U.S. patent application number 15/603487 was filed with the patent office on 2018-08-23 for composition having lactobacillus plantarum strain gmnl-662 for promoting bone regrowth.
The applicant listed for this patent is GENMONT BIOTECH INC.. Invention is credited to Yi-Hsing Chen, Chia-Hsuan Chou, Chi Chien Lin, Wan-Hua Tsai.
Application Number | 20180236015 15/603487 |
Document ID | / |
Family ID | 61023037 |
Filed Date | 2018-08-23 |
United States Patent
Application |
20180236015 |
Kind Code |
A1 |
Chen; Yi-Hsing ; et
al. |
August 23, 2018 |
COMPOSITION HAVING LACTOBACILLUS PLANTARUM STRAIN GMNL-662 FOR
PROMOTING BONE REGROWTH
Abstract
A composition having Lactobacillus Plantarum strain GMNL-662 for
promoting bone regrowth is provided. The Lactobacillus Plantarum
strain GMNL-662 has an ability to promote the expression of
osteogenic genes, inhibit the expression of osteoclast related
genes, and promote the expression of osteogenesis-related cytokine
TGF-.beta., so that the bone loss is improved.
Inventors: |
Chen; Yi-Hsing; (Tainan
City, TW) ; Tsai; Wan-Hua; (Kaohsiung City, TW)
; Chou; Chia-Hsuan; (Tainan City, TW) ; Lin; Chi
Chien; (Taichung City, TW) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GENMONT BIOTECH INC. |
Tainan City |
|
TW |
|
|
Family ID: |
61023037 |
Appl. No.: |
15/603487 |
Filed: |
May 24, 2017 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A23V 2002/00 20130101;
C12N 1/20 20130101; C12R 1/25 20130101; A23L 33/135 20160801; A23Y
2220/67 20130101; A61K 35/747 20130101 |
International
Class: |
A61K 35/747 20060101
A61K035/747; A23L 33/135 20060101 A23L033/135 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 20, 2017 |
TW |
106105625 |
Claims
1. A composition for promoting bone regrowth, comprising
Lactobacillus Plantarum strain GMNL-662 deposited in the China
Center for Type Culture Collection (CCTCC) with an accession number
of CCTCC M2016571.
2. The composition according to claim 1, wherein the Lactobacillus
Plantarum strain GMNL-662 is a viable strain or a dead strain.
3. The composition according to claim 1, wherein the Lactobacillus
Plantarum strain GMNL-662 has an ability to improve the expression
of osteogenic genes.
4. The composition according to claim 3, wherein the osteogenic
genes comprise osteocalcin gene.
5. The composition according to claim 1, wherein the composition is
a pharmaceutical composition, a nutritional supplement, a health
food, a medical food, or the combination thereof.
6. The composition according to claim 1, wherein the composition is
applied to slow down bone loss.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of the filing date of
Taiwan patent application No. 106105625, filed on Feb. 20, 2017,
the disclosure of which is incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to a composition including
Lactobacillus Plantarum strain GMNL-662 for promoting bone
regrowth, and in particular relates to a composition including
Lactobacillus Plantarum strain GMNL-662 which has an ability of
increasing the expression of osteogenic genes.
BACKGROUND OF THE INVENTION
[0003] Osteoporosis is a kind of systemic skeletal disease, which
includes bone loss and bone tissue microstructure deterioration,
resulting in bone fragility and risk of fracture.
[0004] During bone remodeling process, the bone formation of
osteoblasts and bone resorption of osteoclast maintain the dynamic
balance of bone tissue together. Once the bone resorption is over
bone formation, bone loss will caused, and finally result in
osteoporosis. In general, osteoporosis can be divided into
postmenopausal osteoporosis and senile osteoporosis. Postmenopausal
osteoporosis is common in women after menopause, due to the rapid
reduction of estrogen in the female body, so that the osteoclast
activity is increased to absorb the trabecular bone, and ultimately
make the trabecular bone thinning, broken off, and make the number
of the bone cells reduced or discontinuous, resulting in reduction
of bone strength. Senile osteoporosis is caused by the decline of
osteogenic cell function, insufficient calcium and vitamin D
intake, intestinal absorption dysfunction, leading to reduced bone
synthesis, thick loose cortical bone, and trabecular bone
disappeared, so that bone strength is significantly reduced.
[0005] According to its mechanism, the current drugs for prevention
and treatment of osteoporosis and fracture can be divided into
anti-osteoclast or anti-loss drugs, bone formation or promoting
osteoblast drugs, and mixed type drugs. Anti-osteoclast drugs
include calcium, vitamin D, calcitonin, bisphosphonates, estrogen
receptor modulators, sex hormones, osteoclast enzyme inhibitors,
RANKL monoclonal antibody. The mixed type drug is currently
strontium salt only. The drugs that control osteoporosis are
accompanied by some side effects. It is found in the clinical
trials that the use of drugs in combination has no addition effect,
but will resist each other, or increase the incidence or strength
of the side effects. Therefore, the current guidelines for various
prevention and treatment of osteoporosis are not recommended to use
two anti-loss reagents, or use one anti-loss reagent together with
one promoting osteoblast reagent.
[0006] The osteoporotic drugs clinically used in the elderly and
menopausal women, such as Fosamax, Tevanate, Covaxin
(bisphosphonates drugs), will cause serious necrosis of jaw bone
joint if users do not pay attention to oral hygiene, or the users
are subject to tooth extraction, dental implant surgery. Recent
studies have also found that it may cause the adverse reactions
including atypical femoral fracture.
[0007] Although some literatures state that certain specific
probiotic strains, for example: L. reuteri ATCC PTA 6475; L.
paracasei DSM13434; L. plantarum DSM 15312, DSM 15313 and B.
longum, have the ability to reduce bone loss in ovariectomized
rats, but they are applied in the form of live bacteria in the
experiments, and it is found that the ability to slow down bone
loss is achieved by reducing inflammation. The abovementioned
strains do not have the ability to make bone regeneration, and thus
the treatments are more passive.
[0008] It is therefore necessary to provide a composition for
promoting bone regrowth, in order to solve the problems existing in
the conventional technology as described above.
SUMMARY OF THE INVENTION
[0009] A primary object of the present invention is to provide a
composition comprising Lactobacillus Plantarum strain GMNL-662 for
promoting bone regrowth. The Lactobacillus Plantarum strain
GMNL-662 can be administrated through any possible pathway in order
to enter the digestive system to increase the gene expression of
osteogenesis-related cytokine TGF-.beta. and osteocalcin, and
inhibit the expression of osteoclast related genes (such as
TRAP-5), thereby solving the problem caused by bone loss.
[0010] To achieve the above objects, the present invention provides
a composition for promoting bone regrowth, comprising Lactobacillus
Plantarum strain GMNL-662 deposited in the China Center for Type
Culture Collection (CCTCC) with an accession number of CCTCC M
2016571.
[0011] In one embodiment of the present invention, the
Lactobacillus Plantarum strain GMNL-662 is a viable strain or a
dead strain.
[0012] In one embodiment of the present invention, the
Lactobacillus Plantarum strain GMNL-662 has an ability to improve
the expression of osteogenic genes.
[0013] In one embodiment of the present invention, the osteogenic
genes comprise osteocalcin gene.
[0014] In one embodiment of the present invention, the composition
is a pharmaceutical composition, a nutritional supplement, a health
food, a medical food, or the combination thereof.
[0015] In one embodiment of the present invention, the composition
is applied to slow down bone loss.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 is a diagram showing the expression of cytokine
TGF-.beta. of each group in the experiment 2 according to one
embodiment of the present invention.
[0017] FIG. 2 is a diagram showing the expression of
osteogenesis-related gene osteocalcin of each group in the
experiment 2 according to one embodiment of the present
invention.
[0018] FIG. 3 is a diagram showing the expression of osteoclast
related gene TRAP-5 of each group in the experiment 2 according to
one embodiment of the present invention.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0019] The structure and the technical means adopted by the present
invention to achieve the above and other objects can be best
understood by referring to the following detailed description of
the preferred embodiments. Furthermore, if there is no specific
description in the invention, singular terms such as "a", "one",
and "the" include the plural number. For example, "a compound" or
"at least one compound" may include a plurality of compounds, and
the mixtures thereof. If there is no specific description in the
invention, "%" means "weight percentage (wt %)", and the numerical
range (e.g. 10%-11% of A) contains the upper and lower limit (i.e.
10%.ltoreq.A.ltoreq.11%). If the lower limit is not defined in the
range (e.g. less than, or below 0.2% of B), it means that the lower
limit may be 0 (i.e. 0%.ltoreq.B.ltoreq.0.2%). The proportion of
"weight percent" of each component can be replaced by the
proportion of "weight portion" thereof. The abovementioned terms
are used to describe and understand the present invention, but the
present invention is not limited thereto.
[0020] One embodiment of the present invention provides a
Lactobacillus Plantarum strain for promoting bone regrowth. The
Lactobacillus Plantarum strain is referred to as Lactobacillus
Plantarum strain GMNL-662, which is deposited in the China Center
for Type Culture Collection (CCTCC) with an accession number of
CCTCC M2016571.
[0021] One embodiment of the present invention provides a
composition for promoting bone regrowth, comprising the
abovementioned Lactobacillus Plantarum strain GMNL-662. Preferably,
the composition can be a pharmaceutical composition, a nutritional
supplement, a health food, a medical food, or the combination
thereof. The composition can be formed in various form based on the
effectively or convenience. In addition, the composition is
preferably administrated by means of food to enter the digestive
system, and can stimulate the expression of osteogenic genes,
inhibiting the expression of osteoclast related genes, and
promoting the expression of osteogenesis-related cytokine
TGF-.beta. to slow down bone loss.
[0022] The Lactobacillus Plantarum strain GMNL-662 in the
abovementioned embodiments is one of a plurality of isolates mainly
isolated from human intestines. The primers (SEQ ID NO: 1 and SEQ
ID NO: 2) listed in Table 1 are used to perform PCR to reproduce
16S rDNA segments of each isolate, and then sequencing the 16S rDNA
segment of each isolate. After sequencing, a 16S rDNA gene sequence
of one of the isolates can be obtained as below (SEQ ID NO: 3);
subsequently, from the comparison results on the NCBI website, it
shows that the 16S rDNA sequences of the isolates are similar to
that of the Lactobacillus Plantarum strains with identities all
over 99%, so that the strain GMNL-662 indeed belongs to the
Lactobacillus Plantarum genus.
TABLE-US-00001 TABLE 1 PCR primer SEQ Primer ID NO: SEQ PAF 1 AGA
GTT TGA TCC TGG CTC AG 536R 2 GTA TTA CCG CGG CTG CTG
TABLE-US-00002 TABLE 2 NCBI NO Description Identity KT236093.1
Lactobacillus plantarum KLB 410 99% KT962240.1 Lactobacillus
plantarum USIM03 99% KT025848.1 Lactobacillus plantarum KF 99%
KR818164.1 Lactobacillus plantarum KF9 99%
[0023] A complete 16S rDNA sequence (SEQ ID NO: 3) of the
Lactobacillus Plantarum strain GMNL-662 is listed as below:
TABLE-US-00003 GCCGTTGGCGTCGGATACATGCATGTCGTACGAACTCTGGTATTGATTGG
TGCTTGCATCATGATTTACATTTGAGTGAGTGGCGAACTGGTGAGTAACA
CGTGGGAAACCTGCCCAGAAGCGGGGGATAACACCTGGAAACAGATGCTA
ATACCGCATAACAACTTGGACCGCATGGTCCGAGCTTGAAAGATGGCTTC
GGCTATCACTTTTGGATGGTCCCGCGGCGTATTAGCTAGATGGTGGGGTA
ACGGCTCACCATGGCAATGATACGTAGCCGACCTGAGAGGGTAATCGGCC
ACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGG
AATCTTCCACAATGACGAAAGTCTGATGGAGCAACGCCGCGTGAGTGAAG
AAGGGTTTCGGCTCGTAAAACTCTGTTGTTAAAGAAGAACATATCTGAGA
GTAACTGTTCAGGTATTGACGGTATTTAACCAGAAAGCCACGGCTAACTA
CGTGCCAGCAGCCGCGGGTAAACAC
[0024] A fermentation test to the Lactobacillus Plantarum strain
GMNL-662 is carried out to obtain the results shown in Table 3.
TABLE-US-00004 TABLE 3 Fermentation Test Strips No. carbohydrates
substrate GMNL-662 0 CONTROL - 1 Glycerol - 2 Erythritol - 3
D-Arabinose - 4 L-Arabinose - 5 D-Ribose + 6 D-Xylose - 7 L-Xylose
- 8 D-Adonitol - 9 Methyl-.beta.-D-Xylopyranoside - 10 D-Galactose
+ 11 D-Glucose + 12 D-Fructose + 13 D-Mannose + 14 L-Sorbose - 15
L-Rhamnose - 16 Dulcitol - 17 Inositol - 18 D-Mannitol + 19
D-Sorbitol + 20 Methyl-.alpha.-D-mannopyranoside + 21
Methyl-.alpha.-D-glucopyranoside - 22 N-Acetyl glucosamine + 23
Amygdalin + 24 Arbutin + 25 Esculin ferric citrate - 26 Salicin +
27 D-Cellobiose + 28 D-Maltose + 29 D-Lactose (bovine origin) + 30
D-Melibiose + 31 D-Saccharose (sucrose) + 32 D-Trehalose + 33
Inulin - 34 D-Melezitose + 35 D-Raffinose - 36 Amidon (starch) - 37
Glycogen - 38 Xylitol - 39 Gentiobiose + 40 D-Turanose + 41
D-Lyxose - 42 D-Tagatose - 43 D-Fucose - 44 L-Fucose - 45
D-Arabitol - 46 L-Arabitol - 47 Potassium gluconate + 48 Potassium
2-ketogluconate - 49 Potassium 5-ketogluconate - -: negative; +:
positive
[0025] To verify the bone regrowth properties of the Lactobacillus
Plantarum GMNL-662 according to the present invention, and to
confirm that the bone loss can be improved, experiments 1 to 3 are
executed.
Experiment 1: Bone Tissue Analysis
[0026] Strain: Lactobacillus plantarum Strain GMNL-662
[0027] Strain Treatment:
[0028] (1) preparation of viable bacteria: Inoculating the
Lactobacillus Fermentum GMNL-296 from a frozen tube to 1 ml of MRS
broth, and standing under 37.degree. C. for aerobically incubating
for 20 hours. The next day, adding 15 .mu.l culture solution into
1.5 ml of MRS broth (1% secondary activation), and then standing
under 37.degree. C. for aerobically incubating for 20 hours.
Estimating the bacteria number by using OD 600 to adjust the
bacteria concentration to 8.times.10.sup.7 CFU/ml.
[0029] (2) preparation of dead bacteria: Inoculating the
Lactobacillus Plantarum strain GMNL-662 from a frozen tube to 1 ml
of MRS broth, and standing under 37.degree. C. for aerobically
incubating for 20 hours. The next day, adding 15 .mu.l culture
solution into 1.5 ml of MRS broth (1% secondary activation), and
then standing under 37.degree. C. for aerobically incubating for 20
hours. Estimating the bacteria number by using OD 600 to adjust the
bacteria concentration to 4.1.times.10.sup.8 CFU/ml.
[0030] Osteoporosis Mouse Model:
[0031] 8-week-old ICR female rats were purchased from BioLASCO
Taiwan and ovariectomy was performed when they were 9 week-old.
Mice were underwent anesthesia and were ovariectomized through back
on both sides of the ovaries. All groups were given the test
substance by means of tube feed at 4 days after surgery. The groups
were divided into a sham operation group (control group, their
abdominal cavity were cut but their ovaries were not removed); and
4 groups ovariectomized group (Ovariectomy; OVX). When the mice
were sacrificed, the ovarian tissues were checked and confirmed
whether the removal of ovarian was successful. The experimental
results of the mice under failure operation were not used. In the 4
groups of the ovariectomized mice, one group was the vehicle group
(H.sub.2O group), and one group was the positive drug group
(anti-osteoporosis drug Alendronate). Alendronate was formulated
with deionized water at a concentration of 0.25 mg/ml. The mice
were given 0.1 ml per 10 grams of body weight and 4 times a week.
The remaining two groups were fed with 0.2 ml of alive GMNL-662
(strain concentration is 8.times.10.sup.7 cfu/ml; daily dose of the
mouse is 1.6.times.10.sup.7 cfu/mouse, the human dose is
4.times.10.sup.9 cfu/60 kg adult), and 0.2 ml of dead GMNL-662
(strain concentration is 4.1.times.10.sup.8 cfu/ml; daily dose of
the mouse is 8.2.times.10.sup.7 cells/mouse, the human dose is
2.times.10.sup.10 cells/60 kg adult). The two groups were fed with
tube one time every day, continued for 28 days, the mice were
anesthetized and sacrificed for intraperitoneal cephalic vein
sampling, and each femur was removed for analysis.
[0032] Analysis Method:
[0033] The backbone of the right femur far from the end was taken a
computer tomography by a micro computed tomography (SkyScan 1076,
Kontizh, Belgium, with resolution of 18 .mu.m), and the trabecular
bone volume ratio (i.e. bone volume/l tissue volume) is analyzed by
a software. The analyzed position was selected to include the area
of 100 pieces under the growth plate excluding cortical bone. The
bone mineral density analysis was applied to the same area. The
obtained data in the experiments were analyzed with two-way
analysis of variance, and executed T-test statistical analysis. All
data were presented as mean.+-.SD. After comparisons, the
abovementioned groups were analyzed statistically and noted by
different marks to represent the statistically significant
differences (* represents p<0.05: ** represents p<0.01). See
Table 4 and Table 5, showing results of the experiment 1.
TABLE-US-00005 TABLE 4 Trabecular bone volume ratio (BV/TV, bone
volume/tissue volume) BV/TV (%) OVX + OVX + OVX + GMNL-662 GMNL-662
OVX + Control H.sub.2O alive dead Alendronate 42.12 .+-. 30.9 .+-.
36.92 .+-. 36.8 .+-. 34.88 .+-. 2.4** 1.1 1.7** 1.2** 0.9**
[0034] From table 4, after removing the ovarian, the trabecular
bone volume ratio in (OVX+H.sub.2O) group (disease group) was lower
than the control group, which means that the osteoporosis animal
model was successful. Comparing the alive GMNL-662 group with the
dead GMNL-662 group, it can be found that BV/TV thereof were higher
than the disease group, which means that the GMNL-662 indeed slows
down bone loss in a certain degree after removing the ovarian.
Alendronate was positive control group which also had protective
effect against bone loss. The two groups of the tube fed GMNL-662
strains even have slightly better protective effects than the
anti-osteoporosis drug Alendronate.
TABLE-US-00006 TABLE 5 Femur bone mineral density (BMD, excluding
cortical bone) BMD (g/cm.sup.3) OVX + OVX + OVX + GMNL-662 GMNL-662
OVX + Control H.sub.2O Alive Dead Alendronate 0.502 .+-. 0.344 .+-.
0.488 .+-. 0.474 .+-. 0.426 .+-. 0.04** 0.04 0.02** 0.01**
0.02*
[0035] From table 5, it can be noted that the disease group
(OVX+H.sub.2O) has lower BMD than the control group; in the groups
of alive and dead GMNL-662 strains, the BMD is significantly higher
than the BMD in the disease group (OVX+H.sub.2O). That is, both of
the two groups of the tube fed GMNL-662 strains can slow down bone
loss of the mice after removing the ovarian.
Experiment 2: Effects of GMNL-662 on Osteogenic Genes, Cytokines,
and Osteoclast Genes
[0036] Extraction of tibial RNA: The left femur of the mice were
removed, cut into small pieces with scissor, and an appropriate
amount of liquid nitrogen was added to grind the bones quickly. The
ground bone powder was added to 0.5 ml TRIzol.RTM. Reagent to
extract RNA; 0.1 ml chloroform was then added thereto to turn up
and down 15 times. The solution was placed at room temperature to
react for 5 minutes, followed by centrifugalized and extracted the
upper layer to new microcentrifuge tubes (eppendorf); 0.25 ml
isopropanol was added thereto and the solution was placed at room
temperature for 10 minutes and then centrifugalized; the
supernatant was removed and the precipitate was washed with 0.5 ml
75% ethanol; after the precipitate was dried, 20-50 .mu.l DEPC
water was added to dissolve the precipitate and the RNA
concentration was measured.
[0037] RNA reverse transcription cDNA: 1-5 .mu.g RNA was obtained
and RNase-free water was added therein to 10 .mu.l; additionally,
10.times. Random primer (2 .mu.l), 10 mM dNTP (1 .mu.l) were added,
at 65.degree. C. for 5 minutes, and on ice for 2-3 minutes; after
first stage interaction, additional 5.times.RT buffer (4 .mu.l),
0.1M DTT (1 .mu.l), RNase inhibitor (Invitrogen, RNaseOUT.TM., 1
.mu.l), RT enzyme (Invitrogen, SuperScript.RTM. III, 1 .mu.l) were
added and mixed at room temperature for 5 minutes, and then placed
at 50.degree. C. for 60 minutes, at 70.degree. C. for 15 minutes,
to proceed the enzyme reverse transcription.
[0038] Tibial cDNA in real-time PCR analysis: 1 .mu.l tibial cDNA
was obtained and added 4 .mu.l of 1 .mu.M F+R primers
(forward/reverse primers are listed below), and 5 .mu.l of 2.times.
Rotor-Gene SYBR Green PCR Master Mix (Qiagen, Cat. 204076), placed
into Q-PCR apparatus to react. The relative expression of
TGF-.beta. and RANKL were obtained by deducting the GAPDH
itself.
TABLE-US-00007 TABLE 6 Primers TGF-.beta. Forward SEQ ID NO: 4
GAGTAACGCTTTCCG primer GAGTC TGF-.beta. Reverse SEQ ID NO: 5
ACAGTCACCAGCATC primer TCAGC Osteocalcin SEQ ID NO: 6
ACGGTATCACTATTT Forward primer AGGACCTGTG Osteocalcin SEQ ID NO: 7
ACTTTATTTTGGAGC Reverse primer TGCTGTGAC TRAP-5 Forward SEQ ID NO:
8 GACGATGGGCGCTGA primer CTTCA TRAP-5 Reverse SEQ ID NO: 9
GCGCTTGGAGATCTT primer AGAGT GAPDH Forward SEQ ID NO: 10
GCACAGTCAAGGCCG primer AGAAT GAPDH Reverse SEQ ID NO: 11
GCCTTCTCCATGGTG primer GTGAA
[0039] Analysis method: The obtained data in the experiments were
analyzed with two-way analysis of variance, and executed T-test
statistical analysis. The abovementioned groups were analyzed
statistically compared with the OVX+H.sub.2O group, wherein *
represents p<0.05; ** represents p<0.01.
[0040] As shown in FIG. 1, GMNL-662 alive strain and dead strain
both can increase the expression of cytokine TGF-.beta. which can
protect bone against bone loss. Comparing the mice of the control
group with the disease group (OVX+H.sub.2O), the expression of bone
regrowth related cytokine TGF-.beta. of the disease group is
significantly reduced; the mice fed with GMNL-662 (GMNL-662 alive
strain and dead strain) have significant increased expression of
TGF-.beta. compared with the disease group (OVX+H.sub.2O). This
result means that the GMNL-662 strain has ability of promoting the
expression of TGF-.beta. so as to slow down bone loss.
[0041] Next, as shown in FIG. 2, in the groups of the mice given
GMNL-662 (alive or dead strain) after removing ovarian, the
expression of osteocalcin gene are higher than the disease group
(OVX+H.sub.2O), which means that the GMNL-662 strains, no matter
the strain is dead or alive, have ability to promote the expression
of osteogenic genes, especially osteocalcin gene, thereby slowing
down bone loss.
[0042] Refer to FIG. 3, it can be observed apparently, compared
with the mice in the sham operation group (Control), the expression
of osteoclast related genes TRAP-5 in the disease group
(OVX+H.sub.2O) is increased; while in the groups of GMNL-662 alive
strain and dead strain, the expression of osteoclast related genes
TRAP-5 is significantly lower than that in the disease group
(OVX+H.sub.2O). That is, GMNL-662 strains have ability to inhibit
the expression of osteoclast genes so as to slow down bone
loss.
[0043] In summary, according to the above results, it is certain
that the Lactobacillus Plantarum strain GMNL-662 according to the
present invention, no matter the stains are viable or dead, can
significantly slow down bone loss of the mice after removing
ovarian in the bone tissue analysis (Trabecular bone volume ratio,
BV/TV) of animal experiments and bone mineral density (BMD). It is
also noted that the GMNL-662 strain has abilities of promoting the
expression of osteogenic genes (Osteocalcin gene), inhibiting the
expression of osteoclast related genes (TRAP-5), and promoting the
expression of osteogenesis-related cytokine TGF-.beta., so that the
bone loss can be improved. In addition, it can be found in the
experiment results that the GMNL-662 has protective effect better
than the anti-osteoporosis drug "Alendronate". Alendronate has been
found to have many side effects, including heart disease, stubborn
pain, jaw osteonecrosis, fractures, and esophageal cancer.
Therefore, Lactobacillus Plantarum strain GMNL-662, safe and with
no side effects, is applicable to slow down bone loss. It should be
a better choice for the menopausal women in considering the future
prevention and improvement of bone loss.
[0044] The present invention has been described with preferred
embodiments thereof and it is understood that many changes and
modifications to the described embodiments can be carried out
without departing from the scope and the spirit of the invention
that is intended to be limited only by the appended claims.
Sequence CWU 1
1
11120DNAArtificial SequencePAF primer 1agagtttgat cctggctcag
20218DNAArtificial Sequence536R primer 2gtattaccgc ggctgctg
183525DNAArtificial SequenceSequencing Primer 3gccgttggcg
tcggatacat gcatgtcgta cgaactctgg tattgattgg tgcttgcatc 60atgatttaca
tttgagtgag tggcgaactg gtgagtaaca cgtgggaaac ctgcccagaa
120gcgggggata acacctggaa acagatgcta ataccgcata acaacttgga
ccgcatggtc 180cgagcttgaa agatggcttc ggctatcact tttggatggt
cccgcggcgt attagctaga 240tggtggggta acggctcacc atggcaatga
tacgtagccg acctgagagg gtaatcggcc 300acattgggac tgagacacgg
cccaaactcc tacgggaggc agcagtaggg aatcttccac 360aatgacgaaa
gtctgatgga gcaacgccgc gtgagtgaag aagggtttcg gctcgtaaaa
420ctctgttgtt aaagaagaac atatctgaga gtaactgttc aggtattgac
ggtatttaac 480cagaaagcca cggctaacta cgtgccagca gccgcgggta aacac
525420DNAArtificial SequenceTGF beta Forward primer 4gagtaacgct
ttccggagtc 20520DNAArtificial SequenceTGF beta Reverse primer
5acagtcacca gcatctcagc 20625DNAArtificial SequenceOsteocalcin
Forward primer 6acggtatcac tatttaggac ctgtg 25724DNAArtificial
SequenceOsteocalcin Reverse primer 7actttatttt ggagctgctg tgac
24820DNAArtificial SequenceTRAP-5 Forward primer 8gacgatgggc
gctgacttca 20920DNAArtificial SequenceTRAP-5 Reverse primer
9gcgcttggag atcttagagt 201020DNAArtificial SequenceGAPDH Forward
primer 10gcacagtcaa ggccgagaat 201120DNAArtificial SequenceGAPDH
Reverse primer 11gccttctcca tggtggtgaa 20
* * * * *