U.S. patent application number 15/954441 was filed with the patent office on 2018-08-23 for multiplex quantitative pcr.
The applicant listed for this patent is TELOMERE DIAGNOSTICS, INC.. Invention is credited to Karl Guegler, Calvin Harley, Jue Lin.
Application Number | 20180237843 15/954441 |
Document ID | / |
Family ID | 56163505 |
Filed Date | 2018-08-23 |
United States Patent
Application |
20180237843 |
Kind Code |
A1 |
Harley; Calvin ; et
al. |
August 23, 2018 |
MULTIPLEX QUANTITATIVE PCR
Abstract
Disclosed are methods and compositions for determining the
average length or abundance of a first target nucleic by
calculating the abundance of a first target nucleic acid (T)
relative to the average abundance (S) of a second and a third
target nucleic acid, in a single well using a separate detection
label for each target nucleic acid. In various aspects, the first
target nucleic acid is a telomere. In exemplary aspects, the
disclosed methods and compositions can be used to determine the
average telomere length in a biological sample. The average
telomere length determined using the disclosed methods and
compositions can be correlated to a variety of clinically important
conditions and indices. This abstract is intended as a scanning
tool for purposes of searching in the particular art and is not
intended to be limiting of the present invention.
Inventors: |
Harley; Calvin; (Murphys,
CA) ; Lin; Jue; (Foster City, CA) ; Guegler;
Karl; (Menlo Park, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
TELOMERE DIAGNOSTICS, INC. |
MENLO PARK |
CA |
US |
|
|
Family ID: |
56163505 |
Appl. No.: |
15/954441 |
Filed: |
April 16, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14746437 |
Jun 22, 2015 |
9944978 |
|
|
15954441 |
|
|
|
|
62163434 |
May 19, 2015 |
|
|
|
62098057 |
Dec 30, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 35/00 20180101;
A61P 9/00 20180101; A61K 2035/124 20130101; A61K 31/40 20130101;
C12Q 1/6851 20130101; A61P 43/00 20180101; C12Q 1/686 20130101;
A61P 7/00 20180101; C12Q 1/6883 20130101; A61K 35/28 20130101; C12Q
1/686 20130101; C12Q 2525/151 20130101; C12Q 2525/161 20130101;
C12Q 2525/186 20130101; C12Q 2525/197 20130101; C12Q 2525/204
20130101; C12Q 2537/16 20130101; C12Q 2545/113 20130101; C12Q
2563/107 20130101; C12Q 2565/102 20130101 |
International
Class: |
C12Q 1/6851 20180101
C12Q001/6851; A61K 31/40 20060101 A61K031/40; C12Q 1/686 20180101
C12Q001/686; A61K 35/28 20150101 A61K035/28 |
Claims
1. A method for determining average telomere length or abundance,
comprising: (a) contacting a first target nucleic acid with a first
primer set, a second target nucleic acid with a second primer set,
and a third target nucleic acid target with a third primer set; i)
wherein the first primer set comprises a first forward primer and a
first reverse primer; ii) wherein the second primer set comprises a
second forward primer and a second reverse primer; iii) wherein the
third primer set comprises a third forward primer and a third
reverse primer, and iv) wherein the first target nucleic acid
comprises a telomere repeat sequence; (b) amplifying by polymerase
chain reaction the first target nucleic acid with the first primer
set to form a first amplicon, the second target nucleic acid with
the second primer set to form a second amplicon, and the third
target nucleic acid with the third primer set to form a third
amplicon; (c) determining during the polymerase chain reaction the
amount of the first, second, and third amplicons: i) wherein the
first amplicon is detected using a first detection label; ii)
wherein the second amplicon is detected using a second detection
label; and iii) wherein the third amplicon is detected using a
third detection label; (d) determining the average length or
abundance of telomeric DNA in the sample.
2. The method of claim 1, wherein each of the first forward primer
and a first reverse primer comprise: (a) a 3' portion that
hybridizes to a telomeric repeat sequence under annealing
conditions; and (b) a 5' portion having an anchor sequence that
does not hybridize to a telomeric repeat sequence.
3. The method of claim 1, wherein the first reverse primer is a
mismatch primer comprising at least one mismatched nucleotide
adjacent to or including the 3' end of the primer; and wherein the
at least one mismatched nucleotide is not complementary to the
target nucleic acid, but is complementary to the 3' terminal
nucleotide of the first forward primer.
4. The method of claim 3, wherein the first forward primer
comprises the sequence of SEQ ID No.: 1; and wherein the first
reverse primer comprises the sequence of SEQ ID No.: 2.
5. The method of claim 1, wherein the first reverse primer is
blocked from priming the first target nucleic acid.
6. The method of claim 5, wherein the first reverse primer is
blocked from priming the first target nucleic acid by a terminal 3'
mismatched base.
7. The method of claim 1, wherein the second target nucleic acid is
within a gene of known copy number.
8. The method of claim 7, wherein the gene of known copy number is
a low copy number gene.
9. The method of claim 7, wherein the second target nucleic acid is
a single copy number gene.
10. The method of claim 1, wherein the second forward primer
comprises SEQ ID NO.: 3; and wherein the second reverse primer
comprises SEQ ID NO.: 4.
11. The method of claim 1, wherein each of the first detection
label, second detection label, and third detection label
independently comprise fluorogenic moieties; and wherein each of
the fluorogenic moieties is detectable separably and
simultaneously.
12. The method of claim 11, wherein the second detection label
further comprises an oligonucleotide comprising the sequence of SEQ
ID NO.; 5.
13. The method of claim 1, wherein the second amplicon is from
about 50 to about 250 bp in length; and wherein the third amplicon
is from about 50 to about 250 bp in length.
14. The method of claim 1, further comprising the step of obtaining
a chromosomal DNA sample prior to contacting the first, second, and
third target nucleic acids with the first, second, and third primer
sets, respectively; and wherein the chromosomal DNA sample
comprises the first, second, and third target nucleic acids.
15. The method of claim 14, wherein the step of obtaining a
chromosomal DNA sample comprises isolating one or more cell type
from a liquid sample obtained a subject; and wherein the cell type
isolated comprise circulating tumor cells, circulating stem cells,
lymphocytes, granulocytes, myeloid cells, neutrophils, monocytes,
macrophages, platelets, and leukocytes.
16. The method of claim 1, wherein the concentration of first,
second, and third amplicon are determined by comparison to a
control reference DNA.
17. The method of claim 1, wherein determining the average length
or abundance of the first amplicon comprises the steps: (a)
determining the concentration of the first, second, and third
amplicon by comparison to a control polymerase chain reaction; (b)
determine the ratio of the concentration of the first amplicon to
the average or weighted concentration of the second and third
amplicons; and (c) converting the ratio from step (b) to base pairs
of telomere sequence per genome.
18. A method for allogeneic transplant hematopoietic stem cell
donor selection, the method comprising: (a) obtaining samples from
one or more HLA-matched potential donor subjects; (b) determining
the average length or abundance of telomeric DNA for each of the
HLA-matched donor subjects by the method of claim 1; (c)
identifying one or more donor subjects with a first amplicon
average length or abundance that in the upper 25.sup.th percentile
for age-matched controls; (d) obtaining a transplantable
hematopoietic stem cell sample from the identified donor subject;
and (e) transplanting the hematopoietic stem cell sample to a
recipient subject.
19. The method of claim 18, wherein the recipient subject has been
diagnosed with a cancer, cardiovascular disease, or with a need for
a bone marrow transplant.
20. A method for reclassification of cardiovascular disease risk,
the method comprising: (a) obtaining a sample a subject, wherein
the subject has been diagnosed to meet 2013 ACC/AHA Guideline on
the Treatment of Blood Cholesterol criteria for low-intensity
statin therapy; (b) determining the average length or abundance of
the first amplicon in the sample for by the method of claim; (c)
diagnosing the subject at higher cardiovascular risk when the
sample has been determined to have with a first amplicon average
length or abundance that in the lower 25.sup.th percentile for
age-matched controls; and (d) administering to the subject
diagnosed at higher cardiovascular risk: i) a modified statin
therapy; and/or ii) a second therapeutic agent known to treat
cardiovascular disease.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This Application claims the benefit of U.S. Provisional
Application Nos. 62/098,057, filed on Dec. 30, 2014, and
62/163,434, filed on May 19, 2015, each of which is incorporated
herein by reference in its entirety.
REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA
EFS-WEB
[0002] The Sequence Listing submitted Jun. 22, 2015 as a text file
named "37502_0004U3_ST25.txt," created on Jun. 22, 2015, and having
a size 5,057 bytes is hereby incorporated by reference pursuant to
37 C.F.R. .sctn. 1.52(e)(5).
BACKGROUND OF THE INVENTION
[0003] The statements in the Background are not necessarily meant
to endorse the characterization in the cited references.
[0004] Telomeres, the tips of eukaryotic chromosomes, protect the
chromosomes from nucleolytic degradation, end-to-end fusion, and
recombination. Telomeres are structures at the ends of chromosomes
characterized by repeats of the nucleotide sequence
(5'-TTAGGG-3').sub.n. Telomeres shorten as a consequence of normal
cell division and critically short telomeres lead to cellular
senescence or apoptosis. A rich body of epidemiological and
clinical studies in humans in the past decade has linked short
telomere length to high risks of aging-related disease and
all-cause mortality (Puterman, E. and E. Epel, Soc Personal Psychol
Compass, 2012. 6(11) 807-825 Zhu, H., M. Belcher, and P. van der
Harst, Clin Sci (Lond), 2011, 120(10) 427-40; and Fyhrquist, F. and
O. Saijonmaa. Ann Med, 2012. 44 Suppl 1 S138-42). Genetic,
environment, lifestyle, and behavioral factors collectively impact
telomere length. Therefore, telomere length has become an index for
overall health, disease, and mortality risk.
[0005] While average telomere length was measured in almost all the
clinical studies published and has demonstrated utility in
stratifying patient disease and mortality risk, recent work in mice
has also shown that the population of short telomeres is the
triggering signal to senescence or apoptosis (Hemann, M. T., et al.
Cell, 2001. 107(1) 67-77), and thus disease and mortality risk. In
a study reported by Hemann et al, 6th generation telomerase RNA
knockout mice (mTR-/-G6) with short telomeres were crossed with
mice heterozygous for telomerase (mTR+/-) with long telomeres. The
phenotype of the telomerase null offspring mirrors that of the
mTR-/- parent despite the fact that half of their telomeres are
long, suggesting that the quantity of short telomeres, and not
average telomere length, is critical for cell viability and
chromosome stability. In people taking a natural product-derived
telomerase activator (TA-65.RTM.), a significant reduction in the
percentage of short (<3 or <4 kbp) telomeres (as measured by
a quantitative FISH technology: see (Canela, A., et al. Proc Natl
Acad Sci USA, 2007, 104(13) 5300-5) was detected in the leukocytes,
although no change in mean telomere length was seen (Harley, C. B.,
et al., Rejuvenation Res. 2011. 14(1) 45-56). Changes in the
percentage of short telomere abundance therefore is expected to be
a more sensitive measurement of the effects of lifestyle and
pharmacological or other interventions on telomeres. Another study
(Vera et al., "The Rate of Increase of Short Telomeres Predicts
Longevity in Mammals", Cell Reports (2012), world wide web URL:
dx.doi.org/10.1016/.celrep.2012.08.023) found that "the rate of
increase in the abundance of short telomeres was a predictor of
lifespan".
[0006] Various methods have been developed for the measurement of
telomere length, including Southern blotting (Kimura, M. et at,
Nature Protocols, 2010, 5:1596-1607), Q-FISH (Rufer, N. et al.,
Nat. Biotechnol., 1998, 16:743-747), flow FISH (Baerlocher, G. M.
et al., Cytometry, 2002, 47:89-99), a higher throughput
modification of the Q-FISH assay (HTQ-FISH; see Canela. A. et al.,
PNAS, 2007, 104: 5300-5305), dual-label centromeres and telomeres
FISH (Cen/Tel FISH) (Vander Griend D. J., et al. Prostate 2009 Oct.
1; 69(14):1557-64. doi: 10.1002/pros.21001), dot blot (Kimura M,
Aviv A. 2011 NAR), and qPCR (Cawthon, R. M., Nucleic. Acids Res.,
2002, 30(10):e47; and Cawthon RM. Nucleic Acids Res. 2009,
37(3):e21).
[0007] q-PCR-telomere length (qPCR-TL) measures the abundance of
average telomeres normalized with a single copy gene, expressed as
T/S ratios. To convert T/S ratios to absolute length in number of
bp, telomere restriction fragment length (TRF) various methods have
been reported. For example, it was previously reported that this
conversion could be determined by Southern blot analysis and
compared to TTS ratios (Cawthon, ibid). A linear regression formula
was obtained and used to calculate the TRF length of an unknown
sample based on its T/S ratio. One critical issue with this
conversion is that TRF contains a region of non-telomeric sequence
at its centromeric end (subtelomeric sequence). Because the length
of subtelomeric sequence varies among individuals, the converted bp
from T/S ratios based on TRF is only an approximation.
[0008] Thus, despite advances in materials and methods for facile
determination of relative telomere length or abundance, there
remains a need for improved methods and materials for determining
differences in telomere length or abundance in subjects compared to
appropriate control populations. In particular, there remains a
need to determine with great accuracy differences in the relative
telomere length or abundance in a subject in order to improve
clinical assessments and/or therapeutic regimens in those same
subjects. These needs and other needs are addressed by the present
invention.
SUMMARY OF THE INVENTION
[0009] In accordance with the purpose(s) of the invention, as
embodied and broadly described herein, the invention, in one
aspect, relates to methods and compositions for determining the
average length or abundance of at least three target nucleic acid
sequences in a single qPCR multiplexed reaction utilizing a
different detection label for each target nucleic acid sequence. In
one aspect, one of the three target nucleic acid sequences is a
telomeric sequence and the other two target nucleic acid sequences
are distinct low copy number genes known to rarely undergo copy
number variations. In a further aspect, the ratio of the average
telomere length or abundance to the average of the average
abundance for the other two nucleic acid sequences, i.e., the T/S
ratio can be used for associating the average telomere length or
abundance with clinical risks or optimized therapeutic regimens. In
a still further aspect, the low copy number genes are single copy
genes.
[0010] Disclosed are methods for determining average telomere
length, comprising: (a) contacting a first target nucleic acid with
a first primer set, a second target nucleic acid with a second
primer set, and a third target nucleic acid target with a third
primer set; (i) wherein the first primer set comprises a first
forward primer and a first reverse primer; (ii) wherein the second
primer set comprises a second forward primer and a second reverse
primer; (iii) wherein the third primer set comprises a third
forward primer and a third reverse primer; and (iv) wherein the
first target nucleic acid comprises a telomere repeat sequence; (b)
selectively amplifying by polymerase chain reaction the first
target nucleic acid with the first primer set to form a first
amplicon, the second target nucleic acid with the second primer set
to form a second amplicon, and the third target nucleic acid with
the third primer set to form a third amplicon; (c) determining
during one or more cycles of the polymerase chain reaction the
amount of the first, second, and third amplicons; (i) wherein the
first amplicon is detected using a first detection label; (ii)
wherein the second amplicon is detected using a second detection
label; and (iii) wherein the third amplicon is detected using a
third detection label; and (d) determining the average length or
abundance of the first amplicon.
[0011] Also disclosed are methods for allogeneic transplant
hematopoietic stem cell donor selection, the method comprising: (a)
obtaining samples from one or more HLA-matched potential donor
subjects; (b) determining the average length or abundance of the
first amplicon for each of the HLA-matched donor subjects by the
disclosed methods; (c) identifying one or more donor subjects with
a first amplicon average length or abundance that is in upper
25.sup.th percentile for age-matched controls; (d) obtaining a
transplantable hematopoietic stem cell sample from the identified
donor subject; and (e) transplanting the hematopoietic stem cell
sample to a recipient subject.
[0012] Also disclosed are methods for reclassification of
cardiovascular disease risk, the method comprising: (a) obtaining a
sample from a subject, wherein the subject has been diagnosed to
meet 2013 ACC/AHA Guideline on the Treatment of Blood Cholesterol
criteria for low-intensity statin therapy; (b) determining average
length or abundance of the of the first amplicon in the sample by
the disclosed methods; (c) diagnosing the subject at higher
cardiovascular risk when the sample has been determined to have a
first amplicon average length or abundance in the lower 25.sup.th
percentile for age-matched controls; and (d) administering to the
subject diagnosed at higher cardiovascular risk: (i) a modified
statin therapy; and/or (ii) a second therapeutic agent known to
treat cardiovascular disease.
[0013] While aspects of the present disclosure can be described and
claimed in a particular statutory class, such as the system
statutory class, this is for convenience only and one of skill in
the art will understand that each aspect of the present disclosure
can be described and claimed in any statutory class. Unless
otherwise expressly stated, it is in no way intended that any
method or aspect set forth herein be construed as requiring that
its steps be performed in a specific order. Accordingly, where a
method claim does not specifically state in the claims or
descriptions that the steps are to be limited to a specific order,
it is no way intended that an order be inferred, in any respect.
This holds for any possible non-express basis for interpretation,
including matters of logic with respect to arrangement of steps or
operational flow, plain meaning derived from grammatical
organization or punctuation, or the number or type of aspects
described in the specification.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The accompanying figures, which are incorporated in and
constitute a part of this specification, illustrate several aspects
and together with the description serve to explain the principles
of the invention.
[0015] FIG. 1A-FIG. 1C show representative schematic schemes for
the amplification of a telomere target sequence. FIG. 1A shows the
first cycle of amplification. Briefly, the TelG-modified primer
("Tel G modified") binds along native telomeres at multiple
telomeric sites, whereas the TelC-modified primer ("Tel C
modified") cannot bind along native telomere sites due to the
mismatch at the terminal 3' end of the Tel C modified primer.
Accordingly, the abundance of the Tel G modified extension products
is proportional to the abundance of C-strand telomeric DNA. FIG. 1B
shows that the Tel G modified and Tel C modified primers cannot
form primer dimers due to the mismatches, particularly at the 3'
end of each primer. Data from no-template controls (NTC) confirm
that these primers do not amplify in the absence of telomeric DNA.
FIG. 1C shows the second cycle of amplification. Briefly, the
multiple extension products synthesized in the first amplification
cycle 1 from the Tel G modified primer provide binding sites for
the Tel C modified primer. The bound Tel C modified primer can be
extended to the 5' end of the extension products from first
amplification cycle that were primed by the Tel G modified primer.
Accordingly, in cycle 3 and thereafter, an 86 bp duplex is
preferentially amplified. The abundance of this amplicon is
designed to be proportional to the abundance of double-stranded
telomeric DNA in the genomic DNA sample.
[0016] FIG. 2A-FIG. 2F show representative melting curve data for
amplification with B2M-F. B2M-R, RNAP-F, RNAP-R. Tel G modified,
and Tel C modified primers with human genomic target DNA (mosaic
male genomic DNA). The concentration of the Tel G modified and Tel
C modified primers were varied as indicated in the figures. The
concentration of the B2M-F and B2M-R primers was held constant at
300 nM, and the B2M-probe was present at a concentration of 100
nM.
[0017] FIG. 3A-FIG. 3C show representative linear regression lines
of crossing point ("Cp") versus the log (concentration) of target
DNA for the human genomic target DNA (mosaic male genomic DNA),
which comprises the target nucleic acid sequences for telomere
sequences, the RNase P gene, and the .beta.2-microglobulin gene.
The Cp was calculated using the second derivative program of the
Roche LC480 Light Cycler instrument. FIG. 3A shows the Cp versus
log (concentration) for the telomere target nucleic acid using the
Tel G modified and Tel C modified primers. FIG. 3B shows the Cp
versus log (concentration) for the RNase P target nucleic acid
using the RNAP-F and RNAP-R primers. FIG. 3C shows the Cp versus
log (concentration) for the .beta.2-microglobulin target nucleic
acid using the B2M-F and B2M-R primers. In the foregoing, the
concentration used in the log (concentration) expression was in
units of ng/.mu.L.
[0018] FIG. 4A-FIG. 4C show representative amplification curves
amplification reactions carried out using human genomic target DNA
(mosaic male genomic DNA). FIG. 4A shows the amplification curve
using the Tel G modified and Tel C modified primers. As shown in
FIG. 4A, telomeric DNA typically amplifies with significant signal
(Fluorescent signals >25 units) in the Cp range of 20-25, while
the NTCs show essentially background noise (fluorescent units below
1, even at 30 cycles or more). This demonstrates the absence of
non-specific amplifications throughout the relevant cycles of qPCR
amplification. FIG. 4B shows the amplification curve using the
RNAP-F and RNAP-R primers. FIG. 4C shows the amplification curve
using the B2M-F and B2M-R primers.
[0019] FIG. 5A-FIG. 5C show representative amplification curves
from amplification reactions carried out using without human
genomic DNA (i.e., a non-template control reaction). FIG. 5A shows
the amplification curve using the Tel G modified and Tel C modified
primers without target genomic DNA. Note that there is essentially
no amplification of any DNA until after cycle 30. FIG. 5B shows the
amplification curve using the RNAP-F and RNAP-R primers. FIG. 5C
shows the amplification curve using the B2M-F and 82M-R
primers.
[0020] FIG. 6A shows a representative histogram of T/S ratios
determined using the disclosed methods with the B2M-F B2M-R,
RNAP-F, RNAP-R, Tel G modified, and Tel C modified primers in
reactions carried out on 163 independent samples from research
subjects. The T/S ratio is determined by dividing the concentration
of the telomeric DNA amplicon from the qPCR reaction, by the
average concentration of the RNase P and .beta.2-microglobulin
amplicons from the qPCR reaction, where all three amplicons are in
a single reaction well. The graph shows a log-normal distribution
of T/S ratios, as expected for distribution of telomere lengths.
FIG. 6B shows a representative graph of T/S ratios versus age using
the disclosed methods with the B2M-F, B2M-R, RNAP-F, RNAP-R, Tel G
modified, and Tel C modified primers in reactions carried out on
163 samples from healthy research participants.
[0021] FIG. 7A shows a representative graph of the inter-assay CV
values versus T/S ratios. The T/S ratios were determined using the
disclosed methods with the 82M-F, B2M-R, RNAP-F, RNAP-R, Tel G
modified, and Tel C modified primers in reactions carried out on
163 samples from healthy research participants. The data show that
the median CV for plate-to-plate variation with the disclosed
triplex qPCR assay is about 1.5%, which is significantly lower than
that for the older versions of the monochrome or monochrome
multiplex assays (typically in the 5% range or higher).
[0022] FIG. 7B shows a representative histogram of the inter-assay
CV versus T:S ratios for the results obtained from the 163 research
subject samples. The data used for determination of the inter-assay
CV were obtained using the disclosed methods with the B2M-F. B2M-R,
RNAP-F, RNAP-R, Tel G modified, and Tel C modified primers. The
data suggest that inter-assay CV is not a function of T:S ratio, in
other words, the inter-assay CV neither increases or decreases with
telomere length.
[0023] FIG. 8A shows the intra-assay CV estimates for T/S ratios
obtained using 9 research subject samples analyzed in triplicate
per day for experimental determination on each of five different
days by three separate operators. The CV was calculated using a
random effects model wherein the "sample run" was the random effect
in the model. The T/S ratios were determined using the disclosed
methods with the B2M-F, B2M-R, RNAP-F, RNAP-R, Tel G modified, and
Tel C modified primers. The intra-assay CV (the coefficient of
variation between technical replicates, i.e. theoretically
identical samples) for the T:S ratio was 2-3%.
[0024] FIG. 8B shows the inter-assay CV estimates for T/S ratios
(i.e. the plate-to-plate variation) obtained using 9 patient
samples analyzed in triplicate per day for experimental
determination on each of five different days by three separate
operators. The CV was calculated using a random effects model
wherein the "sample run" was the random effect in the model. The
T/S ratios were determined using the disclosed methods with the
B2M-F, B2M-R, RNAP-F, RNAP-R, Tel G modified, and Tel C modified
primers. The data show a very low CV (roughly 0-2.5% for sample run
variations on different days using 3 different operators over 5
different days). To our knowledge, this is the lowest inter-plate
CV for ATL ever reported.
[0025] FIG. 8C shows the total CV estimates for T/S ratios obtained
using the same 9 patient samples analyzed in triplicate per day for
experimental determination on each of five different days by three
separate operators. The CV was calculated using a random effects
model wherein the "sample run" was the random effect in the model.
The T/S ratios were determined using the disclosed methods with the
B2M-F, B2M-R, RNAP-F, RNAP-R, Tel G modified, and Tel C modified
primers. The data show that the whole-assay CV is in the 2-4%
range.
[0026] FIG. 9 shows the 8-point standard curve with 3-fold serial
dilution points of Y3-plasmid clone (a plasmid containing a 286
amplicon containing the 135 bp of telomeric DNA (SEQ ID NO:12), Y3
Clone). qPCR efficiency based on slope of the standard curve is
91.6%+/-6% standard deviation (mean of 4 measurements). R2
linearity was greater than 0.99.
[0027] FIG. 10 shows the average telomere length (in kilobase
pairs, "kbp"), determined using the Y3-plasmid clone as a standard
and the disclosed triplex qPCR assay described herein, plotted as a
function of T/S ratio. The slope of the regression line is 2.46,
indicating that one T:S unit represents 2.46 kbp based with this
methodology. The three data points were from analysis of 3 quality
control samples representing low, medium, and high telomere
length.
[0028] FIG. 11 shows the average telomere length (in kbp) plotted
as a function of T/S ratio for 5 samples derived from a single cell
line (a UMUC-3 bladder cancer line) which underwent telomere
extensions by transfection of the cell line with the RNA subunit of
telomerase (hTER). The average telomere length was determined using
the disclosed triplex qPCR assay described herein. Telomere length
increased from an initial value of approximately 2.8 kbp to 4.6
kbp, with data collected at baseline and 4 additional points during
cell culture. The slope of the regression line is 2.59, indicating
that one T:S unit represents 2.59 kbp based on this
methodology.
[0029] FIG. 12 shows average telomere length (in kbp), determined
using the Southern Blot methodology, plotted as a function of T:S
ratio. Based on this comparison, with a regression line slope of
2.15, one T:S unit represents 2.15 kbp. The samples for this
comparison are identical to those used for FIG. 11.
[0030] FIGS. 13A-13D show data comparing amplification using the
disclosed triplex qPCR assay, described herein, of a canonical
telomere repeat, (CCCTAA).sub.15, with either the Tel 1b and Tel 2b
primers (SEQ ID NOs: 20 and 21, respectively) or the using the Tel
G modified and Tel C modified primers (SEQ ID NOs: 1 and 2,
respectively). Reactions containing the Tel 1b and Tel 2b primers
are indicated with "TT" in the figures, and reactions containing
the Tel G modified and Tel C modified primers are indicated with
"ATL" in the figures. FIG. 13A shows the results obtained for each
primer in a reaction containing 1.times.DNA (1.67 ng/.mu.L),
whereas FIG. 13B under the same conditions except using 7.times.DNA
(11.69 ng: L). FIG. 13C and FIG. 13D show the calculated average
telomere concentration using the data in FIGS. 13A and 13B,
respectively.
[0031] FIGS. 14A-14C shows a similar experiment to that described
above for FIGS. 13A-13D0. The amplification reactions were carried
under the same conditions, except that the target template was a
G-rich target sequence, (CCCTCA).sub.15. Reactions containing the
Tel 1b and Tel 2b primers are indicated with "TT" in the figures,
and reactions containing the Tel G modified and Tel C modified
primers are indicated with "ATL" in the figures. FIG. 14A shows the
results obtained for each primer in a reaction containing
1.times.DNA (1.67 ng/.mu.L), whereas FIG. 14B under the same
conditions except using 7.times.DNA (11.69 ng/.mu.L). FIG. 14C
shows the calculated average telomere concentration using the data
in FIGS. 14A and 14.
[0032] FIGS. 15A-15C shows a similar experiment to that described
above for FIGS. 13A-13D. The amplification reactions were carried
under the same conditions, except that the target template was a
G-rich target sequence, (CCCTGA).sub.15. Reactions containing the
Tel 1b and Tel 2b primers are indicated with "TT" in the figures,
and reactions containing the Tel G modified and Tel C modified
primers are indicated with "ATL" in the figures. FIG. 15A shows the
results obtained for each primer in a reaction containing
1.times.DNA (1.67 ng/.mu.L), whereas FIG. 15B under the same
conditions except using 7.times.DNA (11.69 ng/.mu.L). FIG. 15C
shows the calculated average telomere concentration using the data
in FIGS. 15A and 15B.
[0033] FIG. 16 shows a QQ Plot of T/S ratio data obtained from 311
normal human whole blood samples tested in the both the Cawthon
2002 assay and the disclosed triplex qPCR assay described herein.
The best fit equation for the relationship between the T/S ratio
obtained in the two assays was: Y=1.13x-0.06, with an
R.sup.2=0.81.
[0034] Additional advantages of the invention will be set forth in
part in the description which follows, and in part will be obvious
from the description, or can be learned by practice of the
invention. The advantages of the invention will be realized and
attained by means of the elements and combinations particularly
pointed out in the appended claims. It is to be understood that
both the foregoing general description and the following detailed
description are exemplary and explanatory only and are not
restrictive of the invention, as claimed.
DETAILED DESCRIPTION OF THE INVENTION
[0035] The present disclosure can be understood more readily by
reference to the following detailed description of the invention
and the Examples included therein.
[0036] All publications mentioned herein are incorporated herein by
reference to disclose and describe the methods and/or materials in
connection with which the publications are cited. The publications
discussed herein are provided solely for their disclosure prior to
the filing date of the present application. Nothing herein is to be
construed as an admission that the present disclosure is not
entitled to antedate such publication by virtue of prior invention.
Further, the dates of publication provided herein can be different
from the actual publication dates, which can require independent
confirmation.
[0037] As used in the specification and in the claims, the term
"comprising" can include the aspects "consisting of" and
"consisting essentially of."
[0038] As used herein, nomenclature for compounds, including
organic compounds, can be given using common names, IUPAC, IUBMB,
or CAS recommendations for nomenclature. Unless defined otherwise,
all technical and scientific terms used herein have the same
meaning as commonly understood by one of ordinary skill in the art
to which this invention belongs. In this specification and in the
claims which follow, reference will be made to a number of terms
which shall be defined herein.
[0039] As used in the specification and the appended claims, the
singular forms "a," "an" and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example,
reference to "a cell," "a nucleotide." or "a primer" includes
mixtures of two or more such cells, nucleotides, or primers, and
the like.
[0040] Ranges can be expressed herein as from "about" one
particular value, and/or to "about" another particular value. When
such a range is expressed, a further aspect includes from the one
particular value and/or to the other particular value. Similarly,
when values are expressed as approximations, by use of the
antecedent "about," it will be understood that the particular value
forms a further aspect. It will be further understood that the
endpoints of each of the ranges are significant both in relation to
the other endpoint, and independently of the other endpoint. It is
also understood that there are a number of values disclosed herein,
and that each value is also herein disclosed as "about" that
particular value in addition to the value itself. For example, if
the value "10" is disclosed, then "about 10" is also disclosed. It
is also understood that each unit between two particular units are
also disclosed. For example, if 10 and 15 are disclosed, then 11,
12, 13, and 14 are also disclosed.
[0041] As used herein, the terms "about" and "at or about" mean
that the amount or value in question can be the value designated
some other value approximately or about the same. It is generally
understood, as used herein, that it is the nominal value indicated
.+-.10% variation unless otherwise indicated or inferred. The term
is intended to convey that similar values promote equivalent
results or effects recited in the claims. That is, it is understood
that amounts, sizes, formulations, parameters, and other quantities
and characteristics are not and need not be exact, but can be
approximate and/or larger or smaller, as desired, reflecting
tolerances, conversion factors, rounding oft measurement error and
the like, and other factors known to those of skill in the art. In
general, an amount, size, formulation, parameter or other quantity
or characteristic is "about" or "approximate" whether or not
expressly stated to be such. It is understood that where "about" is
used before a quantitative value, the parameter also includes the
specific quantitative value itself, unless specifically stated
otherwise.
[0042] References in the specification and concluding claims to
parts by weight of a particular element or component in a
composition denotes the weight relationship between the element or
component and any other elements or components in the composition
or article for which a part by weight is expressed. Thus, in a
compound containing 2 parts by weight of component X and 5 parts by
weight component Y, X and Y are present at a weight ratio of 2:5,
and are present in such ratio regardless of whether additional
components are contained in the compound.
[0043] A weight percent (wt. %) of a component, unless specifically
stated to the contrary, is based on the total weight of the
formulation or composition in which the component is included.
[0044] As used herein, the terms "optional" or "optionally" means
that the subsequently described event or circumstance can or cannot
occur, and that the description includes instances where said event
or circumstance occurs and instances where it does not.
[0045] As used herein, the term "effective amount" refers to an
amount that is sufficient to achieve the desired modification of a
physical, chemical, or biological property of the composition or
method.
[0046] As used herein, "kit" means a collection of at least two
components constituting the kit. Together, the components
constitute a functional unit for a given purpose. Individual member
components may be physically packaged together or separately. For
example, a kit comprising an instruction for using the kit may or
may not physically include the instruction with other individual
member components. Instead, the instruction can be supplied as a
separate member component, either in a paper form or an electronic
form which may be supplied on computer readable memory device or
downloaded from an internet website, or as recorded
presentation.
[0047] As used herein, "instruction(s)" means documents describing
relevant materials or methodologies pertaining to a kit. These
materials may include any combination of the following: background
information, list of components and their availability information
(purchase information, etc.), brief or detailed protocols for using
the kit, trouble-shooting, references, technical support, and any
other related documents. Instructions can be supplied with the kit
or as a separate member component, either as a paper form or an
electronic form which may be supplied on computer readable memory
device or downloaded from an internet website, or as recorded
presentation. Instructions can comprise one or multiple documents,
and are meant to include future updates.
[0048] As used herein, the term "subject" can be a vertebrate, such
as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the
subject of the herein disclosed methods can be a human, non-human
primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig
or rodent. The term does not denote a particular age or sex. Thus,
adult and newborn subjects, as well as fetuses, whether male or
female, are intended to be covered. In one aspect, the subject is a
mammal. A patient refers to a subject afflicted with a condition,
disease or disorder. The term "patient" includes human and
veterinary subjects. In some aspects of the disclosed methods, the
subject has been diagnosed with a need for treatment of one or more
conditions or diseases associated with altered telomere length. For
example, a subject with a particular clinical condition can have
cells with chromosomes having an altered telomere length resulting
from a dysfunction in telomerase activity. In such conditions, the
dysfunction in telomerase activity leads to critically short
telomeres ("telomere disease").
[0049] As used herein, the term "treatment" refers to the medical
management of a patient with the intent to cure, ameliorate,
stabilize, or prevent a disease, pathological condition, or
disorder. This term includes active treatment, that is, treatment
directed specifically toward the improvement of a disease,
pathological condition, or disorder, and also includes causal
treatment, that is, treatment directed toward removal of the cause
of the associated disease, pathological condition, or disorder. In
addition, this term includes palliative treatment, that is,
treatment designed for the relief of symptoms rather than the
curing of the disease, pathological condition, or disorder;
preventative treatment, that is, treatment directed to minimizing
or partially or completely inhibiting the development of the
associated disease, pathological condition, or disorder and
supportive treatment, that is, treatment employed to supplement
another specific therapy directed toward the improvement of the
associated disease, pathological condition, or disorder. In various
aspects, the term covers any treatment of a subject, including a
mammal (e.g., a human), and includes: (i) preventing the disease
from occurring in a subject that can be predisposed to the disease
but has not yet been diagnosed as having it; (ii) inhibiting the
disease, i.e., arresting its development; or (iii) relieving the
disease, i.e., causing regression of the disease. In one aspect,
the subject is a mammal such as a primate, and, in a further
aspect, the subject is a human. The term "subject" also includes
domesticated animals (e.g., cats, dogs, etc.), livestock (e.g.,
cattle, horses, pigs, sheep, goats, etc.), and laboratory animals
(e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.).
[0050] As used herein, the term "prevent" or "preventing" refers to
precluding, averting, obviating, forestalling, stopping, or
hindering something from happening, especially by advance action.
It is understood that where reduce, inhibit or prevent are used
herein, unless specifically indicated otherwise, the use of the
other two words is also expressly disclosed.
[0051] As used herein, the terms "administering" and
"administration" refer to any method of providing a pharmaceutical
preparation to a subject. Such methods are well known to those
skilled in the art and include, but are not limited to, oral
administration, transdermal administration, administration by
inhalation, nasal administration, topical administration,
intravaginal administration, ophthalmic administration, intraaural
administration, intracerebral administration, rectal
administration, sublingual administration, buccal administration,
and parenteral administration, including injectable such as
intravenous administration, intra-arterial administration,
intramuscular administration, and subcutaneous administration.
Administration can be continuous or intermittent. In various
aspects, a preparation can be administered therapeutically; that
is, administered to treat an existing disease or condition. In
further various aspects, a preparation can be administered
prophylactically; that is, administered for prevention of a disease
or condition.
[0052] As used herein, the terms "effective amount" and "amount
effective" refer to an amount that is sufficient to achieve the
desired result or to have an effect on an undesired condition. For
example, a "therapeutically effective amount" refers to an amount
that is sufficient to achieve the desired therapeutic result or to
have an effect on undesired symptoms, but is generally insufficient
to cause adverse side effects. The specific therapeutically
effective dose level for any particular patient will depend upon a
variety of factors including the disorder being treated and the
severity of the disorder; the specific composition employed; the
age, body weight, general health, sex and diet of the patient: the
time of administration; the route of administration; the rate of
excretion of the specific compound employed; the duration of the
treatment; drugs used in combination or coincidental with the
specific compound employed and like factors well known in the
medical arts. For example, it is well within the skill of the art
to start doses of a compound at levels lower than those required to
achieve the desired therapeutic effect and to gradually increase
the dosage until the desired effect is achieved. If desired, the
effective daily dose can be divided into multiple doses for
purposes of administration. Consequently, single dose compositions
can contain such amounts or submultiples thereof to make up the
daily dose. The dosage can be adjusted by the individual physician
in the event of any contraindications. Dosage can vary, and can be
administered in one or more dose administrations daily, for one or
several days. Guidance can be found in the literature for
appropriate dosages for given classes of pharmaceutical products.
In further various aspects, a preparation can be administered in a
"prophylactically effective amount"; that is, an amount effective
for prevention of a disease or condition.
[0053] As used herein. "extension primer" means an oligonucleotide
primer used to perform the time-limited extension reaction step
carried out by a DNA polymerase. The extension primer can comprise
a 3' portion and a 5' portion. For example, the 3' portion can
hybridize to a telomeric repeat sequence in the 3' overhang under
annealing conditions, and a 5' portion can have an anchor sequence
that does not hybridize to a telomeric repeat sequence in the 3'
overhang under the annealing conditions.
[0054] As used herein, "telomeric region" means the double-stranded
DNA segment at the ends of a chromosome with repeat telomeric
sequence (TTAGGG:CCCTAA repeats).
[0055] As used herein, "sub-telomeric region" means the segment of
DNA immediately adjacent to telomere at the centromeric side of
telomeres. A sub-telomeric region often contains degenerate
telomeric repeats. In the case of humans, repeats of TGAGGG and
TCAGGG can be present in the sub-telomeric region.
[0056] As used herein, "anchor sequence" means a unique sequence
segment within a primer that is not present in the template genome
that can be used in the PCR reaction or present within 20 kb of the
intended amplicon. For example, the 5' portion of an extension
primer can be an anchor sequence that is configured not to
hybridize under annealing conditions to a telomeric repeat sequence
in the G-strand to which the 3' portion of the extension primer
hybridizes and not to hybridize to any other sequence present in
the template sequence within 20 kb of the telomeric repeat.
[0057] As used herein, the "G-strand of the chromosomal DNA" means
the strand of the telomere having the 3' overhang, and includes the
telomeric repeat sequence 5'-TTAGGG-3'. For example, "G-strand of
the chromosomal DNA" can refer to the DNA strand in a chromosome
comprising the (TTAGGGG).sub.n telomeric repeat sequence in humans
and other vertebrates.
[0058] As used herein, the "C-strand of the chromosomal DNA" means
the strand complementary to the G-strand of the chromosomal DNA,
and comprises the (CCCTAA)n telomeric repeat sequence in humans and
other vertebrates.
[0059] As used herein, "mosaic composition genomic DNA" means a
genomic DNA sample that is a pooled sample comprising individual
donor DNA samples. The pool comprises individual samples obtained
from at least two unrelated sample donors. Typically, mosaic
composition genomic DNA is a pooled sample comprising individual
genomic DNA samples obtained from about 50-100 individual,
unrelated sample donors. In some cases, the individual, unrelated
sample donors are of a single gender, e.g., mosaic composition
genomic DNA obtained only from individual, unrelated male donors.
In other cases, the individual, unrelated sample donors are from
both genders. "Mosaic composition genomic DNA" can be used
interchangeably with other terms such as "mosaic template DNA,"
"mosaic genomic DNA," "mosaic DNA," and the like.
[0060] As used herein, a "polymerase" refers to an enzyme that
catalyzes the polymerization of nucleotides. Generally, the enzyme
will initiate synthesis at the 3'-end of the primer annealed to a
nucleic acid template sequence. "DNA polymerase" catalyzes the
polymerization of deoxyribonucleotides in a sequence specific
manner complementing the nucleic acid the primer is annealed to
resulting in a double-stranded DNA molecule. Known DNA polymerases
include, for example, Pyrococcus furiosus (Pfu) DNA polymerase
(Lundberg et al. (1991) Gene 108:1), E. coli DNA polymerase I
(Lecomte and Doubleday (1983) Nucleic Acids Res. 11:7505). T7 DNA
polymerase (Nordstrom et al. (1981) J. Biol. Chem. 256:3112),
Thermus thermophilus (Tth) DNA polymerase (Myers and Gelfand (1991)
Biochemistry 30:7661), Bacillus stearothermophilus DNA polymerase
(Stenesh and McGowan (1977) Biochim Biophys Acta 475:32),
Thermococcus litoralis (Tli) DNA polymerase (also referred to as
Vent DNA polymerase, Cariello et al. (1991) Nucleic Acids Res
19:4193), Thermotoga maritima (Tma) DNA polymerase (Diaz and Sabino
(1998) Braz J. Med. Res 31:1239), and Thermus aquaticus (Taq) DNA
polymerase (Chien et al., (1976) J. Bacteoriol 127:1550). The
polymerase activity of any of the above enzymes can be determined
by means well known in the art.
[0061] As used herein, "thermostable" DNA polymerase activity means
DNA polymerase activity which is relatively stable to heat and
functions at high temperatures, for example 45-100.degree. C.,
preferably 55-100.degree. C., 65-100.degree. C., 75-100.degree. C.,
85-100.degree. C. or 95-100.degree. C., as compared, for example,
to a non-thermostable form of DNA polymerase.
[0062] As used herein, "primer" refers to an oligonucleotide
capable of acting as a point of initiation of DNA synthesis under
conditions in which synthesis of a primer extension product
complementary to a nucleic acid strand is induced, e.g., in the
presence of four different nucleoside triphosphates and an agent
for extension (e.g., a DNA polymerase or reverse transcriptase) in
an appropriate buffer and at a suitable temperature. A primer need
not reflect the exact sequence of the template nucleic acid, but
must be sufficiently complementary to hybridize with the template.
The design of suitable primers for the amplification of a given
target sequence is well known in the art and described in the
literature cited herein.
[0063] The terms "target," "target sequence," "target region," and
"target nucleic acid," as used herein, are synonymous and refer to
a region or subsequence of a nucleic acid which is to be amplified
or detected.
[0064] The term "hybridization," as used herein, refers to the
formation of a duplex structure by two single-stranded nucleic
acids due to complementary base pairing. Hybridization can occur
between fully complementary nucleic acid strands or between
"substantially complementary" nucleic acid strands that contain
minor regions of mismatch. Conditions under which only fully
complementary nucleic acid strands will hybridize are referred to
as "stringent hybridization conditions" or "sequence-specific
hybridization conditions". Stable duplexes of substantially
complementary sequences can be achieved under less stringent
hybridization conditions; the degree of mismatch tolerated can be
controlled by suitable adjustment of the hybridization conditions.
Those skilled in the art of nucleic acid technology can determine
duplex stability empirically considering a number of variables
including, for example, the length and base pair composition of the
oligonucleotides, ionic strength, and incidence of mismatched base
pairs, following the guidance provided by the art (see, e.g.,
Sambrook et al., (1989) Molecular Cloning--A Laboratory Manual
(Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.); and
Wetmur (1991.) Critical Review in Biochem. and Mol. Biol. 26
(3/4):227-259; both incorporated herein by reference).
[0065] The term "amplification reaction" refers to any chemical
reaction, including an enzymatic reaction, which results in
increased copies of a template nucleic acid sequence or results in
transcription of a template nucleic acid.
[0066] Polymerase chain reaction (PCR) is a method that allows
exponential amplification of DNA sequences within a longer double
stranded DNA molecule. PCR entails the use of a pair of primers
that are complementary to a defined sequence on each of the two
strands of the DNA with one primer being complementary to one
strand and the other primer being complementary to the other strand
of the target sequence. These primers are extended by a DNA
polymerase so that a copy is made of the designated sequence. After
making this copy, the same primers can be used again, not only to
make another copy of the input DNA strand but also of the short
copy (PCR amplicon) made in the first round of synthesis. This
leads to logarithmic amplification. Since it is necessary to raise
the temperature to separate the two strands of the double strand
DNA in each round of the amplification process, a major step
forward was the discovery of a thermo-stable DNA polymerase (Taq
polymerase) that was isolated from Thermus aquaticus, a bacterium
that grows in hot pools; as a result it is not necessary to add new
polymerase in every round of amplification. After several (often
about 20 to 40) rounds of amplification, the PCR product is
analyzed on an agarose gel and is abundant enough to be detected
with an DNA intercalating or binding dye, e.g., ethidium bromide,
SYBR.RTM. Green, or EvaGreen.RTM. dye.
[0067] It is understood that real-time PCR, also called
quantitative real time PCR (qRT-PCR), quantitative PCR
(Q-PCR/qPCR), or kinetic polymerase chain reaction, is a laboratory
technique based on PCR, which is used to amplify and simultaneously
quantify a targeted DNA molecule. qPCR enables both detection and
quantification (as absolute number of copies or relative amount
when normalized to DNA input or additional normalizing genes) of a
specific sequence in a DNA sample.
[0068] As used herein, a primer is "specific," for a target
sequence if, when used in an under sufficiently stringent
conditions, the primer hybridizes primarily only to the target
nucleic acid. Typically, a primer is specific for a target sequence
if the primer-target duplex stability is greater than the stability
of a duplex formed between the primer and any other sequence found
in the sample. One of skill in the art will recognize that various
factors, such as salt conditions as well as base composition of the
primer and the location of the mismatches, will affect the
specificity of the primer, and that routine experimental
confirmation of the primer specificity will be needed in most
cases. Hybridization conditions can be chosen under which the
primer can form stable duplexes only with a target sequence. Thus,
the use of target-specific primers under suitably stringent
amplification conditions enables the specific amplification of
those target sequences which contain the target primer binding
sites. The use of sequence-specific amplification conditions
enables the specific amplification of those target sequences which
contain the exactly complementary primer binding sites.
[0069] The term "Tm" means the melting temperature, or annealing
temperature, of a nucleic acid duplex at which, under specified
conditions, half of the base pairs have disassociated. Those
skilled in the art of nucleic acid technology can determine duplex
stability empirically considering a number of variables including,
for example, the length of the oligonucleotide, base composition
and sequence of the oligonucleotide, ionic strength, and incidence
of mismatched base pairs. The "predicted Tm," as used herein, means
the temperature at which a primer and its complementary template
sequence are predicted to be sufficiently stable to permit
hybridization and extension by PCR, and can be determined using the
nearest neighbor algorithm (Von-Ahsen N et al. (1999) Clinical
Chemistry, 45(12):2094-2101). An exemplary software tool for
determining the predicted Tm for oligonucleotides and primers is
provided on the websites of many vendors selling oligonucleotides
(e.g. Integrated DNA Technologies, Inc.).
[0070] The term "probe," as used herein, refers to a labeled
oligonucleotide which forms a duplex structure with a sequence in
the target nucleic acid, due to complementarity of at least one
sequence in the probe with a sequence in the target region. The
probe preferably does not contain a sequence complementary to
sequence(s) used to prime the polymerase chain reaction.
[0071] As used herein, "complementary" refers to a nucleic acid
molecule that can form hydrogen bond(s) with another nucleic acid
molecule by either traditional Watson-Crick base pairing or other
non-traditional types of pairing (e.g., Hoogsteen or reversed
Hoogsteen hydrogen bonding) between complementary nucleosides or
nucleotides.
[0072] As used herein, "substantially complementary" means that the
complementarity between a nucleic acid molecule that can form with
another nucleic acid is sufficient that hybridization can occur
under the desired or specified conditions. Thus, the two nucleic
acid strands need not be complementary at each and every nucleotide
of the two strands. When the term "substantially complementary" is
used with primers, it means that the primers must be sufficiently
complementary to hybridize with their respective strands.
Therefore, the primer sequence need not reflect the exact sequence
of the template. For example, a non-complementary nucleotide
fragment may be attached to the 5' end of the primer, with the
remainder of the primer sequence being complementary to the strand.
In some situations, it is desirable that the primers have exact
complementarity to obtain the best detection results. However,
there are other situations where it is desirable that the primers
have random mismatches, or alternatively, specific mismatches are
designed into the primers.
[0073] It is understood in the art that a nucleic acid molecule
need not be 100% complementary to a target nucleic acid sequence to
be specifically hybridizable. That is, two or more nucleic acid
molecules may be less than fully complementary and is indicated by
a percentage of contiguous residues in a nucleic acid molecule that
can form hydrogen bonds with a second nucleic acid molecule. For
example, if a first nucleic acid molecule has 10 nucleotides and a
second nucleic acid molecule has 10 nucleotides, then base pairing
of 5, 6, 7, 8, 9, or 10 nucleotides between the first and second
nucleic acid molecules represents 50%, 60%, 70%, 80%, 90%, and 100%
complementarity, respectively. "Perfectly" or "fully" complementary
nucleic acid molecules means those in which all the contiguous
residues of a first nucleic acid molecule will hydrogen bond with
the same number of contiguous residues in a second nucleic acid
molecule, wherein the nucleic acid molecules either both have the
same number of nucleotides (i.e., have the same length) or the two
molecules have different lengths.
[0074] The term "non-specific amplification," as used herein,
refers to the amplification of nucleic acid sequences other than
the target sequence which results from primers hybridizing to
sequences other than the target sequence and then serving as a
substrate for primer extension. The hybridization of a primer to a
non-target sequence is referred to as "non-specific hybridization"
and is apt to occur especially during the lower temperature,
reduced stringency, pre-amplification conditions.
[0075] The term "primer dimer," as used herein, refers to a
template-independent non-specific amplification product, which is
believed to result from primer extensions wherein another primer
serves as a template. Although primer dimes frequently appear to be
a concatemer of two primers, i.e., a dimer, concatemers of more
than two primers also occur. The term "primer dimer" is used herein
generically to encompass a template-independent non-specific
amplification product.
[0076] The term "reaction mixture," as used herein, refers to a
solution containing reagents necessary to carry out a given
reaction. An "amplification reaction mixture", which refers to a
solution containing reagents necessary to carry out an
amplification reaction, typically contains oligonucleotide primers
and a DNA polymerase in a suitable buffer. A "PCR reaction mixture"
typically contains oligonucleotide primers, a DNA polymerase (most
typically a thermostable DNA polymerase), dNTPs, and a divalent
metal cation in a suitable buffer. A reaction mixture is referred
to as complete if it contains all reagents necessary to enable the
reaction, and incomplete if it contains only a subset of the
necessary reagents. It will be understood by one of skill in the
art that reaction components are routinely stored as separate
solutions or in "master mixes", each containing a subset of the
total components, for reasons of convenience, storage stability, or
to allow for application-dependent adjustment of the component
concentrations, and that reaction components are combined prior to
the reaction to create a complete reaction mixture. Furthermore, it
will be understood by one of skill in the art that reaction
components are packaged separately for commercialization and that
useful commercial kits may contain any subset of the reaction
components which includes the blocked primers of the
disclosure.
[0077] The abbreviations and terms described in Table 1 are used
herein throughout.
TABLE-US-00001 TABLE 1 Term Definition bp(s) base pair(s) nt(s)
nucleotide(s) U enzymatic units (as defined in the art for the
indicated enzyme) DNA deoxyribonucleic acid RNA ribonucleic acid
qPCR-TL qPCR telomere length TRF telomere restriction fragment
length aTL absolute telomere length ATL average telomere length T
telomere repeat sequence R RNase P single copy gene B B2M single
copy gene T/S Telomere length ratio based on the ratio of telomere
products ratio and the average of B2M and RNase P products qPCR
Quantitative polymerase chain reaction QC DNA Quality control DNA
QC1 Human genomic DNA obtained from pooled whole blood samples from
female and male donors QC2 Human genomic DNA from 100 female donors
QC3 Human genomic DNA obtained from placental tissue Tel G Telomere
forward primer modified Tel C Telomere reverse primer modified
B2M-F .beta.2-microglobulin forward primer B2M-R
.beta.2-microglobulin reverse primer B2M-P .beta.2-microglobulin
amplicon detection probe that is a Cy5 .RTM. dye-labeled, Iowa
Black .RTM. RQ quenched probe. RNAP-F RNase P forward primer,
TaqMan .RTM. Copy Number Reference Assay RNase P kit, Cat. No.
4403326 or 4403328 (Thermo Fisher Scientific Inc.). RNAP-R RNase P
reverse primer, TaqMan .RTM. Copy Number Reference Assay RNase P
kit, Cat. No. 4403326 or 4403328 (Thermo Fisher Scientific Inc.).
RNAP-P RNase P detection probe that is a VIC .RTM. dye-labeled,
TAMRA .TM. dye-quenched probe, TaqMan .RTM. Copy Number Reference
Assay RNase P kit, Cat. No. 4403326 or 4403328 (Thermo Fisher
Scientific Inc.). Reference Mosaic M DNA used to establish standard
curves for input standard DNA DNA Mosaic NIST-calibrated human
genomic DNA from 100 male donors. M DNA The genomic DNA is purified
so that 90% of the material is greater than or equal to 50 kb.
Pulse A short treatment of a sample in microcentrifuge in a spin
microcentrifuge wherein the sample is spun for a period of about 5
seconds, then released.
[0078] Disclosed are materials, compositions, and components that
can be used for, can be used in conjunction with, can be used in
preparation for, or are products of the disclosed method and
compositions. These and other materials are disclosed herein, and
it is understood that when combinations, subsets, interactions,
groups, etc. of these materials are disclosed that while specific
reference of each various individual and collective combinations
and permutation of these compounds may not be explicitly disclosed,
each is specifically contemplated and described herein. Thus, if a
class of molecules A, B, and C are disclosed as well as a class of
molecules D, E, and F and an example of a combination molecule, A-D
is disclosed, then even if each is not individually recited, each
is individually and collectively contemplated. Thus, is this
example, each of the combinations A-E, A-F, B-D, B-E, B-F, C-D,
C-E, and C-F are specifically contemplated and should be considered
disclosed from disclosure of A, B, and C; D, E, and F; and the
example combination A-D. Likewise, any subset or combination of
these is also specifically contemplated and disclosed. Thus, for
example, the sub-group of A-E, B-F, and C-E are specifically
contemplated and should be considered disclosed from disclosure of
A, B, and C: D. E, and F: and the example combination A-D. This
concept applies to all aspects of this disclosure including, but
not limited to, steps in methods of making and using the disclosed
compositions. Thus, if there are a variety of additional steps that
can be performed it is understood that each of these additional
steps can be performed with any specific embodiment or combination
of embodiments of the disclosed methods, and that each such
combination is specifically contemplated and should be considered
disclosed.
[0079] 1. Triplex qPCR Assay Method
[0080] The present disclosure discloses methods and materials for
determining measures of average telomere length or abundance in a
population of chromosomes and of using these measures for
determining measures of health or disease risk, or effects of
interventions that increase or decrease telomere length and, hence,
increase or decrease health, or conversely decrease or increase
risk of future disease or death, respectively, or to improve the
practice of medicine by providing added value through
telomere-based guidance to physicians. The methods involve
determining the average telomere length or abundance of at least
three target nucleic acid sequences in a single qPCR multiplexed
reaction utilizing a different detection label for each target
nucleic acid sequence. In one aspect, one of the three target
nucleic acid sequences is a telomeric sequence and the other two
target nucleic acid sequences are distinct low copy number genes
known to rarely undergo copy number variation. In a further aspect,
the low copy number genes are single copy genes known to rarely
undergo copy number variation. In a further aspect, the ratio of
the average telomere length or abundance to average of the average
length or abundance for the other two nucleic acid sequences, i.e.,
the T/S ratio, where "S" is the average of the two single low copy
genes, can be used to determine a specific clinical risk.
Alternatively, the T/S ratio can be used for optimizing therapeutic
regimens.
[0081] In one aspect, the present disclosure pertains to methods
for determining average telomere length, comprising: (a) contacting
a first target nucleic acid with a first primer set, a second
target nucleic acid with a second primer set, and a third target
nucleic acid target with a third primer set: (i) wherein the first
primer set comprises a first forward primer and a first reverse
primer; (ii) wherein the second primer set comprises a second
forward primer and a second reverse primer; (iii) wherein the third
primer set comprises a third forward primer and a third reverse
primer; and (iv) wherein the first target nucleic acid comprises a
telomere repeat sequence; (b) amplifying by polymerase chain
reaction the first target nucleic acid with the first primer set to
form a first amplicon, the second target nucleic acid with the
second primer set to form a second amplicon, and the third target
nucleic acid with the third primer set to form a third amplicon;
(c) determining during one or more cycles of the polymerase chain
reaction, the amount of the first, second, and third amplicons; (i)
wherein the first amplicon is detected using a first detection
label; (ii) wherein the second amplicon is detected using a second
detection label; and (iii) wherein the third amplicon is detected
using a third detection label; and (d) determining the average
length or abundance of the first amplicon.
[0082] In various aspects, determining the average length or
abundance of the first amplicon comprises the steps: (a)
determining the concentration of the first, second, and third
amplicon by comparison to a control polymerase chain reaction; (b)
determine the ratio of the concentration of the first amplicon to
the average or weighted concentration of the second and third
amplicons; and (c) converting the ratio from step (b) to base pairs
of telomere sequence per genome.
[0083] In one aspect, the present disclosure pertains to methods
for determining average telomere length, comprising: (a) contacting
a first target nucleic acid with a first primer set, a second
target nucleic acid with a second primer set, a third target
nucleic acid target with a third primer set; and a fourth target
nucleic acid target with a fourth primer set; (i) wherein the first
primer set comprises a first forward primer and a first reverse
primer; (ii) wherein the second primer set comprises a second
forward primer and a second reverse primer; (iii) wherein the third
primer set comprises a third forward primer and a third reverse
primer; (iv) wherein the fourth primer set comprises a fourth
forward primer and a fourth reverse primer, and (v) wherein the
first target nucleic acid comprises a telomere repeat sequence; (b)
amplifying by polymerase chain reaction the first target nucleic
acid with the first primer set to form a first amplicon, the second
target nucleic acid with the second primer set to form a second
amplicon, the third target nucleic acid with the third primer set
to form a third amplicon, and the fourth target nucleic acid with
the fourth primer set to form a fourth amplicon; (c) determining
during one or more cycles of the polymerase chain reaction the
amount of the first, second, and third amplicons; (i) wherein the
first amplicon is detected using a first detection label; (ii)
wherein the second amplicon is detected using a second detection
label; (iii) wherein the third amplicon is detected using a third
detection label; and (iv) wherein the fourth amplicon is detected
using a fourth detection label; and (d) determining the average
length or abundance of the first amplicon.
[0084] In various aspects, determining the average length or
abundance of the first amplicon comprises the steps: (a)
determining the concentration of the first, second, third, and
fourth amplicon by comparison to a control polymerase chain
reaction: (b) determine the ratio of the concentration of the first
amplicon to the average or weighted concentration of the second,
third, and fourth amplicons; and (c) converting the ratio from step
(b) to base pairs of telomere sequence per genome.
[0085] In one aspect, the present disclosure pertains to methods
for determining average telomere length, comprising: (a) contacting
a first target nucleic acid with a first primer set, a second
target nucleic acid with a second primer set, a third target
nucleic acid target with a third primer set; a fourth target
nucleic acid target with a fourth primer set, and a fifth target
nucleic acid target with a fourth primer set; (i) wherein the first
primer set comprises a first forward primer and a first reverse
primer; (ii) wherein the second primer set comprises a second
forward primer and a second reverse primer: (iii) wherein the third
primer set comprises a third forward primer and a third reverse
primer; (iv) wherein the fourth primer set comprises a fourth
forward primer and a fourth reverse primer; (v) wherein the fifth
primer set comprises a fifth forward primer and a fifth reverse
primer, and (vi) wherein the first target nucleic acid comprises a
telomere repeat sequence; (b) amplifying by polymerase chain
reaction the first target nucleic acid with the first primer set to
form a first amplicon, the second target nucleic acid with the
second primer set to form a second amplicon, the third target
nucleic acid with the third primer set to form a third amplicon,
the fourth target nucleic acid with the fourth primer set to form a
fourth amplicon, and the fifth target nucleic acid with the fifth
primer set to form a fifth amplicon; (c) determining during one or
more cycles of the polymerase chain reaction the amount of the
first, second, and third amplicons; (i) wherein the first amplicon
is detected using a first detection label; (ii) wherein the second
amplicon is detected using a second detection label; (iii) wherein
the third amplicon is detected using a third detection label; (iv)
wherein the fourth amplicon is detected using a fourth detection
label; and (v) wherein the fifth amplicon is detected using a fifth
detection label; and (d) determining the average length or
abundance of the first amplicon.
[0086] In various aspects, determining the average length or
abundance of the first amplicon comprises the steps: (a)
determining the concentration of the first, second, third, and
fourth amplicon by comparison to a control polymerase chain
reaction: (b) determine the ratio of the concentration of the first
amplicon to the average or weighted concentration of the second,
third, fourth, and fifth amplicons; and (c) converting the ratio
from step (b) to base pairs of telomere sequence per genome.
[0087] In various aspects, each of the first forward primer and the
first reverse primer comprise: (a) a 3' portion that hybridizes to
a telomeric repeat sequence under annealing conditions; and (b) a
5' portion having an anchor sequence that does not hybridize to a
telomeric repeat sequence. In a further aspect, the 3' ends of the
primers of the first forward primer and the first reverse primer
are complementary to each other. In a still further aspect, the
first reverse primer is a mismatch primer comprising at least one
mismatched nucleotide adjacent to or including the 3' end of the
primer, wherein the at least one mismatched nucleotide is not
complementary to the target nucleic acid, but is complementary to
the 3' terminal nucleotide of the first forward primer. In a yet
further aspect, the extension product of the first forward primer
is capable of hybridizing to the first reverse prime. In an even
further aspect, the extension product of the first forward primer
is capable of hybridizing to the first reverse primer but will not
form a primer dimer. In a still further aspect, the first forward
primer comprises the sequence of SEQ ID NO.: 1; and wherein the
first reverse primer comprises the sequence of SEQ ID NO.; 2. In a
further aspect, the first reverse primer is blocked from priming
the first target nucleic acid. In a still further aspect, the first
reverse primer is blocked from priming the first target nucleic
acid by a terminal 3' mismatched base.
[0088] In various aspects, the second target nucleic acid is within
a gene of known copy number. In a further aspect, the second target
nucleic acid is within a low copy number gene. In a still further
aspect, the second target nucleic acid is within a single copy
number gene.
[0089] In various aspects, the second target nucleic acid is within
a gene of known copy number known to rarely undergo copy number
variations. In a further aspect, the second target nucleic acid is
within a low copy number gene known to rarely undergo copy number
variations. In a still further aspect, the second target nucleic
acid is within a single copy number gene known to rarely undergo
copy number variations.
[0090] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
.beta.2-microglobulin. In a further aspect, the second forward
primer comprises SEQ ID NO.: 3. In a yet further aspect, the second
reverse primer comprises SEQ ID NO.: 4. In a still further aspect,
the second forward primer comprises a sequence complementary to a
sequence in the .beta.2-microglobulin gene, the second reverse
primer comprises a sequence complementary to a sequence in the
.beta.2-microglobulin gene, and the second forward primer and
second reverse primer yield the second amplicon.
[0091] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is PGK.
In a further aspect, the second forward primer comprises a sequence
complementary to a sequence in the PGK gene, the second reverse
primer comprises a sequence complementary to a sequence in the PGK
gene, and the second forward primer and second reverse primer yield
the second amplicon.
[0092] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
GAPDH. In a further aspect, the second forward primer comprises a
sequence complementary to a sequence in the GAPDH gene, the second
reverse primer comprises a sequence complementary to a sequence in
the GAPDH gene, and the second forward primer and second reverse
primer yield the second amplicon.
[0093] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
hTERT. In a further aspect, the second forward primer comprises a
sequence complementary to a sequence in the hTERT gene, the second
reverse primer comprises a sequence complementary to a sequence in
the hTERT gene, and the second forward primer and second reverse
primer yield the second amplicon.
[0094] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is ACTB.
In a further aspect, the second forward primer comprises a sequence
complementary to a sequence in the ACTB gene, the second reverse
primer comprises a sequence complementary to a sequence in the ACTB
gene, and the second forward primer and second reverse primer yield
the second amplicon.
[0095] In various aspects, the second target nucleic acid is
located within a human gene.
[0096] In various aspects, the third target nucleic acid is within
a gene of known copy number. In a further aspect, the third target
nucleic acid is within a low copy number gene.
[0097] In a still further aspect, the third target nucleic acid is
within a single copy number gene.
[0098] In various aspects, the third target nucleic acid is within
a gene of known copy number known to rarely undergo copy number
variations. In a further aspect, the third target nucleic acid is
within a low copy number gene known to rarely undergo copy number
variations. In a still further aspect, the third target nucleic
acid is within a single copy number gene known to rarely undergo
copy number variations.
[0099] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
.beta.2-microglobulin, and the third target nucleic acid is within
a single copy number gene, and the single copy gene is RNase P. In
a further aspect, the second forward primer comprises SEQ ID NO.:
3. In a yet further aspect, the second reverse primer comprises SEQ
ID NO.: 4. In a still further aspect, the second forward primer
comprises a sequence complementary to a sequence in the
.beta.2-microglobulin gene, the second reverse primer comprises a
sequence complementary to a sequence in the .beta.2-microglobulin
gene, and the second forward primer and second reverse primer yield
the second amplicon. In an even further aspect, third forward
primer comprises SEQ ID NO.: 6. In a still further aspect, third
reverse primer comprises SEQ ID NO.: 7. In yet further aspect,
third forward primer comprises SEQ ID NO.: 9. In an even further
aspect, third reverse primer comprises SEQ ID NO.: 10. In a still
further aspect, the third forward primer comprises a sequence
complementary to a sequence in RNase P, the third reverse primer
comprises a sequence complementary to a sequence in RNase P, and
the third forward primer and third reverse primer yield the third
amplicon. Alternatively, primer and probe sequences target to RNase
P. and suitable for use in the disclosed methods, are described by
Fan et al. BMC infectious Disease (2014) 14:541.
[0100] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
.beta.2-microglobulin, and the third target nucleic acid is within
a single copy number gene, and the single copy gene is GAPDH. In a
further aspect, the second forward primer comprises SEQ ID NO.: 3.
In a yet further aspect, the second reverse primer comprises SEQ ID
NO.: 4. In a still further aspect, the third forward primer
comprises SEQ ID NO.: 26. In an even further aspect, the third
reverse primer comprises SEQ ID NO.: 27, In a still further aspect,
the second forward primer comprises a sequence complementary to a
sequence in the .beta.2-microglobulin gene, the second reverse
primer comprises a sequence complementary to a sequence in the
.beta.2-microglobulin gene, and the second forward primer and
second reverse primer yield the second amplicon. In an even further
aspect, the third forward primer comprises a sequence complementary
to a sequence in GAPDH, the third reverse primer comprises a
sequence complementary to a sequence in GAPDH, and the third
forward primer and third reverse primer yield the third
amplicon.
[0101] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
.beta.2-microglobulin, and the third target nucleic acid is within
a single copy number gene, and the single copy gene is PGK. In a
further aspect, the second forward primer comprises SEQ ID NO.: 3.
In a yet further aspect, the second reverse primer comprises SEQ ID
NO.: 4. In a still further aspect, the third forward primer
comprises SEQ ID NO.; 22. In an even further aspect, the third
reverse primer comprises SEQ ID NO.: 23. In a still further aspect,
the second forward primer comprises a sequence complementary to a
sequence in the .beta.2-microglobulin gene, the second reverse
primer comprises a sequence complementary to a sequence in the
2-microglobulin gene, and the second forward primer and second
reverse primer yield the second amplicon. In an even further
aspect, the third forward primer comprises a sequence complementary
to a sequence in PGK, the third reverse primer comprises a sequence
complementary to a sequence in PGK, and the third forward primer
and third reverse primer yield the third amplicon.
[0102] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
.beta.2-microglobulin, and the third target nucleic acid is within
a single copy number gene, and the single copy gene is hTERT. In a
further aspect, the second forward primer comprises SEQ ID NO.: 3.
In a yet further aspect, the second reverse primer comprises SEQ ID
NO.: 4. In a still further aspect, the second forward primer
comprises a sequence complementary to a sequence in the
.beta.2-microglobulin gene, the second reverse primer comprises a
sequence complementary to a sequence in the f.beta.2-microglobulin
gene, and the second forward primer and second reverse primer yield
the second amplicon. In an even further aspect, the third forward
primer comprises a sequence complementary to a sequence in hTERT,
the third reverse primer comprises a sequence complementary to a
sequence in hTERT, and the third forward primer and third reverse
primer yield the third amplicon.
[0103] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
.beta.2-microglobulin, and the third target nucleic acid is within
a single copy number gene, and the single copy gene is ACTB. In a
further aspect, the second forward primer comprises SEQ ID NO.: 3.
In a further aspect, the second reverse primer comprises SEQ ID
NO.: 4. In a still further aspect, the third forward primer
comprises SEQ ID NO.: 24. In an even further aspect, the third
reverse primer comprises SEQ ID NO.: 25. In a still further aspect,
the second forward primer comprises a sequence complementary to a
sequence in the .beta.2-microglobulin gene, the second reverse
primer comprises a sequence complementary to a sequence in the
.beta.2-microglobulin gene, and the second forward primer and
second reverse primer yield the second amplicon. In an even further
aspect, the third forward primer comprises a sequence complementary
to a sequence in ACTB, the third reverse primer comprises a
sequence complementary to a sequence in ACTB, and the third forward
primer and third reverse primer yield the third amplicon.
[0104] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is RNase
P, and the third target nucleic acid is within a single copy number
gene, and the single copy gene is GAPDH. In a further aspect,
second forward primer comprises SEQ ID NO.: 6. In a still further
aspect, second reverse primer comprises SEQ ID NO.: 7. In yet
further aspect, second forward primer comprises SEQ ID NO.: 9. In
an even further aspect, second reverse primer comprises SEQ ID NO.:
10. In a still further aspect, the third forward primer comprises
SEQ ID NO.: 26. In an even further aspect, the third reverse primer
comprises SEQ ID NO.: 27. In a still further aspect, the second
forward primer comprises a sequence complementary to a sequence in
RNase P, the second reverse primer comprises a sequence
complementary to a sequence in RNase P, and the second forward
primer and third reverse primer yield the third amplicon.
Alternatively, primer and probe sequences target to RNase P. and
suitable for use in the disclosed methods, are described by Fan et
al. BMC Infectious Disease (2014) 14:541. In an even further
aspect, the third forward primer comprises a sequence complementary
to a sequence in GAPDH, the third reverse primer comprises a
sequence complementary to a sequence in GAPDH, and the third
forward primer and third reverse primer yield the third
amplicon.
[0105] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is RNase
P. and the third target nucleic acid is within a single copy number
gene, and the single copy gene is PGK. In a further aspect, second
forward primer comprises SEQ ID NO.: 6. In a still further aspect,
second reverse primer comprises SEQ ID NO.: 7. In yet further
aspect, second forward primer comprises SEQ ID NO.: 9. In an even
further aspect, second reverse primer comprises SEQ ID NO.: 10. In
a still further aspect, the third forward primer comprises SEQ ID
NO.: 22. In an even further aspect, the third reverse primer
comprises SEQ ID NO.: 23. In a still further aspect, the second
forward primer comprises a sequence complementary to a sequence in
RNase P, the second reverse primer comprises a sequence
complementary to a sequence in RNase P, and the second forward
primer and third reverse primer yield the third amplicon.
Alternatively, primer and probe sequences target to RNase P, and
suitable for use in the disclosed methods, are described by Fan et
al. BMC infectious Disease (2014) 14:541. In an even further
aspect, the third forward primer comprises a sequence complementary
to a sequence in PGK, the third reverse primer comprises a sequence
complementary to a sequence in PGK, and the third forward primer
and third reverse primer yield the third amplicon.
[0106] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is RNase
P, and the third target nucleic acid is within a single copy number
gene, and the single copy gene is hTERT. In a further aspect,
second forward primer comprises SEQ ID NO.: 6. In a still further
aspect, second reverse primer comprises SEQ ID NO.: 7. In yet
further aspect, second forward primer comprises SEQ ID NO.: 9. In
an even further aspect, second reverse primer comprises SEQ ID NO.:
10. In a still further aspect, the second forward primer comprises
a sequence complementary to a sequence in RNase P, the second
reverse primer comprises a sequence complementary to a sequence in
RNase P, and the second forward primer and third reverse primer
yield the third amplicon. Alternatively, primer and probe sequences
target to RNase P, and suitable for use in the disclosed methods,
are described by Fan et al. BMC Infectious Disease (2014) 14:541.
In an even further aspect, the third forward primer comprises a
sequence complementary to a sequence in hTERT, the third reverse
primer comprises a sequence complementary to a sequence in hTERT,
and the third forward primer and third reverse primer yield the
third amplicon.
[0107] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is RNase
P. and the third target nucleic acid is within a single copy number
gene, and the single copy gene is ACTB. In a further aspect, second
forward primer comprises SEQ ID NO.: 6. In a still further aspect,
second reverse primer comprises SEQ ID NO.: 7. In yet further
aspect, second forward primer comprises SEQ ID NO.: 9. In an even
further aspect, second reverse primer comprises SEQ ID NO.: 10. In
a still further aspect, the third forward primer comprises SEQ ID
NO.: 24. In an even further aspect, the third reverse primer
comprises SEQ ID NO.: 25. In a still further aspect, the second
forward primer comprises a sequence complementary to a sequence in
RNase P, the second reverse primer comprises a sequence
complementary to a sequence in RNase P, and the second forward
primer and third reverse primer yield the third amplicon.
Alternatively, primer and probe sequences target to RNase P, and
suitable for use in the disclosed methods, are described by Fan et
al. BMC Infectious Disease (2014) 14:541. In an even further
aspect, the third forward primer comprises a sequence complementary
to a sequence in ACTB, the third reverse primer comprises a
sequence complementary to a sequence in ACTB, and the third forward
primer and third reverse primer yield the third amplicon.
[0108] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
GAPDH, and the third target nucleic acid is within a single copy
number gene, and the single copy gene is PGK. In a still further
aspect, the second forward primer comprises SEQ ID NO.: 26. In an
even further aspect, the second reverse primer comprises SEQ ID
NO.: 27. In a still further aspect, the third forward primer
comprises SEQ ID NO.: 22. In an even further aspect, the third
reverse primer comprises SEQ ID NO.: 23. In a further aspect, the
second forward primer comprises a sequence complementary to a
sequence in the GAPDH, the second reverse primer comprises a
sequence complementary to a sequence in the GAPDH gene, and the
second forward primer and second reverse primer yield the second
amplicon. In an even further aspect, the third forward primer
comprises a sequence complementary to a sequence in PGK, the third
reverse primer comprises a sequence complementary to a sequence in
PGK, and the third forward primer and third reverse primer yield
the third amplicon.
[0109] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
GAPDH, and the third target nucleic acid is within a single copy
number gene, and the single copy gene is hTERT. In a further
aspect, the second forward primer comprises a sequence
complementary to a sequence in the GAPDH, the second reverse primer
comprises a sequence complementary to a sequence in the GAPDH gene,
and the second forward primer and second reverse primer yield the
second amplicon. In an even further aspect, the third forward
primer comprises a sequence complementary to a sequence in hTERT,
the third reverse primer comprises a sequence complementary to a
sequence in hTERT, and the third forward primer and third reverse
primer yield the third amplicon.
[0110] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
GAPDH, and the third target nucleic acid is within a single copy
number gene, and the single copy gene is ACTB. In a still further
aspect, the second forward primer comprises SEQ ID NO.: 26. In an
even further aspect, the second reverse primer comprises SEQ ID
NO.: 27. In a still further aspect, the third forward primer
comprises SEQ ID NO.: 24. In an even further aspect, the third
reverse primer comprises SEQ ID NO.: 25. In a further aspect, the
second forward primer comprises a sequence complementary to a
sequence in the GAPDH, the second reverse primer comprises a
sequence complementary to a sequence in the GAPDH gene, and the
second forward primer and second reverse primer yield the second
amplicon. In an even further aspect, the third forward primer
comprises a sequence complementary to a sequence in ACTB, the third
reverse primer comprises a sequence complementary to a sequence in
ACTB, and the third forward primer and third reverse primer yield
the third amplicon.
[0111] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is PGK,
and the third target nucleic acid is within a single copy number
gene, and the single copy gene is hTERT. In a still further aspect,
the second forward primer comprises SEQ ID NO.: 22. In an even
further aspect, the second reverse primer comprises SEQ ID NO.: 23.
In a further aspect, the second forward primer comprises a sequence
complementary to a sequence in the PGK, the second reverse primer
comprises a sequence complementary to a sequence in the PGK gene,
and the second forward primer and second reverse primer yield the
second amplicon. In an even further aspect, the third forward
primer comprises a sequence complementary to a sequence in hTERT,
the third reverse primer comprises a sequence complementary to a
sequence in hTERT, and the third forward primer and third reverse
primer yield the third amplicon.
[0112] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is PGK,
and the third target nucleic acid is within a single copy number
gene, and the single copy gene is ACTB. In a still further aspect,
the second forward primer comprises SEQ ID NO.: 22. In an even
further aspect, the second reverse primer comprises SEQ ID NO.: 23.
In a still further aspect, the third forward primer comprises SEQ
ID NO.: 24. In an even further aspect, the third reverse primer
comprises SEQ ID NO.: 25. In a further aspect, the second forward
primer comprises a sequence complementary to a sequence in the PGK,
the second reverse primer comprises a sequence complementary to a
sequence in the PGK gene, and the second forward primer and second
reverse primer yield the second amplicon. In an even further
aspect, the third forward primer comprises a sequence complementary
to a sequence in ACTB, the third reverse primer comprises a
sequence complementary to a sequence in ACTB, and the third forward
primer and third reverse primer yield the third amplicon.
[0113] In a further aspect, the second target nucleic acid is
within a single copy number gene, and the single copy gene is
hTERT, and the third target nucleic acid is within a single copy
number gene, and the single copy gene is ACTB. In a still further
aspect, the third forward primer comprises SEQ ID NO.: 24. In an
even further aspect, the third reverse primer comprises SEQ ID NO.:
25. In a further aspect, the second forward primer comprises a
sequence complementary to a sequence in the hTERT, the second
reverse primer comprises a sequence complementary to a sequence in
the hTERT gene, and the second forward primer and second reverse
primer yield the second amplicon. In an even further aspect, the
third forward primer comprises a sequence complementary to a
sequence in ACTB, the third reverse primer comprises a sequence
complementary to a sequence in ACTB, and the third forward primer
and third reverse primer yield the third amplicon.
[0114] In various aspects, the third target nucleic acid is located
within a human gene.
[0115] In a further aspect, the first detection label, second
detection label, and third detection label are detectable
individually and simultaneously. In a still further aspect, the
first detection label, second detection label, and third detection
label are detectable individually and simultaneously, and each of
the first detection label, second detection label, and third
detection label independently comprise fluorogenic moieties.
[0116] In a further aspect, the first detection label, second
detection label, third detection label, and fourth detection label
are detectable individually and simultaneously. In a still further
aspect, the first detection label, second detection label, third
detection label, and fourth detection label are detectable
individually and simultaneously, and each of the first detection
label, second detection label, fourth detection label, and fourth
detection label independently comprise fluorogenic moieties.
[0117] In a further aspect, the first detection label, second
detection label, third detection label, fourth detection label, and
fifth detection label are detectable individually and
simultaneously. In a still further aspect, the first detection
label, second detection label, third detection label, fourth
detection label, and fifth detection label are detectable
individually and simultaneously, and each of the first detection
label, second detection label, fourth detection label, fourth
detection label, and fifth detection label independently comprise
fluorogenic moieties.
[0118] For example, the methods described herein can use
fluorescent dyes that preferentially bind to double stranded
nucleic acid amplification products during the PCR reaction,
thereby providing continuous monitoring of product synthesis (see
Higuchi, R. et al., Biotechnology 11: 1026-1030 (1993); Morrison,
T. B. et al., Biotechniques 24: 954-962 (1998)).
[0119] In a further aspect, the first detection label further
comprises a DNA binding dye. In a still further aspect, the
fluorogenic DNA-binding dye is
2-methyl-4,6-bis(4-N,N-dimethylaminophenyl)pyrylium iodide,
N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-p-
henylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine,
2-((2-(diethylamino)-1-phenyl-1,8a-dihydroquinolin-4-yl)methyl)-3-methylb-
enzo[d]thiazol-3-ium iodide,
(Z)-4-((3',6-dimethyl-[2,6'-bibenzo[d]thiazol]-2'(3'H)-ylidene)methyl-1-m-
ethylpyridin-1-ium iodide, or
(Z)-4-((6-(benzo[d]oxazol-2-yl)-3-methylbenzo[d]thiazol-2(3H)-ylidene)met-
hyl)-1-methylquinolin-1-ium iodide.
[0120] In a further aspect, the second detection label further
comprises an oligonucleotide, a fluorogenic moiety, and a
fluorogenic quenching moiety. In a still further aspect, the second
detection label further comprises an oligonucleotide, a fluorogenic
moiety linked to the 5' end of the oligonucleotide, and a
fluorogenic quenching moiety at the 3' end of the oligonucleotide
probe. In a yet further aspect, the second detection label further
comprises an oligonucleotide comprising the sequence of SEQ ID NO.:
5. In an even further aspect, the second detection label further
comprises an oligonucleotide comprising the sequence of SEQ ID NO.:
8. In a yet further aspect, the second detection label further
comprises an oligonucleotide comprising the sequence of SEQ ID NO.:
11. In an even further aspect, the second detection label further
comprises a fluorogenic moiety, and the fluorogenic moiety
comprises a cyanine dye. In a still further aspect, the cyanine dye
is Cy5. In a yet further aspect, the fluorogenic quenching moiety
is a dark quencher.
[0121] Examples of additional suitable fluorescent labels include,
but are not limited to, SYBR Green I (Invitrogen), fluorescein
isothiocyanate (FITC), 5,6-carboxymethyl fluorescein, Texas red,
nitrobenz-2-oxa-1,3-diazol-4-yl (NBD), coumarin, dansyl chloride,
rhodamine, amino-methyl coumarin (AMCA), Eosin, Erythrosin,
BODIPY.RTM., Cascade Blue.RTM., Oregon Green.RTM., pyrene,
lissamine, xanthenes, acridines, oxazines, phycoerythrin,
macrocyclic chelates of lanthanide ions such as quantum Dye.TM.,
fluorescent energy transfer dyes, such as thiazole orange-ethidium
heterodimer, and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7.
Examples of other specific fluorescent labels include
3-Hydroxypyrene 5,8,10-Tri Sulfonic acid, 5-Hydroxy Tryptamine
(5-HT), Acid Fuchsin, Alizarin Complexon, Alizarin Red,
Allophycocyanin, Aminocoumarin, Anthroyl Stearate, Astrazon
Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B, Astrazon
Yellow 7 GLL, Atabrine, Auramine, Aurophosphine, Aurophosphine G,
BAO 9 (Bisaminophenyloxadiazole), BCECF, Berberine Sulphate,
Bisbenzamide, Blancophor FFG Solution, Blancophor SV, Bodipy F1,
Brilliant Sulphoflavin FF, Calcien Blue, Calcium Green, Calcofluor
RW Solution, Calcofluor White, Calcophor White ABT Solution,
Calcophor White Standard Solution, Carbostyryl, Cascade Yellow,
Catecholamine, Chinacrine, Coriphosphine O, Coumarin-Phalloidin,
CY3.1 8, CY5.1 8, CY7. Dans (1-Dimethyl Amino Naphaline 5 Sulphonic
Acid), Dansa (Diamino Naphtyl Sulphonic Acid), Dansyl NH--CH3,
Diamino Phenyl Oxydiazole (DAO), Dimethylamino-5-Sulphonic acid,
Dipyrrometheneboron Difluoride, Diphenyl Brilliant Flavine 7GFF,
Dopamine, Erythrosin ITC, Euchrysin, FIF (Formaldehyde Induced
Fluorescence), Flazo Orange, Fluo 3, Fluorescamine, Fura-2,
Genacryl Brilliant Red B, Genacryl Brilliant Yellow 10GF, Genacryl
Pink 30G, Genacryl Yellow 5GF, Gloxalic Acid, Granular Blue,
Haematoporphyrin, Indo-1, Intrawhite Cf Liquid, Leucophor PAF,
Leucophor SF, Leucophor WS. Lissamine Rhodamine B200 (RD200).
Lucifer Yellow CH, Lucifer Yellow VS, Magdala Red, Marina Blue,
Maxilon Brilliant Flavin 10 GFF, Maxilon Brilliant Flavin 8 GFF,
MPS (Methyl Green Pyronine Stilbene), Mithramycin, NBD Amine,
Nitrobenzoxadidole, Noradrenaline, Nuclear Fast Red, Nuclear
Yellow, Nylosan Brilliant Flavin E8G, Oxadiazole, Pacific Blue,
Pararosaniline (Feulgen), Phorwite AR Solution, Phorwite BKL,
Phorwite Rev, Phorwite RPA, Phosphine 3R, Phthalocyanine,
Phycoerythrin R, Polyazaindacene Pontochrome Blue Black, Porphyrin,
Primuline, Procion Yellow, Pyronine, Pyronine B, Pyrozal Brilliant
Flavin 7GF, Quinacrine Mustard, Rhodamine 123, Rhodamine 5 GLD,
Rhodamine 60, Rhodamine B, Rhodamine B 200, Rhodamine B Extra,
Rhodamine BB, Rhodamine BG, Rhodamine WT, Serotonin, Sevron
Brilliant Red 2B, Sevron Brilliant Red 4G, Sevron Brilliant Red B,
Sevron Orange, Sevron Yellow L, SITS (Primuline), SITS (Stilbene
Isothiosulphonic acid), Stilbene, Snarf 1, sulpho Rhodamine B Can
C, Sulpho Rhodamine G Extra, Tetracycline. Thiazine Red R,
Thioflavin S, Thioflavin TCN, Thioflavin 5, Thiolyte, Thiozol
Orange, Tinopol CBS, True Blue, Ultralite, Uranine B, Uvitex SFC,
Xylene Orange, and XRITC. Fluorescent labels can be obtained from a
variety of commercial sources, including Invitrogen, Carlsbad,
Calif.; Amersham Pharmacia Biotech, Piscataway, N.J.; Molecular
Probes. Eugene, Oreg.; and Research Organics, Cleveland, Ohio.
[0122] In a further aspect, the third detection label further
comprises an oligonucleotide, a fluorogenic moiety, and a
fluorogenic quenching moiety. In a still further aspect, the third
detection label further comprises an oligonucleotide, a fluorogenic
moiety linked to the 5' end of the oligonucleotide, and a
fluorogenic quenching moiety 3' end of the oligonucleotide probe.
In a yet further aspect, the third detection label further
comprises an oligonucleotide comprising the sequence of SEQ ID NO.:
8. In a still further aspect, the third detection label further
comprises an oligonucleotide comprising the sequence of SEQ ID NO.:
11. In an even further aspect, the fluorogenic moiety comprises a
VIC. In a yet further aspect, the fluorogenic quenching moiety is a
dark quencher. In an even further aspect, the fluorogenic quenching
moiety is a dark quencher, and the dark quencher is TAMRA.
[0123] In a further aspect, the fourth detection label further
comprises an oligonucleotide, a fluorogenic moiety, and a
fluorogenic quenching moiety. In a still further aspect, the fourth
detection label further comprises an oligonucleotide, a fluorogenic
moiety linked to the 5' end of the oligonucleotide, and a
fluorogenic quenching moiety 3' end of the oligonucleotide
probe.
[0124] In a further aspect, the fifth detection label further
comprises an oligonucleotide, a fluorogenic moiety, and a
fluorogenic quenching moiety. In a still further aspect, the fifth
detection label further comprises an oligonucleotide, a fluorogenic
moiety linked to the 5' end of the oligonucleotide, and a
fluorogenic quenching moiety 3' end of the oligonucleotide
probe.
[0125] In a further aspect, the second amplicon is at greater than
or equal to about 50 bp in length. In a still further aspect, the
second amplicon is at less than or equal to about 250 bp in length.
In a yet further aspect, the second amplicon is from about 50 to
about 60 bp in length. In an even further aspect, the second
amplicon is from about 50 to about 70 bp in length. In a still
further aspect, the second amplicon is from about 50 to about 80 bp
in length. In a yet further aspect, the second amplicon is from
about 50 to about 90 bp in length. In an even further aspect, the
second amplicon is from about 50 to about 100 bp in length. In a
still further aspect, the second amplicon is from about 50 to about
125 bp in length. In a yet further aspect, the second amplicon is
from about 50 to about 150 bp in length. In an even further aspect,
the second amplicon is from about 50 to about 175 bp in length. In
a still further aspect, the second amplicon is from about 50 to
about 200 bp in length. In a yet further aspect, the second
amplicon is from about 50 to about 250 bp in length.
[0126] In a further aspect, the third amplicon is at greater than
or equal to about 50 bp in length. In a still further aspect, the
third amplicon is at less than or equal to about 250 bp in length.
In a yet further aspect, the third amplicon is from about 50 to
about 60 bp in length. In an even further aspect, the third
amplicon is from about 50 to about 70 bp in length. In a still
further aspect, the third amplicon is from about 50 to about 80 bp
in length. In a yet further aspect, the third amplicon is from
about 50 to about 90 bp in length. In an even further aspect, the
third amplicon is from about 50 to about 100 bp in length. In a
still further aspect, the third amplicon is from about 50 to about
125 bp in length. In a yet further aspect, the third amplicon is
from about 50 to about 150 bp in length. In an even further aspect,
the third amplicon is from about 50 to about 175 bp in length. In a
still further aspect, the third amplicon is from about 50 to about
200 bp in length. In a yet further aspect, the third amplicon is
from about 50 to about 250 bp in length,
[0127] In various aspects, the concentration of first second, and
third amplicon are determined by comparison to a control target
DNA.
[0128] In a further aspect, the concentration of first, second, and
third amplicon are determined by comparison to a control target
DNA, wherein the control target DNA is a control synthetic target
DNA. In a still further aspect, the control synthetic target DNA
comprises (TTAGGG).sub.m, wherein m is an integer from 15 to 34. In
a yet further aspect, the control synthetic target DNA comprises
(CCCTAA).sub.m, wherein m is an integer from 15 to 34. In an even
further aspect, the control synthetic target DNA is SEQ ID NO.:
12.
[0129] In a further aspect, the control synthetic target DNA is at
least 90 base pairs in length. In a still further aspect, the
control synthetic target DNA is at least 100 base pairs in length.
In a yet further aspect, the control synthetic target DNA is at
least 110 base pairs in length. In an even further aspect, the
control synthetic target DNA is at least 120 base pairs in length.
In a still further aspect, the control synthetic target DNA is at
least 130 base pairs in length. In a yet further aspect, the
control synthetic target DNA is at least 140 base pairs in length.
In an even further aspect, the control synthetic target DNA is at
least 150 base pairs in length. In a still further aspect, the
control synthetic target DNA is at least 160 base pairs in length.
In a yet further aspect, the control synthetic target DNA is at
least 170 base pairs in length. In an even further aspect, the
control synthetic target DNA is at least 180 base pairs in
length.
[0130] In a further aspect, the control synthetic target DNA is
from about 90 base pairs to about 200 base pairs in length. In a
yet further aspect, the control synthetic target DNA is SEQ ID NO.:
12. In a still further aspect, the control synthetic target DNA is
from about 100 base pairs to about 200 base pairs in length. In a
yet further aspect, the control synthetic target DNA is from about
110 base pairs to about 200 base pairs in length. In an even
further aspect, the control synthetic target DNA is from about 120
base pairs to about 200 base pairs in length. In a still further
aspect, the control synthetic target DNA is from about 130 base
pairs to about 200 base pairs in length. In a yet further aspect,
the control synthetic target DNA is from about 140 base pairs to
about 200 base pairs in length. In an even further aspect, the
control synthetic target DNA is from about 150 base pairs to about
200 base pairs in length. In an even further aspect, the control
synthetic target DNA is from about 175 base pairs to about 200 base
pairs in length.
[0131] In an even further aspect, the control synthetic target DNA
is from about 90 base pairs to about 150 base pairs in length. In a
still further aspect, the control synthetic target DNA is from
about 90 base pairs to about 125 base pairs in length. In a yet
further aspect, the control synthetic target DNA is from about 90
base pairs to about 110 base pairs in length. In an even further
aspect, the control synthetic target DNA is from about 90 base
pairs to about 175 base pair in length.
[0132] In a further aspect, the concentration of first, second, and
third amplicon are determined by comparison to a control target
DNA, wherein is human genomic DNA. In a yet further aspect, the
human genomic DNA comprises DNA obtained from male or female
donors. In an even further aspect, the human genomic DNA is a
mosaic composition of male and female donors together, or a mosaic
composition of male only or female only donors.
[0133] Amplification reactions are carried out according to
procedures well known in the art. Procedures for PCR are widely
used and described (see for example, U.S. Pat. Nos. 4,683,195 and
4,683,202). In brief, a double stranded target nucleic acid is
denatured, generally by incubating at a temperature high enough to
denature the strands, and then incubated in the presence of excess
primers, which hybridize (anneal) to the single-stranded target
nucleic acids. A DNA polymerase extends the hybridized primer,
generating a new copy of the target nucleic acid. The resulting
duplex is denatured and the hybridization and extension steps are
repeated. By reiterating the steps of denaturation, annealing, and
extension in the presence of a second primer for the complementary
target strand, the target nucleic acid encompassed by the two
primers is exponentially amplified. The time and temperature of the
primer extension step will depend on the polymerase, length and
sequence composition of the target nucleic acid being amplified,
and primer sequence employed for the amplification. The number of
reiterative steps required to sufficiently amplify the target
nucleic acid will depend on the efficiency of the amplification.
One skilled in the art will understand that the present disclosure
is not limited by variations in times, temperatures, buffer
conditions, and amplification cycles applied in the amplification
process.
[0134] A denaturation step is typically the first step in the
repeating cycle of the PCR and consists of heating the reaction to
a denaturation temperature of 90-98.degree. C., e.g. 91, 92, 93,
94, 95, 96, 97, or 98.degree. C. for 1-35 seconds, preferably 15
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, or 35 seconds. The denaturation step melts the DNA template
by disrupting the hydrogen bonds between complementary bases,
yielding single strands of DNA.
[0135] An annealing step is typically the second step in the
repeating cycle of the PCR and consists of lowering the temperature
to an annealing temperature of 45, 46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or
70.degree. C. for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 seconds
allowing annealing of the primers in a primer set to hybridize with
a target nucleic acid. The annealing temperature can be about 0, 1,
2, 3, 4, 5, 6, 7, 8, 9, or 10 or up to 15.degree. C. below the
melting temperature of the duplex Tm for the primers used. Stable
DNA-DNA hydrogen bonds are formed when the primer sequence very
closely matches or is identical at the 3' end of the primer to a
portion of the complement to the template sequence. The polymerase
binds to the primer-template hybrid and begins DNA synthesis.
[0136] The extension/elongation step is the step where the nucleic
acid polymerase synthesizes a new nucleic acid strand complementary
to the target nucleic acid strand by adding dNTPs that are
complementary to the target nucleic acid in 5' to 3' direction,
condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxyl
group at the end of the nascent (extending) target nucleic acid
strand. The extension time depends both on the nucleic acid
polymerase used and on the length of the target nucleic acid to be
amplified. As a rule-of-thumb, at its optimum temperature, the
nucleic acid polymerase will polymerize up to a thousand bases per
minute. Under optimum conditions, i.e., if there are no limitations
due to limiting substrates or reagents, at each extension step, the
amount of target nucleic acid is doubled, leading to exponential
(geometric) amplification of the specific target nucleic acid. The
elongation temperature at this step depends on the nucleic acid
polymerase used. For example; Taq polymerase has its optimum
activity temperature at 75-80.degree. C., and commonly a
temperature of 72.degree. C. is used with this enzyme
[0137] PCR can also comprise a final elongation step. The final
elongation can be performed at a final elongation temperature of
68, 69, 70, 71, 72, 73, 74 or 75.degree. C. for 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, or 15 minutes after the last PCR,
cycle to ensure that any remaining single-stranded DNA is fully
copied to make a double-stranded DNA product.
[0138] PCR can also comprise a signal acquisition step wherein the
amount of a detection label can be determined. The signal
acquisition step can be carried out during the amplification of the
target sequence. In some aspects the signal acquisition step
follows a denaturation step, an annealing step and an elongation
steps. The signal acquisition step is carried out at a signal
acquisition temperature. The signal acquisition temperature can be
any temperature and can be carried out at one or more times during
PCR. When the copy number of two or more target nucleic acids are
being determined as described herein, the signal acquisition
temperature should be different for detection of the detection
label of each amplicon. For example, the temperatures for the two
or more signal acquisition temperature should be selected such that
the first signal acquisition temperature is below the Tm of the
first amplicon and the second signal acquisition temperature is
above said first Tm and below the Tm of the second amplicon. The
difference between the two or more signal acquisition temperatures
can be 3, 4, 5, 6, 7, 8, 9, or 10.degree. C. A Signal Acquisition
Step can be carried out for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, or 15 seconds at the acquisition temperature.
[0139] PCR can also comprise a final hold step. The final hold step
can be at a final hold temperature of about 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, or 15.degree. C. for an indefinite time. The final
hold step can be employed for short-term storage of the
reaction.
[0140] The polymerase chain reaction can also comprise consecutive
stages of cycles. Each consecutive stage of cycles can comprise one
or more of the PCR steps described above. Each consecutive stage of
cycles can also be referred to a "cycle" of the PCR. Each
consecutive stage of cycles can be carried out under the same or
different temperatures for each cycle of the PCR. A PCR can be run
where the annealing temperature is changed for one or more of the
cycles of PCR. For example, the PCR can be run for a total of 40
cycles, wherein the annealing temperature is the same for a first
stage of cycles, then the annealing temperature is raised for a
second stage of cycles and the annealing temperature is lowered for
the third stage of cycles.
[0141] The methods described herein allow for the quantitation of
multiple amplicons in one or more amplification cycle by a discrete
signal for each amplicon, i.e., multiplex signal detection. In
various aspects, collecting signals from multiple amplicons in each
cycle consists of using multiple fluorophores which are detected at
different wave-lengths by the optical system of the PCR instrument.
In a further aspects, the disclosed methods utilize a
double-stranded DNA binding or intercalating dye, e.g., ethidium
bromide, SYBR.RTM. Green, or EvaGreen.RTM. dye, and probes for the
second and third amplicons (and fourth, fifth, etc., if more than
three amplicons are to be amplified). The probes are
oligonucleotides with a reporter dye covalently linked to one
terminus of the oligonucleotide, and a quencher dye covalently
linked to the other terminus of the oligonucleotide. In various
aspects, the probe is an oligonucleotide with a reporter dye
attached to the 5' end and a quencher dye attached to the 3' end.
In a further aspect, all amplicons in the reaction can generate a
signal with the DNA binding or intercalating dye, therefore the
first amplicon should reach cycle threshold at least five
amplification cycles before the second and third (and fourth,
fifth, etc., if more than three amplicons are to be amplified)
amplicons reach cycle threshold.
[0142] The methods described herein can also be carried out using
other approaches for the quantitation of multiple amplicons in each
amplification cycle by a discrete signal for each amplicon. In a
further aspect, a third primer for each amplicon can be linked to a
quenching dye, and the quenching agent is cleaved by the polymerase
in the reaction during the extension reaction (i.e., a q-PCR
probe). In a still further aspect, a fluorophore can be linked to
an oligo that hybridizes to the amplicon and is not quenched when
hybridized to the DNA strand (i.e., a molecular beacon), and a
different molecular beacon can be used for each amplicon. In a yet
further aspect, the polymerase chain reaction can comprise a DNA
binding or intercalating fluorescent dyes. The signal for DNA
binding or intercalating dye is collected at the end of the
extension cycle when all amplicons are double-stranded.
[0143] In various aspects, the methods described herein present a
strategy that allows the signals from multiple amplicons to be
collected separately. In a further aspect, the cycle thresholds
(Cts) for the first amplicon are collected at earlier cycles, when
the signal from the second and third amplicons are still at
baseline. The Cts for the second and third amplicons (and fourth,
fifth, etc. amplicons if more than three amplicons are amplified
together) are collected at a temperature well above the melting
temperature (Tm) of the first amplicon, rendering the first
amplicon single-stranded and sending its signal to baseline.
Primers are designed to make both amplicons small, and the second
and third amplicons can be GC-rich, raising its Tm. Pairs of
templates that occur in biological samples as high and low
abundance species with no overlap in copy number ranges are natural
targets for such an approach
[0144] The products of the amplification are detected and analyzed
by methods well known in the art. Amplified products may be
analyzed following separation and/or purification of the products,
or by direct measurement of product formed in the amplification
reaction. For detection, the product may be identified indirectly
with fluorescent compounds, e.g. ethidium bromide, SYBR.RTM. Green,
or EvaGreen.RTM., or by hybridization with labeled nucleic acid
probes. Alternatively, labeled primers or labeled nucleotides are
used in the amplification reaction to label the amplification
product. The label comprises any detectable moiety, including
fluorescent labels, radioactive labels, electronic labels, and
indirect labels such as biotin or digoxigenin.
[0145] Instrumentation suitable for conducting the qPCR reactions
of the present disclosure are available from a number of commercial
sources (ABI Prism 7700, Applied Biosystems, Carlsbad, Calif.;
LIGHTCYCLER 480, Roche Applied Science, Indianapolis, Ind.; Eco
Real-Time PCR System, Illumina, Inc., San Diego, Calif.; RoboCycler
40, Stratagene, Cedar Creek, Tex.).
[0146] When real time quantitative PCR is used to detect and
measure the amplification products, various algorithms are used to
calculate the number of target telomeres in the samples. (For
example, see ABI Prism 7700 Software Version 1.7; Lightcycler
Software Version 3). Quantitation may involve use of standard
samples with known copy number of the telomere nucleic acids and
generation of standard curves from the logarithms of the standards
and the cycle of threshold (C,). In general, C, is the PCR cycle or
fractional PCR cycle where the fluorescence generated by the
amplification product is several deviations above the baseline
fluorescence.
[0147] 2. Target Samples
[0148] Target samples can be derived from any source that has, or
is suspected of having, target molecules. Target samples can
contain, for example, a target molecule(s) such as nucleic acids. A
target sample can be the source of target nucleic acids. A target
sample can include natural target nucleic acids, chemically
synthesized target nucleic acids, or both. A target sample can be,
for example, a sample from one or more cells, tissue, or bodily
fluids such as blood, urine, semen, lymphatic fluid, cerebrospinal
fluid, or amniotic fluid, or other biological samples, such as
tissue culture cells, buccal swabs, mouthwash, stool, tissues
slices, biopsy aspiration, and archeological samples such as bone
or mummified tissue. Types of useful target samples include blood
samples, urine samples, semen samples, lymphatic fluid samples,
cerebrospinal fluid samples, amniotic fluid samples, biopsy
samples, needle aspiration biopsy samples, cancer samples, tumor
samples, tissue samples, cell samples, cell lysate samples, crude
cell lysate samples, forensic samples, archeological samples,
infection samples, nosocomial infection samples, production
samples, drug preparation samples, biological molecule production
samples, protein preparation samples, lipid preparation samples,
and/or carbohydrate preparation samples.
[0149] 3. Target Nucleic Acids
[0150] Nucleic acid samples can be derived from any source that
has, or is suspected of having, target nucleic acids. A nucleic
acid sample is the source of nucleic acid molecules and nucleic
acid sequences such as target nucleic acids. The nucleic acid
sample can contain RNA or DNA or both. The target nucleic acid can
also be cDNA. In addition, mRNA can be reverse transcribed to form
cDNA which can then serve as a target nucleic acid for use in the
methods described herein. For example, chromosomal DNA in its
native, double-stranded state, can be obtained from a target sample
as described herein above. The chromosomal DNA can be obtained
using any DNA purification method which yields high molecular
weight genomic DNA (greater than 20 kb) including phenol/chloroform
extraction, cesium chloride gradient, and commercial kits that use
silicone membrane binding technology, selective detergent-mediated
DNA precipitation method. Examples of DNA purification commercial
kits include Agencourt DNAdvance and Agencourt Genfind (Beckman
Coulter), QIAamp kit (QIAGEN, Valencia, Calif.), QlAamp blood kit
(QIAGEN), QIAamp FFPE tissue kit QIAGEN), AHPrep kit (QIAGEN),
Puregene kit (QIAGEN), PureLink and GeneCatcher (Invitrogen) and
Wizard (Promega).
[0151] ) A "target nucleic acid" or "target sequence" is meant a
nucleic acid sequence on a double or single stranded nucleic acid.
By "nucleic acid" or "oligonucleotide" or grammatical equivalents
herein is meant at least two nucleotides covalently linked
together. A nucleic acid of the present invention will generally
contain phosphodiester bonds, although in some cases, nucleic acid
analogs are included that may have alternate backbones, comprising
for example, phosphoramide (Beaucage, S. L. et at, Tetrahedron 49:
1925-63 (1993), and references therein; Letsinger, R. L et al., J.
Org. Chem. 35: 3800-03 (1970); Sprinzl, M. et al., Eur. J. Biochem.
81: 579-89 (1977); Letsinger, R. L. et al., Nucleic Acids Res.
14:3487-99 (1986); Sawai et al, Chem. Lett. 805 (1984); Letsinger,
R. L. et al., J. Am. Chem. Soc. 110: 4470 (1988); and Pauwels et
al., Chemica Scripta 26:141-49 (1986)), phosphorothioate (Mag, M.
et al., Nucleic Acids Res. 19:1437-41 (1991); and U.S. Pat. No.
5,644,048), phosphorodithioate (Briu et al., J. Am. Chem. Soc.
111:2321 (1989)), O-methylpphphoroamidite linkages (see Eckstein,
Oligonucleotides and Analogues: A Practical Approach. Oxford
University Press, 1991), and peptide nucleic acid backbones and
linkages (Egholm. M., Am. Chem. Soc. 114:1895-97 (1992); Meier et
al., Chem. Int. Ed. Engl. 31:1008 (1992); Egholm, M., Nature 365:
566-68 (1993); Carlsson, C. et al., Nature 380: 207 (1996), all of
which are incorporated by reference). Other analog nucleic acids
include those with positive backbones (Dempcy, R. O. et al., Proc.
Natl. Acad. Sci. USA 92:6097-101 (1995)); non-ionic backbones (U.S.
Pat. Nos. 5,386,023; 5,637,684; 5,602,240; 5,216,141; and
4,469,863; Kiedrowshi et at, Angew. Chem. Intl. Ed. English 30:423
(1991); Letsinger, R. L. et al., J. Am. Chem. Soc. 110: 4470
(1988); Letsinger, R. L. et al., Nucleoside & Nucleotide 13:
1597 (1994): Chapters 2 and 3, ASC Symposium Series 580,
"Carbohydrate Modifications in Antisense Research", Ed. Y. S.
Sanghui and P. Dan Cook; Mesmaeker et al., Bioorganic &
Medicinal Chem. Lett, 4: 395 (1994); Jeffs et al., J. Biomolecular
NMR 34:17 (1994)) and non-ribose backbones, including those
described in U.S. Pat. Nos. 5,235,033 and 5,034,506, and Chapters 6
and 7, ASC Symposium Series 580, "Carbohydrate Modifications in
Antisense Research", Ed. Y. S. Sanghui and P. Dan Cook. Nucleic
acids containing one or more carbocyclic sugars are also included
within the definition of nucleic acids (see Jenkins et al., Chem.
Soc. Rev. 169-176 (1995)); all references are hereby expressly
incorporated by reference.
[0152] Any nucleic acid sequence sought to be measured, identified,
detected or whose copy number is sought to be determined can serve
as a target nucleic acid sequence. In the methods described herein,
there can be more than one target nucleic acid sequence. In the
event that two target nucleic acid sequences are present, they will
be referred to as a first and second target nucleic acid sequence,
respectfully. In the event that three target nucleic acid sequences
are present, they will be referred to as a first, a second and a
third target nucleic acid sequence, respectfully and so on. The
target nucleic acids described in the methods herein can have the
same, similar or different copy numbers. For example, the first
target nucleic acid is a nucleic acid sequence of multiple copy
numbers and the second target nucleic acid is a single copy gene.
For example, the first target nucleic acid can be telomeric repeat
sequences, mtDNA, rDNA or Alu repeat DNA. For example, the first
target nucleic acid can be cDNA reverse-transcribed from a high
copy number mRNA, and the second target nucleic acid can be cDNA
reverse-transcribed from a low copy number mRNA.
[0153] Single copy genes are genes that have a single copy per
haploid genome. Single copy genes therefore have two copies per
cell. Single copy genes include, but are not limited to, the RNase
P gene, the .beta.2-microglobulin gene, the albumin gene, the
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene, the human
telomerase reverse transcriptase, .beta.-actin (ACTB) gene, and the
.beta.-globin gene.
[0154] Telomeres are specialized structures found at the ends of
linear chromosomes of eukaryotes. Telomeres are generally composed
of short tandem repeats, with a repeat sequence unit specified by
the telomerase enzyme particular to that organism. Telomere repeat
sequences are known for a variety of organisms. For vertebrates,
plants, certain types of molds, and some protozoans, the sequences
are perfect repeats. For example, in humans the sequence, TTAGGG
(SEQ ID NO.: 13), occurs as a sequence repeat unit, (TTAGGG)n,
where n can be in the range of 1-1000 or more. In other organisms,
the repeat sequences are irregular, such as those of Saccharomyces
cerevisiae where the sequence is variable G1-3T/C1-3A. In some
eukaryotic organisms, telomeres lack the short tandem sequence
repeats but have sequence elements that function as telomeres. For
example, in the fruit fly Drosophila melanogaster, the telomere is
a composite of retrotransposon elements HeT-A and TART while in the
mosquito Anopheles gambiae the telomeres are arrays of complex
sequence tandem repeats. For the purposes of the present invention,
telomeres of different structures are encompassed within the scope
of the present invention.
[0155] In addition to the repeat sequences, the 3' end of some
telomeres contains a single stranded region, which for humans is
located on the G rich strand. The single strand is composed of
(TTAGOG)n repeats, with n being about 50, although it can be
significantly less than or more than 50. As used herein, the length
of the 3' single stranded region can also be correlated with
mortality or disease risk.
[0156] Typically, the DNA replicative machinery acts in the 5' to
3' direction, and synthesis of the lagging strand occurs
discontinuously by use of short RNA primers that are degraded
following strand synthesis. Since sequences at the 3' end of a
linear DNA are not available to complete synthesis of the region
previously occupied by the RNA primer, the terminal 3' region of
the linear chromosome is not replicated. This "end replication
problem" is solved by the action of telomerase, a telomere specific
ribonucleoprotein reverse transcriptase. The telomerase enzyme has
an integral RNA component that acts as a template for extending the
3' end of the telomere. Repeated extensions by telomerase activity
results in the generation of telomere repeats copied from the
telomerase-bound RNA template. Following elongation by telomerase,
lagging strand synthesis by DNA polymerase completes formation of
the double stranded telomeric structure.
[0157] In normal human somatic cells, telomerase is not expressed
or expressed at low levels. Consequently, telomeres shorten by
about 50-200 bp with each cell division until the cells reach
replicative senescence, at which point the cells lose the capacity
to proliferate. This limited capacity of cells to replicate is
generally referred to as the Hayflick limit, and may provide cells
with a counting mechanism, i.e., a mitotic clock, to count cell
divisions and regulate cellular development. Correspondingly,
activation of telomerase in cells lacking telomerase activity, for
example by expressing telomerase from a constitute retroviral
promoter or activation of endogenous polymerase, allows the cells
to maintain proliferative capacity and leads to immortalization of
the cell.
[0158] Interestingly, cells with very short telomeres often become
extended. This phenomenon suggests that the telomerase enzyme
protects short telomeres from further shortening while extending
those that have fallen below a certain threshold length. Thus,
presence of telomerase activity does not appear to be necessary
when telomeres are a certain length, but becomes critical to
maintenance of telomere integrity when the length falls below a
critical limit.
[0159] In the methods described herein, the abundance or average
length of a telomere may be determined for a single chromosome in a
cell. In an aspect, the average copy number of a telomere or mean
telomere copy number is measured for a single cell. In another
embodiment, the average copy number of a telomere or mean telomere
copy number is measured for a population of cells. A change in
telomere copy number is an increase or decrease in telomere copy
number, in particular an increase or decrease in the average
telomere copy number. The change may be relative to a particular
time point, i.e., telomere copy number of an organism at time, t1,
as compared to telomere length at some later time (t2). A change or
difference in telomere copy number may also be compared as against
the average or mean telomere copy number of a particular cell
population or organism population. In some aspects, a change or
difference in telomere copy number may also be compared as against
the average or mean telomere copy number of a population not
suffering from a disease condition. In certain embodiments, change
in telomere copy number is measured against a population existing
at different time periods.
[0160] Although, telomere copy number may be determined for all
eukaryotes, in a one aspect, telomere copy numbers are determined
for vertebrates, including without limitation, amphibians, birds,
and mammals, for example rodents, ungulates, and primates,
particularly humans. Telomere copy numbers can also be determined
for organisms in which longevity is a desirable trait or where
longevity and susceptibility to disease are correlated with
telomere length. In another aspect, the telomeres may be measured
for cloned organisms in order to assess the probability of short or
long term mortality risk, or disease susceptibility associated with
altered telomere integrity in these organisms.
[0161] Telomeric nucleic acid sequences, such as those described
above can serve as a target sequence. Telomeric nucleic acid
sequences, or any other repetitive or non-repetitive target nucleic
acid, may be any length, with the understanding that longer
sequences can be more specific. In some embodiments, it may be
desirable to fragment or cleave the sample nucleic acid into
fragments of 100-10,000 base pairs. In one aspect, fragments of
roughly 500 bp can be used. Fragmentation or cleavage may be done
in any number of ways well known to those skilled in the art,
including mechanical, chemical, and enzymatic methods. Thus, the
nucleic acids may be subjected to sonication, French press,
shearing, or treated with nucleases (e.g., DNase, restriction
enzymes, RNase etc.), or chemical cleavage agents (e.g.,
acid/piperidine, hydrazine/piperidine, iron-EDTA complexes,
1,10-phenanthroline-copper complexes, etc.). Fragmentation of DNA
may reduce secondary structure formation which may impede accurate
measurement of the target sequence length or abundance.
[0162] In various aspects, the disclosed methods further comprise
the step of obtaining a chromosomal DNA sample prior to contacting
the first, second, and third target nucleic acids with the first,
second, and third primer sets, respectively; and wherein the
chromosomal DNA sample contains or comprises at least portions of
the first, second, and third target nucleic acids. In a further
aspect, the chromosomal DNA is obtained from a solid, fluid,
semisolid or gaseous sample. In a still further aspect, the
chromosomal DNA is obtained from a liquid sample; and wherein the
liquid sample is from blood, saliva, urine, plasma, serum,
cerebrospinal fluid ("CSF") sputum, or bronchial lavage fluid. In a
yet further aspect, the liquid sample is from blood, serum, or
plasma. In an even further aspect, the chromosomal DNA is obtained
from a solid sample; and wherein the solid sample is from tissue
sample, in a still further aspect, the tissue sample is a tissue
biopsy. In a yet further aspect, the tissue biopsy is from lung,
muscle, or skin. In an even further aspect, the chromosomal DNA is
obtained from bone marrow. In a still further aspect, the
chromosomal DNA is obtained from a vertebrate. In a yet further
aspect, the vertebrate is a mammal. In an even further aspect, the
mammal is a primate. In a still further aspect, the primate is
human. In other aspects, the chromosomal DNA can be from
non-vertebrate animals, for example plants.
[0163] In various aspects, the disclosed methods further comprise
the step of obtaining a chromosomal DNA sample prior to contacting
the first, second, and third target nucleic acids with the first,
second, and third primer sets, respectively; and wherein the
chromosomal DNA sample comprises the first, second, and third
target nucleic acids.
[0164] In a further aspect, the disclosed methods further comprise
the step of obtaining a chromosomal DNA sample from blood, saliva,
urine, plasma, serum, cerebrospinal fluid ("CSF") sputum or
bronchial lavage fluid prior to contacting the first, second, and
third target nucleic acids with the first, second, and third primer
sets, respectively; and wherein the chromosomal DNA sample
comprises the first, second, and third target nucleic acids; and
wherein the chromosomal DNA is obtained.
[0165] In a further aspect, the disclosed methods further comprise
the step of obtaining a chromosomal DNA sample from one or more
cell types isolated from blood, saliva, urine, plasma, serum,
cerebrospinal fluid ("CSF") sputum or bronchial lavage fluid prior
to contacting the first, second, and third target nucleic acids
with the first, second, and third primer sets, respectively;
wherein the chromosomal DNA sample comprises the first, second, and
third target nucleic acids; and wherein the chromosomal DNA is
obtained; and wherein the cell types isolated comprise circulating
tumor cells, circulating stem cells, lymphocytes, granulocytes,
myeloid cells, neutrophils, monocytes, macrophages, and
leukocytes.
[0166] In a further aspect, the disclosed methods further comprise
the step of isolating a circulating DNA fragment sample from the
blood prior to contacting the first, second, and third target
nucleic acids with the first, second, and third primer sets,
respectively; and wherein the circulating DNA fragment sample
comprises the first, second, and third target nucleic acids;
[0167] The telomere products of the disclosed methods can be
generated from a single telomere, a single chromosome, a population
of chromosomes from a single cell or a population of chromosomes
from a plurality of cells.
[0168] 4. Polymerases
[0169] In the methods described herein, an amplification enzyme is
required. For example, following contacting the primers to the
target nucleic acids, the reaction can be treated with an
amplification enzyme. Amplification enzymes are generally
polymerases, such as DNA polymerases. A variety of suitable
polymerases are well known in the art, including, but not limited
to. Taq DNA polymerase, KlenTaq, Tfl polymerase, DynaZyme, etc.
Generally, all polymerases are applicable to the present invention.
In one aspect, polymerases are thermostable polymerases lacking 3'
to 5' exonuclease activity, or polymerases engineered to have
reduced or non-functional 3' to 5' exonuclease activities (e.g.,
Pfu(exo-), Vent(exo-), Pyra(exo-), etc.), since use of polymerases
with strong 3' to 5' exonuclease activity tends to remove the
mismatched 3' terminal nucleotides that are needed in some
applications to prevent or delay primer dimer amplifications, and
in other applications to carry out allele-specific amplifications.
Also applicable are mixtures of polymerases used to optimally
extend hybridized primers. In another aspect, polymerase enzymes
useful for the present invention are formulated to become active
only at temperatures suitable for amplification.
[0170] Presence of polymerase inhibiting antibodies, which become
inactivated at amplification temperatures, or sequestering the
enzymes in a form rendering it unavailable until amplification
temperatures are reached, are all suitable. These polymerase
formulations allow mixing all components in a single reaction
vessel while preventing priming of non-target nucleic acid
sequences.
[0171] n addition, those skilled in the art will appreciate that
various agents may be added to the reaction to increase
processivity of the polymerase, stabilize the polymerase from
inactivation, decrease non-specific hybridization of the primers,
or increase efficiency of replication. Such additives include, but
are not limited to, dimethyl sulfoxide, formamide, acetamide,
glycerol, polyethylene glycol, or proteinacious agents such as E.
coli. single stranded DNA binding protein, T4 gene 32 protein,
bovine serum albumin, gelatin, etc. In another aspect, the person
skilled in the art can use various nucleotide analogs for
amplification of particular types of sequences, for example GC rich
or repeating sequences. These analogs include, among others,
c7-dGTP, hydroxymethyl-dUTP, dITP, 7-deaza-dGTP, etc.
[0172] 5. Primers
[0173] In some aspects, a primer can be designed to block the
primer from priming extension of the target nucleic acid in all but
one configuration. For example, one of the primers in a primer set
can be designed to block the primer from priming the extension of
the target nucleic acid by creating a mismatched base at the 3' end
of the primer. By designing and utilizing such a primer, the primer
is still able to hybridize to its complementary sequence: however,
it will only prime DNA synthesis in a single confirmation, thus
giving predictability to the amplicon size and therefore
predictability to the Tm of the amplicon.
[0174] For example, disclosed herein are primers and primer sets,
wherein one primer of the first primer set comprises at least one
nucleotide adjacent to the 3' end of the primer, wherein said
nucleotide is mismatched against, not complementary to, the target
nucleic acid, but complementary to the 3' terminal nucleotide of
the other primer in the primer set.
[0175] Also disclosed herein are primers and primer sets, wherein
one primer of a primer set comprises at least one nucleotide
adjacent to the 3' end of the primer, wherein said nucleotide is
mismatched against, not complementary to, the target nucleic acid,
but complementary to the 3' terminal nucleotide of the other primer
in the primer set, wherein the extension product of the
mismatch-containing primer of the primer set can be hybridized by
the other primer in the primer set, allowing said other primer to
prime DNA synthesis along said extension product. In some aspects,
the methodology can be used to assess telomere length or abundance
on a particular strand of the duplex DNA (e.g., the "C" strand or
the "G" strand of the chromosome).
[0176] To ensure that a blocked primer will only prime in a single,
specific configuration, a primer set including the blocked primer
can be designed such that the primers of the primer set overlap
with perfect complementarity over the region of the mismatched base
present in the blocked primer. Such a design can be performed so as
to prevent primer dimer formation and to minimize the ability of
the two primers to prime each other. Such a design can be utilized
when the target nucleic acid sequence is a sequence comprising
multiple repeats such as the repeats found in a telomere (telomeric
sequence). An example of such a method is described elsewhere
herein, including the Examples below.
[0177] As described herein, the primers for direct amplification of
telomere repeats can comprise a first primer which hybridizes to a
first single strand of the target nucleic acid and a second primer
which hybridizes to a second single strand of the target nucleic
acid, where the first and second strands are substantially
complementary. The primers are capable of primer extension by
polymerase when hybridized to their respective strands. That is,
the primers hybridized to the target nucleic acid have their 3'
terminal nucleotide residues complementary to the nucleotide
residue on the target nucleic acid such that the primers are
extendable by polymerase. Selected primers are complementary to
repetitive units of the repetitive region. For example, at least
one nucleotide residue of at least one of the primers can be
altered to produce mismatches with a nucleotide residue of at least
one repetitive unit to which the primer hybridizes, wherein the
altered nucleotide residue also produces a mismatch with the 3'
terminal nucleotide residue of the other primer when the primers
hybridize to each other. The inclusion of a mismatch prevents or
limits primer extension and primer-primer hybrids (primer
dimers).
[0178] A primer set for direct amplification of telomere repeats
can comprise a primer set wherein at least one nucleotide residue
of the first primer is altered to produce a mismatch between the
altered residue and a nucleotide residue of at least one repetitive
unit of the first strand to which the primer hybridizes, wherein
the altered nucleotide residue also produces a mismatch with the 3'
terminal nucleotide residue of the second primer when the first and
second primers hybridize to each other. The altered nucleotide
residue can be one or more nucleotide residues from the 3' terminal
nucleotide to allow efficient extension by polymerase when the
altered primer hybridizes to target nucleic acids. For example, the
altered nucleotide residue can be at least 1 nucleotide residue, at
least 2 nucleotide residues, or at least 3 nucleotide residues from
the 3' terminal nucleotide to allow efficient extension by
polymerase when the altered primer hybridizes to target nucleic
acids.
[0179] As discussed elsewhere herein, the primers of the primer
sets can be designed to have similar melting temperatures ("Tms")
to limit generation of undesirable amplification products and to
permit amplification and detection of several target nucleic acids
in a single reaction volume. In addition, since the telomeres of
various organisms have differing repetitive unit sequences,
amplifying telomeres of a specific organism will employ primers
specific to the repetitive unit of each different organism. Human
telomeric sequences are used herein to illustrate practice of the
present invention for direct amplification and quantitation of
tandemly repeated nucleic acid sequences, but the invention is not
limited to the disclosed specific embodiment.
[0180] Also disclosed are primers to increase the melting
temperature (Tm) of the resultant amplicon above that of the other
amplicon of the methods described herein. These primers can be
referred to as primers comprising a "GC-clamp". "GC-clamps"
typically refers to the presence of G or C bases within the last
five bases from the 3' end of primers that helps promote specific
binding at the 3' end due to the stronger bonding of G and C bases.
Typically, more than 3 G's or C's should be avoided in the last 5
bases at the 3' end of the primer. However, in the methods
described herein primers comprising a "GC-clamp" are primers that
comprise a 5' tag sequence (GC-clamp) that confers a higher melting
temperature on the resulting PCR product (amplicon) than the
melting temperature without the GC-clamp. The 5' tag sequence of
primers comprising a "GC-clamp" comprise a GC-clamp on the 5' end
of the primer sequence that is not complementary to any part of the
target nucleic acid sequence. A "GC-clamp" is a series of G and C
nucleotides that can be linked to the 5' end of a primer in order
to increase the melting temperature of the amplicon. A GC-clamp can
be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides
long. A GC-clamp can also be referred to a GC-rich region or
GC-rich tag.
[0181] GC-clamps can be used in the methods described herein to
increase the Tm of one of the amplicons. By increasing the Tm of
the amplicon, a fluorescent signal can be acquired at a temperature
high enough to completely melt the other amplicon. thus allowing
for the acquisition of a fluorescent signal for two or more
different amplicons at two or more different temperatures.
GC-clamped primers can be designed for use in the same
amplification reaction such that the GC-clamps on different primers
are different from one another so as to prevent hairpin formation
or primer dimers that could result in a cessation of the
amplification reaction.
[0182] Since primers hybridized to target nucleic acids must be
capable of primer extension, alterations of the first and second
primers must be on non-complementary nucleotides of the repetitive
unit. Thus, in one aspect, when both the first and second primers
comprise altered residues, the alterations are at nucleotide
positions adjacent to the repetitive unit. In another aspect, the
alterations are situated on nucleotide positions non-adjacent to
the repetitive unit. In general, mismatches at adjacent nucleotide
positions provide for the greatest number of base paired or
complementary residues between the altered nucleotide and the 3'
terminal nucleotide, which may be important for efficiently
amplifying short repetitive sequences (i.e., 3-6 bp repeat).
[0183] Primers can be designed to be substantially complementary to
the repeats. In some aspects, the first primer can contain three
repeats complementary to the repetitive target sequence and
multiple mismatches can be accordingly introduced into the first
primer. In a further aspect, the second primer is can also be
designed to contain mismatches with respect to the repeat sequence,
but it is designed such that there no mismatches to the first
several nucleotides (e.g., 5-7 nucleotides) of the first primer.
Thus, an amplicon of defined length can be amplified using the
above-described first and second primers. Accordingly, the amplicon
produced will be the sum of the length of primer 1 plus primer 2
minus the overlap between the 2 primers. This strategy eliminates
the multiple amplicon lengths that were generated in the original
design (Cawthon R. M. (2002). Nucleic Acids Res. 30, e47. doi:
10.1093/nar/30.10.e47),
[0184] Complementarity of the primers to the target nucleic acid
need not be perfect. In various aspects, non-perfect complementary
sequence can be used to avoid primer-dimers. Thus, by
"complementary" or "substantially complementary" herein is meant
that the probes are sufficiently complementary to the target
sequences to hybridize under normal reaction conditions but not
generate false-positive signals such as primer dimers. Deviations
from perfect complementary are permissible so long as deviations
are not sufficient to completely preclude hybridization. However,
if the number of alterations or mutations is sufficient such that
no hybridization can occur under the least stringent of
hybridization conditions, as defined below, the sequence is not a
complementary target sequence.
[0185] Although primers are generally single stranded, the nucleic
acids as described herein may be single stranded or double
stranded, as specified, or contain portions of both double stranded
or single stranded sequence. The nucleic acid may be DNA, RNA, or
hybrid, where the nucleic acid contains any combination of
deoxyribo- and ribonucleotides, and any combination of bases,
including uracil, adenine, thymine, cytosine, guanine, xanthine
hypoxanthine, isocytosine, isoguanine, inosine, etc. As used
herein, the term "nucleoside" includes nucleotides as well as
nucleoside and nucleotide analogs, and modified nucleosides such as
amino modified nucleosides. In addition, "nucleoside" includes
non-naturally occurring analog structures. Thus, for example, the
individual units of a peptide nucleic acid, each containing a base,
are referred herein as a nucleotide.
[0186] The size of the primer nucleic acid may vary, as will be
appreciated by those in the art, in general varying from 5 to 500
nucleotides in length. For example, with primers of between 10 and
100 nucleotides, between 12 and 75 nucleotides, and from 15 to 50
nucleotides can be used, depending on the use, required
specificity, and the amplification technique.
[0187] For any primer pair, the ability of the primers to hybridize
to each other may be examined by aligning the sequence of the first
primer to the second primer. The stability of the hybrids,
especially the thermal melting temperature (Tm), may be determined
by the methods described below and by methods well known in the
art. These include, but are not limited to, nearest-neighbor
thermodynamic calculations (Breslauer, T. et al., Proc. Natl. Acad.
Sci. USA 83:8893-97 (1986); Wetmur, J. G., Crit. Rev. Biochem. Mol.
Biol. 26:227-59 (1991); Rychlik, W. et al., J. NIH Res. 6:78
(1994)), Wallace Rule estimations (Suggs, S. V. et al "Use of
Synthetic oligodeoxribonucleotides for the isolation of specific
cloned DNA sequences," Developmental biology using purified genes,
D. B. Brown, ed., pp 683-693. Academic Press, New York (1981), and
Tm estimations based on Bohon and McCarthy (see Baldino, F. J. et
al., Methods Enzymol. 168: 761-77 (1989); Sambrook, J. et al.,
Molecular Cloning: A Laboratory Manual, Chapter 10, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., (2001)). All
references are hereby expressly incorporated by reference. The
effect of various parameters, including, but not limited to, ionic
strength, probe length, G/C content, and mismatches are taken into
consideration when assessing hybrid stability. Consideration of
these factors are well known to those skilled in the art (see,
e.g., Sambrook, J., supra).
[0188] The primers that can be used in the methods described herein
can be used to amplify various target nucleic acids. A single
primer set, for example a primer pair, may be used to amplify a
single target nucleic acid. In another embodiment, multiple primer
sets may be used to amplify a plurality of target nucleic acids.
Amplifications may be conducted separately for each unique primer
set, or in a single reaction vessel using combinations of primer
sets, generally known in the art as multiplexing. When multiple
primer sets are used in a single reaction, primers are designed to
limit formation of undesirable products and limit interference
between primers of each primer set.
[0189] The general PCR amplification reactions can be carried out
according to procedures well known in the art, as discussed above
(see, e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202). The time and
temperature of the primer extension step will depend on the
polymerase, length of target nucleic acid being amplified, and
primer sequence employed for the amplification. The number of
reiterative steps required to sufficiently amplify the target
nucleic acid will depend on the efficiency of amplification for
each cycle and the starting copy number of the target nucleic acid.
As is well known in the art, these parameters can be adjusted by
the skilled artisan to effectuate a desired level of amplification.
Those skilled in the art will understand that the present invention
is not limited by variations in times, temperatures, buffer
conditions, and the amplification cycles applied in the
amplification process.
[0190] In hybridizing the primers to the target nucleic acids and
in the disclosed amplification reactions, the assays are generally
done under stringency conditions that allow formation of the
hybrids in the presence of target nucleic acid. Those skilled in
the art can alter the parameters of temperature, salt
concentration. pH, organic solvent, chaotropic agents, or other
variables to control the stringency of hybridization and also
minimize hybridization of primers to non-specific targets (i.e., by
use of "hot start" PCR or "touchdown" PCR).
[0191] In some aspects, the primers can comprise a detectable
label. In some aspects, one primer or both primers of a primer pair
or primer set can comprise a detectable label.
[0192] Also disclosed herein are kits for implementing the methods
described herein. For example, disclosed herein are kits comprising
one or more of the primer sets described herein. In some aspects
the kits can comprise a first forward primer and a first reverse
primer wherein the first forward primer comprises a 3' portion that
hybridizes to a telomeric repeat sequence under annealing
conditions; and wherein the first reverse primer comprises a 5'
portion having an anchor sequence that does not hybridize to a
telomeric repeat sequence.
[0193] The kits may also comprise buffers, enzymes, and containers
for performing the amplification and analysis of the amplification
products.
[0194] In some aspects, the kits can comprise one or more of the
detection labels, polymerases or target nucleic acids described
herein.
[0195] Additionally, the kits described herein can comprise any of
the products and reagents required to carry out the methods
described herein as well as instructions.
[0196] 6. Correlations of Telomere Length with Clinical Condition
or Optimal Therapeutic Regimen
[0197] Average telomere length per chromosome end determined from
genomic DNA is a measure of overall telomere abundance, and this
has been shown to correlate with several important biological
indices. These indices include, for example, risk of various
disease conditions, e.g., cardiovascular risk, cancer risk.
pulmonary fibrosis risk, infectious disease risk, and risk of
mortality. Abundance of telomeres also correlates with
chronological age, body-mass index, hip/weight ratio, and perceived
stress. One measurement of the average telomere length or abundance
is the telomere/single copy ("T/S") ratio. Such ratios in a given
population can be divided into quantiles, e.g., into tertiles or
quartiles. It has been found that individuals with telomere
abundance by T/S ratios in the lower two tertiles are at
significantly higher risk for cardiovascular disease than those in
the top tertile for telomere length.
[0198] In the disclosed methods. "S" in the T/S ratio represents
the average of the average length or abundance of at least two low
copy number genes. In a further aspect, "S" in the T/S ratio
represents the average of the average length or abundance of at
least two single copy genes. In a still further aspect. "S" in the
T/S ratio represents the average of the average length or abundance
of two low copy number genes. In a further aspect, "S" in the T/S
ratio represents the average of the average length or abundance of
two single copy genes.
[0199] In general, percentile value of measure of average telomere
length or abundance, e.g., T/S values represented as a percentage
of the reference population (typically the highest tertile or
quartile of telomere lengths), in a population correlates
negatively with risk of disease, i.e. increased average telomere
length or abundance is associated with lower disease or mortality
risk or improved measures of health, while lower percentile scores
are generally associated with decreased measures of health, and
increased mortality and disease risk, including presence of
"telomere disease" where telomeres are genetically short due to
mutations or alternations in genes that negatively impact
telomerase activity or function.
[0200] In a population, telomere length generally decreases with
age. Accordingly, measures of average telomere length or abundance
for an individual can be compared with measures for persons in the
same age range in the population, that is, an age-matched
population. For example, a person at age 30 might have a measure of
telomere abundance about equal to the population average for age
30, or equal to the population average fir age 20 or age 40.
Correlations of a measure of average telomere length or abundance
with measures of health can be more useful when compared with the
measure for an age and gender-matched population. The range for an
age matched population can be, for example, one year, two years,
three years. four years. 5 years, 7 years or 10 years or up to 80
or more years.
[0201] Altered average telomere length or abundance determined from
subject samples by the method of the present disclosure can be
correlated with measures of health. Of particular interest are
measures of health involving perceived stress. Apparent telomere
shortening can be accelerated by genetic and environmental factors,
including multiple forms of stress such as oxidative damage,
biochemical stressors, chronic inflammation and viral infections
(Epel, E. S. et al., Proc. Natl. Acad. Sc. USA, 2004, 49:17312-15).
A convenient measure of general health status is the SF-36.RTM.
Health Survey developed by John Ware (see, e.g., world wide web URL
sf-36.org/tools/SF36.shtml). The SF-36 is a multi-purpose,
short-form health survey with only 36 questions to be posed to
patients, preferably by trained individuals. It provides an 8-scale
profile of functional health and well-being scores as well as
psychometrically-based physical and mental health summary measures
and a preference-based health utility index. The SF-36 survey is
used to estimate disease burden and compare disease-specific
benchmarks with general population norms. The most frequently
studied diseases and conditions include arthritis, back pain,
cancer, cardiovascular disease, chronic obstructive pulmonary
disease, depression, diabetes, gastro-intestinal disease, migraine
headache, HIV/aids, hypertension, irritable bowel syndrome, kidney
disease, low back pain, multiple sclerosis, musculoskeletal
conditions, neuromuscular conditions, osteoarthritis, psychiatric
diagnoses, rheumatoid arthritis, sleep disorders, spinal injuries,
stroke, substance abuse, surgical procedures, transplantation and
trauma (Turner-Bowker et al., SF-36.RTM. Health Survey & "SF"
Bibliography: Third Edition (1988-2000), QualityMetric
Incorporated, Lincoln, R I, 2002). One skilled in the art will
appreciate that other survey methods of general health status, for
example, the RAND-36, may find use in the present disclosure.
[0202] In one aspect of the present disclosure, subject samples are
collected over time and measurements of altered average telomere
length or abundance are determined from the samples. Appropriate
time periods for collection of a plurality of samples include, but
are not limited to, 1 month, 3 months, 6 months, 1 year, 2 years, 5
years and 10 years (for example, the time between the earliest and
the last sample can be about these time periods). This method
allows for monitoring of patient efforts to improve their general
health status and/or to monitor their health status and/or disease
risk. Since shortened telomeres can trigger cell death or genomic
instability which can contribute to cancer initiation or progress,
a finding that the percentage of shortened telomere length is
lowered or maintained with time within an individual indicates a
health improvement, while increase of percentage of shortened
telomeres overtime represents a decrease or worsening in
health.
[0203] Measuring the number of repetitive units of telomeres has a
wide variety of applications in medical diagnosis, e.g., for
disease risk, disease prognosis, and therapeutics. In particular,
measurement of telomere length finds application in assessing
pathological conditions leading to the risk of disease. In one
aspect of the disclosure, the disease is one associated with aging,
for example but not limited to, cardiovascular disease, diabetes,
cancer, liver fibrosis, and depression.
[0204] In one aspect, the present disclosure pertains to methods
for allogeneic transplant hematopoietic stem cell donor selection,
the method comprising: (a) obtaining samples from one or more
HLA-matched potential donor subjects: (b) determining the average
telomere length or abundance of the first amplicon for each of the
HLA-matched donor subjects by the disclosed methods: (c)
identifying one or more donor subjects from with average telomere
length or abundance that is in upper 25.sup.th percentile, upper
50.sup.th percentile, or upper 75.sup.th percentile for age-matched
controls; (d) obtaining a transplantable hematopoietic stem cell
sample from the identified donor subject; and (e) transplanting the
hematopoietic stem cell sample to a recipient subject.
[0205] In one aspect, the present disclosure pertains to methods
for allogeneic transplant hematopoietic stem cell donor selection,
the method comprising: (a) obtaining samples from one or more
HLA-matched potential donor subjects; (b) determining the average
telomere length or abundance of the first amplicon for each of the
HLA-matched donor subjects by the disclosed methods; (c)
identifying one or more donor subjects from with average telomere
length or abundance that is in upper 25.sup.th percentile for
age-matched controls; (d) obtaining a transplantable hematopoietic
stem cell sample from the identified donor subject; and (e)
transplanting the hematopoietic stem cell sample to a recipient
subject.
[0206] In one aspect, the present disclosure pertains to methods
for allogeneic transplant hematopoietic stem cell donor selection,
the method comprising: (a) obtaining samples from one or more
HLA-matched potential donor subjects; (b) determining the average
telomere length or abundance of the first amplicon for each of the
HLA-matched donor subjects by the disclosed methods; (c)
identifying one or more donor subjects from with average telomere
length or abundance that is in upper 50.sup.th percentile for
age-matched controls; (d) obtaining a transplantable hematopoietic
stem cell sample from the identified donor subject; and (e)
transplanting the hematopoietic stem cell sample to a recipient
subject.
[0207] In one aspect, the present disclosure pertains to methods
for allogeneic transplant hematopoietic stem cell donor selection,
the method comprising: (a) obtaining samples from one or more
HLA-matched potential donor subjects; (b) determining the average
telomere length or abundance of the first amplicon for each of the
HLA-matched donor subjects by the disclosed methods; (c)
identifying one or more donor subjects from with average telomere
length or abundance that is in upper 75.sup.th percentile for
age-matched controls; (d) obtaining a transplantable hematopoietic
stem cell sample from the identified donor subject; and (e)
transplanting the hematopoietic stem cell sample to a recipient
subject.
[0208] In a further aspect, the recipient subject has been
diagnosed with a cancer, cardiovascular disease, or with a need for
a bone marrow transplant.
[0209] In a further aspect, the recipient subject has been
diagnosed with a cancer. In a still further aspect, the cancer is a
leukemia or lymphoma. In a yet further aspect, the cancer is a
neuroblastoma. In an even further aspect, the cancer is multiple
myeloma.
[0210] In a further aspect, the recipient subject has received
radiation therapy and/or chemotherapy treatment. In a still further
aspect, the recipient subject is in remission.
[0211] In a further aspect, the hematopoietic stem cell sample
comprises bone marrow obtained from the identified donor subject.
In a still further aspect, the hematopoietic stem cell sample
comprises peripheral blood stem cells obtained from the identified
donor subject.
[0212] In one aspect, the present disclosure finds use in the
assessment and monitoring of cardiovascular disease. Telomere
length in white blood cells has been shown to be shorter in
patients with severe triple vessel coronary artery disease than it
is in individuals with normal coronary arteries as determined by
angiography (Samani, N. J. et al., Lancet, 2001, 358:472-73), and
also in patients who experiencing a premature myocardial infarction
before age 50 years as compared with age- and sex-matched
individuals without such a history (Brouilette S. et al.,
Arterioscler. Thromb. Vase. Biol., 2003, 23:842-46). Brouilette et
al. (Lancet, 2007, 369:107-14) has suggested that shorter leucocyte
telomeres in people prone to coronary heart disease could indicate
the cumulative effect of other cardiovascular risk factors on
telomere length. Increased oxidative stress also contributes to
atherosclerosis, and increased oxidant stress has been shown to
increase rates of telomere attrition in vitro (Harrison, D., Can.
J. Cardiol., 1998, 14(suppl D):30D-32D; von Zglinicki, T., Ann. N.
Y. Acad. Sci., 2000, 908:99-110). In cross-sectional studies,
smoking, body-mass index, and type I diabetes mellitus have also
been reported to be associated with shorter leucocyte telomere
length (Valdes, A., et al., Lancer, 2005, 366:662-64; Jeanclos, E.
et al., Diabetes, 1998, 47:482-86). Increased life stress, a factor
known to increase the risk of coronary heart disease, has been
shown to be associated with shorter telomeres, possibly as a
consequence of increased oxidative stress (Epel, 2004, ibid.).
Thus, smokers and patients with a high body-mass index, diabetes
and/or increased life stress would all benefit from determination
and continued monitoring of their telomere abundance according to
the method of the disclosure.
[0213] Type 2 diabetes is characterized by shorter telomeres
(Salpea, K. and Humphries, S. E., Atherosclerosis, 2010,
209(1):35-38). Shorter telomeres have also been observed in type I
diabetes patients (Uziel O. et al., Exper. Gerontology, 2007,
42:971-978). The etiology of the disease in type I diabetes is
somewhat different from that in type 2, although in both cases,
beta cell failure is the final trigger for full-blown disease.
Telomere length is thus a useful marker for diabetes since it is
associated with the disease progression. Adaikalakoteswari et al.
(Atherosclerosis, 2007, 195:83-89) have shown that telomeres are
shorter in patients with pre-diabetic impaired glucose tolerance
compared to controls. In addition, telomere shortening has been
linked to diabetes complications, such as diabetic nephropathy
(Verzola D. et al., Am. J. Physiol, 2008, 295:F1563-1573),
microalbuminuria (Tentolouris, N. et al., Diabetes Care, 2007,
30:2909-2915), and epithelial cancers (Sampson, M J. et al.,
Diabetologia, 2006, 49:1726-1731) while telomere shortening seems
to be attenuated in patients with well-controlled diabetes (Uziel,
2007, ibid.). The method of the present disclosure is particularly
useful in monitoring the status of pre-diabetic and diabetic
patients to provide an early warning for these complications and
others.
[0214] The present disclosure is useful for determining telomere
lengths of various types of cancer cells because activation of
telomerase activity is associated with immortalization of cells.
While normal human somatic cells do not or only transiently express
telomerase and therefore shorten their telomeres with each cell
division, most human cancer cells typically express high levels of
telomerase and show unlimited cell proliferation. High telomerase
expression allows cells to proliferate and expand long term and
therefore supports tumor growth (Roth, A. et al., in Small
Molecules in Oncology, Recent Results in Cancer Research, U. M.
Martens (ed.), Springer Verlag, 2010, pp. 221-234). Shorter
telomeres are significantly associated with risk of cancer,
especially cancers of the bladder and lung, smoking-related, the
digestive system and the urogenital system. Excessive telomere
shortening likely plays a role in accelerating tumor onset and
progression (Ma H. et al., PLoS ONE, 2011, 6(6): e20466.
doi:10.1371/journal.pone.0020466). Studies have further shown that
the effect of shortened telomeres on breast cancer risk is
significant for certain population subgroups, such as premenopausal
women and women with a poor antioxidative capacity (Shen J., et
al., Int. J. Cancer, 2009, 124:1637-1643). In addition to the
assessing and monitoring cancers in general, the present disclosure
is particularly useful for the monitoring of oral cancers if
genomic DNA derived from saliva samples is utilized.
[0215] Cirrhosis of the liver is characterized by increasing
fibrosis of the organ often associated with significant
inflammatory infiltration. Wiemann et al. (FASEB Journal, 2002,
16(9):935-982) have shown that telomere shortening is a disease-
and age-independent sign of liver cirrhosis in humans. Telomere
shortening is present in cirrhosis induced by viral hepatitis
(chronic hepatitis A and B), toxic liver damage (alcoholism),
autoimmunity, and cholestasis (PBC and PSC); telomeres are
uniformly short in cirrhosis independent of the age of the
patients. Telomere shortening and senescence specifically affect
hepatocytes in the cirrhotic liver and both parameters strongly
correlate with progression of fibrosis during cirrhosis. Thus, the
method of the present disclosure finds use in diagnosing and
monitoring liver fibrosis.
[0216] Depression has been likened to a state of "accelerated
aging," and depressed individuals have a higher incidence of
various diseases of aging, such as cardiovascular and
cerebrovascular diseases, metabolic syndrome, and dementia. People
with recurrent depressions or those exposed to chronic stress
exhibit shorter telomeres in white blood cells. Shorter telomere
length is associated with both recurrent depression and cortisol
levels indicative of exposure to chronic stress (Wikgren. M. et.
al., Biol. Psych., 2011, DOI: 10.1016/j.biopsych.2011.09.015).
However, not all depressed individuals show shortened telomeres
equally because of a large variance in depressive episodes over a
lifetime. Those who suffered from depression for long durations
have significantly shorter telomeres due to longer exposure to
oxidative stress and inflammation induced by psychological stress
when compared with control populations (Wolkowitz et al., PLoS One,
2011, 6(3):e17837). Thus, the method of the present disclosure may
find use in monitoring depression.
[0217] Abnormal telomere length is associated with chronic
infection including HIV (Effros R B et al, AIDS. 1996 July;
10(8):F17-22, Pommier et al Virology. 1997, 231(1):148-54), and
HBV, HCV and CMV (Telomere/telomerase dynamics within the human
immune system; effect of chronic infection and stress. (Effros R B,
Exp Gerontol. 2011 February-March; 46(2-3):135-40. Rejuvenation
Res. 2011 February; 14(1):45-56. doi: 10.1089rej.2010.1085. Epub
2010 Sep. 7.)
[0218] In Harley et al. ("A natural product telomerase activator as
part of a health maintenance program", Harley CB, Liu W, Blasco M,
Vera E, Andrews W H, Briggs L A, Raffaele J M, Rejuvenation Res.
2011 February; 14(1):45-56), it was found that individuals who were
CMV seropositive had shorter telomeres than those who were CMV
negative, and moreover, the CMV positive subjects were more likely
to respond to a nutritional supplement program of TA-65, a natural
product-derived telomerase activator along with other supplements,
in reducing the abundance of senescent CD8+/CD28- cells, suggesting
a companion diagnostics application for measuring average telomere
length or abundance of short telomeres, in conjunction with
administration of telomerase activators or other agents that lead
to longer telomeres.
[0219] Measurement of average telomere length can be used as
indicator of prognosis disease progression and treatment
outcome.
[0220] One study reported that telomere length in CD4+ cells is
related to inflammatory grade, fibrosis stage, laboratory indices
of severity, subsequent hepatic decompensation and treatment
outcome in patients with chronic HCV infection (Hoare et al, J.
Hepatol., 2010, 53(2):252-260).
[0221] In another report, longer leukocyte telomere length predicts
increased risk of hepatitis B virus-related hepatocellular
carcinoma (Liu et al, 2011, 117(18):4247-56.)
[0222] In the case of HIV, telomere shortening is caused by viral
infection. In addition, the nucleoside analog reverse-transcriptase
inhibitors used to treat HIV are telomerase inhibitors (Strahl and
Blackburn, Mol Cell Biol, 1996, 16(1):53-65; Hukezalie et al, PloS
One, 2012, 7(11):e47505). Measurement of short telomere abundance
might help determine the side effects and efficacy of HAART
treatment.
[0223] The present disclosure also finds use in diagnosis of
diseases related to early onset of aging. For example, individuals
with Hutchinson Gilford progeria disease show premature aging and
reduction in proliferative potential in fibroblasts associated with
loss of telomeric length (Allsopp, R. C. et al, Proc. Nad. Acad
Sci, USA, 1992, 89:10114-10118). Amplification and quantitation of
the number of telomeric repeats according to the method of this
disclosure is useful for determining disease risk or prognosis and
taking appropriate interventional steps as described above.
[0224] In one aspect of the present disclosure, both the presence
and the progress of telomeric-specific diseases may be determined
using samples. Telomeric diseases are associated with an abnormal
or premature shortening of telomeres, which can, for example,
result from defects in telomerase activity. Telomerase is a
ribonucleoprotein complex required for the replication and
protection of telomeric DNA in eukaryotes. Cells lacking telomerase
undergo a progressive loss of telomeric DNA that results in loss of
viability and a concomitant increase in genome instability. These
diseases may be inherited and include certain forms of congenital
aplastic anemia, in which insufficient cell divisions in the stem
cells of the bone marrow lead to severe anemia. Certain inherited
diseases of the skin and the lungs are also caused by telomerase
defects. For telomere diseases, a threshold for T/S<0.5 is
appropriate for some conditions. Also, a commonly used metric is an
age-adjusted percentile telomere score less than <10% or
preferably <1% relative to a normal population.
[0225] Dyskeratosis congenita (DKC), also known as
Zinsser-Engman-Cole syndrome, is a rare, progressive bone marrow
failure syndrome characterized by mucocutaneous abnormalities:
reticulated skin hyperpigmentation, nail dystrophy, and oral
leukoplakia (Jyonouchi S. et al., Pediatr. Allergy Immunol., 2011,
22(3):313-9; Bessler M., et al., Haematologica, 2007,
92(8):1009-12). Evidence exists for telomerase dysfunction,
ribosome deficiency, and protein synthesis dysfunction in this
disorder. Early mortality is often associated with bone marrow
failure, infections, fatal pulmonary complications, or malignancy.
The disease is inherited in one of three types: autosomal dominant,
autosomal recessive, or the most common form, X-linked recessive
(where the gene responsible for DC is carried on the X-chromosome).
Early diagnosis and measurement of disease progress using the
method of this disclosure is very beneficial for families with
these genetic characteristics so that early treatment with anabolic
steroids or bone-marrow-stimulating drugs can help prevent bone
marrow failure. The non-invasive, patient friendly saliva-testing
method of the present disclosure is particularly useful for DKC
because babies and small children need testing and continued
monitoring.
[0226] Idiopathic interstitial pneumonias are characterized by
damage to the lung parenchyma by a combination of fibrosis and
inflammation. Idiopathic pulmonary fibrosis (IPF) is an example of
these diseases that causes progressive scarring of the lungs.
Fibrous scar tissue builds up in the lungs over time, affecting
their ability to provide the body with enough oxygen. Heterozygous
mutations in the coding regions of the telomerase genes, TERT and
TERC, have been found in familial and sporadic cases of idiopathic
interstitial pneumonia. All affected patients with mutations have
short telomeres. A significant fraction of individuals with IPF
have short telomere lengths that cannot be explained by coding
mutations in telomerase (Cronkhite, J. T., et al., Am. J. Resp.
Crit. Care Med., 2008, 178:729-737). Thus, telomere shortening can
be used as a marker for an increased predisposition toward this
age-associated disease (Alder, J. K., et al., Proc. Natl. Acad.
Sci. USA, 2008, 105(35):13051-13056). Further, the course of IPF
varies from person to person. For some, the disease may progress
slowly and gradually over years, while for others it may progress
rapidly. The method of the present may be conveniently used to
monitor the course of pulmonary fibrosis and taking appropriate
interventional steps as described above.
[0227] Aplastic anemia is a disease in which bone marrow stops
making enough red blood cells, white blood cells and platelets for
the body. Any blood cells that the marrow does make are normal, but
there are not enough of them. Aplastic anemia can be moderate,
severe or very severe. People with severe or very severe aplastic
anemia are at risk for life-threatening infections or bleeding.
Patients with aplastic anemia who have short telomeres, or are
carrying telomerase mutations, have an increased risk of developing
myelodysplasia and genomic instability leading to chromosomal
aberrations and cancer (Calado et al Leukemia (2011), 1-8).
[0228] Telomerase deficiency may cause variable degrees of telomere
shortening in hematopoietic stem cells and lead to chromosomal
instability and malignant transformation (Calado, R. T. and Young,
N. S., The Hematologist, 2010 world wide web URL
hematology.org/Publications/Hematologist/2010/4849.aspx). Aplastic
anemia patients with shorter telomeres have a lower survival rate
and are much more likely to relapse after immunotherapy than those
with longer telomeres. Scheinberg et al. (JAMA, 2010,
304(12):1358-1364) found that relapse rates dropped as telomere
lengths increased. The group of patients with the shortest
telomeres was also at greater risk for a conversion to bone marrow
cancer and had the lowest overall survival rates. The method of the
present disclosure can be used in aplastic anemia patients to
monitor the risk of developing major complications so that the
clinical management of an individual may be tailored
accordingly.
[0229] In another aspect, the present disclosure is useful in
monitoring effectiveness of therapeutics or in screening for drug
candidates affecting telomere length or telomerase activity. The
ability to monitor telomere characteristics can provide a window
for examining the effectiveness of particular therapies and
pharmacological agents. The drug responsiveness of a disease state
to a particular therapy in an individual can be determined by the
method of the present disclosure. For example, the present
disclosure finds use in monitoring the effectiveness of cancer
therapy since the proliferative potential of cells is related to
the maintenance of telomere integrity. As described above, while
normal human somatic cells do not or only transiently express
telomerase and therefore shorten their telomeres with each cell
division, most human cancer cells typically express high levels of
telomerase and show unlimited cell proliferation. Roth et al.,
(ibid., 2010) have suggested that individuals with cancer who have
very short telomeres in their tumors (in which the shortest
telomeres in most cells are near to telomere dysfunction) and high
telomerase activity might benefit the most from anti-cancer
telomerase-inhibiting drugs. Because telomerase is either not
expressed or expressed transiently and at very low levels in most
normal cells, telomerase inhibition therapies may be less toxic to
normal cells than conventional chemotherapy. An example of such
drugs is the short oligonucleotide-based telomerase inhibitor
imetelstat (previously named GRN163L). Imetelstat is a novel
lipid-based conjugate of the first-generation oligonucleotide
GRN163 (Asai, A. et al., Cancer Res., 2003, 63:3931-3939). However,
cancer patient-s having very short telomeres in normal blood cells
(particularly their granulocytes) are at higher risk of adverse
effects of imetelstat on proliferative tissues such as the bone
marrow. Rattain et al. (2008) found that such subjects with short
granulocyte telomere length were more likely to have bone marrow
failure symptoms such as neutropenia or thrombocytopenia. In this
situation, a doctor might prescribe a lower dose of imetelstat, a
different drug, or more frequent monitoring for bone marrow
problems.
[0230] In other aspects, drug efficacy in the treatment of diseases
of aging, for example but not limited to, cardiovascular disease,
diabetes, pulmonary fibrosis, liver fibrosis, interstitial
pneumonia and depression. In the case of cardiovascular disease,
Brouilette et al. reported that middle-aged men with shorter
telomere lengths than control groups benefit the most from
lipid-lowering therapy with pravastatin (Brouilette, S. W. et al.,
Lancet, 200?, 369:107-114). Satoh et al. (Clin. Sci., 2009,
116:827-835) indicating that intensive lipid-lowering therapy
protected telomeres from erosion better in patients treated with
atorvastatin when compared with patients treated with moderate
pravastatin therapy. The method of the present disclosure can be
used to monitor the efficacy of statins in treated patients,
wherein shorter telomere length correlates with better drug
efficacy. Since subjects with the longest telomeres did not on
average benefit from prophylactic statins, a doctor might suggest
that the patient be especially compliant with good lifestyle habits
as part of their treatment program. Conversely, patients with short
telomeres who fear side effects of chronic statin usage might be
persuaded to take statins based on their higher probability of
benefiting from statins. Examples of statins that can be used
include niacin (ADVICOR, SIMCOR), lovastatin (ALTOPREV, MEVACOR),
amolopidine (CADUET), rosuvastatin (CRESTOR),
sitagliptinisimvastatin (JUVISYNC), fluvastatin (LESCOL),
pravastatin (PRAVACHOL), atorvastatin (LIPITOR), pitavastatin
(LIVALO), and ezetimibeisimvastatin (VYTORIN).
[0231] In one aspect, the present disclosure pertains to methods
for reclassification of cardiovascular disease risk, the method
comprising: (a) obtaining a sample a subject, wherein the subject
has been diagnosed to meet 2013 ACC/AHA Guideline on the Treatment
of Blood Cholesterol criteria for low-intensity statin therapy; (b)
determining the average length or abundance of the first amplicon
relative to the average abundance of the second and third amplicon
in the sample by the disclosed methods; (c) diagnosing the subject
at higher cardiovascular risk when the sample has been determined
to have a first amplicon average length or abundance relative to
the average abundance of the second and third amplicon in the lower
25.sup.th percentile, lower 50.sup.th percentile, or lower
75.sup.th percentile for age-matched controls; and (d)
administering to the subject diagnosed at higher cardiovascular
risk: (i) a modified statin therapy; and/or (ii) a second
therapeutic agent known to treat cardiovascular disease.
[0232] In one aspect, the present disclosure pertains to methods
for reclassification of cardiovascular disease risk, the method
comprising: (a) obtaining a sample a subject. wherein the subject
has been diagnosed to meet 2013 ACC/AHA Guideline on the Treatment
of Blood Cholesterol criteria for low-intensity statin therapy; (b)
determining the average length or abundance of the first amplicon
relative to the average abundance of the second and third amplicon
in the sample by the disclosed methods; (c) diagnosing the subject
at higher cardiovascular risk when the sample has been determined
to have a first amplicon average length or abundance relative to
the average abundance of the second and third amplicon in the lower
25.sup.th percentile for age-matched controls; and (d)
administering to the subject diagnosed at higher cardiovascular
risk: (i) a modified statin therapy; and/or (ii) a second
therapeutic agent known to treat cardiovascular disease.
[0233] In one aspect, the present disclosure pertains to methods
for reclassification of cardiovascular disease risk, the method
comprising: (a) obtaining a sample a subject, wherein the subject
has been diagnosed to meet 2013 ACC/AHA Guideline on the Treatment
of Blood Cholesterol criteria for low-intensity statin therapy; (b)
determining the average length or abundance of the first amplicon
relative to the average abundance of the second and third amplicon
in the sample by the disclosed methods; (c) diagnosing the subject
at higher cardiovascular risk when the sample has been determined
to have a first amplicon average length or abundance relative to
the average abundance of the second and third amplicon in the lower
50.sup.th percentile for age-matched controls; and (d)
administering to the subject diagnosed at higher cardiovascular
risk: (i) a modified statin therapy; and/or (ii) a second
therapeutic agent known to treat cardiovascular disease.
[0234] In one aspect, the present disclosure pertains to methods
for reclassification of cardiovascular disease risk, the method
comprising: (a) obtaining a sample a subject, wherein the subject
has been diagnosed to meet 2013 ACC/AHA Guideline on the Treatment
of Blood Cholesterol criteria for low-intensity statin therapy; (b)
determining the average length or abundance of the first amplicon
relative to the average abundance of the second and third amplicon
in the sample by the disclosed methods; (c) diagnosing the subject
at higher cardiovascular risk when the sample has been determined
to have a first amplicon average length or abundance relative to
the average abundance of the second and third amplicon in the lower
75' percentile for age-matched controls; and (d) administering to
the subject diagnosed at higher cardiovascular risk: (i) a modified
statin therapy; and/or (ii) a second therapeutic agent known to
treat cardiovascular disease.
[0235] In further aspects, drug effectiveness in the treatment of
telomeric diseases, for example but not limited to, Dyskeratosis
congenita, pulmonary fibrosis, and aplastic anemia, may be
measured. For example, dyskeratosis congenita and pulmonary
fibrosis are both treated with high-dose steroids, which are well
known to have numerous deleterious side effects. Use of the lowest
possible steroid dose is thus highly desirable, making the method
of the present disclosure a valuable tool for monitoring these
patients.
[0236] In another aspect, the present disclosure finds use as a
general method of screening for candidate drugs, dietary
supplements, and other interventions including lifestyle changes
which affect biological pathways regulating telomere length, such
as telomerase activity. Ability to rapidly and specifically amplify
telomere repeats in a quantitative manner provides a high
throughput screening method for identifying small molecules,
candidate nucleic acids, and peptides agents and other products or
interventions affecting telomere dynamics in a cell. Drug or other
product candidates that have a positive, telomere lengthening
effect on normal cells would be preferred in the treatment of
degenerative, or cell senescence related conditions over those with
telomere shortening (or telomerase inhibiting) effects, everything
else being equal. In the case of treatment of cancer, drugs that
have a negative, telomere shortening effect, especially in cancer
cells would be preferred.
EXAMPLES
Example 1--Triplex qPCR Assay
[0237] Each PCR reaction was carried out in a total volume of 10
.mu.L per well of a standard 384 well assay plate. The standard
reaction mix contained the following components: 5 ng target DNA,
1.0 .mu.M EvaGreen.RTM. Dye (Biotium, Hayward, Calif.), 300 nM Tel
G modified primer, 300 nM Tel C modified primer, 300 nM B2M-F
primer, 300 nM 82M-R primer, 100 nM B2M probe, 1.times. RNase P Mix
(TaqMan.RTM. Copy Number Reference Assay RNase P, Thermo Fisher
Scientific, Inc.), 1.times. Quantifast Probe PCR Master Mix
(QIAGEN, Inc., Germantown, Md.). Table 2 below provides various
primer sequences.
TABLE-US-00002 TABLE 2 Length SEQ Oligo (nucleotides) ID NO.
Sequence Tel G 45 1 5'-ACACCTCCTCCATGGTTTGGGTTTG modified
GGTTTGGGTTTGGGTTAGTG-3' Tel C 43 2 5'-TGTTAGCGACGCGATATCCCTATCC-3'
modified CTATCCCTATCCCTAACA-3' B2M-F 22 3
5'-CCAGCAGAGAATGGAAAGTCAA-3' B2M-R 28 4
5'-TCTCTCTCCATTCTTCAGTAAGTCAA CT-3' B2M-P* 27 5
5'-ATGTGTCTGGGTTTCATCCATC CGACA3-3'
[0238] The standard cycling conditions for the disclosed triplex
qPCR assay are those shown in Table 3.
TABLE-US-00003 TABLE 3 Cycling Step Temp (.degree. C.) Time #
Cycles Cycle 1 96 .sup. 2 min 1 49 15 sec Cycle 2 96 .sup. 2 min 1
49 30 sec Denaturation 90 10 sec 40 Annealing 62 30 sec Extension
70* 30 sec Melt Curve 95 5 sec 1 65 .sup. 1 min 1 97 Continuous 1
*Signal data acquisition during this step.
[0239] The primers, target nucleic acids, and detection channels
for the various amplicons in the disclosed triplex qPCR assay are
given in Table 4 below. Each of the targets was quantified using
the absolute quantification method in Roche LC480 with the second
derivative method. An 8-point, 2-fold dilution of the mosaic male
genomic DNA was used to generate the standard curve, from which the
concentration of each of three targets for each sample was
calculated. The 8 point standard curve used the following genomic
DNA concentrations was as shown in Table 4. The concentrations of
T, B and R were used to calculate the average telomere length.
TABLE-US-00004 TABLE 4 Primer/ Tel C modified/Tel B2M-F/B2M-R/
RNAP-F/ probe G modified/ B2M-P RNAP-R/ EvaGreen RNAP-P Target
Telomere .beta.2-microglobulin RNase P nucleic acid Detection FAM
(465-510 nm) Cy5 (618-660 nM) VIC channel (533-580 nm)
Example 2--Assessment of the Effect of Tel G Modified and Tel C
Modified Primer Concentration
[0240] The standard reaction conditions described above were used,
except that the concentration of the Tel G modified and Tel C
modified were varied. The following concentrations were examined:
400 nM Tel G modified and 400 nM Tel C modified; 300 nM Tel G
modified and 100 nM Tel C modified; 600 nM Tel G modified and 100
nM Tel C modified; 300 nM Tel G modified and 300 nM Tel C modified;
and 600 nM Tel G modified and 300 nM Tel C modified. The melting
curves for the reactions with the foregoing Tel G modified/Tel C
modified primer concentrations are shown in FIG. 2A-FIG. 2F. The
data show that when the reaction was carried out with 300 nM Tel G
modified and 300 nM Tel C modified, all three targets have similar
amplification amplitude, suggesting that all three PCR reactions
generate approximately similar amounts of products and the assay
reaches the desired balance for the three targets. Comparable
amounts of the three amplicons at the end of the PCR reaction when
equilibrium is reached is an indicator that the none of the PCR
reagents (enzyme, nucleotides, primers) are limiting for any of the
three PCR products.
Example 3--Amplification Efficiency
[0241] An 8-point 2-fold serial dilution of the Mosaic Male genomic
DNA was used to calculate the PCR efficiencies. The DNA
concentration in the final PCR reaction for each point is shown in
Table 5. The PCR efficiencies of each of the target for each primer
combination tested were obtained with absolute quantification
method in the Roche LC480 program and are summarized in Table
6.
TABLE-US-00005 TABLE 5 Final concentration Standard point in PCR
(ng/.mu.l) Std1 5 Std2 2.5 Std3 1.25 Std4 0.625 Std5 0.3125 Std6
0.1563 Std7 0.0781 Std8 0.0391
TABLE-US-00006 TABLE 6 PCR Amplification Efficiencies T RNaseP B2M
T only 104.0% -- -- S only -- 98.6% 96.3% 300 nM TelG 97.5% 106.8%
97.4% 100 nM TelC 300 nM TelG 95.4% 107.9% 96.3% 300 nM TelC 400 nM
TelG 97.4% 105.9% 96.6% 400 nM TelC 600 nM TelG 95.1% 105.2% 97.5%
100 nM TelC
Example 4--Amplification Efficiency
[0242] The disclosed triplex qPCR assay was carried out with varied
concentrations of target DNA (mosaic M DNA), The linear regression
lines of crossing point (Cp) (calculated by the Roche LC480 program
by the second derivative method) vs. the log(concentration) of
input DNA for the telomere, RNase P and .beta.2-microglobulin
targets, and the data are shown in FIG. 3A-FIG. 3C. An
R.sup.2>0.999 was achieved for each of the three targets at
0.0391 ng/.mu.L to 5 ng/.mu.L target DNA, i.e., a 128-fold range.
Since 3 .mu.L of target DNA was used in a 10 .mu.L PCR reaction,
this corresponds to a range of 0.13 ng/.mu.L to 16.7 ng/L of target
DNA in the 3 .mu.L volume added to the reaction. Thus, the assay
can detect and quantify target DNA at least as low as 0.13
ng/.mu.L, although it is possible that lower concentrations target
DNA can be detected under the conditions of the disclosed triplex
qPCR assay. The highest genomic DNA final reaction concentration
used in this study was 5 ng/.mu.L. It was observed that baseline of
the amplification curves for the RNase P and .beta.2-microglobulin
targets are higher than the rest of the standard curve points at
the highest genomic DNA concentrations (mosaic M DNA) used (see
FIG. 4A-FIG. 4C).
Example 5--Assay Carried Out with Non-Template Controls
[0243] The disclosed triplex qPCR assay was carried out using nine
non-template control ("NTC") samples. The experiment was carried
out with the nine NTC samples in a single assay plate. The NTC Cp
for the telomere and the RNase P targets were all greater than 35;
whereas three of the 9 wells for B2M have an artifactual NTC Cp
calling of 5, and the other 6 wells didn't have Cp calling. It
should be noted that although the B2M wells had an artifactual Cp
calling of 5, the data shown in FIG. 5C show minimal amplification
was observed from the amplification curve. These data suggest that
under the conditions of the disclosed triplex qPCR assay there was
little or no risk of NTC signal interference with calculation of
sample Cp values.
Example 6--PCR Efficiency
[0244] The PCR efficiencies of three quality control DNA samples,
male mosaic reference DNA, and four patient DNA samples were
obtained by carrying out the disclosed triplex qPCR assay using an
8-point, 2-fold serial dilution for each of the samples, with the
highest concentration in the final PCR reaction as 3 ng/.mu.L (see
Table 7). The diluted DNA samples were run twice and the PCR
efficiencies are summarized in Table 8. There is significant amount
of variation in the PCR efficiency when the two runs are compared.
Despite the difference in the PCR efficiencies an average CV of
3.4% for RNase P and 3.1% for B2M was obtained when the two runs
were compared. Table 8 shows the CV values obtained for RNase P
target, and Table 9 shows the CV values obtained for the
.beta.2-microglobulin target. The data in Tables 8 and 9 show that
the CVs are higher at the lower concentrations target DNA. When the
lowest concentration points were removed, the average CV decreased
to 2.9% for RNase P and 2.5% for .beta.2-microglobulin. Based on
the CV values for .beta.2-microglobulin, an optimal concentration
in the final PCR reaction may be 0.5 ng/.mu.L (between standard 3
and 4). Therefore, the normalized source DNA for patient samples
should optimally be about 1.7 ng/.mu.L.
TABLE-US-00007 TABLE 7 Final concentration Standard point in
reaction (ng/.mu.l) Std1 3 Std2 1.5 Std3 0.75 Std4 0.375 Std5
0.1875 Std6 0.09375 Std7 0.04688 Std8 0.02344
TABLE-US-00008 TABLE 8 Amplification Efficiencies* T1 T2 R1 R2 B1
B2 QC1 89.6% 90.0% 96.0% 88.9% 95.6% 94.9% QC2 89.7% 93.9% 99.1%
97.7% 96.3% 97.4% QC3 87.2% 88.4% 94.9% 94.9% 88.2% 94.8% MM 92.6%
95.6% 97.8% 98.1% 93.6% 98.7% PT1 94.6% 97.7% 94.1% 94.4% 92.3%
94.8% PT2 90.3% 93.1% 89.3% 90.3% 90.2% 93.3% PT3 87.8% 93.1% 94.1%
93.3% 90.6% 94.3% PT4 90.9% 93.7% 92.8% 92.9% 87.9% 93.0% *T1 and
T2 represent two independent reactions carried out using the Tel G
modified and Tel C modified primers; R1 and R2 represent two
independent reactions carried out using the RNase P primer; and B1
and B2 represent two independent reactions carried out using the
.beta.2-microglobulin primers.
TABLE-US-00009 TABLE 9 QC1 QC2 QC3 PT1 PT2 PT3 PT4 Std1 1.9% 1.2%
2.8% 1.9% 1.9% 4.6% 2.6% Std2 3.1% 5.5% 2.9% 2.3% 2.9% 1.9% 2.8%
Std3 1.5% 1.7% 5.4% 1.9% 1.6% 2.1% 2.8% Std4 3.0% 1.5% 1.9% 1.4%
1.1% 2.7% 3.7% Std5 3.4% 3.9% 2.9% 4.1% 1.4% 5.1% 3.3% Std6 3.9%
3.1% 2.2% 0.9% 4.0% 3.3% 3.4% Std7 3.0% 3.8% 4.0% 5.1% 3.0% 2.7%
6.1% Std8 7.1% 8.9% 2.1% 8.0% 8.4% 2.3% 7.9%
TABLE-US-00010 TABLE 10 QC1 QC2 QC3 PT1 PT2 PT3 PT4 Std1 0.8% 1.5%
1.6% 2.5% 1.3% 1.0% 0.6% Std2 1.8% 1.4% 1.6% 1.7% 2.3% 0.9% 1.4%
Std3 1.6% 2.1% 1.4% 1.2% 2.9% 2.7% 0.9% Std4 1.7% 1.4% 1.5% 1.3%
2.1% 1.6% 2.6% Std5 2.5% 4.4% 3.6% 2.2% 4.2% 1.9% 4.1% Std6 1.9%
2.8% 1.9% 2.6% 5.4% 1.0% 2.8% Std7 5.0% 3.2% 9.4% 3.7% 2.5% 7.9%
4.2% Std8 11.3% 4.4% 10.3% 5.0% 6.0% 7.7% 4.9%
Example 7--T/S Determination in a Patient Population Using the
Disclosed Triplex qPCR Assay Method
[0245] The disclosed triplex qPCR assay method as described herein
was used with 163 patient DNA samples from an asymptomatic
population. The DNA samples were extracted from blood obtained from
each patient. The results established a T/S ratio range of
0.61-1.55 in (FIG. 6A). The patient population examined had an age
range of 21-78 years (mean 51 years), with a gender distribution of
82 females and 81 males. A strong correlation between T/S ratios
and age was observed (R.sup.2=0.36, see FIG. 6B). The disclosed
triplex qPCR method displayed a very low inter-assay CV value (see
FIG. 7A and FIG. 7B). For example, the mean inter-assay CV of these
163 samples is 1.9% even when the PCR assay plate was pipetted
manually by a single individual. In contrast, it should be noted
that typical inter-plate and inter-operator variability (CV values)
with are in the 5-10% range when the assay was carried out as
described by Cawthon (Cawthon, R. M., Nucleic. Acids Res., 2002,
30(10):e47), In a recent publication by Martin-Ruiz, et al. (int.
J. Epidemiol. (2014) doi: 10.1093/ije/dyu191), the authors reported
that inter and intra-batch CV values for qPCR within individual
laboratories CV's ranged from 2.3% to 28%". The data obtained using
the methods of the present invention demonstrate that the disclosed
triplex qPCR assay provides much greater precision than previously
described qPCR methods developed for telomere length determination,
e.g., the method of Cawthon (Cawthon, R. M., Nucleic. Acids Res.,
2002, 30(10):e47). Moreover, the data described herein provide
significantly improved CV values than the average CV values
reported for batch variations by Martin-Ruiz, et al. (Int. J.
Epidemiol. (2014) doi: 10.1093/ije/dyu191).
Example 8--Total Variability in the Disclosed Triplex qPCR Assay
Method
[0246] Each of 9 patient samples was assayed in triplicate in a
single assay carried out in a single 96-well plate by a three
operators. The sample locations for the patient samples in each
assay were as shown in Table 11. The T/S ratio was calculated for
each of the three replicates which provided an estimate of the
"within run" variance. The same plate arrangement was then repeated
on five separate days, once in the morning and once in the evening,
using 3 different operators, for a total of 10 plate repeats per
the schedule shown in Table 12. Nine of the ten plates passed QC
and were used for analysis.
TABLE-US-00011 TABLE 11 1 2 3 4 5 6 7 8 9 10 11 12 A APR_7 APR_7
APR_7 B APR_1 APR_8 APR_1 APR_8 APR_1 C APR_2 APR_9 APR_2 APR_8 D
APR_3 APR_9 APR_2 APR_9 E APR_4 APR_3 APR_3 F APR_5 APR_4 APR_4 G
APR_6 APR_5 APR_5 H APR_6 APR_6
TABLE-US-00012 TABLE 12 Day 1 Day 2 Day 3 Day 4 Day 5 AM Operator 1
Operator 3 Operator 3 Operator 1 Operator 1 PM Operator 2 Operator
2 Operator 2 Operator 3 Operator 2
[0247] The sample data from the multiple assays carried out as
described above were analyzed using a random effects model with
"run" being the random effect. Estimates of within, between and
total run variability were obtained. The design of the study and
data analysis follows the guidelines for evaluation of precision
performance of quantitative assays, outlined in the CLSI (formerly
NCCLS) guidelines. The intra, inter and total CV of the assay,
across the range of T/S covered by the 9 samples was excellent
(FIG. 8A-FIG. 5C). The intra and inter assay CVs ranged from close
to zero to 2.9% while the total CV ranged from .about.2.2% to
3.5%.
Example 9--E. coli Clone with Telomeric Sequence
[0248] PCR product was prepared by amplification of the target
sequence from genomic DNA obtained from the bladder cancer cell
line, UMUC-3. The PCR reaction used the primers Tel-4rp (SEQ ID
NO.: 14; obtained from Integrated DNA Technologies, Inc.,
Coralville, Iowa, "IDT") and SUS SEQ ID NO.: 15; obtained from IDT;
HPLC purified). The reaction was carried out under following
conditions: 40 ng UMUC-3 genomic DNA, 1.5 mM MgCl.sub.2, 500 nM SUS
primer, 500 nM Tel-4rp, 300 .mu.M dNTP (BioRad, Cat. No. 170-8874),
0.125 U/.mu.l Platinum Taq (Invitrogen) in 50 .mu.l reaction. The
PCR cycles were as follows: 1 cycle at 94.degree. C., 2 min; 35
cycles at 94.degree. C., 15 sec, 65.degree. C., 30 sec, 72.degree.
C., 5 min, and 1 cycle at 72.degree. C., 20 min. The PCR product
was purified by gel electrophoresis using a 0.8% E-gel (Cat No.
G05018-08; Thermo Fisher Scientific Corporation, Carlsbad, Calif.)
and the 0.8-1.2 kb size range products were isolated from the gel
using the GeneClean Turbo Kit (Cat. No. 1102-200; MP Biomedicals,
LLC, Santa Ana, Calif.). The PCR product was then cloned into the
TA cloning vector (TOPO.RTM. TA Cloning.RTM. Kit for Subcloning,
Cat. No. K4510-20; Thermo Fisher Scientific Corporation, Carlsbad,
Calif.). The vector with cloned PCR product was transformed into
transformation competent E. coli cells, and following growth
overnight, selected colonies were picked from the transformation
agar plate. The DNA sequence cloned into the plasmid was determined
for the selected colonies. One clone, Y3 (SEQ ID NO.: 12).
contained a 135 bp telomeric sequence fragment. This clone was
chosen to be the source of the absolute telomere length
reference.
Example 10--Preparation of an Absolute Telomere Reference
[0249] DNA obtained from rolling circle amplification ("RCA") of
the Y3 clone described above was used as the template for PCR
amplification. Two rounds of PCR amplification were used to obtain
the absolute telomere reference. In the first round of PCR
amplification, M13 forward (SEQ ID NO.: 16) and M13 reverse primers
(SEQ ID NO.: 17) were used in a reaction with 1 .mu.l of the RCA
product material. The PCR amplification product, Y3-M13 PCR
product, was purified with the QIAquick PCR purification kit (Cat.
No. 28104; QIAGEN Inc., Valencia, Calif.). and then quantified by
nanodrop UV-Vis spectrophotometry (NanoDrop 8000, Thermo Fisher
Scientific). In the second round of PCR amplification, M13 forward
primer (SEQ ID NO.: 16) and TeloAnchor primer (SEQ ID NO.: 18) were
used with 5 ng of the previously purified Y3-M13 PCR product. The
product of the second round of PCR amplification, Y3-Telotail PCR
product, was purified by the QIAquick PCR purification kit and
quantified by Picogreen assay (Quant-iT.TM. PicoGreen.RTM. dsDNA
reagent. Cat. No. P11495, Thermo Fisher Scientific, Inc.). The
Y3-Telotail PCR. product was used as the absolute telomere
reference DNA.
Example 11--Southern Blot Analysis
[0250] Southern blot analysis was performed according to published
protocols (Masayuki K., et al. Nature Protocols 5, 1596-1607 (2010)
with minor modifications. Briefly, genomic DNA was extracted from
unselected blood samples obtained from anonymous donors at the
Stanford Blood center and was isolated as high molecular weight
DNA. The genomic DNA (3-5 .mu.g) was digested by incubation with 20
U of HphI (Cat. No. R0158S, New England Biolabs Inc., Ipswich,
Mass.) and 20 U of MnlI (Cat. No. R0163S, New England Biolabs Inc.)
at 37.degree. C. for 6 hr or overnight (.gtoreq.16 hr) in a
reaction volume of 40 .mu.L. The digested genomic DNA was separated
by agarose gel electrophoresis using a 0.5% agarose gel in presence
of 0.5.times.TBE with electrophoresis carried out at 40 VDC for 16
hr in a BioRad Sub-Cell GT gel apparatus. DIG-labeled size markers
III (Cat. No. 11218603910, Roche Applied Science, Indianapolis,
Ind.) and VII (Cat. No. 11669940910, Roche Applied Science) were
used. The DNA in the gel was depurinated (0.25 M HCl), denatured
(0.5 M NaOH, 1.5 M NaCl) and transferred to a TurboBlotter.TM.
system (Cat. No. 10416316, GE Healthcare Bio-Sciences Corp.,
Piscataway, N.J.). Transfer was onto a Nytran SPC membrane in the
presence of 20.times.SSC transfer buffer and carried out from 4 hr
to overnight (about 16 hr). The DNA was crosslinked to the membrane
by two treatments of the membrane with DNA at 120 mJ cm.sup.-2 in a
Stratagene Crosslinker and prehybridized in DIG Easy Hyb (Cat. No.
11603558001, Roche Applied Science) at 37.degree. C. for 2 hr,
followed by hybridization with 2.5 pmol of DIG labeled TeloProbe
(SEQ ID NO.: 19; obtained from IDT and HPLC purified) per mL Easy
Hyb solution (a total of 30 pmol probe, or 6.6 .mu.L for 12 mL, was
used) at 37.degree. C. overnight. Signal was detected by
Anti-Digoxigenin-AP (Cat. No. 1109327491, Roche Applied Science)
and images were captured using a BioRad ChemiDoc Imager.
Example 12--Telomere Restriction Fragment Length Quantification
[0251] TRF was quantified using the following procedure using
ImageJ software (see http://imagej.nih.gov/ij/).
[0252] To Generate the Standard Curve of Converting Mobility to
Molecular Weight.
[0253] In the ImageJ program, a line was drawn from the top of the
well to the bottom, then select the menu option: Select
Analyze->Plot Profile, Select "List" and then in the new window,
"File->Save As" and save the molecular ladder's profile. Open
the profile in Excel, graph the Distance vs. Intensity. Manually
find the distance/intensity corresponding to each of the peak.
Graph a scatterplot of Distance vs. Log (molecular Weight) for the
peaks and generate a linear formula Log(MW)=A*Distance+B.
[0254] Generation of the Telomere Restriction Fragment (TRF) Length
of Each Lane.
[0255] As above, in ImageJ, a profile was generated for each of the
lanes and Excel was used to convert the Distance to Log(MW) for
each of the data points by applying the formula above, and
transformed the Log(MW) data to MW data. We then obtained the
intensity/MW data by diving the Intensity (from the Image J
profile) data by the MW data. The 20 kb and 1 kb positions were
identified based on the MW data set and used to calculate the TRF
length in kbp by the following formula using the data points from
20 kb to 1 kb: TRF=SUM(Intensity)/SUM(Intensity/MW).
Example 13--PCR Efficiency of aTL Standard Curve
[0256] A 1 ng/.mu.l stock solution (measured by PicoGreen method)
of the Y3-Telotail PCR product was prepared by diluting the
purified Y3-Telotail PCR product in DNA suspension buffer (10 mM
Tris*HCl, 0.1 mM EDTA) and stored at -20.degree. C. in 20 .mu.L
aliquots. A 1:50 dilution was made with DNA suspension buffer to
prepare the Y3-Telotail PCR product at 20 pg/.mu.L. A 3-fold serial
dilution was further made to create an 8-point standard curve, with
20 pg/.mu.L as the highest concentration. The T/S ratios for the
8-point serial dilutions of Y3-Telotail PCR product were determined
using the previously described qPCR assay of Cawthon (Cawthon, R.
M., Nucleic. Acids Res., 2002, 30(10):e47). PCR efficiency was
calculated using the Roche LC480 software with the absolute
quantification method and second derivative method. The average
efficiency was 91.6% (STDEV=6%). This was slightly higher than the
PCR efficiency of the reference standard Mosaic M genomic DNA
(average 88.4%). All four runs had linearity of R greater than 0.99
(Table 13) A typical standard curve is shown in FIG. 9.
TABLE-US-00013 TABLE 13 Individual Run Set Run Efficiency (%)
Linearity -R.sup.2 Run Set A 1 90.2 0.9996 2 89.7 0.9998 Run Set B
1 100.1 0.9953 2 86.2 0.996
Example 14--Calculation of aTL in a Test Sample
[0257] A. Conversion of Y3-Telotail PCR DNA Concentration to
Telomere Sequence Concentration.
[0258] The Y3-Telotail PCR product is a 268 bp long, double
stranded amplicon, wherein 135 bp of the amplicon are perfect
telomere repeats (TTAGGG:CCCTAA). The molecular weight ("MW") of
this amplicon is 165477.2. and the weight of one molecule of
amplicon is the MW divided by Avogadro's number. Thus, the weight
of the Y3-Telotail PCR product standard is:
165477.2/6.02.times.10.sup.23=2.74879.times.10.sup.-19 g.
The highest concentration of the standard (STD1) used in PCR
reaction was 2 pg/.mu.L DNA based on Picogreen measurement.
Therefore, the calculation to provide the number of molecules DNA
per .mu.L in STD1 is as follows:
2.times.10.sup.-12/2.74879.times.10.sup.-19=7275929.
Thus, multiplying the above by 135 yields the result that there are
982250 kb perfect telomere sequence per .mu.L in STD1. The equation
to convert telomere concentration calculated using the Y3 clone
standard to perfect telomere sequence concentration (kb per
.mu.l):
telomere concentration ( ng l ) .times. 982250 kb ( Value A ) .
##EQU00001##
[0259] B. Calculation of the Genome Copy Number Concentration Using
Human Beta-Globin Concentration.
[0260] The weight of one haploid human genome molecule is
3.59.times.10.sup.-3 ng. The human beta-globin concentration is one
measure of a single copy gene in the human genome. The genome copy
number concentration (copy number per .mu.L) per diploid for a
single copy gene such as beta-globin can then be calculated as
follows:
concentration (ng/uL)/(0.00359.times.2)(Value B).
[0261] C. Calculation of Absolute Telomere Length
[0262] The absolute telomere sequence per genome (in kb per genome)
is equal to the perfect telomere sequence concentration per genome
copy number concentration, which in turn is equal to the
calculation:
Value A/Value B,
where the values are calculated as described herein above. Thus,
aTL on each end of chromosome (in kb), is calculated as
follows:
(Value A/Value B)/92.
Example 15--Correlation of T/S Values and aTL
[0263] T/S ratios were determined using the methods described
herein and compared to aTL values derived using the calculations
described herein above. The comparison of three QC samples showed
that the values are highly correlated with R.sup.2 of 0.99998 (FIG.
10). Based on these data. the following formula was derived:
kbp=2.4555*(T/S)+0.005
In addition, a series of genomic DNA derived from the UMUC-3
bladder cancer cell line infected with the gene for the RNA
component of telomerase hTER were used to compare T/S ratios and
aTL. Similar results were obtained and the following formula was
derived for these data:
kbp=2.589*(T/S)-0.074
Data for the correlation of T/S and aTL for QC samples from two
independent runs using freshly prepared Y3 standards are shown
below in Table 14.
TABLE-US-00014 TABLE 14 aTL T/S Average Average Run Sample (kb)
Ratio aTL (kb) T/S 1 QC1 2.0271 0.7950 1.9200 0.7819 QC2 3.3204
1.3221 3.1199 1.2653 QC3 5.4852 2.1279 5.0825 2.0690 2 QC1 1.8128
0.7688 -- -- QC2 2.9195 1.2085 -- -- QC3 4.6798 2.0101 -- --
Example 16--Correlation of T/S and aTL with UMUC3-hTER Series
[0264] The relationship between telomere length in kbp and T/S
ratio (i.e., determining kbp per T/S units) was further assessed
using a cell line (UMUC3) that was transduced with RNA component
(TER) of telomerase, thus increasing telomerase activity and adding
TTAGGG repeats to the ends of chromosomes. This cell line was named
(UMUC3-TER). The length of telomeres in UMUC3-TER increased over
time as the cells expanded in culture. T/S was determined using the
assay described by Cawthon (Cawthon, R. M., Nucleic. Acids Res.,
2002, 30(10):e47). For each data point in FIG. 11, the y-axis
represents the average terminal restriction fragment length (TRF)
in kbp, determined as described herein, and the x-axis represents
the measured T/S ratio of the DNA sample. Since telomerase only
adds telomeric DNA to the ends of chromosome, the slope of the
curve is a direct measure of telomeric DNA per T/S units: which
from this experiment yields 2.45 kbp per T/S unit.
Example 17--Comparison of T/S to TRF by Southern Blot Analysis
[0265] As an third independent method of verifying the absolute
telomere length calculation, telomere length of the same UMUC3-hTER
series was measured using Southern blot analysis. Genomic DNA was
digested with HphI and MnlI, run on a 0.5% gel and probed with an
oligo comprising four telomeric repeats. To calculate telomeric
restriction fragment, the formula originally proposed by Harley et
al (Nature (1990) 345(6274):458-60) was used. This formula was also
used by Cawthon et al. to compare the T/S ratios and TRF (Cawthon,
R. M., Nucleic. Acids Res., 2002, 30(10):e47). Comparison of T/S
ratios using the assay described by Cawthon (Cawthon, R. M.,
Nucleic. Acids Res., 2002, 30(10):e47) and TRF results yielded the
following equation:
TRF=2.1518*(T/S)+1.4257(R.sup.2=0.97283).
The Y-intercept in this equation represents the average length of
the subtelomeric region (Cawthon, R. M., Nucleic. Acids Res., 2002,
30(10):e47), and the slope represents the factor for conversion of
T/S ratios to bp. Thus, in this assay:
kbp=2.1518*(T/S),
which provides a conversion factor of 2.15 kbp per T/S unit.
[0266] A similar methodology was used with samples of genomic DNA
derived from the human lung fibroblast IMR90. Farzaneh-Far R, et
al. (see Farazanch-Far, R., et al., (2010) PLoS ONE 5(1): e8612.
doi: 10.1371/journal.pone.0008612) reported that:
TRF=2.413*(T/S)+3.274.
[0267] Thus, using the above formula, there are 2.41 kbp per T/S
units, that is:
kbp=2.413*(T/S).
This is very similar to the conversion factor above. Without
wishing to be bound by a particular theory, it is possible that the
difference in the Y intercept (subtelomeric region length) is due
to the fact that in Lin et al., RaI and HinfI were used to digest
genomic DNA. HphI and MnlI (used in this report) are known to cut
closer to the telomeric region compared to RsaI and HinfI. In
addition, without wishing to be bound by a particular theory, two
different cell lines were used in the studies described herein and
in Farzaneh-Far R., et al. (see Farazanch-Far, R., et al., (2010)
PLoS ONE 5(1): e8612. doi:10.1371/journal.pone.008612). Thus, it is
possible that these cell lines have different subtelomeric
length.
Example 18--Aggregated aTL Conversion Factor
[0268] In summary, the aggregated telomere length conversion factor
to convert the T/S ratio to bp, the data in Table 15 are used. The
average for the conversion factor from the four results (from four
distinct methods) in Table 15 is 2.4 kbp per T/S unit, with a
standard deviation of 0.19 for the four estimates.
TABLE-US-00015 TABLE 15 Y3 aTL UMUC3-hTER standard* series**
Cawthon.dagger. Lin et al..dagger-dbl. 2.46 2.59 2.14 2.41
*Comparison of T/S ratios and aTL using three QC samples as
described herein. **Comparison of T/S ratios and aTL using
UMUC3-hTER samples as described herein. .dagger.Based on the data
from Cawthon, R. M., Nucleic Acids Res., 2009, 37(3): e21.
.dagger-dbl.Based on data from Farzaneh-Far R, et al. (see
Farazaneh-Far, R., et al., (2010) PLoS ONE 5(1): e8612. doi:
10.1371/journal.pone.0008612).
Example 19--Primer Impact on Quantitation of Canonical Telomere
Sequences
[0269] "Variant sequence" is a term that refers to sequences of DNA
frequently found within the sub-telomeric regions of DNA, but which
are not considered true telomeric sequences. True telomere repeat
sequences consist of blocks of CCCTAA:TTAGGG, while variant
sequences can contain blocks of "degenerate" telomere-like
sequences. One challenge for any method of telomere length
measurement is differentiating between the "true" or canonical
telomere and a series of repeats that vary from the canonical
repeats by a small number of base pairs, e.g. a 1-3 base-pair
variance from the canonical telomere sequence. Specific examples of
such variant or degenerate sequences include TGAGGG, TCAGGG,
TTGGGG, TTCGGG etc.
[0270] Experiments were carried out to compare amplification of
three different templates representing canonical or degenerate
target sequence repeats which were 90 nucleotides in length
(synthetic "ultramers"). The studies were carried out using
equimolar concentrations of the three different templates in order
to provide data showing enhanced specificity of the disclosed
primers for the canonical telomere repeats compared to a prior
standard that is frequently used, I.e. the primers described by
Cawthon (Cawthon. R. M., Nucleic. Acids Res., 2002, 30(10):e47).
The synthetic ultramers used are shown below in Table 16.
TABLE-US-00016 TABLE 16 SEQ ID NO. Ultramer Sequence 28
Tel-repeat/telomere (CCCTAA).sub.15 29 G-rich variant/degenerate1
(CCCTAA).sub.15 30 C-rich variant/degenerate2 (CCCTAA).sub.15
[0271] The assay was carried out using the disclosed triplex qPCR.
assay described herein above (see Example 1) with either the
Cawthon primers, TeloTest Tel 1b and Tel 2b primers (SEQ ID NOs: 20
and 21, respectively), or using the Tel G modified and Tel C
modified primers (SEQ ID NOs: 1 and 2, respectively). In the
figures, these assay conditions are referred to, respectively, as
"Triplex TT" or "ATL T."
[0272] In the first set of experiments, the Tel-repeat/telomere
ultramer representing the "true" telomere template was used (SEQ ID
NO: 28). As shown above, it is made up of 15 repeats of the
canonical CCCTAA telomere sequence. Evaluation of nine replicates
using the disclosed triplex qPCR assay showed a consistent `T`
concentration greater than that seen in the Cawthon 2002 assay (see
FIG. 13A). It should be noted that the initial (IX) ultramer DNA
concentration (1.67 ng/.mu.L) was calculated to mimic an average
genomic telomere length of 3 kb. The difference was magnified when
using a seven-fold higher concentration of the template ((11.69
ng/.mu.L; see FIG. 13B). At the initial ultramer DNA concentration,
the average T concentration of nine Tel-repeat replicates under the
disclosed conditions described herein above, using the disclosed
triplex qPCR assay was determined using the assay to be 0.15
ng/.mu.L (see FIG. 13C). In contrast, under the conditions of the
Cawthon 2002 assay, the T concentration was determined to be 0.11
ng/.mu.L using 1.times. template concentration (FIG. 13C). However,
when the ultramer DNA concentration was increased to 7.times., the
average T concentration were, respectively, 8.40 ng/.mu.L, and 1.83
ng/.mu.L, for the disclosed triplex qPCR assay and the Cawthon 2002
assay (see FIG. 13D). These data suggest that the tel G modified
and tel C modified primers have greater specificity for the
canonical telomere repeats than the TeloTest primers.
Example 20--Primer Impact on Quantitation of G-Rich Telomere-Like
Sequences
[0273] To represent one of the most common variant repeats found in
the telomere associated region located immediately proximal to the
canonical telomere repeats, the G-rich variant/degenerate1 ultramer
was used (SEQ ID NO: 29). As described above, this ultramer
sequence is made up of 15 repeats of CCCTCA sequence. Using the
Cawthon 2002 primers in the disclosed triplex qPCR assay resulted
in ten-fold excess amplification of the G-rich template compared to
using the Tel G modified and Tel C modified primers at the 1.times.
(see FIG. 14A) and 7.times. (see FIG. 14B) template concentration.
The 1.times. and 7.times. template concentration (1.67 and 11.69
ng/.mu.L, respectively), have the same meaning as described in the
immediately preceding example. The average T concentration of nine
G-rich variant replicates under the Cawthon 2002 assay conditions
was 4.30.times.10 ng/.mu.L, in contrast, using the disclosed
triplex qPCR assay yielded a T concentration of 3.06.times.10.sup.4
ng/.mu.L (see FIG. 14C). Similar values were seen when the template
concentration was increased to 7.times., i.e. 4.90.times.10.sup.-3
ng/.mu.L and 5.34.times.10.sup.-4 ng/.mu.L for the Cawthon 2002
assay and the disclosed triplex qPCR assay, respectively (see FIG.
14C). These data indicate that the tel G modified and tel C
modified primers of the present invention do not use the G-rich
variant repeat sequence, TGAGGG, as a template for amplification.
Additionally, these data, taken with the data in the preceding
example, suggest that the tel G modified and tel C modified primers
of the present invention have greater specificity for the canonical
telomere repeats.
Example 21--Primer Impact on Quantitation of C-Rich Telomere-Like
Sequences
[0274] Another of the common variant repeats found in the telomere
associated region is the C-rich variant, which is comprised of
CCCTGA sequence, represented by the C-rich variant/degenerate2
ultramer (SEQ 10 NO: 30). Similar to the data produced using the
G-rich variant as a template, the Cawthon 2002 assay resulted in a
10-fold excess amplification of the C-rich template compared to the
disclosed triplex qPCR assay at the 1.times. (see FIG. 15A) and
7.times. (see FIG. 15B) template concentration. The average T
concentration of nine C-rich variant replicates using the Cawthon
2002 assay was 3.99.times.10.sup.-3 ng/.mu.L, whereas, in contrast,
the disclosed triplex qPCR assay provided a T concentration of
3.06.times.10-4 ng/.mu.L (see FIG. 15C). Similar values were seen
when the template concentration was increased to 7.times.,
4.69.times.10.sup.-3 ng/.mu.L and 6.18.times.10.sup.-4 ng/.mu.L for
the Cawthon 2002 assay and the disclosed triplex qPCR assay,
respectively (see FIG. 15C). These data indicate that the tel G
modified and tel C modified primers of the present invention do not
use the C-rich variant repeat sequence, TCAGGG, as a template for
amplification. These data further demonstrate that the tel G
modified and tel C modified primers of the present invention have
greater specificity for the canonical telomere repeats.
[0275] Based on the data generated in this example and the
preceding two examples, it can be concluded that the Tel1b and
Tel2b primers amplify typical telomere variant repeats at a much
higher level than the tel 0 modified and tel C modified primers of
the present invention. Moreover, these data suggest that the
variant repeats are likely to contribute to higher T/S ratios
reported by the Cawthon 2002 assay. Collectively these data
surprisingly show that the el G modified and tel C modified primers
of the present invention more specifically amplify canonical
telomere repeats.
Example 22--Reproducibility and Precision
[0276] A multi-day, multi-operator study evaluating the total
variability of the disclosed triplex qPCR assay of the present
invention for measuring telomeric length was performed.
Specifically, each of 40 whole blood donor samples was assayed in
triplicate, on the same run by a single operator. The T/S ratio was
calculated for each of the 3 replicates, providing estimates of the
within run variance. The same assay/plate arrangement was then
repeated over 20 days, once in the morning and once in the evening,
using 3 different operators, for a total of 24 plate repeats.
Twenty-four (24) average telomere length ("ATL") assays were
performed, 12 ATL assays for samples 1-20 and 12 ATL assays for
samples 21-40, Each sample's measurements, from the multiple runs,
were analyzed using a random effects model with "run" being the
random effect. Estimates of within, between and total run
variability were obtained and the results are given below in Table
17.
TABLE-US-00017 TABLE 17 Disclosed Triplex Cawthon* Assay**
Intra-assay Precision (T/S ratio) 4.7% 3.2% Total
error/reproducibility 11.2% .sup. 6% *Cawthon 2002 assay using the
Tel1b and Tel2b primers. **Assay of the present invention using the
tel C modified and tel G modified primers with the RNase P and B2M
primers and probes as described herein above.
[0277] The foregoing results demonstrate the superiority of the
disclosed triplex qPCR assay for use in clinical settings. For
example, in any clinical use of quantitation of T/S ratio, e.g., to
assess the correlation of T/S to a given disease, there will a
threshold cut-off at a specific T'S ratio to discern differences in
a between a healthy and a `diseased` individual or population of
individuals, or between subjects or populations that need to be
treated differently (e.g., administered different drugs or
therapeutic agents, treatments, or dosage levels). Accordingly. the
reproducibility of the assay method around this cut-off defines the
individuals or populations which will unequivocally fall into
either the healthy or the at risk population, or need specific
treatments. It will be understood that the lower the CV/total error
for a given test method, the more reproducible will be results
reported using that method. In the foregoing, the 6% total
error/reproducibility observed for the disclosed triplex qPCR assay
is 6/11. or roughly two-fold enhanced reproducibility of the
Cawthon 2002 assay. Thus, the clinical utility of the disclosed
triplex qPCR assay will be enhanced by approximately this same
amount, due to the narrower `indeterminate` zone, and as a
consequent, more patients will be definitively reported as either a
healthy or a diseased sample, or needing specific treatments.
Example 23--Improved Amplification Efficiencies
[0278] Amplification efficiency refers to how close the template
amplification is to the theoretical maximum (100%), which is an
exact doubling of the concentration of the amplicon template during
each qPCR cycle. With the Cawthon 2002 (TeloTest assay),
amplification efficiencies for the telomere and the single copy
gene amplicons were typically in the 70-80%, and 85-95% range,
respectively. In contrast, the qPCR efficiencies with the disclosed
triplex qPCR assay for all three amplicons (I.e., the telomere
amplicon and two different single copy gene amplicons) are
typically in the 95-110% range, and often in the 98-101% range (see
Tables 5 and 8). This represents a significant and unexpected
improvement in quantitation of telomere length or telomere
abundance over the TeloTest assay.
Example 24--Comparison of Methods with Normal Subject
Population
[0279] 311 normal human whole blood samples were tested in both the
Cawthon 2002 assay and the disclosed triplex qPCR assay as
described herein above. The observed T'S ratio for each assay was
plotted and the data are shown in FIG. 16. The best fit equation
for the relationship between the T/S ratio results for the two
assays is:
Y=1.13.times.-0.06 R2=0.81.
[0280] The best fit equation yielded reasonable R2 and intercept
values, but the slope of 1.13 shows that the Cawthon 2002 assay was
reporting a higher T/S result than the more specific disclosed
triplex qPCR assay. This is consistent with the results observed
with the primer specificity described above. The difference between
mean T/S ratios observed was statistically significant with a shift
in TTS of 0.066 and a .rho.=4.times.10.sup.-6, indicating that the
difference in the assays is highly significant.
[0281] Additional analysis of the 313 normal blood sample results
was performed to assess how statistically `normal` the distribution
of T/S ratio results was with each of the two methods. The
distribution was assessed using Shapiro-Wild's Normality Test, in
which a higher .rho.-value reflects a more `normal` distribution.
The .rho.-values determined for each of the two assay methods are
shown below in Table 18, and surprisingly, they show a
significantly improved normal distribution for the disclosed
triplex qPCR assay.
TABLE-US-00018 TABLE 18 Normal .rho.-value.dagger. distribution
Cawthon* 3 .times. 10.sup.-5 Not normally distributed Disclosed
Triplex qPCR 0.105 Normally Assay** distributed *Cawthon 2002 assay
using the Tel1b and Tel2b primers. **Assay of the present invention
using the tel C modified and tel G modified primers with the RNase
P and B2M primers and probes as described herein above.
[0282] It will be apparent to those skilled in the art that various
modifications and variations can be made in the present disclosure
without departing from the scope or spirit of the invention. Other
embodiments of the invention will be apparent to those skilled in
the art from consideration of the specification and practice of the
invention disclosed herein. It is intended that the specification
and examples be considered as exemplary only, with a true scope and
spirit of the invention being indicated by the following
claims.
SEQUENCES
[0283] Various nucleotide sequences, their name, and associated SEQ
ID NO. are provided in Table 16 below.
TABLE-US-00019 TABLE 16 SEQ ID NO. Name Sequence 1 Tel G modified
ACACCTCCTCCATGGTTTGGGTTTGGGTTTGGGTTTGGGTTAG TG 2 Tel C modified
TGTTAGCGACGCGATATCCCTATCCCTATCCCTATCCCTAACA 3 .beta.2 microglobulin
CCAGCAGAGAATGGAAAGTCAA forward primer 4 .beta.2 microglobulin
TCTCTCTCCATTCTTCAGTAAGTCAACT reverse primer 5 .beta.2 microglobulin
ATGTGTCTGGGTTTCATCCATCCGACA probe 6 RNaseP forward
GTTCTCTGGGAACTCACCTCC primer 1 7 RNaseP reverse ATGTCCCTGGGAAGGTCTG
primer 1 8 RNase P probe 1 CCTAACAGGGCTCTCCCTGAG 9 RNaseP forward
TGGCCCTAGTCTCAGACCTT primer 2 10 RNaseP reverse
CGGAGGGAAGCTCATCAGTG primer 2 11 RNaseP probe 2 CTGAGTGCGTCCTGTCAC
12 Y3 clone CCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC
TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT
AACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTA ACCCTAACCCT 13 Core
telomere TTAGGG repeat sequence 14 Tcl-4rp
TGCTCGGCCGATCTGGCATCCCTAACCCTAACCCTAACCCTAA CC 15 SUS
GATGGATCCTGAGGGTGAGGGTGAGGG 16 M13 forward GTTGTAAAACGACGGCCAGT 17
M13 reverse TCACACAGGAAACAGCTATGA 18 TeloAnchor
TGCTCGGCCGATCTGGCATC Primer 19 TeloProbe CCCTAACCCTAACCCTAACCCTAA
20 Telotest primer CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT Tel1b 21
Telotest primer GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT Tel2b 22
PGK1-Forward AAGGGAAGCGGGTCGTTATG 23 PGK1-Reverse
GCAGAATTTGATGCTTGGGAC 24 ACTB-Forward TCACCATTGGCAATGAGCG 25
ACTB-Reverse TGGAGTTGAAGGTAGTTTCGTG 26 GAPDH-Forward
TGGACCTGACCTGCCGT 27 GAPDH-Reverse TGGAGGAGTGGGTGTCGC 28 Tel-repeat
(CCCTAA).sub.15 Ultramer 29 G-rich variant- (CCCTAA).sub.15
degenerate 1 30 C-rich variant- (CCCTAA).sub.15 degenerate 2
Sequence CWU 1
1
30145DNAArtificial SequenceSynthetic 1acacctcctc catggtttgg
gtttgggttt gggtttgggt tagtg 45243DNAArtificial SequenceSynthetic
2tgttagcgac gcgatatccc tatccctatc cctatcccta aca 43322DNAArtificial
SequenceSynthetic 3ccagcagaga atggaaagtc aa 22428DNAArtificial
SequenceSynthetic 4tctctctcca ttcttcagta agtcaact
28527DNAArtificial SequenceSynthetic 5atgtgtctgg gtttcatcca tccgaca
27621DNAArtificial SequenceSynthetic 6gttctctggg aactcacctc c
21720DNAArtificial SequenceSynthetic 7atgtcccttg ggaaggtctg
20821DNAArtificial SequenceSynthetic 8cctaacaggg ctctccctga g
21920DNAArtificial SequenceSynthetic 9tggccctagt ctcagacctt
201020DNAArtificial SequenceSynthetic 10cggagggaag ctcatcagtg
201118DNAArtificial SequenceSynthetic 11ctgagtgcgt cctgtcac
1812140DNAArtificial SequenceSynthetic 12cctaacctaa ccctaaccct
aaccctaacc ctaaccctaa ccctaaccct aaccctaacc 60ctaaccctaa ccctaaccct
aaccctaacc ctaaccctaa ccctaaccct aaccctaacc 120ctaaccctaa
ccctaaccct 1401312DNAArtificial SequenceSynthetic 13ttagggttag gg
121445DNAArtificial SequenceSynthetic 14tgctcggccg atctggcatc
cctaacccta accctaaccc taacc 451527DNAArtificial SequenceSynthetic
15gatggatcct gagggtgagg gtgaggg 271620DNAArtificial
SequenceSynthetic 16gttgtaaaac gacggccagt 201721DNAArtificial
SequenceSynthetic 17tcacacagga aacagctatg a 211820DNAArtificial
SequenceSynthetic 18tgctcggccg atctggcatc 201924DNAArtificial
SequenceSynthetic 19ccctaaccct aaccctaacc ctaa 242039DNAArtificial
SequenceSynthetic 20cggtttgttt gggtttgggt ttgggtttgg gtttgggtt
392139DNAArtificial SequenceSynthetic 21ggcttgcctt acccttaccc
ttacccttac ccttaccct 392220DNAArtificial SequenceSynthetic
22aagggaagcg ggtcgttatg 202321DNAArtificial SequenceSynthetic
23gcagaatttg atgcttggga c 212419DNAArtificial SequenceSynthetic
24tcaccattgg caatgagcg 192522DNAArtificial SequenceSynthetic
25tggagttgaa ggtagtttcg tg 222617DNAArtificial SequenceSynthetic
26tggacctgac ctgccgt 172718DNAArtificial SequenceSynthetic
27tggaggagtg ggtgtcgc 182890DNAArtificial SequenceSynthetic
28ccctaaccct aaccctaacc ctaaccctaa ccctaaccct aaccctaacc ctaaccctaa
60ccctaaccct aaccctaacc ctaaccctaa 902990DNAArtificial
SequenceArtificial SequenceSynthetic 29ccctcaccct caccctcacc
ctcaccctca ccctcaccct caccctcacc ctcaccctca 60ccctcaccct caccctcacc
ctcaccctca 903090DNAArtificial SequenceSynthetic 30ccctgaccct
gaccctgacc ctgaccctga ccctgaccct gaccctgacc ctgaccctga 60ccctgaccct
gaccctgacc ctgaccctga 90
* * * * *
References