U.S. patent application number 15/881375 was filed with the patent office on 2018-08-09 for diagnostic methods and compositions.
The applicant listed for this patent is Theranos, Inc.. Invention is credited to Zahra Kamila Belhocine, Josephine Lee, Pranav Patel, Aaron Richardson, Scott Tabakman, Indira Wu.
Application Number | 20180223381 15/881375 |
Document ID | / |
Family ID | 55533878 |
Filed Date | 2018-08-09 |
United States Patent
Application |
20180223381 |
Kind Code |
A1 |
Patel; Pranav ; et
al. |
August 9, 2018 |
DIAGNOSTIC METHODS AND COMPOSITIONS
Abstract
Methods and compositions for the identification of
genetic-related information are provided. At least portions of
methods provided herein may be performed without thermocycling.
Methods and compositions may include reagents such as nucleic acid
polymerases and primers.
Inventors: |
Patel; Pranav; (Fremont,
CA) ; Wu; Indira; (San Jose, CA) ; Richardson;
Aaron; (Palo Alto, CA) ; Belhocine; Zahra Kamila;
(Fremont, CA) ; Lee; Josephine; (Hayward, CA)
; Tabakman; Scott; (Palo Alto, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Theranos, Inc. |
Newark |
CA |
US |
|
|
Family ID: |
55533878 |
Appl. No.: |
15/881375 |
Filed: |
January 26, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15087840 |
Mar 31, 2016 |
9909193 |
|
|
15881375 |
|
|
|
|
PCT/US15/50811 |
Sep 17, 2015 |
|
|
|
15087840 |
|
|
|
|
PCT/US14/56151 |
Sep 17, 2014 |
|
|
|
PCT/US15/50811 |
|
|
|
|
62151358 |
Apr 22, 2015 |
|
|
|
62068603 |
Oct 24, 2014 |
|
|
|
62068605 |
Oct 24, 2014 |
|
|
|
62051912 |
Sep 17, 2014 |
|
|
|
62051945 |
Sep 17, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/6858 20130101;
C12Q 1/707 20130101; C12Q 2600/156 20130101; C12Q 1/6844 20130101;
C12M 1/00 20130101; C12N 15/00 20130101; C12Q 2600/158 20130101;
C12Q 1/706 20130101; C12Q 1/689 20130101; C12Q 1/6844 20130101;
C12Q 2521/501 20130101; C12Q 2525/161 20130101; C12Q 2525/307
20130101; C12Q 2531/113 20130101; C12Q 2531/119 20130101; C12Q
1/6858 20130101; C12Q 2521/501 20130101; C12Q 2525/161 20130101;
C12Q 2525/307 20130101; C12Q 2531/113 20130101; C12Q 2531/119
20130101 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70; C12Q 1/6858 20060101 C12Q001/6858 |
Claims
1. A method for detecting a first genetic element and a second
genetic element on a common double-stranded nucleic acid molecule,
the method comprising: performing a first amplification reaction in
a first amplification reaction mixture, wherein the first
amplification reaction mixture comprises: i) the common
double-stranded nucleic acid molecule, wherein the common
double-stranded nucleic acid molecule comprises a first strand and
a second strand, and also the first genetic element and the second
genetic element, wherein the first genetic element comprises a
first genetic element first complementary sequence and a first
genetic element second complementary sequence, wherein the second
genetic element comprises a second genetic element first
complementary sequence and a second genetic element second
complementary sequence, wherein the first genetic element first
complementary sequence and the second genetic element first
complementary sequence are part of the first strand, and wherein
the first genetic element second complementary sequence and the
second genetic element second complementary sequence are part of
the second strand; ii) a first amplification reaction first primer,
wherein the first amplification reaction first primer has a
nucleotide sequence which is complementary to the first genetic
element first complementary sequence; and iii) a first
amplification reaction second primer, wherein the first
amplification reaction second primer has a nucleotide sequence
which is complementary to the second genetic element second
complementary sequence, and wherein a first amplification reaction
product is generated in the first amplification reaction mixture,
wherein the first amplification reaction product comprises at least
a portion of the first genetic element and at least a portion of
the second genetic element, and wherein the first amplification
reaction product has a double-stranded, linear configuration;
performing a ligation reaction in a ligation reaction mixture,
wherein the ligation reaction mixture comprises i) the first
amplification reaction product; and ii) a ligase enzyme, and
wherein in the ligation reaction mixture a circular ligation
product is formed from the first amplification reaction product,
wherein the circular ligation product is double-stranded and
comprises a circular ligation product first strand and a circular
ligation product second strand, and wherein the circular ligation
product first strand comprises the nucleotides of the first
amplification reaction product first strand and the circular
ligation product second strand comprises the nucleotides of the
first amplification reaction product second strand; and performing
a second amplification reaction in a second amplification reaction
mixture, wherein the second amplification reaction mixture
comprises: i) the circular ligation product; ii) a second
amplification reaction first primer, wherein the second
amplification reaction first primer has a nucleotide sequence which
is complementary to the first genetic element second complementary
sequence; and iii) a second amplification reaction second primer,
wherein the second amplification reaction second primer has a
nucleotide sequence which is complementary to the second genetic
element first complementary sequence, and wherein a second
amplification reaction product is generated in the second
amplification reaction mixture, wherein the second amplification
reaction product comprises at least a portion of the first genetic
element and at least a portion of the second genetic element; and
detecting the second amplification reaction product.
2. The method of claim 1, wherein the first genetic element and the
second genetic element are separated from each other on the
double-stranded nucleic acid molecule by at least 2000 and no more
than 50000 nucleotides.
3. The method of claim 1, wherein the first genetic element and the
second genetic element are separated from each other on the
double-stranded nucleic acid molecule by at least 4000 and no more
than 50000 nucleotides.
4. The method of claim 1, wherein the first amplification reaction
is a polymerase-chain reaction (PCR) amplification reaction.
5. The method of claim 1, wherein the first amplification reaction
first primer and the first amplification reaction second primer are
each at least 6 nucleotides and no more than 50 nucleotides in
length.
6. The method of claim 1, wherein at least one of the first
amplification reaction first primer and the first amplification
reaction second primer in the first amplification reaction mixture
is phosphorylated at the 5' end of the primer.
7. The method of claim 1, wherein both of the first amplification
reaction first primer and the first amplification reaction second
primer in the first amplification reaction mixture are
phosphorylated at the 5' end of the primer.
8. The method of claim 1, further comprising, prior to performing
the ligation reaction, incubating the first amplification reaction
product with a kinase enzyme.
9. The method of claim 8, wherein the kinase enzyme is T4
polynucleotide kinase.
10. The method of claim 1, wherein the ligase enzyme is T4 DNA
ligase.
11. The method of claim 1, wherein the second amplification
reaction first primer and the second amplification reaction second
primer are each at least 6 nucleotides and no more than 60
nucleotides in length.
12. The method of claim 1, wherein the second amplification
reaction is PCR.
13. The method of claim 1, wherein the second amplification
reaction is performed without thermocycling.
14. The method of claim 13, wherein the second amplification
reaction first primer comprises a first region and a second region,
wherein the second region of the second amplification reaction
first primer is complementary to the second genetic element first
complementary sequence and the second amplification reaction second
primer comprises a first region and a second region, wherein the
second region of the second amplification reaction second primer is
complementary to the first genetic element second complementary
sequence, and wherein the first region of the second amplification
reaction second primer is complementary to the first region of the
second amplification reaction first primer.
15. The method of claim 14, wherein the first region of the second
amplification reaction second primer is also complementary to at
least a portion of the first strand of the circular ligation
product.
16. The method of claim 1, wherein the second amplification
reaction product is detected in real-time as it is generated.
17. The method of claim 1, wherein the first genetic element is an
antibiotic resistance gene.
18. The method of claim 1, wherein the second genetic element is a
pathogen gene.
19. The method of claim 1, wherein the first genetic element is the
mecA gene.
20. The method of claim 1, wherein the second genetic element is a
gene from Staphylococcus aureus.
21-40. (canceled)
Description
RELATED APPLICATIONS
[0001] This application is a continuation of International
Application No. PCT/US2015/050811, filed Sep. 17, 2015, which
claims priority to International Application No. PCT/US2014/056151,
filed Sep. 17, 2014, U.S. Provisional Application No. 62/051,912,
filed Sep. 17, 2014, U.S. Provisional Application No. 62/051,945,
filed Sep. 17, 2014, U.S. Provisional Application No. 62/068,603,
filed Oct. 24, 2014, U.S. Provisional Application No. 62/068,605,
filed Oct. 24, 2014, and U.S. Provisional Application No.
62/151,358, filed Apr. 22, 2015, all of which are hereby
incorporated by reference in their entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Mar. 25, 2016, is named 3034.501_SL.txt and is 5,143 bytes in
size.
BACKGROUND
[0003] In order effectively diagnose or treat a subject suffering
from a mutation in the subject's gene or from an infection with a
pathogen, it is frequently desirable to obtain detailed genetic
information relating to the mutation or the pathogen.
[0004] For example, methicillin-resistant Staphylococcus aureus
(MRSA) is a type of Staphylococcus aureus (S. aureus) which can
cause infection in humans and is resistant to beta-lactam
antibiotics. As a result of its resistance to certain antibiotics,
MRSA infections can be difficult to treat.
[0005] S. aureus bacteria typically become methicillin-resistant
through acquiring the mecA gene. The mecA gene is typically located
in the staphyloccal cassette chromosome mec (SCCmec), which is a
multi-gene, transferrable genomic element. Different types of
SCCmec exist, with known SCCmec types ranging in size from
approximately 21,000-67,000 nucleotides in length. Generally,
within each type of SCCmec, the mecA gene is surrounded by other
genes or elements which are other components of the SCCmec. In MRSA
bacteria, SCCmec containing the mecA gene is integrated into the S.
aureus chromosome.
[0006] In order identify and control MRSA bacteria, effective
reagents and methods for MRSA detection are needed. In addition,
improved reagents and methods for assessing other integrated genes
in host genetic material and also for assessing whether two or more
genetic elements are in a common molecule are needed.
[0007] As another example, within Hepatitis C genotype 1a, there is
a polymorphic site Q80K in the protease gene, nonstructural protein
3 ("NS3"; also known as "p-70"), that is associated with treatment
failure with the protease inhibitor boceprevir, which otherwise can
be effective in blocking peptide maturation in the virus. Assessing
the Q80 polymorphism in the NS3 gene in patients with subtype 1a
can be an important part of formulating a treatment plan.
[0008] Accordingly, improved reagents and methods for assessing the
Q80 polymorphism are needed. In addition, improved reagents and
methods for assessing other SNPs, point mutations, and other
nucleotide variations are needed.
INCORPORATION BY REFERENCE
[0009] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference. However, in the event of a conflict
between the content of the present express disclosure and the
content of a document incorporated by reference herein, the content
of the present express disclosure controls.
SUMMARY
[0010] Provided herein are methods and compositions relating to the
identification of genetic-related information. In embodiments,
improved reagents and methods for assessing integrated genes in
host genetic material are provided. For example, improved reagents
and methods for MRSA detection are provided. In embodiments,
improved reagents and methods for assessing whether at least a
first genetic element and a second genetic element are both on a
common nucleic acid molecule are provided. In such embodiments, the
first genetic element and the second genetic element may be
separated from each other on the common nucleic acid molecule by a
large number of nucleotides. In other embodiments, improved
reagents and methods for assessing SNPs and point mutations are
provided. For example, improved reagents and methods for assessing
the Q80 polymorphism in the Hepatitis C NS3 gene are provided.
[0011] In embodiments, provided herein is a method for detecting a
first genetic element and a second genetic element on a common
double-stranded nucleic acid molecule, the method comprising:
performing a first amplification reaction in a first amplification
reaction mixture, wherein the first amplification reaction mixture
comprises: i) the common double-stranded nucleic acid molecule,
wherein the common double-stranded nucleic acid molecule comprises
a first strand and a second strand, and also the first genetic
element and the second genetic element, wherein the first genetic
element comprises a first genetic element first complementary
sequence and a first genetic element second complementary sequence,
wherein the second genetic element comprises a second genetic
element first complementary sequence and a second genetic element
second complementary sequence, wherein the first genetic element
first complementary sequence and the second genetic element first
complementary sequence are part of the first strand, and wherein
the first genetic element second complementary sequence and the
second genetic element second complementary sequence are part of
the second strand; ii) a first amplification reaction first primer,
wherein the first amplification reaction first primer has a
nucleotide sequence which is complementary to the first genetic
element first complementary sequence; and iii) a first
amplification reaction second primer, wherein the first
amplification reaction second primer has a nucleotide sequence
which is complementary to the second genetic element second
complementary sequence, and wherein a first amplification reaction
product is generated in the first amplification reaction mixture,
wherein the first amplification reaction product comprises at least
a portion of the first genetic element and at least a portion of
the second genetic element, and wherein the first amplification
reaction product has a double-stranded, linear configuration;
performing a ligation reaction in a ligation reaction mixture,
wherein the ligation reaction mixture comprises i) the first
amplification reaction product; and ii) a ligase enzyme, and
wherein in the ligation reaction mixture a circular ligation
product is formed from the first amplification reaction product,
wherein the circular ligation product is double-stranded and
comprises a circular ligation product first strand and a circular
ligation product second strand, and wherein the circular ligation
product first strand comprises the nucleotides of the first
amplification reaction product first strand and the circular
ligation product second strand comprises the nucleotides of the
first amplification reaction product second strand; and performing
a second amplification reaction in a second amplification reaction
mixture, wherein the second amplification reaction mixture
comprises: i) the circular ligation product; ii) a second
amplification reaction first primer, wherein the second
amplification reaction first primer has a nucleotide sequence which
is complementary to the first genetic element second complementary
sequence; and iii) a second amplification reaction second primer,
wherein the second amplification reaction second primer has a
nucleotide sequence which is complementary to the second genetic
element first complementary sequence, and wherein a second
amplification reaction product is generated in the second
amplification reaction mixture, wherein the second amplification
reaction product comprises at least a portion of the first genetic
element and at least a portion of the second genetic element; and
detecting the second amplification reaction product. Optionally,
the method may further comprise, prior to performing the ligation
reaction, incubating the first amplification reaction product with
a kinase enzyme.
[0012] In embodiments, in a composition or method provided herein
involving a double-stranded nucleic acid molecule comprising a
first genetic element and a second genetic element, the first
genetic element and the second genetic element may be separated
from each other on the double-stranded nucleic acid molecule by at
least 100, 200, 500, 1000, 2000, 3000, 4000, 5000, 10,000, 15,000,
20,000, 25,000, or 30,000 and no more than 200, 500, 1000, 2000,
3000, 4000, 5000, 10,000, 15,000, 20,000, 25,000, 30,000, 40,000,
50,000, 60,000, 70,000, 80,000, 90,000, or 100,000 nucleotides.
[0013] In embodiments, in a method or composition provided herein
involving a first amplification reaction, the first amplification
reaction may be a PCR amplification reaction or a non-thermocycling
amplification reaction.
[0014] In embodiments, in a method or composition provided herein
involving a second amplification reaction, the second amplification
reaction may be a PCR amplification reaction or a non-thermocycling
amplification reaction.
[0015] In embodiments, in a method or composition provided herein
involving a first primer and a second primer, the first primer and
the second primer are each at least 4, 5, 6, 7, 8, 9, 10, 11, 12,
15, 20, or 25 and no more than 5, 6, 7, 8, 9, 10, 11, 12, 15, 20,
25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides in length.
[0016] In embodiments, in a method or composition provided herein
involving a first primer and a second primer, at least one or both
of the first primer and the second primer in the first
amplification reaction mixture is phosphorylated at the 5' end of
the primer.
[0017] In embodiments, in a method or composition provided herein
involving a kinase enzyme, the kinase enzyme is T4 polynucleotide
kinase.
[0018] In embodiments, in a method or composition provided herein
involving a ligase enzyme, the ligase enzyme is T4 DNA ligase.
[0019] In embodiments, in a method or composition provided herein
involving a second amplification reaction first primer and a second
amplification reaction second primer.
[0020] In embodiments, in a method or composition provided herein
involving a second amplification reaction first primer and a second
amplification reaction second primer, the second amplification
reaction first primer comprises a first region and a second region,
wherein the second region of the second amplification reaction
first primer is complementary to the second genetic element first
complementary sequence and the second amplification reaction second
primer comprises a first region and a second region, wherein the
second region of the second amplification reaction second primer is
complementary to the first genetic element second complementary
sequence, and wherein the first region of the second amplification
reaction second primer is complementary to the first region of the
second amplification reaction first primer. Optionally, the first
region of the second amplification reaction second primer is also
complementary to at least a portion of the first strand of the
circular ligation product.
[0021] In embodiments, in a method or composition provided herein
involving a second amplification reaction product, the second
amplification reaction product is detected in real-time as it is
generated.
[0022] In embodiment, in a method or composition provided herein
involving a first genetic element, the first genetic element is an
antibiotic resistance gene, such as the mecA gene.
[0023] In embodiment, in a method or composition provided herein
involving a second genetic element, the second genetic element is a
pathogen gene, such as from Staphylococcus aureus.
[0024] In embodiments, a method provided herein may further
comprise obtaining a biological sample from a subject, wherein the
biological sample from the subject contains a common
double-stranded nucleic acid molecule or a polynucleotide template.
In embodiments, the biological sample may be obtained from a
subject's digit. In embodiments, the biological sample may have a
volume of no greater than 500, 400, 300, 200, 100, or 50
microliters.
[0025] In embodiments, in a method or composition provided herein
involving a biological sample from a subject which contains a
common double-stranded nucleic acid molecule, the sample contains
the common double-stranded nucleic acid molecule in a
methicillin-resistant Staphylococcus aureus organism.
[0026] In embodiments, in a method or composition provided herein
involving a first amplification reaction, a ligation reaction, and
a second amplification reaction, the first amplification reaction,
the ligation reaction, and the second amplification reaction all
occur in the same vessel.
[0027] In embodiments, in a method or composition provided herein
involving a first amplification reaction, a ligation reaction, and
a second amplification reaction, the first amplification reaction,
the ligation reaction, and the second amplification reaction occur
in different vessels.
[0028] In embodiments, in a method or composition provided herein
involving a ligation reaction, the ligation reaction may result in
one or both of a circular ligation product or an end-to-end
ligation product.
[0029] In embodiments, provided herein is a method for assessing
the identity of a nucleotide at a position of interest in a
nucleotide sequence in a polynucleotide template, the method
comprising: A) generating multiple copies of a polynucleotide
template in a polymerase chain reaction (PCR) amplification
reaction mixture, wherein the PCR amplification reaction mixture
comprises a PCR amplification reaction first primer and a PCR
amplification reaction second primer, wherein in the PCR
amplification reaction mixture, the PCR amplification reaction
first primer anneals to the polynucleotide template and the PCR
second primer anneals to a polynucleotide which is complementary to
the polynucleotide template, and wherein in the PCR amplification
reaction mixture, multiple copies of a PCR amplification reaction
product are formed, wherein the PCR amplification reaction product
is a double-stranded nucleic acid molecule comprising a first
strand and a second strand, and wherein a first strand of the PCR
amplification reaction product is a copy of the polynucleotide
template; B) providing copies of the PCR amplification reaction
product generated in step A) in each of at least a
non-thermocycling first reaction mixture and a non-thermocycling
second reaction mixture, wherein: the polynucleotide template
comprises a first portion, a second portion and a third portion,
wherein the third portion is situated in the polynucleotide
template between the first portion and the second portion and
wherein the position of interest is in the third portion; the
non-thermocycling first reaction mixture comprises copies of the
polynucleotide template, a non-thermocycling first primer, and a
non-thermocycling second primer, wherein: the non-thermocycling
first primer comprises a first region and a second region, wherein
the first region comprises a 5' end of the primer, the second
region comprises a 3' end of the primer, and the second region is
complementary to the first portion of the polynucleotide template;
the non-thermocycling second primer comprises a first region and a
second region, wherein the first region comprises a 5' end of the
primer, the second region comprises a 3' end of the primer, and the
second region is complementary to a sequence which is complementary
to a second portion of the polynucleotide template; the first
region of the non-thermocycling first primer is complementary to
the first region of the non-thermocycling second primer; and the
first region of the non-thermocycling second primer is
complementary to the third portion of the polynucleotide template;
the second reaction mixture comprises copies of the polynucleotide
template, a non-thermocycling third primer, and a non-thermocycling
fourth primer, wherein: the non-thermocycling third primer
comprises a first region and a second region, wherein the first
region comprises a 5' end of the primer, the second region
comprises a 3' end of the primer, and the second region is
complementary to the first portion of the polynucleotide template;
the non-thermocycling fourth primer comprises a first region and a
second region, wherein the first region comprises a 5' end of the
primer, the second region comprises a 3' end of the primer, and the
second region is complementary to a sequence which is complementary
to a second portion of the polynucleotide template; the first
region of the non-thermocycling third primer is complementary to
the first region of the non-thermocycling fourth primer; and the
first region of the non-thermocycling fourth primer is
complementary to the third portion of the polynucleotide template;
and the nucleotide sequence of the first region of the
non-thermocycling second primer differs from the nucleotide
sequence of first region of the non-thermocycling fourth primer by
a single nucleotide, wherein the position of the different
nucleotide in the non-thermocycling second and non-thermocycling
fourth primers corresponds to the position of the nucleotide of
interest in the polynucleotide template when the nucleotide
sequence of the first region of the non-thermocycling second primer
or non-thermocycling fourth primer is oriented with the nucleotide
sequence of the third portion of the polynucleotide template for
maximum complementation of the sequences; C) incubating the
non-thermocycling first reaction mixture and non-thermocycling
second reaction mixture under conditions without thermocycling; and
D) comparing the rate or amount of amplification of the
polynucleotide template in the non-thermocycling first reaction
mixture to the rate or amount of amplification of the
polynucleotide template in the non-thermocycling second reaction
mixture, wherein the rate or amount of amplification of the
polynucleotide template is indicative of the degree of
complementation between first region of the non-thermocycling
second or non-thermocycling fourth primer and the nucleotide
sequence of the third portion of the polynucleotide template.
Optionally, the PCR amplification reaction first primer is at least
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, or 60
and no more than 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 60,
70, 80, 90, or 100 nucleotides in length, and wherein when the PCR
amplification reaction first primer is annealed to the
polynucleotide template, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
nucleotides of the PCR amplification reaction first primer are
mis-matched according to Watson-Crick base-pairing rules with
corresponding nucleotides on the polynucleotide template.
Optionally, the PCR amplification reaction second primer is at
least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, or
60 and no more than 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 60,
70, 80, 90, or 100 nucleotides in length, and wherein when the PCR
amplification reaction second primer is annealed to the
polynucleotide which is complementary to the polynucleotide
template, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of
the PCR amplification reaction second primer are mis-matched
according to Watson-Crick base-pairing rules with corresponding
nucleotides on the polynucleotide which is complementary to the
polynucleotide template.
[0030] In embodiments, in a method or composition provided herein
involving a position of interest in a nucleotide sequence in a
polynucleotide template, the position of interest in the nucleotide
sequence in the polynucleotide template is a SNP.
[0031] In embodiments, a polynucleotide template provided herein
may be from the hepatitis C virus, optionally specifically from the
hepatitis C NS3 gene. In embodiments, in a method or composition
provided herein involving a position of interest in a nucleotide
sequence in a polynucleotide template, the position of interest in
the nucleotide sequence in the polynucleotide template is in the
codon encoding 80.sup.th amino acid of the NS3 gene of hepatitis
C.
[0032] In embodiments, provided herein is a method for amplifying a
polynucleotide template, the method comprising: A) generating
multiple copies of a polynucleotide template in a polymerase chain
reaction (PCR) amplification reaction mixture, wherein the PCR
amplification reaction mixture comprises a first PCR amplification
reaction primer and a second PCR amplification reaction primer,
wherein in the PCR amplification reaction mixture, the first PCR
amplification reaction primer anneals to the polynucleotide
template and the second PCR amplification reaction primer anneals
to a polynucleotide which is complementary to the polynucleotide
template, and wherein in the PCR amplification reaction mixture,
multiple copies of a PCR amplification reaction product are formed,
wherein the PCR amplification reaction product is a double-stranded
nucleic acid molecule comprising a first strand and a second
strand, and wherein a first strand of the PCR amplification
reaction product is a copy of the polynucleotide template; B)
incubating copies of the polynucleotide template in a
non-thermocycling reaction mixture comprising a non-thermocycling
reaction first primer and a non-thermocycling reaction second
primer, wherein: the polynucleotide template comprises a first
portion, a second portion and a third portion, wherein the third
portion is situated in the polynucleotide template between the
first portion and the second portion; the first primer comprises a
first region and a second region, wherein the second region of the
first primer is complementary to the first portion of the
polynucleotide template; and the second primer comprises a first
region and a second region, wherein the second region of the second
primer is complementary to a sequence in the PCR amplification
reaction product second strand which is complementary to the second
portion of the polynucleotide template, the first region of the
second primer is complementary to the first region of the first
primer, and the first region of the second primer is complementary
to the third portion of the polynucleotide template.
[0033] In embodiments, in a method or composition provided herein
involving a polynucleotide template comprising a first portion and
a second portion, the first portion and second portion of the
polynucleotide template are each between 6 and 30 nucleotides in
length.
[0034] In embodiments, in a method or composition provided herein
involving a polynucleotide template comprising a third portion, the
third portion of the polynucleotide template is between 4 and 14
nucleotides in length.
[0035] In embodiments, in a method or composition provided herein
involving amplifying a polynucleotide template in a
non-thermocycling reaction mixture, the number of copies of the
polynucleotide template in the non-thermocycling reaction mixture
is increased at least 10-fold within 60 minutes of initiation of
the method.
[0036] In embodiments, in a method or composition provided herein
involving amplifying a polynucleotide template in a
non-thermocycling reaction mixture, a concatemer strand comprising
at least three copies of the polynucleotide template is generated
during the incubation of the non-thermocycling reaction
mixture.
[0037] In embodiments, provided herein is a vessel comprising
therein any one or more components of a reaction mixture described
herein.
[0038] In embodiments, provided herein is a kit comprising therein
any one or more components of a reaction mixture described herein.
Optionally, in embodiments provided herein involving a kit, the
components of the kit may be distributed between at least two
separate fluidically isolated containers.
BRIEF DESCRIPTION OF THE DRAWINGS
[0039] In the drawings:
[0040] FIG. 1A is a schematic depicting features of an exemplary
component of a method provided herein.
[0041] FIG. 1B is a schematic depicting features of an exemplary
component of a method provided herein.
[0042] FIG. 1C is a schematic depicting features of an exemplary
component of a method provided herein.
[0043] FIG. 1D is a schematic depicting features of an exemplary
component of a method provided herein.
[0044] FIG. 1E is a schematic depicting features of an exemplary
component of a method provided herein.
[0045] FIG. 2 is a general schematic of steps of a method provided
herein.
[0046] FIG. 3 is a graph depicting results from reactions performed
according to a method provided herein.
[0047] It is noted that the drawings and elements therein are not
necessarily drawn to shape or scale. For example, the shape or
scale of elements of the drawings may be simplified or modified for
ease or clarity of presentation. It should further be understood
that the drawings and elements therein are for exemplary
illustrative purposes only, and not be construed as limiting in any
way.
DETAILED DESCRIPTION
[0048] Provided herein are methods and compositions relating to the
identification of genetic-related information. In embodiments,
improved reagents and methods for assessing integrated genes in
host genetic material are provided. For example, improved reagents
and methods for MRSA detection are provided. In embodiments,
improved reagents and methods for assessing whether at least a
first genetic element and a second genetic element are both on a
common nucleic acid molecule are provided. In such embodiments, the
first genetic element and the second genetic element may be
separated from each other on the common nucleic acid molecule by a
large number of nucleotides. In other embodiments, improved
reagents and methods for assessing SNPs and point mutations are
provided. For example, improved reagents and methods for assessing
the Q80 polymorphism in the Hepatitis C NS3 gene are provided.
Various features described herein may be applied to any of the
particular embodiments set forth below or for any other types
systems for or involving the identification of genetic-related
information. Systems and methods described herein may be applied as
a stand-alone system or method, or as part of an integrated system
or method. It shall be understood that different aspects of the
disclosed systems and methods can be appreciated individually,
collectively, or in combination with each other.
[0049] In embodiments, provided herein are systems, compositions,
and methods for MRSA detection. Prior methods for MRSA detection
typically separately test a sample for the mecA gene and for
genetic material from the S. aureus chromosome. If both the mecA
gene and S. aureus genetic material are found in the sample, a
presumptive conclusion is made that MRSA is present. However, this
conclusion might not be accurate, because the mecA gene can exist
outside of S. aureus (as part of the SCCmec, which is transferrable
between organisms). Thus, a sample that contains both the mecA gene
and S. aureus might not actually contain MRSA bacteria; instead, it
may contain non-MRSA S. aureus bacteria, and a different bacteria
or free genetic element which contains the mecA gene. This
situation thus may give rise to a false-positive identification of
MRSA in a sample.
[0050] Embodiments of methods and compositions provided herein
address the above problem, and provide methods and compositions for
identifying the mecA gene in a S. aureus chromosome (and thus, true
MRSA).
[0051] One approach to identifying a mecA gene in a S. aureus
chromosome might be to perform, for example, polymerase chain
reaction (PCR), where the PCR reaction would contain a sample which
might contain MRSA bacteria or MRSA genetic material, and wherein
one of the primers for the PCR reaction would anneal to portion of
the mecA gene and the other primer for the PCR reaction would
anneal to a portion of the S. aureus chromosome. If such a PCR
reaction yielded a reaction product, it would indicate that both
the mecA gene and genetic material from the S. aureus chromosome
were on the same DNA strand (and thus, that the sample contained
true MRSA bacteria). However, typically this approach is not
effective, because in most MRSA bacteria, the mecA gene is many
thousands of nucleotides away from genetic material of the S.
aureus chromosome. This is due to the fact that in MRSA, the mecA
gene is integrated into the S. aureus chromosome as part of the
SCCmec, and the mecA gene is typically in an inner portion of the
SCCmec, surrounded on both sides by thousands of additional nucleic
acids of the SCCmec insert. The relatively large nucleotide
distance between the mecA gene and the S. aureus chromosome in most
MRSA strains generally results in the poor performance of
traditional PCR reactions as described above (e.g. with one primer
annealing to a portion of the mecA gene and the other primer
annealing to a portion of the S. aureus chromosome), as traditional
PCR (e.g. using Taq polymerase) and many other nucleic acid
amplification techniques are not very effective at amplifying
relatively long nucleotide sequences (e.g. over 3000, 4000, or 5000
nucleotides in length).
[0052] SCCmec types are described, for instance, in Antimicrob.
Agents Chemother. December 2009 vol. 53 no. 12, pages 4961-4967;
Methods Mol Biol. 2014; 1085:131-48, and Methods Mol Biol. 2007;
391:87-102, each of which is hereby incorporated by reference in
its entirety for all purposes. Typically, the mecA gene when
present in a S. aureus chromosome is separated from S. aureus
genetic material by thousands or even tens of thousands of
nucleotides.
[0053] In embodiments, provided herein are improved methods and
compositions for identifying a mecA gene which has been integrated
into a S. aureus chromosome.
[0054] In embodiments, methods provided herein comprise at least
two steps: 1) a step to generate a nucleic acid strand wherein at
least a portion of the mecA gene and the S. aureus chromosome are
in close physical proximity to each other within the strand; and 2)
a step to perform a nucleic acid amplification method using at
least a first primer, a second primer and the nucleic acid strand
of step 1), wherein the first primer anneals to a portion of the
mecA gene and the second primer anneals to a portion of the S.
aureus chromosome, and where an amplification product is generated
which includes portions of both the mecA gene and the S. aureus
chromosome.
[0055] Embodiments of systems and methods provided herein may be
described as follows. A S. aureus chromosome or portion thereof
containing a SCCmec cassette containing a mecA gene may be provided
(optionally referred to herein as a "MRSA chromosome"). The MRSA
chromosome may be incubated with a first primer and a second
primer, wherein the first primer is complementary to a portion of
the mecA gene (or, optionally, other element of the SCCmec
cassette), and the second primer is complementary to a portion of
the S. aureus chromosome. In addition, one or both of the primers
is phosphorylated at the 5' end. The MRSA chromosome is incubated
in a first amplification reaction with a DNA polymerase having high
processivity. An exemplary DNA polymerase with high processivity is
phi29 polymerase. The first amplification reaction may be, for
instance, a polymerase chain reaction (PCR reaction) or an
isothermal amplification reaction. By use of a DNA polymerase with
high processivity, at least a small amount of an amplification
product may be generated. The amplification product from this
reaction will contain both S. aureus and mecA genetic material, but
typically, only a small amount of amplified material will be
generated from this amplification reaction. This amplified material
is generally difficult to detect, due to the small amount
generated. Accordingly, the amplified material is then incubated
with a DNA ligase, which can ligate these amplification products
together (in either intra-strand or inter-strand ligations) due to
the phosphate groups on the 5' end of the primers used for the
amplification reaction. Incubation of the amplified material from
the first amplification reaction with a ligase may result in one or
both of two general types of ligation products: a) concatemers
formed by the end-to-end ligation of two or more amplification
products from the first amplification reaction; or b) circularized
products formed by the ligation of one end of an amplification
product from the first amplification reaction to the other end of
the same amplification product. With both types of ligation
products, the mecA gene is brought into close physical proximity
with S. aureus genetic material (e.g. to the gene attR or orfX).
Accordingly, in embodiments, both types of ligation products are
suitable templates for nucleic acid amplification methods which are
most effective at amplification of relatively small amplicons (e.g.
2000 nucleotides or less). Thus, the next step of a method provided
herein involves using one or both of the ligation products for a
second nucleic acid amplification step. This second nucleic acid
amplification step may use at least a first primer which anneals to
a portion of the mecA gene (or optionally, another portion of the
SCCmec cassette), and a second primer which anneals to S. aureus
genetic material. Various nucleic acid amplification methods may be
used for the second nucleic acid amplification step, such as PCR or
an amplification method as described in PCT/US14/56151, filed Sep.
17, 2014, which is hereby incorporated by reference in its entirety
for all purposes. In embodiments, the first primer and second
primer of the second nucleic acid amplification step are different
than the first primer and second primer of the first nucleic acid
amplification step. In embodiments, the first primer and second
primer of the second nucleic acid amplification step have an
opposite orientation as compared to the first primer and second
primer of the first nucleic acid amplification step. In
embodiments, the first primer and second primer of the second
nucleic acid amplification step are the same as the first primer
and second primer of the first nucleic acid amplification step.
[0056] Embodiments of systems and methods provided herein may be
described with reference to FIG. 1A-1E. In embodiments, the
compositions and methods described in and relating to FIGS. 1A-1E
may be referred to herein as for "genetic element analysis". A
double-stranded nucleic acid molecule 10 may be provided. The
double-stranded nucleic acid molecule 10 comprises a first strand
22 and a second strand 24.
[0057] The double-stranded nucleic acid 10 may be of any suitable
shape and conformation. For example, although FIG. 1 depicts the
double-stranded nucleic acid 10 as a linear double-stranded nucleic
acid, the double-stranded nucleic acid 10 may alternatively, for
example, be part of or the entirety of a circular double-stranded
nucleic acid. A circular double-stranded nucleic acid will not have
a free 5' or 3' end on either strand of the double-stranded nucleic
acid (due to its circular shape). In addition, the double-stranded
nucleic acid 10 may be the entirety of a nucleic acid molecule, or
it may be only a part of a larger double-stranded nucleic acid.
[0058] The double-stranded nucleic acid 10 may be provided from a
wide range of sources. For example, the double-stranded nucleic
acid 10 may be in or prepared from a sample obtained from a
subject, it may be directly obtained from a cultured microorganism,
or it may be chemically synthesized.
[0059] Within the double-stranded nucleic acid 10, there may be one
or more different genetic elements 32, 34, 36, 38. For instance,
within the double-stranded nucleic acid 10, there may be at least
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, or more
different genetic elements. As used herein, a "genetic element"
refers to any identifiable region of interest of a nucleic acid
molecule, such as a gene sequence, a promoter sequence, enhancer
sequence, intron, exon, etc. A genetic element typically contains
two complementary sequences, in which one of the sequences of the
genetic element is on the first strand 22 and the other sequence of
the genetic element is on the second strand 24, and wherein the
sequence of the element on the first strand 22 and the sequence of
the element on the second strand 24 are complementary per
Watson-Crick base-pairing rules (A with T; C with G). Typically,
the complementary sequence on the first strand and the
complementary sequence on the second strand contain the same number
of nucleotides. Also, as used herein, for any given genetic
element, the sequence of the element on the first strand in the 5'
to 3' direction may be referred to as the "first complementary
sequence" and the sequence of that element on the second strand in
the 5' to 3' direction may be referred to as the "second
complementary sequence". Accordingly, for example, in situations
herein in which a double-stranded nucleic acid molecule contains,
for example, a first genetic element, a second genetic element, and
a third genetic element, it may be described that the first strand
of the double-stranded nucleic acid molecule contains a "first
genetic element first complementary sequence", a "second genetic
element first complementary sequence", and a "third genetic element
first complementary sequence", wherein the "first genetic element
first complementary sequence" is the first complementary sequence
of the first genetic element, the "second genetic element first
complementary sequence" is the first complementary sequence of the
second genetic element, and the "third genetic element first
complementary sequence" is the first complementary sequence of the
third genetic element. Similarly, it may be described that the
second strand of the double-stranded nucleic acid molecule contains
a "first genetic element second complementary sequence", a "second
genetic element second complementary sequence", and a "third
genetic element second complementary sequence", wherein the "first
genetic element second complementary sequence" is the second
complementary sequence of the first genetic element, the "second
genetic element second complementary sequence" is the second
complementary sequence of the second genetic element, and the
"third genetic element second complementary sequence" is the second
complementary sequence of the third genetic element. The
designation of any given genetic element in a sequence as a "first
genetic element", "second genetic element", or "third genetic
element", etc. in a sequence is generally arbitrary, and these
terms may be used as appropriate to designate different genetic
elements of interest on a nucleic acid molecule of interest (as
long as the terminology is used consistently for the same genetic
elements on a given nucleic acid molecule).
[0060] For instance, in FIG. 1, genetic element 32 contains a
complementary sequence on the first strand 32a and a complementary
sequence on the second strand 32b (also referred to herein as
"genetic element 32 first complementary sequence" and "genetic
element 32 second complementary sequence", respectively; this
naming system also may be used with other genetic elements); the
sequence on the first strand 32a and the sequence on the second
strand 32b are complementary per Watson-Crick base-pairing rules.
Similarly, genetic element 34 contains a complementary sequence on
the first strand 34a and a complementary sequence on the second
strand 34b; the sequence on the first strand 34a and the sequence
on the second strand 34b are complementary per Watson-Crick
base-pairing rules. Similarly, genetic element 36 contains a
complementary sequence on the first strand 36a and a complementary
sequence on the second strand 36b; the sequence on the first strand
36a and the sequence on the second strand 36b are complementary per
Watson-Crick base-pairing rules. Similarly, genetic element 38
contains a complementary sequence on the first strand 38a and a
complementary sequence on the second strand 38b; the sequence on
the first strand 38a and the sequence on the second strand 38b are
complementary per Watson-Crick base-pairing rules.
[0061] For emphasis, the genetic elements 32, 34, 36, and 38 in
FIG. 1A are represented by different geometric shapes (i.e. element
32 is a rectangle, 34 is a triangle, etc.). However, it is
important to note that the geometric shapes do not provide details
about the characteristic of the genetic element (the shapes are
just to assist in outlining various concepts presented in FIGS.
1A-E). Also, while FIG. 1A depicts the complementary sequences 32a,
34a, 36a, 38a, 32b, 34b, 36b, and 38b as being of a different shape
than the first strand 22 and the second strand 24 on which the
complementary sequences 32a, 34a, 36a, 38a, 32b, 34b, 36b, and 38b
reside, these shapes are just for emphasis and the complementary
sequences in fact have the same structure as the rest of the
portions of the strand.
[0062] A genetic element may be of any length of nucleotides. For
example, in embodiments, a genetic element may be at least 3, 4, 5,
8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80,
90, 100, 200, 500, 1000, 2000, or 5000 nucleotides in length. In
embodiments, a genetic element may contain no more than 5, 8, 9,
10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90,
100, 200, 500, 1000, 2000, 5000, or 10,000 nucleotides. In
embodiments, a genetic element may contain at least 3, 4, 5, 8, 9,
10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90,
100, 200, 500, 1000, 2000, or 5000, and no more than 9, 10, 11, 12,
13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500,
1000, 2000, 5000, or 10,000 nucleotides. Typically, a complementary
sequence of a genetic element may be considered to have a 5' end
and 3' end, wherein the nucleotides of the complementary sequence
include and are between the 5' end and the 3' end of the sequence.
For instance, a complementary sequence of a genetic element may
have the exemplary sequence in the 5' to 3' direction of: 5' TGGA
3'. In this sequence, the "T" is the nucleotide at the 5' end of
the sequence and the "A" is the nucleotide at the 3' end of the
sequence.
[0063] In a double-stranded nucleic acid molecule containing at
least a first genetic element and a second genetic element, the
first genetic element and the second genetic element may be
separated from each other by any number of nucleotides. For
example, in a double-stranded nucleic acid molecule containing at
least a first genetic element and a second genetic element, the
first genetic element and the second genetic element may be
separated from each other by at least 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500,
1000, 2000, 5000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000,
70,000, or 100,000 nucleotides, no more than 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200,
500, 1000, 2000, 5000, 10,000, 20,000, 30,000, 40,000, 50,000,
60,000, 70,000, or 100,000 nucleotides, or at least 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90,
100, 200, 500, 1000, 2000, or 5000, and no more than 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90,
100, 200, 500, 1000, 2000, 5000, 10,000, 20,000, 30,000, 40,000,
50,000, 60,000, 70,000, or 100,000 nucleotides (i.e. there are the
aforementioned number of nucleotides between the first genetic
element and the second genetic element). In another example, a
double-stranded nucleic acid molecule may contain at least a first
genetic element and a second genetic element, and on the first
strand of the double-stranded nucleic acid molecule, in situations
in which the first genetic element first complementary sequence is
upstream to the second genetic element first complementary
sequence, there may be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000,
2000, 5000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000,
or 100,000 nucleotides between the 3' end of the first genetic
element first complementary sequence and the 5' end of the second
genetic element first complementary sequence. In embodiments, a
double-stranded nucleic acid molecule may contain at least a first
genetic element and a second genetic element, and on the first
strand of the double-stranded nucleic acid molecule, in situations
in which the first genetic element first complementary sequence is
upstream to the second genetic element first complementary
sequence, there may be no more than 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500,
1000, 2000, 5000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000,
70,000, or 100,000 nucleotides between the 3' end of the first
genetic element first complementary sequence and the 5' end of the
second genetic element first complementary sequence. In
embodiments, a double-stranded nucleic acid molecule may contain at
least a first genetic element and a second genetic element, and on
the first strand of the double-stranded nucleic acid molecule, in
situations in which the first genetic element first complementary
sequence is upstream to the second genetic element first
complementary sequence, there may be at least 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100,
200, 500, 1000, 2000, or 5000, and no more than 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100,
200, 500, 1000, 2000, 5000, 10,000, 20,000, 30,000, 40,000, 50,000,
60,000, 70,000, or 100,000 nucleotides between the 3' end of the
first genetic element first complementary sequence and the 5' end
of the second genetic element first complementary sequence. The
above statements also apply vice-versa for situations in which the
first genetic element first complementary sequence is downstream to
the second genetic element first complementary sequence
[0064] Similarly, in another example, a double-stranded nucleic
acid molecule may contain at least a first genetic element and a
second genetic element, and on the second strand of the
double-stranded nucleic acid molecule, in situations in which the
second genetic element second complementary sequence is upstream to
the first genetic element second complementary sequence, there may
be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35,
40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000, 5000, 10,000,
20,000, 30,000, 40,000, 50,000, 60,000, 70,000, or 100,000
nucleotides between the 3' end of the second genetic element second
complementary sequence and the 5' end of the first genetic element
second complementary sequence. In embodiments, a double-stranded
nucleic acid molecule may contain at least a first genetic element
and a second genetic element, and on the second strand of the
double-stranded nucleic acid molecule, in situations in which the
second genetic element second complementary sequence is upstream to
the first genetic element second complementary sequence, there may
be no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30,
35, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000, 5000,
10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, or 100,000
nucleotides between the 3' end of the second genetic element second
complementary sequence and the 5' end of the first genetic element
second complementary sequence. In embodiments, a double-stranded
nucleic acid molecule may contain at least a first genetic element
and a second genetic element, and on the second strand of the
double-stranded nucleic acid molecule, in situations in which the
second genetic element second complementary sequence is upstream to
the first genetic element second complementary sequence, there may
be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35,
40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000, or 5000, and no
more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35,
40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000, 5000, 10,000,
20,000, 30,000, 40,000, 50,000, 60,000, 70,000, or 100,000
nucleotides between the 3' end of the second genetic element second
complementary sequence and the 5' end of the first genetic element
second complementary sequence.
[0065] In embodiments, a first amplification reaction may be
performed in order to amplify at least a portion of the
double-stranded nucleic acid molecule 10. Frequently, it may be
desirable to determine whether a first genetic element of interest
and a second genetic element of interest are present in a sample
and specifically if they are part of the same double-stranded
nucleic acid molecule 10. It may be important to determine whether
a first genetic element of interest and a second genetic element of
interest are part of the same double-stranded nucleic acid molecule
in order to better understand, for example, the genetic
characteristics of a pathogen that may be in the sample. For
example, it may be of interest to determine whether a particular
antibiotic-resistant strain of a particular bacteria is present in
a sample from a subject, and this may be determined by identifying,
for example, if there is a double-stranded nucleic acid molecule
which contains both an antibiotic resistance gene (i.e. a first
genetic element) and a gene from a particular species of bacteria
(i.e. a second genetic element). Such double-stranded nucleic acid
molecules may be formed, for example, when a bacterium acquires an
antibiotic-resistance gene and the antibiotic resistance gene is
then integrated into a chromosome of the bacterium. An antibiotic
resistance gene typically provides resistance against a particular
antibiotic or class or antibiotics by encoding a protein which
facilitates resistance against that antibiotic or class of
antibiotic (e.g. the protein facilitates, for example, chemically
deactivating the antibiotic or pumping the antibiotic out of the
bacteria).
[0066] Thus, in performing a first amplification reaction to
amplify at least a portion of the double-stranded nucleic acid
molecule 10, it may be desirable to generate an amplification
product that contains at least a portion of a first genetic element
of interest and at least a portion of a second genetic element of
interest. The successful generation of this kind of amplification
product (i.e. which contains at least a portion a first genetic
element of interest and at least a portion of a second genetic
element of interest) from an amplification reaction indicates that
there is a template double-stranded nucleic acid molecule 10 in the
amplification reaction mixture which contains both the first
genetic element of interest and the second genetic element of
interest on the same double-stranded nucleic acid molecule. An
amplification product from a first nucleic acid amplification
provided herein may be referred to herein as a "first amplification
reaction product".
[0067] In order to perform a first amplification reaction which can
potentially generate a first nucleic acid amplification product
that contains at least a portion of a first genetic element and at
least a portion of a second genetic element (assuming that there is
a template double-stranded nucleic acid molecule 10 which contains
both the first genetic element of interest and the second genetic
element of interest on the same double-stranded nucleic acid
molecule in the first amplification reaction mixture), a first
primer 46 and a second primer 48 may be provided (a "first
amplification reaction first primer" 46 and a "first amplification
reaction second primer" 48, respectively) in a first amplification
reaction mixture.
[0068] The first amplification reaction first primer 46 may have a
nucleotide sequence which is complementary to at least a portion of
a first genetic element of interest 36, and, in embodiments,
specifically to at least a portion of the first complementary
sequence 36a of the first genetic element 36. Due to the
complementation between the nucleotide sequence of the first
amplification reaction first primer 46 and the nucleotide sequence
of the at least a portion of the first complementary sequence 36a
of the first genetic element 36, the first amplification reaction
first primer 46 may anneal to the at least a portion of the first
complementary sequence 36a of the first genetic element 36. In the
block arrow in FIG. 1A representing the first amplification
reaction first primer 46 (and for all other arrows in figures
herein), the pointed end of the arrow represents the 3' end of the
primer, and the rectangle end of the arrow represents the 5' end of
the primer. Thus, the primer will be extended by a polymerase in
the direction of the pointed arrow. In FIG. 1A, the portion of the
first complementary sequence 36a to which the first amplification
reaction first primer 46 is complementary and to which the first
amplification reaction first primer 46 can anneal is illustrated
with a black square 42. While the portion of the first
complementary sequence 36a to which the first amplification
reaction first primer 46 is complementary 42 is only a portion of
the first complementary sequence 36a in FIG. 1A, it should be
understood that the portion of the first complementary sequence 36a
to which the first amplification reaction first primer 46 is
complementary 42 could alternatively be the entirety of the first
complementary sequence 36a, be a different size relative to the
first complementary sequence 36a, or be in a different position
within the first complementary sequence 36a.
[0069] The first amplification reaction second primer 48 may have a
nucleotide sequence which is complementary to at least a portion of
a second genetic element of interest 32, and, in embodiments,
specifically to at least a portion of the second complementary
sequence 32b of the second genetic element 32. Due to the
complementation between the nucleotide sequence of the first
amplification reaction second primer 48 and the nucleotide sequence
of the at least a portion of the second complementary sequence 32b
of the second genetic element 32, the first amplification reaction
second primer 48 may anneal to the at least a portion of the second
complementary sequence 32b of the second genetic element 32. In
FIG. 1A, the portion of the second complementary sequence 32b to
which the first amplification reaction second primer 48 is
complementary and to which the first amplification reaction second
primer 48 can anneal is illustrated with a black square 44. While
the portion of the second complementary sequence 32b to which the
first amplification reaction second primer 48 is complementary 44
is only a portion of the second complementary sequence 32b in FIG.
1A, it should be understood that the portion of the second
complementary sequence 32b to which the first amplification
reaction second primer 48 is complementary 44 could alternatively
be the entirety of the second complementary sequence 32b, be a
different size relative to the second complementary sequence 32b,
or be in a different position within the second complementary
sequence 32b.
[0070] In embodiments, one or both of the first amplification
reaction first primer 46 and the first amplification reaction
second primer 48 may be phosphorylated at the 5' end of the primer.
In embodiments, the primers may be provided to the first
amplification reaction mixture in an already-phosphorylated form.
If a primer is not already phosphorylated, it may be treated with a
kinase (e.g. T4 polynucleotide kinase) in order to phosphorylate
the primer.
[0071] The first amplification reaction may utilize any suitable
nucleic acid replication technique which involves at least two
template-specific primers (e.g. a first primer to anneal to a
sequence of the first genetic element and a second primer to anneal
to a sequence of the second genetic element). In embodiments, the
first nucleic acid replication technique is polymerase chain
reaction (PCR). PCR is described in, for example, U.S. Pat. No.
4,683,202, which is hereby incorporated by reference for all
purposes. In other embodiments, the first nucleic acid replication
technique may be an isothermal amplification reaction. Such
isothermal amplifications may use, for instance, phi29 DNA
polymerase (or another DNA polymerase that is highly processive and
has strand-displacement activity), and may be performed by first
heat-denaturing the common double-stranded nucleic acid molecule
(in order to permit the first primer and second primer to anneal to
their complementary sequences), and then permitting the primers to
be extended and copies thereof to be generated under isothermal
conditions (typically at a temperature between 40 and 65 C). The
first amplification reaction may generate a first amplification
reaction product, which contains at least a portion of the first
genetic element and at least a portion of the second genetic
element.
[0072] The first amplification reaction mixture includes a nucleic
acid polymerase (e.g. a DNA polymerase). A nucleic acid polymerase
used in the first amplification reaction may be a DNA polymerase
which has a relatively high processivity (i.e. which is capable of
readily amplifying templates of at least, for example, 3000
nucleotides in length). DNA polymerases with high processivity
include, for example, LongAmp.RTM. Taq DNA Polymerase (New England
BioLabs, Inc.; it is a blend of Taq and DeepVent.sub.R.TM. DNA
polymerases), Q5.RTM. High-Fidelity DNA Polymerase (New England
BioLabs, Inc.), Phusion.RTM. High-Fidelity DNA Polymerase (New
England BioLabs, Inc.), HOTSTAR HIGHFIDELITY DNA POLYMERASE
(Qiagen), and phi29 DNA polymerase. In addition, a nucleic acid
polymerase used in the first amplification reaction may be a DNA
polymerase which has strand-displacement activity.
[0073] In some embodiments, methods and steps thereof provided
herein for amplification reactions include or are performed under
conditions sufficient to support polymerase-based nucleic acid
synthesis. Example conditions for polymerase-based nucleic acid
synthesis are known in the art and are provided, for example, in
Molecular Cloning: A Laboratory Manual, M. R. Green and J.
Sambrook, Cold Spring Harbor Laboratory Press (2012), which is
herein incorporated by reference in its entirety. Non-limiting
components for a polymerase-based nucleic acid synthesis reaction
may include one or more of: polymerase enzyme (at a concentration
between, for example, 0.01 and 10 units enzyme per 50 microliters
reaction volume, or any range therein including, for example,
between 0.01-1, 0.1-10, 0.1-5, 0.5-10, 0.5-5, 0.5-2, 1-10, or 1-5
units enzyme per 50 microliters reaction volume, where 1 unit of
enzyme will incorporate 15 nmol of dNTPs into polymerization
product in 30 minutes at 75 C); template (at a concentration of at
least, for example, 1, 10, 100, 1,000, 10,000, or 100,000 copies
per reaction); primer (at a concentration between, for example,
0.01 and 10 micromolar, or any range therein including, for
example, between 0.01-1, 0.1-10, 0.1-5, 0.5-5, or 0.5-2
micromolar); dNTPs (e.g. dATP, dTTP, dGTP, and dCTP, at a
concentration between, for example, 50 and 500 micromolar each of
dATP, dTTP, dGTP, and dCTP, or any range therein including, for
example, between 50-350, 100-500, 100-300, 200-500, or 300-400
micromolar each of dATP, dTTP, dGTP, and dCTP); salt (e.g. KCl or
potassium acetate, at a concentration between, for example, 1 and
200 millimolar, or any range therein including, for example,
between 1-100, 1-50, 1-20, 1-10, 10-20, 10-50, or 10-200
millimolar); buffer (e.g. Tris-HCl or Tris-acetate, pH 7.8-8.5, at
a concentration between, for example, 1 and 100 millimolar, or any
range therein including, for example, between 1-50, 1-20, 1-10,
1-5, 10-100, 20-100, or 50-100 millimolar); and magnesium ions (at
a concentration between, for example 0.1 and 10 millimolar, or any
range therein, including, for example, between 0.1-5, 0.1-1,
0.5-10, 0.5-5, or 0.5-2.5 millimolar). Additional non-limiting
components for a polymerase-based nucleic acid synthesis reaction
may increase the speed of the reaction, increase the fidelity of
the reaction, or increase the stability of enzymes or DNA in the
reaction, and may include one or more of: gelatin (at a
concentration between, for example, 0.0001% and 0.1% w/v), BSA (at
a concentration between, for example, 0.01 and 1 microgram per
microliter), sucrose (at a concentration between, for example 0.01
molar and 0.8 molar), trehalose (at a concentration between, for
example 0.01 molar and 0.8 molar), DMSO (at a concentration
between, for example, 0.01 and 10% v/v), betaine (at a
concentration between, for example, 0.1 and 10 molar), formamide
(at a concentration between, for example, 0.1 and 10% v/v),
glycerol (at a concentration between, for example, 0.1 and 20%
v/v), polyethylene glycol (at a concentration between, for example,
0.1 and 20% v/v), non-ionic detergents [e.g. NP-40 (at a
concentration between, for example, 0.01 and 1% v/v), Tween-20 (at
a concentration between, for example, 0.01 and 1% v/v), or Triton
X-100 (at a concentration between, for example, 0.01 and 1% v/v)],
ammonium ions [e.g. ammonium sulfate (at a concentration between,
for example, 1 and 100 millimolar)], and EDTA (at a concentration
between, for example, 0.001 and 0.1 millimolar). Other reagents may
also be present in a polymerase-based nucleic acid synthesis
reaction provided herein. For example, reagents sufficient to
synthesize RNA reaction products or reaction products containing
non-standard nucleotides may be used. Conditions sufficient to
support polymerase-based nucleic acid synthesis may include a
variety of temperatures and pH values. For example, the pH of a
polymerase-based nucleic acid synthesis reaction may be between,
for example pH 6.0 and pH 10.0, such as 6.5, 7, 7.5, 7.8, 7.9, 8,
8.1, 8.2, 8.5, 9, or 9.5. The temperature of a polymerase-based
nucleic acid synthesis reaction may be constant or varied. A
constant temperature may be between, for example, 10 C and 95 C,
such as 20, 25, 30, 35, 37, 40, 42, 45, 50, 55, 60, 65, 70, 75, 80,
or 85 C. A varied temperature may be two or more different
temperatures between, for example, 10 C and 95 C, such as two or
more temperatures selected from 20, 25, 30, 35, 37, 40, 42, 45, 50,
55, 60, 65, 70, 75, 80, or 85 C. In some embodiments, a varied
temperature may vary cyclically (e.g. in a PCR reaction, cyclically
between such as 94-98 C, then 50-65 C, then 72-80, then back to
94-98 C and continuing the cycle for about 10-50 cycling rounds)
Any of the above reagents may be provided in an amplification
reaction mixture described herein; similarly, any reagent described
as being in an "amplification reaction" described herein may also
be described as being in a corresponding "amplification reaction
mixture".
[0074] FIG. 1B depicts an exemplary first amplification reaction
product 50. The first amplification reaction product 50 contains a
first amplification reaction product first strand 52 and a first
amplification reaction product second strand 54. The first
amplification reaction product first strand 52 and the first
amplification reaction product second strand 54 are shorter in
nucleotide length than the first 22 and second strand 24 of the
common double-stranded nucleic acid molecule 10, as only the
nucleotides between and including the nucleotides to which the
first amplification reaction first primer 46 and the first
amplification reaction second primer 48 anneal are amplified. As
depicted in FIG. 1B, the first amplification product 50 contains
genetic elements 32, 34, and 36. Also, it is noted that although
FIG. 1B labels certain features as genetic elements 32 and 36 (and
thus suggest that these features are the same as elements 32 and 36
as in FIG. 1A), the elements 32 and 36 in FIG. 1B (and subsequent
figures) may be slightly different than in FIG. 1A. Specifically,
these elements might not contain all of the nucleotides that are
present in these elements in FIG. 1A. This can occur, for example,
if the portion of the first complementary sequence 36a to which the
first amplification reaction first primer 46 is complementary 42 is
in the middle of the first complementary sequence 36a (rather than
at the end), such that only a portion of the first genetic element
is amplified in the first amplification reaction (or
correspondingly for the first amplification reaction second primer
and the second genetic element). Nonetheless, the features labeled
as features 32 and 36 in FIG. 1B and subsequent figures in FIG. 1
will have nucleotides sequence closely related to that of features
32 and 36 in FIG. 1A, respectively--the nucleotide sequences in
FIG. 1B and subsequent figures may just be shorter in length than
in FIG. 1A. As shown in FIG. 1B, a first amplification reaction
product 50 may have a double-stranded, linear configuration.
[0075] In embodiments, in a first amplification reaction product
which contains at least a portion of a first genetic element of
interest and at least a portion of a second genetic element of
interest, there are at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000,
5000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, or
100,000 nucleotides, no more than 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500,
1000, 2000, 5000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000,
70,000, or 100,000 nucleotides, or at least 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200,
500, 1000, 2000, or 5000, and no more than 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200,
500, 1000, 2000, 5000, 10,000, 20,000, 30,000, 40,000, 50,000,
60,000, 70,000, or 100,000 nucleotides between the 3' end of the
first genetic element and the 5' start of the second genetic
element (or vice-versa).
[0076] In embodiments, a first amplification reaction product may
be phosphorylated at the 5' end of one or both of the first
amplification reaction product first strand 52 or the first
amplification reaction product second strand 54. A phosphorylated
first amplification reaction product may be generated by using
phosphorylated first and second primers in the first amplification
reaction, or a first amplification reaction product may be
phosphorylated once it is generated. In either case, the respective
molecule may be phosphorylated by methods known in the art (e.g.
with T4 polynucleotide kinase).
[0077] A first amplification reaction product may be provided in a
ligation reaction mixture, in which a ligation reaction occurs. The
ligation reaction mixture contains a DNA ligase (e.g. T4 DNA
ligase). In the ligation reaction, a terminal 5' phosphate of a
polynucleotide (e.g. DNA or RNA) strand forms a covalent
phosphodiester bond with a 3' OH group of a polynucleotide strand.
In a ligation reaction, the 5' phosphate of a polynucleotide strand
may link with a 3' OH group of the same strand (i.e. an
intra-strand ligation), or the 5' phosphate may link with a 3' OH
group of a different strand (i.e. an inter-strand ligation). As
depicted in FIG. 1C, in embodiments provided herein, a
phosphorylated first amplification reaction product in a ligation
reaction mixture may yield a circular ligation product 60. In the
circular ligation product 60, there is a circular ligation product
first strand 62 and a circular ligation product second strand 64,
which have been formed from the first amplification reaction
product first strand 52 and the first amplification reaction
product second strand 54, respectively (i.e. by ligating the 5' end
of the first amplification reaction product first strand 52 to the
3' end of the same strand, to form the circular ligation product
first strand 62 and by ligating the 5' end of the first
amplification reaction product second strand 54 to the 3' end of
the same strand, to form the circular ligation product second
strand 64). As shown in FIG. 1C, in the circular ligation product
60, on the first strand 62, the complementary sequence 32a of
genetic element 32 is adjacent to the complementary sequence 36a of
genetic element 36. Also, on the circular ligation product second
strand 64, the complementary sequence 32b of genetic element 32 is
adjacent to the complementary sequence 36b of genetic element 36.
Thus, the formation of the circular ligation product 60 brings
genetic element 32 much closer to genetic element 36 in the
circular ligation product 60 than these genetic elements occur in
relation to each other in the common double-stranded nucleic acid
molecule 10.
[0078] In embodiments, a phosphorylated first amplification
reaction product in a ligation reaction mixture may yield an
end-to-end ligation product (in addition to or alternatively to a
circular ligation product 60). In an end-to-end ligation product, a
first copy of a phosphorylated first amplification reaction product
is ligated end-to-end with a second copy of the phosphorylated
first amplification reaction product (e.g. in embodiments, the 3'
end of the first strand of a first copy of the first amplification
reaction product is ligated to the 5' end of the first strand of a
second copy of the first amplification reaction product, and the 3'
end of the second strand of the second copy of the first
amplification reaction product is ligated to the 5' end of the
second strand of the first copy of the first amplification reaction
product, such that an end-to-end ligation product is formed which
contains an end-to-end ligation product first strand and an
end-to-end ligation product second strand, and the end-to-end
ligation product first strand contains at least two copies of the
first strand of the first amplification reaction product and the
end-to-end ligation product second strand contains at least two
copies of the second strand of the first amplification reaction
product). In an end-to-end ligation product, a copy of genetic
element 32 may be brought much closer to a copy of genetic element
36 than these genetic elements occur in relation to each other in
the common double-stranded nucleic acid molecule 10.
[0079] One or both of a circular ligation product or an end-to-end
ligation product may be provided to a second amplification reaction
mixture. FIG. 1D depicts a circular ligation product 60 in a second
amplification reaction. In a second amplification reaction mixture,
a second amplification reaction first primer 76 and a second
amplification reaction second primer 78 are provided. At least a
region of the second amplification reaction first primer 76 is
complementary to and anneals to a portion 72 of genetic element 32
(in this example, the second genetic element of interest) first
complementary sequence 32a, and at least a region of the second
amplification reaction second primer 78 is complementary to and
anneals to a portion 74 of genetic element 36 (in this example, the
first genetic element of interest) second complementary sequence
36b. As indicated by the directionality of the arrows representing
the second amplification reaction first primer 76 and the second
amplification reaction second primer 78, the extension products of
the primers in the second amplification reaction may be synthesized
in a direction opposite that of the direction of synthesis of the
extension product of primers in the first amplification reaction.
The directionality of the second amplification reaction first
primer 76 and the second amplification reaction second primer 78 in
the second amplification reaction permits the rapid amplification
of the first genetic element and the second genetic element,
without the need of amplifying intervening nucleotide sequences (or
additional genetic elements therein), thus permitting a robust
amplification of and detection of the first genetic element.
[0080] A second amplification reaction may utilize any suitable
nucleic acid replication technique which involves at least two
template-specific primers (e.g. a first primer to anneal to a
sequence of the first genetic element and a second primer to anneal
to a sequence of the second genetic element). Exemplary suitable
nucleic acid replication techniques that may be used for the second
amplification reaction include, for instance, PCR or an
amplification method as described in PCT/US14/56151, which is
hereby incorporated by references for all purposes. PCT/US14/56151
describes methods and compositions for nucleic acid replication. In
embodiments, the methods of PCT/US14/56151 can be performed without
thermocycling. In embodiments, a method of PCT/US14/56151 may
involve a first primer and a second primer. In embodiments, the
first primer of a method of PCT/US14/56151 contains a first region
and a second region, wherein the first region comprises a 5' end of
the primer, the second region comprises a 3' end of the primer, and
the second region is complementary to a least a portion of a first
strand of a double-stranded nucleic acid template (i.e. a
double-stranded nucleic acid molecule). In embodiments, the second
primer of a method of PCT/US14/56151 contains a first region and a
second region, wherein the first region comprises a 5' end of the
primer and is complementary to the first region of the first
primer, the second region comprises a 3' end of the primer, and
wherein the second region is complementary to a least a portion of
a second strand of the double-stranded nucleic acid template. In
embodiments, the second region of a first primer of a method of
PCT/US14/56151 may anneal to a first complementary sequence of an
element as provided in methods herein in the same way as a first
primer in methods provided herein, and the second region of a
second primer of a method of PCT/US14/56151 may anneal to a second
complementary sequence of an element as provided in methods herein
in the same way as a second primer in methods provided herein.
Methods and compositions of PCT/US14/56151 are described in
additional detail elsewhere herein.
[0081] The second amplification reaction may generate a second
amplification reaction product 80, which contains at least a
portion of the first genetic element and at least a portion of the
second genetic element. In embodiments, the second amplification
reaction product 80 may have a double-stranded, linear
configuration. As depicted in FIG. 1E, the second amplification
reaction product 80 contains a second amplification reaction
product first strand 82 and a second amplification reaction product
second strand 84. The second amplification reaction product first
strand 82 contains the first complementary sequence 36a of the
first genetic element 36 and the first complementary sequence 32a
of the second genetic element 32. The second amplification reaction
product second strand 84 contains the second complementary sequence
36b of the first genetic element 36 and the second complementary
sequence 32b of the second genetic element 32. In embodiments, the
second amplification reaction product 80 may form concatemers
containing two or more copies of the first genetic element 36 and
the second genetic element 32, if, for example, the second
amplification reaction is performed as a method described in
PCT/US14/56151.
[0082] The second amplification reaction product 80 may be detected
by methods known if the art for the detection of nucleic acids, and
as described elsewhere herein.
[0083] In an example, a method provided herein for the detection of
two genetic elements on a common double-stranded nucleic acid
molecule may be performed as follows. In this example, the
sequences of the primers and the genetic elements are shorter (i.e.
have fewer nucleotides) than is typical for a method provided
herein. However, the sequences in this example are sufficient to
provide information about exemplary steps of an embodiment of a
method provided herein. In this example, a first genetic element
and a second genetic element are of interest. The first
complementary sequence of the first genetic element is: 5' AAT 3'
and the second complementary sequence of the first genetic element
is: 5' ATT 3'. The first complementary sequence of the second
genetic element is: 5' TTG 3' and the second complementary sequence
of the second genetic element is 5' CAA 3'. The first genetic
element and the second genetic element are present on a common
double-stranded nucleic acid molecule. As used herein, description
of two or more elements as being on a "common" molecule indicates
that the elements are part of the same contiguous molecule (i.e.
the same single or double-stranded DNA molecule). The nucleotide
sequence of the first strand of the common double-stranded nucleic
acid molecule is: 5' TTGXAAT 3', where X is any number and sequence
of nucleotides. For example, X may contain at least 100, 500, 1000,
2000, 3000, 4000, 5000, or 10,000 nucleotides. The nucleotide
sequence of the second strand of the double-stranded nucleic acid
molecule is: 5' ATTX'CAA 3', where X' is a number and sequence of
nucleotides complementary to the sequence of X. In the first
amplification reaction mixture, a first amplification reaction
first primer and a first amplification reaction second primer are
provided. The nucleotide sequence of the first amplification
reaction first primer is: 5' ATT 3'. The nucleotide sequence of the
first amplification reaction second primer is: 5' TTG 3'. In the
first amplification reaction mixture, a first amplification
reaction product is generated. The first amplification reaction
product contains a first amplification reaction product first
strand and a first amplification reaction product second strand.
The nucleotide sequence of the first amplification reaction product
first strand is: 5' TTGXAAT 3', where X is any number and sequence
of nucleotides. The nucleotide sequence of the first amplification
reaction product second strand is: 5' ATTX'CAA 3', where X' is a
number and sequence of nucleotides complementary to the sequence of
X. (While in this example, the first amplification reaction product
is the same size as the common double-stranded nucleic acid
molecule, typically, in methods provided herein, the first
amplification reaction product is shorter in length than the common
double-stranded nucleic acid molecule.) In the ligation reaction
mixture, a circular ligation product is formed from the first
amplification reaction product, in which the circular ligation
product first strand has a nucleotide sequence of: 5' TTGXAAT 3',
and wherein the 5' T and 3' T are covalently linked are part of a
circular polynucleotide. The circular ligation product second
strand has a nucleotide sequence of: 5' ATTX'CAA 3', and wherein
the 5' A and 3' A are covalently linked are part of a circular
polynucleotide. In the second amplification reaction mixture, a
second amplification reaction first primer and a second
amplification reaction second primer are provided. The nucleotide
sequence of the second amplification reaction first primer is: 5'
CAA 3'. The nucleotide sequence of the second amplification
reaction second primer is: 5' AAT 3'. In the second amplification
reaction mixture, a second amplification reaction product is
generated. The second amplification reaction product contains a
second amplification reaction product first strand and a second
amplification reaction product second strand. The nucleotide
sequence of the second amplification reaction product first strand
is: 5' AATTTG 3'. The nucleotide sequence of the second
amplification reaction product second strand is: 5' CAAATT 3'.
[0084] In embodiments, all of the steps of methods provided herein
may be permitted to occur simultaneously in the same vessel (e.g.
all reagents for methods provided herein may be provided in the
same vessel at the same time). Also, provided herein are kits
containing reagents for methods provided herein.
[0085] In addition to being used for the detection of true MRSA
bacteria, the method provided herein may also be used for the
detection of other genetic elements in other species or molecules,
in which, for example, there are two or more genetic elements which
may be on a common nucleic acid strand or part of a common
molecule, but for which the elements are separated from each other
by a large nucleotide distance. A general approach as provided
herein (i.e. to perform a first amplification reaction, followed by
a ligation reaction, followed by a second amplification reaction)
may be used for a wide range of genetic elements which present a
similar structural problem.
[0086] In addition, in embodiments, the first amplification
reaction provided herein may be omitted, if multiple copies of a
molecule containing genetic elements of interest are already
present, and such molecules may be ligated together to form
structures in which the elements of interest may be readily
amplified by, for example, as PCR or an amplification method as
described in PCT/US14/56151.
[0087] In embodiments, provided herein are compositions and methods
for evaluating a SNP, mutation, or other nucleotide of interest in
a target sequence. In some situations, a target sequence may have
multiple different polymorphisms which surround the position of the
nucleotide of interest. For example, the nucleotide of interest may
be located in the 60.sup.th nucleotide position of a target
sequence of 150 nucleotides (with the 5' most nucleotide being in
the first position, the nucleotide next to the 5' most nucleotide
being in the second position, etc.), and other nucleotides in the
target sequence may also frequently be variable (e.g. the
49.sup.th, 51.sup.st, 57.sup.th nucleotide position may also
frequently have variant nucleotides/be SNP sites).
[0088] In embodiments, a nucleotide of interest may be evaluated
through use of a method for SNP detection as provided in
PCT/US14/56151, filed Sep. 17, 2014, which is hereby incorporated
by reference in its entirety for all purposes. In such a method, a
primer pair is used to amplify a target nucleic acid containing the
nucleotide of interest, wherein each primer contains a tail/first
region and a template-binding/second region. In embodiments, the
tail of the/first region of the second primer of the primer pair is
complementary to a portion of the target nucleic acid including the
nucleotide of interest. In a method as disclosed in PCT/US14/56151,
the identity of a nucleotide of interest may be determined, for
example, by comparing the rate or amount of amplification of a
target nucleic acid containing the nucleotide of interest by one or
more primer pairs having slightly different nucleotide sequences in
the first/tail region of the primer (typically by just a single
nucleotide difference between the primer pairs).
[0089] However, in some situations, it may be difficult to perform
a method for SNP detection as provided in PCT/US14/56151, if there
is a lot of sequence variance in the target nucleic acid one or
more positions near the nucleotide of interest. Such positions, for
example, may be in the region corresponding to the template-binding
regions of the first and/or second primer. If the primers as
described in PCT/US14/56151 for SNP detection are not able to
readily bind to a target nucleic acid sequence, the method
disclosed therein may not be effective for SNP detection.
[0090] Accordingly, provided herein are compositions and methods
which facilitate the identification of SNPs or other nucleotides of
interest. In embodiments, steps and reagents for this type of
method may be referred to herein as for "nucleotide analysis". In a
first step, a region of a target nucleic acid containing the
nucleotide of interest is amplified by a first amplification
reaction (such as PCR; also referred to herein as a "PCR
amplification reaction"), to generate a PCR amplification reaction
product. A PCR amplification reaction may occur in a PCR
amplification reaction mixture. In this PCR amplification reaction,
relatively long primer pairs (e.g. each primer contains at least
15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 90, or 100
nucleotides) may be used to amplify the target nucleic acid. The
long primers may tolerate relatively large amounts of sequence
diversity in the template-binding regions (i.e. because the primers
are long, they may still anneal to a target sequence, even if
multiple nucleotides are mis-matched). Importantly, in the PCR
amplification reaction, neither of the primers is to anneal to the
exact position of the nucleotide/SNP of interest (i.e. the primers
should only anneal to areas near the SNP of interest). This is
because with methods provided herein, it is not desirable to change
the identity of the nucleotide/SNP of interest (since it is desired
to identify the nucleotide/SNP of interest). Once a PCR
amplification product is generated in the PCR amplification
reaction, the PCR amplification product will have a generally known
nucleotide sequence (as a result of knowing the nucleotide sequence
of the primers used in the PCR amplification reaction to generate
the PCR reaction amplification product). However, the identity of
the nucleotide/SNP of interest will still be unknown in the PCR
amplification reaction product, since neither of the primers used
in the PCR amplification reaction annealed to the location of the
nucleotide/SNP of interest. The PCR amplification reaction product
may then incubated with primers as provided in PCT/US14/56151 for
SNP detection. These primers may be designed to have regions that
are complementary to sequences that are known to be present in the
PCR amplification reaction product, based on the fact that the PCR
amplification reaction product was generated through use of primers
of known sequences. The identity of a SNP/nucleotide of interest
may then be determined as described in PCT/US14/56151.
[0091] FIG. 2 provides a general schematic of a method provided
herein. A nucleic acid strand 100 containing a target nucleic acid
102 may be provided. The target nucleic acid 102 may contain
multiple polymorphisms/variant nucleotides 104. The target nucleic
acid 102 also contains a nucleotide/SNP of interest 106. The target
nucleic acid is incubated with a PCR amplification reaction first
primer 112 and a PCR amplification reaction second primer 114 in a
PCR reaction mixture, in order to generate a PCR amplification
reaction product 120. The PCR amplification reaction product 120
will have a generally known nucleotide sequence, since it was
amplified with the PCR amplification reaction first primer 112 and
the PCR amplification reaction second primer 114 (which have known
nucleotide sequences). The PCR amplification reaction product 120
is a double-stranded nucleic acid molecule which contains a PCR
amplification reaction product first strand and a PCR amplification
reaction product second strand. In embodiments, the PCR
amplification reaction product first strand may be a copy of a
polynucleotide template of interest. During the process of
generating the PCR amplification reaction product 120, the multiple
polymorphisms/variant nucleotides 104 are replaced by the
nucleotides of the first primer 112 and second primer 114. However,
the PCR amplification reaction product 120 still has an unknown
nucleotide/SNP of interest 106. The PCR amplification reaction
product 120 may then be used in a method as described in
PCT/US14/56151 for SNP detection.
[0092] In embodiments, a PCR amplification reaction used as part of
a method for nucleotide analysis may be performed in the same way
as a first amplification reaction as provided herein for a genetic
element analysis first amplification reaction (e.g. both
amplification reactions may be PCR reactions). Similarly, in
embodiments, the components of a genetic element analysis first
amplification reaction mixture may be the same as the components of
a PCR amplification reaction mixture provided herein (taking in to
account, for example, differences in primer and template nucleotide
sequences and temperature or reagent optimizations). Also, steps
and reagents provided herein may be generally referred to with the
prefix "genetic element analysis" or "nucleotide analysis", if it
is desirable to identify a particular method step or reagent as
being associated with the genetic element analysis or nucleotide
analysis processes described herein. Alternatively, a method step
or reagent provided herein might not be referred to with the prefix
"genetic element analysis" or "nucleotide analysis" (e.g. a first
primer or first strand), if the context clearly indicates a
particular method or, alternatively, if a statement is broadly
applicable to various types of primers or method steps (i.e. not
just to a specific method or reagent).
[0093] In embodiments, methods provided herein may be used to
assess a SNP in the polymorphic site Q80K in the Hepatitis C
protease gene, NS3. An exemplary primer pair that may be used in a
method provided herein for assessing the Q80K site is: First primer
(5' to 3' direction):
GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTATACCAATGTAGAC (SEQ
ID NO: 1); Second primer (5' to 3' direction):
CGCAGGTGCAGGGTGTCAATGAGCGGGCACCTTGAGGAGCGGGCCAGCCCACGAGGTCT (SEQ ID
NO: 2). Methods provided herein may be used to assess SNPs in many
different target nucleic acids, wherein the target nucleic acids
have a high level of sequence variability.
[0094] In embodiments, all of the steps of methods provided herein
may be permitted to occur simultaneously in the same vessel (e.g.
all reagents for methods provided herein may be provided in the
same vessel at the same time).
[0095] In embodiments, a method provided herein may be performed as
follows. A polynucleotide template may be amplified in a first
amplification reaction, wherein the first amplification reaction is
a PCR reaction. In the first amplification reaction, a PCR
amplification reaction product may be generated. The PCR
amplification reaction product may be a double-stranded nucleic
acid molecule comprising a first strand and a second strand, and
wherein a first strand of the PCR amplification reaction product is
a copy of the polynucleotide template. Next, the PCR reaction
product (which comprises a copy of the polynucleotide template) may
be used as a template in a non-thermocycling amplification reaction
as provided in PCT/US14/56151, in order to generate a
non-thermocycling reaction product as described in PCT/US14/56151.
Such non-thermocycling reaction products may include concatemers.
In embodiments of this method involving a PCR amplification
reaction followed by a non-thermocycling amplification reaction,
only the non-thermocycling reaction products are detected (not the
PCR reaction products). In embodiments, the non-thermocycling
reaction products are detected in real-time as they are formed. In
embodiments, a method of PCT/US14/56151 may involve a first primer
and a second primer. In embodiments, the first primer of a method
of PCT/US14/56151 contains a first region and a second region,
wherein the first region comprises a 5' end of the primer, the
second region comprises a 3' end of the primer, and the second
region is complementary to a least a portion of a first strand of a
double-stranded nucleic acid template (i.e. a double-stranded
nucleic acid molecule, such as a PCR amplification reaction
product). In embodiments, the second primer of a method of
PCT/US14/56151 contains a first region and a second region, wherein
the first region comprises a 5' end of the primer and is
complementary to the first region of the first primer, the second
region comprises a 3' end of the primer, and wherein the second
region is complementary to a least a portion of a second strand of
the double-stranded nucleic acid template. In embodiments, the
second region of a first primer of a method of PCT/US14/56151 may
anneal to a first strand of a PCR amplification reaction product in
methods herein in the same way as a first PCR amplification
reaction primer anneals to a polynucleotide template strand in PCR
amplification reactions provided herein, and the second region of a
second primer of a method of PCT/US14/56151 may anneal to a second
strand of a PCR amplification reaction product as provided in
methods herein in the same way as a second PCR amplification
reaction primer anneals to a polynucleotide which is complementary
to the polynucleotide template in PCR amplification reaction
methods provided herein.
[0096] A "primer" as used herein may refer to a polynucleotide
which is i) capable of hybridizing to an original nucleic acid
strand and ii) acting as a point of initiation for the synthesis of
a new nucleic acid strand, wherein the new nucleic acid strand is
an extension product of the primer and is complementary to the
original strand. A primer may have a free --OH group at its 3'
terminus, which may serve as the origin of synthesis for the
extension product.
[0097] A primer may contain standard nucleotides [e.g. standard DNA
deoxyribonucleotides (deoxyadenosine monophosphate, deoxyguanosine
monophosphate, thymidine monophosphate, deoxycytidine
monophosphate) or standard RNA ribonucleotides (adenosine
monophosphate, guanosine monophosphate, uridine monophosphate,
cytidine monophosphate)], alternative nucleotides (e.g. inosine),
modified nucleotides, nucleotide analogs, or a combination thereof.
For example, an oligonucleotide primer may include peptide nucleic
acids, morpholinos (e.g. phosphorodiamidate morpholino oligos),
locked nucleic acids [see, for example, Kaur, H, et. al,
Biochemistry 45 (23), 7347-55 (2006)], glycol nucleic acids, or
threose nucleic acids. A primer may have a backbone, including, for
example, phosphodiester linkages, phosphorothioate linkages (a
non-bridging O is replaced with sulfur), or peptide linkages (as
part of a peptide nucleic acid). Alternative nucleotides, modified
nucleotides, and nucleotide analogs may be referred to collectively
herein as "non-standard nucleotides."
[0098] The presence of a non-standard nucleotide in a primer may
affect various properties of the primer. In some embodiments,
inclusion of a non-standard nucleotide in a primer may increase or
decrease the thermodynamic stability of a primer to a complementary
sequence thereof. For example, a primer having increased
thermodynamic stability may contain a locked nucleic acid. A primer
having decreased thermodynamic stability may contain, for example,
inosine (described by Auer et al., Nucl. Acids Res. 24; 5021-5025
(1996)) or a negatively charged chemical group, such as a
carboxylic acid.
[0099] A first primer or a second primer provided herein may be of
any length. The first primer and second primer may contain the same
number of nucleotides, or a different number of nucleotides. In
some embodiments, a first or second primer may be at least 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90,
100, 150, 200, 250, 300, 350, 400, 500, 750, 1000, or 1500
nucleotides in length. In some embodiments, a first or second
primer may be no more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400,
500, 750, 1000, or 1500 nucleotides in length. In some embodiments,
a first or second primer may have a length selected from a range
having a minimum value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400,
500, 750, or 1000 nucleotides in length, and a maximum value of 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90,
100, 150, 200, 250, 300, 350, 400, 500, 750, 1000, or 1500
nucleotides in length.
[0100] The presence of amplified nucleic acids can be assayed, for
example, by detection of reaction products (amplified nucleic acids
or reaction by-products) or by detection of probes associated with
the reaction progress.
[0101] In some embodiments, reaction products may be identified by
staining the products with a dye. In some embodiments, a dye may
have greater fluorescence when bound to a nucleic acid than when
not bound to a nucleic acid. In embodiments, a dye may intercalate
with a double-stranded nucleic acid or it may bind to an external
region of a nucleic acid. Nucleic acid dyes that may be used with
methods and compositions provided herein include, for example,
cyanine dyes, PicoGreen.RTM., OliGreen.RTM., RiboGreen.RTM.,
SYBR.RTM. dyes, SYBR.RTM. Gold, SYBR.RTM. Green I, SYBR.RTM. Green
II, ethidium bromide, dihydroethidium, BlueView.TM., TOTO.RTM.
dyes, TO-PRO.RTM. dyes, POPO.RTM. dyes, YOYO.RTM. dyes, BOBO.RTM.
dyes, JOJO.RTM. dyes, LOLO.RTM. dyes, SYTOX.RTM. dyes, SYTO.RTM.
dyes, propidium iodide, hexidium iodide, methylene blue, DAPI,
acridine orange, quinacrine, acridine dimers,
9-amino-6-chloro-2-methoxyacridine, bisbenzimide dyes, Hoechst
dyes, 7-aminoactinomycin D, actinomycin D, hydroxystilbamidine,
pyronin Y, Diamond.TM. dye, GelRed.TM., GelGreen.TM. and LDS
751.
[0102] In some embodiments, reaction products may be identified by
analysis of turbidity of amplification reactions. For example, in
embodiments, increased turbidity may be correlated with formation
of reaction products and reaction by-products (e.g. pyrophosphate
complexed with magnesium).
[0103] In some embodiments, reaction products may be identified by
separating a reaction performed according to a method herein by gel
electrophoresis, followed by staining of the gel with a dye for
nucleic acids. The dye may be any nucleic acid dye disclosed herein
or otherwise known in the art.
[0104] In some embodiments, any method or composition known in the
art for the detection of nucleic acids or for the generation of
nucleic acids may be used with methods and compositions provided
herein.
[0105] In some embodiments, a reaction performed according to a
method provided herein may be monitored in an apparatus containing
a light source and an optical sensor. In some situations, the
reaction may be positioned in the path of light from the light
source, and light absorbed by the sample (e.g. in the case of a
turbid reaction), scattered by the sample (e.g. in the case of a
turbid reaction), or emitted by the sample (e.g. in the case of a
reaction containing a fluorescent molecule) may be measured. In
some embodiments, a method provided herein may be performed or
monitored in a device or module therein as disclosed in U.S. patent
application Ser. No. 13/769,779, filed Feb. 18, 2013, which is
herein incorporated by reference in its entirety.
[0106] Using methods provided herein, specific amplification
products of a nucleic acid template of interest may be identified
within, for example, 30 seconds, 1 minute, 3 minutes, 5 minutes, 10
minutes, 15 minutes, 20 minutes, 30 minutes, 45 minutes, 60
minutes, 90 minutes, 120 minutes, 180 minutes, or 240 minutes of
initiation of an amplification reaction. In other examples, using
methods provided herein, amplification reactions which are positive
for a nucleic acid template of interest may be identified when as
few as 10, 50, 100, 500, 1000, 5000, 10,000, 50,000, 100,000,
500,000, or 1,000,000 copies of the template are generated. In
other examples, using methods provided herein, the presence of a
nucleic acid template of interest in a sample containing as few as
1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 100, 200, 500, 1000,
5000, or 10,000 copies of the template of interest at the start of
the method may be identified.
[0107] In embodiments, methods provided herein may be used to assay
a sample for a target nucleic acid of interest. In certain
embodiments, the presence or quantity of a target nucleic acid of
interest in a sample may be determined by a method involving
determining an inflection time for nucleic acid amplification in a
reaction. An inflection time/inflection point is a time or a point
where an amplification reaction is determined as being positive for
a nucleic acid template. An inflection time/point may be identified
by one or more indicators, such as for example, the time
post-initiation of a reaction when a selected quantity of nucleic
acid has been generated in the reaction, the time when the rate of
amplification in a reaction changes from a baseline phase to an
exponential phase, or the time when the rate of amplification in a
reaction changes from an exponential phase to a plateau phase, etc.
In embodiments, an inflection time/point may be identified based on
a change in fluorescence or absorbance of a reaction, or upon the
fluorescence or absorbance of a reaction reaching a selected value.
In certain embodiments, the presence or quantity of a target
nucleic acid of interest in a sample may be determined by a method
involving comparison of an inflection time for nucleic acid
amplification of a reaction of which has an unknown amount of
target nucleic acid of interest versus one or both of: i) a
reaction which is known to lack the target nucleic acid of interest
(i.e. a negative control) or ii) a reaction which is known to
contain the target nucleic acid of interest (i.e. a positive
control). In embodiments, both a reaction which contains the target
nucleic acid of interest and a reaction which does not contain the
target nucleic acid may be measured for a selected inflection time.
In embodiments, the presence of a target nucleic acid of interest
in a sample may be determined based on a method which involves
evaluation of the difference in time between inflection of a
reaction containing a sample which may or may not contain a target
nucleic acid of interest, and a time of inflection of one or more
reactions with known target nucleic acid of interest status (e.g.
which are known to contain or not contain the target nucleic acid
of interest). For example, a sample may be identified as containing
a target nucleic acid of interest if the inflection time of the
reaction according to a method provided herein is at least 3, 5,
10, 15, 20, 30, 40, 50, 60, 90, 120, or 180 minutes earlier than a
corresponding reaction which is known to not contain the target
nucleic acid of interest. In another example, a sample may be
identified as containing a target nucleic acid of interest if the
inflection time of the reaction according to a method provided
herein is no more than 3, 5, 10, 15, 20, 30, 40, 50, 60, 90, 120,
or 180 minutes later than a corresponding reaction which is known
to contain the target nucleic acid of interest.
[0108] Methods provided herein may be performed for any length of
time. Typically, the method will be performed for a length of time
sufficient to monitor, for example, the rate of nucleic acid
replication, the occurrence of polymerase activity, or the
accumulation of amplification product. In some embodiments, a
method provided herein may be performed for a total of less than 10
seconds, 30 seconds, 1 minute, 5 minutes, 10 minutes, 20 minutes,
30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours,
8 hours, 12 hours, 16 hours, or 24 hours, by which time the rate of
nucleic acid replication, the occurrence of polymerase activity, or
the accumulation of amplification product is measured.
[0109] Methods provided herein may be terminated in various ways.
In one embodiment, steps of a method may end upon the reduction in
concentration or complete consumption of one or more reagents
involved in one or more steps of the method (e.g. dNTPs). In
another embodiment, steps of a method may end upon inactivation of
one or more enzymes involved in one or more steps of the method
(e.g. polymerases). Enzymes may be inactivated by various ways. For
example, enzymes may gradually lose enzymatic activity over time
due to random events that affect the structure of the enzyme, or
enzymes may be exposed to a condition to accelerate the
inactivation of the enzyme activity (e.g. high heat, extreme pH,
etc.).
[0110] In methods provided herein, generation of nucleic acid
concatemers also amplifies the number of copies of the nucleic acid
template/particular nucleic acid in the concatemer. Accordingly,
references herein to methods and compositions for the generation of
concatemers also apply to the amplification of nucleic acids.
[0111] As used herein, a "polynucleotide" refers to a polymeric
chain containing two or more nucleotides. "Polynucleotides"
includes primers, oligonucleotides, nucleic acid strands, etc. A
polynucleotide may contain standard or non-standard nucleotides.
Typically, a polynucleotide contains a 5' phosphate at one terminus
("5' terminus") and a 3' hydroxyl group at the other terminus ("3'
terminus) of the chain. The most 5' nucleotide of a polynucleotide
may be referred to herein as the "5' terminal nucleotide" of the
polynucleotide. The most 3' nucleotide of a polynucleotide may be
referred to herein as the "3' terminal nucleotide" of the
polynucleotide.
[0112] The term "downstream" as used herein in the context of a
polynucleotide containing a 5' terminal nucleotide and a 3'
terminal nucleotide refers to a position in the polynucleotide
which is closer to the 3' terminal nucleotide than a reference
position in the polynucleotide. For example, in a primer having the
sequence: 5' ATAAGC 3', the "G" is downstream from the "T" and all
of the "A"s.
[0113] The term "upstream" as used herein in the context of a
polynucleotide containing a 5' terminal nucleotide and a 3'
terminal nucleotide, refers to a position in the polynucleotide
which is closer to the 5' terminal nucleotide than a reference
position in the polynucleotide. For example, in a primer having the
sequence: 5' ATAAGC 3', the "T" is upstream from the "G", the "C",
and the two "A"s closest to the "G".
[0114] As used herein, "nucleic acid" includes both DNA and RNA,
including DNA and RNA containing non-standard nucleotides. A
"nucleic acid" contains at least one polynucleotide (a "nucleic
acid strand"). A "nucleic acid" may be single-stranded or
double-stranded.
[0115] As used herein, a "concatemer" refers to a nucleic acid
molecule which contains within it two or more copies of a
particular nucleic acid, wherein the copies are linked in series.
Within the concatemer, the copies of the particular nucleic acid
may be linked directly to each other, or they may be indirectly
linked (e.g. there may be nucleotides between the copies of the
particular nucleic acid). In an example, the particular nucleic
acid may be that of a double-stranded nucleic acid template, such
that a concatemer may contain two or more copies of the
double-stranded nucleic acid template. In another example, the
particular nucleic acid may be that of a polynucleotide template,
such that a concatemer may contain two or more copies of the
polynucleotide template.
[0116] As used herein, a "target" nucleic acid or molecule refers
to a nucleic acid of interest. A target nucleic acid/molecule may
be of any type, including single-stranded or double stranded DNA or
RNA (e.g. mRNA).
[0117] As used herein, "complementary" sequences refer to two
nucleotide sequences which, when aligned anti-parallel to each
other, contain multiple individual nucleotide bases which can pair
with each other according to standard base-pairing rules (e.g. A-T,
G-C, or A-U), such that molecules containing the sequences can
specifically anneal to each other. It is not necessary for every
nucleotide base in two sequences to be capable of pairing with each
other for the sequences to be considered "complementary". Sequences
may be considered complementary, for example, if at least 30%, 40%,
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%
of the nucleotide bases in two sequences can pair with each other
when the sequences are optimally aligned for complementation. In
addition, sequences may still be considered "complementary" when
the total lengths of the two sequences are significantly different
from each other. For example, a primer of 15 nucleotides may be
considered "complementary" to a longer polynucleotide containing
hundreds of nucleotides if multiple individual nucleotide bases of
the primer can pair with nucleotide bases in the longer
polynucleotide when the primer is aligned anti-parallel to a
particular region of the longer polynucleotide. Additionally,
"complementary" sequences may contain one or more nucleotide
analogs or nucleobase analogs. As used herein, "perfectly
complementary" or "perfect complementation" or the like refers two
sequences which are 100% complementary to each other (i.e. where
there are no mis-matches between the nucleotides of the sequences
when the sequences are paired for maximum complementation). Also,
references herein to a first polynucleotide that "has a nucleotide
sequence which is complementary" to a second polynucleotide and the
like has the same meaning as saying that the first polynucleotide
"is complementary" to the second polynucleotide.
[0118] As used herein, the term "isolated" as applied to proteins,
nucleic acids, or other biomolecules refers to a molecule that has
been purified or separated from a component of its
naturally-occurring environment (e.g. a protein purified from a
cell in which it was naturally produced). An "isolated" molecule
may be in contact with other molecules (for example, as part of a
reaction mixture). As used herein, "isolated" molecules also
include recombinantly-produced proteins or nucleic acids which have
an amino acid or nucleotide sequence which occurs naturally.
"Isolated" nucleic acids include polypeptide-encoding nucleic acid
molecules contained in cells that ordinarily express the
polypeptide where, for example, the nucleic acid molecule is at a
chromosomal location different from that of natural cells. In some
embodiments, "isolated" polypeptides are purified to at least 50%,
60%, 70%, 80%, 90%, 95%, 98%, or 100% homogeneity as evidenced by
SDS-PAGE of the polypeptides followed by Coomassie blue, silver, or
other protein staining method.
[0119] As used herein, a nucleic acid molecule which is described
as containing the "sequence" of a template or other nucleic acid
may also be considered to contain the template or other nucleic
acid itself (e.g. a molecule which is described as containing the
sequence of a template may also be described as containing the
template), unless the context clearly dictates otherwise.
[0120] As used herein, when a first polynucleotide is described as
"annealed", "annealing" or the like to a second polynucleotide, the
entirety of the first polynucleotide or any portion thereof may
anneal to the second polynucleotide, and vice versa.
[0121] As used herein, references to "generating a copy of a
template" and the like includes both i) generation of an exact copy
of a template (e.g. generating a DNA copy of a DNA template) and
ii) generation of a DNA version of an RNA template. For instance, a
template may be a single-strand RNA molecule (such as from a
single-stranded RNA virus). This template may be copied by reverse
transcription PCR, which results in many copies of the DNA version
of the RNA template.
[0122] As used herein, a reference to "treating" a given object to
a condition or other object or the like refers to directly or
indirectly exposing the given object to the recited condition or
other object. Thus, while a "treating" step may involve a distinct
related action (e.g. adding an enzyme to a vessel, shaking a
vessel, etc.), not every "treating" step requires a distinct
related action. For example, a reaction involving one or more
reagents can be set up in a vessel, and once the reaction has been
initiated, multiple events or steps may occur in the vessel without
further human or mechanical intervention with the contents of the
vessel. One or more of these multiple events or steps in the vessel
may be described as "treating" an object in the vessel, even if no
separate intervention with the contents of the vessel occurs after
the initiation of the reaction.
[0123] In some embodiments, a nucleic acid template may be single
stranded or double-stranded. A single strand of a nucleic acid
template may be referred to herein as a "polynucleotide template".
A "polynucleotide template" as referred to herein is not precluded
from binding to a complementary sequence thereof. In other words, a
"polynucleotide template" may be, for example, the entirety of a
single-stranded nucleic acid template, or it may be one strand of a
double-stranded nucleic acid template. A nucleic acid template may
be contained in a primary nucleic acid molecule. In some
embodiments, a nucleic acid template may constitute the entirety of
a primary nucleic acid molecule. In other embodiments, a nucleic
acid template may be contained in a primary nucleic acid which
contains one or more nucleotides which are not part of the nucleic
acid template (e.g. the nucleic acid template may be of a shorter
length than the primary nucleic acid which contains the nucleic
acid template).
[0124] With methods provided herein pathogens or genes may be
positively identified at concentrations as low as, for example,
less than 1000, 500, 100, 50, 10, 5, 2, or 1 copy per microliter in
a sample or a reaction mixture. In embodiments, methods provided
herein may specifically amplify nucleic acid from one type of
pathogen or gene and not amplify nucleic acid from a related
pathogen or gene. For example, assays provided herein to amplify
Influenza A matrix protein gene may amplify this gene from multiple
different strains of Influenza A, but not amplify genetic material
from Influenza B.
[0125] In embodiments, methods provided herein may be successfully
performed in the presence of one or more potentially interfering
substances. Examples of potentially interfering substances include
BSA, glucose, bilirubin, nitrites, beta-hCG, acetone, low pH
conditions, high pH conditions, acetaminophen, aspirin, progestin,
ethinyl estradiol, urine preservatives, seminal fluid, personal
lubricants, contraceptive jellies, spermicides, feminine powders,
hemorrhoid creams, miconzole, human genomic DNA, lotions, universal
transport media (viral), amies transport media (bacteria), blood,
mucin, acyclovir, cold sore treatments, urine, feces, hemoglobin,
triglycerides, EDTA, heparin, cholesterol, gamma-globulin,
ampicillin, nicotine, cotinine, nasal sprays, nasal drops, or any
combination thereof. In embodiments, methods provided herein may be
performed in the presence of a potentially interfering substance
which is at a concentration of up to at least as great as provided
in U.S. Provisional Patent Application No. 62/001,050, filed May
20, 2014, which is hereby incorporated by reference for all
purposes. In embodiments, methods provided herein may be performed
in the presence of a potentially interfering substance which is at
a concentration of up to at least 10%, 25%, 50%, or 100% greater
than provided in U.S. Provisional Patent Application No. U.S.
Provisional Patent Application No. 62/001,050.
[0126] The assays and methods disclosed herein may be performed on
a device, or on a system, for processing a sample. The assays and
methods disclosed herein can be readily incorporated into and used
in a device for processing a sample, or a system for processing a
sample, which may be an automated assay device, or may be an
automated assay system. Such a device, and such a system, may be
useful for the practice of the methods disclosed herein. For
example, a device may be useful for receiving a sample. A device
may be useful for preparing, or for processing a sample. A device
may be useful for performing an assay on a sample. A device may be
useful for obtaining data from a sample. A device may be useful for
transmitting data obtained from a sample. A device may be useful
for disposing of a sample following processing or assaying of a
sample.
[0127] A device may be part of a system, a component of which may
be a sample processing device. A device may be a sample processing
device. A sample processing device may be configured to facilitate
collection of a sample, prepare a sample for a clinical test, or
perform a method with one or more reagents, as disclosed herein. A
sample processing device may be configured to obtain data from a
sample. A sample processing device may be configured to transmit
data obtained from a sample. A sample processing device may be
configured to analyze data from a sample. A sample processing
device may be configured to communicate with another device, or a
laboratory, or an individual affiliated with a laboratory, to
analyze data obtained from a sample.
[0128] A sample processing device may be configured to be placed in
or on a subject. A sample processing device may be configured to
accept a sample from a subject, either directly or indirectly. A
sample may be, for example, a blood sample (e.g., a sample obtained
from a fingerstick, or from venipuncture, or an arterial blood
sample), a urine sample, a biopsy sample, a tissue slice, stool
sample, or other biological sample; a water sample, a soil sample,
a food sample, an air sample; or other sample. A blood sample may
comprise, e.g., whole blood, plasma, or serum. A sample processing
device may receive a sample from the subject through a housing of
the device. The sample collection may occur at a sample collection
site, or elsewhere. The sample may be provided to the device at a
sample collection site.
[0129] In some embodiments, a sample processing device may be
configured to accept or hold a cartridge. In some embodiments, a
sample processing device may comprise a cartridge. The cartridge
may be removable from the sample processing device. In some
embodiments, a sample may be provided to the cartridge of the
sample processing device. Alternatively, a sample may be provided
to another portion of a sample processing device. The cartridge
and/or device may comprise a sample collection unit that may be
configured to accept a sample.
[0130] A cartridge may include a sample, and may include reagents
for use in processing or testing a sample, disposables for use in
processing or testing a sample, or other materials. A cartridge may
contain reagents disclosed herein for the performing a method
disclosed herein. Following placement of a cartridge on, or
insertion of a cartridge into, a sample processing device, one or
more components of the cartridge may be brought into fluid
communication with other components of the sample processing
device. For example, if a sample is collected at a cartridge, the
sample may be transferred to other portions of the sample
processing device. Similarly, if one or more reagents are provided
on a cartridge, the reagents may be transferred to other portions
of the sample processing device, or other components of the sample
processing device may be brought to the reagents. In some
embodiments, the reagents or components of a cartridge may remain
on-board the cartridge. In some embodiments, no fluidics are
included that require tubing or that require maintenance (e.g.,
manual or automated maintenance).
[0131] A sample or reagent may be transferred to a device, such as
a sample processing device. A sample or reagent may be transferred
within a device. Such transfer of sample or reagent may be
accomplished without providing a continuous fluid pathway from
cartridge to device. Such transfer of sample or reagent may be
accomplished without providing a continuous fluid pathway within a
device. In embodiments, such transfer of sample or reagent may be
accomplished by a sample handling system (e.g., a pipette); for
example, a sample, reagent, or aliquot thereof may be aspirated
into an open-tipped transfer component, such as a pipette tip,
which may be operably connected to a sample handling system which
transfers the tip, with the sample, reagent, or aliquot thereof
contained within the tip, to a location on or within the sample
processing device. The sample, reagent, or aliquot thereof can be
deposited at a location on or within the sample processing device.
Sample and reagent, or multiple reagents, may be mixed using a
sample handling system in a similar manner. One or more components
of the cartridge may be transferred in an automated fashion to
other portions of the sample processing device, and vice versa.
[0132] A device, such as a sample processing device, may have a
fluid handling system. A fluid handling system may perform, or may
aid in performing, transport, dilution, extraction, aliquotting,
mixing, and other actions with a fluid, such as a sample. In some
embodiments, a fluid handling system may be contained within a
device housing. A fluid handling system may permit the collection,
delivery, processing and/or transport of a fluid, dissolution of
dry reagents, mixing of liquid and/or dry reagents with a liquid,
as well as collection, delivery, processing and/or transport of
non-fluidic components, samples, or materials. The fluid may be a
sample, a reagent, diluent, wash, dye, or any other fluid that may
be used by the device, and may include, but not limited to,
homogenous fluids, different liquids, emulsions, suspensions, and
other fluids. A fluid handling system, including without limitation
a pipette, may also be used to transport vessels (with or without
fluid contained therein) around the device. The fluid handling
system may dispense or aspirate a fluid. The sample may include one
or more particulate or solid matter floating within a fluid.
[0133] In embodiments, a fluid handling system may comprise a
pipette, pipette tip, syringe, capillary, or other component. The
fluid handling system may have a portion with an interior surface
and an exterior surface and an open end. The fluid handling system
may comprise a pipette, which may include a pipette body and a
pipette nozzle, and may comprise a pipette tip. A pipette tip may
or may not be removable from a pipette nozzle. In embodiments, a
fluid handling system may use a pipette mated with a pipette tip; a
pipette tip may be disposable. A tip may form a fluid-tight seal
when mated with a pipette. A pipette tip may be used once, twice,
or more times. In embodiments, a fluid handling system may use a
pipette or similar device, with or without a pipette tip, to
aspirate, dispense, mix, transport, or otherwise handle the fluid.
The fluid may be dispensed from the fluid handling system when
desired. The fluid may be contained within a pipette tip prior to
being dispensed, e.g., from an orifice in the pipette tip. In
embodiments, or instances during use, all of the fluid may be
dispensed; in other embodiments, or instances during use, a portion
of the fluid within a tip may be dispensed. A pipette may
selectively aspirate a fluid. The pipette may aspirate a selected
amount of fluid. The pipette may be capable of actuating stirring
mechanisms to mix the fluid within the tip or within a vessel. The
pipette may incorporate tips or vessels creating continuous flow
loops for mixing, including of materials or reagents that are in
non-liquid form. A pipette tip may also facilitate mixture by
metered delivery of multiple fluids simultaneously or in sequence,
such as in 2-part substrate reactions.
[0134] The fluid handling system may include one or more
fluidically isolated or hydraulically independent units. For
example, the fluid handling system may include one, two, or more
pipette tips. The pipette tips may be configured to accept and
confine a fluid. The tips may be fluidically isolated from or
hydraulically independent of one another. The fluid contained
within each tip may be fluidically isolated or hydraulically
independent from fluids in other tips and from other fluids within
the device. The fluidically isolated or hydraulically independent
units may be movable relative to other portions of the device
and/or one another. The fluidically isolated or hydraulically
independent units may be individually movable. A fluid handling
system may comprise one or more base or support. A base or support
may support one or more pipette or pipette units. A base or support
may connect one or more pipettes of the fluid handling system to
one another.
[0135] A sample processing device may be configured to perform
processing steps or actions on a sample obtained from a subject.
Sample processing may include sample preparation, including, e.g.,
sample dilution, division of a sample into aliquots, extraction,
contact with a reagent, filtration, separation, centrifugation, or
other preparatory or processing action or step. A sample processing
device may be configured to perform one or more sample preparation
action or step on the sample. Optionally, a sample may be prepared
for a chemical reaction and/or physical processing step. A sample
preparation action or step may include one or more of the
following: centrifugation, separation, filtration, dilution,
enriching, purification, precipitation, incubation, pipetting,
transport, chromatography, cell lysis, cytometry, pulverization,
grinding, activation, ultrasonication, micro column processing,
processing with magnetic beads, processing with nanoparticles, or
other sample preparation action or steps. For example, sample
preparation may include one or more step to separate blood into
serum and/or particulate fractions, or to separate any other sample
into various components. Sample preparation may include one or more
step to dilute and/or concentrate a sample, such as a blood sample,
or other biological samples. Sample preparation may include adding
an anti-coagulant or other ingredients to a sample. Sample
preparation may also include purification of a sample. In
embodiments, all sample processing, preparation, or assay actions
or steps are performed by a single device. In embodiments, all
sample processing, preparation, or assay actions or steps are
performed within a housing of a single device. In embodiments, most
sample processing, preparation, or assay actions or steps are
performed by a single device, and may be performed within a housing
of a single device. In embodiments, many sample processing,
preparation, or assay actions or steps are performed by a single
device, and may be performed within a housing of a single device.
In embodiments, sample processing, preparation, or assay actions or
steps may be performed by more than one device.
[0136] A sample processing device may be configured to run one or
more assays on a sample, and to obtain data from the sample. A
sample processing device may perform methods provided herein, as
well as additional assays. An assay may include one or more
physical or chemical treatments, and may include running one or
more chemical or physical reactions. A sample processing device may
be configured to perform one, two or more assays on a small sample
of bodily fluid. One or more chemical reaction may take place on a
sample having a volume, as described elsewhere herein. For example,
one or more chemical reaction may take place in a pill having less
than femtoliter volumes. In an instance, the sample collection unit
is configured to receive a volume of the bodily fluid sample
equivalent to a single drop or less of blood or interstitial fluid.
In embodiments, the volume of a sample may be a small volume, where
a small volume may be a volume that is less than about 1000 .mu.L,
or less than about 500 .mu.L, or less than about 25 .mu.L, or less
than about 150 .mu.L, or less than about 100 .mu.L, or less than
about 75 .mu.L, or less than about 50 .mu.L, or less than about 40
.mu.L, or less than about 20 .mu.L, or less than about 10 .mu.L,
less than about 5 .mu.L, less than about 1 .mu.L, less than about
0.5 .mu.L, less than about 0.1 .mu.L, or other small volume. In
embodiments, all sample assay actions or steps are performed on a
single sample. In embodiments, all sample assay actions or steps
are performed by a single device. In embodiments, all sample assay
actions or steps are performed within a housing of a single device.
In embodiments, most sample assay actions or steps are performed by
a single device, and may be performed within a housing of a single
device. In embodiments, many sample assay actions or steps are
performed by a single device, and may be performed within a housing
of a single device. In embodiments, sample processing, preparation,
or assay actions or steps may be performed by more than one
device.
[0137] A sample processing device may be configured to perform a
plurality of assays on a sample. In some embodiments, a sample
processing device may be configured to perform a method provided
herein and one, two, or more additional assays. In embodiments, a
sample processing device may be configured to perform a plurality
of assays on a single sample. In embodiments, a sample processing
device may be configured to perform a plurality of assays on a
single sample, where the sample is a small sample. For example, a
small sample may have a sample volume that is a small volume of
less than about 100 .mu.L, or less than about 500 .mu.L, or less
than about 250 .mu.L, or less than about 150 .mu.L, or less than
about 100 .mu.L, or less than about 75 .mu.L, or less than about 50
.mu.L, or less than about 40 .mu.L, or less than about 20 .mu.L, or
less than about 1 .mu.L, less than about 5 .mu.L, less than about 1
.mu.L, less than about 0.5 .mu.L, less than about 0.1 .mu.L, or
other small volume. A sample processing device may be capable of
performing multiplexed assays on a single sample. A plurality of
assays may be run simultaneously; may be run sequentially; or some
assays may be run simultaneously while others are run sequentially.
One or more control assays and/or calibrators (e.g., including a
configuration with a control of a calibrator for the assay/tests)
can also be incorporated into the device; control assays and assay
on calibrators may be performed simultaneously with assays
performed on a sample, or may be performed before or after assays
performed on a sample, or any combination thereof. In embodiments,
all sample assay actions or steps are performed by a single device.
In embodiments, all of a plurality of assay actions or steps are
performed within a housing of a single device. In embodiments, most
sample assay actions or steps, of a plurality of assays, are
performed by a single device, and may be performed within a housing
of a single device. In embodiments, many sample assay actions or
steps, of a plurality of assays, are performed by a single device,
and may be performed within a housing of a single device. In
embodiments, sample processing, preparation, or assay actions or
steps may be performed by more than one device.
[0138] In embodiments, all of a plurality of assays may be
performed in a short time period. In embodiments, such a short time
period comprises less than about three hours, or less than about
two hours, or less than about one hour, or less than about 40
minutes, or less than about 30 minutes, or less than about 25
minutes, or less than about 20 minutes, or less than about 15
minutes, or less than about 10 minutes, or less than about 5
minutes, or less than about 4 minutes, or less than about 3
minutes, or less than about 2 minutes, or less than about 1 minute,
or other short time period.
[0139] A sample processing device may be configured to detect one
or more signals relating to the sample. A sample processing device
may be configured to identify one or more properties of the sample.
For instance, the sample processing device may be configured to
detect the presence or concentration of one analyte (e.g. a target
nucleic acid) or a plurality of analytes or a disease condition in
the sample (e.g., in or through a bodily fluid, secretion, tissue,
or other sample). Alternatively, the sample processing device may
be configured to detect a signal or signals that may be analyzed to
detect the presence or concentration of one or more analytes (which
may be indicative of a disease condition) or a disease condition in
the sample. The signals may be analyzed on board the device, or at
another location. Running a clinical test may or may not include
any analysis or comparison of data collected.
[0140] A chemical reaction or other processing steps may be
performed, with or without the sample. Examples of steps, tests, or
assays that may be prepared or run by the device may include, but
are not limited to immunoassay, nucleic acid assay (e.g. methods
provided herein), receptor-based assay, cytometric assay,
colorimetric assay, enzymatic assay, electrophoretic assay,
electrochemical assay, spectroscopic assay, chromatographic assay,
microscopic assay, topographic assay, calorimetric assay,
turbidimetric assay, agglutination assay, radioisotope assay;
viscometric assay, coagulation assay, clotting time assay, protein
synthesis assay, histological assay, culture assay, osmolarity
assay, and/or other types of assays, centrifugation, separation,
filtration, dilution, enriching, purification, precipitation,
pulverization, incubation, pipetting, transport, cell lysis, or
other sample preparation action or steps, or combinations thereof.
Steps, tests, or assays that may be prepared or run by the device
may include imaging, including microscopy, cytometry, and other
techniques preparing or utilizing images. Steps, tests, or assays
that may be prepared or run by the device may further include an
assessment of histology, morphology, kinematics, dynamics, and/or
state of a sample, which may include such assessment for cells.
[0141] A device may be capable of performing all on-board steps
(e.g., steps or actions performed by a single device) in a short
amount of time. A device may be capable of performing all on-board
steps on a single sample in a short amount of time. For example,
from sample collection from a subject to transmitting data and/or
to analysis may take about 3 hours or less, 2 hours or less, 1 hour
or less, 50 minutes or less, 45 minutes or less, 40 minutes or
less, 30 minutes or less, 20 minutes or less, 15 minutes or less,
10 minutes or less, 5 minutes or less, 4 minutes or less, 3 minutes
or less, 2 minutes or less, or 1 minute or less. The amount of time
from accepting a sample within the device to transmitting data
and/or to analysis from the device regarding such a sample may
depend on the type or number of steps, tests, or assays performed
on the sample. The amount of time from accepting a sample within
the device to transmitting data and/or to analysis from the device
regarding such a sample may take about 3 hours or less, 2 hours or
less, 1 hour or less, 50 minutes or less, 45 minutes or less, 40
minutes or less, 30 minutes or less, 20 minutes or less, 15 minutes
or less, 10 minutes or less, 5 minutes or less, 4 minutes or less,
3 minutes or less, 2 minutes or less, or 1 minute or less.
[0142] A device may be configured to prepare a sample for disposal,
or to dispose of a sample, such as a biological sample, following
processing or assaying of a sample.
[0143] In embodiments, a sample processing device may be configured
to transmit data obtained from a sample. In embodiments, a sample
processing device may be configured to communicate over a network.
A sample processing device may include a communication module that
may interface with the network. A sample processing device may be
connected to the network via a wired connection or wirelessly. The
network may be a local area network (LAN) or a wide area network
(WAN) such as the Internet. In some embodiments, the network may be
a personal area network. The network may include the cloud. The
sample processing device may be connected to the network without
requiring an intermediary device, or an intermediary device may be
required to connect a sample processing device to a network. A
sample processing device may communicate over a network with
another device, which may be any type of networked device,
including but not limited to a personal computer, server computer,
or laptop computer; personal digital assistants (PDAs) such as a
Windows CE device; phones such as cellular phones, smartphones
(e.g., iPhone, Android, Blackberry, etc.), or location-aware
portable phones (such as GPS); a roaming device, such as a
network-connected roaming device; a wireless device such as a
wireless email device or other device capable of communicating
wireless with a computer network; or any other type of network
device that may communicate possibly over a network and handle
electronic transactions. Such communication may include providing
data to a cloud computing infrastructure or any other type of data
storage infrastructure which may be accessed by other devices.
[0144] A sample processing device may provide data regarding a
sample to, e.g., a health care professional, a health care
professional location, such as a laboratory, or an affiliate
thereof. One or more of a laboratory, health care professional, or
subject may have a network device able to receive or access data
provided by the sample processing device. A sample processing
device may be configured to provide data regarding a sample to a
database. A sample processing device may be configured to provide
data regarding a sample to an electronic medical records system, to
a laboratory information system, to a laboratory automation system,
or other system or software. A sample processing device may provide
data in the form of a report.
[0145] A laboratory, device, or other entity or software may
perform analysis on data regarding a sample in real-time. A
software system may perform chemical analysis and/or pathological
analysis, or these could be distributed amongst combinations of
lab, clinical, and specialty or expert personnel. Analysis may
include qualitative and/or quantitative evaluation of a sample.
Data analysis may include a subsequent qualitative and/or
quantitative evaluation of a sample. Optionally, a report may be
generated based on raw data, pre-processed data, or analyzed data.
Such a report may be prepared so as to maintain confidentiality of
the data obtained from the sample, the identity and other
information regarding the subject from whom a sample was obtained,
analysis of the data, and other confidential information. The
report and/or the data may be transmitted to a health care
professional. Data obtained by a sample processing device, or
analysis of such data, or reports, may be provided to a database,
an electronic medical records system, to a laboratory information
system, to a laboratory automation system, or other system or
software.
[0146] Description and disclosure of examples of reagents, assays,
methods, kits, devices, and systems which may use, or be used with,
methods, compositions, or other reagents disclosed herein may be
found, for example, in U.S. Pat. No. 8,088,593; U.S. Pat. No.
8,380,541; U.S. patent application Ser. No. 13/769,798, filed Feb.
18, 2013; U.S. patent application Ser. No. 13/769,779, filed Feb.
18, 2013; U.S. patent application Ser. No. 13/244,947 filed Sep.
26, 2011; International Application No. PCT/US2012/57155, filed
Sep. 25, 2012; U.S. application Ser. No. 13/244,946, filed Sep. 26,
2011; U.S. patent application Ser. No. 13/244,949, filed Sep. 26,
2011; and U.S. Application Ser. No. 61/673,245, filed Sep. 26,
2011, International Application No. PCT/US14/30034, filed Mar. 15,
2014, and U.S. patent application Ser. No. 14/214,850, filed Mar.
15, 2014, the disclosures of which patents and patent applications
are all hereby incorporated by reference in their entireties.
[0147] This application claims the benefit of, and priority to U.S.
Provisional Patent Application No. 62/051,912, filed Sep. 17, 2014;
U.S. Provisional Patent Application No. 62/051,945, filed Sep. 17,
2014; U.S. Provisional Patent Application No. 62/068,603, filed
Oct. 24, 2014; U.S. Provisional Patent Application No. 62/068,605,
filed Oct. 24, 2014; U.S. Provisional Patent Application No.
62/151,358, filed Apr. 22, 2015; U.S. Non-Provisional patent
application Ser. No. 14/214,850, filed Mar. 15, 2014; International
Patent Application No. PCT/US14/30034, filed Mar. 15, 2014; and
International Patent Application No. PCT/US14/56151, filed Sep. 17,
2014, the disclosure of each of which is also hereby incorporated
by reference in its entirety for all purposes.
[0148] The disclosures of U.S. Provisional Patent Application No.
61/908,027, filed Nov. 22, 2013; U.S. Provisional Patent
Application No. 62/001,050, filed May 20, 2014; and U.S.
Provisional Patent Application No. 61/800,606, filed Mar. 15, 2013
are also hereby incorporated by reference in their entirety for all
purposes.
[0149] Methods and Compositions as Provided in PCT/US14/56151
[0150] In embodiments, methods and compositions provided herein may
include methods or compositions as provided in PCT/US14/56151,
filed Sep. 17, 2014, which is hereby incorporated by reference in
its entirety for all purposes. Methods provided in PCT/US14/56151
may be performed without thermocycling. Exemplary methods and
compositions as provided in PCT/US14/56151 are provided below. The
descriptions below are also applicable to methods and compositions
as provided herein, as appropriate for the context.
[0151] In some embodiments, provided herein is a method for
generating a concatemer comprising two or more copies of a
double-stranded nucleic acid template, the method comprising: (A)
treating a primary double-stranded nucleic acid comprising the
double-stranded nucleic acid template with a first copy of a first
primer and a polymerase under conditions such that an extension
product of the first copy of the first primer is synthesized which
is annealed to a first strand of the double-stranded nucleic acid
template, wherein the first primer comprises a 5' terminal
nucleotide, a 3' terminal nucleotide, and two regions: (i) a tail
region comprising: (a) the 5' terminal nucleotide of the primer (b)
an innermost nucleotide, wherein the innermost nucleotide is
downstream from the 5' terminal nucleotide (c) a middle section
between the 5' terminal nucleotide and the innermost nucleotide,
comprising one or more nucleotides, and (ii) a template-binding
region comprising (a) the 3' terminal nucleotide of the primer (b)
an innermost nucleotide, wherein the innermost nucleotide is
upstream from the 3' terminal nucleotide (c) a middle section
between the 3' terminal nucleotide and the innermost nucleotide,
comprising one or more nucleotides, and the template-binding region
of the first copy of the first primer anneals to the first strand
of the double-stranded nucleic acid template, (B) treating the
extension product of the first copy of the first primer of step (A)
with a second primer and a polymerase under conditions such that an
extension product of the second primer is synthesized which is
annealed to the extension product of the first copy of the first
primer of step (A), wherein the second primer comprises a 5'
terminal nucleotide, a 3' terminal nucleotide, and two regions: (i)
a tail region comprising (a) the 5' terminal nucleotide of the
primer (b) an innermost nucleotide, wherein the innermost
nucleotide is downstream from the 5' terminal nucleotide (c) a
middle section between the 5' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and (ii) a
template-binding region comprising (a) the 3' terminal nucleotide
of the primer (b) an innermost nucleotide, wherein the innermost
nucleotide is upstream from the 3' terminal nucleotide (c) a middle
section between the 3' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, the tail region of
the second primer contains a nucleotide sequence which is
complementary to the nucleotide sequence of the tail region of the
first primer, if the sequences are aligned such that the 5'
terminal nucleotide of the second primer is aligned with the
innermost nucleotide of the tail region of the first primer and the
5' terminal nucleotide of the first primer is aligned with the
innermost nucleotide of the tail region of the second primer, the
template-binding region of the second primer anneals to the
extension product of the first copy of the first primer of step
(A), and the extension product of the second primer contains a 5'
terminal nucleotide, a 3' terminal nucleotide, and a 3' terminal
region comprising the 3' terminal nucleotide, wherein the 3'
terminal region contains the same nucleotide sequence as the
nucleotide sequence of the tail region of the second primer read in
the 5' to 3' direction, and the final nucleotide of the 3' terminal
region is the 3' terminal nucleotide of the extension product of
the second primer, (C) treating the extension product of the second
primer of step (B) with a second copy of the first primer and a
polymerase under conditions such that an extension product of the
second copy of the first primer is synthesized which is annealed to
the extension product of the second primer of step (B), to produce
a first copy of a secondary nucleic acid comprising the extension
product of the second primer of step (B) and the extension product
of the second copy of the first primer, wherein the extension
product of the second copy of the first primer contains a 5'
terminal nucleotide, a 3' terminal nucleotide, and a 3' terminal
region comprising the 3' terminal nucleotide, wherein the 3'
terminal region contains the same nucleotide sequence as the
nucleotide sequence of the tail region of the first primer read in
the 5' to 3' direction, and the final nucleotide of the 3' terminal
region is the 3' terminal nucleotide of the extension product of
the second primer, (D) repeating at least step (C) one or more
addition times to generate at least a second copy of the secondary
nucleic acid of step (C), (E) treating the first copy of the
secondary nucleic acid of step (C) and the second copy of the
secondary nucleic acid of step (D) under conditions such that the
3' terminal region of the extension product of the second copy of
the first primer of the first copy of the secondary nucleic acid
anneals to the 3' terminal region of the extension product of the
second primer of the second copy of the secondary nucleic acid, to
produce a cross-over structure comprising the extension product of
the second copy of the first primer of the first copy of the
secondary nucleic acid and the extension product of the second
primer of the second copy of the secondary nucleic acid, (F)
treating the cross-over structure of step (E) with a polymerase
under conditions such that an extension product of the extension
product of the second copy of the first primer of the first copy of
the secondary nucleic acid is synthesized and an extension product
of the extension product of the second primer of the second copy of
the secondary nucleic acid is synthesized, to produce a concatemer
comprising two copies of the double-stranded nucleic acid template
of step (A), wherein the concatemer comprises the extension product
of the extension product of the second copy of the first primer of
the first copy of the secondary nucleic acid and the extension
product of the extension product of the second primer of the second
copy of the secondary nucleic acid.
[0152] In some embodiments, provided herein is a method for
generating a concatemer comprising two or more copies of a
polynucleotide template or an analogous sequence thereof, the
method comprising, (A) treating a primary nucleic acid comprising
the polynucleotide template with a first copy of a first primer and
a polymerase under conditions such that an extension product of the
first copy of the first primer is synthesized which is annealed to
the polynucleotide template, wherein the first primer comprises a
5' terminal nucleotide, a 3' terminal nucleotide, and two regions:
(i) a tail region comprising (a) the 5' terminal nucleotide of the
primer, (b) an innermost nucleotide, wherein the innermost
nucleotide is downstream from the 5' terminal nucleotide (c) a
middle section between the 5' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and (ii) a
template-binding region comprising (a) the 3' terminal nucleotide
of the primer (b) an innermost nucleotide, wherein the innermost
nucleotide is upstream from the 3' terminal nucleotide (c) a middle
section between the 3' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and the
template-binding region of the first copy of the first primer
anneals to the polynucleotide template, (B) treating the extension
product of the first copy of the first primer of step (A) with a
second primer and a polymerase under conditions such that an
extension product of the second primer is synthesized which is
annealed to the extension product of the first copy of the first
primer of step (A), wherein the second primer comprises a 5'
terminal nucleotide, a 3' terminal nucleotide, and two regions: (i)
a tail region comprising (a) the 5' terminal nucleotide of the
primer (b) an innermost nucleotide, wherein the innermost
nucleotide is downstream from the 5' terminal nucleotide (c) a
middle section between the 5' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides (ii) a
template-binding region comprising (a) the 3' terminal nucleotide
of the primer (b) an innermost nucleotide, wherein the innermost
nucleotide is upstream from the 3' terminal nucleotide (c) a middle
section between the 3' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, the tail region of
the second primer contains a nucleotide sequence which is
complementary to the nucleotide sequence of the tail region of the
first primer, if the sequences are aligned such that the 5'
terminal nucleotide of the second primer is aligned with the
innermost nucleotide of the tail region of the first primer and the
5' terminal nucleotide of the first primer is aligned with the
innermost nucleotide of the tail region of the second primer, the
template-binding region of the second primer anneals to the
extension product of the first copy of the first primer of step
(A), and the extension product of the second primer contains a 5'
terminal nucleotide, a 3' terminal nucleotide, and a 3' terminal
region comprising the 3' terminal nucleotide, wherein the 3'
terminal region contains the same nucleotide sequence as the
nucleotide sequence of the tail region of the second primer read in
the 5' to 3' direction, and the final nucleotide of the 3' terminal
region is the 3' terminal nucleotide of the extension product of
the second primer, (C) treating the extension product of the second
primer of step (B) with a second copy of the first primer and a
polymerase under conditions such that an extension product of the
second copy of the first primer is synthesized which is annealed to
the extension product of the second primer of step (B), to produce
a first copy of a secondary nucleic acid comprising the extension
product of the second primer of step (B) and the extension product
of the second copy of the first primer, wherein the extension
product of the second copy of the first primer contains a 5'
terminal nucleotide, a 3' terminal nucleotide, and a 3' terminal
region comprising the 3' terminal nucleotide, wherein the 3'
terminal region contains the same nucleotide sequence as the
nucleotide sequence of the tail region of the first primer read in
the 5' to 3' direction, and the final nucleotide of the 3' terminal
region is the 3' terminal nucleotide of the extension product of
the second primer, (D) repeating at least step (C) one or more
additional times to generate at least a second copy of the
secondary nucleic acid comprising the extension product of the
second primer of step (B) and the extension product of the second
copy of the first primer of step (C), (E) treating the first copy
of the secondary nucleic acid of step (C) and the second copy of
the secondary nucleic acid of step (D) under conditions such that
the 3' terminal region of the extension product of the second copy
of the first primer of the first copy of the secondary nucleic acid
anneals to the 3' terminal region of the extension product of the
second primer of the second copy of the secondary nucleic acid, to
produce a cross-over structure comprising the extension product of
the second copy of the first primer of the first copy of the
secondary nucleic acid and the extension product of the second
primer of the second copy of the secondary nucleic acid, (F)
treating the cross-over structure of step (E) with a polymerase
under conditions such that an extension product of the extension
product of the second copy of the first primer of the first copy of
the secondary nucleic acid is synthesized and an extension product
of the extension product of the second primer of the second copy of
the secondary nucleic acid is synthesized, to produce a concatemer
comprising two copies of the polynucleotide template of step (A),
wherein the concatemer comprises the extension product of the
extension product of the second copy of the first primer of the
first copy of the secondary nucleic acid and the extension product
of the extension product of the second primer of the second copy of
the secondary nucleic acid. In some embodiments, the nucleic acid
polymerase of step (A) is a DNA polymerase. In some embodiments,
the nucleic acid polymerase of step (A) is a reverse
transcriptase.
[0153] In some embodiments, provided herein is a method for
generating a concatemer comprising two or more copies of a
double-stranded nucleic acid template, the method comprising, (A)
preparing a reaction mixture comprising: (i) a primary nucleic acid
comprising the double-stranded nucleic acid template (ii) an
isolated nucleic acid polymerase, (iii) a first primer comprising a
5' terminal nucleotide, a 3' terminal nucleotide, and two regions:
(a) a tail region comprising (1) the 5' terminal nucleotide of the
primer (2) an innermost nucleotide, wherein the innermost
nucleotide is downstream from the 5' terminal nucleotide (3) a
middle section between the 5' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and (b) a
template-binding region comprising (1) the 3' terminal nucleotide
of the primer (2) an innermost nucleotide, wherein the innermost
nucleotide is upstream from the 3' terminal nucleotide (3) a middle
section between the 3' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, wherein the
template-binding region is complementary to a first strand of the
nucleic acid template, (iv) a second primer comprising a 5'
terminal nucleotide, a 3' terminal nucleotide, and two regions: (a)
a tail region comprising (1) the 5' terminal nucleotide of the
primer (2) an innermost nucleotide, wherein the innermost
nucleotide is downstream from the 5' terminal nucleotide (3) a
middle section between the 5' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and (b) a
template-binding region comprising (1) the 3' terminal nucleotide
of the primer (2) an innermost nucleotide, wherein the innermost
nucleotide is upstream from the 3' terminal nucleotide (3) a middle
section between the 3' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and wherein the
template-binding region is complementary to a second strand of the
nucleic acid template, and wherein the tail region of the second
primer contains a nucleotide sequence which is complementary to the
nucleotide sequence of the tail region of the first primer, if the
sequences are aligned such that the 5' terminal nucleotide of the
second primer is aligned with the innermost nucleotide of the tail
region of the first primer and the 5' terminal nucleotide of the
first primer is aligned with the innermost nucleotide of the tail
region of the second primer, and (B) incubating the reaction
mixture for at least 3 minutes without thermocycling.
[0154] In some embodiments, provided herein is a method for
generating a concatemer comprising two or more copies of a
polynucleotide template, the method comprising, (A) preparing a
reaction mixture comprising: (i) a nucleic acid comprising the
polynucleotide template (ii) an isolated nucleic acid polymerase,
(iii) a first primer comprising a 5' terminal nucleotide, a 3'
terminal nucleotide, and two regions: (a) a tail region comprising
(1) the 5' terminal nucleotide of the primer (2) an innermost
nucleotide, wherein the innermost nucleotide is downstream from the
5' terminal nucleotide (3) a middle section between the 5' terminal
nucleotide and the innermost nucleotide, comprising one or more
nucleotides, and (b) a template-binding region comprising (1) the
3' terminal nucleotide of the primer (2) an innermost nucleotide,
wherein the innermost nucleotide is upstream from the 3' terminal
nucleotide (3) a middle section between the 3' terminal nucleotide
and the innermost nucleotide, comprising one or more nucleotides,
and wherein the template-binding region is complementary to the
polynucleotide template, (iv) a second primer comprising a 5'
terminal nucleotide, a 3' terminal nucleotide, and two regions: (a)
a tail region comprising (1) the 5' terminal nucleotide of the
primer (2) an innermost nucleotide, wherein the innermost
nucleotide is downstream from the 5' terminal nucleotide (3) a
middle section between the 5' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and (b) a
template-binding region comprising (1) the 3' terminal nucleotide
of the primer (2) an innermost nucleotide, wherein the innermost
nucleotide is upstream from the 3' terminal nucleotide (3) a middle
section between the 3' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and wherein the
template-binding region is complementary to a nucleotide sequence
complementary to the polynucleotide template, and wherein the tail
region of the second primer contains a nucleotide sequence which is
complementary to the nucleotide sequence of the tail region of the
first primer, if the sequences of the primers are aligned such that
the 5' terminal nucleotide of the second primer is aligned with the
innermost nucleotide of the tail region of the first primer and the
5' terminal nucleotide of the first primer is aligned with the
innermost nucleotide of the tail region of the second primer, and
(B) incubating the reaction mixture at a temperature of no greater
than 80 C for at least 3 minutes.
[0155] In some embodiments, provided herein is a method for
generating a concatemer comprising two or more copies of a
double-stranded nucleic acid template, the method comprising
incubating together a first copy and a second copy of a
double-stranded nucleic acid molecule comprising the
double-stranded nucleic acid template and a polymerase, wherein the
double-stranded nucleic acid molecule comprises a first strand and
a second strand, each containing a plurality of nucleotides, the
first strand comprises a 5' terminal nucleotide and a 3' terminal
nucleotide and contains the general format of regions in the 5' to
3' direction: A1-B-A2, the second strand comprises a 5' terminal
nucleotide and a 3' terminal nucleotide and contains the general
format of regions in the 5' to 3' direction: C1-D-C2, region B
comprises the nucleotide sequence a first strand of the
double-stranded nucleic acid template, region D comprises the
nucleotide sequence of a second strand of the double-stranded
nucleic acid template, in the double-stranded nucleic acid
molecule, region A1 is annealed to C2, B is annealed to D, and A2
is annealed to C1, a cross-over structure comprising the first
strand of the first copy of the double-stranded nucleic acid
molecule and the second strand of the second copy of the
double-stranded nucleic acid molecule is generated, wherein the A2
region of the first strand is annealed to the C2 region of the
second strand, an extension product of the first strand of the
cross-over structure is synthesized and an extension product of the
second strand of the cross-over structure is synthesized, to
produce a concatemer comprising the extension product of the first
strand of the cross-over structure annealed to the extension
product of the second strand of the cross-over structure, wherein
the concatemer contains two copies of the double-stranded nucleic
acid template.
[0156] In embodiments, provided herein is a method of copying a
polynucleotide template, the method comprising: incubating the
polynucleotide template in a reaction mixture comprising multiple
copies of a first primer and multiple copies of a second primer,
wherein: the first primer comprises a first region and a second
region, wherein the second region of the first primer comprises a
nucleotide sequence which is complementary to a first portion of
the polynucleotide template; the second primer comprises a first
region and a second region, wherein the second region of the second
primer comprises a nucleotide sequence which is complementary to a
partner nucleotide sequence, wherein the partner nucleotide
sequence is complementary to a second portion of the polynucleotide
template; and upon incubation of the polynucleotide template with
the multiple copies of the first primer and the multiple copies of
the second primer, at least one concatemer strand is formed,
wherein the concatemer strand comprises a 5' end and a 3' end, and
comprises a nucleotide sequence having the general structure in the
5' to 3' direction of: C'-T-C'-T-X-C', wherein: C' represents the
nucleotide sequence of the first region of the second primer, T
represents the nucleotide sequence of the polynucleotide template
or an analogous sequence thereof, and X represents any number and
sequence of nucleotides.
[0157] In some embodiments, in a method provided herein involving
the formation of a concatemer strand which comprises a nucleotide
sequence having the general structure in the 5' to 3' direction of:
C'-T-C'-T-X-C', the concatemer strand is a first concatemer strand,
and a second concatemer strand is also formed, wherein the second
concatemer strand comprises a 5' end and a 3' end, and comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C-X'-T'-C-T'-C, wherein: C represents the nucleotide
sequence of the first region of the first primer, T' represents a
nucleotide sequence which is complementary to the polynucleotide
template, and X' represents a nucleotide sequence which is
complementary to the nucleotide sequence of X.
[0158] In embodiments, provided herein is method of assaying for a
target polynucleotide template in a biological sample, the method
comprising: A) incubating the biological sample or portion thereof
in a reaction mixture comprising multiple copies of a first primer
and multiple copies of a second primer, wherein: the first primer
comprises a first region and a second region, wherein the second
region of the first primer comprises a nucleotide sequence which is
complementary to a first portion of the polynucleotide template;
the second primer comprises a first region and a second region,
wherein the second region of the second primer comprises a
nucleotide sequence which is complementary to a partner nucleotide
sequence, wherein the partner nucleotide sequence is complementary
to a second portion of the polynucleotide template; and upon
incubation of the polynucleotide template with the multiple copies
of the first primer and the multiple copies of the second primer,
at least one concatemer strand is formed, wherein the concatemer
strand comprises a 5' end and a 3' end, and comprises a nucleotide
sequence having the general structure in the 5' to 3' direction of:
C'-T-C'-T-X-C', wherein: C' represents the nucleotide sequence of
the first region of the second primer, T represents the nucleotide
sequence of the polynucleotide template or an analogous sequence
thereof, and X represents any number and sequence of nucleotides;
and B) measuring an amount of amplified nucleic acid in the
reaction mixture of A) at one or more points after the initiation
of the incubating step of A). In embodiments, the measuring an
amount of amplified nucleic acid in the reaction mixture may
comprise determining a level of fluorescence in the reaction
mixture. In embodiments, the method may further comprise
determining an inflection time of nucleic acid amplification in the
reaction mixture.
[0159] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a concatemer strand which comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C'-T-C'-T-X-C', X may contain a sequence having the
general structure in the 5' to 3' direction of [(C'-T).sub.N]
wherein C' represents the nucleotide sequence of the first region
of the second primer, T represents the nucleotide sequence of the
polynucleotide template or an analogous sequence thereof, and N is
any integer between 0 and 2000. In embodiments, N may be any
integer between 0 and 10, 0 and 100, 0 and 1000, 0 and 5000, 0 and
10,000 1 and 10, 1 and 100, 1 and 1000, 1 and 2000, 1 and 5000, or
1 and 10,000.
[0160] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a concatemer strand which comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C'-T-C'-T-X-C', X may contain no more than 0, 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 500, 1000, 10,000,
50,000, 100,000, or 500,000 nucleotides. In embodiments, in a
method, vessel, or kit provided herein involving a concatemer
strand which comprises a nucleotide sequence having the general
structure in the 5' to 3' direction of: C'-T-C'-T-X-C', X may
contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50,
100, 500, 1000, 10,000, 50,000, 100,000, or 500,000 nucleotides. In
embodiments, in a method, vessel, or kit provided herein involving
a concatemer strand which comprises a nucleotide sequence having
the general structure in the 5' to 3' direction of: C'-T-C'-T-X-C',
X may contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25,
50, 100, 500, 1000, 10,000, 50,000, 100,000, nucleotides, and no
more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 500,
1000, 10,000, 50,000, 100,000, or 500,000 nucleotides.
[0161] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a concatemer strand which comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C'-T-C'-T-X-C', between at least one C' and T, one or
more extra nucleotides are present which are not part of the C' or
T sequence. The one or more extra nucleotides may be, for example,
between 1 and 10, 1 and 20, 1 and 100, or 1 and 1000
nucleotides.
[0162] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a concatemer strand which comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C'-T-C'-T-X-C', at least one C' or T sequence may be
missing one or more nucleotides. In the event that 2 or more
nucleotides are missing, the missing nucleotides may be contiguous,
or may be at separate locations. The one or more missing
nucleotides may be, for example, between 1 and 10, 1 and 20, 1 and
100, or 1 and 1000 nucleotides.
[0163] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a concatemer strand which comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C'-T-C'-T-X-C', at least one C' or T sequence may
have one or more point mutations. In the event that two or more
point mutations are present, the point mutations may be contiguous,
or may be at separate locations. The one or more point mutations
may be, for example, between 1 and 10, 1 and 20, 1 and 100, or 1
and 1000 point mutations.
[0164] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a concatemer strand which comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C'-T-C'-T-X-C', the nucleotide sequence has two or
all three of the following characteristics: i) between at least one
C' and T, one or more extra nucleotides are present which are not
part of the C' or T sequence; ii) at least one C' or T sequence is
missing one or more nucleotides; and iii) at least one C' or T
sequence contains one or more point mutations.
[0165] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a concatemer strand which comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C'-T-C'-T-X-C', in embodiments which the
polynucleotide template is an RNA molecule, the T may represent the
nucleotide sequence of a DNA sequence which is analogous to the RNA
sequence of the polynucleotide template.
[0166] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a concatemer strand which comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C'-T-C'-T-X-C', the concatemer strand further
comprises one or more nucleotides to the 5' of the 5'-most situated
C' sequence. The one or more nucleotides may be, for example,
between 1 and 10, 1 and 20, 1 and 100, or 1 and 1000
nucleotides.
[0167] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a concatemer strand which comprises a
nucleotide sequence having the general structure in the 5' to 3'
direction of: C'-T-C'-T-X-C', the concatemer strand further
comprises one or more nucleotides to the 3' of the 3'-most situated
C' sequence. The one or more nucleotides may be, for example,
between 1 and 10, 1 and 20, 1 and 100, or 1 and 1000
nucleotides.
[0168] In embodiments, provided herein is a method of generating a
concatemer comprising at least two copies of a double stranded
nucleic acid template, the method comprising: incubating in a
reaction mixture at least a first template molecule and a second
template molecule, wherein: the first template molecule comprises a
first nucleic acid strand and a second nucleic acid strand,
wherein: the first nucleic acid strand of the first template
molecule comprises a nucleotide sequence having the general
structure in the 5' to 3' direction of: H'-S-Y.sub.1-H', wherein:
H' represents the nucleotide sequence of a first homology sequence,
S represents the nucleotide sequence of a first strand of the
double stranded nucleic acid template, and Y.sub.1 represents any
number and sequence of nucleotides; and the second nucleic acid
strand of the first template molecule comprises a nucleotide
sequence having the general structure in the 5' to 3' direction of:
H-Y.sub.1'-S'-H, wherein: H represents the nucleotide sequence of a
second homology sequence, wherein the first homology sequence and
second homology sequence are complementary to each other, Y.sub.1'
represents a nucleotide sequence which is complementary to the
nucleotide sequence of Y.sub.1, and S' represents the nucleotide
sequence of a second strand of the double stranded nucleic acid
template, wherein the first strand and second strand of the double
stranded nucleic acid template are complementary to each other; and
the second template molecule comprises a first nucleic acid strand
and a second nucleic acid strand, wherein: the first nucleic acid
strand of the second template molecule comprises a nucleotide
sequence having the general structure in the 5' to 3' direction of:
H'-S-Y.sub.2-H', wherein: H' represents the nucleotide sequence of
the first homology sequence, S represents the nucleotide sequence
of the first strand of the double stranded nucleic acid template,
and Y.sub.2 represents any number and sequence of nucleotides; and
the second nucleic acid strand of the first template molecule
comprises a nucleotide sequence having the general structure in the
5' to 3' direction of: H-Y.sub.2'-S'-H, wherein: H represents the
nucleotide sequence of the second homology sequence, Y.sub.2'
represents a nucleotide sequence which is complementary to the
nucleotide sequence of Y.sub.2, and S' represents the nucleotide
sequence of the second strand of the double stranded nucleic acid
template; and upon incubation of the first template molecule with
the second template molecule in the reaction mixture, at least one
concatemer comprising at least two copies of the double stranded
nucleic acid template is formed, wherein the concatemer comprises a
first concatemer strand and a second concatemer strand, wherein the
first concatemer strand comprises a 5' end and a 3' end, and
comprises a nucleotide sequence having the general structure in the
5' to 3' direction of: H'-S-Y.sub.2-H'-S-Y.sub.1-H', wherein each
of H', Y.sub.1, S, and Y.sub.2 represent nucleotide sequences as
described above; and wherein the second concatemer strand comprises
a 5' end and a 3' end, and comprises a sequence having the general
structure in the 5' to 3' direction of:
H-Y.sub.1'-S'-H-Y.sub.2'-S'-H, wherein each of H', Y.sub.1, S, and
Y.sub.2 represent nucleotide sequences as described above.
[0169] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a first concatemer strand which
comprises a nucleotide sequence having the general structure in the
5' to 3' direction of: H'-S-Y.sub.2-H'-S-Y.sub.1-H', at least one
of or both Y.sub.1 and Y.sub.2 may represent 0 nucleotides.
[0170] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a first concatemer strand which
comprises a nucleotide sequence having the general structure in the
5' to 3' direction of: H'-S-Y.sub.2-H'-S-Y.sub.1-H', Y.sub.1 may
contain a sequence having the general structure in the 5' to 3'
direction of [(H'-S).sub.N1] wherein H' and S represent nucleotide
sequences as described above, and N1 is any integer between 0 and
2000.
[0171] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a first concatemer strand which
comprises a nucleotide sequence having the general structure in the
5' to 3' direction of: H'-S-Y.sub.2-H'-S-Y.sub.1-H', Y.sub.2 may
contain a sequence having the general structure in the 5' to 3'
direction of [(H'-S).sub.N2] wherein H' and S represent nucleotide
sequences as described above, and N2 is any integer between 0 and
2000.
[0172] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a first template molecule and a
second template molecule, the first template molecule and second
template molecule are both double-stranded DNA molecules.
[0173] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a first nucleic acid strand of a
first template molecule comprises, wherein the first nucleic acid
strand comprises a nucleotide sequence having the general structure
in the 5' to 3' direction of: H'-S-Y.sub.1-H', wherein H'
represents the nucleotide sequence of a first homology sequence,
the first homology sequence may contain no more than 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or
100 nucleotides. In embodiments, the first homology sequence may
contain at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25,
30, 40, 50, 60, 70, 80, 90, or 100 nucleotides. In embodiments, the
first homology sequence may contain at least 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 and
no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40,
50, 60, 70, 80, 90, 100, or 200 nucleotides.
[0174] In embodiments, a reaction mixture, vessel, or kit provided
herein comprises a nucleic acid polymerase. In embodiments, a
nucleic acid polymerase is a DNA polymerase having
strand-displacement activity. In embodiments, a nucleic acid
polymerase is an RNA polymerase. In embodiments, a nucleic acid
polymerase is a reverse transcriptase. In embodiments, a reaction
mixture, vessel, or kit comprises more than one kind of nucleic
acid polymerase, such as both a DNA polymerase having strand
displacement activity and a reverse transcriptase. In embodiments,
a reaction mixture, vessel, or kit provided herein comprises
nucleotides and buffer.
[0175] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a polynucleotide template, the
polynucleotide template is a single-stranded molecule. In
embodiments, in a method, reaction mixture, vessel, or kit provided
herein involving a polynucleotide template, the polynucleotide
template comprises one strand of a double-stranded nucleic acid
template. In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a polynucleotide template, the
polynucleotide template is a DNA or RNA molecule.
[0176] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a nucleic acid template, the nucleic
acid template is an RNA or DNA molecule. In embodiments, a nucleic
acid template may be a single-stranded or double-stranded
molecule.
[0177] In embodiments, in a method provided herein involving
incubation of a reaction mixture, during the incubation of the
reaction mixture, the temperature of the reaction mixture does not
exceed 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 37, 35, 30, 25,
or 20 C. In embodiments, in a method provided herein, all steps of
the method are performed at a temperature of no greater than 90,
85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 37, 35, 30, 25, or 20 C. In
embodiments, a reaction mixture, vessel, or kit provided herein is
maintained at a temperature of no greater than 90, 85, 80, 75, 70,
65, 60, 55, 50, 45, 40, 37, 35, 30, 25, or 20 C. In embodiments, a
method provided herein is performed without thermocycling.
[0178] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a polynucleotide template comprising
a first portion, the first portion contains no more than 5, 10, 15,
20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, or 200 nucleotides. In
embodiments, in a method, reaction mixture, vessel, or kit provided
herein involving a polynucleotide template comprising a first
portion, the first portion contains at least 5, 10, 15, 20, 25, 30,
35, 40, 50, 60, 70, 80, 90, 100, or 200 nucleotides. In
embodiments, in a method, reaction mixture, vessel, or kit provided
herein involving a polynucleotide template comprising a first
portion, the first portion contains at least 5, 10, 15, 20, 25, 30,
35, 40, 50, 60, 70, 80, 90, or 100 and no more than 10, 15, 20, 25,
30, 35, 40, 50, 60, 70, 80, 90, 100, or 200 nucleotides.
[0179] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a primer comprising a first region,
the first region contains at least 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100
nucleotides. In embodiments, in a method, reaction mixture, vessel,
or kit provided herein involving a primer comprising a first
region, the first region contains no more than 1, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or
100 nucleotides. In embodiments, in a method, reaction mixture,
vessel, or kit provided herein involving a primer comprising a
first region, the first region contains at least 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, or 90
and no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30,
35, 40, 50, 60, 70, 80, 90, or 100 nucleotides. In embodiments, in
a method, reaction mixture, vessel, or kit provided herein
involving a first primer comprising a first region and a second
primer comprising a first region, both the first primer and second
primer may have any of the features described above. In
embodiments, in a method, reaction mixture, vessel, or kit provided
herein involving a first primer comprising a first region and a
second primer comprising a first region, the first region of the
first primer and the first region of the second primer may contain
the same number of nucleotides. In embodiments, in a method,
reaction mixture, vessel, or kit provided herein involving a first
primer comprising a first region and a second primer comprising a
first region, the first region of the first primer and the first
region of the second primer may contain a different number of
nucleotides.
[0180] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a primer comprising a second region,
the second region contains at least 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100
nucleotides. In embodiments, in a method, reaction mixture, vessel,
or kit provided herein involving a primer comprising a second
region, the second region contains no more than 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or
100 nucleotides. In embodiments, in a method, reaction mixture,
vessel, or kit provided herein involving a primer comprising a
second region, the second region contains at least 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, or
90 and no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25,
30, 35, 40, 50, 60, 70, 80, 90, or 100 nucleotides. In embodiments,
in a method, reaction mixture, vessel, or kit provided herein
involving a first primer comprising a second region and a second
primer comprising a second region, both the first primer and second
primer may have any of the features described above. In
embodiments, in a method, reaction mixture, vessel, or kit provided
herein involving a first primer comprising a second region and a
second primer comprising a second region, the second region of the
first primer and the second region of the second primer may contain
the same number of nucleotides. In embodiments, in a method,
reaction mixture, vessel, or kit provided herein involving a first
primer comprising a second region and a second primer comprising a
second region, the second region of the first primer and the second
region of the second primer may contain a different number of
nucleotides.
[0181] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a second primer containing a second
region and a polynucleotide template comprising a second portion,
the nucleotide sequence of the second region of the second primer
is the same as the nucleotide sequence of the second portion of the
polynucleotide template.
[0182] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a primer comprising a tail region,
the tail region contains at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100 nucleotides.
In embodiments, in a method, reaction mixture, vessel, or kit
provided herein involving a primer comprising a tail region, the
tail region contains no more than 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100 nucleotides.
In embodiments, in a method, reaction mixture, vessel, or kit
provided herein involving a primer comprising a tail region, the
tail region contains at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 20, 25, 30, 35, 40, 50, 60, 70, 80, or 90 and no more than 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70,
80, 90, or 100 nucleotides. In embodiments, in a method, reaction
mixture, vessel, or kit provided herein involving a first primer
comprising a tail region and a second primer comprising a tail
region, both the first primer and second primer may have any of the
features described above. In embodiments, in a method, reaction
mixture, vessel, or kit provided herein involving a first primer
comprising a tail region and a second primer comprising a tail
region, the tail region of the first primer and the tail region of
the second primer may contain the same number of nucleotides. In
embodiments, in a method, reaction mixture, vessel, or kit provided
herein involving a first primer comprising a tail region and a
second primer comprising a tail region, the tail region of the
first primer and the tail region of the second primer may contain a
different number of nucleotides.
[0183] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a primer comprising a
template-binding region, the template-binding region contains at
least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40,
50, 60, 70, 80, 90, or 100 nucleotides. In embodiments, in a
method, reaction mixture, vessel, or kit provided herein involving
a primer comprising a template-binding region, the template-binding
region contains no more than 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100 nucleotides. In
embodiments, in a method, reaction mixture, vessel, or kit provided
herein involving a primer comprising a template-binding region, the
template-binding region contains at least 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, or 90 and no
more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35,
40, 50, 60, 70, 80, 90, or 100 nucleotides. In embodiments, in a
method, reaction mixture, vessel, or kit provided herein involving
a first primer comprising a template-binding region and a second
primer comprising a template-binding region, both the first primer
and second primer may have any of the features described above. In
embodiments, in a method, reaction mixture, vessel, or kit provided
herein involving a first primer comprising a template-binding
region and a second primer comprising a template-binding region,
the template-binding region of the first primer and the
template-binding region of the second primer may contain the same
number of nucleotides. In embodiments, in a method, reaction
mixture, vessel, or kit provided herein involving a first primer
comprising a template-binding region and a second primer comprising
a template-binding region, the template-binding region of the first
primer and the template-binding region of the second primer may
contain a different number of nucleotides.
[0184] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a polynucleotide template, the
polynucleotide template may contain at least 8, 9, 10, 11, 12, 13,
14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500,
1000, 2000, or 5000 nucleotides. In embodiments, in a method,
reaction mixture, vessel, or kit provided herein involving a
polynucleotide template, the polynucleotide template may contain no
more than 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 60,
70, 80, 90, 100, 200, 500, 1000, 2000, 5000, or 10,000 nucleotides.
In embodiments, in a method, reaction mixture, vessel, or kit
provided herein involving a polynucleotide template, the
polynucleotide template may contain at least 8, 9, 10, 11, 12, 13,
14, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500,
1000, 2000, or 5000, and no more than 9, 10, 11, 12, 13, 14, 15,
20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000,
5000, or 10,000 nucleotides.
[0185] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein involving a double-stranded nucleic acid
template, each strand of the double-stranded nucleic acid template
may contain at least 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35,
40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000, or 5000
nucleotides. In embodiments, in a method, reaction mixture, vessel,
or kit provided herein involving a double-stranded nucleic acid
template, each strand of the double-stranded nucleic acid template
may contain no more than 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30,
35, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000, 5000, or
10,000 nucleotides. In embodiments, in a method, reaction mixture,
vessel, or kit provided herein involving a double-stranded nucleic
acid template, each strand of the double-stranded nucleic acid
template may contain at least 8, 9, 10, 11, 12, 13, 14, 15, 20, 25,
30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000, or 5000,
and no more than 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50,
60, 70, 80, 90, 100, 200, 500, 1000, 2000, 5000, or 10,000
nucleotides.
[0186] In embodiments, a reaction mixture, vessel, or kit provided
herein does not contain a recombinase enzyme.
[0187] In embodiments, in a method, reaction mixture, vessel, or
kit provided herein may contain or involve multiple copies of a
primer. The multiple copies may be, for example, at least 5, 10,
15, 20, 50, 100, 500, 1000, 10,000, 100,000, or 1,000,000 copies of
the primer.
[0188] In embodiments, a reaction mixture or vessel provided herein
may comprise at least a portion of a biological sample from a
subject. The biological sample may be, for example, saliva, blood,
urine, a cheek swab, or a nasal swab. The subject may be a
human.
[0189] In some embodiments, all of the steps of a method provided
herein are performed at a temperature of no greater than 70, 65,
60, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, or 10 C. In some
embodiments, some of the steps of a method provided herein are
performed at a temperature of no greater than 70, 65, 60, 65, 60,
55, 50, 45, 40, 35, 30, 25, 20, 15, or 10 C.
[0190] In some embodiments, two or more steps of a method provided
herein are performed simultaneously in the same reaction mixture.
In some embodiments, all of the steps of a method provided herein
are performed simultaneously in the same reaction mixture.
[0191] In some embodiments, in a method provided herein, a nucleic
acid template is amplified at least 10, 100, 1000, 10,000, 100,000,
or 1,000,000-fold within 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90,
120, or 180 minutes of initiation of the method. In some
embodiments, in a method provided herein, the number of copies of a
nucleic acid template in a reaction mixture is increased least 10,
100, 1000, 10,000, 100,000, or 1,000,000-fold within 5, 10, 15, 20,
30, 40, 50, 60, 70, 80, 90, 120, or 180 minutes of initiation of
the method.
[0192] In embodiments, a nucleic acid template provided herein may
be a single-stranded or a double-stranded nucleic acid
template.
[0193] In embodiments, provided herein is a vessel, comprising in
fluid communication therein: a first primer, wherein the first
primer comprises a first region and a second region, and wherein
the second region of the first primer comprises a nucleotide
sequence which is complementary to a first portion of a
polynucleotide template; a second primer, wherein the second primer
comprises a first region and a second region, and wherein the
second region of the second primer comprises a nucleotide sequence
which is complementary to a partner nucleotide sequence, wherein
the partner nucleotide sequence is complementary to a second
portion of the polynucleotide template; and at least one concatemer
strand, wherein the concatemer strand comprises a 5' end and a 3'
end, and comprises a nucleotide sequence having the general
structure in the 5' to 3' direction of: C'-T-C'-T-X-C', wherein: C'
represents the nucleotide sequence of the first region of the
second primer, T represents the nucleotide sequence of the
polynucleotide template or an analogous sequence thereof, and X
represents any number and sequence of nucleotides.
[0194] In some embodiments, provided herein is a vessel, comprising
in fluid communication therein: (A) an isolated nucleic acid
polymerase, (B) a nucleic acid template comprising at least a first
strand, (C) a first primer comprising a 5' terminal nucleotide, a
3' terminal nucleotide, and two regions: (i) a tail region
comprising (a) the 5' terminal nucleotide of the primer (b) an
innermost nucleotide, wherein the innermost nucleotide is
downstream from the 5' terminal nucleotide (c) a middle section
between the 5' terminal nucleotide and the innermost nucleotide,
comprising one or more nucleotides, and (ii) a template-binding
region comprising (a) the 3' terminal nucleotide of the primer (b)
an innermost nucleotide, wherein the innermost nucleotide is
upstream from the 3' terminal nucleotide (c) a middle section
between the 3' terminal nucleotide and the innermost nucleotide,
comprising one or more nucleotides, wherein the template-binding
region is complementary to a first strand of the nucleic acid
template, and (D) a second primer comprising a 5' terminal
nucleotide, a 3' terminal nucleotide, and two regions: (i) a tail
region comprising (a) the 5' terminal nucleotide of the primer (b)
an innermost nucleotide, wherein the innermost nucleotide is
downstream from the 5' terminal nucleotide (c) a middle section
between the 5' terminal nucleotide and the innermost nucleotide,
comprising one or more nucleotides, and (ii) a template-binding
region comprising (a) the 3' terminal nucleotide of the primer (b)
an innermost nucleotide, wherein the innermost nucleotide is
upstream from the 3' terminal nucleotide (c) a middle section
between the 3' terminal nucleotide and the innermost nucleotide,
comprising one or more nucleotides, and wherein the
template-binding region is complementary to a nucleotide sequence
complementary to first strand of the nucleic acid template, and
wherein the tail region of the second primer contains a nucleotide
sequence which is complementary to the nucleotide sequence of the
tail region of the first primer, if the sequences of the primers
are aligned such that the 5' terminal nucleotide of the second
primer is aligned with the innermost nucleotide of the tail region
of the first primer and the 5' terminal nucleotide of the first
primer is aligned with the innermost nucleotide of the tail region
of the second primer.
[0195] In embodiments, provided herein is a kit comprising two or
more fluidically isolated containers, the containers collectively
comprising: a first primer, wherein the first primer comprises a
first region and a second region, and wherein the second region of
the first primer comprises a nucleotide sequence which is
complementary to a first portion of a polynucleotide template; a
second primer, wherein the second primer comprises a first region
and a second region, and wherein the second region of the second
primer comprises a nucleotide sequence which is complementary to a
partner nucleotide sequence, wherein the partner nucleotide
sequence is complementary to a second portion of the polynucleotide
template; and an isolated DNA polymerase having strand-displacement
activity; wherein: the first region of the first primer and the
first region of the second primer are complementary.
[0196] In some embodiments, provided herein is a kit for detecting
a target nucleic acid of interest comprising at least a first
strand, the kit comprising two or more fluidically isolated
containers, the containers collectively comprising: (A) an isolated
nucleic acid polymerase, (B) a first primer comprising a 5'
terminal nucleotide, a 3' terminal nucleotide, and two regions: (i)
a tail region comprising (a) the 5' terminal nucleotide of the
primer (b) an innermost nucleotide, wherein the innermost
nucleotide is downstream from the 5' terminal nucleotide (c) a
middle section between the 5' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and (ii) a
template-binding region comprising (a) the 3' terminal nucleotide
of the primer (b) an innermost nucleotide, wherein the innermost
nucleotide is upstream from the 3' terminal nucleotide (c) a middle
section between the 3' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, wherein the
template-binding region is complementary to the first strand of the
target nucleic acid, and (C) a second primer comprising a 5'
terminal nucleotide, a 3' terminal nucleotide, and two regions: (i)
a tail region comprising (a) the 5' terminal nucleotide of the
primer (b) an innermost nucleotide, wherein the innermost
nucleotide is downstream from the 5' terminal nucleotide (c) a
middle section between the 5' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and (ii) a
template-binding region comprising (a) the 3' terminal nucleotide
of the primer (b) an innermost nucleotide, wherein the innermost
nucleotide is upstream from the 3' terminal nucleotide (c) a middle
section between the 3' terminal nucleotide and the innermost
nucleotide, comprising one or more nucleotides, and wherein the
template-binding region is complementary to a nucleotide sequence
complementary to the first strand of the target nucleic acid, and
wherein the tail region of the second primer contains a nucleotide
sequence which is complementary to the nucleotide sequence of the
tail region of the first primer, if the sequences of the primers
are aligned such that the 5' terminal nucleotide of the second
primer is aligned with the innermost nucleotide of the tail region
of the first primer and the 5' terminal nucleotide of the first
primer is aligned with the innermost nucleotide of the tail region
of the second primer.
[0197] In some embodiments, a kit provided herein comprises a
nucleic acid having the nucleotide sequence of the target nucleic
acid of interest.
[0198] In some embodiments, a reaction mixture, vessel or kit
provided herein comprises a nucleic acid dye.
[0199] In some embodiments, in a vessel or kit provided herein
comprising an isolated nucleic acid polymerase, the isolated
nucleic acid polymerase is a DNA polymerase. In some embodiments,
in a vessel or kit provided herein comprising an isolated nucleic
acid polymerase, the isolated nucleic acid polymerase is a reverse
transcriptase. In some embodiments, in a vessel or kit provided
herein comprising an isolated nucleic acid polymerase, the vessel
or kit comprises both a DNA polymerase and a reverse
transcriptase.
[0200] In some embodiments, in a method, vessel, or kit provided
herein comprising a nucleic acid polymerase, the nucleic acid
polymerase has strand displacement activity.
[0201] In some embodiments, a method provided herein comprises
treating one or more of the reaction components or steps of the
method with a nucleic acid dye.
[0202] In some embodiments, in a method, vessel, or kit provided
herein comprising a nucleic acid template, the template is a DNA
molecule. In some embodiments, in a method, vessel, or kit provided
herein comprising a nucleic acid template, the template is an RNA
molecule.
[0203] In some embodiments, in a method, vessel, or kit provided
herein comprising a first primer, the tail region of the first
primer comprises at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, or 20 nucleotides. In some embodiments, in a
method, vessel, or kit provided herein comprising a first primer,
the tail region of the first primer comprises no more than 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or
60 nucleotides.
[0204] In some embodiments, in a method, vessel, or kit provided
herein comprising a second primer, the tail region of the second
primer comprises at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, or 20 nucleotides. In some embodiments, in a
method, vessel, or kit provided herein comprising a second primer,
the tail region of the second primer comprises no more than 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50,
or 60 nucleotides.
[0205] In some embodiments, in a method, vessel, or kit provided
herein comprising a first primer, the template-binding region of
the first primer comprises at least 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments,
in a method, vessel, or kit provided herein comprising a first
primer, the template-binding region of the first primer comprises
no more than 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 30, 40, 50, or 60 nucleotides.
[0206] In some embodiments, in a method, vessel, or kit provided
herein comprising a second primer, the template-binding region of
the second primer comprises at least 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments,
in a method, vessel, or kit provided herein comprising a second
primer, the template-binding region of the second primer comprises
no more than 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 30, 40, 50, in 60 nucleotides.
[0207] In some embodiments, in methods and compositions provided
herein wherein an RNA molecule is the template molecule or primary
nucleic acid, amplification of the template may refer to generation
of copies of DNA strands corresponding to the RNA molecule.
[0208] In some embodiments, a method provided herein comprises
measuring a fluorescent signal from an assay comprising the
method.
[0209] In some embodiments, a nucleic acid ligase may be included
with a method or composition provided herein. In some embodiments,
a nucleic acid template may be amplified more rapidly with a method
provided herein when a ligase is included in a reaction mixture for
a method provided herein, as compared to if a nucleic acid ligase
is not included in the reaction. In embodiments, a reaction
mixture, vessel, or kit provided herein may contain an enzyme
having ligase activity.
[0210] In embodiments, provided herein is a method of assaying for
a pathogen in a sample, the method comprising performing a method
as provided herein to amplify nucleic acid from the pathogen. In
embodiments, the target nucleic acid used in a composition or
method provided herein may be nucleic acid from a pathogen. In
embodiments, the first and second primer used in a method provided
herein may each contain regions which are complementary to a
sequence in the nucleic acid of the pathogen, or which are
complementary to a sequence which is complementary to a sequence in
the nucleic acid of the pathogen. In embodiments, the nucleic acid
of the pathogen may be DNA or RNA. Pathogens may include, without
limitation, viruses, bacteria, fungi, and protists. A sample may be
from a subject, and may have any of the sample characteristics
described elsewhere herein.
[0211] In embodiments, a method provided herein for amplification
of a nucleic acid may be used for a diagnostic method externally of
a human or animal body. For example, a sample may be obtained from
a human or animal, and the sample may be assayed for a target
nucleic acid of interest with a method provided herein for
amplification of nucleic acid.
[0212] In embodiments, a method provided herein may include: a)
providing one or more reagents for performing a method as provided
herein (e.g. one or more of first primer, second primer, nucleic
acid template, nucleic acid polymerase, nucleotides, buffer, water,
etc.) in a reaction mixture, and b) incubating the reaction mixture
at a substantially isothermal temperature, wherein the temperature
of the reaction mixture does not diverge from a central temperature
by more or less than 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1
degree Celsius during the incubation. In embodiments, a central
temperature may be, for example, 30, 35, 40, 45, 50, 55, 60, 65,
70, 75, or 80 degrees Celsius.
[0213] In embodiments, a method provided herein may be performed at
a substantially isothermal temperature. In embodiments, a
substantially isothermal temperature may be any of 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, or 80 degrees Celsius, plus or minus 20,
15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 degree Celsius.
[0214] In embodiments, a method provided herein may be performed at
one or more temperatures, none or which exceed 90, 85, 80, 75, 70,
65, 60, 55, 50, 45, 40, 35, 30, or 25 degrees Celsius.
[0215] In embodiments, methods provided herein may be performed
without thermocycling/reaction mixtures may be incubated under
conditions without thermocycling (i.e. without cycles of raising
and lowering incubation temperatures to separate strands or allow
hybridization of primers as is used in, for example, PCR-based
methods).
[0216] In compositions and methods provided herein involving a
first primer comprising a first region and a second primer
comprising a first region, wherein the first region of the first
primer is complementary to the first region of the second primer,
in embodiments, the first region of the first primer and the first
region of the second primer contain nucleotide sequences such that
a double stranded structure which would be formed by the annealing
of the first region of the first primer to the first region of the
second primer according to Watson-Crick base pairing rules would
not form a restriction enzyme recognition sequence.
[0217] In compositions and methods provided herein involving a
nucleic acid polymerase, in embodiments, the nucleic acid
polymerase has 3' to 5' exonuclease activity.
[0218] In embodiments, provided herein is a method for amplifying a
target nucleic acid strand, the method comprising: incubating a
reaction mixture comprising the target nucleic acid strand, a first
primer, and a second primer under substantially isothermal
conditions, wherein: the target nucleic acid strand comprises a
first portion and a second portion; the first primer comprises a
first region and a second region, wherein the first region
comprises a 5' end of the primer, the second region comprises a 3'
end of the primer, and the second region is complementary to the
first portion of the nucleic acid strand; the second primer
comprises a first region and a second region, wherein the first
region comprises a 5' end of the primer, the second region
comprises a 3' end of the primer, and the second region is
complementary to a sequence which is complementary to the second
portion of the nucleic acid strand; the first region of the first
primer is complementary to the first region of the second primer;
and the target nucleic acid strand is amplified. Optionally, the
target nucleic acid strand may further comprise a third portion,
wherein the third portion is situated in the target nucleic acid
strand between the first portion and the second portion, and
wherein the first region of the second primer is complementary to
the third portion of the target nucleic acid strand.
[0219] In embodiments, in any of the methods provided herein, a,
polynucleotide template, target nucleic acid strand or the like may
contain an internal motif, wherein the tail region of a primer
provided herein to amplify the target nucleic acid strand is
complementary to the internal motif.
[0220] In embodiments, a method provided herein may further
comprise adding to a reaction mixture provided herein a
peptide-nucleic acid (PNA) probe and a dye which binds to DNA-PNA
hybrid, wherein the PNA probe is complementary to a target nucleic
acid for amplification in the reaction mixture, or a complement
thereof.
[0221] In embodiments, a reaction mixture provided herein may
comprise a DNA polymerase having strand-displacement activity.
[0222] When a nucleic acid is described herein as being "amplified"
or the like, the nucleic acid may also be described as being
"copied" or the like.
[0223] In embodiments, in a primer described herein as having a
first region and a second region, the first region may contain the
5' end of the primer and the second region may contain the 3' end
of the primer.
[0224] In embodiments, in a primer described herein as having a
tail region and a template-binding region, the first region may
contain the 5' end of the primer and the second region may contain
the 3' end of the primer.
[0225] In embodiments, provided herein is method for copying a
polynucleotide template, the method comprising: incubating a
reaction mixture comprising the polynucleotide template, a first
primer, and a second primer under conditions without thermocycling,
wherein: the polynucleotide template comprises a first portion and
a second portion; the first primer comprises a first region and a
second region, wherein the first region comprises a 5' end of the
primer, the second region comprises a 3' end of the primer, and the
second region is complementary to the first portion of the
polynucleotide template; the second primer comprises a first region
and a second region, wherein the first region comprises a 5' end of
the primer, the second region comprises a 3' end of the primer, and
the second region is complementary to a sequence which is
complementary to the second portion of the polynucleotide template;
the first region of the first primer is complementary to the first
region of the second primer; and multiple copies of the
polynucleotide template are generated. Optionally, the
polynucleotide template may further comprise a third portion,
wherein the third portion is situated in the polynucleotide
template between the first portion and the second portion, and
wherein the first region of the second primer is complementary to
the third portion of the polynucleotide template.
[0226] In embodiments, provided herein is a method for amplifying a
polynucleotide template, the method comprising incubating the
polynucleotide template in a reaction mixture comprising a first
primer and a second primer, wherein: the polynucleotide template
comprises a first portion, a second portion and a third portion,
wherein the third portion is situated in the polynucleotide
template between the first portion and the second portion; the
first primer comprises a first region and a second region, wherein
the second region of the first primer is complementary to the first
portion of the polynucleotide template; and the second primer
comprises a first region and a second region, wherein the second
region of the second primer is complementary to a sequence which is
complementary to the second portion of the polynucleotide template,
the first region of the second primer is complementary to the first
region of the first primer, and the first region of the second
primer is complementary to the third portion of the polynucleotide
template.
[0227] In embodiments, provided herein is a method for assessing
the identity of a nucleotide at a position of interest in a
nucleotide sequence in a polynucleotide template, the method
comprising: A) providing copies of the polynucleotide template in
each of at least a first reaction mixture and a second reaction
mixture, wherein: the polynucleotide template comprises a first
portion, a second portion and a third portion, wherein the third
portion is situated in the polynucleotide template between the
first portion and the second portion and wherein the position of
interest is in the third portion; the first reaction mixture
comprises copies of the polynucleotide template, a first primer,
and a second primer, wherein: the first primer comprises a first
region and a second region, wherein the first region comprises a 5'
end of the primer, the second region comprises a 3' end of the
primer, and the second region is complementary to a first portion
of the polynucleotide template; the second primer comprises a first
region and a second region, wherein the first region comprises a 5'
end of the primer, the second region comprises a 3' end of the
primer, and the second region is complementary to a sequence which
is complementary to a second portion of the polynucleotide
template; the first region of the first primer is complementary to
the first region of the second primer; and the first region of the
second primer is complementary to the third portion of the
polynucleotide template; the second reaction mixture comprises
copies of the polynucleotide template, a third primer, and a fourth
primer, wherein: the third primer comprises a first region and a
second region, wherein the first region comprises a 5' end of the
primer, the second region comprises a 3' end of the primer, and the
second region is complementary to a first portion of the
polynucleotide template; the fourth primer comprises a first region
and a second region, wherein the first region comprises a 5' end of
the primer, the second region comprises a 3' end of the primer, and
the second region is complementary to a sequence which is
complementary to a second portion of the polynucleotide template;
the first region of the third primer is complementary to the first
region of the fourth primer; and the first region of the fourth
primer is complementary to the third portion of the polynucleotide
template; and the nucleotide sequence of the first region of the
second primer differs from the nucleotide sequence of first region
of the fourth primer by a single nucleotide, wherein the position
of the different nucleotide in the second and fourth primers
corresponds to the position of the nucleotide of interest in the
polynucleotide template if the nucleotide sequence of the first
region of the second primer or fourth primer is oriented with the
nucleotide sequence of the third portion of the polynucleotide
template for maximum complementation of the sequences; B)
incubating the first reaction mixture and second reaction mixture
under conditions without thermocycling; and C) comparing the rate
or amount of amplification of the polynucleotide template in the
first reaction mixture to the rate or amount of amplification of
the polynucleotide template in the second reaction mixture, wherein
the rate or amount of amplification of the polynucleotide template
is indicative of the degree of complementation between first region
of the second or fourth primer and the nucleotide sequence of the
third portion of the polynucleotide template.
[0228] Optionally, in embodiments provided herein involving a
polynucleotide template, the polynucleotide template is a DNA
strand.
[0229] Optionally, in embodiments provided herein involving a
polynucleotide template, the polynucleotide template is an RNA
strand.
[0230] Optionally, in embodiments provided herein involving a
polynucleotide template, the polynucleotide template is one strand
of a duplex nucleic acid molecule. In embodiments, the duplex
nucleic acid molecule is a duplex DNA molecule or a duplex RNA
molecule.
[0231] Optionally, in embodiments provided herein involving a
reaction mixture, vessel, or kit, the reaction mixture, vessel, or
kit comprises a DNA polymerase having strand displacement
activity.
[0232] Optionally, in embodiments provided herein involving a
reaction mixture, vessel, or kit, the reaction mixture, vessel, or
kit comprises a reverse transcriptase.
[0233] Optionally, in embodiments provided herein involving a
reaction mixture, vessel, or kit, the reaction mixture, vessel, or
kit comprises a nucleic acid dye, nucleotides, or buffers.
[0234] Optionally, in embodiments provided herein involving a
polynucleotide template containing a first portion, a second
portion, and a third portion, the polynucleotide template may have
the general structure of elements, in the 3' to 5' direction, of:
1P-1S-3P-2S-2P, wherein "1P" is the first portion, "1S" is a first
space, "3P" is the third portion, "2S" is a second space, and "2P"
is the second portion. The "first space" and "second space" are
portions of the polynucleotide template which contain nucleotides
which are not part of the first portion, second portion, or third
portion. In embodiments, the first portion may have, for example,
between 6 and 30 nucleotides or any other number of nucleotides as
described elsewhere herein. In embodiments, the first space may,
for example, between 2 and 30 nucleotides or any other number of
nucleotides as described elsewhere herein. In embodiments, the
third portion may have, for example, between 4 and 14 nucleotides
or any other number of nucleotides as described elsewhere herein.
In embodiments, the first space may, for example, between 2 and 30
nucleotides or any other number of nucleotides as described
elsewhere herein. In embodiments, the first portion may have, for
example, between 6 and 30 nucleotides or any other number of
nucleotides as described elsewhere herein.
[0235] In embodiments, in methods provided herein involving the
incubation of a polynucleotide template in a reaction mixture, a
concatemer strand comprising at least 2, 3, 4, 5, or 10 copies of
the polynucleotide template may be generated during the incubation
of the reaction mixture.
[0236] In embodiments, provided herein is a method for amplifying a
double stranded nucleic acid molecule, the method comprising
incubating the double stranded nucleic acid molecule in a reaction
mixture comprising a first primer and a second primer, wherein: the
double stranded nucleic acid molecule comprises a first strand and
a second strand, wherein the first strand comprises a first portion
and a third portion and the second strand comprises a second
portion; the first primer comprises a first region and a second
region, wherein the second region of the first primer is
complementary to the first portion of the first strand; and the
second primer comprises a first region and a second region, wherein
the second region of the second primer is complementary to the
second portion of the second strand, the first region of the second
primer is complementary to the third portion of the first strand,
and the first region of the second primer is complementary to the
first region of the first primer.
[0237] In embodiments, provided herein is a reaction mixture
comprising: a polynucleotide template, a first primer, and a second
primer, wherein: the polynucleotide template comprises a first
portion, a second portion and a third portion, wherein the third
portion is situated in the polynucleotide template between the
first portion and the second portion; the first primer comprises a
first region and a second region, wherein the first region
comprises a 5' end of the primer, the second region comprises a 3'
end of the primer, and the second region is complementary to the
first portion of the polynucleotide template; the second primer
comprises a first region and a second region, wherein the first
region comprises a 5' end of the primer, the second region
comprises a 3' end of the primer, and the second region is
complementary to a sequence which is complementary to the second
portion of the polynucleotide template; the first region of the
first primer is complementary to the first region of the second
primer; and the first region of the second primer is complementary
to the third portion of the polynucleotide template.
[0238] In embodiments, provided herein is a kit for the
amplification of a polynucleotide template, the kit comprising: a
first primer and a second primer, wherein: the first primer
comprises a first region and a second region, wherein the first
region comprises a 5' end of the primer, the second region
comprises a 3' end of the primer, and the second region is
complementary to a first portion of the polynucleotide template;
the second primer comprises a first region and a second region,
wherein the first region comprises a 5' end of the primer, the
second region comprises a 3' end of the primer, and the second
region is complementary to a sequence which is complementary to a
second portion of the polynucleotide template; the first region of
the first primer is complementary to the first region of the second
primer; and the first region of the second primer is complementary
to a third portion of the polynucleotide template, wherein the
third portion is situated in the polynucleotide template between
the first portion and the second portion.
[0239] Optionally, in embodiments provided herein involving a kit,
the components of the kit may be distributed between at least two
separate fluidically isolated containers.
[0240] In embodiments, provided herein is a kit comprising two or
more fluidically isolated containers, the containers collectively
comprising: a first primer, a second primer, a third primer, and a
fourth primer, wherein: the first primer comprises a first region
and a second region, wherein the first region comprises a 5' end of
the primer, the second region comprises a 3' end of the primer, and
the second region is complementary to a first portion of a
polynucleotide template; the second primer comprises a first region
and a second region, wherein the first region comprises a 5' end of
the primer, the second region comprises a 3' end of the primer, and
the second region is complementary to a sequence which is
complementary to a second portion of the polynucleotide template;
the third primer comprises a first region and a second region,
wherein the first region comprises a 5' end of the primer, the
second region comprises a 3' end of the primer, and the second
region is complementary to the first portion of the polynucleotide
template; the fourth primer comprises a first region and a second
region, wherein the first region comprises a 5' end of the primer,
the second region comprises a 3' end of the primer, and the second
region is complementary to a sequence which is complementary to a
second portion of the polynucleotide template; the first region of
the first primer is complementary to the first region of the second
primer; the first region of the third primer is complementary to
the first region of the fourth primer; and the nucleotide sequence
of the first region of the first primer differs from the nucleotide
sequence of first region of the third primer by a single
nucleotide. Optionally, the first region of the second primer and
the first region of the fourth primer are both complementary to a
third portion of the polynucleotide template, wherein the third
portion is situated in the polynucleotide template between the
first portion and the second portion. Optionally, the second region
of the each of the first primer, second primer, third primer, and
fourth primers is between 6 and 30 nucleotides in length.
Optionally, the second region of the each of the first primer,
second primer, third primer, and fourth primers is between 6 and 30
nucleotides in length.
[0241] In embodiments provided herein involving a kit, the kit may
comprises a control nucleic acid strand comprising the nucleotide
sequence of a polynucleotide template to be detected with reagents
of the kit.
[0242] In methods and compositions provided herein, optionally, a
PNA probe and the dye DiSc.sub.2(5) may be included. The PNA probe
may specifically anneal to a target sequence for amplification in
the relevant reaction, and copies thereof, such that DNA-PNA
duplexes are formed. Methods provided herein may include detecting
a color change of the dye DiSc.sub.2(5) upon the binding of the dye
to DNA-PNA duplexes. In embodiments, a PNA probe and dye may be
added to a reaction mixture provided herein after the initiation or
after the completion of the reaction. In embodiments, a PNA probe
and dye may be added to a reaction mixture provided herein at least
5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or 100 minutes after the
initiation of the reaction. In embodiments, a PNA probe and dye may
be added to a reaction mixture provided herein no more than 5, 10,
15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 minutes after the
initiation of the reaction.
[0243] References herein to generating a copy of or amplifying a
polynucleotide template or nucleic acid template include generating
a copy which contains the sequence of the polynucleotide
template/nucleic acid template, as well as generating a copy which
contains an analogous sequence of the polynucleotide
template/nucleic acid template, unless the context clearly dictates
otherwise. For instance, if a polynucleotide template is RNA,
generating a copy of the template can include generating a copy
which is a DNA molecule which contains the DNA version of the RNA
sequence of the polynucleotide template (i.e. in the DNA sequence,
contains "T"s instead of "U" s).
[0244] In some embodiments, a method or composition provided herein
may be used to detect the presence or absence of a particular
nucleotide of interest in a target nucleic acid (e.g. in the case
of a mutation or SNP). For example, a first or second primer may be
selected which selectively binds to a region in a target nucleic
acid which includes or is adjacent to the nucleotide of interest.
The primer may be designed such that it selectively either: i)
binds to the region when the region contains the nucleotide of
interest, or ii) does not bind to the region when the region
contains the nucleotide of interest. A method as described herein
may be performed with the selected primer, and the outcome of the
amplification reaction may provide information regarding the
presence or absence of the nucleotide of interest in the target
nucleic acid. For example, if the template-binding region of a
first primer is designed to have a nucleotide sequence which is
complementary to a sequence in the target nucleic acid which
includes a particular nucleotide of interest (e.g. a mutation),
successful amplification of the target nucleic acid with the
selected primer from a sample may indicate that the sample contains
a target nucleic acid having the particular nucleotide of interest.
In some embodiments, a primer used for analysis of a nucleotide of
interest in a target nucleic acid may contain a critical nucleotide
(i.e. a nucleotide which corresponds to the same position of a
nucleotide of interest in the target nucleic acid) at the 3'
terminus of the primer. In such a case, the annealing of the 3'
terminal nucleotide of the primer may be dependent on the presence
of the nucleotide of interest in the target nucleic acid. If the 3'
terminal nucleotide of the primer does not anneal with a nucleotide
in the target nucleic acid (e.g. due to a mismatch between the
nucleotides), the mismatch may significantly impair a nucleic acid
polymerase from synthesizing an extension product from the primer.
Accordingly, in some embodiments, a primer having a 3' terminal
nucleotide which corresponds to a nucleotide of interest may be
useful for determining the presence or absence of a particular
nucleotide in a target nucleic acid. In such embodiments, in some
situations the critical nucleotide at the 3' terminus of the primer
may be selected to be complementary the nucleotide of interest in
the target nucleic acid, and in some other situations the critical
nucleotide at the 3' terminus of the primer may be selected to be
non-complementary the nucleotide of interest in the target nucleic
acid. The nucleotide of interest may represent, for example, a
wild-type form, a mutant form, or a polymorphism of a target
nucleic acid.
[0245] In other embodiments, a particular nucleotide of interest in
a target nucleic acid (e.g. a mutation or SNP) may be detected by
selecting primers such that the nucleotide of interest is present
in the target nucleic acid in a region which is not complementary
to a template-binding region of a first or second primer. For
example, the nucleotide of interest may be approximately in the
middle of a target nucleic acid sequence. In embodiments, the
nucleotide of interest may be in an "internal motif" described
elsewhere herein. When a nucleotide of interest is in an internal
motif, in embodiments, a primer pair may be prepared to contain a
nucleotide sequence in the tail region of the primers which is
complementary to an internal motif or the complement thereof, and
which may be used to assay for the presence or absence of the
nucleotide of interest in the internal motif in the target
sequence. As explained elsewhere herein, the temporary annealing of
a nucleotide sequence in the tail region of a primer to an internal
motif in an extension product of that primer may increase the rate
of a reaction provided herein. In some circumstances, the greater
the affinity of a nucleotide sequence in the tail region of a
primer to the internal motif in an extension product of that
primer, the faster the reaction may occur. Also, typically, the
greater the number of nucleotides in the nucleotide sequence in the
tail region of the primer which can bind to nucleotides in the
internal motif in the extension product of the primer, the greater
the affinity of the nucleotide sequence in the tail region of the
extension product for the internal motif in the extension product.
Thus, with compositions and methods provided herein, in
embodiments, the presence or absence of a nucleotide of interest in
a target sequence may be determined through the use of primers
which have a nucleotide sequence in the tail region of the primer
which can bind to the internal motif in the target sequence or a
complement thereof, and which, within the tail region, do or do not
have a nucleotide which specifically binds with the particular
nucleotide of interest in the internal motif or its complement.
Typically, the reaction will occur faster when the nucleotide
sequence in the tail region of a primer contains a nucleotide which
is complementary to the nucleotide in the extension product of that
primer which corresponds to the nucleotide of interest in the
target, than when the relevant nucleotide in the tail region of the
primer is not complementary to the nucleotide in the extension
product of that primer which corresponds to the nucleotide of
interest in the target. For example, the internal motif of a
wild-type version of a target nucleic acid strand may have the
nucleotide sequence: 5' TATTGCAT 3'. However, the "G" in the
sequence may frequently be mutated to an "A" in many individuals in
the population. In order to determine whether a particular target
nucleic acid contains a "G" or other nucleotide in the sequence, a
primer may be prepared which contain a nucleotide sequence in its
tail region having the sequence: 5'ATGCAATA 3'. If this primer (and
an appropriate second primer) is used to amplify the target nucleic
acid according to a method provided herein, the amplification
reaction may have a certain reaction rate if the "G" is present in
the internal motif, versus if a different nucleotide is present at
the position of the "G" in the internal motif. This is because the
nucleotide sequence in the tail region of the primer will be
perfectly complementary to the internal motif if the "G" is present
in the internal motif, but it will not be if a nucleotide other
than a "G" is present at the G's normal position. Generally, in
this example, if a "G" is present in the internal motif, the tail
region of the primer will anneal to the internal motif more
frequently than if the "G" is not present, and this may in turn
lead to a faster reaction rate if the "G" is present than not
present. With systems and methods provided herein, primers may be
prepared to assay for either the presence or absence of a
nucleotide of interest (e.g. primers can be prepared such that the
reaction occurs more quickly if a mutated version of a nucleotide
is present than if a wild-type version of the nucleotide is
present, or vice-versa). Also, in embodiments, primers may be
prepared so as to determine the identity of an unknown nucleotide
in a position of interest in an internal motif in a target. For
example, four different primer pairs may be prepared, each
containing either an A, T, G, or C as appropriate corresponding to
a nucleotide of interest in a target nucleic acid. In embodiments,
the primer pair which yields the fastest reaction results may
indicate which nucleotide is present in the position of interest in
the internal motif in the target nucleic acid. For instance, a
target nucleic acid may have an internal motif which commonly has
the sequence, in the 5' to 3' direction of: GTAACGAG. However,
different variants of the target nucleic acid may have different
nucleotides in the 5.sup.th position in the internal motif (i.e.
the position of the "C"). Continuing with the example, if a sample
containing the target nucleic acid is provided, wherein it is
unknown what nucleotide is in the 5.sup.th position in the of the
internal motif, the sample can be divided into at least 4 portions,
and the four portions can be used for a first reaction mixture, a
second reaction mixture, a third reaction mixture, and a fourth
reaction mixture. To the first reaction mixture, a first primer
pair is provided, where the primers have tail regions with the
sequences, in the 5' to 3' direction: CTCGTTAC and GTAACGAG,
respectively. These tail regions will be perfectly complementary to
the internal motif or complement thereof, if a "C" is present at
5.sup.th position in internal motif. Thus, if the target is
amplified most quickly in this reaction mixture, it indicates that
a "C" is present in the position of the nucleotide of interest in
the internal motif in the target. To the second reaction mixture, a
second primer pair is provided, where the primers have tail regions
with the sequences, in the 5' to 3' direction: CTCATTAC and
GTAATGAG, respectively. These tail regions will be perfectly
complementary to the internal motif or complement thereof, if a "T"
is present at 5.sup.th position in internal motif. Thus, if the
target is amplified most quickly in this reaction mixture, it
indicates that a "T" is present in the position of the nucleotide
of interest in the internal motif in the target. To the third
reaction mixture, a third primer pair is provided, where the
primers have tail regions with the sequences, in the 5' to 3'
direction: CTCCTTAC and GTAAGGAG, respectively. These tail regions
will be perfectly complementary to the internal motif or complement
thereof, if a "G" is present at 5.sup.th position in internal
motif. Thus, if the target is amplified most quickly in this
reaction mixture, it indicates that a "G" is present in the
position of the nucleotide of interest in the internal motif in the
target. To the fourth reaction mixture, a fourth primer pair is
provided, where the primers have tail regions with the sequences,
in the 5' to 3' direction: CTCTTTAC and GTAAAGAG, respectively.
These tail regions will be perfectly complementary to the internal
motif or complement thereof, if an "A" is present at 5.sup.th
position in internal motif. Thus, if the target is amplified most
quickly in this reaction mixture, it indicates that an "A" is
present in the position of the nucleotide of interest in the
internal motif in the target. In embodiments, methods or
compositions as generally described above may optionally be
prepared with only 2 or 3 reaction mixtures with primer pairs
corresponding to only 2 or 3 options for a nucleotide at a position
of interest, if for example, it is not desired to screen all
possible nucleotide variants (for instance if only 2 different
nucleotides are typically found in a position of interest).
[0246] In embodiments, a sample containing a target nucleic acid
may be divided into at least a first and a second portion, where
the first portion is incubated in a first reaction mixture with a
first primer pair, and the second portion is incubated in a second
reaction mixture with a second primer pair, according to methods
provided herein. In embodiments, the first primer pair and the
second primer pair differ from each other by only a single
nucleotide in the respective tail/first regions of the primer (e.g.
the sequence of the first region of the first primer of the first
pair differs from the sequence of the first region of the first
primer of the second pair by only a single nucleotide). The single
nucleotide which is different in the tail region of the primers may
correspond to the position of a nucleotide of interest in the
target nucleic acid. By comparing the rate or quantity of
amplification of the target nucleic acid in the first reaction
mixture to that in the second reaction mixture, the identity of a
nucleotide of interest in the target nucleic acid may be
determined. In embodiments, the method outlined above may be
performed with a first, second, third, and fourth portion of the
sample, and with a first primer pair, second primer pair, third
primer pair, and fourth primer pair, wherein the first primer pair,
second primer pair, third primer pair, and fourth primer pair
differ from each other by only a single nucleotide in the
respective tail/first region of the primers, as described
above.
[0247] In embodiments, at least a first target nucleic acid and a
second target nucleic acid may be provided, wherein the first
target nucleic acid and the second target nucleic acid differ by a
single nucleotide at a position of interest in an internal motif as
described elsewhere herein. In embodiments, the first target
nucleic acid may be incubated in a first reaction mixture
containing a primer pair described herein and the second target
nucleic acid may be incubated in a second reaction mixture
containing the same primer pair, according to methods provided
herein. By comparing the rate or quantity of amplification of the
first target nucleic acid in the first reaction mixture to that of
the second target nucleic acid in second reaction mixture or to an
absolute value, the identity of the nucleotide in the position of
interest in one or both of the first target nucleic acid and the
second target nucleic may be determined, according to principles
described elsewhere herein.
[0248] In addition, in embodiments, compositions and methods
described herein for detecting a single nucleotide of interest may
also be used to detect multi-nucleotide mutations or
polymorphisms.
EXAMPLES
[0249] The following examples are offered for illustrative purposes
only, and are not intended to limit the present disclosure in any
way.
Example 1--Primers for MRSA Detection
[0250] Primers were prepared for use in a first amplification
reaction for amplifying a first genetic element (mecA) and a second
genetic element (orfX from S. Aureus) from a common double-stranded
nucleic acid molecule. Exemplary genetic element analysis first
amplification reaction first primers have the following sequences,
in the 5' to 3' direction: GAACCAACGCATGACCCAAG (SEQ ID NO: 3);
TTGAACCAACGCATGACCC (SEQ ID NO: 4); CAGACGAAAAAGCACCAGAA (SEQ ID
NO: 5); GCACCAGAAAATATGAGCGAC (SEQ ID NO: 6). Exemplary genetic
element analysis first amplification reaction second primers have
the following sequences, in the 5' to 3' direction:
ATCCGGTACTGCAGAACTCA (SEQ ID NO: 7); GCAAATCCGGTACTGCAGAA (SEQ ID
NO: 8); ATTGGCAAATCCGGTACTGC (SEQ ID NO: 9); GGCAGACAAATTGGGTGGTT
(SEQ ID NO: 10). An exemplary genetic element analysis second
amplification reaction first primer has the following sequence, in
the 5' to 3' direction: GCCAATGACGAATACAAAGTC (SEQ ID NO: 11). An
exemplary genetic element analysis second amplification reaction
second primer has the following sequence, in the 5' to 3'
direction: TAATAGCCATCATCATGTTTGG (SEQ ID NO: 12).
Example 2--Amplification of Wild-Type and Mutant Hepatitis C NS3
Genes
[0251] Nine different reaction mixtures were prepared. Each
reaction mixture contained the same reagents and primer
concentrations, but the reaction mixtures varied in primers and
templates. Of the nine reaction mixtures, three were prepared for
each of three different templates: Template 1: wild-type NS3
[nucleotide sequence, in the 5' to 3' direction:
GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTATACCAAT
GTAGACCAAGACCTCGTGGGCTGGCCCGCTCCTCAAGGTGCCCGCTCATTGACACCCTGCACCTGCG
(SEQ ID NO: 13)]; Template 2: Q80K mutation NS3 [nucleotide
sequence, in the 5' to 3' direction:
GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTATACCAAT
GTAGACAAAGACCTCGTGGGCTGGCCCGCTCCTCAAGGTGCCCGCTCATTGACACCCTGCACCTGCG
(SEQ ID NO: 14)]; Template 3: No template control. For each
different template, 3 different reaction mixtures were prepared,
with each different reaction mixture having a different primer
pair: Primer Pair 1: first primer [nucleotide sequence, in the 5'
to 3' direction: TTTGTCTAAAGGGTCCTGTTATCC (SEQ ID NO: 15)], second
primer [nucleotide sequence, in the 5' to 3' direction:
TAGACAAACAGCCCACGAGG (SEQ ID NO: 16)]; Primer Pair 2: first primer
[nucleotide sequence, in the 5' to 3' direction:
TTTGTCTAGTTATCCAGATGTAT (SEQ ID NO: 17)], second primer [nucleotide
sequence, in the 5' to 3' direction: TAGACAAACCAGCCCACGAGGTC (SEQ
ID NO: 18)]; Primer Pair 3: first primer [nucleotide sequence, in
the 5' to 3' direction: TCTTGGTCCAAGGGTCCTGTTATC (SEQ ID NO: 19)],
second primer [nucleotide sequence, in the 5' to 3' direction:
GACCAAGAAGGGTGTCAATGAGC (SEQ ID NO: 20)]. The reaction mixtures
each contained the following reagents: potassium acetate (50 mM);
magnesium acetate (10 mM); DTT (1 mM); Tween-20.RTM. (0.08%);
Tris-HCl, pH 7.9 (20 mM); betaine (800 mM); dNTP mixture (1.4 mM
each dNTP); Syto Red.RTM. (2 uM); Bst DNA polymerase (0.8 U/ul);
AMV reverse transcriptase (0.016 U/ul); respective first primer and
second primer (0.8 uM each); and respective template. The template
sequences were provided in a plasmid. FIG. 3 provides the results
of the different amplification reactions. The Y-axis shows the
inflection time (in minutes) for the different reactions. The no
template reactions show an eventual inflection time due to
background signal. On the X-axis, the reactions are grouped
together based on the primer pair. From the left to the right, the
first group of reactions is with Primer Pair 1, then Primer Pair 2,
then Primer Pair 3. Within each group of 3 bars for each Primer
Pair, the bars are for the following templates, from left to right:
wild-type NS3; 080K mutation NS3; no template control. As shown in
FIG. 3, the wild-type and Q80K mutation templates have different
inflection times, depending on the primer pair used to amplify the
sequences.
[0252] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. For example, a feature of one embodiment
may be combined with a feature of another embodiment, whether such
combination is described herein or not. It should also be
understood that while the invention provided herein has been
described herein using a limited number of terms and phrases for
purposes of expediency, the invention could also be described using
other terms and phrases not provided herein which also accurately
describe the invention.
[0253] It should be understood that as used in the description
herein and throughout the claims that follow, the meaning of "a,"
"an," and "the" includes plural reference unless the context
clearly dictates otherwise. For example, a reference to "an assay"
may refer to a single assay or multiple assays. Also, as used in
the description herein and throughout the claims that follow, the
meaning of "in" includes "in" and "on" unless the context clearly
dictates otherwise. The appended claims are not to be interpreted
as including means-plus-function limitations, unless such a
limitation is explicitly recited in a given claim using the phrase
"means for." As used in the description herein and through the
claims that follow, a first object described as containing "at
least a portion" of a second object may contain the full amount
of/the complete second object.
[0254] As used in the description herein and throughout the claims
that follow, the terms "comprise", "include", and "contain" and
related tenses are inclusive and open-ended, and do not exclude
additional, unrecited elements or method steps. Also, the presence
of broadening words and phrases such as "one or more," "at least,"
"but not limited to" or other like phrases in some instances shall
not be read to mean that the narrower case is intended or required
in instances where such broadening phrases may be absent. Finally,
as used in the description herein and throughout the claims that
follow, the meaning of "or" includes both the conjunctive and
disjunctive unless the context expressly dictates otherwise. Thus,
the term "or" includes "and/or" unless the context expressly
dictates otherwise.
[0255] This document contains material subject to copyright
protection. The copyright owner (Applicant herein) has no objection
to facsimile reproduction by anyone of the patent documents or the
patent disclosure, as they appear in the US Patent and Trademark
Office patent file or records, but otherwise reserves all copyright
rights whatsoever. The following notice shall apply: Copyright
2014-15 Theranos, Inc.
TABLE-US-00001 SEQUENCE LISTING SEQ ID NO: 1:
GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTA TACCAATGTAGAC SEQ
ID NO: 2: CGCAGGTGCAGGGTGTCAATGAGCGGGCACCTTGAGGAGCGGGCCAG
CCCACGAGGTCT SEQ ID NO: 3: GAACCAACGCATGACCCAAG SEQ ID NO: 4:
TTGAACCAACGCATGACCC SEQ ID NO: 5: CAGACGAAAAAGCACCAGAA SEQ ID NO:
6: GCACCAGAAAATATGAGCGAC SEQ ID NO: 7: ATCCGGTACTGCAGAACTCA SEQ ID
NO: 8: GCAAATCCGGTACTGCAGAA SEQ ID NO: 9: ATTGGCAAATCCGGTACTGC SEQ
ID NO: 10: GGCAGACAAATTGGGTGGTT SEQ ID NO: 11:
GCCAATGACGAATACAAAGTC SEQ ID NO: 12: TAATAGCCATCATCATGTTTGG SEQ ID
NO: 13: GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTA
TACCAATGTAGACCAAGACCTCGTGGGCTGGCCCGCTCCTCAAGGTG
CCCGCTCATTGACACCCTGCACCTGCG SEQ ID NO: 14:
GGAACGAGGACCATCGCATCACCCAAGGGTCCTGTTATCCAGATGTA
TACCAATGTAGACAAAGACCTCGTGGGCTGGCCCGCTCCTCAAGGTG
CCCGCTCATTGACACCCTGCACCTGCG SEQ ID NO: 15: TTTGTCTAAAGGGTCCTGTTATCC
SEQ ID NO: 16: TAGACAAACAGCCCACGAGG SEQ ID NO: 17:
TTTGTCTAGTTATCCAGATGTAT SEQ ID NO: 18: TAGACAAACCAGCCCACGAGGTC SEQ
ID NO: 19: TCTTGGTCCAAGGGTCCTGTTATC SEQ ID NO: 20:
GACCAAGAAGGGTGTCAATGAGC
Sequence CWU 1
1
20160DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1ggaacgagga ccatcgcatc acccaagggt cctgttatcc
agatgtatac caatgtagac 60259DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 2cgcaggtgca gggtgtcaat
gagcgggcac cttgaggagc gggccagccc acgaggtct 59320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
3gaaccaacgc atgacccaag 20419DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 4ttgaaccaac gcatgaccc
19520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5cagacgaaaa agcaccagaa 20621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
6gcaccagaaa atatgagcga c 21720DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 7atccggtact gcagaactca
20820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 8gcaaatccgg tactgcagaa 20920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
9attggcaaat ccggtactgc 201020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 10ggcagacaaa ttgggtggtt
201121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 11gccaatgacg aatacaaagt c 211222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
12taatagccat catcatgttt gg 2213121DNAHepatitis C virus 13ggaacgagga
ccatcgcatc acccaagggt cctgttatcc agatgtatac caatgtagac 60caagacctcg
tgggctggcc cgctcctcaa ggtgcccgct cattgacacc ctgcacctgc 120g
12114121DNAHepatitis C virus 14ggaacgagga ccatcgcatc acccaagggt
cctgttatcc agatgtatac caatgtagac 60aaagacctcg tgggctggcc cgctcctcaa
ggtgcccgct cattgacacc ctgcacctgc 120g 1211524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
15tttgtctaaa gggtcctgtt atcc 241620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
16tagacaaaca gcccacgagg 201723DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 17tttgtctagt tatccagatg tat
231823DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 18tagacaaacc agcccacgag gtc 231924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
19tcttggtcca agggtcctgt tatc 242023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
20gaccaagaag ggtgtcaatg agc 23
* * * * *