U.S. patent application number 15/750880 was filed with the patent office on 2018-08-09 for super resolution imaging of protein-protein interactions.
The applicant listed for this patent is President and Fellows of Harvard College. Invention is credited to Maier S. Avendano Amado, Juanita M. Lara Gutierrez, Peng Yin.
Application Number | 20180224461 15/750880 |
Document ID | / |
Family ID | 57984638 |
Filed Date | 2018-08-09 |
United States Patent
Application |
20180224461 |
Kind Code |
A1 |
Lara Gutierrez; Juanita M. ;
et al. |
August 9, 2018 |
SUPER RESOLUTION IMAGING OF PROTEIN-PROTEIN INTERACTIONS
Abstract
This disclosure provides methods and compositions for detecting
intramolecular and intermolecular interactions, such as
protein-protein interactions. These methods detect such
interactions at sub-diffraction distances, and thus are referred to
as super-resolution detection and imaging methods.
Inventors: |
Lara Gutierrez; Juanita M.;
(Brookline, MA) ; Avendano Amado; Maier S.;
(Brookline, MA) ; Yin; Peng; (Brookline,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
President and Fellows of Harvard College |
Cambridge |
MA |
US |
|
|
Family ID: |
57984638 |
Appl. No.: |
15/750880 |
Filed: |
August 5, 2016 |
PCT Filed: |
August 5, 2016 |
PCT NO: |
PCT/US2016/045756 |
371 Date: |
February 7, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62202327 |
Aug 7, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6897 20130101;
G01N 33/582 20130101; G01N 2458/10 20130101; G01N 33/6845 20130101;
C12Q 1/6816 20130101 |
International
Class: |
G01N 33/68 20060101
G01N033/68; G01N 33/58 20060101 G01N033/58 |
Goverment Interests
FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under
U01-MH106011-01 and 5R01EB018659-02 awarded by National Institutes
of Health and under CCF-1317291 awarded by National Science
Foundation and under N00014-13-1-0593 awarded by U.S. Department of
Defense, Office of Naval Research. The government has certain
rights in the invention.
Claims
1. A composition comprising: (a) a first binding
partner-oligonucleotide conjugate comprising a binding partner
linked to an oligonucleotide that comprises a half-docking domain,
a stability domain, and optionally a spacer domain; (b) a second
binding partner-oligonucleotide conjugate comprising a binding
partner linked to an oligonucleotide that comprises a half-docking
domain, a stability domain, and optionally a spacer domain; wherein
the stability domains of (a) and (b) are complementary to each
other, and wherein the half-docking domains of (a) and (b) combine
linearly to form a full docking domain; and (c) an imager strand
comprising a 5' domain, a 3' domain, and a linker domain located
between the 5' domain and the 3'domain, wherein the 5' domain is
complementary to the half-docking domain of (a) and the 3' domain
is complementary to the half-docking domain of (b).
2. The composition of claim 1, wherein each of the binding partners
of (a) and (b) is an antibody or antigen-binding antibody
fragment.
3. The composition of claim 1, wherein each of the binding partners
of (a) and (b) binds to a different protein or to different
epitopes of the same protein.
4. The composition of claim 1, wherein each of the half-docking
domains of (a) and (b) has a length of 5-15 nucleotides.
5. The composition of claim 1, wherein each of the half-docking
domains of (a) and (b) has a length of 5-10 nucleotides.
6. The composition of claim 1, wherein each of the stability
domains of (a) and (b) has a length of is 5-50 nucleotides.
7. The composition of claim 1, wherein the imager strand has a
length of 10-30 nucleotides.
8. The composition of claim 1, wherein each of the 5' domain and 3'
domain of the imager strand has a length of 5-10 nucleotides.
9. The composition of claim 1, wherein the linker domain has a
length of 1-5 nucleotides.
10. The composition of claim 1, wherein the linker domain comprises
thymine (T) nucleotides.
11. The composition of claim 1, wherein the linker domain comprises
a TT sequence.
12. The composition of claim 1, wherein the imager strand is
detectably labeled.
13. The composition of claim 12, wherein the imager strand is
fluorescently labeled.
14. The composition of claim 1, wherein each of the binding
partners of (a) and (b) is respectively conjugated to the
oligonucleotide of (a) and (b) via a streptavidin-biotin binding
pair.
15. The composition of claim 1, further comprising a complex that
comprises two targets, wherein the binding partner of (a) binds or
is bound to one of the two targets, and the binding partner of (b)
binds or is bound to the other of the two targets.
16. The composition of claim 15, wherein each of the two targets is
a protein.
17. A plurality of the composition of claim 1, wherein the imager
strands of different compositions within the plurality comprise
spectrally-distinct labels.
18. A plurality of the composition of claim 1, wherein the imager
strands of different compositions within the plurality comprise
spectrally-indistinct labels.
19. A plurality of the composition of claim 1, wherein at least one
of the compositions of the plurality has a blinking frequency that
is distinct from other compositions in the plurality.
20. A method of detecting a complex of two targets in a sample, the
method comprising: contacting a sample with the imager strand of
claim 1 and the binding partner-oligonucleotide conjugates claim 1,
wherein the binding partner of (a) has specificity for one of the
two targets, and the binding partner of (b) has specificity for the
other of the two targets; and detecting presence or absence of the
complex in the sample.
21. The method of claim 20, wherein the sample is a cell or cell
lysate.
22. The method of claim 20, wherein each of the two targets is a
protein.
23. The method of claim 20, wherein each of the two targets is
obtained from a cell or cell lysate.
24. The method of claim 20, further comprising detecting a
plurality of complexes of two targets in the sample.
25. The method of claim 24, wherein the plurality of complexes is a
plurality of different complexes.
26. The method of claim 24, wherein a subset of complexes within
the plurality is located within a sub-diffraction distance of each
other.
27. A method of detecting an intramolecular interaction in a
sample, the method comprising: contacting a sample that comprises a
target molecule with (a) a first binding partner-oligonucleotide
conjugate comprising a binding partner linked to an oligonucleotide
that comprises a half-docking domain, a stability domain, and
optionally a spacer domain, wherein the binding partner of (a) has
specificity for one location on a target molecule, (b) a second
binding partner-oligonucleotide conjugate comprising a binding
partner linked to an oligonucleotide that comprises a half-docking
domain, a stability domain, and optionally a spacer domain, wherein
the binding partner of (b) has specificity for another location on
the target molecule, wherein the stability domains of (a) and (b)
are complementary to each other, and wherein the half-docking
domains of (a) and (b) combine linearly to form a full docking
domain, and (c) a imager strand comprising a detectable label, a 5'
domain, a 3' domain, and a linker domain located between the 5'
domain and the 3'domain, wherein the 5' domain is complementary to
the half-docking domain of (a) and the 3' domain is complementary
to the half-docking domain of (b); and detecting presence or
absence of the detectable label of the imager strand of (c) in the
sample.
28. The method of claim 27, wherein the sample is a cell or cell
lysate.
29. The method of claim 27, wherein the target molecule is a
protein.
30. The method of claim 29, wherein each of the location of (a) and
(b) is a different epitope on the protein.
31. A composition comprising (a) a first binding
partner-oligonucleotide conjugate comprising a binding partner
linked to an oligonucleotide that comprises a half-docking domain,
a stability domain, and optionally a spacer domain; (b) a second
binding partner-oligonucleotide conjugate comprising a binding
partner linked to an oligonucleotide that comprises a half-docking
domain, a stability domain, and optionally a spacer domain; wherein
the stability domains of (a) and (b) are complementary to each
other, and wherein the half-docking domains of (a) and (b) combine
linearly to form a first full docking domain; (c) a third binding
partner-oligonucleotide conjugate comprising a binding partner
linked to an oligonucleotide that comprises a half-docking domain,
a stability domain, and optionally a spacer domain, wherein the
stability domains of (a) and (c) are complementary to each other,
and wherein the half-docking domains of (a) and (c) combine
linearly to form a second full docking domain; (d) an first imager
strand comprising a 5' domain, a 3' domain, and a linker domain
located between the 5' domain and the 3'domain, wherein the 5'
domain of the first imager strand is complementary to the
half-docking domain of (a) and the 3' domain of the first imager
strand is complementary to the half-docking domain of (b); and (e)
a second imager strand comprising a 5' domain, a 3' domain, and a
linker domain located between the 5' domain and the 3'domain,
wherein the 5' domain of the second imager strand is complementary
to the half-docking domain of (a) and the 3' domain of the second
imager strand is complementary to the half-docking domain of (c).
Description
RELATED APPLICATION
[0001] This application claims the benefit under 35 U.S.C. .sctn.
119(e) of U.S. provisional application number 62/202,327, filed
Aug. 7, 2015, which is incorporated by reference herein in its
entirety.
BACKGROUND
[0003] Genome sequencing data has produced a vast amount of
predicted protein sets. The establishment of comprehensive
interactome maps useful for biomedical research, however, requires
precise and accurate methods to study the localization and
co-localization of interacting proteins. Many of the currently
available methods cannot detect transient interactions in single
cells, and instead can only detect relatively stable protein
interactions in cell populations (e.g., using
co-immunoprecipitation).
SUMMARY
[0004] The present disclosure provides compositions, kits and
methods for super-resolution imaging of interacting moieties, such
as proteins and other biomolecules. These sensitive and specific
methods, which build on DNA-PAINT (deoxyribonucleic acid-point
accumulation for imaging in nanoscale topography) technology, are
referred to herein as `proximity DNA-PAINT` methods. Proximity
DNA-PAINT is used, in some embodiments, to detect/visualize
interactions between two different molecules, such as intracellular
proteins (or nucleic acids) in an individual cell. Proximity
DNA-PAINT uses a pair of oligonucleotides (e.g., single-stranded
nucleic acids having a length of less than 200 nucleotides, or a
length of less than 100 nucleotides), each oligonucleotide
comprising a domain that forms half of a `docking site` to which a
labeled `imager strand` binds only when two halves are brought
together to form a full docking site. Each oligonucleotide also
comprises a stability domain. The stability domains of a pair of
oligonucleotides are complementary to each other such that when the
pair of oligonucleotides are brought close together by interaction
between the binding partners (e.g., proteins) to which the
oligonucleotides are linked, the oligonucleotides bind to each
other (through the stability/stem domains). The full docking site
forms only when two oligonucleotides of a (complementary) pair,
each containing half of the docking site, bind to each other (when
two binding partners of interest interact with, or are very close
to, each other), as depicted in FIGS. 1A-1B. Thus, binding of an
imager strand to a docking site will only occur when both
oligonucleotides of a pair are sufficiently close to each other
that they bind to each other. By conjugating each pair of
oligonucleotides to a pair of target-specific binding partners,
such as target-specific antibodies, the interactions of such
targets can be observed with sub-diffraction limit resolution
directly. Thus, the compositions and methods, as provided herein,
can be used to visualize interactions between endogenous proteins
in individual cells, for example. Multiplexing can also be achieved
through the orthogonality of DNA docking strands.
[0005] Thus, the present disclosure provides systems, compositions
and kits comprising (a) a first binding partner-oligonucleotide
conjugate comprising a binding partner linked to an oligonucleotide
that comprises a half-docking domain, a stability domain, and
optionally a spacer domain, (b) a second binding
partner-oligonucleotide conjugate comprising a binding partner
linked to an oligonucleotide that comprises a half-docking domain,
a stability domain, and optionally a spacer domain, wherein the
stability domains of (a) and (b) are complementary to each other,
and wherein the half-docking domains of (a) and (b) combine
linearly to form a full docking domain, and (c) an imager strand
comprising a 5' domain, a 3' domain, and a linker domain located
between the 5' domain and the 3'domain, wherein the 5' domain is
complementary to the half-docking domain of (a) and the 3' domain
is complementary to the half-docking domain of (b).
[0006] In some embodiments, each of the binding partners of (a) and
(b) is an antibody or antigen-binding antibody fragment. Antibodies
(and antigen-binding antibody fragments) may be, for example,
monoclonal or polyclonal. Chimeric antibodies (and antigen-binding
antibody fragments and humanized antibodies (and antigen-binding
antibody fragments) are also encompassed herein.
[0007] In some embodiments, each of the binding partners of (a) and
(b) binds to a different protein. For example, a pair of binding
partners may include one antibody that binds specifically to
Protein A, and another antibody that binds specifically to Protein
B. Thus, each binding partner (e.g., antibody) binds to a different
protein (e.g., one to Protein A, one to Protein B). In some
embodiments, each of the binding partners of (a) and (b) binds to a
different binding sites (e.g., epitopes) of the same protein. For
example, a pair of binding partners may include one antibody that
binds specifically to Epitope A of Protein A, and another antibody
that binds specifically to Epitope B of Protein A. Thus, each
binding partner (e.g., antibody) binds to a different epitope of
the same protein (e.g., one to Epitope A, one to Epitope B).
[0008] In some embodiments, each of the half-docking domains of (a)
and (b) has a length of 5-15 nucleotides. For example, each of the
half-docking domains of (a) and (b) may have a length of 5-10
nucleotides. In some embodiments, each of the half-docking domains
of (a) and (b) has a length of 3-20, 3-15, 3-10, 4-20, 4-15, 4-10,
5-20, 5-15 or 5-10 nucleotides. In some embodiments, each of the
half-docking domains of (a) and (b) has a length of 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides. In
some embodiments, each of the half-docking domains of (a) and (b)
has a length of 5.+-.2 nucleotides, 6.+-.2 nucleotides, 7.+-.2
nucleotides, or 8.+-.2 nucleotides. In some embodiments, each of
the half-docking domains of (a) and (b) has a length of 5-7
nucleotides. In some embodiments, each of the half-docking domains
of (a) and (b) has a length of 6 nucleotides.
[0009] In some embodiments, each of the stability domains of (a)
and (b) has a length of 5-50 nucleotides. For example, each of the
stability domains of (a) and (b) may have a length of 5-40, 5-30,
5-20, 5-10, 10-50, 10-40, 10-30 or 10-20 nucleotides. In some
embodiments, each of the stability domains of (a) and (b) has a
length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or
20 nucleotides. In some embodiments, each of the stability domains
of (a) and (b) has a length of 8.+-.2 nucleotides, 9.+-.2
nucleotides, 10.+-.2 nucleotides, 11.+-.2 nucleotides, or 12.+-.2
nucleotides. In some embodiments, each of the stability domains of
(a) and (b) has a length 9-11 nucleotides.
[0010] In some embodiments, the imager strand has a length of 10-30
nucleotides. For example, the imager strand may have a length of
10-15 or 10-20 nucleotides. In some embodiments, the imager strand
has a length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20
nucleotides. In some embodiments, the imager strand has a length of
8.+-.2 nucleotides, 9.+-.2 nucleotides, 10.+-.2 nucleotides,
11.+-.2 nucleotides, 12.+-.2 nucleotides, 13.+-.2 nucleotides,
14.+-.2 nucleotides,15.+-.2 nucleotides, or 16.+-.2 nucleotides. In
some embodiments, the imager strand has a length of 10-12
nucleotides or 12-14 nucleotides.
[0011] In some embodiments, each of the 5' domain and 3' domain of
the imager strand has a length of 5-10 nucleotides. In some
embodiments, each of the 5' domain and 3' domain of the imager
strand has a length of 5, 6, 7, 8, 9 or 10 nucleotides. In some
embodiments, each of the 5' domain and 3' domain of the imager
strand has a length of 6 nucleotides. In some embodiments, each of
the 5' domain and 3' domain of the imager strand has a length of
6.+-.2 nucleotides.
[0012] In some embodiments, the linker domain has a length of 1-5
nucleotides. For example, the linker domain may have a length of 1,
2, 3, 4, or 5 nucleotides. In some embodiments, the linker domain
comprises or consists of thymine (T) nucleotides (T residues). In
some embodiments, the linker comprises or consists of a TT
sequence. In some embodiments, the linker domain comprises or
consists of adenine (A) nucleotides (A residues). In some
embodiments, the linker comprises or consists of a AA sequence. In
some embodiments, the linker domain comprises or consists of
cytosine (C) nucleotides (C residues). In some embodiments, the
linker comprises or consists of a CC sequence. In some embodiments,
the linker domain comprises or consists of guanine (G) nucleotides
(G residues). In some embodiments, the linker comprises or consists
of a GG sequence.
[0013] In some embodiments, the imager strand is detectably labeled
(comprises a molecule that can be detected). In some embodiments,
the imager strand is fluorescently labeled (comprises a fluorescent
label/molecule, such as a fluorophore).
[0014] In some embodiments, each of the binding partners of (a) and
(b) is respectively conjugated to the oligonucleotide of (a) and
(b) via a streptavidin-biotin binding pair. For example, a binding
partner may be linked to streptavidin, and the oligonucleotide may
be linked to biotin. Alternatively, a binding partner may be linked
to biotin, and the oligonucleotide may be linked to
streptavidin.
[0015] In some embodiments, a composition further comprises a
complex that comprises two targets (e.g., proteins that bind or
otherwise interact with each other), wherein the binding partner of
(a) binds or is bound to one of the two targets, and the binding
partner of (b) binds or is bound to the other of the two
targets.
[0016] In some embodiments, each of the two targets is a
protein.
[0017] In some embodiments, the imager strands of different
compositions within the plurality comprise spectrally-distinct
labels (e.g., some fluorescing in a red channel, others fluorescing
in a blue channel, etc.).
[0018] Also provided herein is plurality (e.g., 10, 100, 1000,
10000, etc.) of compositions comprising (a) a first binding
partner-oligonucleotide conjugate comprising a binding partner
linked to an oligonucleotide that comprises a half-docking domain,
a stability domain, and optionally a spacer domain, (b) a second
binding partner-oligonucleotide conjugate comprising a binding
partner linked to an oligonucleotide that comprises a half-docking
domain, a stability domain, and optionally a spacer domain, wherein
the stability domains of (a) and (b) are complementary to each
other, and wherein the half-docking domains of (a) and (b) combine
linearly to form a full docking domain, and (c) an imager strand
comprising a 5' domain, a 3' domain, and a linker domain located
between the 5' domain and the 3'domain, wherein the 5' domain is
complementary to the half-docking domain of (a) and the 3' domain
is complementary to the half-docking domain of (b), wherein the
imager strands of different compositions within the plurality
comprise spectrally-indistinct labels.
[0019] Also provided herein is plurality of compositions comprising
(a) a first binding partner-oligonucleotide conjugate comprising a
binding partner linked to an oligonucleotide that comprises a
half-docking domain, a stability domain, and optionally a spacer
domain, (b) a second binding partner-oligonucleotide conjugate
comprising a binding partner linked to an oligonucleotide that
comprises a half-docking domain, a stability domain, and optionally
a spacer domain, wherein the stability domains of (a) and (b) are
complementary to each other, and wherein the half-docking domains
of (a) and (b) combine linearly to form a full docking domain, and
(c) an imager strand comprising a 5' domain, a 3' domain, and a
linker domain located between the 5' domain and the 3'domain,
wherein the 5' domain is complementary to the half-docking domain
of (a) and the 3' domain is complementary to the half-docking
domain of (b), wherein at least one of the compositions of the
plurality has a blinking frequency (e.g., K.sub.ON/K.sub.OFF) that
is distinct from other compositions in the plurality. Further
provided herein are methods of detecting a complex of two targets
in a sample, the methods comprising: contacting a sample with (a) a
first binding partner-oligonucleotide conjugate comprising a
binding partner linked to an oligonucleotide that comprises a
half-docking domain, a stability domain, and optionally a spacer
domain, (b) a second binding partner-oligonucleotide conjugate
comprising a binding partner linked to an oligonucleotide that
comprises a half-docking domain, a stability domain, and optionally
a spacer domain, wherein the stability domains of (a) and (b) are
complementary to each other, and wherein the half-docking domains
of (a) and (b) combine linearly to form a full docking domain, and
(c) an imager strand comprising a 5' domain, a 3' domain, and a
linker domain located between the 5' domain and the 3'domain,
wherein the 5' domain is complementary to the half-docking domain
of (a) and the 3' domain is complementary to the half-docking
domain of (b) , wherein the binding partner of (a) has specificity
for one of the two targets, and the binding partner of (b) has
specificity for the other of the two targets; and detecting
presence or absence of the complex in the sample.
[0020] In some embodiments, the sample is a cell (e.g., bacterial
cell, yeast cell, insect cell or mammalian cell) or cell
lysate.
[0021] In some embodiments, each of the two targets is a
protein.
[0022] In some embodiments, each of the two targets is obtained
from (e.g., isolated from or purified from) a cell or cell
lysate.
[0023] In some embodiments, the methods further comprise detecting
a plurality of complexes of two targets in the sample. In some
embodiments, the plurality of complexes is a plurality of different
complexes. In some embodiments, a subset of complexes within the
plurality is located within a sub-diffraction distance of each
other.
[0024] The present disclosure also provides methods of detecting an
intramolecular interaction in a sample, the method comprising
contacting a sample that comprises a target molecule with (a) a
first binding partner-oligonucleotide conjugate comprising a
binding partner linked to an oligonucleotide that comprises a
half-docking domain, a stability domain, and optionally a spacer
domain, wherein the binding partner of (a) has specificity for one
location on a target molecule, (b) a second binding
partner-oligonucleotide conjugate comprising a binding partner
linked to an oligonucleotide that comprises a half-docking domain,
a stability domain, and optionally a spacer domain, wherein the
binding partner of (b) has specificity for another location on the
target molecule, wherein the stability domains of (a) and (b) are
complementary to each other, and wherein the half-docking domains
of (a) and (b) combine linearly to form a full docking domain, and
(c) a imager strand comprising a detectable label, a 5' domain, a
3' domain, and a linker domain located between the 5' domain and
the 3'domain, wherein the 5' domain is complementary to the
half-docking domain of (a) and the 3' domain is complementary to
the half-docking domain of (b); and detecting presence or absence
of the detectable label of the imager strand of (c) in the
sample.
[0025] In some embodiments, the sample is a cell or cell
lysate.
[0026] In some embodiments, the target molecule is a protein.
[0027] In some embodiments, each of the location of (a) and (b) is
a different epitope on the protein. Thus, the methods may be used
to detect the presence of two different binding sites (e.g.,
epitopes) on a protein of interest.
[0028] Also provided herein are systems, kits and compositions
comprising (a) a first binding partner-oligonucleotide conjugate
comprising a binding partner linked to an oligonucleotide that
comprises a half-docking domain, a stability domain, and optionally
a spacer domain, (b) a second binding partner-oligonucleotide
conjugate comprising a binding partner linked to an oligonucleotide
that comprises a half-docking domain, a stability domain, and
optionally a spacer domain, wherein the stability domains of (a)
and (b) are complementary to each other, and wherein the
half-docking domains of (a) and (b) combine linearly to form a
first full docking domain, (c) a third binding
partner-oligonucleotide conjugate comprising a binding partner
linked to an oligonucleotide that comprises a half-docking domain,
a stability domain, and optionally a spacer domain, wherein the
stability domains of (a) and (c) are complementary to each other,
and wherein the half-docking domains of (a) and (c) combine
linearly to form a second full docking domain, (d) an first imager
strand comprising a 5' domain, a 3' domain, and a linker domain
located between the 5' domain and the 3'domain, wherein the 5'
domain of the first imager strand is complementary to the
half-docking domain of (a) and the 3' domain of the first imager
strand is complementary to the half-docking domain of (b), and (e)
a second imager strand comprising a 5' domain, a 3' domain, and a
linker domain located between the 5' domain and the 3'domain,
wherein the 5' domain of the second imager strand is complementary
to the half-docking domain of (a) and the 3' domain of the second
imager strand is complementary to the half-docking domain of
(c).
[0029] The present disclosure, in some embodiments, provides
systems, compositions and kits comprising (a) a first
antibody-oligonucleotide (e.g., antibody-DNA) conjugate comprising
an antibody linked to an oligonucleotide that comprises a
half-docking domain having a length of 5-7 nucleotides, a stability
domain having a length of 9-11 nucleotides, and optionally a spacer
domain, (b) a second antibody-oligonucleotide (e.g., antibody-DNA)
conjugate comprising a binding partner linked to an oligonucleotide
that comprises a half-docking domain having a length of 5-7
nucleotides, a stability domain having a length of 9-11
nucleotides, and optionally a spacer domain, wherein the stability
domains of (a) and (b) are complementary to each other, and wherein
the half-docking domains of (a) and (b) align (e.g., linearly) to
form a full docking domain, and (c) an imager strand comprising a
5' domain having a length of 5-7 nucleotide, a 3' domain having a
length of 5-7 nucleotides, and a linker domain having a length of
1-5 nucleotides located between the 5' domain and the 3'domain,
wherein the 5' domain is complementary to the half-docking domain
of (a) and the 3' domain is complementary to the half-docking
domain of (b).
BRIEF DESCRIPTION OF DRAWINGS
[0030] FIGS. 1A-1C show an example of proximity-PAINT. FIG. 2A
shows two target proteins, each labeled with one of the two p-PAINT
DNA oligos. If the proteins interact, the interaction will be
visible via DNA-PAINT. FIG. 1B shows detailed schematics of pPAINT
oligos: the two oligos that serve as the docking site have a short
complementary domain (stem) that will bind transiently. This domain
is designed to have a longer mean bound time than the mean bound
time of the imager strand. Thus, when the two oligos are
sufficiently close to form a docking site the imager strand will
bind the docking site with higher probability than if the two
oligos were not sufficiently close to form a docking site. Without
formation of a docking site, a DNA-PAINT trace is not observed. The
imager strand (probe) used for pPAINT shown in this example has
three domains: an end domain `a1*` that binds to one end `a1`
(e.g., 5' end) of one of the docking-strand sequences, a central
domain that comprises a TT linker, and another end domain `a2*`
that binds to one end `2a` (e.g., the 3' end) of the other docking
strand sequence. As used herein, the terms linker and spacer are
used interchangeably. FIG. 1C shows a DNA origami structure that
was "labeled" with pPAINT oligos in its four corners: when the pair
of pPAINT oligos was present, a DNA-PAINT super-resolution
fluorescence image was obtained using Cy3b-labeled imager strands.
When only one of the pPAINT oligos was present, no visible trace
was obtained. FIG. 1D shows a DNA origami nanostructure containing
extensions with the pPAINT probes, demonstrating that the desired
geometry can be visualized with the control DNA-PAINT docking sites
(P16 and P38) and the pPAINT docking site (pP1). FIG. 1E shows
secondary structures adopted by the pair of pPAINT probes (i),
motif 2 (ii) and motif 1(iii). Each motif was designed to adopt a
secondary structure that is weak enough to guarantee that when the
two probes are in close proximity they adopt the secondary
structure depicted in (i), but is strong enough to prevent the
formation of multivalent interactions. This last feature is useful,
for example, because antibodies are usually labeled with more than
one DNA probe, thus multivalent interactions can cause the
formation of the pPAINT docking site (i) even when only one of the
targets is present.
[0031] FIG. 2. First stages of pPAINT. (Left panel) Three types of
docking sites: TT, T and no spacer in the edge between the stem and
one of the docking sites were evaluated with three types of
imagers: TTTT, TTT and TT linker in the middle. (Middle panel) The
best performing imager with its docking site is chosen based on the
kinetic analysis. (Right panel) This pair is used to determine the
optimal stem length within a pool of stem designs that ranged from
9-11 bp in length, as an example.
[0032] FIG. 3. Mean bound time for three types of docking sites: TT
spacer (squares), T spacer (triangles) and no spacer (circles)
between the stem and one of the docking site sequences, and the
three types of imagers: TTTT (medium gray), TTT (light gray) and TT
(dark gray) linker in the middle. In some instances, the design for
pPAINT corresponds to the one lacking a spacer at the edge of the
stem, and a TT linker in the imager strand.
[0033] FIG. 4. K.sub.on for the three types of docking sites: TT
spacer (squares), T spacer (triangles) and no spacer (circles)
between the stem and one of the docking site sequences, and the
three types of imagers: TTTT (medium gray), TTT (light gray) TT
(dark gray) linker in the middle.
[0034] FIG. 5. Mean bound times for the best design per stem length
evaluated: S9V2 (square), S 10V2 (triangle), S11V1 (circle).
[0035] FIG. 6. K.sub.on for an example design per stem length
evaluated: S9V2 (square), S 10V2 (triangle), S11V1 (circle).
[0036] FIG. 7. Detection range for pPAINT. (Left panel) A DNA
origami polymer is "labeled" with pPAINT oligos at three different
distances. (Middle panel) With increasing distance we expect to see
a dimmer signal. (Top right panel) With this characterization, it
will be possible to determine the working range for p-PAINT.
(Bottom right panel) Preliminary results of the tests performed
with the two docking sites at a larger distance. The two pPAINT
oligonucleotides were placed at a distance of 5 nm (upper panel)
and 20 nm (lower panel) between them. At the left of each panel,
the hex-staple representation, where each hexagon represents a
staple color-coded for the modification in the 3'-end extension
(dark grey) and the 5'-end (black), depicts the position where the
two half-docking sites were placed in the DNA origami. With this
characterization, it is possible to conclude that the working range
of pPAINT is at least 20 nm.
[0037] FIG. 8. Benchmarking pPAINT in situ.
DETAILED DESCRIPTION
[0038] The present disclosure provides a modification to
traditional DNA-PAINT methodology. Rather than imaging a single
target, such as a single protein or a single nucleic acid, the
methods of the present disclosure detect targets (e.g., two
targets) that are interacting with each other. The methods yield
signal only when a pair of targets are in close enough proximity to
each other such that the two targets can be regarded as binding to
each other or being complexed to each other. When the targets are
not sufficiently close to each other, no signal is detected. The
present disclosure therefore provides an unexpected use of the
DNA-PAINT methodology, as well as compositions relating to such
use.
[0039] DNA-PAINT is a super-resolution imaging methodology that
involves stochastic, short-lived binding of labeled
oligonucleotides to targets that are separated from each other by a
distance that is less than a diffraction limited distance. The
method relies on the binding of oligonucleotides to only a subset
of targets at any given time. The subset of targets may be one or
more (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10), and in some instances no
target may be bound. When less than all the targets are bound to
detectable oligonucleotides, signals from individual targets are
more easily discerned from each other. This is in contrast to the
situation when all the targets are bound to detectable labels, in
which case the signals from the multiple targets are not
discernable. Thus, targets that are too close to each other can be
resolved spatially by detecting signal, each of them in a
temporally staggered manner.
[0040] In a DNA-PAINT method, a target is detected through the use
of a binding partner that binds specifically to the target. The
binding partner in turn is conjugated to an oligonucleotide,
referred to herein as a `docking strand`. Detection further
requires the use of another oligonucleotide, referred to as an
`imager strand` (probe) that is complementary to the docking
strand. The docking strand provides the docking site to which the
imager strand binds. The imager strand is detectably labeled,
including for example fluorescently labeled. DNA-PAINT requires
that the interaction between docking and imager strands be
short-lived. This is achieved in a number of ways including for
example through the length of the docking and imager strands,
through the nucleotide sequence of the docking and imager strands,
through the concentration of imager strands, through the number of
docking strands per target, through the conditions in which the
binding interactions occur, and the like.
[0041] Other techniques such as bimolecular fluorescence
complementation (Hu, Chinenov, & Kerppola, 2002) enable the
localization of these interactions within the cell but require high
expression levels of fusion proteins. A different approach, named
Proximity Ligation Assay (PLA) (Soderberg, et al., 2006) offers
high sensitivity and specificity, but the visual signal that
indicative of interactions between proteins is still confined to
the diffraction limit, and several enzymatic steps are necessary in
order to amplify and detect such signal.
[0042] Single Molecule Localization (SML) techniques enable the
visualization below the diffraction limit, unveiling a myriad of
valuable biological information. Many of these implementations use
fluorescent ON and OFF states to temporally decouple the
localization of proteins within a diffraction-limited area. Both
targeted (e.g. Stimulated Emission Depletion microscopy or STED)
(Hell, 1994) and stochastic (Photoactivated Localization Microscopy
or PALM, and Stochastic Optical Reconstruction Microscopy or STORM)
(Rust, Bates, & Zhuang, 2006) (Betzig, et al., 2006) switching
methods have achieved unprecedented spatial resolution, but they
require either costly equipment and/or specialized experimental
conditions.
[0043] In contrast, DNA-PAINT utilizes the programmable
capabilities of short detectably labeled oligonucleotides (`imager`
strands) that transiently bind to their complementary `docking`
strands, achieving the necessary stochastic ON- and OFF-states for
single molecule localization thereby facilitating super-resolution
microscopy (Jungmann et al. Nano Lett. 2010 Nov 10;10(11):4756-61,
incorporated herein by reference). DNA-PAINT can achieve
highly-multiplexed sub-diffraction images with <10 nm spatial
resolution in DNA nanostructures. In addition to this, by coupling
DNA oligonucleotides to antibodies, DNA-PAINT can been extended to
in situ multiplexed two- and three-dimensional super-resolution
imaging.
[0044] Techniques that combine the resolving power of SML
approaches with other assays are also available. These include the
combination of Bimolecular Fluorescence Complementation (BiFC) with
PALM for super-resolution imaging of protein-protein interactions
(Liu, et al., 2014) and the combination of Forster Resonance Energy
Transfer (FRET) with universal-PAINT (uPAINT) (Winckler, et al.,
2013). These approaches have provided valuable insights into the
role of interacting proteins using sub-diffraction limit
resolution. Nonetheless, these methods are dependent upon and,
thus, limited by the need to express fusion proteins in very high
levels. In addition, these methods are restricted to analyses of
target proteins in membranes. Furthermore, multiplexing for a large
number of protein pairs is very challenging using these available
techniques.
Proximity PAINT
[0045] Like DNA PAINT, proximity DNA-PAINT relies on known kinetics
of nucleotide sequences. By adjusting the length and sequence of
oligonucleotides pairs, it is possible to achieve a transient
binding and unbinding that enables the localization of target
molecules, such as complexes, within a diffraction-limited area.
See International Publication No. WO 2015/017586, filed Jul. 30,
2014, incorporated herein by reference in its entirety.
[0046] A system is provided that comprises, in some embodiments, of
a pair of nucleotide sequences that will act as a docking site only
when they are in close proximity to each other. When the pair are
not in close proximity, any interaction between the imager strand
and each sequence alone is not stable enough to be detected (FIGS.
1A-B).
[0047] FIGS. 1A-C illustrate the proximity-PAINT (pPAINT) method in
the context of two interacting proteins. In FIG. 1A, two target
proteins are each labeled with one of a pair of p-PAINT
oligonucleotides. If the proteins are interacting, the interaction
is visible via DNA-PAINT.
[0048] FIG. 1B illustrates the pPAINT oligonucleotides design. The
two pPAINT oligonucleotides combine to form the docking site.
Additionally, they have a short complementary domain (referred to
herein as the stability or stem domain) that will bind the
oligonucleotides to each other transiently. This domain has a
longer mean bound time than the imager strand binding to the
docking site. Thus, when the two oligonucleotides are close enough
to each other, the imager strand will bind the docking site with
higher probability than if oligonucleotides were not close enough
together. When the oligonucleotides are not close enough to each
other, no significant DNA-PAINT trace (e.g., fluorescent signal) is
obtained.
[0049] One embodiment of a pPAINT imager strand is illustrated in
FIG. 1B. The illustrated imager strand has three domains: a first
domain binds the 5'-end nucleotide sequence of the docking site
(i.e., the 5' half-docking site); a second domain binds the 3'-end
nucleotide sequence of the docking site (i.e., the 3' half-docking
site); and a (optional) linker domain situated between the 5' and
3' domains. When present, the linker may be a nucleic acid or it
may be non-nucleic acid. In some embodiments, the linker comprises
1-5 nucleotides. The nucleotides may be A, T, C or G residues or
some combination, variant or modified version thereof. The linker
may be comprised of abasic sites. It is important that, when
present, the linker sequence does not bind to sequence in either of
the half-docking sites. Rather the linker functions to separate the
5' and 3' domains from each other sufficiently so that they may
bind to their complementary sequences on the half-docking sites. In
some embodiments, the linker domain may consist of only T residues,
such as T, TT, TTT, TTTT or TTTTT. In some embodiments, the linker
domain may consist of only A residues, such as A, AA, AAA, AAAA or
AAAAA. In some embodiments, the linker domCin mCy consist of only C
residues, such Cs C, CC, CCC, CCCC or CCCCC. In some embodiments,
the linker domGin mGy consist of only G residues, such Gs G, GG,
GGG, GGGG or GGGGG. Thus, a linker may be, for example, a
homopolymers consisting of only A (polyA), T (polyT), C (polyC) or
G (polyC).
[0050] For in vitro analysis, a DNA origami structure
(nanostructure) was "labeled" with pPAINT oligonucleotides in its
four corners, as shown schematically in FIG. 1C. When the pair of
pPAINT oligonucleotides are present, a DNA-PAINT super-resolution
fluorescence image was obtained using Cy3b-labeled imager strands.
When only one of the pPAINT oligonucleotides is present, no visible
trace was obtained.
[0051] The pPAINT oligonucleotides conjugated to target-specific
binding partners are designed with short complementary (stem or
stability) domains that will bind (hybridize to each other)
transiently. The mean bound time for the stem domains is longer
than the mean bound time for the imager--docking site binding.
Therefore the stem domain confers a certain degree of stability to
the docking site complex in order to increase the probability of
imager strand binding. The imager strand binds the 5'-end of the
docking site (imparted by one oligonucleotide) and the 3'-end of
the docking site (imparted by the other oligonucleotide).
[0052] The imager strand illustrated in FIG. 1B comprises the 5'
and 3' domains that each bind to a half-docking site, with a linker
domain in the middle. The imager may be longer than previously used
imager strands. The increased length compensates for the
thermodynamic penalty of having a small loop in the middle (FIG.
1B).
[0053] The present disclosure provides, inter alia, methods for
detecting interactions between various targets, such as
interactions between at least two (e.g., 2, 3, 4 or 5) proteins, or
interactions between proteins and other moieties.
[0054] The methods of the present disclosure can be used to study
interactions in cells or in cell lysates. Additionally, they may be
used to study interactions between targets in vitro such as as part
of a screening assay or platform.
Docking Sites, Half-Docking Sites, and Half-Docking Strands
[0055] In the methods provided herein, the "docking site" comprises
two "half-docking sites," each half site contributed by a
target-specific binding partner. Thus, when two targets are
complexed with each other, binding partners bound to the two
targets will be in close proximity to each other as will the
oligonucleotides conjugated to the binding partners. When the
oligonucleotides are in close proximity to each other, together
they form a full docking site to which an imager strand can
hybridize. If the targets are not complexed, then the binding
partners are not likely to be located within sufficient proximity
of each other, and the oligonucleotides to which they are bound
will not interact with each other, and consequently no docking site
will be formed.
[0056] The system and its components are designed such that imager
strands do not bind to either of the half-docking sites for the
period of time required to observe such binding. Thus the
combination of the two half-docking sites is needed for imager
strand binding. Only when the imager strand is bound, a detectable
signal coming from the focal plane will be obtained. Unbound imager
strands are typically outside of the focal plane and thus not
detected, although they can contribute to noise.
[0057] The oligonucleotides conjugated to the binding partners each
comprise a half-docking site domain, a stability (or stem) domain,
optionally a spacer domain between the half-docking site domain and
the stability domain, and optionally a spacer domain between the
end of the oligonucleotide conjugated to the binding partner and
the stability domain. The half-docking site domain is the
nucleotide sequence that combines with another half-docking site
domain imparted by the oligonucleotide conjugated to another
binding partner to form a full docking site to which a
complementary imager strand binds. The stability domain is a
nucleotide sequence that is complementary to a stability domain in
another oligonucleotide conjugated to another binding partner. When
two targets are interacting and these oligonucleotides are in
sufficiently close proximity, they hybridize to each other through
their stability domains to form a double-stranded stem domain. Such
hybridization helps to stabilize the full docking site formed by
the combination of the two half-docking sites domains. The
oligonucleotides may optionally comprise 1 or 2 spacer domains. The
spacer domain may facilitate the hybridization of the
oligonucleotides to each other and/or hybridization of the imager
strand to the docking site.
[0058] The oligonucleotide is typically single-stranded although it
may comprise double stranded regions prior to binding to another
oligonucleotide conjugated to another binding partner.
[0059] The present disclosure contemplates that the hybridization
between the two oligonucleotides, via their stability domains, will
be more stable than the binding of the imager strand to the docking
site. The present disclosure further contemplates that the binding
of the two complexes to each other will be more stable than the
hybridization between the two oligonucleotides. In other words, the
free energies of the various interactions are as follows:
target-target interaction>oligo-oligo hybridization>imager
strand- docking site.
[0060] The full docking site may have a length of about 8
nucleotides to about 60 nucleotides, about 8 to about 50
nucleotides, about 8 to about 40 nucleotides, about 8 to about 30
nucleotides, about 8 to about 20 nucleotides, about 8 to about 15
nucleotides, or about 10 to about 14 nucleotides, including a
length of 8, 9, 10, 11, 12, 13 or 14 nucleotides. In some
embodiments, the full docking site is 8-14 nucleotides in length,
or 9-13 nucleotides in length, or 10-12 nucleotides in length. The
imager strand length is typically at least the length of the full
docking site.
[0061] The half-docking site ranges in length from about 4
nucleotides to about 100 nucleotides. In some embodiments, a
docking strand is about 4 to about 20 nucleotides, about 4 to about
10 nucleotides, including 4, 5, 6, 7, 8, 9 or 10 nucleotides in
length. In some embodiments, a docking strand has a length of 4 to
50, or 4 to 100 nucleotides. For example, a a docking strand may
have a length of 4 to 10, 4 to 15, 4 to 20, 4 to 25, 4 to 30, 4 to
35, 4 to 40, 4 to 45, 4 to 50, 4 to 55, 4 to 60, 4 to 60, 4 to 70,
or 4 to 75 nucleotides.
[0062] The half-docking sites may contribute an equal number of
nucleotides to the full docking site, or they may contribute an
unequal number of nucleotides to the full docking site. For
example, the half-docking sites may each contribute 4, 5, 6, 7 or
more nucleotides. In some embodiments, the half-docking sites each
contribute 4 or 5 nucleotides. The half-docking sites contribute 5
nucleotides, or 6 nucleotides, or 7 nucleotides.
[0063] The stability or stem domains may be about 8 to about 20
nucleotides in length, or about 8 to about 15 nucleotides in
length, including 8, 9, 10, 11, 12, 13 or 14 nucleotides in
length.
[0064] The oligonucleotide may comprise a spacer domain between the
stability domain and the half-docking site domain. Such spacer
domain may be 1-5 nucleotides in length, for example. The
nucleotides may be T residues, or they may be abasic residues. Such
spacer domain should not hybridize with the imager strand. In some
embodiments, there is no spacer domain between the stability domain
and the half-docking site.
[0065] The oligonucleotide may comprise a spacer domain between the
conjugated end of the oligonucleotide and the stability domain.
This spacer domain may be 1-100 nucleotide in length or longer,
including for example 5-100 nucleotides in length. The spacer
domain may be up to 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 and 100
nucleotides. In some embodiments, the spacer domain is up to or
about 40 nm in length, including about 2.5 nm, 5 nm, 10 nm, 15 nm,
20 nm, 30 nm, or longer.
Imager Strands
[0066] An "imager strand" is a single-stranded nucleic acid (e.g.,
DNA) that binds transiently to the docking site. The imager strand
may be about the same length as the docking site. Thus, without a
linker domain, the imager strand may be about 8 nucleotides to
about 50 nucleotides in length, about 8 to about 40 nucleotides,
about 8 to about 30 nucleotides, about 8 to about 20 nucleotides,
about 8 to about 15 nucleotides, or about 10 to about 14
nucleotides, including 8, 9, 10, 11, 12, 13 or 14 nucleotides in
length. In some embodiments, the imager strand is 8-14 nucleotides
in length, or 9-13 nucleotides in length, or 10-12 nucleotides in
length, in the absence of a linker domain or sequence.
[0067] In some embodiments, the imager strand is 14 nucleotides in
length, comprising the 5' and 3'domains, each of which is 6
nucleotides in length, and a 2 nucleotide linker.
[0068] In some embodiments, the imager strand is 8-20 nucleotides
in length, comprising the 5' and 3'domains, each of which is 4-8
nucleotides in length, and a 1-4 nucleotide linker.
[0069] An imager strand is complementary to and transiently binds
to a full docking site. Two nucleic acids or nucleic acid domains
are "complementary" to one another if they base-pair, or bind, with
each other to form a double-stranded nucleic acid molecule via
Watson-Crick interactions. As used herein, "binding" refers to an
association between at least two molecules due to, for example,
electrostatic, hydrophobic, ionic and/or hydrogen-bond interactions
under physiological conditions. An imager strand is considered to
"transiently bind" to a docking site if it binds to a complementary
region of a docking site and then disassociates (unbinds) from the
docking site within a short period of time. These interactions may
occur at room temperature in some embodiments. In some embodiments,
an imager strand remains bound to a docking strand for about 0.1 to
about 10, or about 0.1 to about 5 seconds. For example, an imager
strand may remain bound to a docking strand for about 0.1, about 1,
about 5 or about 10 seconds.
[0070] In the presence of the linker domain, the imager strand may
be at least 1-5 nucleotides longer than the above-recited
lengths.
[0071] Imager strands of the present disclosure may be labeled with
a detectable label (e.g., a fluorescent label, in which case they
are considered to be "fluorescently labeled"). For example, in some
embodiments, an imager strand may comprise at least one (i.e., one
or more) fluorophore. Examples of fluorophores for use in
accordance with the present disclosure include, without limitation,
xanthene derivatives (e.g., fluorescein, rhodamine, Oregon green,
eosin and Texas red), cyanine derivatives (e.g., cyanine,
indocarbocyanine, oxacarbocyanine, thiacarbocyanine and
merocyanine), naphthalene derivatives (e.g., dansyl and prodan
derivatives), coumarin derivatives, oxadiazole derivatives (e.g.,
pyridyloxazole, nitrobenzoxadiazole and benzoxadiazole), pyrene
derivatives (e.g., cascade blue), oxazine derivatives (e.g., Nile
red, Nile blue, cresyl violet and oxazine 170), acridine
derivatives (e.g., proflavin, acridine orange and acridine yellow),
arylmethine derivatives (e.g., auramine, crystal violet and
malachite green), and tetrapyrrole derivatives (e.g., porphin,
phthalocyanine and bilirubin). Other detectable labels may be used
in accordance with the present disclosure, such us, for example,
gold nanoparticles or other detectable particles or moieties.
[0072] In some embodiments, imager strands are labeled in a
target-specific manner. This intends that imager strands that are
specific for a complex A are labeled with a spectrally distinct
label. As used herein, "spectrally distinct" labels refer to labels
(e.g., fluorophores) of different spectral signal or wavelength.
For example, an imager strand labeled with a Cy2 fluorophore emits
a signal at a wavelength of light of about 510 nm, while an imager
strand labeled with a Cy5 fluorophore emits a signal at a
wavelength of light of about 670 nm. Thus, the Cy2-labeled imager
strand is spectrally distinct from the Cy5-labeled imager
strand.
[0073] Conversely, "spectrally indistinct" labels are labels having
the same spectral signal or wavelength--that is, the emission
wavelength of the labels cannot be used to distinguish between two
spectrally indistinct fluorescently labels because the wavelengths
are the same or close together. In some embodiments, the imager
strands are labeled in a non-target specific manner. The imager
strands may be labeled with the same labels or with spectrally
indistinct labels.
[0074] The methods provided herein may be used to detect a
plurality of interactions, and in this way the methods may be
referred to as multiplexed methods or assays. Different
interactions may be distinguished from each other temporally, or
through the use of spectrally distinct signals, or through
differences in the blinking frequency of the imager strand--docking
site interaction. Different targets can be distinguished temporally
using different imager strands sequentially and not concurrently.
For example, a first imager strand specific for a first interaction
is used to detect the presence of the first interaction, and then a
second imager strand specific for a second interaction is used to
detect the presence of the second interaction, etc. Different
imager strands refer to imager strands having different nucleotide
sequence that detect different docking sites. Different targets can
be distinguished spectrally using different imager strands that are
labeled with spectrally distinct labels. For example, a first
imager strand having a Cy2 label is used to detect a first
interaction and a second imager strand having a Cy5 label is used
to detect a second interaction. These spectrally distinct imager
strands can be used concurrently. Different targets can be
distinguished by imager strand--docking site combinations having
different blinking frequencies. As described herein, the blinking
frequency of an imager strand--docking site interaction can be
modulated in order to have a defined and distinct ON and/or OFF
rates. In this way, some imager strands--docking site pairs may
bind and unbind at higher frequency and thereby appear to "blink"
more frequently than other pairs. In this way, the imager strands
may be labeled with spectrally indistinct labels, including with
the same labels, and yet still used at the same time because their
blinking frequencies are different. Blinking frequency can be
modulated by changes in imager strand length and correspondingly
docking sites, altering the sequence composition (e.g., more AT
rich or more GC rich), altering melting temperatures using other
methods including for example altering the hybridization
conditions, altering the number of docking sites per target,
increasing the concentration of imager strands, etc.
Binding Partners
[0075] The method can be used to detect the interaction of
virtually any moieties for which binding partners exist or can be
made provided such binding partners can be conjugated to an
oligonucleotide.
[0076] Binding partners conjugated to an oligonucleotide may be
referred to here as binding partner-nucleic acid (BP-NA) conjugates
or binding partner-oligonucleotide (BP-Oligo) conjugates. As used
herein, BP-NA or BP-Oligo conjugates refer to a molecule linked
(e.g., through an N-Hydroxysuccinimide (NHS) linker) to a
single-stranded nucleic acid (e.g., DNA). The single-stranded
nucleic acid comprises a half-docking site, a stability domain and
optionally a spacer domain.
[0077] The binding partners may be any moiety (e.g., antibody or
aptamer) that has an affinity for (e.g., binds to) a target, such
as a biomolecule (e.g., protein or nucleic acid), of interest. In
some embodiments, the binding partner is a protein. Examples of
proteins for use in the conjugates of the present disclosure
include, without limitation, antibodies (e.g., monoclonal
antibodies), antigen-binding antibody fragments (e.g., Fab
fragments), receptors, peptides and peptide aptamers. Other binding
partners may be used in accordance with the present disclosure. For
example, binding partners that bind to targets through
electrostatic (e.g., electrostatic particles), hydrophobic or
magnetic (e.g., magnetic particles) interactions are contemplated
herein.
[0078] As used herein, "antibody" includes full-length antibodies
and any antigen binding fragment (e.g., "antigen-binding portion")
or single chain thereof. The term "antibody" includes, without
limitation, a glycoprotein comprising at least two heavy (H) chains
and two light (L) chains inter-connected by disulfide bonds, or an
antigen binding portion thereof. Antibodies may be polyclonal or
monoclonal; xenogeneic, allogeneic, or syngeneic; or modified forms
thereof (e.g., humanized, chimeric).
[0079] As used herein, "antigen-binding portion" of an antibody,
refers to one or more fragments of an antibody that retain the
ability to specifically bind to an antigen. The antigen-binding
function of an antibody can be performed by fragments of a
full-length antibody. Examples of binding fragments encompassed
within the term "antigen-binding portion" of an antibody include
(i) a Fab fragment, a monovalent fragment consisting of the VH, VL,
CL and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment
comprising two Fab fragments linked by a disulfide bridge at the
hinge region; (iii) a Fd fragment consisting of the VH and CH1
domains; (iv) a Fv fragment consisting of the VH and VL domains of
a single arm of an antibody, (v) a dAb fragment (Ward et al.,
Nature 341:544 546, 1989), which consists of a VH domain; and (vi)
an isolated complementarity determining region (CDR) or (vii) a
combination of two or more isolated CDRs, which may optionally be
joined by a synthetic linker. Furthermore, although the two domains
of the Fv fragment, VH and VL, are coded for by separate genes,
they can be joined, using recombinant methods, by a synthetic
linker that enables them to be made as a single protein chain in
which the VH and VL regions pair to form monovalent molecules
(known as single chain Fv (scFv); see, e.g., Bird et al. Science
242:423 426, 1988; and Huston et al. Proc. Natl. Acad. Sci. USA
85:5879-5883, 1988). Such single chain antibodies are also
encompassed within the term "antigen-binding portion" of an
antibody. These antibody fragments are obtained using conventional
techniques known to those with skill in the art, and the fragments
are screened for utility in the same manner as are intact
antibodies.
[0080] As used herein, "receptors" refer to cellular-derived
molecules (e.g., proteins) that bind to ligands such as, for
example, peptides or small molecules (e.g., low molecular weight
(<900 Daltons) organic or inorganic compounds).
[0081] As used herein, "peptide aptamer" refers to a molecule with
a variable peptide sequence inserted into a constant scaffold
protein (see, e.g., Baines IC, et al. Drug Discov. Today
11:334-341, 2006). In some embodiments, the molecule of the BP-NA
conjugate is a nucleic acid such as, for example, a nucleic acid
aptamer. As used herein, "nucleic acid aptamer" refers to a small
RNA or DNA molecules that can form secondary and tertiary
structures capable of specifically binding proteins or other
cellular targets (see, e.g., Ni X, et al. Curr Med Chem. 18(27):
4206-4214, 2011). Thus, in some embodiments, the BP-NA conjugate
may be an aptamer-nucleic acid conjugate.
[0082] In an important embodiments, the binding partner is an
antibody or an antigen-binding antibody fragment that binds to the
target of interest.
Targets
[0083] A target may be any molecule of interest or any binding site
on a molecule (e.g., biomolecule) of interest. Examples of targets
include, but are not limited to, proteins and nucleic acids (DNA
and/or RNA, such as mRNA). Examples of proteins include, but are
not limited to, enzymes, proteins involved in cell signaling,
ligand binding and/or localization, as well as structural proteins.
In some embodiments, the target is an epitope of a protein.
[0084] A pair of targets may be a pair if the same type of molecule
or a pair of different types of molecules. For example, a pair of
targets may include Protein A and Nucleic Acid A, Protein A and
Protein B, or Nucleic Acid A and Nucleic Acid B.
Methods
[0085] Also provided herein are methods of detecting a (at least
one) complex of two targets in a sample, the method comprising
contacting a sample with the imager strand of any one of paragraphs
29-44 and the binding partner-oligonucleotide conjugates of any one
of paragraphs 29-44, wherein the binding partner of (a) has
specificity for one of the two targets, and the binding partner of
(b) has specificity for the other of the two targets; and detecting
presence or absence of the complex in the sample.
[0086] A sample may be a biological sample, such as a tissue
sample, including a blood (e.g., serum and/or plasma) sample,
cerebrospinal fluid sample, urine sample, or other biological
sample. In some embodiments, the sample is a cell or cell lysate.
The cell may be a mammalian cell, a bacterial cell, a yeast cell or
an insect cell, for example. Other cells and lysates of cells are
encompassed herein.
[0087] A target, in some embodiments, is a biomolecule, such as a
protein or a nucleic acid. Examples of proteins of interest
include, but are not limited to, enzymes, proteins involved in cell
signaling, ligand binding and/or localization, as well as
structural proteins. Examples of nucleic acids include, but are not
limited to, DNA and RNA (e.g., mRNA), naturally occurring or
engineered (e.g., synthetic or recombinant).
[0088] In some embodiments, target complexes are located within a
sub-diffraction distance of each other. That is, when using an
optical imaging system--e.g., a microscope--the resolution of
interacting targets is diffraction limited (there is a fundamental
maximum to the resolution of any optical system which is due to
diffraction).
[0089] The conditions under which a method is performed can be
determined by one of ordinary skill in the art with an
understanding of nucleic acid hybridization kinetics. Such
conditions may be varied. For example, methods are of target
detection may be performed in reaction buffer or cell lysate having
a particular concentration of salt, as needed, and any other
necessary reagents to permit nucleic acid hybridization and
`blinking` kinetics (as discussed above).
Kits
[0090] Also provided herein are kits. Kits may include, for
example, binding partner-oligonucleotide conjugate pairs, either as
individual components (binding partner and oligonucleotide
separately) or as a conjugate (binding partner linked to
oligonucleotide) as well as imager strands, with or without labels,
as provided herein. Any component (e.g., binding partner, nucleic
acid, linker, etc.) that may be included in a composition, as
provided herein, may also be included in a kit where, for example,
individual components are packaged (e.g., in separate storage
containers) and provided together in a larger package (e.g.,
box).
[0091] The present disclosure further provides embodiments
encompassed by the following numbered paragraphs:
[0092] 1. A kit, system or composition comprising
[0093] a first binding partner-oligonucleotide conjugate comprising
a first binding partner linked to a first oligonucleotide, wherein
the first oligonucleotide comprises a first half-docking domain, a
first stability domain, and optionally a first spacer domain,
[0094] a second binding partner-oligonucleotide conjugate
comprising a second binding partner linked to a second
oligonucleotide, wherein the second oligonucleotide comprises a
second half-docking domain, a second stability domain, and
optionally a second spacer domain, wherein the first and second
stability domains are complementary to each other, and wherein the
first and second half-docking domains combine linearly to form a
full docking domain, and
[0095] an imager strand comprising a 5' domain and a 3' domain and
a linker domain between the 5' domain and the 3' domain, wherein
the 5' domain is complementary to the first half-docking domain and
the 3' domain is complementary to the second half-docking
domain.
[0096] 2. The kit, system or composition of paragraph 1, wherein
the first and second binding partners are antibodies or
antigen-binding antibody fragments.
[0097] 3. The kit, system or composition of paragraph 1 or 2,
wherein the first and second binding partners bind to first and
second proteins, wherein the first and second proteins are
different from each other.
[0098] 4. The kit, system or composition of any one of paragraphs
1-3, wherein the first and second half-docking domains are 5-7
nucleotides in length.
[0099] 5. The kit, system or composition of any one of paragraphs
1-4, wherein the first and second half-docking domains are both 6
nucleotides in length.
[0100] 6. The kit, system or composition of any one of paragraphs
1-5, wherein the first and second stability domains are 9-11
nucleotides in length. 7. The kit, system or composition of any one
of paragraphs 1-6, wherein the imager strand is 10-12 nucleotides
in length or 12-14 nucleotides in length.
[0101] 8. The kit, system or composition of any one of paragraphs
1-7, wherein the 5' and 3' domains are 6 nucleotides in length.
[0102] 9. The kit, system or composition of any one of paragraphs
1-8, wherein the linker domain is 1-5 nucleotides in length.
[0103] 10. The kit, system or composition of any one of paragraphs
1-9, wherein the linker domain comprises T residues.
[0104] 11. The kit, system or composition of any one of paragraphs
1-10, wherein the linker domain comprises a TT sequence.
[0105] 12. The kit, system or composition of any one of paragraphs
1-11, wherein the imager strand is detectably labeled.
[0106] 13. The kit, system or composition of any one of paragraphs
1-12, wherein the imager strand is fluorescently labeled.
[0107] 14. The kit, system or composition of any one of paragraphs
1-13, wherein the binding partner is conjugated to the
oligonucleotide via streptavidin and biotin.
[0108] 15. The kit, system or composition of any one of paragraphs
1-14, further comprising a complex comprising a first and a second
target, wherein the first binding partner binds or is bound to the
first target and the second binding partner binds or is bound to
the second target.
[0109] 16. The kit, system or composition of paragraph 15, wherein
the first and second targets are proteins.
[0110] 17. A plurality of the kit, system or composition of any one
of paragraphs 1-16, wherein the imager strands of different systems
are labeled with spectrally distinct labels.
[0111] 18. A plurality of the kit, system or composition of any one
of paragraphs 1-16, wherein the imager strands of the different
systems are labeled with spectrally indistinct labels.
[0112] 19. A plurality of the kit, system or composition of any one
of paragraphs 1-16, wherein at least one of the systems has a
blinking frequency that is distinct from other systems in the
plurality.
[0113] 20. A method of detecting a complex of a first and second
target in a sample, the method comprising:
[0114] contacting a sample with [0115] (a) the first and second
binding partner-oligonucleotide conjugates of any one of paragraphs
1-16 wherein the first binding partner has specificity for the
first target and the second binding partner has specificity for the
second target, and [0116] (b) the imager strand of any one of
paragraphs 1-16; and detecting presence of the complex of the first
and second target in the sample.
[0117] 21. The method of paragraph 20, wherein the sample is a cell
or cell lysate.
[0118] 22. The method of paragraph 20 or 21, wherein the first
and/or the second target is a protein
[0119] 23. The method of any one of paragraphs 20-22, wherein the
target is obtained from a cell or cell lysate.
[0120] 24. The method of any one of paragraphs 20-23, wherein the
method detects a plurality of complexes.
[0121] 25. The method of paragraph 24, wherein the plurality of
complexes is a plurality of identical complexes.
[0122] 26. The method of paragraph 24, wherein the plurality of
complexes is a plurality of different complexes.
[0123] 27. The method of any one of paragraphs 24-26, wherein a
subset of complexes within the plurality is located within a
sub-diffraction distance of each other.
[0124] 28. A kit, system or composition comprising
[0125] a first binding partner-oligonucleotide conjugate comprising
a first binding partner linked to a first oligonucleotide, wherein
the first oligonucleotide comprises a first half-docking domain, a
first stability domain, and optionally a first spacer domain,
[0126] a second binding partner-oligonucleotide conjugate
comprising a second binding partner linked to a second
oligonucleotide, wherein the second oligonucleotide comprises a
second half-docking domain, a second stability domain, and
optionally a second spacer domain, wherein the first and second
stability domains are complementary to each other, and wherein the
first and second half-docking domains combine linearly to form a
first full docking domain,
[0127] a third binding partner-oligonucleotide conjugate comprising
a third binding partner linked to a third oligonucleotide, wherein
the third oligonucleotide comprises a third half-docking domain, a
third stability domain, and optionally a third spacer domain,
wherein the first and third stability domains are complementary to
each other, and wherein the first and third half-docking domains
combine linearly to form a second full docking domain,
[0128] a first imager strand comprising a first 5' domain and a
first 3' domain and a first linker domain between the first 5'
domain and the first 3'domain, wherein the first 5' domain is
complementary to the first half-docking domain and the 3' domain is
complementary to the second half-docking domain, and
[0129] a second imager strand comprising a second 5' domain and a
second 3' domain and a second linker domain between the second 5'
domain and the second 3'domain, wherein the second 5' domain is
complementary to the first half-docking domain and the second 3'
domain is complementary to the third half-docking domain.
[0130] 29. A composition comprising:
[0131] (a) a first binding partner-oligonucleotide conjugate
comprising a binding partner linked to an oligonucleotide that
comprises a half-docking domain, a stability domain, and optionally
a spacer domain;
[0132] (b) a second binding partner-oligonucleotide conjugate
comprising a binding partner linked to an oligonucleotide that
comprises a half-docking domain, a stability domain, and optionally
a spacer domain;
[0133] wherein the stability domains of (a) and (b) are
complementary to each other, and wherein the half-docking domains
of (a) and (b) combine linearly to form a full docking domain;
and
[0134] (c) an imager strand comprising a 5' domain, a 3' domain,
and a linker domain located between the 5' domain and the 3'domain,
wherein the 5' domain is complementary to the half-docking domain
of (a) and the 3' domain is complementary to the half-docking
domain of (b).
[0135] 30. The composition of paragraph 29, wherein each of the
binding partners of (a) and (b) is an antibody or antigen-binding
antibody fragment.
[0136] 31. The composition of paragraph 29 or 30, wherein each of
the binding partners of (a) and (b) binds to a different
protein.
[0137] 32. The composition of any one of paragraphs 29-31, wherein
each of the half-docking domains of (a) and (b) has a length of
5-15 nucleotides.
[0138] 33. The composition of paragraph 32, wherein each of the
half-docking domains of (a) and (b) has a length of 5-10
nucleotides.
[0139] 34. The composition of any one of paragraphs 29-33, wherein
each of the stability domains of (a) and (b) has a length of is
5-50 nucleotides.
[0140] 35. The composition of paragraph 34, wherein the imager
strand has a length of 10-30 nucleotides.
[0141] 36. The composition of any one of paragraphs 29-35, wherein
each of the 5' domain and 3' domain of the imager strand has a
length of 5-10 nucleotides.
[0142] 37. The composition of any one of paragraphs 29-36, wherein
the linker domain has a length of 1-5 nucleotides.
[0143] 38. The composition of any one of paragraphs 29-37, wherein
the linker domain comprises thymine (T) nucleotides.
[0144] 39. The composition of any one of paragraphs 29-38, wherein
the linker domain comprises a TT sequence.
[0145] 40. The composition of any one of paragraphs 29-39, wherein
the imager strand is detectably labeled.
[0146] 41. The composition of any one of paragraphs 29-39, wherein
the imager strand is fluorescently labeled.
[0147] 42. The composition of any one of paragraphs 29-41, wherein
each of the binding partners of (a) and (b) is respectively
conjugated to the oligonucleotide of (a) and (b) via a
streptavidin-biotin binding pair.
[0148] 43. The composition of any one of paragraphs 29-42, further
comprising a complex that comprises two targets, wherein the
binding partner of (a) binds or is bound to one of the two targets,
and the binding partner of (b) binds or is bound to the other of
the two targets.
[0149] 44. The composition of paragraph 43, wherein each of the two
targets is a protein.
[0150] 45. A plurality of the composition of any one of paragraphs
29-44, wherein the imager strands of different compositions within
the plurality comprise spectrally-distinct labels.
[0151] 46. A plurality of any one of paragraphs 29-44, wherein the
imager strands of different compositions within the plurality
comprise spectrally-indistinct labels.
[0152] 47. A plurality of any one of paragraphs 29-44, wherein at
least one of the compositions of the plurality has a blinking
frequency that is distinct from other compositions in the
plurality.
[0153] 48. A method of detecting a complex of two targets in a
sample, the method comprising:
[0154] contacting a sample with the imager strand of any one of
paragraphs 29-44 and the binding partner-oligonucleotide conjugates
of any one of paragraphs 29-44, wherein the binding partner of (a)
has specificity for one of the two targets, and the binding partner
of (b) has specificity for the other of the two targets; and
[0155] detecting presence or absence of the complex in the
sample.
[0156] 49. The method of paragraph 48, wherein the sample is a cell
or cell lysate.
[0157] 50. The method of paragraph 48 or 49, wherein each of the
two targets is a protein
[0158] 51. The method of paragraph 50, wherein each of the two
targets is obtained from a cell or cell lysate.
[0159] 52. The method of any one of paragraphs 48-51, further
comprising detecting a plurality of complexes of two targets in the
sample.
[0160] 53. The method of any one of paragraphs 48-52, wherein the
plurality of complexes is a plurality of different complexes.
[0161] 54. The method of any one of paragraphs 48-53, wherein a
subset of complexes within the plurality is located within a
sub-diffraction distance of each other.
[0162] 55. A method of detecting an intramolecular interaction in a
sample, the method comprising:
[0163] contacting a sample that comprises a target molecule with
[0164] (a) a first binding partner-oligonucleotide conjugate
comprising a binding partner linked to an oligonucleotide that
comprises a half-docking domain, a stability domain, and optionally
a spacer domain, wherein the binding partner of (a) has specificity
for one location on a target molecule, [0165] (b) a second binding
partner-oligonucleotide conjugate comprising a binding partner
linked to an oligonucleotide that comprises a half-docking domain,
a stability domain, and optionally a spacer domain, wherein the
binding partner of (b) has specificity for another location on the
target molecule, wherein the stability domains of (a) and (b) are
complementary to each other, and wherein the half-docking domains
of (a) and (b) combine linearly to form a full docking domain, and
[0166] (c) a imager strand comprising a detectable label, a 5'
domain, a 3' domain, and a linker domain located between the 5'
domain and the 3'domain, wherein the 5' domain is complementary to
the half-docking domain of (a) and the 3' domain is complementary
to the half-docking domain of (b); and
[0167] detecting presence or absence of the detectable label of the
imager strand of (c) in the sample.
[0168] 56. The method of paragraph 27, wherein the sample is a cell
or cell lysate.
[0169] 57. The method of paragraph 55 or 55, wherein the target
molecule is a protein.
[0170] 58. The method of paragraph 57, wherein each of the location
of (a) and (b) is a different epitope on the protein.
[0171] 59. A composition comprising
[0172] (a) a first binding partner-oligonucleotide conjugate
comprising a binding partner linked to an oligonucleotide that
comprises a half-docking domain, a stability domain, and optionally
a spacer domain;
[0173] (b) a second binding partner-oligonucleotide conjugate
comprising a binding partner linked to an oligonucleotide that
comprises a half-docking domain, a stability domain, and optionally
a spacer domain;
[0174] wherein the stability domains of (a) and (b) are
complementary to each other, and wherein the half-docking domains
of (a) and (b) combine linearly to form a first full docking
domain;
[0175] (c) a third binding partner-oligonucleotide conjugate
comprising a binding partner linked to an oligonucleotide that
comprises a half-docking domain, a stability domain, and optionally
a spacer domain,
[0176] wherein the stability domains of (a) and (c) are
complementary to each other, and wherein the half-docking domains
of (a) and (c) combine linearly to form a second full docking
domain;
[0177] (d) an first imager strand comprising a 5' domain, a 3'
domain, and a linker domain located between the 5' domain and the
3'domain, wherein the 5' domain of the first imager strand is
complementary to the half-docking domain of (a) and the 3' domain
of the first imager strand is complementary to the half-docking
domain of (b); and
[0178] (e) a second imager strand comprising a 5' domain, a 3'
domain, and a linker domain located between the 5' domain and the
3'domain, wherein the 5' domain of the second imager strand is
complementary to the half-docking domain of (a) and the 3' domain
of the second imager strand is complementary to the half-docking
domain of (c).
EXAMPLES
Example 1
[0179] In this Example, the length and design of the linker was
analyzed. Linkers consisting of 2, 3 or 4 thymine (T) residues were
compared to each other. In addition to this, a short spacer of 1 or
2 T residues was introduced into one of the pPAINT oligonucleotides
between the half-docking site domain and the stem (or stability)
domain. These different imager strands and oligonucleotides are
illustrated in FIG. 2A. Three types of docking sites: TT, T and no
spacer between the stem domain and one half-docking domain (in
green) were evaluated with three types of imagers: TTTT, TTT and TT
linker in the middle (in orange). These combinations were analyzed
for their characteristic kinetic parameters. The best performing
imager strand with its docking site was chosen based on the kinetic
analysis, as represented by FIG. 2B. This pair was used to
determine the optimal stem length within a pool of stem designs
that ranged from 9-11bp in length, as illustrated in FIG. 2C.
[0180] In another experiment, the length of the stem domain that
holds together the pPAINT oligonucleotides prior to the binding of
the imager strand was initially determined by trying out 9, 10 and
l lbp stem domains (Table 1 lists example sequences per length)
with both strands located at a distance of 0.35 nm between each
other in each of the experiments. From these results, we concluded
that the imager strand with a TT linker in between the 5' and 3'
domains and the docking site with no spacer performed best with the
longest mean bound time and largest Kon as shown in FIGS. 3 and 4.
From these results we concluded that the best stem domains were the
11 and 10 bp long, as shown in FIGS. 5 and 6. Both lengths should
render a stem domain that will bind transiently, but long enough to
enable the imager strand to bind to the docking site.
TABLE-US-00001 TABLE 1 Sequences of the stem domains that were
tested during the optimization. Name of the stem Sequence S9V2
5'-GATGACATC-3' (SEQ ID NO: 1) S10V2 5'-TAATAAGGAT-3' (SEQ ID NO:
2) S11V1 5'-CTAACTAATTA-3' (SEQ ID NO: 3)
After choosing sequences for the imager and the two half-docking
sites, these were tested in DNA origami structures again with a
distance of 5 and 20 nm between each other. As shown in FIG. 7, a
DNA-PAINT signal was obtained, thus demonstrating that the working
range of pPAINT is at least 20 nm, in this example.
Example 2
[0181] This Example describes a benchmarking pPAINT in situ
experiment. Alpha and Beta tubulin were selected as the two
targets. The positive control (top three panels) included use of
primary antibodies against alpha and beta tubulin and secondary
antibodies against each of their primary antibody targets, each
labeled with one of the pPAINT motifs (FIG. 8). Microtubules were
visible when imaging with pP1, P16 and P38. The negative controls
included adding only one of the primary antibodies and both
secondary antibodies. For the first one, only anti alpha tubulin
was added (middle three panels) thus microtubules were visible when
using only P16. For the second negative control, only anti beta
tubulin was added and microtubules were observed only when using
P38. With the embodiments described in FIGS. 1A-1E, pPAINT can be
used to detect protein interactions by using traditional
immunolabeling techniques that require only PBS, for example, to
wash away the excess oligo-labeled antibodies.
[0182] Range of distance between the probes: up to 10 nm
TABLE-US-00002 (SEQ ID NO: 4) pP1.motif1.10nm:
ATACAACGAACTATTCGTTAGTTTGTTT (SEQ ID NO: 5) pP1.motif2.10nm:
TATTTAGTGTTCGAATAGTTCGATCTAG
[0183] Range of distance between the probes: up to 15 nm
TABLE-US-00003 pP1.motif1.15nm: (SEQ ID NO: 6) ATA CAA CGA ACT ATT
CGT TAG TTT GTT TTT TT pP1.motif2.15nm: (SEQ ID NO: 7) TT TTT ATT
TAG TGT TCG AAT AGT TCG ATC TAG
REFERENCES
[0184] Betzig, E., Patterson, G., Sougrat, R., Lindwasser, O.,
Olenych, S., Bonifacino, J., et al. (2006). Imaging intracellular
fluorescent proteins at nanometer resolution. Science , 313,
1642-5. [0185] Hell, S. &. (1994). Breaking the diffraction
resolution limit by stimulated emission:
stimulated-emission-depletion fluorescence microscopy. Opt Lett ,
19, 780-2. [0186] Hu, C., Chinenov, Y., & Kerppola, T. (2002).
Visualization of interactions among bZIP and Rel family proteins in
living cells using bimolecular fluorescence complementation.
Molecular Cell , 9, 789-798. [0187] Jungmann, R., Steinhauer, C.,
Scheible, M., Kuzyk, A., & Tinnefeld, P. &. (2010).
Single-Molecule Kinetics and Super-Resolution Microscopy by
Fluorescence Imaging of Transient Binding on DNA Origami. Nano
Letters, 10, 4756-4761. [0188] Liu, Z., Xing, D., Su, Q. P., Zhu,
Y., Zhang, J., Kong, X., et al. (2014). Super-resolution imaging
and tracking of protein--protein interactions in sub-diffraction
cellular space. Nature Communications , 5. [0189] Rust, M. J.,
Bates, M., & Zhuang, X. (2006). Sub-diffraction-limit imaging
by stochastic optical reconstruction microscopy (STORM). Nature
methods , 3, 793-5. [0190] Soderberg, O., Gullberg, M., Jarvius,
M., Ridderstrale, K., Leuchowius, K., Jarvius, J., et al. (2006).
Direct observation of individual endogenous protein complexes in
situ by proximity ligation. Nature methods , 3, 995-1000. [0191]
Winckler, P., Lartigue, L., Giannone, G., De Giorgi, F., Ichas, F.,
Sibarita, J.-B., et al. (2013). Identification and super-resolution
imaging of ligand-activated receptor dimers in live cells.
Scientific Reports , 3.
[0192] All references, patents and patent applications disclosed
herein are incorporated by reference with respect to the subject
matter for which each is cited, which in some cases may encompass
the entirety of the document.
[0193] The indefinite articles "a" and "an," as used herein in the
specification and in the claims, unless clearly indicated to the
contrary, should be understood to mean "at least one."
[0194] It should also be understood that, unless clearly indicated
to the contrary, in any methods claimed herein that include more
than one step or act, the order of the steps or acts of the method
is not necessarily limited to the order in which the steps or acts
of the method are recited.
[0195] In the claims, as well as in the specification above, all
transitional phrases such as "comprising," "including," "carrying,"
"having," "containing," "involving," "holding," "composed of," and
the like are to be understood to be open-ended, i.e., to mean
including but not limited to. Only the transitional phrases
"consisting of" and "consisting essentially of" shall be closed or
semi-closed transitional phrases, respectively, as set forth in the
United States Patent Office Manual of Patent Examining Procedures,
Section 2111.03.
Sequence CWU 1
1
719DNAArtificial SequenceSynthetic Polynucleotide 1gatgacatc
9210DNAArtificial SequenceSynthetic Polynucleotide 2taataaggat
10311DNAArtificial SequenceSynthetic Polynucleotide 3ctaactaatt a
11428DNAArtificial SequenceSynthetic Polynucleotide 4atacaacgaa
ctattcgtta gtttgttt 28528DNAArtificial SequenceSynthetic
Polynucleotide 5tatttagtgt tcgaatagtt cgatctag 28632DNAArtificial
SequenceSynthetic Polynucleotide 6atacaacgaa ctattcgtta gtttgttttt
tt 32732DNAArtificial SequenceSynthetic Polynucleotide 7tttttattta
gtgttcgaat agttcgatct ag 32
* * * * *