U.S. patent application number 15/499072 was filed with the patent office on 2018-08-23 for needle-free administration of prrsv vaccines.
This patent application is currently assigned to MERIAL INC.. The applicant listed for this patent is CHULALONGKORN UNIVERSITY, MERIAL INC.. Invention is credited to Jean-Christophe Audonnet, Catherine Charreyre, Sanipa Suradhat.
Application Number | 20180236056 15/499072 |
Document ID | / |
Family ID | 46210436 |
Filed Date | 2018-08-23 |
United States Patent
Application |
20180236056 |
Kind Code |
A1 |
Suradhat; Sanipa ; et
al. |
August 23, 2018 |
Needle-free administration of PRRSV vaccines
Abstract
The invention provides novel methods and compositions for the
vaccination of porcine animals against porcine reproductive and
respiratory syndrome virus (PRRSV). Described herein are
immunological and/or vaccine compositions comprising a DNA vector
encoding a PRRSV protein, particularly a truncated ORF7 protein,
which are administered to porcines using needle-free delivery. The
plasmid can include more than one nucleic acid molecule such that
the plasmid can express more than one antigen. Also disclosed are
methods for using and kits employing such compositions.
Inventors: |
Suradhat; Sanipa; (Yannawa,
TH) ; Audonnet; Jean-Christophe; (Lyon, FR) ;
Charreyre; Catherine; (Lyon, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
MERIAL INC.
CHULALONGKORN UNIVERSITY |
Duluth
Bangkok |
GA |
US
TH |
|
|
Assignee: |
MERIAL INC.
DULUTH
GA
CHULALONGKORN UNIVERSITY
Bangkok
|
Family ID: |
46210436 |
Appl. No.: |
15/499072 |
Filed: |
April 27, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13479451 |
May 24, 2012 |
9669085 |
|
|
15499072 |
|
|
|
|
61491955 |
Jun 1, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2039/53 20130101;
A61K 39/12 20130101; A61K 2039/552 20130101; A61P 31/14 20180101;
C12N 2770/10034 20130101; A61K 2039/54 20130101 |
International
Class: |
A61K 39/12 20060101
A61K039/12 |
Claims
1-20. (canceled)
21. A non-viral DNA plasmid vector comprising a nucleic acid
sequence encoding a truncated porcine reproductive and respiratory
syndrome virus (PRRSV) ORF7 protein; wherein when said plasmid is
administered to a suidae animal there is expression in vivo in the
suidae animal of the truncated PRRSV ORF7 protein in an effective
amount to provide the suidae animal protection from subsequent
challenge with a virulent PRRSV; with the proviso that the
truncated ORF7 protein lacks at least ii carboxy terminal amino
acids when said truncated ORF7 protein is aligned and compared with
a non-truncated PRRSV ORF7 protein having the polypeptide sequence
as set forth in SEQ ID NO: 2.
22. The plasmid of claim 21, wherein the encoded truncated PRRSV
ORF7 protein has at least 85% homology to the sequence as set forth
in SEQ ID NO: 4.
23. The plasmid of claim 21, wherein the nucleic acid sequence
consists of a sequence encoding the polypeptide sequence as set
forth in SEQ ID NO: 4.
24. The plasmid of claim 21, wherein the truncated PRRSV ORF7
protein is encoded by a sequence having at least 70% homology with
the sequence as set forth in SEQ ID NO:3.
25. The plasmid of claim 24, wherein the truncated PRRSV ORF7
protein is encoded by a sequence set forth in SEQ ID NO: 3.
26. A vaccine comprising the plasmid of claim 21.
27. The vaccine of claim 26, further comprising an adjuvant.
28. The vaccine of claim 27, formulated as an oil-in-water
emulsion.
29. The vaccine of claim 28, wherein the emulsion is TS6.
30. The vaccine of claim 26, further comprising a pharmaceutically
or veterinarily suitable carrier.
31. The vaccine of claim 26, formulated for transdermal
administration.
32. The vaccine of claim 26, which is more effective at eliciting
in an animal a protective immune response as compared with an
otherwise identical vaccine, wherein the PRRSV protein is
full-length instead of truncated.
33. The vaccine of claim 32, wherein the full-length protein has
the sequence as set forth in SEQ ID NO: 2, and wherein the
truncated PRRSV ORF7 protein has the sequence as set forth in SEQ
ID NO: 4.
34. A method of eliciting in a suidae animal a safe and protective
immune response against PRRSV comprising administering the vaccine
of claim 26.
35. The method of claim 34, wherein the animal is a weaned piglet
from about 11 to about 24 days of age.
36. The method of claim 34, wherein the vaccine is delivered using
a liquid jet needle-free injector.
37. The method of claim 36, wherein the liquid jet needle-free
injector is a DERMAVAC.TM. device.
38. The method of claim 34, wherein the plasmid is a pMASIA-based
plasmid.
39. A vaccination kit or set, comprising a liquid jet needle-free
injector and at least one vaccine vial containing the PRRSV vaccine
of claim 26, operatively assembled to perform the administration of
the vaccine to a suidae animal and to elicit a safe and protective
immune response against PRRSV.
40. The kit of claim 39, comprising about 100 ng to about 500 .mu.g
of the plasmid.
Description
INCORPORATION BY REFERENCE
[0001] This application claims priority to provisional application
U.S. Ser. No. 61/491,955, filed on Jun. 1, 2011, and incorporated
by reference herein in its entirety.
FIELD OF THE INVENTION
[0002] The invention provides a method of vaccination of an animal
against Porcine Reproductive and Respiratory Syndrome (PRRS).
BACKGROUND OF THE INVENTION
[0003] Porcine reproductive and respiratory syndrome virus (PRRSV)
belongs to a family of enveloped positive-strand RNA viruses called
arteri viruses. Other viruses in this family are the prototype
virus, equine arteritis virus (EAV), lactate
dehydrogenase-elevating virus (LDV) and simian hemorrhagic fever
virus (SHFV) (de Vries et al., 1997 for review). Striking features
common to the Coronaviridae and Arteriviridae have recently
resulted in their placement in a newly created order, Nidovirales
(Pringle, 1996; Cavanagh, 1997; de Vries et al., 1997). The four
members of the Arterivirus group, while being similar in genome
organization, replication strategy and amino acid sequence of the
proteins are also similar in their preference for infection of
macrophages, both in vivo and in vitro (Conzelmann et al., 1993;
Meulenberg et al, 1993a).
[0004] The genome organization of arteriviruses is reviewed in de
Vries et al. (1997). The genome RNA is single-stranded, infectious,
polyadenylated and 5' capped. The genome of PRRSV is small, at
15,088 bases. Both the EAV and LDV genomes are slightly smaller at
12,700 bases and 14,200 bases, respectively. Complete sequences of
EAV, LDV and PRRSV genomes are available (Den Boon et al, 1991;
Godeny et al, 1993; Meulenberg et al. 1993a).
[0005] The genome contains eight open reading frames (ORFs) that
encode, in the following order, the replicase genes (ORFs 1a and
1b), the envelope proteins (ORFs 2 to 6) and the nucleocapsid
protein (ORF 7) (Meulenberg et al. 1993a). ORFs 2 to 7 are
expressed from six sub-genomic RNAs, which are synthesized during
replication (Meng et al., 1994, 1996). These sub-genomic RNAs form
a 3' co-terminal nested set and are composed of a common leader,
derived from the 5' end of the viral genome (Meulenberg et al.
1993b). Although the RNAs are structurally polycistronic,
translation is restricted to the unique 5' sequences not present in
the next smaller RNA of the set. Two large overlapping open reading
frames (ORFs), designated ORF 1a and ORF 1b, take up more than two
thirds of the genome. The second ORF, ORF 1b is only expressed
after a translational read-through via a -1 frame shift mediated by
a pseudoknot structure (Brierley 1995). The polypeptides encoded by
these ORFs are proteolytically cleaved by virus-encoded proteases
to yield the proteins involved in RNA synthesis.
[0006] ORF 2 encodes a 29-30 kDa N-glycosylated structural protein
(GP2 or GS) showing the features of a class 1 integral membrane
glycoproteins (Meulenberg and Petersen-den Besten, 1996 using the
Ter Huurne strain of Lelystad virus). The ORF 2 protein shows 63%
amino acid homology when the American VR-2332 isolate is compared
to Lelystad virus (Murtaugh et al., 1995). ORF 3 encodes a
N-glycosylated 45-50 kDa minor structural protein designated GP3
(van Nieuwstadt et al., 1996). ORF 4 encodes a 31-35 kDA minor
N-glycosylated membrane protein designated GP4 (van Nieuwstadt et
al., 1996). ORF 5 encodes GP5 or GL, which is a 25 kDA major
envelope glycoprotein (Meulenberg et al., 1995). ORF 6 encodes an
18 kDA class III non-glycosylated integral membrane (M) protein
(Meulenberg et al, 1995). ORF 7 encodes a 15 kDa non-glycosylated
basic protein. Equine arteritis virus (EAV) genome ORF was
designated 2a and codes for an essential 8 kDa structural protein
called "E" (Snijder et al, 1999). In PRRSV, the homologous ORF has
been designated 2b, the ORF 2 coding for GP2 (see above) being
renamed ORF 2a (Snijder et al., 1999).
[0007] Two main groups of clinical signs are associated with the
occurrence of PRRS although it is now recognized that clinical
effects vary greatly among infected herds and in many cases,
infection is sub-clinical and productivity is within acceptable
parameters. The two groups are: (1) Reproductive signs which
include premature births, late-term abortions, piglets born weak
and increased numbers of still-births and mummifications (Done and
Paton, 1995). (2) Signs of respiratory disease are also important
in neonatal pigs with labored breathing and coughing being the most
dominant characteristics. The symptoms usually occur in pigs about
three weeks of age though all ages are susceptible. In contrast to
the reproductive failures, clinically overt respiratory disease is
harder to reproduce experimentally (Zimmermann et al. 1997). These
clinical signs vary considerably and may be influenced by the virus
strain (Halbur et al., 1995), age at infection and differences in
genetic susceptibility (Halbur et al., 1992), concurrent infections
(Galina et al., 1994), pig density, pig movements and housing
systems (Done et al., 1996) and immune status including the
presence of low levels of PRRS virus-specific antibodies which may
be enhancing (Yoon et al., 1994).
[0008] There appear to be three routes of transmission: (1) nose to
nose or close contact (Done et al, 1996), (2) aerosols (Le Potier
et al, 1995), and (3) spread through urine, feces and semen.
Transmission via insemination with contaminated semen is
well-documented (Yeager et al., 1993; Albina, 1997). In terms of
pathogenesis, the most significant change induced by PRRSV is the
severe damage to alveolar macrophages, which are destroyed in huge
numbers (reviewed in Done and Paton, 1995; Rossow, 1998). The
induction of apoptosis in a large number of mononuclear cells in
the lungs and lymph nodes might be an explanation for a dramatic
reduction in the number of alveolar macrophages and circulating
lymphocytes and monocytes in PRRSV-infected pigs (Sirinarumitr et
al., 1998; Sur et al., 1998). Coupled with the destruction of
circulating lymphocytes and the destruction of the mucociliary
clearance system, this may suppress immunity and render pigs more
susceptible to secondary infection. An enhanced rate of bacterial
secondary infections has been documented following PRRSV infection
(Galina et al, 1994; Done and Paton, 1995; Nakamine et al. 1998).
The severity of PRRSV infection may be also increased by bacterial
or mycoplasma infection (Thacker et al. 1999). In addition a number
of viral infections have been found associated with PRRS (Carlson,
1992; Brun et al., 1992; Halbur et al, 1993; Done et al., 1996;
Heinen et al., 1998).
[0009] Infection with PRRSV usually induces slow and weak
anti-viral immune responses, leading to persistent infection and
immunosuppression in the lungs of infected pigs. The reported PRRSV
immune evasion strategies include inhibition of innate immune
responses, induction systemic immunosuppressive cytokine; IL-10 and
porcine Tregs (CD4.sup.+CD25.sup.+Foxp3.sup.+ lymphocytes) that
resulted in generalized immunosuppression during an early phase of
infection. The adaptive immunity against PRRSV is often slow and
inefficient, with evidence of polyclonal B cell activation and
induction of ADE in the following exposure. Applicants have
recently generated experimental evidence suggesting that the
immunomodulatory properties of the virus may rely on the
interaction of the structural protein and the immune cells (S.
Suradhat, unpublished observation). In general, PRRSV infection
does not kill the infected pigs, but rather causes several health
complications related to suboptimal immune function. Several
reports demonstrate that the PRRSV-induced immunomodulatory
activities could result in secondary immunodeficiency causing
persistent infection, secondary complications, and vaccine failure
in the infected pigs.
[0010] Although, several commercial vaccines are available in the
market, the benefit of vaccine-induced immunity in the vaccinated
pigs has not been satisfactory. The modified live vaccine (MLV) has
proven more efficacious than the inactivated vaccine due to its
ability to induce relatively broader immunity. Evidence also
suggest a role for cell-mediated immunity in limiting PRRSV
infection and spreading within infected pigs. However, induction of
specific immunity by MLV has proven to be delayed and inefficient.
In addition, the immunity induced by MLV provides only partial
protection against heterologous PRRSV infection. In some cases, the
use of MLV has raised concerns regarding safety and induction of
immunotolerance.
[0011] In general, the development of vaccine against viral
infection relies on induction of viral-specific protective humoral
and cellular-mediated immunity. The development of effective PRRS
vaccine has been extensively challenged with the high antigenic
variability of the virus (quasispecies) and its ability to control
the immune system via several immunomodulatory activities.
Therefore, despite of being properly primed prior to infection, the
vaccine-induced, PRRSV-specific effector/memory cells might not be
able to function well during an early phase of infection. Since
PRRSV alone does not kill infected pigs, we hypothesize that if the
PRRSV-induced immunomodulatory effects is removed/reduced, the
immune system of the infected host should be able to limit/clear
viral infection by itself. This will also help minimizing
persistent infection and secondary complications in the late stage
of infection.
[0012] A vaccine that could induce strong cross-reactive,
anti-PRRSV cellular immunity should have benefit on reduction of
viremia, PRRSV-induced clinical signs, and improving of the general
health condition by reducing secondary complications related to
PRRSV-induced immunodeficiency. In addition, avoiding of
unnecessary B cell activation by the vaccine antigen would be ideal
for implementation of the differentiation of infected and
vaccinated animals (DIVA) strategies in the farms. It has been
proposed to use needle-free injectors in veterinary field
(WO-A-98/03659; WO-A-92/15330; WO-A-98/03658; van Rooij et al.,
Vet. Immunol. Immunopathol., 1998, 66(2), 113-126; U.S. Pat. No.
6,451,770; Schrijver et al., Vaccine, 1998, 16(2-3), 130-134), but
the prior art contains inconsistent and contradictory results
(McKercher P. D. et al., Can. J. Comp. Med., 1976, 40, 67-74;
Epstein, Hum. Gene Ther., 2002, 13(13), 275-280; Haensler, Vaccine,
1999, 17(7-8), 628-638). Therefore, a skilled person cannot predict
whether needle-free delivery will be efficacious for an untested
host/vaccine combination.
[0013] Citation or identification of any document in this
application is not an admission that such document is available as
prior art to the present invention.
SUMMARY OF THE INVENTION
[0014] The objective of the present invention is to provide a new
method of vaccination of an animal of the suidae family, which is
efficient, easier and less expensive to use, and which leads to
increased safety.
[0015] This objective is met by administering a porcine
reproductive and respiratory syndrome virus (PRRSV) DNA vaccine
with the aid of a liquid jet needle-free injector, ensuring
distribution of the vaccine essentially in the dermis and the
hypodermis of the animal.
[0016] A first object of the present invention is a vaccination
method against PRRSV, which may comprise the step of administration
essentially in the dermis and the hypodermis of an animal of the
suidae family an efficient amount of a PRRSV DNA vaccine using a
liquid jet needle-free injector, which administration elicits a
safe and protective immune response against PRRSV.
[0017] Another object is a vaccination kit or set, which may
comprise such a liquid jet needle-free injector and at least one
vaccine vial containing a PRRSV DNA vaccine, operatively assembled
to perform the administration of the vaccine essentially in the
dermis and the hypodermis of an animal of the suidae family and to
elicit a safe and protective immune response against PRRSV.
[0018] Another object of the invention is the use of a DNA vector
which may encode and express at least one PRRSV immunogen and of an
acceptable vehicle or diluent, for the preparation of a liquid
vaccine designed to be administered essentially in the dermis and
the hypodermis of animals of the suidae family using a liquid jet
needle-free injector, and resulting in eliciting a safe and
protective immune response against PRRSV.
[0019] It is noted that in this disclosure and particularly in the
claims and/or paragraphs, terms such as "comprises", "comprised",
"comprising" and the like can have the meaning attributed to it in
U.S. Patent law; e.g., they can mean "includes", "included",
"including", and the like; and that terms such as "consisting
essentially of" and "consists essentially of" have the meaning
ascribed to them in U.S. Patent law, e.g., they allow for elements
not explicitly recited, but exclude elements that are found in the
prior art or that affect a basic or novel characteristic of the
invention.
[0020] Unless otherwise explained, all technical and scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which this disclosure belongs.
The singular terms "a", "an", and "the" include plural referents
unless context clearly indicates otherwise. Similarly, the word
"or" is intended to include "and" unless the context clearly
indicate otherwise.
[0021] These and other embodiments are disclosed or are obvious
from and encompassed by, the following Detailed Description.
BRIEF DESCRIPTION OF DRAWINGS
[0022] The following Detailed Description, given by way of example,
and not intended to limit the invention to specific embodiments
described, may be understood in conjunction with the accompanying
Figures, incorporated herein by reference, in which:
[0023] FIGS. 1A-1B illustrate the cloning scheme for producing
pORF7 (SEQ ID NO:10) and pORF7t (SEQ ID NO:11); included is a map
of pBAD-ORF7 (SEQ ID NO:13) and pMASIA (SEQ ID NO:9);
[0024] FIG. 2 presents amino acid sequence alignments of
nucleocapsid proteins 1) US pMA C2 (SEQ ID NO:15), pBAD (SEQ ID
NO:16), 01NP1.2 (SEQ ID NO:17); and 2) 01NP1 (SEQ ID NO:18) and
ORF7t (SEQ ID NO:4);
[0025] FIG. 3 is an agarose gel image showing presence or absence
of PRRSV-nucleocapsid gene (ORF7) PCR amplification products for
the of the PRRSV-nucleocapsid gene (ORF7) in porcine PBMC
transfected with either pORF7, pORF7t, or pMASIA plasmids;
[0026] FIG. 4 presents a Western blot analysis of the recombinant
proteins produced from the expression vector containing ORF7 or
ORF7t gene fragment;
[0027] FIG. 5 is an agarose gel image depicting the NcoI
restriction analyses of pMASIA, pORF7, and pORF7t;
[0028] FIG. 6 presents the PRRSV vaccination study plan, including
timeline of events and data collection;
[0029] FIGS. 7A-7B show intradermal injection of a plasmid into
skin using a tuberculin syringe;
[0030] FIGS. 8A-8B show agarose gel images;
[0031] FIG. 9A is a graph of the numbers of PRRSV-specific
IFN.gamma.+ in the PBMC;
[0032] FIG. 9B is a graph of the numbers of IL-10+ cells in the
PBMC;
[0033] FIG. 10A is a graph of the numbers of PRRSV-specific CD4+
CD25+ in the PBMC;
[0034] FIG. 10B is a graph of the numbers of CD4+ CD25+ Foxp3+
cells (B) in the PBMC;
[0035] FIG. 11A presents an overview of the experimental plan
described in Example 3;
[0036] FIG. 11B presents clinical tests performed during the
study;
[0037] FIG. 12A is a graph of the numbers of PRRSV-specific IL-10+
cells in the PBMC;
[0038] FIG. 12B is a graph of the numbers of PRRSV-specific IL-10+
cells in the lymphocyte population;
[0039] FIG. 12C is a graph of the number of PRRSV-specific
IFN.gamma.+ cells in the PBMC;
[0040] FIG. 12D is a graph of the number of PRRSV-specific
IFN.gamma.+ cells in the lymphocyte population; the FIGS. 12A-12D
data represents mean percentage (.+-.SEM) of the cytokine producing
cells, obtained by the percentage of the cytokine producing cells
from the PRRSV-cultured cells-the percentage of cytokine producing
cells from the cells cultured with mock lysate. "a" indicates
statistical difference from other groups, at p<0.05. "b"
indicates statistical difference between the pORF7t and null
plasmid, at p<0.05. "c" indicates statistical different between
the pORF7t and PBSA, at p<0.05. "d" indicates statistical
different between the null and PBSA, at p<0.05.
[0041] FIG. 13A is a graph of the numbers of PRRSV-specific Foxp3+
cells in the PBMC of the experimental pigs;
[0042] FIG. 13B is a graph of the numbers of PRRSV-specific Foxp3+
cells in the CD4+ CD25+ lymphocyte subpopulation from the PBMC of
the experimental pigs; the FIGS. 13A-13B data represents mean
percentage (.+-.SEM) of the Foxp3+ cells, obtained by the
percentage of the Foxp3+ cells from the PRRSV-cultured cells-the
percentage of Foxp3+ cells from the cells cultured with mock
lysate. ("a" indicates statistical difference from other groups, at
p<0.05. "b" indicates statistical difference between the pORF7t
and null plasmid, at p<0.05.)
[0043] FIG. 14A is a graph of the numbers of PRRSV-specific IL-10+
cells in the PBMC;
[0044] FIG. 14B is a graph of the numbers of PRRSV-specific IL-10+
cells in the lymphocyte population (B);
[0045] FIG. 14C is a graph of the number of PRRSV-specific
IFN.gamma.+ cells in the PBMC;
[0046] FIG. 14D is a graph of the number of PRRSV-specific
IFN.gamma.+ cells in the lymphocyte population; pigs were
vaccinated with pORF7t, null plasmid, or PBSA on d35, and moved to
the finisher unit. The freshly isolated porcine PBMC samples were
cultured with 0.1 m.o.i. of US-PRRSV (strain 01NP1), or
mock-infected MARC-145 lysate for 48 hrs prior to fluorescent
staining and flow cytometric analyses. The data represents mean
percentage (.+-.SEM) of the cytokine producing cells, obtained by
the percentage of the cytokine producing cells from the
PRRSV-cultured cells-the percentage of cytokine producing cells
from the cells cultured with mock lysate. ("a" indicates
statistical difference from other groups, at p<0.05. "b"
indicates statistical difference between the pORF7t and null
plasmid, at p<0.05. "c" indicates statistical different between
the pORF7t and PBSA, at p<0.05. d indicates statistical
different between the null and PBSA, at p<0.05);
[0047] FIG. 15A is a graph of the numbers of PRRSV-specific Foxp3+
cells in the PBMC of the experimental pigs;
[0048] FIG. 15B is a graph of the numbers of PRRSV-specific Foxp3+
cells in the CD4+ CD25+ lymphocyte subpopulation from the PBMC of
the experimental pigs; the data are mean percentage (.+-.SEM) of
the Foxp3+ cells, obtained by the percentage of the Foxp3+ cells
from the PRRSV-cultured cells-the percentage of Foxp3+ cells from
the cells cultured with mock lysate. (a indicates statistical
difference from other groups, at p<0.05. b indicates statistical
difference between the pORF7t and null plasmid, at p<0.05.)
[0049] FIG. 16 is a graph of PRRSV-specific antibody responses, as
measured by IDEXX ELISA
[0050] FIG. 17 is a plot of the PRRSV viral load in the serum of
the experimental pigs at d43
[0051] FIG. 18 are images of the needle-free injectors being used
on the pigs;
[0052] FIG. 19 are graphs depicting numbers of Treg and IL-10+
cells from lymphocyte subpopulations in PBMC, isolated from pigs
immunized with ORF7t-500 .mu.g, ORF7t-200 .mu.g, or Null--500 .mu.g
via Intradermal, Pulse50, or Dermavac;
[0053] FIG. 20 are graphs depicting numbers of IFN.gamma.+ and CD8+
IFN.gamma.+ cells from lymphocyte subpopulations in PBMC, isolated
from pigs immunized with ORF7t-500 .mu.g, ORF7t-200 .mu.g, or
Null--500 .mu.g via Intradermal, Pulse50, or Dermavac;
[0054] FIG. 21 is a summary table of the sequence identification
listing;
[0055] FIGS. 22A-22F show Numbers of PRRSV-specific CD4+ CD25+
FoxP3+ cells (A), IL-10+ cells (B), CD4+ CD25+ cells (C) and
IFN.gamma.+ cells (D) in a lymphocyte gate, numbers of
PRRSV-specific IL-10+ (E), IFN.gamma.+(F) cells in the CD4+ CD8+
lymphocyte subpopulation from pigs raised in the PRRSV-positive
production system. Pigs were immunized with PBSA, null plasmid, or
pORF7t on d0 (V1) and d21 (V2), and then moved to the fattening
site on d35 (Move). The PBMCs were cultured with PRRSV (01NP1) or
mock lysate for 48 hr prior to flow cytometric analysis. The data
are mean.+-.SEM of the % PRRSV-activated lymphocyte subpopulations,
subtracted with background obtained from the cells cultured with
MARC-145 lysate. * indicates statistical difference between the DNA
vaccinated group and the control groups (p<0.05, one-way ANOVA
followed by Tukey multiple comparison test);
[0056] FIG. 23 is a graph showing S/P ratio among control and
pORF7t vaccinated pigs;
[0057] FIG. 24 is a graph of lung scores obtained from the
experimental pigs;
[0058] FIGS. 25A-25F are graphs indicating numbers of
PRRSV-specific CD4+ CD25+ FoxP3+ cells (A), CD4+ CD25+ FoxP3+
IL-10+ cells (B), CD4+ CD25+ cells (C) and IFN.gamma.+ cells (D) in
a lymphocyte gate, numbers of PRRSV-specific IFN.gamma.+ cells in
CD4+ CD8+ (E) CD8+ subpopulation from pigs raised in a
PRRSV-negative production system--** indicates statistical
difference between the DNA vaccinated group and the control groups
(p<0.05, one-way ANOVA followed by Tukey multiple
comparison);
[0059] FIG. 26A is a graph showing numbers of FoxP3.sup.+ cells
from challenged pigs; Pigs were vaccinated with PBSA, null plasmid,
or pORF7t on d0 (V1) and d21 (V2), and challenged (Chall.) on d35.
The data are mean.+-.SEM of the % PRRSV-activated lymphocyte
subpopulations, subtracted with background obtained from the cells
cultured with MARC-145 lysate. Mean differences were considered
significant if p<0.05, using one-way ANOVA followed by Tukey
multiple comparison test (for FIG. 22A, pORF7t and PBSA means were
significantly different).
[0060] FIG. 26B is a graph showing numbers of
CD4.sup.+CD25.sup.+FoxP3.sup.+ cells from challenged pigs (pORF7t
differed significantly from either null plasmid (pMASIA) or PBSA
immunized group);
[0061] FIG. 26C is a graph showing numbers of
CD4.sup.+CD25.sup.+FoxP3.sup.+IL-10.sup.+ cells form challenged
pigs (pORF7t and null plasmid differed significantly);
[0062] FIG. 26D is a graph showing IL-10.sup.+ cells in a
lymphocyte gate from challenged pigs;
[0063] FIG. 27A is a graph showing % CD4.sup.+CD25.sup.+ cells in a
lymphocyte gate; Pigs were vaccinated with PBSA, null plasmid, or
pORF7t on d0 (V1) and d21 (V2), and challenged (Chall.) on d35. The
data are mean.+-.SEM of the % PRRSV-activated lymphocyte
subpopulations, subtracted with background obtained from the cells
cultured with MARC-145 lysate;
[0064] FIG. 27B is a graph showing % IFN.gamma. producing cells in
a lymphocyte gate;
[0065] FIG. 27C is a graph showing % IFN.gamma. producing cells in
CD4.sup.+ CD8.sup.+ population;
[0066] FIG. 27D is a graph showing % IFN.gamma. producing cells in
CD8.sup.+ population;
[0067] FIG. 28A is a graph showing % FoxP3.sup.+ cells following
vaccination;
[0068] FIG. 28B is a graph showing % FoxP3.sup.+ cells following
vaccination;
[0069] FIG. 28C is a graph showing % CD4.sup.+CD25.sup.+ cells
following vaccination;
[0070] FIG. 28D is a graph showing % IFN.gamma. producing
cells;
[0071] FIG. 28E is a graph showing % IFN.gamma. producing
cells;
[0072] FIG. 28F is a graph showing % IFN.gamma. producing
cells;
[0073] FIG. 29A is a graph showing the levels of viral load in the
serum samples following vaccination; pigs were vaccinated with
PBSA, null plasmid, pORF7, or pORF7t on d0 and d21, and challenged
with US-PRRSV (strain 01NP1) on d35 (0 dpi). Serum, lung, and
tracheobronchial lymph node samples were collected at the indicated
days, and subjected for determination of the quantity of PRRSV
genome by quantitative RT-PCR (as described by Egli et al., 2001.
J. Virol. Methods. 98: 63-75);
[0074] FIG. 29B is a graph of viral load in lung at 10 and 21
dpi;
[0075] FIG. 29C is a graph of viral load in lymph node at 10 and 21
dpi;
DETAILED DESCRIPTION
[0076] The present invention concerns a vaccination method against
PRRSV, comprising the step of administration essentially in the
dermis and the hypodermis of an animal of the suidae family an
efficient amount of a PRRSV DNA vaccine using a liquid jet
needle-free injector, which administration elicits a safe and
protective immune response against PRRSV. "Essentially" means that
some portion of the vaccine may also be found in the epidermis or
in the muscles.
[0077] A protective immune response is characterized by a
significant reduction of the antigenemia after challenge or by
significant neutralizing antibody titers. A safe immune response is
characterized by the limitation of the side effects linked to the
vaccine administration, notably by a significant reduction or by
the absence of local injection site reaction and by a significant
reduction or by the absence of symptoms, like anorexia and
depression following vaccine administration.
[0078] As used herein, the term "pig" refers to an animal of
porcine origin, in other words, an animal of the suidae family. The
term "boar" refers to an entire male pig over six months of age
destined as a sire. The term "gilt" refers to a young female pig
who has not produced first litter up to first farrowing. The term
"hog" refers to a castrated male pig. The term "piglet" refers to a
young pig. The term "porker" refers to a breed of pig breed for
good pork meat cuts. The term "stores" refers to a pig which may be
about 10-12 weeks old. The term "sow" refers to a female of
reproductive age and capability or a female pig after she has had
her first litter. The term "weaned piglet" or "weaner" refers to a
young pig which may be about 11 to about 24 days of age, about two
to three weeks of age, about three to five weeks of age or about
five to eight weeks old weeks of age.
[0079] As used herein, the term "virulent" means an isolate that
retains its ability to be infectious in an animal host.
[0080] As used herein, the term "inactivated vaccine" means a
vaccine composition containing an infectious organism or pathogen
that is no longer capable of replication or growth. The pathogen
may be bacterial, viral, protozoal or fungal in origin.
Inactivation may be accomplished by a variety of methods including
freeze-thawing, chemical treatment (for example, treatment with
thimerosal or formalin), sonication, radiation, heat or any other
convention means sufficient to prevent replication or growth of the
organism while maintaining its immunogenicity.
[0081] As used herein, the term "immune response" refers to a
response elicited in an animal. An immune response may refer to
cellular immunity (CMI); humoral immunity or may involve both. The
present invention also contemplates a response limited to a part of
the immune system. For example, a vaccine composition of the
present invention may specifically induce an increased gamma
interferon response.
[0082] As used herein, the term "antigen" or "immunogen" means a
substance that induces a specific immune response in a host animal.
The antigen may comprise a whole organism, killed, attenuated or
live; a subunit or portion of an organism; a recombinant vector
containing a polynucleotide encoding an immunogen, capable of
inducing an immune response upon presentation to a host animal; a
protein, a polypeptide, a peptide, an epitope, a hapten, or any
combination thereof.
[0083] As used herein, the term "multivalent" means a vaccine
containing more than one antigen from different genera or species
of microorganisms (for example, a vaccine comprising antigens from
Pasteurella multocida, Salmonella, Escherichia coli, Haemophilus
somnus and Clostridium).
[0084] As used herein, the term "adjuvant" means a substance added
to a vaccine to increase a vaccine's immunogenicity. The mechanism
of how an adjuvant operates is not entirely known. Some adjuvants
are believed to enhance the immune response by slowly releasing the
antigen, while other adjuvants present the immunogen to the host
immune system more efficiently or effectively or stimulate the
production of specific cytokines.
[0085] As used herein, the terms "pharmaceutically acceptable
carrier" and "pharmaceutically acceptable vehicle" are
interchangeable and refer to a fluid vehicle for containing vaccine
antigens that can be injected into a host without adverse effects.
Suitable pharmaceutically acceptable carriers known in the art
include, but are not limited to, sterile water, saline, glucose,
dextrose, or buffered solutions. Carriers may include auxiliary
agents including, but not limited to, diluents, stabilizers (i.e.,
sugars and amino acids), preservatives, wetting agents, emulsifying
agents, pH buffering agents, viscosity enhancing additives, colors
and the like.
[0086] As used herein, the term "vaccine composition" includes at
least one antigen or immunogen in a pharmaceutically acceptable
vehicle useful for inducing an immune response in a host. Vaccine
compositions can be administered in dosages and by techniques well
known to those skilled in the medical or veterinary arts, taking
into consideration such factors as the age, sex, weight, species
and condition of the recipient animal, and the route of
administration. The route of administration can be percutaneous
e.g. intradermal, intramuscular, subcutaneous. Vaccine compositions
can be administered alone, or can be co-administered or
sequentially administered with other treatments or therapies. The
compositions can contain auxiliary substances such as wetting or
emulsifying agents, pH buffering agents, adjuvants, or viscosity
enhancing additives, preservatives, colors, and the like, depending
upon the route of administration and the preparation desired.
Standard pharmaceutical texts, such as "Remington's Pharmaceutical
Sciences," 1990 may be consulted to prepare suitable preparations,
without undue experimentation.
[0087] The invention further encompasses at least one PRRSV
immunogen contained in a vector molecule or an expression vector
and operably linked to a promoter element and optionally to an
enhancer. In an embodiment the vector is pMASIA.
[0088] In an embodiment, the promoter is the promoter of the
cytomegalovirus (CMV) immediate early gene. In another advantageous
embodiment, the promoter and/or enhancer elements are
oxygen-inducible. Examples of oxygen-inducible promoters and/or
enhancers that can be used in the methods of the present invention
include, but are not limited to, early growth response-1 (Egr1)
promoter (see, e.g., Park et al., J Clin Invest. 2002 August;
110(3):403-1), hypoxia-inducible factor (HIF) inducible enhancers
(see e.g., Cuevas et al., Cancer Res. 2003 October 15;
63(20):6877-84) and Mn-superoxide dismutase (Mn-SOD) promoters
(see, e.g., Gao et al., Gene. 1996 October 17;
176(1-2):269-70).
[0089] In another embodiment, the enhancers and/or promoters
include various cell or tissue specific promoters (e.g., muscle,
endothelial cell, liver, somatic cell or stem cell), various viral
promoters and enhancers and various PRRSV immunogen sequences
isogenically specific for each animal species. Examples of
muscle-specific promoters and enhancers have been described are
known to one of skill in the art (see, e.g., Li et al., Gene Ther.
1999 December; 6(12):2005-11; Li et al., Nat Biotechnol. 1999
March; 17(3):241-5 and Loirat et al., Virology. 1999 July 20;
260(1):74-83; the disclosures of which are incorporated by
reference in their entireties).
[0090] Promoters and enhancers that may be employed in the present
invention include, but are not limited to LTR or the Rous sarcoma
virus, TK of HSV-1, early or late promoter of SV40, adenovirus
major late (MLP), phosphoglycerate kinase, metallothionein,
.alpha.-1 antitrypsin, albumin, collagenase, elastase I,
.beta.-actin, .beta.-globin, .gamma.-globin, .alpha.-fetoprotein,
muscle creatine kinase.
[0091] A "vector" refers to a recombinant DNA or RNA plasmid or
virus that comprises a heterologous polynucleotide to be delivered
to a target cell, either in vitro or in vivo. The heterologous
polynucleotide may comprise a sequence of interest for purposes of
therapy, and may optionally be in the form of an expression
cassette. As used herein, a vector need not be capable of
replication in the ultimate target cell or subject. The term
includes cloning vectors also included are viral vectors.
[0092] The term "recombinant" means a polynucleotide of
semisynthetic or synthetic origin which either does not occur in
nature or is linked to another polynucleotide in an arrangement not
found in nature.
[0093] "Heterologous" means derived from a genetically distinct
entity from the rest of the entity to which it is being compared.
For example, a polynucleotide may be placed by genetic engineering
techniques into a plasmid or vector derived from a different
source, and is a heterologous polynucleotide. A promoter removed
from its native coding sequence and operatively linked to a coding
sequence other than the native sequence is a heterologous
promoter.
[0094] The polynucleotides of the invention may comprise additional
sequences, such as additional encoding sequences within the same
transcription unit, controlling elements such as promoters,
ribosome binding sites, polyadenylation sites, additional
transcription units under control of the same or a different
promoter, sequences that permit cloning, expression, homologous
recombination, and transformation of a host cell, and any such
construct as may be desirable to provide embodiments of this
invention.
[0095] The present invention encompasses a vector expressing a
PRRSV immunogen or variants or analogues or fragments. Elements for
the expression of a PRRSV immunogen are advantageously present in
an inventive vector. In minimum manner, this comprises, consists
essentially of, or consists of an initiation codon (ATG), a stop
codon and a promoter, and optionally also a polyadenylation
sequence for certain vectors such as plasmid and certain viral
vectors, e.g., viral vectors other than poxviruses. When the
polynucleotide encodes a polyprotein fragment, e.g. a PRRSV
immunogen, advantageously, in the vector, an ATG is placed at 5' of
the reading frame and a stop codon is placed at 3'. Other elements
for controlling expression may be present, such as enhancer
sequences, stabilizing sequences, such as intron and signal
sequences permitting the secretion of the protein.
[0096] Methods for making and/or administering a vector or
recombinants or plasmid for expression of gene products of genes
either in vivo or in vitro can be any desired method, e.g., a
method which is by or analogous to the methods disclosed in, or
disclosed in documents cited in: U.S. Pat. Nos. 4,603,112;
4,769,330; 4,394,448; 4,722,848; 4,745,051; 4,769,331; 4,945,050;
5,494,807; 5,514,375; 5,744,140; 5,744,141; 5,756,103; 5,762,938;
5,766,599; 5,990,091; 5,174,993; 5,505,941; 5,338,683; 5,494,807;
5,591,639; 5,589,466; 5,677,178; 5,591,439; 5,552,143; 5,580,859;
6,130,066; 6,004,777; 6,130,066; 6,497,883; 6,464,984; 6,451,770;
6,391,314; 6,387,376; 6,376,473; 6,368,603; 6,348,196; 6,306,400;
6,228,846; 6,221,362; 6,217,883; 6,207,166; 6,207,165; 6,159,477;
6,153,199; 6,090,393; 6,074,649; 6,045,803; 6,033,670; 6,485,729;
6,103,526; 6,224,882; 6,312,682; 6,348,450 and 6; 312,683; U.S.
patent application Ser. No. 920,197, filed Oct. 16, 1986; WO
90/01543; WO91/11525; WO 94/16716; WO 96/39491; WO 98/33510; EP
265785; EP 0 370 573; Andreansky et al., Proc. Natl. Acad. Sci. USA
1996; 93:11313-11318; Ballay et al., EMBO J. 1993; 4:3861-65;
Felgner et al., J. Biol. Chem. 1994; 269:2550-2561; Frolov et al.,
Proc. Natl. Acad. Sci. USA 1996; 93:11371-11377; Graham, Tibtech
1990; 8:85-87; Grunhaus et al., Sem. Virol. 1992; 3:237-52; Ju et
al., Diabetologia 1998; 41:736-739; Kitson et al., J. Virol. 1991;
65:3068-3075; McClements et al., Proc. Natl. Acad. Sci. USA 1996;
93:11414-11420; Moss, Proc. Natl. Acad. Sci. USA 1996;
93:11341-11348; Paoletti, Proc. Natl. Acad. Sci. USA 1996;
93:11349-11353; Pennock et al., Mol. Cell. Biol. 1984; 4:399-406;
Richardson (Ed), Methods in Molecular Biology 1995; 39,
"Baculovirus Expression Protocols," Humana Press Inc.; Smith et al.
(1983) Mol. Cell. Biol. 1983; 3:2156-2165; Robertson et al., Proc.
Natl. Acad. Sci. USA 1996; 93:11334-11340; Robinson et al., Sem.
Immunol. 1997; 9:271; and Roizman, Proc. Natl. Acad. Sci. USA 1996;
93:11307-11312. Thus, the vector in the invention can be any
suitable recombinant virus or virus vector, such as a poxvirus
(e.g., vaccinia virus, avipox virus, canarypox virus, fowlpox
virus, raccoonpox virus, swinepox virus, etc.), adenovirus (e.g.,
human adenovirus, canine adenovirus), herpesvirus (e.g. canine
herpesvirus), baculovirus, retrovirus, etc. (as in documents
incorporated herein by reference); or the vector can be a plasmid.
The herein cited and incorporated herein by reference documents, in
addition to providing examples of vectors useful in the practice of
the invention, can also provide sources for non-PRRSV immunogens,
e.g., non-PRRSV immunogens, non-PRRSV immunogens peptides or
fragments thereof, cytokines, etc. to be expressed by vector or
vectors in, or included in, the compositions of the invention.
[0097] The present invention also relates to preparations
comprising vectors, such as expression vectors, e.g., therapeutic
compositions. The preparations can comprise, consist essentially
of, or consist of one or more vectors, e.g., expression vectors,
such as in vivo expression vectors, comprising, consisting
essentially or consisting of (and advantageously expressing) one or
more of PRRSV immunogens. Advantageously, the vector contains and
expresses a polynucleotide that includes, consists essentially of,
or consists of a coding region encoding one or more PRRSV
immunogens a pharmaceutically or veterinarily acceptable carrier,
excipient or vehicle. Thus, according to an embodiment of the
invention, the other vector or vectors in the preparation
comprises, consists essentially of or consists of a polynucleotide
that encodes, and under appropriate circumstances the vector
expresses one or more other proteins of a PRRSV immunogen or a
fragment thereof.
[0098] According to another embodiment, the vector or vectors in
the preparation comprise, or consist essentially of, or consist of
polynucleotide(s) encoding one or more proteins or fragment(s)
thereof of a PRRSV immunogen, the vector or vectors have expression
of the polynucleotide(s). The inventive preparation advantageously
comprises, consists essentially of, or consists of, at least two
vectors comprising, consisting essentially of, or consisting of,
and advantageously also expressing, advantageously in vivo under
appropriate conditions or suitable conditions or in a suitable host
cell, polynucleotides from different PRRSV isolates encoding the
same proteins and/or for different proteins, but advantageously for
the same proteins. Preparations containing one or more vectors
containing, consisting essentially of or consisting of
polynucleotides encoding, and advantageously expressing,
advantageously in vivo, PRRSV peptide, fusion protein or an epitope
thereof.
[0099] According to one embodiment of the invention, the expression
vector is a DNA vector, in particular an in vivo expression
vector.
[0100] In one particular embodiment the viral vector is a poxvirus,
e.g. a vaccinia virus or an attenuated vaccinia virus, (for
instance, MVA, a modified Ankara strain obtained after more than
570 passages of the Ankara vaccine strain on chicken embryo
fibroblasts; see Stickl & Hochstein-Mintzel, Munch. Med.
Wschr., 1971, 113, 1149-1153; Sutter et al., Proc. Natl. Acad. Sci.
U.S.A., 1992, 89, 10847-10851; available as ATCC VR-1508; or NYVAC,
see U.S. Pat. No. 5,494,807, for instance, Examples 1 to 6 and et
seq of U.S. Pat. No. 5,494,807 which discuss the construction of
NYVAC, as well as variations of NYVAC with additional ORFs deleted
from the Copenhagen strain vaccinia virus genome, as well as the
insertion of heterologous coding nucleic acid molecules into sites
of this recombinant, and also, the use of matched promoters; see
also WO96/40241), an avipox virus or an attenuated avipox virus
(e.g., canarypox, fowlpox, dovepox, pigeonpox, quailpox, ALVAC or
TROVAC; see, e.g., U.S. Pat. Nos. 5,505,941, 5,494,807), swinepox,
raccoonpox, camelpox, or myxomatosis virus.
[0101] According to another embodiment of the invention, the
poxvirus vector is a canarypox virus or a fowlpox virus vector,
advantageously an attenuated canarypox virus or fowlpox virus. In
this regard, is made to the canarypox available from the ATCC under
access number VR-111. Attenuated canarypox viruses are described in
U.S. Pat. No. 5,756,103 (ALVAC) and WO01/05934. Numerous fowlpox
virus vaccination strains are also available, e.g. the DIFTOSEC CT
strain marketed by MERIAL and the NOBILIS VARIOLE vaccine marketed
by INTERVET; and, reference is also made to U.S. Pat. No. 5,766,599
which pertains to the attenuated fowlpox strain TROVAC.
[0102] For information on the method to generate recombinants
thereof and how to administer recombinants thereof, the skilled
artisan can refer documents cited herein and to WO90/12882, e.g.,
as to vaccinia virus mention is made of U.S. Pat. Nos. 4,769,330,
4,722,848, 4,603,112, 5,110,587, 5,494,807, and 5,762,938 inter
alia; as to fowlpox, mention is made of U.S. Pat. Nos. 5,174,993,
5,505,941 and U.S. Pat. No. 5,766,599 inter alia; as to canarypox
mention is made of U.S. Pat. No. 5,756,103 inter alia; as to
swinepox mention is made of U.S. Pat. No. 5,382,425 inter alia;
and, as to raccoonpox, mention is made of WO00/03030 inter
alia.
[0103] When the expression vector is a vaccinia virus, insertion
site or sites for the polynucleotide or polynucleotides to be
expressed are advantageously at the thymidine kinase (TK) gene or
insertion site, the hemagglutinin (HA) gene or insertion site, the
region encoding the inclusion body of the A type (ATI); see also
documents cited herein, especially those pertaining to vaccinia
virus. In the case of canarypox, advantageously the insertion site
or sites are ORF(s) C3, C5 and/or C6; see also documents cited
herein, especially those pertaining to canarypox virus. In the case
of fowlpox, advantageously the insertion site or sites are ORFs F7
and/or F8; see also documents cited herein, especially those
pertaining to fowlpox virus. The insertion site or sites for MVA
virus area advantageously as in various publications, including
Carroll M. W. et al., Vaccine, 1997, 15 (4), 387-394; Stittelaar K.
J. et al., J. Virol., 2000, 74 (9), 4236-4243; Sutter G. et al.,
1994, Vaccine, 12 (11), 1032-1040; and, in this regard it is also
noted that the complete MVA genome is described in Antoine G.,
Virology, 1998, 244, 365-396, which enables the skilled artisan to
use other insertion sites or other promoters.
[0104] Advantageously, the polynucleotide to be expressed is
inserted under the control of a specific poxvirus promoter, e.g.,
the vaccinia promoter 7.5 kDa (Cochran et al., J. Virology, 1985,
54, 30-35), the vaccinia promoter I3L (Riviere et al., J. Virology,
1992, 66, 3424-3434), the vaccinia promoter HA (Shida, Virology,
1986, 150, 451-457), the cowpox promoter ATI (Funahashi et al., J.
Gen. Virol., 1988, 69, 35-47), the vaccinia promoter H6 (Taylor J.
et al., Vaccine, 1988, 6, 504-508; Guo P. et al. J. Virol., 1989,
63, 4189-4198; Perkus M. et al., J. Virol., 1989, 63, 3829-3836),
inter alia.
[0105] In an embodiment the viral vector is an adenovirus, such as
a human adenovirus (HAV) or a canine adenovirus (CAV).
[0106] In one embodiment the viral vector is a human adenovirus, in
particular a serotype 5 adenovirus, rendered incompetent for
replication by a deletion in the E1 region of the viral genome, in
particular from about nucleotide 459 to about nucleotide 3510 by
reference to the sequence of the hAd5 disclosed in Genbank under
the accession number M73260 and in the referenced publication J.
Chroboczek et al Virol. 1992, 186, 280-285. The deleted adenovirus
is propagated in E1-expressing 293 (F. Graham et al J. Gen. Virol.
1977, 36, 59-72) or PER cells, in particular PER.C6 (F. Falloux et
al Human Gene Therapy 1998, 9, 1909-1917). The human adenovirus can
be deleted in the E3 region, in particular from about nucleotide
28592 to about nucleotide 30470. The deletion in the E1 region can
be done in combination with a deletion in the E3 region (see, e.g.
J. Shriver et al. Nature, 2002, 415, 331-335, F. Graham et al
Methods in Molecular Biology Vol 0.7: Gene Transfer and Expression
Protocols Edited by E. Murray, The Human Press Inc, 1991, p
109-128; Y. Ilan et al Proc. Natl. Acad. Sci. 1997, 94, 2587-2592;
U.S. Pat. No. 6,133,028; U.S. Pat. No. 6,692,956; S. Tripathy et al
Proc. Natl. Acad. Sci. 1994, 91, 11557-11561; B. Tapnell Adv. Drug
Deliv. Rev. 1993, 12, 185-199; X. Danthinne et al Gene Thrapy 2000,
7, 1707-1714; K. Berkner Bio Techniques 1988, 6, 616-629; K.
Berkner et al Nucl. Acid Res. 1983, 11, 6003-6020; C. Chavier et al
J. Virol. 1996, 70, 4805-4810). The insertion sites can be the E1
and/or E3 loci (region) eventually after a partial or complete
deletion of the E1 and/or E3 regions. Advantageously, when the
expression vector is an adenovirus, the polynucleotide to be
expressed is inserted under the control of a promoter functional in
eukaryotic cells, such as a strong promoter, preferably a
cytomegalovirus immediate-early gene promoter (CMV-IE promoter), in
particular the enhancer/promoter region from about nucleotide -734
to about nucleotide +7 in M. Boshart et al Cell 1985, 41, 521-530
or the enhancer/promoter region from the pCI vector from Promega
Corp. The CMV-IE promoter is advantageously of murine or human
origin. The promoter of the elongation factor 1.alpha. can also be
used. In one particular embodiment a promoter regulated by hypoxia,
e.g. the promoter HRE described in K. Boast et al Human Gene
Therapy 1999, 13, 2197-2208), can be used. A muscle specific
promoter can also be used (X. Li et al Nat. Biotechnol. 1999, 17,
241-245). Strong promoters are also discussed herein in relation to
plasmid vectors. In one embodiment, a splicing sequence can be
located downstream of the enhancer/promoter region. For example,
the intron 1 isolated from the CMV-IE gene (R. Stenberg et al J.
Virol. 1984, 49, 190), the intron isolated from the rabbit or human
.beta.-globin gene, in particular the intron 2 from the b-globin
gene, the intron isolated from the immunoglobulin gene, a splicing
sequence from the SV40 early gene or the chimeric intron sequence
isolated from the pCI vector from Promega Corp. comprising the
human .beta.-globin donor sequence fused to the mouse
immunoglobulin acceptor sequence (from about nucleotide 890 to
about nucleotide 1022 in Genbank under the accession number
CVU47120). A poly(A) sequence and terminator sequence can be
inserted downstream the polynucleotide to be expressed, e.g. a
bovine growth hormone gene, in particular from about nucleotide
2339 to about nucleotide 2550 in Genbank under the accession number
BOVGHRH, a rabbit .beta.-globin gene or a SV40 late gene
polyadenylation signal.
[0107] In another embodiment the viral vector is a canine
adenovirus, in particular a CAV-2 (see, e.g. L. Fischer et al.
Vaccine, 2002, 20, 3485-3497; U.S. Pat. No. 5,529,780; U.S. Pat.
No. 5,688,920; PCT Application No. WO95/14102). For CAV, the
insertion sites can be in the E3 region and/or in the region
located between the E4 region and the right ITR region (see U.S.
Pat. No. 6,090,393; U.S. Pat. No. 6,156,567). In one embodiment the
insert is under the control of a promoter, such as a
cytomegalovirus immediate-early gene promoter (CMV-IE promoter) or
a promoter already described for a human adenovirus vector. A
poly(A) sequence and terminator sequence can be inserted downstream
the polynucleotide to be expressed, e.g. a bovine growth hormone
gene or a rabbit .beta.-globin gene polyadenylation signal.
[0108] In another particular embodiment the viral vector is a
herpesvirus such as a canine herpesvirus (CHV) or a porcine
herpesvirus (FHV). For CHV, the insertion sites may be in
particular in the thymidine kinase gene, in the ORF3, or in the
UL43 ORF (see U.S. Pat. No. 6,159,477). In one embodiment the
polynucleotide to be expressed is inserted under the control of a
promoter functional in eukaryotic cells, advantageously a CMV-IE
promoter (murine or human). In one particular embodiment a promoter
regulated by hypoxia, e.g. the promoter HRE described in K. Boast
et al Human Gene Therapy 1999, 13, 2197-2208), can be used. A
poly(A) sequence and terminator sequence can be inserted downstream
the polynucleotide to be expressed, e.g. bovine growth hormone or a
rabbit .beta.-globin gene polyadenylation signal.
[0109] According to a yet further embodiment of the invention, the
expression vector is a plasmid vector or a DNA plasmid vector, in
particular an in vivo expression vector. In a specific,
non-limiting example, the pVR1020 or 1012 plasmid (VICAL Inc.; Luke
C. et al., Journal of Infectious Diseases, 1997, 175, 91-97;
Hartikka J. et al., Human Gene Therapy, 1996, 7, 1205-1217, see,
e.g., U.S. Pat. Nos. 5,846,946 and 6,451,769) can be utilized as a
vector for the insertion of a polynucleotide sequence. The pVR1020
plasmid is derived from pVR1012 and contains the human tPA signal
sequence. In one embodiment the human tPA signal comprises from
amino acid M(1) to amino acid S(23) in Genbank under the accession
number HUMTPAl4. In another specific, non-limiting example, the
plasmid utilized as a vector for the insertion of a polynucleotide
sequence can contain the signal peptide sequence of equine IGF1
from amino acid M(24) to amino acid A(48) in Genbank under the
accession number U28070. Additional information on DNA plasmids
which may be consulted or employed in the practice are found, for
example, in U.S. Pat. Nos. 6,852,705; 6,818,628; 6,586,412;
6,576,243; 6,558,674; 6,464,984; 6,451,770; 6,376,473 and
6,221,362.
[0110] The term plasmid covers any DNA transcription unit
comprising a polynucleotide according to the invention and the
elements necessary for its in vivo expression in a cell or cells of
the desired host or target; and, in this regard, it is noted that a
supercoiled or non-supercoiled, circular plasmid, as well as a
linear form, are intended to be within the scope of the
invention.
[0111] Each plasmid comprises or contains or consists essentially
of, in addition to the polynucleotide encoding the PRRSV immunogen
or a variant, analog or fragment thereof, operably linked to a
promoter or under the control of a promoter or dependent upon a
promoter. In general, it is advantageous to employ a strong
promoter functional in eukaryotic cells. The preferred strong
promoter is the immediate early cytomegalovirus promoter (CMV-IE)
of human or murine origin, or optionally having another origin such
as the rat or guinea pig. The CMV-IE promoter can comprise the
actual promoter part, which may or may not be associated with the
enhancer part Reference can be made to EP-A-260 148, EP-A-323 597,
U.S. Pat. Nos. 5,168,062, 5,385,839, and 4,968,615, as well as to
PCT Application No WO87/03905. The CMV-IE promoter is
advantageously a human CMV-IE (Boshart M. et al., Cell., 1985, 41,
521-530) or murine CMV-IE.
[0112] In more general terms, the promoter has either a viral or a
cellular origin. A strong viral promoter other than CMV-IE that may
be usefully employed in the practice of the invention is the
early/late promoter of the SV40 virus or the LTR promoter of the
Rous sarcoma virus. A strong cellular promoter that may be usefully
employed in the practice of the invention is the promoter of a gene
of the cytoskeleton, such as e.g. the desmin promoter (Kwissa M. et
al., Vaccine, 2000, 18, 2337-2344), or the actin promoter (Miyazaki
J. et al., Gene, 1989, 79, 269-277).
[0113] Functional sub fragments of these promoters, i.e., portions
of these promoters that maintain an adequate promoting activity,
are included within the present invention, e.g. truncated CMV-IE
promoters according to PCT Application No. WO98/00166 or U.S. Pat.
No. 6,156,567 can be used in the practice of the invention. A
promoter in the practice of the invention consequently includes
derivatives and sub fragments of a full-length promoter that
maintain an adequate promoting activity and hence function as a
promoter, preferably promoting activity substantially similar to
that of the actual or full-length promoter from which the
derivative or sub fragment is derived, e.g., akin to the activity
of the truncated CMV-IE promoters of U.S. Pat. No. 6,156,567 to the
activity of full-length CMV-IE promoters. Thus, a CMV-IE promoter
in the practice of the invention can comprise or consist
essentially of or consist of the promoter portion of the
full-length promoter and/or the enhancer portion of the full-length
promoter, as well as derivatives and sub fragments.
[0114] Preferably, the plasmids comprise or consist essentially of
other expression control elements. It is particularly advantageous
to incorporate stabilizing sequence(s), e.g., intron sequence(s),
preferably the first intron of the hCMV-IE (PCT Application No
WO89/01036), the intron II of the rabbit b-globin gene (van Ooyen
et al., Science, 1979, 206, 337-344).
[0115] As to the polyadenylation signal (polyA) for the plasmids
and viral vectors other than poxviruses, use can more be made of
the poly(A) signal of the bovine growth hormone (bGH) gene (see
U.S. Pat. No. 5,122,458), or the poly(A) signal of the rabbit
b-globin gene or the poly(A) signal of the SV40 virus.
[0116] According to another embodiment of the invention, the
expression vectors are expression vectors used for the in vitro
expression of proteins in an appropriate cell system. The expressed
proteins can be harvested in or from the culture supernatant after,
or not after secretion (if there is no secretion a cell lysis
typically occurs or is performed), optionally concentrated by
concentration methods such as ultrafiltration and/or purified by
purification means, such as affinity, ion exchange or gel
filtration-type chromatography methods.
[0117] Host cells that can be used in the present invention
include, but are not limited to, muscle cells, keratinocytes,
myoblasts, Chinese Hamster ovary cells (CHO), vero cells, BHK21,
sf9 cells, and the like. It is understood to one of skill in the
art that conditions for culturing a host cell varies according to
the particular gene and that routine experimentation is necessary
at times to determine the optimal conditions for culturing an PRRSV
depending on the host cell. For example, the vector encoding an
PRRSV immunogen can be transformed into myoblasts (which can be
obtained from muscle tissue from the animal in need of treatment),
and the transformed myoblasts can be transplanted to the animal. In
another example, keratinocytes can also be transformed with a
vector encoding a PRRSV immunogen and transplanted into the animal,
resulting in secretion of a PRRSV immunogen into circulation.
[0118] A "host cell" denotes a prokaryotic or eukaryotic cell that
has been genetically altered, or is capable of being genetically
altered by administration of an exogenous polynucleotide, such as a
recombinant plasmid or vector. When referring to genetically
altered cells, the term refers both to the originally altered cell
and to the progeny thereof.
[0119] Polynucleotides comprising a desired sequence can be
inserted into a suitable cloning or expression vector, and the
vector in turn can be introduced into a suitable host cell for
replication and amplification. Polynucleotides can be introduced
into host cells by any means known in the art. The vectors
containing the polynucleotides of interest can be introduced into
the host cell by any of a number of appropriate means, including
direct uptake, endocytosis, transfection, f-mating,
electroporation, transfection employing calcium chloride, rubidium
chloride, calcium phosphate, DEAE-dextran, or other substances;
microprojectile bombardment; lipofection; and infection (where the
vector is infectious, for instance, a retroviral vector). The
choice of introducing vectors or polynucleotides will often depend
on features of the host cell.
[0120] In an advantageous embodiment, the invention provides for
the administration of a therapeutically effective amount of a
formulation for the delivery and expression of a PRRSV immunogen in
a target cell. Determination of the therapeutically effective
amount is routine experimentation for one of ordinary skill in the
art. In one embodiment, the formulation comprises an expression
vector comprising a polynucleotide that expresses a PRRSV immunogen
and a pharmaceutically or veterinarily acceptable carrier, vehicle
or excipient. In an advantageous embodiment, the pharmaceutically
or veterinarily acceptable carrier, vehicle or excipient
facilitates transfection and/or improves preservation of the vector
or protein.
[0121] The pharmaceutically or veterinarily acceptable carriers or
vehicles or excipients are well known to the one skilled in the
art. For example, a pharmaceutically or veterinarily acceptable
carrier or vehicle or excipient can be a 0.9% NaCl (e.g., saline)
solution or a phosphate buffer. Other pharmaceutically or
veterinarily acceptable carrier or vehicle or excipients that can
be used for methods of this invention include, but are not limited
to, poly-(L-glutamate) or polyvinylpyrrolidone. The
pharmaceutically or veterinarily acceptable carrier or vehicle or
excipients may be any compound or combination of compounds
facilitating the administration of the vector (or protein expressed
from an inventive vector in vitro); advantageously, the carrier,
vehicle or excipient may facilitate transfection and/or improve
preservation of the vector (or protein). Doses and dose volumes are
herein discussed in the general description and can also be
determined by the skilled artisan from this disclosure read in
conjunction with the knowledge in the art, without any undue
experimentation.
[0122] The cationic lipids containing a quaternary ammonium salt
which are advantageously but not exclusively suitable for plasmids,
are advantageously those having the following formula:
##STR00001##
in which R1 is a saturated or unsaturated straight-chain aliphatic
radical having 12 to 18 carbon atoms, R2 is another aliphatic
radical containing 2 or 3 carbon atoms and X is an amine or
hydroxyl group, e.g. the DMRIE. In another embodiment the cationic
lipid can be associated with a neutral lipid, e.g. the DOPE.
[0123] Among these cationic lipids, preference is given to DMRIE
(N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propane
ammonium; WO96/34109), advantageously associated with a neutral
lipid, advantageously DOPE (dioleoyl-phosphatidyl-ethanol amine;
Behr J. P., 1994, Bioconjugate Chemistry, 5, 382-389), to form
DMRIE-DOPE.
[0124] Advantageously, the plasmid mixture with the adjuvant is
formed extemporaneously and advantageously contemporaneously with
administration of the preparation or shortly before administration
of the preparation; for instance, shortly before or prior to
administration, the plasmid-adjuvant mixture is formed,
advantageously so as to give enough time prior to administration
for the mixture to form a complex, e.g. between about 10 and about
60 minutes prior to administration, such as approximately 30
minutes prior to administration.
[0125] When DOPE is present, the DMRIE:DOPE molar ratio is
advantageously about 95:about 5 to about 5:about 95, more
advantageously about 1:about 1, e.g., 1:1.
[0126] The DMRIE or DMRIE-DOPE adjuvant:plasmid weight ratio can be
between about 50:about 1 and about 1:about 10, such as about
10:about 1 and about 1:about 5, and advantageously about 1:about 1
and about 1:about 2, e.g., 1:1 and 1:2.
[0127] The polymers of acrylic or methacrylic acid are preferably
crosslinked, in particular with polyalkenyl ethers of sugars or
polyalcohols. These compounds are known under the term carbomer
(Pharmeuropa vol. 8, No. 2, June 1996). Persons skilled in the art
can also refer to U.S. Pat. No. 2,909,462 describing such acrylic
polymers crosslinked with a polyhydroxylated compound having at
least 3 hydroxyl groups, preferably not more than 8, the hydrogen
atoms of at least three hydroxyls being replaced with unsaturated
aliphatic radicals having at least 2 carbon atoms. The preferred
radicals are those containing 2 to 4 carbon atoms, e.g. vinyls,
allyls and other ethylenically unsaturated groups. The unsaturated
radicals may themselves contain other substituents, such as methyl.
The products sold under the name Carbopol.RTM. (BF Goodrich, Ohio,
USA) are particularly appropriate. They are crosslinked with an
allyl sucrose or with allylpentaerythritol. Among them, there may
be mentioned CARBOPOL.RTM. 974P, 934P and 971P.
[0128] Among the copolymers of maleic anhydride and of alkenyl
derivative, the EMA.RTM. copolymers (Monsanto) which are copolymers
of maleic anhydride and of ethylene, which are linear or
crosslinked, for example crosslinked with divinyl ether, are
preferred. Reference may be made to J. Fields et al., Nature, 186:
778-780, Jun. 4, 1960.
[0129] The proportions of adjuvant which are useful are well known
and readily available to the one skilled in the art. By way of
example, the concentration of polymers of acrylic or methacrylic
acid or of anhydride maleic and alkenyl copolymers in the final
vaccine composition will be from 0.01% to 1.5% W/V, more
particularly from 0.05 to 1% W/V, preferably from 0.1 to 0.4%
W/V.
[0130] Optionally the vaccine used according to the method of the
invention may contain a cytokine. The cytokine may be present as a
protein or as a gene encoding this cytokine inserted into a
recombinant viral vector. The cytokines may be selected among the
porcine cytokines, e.g. porcine interleukin 18 (fIL-18) (Taylor S.
et al., DNA Seq., 2000, 10(6), 387-394), fIL-16 (Leutenegger C. M.
et al., DNA Seq., 1998, 9(1), 59-63), fIL-12 (Fehr D. et al., DNA
Seq., 1997, 8(1-2), 77-82; Imamura T. et al., J. Vet. Med. Sci.,
2000, 62(10), 1079-1087) and porcine GM-CSF (Granulocyte-Macrophage
Colony-Stimulating Factor) (GenBank AF053007).
[0131] In a specific embodiment, the pharmaceutical composition is
directly administered in vivo, and the encoded product is expressed
by the vector in the host. The methods of in vivo delivery a vector
encoding a PRRSV immunogen can be modified to deliver the PRRSV
immunogen of the present invention to a porcine. The in vivo
delivery of a vector encoding the PRRSV immunogen described herein
can be accomplished by one of ordinary skill in the art given the
teachings of the above-mentioned references.
[0132] Advantageously, the pharmaceutical and/or therapeutic
compositions and/or formulations according to the invention
comprise or consist essentially of or consist of an effective
quantity to elicit a therapeutic response of one or more expression
vectors and/or polypeptides as discussed herein; and, an effective
quantity can be determined from this disclosure, including the
documents incorporated herein, and the knowledge in the art,
without undue experimentation.
[0133] In the case of therapeutic and/or pharmaceutical
compositions based on a plasmid vector, a dose can comprise,
consist essentially of or consist of, in general terms, about in 1
mg to about 2000 mg, advantageously about 50 mg to about 1000 mg
and more advantageously from about 100 .mu.g to about 800 .mu.g of
plasmid expressing a PRRSV immunogen. When the therapeutic and/or
pharmaceutical compositions based on a plasmid vector is
administered with electroporation the dose of plasmid is generally
between about 0.1 .mu.g and 1 mg, advantageously between about 1
.mu.g and 100 .mu.g, advantageously between about 2 .mu.g and 50
.mu.g. The dose volumes can be between about 0.1 and about 2 ml,
advantageously between about 0.2 and about 1 ml. These doses and
dose volumes are suitable for the treatment of felines and other
mammalian target species such as equines and canines.
[0134] The therapeutic and/or pharmaceutical composition contains
per dose from about 10.sup.4 to about 10.sup.11, advantageously
from about 10.sup.5 to about 10.sup.10 and more advantageously from
about 10.sup.6 to about 10.sup.9 viral particles of recombinant
adenovirus expressing a PRRSV immunogen. In the case of therapeutic
and/or pharmaceutical compositions based on a poxvirus, a dose can
be between about 10.sup.2 pfu and about 10.sup.9 pfu. The
pharmaceutical composition contains per dose from about 10.sup.5 to
10.sup.9, advantageously from about 10.sup.6 to 10.sup.8 pfu of
poxvirus or herpesvirus recombinant expressing a PRRSV
immunogen.
[0135] The dose volume of compositions for target species that are
mammals, e.g., the dose volume of porcine compositions, based on
viral vectors, e.g., non-poxvirus-viral-vector-based compositions,
is generally between about 0.1 to about 2.0 ml, preferably between
about 0.1 to about 1.0 ml, and more preferably between about 0.5 ml
to about 1.0 ml.
[0136] t should be understood by one of skill in the art that the
disclosure herein is provided by way of example and the present
invention is not limited thereto. From the disclosure herein and
the knowledge in the art, the skilled artisan can determine the
number of administrations, the administration route, and the doses
to be used for each injection protocol, without any undue
experimentation.
[0137] The present invention contemplates at least one
administration to an animal of an efficient amount of the
therapeutic composition made according to the invention. The animal
may be male, female, pregnant female and newborn. This
administration may be via various routes including, but not limited
to, intramuscular (IM), intradermal (ID) or subcutaneous (SC)
injection or via intranasal or oral administration. The therapeutic
composition according to the invention can also be administered by
a needleless apparatus (as, for example with a Pigjet, Biojector or
Vitajet apparatus (Bioject, Oregon, USA)). Another approach to
administer plasmid compositions is to use electroporation (see,
e.g. S. Tollefsen et al. Vaccine, 2002, 20, 3370-3378; S. Tollefsen
et al. Scand. J. Immunol., 2003, 57, 229-238; S. Babiuk et al.,
Vaccine, 2002, 20, 3399-3408; PCT Application No. WO99/01158). In
another embodiment, the plasmid is delivered to the animal by gene
gun or gold particle bombardment. In an advantageous embodiment,
the animal is a vertebrate. In a more advantageous embodiment, the
vertebrate is a cat.
[0138] Liquid jet needle-free injectors are devices performing
injections of a certain amount of liquid under high pressure
through a minute orifice. Mechanical specifications of the injector
may be adjusted or selected in order to control the depth of
penetration into tissues. Administrations of a liquid using a
syringe or a needle-free injector end up in a different
distribution of the liquid in the tissues. Using a syringe end up
in a localized bolus or pool. Using an injector end up in a
diffused distribution in the layers of the targeted tissues, as
illustrated in WO-A-01/13975.
[0139] The depth of penetration is mainly controlled by the liquid
pressure. This liquid pressure is depending upon the mechanical
specifications of the injector, such as the strength of spring or
any other propulsion means and the diameter of the piston and the
nozzle orifice. This is readily available to the one skilled in the
art.
[0140] The depth of injection may be easily determined by the
dissection of the tissue at the injection site (corresponding
preferably to the location where the vaccine is going to be
administered, and the test is advantageously performed on an animal
of the same species and age than the population to be vaccinated)
after the administration of a colored liquid having preferably the
same viscosity than the intended vaccine. This test may be
performed directly with the intended vaccine containing further a
dye. This test allows the one skilled in the art to adjust the
mechanical specifications of an injector.
[0141] The needle-free injector may be equipped with a head
comprising one or several nozzles. The use of several nozzles
allows to increase the dispersion pattern of the vaccine over a
larger area. There can be from 1 to 10 nozzles, preferably from 1
to 6.
[0142] Several injectors are available in the commerce. The
Vitajet.TM.3 (Bioject Inc.) is particularly adapted to the method
according to the invention.
[0143] It is advantageous to use an injector equipped with means
allowing to fit to the injector directly a standard vial or
ampoule. In addition, the vaccine vial may comprise several vaccine
doses allowing several shots of vaccine and/or vaccination of
several animals using the injector and the same vial. Thus, the
injector is preferably able to perform successive injections from a
same vial.
[0144] The invention also relates to a method to stimulate the
immune response of a vertebrate. In one embodiment, the vertebrate
is a bird, cat, cow, dog, fish, goat, horse, human, mouse, monkey,
pig, rat or sheep. In a more advantageous embodiment, the
vertebrate is a cat.
[0145] In one aspect of the invention, vaccination against PRRSV
can be associated with a vaccination against another porcine
disease. The vaccine comprises the DNA vector according to the
invention and a vaccine component able to protect against other
porcine pathogens including, but not solely, Mycoplasma
hyopneumoniae and PCV2.
[0146] The volume of dose injected may be from about 0.1 ml to
about 1.0 ml, preferably about 0.1 ml to about 0.8 ml, more
preferably from about 0.2 ml to about 0.5 ml, and in a preferred
use the volume of dose injected may be 0.25 ml. By definition, the
volume of one dose means the total volume of vaccine administered
at once to one animal.
[0147] The vaccine may contain from about 10.sup.4.5 to about
10.sup.8.0 TCID.sub.50/dose (50% tissue culture infective dose per
dose of vaccine) and preferably from about 10.sup.5.5 to about
10.sup.6.5 TCID.sub.50/dose.
[0148] Optionally, the administration can be repeated, as booster
administration, at suitable intervals if necessary or desirable,
e.g. about from 2 to about 8 weeks after the first administration,
and preferably about from 3 to about 5 weeks after the first
administration. A booster administration can also be repeated every
year.
[0149] Another object of the invention is the use of an efficient
amount of a DNA vector encoding and expressing at least one PRRSV
immunogen as described above and of an acceptable vehicle or
diluent, for the preparation of a liquid DNA vector vaccine
designed to be administered essentially in the dermis and the
hypodermis of an animal of the suidae family using a liquid jet
needle-free injector as described above, and resulting in eliciting
a safe and protective immune response against PRRSV.
[0150] Another object is a vaccination kit or set, comprising such
a liquid jet needle-free injector and at least one vaccine vial
containing a PRRSV vaccine based on a DNA vector as described
above, operatively assembled to perform the administration of the
vaccine to an animal of the suidae family. The distribution of the
vaccine is essentially done in the dermis and the hypodermis.
[0151] Such vaccination kit or set is able to elicit a safe and
protective immune response against PRRSV.
[0152] The long-term efficacy and safety of a novel formulation
specifically designed to be administered transdermally using the
Derma-Vac.TM. NF Transdermal Vaccinator System is presented in
Example 4. Needle-free administration has the potential to address
both safety and quality aspects of these objectives as well as to
provide an optimized presentation of the vaccine to the immune
system (see, e.g., Charreyre C., F. Milward, R. Nordgren and G.
Royer, 2005, Demonstration of efficacy in pigs of Mycoplasma
hyopneumoniae experimental vaccines by an innovative needle-free
route, Proceedings of the American Association of Swine
Veterinarians).
ADDITIONAL REFERENCES
[0153] Albina, E. 1997. Epidemiology of porcine reproductive and
respiratory syndrome (PRRS): An overview. Veterinary Microbiology
55: 309-316. [0154] Bautista, E. M., Morrison, R. B., Goyal, S. M.,
Collins, J. E. and Annelli, J. F. 1993. Seroprevalence of PRRS
virus in the United States. Swine Health Prod. 1(6): 4-7. [0155]
Bautista, E. M., Suarez P., Molitor T. W. 1999. T cell response to
the structural polypeptides of porcine reproductive and respiratory
syndrome virus. Arch. Virol. 144:117-134. [0156] Benfield, D. A.,
Nelson, E. A., Collins, J. E., Harris, L., Goyal, S. M., Robinson,
D., Christianson, W. T., Morrison, R. B., Gorcyca, D. and Chladek,
D. 1992. Characterization of swine infertility and respiratory
syndrome (SIRS) virus (isolate ATCC VR-2332). J. Vet. Diagn.
Invest. 4: 127-133. [0157] Brierley, I. 1995. Ribosomal
frameshifting on viral RNAs. J. Gen. Virol. 76: 1885-1892. [0158]
Brun A., Vaganay, A., Tardy, M. C., Noe, T., Vandeputte, J.,
Schirvel, C. and Lacoste, F. 1992. Evaluation of etio logical
elements in the "P. R. R. S." in pigs. In Proceedings of the 12*"
Congress of the International Pig Veterinary Society, The Hague,
Netherlands, 17-20 August, p. 108. [0159] Carlson, J. 1992.
Encephalomyocarditis virus (EMCV) as a cause of reproductive and
respiratory disease in swine. American Association of Swine
Practitioners Newsletter. 4: 23. [0160] Cavanagh, D. 1997.
Nidovirales: a new order comprising Coronaviridae and
Arteriviridae. Arch Virol. 142 (3): 629-633. [0161] Cho, S. H.,
Freese, W. R., Yoon, I. J., Trigo, A. V. and Joo, H. S. 1993.
Seroprevalence of indirect fluorescent antibody to porcine
reproductive and respiratory syndrome virus in selected swine
herds. J. Vet. Diagn. Invest. 5: 259-260. [0162] Collins, J. E.,
Benfield, D. A., Christianson, W. T., Harris, L., Hennings, J. C.,
Shaw, D. P., Goyal, S. M., McCulloygh, S., Morrisson, R. B., Joo,
H. S., Gorcyca, D. and Chladek, D. W. 1992. Isolation of swine
infertility and respiratory syndrome virus (isolate ATCC VR-2332)
in North America and experimental reproduction of the disease in
gnotobiotic pigs. J. Vet. Diagn. Invest. 4: 117-126. [0163]
Conzelmann, K. K., Visser, N., van Woensel, P. and Tiel, H. J.
1993. Molecular characterization of porcine reproductive and
respiratory syndrome virus, a member of the Arterivirus group.
Virology 193: 329-339. [0164] Den Boon, J. A., Snijder, E. J.,
Chirnside, E. D., de Vries, A. A. F., Horzinek, M. C. and Spaan, W.
1991. Equine arteritis virus is not a togavirus but belongs to the
coronavirus superfamily. J. Virol. 65: 2910-2920. [0165] De Vries,
A. A. F., Horzinek, M. C, Rottier, P. J. M. and de Groot, R. J.
1997. The genome organization of the Nidovirales: Similiarities and
differences between Arteri-, Toro-, and Coronaviruses. Seminars in
Virology 8: 33-47. [0166] Dewey C E, Wilson S, Buck P, Leyenaar J
K. 1999. The reproductive performance of sows after PRRS
vaccination depends on stage of gestation. Prev Vet Med 40:233-241.
[0167] Done, S. H. and Paton, D. J. 1995. Porcine reproductive and
respiratory syndrome: clinical disease, pathology and
immunosuppression. Veterinary Record 136: 32-35. [0168] Done, S.
H., Paton, D. J. and White, M. E. C. 1996. Porcine Respiratory and
Reproductive Syndrome (PRRS): A review, with emphasis on
pathological, virological and diagnostic aspects. British
Veterinary Journal 152 (2): 153-174. [0169] Drew, T. W.,
Meulenberg, J. J. M., Sands, J. J. and Paton, D. J. 1995.
Production, characterization and reactivity of monoclonal
antibodies to porcine reproductive and respiratory syndrome virus.
J. Gen. Virol. 76: 1361-1369. [0170] Edbauer, C, R. Weinberg, J.
Taylor, A. Rey-Senelonge, J. F. Bouquet, P. Desmettre and E.
Paoletti, Virology 179, 901-904 (1990). [0171] Faaberg, K. S. and
Plagemann, P. G. W. 1995. The envelope proteins of lactate
dehydrogenase-elevating virus and their membrane topography.
Virology 212: 512-525. [0172] Faaberg, K. S., Even, C, Palmer, G.
A. and Plagemann, P. G. W. 1995. Disulfide bonds between two
envelope proteins of lactate dehydrogenase-elevating virus are
essential for viral infectivity. J. Virol. 69: 613-617. 1. Galina,
L., Pijoan, C, Sitjar, M., Christianson, W. T., Rossow, K. and
Collins, J. E. 1994. Interaction between Streptococcus suis
serotype 2 and porcine reproductive and respiratory syndrome virus
in specific pathogen-free piglets. Vet. Record. 134: 60-64. [0173]
Godeny, E. K., Chen, L., Kumar, S. N., Methven, S. L., Koonin, E.
V., and Brinton, M. A. 1993. Complete genomic sequence and
phylogenetic analysis of the lactate dehydrogenase elevating virus
(LDV). Virology 192: 585-596. [0174] Goebel, S. J., G. P. Johnson,
M. E. Perkus, S. W. Davis, J. P. Winslow, E. Paoletti, Virology
179, 247-266, 517-563 (1990). [0175] Gonin P, Mardassi H., Gagnon C
A, Massie B., Dea S. 1999. A nonstructural and antigenic
glycoprotein is encoded by ORF3 of the IAF-Klop strain of porcine
reproductive and respiratory syndrome virus. Arch. Virol.
143:1927-1940. [0176] Gonin P, Pirzadeh B, Gagnon C A, Dea S. 1999.
Seroneutralization of porcine reproductive and respiratory syndrome
virus correlates with antibody response to the GP5 major envelope
glycoprotein. J Vet Diagn Invest 11:20-26. [0177] Gorcyca, D.,
Schlesinger, K., Chladek, D. and Behan, W. 1995. RespPRRS: a new
tool for the prevention and control of PRRS in pigs. In Proceedings
of the American Association of Swine Practitioners, pp1-22 [0178]
Guo, P., S. Goebel, S. Davis, M. E. Perkus, B. Languet, P.
Desmettre, G. Allen, and E. Paoletti, J. Virol. 63, 4189-4198
(1989). [0179] Halbur, P. G., Paul, P. S., Meng, X. and Andrews, J.
J. 1992. Comparative pathology of porcine reproductive and
respiratory syndrome in SPF pigs. Iowa State University Swine
Research Reports, p137. Cooperative Extension Service, Iowa State
University, Ames, Iowa, 50011. [0180] Halbur, P. G., Paul, P. S.
and Janke, B. H. 1993. Viral contributors to the porcine
respiratory disease complex. In Proceedings of the 24.sup.th Annual
meeting of the American Association of Swine Practitioners, Kansas
City, Mo., USA, pp343-350. [0181] Halbur, P. G., Paul, P. S., Frey,
M. L., Landgraf, J., Eernisse, K., Meng, X.-J., Lum, M. A.,
Andrews, J. J. and Rathje, J. A. 1995. Comparison of the pathology
of two U.S. porcine reproductive and respiratory syndrome virus
isolates with the Lelystad virus. Vet. Pathol. 32:648-660. [0182]
Heinen E, Herbst W, Schmeer N. 1998. Isolation of a cytopathogenic
virus from a case of porcine reproductive and respiratory syndrome
(PRRS) and its characterization as parainfluenza virus type 2. Arch
Virol 143:2233-2239 [0183] Hill, H. 1990. Overview and history of
mystery swine disease (swine infertility and respiratory syndrome).
In. Proceedings of the Mystery Swine Disease Committee Meeting,
Denver, Colo., 1990. Livestock Conservation Institute, Madison,
Wis., pp 29-30. [0184] Kwang J, Zuckermann F, Ross G, Yang S,
Osorio F, Liu W, Low S. 1999. Antibody and cellular immune
responses of swine following immunisation with plasmid DNA encoding
the PRRS virus ORF's 4, 5, 6 and 7. Res Vet Sci 67:199-201. [0185]
Lager K M, Mengeling W L, Brockmeier S L. 1999. Evaluation of
protective immunity in gilts inoculated with the NADC-8 isolate of
porcine reproductive and respiratory syndrome virus (PRRSV) and
challenge-exposed with an antigenically distinct PRRSV isolate. Am
J Vet Res 60:1022-1027. [0186] Le Potier, M. F., Blanquefort, P.,
Morvan, E. and Albina, E. 1995. Results of a control program for
PRRS in the French area `Pays de Loire`. Proc. of the 2.sup.nc Int.
Symposium on PRRS, Copenhagen, Denmark, 9-10 August, p34. [0187]
Mardassi, H., Mounir, S. and Dea, S. 1995. Molecular analysis of
the ORFs 3 to 7 of porcine reproductive and respiratory syndrome
virus, Quebec reference strain. Arch. Virol. 140: 1405-1418. [0188]
Mardassi, H., Massie, B. and Dea, S. 1996. Intracellular synthesis,
processing, and transport of proteins encoded by ORFs 5 to 7 of
porcine reproductive and respiratory syndrome. Virology 221:
98-112. [0189] Meng, X.-J., Paul, P. S., Halbur, P. G. and Lunn, M.
A. 1995a. Phylogenetic analysis of the putative M (ORF6) and
N(ORF7) genes of porcine reproductive and respiratory syndrome
virus (PRRSV): implications for the existence of two genotypes of
PRRSV in the USA and Europe. Arch. Virol. 140: 745-755. 39. Meng,
X.-J., Paul, P. S., Halbur, P. G. and Morozov, I. 1995b. Sequence
comparison of open reading frames 2 to 5 of low and high virulence
United States isolates of porcine reproductive and respiratory
syndrome virus. J. Gen. Virol. 76: 3181-3188. [0190] Meng, X.-J.,
Paul, P. S., Morozov, I. And Halbur, P. G. 1996. A nested set of
six or seven subgenomic mRNAs is formed in cells infected with
different isolates of porcine reproductive and respiratory syndrome
virus. J. Gen. Virol. 77; 1265-1270. [0191] Mengeling W L, Vorwald
A C, Lager K M, Clouser D F, Wesley P J D. 1999a. Identification
and clinical assessment of suspected vaccine-related field strains
of porcine reproductive and respiratory syndrome virus. Am J Vet
Res 60:334-340. [0192] Mengeling W L, Lager K M, Vorwald A C.
1999b. Safety and efficacy of vaccination of pregnant gilts against
porcine reproductive and respiratory syndrome. Am J Vet Res
60:796-801. [0193] Mengeling W L, Lager K M, Vorwald A C. 1998.
Clinical consequences of exposing pregnant gilts to strains of
porcine reproductive and respiratory syndrome (PRRS) virus isolated
from field cases of "atypical" PRRS. Am J Vet Res 59:1540-1544.
[0194] Meulenberg, J. J. M., Hulst, M. M., de Meijer, E. J.,
Moonen, P. J. L. M., den Besten, A., de Kluyver, E. P., Wensvoort,
G. and Moormann, R J. M. 1993a. Lelystad virus, the causative agent
of porcine epidemic abortion and respiratory syndrome (PEARS), is
related to LDV and EAV. Virology 192: 62-72. [0195] Meulenberg, J.
J. M., de Meijer, E. J. and Moormann, R J. M. 1993b. Subgenomic
RNAs of Lelystad virus contain a conserved junction sequence. J.
Gen. Virol. 74: 1697-1701. [0196] Meulenberg, J. J. M., den Besten,
A. P., De Kluyver, E. P., Moormann, R. J. M., Schaaper, W. M. M.
and Wensvoort, G. 1995. Characterization of proteins encoded by
ORFs 2 to 7 of Lelystad virus. Virology 206: 155-163. [0197]
Meulenberg, J. J. M. and Petersen-Den Besten, P.-D. 1996.
Identification and characterization of a sixth structural protein
of Lelystad virus: The glycoprotein GP.sub.2 encoded by ORF 2 is
incorporated in virus particles. Virology 225: 44-51. [0198]
Murtaugh, M. P., Elam, M. and Kakach, L. T. 1995 Comparison of the
structural protein coding sequences of the VR-2332 and Lelystad
virus strains of PRRS virus. Arch. Virol. 140: 1451-1460. [0199]
Nakamine M, Kono Y, Abe S, Hoshino C, Shirai J, Ezaki T. 1998. Dual
infection with enterotoxigenic Escherichia coli and porcine
reproductive and respiratory syndrome virus observed in weaning
pigs that died suddenly. J Vet Med Sci 60:555-561. [0200] Nelsen C
J, Murtaugh M P, Faaberg K S. 1999. Porcine reproductive and
respiratory syndrome virus comparison: divergent evolution on two
continents. J Virol 73:270-280. [0201] Nelson, E. A.,
Christopher-Hennings, Drew, T., Wensvoort, G., Collins, G. and
Benfield, D. A. 1993. Differentiation of US and European isolates
of porcine reproductive and respiratory syndrome virus by
monoclonal antibodies. J. Clin. Micro. 31: 3184-3189. [0202]
Ohlinger, V., Haas, B., Saalmuller, A., Beyer, J., Teuffert, J.,
Visser, N. and Weiland, F. 1992. In vivo and in vitro studies on
the immunobiology of PRRS. Proc. of American Assoc. Swine
Practitioners--1.sup.st Int. PRRS Symp., 4(4): 24. [0203] Ohlinger
V F. 1995. The respiratory syndrome: studies on PRRSV-replication
and immune response. Int. Symp. PRRS 2:12. [0204] Panicali, D. and
E. Paoletti, Proc. Natl. Acad. Sci. USA 79, 4927-4931 (1982).
[0205] Pirzadeh B, Dea S. 1998a. Immune response in pigs vaccinated
with plasmid DNA encoding ORF5 of porcine reproductive and
respiratory syndrome virus. J Gen Virol 79:989-999. [0206] Pirzadeh
B, Gagnon C A, Dea S. 1998b. Genomic and antigenic variations of
porcine reproductive and respiratory syndrome virus major envelope
GP5 glycoprotein. Can J Vet Res 62:170-177 [0207] Paoletti, E., B.
R. Lipinskaks, C. Samsonoff, S. Mercer, and D. Panicali, Proc.
Natl. Acad. Sci. U.S.A. 81, 193-197 (1984). 58. Paton, D. J.,
Brown, I. H., Edwards, S. and Wensvoort, G. 1991. Blue ear disease
of pigs. Vet. Rec. 128: 617. [0208] Perkus, M. E., K. Limbach, and
E. Paoletti, J. Virol. 63, 3829-3836 (1989). [0209] Piccini, A., M.
E. Perkus, and E. Paoletti, In Methods in Enzymology, Vol. 153,
eds. Wu, R, and Grossman, L., (Academic Press) pp. 545-563 (1987).
[0210] Pirzadeh, B. and Dea, S. 1997. Monoclonal antibodies to the
ORF5 product of porcine reproductive and respiratory syndrome virus
define linear neutralizing determinants. J. Gen. Virol. 78:
1867-1873. [0211] Plagemann, P. G. W. 1996. Lactate
dehydrogenase-elevating virus and related viruses. In "Virology"
(B. N. Fields, D. M. Knipe and P. M. Howley, Eds.) 3.sup.rd ed.,
pp1 105-1120. Raven Press, New York. [0212] Plana-Duran J, Bastons
M, Urniza A, Vayreda M, Vila X, Mane H. 1997. Efficacy of an
inactivated vaccine for prevention of reproductive failure induced
by porcine reproductive and respiratory syndrome virus. Vet
Microbiol 55:361-370. [0213] Plana Duran, J., Climent, I.,
Sarraseca, J., Urniza, A., Cortes, E., Vela, C. and Casal, I. 1997.
Baculovirus expression of proteins of porcine reproductive and
respiratory syndrome virus strain Olot/91. Involvement of ORF3 and
ORF5 proteins in protection. Virus Genes 14: 19-29. [0214] Rossow
K. D. 1998. Porcine reproductive and respiratory syndrome (review
article). Vet Pathol. 35:1-20. [0215] Sirinarumitr T, Zhang Y,
Kluge J P, Halbur P G, Paul P S. 1998. A pneumo-virulent United
States isolate of porcine reproductive and respiratory syndrome
virus induces apoptosis in bystander cells both in vitro and in
vivo. J Gen Virol 79:2989-2995. [0216] Snijder E., van Tol H.,
Pedersen K. W., Raamsman M. J. B., and de Vries A. A. F. 1999.
Identification of a novel structural protein of arteri viruses. J.
Virol. 73, 6335-6345. [0217] Suarez, P., Diaz-Guerra, M., Prieto,
C, Esteban, M., Castro, J. M., Nieto, A. and Ortin, J. 1996. Open
reading frame 5 of porcine reproductive and respiratory syndrome
virus as a cause of virus-induced apoptosis. J. Virol. 70:
2876-2882. 69. Sur J H, Doster A R, Osorio F A. 1998. Apoptosis
induced in vivo during acute infection by porcine reproductive and
respiratory syndrome virus. Vet Pathol 35:506-514. [0218] Thacker E
L, Halbur P G, Ross R F, Thanawongnuwech R, Thacker B J. 1999.
Mycoplasma hyopneumoniae potentiation of porcine reproductive and
respiratory syndrome virus-induced pneumonia. J Clin Microbiol
37:620-627. [0219] Van Nieuwstadt, A. P., Meulenberg, J. J. M., van
Essen-Zandbergen, A., Petersen-den Besten, A., Bende, R. J.,
Moorman, R J. M. and Wensvoort, G. 1996. Proteins encoded by open
reading frames 3 and 4 of the genome of Lelystad virus
(Arteriviridae) are structural proteins of the virion. J. Virol.
70: 4767-4772.
[0220] van Woensel P A, Liefkens K, Demaret S. 1998a. Effect on
viraemia of an American and a European serotype PRRSV vaccine after
challenge with European wild-type strains of the virus. Vet Rec
142:510-512. 81. van Woensel P A, Liefkens K, Demaret S. 1998b.
European serotype PRRSV vaccine protects against European serotype
challenge whereas an American serotype vaccine does not. Adv Exp
Med Biol 440:713-718. [0221] Weiland E, Wieczorek-Krohmer M, Kohl
D, Conzelmann K K, Weiland F. 1999. Monoclonal antibodies to the
GP5 of porcine reproductive and respiratory syndrome virus are more
effective in virus neutralization than monoclonal antibodies to the
GP4. Vet Microbiol 66:171-186 [0222] Wensvoort, G. C., Terpstra, J.
M. A., Pol, E. A., ter Laak, M., Bloemraad, E. P., de Kluyver, C,
Kragten, C, van Buiten, A., den Besten, F., Wagenaar, J. M.,
Broekhuysen, P. L. J. M., Moonen, T., Zetstra, E. A., de Boer, H
J., Tibben M. F., de Jong, P., van't Veld, G. J. R., Greenland, A.,
van Gennep, M. T., Voets, J. H. M., Verheyden, J. H. M. and
Braamskamp, J. 1991. Mystery swine disease in The Netherlands: the
isolation of Lelystad virus. Vet Q. 13: 121-130. [0223] Wensvoort,
G., de Kluyver, E. P., Luijtze, E. A., den Besten, A., Harris, L.,
Collins, J. E., Christianson, J. E. and Chladek, D. 1992. Antigenic
comparison of Lelystad virus and swine infertility and respiratory
syndrome (SIRS) virus. J. Vet. Diagn. Invest. 4: 134-138. [0224]
Yeager, M. J., Prieve, T., Collins, J., Christopher-Hennings, J.,
Nelson, E. and Benfield, D. 1993. Evidence for the transmission of
porcine reproductive and respiratory syndrome (PRRS) virus in boar
semen. Swine Health Prod. 1(5): 7-9. [0225] Yoon, K.-J.,
Zimmermann, J. J., Swenson, S. L., Wills, R. W., Hill, H. T. and
Platt, K. B. 1994. Assessment of the biological significance of
antibody dependent enhancement (ADE) of porcine epidemic abortion
and respiratory syndrome (PEARS) virus infection in passively
immunized pigs. Proc. 13 Int. Pig Vet. Soc. Congress, p69. [0226]
Yoon, K.-J., Zimmerman, J. J., Swenson, S. L., McGinley, M. J.,
Eernisse, K. A., Brevik, A., Rhinehart, L. L., Frey, M. L., Hill,
H. T. and Platt, K. B. 1995. Characterization of the humoral immune
response to porcine reproductive and respiratory syndrome (PRRS)
virus infection. J. Vet. Diagn. Invest. 7: 305-312. Zimmermann, J.
J., Yoon, K.-J., Wills, R. W. and Swenson, S. L. 1997. General
Overview of PRRSV: A perspective from the United States. Veterinary
Microbiology 55: 187-196.
[0227] The invention will now be further described by way of the
following non-limiting examples.
Example 1: Construction and Characterization of the Plasmids
Encoding for Nucleocapsid Gene (ORF7)
[0228] The PRRSV ORF7 gene (SEQ ID NO:1) and the genetically
modified truncated ORF7 (ORF7t) gene (SEQ ID NO:3), with a stop
codon after amino acid 112, were PCR amplified from the vector
pBAD-ORF7 (SEQ ID NO:13) containing the nucleocapsid gene (ORF7) of
the US-genotype Thai PRRSV isolate (01NP1), using the primer sets
indicated in Table 1.
TABLE-US-00001 TABLE 1 PRRSV-ORF7 and truncated ORF7 (ORF7t) gene
cloning primers SEQ Amplicon ID Name Sequence Target length (bp) NO
ORF7 US-F 5'-AAAAAAGAATTCATGCCAAATAACAACGGCAAG-3' 1-21 384 5 ORF7
US -R 5' AAAAAAGAATTCTCATGCTGAGGGTGATGCTGTG 3' 372-351 6 ORF7 US-F
5' AAAAAAGAATTCATGCCAAATAACAACGGCAAG 3' 1-21 351 5 US-11R 5'
AAAAAAGAATTCTCACACAGTATGATGCGTAGGC 3' 336-318 7 Stop codon Note:
Italic cases indicate the EcoRI restriction sites
[0229] The ORF7 and ORF7t fragments were then cut with EcoRI and
cloned into the EcoRI cut pMASIA vector (SEQ ID NO:8). The cloned
plasmids were transformed into the competent cells, E. coli strain
JM109. The obtained constructs were referred as pORF7 (SEQ ID NO:9)
and pORF7t (SEQ ID NO:10), respectively (FIGS. 1A-1B). The
orientation of the inserted ORF genes was initially confirmed by
PCR analysis, using the primer sets indicated in Table 2. The
selected plasmids were further subjected to sequence analyses of
the ORF7 gene. All of the sequence analyses confirmed the correct
insertion of the ORF7 gene, with identical sequences to the
original ORF7 sequences from the original vector (pBAD-RF7) and the
01NP1-PRRSV (Genbank, Q056373, SEQ ID NO:13), (FIG. 2).
TABLE-US-00002 TABLE 2 The primers used for analyses of the
orientation of the inserted ORF7 genes Amplicon SEQ length ID Name
Sequence Target (bp) NO pMASIA F 5'-CAGTGTAGTCTGAGCAGTACT-3'
4100-4120 564 11 ORF7 US-F 5'-AAAAAAGAATTCATGCCAAATAACAACGGCAAG-3'
1-21 5 pMASIA F 5'-CAGTGTAGTCTGAGCAGTACT-3' 4100-4120 564 11 ORF7
US-R 5'-AAAAAAGAATTCTCATGCTGAGGGTGATGCTGTG-3' 372-351 6 pMASIA F
5'-CAGTGTAGTCTGAGCAGTACT-3' 4100-4120 531 11 US-11R
5'-AAAAAAGAATTCTCACACAGTATGATGCGTAGGC-3' 336-318 7
[0230] The expression of the ORF7 genes by the plasmid constructs,
was verified by in vitro transfection of the freshly isolated
porcine peripheral blood mononuclear cells (PBMC) with the pORF7 or
pORF7t. Briefly, the PBMC were transfected with pORF7 or pORF7t,
using Effectene Transfection reagent (Qiagen, Germany), according
to the manufacturer's protocol. The cells were further incubated
for 48 hrs, in a 5%, CO2 incubator. Following incubation, the PBMC
samples were harvested, and subjected for total RNA isolation using
the commercial RNA extraction kit (Macherey-Nagel, Germany).
Contaminated DNA was removed by addition of DNase I supplied with
the kit. The expression of the ORF7 gene in the transfected PBMC
was determined by the cDNA synthesis using random hexamers,
followed by the PCR reaction, using the previously described primer
sets (Table 1). The result confirmed the expression of the ORF7
mRNA from both pORF7 and pORF7t, as shown in FIG. 3.
[0231] In addition, when subcloned into an expression vector
(pQE31, SEQ ID NO:18), the ORF7 and ORF7t genes could correctly
produce the recombinant proteins with a correct molecular weight
(approx. 15 kDa), and could be detected using porcine anti-PRRSV
hyperimmune serum (FIG. 4). The recombinant proteins were subjected
to 15% SDS-PAGE, and transferred to the PVDF membrane. The presence
of PRRSV protein was determined using porcine anti-PRRSV
hyperimmune serum. (U; unpurified protein, P; purified protein, +;
with IPTG, -; without IPTG; M; Molecular weight marker).
[0232] For preparation of the DNA vaccine, the E. coli
transformants were propagated and subjected to plasmid
purification, using the commercial plasmid purification column
(NucleoBond endotoxinfree plasmid purification, Macherey-Nagel).
The confirmation of the purified plasmids was performed by
restriction analyses, using the restriction enzyme NcoI (FIG. 5).
The concentration of the plasmid was determined by
spectrophotometer. The OD260/OD280 ratios obtained from each
preparation ranged between 1.625-1.69.
Example 2: The Immunomodulatory Effects of the PRRSV DNA Vaccine in
the Challenged Model
[0233] Experimental design (FIG. 6). To determine the
immunomodulatory effects of the PRRSV DNA vaccine, four-week-old,
PRRSV-seronegative, crossbred pigs (4-6 pigs/group) were immunized
with 500 .mu.g of pORF7t or pORF7 diluted in 200 .mu.l Ca2+,
Mg2+-free PBS (referred as PBSA), of the plasmids twice at 4 weeks
interval (d0, d28). The plasmid was intradermally injected into the
skin of both ears (2.times.50 .mu.l/side), using a tuberculin
syringe (FIGS. 7A-7B). The control groups receiving the same amount
of PBS or null plasmid (pMASIA) were also included in the study.
Four weeks following the second vaccination (d56), the pigs were
intranasally challenged with 5 ml (2.5 ml/nostril) of the virulent
PRRSV (01NP1) at the concentration of 10.sup.5.5 TCID.sub.50/ml.
The immunological parameters and clinical signs were monitored
every 2 weeks and at 0, 5, and 10 days post infection (dpi). The
pigs were sacrificed at 10 dpi and subjected to pathological
examination and virological studies.
[0234] Virological and Pathological Studies.
[0235] There were no clinical signs, nor adverse reactions observed
following DNA immunization process. Following the challenge, the
presence of PRRSV in the pooled samples was initially determined by
RT-PCR using the ORF1-specific primer set. PRRSV was detected in
the samples of the groups immunized with pORF7, Null plasmid and
PBSA, at 5 dpi (serum), and 10 dpi (lung tissues). However, PRRSV
was not detected in the group immunized with pORF7t at any time of
this study (FIGS. 8A-8B). In addition, the presence of PRRSV in the
lung tissues of individual pigs was assessed by RT-PCR. The
presence of PRRSV genome was determined by RT-PCR using the
ORF1-specific primer sets, which would give the 107 bp PCR product
in the positive sample (Gilbert et al., J Clin Microbiol. 1997.
35:264-7). +ve; positive control (PRRSV-US genotype), -ve; negative
control (ddH20), L; 100 bp ladder. Consistent to the results from
pooled samples, PRRSV could be detected in all groups except the
group immunized with pORF7t (Table 3).
TABLE-US-00003 TABLE 3 Vaccination groups and results indicating
the presence of PRRSV in the lung tissue samples of the pigs at 10
dpi Sample % positive Group ID Results samples pORF7t H4811 - 0
H4831 - H4841 - H4853 - H4849 - H4809 - pORF7 H4843 + 33 H4875 +
H4871 - H4827 - H4823 - H4813 - Null H4867 - 50 plasmid H4923 +
H4893 - H4859 + H4897 + H4861 - PBSA H4863 + 50 H4865 - H4895 -
H4869 +
TABLE-US-00004 TABLE 4 Percentage of pigs in each group presenting
pathological changes in the respiratory tract at 10 dpi.
Experimental group Pathological lesions PBSA.sup.a Null.sup.b
pORF7.sup.b pORF7tl.sup.b Pneumonia 75.0 33.2 33.2 50.0
Lymphadenopathy 50.0 16.6 0 16.6 (Tracheobronchial Ln.) Fibrinous
pleuritis 0 16.6 16.6 0 .sup.an = 4; .sup.bn = 6
However, there were no significant differences in the number of
experimental pigs with pathological changes in the respiratory
tract at 10 dpi (Table 4). The data suggested that immunization
with pORF7t could enhance viral clearance in the experimentally
challenged pigs.
[0236] Study of Humoral Immune Responses.
[0237] The PRRSV-specific antibody response was determined by the
commercial ELISA test kit (HerdChek PRRS, IDEXX, Germany). It
should be pointed out that nucleocapsid protein is the major
epitope recognized by the anti-PRRSV antibody determined by IDEXX
HerdChek ELISA assay (Plagemann, 2006. J Virol Methods. 134:
99-118). The pigs were PRRSV-seronegative at the beginning of the
experiment. The seroconversion was only observed in the group that
received pORF7 on the challenge day (1 pig), and at 10 dpi (3
pigs), suggesting the priming of anti-PRRSV antibody response by
pORF7 immunization. However, no seroconversion was observed in the
pigs immunized with pORF7t or the controls throughout the
experiment (Table 5).
TABLE-US-00005 TABLE 5 Anti-PRRSV antibody responses in the
experimental pigs during the experiment Mean S/P ratio (%
seroconversion.sup.a) Group d0 d56 (0 dpi) d61 (5 dpi) d66 (10 dpi)
ORF7t 0.08 (0) 0.02 (0) 0.02 (0) 0.03 (0) ORF7 0.07 (0) 0.15 (16.6)
0.04 (0) 0.46 (50) Null 0.11 (0) 0.04 (0) 0.01 (0) 0.02 (0) PBSA
0.06 (0) 0.03 (0) 0.02 (0) 0.01 (0) .sup.aS/P ratio .gtoreq. 0.4 =
positive
[0238] Study of the Viral-Specific Cytokine Production in the
PBMC.
[0239] There were no significant differences in the PRRSV-specific
IFN.gamma. and IL-10 producing cells among the groups prior to the
challenge. Following the challenge, increased numbers of
PRRSV-specific IFN.gamma. and IL-10 producing cells were observed
in all groups (FIGS. 9A-9B). Pigs were immunized with the vaccine
indicated in the legend twice on d0 and d28, and received PRRSV
inoculation on d56. The freshly isolated porcine PBMCs were
cultured in vitro with 0.08 m.o.i. of the virulent US-PRRSV (strain
01NP1), or mock infected MARC-145 lysate for 48 hrs prior to
harvesting for fluorescent staining and flow cytometric analyses.
The data represents mean percentage (.+-.SEM) of the
cytokine-producing cells from the pigs in the same group, which was
calculated from % cytokine producing cells obtained from the
PRRSV-cultured PBMC-% cytokine-producing cells obtained from the
mock-cultured PBMC.
[0240] Study of the Viral-Specific CD4+ CD25+ and CD4+ CD25+ Foxp3+
Cells in the PBMC.
[0241] Following the first immunization, the pigs immunized with
pORF7t exhibited significantly higher number of the PRRSV-specific
CD4+ C25+ cells (activated Th lymphocytes) than the other groups
(p<0.05, ANOVA followed by Newman Keuls test), (FIG. 10A). The
enhanced number of the CD4+ CD25+ was also observed in the pORF7t
immunized group following the challenge (d66). Interestingly, the
numbers of PRRSV-specific CD4+ CD25+ Foxp3+ cells (regulatory T
cells; Treg) in the group receiving the pORF7t and pORF7 were
significantly lower than the control groups (p<0.05, ANOVA
followed by Newman Keuls) at d28. Following the viral challenge,
all groups exhibited increased numbers of CD4+ CD25+ Foxp3+ cells
in the PBMCs (FIG. 10B). The data represents mean percentage
(.+-.SEM) of the lymphocyte subpopulation from the pigs in the same
group, which was calculated from % of the lymphocyte subpopulation
obtained from the PRRSV-cultured PBMC-% of the lymphocyte
subpopulation obtained from the mock-cultured PBMC. "a" indicates
significant difference from the other treatments. "b" indicates
significant difference between the groups receiving the DNA vaccine
(pORF7t or pORF7) and the controls (null or PBSA). Further, the
data indicated that the 2 plasmids could modulate the immune
responses against PRRSV, by reduction of the viral-specific Treg,
and that pORF7t could enhance the numbers of viral-specific
responder Th cells in the pigs following immunization and the
challenge.
[0242] Conclusion.
[0243] The data from this challenge experiment indicates that the
DNA immunization with plasmid encoding ORF7 (pORF7t or pORF7) could
significantly modulate the anti-PRRSV immunity. The pORF7t, but not
pORF7, induced higher numbers of the viral-specific responder Th
cells and viral clearance following the challenge, without the
evidence of priming of anti-PRRSV antibody response. Although pORF7
could prime the pigs for the anti-PRRSV antibody response, the
plasmid did not enhance anti-viral immunity or viral clearance in
the immunized pigs (Table 6). The result emphasized the important
role of anti-PRRSV cell-mediated immunity on the anti-PRRSV
immunity. In addition, the data from this experiment suggested the
superior immunomodulatory effects of the pORF7t compared to the
pORF7, therefore, the plasmid pORF7t was selected for the
subsequent experiment.
TABLE-US-00006 TABLE 6 Summary of the effects of plasmid
immunization on anti-PRRSV immunity CD4.sup.+CD25.sup.+ Enhanced
CD4.sup.+CD25.sup.+ FoxP3.sup.+ Sero- viral IFN-.quadrature. IL-10
lymphocytes cells conversion clearance Pre-challenge Null -- -- --
-- -- na.sup.c pORF7t -- -- .uparw..sup.a .dwnarw..sup.b -- na
pORF7 -- -- -- .dwnarw..sup.b -- na Post-Challenge Null -- -- -- --
-- -- pORF7t -- -- .uparw..sup.a -- -- yes pORF7 -- -- -- -- yes --
.sup.asignificant difference from the other treatments (p <
0.05) .sup.bsignificant difference between the groups receiving the
DNA vaccine (pORF7t or pORF7) and the controls (null or PBSA), (p
< 0.05) .sup.cnot applicable
Example 3: The Immunomodulatory Effects of pORF7t in the Pigs in
the Commercial Farm (Long-Term Study)
[0244] The objective was to study the immunomodulatory effects of
pORF7t in the PRRSV-positive, commercial farm. Specific Aims: 1. To
investigate the immunomodulatory effect of the DNA vaccine on the
anti-PRRSV immunity, when immunized prior to infection (priming
exp.); 2. To investigate the immunomodulatory effects of the DNA
vaccine on the anti-PRRSV immunity, when immunized at the time of
infection (treatment exp.); 3. To investigate the effect of DNA
immunization on the growth and performance of the immunized
pigs
[0245] Experimental Design--
[0246] The selected farm for the long-term study was a
PRRSV-positive farm with known PRRSV serological status during the
past 2 years. The farm was situated approximately 160 km from
Bangkok. It had approximately 3,000 sows, and employed a continuous
flow rearing system. Generally, the piglets were weaned at 4 weeks
old, and kept at the nursery at the same site (unit 1) until 11
weeks old and subsequently moved to the finisher (unit 2), situated
approximately 20 km from the nursery. It is during this time (i.e.
4-11 weeks) that most of the pigs become infected with PRRSV. The
pigs were kept at finisher (unit 2) until 26-28 weeks old.
[0247] Experimental Pig:
[0248] six week-old, male weanling pigs were randomly grouped into
5 groups (30 pigs/group) according to scheme presented in Table 7.
Additional details of the experiment are illustrated in FIG.
11A.
TABLE-US-00007 TABLE 7 Details of the experimental groups Expected
Vaccination No. Culled No. @ Group Age @ start @ 8 dpm slaughter 1.
Control (PBSA) 6, 11 wk 30 6 24 2. pORF7t-prime 6 wk 30 6 24 3.
Null-prime 6 wk 30 6 24 4. pRF7t-Tx 11 wk 30 30 5. Null-Tx 11 wk 30
30
[0249] The DNA priming (DNA-P): the pigs were intradermally
immunized with 500 .mu.g of pORF7t at 6 wks old (d0). The pigs
receiving the same amount of null plasmid (pMASIA), or PBSA were
included as the controls. At 8 days post moving (8 dpm, d43), the
pigs (6/group) were euthanized and subjected for pathological and
virological studies--The DNA treatment (DNA-T): The pigs were
immunized with 500 .mu.g of pORF7t at the time of moving (wk 11,
d35). The control groups included the group immunized with the null
plasmid or PBSA.--Blood samples were collected every 2 wks. The
numbers of PRRSV-specific Treg, IL-10 and IFN.gamma. producing
cells in the PBMC were determined by flow cytometry. Serum samples
were collected for determining of the anti-PRRSV antibody and the
presence of PRRSV. Clinical signs and performance indexes were
monitored until the end of a finishing period (FIG. 11B).
[0250] Immunomodulatory Effects of the DNA Vaccine when Immunized
Prior to PRRSV Exposure (Priming Experiment)
[0251] All groups had comparable levels of cytokine producing cells
at the beginning of the experiment. After moving to the finisher
(d43), all the groups exhibited significantly increased numbers of
PRRSV-specific IL-10+ cells, possibly due to the natural exposure
to PRRSV at the finisher. The levels of the numbers of IL-10+
producing cells gradually decreased after d56. Interestingly, the
groups receiving either pORF7t or the null plasmid had
significantly lower number of PRRSV-specific IL-10+ cells than the
control PBSA at d70 (p<0.05, ANOVA followed by Tukey's multiple
comparison tests). However, only the group immunized with pORF7t
exhibited gradual decreased of the PRRSV-specific IL-10+ cells
through the end of the observation period. By d112, the pigs
vaccinated with pORF7t had significantly lower number of the IL-10+
lymphocytes than the other groups (p<0.05, ANOVA followed by
Tukey's multiple comparison tests), (FIG. 12A, B). Following the
DNA vaccination (d14), the pigs receiving pORF7t exhibited
significant increase in the number of PRRSV-specific IFN.gamma.+
lymphocytes. The number of the PRRSV-specific IFN.gamma.+ cells
remained higher than other groups until d70 (FIG. 12C, D). Pigs
were vaccinated with pORF7t, null plasmid, or PBSA on d0, and moved
to the finisher unit on d35. The freshly isolated porcine PBMC
samples had been cultured with 0.1 m.o.i. of US-PRRSV (strain
01NP1), or mock-infected MARC-145 lysate for 48 hrs prior to
fluorescent staining and flow cytometric analyses. All groups had
comparable numbers of PRRSV-specific CD4+ CD25+ Foxp3+ cells (Treg)
at the beginning of the experiment. Following vaccination, the pigs
receiving pORF7t exhibited significantly lower numbers of the
PRRSV-specific Treg than the other control groups (p<0.05, ANOVA
followed by Tukey's multiple comparison tests). Following the
movement (d43), the numbers of PRRSV-specific Treg increased in
every group, possibly due to the PRRSV exposure. However, the
number of the PRRSV-specific Treg in the pORF7t vaccinated group
remained lower than the other groups throughout the experiment
(FIG. 13A, B). The result from this experiment indicated that the
DNA vaccine could modulate the anti-PRRSV immune responses in the
pigs, by enhancing the production of viral-specific IFN.gamma. and
reducing the viral-specific IL-10 and Treg production in the
vaccinated pigs following the viral exposure.
[0252] Immunomodulatory Effect of the DNA Vaccine when Immunized at
the Time of PRRSV Exposure (Treatment Experiment).
[0253] All the pigs exhibited increased PRRSV-specific IL-10+ cells
in the PBMC following the movement into the finisher unit (d43).
However, the pigs receiving pORF7t exhibited faster reduction of
the PRRSV-specific IL-10+ cells and had lower levels of
PRRSV-specific IL-10+ cells than the other control groups until the
end of the observation period (FIG. 14A, B). Immunization with
pORF7t resulted in an enhanced induction of PRRSV-specific
IFN.gamma.+ cells. Furthermore, the numbers of the PRRSV-specific
IFN.gamma. cells in the pORF7t group remained higher than the other
groups throughout the end of the experiments (FIG. 14C, D).
Furthermore, the pigs received pORF7t exhibited significantly lower
numbers of PRRSV-specific CD4+ CD25+ Foxp3+ cells than the control
groups throughout the experiment (FIGS. 15A-B). The results
suggested that pORF7t could modulate the PRRSV-specific immune
responses that should be benefit to the anti-PRRSV immunity.
[0254] The Effect of DNA Immunization on Antibody Responses
[0255] Some of the pigs contained maternal-derived PRRSV-specific
antibody in their serum at the beginning of the experiment. The
level of MDA gradually reduced until 8 wks old (d14). However,
80-100% of the pigs in every groups exhibited seroconversion at the
time of moving (d35), suggesting that the natural infection
actually occurred at the end of the nursery period. There were no
significant different in the pattern of antibody responses,
measured by ELISA, among the experimental groups (Table 8, FIG.
16).
TABLE-US-00008 TABLE 8 PRRSV-specific antibody determined by IDEXX
ELISA Mean S/P ratio.sup.a (% seropositive pigs.sup.b) Group d0 d14
d35 d43 d56 d70 d82 d112 PBSA 0.25 (33.3) 0.21 (33.3) 1.31 (100)
2.28 (100) 1.99 (80) 2.29 (100) 1.42 (100) 1.36 (100) pORF7t-P 0.17
(16.7) 0.09 (0) 1.24 (100) 1.35 (100) 1.15 (100) 1.26 (80) 1.02
(100) 1.26 (100) Null-P 0.30 (33.3) 0.24 (0) 1.22 (100) 0.93 (100)
2.16 (100) 1.36 (100) 1.01 (80) 1.00 (60) pORF7t-T nd nd 1.19 (80)
1.29 (100) 1.16 (100) 1.09 (100) 1.65 (100) 1.29 (100) Null-T nd nd
0.96 (80) 1.07 (80) 0.98 (80) 1.72 (80) 0.83 (100) 1.21 (100)
.sup.amean OD values from 5 pigs/group .sup.bS/P ratio .gtoreq.0.4
= seropositive
[0256] The virological studies. The virological studies by RT-PCR
and quantitative RT-PCR confirmed presence of the US genotype PRRSV
in the lung samples of the experimental pigs that were sacrificed
at 8 dpm (d43), Table 9. However, there were no different in the
number of viral load in the serum at d43 (FIG. 17). The
pathological studies of the respiratory tracts at d43 revealed
viral infection with secondary complication in the lungs of the
pigs.
TABLE-US-00009 TABLE 9 The number of experimental pigs with
positive PRRSV in the lung at d43 Treatment Positive animal/total
examined (%.sup.a) 1) Control (PBSA) 3/6 (50) 2) pORF7t-prime 3/6
(50) 3) Null plasmid 5/6 (83.33) .sup.a% positive samples from 6
pigs/group
Example 4: The Immunomodulatory Effects of PRRSV DNA Vaccine
Delivered Using Transdermal Technology
[0257] Inventors have observed the unexpected and surprising result
that significantly improved efficacy was achieved when the
inventive plasmids were delivered using transdermal technologies,
specifically the DERMAVAC.RTM. device. In the above examples, the
novel PRRSV-DNA vaccine was developed and tested for its
immunoprophylaxis and immunotherapeutic properties against PRRSV.
The results indicated that the prototype DNA vaccine, when
intradermally immunized into the experimental pigs, was capable of
modulating anti-PRRSV immune responses and enhanced viral clearance
in the vaccinated-challenged pigs. Since intradermal injection
technique was not routinely practiced in pig farms, the inventors
explored the potential use of a needle-free device for delivering
of the inventive DNA vaccine into pigs. It is contemplated by the
inventors that inventive vaccines should additionally demonstrate
efficacy in, for example, but not solely, fattening pigs and
replacement gilts.
[0258] Materials and Methods.
[0259] Plasmid Immunization.
[0260] The PRRSV-DNA vaccine (pORF7t) containing the genetically
modified ORF7 gene, encoding for the linearized N protein, derived
from the US-genotype, Thai PRRSV isolate (01 NP1), and null plasmid
(pMASIA) were used for DNA immunization. The needleless injectors;
Pulse50 (Pulse Needle-Free System, USA), and Dermavac (Merial,
France) were tested and optimized for intradermal inoculation prior
to the animal experiment (FIG. 18). Animal Experiment
Four-week-old, crossbred pigs (8 pigs/group) were immunized with
200 .mu.g or 500 .mu.g of the indicated plasmid at day 0 (DO) using
conventional intradermal injection, Dermavac or Pulse50 needleless
injector. The immunological parameters were monitored every 2
weeks, at day 0, 14, 28, 42 and 56 post immunization. The pigs were
kept at the commercial farm throughout the experiment. In vitro
activation with PRRSV Freshly isolated porcine peripheral blood
mononuclear cells (PBMCs) were cultured in vitro in the presence of
the Thai isolated, US genotype, PRRSV (01 NP1 strain) or the
control, MARC-145 infected cell lysate for 48 hours prior to
harvesting and fluorescent labelings. The numbers of PRRSV-specific
Treg, IL-10, and IFN.gamma. producing cells in different lymphocyte
subpopulation were determined by flow cytometry.
[0261] Results.
[0262] Both needleless injectors provided effective DNA
immunization in 4-week-old pigs. Following a single plasmid
immunization (d0), the pig immunized with Dermavac exhibited
significantly better patterns of controlled PRRSV-specific
immunoinhibitory parameters (Treg and IL-10), and enhanced
PRRSV-specific immunostimulatory parameters (IFN.gamma.
production), (FIG. 19). Interestingly, immunization with both
injectors, at the dose of 500 .mu.g, could enhance numbers of
PRRSV-specific CDS+IFN-.gamma.+ cells, compared to the conventional
intradermal injection (FIG. 20).
Example 5: PRRSV-DNA Vaccine Challenge Study (PRRSV-Positive
Farm)
[0263] Objective.
[0264] This study was designed to evaluate the efficacy of the
prototype DNA vaccine in the fattening pigs raised in
PRRSV-positive farm
[0265] Methods.
[0266] Four weeks old pigs from a commercial PRRSV-positive farm
were randomly grouped (30 pigs/gr) and immunized twice, at 4 (d0)
and 7 (d21) weeks old with DERMAVAC system. Pigs were moved to
PRRSV-positive fattening site at 9 weeks old (d35). Group 1 was
given PBSA (500 .mu.l/dose); Group 2 received Null plasmid (pMASIA)
at 500 .mu.g/500 .mu.l/dose); and Group 3 received the DNA vaccine
(pORF7t) at 500 .mu.g/500 Heparinized blood samples were collected
(6 pigs/gr) for isolation of the PBMC and analysis of
PRRSV-specific IL-10 and IFN.gamma. producing cells and the numbers
of PRRSV-specific CD4+ CD25+ Foxp3+ lymphocytes (Treg) on d0, 21,
35, 49, 84, 112, and 147. Serum samples were collected for
determination of PRRSV-specific antibody (IDEXX ELISA) at the same
time of whole blood collection. Monitoring of clinical signs and
assessing lung score were performed at the slaughter house.
[0267] Results.
[0268] No vaccine adverse reaction was observed following DNA
immunization. The pigs receiving DNA vaccine tended to have lower
numbers of PRRSV-specific CD4+ CD25+ Foxp3+ Treg than the control
groups, particularly after moving to the fattening site. The
increases in Treg numbers were observed in both control groups
following moving (d49), but not in the DNA vaccinated group (FIG.
22A). There were not statistical differences in the numbers of
IL-10 producing cells throughout the experiment.
[0269] There was an increase in the numbers of PRRSV-specific CD4+
CD25+ lymphocyte (activated effector T cells) in the DNA vaccinated
group following moving, (FIG. 22C), consistent with an increase in
the numbers of PRRSV-specific IFN.gamma. producing cells. The
number of PRRSV-specific IFN-.gamma. producing cells in DNA
vaccinated group was significantly higher than the control groups
on d84 (FIG. 22D). The number of IFN.gamma. producing memory T
cells (CD4+ CD8+ IFN-.gamma.+ cells) of the DNA vaccinated group
remained at a higher level, compared to the controls, through the
end of the observatory period (FIG. 22F). It should be noted that
the data variation within the study groups was quite high in this
experiment. In addition, the immunomodulatory effects of the null
plasmid were also observed.
[0270] On day 84, all groups exhibited PRRSV-seroconversion
following moving into the PRRSV-positive fattening site. On d112,
all pigs were seroconverted with the similar pattern of S/P ratios
(FIG. 23). There was no significant difference in clinical sign
among the groups during fattening period. Interestingly, the group
receiving DNA vaccine exhibited lower lung scores, than the control
group (p<0.05, student t-test), (FIG. 24).
[0271] Summary.
[0272] The DNA vaccine modulated the PRRSV-specific immune
responses as shown by enhanced immunostimulatory parameters and
reduced immunoinhibitory parameters during the fattening period
(Table 10). There were no significant differences in the patterns
of anti-PRRSV humoral responses among the experimental groups. In
addition, the DNA vaccination pigs exhibited significantly lower
lung pathological changes than the control pigs.
TABLE-US-00010 TABLE 10 Summary for % seropositive animals %
seropositive* (No. of positive/tested animals) Group d0 d21 d49 d84
d112 PBSA 0 0 0 57.14 100 (0/7) (0/7) (0/7) (4/7) (8/8) Null 0 0 0
100 100 (0/7) (0/7) (0/7) (6/6) (7/7) pORF7t 0 0 0 100 100 (0/7)
(0/7) (0/7) (6/6) (8/8) *S/P ratio > 0.4
Example 6: PRRSV-DNA Vaccine Challenge Study (PRRSV-Negative
Farm)
[0273] Methods. Four week-old pigs in a PRRSV-seronegative
commercial farm were randomly grouped (30 pigs/gr) and vaccinated
at 4 weeks (d0) and 7 weeks old (d21), using Dermavac system. The
pigs were all moved to the PRRSV-negative fattening site at
approximately 9 weeks old. The treatment groups were as follows:
Gr. 1 (PBSA, 500 .mu.l/dose); Gr. 2 (Null plasmid, 500 .mu.g/500
.mu.l/dose); and Gr. 3 (pORF7t DNA vaccine 500 .mu.g/500
.mu.l/dose). Heparinized blood samples were collected (6 pigs/gr)
for isolation of the PBMC and analysis of PRRSV-specific IL-10 and
IFN.gamma. producing cells and the numbers of PRRSV-specific
CD4.sup.+CD25.sup.+Foxp3.sup.+ lymphocytes (Treg) on d0, 21, 35,
49, and 63. Serum samples were collected for determination of
PRRSV-specific antibody (IDEXX ELISA) at the same time of whole
blood collection.
[0274] Results.
[0275] No vaccine adverse reaction was observed throughout the
experiment. The immunomodulatory effects of the prototype DNA
vaccine were depicted in FIGS. 25A-25F. Following the second
vaccination, the group vaccinated with pORF7t exhibited
significantly lower immunoinhibitory parameters than the control
groups, and the numbers of PRRSV-specific
CD4.sup.+CD25.sup.+Foxp3.sup.+ and
CD4.sup.+CD25.sup.+Foxp3.sup.+IL-10.sup.+ lymphocytes were lower
than the control groups throughout the experiment, especially at
day 35 (FIGS. 25A & 25B). In addition, the DNA immunized group
tended to have higher numbers of immunostimulatory parameters than
the control groups. There were quite high data variations within
the experimental groups. However, the group receiving DNA vaccine
had significantly higher numbers of PRRSV-specific
CD8.sup.+IFN.gamma..sup.+ lymphocytes (CTL) than the control groups
at d35 (FIG. 25F). In addition, the immunomodulatory effects of the
null plasmid were also observed in this study. No seroconverion was
observed in the pigs throughout the experiment, and there was no
obvious difference in the clinical signs among the groups. In
summary, the immunized pigs exhibited significantly better
PRRSV-specific cell-mediated immune responses and lower
immunoinhibitory parameters, with no evidence of enhance anti-PRRSV
antibody response.
Example 7. Challenge Study (PRRSV-Seronegative Farm)
[0276] Methods.
[0277] Four week old pigs in a PRRSV-seronegative farm were
randomly grouped (10-12 pigs/gr) and vaccinated at 4 weeks (d0) and
7 weeks old (d21), using Dermavac: Gr. 1 (PBSA, 500 .mu.l/dose);
Gr. 2 (Null plasmid, 500 .mu.g/500 .mu.l/dose); Gr. 3 (pORF7t, 500
.mu.g/500 .mu.l/dose); and Gr. 4 (pORF7, 500 .mu.g/500 .mu.l/dose).
Prior to the age of 9 weeks old, pigs were moved to the isolation
unit, and following acclimatization, the pigs were intranasally
challenged with 5 ml (2.5 ml/nostril) of 10.sup.5.5 TCID.sub.50/ml
of the virulent, US genotype PRRSV (strain 01NP1). The clinical
signs were monitored following the challenge until the end of the
experiment. Pigs (5-6 pigs/gr) were euthanized at 10 days post
infection (dpi) and 21 dpi, and subjected for virological and
pathological studies. Heparinized blood samples were collected (5
pigs/gr) for isolation of the PBMC and analysis of PRRSV-specific
IL-10 and IFN.gamma. producing cells and the numbers of
PRRSV-specific CD4.sup.+CD25.sup.+Foxp3.sup.+ lymphocytes (Treg) on
the vaccination days (d0, d21) and at 0, 7, 14, and 21 dpi.
[0278] Results.
[0279] The pORF7t vaccinated group exhibited significantly lower
number of the PRRSV-specific Treg, while there were increases in
the numbers of the Foxp3.sup.+ cells in the control groups
throughout the observatory period (FIGS. 26A-26C). On the challenge
day (0 dpi), the numbers of Foxp3.sup.+ lymphocytes from the DNA
vaccinated group were lower than those of the controls (FIGS.
26B-26C). Following the challenge the numbers of Foxp3.sup.+ cells
in the pORF7t vaccinated group remained lower than the control
groups throughout the experiment. At the end of the observatory
period (21 dpi), the pORF7t vaccinated group had significant lower
Treg number than the control groups (FIGS. 26A-26C). Following the
challenge, there were increases in the numbers of IL-10 producing
cells in every experimental group. However, the pORF7t vaccinated
group exhibited slower increase and faster reduction in the number
of IL-10 producing cells (FIG. 26D). The pORF7t vaccinated group
tended to have higher immunostimulatory parameters than the control
groups. All challenge pigs exhibited clinical signs of PRRSV
infection including depression in appetite, fever, swollen eyes,
coughing. The pORF7t Group animals exhibited fewer clinical signs,
and responded to external stimuli better than the other groups.
[0280] Following the challenge, PRRSV was detected from 3 dpi,
peaked at 7-10 dpi and gradually decreased till the end of the
experiment (FIGS. 29A-29C). The pORF7t vaccinated group was less
viremic and recovered faster than the control groups (FIG. 29A).
There was a trend of lower levels of viral genome in the lungs and
tracheobronchial lymph nodes of the DNA vaccinated pigs (FIG. 29B).
However, due to high data variation within the group, there was no
statistical difference among the experimental groups. PRRSV
seroconversion could be detected 2 weeks following the challenge.
There were more seroconverted animals in the pORF7t vaccinated
group at 21 dpi, however, no significant difference in the levels
of S/P ratio was observed among the group. In addition, no
PRRSV-specific neutralizing antibody was detected in any group, at
21 dpi.
[0281] Pathological studies at 10 dpi revealed the PRRSV induced
pathological changes in the lungs from all groups (Table 12). There
were more degree of macroscopic pathological changes in the lungs
and lymph nodes of the control groups. At 21 dpi, the observed
pathological changes were comparable among the groups (Table
13).
[0282] Summary.
[0283] This study demonstrated that the prototype PRRSV-DNA vaccine
could modulate the PRRSV-specific immune responses in the
vaccinated-challenged pigs as expected. The reduced number of Treg
and enhanced immunostimulatory parameters were observed in the DNA
vaccinated group, in particular, following the challenge. At 10
dpi, the pORF7t vaccinated pigs were less viremic, exhibited better
clinical signs and less pathological changes than the control
groups.
TABLE-US-00011 TABLE 11 Percent Seropositive % seropositive* (No.
of positive/tested animals) Group 0 dpi 7 dpi 14 dpi 21 dpi PBSA 0
(0/5) 0 (0/5) 0 (0/5) 40 (2/5) Null 0 (0/5) 0 (0/5) 0 (0/5) 0 (0/5)
pORF7t 0 (0/5) 0 (0/5) 20 (1/5) 60 (3/5) *positive: S/P ratio >
0.4
Example 8. Vaccine Efficacy in Replacement Gilts in the
PRRSV-Positive Farm
[0284] Methods.
[0285] Nineteen week old, replacement gilts from a PRRSV-negative
commercial farm were randomly grouped (30 pigs/gr) and immunized
twice, at 20 (d0) and 23 (d21) weeks old with Dermavac system. Pigs
were moved to PRRSV-positive production site at 9 weeks old (d35).
The immunization groups were as followed; Gr. 1 PBSA (500
.mu.l/dose); Gr. 2 Null plasmid (pMASIA, 500 .mu.g/500 .mu.l/dose);
Gr. 3 DNA vaccine (pORF7t, 500 .mu.g/500 .mu.l/dose. At 25 weeks
old, the gilts were moved to PRRSV-positive farm where they would
be exposed to the local PRRSV strain during the acclimatization in
the recipient farm. The recipient farm has low level of losses from
PRDC and PRRSV. Heparinized blood samples were collected (6
pigs/gr) for isolation of the PBMC and analysis of PRRSV-specific
IL-10 and IFN.gamma. producing cells and the numbers of
PRRSV-specific CD4.sup.+CD25.sup.+Foxp3.sup.+ lymphocytes (Treg) on
d0, 21, 35, 42, 49, 56, 70, and 98. Methods were generally
performed as in previous example.
[0286] Results.
[0287] No evidence of vaccine adverse reaction was observed in the
vaccinated gilts. Following vaccination, the vaccinated gilts
exhibited a tendency of reduced PRRSV-specific
CD4.sup.+CD25.sup.+Foxp3.sup.+ Treg and IL-10 producing cells, and
enhanced PRRSV-specific memory effector T cells and IFN.gamma.
producing cells, compared to the controls throughout the
experiment. The DNA-vaccinated gilts contained significantly lower
numbers of PRRSV-specific CD4.sup.+CD25.sup.+Foxp3.sup.+ lymphocyte
(Treg), and higher numbers of PRRSV-specific IFN.gamma. producing
cells than the pigs received PBSA on the day they were moved to the
positive production site. It should be noted that there was quite
high data variation within the experimental groups.
[0288] Prior to moving, the baseline levels of PRRSV genome in all
groups were comparable, but following the move, PRRSV infection
became apparent in all groups, as indicated by increases in PRRSV
viral loads in the serum. The viremic stages were observed from 3
days post moving (dpm), peaked around 10-14 dpm, and lasted
approximately 2 weeks. The pORF7t vaccinated gilts tended to have
slower increases in viral loads and lower copy numbers of detected
PRRSV genome in their serum samples.
[0289] Summary.
[0290] The pORF7t DNA vaccine exhibited immunomodulatory activities
as in previous studies. Following PRRSV exposure in the farm, there
was a trend of lower level of PRRSV viremia, and less culling in
the DNA vaccinated gilts, as compared to controls.
[0291] Having thus described in detail preferred embodiments of the
present invention, it is to be understood that the invention
defined by the above paragraphs is not to be limited to particular
details set forth in the above description as many apparent
variations thereof are possible without departing from the spirit
or scope of the present invention.
Sequence CWU 1
1
181372DNAArtificial SequencePRRSV ORF7 1atgccaaata acaacggcaa
gcagcagaag agaaagaagg gggatggcca gccagtcaat 60cagctgtgcc agatgctggg
taagatcatc gctcagcaaa accagtccag aggcaaggga 120ccgggaaaga
aaaataagaa gaaaaacccg gagaagcccc attttcctct agcgactgaa
180gatgatgtca gacatcactt tacccctagt gagcggcaat tgtgtctgtc
gtcaatccag 240accgccttta atcaaggcgc tgggacttgc accctgtcag
attcagggag gataagttac 300actgtggagt ttagtttgcc tacgcatcat
actgtgcgcc tgatccgcgt cacagcatca 360ccctcagcat ga
3722123PRTArtificial SequencePRRSV ORF7 translation 2Met Pro Asn
Asn Asn Gly Lys Gln Gln Lys Arg Lys Lys Gly Asp Gly 1 5 10 15 Gln
Pro Val Asn Gln Leu Cys Gln Met Leu Gly Lys Ile Ile Ala Gln 20 25
30 Gln Asn Gln Ser Arg Gly Lys Gly Pro Gly Lys Lys Asn Lys Lys Lys
35 40 45 Asn Pro Glu Lys Pro His Phe Pro Leu Ala Thr Glu Asp Asp
Val Arg 50 55 60 His His Phe Thr Pro Ser Glu Arg Gln Leu Cys Leu
Ser Ser Ile Gln 65 70 75 80 Thr Ala Phe Asn Gln Gly Ala Gly Thr Cys
Thr Leu Ser Asp Ser Gly 85 90 95 Arg Ile Ser Tyr Thr Val Glu Phe
Ser Leu Pro Thr His His Thr Val 100 105 110 Arg Leu Ile Arg Val Thr
Ala Ser Pro Ser Ala 115 120 3339DNAArtificial SequencePRRSV
modified truncated ORF7 (ORF7t) 3atgccaaata acaacggcaa gcagcagaag
agaaagaagg gggatggcca gccagtcaat 60cagctgtgcc agatgctggg taagatcatc
gctcagcaaa accagtccag aggcaaggga 120ccgggaaaga aaaataagaa
gaaaaacccg gagaagcccc attttcctct agcgactgaa 180gatgatgtca
gacatcactt tacccctagt gagcggcaat tgtgtctgtc gtcaatccag
240accgccttta atcaaggcgc tgggacttgc accctgtcag attcagggag
gataagttac 300actgtggagt ttagtttgcc tacgcatcat actgtgtga
3394112PRTArtificial SequencePRRSV ORF7t translation 4Met Pro Asn
Asn Asn Gly Lys Gln Gln Lys Arg Lys Lys Gly Asp Gly 1 5 10 15 Gln
Pro Val Asn Gln Leu Cys Gln Met Leu Gly Lys Ile Ile Ala Gln 20 25
30 Gln Asn Gln Ser Arg Gly Lys Gly Pro Gly Lys Lys Asn Lys Lys Lys
35 40 45 Asn Pro Glu Lys Pro His Phe Pro Leu Ala Thr Glu Asp Asp
Val Arg 50 55 60 His His Phe Thr Pro Ser Glu Arg Gln Leu Cys Leu
Ser Ser Ile Gln 65 70 75 80 Thr Ala Phe Asn Gln Gly Ala Gly Thr Cys
Thr Leu Ser Asp Ser Gly 85 90 95 Arg Ile Ser Tyr Thr Val Glu Phe
Ser Leu Pro Thr His His Thr Val 100 105 110 533DNAArtificial
SequenceORF7 US-F primer 5aaaaaagaat tcatgccaaa taacaacggc aag
33634DNAArtificial SequenceORF7 US-R primer 6aaaaaagaat tctcatgctg
agggtgatgc tgtg 34734DNAArtificial SequenceUS-11R primer
7aaaaaagaat tctcacacag tatgatgcgt aggc 3484283DNAArtificial
SequencepMASIA plasmid 8gaattcgagc tcccgggtac catggcatgc atcgatagat
ctcgagtcta gactagagct 60cgctgatcag cctcgactgt gccttctagt tgccagccat
ctgttgtttg cccctccccc 120gtgccttcct tgaccctgga aggtgccact
cccactgtcc tttcctaata aaatgaggaa 180attgcatcgc attgtctgag
taggtgtcat tctattctgg ggggtggggt ggggcaggac 240agcaaggggg
aggattggga agacaatagc aggcatgctg gggaaggcct cggactagtg
300gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac
aattccacac 360aacatacgag ccgcggaagc ataaagtgta aagcctgggg
tgcctaatga gtgagctaac 420tcacattaat tgcgttgcgc tcactgcccg
ctttccagtc gggaaacctg tcgtgccagc 480tgcattaatg aatcggccaa
cgcgcgggga gaggcggttt gcgtattggg cgctcttccg 540cttcctcgct
cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc
600actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga
aagaacatgt 660gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc
cgcgttgctg gcgtttttcc 720ataggctccg cccccctgac gagcatcaca
aaaatcgacg ctcaagtcag aggtggcgaa 780acccgacagg actataaaga
taccaggcgt ttccccctgg aagctccctc gtgcgctctc 840ctgttccgac
cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg
900cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt
cgctccaagc 960tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg
cgccttatcc ggtaactatc 1020gtcttgagtc caacccggta agacacgact
tatcgccact ggcagcagcc actggtaaca 1080ggattagcag agcgaggtat
gtaggcggtg ctacagagtt cttgaagtgg tggcctaact 1140acggctacac
tagaagaaca gtatttggta tctgcgctct gctgaagcca gttaccttcg
1200gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc
ggtggttttt 1260ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc
tcaagaagat cctttgatct 1320tttctacggg gtctgacgct cagtggaacg
aaaactcacg ttaagggatt ttggtcatga 1380gctgtcgttg tgtcgtcaag
tcagcgtaat gctctgccag tgttacaacc aattaaccaa 1440ttctgattag
aaaaactcat cgagcatcaa atgaaactgc aatttattca tatcaggatt
1500atcaatacca tatttttgaa aaagtcgttt ctgtaatgaa ggagaaaact
caccaaggca 1560gttccatagg atggcaagat cctggtatcg atctgcgatt
ccaactcgtc caacatcaat 1620acaacctatt aatttcccct cgtcaaaaat
aaggttatca agtgagaaat caccatgagt 1680gacgactgaa tctggtgaga
atggcaaaag tttatgcatt tctttccaga cttgttcaac 1740aggccagcca
ttacgctcgt catcaaaatc actcgcatca accaaaccat tattcattcg
1800tgattgcgcc tgagcgagac gaaatacgcg atcgctgtta aaaggacaat
tacaaacagg 1860aatcgaatgc aaacgtctca ggaacactgc cagcgcatca
acaatatttt cacctgaatc 1920aggatattct tctaatacct ggaatgctgt
ttttccaggg atcgcagtgg tgagtaacca 1980tgcatcatca ggagtacgta
taaaatgctt gatggtggga agaggcataa attctgtcag 2040ccagtttagt
ctgaccatct catctgtaac atcattggca acgctacctt tgccatgttt
2100cagaaacaac tctggcgcat ctggcttccc atacaagcga tagattgtcg
cacctgattg 2160ccctacatta tcgcgagccc atttataccc atataaatca
gcatccatgt tggaatttaa 2220tcgtggcctc gacgtttccc gttgaatatg
gctcataaca ccccttgtat tactgtttat 2280gtaagcagac agttttattg
ttcatgatga tatattttta tcttgtgcaa tgtaacatca 2340gagattttga
gacacaacgt ggctttcccc ccccccccca tgacattaac ctataaaaat
2400aggcgtatca cgaggcccta ttttaaattc gaaagtactg gacctgttaa
cacgccattc 2460gccattcagg ctgcgcaact gttgggaagg gcgatcggtg
cgggcctctt cgctattacg 2520ccagctggcg aaagggggat gtgctgcaag
gcgattaagt tgggtaacgc cagggttttc 2580ccagtcacga cgttgtaaaa
cgacggccag tgaattgtaa tacgactcac tatagggcga 2640attggggatc
gatccactag ttctagatcc gatgtacggg ccagatatac gcgttgacat
2700tgattattga ctagttatta atagtaatca attacggggt cattagttca
tagcccatat 2760atggagttcc gcgttacata acttacggta aatggcccgc
ctggctgacc gcccaacgac 2820ccccgcccat tgacgtcaat aatgacgtat
gttcccatag taacgccaat agggactttc 2880cattgacgtc aatgggtgga
gtatttacgg taaactgccc acttggcagt acatcaagtg 2940tatcatatgc
caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat
3000tatgcccagt acatgacctt atgggacttt cctacttggc agtacatcta
cgtattagtc 3060atcgctatta ccatggtgat gcggttttgg cagtacatca
atgggcgtgg atagcggttt 3120gactcacggg gatttccaag tctccacccc
attgacgtca atgggagttt gttttggcac 3180caaaatcaac gggactttcc
aaaatgtcgt aacaactccg ccccattgac gcaaatgggc 3240ggtaggcgtg
tacggtggga ggtctatata agcagagctc tctggctaac tagagaaccc
3300actgcttact ggcttatcga aattgcggcc gggaacggtg cattggaacg
cggattcccc 3360gtgccaagag tgacgtaagt accgcctata gactctatag
gcacacccct ttggctctta 3420tgcatgctat actgtttttg gcttggggcc
tatacacccc cgctccttat gctataggtg 3480atggtatagc ttagcctata
ggtgtgggtt attgaccatt attgaccact cccctattgg 3540tgacgatact
ttccattact aatccataac atggctcttt gccacaacta tctctattgg
3600ctatatgcca atactctgtc cttcagagac tgacacggac tctgtatttt
tacaggatgg 3660ggtcccattt attatttaca aattcacata tacaacaacg
ccgtcccccg tgcccgcagt 3720ttttattaaa catagcgtgg gatctccacg
cgaatctcgg gtacgtgttc cggacatggg 3780ctcttctccg gtagcggcgg
agcttccaca tccgagccct ggscccatgc ctccagcggc 3840tcatggtcgc
tcggcagctc cttgctccta acagtggagg ccagacttag gcacagcaca
3900atgcccacca ccaccagtgt gccgcacaag gccgtggcgg tagggtatgt
gtctgaaaat 3960gagctcggag attgggctcg caccgtgacg cagatggaag
acttaaggca gcggcagaag 4020aagatgcagg cagctgagtt gttgtattct
gataagagtc agaggtaact cccgttgcgg 4080ttctgttaac ggtggagggc
agtgtagtct gagcagtact cgttgctgcc gcgcgcgcca 4140ccagacataa
tagctgacag actaacagac tgttcctttc catgggtctt ttctgcagtc
4200accgtcgtcg acacgtgtga tcagatgact ctctagacca ggcgcctgga
tccatatgac 4260gtcgacgcgt ctgcagaagc ttc 428394655DNAArtificial
SequencepORF7 plasmid 9gaattcatgc caaataacaa cggcaagcag cagaagagaa
agaaggggga tggccagcca 60gtcaatcagc tgtgccagat gctgggtaag atcatcgctc
agcaaaacca gtccagaggc 120aagggaccgg gaaagaaaaa taagaagaaa
aacccggaga agccccattt tcctctagcg 180actgaagatg atgtcagaca
tcactttacc cctagtgagc ggcaattgtg tctgtcgtca 240atccagaccg
cctttaatca aggcgctggg acttgcaccc tgtcagattc agggaggata
300agttacactg tggagtttag tttgcctacg catcatactg tgcgcctgat
ccgcgtcaca 360gcatcaccct cagcgtgaga gctcccgggt accatggcat
gcatcgatag atctcgagtc 420tagactagag ctcgctgatc agcctcgact
gtgccttcta gttgccagcc atctgttgtt 480tgcccctccc ccgtgccttc
cttgaccctg gaaggtgcca ctcccactgt cctttcctaa 540taaaatgagg
aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg
600gtggggcagg acagcaaggg ggaggattgg gaagacaata gcaggcatgc
tggggaaggc 660ctcggactag tggcgtaatc atggtcatag ctgtttcctg
tgtgaaattg ttatccgctc 720acaattccac acaacatacg agccgcggaa
gcataaagtg taaagcctgg ggtgcctaat 780gagtgagcta actcacatta
attgcgttgc gctcactgcc cgctttccag tcgggaaacc 840tgtcgtgcca
gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg
900ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg
ctgcggcgag 960cggtatcagc tcactcaaag gcggtaatac ggttatccac
agaatcaggg gataacgcag 1020gaaagaacat gtgagcaaaa ggccagcaaa
aggccaggaa ccgtaaaaag gccgcgttgc 1080tggcgttttt ccataggctc
cgcccccctg acgagcatca caaaaatcga cgctcaagtc 1140agaggtggcg
aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc
1200tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc
tttctccctt 1260cgggaagcgt ggcgctttct catagctcac gctgtaggta
tctcagttcg gtgtaggtcg 1320ttcgctccaa gctgggctgt gtgcacgaac
cccccgttca gcccgaccgc tgcgccttat 1380ccggtaacta tcgtcttgag
tccaacccgg taagacacga cttatcgcca ctggcagcag 1440ccactggtaa
caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt
1500ggtggcctaa ctacggctac actagaagaa cagtatttgg tatctgcgct
ctgctgaagc 1560cagttacctt cggaaaaaga gttggtagct cttgatccgg
caaacaaacc accgctggta 1620gcggtggttt ttttgtttgc aagcagcaga
ttacgcgcag aaaaaaagga tctcaagaag 1680atcctttgat cttttctacg
gggtctgacg ctcagtggaa cgaaaactca cgttaaggga 1740ttttggtcat
gagctgtcgt tgtgtcgtca agtcagcgta atgctctgcc agtgttacaa
1800ccaattaacc aattctgatt agaaaaactc atcgagcatc aaatgaaact
gcaatttatt 1860catatcagga ttatcaatac catatttttg aaaaagtcgt
ttctgtaatg aaggagaaaa 1920ctcaccaagg cagttccata ggatggcaag
atcctggtat cgatctgcga ttccaactcg 1980tccaacatca atacaaccta
ttaatttccc ctcgtcaaaa ataaggttat caagtgagaa 2040atcaccatga
gtgacgactg aatctggtga gaatggcaaa agtttatgca tttctttcca
2100gacttgttca acaggccagc cattacgctc gtcatcaaaa tcactcgcat
caaccaaacc 2160attattcatt cgtgattgcg cctgagcgag acgaaatacg
cgatcgctgt taaaaggaca 2220attacaaaca ggaatcgaat gcaaacgtct
caggaacact gccagcgcat caacaatatt 2280ttcacctgaa tcaggatatt
cttctaatac ctggaatgct gtttttccag ggatcgcagt 2340ggtgagtaac
catgcatcat caggagtacg tataaaatgc ttgatggtgg gaagaggcat
2400aaattctgtc agccagttta gtctgaccat ctcatctgta acatcattgg
caacgctacc 2460tttgccatgt ttcagaaaca actctggcgc atctggcttc
ccatacaagc gatagattgt 2520cgcacctgat tgccctacat tatcgcgagc
ccatttatac ccatataaat cagcatccat 2580gttggaattt aatcgtggcc
tcgacgtttc ccgttgaata tggctcataa caccccttgt 2640attactgttt
atgtaagcag acagttttat tgttcatgat gatatatttt tatcttgtgc
2700aatgtaacat cagagatttt gagacacaac gtggctttcc cccccccccc
catgacatta 2760acctataaaa ataggcgtat cacgaggccc tattttaaat
tcgaaagtac tggacctgtt 2820aacacgccat tcgccattca ggctgcgcaa
ctgttgggaa gggcgatcgg tgcgggcctc 2880ttcgctatta cgccagctgg
cgaaaggggg atgtgctgca aggcgattaa gttgggtaac 2940gccagggttt
tcccagtcac gacgttgtaa aacgacggcc agtgaattgt aatacgactc
3000actatagggc gaattgggga tcgatccact agttctagat ccgatgtacg
ggccagatat 3060acgcgttgac attgattatt gactagttat taatagtaat
caattacggg gtcattagtt 3120catagcccat atatggagtt ccgcgttaca
taacttacgg taaatggccc gcctggctga 3180ccgcccaacg acccccgccc
attgacgtca ataatgacgt atgttcccat agtaacgcca 3240atagggactt
tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca
3300gtacatcaag tgtatcatat gccaagtacg ccccctattg acgtcaatga
cggtaaatgg 3360cccgcctggc attatgccca gtacatgacc ttatgggact
ttcctacttg gcagtacatc 3420tacgtattag tcatcgctat taccatggtg
atgcggtttt ggcagtacat caatgggcgt 3480ggatagcggt ttgactcacg
gggatttcca agtctccacc ccattgacgt caatgggagt 3540ttgttttggc
accaaaatca acgggacttt ccaaaatgtc gtaacaactc cgccccattg
3600acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc
tctctggcta 3660actagagaac ccactgctta ctggcttatc gaaattgcgg
ccgggaacgg tgcattggaa 3720cgcggattcc ccgtgccaag agtgacgtaa
gtaccgccta tagactctat aggcacaccc 3780ctttggctct tatgcatgct
atactgtttt tggcttgggg cctatacacc cccgctcctt 3840atgctatagg
tgatggtata gcttagccta taggtgtggg ttattgacca ttattgacca
3900ctcccctatt ggtgacgata ctttccatta ctaatccata acatggctct
ttgccacaac 3960tatctctatt ggctatatgc caatactctg tccttcagag
actgacacgg actctgtatt 4020tttacaggat ggggtcccat ttattattta
caaattcaca tatacaacaa cgccgtcccc 4080cgtgcccgca gtttttatta
aacatagcgt gggatctcca cgcgaatctc gggtacgtgt 4140tccggacatg
ggctcttctc cggtagcggc ggagcttcca catccgagcc ctggscccat
4200gcctccagcg gctcatggtc gctcggcagc tccttgctcc taacagtgga
ggccagactt 4260aggcacagca caatgcccac caccaccagt gtgccgcaca
aggccgtggc ggtagggtat 4320gtgtctgaaa atgagctcgg agattgggct
cgcaccgtga cgcagatgga agacttaagg 4380cagcggcaga agaagatgca
ggcagctgag ttgttgtatt ctgataagag tcagaggtaa 4440ctcccgttgc
ggttctgtta acggtggagg gcagtgtagt ctgagcagta ctcgttgctg
4500ccgcgcgcgc caccagacat aatagctgac agactaacag actgttcctt
tccatgggtc 4560ttttctgcag tcaccgtcgt cgacacgtgt gatcagatga
ctctctagac caggcgcctg 4620gatccatatg acgtcgacgc gtctgcagaa gcttc
4655104622DNAArtificial SequencepORF7t plasmid 10gaattcatgc
caaataacaa cggcaagcag cagaagagaa agaaggggga tggccagcca 60gtcaatcagc
tgtgccagat gctgggtaag atcatcgctc agcaaaacca gtccagaggc
120aagggaccgg gaaagaaaaa taagaagaaa aacccggaga agccccattt
tcctctagcg 180actgaagatg atgtcagaca tcactttacc cctagtgagc
ggcaattgtg tctgtcgtca 240atccagaccg cctttaatca aggcgctggg
acttgcaccc tgtcagattc agggaggata 300agttacactg tggagtttag
tttgcctacg catcatactg tgtgagagct cccgggtacc 360atggcatgca
tcgatagatc tcgagtctag actagagctc gctgatcagc ctcgactgtg
420ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt
gaccctggaa 480ggtgccactc ccactgtcct ttcctaataa aatgaggaaa
ttgcatcgca ttgtctgagt 540aggtgtcatt ctattctggg gggtggggtg
gggcaggaca gcaaggggga ggattgggaa 600gacaatagca ggcatgctgg
ggaaggcctc ggactagtgg cgtaatcatg gtcatagctg 660tttcctgtgt
gaaattgtta tccgctcaca attccacaca acatacgagc cgcggaagca
720taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt
gcgttgcgct 780cactgcccgc tttccagtcg ggaaacctgt cgtgccagct
gcattaatga atcggccaac 840gcgcggggag aggcggtttg cgtattgggc
gctcttccgc ttcctcgctc actgactcgc 900tgcgctcggt cgttcggctg
cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 960tatccacaga
atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg
1020ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc
ccccctgacg 1080agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa
cccgacagga ctataaagat 1140accaggcgtt tccccctgga agctccctcg
tgcgctctcc tgttccgacc ctgccgctta 1200ccggatacct gtccgccttt
ctcccttcgg gaagcgtggc gctttctcat agctcacgct 1260gtaggtatct
cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc
1320ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc
aacccggtaa 1380gacacgactt atcgccactg gcagcagcca ctggtaacag
gattagcaga gcgaggtatg 1440taggcggtgc tacagagttc ttgaagtggt
ggcctaacta cggctacact agaagaacag 1500tatttggtat ctgcgctctg
ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt 1560gatccggcaa
acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta
1620cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg
tctgacgctc 1680agtggaacga aaactcacgt taagggattt tggtcatgag
ctgtcgttgt gtcgtcaagt 1740cagcgtaatg ctctgccagt gttacaacca
attaaccaat tctgattaga aaaactcatc 1800gagcatcaaa tgaaactgca
atttattcat atcaggatta tcaataccat atttttgaaa 1860aagtcgtttc
tgtaatgaag gagaaaactc accaaggcag ttccatagga tggcaagatc
1920ctggtatcga tctgcgattc caactcgtcc aacatcaata caacctatta
atttcccctc 1980gtcaaaaata aggttatcaa gtgagaaatc accatgagtg
acgactgaat ctggtgagaa 2040tggcaaaagt ttatgcattt ctttccagac
ttgttcaaca ggccagccat tacgctcgtc 2100atcaaaatca ctcgcatcaa
ccaaaccatt attcattcgt gattgcgcct gagcgagacg 2160aaatacgcga
tcgctgttaa aaggacaatt acaaacagga atcgaatgca aacgtctcag
2220gaacactgcc agcgcatcaa caatattttc acctgaatca ggatattctt
ctaatacctg 2280gaatgctgtt tttccaggga tcgcagtggt gagtaaccat
gcatcatcag gagtacgtat 2340aaaatgcttg atggtgggaa gaggcataaa
ttctgtcagc cagtttagtc tgaccatctc 2400atctgtaaca tcattggcaa
cgctaccttt gccatgtttc agaaacaact ctggcgcatc 2460tggcttccca
tacaagcgat agattgtcgc acctgattgc cctacattat cgcgagccca
2520tttataccca tataaatcag catccatgtt ggaatttaat cgtggcctcg
acgtttcccg 2580ttgaatatgg ctcataacac cccttgtatt actgtttatg
taagcagaca gttttattgt 2640tcatgatgat atatttttat cttgtgcaat
gtaacatcag agattttgag acacaacgtg 2700gctttccccc ccccccccat
gacattaacc tataaaaata ggcgtatcac gaggccctat 2760tttaaattcg
aaagtactgg acctgttaac acgccattcg ccattcaggc tgcgcaactg
2820ttgggaaggg cgatcggtgc gggcctcttc gctattacgc cagctggcga
aagggggatg 2880tgctgcaagg cgattaagtt gggtaacgcc agggttttcc
cagtcacgac gttgtaaaac 2940gacggccagt gaattgtaat acgactcact
atagggcgaa ttggggatcg atccactagt 3000tctagatccg atgtacgggc
cagatatacg cgttgacatt gattattgac tagttattaa 3060tagtaatcaa
ttacggggtc attagttcat agcccatata tggagttccg cgttacataa
3120cttacggtaa atggcccgcc
tggctgaccg cccaacgacc cccgcccatt gacgtcaata 3180atgacgtatg
ttcccatagt aacgccaata gggactttcc attgacgtca atgggtggag
3240tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
aagtacgccc 3300cctattgacg tcaatgacgg taaatggccc gcctggcatt
atgcccagta catgacctta 3360tgggactttc ctacttggca gtacatctac
gtattagtca tcgctattac catggtgatg 3420cggttttggc agtacatcaa
tgggcgtgga tagcggtttg actcacgggg atttccaagt 3480ctccacccca
ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg ggactttcca
3540aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
acggtgggag 3600gtctatataa gcagagctct ctggctaact agagaaccca
ctgcttactg gcttatcgaa 3660attgcggccg ggaacggtgc attggaacgc
ggattccccg tgccaagagt gacgtaagta 3720ccgcctatag actctatagg
cacacccctt tggctcttat gcatgctata ctgtttttgg 3780cttggggcct
atacaccccc gctccttatg ctataggtga tggtatagct tagcctatag
3840gtgtgggtta ttgaccatta ttgaccactc ccctattggt gacgatactt
tccattacta 3900atccataaca tggctctttg ccacaactat ctctattggc
tatatgccaa tactctgtcc 3960ttcagagact gacacggact ctgtattttt
acaggatggg gtcccattta ttatttacaa 4020attcacatat acaacaacgc
cgtcccccgt gcccgcagtt tttattaaac atagcgtggg 4080atctccacgc
gaatctcggg tacgtgttcc ggacatgggc tcttctccgg tagcggcgga
4140gcttccacat ccgagccctg gscccatgcc tccagcggct catggtcgct
cggcagctcc 4200ttgctcctaa cagtggaggc cagacttagg cacagcacaa
tgcccaccac caccagtgtg 4260ccgcacaagg ccgtggcggt agggtatgtg
tctgaaaatg agctcggaga ttgggctcgc 4320accgtgacgc agatggaaga
cttaaggcag cggcagaaga agatgcaggc agctgagttg 4380ttgtattctg
ataagagtca gaggtaactc ccgttgcggt tctgttaacg gtggagggca
4440gtgtagtctg agcagtactc gttgctgccg cgcgcgccac cagacataat
agctgacaga 4500ctaacagact gttcctttcc atgggtcttt tctgcagtca
ccgtcgtcga cacgtgtgat 4560cagatgactc tctagaccag gcgcctggat
ccatatgacg tcgacgcgtc tgcagaagct 4620tc 46221121DNAArtificial
SequencepMASIA F primer 11cagtgtagtc tgagcagtac t
21124840DNAArtificial SequencepBAD-ORF7 plasmid 12aagaaaccaa
ttgtccatat tgcatcagac attgccgtca ctgcgtcttt tactggctct 60tctcgctaac
caaaccggta accccgctta ttaaaagcat tctgtaacaa agcgggacca
120aagccatgac aaaaacgcgt aacaaaagtg tctataatca cggcagaaaa
gtccacattg 180attatttgca cggcgtcaca ctttgctatg ccatagcatt
tttatccata agattagcgg 240atcctacctg acgcttttta tcgcaactct
ctactgtttc tccatacccg tttttttggg 300ctagaaataa ttttgtttaa
ctttaagaag gagatataca tacccatggg atctgataaa 360attattcatc
tgactgatga ttcttttgat actgatgtac ttaaggcaga tggtgcaatc
420ctggttgatt tctgggcaca ctggtgcggt ccgtgcaaaa tgatcgctcc
gattctggat 480gaaatcgctg acgaatatca gggcaaactg accgttgcaa
aactgaacat cgatcacaac 540ccgggcactg cgccgaaata tggcatccgt
ggtatcccga ctctgctgct gttcaaaaac 600ggtgaagtgg cggcaaccaa
agtgggtgca ctgtctaaag gtcagttgaa agagttcctc 660gacgctaacc
tggccggctc tggatccggt gatgacgatg acaagctggg aattgatccc
720ttcaccatgc caaataacaa cggcaagcag cagaagagaa agaaggggga
tggccagcca 780gtcaatcagc tgtgccagat gctgggtaag atcatcgctc
agcaaaacca gtccagaggc 840aagggaccgg gaaagaaaaa taagaagaaa
aacccggaga agccccattt tcctctagcg 900actgaagatg atgtcagaca
tcactttacc cctagtgagc ggcaattgtg tctgtcgtca 960atccagaccg
cctttaatca aggcgctggg acttgcaccc tgtcagattc agggaggata
1020agttacactg tggagtttag tttgcctacg catcatactg tgcgcctgat
ccgcgtcaca 1080gcatcaccct cagcgaaggg cgagctcaag cttgaaggta
agcctatccc taaccctctc 1140ctcggtctcg attctacgcg taccggtcat
catcaccatc accattgagt ttaaacggtc 1200tccagcttgg ctgttttggc
ggatgagaga agattttcag cctgatacag attaaatcag 1260aacgcagaag
cggtctgata aaacagaatt tgcctggcgg cagtagcgcg gtggtcccac
1320ctgaccccat gccgaactca gaagtgaaac gccgtagcgc cgatggtagt
gtggggtctc 1380cccatgcgag agtagggaac tgccaggcat caaataaaac
gaaaggctca gtcgaaagac 1440tgggcctttc gttttatctg ttgtttgtcg
gtgaacgctc tcctgagtag gacaaatccg 1500ccgggagcgg atttgaacgt
tgcgaagcaa cggcccggag ggtggcgggc aggacgcccg 1560ccataaactg
ccaggcatca aattaagcag aaggccatcc tgacggatgg cctttttgcg
1620tttctacaaa ctcttttgtt tatttttcta aatacattca aatatgtatc
cgctcatgag 1680acaataaccc tgataaatgc ttcaataata ttgaaaaagg
aagagtatga gtattcaaca 1740tttccgtgtc gcccttattc ccttttttgc
ggcattttgc cttcctgttt ttgctcaccc 1800agaaacgctg gtgaaagtaa
aagatgctga agatcagttg ggtgcacgag tgggttacat 1860cgaactggat
ctcaacagcg gtaagatcct tgagagtttt cgccccgaag aacgttttcc
1920aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgtg
ttgacgccgg 1980gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat
gacttggttg agtactcacc 2040agtcacagaa aagcatctta cggatggcat
gacagtaaga gaattatgca gtgctgccat 2100aaccatgagt gataacactg
cggccaactt acttctgaca acgatcggag gaccgaagga 2160gctaaccgct
tttttgcaca acatggggga tcatgtaact cgccttgatc gttgggaacc
2220ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgcctg
tagcaatggc 2280aacaacgttg cgcaaactat taactggcga actacttact
ctagcttccc ggcaacaatt 2340aatagactgg atggaggcgg ataaagttgc
aggaccactt ctgcgctcgg cccttccggc 2400tggctggttt attgctgata
aatctggagc cggtgagcgt gggtctcgcg gtatcattgc 2460agcactgggg
ccagatggta agccctcccg tatcgtagtt atctacacga cggggagtca
2520ggcaactatg gatgaacgaa atagacagat cgctgagata ggtgcctcac
tgattaagca 2580ttggtaactg tcagaccaag tttactcata tatactttag
attgatttaa aacttcattt 2640ttaatttaaa aggatctagg tgaagatcct
ttttgataat ctcatgacca aaatccctta 2700acgtgagttt tcgttccact
gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg 2760agatcctttt
tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac cgctaccagc
2820ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa
ctggcttcag 2880cagagcgcag ataccaaata ctgtccttct agtgtagccg
tagttaggcc accacttcaa 2940gaactctgta gcaccgccta catacctcgc
tctgctaatc ctgttaccag tggctgctgc 3000cagtggcgat aagtcgtgtc
ttaccgggtt ggactcaaga cgatagttac cggataaggc 3060gcagcggtcg
ggctgaacgg ggggttcgtg cacacagccc agcttggagc gaacgaccta
3120caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc
ccgaagggag 3180aaaggcggac aggtatccgg taagcggcag ggtcggaaca
ggagagcgca cgagggagct 3240tccaggggga aacgcctggt atctttatag
tcctgtcggg tttcgccacc tctgacttga 3300gcgtcgattt ttgtgatgct
cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc 3360ggccttttta
cggttcctgg ccttttgctg gccttttgct cacatgttct ttcctgcgtt
3420atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata
ccgctcgccg 3480cagccgaacg accgagcgca gcgagtcagt gagcgaggaa
gcggaagagc gcctgatgcg 3540gtattttctc cttacgcatc tgtgcggtat
ttcacaccgc atatggtgca ctctcagtac 3600aatctgctct gatgccgcat
agttaagcca gtatacactc cgctatcgct acgtgactgg 3660gtcatggctg
cgccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg
3720ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat
gtgtcagagg 3780ttttcaccgt catcaccgaa acgcgcgagg cagcagatca
attcgcgcgc gaaggcgaag 3840cggcatgcat aatgtgcctg tcaaatggac
gaagcaggga ttctgcaaac cctatgctac 3900tccgtcaagc cgtcaattgt
ctgattcgtt accaattatg acaacttgac ggctacatca 3960ttcacttttt
cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta
4020aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac
ggtggcgata 4080ggcatccggg tggtgctcaa aagcagcttc gcctggctga
tacgttggtc ctcgcgccag 4140cttaagacgc taatccctaa ctgctggcgg
aaaagatgtg acagacgcga cggcgacaag 4200caaacatgct gtgcgacgct
ggcgatatca aaattgctgt ctgccaggtg atcgctgatg 4260tactgacaag
cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct
4320tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc
cgaatagcgc 4380ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt
cgctgaaatg cggctggtgc 4440gcttcatccg ggcgaaagaa ccccgtattg
gcaaatattg acggccagtt aagccattca 4500tgccagtagg cgcgcggacg
aaagtaaacc cactggtgat accattcgcg agcctccgga 4560tgacgaccgt
agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa
4620acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag
attgagaata 4680taacctttca ttcccagcgg tcggtcgata aaaaaatcga
gataaccgtt ggcctcaatc 4740ggcgttaaac ccgccaccag atgggcatta
aacgagtatc ccggcagcag gggatcattt 4800tgcgcttcag ccatactttt
catactcccg ccattcagag 48401315412DNAArtificial Sequence01NP1-PRRSV
- Genbank accession number Q056373 - illustrated in FIG. 2
13atgacgtata ggtgttggct ctatgccttg gcatttgtat tgtcgggagc tgtgaccatt
60ggcacagccc aaaacttgct gcacagaaac acccttctgt gatagcctcc ttcaggggag
120cttagggttt gtccctagca ccttgcttcc ggagttgcac tgctttacgg
tctctccacc 180cctttaacca tgtctgggat acttgatcgg tgcacgtgta
cccccaatgc cagggtgttt 240atggcggagg gccaagtcta ctgcacacga
tgcctcagtg cacggtctct ccttcccctg 300aacctccaag tttctgagct
cggggtgcta ggcctattct acaggcccga agagccactc 360cggtggacgt
tgccacgtgc attccccact gttgagtgct cccccgccgg ggcctgctgg
420ctttctgcaa tctttccaat cgcacgaatg accagtggaa acctgaactt
ccaacaaaga 480atggtacggg tcgcagctga gctttacaga gccggccagc
tcacccctgc agtcttgaag 540gctctacaag tttatgaacg gggttgccgc
tggtacccca ttgttggacc tgtccctgga 600gtggccgttt tcgccaattc
cctacatgtg agtgataaac ctttcccggg agcaactcac 660gtgttgacca
acctgccgct cccgcagaga cccaagcctg aagacttttg cccctttgag
720tgtgctatgg ctactgtcta tgacattggt catgacgccg tcatgtatgt
ggccgaaagg 780aaaatctcct gggcccctcg tggcggggat gaagtgaaat
ttgaagctgt ccccggggag 840ttgaagttga ttgcgaaccg gctccgcacc
tccttcccgc cccaccacac agtggacatg 900tctaagttcg ccttcacagc
ccctgggtgt ggtgtttcta tgcgggtcga acgccaacac 960ggctgccttc
ccgctgacac tgtccctgaa ggcaactgct ggtggagctt gtttgacttg
1020cttccactgg aagttcagaa caaagaaatt cgccatgcta accaatttgg
ctaccagacc 1080aagcatggtg tctctggcaa gtacctacag cggaggctgc
aagttaatgg tctccgagca 1140gtaactgacc taaacggacc tatcgtcgta
cagtacttct tcgttaagga gagttggatc 1200cgccatttga aactggcggg
agaacccagc tactctgggt ttgaggacct cctcagaata 1260agggttgagc
ctaacacgtc gccattggct gacaaggaag aaaaaatttt ccggtttggc
1320agtcacaagt ggtacggcgc tggaaagaga gcaagaaaag cacgctcttg
tgcgactgct 1380acagtcgctg gccgcgcttt gtccgttcgt gaaacccggc
aggccaagga gcacgaggtt 1440gccggcgcca acaaggctga gcacctcaaa
cactactccc cgcctgccga agggaattgt 1500ggttggcact gcatttccgc
catcgccaac cggatggtga attccaaatt tgaaaccacc 1560cttcccgaaa
gagtgagacc tccagatgac tgggctactg acgaggatct tgtgaatgcc
1620atccaaatcc tcagactccc tgcggcctta gacaggaacg gtgcttgtac
tagcgccaag 1680tacgtactta agctggaagg tgagcattgg actgtcactg
tgacccctgg gatgtcccct 1740tctttgctcc ctcttgaatg tgttcagggc
tgttgtgggc acaagggcgg tcttggttcc 1800ccagatgcag tcgaggtctc
cggatttgac cctgcctgcc ttgaccggct ggctgaggtg 1860atgcacctgc
ctagcagtgc tatcccagcc gctctggccg aaatgtctgg cgattccgat
1920cgttcggctt ctccggtcac caccgtgtgg actgtttcgc agttctttgc
ccgtcacagc 1980ggagggaatc accctgacca agtgcgctta gggaaaatta
tcagcctttg tcaggtgatt 2040gaggactgct gctgttccca gaacaaaacc
aaccgggtca ccccggagga ggtcgcagca 2100aagattgacc tgtacctccg
tggtgcaaca aatcttgaag aatgcttggc caggcttgag 2160aaagcgcgcc
cgccacgcgt aatcgacacc ttctttgatt gggatgttgt gctccctggg
2220gttgaggcgg caacccagac gatcaagctg ccccaggtca accagtgtcg
tgctctggtc 2280cctgttgtga ctcaaaagtc cttggacaac aactcggtcc
ccctgaccgc cttttcactg 2340gctaactact actaccgtgc gcaaggtgac
gaagttcgtc accgtgaaag actaaccgcc 2400gtgctctcca agttggaaaa
ggttgttcga gaagaatatg ggctcatgcc aaccgagcct 2460ggtccacggc
ccacactgcc acgcgggctc gacgaactca aagcccagat ggaggaggac
2520ttgctgaaac tggctaacgc ccagacgact tcggacatga tggcctgggc
agtcgagcag 2580gttgacctaa aaacttgggt caagaactac ccgcggtgga
caccaccacc ccctccgcca 2640aaagttcagc ctcgaaaaac gaagcctgtc
aagagcttgc cggagagaaa gcctgtcccc 2700gccccgcgca ggaaggttgg
gtccgattgt ggcagcccgg tttcattagg cggcgatgtc 2760cctaacagtt
gggaagattt ggctgttagt agcccctttg atctcccgac cccacctgag
2820ccggcaacac cttcaagtga gctggtgatt gtgtcctcac cgcaatgcat
cttcaggccg 2880gcgacaccct tgagtgagcc ggctccaatt cccgcacctc
gcggaactgt gtctcgaccg 2940gtgacaccct tgagtgagcc gatccctgtg
cccgcaccgc ggcgtaagtt tcagcaggtg 3000aaaagattga gttcggcggc
ggcaatccca ccgtaccaga acgagcccct ggatttgtct 3060gcttcctcac
agactgaata tgaggcctct cccccagcac cgccgcagag cgggggcgtt
3120ctgggagtag aggggcatga agctgaggaa accctgagtg aaatctcgga
catgtcgggt 3180aacattaaac ctgcgtccgt gtcatcaagc agctccttgt
ccagcgtgag aatcacacgc 3240ccaaaatact cagctcaagc catcatcgac
tcgggcgggc cctgcagtgg gcatctccaa 3300gaggtaaagg aaacatgcct
tagtgtcatg cgcgaggcat gtgatgcgac taagcttgat 3360gaccctgcta
cgcaggaatg gctttctcgc atgtgggatc gggtggacat gctgacttgg
3420cgcaacacgt ctgtttacca ggcgatttgc accttagatg gcaggttaaa
gttcctccca 3480aaaatgatac tcgagacacc gccgccctat ccgtgtgagt
ttgtgatgat gcctcacacg 3540cctgcacctt ccgtaggtgc ggagagcgac
cttaccattg gctcagttgc tactgaagat 3600gttccacgca tcctcgagaa
aatagaaaat gtcggcgaga tggccaacca gggacccttg 3660gccttctccg
aggataaacc ggtagatgac caacttgtca acgacccccg gatatcgtcg
3720cggaggcctg acgagagcac atcagctccg tccgcaggca caggtggcgc
cggctctttt 3780accgatttgc cgccttcaga tggcgcggat gcggacgggg
gggggccgtt tcggacggta 3840aaaagaaaag ctgaaaggct ctttgaccaa
ctgagccgtc aggtttttga cctcgtctcc 3900catctccctg ttttcttctc
acgccttttc taccctggcg gtggttattc tccgggtgat 3960tggggttttg
cagcttttac tctattgtgc ctctttttat gttacagtta cccagccttt
4020ggtattgctc ccctcttggg tgtgttttct gggtcttctc ggcgcgttcg
aatgggggtt 4080tttggctgct ggttggcttt tgctgttggt ctgttcaagc
ctgtgtccga cccagtcggc 4140gctgcttgtg agtttgactc gccagagtgt
agaaacatcc ttcattcttt tgagcttctc 4200aaaccttggg accctgttcg
cagccttgtt gtgggccccg tcggtctcgg tcttgccatt 4260cttggcaggt
tactgggcgg ggcacgctgc atctggcact ttttgcttag gcttggcatt
4320gttgcagact gtatcttggc tggagcttac gtgctttctc aaggtaggtg
taaaaagtgc 4380tggggatctt gtataagaac tgctcctaat gaggtcgctt
ttaacgtgtt tcctttcaca 4440cgtgcgacca ggtcgtcact tatcgacctg
tgcgatcggt tttgtgcgcc aaaaggaatg 4500gaccccattt ttctcgccac
tgggtggcgc gggtgctggg ccggccgaag ccccattgag 4560caaccctctg
aaaaacccat cgcgtttgcc caattggatg aaaagaagat tacggctagg
4620actgtggtcg cccagcctta tgaccccaac caagccgtaa agtgcttgcg
ggtattgcag 4680gcgggtgggg cgatggtggc taaggcggtc ccaaaagtgg
tcaaggtttc cgctgttcca 4740ttccgagccc ccttctttcc cactggagtg
aaagttgacc ctgattgcag ggtcgtggtt 4800gaccctgaca ctttcactgc
agctctccgg tctggctact ccaccacaaa cctcgtcctt 4860ggtgtagggg
actttgccca gctgaatgga ttaaaaatca ggcaaatttc caagccttca
4920gggggaggcc cacatctcat ggctgccctg catgttgcct gctcgatggc
tctgcacatg 4980cttgctggga tttatgtgac tgcggtgggt tcttgcggca
ccggcaccaa cgacccgtgg 5040tgcgctaacc cgtttgccgt ccctggctac
ggacctggct ctctctgcac gtccagattg 5100tgcatttacc aacacggcct
taccctgccc ttgacagcac ttgtggcggg attcggtatt 5160caagaaattg
ccttggtcgt tttgattttt gtttccatcg gaggcatggc tcataggttg
5220agctgtaagg ctgacatgct gtgtgttttg cttgcaattg ccagctatgt
ttgggtacct 5280cttacctggt tgctttgtgt gtttccttgc tggttgcgct
gtttttcttt gcaccccctc 5340accatcctat ggttggtgtt tttcttgatt
tctgtgaata tgccttcagg aatcttggcc 5400atggtgttgt tggtttctct
ttggcttctt ggtcgttata ctaatgttgc tggccttgtc 5460accccctacg
acattcatca ttacaccagt ggcccccgcg gtgttgccgc cttggctacc
5520gcaccagatg ggacctactt ggccgctgtc cgccgcgctg cgttgactgg
ccgcaccatg 5580ctgtttaccc cgtcccagct tgggtctctt cttgagggtg
ctttcagaac tcgaaagccc 5640tcactgaaca ccgtcaatgt gatcgggtcc
tccatgggct ctggcggggt gtttaccatc 5700gacgggaaag tcaagtgcgt
aactgccgca catgtcctta cgggcaattc agctcgggtt 5760tccggggtcg
gcttcaatca aatgcttgac tttgacgtaa agggagattt cgctatagct
5820gattgcccga attggcaagg ggctgccccc aagacccaat tctgcacgga
tggatggact 5880ggccgtgcct attggctaac atcctctggc gtcgaacccg
gcgtcattgg aaaaggattc 5940gccttctgct tcaccgcatg tggcgattcc
gggtccccag tgatcaccga ggccggtgag 6000cttgtcggcg ttcacacggg
atcgaataaa caaggggggg gcattgttac gcgcccctca 6060ggccagtttt
gtaatgtggc acccatcaag ctaagcgaat taagtgaatt ctttgctggg
6120cctaaggtcc cgctcggtga tgtgaaggtc ggcagccaca taattaaaga
cataagcgag 6180gtgccttcag atctttgtgc cttgcttgct gccaaacctg
aactggaagg aggcctctcc 6240accgtccaac ttctttgtgt gttttttctc
ctgtggagaa tgatgggaca tgcctggacg 6300cccttggttg ctgtgagttt
ctttattttg aatgaggttc tcccagccgt cctggtccgg 6360agtgttttct
cctttggaat gtttgtgctc tcctggctca cgccatggtc tgcgcaagtt
6420ctgatgatca ggcttctaac agcagctctt aacaggaaca gatggtcact
tgcctttttc 6480agcctcggtg cagtgaccgg ttttgtcgca gatcttgcgg
ccactcaggg gcatccgttg 6540caggcagtga tgaatttgag cacctatgca
ttcctgcctc ggatgatggt tgtgacctca 6600ccagtcccag tgatcacgtg
tggtgtcgtg cacctacttg ccatcatttt gtacttgttt 6660aagtaccgtg
gcctgcacca tatccttgtt ggcgatggag tgttctctgc ggctttcttc
6720ttgagatact ttgccgaggg aaagttgagg gaaggggtgt cgcaatcctg
cggaatgaat 6780catgagtctc tgactggtgc cctcgctatg agactcaatg
acgaggactt ggatttcctt 6840atgaaatgga ctgattttaa gtgctttgtt
tctgcgtcca acatgaggaa tgcagcgggt 6900caatttatcg aggctgccta
tgctaaagca cttagagtag aactggccca gttggtgcag 6960gttgataaag
ttcgaggtac tttggccaaa cttgaagctt ttgctgatac cgtggcacct
7020caactctcgc ccggtgacat tgttgtcgct ctccgccaca cgcctgtggg
cagtatcttc 7080gacctaaagg ttggtatcac caagcatacc ctccaagcca
ttgagaccag agtccttgct 7140gggtccaaaa tgaccgtggc gcgcgtcgtc
gacccgaccc ccacgccccc acccgcaccc 7200gtgcccatcc ccctcccacc
gaaagttctg gagaatggcc ccaacgcttg gggggatgag 7260gaccgtttga
ataagaagaa gaggcgcagg atggaagccc tcggcatcta tgttatgggc
7320gggaaaaagt accagaaatt ttgggacaag aattccggtg atgtgtttta
tgaggaggtc 7380cataataaca cagatgagtg ggagtgtctc agagttggcg
accctgccga ctttgaccct 7440gagaagggaa ctctgtgtgg acatgtcacc
attgaaaaca aggcttacca tgtttacacc 7500tccccatctg gtaagaagtt
cttggtcccc gtcaacccag agaatggaag agttcaatgg 7560gaagctgcaa
agctttccgt ggagcaggcc ctaggtatga tgaatgtcga cggcgaactg
7620actgccaaag aactggagaa actgaaaaga ataattgaca aactccaggg
cctgactaag 7680gagcagtgtt taaactgcta gccgccagcg acttgacccg
ctgtggtcgc ggcggcttgg 7740ttgttactga aacagcggta aaaatagtca
aatttcacaa ccggaccttc accctgggac 7800ctgtgaattt aaaagtggcc
agtgaggttg agctaaaaga cgcggttgag cacaaccaac 7860acccggttgc
gagaccgatc gatggtggag ttgtgctcct gcgttccgcg gttccttcgc
7920ttatagacgt cttgatctcc ggtgctgatg catctcccaa gttacttgcc
catcacgggc 7980cgggaaacac tgggatcgat ggcacgctct gggattttga
gtccgaagcc actaaagagg 8040aagtcgcact cagtgcgcaa ataatacagg
cttgtgacat taggcgcggc gacgctcctg 8100aaattggtct cccttacaag
ctgcaccctg ttaggggtaa ccctgagcgg gtgaaaggag 8160ttctgcagaa
tacaaggttt ggagacatac cttacaaaac ccccagtgac actggaagcc
8220cagtgcacgc ggctgcctgc cttacgccca acgccactcc ggtgactgat
gggcgctccg 8280tcttggccac gaccatgccc cccgggtttg agttatatgt
accgaccata ccagcgtctg 8340tccttgatta ccttgactct aggcctgact
gccctaaact gctgacagag cacggctgca 8400aagatgccgc actgaaagac
ctctctaaat
atgacttgtc cacccaaggc tttgttttac 8460ctggagttct tcgccttgtg
cggaaatacc tgtttgccca tgtaggtaag tgcccacccg 8520ttcatcggcc
ttctacttac cctgctaaga attctatggc tggaataaat gggaacaggt
8580tcccaaccaa ggacattcag agcgtccctg aaatcgacgt tctgtgcgca
caggctgtgc 8640gagaaaactg gcaaactgtc accccttgta ctcttaagaa
acagtattgc gggaagaaga 8700agactaggac catactcggc accaataact
tcatcgcact agcccaccga gcagtgttga 8760gtggtgttac ccagggcttc
atgaaaaagg cgtttaactc gcccatcgcc ctcggaaaga 8820acaagtttaa
ggagctacag actccggtcc tgggcaggtg ccttgaagct gatctcgcat
8880cctgcgatcg atccacgcct gcaattgtcc gctggtttgc cgccaacctt
ctttatgaac 8940ttgcctgtgc tgaagagcat ctaccgtcgt acgtgctgaa
ctgctgccac gacttactgg 9000tcacgcagtc cggcgcagtg actaagagag
gtggcctgtc gtctggcgac ccgatcacct 9060ctgtgtctaa caccatttat
agtttggtga tctatgcaca gcatatggtg cttagttact 9120tcaaaagtgg
tcacccccat ggccttctgt tcttacaaga ccagctaaag tttgaggaca
9180tgctcaaggt tcaacccctg atcgtctatt cggacgacct cgtgctgtat
gccgagtctc 9240ccaccatgcc aaactatcac tggtgggttg aacatctgaa
tttgatgctg gggtttcaga 9300cggacccaaa gaagacagca ataacagact
cgccatcatt tctaggctgt agaataataa 9360atgggcgcca gctagtcccc
aaccgtgaca ggatcctcgc ggccctcgcc tatcacatga 9420aggcgagtaa
tgtttctgaa tactatgcct cagcggctgc aatactcatg gacagctgtg
9480cttgtttgga gtatgatcct gaatggtttg aagaacttgt agttggaata
gcgcagtgcg 9540cccgcaagga cggctacagc tttcccggca cgccgttctt
catgtccatg tgggaaaaac 9600tcaggtccaa ttatgagggg aagaagtcga
gagtgtgcgg gtactgcggg gccccggccc 9660cgtacgctac tgcctgtggc
ctcgacgtct gcatttacca cacccacttc caccagcatt 9720gtccagtcac
aatctggtgt ggccatccag cgggttctgg ttcttgtagt gagtgcaaat
9780cccctgtagg gaaaggcaca agccctttag acgaggtgct ggaacaagtc
ccgtataagc 9840ccccacggac cgttatcatg catgtggagc agggtctcac
cccccttgat ccaggtagat 9900accaaactcg ccgcggatta gtctctgtca
ggcgtggaat taggggaaat gaagttgaac 9960taccagacgg tgattatgct
agcaccgcct tgctccctac ctgcaaagag atcaacatgg 10020tcgctgtcgc
ttccaatgta ttgcgcagca ggttcatcat cggcccaccc ggtgctggga
10080aaacatactg gctccttcaa caggtccagg atggtgatgt tatttacaca
ccaactcacc 10140agaccatgct tgacatgatt agggctttgg ggacgtgccg
gttcaacgtc ccggcaggca 10200caacgctgca attccccgtc ccctcccgca
ccggtccgtg ggttcgcatc ctagccggcg 10260gttggtgtcc tggcaagaat
tccttcctag atgaagcagc gtattgcaat caccttgatg 10320ttttgaggct
tcttagtaaa actaccctca cctgtctagg agacttcaag caactccacc
10380cagtgggttt tgattctcat tgctatgttt ttgacatcat gcctcaaact
caactgaaga 10440ccatctggag gtttggacag aatatctgtg atgccattca
gccagattac agggacaaac 10500tcatgtccat ggtcaacaca acccgtgtga
cccacgtgga aaaacctgtc aggtatgggc 10560aggtcctcac cccctaccac
agggaccgag aggacgacgc catcactatt gactccagtc 10620aaggcgccac
attcgatgtg gttacattgc atttgcccac taaagattca ctcaacaggc
10680aaagagccct tgttgccatc accagggcaa gacacgctat ctttgtgtat
gacccacaca 10740ggcagctgca gggcttgttt gatcttcctg caaaaggcac
acccgtcaac ctcgcagtgc 10800accgcgacgg gcagctgatc gtgctggata
gaaataacaa agaatgcacg gttgctcagg 10860ctctaggcaa cggggataaa
tttagggcca cagataagcg tgttgtagat tctctccgcg 10920ccatttgtgc
tgatctagaa gggtcgagct ctccgctccc caaggtcgca cacaacttgg
10980gattttattt ctcacctgat ttaacacagt ttgctaaact cccagtagaa
cttgcacctc 11040actggcccgt ggtgacaacc cagaacaatg aaaagtggcc
agatcggctg gttgccagcc 11100ttcgccctat ccataaatac agccgcgcgt
gcatcggtgc cggctatatg gtgggccctt 11160cggtgtttct aggcactcct
ggggtcgtgt catactatct cacaaaattt gttaagggcg 11220aggctcaatt
gcttccggag acggttttca gcaccggccg aattgaggta gactgccggg
11280aatatcttga tgatcgggag cgagaagttg ctgcgtccct cccacacgct
ttcattggcg 11340acgtcaaagg cactaccgtt ggaggatgtc atcatgtcac
ctccagatac ctcccgcgcg 11400tccttcccaa ggaatcagtt gcggtagtcg
gggtttcaag ccccggaaaa gccgcgaaag 11460cattgtgcac actgacagat
gtgtacctcc cagatcttga agcctatctc cacccggaga 11520cccagtccaa
gtgctggaaa atgatgttgg acttcaaaga agttcgacta atggtctgga
11580aagacaaaac agcctatttc caacttgaag gtcgctattt cacctggtat
cagcttgcca 11640gctatgcctc gtacatccgt gttcctgtca actctacggt
gtacttggac ccctgcatgg 11700gccccgccct ttgcaacagg agagtcgtcg
ggtccaccca ctggggggct gacctcgcgg 11760tcacccctta tgattacggc
gctaaaatta tcctgtctag cgcgtaccat ggtgaaatgc 11820cccccggata
caaaattctg gcgtgcgcgg agttctcgtt ggatgaccca gttaagtaca
11880aacatacctg ggggtttgaa tcggatacag cgtatctgta tgagttcacc
gggaacggtg 11940aggactggga ggattacaat gatgcgtttc gtgcgcgcca
ggaagggaaa atttacaagg 12000ccactgccac cagcttgaag ttttattttc
ccccgggccc tgtcattgaa ccaactttag 12060gcctgaattg aaatgaaatg
gggtccatgc aaagcctttt ttacaaaatt ggccaacttt 12120ttgtggatgc
tttcacggag ttcttggtgt ccattgttga tatcattata tttttggcca
12180ttttgtttgg cttcaccatc gccggttggc tggtggtctt ttgcatcaga
ttggtttgct 12240ccgcgatact ccgtacgcgc tctgccattc actctgagca
attacagaag atcttatgag 12300gcctttcttt cccagtgcca agtggacatt
cccacctggg gaactaaaca tcctttgggg 12360atgctttggc accataaggt
gtcaaccctg attgatgaaa tggtgtcgcg tcgaatgtac 12420cgcatcatgg
aaaaagcagg gcaggctgcc tggaaacagg tggtgagcga ggctacgctg
12480tctcgcatta gtagtttgga tgtggtggct cattttcagc atctagccgc
cattgaagcc 12540gagacctgta aatatttggc ctcccggctg cccatgctac
acaacctgcg catgacaggt 12600tcaaatgtaa ccatagtgta taatagcact
ttgaatcagg tgtttgctat ttttccaacc 12660cctggttccc ggccaaagct
tcatgatttt cagcaatggt taatagctgt acattcctcc 12720atattttcct
ctgttgcagc ttcttgtact ctttttgttg tgctgtggtt gcgggttcca
12780atactacgta ctgtttttgg tttccgctgg ttaggggcaa tttttctttc
gaactcacag 12840tgaattacac ggtgtgtcca ccttgcctca cccggcaagc
agccacagag atctacgaac 12900ccggtaggtc tctttggtgc aggatagggt
atgaccgatg tgaggaggat gatcatgacg 12960agctagggtt tatggtaccg
cctggcctct ccagcgaagg ccacttgact agtgtttacg 13020cctggttggc
gttcttgtcc ttcagctaca cggcccagtt ccatcccgag atattcggga
13080tagggaatgt gagtcgagtt tatgttgaca tcaaacatca actcatctgc
gccgaacatg 13140acgggcagaa caccaccttg cctcgtcatg acaacatttc
agccgtgttt cagacctatt 13200accaacatca agtcgacggc ggcaattggt
ttcacctaga atggcttcgt cccttctttt 13260cctcgtggtt ggttttaaat
gtctcttggt ttctcaggcg ttcgcctgca aaccatgttt 13320cagttcgagt
cttgcagata ttaagaccaa caccaccgca gcggcaggct ttgctgtcct
13380ccaagacatc agttgcctta ggcatcgcga ctcggcctct gaggcgattc
gcaaaatccc 13440tcagtgccgt acggcgatag ggacacccgt gtatgttacc
atcacagcca atgtgacaga 13500tgagaattat ttacattctt ctgatctcct
catgctttct tcttgccttt tctatgcttc 13560tgagatgagt gaaaagggat
ttaaggtggt atttggcaat gtgtcaggca tcgtggctgt 13620gtgtgtcaat
tttaccagct acgtccaaca tgtcaaggag tttacccaac gctccctggt
13680ggtcgaccat gtgcggttgc tccatttcat gacacctgag accatgaggt
gggcaactgt 13740tttagcctgt ctttttgcca ttctgttggc aatttgaatg
tttaagtatg ttggagaaat 13800gcttgaccgc gggctgttgc tcgcaattgc
tttctttgtg gtgtatcgtg ccgttctgtt 13860ttgctgtgct cgccaacgcc
agcaacgaca gcagctccca tctacagctg atttacaact 13920tgacgctatg
tgagctgaat ggcacagact ggctagctaa caaatttgat tgggcagtgg
13980agagttttgt catctttccc gttttgactc acattgtctc ctatggtgcc
ctcactacca 14040gccatttcct tgacacagtc gctttagtca ctgtgtctac
cgccgggttt gttcacgggc 14100ggtatgtcct aagtagcatc tacgcggtct
gtgccctggc tgcgttgact tgcttcgtca 14160ttaggtttgc aaagaattgc
atgtcctggc gctacgcgtg taccagatat accaactttc 14220ttctggacac
taagggcgga ctctatcgtt ggcggtcgcc tgtcatcata gagaaaaggg
14280gcaaagttga ggtcgaaggt catctgatcg acctcaaaag agttgtgctt
gatggttccg 14340tggcaacccc tataaccaga gtttcagcgg aacaatgggg
tcgtccttag atgacttctg 14400tcatgatagc acggctccag aaaaggtgct
tttggcgttt tctattacct acacgccagt 14460gatgatatat gccctaaagg
tgagtcgcgg ccgactgcta gggcttctgc accttttgat 14520cttcctgaat
tgtgcttkca ccttcgggta catgactttc gcgcactttc agagtacaaa
14580taaggtcgcg ctcactatgg gagcagtagt tgcactcctt tggkgggtgt
actcagccat 14640agaaacctgg aaattcatca cctccagatg ccgtttgtgc
ttgctaggcc gcaagtacat 14700tctggcccct gcccaccacg ttgaaagtgc
cgcagggttt catccgattg cggcaaatga 14760taaccacgca tttgtcgtcc
ggcgtcccgg ctccactacg gtcaacggca cattggtgcc 14820cgggttaaaa
agcctcgtgt tgggtggcag aaaagctgtt aaacagggag tggtaaacct
14880tgtcaaatat gccaaataac aacggcaagc agcagaagag aaagaagggg
gatggccagc 14940cagtcaatca gctgtgccag atgctgggta agatcatcgc
tcagcaaaac cagtccagag 15000gcaagggacc gggaaagaaa aataagaaga
aaaacccgga gaagccccat tttcctctag 15060cgactgaaga tgatgtcaga
catcacttta cccctagtga gcggcaattg tgtctgtcgt 15120caatccagac
cgcctttaat caaggcgctg ggacttgcac cctgtcagat tcagggagga
15180taagttacac tgtggagttt agtttgccta cgcatcatac tgtgcgcctg
atccgcgtca 15240cagcatcacc ctcagcatga tgggctggca ttcttgaggc
atctcagtgt atgaattgga 15300agaatgtatg gtgaatggca ctgattgaca
ttgtgcctct aagtcaccta ttcaattagg 15360gcgaccgtgt gggggtgaga
tttaattggc gagaaccatg cggccgaaat ta 1541214123PRTArtificial
SequenceUS pMA C2 14Met Pro Asn Asn Asn Gly Lys Gln Gln Lys Arg Lys
Lys Gly Asp Gly 1 5 10 15 Gln Pro Val Asn Gln Leu Cys Gln Met Leu
Gly Lys Ile Ile Ala Gln 20 25 30 Gln Asn Gln Ser Arg Gly Lys Gly
Pro Gly Lys Lys Asn Lys Lys Lys 35 40 45 Asn Pro Glu Lys Pro His
Phe Pro Leu Ala Thr Glu Asp Asp Val Arg 50 55 60 His His Phe Thr
Pro Ser Glu Arg Gln Leu Cys Leu Ser Ser Ile Gln 65 70 75 80 Thr Ala
Phe Asn Gln Gly Ala Gly Thr Cys Thr Leu Ser Asp Ser Gly 85 90 95
Arg Ile Ser Tyr Thr Val Glu Phe Ser Leu Pro Thr His His Thr Val 100
105 110 Arg Leu Ile Arg Val Thr Ala Ser Pro Ser Ala 115 120
15123PRTArtificial SequenceORF7-pBAD 15Met Pro Asn Asn Asn Gly Lys
Gln Gln Lys Arg Lys Lys Gly Asp Gly 1 5 10 15 Gln Pro Val Asn Gln
Leu Cys Gln Met Leu Gly Lys Ile Ile Ala Gln 20 25 30 Gln Asn Gln
Ser Arg Gly Lys Gly Pro Gly Lys Lys Asn Lys Lys Lys 35 40 45 Asn
Pro Glu Lys Pro His Phe Pro Leu Ala Thr Glu Asp Asp Val Arg 50 55
60 His His Phe Thr Pro Ser Glu Arg Gln Leu Cys Leu Ser Ser Ile Gln
65 70 75 80 Thr Ala Phe Asn Gln Gly Ala Gly Thr Cys Thr Leu Ser Asp
Ser Gly 85 90 95 Arg Ile Ser Tyr Thr Val Glu Phe Ser Leu Pro Thr
His His Thr Val 100 105 110 Arg Leu Ile Arg Val Thr Ala Ser Pro Ser
Ala 115 120 16123PRTArtificial Sequence01NP1.2 16Met Pro Asn Asn
Asn Gly Lys Gln Gln Lys Arg Lys Lys Gly Asp Gly 1 5 10 15 Gln Pro
Val Asn Gln Leu Cys Gln Met Leu Gly Lys Ile Ile Ala Gln 20 25 30
Gln Asn Gln Ser Arg Gly Lys Gly Pro Gly Lys Lys Asn Lys Lys Lys 35
40 45 Asn Pro Glu Lys Pro His Phe Pro Leu Ala Thr Glu Asp Asp Val
Arg 50 55 60 His His Phe Thr Pro Ser Glu Arg Gln Leu Cys Leu Ser
Ser Ile Gln 65 70 75 80 Thr Ala Phe Asn Gln Gly Ala Gly Thr Cys Thr
Leu Ser Asp Ser Gly 85 90 95 Arg Ile Ser Tyr Thr Val Glu Phe Ser
Leu Pro Thr His His Thr Val 100 105 110 Arg Leu Ile Arg Val Thr Ala
Ser Pro Ser Ala 115 120 17123PRTArtificial Sequence01NP1 17Met Pro
Asn Asn Asn Gly Lys Gln Gln Lys Arg Lys Lys Gly Asp Gly 1 5 10 15
Gln Pro Val Asn Gln Leu Cys Gln Met Leu Gly Lys Ile Ile Ala Gln 20
25 30 Gln Asn Gln Ser Arg Gly Lys Gly Pro Gly Lys Lys Asn Lys Lys
Lys 35 40 45 Asn Pro Glu Lys Pro His Phe Pro Leu Ala Thr Glu Asp
Asp Val Arg 50 55 60 His His Phe Thr Pro Ser Glu Arg Gln Leu Cys
Leu Ser Ser Ile Gln 65 70 75 80 Thr Ala Phe Asn Gln Gly Ala Gly Thr
Cys Thr Leu Ser Asp Ser Gly 85 90 95 Arg Ile Ser Tyr Thr Val Glu
Phe Ser Leu Pro Thr His His Thr Val 100 105 110 Arg Leu Ile Arg Val
Thr Ala Ser Pro Ser Ala 115 120 183463DNAArtificial SequencepQE31
18ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
60attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
120ggatctcacc atcaccatca ccatacggat ccgcatgcga gctcggtacc
ccgggtcgac 180ctgcagccaa gcttaattag ctgagcttgg actcctgttg
atagatccag taatgacctc 240agaactccat ctggatttgt tcagaacgct
cggttgccgc cgggcgtttt ttattggtga 300gaatccaagc tagcttggcg
agattttcag gagctaagga agctaaaatg gagaaaaaaa 360tcactggata
taccaccgtt gatatatccc aatggcatcg taaagaacat tttgaggcat
420ttcagtcagt tgctcaatgt acctataacc agaccgttca gctggatatt
acggcctttt 480taaagaccgt aaagaaaaat aagcacaagt tttatccggc
ctttattcac attcttgccc 540gcctgatgaa tgctcatccg gaatttcgta
tggcaatgaa agacggtgag ctggtgatat 600gggatagtgt tcacccttgt
tacaccgttt tccatgagca aactgaaacg ttttcatcgc 660tctggagtga
ataccacgac gatttccggc agtttctaca catatattcg caagatgtgg
720cgtgttacgg tgaaaacctg gcctatttcc ctaaagggtt tattgagaat
atgtttttcg 780tctcagccaa tccctgggtg agtttcacca gttttgattt
aaacgtggcc aatatggaca 840acttcttcgc ccccgttttc accatgggca
aatattatac gcaaggcgac aaggtgctga 900tgccgctggc gattcaggtt
catcatgccg tttgtgatgg cttccatgtc ggcagaatgc 960ttaatgaatt
acaacagtac tgcgatgagt ggcagggcgg ggcgtaattt ttttaaggca
1020gttattggtg cccttaaacg cctggggtaa tgactctcta gcttgaggca
tcaaataaaa 1080cgaaaggctc agtcgaaaga ctgggccttt cgttttatct
gttgtttgtc ggtgaacgct 1140ctcctgagta ggacaaatcc gccctctaga
gctgcctcgc gcgtttcggt gatgacggtg 1200aaaacctctg acacatgcag
ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg 1260ggagcagaca
agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca
1320tgacccagtc acgtagcgat agcggagtgt atactggctt aactatgcgg
catcagagca 1380gattgtactg agagtgcacc atatgcggtg tgaaataccg
cacagatgcg taaggagaaa 1440ataccgcatc aggcgctctt ccgcttcctc
gctcactgac tcgctgcgct cggtcgttcg 1500gctgcggcga gcggtatcag
ctcactcaaa ggcggtaata cggttatcca cagaatcagg 1560ggataacgca
ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa
1620ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc
acaaaaatcg 1680acgctcaagt cagaggtggc gaaacccgac aggactataa
agataccagg cgtttccccc 1740tggaagctcc ctcgtgcgct ctcctgttcc
gaccctgccg cttaccggat acctgtccgc 1800ctttctccct tcgggaagcg
tggcgctttc tcatagctca cgctgtaggt atctcagttc 1860ggtgtaggtc
gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg
1920ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg
acttatcgcc 1980actggcagca gccactggta acaggattag cagagcgagg
tatgtaggcg gtgctacaga 2040gttcttgaag tggtggccta actacggcta
cactagaagg acagtatttg gtatctgcgc 2100tctgctgaag ccagttacct
tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 2160caccgctggt
agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg
2220atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga
acgaaaactc 2280acgttaaggg attttggtca tgagattatc aaaaaggatc
ttcacctaga tccttttaaa 2340ttaaaaatga agttttaaat caatctaaag
tatatatgag taaacttggt ctgacagtta 2400ccaatgctta atcagtgagg
cacctatctc agcgatctgt ctatttcgtt catccatagt 2460tgcctgactc
cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag
2520tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag
caataaacca 2580gccagccgga agggccgagc gcagaagtgg tcctgcaact
ttatccgcct ccatccagtc 2640tattaattgt tgccgggaag ctagagtaag
tagttcgcca gttaatagtt tgcgcaacgt 2700tgttgccatt gctacaggca
tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag 2760ctccggttcc
caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt
2820tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt
tatcactcat 2880ggttatggca gcactgcata attctcttac tgtcatgcca
tccgtaagat gcttttctgt 2940gactggtgag tactcaacca agtcattctg
agaatagtgt atgcggcgac cgagttgctc 3000ttgcccggcg tcaatacggg
ataataccgc gccacatagc agaactttaa aagtgctcat 3060cattggaaaa
cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag
3120ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt
tcaccagcgt 3180ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa
aagggaataa gggcgacacg 3240gaaatgttga atactcatac tcttcctttt
tcaatattat tgaagcattt atcagggtta 3300ttgtctcatg agcggataca
tatttgaatg tatttagaaa aataaacaaa taggggttcc 3360gcgcacattt
ccccgaaaag tgccacctga cgtctaagaa accattatta tcatgacatt
3420aacctataaa aataggcgta tcacgaggcc ctttcgtctt cac 3463
* * * * *