U.S. patent application number 15/950819 was filed with the patent office on 2018-08-23 for polynucleotides for treating oncogenic viral polypeptide positive tumors.
The applicant listed for this patent is SANFORD HEALTH. Invention is credited to John H. LEE, Daniel W. VERMEER.
Application Number | 20180237477 15/950819 |
Document ID | / |
Family ID | 48873849 |
Filed Date | 2018-08-23 |
United States Patent
Application |
20180237477 |
Kind Code |
A1 |
LEE; John H. ; et
al. |
August 23, 2018 |
POLYNUCLEOTIDES FOR TREATING ONCOGENIC VIRAL POLYPEPTIDE POSITIVE
TUMORS
Abstract
This document relates to polynucleotides encoding antigenic
polypeptides to induce an immune response to oncogenic viral
polypeptides. Also provided are compositions comprising
polynucleotides encoding antigenic polypeptides, and methods of
use. In the provided methods, the virus can be a human papilloma
virus. In some embodiments, a method for killing a cell expressing
a first oncogenic viral polypeptide in a subject is provided. The
method includes administering to the subject a composition in an
amount sufficient to initiate an immune response against the first
oncogenic viral peptide, where the composition comprises a
pharmaceutically acceptable carrier and a polynucleotide provided
herein and the immune response is effective to cause a cytotoxic
effect in the cell. In some embodiments, the polynucleotide
includes a second nucleotide sequence encoding a second antigenic
polypeptide. The first oncogenic viral polypeptide can be E6 and
the second oncogenic viral polypeptide can be E7.
Inventors: |
LEE; John H.; (Sioux Falls,
SD) ; VERMEER; Daniel W.; (Sioux Falls, SD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SANFORD HEALTH |
Sioux Falls |
SD |
US |
|
|
Family ID: |
48873849 |
Appl. No.: |
15/950819 |
Filed: |
April 11, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15257198 |
Sep 6, 2016 |
9969779 |
|
|
15950819 |
|
|
|
|
14373844 |
Jul 22, 2014 |
9492526 |
|
|
PCT/US13/22696 |
Jan 23, 2013 |
|
|
|
15257198 |
|
|
|
|
61590089 |
Jan 24, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/5256 20130101;
A61K 2039/5258 20130101; A61K 2039/53 20130101; C12N 2710/20022
20130101; A61K 39/12 20130101; A61P 35/00 20180101; A61K 2039/585
20130101; C12N 2710/20032 20130101; A61K 2039/543 20130101; C12N
7/00 20130101; C12N 2710/20071 20130101; A61P 31/20 20180101; C07K
14/005 20130101; C12N 2710/20034 20130101; C12N 2710/10343
20130101; A61K 39/0011 20130101; C12N 2710/10042 20130101 |
International
Class: |
C07K 14/005 20060101
C07K014/005; C12N 7/00 20060101 C12N007/00; A61K 39/12 20060101
A61K039/12; A61K 39/00 20060101 A61K039/00 |
Claims
1. An isolated polynucleotide comprising a first nucleotide
sequence encoding a first antigenic polypeptide, wherein the first
antigenic polypeptide: a. comprises an amino acid sequence having
at least 70% sequence identity to the amino acid sequence of a
first oncogenic viral polypeptide; b. is capable of initiating an
immune response to the first oncogenic viral polypeptide in an
immune-competent host; and c. is non-oncogenic in the
immune-competent host.
2. The polynucleotide of claim 1, wherein the polynucleotide
comprises a second nucleotide sequence encoding a second antigenic
polypeptide, wherein the second antigenic polypeptide: a. comprises
an amino acid sequence having at least 70% sequence identity to the
amino acid sequence of a second oncogenic viral polypeptide; b. is
capable of initiating an immune response to the second oncogenic
viral polypeptide in the immune-competent host; and c. is
non-oncogenic in the immune-competent host.
3. The polynucleotide of claim 2, wherein the virus is a human
papilloma virus.
4. The polynucleotide of claim 3, wherein the first oncogenic viral
polypeptide is E6 and the second oncogenic viral polypeptide is
E7.
5. The polynucleotide of claim 4, wherein the first nucleotide
sequence encodes SEQ ID NO:2 having a mutation selected from the
group consisting of: a. a point mutation or deletion at L50; b. a
point mutation or deletion at E148; c. a point mutation or deletion
at T149; d. a point mutation or deletion at Q150; and e. a point
mutation or deletion at L151.
6. The polynucleotide of claim 4, wherein the second nucleotide
sequence encodes SEQ ID NO:4 having a mutation selected from the
group consisting of: a. a point mutation or deletion at H2; b. a
point mutation or deletion at C24; c. a point mutation or deletion
at E46; and d. a point mutation or deletion at L67.
7. The polynucleotide of claim 4, wherein the first nucleotide
sequence encodes SEQ ID NO:29 and the second nucleotide sequence
encodes SEQ ID NO:30.
8. A composition comprising: a. a pharmaceutically acceptable
carrier; and b. a polynucleotide, said polynucleotide comprising a
first nucleotide sequence encoding a first antigenic polypeptide,
wherein the first antigenic polypeptide: i. comprises an amino acid
sequence having at least 70% sequence identity to the amino acid
sequence of a first oncogenic viral polypeptide; ii. is capable of
initiating an immune response to the first oncogenic viral
polypeptide in an immune-competent host; and iii. is non-oncogenic
in the immune-competent host.
9. The composition of claim 8, wherein the polynucleotide comprises
a second nucleotide sequence encoding a second antigenic
polypeptide, wherein the second antigenic polypeptide: a. comprises
an amino acid sequence having at least 70% sequence identity to the
amino acid sequence of a second oncogenic viral polypeptide; b. is
capable of initiating an immune response to the second oncogenic
viral polypeptide in the immune-competent host; and c. is
non-oncogenic in the immune-competent host.
10. The composition of claim 9, wherein the virus is a human
papilloma virus.
11. The composition of claim 10, wherein the first oncogenic viral
polypeptide is E6 and the second oncogenic viral polypeptide is
E7.
12. The composition of claim 11, wherein the first nucleotide
sequence encodes SEQ ID NO:2 having a mutation selected from the
group consisting of: a. a point mutation or deletion at L50; b. a
point mutation or deletion at E148; c. a point mutation or deletion
at T149; d. a point mutation or deletion at Q150; and e. a point
mutation or deletion at L151.
13. The composition of claim 11, wherein the second nucleotide
sequence encodes SEQ ID NO:4 having a mutation selected from the
group consisting of: a. a point mutation or deletion at H2; b. a
point mutation or deletion at C24; c. a point mutation or deletion
at E46; and d. a point mutation or deletion at L67.
14. The composition of claim 11, wherein the first nucleotide
sequence encodes SEQ ID NO:29 and the second nucleotide sequence
encodes SEQ ID NO:30.
15. The composition of claim 8, wherein the pharmaceutically
acceptable carrier is an adenovirus envelope.
16. A method for killing a cell expressing a first oncogenic viral
polypeptide in a subject, the method comprising administering to
the subject a composition in an amount sufficient to initiate an
immune response against said first oncogenic viral peptide, the
composition comprising: a. a pharmaceutically acceptable carrier;
and b. a polynucleotide, said polynucleotide comprising a first
nucleotide sequence encoding a first antigenic polypeptide, wherein
the first antigenic polypeptide: i. comprises an amino acid
sequence having at least 70% sequence identity to the amino acid
sequence of a first oncogenic viral polypeptide; ii. is capable of
initiating an immune response to the first oncogenic viral
polypeptide in an immune-competent host; and iii. is non-oncogenic
in the immune-competent host; said immune response effective to
cause a cytotoxic effect in said cell.
17. The method of claim 16, wherein the polynucleotide comprises a
second nucleotide sequence encoding a second antigenic polypeptide,
wherein the second antigenic polypeptide: a. comprises an amino
acid sequence having at least 70% sequence identity to the amino
acid sequence of a second oncogenic viral polypeptide; b. is
capable of initiating an immune response to the second oncogenic
viral polypeptide in the immune-competent host; and c. is
non-oncogenic in the immune-competent host.
18. The method of claim 17, wherein said cell is part of a
neoplasia.
19. The method of claim 18, wherein said neoplasia is
malignant.
20. The method of claim 17, wherein the virus is a human papilloma
virus.
21.-25. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. patent
application Ser. No. 14/373,844 filed on Jul. 22, 2014, which is a
U.S. National phase of International Application No.
PCT/US2013/022696, filed on Jan. 23, 2013, which claims priority to
U.S. Provisional Application No. 61/590,089, filed Jan. 24, 2012,
the disclosures of which are incorporated herein by reference in
their entirety.
TECHNICAL FIELD
[0002] The various embodiments disclosed herein relate to viral
vaccines. In particular, the various embodiments relate to viral
vaccines for the treatment of cancer.
BACKGROUND
[0003] Some viruses, such as papilloma viruses (e.g., HPV16,
HPV18), retroviruses (e.g., HTLV, feline leukemia virus), herpes
viruses (e.g., Epstein Barr Virus), and hepatitis viruses (e.g.,
HBV), are known to cause cancer in humans and other animals. While
vaccines, which utilize viral coat proteins or virus-like
particles, are often successful at preventing infection, there is a
need for therapies that treat established disease and
virally-associated cancers.
SUMMARY
[0004] In some embodiments, an isolated polynucleotide is provided.
The isolated polynucleotide can include a first nucleotide sequence
encoding a first antigenic polypeptide, where the first antigenic
polypeptide comprises an amino acid sequence having at least 70%
sequence identity to the amino acid sequence of a first oncogenic
viral polypeptide, is capable of initiating an immune response to
the first oncogenic viral polypeptide in an immune-competent host,
and is non-oncogenic in the immune-competent host. In some
embodiments, the polynucleotide includes a second nucleotide
sequence encoding a second antigenic polypeptide, where the second
antigenic polypeptide comprises an amino acid sequence having at
least 70% sequence identity to the amino acid sequence of a second
oncogenic viral polypeptide, is capable of initiating an immune
response to the second oncogenic viral polypeptide in the
immune-competent host, and is non-oncogenic in the immune-competent
host.
[0005] The virus can be a human papilloma virus. The first
oncogenic viral polypeptide can be E6 and the second oncogenic
viral polypeptide can be E7.
[0006] The first nucleotide sequence can encode SEQ ID NO:2 having
a specific mutation, e.g., a point mutation or deletion at L50, a
point mutation or deletion at E148, a point mutation or deletion at
T149, a point mutation or deletion at Q150, or a point mutation or
deletion at L151. The first nucleotide sequence can encode SEQ ID
NO:29.
[0007] The second nucleotide sequence can encode SEQ ID NO:4 having
a specific mutation, e.g., a point mutation or deletion at H2, a
point mutation or deletion at C24, a point mutation or deletion at
E46, or a point mutation or deletion at L67. The second nucleotide
sequence can encode SEQ ID NO:30.
[0008] In some embodiments, a composition is provided. The
composition comprises a pharmaceutically acceptable carrier and a
polynucleotide provided herein. The polynucleotide can include a
first nucleotide sequence encoding a first antigenic polypeptide,
where the first antigenic polypeptide comprises an amino acid
sequence having at least 70% sequence identity to the amino acid
sequence of a first oncogenic viral polypeptide, is capable of
initiating an immune response to the first oncogenic viral
polypeptide in an immune-competent host, and is non-oncogenic in
the immune-competent host. In some embodiments, the polynucleotide
includes a second nucleotide sequence encoding a second antigenic
polypeptide, where the second antigenic polypeptide comprises an
amino acid sequence having at least 70% sequence identity to the
amino acid sequence of a second oncogenic viral polypeptide, is
capable of initiating an immune response to the second oncogenic
viral polypeptide in the immune-competent host, and is
non-oncogenic in the immune-competent host.
[0009] The virus in the provided compositions can be a human
papilloma virus. In the provided compositions, the first oncogenic
viral polypeptide can be E6 and the second oncogenic viral
polypeptide can be E7.
[0010] The first nucleotide sequence in the provided compositions
can encode SEQ ID NO:2 having a specific mutation, e.g., a point
mutation or deletion at L50, a point mutation or deletion at E148,
a point mutation or deletion at T149, a point mutation or deletion
at Q150, or a point mutation or deletion at L151. The first
nucleotide sequence in the provided compositions can encode SEQ ID
NO:29.
[0011] The second nucleotide sequence in the provided compositions
can encode SEQ ID NO:4 having a specific mutation, e.g., a point
mutation or deletion at H2, a point mutation or deletion at C24, a
point mutation or deletion at E46, or a point mutation or deletion
at L67. The second nucleotide sequence in the provided compositions
can encode SEQ ID NO:30.
[0012] In some embodiments of the provided compositions, the
pharmaceutically acceptable carrier in the provided compositions
can be an adenovirus envelope.
[0013] In some embodiments, a method for killing a cell expressing
a first oncogenic viral polypeptide in a subject is provided. The
method includes administering to the subject a composition in an
amount sufficient to initiate an immune response against the first
oncogenic viral peptide, where the composition comprises a
pharmaceutically acceptable carrier and a polynucleotide provided
herein and the immune response is effective to cause a cytotoxic
effect in the cell. The polynucleotide can include a first
nucleotide sequence encoding a first antigenic polypeptide, where
the first antigenic polypeptide comprises an amino acid sequence
having at least 70% sequence identity to the amino acid sequence of
a first oncogenic viral polypeptide, is capable of initiating an
immune response to the first oncogenic viral polypeptide in an
immune-competent host, and is non-oncogenic in the immune-competent
host. In some embodiments, the polynucleotide includes a second
nucleotide sequence encoding a second antigenic polypeptide, where
the second antigenic polypeptide comprises an amino acid sequence
having at least 70% sequence identity to the amino acid sequence of
a second oncogenic viral polypeptide, is capable of initiating an
immune response to the second oncogenic viral polypeptide in the
immune-competent host, and is non-oncogenic in the immune-competent
host.
[0014] In the provided methods, the virus can be a human papilloma
virus. In the provided methods, the first oncogenic viral
polypeptide can be E6 and the second oncogenic viral polypeptide
can be E7.
[0015] In the provided methods, the first nucleotide sequence can
encode SEQ ID NO:2 having a specific mutation, e.g., a point
mutation or deletion at L50, a point mutation or deletion at E148,
a point mutation or deletion at T149, a point mutation or deletion
at Q150, or a point mutation or deletion at L151. In the provided
methods, the first nucleotide sequence can encode SEQ ID NO:29.
[0016] In the provided methods, the second nucleotide sequence can
encode SEQ ID NO:4 having a specific mutation, e.g., a point
mutation or deletion at H2, a point mutation or deletion at C24, a
point mutation or deletion at E46, or a point mutation or deletion
at L67. In the provided methods, the second nucleotide sequence can
encode SEQ ID NO:30.
[0017] In some embodiments of the provided methods, the
pharmaceutically acceptable carrier can be an adenovirus
envelope.
[0018] In some embodiments of the provided methods, the cell can be
part of a neoplasia. In some embodiments of the provided methods,
the cell can be part of a malignant neoplasia.
[0019] While multiple embodiments are disclosed, still other
embodiments will become apparent to those skilled in the art from
the following detailed description, which shows and describes
illustrative embodiments of the invention. Accordingly, the
drawings and detailed description are to be regarded as
illustrative in nature and not restrictive.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] FIG. 1 is a schematic showing mutations in HPV16 E6 and
E7.
[0021] FIG. 2 shows tumor suppressor protein expression (A), HPV16
E6/E7 expression (B), and relative telomerase activity (RTA) (C) in
cells infected with a control retrovirus, a retrovirus encoding
wild type E6/E7, and a retrovirus encoding a mutant E6/E7.
[0022] FIG. 3 shows the growth characteristics of cells infected
with a control retrovirus (A), a retrovirus encoding wild type
E6/E7 (B), and a retrovirus encoding a mutant E6/E7 (C).
[0023] FIG. 4 shows the growth rate (A) and p53 expression of cells
infected with a control retrovirus (LXSN), a retrovirus encoding
wild type E6/E7, and a retrovirus encoding a mutant E6/E7 (B).
[0024] FIG. 5 shows the growth rate of cells infected with an
control adenovirus, an adenovirus encoding wild type E6/E7, and an
adenovirus encoding a mutant E6/E7.
[0025] FIG. 6 shows the interferon gamma response of splenocytes
from mice immunized with buffer control, control adenovirus (vector
control), or adenovirus encoding mutant E6/E7 exposed to the
indicated antigen.
[0026] FIG. 7 shows the IL-2 response of splenocytes from mice
immunized with buffer control, control adenovirus (vector control),
or adenovirus encoding mutant E6/E7 exposed to the indicated
antigen.
[0027] FIG. 8 shows HPV+ tumor growth in mice vaccinated with (A)
control adenovirus (vector control), (B) adenovirus encoding mutant
E6/E7, or (C) adenovirus encoding wild type E6/E7. Each line
indicates tumor growth in an individual mouse.
[0028] FIG. 9 shows survival in mice implanted with HPV+ cancer
cells and vaccinated with control adenovirus (Ad5 [E1-,E2b-]-null),
or adenovirus encoding mutant E6/E7 (Ad5
[El-,)E2b-]-E6.sup..DELTA./E7.sup..DELTA.).
DETAILED DESCRIPTION
[0029] The various embodiments disclosed herein relate to an
antigenic polypeptide that initiates an immune response to an
oncogenic viral polypeptide in an immune-competent host, but is
non-oncogenic in the immune-competent host. Also provided herein
are polynucleotides comprising a sequence encoding such an
antigenic polypeptide, compositions comprising such
polynucleotides, and methods of use.
[0030] As used herein, an oncogenic viral polypeptide is a
polypeptide encoded by a viral genome that, when expressed in a
host cell, transforms the cell. Oncogenic viral polypeptides
include, without limitation, HPV(human papilloma virus)16 E6, HPV16
E7, HPV18 E6, HPV18 E7, HBV (hepatitis B virus) HBXAg, HCV
(hepatitis C virus) core protein, HCV NS5A, HTLV (human T-cell
lymphotropic virus) TAX, EBV (Epstein-Barr virus) EBNA, and EBV
LMP-1. In some embodiments, an oncogenic viral polypeptide (e.g.,
HPV E6) is sufficient to transform a host cell alone. In other
embodiments, an oncogenic viral polypeptide transforms a host cell
only in the presence of one or more additional specific cofactors
(e.g., other viral oncogenes, host cell gene mutations). For
example, HPV E6 can immortalize cells that have a mutation in
ErbB2, which can induce invasive growth in some cells.
[0031] As used herein, an antigenic polypeptide is a polypeptide
that elicits an immune response when present in an immune-competent
host. As used herein, an immune-competent host is an animal capable
of producing an immune response that results in cytotoxicity (e.g.,
cytotoxic T-cell-mediated cytotoxicity or antibody-mediated
cytotoxicity).
[0032] The antigenic polypeptides provided herein are derived from
oncogenic viral polypeptides and contain at least one mutation
(e.g., a substitution, deletion, or addition of one or more amino
acid) as compared to the oncogenic viral polypeptides from which
they are derived. An antigenic polypeptide provided herein contains
at least one mutation that renders it non-oncogenic under the same
conditions under which the oncogenic viral polypeptide from which
it is derived transforms a host cell. Mutations that render an
oncogenic viral polypeptide non-oncogenic include those that
inactivate oncogenic functions, such as, but not limited to,
disrupting binding to tumor suppressor proteins, disrupting
activation domains, and disrupting binding to DNA. For example, an
antigenic polypeptide derived from HPV16 E6 can include a mutation
that disrupts a p53 binding site, a telomerase activation site, a
PDZ binding domain, or a combination thereof. In another example,
an antigenic polypeptide derived from HPV16 E7 can include a
mutation that disrupts an Rb protein binding site, an Mi2.beta.
binding site, or a combination thereof.
[0033] An antigenic polypeptide provided herein has at least 70%
sequence identity (e.g., at least 72%, at least 75%, at least 80%,
at least 85%, at least 95%, at least 96%, at least 98%, at least
99%, at least 99.5%, or at least 99.7% sequence identity, or from
70% to 99%, from 75% to 99%, from 80% to 99%, or from 88% to 99.9%
sequence identity) to an oncogenic viral polypeptide and elicits a
cytotoxic immune response to a cell that expresses the oncogenic
viral polypeptide. In some embodiments, an antigenic polypeptide
and the oncogenic viral polypeptide from which it is derived are
about 95.9% identical, about 96.7% identical, about 96.9%
identical, about 97.2% identical, about 97.9% identical, about
98.6% identical, about 99% identical, or about 99.3% identical.
Examples of antigenic polypeptides include SEQ ID NO:23, SEQ ID
NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ
ID NO:29, SEQ ID NO:30, and SEQ ID NO:31.
[0034] "Percent sequence identity" refers to the degree of sequence
identity between any given oncogenic viral polypeptide sequence,
e.g., SEQ ID NO:2 or SEQ ID NO:4, and an antigenic polypeptide
sequence derived therefrom. An antigenic polypeptide typically has
a length that is from 70% to 130% percent of the full length of the
oncogenic viral polypeptide from which it is derived, e.g., 71%,
74%, 75%, 77%, 80%, 82%, 85%, 87%, 89%, 90%, 93%, 95%, 97%, 99%,
100%, 105%, 110%, 115%, 120%, or 130% of the full length of the
oncogenic viral polypeptide from which it is derived. A percent
identity for any antigenic polypeptide relative to the oncogenic
viral polypeptide from which it is derived can be determined as
follows. An oncogenic viral polypeptide (e.g., SEQ ID NO:2 or SEQ
ID NO:4) is aligned to one or more candidate sequences using the
computer program available under the commercial name ClustalW
(version 1.83, default parameters), which allows alignments of
nucleic acid or polypeptide sequences to be carried out across
their entire length (global alignment). Chema et al., Nucleic Acids
Res., 31(13):3497-500 (2003).
[0035] ClustalW calculates the best match between a reference
(e.g., an oncogenic viral polypeptide) and one or more candidate
sequences (e.g., an antigenic polypeptide derived from an oncogenic
viral polypeptide), and aligns them so that identities,
similarities and differences can be determined. Gaps of one or more
residues can be inserted into a reference sequence, a candidate
sequence, or both, to maximize sequence alignments. For fast
pairwise alignment of nucleic acid sequences, the following default
parameters are used: word size: 2; window size: 4; scoring method:
percentage; number of top diagonals: 4; and gap penalty: 5. For
multiple sequence alignment of nucleic acid sequences, the
following parameters are used: gap opening penalty: 10.0; gap
extension penalty: 5.0; and weight transitions: yes. For fast
pairwise alignment of protein sequences, the following parameters
are used: word size: 1; window size: 5; scoring method: percentage;
number of top diagonals: 5; gap penalty: 3. For multiple alignment
of protein sequences, the following parameters are used: weight
matrix: blosum; gap opening penalty: 10.0; gap extension penalty:
0.05; hydrophilic gaps: on; hydrophilic residues: Gly, Pro, Ser,
Asn, Asp, Gln, Glu, Arg, and Lys; residue-specific gap penalties:
on. The ClustalW output is a sequence alignment that reflects the
relationship between sequences. ClustalW can be run, for example,
at the European Bioinformatics Institute site on the World Wide Web
(ebi.ac.uk/Tools/msa/clustalw2/), or downloaded from, for example,
the Clustal.org site on the World Wide Web
(clustal.org/clustal2/).
[0036] To determine percent identity of an antigenic polypeptide to
an oncogenic viral polypeptide, the sequences are aligned using
ClustalW, the number of identical matches in the alignment is
divided by the length of the reference sequence, and the result is
multiplied by 100. It is noted that the percent identity value can
be rounded to the nearest tenth. For example, 78.11, 78.12, 78.13,
and 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17,
78.18, and 78.19 are rounded up to 78.2.
[0037] Polynucleotides provided herein (e.g., SEQ ID NO:34) include
double stranded or single stranded, linear or circular DNA or RNA
that comprise a nucleotide sequence encoding an antigenic
polypeptide provided herein. In some embodiments, a polynucleotide
provided herein includes more than one nucleotide sequence, each
encoding an antigenic polypeptide. In some embodiments, a
polynucleotide can comprise a concatamer of nucleotide sequences
encoding the same antigenic polypeptide.
[0038] The polynucleotides provided herein also comprise one or
more nucleotide sequences operatively linked to a nucleotide
sequence encoding an antigenic polypeptide that promotes expression
of protein from the antigenic polypeptide nucleotide sequence(s)
contained therein. Such sequences include, without limitation,
promoters, enhancers, RNA stabilization sequences, internal
ribosomal entry sites (IRES), and protein stabilization sequences.
Promoters suitable for use in the provided polynucleotides include,
without limitation, SV40 early promoter, CMV immediate early
promoter, retroviral long terminal repeats (LTRs), regulatable
promoters (e.g., tetracycline or IPTG responsive promoters), and
RSV promoter.
[0039] When a plurality of nucleotide sequences encoding antigenic
polypeptides are included in a polynucleotide provided herein, the
polypeptides expressed therefrom can be expressed as separate
proteins, e.g., via separate promoters or through the use of an
IRES, or they can be expressed as fused proteins.
[0040] In some embodiments, a polynucleotide provided herein
includes a nucleotide sequence that encodes a protein tag (e.g.,
myc tag or FLAG tag) operatively linked to antigenic polypeptide
nucleotide sequence such that the tag is attached to the antigenic
polypeptide when expressed. As used herein, a protein tag is not
included in the antigenic polypeptide sequence for the purposes of
determining percent sequence identity to the oncogenic viral
polypeptide from which it is derived.
[0041] In some embodiments, the polynucleotides provided herein
include marker sequences that facilitate the detection of the
polynucleotides and/or protein expression from the polynucleotides.
In some embodiments, a marker sequence can encode a marker protein,
such as a fluorescent marker (e.g., GFP, RFP, or YFP) to facilitate
detection of protein expression from the polynucleotide. In other
embodiments, a marker sequence does not encode a protein, but can
be detected using nucleic acid detection techniques, such as
polymerase chain reaction. In some embodiments, a marker sequence
can be used to disrupt a region in an oncogenic viral polypeptide
that contributes to oncogenic activity of the oncogenic viral
polypeptide to produce an antigenic polypeptide. In such cases, the
marker sequence is not included in the antigenic polypeptide
sequence for the purposes of determining percent sequence identity
to the oncogenic viral polypeptide from which it is derived, and
the remaining sequence can retain 100% sequence identity to the
oncogenic viral polypeptide from which it is derived.
[0042] A polynucleotide provided herein can be produced using known
methods, such as site directed mutagenesis of an oncogenic viral
polypeptide-encoding polynucleotide (e.g., SEQ ID NO:1, SEQ ID
NO:3, and SEQ ID NO:5).
[0043] Any of the polynucleotides provided herein can be
incorporated into a pharmaceutically acceptable carrier.
Appropriate pharmaceutically acceptable carriers include, without
limitation, viral envelopes, cationic lipid carriers, autologous
cells, plasmid vectors, and viral vectors. When a polynucleotide
provided herein is incorporated into a viral envelope, it may
include one or more packaging sequences that support incorporation
into the envelope.
[0044] In certain implementations, a composition comprising a
polynucleotide provided herein and a pharmaceutically acceptable
carrier is formulated for introduction (e.g., enterally,
transdermally, intravenously, subcutaneously, or intramuscularly)
into an immune-competent host. In use, the composition is
administered to an immune-competent host at risk of infection by a
virus whose genome encodes an oncogenic viral polypeptide. In some
embodiments, the composition is administered to an immune-competent
host that has already been infected with such a virus, or has cells
(e.g., cancer cells) that express an oncogenic viral
polypeptide.
[0045] When administered to an immune-competent host, according to
one embodiment, a composition provided herein elicits a cytotoxic
immune response to a cell expressing an oncogenic viral
polypeptide. In some embodiments, administration of a composition
provided herein can be used to treat, ameliorate, and/or prevent
cancer associated with the expression of an oncogenic viral
polypeptide in a subject. In some embodiments, administration of a
composition provided herein can result in a reduction in a
population of cells expressing an oncogenic viral polypeptide. A
reduction in a population of cells expressing an oncogenic viral
polypeptide can be measured using any appropriate means, such as,
for example, measuring a change in size of a tumor comprising cells
expressing the oncogenic viral polypeptide, or measuring a change
in the number of circulating cancer cells expressing the oncogenic
viral polypeptide. In some embodiments, administration of a
composition provided herein to a population of subjects with a
cancer associated with the expression of an oncogenic viral
polypeptide can result in a longer average survival as compared to
a control population that has been similarly treated, but without
the administration of a composition provided herein.
[0046] In some embodiments, the compositions provided herein can be
used in combination with one or more standard therapies (e.g.,
radiation, surgery, or chemotherapy) to treat a subject having a
cancer associated with the expression of an oncogenic viral
polypeptide. When used in combination with a standard therapy, the
compositions provided herein can be administered before, during, or
after the administration of the standard therapy. In some
embodiments, the timing of administration of a composition provided
herein and/or a standard therapy can be adjusted to increase the
efficacy of one or both of the composition or the standard therapy.
For example, a composition provided herein can be administered as
an initial dose followed over time with additional booster doses to
increase immune response. In another example, a composition
provided herein can be administered before chemotherapy or after
immune recovery from chemotherapy to increase the likelihood of a
sufficient immune response.
[0047] The compositions provided herein can be dosed in an amount
sufficient to elicit a cytotoxic immune response. The dose can be
adjusted in order to elicit an immune response, yet not induce a
systemic adverse reaction to a carrier in the composition. For
example, when using an adenoviral carrier, an appropriate dosage
can be in the range of about 10.sup.8 to 10.sup.12 particles per
dose. In some embodiments, the dose amount and/or number of doses
can be adjusted depending on the type of sequences used to promote
expression of the encoded antigenic polypeptide, the strength of
the immune response in the subject, or the type of pharmaceutically
acceptable carrier used.
[0048] The compositions provided herein can be packaged as premixed
formulations or as separate components that can be mixed prior to
use. In some embodiments, the compositions provided herein can be
packaged in individual doses. In other embodiments, the
compositions provided herein can be packaged in containers
containing multiple dosages that are measured prior to
administration. In some embodiments, the compositions provided
herein can be formulated as a concentrate that is diluted before
administration. In yet other embodiments, the compositions provided
herein can be produced by mixing the separate components prior to
administration. Packaging can further include appropriate
documentation, labeling, and the like.
[0049] It is to be understood that the following examples are not
intended to limit the scope of the invention.
EXAMPLES
Example 1. Mutagenesis of HPV16 E6/E7 and Viral Construction
[0050] HPV16 E6/E7 mutagenesis. Six mutations in HPV16 E6 and E7
were introduced into a wild type E6/E7 encoding nucleic acid as
shown in FIG. 1 using in vitro site-directed mutagenesis. For the
mutation designated L50G, a leucine to glycine mutation was made at
position 50 in E6 within a p53 binding and telomerase activation
site domain. For the mutation designated PDZ, the C-terminal PDZ
binding domain of E6 at residues 146-151 was substituted with four
alanine residues. For the mutation designated H2P, a histidine
residue was substituted with a proline residue within an Rb binding
site in E7 at position 2. For the mutation designated C24G, a
cysteine residue was replaced with a glycine residue within an Rb
binding site in E7 at position 24. For the mutation designated
E46A, a glutamic acid residue was changed to alanine within an Rb
binding site in E7 at position 46. For the mutation designated
L67R, leucine to arginine mutation was made within an Mi2f3 binding
region of E7 at position 67. Site-directed mutagenesis was
performed on a nucleic acid encoding HPV16 E6 and E7 (SEQ ID NO:5)
as per manufacturer directions (Agilent Technologies #200521) using
the primers listed in Table 1.
TABLE-US-00001 TABLE 1 Mutation Forward primer Reverse primer L50G
GACTATTTTGCTTTTCGGGATGGA CCCATCTCTATATACTATGCATCCA TG (SEQ ID NO:
7) TC (SEQ ID NO: 8) PDZ GAACTCGTAGAGCAGCCGCGGCG
GTGTATCTCCATGCATGATTACGC TA (SEQ ID NO: 9) CG (SEQ ID NO: 10) H2P
CAGCCGCGGCGTAATCATGCCTG GCAATGTAGGTGTATCTCCAGGCA GA (SEQ ID NO: 11)
TG (SEQ ID NO: 12) C24G CCAGAGACAACTGATCTCTACGG
GCTGTCATTTAATTGCTCATAACCG TTA (SEQ ID NO: 13) TA (SEQ ID NO: 14)
E46A GGTCCAGCTGGACAAGCAGCACC GTAATGGGCTCTGTCCGGTGCTGC GG (SEQ ID
NO: 15) TT (SEQ ID NO: 16) L67R CGTGTGTGCTTTGTACGCACCTCC
GTGTGACTCTACGCTTCGGAGGTG GA (SEQ ID NO: 17) C (SEQ ID NO: 18)
[0051] The mutated construct was cloned into an adenoviral shuttle
vector Ad5 VQ. Fidelity of the final construct was verified by
direct DNA sequencing.
[0052] Viral construction. E1 and E2b deficient Ad5 CMV vectors
(empty vector designated [E1-, E2b-]) containing mutant E6/E7
(designated [E1-, E2b-]mut-E6/E7) and wildtype E6/E7 (designated
[E1-, E2b-]wt-E6/E7) were constructed and produced as previously
described (Amalfitano et al. (1998) J. Virol. 72(2):926-33).
Briefly, the wildtype and mutant E6/E7 sequences were sub-cloned
into the E1 region of the Ad5 [E1-, E2b-] vector using a homologous
recombination-based approach. The replication deficient virus was
propagated in the E.C7 packaging cell line, CsCl.sub.2 purified,
and titered. Viral infectious titer was determined as plaque
forming units (PFU) on an E.C7 cell monolayer. The viral particle
(VP) concentration was determined by sodium dodecyl sulfate (SDS)
disruption and spectrophotometry at 260 nm and 280 nm. The ratio of
VP to plaque forming units (PFU) was 36.7/1 VP/PFU. The mut-E6/E7
insert as well as wt-E6/E7 were then cut and ligated into the
retroviral vector pLXSN using EcoRI and BamHI restriction sites.
Retrovirus particles were generated in the Phoenix A cell line
according to recommended methods (Nolan Lab, Stanford University,
California) with polybrene (Sigma H9268) added to a final
concentration of 8 .mu.g/ml.
Example 2. Effect of E6/E7 Mutations on Oncogenesis
[0053] Oncogenesis in a human adenocarcinoma alveolar basal
epithelium cell line. To determine whether the mutated E6/E7
promoted oncogenesis, A549 cells (human adenocarcinoma alveolar
basal epithelium cell line) were infected with a retrovirus
containing wt-E6/E7 (SEQ ID NO:6), mut-E6/E7 (SEQ ID NO:31), or
control vector, and were ring cloned. Clones were analyzed by
western blot. FIG. 2A shows that expression of wt-E6/E7 decreases
PTPN13, pRb, and p53 protein expression while PTPN13, pRb, and p53
expression levels are similar to control in mut-E6/E7 expressing
cells. PCR analysis of clones confirmed that mut-E6/E7 was
expressed at levels similar to wt-E6/E7 (FIG. 2B) suggesting that
the changes evident by western blot were a consequence of altered
E6/E7 function rather than expression levels and confirm an
oncogenic loss-of-function in the mut-E6/E7 construct. Telomerase
activity was also examined in these clones. The mut-E6/E7 and
vector control showed significantly less relative telomerase
activity (RTA) compared to the wt-E6/E7 (FIG. 2C). Because wt-E6/E7
induces morphological mesenchymal type changes, the morphological
characteristics of clones were also examined. FIG. 3 shows that
control and mut-E6/E7 grow in tight colonies, while wt-E6/E7
expression induces a mesenchymal-like change in morphology and
cells grow in a non-adherent manner. Together, these data suggest
that, unlike expression of wt-E6/E7, stable expression of mut-E6/E7
does not induce the biochemical or morphological changes associated
with cellular transformation.
[0054] Transformation in primary human epithelial cells. To further
show that mut-E6/E7 does not transform cells, primary human tonsil
epithelia (HTE) were infected with retrovirus containing wt-E6/E7,
mut-E6/E7, or empty vector (LXSN). Uninfected HTE cells (HTE052)
served as an additional control. Expression of wt-E6/E7 results in
cellular immortalization. However, HTEs expressing mut-E6/E7 and as
well as controls, did not immortalize (FIG. 4A). These results
demonstrate that stable expression of the mut-E6/E7, even expressed
from an integrating retrovirus, does not result in cellular
immortalization.
[0055] To determine whether wt-E6/E7 or mut-E6/E7 in a
non-replicative adenoviral viral vector infection of primary human
tonsillar keratinocytes can result in transformation, HTE were
infected with [E1-, E2b-] expressing GFP, [E1-, E2b-]mut-E6/E7, or
[E1-, E2b-]wt-E6/E7. Wt-E6/E7 was able to induce loss of p53 (FIG.
4B) however neither wt-E6/E7 or mut-E6/E7 were able to immortalize
primary tonsil epithelial cells after infection (FIG. 5). To
determine if this was due to viral loss with replication we examine
persistence of viral DNA with cell growth. Q-PCR was performed and
demonstrated that, as cells replicated, viral DNA was lost at a
similar rate with all inserts, suggesting the viral genes did not
integrate into the host cell DNA. Therefore HPV genes in the [E1-,
E2b-] adenoviral vector does not persist with division and that
transient expression of wt-E6/E7 from a replication-deficient
adenoviral vector is not sufficient to transform primary cells.
[0056] Cell culture. A549 cells were grown in Dulbecco's Modified
Eagle Medium (Thermo Fisher #SH30022.01) supplemented with 10%
Fetal Bovine Serum (Thermo Fisher #SH3007103). Primary human tonsil
epithelial cells (HTE) were isolated from surgical tonsillectomy of
consented patients under institutional IRB approval using known
techniques (Williams et al. (2009) Head Neck. 31(7):911-8). Primary
HTE were maintained in Keratinocyte SFM media (KSFM, Invitrogen
#17005-042).
[0057] Retroviral infection. HTE and A549 cells were infected with
retroviral supernatant containing wt-E6/E7, mut-E6/E7, or empty
vector retrovirus and incubated at 37.degree. C. with 5% CO.sub.2
overnight. Media was aspirated 24 hours post-infection and fresh
media supplemented with neomycin (RPI #G64000) for selection.
Individual colonies were ring cloned and put under selection at 800
ug/ml neomycin. Data shown using retrovirally infected clones is
representative of multiple clones tested. Due to their density
dependence for cell growth, HTE cell lines were not placed under
antibiotic selection but maintained in KSFM until cell death or
immortalization.
[0058] Standard PCR was done to analyze mRNA in stable cell lines
expressing LXSN, LXSN wt-E6/E7, or LXSN mut-E6/E7 to validate that
the changes made in mut-E6/E7 did not affect E6/E7 transcription
rate. PCR was performed using E6/E7 forward primer
5'-CAAACCGTTGTGTGATTTGTTAATTA-3' (SEQ ID NO:19) and E6/E7 reverse
primer 5'-GCTTTTTGTCCAGATGTCTTTGC-3' (SEQ ID NO:20), and expression
levels were normalized to GADPH levels using GAPDH forward primer
5'-GGGAAGGTGAAGGTCGGAGT-3' (SEQ ID NO:21) and GAPDH reverse primer
5'-TGGAAGATGGTGATGGGATTTC-3' (SEQ ID NO:22). All primer
concentrations were 450 nM. Preincubation was 94.degree. C. for 10
min. Cycling conditions were 94.degree. C. for 40 sec, 55.degree.
C. for 40 sec, and 72.degree. C. for 1 min for a total of 30
cycles.
[0059] Adenoviral infection. Primary human tonsil epithelial cells
grown to 80% confluency were infected with [E1-, E2b-]null, [E1-,
E2b-]wt-E6/E7, [E1-, E2b-]mut-E6/E7 or Ad GFP at an MOI of 100 for
24 hours. DNA was collected at passages 4, 5 and 6 post-infection.
Cells were trypsinized, rinsed and resuspended in 1.times.
Phosphate Buffered Saline. DNA extraction was performed using
standard animal tissue spin-column protocol from DNeasy DNA Blood
and Tissue Kit (Qiagen #69504).
[0060] Q-PCR. Quantitative real-time polymerase chain reaction was
performed to assay for HPV16 copy number using HPV16 primer set 520
5'-TTGCAGATCATCAAGAACACGTAGA-3' (SEQ ID NO:32) and 671
5'-CTTGTCCAGCTGGACCATCTATTT-3' (SEQ ID NO:33). An 18S primer set
from Applied Biosystems was used as a control. The amplification
reaction included SyberGreen Universal Master Mix (Applied
Biosystems), 250 nM (HPV16 primer set) or 100 nM (18S primer set)
of each primer, and 25 ng template. Cycling conditions were
95.degree. C. for 10 minutes with 40 cycles at 95.degree. C. for 15
seconds and 60.degree. C. for 60 seconds using the Stratagene
Mx3000P thermocycler.
[0061] Western blot analysis. Stable cell lines A549 wt-E6/E7, A549
mut-E6/E7 and parental A549 cells were grown to 80-90% confluency,
rinsed with PBS and harvested with lysis solution (50mM Tris HCl pH
7.5; 150mM NaCl; 5 mM EDTA; 2 mM Na.sub.3VO.sub.4; 100 mM NaF; 10
mM NaPPi; 10% glycerol; 1% Triton; 1.times. Halt Protease
Inhibitors; 17.4 .mu.g/.mu.l PMSF). Membranes were pelleted by
centrifugation (10,000 rpm at 4.degree. C.) and soluble proteins
collected. Total protein was quantified using the BCA protein assay
kit as per the manufacturer's directions (Pierce) and equal total
protein was analyzed by western blot. Briefly, proteins were
separated by SDS-PAGE, transferred to PVDF-membranes (Immobilon-P),
blocked with either 5% bovine serum albumin (MP Biomedicals) or
non-fat dry milk, and visualized by chemiluminescnence on film or
via UVP bioimaging system (Upland, Calif.). Membranes were
incubated with the following antibodies: FAP-1(1:500, Santa Cruz
sc15356), p53 (1:500, Calbiochem OP43), pRb (1:250, BD Biosciences
554136) and GAPDH (1:5000, Ambion #Am4300)
Example 3. HPV Specific Cell Mediated Immune Response
[0062] Cell mediated immunity in response to mutant E6/E7. To
determine whether the mutations in E6/E7, rendering them
non-oncogenic, alter the ability to mount an HPV-specific immune
response in the context of the [E1-, E2b-] adenoviral vector in
vitro, spleens were harvested from control and immunized mice and
the ability of splenocytes to secrete IFN-.gamma. and IL-2 when
stimulated by E6/E7 or lysates from cells immortalized with E6/E7
was examined. Cell mediated immunity (CMI) responses were
determined in control non-vaccinated and vaccinated mice by
assessing the numbers of IFN-.gamma. and IL-2 secreting cells in
splenocytes harvested from groups of individual mice using
enzyme-linked immunospot (ELISpot) analysis. As shown in FIGS. 6
and 7, CMI responses were detected in mice immunized with Ad5 [E1-,
E2b-]mut-E6/E7. This was demonstrated by significantly elevated
levels of IFN-.gamma. (FIG. 6) and IL-2 (FIG. 7) spot forming cells
(SFC) induced in immunized mice but not control mice injected with
buffer solution or Ad5 [E1-, E2b-]null. Although the IL-2 SFC
responses were consistently lower than those observed for
IFN-.gamma., they were significantly elevated above control values.
The specificity of the CMI responses was demonstrated by a lack of
reactivity when splenocytes from all groups were exposed to
irrelevant antigens HIV-gag or CMV. The presence of functionally
active splenocytes in all groups of mice was verified by positive
responses to concanavalin A (ConA). These results indicate that the
non-oncogenic mut-E6/E7 is immunogenic and induces a HPV specific
E6/E7 immune response at or above the level of that induced by
wt-E6/E7 when expressed from an adenoviral vector.
[0063] Animal immunizations. All animal studies were performed
under approval by the institutional animal care and use review.
Male C57B1/6 mice 8 to 10 weeks old were injected three times
subcutaneously at 7 day intervals with a buffer solution (N=4),
10.sup.10 VP Ad5 [E1-, E2b-] null, or 10.sup.10 VP Ad5 [E1-, E2b-]
mut-E6/E7. A fourth immunization 2 weeks following the third
immunization served as an additional boost injection. Two weeks
after the last injection/immunization, all mice were sacrificed and
spleens harvested. Splenocytes were isolated for ELISpot testing.
Serum from each mouse was collected and stored at -20.degree. C.
until testing.
[0064] Cell culture. Mouse tonsil epithelial cells expressing HPV16
E6, E7, Ras, and luciferace (mEERL) (Williams et al. (2009) Head.
Neck. 31(7):911-8) were maintained in DMEM supplemented with 22.5%
Hams F-12 medium, 10% heat inactivated FCS, 100 U/mL penicillin,
100 .mu.g/mL streptomycin, 0.5 .mu.g/mL hydrocortisone, 0.0084
.mu.g/mL cholera toxin, 5 .mu.g/mL transferrin, 5 .mu.g/mL insulin,
0.00136 .mu.g/mL tri-iodo-thyronine, and 5 .mu.g/mL EGF.
[0065] HPV+ cell lysate preparation. HPV+ (mEERL) cells were grown
in two T125 flask until confluent, after which cells were
aseptically scraped off the plastic surface, washed three times
with sterile PBS, and re-suspended in 1 mL of sterile PBS. Cells
were lysed by freeze-thawing 3 times and cellular debris removed by
centrifugation. Soluble protein was brought to a final volume of 2
mL with sterile PBS. The presence of HPV-E7 in the lysate was
confirmed by western blot analysis performed as described elsewhere
(Gabitzsch et al. (2009) Immunol. Lett. 122(1):44-51).
[0066] ELISpot analysis. HPV16-E6 and E7 specific IFN-.gamma. and
IL-2 production from splenocytes isolated from individual mice
following immunizations was detected by ELISpot as described
elsewhere (Gabitzsch et al. (2009) Vaccine. 27(46):6394-8).
Briefly, cells were stimulated with HPV16 E6 and E7 peptides
(15-mer peptide complete sets for each; JPT Peptide Technologies,
Berlin, Germany). Peripheral blood mononuclear cells (PBMC) were
used at a concentration of 2.times.10.sup.5 cells/well and reported
as the number of spot forming cells (SFC) per 10.sup.6 cells per
well. All E6 peptides were combined and tested as a single pool.
Similarly, all E7 peptides were combined and tested as a single
pool. Each peptide pool was tested in duplicate. To test for
specificity, splenocytes were exposed to an HIV-gag peptide pool
and a cytomegalovirus (CMV) peptide pool. Peptides were utilized at
0.1 .mu.g of each peptide/well. To test for reactivity to mEERL
cell lysate, 25 .mu.L of lysate was added to test wells in
duplicate. In all ELISpot assays, cells stimulated with
concanavalin A (ConA) at a concentration of 1 .mu.g/well served as
positive controls. Colored SFC were counted using an Immunospot
ELISpot plate reader (Cellular Technology, Shaker Heights, Ohio)
and responses considered positive if, 1) 50 SFC were
detected/10.sup.6 cells after subtraction of the negative control
or 2) SFC were at least 2-fold greater than those in the negative
control wells and significantly elevated.
[0067] Statistical analysis. Statistically significant differences
in the mean immune responses between groups of animals were
determined by Student's t-test with a P-value of 0.05 or lower
being considered significant, using GraphPad Prism.RTM. (GraphPad
Software, Inc.).
Example 4. Survival in an HPV+ Tumor Model
[0068] To test whether an immune response to non-oncogenic
mut-E6/E7 would synergize with chemoradiation as wt-E6/E7 has been
demonstrated to do in an adenovirus background, a mouse model of
HPV+ related HNSCC was used. HPV+ tumors were generated in wildtype
mice which then received intranasal immunization with adenovirus
expressing mut-E6/E7 (Ad5 [E1-, E2b-]-E6.sup.66/E7.sup..DELTA.) or
adenovirus control (Ad5 [E1-,E2b-]-null) in conjunction with
cisplatin and radiation (cisplatin/xrt). Mice receiving only
cisplatin/xrt (historical data) or cisplatin/xrt+[E1-, E2b-] vector
control (Ad empty) had similar tumor growth and long term survival.
However, mice receiving mut-E6/E7 or wt-E6/E7 had significantly
improved survival. The mut-E6/E7 mice showed the best overall
control of tumor growth and survival (FIGS. 8 and 9). These data
confirm that mut-E6/E7 enhances immune related clearance in vivo
during standard therapy for HPV related cancer.
[0069] Cell culture. mEERL were maintained as described in Example
3.
[0070] HPV+ cell preparation. HPV+ (mEERL) cells were grown in a
single T125 flask until confluent, after which cells were scraped
off the plastic surface and washed.
[0071] Tumor models. Male C57B1J/6 mice were obtained from the
Jackson Labs and maintained by Sanford Research LARF in accordance
with USDA guidelines. All experiments were approved by Sanford
Research IACUC and performed within institutional guidelines.
Briefly, using a 23-gauge needle 1.times.10.sup.6 mEERL cells were
implanted subcutaneously in the right hind flank of mice. After
palpable tumors were present, on days 7, 14, and 21, mice were
given 10.sup.10 viral particles adenovirus control (Ad5
[E1-,E2b-]-null), or adenovirus encoding mut-E6/E7 (Ad5 [E1-,
E2b-]-E6.sup..DELTA./E7.sup..DELTA.) intranasally. Cisplatin was
dissolved in bacteriostatic 0.9% sodium chloride (Hospira Inc. Lake
Forest, Ill.) at 20mg/m.sup.2 and administered intraperitoneally at
13, 20, and 27 days post tumor implantation. Mice were treated with
8Gy X-ray radiation therapy (RadSource RS2000 irradiator,
Brentwood, Tenn.) concurrently with cisplatin treatment. Growth of
tumors was monitored weekly using caliper measurements and tumor
volume calculated using the following formula,
volume=(width.sup.2)(depth). Mice were euthanized when tumors
reached 1.5 cm in any dimension, the animal became emaciated, or
demonstrated functional leg impairment. Long-term survival was
followed for greater than 70 days. cl Example 5. Other Oncogenic
Viral Polypeptides
[0072] The approach outlined in Examples 1-4 can be used to produce
polypeptides derived from other oncogenic viral polypeptides that
are effective for initiating an immune response to the respective
oncogenic viral polypeptide.
[0073] In an example, one or both of EBV oncogenes LMP and EBNA are
altered to make them non-oncogenic. Such altered EBV oncogenes are
used as a therapy, either alone or in combination with cisplatin
and/or radiation, for nasopharyngeal cancer.
[0074] In another example, an HPV oncogene is altered in order to
treat Kaposi's Sarcoma.
[0075] Various modifications and additions can be made to the
exemplary embodiments discussed without departing from the scope of
the present invention. For example, while the embodiments described
above refer to particular features, the scope of this invention
also includes embodiments having different combinations of features
and embodiments that do not include all of the above described
features.
Sequence CWU 1
1
341456DNAHuman papillomavirus type 16 1atgtttcagg acccacagga
gcgacccaga aagttaccac agttatgcac agagctgcaa 60acaactatac atgatataat
attagaatgt gtgtactgca agcaacagtt actgcgacgt 120gaggtatatg
actttgcttt tcgggattta tgcatagtat atagagatgg gaatccatat
180gctgtatgtg ataaatgttt aaagttttat tctaaaatta gtgagtatag
acattattgt 240tatagtttgt atggaacaac attagaacag caatacaaca
aaccgttgtg tgatttgtta 300attaggtgta ttaactgtca aaagccactg
tgtcctgaag aaaagcaaag acatctggac 360aaaaagcaaa gattccataa
tataaggggt cggtggaccg gtcgatgtat gtcttgttgc 420agatcatcaa
gaacacgtag agaaacccag ctgtaa 4562151PRTHuman papillomavirus type 16
2Met Phe Gln Asp Pro Gln Glu Arg Pro Arg Lys Leu Pro Gln Leu Cys 1
5 10 15 Thr Glu Leu Gln Thr Thr Ile His Asp Ile Ile Leu Glu Cys Val
Tyr 20 25 30 Cys Lys Gln Gln Leu Leu Arg Arg Glu Val Tyr Asp Phe
Ala Phe Arg 35 40 45 Asp Leu Cys Ile Val Tyr Arg Asp Gly Asn Pro
Tyr Ala Val Cys Asp 50 55 60 Lys Cys Leu Lys Phe Tyr Ser Lys Ile
Ser Glu Tyr Arg His Tyr Cys 65 70 75 80 Tyr Ser Leu Tyr Gly Thr Thr
Leu Glu Gln Gln Tyr Asn Lys Pro Leu 85 90 95 Cys Asp Leu Leu Ile
Arg Cys Ile Asn Cys Gln Lys Pro Leu Cys Pro 100 105 110 Glu Glu Lys
Gln Arg His Leu Asp Lys Lys Gln Arg Phe His Asn Ile 115 120 125 Arg
Gly Arg Trp Thr Gly Arg Cys Met Ser Cys Cys Arg Ser Ser Arg 130 135
140 Thr Arg Arg Glu Thr Gln Leu 145 150 3297DNAHuman papillomavirus
type 16 3atgcatggag atacacctac attgcatgaa tatatgttag atttgcaacc
agagacaact 60gatctctact gttatgagca attaaatgac agctcagagg aggaggatga
aatagatggt 120ccagctggac aagcagaacc ggacagagcc cattacaata
ttgtaacctt ttgttgcaag 180tgtgactcta cgcttcggtt gtgcgtacaa
agcacacacg tagacattcg tactttggaa 240gacctgttaa tgggcacact
aggaattgtg tgccccatct gttctcagaa accataa 297498PRTHuman
papillomavirus type 16 4Met His Gly Asp Thr Pro Thr Leu His Glu Tyr
Met Leu Asp Leu Gln 1 5 10 15 Pro Glu Thr Thr Asp Leu Tyr Cys Tyr
Glu Gln Leu Asn Asp Ser Ser 20 25 30 Glu Glu Glu Asp Glu Ile Asp
Gly Pro Ala Gly Gln Ala Glu Pro Asp 35 40 45 Arg Ala His Tyr Asn
Ile Val Thr Phe Cys Cys Lys Cys Asp Ser Thr 50 55 60 Leu Arg Leu
Cys Val Gln Ser Thr His Val Asp Ile Arg Thr Leu Glu 65 70 75 80 Asp
Leu Leu Met Gly Thr Leu Gly Ile Val Cys Pro Ile Cys Ser Gln 85 90
95 Lys Pro 5753DNAHuman papillomavirus type 16 5atgtttcagg
acccacagga gcgacccaga aagttaccac agttatgcac agagctgcaa 60acaactatac
atgatataat attagaatgt gtgtactgca agcaacagtt actgcgacgt
120gaggtatatg actttgcttt tcgggattta tgcatagtat atagagatgg
gaatccatat 180gctgtatgtg ataaatgttt aaagttttat tctaaaatta
gtgagtatag acattattgt 240tatagtttgt atggaacaac attagaacag
caatacaaca aaccgttgtg tgatttgtta 300attaggtgta ttaactgtca
aaagccactg tgtcctgaag aaaagcaaag acatctggac 360aaaaagcaaa
gattccataa tataaggggt cggtggaccg gtcgatgtat gtcttgttgc
420agatcatcaa gaacacgtag agaaacccag ctgtaaatgc atggagatac
acctacattg 480catgaatata tgttagattt gcaaccagag acaactgatc
tctactgtta tgagcaatta 540aatgacagct cagaggagga ggatgaaata
gatggtccag ctggacaagc agaaccggac 600agagcccatt acaatattgt
aaccttttgt tgcaagtgtg actctacgct tcggttgtgc 660gtacaaagca
cacacgtaga cattcgtact ttggaagacc tgttaatggg cacactagga
720attgtgtgcc ccatctgttc tcagaaacca taa 7536249PRTHuman
papillomavirus type 16 6Met Phe Gln Asp Pro Gln Glu Arg Pro Arg Lys
Leu Pro Gln Leu Cys 1 5 10 15 Thr Glu Leu Gln Thr Thr Ile His Asp
Ile Ile Leu Glu Cys Val Tyr 20 25 30 Cys Lys Gln Gln Leu Leu Arg
Arg Glu Val Tyr Asp Phe Ala Phe Arg 35 40 45 Asp Leu Cys Ile Val
Tyr Arg Asp Gly Asn Pro Tyr Ala Val Cys Asp 50 55 60 Lys Cys Leu
Lys Phe Tyr Ser Lys Ile Ser Glu Tyr Arg His Tyr Cys 65 70 75 80 Tyr
Ser Leu Tyr Gly Thr Thr Leu Glu Gln Gln Tyr Asn Lys Pro Leu 85 90
95 Cys Asp Leu Leu Ile Arg Cys Ile Asn Cys Gln Lys Pro Leu Cys Pro
100 105 110 Glu Glu Lys Gln Arg His Leu Asp Lys Lys Gln Arg Phe His
Asn Ile 115 120 125 Arg Gly Arg Trp Thr Gly Arg Cys Met Ser Cys Cys
Arg Ser Ser Arg 130 135 140 Thr Arg Arg Glu Thr Gln Leu Met His Gly
Asp Thr Pro Thr Leu His 145 150 155 160 Glu Tyr Met Leu Asp Leu Gln
Pro Glu Thr Thr Asp Leu Tyr Cys Tyr 165 170 175 Glu Gln Leu Asn Asp
Ser Ser Glu Glu Glu Asp Glu Ile Asp Gly Pro 180 185 190 Ala Gly Gln
Ala Glu Pro Asp Arg Ala His Tyr Asn Ile Val Thr Phe 195 200 205 Cys
Cys Lys Cys Asp Ser Thr Leu Arg Leu Cys Val Gln Ser Thr His 210 215
220 Val Asp Ile Arg Thr Leu Glu Asp Leu Leu Met Gly Thr Leu Gly Ile
225 230 235 240 Val Cys Pro Ile Cys Ser Gln Lys Pro 245
726DNAArtificial Sequenceprimer 7gactattttg cttttcggga tggatg
26827DNAArtificial Sequenceprimer 8cccatctcta tatactatgc atccatc
27925DNAArtificial Sequenceprimer 9gaactcgtag agcagccgcg gcgta
251026DNAArtificial Sequenceprimer 10gtgtatctcc atgcatgatt acgccg
261125DNAArtificial Sequenceprimer 11cagccgcggc gtaatcatgc ctgga
251226DNAArtificial Sequenceprimer 12gcaatgtagg tgtatctcca ggcatg
261326DNAArtificial Sequenceprimer 13ccagagacaa ctgatctcta cggtta
261427DNAArtificial Sequenceprimer 14gctgtcattt aattgctcat aaccgta
271525DNAArtificial Sequenceprimer 15ggtccagctg gacaagcagc accgg
251626DNAArtificial Sequenceprimer 16gtaatgggct ctgtccggtg ctgctt
261726DNAArtificial Sequenceprimer 17cgtgtgtgct ttgtacgcac ctccga
261825DNAArtificial Sequenceprimer 18gtgtgactct acgcttcgga ggtgc
251926DNAArtificial Sequenceprimer 19caaaccgttg tgtgatttgt taatta
262023DNAArtificial Sequenceprimer 20gctttttgtc cagatgtctt tgc
232120DNAArtificial Sequenceprimer 21gggaaggtga aggtcggagt
202222DNAArtificial Sequenceprimer 22tggaagatgg tgatgggatt tc
2223151PRTArtificial SequenceHuman papillomavirus type 16 E6 L50G
mutant 23Met Phe Gln Asp Pro Gln Glu Arg Pro Arg Lys Leu Pro Gln
Leu Cys 1 5 10 15 Thr Glu Leu Gln Thr Thr Ile His Asp Ile Ile Leu
Glu Cys Val Tyr 20 25 30 Cys Lys Gln Gln Leu Leu Arg Arg Glu Val
Tyr Asp Phe Ala Phe Arg 35 40 45 Asp Gly Cys Ile Val Tyr Arg Asp
Gly Asn Pro Tyr Ala Val Cys Asp 50 55 60 Lys Cys Leu Lys Phe Tyr
Ser Lys Ile Ser Glu Tyr Arg His Tyr Cys 65 70 75 80 Tyr Ser Leu Tyr
Gly Thr Thr Leu Glu Gln Gln Tyr Asn Lys Pro Leu 85 90 95 Cys Asp
Leu Leu Ile Arg Cys Ile Asn Cys Gln Lys Pro Leu Cys Pro 100 105 110
Glu Glu Lys Gln Arg His Leu Asp Lys Lys Gln Arg Phe His Asn Ile 115
120 125 Arg Gly Arg Trp Thr Gly Arg Cys Met Ser Cys Cys Arg Ser Ser
Arg 130 135 140 Thr Arg Arg Glu Thr Gln Leu 145 150
24151PRTArtificial SequenceHuman papillomavirus type 16 E6 PDZ
mutant 24Met Phe Gln Asp Pro Gln Glu Arg Pro Arg Lys Leu Pro Gln
Leu Cys 1 5 10 15 Thr Glu Leu Gln Thr Thr Ile His Asp Ile Ile Leu
Glu Cys Val Tyr 20 25 30 Cys Lys Gln Gln Leu Leu Arg Arg Glu Val
Tyr Asp Phe Ala Phe Arg 35 40 45 Asp Leu Cys Ile Val Tyr Arg Asp
Gly Asn Pro Tyr Ala Val Cys Asp 50 55 60 Lys Cys Leu Lys Phe Tyr
Ser Lys Ile Ser Glu Tyr Arg His Tyr Cys 65 70 75 80 Tyr Ser Leu Tyr
Gly Thr Thr Leu Glu Gln Gln Tyr Asn Lys Pro Leu 85 90 95 Cys Asp
Leu Leu Ile Arg Cys Ile Asn Cys Gln Lys Pro Leu Cys Pro 100 105 110
Glu Glu Lys Gln Arg His Leu Asp Lys Lys Gln Arg Phe His Asn Ile 115
120 125 Arg Gly Arg Trp Thr Gly Arg Cys Met Ser Cys Cys Arg Ser Ser
Arg 130 135 140 Thr Arg Arg Ala Ala Ala Ala 145 150
2598PRTArtificial SequenceHuman papillomavirus type 16 E7 H2P
mutant 25Met Pro Gly Asp Thr Pro Thr Leu His Glu Tyr Met Leu Asp
Leu Gln 1 5 10 15 Pro Glu Thr Thr Asp Leu Tyr Cys Tyr Glu Gln Leu
Asn Asp Ser Ser 20 25 30 Glu Glu Glu Asp Glu Ile Asp Gly Pro Ala
Gly Gln Ala Glu Pro Asp 35 40 45 Arg Ala His Tyr Asn Ile Val Thr
Phe Cys Cys Lys Cys Asp Ser Thr 50 55 60 Leu Arg Leu Cys Val Gln
Ser Thr His Val Asp Ile Arg Thr Leu Glu 65 70 75 80 Asp Leu Leu Met
Gly Thr Leu Gly Ile Val Cys Pro Ile Cys Ser Gln 85 90 95 Lys Pro
2698PRTArtificial SequenceHuman papillomavirus type 16 E7 C24G
mutant 26Met His Gly Asp Thr Pro Thr Leu His Glu Tyr Met Leu Asp
Leu Gln 1 5 10 15 Pro Glu Thr Thr Asp Leu Tyr Gly Tyr Glu Gln Leu
Asn Asp Ser Ser 20 25 30 Glu Glu Glu Asp Glu Ile Asp Gly Pro Ala
Gly Gln Ala Glu Pro Asp 35 40 45 Arg Ala His Tyr Asn Ile Val Thr
Phe Cys Cys Lys Cys Asp Ser Thr 50 55 60 Leu Arg Leu Cys Val Gln
Ser Thr His Val Asp Ile Arg Thr Leu Glu 65 70 75 80 Asp Leu Leu Met
Gly Thr Leu Gly Ile Val Cys Pro Ile Cys Ser Gln 85 90 95 Lys Pro
2798PRTArtificial SequenceHuman papillomavirus type 16 E7 E46A
mutant 27Met His Gly Asp Thr Pro Thr Leu His Glu Tyr Met Leu Asp
Leu Gln 1 5 10 15 Pro Glu Thr Thr Asp Leu Tyr Cys Tyr Glu Gln Leu
Asn Asp Ser Ser 20 25 30 Glu Glu Glu Asp Glu Ile Asp Gly Pro Ala
Gly Gln Ala Ala Pro Asp 35 40 45 Arg Ala His Tyr Asn Ile Val Thr
Phe Cys Cys Lys Cys Asp Ser Thr 50 55 60 Leu Arg Leu Cys Val Gln
Ser Thr His Val Asp Ile Arg Thr Leu Glu 65 70 75 80 Asp Leu Leu Met
Gly Thr Leu Gly Ile Val Cys Pro Ile Cys Ser Gln 85 90 95 Lys Pro
2898PRTArtificial SequenceHuman papillomavirus type 16 E7 L67R
mutant 28Met His Gly Asp Thr Pro Thr Leu His Glu Tyr Met Leu Asp
Leu Gln 1 5 10 15 Pro Glu Thr Thr Asp Leu Tyr Cys Tyr Glu Gln Leu
Asn Asp Ser Ser 20 25 30 Glu Glu Glu Asp Glu Ile Asp Gly Pro Ala
Gly Gln Ala Glu Pro Asp 35 40 45 Arg Ala His Tyr Asn Ile Val Thr
Phe Cys Cys Lys Cys Asp Ser Thr 50 55 60 Leu Arg Arg Cys Val Gln
Ser Thr His Val Asp Ile Arg Thr Leu Glu 65 70 75 80 Asp Leu Leu Met
Gly Thr Leu Gly Ile Val Cys Pro Ile Cys Ser Gln 85 90 95 Lys Pro
29151PRTArtificial SequenceHuman papillomavirus type 16 E6 L50G/PDZ
mutant 29Met Phe Gln Asp Pro Gln Glu Arg Pro Arg Lys Leu Pro Gln
Leu Cys 1 5 10 15 Thr Glu Leu Gln Thr Thr Ile His Asp Ile Ile Leu
Glu Cys Val Tyr 20 25 30 Cys Lys Gln Gln Leu Leu Arg Arg Glu Val
Tyr Asp Phe Ala Phe Arg 35 40 45 Asp Gly Cys Ile Val Tyr Arg Asp
Gly Asn Pro Tyr Ala Val Cys Asp 50 55 60 Lys Cys Leu Lys Phe Tyr
Ser Lys Ile Ser Glu Tyr Arg His Tyr Cys 65 70 75 80 Tyr Ser Leu Tyr
Gly Thr Thr Leu Glu Gln Gln Tyr Asn Lys Pro Leu 85 90 95 Cys Asp
Leu Leu Ile Arg Cys Ile Asn Cys Gln Lys Pro Leu Cys Pro 100 105 110
Glu Glu Lys Gln Arg His Leu Asp Lys Lys Gln Arg Phe His Asn Ile 115
120 125 Arg Gly Arg Trp Thr Gly Arg Cys Met Ser Cys Cys Arg Ser Ser
Arg 130 135 140 Thr Arg Arg Ala Ala Ala Ala 145 150
3098PRTArtificial SequenceHuman papillomavirus type 16 E7 H2P/C24G/
E46A/L67R mutant 30Met Pro Gly Asp Thr Pro Thr Leu His Glu Tyr Met
Leu Asp Leu Gln 1 5 10 15 Pro Glu Thr Thr Asp Leu Tyr Gly Tyr Glu
Gln Leu Asn Asp Ser Ser 20 25 30 Glu Glu Glu Asp Glu Ile Asp Gly
Pro Ala Gly Gln Ala Ala Pro Asp 35 40 45 Arg Ala His Tyr Asn Ile
Val Thr Phe Cys Cys Lys Cys Asp Ser Thr 50 55 60 Leu Arg Arg Cys
Val Gln Ser Thr His Val Asp Ile Arg Thr Leu Glu 65 70 75 80 Asp Leu
Leu Met Gly Thr Leu Gly Ile Val Cys Pro Ile Cys Ser Gln 85 90 95
Lys Pro 31249PRTArtificial SequenceHPV type 16 E6 L50G/PDZ E7
H2P/C24G/ E46A/L67R mutant 31Met Phe Gln Asp Pro Gln Glu Arg Pro
Arg Lys Leu Pro Gln Leu Cys 1 5 10 15 Thr Glu Leu Gln Thr Thr Ile
His Asp Ile Ile Leu Glu Cys Val Tyr 20 25 30 Cys Lys Gln Gln Leu
Leu Arg Arg Glu Val Tyr Asp Phe Ala Phe Arg 35 40 45 Asp Gly Cys
Ile Val Tyr Arg Asp Gly Asn Pro Tyr Ala Val Cys Asp 50 55 60 Lys
Cys Leu Lys Phe Tyr Ser Lys Ile Ser Glu Tyr Arg His Tyr Cys 65 70
75 80 Tyr Ser Leu Tyr Gly Thr Thr Leu Glu Gln Gln Tyr Asn Lys Pro
Leu 85 90 95 Cys Asp Leu Leu Ile Arg Cys Ile Asn Cys Gln Lys Pro
Leu Cys Pro 100 105 110 Glu Glu Lys Gln Arg His Leu Asp Lys Lys Gln
Arg Phe His Asn Ile 115 120 125 Arg Gly Arg Trp Thr Gly Arg Cys Met
Ser Cys Cys Arg Ser Ser Arg 130 135 140 Thr Arg Arg Ala Ala Ala Ala
Met Pro Gly Asp Thr Pro Thr Leu His 145 150 155 160 Glu Tyr Met Leu
Asp Leu Gln Pro Glu Thr Thr Asp Leu Tyr Gly Tyr 165 170 175 Glu Gln
Leu Asn Asp Ser Ser Glu Glu Glu Asp Glu Ile Asp Gly Pro 180 185 190
Ala Gly Gln Ala Ala Pro Asp Arg Ala His Tyr Asn Ile Val Thr Phe 195
200 205 Cys Cys Lys Cys Asp Ser Thr Leu Arg Arg Cys Val Gln Ser Thr
His 210 215 220 Val Asp Ile Arg Thr Leu Glu Asp Leu Leu Met Gly Thr
Leu Gly Ile 225 230 235 240 Val Cys Pro Ile Cys Ser Gln Lys Pro 245
3225DNAArtificial Sequenceprimer 32ttgcagatca tcaagaacac gtaga
253323DNAArtificial Sequenceprimer 33cttgtccagc tggaccatct att
2334755DNAArtificial SequenceHPV type 16 E6 L50G/PDZ E7
H2P/C24G/
E46A/L67R mutant 34atgtttcagg acccacagga gcgacccaga aagttaccac
agttatgcac agagctgcaa 60acaactatac atgatataat attagaatgt gtgtactgca
agcaacagtt actgcgacgt 120gaggtatatg actttgcttt tcgggatgga
tgcatagtat atagagatgg gaatccatat 180gctgtatgtg ataaatgttt
aaagttttat tctaaaatta gtgagtatag acattattgt 240tatagtttgt
atggaacaac attagaacag caatacaaca aaccgttgtg tgatttgtta
300attaggtgta ttaactgtca aaagccactg tgtcctgaag aaaagcaaag
acatctggac 360aaaaagcaaa gattccataa tataaggggt cggtggaccg
gtcgatgtat gtcttgttgc 420agatcatcaa gaactcgtag agcagccgcg
gcgtaatcat gcctggagat acacctacat 480tgcatgaata tatgttagat
ttgcaaccag agacaactga tctctacggt tatgagcaat 540taaatgacag
ctcagaggag gaggatgaaa tagatggtcc agctggacaa gcagcaccgg
600acagagccca ttacaatatt gtaacctttt gttgcaagtg tgactctacg
cttcggaggt 660gcgtacaaag cacacacgta gacattcgta ctttggaaga
cctgttaatg ggcacactag 720gaattgtgtg ccccatctgt tctcagaaac cataa
755
* * * * *