U.S. patent application number 15/886084 was filed with the patent office on 2018-08-09 for detection of glutathionylated proteins.
This patent application is currently assigned to The University of Vermont and State Agricultural College. The applicant listed for this patent is Universiteit Maastricht, The University of Vermont and State Agricultural College. Invention is credited to Yvonne M. Janssen-Heininger, Niki Reynaert.
Application Number | 20180224452 15/886084 |
Document ID | / |
Family ID | 38309830 |
Filed Date | 2018-08-09 |
United States Patent
Application |
20180224452 |
Kind Code |
A1 |
Janssen-Heininger; Yvonne M. ;
et al. |
August 9, 2018 |
DETECTION OF GLUTATHIONYLATED PROTEINS
Abstract
The present invention, in some aspects, relates to systems and
methods for determining oxidized proteins, including
glutathionylated proteins such as S-glutathionylated proteins. The
systems and methods of the invention can be used in vitro (e.g., in
cell or tissue culture) or in vivo, for example, to diagnose a
person having an oxidative stress condition. For instance, in some
cases, the invention can be used to spatially determine the
location and/or concentration of oxidized proteins within cells
and/or tissues (e.g., through visual detection). In one set of
embodiments, a glutathionylated or otherwise oxidized moiety on a
protein may be reacted with a detection entity, which may be, for
example, fluorescent, radioactive, electron-dense, able to bind to
a signaling entity or a binding partner in order to produce a
signal, etc. As a specific example, a glutathionylated moiety on a
glutathionylated protein may be reacted with an alkylating agent to
form an alkylthio moiety; the alkylthio moiety may include a
detection entity or otherwise be able to interact with a signaling
entity. In some embodiments, other moieties on the protein may be
altered or blocked before reaction of the protein with the
detection entity. Such moieties on the protein may be, for
instance, non-oxidized or non-glutathionylated moieties able to
react with the detection entity. As a particular example, in a
protein containing a glutathionylated moiety and
non-glutathionylated thiol moieties, the thiol moieties may first
be altered or blocked prior to reaction of the protein with the
detection entity. Also provided in certain aspects of the present
invention are kits for determining oxidized proteins, which may
include components such as detection entities, alkylating agents,
blocking agents, reducing agents, signaling entities, binding
partners, antibodies, instructions, and the like.
Inventors: |
Janssen-Heininger; Yvonne M.;
(Charlotte, VT) ; Reynaert; Niki; (Maasmechelen,
BE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The University of Vermont and State Agricultural College
Universiteit Maastricht |
Burlington
Maastricht |
VT |
US
NL |
|
|
Assignee: |
The University of Vermont and State
Agricultural College
Burlington
VT
Universiteit Maastricht
Maastricht
|
Family ID: |
38309830 |
Appl. No.: |
15/886084 |
Filed: |
February 1, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14489616 |
Sep 18, 2014 |
|
|
|
15886084 |
|
|
|
|
11698300 |
Jan 25, 2007 |
8877447 |
|
|
14489616 |
|
|
|
|
60774060 |
Feb 16, 2006 |
|
|
|
60761956 |
Jan 25, 2006 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/6893 20130101;
G01N 33/573 20130101; G01N 2800/24 20130101; G01N 33/58 20130101;
G01N 2800/122 20130101; G01N 33/6842 20130101; G01N 33/6815
20130101; G01N 2333/902 20130101 |
International
Class: |
G01N 33/573 20060101
G01N033/573; G01N 33/68 20060101 G01N033/68; G01N 33/58 20060101
G01N033/58 |
Goverment Interests
GOVERNMENT FUNDING
[0002] This invention was made with government support under Grant
Nos. NIH RO1 HL60014 and HL60812 awarded by the National Institutes
of Health, and Grant Nos. P20 RL15557 (NCRR COBRE) and PO1 HL67004
awarded by the Public Health Service. The government has certain
rights in the invention.
Claims
1. A method, comprising: providing a sample taken from a subject;
exposing the sample to an alkylating agent able to react a first
thiol moiety on a protein to produce an alkylthio moiety; exposing
the sample to a reducing agent able to react a glutathionylated
moiety on the protein to produce a second thiol moiety; diagnosing
the subject with an oxidative stress condition based on a result of
the assay; and administering, to the subject, a medicine for
treating the oxidative stress condition.
2. The method of claim 1, wherein the alkylating agent comprises a
maleimide moiety.
3. The method of claim 2, wherein the maleimide moiety comprises
N-ethylmaleimide.
4. The method of claim 1, wherein the alkylating agent comprises at
least one of 2-iodoacetamide, 2-iodoacetate,
p-chloromercuriphenylsulfonate, p-chloromercuribenzoate,
dithiobis(2-nitro)benzoic acid, N-tosyllysyl chloromethyl ketone,
6-acryloyl-2-dimethylaminonaphthalene, dansyl aziridine, acrylodan,
a benzylic halide, or a bromomethylketone.
5. The method of claim 1, wherein the reducing agent comprises a
reductase.
6. The method of claim 1, wherein the reducing agent comprises a
glutaredoxin.
7. The method of claim 1, further comprising exposing the sample to
a second alkylating agent able to react the second thiol moiety to
form a second alkylthio moiety.
8. The method of claim 7, wherein the second alkylthio moiety
comprises a detection entity.
9. The method of claim 8, further comprising determining the
detection entity, the determination being a result of the
assay.
10. The method of claim 9, wherein determining the detection entity
comprises fluorescently detecting the detection entity.
11. The method of claim 7, wherein the second alkylating agent
comprises a biotin moiety.
12. The method of claim 7, wherein the second alkylating agent
comprises N-(3-maleimidylpropionyl)biocytin.
13. The method of claim 7, further comprising providing a signaling
entity able to determine the second alkylthio moiety.
14. The method of claim 7, wherein the signaling entity comprises
an avidin or a streptavidin moiety.
15. The method of claim 7, wherein the signaling entity comprises a
fluorescent moiety.
16. The method of claim 7, wherein the signaling entity comprises
at least one of streptavidin-HRP or streptavidin-FITC.
17-96. (canceled)
97. A method, comprising: spatially determining a glutathionylated
protein in tissue in a subject by detecting a fluorescent signal
within the tissue associated with the glutathionylated protein.
98. (canceled)
99. A method, comprising: determining a glutathionylated state of a
protein within a subject; diagnosing the subject with a medical
condition based on the glutathionylated state of the protein; and
administering, to the subject, a medicine for treating the
oxidative stress condition based on the diagnosis.
100. The method of claim 99, wherein the act of determining the
glutathionylated state of the protein comprises: providing a sample
taken from the subject; exposing the sample to an alkylating agent
able to react a first thiol moiety on a protein to produce an
alkylthio moiety; and exposing the sample to a reducing agent able
to react a glutathionylated moiety on the protein to produce a
second thiol moiety.
101. (canceled)
102. The method of claim 99, wherein the medical condition is an
inflammatory condition.
103. The method of claim 99, wherein the medical condition is an
allergic airway inflammation disease.
104. The method of claim 99, wherein the medical condition is
asthma.
105. (canceled)
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 14/489,616, filed Sep. 18, 2014, entitled "Detection of
Glutathionylated Proteins," by Y. Janssen-Heininger et al., which
is a divisional of U.S. patent application Ser. No. 11/698,300,
filed Jan. 25, 2007, entitled "Detection of Glutathionylated
Proteins," by Y. Janssen-Heininger et al., which claims the benefit
of U.S. Provisional Patent Application Ser. No. 60/761,956, filed
Jan. 25, 2006, entitled "Detection of Glutathionylated Proteins,"
by Y. Janssen-Heininger; and U.S. Provisional Patent Application
Ser. No. 60/774,060, filed Feb. 16, 2006, entitled "Detection of
Glutathionylated Proteins," by Y. Janssen-Heininger. Each of these
is incorporated herein by reference.
FIELD OF INVENTION
[0003] The present invention generally relates to systems and
methods for determining oxidized proteins, and in particular, to
systems and methods for determining glutathionylated proteins. In
some cases, the present invention relates to visualization
techniques for determining the spatial locations and/or
concentrations of glutathionylated or otherwise oxidized proteins
within cells and/or tissues. In certain embodiments, the present
invention relates to methods of diagnosing subjects having
oxidative stress conditions.
BACKGROUND
[0004] The tripeptide glutathione
(2-amino-5-{[2-[(carboxymethyl)amino]-1-(mercaptomethyl)-2-oxoethyl]amino-
}-5-oxopentanoic acid, or .gamma.-glutamylcysteinylglycine) is
considered one of the major anti-oxidants of the human body, with
cellular concentrations in the millimolar range. A number of enzyme
systems exist that are dedicated to maintaining glutathione
homeostasis, including the rate-limiting enzyme for its synthesis,
.gamma. (gamma)-glutamylcysteine synthetase, and glutathione
reductase, which reduces GSSG, using NADPH as a cofactor.
Glutathione may serve a major role in maintaining the reduced state
of cellular protein thiol groups. It can accomplish this role
through the function of glutathione peroxidases, which utilize GSH
to reduce hydroperoxides. In addition, upon oxidative stress,
glutathione often spontaneously forms mixed disulfides with protein
thiol groups, causing reversible S-glutathionylation.
[0005] S-glutathionylation of thiols may confer protection against
their irreversible oxidation, like for instance the formation of
sulphonic acid moieties. If the targeted cysteine is a functionally
critical amino acid, S-glutathionylation may also modify protein
function. For instance S-glutathionylation of the p50 subunit of
NF-.kappa.B (NF-kappaB) as well as of the c-Jun subunit of AP-1 may
be linked to repression of DNA binding activity of these
transcription factors. The activities of protein kinase C,
glyceraldehyde-3-phosphate dehydrogenase, and HIV-1 protease may
also be adversely affected by S-glutathionylation.
[0006] Mammalian glutaredoxins (GRX), or thioltransferases, are
members of the thiol-disulfide oxidoreductase family. They are
often characterized by a thioredoxin fold and a
Cys-Pro-Tyr(Phe)-Cys active site. Examples include GRX1, a
cytosolic protein, and GRX2, which may be directed to the
mitochondria by a mitochondrial leader sequence and/or can also
occur in the nucleus following alternative splicing. Mammalian
glutaredoxins may specifically catalyze the reversible reduction of
protein-glutathionyl-mixed disulfides to free sulfhydryl groups,
using GSH as a cofactor. GRXs through their deglutathionylation
activity could therefore play a unique role in redox signaling.
SUMMARY OF THE INVENTION
[0007] The present invention generally relates to systems and
methods for determining oxidized proteins, such as glutathionylated
proteins. In some cases, the present invention relates to
visualization techniques for spatially determining the spatial
locations and/or concentrations of glutathionylated or otherwise
oxidized proteins within cells and/or tissues. The subject matter
of the present invention involves, in some cases, interrelated
products, alternative solutions to a particular problem, and/or a
plurality of different uses of one or more systems and/or
articles.
[0008] One aspect of the invention provides a diagnostic method. In
one set of embodiments, the diagnostic method comprises providing a
sample taken from a subject; exposing the sample to an alkylating
agent able to react a first thiol moiety on a protein to produce an
alkylthio moiety; and exposing the sample to a reducing agent able
to react a glutathionylated moiety on the protein to produce a
second thiol moiety. The method also includes diagnosing the
subject with an oxidative stress condition based on a result of the
assay, in certain embodiments.
[0009] Another aspect of the invention provides a method for
determining a glutathionylated protein. The method, in one set of
embodiments, includes the steps of reacting a first thiol moiety on
a protein to form an alkylthio moiety, reacting a glutathionylated
moiety on the protein to form a second thiol moiety, and reacting
the second thiol moiety with an alkylating agent comprising a
detection entity to form a second alkylthio moiety to determine
protein glutathionylated.
[0010] In another set of embodiments, the method is defined, at
least in part, by a step of reacting a glutathionylated moiety on a
protein to form an alkylthio moiety. In yet another set of
embodiments, the method includes the steps of reacting a first
thiol moiety on a protein to form an alkylthio moiety, and reacting
a glutathionylated moiety on the protein to form a second thiol
moiety.
[0011] In one set of embodiments, the method comprises a step of
spatially determining a glutathionylated protein in tissue. In
still another set of embodiments, the method includes a step of
non-reversibly reacting a glutathionylated moiety on a protein with
a detection entity.
[0012] In yet another set of embodiments, the method includes acts
of determining a glutathionylated state of a protein within a
subject, and diagnosing the subject with a medical condition based
on the glutathionylated state of the protein.
[0013] A kit is provided in another aspect of the invention. In
certain embodiments, the kit includes a container housing an
alkylating agent and a reducing agent. In some cases, the
alkylating agent is able to react a first thiol moiety on a protein
to an alkylthio moiety, and the reducing agent is able to react a
glutathionylated moiety on the protein to a second thiol
moiety.
[0014] In another aspect, the present invention is directed to a
method of promoting one or more of the embodiments described
herein.
[0015] Other advantages and novel features of the present invention
will become apparent from the following detailed description of
various non-limiting embodiments of the invention when considered
in conjunction with the accompanying figures. In cases where the
present specification and a document incorporated by reference
include conflicting and/or inconsistent disclosure, the present
specification shall control.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Non-limiting embodiments of the present invention will be
described by way of example with reference to the accompanying
figures, which are schematic and are not intended to be drawn to
scale. In the figures, each identical or nearly identical component
illustrated is typically represented by a single numeral. For
purposes of clarity, not every component is labeled in every
figure, nor is every component of each embodiment of the invention
shown where illustration is not necessary to allow those of
ordinary skill in the art to understand the invention. In the
figures:
[0017] FIGS. 1A and 1B are schematic diagrams for determining
glutathionylated proteins according to one embodiment of the
invention;
[0018] FIGS. 2A-2E are photomicrographs of cells demonstrating the
visualization of glutathionylated proteins in cells, according to
another embodiment of the invention;
[0019] FIGS. 3A-3J are photomicrographs of cells illustrating
increased glutaredoxin activity in cells exposed to certain
oxidants, in yet another embodiment of the invention;
[0020] FIGS. 4A-4D are photomicrographs of cells illustrating
depletion of glutathione, in still another embodiment of the
invention; and
[0021] FIGS. 5A-5J illustrate the manipulation of GRX1 expression,
in yet another embodiment of the invention.
BRIEF DESCRIPTION OF THE SEQUENCES
[0022] SEQ ID NO: 1 is CATGGCTCAGGAGTTTGTGA, a primer sequence;
[0023] SEQ ID NO: 2 is GCCACCCCTTTTATAACTGC, a primer sequence;
[0024] SEQ ID NO: 3 is
CCGGATCCATGTACCCATACACGTCCCAGACTACGCTGCTCAGGAGTTTTGT GAACTG, a
primer sequence; and
[0025] SEQ ID NO: 4 is GCCACCCCTTTTATAACTGCGAATTCCGG, a primer
sequence.
DETAILED DESCRIPTION
[0026] The present invention, in some aspects, relates to systems
and methods for determining oxidized proteins, including
glutathionylated proteins such as S-glutathionylated proteins. The
systems and methods of the invention can be used in vitro (e.g., in
cell or tissue culture) or in vivo, for example, to diagnose a
subject as having an oxidative stress condition. For instance, in
some cases, the invention can be used to spatially determine the
location and/or concentration of oxidized proteins within cells
and/or tissues (e.g., through visual detection). In one set of
embodiments, a glutathionylated or otherwise oxidized moiety on a
protein may be reacted with a detection entity, which may be, for
example, fluorescent, radioactive, electron-dense, able to bind to
a signaling entity or a binding partner in order to produce a
signal, etc. As a specific example, a glutathionylated moiety on a
glutathionylated protein may be reacted with an alkylating agent to
form an alkylthio moiety; the alkylthio moiety may include a
detection entity or otherwise be able to interact with a signaling
entity. In some embodiments, other moieties on the protein may be
altered or blocked before reaction of the protein with the
detection entity. Such moieties on the protein may be, for
instance, non-oxidized or non-glutathionylated moieties able to
react with the detection entity. As a particular example, in a
protein containing a glutathionylated moiety and
non-glutathionylated thiol moieties, the thiol moieties may first
be altered or blocked prior to reaction of the protein with the
detection entity. Also provided in certain aspects of the present
invention are kits for determining oxidized proteins, which may
include components such as detection entities, alkylating agents,
blocking agents, reducing agents, signaling entities, binding
partners, antibodies, instructions, and the like.
[0027] Various aspects of the present invention relate to systems
and methods for determining oxidized proteins, including
glutathionylated proteins such as S-glutathionylated proteins. In
some aspects, the present invention relates to visualization
techniques for spatially determining the spatial locations and/or
concentrations of glutathionylated or otherwise oxidized proteins
within cells and/or tissues. An "oxidized" protein, as used herein,
is a protein in which at least one (native) amino acid residue of
the protein has been oxidized in some fashion. As an example,
glutathione may react with a residue on the protein to
glutathionylate the residue. Thus, as used herein, a
"glutathionylated" protein is a protein in which at least one amino
acid residue of the protein has been glutathionylated, i.e., the
amino acid residue has reacted with gluatathione, typically through
the addition of the gluatathione (or a portion thereof) to the
residue. Residues that may undergo reactions with glutathione
include sulfhydryl moieties (--SH) (e.g., from a cysteine residue),
hydroxyl moieties (--OH) (e.g., from a serine residue or a
threonine residue), or the like. As a particular example, if the
residue includes a sulfhydryl moiety (--SH) (also referred to as a
thiol moiety), reaction of the moiety with glutathione can produce
a S-glutathionylated moiety, i.e., --S--S-G, where "G" represents
the glutathione tripeptide). The "S--" signifies reaction with the
sulfhydryl moiety.
[0028] It should be understood that, in the following descriptions,
although the determination of oxidized proteins is often described
in terms of the determination of S-glutathionylated proteins, this
is by way of example only, and the determination of other types of
oxidized proteins and/or glutathionylated proteins is also within
the scope of the invention. As used herein, "determining" refers to
the detection and/or analysis of an entity, either quantitatively
or qualitatively. Determination of an entity may include
determination of the presence or absence of the entity, and/or a
measurement of the amount or degree of the entity, e.g., the
concentration of the entity, the density of the entity, etc. In
some cases, the location of an entity may be determined, for
example, the location of the entity within a cell, within a tissue,
etc.
[0029] According to one aspect, an oxidized protein can be
determined by attaching a detection entity to an oxidized residue
on the protein, for example, the protein may be spatially or
visually determined. As used herein, a "detection entity" is an
entity that can be determined in some fashion, either directly or
indirectly. For instance, the detection entity may be fluorescent,
radioactive, electron-dense, a member of a binding pair, a
substrate for an enzymatic reaction, an antigen for an antibody,
etc. In some cases, the detection entity itself is not directly
determined, but instead interacts with a second entity (a
"signaling entity") in order to effect determination; for example,
coupling of the signaling entity to the detection entity may result
in a determinable signal. As examples, the detection entity and the
signaling entity may each include one member of a binding pair, for
example, nucleic acid/nucleic acid, nucleic acid/protein,
protein/protein, antibody/antigen, antibody/hapten,
enzyme/substrate, enzyme/inhibitor, enzyme/cofactor,
receptor/hormone, receptor/effector, ligand/cell surface receptor,
virus/ligand, etc. The term "binding partner," as used herein,
refers to a molecule that can undergo binding with a particular
molecule, forming a "binding pair." Thus, as an example, the
detection entity may include a biotin moiety and the signaling
entity may include an avidin or a streptavidin moiety that is
determinable in some fashion, for example, by being coupled to a
radioactive, a fluorescent moiety, an electron-dense moiety, etc.
As another example, the signaling entity may be an antibody able to
recognize the detection entity on the protein. The antibody may be
labeled in some way, for example, radioactively, fluorescently,
using an electron-dense moiety, etc.
[0030] In some embodiments, the detection entity may be added to
the oxidized residue using an alkylating agent, for example,
directly by reacting the oxidized residue directly with an
alkylating agent, indirectly by reducing the oxidized residue and
thereafter reacting the reduced residue with an alkylating agent,
etc. As used herein, an "alkylating agent" is an agent able to
alkylate a target reactant, i.e., the agent interacts with the
target reactant such that an alkyl moiety is added to the target
reactant (i.e., the compound becomes "alkylated"). In some cases,
the alkylating agent itself may include the alkyl moiety that is
transferred to the target reactant, e.g., the alkylating agent
causes the formation of a covalent bond between the alkyl moiety
and the target reactant. Typically, when the target reactant is a
protein, the alkylating agent is able to react with the protein to
cause alkylation of at least one moiety on the protein, in some
cases without denaturing or otherwise damaging the protein. As one
particular example, the alkylating agent may alkylate a thiol
(--SH) moiety on a protein (e.g., from a cysteine residue) to form
an alkylthio (--SR) moiety, where R is an alkyl moiety and "--"
indicates attachment to the protein. It is to be noted that an
alkylthio moiety does not include a disulfide (--SSR) moiety. As
another example, the alkylating agent may alkylate a hydroxy (--OH)
moiety on the protein (e.g., from a serine residue or threonine
residue) to form an alkoxy (--OR) moiety. In some cases, in order
to prevent or reduce signal interference with non-oxidized residues
on the protein and/or from other, non-oxidized proteins, a blocking
reaction is provided by the invention, where the non-oxidized
residues are blocked or inhibited in some fashion, prior to the
attachment of the detection entity on the oxidized residues.
[0031] As used herein, an "alkyl" moiety, attached to a residue, is
a moiety containing at least one carbon atom that is covalently
bound to the residue, and may include any number of carbon atoms,
for example, between and 1 and 25 carbon atoms, between 1 and 20
carbon atoms, between 1 and 15 carbon atoms, between 1 and 10
carbon atoms, or between 1 and 5 carbon atoms. In some embodiments,
the alkyl moiety will contain at least 1 carbon atom, at least 3
carbon atoms, at least 5 carbon atoms, or at least 10 carbon atoms;
in other embodiments, the alkyl moiety will have at most 10 carbon
atoms, at most 5 carbon atoms, or at most 3 carbon atoms. The alkyl
moiety may be a non-cyclic or a cyclic moiety. The carbon atoms
within the alkyl moiety may be arranged in any configuration within
the alkyl moiety, for example, as a straight chain (i.e., a n-alkyl
such as methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl,
etc.), a branched chain, i.e., a chain where there is at least one
carbon atom covalently bonded to at least three carbon atoms (e.g.,
a t-butyl moiety, an isoalkyl moiety such as an isopropyl moiety or
an isobutyl moiety, etc.), a ring structure (e.g., cyclopropyl,
cyclobutyl, cyclopentyl), etc. or any combination thereof. The
alkyl moiety may contain only single bonds, or may contain one or
more double and/or triple bonds within its structure, for example,
as in an alkene, an alkyne, an alkadiene, an alkadiyne, an
alkenyne, etc. In some cases, the alkyl moiety contains only carbon
and hydrogen atoms; however, in other embodiments, the alkyl moiety
may also contain one or more substituents, i.e., a non-carbon,
non-hydrogen moiety may be present within the alkyl moiety, e.g.,
the alkyl moiety may be "heterogeneous," as in a heterocycloalkyl
moiety. In certain embodiments, the alkyl moiety can include a
halogen such as chlorine or bromine, an alkoxy moiety, an amine
moiety, a carbonyl, a hydroxide, etc. If more than substituent is
present within the alkyl moiety, then the substituents may each
independently be the same or different.
[0032] In one set of embodiments, a glutathionylated protein is
determined by reacting a glutathionylated moiety on the protein to
form an alkylthio moiety, for example, spatially determined (e.g.,
through visualization). In some cases, the alkylthio moiety may
include a detection entity. An example of such a reaction is the
initial reduction of a glutathionylated moiety on the protein to a
thiol moiety, followed by alkylation of the thiol moiety to form an
alkylthio moiety. Any suitable reaction able to convert the
glutathionylated moiety on the protein to a thiol moiety may be
used, for example, reduction of the glutathionylated moiety. In one
embodiment, the glutathionylated moiety is reduced by exposing the
protein to a reducing agent. A "reducing agent," as used herein, is
given its ordinary meaning in the art, i.e., an agent that is able
to cause a reactant to attain a more negative oxidation state. An
example of a reducing agent of a glutathionylated moiety is a
glutaredoxin, which catalyzes the reduction of the moiety to a
thiol moiety. Non-limiting examples of glutaredoxin include GRX1
(GLRX) and GRX2 (GLRX2) in mammals. Other examples of reducing
agents include, but are not limited to, an ascorbate (for example,
sodium ascorbate or potassium ascorbate), dithiothreitol (DTT),
glutathione (GSH), NADPH, NADH, beta-mercaptoethanol,
tris-(2-carboxyethyl)phosphine, tris-(2-cyanoethyl)phosphine,
etc.
[0033] The thiol moiety (--SH) may then be reacted to produce an
alkylthio moiety (--SR), which may include a detection entity in
some cases, for example, a binding partner such as biotin or
avidin, a fluorescent moiety, a radioactive moiety, or the like. As
an example, the thiol moiety may be exposed to an alkylating agent
able to react with the thiol moiety to form an alkylthio moiety.
For example, in one embodiment, the alkylating agent can include a
maleimide moiety. In some cases, the maleimide may be covalently
bonded to a detection entity, for example, a biotin moiety or a
fluorescent moiety. As a specific non-limiting example, the
alkylating agent may be N-(3-maleimidylpropionyl)biocytin (MBP) (or
N-[6-(biotinamido)hexyl]-3-(2-pyridyldithio)propionamide), and/or a
derivative thereof. As used herein, a "maleimide moiety" is a
moiety having a general maleimide structure, e.g.:
##STR00001##
where each of R.sup.1, R.sup.2, and R.sup.3 independently is a
hydrogen atom (i.e., maleimide) or represents other, non-hydrogen
atoms or group of atoms, for example, halogens, alkyls, alkoxyls,
etc. In some cases, at least one of R.sup.1, R.sup.2, and R.sup.3
may indicate attachment of the maleimide moiety to a fluorescent
moiety, a biotin moiety (e.g., as in MBP), etc. Additionally, as
used herein, a "biotin moiety" is a moiety having a general biotin
structure, e.g.:
##STR00002##
where each A in the above structure independently is a hydrogen
atom (i.e., biotin) or represents other, non-hydrogen atoms or
group of atoms, for example, halogens, alkyls, alkoxyls, etc. In
some cases, at least one A in the above structure may indicate
attachment of the biotin moiety to other moieties, for example, a
fluorescent moiety.
[0034] In another embodiment, the alkylating agent includes an
iodoacetamide moiety or an iodoacetate moiety, for example, as in
2-iodoacetamide or 2-iodoacetate, respectfully. In yet another
embodiment, the alkylating agent includes at least one of
p-chloromercuriphenylsulfonate, p-chloromercuribenzoate,
dithiobis(2-nitro)benzoic acid, N-tosyllysyl chloromethyl ketone,
6-acryloyl-2-dimethylaminonaphthalene, dansyl aziridine, acrylodan,
a benzylic halide, or a bromomethylketone. In some embodiments,
more than one alkylating agent may be present, for example,
N-ethylmaleimide and 2-iodoacetamide or 2-iodoacetate, etc.
[0035] In some cases, when other, unmodified thiol moieties are
present within the protein and/or within other, proximate proteins
near the protein suspected of being glutathionylated (or otherwise
oxidized), the unmodified (i.e., non-glutathionylated) thiol
moieties may be initially blocked or otherwise altered before the
glutathionylated moiety is converted into an alkylthio moiety, such
that the unmodified thiol moieties are not able to react in the
same fashion as the glutathionylated moieties, which may confound
the determination and analysis of the glutathionylated moieties. In
other cases, however, some side reactions involving other
unmodified thiol moieties on the protein suspected of being
glutathionylated and/or other, proximate proteins may be tolerable,
as long as determination of glutathionylation within the protein
can still be performed, for example, in in vitro assays, in protein
studies, through visualization, or the like. Blocking or otherwise
altering unmodified thiol moieties may be useful in some
embodiments in isolating and/or boosting determination of any
glutathionylated moieties on the protein suspected of being
glutathionylated, relative to unrelated, unmodified thiol moieties.
Any suitable techniques for blocking unmodified thiol groups on a
protein from reaction may be used. For example, thiol moieties on
the protein may first be converted to alkylthio moieties (which
typically will not contain detection entities), prior to reaction
of the glutathionylated moieties to form alkylthio moieties
containing detection entities. As a non-limiting example,
unmodified thiol moieties on a protein may be reacted with
N-ethylmaleimide (NEM), methyl methanothiosulfonate, and/or
derivatives thereof, prior to reaction/determination of
glutathionylated moieties in the protein, for example, using
MBP.
[0036] In one set of embodiments, the detection entity can be
directly determined, e.g., spatially, for example, through the use
of fluorescence detection techniques such as spectroscopy,
radioactivity, electron microscopy, etc. In other embodiments,
however, the detection entity is indirectly determined, for
example, through interaction of the detection entity with a
signaling entity. For example, the signaling entity and the
detection entity may together form a binding pair, e.g., as
previously described. Typically, the signaling entity is externally
determined, for example, using radioactivity, fluorescence,
electron microscopy, etc. As a non-limiting example, if the
detection entity comprises a biotin moiety, the signaling entity
may include an avidin moiety, a streptavidin moiety, a biotin
antibody, etc; the signaling entity may also include a fluorescent
moiety, an enzymatic moiety, a radioactive atom, etc. Specific,
non-limiting examples include streptavidin horseradish peroxidase
(streptavidin-HRP), streptavidin fluorescein, or streptavidin
fluorescein isothiocyanate (streptavidin-FITC). In some cases, the
detection entity can also be determined as a function of time, for
example, by real-time imaging, e.g., via fluorescence, MRI, or the
like. As a specific example, a detection entity, such as GSH, may
be labeled with a fluorescent entity, and detected in real time via
fluorescence microscopy.
[0037] The invention, in another aspect, may be used to determine a
characteristic of a protein in vivo or in vitro. In one set of
embodiments, a protein may be detected in vitro or in isolation,
e.g., within a protein assay, for example, within a 96-well plate
or other microwell plate. For instance, an embodiment of the
invention may be used to determine oxidized proteins such as
glutathionylated proteins in a sample, e.g., a synthetically
prepared sample, a sample from cell culture or tissue culture, a
cell lysate, and/or a sample from a subject, such as a human, a
non-human primate, a cow, a horse, a pig, a sheep, a goat, a dog, a
cat or a rodent such as a mouse, a rat, a hamster, a guinea pig,
etc. A "sample," as used herein, is any cell, body tissue, or body
fluid sample obtained from a subject. Examples of body fluids
include lymph, saliva, blood, plasma, urine, lung fluid and the
like. Samples of tissue and/or cells for use in the various methods
described herein can be obtained through standard methods
including, but not limited to, tissue biopsy, including punch
biopsy and cell scraping, needle biopsy; or collection of blood or
other bodily fluids by aspiration or other suitable methods. In
some cases, the tissue samples may be frozen, embedded in paraffin,
or the like.
[0038] In another set of embodiments, oxidized proteins such as
glutathionylated proteins may be determined in an intact cell. The
intact cell may be alive, or the intact cell may be fixed in some
cases. Determination of the protein in the cell may include
determining the presence or absence of the proteins within the
cell, determining the concentration of the proteins within the
cell, and/or determining the location of the proteins within the
cell, e.g., within organelles within the cell, such as within the
nucleus, within mitochondria, within lysosomes, etc.
[0039] The invention, in yet another set of embodiments, provides
for the determination of oxidized proteins such as glutathionylated
proteins within tissue, for example, brain tissue, lung tissue,
etc. In some embodiments, such determination of the
glutathionylated and/or other oxidized proteins within the tissue
allows the spatial locations and/or concentrations of the proteins
within the tissues to be identified and/or measured, for example,
quantitatively. The tissue may be alive, or fixed in some cases.
Determination of the oxidized proteins may include determining the
amount of protein present, and/or determining the spatial location
of the oxidized proteins within the tissue, or within portions of
the tissue (e.g., within certain structures comprising the tissue,
within certain cells within the tissue, within certain regions of
cells within the tissue, etc.). Thus, as a non-limiting example, a
reaction where glutathionylated proteins become fluorescent may be
used, according to the invention, to resolve the location of
glutathionylated proteins within a tissue sample, such as within
lung tissue.
[0040] In still another set of embodiments, the invention provides
for the determination of oxidized proteins, such as
glutathionylated proteins, within a subject. For example, the
invention may be used to diagnose a subject as having an oxidative
stress condition, according to one embodiment, e.g., determining
the subject with an oxidative stress condition or not, and/or to
the degree to which a subject has an oxidative stress condition.
Thus, determination of a glutathionylated protein within a subject
may used as a biomarker for the oxidative stress condition. In a
subject, an oxidative stress condition may be caused by certain
types of chronic diseases or conditions, for example, airway
inflammation, aging, asthmas, emphysema, cancers, rheumatoid
arthritis, atherosclerosis, alcohol addition, certain types of
cardiovascular disease, certain types of chronic inflammatory
diseases, or certain types of neurodegenerative diseases, such as
Lou Gehrig's Disease, Parkinson's Disease, Alzheimer's Disease,
sporadic amytrophic lateral sclerosis, or Huntington's Disease.
Such diseases are often characterized by chronic altered metabolic
states in which there are elevated concentrations of certain
reactive oxygen species, such as superoxides, singlet oxygens,
peroxynitrite, ozone, or hydrogen peroxide. In some cases, the
reactive oxygen species are created by external factors, such as
radiation or ultraviolet light. Other agents that may lead to
oxidized proteins include, but are not limited to, chemical
reagents such as hydrogen peroxide, NO.sub.x species, or the like,
or certain types of biological reactions, such as enzymes that
produce oxidative intermediate species (e.g., metabolic enzymes).
In one embodiment, the oxidative stress condition may be diagnosed
within a subject by providing a sample taken from the subject
(e.g., a blood sample, cells, fluid, etc.), exposing the sample to
a reducing agent, such as an enzyme, able to interact with certain
proteins within the sample (e.g., an enzyme or other reducing agent
able to react with glutathione or nitroso groups on the protein),
and determining if the proteins have been oxidized and in some
cases, to what degree. Based on the results of this assay, the
subject may be diagnosed as having an oxidative stress condition,
which may be indicative of certain diseases, as previously
described. Non-limiting examples of suitable reducing agents are
described herein, for instance, glutaredoxin. In certain
embodiments, blocking reactions may also be used. For instance,
prior to exposure of the sample to a reducing agent, the sample may
be exposed to an alkylating agent, for instance, to react with
non-oxidized thiol moieties.
[0041] In some cases, use of an enzyme may offer a high degree of
specificity, e.g., with respect to oxidized glutathionylated
moieties on the proteins, relative to other, non-glutathionylated
moieties on the protein. In some embodiments, such a method may be
used to determine whether a subject exhibits an oxidative stress
condition, for example, a chronic inflammatory disease, asthma,
cancers, or the like, irrespective of the disease or condition that
a subject has. Thus, the method can be used for a broad array of
diseases or conditions, in contrast to other tests which are often
specific to a particular protein or molecule, and thus may miss or
incorrectly diagnose, other, similar oxidative stress conditions
that a subject may have. In some cases, such a diagnosis may be
followed by the prescription and/or administration, to the subject,
of a therapeutic intervention, for example, the application of a
medicine to treat the subject, etc. In certain embodiments, one or
more specific proteins and/or enzymes may be used as biomarkers to
determine whether a subject exhibits an oxidative stress
condition.
[0042] The oxidized protein (e.g., glutathionylated proteins), in
some embodiments, may also be spatially determined or resolved
within a cell or tissue. For example, an oxidized protein may be
determined to be within a cell and/or within a portion of the cell,
such as within an organelle, for example, within the nucleus of the
cell. In some cases, for instance, certain cells express
glutathionylated proteins preferentially within the nucleus, e.g.,
as further described in the examples, below. In some instances, the
concentration and the location of oxidized protein within the cell
or tissue may both be determined. For instance, by using
fluorescent and/or radioactive signals indicative of oxidized
proteins, as previously described, the strength of the respective
fluorescent and/or radioactive signal(s) may be correlated with the
concentration of oxidized proteins, while the spatial location of
the signal(s) may be correlated with the location of the oxidized
proteins within the cell/or tissue.
[0043] Non-limiting examples of techniques that may be useful in
determining oxidized proteins (for instance, oxidized proteins
within a cell or a tissue that are reacted with a fluorescent
detection entity, and/or a detection entity able to interact with a
signaling entity that is or can become fluorescent upon interaction
with the detection entity) include fluorescence detection
techniques such as spectrofluorimetery, fluorescence microscopy,
confocal microscopy, microwell plate readers (for example, for
24-well plates, 96-well plates, 384-well plates, or the like),
fluorescence photobleaching recovery techniques,
fluorescence-activated cell sorting techniques, etc. Other
techniques for determining fluorescence will be known to those of
ordinary skill in the art. Thus, as non-limiting examples, a
fluorescent detection entity or a fluorescent signaling entity may
be detected in a protein solution, a cell lysate, a cell
suspension, etc., using spectrofluorimetery techniques, microwell
plate readers, or the like, while a fluorescent detection entity or
a fluorescent signaling entity may be detected in live and/or
intact cells or tissue using fluorescence microscopy, confocal
microscopy techniques, etc. As another example,
fluorescence-activated cell sorting techniques may be used to sort
cells having or expressing a certain amount of oxidized proteins
from cells that do not have or express those oxidized proteins. In
some cases, samples from multiple subjects may be determined
simultaneously, or in rapid succession. For example, in one set of
embodiments, a microwell plate reader may be used to determine a
plurality of sample from different subjects, for example, in a
96-well plate format, in a 384-well plate format, or the like.
[0044] Other examples of techniques that may be useful for
determining oxidized proteins include radioactivity detection
techniques such as scintillation counters, radioimmunoassay
techniques, radiosensitive films, etc. Thus, in one example, cells
or tissues containing oxidized proteins that are reacted with a
radioactivity detection entity, and/or a detection entity able to
interact with a radioactivity signaling entity, may be placed
proximate radiosensitive film. The degree of radioactive exposure
of the film may be indicative of the concentration of oxidized
proteins within the cell or tissue, while the spatial location of
the radioactive exposure may be indicative of the spatial
distribution of oxidized proteins. Other suitable radioactivity
detection techniques will be known to those of ordinary skill in
the art.
[0045] Still other examples of techniques useful for determining
oxidized proteins include detection techniques based on electron
densities, for example, electron microscopy, such as TEM or SEM. As
an example, a cell or a tissue containing oxidized proteins can be
reacted with "heavy" or electron-dense moieties. As used herein, an
"electron-dense moiety" is a moiety having an electron density
determinably greater than the electron density of the atoms
comprising the cell or tissue. Non-limiting examples of
electron-dense moieties include gold, osmium, uranium, lead,
platinum, chromium, palladium, etc., for example, present as
individual atoms (e.g., in a chemical structure), as colloids or
microspheres, or the like. A specific non-limiting example is
MPB-labeled gold.
[0046] In one set of embodiments, binding of the detection entity
to the protein is generally non-reversible, i.e., the detection
entity may be bound to the protein under relatively benign
conditions, but removal of the detection entity from the protein
occurs under relatively harsh conditions, and in some cases, the
detection entity cannot be removed from the protein without
damaging and/or denaturing the protein. One non-limiting example
method of determining reversibility is as follows. The detection
entity is radiolabeled and reacted with the protein of interest.
The unreacted label is removed, and the amount of radioactivity
incorporated into the protein is determined, in the presence and in
the absence of reducing agent. If the radiolabeled detection entity
is reversibly attached, then the amount of radioactivity
incorporated into the protein will be different for samples
determined in the presence and in the absence of reducing agent;
conversely, if the radiolabeled detection entity is non-reversibly
attached, then the amount of radioactivity incorporated into the
protein will be substantially the same in the presence and in the
absence of the reducing agent. Other methods of determining
reversibility include using fluorescence, electron-dense moieties,
etc.
[0047] In yet another aspect, the present invention provides a kit
suitable for determining glutathionylated proteins and other
oxidized proteins, e.g., in vitro or in vivo, as previously
described, optionally including instructions for use of the kit.
The kit may include one or more of an alkylating agent, a detection
entity, a reducing agent, a signaling entity, antibodies,
instructions, suitable containers, or the like. Each of the
compositions of the kit, where applicable, may be provided in
liquid form (e.g., in solution), or in solid form, (e.g., a dry
powder). In certain cases, some of the compositions may be
constitutable or otherwise processable (e.g., to an active form),
for example, by the addition of a suitable solvent or other species
(for example, water or a cell culture medium), which may or may not
be provided with the kit. As used herein, "instructions" can define
a component of instruction and/or promotion, and typically involve
written instructions on or associated with packaging of the
invention. Instructions also can include any oral or electronic
instructions provided in any manner such that a user will clearly
recognize that the instructions are to be associated with the kit,
for example, audiovisual (e.g., videotape, DVD, etc.), Internet,
and/or web-based communications, etc. As an example, in one
embodiment, the kit may include instructions for exposing a sample
(e.g., taken from a subject) to a method as described herein for
diagnosing the subject as having an oxidative stress condition,
e.g., by determining if proteins within the sample have been
oxidized and in some cases, to what degree, using the methods as
described herein. For instance, the sample may be exposed to an
alkylating agent and a reducing agent (such as a glutaredoxin), as
described above. As another example, the kit may include
instructions for diagnosing an oxidative stress condition in a
subject, and prescribing or applying a therapeutic method based on
the diagnosis for example, medicine or other therapeutic
interventions. The kit may also include other components, depending
on the specific application, for example, containers, cell media,
salts, buffers, reagents, syringes, needles, etc.
[0048] In still another aspect, the invention includes the
promotion of one or more of the above-described embodiments. As
used herein, "promoted" includes all methods of doing business,
including methods of education, scientific inquiry, academic
research, industry activity including pharmaceutical industry
activity, and any advertising or other promotional activity
including written, oral and electronic communication of any form,
associated with the invention.
[0049] The following applications are incorporated herein by
reference: U.S. Provisional Patent Application Ser. No. 60/761,956,
filed Jan. 25, 2006, entitled "Detection of Glutathionylated
Proteins," by Y. Janssen-Heininger; and U.S. Provisional Patent
Application Ser. No. 60/774,060, filed Feb. 16, 2006, entitled
"Detection of Glutathionylated Proteins," by Y.
Janssen-Heininger.
[0050] The following examples are intended to illustrate certain
aspects of certain embodiments of the present invention, but do not
exemplify the full scope of the invention.
EXAMPLE 1
[0051] This example describes certain protocols and methods that
may be useful in various embodiments of the invention.
[0052] A line of spontaneously transformed mouse alveolar type II
epithelial cells (C10) was used in some experiments. The C10 cells
were propagated in cell culture media-1066 containing 50 units/ml
penicillin and 50 mg/ml streptomycin ("P/S"), 2 mM L-glutamine, and
10% FBS (fetal bovine serum), all from GIBCO/BRL. For experiments
involving microscopic analysis, cells were grown on glass
coverslips. One hour before exposure to test agents the cells were
switched to phenol red free DMEM/F12, containing 0.5% FBS and
P/S.
[0053] The primary epithelial cells were isolated from C57BL/6
according to techniques known to those of ordinary skill in the
art, with minor modifications. Briefly, trachea were cannulated,
filled with MEM media containing 0.1% Protease 14, tied-off and
removed from the mouse. After overnight incubation at 4.degree. C.
in MEM, the cells were dislodged by opening the ends of the trachea
and flushing through 5 ml of MEM containing 10% FBS. The Cells were
pelleted and plated on collagen gel coated tissue culture flasks in
DMEM/F12 media containing 20 ng/ml cholera toxin, 4 microgram/ml
insulin, 5 microgram/ml transferrin, 5 microgram/ml bovine
pituitary extract, 10 ng/ml EGF (epidermal growth factor), 100 nM
dexamethasone, 2 mM L-glutamine and P/S. For each experiment, the
cells were plated on collagen I-coated glass slides. All reagents
were purchased from Sigma unless otherwise stated.
[0054] Vector construction and transfection was performed using
techniques known to those of ordinary skill in the art, as follows.
Full length mouse glutaredoxin ("GRX1") was amplified from mouse
lung cDNA using PCR with 5'-CATGGCTCAGGAGTTTGTGA-3' (SEQ ID NO: 1)
as the 5'-primer and 5'-GCCACCCCTTTTATAACTGC-3' (SEQ ID NO: 2) as
3'-primer and inserted into TA cloning vector. GRX1 was amplified
from this vector using 5'-primer
5'-CCGGATCCATGTACCCATACACGTCCCAGACTACGCTGCTCAGGAGTTTTGT GAACTG-3'
(SEQ ID NO: 3) that introduced a BamHI site, a start codon and HA
sequence and as the 3'-primer, 5'-GCCACCCCTTTTATAACTGCGAATTCCGG-3'
(SEQ ID NO: 4), inserting an EcoRI site and a stop codon. The
amplified fragment was digested using BamHI and EcoRI and cloned
into pcDNA3 expression vector.
[0055] Nox and Duox are H.sub.2O.sub.2 generating enzymes. Plasmids
for Nox1, p41 Nox and p51 Nox were gifts of Dr. David Lambeth,
Emory University, Atlanta, Ga. The C10 cells were transfected with
1 microgram HA-GRX1 or pcDNA3 or 0.5 microgram of Nox1 plus 0.5
microgram of p41 Nox plus 0.5 microgram of p51 Nox according to the
manufacture's directions (Lipofectamine Plus, Invitrogen) and 24 h
after transfection, test agents were added.
[0056] Control and GRX1 siRNA (Ambion) were transfected into C10
cells at a concentration of 20 nM using siPORTamine according to
the manufacture's directions. At 48 h after transfection, the test
agents were added and the experiments performed.
[0057] For GRX1 immunocytochemistry, the cells were exposed to test
agents, washed twice with PBS (phosphate-buffered saline) and fixed
with 4% PFA for 10 min at RT (room temperature, about 25.degree.
C.). After three washes with PBS, the cells were permeabilized and
blocked simultaneously with PBS containing 0.5% triton and 2% BSA
for 10 min at RT. Next, the cells were incubated with rabbit
anti-human GRX1 antibody (American Diagnostics), diluted 1:100 in
blocking buffer, for 1 h at RT. After three washes with PBS, the
cells were incubated for 1 h with goat anti-rabbit Cy-3 in blocking
buffer. The nuclei were counterstained with Sytox green (Molecular
Probes) for 5 min at RT, the coverslips were mounted and cells
analyzed by confocal microscopy using an Olympus BX50 microscope
coupled to a Bio-Rad MRC 1024 confocal scanning laser microscope
system.
[0058] The assessment of GRX catalyzed cysteine derivatization to
visualize protein-S-glutathionylation in intact cells was performed
as follows. The cells were exposed to test agents, washed twice
with PBS and fixed with 4% PFA (paraformaldehyde) for 10 min at RT.
After three washes with PBS, cells were permeabilized and free
sulfhydryl groups blocked with buffer containing 25 mM Hepes, pH
7.7, 0.1 mM EDTA, 0.01 mM neocuproine, 20 mM N-ethylmaleimide and
0.5% Triton X-100 for 30 min at 4.degree. C. After three washes
with PBS, S-glutathionyl mixed disulfides were reduced by
incubation with 27 microgram/ml E. coli GRX1 (American
Diagnostics), 4 U/ml GSSG reductase (Roche), 1 mM GSH, 1 mM NADPH
and 1 mM EDTA in 50 mM Tris, pH 7.5, for 15 min at 37.degree.
C.
[0059] Next, the cells were washed three times with PBS and newly
reduced sulfhydryl groups were labeled with 1 mM
N-(3-maleimidylpropionyl) biocytin (MPB, Molecular Probes) for 1 h
at RT. After removal of excess MPB by three washes with PBS, cells
were incubated with 10 microgram/ml streptavidin-FITC for 1 h at RT
and nuclei counter stained with 10 microgram/ml propidium iodide
for 30 min at RT. Coverslips were mounted and cells analyzed by
confocal microscopy using an Olympus BX50 microscope coupled to a
Bio-Rad MRC 1024 confocal scanning laser microscope system. As a
negative control, GRX1 alone or GRX1, GSSG reductase, GSH and NADPH
were omitted in the reduction step. Furthermore, MPB was omitted in
some coverslips to assess the contribution of endogenous
biotin.
[0060] Western blotting was performed as follows. The cells were
lysed in buffer containing 50 mM HEPES, 150 mM NaCl, 1 mM EDTA, 2
mM MgCl.sub.2, 10 mM Na.sub.3VO.sub.4, 1 mM PMSF, 0.1% NP40, 10
microgram/ml leupeptin, 1% aprotenin, 250 micromolar DTT, 100
micromolar NaF, equalized for protein content and an equal volume
of 2.times. Laemmli sample buffer was added. After boiling the
samples for 5 min, proteins were separated on 15% polyacrylamide
gels and transferred to nitrocellulose. Following blocking of the
membranes overnight in TBS containing 0.05% Tween-20 (TBST) and 5%
milk at 4.degree. C., primary antibodies against HA (Upstate) or
GRX1 (Labfrontier) were incubated for 4 h at RT. After three 20 min
washes with TBST, the membranes were incubated with
peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch
Laboratories) for 1 h at RT. Conjugated peroxidase was detected by
chemiluminescence according to the manufacturer's instructions
(Amersham Biosciences).
EXAMPLE 2
[0061] This example illustrates GRX catalyzed cysteine
derivatization to visualize protein S-glutathionylation in intact
cells. First evaluated was whether GRX-catalyzed reversal of
proteins S-glutathionylation could be observed in control cells,
according to the protocol depicted in FIG. 1. FIG. 1A illustrates
reactions involved in GRX mediated deglutathionylation. In reaction
(1), the S-glutathionyl moiety is transferred to GRX. The GRX-S-SG
intermediate is reduced by GSH in reaction (2) and GSSG reductase
reduces the resulting GSSG using NAPDH in reaction (3). FIG. 1B is
a schematic representation of the staining method for GRX
reversible cysteine oxidation using in this example. In the first
step, free protein thiols are blocked with NEM. In the second step,
S-glutathionyl moieties are reduced using GRX1, and next labeled
using MPB. Newly biotinylated proteins are then visualized with a
detection entity, such as streptavidin-FITC.
[0062] FIG. 2 illustrates the visualization of protein
S-glutathionylation in intact cells following GRX catalyzed
cysteine derivatization. C10 cells were left untreated (FIGS.
2A-2C, 40.times. objective), or a wound was created using a 1 ml
pipet tip on a coverslip of confluent cells and cells were left to
recover for 4 h (FIGS. 2D and 2E). GRX reversible cysteine
oxidation staining was performed and nuclei were counter stained
with propidium iodide. As reagent controls, GRX1 (-GRX, FIG. 2B) or
MPB (-MPB, FIG. 2C) were omitted in the staining procedure.
[0063] The results in FIG. 2 demonstrate marked MPB-FITC labeling
in control cells, which depends on the presence of GRX in the
reaction mixture. Furthermore, the omission of MBP resulted in
minimal staining, demonstrating that endogenous biotin does not
contribute to the observed signal. These reagent controls
demonstrated that the labeling method used was specific for
GRX-reversible cysteine oxidation, and illustrated that basal
protein S-gluathionylation may occur in control cells. It is of
interest to note that GRX-catalyzed MPB-FITC labeling was
predominant in the cell periphery in association with membrane
ruffles, which was particularly noticeable in cells at the leading
edge of a wound (FIGS. 2D and 2E).
EXAMPLE 3
[0064] This example illustrates increased GRX reversible cysteine
oxidation in cells exposed to oxidants. Following these
observations, some cells were exposed to certain oxidants that were
known to cause the formation of protein glutathione mixed
disulfides, and again visualized GRX-reversible cysteine
oxidations. Glucose oxidase (GOX), the thiol oxidizing agent
diamide, or GSNO were all found to cause a marked increase in GRX
catalyzed FITC-MBP labeling (FIGS. 3A-3F). It is of interest to
note that the pattern of protein S-glutathionylation after diamide
exposure appeared to be highly punctuate in nature, whereas GOX or
GSNO caused uniform increases in labeling throughout the cells.
Primary epithelial cells isolated from C57BL/6 mice also
demonstrated a basal level of glutathione mixed disulfides, which
was enhanced after treatment with H.sub.2O.sub.2, similar to the
C10 cell line.
[0065] FIGS. 3A-3F illustrate increased GRX reversible cysteine
oxidation in cells exposed to oxidants. C10 cells were left
untreated or treated with 5 U/ml GOX for 1 h (FIGS. 3A and 3B), 400
micromolar diamide for 15 min, or 1 mM GSNO for 1 h (FIGS. 3C and
3D). Primary tracheal epithelial cells from C57BL/6 mice were left
untreated or were exposed to 200 micromolar H.sub.2O.sub.2 for 15
min (FIGS. 3E and 3F). GRX reversible cysteine oxidation staining
was performed and nuclei were counter stained with propidium iodide
(20.times. objective).
[0066] In order to assess the formation of glutathione mixed
disulfides in cells that endogenously produce an elevated flux of
H.sub.2O.sub.2, some cells were transfected with Nox 1 plus its
co-activators. Nox1-dependent generation of H.sub.2O.sub.2 also
resulted in markedly enhanced formation of glutathione mixed
disulfides (FIGS. 3G-3J). FIGS. 3G-3J illustrate C10 cells that
were transfected with pcDNA3 or Nox1 plus p41 Nox and p51 Nox and
stained for GRX reversible cysteine oxidation as in FIGS. 3A-3F. As
a control, immunocytochemistry for GRX1 was performed (FIGS.
3I-3J). Nuclei were counter stained with Sytox green (40.times.
objective).
[0067] GRX1 expression in cells that overexpress Nox1 plus its
co-activators was also assessed, because differences in GRX1
expression could affect the levels of protein-S-glutathionylation
(further addressed below). The results illustrated in FIG. 3B
suggested that GRX-1 immunoreactivity was not significantly
different between pcDNA3 and Nox 1 overexpressing cells,
illustrating that the differences in S-gluathionylation in Nox1
overexpressing cells were not due to intrinsic differences in GRX1
content.
[0068] Quite surprisingly, in resting conditions, or in response to
some oxidants, marked staining was revealed at the periphery of
cells. Moreover, cells at the leading edge of a wound may display a
greater extent of glutathione mixed disulfides, when compared to
cells in confluent unwounded areas, which is consistent with
enhanced patterns of DCF oxidation at those sites. It is of
interest to note that the cell membrane is where the H.sub.2O.sub.2
generating enzymes Nox and Duox are localized, which may provide a
direct source of oxidants in order to produce S-glutathionylated
proteins locally. As the cytoskeleton, and in particular its actin
component, may be involved in the formation of membrane ruffles, as
well as in migration and cellular plasticity, the actin may
represent one of the targets for S-glutathionylation.
S-glutathionylation of actin may inhibit its ability to undergo
polymerization and form F-actin, and additionally, GRX may be
involved in actively mediating actin depolymerization. Thus,
dynamic control of actin polymerization/depolymerizaton may
represent a key feature in the response of cells to growth factors
and other mediators, through its role in the formation of signal
transduction scaffolds. These examples thus illustrate a potential
role for protein S-glutathionylation in these processes.
EXAMPLE 4
[0069] This example illustrates that depletion of glutathione
enhances GRX reversible cysteine oxidation. While .gamma.
(gamma)-glutamylcysteine synthetase inhibitor,
DL-buthionine-[S,R]-sulfoximine (BSO) may deplete the cellular
glutathione pool, this agent also may cause increases in levels of
glutathione mixed disulfides. In agreement with those previous
observations, the results shown in FIGS. 4A-4D demonstrate marked
increases in GRX-dependent MPB-FITC labeling in cell treated with
BSO, which were most prominent in membrane ruffles, and were
further enhanced in cells exposed to H.sub.2O.sub.2. In FIGS.
4A-4D, the C10 cells were treated with (1) 0.1 mM BSO for 16 h to
deplete glutathione, followed by (2) 200 micromolar H.sub.2O.sub.2
for 15 min, as indicated in the lower right corner of each
photomicrograph. GRX reversible cysteine oxidation was stained
according to the protocol and nuclei were counter stained with
propidium iodide (40.times. objective).
EXAMPLE 5
[0070] This example illustrates that manipulation of cellular GRX1
affects levels of S-glutathionylated proteins detected in situ.
Since GRX1 specifically reverses protein-glutathione mixed
disulfides next GRX1 expression was manipulated in some cells, in
order to augment or attenuate S-glutathionylation, to show that the
labeling approach used so far indeed detects S-glutathionylated
proteins. Referring now to FIG. 5, C10 cells were transfected with
pcDNA3, HA-GRX1 (FIGS. 5A and 5C-5F), control siRNA (c siRNA) or
GRX1 siRNA (FIGS. 5B and 5G-5J). FIGS. 5A and 5B are Western blots
for HA or GRX1. FIGS. 5C-5J illustrate cells left untreated or
treated with 200 micromolar H.sub.2O.sub.2 for 15 min and stained
for GRX reversible cysteine oxidation. Nuclei were counter stained
with propidium iodide (40.times. objective).
[0071] First, transfected C10 cells with HA-GRX1 were used, which
was confirmed by Western blot for HA (FIG. 5A). Whereas
overexpression of GRX1 in C10 cells did not appear to attenuate the
basal level of cellular glutathione mixed disulfides (FIGS. 5C-5F),
GRX1 overexpression generally prevented the increased formation of
S-glutathionylated proteins in response to H.sub.2O.sub.2, seen in
pcDNA3 transfected cells.
[0072] Lastly, RNA interference to selectively inhibit the
expression of GRX1 resulted in significantly decreases in protein
expression of GRX1 (FIG. 5B). Importantly, knock-down of GRX1 was
sufficient to enhance basal cellular S-glutathionylation, and
substantially increased the formation of S-glutathionylated
proteins in response to H.sub.2O.sub.2 (FIGS. 5G-5J).
[0073] Collectively, these findings demonstrate that the patterns
of FITC-MBP labeling observed in the presence of catalytically
active GRX1 may be due to protein-S-glutathionylation, and that the
staining patterns may change substantially in a cell under
conditions of oxidative stress or following manipulation of
endogenous GRX1.
[0074] Thus, various oxidants, including bolus H.sub.2O.sub.2,
diamide, GSNO, GOX, and H.sub.2O.sub.2 production through
overexpression of Nox1 all led to enhanced staining for
S-glutathionylated proteins. However, the staining patterns that
these various oxidants and oxidant generating systems inflicted
displayed marked differences. Nox1 overexpression appeared not to
have altered GRX1 protein levels. The observation that
S-glutathionylation is enhanced in cells under glutathione depleted
conditions was surprising. However, as GSH may be an essential
cofactor for GRX catalyzed deglutathionylation, depletion of GSH
could limit the extent of GRX activity, resulting in enhanced
S-glutathionylation. On the other hand, if S-glutathionylation
represents a mechanism that protects protein thiols from
irreversible oxidation, the available GSH may become conjugated to
protein thiols in a pro-oxidative environment of low GSH
levels.
[0075] While several embodiments of the present invention have been
described and illustrated herein, those of ordinary skill in the
art will readily envision a variety of other means and/or
structures for performing the functions and/or obtaining the
results and/or one or more of the advantages described herein, and
each of such variations and/or modifications is deemed to be within
the scope of the present invention. More generally, those skilled
in the art will readily appreciate that all parameters, dimensions,
materials, and configurations described herein are meant to be
exemplary and that the actual parameters, dimensions, materials,
and/or configurations will depend upon the specific application or
applications for which the teachings of the present invention
is/are used. Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. It is, therefore, to be understood that the foregoing
embodiments are presented by way of example only and that, within
the scope of the appended claims and equivalents thereto, the
invention may be practiced otherwise than as specifically described
and claimed. The present invention is directed to each individual
feature, system, article, material, kit, and/or method described
herein. In addition, any combination of two or more such features,
systems, articles, materials, kits, and/or methods, if such
features, systems, articles, materials, kits, and/or methods are
not mutually inconsistent, is included within the scope of the
present invention.
[0076] All definitions, as defined and used herein, should be
understood to control over dictionary definitions, definitions in
documents incorporated by reference, and/or ordinary meanings of
the defined terms.
[0077] The indefinite articles "a" and "an," as used herein in the
specification and in the claims, unless clearly indicated to the
contrary, should be understood to mean "at least one."
[0078] The phrase "and/or," as used herein in the specification and
in the claims, should be understood to mean "either or both" of the
elements so conjoined, i.e., elements that are conjunctively
present in some cases and disjunctively present in other cases.
Multiple elements listed with "and/or" should be construed in the
same fashion, i.e., "one or more" of the elements so conjoined.
Other elements may optionally be present other than the elements
specifically identified by the "and/or" clause, whether related or
unrelated to those elements specifically identified. Thus, as a
non-limiting example, a reference to "A and/or B", when used in
conjunction with open-ended language such as "comprising" can
refer, in one embodiment, to A only (optionally including elements
other than B); in another embodiment, to B only (optionally
including elements other than A); in yet another embodiment, to
both A and B (optionally including other elements); etc.
[0079] As used herein in the specification and in the claims, "or"
should be understood to have the same meaning as "and/or" as
defined above. For example, when separating items in a list, "or"
or "and/or" shall be interpreted as being inclusive, i.e., the
inclusion of at least one, but also including more than one, of a
number or list of elements, and, optionally, additional unlisted
items. Only terms clearly indicated to the contrary, such as "only
one of" or "exactly one of," or, when used in the claims,
"consisting of," will refer to the inclusion of exactly one element
of a number or list of elements. In general, the term "or" as used
herein shall only be interpreted as indicating exclusive
alternatives (i.e. "one or the other but not both") when preceded
by terms of exclusivity, such as "either," "one of," "only one of,"
or "exactly one of." "Consisting essentially of," when used in the
claims, shall have its ordinary meaning as used in the field of
patent law.
[0080] As used herein in the specification and in the claims, the
phrase "at least one," in reference to a list of one or more
elements, should be understood to mean at least one element
selected from any one or more of the elements in the list of
elements, but not necessarily including at least one of each and
every element specifically listed within the list of elements and
not excluding any combinations of elements in the list of elements.
This definition also allows that elements may optionally be present
other than the elements specifically identified within the list of
elements to which the phrase "at least one" refers, whether related
or unrelated to those elements specifically identified. Thus, as a
non-limiting example, "at least one of A and B" (or, equivalently,
"at least one of A or B," or, equivalently "at least one of A
and/or B") can refer, in one embodiment, to at least one,
optionally including more than one, A, with no B present (and
optionally including elements other than B); in another embodiment,
to at least one, optionally including more than one, B, with no A
present (and optionally including elements other than A); in yet
another embodiment, to at least one, optionally including more than
one, A, and at least one, optionally including more than one, B
(and optionally including other elements); etc.
[0081] It should also be understood that, unless clearly indicated
to the contrary, in any methods claimed herein that include more
than one step or act, the order of the steps or acts of the method
is not necessarily limited to the order in which the steps or acts
of the method are recited.
[0082] In the claims, as well as in the specification above, all
transitional phrases such as "comprising," "including," "carrying,"
"having," "containing," "involving," "holding," "composed of," and
the like are to be understood to be open-ended, i.e., to mean
including but not limited to. Only the transitional phrases
"consisting of" and "consisting essentially of" shall be closed or
semi-closed transitional phrases, respectively, as set forth in the
United States Patent Office Manual of Patent Examining Procedures,
Section 2111.03.
Sequence CWU 1
1
4120DNAArtificial SequencePrimer 1catggctcag gagtttgtga
20220DNAArtificial SequencePrimer 2gccacccctt ttataactgc
20358DNAArtificial SequencePrimer 3ccggatccat gtacccatac acgtcccaga
ctacgctgct caggagtttt gtgaactg 58429DNAArtificial SequencePrimer
4gccacccctt ttataactgc gaattccgg 29
* * * * *