U.S. patent application number 15/955103 was filed with the patent office on 2018-08-23 for competitive and effective bacterial strains.
This patent application is currently assigned to NOVOZYMES BIOLOGICALS, INC.. The applicant listed for this patent is NOVOZYMES BIOLOGICALS, INC.. Invention is credited to Yaowei Kang, Shawn Semones, Jessica Smith, Kristi Woods.
Application Number | 20180237354 15/955103 |
Document ID | / |
Family ID | 45929639 |
Filed Date | 2018-08-23 |
United States Patent
Application |
20180237354 |
Kind Code |
A1 |
Kang; Yaowei ; et
al. |
August 23, 2018 |
COMPETITIVE AND EFFECTIVE BACTERIAL STRAINS
Abstract
According to the present invention new isolates of bacterial
strains have been shown to possess unique properties. These
bacterial strains are plant growth-promoting rhizobacterium (PGPR),
posses an enhanced competitive advantage at colonizing leguminous
plants, and enhance the overall performance of leguminous plant
growth. Further still, the present invention discloses a novel
method for screening and selecting bacterial strains having the
aforementioned beneficial characteristics.
Inventors: |
Kang; Yaowei; (Durham,
NC) ; Semones; Shawn; (Salem, VA) ; Smith;
Jessica; (Bagsaverd, DK) ; Woods; Kristi;
(Salem, VA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
NOVOZYMES BIOLOGICALS, INC. |
Salem |
VA |
US |
|
|
Assignee: |
NOVOZYMES BIOLOGICALS, INC.
Salem
VA
|
Family ID: |
45929639 |
Appl. No.: |
15/955103 |
Filed: |
April 17, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15265345 |
Sep 14, 2016 |
9975816 |
|
|
15955103 |
|
|
|
|
14636829 |
Mar 3, 2015 |
9586870 |
|
|
15265345 |
|
|
|
|
13436268 |
Mar 30, 2012 |
8999698 |
|
|
14636829 |
|
|
|
|
61470145 |
Mar 31, 2011 |
|
|
|
61583413 |
Jan 5, 2012 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A01N 63/10 20200101;
A01N 63/00 20130101; C12R 1/01 20130101; C12R 1/41 20130101; A01N
43/90 20130101; C05F 11/08 20130101; A01N 43/16 20130101 |
International
Class: |
C05F 11/08 20060101
C05F011/08; A01N 63/02 20060101 A01N063/02; A01N 43/90 20060101
A01N043/90; A01N 43/16 20060101 A01N043/16; A01N 63/00 20060101
A01N063/00; C12R 1/41 20060101 C12R001/41; C12R 1/01 20060101
C12R001/01 |
Claims
1. A non-naturally occurring composition comprising at least one
of: the Bradyrhizobia japonicum strain having the deposit accession
number NRRL B-50586; the Bradyrhizobia japonicum strain having the
deposit accession number NRRL B-50587; the Bradyrhizobia japonicum
strain having the deposit accession number NRRL B-50588; the
Bradyrhizobia japonicum strain having the deposit accession number
NRRL B-50589; the Bradyrhizobia japonicum strain having the deposit
accession number NRRL B-50590; the Bradyrhizobia japonicum strain
having the deposit accession number NRRL B-50591; the Bradyrhizobia
japonicum strain having the deposit accession number NRRL B-50592;
the Bradyrhizobia japonicum strain having the deposit accession
number NRRL B-50593; the Bradyrhizobia japonicum strain having the
deposit accession number NRRL B-50594; the Bradyrhizobia japonicum
strain having the deposit accession number NRRL B-50726; the
Bradyrhizobia japonicum strain having the deposit accession number
NRRL B-50727; the Bradyrhizobia japonicum strain having the deposit
accession number NRRL B-50728; the Bradyrhizobia japonicum strain
having the deposit accession number NRRL B-50729; and the
Bradyrhizobia japonicum strain having the deposit accession number
NRRL B-50730.
2. The non-naturally occurring composition of claim 1, wherein said
composition is formulated as a liquid inoculant.
3. The non-naturally occurring composition of claim 1, wherein said
composition is formulated as a solid inoculant.
4. The non-naturally occurring composition of claim 1, further
comprising at least one lipo-chitooligosaccharide (LCO).
5. The non-naturally occurring composition of claim 1, further
comprising at least one chitooligosaccharide (CO).
6. The non-naturally occurring composition of claim 1, further
comprising at least one flavonoid.
7. The non-naturally occurring composition of claim 1, further
comprising at least one phosphate solubilising microorganism.
8. The non-naturally occurring composition of claim 1, further
comprising at least one strain of Penicillium.
9. The non-naturally occurring composition of claim 1, further
comprising at least one strain of Penicillium bilaiae.
10. The non-naturally occurring composition of claim 9, wherein
said at least one strain of Penicillium bilaiae comprises the
strain of P. bilaiae having the deposit accession number ATCC
18309.
11. The non-naturally occurring composition of claim 9, wherein
said at least one strain of Penicillium bilaiae comprises the
strain of P. bilaiae having the deposit accession number ATCC
20851.
12. The non-naturally occurring composition of claim 9, wherein
said at least one strain of Penicillium bilaiae comprises the
strain of P. bilaiae having the deposit accession number ATCC
22348.
13. The non-naturally occurring composition of claim 9, wherein
said at least one strain of Penicillium bilaiae comprises the
strain of P. bilaiae having the deposit accession number NRRL
50162.
14. The non-naturally occurring composition of claim 9, wherein
said at least one strain of Penicillium bilaiae comprises the
strain P. bilaiae having the deposit accession number NRRL
50169.
15. The non-naturally occurring composition of claim 1, further
comprising at least one strain of Penicillium gaestrivorus.
16. The non-naturally occurring composition of claim 15, wherein
said at least one strain of Penicillium gaestrivorus the strain of
P. gaestrivorus having the deposit accession number NRRL 50170.
17. The non-naturally occurring composition of claim 1, further
comprising at least one agriculturally acceptable pesticide.
18. A coated seed characterized in that the coating comprises the
non-naturally occurring composition of claim 1.
19. A method comprising applying the non-naturally occurring
composition of claim 1 to a plant or plant part.
20. A method comprising introducing the non-naturally occurring
composition of claim 1 into a plant growth medium.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 15/265,345 filed Sep. 14, 2016, now allowed, which is a
continuation of U.S. application Ser. No. 14/636,829 filed on Mar.
3, 2015, now U.S. Pat. No. 9,586,870, which is continuation of U.S.
application Ser. No. 13/436,268 filed on Mar. 30, 2012, now U.S.
Pat. No. 8,999,698, which claims the benefit under 35 U.S.C. 119 of
U.S. provisional application Nos. 61/470,145 and 61/583,413 filed
Mar. 31, 2011 and Jan. 5, 2012, respectively, the contents of which
are fully incorporated herein by reference.
REFERENCE TO SEQUENCE LISTING
[0002] This application contains a Sequence Listing in computer
readable form. The computer readable form is incorporated herein by
reference.
REFERENCE TO A DEPOSIT OF BIOLOGICAL MATERIAL
[0003] This application contains a reference to a deposit of
biological material, which deposit is incorporated herein by
reference. For complete information see Table 1.
FIELD OF THE INVENTION
[0004] The present invention relates to isolated bacterial strains,
and a method of selecting bacterial strains having enhanced
competitiveness and performance characteristics.
BACKGROUND OF THE INVENTION
[0005] In order to maintain healthy growth, plants must extract a
variety of elements from the soil in which they grow. These
elements include nitrogen and the so-called micro-nutrients (e.g.,
copper, iron and zinc), but many soils are deficient in such
elements or they contain them only in forms which cannot be readily
taken up by plants (it is generally believed that essential
elements cannot be readily taken up by plants unless they are
present in dissolved form in the soil). Nitrogen is an essential
element for most plants as it plays a role in the synthesis of
amino acids, proteins, nucleotides, nucleic acids, chlorophyll,
co-enzymes and in the overall growth and health of the plant. To
counteract such deficiencies, sources of the deficient elements are
commonly applied to soils in order to improve growth rates and
yields obtained from crop plants. For example, nitrate and/or
ammonium is often added to soil to counteract a lack of available
nitrogen.
[0006] In the field of crop science, it is well known that many
cultivated crops require that the soil provide relatively large
amounts of nitrogen to the plant. The notable exceptions to those
plants requiring nitrogen via the soil are plants from the legume
family.
[0007] Specifically, leguminous plants are unique from
non-leguminous plants in their ability to fix atmospheric nitrogen
into ammonia. The ability to fix atmospheric nitrogen into a
useable nitrogen source for the plant obviates the need for the
plant to obtain nitrogen from the soil. Nitrogen fixation, however,
requires a symbiotic relationship between the leguminous plant and
native bacterial within the soil. One of the most extensively
studied partners in this symbiotic relationship is bacteria
belonging to the genus Bradyrhizobium or Rhizobium. Gresshoff, P.
(1999). Identification of Plant Genes Involved in Plant-Microbe
Interactions. Stacey, G. & Keen, T. (Ed.), Plant-Microbe
Interactions (4th ed.) (Ch. 6). St. Paul: APS Press.
[0008] Symbiosis is generally achieved through an exchange of
complex bidirectional signaling between the plant and the microbe
and the microbe and the plant. Typically, plant factors, such as
flavonoids and flavonoid like substances, induce colonization of
the bacteria into the root nodule of the leguminous plant.
(Gresshoff, 1999). Once the bacteria has colonized the root nodule,
the bacteria effect morphological changes in the plant, namely root
hair curling and the development of a new root organ--the nodule.
(Gresshoff, 1999). The nodule permits the establishment of a new
physiological environment for the nodule inducing bacteria to
differentiate into a nitrogen-fixing endosymbiont, or bacteriod,
for the colonized plant. (Gresshoff, 1999).
[0009] It is well known that Rhizobial motility and chemotaxis are
important attributes for strain competiveness. For example,
Althabegoiti, et al., 2008, FEMS Microbiol. Lett. 282: 115-123
discusses deriving a spontaneous mutant strain from USDA 110 having
increased motility which enhances nodulation when compared to its
wild type strain. Further, Maier, et al., 1990, Appl. Environ.
Microbiol. 56 (8): 2341-2346 discusses the role of molybdenum
during the biological nitrogen fixation process. Further still,
Alves, et al., 2003, Plant and Soil 252: 1-9 discusses soybean
inoculants used in Brazil and the importance of competiveness for
effective nitrogen fixation. Finally, Bloem, J. F., et al., 2001,
Bio Fertil. Soils 33: 181-189 reports the importance of
competitiveness in strain selection. In the study, the researchers
use genetic engineering methods to put a reporter gene (GUS) into
their index strain as a way to determine the competitiveness of
strains. (Bloem, et al. 2001). As the study performed (Bloem, et
al. 2001) required an extensive use of chemical staining and
microscopy technology, the method reported remains an impractical
approach for screening large samples of microbes.
[0010] It is an object of the present invention to provide a super
competitive isolate(s) of bacteria from the genus Bradyrhizobia for
colonizing leguminous plants that outperforms the colonizing
ability of commercially available strains, e.g., commercial strain
USDA 532C. It is a further object of the present invention to
provide a super competitive isolate(s) of bacteria from the genus
Bradyrhizobia for colonizing leguminous plants capable of enhancing
the effectiveness at promoting leguminous plant growth in
comparison to commercially available strains, e.g., commercial
strain USDA 532C.
SUMMARY OF THE INVENTION
[0011] In order to improve the overall plant health and the
availability of a usable Nitrogen source for plants, a need exists
for bacterial strains which are superior at colonizing plants and
enhancing overall plant growth. The isolated strains of the present
invention realize these benefits.
[0012] The present invention relates to isolated strains of
bacteria having at least the following enhanced characteristics in
comparison to commercially available strains, e.g., commercial
strain USDA 532C, wherein enhanced characteristics include, but are
not limited to: [0013] a. enhanced competitiveness for colonizing a
plant; and [0014] b. enhanced effectiveness at promoting plant
growth.
[0015] The present invention is directed to a biologically pure
culture(s) of Bradyrhizobia japonicum strain(s)
[0016] the strain having the deposit accession number NRRL B-50592
(deposited also as NRRL B-59571);
[0017] the strain having the deposit accession number NRRL B-50593
(deposited also as NRRL B-59572);
[0018] the strain having the deposit accession number NRRL B-50586
(deposited also as NRRL B-59565);
[0019] the strain having the deposit accession number NRRL B-50588
(deposited also as NRRL B-59567);
[0020] the strain having the deposit accession number NRRL B-50587
(deposited also as NRRL B-59566);
[0021] the strain having the deposit accession number NRRL B-50589
(deposited also as NRRL B-59568);
[0022] the strain having the deposit accession number NRRL B-50591
(deposited also as NRRL B-59570);
[0023] the strain having the deposit accession number NRRL B-50590
(deposited also as NRRL B-59569);
[0024] the strain having the deposit accession number NRRL B-50594
(deposited also as NRRL B-50493);
[0025] the strain having the deposit accession number NRRL
B-50726;
[0026] the strain having the deposit accession number NRRL
B-50727;
[0027] the strain having the deposit accession number NRRL
B-50728;
[0028] the strain having the deposit accession number NRRL B-50729;
and
[0029] the strain having the deposit accession number NRRL B-50730,
or a combination of at least two or more of the above deposited
strains.
[0030] The present invention also relates to isolated bacterial
strain(s) of the present invention includes strain(s) that are
closely related to any of the above strains on the basis of 16S
rDNA sequence identity, and which are at least 95% identical to any
of the above strains on the basis of 16S rDNA sequence
identity.
[0031] The present invention further includes a method of enhancing
plant growth, comprising applying to plants, plant seeds, or soil
surrounding plants, or plant seeds a composition comprising at
least one of the strains of the present invention or a combination
of at least two or more of the above deposited strains.
[0032] The invention further includes compositions comprising one
or more strains of the present invention, including with an
agronomically acceptable carrier.
BRIEF DESCRIPTION OF DRAWINGS
[0033] FIG. 1A is an image of a PCR gel showing a unique Primer 209
specific to USDA 532C.
[0034] FIG. 1B is an image of a PCR gel showing Primer 209
specificity using USDA 532C and native strains.
[0035] FIG. 2A is an image of a PCR gel showing Bradyrhizobia
japonicum strain USDA 532C as the competitively dominant strain for
soybean nodulation.
[0036] FIG. 2B is an image of a PCR gel showing strains other than
Bradyrhizobia japonicum strain USDA 532C as the competitively
dominant strain for soybean nodulation.
[0037] FIG. 3A is a DNA fingerprint dendrogram of isolated strains
and USDA 532C: [0038] 138--NRRL B-50589 (deposited also as NRRL
B-59568); [0039] 13--NRRL B-50586 (deposited also as NRRL B-59565);
[0040] p140--USDA 532C; [0041] 184--NRRL B-50594 (deposited also as
NRRL B-50493); [0042] 142--NRRL B-50590 (deposited also as NRRL
B-59569); [0043] 130--NRRL B-50587 (deposited also as NRRL
B-59566); [0044] 65--NRRL B-50588 (deposited also as NRRL B-59567);
[0045] 198--NRRL B-50592 (deposited also as NRRL B-59571); [0046]
135--NRRL B-50591 (deposited also as NRRL B-59570); and [0047]
48--NRRL B-50593 (deposited also as NRRL B-59572).
[0048] FIG. 3B is a DNA fingerprint dendrogram of isolated strains
and USDA 532C: [0049] 138--NRRL B-50589 (deposited also as NRRL
B-59568); [0050] 13--NRRL B-50586 (deposited also as NRRL B-59565);
[0051] 140--USDA 532C; [0052] 184--NRRL B-50594 (deposited also as
NRRL B-50493); [0053] 142--NRRL B-50590 (deposited also as NRRL
B-59569); [0054] 130--NRRL B-50587 (deposited also as NRRL
B-59566); [0055] 65--NRRL B-50588 (deposited also as NRRL B-59567);
[0056] 198--NRRL B-50592 (deposited also as NRRL B-59571); [0057]
135--NRRL B-50591 (deposited also as NRRL B-59570); [0058] 48--NRRL
B-50593 (deposited also as NRRL B-59572) [0059] 318--NRRL B-50727,
[0060] 278--NRRL B-50726, [0061] 727--NRRL B-50730, [0062]
370--NRRL B-50728; and [0063] 518--NRRL B-50729.
DETAILED DESCRIPTION OF THE INVENTION
[0064] The present invention provides isolated strains of bacteria
having at least the following enhanced characteristics in
comparison to commercially available strains, e.g., commercial
strain USDA 532C, wherein enhanced characteristics include, but are
not limited to: [0065] a. enhanced competitiveness for colonizing a
plant; and [0066] b. enhanced effectiveness at promoting plant
growth.
[0067] "Bacterial strain(s)" as used herein, means bacterial
strains that are diazotrophs. That is, bacteria which are symbiotic
nitrogen-fixing bacteria. Non-limiting examples of bacterial
strains as used herein include, but are not limited to bacteria
from the genera Rhizobium spp. (e.g., R. cellulosilyticum, R.
daejeonense, R. etli, R. galegae, R. gallicum, R. giardinii, R.
hainanense, R. huautlense, R. indigoferae, R. leguminosarum, R.
loessense, R. lupini, R. lusitanum, R. mongolense, R. miluonense,
R. sullae, R. tropici, R. undicola, and/or R. yanglingense),
Bradyrhizobium spp. (e.g., B. bete, B. canariense, B. elkanii, B.
iriomotense, B. japonicum, B. jicamae, B. liaoningense, B.
pachyrhizi, and/or B. yuanmingense), Azorhizobium spp. (e.g., A.
caulinodans and/or A. doebereinerae), Sinorhizobium spp. (e.g., S.
abri, S. adhaerens, S. americanum, S. aboris, S. fredii, S.
indiaense, S. kostiense, S. kummerowiae, S. medicae, S. meliloti,
S. mexicanus, S. morelense, S. saheli, S. terangae, and/or S.
xinjiangense), Mesorhizobium spp (M. albiziae, M. amorphae, M.
chacoense, M. ciceri, M. huakuii, M. loti, M. mediterraneum, M.
pluifarium, M. septentrionale, M. temperatum, M. tianshanense). In
one particular embodiment, bacterial strain(s) of the invention
further include Bradyrhizobium japonicum strains having the deposit
accession numbers NRRL B-50592 (deposited also as NRRL B-59571),
NRRL B-50593 (deposited also as NRRL B-59572), NRRL B-50586
(deposited also as NRRL B-59565), NRRL B-50588 (deposited also as
NRRL B-59567), NRRL B-50587 (deposited also as NRRL B-59566), NRRL
B-50589 (deposited also as NRRL B-59568), NRRL B-50591 (deposited
also as NRRL B-59570); NRRL B-50590 (deposited also as NRRL
B-59569); NRRL B-50594 (deposited also as NRRL B-50493); NRRL
B-50726; NRRL B-50727; NRRL B-50728; NRRL B-50729; NRRL B-50730, or
a combination of at least two or more of the above deposited
strains, including two of the above strains, at least three of the
above strains, at least four of the above strains, at least five of
the above strains, at least six of the above strains, at least
seven of the above strains, at least eight of the above strains, at
least nine of the above strains, at least ten of the above strains,
at least eleven of the above strains, at least twelve of the above
strains, at least thirteen of the above strains, up to and
including all of the above strains.
[0068] The term "commercially available strain(s)" means
commercially available bacterial strains, e.g., USDA 532C, USDA
110, USDA 123, USDA 127, USDA 129, etc. Cregan, P.B., et al., 1989,
Appl. and Enviro. Microbiol. 55 (10): 2532-2536.
[0069] As used herein, "enhanced competitiveness" and/or "enhanced
nodulation" is defined to mean bacterial strain(s) possessing a
dominant percent nodule occupancy, e.g. at least 50%, at least 55%,
at least 60%, at least 65%, at least 70%, at least 75%, at least
80%, at least 85%, at least 85%, at least 90%, at least 91%, at
least 92%, at least 93%, at least 94%, at least 95%, at least 96%,
at least 97%, at least 98%, at least 99%, up to 100% nodule
occupancy. "Enhanced competitiveness" was determined pursuant to
the detailed assay(s) described below (see Materials and Methods:
"Primary Screening Protocol" and "Competition Study Protocol").
[0070] As used herein, the term "nodule" is defined to include, but
is not intended to be limited to, determinate nodules,
indeterminate nodules, or a combination thereof. Examples of
determinate nodules and indeterminate nodules are well known in the
art and described in Denison, R. F., 2000, The Amer. Naturalist.
156 (6): 567-576. Determinate nodules are found on Glycine, Lotus,
or Phaseolus species and are round and spherical in shape.
(Denison, 2000) Determinate nodules grow only for a limited period
of time--typically a few weeks. (Denison, 2000) In contrast to
determinate nodules, indeterminate nodules are found on Medicago,
Trifolium, and Pisium species, have an elongated shape and grow
continuously. (Denison, 2000)
[0071] "Nodule occupancy" is a term known in the art. McDermott T.
R. & Graham ,P. H., Appl. and Environ. Microbiol. 55(10):
2493-2498. As used herein, "nodule occupancy" means the percent of
nodules occupied by a bacterial strain(s) other than a commercially
available Bradyrhizobium strain, e.g. USDA 532C, and/or the number
of nodules containing a particular bacterial strain(s) other than a
commercially available Bradyrhizobium strain, e.g. USDA 532C,
divided by the total number of nodules containing all bacterial
strains. "Nodule occupancy" was determined pursuant to the detailed
assay(s) described below (see Materials and Methods: "Primary
Screening Protocol" and "Competition Study Protocol") and can be
determined from an analysis of nodules from plants obtained from
either greenhouse or field samples. By way of example, percent
nodule occupancy=A/(A+B) wherein A is the number of nodules
containing a particular bacterial strain(s) other than a
commercially available Bradyrhizobium strain, e.g. USDA 532C, and B
is the number of nodules containing a commercially available
Bradyrhizobium strain, e.g., USDA 532C. It is well known in the art
that, notwithstanding the rare exception, a single nodule will
contain only one bacterial strain. Johnston, A.W.B., et al., 1974,
J. Gen. Microbiol 87: 343-350; Dunham, D. H. & Baldwin, I. L.,
1931, Soil Science 32: 235-249; Johnson, H. W., et al., 1963,
Agrono. J. 55: 269-271; Dudman, W. F. & Brockwell, J., 1968, J.
Agricul. Res. 19: 739-747; Nicol, H. & Thorton, H. G., 1941,
Proc. Roy. Soc. B 130, 32-59; Hughes, D. Q., & Vincent, J. M.,
1942, Proc. of the Linnenan Soc. of New South Wales 67: 142-152;
and Vincent, J. M. & Waters, L. M., 1953, J. Gen. Microbiol. 9:
357-370.
[0072] As used herein, "enhanced effectiveness at promoting growth"
includes at least one of increased plant yield measured in terms of
bushels/acre, increased fruit number, increased root number,
increased root length, increased root mass, increased root volume,
increased leaf area, increased plant stand, increased plant vigour,
and/or increased nitrogen (N.sub.2) fixing capability. "Enhanced
effectiveness at promoting growth" was determined pursuant to the
detailed assay(s) described below (see Materials and Methods:
"Primary Screening Protocol" and "Performance Study Protocol") and
can be determined from an analysis of plants obtained from either
greenhouse or field samples.
[0073] As used herein "increased fruit number" means an increased
total number of soybean pods on a soybean plant and/or an increased
total dry weight of soybean pods on a soybean plant.
[0074] As used herein "total dry weight" means the weight of plant
matter (e.g., plant fruit, plant pods, plant roots, plant nodules,
whole plants, partial plants, etc.) following incubation at
80.degree. C. for a specified period of time, e.g., at least 4
hours, at least 8 hours, at least 12 hours, at least 24 hours, at
least 48 hours, etc., or any period of time necessary to dry the
plant matter. It is to be understood that drying times for the
purposes of determining "total dry weight" are dependent on many
factors. Non-limiting factors which may impact drying time include
the material to be dried, the mass of the material to be dried, the
amount of material to be dried, and/or combinations thereof.
Incubation can be performed in any temperature controlled device
used in the art. For the purposes of this invention, "total dry
weight" was determined with an Eppendorf Innova.RTM. 42R
incubator.
[0075] The term "increased nitrogen (N.sub.2) fixing capability,"
as used herein, means the isolated bacteria may increase nitrogen
(N.sub.2) fixation. Pursuant to the "Performance Study Protocol"
provided infra (Materials and Methods), the relative nitrogen
(N.sub.2) fixing capability of bacteria can be quantified by
measuring the total nitrogen content of the plant using standard
nitrogen quantifying methods known to those possessing an ordinary
skill in the art (e.g., the Kjeldahl method, etc.). See Takahashi,
M., et al., 2007. Uptake, Assimilation, and Novel Metabolism of
Nitrogen Dioxide in Plants, p. 109-118. In N. Willey (ed.),
Phytoremediation: Methods and Reviews, vol. 23. Humana Press, New
York; Bremner, J. M. 1965. Total nitrogen, p. 1149-1178. In C. A.
Black (ed.), Methods of soil analysis, vol. 2. American Society for
Agronomy, Madison; Schank, S. C., et al., 1981, App. and Enviro.
Microbiol., 41 (2): 342-345.
[0076] In yet another aspect of the present invention, the isolated
bacterial strain(s) have an enhanced temperature tolerance.
"Enhanced temperature tolerance" means the range of temperatures at
which the isolated bacterial strain(s) are able to grow, e.g., the
maximum and minimum temperatures at which isolated Bradyrhizobium
strain(s) can grow. In one aspect, "enhanced temperature tolerance"
was determined according to the "Temperature Profile Protocol"
discussed infra (Materials and Methods).
[0077] In yet another aspect of the present invention, the isolated
bacterial strain(s) are naturally resistant to glyphosate. In one
aspect, "enhanced temperature tolerance" was determined according
to the "Glyphosate Resistance Profile Protocol" discussed infra
(Materials and Methods).
[0078] In another aspect, the isolated bacterial strain(s) of the
present invention includes strain(s) that are closely related to
any of the above strains on the basis of 16S rDNA sequence
identity. See Stackebrandt E, et al., "Report of the ad hoc
committee for the re-evaluation of the species definition in
bacteriology," Int J Syst Evol Microbiol. 52(3):1043-7 (2002)
regarding use of 16S rDNA sequence identity for determining
relatedness in bacteria. In an embodiment, the at least one strain
is at least 95% identical to any of the above strains on the basis
of 16S rDNA sequence identity, at least 96% identical to any of the
above strains on the basis of 16S rDNA sequence identity, at least
97% identical to any of the above strains on the basis of 16S rDNA
sequence identity, at least 98% to any of the above strains on the
basis of 16S rDNA sequence identity, at least 98.5% identical to
any of the above strains on the basis of 16S rDNA sequence
identity, at least 99% identical to any of the above strains on the
basis of 16S rDNA sequence identity or at least 99.5% to any of the
above strains on the basis of 16S rDNA sequence identity.
[0079] In another embodiment, the present invention includes a
method for isolating bacterial strain(s) having enhanced
competitiveness for occupying the nodules of a leguminous plant and
enhanced effectiveness at promoting leguminous plant growth. As
used herein, the term "isolate, isolates, isolating, and/or
isolated, etc." means that the referenced material is removed from
the environment in which it is normally found. The method includes,
among other things, [0080] a. obtaining a bacterial strain(s) from
a soil sample; [0081] b. subjecting the bacterial strain(s) and a
commercially available strain to a leguminous plant; [0082] c.
selecting the bacterial strain(s) which are more competitive than
the commercially available strain for occupying the nodules of a
leguminous plant; [0083] d. analyzing the selected bacterial
strain(s) which are more competitive than the commercially
available strain for occupying the nodules of a leguminous plant
for those bacterial strain(s) having an enhanced effectiveness at
promoting leguminous plant growth; and [0084] e. isolating the
bacterial strain(s) having enhanced effectiveness at promoting
leguminous plant growth.
[0085] In one aspect, the isolated bacterial strain(s) are strains
from the genus Bradyrhizobium. In still yet another aspect, the
method further includes the step of screening the Bradyrhizobium
strain(s) against a specific primer unique to a commercially
available strain of Bradyrhizobia, e.g., commercial strain USDA
532C.
[0086] In yet another aspect, the method includes isolating a
culture of Bradyrhizobia japonicum selected from the group
consisting of:
[0087] the strain having the deposit accession number NRRL B-50592
(deposited also as NRRL B-59571);
[0088] the strain having the deposit accession number NRRL B-50593
(deposited also as NRRL B-59572);
[0089] the strain having the deposit accession number NRRL B-50586
(deposited also as NRRL B-59565);
[0090] the strain having the deposit accession number NRRL B-50588
(deposited also as NRRL B-59567);
[0091] the strain having the deposit accession number NRRL B-50587
(deposited also as NRRL B-59566);
[0092] the strain having the deposit accession number NRRL B-50589
(deposited also as NRRL B-59568);
[0093] the strain having the deposit accession number NRRL B-50591
(deposited also as NRRL B-59570);
[0094] the strain having the deposit accession number NRRL B-50590
(deposited also as NRRL B-59569);
[0095] the strain having the deposit accession number NRRL B-50594
(deposited also as NRRL B-50493);
[0096] the strain having the deposit accession number NRRL
B-50726;
[0097] the strain having the deposit accession number NRRL
B-50727;
[0098] the strain having the deposit accession number NRRL
B-50728;
[0099] the strain having the deposit accession number NRRL B-50729;
and
[0100] the strain having the deposit accession number NRRL B-50730,
or a combination of at least two or more of the above deposited
strains, including more than two, such as, at least three of the
above strains, at least four of the above strains, at least five of
the above strains, at least six of the above strains, at least
seven of the above strains, at least eight of the above strains, at
least nine of the above strains, at least ten of the above strains,
at least eleven of the above strains, at least twelve of the above
strains, at least thirteen of the above strains, up to an including
all of the above strains.
[0101] In still another aspect, the method includes isolating
bacterial strain(s) having enhanced temperature tolerance. See
Materials and Methods: "Temperature Profile Protocol."
[0102] Further still, the method includes isolating a bacterial
strain(s) having natural resistance to glyphosate. See Materials
and Methods: "Glyphosate Resistance Profile Protocol."
[0103] In another preferred aspect, the method includes isolating
bacterial strain(s) selected from the genus consisting of Rhizobium
and Bradyrhizobium capable of enhancing the nodulation of a
leguminous plant.
Composition
[0104] The present invention includes a composition comprising at
least one of the isolated bacterial strain(s) of the present
invention or a combination of at least two or more of the above
deposited strains, including more than two, such as, at least three
of the above strains, at least four of the above strains, at least
five of the above strains, at least six of the above strains, at
least seven of the above strains, at least eight of the above
strains, at least nine of the above strains, at least ten of the
above strains, at least eleven of the above strains, at least
twelve of the above strains, at least thirteen of the above
strains, up to an including all of the above strains and an
agronomically suitable carrier.
[0105] In some embodiments, the composition may be an inoculant
composition. As used herein and in the art, the term "inoculant
composition" refers generally to compositions or materials that
introduce compatible bacterial strains either onto an external
surface of seeds or in the seed furrow.
[0106] The composition may comprise one or more agronomically
acceptable carriers. In instances where multiple agronomically
acceptable carriers are used, the agronomically acceptable carriers
may be the same or different. As used herein in connection with
"carrier", the term "agronomically acceptable" refers to any
material which can be used to deliver the actives to a seed, soil
or plant, and preferably which carrier can be added (to the seed,
soil or plant) without having an adverse effect on plant growth,
soil structure, soil drainage or the like. Suitable carriers
comprise, but are not limited to, wheat chaff, bran, ground wheat
straw, peat-based powders or granules, gypsum-based granules, and
clays (e.g., kaolin, bentonite, montmorillonite). Formulations as
liquid, peat, or wettable powder will be suitable for coating of
seeds. When used to coat seeds, the material can be mixed with
water, applied to the seeds and allowed to dry. Example of yet
other carriers include moistened bran, dried, sieved and applied to
seeds prior coated with an adhesive, e.g., gum arabic. In
embodiments that entail formulation of the actives, the
agronomically acceptable carrier may be aqueous. If a liquid
carrier is used, the liquid (e.g., water) carrier will typically
include growth media to culture the bacterial strains. Non-limiting
examples of suitable growth media for the bacterial strains include
mannitol yeast extract, glycerol yeast extract, or any media known
to those skilled in the art to be compatible with, and/or provide
growth nutrients to the bacterial strains.
[0107] Also encompassed by the compositions of the present
invention are compositions including one or more signal molecules.
Non-limiting examples of plant signal molecules include nod factors
(i.e., lipo-chitooligosaccharies), chitooligosaccharides, chitinous
compounds, flavonoids, jasmonic acid or derivatives thereof,
linoleic acid or derivatives thereof, linolenic acid or derivatives
thereof, karrikins, or combinations thereof.
[0108] Lipo-chitooligosaccharide compounds (LCO's), also known in
the art as symbiotic Nod signals or Nod factors, consist of an
oligosaccharide backbone of .beta.-1,4-linked
N-acetyl-D-glucosamine ("GlcNAc") residues with an N-linked fatty
acyl chain condensed at the non-reducing end. LCO's differ in the
number of GlcNAc residues in the backbone, in the length and degree
of saturation of the fatty acyl chain, and in the substitutions of
reducing and non-reducing sugar residues. An example of an LCO is
presented below as formula 1:
##STR00001##
in which:
[0109] G is a hexosamine which can be substituted, for example, by
an acetyl group on the nitrogen, a sulfate group, an acetyl group
and/or an ether group on an oxygen,
[0110] R.sub.1, R.sub.2, R.sub.3, R.sub.5, R.sub.6 and R.sub.7,
which may be identical or different, represent H, CH.sub.3 CO--,
C.sub.x H.sub.yCO-- where xis an integer between 0 and 17, and y is
an integer between 1 and 35, or any other acyl group such as for
example a carbamyl,
[0111] R.sub.4 represents a mono-, di- or triunsaturated aliphatic
chain containing at least 12 carbon atoms, and n is an integer
between 1 and 4.
[0112] LCOs may be obtained (isolated and/or purified) from
bacteria such as Rhizobia, e.g., Rhizobium spp., Bradyrhizobium
spp., Sinorhizobium spp. and Azorhizobium spp. LCO structure is
characteristic for each such bacterial species, and each strain may
produce multiple LCO's with different structures. For example,
specific LCOs from S. meliloti have also been described in U.S.
Pat. No. 5,549,718 as having the formula II:
##STR00002##
in which R represents H or CH.sub.3CO-- and n is equal to 2 or
3.
[0113] Even more specific LCOs include NodRM, NodRM-1, NodRM-3.
When acetylated (the R.dbd.CH.sub.3 CO--), they become AcNodRM-1,
and AcNodRM-3, respectively (U.S. Pat. No. 5,545,718).
[0114] LCOs from Bradyrhizobium japonicum are described in U.S.
Pat. Nos. 5,175,149 and 5,321,011. Broadly, they are
pentasaccharide phytohormones comprising methylfucose. A number of
these B. japonicum-derived LCOs are described: BjNod-V
(C.sub.18:1); BjNod-V (A.sub.c, C.sub.18:1), BjNod-V (C.sub.16:1);
and BjNod-V (A.sub.c, C.sub.16:0), with "V" indicating the presence
of five N-acetylglucosamines; "Ac" an acetylation; the number
following the "C" indicating the number of carbons in the fatty
acid side chain; and the number following the ":" the number of
double bonds.
[0115] LCO's used in compositions of the invention may be obtained
(i.e., isolated and/or purified) from bacterial strains that
produce LCO's, such as strains of Azorhizobium, Bradyrhizobium
(including B. japonicum), Mesorhizobium, Rhizobium (including R.
leguminosarum), Sinorhizobium (including S. meliloti), and
bacterial strains genetically engineered to produce LCO's.
[0116] Also encompassed by the present invention are compositions
using LCOs obtained (i.e., isolated and/or purified) from a
mycorrhizal fungus, such as fungi of the group Glomerocycota, e.g.,
Glomus intraradicus. The structures of representative LCOs obtained
from these fungi are described in WO 2010/049751 and WO 2010/049751
(the LCOs described therein also referred to as "Myc factors").
[0117] Further encompassed by compositions of the present invention
is use of synthetic LCO compounds, such as those described in WO
2005/063784, and recombinant LCO's produced through genetic
engineering. The basic, naturally occurring LCO structure may
contain modifications or substitutions found in naturally occurring
LCO's, such as those described in Spaink, Crit. Rev. Plant Sci.
54:257-288 (2000) and D'Haeze, et al., Glycobiology 12:79R-105R
(2002). Precursor oligosaccharide molecules (COs, which as
described below, are also useful as plant signal molecules in the
present invention) for the construction of LCOs may also be
synthesized by genetically engineered organisms, e.g., as in
Samain, et al., Carb. Res. 302:35-42 (1997); Samain, et al., J.
Biotechnol. 72:33-47 (1999).
[0118] LCO's may be utilized in various forms of purity and may be
used alone or in the form of a culture of LCO-producing bacteria or
fungi. Methods to provide substantially pure LCO's include simply
removing the microbial cells from a mixture of LCOs and the
microbe, or continuing to isolate and purify the LCO molecules
through LCO solvent phase separation followed by HPLC
chromatography as described, for example, in U.S. Pat. No.
5,549,718. Purification can be enhanced by repeated HPLC, and the
purified LCO molecules can be freeze-dried for long-term
storage.
[0119] Chitooligosaccharides (COs) are known in the art as
.beta.-1-4 linked N actyl glucosamine structures identified as
chitin oligomers, also as N-acetylchitooligosaccharides. CO's have
unique and different side chain decorations which make them
different from chitin molecules [(C.sub.8H.sub.13NO.sub.5)n, CAS
No. 1398-61-4], and chitosan molecules [(C.sub.5H.sub.11NO.sub.4)n,
CAS No. 9012-76-4]. Representative literature describing the
structure and production of COs is as follows: Van der Holst, et
al., Current Opinion in Structural Biology, 11:608-616 (2001);
Robina, et al., Tetrahedron 58:521-530 (2002); Hanel, et al.,
Planta 232:787-806 (2010); Rouge, et al. Chapter 27, "The Molecular
Immunology of Complex Carbohydrates" in Advances in Experimental
Medicine and Biology, Springer Science; Wan, et al., Plant Cell
21:1053-69 (2009); PCT/F100/00803 (9/21/2000); and Demont-Caulet,
et al., Plant Physiol. 120(1):83-92 (1999). The COs may be
synthetic or recombinant. Methods for preparation of recombinant
COs are known in the art. See, e.g., Samain, et al. (supra.);
Cottaz, et al., Meth. Eng. 7(4):311-7 (2005) and Samain, et al., J.
Biotechnol. 72:33-47 (1999).
[0120] Compositions of the present invention may also include
chitinous compounds (other than COs), flavonoids, jasmonic acid,
linoleic acid and linolenic acid and their derivatives, and
karrikins.
[0121] Chitins and chitosans, which are major components of the
cell walls of fungi and the exoskeletons of insects and
crustaceans, are also composed of GlcNAc residues. Chitinous
compounds include chitin, (I UPAC:
N454[3-acetylamino-4,5-dihydroxy-6-(hydroxymethyl)oxan-2yl]methoxymethyl]-
-2-[[5-acetylamino-4,6-dihydroxy-2-(hydroxy
methyl)oxan-3-yl]methoxymethyl]-4-hydroxy-6-(hydroxymethyl)oxan-3-ys]etha-
namide), and chitosan, (I UPAC:
5-amino-645-amino-645-amino-4,6-dihydroxy-2(hydroxymethyl)oxan-3-yl]oxy-4-
-hydroxy-2-(hydroxymethyl)oxan-3-yl]oxy-2(hydroxymethyl)oxane-3,4-diol).
These compounds may be obtained commercially, e.g., from
Sigma-Aldrich, or prepared from insects, crustacean shells, or
fungal cell walls. Methods for the preparation of chitin and
chitosan are known in the art, and have been described, for
example, in U.S. Pat. No. 4,536,207 (preparation from crustacean
shells), Pochanavanich, et al., Lett. Appl. Microbiol. 35:17-21
(2002) (preparation from fungal cell walls), and U.S. Pat. No.
5,965,545 (preparation from crab shells and hydrolysis of
commercial chitosan). Deacetylated chitins and chitosans may be
obtained that range from less than 35% to greater than 90%
deacetylation, and cover a broad spectrum of molecular weights,
e.g., low molecular weight chitosan oligomers of less than 15kD and
chitin oligomers of 0.5 to 2kD; "practical grade" chitosan with a
molecular weight of about 15kD; and high molecular weight chitosan
of up to 70kD. Chitin and chitosan compositions formulated for seed
treatment are also commercially available. Commercial products
include, for example, ELEXA.RTM. (Plant Defense Boosters, Inc.) and
BEYOND.TM. (Agrihouse, Inc.).
[0122] Flavonoids are phenolic compounds having the general
structure of two aromatic rings connected by a three-carbon bridge.
Flavonoids are produced by plants and have many functions, e.g., as
beneficial signaling molecules, and as protection against insects,
animals, fungi and bacteria. Classes of flavonoids include
chalcones, anthocyanidins, coumarins, flavones, flavanols,
flavonols, flavanones, and isoflavones. See, Jain, et al., J. Plant
Biochem. & Biotechnol. 11:1-10 (2002); Shaw, et al.,
Environmental Microbiol. 11:1867-80 (2006).
[0123] Representative flavonoids that may be useful in compositions
of the present invention include genistein, daidzein, formononetin,
naringenin, hesperetin, luteolin, and apigenin. Flavonoid compounds
are commercially available, e.g., from Natland International Corp.,
Research Triangle Park, N.C.; MP Biomedicals, Irvine, Calif.; LC
Laboratories, Woburn Ma. Flavonoid compounds may be isolated from
plants or seeds, e.g., as described in U.S. Pat. Nos. 5,702,752;
5,990,291; and 6,146,668. Flavonoid compounds may also be produced
by genetically engineered organisms, such as yeast, as described in
Ralston, et al., Plant Physiology 137:1375-88 (2005).
[0124] Jasmonic acid (JA,
[1R-[1.alpha.,2.beta.(Z)]]-3-oxo-2-(pentenyl)cyclopentaneacetic
acid) and its derivatives, linoleic acid
((Z,Z)-9,12-Octadecadienoic acid) and its derivatives, and
linolenic acid ((Z,Z,Z)-9,12,15-octadecatrienoic acid) and its
derivatives, may also be used in compositions of the present
invention. Jasmonic acid and its methyl ester, methyl jasmonate
(MeJA), collectively known as jasmonates, are octadecanoid-based
compounds that occur naturally in plants. Jasmonic acid is produced
by the roots of wheat seedlings, and by fungal microorganisms such
as Botryodiplodia theobromae and Gibbrella fujikuroi, yeast
(Saccharomyces cerevisiae), and pathogenic and non-pathogenic
strains of Escherichia coli. Linoleic acid and linolenic acid are
produced in the course of the biosynthesis of jasmonic acid.
Jasmonates, linoleic acid and linoleic acid (and their derivatives)
are reported to be inducers of nod gene expression or LCO
production by rhizobacteria. See, e.g., Mabood, Fazli, Jasmonates
induce the expression of nod genes in Bradyrhizobium japonicum, May
17, 2001; and Mabood, Fazli, "Linoleic and linolenic acid induce
the expression of nod genes in Bradyrhizobium japonicum," USDA 3,
May 17, 2001.
[0125] Useful derivatives of linoleic acid, linolenic acid, and
jasmonic acid that may be useful in compositions of the present
invention include esters, amides, glycosides and salts.
Representative esters are compounds in which the carboxyl group of
linoleic acid, linolenic acid, or jasmonic acid has been replaced
with a --COR group, where R is an --OR' group, in which R.sup.1 is:
an alkyl group, such as a C.sub.1-C.sub.8 unbranched or branched
alkyl group, e.g., a methyl, ethyl or propyl group; an alkenyl
group, such as a C.sub.2-C.sub.8 unbranched or branched alkenyl
group; an alkynyl group, such as a C.sub.2-C.sub.8 unbranched or
branched alkynyl group; an aryl group having, for example, 6 to 10
carbon atoms; or a heteroaryl group having, for example, 4 to 9
carbon atoms, wherein the heteroatoms in the heteroaryl group can
be, for example, N, O, P, or S. Representative amides are compounds
in which the carboxyl group of linoleic acid, linolenic acid, or
jasmonic acid has been replaced with a --COR group, where R is an
NR.sup.2R.sup.3 group, in which R.sup.2 and R.sup.3 are
independently: hydrogen; an alkyl group, such as a C.sub.1-C.sub.8
unbranched or branched alkyl group, e.g., a methyl, ethyl or propyl
group; an alkenyl group, such as a C.sub.2-C.sub.8 unbranched or
branched alkenyl group; an alkynyl group, such as a C.sub.2-C.sub.8
unbranched or branched alkynyl group; an aryl group having, for
example, 6 to 10 carbon atoms; or a heteroaryl group having, for
example, 4 to 9 carbon atoms, wherein the heteroatoms in the
heteroaryl group can be, for example, N, O, P, or S. Esters may be
prepared by known methods, such as acid-catalyzed nucleophilic
addition, wherein the carboxylic acid is reacted with an alcohol in
the presence of a catalytic amount of a mineral acid. Amides may
also be prepared by known methods, such as by reacting the
carboxylic acid with the appropriate amine in the presence of a
coupling agent such as dicyclohexyl carbodiimide (DCC), under
neutral conditions. Suitable salts of linoleic acid, linolenic
acid, and jasmonic acid include e.g., base addition salts. The
bases that may be used as reagents to prepare metabolically
acceptable base salts of these compounds include those derived from
cations such as alkali metal cations (e.g., potassium and sodium)
and alkaline earth metal cations (e.g., calcium and magnesium).
These salts may be readily prepared by mixing together a solution
of linoleic acid, linolenic acid, or jasmonic acid with a solution
of the base. The salt may be precipitated from solution and be
collected by filtration or may be recovered by other means such as
by evaporation of the solvent.
[0126] Karrikins are vinylogous 4H-pyrones e.g.,
2H-furo[2,3-c]pyran-2-ones including derivatives and analogues
thereof. Examples of these compounds are represented by the
following structure:
##STR00003##
wherein; Z is O, S or NR.sub.5; R.sub.1, R.sub.2, R.sub.3, and
R.sub.4 are each independently H, alkyl, alkenyl, alkynyl, phenyl,
benzyl, hydroxy, hydroxyalkyl, alkoxy, phenyloxy, benzyloxy, CN,
COR.sub.6, COOR.dbd., halogen, NR.sub.6R.sub.7, or NO.sub.2; and
R.sub.5, R.sub.6, and R.sub.7 are each independently H, alkyl or
alkenyl, or a biologically acceptable salt thereof. Examples of
biologically acceptable salts of these compounds may include acid
addition salts formed with biologically acceptable acids, examples
of which include hydrochloride, hydrobromide, sulphate or
bisulphate, phosphate or hydrogen phosphate, acetate, benzoate,
succinate, fumarate, maleate, lactate, citrate, tartrate,
gluconate; methanesulphonate, benzenesulphonate and
p-toluenesulphonic acid. Additional biologically acceptable metal
salts may include alkali metal salts, with bases, examples of which
include the sodium and potassium salts. Examples of compounds
embraced by the structure and which may be suitable for use in the
present invention include the following:
3-methyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1.dbd.CH.sub.3,
R.sub.2, R.sub.3, R.sub.4.dbd.H), 2H-furo[2,3-c]pyran-2-one (where
R.sub.1, R.sub.2, R.sub.3, R4.dbd.H),
7-methyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1, R.sub.2,
R.sub.4=H, R.sub.3=CH.sub.3), 5-methyl-2H-furo[2,3-c]pyran-2-one
(where R.sub.1, R.sub.2, R.sub.3.dbd.H, R.sub.4.dbd.CH.sub.3),
3,7-dimethyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1,
R.sub.3.dbd.CH.sub.3, R.sub.2, R.sub.4.dbd.H),
3,5-dimethyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1,
R.sub.4.dbd.CH.sub.3, R.sub.2, R.sub.3.dbd.H),
3,5,7-trimethyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1, R.sub.3,
R.sub.4.dbd.CH.sub.3, R.sub.2.dbd.H),
5-methoxymethyl-3-methyl-2H-furo[2,3-c]pyran-2-one (where
R.sub.1.dbd.CH.sub.3, R.sub.2, R.sub.3.dbd.H,
R.sub.4.dbd.CH.sub.2OCH.sub.3),
4-bromo-3,7-dimethyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1,
R.sub.3.dbd.CH.sub.3, R.sub.2.dbd.Br, R.sub.4.dbd.H),
3-methylfuro[2,3-c]pyridin-2(3H)-one (where Z.dbd.NH,
R.sub.1.dbd.CH.sub.3, R.sub.2, R.sub.3, R.sub.4.dbd.H),
3,6-dimethylfuro[2,3-c]pyridin-2(6H)-one (where Z.dbd.N--CH.sub.3,
R.sub.1.dbd.CH.sub.3, R.sub.2, R.sub.3, R.sub.4.dbd.H). See, U.S.
Pat. No. 7,576,213. These molecules are also known as karrikins.
See, Halford, supra.
[0127] Compositions of the present invention may further include an
agriculturally/agronomically beneficial agent. Non-limiting
examples of such agents that may be useful in the practice of the
present invention include herbicides, fungicides and
insecticides.
[0128] Suitable herbicides include bentazon, acifluorfen,
chlorimuron, lactofen, clomazone, fluazifop, glufosinate,
glyphosate, sethoxydim, imazethapyr, imazamox, fomesafe,
flumiclorac, imazaquin, and clethodim. Commercial products
containing each of these compounds are readily available. Herbicide
concentration in the composition will generally correspond to the
labeled use rate for a particular herbicide.
[0129] A "fungicide" as used herein and in the art, is an agent
that kills or inhibits fungal growth. As used herein, a fungicide
"exhibits activity against" a particular species of fungi if
treatment with the fungicide results in killing or growth
inhibition of a fungal population (e.g., in the soil) relative to
an untreated population. Effective fungicides in accordance with
the invention will suitably exhibit activity against a broad range
of pathogens, including but not limited to Phytophthora,
Rhizoctonia, Fusarium, Pythium, Phomopsis or Selerotinia and
Phakopsora and combinations thereof.
[0130] Commercial fungicides may be suitable for use in the present
invention. Suitable commercially available fungicides include
PROTEGE, RIVAL or ALLEGIANCE FL or LS (Gustafson, Plano, TX),
WARDEN RTA (Agrilance, St. Paul, Minn.), APRON XL, APRON MAXX RTA
or RFC, MAXIM 4FS or XL (Syngenta, Wilmington, Del.), CAPTAN
(Arvesta, Guelph, Ontario) and PROTREAT (Nitragin Argentina, Buenos
Ares, Argentina). Active ingredients in these and other commercial
fungicides include, but are not limited to, fludioxonil, mefenoxam,
azoxystrobin and metalaxyl. Commercial fungicides are most suitably
used in accordance with the manufacturer's instructions at the
recommended concentrations.
[0131] As used herein, an insecticide "exhibits activity against" a
particular species of insect if treatment with the insecticide
results in killing or inhibition of an insect population relative
to an untreated population. Effective insecticides in accordance
with the invention will suitably exhibit activity against a broad
range of insects including, but not limited to, wireworms,
cutworms, grubs, corn rootworm, seed corn maggots, flea beetles,
chinch bugs, aphids, leaf beetles, and stink bugs.
[0132] Commercial insecticides may be suitable for use in the
present invention. Suitable commercially-available insecticides
include CRUISER (Syngenta, Wilmington, Del.), GAUCHO and PONCHO
(Gustafson, Plano, Tex.). Active ingredients in these and other
commercial insecticides include thiamethoxam, clothianidin, and
imidacloprid. Commercial insecticides are most suitably used in
accordance with the manufacturer's instructions at the recommended
concentrations.
[0133] Compositions of the present invention also are intended to
include the use of one or more phosphate solubilizing agent. As
used herein, phosphate solubilizing agents, include, but are not
limited to, phosphate solubilizing microorganisms. As used herein,
"phosphate solubilizing microorganism" is a microorganism that is
able to increase the amount of phosphorous available for a plant.
Phosphate solubilizing microorganisms include fungal and bacterial
strains. In an embodiment, the phosphate solubilizing microorganism
is a spore forming microorganism.
[0134] Non-limiting examples of phosphate solubilizing
microorganisms include species from a genus selected from the group
consisting of Acinetobacter, Arthrobacter, Arthrobotrys,
Aspergillus, Azospirillum, Bacillus, Burkholderia, Candida
Chryseomonas, Enterobacter, Eupenicillium, Exiguobacterium,
Klebsiella, Kluyvera, Microbacterium, Mucor, Paecilomyces,
Paenibacillus, Penicillium, Pseudomonas, Serratia,
Stenotrophomonas, Streptomyces, Streptosporangium, Swaminathania,
Thiobacillus, Torulospora, Vibrio, Xanthobacter, and
Xanthomonas.
[0135] Non-limiting examples of phosphate solubilizing
microorganisms are selected from the group consisting Acinetobacter
calcoaceticus, Acinetobacter spp., Arthrobacter spp., Arthrobotrys
oligospora, Aspergillus niger, Aspergillus spp., Azospirillum
halopraeferans, Bacillus amyloliquefaciens, Bacillus atrophaeus,
Bacillus circulans, Bacillus licheniformis, Bacillus subtilis,
Burkholderia cepacia, Burkholderia vietnamiensis, Candida krissii
Chryseomonas luteola, Enterobacter aerogenes, Enterobacter
asburiae, Enterobacter spp., Enterobacter taylorae, Eupenicillium
parvum, Exiguobacterium spp., Klebsiella spp., Kluyvera
cryocrescens, Microbacterium spp., Mucor ramosissimus, Paecilomyces
hepialid, Paecilomyces marquandii, Paenibacillus macerans,
Paenibacillus mucilaginosus, Pantoea aglomerans, Penicillium
expansum, Pseudomonas corrugate, Pseudomonas fluorescens,
Pseudomonas lutea, Pseudomonas poae, Pseudomonas putida,
Pseudomonas stutzeri, Pseudomonas trivialis, Serratia marcescens,
Stenotrophomonas maltophilia, Streptomyces sp., Streptosporangium
spp., Swaminathania salitolerans, Thiobacillus ferrooxidans,
Torulospora globosa, Vibrio proteolyticus, Xanthobacter agilis, and
Xanthomonas campestris.
[0136] In one embodiment, the phosphate solubilizing microorganism
is a strain of the fungus Penicillium. Strains of the fungus
Penicillium that may be useful in the practice of the present
invention include P. bilaiae (formerly known as P. bilaii), P.
albidum, P. aurantiogriseum, P. chrysogenum, P. citreonigrum, P.
citrinum, P. digitatum, P. frequentas, P. fuscum, P. gaestrivorus,
P. glabrum, P. griseofulvum, P. implicatum, P. janthinellum, P.
lilacinum, P. minioluteum, P. montanense, P. nigricans, P.
oxalicum, P. pinetorum, P. pinophilum, P. purpurogenum, P.
radicans, P. radicum, P. raistrickii, P. rugulosum, P.
simplicissimum, P. solitum, P. variabile, P. velutinum, P.
viridicatum, P. glaucum, P. fussiporus, and P. expansum.
[0137] In another embodiment, the phosphate solubilizing
microorganism Penicillium species is P. bilaiae, P. gaestrivorus,
and/or a combination thereof. In still another embodiment, the P.
bilaiae strains are selected from the group consisting of ATCC
20851, NRRL 50169, ATCC 22348, ATCC 18309, NRRL 50162 (Wakelin, et
al., 2004. Biol Fertil Soils 40:36-43) and the P. gaestrivorus
strain is NRRL 50170 (see, Wakelin, supra.).
[0138] According to compositions of the invention, it is envisioned
that more than one phosphate solubilizing microorganism may be
used, such as, at least two, at least three, at least four, at
least five, at least 6, including any combination of the
Acinetobacter, Arthrobacter, Arthrobotrys, Aspergillus,
Azospirillum, Bacillus, Burkholderia, Candida Chryseomonas,
Enterobacter, Eupenicillium, Exiguobacterium, Klebsiella, Kluyvera,
Microbacterium, Mucor, Paecilomyces, Paenibacillus, Penicillium,
Pseudomonas, Serratia, Stenotrophomonas, Streptomyces,
Streptosporangium, Swaminathania, Thiobacillus, Torulospora,
Vibrio, Xanthobacter, and Xanthomonas, including one species
selected from the following group: Acinetobacter calcoaceticus,
Acinetobacter spp., Arthrobacter spp., Arthrobotrys oligospora,
Aspergillus niger, Aspergillus spp., Azospirillum halopraeferans,
Bacillus amyloliquefaciens, Bacillus atrophaeus, Bacillus
circulans,Bacillus licheniformis, Bacillus subtilis, Burkholderia
cepacia, Burkholderia vietnamiensis, Candida krissii Chryseomonas
luteola, Enterobacter aerogenes, Enterobacter asburiae,
Enterobacter spp., Enterobacter taylorae, Eupenicillium parvum,
Exiguobacterium spp., Klebsiella spp., Kluyvera cryocrescens,
Microbacterium spp., Mucor ramosissimus, Paecilomyces hepialid,
Paecilomyces marquandii, Paenibacillus macerans, Paenibacillus
mucilaginosus, Pantoea aglomerans, Penicillium expansum,
Pseudomonas corrugate, Pseudomonas fluorescens, Pseudomonas lutea,
Pseudomonas poae, Pseudomonas putida, Pseudomonas stutzeri,
Pseudomonas trivialis, Serratia marcescens, Stenotrophomonas
maltophilia, Streptomyces spp., Streptosporangium spp.,
Swaminathania salitolerans, Thiobacillus ferrooxidans, Torulospora
globosa, Vibrio proteolyticus, Xanthobacter agilis, and Xanthomonas
campestris.
[0139] In another embodiment, the present invention includes a
method of enhancing plant growth, comprising applying to plants,
plant seeds, or soil surrounding plants, or plant seeds one or more
of the bacterial strain(s) of the present invention (including a
composition comprising at least one of the isolated bacterial
strain(s) of the present invention and an agronomically acceptable
carrier. The one or more bacterial strains may comprise only one
bacterial strain or a combination of at least two or more of the
strains of the present invention, including more than two, such as,
at least three of the above strains, at least four of the above
strains, at least five of the above strains, at least six of the
above strains, at least seven of the above strains, at least eight
of the above strains, at least nine of the above strains, at least
ten of the above strains, at least eleven of the above strains, at
least twelve of the above strains, at least thirteen of the above
strains, up to an including all of the above strains.
[0140] Applications
[0141] Methods of the invention include a treatment step for
applying at least one of the isolated strains and/or compositions
comprising at least one of the isolated strains to seeds,
seedlings, roots, plants, soils, or combinations thereof.
"Treating" or "treatment," as the terms are used herein and in the
art, refers to any application which results in contact of seeds,
seedlings, roots, or plants with an effective amount of a treatment
composition or components to enhance competitiveness for colonizing
a plant and effectiveness at promoting plant growth.
[0142] The effective amount and/or suitable application rates vary
according to the type of soil, the type of plants, the amounts of
the source of micronutrients present in the soil or added thereto,
etc. and a suitable rate can be found without difficulty by simple
trial and error experiments for each particular case. Normally, the
rate for applying at least one of the isolated strains and/or
compositions comprising at least one of the isolated strains falls
into the range of 1.times.10.sup.2-1.times.10.sup.8 colony forming
units (cfu) per seed (when coated seeds are used). In a specific
embodiment, the application rate falls in the range of
1.times.10.sup.4-1.times.10.sup.5 colony forming units (cfu) per
seed (when coated seeds are used. On a granular carrier, the
application rate falls into the range of
1.times.10.sup.8-1.times.10.sup.13 cfu per hectare. In a specific
embodiment, the application rate on a granular carrier falls into
the range of 2.times.10.sup.11-6.times.10.sup.11 cfu per hectare.
Even though the inoculant compositions and/or compositions used
according to the present invention may include a
mixture/combination of at least two or more different bacterial
strains, it is the total amount of colony forming units in the
combined mixture that is referred to throughout the specification.
The effective amount of LCO and/or CO used in a composition of the
invention for treating a seed directly is expressed in units of
concentration and generally ranges from about 10.sup.-5 to about
10.sup.-14 M (molar concentration), and in some embodiments, from
about 10.sup.-5 to about 10.sup.-11 M, and in some other
embodiments from about 10.sup.-7 to about 10.sup.-8 M. Expressed in
units of weight, the effective amount generally ranges from about 1
to about 400 .mu.g/hundred weight (cwt) seed, and in some
embodiments from about 2 to about 70 .mu.g/cwt, and in some other
embodiments, from about 2.5 to about 3.0 .mu.g/cwt seed.
[0143] For purposes of treatment of seed indirectly, i.e.,
in-furrow treatment, the effective amount of the LCO or CO
generally ranges from 1 .mu.g/acre to about 70 .mu.g/acre, and in
some embodiments, from about 50 .mu.g/acre to about 60 .mu.g/acre.
For purposes of application to the plants, the effective amount of
the LCO or CO generally ranges from 1 .mu.g/acre to about 30
.mu.g/acre, and in some embodiments, from about 11 .mu.g/acre to
about 20 .mu.g/acre.
[0144] Treatment may be accomplished directly, i.e., by application
directly on seeds, seedlings, roots, or plants (including foliage),
or may be accomplished indirectly, i.e., by application to the soil
(including in furrow).
[0145] As will be understood, treatment with each component may be
accomplished sequentially or simultaneously. For example, if a
liquid carrier is used, the components may be co-slurried in a
commercial treater mix tank and subsequently applied to seeds by
any suitable coating process, e.g., film coating. In the film
coating process, a slurry is sprayed onto the seeds in a continuous
coating process. Alternatively, for example, if a dust or powder
carrier is used, the components can be sequentially applied.
Accordingly, treatment may also encompass foliar application and/or
application of the compositions in furrow.
[0146] Non-limiting examples of plants to be treated by the
isolated strains and/or compositions comprising at least one of the
isolated strains include leguminous crops. Non-limiting examples of
leguminous crops include, but are not limited to, plants such as
soybean, alfalfa, peanut, pea, lentil, bean, and clover. As will be
appreciated, the term "crop" encompasses any plant material that
may be harvested.
[0147] Culture
[0148] The present invention is directed to a biologically pure
culture of Bradyrhizobia japonicum strain(s)
[0149] the strain having the deposit accession number NRRL B-50592
(deposited also as NRRL B-59571);
[0150] the strain having the deposit accession number NRRL B-50593
(deposited also as NRRL B-59572);
[0151] the strain having the deposit accession number NRRL B-50586
(deposited also as NRRL B-59565);
[0152] the strain having the deposit accession number NRRL B-50588
(deposited also as NRRL B-59567);
[0153] the strain having the deposit accession number NRRL B-50587
(deposited also as NRRL B-59566);
[0154] the strain having the deposit accession number NRRL B-50589
(deposited also as NRRL B-59568);
[0155] the strain having the deposit accession number NRRL B-50591
(deposited also as NRRL B-59570);
[0156] the strain having the deposit accession number NRRL B-50590
(deposited also as NRRL B-59569);
[0157] the strain having the deposit accession number NRRL B-50594
(deposited also as NRRL B-50493);
[0158] the strain having the deposit accession number NRRL
B-50726;
[0159] the strain having the deposit accession number NRRL
B-50727;
[0160] the strain having the deposit accession number NRRL
B-50728;
[0161] the strain having the deposit accession number NRRL B-50729;
and
[0162] the strain having the deposit accession number NRRL
B-50730.
[0163] As used herein, the phrase "biologically pure culture" means
a culture essentially free from biological contamination and having
a genetic uniformity such that different subcultures taken
therefrom will display substantially identical genotypes and
phenotypes (e.g., cultures have a purity of at least 60%, of at
least 65%, at least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 91%, at least 92%, at least 93%, at least
94%, at least 95%, at least 96%, at least 97%, at least 98%, at
least 99%, up to 100% pure). Such cultures may be useful in
large-scale fermentation or for other commercial purposes.
Accordingly, mutants, transconjugants, recombinants, and
genetically engineered variants which are derived from
Bradyrhizobium japonicum strains having the deposit accession
numbers NRRL B-50592 (deposited also as NRRL B-59571), NRRL B-50593
(deposited also as NRRL B-59572), NRRL B-50586 (deposited also as
NRRL B-59565), NRRL B-50588 (deposited also as NRRL B-59567), NRRL
B-50587 (deposited also as NRRL B-59566), NRRL B-50589 (deposited
also as NRRL B-59568), NRRL B-50591 (deposited also as NRRL
B-59570); NRRL B-50590 (deposited also as NRRL B-59569); NRRL
B-50594 (deposited also as NRRL B-50493); NRRL B-50726; NRRL
B-50727; NRRL B-50728; NRRL B-50729; NRRL B-50730, and cultures
thereof are within the scope of the invention.
[0164] In one embodiment the culture is a strain having the deposit
accession number NRRL B-50592 (deposited also as NRRL B-59571). In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50593 (deposited also as NRRL B-59572). In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50586 (deposited also as NRRL B-59565). In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50588 (deposited also as NRRL B-59567). In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50587 (deposited also as NRRL B-59566). In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50589 (deposited also as NRRL B-59568). In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50591 (deposited also as NRRL B-59570). In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50590 (deposited also as NRRL B-59569). In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50594 (deposited also as NRRL B-50493). In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50726. In another embodiment the culture is
a strain having the deposit accession number NRRL B-50727. In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50728. In another embodiment the culture is
a strain having the deposit accession number NRRL B-50729. In
another embodiment the culture is a strain having the deposit
accession number NRRL B-50730.
Deposit of Biological Material
[0165] The following biological material has been deposited under
the terms of the Budapest Treaty at American Type Culture
Collection (ATCC), 10801 University Blvd., Manassas, Va. 20108,
USA, and the Microbial Genomics and Bioprocessing Research Unit
(NRRL) National Center for Agricultural Utilization Research 1815
N. University Street, Peoria, Ill. 61604, USA and given the
following accession number:
TABLE-US-00001 TABLE 1 Deposit of Biological Material
Identification Accession Number Date of Deposit Bradyrhizobia
japonicum NRRL B-50592 Nov. 9, 2011 NRRL B-59571 Mar. 8, 2011
Bradyrhizobia japonicum NRRL B-50593 Nov. 9, 2011 NRRL B-59572 Mar.
8, 2011 Bradyrhizobia japonicum NRRL B-50586 Nov. 9, 2011 NRRL
B-59565 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50588 Nov. 9,
2011 NRRL B-59567 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50587
Nov. 9, 2011 NRRL B-59566 Mar. 8, 2011 Bradyrhizobia japonicum NRRL
B-50589 Nov. 9, 2011 NRRL B-59568 Mar. 8, 2011 Bradyrhizobia
japonicum NRRL B-50591 Nov. 9, 2011 NRRL B-59570 Mar. 8, 2011
Bradyrhizobia japonicum NRRL B-50590 Nov. 9, 2011 NRRL B-59569 Mar.
8, 2011 Bradyrhizobia japonicum NRRL B-50594 Nov. 9, 2011 NRRL
B-50493 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50726 Mar. 9,
2012 Bradyrhizobia japonicum NRRL B-50727 Mar. 9, 2012
Bradyrhizobia japonicum NRRL B-50728 Mar. 9, 2012 Bradyrhizobia
japonicum NRRL B-50729 Mar. 9, 2012 Bradyrhizobia japonicum NRRL
B-50730 Mar. 9, 2012 *NRRL indicates deposit with the Agricultural
Research Service Culture Collection, Peoria, IL.
[0166] The strain has been deposited under conditions that assure
that access to the culture will be available during the pendency of
this patent application to one determined by the Commissioner of
Patents and Trademarks to be entitled thereto under 37 C.F.R.
.sctn. 1.14 and 35 U.S.C. .sctn. 122. The deposit represents a pure
culture of the deposited strain. The deposit is available as
required by foreign patent laws in countries wherein counterparts
of the subject application or its progeny are filed. However, it
should be understood that the availability of a deposit does not
constitute a license to practice the subject invention in
derogation of patent rights granted by governmental action.
[0167] The following examples are included for illustrative
purposes only and are not intended to limit the scope of the
invention.
EXAMPLES
Materials and Methods
Media
[0168] YEM Agar (YEMA): (10 g/L D-mannitol; 0.50 g/L Oxoid yeast
extract; 0.10 g/L NaCl; 0.50 g/L K.sub.2HPO.sub.4; 0.20 g/L
MgSO.sub.47H.sub.2O; 12.0 g/L Agar; pH.apprxeq.6.8).
[0169] Liquid YEM: (10 g/L D-mannitol; 0.50 g/L Oxoid yeast
extract; 0.10 g/L NaCl; 0.50 g/L K.sub.2HPO.sub.4; 0.20 g/L
MgSO.sub.47H.sub.2O; pH.apprxeq.6.8).
DNA Isolation Protocol
[0170] For strains grown on plates, a 1 pL loop of each strain from
plates was added individually to 100 .mu.L PrepMan.RTM. Ultra DNA
Isolation solution from Applied Biosystems. The solution was heated
to 100.degree. C. for 10 minutes. Isolated DNA was used for PCR
analysis.
[0171] For DNA isolated from nodules, nodules were removed with
forceps from soybean roots and rinsed in diH.sub.2O. Nodules were
placed individually in 100 uL PrepMan.RTM. Ultra DNA Isolation
solution from Applied Biosystems, broken apart, and heated at
100.degree. C. for 10 minutes using a 96-well PCR Plate also from
Applied Biosystems. Disposable toothpicks were used to break the
nodules open to avoid cross contamination. Isolated DNA was used
for PCR analysis.
PCR Protocol
[0172] Polymerase chain reactions (PCR) were performed using
Applied Biosystems Veriti.RTM. 96-well Fast Thermal Cycler. PCRs
were set up for each strain. 2 .mu.L of DNA was added to 0.5 .mu.L
of a 3' primer, 0.5 .mu.L of a 5' primer, 0.5 .mu.L of Taq
Polymerase (New England Biolabs, Inc.) and 21.5 .mu.L of Platinum
Blue PCR Supermix.RTM. (Invitrogen). The PCR mixture was heated to
94.degree. C. for 4 minutes. Following denaturation, the PCR was
performed for 35 cycles with the following program: 94.degree. C.
for 1 minute, 68.degree. C. or primer annealing dependent
temperature(s) for 1 minute, and reaction extension at 72.degree.
C. for 1 minute. After completion of the PCR program, 5 pL of PCR
mixture was run on a Lonza.RTM. FlashGel.RTM. system.
Strain Isolation Protocol
[0173] To isolate strains, nodules were surface sterilized with 10%
household bleach for 2 minutes. Nodules were rinsed in sterile
water and then placed in a microcentrifuge tube with 250 uL of
sterile water. Nodules were crushed with sterile toothpicks and the
Rhizobium strains were released into the water. Two 10 uL loops of
water were streaked out for single colonies onto YEMA plates. All
plates were wrapped with Parafilm.RTM. and grown at 30.degree. C.
in an Eppendorf Innova.RTM. 42R incubator. Growing time differed
per isolate.
Primary Screening Protocol
[0174] Strains were primarily screened by two distinct protocols,
i.e., the "Soybean Field Soil Protocol (USDA 532C Treated Field)"
and the "Untreated (Control) Field Protocol." Each protocol is
described.
[0175] Soybean Field Soil Protocol (USDA 532C Treated Field)
[0176] Soybean seeds coated with USDA 532C were planted in various
soils throughout soybean growing regions in the United States,
e.g., South Dakota, North Dakota, Georgia, Iowa, Nebraska,
Illinois, Indiana, Texas, Kansas, Minnesota, etc. Soybean seeds
treated with Bradyrhizobium japonicum strain USDA 532C were grown
in these soils, harvested, and the soybean nodules were analyzed
directly using PCR analysis. Forty (40) nodules were collected from
each soil sample. Individual soybean nodules were loaded into a
single well of 96 well microtiter plate. DNA from those individual
soybean nodules was isolated directly from nodules based on the
procedure described supra (see Materials and Methods: DNA Isolation
Protocol).
[0177] PCR analysis using USDA 532C specific primer 209 was
performed directly on the 96 well plate (see Materials and Methods:
PCR Protocol). The amplification of primer 209 (0.9 kb band) from
the 40 nodules was calculated to determine the percent
amplification. If the 0.9 kb DNA amplification was less than or
equal to 30% (i.e., greater than or equal to 70% of the PCR was
negative for primer 209 amplification), then the soil sample
contained Bradyrhizobium japonicum strains with greater
competitiveness than the USDA 532C strain. Soybean nodules with
less than or equal to 30% amplification contained native strains
identified as being more competitive than USDA 532C based on the
procedure described (see Materials and Methods: Strain Isolation
Protocol).
[0178] If more than 30% of soybean nodules were colonized by
Bradyrhizobia japonicum strain USDA 532C, then the soil was deemed
unfit for novel strain isolation and the soil sample was
terminated.
[0179] Untreated Field (Control) Protocol
[0180] Nodules were obtained from soybean fields untreated with
USDA 532C, in the following states: Arkansas, Georgia, Illinois,
Indiana, Iowa, Oklahoma, Nebraska, Kansas, Missouri, and Texas.
Bradyrhizobium japonicum strains were isolated directly from these
nodules per the protocol described supra (see Materials and
Methods: Strain Isolation Protocol). Isolated strains were put into
direct competition with Bradyrhizobia japonicum strain USDA 532C
per the "Competition Study Protocol" (see Materials and Methods:
Competition Study Protocol). Isolated strains that occupied more
than 70% of soybean nodules when compared to Bradyrhizobia
japonicum strain USDA 532C, were selected for performance
evaluation (see Materials and Methods: Performance Study
Protocol).
Competition Study Protocol
[0181] Optical densities were determined. (Nanodrop.RTM. ND1000
Spectrophotometer) A 1:1 inoculum ratio of USDA 532C to each
isolate strain was obtained. USDA 532C was diluted or concentrated
to an optical density of 0.5 at 600 nm and 0.5 mL of USDA 532C
inoculum was set aside for each isolate. All isolate strains were
either concentrated or diluted to an optical density of 0.5 at 600
nm using the following calculation: (0.5 optical density USDA
532C).times.(0.5mL USDA 532C)=(isolate strain optical
density).times.(isolate strain mL). 0.5 mL of USDA 532C was added
to 0.5 mL of each isolate as separate treatments. Soybean seeds
were coated with the inoculum mixture at a rate of 0.5 mL inoculum
mixture per 12 soybean seeds. The seeds were allowed to imbibe for
30 minutes. 5 of the 12 treated soybean seeds were planted in
Fafard.RTM. 3B Potting mix in a 1 gallon pot. Gloves were worn to
plant the seeds and were changed between treatments. Following
planting, the 7 remaining treated soybean seeds were discarded.
[0182] At germination, pots were thinned to 3 plants. Plants were
grown for 6-7 weeks in a greenhouse and cross-contamination during
the watering process was avoided. Temperatures ranged from
approximately 23.degree. C.-32.degree. C. Watering was performed on
an "as needed" basis. Nodules were harvested from each treatment
and used for DNA isolation and PCR analysis with USDA 532C specific
primer 209. See Materials and Methods: DNA isolation protocol and
PCR Protocol.
Performance Study Protocol
[0183] The performance study is a direct strain to strain
performance comparison between a single isolated strain and
commercially available Bradyrhizobium japonicum strain USDA 532C.
The isolate strain and the control strain (Bradyrhizobium japonicum
strain USDA 532C) were streaked out concurrently on separate YEMA
plates. The isolate strain and the control strain were separately
inoculated into 5 mL of YEM liquid media to obtain an initial
optical density of 0.03 at 600 nm in each inoculum tube.
(Nanodrop.RTM. ND1000 Spectrophotometer) The isolate strain and the
control strain were incubated separately at 30.degree. C. for 3
days. Following incubation, the inoculum for the isolate strain and
the control strain was further diluted or concentrated to a final
optical density of 0.5 at 600 nm in each inoculum tube
(Nanodrop.RTM. ND1000 Spectrophotometer) to obtain a test treatment
(isolate strain) and a control treatment (control strain
Bradyrhizobium japonicum strain USDA 532C).
[0184] 0.75 mL of the test treatment was added to 32 soybean seeds.
The treated seeds were allowed to imbibe for 30 minutes. After 30
minutes, 2 seeds were planted into 15 separate
(4''.times.4''.times.6'') pots in Fafard.RTM. 3B Potting mix.
Gloves were worn to plant the seeds and were changed between
treatments. Following planting, the 2 remaining treated soybean
seeds were discarded. This process was repeated for the control
treatment.
[0185] At germination, test treatment and control treatment pots
were thinned to a single plant. Plants were grown for 8-10 weeks in
a greenhouse and cross-contamination during the watering process
was avoided. Temperatures ranged from approximately 23.degree.
C.-32.degree. C. Watering was performed on an "as needed" basis.
After 8-10 weeks, pods were harvested and dried overnight at
80.degree. C. Analysis with JMP.RTM. statistical software (SAS
Institute, Inc.) was used to determine statistically significant
performance enhancement compared to Bradyrhizobium japonicum strain
USDA 532C.
Temperature Profile Protocol
[0186] Isolated Bradyrhizobium japonicum strains were streaked onto
YEMA plates (10 g/L D-mannitol; 0.50 g/L Oxoid yeast extract; 0.10
g/L NaCl; 0.50 g/L K.sub.2HPO.sub.4; 0.20 g/L MgSO.sub.47H.sub.2O;
12.0 g/L Agar; pH.apprxeq.6.8) and incubated at 30.degree. C. and
35.degree. C. respectively for 7 days. The isolated strains were
analyzed for their ability to grow isolated colonies.
Glyphosate Resistance Profile Protocol
[0187] Isolated Bradyrhizobium japonicum strains were streaked onto
1 mM glyphosate, and 2 mM glyphosate, YEMA plates (10 g/L
D-mannitol; 0.50 g/L Oxoid yeast extract; 0.10 g/L NaCl; 0.50 g/L
K.sub.2HPO.sub.4; 0.20 g/L MgSO.sub.47H.sub.2O; 12.0 g/L Agar;
pH.apprxeq.6.8). The plates were incubated at 30.degree. C. for 7
days and the strains were analyzed for their ability to grow
isolated colonies.
Antibiotic Profile Protocol
[0188] Isolated Bradyrhizobium japonicum strains were T-streaked
onto gentamicin (50 mg/L) YEMA, chloramphenicol (50 mg/L) YEMA,
polymyxin B (100 mg/L) YEMA, carbenicillin (100 mg/L) YEMA,
neomycin (50 mg/L) YEMA, and nalidixic acid (50 mg/L) YEMA. The
plates were incubated at 30.degree. C. for 7 days and the strains
were analyzed for their ability to grow isolated colonies.
Diversilab.RTM. PCR Protocol
[0189] Diversilab.RTM. PCR was set up using the Diversilab
Pseudomonas Kit.RTM. from BioMerieux. This kit contained
proprietary primers designed to amplify various portions of the
genome to produce a fingerprint of multiple DNA amplifications.
Each strain has a unique fingerprint and percent similarity among
strains can be determined using the Diverilab software.
[0190] The PCR was setup accordingly. 2 .mu.L of DNA was added to
18.0 .mu.L of Re-PCR MM1, 2.0 .mu.L of primer mix, 0.5 .mu.L of Taq
Polymerase (New England Biolabs, Inc.) and 2.5 .mu.L of Taq
Polymerase buffer (New England Biolabs, Inc.) for a total volume of
25 uL. The PCR was heated to 94.degree. C. for 2 minutes and then
run for 35 cycles according to the following: 94.degree. C. for 0.5
minutes, then 50.degree. C. for 0.5 minutes, and finally 70.degree.
C. for 1.5 minutes. After the completion of the 35 cycles, the
entire reaction was maintained at 70.degree. C. for 3 minutes.
Following completion of the PCR analysis, the PCR product was run
on the Agilent.RTM. 2100 Series Bioanalyzer. Diversilab.RTM. DNA
Reagents & Supplies Kit from BioMerieux was used to load PCR
product onto Diversilab.RTM. System chips. The kit was maintained
according to instructions. Before use, the kit sat at room
temperature for 30 minutes prior to loading the Diversilab.RTM.
chip. The Diversilab.RTM. chip was loaded in full accordance with
all protocols and instructions provided. Upon completion of loading
the Diversilab.RTM. chip, the chip was loaded into the Agilent.RTM.
2100 Series Bioanalyzer and the analysis performed until
completion.
Example 1
[0191] Unique Primer Design for Commercial Bradyrhizobium strain
USDA 532C
[0192] A genetic identification method was developed to evaluate
the competitiveness of commercial Bradyrhizobium japonicum strain
USDA 532C against native strains in the field. A primer specific to
USDA 532C was identified and PCR technology was used to efficiently
evaluate competitiveness of USDA 532C in the field.
[0193] Complete genome sequencing of USDA 532C was performed at
Novozymes Davis. Twenty-five different DNA fragments were found to
have low homology with public sequences of Bradyrhizobium
japonicum. DNA was isolated from strains of B. japonicum (USDA
532C, P152, Br173, Br187, P190, and P194) grown on plates according
to the procedure described supra (see Materials and Methods: DNA
Isolation Protocol). Additional sequence analysis was performed on
those twenty-five DNA fragments. Putative unique primers for USDA
532C strain were chosen and used for USDA 532C-specific primer
screening by PCR against some representative Bradyrhizobium
japonicum strains. After PCR evaluation, a single unique primer for
USDA 532C was identified and was designated as p209.
[0194] Primer 209 sequence was as follows:
TABLE-US-00002 -P209p5- SEQ ID NO: 1 TTGGGTTGAGCATGCCCACCCGGACGG,
-P209p3- SEQ ID NO: 2 GTCTCAGTTGCCGAGCCCACGGCGC
Primer Specificity
[0195] The twenty-five primers were individually tested for
positive identification of USDA 532C. The primers were further
tested for USDA 532C specificity through PCR using USDA 532C and 5
different native strains of B. japonicum (P152, Br173, Br187, P190,
and P194) for comparison. Genome sequencing indicated that Br187
and USDA 532C were genetically the same.
TABLE-US-00003 TABLE 2 Primer Screening Summary USDA PCR Primer
532C P152 Br173 Br187 P190 P194 Temp 787 - - - - - - 65 1114 + + +
+ + + 65 1181 + + + + + + 64 943 + + + + + + 60 1073 + + + + + + 65
125 + - - + - - 68 209* + - - + - - 68 487 + - - + - - 68 567 + - -
+ - - 58 744 + - - + - - 65 811 + - - + - - 65 989 + - - + - - 69
1073 + - - + - - 69 989 a + - - + - - 64 893 + - - + - - 64 2254 +
- - + + + 68 607 + - - + + + 68 389 + - - + + + 60 728 + - - + + +
65 869 + - - + + + 62 1424 + - + + + + 65 1181 + + + + + + 60 989 b
+ - + + + + 65 895 + - + + + + 65 943 + - - + + - 64 *Primer 209
exhibited the clearest bands and was chosen for further
evaluation.
[0196] Table 2 summarizes the findings ("+" indicates a positive
identification of a PCR amplification band in the gel, "-"
indicates no DNA amplification).
[0197] Referring to FIG. 1A, it was demonstrated that isolated
primer 209 is specific to USDA 532C and Br187. Further genetic
testing, showed that USDA 532C and Bradyrhizobium japonicum strain
P187 are identical (results not shown). The well contents (left to
right) indicate the following native strains USDA 532C, P152,
Br173, Br187, Br190, Br194, and the control ladder. See FIG.
1A.
[0198] The specificity of primer 209 was tested against native
strains P152, Br173, Br187, Br190, Br194, and USDA 532C. See FIG.
1B. PCR with primer 209 was performed for 100 strains obtained from
untreated plots in field trials according to the above method (see
Materials and Methods: Untreated (Control) Field Protocol).
Bradyrhizobium japonicum strain USDA 532C was not added to these
plots. Of the strains tested, only 3% of the native strains could
be amplified for a 0.9 kb band specific to primer 209. This result
demonstrated that primer 209 could be used for specific detection
of USDA 532C.
Example 2
Analyzing and Isolating Novel Strains
[0199] Primer 209 was used as a marker to indicate the presence or
absence of colonization by Bradyrhizobia japonicum strain USDA 532C
into the root nodules of soybean plants. Bands (i.e., a 0.9 kb
band) indicating the presence of primer 209 represent a positive
identification of Bradyrhizobia japonicum strain USDA 532C. See
FIG. 2A. FIG. 2A is exemplary of an instance wherein Bradyrhizobia
japonicum strain USDA 532C is the dominantly competitive strain for
colonization of soybean plant nodules when compared to other native
Rhizobial strains. In FIG. 2B, the number of bands indicating
positive identification for primer 209, and therefore the presence
of Bradyrhizobia japonicum strain USDA 532C, are reduced in
comparison to the total number bands present for primer 209 in FIG.
2A. FIG. 2A and FIG. 2B demonstrate that the presence or absence of
primer 209 can be used to determine whether USDA 532C is the
dominantly competitive strain in the nodules of a soybean
plant.
[0200] Isolated Bradyrhizobium japonicum strains were selected from
nodules according to both screening protocols (see Materials and
Methods: Primary Screening Protocol). The selected strains were
isolated from the nodules according to the isolation procedure (see
Materials and Methods: Strain Isolation Protocol).
Example 3
[0201] Head-to-head Competition Evaluation
[0202] All isolated strains were put into a screening program
designed to directly challenge the competitiveness of the isolate
against Bradyrhizobium japonicum strain USDA 532C in terms of
nodule colonization ability (see Materials and Methods: Competition
Study Protocol).
[0203] Isolated primer 209 specific to USDA 532C was used as a
marker to indicate the presence or absence of colonization by
Bradyrhizobia japonicum strain USDA 532C into the root nodules of
soybean plants. Positive identification for primer 209 indicated
the colonization of Bradyrhizobia japonicum strain USDA 532C into
the root nodules of soybean plants. Conversely, the absence of
bands indicating positive identification for primer 209 indicated
colonization of a native strain into the root nodules of soybean
plants other than Bradyrhizobia japonicum strain USDA 532C.
Isolated strains that exhibited a greater than 70% colonization of
the analyzed nodules were chosen for a second evaluation for
confirmation. Strains were subject to at least two rounds of
competition evaluation. Through this procedure, over 1000 isolates
have been screened for enhanced competitiveness.
Example 4
Performance Evaluation
[0204] The performance study is a direct strain to strain
comparison of isolated strains to USDA 532C. Enhanced performance
was measured as a function of Pod Dry Weight (g). See Materials and
Methods: Performance Study Protocol. Results are provided in Tables
3A-3D
TABLE-US-00004 TABLE 3A Enhanced Performance as a Function of Pod
Dry Weight (g) Strain Percent Colonization Pod dry weight (g) NRRL
B- 59571 85 5.92 NRRL B-59567 80 6.12 NRRL B-59572 85 6.05 NRRL
B-59565 80 5.87 USDA532-C -- 5.72
The percent colonization was confirmed in triplicate studies and
increased pod dry weight was confirmed in duplicate studies for all
strains.
TABLE-US-00005 TABLE 3B Enhanced Performance as a Function of Pod
Dry Weight (g) Strain Percent Colonization Pod dry weight (g) NRRL
B- 50493 75 4.86 NRRL B-59570 80 5.30 USDA532-C -- 5.45
The percent colonization was confirmed in triplicate studies and
increased pod dry weight was confirmed in duplicate studies for all
strains.
TABLE-US-00006 TABLE 3C Enhanced Performance as a Function of Pod
Dry Weight (g) Strain Percent Colonization Pod dry weight (g) NRRL
B-59566 85 5.30 NRRL B-59569 85 5.50 NRRL B-59568 95 5.69 USDA532-C
-- 4.69
The percent colonization was confirmed in triplicate studies and
increased pod dry weight was confirmed in duplicate studies for all
strains.
TABLE-US-00007 TABLE 3D Enhanced Performance as a Function of Pod
Dry Weight (g) Strain Percent Colonization Pod dry weight (g) NRRL
B-50726 95 5.79 NRRL B-50727 85 5.02 NRRL B-50728 83 5.78 NRRL
B-50729 83 5.94 NRRL B-50730* 90 5.94 USDA532-C -- 5.45
The percent colonization and increased pod dry weight were
confirmed in duplicate studies for all strains except NRRL B-50730*
which has only had one round of testing.
[0205] Commercially available strain USDA 532C was used as a
control for each evaluation. Results of Tables 3A-3D indicate that
all but one of the isolated strains had enhanced performance when
compared to the control, USDA 532C.
Example 5
Characterization Study
[0206] Isolated Bradyrhizobium japonicum strains were further
characterized based on temperature, glyphosate resistance, and
antibiotic profiles (see Materials and Methods: Temperature
Profile, Glyphosate Resistance Profile, and Antibiotic Profile
Protocols). Results provided in Table 4.
TABLE-US-00008 TABLE 4 Characterization of Isolated Strains as a
Function of Temperature Profile, Glyphosate Resistance, and
Antibiotic Resistance NRRL NRRL NRRL NRRL NRRL NRRL NRRL NRRL NRRL
B- B- B- B- B- B- B- B- B- USDA Treatment 59565 59572 59567 59566
59570 59568 59569 50493 59571 532C 30.degree. C. + + + + + + + + +
+ 35.degree. C. + - - + + + - + - - 1.0 mM glyphosate + - - - - + +
+ - - 2.0 mM glyphosate - - - - +- - + - - Gentamicin + - - - + - +
+- - + Chloramphenicol + - - + + + + + - + Polymyxin B + + + + + +
+ + + + Carbenicillin + - - - - - + - +- + Neomycin + - + +- - + +
- + + Nalidixic acid - - - + - - + - - -
[0207] Table 4 summarizes the results ("+" indicates growth with
isolated colonies, "-" indicates no growth, and "+-" indicates a
few isolated colonies/minimal and sporadic growth). Results
indicate that strains NRRL B-59570, NRRL B-59568, NRRL B-59565,
NRRL B-59566 and NRRL B-50493 are tolerant to temperatures of
substantially 35 .degree. C. Results further indicate that isolated
strains NRRL B-59569, NRRL B-59568, NRRL B-59565, and NRRL B-50493
are naturally resistant to glyphosate. Strains NRRL B-59566 and
NRRL B-59569 were found to have resistance to nalidixic acid.
Example 5
DNA Fingerprint Development
[0208] Top performing isolates were put through DNA Diversilab.RTM.
fingerprint analysis (see Materials and Methods: Diversilab.RTM.
PCR Protocol). DNA was isolated from each strain according to the
methods discussed (see Materials and Methods: DNA Isolation
Protocol). Isolated DNA was used for PCR analysis.
[0209] Results to the Diversilab DNA Fingerprint Analysis are
indicated in FIGS. 3A-3B. Results demonstrate that the isolated
strains are unique strains and strains different than USDA
532C.
[0210] The invention described and claimed herein is not to be
limited in scope by the specific embodiments herein disclosed,
since these embodiments are intended as illustrations of several
aspects of the invention. Any equivalent embodiments are intended
to be within the scope of this invention. Indeed, various
modifications of the invention in addition to those shown and
described herein will become apparent to those skilled in the art
from the foregoing description. Such modifications are also
intended to fall within the scope of the appended claims. In the
case of conflict, the present disclosure including definitions will
control.
[0211] Various references are cited herein, the disclosures of
which are incorporated by reference in their entireties.
Sequence CWU 1
1
2127DNAArtificial SequencePrimer 209p5 1ttgggttgag catgcccacc
cggacgg 27225DNAArtificial SequencePrimer 209p3 2gtctcagttg
ccgagcccac ggcgc 25
* * * * *