glu Arg Ile Glu Glu 355 360 365 Ile Ala Ser Ala Asp Asp Tyr Phe Arg His Arg Gly Leu Tyr Pro Asn 370 375 380 Ala Asp Phe Tyr Gly Asn Phe Val Phe Thr Ala Ile Gly Phe Asp Pro 385 390 395 400 Asp Ile Ile Pro Ala Ala Met Leu Thr Gln Arg Ile Ile Gly Ile Met 405 410 415 Ala His Trp Arg Glu Tyr Met Cys Met Cys 420 425 55510PRTAspergillus oryzae 55Met Ser Ser Gly Val Leu His Ile Val Asp Ser Arg Thr Lys Gln Lys 1 5 10 15 Tyr Glu Ile Pro Ile Arg Arg Asn Val Ile Ser Ala Ile Asp Leu Lys 20 25 30 Ser Ile Lys Ala Pro Ala Ala Gly Thr Asp Arg Ala Asp His Val Ala 35 40 45 Asp Gly Leu Arg Val His Asp Pro Gly Leu Gln Asn Thr Thr Val Ile 50 55 60 Glu Ser Ala Ile Ser Tyr Ser Asp His Glu Arg Gly Val Leu Leu Phe 65 70 75 80 His Gly Tyr Thr Leu Ser Gln Leu Trp Asp Ser Asp Phe Glu Asp Met 85 90 95 Leu His Leu Leu Val Trp Gly Thr Tyr Pro Ser Met Gln Gln Lys Lys 100 105 110 Asp Leu Asn Arg Lys Leu Thr Glu Gln Met Leu Ala Val Pro Asp Ser 115 120 125 Val His Arg Thr Ile Arg Gly Leu Pro Arg Thr Thr Ser Pro Leu Pro 130 135 140 Leu Ile Leu Ala Gly Leu Ser Ala Tyr Leu Ala Cys Phe Pro Asp Thr 145 150 155 160 Ile Pro Ala Ser Thr His Ala Ser Leu Tyr Gln Gly Asn Leu Arg Asn 165 170 175 Val Asp His Ala Val Ile Arg Thr Val Ala Ala Tyr Gly Val Ile Phe 180 185 190 Gly Leu Val Asn Ser His Arg Lys Gly Ile Asp Phe Gln Pro Pro Ser 195 200 205 Gln Glu Asn Ser Tyr Cys Ala Asn Leu Phe Ile Met Ala Gly Leu Leu 210 215 220 Asp Arg His Ser Ser Arg Pro Asp Pro Thr Lys Leu Ser Cys Phe Arg 225 230 235 240 Arg Phe Ala Met Leu Asn Ala Asp His Gly Met Ala Leu Thr Val Phe 245 250 255 Ser Ala Leu Val Thr Ala Ser Ser Leu Thr Asp Pro Ile Ser Cys Leu 260 265 270 Ile Ser Ala Val Ala Ala Ala Tyr Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Val Ser Ala Gln Arg Thr Leu Arg Glu Ile Gly Ser Thr Asp Lys Val 290 295 300 Pro Glu Phe Ile Glu Gly Val Lys Asn Arg Arg Thr Lys Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Ser Tyr Lys Gly Leu Asp Pro Arg Val Arg Pro Ile 325 330 335 Gln Ser Ile Leu Lys Asp Leu Asp Leu Ser Lys Asn Asp Tyr Leu Lys 340 345 350 Ile Thr Glu Arg Ile Glu Glu Ile Ala Ser Ala Asp Asp Tyr Phe Arg 355 360 365 His Arg Gly Leu Tyr Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe 370 375 380 Thr Ala Ile Gly Phe Asp Pro Asp Ile Ile Pro Ala Ala Met Leu Thr 385 390 395 400 Gln Arg Ile Ile Gly Ile Met Ala His Trp Arg Glu Tyr Met Cys Ser 405 410 415 Asp Thr Ile Asp Leu Ser Asp Asn Trp Leu Gln Glu Phe Ile Ser Gly 420 425 430 Gln Pro Ala Asp Leu Thr Gln Asp Arg Asn Phe Leu Asp Ala Leu Gly 435 440 445 Leu Asn Ser Ala Asp Ser Thr Leu Thr Ala Ile Pro Ser Ser Thr Asn 450 455 460 Asp Phe Thr Gly Ser Ala Lys Thr Ile Asp Val Ala Ser Ser Glu Leu 465 470 475 480 Gln Asp Gln Leu Pro Leu Ala Ala Tyr Tyr Pro Pro Ala Ser Gly Phe 485 490 495 Ser Ser Tyr Asn Tyr Thr Phe Phe His Gly Lys Arg Phe Cys 500 505 510

56425PRTAspergillus nidulans 56Met Ser Ser Gly Thr Leu Tyr Ile Arg Asp Ser Arg Thr Asp Ala Leu 1 5 10 15 Tyr Glu Ile Pro Ile Arg Arg Asn Ser Val Ser Ala Ala Asp Phe Lys 20 25 30 Arg Ile Lys Ala Pro Gly Ile Gly Ala Asn Arg Ala Asp Gln Val Ser 35 40 45 Gly Gly Leu Arg Val His Asp Pro Gly Leu Leu Asn Thr Thr Val Ile 50 55 60 Glu Ser Ala Ile Ser Phe Ser Asp His Glu Arg Gly Leu Leu Leu Phe 65 70 75 80 Arg Gly Tyr Ser Leu Glu Glu Leu Trp Lys Ser Asp Phe Glu Asp Met 85 90 95 Leu His Leu Leu Val Trp Gly Ser Tyr Pro Thr Pro Pro Gln Lys Glu 100 105 110 Gln Leu Arg Ser Lys Leu Ala Ala Gln Met Leu Ala Val Pro Glu Thr 115 120 125 Val Gln Thr Ala Val Gln Ser Leu Pro Asn Thr Thr Pro Pro Leu Ala 130 135 140 Leu Ile Leu Thr Gly Leu Ser Thr Tyr Leu Ser Cys Ile Pro Glu Thr 145 150 155 160 Ile Pro Ala Ser Thr Asp Ala His Gln Tyr Arg Ala Asn Arg Glu Asn 165 170 175 Val Asp Asn Ala Val Leu Arg Thr Val Ala Ala Tyr Ala Val Val Phe 180 185 190 Gly Ile Val Ala Ser His Arg Lys Ser Ile Pro Phe Thr Pro Pro Ser 195 200 205 Pro Asp Arg Thr Tyr Cys Glu Asn Leu Phe Thr Met Ala Gly Leu Val 210 215 220 Asp Pro Val Ala Gly Met Pro Asp Pro Val Lys Leu Ser Cys Phe Arg 225 230 235 240 Arg Phe Ala Met Leu Asn Ala Asp His Gly Met Ala Leu Thr Val Phe 245 250 255 Ser Ala Leu Val Thr Ala Ser Ser Leu Thr Asp Pro Val Ser Cys Leu 260 265 270 Ile Thr Ser Val Ala Ser Ala Trp Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ser Ala Gln Arg Ala Leu Ala Asp Ile Gly Thr Glu Ala Gly Ile 290 295 300 Pro Ala Phe Leu Asp Glu Val Lys Gln Gly Arg Lys Arg Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Ser Tyr Lys Arg Ile Asp Pro Arg Val Arg Phe Val 325 330 335 Gln Ser Ile Leu His Asp Leu Pro Ser Thr Arg Leu Leu Lys Leu Ala 340 345 350 Glu Ala Ile Glu Cys Ala Ala Ser Ala Asp Asp Tyr Phe Arg Ser Arg 355 360 365 Gly Leu Tyr Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe Thr Gly 370 375 380 Ile Gly Phe Glu Val Glu Met Ile Pro Ala Ala Met Leu Ala Gln Arg 385 390 395 400 Ile Met Gly Ile Met Ala His Trp Arg Glu Tyr Met Arg Glu Phe Cys 405 410 415 Ala His Thr Thr Arg Ala Met Gln Arg 420 425 57928PRTAspergillus nidulans 57Met Ser Ser Gly Thr Leu Tyr Ile Arg Asp Ser Arg Thr Asp Ala Leu 1 5 10 15 Tyr Glu Ile Pro Ile Arg Arg Asn Ser Val Ser Ala Ala Asp Phe Lys 20 25 30 Arg Ile Lys Ala Pro Gly Ile Gly Ala Asn Arg Ala Asp Gln Val Ser 35 40 45 Gly Gly Leu Arg Val His Asp Pro Gly Leu Leu Asn Thr Thr Val Ile 50 55 60 Glu Ser Ala Ile Ser Phe Ser Asp His Glu Arg Gly Leu Leu Leu Phe 65 70 75 80 Arg Gly Tyr Ser Leu Glu Glu Leu Trp Lys Ser Asp Phe Glu Asp Met 85 90 95 Leu His Leu Leu Val Trp Gly Ser Tyr Pro Thr Pro Pro Gln Lys Glu 100 105 110 Gln Leu Arg Ser Lys Leu Ala Ala Gln Met Leu Ala Val Pro Glu Thr 115 120 125 Val Gln Thr Ala Val Gln Ser Leu Pro Asn Thr Thr Pro Pro Leu Ala 130 135 140 Leu Ile Leu Thr Gly Leu Ser Thr Tyr Leu Ser Cys Ile Pro Glu Thr 145 150 155 160 Ile Pro Ala Ser Thr Asp Ala His Gln Tyr Arg Ala Asn Arg Glu Asn 165 170 175 Val Asp Asn Ala Val Leu Arg Thr Val Ala Ala Tyr Ala Val Val Phe 180 185 190 Gly Ile Val Ala Ser His Arg Lys Ser Ile Pro Phe Thr Pro Pro Ser 195 200 205 Pro Asp Arg Thr Tyr Cys Glu Asn Leu Phe Thr Met Ala Gly Leu Val 210 215 220 Asp Pro Val Ala Gly Met Pro Asp Pro Val Lys Leu Ser Cys Phe Arg 225 230 235 240 Arg Phe Ala Met Leu Asn Ala Asp His Gly Met Ala Leu Thr Val Phe 245 250 255 Ser Ala Leu Val Thr Ala Ser Ser Leu Thr Asp Pro Val Ser Cys Leu 260 265 270 Ile Thr Ser Val Ala Ser Ala Trp Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ser Ala Gln Arg Ala Leu Ala Asp Ile Gly Thr Glu Ala Gly Ile 290 295 300 Pro Ala Phe Leu Asp Glu Val Lys Gln Gly Arg Lys Arg Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Ser Tyr Lys Arg Ile Asp Pro Arg Val Arg Phe Val 325 330 335 Gln Ser Ile Leu His Asp Leu Pro Ser Thr Arg Leu Leu Lys Leu Ala 340 345 350 Glu Ala Ile Glu Cys Ala Ala Ser Ala Asp Asp Tyr Phe Arg Ser Arg 355 360 365 Gly Leu Tyr Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe Thr Gly 370 375 380 Ile Gly Phe Glu Val Glu Met Ile Pro Ala Ala Met Leu Ala Gln Arg 385 390 395 400 Ile Met Gly Ile Met Ala His Trp Arg Glu Tyr Met His Pro Ile Ala 405 410 415 Cys Pro Thr Arg Lys Ser Tyr Val Leu Pro Met Arg Leu Ala Thr Arg 420 425 430 Ser Ser Ser Ile Asn Thr Ser Leu Leu Phe Thr Ser Asn His Glu Thr 435 440 445 Ser Arg Arg Ile His Asp His Ala His Arg Asn Arg Asn Asn Pro Ser 450 455 460 Pro Leu Thr Asn Cys His Thr Arg Ile Thr Thr Thr Ala Asn Thr Asn 465 470 475 480 Thr Ile Ile Ile Ala Leu Ile Phe Glu Leu Gly Leu Lys His Ser Pro 485 490 495 Gln Ile Glu Pro Tyr Asn His Leu Lys Tyr Leu Leu His Thr Phe Pro 500 505 510 Lys Ala Ala His Asn Thr His Arg Ile Pro Cys Val His Leu Leu Pro 515 520 525 Pro Leu Val Lys His Leu Leu Ser Ser Pro Lys Arg Pro Arg Gly Gly 530 535 540 Ser Ala Arg Leu Leu Ile Ala Asn Gln Pro His Asn His Tyr Ile His 545 550 555 560 Gly Leu Arg Ala Val Gln Ser Ser Gly Ile Ser Gly Thr Val Ala Leu 565 570 575 Ser Ala Ala Val Ala Ala Asp Ile Val Asp Ser His Glu Arg Gly Ala 580 585 590 Tyr Met Gly Leu Thr Ser Leu Gly Asn Ile Leu Ala Pro Ser Leu Gly 595 600 605 Pro Val Leu Gly Gly Leu Ile Thr Ser His Cys Gly Trp Arg Gly Val 610 615 620 Phe Cys Phe Leu Ala Gly Gly Gly Val Val Val Leu Leu Val Leu Gly 625 630 635 640 Phe Phe Leu Pro Glu Thr Arg Lys Ala Arg Val Asn Thr Leu Glu Val 645 650 655 Gly Ser Val Glu Arg Gly Gln Ala Glu Gly Ala Ala Pro Asp Asn Gln 660 665 670 Gln Ser Lys Arg Arg Lys Lys Pro Gly Leu Pro Asn Pro Leu Thr Pro 675 680 685 Leu Arg Leu Leu Ala His Phe Pro Thr Ser Leu Val Leu Leu Ser Asn 690 695 700 Gly Leu Val Phe Ala Ser Tyr Tyr Ala Val Thr Ala Gly Ile Pro Ser 705 710 715 720 Gln Phe Ala Arg Ile Tyr Gly Leu Ser Asp Met Glu Val Gly Leu Val 725 730 735 Phe Leu Pro Ala Gly Val Gly Ser Leu Val Ser Ala Thr Phe Asn Gly 740 745 750 Ala Leu Val Asp Trp Asn Tyr Arg Arg Val Arg Lys Met Tyr Glu Asp 755 760 765 Thr Lys Val Thr Ala Glu Gly Asp Asn Glu Val Ser Gly Ala Ala Glu 770 775 780 Gly Thr Gln Ser Asp Trp Glu Phe Pro Val Glu Arg Ala Arg Leu Gln 785 790 795 800 Val Gly Gly Pro Met Thr Leu Phe Cys Ser Leu Val Ile Phe Ile Tyr 805 810 815 Gly Leu Val Leu Asp Arg His Pro Pro Leu Ala Leu Ser Leu Ala Met 820 825 830 Ile Phe Leu Val Ser Phe Ser Ile Thr Ala Ser Tyr Asn Val Met Asn 835 840 845 Val Leu Leu Val Asp Leu Tyr Tyr Ser Thr Pro Ala Thr Val Met Ala 850 855 860 Thr Asn Asn Phe Val Arg Cys Phe Leu Gly Ala Val Ser Thr Ala Leu 865 870 875 880 Val Thr Pro Met Ile Glu Arg Phe Gly Gly Gly Arg Thr Tyr Gly Met 885 890 895 Val Ala Ala Leu Ile Val Gly Val Cys Cys Pro Val Leu Gly Thr Val 900 905 910 Tyr Val Asn Gly Val Gln Trp Arg Val Gln Arg Glu Ser Lys Phe Arg 915 920 925 58441PRTPenicillium roqueforti 58Met Ser Thr Gly Ile Leu Phe Ile Arg Asp Ser Arg Thr Asn Ala Asn 1 5 10 15 Tyr Glu Ile Pro Ile Asn Arg Asn Ala Val Arg Ala Thr Asp Leu Gln 20 25 30 Arg Ile Arg Ala Pro Ser Leu Asn Ser Asn Arg Ala Asp Gln Val Ala 35 40 45 His Gly Leu Arg Val Tyr Asp Pro Gly Leu Gln Asn Thr Ala Val Thr 50 55 60 Glu Ser Pro Ile Ser Phe Ser Asp His Glu Arg Gly Leu Leu Leu Tyr 65 70 75 80 Arg Gly Tyr Thr Leu Asp Gln Leu Trp Gly Cys Asp Phe Glu Glu Met 85 90 95 Phe His Leu Leu Leu Trp Gly Thr Tyr Pro Thr Ala Ser Gln Phe Glu 100 105 110 Glu Leu Arg Arg Gln Leu Ala Gln Tyr Met Gln Val Val Pro Asp Ile 115 120 125 Val Arg Gln Thr Ile Val Asn Leu Pro Lys Glu Thr Ser Pro Leu Pro 130 135 140 Leu Val Leu Ala Gly Leu Ser Ala Tyr Leu Ala Cys Thr Pro Asp Val 145 150 155 160 Ile Pro Ala Thr Thr Asn Pro Thr Ile Tyr Gln Arg Asp Ile Lys Arg 165 170 175 Ala Asp Gln Ile Ile Leu Arg Thr Val Ala Ala Tyr Ala Val Val Phe 180 185 190 Gly Ala Val Arg Ser His Arg Leu Gly Ile Pro Trp Lys Ser Pro Ser 195 200 205 Ile His Gln Thr Tyr Tyr Glu Asn Leu Phe Ala Met Ala Gly Leu Val 210 215 220 Asp Pro Lys Thr Asn Arg Pro Asp Pro Thr Arg Val Ser Cys Phe Arg 225 230 235 240 Arg Phe Gly Asn Leu Asn Ala Glu His Gly Met Ala Leu Thr Val Phe 245 250 255 Ser Thr Val Val Thr Ala Ser Ser Leu Thr Asp Pro Val Ser Cys Leu 260 265 270 Ile Ala Thr Val Ala Ala Ala His Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ser Ala Gln Leu Ala Leu Arg Asn Ile Gly Glu Pro Lys Asn Val 290 295 300 Pro Ala Phe Ile Glu Asp Ile Lys Ser Gly Lys Gln Lys Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Thr Tyr Lys Gly Met Asp Pro Arg Val Arg Pro Ile 325 330 335 Gln Ser Ile Leu Lys Asp Met Thr Asp Val Asn Gln Pro Leu Leu Lys 340 345 350 Val Ala Glu Ala Ile Glu Glu Ala Ala Ser Lys Asp Glu Phe Phe Ser 355 360 365 Thr Arg Gly Leu Tyr Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe 370 375 380 Thr Gly Ile Gly Phe Glu Pro Asp Met Ile Pro Ala Ala Met Leu Ala 385 390 395 400 His Arg Ile Ile Gly Ile Met Ala His Trp Arg Glu Tyr Met Val Asn 405 410 415 Arg Gly Lys Leu Phe Arg Pro Ile His Leu Tyr Thr Gly His Ala Glu 420 425 430 Pro Thr Ser Gly Pro Arg Pro Lys Ile 435 440 59469PRTPenicillium chrysogenum 59Met Cys Leu Cys Arg Gln Val Ser Gly Glu Thr Thr Tyr Phe Val Pro 1 5 10 15 Ser Gly Thr Leu Cys Ser Arg Arg Ile Leu Leu Lys Met Ser Thr Gly 20 25 30 Thr Leu Phe Ile Arg Asp Ser Arg Thr Asn Val Asn Tyr Glu Ile Pro 35 40 45 Ile Asn Arg Asn Ala Val Arg Ala Thr Asp Leu Gln Gly Ile Arg Ala 50 55 60 Ser Ser Leu Asn Ser Asn Arg Ala Asp Gln Val Ala His Gly Leu Arg 65 70 75 80 Val Tyr Asp Pro Gly Leu Gln Asn Thr Ala Val Thr Gln Ser Thr Ile 85 90 95 Ser Phe Ser Asp His Glu His Gly Leu Leu Leu Tyr Arg Gly Tyr Thr 100 105 110 Leu Glu Gln Leu Trp Gly Cys Glu Phe Glu Glu Met Phe His Leu Leu 115 120 125 Leu Arg Gly Thr Tyr Pro Thr Ala His Gln Cys Glu Glu Leu Arg Gln 130 135 140 Arg Leu Ala Gln Tyr Met Gln Glu Val Pro Asp Ile Val Arg Gln Thr 145 150 155 160 Ile Phe Asn Leu Pro Arg Lys Thr Ser Pro Leu Pro Leu Ile Leu Ala 165 170 175 Gly Leu Ser Ala Tyr Leu Ala Cys Ile Pro Asp Val Ile Pro Ala Thr 180 185 190 Ala Asn Ala Thr Ile Tyr Gln Thr His Ile Lys Arg Ala Asp Gln Val 195 200 205 Ile Leu Gln Thr Val Ala Ala Tyr Ala Val Val Phe Gly Ala Val Arg 210 215 220 Ser His Arg Leu Gly Ile Pro Trp Arg Ser Pro Ser Leu His Gln Thr 225 230 235 240 Tyr Tyr Glu Asn Leu Phe Thr Met Ala Gly Leu Val Asp Pro Glu Thr 245 250 255 Asn Arg Pro Asp Pro Thr Arg Ile Ser Cys Phe Arg Arg Phe Gly Asn 260 265 270 Leu Asn Ala Glu His Gly Met Ala Leu Ser Val Phe Thr Thr Leu Val 275 280 285 Thr Ala Ser Ser Leu Thr Asp Pro Val Ser Cys Leu Ile Ser Ser Val 290 295 300 Ala Ala Ala His Gly Pro Leu His Phe Gly Ala Thr Glu Ser Ala Gln 305 310 315 320 Arg Ala Leu His Asn Val Gly Glu Pro Ser Asn Val Pro Ala Phe Ile 325 330 335 Glu Glu Ile Lys Ala Gly Lys Gln Lys Leu Phe Gly Tyr Gly His Arg 340 345 350 Thr Tyr Lys Gly Met Asp Pro Arg Val Arg Pro Ile Gln Ser Ile Leu 355 360 365 Lys Asp Leu Thr Asp Val His Gln Pro Leu Leu Lys Val Ala Glu Ala 370 375 380 Ile Glu Glu Ala Ala Ala Lys Asp Glu Tyr Phe Ser Thr Arg Gly Leu 385 390 395 400 Tyr Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe Thr Gly Ile Gly 405 410 415 Phe Glu Pro Glu Met Ile Pro Ala Ala Met Leu Ala His Arg Ile Met 420 425 430 Gly Ile Met Ala His Trp Arg Glu Tyr Met Val Thr Arg Gly Lys Leu 435 440 445 Phe Arg Pro Ile His Leu Tyr Thr Gly Gln Ala Glu Pro Thr Pro Gly 450 455 460 Pro Arg Pro Lys Ile 465 60441PRTBipolaris zeicola 60Met Ser Asn Gly Phe Leu Leu Val Lys Asp Ser Arg Thr Thr Leu Glu 1 5 10 15 Tyr Arg Val Pro Ile Gln

Arg Asn Ser Val Leu Ala Thr Ala Phe Lys 20 25 30 Asp Ile Lys Ala Pro Ser Ser Ser Gly Asn Arg Ala Asp Lys Val Gly 35 40 45 Ser Gly Leu Arg Val His Asp Pro Gly Leu Leu Asn Thr Thr Val Val 50 55 60 Glu Thr Gly Val Ser Phe Ala Asp Gly Glu Arg Asp Leu Leu Leu Phe 65 70 75 80 Arg Gly Tyr Ser Leu Glu Gln Leu Trp Gln Ser Asp Tyr Glu Asp Met 85 90 95 Leu His Leu Met Val Trp Ala Lys Tyr Pro Thr Pro Val Gln Lys Glu 100 105 110 Ser Leu Arg Arg Leu Leu Ile Ala Ala Met Leu Glu Val Pro Lys Asn 115 120 125 Val Phe Glu Ile Val Ser Ala Phe Pro Ser Ser Ser Pro Pro Met Pro 130 135 140 Met Val Val Ala Gly Leu Ala Ala Tyr Leu Gly Ser Asn Pro Ala Met 145 150 155 160 Ile Pro Ala Ser Ser Gly Gly Asn Ile Tyr Gln Gly Asn Ile Glu Lys 165 170 175 Thr Asp Glu Ala Ile Ile Asn Thr Ile Ala Ala Tyr Ala Val Ile Val 180 185 190 Gly Met Ala Ala Cys His Arg Lys Gly Ile Glu Phe Thr Ala Pro Ser 195 200 205 Leu Asp Tyr Ser Phe Val Glu Asn Leu Phe His Met Ser Gly Met Val 210 215 220 Asp Asp Leu Thr Gly Arg Pro Asp Ala Met Lys Val Ser Cys Phe Arg 225 230 235 240 Arg Phe Ala Ala Leu Asn Met Asp His Gly Met Ala Leu Ala Val Phe 245 250 255 Ser Thr Met Val Thr Ala Ser Ser Leu Thr Asp Pro Val Ser Cys Leu 260 265 270 Ile Ala Ser Leu Ala Ala Ala Tyr Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ala Ala His Leu Ser Leu Arg Ser Ile Gly Asp Lys Ser Lys Val 290 295 300 Pro Glu Phe Ile Ser Glu Val Lys Gln Gly Lys Arg Lys Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Thr Tyr Lys Gly Thr Asp Pro Arg Val Arg Pro Ile 325 330 335 Lys Glu Leu Ile Glu Asp Ser Gly Ala Asn Ser Asp Arg Leu Ile Glu 340 345 350 Ile Ala Arg Glu Ile Glu Arg Leu Ala Ser Asn Asp Asp Tyr Phe Thr 355 360 365 Ser Arg Gly Leu His Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe 370 375 380 Thr Ala Val Gly Phe Gln Ser Asp Phe Ile Pro Ile Ala Met Ile Ser 385 390 395 400 Gln Arg Leu Ile Gly Ile Met Ala His Trp Arg Glu Ala Met Val Arg 405 410 415 Gly Ile Lys Leu Phe Arg Pro Ser His Ile Tyr Thr Gly Asp Thr Glu 420 425 430 Pro Val Tyr Thr Ala Ser Ala Lys Leu 435 440 61441PRTBipolaris oryzae 61Met Ser Asn Gly Phe Leu Leu Val Arg Asp Ser Arg Thr Thr Leu Glu 1 5 10 15 Tyr Arg Val Pro Ile Gln Arg Asn Ser Ile Leu Ala Thr Ala Phe Lys 20 25 30 Asp Ile Lys Ala Pro Ser Ser Ser Ala Ser Arg Ala Asp Lys Val Gly 35 40 45 Ser Gly Leu Arg Val His Asp Pro Gly Leu Leu Asn Thr Thr Val Val 50 55 60 Glu Thr Gly Val Ser Phe Ala Asp Gly Glu Arg Asp Leu Leu Leu Phe 65 70 75 80 Arg Gly Tyr Ser Leu Glu Gln Leu Trp Gln Ser Asp Tyr Glu Asp Met 85 90 95 Leu His Leu Met Val Trp Asp Lys Tyr Pro Thr Pro Val Gln Lys Glu 100 105 110 Ser Leu Arg Arg Ala Leu Ile Thr Ala Met Leu Glu Val Pro Lys Thr 115 120 125 Val Phe Glu Ile Val Ser Thr Phe Pro Ser Ala Ser Pro Pro Met Pro 130 135 140 Met Val Val Ala Gly Leu Ala Ala Tyr Leu Gly Gly Asn Pro Asp Met 145 150 155 160 Ile Pro Ala Ser Ser Gly Gly Asn Ile Tyr Gln Gly Asn Ile Glu Lys 165 170 175 Thr Asp Lys Ala Val Ile Lys Thr Ile Ala Ala Tyr Ala Val Val Val 180 185 190 Gly Met Ala Ala Cys His Arg Lys Gly Ile Glu Phe Thr Ala Pro Ser 195 200 205 Leu Asp Tyr Asn Phe Ile Glu Asn Leu Phe His Met Ser Gly Met Val 210 215 220 Asp Asp Leu Thr Gly Arg Pro Asp Ala Ile Lys Val Ser Cys Phe Arg 225 230 235 240 Arg Phe Ala Ala Leu Asn Met Asp His Gly Met Ala Leu Ala Val Phe 245 250 255 Ser Thr Met Val Thr Ala Ser Ser Leu Thr Asp Pro Ile Ser Cys Leu 260 265 270 Ile Ala Ser Leu Ala Ala Ala Tyr Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ala Ala His Leu Asn Leu Arg Ser Ile Gly Asp Lys Ser Lys Val 290 295 300 Pro Glu Phe Ile Ser Glu Val Lys Gln Gly Lys Arg Lys Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Thr Tyr Lys Gly Thr Asp Pro Arg Val Lys Pro Ile 325 330 335 Lys Glu Leu Ile Glu Asp Ser Gly Ala Asn Ser Asp Pro Leu Ile Glu 340 345 350 Ile Ala Lys Glu Ile Glu Arg Leu Ala Ser Asn Asp Asp Tyr Phe Thr 355 360 365 Ser Arg Gly Leu His Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe 370 375 380 Thr Ala Val Gly Phe Gln Ser Asp Phe Ile Pro Ile Ala Met Ile Ser 385 390 395 400 Gln Arg Leu Ile Gly Ile Met Ala His Trp Arg Glu Ala Met Val Arg 405 410 415 Gly Ile Lys Leu Phe Arg Pro Ser His Ile Tyr Thr Gly Asp Thr Glu 420 425 430 Pro Val Tyr Thr Ala Ser Ala Lys Leu 435 440 62454PRTAspergillus clavatus 62Met Tyr Ala Met Ile Leu Leu Cys Tyr Ala Ile Phe Gly Val Pro Gln 1 5 10 15 Leu Pro Met Asp Ile Asn Arg Ala Glu Trp Leu Cys Asn Leu Leu Tyr 20 25 30 Gln Ile Cys Pro Gly Phe Ala Val Lys Ser Cys Thr Met Ser Ser Gly 35 40 45 Val Leu Phe Ile Lys Asp Ser Arg Thr Asn Ile Gln Tyr Glu Ile Pro 50 55 60 Ile Arg Arg Asn Ala Ile Ala Ala Val Asp Phe Lys Arg Ile Lys Ala 65 70 75 80 Pro Ser Ala Gly Thr Asp Arg Ala Asp Gln Val Ala Ser Gly Leu Arg 85 90 95 Val His Asp Pro Gly Leu Leu Asn Thr Thr Val Val Glu Thr Glu Ile 100 105 110 Ser Phe Ser Asp His Glu Arg Gly Leu Leu Leu Phe Arg Gly Tyr Thr 115 120 125 Leu Gln Gln Leu Trp Asp Ser Glu Phe Glu Asp Met Leu His Leu Leu 130 135 140 Val Trp Gly Thr Tyr Pro Thr Leu Arg Gln Arg Lys Glu Leu Ser Arg 145 150 155 160 Lys Leu Val Asp Cys Met Leu Ala Val Pro Lys Thr Val His Glu Val 165 170 175 Ile Arg Thr Leu Pro Ser Thr Thr Ser Pro Leu Pro Leu Ile Met Ala 180 185 190 Gly Leu Ser Ala Tyr Leu Ala Cys Ile Pro Gly Thr Ile Pro Ala Ser 195 200 205 Thr Asn Pro Asp Leu Tyr Gln Gly Asn Met Glu Glu Val Asp Arg Ala 210 215 220 Ile Val Arg Thr Val Ala Ala Tyr Ala Val Val Phe Gly Leu Val Asn 225 230 235 240 Cys His Arg Lys Gly Ile Pro Phe Thr Pro Pro Ser His Glu Gln Leu 245 250 255 Tyr Phe Glu Asn Leu Phe Ser Met Ala Gly Leu Val Asp Pro Ala Thr 260 265 270 Asn Ser Ala Asp Ala Thr Lys Leu Ser Cys Phe Arg Arg Phe Ala Met 275 280 285 Leu Asn Ala Asp His Gly Met Ala Leu Ser Val Phe Ser Ala Leu Val 290 295 300 Thr Ala Ser Ser Leu Pro Asp Pro Ile Ser Cys Leu Ile Thr Ser Ile 305 310 315 320 Gly Ala Ala Phe Gly Pro Leu His Phe Ala Ala Thr Glu Ser Ala Gln 325 330 335 Leu Ala Leu Arg Glu Ile Gly Thr Pro Asp Lys Val Pro Glu Phe Ile 340 345 350 Glu Glu Val Lys Arg Gly Gln Arg Arg Leu Phe Gly Tyr Gly His Arg 355 360 365 Ser Tyr Lys Gly Thr Asp Pro Arg Val Ala Pro Ile Lys Ser Ile Leu 370 375 380 Lys Asp Leu Asp Thr Ser Asp Asn Pro Phe Leu Lys Ile Ala Glu Gln 385 390 395 400 Ile Glu Arg Val Ala Ser Ala Asp Asp Phe Phe Ser Lys Arg Gly Leu 405 410 415 His Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe Thr Ala Ile Asp 420 425 430 Asp Ser Arg Arg Asp Asp Gly Ala Ala Asp Tyr Arg Gly His Gly Thr 435 440 445 Leu Glu Gly Val Tyr Val 450 63441PRTBipolaris victoriae 63Met Ser Asn Gly Phe Leu Leu Val Lys Asp Ser Arg Thr Thr Leu Glu 1 5 10 15 Tyr Arg Val Pro Ile Gln Arg Asn Ser Val Leu Ala Thr Ala Phe Lys 20 25 30 Asp Ile Lys Ala Pro Ser Ser Ser Gly Asn Arg Ala Asp Lys Val Gly 35 40 45 Ser Gly Leu Arg Val His Asp Pro Gly Leu Leu Asn Thr Thr Val Val 50 55 60 Glu Thr Gly Val Thr Tyr Arg Asp Gly Glu Arg Asp Leu Leu Leu Phe 65 70 75 80 Arg Gly Tyr Ser Leu Glu Gln Leu Trp Gln Ser Asp Tyr Glu Asp Met 85 90 95 Leu His Leu Met Val Trp Ala Lys Tyr Pro Thr Pro Val Gln Lys Glu 100 105 110 Ser Leu Arg Arg Leu Leu Ile Ala Ala Met Leu Glu Val Pro Lys Asn 115 120 125 Val Phe Glu Ile Val Ser Ala Phe Pro Ser Ser Ser Pro Pro Met Pro 130 135 140 Met Ile Val Ala Gly Leu Ala Ala Tyr Leu Gly Ser Asn Pro Ala Met 145 150 155 160 Ile Pro Ala Ser Ser Gly Gly Asn Ile Tyr Gln Gly Asn Ile Glu Lys 165 170 175 Thr Asp Lys Ala Ile Ile Asn Thr Ile Ala Ala Tyr Ala Val Ile Val 180 185 190 Gly Met Ala Ala Cys His Arg Lys Gly Ile Glu Phe Thr Ala Pro Ser 195 200 205 Leu Asp Tyr Ser Phe Val Glu Asn Leu Phe His Met Ser Gly Met Val 210 215 220 Asp Asp Leu Thr Gly Arg Pro Asp Ala Met Lys Val Ser Cys Phe Arg 225 230 235 240 Arg Phe Ala Ala Leu Asn Met Asp His Gly Met Ala Leu Ala Val Phe 245 250 255 Ser Thr Met Val Thr Ala Ser Ser Leu Thr Asp Pro Val Ser Cys Leu 260 265 270 Ile Ala Ser Leu Ala Ala Ala Tyr Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ala Ala His Leu Ser Leu Arg Ser Ile Gly Asp Lys Ser Lys Val 290 295 300 Pro Glu Phe Ile Ser Glu Val Lys Gln Gly Lys Arg Lys Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Thr Tyr Lys Gly Thr Asp Pro Arg Val Arg Pro Ile 325 330 335 Lys Glu Leu Ile Glu Asp Ser Gly Ala Asn Ser Asp Pro Leu Ile Glu 340 345 350 Ile Ala Arg Glu Ile Glu Arg Leu Ala Ser Asn Asp Asp Tyr Phe Thr 355 360 365 Ser Arg Gly Leu His Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe 370 375 380 Thr Ala Val Gly Phe His Ser Asp Phe Ile Pro Ile Ala Met Ile Ser 385 390 395 400 Gln Arg Leu Ile Gly Ile Met Ala His Trp Arg Glu Ala Met Val Arg 405 410 415 Gly Ile Lys Leu Phe Arg Pro Ser His Ile Tyr Thr Gly Asp Thr Glu 420 425 430 Pro Val Tyr Thr Ala Ser Ala Lys Leu 435 440 64978PRTAspergillus ruber 64Met Ala Gly Met Leu Asn Ile Thr Asp Ser Arg Thr Asn Ala Gln His 1 5 10 15 Gln Ile Ser Ile Arg His Asn Ala Ile Leu Ala Ser Asp Leu Lys Lys 20 25 30 Thr Thr Gly Leu Arg Val His Asp Pro Gly Leu Gln Asn Thr Thr Val 35 40 45 Val Glu Thr Gly Ile Thr Val Ser His His Asp Thr Gly Leu Leu Leu 50 55 60 Phe Arg Gly Tyr Lys Leu Gln Asp Leu Trp Asp Ile Asn Ser Asp Phe 65 70 75 80 Glu Asp Ile Leu His Leu Leu Val Trp Gly Val Tyr Pro Ser Ser Glu 85 90 95 Gln Arg Lys Thr Leu Ser Arg Gln Leu Ala Thr Ala Met Leu Glu Val 100 105 110 Pro Asp Val Val Phe Gln Thr Ile Arg Ala Leu Pro Lys Thr Thr Ser 115 120 125 Pro Leu Pro Leu Leu Met Ala Gly Leu Ser Ala Ser Leu Ser Cys Arg 130 135 140 Pro Glu Met Ile Pro Ala Ser Thr Asn Pro His Leu Tyr Arg Asp Pro 145 150 155 160 Lys Ile Ala Asp His Ala Ile Ile Tyr Thr Ile Ala Thr Tyr Ala Val 165 170 175 Ala Phe Gly Ile Ile Arg Cys His Arg Gln Gly Ile Thr Phe Thr Ser 180 185 190 Pro Ser Val Asp Asn Ser Tyr Leu Glu Asn Leu Phe Ile Met Ala Gly 195 200 205 Leu Val Asp Pro Ser Thr Gly Arg Pro Asp Pro Val Arg Leu Ser Cys 210 215 220 Tyr Arg His Phe Gly Ile Phe Asn Ser Asp His Gly Met Ala Leu Ser 225 230 235 240 Val Phe Ser Ala Leu Val Thr Ala Ser Ser Gln Thr Asp Pro Ile Ser 245 250 255 Cys Leu Ile Thr Ala Thr Gly Ala Ala Tyr Gly Pro Leu His Phe Gly 260 265 270 Ala Thr Glu Ser Ala Lys Arg Ala Leu Leu His Ile Gly Thr Ile Asp 275 280 285 Asn Val Pro Ser Phe Ile Glu Gly Val Lys Gln Gly Lys Gln Lys Leu 290 295 300 Phe Gly Tyr Gly His Arg Ser Tyr Lys Gly Met Asp Pro Arg Val Gln 305 310 315 320 Pro Met Arg Lys Leu Val Cys Asp Leu Lys Leu Asp Ser Ala Ser Asn 325 330 335 Pro Leu Leu Lys Ile Ala Glu Arg Ile Glu Gln Val Ala Ser Glu Asp 340 345 350 Glu Trp Phe Ala Arg Arg Gly Leu Tyr Pro Asn Ala Asp Phe Tyr Gly 355 360 365 His Phe Val Leu Ser Gly Cys Gly Phe Glu Thr Asp Ile Ile Pro Ala 370 375 380 Ala Met Leu Ala Gln Arg Val Val Gly Ile Met Ala His Trp Arg Glu 385 390 395 400 Tyr Met Leu Thr Gly Gly Lys Leu Phe Arg Pro Ser His Ile Tyr Thr 405 410 415 Gly Glu Glu Glu Gly Lys Leu Lys Leu His Leu Gly Gln Gln Val Lys 420 425 430 Met Ser Glu Glu Asn Glu Asn Thr Pro Leu Leu Leu Pro Tyr Ser Val 435 440 445 Phe Thr Pro Ser Gln Lys Arg Leu Leu Ile Leu Thr Ala Ala Leu Ala 450 455 460 Ser Ser Phe Ser Pro Phe Ser Ala Asn Ile Tyr Tyr Pro Ser Leu Asn 465 470 475 480 Ser Ile Ala Arg Asp Leu His Val Ser Ser Ser Gln Ile Asn Leu Thr 485 490 495 Ile Thr Thr Tyr Met Ile Cys Gln Gly Leu Ala Pro Ala Phe Met Gly 500 505 510 Ser Leu Ala Asp Gln Ala Gly Arg Arg Pro Ala Tyr Leu Leu Cys Phe 515 520 525 Ile Ile Tyr Ile Ala Gly Asn Ile Ala Leu Ala Leu Gln His Ser Tyr 530

535 540 Pro Ala Leu Leu Ile Leu Arg Ala Val Gln Ser Cys Gly Ser Ser Gly 545 550 555 560 Thr Val Ala Leu Ala Ser Ala Val Ala Ala Asp Val Ile Thr Ser Ala 565 570 575 Glu Arg Gly Met Tyr Met Gly Ile Ala Ser Leu Gly Asn Ile Leu Ala 580 585 590 Pro Ser Leu Gly Pro Ile Leu Gly Gly Pro Arg Arg Pro Lys Ile Thr 595 600 605 Phe Pro Asn Pro Leu Gly Thr Leu Arg Leu Leu Phe His Arg Pro Thr 610 615 620 Gly Phe Val Leu Leu Ala Asn Gly Ile Ile Tyr Ala Ser Tyr Tyr Ser 625 630 635 640 Val Thr Ala Gly Leu Pro Ala Gln Phe His Glu Leu Tyr Asn Leu Gln 645 650 655 Asp Leu Gly Ile Gly Leu Ser Phe Ile Pro Ala Gly Leu Gly Ser Leu 660 665 670 Phe Ser Ala Thr Val Asn Gly Met Leu Val Asp Trp Asn Tyr His Arg 675 680 685 Val Lys Met Lys Met Gly Leu Pro Val Thr Arg Asp Gln Lys Gln Asp 690 695 700 His Gly Asp Phe Pro Ile Glu Gln Thr Arg Leu Gln Ile Gly Leu Pro 705 710 715 720 Met Met Val Phe Leu Ser Phe Phe Ala Thr Val Ser Leu Thr Leu Val 725 730 735 Phe Leu Ile Ser Leu Phe Ile Thr Ala Ala Tyr Asn Val Leu Asn Val 740 745 750 Leu Ile Val Asp Leu Tyr Tyr Thr Thr Pro Ala Thr Ala Met Ala Ala 755 760 765 Asn Asn Leu Val Arg Cys Phe Leu Gly Ala Ala Ala Thr Ala Val Val 770 775 780 His Pro Leu Ser Ser Gln Trp Gly Ile Gly Trp Thr Tyr Ser Ala Asn 785 790 795 800 Ile Met Met Leu Ser Thr Leu Leu Leu Pro Leu Val Ser Ala Leu His 805 810 815 Gly His Leu Tyr Met Arg Tyr Pro Asp Ser Arg Trp Ile Thr Pro Gly 820 825 830 Asp Thr Leu Pro Ile Ala Glu Thr Lys Pro Ile Pro Ile Leu Gln Thr 835 840 845 Thr Leu Pro Cys Thr Ser Pro Tyr Leu Leu Leu Thr Ile Asp Pro Asp 850 855 860 Val Gln Tyr Gly Thr Thr Ser Thr Ile Val Leu His Trp Leu Gln Ser 865 870 875 880 Leu Arg Ala Asp Cys Gln Thr Gly Phe Leu Tyr Glu Asn Pro Lys Ser 885 890 895 Glu Glu Thr Ala Val Tyr Ile Pro Pro Gln Pro Pro Lys Arg Ser His 900 905 910 His Arg Tyr Ile Phe Leu Leu Phe Gln Gln Pro Glu Asp Tyr Asn Leu 915 920 925 Pro Glu Cys Tyr Gln His Ile Leu Pro Ala Thr Lys Glu Ala Arg Val 930 935 940 Gly Phe Asn Pro Lys Glu Phe Val Glu Val Leu Gly Leu Gly Gly Pro 945 950 955 960 Leu Ala Gly Asn Trp Phe Tyr Val Glu Asn Gly Gly Asp Ala Arg Asn 965 970 975 Glu Leu 65420PRTBipolaris maydis 65Met Ser Asn Gly Phe Leu Phe Val Arg Asp Ser Arg Thr Thr Gln Glu 1 5 10 15 Tyr Arg Val Pro Ile Gln Arg Asn Ala Ile Leu Ala Thr Ala Phe Lys 20 25 30 Asp Ile Lys Ala Pro Ser Ser Ser Gly Asn Arg Ala Asp Lys Leu Asp 35 40 45 Ser Gly Leu Arg Val His Asp Pro Gly Leu Leu Asn Thr Thr Val Val 50 55 60 Glu Thr Gly Val Ser Phe Ala Asp Gly Glu Arg Asp Leu Leu Leu Phe 65 70 75 80 Arg Gly Tyr Ser Leu Glu Gln Leu Trp Gln Ser Asp Tyr Glu Asp Met 85 90 95 Leu His Leu Leu Val Trp Ala Lys Tyr Pro Thr Pro Val Gln Lys Glu 100 105 110 Ser Leu Arg Arg Ala Leu Ile Ala Ala Met Leu Glu Val Pro Lys Thr 115 120 125 Val Phe Glu Val Val Ser Ala Phe Pro Ser Ala Ser Pro Pro Met Pro 130 135 140 Met Val Val Ala Gly Leu Ala Ala Tyr Leu Gly Ser Asn Pro Asp Met 145 150 155 160 Ile Pro Ala Ser Asn Gly Gly Asn Ile Tyr Gln Gly Asp Ile Glu Lys 165 170 175 Thr Asp Lys Ala Ile Val Lys Thr Ile Ala Ala Tyr Ala Val Val Val 180 185 190 Gly Met Ala Ala Cys His Arg Lys Gly Ile Glu Phe Thr Ala Pro Leu 195 200 205 Leu Asp Tyr Asn Phe Ile Glu Asn Leu Phe His Met Ser Gly Met Val 210 215 220 Asp Asp Leu Thr Gly Arg Pro Asp Ala Met Lys Val Ser Cys Phe Arg 225 230 235 240 Arg Phe Ala Ala Leu Asn Met Asp His Gly Met Ala Leu Ala Val Phe 245 250 255 Ser Thr Met Val Thr Ala Ser Ser Leu Thr Asp Pro Ile Ser Cys Leu 260 265 270 Val Ala Ser Leu Ala Ala Ala Tyr Gly Pro Leu His Phe Gly Ala Thr 275 280 285 Glu Ala Ala His Leu Asn Leu Arg Ser Ile Gly Asp Lys Ser Lys Val 290 295 300 Pro Glu Phe Ile Ser Glu Val Lys Gln Gly Lys Arg Lys Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Thr Tyr Lys Gly Thr Asp Pro Arg Val Arg Pro Ile 325 330 335 Lys Glu Leu Ile Glu Asp Ser Gly Ala Asn Ser Asp Pro Leu Ile Glu 340 345 350 Ile Ala Arg Glu Val Glu Arg Leu Ala Ser Asn Asp Asp Tyr Phe Thr 355 360 365 Ser Arg Gly Leu His Pro Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe 370 375 380 Thr Ala Val Gly Phe Gln Ser Asp Phe Ile Pro Ile Ala Met Ile Ser 385 390 395 400 Gln Arg Leu Ile Gly Ile Met Ala His Trp Arg Glu Ala Met Gly Glu 405 410 415 Ser Ser Asp Thr 420 66443PRTTalaromyces stipitatus 66Met Ser Asp Gly Thr Leu Phe Val Glu Asp Ser Arg Ser Gly Lys Lys 1 5 10 15 Tyr Glu Ile Pro Ile Arg His Asn Thr Val Leu Ala Thr Asp Leu Lys 20 25 30 Arg Ile Lys Ala Ser Ser Thr Ala Ala Asn Arg Ala Asp Lys Val Ala 35 40 45 Asp Gly Leu Arg Leu Tyr Asp Pro Gly Leu Glu Asn Thr Thr Val Val 50 55 60 Glu Thr Ser Met Thr Tyr Ala Asp Ala Asp Arg Gly Leu Leu Met Phe 65 70 75 80 Arg Gly Tyr Ala Leu Glu Gln Leu Trp Glu Ser Glu Phe Glu Asp Met 85 90 95 Leu His Leu Met Val Trp Gly Lys Tyr Pro Thr Pro Ser Gln Ser Ala 100 105 110 Ser Leu Arg Lys Asp Leu Ala Ser Leu Met Gly Asp Ile Pro Lys Thr 115 120 125 Val Phe Glu Val Ile Glu Lys Phe Pro Arg Asp Cys Pro Pro Met Pro 130 135 140 Met Leu Val Ala Gly Leu Ala Ala Tyr Leu Ser Asp Asp Leu Asp Ser 145 150 155 160 Ile Pro Thr Phe Asn Gly Gly Asn Ile Phe His Gly Asn Val Glu Lys 165 170 175 Thr Asp Glu Ala Ile Leu Lys Thr Val Ala Ala Phe Ala Ser Val Val 180 185 190 Gly Ile Ala Gly Ser His Arg Arg Gly Ile Ala Phe Thr Pro Pro Ser 195 200 205 Leu Asp Lys Gly Tyr Leu Asp Asn Leu Phe Lys Met Met Gly Ile Val 210 215 220 Asp Pro Thr Thr Asn Lys Pro Ser Pro Glu Lys Leu Asp Cys Phe Arg 225 230 235 240 Arg Phe Thr Ile Ile Asn Thr Asp His Gly Met Ala Leu Ser Ala Phe 245 250 255 Ala His Leu Val Ala Thr Ser Ala Leu Ala Asp Pro Ile Ser Gly Leu 260 265 270 Ile Gly Ser Leu Val Ala Ala Tyr Gly Pro Leu His Phe Gly Ala Pro 275 280 285 Glu Ala Ala Tyr Lys Thr Ile Lys Ser Ile Gly Gly Pro Gln Asn Val 290 295 300 Pro Ser Phe Leu Asp Glu Val Lys Ser Gly Lys Arg Arg Leu Phe Gly 305 310 315 320 Tyr Gly His Arg Thr Tyr Arg Thr Val Asp Pro Arg Leu Ala Pro Ile 325 330 335 Lys Ser Ala Leu Gln Thr Leu Asn Val Glu Thr Asp Ile Pro Leu Glu 340 345 350 Thr Ala Tyr Glu Ile Asp Arg Leu Ala Ser Asn Asp Asp Tyr Phe Leu 355 360 365 Lys Arg Gly Leu His Ala Asn Ala Asp Phe Tyr Thr Pro Tyr Cys Phe 370 375 380 Ile Lys Ile Gly Phe His Pro Glu Glu Phe Pro Ile Ala Met Phe Ala 385 390 395 400 Gln Arg Ile Ile Gly Ile Met Ala His Trp Arg Glu Ala Met Leu Arg 405 410 415 Lys Val Lys Leu Phe Arg Pro Thr His Ile Tyr Thr Gly Glu Thr Glu 420 425 430 Pro Val Glu His Ile Lys Ile Pro Ser Lys Leu 435 440 67438PRTTalaromyces stipitatus 67Met Ser Asp Gly Thr Leu Phe Ile Gln Asp Ser Arg Thr Ser Lys Gln 1 5 10 15 Tyr Thr Ile Ser Val Thr Ser Asp Thr Ile Thr Ala Val Asp Phe Gln 20 25 30 Lys Ile Thr Ser Pro Thr Gly Lys Leu Ala Leu Tyr Asp Pro Gly Leu 35 40 45 Gln Asn Thr Ile Ile Lys Lys Thr Gln Ile Thr Gly Arg Asp Pro Val 50 55 60 Thr Gly Ile Thr Leu Phe Arg Gly Leu Ser Ala Lys Glu Ile Trp Asn 65 70 75 80 Arg His Ala Asp Phe Glu Asp His Phe His Leu Leu Val Phe Gly Lys 85 90 95 Tyr Pro Ser Pro Glu Glu Ser Glu Ala Leu Arg Arg Arg Leu Ala Val 100 105 110 Gln Met Thr Val Val Pro Glu Thr Val Ile Lys Ala Val Gln Ala Phe 115 120 125 Pro Arg Thr Ser His Pro Leu Pro Met Ile Ile Ala Gly Leu Ala Ala 130 135 140 Phe Ile Ser Ala Asp Pro Ser Ser Leu Pro Ala Ile Arg Gly Gly Asn 145 150 155 160 Ile Tyr His Gly Asn Arg Ala Leu Cys Asp Glu Gly Val Ile Arg Ala 165 170 175 Thr Ala Ala Tyr Ala Val Val Met Gly Leu Ile Asn Ser His Arg Lys 180 185 190 Gln Leu Pro Tyr Val Pro Ala Asp Pro Gln Lys Ser Phe Tyr Glu Asn 195 200 205 Val Phe Ala Met Met Arg Cys Pro Val His His Asn Tyr Leu Val Thr 210 215 220 Phe Arg Glu Gly Met Val Leu Asn Ser Asp Asn Gly Met Thr Gln Ser 225 230 235 240 Ser Val Val Leu Leu Ser Thr Ala Ser Ser Leu Pro Asp Pro Ile Ser 245 250 255 Cys Leu Ile Ser Ala Ile Thr Ala Ala Tyr Gly Pro Leu His Tyr Gly 260 265 270 Ala Gln Glu Ala Gly Ser Thr Thr Leu Lys Ser Ile Gly Ser Leu Asp 275 280 285 Lys Val Pro Glu Phe Leu Glu Gln Val Lys Arg Arg Glu Arg Arg Leu 290 295 300 Phe Gly Phe Gly His Arg Leu His Lys Arg Glu Asp Pro Arg Leu Ala 305 310 315 320 Ser Val Lys Arg Trp Leu Lys Met Met Asp Tyr Thr Pro Asp Gln Glu 325 330 335 Pro Leu Leu Glu Leu Ala Gln Glu Ile Asp Arg Leu Ala Ser Ser Asp 340 345 350 Glu Tyr Phe Ile Lys Arg Asn Leu Arg Ala Asn Ala Asp Phe Tyr Thr 355 360 365 His Phe Leu Phe Lys Ala Trp Gly Phe Asp Trp Asp Met Leu Cys Ala 370 375 380 Ala Asn Met Phe His Arg Ile Ile Gly Leu Met Ala His Trp Arg Glu 385 390 395 400 Ala Met Asp Gln Pro Ile Lys Ile Phe Arg Ala Thr Asp Leu Tyr Val 405 410 415 Gly Pro Val Val Ile Gln Glu Asp Asn Arg Thr Val Leu Glu Glu Pro 420 425 430 Lys Ile Gln Ser Arg Leu 435 68221PRTAspergillus terreus 68Met Ala Gly Leu Leu Asn Gln Pro Ser Ala Thr Pro Asp Gly Val Lys 1 5 10 15 Ile Ser Cys Phe Arg Arg Phe Ala Leu Leu Asn Ala Asp His Gly Met 20 25 30 Ala Leu Ser Val Phe Ser Ala Leu Val Thr Ala Ser Ser Leu Pro Asp 35 40 45 Pro Leu Ser Ser Val Leu Ser Ala Val Ala Ala Ala Tyr Gly Pro Leu 50 55 60 His Phe Gly Ala Thr Glu Thr Ala His Arg Thr Leu Arg Glu Ile Gly 65 70 75 80 Ser Pro Asp Asn Val Pro Ser Phe Ile Glu Glu Val Lys Asn Gly Arg 85 90 95 Arg Lys Leu Phe Gly Tyr Gly His Arg Ala Tyr Lys Gly Val Asp Pro 100 105 110 Arg Val Gln Pro Ile Gln Ser Ile Leu Lys Asp Leu Asp Met Ser Ser 115 120 125 Asn Gly Leu Leu Lys Ile Ala Glu Arg Ile Glu Gln Thr Ala Ser Thr 130 135 140 Asp Asp Tyr Phe Leu Lys Arg Gly Leu Tyr Pro Asn Ala Asp Phe Tyr 145 150 155 160 Gly Asn Phe Val Phe Thr Gly Ile Gly Phe Glu Pro Asp Met Ile Pro 165 170 175 Ala Ala Met Leu Ala Gln Arg Ile Ile Gly Ile Met Ala His Trp Arg 180 185 190 Glu Tyr Met Leu Asn Arg Gly Lys Leu Leu Arg Pro Ser His Ile Tyr 195 200 205 Thr Gly Asp Val Lys Ala Ala Glu Ile Ser Ser Lys Leu 210 215 220 69253PRTPenicillium digitatum 69Met Cys Ser Lys Ala Thr Ser Pro Leu Pro Leu Ile Leu Ala Gly Leu 1 5 10 15 Ser Ala His Leu Ala Cys Leu Pro Asp Val Ile Pro Ala Thr Thr Asn 20 25 30 Pro Thr Ile Tyr Gln Thr Asp Ile Lys Arg Ala Asp Gln Ile Ile Leu 35 40 45 Gln Thr Val Ala Gly Tyr Ala Val Val Phe Gly Ala Val Arg Ser His 50 55 60 Arg Leu Gly Leu Pro Trp Arg Ser Pro Ser Leu His Gln Thr Tyr Tyr 65 70 75 80 Glu Asn Leu Phe Thr Met Ala Gly Leu Val Asp Pro Glu Thr Asn Tyr 85 90 95 Pro Asp Leu Arg Gly Ile Ser Cys Phe Arg Arg Phe Gly Asn Leu Asn 100 105 110 Ala Glu His Gly Met Ala Leu Thr Ala Phe Ser Ser Ile Val Thr Ala 115 120 125 Ser Ser Leu Thr Asp Pro Val Ser Cys Leu Ile Ser Ala Leu Ala Ala 130 135 140 Ala His Gly Pro Leu His Phe Gly Ala Thr Glu Ser Ala Gln Arg Ala 145 150 155 160 Leu Arg Asp Ile Gly Glu Pro Lys Asn Val Pro Ala Phe Ile Glu Glu 165 170 175 Val Lys Ala Gly Lys Gln Lys Leu Phe Gly Tyr Gly His Arg Thr Tyr 180 185 190 Lys Gly Met Asp Pro Arg Val Arg Pro Ile Gln Ser Ile Leu Lys Asp 195 200 205 Leu Ile His Ile Asn Gln Pro Leu Leu Lys Val Ala Glu Ala Ile Glu 210 215 220 Asp Ala Ala Ala Lys Asp Asp Tyr Phe Val Ser Arg Gly Leu Tyr Pro 225 230 235 240 Asn Ala Asp Phe Tyr Gly Asn Phe Val Phe Thr Gly Met 245 250 70493PRTColletotrichum graminicola 70Met Gly Val Ile Phe Tyr Gly Leu Lys His Leu Arg Pro Phe Phe Ser 1 5 10 15 Leu Leu Gly Leu Val Lys Arg Ser Met Val Met Val Asn Lys Ala Ile 20 25 30 Gln Lys Ser Pro Arg Ile Val His Trp Val Leu Gly Arg His Asp Ile 35 40 45 Asp Ser Pro Cys Ser Thr Leu Thr Val Leu Asp Asn Arg Thr Lys Arg 50 55 60

Arg Tyr Glu Ile Pro Ile Arg Arg Asn Ala Val Ser Ala Leu Glu Phe 65 70 75 80 Gln Lys Ile Thr Thr Ala His Cys Gly Ile Glu Ser Val Gly Gln Val 85 90 95 Asp Phe Gly Leu Arg Val Leu Asp Pro Gly Tyr Arg Asn Thr Ala Cys 100 105 110 Val Glu Ser Asn Ile Thr Phe Val Asp Gly Lys Arg Gly Tyr Ile Gln 115 120 125 Leu Arg Gly Tyr Pro Ile Glu Tyr Leu Val Glu Asn His Asp Tyr Glu 130 135 140 Glu Val Ile His Leu Leu Ile Trp Gly Arg Leu Pro Asp Ala Val Glu 145 150 155 160 Lys Lys Glu Leu Gln Arg Arg Ile Ala Ala Gly Cys Ala Pro Pro Glu 165 170 175 His Val Val Gln Val Ile Thr Ser Phe Pro Arg Asp Ser Leu Thr Ser 180 185 190 Thr Met Val Met Ala Gly Met Ala Ala Tyr Ala Ser Cys Asp Glu Gly 195 200 205 Ala Val Ser Thr Leu Gln Ser Gly Cys Pro Ala Tyr Leu Gly Gln Pro 210 215 220 Asp Lys Val Asp Ala Ala Leu Ile Ser Thr Ile Ser Ala Leu Ala Thr 225 230 235 240 Val Val Ala Leu Thr Tyr Cys His Lys Arg Gly Lys Arg Leu Ala Pro 245 250 255 Val Asp Pro Glu Ala Ser Phe Thr Ala Asn Val Leu Gly Met Met Gly 260 265 270 Phe Gln Glu Gly Met Ser Gly Lys Pro Asp Ala Glu Met Val Gln Cys 275 280 285 Phe Glu Lys Leu Trp Ile Leu Tyr Ala Asp Gln Glu Met Thr Asn Ser 290 295 300 Thr Ser Ala Phe Leu His Ala Ala Ser Thr Leu Val Asp Pro Leu Ser 305 310 315 320 Cys Cys Ile Ser Gly Ile Val Ser Gly Tyr Gly Pro Leu His Gly Gly 325 330 335 Ala Ile Asp Leu Ala Tyr Lys Ala Phe Gln Asp Val Lys Thr Pro Glu 340 345 350 Asn Val Pro Ala Leu Ile Ala Asp Val Lys Ala Lys Lys Gln Arg Leu 355 360 365 Phe Gly Tyr Gly His Arg Val Tyr Lys Val Val Asp Pro Arg Ala Lys 370 375 380 Phe Ile Arg Ala Met Ile Asn Gln Tyr Arg Asp Lys Val Glu Ser Asn 385 390 395 400 Pro Leu Leu Ser Val Ala Met Glu Ile Asp Arg Val Ala Ser Thr Asp 405 410 415 Glu Tyr Phe Thr Ser Arg Ser Leu Lys Ala Asn Ala Asp Leu Tyr Gly 420 425 430 Cys Phe Leu Tyr Thr Ala Phe Gly Phe Glu Pro Asp Ile Ile Val Ala 435 440 445 Met Ala Ser Leu Ser Arg Ile Pro Gly Val Leu Ala His Trp Arg Glu 450 455 460 Ala Met Leu Glu Lys Gly Pro Leu Leu Trp Arg Pro Gln Gln Val Phe 465 470 475 480 Thr Gly Ala Leu Ala Asp Glu Tyr Tyr Cys Ala Thr Arg 485 490 71450PRTAuricularia delicata 71Met Gly Arg Trp Ala Leu Asn Lys Ala Gly Ala Thr Ser Leu Gly Glu 1 5 10 15 Ser Ser Gly Ser Leu Thr Val Ile Asp Asn Arg Thr Gln Arg Thr Tyr 20 25 30 Glu Val Glu Ile Lys His Asn Ala Ile Lys Ala Thr Asp Leu Arg Arg 35 40 45 Ile Thr Ala Ala Gly Val Ala Ala Asp Pro Val Asp Gln Val Glu Ser 50 55 60 Gly Leu Arg Val Leu Asp Lys Gly Tyr Leu Asn Thr Ala Cys Met Glu 65 70 75 80 Ser Ser Val Thr Leu Ile Asp Gly Lys Arg Gly Tyr Ile Gln Tyr Arg 85 90 95 Asp Lys Ser Ile Asp Glu Leu Val Arg Asn Asn Asp Tyr Glu Glu Val 100 105 110 Ala His Leu Leu Ile Trp Gly Arg Leu Pro Ser Leu Glu Glu Lys Thr 115 120 125 Arg Leu Arg Arg Gly Leu Ala Ala Ala Met Val Pro Pro Gln Ser Val 130 135 140 Ile Asp Val Ile Gln Ala Phe Pro Arg Asp Ser Leu Thr Phe Pro Met 145 150 155 160 Leu Leu Ala Gly Leu Ser Ala Phe Ala Ala Val Asp Lys Gly Thr Gln 165 170 175 Gln Val His Glu Ser Gly Arg Pro Val Tyr Leu Gly Asn Thr Pro Ala 180 185 190 Val Asp Ala Ala Ile Val Arg Ser Leu Ala Ala Leu Ala Thr Thr Val 195 200 205 Ala Leu Val His Cys His Lys Arg Gly Ile Ala Phe Thr Pro Ala Asp 210 215 220 Pro Glu Gly Thr Leu Ile Gly Asn Leu Leu Leu Met Met Gly Phe Lys 225 230 235 240 Lys Asp Gly Arg Pro Asp Pro Lys Ile Glu Lys Cys Leu Glu Lys Leu 245 250 255 Trp Ile Leu Tyr Ala Asp His Glu Met Thr Asn Ser Thr Ala Ser Phe 260 265 270 Leu His Ala Ala Ser Thr Leu Thr Asp Pro Ile Ser Cys Leu Ile Ala 275 280 285 Gly Val Val Ser Gly Tyr Gly Pro Leu His Gly Gly Ala Ile Asp Leu 290 295 300 Ala Tyr Lys Gly Phe Glu Glu Val Gly Thr Pro Glu Arg Val Pro Glu 305 310 315 320 Leu Ile Ala Asp Val Lys Ala Lys Lys Gln Arg Leu Phe Gly Tyr Gly 325 330 335 His Arg Val Tyr Lys Thr Val Asp Pro Arg Thr Arg Tyr Ile Arg Asp 340 345 350 Met Met Asp Asp His Trp Ala Glu Met Ser Ala Asn Pro Leu Leu Arg 355 360 365 Val Ala Leu Glu Ile Asp Arg Val Ala Gly Gln Asp Pro Tyr Phe Thr 370 375 380 Ser Arg Asn Leu Lys Val Asn Ala Asp Leu Tyr Gly Cys Phe Leu Tyr 385 390 395 400 Thr Ala Phe Gly Phe Asp Thr Asp Ile Ile Thr Ala Val Ala Ala Val 405 410 415 Ser Arg Ile Ala Gly Val Leu Ala His Trp Arg Glu Ala Met His Gln 420 425 430 Gln Pro Met Leu Trp Arg Pro Met Gln Val Phe Thr Gly Ser Met Ala 435 440 445 Gln Ala 450 72447PRTAspergillus oryzae 72Met Thr Val Thr Gln Glu Ala Ser Pro Lys Arg Glu Ser Leu His Ile 1 5 10 15 Ile Asp Asp Arg Thr Gly Ser Tyr Tyr Ser Ile Pro Ile Val Asn Asn 20 25 30 Ala Ile Asn Ala Ser Asp Phe Lys Lys Val Thr Ala Pro Glu Asp Lys 35 40 45 Ala Tyr Pro Ala Asn Gln Thr Glu Asn Gly Leu Arg Val Tyr Asp Pro 50 55 60 Gly Tyr Ser Asn Thr Ala Val Ser His Ser Lys Ile Thr Tyr Ile Asp 65 70 75 80 Gly Leu Lys Gly Thr Ile Gln Tyr Arg Gly Tyr Ser Ile Asn Asp Ile 85 90 95 Val Gly Arg Lys Thr Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly 100 105 110 His Trp Pro Ser Thr Ala Glu Ala Glu Thr Leu Gln Gln Arg Leu Asp 115 120 125 Gln Val Pro Val Pro Gln Asp Phe Val Phe Asn Val Ile Lys Ser Phe 130 135 140 Pro Arg Asp Gly Ser Leu Met Gly Met Val Ile Ala Gly Leu Ser Ala 145 150 155 160 Leu Gln Ser Ser Asp Met Asn Ala Ile Pro Ala His Val Gly Lys Thr 165 170 175 Ile Tyr Leu Asn Asn Pro Glu Leu Ala Asp Gln Gln Ile Ile Arg Val 180 185 190 Met Ala Asn Met Ser Met Leu Thr Ala Ala Ala Tyr Cys His His Ile 195 200 205 Gly Arg Asp Phe Thr Pro Pro Arg Ala Gly Leu Ser Tyr Ile Glu Asn 210 215 220 Phe Leu Leu Met Thr Gly His Val Glu Ala Ala Thr Gly Leu Pro Asn 225 230 235 240 Pro Arg Tyr Val Asn Ala Ile Glu Arg Leu Trp Val Leu Ile Ala Asp 245 250 255 His Glu Met Thr Cys Ser Thr Ala Ala Leu Leu Gln Thr Ala Ser Ala 260 265 270 Leu Pro Asp Val Ile Ser Cys Met Val Ser Ala Ile Ser Ala Leu Tyr 275 280 285 Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Ile Glu 290 295 300 Ser Ile Gly Ser Ile Ser Asn Val Pro Ala Lys Ile Ala Arg Val Lys 305 310 315 320 Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Val Tyr Arg Val 325 330 335 Thr Asp Pro Arg Phe Val Phe Ile Arg Glu Ile Leu Asn Glu Leu Ser 340 345 350 Glu Glu Val Glu Lys Asp Pro Leu Leu Lys Val Ala Phe Glu Val Asp 355 360 365 Arg Val Ala Ser Glu Asp Glu Tyr Phe Thr Ser Arg Asn Leu Arg Pro 370 375 380 Asn Ala Asp Leu Phe Ala Ala Phe Val Tyr Lys Ala Leu Gly Phe Pro 385 390 395 400 Pro Glu Phe Ile Leu Pro Leu Ser Ile Leu Ser Arg Thr Gln Gly Phe 405 410 415 Met Ala His Trp Arg Glu Ala Met Gly Asn Pro Pro Arg Ile Trp Arg 420 425 430 Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn Lys Ser Met Asp Glu 435 440 445 73447PRTAspergillus oryzae 73Met Thr Val Thr Gln Glu Ala Ser Pro Lys Arg Glu Ser Leu His Ile 1 5 10 15 Ile Asp Asp Arg Thr Gly Ser Tyr Tyr Ser Ile Pro Ile Val Asn Asn 20 25 30 Ala Ile Asn Ala Ser Asp Phe Lys Lys Val Thr Ala Pro Glu Asp Lys 35 40 45 Ala Tyr Pro Ala Asn Gln Thr Glu Asn Gly Leu Arg Val Tyr Asp Pro 50 55 60 Gly Tyr Ser Asn Thr Ala Val Ser His Ser Lys Ile Thr Tyr Ile Asp 65 70 75 80 Gly Leu Lys Gly Thr Ile Gln Tyr Arg Gly Tyr Ser Ile Asn Asp Ile 85 90 95 Val Gly Arg Lys Thr Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly 100 105 110 His Trp Pro Ser Ala Ala Glu Ala Glu Thr Leu Gln Gln Arg Leu Asp 115 120 125 Gln Val Pro Val Pro Gln Asp Phe Val Phe Asn Val Ile Lys Ser Phe 130 135 140 Pro Arg Asp Gly Ser Leu Met Gly Met Val Ile Ala Gly Leu Ser Ala 145 150 155 160 Leu Gln Ser Ser Asp Met Asn Ala Ile Pro Ala His Val Gly Lys Thr 165 170 175 Ile Tyr Leu Asn Asn Pro Glu Leu Ala Asp Gln Gln Ile Ile Arg Val 180 185 190 Met Ala Asn Met Ser Met Leu Thr Ala Ala Ala Tyr Cys His His Ile 195 200 205 Gly Arg Asp Phe Thr Pro Pro Arg Ala Gly Leu Ser Tyr Ile Glu Asn 210 215 220 Phe Leu Leu Met Thr Gly His Val Glu Ala Ala Thr Gly Leu Pro Asn 225 230 235 240 Pro Arg Tyr Val Asn Ala Ile Glu Arg Leu Trp Val Leu Ile Ala Asp 245 250 255 His Glu Met Thr Cys Ser Thr Ala Ala Leu Leu Gln Thr Ala Ser Ala 260 265 270 Leu Pro Asp Val Ile Ser Cys Met Val Ser Ala Ile Ser Ala Leu Tyr 275 280 285 Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Ile Glu 290 295 300 Ser Ile Gly Ser Ile Ser Asn Val Pro Ala Lys Ile Ala Arg Val Lys 305 310 315 320 Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Val Tyr Arg Val 325 330 335 Thr Asp Pro Arg Phe Val Phe Ile Arg Glu Ile Leu Asn Glu Leu Ser 340 345 350 Glu Glu Val Glu Lys Asp Pro Leu Leu Lys Val Ala Phe Glu Val Asp 355 360 365 Arg Val Ala Ser Glu Asp Glu Tyr Phe Thr Ser Arg Asn Leu Arg Pro 370 375 380 Asn Ala Asp Leu Phe Ala Ala Phe Val Tyr Lys Ala Leu Gly Phe Pro 385 390 395 400 Pro Glu Phe Ile Leu Pro Leu Ser Ile Leu Ser Arg Thr Gln Gly Phe 405 410 415 Met Ala His Trp Arg Glu Ala Met Gly Asn Pro Pro Arg Ile Trp Arg 420 425 430 Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn Lys Ser Met Asp Glu 435 440 445 74458PRTAspergillus kawachii 74Met Pro Asp Ile Ala Pro Asn Val Ala Arg Asn Gly Ser Ala Lys Asn 1 5 10 15 Ala Glu Asn Lys Pro Glu Thr Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Asn Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Arg Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Ile 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Ser 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Gln Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Leu Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Ser Arg Glu Met Ala 450 455 75458PRTZea mays 75Met Pro Asp Ile Ala Pro Asn Val Ala Arg Asn Gly Ser Ser Lys His 1 5 10 15 Ala Glu Thr Lys Pro Glu Thr Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Asn Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50

55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Ile 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Ser 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Gln Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 76458PRTAspergillus niger 76Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Ala Ser Gln Asn 1 5 10 15 Ala Glu Thr Lys Pro Glu Pro Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Val 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Thr 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Lys Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 77495PRTAspergillus niger 77Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Ala Ser Gln Asn 1 5 10 15 Ala Glu Thr Lys Pro Glu Pro Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Val 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Thr 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Lys Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Met Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala Ile Ser Lys Ala Arg Thr 450 455 460 Lys Thr His Ala Ser Arg Gln Thr Thr Trp Ala Arg Arg Arg Asn Val 465 470 475 480 Ser Gly Leu Arg Leu Met Lys Ile Ala Asn Arg Met Ala Asn Gly 485 490 495 78458PRTAspergillus niger 78Met Pro Asp Ile Ala Ser Asn Gly Ala Arg Asn Gly Ala Ser Gln Asn 1 5 10 15 Ala Glu Thr Lys Pro Glu Pro Pro Val Leu His Val Val Asp Ser Arg 20 25 30 Thr Gly Lys Tyr Phe Pro Ile Pro Ile Val Arg Asn Ala Ile Asn Ala 35 40 45 Ser Glu Phe Lys Lys Leu Lys Ser Pro Glu Asp Pro Ala His Pro Glu 50 55 60 Asp Gln Asn Glu Gln Gly Ile Arg Val Phe Asp Pro Gly Tyr Ser Asn 65 70 75 80 Thr Ala Val Ser Glu Ser Gln Val Thr Tyr Ile Asp Gly Leu Lys Gly 85 90 95 Thr Ile Gln Tyr Arg Gly Tyr Asn Ile Glu Asp Ile Val Gly Lys Lys 100 105 110 Lys Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly Glu Trp Pro Thr 115 120 125 Pro Glu Gln Ala Lys Ser Leu Gln Glu Lys Leu Ser Ser Val Pro Val 130 135 140 Leu Asp Glu Ser Val Phe Lys Val Ile Gln Ala Phe Pro Pro Asn Ser 145 150 155 160 Ser Ile Ile Gly Met Met Ile Ala Ala Leu Ser Ala Val Gln Ser Thr 165 170 175 Gln Met Asp Arg Ile Pro Ala His Ala Ala Lys Asn Leu Tyr Leu Gly 180 185 190 Asn Pro Lys Ala Val Asp Asp Glu Ile Val Arg Leu Met Gly Ser Leu 195 200 205 Ser Met Ile Thr Ala Ala Val Tyr Cys His His Thr Gly Arg Glu Phe 210 215 220 Thr Pro Pro Arg Pro Glu Leu Ser Tyr Ile Glu Asn Phe Leu Leu Met 225 230 235 240 Met Gly His Val Glu Ser Ser Thr Gly Leu Pro Asn Pro Gln Tyr Val 245 250 255 Asp Arg Ile Glu Arg Leu Trp Val Leu Ile Ala Asp His Glu Met Thr 260 265 270 Cys Ser Thr Ala Ala Phe Leu Gln Thr Ala Ser Ser Leu Pro Asp Val 275 280 285 Phe Ser Cys Met Ile Ser Ala Leu Ser Ala Leu Tyr Gly Pro Leu His 290 295 300 Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Phe Glu Glu Ile Gly Ser 305 310 315 320 Val Glu Asn Val Ala Ala Lys Ile Glu Arg Val Lys Ala Gly Lys Glu 325 330 335 Arg Leu Tyr Gly Tyr Gly His Arg Ile Tyr Arg Val Thr Asp Pro Arg 340 345 350 Phe Ile Phe Ile Arg Gln Ile Leu Asp Glu Leu Lys Glu Glu Ile Ala 355 360 365 Arg Asn Pro Leu Leu Lys Val Ala Phe Glu Val Asp Arg Val Ala Ser 370 375 380 Glu Asp Glu Tyr Phe Val Thr Arg Lys Leu Arg Pro Asn Ala Asp Leu 385 390 395 400 Phe Ala Ala Leu Val Tyr Ser Ala Met Gly Phe Pro Thr Glu Phe Ile 405 410 415 Leu Pro Leu Ser Leu Leu Ser Arg Thr Gln Gly Phe Leu Ala His Trp 420 425 430 Lys Glu Ala Met Ser Ser Thr Ala Arg Ile Trp Arg Pro Gly Gln Ile 435 440 445 Tyr Thr Gly His Leu Asn Arg Glu Met Ala 450 455 79463PRTTalaromyces marneffei 79Met Ser Pro Ala Ala Ile Ile Ser Ser Asp Asp Ala Ala Lys Ser Val 1 5 10 15 Asp Ala Lys Ala Ser Ala Lys Thr Ile Ser Arg Asn Phe Leu His Val 20 25 30 Ile Asp Glu Arg Thr Gly Gln Tyr Tyr Gln Ile Pro Ile His His Asn 35 40 45 Ala Ile Ser Ala Asn Glu Phe Lys Lys Ile Lys Ala Pro Asp Ser Glu 50 55 60 Tyr Tyr Ala Asp Gln Asn Glu Asn Gly Ile Arg Val Phe Asp Pro Gly 65 70 75 80 Phe Thr Asn Thr Ala Val Val Glu Ser Lys Val Thr Tyr Val Asp Gly 85 90 95 Lys Arg Gly Lys Ile Gln Tyr Arg Gly Tyr Asp Leu Ala Asp Val Val 100 105 110 Ala Asn Asn Lys Lys Phe Ile Asp Thr Ala His Leu Met Val Phe Gly 115 120 125 Phe Trp Pro Thr Ala Glu Glu Gly Ala Gly Phe Gln Gln Lys Leu Phe 130 135 140 Asp Ala Met His Ile Glu Gln Cys Val Ile Asp Thr Ile His Ala Phe 145 150 155 160 Pro Arg Thr Ala Ser Thr Thr Leu Met Leu Thr Ala Gly Leu Ala Ala 165 170 175 Val Gln Ala Thr Gln Met Asp Arg Ile Pro Ala His Met Ala Lys Asn 180 185 190 Leu Tyr Leu Gly Asn Pro Thr Leu Val Asp Glu Gln Ile Val Arg Leu 195 200 205 Met Gly Val Leu Pro Ile Val Ser Ala Val Ala Tyr Cys His His Thr 210 215 220 Gly Arg Glu Phe Lys Ser Pro Arg Ser Asp Leu Thr Tyr Ile Glu Asn 225 230 235 240 Phe Leu Tyr Met Cys Gly His Val Gln Glu Glu Thr Gly Leu Pro Asn 245 250 255 Pro Arg Tyr Val Gln Asn Phe Glu Arg Leu Trp Ser Leu Val Ala Asp 260 265 270 His Glu Met Thr Cys Ser Thr Ala Ala Val Leu Leu Thr Ala Ser Ser 275 280 285 Leu Pro Asp Pro Ile Ser Cys Ile Ile Ser Gly Ile Gly Ala Ser Tyr 290 295 300 Gly Pro Leu His Gly Gly Ala Ile Glu Phe Ala Tyr Lys Asp Met Ala 305 310 315 320 Asp Ile Gly Ser Val Asp Asn Cys Gln Thr Lys Ile Asp Arg Val Lys 325 330 335 Ser Gly Lys Glu Arg Leu Phe Gly Tyr Gly His Arg Val Tyr Lys Val 340 345 350 Thr Asp Pro Arg Ser Glu His Ile Gln Ala Val Leu Glu Thr Leu Lys 355 360 365 Glu Glu Ile Asp Asn Asp Pro Leu Leu Lys Val Ala Phe Glu Leu Asn 370 375 380 Arg Ile Ala Gln Glu Asp Glu Tyr Phe Val Ser Arg Gly Leu Lys Pro 385 390 395 400 Asn Ala Asp Leu Phe Ala Ala Phe Thr Tyr Gly Ala Met Gly Phe Pro 405 410 415 Pro Asp Phe Ile Leu Thr Ile Ser Thr Ile Ser Arg Thr Gln Gly Leu 420 425 430 Met Ala His Trp Lys Glu Ala Met Ser Gly Lys Pro Leu Ile Trp Arg 435 440 445 Pro Thr Gln Val Tyr Thr Gly Lys Leu Asp Leu Lys Met Glu Val 450 455 460 80466PRTAspergillus flavus 80Met Thr Val Thr Gln Glu Ala Ser Pro Lys Arg Glu Ser Leu His Ile 1 5 10

15 Ile Asp Asp Arg Thr Gly Ser Tyr Tyr Ser Ile Pro Ile Val Asn Asn 20 25 30 Ala Ile Asn Ala Ser Asp Phe Lys Lys Val Thr Ala Pro Glu Asp Lys 35 40 45 Ala Tyr Pro Ala Asn Gln Thr Glu Asn Gly Leu Arg Val Tyr Asp Pro 50 55 60 Gly Tyr Ser Asn Thr Ala Val Ser His Ser Lys Ile Thr Tyr Ile Asp 65 70 75 80 Gly Leu Lys Gly Thr Ile Gln Tyr Arg Gly Tyr Ser Ile Asn Asp Ile 85 90 95 Val Gly Arg Lys Thr Phe Ile Asp Thr Ala His Leu Leu Ile Trp Gly 100 105 110 His Trp Pro Ser Thr Ala Glu Ala Glu Thr Leu Gln Gln Arg Leu Asp 115 120 125 Gln Val Pro Val Pro Gln Asp Phe Val Phe Asn Val Ile Lys Ser Phe 130 135 140 Pro Arg Asp Gly Ser Leu Met Gly Met Val Ile Ala Gly Leu Ser Ala 145 150 155 160 Leu Gln Ser Ser Asp Met Asn Ala Ile Pro Ala His Val Gly Lys Thr 165 170 175 Ile Tyr Leu Asn Asn Pro Glu Leu Ala Asp Gln Gln Ile Ile Arg Val 180 185 190 Met Ala Asn Met Ser Met Leu Thr Ala Ala Ala Tyr Cys His His Ile 195 200 205 Gly Arg Asp Phe Thr Pro Pro Arg Ala Gly Leu Ser Tyr Ile Glu Asn 210 215 220 Phe Leu Leu Met Thr Gly His Val Glu Ala Ala Thr Gly Leu Pro Asn 225 230 235 240 Pro Arg Tyr Val Asn Ala Ile Glu Arg Leu Trp Val Leu Ile Ala Asp 245 250 255 His Glu Met Thr Cys Ser Thr Ala Ala Leu Leu Gln Thr Ala Ser Ala 260 265 270 Leu Pro Asp Val Ile Ser Cys Met Val Ser Ala Ile Ser Ala Leu Tyr 275 280 285 Gly Pro Leu His Gly Gly Ala Ile Glu Val Ala Tyr Lys Asn Ile Glu 290 295 300 Ser Ile Gly Ser Ile Ser Asn Val Pro Ala Lys Ile Ala Arg Val Lys 305 310 315 320 Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly His Arg Val Tyr Arg Val 325 330 335 Thr Asp Pro Arg Phe Val Phe Ile Arg Glu Ile Leu Asn Glu Leu Ser 340 345 350 Glu Glu Val Glu Lys Asp Pro Leu Leu Lys Val Ala Phe Glu Val Asp 355 360 365 Arg Val Ala Ser Glu Asp Glu Tyr Phe Thr Ser Arg Asn Leu Arg Pro 370 375 380 Asn Ala Asp Leu Phe Ala Ala Phe Val Tyr Lys Ala Leu Gly Phe Pro 385 390 395 400 Pro Glu Phe Ile Leu Pro Leu Ser Ile Leu Ser Arg Thr Gln Gly Phe 405 410 415 Met Ala His Trp Arg Glu Ala Met Gly Met Pro Glu Ser Thr Leu Asn 420 425 430 Ser Ser Arg Ser Ile Cys Pro Asp Thr Asn Ile Gly Asn Pro Pro Arg 435 440 445 Ile Trp Arg Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn Lys Ser Met 450 455 460 Asp Glu 465 81467PRTEutypa lata 81Met Gly Gly Ser Trp Thr Gln Met Leu Ser Pro Thr Phe Leu Val His 1 5 10 15 Met Val Ala Lys Leu Leu Gly Gln Thr Gln Met Gly Glu Ala Asp Gly 20 25 30 Ser Leu Thr Ile Thr Asp Asn Arg Thr Gly Arg Gln Tyr Thr Ile Pro 35 40 45 Ile Asn Arg Asn Thr Val Lys Ala Thr Asp Phe Arg Arg Ile Thr Ala 50 55 60 Ala Gly Leu Gly Ala Asp Pro Ala Glu Met Val Glu Ser Gly Leu Lys 65 70 75 80 Val Phe Asp Arg Gly Tyr Leu Asn Thr Ala Cys Met Glu Ser Asn Ile 85 90 95 Thr Phe Ile Asp Gly Lys Arg Gly Tyr Ile Gln Tyr Arg Asp Tyr Ser 100 105 110 Ile Asp His Leu Phe Arg Asn Asn Asp Phe Glu Glu Val Ala His Leu 115 120 125 Val Met Phe Gly Lys Leu Pro Ser Pro Ser Glu Lys Met Thr Phe Arg 130 135 140 Arg Ala Leu Ala Lys Gly Met Glu Ala Pro Gln Asn Val Ile Asn Val 145 150 155 160 Ile Arg Ala Phe Pro Lys Asp Ser Leu Thr Phe Pro Met Ile Leu Ala 165 170 175 Gly Leu Ser Ala Tyr Ala Gly Val Asp Pro Gly Thr Glu Lys Thr His 180 185 190 His Glu Gly Arg Ala Tyr Tyr Leu Gly Asn Met Lys Glu Val Asp Ala 195 200 205 Ala Ile Ile Arg Thr Leu Ser Ala Leu Ala Thr Val Ile Ala Ile Thr 210 215 220 Tyr Cys His Lys Arg Gly Arg Glu Phe Thr Pro Ala Asp Pro Asn Gly 225 230 235 240 Ser Phe Val Ala Asn Thr Leu Leu Met Met Gly Phe Thr Lys Asp Gly 245 250 255 Lys Ala Asp Pro Glu Val Glu Ala Cys Phe Glu Arg Leu Trp Ile Leu 260 265 270 Tyr Ala Asp His Glu Met Thr Asn Ser Thr Ala Ala Val Leu His Ala 275 280 285 Ala Ser Thr Leu Thr Asp Pro Ile Ser Ser Leu Val Ser Gly Ile Val 290 295 300 Ser Ala Tyr Gly Pro Leu His Gly Gly Ala Ile Asp Leu Ala Tyr Lys 305 310 315 320 Gly Phe Glu Glu Val Gly Thr Val Asp Asn Val Ser Gln Leu Ile Thr 325 330 335 Asp Val Lys Gly Lys Lys Gln Arg Leu Phe Gly Tyr Gly His Arg Ile 340 345 350 Tyr Lys Thr Val Asp Pro Arg Ser Lys Phe Ile Arg Glu Met Ile Ala 355 360 365 Glu Lys Gln Glu Leu Val Asp Ser Asn Pro Leu Leu Arg Ile Ala Phe 370 375 380 Glu Ile Asp Arg Ile Ala Asn Glu Asp Pro Tyr Phe Thr Ser Arg Asn 385 390 395 400 Leu Lys Ala Asn Ala Asp Leu Tyr Gly Cys Phe Leu Tyr Thr Ala Leu 405 410 415 Gly Phe Glu Thr Asp Ile Ile Ile Ala Met Ala Cys Leu Ser Arg Thr 420 425 430 Pro Gly Ala Met Ala His Trp Arg Glu Ser Met Gln Gln Gly Pro Met 435 440 445 Leu Trp Arg Pro Leu Gln Val Phe Thr Gly Asn Val Thr Ala Pro Ser 450 455 460 Ala Arg Ser 465 82467PRTEutypa lata 82Met Ala Thr Ala Ala Pro Thr Ala Thr Lys Ser Thr Ala Ala Asn Asn 1 5 10 15 Pro Met Thr Ser Ser Gln Ser Glu Ile Asn Val Ala Val Glu Lys Arg 20 25 30 Asp Val Leu His Ala Val Asp Gly Arg Thr Gly Leu Tyr Tyr Ser Ile 35 40 45 Pro Ile Asn Lys Asn Ala Val Asn Ala Gly Asp Phe Lys Lys Ile Lys 50 55 60 Ser Pro Ala Asp Arg Lys His Pro Ala Tyr Gln Asn Glu Leu Gly Leu 65 70 75 80 Arg Ile Tyr Asp Pro Gly Phe Ser Asn Thr Thr Val Ser Glu Ser Lys 85 90 95 Ile Thr Tyr Ile Asp Gly Ile Glu Gly Thr Ile Gln Tyr Arg Gly Tyr 100 105 110 Ser Ile His Asp Ile Phe Gly Lys Lys Gly Trp Ile Asp Val Ser His 115 120 125 Leu Leu Ile Trp Gly Asn Trp Pro Ser Ser Ala Glu Ala Lys Glu Tyr 130 135 140 Gln Glu Arg Leu Asn Gly Val Pro Leu Leu Asp Gln His Val Leu Asp 145 150 155 160 Val Ile His Ser Phe Pro Lys Asp Gly Val Ile Thr Gly Met Met Ile 165 170 175 Ala Gly Leu Ser Ala Leu Gln Ser Cys Asn Leu Asp Ala Val Pro Ala 180 185 190 Tyr Val Gly Asp Asn Leu Tyr Val Gly His Pro Asp Arg Val Asp Lys 195 200 205 Gln Ile Ile His Leu Leu Gln Ser Phe Ala Met Ile Thr Ala Ala Cys 210 215 220 Tyr Cys His Ser Thr Ser Arg Glu Phe Thr Gln Pro Arg Gln Asp Phe 225 230 235 240 Ser Tyr Val Glu Asn Phe Leu Leu Met Val Gly His Val Asp Ala Thr 245 250 255 Thr Gly Leu Pro Ser Pro Arg His Val Asp Ala Leu Glu Arg Leu Trp 260 265 270 Gly Val Val Ala Asp His Glu Met Thr Cys Ser Thr Ala Ala Phe Leu 275 280 285 His Thr Ala Ser Ser Leu Pro Asp Ile Ile Ser Cys Phe Ile Thr Ala 290 295 300 Ile Cys Ala Ala Thr Gly Pro Leu His Gly Gly Ala Ile Ser Val Ala 305 310 315 320 His Lys His Ile Lys Ala Ile Gly Thr Val Ala Asn Val Pro Ala Lys 325 330 335 Ile Glu Arg Val Lys Ser Gly Lys Glu Leu Leu Tyr Gly Tyr Gly His 340 345 350 Arg Val Tyr Arg Thr Thr Asp Pro Arg Tyr Thr Tyr Ile Asn Gln Val 355 360 365 Leu Asp Gly Leu Thr Glu Glu Val Ala Arg Asp Pro Leu Leu Gln Val 370 375 380 Ala Leu Ala Leu Asp Lys Ala Ala Ser Glu Asp Glu Tyr Phe Thr Ser 385 390 395 400 Arg Lys Leu Phe Pro Asn Ala Asp Leu Phe Ala Ala Phe Ala Tyr Gln 405 410 415 Ala Leu Gly Phe Pro Pro Asp Phe Val Leu Pro Met Ser Cys Leu Ser 420 425 430 Arg Leu Gln Gly Phe Ala Ala His Trp Lys Glu Gly Leu Gln Gly Lys 435 440 445 Pro Lys Ile Trp Arg Pro Gly Gln Ile Tyr Thr Gly Asp Leu Glu Lys 450 455 460 Thr Met Gly 465 83452PRTNeofusicoccum parvum 83Met Ala Thr Thr Thr Ile Thr Ala Pro Ala Asn Gly Arg Val Ser Lys 1 5 10 15 Asp Ser Leu Thr Val Thr Asp Asn Arg Thr Gly Ser Thr Phe Thr Phe 20 25 30 Pro Ile Thr His Asn Ala Val Asn Ala Ser Asn Phe Lys Gln Ile Lys 35 40 45 Ala Pro Glu Asp Pro Asp Asn Ile Ala Asp Gln Asn Glu Gln Gly Leu 50 55 60 Arg Val Phe Asp Pro Gly Phe Gly Asn Thr Cys Val Ser Glu Ser Lys 65 70 75 80 Ile Thr Phe Ile Asp Gly Leu Lys Gly Ile Ile Gln Tyr Arg Gly Tyr 85 90 95 Asp Ile Gly Asp Leu Ile Glu Ala Lys Lys Gly Phe Val Asp Thr Ala 100 105 110 His Leu Leu Trp Phe Gly Thr Leu Pro Ser Pro Lys Glu Lys Gln Glu 115 120 125 Leu Gln Asp Arg Leu Asn Ala Val Pro Leu Ile Asp Asp His Val Phe 130 135 140 Asn Thr Ile Arg Ser Phe Pro Lys Asn Gly Ser Pro Phe Gly Met Ile 145 150 155 160 Ile Ala Gly Leu Met Ala Leu Gln Ser Ser Glu Met Asp Leu Ile Pro 165 170 175 Ala His Ala Ala Lys Asn Ile Tyr Leu Gly Asn Leu Ser Leu Val Asp 180 185 190 Ser Gln Leu Ile Arg Val Met Gln Ser Leu Ser Gln Ile Cys Ala Val 195 200 205 Ala Tyr Cys His Gln Thr Gly Arg Thr Phe Thr Pro Pro Arg Ala Asp 210 215 220 Leu Thr Phe Ile Glu Asn Phe Leu Leu Met Met Gly His Thr Glu Ala 225 230 235 240 Ala Thr Gly Leu Pro Asn Pro Ala Tyr Val Ala Lys Phe Glu Arg Leu 245 250 255 Trp Leu Leu Ile Ala Asp His Glu Met Thr Cys Ser Thr Ala Ala Met 260 265 270 Leu Gln Thr Ala Ser Ala Met Pro Asp Ala Leu Ser Cys Leu Ala Ser 275 280 285 Ala Thr Ser Ala Leu Tyr Gly Pro Leu His Gly Gly Ala Ile Glu Val 290 295 300 Ala Tyr Lys Asn Ile Ala Glu Ile Gly Ser Val Asp Asn Ile Pro Pro 305 310 315 320 Lys Ile Ala Arg Val Lys Ala Gly Lys Glu Arg Leu Tyr Gly Tyr Gly 325 330 335 His Arg Val Tyr Arg Val Pro Asp Pro Arg Tyr Arg His Ile Lys Glu 340 345 350 Val Leu Glu Asp Leu Thr Ala Glu Ile Glu Asp Asp Pro Leu Leu Lys 355 360 365 Val Ala Phe Glu Leu Asp Arg Val Ala Arg Thr Asp Glu Tyr Phe Thr 370 375 380 Ser Arg Lys Leu Asn Pro Asn Ala Asp Leu Phe Ala Ala Leu Ala Tyr 385 390 395 400 Asn Ala Met Gly Phe Glu Pro Glu Trp Ile Leu Pro Ile Ser Leu Met 405 410 415 Ser Arg Ser Gln Gly Leu Leu Ala His Trp Lys Glu Ala Met Ser Gly 420 425 430 Ser Ala Arg Ile Trp Arg Pro Gly Gln Ile Tyr Thr Gly Asp Leu Asn 435 440 445 Lys Lys Ile Glu 450 84472PRTAspergillus niger 84Met Ala Tyr Thr Leu Ala Ser Trp Leu Gly Arg Leu Phe Asp Ala Gly 1 5 10 15 Lys Ser Leu Leu Pro Leu Gln Gly Asn Tyr Ile Asn Ala Leu Leu Glu 20 25 30 Gln Glu Leu Pro Gly Glu Arg Glu Gly Thr Leu Thr Val Arg Asp Asn 35 40 45 Arg Thr Gly Ser Lys Tyr Thr Ile Pro Ile Val Arg Asn Ser Val Pro 50 55 60 Ala Met Gly Phe Arg Gln Ile Cys Val Asp Arg Ala Gly Lys Ser Pro 65 70 75 80 Arg Gln Gln Phe Glu Asp Gly Leu Arg Leu Ile Asp Pro Gly Tyr Arg 85 90 95 Asn Thr Ala Val Lys Met Ser Ser Ile Thr Tyr Ile Asn Gly Asn Glu 100 105 110 Gly Val Ile Leu Tyr Arg Gly His Pro Leu Ala Ser Leu Ile Gly Lys 115 120 125 Ser Tyr Glu Glu Ile Thr His Leu Leu Ile Trp Gly Ser Leu Pro Thr 130 135 140 Pro Glu Gln Arg Leu Arg Phe Gln Arg Arg Ile Ala Glu Ala Met Met 145 150 155 160 Val Val Pro Glu Asn Val Lys Gln Leu Val Ala Thr Phe Pro Arg Asn 165 170 175 Thr Pro Pro Met Val Ile Leu Cys Ala Val Leu Thr Gly Tyr Leu Ala 180 185 190 Asp Gln Pro Glu Leu Ile Pro Ala His Ala Gly Ala Asn Leu Tyr Asn 195 200 205 Arg Arg Pro Glu Met Val Asp Glu Gln Ile Ile Arg Thr Leu Ala Val 210 215 220 Thr Ala Ile Ala Gly Ser Ile Ala His Cys His Met Lys Gly Glu Glu 225 230 235 240 Leu Arg Met Ala Asp Pro Asn Leu Ser Tyr Ile Glu Asn Ile Leu Trp 245 250 255 Met Gly Arg Tyr Val Asp Asn Asn Pro Ala Val Thr Arg Glu Lys Ala 260 265 270 Ala Glu Ile Leu Thr Lys Ala Trp Ser Leu Tyr Ala Asp His Glu Met 275 280 285 Thr Asn Ser Thr Ser Ala Phe Leu His Val Ser Ser Ser Leu Ala Asp 290 295 300 Pro Leu Ser Ala Met Ala Ala Cys Cys Met Ser Gly Tyr Gly Leu Leu 305 310 315 320 His Gly Gly Ala Ile Asp Ala Ala Tyr Arg Gly Met Arg Glu Ile Gly 325 330 335 Gly Pro Gln Asn Val Pro Lys Leu Ile Glu Lys Val Ile Asn Lys Glu 340 345 350 Cys Arg Leu Ser Gly Tyr Gly His Arg Ile Tyr Lys Gln Val Asp Pro 355 360 365 Arg Ala Lys Tyr Val Arg Glu Met Leu Asp Glu Leu Thr Arg Asp Arg 370 375 380 Asp Ile Arg Glu Met Asp Pro Val Leu Gln Val Ala Met Glu Ile Asp 385 390 395 400 Arg Ile Ala Ser Thr His Glu Tyr Phe Val Lys Arg Asn Leu Gln Ala 405 410 415 Asn Ala Asp Leu Tyr Gly Ser Phe Val Tyr Thr Ala Leu Gly Ile Asp 420 425 430 Ser Gln Phe Ala Thr Val Leu Ala Ala Thr Ala Arg Val Ser Gly Val 435 440 445 Met Ala His Trp Lys Glu Gln Thr Glu Arg Ala Pro Asp Leu Trp Arg 450

455 460 Pro Leu Gln Val Tyr Val Pro Asn 465 470 85472PRTAspergillus kawachii 85Met Ala Tyr Thr Leu Ala Ser Trp Leu Gly Arg Leu Phe Asp Ala Gly 1 5 10 15 Lys Ser Leu Leu Pro Leu Gln Gly Asn Tyr Ile Asn Ala Leu Leu Glu 20 25 30 Gln Glu Leu Pro Gly Glu Arg Glu Gly Thr Leu Thr Val Arg Asp Asn 35 40 45 Arg Thr Gly Ser Lys Tyr Thr Ile Pro Ile Val Arg Asn Ser Val Pro 50 55 60 Ala Met Gly Phe Arg Gln Ile Cys Val Asp Arg Ala Gly Lys Ser Pro 65 70 75 80 Arg Gln Gln Phe Glu Asp Gly Leu Arg Leu Ile Asp Pro Gly Tyr Arg 85 90 95 Asn Thr Ala Val Lys Met Ser Ser Ile Thr Tyr Ile Asn Gly Asn Glu 100 105 110 Gly Val Ile Leu Tyr Arg Gly His Pro Leu Ala Ser Leu Ile Gly Lys 115 120 125 Ser Tyr Glu Glu Ile Thr His Leu Leu Ile Trp Gly Ser Leu Pro Thr 130 135 140 Pro Glu Glu Arg Leu Arg Phe Gln Arg Arg Ile Ala Glu Ala Met Met 145 150 155 160 Val Val Pro Glu Asn Val Lys Gln Leu Val Ala Thr Phe Pro Arg Asn 165 170 175 Thr Pro Pro Met Val Ile Leu Cys Ala Val Leu Thr Gly Tyr Leu Ala 180 185 190 Asp Gln Pro Glu Leu Ile Pro Ala His Ala Gly Ala Asn Leu Tyr Asn 195 200 205 Arg Arg Pro Glu Met Val Asp Glu Gln Ile Ile Arg Thr Leu Ala Val 210 215 220 Thr Ala Ile Ala Gly Ser Ile Ala His Cys His Met Lys Gly Glu Glu 225 230 235 240 Leu Arg Ala Ala Asp Pro Asn Leu Ser Tyr Ile Glu Asn Ile Leu Trp 245 250 255 Met Gly Arg Tyr Val Asp Asn Asn Ala Ala Ile Thr Arg Glu Lys Ala 260 265 270 Ala Glu Ile Leu Thr Lys Ala Trp Ser Leu Tyr Ala Asp His Glu Met 275 280 285 Thr Asn Ser Thr Ser Ala Phe Leu His Val Ser Ser Ser Leu Ala Asp 290 295 300 Pro Leu Ser Ala Met Ala Ala Cys Cys Met Ser Gly Tyr Gly Leu Leu 305 310 315 320 His Gly Gly Ala Ile Asp Ala Ala Tyr Arg Gly Met Arg Glu Ile Gly 325 330 335 Gly Pro Glu Asn Val Pro Lys Leu Ile Glu Lys Val Ile Asn Lys Glu 340 345 350 Cys Arg Leu Ser Gly Tyr Gly His Arg Ile Tyr Lys Gln Val Asp Pro 355 360 365 Arg Ala Lys Tyr Val Arg Glu Met Leu Asp Glu Leu Thr Arg Asp Arg 370 375 380 Asp Ile Arg Glu Met Asp Pro Val Leu Gln Val Ala Met Glu Ile Asp 385 390 395 400 Arg Ile Ala Ser Thr His Glu Tyr Phe Val Lys Arg Asn Leu Gln Ala 405 410 415 Asn Ala Asp Leu Tyr Gly Ser Phe Val Tyr Thr Ala Leu Gly Ile Asp 420 425 430 Ser Gln Phe Ala Thr Val Leu Ala Ala Thr Ala Arg Val Ser Gly Val 435 440 445 Met Ala His Trp Lys Glu Gln Thr Glu Arg Ala Pro Asp Leu Trp Arg 450 455 460 Pro Leu Gln Val Tyr Val Pro Asn 465 470 86152PRTAspergillus niger 86Met Pro His Met Asp Gly Leu Ser His Lys Leu Thr Glu Ala Met Leu 1 5 10 15 Ala Val Pro Asp Asp Val Gln Arg Thr Val Trp Thr His Pro Ile Cys 20 25 30 Gln Glu Asn Phe Glu Arg Ser Trp Lys Ser Gly Asn Ile Pro Gly Tyr 35 40 45 Ser Gln Arg Val Lys Gln Gly Arg Val Lys Val Phe Glu Tyr Gly His 50 55 60 Arg Ser Tyr Lys Gly Ile Asn Pro Arg Val Pro Pro Ile Gln Ser Ile 65 70 75 80 Leu Lys Asn Leu Asp Leu Ser Ala Asp Asn Pro Leu Lys Leu Ala Glu 85 90 95 Arg Leu Glu Arg Val Cys Pro Thr Asp Ala Tyr Phe Lys Glu Gln Gly 100 105 110 Leu Tyr Val Asn Asp Ala Asp Thr Ser Asn Gly Phe Tyr Pro Lys Ile 115 120 125 Ile Ser Met Ala Met Leu Ala Gln Arg Ile Met Gly Ile Met Thr His 130 135 140 Trp Arg Glu Tyr Met Cys Lys Gln 145 150

* * * * *

References


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed