U.S. patent application number 15/890290 was filed with the patent office on 2018-08-16 for factor ix polypeptides and methods of use thereof.
This patent application is currently assigned to Bioverativ Therapeutics Inc.. The applicant listed for this patent is Bioverativ Therapeutics Inc.. Invention is credited to HAIYAN JIANG, ROBERT T. PETERS, Glenn PIERCE, SAMANTHA TRUEX.
Application Number | 20180228879 15/890290 |
Document ID | / |
Family ID | 45441870 |
Filed Date | 2018-08-16 |
United States Patent
Application |
20180228879 |
Kind Code |
A1 |
PIERCE; Glenn ; et
al. |
August 16, 2018 |
Factor IX Polypeptides and Methods of Use Thereof
Abstract
The present invention provides methods of administering Factor
IX; methods of administering chimeric and hybrid polypeptides
comprising Factor IX; polynucleotides encoding such chimeric and
hybrid polypeptides; cells comprising such polynucleotides; and
methods of producing such chimeric and hybrid polypeptides using
such cells.
Inventors: |
PIERCE; Glenn; (Cambridge,
MA) ; TRUEX; SAMANTHA; (SUDBURY, MA) ; PETERS;
ROBERT T.; (NEEDHAM, MA) ; JIANG; HAIYAN;
(BELMONT, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Bioverativ Therapeutics Inc. |
Waltham |
MA |
US |
|
|
Assignee: |
Bioverativ Therapeutics
Inc.
Waltham
MA
|
Family ID: |
45441870 |
Appl. No.: |
15/890290 |
Filed: |
February 6, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15820080 |
Nov 21, 2017 |
|
|
|
15890290 |
|
|
|
|
14982934 |
Dec 29, 2015 |
9867873 |
|
|
15820080 |
|
|
|
|
13793796 |
Mar 11, 2013 |
9233145 |
|
|
14982934 |
|
|
|
|
13809276 |
Apr 24, 2013 |
9670475 |
|
|
PCT/US2011/043569 |
Jul 11, 2011 |
|
|
|
13793796 |
|
|
|
|
61363064 |
Jul 9, 2010 |
|
|
|
61424555 |
Dec 17, 2010 |
|
|
|
61430819 |
Jan 7, 2011 |
|
|
|
61438572 |
Feb 1, 2011 |
|
|
|
61442079 |
Feb 11, 2011 |
|
|
|
61470951 |
Apr 1, 2011 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 39/39533 20130101;
C07K 2319/33 20130101; C12N 9/96 20130101; C12Y 304/21022 20130101;
A61P 7/04 20180101; C07K 2319/30 20130101; C07K 2317/21 20130101;
C12N 9/644 20130101; A61K 39/395 20130101; C07K 2317/94 20130101;
A61K 47/643 20170801; A61K 38/4846 20130101; C07K 2317/90 20130101;
A61K 9/0019 20130101; C07K 2319/31 20130101; A61K 38/38 20130101;
C07K 14/76 20130101; C07K 16/18 20130101; A61K 39/3955
20130101 |
International
Class: |
A61K 38/48 20060101
A61K038/48; C12N 9/96 20060101 C12N009/96; C07K 14/76 20060101
C07K014/76; A61K 39/395 20060101 A61K039/395; C07K 16/18 20060101
C07K016/18; A61K 9/00 20060101 A61K009/00; C12N 9/64 20060101
C12N009/64; A61K 38/38 20060101 A61K038/38; A61K 47/64 20060101
A61K047/64 |
Claims
1-121. (canceled)
122. A method of prophylactic treatment of hemophilia B in a human
subject in need thereof, comprising intravenously administering to
the subject multiple doses of about 25 IU/kg to about 50 IU/kg of a
chimeric polypeptide comprising human Factor IX (FIX) and a FcRn
binding partner (FcRn BP) at a dosing interval of about 7 days
between doses, wherein the FcRn BP is a human Fc or a human
albumin, wherein the subject exhibits a baseline-subtracted plasma
FIX activity trough level of at least 1 IU/dL, and wherein the
baseline is the lowest measured plasma Factor IX level in the
subject prior to administering the first dose of the chimeric
polypeptide.
123. The method of claim 122, wherein the dosing interval is 7
days.
124. The method of claim 122, wherein each of the multiple doses is
25 IU/kg to 40 IU/kg.
125. The method of claim 124, wherein the dosing interval is 7
days.
126. The method of claim 122, wherein each of the multiple doses is
25 IU/kg, 30 IU/kg, 35 IU/kg, 40 IU/kg, 45 IU/kg, or 50 IU/kg.
127. The method of claim 122, wherein each of the multiple doses is
25 IU/kg.
128. The method of claim 122, wherein each of the multiple doses is
30 IU/kg.
129. The method of claim 122, wherein each of the multiple doses is
35 IU/kg.
130. The method of claim 122, wherein each of the multiple doses is
40 IU/kg.
131. The method of claim 122, wherein each of the multiple doses is
45 IU/kg.
132. The method of claim 122, wherein each of the multiple doses is
50 IU/kg.
133. The method of claim 122, wherein the human FIX comprises amino
acids 1 to 415 of SEQ ID NO: 2.
134. The method of claim 122, wherein the FcRn BP is human Fc.
135. the method of claim 122, wherein the FcRn BP is human
albumin.
136. The method of claim 134, wherein the human Fc comprises amino
acids 1 to 227 of SEQ ID NO: 4.
137. The method of claim 122, wherein the chimeric polypeptide
further comprises a linker joining the human FIX and the FcRn
BP.
138. The method of claim 122, wherein the subject exhibits a
baseline-subtracted plasma FIX activity trough level above 2
IU/dL.
139. The method of claim 122, wherein the subject exhibits a
baseline-subtracted plasma FIX activity trough level above 3
IU/dL.
140. The method of claim 122, wherein the subject exhibits a
baseline-subtracted plasma FIX activity trough level above 4
IU/dL.
141. The method of claim 122, wherein the subject exhibits a
baseline-subtracted plasma FIX activity trough level above 5
IU/dL.
142. A method of prophylactic treatment of hemophilia B in a human
subject in need thereof, comprising intravenously administering to
the subject multiple doses of about 25 IU/kg to about 50 IU/kg of a
chimeric polypeptide comprising human Factor IX (FIX) and a FcRn
binding partner (FcRn BP) at a dosing interval of 7 days between
doses, wherein the FcRn BP is a human Fc, wherein the subject
exhibits a baseline-subtracted plasma FIX activity trough level of
at least 1 IU/dL, and wherein the baseline is the lowest measured
plasma Factor IX level in the subject prior to administering the
first dose of the chimeric polypeptide.
143. A method of prophylactic treatment of hemophilia B in a human
subject in need thereof, comprising intravenously administering to
the subject multiple doses of about 25 IU/kg to about 50 IU/kg of a
chimeric polypeptide comprising human Factor IX (FIX) and a FcRn
binding partner (FcRn BP) at a dosing interval of 7 days between
doses, wherein the FcRn BP is a human albumin, wherein the subject
exhibits a baseline-subtracted plasma FIX activity trough level of
at least 1 IU/dL, and wherein the baseline is the lowest measured
plasma Factor IX level in the subject prior to administering the
first dose of the chimeric polypeptide.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
application Ser. No. 15/820,080, filed Nov. 21, 2017, which is a
continuation of U.S. application Ser. No. 14/982,934, filed Dec.
29, 2015, now U.S. Pat. No. 9,867,873, which is a divisional
application of U.S. application Ser. No. 13/793,796, filed Mar. 11,
2013, now U.S. Pat. No. 9,233,145, which is a continuation
application of U.S. application Ser. No. 13/809,276, filed Apr. 24,
2013 under 35 U.S.C. .sctn. 371, now U.S. Pat. No. 9,670,475, and
which is based on International Application No. PCT/US2011/043569,
filed Jul. 11, 2011, which claims the benefit of U.S. Provisional
Application No. 61/363,064, filed Jul. 9, 2010, U.S. Provisional
Application No. 61/424,555, filed Dec. 17, 2010, U.S. Provisional
Application No. 61/430,819, filed Jan. 7, 2011, U.S. Provisional
Application No. 61/438,572, filed Feb. 1, 2011, U.S. Provisional
Application No. 61/442,079, filed Feb. 11, 2011, and U.S.
Provisional Application No. 61/470,951, filed Apr. 1, 2011, all of
which are incorporated herein by reference in their entireties.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY VIA
EFS-WEB
[0002] The content of the electronically submitted sequence listing
(Name: 4159.2730000E_SequenceListing_ST25.txt, Size: 20,446 bytes;
and Date of Creation: Feb. 6, 2018) submitted in this application
is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
Field of the Invention
[0003] The present invention relates generally to the field of
therapeutics for hemostatic disorders.
Background Art
[0004] Hemophilia B (also known as Christmas disease) is one of the
most common inherited bleeding disorders in the world. It results
in decreased in vivo and in vitro blood clotting activity and
requires extensive medical monitoring throughout the life of the
affected individual. In the absence of intervention, the afflicted
individual will suffer from spontaneous bleeding in the joints,
which produces severe pain and debilitating immobility; bleeding
into muscles results in the accumulation of blood in those tissues;
spontaneous bleeding in the throat and neck may cause asphyxiation
if not immediately treated; renal bleeding; and severe bleeding
following surgery, minor accidental injuries, or dental extractions
also are prevalent.
[0005] Normal in vivo blood coagulation at minimum requires the
serine proteases Factors II (prothrombin), VII, IX, X and XI
(soluble plasma proteins); cofactors including the transmembrane
protein tissue factor and the plasma proteins Factors V and VIII;
fibrinogen, the transglutaminase Factor XIII, phospholipid
(including activated platelets), and calcium. Additional proteins
including kallikrein, high molecular weight kininogen, and Factor
XII are required for some in vitro clotting tests, and may play a
role in vivo under pathologic conditions.
[0006] In hemophilia, blood clotting is disturbed by a lack of
certain plasma blood clotting factors. Hemophilia B is caused by a
deficiency in Factor IX that may result from either the decreased
synthesis of the Factor IX protein or a defective molecule with
reduced activity. The treatment of hemophilia occurs by replacement
of the missing clotting factor by exogenous factor concentrates
highly enriched in Factor IX. However, generating such a
concentrate from blood is fraught with technical difficulties, as
is described below.
[0007] Purification of Factor IX from plasma (plasma derived Factor
IX; pdFIX) almost exclusively yields active Factor IX. However,
such purification of factor IX from plasma is very difficult
because Factor IX is only present in low concentration in plasma (5
ug/mL. Andersson, Thrombosis Research 7: 451 459 (1975). Further,
purification from blood requires the removal or inactivation of
infectious agents such as HIV and HCV. In addition, pdFIX has a
short half-life and therefore requires frequent dosing. Recombinant
factor IX (rFIX) is also available, but suffers from the same short
half-life and need for frequent dosing (e.g., 2-3 times per week
for prophylaxis) as pdFIX. rFIX also has a lower incremental
recovery (K value) compared to pdFIX, which necessitates the use of
higher doses of rFIX than those for pdFIX.
[0008] Reduced mortality, prevention of joint damage and improved
quality of life have been important achievements due to the
development of plasma-derived and recombinant Factor IX. Prolonged
protection from bleeding would represent another key advancement in
the treatment of hemophilia B patients. However, to date, no
products that allow for prolonged protection have been developed.
Therefore, there remains a need for improved methods of treating
hemophilia due to Factor IX deficiency that are more tolerable and
more effective than current therapies.
BRIEF SUMMARY OF THE INVENTION
[0009] The present invention provides methods of administering
Factor IX using chimeric polypeptides comprising Factor IX and
hybrids of such chimeric polypeptides; chimeric polypeptides
comprising Factor IX and hybrids of such chimeric polypeptides;
polynucleotides encoding such chimeric and hybrid polypeptides;
cells comprising such polynucleotides; and methods of producing
such chimeric and hybrid polypeptides using such cells. In some
embodiments, the Factor IX chimeric polypeptide is a Factor IX FcRn
binding partner (BP) chimeric polypeptide such as a Factor IX Fc
chimeric polypeptide. In other embodiments, the Factor IX chimeric
polypeptide is a Factor IX-XTEN polypeptide.
[0010] The present invention provides a method of administering
Factor IX to a subject in need thereof, comprising administering to
the subject a dose of at least about 10, at least about 20, or at
least about 25 IU/kg of a Factor IX FcRn BP chimeric polypeptide,
e.g., a Factor IX-Fc chimeric polypeptide or a Factor IX-XTEN
chimeric polypeptide, at about a once weekly or longer dosing
interval.
[0011] In some embodiments, the plasma level of the chimeric
polypeptide reaches an average trough of at least about 1 IU/dl
after at least about 6 days in at least about 70%, at least about
80%, at least about 90%, or about 100% of a patient population or
reaches a trough of at least about 1, 2, 3, 4, or 5 IU/dl after at
least about 6 days in a subject. In some embodiments, the plasma
level of said chimeric polypeptide reaches an average trough of
about 1-5 or 1-3 IU/dl. Such trough or average trough may be
reached after about 6, about 7, about 8, about 9, about 10, about
11, about 12, about 13, about 14, about 15, about 16, about 17,
about 18, about 19, about 20, about 21, about 22, about 23, about
24, about 25, about 26, about 27, about 28, about 29, about 30,
about 31, about 32, about 33, about 34, about 35, about 36, about
37, about 38, about 39, or about 40 days.
[0012] In some embodiments, the chimeric polypeptide has greatly
reduced phosphorylation and sulfation in comparison to plasma
derived Factor IX. In some embodiments the chimeric polypeptide is
less than 25% phosphorylated and less than 25% sulfated, e.g., less
than 25% fully phosphorylated and sulfated. In some embodiments,
the chimeric polypeptide is less than about 10% phosphorylated and
less than about 9% sulfated. In some embodiments, the chimeric
polypeptide has a gamma carboxylation pattern/distribution, a gamma
carboxylation content, a sialylation pattern/distribution, and/or a
sialylation content similar to (i.e., within 10% of) or the same as
those of the Factor IX Fc chimeric polypeptide in Examples 5-6.
[0013] In some embodiments, the chimeric polypeptide has an
incremental recovery greater that 0.7 or greater than 0.75 ug/ml
(antigen). In some embodiments, the chimeric polypeptide has a mean
incremental recovery (K-Value) (activity; observed) of at least
about 0.8, at least about 0.9, or at least about 1 IU/dL per
IU/kg.
[0014] In some embodiments, the chimeric polypeptide exhibits one
or more pharmacokinetic parameters, in said patient population or
in said subject, selected from the group consisting of:
[0015] (a) a mean clearance (CL) (activity) in said patient
population of about 3.36.+-.0.93 mL/hour/kg; a mean clearance (CL)
(activity) in said patient population of about 3.0-3.72, 3.0, 3.1,
3.2, 3.3, 3.4, 3.5, 3.6, 3.7, or 3.72 mL/hour/kg; a mean clearance
(CL) (activity) in said patient population that is about 2.5 fold
lower than the clearance of a polypeptide comprising said Factor IX
without said FcRn BP; a clearance (CL) (activity) in said subject
of about 1.84-4.58 mL/hour/kg
[0016] (b) a mean mean residence time (MRT) (activity) in said
patient population of at least about 68.05.+-.11.16 hours; a mean
MRT (activity) in said patient population of about 60-78, 60, 62,
64, 66, 68, 70, 72, 74, 76, or 78 hours; a mean MRT (activity) in
said patent population that is about 3 fold longer than the mean
MRT of a polypeptide comprising said Factor IX without said FcRn
BP; a mean residence time (MRT) (activity) in said subject of about
53.1-85.8 hours; a mean residence time (MRT) (activity) in said
subject of at least about 45, about 50, about 55, about 60, about
65, about 70, about 75, about 80, about 85, or about 90 hours;
[0017] (c) a mean t.sub.1/2beta (activity) in said patient
population of about 52.5.+-.9.2 hours; a mean f.sub.1/2beta
(activity) in said patient population that is about 47-60 hours,
about 47, about 48, about 49, about 50, about 51, about 52, about
53, about 54, about 55, about 56, about 57, about 58, about 59,
about 60 hours; a mean t.sub.1/2beta (activity) in said patient
population that is about 3 fold longer than the mean t.sub.1/2beta
of a polypeptide comprising said Factor IX without said FcRn BP; a
t.sub.1/2beta (activity) in said subject of about 40-67.4, about
40, about 45, about 50, about 55, about 60, about 65, about 70, or
about 75 hours;
[0018] (d) a mean incremental recovery (K value) (activity;
observed) in said patient population of about 0.93.+-.0.18 IU/dL
per IU/kg; a mean incremental recovery (K value) (activity;
observed) in said patient population of about 0.85-1.0, about 0.85,
about 0.86, about 0.87, about 0.88, about 0.89, about 0.90, about
0.91, about 0.92, about 0.93, about 0.94, about 0.95, about 0.96,
about 0.97, about 0.98, about 0.99, about 1.0, about 1.05, about
1.10, or about 1.15 IU/dL per IU/kg; a mean incremental recovery (K
value) (activity; observed) in said patient population that is
about 24% better than the mean incremental recovery of a
polypeptide comprising said Factor IX without said FcRn BP; an
incremental recovery (K value) (activity; observed) in said subject
of about 0.62-1.17 IU/dL per IU/kg;
[0019] (e) a mean V.sub.SS (activity) in said patient population of
about 226.+-.67.76 (corrected to 69.8) mL/kg; a mean V.sub.SS
(activity) in said patient population of about 200-300, about 200,
about 210, about 220, about 230, about 240, about 250, about 260,
about 270, about 280, about 290, or about 300 mL/kg; a V.sub.SS
(activity) in said subject of about 145-365 mL/kg;
[0020] (f) a mean AUC/dose (activity) in said patient population of
about 32.44.+-.10.75 IU*h/dL per IU/kg; a mean AUC/dose (activity)
in said patient population of about 26-40, about 26, about 27,
about 28, about 29, about 30, about 31, about 32, about 33, about
34, about 35, about 36, about 37, about 38, about 39, or about 40
IU*h/dL per IU/kg; an AUC/dose in said subject of about 21.80-54.30
IU*h/dL per IU/kg.
[0021] In some embodiments, the dose of chimeric polypeptide
contains a significantly lower (10-100 fold) level (0.01-0.001%) of
activated FIX (FIXa), than currently marketed Factor IX products
such as MONONINE.TM. (pdFIX; CSL Behring)) or BENEFIX.TM. (Wyeth;
rFIX) (0.1%). Such level may be 10, 20, 30, 40, 50, 60, 70, 80, 90,
or 100 fold lower than currently marketed products, or 0.01, 0.05,
0.0033, 0.0025, 0.002, 0.00167, 0.00142, 0.00125, 0.00111, or
0.001%.
[0022] In some embodiments, the dosing interval is 6-18, 6-10,
9-18, at least 6, at least 7, at least 8, at least 9, at least 10,
at least 11, at least 12, at least 13, at least 14, at least 15, at
least 16, at least 17, or at least 18 days, weekly, two times
monthly, or one time monthly. The dosing interval may be a
prophylactic dosing interval, a fixed prophylactic dosing interval,
or an individualized prophylactic dosing interval.
[0023] The methods of the invention are practiced on a subject in
need of control or prevention of bleeding or bleeding episodes, in
need of intermittent treatment, in need of prophylactic treatment,
or in need of on-demand treatment.
[0024] The therapeutic doses that may be used in the methods of the
invention are about 25-180, about 20-180, about 20-50, about
20-100, about 10-180, about 10-50, about 10-30, or about 50-100
IU/kg. The dose may be a fixed dose or an individualized dose.
[0025] In some embodiments, the chimeric polypeptide is
administered intravenously or subcutaneously.
[0026] The subject in the methods of the invention may be a human
subject or may be a non-human mammal. Non-human mammals include
mice, dogs, primates, monkeys, cats, horses, cows, pigs, and other
domestic animals and small animals.
[0027] The chimeric polypeptide may be in the form of a hybrid
comprising a second polypeptide in association with said chimeric
polypeptide, wherein said second polypeptide comprises or consists
essentially of an FcRn BP, e.g., an Fc. The chimeric polypeptide
may be at least 90%, at least 95%, or 100% identical to the Factor
IX sequence, the Fc sequence, or both the Factor IX and Fc sequence
in Tables 2A (SEQ ID NO:2) and/or 2B (SEQ ID NO:4), with or without
the signal sequence(s) and propeptide.
[0028] The chimeric polypeptide or hybrid may be administered as
part of a pharmaceutical composition comprising at least one
excipient.
[0029] The invention also provides the above-described chimeric and
hybrid polypeptides themselves, polynucleotides encoding them, a
cultured human embryonic cells comprising the polynucleotides, and
methods of producing such chimeric and hybrid polypeptides, and the
polypeptides produced by such methods.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0030] FIG. 1. Schematic of one type of Factor IX chimeric
polypeptide, a Factor IX-Fc hybrid.
[0031] FIG. 2. Group mean FIXFc concentration versus time profiles;
nominal dose comparison.
[0032] FIG. 3. Group mean FIXFc activity versus time profiles;
nominal dose comparison.
[0033] FIG. 4. The baseline subtraction decision tree.
[0034] FIG. 5. Dose proportional increase in Cmax and AUC for FIX
activity.
[0035] FIG. 6. Estimated Therapeutic Duration of rFIXFc at 50 (A)
and 100 (B) IU/kg.
[0036] FIG. 7. Dose proportional increase in Cmax and AUC for FIX
antigen.
[0037] FIG. 8. Pharmacokinetic estimates for rFIXFc antigen at 50
(A) and 100 (B) IU/kg nominal doses.
[0038] FIG. 9. Excellent correlation between rFIXFc activity and
antigen levels. Note that due to recalculation of activity PK, as
discussed in Example 11, R.sup.2=0.946.
[0039] FIG. 10. rFIX-Fc domain structure and posttranslational
modifications. PRO: Propeptide cleaved by processing enzyme. GLA:
contains 12 .gamma.-carboxylated glutamic acid (Gla) residues. ACT
PEP: activation peptide cleaved to yield active protease. Other
modifications: N- and O-glycosylation, Asp(64)
.beta.-hydroxylation, Tyr sulfation, Ser phosphorylation.
[0040] FIG. 11. SDS-PAGE gel of purification intermediates and
purified FIXFc monomer. Samples from different steps in the
purification of FIXFc were analyzed by non-reducing SDS-PAGE. Lane
1: SeeBlue Plus Molecular Weight Markers (Invitrogen). Lane 2:
empty lane. Lane 3: Protein A load. Lane 4: Protein A eluate. Lane
5: Fractogel DEAE eluate. Lane 6: Q Seph FF eluate. Lane 7: final
bulk FIXFc. Lane 8: empty lane. Lane 9: final bulk reduced
FIXFc.
[0041] FIG. 12. Functional activity of FIXFc in FIX-deficient mice.
FIX-deficient mice were dosed intravenously with 219 IU/kg FIXFc (3
or 4 per group, 6 groups, n=23) or 200 IU/kg rFIX (3 or 4 per
group, 5 groups, n=23) at time=0. Blood samples were collected at
various times after dosing (0.25 hr to 96 hr) and analyzed for
clotting activity using FIX activity assay. * rFIX activity is
undetectable in all of the mice at time points later than 48 hr
after dosing.
[0042] FIG. 13. Whole blood clotting time of FIXFc versus
recombinant FIX in FIX-deficient mice. FIX-deficient mice (6 per
group) were dosed intravenously with 50 IU/kg FIXFc or 50 IU/kg
rFIX. Blood samples were collected before dosing and at various
times after dosing. Blood samples were incubated at 37.degree. C.
and were visually inspected for the presence of a blood clot once
per minute. The time needed for a clot to form was recorded and,
once the clotting activity returned to baseline (i.e. no clot
formation), no additional samples were obtained (samples collected
15 min to 144 hr for FIXFc or 15 min to 72 hr for rFIX).
[0043] FIG. 14. Pharmacodynamics of FIXFc in FIX-deficient mice.
FIX-deficient mice were dosed with 219 IU/kg FIXFc (5 per group, 6
groups, n=30) or 200 IU/kg rFIX (4 or 5 per group, 6 groups, n=28)
on Day 0, 4 and 8. Plasma samples were collected by cardiac
puncture at 15 min and 96 hr after each dose and clotting activity
was measured using a FIX activity assay. Plasma was also collected
by tail bleeds at 8, 24, 48, and 72 hr after each dose. FIXFc
levels were measured in all of the samples using an ELISA specific
for FIXFc. (A) Measured v. Calculated Activity. Clotting activity
for FIXFc was measured using FIX activity assay 15 min and 96 h
after three doses. The in vitro clotting activity for FIXFc was
determined to be 43.8.+-.5.4 IU/mg. Based on this activity (IU/mg)
and the measured protein levels, a calculated plasma clotting
activity level was determined for time points at 15 min, 8, 24, 48,
72 and 96 h after each dose. (B) In FIX-deficient mice treated with
up to three doses of 200 IU/kg rFIX, FIX levels were measured using
FIX-specific ELISA. Using the measured specific activities of FIXFc
and rFIX, it was possible to compare calculated clotting activity
for all samples analyzed by ELISA.
[0044] FIG. 15. Pharmacokinetics and pharmacodynamics of FIXFc in
FIX-deficient dogs. Two dogs with hemophilia B were intravenously
infused with 140 IU/kg FIXFc. Blood samples were collected at 5,
15, and 30 min, and at 1, 2, 4, 6, 8, 12, 24, 27, 30, 48, 51, 54,
72, 80, 96, 126, 144, and 168 hr. (A) A sandwich ELISA utilizing a
FIX capture antibody and Fc-HRP detection antibody was used to
measure the concentration of intact FIXFc in the Hemophilic B dog
plasma samples. (B) FIX clotting activity was measured for all time
points with respect to a standard curve generated with FIXFc. (C)
Blood collected from animals was immediately analyzed for whole
blood clotting time. Blood samples were incubated at 28.degree. C.
and were visually inspected for the presence of a clot once per
minute, and the time in which a clot formed was recorded.
[0045] FIG. 16. Pharmacokinetics of FIXFc in Cynomolgus monkeys.
Monkeys were administered a single dose (0.5, 2, and 10 mg/kg,
corresponding to approximately 25, 100 or 500 IU/kg) of FIXFc (n=2,
3, and 3, respectively). Blood samples were collected at 0.25, 0.5,
1, 8, 24, 48, 72, 96, 120, 144 and 168 hr post-dose and plasma
prepared for analysis of protein concentration by FIXFc-specific
ELISA.
[0046] FIG. 17. rFIXFc and BENEFIX.TM. show comparable activity and
dose response in whole blood from HemB mice. (A) ROTEM.RTM.
Parameters. rFIX or BENEFIX.TM. were spiked into HemB mouse blood
and clotting parameters were measured by ROTEM.RTM.. (B)-(D) Dose
response, measuring (B) CT, (C) CFT, and (D) Alpha-angle.
[0047] FIG. 18. Evaluation of acute efficacy in tail clip bleeding
model of Hemophiliac mice.
[0048] FIG. 19. (A) Blood loss following tail clip in individual
HemB mice treated with rFIXFc or BENEFIX.TM.. (B) Dose response of
rFIXFc and BENEFIX.TM. in median blood loss following tail clip in
HemB mice.
[0049] FIG. 20. Tail vein transection (TVT) bleeding model of HemB
mice: a model for the venous bleeding characteristic of severe
hemophilia patients.
[0050] FIG. 21. Prolonged activity of rFIXFc relative to
BENEFIX.TM. in treated HemB mice by whole blood ROTEM.RTM.. (A) CT,
(B) CFT, (C) Alpha-angle, and (D) Partial correlation between whole
blood clotting activity (CT) by ROTEM.RTM. versus plasma activity
by aPTT.
[0051] FIG. 22. Prolonged efficacy of FIXFc relative to BENEFIX.TM.
in tail vein transection (TVT) bleeding model of HemB mice. (A)
Survival: Survival rates were comparable in mice receiving
BENEFIX.TM. 24 hours pre TVT as in mice receiving rFIXFc 72 hours
pre TVT, and (B) Rebleed: Bleeding rates were comparable in mice
receiving BENEFIX.TM. 24 hours pre TVT as in mice receiving rFIXFc
72 hours pre TVT.
[0052] FIG. 23. Correlation between incremental recovery of rFIXFc
activity versus body weight in 12 subjects who received a single
dose of 12.5 to 100 IU/kg of rFIXFc.
[0053] FIG. 24. Monte Carlo simulation using the structural PK
model of rFIXFc activity to construct the activity-time profiles to
achieve trough of 1 IU/dL above baseline following weekly (A),
every 10 days (B), or every two week dosing regimens (C). The
median population PK parameters and relevant inter- and
intra-subject variabilities were adopted from the clinical
Phase1/2a study. 1000 subjects were simulated per dosing regimen
with 14 to 16 sampling points for each subject, and the mean.+-.SD
of the activity-time profiles of the 1000 subjects was constructed
graphically for different dosing regimens.
[0054] FIG. 25. Monte Carlo simulation for rFIXFc doses to achieve
trough of 1 IU/dL (1%), based on recalculated pharmacokinetic data.
(A) once weekly, (B) every 10 days, and (C) every two weeks.
DETAILED DESCRIPTION OF THE INVENTION
[0055] The present invention provides a method of treating Factor
IX deficiency, e.g., Hemophilia B, with Factor IX using a longer
dosing interval and/or improved pharmacokinetic parameters than is
possible with currently known Factor IX products. The present
invention also provides improved Factor IX chimeric polypeptides,
Factor IX chimeric polynucleotides, and methods of production.
[0056] "Administering," as used herein, means to give a
pharmaceutically acceptable Factor IX polypeptide of the invention
to a subject via a pharmaceutically acceptable route. Preferred
routes of administration are intravenous, e.g., intravenous
injection and intravenous infusion, e.g., via central venous
access. Additional routes of administration include subcutaneous,
intramuscular, oral, nasal, and pulmonary administration,
preferably subcutaneous. Factor IX chimeric polypeptides and hybrid
proteins may be administered as part of a pharmaceutical
composition comprising at least one excipient. Advantages of the
present invention include: improved regimen compliance; reduced
break through bleeds; increased protection of joints from bleeds;
prevention of joint damage; reduced morbidity; reduced mortality;
prolonged protection from bleeding; decreased thrombotic events;
and improved quality of life.
[0057] "Chimeric polypeptide," as used herein, means a polypeptide
that includes within it at least two polypeptides (or portions
thereof such as subsequences or peptides) from different sources.
Chimeric polypeptides may include two, three, four, five, six,
seven, or more polypeptides or portions thereof from different
sources, such as different genes, different cDNAs, or different
animal or other species. Chimeric polypeptides may include one or
more linkers joining the different polypeptides or portions
thereof. Thus, the polypeptides or portions thereof may be joined
directly or they may be joined indirectly, via linkers, or both,
within a single chimeric polypeptide. Chimeric polypeptides may
include additional peptides such as signal sequences and sequences
such as 6His and FLAG that aid in protein purification or
detection. In addition, chimeric polypeptides may have amino acid
or peptide additions to the N- and/or C-termini. Exemplary chimeric
polypeptides of the invention are Factor IX-FcRn BP chimeric
polypeptides, e.g., Factor IX-Fc chimeric polypeptides such as the
FIXFc in FIG. 1, SEQ ID NO:2 (Table 2) and Examples 1-4, with or
without its signal sequence and propeptide. Another exemplary
chimeric polypeptides of the invention include, but are not limited
to, Factor IX-XTEN chimeric polypeptides. Factor IX can be fused to
either N-terminus or C-terminus of XTEN.
[0058] The chimeric polypeptide may comprise a sequence at least
90% or at least 95% or 100% identical to the Factor IX and FcRn BP,
e.g., the Fc amino acid sequence shown in Table 2A without a signal
sequence and propeptide sequence (amino acids 1 to 642 of SEQ ID
NO:2), or alternatively, with a propeptide sequence, or
alternatively with a signal sequence and a propeptide sequence.
[0059] "Culture," "to culture" and "culturing," as used herein,
means to incubate cells under in vitro conditions that allow for
cell growth or division or to maintain cells in a living state.
"Cultured cells," as used herein, means cells that are propagated
in vitro.
[0060] "Factor IX" and "FIX," as used herein, means functional
Factor IX polypeptide in its normal role in coagulation, unless
otherwise specified. Thus, the term Factor IX includes variant
polypeptides that are functional and the polynucleotides that
encode such functional variant polypeptides. Preferred Factor IX
polypeptides are the human, bovine, porcine, canine, feline, and
murine Factor IX polypeptides. The full length polypeptide and
polynucleotide sequences of Factor IX are known, as are many
functional variants, e.g., fragments, mutants and modified
versions. Factor IX polypeptides include full-length Factor IX,
full-length Factor IX minus Met at the N-terminus, full-length
Factor IX minus the signal sequence, mature Factor IX (minus the
signal sequence and propeptide), and mature Factor IX with an
additional Met at the N-terminus. Factor IX is preferably made by
recombinant means ("recombinant Factor IX" or "rFIX"), i.e., it is
not naturally occurring or derived from plasma.
[0061] A great many functional Factor IX variants are known.
International publication number WO 02/040544 A3, which is herein
incorporated by reference in its entirety, discloses mutants that
exhibit increased resistance to inhibition by heparin at page 4,
lines 9-30 and page 15, lines 6-31. International publication
number WO 03/020764 A2, which is herein incorporated by reference
in its entirety, discloses Factor IX mutants with reduced T cell
immunogenicity in Tables 2 and 3 (on pages 14-24), and at page 12,
lines 1-27. International publication number WO 2007/149406 A2,
which is herein incorporated by reference in its entirety,
discloses functional mutant Factor IX molecules that exhibit
increased protein stability, increased in vivo and in vitro
half-life, and increased resistance to proteases at page 4, line 1
to page 19, line 11. WO 2007/149406 A2 also discloses chimeric and
other variant Factor IX molecules at page 19, line 12 to page 20,
line 9. International publication number WO 08/118507 A2, which is
herein incorporated by reference in its entirety, discloses Factor
IX mutants that exhibit increased clotting activity at page 5, line
14 to page 6, line 5. International publication number WO 09/051717
A2, which is herein incorporated by reference in its entirety,
discloses Factor IX mutants having an increased number of N-linked
and/or O-linked glycosylation sites, which results in an increased
half-life and/or recovery at page 9, line 11 to page 20, line 2.
International publication number WO 09/137254 A2, which is herein
incorporated by reference in its entirety, also discloses Factor IX
mutants with increased numbers of glycosylation sites at page 2,
paragraph [006] to page 5, paragraph [011] and page 16, paragraph
[044] to page 24, paragraph [057]. International publication number
WO 09/130198 A2, which is herein incorporated by reference in its
entirety, discloses functional mutant Factor IX molecules that have
an increased number of glycosylation sites, which result in an
increased half-life, at page 4, line 26 to page 12, line 6.
International publication number WO 09/140015 A2, which is herein
incorporated by reference in its entirety, discloses functional
Factor IX mutants that an increased number of Cys residues, which
may be used for polymer (e.g., PEG) conjugation, at page 11,
paragraph [0043] to page 13, paragraph [0053].
[0062] In addition, hundreds of non-functional mutations in Factor
IX have been identified in hemophilia patients, many of which are
disclosed in Table 1, at pages 11-14 of International publication
number WO 09/137254 A2, which is herein incorporated by reference
in its entirety. Such non-functional mutations are not included in
the invention, but provide additional guidance for which mutations
are more or less likely to result in a functional Factor IX
polypeptide.
[0063] The Factor IX (or Factor IX portion of a chimeric
polypeptide) may be at least 90% or at least 95% or 100% identical
to a Factor IX amino acid sequence shown in Table 2A without a
signal sequence and propeptide sequence (amino acids 1 to 415 of
SEQ ID NO:2), or alternatively, with a propeptide sequence, or with
a propeptide and signal sequence (full length Factor IX).
[0064] Factor IX coagulant activity is expresses as International
Unit(s) (IU). One IU of Factor IX activity corresponds
approximately to the quantity of Factor IX in one milliliter of
normal human plasma. Several assays are available for measuring
Factor IX activity, including the one stage clotting assay
(activated partial thromboplastin time; aPTT), thrombin generation
time (TGA) and rotational thromboelastometry (ROTEM.RTM.). See,
e.g., Example 3.
[0065] "FcRn binding partner," or "FcRn BP" as used herein, means
functional neonatal Fc receptor (FcRn) binding partners, unless
otherwise specified. An FcRn binding partner is any molecule that
can be specifically bound by the FcRn receptor with consequent
active transport by the FcRn receptor of the FcRn binding partner.
Thus, the term FcRn BP includes any variants of IgG Fc that are
functional. For example, the region of the Fc portion of IgG that
binds to the FcRn receptor has been described based on X-ray
crystallography (Burmeister et al. 1994, Nature 372:379,
incorporated herein by reference in its entirety). The major
contact area of the Fc with the FcRn is near the junction of the
CH2 and CH3 domains. Fc-FcRn contacts are all within a single Ig
heavy chain. FcRn BPs include whole IgG, the Fc fragment of IgG,
and other fragments of IgG that include the complete binding region
of FcRn. The major contact sites include amino acid residues 248,
250-257, 272, 285, 288, 290-291, 308-311, and 314 of the CH2 domain
and amino acid residues 385-387, 428, and 433-436 of the CH3
domain. References made to amino acid numbering of immunoglobulins
or immunoglobulin fragments, or regions, are all based on Kabat et
al. 1991, Sequences of Proteins of Immunological Interest, U. S.
Department of Public Health, Bethesda; MD, incorporated herein by
reference in its entirety. (The FcRn receptor has been isolated
from several mammalian species including humans. The sequences of
the human FcRn, rat FcRn, and mouse FcRn are known (Story et al.
1994, J. Exp. Med. 180: 2377), incorporated herein by reference in
its entirety.) An FcRn BP may comprise the CH2 and CH3 domains of
an immunoglobulin with or without the hinge region of the
immunoglobulin. Exemplary FcRn BP variants are provided in WO
2004/101740 and WO 2006/074199, incorporated herein by reference in
its entirety.
[0066] FcRn BP also include albumin and fragments thereof that bind
to the FcRn. Preferably the albumin is human albumin. Factor IX can
be fused to either the N-terminal end of the albumin or to the
C-terminal end of the albumin, provided the Factor IX component of
the Factor IX-albumin fusion protein can be processed by an
enzymatically-active proprotein convertase to yield a processed
Factor IX-containing polypeptide. Examples of albumin, e.g.,
fragments thereof, that may be used in the present invention are
known. e.g., U.S. Pat. No. 7,592,010; U.S. Pat. No. 6,686,179; and
Schulte, Thrombosis Res. 124 Suppl. 2:S6-S8 (2009), each of which
is incorporated herein by reference in its entirety.
[0067] FcRn BP (or FcRn BP portion of a chimeric polypeptide) may
contain one or more mutations, and combinations of mutations.
[0068] FcRn BP (or FcRn BP portion of a chimeric polypeptide) may
contain mutations conferring increased half-life such as M252Y,
S254T, T256E, and combinations thereof, as disclosed in Oganesyan
et al., Mol. Immunol. 46:1750 (2009), which is incorporated herein
by reference in its entirety; H433K, N434F, and combinations
thereof, as disclosed in Vaccaro et al., Nat. Biotechnol. 23:1283
(2005), which is incorporated herein by reference in its entirety;
the mutants disclosed at pages 1-2, paragraph [0012], and Examples
9 and 10 of U.S. 2009/0264627 A1, which is incorporated herein by
reference in its entirety; and the mutants disclosed at page 2,
paragraphs [0014] to [0021] of U.S. 20090163699 A1, which is
incorporated herein by reference in its entirety.
[0069] FcRn BP (or FcRn BP portion of a chimeric polypeptide) may
also include the following mutations: The Fc region of IgG can be
modified according to well recognized procedures such as site
directed mutagenesis and the like to yield modified IgG or Fc
fragments or portions thereof that will be bound by FcRn. Such
modifications include modifications remote from the FcRn contact
sites as well as modifications within the contact sites that
preserve or even enhance binding to the FcRn. For example the
following single amino acid residues in human IgG1 Fc (Fcy1) can be
substituted without significant loss of Fc binding affinity for
FcRn: P238A, S239A, K246A, K248A, D249A, M252A, T256A, E258A,
T260A, D265A, S267A, H268A, E269A, D270A, E272A, L274A, N276A,
Y278A, D280A, V282A, E283A, H285A, N286A, T289A, K290A, R292A,
E293A, E294A, Q295A, Y296F, N297A, S298A, Y300F, R301A, V303A,
V305A, T307A, L309A, Q311A, D312A, N315A, K317A, E318A, K320A,
K322A, S324A, K326A, A327Q, P329A, A330Q, A330S, P331A, P331S,
E333A, K334A, T335A, S337A, K338A, K340A, Q342A, R344A, E345A,
Q347A, R355A, E356A, M358A, T359A, K360A, N361A, Q362A, Y373A,
S375A D376A, A378Q, E380A, E382A, S383A, N384A, Q386A, E388A,
N389A, N390A, Y391F, K392A, L398A, S400A, D401A, D413A, K414A,
R416A, Q418A, Q419A, N421A, V422A, S424A, E430A, N434A, T437A,
Q438A, K439A, S440A, S444A, and K447A, where for example P238A
represents wild type proline substituted by alanine at position
number 238. In addition to alanine other amino acids may be
substituted for the wild type amino acids at the positions
specified above. Mutations may be introduced singly into Fc giving
rise to more than one hundred FcRn binding partners distinct from
native Fc. Additionally, combinations of two, three, or more of
these individual mutations may be introduced together, giving rise
to hundreds more FcRn binding partners. Certain of these mutations
may confer new functionality upon the FcRn binding partner. For
example, one embodiment incorporates N297A, removing a highly
conserved N-glycosylation site. The effect of this mutation is to
reduce immunogenicity, thereby enhancing circulating half-life of
the FcRn binding partner, and to render the FcRn binding partner
incapable of binding to FcyRI, FcyRIIA, FcyRIIB, and FcyRIIIA,
without compromising affinity for FcRn (Routledge et al. 1995,
Transplantation 60:847, which is incorporated herein by reference
in its entirety; Friend et al. 1999, Transplantation 68:1632, which
is incorporated herein by reference in its entirety; Shields et al.
1995, J. Biol. Chem. 276:6591, which is incorporated herein by
reference in its entirety). Additionally, at least three human Fc
gamma receptors appear to recognize a binding site on IgG within
the lower hinge region, generally amino acids 234-237. Therefore,
another example of new functionality and potential decreased
immunogenicity may arise from mutations of this region, as for
example by replacing amino acids 233-236 of human IgG1 "ELLG" to
the corresponding sequence from IgG2 "PVA" (with one amino acid
deletion). It has been shown that FcyRI, FcyRII, and FcyRIII which
mediate various effector functions will not bind to IgG1 when such
mutations have been introduced (Ward and Ghetie 1995, Therapeutic
Immunology 2:77, which is incorporated herein by reference in its
entirety; and Armour et al. 1999, Eur. J. Immunol. 29:2613, which
is incorporated herein by reference in its entirety). As a further
example of new functionality arising from mutations described
above, affinity for FcRn may be increased beyond that of wild type
in some instances. This increased affinity may reflect an increased
"on" rate, a decreased "off" rate or both an increased "on" rate
and a decreased "off" rate. Mutations believed to impart an
increased affinity for FcRn include T256A, T307A, E380A, and N434A
(Shields et al. 2001, J. Biol. Chem. 276:6591, which is
incorporated herein by reference in its entirety).
[0070] The FcRn BP (or FcRn BP portion of a chimeric polypeptide)
may be at least 90% or at least 95% or 100% identical to the Fc
amino acid sequence shown in Table 2A or B without a signal
sequence (amino acids 1 to 227 of SEQ ID NO:2), or alternatively,
with a signal sequence.
[0071] "Hybrid" polypeptides and proteins, as used herein, means a
combination of a chimeric polypeptide with a second polypeptide.
The chimeric polypeptide and the second polypeptide in a hybrid may
be associated with each other via non-covalent protein-protein
interactions, such as charge-charge or hydrophobic interactions.
The chimeric polypeptide and the second polypeptide in a hybrid may
be associated with each other via covalent bond(s) such as
disulfide bonds. The chimeric peptide and the second peptide may be
associated with each other via more than one type of bond, such as
non-covalent and disulfide bonds. Hybrids are described in WO
2004/101740, WO2005/001025, U.S. Pat. No. 7,404,956, U.S. Pat. No.
7,348,004, and WO 2006/074199, each of which is incorporated herein
by reference in its entirety. The second polypeptide may be a
second copy of the same chimeric polypeptide or it may be a
non-identical chimeric polypeptide. In preferred embodiments, the
second polypeptide is a polypeptide comprising an FcRn BP, e.g.,
Fc. In preferred embodiments, the chimeric polypeptide is a Factor
IX-FcRn BP, e.g., Factor IX-Fc chimeric polypeptide, and the second
polypeptide consists essentially of Fc. See, e.g., FIG. 1, Examples
1-3, and Table 2 (SEQ ID NOs:2 and 4). See, e.g., U.S. Pat. No.
7,404,956, which is incorporated herein by reference. in its
entirety.
[0072] The second polypeptide in a hybrid may comprise or consist
essentially of a sequence at least 90% or at least 95% or 100%
identical to the amino acid sequence shown in Table 2B without a
signal sequence (amino acids 1 to 227 of SEQ ID NO:4), or
alternatively, with a signal sequence.
[0073] The polypeptide of the present invention also includes
Factor IX fused to one or more XTEN polypeptides. Schellenburger et
al., Nat. Biotech. 27:1186-90 (2009), which is incorporated herein
by reference in its entirety. Factor IX can be fused to either the
N-terminal end of the XTEN polypeptide or to the C-terminal end of
the XTEN polypeptide. XTEN polypeptides include, but not limited
to, those disclosed in WO 2009/023270, WO 2010/091122, WO
2007/103515, US 2010/0189682, and US 2009/0092582, each of which is
incorporated herein by reference in its entirety.
[0074] "Dosing interval," as used herein, means the amount of time
that elapses between multiple doses being administered to a
subject. The dosing interval in the methods of the invention using
a chimeric FIX-FcRn BP, e.g., a chimeric FIX-Fc, may be at least
about one and one-half to eight times longer than the dosing
interval required for an equivalent amount (in IU/kg) of said
Factor IX without the FcRn BP, e.g., Fc portion (i.e., a
polypeptide consisting of said FIX). The dosing interval when
administering, e.g., a Factor IX-Fc chimeric polypeptide (or a
hybrid) of the invention may be at least about one and one-half
times longer than the dosing interval required for an equivalent
amount of said Factor IX without the FcRn BP, e.g., Fc, portion
(i.e., a polypeptide consisting of said Factor IX). The dosing
interval may be at least about one and one-half to eight times
longer than the dosing interval required for an equivalent amount
of said Factor IX without, e.g., the Fc portion (or a polypeptide
consisting of said Factor IX).
[0075] In some embodiments, the dosing interval is 6-18, 6-10,
9-18, at least 6, at least 7, at least 8, at least 9, at least 10,
at least 11, at least 12, at least 13, at least 14, at least 15, at
least 16, at least 17, or at least 18 days. The dosing interval may
be at least about once weekly, and may be 6-10 days, e.g., about
7-10, about 7-9, about 7-8, about 8-10, about 9-10, about 6-7,
about 8-9, about 6, about 7, about 8, about 9, or about 10
days.
[0076] The dosing interval may be 9-18 days, e.g., about 9-17,
about 9-16, about 9-15, about 9-14, about 9-13, about 9-12, about
9-11, about 9-10 days, about 10-18, about 11-18, about 12-18, about
13-18, about 14-18, about 15-18, about 16-18, about 17-18 days,
about 10-11, about 11-12, about 12-13, about 13-14, about 14-15,
about 15-16, and about 16-17 days, about 9, about 10, about 11,
about 12, about 13, about 14, about 15, about 16, about 17, or
about 18 days. The dosing interval may be about 10-14 days. The
dosing interval may be about every two weeks or twice monthly. The
dosing interval may be longer than 18 days, e.g., about 19, about
20, about 21, about 22, about 23, about 24, about 25, about 26,
about 27, about 28, about 29, about 30, about 31, about 32, about
33, about 34, about 35, about 36, about 37, about 38, about 39, or
about 40 days. The dosing interval may be a fixed interval, e.g., 7
days for 25-50 IU/kg, 10-13 days for 50-100 IU/kg, or 14 days for
100-150 IU/kg. The fixed interval and dose are determined such that
the combination of interval and dose will result in a trough of at
least about 1-5 or at least about 1-3, or at least about 1, at
least about 2, or at least about 3 IU/dl FIX activity in a
population of subjects or in an individual subject. The fixed
dosing interval may also be 7 days for 20-50 IU/kg, 10-14 days for
50-100 IU/kg, 14-16 days for 100-150 IU/kg, 7 days for 10-50 IU/kg,
10-13 days for 15-100 IU/kg, or 14-15 days for 50-150 IU/kg. The
fixed dosing interval may also be 7 days for 10-30 IU/kg, 10 days
15-50 IU/kg, 11 days 20-70 IU/kg, 12 days 25-85 IU/kg, 13 days 30
to 100 IU/kg, 14 days 40 to 125 IU/kg, and 15 days for 50-150
IU/kg.
[0077] In preferred embodiments, the dosing interval is 20 IU/kg
once weekly, 40 IU/kg every 10 days, or 100 IU/kg every two weeks
(twice monthly).
[0078] The dosing interval may, alternatively, be an individualized
interval that is determined for each subject based on
pharmacokinetic data or other information about that subject. The
individualized dose/dosing interval combination may be the same as
those for fixed interval regimens in the preceding paragraphs, or
may differ, as illustrated in the Examples. The regimen may
initially be at a fixed dosing interval, and then it may change to
an individualized dosing interval.
[0079] "On-demand treatment," as used herein, means treatment that
is intended to take place over a short course of time and is in
response to an existing condition, such as a bleeding episode, or a
perceived short term need such as planned surgery. Conditions that
may require on-demand treatment include a bleeding episode,
hemarthrosis, muscle bleed, oral bleed, hemorrhage, hemorrhage into
muscles, oral hemorrhage, trauma, trauma capitis, gastrointestinal
bleeding, intracranial hemorrhage, intra-abdominal hemorrhage,
intrathoracic hemorrhage, bone fracture, central nervous system
bleeding, bleeding in the retropharyngeal space, bleeding in the
retroperitoneal space, or bleeding in the illiopsoas sheath.
Bleeding episodes other than these are also included. The subject
may be in need of surgical prophylaxis, peri-operative management,
or treatment for surgery. Such surgeries include minor surgery,
major surgery, tooth extraction, tonsillectomy, other
dental/thoraco-facial surgeries, inguinal herniotomy, synovectomy,
total knee replacement, other joint replacement, craniotomy,
osteosynthesis, trauma surgery, intracranial surgery,
intra-abdominal surgery, intrathoracic surgery. Surgeries other
than these are also included. Additional conditions that may
require on-demand treatment include those listed in Table 26.
[0080] Additional conditions that may require on-demand treatment
include minor hemorrhage, hemarthroses, superficial muscle
hemorrhage, soft tissue hemorrhage, moderate hemorrhage,
intramuscle or soft tissue hemorrhage with dissection, mucous
membrane hemorrhage, hematuria, major hemorrhage, hemorrhage of the
pharynx, hemorrhage of the retropharynx, hemorrhage of the
retroperitonium, hemorrhage of the central nervous system, bruises,
cuts, scrapes, joint hemorrhage, nose bleed, mouth bleed, gum
bleed, intracranial bleeding, intraperitoneal bleeding, minor
spontaneous hemorrhage, bleeding after major trauma, moderate skin
bruising, or spontaneous hemorrhage into joints, muscles, internal
organs or the brain. Additional reasons for on-demand treatment
include the need for peri-operative management for surgery or
dental extraction, major surgery, extensive oral surgery, urologic
surgery, hernia surgery, orthopedic surgery such as replacement of
knee, hip, or other major joint.
Abbreviations
[0081] AUC.sub.INF Area under the concentration-time curve from
zero to infinity [0082] AUC.sub..alpha. Area under the
concentration-time curve over the distribution phase [0083]
AUC.sub..beta. Area under the concentration-time curve over the
elimination phase [0084] Alpha HL Distribution phase half-life
[0085] Beta HL Elimination phase half-life; also referred to as
t.sub.1/2 [0086] C168 Estimated FIXFc activity above baseline at
approximately 168 h after dose [0087] C.sub.max Maximum
concentration, occurring at T.sub.max [0088] CV % Percent
coefficient of variation [0089] Cl Clearance [0090] IVR in vivo
recovery (%) [0091] K-Value Incremental recovery [0092] MRT Mean
residence time [0093] N Number [0094] NC Not Calculable [0095] NR
Not Reported [0096] SD Standard Deviation [0097] SE Standard Error
[0098] TBLP1 Model-predicted time after dose when FIXFc activity
has declined to approximately 1 IU/dL above baseline [0099] TBLP3
Model-predicted time after dose when FIXFc activity has declined to
approximately 3 IU/dL above baseline [0100] TBLP5 Model-predicted
time after dose when FIXFc activity has declined to approximately 5
IU/dL above baseline [0101] V.sub.SS Volume of distribution at
steady state [0102] V.sub.l Volume of distribution of the central
compartment
[0103] Pharmacokinetic (PK) parameters include the terms above and
the following terms, which have their ordinary meaning in the art,
unless otherwise indicated. Some of the terms are explained in more
detail in the Examples. PK parameters may be based on FIX antigen
level (often denoted parenthetically herein as "antigen") or FIX
activity level (often denoted parenthetically herein as
"activity"). In the literature, PK parameters are often based on
FIX activity level due to the presence in the plasma of some
patients of endogenous, inactive FIX, which interferes with the
ability to measure administered (i.e., exogenous) FIX using
antibody against FIX. However, when FIX is administered as part of
a fusion protein containing a heterologous polypeptide such as a
FcRn BP, administered (i.e., exogenous) FIX antigen may be
accurately measured using antibody to the heterologous polypeptide.
In addition, certain PK parameters may be based on model predicted
data (often denoted parenthetically herein as "model predicted") or
on observed data (often denoted parenthetically herein as
"observed"), and preferably are based on observed data.
[0104] "Baseline," as used herein, is the lowest measured plasma
Factor IX level in a subject prior to administering a dose. In the
first-in-human study described in Example 1, the Factor IX plasma
levels were measured at two time points prior to dosing: at a
screening visit and immediately prior to dosing. Predose times were
treated as zero (baseline) for the purpose of calculations, i.e.,
to generate "baseline subtracted" data. See, e.g., FIG. 4.
Alternatively, (a) the baseline in patients whose pretreatment FIX
activity is <1%, who have no detectable FIX antigen, and have
nonsense genotypes is defined as 0%, (b) the baseline for patients
with pretreatment FIX activity <1% and who have detectable FIX
antigen is set at 0.5%, (c) the baseline for patients whose
pretreatment FIX activity is between 1-2% is Cmin (the lowest
activity throughout the PK study), and (d) the baseline for
patients whose pretreatment FIX activity is .gtoreq.2% is 2%.
Activity above the baseline pre-dosing is considered residue drug
from prior treatment, and was decayed to baseline and subtracted
from the PK data following rFIXFc dosing. See Example 11.
[0105] "Area under the plasma concentration versus time curve"
("AUC"), which, as used herein, is based upon the rate and extent
of elimination of Factor IX following administration. AUC is
determined over a specified time period, such as 12, 18, 24, 36,
48, or 72 hours, or for infinity using extrapolation based on the
slope of the curve. Unless otherwise specified herein, AUC is
determined for infinity (AUC.sub.INF). AUC may also be calculated
on a per dose basis. As with many of the other PK parameters, the
determination of AUC may be carried out in a single subject, or in
a population of subjects for which the average is calculated. In
Example 1, the mean AUC/dose in the patient population was 32.44
IU*h/dL per IU/kg and the range for individual subjects was
21.80-54.30 IU*h/dL per IU/kg. (See Table 13 for mean AUC/dose
based on activity.) Therefore, the mean AUC/dose in a patient
population may be about 26-40, about 26, about 27, about 28, about
29, about 30, about 31, about 32, about 33, about 34, about 35,
about 36, about 37, about 38, about 39, or about 40 IU*h/dL per
IU/kg. See Table 14 for AUC/dose and other AUC parameters based on
antigen.
[0106] "In vivo recovery" ("IVR") is represented by the incremental
recovery (K-value), which is the observed peak activity minus
predose level and then divided by the dose. IVR may also be
calculated on a percentage basis, as is described in the Examples.
For clarity, the units (K value or IU/dl per IU/kg versus %) are
used herein. The mean IVR can be determined in a patient
population, or the individual IVR can be determined in a single
subject. The FIXFc used in the first-in-human study described in
Example 1 exhibited a mean IVR of about 0.93 IU/dl per IU/kg in the
patient population; and an IVR in each subject that ranged from
0.62 to 1.17 IU/dl per IU/kg (Table 13). Therefore, the chimeric
polypeptide of the invention exhibits an mean IVR in a patient
population of 0.85-1.15 (e.g., about 0.85, about 0.86, about 0.87,
about 0.88, about 0.89, about 0.90, about 0.91, about 0.92, about
0.93, about 0.94, about 0.95, about 0.96, about 0.97, about 0.98,
about 0.99, about 1.0, about 1.05, about 1.10, about 1.15) and an
IVR in a subject of at least about 0.6, about 0.7, 0.8, about 0.9,
about 1.0, about 1.1, or about 1.2 IU/dl per IU/kg.
[0107] "Clearance rate" ("CL"), as used herein, is a measure of the
body's ability to eliminate a drug, and is expressed as the volume
of plasma cleared of drug over time. The FIXFc used in the study
described in Example 1 exhibited a mean CL of about 3.36 ml/hour/kg
(see Table 13), which is about 2.5 fold lower than the CL (8.2
ml/hour/kg) of a polypeptide consisting of Factor IX (BENEFIX.TM.);
the range of CL values in individual subjects was 1.84-4.58
ml/h/kg. Therefore, a chimeric polypeptide of the invention
exhibits a mean CL in a population of 3.0-3.72, 3.0, 3.1, 3.2, 3.3,
3.4, 3.5, 3.6, 3.7, or 3.72 mL/hour/kg For CL based on antigen, see
Table 14.
[0108] "Mean residence time" ("MRT"), as used herein, is a measure
of the average lifetime of drug molecules in the body. The FIXFc
used in the study described in Example 1 exhibited a mean MRT of
about 68.05 hours (see Table 13); the range of MRT values was
53.1-85.8 hours in individual subjects. Therefore, a chimeric
polypeptide of the invention exhibits a mean MRT in a population of
60-78, about 60, about 62, about 64, about 66, about 68, about 70,
about 72, about 74, about 76, or about 78 hours and a MRT in a
subject of at least about 50, about 55, about 60, about 65, about
70, about 75, about 80, about 85, or about 90 hours. For MRT based
on antigen, see Table 14.
[0109] "t.sub.1/2.beta.," or t.sub.1/2 beta" or "Beta HL," as used
herein, is half-life associated with elimination phase,
t.sub.1/2.beta.=(ln 2)/elimination rate constant associated with
the terminal phase. In the study described in Example 1, the FIXFc
used exhibited a mean t.sub.1/2z in a patient population that was
about 52.5 hours (see Table 13) and the range of t.sub.1/2 .beta.
values in individual subjects was 47-60 hours. Therefore, a
chimeric polypeptide of the invention exhibits an average
t.sub.1/2.beta. greater than about 47, about 48, about 49, about
50, about 51, about 52, about 53, about 54, about 55, about 56,
about 57, about 58, about 59, or about 60 hours. For
t.sub.1/2.beta. based on antigen, see Table 14.
[0110] "Trough," as used herein, is the lowest plasma Factor IX
activity level reached after administering a dose of chimeric
polypeptide of the invention or another Factor IX molecule and
before the next dose is administered, if any. Trough is used
interchangeably herein with "threshold." Baseline Factor IX levels
are subtracted from measured Factor IX levels to calculate the
trough level. In some embodiments, the trough is 1-5 or 1-3 IU/dl
after about 6, about 7, about 8, about 9, about 10, about 11, about
12, about 13 or about 14 days. In some embodiments, the plasma
level of the chimeric polypeptide reaches an average trough of at
least about 1 IU/dl after at least about 6 days in at least about
70%, at least about 80%, at least about 90%, or about 100% of a
patient population or reaches a trough of at least about 1, 2, 3,
4, or 5 IU/dl after at least about 6 days in a subject. In some
embodiments, the plasma level of said chimeric polypeptide reaches
an average trough of about 1-5 or 1-3 IU/dl. Such trough or average
trough may be reached after about 6, about 7, about 8, about 9,
about 10, about 11, about 12, about 13, about 14, about 15, about
16, about 17, about 18, about 19, about 20, about 21, about 22,
about 23, about 24, about 25, about 26, about 27, about 28, about
29, about 30, about 31, about 32, about 33, about 34, about 35,
about 36, about 37, about 38, about 39, or about 40 days.
[0111] "Volume of distribution at steady state (V.sub.SS)," as used
herein, is the apparent space (volume) into which a drug
distributes. V.sub.SS=the amount of drug in the body divided by the
plasma concentration at steady state. In Example 1, the mean
V.sub.SS found in the population was about 226 mL/kg and the range
for subjects was about 145-365 mL/kg. (See Table 13.) Thus, the
mean V.sub.SS in a patient population may be 200-300, about 200,
about 210, about 220, about 230, about 240, about 250, about 260,
about 270, about 280, about 290, or about 300 mL/kg. The V.sub.SS
for individual subjects may be about 145, about 150, about 160,
about 170, about 180, about 190, about 200, about 210, about 220,
about 230, about 240, about 250, about 260, about 270, about 280,
about 290, about 300, about 310, about 320, about 330, about 340,
about 350, about 360, or about 370 ml/kg. For V.sub.SS based on
antigen, see Table 14.
[0112] "Polypeptide," "peptide" and "protein" are used
interchangeably and refer to a polymeric compound comprised of
covalently linked amino acid residues.
[0113] "Polynucleotide" and "nucleic acid" are used interchangeably
and refer to a polymeric compound comprised of covalently linked
nucleotide residues. Polynucleotides may be DNA, cDNA, RNA, single
stranded, or double stranded, vectors, plasmids, phage, or viruses.
Polynucleotides include those in Table 1, which encode the
polypeptides of Table 2 (see Table 1). Polynucleotides also include
fragments of the polynucleotides of Table 1, e.g., those that
encode fragments of the polypeptides of Table 2, such as the Factor
IX, Fc, signal sequence, propeptide, 6His and other fragments of
the polypeptides of Table 2.
[0114] "Prophylactic treatment," as used herein, means
administering a Factor IX polypeptide in multiple doses to a
subject over a course of time to increase the level of Factor IX
activity in a subject's plasma. Preferably, the increased level is
sufficient to decrease the incidence of spontaneous bleeding or to
prevent bleeding in the event of an unforeseen injury. Prophylactic
treatment decreases or prevents bleeding episodes, for example,
those described under on-demand treatment. Prophylactic treatment
may be fixed or may be individualized, as discussed under "dosing
interval", e.g., to compensate for inter-patient variability.
[0115] "Subject," as used herein means a human or a non-human
mammal. Non-human mammals include mice, dogs, primates, monkeys,
cats, horses, cows, pigs, and other domestic animals and small
animals. Subjects also include pediatric humans. Pediatric human
subjects are birth to 20 years, preferably birth to 18 years, birth
to 16 years, birth to 15 years, birth to 12 years, birth to 11
years, birth to 6 years, birth to 5 years, birth to 2 years, and 2
to 11 years of age.
[0116] The methods of the invention may be practiced on a subject
in need of control or prevention of bleeding or bleeding episodes.
Such subjects include those in need of control or prevention of
bleeding in minor hemorrhage, hemarthroses, superficial muscle
hemorrhage, soft tissue hemorrhage, moderate hemorrhage,
intramuscle or soft tissue hemorrhage with dissection, mucous
membrane hemorrhage, hematuria, major hemorrhage, hemorrhage of the
pharynx, hemorrhage of the retropharynx, hemorrhage of the
retroperitonium, hemorrhage of the central nervous system, bruises,
cuts, scrapes, joint hemorrhage, nose bleed, mouth bleed, gum
bleed, intracranial bleeding, intraperitoneal bleeding, minor
spontaneous hemorrhage, bleeding after major trauma, moderate skin
bruising, or spontaneous hemorrhage into joints, muscles, internal
organs or the brain. Such subjects also include those need of
pen-operative management, such as management of bleeding associated
with surgery or dental extraction.
[0117] "Therapeutic dose," as used herein, means a dose that
achieves a therapeutic goal, as described herein. The calculation
of the required dosage of plasma derived Factor IX (pdFIX) is based
upon the empirical finding that, on average, 1 IU of pdFIX per kg
body weight raises the plasma Factor IX activity by approximately 1
IU/dL (1%). On that basis, the required dosage is determined using
the following formula:
Required units=body weight (kg).times.desired Factor IX rise (IU/dL
or % of normal).times.1 (IU/kg per IU/dL)
[0118] Because FIXFc, e.g., as described in the Examples and in
FIG. 1, has an incremental recovery similar to pdFIX (different
from that of BENEFIX.TM.), the required dose is determined using
the formula above, or adjusting it slightly. See also Table 26 for
specific recommended doses for various on-demand treatment needs.
For pediatric subjects using pdFIX, dosage guidance is the same as
for adults. However, pediatric patients may have a lower
incremental recovery, and the dosage may therefore need to be
adjusted upwards.
[0119] The therapeutic doses that may be used in the methods of the
invention are 10-180, 20-180, or 25-180 IU/kg, more specifically,
preferred doses for a 6-10 day dosing interval are as follows:
about 25-110, about 30-110, about 40-110, about 50-110, about
60-110, about 70-110, about 80-110, about 90-110, and about
100-110; about 30-100, about 30-90, about 30-80, about 30-70, about
30-60, about 30-50, about 30-40 IU/kg; about 40-110, about 50-100,
about 60-90, and about 70-80 IU/kg; about 40-50, about 50-60, about
60-70, about 70-80, about 80-90, about 90-100, and about 100-110
IU/kg; about 25, about 30, about 35, about 40, about 45, about 50,
about 55, about 60, about 65, about 70, about 75, about 80, about
85, about 90, about 95, about 100, about 105, and about 110 IU/kg.
A 6-10 day dosing interval includes a weekly dosing interval.
Additional therapeutic doses for a 6-10 day, e.g., weekly, dosing
interval include 20-50, 20-100, and 20-180 IU/kg, more
specifically, preferred doses for a 6-10 day, e.g., weekly, dosing
interval are as follows: about 20-110, about 20-100, about 20-90,
about 20-80, about 20-70, about 20-60, about 20-50, about 20-40,
about 20-30, about 20-40, and about 20 IU/kg. See also Examples 10
and 11. Doses may be lower than 20 IU/kg if effective for a given
patient, e.g., about 10, about 11, about 12, about 13, about 14,
about 15, about 16, about 17, about 18, or about 19 IU/kg.
[0120] Preferred therapeutic doses for a 9-18 day, e.g., two times
monthly, dosing interval are as follows: about 50-180, about
60-180, about 70-180, about 80-180, about 90-180, about 100-180,
about 110-180, about 120-180, about 130-180, about 140-180, about
150-180, about 160-180, and about 170-180 IU/kg; about 90-170,
about 90-160, about 90-150, about 90-140, about 90-130, about
90-120, about 90-110, and about 90-100 IU/kg; about 100-170, about
110-160, about 120-150, and about 130-140 IU/kg; about 90-100,
about 100-110, about 110-120, about 120-130, about 130-140, about
140-150, about 150-160, and about 160-170 IU/kg; about 60, about
70, about 80, about 90, about 95, about 100, about 105, about 110,
about 115, about 120, about 125, about 130, about 135, about 140,
about 145, about 150, about 155, about 160, about 165, about 170,
about 175, and about 180 IU/kg. See also Examples 10 and 11.
[0121] Preferred therapeutic doses are 10-50, 15-100, 20-100,
20-50, 50-100, 10, 20, 40, 50, and 100 IU/kg.
[0122] The therapeutic dose may be about 20-50, about 20-100, about
20-180, 25-110, about 30-110, about 40-110, about 50-110, about
60-110, about 70-110, about 80-110, about 90-110, about 100-110,
about 30-100, about 30-90, about 30-80, about 30-70, about 30-60,
about 30-50, about 30-40 IU/kg, about 40-110, about 50-100, about
60-90, about 70-80 IU/kg, about 40-50, about 50-60, about 60-70,
about 70-80, about 80-90, about 90-100, about 100-110 IU/kg, about
20, about 25, about 30, about 35, about 40, about 45, about 50,
about 55, about 60, about 65, about 70, about 75, about 80, about
85, about 90, about 95, about 100, about 105, and about 110 IU/kg.
Such doses are preferred for dosing intervals of about 6-10, about
7-10, about 7-9, about 7-8, about 8-10, about 9-10, about 6-7,
about 8-9, about 6, about 7, about 8, about 9, and about 10 days,
and once weekly.
[0123] The therapeutic dose may about 90-180, about 100-180, about
110-180, about 120-180, about 130-180, about 140-180, about
150-180, about 160-180, and about 170-180 IU/kg. The dose may be
about 90-170, about 90-160, about 90-150, about 90-140, about
90-130, about 90-120, about 90-110, and about 90-100 IU/kg. The
dose may be about 100-170, about 110-160, about 120-150, and about
130-140 IU/kg. The dose may be about 90-100, about 100-110, about
110-120, about 120-130, about 130-140, about 140-150, about
150-160, and about 160-170 IU/kg. The dose may be about 90, about
95, about 100, about 105, about 110, about 115, about 120, about
125, about 130, about 135, about 140, about 145, about 150, about
155, about 160, about 165, about 170, about 175, and about 180
IU/kg. Such doses are preferred for dosing interval of about 9-18,
about 9-17, about 9-16, about 9-15, about 9-14, about 9-13, about
9-12, about 9-11, about 9-10, about 10-18, about 11-18, about
12-18, about 13-18, about 14-18, about 15-18, about 16-18, about
17-18, about 10-11, about 11-12, about 12-13, about 13-14, about
14-15, about 15-16, and about 16-17 days, about 9, about 10, about
11, about 12, about 13, about 14, about 15, about 16, about 17, and
about 18 days, one time monthly and two times monthly (every two
weeks).
[0124] Preferred therapeutic dose and dosing intervals are as
follows: 20 IU/kg once weekly, 40 IU/kg every 10 days, and 100
IU/kg every two weeks (twice monthly). Additional combinations of
dose and dose interval include: a dose at least about 50 IU/kg and
a dosing interval at least about 7 days, a dose at least about 100
IU/kg and a dosing interval at least about 9 days, a dose at least
about 100 IU/kg and a dosing interval at least about 12 days, a
dose at least about 150 IU/kg and a dosing interval at least about
14 days, 20-50 or 20-100 IU/kg and said dosing interval is one time
weekly, a dose of 20-50 IU/kg and a dosing interval of 7 days, a
dose of 50-100 IU/kg and a dosing interval of 10-14 days, or a dose
of 100-150 IU/kg and a dosing interval of 14-16 days. Preferred
combinations of dosing interval and dose also include 10-50 IU/kg
for 7 days, 15-100 IU/kg for 10-13 days, 50-150 IU/kg for 14-15
days, 10-30 IU/kg for 7 days, 15-50 IU/kg for 10 days, 20-70 IU/kg
for 11 days, 25-85 IU/kg for 12 days, 30 to 100 IU/kg for 13 days,
40 to 125 IU/kg for 14 days, and 50-150 IU/kg for 15 days.
[0125] "Variant," as used herein, refers to a polynucleotide or
polypeptide differing from the original polynucleotide or
polypeptide, but retaining essential properties thereof, e.g.,
Factor IX coagulant activity or Fc (FcRn binding) activity.
Generally, variants are overall closely similar, and, in many
regions, identical to the original polynucleotide or polypeptide.
Variants include polypeptide and polynucleotide fragments,
deletions, insertions, and modified versions of original
polypeptides.
[0126] Variant polynucleotides may comprise, or alternatively
consist of, a nucleotide sequence which is at least 85%, 90%, 95%,
96%, 97%, 98% or 99% identical to, for example, the nucleotide
coding sequence in SEQ ID NO:1 or 3 (the Factor IX portion, the Fc
portion, individually or together) or the complementary strand
thereto, the nucleotide coding sequence of known mutant and
recombinant Factor IX or Fc such as those disclosed in the
publications and patents cited herein or the complementary strand
thereto, a nucleotide sequence encoding the polypeptide of SEQ ID
NO:2 or 4 (the Factor IX portion, the Fc portion, individually or
together), and/or polynucleotide fragments of any of these nucleic
acid molecules (e.g., those fragments described herein).
Polynucleotides which hybridize to these nucleic acid molecules
under stringent hybridization conditions or lower stringency
conditions are also included as variants, as are polypeptides
encoded by these polynucleotides as long as they are
functional.
[0127] Variant polypeptides may comprise, or alternatively consist
of, an amino acid sequence which is at least 85%, 90%, 95%, 96%,
97%, 98%, 99% identical to, for example, the polypeptide sequence
shown in SEQ ID NO:2 or 4 (the Factor IX portion, the Fc portion,
individually or together), and/or polypeptide fragments of any of
these polypeptides (e.g., those fragments described herein).
[0128] By a nucleic acid having a nucleotide sequence at least, for
example, 95% "identical" to a reference nucleotide sequence, it is
intended that the nucleotide sequence of the nucleic acid is
identical to the reference sequence except that the nucleotide
sequence may include up to five point mutations per each 100
nucleotides of the reference nucleotide sequence. In other words,
to obtain a nucleic acid having a nucleotide sequence at least 95%
identical to a reference nucleotide sequence, up to 5% of the
nucleotides in the reference sequence may be deleted or substituted
with another nucleotide, or a number of nucleotides up to 5% of the
total nucleotides in the reference sequence may be inserted into
the reference sequence. The query sequence may be, for example, the
entire sequence shown in SEQ ID NO:1 or 3, the ORF (open reading
frame), or any fragment specified as described herein.
[0129] As a practical matter, whether any particular nucleic acid
molecule or polypeptide is at least 85%, 90%, 95%, 96%, 97%, 98% or
99% identical to a nucleotide sequence or polypeptide of the
present invention can be determined conventionally using known
computer programs. A preferred method for determining the best
overall match between a query sequence (reference or original
sequence) and a subject sequence, also referred to as a global
sequence alignment, can be determined using the FASTDB computer
program based on the algorithm of Brutlag et al. (Comp. App.
Biosci. (1990) 6:237-245), which is herein incorporated by
reference in its entirety In a sequence alignment the query and
subject sequences are both DNA sequences. An RNA sequence can be
compared by converting U's to T's. The result of said global
sequence alignment is in percent identity. Preferred parameters
used in a FASTDB alignment of DNA sequences to calculate percent
identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=1,
Joining Penalty=30, Randomization Group Length=0, Cutoff Score=1,
Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length
of the subject nucleotide sequence, whichever is shorter.
[0130] If the subject sequence is shorter than the query sequence
because of 5' or 3' deletions, not because of internal deletions, a
manual correction must be made to the results. This is because the
FASTDB program does not account for 5' and 3' truncations of the
subject sequence when calculating percent identity. For subject
sequences truncated at the 5' or 3' ends, relative to the query
sequence, the percent identity is corrected by calculating the
number of bases of the query sequence that are 5' and 3' of the
subject sequence, which are not matched/aligned, as a percent of
the total bases of the query sequence. Whether a nucleotide is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This corrected score is what is used for the purposes of the
present invention. Only bases outside the 5' and 3' bases of the
subject sequence, as displayed by the FASTDB alignment, which are
not matched/aligned with the query sequence, are calculated for the
purposes of manually adjusting the percent identity score.
[0131] For example, a 90 base subject sequence is aligned to a 100
base query sequence to determine percent identity. The deletions
occur at the 5' end of the subject sequence and therefore, the
FASTDB alignment does not show a matched/alignment of the first 10
bases at 5' end. The 10 unpaired bases represent 10% of the
sequence (number of bases at the 5' and 3' ends not matched/total
number of bases in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 bases were perfectly matched the final percent
identity would be 90%. In another example, a 90 base subject
sequence is compared with a 100 base query sequence. This time the
deletions are internal deletions so that there are no bases on the
5' or 3' of the subject sequence which are not matched/aligned with
the query. In this case the percent identity calculated by FASTDB
is not manually corrected. Once again, only bases 5' and 3' of the
subject sequence which are not matched/aligned with the query
sequence are manually corrected for. No other manual corrections
are to made for the purposes of the present invention.
[0132] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a query amino acid sequence of the
present invention, it is intended that the amino acid sequence of
the subject polypeptide is identical to the query sequence except
that the subject polypeptide sequence may include up to five amino
acid alterations per each 100 amino acids of the query amino acid
sequence. In other words, to obtain a polypeptide having an amino
acid sequence at least 95% identical to a query amino acid
sequence, up to 5% of the amino acid residues in the subject
sequence may be inserted, deleted, (indels) or substituted with
another amino acid. These alterations of the reference sequence may
occur at the amino or carboxy terminal positions of the reference
amino acid sequence or anywhere between those terminal positions,
interspersed either individually among residues in the reference
sequence or in one or more contiguous groups within the reference
sequence.
[0133] As a practical matter, whether any particular polypeptide is
at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for
instance, the amino acid sequences of SEQ ID NO:2 (the Factor IX
portion, the Fc portion, individually or together) or 4, or a known
Factor IX or Fc polypeptide sequence, can be determined
conventionally using known computer programs. A preferred method
for determining the best overall match between a query sequence
(reference or original sequence) and a subject sequence, also
referred to as a global sequence alignment, can be determined using
the FASTDB computer program based on the algorithm of Brutlag et
al., Comp. App. Biosci. 6:237-245(1990), incorporated herein by
reference in its entirety. In a sequence alignment the query and
subject sequences are either both nucleotide sequences or both
amino acid sequences. The result of said global sequence alignment
is in percent identity. Preferred parameters used in a FASTDB amino
acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1,
Joining Penalty=20, Randomization Group Length=0, Cutoff Score=1,
Window Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05,
Window Size=500 or the length of the subject amino acid sequence,
whichever is shorter.
[0134] If the subject sequence is shorter than the query sequence
due to N- or C-terminal deletions, not because of internal
deletions, a manual correction must be made to the results. This is
because the FASTDB program does not account for N- and C-terminal
truncations of the subject sequence when calculating global percent
identity. For subject sequences truncated at the N- and C-termini,
relative to the query sequence, the percent identity is corrected
by calculating the number of residues of the query sequence that
are N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. Whether a residue is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This final percent identity score is what is used for the purposes
of the present invention. Only residues to the N- and C-termini of
the subject sequence, which are not matched/aligned with the query
sequence, are considered for the purposes of manually adjusting the
percent identity score. That is, only query residue positions
outside the farthest N- and C-terminal residues of the subject
sequence.
[0135] For example, a 90 amino acid residue subject sequence is
aligned with a 100 residue query sequence to determine percent
identity. The deletion occurs at the N-terminus of the subject
sequence and therefore, the FASTDB alignment does not show a
matching/alignment of the first 10 residues at the N-terminus. The
10 unpaired residues represent 10% of the sequence (number of
residues at the N- and C-termini not matched/total number of
residues in the query sequence) so 10% is subtracted from the
percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are to made for the purposes of the
present invention.
[0136] The polynucleotide variants may contain alterations in the
coding regions, non-coding regions, or both. Especially preferred
are polynucleotide variants containing alterations which produce
silent substitutions, additions, or deletions, but do not alter the
properties or activities of the encoded polypeptide. Nucleotide
variants produced by silent substitutions due to the degeneracy of
the genetic code are preferred. Moreover, variants in which 5-10,
1-5, or 1-2 amino acids are substituted, deleted, or added in any
combination are also preferred. Polynucleotide variants can be
produced for a variety of reasons, e.g., to optimize codon
expression for a particular host (change codons in the human mRNA
to those preferred by a bacterial host such as E. coli).
[0137] Naturally occurring variants are called "allelic variants,"
and refer to one of several alternate forms of a gene occupying a
given locus on a chromosome of an organism (Genes II, Lewin, B.,
ed., John Wiley & Sons, New York (1985)). These allelic
variants can vary at either the polynucleotide and/or polypeptide
level and are included in the present invention. Alternatively,
non-naturally occurring variants may be produced by mutagenesis
techniques or by direct synthesis.
[0138] Using known methods of protein engineering and recombinant
DNA technology, variants may be generated to improve or alter the
characteristics of the polypeptides. For instance, one or more
amino acids can be deleted from the N-terminus or C-terminus of the
secreted protein without substantial loss of biological function.
The authors of Ron et al., J. Biol. Chem. 268: 2984-2988 (1993),
incorporated herein by reference in its entirety, reported variant
KGF proteins having heparin binding activity even after deleting 3,
8, or 27 amino-terminal amino acid residues. Similarly, Interferon
gamma exhibited up to ten times higher activity after deleting 8-10
amino acid residues from the carboxy terminus of this protein.
(Dobeli et al., J. Biotechnology 7:199-216 (1988), incorporated
herein by reference in its entirety.)
[0139] Moreover, ample evidence demonstrates that variants often
retain a biological activity similar to that of the naturally
occurring protein. For example, Gayle and coworkers (J. Biol. Chem.
268:22105-22111 (1993), incorporated herein by reference in its
entirety) conducted extensive mutational analysis of human cytokine
IL-la. They used random mutagenesis to generate over 3,500
individual IL-la mutants that averaged 2.5 amino acid changes per
variant over the entire length of the molecule. Multiple mutations
were examined at every possible amino acid position. The
investigators found that "[m]ost of the molecule could be altered
with little effect on either [binding or biological activity]."
(See Abstract.) In fact, only 23 unique amino acid sequences, out
of more than 3,500 nucleotide sequences examined, produced a
protein that significantly differed in activity from wild type.
[0140] As stated above, polypeptide variants include modified
polypeptides. Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
pegylation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination.
[0141] The term "about" is used herein to mean approximately,
roughly, around, or in the regions of. When the term "about" is
used in conjunction with a numerical range, it modifies that range
by extending the boundaries above and below the numerical values
set forth. In general, the term "about" is used herein to modify a
numerical value above and below the stated value by a variance of
10 percent, up or down (higher or lower).
[0142] Having now described the present invention in detail, the
same will be more clearly understood by reference to the following
examples, which are included herewith for purposes of illustration
only and are not intended to be limiting of the invention. All
patents and publications referred to herein are expressly
incorporated by reference.
Example 1. First-in-Human (FiH) Trial
[0143] The first-in-human study was an open label, dose-escalation,
Phase 1/2 study to determine the safety, tolerability and
pharmacokinetic (PK) parameters of FIXFc (recombinant human
coagulation factor IX fusion protein). FIXFc is a recombinant
fusion protein comprising human clotting factor IX coupled to the
Fc domain from human IgG1. The fusion protein is expressed in human
embryonic kidney cells (HEK 293). See Example 3.
[0144] FIXFc is being developed for the control and prevention of
hemorrhagic episodes in patients with hemophilia B (congenital
factor IX deficiency or Christmas disease), including the control
and prevention of bleeding in surgical settings.
[0145] FIXFc is a recombinant fusion protein comprised of
coagulation Factor IX (FIX) and an Fc domain of a human antibody
(IgG1 isotype). The FIXFc molecule is heterodimeric with a FIXFc
single chain (FIXFc-sc) and an Fc single chain (Fc-sc) bound
together through two disulfide bonds in the hinge region of Fc. See
FIG. 1 and Table 2.
[0146] rFIXFc drug product is a clear colorless solution intended
for intravenous (IV) administration. rFIXFc is supplied as 1000 IU
per a 5 mL volume in a 10 mL single use only vial. The Drug Product
is packaged in USP Type I glass vials with bromobutyl stoppers and
tear-off plain aluminum overseals. rFIXFc drug product contains 200
IU/mL in 10 mM sodium phosphate buffer pH 7.0 with addition of 145
mM NaCl and 0.1% polysorbate 20. The rFIXFc solution should not be
diluted.
[0147] Study Design. A total of 14 previously treated patients with
severe hemophilia B were enrolled and treated with FIXFc as an
intravenous (IV) infusion over approximately 10 minutes. Six dose
levels, 1, 5, 12.5, 25, 50, and 100 IU/kg were evaluated in the
study. One patient per dose level was enrolled at dose levels 1, 5,
12.5, and 25 IU/kg, and at least three evaluable patients per dose
level were enrolled at 50 and 100 IU/kg.
[0148] After the screening (scheduled within 14 days of the FIXFc
dose), the treatment period for the patients began. The treatment
period for each dose level included a single dose of FIXFc (Day 1)
up until the completion of the 72-hour safety observation period (3
days) for dose levels 1 and 5 IU/kg or until the last PK sample was
taken for patients in dose levels 12.5 to 100 IU/kg (approximately
10 days). Patients treated with 1, 5, 12.5, or 25 IU/kg were
enrolled and treated in a sequential manner starting at 1 IU/kg.
Patients receiving 50 IU/kg were not treated on the same day and at
least one day separated dosing. After treatment of the 50 IU/kg
patients, treatment of the 100 IU/kg patients began.
[0149] The post-treatment period was a 30-day safety observation
period starting from the day the patient received the dose of FIXFc
and overlapped with the treatment period since patients were
undergoing the required study evaluations, such as PK sampling,
during this time.
[0150] Patients assigned to dose levels 12.5 to 100 IU/kg had blood
samples drawn to assess FIX activity and FIXFc concentration. Blood
samples were to be drawn just prior to administration of FIXFc; 15
minutes following the end of the infusion; and at 1, 3, 6, 9, 24,
48, 72, 96, 120, 168, and 240 hours following the end of the
infusion or until baseline FIX levels were reached. If a patient
continued to have FIX levels above baseline at the 240-hour time
point (Study Day 11), samples were taken at 288 hours (Study Day
13) and again at 336 hours (Study Day 15) if the FIX level was
above baseline at Study Day 13.
[0151] Patient 10 received BENEFIX.TM. treatment for a bleed prior
to scheduled FIXFc sampling at 216 hours post dosing. Consequently,
FIXFc activity and antigen data for the 216 h and following time
points were excluded from analysis. No additional deviations
occurred that are felt to have affected the interim analysis
results of this study.
[0152] For Factor IX antigen, pharmacokinetic analyses were
performed on the individual patient observed FIXFc concentration
versus time data following IV infusion of FIXFc. Primary analysis
was performed using model-dependent methodology. FIXFc
concentration data were computer-fitted to a two-compartment open
model with elimination from the central compartment using
user-defined initial parameter estimates for the calculation of
initial parameter values. WinNonlin estimated microscopic rate
constants were generated and FIXFc concentration data were weighted
with the function of l/(Y.sup.-hat*Y.sup.-hat). Observed data for
two subjects (e.g., Patients 5 and 6) were inadequately described
by the two-compartment model. Consequently, model-independent
analysis was performed on these two patients using WinNonlin
noncompartmental analysis IV-Infusion input model (linear
trapezoidal rule for AUC calculation). For noncompartmental
analysis, the half-life was calculated from the beta phase using
the data points that describe the terminal log-linear decline in
the regression. A minimum of three points were used to describe
elimination phase. This occurred approximately between 4 and 14
days. For PK analysis of antigen, the "mg/kg" dose equivalents were
utilized. These values were determined based on a specific activity
for FIXFc of 60.2 IU/mg. Actual sampling times, doses, and infusion
durations were used for calculations. Nominal sampling times and
doses were used for the creation of tables and concentration-time
figures. Individual and mean PK parameters and descriptive
statistics are presented. Formal statistical analysis was not
performed because the dose range and the number of subjects in each
cohort were too small for meaningful analysis.
[0153] For Factor IX activity, a baseline subtraction method was
applied to the activity versus time profile according the baseline
subtraction decision tree (FIG. 4). Activity values of <1% were
defined at 1 IU/dL for baseline decay. Predose times were treated
as zero for the purpose of calculations. In addition, baseline
corrected activity data were truncated at time points that
represented a return to baseline levels. Pharmacokinetic analyses
were performed on the baseline subtracted FIX activity versus time
data obtained following IV infusion administration of FIXFc. A
model-dependent assessment was utilized for analysis of the
IV-infusion dose groups. The baseline subtracted data were
computer-fitted to a two-compartment open model with elimination
from the central compartment using WinNonlin-defined parameter
boundaries for the calculation of the initial parameter values.
WinNonlin estimated microscopic rate constants were generated and
FIXFc activity data were weighted with the function of
l/(Y.sup.-hat*Y.sup.-hat). Actual sampling times, doses, and
infusion durations were used for calculations. Nominal sampling
times and doses were used for the creation of tables and
concentration-time figures.
[0154] When unavailable from the actual data, the activity at 168 h
post dosing (C168) and time to 1 IU/dL above baseline (TBLP1) of
rFIXFc were obtained using the WinNonlin generated microscopic rate
constants to simulate the FIXFc activity level versus time data.
Individual and mean PK parameters and descriptive statistics are
presented in this Example. Formal statistical analysis was not
performed, because the dose range and the number of subjects in
each cohort were too small for meaningful analysis.
[0155] Results for FIXFc antigen pharmacokinetics showed that FIXFc
plasma concentrations increased sharply after the short IV infusion
of FIXFc, with mean (.+-.SD) C.sub.max values of 1670 (n=1), 2730
(n=1), 7510.+-.2480 and 15400.+-.3960 ng/mL for the 12.5, 25, 50,
and 100 IU/kg nominal dose levels, respectively, and was reached
within the first half-hour for all patients All FIXFc-treated
patients had dose-related increases in systemic FIXFc plasma
exposure (as assessed by C.sub.max and AUC.sub.INF). Although
limited to a single evaluable patient at the 12.5 and 25 IU/kg
nominal dose, the observed increase in both C.sub.max and
AUC.sub.INF was reasonably proportional to dose over the dose range
evaluated. (Table 3 shows individual patient and group mean FIXFc
antigen concentration versus time data; sorted by nominal dose,
actual dose, infusion duration, and patient number. Table 4 shows
individual patient and group mean FIXFc antigen PK summary data;
sorted by nominal dose, actual dose, "mg/kg" equivalent dose, and
patient number, shows individual patient and group mean FIXFc
antigen PK summary data; sorted by nominal dose, actual dose,
"mg/kg" equivalent dose, and patient number, and see Table 11.)
[0156] FIXFc plasma concentrations declined in a biexponential
fashion following the short IV infusion. Both distribution (alpha)
and elimination (beta) half-life values appeared to be
dose-independent over the dose range evaluated with individual
patient alpha and beta half-life values ranging from 9.79 to 21.2
hours and 71.0 to 140 hours, respectively. Mean alpha half-life
values (.+-.SD) for the 50 and 100 IU/kg nominal dose levels were
13.1.+-.4.77 and 12.1.+-.2.33 hours, respectively. Mean beta
half-life values (.+-.SD) for the 50 and 100 IU/kg nominal dose
levels were 110.+-.26.5 and 95.8.+-.11.1 hours, respectively. In
addition, primary PK parameter values for Cl, V.sub.SS, and MRT
were determined and, in general, all appeared to be
dose-independent over the dose range evaluated. As indicated, this
assessment is limited by single patient data at the 12.5 and 25
IU/kg nominal dose levels. (Table 12 and FIGS. 2, 7, and 8.)
[0157] Further, mean Cl values were 2.28.+-.0.374 and 2.11.+-.0.464
mL/h/kg for the 50 and 100 IU/kg nominal dose levels, respectively.
Mean V.sub.SS values were 259.+-.78.5 and 238.+-.52.2 mL/kg for the
50 and 100 IU/kg nominal dose levels, respectively. In addition,
mean MRT values were 112.+-.21.5 and 114.+-.17.1 h for the 50 and
100 IU/kg nominal dose levels.
[0158] Results for baseline corrected FIXFc activity
pharmacokinetics showed that FIXFc activity increased sharply after
the short IV infusion of FIXFc, with mean (.+-.SD) model-predicted
C.sub.max values of 11.9 (n=1), 19.9 (n=1), 41.6.+-.8.97 and
98.2.+-.8.21 IU/dL for the 12.5, 25, 50, and 100 IU/kg nominal dose
levels, respectively, and was reached within the first half-hour
for all patients. (Table 5 shows individual patient and group mean
baseline corrected FIXFc activity versus time data; sorted by
nominal dose, actual dose, infusion duration, and patient number
and. Table 6 shows individual patient and group mean FIXFc activity
PK summary data; sorted by nominal dose, actual dose, "mg/kg"
equivalent dose, and patient number.)
[0159] All FIXFc-treated patients had dose-related increases in FIX
activity (relative to predose baseline response). Although limited
to a single evaluable patient at both the 12.5 and 25 IU/kg nominal
dose levels, the observed increase in both C.sub.max and
AUC.sub.INF was reasonably proportional to dose over the dose range
evaluated. (Tables 6, 9, and 13 and FIGS. 3 and 5.)
[0160] After the end of the infusion, the decline in baseline
corrected FIX activity exhibited biexponential decay; characterized
by a rapid distribution (alpha) phase followed by a log-linear
elimination (beta) phase. During the alpha phase, the rate of
decline in FIXFc activity was variable with individual patient
alpha half-life values ranging from 0.140 to 16.6 hours. The
seemingly dose-dependent increase in mean alpha half-life values
was confounded by a single patient at the 12.5 and 25 IU/kg nominal
dose levels. In contrast, elimination (beta) half-life values
appeared to be dose-independent over the dose range with individual
patient beta half-life values ranging from 42.1 to 67.4 hours over
the 25 to 100 IU/kg dose range. Although estimated and reported,
the elimination half-life for patient 1 treated with 12.5 IU/kg of
rFIXFc are not included in summary evaluation due to this patient's
FIX levels being detectable for only up to 96 hours resulting in a
truncated terminal phase and contributing to an underestimation of
the terminal elimination half-life. Mean beta half-life values
(.+-.SD) for the 50 and 100 IU/kg nominal dose levels were
52.1.+-.10.4 and 52.5.+-.10.1 hours, respectively, and 52.5.+-.9.2
(range 40-67.4) hours for combined 25, 50 and 100 IU/kg nominal
doses. (Tables 6, 8 and 13).
[0161] In addition, primary PK parameter values for Cl, V.sub.1,
V.sub.SS, and MRT were determined and, in general, all appeared to
be dose-independent over the dose range evaluated.
[0162] Further, mean Cl values were 3.77.+-.1.12 and 2.89.+-.0.615
mL/h/kg for the 50 and 100 IU/kg nominal dose levels, respectively,
and 3.36.+-.0.928 mL/h/kg for the combined 25, 50, and 100 IU/kg
nominal doses. (Tables 6, 8 and 13.)
[0163] Mean V.sub.SS values were 264.+-.77.6 and 179.+-.31.1 mL/kg
for the 50 and 100 IU/kg nominal dose levels, respectively, and
226.+-.69.8 mL/kg for the combined 25, 50, and 100 IU/kg nominal
doses. (Tables 6, 8 and 13.) In addition, mean MRT values were
71.7.+-.13.0 and 62.8.+-.8.82 h for the 50 and 100 IU/kg nominal
dose levels, respectively, and 68.05.+-.11.16 h for the combined
25, 50, and 100 IU/kg nominal doses. (Tables 6, 8 and 13.)
[0164] In addition to the primary PK parameters, secondary PK
parameters (e.g., C168, K-values, IVR, etc.) were determined to
evaluate FIXFc duration of effect. As anticipated, dose-dependent
increases in C168, TBLP1, TBLP3, and TBLP5 values were observed. In
contrast, K-values and IVR values appeared to be dose-independent
over the dose range evaluated. Over the full dose range, individual
patient model-predicted and observed K-values ranged from 0.61 to
1.02 and 0.62 to 1.17 IU/dL per IU/kg, respectively. Mean
model-predicted K-values for the 50 and 100 IU/kg nominal dose
levels were 0.76 and 0.90 IU/dL per IU/kg, respectively, and
0.821.+-.0.1387 (range 0.61-1.02) IU/dL per 1 IU/kg for combined
25, 50, and 100 IU/kg nominal doses. Mean model-predicted IVR
values for the 50 and 100 IU/kg nominal dose levels were 34.5 and
35.1%, respectively. Mean observed K-values for the 50 and 100
IU/kg nominal dose levels were 0.86 and 1.02 IU/dL per IU/kg,
respectively, and 0.926.+-.0.1787 (range 0.97-1.17) IU/dL per 1
IU/kg for combined 25, 50, and 100 IU/kg nominal doses. Mean
observed IVR values for the 50 and 100 IU/kg nominal dose levels
were 39.2 and 39.8%, respectively. (Tables 6, 7, 8 and 13.) Table
7A-7B show 7 shows individual patient and group mean FIXFc activity
secondary PK summary data; sorted by nominal dose, actual dose, and
patient number.
[0165] Each 1 IU/kg of infused rFIXFc raised plasma FIX activity by
0.93.+-.0.18 IU/dl on average, and this incremental recovery (K
value) showed weak positive correlation with body weight
(R.sup.2=0.336, p=0.048) (FIG. 23).
[0166] Pharmacokinetic estimates for FIXFc activity were consistent
with those for rFIXFc antigen (e.g., compare Tables 13 and 14).
Further, there was excellent correlation between rFIXFc activity
and antigen levels, indicating the preservation of rFIXFc in vivo
activity. (FIG. 9.) In addition, relative to historical data for
BENEFIX.TM. (Wyeth), rFIXFc demonstrated (Table 8) the
following:
[0167] Dose linearity from 25-100 IU/kg
[0168] 3 fold increase in t.sub.1/2beta
[0169] 3 fold increase in mean residence time
[0170] 24% improved incremental recovery
[0171] 2.5 fold reduced clearance
[0172] FIXFc is a recombinant fusion protein comprised of FIX
attached to the Fc domain of human IgG1. FIXFc has been designed to
be a long-acting version of FIX. Preclinical studies with FIXFc
have shown a prolongation of the half-life of FIX activity compared
to BENEFIX.TM., the commercially available recombinant FIX product.
The rationale for this study was to evaluate the safety and PK of
FIXFc in severe hemophilia B patients. For this study, 12 evaluable
subjects aged 18 to 76 years were available for PK evaluation. Each
subject received a single administration of FIXFc at a nominal dose
of 12.5, 25, 50, or 100 IU/kg of body weight infused intravenously
over approximately 10 minutes. Plasma samples for PK assessments of
both FIXFc activity and antigen concentrations were obtained before
infusion as well as up to 14 days after dosing. The PK of both
FIXFc antigen and activity were independently characterized in this
study using model-dependent and model-independent methods.
[0173] FIXFc was well tolerated following administration of single
IV doses of 12.5, 25, 50, and 100 IU/kg of body weight. There was
no evidence of drug-related serious adverse events in this study.
No neutralizing or binding antibodies to rFIXFc were detected in
any subject.
[0174] Approximate dose-proportional increases in C.sub.max and
AUC.sub.INF were observed for both FIXFc antigen and activity
following the administration of doses of 12.5 through 100 IU/kg,
but the V and Cl were similar across all doses. These results
indicate that FIXFc antigen and activity exhibited linear PK over
the dose range evaluated. The relatively small V parameter values
may indicate that FIXFc enters the interstitial fluid but does not
cross the cell membrane into the intracellular fluids.
[0175] Peak plasma levels of FIXFc antigen and activity were
observed within 0.5 h after the end of the infusion and remained
detectable for several days after dosing. Evidence of reduced
clearance and prolonged half-life was observed for both FIXFc
antigen and activity.
[0176] Mean clearance and terminal elimination half-life values
associated with FIXFc antigen concentrations for the 50 and 100
IU/kg dose levels were 2.28 and 2.11 mL/h/kg and 110 and 95.8
hours, respectively. Similarly, mean clearance and terminal
elimination half-life values associated with FIXFc activity levels
over the same dose range were 3.77 and 2.89 mL/h/kg and 52.1 and
52.5 hours, respectively. Comparison of FIXFc activity PK results
observed in the current study to reported PK for BENEFIX.TM.
activity (Summary of Product Characteristics of BENEFIX.TM.; Nov.
18, 2009) revealed an approximate 3-fold reduction in FIXFc
clearance and an approximate 3-fold increase in both FIXFc terminal
elimination half-life and mean residence time relative to
BENEFIX.TM..
[0177] With the observed improvements in PK, FIXFc will provide a
prolonged protection from bleeding, allowing less frequent
injections for individuals with Hemophilia B. Based on the results
of this trial, rFIXFc may be dosed every two weeks or twice monthly
using doses of 100 IU/kg and at least weekly using lower doses.
Such a regimen requires fewer injections. In addition, the use of
rFIXFc will have other potential clinical impacts such as: central
venous access; improved regimen compliance; reduced break through
bleeds; and increased protection of joints from bleeds.
Example 2. B-LONG Phase 1/2/3 Trial
[0178] This will be an open-label, multicenter evaluation of the
safety, pharmacokinetics, and efficacy of recombinant, long-acting
coagulant Factor IX Fc fusion (rFIXFc) in the prevention and
treatment of bleeding in previously treated subjects with severe
hemophilia B. Treatment with FIX products currently on the market
necessitates dosing 2-3 times per week. A product with a prolonged
half-life that extends the required dosing interval to once weekly
or longer would be considered by the medical community as a
significant improvement for the treatment of severe hemophilia
patients.
[0179] Dose levels vary widely for rFIX products in clinical
prophylaxis studies: the reported doses range from 10 to 171 IU/kg
(Roth et al., Blood 98:3600 (2001)) or 40 to 100 IU/kg (MASAC
Recommendation 177, National Hemophilia Foundation (October 2006)).
Moreover, trough levels of FIX activity during prophylaxis
treatment in subjects with no clinical signs of bleeding are
predicted to range between 0.2 and 3.8 IU/dL (Carlsson et al.,
Hemophilia 4:83 (1998)). Considering the inter-individual patient
variability, individualized dosage regimens based on the clinical
status of a patient are common practice.
[0180] The results of a Phase 1/2a study (Example 1) evaluating the
safety and pharmacokinetics of a single dose of a frozen liquid
formulation of rFIXFc have demonstrated the drug is well tolerated
at doses ranging from 1 to 100 IU/kg and the PK characterization
suggests several advantages over currently available treatments,
namely a half-life and MRT that are 3-fold longer than that
previously reported for BENEFIX.TM. (61 hours vs. 19 hours). The
purpose of this study is to determine the PK parameter estimates of
the lyophilized rFIXFc in humans prospectively, to compare these
with BENEFIX.TM. PK parameter estimates in humans, and to
demonstrate the efficacy of lyophilized rFIXFc in the prevention
and treatment of bleeding and the safety of its repeat dosing for
previously treated subjects with severe hemophilia B.
[0181] The study will entail four arms: a low dose prophylaxis
regimen (n=25), a high dose prophylaxis regimen (n=25), an
on-demand regimen (n=20) and a major surgery regimen (n=5). The low
dose regimen arm will include a PK subgroup (n=16) dosed with
BENEFIX.TM., followed by crossover to rFIXFc.
[0182] The primary objectives of the study are: to evaluate the
safety and tolerability of rFIXFc in all treatment arms; to
evaluate the efficacy of rFIXFc in all treatment arms; and to
evaluate the effectiveness of prophylaxis over on-demand therapy
(comparison of the annualized number of bleeding episodes between
Arms 1 and 2 versus on-demand regimen Arm 3).
[0183] The secondary objectives of the study are: to compare the PK
parameter estimates of rFIXFc and BENEFIX.TM.; to evaluate the
efficacy of rFIXFc in the on-demand and surgical arms; to evaluate
and compare the PK parameter estimates of rFIXFc at baseline and
Week 26 (.+-.1 week) in the PK subgroup; to evaluate subjects'
response to treatment in all arms; and to evaluate rFIXFc
consumption in all arms.
[0184] Main Inclusion Criteria: [0185] Male and 12 years of age and
older and weigh at least 40 kg [0186] Diagnosed with hemophilia B
(baseline Factor IX level less than or equal to 2%) [0187] History
of at least 100 exposure days to any Factor IX product [0188]
Platelet count.gtoreq.100,000 cells/.mu.L [0189] INR (international
normalized ratio).ltoreq.1.40 as defined by the testing
laboratory's normal range [0190] CD4 count.gtoreq.200
cells/.mu.L
[0191] Main Exclusion Criteria: [0192] History of Factor IX
inhibitors [0193] Kidney or liver dysfunction [0194] Diagnosed with
another coagulation defect other than hemophilia B [0195] Prior
history of anaphylaxis associated with any FIX or IV immunoglobulin
administration [0196] Taking systemic immunosuppressive drugs
(e.g., systemic corticosteriods; however, HAART (highly active
antiretroviral therapy) is permitted)
Example 3. FIXFc Production in HEK293 Cells
[0197] FIXFc was produced in stably transfected HEK293 cells
containing an expression cassette for FIXFc (native FIX fused
directly to the Fc region) and an expression cassette for Fc alone.
The cells also were transfected with an expression cassette for
PCS, which is a processing enzyme that allows for full processing
of the FIX propeptide. The transfected cells were grown in
serum-free suspension media containing vitamin K, and they secreted
three proteins: FIXFc dimer, FIXFc monomer (one FIXFc chain and one
Fc chain), and Fc dimer. FIXFc monomer ("FIXFc") was purified by
column chromatography (Protein A, Fractogel DEAE, and Q Sepharose
pseudo-affinity elution with low ionic strength CaCl.sub.2), and
viral inactivated and filtered for administration to human
subjects. Also see Peters et al., Blood. 2010 Mar. 11;
115(10):2057-64 (Epub 2010 Jan. 7); and U.S. Pat. No. 7,566,565;
each of which is incorporated by reference herein in its
entirety.
[0198] Coagulant activity of FIXFc was measured by quantitating its
ability to restore the clotting activity of FIX-deficient plasma
using an MLA Electra 1600C (Medical Laboratory
Automation/Instrument Labs, Pleasantville, N.Y.). Results were
compared to a calibration curve generated using serial dilutions of
a World Health Organization FIX standard.
[0199] Serine phosphorylation and tyrosine sulfation of Factor IX
are thought to be important for in vivo recovery. It has been
reported that MONONINE.TM. (plasma purified Factor IX (pdFIX)
marketed by CSL Berhing) has better in vivo recovery than
BENEFIX.TM. (recombinant FIX (rFIX) marketed by Wyeth) because of
the higher phosphorylation/sulfation level of MONONINE.TM.
(>90%/>90% versus <10%/5%). However, FIXFc produced in
HEK293 cells has almost no phosphorylation/sulfation (<10%/4%,
which is very similar to BENEFIX.TM.), and shows better IVR (1.0
IU/dl per IU/kg) than BENEFIX.TM. (0.7).
[0200] In addition, FIXFc produced as described above had a
significantly lower (10-100 fold) level (0.01-0.001%) of activated
FIX (FIXa), a product related impurity, than either MONONINE.TM.
(pdFIX) or BENEFIX.TM. (rFIX) (0.1%). The resulting FIXFc will have
fewer unwanted thrombotic events upon administration than
MONONINE.TM. or BENEFIX.TM..
Example 4. Pediatric Studies: Extrapolation and Interrelation
Between the Development in Adult and Pediatric Populations
[0201] Patient characteristics that show relationships with FIX
pharmacokinetics include age-dependent physiological changes
(Bjorkman and Berntorp, Clin. Pharmacokinetics 40:815-32 (2001);
and Bjorkman, Hemophilia 9(suppl 1):101-10 (2003)) and body size
and composition (Shapiro, Hemophilia 11:571-82 (2005)). Thus,
weight-adjusted clearance (CL) of FIX has generally been found to
decrease with age and/or body weight during growth from infancy to
adulthood, with a corresponding increase in terminal half-life
(t.sub.1/2). For rFIX product (BENEFIX.TM.), CL and volume
distribution at steady state (V.sub.SS) are increased in children
and then remain constant during adulthood; thus, these parameters
will be closely monitored in the pediatric studies.
[0202] Peak levels of FIX procoagulant activity (FIX:C) depend on
the initial volume of distribution of FIX:C after single and/or
repeated doses of FIX. The initial distribution of FIX is rapid.
However, it has been shown that in vivo recovery (mean incremental
recovery) for BENEFIX.TM. was typically 30% lower than that of a
monoclonal antibody purified plasma derived coagulation factor
(pdFIX) (Roth et al., Blood 98:3600-3606 (2001)). Furthermore,
studies with pdFIX have shown that subjects 15 years of age and
younger have a significantly lower recovery than those who are
older (White et al., Thromb. Haemost. 73:779-84 (1995)). Therefore,
monitoring of trough and peak levels will also be performed in the
pediatric studies.
[0203] Since studies have shown that children may respond
differently compared to adults, pharmacokinetic assessments at
baseline with 50 IU/kg of rFIXFc will be performed in children with
abbreviated pharmacokinetic sampling.
[0204] The Phase 1/2a study (SYN-FIXFc-07-001) evaluating the
safety and pharmacokinetics profile of a single intravenous
administration of rFIXFc in PTPs aged 18 years and above with
severe hemophilia B was recently completed. Preliminary results
from this initial exploration in humans demonstrates an
approximately 3-fold increase in pharmacokinetic parameters (mean
terminal half-life, MRT, and AUC) of rFIXFc compared with what has
been reported in the literature for BENEFIX.TM. (see above).
Additionally, rFIXFc was well tolerated and there were no sign of
injection site reactions as well as no development of inhibitors.
Together, these safety and pharmacokinetic results support the
initiation of a Phase 1/2/3 registrational study (998HB102 Study
(B-LONG), see above) evaluating the safety, pharmacokinetics, and
efficacy of rFIXFc in prevention and treatment of bleeding in 104
PTPs (with at least 100 treatment EDs to previous products) 12
years and older with severe hemophilia B (<2%). Once sufficient
safety data are available from the registrational study, a
pediatrics program will be initiated to further investigate the
safety and efficacy of rFIXFc in children. The demonstration of
prolonged half-life of rFIX in humans will mean that less frequent
injections will be needed for the prevention and treatment of
bleeding to individuals with hemophilia B.
[0205] Phase 2/3 Pediatric PTPs Study in Previously Treated
Children (<12 Years Old)
[0206] Once the data are available on 10 PTPs (.gtoreq.12 years)
for 26 EDs from the registrational study (998HB 102 Study), a
Pediatric Study, phase 3 will be initiated. This Phase 2/3
pediatric study, in PTPs who had at least 50 EDs to FIX products
prior to enrollment, will be conducted globally at approximately 25
clinical sites. Approximately 25 PTPs (to ensure 20 evaluable
subjects), age 2-11 years with severe hemophilia B (<2 IU/dL
[<2%] endogenous FIX), will be screened and selected according
to the pre-defined criteria. All evaluable subjects will complete
the pharmacokinetic portion of the study (PK with pre-study FIX
product and then PK with rFIXFc) and will receive weekly dosing of
rFIXFc for 52 weeks. This study will record incremental recovery,
in vivo half-life, AUC, and clearance of rFIXFc. All subjects will
undergo pharmacokinetic assessment at baseline with pre-study FIX
and rFIXFc and the duration of the study for each subject will be
approximately 69 weeks, including screening and follow-up.
[0207] Each subject will receive 50 IU/kg of rFIXFc at baseline for
pharmacokinetic assessment followed by repeated weekly dosing with
50-60 IU/kg of rFIXFc. With regard to patient compliance,
abbreviated pharmacokinetic sampling will be employed for pre-study
product and for rFIXFc as follows: pre dose, end of injection,
30+10 minutes, 3.+-.1 hours, 24.+-.3 (Day 1), 72.+-.3 (Day 3),
120.+-.3 (Day 5), and 168.+-.3 hours (Day 7) after the end of
injection. In order to address immunogenicity, all subjects will be
treated with rFIXFc weekly for a minimum of 50 EDs. Safety
parameters will be included for immediate safety and tolerability
assessment, such as: (a) vital signs (pulse, blood pressure,
respiratory rate, temperature) at pre rFIXFc injection and 30
minutes post injection; (b) hematology and coagulation parameters;
(c) clinical chemistry; (d) frequent FIX inhibitor determinations
using the Nijmegen-modified Bethesda assay (immediately before
first exposure, ED4 [Week 4], ED12, ED24, ED36, and ED50); and (e)
adverse events.
[0208] Efficacy will be assessed by evaluation of number of
bleeding episodes, bleeding intervals and number of treatments and
consumption of FIX per annualized year and per event.
[0209] Phase 2/3 Pediatric PUPs Study in Previously Untreated
Children (0-11 Years Old)
[0210] Once the data from 10 previously-treated children (2-11
years) with complete pharmacokinetics and 50 EDs are available in
the preceding study, a Phase 2/3 pediatric PUPs study will be
initiated. This study will be conducted globally at approximately
60 clinical sites. Up to 30 PUPs (to ensure 20 evaluable subjects)
for 0 and above years with severe hemophilia B (<2 IU/dL
[<2%] endogenous FIX) will be screened and selected according to
the pre-defined criteria.
[0211] Participation in the study will vary since the initiation
treatment may begin using rFIXFc as modified prophylaxis regimen.
Per patient study participation is expected to be approximately
four years including screening and follow-up. During this time most
patients are expected to achieve 50 EDs to rFIXFc. In order to
address immunogenicity, all subjects will be treated with
approximately 50 EDs of rFIXFc or for up to 4 years. Safety
parameters will be included for immediate safety and tolerability
assessment: (a) frequent FIX inhibitor determinations using the
Nijmegen-modified Bethesda assay; and (b) adverse events.
[0212] Efficacy will be assessed by evaluation of number of
bleeding episodes, bleeding intervals and number of treatments and
consumption of FIX per annualized year and per event.
Example 5. Biochemical Characterization, Activity, and PK Analysis
in Non-Human Animals
[0213] The rFIXFc produced in Example 3 was characterized for its
posttranslational modification, and the following results were
obtained (see Table 15 and FIG. 11). The propeptide of rFIXFc was
properly processed during production. rFIXFc's gamma-carboxylation
pattern was similar to that of rFIX. Further, total Gla/molecule
(11.2.+-.0.7) of rFIXFc was comparable to rFIX. Because
gamma-carboxylation at certain residues is essential for FIX
activity, these are important results. In addition, Ser 158
phosphorylation and Tyr 155 sulfation of rFIXFc were comparable to
rFIX. N-linked glycans in FIX are not fully sialylated, similar to
rFIX. rFIXFc O-linked glycosylation in the first EGF domain was the
same as FIX, albeit in different relative ratios. Asp 64 of rFIXFc
had a higher degree of beta-hydroxylation than rFIX or plasma
derived FIX (pdFIX). Activated FIX was present at a much lower
level in the rFIXFc preparation than in the rFIX or pdFIX
preparations, as is discussed in detail in Example 3.
[0214] In addition, rFIXFc was administered to various animal
species to determine its activity and PK parameters. The results
are shown in Table 16 and FIGS. 12-16.
Example 6. Gamma-Carboxylation
[0215] The goals of this study were to analyze and characterize
.gamma.-carboxylation of the glutamic acids (Gla) in a preclinical
lot of FIXFc material and commercially available FIX products, to
characterize the Gla content of an enriched "peak" fraction and a
high salt elution "strip" fraction originating from a
pseudo-affinity chromatography ion-exchange step, and to further
separate an enriched "peak" and a high salt elution "strip"
fraction by anion-exchange HPLC and further characterize the
separated species.
[0216] To achieve these goals, a number of complementary analytical
methods were developed. These include amino acid analysis (AAA)
using basic hydrolysis to determine (total) Gla content, peptide
map (LC/MS) using Lys-C peptides to determine Gla distribution,
analytical anion-exchange HPLC of intact molecules to separate
isoforms, and activated partial thromboplastin time (aPTT) to
determine biological activity.
[0217] The two Gla (E) containing peptides are: [0218] K1K2:
YNSGKL.sup.7E.sup.8EFVQGNL.sup.15ER.sup.17ECM.sup.20E.sup.21EK
[0219] [M+H]+6 Gla=2953.9 [0220] [M+H]+5 Gla=2909.9 [0221] K3:
CSF.sup.26E.sup.27EAR.sup.30EVF.sup.33ENT.sup.36ERTT.sup.40EFWK
[0222] [M+H]+6 Gla=2959.9 [0223] [M+H]+5 Gla=2915.9 [0224] [M+H]+4
Gla=2871.9
[0225] Thirty micrograms of sample (originating from the enriched
peak fraction, high salt strip fraction and each species from the
analytical anion-exchange HPLC) was denatured, reduced, alkylated
and digested with Lys-C (1:20, E:S). The digest was quenched with
2% TFA and injected onto a Jupiter C18 (2.0.times.250 mm)
Phenomenex column. Separation was performed on an Agilent 1100
system. The column was maintained at 25.degree. C. and peptides
were eluted with a multi-step acetonitrile gradient. Mass
spectrometry (Thermo-Fisher LCQ) was performed in "Triple Play"
mode.
[0226] Complementary methods were developed to analyze and
characterize the Gla content and distribution of preclinical rFIXFc
material. The .gamma.-carboxylation of glutamic acids (Gla) content
and distribution in a preclinical lot of rFIXFc (enriched peak
fraction) was performed and compared to commercially available
products. Analysis demonstrated similar Gla content and
distribution with respect to commercially available products. A
high salt elution "strip" fraction was analyzed and compared to the
enriched peak fraction. Analysis indicated a reduced level of
.gamma.-carboxylation.
[0227] The FIXFc (Enriched Peak Fraction) was isolated from
pseudo-affinity chromatography ion-exchange step and further
separated into 3 iso-forms by analytical anion exchange HPLC. AEX
column load and separated species were highly .gamma.-carboxylated.
(The AEX column load is the strip fraction collected during a high
salt elution step from the pseudo-affinity chromatography
ion-exchange step.) AEX column load and separated species were
biologically active. The Gla content and distribution was similar
to rFIX. The peptide map indicates distribution of 4/5/6 Gla's on
the K3 peptide. The peptide map indicates a high population of 6
Gla's on the K1K2 peptide and a trace level of 5 Gla's.
[0228] The FIXFc (Strip Peak Fraction) was isolated from
pseudo-affinity chromatography ion-exchange step and further
separated into 2 iso-forms by analytical anion exchange HPLC. AEX
column load and separated species were reduced in
.gamma.-carboxylation level. There was reduced Gla content relative
to FIXFc enriched peak fraction. A decreased level of biological
activity was observed. The peptide map indicates an increased
population of 5 Gla's in K1K2 relative to the enriched peak
fraction and may suggest an impact on biological activity.
[0229] References (each of which is incorporated by reference
herein in its entirety): Dumont J A, et al., Monomeric Fc Fusion
Molecules in Therapeutic Abs--From Bench to Clinic, Ch. 33 p
779-795; Gillis S, et al., Protein Science (1997) 6:185; White G C,
et al., J. Thrombosis and Haemostasis (1997) 78:261; Hansson K, and
Stenflo J, Journal Thrombosis and Haemostasis (2005) 3:2633; and
Peters R T, et al., Blood (2010) 115:2057.
Example 7. Evaluation of rFIXFc Pro-Coagulant Activity in HemB Mice
Bleeding Models
[0230] Comparable Potency of rFIXFc and BENEFIX.TM. was
Demonstrated in HemB Mouse Whole Blood ROTEM In Vitro and in a HemB
Mouse Tail Clip Bleeding Model In Vivo.
[0231] The ability of rFIXFc to form firm and stable clots was
evaluated by Rotation Thromoboelastometry (ROTEM.RTM., Pentapharm
GmbH, Munich, Germany) with Calcium Chloride as activator (NATEM).
Pooled whole blood collected via the vena cava from HemB mice was
divided into seven aliquots, which were spiked with rFIXFc to a
final concentration of 7.4%, 0.74% and 0.074% of normal plasma FIX
activity, or BENEFIX.TM. to 10%, 1%, 0.1% of normal. As a negative
control, a blood sample was spiked with FIX formulation buffer. A
total of 10 blood pools from 5 HemB mice were generated to complete
the assessment. The NATEM reaction was initiated by the addition of
CaCl.sub.2. Coagulation parameters, including Clotting Time (CT),
Clot Formation Time (CFT) and Alpha Angle were assessed. The mean
and SD of CT, CFT and alpha angle are summarized in Table 17. The
dose responses for the three parameters are plotted in FIG. 17. All
three parameters are comparable between rFIXFc and BENEFIX.TM. in
the dose range tested (p>0.05 by one-way ANOVA (Kruskal-Wallis)
analysis).
[0232] Acute efficacy of rFIXFc was also evaluated in HemB mouse
Tail Clip bleeding model. (FIG. 18.) Male HemB mice were stratified
for equal presentation of body weight and age in different
treatment groups. Prior to tail clip injury, mice were anesthetized
with a cocktail of 50 mg/kg Ketamine and 0.5 mg/kg Dexmedetomidine
and placed on a heating pad to help maintain the body temperature.
The tails of the mice were then immersed in 37.degree. C. water for
10 minutes to dilate the lateral vein. After the vein dilation,
rFIXFc, BENEFIX.TM. or vehicle were injected via the tail vein and
5 min later, the distal 4 mm of the tail were then cut off using a
#11 scalpel with straight edge. The shed blood was collected into
13 ml of warm saline for 30 minutes and the blood loss was
quantified gravimetrically. Six rFIXFc treatment groups (720, 360,
240, 120, 80, 40 IU/kg, n=15) and three BENEFIX.TM. treatment
groups (360, 120, 40 IU/kg, n=15) were tested. The individual
animal's blood loss value and dose response curve of median blood
loss are shown in FIG. 19(A), and the median blood loss volume of
each treatment group is summarized in Table 18. The dose response
in median blood loss volume for both rFIXFc and BENEFIX.TM. are
comparable (p=0.9315 by unpaired t test with Welch's
correction).
[0233] To determine if the three-fold extended half-life of rFIXFc
relative to BENEFIX.TM. resulted in prolonged efficacy of rFIXFc,
the present inventors evaluated the efficacy of rFIXFc and
BENEFIX.TM. in both ex-vivo ROTEM.RTM. assay and Tail Vein
Transection bleeding model (TVT) in HemB mice. FIG. 20.
[0234] For ex vivo ROTEM.RTM., male HemB mice received 50 IU/kg of
rFIXFc or 100 IU/kg of BENEFIX.TM. by intravenous injection. Whole
blood was collected from the vena cava of treated animals at 5 min,
24, 72, 96, 120, 168, and 216 hour post rFIXFc dosing (n=8 mice at
each time point) or at 5 min, 24, 48, 72, and 96 hour post
BENEFIX.TM. dosing (n=4 mice/time point). Blood samples were
analyzed immediately by NATEM. The mean and SD for CT, CFT, and
alpha angle are shown in Table 19, and the CT, CFT and alpha-angle
versus time curves are shown in FIG. 21. In comparison to
BENEFIX.TM., rFIXFc showed comparable CT, CFT, and alpha angle at 5
min, but significantly improved CT, CFT and alpha angle after 72
hrs despite a 2-fold lower dose relative to BENEFIX.TM..
[0235] To evaluate the prophylactic efficacy of rFIXFc and
BENEFIX.TM., male HemB mice were stratified for equal
representation of body weight and age in 9 different treatment
groups. rFIXFc was administered by iv injection at a dose of 4
IU/kg, 13 IU/kg, 40 IU/kg and 120 IU/kg at 72 hours prior to tail
vein transaction, whereas the same doses of BENEFIX.TM. was
administered at 24 hour prior to the injury. Prior to tail vein
transection, mice were anesthetized with a cocktail of 50 mg/kg
Ketamine/0.125 mg/kg Dexmedetomidine/0.1 mg/kg Buprenex. In order
to allow the mice to maintain normal activity following tail vein
transection, 1 mg/kg Atipamezole solution was given to reverse the
effect of Dexmedetomidine, which immediately followed by the
lateral tail vein transection with a straight edged number 11
surgical blade at an area where the diameter of the tail is
approximately 3 mm. The shedding blood was washed away with warm
saline to ensure clear observation of the wound, and the mouse was
then single-housed in a clean cage with white paper bedding for the
next 24 hours. The re-bleed and the physical activity were observed
and recorded hourly up to 12 hour post injury. Moribund mice were
euthanized immediately after identification, and a 24 hour post
injury checkup was performed to complete the study. The
Kaplan-Meier curve for Time to Euthanasia and chart of survival
rates 24 hour post TVT were shown in FIG. 22. The Log-rank test
determined that all treatment groups with higher than 4 IU/kg dose
are significantly better than vehicle group (p<0.001).
Furthermore, survival is comparable between mice that received the
same dose of rFIXFc at 72 hrs prior to injury as that of
BENEFIX.TM. at 24 hrs prior to injury (p=0.4886, 0.9268, 0.7279 and
0.5209 for 4, 13, 40 and 120 IU/kg dose groups respectively). The
survival rates at 24 hour post TVT were plotted and ED50 value for
each molecule were extrapolated from the curve, the ED50 for the
two treatments are similar at 17.8 IU/kg for rFIXFc and 15.4 IU/kg
for rFIX. Therefore, rFIXFc provided 3-fold longer duration of
protection in HemB mice relative to a comparable dose of
BENEFIX.TM. as measured by survival and re-bleed following tail
vein transection injury. Therefore, rFIXFc provided 3-fold longer
duration of protection in HemB mice relative to a comparable dose
of BENEFIX.TM. as measured by survival and rebleed following tail
vein transection injury.
[0236] In conclusion, as the data show, whereas 15.4 IU/kg of
BENEFIX.TM. resulted in 50% of HemB mice surviving the tail vein
transection at 24 hrs post dosing, 17.8 IU/kg of rFIXFc achieved
50% survival in animals that were injured at 72 hrs post dosing.
Therefore, rFIXFc demonstrates a 3-fold longer prophylactic
efficacy in correlation with its half-life extension relative to
BENEFIX.TM.. The results from the bleeding models are further
corroborated by ex vivo ROTEM.RTM. analysis of whole blood from
HemB mice treated with either 100 IU/kg of BENEFIX.TM. or 50 IU/kg
of rFIXFc. At 5 min post dosing, comparable improvement in clot
formation were observed in both treatment groups. However, the
major ROTEM.RTM. parameters such as the clotting time, clot
formation time and alpha-angle were significantly improved in
rFIXFc-treated mice at 72 to 216 hrs following dosing despite a
2-fold lower dose of rFIXFc relative to BENEFIX.TM..
[0237] In summary, the acute potency of rFIXFc is comparable to
that of BENEFIX.TM. as shown in both whole blood ROTEM.RTM. in
vitro and the tail clip bleeding model in HemB mice. The prolonged
prophylactic efficacy of rFIXFc was shown in ex vivo whole blood
ROTEM.RTM. from treated HemB mice and was determined to be
approximately 3-fold longer in comparison to BENEFIX.TM. in the
tail vein transection bleeding model in HemB mice. The prolonged
efficacy of rFIXFc correlates well with the 3-fold longer T.sub.1/2
of rFIXFc relative to BENEFIX.TM. previously demonstrated in
pharmacokinetic study in HemB mice. Therefore, rFIXFc is fully
active for on-demand treatment while achieving significantly
prolonged prophylactic protection with the potential to reduce the
dosing frequency, which are under investigation in the phase 3
study.
Example 8. Pharmacokinetic and Pharmacodynamic Analysis of rFIXFc
and BENEFIX.TM. Following a Single Subcutaneous Dose in
FIX-Deficient Mice
[0238] The pharmacokinetic (PK) and pharmacodynamic (PD) profiles
of recombinant Factor IX-Fc (rFIXFc) and BENEFIX.TM. (rFIX) were
determined following a single intravenous or subcutaneous injection
of 200 or 400 IU/kg in FIX-deficient mice. Whole blood was
collected via vena cava (n=4 mice/timepoint/treatment). The
concentrations of rFIXFc and BENEFIX.TM. in plasma were determined
using a human FIX-specific ELISA. The activities of rFIXFc and
BENEFIX.TM. were determined using an activated partial
thromboplastin time (aPTT) assay. PK analyses were performed using
model-dependent methodology using WinNonLin. Results are shown in
Tables 22 and 23.
[0239] For FIXFc, the bioavailability in FIX-deficient mice was 38%
for the 200 IU/kg dose and 38-46% for the combined dose (antigen
ELISA) and 29% for the 200 IU/kg dose and 29-39% for the combined
dose (aPTT activity assay) compared to rFIX, 23% and 19%,
respectively. The rFIXFc had 1.5-1.7 fold (200 IU/kg dose) and
1.5-2.5 fold (combined doses) improved bioavailability compared to
BENEFIX.TM..
[0240] For rFIXFc, the terminal half-life (antigen ELISA) was 62 hr
for the 200 IU/kg dose and 51-62 hr for the combined doses and the
terminal half-life (aPTT activity assay) was 42 hr for the 200
IU/kg dose and 40-42 hr for the combined doses, whereas for
BENEFIX.TM. the terminal half-life was 24 hr (antigen ELISA) for
the 200 IU/kg dose and 17 hr (aPTT activity assay) for the 200
IU/kg dose. This indicates a 2.5-2.6 fold (200 IU/kg dose and
combined dose) improvement in half-life with rFIXFc.
[0241] In addition, as Tables 22 and 23 show, rFIXFc had 4.5-5.6
fold increase in AUC/dose and a 1.9-3.7 fold increase in Cmax/dose
versus BENEFIX.TM..
[0242] Recombinant factor IX Fc fusion (rFIXFc) protein is a
long-acting form of recombinant FIX (rFIX) that will provide less
frequent dosing of rFIX for treatment of hemophilia B. From mice to
non-human primates and in hemophilia B patients, rFIXFc has an
approximately 3-fold longer half-life versus rFIX (BENEFIX.TM.).
For prophylactic treatment, intravenous delivery of rFIX remains a
burdensome delivery method, especially for children and in patients
with poorly accessible veins. Subcutaneous administration of rFIX
presents as a more attractive delivery route that is less invasive
and with less frequent dosing. As such, subcutaneous delivery of
rFIXFc will cause less pain and discomfort than intravenous
delivery and result in improved compliance due to being easier to
administer and administered in less time than an intravenous route.
Prophylaxis regimens will also improve quality-of-life and clinical
outcomes will include decreased bleeding incidences.
[0243] The concentration of rFIXFc in mouse plasma was measured
using a human FIX-specific ELISA that measured the FIX portion of
the molecule and the mg/kg nominal dose was used in the analysis. A
summary of the PK parameters for rFIXFc and BENEFIX.TM. are shown
in Table 20 (antigen ELISA) and Table 21 (aPTT activity assay) for
n=4/group. Both analysis by antigen and activity showed that the
Cmax and AUC were significantly improved for rFIXFc versus
BENEFIX.TM.. Using the antigen ELISA, the bioavailability (F %) was
38% for rFIXFc versus 23% for BENEFIX.TM.. Similarly, using the
aPTT activity assay, the bioavailability was 29% for rFIXFc versus
19% for BENEFIX.TM.. Thus, rFIXFc demonstrated an increase in
bioavailability over BENEFIX.TM. by 1.5 to 1.6 fold. Measurements
of elimination half-life showed that rFIXFc markedly increased the
half-life whether measured by antigen (rFIXFc 62 hr versus
BENEFIX.TM. 24 hr) or activity (rFIXFc 42 hr versus BENEFIX.TM. 17
hr) assays. These data show that rFIXFc had an extended half-life
compared to BENEFIX.TM. by 2.6 to 2.5 fold.
[0244] The rFIXFc given subcutaneously to FIX-deficient mice
demonstrated a PK and PD profile with increases in Cmax and AUC for
rFIXFc compared to BENEFIX.TM.. Overall, the bioavailability for
rFIXFc ranged from 29% (activity) to 38% (antigen) with a half-life
of 42 hr (activity) to 62 hr (antigen) compared to BENEFIX.TM.,
which had bioavailability from 19-23% and half-life from 17-24%,
respectively. Thus, the half-life for rFIXFc delivered
subcutaneously in FIX-deficient mice demonstrated about a 2.2
(antigen) to 3.3 (activity) fold increase over currently marketed
rFIX products given intravenously. Overall, these data support the
notion that rFIXFc delivered subcutaneously will be of clinical
benefit for prophylactic treatment in hemophilia B patients.
Example 9. Pharmacokinetic Analysis of rFIXFc Following a Single
Subcutaneous Dose in Cynomolgus Monkeys
[0245] The pharmacokinetic (PK) profile of recombinant Factor IX-Fc
(rFIXFc) was studied after a single subcutaneous dose of 50 IU/kg,
100 IU/kg or 200 IU/kg in cynomolgus monkeys. The concentration of
rFIXFc in plasma was measured using a FIX-specific ELISA. Primary
analysis was performed using model-dependent methodology using
WinNonLin. See Tables 22-25.
[0246] Pharmacokinetic analysis of the plasma concentration versus
time data (measured by FIX-specific ELISA) demonstrated that the
bioavailability and terminal half-life were similar among doses.
The bioavailabilities for rFIXFc were 40% (50 IU/kg), 34% (100
IU/kg), 36% (200 IU/kg), and 36-45% (combined doses) The terminal
half-lives for rFIXFc were 61 hr (50 IU/kg), 45 hr (100 IU/kg), 49
hr (200 IU/kg), and 44-58 hr (combined doses).
[0247] The concentration of rFIXFc in monkey plasma was measured
using a FIX-specific ELISA that measured the FIX portion of the
molecule and the mg/kg nominal dose was used in the analysis. Spike
and recovery analysis demonstrated the accuracy of this
FIX-specific ELISA assay for detecting rFIXFc over the range of
plasma concentrations assessed. A summary of the PK parameters for
rFIXFc are shown in Table 22 (50 IU/kg), Table 23 (100 IU/kg) and
Table 24 (200 IU/kg) for n=3/group. For rFIXFc SC, the geometric
means and CV % of the geometric mean for Cmax were 860+22 (50
IU/kg), 1630+97 (100 IU/kg) and 3,750+26 (200 IU/kg), respectively
indicating a dose-dependent increase. Similar increases were seen
for AUC. The geometric means for bioavailability (F %) were 40+16
(50 IU/kg), 30+75 (100 IU/kg) and 36+27 (200 IU/kg), demonstrating
that bioavailability was similar among doses. Measurements of
terminal half-life showed that the half-life was similar among
doses at 58+39 hr (50 IU/kg), 45+13 hr (100 IU/kg) and 46+44 hr
(200 IU/kg).
[0248] The rFIXFc given subcutaneously to cynomolgus monkeys
demonstrated a PK profile with dose-dependent increases in Cmax and
AUC. Overall, the bioavailability ranged from 30-40% with a
half-life of 45-58 hr. Thus, the half-life for rFIXFc delivered
subcutaneously in monkeys demonstrated about a 2.8-fold increase
over currently marketed rFIX products given intravenously. Overall,
these data support the notion that rFIXFc delivered subcutaneously
will be of clinical benefit for prophylactic treatment in
hemophilia B patients.
Example 10. Predicted Prophylactic Dosing Regimens
[0249] In comparison with the standard recommended dose regimen of
25 to 40 IU/kg of FIX twice or three times weekly, the median
rFIXFc activity PK results from the Phase 1/2a study described
above suggest that about once weekly dosing of rFIXFc at about 22.5
IU/kg, or about every 10 days at about 45 IU/kg, or about every 2
weeks at about 120 IU/kg is sufficient to maintain a trough of 1%
above baseline (FIG. 24). These model simulated estimates are
validated by the available data from the Phase 1/2a trial, which
fall entirely within the 95% confidence interval of the simulated
activity-over-time curve. These regimens will often serve at the
beginning of therapy. Considering the heterogeneity of reported
clinical breakthrough bleeding events relative to trough level of
plasma FIX activity, maintenance doses will need to be adjusted
individually.
[0250] After recalculation of the PK results from the Phase 1/2
study (see Example 11), the new predicted dosing regimen, e.g., for
prophylaxis, is 20 IU/kg once weekly, 40 IU/kg every 10 days, or
100 IU/kg every two weeks (twice monthly). See also Table 27 and
FIG. 25.
Example 11. Recalculation of Pharmacokinetic Data from First in
Human (FiH) Study (Example 1)
[0251] Subjects with a variety of hemophilia B genotypes, such as
stop codon/nonsense and missense mutations, were included in the
FiH study discussed in Example 1. Several subjects had markedly
reduced endogenous FIX antigen levels which correlated with
markedly reduced FIX activity, while a few subjects with missense
genotypes had more antigen than measured activity, indicating a
dysfunctional circulating protein. The pre-treatment FIX activity
in 2 subjects exceeded 2 IU/dL, likely due to an incomplete washout
from their last infusion of FIX concentrate based on historical
testing and disease phenotype. Based on this information, the PK
data from Example 1 was recalculated without baseline subtraction,
as is described below in detail. See Table 27.
[0252] In contrast to the PK calculations (based on activity) in
Example 1, if the rFIXFc activity PK is modeled without baseline
subtraction, as was recently reported for the PK analysis of a
glycoPEGylated rFIX (Negrier et al., Blood DOI 10.1182/blood 2011
02 335596 (2011), which is herein incorporated by reference in its
entirety), the resulting estimates of elimination half-life and MRT
are much longer than the estimates in Example 1, at 82.2.+-.21.6
and 96.8.+-.22.0 hours (mean.+-.SD), respectively. However, with
the knowledge that not all severe hemophilia B patients have 0%
endogenous FIX activity, and taking into account patient's genotype
and endogenous FIX antigen level, the present inventors adopted a
baseline subtraction analysis method in their PK modeling.
Specifically, (a) the baseline in two patients was defined as 0%
because their pretreatment FIX activity was <1%, they had no
detectable FIX antigen and had nonsense genotypes, (b) the baseline
for three patients was set at 0.5% because their pretreatment FIX
activity was <1% and they had detectable FIX antigen, (c) for
patients whose pretreatment FIX activity was between 1-2%, Cmin
(the lowest activity throughout the PK study) was defined as
baseline, and (d) for patients whose pretreatment FIX activity was
.gtoreq.2%, 2% (which was the upper limit for enrollment into the
trial) was the baseline. Activity above the baseline pre-dosing was
considered residue drug from prior treatment, and was decayed to
baseline and subtracted from the PK data following rFIXFc
dosing.
[0253] The resulting mean terminal half-life (56.7.+-.10.9 hours,
range 42.4-74.5 hours) and MRT (71.8.+-.10 hours, range 53.2-85.9
hours) of rFIXFc are approximately 3-fold longer than that reported
for rFIX. The reported terminal half-life of rFIX is 19.3.+-.4.97
hours (range 11.1-36.4 hours) and MRT 26.0.+-.6.07 hours (range
15.8-46.1 hours). Roth et al., Blood 98: 3600-3606 (2001); and
Summary of Product Characteristics for BENEFIX.TM., Electronic
Medicines Compendium (2010)
(worldwideweb.medicines.org.uk/emc/medicine/20376/SPC/BENEFIX.TM./#PHARMA-
CODY NAMIC_PROPS), each of which his incorporated herein by
reference in its entirety. Thus, the ranges for rFIXFc do not
overlap the ranges for rFIX. Similarly, the mean CL of rFIXFc
activity (3.18.+-.0.78 mL/hr/kg, range 2.05-4.18 mL/hr/kg) is
approximately 2.6-fold less than that reported for rFIX
(8.40.+-.2.01 mL/hr/kg, range 4.66-13.64 mL/hr/kg), while the
V.sub.SS of both proteins are comparable at 4-5 times the plasma
volume.
[0254] Although the same trend toward improvement was observed in
the rFIXFc antigen PK, both the T.sub.1/2.alpha. and
T.sub.1/2.beta. of rFIXFc antigen were significantly longer than
that derived from FIX activity measurements. The T.sub.1/2.alpha.
estimated for rFIXFc antigen clearly deviates from that normally
associated with FIX (2-3 hours). Furthermore, the probable
incomplete washout from the pre-study replacement therapy before
infusion of rFIXFc sometimes resulted in a higher baseline value,
which in turn could lead to an underestimation of the rFIXFc
T.sub.1/2.beta., as measured by FIX activity. A number of subjects
had an aPTT activity up to 3 IU/dL, well above the limit of
quantification (1 IU/dL) for the aPTT assay, at later time points
up to 336 hrs (14 days) post-dose. However, these time points were
excluded from the estimation of the terminal half-life because the
values were at or only slightly above pretreatment baselines, thus
deemed to have returned to baseline. In contrast, the low but
detectable terminal levels of rFIXFc may be unmasked by the
specific and highly sensitive rFIXFc antigen ELISA, which detects
as low as 0.1 IU/dL as compared to aPTT lower limit of 1.0
IU/dl.
[0255] The remaining PK parameters (activity) changed a small
amount relative to elimination half-life and MRT. See Table 27(B).
A dose-proportional, linear increase in FIX activity was observed
based on C.sub.max occurring immediately after infusion and
AUC.sub.INF (Table 4). FIX activity exhibited biexponential decay
following infusion of rFIXFc, and was characterized by a rapid
distribution (alpha) phase followed by a log-linear elimination
(beta) phase. The mean distribution half-life (T.sub.1/2.alpha.)
was highly variable for individual subjects (mean of 3.4 and 10.3
hours for the two higher dose groups) (Table 27(B)). The mean
elimination half-life (T.sub.1/2.beta.) was dose independent over
the therapeutic dose range tested, i.e., 53.5 hours, 57.5.+-.8.2
hours, and 56.5.+-.14.1 hours at 25 IU/kg, 50 IU/kg, and 100 IU/kg,
respectively. The time to 1% (1 IU/dL) above baseline, an
assessment of rFIXFc activity, showed a dose-proportional increase.
It was 7.3, 10.1.+-.1.5, and 12.3.+-.2.5 days for doses of 25, 50,
and 100 IU/kg, respectively. At 168 hours (1 week) post dose, the
plasma FIX activity was sustained at 1.1 IU/dL, 2.5.+-.0.9 IU/dL,
and 4.6.+-.1.7 IU/dL above baseline for the 25, 50, and 100 IU/kg
dose groups, respectively. Also dose-independent were MRT, CL, and
V.sub.SS over the dose range of 25 to 100 IU/kg. Furthermore, each
1 IU/kg of infused rFIXFc raised plasma FIX activity by
0.93.+-.0.18 IU/dL on average (Table 27(B)), and this incremental
recovery (K) showed weak positive correlation with body weight
(R.sup.2=0.336, p=0.048)
[0256] Long-term empirical clinical experience has suggested that a
sustained plasma factor activity as low as 1 to 2 IU/dL will be
adequate to prevent spontaneous bleeding events in severe
hemophilia A and B patients, (Nilsson et al., J. Intern. Med.
232:25-32 (1992), which is herein incorporated by reference in its
entirety), and increased bleeding events are associated with the
amount of time under 1% of normal FVIII activity. Collins et al.,
Thromb Haemost 7:413-420 (2009), which is herein incorporated by
reference in its entirety. Thus, PK analyses provide a means to
optimize prophylactic treatment with individualized dose modeling
to achieve sustained trough levels above 1% (1 IU/dL) of baseline,
reduce peak/trough variation, and improve the cost effectiveness of
treatment. Carlsson et al., Haemophilia 4:83-88 (1998); Kisker et
al., Haemophilia 9:279-284 (2003), each of which is herein
incorporated by reference in its entirety.
[0257] To construct the concentration-time profiles following
different dosing regimens, Monte Carlo simulation was conducted
using the population PK model of rFIXFc. The mean estimates of
model parameters (CL, volume of distribution, inter-compartmental
clearance, and volume of the second compartment) in the tested
population, the inter-individual variance, and the residual
variability were adopted for this Phase1/2a study. Wang et al., J.
Clin. Pharmacol. 49:1012-1024 (2009), which is herein incorporated
by reference in its entirely. One thousand subjects were simulated
per dosing regimen with 14 to 16 sampling points for each subject.
There were 14 sampling points for weekly dosing, 15 for every 10
day dosing, and 16 for every other week dosing. The body weight
(BW) was generated according to the published method, Wang et al.
(2009). i.e., based on a power equation of Z=BW-0.5. The median BW
in 1000 subjects was assumed to be 75 kg. Based on the simulated
concentration-time profiles, the mean.+-.standard deviation (SD) of
the drug concentration-time profiles of the 1000 subjects was
constructed graphically for different dosing regimens. FIG. 25.
[0258] In comparison with the standard recommended dose regimen of
25 to 40 IU/kg of FIX twice weekly, the median rFIXFc activity PK
modeling results from this study show that once weekly dosing of
rFIXFc at 20 IU/kg, or every 10 days at 40 IU/kg, or every 2 weeks
at 100 IU/kg is sufficient to maintain a trough of 1% above
baseline. FIG. 25. These model-simulated estimates are validated by
the available data from this Phase 1/2a study, which fall entirely
within the 95% confidence interval of the simulated
activity-over-time curve. However, considering the heterogeneity of
reported clinical breakthrough bleeding events relative to trough
level of plasma FIX activity (Bjorkman, Haemophilia 9:101-110
(2003); Ahnstrom et al., Haemophilia 10:689-697 (2004), each of
which is herein incorporated by reference in its entirety), the
maintenance dose would likely require individual adjustment.
Tables
TABLE-US-00001 [0259] TABLE 1 Polynucleotide Sequences: FIX-Fc A.
FIX-Fc Chain DNA Sequence (SEQ ID NO: 1, which encodes SEQ ID NO:
2) pSYN-FIX-030 Nucleotide sequence (nt 1 to 7583): FIX exon 1
(signal peptide, 1st amino acid propeptide): nt 690-777 FIX mini
intron: nt 778-1076 FIX propeptide sequence: nt 1077-1126 Mature
FIX sequence: nt 1127-2371 Fc: nt 2372-3052
gcgcgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatat-
a
tggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacg-
t
caataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacgg-
t
aaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaa-
t
ggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtc-
a
tcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggattt-
c
caagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgt-
a
acaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctgg-
c
taactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggagacccaagcttcgcga-
c
gtacggccgccaccatgcagcgcgtgaacatgatcatggcagaatcaccaggcctcatcaccatctgcctttta-
g
gatatctactcagtgctgaatgtacaggtttgtttccttttttaaaatacattgagtatgcttgccttttagat-
a
tagaaatatctgatgctgtcttcttcactaaattttgattacatgatttgacagcaatattgaagagtctaaca-
g
ccagcacgcaggttggtaagtactgtgggaacatcacagattttggctccatgccctaaagagaaattggcttt-
c
agattatttggattaaaaacaaagactttcttaagagatgtaaaattttcatgatgttttcttttttgctaaaa-
c
taaagaattattcttttacatttcagtttttcttgatcatgaaaacgccaacaaaattctgaatcggccaaaga-
g
gtataattcaggtaaattggaagagtttgttcaagggaatctagagagagaatgtatggaagaaaagtgtagtt-
t
tgaagaagcacgagaagtttttgaaaacactgaaagaacaactgaattttggaagcagtatgttgatggagatc-
a
gtgtgagtccaatccatgtttaaatggcggcagttgcaaggatgacattaattcctatgaatgttggtgtccct-
t
tggatttgaaggaaagaactgtgaattagatgtaacatgtaacattaagaatggcagatgcgagcagttttgta-
a
aaatagtgctgataacaaggtggtttgctcctgtactgagggatatcgacttgcagaaaaccagaagtcctgtg-
a
accagcagtgccatttccatgtggaagagtttctgtttcacaaacttctaagctcacccgtgctgagactgttt-
t
tcctgatgtggactatgtaaattctactgaagctgaaaccattttggataacatcactcaaagcacccaatcat-
t
taatgacttcactcgggttgttggtggagaagatgccaaaccaggtcaattcccttggcaggttgttttgaatg-
g
taaagttgatgcattctgtggaggctctatcgttaatgaaaaatggattgtaactgctgcccactgtgttgaaa-
c
tggtgttaaaattacagttgtcgcaggtgaacataatattgaggagacagaacatacagagcaaaagcgaaatg-
t
gattcgaattattcctcaccacaactacaatgcagctattaataagtacaaccatgacattgcccttctggaac-
t
ggacgaacccttagtgctaaacagctacgttacacctatttgcattgctgacaaggaatacacgaacatcttcc-
t
caaatttggatctggctatgtaagtggctggggaagagtcttccacaaagggagatcagctttagttcttcagt-
a
ccttagagttccacttgttgaccgagccacatgtcttcgatctacaaagttcaccatctataacaacatgttct-
g
tgctggcttccatgaaggaggtagagattcatgtcaaggagatagtgggggaccccatgttactgaagtggaag-
g
gaccagtttcttaactggaattattagctggggtgaagagtgtgcaatgaaaggcaaatatggaatatatacca-
a
ggtgtcccggtatgtcaactggattaaggaaaaaacaaagctcactgacaaaactcacacatgcccaccgtgcc-
c
agctccggaactcctgggcggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctccc-
g
gacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtgg-
a
cggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcg-
t
cctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccag-
c
ccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatccc-
g
ggatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtgg-
a
gtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgttggactccgacggctccttct-
t
cctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatg-
a
ggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatgagaattcagacatgataaga-
t
acattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgct-
a
ttgctttatttgtaaccattataagctgcaataaacaagttggggtgggcgaagaactccagcatgagatcccc-
g
cgctggaggatcatccagccggcgtcccggaaaacgattccgaagcccaacctttcatagaaggcggcggtgga-
a
tcgaaatctcgtagcacgtgtcagtcctgctcctcggccacgaagtgcacgcagttgccggccgggtcgcgcag-
g
gcgaactcccgcccccacggctgctcgccgatctcggtcatggccggcccggaggcgtcccggaagttcgtgga-
c
acgacctccgaccactcggcgtacagctcgtccaggccgcgcacccacacccaggccagggtgttgtccggcac-
c
acctggtcctggaccgcgctgatgaacagggtcacgtcgtcccggaccacaccggcgaagtcgtcctccacgaa-
g
tcccgggagaacccgagccggtcggtccagaactcgaccgctccggcgacgtcgcgcgcggtgagcaccggaac-
g
gcactggtcaacttggccatggtttagttcctcaccttgtcgtattatactatgccgatatactatgccgatga-
t
taattgtcaacacgtgctgatcagatccgaaaatggatatacaagctcccgggagctttttgcaaaagcctagg-
c
ctccaaaaaagcctcctcactacttctggaatagctcagaggcagaggcggcctcggcctctgcataaataaaa-
a
aaattagtcagccatggggcggagaatgggcggaactgggcggagttaggggcgggatgggcggagttaggggc-
g
ggactatggttgctgactaattgagatgcatgctttgcatacttctgcctgctggggagcctggggactttcca-
c
acctggttgctgactaattgagatgcatgctttgcatacttctgcctgctggggagcctggggactttccacac-
c
ctcgtcgagctagcttcgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaa-
g
ttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgt-
g
tactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttt-
t
cgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggtta-
t
ggcccttgcgtgccttgaattacttccacctggctccagtacgtgattcttgatcccgagctggagccaggggc-
g
ggccttgcgctttaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtg-
c
gaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacct-
g
ctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaggatctgcacactggtatttcggttttt-
g
gggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggcca-
c
cgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgcc-
c
cgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgct-
c
cagggggctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaggggcc-
t
ttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctgg-
a
gcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtg-
g
agactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttgg-
t
tcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgaacacgtggtcgcggc-
c
gcgccgccaccatggagacagacacactcctgctatgggtactgctgctctgggttccaggttccactggtgac-
a
aaactcacacatgcccaccgtgcccagcacctgaactcctgggaggaccgtcagtcttcctcttccccccaaaa-
c
ccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccct-
g
aggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtac-
a
acagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgc-
a
aggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaacca-
c
aggtgtacaccctgcccccatcccgcgatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggc-
t
tctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctccc-
g
tgttggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaac-
g
tcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggt-
a
aatgactcgagagatctggccggctgggcccgtttcgaaggtaagcctatccctaaccctctcctcggtctcga-
t
tctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgatcagcctcgactgtgccttctag-
t
tgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttc-
c
taataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcagga-
c
agcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcgga-
a
agaaccagtggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggcc-
a
gcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatc-
a
caaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctagaa-
g
ctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcg-
t
ggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgc-
a
cgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacg-
a
cttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttct-
t
gaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttacct-
t
cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagc-
a
gcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtgga-
a
cgaaaactcacgttaagggattttggtcatgacattaacctataaaaataggcgtatcacgaggccctttcgtc-
t
cgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaag-
c
ggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatg-
c
ggcatcagagcagattgtactgagagtgcaccatatatgcggtgtgaaataccgcacagatgcgtaaggagaaa-
a
taccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgct-
a ttacgcca B. Fc DNA sequence (mouse Ig.kappa. signal peptide
underlined) (SEQ ID NO: 3, which encodes SEQ ID NO: 4) This is the
Fc cassette from pSYN-FIX-030. In addition, there is a separate Fc
expression cassette that was transfected into the cell line in
plasmid pSYN-Fc-015 that encodes the same amino acid sequence, but
contains a few noncoding changes. The second copy of Fc encoding
sequence enables a better monomer: dimer ratio.
atggagacagacacactcctgctatgggtactgctgctctgggttccaggttccactggtgacaaaactcacac-
a
tgcccaccgtgcccagcacctgaactcctgggaggaccgtcagtcttcctcttccccccaaaacccaaggacac-
c
ctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagtt-
c
aactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgta-
c
cgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaa-
c
aaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacac-
c
ctgcccccatcccgcgatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccag-
c
gacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgttggactc-
c
gacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatg-
c
tccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaa
TABLE-US-00002 TABLE 2 Polypeptide Sequences FIX-Fc Monomer Hybrid:
created by coexpressing FIX-Fc and Fc chains. A. FIX-Fc chain (SEQ
ID NO: 2): (28 amino acid signal sequence underlined, 18 amino acid
propeptide double underlined, Fc portion in italics.) The
C-terminal lysine is not present in either subunit; this processing
is often observed in recombinant proteins produced in mammalian
cell culture, as well as with plasma derived proteins. FIXFC-SC
SUBUNIT: FIX Signal Peptide: -46 MQRVNMIMAE SPGLITICLL GYLLSAEC FIX
Propeptide: -18 TVFLDHENAN KILNRPKR 1 YNSGKLEEFV QGNLERECME
EKCSFEEARE VFENTERTTE FWKQYVDGDQ 51 CESNPCLNGG SCKDDINSYE
CWCPFGFEGK NCELDVTCNI KNGRCEQFCK 101 NSADNKVVCS CTEGYRLAEN
QKSCEPAVPF PCGRVSVSQT SKLTRAETVF 151 PDVDYVNSTE AETILDNITQ
STQSFNDFTR VVGGEDAKPG QFPWQVVLNG 201 KVDAFCGGSI VNEKWIVTAA
HCVETGVKIT VVAGEHNIEE TEHTEQKRNV 251 IRIIPHHNYN AAINKYNHDI
ALLELDEPLV LNSYVTPICI ADKEYTNIFL 301 KFGSGYVSGW GRVFHKGRSA
LVLQYLRVPL VDRATCLRST KFTIYNNMFC 351 AGFHEGGRDS CQGDSGGPHV
TEVEGTSFLT GIISWGEECA MKGKYGIYTK 401 VSRYVNWIKE KTKLT 451 501 551
601 B. Fc chain (SEQ ID NO: 4) 20 amino acid heterologous mouse
Ig.kappa. light chain signal peptide (underlined): -20 METDTLLLWV
LLLWVPGSTG Mature Fc sequence (corresponding to human IgG1 amino
acids 221 to 447, EU numbering) 1 DKTHTCPPCP APELLGGPSV FLFPPKPKDT
LMISRTPEVT CVVVDVSHED 51 PEVKFNWYVD GVEVHNAKTK PREEQYNSTY
RVVSVLTVLH QDWLNGKEYK 101 CKVSNKALPA PIEKTISKAK GQPREPQVYT
LPPSRDELTK NQVSLTCLVK 151 GFYPSDIAVE WESNGQPENN YKTTPPVLDS
DGSFFLYSKL TVDKSRWQQG 201 NVFSCSVMHE ALHNHYTQKS LSLSPGK
TABLE-US-00003 TABLE 3 Individual Patient FIXFc Antigen
Concentration versus Time Data; Sorted by Nominal Dose, Actual
Dose, Infusion Duration, and Patient Number Actual Time
Concentration Actual Time Concentration Actual Time Concentration
Actual Time Concentration (h) (ng/mL) (h) (ng/mL) (h) (ng/mL) (h)
(ng/mL) Patient 1 Patient 2 Patient 3 Patient 4 -0.50 0.0 -1.23 0.0
-0.18 0.0 -0.18 0.0 0.17 2325.3 0.17 3352.1 0.28 5915.3 0.17 8166.5
0.42 1632.4 0.40 3017.3 0.42 6574.3 0.42 7362.3 1.17 1497.7 1.15
2280.7 1.17 5764.7 1.17 6723.4 3.18 1466.4 3.15 2077.5 3.17 4204.8
3.17 5291.4 6.13 1268.2 6.15 2054.7 6.17 3956.2 6.18 4673.1 9.12
1100.7 9.15 1700.4 9.17 3567.7 9.17 3954.6 24.12 805.0 24.23 1417.3
24.17 2805.6 24.17 3327.6 48.03 544.5 48.40 766.0 48.98 1727.7
48.20 2148.7 72.23 377.7 70.73 719.0 72.40 1165.8 72.17 1632.2
96.75 215.3 92.57 480.2 96.98 917.1 96.17 1234.4 120.13 192.6
119.98 326.3 121.23 673.9 120.13 894.0 141.95 128.6 141.10 241.1
168.65 568.2 144.18 645.2 169.45 112.4 167.98 194.6 240.15 265.4
168.22 564.1 192.37 93.6 192.85 160.1 290.97 286.4 192.20 509.2
216.28 76.1 216.98 149.0 337.98 238.5 216.23 474.5 237.30 76.4
238.65 125.7 240.23 446.1 Actual Time Concentration Actual Time
Concentration Actual Time Concentration Actual Time Concentration
(h) (ng/mL) (h) (ng/mL) (h) (ng/mL) (h) (ng/mL) Patient 5 Patient 6
Patient7 Patient 8 -0.18 0.0 -0.07 0.0 -1.27 0.0 -1.37 0.0 0.17
7520.2 0.17 11671.7 0.22 7055.9 0.25 27413.4 0.43 7233.9 0.42
8654.5 0.42 6215.7 0.47 23640.8 1.20 6752.1 1.17 8880.4 1.17 5498.6
1.35 18505.6 3.15 5873.1 3.17 8509.3 3.17 4477.7 3.22 15708.1 6.23
5919.2 6.17 7618.7 6.17 4084.8 6.17 14915.6 9.20 5332.9 9.17 6584.2
9.17 3888.9 9.17 16486.4 24.17 4215.9 48.17 3217.7 24.17 2849.4
24.72 9937.8 48.15 2986.6 72.17 1651.6 48.82 1630.6 48.90 6383.5
72.15 1933.3 96.17 1580.1 72.57 1295.7 72.38 4190.6 96.03 1249.0
120.17 722.7 96.57 1150.7 96.40 3774.7 120.13 401.4 240.17 329.5
121.15 954.9 120.30 2514.9 144.03 482.3 288.17 292.7 144.10 780.6
168.77 1626.0 168.17 478.0 336.17 252.7 168.82 447.6 240.27 924.7
192.12 433.7 192.77 446.5 288.83 682.4 216.15 368.9 240.57 427.8
337.03 586.4 240.07 264.0 Actual Time Concentration Actual Time
Concentration Actual Time Concentration Actual Time Concentration
(h) (ng/mL) (h) (ng/mL) (h) (ng/mL) (h) (ng/mL) Patient 9 Patient
10 Patient 11 Patient 12 -0.82 0.0 -0.48 0.0 -0.15 0.0 -1.12 0.0
0.28 15027.1 0.25 16760.0 0.23 19641.7 0.17 15194.5 0.63 13374.1
0.50 11529.0 0.47 17267.2 0.42 12255.7 1.17 12395.6 1.22 10566.3
1.22 15902.2 1.17 11171.3 3.20 10808.4 3.22 9889.0 3.22 13708.9
3.17 9835.4 6.22 9640.2 6.22 8290.2 6.25 12469.4 6.17 8513.2 9.15
10505.5 9.22 7114.7 9.22 12029.8 9.17 8413.0 23.15 6487.3 24.22
5877.0 24.22 8083.3 24.17 5538.2 46.62 5324.8 48.22 3980.4 47.72
4431.0 48.20 3885.5 70.10 2895.5 72.22 2455.6 71.88 2162.6 72.13
2959.9 94.15 3208.3 96.12 2052.6 191.72 1468.7 95.17 2215.4 118.13
2610.6 120.22 1302.5 263.72 428.6 119.17 1799.7 166.10 2007.2
144.22 1349.3 167.38 1339.7 238.15 1086.2 168.22 1221.0 239.50
892.4 286.15 942.8 192.18 910.2 287.25 646.9 335.57 621.3 216.22
136.2
TABLE-US-00004 TABLE 4 Individual Patient and Group Mean FIXFc
Antigen Pharmacokinetic Summary Data Nominal Actual Equivalent
Alpha Beta Dose Dose Dose C.sub.max AUC.sub.INF Cl* V.sub.SS* MRT*
HL* HL* (IU/kg) (IU/kg) (mg/kg) Patient (ng/mL) (h*ng/mL) (mL/h/kg)
(mL/kg) (h) (h) (h) 12.5 13.714 0.228 1 1670 91300 2.50 245 98.2
21.2 107 N 1 1 1 1 1 1 1 25 27.250 0.453 2 2730 144000 3.14 273
87.1 11.3 71.0 N 1 1 1 1 1 1 1 50 54.5 0.905 3 5470 356000 2.54 366
144 18.6 138 54.5 0.905 4 6910 389000 2.32 244 105 10.6 85.3 54.5
0.905 5 7520 416000 2.17 184 84.5 NC 94.3 54.513 0.906 6 11700
531000 1.71 190 112 NC 140 55.878 0.928 7 5950 348000 2.67 310 116
10.1 93.9 N 5 5 5 5 5 3 5 Mean 7510 408000 2.28 259 112 13.1 110 SD
2480 73900 0.374 78.5 21.5 4.77 26.5 SE 1110 33100 0.167 35.1 9.60
2.75 11.8 Geometric Mean 7230 403000 2.26 250 111 12.6 108 CV %
Geometric Mean 30.3 17.1 17.6 30.8 19.4 34.9 23.8 100 109 1.81 10
12500 667000 2.72 263 96.8 9.79 78.0 109 1.81 8 21600 1200000 1.51
156 103 15.7 94.3 109 1.81 9 13400 998000 1.81 248 137 11.5 107
109.176 1.81 11 17200 844000 2.15 226 105 13.0 97.1 109.441 1.82 12
12500 778000 2.34 295 126 10.6 102 N 5 5 5 5 5 5 5 Mean 15400
897000 2.11 238 114 12.1 95.8 SD 3960 .sup. 206000.sup.a
0.464.sup.b 52.2.sup.c 17.1 2.33 11.1 SE 1770 92000 0.208 23.3 7.64
1.04 4.96 Geometric Mean 15100 878000 2.06 232 113 11.9 95.2 CV %
Geometric Mean 24.5 22.9 22.9 24.7 14.8 118.7 12.2 *CL, V.sub.SS,
MRT, T1/2 .alpha. and T1/2.beta. for combined 12.5-100 IU/kg doses
are 2.30 .+-. 0.46 (1.51-2.72); 250 .+-. 58.2 (156-366); 110 .+-.
18.5 (84.5-144); 12.0 .+-. 4.0 (10.1-18.6, not including two
patients whose PK parameters were determined by non-compartmental
analysis); and 101 .+-. 20.9 (78-140), respectively. Due to
correction of rounding or other errors, .sup.ashould be 207,000,
and .sup.bshould be 0.468, .sup.cshould be 52.1.
TABLE-US-00005 TABLE 5 Individual Patient and Group Mean FIXFc
Activity and Baseline Corrected FIXFc Activity versus Time Data;
Sorted by Nominal Dose, Actual Dose, Infusion Duration, and Patient
Number Baseline Baseline Baseline Actual Corrected Actual Corrected
Actual Corrected Time Result Result Time Result Result Time Result
Result (h) (IU/dL) (IU/dL) (h) (IU/dL) (IU/dL) (h) (IU/dL) (IU/dL)
Patient 1 Patient 2 Patient 3 -309.80 2 NC -310.60 3 NC -524.08
<1.0 NC -0.50 3 0.0 -1.23 2 0.0 -0.18 2 0.0 0.17 16 13.0 0.17 23
21.0 0.28 44 42.0 0.42 11 8.1 0.40 19 17.0 0.42 31 29.0 1.17 10 7.1
1.15 15 13.0 1.17 27 25.1 3.18 12 9.4 3.15 13 11.0 3.17 22 20.2
6.13 9 6.6 6.15 11 9.0 6.17 18 16.4 9.12 10 7.9 9.15 13 11.0 9.17
17 15.6 24.12 7 5.0 24.23 8 6.0 24.17 12 11.0 48.03 6 4.0 48.40 6
4.0 48.98 7 6.0 72.23 4 2.0 70.73 6 4.0 72.40 6 5.0 96.75 3 1.0
92.57 4 2.0 96.98 6 5.0 120.13 3 1.0 119.98 4 2.0 121.23 5 4.0
141.95 3 1.0 141.10 4 2.0 168.65 3 2.0 169.45 2 0.0 167.98 3 1.0
240.15 1 0.0 192.37 3 1.0 192.85 2 0.0 290.97 1 0.0 216.28 3 1.0
216.98 3 1.0 337.98 1 0.0 237.30 3 1.0 238.65 3 1.0 675.22 2 1.0
746.22 3 1.0 891.90 2 0.0 Baseline Baseline Baseline Actual
Corrected Actual Corrected Actual Corrected Time Result Result Time
Result Result Time Result Result (h) (IU/dL) (IU/dL) (h) (IU/dL)
(IU/dL) (h) (IU/dL) (IU/dL) Patient 4 Patient 5 Patient 6 -285.52 1
NC -104.18 <1.0 NC -503.20 3 NC -0.18 <1.0 0.0 -0.18 <1.0
0.0 -0.07 3 0.0 0.17 59 58.0 0.17 35 34.0 0.17 3 0.0 0.42 45 44.0
0.43 30 29.0 0.42 64 61.0 1.17 40 39.0 1.20 25 24.0 1.17 57 54.1
3.17 30 29.0 3.15 21 20.0 3.17 54 51.3 6.18 26 25.0 6.23 19 18.0
6.17 42 39.6 9.17 22 21.0 9.20 NR NR 9.17 43 40.9 24.17 14 13.0
24.17 13 12.0 24.17 26 24.0 48.20 9 8.0 48.15 9 8.0 48.17 17 15.0
72.17 8 7.0 72.15 7 6.0 72.17 13 11.0 96.17 5 4.0 96.03 5 4.0 96.17
10 8.0 120.13 4 3.0 120.13 4 3.0 120.17 9 7.0 144.18 4 3.0 144.03 3
2.0 168.17 6 4.0 168.22 3 2.0 168.17 2 1.0 240.17 4 2.0 192.20 3
2.0 192.12 2 1.0 288.17 3 1.0 216.23 2 1.0 216.15 2 1.0 336.17 4
2.0 240.23 2 1.0 240.07 2 1.0 504.17 3 1.0 720.73 <1.0 0.0
547.07 <1.0 0.0 Baseline Baseline Baseline Actual Corrected
Actual Corrected Actual Corrected Time Result Result Time Result
Result Time Result Result (h) (IU/dL) (IU/dL) (h) (IU/dL) (IU/dL)
(h) (IU/dL) (IU/dL) Patient 7 Patient 8 Patient 9 -438.43 <1.0
NC -120.42 <1.0 NC -193.05 8 NC -1.27 4 0.0 -1.37 <1.0 0.0
-0.82 3 0.0 0.22 46 42.0 0.25 129 128.0 0.28 100 97.0 0.42 38 34.1
0.47 117 116.0 0.63 93 90.1 1.17 30 26.2 1.35 102 101.0 1.17 94
91.1 3.17 28 24.5 3.22 98 97.0 3.20 80 77.3 6.17 24 20.8 6.17 80
79.0 6.22 69 66.6 9.17 22 19.2 9.17 72 71.0 9.15 64 61.9 24.17 14
12.4 24.72 53 52.0 23.15 47 45.0 48.82 10 9.0 48.90 30 29.0 46.62
25 23.0 72.57 6 5.0 72.38 19 18.0 70.10 17 15.0 96.57 5 4.0 96.40
14 13.0 94.15 13 11.0 121.15 4 3.0 120.30 9 8.0 118.13 9 7.0 144.10
3 2.0 168.77 6 5.0 166.10 5 3.0 168.82 2 1.0 240.27 3 2.0 238.15 3
1.0 192.77 2 1.0 288.83 2 1.0 286.15 2 0.0 240.57 2 1.0 337.03 2
1.0 335.57 2 0.0 744.57 3 2.0 840.28 <1.0 0.0 741.77 3 1.0
Baseline Baseline Baseline Actual Corrected Actual Corrected Actual
Corrected Time Result Result Time Result Result Time Result Result
(h) (IU/dL) (IU/dL) (h) (IU/dL) (IU/dL) (h) (IU/dL) (IU/dL) Patient
10 Patient 11 Patient 12 -334.63 1 NC -912.28 2 NC -342.58 2 NC
-0.48 2 0.0 -0.15 2 0.0 -1.12 2 0.0 0.25 120 118.0 0.23 110 108.0
0.17 108 106.0 0.50 104 102.0 0.47 106 104.0 0.42 90 88.0 1.22 84
82.1 1.22 96 94.0 1.17 70 68.0 3.22 75 73.2 3.22 92 90.0 3.17 69
67.0 6.22 60 58.4 6.25 81 79.0 6.17 55 53.0 9.22 56 54.6 9.22 70
68.0 9.17 55 53.0 24.22 36 35.0 24.22 53 51.0 24.17 37 35.0 48.22
21 20.0 47.72 33 31.0 48.20 25 23.0 72.22 14 13.0 71.88 25 23.0
72.13 14 12.0 96.12 11 10.0 167.72 8 6.0 95.17 10 8.0 120.22 7 6.0
191.72 8 6.0 119.17 7 5.0 144.22 6 5.0 263.72 4 2.0 167.38 6 4.0
168.22 6 5.0 359.72 3 1.0 239.50 3 1.0 192.18 4 3.0 383.97 3 1.0
287.25 2 0.0 216.22 85 84.0 890.97 14 12.0 526.42 4 2.0 744.95 2
1.0 Note: Data in bold represent a return to baseline and were
excluded from analysis.
TABLE-US-00006 TABLE 6 Individual Patient and Group Mean FIXFc
Activity Pharmacokinetic Summary Data; Sorted by Nominal Dose,
Actual Dose, and Patient Number Nominal Actual AUC/Dose Alpha Beta
Dose Dose C.sub.max AUC.sub.INF AUC.sub..alpha. AUC.sub..beta.
(IU*h/dL Cl V.sub.1 V.sub.SS MRT HL HL (IU/kg) (IU/kg) Patient
(IU/dL) (h*IU/dL) (%) (%) per IU/kg) (mL/h/kg) (mL/kg) (mL/kg) (h)
(h) (h) 12.5 13.714 1 11.9 418 0.231 99.8 30.5 3.28 102 157 48.0
0.140 33.3 N 1 1 1 1 1 1 1 1 1 1 1 25 27.25 2 19.9 753 2.50 97.8
27.6 3.62 134 275 76.0 1.20 54.0 N 1 1 1 1 1 1 1 1 1 1 1 50 54.5 3
34.5 1280 5.7 94.5 23.5 4.26 155 365 85.8 2.32 62.9 54.5 4 48.5
1450 12.4 87.7 26.6 3.76 111 282 75.1 3.64 58.9 54.5 5 33.0 1190
1.5 98.3 21.8 4.58 160 274 59.9 0.840 42.1 54.513 6 53.5 2960 1.0
99.1 54.3 1.84 100 149 81.1 1.07 56.7 55.878 7 38.6 1270 2.2 97.9
22.7 4.41 141 248 56.4 1.07 40.0 N 5 5 5 5 5 5 5 5 5 5 5 Mean 41.6
1630 4.56 95.5 29.8 3.77 133 264 71.7 1.79 52.1 SD 8.97.sup.a 750
4.75 4.70 13.8 1.12 26.7 77.6 13.0 1.19 10.4 SE 4.01 335 2.13 2.10
6.18 0.501 11.9 34.7 5.79 0.531 4.65 Geometric Mean 40.9 1530 2.98
95.4 27.9 3.59 131 254 70.7 1.52 51.3 CV % Geometric Mean 21.4 39.1
136.5 5.0 39.4 39.4 21.1 33.8 18.8 68.6 21.0 100 109 10 98.9 3330
18.5 81.3 30.6 3.28 109 216 65.9 6.53 54.6 109 8 111 4580 28.9 71.1
42.0 2.38 98.0 145 61.1 13.2 54.2 109 9 92.1 3540 17.0 82.9 32.5
3.08 118 163 53.1 9.43 42.4.sup.d 109.176 11 99.1 5150 28.6 71.3
47.2 2.12 110 162 76.2 16.6 67.4 109.441 12 89.9 3060 9.2 90.8 28.0
3.58 121 207 57.9 4.19 43.8 N 5 5 5 5 5 5 5 5 5 5 5 Mean 98.2 3930
20.4 79.5 36.1 2.89 111 179 62.8 9.99 52.5 SD 8.21.sup.b .sup.
893.sup.c 8.37 8.37 8.17 0.615 8.98 31.1 8.82 4.99 10.1 SE 3.67 399
3.74 3.74 3.65 0.275 4.02 13.9 3.95 2.23 4.51 Geometric Mean 97.9
3860 18.9 79.1 35.4 2.83 111 177 62.4 8.92 51.7 CV % Geometric Mean
8.2 22.4 49.7 10.5 22.4 22.5 8.2 17.4 13.8 59.4 19.0 Due to
correction of rounding or other errors, .sup.ashould be 8.98,
.sup.bshould be 8.23, .sup.cshould be 892, and .sup.dshould be
42.2.
TABLE-US-00007 TABLE 7A-7B Individual Patient and Group Mean FIXFc
Activity Secondary Pharmacokinetic Summary Data; Sorted by Nominal
Dose, Actual Dose, and Patient Number Nominal Actual K Value.sup.e
K Value.sup.f In Vivo In Vivo Dose Dose C168.sup.a TBLP1.sup.b
TBLP3.sup.c TBLP5.sup.d (IU/dL (IU/dL Recovery.sup.g Recovery.sup.h
(IU/kg) (IU/kg) Patient (IU/dL) (Day) (Day) (Day) per IU/kg) per
IU/kg) (%) (%) 12.5 13.714 1 0.264 4.34 2.13 1.11 0.87 0.95 30.8
33.6 N 1 1 1 1 1 1 1 1 25 27.25 2 1.09 7.28 3.72 2.06 0.73 0.77
31.8 33.5 N 1 1 1 1 1 1 1 1 50 54.5 3 2.09 9.79 5.64 3.70 0.63 0.77
33.0 40.2 54.5 4 2.08 9.58 5.69 3.89 0.89 1.06 37.8 45.2 54.5 5
1.22 7.50 4.72 3.42 0.61 0.62 33.6 34.6 54.513 6 4.61 12.2 8.47
6.72 0.98 1.12 38.2 43.6 55.878 7 1.17 7.37 4.74 3.51 0.69 0.75
29.9 32.6 N 5 5 5 5 5 5 5 5 Mean 2.23 9.29 5.85 4.25 0.76 0.86 34.5
39.2 SD 1.40 1.98 1.54 1.39 0.17 0.22 3.5 5.5 SE 0.627 0.886 0.687
0.623 0.074 0.0963 1.6 2.5 Geometric Mean 1.96 9.12 5.71 4.10 0.75
0.84 34.4 38.9 CV % Geometric Mean 60.0 21.2 24.1 28.6 21.5 25.4
10.2 14.4 Nominal Actual K Value.sup.e K Value].sup.f In Vivo In
Vivo Dose Dose C168.sup.a TBLP1.sup.b TBLP3.sup.c TBLP5.sup.d
(IU/dL (IU/dL Recovery.sup.g Recovery.sup.h (IU/kg) (IU/kg) Patient
(IU/dL) (Day) (Day) (Day) per IU/kg) per IU/kg) (%) (%) 100 109 10
4.08 11.6 8.01 6.34 0.91 1.08 43.4 51.8 109 8 4.88 12.1 8.57 6.92
1.02 1.17 28.7 33.1 109 9 3.09 9.87 7.07 5.78 0.84 0.89 39.7 41.8
109.176 11 6.77 14.7 10.3 8.21 0.91 0.99 27.8 30.3 109.441 12 3.09
9.96 7.07 5.72 0.82 0.97 35.8 42.2 N 5 5 5 5 5 5 5 5 Mean 4.38 11.6
8.20 6.59 0.90 1.02 35.1 39.8 SD 1.53 1.97 1.34 1.03 0.0784 0.11
6.8 8.5 SE 0.685 0.881 0.597 0.459 0.0351 0.0482 3.0 3.8 Geometric
Mean 4.19 11.5 8.12 6.53 0.90 1.02 34.5 39.1 CV % Geometric Mean
34.1 16.5 15.7 15.0 8.6 10.5 19.8 21.6 .sup.aC168 = Estimated FIX
activity above baseline at approximately 168 h after dose. Value in
italics was estimated from simulations performed using a
one-compartment model and patient microscopic rate constants.
.sup.bTBLP1 = Model-predicted time after dose when FIX activity has
declined to approximately 1 IU/dL above baseline. Values in italics
were estimated from simulations performed using a one-compartment
model and patient microscopic rate constants. .sup.cTBLP3 =
Model-predicted time after dose when FIX activity has declined to
approximately 3 IU/dL above baseline. .sup.dTBLP5 = Model-predicted
time after dose when FIX activity has declined to approximately 5
IU/dL above baseline. .sup.eK-Value was calculated using model
predicted C.sub.max value generated from background subtracted
results divided by dose. .sup.fK-Value was calculated using the
observed maximum post dose sample result; K-value = (Baseline
Subtracted C.sub.max observed)/Dose). .sup.gIn-vivo Recovery = 100
.times. (Model Predicted C.sub.max from baseline subtracted
data/Dose) .times. Plasma Volume (dL)/Dose in IU; where plasma
volume in mL = (23.7 .times. Ht in cm) + (9.0 .times. Wt in kg) -
1709. .sup.hIn-vivo Recovery = 100 .times. (Baseline Subtracted
Observed C.sub.max) .times. Plasma Volume (dL)/Dose in IU; where
plasma volume in mL = (23.7 .times. Ht in cm) + (9.0 .times. Wt in
kg) - 1709.
TABLE-US-00008 TABLE 8 Phase 1/2a Study: Comparison of PK
Parameters for rFIXFc and BENEFIX .TM. *rFIXFc [Mean .+-. SD
.sup..dagger.BENEFIX .TM. [Mean .+-. SD Parameters (min-max)] [N =
11] (min-max)] [N = 11] t.sub.1/2 (hours) 52.5 .+-. 9.2 (40-67.4)
19.3 .+-. 4.97 (11.1-36.4) MRT (hours) 68.05 .+-. 11.16 (53.1-85.8)
26.0 .+-. 6.07 (15.81-46.09) CL 3.36 .+-. 0.93 (1.84-4.58) 8.4 .+-.
2.01 (4.66-13.64) (mL/hour/kg) Incremental 0.93 .+-. 0.18
(0.62-1.17).sup.a 0.75 .+-. 0.23 (0.34-1.38) Recovery (IU/dL per
IU/kg) C.sub.max 24 hrs post-injection (IU/dL per IU/kg) AUC 48 hrs
post-injection *Estimates from 2-compartmental analysis of FIX
activity at the nominal doses 25, 50 and 100 IU/kg (n = 11)
.sup..dagger.Summary of Product Characteristics of BENEFIX .TM.
(Nov. 18, 2009); Median and range (n = 56) .sup.aRange corrected
due to rounding or other errors as 0.63-1.18. Relative to
Historical Data for BENEFIX .TM., rFIX-Fc demonstrated: 3x increase
in half-life and mean residence time 24% improved incremental
recovery relative 2.5x reduced clearance
TABLE-US-00009 TABLE 9 Phase 1/2a Study: Dose Proportional Increase
in Cmax and AUC of rFIXFc (activity) Dose # of Cmax (IU/dL) AUC (h
* IU/dL) (IU/kg) Patients [Mean .+-. SD (min-max)] [Mean .+-. SD
(min-max)] 25 1 19.9 753 50 5 41.6 .+-. 8.97 (33.0-53.5) 1630 .+-.
750 (1190-2960) 100 5 98.2 .+-. 8.21 (89.9-111.0) 3930 .+-. 893
(3060-5150) Also see FIG. 5.
TABLE-US-00010 TABLE 10A-10B Estimated Therapeutic Duration of
rFIXFc at 50 and 100 IU/kg Doses. Parameter Geo Median FIX: C on
Day 7 2.0 IU/dL (above baseline) Time to 1 IU/dL 9.1 days above
baseline Time to 3 IU/dL 5.7 days above baseline FIX: C on Day 7
4.2 IU/dL (above baseline) Time to 1 IU/dL 11.5 days above baseline
Time to 3 IU/dL 8.1 days above baseline Also see FIG. 6A-6B.
TABLE-US-00011 TABLE 11 Dose Proportional Increase in Cmax and AUC
for rFIXFc Antigen. Dose # of Cmax (ng/mL) AUC (h * ng/mL) (IU/kg)
patients [Mean .+-. SD] [Mean .+-. SD] 25 1 2,730 144,000 50 5
7,510 .+-. 2,480 408,000 .+-. 73,900 100 5 15,400 .+-. 3,960
897,000 .+-. 206,000 Also see FIG. 7.
TABLE-US-00012 TABLE 12 Pharmacokinetic Estimates for rFIXFc
Antigen 50 IU/kg [Mean .+-. SD] 100 IU/kg [Mean .+-. SD] Parameters
(N = 5) (N = 5) CL (mL/hour/kg) 2.28 .+-. 0.37 2.11 .+-. 0.46 Vss
(mL/kg) 259 .+-. 78.5 238 .+-. 52.2 MRT (hours) 112 .+-. 21.5 114
.+-. 17.1 t.sub.1/2 (hours) 110 .+-. 26.5 95.8 .+-. 11.1 Also see
FIG. 8A-8B.
TABLE-US-00013 TABLE 13 Mean PK Values Based on Activity AUC/Dose
Cmax AUCINF AUCa AUCb (IU*h/dL C1 V1 VSS MRT t1/2.alpha. t1/2.beta.
(IU/dL) (h*IU/dL) (%) (%) per IU/kg) (mL/kg) (mL/h/kg) (mL/kg) (h)
(h) (h) n 11 11 11 11 11 11 11 11 11 11 11 Mean 65.364 2596.636
11.591 88.427 32.436 3.555 123.364 226.000 68.045 5.463 52.455 Std
Dev 32.9708 1497.1234 10.4490 10.5210 10.7506 0.9257 21.2804
69.7582 11.1637 9.1674 5.4197 % CV 50.4420 57.6563 90.1479 11.8980
33.1435 27.5890 17.2501 30.8664 16.4063 17.4768 99.2128 Median
53.500 2960.000 9.200 90.800 28.000 3.580 118.000 216.000 65.900
3.640 54.200 Minimum 19.90 753.00 1.00 71.10 21.80 1.84 98.00
145.00 53.10 0.84 40.00 Maximum 111.00 5150.00 28.90 99.10 54.30
4.58 160.00 365.00 85.80 16.60 67.40 Geo. mean 56.951 2181.294
6.781 87.826 31.020 3.226 121.767 216.533 67.218 3.326 51.715
Incremental Incremental In Vivo In Vivo Recovery [5] Recovery [6]
Recovery Recovery C168 [1] TBLP1 [2] TBLP3 [3] TBLP5 [4] (IU/dL per
(IU/dL per [7] [8] (IU/dL) (Day) (Day) (Day) IU/kg) IU/kg) (%) (%)
n 11 11 11 11 11 11 11 11 Mean 3.106 10.177 6.727 5.115 0.821 0.926
34.518 38.991 Std Dev 1.8231 2.3315 2.0089 1.8975 0.1387 0.1787
4.9250 6.6636 % CV 58.6897 22.9088 29.8623 37.0944 16.8921 19.2940
14.2678 17.0900 Median 3.090 9.870 7.070 5.720 0.840 0.970 33.600
40.200 Minimum 1.09 7.28 3.72 2.06 0.61 0.62 27.80 30.30 Maximum
6.77 14.70 10.30 8.21 1.02 1.17 43.40 51.80 Geo. mean 2.621 9.938
6.447 4.761 0.810 0.910 34.202 38.486 Footnotes: Note: PK parameter
values were determined by 2-compartmental method. Geo. Mean =
Geometric Mean [1] C168 = FIX activity above baseline at 168 hr
after dose. [2] TBLP1 = Estimated time after dose when FIX activity
has declined to 1 IU/dL above baseline. [3] TBLP3 = Estimated time
after dose when FIX activity has declined to 3 IU/dL above
baseline. [4] TBLP5 = Estimated time after dose when FIX activity
has declined to 5 IU/dL above baseline. [5] Incremental Recovery
was calculated using model predicted Cmax value generated from
background subtracted results divided by dose. [6] Incremental
Recovery was calculated using the observed maximum post-dose sample
result; Incremental Recovery = (Baseline Subtracted Cmax
observed)/Dose. [7] In-vivo Recovery = 100 .times. (Model Predicted
Cmax from baseline subtracted data/Dose) .times. Plasma Volume
(dL)/Dose in IU; where plasma volume in mL = (23.7 .times. Ht in
cm) + (9.0 .times. Wt in kg) - 1709. [8] In-vivo Recovery = 100
.times. (Baseline Subtracted Observed Cmax) .times. Plasma Volume
(dL)/Dose in IU; where plasma volume in mL = (23.7 .times. Ht in
cm) + (9.0 .times. Wt in kg) - 1709.
TABLE-US-00014 TABLE 14 Mean PK Values Based on Antigen Level.
Nominal Actual Equivalent Alpha Beta Dose Dose Dose C.sub.max
AUC.sub.INF Cl V.sub.SS MRT HL HL (IU/kg) (IU/kg) (mg/kg) Patient
(ng/mL) (h*ng/mL) (mL/h/kg) (mL/kg) (h) (h) (h) 12.5 13.714 0.228 1
1670 91300 2.5 245 98.2 21.2 107 25 27.25 0.453 2 2730 144000 3.14
273 87.1 11.3 71 50 54.5 0.905 3 5470 356000 2.54 366 144 18.6 138
54.5 0.905 4 6910 389000 2.32 244 105 10.6 85.3 54.5 0.905 5 7520
416000 2.17 184 84.5 NC 94.3 54.513 0.906 6 11700 531000 1.71 190
112 NC 140 55.878 0.928 7 5950 348000 2.67 310 116 10.1 93.9 100
109 1.81 10 12500 667000 2.72 263 96.8 9.79 78 109 1.81 8 21600
1200000 1.51 156 103 15.7 94.3 109 1.81 9 13400 998000 1.81 248 137
11.5 107 109.176 1.81 11 17200 844000 2.15 226 105 13 97.1 109.441
1.82 12 12500 778000 2.34 295 126 10.6 102 N 12 12 12 12 12 12 12
Mean 9929.0 563525.0 2.3 250.0 109.6.sup.b 13.2.sup.c 100.7.sup.e
SD 5940.0 339925.0 0.5.sup.a 58.2 18.5 4.0.sup.d 20.9 SE 1715.0
98128.0 0.1 16.8 5.3 1.3 6.0 Geometric Mean 8014.0 452356.0 2.3
243.7 108.2 12.8 98.8 Due to correction of rounding or other
errors, .sup.ashould be 0.46, .sup.bshould be 110, .sup.cshould be
12.0, .sup.dshould be 3.95, and .sup.eshould be 101.
TABLE-US-00015 TABLE 15 Biochemical characterization of Factor IX
FIXFc rFIX pdFIX Gamma-carboxylation aa 1-23 % 6 Gla 97.8 96.9 99.6
(K1K2 peptide) % 5 Gla 2.2 3.1 0.4 % 4 Gla 0 0 0 aa 24-43 % 6 Gla
61.3 63.7 98.9 (K3 peptide) % 5 Gla 26.3 30.9 1.1 % 4 Gla 12.5 5.4
0 Total Gla/mol, peptide map 11.5 11.6 12.0 Total Gla/mol, AAA 11.3
.+-. 0.3 11.5 .+-. 0.3 (12) Propeptide content none detected none
detected none detected .beta.-hydroxylation Asp 64 70% 49% 37%
Sulfation of Tyr 155 4% 5% (>90%) Phosphorylation of Ser 158
<10% <10% (>90%) Ala 148/Thr 148 0/100% 100/0% 30/70%
Activated FIX <0.0125% 0.109 +/- 0.00185% 0.21 +/- 0.010% FXIa
Activation 94.8 +/- 2.4% 96.6 +/- 1.8% Not done
TABLE-US-00016 TABLE 16 Summary of terminal half-lives of FIXFc and
BENEFIX .TM. after a single intravenous dose. Species BENEFIX .TM.
FIXFc Normal mice 12.3 hr 47.2 .+-. 4.8 hr FIX-deficient mice 13.2
hr 46.2 .+-. 10.1 hr FcRN KO mice 16.5 .+-. 3.0 hr 16.9 .+-. 2.1 hr
FcRN Tg32b mice 14.2 .+-. 2.9 hr 53.0 .+-. 6.6. hr Rats 5.8 hr 34.8
.+-. 5.3 hr FIX-deficient dogs 14-18 hr* 47.5 hr Monkey 12.7
hr.sup..dagger. 47.3 .+-. 9.1 hr *Brinkhous et al, Blood, 1996; 88:
2603-2610 .sup..dagger.McCarthy et al, 2002, Thromb Haemost, 2002;
87: 824-830
TABLE-US-00017 TABLE 17 Summary of in vitro ROTEM .RTM. parameters
for rFIXFc and BENEFIX .TM. spiked in pooled HemB mouse whole blood
CFT (sec) Alpha Angle % of Normal CT (sec) (Mean .+-. (.degree.)
Activity (Mean .+-. SD) SD) (Mean .+-. SD) rFIXFc 0.074 2263 .+-.
209 1152 .+-. 170 24 .+-. 5 (n = 10 pools) 0.74 1371 .+-. 82 459
.+-. 45 34 .+-. 5 7.4 790.8 .+-. 30 226 .+-. 20 52 .+-. 2 BENEFIX
.TM. 0.1 2019 .+-. 178 732 .+-. 123 30 .+-. 3 (n = 10 pools) 1 1090
.+-. 38 324 .+-. 33 43 .+-. 3 10 551.1 .+-. 38 127 .+-. 10 67 .+-.
2
TABLE-US-00018 TABLE 18 Median blood loss following tail clip in
HemB mice treated with rFIXFc or BENEFIX .TM. Median Blood Loss
(mL) rFIXFc BENEFIX .TM. Vehicle Dose (IU/kg) (n = 15/dose) (n =
15/dose) (n = 18) 720 0.101 360 0.651 0.218 240 0.298 120 0.4567
0.564 80 0.8474 40 1.0097 0.918 0 1.1586
TABLE-US-00019 TABLE 19 Ex vivo ROTEM .RTM. parameter in HemB mice
treated with rFIXFc and BENEFIX .TM. Alpha Angle Time CT (sec) CFT
(sec) (degree) (hour) (Mean .+-. SD) (Mean .+-. SD) (Mean .+-. SD)
100 IU/kg 0.083 599 .+-. 23 174 .+-. 16 58 .+-. 2 BENEFIX .TM. 24
682 .+-. 49 184 .+-. 34 57 .+-. 5 (n = 4 mice/time 48 897 .+-. 114
310 .+-. 89 45 .+-. 7 point) 72 1141 .+-. 155 508 .+-. 123 32 .+-.
7 96 1613 .+-. 181 605 .+-. 92 27 .+-. 3 50 IU/kg 0.083 700 .+-. 18
213 .+-. 9 53 .+-. 1 rFIXFc 24 836 .+-. 31 261 .+-. 15 47 .+-. 2 (n
= 8 mice/time 72 845 .+-. 38 285 .+-. 17 45 .+-. 2 point) 96 957
.+-. 30 296 .+-. 26 43 .+-. 2 120 1014 .+-. 83 342 .+-. 50 42 .+-.
4 168 1139 .+-. 65 408 .+-. 41 36 .+-. 3 216 1366 .+-. 96 453 .+-.
48 34 .+-. 3
TABLE-US-00020 TABLE 20A PK parameters of rFIXFc and BENEFIX .TM.
(200 IU/kg) following subcutaneous injection of a single dose in
FIX-deficient mice (Antigen ELISA) Absorption Elimination
AUC.sub.INF/ Cmax/ Dose V/F Tlag AUC.sub.INF HL HL CL/F Tmax Cmax
Dose Dose F Compound ng/kg mL/kg Hr Hr*ng/mL Hr Hr mL/Hr/kg Hr
ng/mL Hr kg/mL g/mL % BeneFIX 727273 3920 2.86 6397 1.96 23.9 114
10.6 148 0.00880 0.204 23.3 rFIXFc 3278689 2071 0.896 141370 7.67
61.9 23.2 27.3 1178 0.0431 0.359 38.1
TABLE-US-00021 TABLE 20B PK parameters of rFIXFc and BENEFIX .TM.
(200 IU/kg) following subcutaneous injection of a single dose in
FIX-deficient mice (aPTT activity assay) Absorption Elimination
AUC.sub.INF/ Cmax/ Dose V/F Tlag AUC.sub.INF HL HL CL/F Tmax Cmax
Dose Dose F Compound IU/kg dL/kg Hr Hr*IU/dL Hr Hr dL/Hr/kg Hr
IU/dL Hr*kg/dL g/dL % BeneFIX 207 54.8 0.631 93.9 7.01 17.2 2.20
16.0 2.04 0.454 9.86 18.9 rFIXFc 172 25.1 2.32 418 6.84 42.4 0.411
23.8 4.82 2.43 28.0 29.1
TABLE-US-00022 TABLE 21 PK and PD Analysis of rFIXFc and BENEFIX
.TM. After a Single Subcutaneous Dose in FIX-Deficient Mice. Elim.
CL/F AUC/Dose Half-Life (mL/Hr/kg)/ Tmax Cmax/Dose F Assay
(Hr*kg/mL) (Hr) % (Hr) (kg/mL) (%) rFIXFc 200 IU/kg Antigen 0.041
61.9 23.2 27.3 0.00035 38.1 BENEFIX .TM. 200 IU/kg Antigen 0.0073
23.9 114 10.6 0.00017 23.3 Ratio Antigen 5.62 2.59 0.20 2.58 2.05
1.63 (rFIXFc/BENEFIX .TM.) rFIXFc 400 IU/kg Antigen 0.042 50.9 23.7
18.3 0.00045 45.6 BENEFIX .TM. 400 IU/kg Antigen 0.0089 20.2 113
8.13 0.00024 20.2 Ratio Antigen 4.72 2.52 0.21 2.25 1.91 2.26
(rFIXFc/BENEFIX .TM.) rFIXFc 200 IU/kg Activity 0.021 42.4 41.1
23.8 0.00024 29.1 BENEFIX .TM. 200 IU/kg Activity 0.0047 17.2 220
16.0 0.00010 18.9 Ratio Activity 4.47 2.46 0.19 1.49 2.40 1.54
(rFIXFc/BENEFIX .TM.) rFIXFc 400 IU/kg Activity 0.028 40.3 35.6
15.9 0.00037 39.2 BENEFIX .TM. 400 IU/kg Activity 0.0052 15.6 193
18.1 0.00010 15.5 Ratio Activity 5.38 2.58 0.18 0.88 3.70 2.53
(rFIXFc/BENEFIX .TM.)
TABLE-US-00023 TABLE 22 PK parameters of rFIXFc (50 IU/kg)
following subcutaneous injection of a single dose in cynomolgus
monkeys. Absorption Terminal V/F AUC HL HL CL/F Tmax Cmax AUC/D F
Group Animal_ID (mL/kg) (Hr*ng/mL) (Hr) (Hr) (mL/Hr/kg) (Hr)
(ng/mL) (Hr*kg/mL) (%) 50 5C4 545 109000 8.42 50.2 7.53 26.1 1050
0.133 43.7 IU/kg C37716 975 108000 6.4 89 7.6 26.2 685 0.132 43.3
rFIXFc C41440 622 82500 8.54 43.4 9.93 24.9 885 0.101 33.1 N 3 3 3
3 3 3 3 3 3 Mean 714 99800 7.79 60.9 8.35 25.7 873 0.122 40.1 SD
229 14900 1.2 24.6 1.37 0.685 182 0.0183 6.03 SE 132 8630 0.695
14.2 0.79 0.396 105 0.0106 3.48 Geometric Mean 691 99000 7.72 57.9
8.28 25.7 860 0.121 39.7 CV % Geometric Mean 31.2 15.8 16.4 39.4
15.8 2.68 21.7 15.9 15.9
TABLE-US-00024 TABLE 23 PK parameters of rFIXFc (100 IU/kg)
following subcutaneous injection of a single dose in cynomolgus
monkeys. Absorption Terminal V/F AUC HL HL CL/F Tmax Cmax AUC/D F
Group Animal_ID (mL/kg) (Hr*ng/mL) (Hr) (Hr) (mL/Hr/kg) (Hr)
(ng/mL) (Hr*kg/mL) (%) 100 29109 1630 69800 11.4 48.1 23.5 31 644
0.0426 14.0 IU/kg 605097 561 207000 5.12 49.2 7.9 18.6 2250 0.126
41.5 rFIXFc C35785 387 238000 6.37 39 6.89 19.9 2970 0.145 47.8 N 3
3 3 3 3 3 3 3 3 Mean 858 172000 7.62 45.4 12.8 23.2 1950 0.105 34.4
SD 671 89600 3.31 5.58 9.3 6.79 1190 0.0546 18.0 SE 388 51700 1.91
3.22 5.37 3.92 687 0.0315 10.4 Geometric Mean 707 151000 7.18 45.2
10.9 22.6 1630 0.0921 30.3 CV % Geometric Mean 86.2 75.5 43.1 12.8
75.5 28.2 96.9 75.5 75.5
TABLE-US-00025 TABLE 24 PK parameters of rFIXFc (200 IU/kg)
following subcutaneous injection of a single dose in cynomolgus
monkeys. Absorption Terminal V/F AUC HL HL CL/F Tmax Cmax AUC/D F
Group Animal_ID (mL/kg) (Hr*ng/mL) (Hr) (Hr) (mL/Hr/kg) (Hr)
(ng/mL) (Hr*kg/mL) (%) 200 50883 855 408000 3.36 73.7 8.03 15.7
3310 0.124 40.9 IU/kg C31129 461 415000 6.42 40.4 7.91 20.2 5030
0.127 41.6 rFIXFc C41410 147 262000 11.5 32.6 3.12 26.7 3160 0.0799
26.3 N 3 3 3 3 3 3 3 3 3 Mean 487 362000 7.08 48.9 6.36 20.9 3830
0.110 36.3 SD 354 86100 4.08 21.8 2.8 5.51 1040 0.0263 8.67 SE 205
49700 2.36 12.6 1.62 3.18 598 0.0152 5.00 Geometric Mean 387 354000
6.27 46 5.83 20.4 3750 0.108 35.5 CV % Geometric Mean 110 26.4 67.6
44.2 58.3 27 25.9 26.5 26.5
TABLE-US-00026 TABLE 25 PK Analysis of rFIXFc Following a Single
Subcutaneous Dose in Cynomolgus Monkeys Abs Elim. CL/F rFIXFc AUC
Half-Life Half-Life (mL/Hr/kg)/ Tmax Cmax F (IU/kg) (Hr*ng/mL) (Hr)
(Hr) % (Hr) (ng/mL) (%) 50 Geo. Mean 99,000 7.72 57.9 8.28 25.7 860
39.7 CV % 15.8 16.4 39.4 15.8 2.68 21.7 15.9 Geo. Mn 100 Geo. Mean
221,959 5.71 43.8 7.38 19.2 2,585 44.5 CV % 9.89 15.5 16.5 9.70
4.78 19.8 10.0 Geo. Mn 200 Geo. Mean 354,000 6.27 46 5.83 20.4
3,750 35.5 CV % 26.4 67.6 44.2 58.3 27 25.9 26.5 Geo. Mn
Bioavailability ranged from 35.5 to 44.5% for rFIXFc Elimination
half-life ranged 43.8 to 57.9 hrs for rFIXFc
TABLE-US-00027 TABLE 26 Dosing Guidelines For rFIXFc Therapy In
Hemophilia B Factor IX Frequency of Level Required Doses Type of
Hemorrhage (%) (hrs) Minor Epistaxis Hemarthroses, uncomplicated
20-30 48 Superficial muscular 20-30 48 Superficial soft tissue
20-30 48 Moderate Epistaxis Intramuscular with dissection 25-50 48
Soft tissue with dissection 25-50 48 Mucous membranes 25-50 48
Dental extractions 25-50 48 Hematuria 25-50 48 Hemarthroses, with
limited motion 40-80 48 Major Epistaxis 50-100 24-48 Pharynx 50-100
24-48 Retropharynx 50-100 24-48 Retroperitoneum 50-100 24-48
Surgery 50-100 24-48 CNS 50-100 24-48 Patient should consult with
the their physicians, but should take only 1 follow-up dose not
less than 24-48 hours after the initial dose.
Tables 27A and 27B. Comparison of data using calculations in (A)
Example 1 and (B) Example 11.
TABLE-US-00028 A Parameter (mean .+-. SD) Incremental Time to
Recovery 1% above Dose C.sub.max AUC.sub.INF CL Vss (IU/dL per
C.sub.168 h baseline (IU/kg) n (IU/dL) (h IU/dL) (mL/h/kg) (mL/kg)
MRT (h) T1/2.alpha.(h) T1/2.beta. (h) IU/kg)* (IU/dL).sup..dagger.
(Day).sup..dagger-dbl. 25 1 19.9 753 3.62 275 76.0 1.20 54.0 0.77
1.09 7.28 50 5 41.6 .+-. 1630 .+-. 3.77 .+-. 264 .+-. 71.7 .+-.
1.79 .+-. 52.1 .+-. 0.86 .+-. 2.23 .+-. 9.29 .+-. 8.97/ 750 1.12
77.6 13.0 1.19 10.4 0.22 1.40 1.98 8.98 100 5 98.2 .+-. 3930 .+-.
2.89 .+-. 179 .+-. 62.8 .+-. 9.99 .+-. 52.5 .+-. 1.02 .+-. 4.38
.+-. 11.6 .+-. 8.21/ 893 0.615 31.1 8.82 4.99 10.1 0.11 1.53 1.97
8.23 25-100 11 NA.sup..sctn. NA.sup..sctn. ND ND ND ND ND ND
NA.sup..sctn. NA.sup..sctn.
TABLE-US-00029 B Parameter (mean .+-. SD) (Range) Incremental Time
to Recovery 1% above Dose C.sub.max AUC.sub.INF CL Vss (IU/dL per
C.sub.168 h baseline (IU/kg) n (IU/dL) (h IU/dL) (mL/h/kg) (mL/kg)
MRT (h) T1/2.alpha..sub..quadrature.(h) T1/2.beta. (h) IU/kg)*
(IU/dL).sup..dagger. (Day).sup..dagger-dbl. 25 1 20.4 766 3.56 271
76.2 0.61 53.5 0.77 1.11 7.3 50 5 47.5 .+-. 1700 .+-. 3.44 .+-. 262
.+-. 76.8 .+-. 3.4 .+-. 57.5 .+-. 0.87 .+-. 2.46 .+-. 10.1 .+-.
12.8 550 0.84 55.4 6.7 3.4 8.2 0.21 0.89 1.5 (33.0- (1300- (2.05-
(163- (67.9- (0.13- (47.9- (0.63- (1.63- (8.4- 61.1) 2660) 4.18)
296) 85.9) 8.72) 67.2) 1.12) 3.92) 12.3) 100 5 98.5 .+-. 4020 .+-.
2.84 .+-. 183 .+-. 65.9 .+-. 10.3 .+-. 56.5 .+-. 1.02 .+-. 4.65
.+-. 12.3 .+-. 7.9 986 0.66 27.9 10.3 5.6 14.1 0.11 1.73 2.5 (90.8-
(3090- (2.13- (162- (53.2- (3.97- (42.4- (0.89- (3.08- (9.9- 110)
5130) 3.55) 221) 76.5) 16.6) 74.5) 1.18) 6.85) 15.0) 25-100 11
NA.sup..sctn. NA.sup..sctn. 3.18 .+-. 227 .+-. 71.8 .+-.
NA.sup..sctn. 56.7 .+-. 0.93 .+-. NA.sup..sctn. NA.sup..sctn. 0.78
58.6 10.0 10.9 0.18 (2.05- (162- (53.2- (42.4- (0.63- 4.18) 296)
85.9) 74.5) 1.18)
Results presented are mean.+-.SD with range listed in the
parentheses C.sub.max indicates maximum concentration; AUC.sub.INF,
area under the curve (time zero extrapolated to infinite time); CL,
clearance; V.sub.SS, volume of distribution at steady state; MRT,
mean residence time; T1/2.quadrature., distribution half-life;
T1/2.quadrature., elimination half-life; NA, not applicable *
Incremental recovery was calculated using observed C.sub.max
subtracted with pretreatment baseline value and divided by dose
.dagger. Plasma FIX activity above baseline at 168 hours (7 days)
post dose .dagger-dbl. Model-predicted time after dose when FIX
activity declined to 1 IU/dL above subject's baseline .sctn. Data
are not applicable because parameters are not dose-independent,
thus the mean and SD values were not calculated across the
different dose groups
Sequence CWU 1
1
417583DNAArtificialFIX-Fc Chain DNA (pSYN-FIX-030) 1gcgcgcgttg
acattgatta ttgactagtt attaatagta atcaattacg gggtcattag 60ttcatagccc
atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct
120gaccgcccaa cgacccccgc ccattgacgt caataatgac gtatgttccc
atagtaacgc 180caatagggac tttccattga cgtcaatggg tggagtattt
acggtaaact gcccacttgg 240cagtacatca agtgtatcat atgccaagta
cgccccctat tgacgtcaat gacggtaaat 300ggcccgcctg gcattatgcc
cagtacatga ccttatggga ctttcctact tggcagtaca 360tctacgtatt
agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc
420gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac
gtcaatggga 480gtttgttttg gcaccaaaat caacgggact ttccaaaatg
tcgtaacaac tccgccccat 540tgacgcaaat gggcggtagg cgtgtacggt
gggaggtcta tataagcaga gctctctggc 600taactagaga acccactgct
tactggctta tcgaaattaa tacgactcac tatagggaga 660cccaagcttc
gcgacgtacg gccgccacca tgcagcgcgt gaacatgatc atggcagaat
720caccaggcct catcaccatc tgccttttag gatatctact cagtgctgaa
tgtacaggtt 780tgtttccttt tttaaaatac attgagtatg cttgcctttt
agatatagaa atatctgatg 840ctgtcttctt cactaaattt tgattacatg
atttgacagc aatattgaag agtctaacag 900ccagcacgca ggttggtaag
tactgtggga acatcacaga ttttggctcc atgccctaaa 960gagaaattgg
ctttcagatt atttggatta aaaacaaaga ctttcttaag agatgtaaaa
1020ttttcatgat gttttctttt ttgctaaaac taaagaatta ttcttttaca
tttcagtttt 1080tcttgatcat gaaaacgcca acaaaattct gaatcggcca
aagaggtata attcaggtaa 1140attggaagag tttgttcaag ggaatctaga
gagagaatgt atggaagaaa agtgtagttt 1200tgaagaagca cgagaagttt
ttgaaaacac tgaaagaaca actgaatttt ggaagcagta 1260tgttgatgga
gatcagtgtg agtccaatcc atgtttaaat ggcggcagtt gcaaggatga
1320cattaattcc tatgaatgtt ggtgtccctt tggatttgaa ggaaagaact
gtgaattaga 1380tgtaacatgt aacattaaga atggcagatg cgagcagttt
tgtaaaaata gtgctgataa 1440caaggtggtt tgctcctgta ctgagggata
tcgacttgca gaaaaccaga agtcctgtga 1500accagcagtg ccatttccat
gtggaagagt ttctgtttca caaacttcta agctcacccg 1560tgctgagact
gtttttcctg atgtggacta tgtaaattct actgaagctg aaaccatttt
1620ggataacatc actcaaagca cccaatcatt taatgacttc actcgggttg
ttggtggaga 1680agatgccaaa ccaggtcaat tcccttggca ggttgttttg
aatggtaaag ttgatgcatt 1740ctgtggaggc tctatcgtta atgaaaaatg
gattgtaact gctgcccact gtgttgaaac 1800tggtgttaaa attacagttg
tcgcaggtga acataatatt gaggagacag aacatacaga 1860gcaaaagcga
aatgtgattc gaattattcc tcaccacaac tacaatgcag ctattaataa
1920gtacaaccat gacattgccc ttctggaact ggacgaaccc ttagtgctaa
acagctacgt 1980tacacctatt tgcattgctg acaaggaata cacgaacatc
ttcctcaaat ttggatctgg 2040ctatgtaagt ggctggggaa gagtcttcca
caaagggaga tcagctttag ttcttcagta 2100ccttagagtt ccacttgttg
accgagccac atgtcttcga tctacaaagt tcaccatcta 2160taacaacatg
ttctgtgctg gcttccatga aggaggtaga gattcatgtc aaggagatag
2220tgggggaccc catgttactg aagtggaagg gaccagtttc ttaactggaa
ttattagctg 2280gggtgaagag tgtgcaatga aaggcaaata tggaatatat
accaaggtgt cccggtatgt 2340caactggatt aaggaaaaaa caaagctcac
tgacaaaact cacacatgcc caccgtgccc 2400agctccggaa ctcctgggcg
gaccgtcagt cttcctcttc cccccaaaac ccaaggacac 2460cctcatgatc
tcccggaccc ctgaggtcac atgcgtggtg gtggacgtga gccacgaaga
2520ccctgaggtc aagttcaact ggtacgtgga cggcgtggag gtgcataatg
ccaagacaaa 2580gccgcgggag gagcagtaca acagcacgta ccgtgtggtc
agcgtcctca ccgtcctgca 2640ccaggactgg ctgaatggca aggagtacaa
gtgcaaggtc tccaacaaag ccctcccagc 2700ccccatcgag aaaaccatct
ccaaagccaa agggcagccc cgagaaccac aggtgtacac 2760cctgccccca
tcccgggatg agctgaccaa gaaccaggtc agcctgacct gcctggtcaa
2820aggcttctat cccagcgaca tcgccgtgga gtgggagagc aatgggcagc
cggagaacaa 2880ctacaagacc acgcctcccg tgttggactc cgacggctcc
ttcttcctct acagcaagct 2940caccgtggac aagagcaggt ggcagcaggg
gaacgtcttc tcatgctccg tgatgcatga 3000ggctctgcac aaccactaca
cgcagaagag cctctccctg tctccgggta aatgagaatt 3060cagacatgat
aagatacatt gatgagtttg gacaaaccac aactagaatg cagtgaaaaa
3120aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt
ataagctgca 3180ataaacaagt tggggtgggc gaagaactcc agcatgagat
ccccgcgctg gaggatcatc 3240cagccggcgt cccggaaaac gattccgaag
cccaaccttt catagaaggc ggcggtggaa 3300tcgaaatctc gtagcacgtg
tcagtcctgc tcctcggcca cgaagtgcac gcagttgccg 3360gccgggtcgc
gcagggcgaa ctcccgcccc cacggctgct cgccgatctc ggtcatggcc
3420ggcccggagg cgtcccggaa gttcgtggac acgacctccg accactcggc
gtacagctcg 3480tccaggccgc gcacccacac ccaggccagg gtgttgtccg
gcaccacctg gtcctggacc 3540gcgctgatga acagggtcac gtcgtcccgg
accacaccgg cgaagtcgtc ctccacgaag 3600tcccgggaga acccgagccg
gtcggtccag aactcgaccg ctccggcgac gtcgcgcgcg 3660gtgagcaccg
gaacggcact ggtcaacttg gccatggttt agttcctcac cttgtcgtat
3720tatactatgc cgatatacta tgccgatgat taattgtcaa cacgtgctga
tcagatccga 3780aaatggatat acaagctccc gggagctttt tgcaaaagcc
taggcctcca aaaaagcctc 3840ctcactactt ctggaatagc tcagaggcag
aggcggcctc ggcctctgca taaataaaaa 3900aaattagtca gccatggggc
ggagaatggg cggaactggg cggagttagg ggcgggatgg 3960gcggagttag
gggcgggact atggttgctg actaattgag atgcatgctt tgcatacttc
4020tgcctgctgg ggagcctggg gactttccac acctggttgc tgactaattg
agatgcatgc 4080tttgcatact tctgcctgct ggggagcctg gggactttcc
acaccctcgt cgagctagct 4140tcgtgaggct ccggtgcccg tcagtgggca
gagcgcacat cgcccacagt ccccgagaag 4200ttggggggag gggtcggcaa
ttgaaccggt gcctagagaa ggtggcgcgg ggtaaactgg 4260gaaagtgatg
tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata
4320agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag
aacacaggta 4380agtgccgtgt gtggttcccg cgggcctggc ctctttacgg
gttatggccc ttgcgtgcct 4440tgaattactt ccacctggct ccagtacgtg
attcttgatc ccgagctgga gccaggggcg 4500ggccttgcgc tttaggagcc
ccttcgcctc gtgcttgagt tgaggcctgg cctgggcgct 4560ggggccgccg
cgtgcgaatc tggtggcacc ttcgcgcctg tctcgctgct ttcgataagt
4620ctctagccat ttaaaatttt tgatgacctg ctgcgacgct ttttttctgg
caagatagtc 4680ttgtaaatgc gggccaggat ctgcacactg gtatttcggt
ttttggggcc gcgggcggcg 4740acggggcccg tgcgtcccag cgcacatgtt
cggcgaggcg gggcctgcga gcgcggccac 4800cgagaatcgg acgggggtag
tctcaagctg gccggcctgc tctggtgcct ggcctcgcgc 4860cgccgtgtat
cgccccgccc tgggcggcaa ggctggcccg gtcggcacca gttgcgtgag
4920cggaaagatg gccgcttccc ggccctgctc cagggggctc aaaatggagg
acgcggcgct 4980cgggagagcg ggcgggtgag tcacccacac aaaggaaagg
ggcctttccg tcctcagccg 5040tcgcttcatg tgactccacg gagtaccggg
cgccgtccag gcacctcgat tagttctgga 5100gcttttggag tacgtcgtct
ttaggttggg gggaggggtt ttatgcgatg gagtttcccc 5160acactgagtg
ggtggagact gaagttaggc cagcttggca cttgatgtaa ttctccttgg
5220aatttgccct ttttgagttt ggatcttggt tcattctcaa gcctcagaca
gtggttcaaa 5280gtttttttct tccatttcag gtgtcgtgaa cacgtggtcg
cggccgcgcc gccaccatgg 5340agacagacac actcctgcta tgggtactgc
tgctctgggt tccaggttcc actggtgaca 5400aaactcacac atgcccaccg
tgcccagcac ctgaactcct gggaggaccg tcagtcttcc 5460tcttcccccc
aaaacccaag gacaccctca tgatctcccg gacccctgag gtcacatgcg
5520tggtggtgga cgtgagccac gaagaccctg aggtcaagtt caactggtac
gtggacggcg 5580tggaggtgca taatgccaag acaaagccgc gggaggagca
gtacaacagc acgtaccgtg 5640tggtcagcgt cctcaccgtc ctgcaccagg
actggctgaa tggcaaggag tacaagtgca 5700aggtctccaa caaagccctc
ccagccccca tcgagaaaac catctccaaa gccaaagggc 5760agccccgaga
accacaggtg tacaccctgc ccccatcccg cgatgagctg accaagaacc
5820aggtcagcct gacctgcctg gtcaaaggct tctatcccag cgacatcgcc
gtggagtggg 5880agagcaatgg gcagccggag aacaactaca agaccacgcc
tcccgtgttg gactccgacg 5940gctccttctt cctctacagc aagctcaccg
tggacaagag caggtggcag caggggaacg 6000tcttctcatg ctccgtgatg
catgaggctc tgcacaacca ctacacgcag aagagcctct 6060ccctgtctcc
gggtaaatga ctcgagagat ctggccggct gggcccgttt cgaaggtaag
6120cctatcccta accctctcct cggtctcgat tctacgcgta ccggtcatca
tcaccatcac 6180cattgagttt aaacccgctg atcagcctcg actgtgcctt
ctagttgcca gccatctgtt 6240gtttgcccct cccccgtgcc ttccttgacc
ctggaaggtg ccactcccac tgtcctttcc 6300taataaaatg aggaaattgc
atcgcattgt ctgagtaggt gtcattctat tctggggggt 6360ggggtggggc
aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat
6420gcggtgggct ctatggcttc tgaggcggaa agaaccagtg gcggtaatac
ggttatccac 6480agaatcaggg gataacgcag gaaagaacat gtgagcaaaa
ggccagcaaa aggccaggaa 6540ccgtaaaaag gccgcgttgc tggcgttttt
ccataggctc cgcccccctg acgagcatca 6600caaaaatcga cgctcaagtc
agaggtggcg aaacccgaca ggactataaa gataccaggc 6660gtttccccct
agaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata
6720cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac
gctgtaggta 6780tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt
gtgcacgaac cccccgttca 6840gcccgaccgc tgcgccttat ccggtaacta
tcgtcttgag tccaacccgg taagacacga 6900cttatcgcca ctggcagcag
ccactggtaa caggattagc agagcgaggt atgtaggcgg 6960tgctacagag
ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg
7020tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct
cttgatccgg 7080caaacaaacc accgctggta gcggtggttt ttttgtttgc
aagcagcaga ttacgcgcag 7140aaaaaaagga tctcaagaag atcctttgat
cttttctacg gggtctgacg ctcagtggaa 7200cgaaaactca cgttaaggga
ttttggtcat gacattaacc tataaaaata ggcgtatcac 7260gaggcccttt
cgtctcgcgc gtttcggtga tgacggtgaa aacctctgac acatgcagct
7320cccggagacg gtcacagctt gtctgtaagc ggatgccggg agcagacaag
cccgtcaggg 7380cgcgtcagcg ggtgttggcg ggtgtcgggg ctggcttaac
tatgcggcat cagagcagat 7440tgtactgaga gtgcaccata tatgcggtgt
gaaataccgc acagatgcgt aaggagaaaa 7500taccgcatca ggcgccattc
gccattcagg ctgcgcaact gttgggaagg gcgatcggtg 7560cgggcctctt
cgctattacg cca 75832688PRTArtificialFIX-Fc
chainSIGNAL(-46)..(-19)PROPEP(-18)..(-1)mat_peptide(1)..(642)MISC_FEATURE-
(1)..(415)FIX portionMISC_FEATURE(416)..(642)Fc portion 2Met Gln
Arg Val Asn Met Ile Met Ala Glu Ser Pro Gly Leu Ile Thr -45 -40 -35
Ile Cys Leu Leu Gly Tyr Leu Leu Ser Ala Glu Cys Thr Val Phe Leu -30
-25 -20 -15 Asp His Glu Asn Ala Asn Lys Ile Leu Asn Arg Pro Lys Arg
Tyr Asn -10 -5 -1 1 Ser Gly Lys Leu Glu Glu Phe Val Gln Gly Asn Leu
Glu Arg Glu Cys 5 10 15 Met Glu Glu Lys Cys Ser Phe Glu Glu Ala Arg
Glu Val Phe Glu Asn 20 25 30 Thr Glu Arg Thr Thr Glu Phe Trp Lys
Gln Tyr Val Asp Gly Asp Gln 35 40 45 50 Cys Glu Ser Asn Pro Cys Leu
Asn Gly Gly Ser Cys Lys Asp Asp Ile 55 60 65 Asn Ser Tyr Glu Cys
Trp Cys Pro Phe Gly Phe Glu Gly Lys Asn Cys 70 75 80 Glu Leu Asp
Val Thr Cys Asn Ile Lys Asn Gly Arg Cys Glu Gln Phe 85 90 95 Cys
Lys Asn Ser Ala Asp Asn Lys Val Val Cys Ser Cys Thr Glu Gly 100 105
110 Tyr Arg Leu Ala Glu Asn Gln Lys Ser Cys Glu Pro Ala Val Pro Phe
115 120 125 130 Pro Cys Gly Arg Val Ser Val Ser Gln Thr Ser Lys Leu
Thr Arg Ala 135 140 145 Glu Thr Val Phe Pro Asp Val Asp Tyr Val Asn
Ser Thr Glu Ala Glu 150 155 160 Thr Ile Leu Asp Asn Ile Thr Gln Ser
Thr Gln Ser Phe Asn Asp Phe 165 170 175 Thr Arg Val Val Gly Gly Glu
Asp Ala Lys Pro Gly Gln Phe Pro Trp 180 185 190 Gln Val Val Leu Asn
Gly Lys Val Asp Ala Phe Cys Gly Gly Ser Ile 195 200 205 210 Val Asn
Glu Lys Trp Ile Val Thr Ala Ala His Cys Val Glu Thr Gly 215 220 225
Val Lys Ile Thr Val Val Ala Gly Glu His Asn Ile Glu Glu Thr Glu 230
235 240 His Thr Glu Gln Lys Arg Asn Val Ile Arg Ile Ile Pro His His
Asn 245 250 255 Tyr Asn Ala Ala Ile Asn Lys Tyr Asn His Asp Ile Ala
Leu Leu Glu 260 265 270 Leu Asp Glu Pro Leu Val Leu Asn Ser Tyr Val
Thr Pro Ile Cys Ile 275 280 285 290 Ala Asp Lys Glu Tyr Thr Asn Ile
Phe Leu Lys Phe Gly Ser Gly Tyr 295 300 305 Val Ser Gly Trp Gly Arg
Val Phe His Lys Gly Arg Ser Ala Leu Val 310 315 320 Leu Gln Tyr Leu
Arg Val Pro Leu Val Asp Arg Ala Thr Cys Leu Arg 325 330 335 Ser Thr
Lys Phe Thr Ile Tyr Asn Asn Met Phe Cys Ala Gly Phe His 340 345 350
Glu Gly Gly Arg Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro His Val 355
360 365 370 Thr Glu Val Glu Gly Thr Ser Phe Leu Thr Gly Ile Ile Ser
Trp Gly 375 380 385 Glu Glu Cys Ala Met Lys Gly Lys Tyr Gly Ile Tyr
Thr Lys Val Ser 390 395 400 Arg Tyr Val Asn Trp Ile Lys Glu Lys Thr
Lys Leu Thr Asp Lys Thr 405 410 415 His Thr Cys Pro Pro Cys Pro Ala
Pro Glu Leu Leu Gly Gly Pro Ser 420 425 430 Val Phe Leu Phe Pro Pro
Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 435 440 445 450 Thr Pro Glu
Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 455 460 465 Glu
Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 470 475
480 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val
485 490 495 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys
Glu Tyr 500 505 510 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro
Ile Glu Lys Thr 515 520 525 530 Ile Ser Lys Ala Lys Gly Gln Pro Arg
Glu Pro Gln Val Tyr Thr Leu 535 540 545 Pro Pro Ser Arg Asp Glu Leu
Thr Lys Asn Gln Val Ser Leu Thr Cys 550 555 560 Leu Val Lys Gly Phe
Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 565 570 575 Asn Gly Gln
Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 580 585 590 Ser
Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 595 600
605 610 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu
Ala 615 620 625 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser
Pro Gly Lys 630 635 640 3741DNAArtificialFc DNA sequence
3atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt
60gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggagg accgtcagtc
120ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc
tgaggtcaca 180tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca
agttcaactg gtacgtggac 240ggcgtggagg tgcataatgc caagacaaag
ccgcgggagg agcagtacaa cagcacgtac 300cgtgtggtca gcgtcctcac
cgtcctgcac caggactggc tgaatggcaa ggagtacaag 360tgcaaggtct
ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa
420gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgcgatga
gctgaccaag 480aaccaggtca gcctgacctg cctggtcaaa ggcttctatc
ccagcgacat cgccgtggag 540tgggagagca atgggcagcc ggagaacaac
tacaagacca cgcctcccgt gttggactcc 600gacggctcct tcttcctcta
cagcaagctc accgtggaca agagcaggtg gcagcagggg 660aacgtcttct
catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc
720ctctccctgt ctccgggtaa a 7414247PRTArtificialFc
chainSIGNAL(-20)..(-1)Heterologous mouse Igk light chain signal
peptidemat_peptide(1)..(227)Mature Fc sequence 4Met Glu Thr Asp Thr
Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro -20 -15 -10 -5 Gly Ser
Thr Gly Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro -1 1 5 10
Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 15
20 25 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val
Val 30 35 40 Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp
Tyr Val Asp 45 50 55 60 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro
Arg Glu Glu Gln Tyr 65 70 75 Asn Ser Thr Tyr Arg Val Val Ser Val
Leu Thr Val Leu His Gln Asp 80 85 90 Trp Leu Asn Gly Lys Glu Tyr
Lys Cys Lys Val Ser Asn Lys Ala Leu 95 100 105 Pro Ala Pro Ile Glu
Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 110 115 120 Glu Pro Gln
Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys 125 130 135 140
Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 145
150 155 Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr
Lys 160 165 170 Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe
Leu Tyr Ser 175 180 185 Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln
Gly Asn Val Phe Ser 190 195 200 Cys Ser Val Met His Glu Ala Leu His
Asn His Tyr Thr Gln Lys Ser 205 210 215 220 Leu Ser Leu Ser Pro Gly
Lys 225
* * * * *