U.S. patent application number 15/910586 was filed with the patent office on 2018-08-09 for method of treating and prognosing scoliotic patient subgroups.
The applicant listed for this patent is Chu Sainte-Justine. Invention is credited to Marie - Yvonne Akoume Ndong, Alain Moreau.
Application Number | 20180224467 15/910586 |
Document ID | / |
Family ID | 52627658 |
Filed Date | 2018-08-09 |
United States Patent
Application |
20180224467 |
Kind Code |
A1 |
Moreau; Alain ; et
al. |
August 9, 2018 |
METHOD OF TREATING AND PROGNOSING SCOLIOTIC PATIENT SUBGROUPS
Abstract
The present invention provides a method of treating a subject in
need thereof comprising classifying the subject into functional
group FG1, FG2 or FG3, wherein i) when the subject is classified
into the FG1 functional group, (A) the level of OPN or the activity
of OPN in said subject is increased; (B) the subject is not treated
with a brace; or (C) a combination of (A) and (B); and ii) when the
subject is classified into the FG2 or FG3 functional group, (A) the
level of OPN or the activity of OPN in said subject is decreased;
(B) the subject is treated with a brace; or (C) a combination of
(A) and (B).
Inventors: |
Moreau; Alain; (Montreal,
CA) ; Akoume Ndong; Marie - Yvonne; (Montreal,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Chu Sainte-Justine |
Montreal |
|
CA |
|
|
Family ID: |
52627658 |
Appl. No.: |
15/910586 |
Filed: |
March 2, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14917786 |
Mar 9, 2016 |
|
|
|
PCT/CA2014/050852 |
Sep 9, 2014 |
|
|
|
15910586 |
|
|
|
|
61879314 |
Sep 18, 2013 |
|
|
|
61875162 |
Sep 9, 2013 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 2333/47 20130101;
G01N 33/6893 20130101; G01N 2800/50 20130101; A61K 33/04 20130101;
A61K 31/713 20130101; A61K 38/19 20130101; A61F 5/026 20130101;
C12N 15/1138 20130101; C12N 2320/30 20130101; G01N 2333/726
20130101; A61K 45/06 20130101; C12N 2310/14 20130101; A61K 31/4045
20130101; G01N 33/48728 20130101; A61F 5/02 20130101; G01N 2800/10
20130101; G01N 2800/52 20130101; A61K 31/4045 20130101; A61K
2300/00 20130101; A61K 31/713 20130101; A61K 2300/00 20130101; A61K
33/04 20130101; A61K 2300/00 20130101 |
International
Class: |
G01N 33/68 20060101
G01N033/68; A61F 5/02 20060101 A61F005/02; C12N 15/113 20060101
C12N015/113; A61K 38/19 20060101 A61K038/19; A61K 33/04 20060101
A61K033/04; A61K 31/4045 20060101 A61K031/4045; G01N 33/487
20060101 G01N033/487; A61K 45/06 20060101 A61K045/06; A61K 31/713
20060101 A61K031/713 |
Claims
1. A method of treating a subject in need thereof comprising
classifying the subject into functional group FG1, FG2 or FG3,
wherein i) when the subject is classified into the FG1 functional
group, (A) the level of OPN or the activity of OPN in said subject
is increased; (B) the subject is not treated with a brace; or (C) a
combination of (A) and (B); and ii) when the subject is classified
into the FG2 or FG3 functional group, (A) the level of OPN or the
activity of OPN in said subject is decreased; (B) the subject is
treated with a brace; or (C) a combination of (A) and (B).
2. The method of claim 1, wherein i) comprises treating said
subject with: (a) OPN; (b) an OPN agonist; (c) a treatment or
preventive measure which increases the level of circulating OPN;
(d) an inhibitor of CD44 expression or activity; or (e) a
combination of at least two of (a) to (d); and and wherein ii)
comprises treating said subject with: (f) an OPN antagonist; (g) a
treatment or preventive measure which decreases the level of
circulating OPN; (h) an inhibitor of integrin expression or
activity; (i) sCD44 or a stimulator of CD44 expression; or (j) a
combination of at least two of (f) to (i).
3. The method of claim 2, wherein the method comprises treating
said subject with (b) the OPN agonist and wherein the OPN agonist
is (b i) HA; (b ii) an OPN functional fragment; (b iii) an OPN
functional derivative; or (b iv) a combination of at least two of
(b i) to (b iii).
4. The method of claim 2, wherein the method comprises treating
said subject with (c) the treatment or preventive measure which
increases the level of circulating OPN and wherein the treatment or
preventive measure which increases the level of circulating OPN
comprises applying pulsative compressive pressure for 15-90 minutes
on at least one body part of said subject.
5. The method of claim 4, wherein the treatment or preventive
measure which increases the level of circulating OPN comprises
applying low intensity pulse ultrasound (LIPUS).
6. The method of claim 2, wherein the method comprises treating
said subject with (d) the inhibitor of CD44 expression or activity
and wherein the inhibitor of CD44 expression or activity is an
antibody which binds to CD44 or a siRNA or antisense specific for
CD44.
7. The method of claim 2, wherein the method comprises treating
said subject with (e) the OPN antagonist and wherein the OPN
antagonist is (f i) melatonin; (f ii) selenium; (f iii) an antibody
which binds to OPN; (f iv) an siRNA or antisense specific for OPN;
(f v) a molecule that blocks the binding of OPN to integrins
preferably a RGD peptide or derivative thereof or a peptide
fragment of OPN comprising a RGD motif; or (f vi) a combination of
at least two of (f i) to (f vi).
8. The method of claim 2, wherein the method comprises treating
said subject with (g) the treatment or preventive measure which
decreases the level of circulating OPN and wherein the treatment or
preventive measure which decreases the level of circulating OPN is:
(g i) brace treatment; (g ii) accupoint heat sensitive moxibustion;
(g iii) heat therapy with pad; (g iv) electroacupuncture; (g v)
thermal bath; or (g vi) a combination of at least two of (g i) to
(g v).
9. The method of claim 2, wherein the method comprises treating
said subject with (h) the inhibitor of integrin activity and
wherein the inhibitor of integrin activity is (h i) an antibody
that binds specifically to integrin subunit .alpha..sub.5; (h ii)
an antibody that binds specifically to integrin subunit
.beta..sub.1; (h iii) an antibody that binds specifically to
integrin subunit .beta..sub.3; (h iv) an antibody that binds
specifically to integrin subunit .beta..sub.5; (h v) an antibody
that binds specifically to integrin subunits
.alpha..sub.5.beta..sub.1; or (h vi) a combination of at least two
of (h i) to (h v).
10. The method of claim 9, wherein the inhibitor of integrin
activity is Volociximab.TM.; ATN-161, Etaratuzumab.TM.,
Etaracizzumab.TM., Vitaxin.TM., MEDI-522, CNT095 or
Cilengitide.TM..
11. The method of claim 9, wherein the inhibitor of integrin
activity is Volociximab.TM. or Cilengitide.TM..
12. The method of claim 9, wherein the integrin is
.alpha..sub.5.beta..sub.1.
13. The method of claim 2, wherein the method comprises treating
said subject with (h) the inhibitor of integrin expression and
wherein the inhibitor of integrin expression is (h i) an siRNA or
antisense specific to integrin subunit .alpha.5; (h ii) an siRNA or
antisense specific to integrin subunit .beta.1; (h iii) an siRNA or
antisense specific to integrin subunit .beta.3; (h iv) an siRNA or
antisense specific to integrin subunit .beta.5; (v) a combination
of at least two of (h i) to (h vi).
14. The method of claim 9, comprising treating the FG2 or FG3
subject with a brace.
15. The method of claim 14, further comprising measuring the level
of OPN in a blood sample from the subject periodically.
16. The method of claim 15, wherein the level of OPN is measured
once a month.
17. The method of claim 1, wherein the subject is a pediatric
subject.
18. The method of claim 1, wherein classifying the subject
comprises (i) determining changes in cellular impedance following
Gi-stimulation; (ii) measuring changes in cAMP concentration
following Gi-stimulation; (iii) determining the phosphorylation
pattern of Gi.alpha. proteins; (iv) determining cellular
proliferation in a cell sample from the subject.
19. The method of claim 18, wherein the cellular impedance is
measured by cellular dielectric spectroscopy (CDS).
20. The method of claim 1, wherein the subject is a subject
diagnosed with adolescent idiopathic scoliosis (AIS).
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 14/917,786 which is a national phase entry under 35 U.S.C.
.sctn. 371 of International Application No. PCT/CA2014/050852 filed
Sep. 9, 2014 and published as International Publication No. WO
2015/032004A1, which claims priority from U.S. Provisional
Application No. 61/875,162, filed Sep. 9, 2013 and U.S. Provisional
Application No. 61/879,314, filed Sep. 18, 2013, all of which are
incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to Idiopathic Scoliosis (IS).
More specifically, the present invention is concerned with
endogenous osteopontin (OPN) levels, biological endophenotypes and
IS treatment and prognostic.
REFERENCE TO SEQUENCE LISTING
[0003] This application contains a Sequence Listing in computer
readable form entitled 14033_166_ST25, created on Feb. 20, 2018
having a size of 71 kilobytes, which is incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0004] IS (e.g., Infantile Idiopathic scoliosis, Juvenile
Idiopathic scoliosis or Adolescent Idiopathic scoliosis (AIS)) is a
spine deformity of unknown cause generally defined as a lateral
curvature greater than 10 degrees accompanied by a vertebral
rotation 7. The condition affects 4% of the pediatric population
and is most commonly diagnosed between the ages of 9 to 13 years 8,
9, 10.
[0005] Today in the United States there are approximately one
million children between ages 10 and 16 with some degree of IS and
about 100 000 children in Canada are diagnosed with IS. The total
cost of diagnosis and monitoring of the scoliotic children by X-ray
exposure is over S2.5 billion dollars annually in North America.
Approximately, 10% of children diagnosed with idiopathic scoliosis
have curve progression requiring corrective surgery.sup.11. About
29,000 scoliosis surgeries are done every year in North America,
resulting in significant psychological and physical morbidity.
[0006] At the clinical level, the heterogeneity of IS is clearly
illustrated by the variability of curve patterns, localisations and
curve magnitude even in families with multiple affected members. In
this regard, Applicants have previously discovered that scoliotic
patients and subjects at risk of developing scoliosis are less
responsive to Gi protein (inhibitory guanine nucleotide binding
protein in G protein coupled receptors (GPCRs) also known as
G.sub.i alpha subunit) stimulation when compared with healthy
control subjects. The presence of a general differential
Gi-signaling dysfunction allowed to stratify patients into three
functional groups (FG1, FG2 and FG3) representing distinct
biological endophenotypes. This impairment was measured in all cell
types tested including bone-forming cells; muscle-forming cells and
blood cells. Furthermore, because the Gi cellular response
impairment is generalized and not specific to a particular
receptor, any Gi-PCR ligand (e.g., agonist) can be used to classify
subjects.
[0007] A first classification method is based on the percentage of
degree of reduction (inhibitory response) relative to control
group. The classification ranges were fixed between about 10 and
40% (or below 40%) of reduction of response relative to control
group for FG3, about 40 and 60% for FG2 and above about 60% (e.g.,
between about 60% and 90%) for FG1. The same the classification
ranges can be expressed as the percentage of maximal response
relative to the control (as opposed to the % of reduction of
response relative to the control). In such a case, the ranges are
fixed between about 10-40% for FG1, about 40 and 60% for FG2 and
about 60-90% for FG3. Both classification ranges can be used
interchangeably (see, Moreau et al., 2004; Akoume et al., 2010;
Akoume et al., 2013, Azeddine et al., 2007; Letellier et al., 2008;
WO2003/073102, WO2010/040234 to Moreau, which are incorporated
herein by reference in their entirety).
[0008] More recently, Applicants have modified this approach by
demonstrating that the three functional groups can clearly be
distinguished according to the profile of imbalance between
response to Gi and Gs stimulation (i.e. Gi response minus Gs
response or ratio between Gi/Gs stimulation or Gi/Gs-see
PCT/CA2014/050562, which is incorporated herein by reference). It
was found that the response to Gi stimulation predominated in FG3,
while no apparent (i.e., no substantial or a very small) imbalance
was observed in FG2. In contrast, FG1 subjects exhibited
predominance for response to Gs stimulation. In addition, evidence
was provided to the effect that patients belonging to the FG2
endophenotype are more at risk of progressing to the point of
needing surgery (Julien et al., (2013)).
[0009] The differences in Gi-mediated cellular response observed
among the three endophenotypes is a consequence of differences
observed at the level of Gi protein phosphorylation. When Gi.alpha.
proteins are phosphorylated they become inactive. The inventors
have shown that the degree of serine phosphorylation of Gi.alpha.
proteins can alternatively be used to classify subjects into a
specific functional group. In FG1 subjects, all Gi.alpha. proteins
(Gi.alpha.1-3) are phosphorylated and their level of serine
phosphorylation is substantially higher than in control subjects.
In FG2 subjects, Gi.alpha.1 and Gi.alpha.2 are phosphorylated, the
level of Gi.alpha.1 and Gi.alpha.2 phosphorylation is higher than
in control subjects and most Gi.alpha.3 proteins are not
phosphorylated and thus, remain functional. Finally, in FG3
subjects Gi.alpha.2 and Gi.alpha.3 are phosphorylated, their level
of phosphorylation is higher than in control subjects and most
Gi.alpha.1 are not phosphorylated and thus remain functional16.
[0010] The assessment of an imbalance between Gi and Gs coupled
receptor signaling (as opposed to the assessment of a Gi-coupled
receptor signaling impairment), greatly simplifies the risk
assessment and endophenotype (functional group) assessment by
eliminating the need of a reference signal from a control subject
(see for example co-pending International Publication
WO2014/201557, and co-pending International Publication
WO2015/032005 to Moreau). The establishment of a reference signal
is often difficult and may sometimes constitute an obstacle because
the control subject(s) from whom the reference signal is derived
should preferably match with age, gender, and medication, if any.
Life-style (e.g., exercises and food) may also have some influence
on the level of impairment, scoliosis marker level and individual
cellular responses.
[0011] Finally, in International Publication WO2015/032005,
Applicants further describe novel alternative methods of
identifying subjects at risk of developing IS and of classifying IS
subjects into a specific IS functional group. These methods improve
current classification methods by providing distinct (unique)
cellular responses for the specific functional groups thereby
enabling to classify borderline subjects, which may not otherwise
be identified as belonging to a specific functional group with
sufficient confidence (high specificity) using other known
methods.
[0012] In particular, Applicants have demonstrated that borderline
subjects which cannot be unambiguously classified into a particular
endophenotype subgroup using one or more of the above methods can
be distinguished by assessing the effect of osteopontin (OPN) on
the cellular response following Gi-stimulation (see International
Publication WO2015/032005). Hence, subjects having a scoliosis or
at risk of developing scoliosis can be identified by detecting an
impairment in their cellular response following Gi stimulation and
classified according to their Gi functional status (FG1, FG2 and
FG3) without ambiguity.
[0013] A second method disclosed therein takes advantage of unique
cellular impedance profiles following Gi-protein stimulation in
four GiPCR clusters (I, II, III and IV). The impedance profile for
each cluster has a different shape. In addition, in the case of
GiPCR cluster II, only FG1 subject show an impedance profile
comprising a characteristic negative impedance phase followed by a
positive phase, thereby enabling to easily distinguish FG1 subjects
from FG2 and FG3 subjects. Finally, a third classification method
is based on the demonstration that FG1 subjects can further be
distinguished over FG2 and FG3 subjects based on their cellular
response to GiPCR cluster I and/or II stimulation in the presence
of high concentration of PTX. Following GiPCR cluster I or cluster
II agonist stimulation, the cellular response curve in the presence
of PTX is characterized by a first phase in which the response
decreases with increasing amounts of PTX followed by a second phase
where the response increases with increasing amounts of PTX (V
shape curve). In the second phase of the response, the % of
response relative to administration of a control vehicle is above
that of the corresponding % of response for control (subjects not
having IS or not at risk of developing IS), FG2 and FG3 subjects.
Hence, a magnitude of cellular response in the presence of high
concentration of PTX that is above that of a control (subjects not
having IS or not at risk of developing IS as well as FG2 and FG3
subjects) indicates that the subjects belongs to the FG1 functional
group.
[0014] Once diagnosed, the primary concern for physicians in
managing scoliotic children is whether the curve will progress.
Indeed, the curve progression is often unpredictable and is more
frequently observed among girls than in boys 12. If untreated, the
curve can progress dramatically, creating significant physical
deformity and even cardiopulmonary problems. These manifestations
become life threatening when the curve exceeds 70 degrees 13,14.
The current treatment options to prevent or stop curve progression
include bracing and surgery. In general, bracing is recommended for
curves between 25 and 40 degrees, while surgery is reserved for
curve greater than 45 degrees or curves that are unresponsive to
bracing.
[0015] All diagnosed IS children are subjected to multiple
radiographs over several years, usually until they reach skeletal
maturity. Patients with a curve that is between 20 to 30 degrees
will usually be observed at 4 to 6 months intervals with an x-ray
test to measure the curve. Any progression that is less than 5
degrees is not considered significant. If the curve progresses more
than 5 degrees, then the curve will need treatment. In general,
treatment with a back brace will be recommended for patients: i)
having a curve of about 25 to 40 degrees, and; ii) who are still
growing i.e. patients who are skeletally immature (e.g., girls who
are about 11 to 13 years old, and boys who are about 12 to 14
years, Risser between 0 and 3). Brace treatment is typically used
in girls up to one/-two years after menarche, the onset of the
female menstrual cycle. Brace treatment will often be maintained
after menarche until curve progression has stabilized for 1-2
years, but may be stopped when skeletal maturity is reached. If an
older child has a curve greater than 30 degrees and is almost
mature (Risser of 4-5), his or her curvature will often be treated
with observation only, as there is little growth left and bracing
is unlikely to be as effective. The only curves that tend to
progress after skeletal maturity are those that are greater than 50
degrees in angulation, so the treatment objective with the back
brace is to try to bring the child into adulthood with less than a
50-degree curvature.
[0016] Typically, if the curve continues to progress to 40-45
degrees or more, a spinal fusion surgery will usually be
recommended. However, even if surgery eventually becomes necessary,
the back brace can still be beneficial by helping delay the
progression of the curvature and allowing optimal growth for the
child before undergoing spinal fusion (which ends the spine
growth).
[0017] Unfortunately, some patients do not respond or respond
poorly to bracing, and their spinal curves continue to progress.
Currently, there is no approved method or test available to predict
which affected individuals are likely to benefit from bracing and
which individuals are likely to experience a curve progression
requiring surgery, despite brace treatment.
[0018] It would be advantageous to identify prior to treatment
subjects likely to benefit from brace treatment (or other scoliosis
treatment) from those unlikely to benefit from it or likely to
worsen following treatment. Curves that progress can require fusion
surgery and/or lead to potential long-term health problems. Even
for patients unlikely to worsen after brace treatment, it would be
advantageous to avoid the treatment if it is unnecessary or
ineffective: while it is non-invasive, bracing for scoliosis is in
itself a very difficult treatment option for many patients and may
have a significant psychological impact. Early knowledge of bracing
treatment outcome could therefore help IS treatment by avoiding
unnecessary bracing and by enabling the selection of the most
appropriate treatment for a given individual early on during the
course of the disease.
[0019] The present description refers to a number of documents, the
content of which is herein incorporated by reference in their
entirety.
SUMMARY OF THE INVENTION
[0020] Mechanotransduction (biomechanics and bodily responses to
mechanical stimuli) is involved in IS development as well as its
non-surgical treatments (i.e. bracing, physical therapies).
Mechanotransduction is a relatively new and emerging angle of
research in the field of IS (e.g., AIS) study that holds many
possibilities for novel personalized therapeutic options. Knowledge
of the specific genes and biochemical pathways that are altered
because of mechanotransduction differences in scoliosis could
significantly change the diagnosis and treatment of IS.
[0021] In this context, the present invention identified that
certain mechanotransductive genes (e.g., SSP1 encoding OPN;
SPP1-Gene ID: 6696, OPNa: NP_001035147.1, OPNb: NP_000573.1, OPNc:
NP_001035149.1, OPN Isoform 4: NP_001238758.1, OPN Isoform 5:
NP_001238759.1, NM_001251829.1, GI_352962173) and pathways are
distinctive between FG1 and the two other IS functional groups (FG2
and FG3). The present invention is based in part on the discovery
that depending on their Gi functional status (FG1, FG2 or FG3),
subjects suffering from IS do not equally respond to bracing and
OPN.
[0022] The present inventors have found that subjects of the FG3
functional group are more likely than those of the FG2 functional
group to have successful brace treatment, while subjects belonging
to the FG1 group are the least likely to have successful brace
treatment and their condition could even be aggravated by brace
treatment. They have also found that OPN has a protective effect in
subjects belonging to the FG1 functional group while it is a risk
factor in the subjects of the FG2 and FG3 functional groups.
Indeed, it was unexpectedly found that OPN increases the
Gi-mediated response in FG1 subjects while it further decreases
(aggravates) the impairment observed in the Gi-mediated response of
FG2 and FG3 functional groups. This illustrates the heterogeneity
of mechanical response on a biological level among IS patients and
could explain why some patients are considered as brace-responders
while for others, bracing cannot stop curve progression.
[0023] Accordingly, the present invention provides a method of
predicting brace treatment outcome in a subject in need thereof
comprising classifying the subject into functional group FG1, FG2
or FG3, wherein the classification enables the prediction of brace
treatment outcome.
[0024] In a specific embodiment, the classification of the subject
into the FG2 or FG3 functional group is indicative that the subject
is likely to benefit from brace treatment. In another specific
embodiment, the classification of the subject into the FG1
functional group is indicative that the subject is unlikely to
benefit from brace treatment. In another specific embodiment, the
classification of the subject into the FG2 or FG3 functional group
is indicative that the subject is likely to have a successful brace
treatment. In another specific embodiment, the classification of
the subject into the FG1 functional group is indicative that the
subject is unlikely to have a successful brace treatment. In
another specific embodiment, the classification of the subject into
the FG2 or FG3 functional group is indicative that the subject has
a decreased risk of curve progression following brace treatment. In
another specific embodiment, the classification of the subject into
the FG1 functional group is indicative that the subject has an
increased risk of curve progression following brace treatment. In
another specific embodiment, the classification of the subject into
the FG2 or FG3 functional group is indicative that the subject has
a decreased risk of requiring surgery following brace treatment. In
another specific embodiment, the classification of the subject into
the FG1 functional group is indicative that the subject has an
increased risk of requiring surgery following brace treatment. In
another specific embodiment, the method further comprises measuring
the level of OPN in a blood sample from the subject prior to the
beginning of brace treatment. In another specific embodiment, the
classification of the subject into the FG1 functional group and a
high level of OPN in the blood sample from the subject is
indicative that the subject is further unlikely to benefit from
brace treatment. In another specific embodiment, the classification
of the subject into the FG1 functional group and a low level of OPN
level in the blood sample from the subject is indicative that the
subject may benefit from a short brace treatment. In another
specific embodiment, the classification of the subject into the FG2
or FG3 functional group and a high level of OPN in the blood sample
from the subject is indicative that the subject is further likely
to benefit from brace treatment.
[0025] In another specific embodiment, the brace treatment
comprises treatment with a Thoraco-Lumbo-Sacral-Orthosis (TLSO)
brace, a Milwakee brace, a Charleston brace, a SpineCor.TM. brace
or any combination thereof. In another specific embodiment, the
brace treatment comprises treatment with a
Thoraco-Lumbo-Sacral-Orthosis (TLSO) brace.
[0026] In accordance with another aspect of the present invention,
there is provided a method of predicting the risk of developing
idiopathic scoliosis in a subject in need thereof comprising:
classifying the subject into functional group FG1, FG2 or FG3;
measuring the level of OPN in a blood sample from the subject,
wherein a classification of the subject into the FG1 functional
group and a low level of OPN or a classification of the subject
into the FG2 or FG3 functional group and a high level of OPN is
indicative that the subject has an increased risk of developing
idiopathic scoliosis. In a specific embodiment, the risk of
developing scoliosis is a risk of curve progression.
[0027] In accordance with yet another aspect of the present
invention, there is provided a method of treating a subject
suffering from an idiopathic scoliosis or at risk of developing an
idiopathic scoliosis comprising classifying the subject into
functional group FG1, FG2 or FG3, wherein when the subject is
classified into the FG1 functional group, the subject is not
treated with a brace; and when the subject is classified into the
FG2 or FG3 functional group, the subject is treated with a
brace.
[0028] In accordance with yet another aspect of the present
invention, there is provided a method of treating a subject in need
thereof comprising classifying the subject into functional group
FG1, FG2 or FG3, wherein when the subject is classified into the
FG1 functional group, the subject is treated with OPN or an OPN
agonist or with treatment or preventive measures which increase the
level or activity of circulating OPN; and when the subject is
classified into the FG2 or FG3 functional group, the subject is
treated with an OPN antagonist or with treatment or preventive
measures which decrease the level or activity of circulating
OPN.
[0029] In accordance with yet another aspect of the present
invention, there is provided a method of treating a subject in need
thereof comprising a) classifying the subject into functional group
FG1, FG2 or FG3; and b) determining the level of OPN in a blood
sample from the subject, wherein when the subject is classified
into the FG1 functional group and the level of OPN is high, the
subject is not treated with a brace; when the subject is classified
into the FG1 functional group and the level of OPN is low, the
subject is optionally treated with a brace for a short period of
time; and when the subject is classified into the FG2 or FG3
functional group the subject is treated with a brace.
[0030] In a specific embodiment, when the subject is classified
into functional group FG1, the subject is further treated with OPN
or an OPN agonist or with treatment or preventive measures which
increase the level or activity of circulating OPN. In another
specific embodiment, when the subject is classified into functional
group FG2 or FG3, the subject is further treated with an OPN
antagonist or with treatment or preventive measures which decrease
the level or activity of circulating OPN.
[0031] In a related aspect, the present invention provides a method
of treating a subject in need thereof comprising classifying the
subject into functional group FG1, FG2 or FG3, wherein (i) when the
subject is classified into the FG1 functional group, the level of
OPN or the activity of OPN in said subject is increased; and (ii)
when the subject is classified into the FG2 or FG3 functional
group, the level of OPN or the activity of OPN in said subject is
decreased. In an embodiment, i) comprises treating said subject
with: (a) OPN; (b) an OPN agonist; (c) a treatment or preventive
measure which increases the level of circulating OPN; (d) an
inhibitor of CD44 expression or activity; or (e) a combination of
at least two of (a) to (d). In an embodiment, ii) comprises
treating said subject with: (f) an OPN antagonist; (g) a treatment
or preventive measure which decreases the level of circulating OPN;
(h) an inhibitor of integrin expression or activity; (i) sCD44 or a
stimulator of CD44 expression; or (j) a combination of at least two
of (f) to (i).
[0032] In an embodiment, the OPN agonist is (b i) HA; (b ii) an OPN
functional fragment; (b iii) an OPN functional derivative; or (b
iv) a combination of at least two of (b i) to (b iii). In an
embodiment the treatment or preventive measure which increases the
level of circulating OPN comprises applying pulsative compressive
pressure for 15-90 minutes on at least one body part of said
subject. In an embodiment the treatment or preventive measure which
increases the level of circulating OPN comprises applying low
intensity pulse ultrasound (LIPUS). In an embodiment the inhibitor
of CD44 expression or activity is an antibody which binds to CD44
or a siRNA or antisense specific for CD44. In an embodiment the OPN
antagonist is (f i) melatonin; (f ii) selenium; (f iii) an antibody
which binds to OPN; (f iv) an siRNA or antisense specific for OPN;
(f v) a molecule that blocks the binding of OPN to integrins; or (f
vi) a combination of at least two of (f i) to (f vi). In an
embodiment the treatment or preventive measure which decreases the
level of circulating OPN is: (g i) brace treatment; (g ii)
accupoint heat sensitive moxibustion; (g iii) heat therapy with
pad; (g iv) electroacupuncture; (g v) thermal bath; or (g vi) a
combination of at least two of (g i) to (g v). In an embodiment the
molecule that blocks the binding of OPN to integrins is a RGD
peptide or derivative thereof. In an embodiment the molecule that
blocks the binding of OPN to integrins is a peptide fragment of OPN
comprising a RGD motif. In an embodiment the peptide fragment of
OPN comprises the amino acid sequence GRGDSVVYGLRS (SEQ ID NO: 13).
In an embodiment the inhibitor of integrin activity is (h i) an
antibody that binds specifically to integrin subunit .alpha..sub.5;
(h ii) an antibody that binds specifically to integrin subunit
.beta..sub.1; (h iii) an antibody that binds specifically to
integrin subunit .beta..sub.3; (h iv) an antibody that binds
specifically to integrin subunit .beta..sub.5; (h v) an antibody
that binds specifically to integrin subunits
.alpha..sub.5.beta..sub.1; or (h vi) a combination of at least two
of (h i) to (h v). In an embodiment the inhibitor of integrin
activity is Volociximab.TM.; ATN-161, Etaratuzumab.TM.,
Etaracizzumab.TM., Vitaxin.TM., MEDI-522, CNT095 or
Cilengitide.TM.. In a particular embodiment the inhibitor of
integrin activity is Volociximab.TM. or Cilengitide.TM.. In a
particular embodiment of the methods of the present invention,
integrin is .alpha..sub.5.beta..sub.1. In an embodiment, the
inhibitor of integrin expression is (h i) an siRNA or antisense
specific to integrin subunit .alpha.5; (h ii) an siRNA or antisense
specific to integrin subunit .beta.1; (h iii) an siRNA or antisense
specific to integrin subunit .beta.3; (h iv) an siRNA or antisense
specific to integrin subunit .beta.5; (v) a combination of at least
two of (h i) to (h vi).
[0033] In a particular aspect, the above treatment methods further
comprise treating the subject with a brace.
[0034] In another specific embodiment, the above methods of the
present invention further comprise measuring the level of OPN in a
blood sample from the subject periodically. In another specific
embodiment, the level of OPN is measured once a month.
[0035] In another specific embodiment, the high level of OPN in the
blood sample of the subject is between about 600-1000 ng/ml. In
another specific embodiment, the low level of OPN in the blood
sample of the subject is .ltoreq.500 ng/ml.
[0036] In another specific embodiment, the subject is a pediatric
subject.
[0037] In another specific embodiment, the classification comprises
determining changes in cellular impedance following Gi-stimulation
in a cell sample from the subject. In another specific embodiment,
the cellular impedance is measured by cellular dielectric
spectroscopy (CDS). In another specific embodiment, the
classification comprises measuring changes in cAMP concentration
following Gi-stimulation in a cell sample from the subject. In
another specific embodiment, the classification comprises
determining the phosphorylation pattern of Gi.alpha. proteins in a
cell sample from the subject. In another specific embodiment, the
classification comprises determining cellular proliferation of a
cell sample from the subject.
[0038] In another specific embodiment, the subject is a subject
diagnosed with Idiopathic Scoliosis (IS). In another specific
embodiment, the Idiopathic Scoliosis is Adolescent Idiopathic
Scoliosis (AIS).
[0039] In accordance with another aspect of the present invention,
there is provided a kit for predicting brace treatment outcome in a
subject suffering from Idiopathic Scoliosis or for predicting the
risk of developing severe Idiopathic Scoliosis comprising reagents
for classifying a subject into functional group FG1, FG2 or FG3. In
a specific embodiment of the kit, the kit comprises at least two of
(i) a ligand for Gi stimulation; (ii) a ligand for detecting
Gi.alpha. proteins phosphorylation; and/or (iii) reagents for
detecting cellular proliferation. In a specific embodiment of the
kit, the kit further comprises: (i) a ligand for Gs stimulation;
(ii) reagents for detecting the level of OPN; and/or (iii)
instructions for predicting brace treatment outcome.
[0040] Other objects, advantages and features of the present
invention will become more apparent upon reading of the following
non-restrictive description of specific embodiments thereof, given
by way of example only with reference to the accompanying
drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0041] In the appended drawings:
[0042] FIGS. 1A and 1B present possible treatment options depending
on the functional status of the subject and the level of
circulating OPN in the blood sample of the subject. FIG. 1A. Brace
treatment options depending on the subject's functional group and
on the circulating level of OPN. FIG. 1B. Complementary/alternative
treatment options according to the functional status of the
subject;
[0043] FIG. 2 shows OPN circulating levels between age 9 and 18 in
controls and AIS subjects;
[0044] FIGS. 3A-3B show OPN circulating levels variation in blood
sample of AIS subjects during brace treatment. FIG. 3A shows OPN
circulating levels variation in blood samples of AIS subjects
having low initial OPN circulating levels (e.g., below about 600
ng/ml) and FIG. 3B shows OPN circulating levels variation in blood
samples of AIS subjects having high initial OPN circulating levels
(e.g., at or above about 600 ng/ml);
[0045] FIGS. 4A-4B shows curve progression and subject's clinical
information (FIG. 4A) and OPN and sCD44 levels variation (FIG. 4B)
with time in blood samples from a female FG1 AIS subject
(#593);
[0046] FIGS. 5A-5B: FIG. 5A shows OPN and sCD44 levels variation;
and FIG. 5B shows curve progression and subject's clinical
information with time in blood samples from a female FG1 AIS
subject (#148);
[0047] FIGS. 6A-6B: FIG. 6A shows OPN and sCD44 levels variation;
and FIG. 6B shows curve progression and subject's clinical
information with time in blood samples from a male FG1 AIS subject
(#393);
[0048] FIGS. 7A-7B: FIG. 7A shows OPN and sCD44 levels variation;
and FIG. 7B shows curve progression and subject's clinical
information with time in blood samples from a male FG1 AIS subject
(#498);
[0049] FIGS. 8A-8B: FIG. 8A shows OPN and sCD44 levels variation;
and FIG. 8B curve progression and subject's clinical information
(B) with time in blood samples from a female FG1 AIS subject
(#530);
[0050] FIGS. 9A-9B: FIG. 9A shows OPN and sCD44 levels variation;
and FIG. 9B curve progression and subject's clinical information
with time in blood samples from a female FG1 AIS subject
(#627);
[0051] FIGS. 10A-10B: FIG. 10A shows OPN and sCD44 levels
variation; and FIG. 10B shows curve progression and subject's
clinical information with time in blood samples from a female FG1
AIS subject (#675);
[0052] FIGS. 11A-11B: FIG. 11A shows OPN and sCD44 levels
variation; and FIG. 11B shows curve progression and subject's
clinical information with time in blood samples from a female FG1
AIS subject (#394);
[0053] FIGS. 12A-12B: FIG. 12A shows curve progression and
subject's clinical information and FIG. 12B shows OPN and sCD44
levels variation with time in blood samples from a female FG1 AIS
subject (#679);
[0054] FIGS. 13A-13B: FIG. 13A shows OPN and sCD44 levels
variation; and FIG. 13B shows curve progression and subject's
clinical information with time in blood samples from a female FG1
AIS subject (#460);
[0055] FIGS. 14A-14B: FIG. 14A shows OPN and sCD44 levels
variation; and FIG. 14B shows curve progression and subject's
clinical information with time in blood samples from a female FG1
AIS subject (#789);
[0056] FIGS. 15A-15B: FIG. 15A shows OPN and sCD44 levels
variation; and FIG. 15B shows curve progression and subject's
clinical information with time in blood samples from a female FG1
AIS subject (#144);
[0057] FIGS. 16A-16B: FIG. 16A shows curve progression and
subject's clinical information and FIG. 16B shows OPN and sCD44
levels variation with time in blood samples from a female FG2 AIS
subject (#208);
[0058] FIGS. 17A-17B: FIG. 17A shows curve progression and
subject's clinical information and FIG. 17B shows OPN and sCD44
levels variation with time in blood samples from a female FG2 AIS
subject (#159);
[0059] FIGS. 18A-18B: FIG. 18A shows curve progression and
subject's clinical information and FIG. 18B shows OPN and sCD44
levels variation with time in blood samples from a female FG2 AIS
subject (#272);
[0060] FIGS. 19A-19B: FIG. 19A shows curve progression and
subject's clinical information and FIG. 19B shows OPN and sCD44
levels variation with time in blood samples from a female FG3 AIS
subject (#301);
[0061] FIG. 20 shows that cell response to OPN is genetically
programmed in AIS patients. Gi-mediated cellular response in the
presence of increasing amounts of rOPN was measured by cellular
impedance using the CellKey.TM. system (Akoume et al., 2010; and
Akoume et al., 2013 (J. Vis. Exp.)) in functional groups FG1, FG2
and FG3;
[0062] FIG. 21 shows that knock down of OPN rescued Gi-mediated
cell signalling in AIS subjects of FG2 and FG3 functional groups.
Gi-mediated cellular response in the presence siRNAs against rOPN
was measured by cellular impedance using the CellKey.TM. system
(Akoume et al., 2010; and Akoume et al., 2013 (J. Vis. Exp.)) in
functional groups FG1, FG2 and FG3;
[0063] FIG. 22 shows the effect of OPN and hyaluronic acid
treatment on GiPCR signaling in cells of healthy and AIS subjects
according to their biological endophenotype. Osteoblasts from
healthy subjects and AIS patients of each endophenotype (FG1, FG2
and FG3) were treated with vehicle, OPN (500 ng/ml) or HA (10
.mu.M). The Gi-mediated cellular response in the presence of
increasing amounts of LPA was measured by cellular impedance using
the CellKey.TM. system;
[0064] FIG. 23 shows that absence or inhibition of CD44 potentiates
the effects of OPN on Gi-mediated cell signaling in each biological
endophenotype groups (FG1, FG2 and FG3). CD44 activity (A) or
expression (B) was inhibited in osteoblasts from control, FG1, FG2
and FG3 patients and the effect on OPN-dependent inhibition of
Gi-mediated cell signaling was monitored using the CellKey.TM.
system following stimulation with LPA. Inhibition of CD44 using an
anti-CD44 antibody (A) or a siRNA against CD44 (B) further
decreased Gi-mediated cell signaling in control, FG2 and FG3
subjects while it further increased Gi-mediated cell signaling in
FG1 subjects;
[0065] FIGS. 24A-24D show that OPN-dependent inhibition of
Gi-mediated cell signaling involves integrins. Antibodies against
integrins .beta..sub.1, .beta..sub.3 and .beta..sub.5 reverse the
effect of OPN on Gi-mediated response in FG2 and FG3 subjects only,
while blockade of CD44 further potentiates the effect of OPN.
(FIGS. SA, C and D) In osteoblasts from control, FG2 and FG3
subjects, the inhibition of OPN on Gi-mediated cell signaling can
be reversed by antibodies against integrins .beta..sub.1,
.beta..sub.3 and .beta..sub.5 while inhibition of CD44 using an
anti-CD44 antibody further reduced (aggravated) Gi-mediated
signaling in FG2 and FG3 subjects and potentiated the effect of
OPN. Inhibition of integrin .beta.1 was most effective; (FIG. 24B)
In osteoblasts from FG1 subjects, antibodies against integrins
.beta..sub.3 and .beta..sub.5 have an opposite effect and reduced
(blocked) the increase in Gi-mediated response induced by OPN,
although to a lesser extent. Conversely, inhibition of CD44 using a
CD44 antibody, increased the Gi-mediated response in FG1 subjects;
and
[0066] FIGS. 25A-24D shows that OPN-dependent inhibition of
Gi-mediated cell signaling involves integrins. SiRNAs against
integrins .beta..sub.3 and .beta..sub.5 reversed the effect of OPN
on Gi-mediated response while blockade of CD44 further potentiated
the effect of OPN. (FIGS. 25A, 25C and 25D) In osteoblasts from
control, FG2 and FG3 subjects, the inhibition of OPN on Gi-mediated
cell signaling can be reversed by siRNAs against integrins
.beta..sub.1, .beta..sub.3 and .beta..sub.5 while inhibition of
CD44 using an siRNA further reduced Gi-mediated signaling and
potentiated the effect of OPN (FIG. 25B) In osteoblasts from FG1
subjects, siRNAs against integrins .beta..sub.1, .beta..sub.3 and
.beta..sub.5 had an opposite effect and reduced (blocked) the
increase in Gi-mediated response induced by OPN but in a less or
non-significant extent.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0067] Applicants have assessed whether circulating OPN levels have
the same effect with regards to Gi-mediated response and risk of
developing scoliosis among the three functional groups and have
undertaken a retrospective study with IS subjects to determine
whether patient bracing outcome could be differentiated based on
their Gi functional status (FG1, FG2 and FG3).
[0068] The present invention is based on the findings that i) OPN
has a differential (opposite) effect on the response to Gi
stimulation among IS functional groups (it decreases the
Gi-mediated response in control, FG2 and FG3 subjects while it
increases the Gi-mediated cellular response in FG1 subjects); ii)
inhibition of the expression or activity of CD44 (a receptor for
OPN) potentiates the effect of OPN; iii) Hyaluronic acid (HA)
(which binds to CD44 receptor with higher affinity than OPN) also
has a differential effect on Gi-mediated cellular response (it
decreases the Gi-mediated response in control, FG2 and FG3 subjects
while it increases the Gi-mediated cellular response in FG1
subjects; iv) inhibition of the expression or activity of integrins
(which bind OPN) reduce the effect of OPN on the Gi-mediated
cellular response in FG2 and FG3 subjects; v) high circulating OPN
level in FG1 subjects has a protective effect while it is a risk
factor in FG2 and FG3 subjects; vi) brace treatment outcome is most
favorable in FG2 and FG3 subjects (mainly in FG3); vii) bracing is
less effective in FG1 subjects with significant increased
likelihood to progress over 45.degree. and to have surgery than the
other 2 groups; and viii) bracing generally decreases circulating
OPN levels in all AIS subjects. Taken together, these results
enable to improve IS treatment, to more accurately predict brace
treatment outcome and to select the most appropriate treatment
method and follow up schedule for each patient according to their
biological endophenotype (FG1, FG2 and FG3) and/or circulating OPN
level.
[0069] IS patient bracing outcome was evaluated in regard to curve
progression leading up to surgery between the 3 functional groups
(FG1, FG2 and FG3). Each patient had been previously classified in
one of the 3 functional groups (FG1, FG2 or FG3) using a cell-based
assay measuring cAMP (Moreau et al., 2004) variation and/or CDS
response (Akoume et al., 2010) following Gi stimulation. Outcome of
brace treatment in terms of curve progression over 45.degree. and
occurrence of corrective surgery was determined for each functional
group. It was found that bracing is less effective in FG1, with an
increased likelihood to progress over 45.degree. and to have
surgery than the other 2 groups. Outcomes of bracing were most
favorable for patients presenting the FG3 endophenotype.
[0070] Applicants have determined that subjects classified in the
FG1 functional group are less likely to benefit from bracing.
Furthermore, FG1 subjects having high level of OPN (e.g., above
1000 ng/ml) are less likely to progress than FG1 subjects having
low levels of OPN (.ltoreq.500 ng/ml). Results suggest that in FG1
subjects, when the level of OPN decreases around 500 ng/ml or
below, scoliosis tend to progress (i.e., increase in Cobb's angle).
These results are consistent with applicant's findings that in the
FG1 functional group, OPN reduces the Gi-mediated signaling defect
(i.e., increases Gi-mediated cell signaling) generally present in
scoliosis subjects. Applicants have also determined that brace
treatment generally decreases OPN levels by way of a
retroinhibition mechanism and that effect of brace treatment may
further be distinguished based on initial circulating OPN levels
prior to beginning of treatment. Indeed, it was found that in
certain subjects having initial low level of circulating OPN, brace
treatment first induces a sharp rise in OPN levels (within the
first 6 months) while it induces a sharp decrease in OPN levels in
subjects having high initial OPN levels, thereby supporting a
retroinhibition mechanism controlling circulating OPN levels in
vivo. Furthermore, Applicants have found that high circulating OPN
levels have a protective effect on patients of functional group FG1
and have a detrimental effect (i.e., increasing their risk of
developing a scoliosis) in subjects classified into the FG2 and FG3
functional groups.
[0071] Accordingly, FG1 subjects (especially having a high level of
circulating OPN) should generally not be prescribed brace treatment
even if very short. Subjects of the FG2 and FG3 functional groups
are more likely to benefit from brace treatment (e.g., long term
brace treatment) possibly because it generally decreases OPN levels
and an elevated OPN level is a risk factor for these subjects.
[0072] Hence, further combining endophenotype classification with
OPN circulating levels allows to further distinguish among
functional groups which subjects should be treated with a brace,
which subjects should have their level or activity of OPN lowered
(e.g., FG2 and FG3 subjects), which subject should have their level
or activity of OPN increased (FG1 subjects), which subjects should
have their level of CD44 (e.g., sCD44) increased (FG2 and FG3);
which subjects should have their level of CD44 (e.g., sCD44)
decreased (e.g., FG1); which subjects should have their level of HA
increased (FG1); which subjects should have their level of HA
decreased (FG2 and FG3); which subjects should have their level or
activity of integrins (e.g., .alpha..sub.5, .beta..sub.1,
.beta..sub.3 and .beta..sub.5) decreased (FG2 and FG3); as well as
the optimal duration of treatment. Other treatment regimens known
to have an effect on OPN, HA, CD44 or integrins level or activity
may also be adapted according to each specific functional group
(e.g., specific exercises or massages (e.g., application of
compressive pressure for 15 to 90 minutes--See for example U.S.
Ser. No. 13/822,982, and low intensity pulsed ultrasounds (LIPUS),
for FG1 patients, because such approaches can increase OPN
expression level (e.g., OPN plama level)), accupoint heat sensitive
moxibustion or heat therapy with pad, thermal bath,
electroacupuncture (for FG2 and FG3 subjects because such
approaches are known to decrease OPN levels in serum of subjects).
These findings enable personalized treatment prescription according
to each patient Gi-endophenotype and/or OPN level, early on
following diagnosis thereby avoiding unnecessary delay in finding
best treatment options which will ultimately improve IS treatment
outcome.
[0073] Accordingly, the present invention provides a method of
predicting brace treatment outcome in a subject in need thereof
comprising; i) classifying the subject into functional group FG1,
FG2 or FG3, wherein the classification enables the prediction of
brace treatment outcome.
[0074] Specifically, according to the above method, classification
of the subject into the FG1 functional group is indicative that the
subject: i) is less likely to benefit from brace treatment (e.g.,
is less likely to have brace treatment success); ii) is more likely
to require surgery; iii) is more likely to show a curve progression
>6.degree. in Cobb's angle; iv) is less likely to have a Cobb
angle .ltoreq. to 45.degree.; and v) is more likely to aggravate
his/her condition (e.g., increase speed of curve progression or
increased final Cobb angle) by brace treatment as compared to FG2
and FG3 functional groups.
[0075] According to the above brace treatment outcome prediction
method, classification of the subject into the FG3 functional group
is indicative that the subject: i) is more likely to benefit from
brace treatment (e.g., is more likely to have brace treatment
success); ii) is less likely to require surgery; iii) is less
likely to show a curve progression >6.degree. in Cobb's angle;
iv) is more likely to have a Cobb angle .ltoreq. to 45.degree.; and
v) that the subject is less likely (or unlikely) to aggravate
his/her condition (e.g., increase speed of curve progression or
increased final Cobb angle) by brace treatment as compared to FG1
and FG2 functional groups.
[0076] Finally, classification of the subject into the FG2
functional group according to the above brace treatment outcome
prediction method is indicative that the subject: i) has moderate
chances of benefiting from brace treatment (e.g., the subject has
moderate chances of brace treatment success); ii) has moderate risk
of requiring surgery; iii) has moderate risk to show a curve
progression >6.degree. in Cobb's angle; iv) has moderate risk of
having a Cobb angle .ltoreq. to 45.degree.; and v) has low risk of
aggravating his/her condition (e.g., increase speed of curve
progression or increased final Cobb angle) by brace treatment as
compared to FG1 and FG3 functional groups.
[0077] Under certain circumstances, certain rare FG1 subjects could
nevertheless benefit from a short brace treatment if, in such
patients bracing increases OPN level. It was found that subjects in
each functional group may further be distinguished based on their
level of circulating OPN (low or high level of OPN). In order to
further distinguish among each groups which subjects could benefit
from brace treatment, the present prediction method can
advantageously further comprise measuring the level of circulating
OPN prior to the beginning of brace treatment. According to this
method, certain subjects classified into the FG1 functional group
and having a low level of circulating OPN (e.g., below 500 ng/ml)
may benefit from a short brace treatment (e.g., 6 months or less)
and are less likely to aggravate their condition by short treatment
than FG1 subjects having high levels of circulating OPN because
brace treatment can induce an increase in circulating OPN in these
subjects at the beginning of treatment and OPN has a protective
effect in these subjects. The short brace treatment may be for 18
months or less, preferably 12 months or less and more preferably, 6
months or less or until OPN concentration is at its maximal
concentration or close to its maximal concentration (i.e., below
the retroinhibition concentration). It should be noted that if an
FG1 subject is treated with a brace, his/her OPN level should be
monitored closely in order to detect any drop in circulating OPN.
Preferably, brace treatment would be pursued only if and while
bracing induces an increase in OPN level. If a drop in circulating
OPN level is detected, then brace treatment should be stopped.
[0078] According to the above method, subjects classified into the
FG2 or FG3 functional group and having a high level of circulating
OPN may more rapidly benefit from brace treatment than FG2 or FG3
subjects having low levels of circulating OPN because OPN is a risk
factor in these subjects and brace treatment reduces the level of
circulating OPN in these subjects. In subjects of the FG2 and FG3
functional groups having a low level of circulating OPN, brace
treatment is nevertheless beneficial but is preferably maintained
for a sufficient time so that the level of OPN level is decreased
(e.g., 12-18 months and preferably more than 18 months).
[0079] In a related aspect, the present invention also encompasses
selecting the most efficient and least invasive known preventive
action, treatment or follow-up schedule in view of the determined
classification and concentration of circulating OPN level.
[0080] Accordingly, the present invention provides a method of
treating or preventing IS in a subject comprising, classifying the
subject into functional group FG1, FG2 or FG3, wherein when the
subject is classified into the FG1 functional group: i) the subject
is treated with OPN; ii) the subject is treated with an OPN agonist
(e.g., HA supplements or treatment or preventive measures which
increase HA level such as a HA rich diet); iii) the subject is
treated with a CD44 antagonist (e.g., an antibody against CD44);
iv) the subject is treated with an integrin agonist (or the subject
is prescribed treatment or preventive measures which increase
integrin level or activity); iv) the subject is prescribed
treatment or preventive measures which increase circulating OPN
levels (e.g., massages such as by compressive pressure as described
in U.S. Ser. No. 13/822,982; low intensity pulsed ultrasound
(LIPUS), etc.); v) the subject is prescribed treatment or
preventive measures which decrease CD44 level or activity (e.g.,
siRNA specific for CD44 or antibody which blocks CD44 binding to
OPN); and vi) any combinations of i) to v); and wherein when the
subject is classified into functional group FG2 or FG3, the subject
is vii) treated with an OPN antagonist (e.g., OPN antibody, OPN
siRNA, melatonin, vitamin D, PROTANDIM.TM. (nutraceutic cocktail
known to reduce plasma or serum OPN levels and used as a natural
anti-oxydant mix), an inactive OPN derivative or analog blocking
one or more OPN receptors (e.g., .alpha..sub.5.beta..sub.1,
.alpha..sub.4.beta..sub.1, .alpha..sub.9.beta..sub.1, and
.alpha..sub.9.beta..sub.4)); viii) the subject is treated with
sCD44 or a CD44 agonist; ix) the subject is treated with an
integrin antagonist (e.g., RGD peptide or derivative thereof, a
synthetic peptide acting as specific .alpha..sub.v integrin
inhibitor (e.g. Cilengitide.TM.) or monoclonal antibodies targeting
specifically integrin (Volociximab.TM. (.alpha..sub.5.beta..sub.1);
Etaratuzumab.TM. (.alpha..sub.v.beta..sub.3), Etaracizzumab.TM.
(.alpha..sub.v.beta..sub.3), vitaxin (.alpha..sub.v.beta..sub.3),
MEDI-522 (.alpha..sub.v.beta..sub.3)) or anti-.alpha..sub.v
integrin (CNT095); or x is prescribed treatment or preventive
measures which reduce the level of circulating OPN (e.g., brace
treatment, accupoint heat sensitive moxibustion, heat therapy with
pad, thermal bath, electroacupuncture, etc.); xi) the subject is
prescribed treatment or preventive measures which increase
CD44/sCD44 level; xii) the subject is prescribed treatment or
preventive measures which decrease HA level (e.g., HA-poor diet);
xiii) the subject is prescribed an integrin antagonist (e.g., an
antibody or siRNA specific for integrin .alpha.5, .beta.1, .beta.3
or .beta.5 or treatment or preventive measures which decrease
integrin level or activity); and xiv) any combinations of vii) to
xiii). In addition to the above, non-limiting treatments or
preventive measures include: exercises (physiotherapy), orthodontic
treatment, and administration of other natural substances
increasing or reducing OPN, CD44 and HA levels. Once a subject is
classified into a specific functional group, his/her OPN levels are
preferably monitored periodically. When a new treatment or
preventive measure is prescribed OPN levels should be monitored in
order to maintain the optimal level of OPN (e.g., below or above
the OPN retroinhibition/retroactivation concentrations) for this
subject and detect any variation that could potentially accelerate
the development of IS (including curve progression).
[0081] Accordingly, the above treatment or prevention method may
further be improved by measuring the level of circulating OPN in
the subject and determining whether the subject has a high or low
level of circulating OPN. Determination of the level of circulating
OPN (and of its variation with time) enables to more appropriately
select the best treatment option and follow-up schedule. FIG. 1
summarizes treatment options in view of the functional status of
the subject and his/her level of circulating OPN.
[0082] For example, an FG1 subject could be prescribed OPN or an
OPN agonist. For FG1 subjects, brace treatment should generally be
avoided. However, FG1 subjects having low levels of circulating OPN
could under specific circumstances be prescribed brace treatment
for a short period of time (e.g., about 6 months or until OPN
concentration has been sufficiently increased i.e., at or near the
retroinhibition concentration) so as to maintain his/her level of
OPN high. Brace treatment could be stopped completely or
temporarily when the maximal concentration of OPN is reached (i.e.,
near (but below) the retroinhibition concentration for a given
patient e.g., for example between about 600 ng/ml and 1200 ng/ml,
preferably between about 600 ng/ml and 1000 ng/ml. Generally, for
FG1 subjects, preventive and treatment measures should aim at
maintaining their level of OPN as high as possible.
[0083] For FG1 subjects already having high levels of OPN (i.e.,
close to the maximal OPN concentration where retroinhibition is
induced), brace treatment should be avoided. If brace treatment is
nevertheless prescribed, OPN levels and curve progression should be
monitored closely so as to make sure that OPN levels do not drop
significantly and that the rate or curve progression is not
increased. OPN or an OPN agonist could also be prescribed to
maintain OPN concentration high (as OPN has a protective effect in
FG1 subjects as indicated above).
[0084] In general, any treatment or preventive measure which will
help maintaining the level or activity of OPN as high as possible
is desirable for FG1 subjects. In an embodiment, massages which
increase OPN's level can be performed on a regular basis. For
example, in U.S. Ser. No. 13/822,962 Applicants show that the local
application of pressure (e.g., pulsative compressive pressure) on
at least one body part of the subject (e.g., arm or leg) for 15-90
minutes increases circulating OPN blood level. Hence, such
treatment could be applied to the subject periodically (e.g., every
day, every two days, every 3 days, twice a week, once a week or
once every two weeks) to increase or maintain the level of
circulating OPN. Furthermore, as disclosed herein, HA increases
(i.e., compensate in part) the Gi-mediated signaling defect present
in FG1 subjects. Without being bound to any particular theory, HA
could act by increasing OPN's bioavailability by competing with OPN
for binding to CD44 (and thus act as an OPN agonist). By doing so,
more OPN could be available for increasing the Gi-mediated cellular
response.
[0085] Accordingly, one way of increasing the level or desired
activity of OPN is by increasing the amount of Hyaluronic Acid (HA)
in subjects. This can be done for example by taking HA supplements
or by increasing HA intake or HA synthesis by favoring certain
food. Non-limiting examples of food with high HA content or which
stimulates/support HA production include, meat and meat organs
(e.g., veal, lamb, beef and gizzards, livers, hearts and kidneys),
fish, poultry (including meat fish and poultry broths), soy
(including soy milk), root vegetables containing starch including
potatoes and sweet potatoes, satoimo (Japanese sweet potato), imoji
(Japanese sweet potato), Konyaku concoction (root vegetable
concoction. Fruits and vegetables rich in vitamin C, magnesium or
zinc are also useful as they support the synthesis of HA by the
body. Non-limiting examples of food rich in vitamin C include
lemons, oranges, limes, grapefruit, guava, mango, cherries, kiwi,
blueberries, raspberries, all varieties of grapes, parsley and
thyme. Fruits and vegetables rich in magnesium include apples,
bananas, tomatoes, avocados, pineapples, melons, peaches, pears,
spinach, cauliflower, broccoli, asparagus, green lettuce, Brussels
sprouts and green beans. Non-limiting examples of food rich in zinc
include pumpkins, yeast, peanuts, whole grains, beans, and brown
rice.
[0086] Other possible treatments of preventive measures include the
administration of agents which increase OPN expression or secretion
(e.g., angiotensin, tumour necrosis factor .alpha. (TNF.alpha.),
infterleukin-1.beta. (IL-1.beta.)), angiotensin II, transforming
growth factor .beta. (TGF.beta.) and parathyroid hormone (PTH)),
low intensity pulsed ultrasounds (LIPUS), and treatment and
preventive measure which decrease CD44 expression or binding to OPN
(e.g., an antibody or siRNA specific for CD44/sCD44). Also, FG1
subjects should avoid diets rich in selenium since selenium is a
powerful inhibitor of OPN or any other nutraceutical that decreases
OPN level.
[0087] As indicated above, as opposed to the FG1 group, FG2 and FG3
subjects are particularly sensitive to OPN. High OPN levels in
these subjects increase the risk of scoliosis development and
progression. Generally, for FG2 and FG3 subjects, preventive and
treatment measures should aim at maintaining their level of OPN as
low as possible, especially since these subjects are sensitive to
OPN (especially FG2 subjects, which are the most sensitive to OPN
i.e. hypersensitive). Accordingly, any treatment or preventive
measure which will help decreasing or maintaining the level or
activity of OPN as low as possible is desirable for FG2 and FG3
subjects. Non-limiting examples of such treatment or preventive
measure include, accupoint heat sensitive moxibustion, heat
therapies with pad, thermal baths, electroacupuncture, which are
known to decrease OPN in serum of subjects.
[0088] For FG2 and FG3 subjects, possible treatment and preventive
measures also includes administration of an OPN antagonist to
reduce OPN levels (administration of OPN antagonists (e.g.,
melatonin, selenium supplements or selenium from the diet (e.g.
Brazil nuts), the use of nutraceutical like PROTANDIM) and/or brace
treatment as it is likely to be beneficial to these subjects,
especially to FG3 subjects. In FG2 and FG3 subjects having low
levels of OPN, brace treatment could be postponed or not prescribed
at all depending on the skeletal maturity, age and sex of the
subject but if prescribed, it will be for preferably be at least
12-18 months, more preferably 24-36 months and even more preferably
for 36 months or more, or for a sufficient time to induce a
significant reduction in OPN levels. In a specific embodiment brace
treatment will last at least 12, 18, 24, 30 or 36 months.
[0089] Since HA exacerbates the effect of OPN, FG2 and FG3 subjects
should avoid taking HA supplements and preferably avoid taking food
with high HA content or which stimulates/support HA production
(e.g., comply to a HA-poor or HA-low diet). Similarly, any compound
(synthetic or natural) or activity which are known to increase the
level of OPN or HA should preferably be avoided (e.g., angiotensin,
tumour necrosis factor .alpha. (TNF.alpha.), infterleukin-1.beta.
(IL-1.beta.)), angiotensin II, transforming growth factor .beta.
(TGF.beta.) and parathyroid hormone (PTH, regular application of
compressive pressure (e.g., pulsative compressive pressure), LIPUS,
etc.).
[0090] As disclosed herein, CD44 inhibition further decreases the
Gi-mediated cellular response in FG2 and FG3 subjects. Accordingly,
FG2 and FG3 subjects could also be treated with soluble CD44 or any
compound which will increase its level. Furthermore, as the effect
of OPN on the Gi-mediated response is dependent on the binding of
OPN to integrins (e.g., .alpha.5.beta.1), molecules that
specifically block the binding of OPN to integrins are also
considered useful. For example, one known molecule that
specifically blocks the binding of OPN to integrin (e.g.,
.alpha..sub.5.beta..sub.1) is a RGD peptide or derivative thereof.
Other useful molecules include a peptide fragment of OPN comprising
a RGD motif (e.g., GRGDSVVYGLRS (SEQ ID NO: 13); an siRNA specific
for an integrin (e.g., .alpha..sub.5, .beta..sub.3 or .beta..sub.5)
or an antibody against an integrin (e.g., .alpha..sub.5,
.beta..sub.3 and/or .beta..sub.5 and/or Volociximab.TM.;
Etaratuzumab.TM., Etaracizzumab.TM. Vitaxin.TM., MEDI-522 or
CNT095).
[0091] Preferably, the level of OPN in the subject should be
monitored periodically (e.g., every 6 months, every 5 months, every
4 months, preferably every 2 or 3 months, even more preferably
every month) prior to and during any form of treatment or
preventive measures and the frequency of OPN level monitoring
increased when the level approaches retroinhibition concentration
(e.g., 580-1000 ng/ml of OPN) in order to adapt treatment. For
Example, for FG1 subjects having low levels of OPN, brace treatment
could be performed, stopped when the level of OPN approaches
retroinhibition concentration and restarted later (e.g., 6-18
months later) so as to induce another surge in OPN level. This
cycle could be repeated as necessary.
[0092] The present invention also provides a method of predicting
the risk of developing IS in a subject comprising: a) classifying
the subject into functional group FG1, FG2 or FG3; and b)
determining the level of circulating OPN in a blood sample from the
subject, wherein when the subject is classified into the FG1
functional group and the level of circulating OPN in the blood
sample of the subject is low, the subject has an increased risk of
curve progression (as compared to FG1 subjects having high
circulating level of OPN); and wherein when the subject is
classified into the FG2 or FG3 functional group and the level of
circulating OPN in the blood sample of the subject is high, the
subject has an increased risk of curve progression (as compared to
FG2 or FG3 subjects having low circulating level of OPN).
[0093] The present invention also provides kits for predicting the
risk of developing scoliosis, for predicting brace treatment
outcome and for selecting the best treatment or preventive
measures. Such kits may comprise one or more reagents for
classifying subjects into functional group FG1, FG2, or FG3 such as
(a) one or more ligands (e.g., agonists) for stimulating GiPCRs;
(b) ligands (e.g., antibodies) for detecting Gi.alpha. proteins
(Gi.alpha.1, Gi.alpha.2 and Gi.alpha.3) and their phosphorylation
pattern (e.g., antibodies for detecting serine phosphorylation);
and/or (c) reagents for determining cellular proliferation; and
optionally (d) (i) one or more ligands for stimulating GsPCRs
(e.g., agonists) and (ii) instructions for using the kit. The kit
may further comprise reagents for determining the level of
circulating OPN in a blood sample such as primary antibodies
(labeled or not) against OPN and optionally secondary antibodies to
detect the binding of primary antibodies.
Definitions
[0094] For clarity, definitions of the following terms in the
context of the present invention are provided.
[0095] Methods of classifying subjects into a functional group
(FG1, FG2 or FG3) according to the degree of their imbalance in
Gi-mediated cellular signaling are known in the art and have been
described previously (see for example, Moreau at al. (2004), Akoume
et al., (2010), Akoume et al., (2013), Azeddine et al., 2007;
Letellier et al., 2008; WO2003/073102, WO2010/040234, International
Publication No. WO2014/201557, and International Publication No.
WO2015/032005 to Moreau, which are incorporated herein by reference
in their entirety). Hence, in accordance with the present
invention, any method or combination of methods of classifying a
subject into the FG1, FG2 or FG3 group can be used. Non-limiting
examples of classifying subjects following Gi-stimulation include
i) detection of changes in cAMP concentration (Moreau et al.,
2004), ii) change in cellular impedance (e.g., by cellular
dielectric spectroscopy (CDS), Akoume et al., 2010 and Akoume et
al., 2013b), detection of Gi phosphorylation pattern (Akoume et al.
2013), and cellular proliferation rate (WO03073102 and co-pending
U.S. application No. 61/875,162). Classification may also be
effected by determining the degree of imbalance between Gi and Gs
as described in Akoume et al., 2013; Akoume et al., 2013b; and
International Publication No. WO2015/032005).
[0096] As used herein, the terms "brace treatment outcome" refers
to a genetic or metabolic predisposition of a subject to benefit or
not from brace treatment. Non-limiting examples of brace treatment
outcome includes: i) a final Cobb angle .ltoreq. to 45.degree.; ii)
a final Cobb angle .gtoreq. to 45 (severe scoliosis); iii) curve
progression; iv) absence of curve progression; and v) need for
surgery or any other benefit that may be measured following brace
treatment. A curve progression is defined as a progression of
Cobb's angle .gtoreq. to 6.degree..
[0097] A "successful brace treatment" or "brace treatment success"
is a brace treatment following which the Cobb's angle is .ltoreq.
to 45.degree. or no surgery is required.
[0098] As used herein, the term "benefit" in for example, "benefit
from brace treatment" means that brace treatment has a positive
effect on the prevention and/or treatment of IS. For example, a
"benefit" of brace treatment can be one or more of: i) a reduction
in the speed of curve progression; ii) a complete prevention of
curve progression (i.e., a curve progression .ltoreq.6.degree.);
ii) a reduction of Cobb's angle in a preexisting spinal deformity;
iii) improvement of column mobility; iv) preservation/maintenance
of column mobility; v) improvement of equilibrium and balance in a
specific plan; vi) maintenance/preservation of equilibrium and
balance in a specific plan; vii) improvement of functionality in a
specific plan; viii) preservation/maintenance of functionality in a
specific plan; ix) cosmetic improvement; x) avoidance of corrective
surgery; and xi) combination of at least two of any of i) to
x).
[0099] As used herein, the term "likely" in for example, "likely to
have a successful brace treatment" refers to an increased chance of
having a Cobb's angle .ltoreq. to 45.degree. or of not requiring
surgery as compared to IS subjects in general, following brace
treatment. In an embodiment, the increased chance of having
successful brace treatment refers to a 50% chance or more (e.g.,
60%, 65%, 70%, 75%, 80%, 85% . . . etc.) of having a Cobb's angle
.ltoreq. to 45.degree. or of not requiring surgery following brace
treatment. Similarly, the term "unlikely" (or less likely) in for
example "unlikely to have a successful brace treatment" refers to a
decreased chance of having a Cobb's angle .ltoreq. to 45.degree. or
of not requiring surgery as compared to IS subjects in general,
following brace treatment. In an embodiment, the decreased chance
of having successful brace treatment refers to less than 50% chance
(e.g., 49%, 45% 40%, 35%, 30%, 25%, 20% . . . etc.) of having a
Cobb's angle .ltoreq. to 45.degree. or of not requiring surgery
following brace treatment.
[0100] As used herein the term "subject" is meant to refer to any
mammal including human, mouse, rat, dog, chicken, cat, pig, monkey,
horse, etc. In a particular embodiment, it refers to a human. In a
specific embodiment, the subject is a pediatric subject. In an
embodiment, the subject is skeletally immature.
[0101] As used herein, the terms "subject in need thereof" refer to
a subject already diagnosed with IS or at risk of developing IS
(i.e., a likely candidate for developing scoliosis). In an
embodiment, the subject in need thereof is a subject already
diagnosed with idiopathic scoliosis. In an embodiment, the subject
in need thereof is an asymptomatic subject having at least one
family member having been diagnosed with idiopathic scoliosis. In
an embodiment, the subject in need thereof is a pediatric
subject.
[0102] In an embodiment, the above-mentioned subject is a likely
candidate for developing a scoliosis, such as idiopathic scoliosis
(e.g., Infantile Idiopathic Scoliosis, Juvenile Idiopathic
Scoliosis or Adolescent Idiopathic Scoliosis (AIS)). As used herein
the terms "likely candidate for developing scoliosis" include
subjects (e.g., children) of which at least one parent has a
scoliosis (e.g., adolescent idiopathic scoliosis). Among other
factors, age (adolescence), gender and other family antecedent are
factors that are known to contribute to the risk of developing a
scoliosis and are used to a certain degree to assess the risk of
developing a scoliosis. In certain subjects, scoliosis develops
rapidly over a short period of time to the point of requiring a
corrective surgery (often when the deformity reaches a Cobb's angle
.gtoreq.50.degree.). Current courses of action available from the
moment a scoliosis such as AIS is diagnosed (when scoliosis is
apparent) include observation (when Cobb's angle is around
10-25.degree.), orthopedic devices (when Cobb's angle is around
25-30.degree.), and surgery (over 45.degree.). A more reliable
determination of the risk of progression could enable to 1) select
an appropriate diet to remove certain food products identified as
contributors to scoliosis; 2) select the best therapeutic agent;
and/or 3) select the least invasive available treatment such as
postural exercises, orthopedic device, or less invasive surgeries
or surgeries without fusions (a surgery that does not fuse vertebra
and preserves column mobility). The present invention encompasses
selecting the most efficient and least invasive known preventive
actions or treatments in view of the determined risk of developing
scoliosis.
[0103] As used herein, the terms "severe scoliosis", "severe IS" or
"severe progression" is an increase of the Cobb's angle to
45.degree. or more, potentially at a younger age.
[0104] As used herein the term "treating" or "treatment" in
reference to idiopathic scoliosis (e.g., Infantile Idiopathic
scoliosis (0-2 years old at the time of onset), Juvenile Idiopathic
scoliosis (from 4 to 9 years old at the time of onset) and
Adolescent Idiopathic scoliosis (from 10 to 17 years old at the
time of onset) is meant to refer to e.g., at least one of a
reduction of Cobb's angle in a preexisting spinal deformity,
improvement of column mobility, preservation/maintenance of column
mobility, improvement of equilibrium and balance in a specific
plan; maintenance/preservation of equilibrium and balance in a
specific plan; improvement of functionality in a specific plan,
preservation/maintenance of functionality in a specific plan,
cosmetic improvement, and combination of at least two of any of the
above.
[0105] As used herein the term "preventing" or "prevention" in
reference to scoliosis is meant to refer to a at least one of a
reduction in the progression of a Cobb's angle in a patient having
a scoliosis, a reduction in the speed of curve progression; or, in
an asymptomatic patient, a complete prevention of apparition of a
spinal deformity, including changes affecting the rib cage and
pelvis in 3D, or a combination of any of the above.
[0106] As used herein the terms "at risk of developing a scoliosis"
or "at risk of developing IS" refer to a genetic or metabolic
predisposition of a subject to develop a scoliosis (i.e. spinal
deformity) and/or a more severe scoliosis at a future time (i.e.,
curve progression of the spine). For instance, an increase of the
Cobb's angle of a subject (e.g., from 40.degree. to 50.degree. or
from 18.degree. to 25.degree.) is a "development" of a scoliosis.
The terminology "a subject at risk of developing a scoliosis"
includes asymptomatic subjects which are more likely than the
general population to suffer in a future time of a scoliosis such
as subjects (e.g., children) having at least one parent, sibling or
family member suffering from a scoliosis. Among others, age
(adolescence), gender and other family antecedent are factors that
are known to contribute to the risk of developing a scoliosis and
are used to evaluate the risk of developing a scoliosis. Also
included in the terminology "a subject at risk of developing a
scoliosis" are subjects already diagnosed with IS but which are at
risk to develop a more severe scoliosis (i.e. curve
progression).
[0107] As used herein, a "low" level of OPN (e.g., Gene ID 6696,
NP_001035147.1 (SEQ ID NO: 1) and NM_001040058 (SEQ ID NO: 2)
SPP1-Gene ID: 6696, OPNa: NP_001035147.1, OPNb: NP_000573.1, OPNc:
NP_001035149.1, OPN Isoform 4: NP_001238758.1, OPN Isoform 5:
NP_001238759.1, NM_001251829.1, GI_352962173); is a level of OPN
that is lower than the average level of OPN in IS (e.g., AIS)
subjects. In an embodiment, the IS subjects are matched for age
and/or sex. In another embodiment, the IS subjects are matched to a
specific functional group (FG1, FG2 or FG3). In a specific
embodiment, a low level of OPN is a level of OPN<than about 600
ng/ml, 580 ng/ml; 575 ng/ml, 560 ng/ml, 550 ng/ml, 520 ng/ml, 500
ng/ml, 450 ng ml, 400 ng/ml or 300 ng/ml. In specific embodiment, a
low level of OPN is a level of OPN<600 ng/ml in a blood sample
from the subject. In another specific embodiment, a low level of
OPN is a level of OPN.ltoreq.500 ng/ml in a blood sample from the
subject. In another specific embodiment, a low level of OPN is a
level of OPN.ltoreq.250 ng/ml in a blood sample from the subject.
In another specific embodiment, a low level of OPN is a level of
OPN that is about that of healthy subjects. In a specific
embodiment, for FG2 subjects (which are hypersensitive to OPN), in
the context of the treatment method of the present invention, the
level of OPN is maintained as low as possible, preferably below 400
ng/ml, more preferably below 300 ng/ml and even more preferably
below 200 ng/ml.
[0108] As used herein, a "high" level of OPN (e.g., Gene ID 6696,
NP_001035147.1 (SEQ ID NO: 1) and NM_001040058 (SEQ ID NO: 2) is a
level of OPN that is higher than the average level of OPN in IS
(e.g., AIS) subjects. In an embodiment, the IS subjects are matched
for age and/or sex. In another embodiment, the IS subjects are
matched to a specific functional group (FG1, FG2 or FG3). In a
specific embodiment, a high level of OPN is a level of
OPN.gtoreq.than about 1200 ng/ml, 1000 ng/ml, 900, ng/ml, 850
ng/ml, 800 ng/ml, 750 ng/ml, 700 ng/ml, 550 ng/ml, 580 ng/ml, 600
ng/ml; 610 ng/ml, 620 ng/ml, 630 ng/ml, 650 ng/ml, 675 ng/ml, 700
ng/ml or 750 ng/ml. In a specific embodiment, a high level of OPN
is a level of OPN between about 650-1000 ng/ml in a blood sample
from the subject. In another specific embodiment, a high level of
OPN is a level of OPN.gtoreq.600 ng/ml in a blood sample from the
subject. In another embodiment, a high level of OPN is a level of
OPN that is close to but below the retroinhibition concentration
(e.g., 80%, 85%, 90%, 95% of the retroinhibition concentration). In
another specific embodiment, for FG1 subjects, in the context of
the treatment method of the present invention, the level of OPN is
maintained as high as possible, preferably above 500 ng/ml, above
800 ng/ml or above 900 ng/ml and even more preferably above 1000
ng/ml or above 1200 ng/ml.
[0109] As used herein, the term "retroinhibition concentration"
refers to the in vivo concentration at which OPN level reaches its
maximum and the retroinhibition mechanism is induced so as to
decrease the level of circulating OPN in the blood
endogenously.
[0110] As used herein, the term "retroactivation concentration"
refers to the in vivo concentration at which OPN level reaches its
minimum and the retroactiviation mechanism is induced so as to
increase the level of circulating OPN in the blood endogenously. In
a specific embodiment, it refers the concentrations of OPN at which
brace treatment first induces an increase in OPN level. In an
embodiment, the retroactivation concentration is 600 ng/ml or less,
preferably 500 ng/ml or less and even more preferably, 400 ng/ml or
less.
[0111] As used herein the terms "follow-up schedule" is meant to
refer to future medical visits a subject diagnosed with a scoliosis
or at risk of developing a scoliosis is prescribed once the
diagnosis or risk evaluation is made. For example, when a subject
is identified as belonging to the FG1 functional group and as
having a low level of OPN (and the subject is prescribed OPN, an
OPN agonist or treatment and preventive measures which increase OPN
levels), the number of medical visits are increased to make sure
that OPN levels are stable, preferably increase and remain as high
as possible. In addition, in the rare case where an FG1 subject is
prescribed a brace treatment, the number of medical visits is
increased to make sure that brace treatment lasts for an optimal
time and the level of OPN does not decrease. For example, OPN
levels could be monitored every 2 months, preferably every month
and the treatment adjusted in view of the detected OPN level. For
example, when OPN level reached or approached retroinhibition
concentration treatment would be stopped completely or temporarily
until OPN level decrease sufficiently and the treatment could be
started again. In addition, or alternatively, curve progression
could be monitored and the treatment maintained until curve
progression is detected. Another limiting example include when a
subject being at risk of developing a severe scoliosis or at risk
of rapid curve progression (e.g., a subject classified as belonging
to the FG2 functional group and having a high level or circulating
OPN), the number of medical visits (e.g., to the orthopedist) is
increased, the frequency of OPN monitoring is increased and/or the
number of x-rays in a given period (e.g., 1, 2, 3, 6 or 12 months)
is increased. On the other hand, when a subject is identified as
having a lower risk of curve progression or rapid curve progression
(e.g., subject being classified as belonging to the FG1 functional
group and having high levels of OPN) the number of medical visits,
OPN level monitoring or x-rays may be decreased to less than the
average (e.g., less than 22 x-rays over a 3 year period or less
than 1 visit every month, every 3 months, 6 months or 12 months).
The follow-up schedule and OPN monitoring frequency is adapted in
view of several factor including sex, age, Cobb's angle, skeletal
maturity (Risser of 5), menarche, functional classification (FG1,
FG2 or FG3) and OPN level.
[0112] As used herein, the term "brace treatment" refers to the use
of a brace for reducing (i.e. slowing or stopping) curve
progression of the scoliosis or for improving scoliosis (i.e.,
reversing completely or partially the scoliosis, e.g., a reduction
of a Cobb's angle from 30 to 24.degree.). There are a number of
bracing options known in the art. Non-limiting examples of braces
used in the treatment of scoliosis include the
Thrombo-Lumbar-Sacral Orthosis (TLSO) brace, the Milwaukee brace,
the Charleston brace and the SpineCor.TM. brace. Other examples
include, the Dynamic scoliosis orthosis brace (DSO) (U.S. Pat. No.
7,967,767); scoliosis braces with angle adjustment (U.S. Pat. No.
8,066,653) and braces with adjustable inflatable air bags
(US2009/0275871). The physician will recommend a particular back
brace and bracing schedule based on factors such as the location of
the curve, degree of curvature (Cobb's angle), age, growth status
of the IS subject (e.g., pre or post menarche, and skeletal
maturity (Risser of 5), endophenotype (IS functional group) and
lifestyle (e.g., for subjects involved in sports, a more flexible
brace (e.g., SpineCor.TM. or Charleston may be favored). Moreover,
a combination of braces may also be prescribed (e.g., a TLSO brace
for day time and a Charleston brace for night time).
[0113] The most common form of TLSO brace is called the "Boston
brace", and it may be referred to as an "underarm" brace. This
brace is fitted to the child's body and custom molded from plastic.
It works by applying three-point pressure to the curvature to
prevent its progression. The TLSO brace is usually worn 23
hours/day, and it can be taken off to swim, play sports or
participate in gym class during the day. This type of brace is
usually prescribed for curves in the lumbar or thoraco-lumbar part
of the spine.
[0114] The Cervico-Thoraco-Lumbo-Scacral-Orthosis brace (Milwaukee
brace) is similar to the TLSO described above, but also includes a
neck ring held in place by vertical bars attached to the body of
the brace. It is usually worn 23 hours a day, and can be taken off
to swim, play sports or participate in gym class during the day.
This type of brace is often prescribed for curves in the Thoracic
spine.
[0115] The Charleston brace, also called nighttime brace is a back
brace which is molded to the patient while they are bent to the
side, and thus applies more pressure and bends the child against
the curve. This pressure improves the corrective action of the
brace. This type of brace is worn only at night while the child is
asleep. Curves must be in the 20- to 40-degree range and the apex
of the curve needs to be below the level of the shoulder blade for
the Charleston brace to be effective.
[0116] In accordance with the present invention, the skilled
practitioner (e.g., the treating physician) can select the most
appropriate treatment regimen based on the subject's
classification. The particular choice of treatment or combination
of treatment will be adapted based on the subject's classification
and optionally based on his/her level of circulating OPN. For
example, brace treatment may be delayed, shortened/lengthened, the
choice of a particular brace or braces adapted (in view of age,
sex, and Cobb's angle) and the time at which surgery is performed
(if needed) modified in view of the subject's classification and
optionally, circulating OPN level.
[0117] In the context of treating FG1 subjects with a brace, a
"short" brace treatment or "short term" brace treatment includes
brace treatment for 18 months or less, preferably 12 months or less
and more preferably, 6 months or less (e.g., 1, 2, 3, 4, 5 or 6
months). Preferably, if brace treatment is prescribed for FG1
subjects, the brace treatment may be continued until the OPN
concentration reaches its maximal concentration or close to its
maximal concentration (retroinhibition concentration). In an
embodiment, brace treatment will be continued until OPN
concentration starts declining in the subject. In a specific
embodiment, brace treatment is continued until OPN concentration
reaches 700, 800, 1000, 1100 or 1200 or more ng/ml.
[0118] In the context of treating FG2 and FG3 subjects with a
brace, a "long" brace treatment or "long-term" brace treatment
includes brace treatment for at least 18 months (e.g., 18, 19, 20,
21, 22, 23 months), preferably at least 24 months (e.g., 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35 months) and more preferably,
at least 36 months. Preferably, for FG2 and FG3 subjects brace
treatment will be continued until OPN concentration is
significantly reduced or until skeletal maturity is reached. In a
specific embodiment, brace treatment is maintained until the OPN
concentration reaches its minimum or until the OPN concentration
begins increasing. In a specific embodiment, brace treatment is
maintained up to two years after menarche in a female subject. In a
particular embodiment, brace treatment is maintained until the
concentration of OPN reaches less than 600 ng/ml, preferably less
than 500 ng/ml or until the OPN concentration reaches its minimum
or starts increasing. In a particular embodiment for FG3 subjects,
brace treatment is maintained until the concentration of OPN
reaches less than 600 ng/ml, preferably less than 500 ng/ml. In
another particular embodiment, for FG2 subjects brace treatment is
maintained until the concentration of OPN reaches less than 400
ng/ml, preferably less than 300 ng/ml more preferably less than 200
ng/ml (due to their hypersensitivity toward OPN).
[0119] The terms "activator" or "agonist" are well known in the art
and are used herein interchangeably. Similarly, the terms
"suppressor", "inhibitor" and "antagonist" are well known in the
art and are used herein interchangeably
[0120] As used herein, the expression "OPN agonist" or "OPN
activator" is used to refer to any compound capable to increase, at
least partially, the level and/or desired biological activity of
OPN (e.g., Gene ID 6696, NP_001035147.1 (SEQ ID NO: 1) and
NM_001040058 (SEQ ID NO: 2) SPP1-Gene ID: 6696, OPNa:
NP_001035147.1, OPNb: NP_000573.1, OPNc: NP_001035149.1, OPN
Isoform 4: NP_001238758.1, OPN Isoform 5: NP_001238759.1,
NM_001251829.1, GI_352962173). Without being so limited it includes
OPN functional fragment or derivative thereof and activators of OPN
expression such as (but not limited to) transcriptional and
translational activators of the OPN gene (e.g., tumour necrosis
factor .alpha. (TNF.alpha.), infterleukin-1.beta. (IL-1.beta.)),
angiotensin II (Ang II), transforming growth factor .beta.
(TGF.beta.) and parathyroid hormone (PTH)). Activator of OPN
activity includes compounds that are able to bind to OPN receptors
in order to increase the desired biological activity of OPN,
peptidomimetics, OPN fragments and the like. In a specific
embodiment, the OPN biological activity is an increase in
Gi-mediated cellular response in FG1 subjects and the OPN activator
or agonist is HA.
[0121] As used herein, the term "functional fragment" of OPN refers
to a molecule (e.g., polypeptide) which retains substantially the
same desired activity as the original molecule but which differs by
any modifications, and/or amino acid/nucleotide substitutions,
deletions or additions (e.g., fusion with another polypeptide).
Modifications can occur anywhere including the
polypeptide/polynucleotide backbone (e.g., the amino acid sequence,
the amino acid side chains and the amino or carboxy termini). Such
substitutions, deletions or additions may involve one or more amino
acids or in the case of polynucleotide, one or more nucleotide. The
substitutions are preferably conservative, i.e., an amino acid is
replaced by another amino acid having similar physico-chemical
properties (size, hydrophobicity, charge/polarity, etc.) as well
known by those of ordinary skill in the art. Functional fragments
of OPN (SEQ ID NO: 1) include a fragment or a portion of OPN
polypeptide or a fragment or a portion of a homologue or allelic
variant of OPN which retains activity, i.e., binds to integrins
(e.g., .alpha.5.beta.1) and/or CD44. In an embodiment, the OPN
functional fragment is at least 80, 85, 88, 90, 95, 98 or 99%
identical to the polypeptide sequence of (SEQ ID NO: 1). In an
embodiment, the OPN functional fragment is a functional variant
which includes variations in amino acids which are not conserved
between rat, mouse and human OPN. Preferably, the OPN functional
fragment is human. A "functional derivative" refers to a molecule
derived from the OPN polypeptide or polynucleotide and which is
substantially similar in structure and biological activity to the
OPN protein or nucleic acid of the present invention. An OPN
polypeptide derivative may for example include modifications to
increase its bioavailability, its stability, to simplify its
purification or to preferentially target the OPN derivative to a
particular tissue or cell.
[0122] As used herein, the expression "OPN antagonist" or "OPN
inhibitor" is used to refer to any compound capable to block
completely or partially (i.e., negatively affect) the expression
(at the transcriptional (mRNA) and/or translational (protein))
level or targeted biological activity of OPN (e.g., binding to one
or more of its integrin receptors) in cells. In an embodiment, the
biological activity of OPN in cells is a reduction in GiPCR
signaling. OPN inhibitors include intracellular as well as
extracellular suppressors. Without being so limited, such
suppressors include RNA interference agents (siRNA, shRNA, miRNA),
antisense molecules, ribozymes, proteins (e.g., dominant negative,
inactive variants), peptides, small molecules, antibodies, antibody
fragments, etc. In an embodiment, the OPN antagonist is a
neutralizing antibody against human OPN. In an embodiment, the OPN
antagonist is melatonin. In an embodiment, the OPN antagonist is
selenium. In an embodiment, the OPN antagonist is PROTANDIM.TM.. In
an embodiment, the OPN antagonist is soluble CD44 (sCD44) or a
stimulator or enhancer of sCD44/CD44 expression.
[0123] As used herein, the expression "integrin antagonist" or
"integrin inhibitor" is used to refer to any compound capable to
block completely or partially (i.e., negatively affect) the
expression (at the transcriptional (mRNA) and/or translational
(protein)) level or targeted biological activity of integrins
(e.g., binding to OPN) in cells. In an embodiment, the biological
activity of integrins in cells is a reduction in GiPCR signaling.
INtegrin inhibitors include intracellular as well as extracellular
suppressors. Without being so limited, such suppressors include RNA
interference agents (siRNA, shRNA, miRNA), antisense molecules,
ribozymes, proteins (e.g., dominant negative, inactive variants),
peptides, small molecules, antibodies, antibody fragments, etc. In
an embodiment, the integrin antagonist is a neutralizing antibody
against human integrin (Volociximab.TM.; Etaratuzumab.TM.,
Etaracizzumab.TM., Vitaxin.TM., MEDI-522, CNT095,
Cilengitide.TM.).
[0124] The terms "inhibitor of OPN expression" or "inhibitor of
integrin expression" (e.g., .alpha..sub.5, .beta..sub.3 and/or
.beta..sub.5) expression" include any compound able to negatively
affect OPN's or integrin's (e.g., .alpha..sub.5's, .beta..sub.3's
and/or .beta..sub.5's) expression (i.e., at the transcriptional
and/or translational level), i.e. the level of OPN/integrin mRNA
and/or protein or the stability of the protein. Without being so
limited, such inhibitors include agents which negatively affect the
expression of OPN (e.g., vitamin D, melatonin, selenium,
PROTANDIM.TM.) or integrin, RNA interference agents (siRNA, shRNA,
miRNA), antisense molecules, and ribozymes. Such RNA interference
agents are design to specifically hybridize with their target
nucleic acid under suitable conditions and are thus substantially
complementary their target nucleic acid.
[0125] The terms "inhibitor of OPN activity" or "inhibitor of
integrin activity" (e.g., (e.g., .alpha..sub.5, .beta..sub.1,
.beta..sub.3 and/or .beta..sub.5) refers to any molecules that is
able to reduce or block the effect of OPN or integrins (e.g.,
.alpha..sub.5.beta..sub.1) on Gi-mediated signaling. These
molecules increase GiPCR signaling in cells (i.e., in FG2 and FG3
subjects) by blocking/reducing totally or partially the inhibitory
effect induced by OPN and/or integrins activity. Non-limiting
examples of inhibitors of OPN's activity include proteins (e.g.,
dominant negative, inactive variants), peptides, small molecules,
anti-OPN antibodies (neutralizing antibodies), antibody fragments,
inactive fragments of .alpha.5 and/or .beta.1 integrins etc.
Non-limiting examples of inhibitors of integrin (e.g.,
.alpha.5.beta.1) activity include proteins (e.g., dominant
negative, inactive variants), peptides (RGD peptides or RGD
peptide-derivatives), small molecules, anti .alpha..sub.5 and/or
.beta..sub.1 antibodies (e.g., neutralizing antibodies such as
Volociximab.TM. M200, Etaratuzumab.TM., Etaracizzumab.TM.,
Vitaxin.TM., MEDI-522, CNT095, Cilengitide.TM.), antibody
fragments, etc. In an embodiment, the RGD peptide is a peptide
fragment of OPN comprising a RGD motif comprising the amino acid
sequence GRGDSVVYGLRS corresponding to amino acid 158 to 169 of OPN
(SEQ ID NO: 1). In an embodiment, the OPN fragment comprising the
RGD motif comprises amino acids 158 to 162, 158 to 165, 158 to 167,
158 to 170, 158 to 175, 158 to 180, 158 to 185, 158 to 190, 158 to
195, or 158 to 200 of OPN (e.g., SEQ ID NO: 1). In an embodiment,
peptide fragment of OPN comprising a RGD motif comprises amino
acids 158 to 161, 156 to 161, 154 to 161, 152 to 162, 150 to 162,
148 to 162, 146 to 162, 144 to 162, 140 to 162, 159 to 163, 159 to
164, 159 to 162, 159 to 166, 159 to 167, or 159 to 169 of OPN
(e.g., SEQ ID NO: 1).
[0126] In an embodiment, the "inhibitor of OPN's activity" is a
neutralizing antibody directed against (or specifically binding to)
a human OPN polypeptide which inhibits its binding to integrins
such as .alpha..sub.5.beta..sub.1 (i.e, binding to .alpha..sub.5
and/or .beta..sub.1 integrin) In an embodiment, the "inhibitor of
integrin activity" is a neutralizing antibody directed against (or
specifically binding to) a human integrin (.alpha..sub.5,
.beta..sub.3 and/o .beta..sub.5) polypeptide which inhibits the
binding of OPN to integrins (i.e, binding to .alpha..sub.5
.beta..sub.3 and/o .beta..sub.5 integrin). In an embodiment, the
antibody binds to the RGD domain of OPN. In an embodiment, the
antibody is directed against amino acids 159 to 162, 158 to 162,
158 to 165, 158 to 167, 158 to 170, 158 to 175, 158 to 180, 158 to
185, 158 to 190, 158 to 195, or 158 to 200 of OPN (e.g., SEQ ID NO:
1). In an embodiment, the antibody is directed against amino acids
158 to 161, 156 to 161, 154 to 161, 152 to 162, 150 to 162, 148 to
162, 146 to 162, 144 to 162, 140 to 162, 159 to 163, 159 to 164,
159 to 162, 159 to 166, 159 to 167, or 159 to 169 of OPN (e.g., SEQ
ID NO: 1).
[0127] Similarly, the terms "inhibitor of integrin's activity",
"inhibitor of .alpha..sub.5.beta..sub.1's activity", "inhibitor of
.alpha..sub.5's activity" or "inhibitor of .beta..sub.1's
activity", "inhibitor of .beta..sub.3's activity", "inhibitor of
.beta..sub.5's activity" and the like include any compound able to
negatively affect the expression and/or activity of .alpha..sub.5
(e.g., Gene ID 3678, NP_002196.2 (SEQ ID NO: 5) and NM.sub.--
002205.2 (SEQ ID NO: 6)), .beta..sub.1 (Gene ID 3688, NP_002202.2
(SEQ ID NO: 7) and NM_002211.3 (SEQ ID NO: 8)), .beta..sub.3 (Gene
ID 3690, NP_000203.2 (SEQ ID NO: 9) and NM_000212 (SEQ ID NO: 10)
and/or .beta..sub.5 (Gene ID 3693, NP_002204.2 (SEQ ID NO: 11) and
NM_002213.3 (SEQ ID NO: 12)) in cells. In a particular embodiment,
the "activity" of .alpha..sub.5 and/or .beta..sub.1 in cells is the
transduction of the signal leading to the OPN-dependent inhibition
of GiPCR signaling. In a particular embodiment, the inhibitor is
Volociximab.TM. M200, Etaratuzumab.TM., Etaracizzumab.TM.,
Vitaxin.TM., MEDI-522, CNT095 or Cilengitide.TM..
[0128] The term "inhibitor" of sCD44/CD44 expression (e.g., Gene ID
960, NP_000601.3, (SEQ ID NO: 3), NM_000610 (SEQ ID NO: 4)) refers
to an agent able to decrease the level of expression of CD44 and an
agent able to decrease CD44 secretion. In an embodiment, the
inhibitor of sCD44/CD44 is an agent able to decrease CD44 binding
with OPN. Without being so limited, the agent can be a protein
(e.g., an antibody specific to CD44), a peptide, a small molecule
or a nucleotide. Inhibitors of sCD44 or CD44 generally increase
OPN's bioavailability for other receptor of OPN (e.g., integrins)
and may be particularly useful for treating and preventing
scoliosis development in FG1 subjects.
[0129] The term "stimulator" or "enhancer" of sCD44/CD44 expression
(e.g., Gene ID 960, NP_000601.3, (SEQ ID NO: 3), NM_000610 (SEQ ID
NO: 4)) refers to an agent able to increase the level or expression
of CD44 and an agent able to increase CD44 secretion. In an
embodiment, the stimulator of sCD44/CD44 is an agent able to
increase CD44 affinity toward OPN. Without being so limited, the
agent can be a protein, a peptide, a small molecule or a
nucleotide. "Stimulators" or "enhancers" of sCD44/CD44 expression
generally decrease OPN's bioavailability for other receptor of OPN
(e.g., integrins) and may be particularly useful for treating and
preventing scoliosis development in FG2 and FG3 subjects.
Antibodies
[0130] In general, techniques for preparing antibodies (including
monoclonal antibodies and hybridomas) and for detecting antigens
using antibodies are well known in the art (Campbell, 2000, In
"Monoclonal Antibody Technology: The production and
characterization of Rodent and Human Hybridomas", Elsevier Science
Publisher, Amsterdam, The Netherlands) and Recombinant Monoclonal
Antibodies (Mariel Donzeau and Achim Knappik; Methods in Molecular
Biology; Volume 378, 2007, pp 15-31).
[0131] As used herein, the term "anti-OPN antibody", refers to an
antibody that specifically binds to (interacts with) OPN and
displays no substantial binding to other naturally occurring
proteins other than the ones sharing the same antigenic
determinants as OPN. Similarly, the expression "anti-CD44
antibody", "anti-.beta..sub.1 antibody" and the like
(anti-.alpha..sub.5, anti-.beta..sub.3, anti-.beta..sub.5 . . . )
refers to an antibody that specifically binds to (interacts with)
CD44 or .beta..sub.1 and displays no substantial binding to other
naturally occurring proteins other than the ones sharing the same
antigenic determinants as CD44/.beta.1, The term "antibody" or
"immunoglobulin" is used in the broadest sense, and covers
monoclonal antibodies (including full length monoclonal
antibodies), polyclonal antibodies, multispecific antibodies, and
antibody fragments so long as they exhibit the desired biological
activity. Antibody fragments comprise a portion of a full-length
antibody, generally an antigen binding or variable region thereof.
Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv
fragments, diabodies, linear antibodies, single-chain antibody
molecules, single domain antibodies (e.g., from camelids), shark
NAR single domain antibodies, and multispecific antibodies formed
from antibody fragments. Antibody fragments can also refer to
binding moieties comprising CDRs or antigen binding domains
including, but not limited to, VH regions (VH, VH-VH), anticalins,
PepBodies.TM., antibody-T-cell epitope fusions (Troybodies) or
Peptibodies. Additionally, any secondary antibodies, either
monoclonal or polyclonal, directed to the first antibodies would
also be included within the scope of this invention. In an
embodiment, the antibody is a monoclonal antibody. In another
embodiment, the antibody is a humanized or CDR-grafted
antibody.
TABLE-US-00001 TABLE 1 commercially available human OPN Elisa kits.
Catalogue Company Kit name number Sensitivity IBL Hambourg Human
Osteopontin ELISA JP 171 58 3.33 ng/ml IBL America Human
Osteopontin N-Half 27258 3.90 pmol/L Assay Kit-IBL IBL-America
Human Osteopontin Assay 27158 3.33 ng/ml Kit-IBL Assay designs
Osteopontin (human) EIA Kit 900-142 0.11 ng/ml American Research
Osteopontin, human kit 17158 ? Products, Inc. R&D Systems Human
Osteopontin (OPN) DOST00 0.024 ng/mL ELISA Kit Promokine Human
Osteopontin ELISA PK-EL-KA4231 3.6 ng/ml Uscnlife Human
Osteopontin, OPN E0899h ? ELISA Kit
TABLE-US-00002 TABLE 2 Non-limiting examples of commercially
available antibodies for OPN (Human, Unconjugated) Catalogue
Company Name Number Host EMD Millipore AB10910 rabbit Boster
Immunoleader PA1431 LifeSpan BioSciences LS-C63082- mouse 100
LifeSpan BioSciences LS-B5940-50 mouse LifeSpan BioSciences
LS-C137501- mouse 100 LifeSpan BioSciences LS-C31763- rabbit 100
LifeSpan BioSciences LS-C99283- rabbit 400 LifeSpan BioSciences
LS-C9410- rabbit 100 LifeSpan BioSciences LS-C122259- rabbit 20
LifeSpan BioSciences LS-C88774- rabbit 0.1 LifeSpan BioSciences
LS-C136850- rabbit 100 LifeSpan BioSciences LS-C96393- rabbit 500
LifeSpan BioSciences LS-C193595- mouse 200 LifeSpan BioSciences
LS-C193596- mouse 100 LifeSpan BioSciences LS-C63081- mouse 100
LifeSpan BioSciences LS-C193597- mouse 100 LifeSpan BioSciences
LS-C169155- mouse 100 LifeSpan BioSciences LS-C189569- mouse 1000
LifeSpan BioSciences LS-C189635- mouse 1000 LifeSpan BioSciences
LS-C189636- mouse 1000 LifeSpan BioSciences LS-C189634- mouse 1000
LifeSpan BioSciences LS-C73947- mouse 500 LifeSpan BioSciences
LS-C189134- rabbit 50 LifeSpan BioSciences LS-B5272- rabbit 250
LifeSpan BioSciences LS-C176152- rabbit 100 LifeSpan BioSciences
LS-C194024- rabbit 100 LifeSpan BioSciences LS-B5626-50 rabbit
LifeSpan BioSciences LS-C131159- rabbit 20 LifeSpan BioSciences
LS-B9287- rabbit 200 LifeSpan BioSciences LS-C73949- rabbit 200
LifeSpan BioSciences LS-C182368- rabbit 50 LifeSpan BioSciences
LS-B2411-50 goat LifeSpan BioSciences LS-B8326- mouse 100 LifeSpan
BioSciences LS-B7193-50 rabbit LifeSpan BioSciences LS-B425-50
rabbit LifeSpan BioSciences LS-C9413- rabbit 100 LifeSpan
BioSciences LS-B7193-50 rabbit LifeSpan BioSciences LS-C9413-
rabbit 100 LifeSpan BioSciences LS-B9080- rabbit 100 LifeSpan
BioSciences LS-C201116- rabbit 100 Boster Immunoleader PA1431
antibodies-online ABIN933617 mouse antibodies-online ABIN1381708
Chicken BACHEM T-4816.0400 Rabbit BACHEM T-4815.0050 Rabbit Biorbyt
orb12414 mouse Biorbyt orb128774 Rabbit Biorbyt orb12506 mouse
Biorbyt orb94522 Rabbit Biorbyt orb13123 Rabbit Biorbyt orb88187
goat Biorbyt orb94961 mouse Biorbyt orb86662 rabbit Biorbyt
orb170816 mouse Biorbyt orb175965 mouse Biorbyt orb19047 goat
Biorbyt orb43142 rabbit Biorbyt orb120032 rabbit Biorbyt orb11192
rabbit Biorbyt orb11191 rabbit antibodies-online ABIN933617 mouse
BioVision 5426-100 mouse BioVision 5422-100 mouse BioVision
5424-100 mouse BioVision 5423-100 mouse BioVision 5425-100 mouse
BioVision 5421-100 mouse Merck Millipore 04-970 mouse Merck
Millipore MAB3055 rabbit Merck Millipore AB1870 Rabbit Merck
Millipore AB10910 Rabbit GenWay Biotech, Inc. GWB-T00561 mouse
GenWay Biotech, Inc. GWB-T00557 mouse GenWay Biotech, Inc.
GWB-T00558 mouse GenWay Biotech, Inc. GWB-T00559 mouse GenWay
Biotech, Inc. GWB-T00560 mouse GenWay Biotech, Inc. GWB- goat
3A2E99 GenWay Biotech, Inc. GWB- rabbit 23C38D GenWay Biotech, Inc.
GWB-295359 Rabbit GenWay Biotech, Inc. GWB-806785 Goat Enzo Life
Sciences, ADI-905-629- mouse Inc. 100 Enzo Life Sciences,
ADI-905-630- mouse Inc. 100 Enzo Life Sciences, ADI-905-500-1
Rabbit Inc. Enzo Life Sciences, ALX-210- Rabbit Inc. 309-R100
GeneTex GTX28448 Rabbit GeneTex GTX37500 rabbit GeneTex GTX15489
rabbit GeneTex GTX89519 goat Spring Bioscience E3282 rabbit Spring
Bioscience E3280 rabbit Spring Bioscience E3281 rabbit Spring
Bioscience E3284 rabbit Abbiotec 251924 rabbit Abbiotec 250801
rabbit MBL International CY-P1035 Rockland 100-401-404 Rabbit
Immunochemicals, Inc. Bioss Inc. bs-0026R Rabbit Bioss Inc.
bs-0019R Rabbit Proteintech Group Inc 22952-1-AP Rabbit
TABLE-US-00003 TABLE 4 Non-limiting examples of commercially
available ELISA Kits for integrin .alpha..sub.5 (ITGA5, Human)
Catalogue Company Name number Range Sensitivity antibodies-online
ABIN417612 0.156-10 ng/mL 0.054 ng/mL antibodies-online ABIN365741
na na DLdevelop DL-ITGa5-Hu 0.156-10 ng/mL 0.054 ng/mL
MyBioSource.- MBS814027 na na com R&D Systems DYC3230-2
312-20,000 pg/mL na Biomatik E91287Hu 0.156-10 ng/mL 0.054
ng/mL
TABLE-US-00004 TABLE 5 Non-limiting examples of commercially
available Antibodies for .alpha..sub.5 (ITGA5, human) Company Name
Catalogue Number Host Novus Biologicals NBP1-84576 rabbit Biorbyt
orb69201 mouse Abcam ab72663 rabbit Acris Antibodies GmbH BM4033
mouse Aviva Systems Biology OAAF05375 rabbit St John's Laboratory
STJ32097 mouse GeneTex GTX86915 rabbit GeneTex GTX86905 rabbit
OriGene Technologies TA311966 rabbit OriGene Technologies TA310024
rat Abbexa abx15590 rabbit Abbexa abx15591 rabbit Abbiotec 252937
mouse Abnova Corporation MAB10703 mouse Abnova Corporation MAB5267
mouse Bioss Inc. bs-0567R rabbit Cell Signaling Technology 4705S
rabbit Atlas Antibodies HPA002642 rabbit GenWay Biotech, Inc.
GWB-MX190A rabbit GenWay Biotech, Inc. GWB-D9743E mouse
antibodies-online ABIN656138 rabbit antibodies-online ABIN219716
rabbit Novus Biologicals NBP1-71421-0.1mg rabbit Novus Biologicals
NBP1-71421-0.05mg rabbit BioLegend 328009 mouse BD Biosciences
610634 mouse BioLegend 328002 mouse BD Biosciences 610634 mouse
Abcam ab72665 rabbit Abcam ab55988 rabbit Bioworld Technology
BS7053 rabbit Santa Cruz Biotechnology, Inc. sc-166665 mouse
Bioworld Technology BS7052 rabbit R&D Systems AF1864 goat
R&D Systems FAB1864A mouse Thermo Scientific Pierce MA5-15568
mouse Antibodies Thermo Scientific Pierce MA1-81134 mouse
Antibodies AbD Serotec (Bio-Rad) MCA1187 mouse AbD Serotec
(Bio-Rad) MCA1187T mouse Life Technologies 132600 mouse Proteintech
Group Inc 10569-1-AP rabbit Raybiotech, Inc. 119-14178 mouse
Creative Biomart CAB-3671MH mouse Merck Millipore CBL497 mouse
Fitzgerald Industries International 10R-1984 mouse EMD Millipore
AB1921 rabbit EMD Millipore AB1949 rabbit
TABLE-US-00005 TABLE 6 Non-limiting examples of commercially
available ELISA Kits for .beta.1 (ITGB1, human) Company Name
Catalogue number Range Sensitivity antibodies-online ABIN833710 na
na Merck Millipore ECM470 na na DLdevelop DL-ITGb1-Hu 1.56-100
ng/mL na Biomatik E91042Hu 1.56-100 ng/mL 0.64 ng/mL
TABLE-US-00006 TABLE 7 Non-limiting examples of commercially
available antibodies for .beta..sub.1 ITGB1 (Human, Unconjugated)
Company Name Catalogue number Host Abgent AM2241b mouse Biorbyt
orb86390 rabbit LifeSpan BioSciences LS-C84969-100 mouse Novus
Biologicals NB110-55545 rabbit Abbexa abx12778 rabbit Bethyl
Laboratories, A303-735A rabbit Inc. Abcam ab5189 Rabbit St John's
Laboratory STJ60344 Rabbit Cell Signaling 4706S Rabbit Technology
Bioss Inc. bs-0486R Rabbit Antigenix America MA290020 Inc. GenWay
Biotech, Inc. GWB-312F4D mouse Fitzgerald Industries 20R-2722
rabbit International GeneTex GTX50784 rabbit Thermo Scientific
MA1-80764 mouse Pierce Antibodies R&D Systems AF1778 goat
Abbiotec 251162 rabbit Bioworld Technology BS1817 rabbit Abgent
AM2241b mouse Enzo Life Sciences, BML-IG6060- mouse Inc. 0100
BIOCARE CME 386 A rabbit MEDICAL ProSci, Inc 48-392 Rabbit
eBioscience 14-0299-82 mouse
TABLE-US-00007 TABLE 8 Non-limiting Examples of commercially
available antibodies for CD44 (human and unconjugated. Catalogue
Company Number Host eBioscience 16-0441-81 Rat Novus NBP1-31121
Rabbit Thermo PA5-32327 Rabbit Gentex GTX50755 Rabbit Cell
Signaling 5640S Mouse Abcam ab103552 Rabbit Abnova H00000960-M03
Mouse antibodies-online ABIN871672 Rabbit R & D Systems AF3660
Sheep BD Biosciences 555476 Mouse Abbiotec 252831 Mouse Bethyl
Laboratories A303-872A Rabbit Proteintech Group 15675-1-AP Rabbit
Enzo Life Sciences ALX-801-089- Mouse C100 Cell Science 852.603.020
Merck Millipore 217594-100UL Rat Life Technologies 336700 Mouse
Santa Cruz sc-53503 Mouse ProSci 79-668 Rabbit MP Biomedicals
08D526000 Mouse Cedarlane CLX47AP Mouse
TABLE-US-00008 TABLE 9 Non-limiting examples of commercially
available ELISA Kits for CD44. Catalogue Company Number Cell
Sciences 850.570.192 MyBioSource.com MBS335446 Sino Biological
SEK12211 Biotrend Chemikalien BMA-27215 Antibodies online
ABIN366268 Enzo Life Sciences ALX-850-053- KI01 DRG International
EIA4876 Kamiya Biomedical KT-032 Company abcam AB45912-2 Novus
NBP1-87599 CUSABIO CSB-E11846H
[0132] Antibodies directed against OPN, CD44 and integrins
(.alpha..sub.5, .beta..sub.3, .beta..sub.5) are included within the
scope of this invention as they can be produced by well established
procedures known to those of skill in the art. Additionally, any
secondary antibodies, either monoclonal or polyclonal, directed to
the first antibodies would also be included within the scope of
this invention.
[0133] Polyclonal antibodies are preferably raised in animals by
multiple subcutaneous (sc), intravenous (iv) or intraperitoneal
(ip) injections of the relevant antigen with or without an
adjuvant. It may be useful to conjugate the relevant antigen to a
protein that is immunogenic in the species to be immunized, e.g.,
keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or
soybean trypsin inhibitor using a bifunctional or derivatizing
agent, for example, maleimidobenzoyl sulfosuccinimide ester
(conjugation through cysteine residues), N-hydroxysuccinimide
(through lysine residues), glutaraldehyde, succinic anhydride,
SOCl2, or R1N.dbd.C.dbd.NR, where R and R1 are different alkyl
groups.
[0134] Animals may be immunized against the antigen, immunogenic
conjugates, or derivatives by combining the antigen or conjugate
(e.g., 100 .mu.g for rabbits or 5 .mu.g for mice) with 3 volumes of
Freund's complete adjuvant and injecting the solution intradermally
at multiple sites. One month later the animals are boosted with the
antigen or conjugate (e.g., with 1/5 to 1/10 of the original amount
used to immunize) in Freund's complete adjuvant by subcutaneous
injection at multiple sites. Seven to 14 days later the animals are
bled and the serum is assayed for antibody titer. Animals are
boosted until the titer plateaus. Preferably, for conjugate
immunizations, the animal is boosted with the conjugate of the same
antigen, but conjugated to a different protein and/or through a
different cross-linking reagent. Conjugates also can be made in
recombinant cell culture as protein fusions. Also, aggregating
agents such as alum are suitably used to enhance the immune
response.
[0135] Monoclonal antibodies may be made using the hybridoma method
first described by Kohler et al., Nature, 256: 495 (1975), or may
be made by recombinant DNA methods (e.g., U.S. Pat. No. 6,204,023).
Monoclonal antibodies may also be made using the techniques
described in U.S. Pat. Nos. 6,025,155 and 6,077,677 as well as U.S.
Patent Application Publication Nos. 2002/0160970 and
2003/0083293.
[0136] In the hybridoma method, a mouse or other appropriate host
animal, such as a rat, hamster or monkey, is immunized (e.g., as
hereinabove described) to elicit lymphocytes that produce or are
capable of producing antibodies that will specifically bind to the
antigen used for immunization. Alternatively, lymphocytes may be
immunized in vitro. Lymphocytes then are fused with myeloma cells
using a suitable fusing agent, such as polyethylene glycol, to form
a hybridoma cell.
[0137] The hybridoma cells thus prepared are seeded and grown in a
suitable culture medium that preferably contains one or more
substances that inhibit the growth or survival of the unfused,
parental myeloma cells. For example, if the parental myeloma cells
lack the enzyme hypoxanthine guanine phosphoribosyl transferase
(HGPRT or HPRT), the culture medium for the hybridomas typically
will include hypoxanthine, aminopterin, and thymidine (HAT medium),
which substances prevent the growth of HGPRT-deficient cells.
[0138] As used herein, the term "purified" in the expression
"purified antibody" is simply meant to distinguish man-made
antibody from an antibody that may naturally be produced by an
animal against its own antigens. Hence, raw serum and hybridoma
culture medium containing anti-OPN antibody are "purified
antibodies" within the meaning of the present invention.
[0139] As used herein, the terminology "blood sample" is meant to
refer to blood, plasma or serum.
[0140] As used herein, the terminology "cell sample" is meant to
refer to a sample containing cells expressing the desired GPCR(s)
in sufficient amount to detect a cellular response in in order to
classify the subject into one of functional groups FG1, FG2 and
FG3. The cells in the cell sample may be any type of cells as long
as they express the desired GPCR to be tested. The cells used
herein naturally express one or more receptors coupled to G.sub.i
proteins and were selected in part for their accessibility for
collection from subjects. Hence, cells such as osteoblasts,
osteoclasts, peripheral blood mononuclear cell (PBMC) (inherently
including principally lymphocytes but also monocytes) and myoblasts
are advantageously accessible and may conveniently be used in the
methods of the present invention. Blood cells (e.g., PBMCs,
platelets (thrombocytes), etc.) in particular are particularly
accessible and provide for a more rapid testing. Any blood cell can
be used for the methods of the present invention so long as it
possesses at least one GPCR receptor coupled to a Gi protein. The
cells can be fresh or frozen and may or may not have been cultured
(expanded) prior to testing. The "sample" may be of any origin
including blood, saliva, tears, sputum, urine, feces, biopsy (e.g.,
muscle biopsy), as long as it contains cells expressing the desired
GPCR(s).
[0141] The articles "a," "an" and "the" are used herein to refer to
one or to more than one (i.e., to at least one) of the grammatical
object of the article.
[0142] The term "including" and "comprising" are used herein to
mean, and re used interchangeably with, the phrases "including but
not limited to" and "comprising but not limited to".
[0143] The terms "such as" are used herein to mean, and is used
interchangeably with, the phrase "such as but not limited to".
[0144] The present invention is illustrated in further details by
the following non-limiting examples.
Example 1
AIS Endophenotype and Brace Treatment Outcome
[0145] Methods:
[0146] A retrospective study was performed with 67 AIS patients
having had a blood test (cell-based assay), seen between January
2007 and November 2012 and having completed treatment with TLSO
braces respecting standard prescription criteria (23 h per day).
AIS patients were stratified according to the method developed by
Moreau et al. 2004 (Moreau et al., 2004; Akoume et al., 2010) based
upon the measurement of a differential signaling impairment of
receptors coupled to G inhibitory proteins (Gi) allowing their
classification into three functional groups (i.e., biological
endophenotypes FG1, FG2 or FG3). Cobb angles were measured by
single blind observer in brace and at the end of treatment and
compared to their initial values. Progression of the curvature was
defined by 6.degree. angle increase (Nachemson et al., 1995).
Treatment was considered a success if final Cobb angle was
.ltoreq.45.degree. or no surgery was required (Richards et al.,
2005). Association between group classification and treatment
outcome was analysed with Chi.sup.2 test in a contingency table.
Logistic regression models were performed for odds ratio
calculation. Group comparability at time of prescription was
verified using ANOVA and Chi.sup.2 test: groups were not different
on mean Cobb angle for all curves, Risser sign (i.e., amount of
calcification of human pelvis as a measure of maturity) nor
age.
[0147] Results:
[0148] The patient distribution is reported in Table 10 (15 in FG1,
27 in FG2, and 25 in FG3).
TABLE-US-00009 TABLE 10 Statistical analysis of the patient
distribution comparing 3 success criteria (Cobb at the end of
treatment .ltoreq.45.degree., Cobb angle progression
.ltoreq.6.degree. and no need for surgery) Odds success failure
ratio Final Cobb .ltoreq.45.degree. FG1 6 (40%) 9 (60%) 1 FG2 16
(59%) 11 (41%) 2.18 p = 0.235 FG3 21 (84%) 4 (16%) 7.88 p = 0.007
Total 43 (64%) 24 (36%) .chi..sup.2 = 8.4 (p = 0.015) Cobb angle
progression .ltoreq.6.degree. FG1 6 (40%) 9 (60%) 1 FG2 13 (48%) 14
(52%) 1.39 p = 0.612 FG3 15 (60%) 10 (40%) 2.25 p = 0.224 Total 33
(49%) 34 (51%) .chi..sup.2 = 1.6 (p = 0.444) No need for surgery
FG1 8 (53%) 7 (47%) 1 FG2 20 (74%) 7 (26%) 2.5 p = 0.177 FG3 22
(88%) 3 (12%) 6.4 p = 0.02 Total 50 (74%) 17 (25%) .chi..sup.2 =
5.96 (p = 0.05)
[0149] Globally, in all patients who had brace success, the
majority were from FG2 and FG3. There was a clear association
between the functional group and success of the treatment regarding
the progression of curvature .ltoreq.45.degree. criteria. Group FG3
patients were more likely to have success with brace treatment than
in group FG1. The association was in the same direction for group
FG2. Regarding the .gtoreq.6.degree. of progression criteria, an
increased proportion of success was noted in FG3. Success in
treatment in regard to preventing surgery was statistically
different between the groups (Chi 2 (2, 67)=5.96, p=0.05). It is
6.4 times more likely to prevent surgery than to have one in group
FG3 compared to FG1 (p=0.02). Again, a tendency towards increased
chance of preventing surgery was found in group FG2 compared to
FG1.
[0150] In order to confirm the above results and determine whether
the specific type of brace treatment used influenced outcome, a
retrospective study was performed with 90 AIS patients previously
stratified among three biological endophenotypes according to a
cell-based assay, as described above, allowing their classification
into three functional groups (FG1, FG2 or FG3). Patients completed
the non-rigid/dynamic (SpineCor.TM.) brace treatment following
standard prescription criteria. Cobb angles were measured by a
single blind observer in brace and at the end of treatment and
compared to their initial values. Progression of the curvature was
defined by a 6.degree. Cobb increase and treatment was considered a
success if final Cobb angle was .ltoreq.45.degree. or no surgery
was required. Association between group classification and
treatment outcome was analysed with Chi2 test. Logistic regression
models were performed for odds ratio calculation. Group
comparability at time of prescription was verified using ANOVA and
Chi2 test: no differences for mean Cobb angle, Risser sign, BMI nor
age.
[0151] Results. The patient distribution is reported in Table 11
(24 in FG1, 27 in FG2, and 39 in FG3). As for the first study with
rigid brace treatment, globally, in all patients who had brace
success, the majority were from FG3. There was a clear association
between the functional group and the success of the treatment
regarding the final Cobb angle .ltoreq.45.degree. criteria
(Chi2=6.7, p=0.034) and in regard to preventing progression of
6.degree. (Chi2=15.7, p<0.001). Being classified as FG3 was 4
times (p=0.028) and 7.6 times (p=0.001) more likely to lead to
treatment success than failure compared to FG1, respectively for
the .ltoreq.45.degree. final Cobb and .ltoreq.6.degree. progression
criteria. There was no significant difference in treatment outcomes
between groups FG1 and FG2.
TABLE-US-00010 TABLE 11 Statistical analysis of the patient
distribution treated with SpineCor .TM. brace comparing 2 success
criteria (Cobb at the end of treatment .ltoreq.45.degree. and Cobb
angle progression) Odds success failure ratio Final Cobb
.ltoreq.45.degree. FG1 15 (63%) 9 (37%) 1 FG2 17 (63%) 10 (37%)
1.02 p = 0.973 FG3 34 (87%) 5 (13%) 4.08 p = 0.028 Total 66 (73%)
24 (27%) .chi..sup.2 = 6.7 (p = 0.034) Cobb angle progression
.ltoreq.6.degree. FG1 5 (21%) 19 (79%) 1 FG2 8 (30%) 19 (70%) 1.60
p = 0.474 FG3 26 (67%) 13 (33%) 7.60 p = 0.001 Total 39 (43%) 51
(57%) .chi..sup.2 = 15.7 (p < 0.001)
[0152] Conclusion. Globally, in all patients who had brace success,
the majority were from FG2 and FG3. Outcomes of bracing were most
favorable for patients presenting the FG3 endophenotype,
independently of the type of bracing. There was a clear association
between the functional group and success of the treatment regarding
the progression of curvature .ltoreq.45.degree. criteria and the
Cobb angle progression .ltoreq.6. Furthermore, results showed a
tendency towards increased chance of preventing Cobb angle
progression (.ltoreq.6) and surgery in group FG2 compared to
FG1.
Example 2
Circulating OPN Level Variations with Age in AIS and Control
Subjects
[0153] Data was obtained with AIS patients (N=884) in Phase 2
followed at Sainte-Justine Hospital, at the Shriners Hospital or
Montreal Children's Hospital, in Montreal, Quebec, Canada. Age
matched control subjects (N=254) were recruited from primary and
secondary schools in Montreal. The plasma was collected in tubes
containing EDTA and circulating OPN levels were measured in blood
samples from control and AIS subjects of age 9 to 18 by ELISA.
[0154] As shown in FIG. 2, circulating OPN blood level generally
increases until between the age of 11 and 12 years old and then
begin to decrease with age. OPN levels are significantly higher in
AIS than control subjects at all times and follow generally the
same variation pattern with age.
Example 3
Circulating OPN Level Variations Upon Brace Treatment in Subjects
Having High and Low Levels of OPN
[0155] The effect of brace treatment on the level of circulating
OPN in AIS subjects was studied. Data was obtained with AIS
patients in Phase 2 followed at Sainte-Justine Hospital, at the
Shriners Hospital or Montreal Children's Hospital, in Montreal,
Quebec, Canada. The plasma was collected in tubes containing EDTA
and OPN was measured with ELISA (IBL International, catalogue #
JP27158). Circulating OPN levels were measured in blood samples
from control and AIS subjects every 6 months during four years.
Subjects were separated in two groups. FIG. 3A presents OPN levels
for subjects which had initial (i.e., before the beginning of brace
treatment) circulating OPN levels below 600 ng/mL, treated with a
brace (N=94) and age-matched untreated control subjects (N=330).
FIG. 3B shows OPN levels for subjects which had initial circulating
OPN levels .gtoreq.600 ng/ml, treated (N=153) with a TLSO brace and
age-matched untreated control subjects (N=310).
[0156] As shown in FIG. 3A, in subjects having initial low levels
of circulating OPN (i.e., below about 600 ng/ml), brace treatment
first increased OPN levels. OPN levels were significantly higher in
subjects treated with a brace, 6 months after treatment and
returned to the same level than subjects not treated with a brace
after about 12 to 18 months of brace treatment. Brace treatment
then induced a decrease in OPN levels which was maintained during
the rest of the study, i.e., up to 48 months (FIG. 3A).
[0157] In subjects having high levels of OPN at the beginning of
the study (i.e., .gtoreq.about 600 ng/ml), brace treatment had the
opposite effect. It produced an important decrease in circulating
OPN level within the first 6 months. Then, OPN level increased
slowly until it reached about 600 ng/ml (i.e., about the same level
as untreated subjects) about 24 months after the beginning of
treatment and decreased again after. Circulating OPN levels
remained below that of AIS subjects not treated with a brace,
except for a short period around 24 months of treatment, where OPN
levels reached a peak and overlapped with OPN levels of untreated
subjects (FIG. 2B).
[0158] Based on the results presented in FIGS. 3A and 3B, it
appears that when the treatment begins with circulating OPN levels
below about 600 ng/mL, brace treatment generally first causes an
increase in OPN production, whereas when treatment begins with OPN
concentrations at or above this value, brace treatment induces a
reduction in circulating levels of OPN. These results show that
long term brace treatment generally decreases the circulating level
of OPN and suggest the presence of a retroinhibition mechanism
which regulates circulating OPN levels when they reach around 600
ng/ml.
Example 4
Association Between OPN and sCD44 Levels and Curve Progression in
AIS Subjects According to their Functional Group
[0159] The relation between curve progression and OPN and sCD44
levels was followed in AIS subjects. An association between OPN
levels and curve progression was observed. In FG1 subjects, low
levels of OPN (.ltoreq.than about 500 ng/ml) correlated with curve
progression (see for examples FIGS. 6, 8, 9 and 10) while high
levels (e.g., at or above 1000 ng/ml) were generally associated
with absence of curve progression or smaller rate of progression
(see for example FIGS. 2 and 7). For FG2 and FG3 subjects, high
levels of OPN were more often associated with curve progression
(see for example FIG. 17B). FIGS. 4A-19B shows examples of OPN and
sCD44 levels variations observed with time and curve progression in
AIS subjects for each functional group. No clear correlation was
observed between curve progression and sCD44.
Example 5
OPN Enhances Gi-Mediated Cell Signalling in FG1 Subjects and
Decreases Gi-Mediated Signalling in FG2 and FG3 Subjects
[0160] The variation in Gi-mediated cell signaling in response to
OPN in each functional group (FG1, FG2 and FG3) was studied. FIGS.
20 and 21 show the response to OPN (increasing doses) on
osteoblasts isolated from patients classified into functional
groups FG1, FG2 and FG3. OPN enhances Gi signaling in the FG1
functional group and aggravates the impairment in the FG2
(hypersensitive) and FG3 (sensitive) functional groups (FIG. 20).
Furthermore, MC3T3-E1 cells were used to check the effect of the
knockdown of OPN and its receptors. MC3T3-E1 osteoblasts cells were
transiently transfected in serum-free medium, using
Lipofectamine.TM. RNAiMAX reagent (Invitrogen) according to the
manufacturer's instructions and functional experiments were
performed 48 h post transfection. Knock down of OPN expression in
osteoblasts by siRNAs (CCA CAG CCA CAA GCA GUC CAG AUU A (SEQ ID
NO: 14)) increases Gi-mediated transduction in FG2 and FG3
subgroups while it tends to decrease the response in FG1 (FIG.
21).
Example 6
Differential Effect of HA, CD44 and Integrins on Gi-Mediated Cell
Signalling in FG1, FG2 and FG3 Functional Groups
[0161] MC3T3-E1 cells were also used to check the effect of the
knockdown of OPN's receptors by RNAi. Experimental conditions were
as described for Example 5. The sequence of RNA oligonucleotides
used for the knockdowns are: integrin .beta.1 (CCU AAG UCA GCA GUA
GGA ACA UUA U (SEQ ID NO: 15)), integrin .beta.3 (CCU CCA GCU CAU
UGU UGA UGC UUA U (SEQ ID NO: 16)); integrin .beta.5
(AGAAUGUCUGCUAAUCCACCCAAAA, HSS-105572, Life technologies (SEQ ID
NO: 17), CUGAGGGCAAACCUUGUCAAAAAUG, HSS-105573, Life technologies
(SEQ ID NO: 18); and GAAAUGGCUUCAAAUCCAUUAUACA, HSS-179984, life
technologies, (SEQ ID NO: 19)) and CD44 (GAA CAA GGA GUC GUC AGA
AAC UCC A (SEQ ID NO: 20)).
[0162] The scope of the claims should not be limited by the
preferred embodiments set forth in the examples, but should be
given the broadest interpretation consistent with the description
as a whole.
Sequence CWU 1
1
201314PRTHomo Sapiens 1Met Arg Ile Ala Val Ile Cys Phe Cys Leu Leu
Gly Ile Thr Cys Ala 1 5 10 15 Ile Pro Val Lys Gln Ala Asp Ser Gly
Ser Ser Glu Glu Lys Gln Leu 20 25 30 Tyr Asn Lys Tyr Pro Asp Ala
Val Ala Thr Trp Leu Asn Pro Asp Pro 35 40 45 Ser Gln Lys Gln Asn
Leu Leu Ala Pro Gln Asn Ala Val Ser Ser Glu 50 55 60 Glu Thr Asn
Asp Phe Lys Gln Glu Thr Leu Pro Ser Lys Ser Asn Glu 65 70 75 80 Ser
His Asp His Met Asp Asp Met Asp Asp Glu Asp Asp Asp Asp His 85 90
95 Val Asp Ser Gln Asp Ser Ile Asp Ser Asn Asp Ser Asp Asp Val Asp
100 105 110 Asp Thr Asp Asp Ser His Gln Ser Asp Glu Ser His His Ser
Asp Glu 115 120 125 Ser Asp Glu Leu Val Thr Asp Phe Pro Thr Asp Leu
Pro Ala Thr Glu 130 135 140 Val Phe Thr Pro Val Val Pro Thr Val Asp
Thr Tyr Asp Gly Arg Gly 145 150 155 160 Asp Ser Val Val Tyr Gly Leu
Arg Ser Lys Ser Lys Lys Phe Arg Arg 165 170 175 Pro Asp Ile Gln Tyr
Pro Asp Ala Thr Asp Glu Asp Ile Thr Ser His 180 185 190 Met Glu Ser
Glu Glu Leu Asn Gly Ala Tyr Lys Ala Ile Pro Val Ala 195 200 205 Gln
Asp Leu Asn Ala Pro Ser Asp Trp Asp Ser Arg Gly Lys Asp Ser 210 215
220 Tyr Glu Thr Ser Gln Leu Asp Asp Gln Ser Ala Glu Thr His Ser His
225 230 235 240 Lys Gln Ser Arg Leu Tyr Lys Arg Lys Ala Asn Asp Glu
Ser Asn Glu 245 250 255 His Ser Asp Val Ile Asp Ser Gln Glu Leu Ser
Lys Val Ser Arg Glu 260 265 270 Phe His Ser His Glu Phe His Ser His
Glu Asp Met Leu Val Val Asp 275 280 285 Pro Lys Ser Lys Glu Glu Asp
Lys His Leu Lys Phe Arg Ile Ser His 290 295 300 Glu Leu Asp Ser Ala
Ser Ser Glu Val Asn 305 310 21641DNAHomo Sapiens 2ctccctgtgt
tggtggagga tgtctgcagc agcatttaaa ttctgggagg gcttggttgt 60cagcagcagc
aggaggaggc agagcacagc atcgtcggga ccagactcgt ctcaggccag
120ttgcagcctt ctcagccaaa cgccgaccaa ggaaaactca ctaccatgag
aattgcagtg 180atttgctttt gcctcctagg catcacctgt gccataccag
ttaaacaggc tgattctgga 240agttctgagg aaaagcagct ttacaacaaa
tacccagatg ctgtggccac atggctaaac 300cctgacccat ctcagaagca
gaatctccta gccccacaga atgctgtgtc ctctgaagaa 360accaatgact
ttaaacaaga gacccttcca agtaagtcca acgaaagcca tgaccacatg
420gatgatatgg atgatgaaga tgatgatgac catgtggaca gccaggactc
cattgactcg 480aacgactctg atgatgtaga tgacactgat gattctcacc
agtctgatga gtctcaccat 540tctgatgaat ctgatgaact ggtcactgat
tttcccacgg acctgccagc aaccgaagtt 600ttcactccag ttgtccccac
agtagacaca tatgatggcc gaggtgatag tgtggtttat 660ggactgaggt
caaaatctaa gaagtttcgc agacctgaca tccagtaccc tgatgctaca
720gacgaggaca tcacctcaca catggaaagc gaggagttga atggtgcata
caaggccatc 780cccgttgccc aggacctgaa cgcgccttct gattgggaca
gccgtgggaa ggacagttat 840gaaacgagtc agctggatga ccagagtgct
gaaacccaca gccacaagca gtccagatta 900tataagcgga aagccaatga
tgagagcaat gagcattccg atgtgattga tagtcaggaa 960ctttccaaag
tcagccgtga attccacagc catgaatttc acagccatga agatatgctg
1020gttgtagacc ccaaaagtaa ggaagaagat aaacacctga aatttcgtat
ttctcatgaa 1080ttagatagtg catcttctga ggtcaattaa aaggagaaaa
aatacaattt ctcactttgc 1140atttagtcaa aagaaaaaat gctttatagc
aaaatgaaag agaacatgaa atgcttcttt 1200ctcagtttat tggttgaatg
tgtatctatt tgagtctgga aataactaat gtgtttgata 1260attagtttag
tttgtggctt catggaaact ccctgtaaac taaaagcttc agggttatgt
1320ctatgttcat tctatagaag aaatgcaaac tatcactgta ttttaatatt
tgttattctc 1380tcatgaatag aaatttatgt agaagcaaac aaaatacttt
tacccactta aaaagagaat 1440ataacatttt atgtcactat aatcttttgt
tttttaagtt agtgtatatt ttgttgtgat 1500tatctttttg tggtgtgaat
aaatctttta tcttgaatgt aataagaatt tggtggtgtc 1560aattgcttat
ttgttttccc acggttgtcc agcaattaat aaaacataac cttttttact
1620gcctaaaaaa aaaaaaaaaa a 16413742PRTHomo Sapiens 3Met Asp Lys
Phe Trp Trp His Ala Ala Trp Gly Leu Cys Leu Val Pro 1 5 10 15 Leu
Ser Leu Ala Gln Ile Asp Leu Asn Ile Thr Cys Arg Phe Ala Gly 20 25
30 Val Phe His Val Glu Lys Asn Gly Arg Tyr Ser Ile Ser Arg Thr Glu
35 40 45 Ala Ala Asp Leu Cys Lys Ala Phe Asn Ser Thr Leu Pro Thr
Met Ala 50 55 60 Gln Met Glu Lys Ala Leu Ser Ile Gly Phe Glu Thr
Cys Arg Tyr Gly 65 70 75 80 Phe Ile Glu Gly His Val Val Ile Pro Arg
Ile His Pro Asn Ser Ile 85 90 95 Cys Ala Ala Asn Asn Thr Gly Val
Tyr Ile Leu Thr Ser Asn Thr Ser 100 105 110 Gln Tyr Asp Thr Tyr Cys
Phe Asn Ala Ser Ala Pro Pro Glu Glu Asp 115 120 125 Cys Thr Ser Val
Thr Asp Leu Pro Asn Ala Phe Asp Gly Pro Ile Thr 130 135 140 Ile Thr
Ile Val Asn Arg Asp Gly Thr Arg Tyr Val Gln Lys Gly Glu 145 150 155
160 Tyr Arg Thr Asn Pro Glu Asp Ile Tyr Pro Ser Asn Pro Thr Asp Asp
165 170 175 Asp Val Ser Ser Gly Ser Ser Ser Glu Arg Ser Ser Thr Ser
Gly Gly 180 185 190 Tyr Ile Phe Tyr Thr Phe Ser Thr Val His Pro Ile
Pro Asp Glu Asp 195 200 205 Ser Pro Trp Ile Thr Asp Ser Thr Asp Arg
Ile Pro Ala Thr Thr Leu 210 215 220 Met Ser Thr Ser Ala Thr Ala Thr
Glu Thr Ala Thr Lys Arg Gln Glu 225 230 235 240 Thr Trp Asp Trp Phe
Ser Trp Leu Phe Leu Pro Ser Glu Ser Lys Asn 245 250 255 His Leu His
Thr Thr Thr Gln Met Ala Gly Thr Ser Ser Asn Thr Ile 260 265 270 Ser
Ala Gly Trp Glu Pro Asn Glu Glu Asn Glu Asp Glu Arg Asp Arg 275 280
285 His Leu Ser Phe Ser Gly Ser Gly Ile Asp Asp Asp Glu Asp Phe Ile
290 295 300 Ser Ser Thr Ile Ser Thr Thr Pro Arg Ala Phe Asp His Thr
Lys Gln 305 310 315 320 Asn Gln Asp Trp Thr Gln Trp Asn Pro Ser His
Ser Asn Pro Glu Val 325 330 335 Leu Leu Gln Thr Thr Thr Arg Met Thr
Asp Val Asp Arg Asn Gly Thr 340 345 350 Thr Ala Tyr Glu Gly Asn Trp
Asn Pro Glu Ala His Pro Pro Leu Ile 355 360 365 His His Glu His His
Glu Glu Glu Glu Thr Pro His Ser Thr Ser Thr 370 375 380 Ile Gln Ala
Thr Pro Ser Ser Thr Thr Glu Glu Thr Ala Thr Gln Lys 385 390 395 400
Glu Gln Trp Phe Gly Asn Arg Trp His Glu Gly Tyr Arg Gln Thr Pro 405
410 415 Lys Glu Asp Ser His Ser Thr Thr Gly Thr Ala Ala Ala Ser Ala
His 420 425 430 Thr Ser His Pro Met Gln Gly Arg Thr Thr Pro Ser Pro
Glu Asp Ser 435 440 445 Ser Trp Thr Asp Phe Phe Asn Pro Ile Ser His
Pro Met Gly Arg Gly 450 455 460 His Gln Ala Gly Arg Arg Met Asp Met
Asp Ser Ser His Ser Ile Thr 465 470 475 480 Leu Gln Pro Thr Ala Asn
Pro Asn Thr Gly Leu Val Glu Asp Leu Asp 485 490 495 Arg Thr Gly Pro
Leu Ser Met Thr Thr Gln Gln Ser Asn Ser Gln Ser 500 505 510 Phe Ser
Thr Ser His Glu Gly Leu Glu Glu Asp Lys Asp His Pro Thr 515 520 525
Thr Ser Thr Leu Thr Ser Ser Asn Arg Asn Asp Val Thr Gly Gly Arg 530
535 540 Arg Asp Pro Asn His Ser Glu Gly Ser Thr Thr Leu Leu Glu Gly
Tyr 545 550 555 560 Thr Ser His Tyr Pro His Thr Lys Glu Ser Arg Thr
Phe Ile Pro Val 565 570 575 Thr Ser Ala Lys Thr Gly Ser Phe Gly Val
Thr Ala Val Thr Val Gly 580 585 590 Asp Ser Asn Ser Asn Val Asn Arg
Ser Leu Ser Gly Asp Gln Asp Thr 595 600 605 Phe His Pro Ser Gly Gly
Ser His Thr Thr His Gly Ser Glu Ser Asp 610 615 620 Gly His Ser His
Gly Ser Gln Glu Gly Gly Ala Asn Thr Thr Ser Gly 625 630 635 640 Pro
Ile Arg Thr Pro Gln Ile Pro Glu Trp Leu Ile Ile Leu Ala Ser 645 650
655 Leu Leu Ala Leu Ala Leu Ile Leu Ala Val Cys Ile Ala Val Asn Ser
660 665 670 Arg Arg Arg Cys Gly Gln Lys Lys Lys Leu Val Ile Asn Ser
Gly Asn 675 680 685 Gly Ala Val Glu Asp Arg Lys Pro Ser Gly Leu Asn
Gly Glu Ala Ser 690 695 700 Lys Ser Gln Glu Met Val His Leu Val Asn
Lys Glu Ser Ser Glu Thr 705 710 715 720 Pro Asp Gln Phe Met Thr Ala
Asp Glu Thr Arg Asn Leu Gln Asn Val 725 730 735 Asp Met Lys Ile Gly
Val 740 45748DNAHomo Sapiens 4gagaagaaag ccagtgcgtc tctgggcgca
ggggccagtg gggctcggag gcacaggcac 60cccgcgacac tccaggttcc ccgacccacg
tccctggcag ccccgattat ttacagcctc 120agcagagcac ggggcggggg
cagaggggcc cgcccgggag ggctgctact tcttaaaacc 180tctgcgggct
gcttagtcac agcccccctt gcttgggtgt gtccttcgct cgctccctcc
240ctccgtctta ggtcactgtt ttcaacctcg aataaaaact gcagccaact
tccgaggcag 300cctcattgcc cagcggaccc cagcctctgc caggttcggt
ccgccatcct cgtcccgtcc 360tccgccggcc cctgccccgc gcccagggat
cctccagctc ctttcgcccg cgccctccgt 420tcgctccgga caccatggac
aagttttggt ggcacgcagc ctggggactc tgcctcgtgc 480cgctgagcct
ggcgcagatc gatttgaata taacctgccg ctttgcaggt gtattccacg
540tggagaaaaa tggtcgctac agcatctctc ggacggaggc cgctgacctc
tgcaaggctt 600tcaatagcac cttgcccaca atggcccaga tggagaaagc
tctgagcatc ggatttgaga 660cctgcaggta tgggttcata gaagggcacg
tggtgattcc ccggatccac cccaactcca 720tctgtgcagc aaacaacaca
ggggtgtaca tcctcacatc caacacctcc cagtatgaca 780catattgctt
caatgcttca gctccacctg aagaagattg tacatcagtc acagacctgc
840ccaatgcctt tgatggacca attaccataa ctattgttaa ccgtgatggc
acccgctatg 900tccagaaagg agaatacaga acgaatcctg aagacatcta
ccccagcaac cctactgatg 960atgacgtgag cagcggctcc tccagtgaaa
ggagcagcac ttcaggaggt tacatctttt 1020acaccttttc tactgtacac
cccatcccag acgaagacag tccctggatc accgacagca 1080cagacagaat
ccctgctacc actttgatga gcactagtgc tacagcaact gagacagcaa
1140ccaagaggca agaaacctgg gattggtttt catggttgtt tctaccatca
gagtcaaaga 1200atcatcttca cacaacaaca caaatggctg gtacgtcttc
aaataccatc tcagcaggct 1260gggagccaaa tgaagaaaat gaagatgaaa
gagacagaca cctcagtttt tctggatcag 1320gcattgatga tgatgaagat
tttatctcca gcaccatttc aaccacacca cgggcttttg 1380accacacaaa
acagaaccag gactggaccc agtggaaccc aagccattca aatccggaag
1440tgctacttca gacaaccaca aggatgactg atgtagacag aaatggcacc
actgcttatg 1500aaggaaactg gaacccagaa gcacaccctc ccctcattca
ccatgagcat catgaggaag 1560aagagacccc acattctaca agcacaatcc
aggcaactcc tagtagtaca acggaagaaa 1620cagctaccca gaaggaacag
tggtttggca acagatggca tgagggatat cgccaaacac 1680ccaaagaaga
ctcccattcg acaacaggga cagctgcagc ctcagctcat accagccatc
1740caatgcaagg aaggacaaca ccaagcccag aggacagttc ctggactgat
ttcttcaacc 1800caatctcaca ccccatggga cgaggtcatc aagcaggaag
aaggatggat atggactcca 1860gtcatagtat aacgcttcag cctactgcaa
atccaaacac aggtttggtg gaagatttgg 1920acaggacagg acctctttca
atgacaacgc agcagagtaa ttctcagagc ttctctacat 1980cacatgaagg
cttggaagaa gataaagacc atccaacaac ttctactctg acatcaagca
2040ataggaatga tgtcacaggt ggaagaagag acccaaatca ttctgaaggc
tcaactactt 2100tactggaagg ttatacctct cattacccac acacgaagga
aagcaggacc ttcatcccag 2160tgacctcagc taagactggg tcctttggag
ttactgcagt tactgttgga gattccaact 2220ctaatgtcaa tcgttcctta
tcaggagacc aagacacatt ccaccccagt ggggggtccc 2280ataccactca
tggatctgaa tcagatggac actcacatgg gagtcaagaa ggtggagcaa
2340acacaacctc tggtcctata aggacacccc aaattccaga atggctgatc
atcttggcat 2400ccctcttggc cttggctttg attcttgcag tttgcattgc
agtcaacagt cgaagaaggt 2460gtgggcagaa gaaaaagcta gtgatcaaca
gtggcaatgg agctgtggag gacagaaagc 2520caagtggact caacggagag
gccagcaagt ctcaggaaat ggtgcatttg gtgaacaagg 2580agtcgtcaga
aactccagac cagtttatga cagctgatga gacaaggaac ctgcagaatg
2640tggacatgaa gattggggtg taacacctac accattatct tggaaagaaa
caaccgttgg 2700aaacataacc attacaggga gctgggacac ttaacagatg
caatgtgcta ctgattgttt 2760cattgcgaat cttttttagc ataaaatttt
ctactctttt tgttttttgt gttttgttct 2820ttaaagtcag gtccaatttg
taaaaacagc attgctttct gaaattaggg cccaattaat 2880aatcagcaag
aatttgatcg ttccagttcc cacttggagg cctttcatcc ctcgggtgtg
2940ctatggatgg cttctaacaa aaactacaca tatgtattcc tgatcgccaa
cctttccccc 3000accagctaag gacatttccc agggttaata gggcctggtc
cctgggagga aatttgaatg 3060ggtccatttt gcccttccat agcctaatcc
ctgggcattg ctttccactg aggttggggg 3120ttggggtgta ctagttacac
atcttcaaca gaccccctct agaaattttt cagatgcttc 3180tgggagacac
ccaaagggtg aagctattta tctgtagtaa actatttatc tgtgtttttg
3240aaatattaaa ccctggatca gtcctttgat cagtataatt ttttaaagtt
actttgtcag 3300aggcacaaaa gggtttaaac tgattcataa taaatatctg
tacttcttcg atcttcacct 3360tttgtgctgt gattcttcag tttctaaacc
agcactgtct gggtccctac aatgtatcag 3420gaagagctga gaatggtaag
gagactcttc taagtcttca tctcagagac cctgagttcc 3480cactcagacc
cactcagcca aatctcatgg aagaccaagg agggcagcac tgtttttgtt
3540ttttgttttt tgtttttttt ttttgacact gtccaaaggt tttccatcct
gtcctggaat 3600cagagttgga agctgaggag cttcagcctc ttttatggtt
taatggccac ctgttctctc 3660ctgtgaaagg ctttgcaaag tcacattaag
tttgcatgac ctgttatccc tggggcccta 3720tttcatagag gctggcccta
ttagtgattt ccaaaaacaa tatggaagtg ccttttgatg 3780tcttacaata
agagaagaag ccaatggaaa tgaaagagat tggcaaaggg gaaggatgat
3840gccatgtaga tcctgtttga catttttatg gctgtatttg taaacttaaa
cacaccagtg 3900tctgttcttg atgcagttgc tatttaggat gagttaagtg
cctggggagt ccctcaaaag 3960gttaaaggga ttcccatcat tggaatctta
tcaccagata ggcaagttta tgaccaaaca 4020agagagtact ggctttatcc
tctaacctca tattttctcc cacttggcaa gtcctttgtg 4080gcatttattc
atcagtcagg gtgtccgatt ggtcctagaa cttccaaagg ctgcttgtca
4140tagaagccat tgcatctata aagcaacggc tcctgttaaa tggtatctcc
tttctgaggc 4200tcctactaaa agtcatttgt tacctaaact tatgtgctta
acaggcaatg cttctcagac 4260cacaaagcag aaagaagaag aaaagctcct
gactaaatca gggctgggct tagacagagt 4320tgatctgtag aatatcttta
aaggagagat gtcaactttc tgcactattc ccagcctctg 4380ctcctccctg
tctaccctct cccctccctc tctccctcca cttcacccca caatcttgaa
4440aaacttcctt tctcttctgt gaacatcatt ggccagatcc attttcagtg
gtctggattt 4500ctttttattt tcttttcaac ttgaaagaaa ctggacatta
ggccactatg tgttgttact 4560gccactagtg ttcaagtgcc tcttgttttc
ccagagattt cctgggtctg ccagaggccc 4620agacaggctc actcaagctc
tttaactgaa aagcaacaag ccactccagg acaaggttca 4680aaatggttac
aacagcctct acctgtcgcc ccagggagaa aggggtagtg atacaagtct
4740catagccaga gatggttttc cactccttct agatattccc aaaaagaggc
tgagacagga 4800ggttattttc aattttattt tggaattaaa tacttttttc
cctttattac tgttgtagtc 4860cctcacttgg atatacctct gttttcacga
tagaaataag ggaggtctag agcttctatt 4920ccttggccat tgtcaacgga
gagctggcca agtcttcaca aacccttgca acattgcctg 4980aagtttatgg
aataagatgt attctcactc ccttgatctc aagggcgtaa ctctggaagc
5040acagcttgac tacacgtcat ttttaccaat gattttcagg tgacctgggc
taagtcattt 5100aaactgggtc tttataaaag taaaaggcca acatttaatt
attttgcaaa gcaacctaag 5160agctaaagat gtaatttttc ttgcaattgt
aaatcttttg tgtctcctga agacttccct 5220taaaattagc tctgagtgaa
aaatcaaaag agacaaaaga catcttcgaa tccatatttc 5280aagcctggta
gaattggctt ttctagcaga acctttccaa aagttttata ttgagattca
5340taacaacacc aagaattgat tttgtagcca acattcattc aatactgtta
tatcagagga 5400gtaggagaga ggaaacattt gacttatctg gaaaagcaaa
atgtacttaa gaataagaat 5460aacatggtcc attcaccttt atgttataga
tatgtctttg tgtaaatcat ttgttttgag 5520ttttcaaaga atagcccatt
gttcattctt gtgctgtaca atgaccactg ttattgttac 5580tttgactttt
cagagcacac ccttcctctg gtttttgtat atttattgat ggatcaataa
5640taatgaggaa agcatgatat gtatattgct gagttgaaag cacttattgg
aaaatattaa 5700aaggctaaca ttaaaagact aaaggaaaca gaaaaaaaaa aaaaaaaa
574851049PRTHomo Sapiens 5Met Gly Ser Arg Thr Pro Glu Ser Pro Leu
His Ala Val Gln Leu Arg 1 5 10 15 Trp Gly Pro Arg Arg Arg Pro Pro
Leu Leu Pro Leu Leu Leu Leu Leu 20 25 30 Leu Pro Pro Pro Pro Arg
Val Gly Gly Phe Asn Leu Asp Ala Glu Ala 35 40 45 Pro Ala Val Leu
Ser Gly Pro Pro Gly Ser Phe Phe Gly Phe Ser Val 50 55 60 Glu Phe
Tyr Arg Pro Gly Thr Asp Gly Val Ser Val Leu Val Gly Ala 65 70 75 80
Pro Lys Ala Asn Thr Ser Gln Pro Gly Val Leu Gln Gly Gly Ala Val 85
90
95 Tyr Leu Cys Pro Trp Gly Ala Ser Pro Thr Gln Cys Thr Pro Ile Glu
100 105 110 Phe Asp Ser Lys Gly Ser Arg Leu Leu Glu Ser Ser Leu Ser
Ser Ser 115 120 125 Glu Gly Glu Glu Pro Val Glu Tyr Lys Ser Leu Gln
Trp Phe Gly Ala 130 135 140 Thr Val Arg Ala His Gly Ser Ser Ile Leu
Ala Cys Ala Pro Leu Tyr 145 150 155 160 Ser Trp Arg Thr Glu Lys Glu
Pro Leu Ser Asp Pro Val Gly Thr Cys 165 170 175 Tyr Leu Ser Thr Asp
Asn Phe Thr Arg Ile Leu Glu Tyr Ala Pro Cys 180 185 190 Arg Ser Asp
Phe Ser Trp Ala Ala Gly Gln Gly Tyr Cys Gln Gly Gly 195 200 205 Phe
Ser Ala Glu Phe Thr Lys Thr Gly Arg Val Val Leu Gly Gly Pro 210 215
220 Gly Ser Tyr Phe Trp Gln Gly Gln Ile Leu Ser Ala Thr Gln Glu Gln
225 230 235 240 Ile Ala Glu Ser Tyr Tyr Pro Glu Tyr Leu Ile Asn Leu
Val Gln Gly 245 250 255 Gln Leu Gln Thr Arg Gln Ala Ser Ser Ile Tyr
Asp Asp Ser Tyr Leu 260 265 270 Gly Tyr Ser Val Ala Val Gly Glu Phe
Ser Gly Asp Asp Thr Glu Asp 275 280 285 Phe Val Ala Gly Val Pro Lys
Gly Asn Leu Thr Tyr Gly Tyr Val Thr 290 295 300 Ile Leu Asn Gly Ser
Asp Ile Arg Ser Leu Tyr Asn Phe Ser Gly Glu 305 310 315 320 Gln Met
Ala Ser Tyr Phe Gly Tyr Ala Val Ala Ala Thr Asp Val Asn 325 330 335
Gly Asp Gly Leu Asp Asp Leu Leu Val Gly Ala Pro Leu Leu Met Asp 340
345 350 Arg Thr Pro Asp Gly Arg Pro Gln Glu Val Gly Arg Val Tyr Val
Tyr 355 360 365 Leu Gln His Pro Ala Gly Ile Glu Pro Thr Pro Thr Leu
Thr Leu Thr 370 375 380 Gly His Asp Glu Phe Gly Arg Phe Gly Ser Ser
Leu Thr Pro Leu Gly 385 390 395 400 Asp Leu Asp Gln Asp Gly Tyr Asn
Asp Val Ala Ile Gly Ala Pro Phe 405 410 415 Gly Gly Glu Thr Gln Gln
Gly Val Val Phe Val Phe Pro Gly Gly Pro 420 425 430 Gly Gly Leu Gly
Ser Lys Pro Ser Gln Val Leu Gln Pro Leu Trp Ala 435 440 445 Ala Ser
His Thr Pro Asp Phe Phe Gly Ser Ala Leu Arg Gly Gly Arg 450 455 460
Asp Leu Asp Gly Asn Gly Tyr Pro Asp Leu Ile Val Gly Ser Phe Gly 465
470 475 480 Val Asp Lys Ala Val Val Tyr Arg Gly Arg Pro Ile Val Ser
Ala Ser 485 490 495 Ala Ser Leu Thr Ile Phe Pro Ala Met Phe Asn Pro
Glu Glu Arg Ser 500 505 510 Cys Ser Leu Glu Gly Asn Pro Val Ala Cys
Ile Asn Leu Ser Phe Cys 515 520 525 Leu Asn Ala Ser Gly Lys His Val
Ala Asp Ser Ile Gly Phe Thr Val 530 535 540 Glu Leu Gln Leu Asp Trp
Gln Lys Gln Lys Gly Gly Val Arg Arg Ala 545 550 555 560 Leu Phe Leu
Ala Ser Arg Gln Ala Thr Leu Thr Gln Thr Leu Leu Ile 565 570 575 Gln
Asn Gly Ala Arg Glu Asp Cys Arg Glu Met Lys Ile Tyr Leu Arg 580 585
590 Asn Glu Ser Glu Phe Arg Asp Lys Leu Ser Pro Ile His Ile Ala Leu
595 600 605 Asn Phe Ser Leu Asp Pro Gln Ala Pro Val Asp Ser His Gly
Leu Arg 610 615 620 Pro Ala Leu His Tyr Gln Ser Lys Ser Arg Ile Glu
Asp Lys Ala Gln 625 630 635 640 Ile Leu Leu Asp Cys Gly Glu Asp Asn
Ile Cys Val Pro Asp Leu Gln 645 650 655 Leu Glu Val Phe Gly Glu Gln
Asn His Val Tyr Leu Gly Asp Lys Asn 660 665 670 Ala Leu Asn Leu Thr
Phe His Ala Gln Asn Val Gly Glu Gly Gly Ala 675 680 685 Tyr Glu Ala
Glu Leu Arg Val Thr Ala Pro Pro Glu Ala Glu Tyr Ser 690 695 700 Gly
Leu Val Arg His Pro Gly Asn Phe Ser Ser Leu Ser Cys Asp Tyr 705 710
715 720 Phe Ala Val Asn Gln Ser Arg Leu Leu Val Cys Asp Leu Gly Asn
Pro 725 730 735 Met Lys Ala Gly Ala Ser Leu Trp Gly Gly Leu Arg Phe
Thr Val Pro 740 745 750 His Leu Arg Asp Thr Lys Lys Thr Ile Gln Phe
Asp Phe Gln Ile Leu 755 760 765 Ser Lys Asn Leu Asn Asn Ser Gln Ser
Asp Val Val Ser Phe Arg Leu 770 775 780 Ser Val Glu Ala Gln Ala Gln
Val Thr Leu Asn Gly Val Ser Lys Pro 785 790 795 800 Glu Ala Val Leu
Phe Pro Val Ser Asp Trp His Pro Arg Asp Gln Pro 805 810 815 Gln Lys
Glu Glu Asp Leu Gly Pro Ala Val His His Val Tyr Glu Leu 820 825 830
Ile Asn Gln Gly Pro Ser Ser Ile Ser Gln Gly Val Leu Glu Leu Ser 835
840 845 Cys Pro Gln Ala Leu Glu Gly Gln Gln Leu Leu Tyr Val Thr Arg
Val 850 855 860 Thr Gly Leu Asn Cys Thr Thr Asn His Pro Ile Asn Pro
Lys Gly Leu 865 870 875 880 Glu Leu Asp Pro Glu Gly Ser Leu His His
Gln Gln Lys Arg Glu Ala 885 890 895 Pro Ser Arg Ser Ser Ala Ser Ser
Gly Pro Gln Ile Leu Lys Cys Pro 900 905 910 Glu Ala Glu Cys Phe Arg
Leu Arg Cys Glu Leu Gly Pro Leu His Gln 915 920 925 Gln Glu Ser Gln
Ser Leu Gln Leu His Phe Arg Val Trp Ala Lys Thr 930 935 940 Phe Leu
Gln Arg Glu His Gln Pro Phe Ser Leu Gln Cys Glu Ala Val 945 950 955
960 Tyr Lys Ala Leu Lys Met Pro Tyr Arg Ile Leu Pro Arg Gln Leu Pro
965 970 975 Gln Lys Glu Arg Gln Val Ala Thr Ala Val Gln Trp Thr Lys
Ala Glu 980 985 990 Gly Ser Tyr Gly Val Pro Leu Trp Ile Ile Ile Leu
Ala Ile Leu Phe 995 1000 1005 Gly Leu Leu Leu Leu Gly Leu Leu Ile
Tyr Ile Leu Tyr Lys Leu 1010 1015 1020 Gly Phe Phe Lys Arg Ser Leu
Pro Tyr Gly Thr Ala Met Glu Lys 1025 1030 1035 Ala Gln Leu Lys Pro
Pro Ala Thr Ser Asp Ala 1040 1045 64267DNAHomo Sapiens 6attcgcctct
gggaggttta ggaagcggct ccgggtcggt ggccccagga cagggaagag 60cgggcgctat
ggggagccgg acgccagagt cccctctcca cgccgtgcag ctgcgctggg
120gcccccggcg ccgacccccg ctgctgccgc tgctgttgct gctgctgccg
ccgccaccca 180gggtcggggg cttcaactta gacgcggagg ccccagcagt
actctcgggg cccccgggct 240ccttcttcgg attctcagtg gagttttacc
ggccgggaac agacggggtc agtgtgctgg 300tgggagcacc caaggctaat
accagccagc caggagtgct gcagggtggt gctgtctacc 360tctgtccttg
gggtgccagc cccacacagt gcacccccat tgaatttgac agcaaaggct
420ctcggctcct ggagtcctca ctgtccagct cagagggaga ggagcctgtg
gagtacaagt 480ccttgcagtg gttcggggca acagttcgag cccatggctc
ctccatcttg gcatgcgctc 540cactgtacag ctggcgcaca gagaaggagc
cactgagcga ccccgtgggc acctgctacc 600tctccacaga taacttcacc
cgaattctgg agtatgcacc ctgccgctca gatttcagct 660gggcagcagg
acagggttac tgccaaggag gcttcagtgc cgagttcacc aagactggcc
720gtgtggtttt aggtggacca ggaagctatt tctggcaagg ccagatcctg
tctgccactc 780aggagcagat tgcagaatct tattaccccg agtacctgat
caacctggtt caggggcagc 840tgcagactcg ccaggccagt tccatctatg
atgacagcta cctaggatac tctgtggctg 900ttggtgaatt cagtggtgat
gacacagaag actttgttgc tggtgtgccc aaagggaacc 960tcacttacgg
ctatgtcacc atccttaatg gctcagacat tcgatccctc tacaacttct
1020caggggaaca gatggcctcc tactttggct atgcagtggc cgccacagac
gtcaatgggg 1080acgggctgga tgacttgctg gtgggggcac ccctgctcat
ggatcggacc cctgacgggc 1140ggcctcagga ggtgggcagg gtctacgtct
acctgcagca cccagccggc atagagccca 1200cgcccaccct taccctcact
ggccatgatg agtttggccg atttggcagc tccttgaccc 1260ccctggggga
cctggaccag gatggctaca atgatgtggc catcggggct ccctttggtg
1320gggagaccca gcagggagta gtgtttgtat ttcctggggg cccaggaggg
ctgggctcta 1380agccttccca ggttctgcag cccctgtggg cagccagcca
caccccagac ttctttggct 1440ctgcccttcg aggaggccga gacctggatg
gcaatggata tcctgatctg attgtggggt 1500cctttggtgt ggacaaggct
gtggtataca ggggccgccc catcgtgtcc gctagtgcct 1560ccctcaccat
cttccccgcc atgttcaacc cagaggagcg gagctgcagc ttagagggga
1620accctgtggc ctgcatcaac cttagcttct gcctcaatgc ttctggaaaa
cacgttgctg 1680actccattgg tttcacagtg gaacttcagc tggactggca
gaagcagaag ggaggggtac 1740ggcgggcact gttcctggcc tccaggcagg
caaccctgac ccagaccctg ctcatccaga 1800atggggctcg agaggattgc
agagagatga agatctacct caggaacgag tcagaatttc 1860gagacaaact
ctcgccgatt cacatcgctc tcaacttctc cttggacccc caagccccag
1920tggacagcca cggcctcagg ccagccctac attatcagag caagagccgg
atagaggaca 1980aggctcagat cttgctggac tgtggagaag acaacatctg
tgtgcctgac ctgcagctgg 2040aagtgtttgg ggagcagaac catgtgtacc
tgggtgacaa gaatgccctg aacctcactt 2100tccatgccca gaatgtgggt
gagggtggcg cctatgaggc tgagcttcgg gtcaccgccc 2160ctccagaggc
tgagtactca ggactcgtca gacacccagg gaacttctcc agcctgagct
2220gtgactactt tgccgtgaac cagagccgcc tgctggtgtg tgacctgggc
aaccccatga 2280aggcaggagc cagtctgtgg ggtggccttc ggtttacagt
ccctcatctc cgggacacta 2340agaaaaccat ccagtttgac ttccagatcc
tcagcaagaa tctcaacaac tcgcaaagcg 2400acgtggtttc ctttcggctc
tccgtggagg ctcaggccca ggtcaccctg aacggtgtct 2460ccaagcctga
ggcagtgcta ttcccagtaa gcgactggca tccccgagac cagcctcaga
2520aggaggagga cctgggacct gctgtccacc atgtctatga gctcatcaac
caaggcccca 2580gctccattag ccagggtgtg ctggaactca gctgtcccca
ggctctggaa ggtcagcagc 2640tcctatatgt gaccagagtt acgggactca
actgcaccac caatcacccc attaacccaa 2700agggcctgga gttggatccc
gagggttccc tgcaccacca gcaaaaacgg gaagctccaa 2760gccgcagctc
tgcttcctcg ggacctcaga tcctgaaatg cccggaggct gagtgtttca
2820ggctgcgctg tgagctcggg cccctgcacc aacaagagag ccaaagtctg
cagttgcatt 2880tccgagtctg ggccaagact ttcttgcagc gggagcacca
gccatttagc ctgcagtgtg 2940aggctgtgta caaagccctg aagatgccct
accgaatcct gcctcggcag ctgccccaaa 3000aagagcgtca ggtggccaca
gctgtgcaat ggaccaaggc agaaggcagc tatggcgtcc 3060cactgtggat
catcatccta gccatcctgt ttggcctcct gctcctaggt ctactcatct
3120acatcctcta caagcttgga ttcttcaaac gctccctccc atatggcacc
gccatggaaa 3180aagctcagct caagcctcca gccacctctg atgcctgagt
cctcccaatt tcagactccc 3240attcctgaag aaccagtccc cccaccctca
ttctactgaa aaggaggggt ctgggtactt 3300cttgaaggtg ctgacggcca
gggagaagct cctctcccca gcccagagac atacttgaag 3360ggccagagcc
aggggggtga ggagctgggg atccctcccc cccatgcact gtgaaggacc
3420cttgtttaca cataccctct tcatggatgg gggaactcag atccagggac
agaggcccca 3480gcctccctga agcctttgca ttttggagag tttcctgaaa
caacttggaa agataactag 3540gaaatccatt cacagttctt tgggccagac
atgccacaag gacttcctgt ccagctccaa 3600cctgcaaaga tctgtcctca
gccttgccag agatccaaaa gaagccccca gctaagaacc 3660tggaacttgg
ggagttaaga cctggcagct ctggacagcc ccaccctggt gggccaacaa
3720agaacactaa ctatgcatgg tgccccagga ccagctcagg acagatgcca
cacaaggata 3780gatgctggcc cagggcccag agcccagctc caaggggaat
cagaactcaa atggggccag 3840atccagcctg gggtctggag ttgatctgga
acccagactc agacattggc acctaatcca 3900ggcagatcca ggactatatt
tgggcctgct ccagacctga tcctggaggc ccagttcacc 3960ctgatttagg
agaagccagg aatttcccag gaccctgaag gggccatgat ggcaacagat
4020ctggaacctc agcctggcca gacacaggcc ctccctgttc cccagagaaa
ggggagccca 4080ctgtcctggg cctgcagaat ttgggttctg cctgccagct
gcactgatgc tgcccctcat 4140ctctctgccc aacccttccc tcaccttggc
accagacacc caggacttat ttaaactctg 4200ttgcaagtgc aataaatctg
acccagtgcc cccactgacc agaactagaa aaaaaaaaaa 4260aaaaaaa
42677798PRTHomo Sapiens 7Met Asn Leu Gln Pro Ile Phe Trp Ile Gly
Leu Ile Ser Ser Val Cys 1 5 10 15 Cys Val Phe Ala Gln Thr Asp Glu
Asn Arg Cys Leu Lys Ala Asn Ala 20 25 30 Lys Ser Cys Gly Glu Cys
Ile Gln Ala Gly Pro Asn Cys Gly Trp Cys 35 40 45 Thr Asn Ser Thr
Phe Leu Gln Glu Gly Met Pro Thr Ser Ala Arg Cys 50 55 60 Asp Asp
Leu Glu Ala Leu Lys Lys Lys Gly Cys Pro Pro Asp Asp Ile 65 70 75 80
Glu Asn Pro Arg Gly Ser Lys Asp Ile Lys Lys Asn Lys Asn Val Thr 85
90 95 Asn Arg Ser Lys Gly Thr Ala Glu Lys Leu Lys Pro Glu Asp Ile
Thr 100 105 110 Gln Ile Gln Pro Gln Gln Leu Val Leu Arg Leu Arg Ser
Gly Glu Pro 115 120 125 Gln Thr Phe Thr Leu Lys Phe Lys Arg Ala Glu
Asp Tyr Pro Ile Asp 130 135 140 Leu Tyr Tyr Leu Met Asp Leu Ser Tyr
Ser Met Lys Asp Asp Leu Glu 145 150 155 160 Asn Val Lys Ser Leu Gly
Thr Asp Leu Met Asn Glu Met Arg Arg Ile 165 170 175 Thr Ser Asp Phe
Arg Ile Gly Phe Gly Ser Phe Val Glu Lys Thr Val 180 185 190 Met Pro
Tyr Ile Ser Thr Thr Pro Ala Lys Leu Arg Asn Pro Cys Thr 195 200 205
Ser Glu Gln Asn Cys Thr Ser Pro Phe Ser Tyr Lys Asn Val Leu Ser 210
215 220 Leu Thr Asn Lys Gly Glu Val Phe Asn Glu Leu Val Gly Lys Gln
Arg 225 230 235 240 Ile Ser Gly Asn Leu Asp Ser Pro Glu Gly Gly Phe
Asp Ala Ile Met 245 250 255 Gln Val Ala Val Cys Gly Ser Leu Ile Gly
Trp Arg Asn Val Thr Arg 260 265 270 Leu Leu Val Phe Ser Thr Asp Ala
Gly Phe His Phe Ala Gly Asp Gly 275 280 285 Lys Leu Gly Gly Ile Val
Leu Pro Asn Asp Gly Gln Cys His Leu Glu 290 295 300 Asn Asn Met Tyr
Thr Met Ser His Tyr Tyr Asp Tyr Pro Ser Ile Ala 305 310 315 320 His
Leu Val Gln Lys Leu Ser Glu Asn Asn Ile Gln Thr Ile Phe Ala 325 330
335 Val Thr Glu Glu Phe Gln Pro Val Tyr Lys Glu Leu Lys Asn Leu Ile
340 345 350 Pro Lys Ser Ala Val Gly Thr Leu Ser Ala Asn Ser Ser Asn
Val Ile 355 360 365 Gln Leu Ile Ile Asp Ala Tyr Asn Ser Leu Ser Ser
Glu Val Ile Leu 370 375 380 Glu Asn Gly Lys Leu Ser Glu Gly Val Thr
Ile Ser Tyr Lys Ser Tyr 385 390 395 400 Cys Lys Asn Gly Val Asn Gly
Thr Gly Glu Asn Gly Arg Lys Cys Ser 405 410 415 Asn Ile Ser Ile Gly
Asp Glu Val Gln Phe Glu Ile Ser Ile Thr Ser 420 425 430 Asn Lys Cys
Pro Lys Lys Asp Ser Asp Ser Phe Lys Ile Arg Pro Leu 435 440 445 Gly
Phe Thr Glu Glu Val Glu Val Ile Leu Gln Tyr Ile Cys Glu Cys 450 455
460 Glu Cys Gln Ser Glu Gly Ile Pro Glu Ser Pro Lys Cys His Glu Gly
465 470 475 480 Asn Gly Thr Phe Glu Cys Gly Ala Cys Arg Cys Asn Glu
Gly Arg Val 485 490 495 Gly Arg His Cys Glu Cys Ser Thr Asp Glu Val
Asn Ser Glu Asp Met 500 505 510 Asp Ala Tyr Cys Arg Lys Glu Asn Ser
Ser Glu Ile Cys Ser Asn Asn 515 520 525 Gly Glu Cys Val Cys Gly Gln
Cys Val Cys Arg Lys Arg Asp Asn Thr 530 535 540 Asn Glu Ile Tyr Ser
Gly Lys Phe Cys Glu Cys Asp Asn Phe Asn Cys 545 550 555 560 Asp Arg
Ser Asn Gly Leu Ile Cys Gly Gly Asn Gly Val Cys Lys Cys 565 570 575
Arg Val Cys Glu Cys Asn Pro Asn Tyr Thr Gly Ser Ala Cys Asp Cys 580
585 590 Ser Leu Asp Thr Ser Thr Cys Glu Ala Ser Asn Gly Gln Ile Cys
Asn 595 600 605 Gly Arg Gly Ile Cys Glu Cys Gly Val Cys Lys Cys Thr
Asp Pro Lys 610 615 620 Phe Gln Gly Gln Thr Cys Glu Met Cys Gln Thr
Cys Leu Gly Val Cys 625 630 635 640 Ala Glu His Lys Glu Cys Val Gln
Cys Arg Ala Phe Asn Lys Gly Glu 645 650 655 Lys Lys Asp Thr Cys Thr
Gln Glu Cys Ser Tyr Phe Asn Ile Thr Lys 660 665 670 Val Glu Ser Arg
Asp Lys Leu Pro Gln Pro Val Gln Pro Asp Pro Val 675
680 685 Ser His Cys Lys Glu Lys Asp Val Asp Asp Cys Trp Phe Tyr Phe
Thr 690 695 700 Tyr Ser Val Asn Gly Asn Asn Glu Val Met Val His Val
Val Glu Asn 705 710 715 720 Pro Glu Cys Pro Thr Gly Pro Asp Ile Ile
Pro Ile Val Ala Gly Val 725 730 735 Val Ala Gly Ile Val Leu Ile Gly
Leu Ala Leu Leu Leu Ile Trp Lys 740 745 750 Leu Leu Met Ile Ile His
Asp Arg Arg Glu Phe Ala Lys Phe Glu Lys 755 760 765 Glu Lys Met Asn
Ala Lys Trp Asp Thr Gly Glu Asn Pro Ile Tyr Lys 770 775 780 Ser Ala
Val Thr Thr Val Val Asn Pro Lys Tyr Glu Gly Lys 785 790 795
83879DNAHomo Sapiens 8atcagacgcg cagaggaggc ggggccgcgg ctggtttcct
gccggggggc ggctctgggc 60cgccgagtcc cctcctcccg cccctgagga ggaggagccg
ccgccacccg ccgcgcccga 120cacccgggag gccccgccag cccgcgggag
aggcccagcg ggagtcgcgg aacagcaggc 180ccgagcccac cgcgccgggc
cccggacgcc gcgcggaaaa gatgaattta caaccaattt 240tctggattgg
actgatcagt tcagtttgct gtgtgtttgc tcaaacagat gaaaatagat
300gtttaaaagc aaatgccaaa tcatgtggag aatgtataca agcagggcca
aattgtgggt 360ggtgcacaaa ttcaacattt ttacaggaag gaatgcctac
ttctgcacga tgtgatgatt 420tagaagcctt aaaaaagaag ggttgccctc
cagatgacat agaaaatccc agaggctcca 480aagatataaa gaaaaataaa
aatgtaacca accgtagcaa aggaacagca gagaagctca 540agccagagga
tattactcag atccaaccac agcagttggt tttgcgatta agatcagggg
600agccacagac atttacatta aaattcaaga gagctgaaga ctatcccatt
gacctctact 660accttatgga cctgtcttac tcaatgaaag acgatttgga
gaatgtaaaa agtcttggaa 720cagatctgat gaatgaaatg aggaggatta
cttcggactt cagaattgga tttggctcat 780ttgtggaaaa gactgtgatg
ccttacatta gcacaacacc agctaagctc aggaaccctt 840gcacaagtga
acagaactgc accagcccat ttagctacaa aaatgtgctc agtcttacta
900ataaaggaga agtatttaat gaacttgttg gaaaacagcg catatctgga
aatttggatt 960ctccagaagg tggtttcgat gccatcatgc aagttgcagt
ttgtggatca ctgattggct 1020ggaggaatgt tacacggctg ctggtgtttt
ccacagatgc cgggtttcac tttgctggag 1080atgggaaact tggtggcatt
gttttaccaa atgatggaca atgtcacctg gaaaataata 1140tgtacacaat
gagccattat tatgattatc cttctattgc tcaccttgtc cagaaactga
1200gtgaaaataa tattcagaca atttttgcag ttactgaaga atttcagcct
gtttacaagg 1260agctgaaaaa cttgatccct aagtcagcag taggaacatt
atctgcaaat tctagcaatg 1320taattcagtt gatcattgat gcatacaatt
ccctttcctc agaagtcatt ttggaaaacg 1380gcaaattgtc agaaggcgta
acaataagtt acaaatctta ctgcaagaac ggggtgaatg 1440gaacagggga
aaatggaaga aaatgttcca atatttccat tggagatgag gttcaatttg
1500aaattagcat aacttcaaat aagtgtccaa aaaaggattc tgacagcttt
aaaattaggc 1560ctctgggctt tacggaggaa gtagaggtta ttcttcagta
catctgtgaa tgtgaatgcc 1620aaagcgaagg catccctgaa agtcccaagt
gtcatgaagg aaatgggaca tttgagtgtg 1680gcgcgtgcag gtgcaatgaa
gggcgtgttg gtagacattg tgaatgcagc acagatgaag 1740ttaacagtga
agacatggat gcttactgca ggaaagaaaa cagttcagaa atctgcagta
1800acaatggaga gtgcgtctgc ggacagtgtg tttgtaggaa gagggataat
acaaatgaaa 1860tttattctgg caaattctgc gagtgtgata atttcaactg
tgatagatcc aatggcttaa 1920tttgtggagg aaatggtgtt tgcaagtgtc
gtgtgtgtga gtgcaacccc aactacactg 1980gcagtgcatg tgactgttct
ttggatacta gtacttgtga agccagcaac ggacagatct 2040gcaatggccg
gggcatctgc gagtgtggtg tctgtaagtg tacagatccg aagtttcaag
2100ggcaaacgtg tgagatgtgt cagacctgcc ttggtgtctg tgctgagcat
aaagaatgtg 2160ttcagtgcag agccttcaat aaaggagaaa agaaagacac
atgcacacag gaatgttcct 2220attttaacat taccaaggta gaaagtcggg
acaaattacc ccagccggtc caacctgatc 2280ctgtgtccca ttgtaaggag
aaggatgttg acgactgttg gttctatttt acgtattcag 2340tgaatgggaa
caacgaggtc atggttcatg ttgtggagaa tccagagtgt cccactggtc
2400cagacatcat tccaattgta gctggtgtgg ttgctggaat tgttcttatt
ggccttgcat 2460tactgctgat atggaagctt ttaatgataa ttcatgacag
aagggagttt gctaaatttg 2520aaaaggagaa aatgaatgcc aaatgggaca
cgggtgaaaa tcctatttat aagagtgccg 2580taacaactgt ggtcaatccg
aagtatgagg gaaaatgagt actgcccgtg caaatcccac 2640aacactgaat
gcaaagtagc aatttccata gtcacagtta ggtagcttta gggcaatatt
2700gccatggttt tactcatgtg caggttttga aaatgtacaa tatgtataat
ttttaaaatg 2760ttttattatt ttgaaaataa tgttgtaatt catgccaggg
actgacaaaa gacttgagac 2820aggatggtta ctcttgtcag ctaaggtcac
attgtgcctt tttgaccttt tcttcctgga 2880ctattgaaat caagcttatt
ggattaagtg atatttctat agcgattgaa agggcaatag 2940ttaaagtaat
gagcatgatg agagtttctg ttaatcatgt attaaaactg atttttagct
3000ttacaaatat gtcagtttgc agttatgcag aatccaaagt aaatgtcctg
ctagctagtt 3060aaggattgtt ttaaatctgt tattttgcta tttgcctgtt
agacatgact gatgacatat 3120ctgaaagaca agtatgttga gagttgctgg
tgtaaaatac gtttgaaata gttgatctac 3180aaaggccatg ggaaaaattc
agagagttag gaaggaaaaa ccaatagctt taaaacctgt 3240gtgccatttt
aagagttact taatgtttgg taacttttat gccttcactt tacaaattca
3300agccttagat aaaagaaccg agcaattttc tgctaaaaag tccttgattt
agcactattt 3360acatacaggc catactttac aaagtatttg ctgaatgggg
accttttgag ttgaatttat 3420tttattattt ttattttgtt taatgtctgg
tgctttctgt cacctcttct aatcttttaa 3480tgtatttgtt tgcaattttg
gggtaagact ttttttatga gtactttttc tttgaagttt 3540tagcggtcaa
tttgcctttt taatgaacat gtgaagttat actgtggcta tgcaacagct
3600ctcacctacg cgagtcttac tttgagttag tgccataaca gaccactgta
tgtttacttc 3660tcaccatttg agttgcccat cttgtttcac actagtcaca
ttcttgtttt aagtgccttt 3720agttttaaca gttcactttt tacagtgcta
tttactgaag ttatttatta aatatgccta 3780aaatacttaa atcggatgtc
ttgactctga tgtattttat caggttgtgt gcatgaaatt 3840tttatagatt
aaagaagttg aggaaaagca aaaaaaaaa 38799788PRTHomo Sapiens 9Met Arg
Ala Arg Pro Arg Pro Arg Pro Leu Trp Ala Thr Val Leu Ala 1 5 10 15
Leu Gly Ala Leu Ala Gly Val Gly Val Gly Gly Pro Asn Ile Cys Thr 20
25 30 Thr Arg Gly Val Ser Ser Cys Gln Gln Cys Leu Ala Val Ser Pro
Met 35 40 45 Cys Ala Trp Cys Ser Asp Glu Ala Leu Pro Leu Gly Ser
Pro Arg Cys 50 55 60 Asp Leu Lys Glu Asn Leu Leu Lys Asp Asn Cys
Ala Pro Glu Ser Ile 65 70 75 80 Glu Phe Pro Val Ser Glu Ala Arg Val
Leu Glu Asp Arg Pro Leu Ser 85 90 95 Asp Lys Gly Ser Gly Asp Ser
Ser Gln Val Thr Gln Val Ser Pro Gln 100 105 110 Arg Ile Ala Leu Arg
Leu Arg Pro Asp Asp Ser Lys Asn Phe Ser Ile 115 120 125 Gln Val Arg
Gln Val Glu Asp Tyr Pro Val Asp Ile Tyr Tyr Leu Met 130 135 140 Asp
Leu Ser Tyr Ser Met Lys Asp Asp Leu Trp Ser Ile Gln Asn Leu 145 150
155 160 Gly Thr Lys Leu Ala Thr Gln Met Arg Lys Leu Thr Ser Asn Leu
Arg 165 170 175 Ile Gly Phe Gly Ala Phe Val Asp Lys Pro Val Ser Pro
Tyr Met Tyr 180 185 190 Ile Ser Pro Pro Glu Ala Leu Glu Asn Pro Cys
Tyr Asp Met Lys Thr 195 200 205 Thr Cys Leu Pro Met Phe Gly Tyr Lys
His Val Leu Thr Leu Thr Asp 210 215 220 Gln Val Thr Arg Phe Asn Glu
Glu Val Lys Lys Gln Ser Val Ser Arg 225 230 235 240 Asn Arg Asp Ala
Pro Glu Gly Gly Phe Asp Ala Ile Met Gln Ala Thr 245 250 255 Val Cys
Asp Glu Lys Ile Gly Trp Arg Asn Asp Ala Ser His Leu Leu 260 265 270
Val Phe Thr Thr Asp Ala Lys Thr His Ile Ala Leu Asp Gly Arg Leu 275
280 285 Ala Gly Ile Val Gln Pro Asn Asp Gly Gln Cys His Val Gly Ser
Asp 290 295 300 Asn His Tyr Ser Ala Ser Thr Thr Met Asp Tyr Pro Ser
Leu Gly Leu 305 310 315 320 Met Thr Glu Lys Leu Ser Gln Lys Asn Ile
Asn Leu Ile Phe Ala Val 325 330 335 Thr Glu Asn Val Val Asn Leu Tyr
Gln Asn Tyr Ser Glu Leu Ile Pro 340 345 350 Gly Thr Thr Val Gly Val
Leu Ser Met Asp Ser Ser Asn Val Leu Gln 355 360 365 Leu Ile Val Asp
Ala Tyr Gly Lys Ile Arg Ser Lys Val Glu Leu Glu 370 375 380 Val Arg
Asp Leu Pro Glu Glu Leu Ser Leu Ser Phe Asn Ala Thr Cys 385 390 395
400 Leu Asn Asn Glu Val Ile Pro Gly Leu Lys Ser Cys Met Gly Leu Lys
405 410 415 Ile Gly Asp Thr Val Ser Phe Ser Ile Glu Ala Lys Val Arg
Gly Cys 420 425 430 Pro Gln Glu Lys Glu Lys Ser Phe Thr Ile Lys Pro
Val Gly Phe Lys 435 440 445 Asp Ser Leu Ile Val Gln Val Thr Phe Asp
Cys Asp Cys Ala Cys Gln 450 455 460 Ala Gln Ala Glu Pro Asn Ser His
Arg Cys Asn Asn Gly Asn Gly Thr 465 470 475 480 Phe Glu Cys Gly Val
Cys Arg Cys Gly Pro Gly Trp Leu Gly Ser Gln 485 490 495 Cys Glu Cys
Ser Glu Glu Asp Tyr Arg Pro Ser Gln Gln Asp Glu Cys 500 505 510 Ser
Pro Arg Glu Gly Gln Pro Val Cys Ser Gln Arg Gly Glu Cys Leu 515 520
525 Cys Gly Gln Cys Val Cys His Ser Ser Asp Phe Gly Lys Ile Thr Gly
530 535 540 Lys Tyr Cys Glu Cys Asp Asp Phe Ser Cys Val Arg Tyr Lys
Gly Glu 545 550 555 560 Met Cys Ser Gly His Gly Gln Cys Ser Cys Gly
Asp Cys Leu Cys Asp 565 570 575 Ser Asp Trp Thr Gly Tyr Tyr Cys Asn
Cys Thr Thr Arg Thr Asp Thr 580 585 590 Cys Met Ser Ser Asn Gly Leu
Leu Cys Ser Gly Arg Gly Lys Cys Glu 595 600 605 Cys Gly Ser Cys Val
Cys Ile Gln Pro Gly Ser Tyr Gly Asp Thr Cys 610 615 620 Glu Lys Cys
Pro Thr Cys Pro Asp Ala Cys Thr Phe Lys Lys Glu Cys 625 630 635 640
Val Glu Cys Lys Lys Phe Asp Arg Gly Ala Leu His Asp Glu Asn Thr 645
650 655 Cys Asn Arg Tyr Cys Arg Asp Glu Ile Glu Ser Val Lys Glu Leu
Lys 660 665 670 Asp Thr Gly Lys Asp Ala Val Asn Cys Thr Tyr Lys Asn
Glu Asp Asp 675 680 685 Cys Val Val Arg Phe Gln Tyr Tyr Glu Asp Ser
Ser Gly Lys Ser Ile 690 695 700 Leu Tyr Val Val Glu Glu Pro Glu Cys
Pro Lys Gly Pro Asp Ile Leu 705 710 715 720 Val Val Leu Leu Ser Val
Met Gly Ala Ile Leu Leu Ile Gly Leu Ala 725 730 735 Ala Leu Leu Ile
Trp Lys Leu Leu Ile Thr Ile His Asp Arg Lys Glu 740 745 750 Phe Ala
Lys Phe Glu Glu Glu Arg Ala Arg Ala Lys Trp Asp Thr Ala 755 760 765
Asn Asn Pro Leu Tyr Lys Glu Ala Thr Ser Thr Phe Thr Asn Ile Thr 770
775 780 Tyr Arg Gly Thr 785 104894DNAHomo Sapiens 10cgccgcggga
ggcggacgag atgcgagcgc ggccgcggcc ccggccgctc tgggcgactg 60tgctggcgct
gggggcgctg gcgggcgttg gcgtaggagg gcccaacatc tgtaccacgc
120gaggtgtgag ctcctgccag cagtgcctgg ctgtgagccc catgtgtgcc
tggtgctctg 180atgaggccct gcctctgggc tcacctcgct gtgacctgaa
ggagaatctg ctgaaggata 240actgtgcccc agaatccatc gagttcccag
tgagtgaggc ccgagtacta gaggacaggc 300ccctcagcga caagggctct
ggagacagct cccaggtcac tcaagtcagt ccccagagga 360ttgcactccg
gctccggcca gatgattcga agaatttctc catccaagtg cggcaggtgg
420aggattaccc tgtggacatc tactacttga tggacctgtc ttactccatg
aaggatgatc 480tgtggagcat ccagaacctg ggtaccaagc tggccaccca
gatgcgaaag ctcaccagta 540acctgcggat tggcttcggg gcatttgtgg
acaagcctgt gtcaccatac atgtatatct 600ccccaccaga ggccctcgaa
aacccctgct atgatatgaa gaccacctgc ttgcccatgt 660ttggctacaa
acacgtgctg acgctaactg accaggtgac ccgcttcaat gaggaagtga
720agaagcagag tgtgtcacgg aaccgagatg ccccagaggg tggctttgat
gccatcatgc 780aggctacagt ctgtgatgaa aagattggct ggaggaatga
tgcatcccac ttgctggtgt 840ttaccactga tgccaagact catatagcat
tggacggaag gctggcaggc attgtccagc 900ctaatgacgg gcagtgtcat
gttggtagtg acaatcatta ctctgcctcc actaccatgg 960attatccctc
tttggggctg atgactgaga agctatccca gaaaaacatc aatttgatct
1020ttgcagtgac tgaaaatgta gtcaatctct atcagaacta tagtgagctc
atcccaggga 1080ccacagttgg ggttctgtcc atggattcca gcaatgtcct
ccagctcatt gttgatgctt 1140atgggaaaat ccgttctaaa gtagagctgg
aagtgcgtga cctccctgaa gagttgtctc 1200tatccttcaa tgccacctgc
ctcaacaatg aggtcatccc tggcctcaag tcttgtatgg 1260gactcaagat
tggagacacg gtgagcttca gcattgaggc caaggtgcga ggctgtcccc
1320aggagaagga gaagtccttt accataaagc ccgtgggctt caaggacagc
ctgatcgtcc 1380aggtcacctt tgattgtgac tgtgcctgcc aggcccaagc
tgaacctaat agccatcgct 1440gcaacaatgg caatgggacc tttgagtgtg
gggtatgccg ttgtgggcct ggctggctgg 1500gatcccagtg tgagtgctca
gaggaggact atcgcccttc ccagcaggac gaatgcagcc 1560cccgggaggg
tcagcccgtc tgcagccagc ggggcgagtg cctctgtggt caatgtgtct
1620gccacagcag tgactttggc aagatcacgg gcaagtactg cgagtgtgac
gacttctcct 1680gtgtccgcta caagggggag atgtgctcag gccatggcca
gtgcagctgt ggggactgcc 1740tgtgtgactc cgactggacc ggctactact
gcaactgtac cacgcgtact gacacctgca 1800tgtccagcaa tgggctgctg
tgcagcggcc gcggcaagtg tgaatgtggc agctgtgtct 1860gtatccagcc
gggctcctat ggggacacct gtgagaagtg ccccacctgc ccagatgcct
1920gcacctttaa gaaagaatgt gtggagtgta agaagtttga ccggggagcc
ctacatgacg 1980aaaatacctg caaccgttac tgccgtgacg agattgagtc
agtgaaagag cttaaggaca 2040ctggcaagga tgcagtgaat tgtacctata
agaatgagga tgactgtgtc gtcagattcc 2100agtactatga agattctagt
ggaaagtcca tcctgtatgt ggtagaagag ccagagtgtc 2160ccaagggccc
tgacatcctg gtggtcctgc tctcagtgat gggggccatt ctgctcattg
2220gccttgccgc cctgctcatc tggaaactcc tcatcaccat ccacgaccga
aaagaattcg 2280ctaaatttga ggaagaacgc gccagagcaa aatgggacac
agccaacaac ccactgtata 2340aagaggccac gtctaccttc accaatatca
cgtaccgggg cacttaatga taagcagtca 2400tcctcagatc attatcagcc
tgtgccacga ttgcaggagt ccctgccatc atgtttacag 2460aggacagtat
ttgtggggag ggatttgggg ctcagagtgg ggtaggttgg gagaatgtca
2520gtatgtggaa gtgtgggtct gtgtgtgtgt atgtgggggt ctgtgtgttt
atgtgtgtgt 2580gttgtgtgtg ggagtgtgta atttaaaatt gtgatgtgtc
ctgataagct gagctcctta 2640gcctttgtcc cagaatgcct cctgcaggga
ttcttcctgc ttagcttgag ggtgactatg 2700gagctgagca ggtgttcttc
attacctcag tgagaagcca gctttcctca tcaggccatt 2760gtccctgaag
agaagggcag ggctgaggcc tctcattcca gaggaaggga caccaagcct
2820tggctctacc ctgagttcat aaatttatgg ttctcaggcc tgactctcag
cagctatggt 2880aggaactgct gggcttggca gcccgggtca tctgtacctc
tgcctccttt cccctccctc 2940aggccgaagg aggagtcagg gagagctgaa
ctattagagc tgcctgtgcc ttttgccatc 3000ccctcaaccc agctatggtt
ctctcgcaag ggaagtcctt gcaagctaat tctttgacct 3060gttgggagtg
aggatgtctg ggccactcag gggtcattca tggcctgggg gatgtaccag
3120catctcccag ttcataatca caacccttca gatttgcctt attggcagct
ctactctgga 3180ggtttgttta gaagaagtgt gtcaccctta ggccagcacc
atctctttac ctcctaattc 3240cacaccctca ctgctgtaga catttgctat
gagctgggga tgtctctcat gaccaaatgc 3300ttttcctcaa agggagagag
tgctattgta gagccagagg tctggcccta tgcttccggc 3360ctcctgtccc
tcatccatag cacctccaca tacctggccc tgtgccttgg tgtgctgtat
3420ccatccatgg ggctgattgt atttaccttc tacctcttgg ctgccttgtg
aaggaattat 3480tcccatgagt tggctgggaa taagtgccag gatggaatga
tgggtcagtt gtatcagcac 3540gtgtggcctg ttcttctatg ggttggacaa
cctcatttta actcagtctt taatctgaga 3600ggccacagtg caattttatt
ttatttttct catgatgagg ttttcttaac ttaaaagaac 3660atgtatataa
acatgcttgc attatatttg taaatttatg tgatggcaaa gaaggagagc
3720ataggaaacc acacagactt gggcagggta cagacactcc cacttggcat
cattcacagc 3780aagtcactgg ccagtggctg gatctgtgag gggctctctc
atgatagaag gctatgggga 3840tagatgtgtg gacacattgg acctttcctg
aggaagaggg actgttcttt tgtcccagaa 3900aagcagtggc tccattggtg
ttgacataca tccaacatta aaagccaccc ccaaatgccc 3960aagaaaaaaa
gaaagactta tcaacatttg ttccatgagc agaaaactgg agctctggcc
4020tcagtgttac agctaaataa tctttaatta aggcaagtca ctttcttctt
cttaaagctg 4080ttttctagtt tgagaaatga tgggatttta gcagccagtc
ttgaaggtct ctttcagtat 4140caacattcta agatgctggg acttactgtg
tcatcaaatg tgcggttaag attctctggg 4200atattgatac tgtttgtgtt
tttagttggg agatctgaga gacctggctt tggcaagagc 4260agatgtcatt
ccatatcacc tttctcaatg aaagtctcat tctatcctct ctccaaaccc
4320gttttccaac atttgttaat agttacgtct ctcctgatgt agcacttaag
cttcatttag 4380ttattatttc tttcttcact ttgcacacat ttgcatccac
atattaggga agaggaatcc 4440ataagtagct gaaatatcta ttctgtatta
ttgtgttaac attgagaata agccttggaa 4500ttagatatgg ggcaatgact
gagccctgtc tcacccatgg attactcctt actgtaggga 4560atggcagtat
ggtagaggga taaatagggg gcggggaggg atagtcatgg atccaagaag
4620tccttagaaa tagtggcagg gaacaggtgt ggaagctcat gcctgtaatt
ataaccttca 4680gctactaaga caggtgtggt ggctcacgcc tgtgattata
atcttcagtt actaagacag 4740agtccatgag agtgttaatg ggacattttc
tttagataag atgttttata tgaagaaact 4800gtatcaaagg gggaagaaaa
tgtatttaac aggtgaatca aatcaggaat cttgtctgag 4860ctactggaat
gaagttcaca ggtcttgaag acca 489411799PRTHomo Sapiens 11Met Pro Arg
Ala Pro Ala Pro Leu Tyr Ala Cys Leu Leu Gly Leu Cys 1 5 10 15 Ala
Leu Leu Pro Arg Leu Ala Gly Leu Asn Ile Cys Thr Ser Gly Ser 20 25
30 Ala Thr Ser Cys Glu Glu Cys Leu Leu Ile His Pro Lys Cys Ala
Trp 35 40 45 Cys Ser Lys Glu Asp Phe Gly Ser Pro Arg Ser Ile Thr
Ser Arg Cys 50 55 60 Asp Leu Arg Ala Asn Leu Val Lys Asn Gly Cys
Gly Gly Glu Ile Glu 65 70 75 80 Ser Pro Ala Ser Ser Phe His Val Leu
Arg Ser Leu Pro Leu Ser Ser 85 90 95 Lys Gly Ser Gly Ser Ala Gly
Trp Asp Val Ile Gln Met Thr Pro Gln 100 105 110 Glu Ile Ala Val Asn
Leu Arg Pro Gly Asp Lys Thr Thr Phe Gln Leu 115 120 125 Gln Val Arg
Gln Val Glu Asp Tyr Pro Val Asp Leu Tyr Tyr Leu Met 130 135 140 Asp
Leu Ser Leu Ser Met Lys Asp Asp Leu Asp Asn Ile Arg Ser Leu 145 150
155 160 Gly Thr Lys Leu Ala Glu Glu Met Arg Lys Leu Thr Ser Asn Phe
Arg 165 170 175 Leu Gly Phe Gly Ser Phe Val Asp Lys Asp Ile Ser Pro
Phe Ser Tyr 180 185 190 Thr Ala Pro Arg Tyr Gln Thr Asn Pro Cys Ile
Gly Tyr Lys Leu Phe 195 200 205 Pro Asn Cys Val Pro Ser Phe Gly Phe
Arg His Leu Leu Pro Leu Thr 210 215 220 Asp Arg Val Asp Ser Phe Asn
Glu Glu Val Arg Lys Gln Arg Val Ser 225 230 235 240 Arg Asn Arg Asp
Ala Pro Glu Gly Gly Phe Asp Ala Val Leu Gln Ala 245 250 255 Ala Val
Cys Lys Glu Lys Ile Gly Trp Arg Lys Asp Ala Leu His Leu 260 265 270
Leu Val Phe Thr Thr Asp Asp Val Pro His Ile Ala Leu Asp Gly Lys 275
280 285 Leu Gly Gly Leu Val Gln Pro His Asp Gly Gln Cys His Leu Asn
Glu 290 295 300 Ala Asn Glu Tyr Thr Ala Ser Asn Gln Met Asp Tyr Pro
Ser Leu Ala 305 310 315 320 Leu Leu Gly Glu Lys Leu Ala Glu Asn Asn
Ile Asn Leu Ile Phe Ala 325 330 335 Val Thr Lys Asn His Tyr Met Leu
Tyr Lys Asn Phe Thr Ala Leu Ile 340 345 350 Pro Gly Thr Thr Val Glu
Ile Leu Asp Gly Asp Ser Lys Asn Ile Ile 355 360 365 Gln Leu Ile Ile
Asn Ala Tyr Asn Ser Ile Arg Ser Lys Val Glu Leu 370 375 380 Ser Val
Trp Asp Gln Pro Glu Asp Leu Asn Leu Phe Phe Thr Ala Thr 385 390 395
400 Cys Gln Asp Gly Val Ser Tyr Pro Gly Gln Arg Lys Cys Glu Gly Leu
405 410 415 Lys Ile Gly Asp Thr Ala Ser Phe Glu Val Ser Leu Glu Ala
Arg Ser 420 425 430 Cys Pro Ser Arg His Thr Glu His Val Phe Ala Leu
Arg Pro Val Gly 435 440 445 Phe Arg Asp Ser Leu Glu Val Gly Val Thr
Tyr Asn Cys Thr Cys Gly 450 455 460 Cys Ser Val Gly Leu Glu Pro Asn
Ser Ala Arg Cys Asn Gly Ser Gly 465 470 475 480 Thr Tyr Val Cys Gly
Leu Cys Glu Cys Ser Pro Gly Tyr Leu Gly Thr 485 490 495 Arg Cys Glu
Cys Gln Asp Gly Glu Asn Gln Ser Val Tyr Gln Asn Leu 500 505 510 Cys
Arg Glu Ala Glu Gly Lys Pro Leu Cys Ser Gly Arg Gly Asp Cys 515 520
525 Ser Cys Asn Gln Cys Ser Cys Phe Glu Ser Glu Phe Gly Lys Ile Tyr
530 535 540 Gly Pro Phe Cys Glu Cys Asp Asn Phe Ser Cys Ala Arg Asn
Lys Gly 545 550 555 560 Val Leu Cys Ser Gly His Gly Glu Cys His Cys
Gly Glu Cys Lys Cys 565 570 575 His Ala Gly Tyr Ile Gly Asp Asn Cys
Asn Cys Ser Thr Asp Ile Ser 580 585 590 Thr Cys Arg Gly Arg Asp Gly
Gln Ile Cys Ser Glu Arg Gly His Cys 595 600 605 Leu Cys Gly Gln Cys
Gln Cys Thr Glu Pro Gly Ala Phe Gly Glu Met 610 615 620 Cys Glu Lys
Cys Pro Thr Cys Pro Asp Ala Cys Ser Thr Lys Arg Asp 625 630 635 640
Cys Val Glu Cys Leu Leu Leu His Ser Gly Lys Pro Asp Asn Gln Thr 645
650 655 Cys His Ser Leu Cys Arg Asp Glu Val Ile Thr Trp Val Asp Thr
Ile 660 665 670 Val Lys Asp Asp Gln Glu Ala Val Leu Cys Phe Tyr Lys
Thr Ala Lys 675 680 685 Asp Cys Val Met Met Phe Thr Tyr Val Glu Leu
Pro Ser Gly Lys Ser 690 695 700 Asn Leu Thr Val Leu Arg Glu Pro Glu
Cys Gly Asn Thr Pro Asn Ala 705 710 715 720 Met Thr Ile Leu Leu Ala
Val Val Gly Ser Ile Leu Leu Val Gly Leu 725 730 735 Ala Leu Leu Ala
Ile Trp Lys Leu Leu Val Thr Ile His Asp Arg Arg 740 745 750 Glu Phe
Ala Lys Phe Gln Ser Glu Arg Ser Arg Ala Arg Tyr Glu Met 755 760 765
Ala Ser Asn Pro Leu Tyr Arg Lys Pro Ile Ser Thr His Thr Val Asp 770
775 780 Phe Thr Phe Asn Lys Phe Asn Lys Ser Tyr Asn Gly Thr Val Asp
785 790 795 123392DNAHomo Sapiens 12gcggagccag cccctcccct
acccggagca gcccgctggg gccgtcccga gcggcgacac 60actaggagtc ccggccggcc
agccagggca gccgcggtcc cgggactcgg ccgtgagtgc 120tgcgggacgg
atggtggcgg cggggcgcgg gccagcgcgg gcgccgtgag ccggagctgc
180gcgcggggca tgcggctgcg gcccccggcc ctcggccccc gcgctccggc
cccagccccg 240gccgccggcc cccgcggagt gcagcgaccg cgccgccgct
gagggaggcg ccccaccatg 300ccgcgggccc cggcgccgct gtacgcctgc
ctcctggggc tctgcgcgct cctgccccgg 360ctcgcaggtc tcaacatatg
cactagtgga agtgccacct catgtgaaga atgtctgcta 420atccacccaa
aatgtgcctg gtgctccaaa gaggacttcg gaagcccacg gtccatcacc
480tctcggtgtg atctgagggc aaaccttgtc aaaaatggct gtggaggtga
gatagagagc 540ccagccagca gcttccatgt cctgaggagc ctgcccctca
gcagcaaggg ttcgggctct 600gcaggctggg acgtcattca gatgacacca
caggagattg ccgtgaacct ccggcccggt 660gacaagacca ccttccagct
acaggttcgc caggtggagg actatcctgt ggacctgtac 720tacctgatgg
acctctccct gtccatgaag gatgacttgg acaatatccg gagcctgggc
780accaaactcg cggaggagat gaggaagctc accagcaact tccggttggg
atttgggtct 840tttgttgata aggacatctc tcctttctcc tacacggcac
cgaggtacca gaccaatccg 900tgcattggtt acaagttgtt tccaaattgc
gtcccctcct ttgggttccg ccatctgctg 960cctctcacag acagagtgga
cagcttcaat gaggaagttc ggaaacagag ggtgtcccgg 1020aaccgagatg
cccctgaggg gggctttgat gcagtactcc aggcagccgt ctgcaaggag
1080aagattggct ggcgaaagga tgcactgcat ttgctggtgt tcacaacaga
tgatgtgccc 1140cacatcgcat tggatggaaa attgggaggc ctggtgcagc
cacacgatgg ccagtgccac 1200ctgaacgagg ccaacgagta cactgcatcc
aaccagatgg actatccatc ccttgccttg 1260cttggagaga aattggcaga
gaacaacatc aacctcatct ttgcagtgac aaaaaaccat 1320tatatgctgt
acaagaattt tacagccctg atacctggaa caacggtgga gattttagat
1380ggagactcca aaaatattat tcaactgatt attaatgcat acaatagtat
ccggtctaaa 1440gtggagttgt cagtctggga tcagcctgag gatcttaatc
tcttctttac tgctacctgc 1500caagatgggg tatcctatcc tggtcagagg
aagtgtgagg gtctgaagat tggggacacg 1560gcatcttttg aagtatcatt
ggaggcccga agctgtccca gcagacacac ggagcatgtg 1620tttgccctgc
ggccggtggg attccgggac agcctggagg tgggggtcac ctacaactgc
1680acgtgcggct gcagcgtggg gctggaaccc aacagtgcca ggtgcaacgg
gagcgggacc 1740tatgtctgcg gcctgtgtga gtgcagcccc ggctacctgg
gcaccaggtg cgagtgccag 1800gatggggaga accagagcgt gtaccagaac
ctgtgccggg aggcagaggg caagccactg 1860tgcagcgggc gtggggactg
cagctgcaac cagtgctcct gcttcgagag cgagttcggc 1920aagatctatg
ggcctttctg tgagtgcgac aacttctcct gtgccaggaa caagggagtc
1980ctctgctcag gccatggcga gtgtcactgc ggggaatgca agtgccatgc
aggttacatc 2040ggggacaact gtaactgctc gacagacatc agcacatgcc
ggggcagaga tggccagatc 2100tgcagcgagc gtgggcactg tctctgtggg
cagtgccaat gcacggagcc gggggccttt 2160ggggagatgt gtgagaagtg
ccccacctgc ccggatgcat gcagcaccaa gagagattgc 2220gtcgagtgcc
tgctgctcca ctctgggaaa cctgacaacc agacctgcca cagcctatgc
2280agggatgagg tgatcacatg ggtggacacc atcgtgaaag atgaccagga
ggctgtgcta 2340tgtttctaca aaaccgccaa ggactgcgtc atgatgttca
cctatgtgga gctccccagt 2400gggaagtcca acctgaccgt cctcagggag
ccagagtgtg gaaacacccc caacgccatg 2460accatcctcc tggctgtggt
cggtagcatc ctccttgttg ggcttgcact cctggctatc 2520tggaagctgc
ttgtcaccat ccacgaccgg agggagtttg caaagtttca gagcgagcga
2580tccagggccc gctatgaaat ggcttcaaat ccattataca gaaagcctat
ctccacgcac 2640actgtggact tcaccttcaa caagttcaac aaatcctaca
atggcactgt ggactgatgt 2700ttccttctcc gaggggctgg agcggggatc
tgatgaaaag gtcagactga aacgccttgc 2760acggctgctc ggcttgatca
cagctcccta ggtaggcacc acagagaaga ccttctagtg 2820agcctgggcc
aggagcccac agtgcctgta caggaaggtg cctggccatg tcacctggct
2880gctaggccag agccatgcca ggctgcgtcc ctccgagctt gggataaagc
aaggggacct 2940tggcactctc agctttccct gccacatcca gcttgttgtc
ccaatgaaat actgagatgc 3000tgggctgtct ctcccttcca ggaatgctgg
gcccccagcc tggccagaca agacgactgt 3060caggaagggt cggagtctgt
aaaaccagca tacagtttgg cttttttcac attgatcatt 3120tttatatgaa
ataaaaagat cctgcattta tggtgtagtt ctgagtcctg agacttttcc
3180gcgtgatggc tatgccttgc acacaggtgt tggtgatggg gctgttgaga
tgcctgttga 3240aggtacatcg tttgcaaatg tcagtttcct ctcctgtccg
tgtttgttta gtacttttat 3300aatgaaaaga aacaagattg tttgggattg
gaagtaaaga ttaaaaccaa aagaatttgt 3360gtttgtctga taaaaaaaaa
aaaaaaaaaa aa 33921312PRTArtificial sequenceSynthetic Construct
13Gly Arg Gly Asp Ser Val Val Tyr Gly Leu Arg Ser 1 5 10
1425RNAArtificial sequenceSynthetic Construct 14ccacagccac
aagcagucca gauua 251525RNAArtificial sequenceSynthetic Construct
15ccuaagucag caguaggaac auuau 251625RNAArtificial sequenceSynthetic
Construct 16ccuccagcuc auuguugaug cuuau 251725RNAArtificial
sequenceSynthetic Construct 17agaaugucug cuaauccacc caaaa
251825RNAArtificial sequenceSynthetic Construct 18cugagggcaa
accuugucaa aaaug 251925RNAArtificial sequenceSynthetic Construct
19gaaauggcuu caaauccauu auaca 252025RNAArtificial sequenceSynthetic
Construct 20gaacaaggag ucgucagaaa cucca 25
* * * * *