U.S. patent application number 15/899801 was filed with the patent office on 2018-07-26 for uses of monoclonal antibody 8h9.
The applicant listed for this patent is SLOAN-KETTERING INSTITUTE FOR CANCER RESEARCH. Invention is credited to Nai-Kong V. CHEUNG.
Application Number | 20180208673 15/899801 |
Document ID | / |
Family ID | 43300905 |
Filed Date | 2018-07-26 |
United States Patent
Application |
20180208673 |
Kind Code |
A1 |
CHEUNG; Nai-Kong V. |
July 26, 2018 |
USES OF MONOCLONAL ANTIBODY 8H9
Abstract
This invention provides a composition comprising an effective
amount of monoclonal antibody 8H9 or a derivative thereof and a
suitable carrier. This invention provides a pharmaceutical
composition comprising an effective amount of monoclonal antibody
8H9 or a derivative thereof and a pharmaceutically acceptable
carrier. This invention also provides an antibody other than the
monoclonal antibody 8H9 comprising the complementary determining
regions of monoclonal antibody 8H9 or a derivative thereof, capable
of binding to the same antigen as the monoclonal antibody 8H9. This
invention provides a substance capable of competitively inhibiting
the binding of monoclonal antibody 8H9. This invention also
provides an isolated scFv of monoclonal antibody 8H9 or a
derivative thereof. This invention also provides the 8H9 antigen.
This invention also provides a method of inhibiting the growth of
tumor cells comprising contacting said tumor cells with an
appropriate amount of monoclonal antibody 8H9 or a derivative
thereof.
Inventors: |
CHEUNG; Nai-Kong V.; (New
York, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SLOAN-KETTERING INSTITUTE FOR CANCER RESEARCH |
New York |
NY |
US |
|
|
Family ID: |
43300905 |
Appl. No.: |
15/899801 |
Filed: |
February 20, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15365803 |
Nov 30, 2016 |
9938351 |
|
|
15899801 |
|
|
|
|
13958902 |
Aug 5, 2013 |
|
|
|
15365803 |
|
|
|
|
12797081 |
Jun 9, 2010 |
8501471 |
|
|
13958902 |
|
|
|
|
10097558 |
Mar 8, 2002 |
7737258 |
|
|
12797081 |
|
|
|
|
PCT/US01/32565 |
Oct 18, 2001 |
|
|
|
10097558 |
|
|
|
|
09982645 |
Oct 18, 2001 |
|
|
|
10097558 |
|
|
|
|
60241344 |
Oct 18, 2000 |
|
|
|
60330396 |
Oct 17, 2001 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 35/00 20180101;
A61K 2039/505 20130101; A61K 51/1066 20130101; C07K 2317/24
20130101; C07K 2317/33 20130101; C07K 2319/00 20130101; C07K 16/30
20130101; C07K 2317/73 20130101; C07K 16/3053 20130101; C07K
2317/21 20130101; C07K 2317/76 20130101; C07K 16/3084 20130101;
C07K 2317/622 20130101; A61K 51/1078 20130101; C07K 2317/565
20130101; A01K 2217/05 20130101; C07K 2317/732 20130101; C07K
16/4266 20130101 |
International
Class: |
C07K 16/30 20060101
C07K016/30 |
Goverment Interests
[0002] The invention disclosed herein was made with government
support under Department of Energy Grant No. DE-FG-02-93ER61658
(1997-2002), the National Cancer Institute Grant No. NCI CA 89936
(12/1/00-11/30/02), and National Institutes of Health Grant No.
CA61017. Accordingly, the U.S. Government has certain rights in
this invention.
Claims
1-16. (canceled)
17. An isolated antibody that binds the same antigen as that of
monoclonal antibody 8H9, wherein the Complementary Determining
Region comprises SEQ ID NO:29 for CDR1, SEQ ID NO:30 for CDR2, SEQ
ID NO:31 for CDR3 for the heavy chain, and SEQ ID NO:32 for the
CDR1, SEQ ID NO:33 for CDR2, and SEQ ID NO:34 for CDR3 for the
light chain, wherein said antibody is labeled.
18. The antibody of claim 17, wherein said antibody is labelled by
a radioisotope.
19. The antibody of claim 18, wherein said radioisotope is
Iodine.
20. The antibody of claim 18, wherein said radioisotope is
.sup.124Iodine.
21. The antibody of claim 18, wherein said radioisotope is
.sup.131Iodine.
22. A composition comprising an effective amount of the antibody of
claim 17 and a suitable carrier.
23. An isolated antibody that binds the same antigen as that of
monoclonal antibody 8H9, wherein the Complementary Determining
Region comprises SEQ ID NO:29 for CDR1, SEQ ID NO:30 for CDR2, SEQ
ID NO:31 for CDR3 for the heavy chain, and SEQ ID NO:32 for the
CDR1, SEQ ID NO:33 for CDR2, and SEQ ID NO:34 for CDR3 for the
light chain, wherein said antibody is coupled to a cytotoxic
agent.
24. The antibody of claim 23, wherein said cytotoxic agent is a
radioisotope.
25. The antibody of claim 24, wherein said radioisotope is
Iodine.
26. The antibody of claim 24, wherein said radioisotope is
.sup.124Iodine.
27. The antibody of claim 24, wherein said radioisotope is
.sup.131Iodine.
28. A composition comprising an effective amount of the antibody of
claim 23 and a suitable carrier.
29. A method for imaging a tumor in a subject comprising
administering to the subject an antibody of claim 17.
30. The method of claim 29, wherein said tumor is selected from the
group consisting of neuroblastoma, glioma, desmoplastic small round
cell tumor, and leptomeningeal cancer.
31. A method for imaging a tumor in a subject comprising
administering to the subject a composition of claim 22.
32. The method of claim 31, wherein said tumor is selected from the
group consisting of neuroblastoma, glioma, desmoplastic small round
cell tumor, and leptomeningeal cancer.
33. A method of reducing tumor cells in a subject comprising
administering to the subject an antibody of claim 23.
34. The method of claim 33, wherein said tumor is selected from the
group consisting of neuroblastoma, glioma, desmoplastic small round
cell tumor, and leptomeningeal cancer.
35. A method of reducing tumor cells in a subject comprising
administering to the subject a composition of claim 28.
36. The method of claim 35, wherein said tumor is selected from the
group consisting of neuroblastoma, glioma, desmoplastic small round
cell tumor, and leptomeningeal cancer.
Description
[0001] This application is a Continuation-In-Part Application of
U.S. Ser. No. 13/958,902, filed Aug. 5, 2013, which is a
Continuation of U.S. Ser. No. 12/797,081, filed Jun. 9, 2010, which
is a continuation-in-part of U.S. Ser. No. 10/097,558, filed Mar.
8, 2002, which is a Continuation-In-Part of International
Application No. PCT/US01/32565, filed Oct. 18, 2001, which claims
benefit of U.S. Ser. No. 60/241,344, filed Oct. 18, 2000, and U.S.
Ser. No. 60/330,396, filed Oct. 17, 2001 and said U.S. Ser. No.
10/097,558 is a continuation-in-part of U.S. Ser. No. 09/982,645,
filed Oct. 18, 2001. The content of these applications is
incorporated by reference here into this application.
[0003] This invention provides an isolated antibody secreted by
hybridoma 8H9. A deposit of hybridoma 8H9 is being made with
American Type Culture Collection (ATCC).
[0004] Throughout this application, various references are referred
to. Disclosures of these publications in their entireties are
hereby incorporated by reference into this application to more
fully describe the state of the art to which this invention
pertains.
BACKGROUND OF THE INVENTION
[0005] Tumor-restricted surface antigens may be targets for
diagnosis and immune-based therapies. Monoclonal antibody 8H9 is a
murine IgG1 hybridoma derived from the fusion of mouse myeloma
SP2/0 cells and splenic lymphocytes from BALB/c mice immunized with
human neuroblastoma. By immunohistochemistry, 8H9 was highly
reactive with human brain tumors, childhood sarcomas,
neuroblastomas and less so with adenocarcinomas. Among primary
brain tumors, 15/17 glioblastomas, 3/4 mixed gliomas, 4/11
oligodendrogliomas, 6/8 astrocytomas, 2/2 meningiomas, 3/3
schwannomas, 2/2 medulloblastomas, 1/1 neurofibroma, 1/2
neuronoglial tumors, 2/3 ependymomas and 1/1 pineoblastoma were
tested positive. Among sarcomas, 21/21 Ewing's/PNET, 28/29
rhabdomyosarcoma, 28/29 osteosarcomas, 35/37 desmoplastic small
round cell tumors, 2/3 synovial sarcomas, 4/4 leiomyosarcomas, 1/1
malignant fibrous histiocytoma and 2/2 undifferentiated sarcomas
tested positive with 8H9. 87/90 neuroblastomas, 12/16 melanomas,
3/4 hepatoblastomas, 7/8 Wilm's tumors, 3/3 rhabdoid tumors and
12/27 adenocarcinomas also tested positive. In contrast 8H9 was
nonreactive with normal human tissues including bone marrow, colon,
stomach, heart, lung, muscle, thyroid, testes, pancreas, and human
brain (frontal lobe, cerebellum, pons and spinal cord). Reactivity
with normal cynomolgus monkey tissue was similarly restricted.
Indirect immunofluorescence localized the antigen recognized by 8H9
to the cell membrane. The antigen is proteinase-sensitive and is
not easily modulated off cell surface. 8H9 immuno-precipitated a 58
kD band following N-glycanase treatment, most likely a protein with
heterogeneous degree of glycosylation. This novel antibody-antigen
system may have potential for tumor targeting.
[0006] Monoclonal antibodies such as 3F8 (1) and 14.18 (2) against
G.sub.D2 in neuroblastoma, M195 against CD33 in acute leukemia (3),
anti-HER2 antibodies in breast cancer (4) and anti-CD20 antibodies
in lymphoma (5) have shown efficacy in recent clinical trials. The
prognosis in glial brain tumors and metastatic mesenchymal and
neuroectodermal tumors remains dismal despite innovations in
chemotherapy and radiation therapy. Immunotherapy may offer new
possibilities for improving the outcome in these patients.
[0007] Tumor antigens expressed on cell membrane are potential
targets in immunotherapy. Examples of tumor antigens expressed on
glial tumors include neural cell adhesion molecules (6),
gangliosides such as G.sub.D2 and G.sub.M2 (7), and
neurohematopoeitic antigens (8). Recent investigations have focused
on growth factor receptors as immune targets, in particular type
III mutant epidermal growth factor receptor (EGFRvIII) which has
been shown to be expressed on 50% of glial brain tumors (9).
Notwithstanding the universal expression of NCAM by neuronal cells,
two clinical studies have utilized anti-NCAM antibodies in
patients. MAb UJ13A was shown to accumulate in gliomas by virtue of
disruption of blood brain barrier locally (10) and another
antibody, ERIC-1 was used in a therapeutic setting in resected
glioma cavities with some clinical benefit (11)
[0008] Recent studies have targeted immunotherapy to extracellular
matrix around tumor cells. Tenascin has been reported to be
expressed in 50-95% of glial brain tumors as well as on mesenchymal
tumors, carcinomas and normal human glial, liver and kidney cells
(12). Anti-tenascin monoclonal antibodies 81C6 (13) and BC-2 and
BC-4 (14) administered intra-cavity have recently been reported to
show efficacy in the treatment of patients with malignant gliomas.
However, since these antigens are also present to varying degrees
on normal human neural and non-neural cells, their clinical utility
would depend on their overexpression by brain tumors when compared
to normal tissues. With the exception of EGFRvIII, the glial tumors
antigens described to date are generally found on normal brain
tissue, or are restricted to intracellular compartments, thus with
limited clinical utility for antibody targeting.
[0009] Membrane antigens that have been targeted on osteosarcoma
include G.sub.D2 (15), CD55 (16) and an as yet undefined
osteosarcoma-associated antigen recognized by the MoAbs TP-1 and
TP-3 (17). However, these antigens are present to varying degrees
on normal tissues. Similarly the glycoprotein p30/32 coded by the
MIC2 oncogene and recognized by the monoclonal antibody O13 in the
Ewing's family of tumors is expressed on normal tissues (18). In
rhabdomyosarcoma, the MyoD family of oncofetal proteins is nuclear
in localization (19) and therefore inaccessible to
antibody-targeted immunotherapy.
[0010] An ideal tumor antigen for targeted immunotherapy should be
absent on normal tissues and abundantly expressed on tumor cell
surface. Such tumor-specific antigens e.g. idiotypes in B cell
lymphoma are rare (20). Moreover, a "generic" tumor-specific
antigen expressed on tumor cells of varying lineage recognized by
monoclonal antibodies may have broader utility in antibody-based
strategies. We describe here a novel tumor-associated antigen,
recognized by a murine monoclonal antibody 8H9, expressed on cell
membranes of a broad spectrum of tumors of neuroectodermal,
mesenchymal and epithelial origin, with restricted distribution on
normal tissues.
SUMMARY OF THE INVENTION
[0011] This invention provides a composition comprising an
effective amount of monoclonal antibody 8H9 or a derivative thereof
and a suitable carrier. This invention provides a pharmaceutical
composition comprising an effective amount of monoclonal antibody
8H9 or a derivative thereof and a pharmaceutically acceptable
carrier.
[0012] This invention also provides an antibody other than the
monoclonal antibody 8H9 comprising the complementary determining
regions of monoclonal antibody 8H9 or a derivative thereof, capable
of binding to the same antigen as the monoclonal antibody 8H9.
[0013] This invention provides a substance capable of competitively
inhibiting the binding of monoclonal antibody 8H9. In an embodiment
of the substance, it is an antibody.
[0014] This invention provides an isolated antibody, wherein the
Complementary Determining Region is NYDIN (SEQ ID NO:29) for CDR1,
WIFPGDGSTQY (SEQ ID NO:30) for CDR2, QTTATWFAY (SEQ ID NO:31) for
CDR3 for the heavy chain, and RASQSISDYLH (SEQ ID NO:32) for the
CDR1, YASQSIS (SEQ ID NO:33) for CDR2, QNGHSFPLT (SEQ ID NO:34) for
CDR3 for the light chain. This invention further provides the above
antibody, wherein the other sequences are of human origin.
[0015] The invention also provides a composition comprising an
effective amount of monoclonal antibody 8H9 or a derivative thereof
and a suitable carrier, which includes sequences as set forth in
FIG. 33. In an embodiment, the sequences are mutated. This
invention also provides the mutated form of 8H9, so as to reduce
background and cytotoxicity. Other mutations could be established
which could achieve the above-described function. In a further
embodiment, the antibody includes sequences as set forth in FIG.
34.
[0016] Furthermore, the invention provides a composition comprising
the above antibodies and an isolated nucleic acid molecule encoding
the antibodies above. This invention also provides the isolated
nucleic acid molecule above, wherein the sequences are set forth in
FIG. 33.
[0017] In addition, this invention provides a vector comprising the
above nucleic acid molecules. The invention also provides a cell
comprising the above vector.
[0018] This invention provides an isolated scFv of monoclonal
antibody 8H9 or a derivative thereof. In an embodiment, the scFv is
directly or indirectly coupled to a cytotoxic agent.
[0019] This invention provides a cell comprising 8H9-scFv. In an
embodiment, it is a red cell. This invention also provides a
8H9-scFv-gene modified cell. This invention provides a liposome
modified by 8H9-scFv.
[0020] This invention provides a method for directly kill, or
deliver drug, DNA, RNA or derivatives thereof to cell bearing the
antigen recognized by the monoclonal antibody 8H9 or to image cells
or tumors bearing said antigen using the isolated 8H9-scFv or cell
or liposome comprising the 8H9-scFv.
[0021] This invention provides a protein with about 58 kilodaltons
in molecular weight, reacting specifically with the monoclonal
antibody 8H9. When this 58 kd protein is glycosylated, the apparent
molecular weight is about 90 kilodaltons.
[0022] This invention also provides an antibody produced by
immunizing the 8H9 antigen or specific portion thereof, which is
immunogenic.
[0023] This invention also provides a nucleic acid molecule
encoding the 8H9 antigen. In addition, this invention provides a
nucleic acid molecule capable of specifically hybridizing the
molecule encoding the 8H9 antigen. The nucleic acid molecule
includes but is not limited to synthetic DNA, genomic DNA, cDNA or
RNA.
[0024] This invention provides a vector comprising the nucleic acid
molecule encoding 8H9 antigen or a portion thereof. This invention
provides a cell comprising the nucleic acid molecule encoding 8H9
antigen.
[0025] This invention provides a method for producing the protein
which binds to the monoclonal antibody 8H9 comprising cloning the
nucleic acid molecule encoding the 8H9 antigen in an appropriate
vector, expressing said protein in appropriate cells and recovery
of said expressed protein.
[0026] This invention also provides a method for production of
antibody using the protein produced by the above method. This
invention also provides antibodies produced by the above method. In
an embodiment, the antibody is a polyclonal antibody. In another
embodiment, the antibody is a monoclonal.
[0027] This invention provide a method of inhibiting the growth of
tumor cells comprising contacting said tumor cells with an
appropriate amount of monoclonal antibody 8H9 or a derivative
thereof, or the antibody of claim produced by the expressed 8H9
antigen or a derivative of the produced antibody thereof.
[0028] This invention provides a method of inhibiting the growth of
tumor cells in a subject comprising administering to the subject an
appropriate amount of monoclonal antibody 8H9 or a derivative
thereof, or the antibody produced by the expressed 8H9 antigen or a
derivative thereof.
[0029] This invention provides a method for imaging a tumor in a
subject comprising administering to the subject a labeled
monoclonal antibody 8H9 or labeled derivatives, or a labeled
antibody produced by the expressed 8H9 antigen or a labeled
derivative. In embodiment, the antibodies or derivatives are
labeled by a radioisotope.
[0030] This invention provides a method of reducing tumor cells in
a subject comprising administering to the subject monoclonal
antibody 8H9 or a derivative thereof, or a monoclonal antibody
produced by the expressed 8H9 antigen or a derivative thereof
wherein the antibody or derivative is coupled to a cytotoxic agent
to the subject.
[0031] This invention provides a method to evaluate the tumor
bearing potential of a subject comprising measuring the expression
the 8H9 antigen in the subject, wherein the increased expression of
said antigen indicates higher tumor bearing potential of the
subject.
[0032] This invention provides a transgenic animal comprising an
exogenous gene encoding the 8H9 antigen. This invention also
provides a knock out animal wherein the gene encoding the 8H9 mouse
analogous antigen has been knocked out.
[0033] Finally, this invention provides a method to screening new
anti-tumor compound comprising contacting the above transgenic
animal with the tested compound and measuring the level of
expression of the 8H9 antigen in said transgenic animal, a decrease
in the level of expression indicating that the compound can inhibit
the expression of the 8H9 antigen and is a anti-tumor
candidate.
DETAILED DESCRIPTION OF THE FIGURES
First Series of Experiments
[0034] FIG. 1A shows Desmoplastic small round cell tumor
(10.times.) immunostained with 8H9 showing strong membrane
positivity and typical histology FIG. 1B shows Glioblastoma
multiforme stained with 8H9 showing binding to cell membranes and
fibrillary stroma FIG. 1C shows Embryonal rhabdomyosarcoma stained
with 8H9 showing cell membrane reactivity FIG. 1D shows Negative
staining of embryonal rhabdomyosarcoma with MOPC21, an irrelevant
IgG1 control antibody
[0035] FIG. 2A shows Persistence of 8H9 binding to U2OS cells and
FIG. 2B shows persistence of 8H9 binding to NMB7 cells as studied
by indirect immunofluorescence. X-axis: relative
immunofluorescence, y-axis: hours of incubation. U2OS cells were
reacted with 8H9 and HB95, and NMB7 cells with 8H9 and 3F8. After
washing, cells were recultured and persistence of immunoreactivity
of the primary antibodies evaluated by indirect immunofluorescence
using FITC-conjugated secondary antibody. Relative
immunofluorescence of 8H9 on U2OS cells dropped to 80% after 48 hrs
(HB95 to 11%), while that on NMB7 cells showed no significant drop
off at 36 hrs (3F8 dropped to 39%)
[0036] FIG. 3. Effect of Pronase E on 8H9 immunoreactivity with
HTB82, U2OS and NMB7 cells and on 3F8 immunoreactivity with NMB7
cells as studied by indirect immunofluorescence. X-axis:
concentration of Pronase E (mg/ml); y-axis: relative
immunofluorescence
Second Series of Experiments
[0037] FIG. 4. 4 cycles of 3F8 and low level HAMA response are
associated with prolonged survival.
[0038] FIG. 5. Improved long-term survival after MoAb 3F8 in
patients with stage 4 NB newly diagnosed >1 year of age at
Memorial Sloan-Kettering Cancer Center. N4 to N7 are sequential
protocols over 15 years. N4 and N5 are chemotherapy+ABMT, N6 is
chemotherapy+3F8, and N7 is N6+.sup.131I-3F8.
[0039] FIG. 6. Antigen modulation following binding to 8H9.
[0040] FIG. 7. At 120 h: .sup.125I8H9 localized to tumors (N=4)
while control antibody 2C9 (mouse IgG) remained in blood pool/liver
(N=4).
[0041] FIG. 8. High tumor-tissue ratio was specific for
.sup.125I-8H9 vs control MoAb .sup.125I-2C9 in RMS xenografts.
Third Series of Experiments
[0042] FIG. 9. Reactivity of 8H9 with Ewing's sarcoma cell lines.
Flow cytometric analysis of 8H9 binding to nine Ewing's sarcoma
cell lines is shown. The designation for each line is shown in the
upper right corner. FL1 fluorescence of isotype (dashed black line)
CD99 (thin black line) and 8H9 (thick black line) is shown.
[0043] FIGS. 10A-B shows Lack of Reactivity of 8H9 with T cells or
bone marrow progenitor cells. Electronically gated Cd3+ cells from
peripheral blood of a normal donor (top panel) are analyzed for
isotype (dashed line), CD99 (thin black line) and 8H9 (thick black
line). Electronically gated CD34+ cells from fresh human bone
marrow from a normal donor (bottom panel) are analyzed for isotype
(dashed line) and 8H9 (thick black line) staining.
[0044] FIGS. 11A-C shows Real-time PCR analysis of t(11,22) in
artificially contaminated PBMCs accurately quantifies EWS/FII 1
transcript over up to five log dilutions of tumor. Crossing time (x
axis) is plotted vs. fluorescence (y axis) FIG. 11A: Non-nested PCR
of 10.times.10.sup.6 PBMCs contaminated from 1:10 to 1:10.sup.6. In
the inset, a linear relationship between crossing time and log cell
concentration over 4 log dilutions of tumor is shown. Samples
contaminated at less that 1:10.sup.4 show no detectable postivity
in this assay. FIG. 11B: Nested PCR of 10.times.10.sup.6 PBMCs
contaminated from 1:10 to 1:10.sup.7. A linear relationship is
observed over 5 log dilutions of tumor from 1:100 to
1:10.sup.6.
[0045] FIGS. 12A-D shows Quantitative PCR analysis of purging
demonstrates 2-3 log reduction in peripheral blood and progenitor
cells spikes with Ewing's Sarcoma cells. Cycle number (x axis) is
plotted vs. fluorescence (y axis). Experimental samples were run
with standard contaminated dilutions shown in the inset. FIG. 12A:
Non-nested PCR analysis of 1.times.10.sup.6 pre-purged and
post-purged non-CD34 selected bone marrow from a normal healthy
donor contaminated at a level of 1:100. A two-log reduction in
tumor burden is demonstrated in the post-purged sample which shows
a level of contamination at 1:10.sup.4. FIG. 12B: Nested PCR
analysis of pre-purged and post-purged CD34 selected cells
harvested following G-CSF mobilization from a patient with Ewing's
sarcoma. Since this patient was negative for EWS/FLI, CD34 cells
were spike with Ewing's sarcoma at a level of 1:10.sup.1. A
three-log reduction in tumor burden is demonstrated in the
post-purged sample which shows a level of contamination at
1:10.sup.6. FIG. 12C: Nested PCR analysis of pre-purged and
post-purged PBMCc from a normal healthy donor buffy coat
contaminated at a level of 1:100. A greater than 3-log reduction in
tumor burden is demonstrated in the post-purged sample which shows
a level of contamination of less than 1:10.sup.6. FIG. 12D: Nested
PCR analysis of pre-purged and post-purged non PBMCs from a normal
healthy donor buffy coat contaminated at a level of 1:10.sup.1. A 3
log reduction in tumor burden is demonstrated in the post-purged
sample which shows a level of contamination at 1:10.sup.6.
[0046] FIGS. 13A-C shows Contamination of patient elutriated
apheresis fractions is demonstrated at at level of
1:10.sup.5-1:10.sup.6. Quantitative PCR analysis of apheresis
fractions from patients presenting with disseminated Ewing's
sarcoma. Cycle number (x axis) is plotted vs. fluorescence (y axis)
Patient samples are compared to standard contaminated dilutions.
Patient a (FIG. 13A) shows contamination of all fractions at a
level of 1:10.sup.5-1:10.sup.6. Patient B (FIG. 13B) shows
contamination in the leukocyte fraction only at a level of
approximately 1:10.sup.6, Patient C (FIG. 13C) shows contamination
in several fractions at a similar level.
[0047] FIG. 14. Progenitor CFU capability is not affected by 8H9
based purging. Colony formy units from CD34 selected cells from
bone marrow from a normal healthy donor (x axis) are plotted for
pre- and post purged samples.
[0048] FIG. 15. OKT3 mediated T cell proliferation is unchanged
after purging when compared to pre-purged proliferation. T cells
from normal healthy donor buffy coat were evaluated for [.sup.3H]
Thymidine uptake as a measure of T cell proliferation with a
decreasing concentration of OKT3. Uptake is measured as counts per
million (y axis) and is plotted vs. OKT3 concentration for
pre-purged (solid square), and post purged (solid circle).
Fourth Series of Experiments
[0049] FIG. 16. DSRCT (40.times.) demonstrating cell membrane and
stromal reactivity with 3F8
[0050] FIG. 17. DSRCT (40.times.) showing strong, homogeneous, cell
membrane and stromal reactivity with 8H9
Fifth Series of Experiments
[0051] FIGS. 18A-C shows Inhibition of 8H9 by anti-idiotype 2E9 by
FACS analysis. FIG. 18A shows Staining of LAN-1 neuroblastoma cells
with 5 ug/ml of 8H9 (shaded peak) was not inhibited at low
concentration of 2E9 (2 ug/ml, solid line), but almost completely
at concentration of 10 ug/ml (dotted line) superimposable with the
negative antibody control (solid line). FIG. 18B shows. Staining of
LAN-1 neuroblastoma cells with 5 ug/ml of 3F8 (anti-GD2, shaded
peak) was not inhibited by any concentrations (2 ug/ml, solid line,
or 200 ug/ml, dotted line) of 2E9. FIG. 18C shows Staining of
HTB-82 rhabdomyosarcoma cells with 5 ug/ml of 8H9 (grey peak) was
not inhibited at low concentration (2 ug/ml, solid line), but
completely at 10 ug/ml of 2E9 (solid line) superimposable with
negative antibody control (black peak).
[0052] FIG. 19. SDS-PAGE (lanes a and b) and Western blot (c and d)
of 8H9 scFv-Fc. H=heavy chain of 8H9, L=light chain of 8H9,
scFv-Fc=chimeric fusion protein between 8H9 scFv and the human
.quadrature.1-CH2-CH3 domain. With 2-mercaptothanol: lanes a, b and
c. Native gel: lane d. SDS-PAGE was stained with Comassie Blue;
western blot with 2E9 anti-idiotypic antibody.
[0053] FIGS. 20A-B show FACS analysis of 8 h9-scFv-Fc staining of
HTB82 rhabdomyosarcoma cells. FIG. 20A shows Immunofluorescence
increased with concentrations of 8H9-scFv-Fc (1, 5, 25, 125 ug/ml),
shaded peak is no antibody control. FIGURE 20B-shows Cell staining
(5 ug/ml of 8H9-scFv-Fc, thin solid line) was completely inhibited
(thick solid line) at 1 ug/ml of anti-idiotypic antibody 2E9,
shaded peak is no antibody control.
[0054] FIG. 21. Immunoscintigraphy of human tumors using
.sup.125I-labeled 8H9 scFv-Fc. Mice xenografted with human LAN-1
neuroblastoma received retroorbital injections of 25 uCi of
.sup.125I-labeled antibody. 24 h, 48 h and 7 days after injection,
the animals were anesthetized and imaged with a gamma camera.
[0055] FIG. 22. Blood clearance of .sup.125I-labeled chimeric 8H9
and .sup.125I-native 8H9. Mice xenografted with human LAN-1
neuroblastoma received retroorbital injections of .sup.125I-labeled
antibody. Percent injected dose/gm of serial blood samples were
plotted over time.
Sixth Series of Experiments
[0056] FIGS. 23A-D show Anti-idiotype affinity enrichment of
producer lines. Producer lines were stained with anti-idiotypic
MoAb 2E9 before (shaded peak, A and B), and after first (dotted
line peak, A) and second (thick solid line, A) affinity
purification, and after first (dotted line, B) and second (solid
line B) subcloning, showing improved scFv expression. By FACS the
indicator line K562 showed improved scFv expression after first
(dotted line, C) and second (thick solid line, C) affinity
purification of the producer line, and subsequent first (dotted
line, C) and second (thick solid line, D) subcloning of the
producer line, when compared to unpurified producer lines (shaded
peaks, C and D), consistent with improvement in gene transduction
efficiency. The thin solid line curves in each figure represents
nonproducer line (A and B) or uninfected K562 (C and D).
[0057] FIG. 24. Flow cytometry analysis of scFv expression.
Cultured 8H9-scFv-CD28-. gene-modified lymphocytes were assayed for
their scFv expression using anti-idiotypic MoAb 2E9 (solid curves)
and control rat IgG1 MoAb as control (shaded histograms) from day
13 through day 62. Although a substantial proportion of cells were
positive by day 13, they became homogeneous by day 21 and persisted
till day 62, when the overall mean fluorescence appeared to
decrease.
[0058] FIG. 25. In vitro expansion of 8H9-scFv-CD28-.quadrature.
gene-modified primary human lymphocytes. Clonal expansion was
expressed as a fraction of the initial viable cell number. IL-2
(100 U/ml) was added after retroviral infection and was present
throughout the entire in vitro culture period. Short bars depict
the days when soluble anti-idiotypic antibody 2E9 (3-10 ug/ml) was
present in the culture.
[0059] FIGS. 26A-D show Cytotoxicity against tumor cell lines:
8H9-scFv-CD28-.quadrature. gene-modified lymphocytes from day 56 of
culture (scFv-T) were assayed by .sup.51Cr release assay in the
presence or absence of 8H9 (50 ug/ml final concentration) as an
antigen blocking agent. Control lymphocytes (LAK) from the same
donor but not gene-modified, were cultured under the same
conditions as the gene-modified cells. FIG. 26A: NMB-7
neuroblastoma. FIG. 26B: LAN-1 neuroblastoma. FIG. 26C: HTB-82
rhabdomyosarcoma. FIG. 26D: Daudi lymphoma.
[0060] FIG. 27. Suppression of rhabdomyosarcoma tumor growth in
SCID mice. Human rhabdomyosarcoma HTB-82 was strongly reactive with
8H9, but not with 5F11 (anti-GD2) antibodies. Experimental group:
8H9-scFv-CD28-.quadrature. gene-modified human lymphocytes (solid
circles). Control groups: no cells +2E9 (open circles), cultured
unmodified lymphocytes (LAK)+2E9 (open triangles), or
5F11scFv-CD28-.quadrature. modified lymphocytes+1G8 [rat anti-5F11
anti-idiotype MoAb] (solid triangles).
Seventh Series of Experiments
[0061] FIG. 28. Sequential imaging of nude mouse bearing RMS
xenograft 24, 48 and 172 h after injection with 4.4MBq
.sup.125I-8H9 as compared to a RMS xenograft-bearing mouse imaged
172 h after injection with 4.4MBq.sup.125I-2C9.
[0062] FIG. 29. Blood kinetics of .sup.125I-8H9 in nude mice with
RMS xenografts. Error bars represent SEM.
[0063] FIG. 30. Comparison of biodistribution of .sup.125I-8H9 at
24, 48 and 172 h after injection in xenograft and normal
tissues.
[0064] FIG. 31. Comparison of biodistribution of .sup.125I-8H9 with
that of the nonspecific anticytokeratin MoAb .sup.125I-2C9 (solid
bars) in xenografts and normal tissues.
[0065] FIG. 32. Anti tumor effect on RMS xenografts: .sup.131I-8H9
versus negative control MoAb.sup.131I-3F8. Each mouse received
18.5MBq radiolabeled MoAb (5 mice per group).
[0066] FIG. 33: 8H9 scFv gene sequence (sense and
complementary).
[0067] Complementary determining regions (CDR) are marked in boxes
in the following order: CDR-1 (HC, heavy chain), CDR-2 (HC), CDr-3
(HC), CDR-1 (LC, light chain), CDR-2 (LC), CDR-3 (LC).
[0068] FIG. 34: Gene and amino acid sequences of 8H9scFv is
depicted. Mutated 8H9 scFv carries the following site-directed
mutagenesis (VH: K13E and VL: R18Q, R45Q, K103E, K107E) to decrease
PI from 6.4 to 4.8, and net charge from -1 to -9, a strategy to
decrease nonspecific normal tissue adherence.
DETAILED DESCRIPTION OF THE INVENTION
[0069] This invention provides a composition comprising an
effective amount of monoclonal antibody 8H9 or a derivative thereof
and a suitable carrier. This invention provides a pharmaceutical
composition comprising an effective amount of monoclonal antibody
8H9 or a derivative thereof and a pharmaceutically acceptable
carrier. In an embodiment of the above composition, the derivative
is a scFv. In a separate embodiment, the antibody is an
antibody-fusion construct. In another embodiment, the antibody is
an scFvFc.
[0070] This invention provides an isolated antibody, wherein the
Complementary Determining Region is NYDIN (SEQ ID NO:29) for CDR1,
WIFPGDGSTQY (SEQ ID NO:30) for CDR2, QTTATWFAY (SEQ ID NO:31) for
CDR3 for the heavy chain, and RASQSISDYLH (SEQ ID NO:32) for the
CDR1, YASQSIS (SEQ ID NO:33) for CDR2, QNGHSFPLT (SEQ ID NO:34) for
CDR3 for the light chain. This invention further provides the above
antibody, wherein the other sequences are of human origin.
[0071] The invention also provides a composition comprising an
effective amount of monoclonal antibody 8H9 or a derivative thereof
and a suitable carrier, which includes sequences as set forth in
FIG. 33. In an embodiment, the sequences are mutated. This
invention also provides the mutated form of 8H9, so as to reduce
background and cytotoxicity. Other mutations could be established
which could achieve the above-described function. In a further
embodiment, the antibody includes sequences as set forth in FIG.
34.
[0072] Furthermore, the invention provides a composition comprising
the above antibodies and an isolated nucleic acid molecule encoding
the antibodies above. This invention also provides the isolated
nucleic acid molecule above, wherein the sequences are set forth in
FIG. 33.
[0073] In addition, this invention provides a vector comprising the
above nucleic acid molecules. The invention also provides a cell
comprising the above vector.
[0074] This invention provides an antibody other than the
monoclonal antibody 8H9 comprising the complementary determining
regions of monoclonal antibody 8H9 or a derivative thereof, capable
of binding to the same antigen as the monoclonal antibody 8H9.
[0075] This invention also provides a substance capable of
competitively inhibiting the binding of monoclonal antibody 8H9. In
an embodiment, the substance is an antibody.
[0076] This invention provides an isolated scFv of monoclonal
antibody 8H9 or a derivative thereof. In an embodiment, the scFv is
directly or indirectly coupled to a cytotoxic agent. In a further
embodiment, the scFv is linked to a first protein capable of
binding to a second protein which is coupled to a cytotoxic agent.
Same rationale applies to the imaging uses of the 8H9 monoclonal
antibody or its derivative. In the case of imaging, instead of a
cytotoxic agent, the antibody or its derivative will be coupled to
an imaging agent. Both cytotoxic or imaging agents are known in the
art.
[0077] This invention provides a cell comprising 8H9-scFv. In an
embodiment, the cell is a red cell. This invention also provides a
8H9-scFv-gene modified cell.
[0078] This invention also provides a liposome modified by
8H9-scFv.
[0079] This invention provides a method for directly kill, or
deliver drug, DNA, RNA or derivatives thereof to cell bearing the
antigen recognized by the monoclonal antibody 8H9 or to image cells
or tumors bearing said antigen using the isolated 8H9-scFv or
8H9-scFv modified cell or liposome.
[0080] This invention provides a protein with about 58 kilodaltons
in molecular weight, reacting specifically with the monoclonal
antibody 8H9. When this protein is glycosylated, the apparent
molecular weight is about 90 kilodaltons.
[0081] This invention provides an antibody produced by immunizing
the expressed 8H9 antigen or specific portion thereof.
[0082] This invention provides a nucleic acid molecule encoding 8H9
antigen.
[0083] This invention provides a nucleic acid molecule capable of
specifically hybridizing the nucleic acid molecule which encodes
the 8H9 antigen. The nucleic acid molecule includes but is not
limited to synthetic DNA, genomic DNA, cDNA or RNA.
[0084] This invention also provides a vector comprising the nucleic
acid molecule encoding the 8H9 antigen or a portion thereof. The
portion could be a functional domain of said antigen. This
invention provides a cell comprising the nucleic acid molecule
encoding the 8H9 antigen.
[0085] This invention provides a method for producing the protein
which binds to the monoclonal antibody 8H9 comprising cloning the
nucleic acid molecule which encodes the 8H9 antigen in an
appropriate vector, expressing said protein in appropriate cells
and recovery of said expressed protein.
[0086] This invention provides a method for production of antibody
using the expressed 8H9 antigen or the portion which is
immunogenic. This invention also provides an antibody produced by
the above described method. In an embodiment, the antibody is
polyclonal. In another embodiment, the antibody is a
monoclonal.
[0087] This invention provides a method of inhibiting the growth of
tumor cells comprising contacting said tumor cells with an
appropriate amount of monoclonal antibody 8H9 or a derivative
thereof, or the antibody produced using the expressed 8H9 antigen
or a derivative thereof.
[0088] This invention provides a method of inhibiting the growth of
tumor cells in a subject comprising administering to the subject an
appropriate amount of monoclonal antibody 8H9 or a derivative
thereof, or the antibody produced using the expressed 8H9 antigen
or a derivative thereof.
[0089] This invention provides a method for imaging a tumor in a
subject comprising administering to the subject a labeled
monoclonal antibody 8H9 or a labeled derivatives, or a labeled
antibody produced using the expressed 8H9 antigen or a labeled
derivative. In an embodiment, the antibody or the derivative is
labeled with radioisotope.
[0090] This invention provides a method of reducing tumor cells in
a subject comprising administering to the subject monoclonal
antibody 8H9 or a derivative thereof, or a monoclonal antibody
produced using the expressed 8H9 antigen or a derivative thereof
wherein the antibody or derivative is coupled to a cytotoxic agent
to the subject. In an embodiment, the coupling to a cytotoxic agent
is indirect. In another embodiment, the coupling is first directly
linking the antibody or derivative with a first protein which is
capable of bind to a second protein and the second protein is
covalently couple to a cytotoxic agent. In a further embodiment,
the cytotoxic agent is a radioisotope.
[0091] This invention also provides a method to evaluate the tumor
bearing potential of a subject comprising measuring the expression
the 8H9 antigen in the subject, wherein the increased expression of
said antigen indicates higher tumor bearing potential of the
subject.
[0092] This invention provides a transgenic animal comprising an
exogenous gene encoding the 8H9 antigen. The transgenic animal may
also carried an knock out gene encoding the 8H9 mouse analogous
antigen. In an embodiment, it is a transgenic mouse.
[0093] This invention provides a method to screening new anti-tumor
compound comprising contacting the transgenic animal with the
tested compound and measuring the level of expression of the 8H9
antigen in said transgenic animal, a decrease in the level of
expression indicating that the compound can inhibit the expression
of the 8H9 antigen and is a anti-tumor candidate.
First Series of Experiments
Monoclonal Antibody 8H9 Targets a Novel Cell Surface Antigen
Expressed by a Wide Spectrum of Human Solid Tumors
[0094] Tumor-restricted surface antigens may be targets for
diagnosis and immune-based therapies. Monoclonal antibody 8H9 is a
murine IgG1 hybridoma derived from the fusion of mouse myeloma
SP2/0 cells and splenic lymphocytes from BALB/c mice immunized with
human neuroblastoma. By immunohistochemistry, 8H9 was highly
reactive with human brain tumors, childhood sarcomas,
neuroblastomas and less so with adenocarcinomas. Among primary
brain tumors, 15/17 glioblastomas, 3/4 mixed gliomas, 4/11
oligodendrogliomas, 6/8 astrocytomas, 2/2 meningiomas, 3/3
schwannomas, 2/2 medulloblastomas, 1/1 neurofibroma, 1/2
neuronoglial tumors, 2/3 ependymomas and 1/1 pineoblastoma were
tested positive. Among sarcomas, 21/21 Ewing's/PNET, 28/29
rhabdomyosarcoma, 28/29 osteosarcomas, 35/37 desmoplastic small
round cell tumors, 2/3 synovial sarcomas, 4/4 leiomyosarcomas, 1/1
malignant fibrous histiocytoma and 2/2 undifferentiated sarcomas
tested positive with 8H9. 87/90 neuroblastomas, 12/16 melanomas,
3/4 hepatoblastomas, 7/8 Wilm's tumors, 3/3 rhabdoid tumors and
12/27 adenocarcinomas also tested positive. In contrast 8H9 was
nonreactive with normal human tissues including bone marrow, colon,
stomach, heart, lung, muscle, thyroid, testes, pancreas, and human
brain (frontal lobe, cerebellum, pons and spinal cord). Reactivity
with normal cynomolgus monkey tissue was similarly restricted.
Indirect immunofluorescence localized the antigen recognized by 8H9
to the cell membrane. The antigen is proteinase-sensitive and is
not easily modulated off cell surface. 8H9 immuno-precipitated a 58
kD band following N-glycanase treatment, most likely a protein with
heterogeneous degree of glycosylation. This novel antibody-antigen
system may have potential for tumor targeting.
introduction
[0095] Monoclonal antibodies such as 3F8 (1) and 14.18 (2) against
G.sub.D2 in neuroblastoma, M195 against CD33 in acute leukemia (3),
anti-HER2 antibodies in breast cancer (4) and anti-CD20 antibodies
in lymphoma (5) have shown efficacy in recent clinical trials. The
prognosis in glial brain tumors and metastatic mesenchymal and
neuroectodermal tumors remains dismal despite innovations in
chemotherapy and radiation therapy. Immunotherapy may offer new
possibilities for improving the outcome in these patients.
[0096] Tumor antigens expressed on cell membrane are potential
targets in immunotherapy. Examples of tumor antigens expressed on
glial tumors include neural cell adhesion molecules (6),
gangliosides such as G.sub.D2 and G.sub.M2 (7), and
neurohematopoeitic antigens (8). Recent investigations have focused
on growth factor receptors as immune targets, in particular type
III mutant epidermal growth factor receptor (EGFRvIII) which has
been shown to be expressed on 50% of glial brain tumors (9).
Notwithstanding the universal expression of NCAM by neuronal cells,
two clinical studies have utilized anti-NCAM antibodies in
patients. MAb UJ13A was shown to accumulate in gliomas by virtue of
disruption of blood brain barrier locally (10) and another
antibody, ERIC-1 was used in a therapeutic setting in resected
glioma cavities with some clinical benefit (11)
[0097] Recent studies have targeted immunotherapy to extracellular
matrix around tumor cells. Tenascin has been reported to be
expressed in 50-95% of glial brain tumors as well as on mesenchymal
tumors, carcinomas and normal human glial, liver and kidney cells
(12). Anti-tenascin monoclonal antibodies 81C6 (13) and BC-2 and
BC-4 (14) administered intra-cavity have recently been reported to
show efficacy in the treatment of patients with malignant gliomas.
However, since these antigens are also present to varying degrees
on normal human neural and non-neural cells, their clinical utility
would depend on their overexpression by brain tumors when compared
to normal tissues. With the exception of EGFRvIII, the glial tumors
antigens described to date are generally found on normal brain
tissue, or are restricted to intracellular compartments, thus with
limited clinical utility for antibody targeting.
[0098] Membrane antigens that have been targeted on osteosarcoma
include G.sub.D2 (15), CD55 (16) and an as yet undefined
osteosarcoma-associated antigen recognized by the MoAbs TP-1 and
TP-3 (17). However, these antigens are present to varying degrees
on normal tissues. Similarly the glycoprotein p30/32 coded by the
MIC2 oncogene and recognized by the monoclonal antibody 013 in the
Ewing's family of tumors is expressed on normal tissues (18). In
rhabdomyosarcoma, the MyoD family of oncofetal proteins is nuclear
in localization (19) and therefore inaccessible to
antibody-targeted immunotherapy.
[0099] An ideal tumor antigen for targeted immunotherapy should be
absent on normal tissues and abundantly expressed on tumor cell
surface. Such tumor-specific antigens e.g. idiotypes in B cell
lymphoma are rare (20). Moreover, a "generic" tumor-specific
antigen expressed on tumor cells of varying lineage recognized by
monoclonal antibodies may have broader utility in antibody-based
strategies. We describe here a novel tumor-associated antigen,
recognized by a murine monoclonal antibody 8H9, expressed on cell
membranes of a broad spectrum of tumors of neuroectodermal,
mesenchymal and epithelial origin, with restricted distribution on
normal tissues.
Materials and Methods
Tumor and Normal Tissue Samples
[0100] Frozen tumors from 330 patients with neuroectodermal,
mesenchymal and epithelial neoplasia were analyzed. All diagnoses
of tumor samples were confirmed by hematoxylin and eosin assessment
of paraffin-embedded specimens. 15 normal human tissue samples and
8 normal cynomolgus monkey tissue samples obtained at autopsy were
also analyzed.
Cell Lines
[0101] Human neuroblastoma cell lines LA-N-1 was provided by Dr.
Robert Seeger, Children's Hospital of Los Angeles, Los Angeles,
Calif. Human neuroblastoma cell lines LA-15-N, LA-66-N, LA-5S,
LA-19-S and LA-19-N were provided by Dr. Robert Ross (Fordham
University, NY) and IMR 32 and NMB7 by Dr. Shuen-Kuei Liao
(McMaster University, Ontario, Canada). Breast carcinoma cell lines
SW480 and ZR75-1 were provided by Dr. S. Welt (Memorial
Sloan-Kettering Cancer Center, NY) and the melanoma line SKMe128 by
Dr. P. Chapman (Memorial Sloan-Kettering Cancer Center, NY).
Neuroblastoma cell lines SKNHM, SKNHB, SKNJD, SKNLP, SKNER, SKNMM,
SKNCH and SKNSH, rhabdomyosarcoma cell line SKRJC and Ewing's/PNET
cell lines SKPPR, SKPRT and SKNMC were derived from patients with
metastatic disease treated at MSKCC. The following cell lines were
purchased from American Type Culture Collection, Bethesda, Md.:
melanoma cell lines HTB63 and HTB67, rhabdomyosarcoma cell line
HTB82, small cell lung cancer cell line HTB 119, acute T-leukemia
cell line Jurkat, glioblastoma multiforme cell line Glio72, breast
cancer cell line HTB 22, colon carcinoma cells line SK Co-1, Hela,
embryonal kidney 293, and osteosarcoma cell lines CRL1427, HTB86
and HTB 96. All cell lines were grown at 37.degree. C. in a 6%
CO.sub.2 incubator using standard culture medium, which consisted
of RPMI 1640 medium supplemented with 10% bovine calf serum, 2 mM
glutamine, penicillin (100 IU/ml) and streptomycin (100 .mu.g/ml).
Normal human hepatocytes were purchased from Clonetics, San Diego,
Calif. and processed immediately upon delivery. Normal human
mononuclear cells were prepared from heparinized bone marrow
samples by centrifugation across a Ficoll-Hypaque density
separation gradient. EBV lymphoblastoid cell lines were derived
from human mononuclear cells.
Monoclonal Antibody
[0102] Female BALB/c mice were hyperimmunized with human
neuroblastoma according to previously outlined methods (21).
Lymphocytes derived from these mice were fused with SP2/0 mouse
myeloma cells line. Clones were selected for specific binding on
ELISA. The 8H9 hybridoma secreting an IgG.sub.1 monoclonal antibody
was selected for further characterization after subcloning.
Immunohistochemical Studies
[0103] Eight .mu.m cryostat frozen tumor sections were fixed in
acetone and washed in PBS. Immunohistochemical studies were
performed as described previously (22). Endogenous peroxidases were
blocked in 0.3% H.sub.2O.sub.2 in PBS. Sections were incubated in
10% horse serum (Gibco BRL, Gaithersburg, Md.) after blocking with
avidin and biotin. Incubation with purified 8H9 (2 .mu.g/ml) in PBS
was carried out at room temperature for 1 hour. An IgG1 myeloma was
used as a control (Sigma Chemical, St Louis Mo.). Sections were
incubated with a secondary horse anti-mouse biotinylated antibody
(Vector Laboratories, Burlingame, Calif.) followed by incubation
with ABC complex (Vector) and developed with Vector VIP peroxidase
substrate or DAB peroxidase substrate kit (Vector). A 10%
hematoxylin counterstain for 4 minutes was used. Staining was
graded as positive or negative and homogeneous or heterogeneous
reactivity noted.
Indirect Immunofluorescence
[0104] 1 million target cells were washed in PBS and then spun at
180.times.g for 5 min. The pellets were then reacted with 100 .mu.l
of 15 .mu.g/ml 8H9 at 4.degree. C. for 1 hour. After washing the
cells with PBS they were allowed to react with 100 .mu.l
FITC-conjugated goat F (ab').sub.2 anti-mouse IgG+IgM, (Biosource
International, Camarillo, Calif.) at 4.degree. C. Flow cytometric
analysis was performed using FACSCalibur Immunocytometer
(Becton-Dickinson Immunocytometry Systems, San Jose, Calif.).
[0105] In order to study loss of antigen after binding to 8H9,
10.sup.6 NMB7 and U2OS cell pellets were prepared as above and
reacted with 100 .mu.l each of 15 .mu.g/ml of 8H9 or the anti-HLA
A,B,C antibody, HB-95 (American Type Culture Collection, Bethesda,
Md.) at 4.degree. C. for 1 hour. NMB7 cells were also similarly
reacted with the anti-G.sub.D2 monoclonal antibody 3F8. After
washing with PBS, cells were cultured at 37.degree. C. in standard
culture medium for 0, 1, 2, 4, 8, 12, 24, 36 and 48 h. They were
then reacted with FITC-conjugated secondary antibody goat F
(ab').sub.2 anti-mouse IgG+IgM, (Biosource International,
Camarillo, Calif.) at 4.degree. C. Flow cytometric analysis was
performed. Geometric mean immunofluorescence was compared to that
of control cells incubated for similar time intervals in standard
culture medium in the absence of MoAbs, and then immunostained with
HB-95 (U2OS) or 3F8 (NMB7).
[0106] Antigen sensitivity to proteinase was tested by incubating
0.5.times.10.sup.6 of HTB82, U2OS and NMB7 cells at 37.degree. C.
for 30 minutes in RPMI with increasing concentrations of neutral
proteinase, Pronase E from streptomyces griseus (E. Merck,
Darmstadt, Germany) After washing, cells were stained with 8H9 or
3F8 and studied by indirect immunofluorescence.
Immunoprecipitation
[0107] Immunoprecipitation was carried out using a modification of
the standard technique. (23) 8H9-positive cell lines (NMB7, LAN-1,
HTB82, U2OS, HELA, 293) and 8H9-negative cell lines (Jurkat,
HTB119) were used. 2.times.10.sup.7 viable cells were washed in TBS
(0.05 M Tris-HCl, pH 8, with 0.15 M NaCl) and incubated with 10 U
lactoperoxidase (Sigma) 100 ul of 100 U/ml in TBS, 1 mCi .sup.125I
(2.7 ul) and 1/6000 dilution of 30% hydrogen peroxide for 5 min at
20.degree. C. Five units of lactoperoxidase (50 ul) and the same
dilution of hydrogen peroxide (50 ul) were added every 3 min with
mixing for a total of 3 times. The cells were washed extensively in
TBS containing 2 mg/ml of NaI. The iodinated cells were washed
three times in TBS, lysed on ice (30 min) in 500 ul of modified
RIPA buffer (0.01 M Tris-HCl, pH 7.2, 0.15 M NaCl, 1% sodium
deoxycholate, 1% Nonidet P-40, 0.1% sodium dodecyl sulfate (SDS),
0.01 M EDTA) containing protease inhibitors (1 mM PMSF, 50 ug/ml
Bestatin, 2 ug/ml Aprotinin, 0.5 ug/ml Leupeptin, 0.7 ug/ml
Pepstatin, 10 ug/ml E-64). The lysates were clarified by
centrifugation at 15,000 rpm for 5 min at 4.degree. C., then
incubated with 1 mg of 8H9 or IgG1 control antibody for 16 hr at
4.degree. C. with mixing. The antigen-antibody complex was
collected by adsorption onto 100 ul Protein G-sepharose beads
(Sigma) for 6 hr at 4.degree. C. The immune complex immobilized on
Protein G was washed three times with modified RIPA buffer, and
then washed once with RIPA buffer containing 1 M NaCl, and then
twice with modified TNN buffer (0.05 M Tris-HCl, pH 8, 0.15 M NaCl,
0.05% Nonidet P-40). Bound proteins were removed by elution with
SDS-sample buffer and analyzed by 7.5% SDS-PAGE, followed by
autoradiography. Deglycosylation of the radiolabeled antigen was
carried out on the protein G sepharose using N-glycanase (Glyco,
Novato, Calif.) and O-glycanase (Glyco) according to manufacturers'
instructions. Molecular weight was estimated using Quantity One
software from BioRad Inc. (Hercules, Calif.).
Results
Immunohistochemical Studies
[0108] Frozen sections from 330 tumors with histologically
confirmed diagnoses of cancer were analyzed for immunoreactivity
with mAb 8H9 (Tables 1, 2). 15 histologically normal human tissues
and 8 normal monkey tissues were also analyzed (Table 3).
TABLE-US-00001 TABLE 1 8H9 reactivity: neuroectodermal Tumors 8H9
Tumors No. positive % Neuroblastoma 90 87 97 Brain Tumors 1. Glial
Tumors Glioblastoma multiforme 17 15 88 Mixed Glioma 4 3 --
Oligodendroglioma 11 4 36 Astrocytoma 8 6 75 Ependymoma 3 2 -- 2.
Primitive PNET Medulloblastoma 2 2 -- 3. Mixed Neuronoglial tumor 2
1 -- 4. Other Schwannoma 3 3 -- Meningioma 2 2 -- Neurofibroma 1 1
-- Pineoblastoma 1 1 -- Melanoma 16 12 75 Ewing's Family of tumors
21 21 100 TOTAL 181 160 88
TABLE-US-00002 TABLE 2 8H9 reactivity: mesenchymal, epithelial and
other tumors 8H9 Tumors No. Reactive % A. Mesenchymal
Rhabdomyosarcoma 29 28 97 Osteosarcoma 29 28 97 Desmoplastic small
37 35 95 round cell tumor Leiomyosarcoma 4 4 -- Synovial sarcoma 3
2 -- Malignant fibrous 1 1 -- histiocytoma Undifferentiated 2 2 --
sarcoma Fibrosarcoma 1 0 TOTAL 106 100 94 B. Epithelial Breast 12 4
33 Bladder 4 1 -- Adrenal 3 1 -- Stomach 1 1 -- Prostate 2 1 --
Colon 1 1 -- Lung 1 1 -- Endometrium 1 1 -- Cervix 1 0 -- Renal 1 1
-- TOTAL 27 12 44 No. Slide Date Diagnosis 8H9 Epithelial tumors
summary 1 7251 Mar. 11, 1998 Breast Ca neg 2 7279 Mar. 13, 1998
Breast Ca neg 3 7282/ Mar. 13, 1998; Breast Ca neg 7601 Oct. 5,
1998 4 7722 Oct. 21, 1998 Breast Ca NE(no cells) 5 7261 Mar. 11,
1998 Breast Ca pos 6 6388 Aug. 26, 1998 Breast Ca pos 7 6493 Oct.
11, 1998 Breast Ca neg 8 6498 Oct. 11, 1998 Breast Ca neg 9 6499
Oct. 11, 1998 Breast Ca neg 10 6492 Oct. 11, 1998 Breast Ca neg 11
6376 Aug. 26, 1996 Breast Ca pos 12 6488 Oct. 11, 1998 Bladder Ca
neg 13 6489 Oct. 11, 1998 Bladder Ca weakly + 14 6490 Oct. 11, 1998
Bladder Ca neg 15 6491 Oct. 11, 1998 Bladder Ca neg 16 6441 Sep.
30, 1998 Lung Ca pos 17 6503 Oct. 11, 1998 Prostate Ca neg 18 6504
Oct. 11, 1998 Prostate Ca pos 19 6501 Oct. 11, 1998 Cervix Ca neg
20 6502 Oct. 11, 1998 Uterine Ca pos 21 7717 Oct. 21, 1998 Adrenal
Ca ne (necrotic) 22 7250 Mar. 11, 1998 Adrenal Ca neg 23 7207 Nov.
18, 1997 Renal Ca pos 24 6505 Oct. 11, 1998 Stomach Ca pos 25 7886
Feb. 22, 1999 Adrenal Ca pos Total Evaluable 8H9 pos. Breast 11 10
3 of 10 Bladder 4 4 1 of 4 Prostate 2 2 1 of 2 Adrenal 3 2 1 of 2
Renal 1 1 1 of 1 Stomach 1 1 1 of 1 Uterine 1 1 1 of 1 Cervix 1 1 0
of 1 Lung 1 1 1 of 1 TOTAL 25 23 10 of 23 Tumors No. 8H9 reactive %
C. Other tumors Hepatoblastoma 4 3 -- Wilm's tumor 8 7 -- Rhabdoid
tumor 3 3 -- Paraganglioma 1 1 -- TOTAL 16 14 88
TABLE-US-00003 TABLE 3 8H9 reactivity in normal human and
cynomolgus monkey tissues Tissues 8H9 reactivity A. Human Frontal
lobe Negative Pons Negative Spinal cord Negative Cerebellum
Negative Lung Negative Heart Negative Skeletal muscle Negative
Thyroid Negative Testes Negative Pancreas cytoplasmic staining*
Adrenal cortex cytoplasmic staining* Liver cytoplasmic staining*
Sigmoid colon Negative Bone Marrow Negative Kidney Negative B.
Cynomolgus monkey Cerebellum Negative Frontal Lobe Negative
Occipital Cortex Negative Brainstem Negative Liver cytoplasmic
staining Stomach Negative Adrenal Cortex cytoplasmic staining
Kidney Negative *non-specific background
[0109] Heterogenous, non-specific cytoplasmic staining was noticed
in normal human pancreas, stomach, liver and adrenal cortex which
was diminished when 8H9 F(ab').sub.2 fragments were used instead of
the whole antibody for immunostaining (data not shown). None of the
other human tissues showed reactivity with 8H9. In particular
normal human brain tissue sections including frontal lobe, spinal
cord, pons and cerebellum were completely negative. Normal tissues
from cynomolgus monkey also demonstrated similarly restricted
reactivity with nonspecific staining observed in stomach and liver.
(Table 3)
[0110] The majority of neuroectodermal and mesenchymal tumors
tested showed positive reactivity with 8H9, epithelial tumors to a
lesser extent. 8H9 immunoreactivity was seen in a characteristic,
homogeneous, cell membrane distribution in 286 of the 330 (87%)
tumor samples examined. (FIG. 1). 88% of neuroectodermal tumors,
94% of mesenchymal tumors and 44% of epithelial tumors tested
positive with 8H9. (Tables 2, 3)
Indirect Immunofluorescence
[0111] 8H9 immunoreactivity in 35 neuroblastoma, melanoma,
rhabdomyosarcoma, small cell lung cancer, osteosarcoma,
glioblastoma, leukemia, breast cancer and colon cancer cell lines
was tested using indirect immunofluorescence. Moderate to strong
cell membrane reactivity with 8H9 was detected in 16/16
neuroblastoma cell lines, 3/3 melanoma cell lines, 2/2
rhabdomyosarcoma cell lines, 1/1 glioblastoma multiforme cell line,
3/3 breast cancer cell lines and 1/1 colon cancer cell lines
studied. 2 of 3 Ewing's/PNET cell lines, and 2 of the 3
osteosarcoma cell lines were strongly positive while the others
showed weak positivity. The small cell lung cancer cell line tested
negative with 8H9 as did Jurkat T-ALL cell line and EBV transformed
lymphoblastoid cells. Normal human bone marrow mononuclear cells
and hepatocytes had no reactivity with 8H9. (Table 4) In the
neuroblastoma cell lines studied, indirect immunofluorescence with
8H9 was weaker (mean fluorescence: 73.73; negative control: 3.95)
when compared to the anti-G.sub.D2 antibody 3F8 (mean fluorescence:
249.95).
[0112] 8H9 binding to U2OS as detected by indirect
immunofluorescence did not diminish significantly after 48 hr of
incubation at 37.degree. C. During the same period, binding to the
anti-HLA antibody HB-95 diminished by 89%. Similarly there was no
significant loss of 8H9 binding to NMB7 cells. whereas 3F8 binding
diminished by 61%. (FIG. 2)
[0113] There was a pronase dose-dependent reduction in reactivity
with 8H9 with 75-85% loss of immunofluorescence achieved at a final
Pronase concentration of 0.3 mg/ml (FIG. 3). There was no
appreciable loss of reactivity with 3F8 on NMB7 cells. Furthermore,
the 8H9 antigen was not sensitive to neuraminidase or
phosphatidyl-inositol specific phospholipase C (data not
shown).
TABLE-US-00004 TABLE 4 8H9 reactivity with cell lines by indirect
immunofluorescence Cell line 8H9 Reactivity 1. Neuroblastoma LA-N-1
positive NMB7 positive LA-1-15-N positive LA-1-66N positive IMR32
positive LA-1-19N positive LA-1-5S positive LA-1-19S positive SKNHM
positive SKNSH positive SKNHB positive SKNJD positive SKNLP
positive SKNMM positive SKPCH positive SKNER positive 2. Melanoma
HTB63 positive HTB67 positive SKMel28 positive 3. Rhabdomyosarcoma
HTB 82 positive SKRJC positive 4. Small cell lung cancer HTB119
negative 5. Osteosarcoma CRL1427 positive HTB96 positive HTB86
positive 6. Ewing's/PNET SKPPR positive SKPRT positive SKNMC
positive 7. Glioblastoma Glio72 positive 8. Carcinoma Breast ZR75-1
positive SW480 positive HTB22 positive 9. Carcinoma Colon SKCo-1
positive 10. Leukemia Jurkat negative 11. Normal human cells
negative Bone marrow negative Hepatocytes negative 12. EBV
lymphoblastoid cells negative
Immunoprecipitation:
[0114] 8H9 immunoprecipitated a broad band centered around 90 kD
from all the 8H9-positive cell lines (HTB82, NMB7, LAN1, U2OS,
Hela, 293), whether using native or reducing (2ME) conditions (data
not shown). Neither control IgG1 antibody nor 8H9-negative cell
lines (Jurkat or HTB 119) showed the 90 kD antigen. Following
N-glycanase treatment, a single 58 kD band was found. O-glycanase
had no effect. We interpreted this to mean a protein with
heterogeneous glycosylation pattern, without disulfide-linked
subunits.
Discussion
[0115] We describe a novel 58 kD surface tumor antigen, which is
detected by the monoclonal antibody 8H9. This antigen is expressed
on a broad spectrum of human neuroectodermal, mesenchymal and
epithelial tumors and appears to be immunohistochemically tumor
specific, namely, it is expressed on cell membranes of tumor cells
with no/low membrane reactivity noted on normal human tissues. The
antigen was present on 88% of neuroectodermal tumors, 96% of
mesenchymal tumors and 44% of epithelial cancers tested. The
specific tissue distribution suggests a unique tumor antigen not
previously reported.
[0116] The expression of the 8H9 antigen on several glial and
nonglial brain tumors and the complete absence on normal brain
tissue is unusual. This property contrasts with most of the
previously described glial tumor antigens with a cell membrane
distribution (Table 5). Neuroectodermal-oncofetal antigens e.g.
neural cell adhesion molecules are present to varying degrees on
normal adult and fetal tissues (6). Neurohematopoeitic antigens
including Thy-1 determinants (24), CD-44 (8) and its splice
variants (25) are present on normal and neoplastic brain tissue as
well as hematopoeitic tissues, principally of the lymphoid lineage.
Gangliosides, such as G.sub.D2 and G.sub.M2, although expressed on
tumors of neuroectodermal origin, are also present on normal brain
tissue (7). The lactotetraose series ganglioside 3'-6''-iso
L.sub.D1 is widely expressed on brain tumors and on epithelial
cancers and germ cell tumors as well as on normal brain tissue.
(26).
TABLE-US-00005 TABLE 5 Antigens expressed on glial tumors Antigen
Antibody Crossreactivity with normal tissues Cell Membrane antigens
Neurohematopoeitic antigens Thy-1 Ab 390 (24) Normal neuronal cells
CD44 Multiple Normal endothelium CD44 splice variants Multiple (25)
Normal neuronal cells Cell Adhesion molecules NCAM ERIC-1 (11),
UJ13-A (10) Normal neuronal cells Normal neuronal cells Integrin 3
ONS-M21 (30) Not reactive with normal brain Gangliosides G.sub.D2
3F8 (35) Normal neuronal cells 3'-6' iso-LD1 DMAb-22 (29) Fetal
brain, reactive astrocytes Growth Factor Receptors EGFRvIII MR1 (9)
No normal tissues; breast and lung carcinoma PDGFR- Anti-PDGFR-7
(36) Normal neuronal cells Uncharacterized Ependymoma-associated
MabEp-C4 (34) Not reactive with PBL, normal brain Glioma-associated
GA-17, GB-4, GC-3 (32) Not reactive with normal adult or fetal
brain Glioma-associated 6DS1 (33) Not reactive with normal adult or
fetal brain Intracellular IFAP-300 Anti-IFAP-300 kDa (37) Not
reactive with normal brain GFAP Multiple Normal neuronal cells
Interstitial matrix Tenascin 81C6 (13), Normal liver, kidney; not
reactive with adult brain BC-2 (14) Not reactive with normal brain
GP-240 Mel-14 (38) Melanoma; not reactive with normal brain
Oncofetal fibronectin BC-1 (39) Adult endometrium; not reactive
with normal brain
[0117] Another remarkable property of the 8H9 antigen is its
expression on tumors of diverse lineage: neuroectodermal,
mesenchymal and to a lesser degree epithelial tumors. No monoclonal
antibody to date has the binding spectrum described with 8H9. This
broad distribution provides MoAb 8H9 the potential of being a
"generic" tumor antigen for targeted therapy. Of particular
interest is its expression on 28/29 rhabdomyosarcoma tumors and the
rhabdomyosarcoma cell lines tested by indirect immunofluorescence.
Disseminated and high risk rhabdomyosarcomas have a very poor
prognosis with <40% long term survival rate (27). Although the
MYOD family of oncofetal proteins are specific to rhabdomyosarcoma,
they are nuclear antigens and therefore unlikely candidates for
antibody-based therapy (19). In a preliminary report, cross
reactivity of the monoclonal antibody BW575 raised against small
cell lung carcinoma with rhabdomyosarcoma cell lines and 2/2
rhabdomyosarcoma sections was described. However, this antibody
showed cross-reactivity with normal tissues (28).
[0118] Two further groups of tumors studied were the Ewing's family
of tumors and osteosarcoma. The Ewing's family of tumors can be
differentiated from other small blue round cell tumors of childhood
by monoclonal antibodies recognizing glycoprotein p30/32 coded by
MIC2 oncogene. However, this protein is also expressed on normal
tissues and on other tumors, severely limiting its utility in
radioimaging and therapy (18). 100% (21/21) of Ewing's family
tumors tested showed immunoreactivity with MoAb 8H9. Apart from
G.sub.D2 (15), the osteosarcoma-associated antigen recognized by
the MoAbs TP-1 and TP-3 (17), and the decay accelerating factor
CD55 (16), few tumor-associated antigens have been defined for
osteosarcoma. In our study 28/29 (95%) osteosarcomas tested
immunohistochemically positive with MoAb 8H9. The latter may
therefore have clinical utility in the Ewing's family of tumors and
osteosarcomas.
[0119] The 8H9 antigen appears to be a novel, previously
undescribed antigen. Sensitivity to proteinase suggests that it has
a protein component. Conversely, the lack of sensitivity to
neuraminidase implies absence of sialic acid residues, and the lack
of sensitivity to phosphatidyl-inositol specific phospholipase C
implies that the 8H9 antigen is not GPI anchored. It is unlikely to
be related to the neural cell adhesion molecule family due to its
unique distribution and restriction of expression among normal
tissues (6). Of the currently described antibodies, which bind to
glial tumors, four have been reported to be restricted to tumor
tissues. The mutated EGFRvIII was found to be expressed on 52% of
gliomas tested and crossreacts with breast and lung carcinomas
(29). However, the broad distribution of the 8H9 antigen is
different from EGFRvIII. Integrin 3, a 140 kDa protein expressed on
gliomas and medulloblastomas is targeted by the monoclonal antibody
ONS-M21 which does not cross react with normal brain (30). However,
negative immunoreactivity with neuroblastoma, melanoma and
meningioma has been reported. (31). Similar data on glioma-specific
antibodies with no cross reactivity with normal brain has been
published. However, they do not react with other neuroectodermal or
mesenchymal tumors and data regarding reactivity with other tissues
is unavailable (32). A 38 kDa antigen has been targeted on
glioblastoma cells by the antibody 6DS1. No crossreactivity with
human brain has been reported. Data regarding reactivity with other
human tissues is unknown, although a high accumulation of the
radiolabeled antibody in mouse kidney has been reported. (33). An
ependymoma-specific protein antigen of 81 kDa, recognized by
monoclonal antibodies which do not crossreact with normal glial
cells, has also been described. These antibodies do not react with
other glial tumors such as glioblastoma and crossreactivity with
other tumor tissue is not known (34).
[0120] The homogeneous expression of the 8H9 antigen on cell
membrane makes it an attractive candidate for targeted
immunotherapy. Furthermore, the persistence of the 8H9 antigen on
NMB7 cells after binding to the MoAb suggests that the antigen is
not easily immunomodulated. In order to explore its potential for
radioimaging we used .sup.99mTc conjugated 8H9 to image
neuroblastoma xenografts in athymic nude mice. This revealed
selective uptake in the xenografts apart from moderate uptake in
the liver, % ID/gm being 50% of that achieved with the
anti-G.sub.D2 monoclonal antibody 3F8 (data not shown). The
hydrazino-derivative of 8H9, therefore, retains the immunoreactive
properties of the unmodified antibody, and may be useful for
radioimaging of tumors. We have also demonstrated selective
radioimmunolocalization of rhabdomyosarcoma xenografts in athymic
mice with no significant uptake in normal tissues using
.sup.125I-labeled 8H9 (data not shown).
[0121] In summary, the monoclonal antibody 8H9 recognizes a unique
58 kD tumor-specific antigen with broad distribution across a
spectrum of tumors of varying lineage: neuroectodermal, mesenchymal
and epithelial, with restricted expression in normal tissues. 8H9
may have clinical utility in the targeted therapy of these human
solid tumors in vitro or in vivo. Further biochemical
characterization of the 8H9 antigen is warranted and may be of
interest in delineating a possible role in the oncogenic
process.
REFERENCES
[0122] 1. Cheung, N. K. V., Kushner, B. H., Cheung, I. Y., Canete,
A., Gerald, W., Liu, C., Finn, R., Yeh, S. J., Larson, S. M.
Anti-GD2 antibody treatment of minimal residual stage 4
neuroblastoma diagnosed at more than 1 year of age. J. Clin.
Oncol., 16:3053-3060, 1998. [0123] 2. Yu, A., Uttenreuther-Fischer,
M., Huang, C.-S., Tsui, C., Gillies, S., Reisfeld, R., Kung, F.
Phase I trial of a human-mouse chimeric anti-disialoganglioside
monoclonal antibody ch14.18 in patients with refractory
neuroblastoma and osteosarcoma. J. Clin. Oncol., 16:2169-2180,
1998. [0124] 3. Jurcic, J. G., Caron, P. C., Miller, W. H., Yao, T.
J., Maslak, P., Finn, R. D., Larson, S. M., Warrell, R. P. J.,
Scheinberg, D. A. Sequential targeted therapy for acute
promyelocytic leukemia with all-trans retinoic acid and anti-CD33
monoclonal antibody M195. Leuk., 9:244-248, 1995. [0125] 4. Pegram,
M. D., Slamon, D. J. Combination chemotherapy with trastuzumab
(Herceptin) and cisplatin for chemoresistant metastatic breast
cancer: evidence for receptor-enhanced chemosensitivity. Sem.
Oncol., 26:89-95, 1999. [0126] 5. Czuczman, M. S., Grilo-Lopez, A.
J., White, C. A., Saleh, M., Gordon, L., LoBuglio, A. F., Jonas,
C., Klippenstein, D., Dallaire, B., Varns, C. Treatment of patients
with low-grade B-cell lymphoma with the combination of chimeric
anti-CD20 monoclonal antibody and CHOP chemotherapy. J. Clin.
Oncol., 17:268-276, 1999. [0127] 6. Garin-Chesa, P., Fellinger, E.
J., Huvos, A. G., Beresford, H. R., Melamed, M. R., Triche, T. J.,
Rettig, W. J. Immunohistochemical analysis of neural cell adhesion
molecules. Differential expression in small round cell tumors of
childhood and adolescence. Am. J. Pathol., 139:275-286, 1991.
[0128] 7. Ritter, G., Livingston, P. O. Ganglioside antigens
expressed by human cancer cells. Semin. Cancer. Biol., 2:401-409,
1991. [0129] 8. Ylagan, Quinn, L. R. B: CD44 expression in
astrocytic tumors. Modern Pathology, 10:1239-1246, 1997. [0130] 9.
Kuan, C. T., Reist, C. J., Foulon, C. F., Lorimer, I. A., Archer,
G., Pegram, C. N., Pastan, I., Zalutsky, M. R., Bigner, D. D.
125I-labeled anti-epidermal growth factor receptor viii
single-chain Fv exhibits specific and high-level targeting of
glioma xenografts. Clin. Can. Res., 5:1539-1549, 1999. [0131] 10.
Richardson, R. B., Davies, A. G., Bourne, S. P., Staddon, G. E.,
Jones, D. H., Kemshead, J. T., Coakham, H. B.
Radioimmunolocalization of human brain tumors. Biodistribution of
radiolabelled monoclonal antibody UJ13A. Eur J Nucl Med,
12:313-320, 1986. [0132] 11. Papanastassiou, V., Pizer, B. L.,
Coakham, H. B., Bullimore, J., Zananiri, A., Kemshead, J. T.
Treatment of recurrent and cystic malignant gliomas by a single
intracavitary injection of 131I-monoclonal antibody: Feasibility,
pharmacokinetics and dosimetry. Br. J. Cancer, 67:144-151, 1993.
[0133] 12. Celis, E., Tsai, V., Crimi, C., Demars, R., Wentworth,
P. A., Chesnut, R. W., Grey, H. M., Sette, A., Serra, H. M.
Induction of anti-tumor cytotoxic T lymphocytes in normal humans
using primary cultures and synthetic peptide epitopes. Proc. Natl.
Acad. Sci. USA, 91:2105-2109, 1994. [0134] 13. Bigner, D. D.,
Brown, M. T., Friedman, A. H., Coleman, R. E., Akabani, G.,
Friedman, H. S., Thorstad, W. L., Mclendon, R. E., Bigner, S. H.,
Zhao, X. G. Iodine-131-labeled antitenascin monoclonal antibody
81C6 treatment of patients with recurrent malignant gliomas:phase I
trial results. Journal Clincal Oncology, 16:2202-2212, 1998. [0135]
14. Riva, P., Frnceschi, G., Frattarelli, M., Riva, N., Guiduci,
G., Cremonini, A. M., Giulaiani, G., Casi, M., Gentile, R.,
Jekunen, A., Kairemo, K. J. 131I radioconjugated antibodies for the
locoregional radioimmunotherapy of high-grade malignant
glioma-phase I and II study. Acta Oncol, 38:351-359, 1999. [0136]
15. Heiner, J., Miraldi, F. D., Kallick, S., Makley, J.,
Smith-Mensah, W. H., Neely, J., Cheung, N. K. V. In vivo targeting
of GD2 specific monoclonal antibody in human osteogenic sarcoma
xenografts. Cancer Res., 47:5377-5381, 1987. [0137] 16. Spendlove,
I., James, L. L., Carmichael, J., Durrant, L. G. Decay accelerating
factor (CD55): a target for cancer vaccines? Cancer Res.,
59:2282-2286, 1999. [0138] 17. Bruland, O., Fodstad, O., Funderud,
S., Pihl, A. New monoclonal antibodies specific for human sarcomas.
Int J Cancer, 15:27-31, 1986. [0139] 18. Weidner, N., Tjoe, J.
Immunohistochemical profile of monoclonal antibody 013 that
recognizes glycoprotein 930/32MIC2 and is useful in diagnosing
ewing's sarcoma and peripheral neuroepithelioma. American Journal
of Surgical Pathology, 18:486-494, 1994. [0140] 19. Wang, N. P.,
Marx, J., McNutt, M. A., Rutledge, J. C., Gown, A. M. Expression of
myogenic regulatory proteins(myogenin and MyoD1) in small blue
round cell tumors of childhood. Am. J. Pathol., 147:1799-1810,
1995. [0141] 20. Hatzubai, A., Maloney, D. G., Levy, R. The use of
a monoclonal anti-idiotype antibody to study the biology of human
B-cell lymphoma. J. Immunol., 126:2397-2402, 1981. [0142] 21.
Cheung, N. K., Saarinen, U., Neely, J., Landmeier, B., Donovan, D.,
Coccia, P. Monoclonal antibodies to a glycolipid antigen on human
neuroblastoma cells. Cancer Res., 45:2642-2649, 1985. [0143] 22.
Kramer, K., Gerald, W., LeSauteur, L., Saragovi, H. U., Cheung, N.
K. V. Prognostic value of TrkA protein detection my monoclonal
antibody 5C3 in Neuroblastoma. Clin. Can. Res., 2:1361-1367, 1996.
[0144] 23. Hecht, T. T., Longo, D. L., Cossman, J., Bolen, J. B.,
Hsu, S.-M., Israel, M., Fisher, R. I. Production and
characterization of a monoclonal antibody that binds reed-sternberg
cells. J. Immunol., 134:4231-4236, 1985. [0145] 24. Seeger, R. C.,
Danon, Y. L., Rayner, S. A., Hoover, F. Definition of a Thy-1
determinant on human neuroblastoma, glioma, sarcoma, and teratoma
cells with a monoclonal antibody. J. Immunol., 128:983-989, 1982.
[0146] 25. Kaaijk, P., Troost, D., Morsink, F., Keehnen, R. M.,
Leenstra, S., Bosch, D. A., Pals, S. T. Expression of CD44 splice
variants in human primary brain tumors. Journal of Neuro-Oncology,
26:185-190, 1995. [0147] 26. Wikstrand, C. J., Longee, D. C.,
McLendon, R. E., Fuller, G. N., Friedman, H. S., Fredman, P.,
Svennerholm, L., Bigner, D. D. Lactotetraose series ganglioside
3',6'-isoLDi in tumors of central nervous and other systems in
vitro and in vivo. Cancer Res., 53:120-126, 1993. [0148] 27. Pappo,
A., Shapiro, D. N., Crist, W. M. Rhabdomyosarcoma: biology and
treatment. Pediatr. Clin. North Am., 44:953-972, 1997. [0149] 28.
Fujisawa, T., Xu, Z. J., Reynolds, C. P., Schultz, G., Bosslet, I.
V., Seeger, R. C. A monoclonal antibody with selective
immunoreactivity for neuroblastoma and rhabdomyosarcoma. Proc. Am.
Assoc. Cancer Res., 30:345, 1989. [0150] 29. Wikstrand, C. J.,
Hale, L. P., Batra, S. K., Hill, M. L., Humphrey, P. A., Kurpad, S.
N., McLendon, R. E., Moscatello, D., Pegram, C. N., Reist, C. J.,
et al. Monoclonal Antibodies against EGFRvIII are Tumor Specific
and React with Breast and Lung Carcinomas and Malignant Gliomas.
Cancer Res., 55:3140-48, 1995. [0151] 30. Kishima, H., Shimizu, K.,
Tamura, K., Miyao, Y., Mabuchi, E., Tominage, E., Matsuzaki, J.,
Hayakawa, T. Monoclonal antibody ONS-21 recognizes integrin a3 in
gliomas and gliomas and medulloblastomas. Br. J. Cancer,
79:333-339, 1998. [0152] 31. Moriuchi, S., Shimuzu, K., Miyao, Y.,
Hayakawa, T. Characterization of a new mouse monoclonal antibody
(ONS-M21) reactive with both medulloblastomas and gliomas. Br. J.
Cancer, 68:831-837, 1993. [0153] 32. Kondo, S., Miyatake, S.,
Iwasaki, K., Oda, Y., Kikuchi, H., Zu, Y., Shomoto, M., Namba, Y.
Human glioma-specific antigens detected by monoclonal antibodies.
Neurosurgery, 30:506-511, 1992. [0154] 33. Dastidar, S. G., Sharma,
S. K. Monoclonal antibody against human glioblastoma multiforme
(U-87Mg) immunoprecipitates a protein of monoclonal mass 38 KDa and
inhibits tumor growth in nude mice. J Neuroimmuno, 56:91-98, 1995.
[0155] 34. Mihara, Y., Matsukado, Y., Goto, S., Ushio, Y.,
Tokumitsu, S., Takahashi, K. Monoclonal antibody against
ependymoma-derived cell line. Journal of Neuro-Oncology, 12:1-11,
1992. [0156] 35. Daghighian, F., Pentlow, K. S., Larson, S. M.,
Graham, M. C., DiResta, G. R., Yeh, S. D., Macapinlac, H., Finn, R.
D., Arbit, E., Cheung, N. K. Development of a method to measure
kinetics of radiolabeled monoclonal antibody in human tumour with
applications to microdosimetry: positron emission tomography
studies of iodine-124 labeled 3F8 monoclonal antibody in glioma.
Eur J Nucl Med, 20:402-409, 1993. [0157] 36. Plate, K. H., Breier,
G., Farell, C. L., Risau, W. Platelet derived growth factor b is
induced during tumor development and upregulated during tumor
progressin in endothelial cells in human gliomas. Lab. Invest.,
67:529-534, 1992. [0158] 37. Yang, H. S., Lieska, N., Glick, R.,
Shao, D., Pappas, G. D. Expression of 300-kilodalton intermediate
filament-associated protein distinguishes human glioma cells from
normal astrocytes. Proceedings of the National Academy of Sciences
of the United States of America, 90:8534-8537, 1993. [0159] 38.
Bigner, D. D., Brown, M., Coleman, E., Friedman, H. A., McClendon,
R. E., Bigner, S. H., Zhao, X. G., Wikstrand, C. J., Pegram, C. N.
Phase I studies of treatment of malignant gliomas and neoplastic
meningitis with 131 I radiolabeled monoclonal antibodies
anti-tenascin 81C6 and anti-chondroitin proteoglycan sulfate Mel-14
(ab')2-a preliminary report. J Neuro Oncol, 24:109-122, 1995.
[0160] 39. Mariani, G., Lasku, A., Pau, A., Villa, G., Motta, C.,
Calcagno, G., Taddei, G. Z., Castellani, P., Syrigos, K.,
Dorcaratto, A., et al. A pilot pharmacokinetic and
immunoscintigraphic study with the technetium-99m-labeled
monoclonal antibody BC-1 directed against oncofetal fibronectin in
patients with brain tumors. Cancer Supplement, 80:2484-2489,
1997.
Second Series of Experiments
[0161] Recent clinical trials have shown promising potentials of
monoclonal antibodies (MoAbs) in the treatment of cancer: anti-CD20
(lymphoma), anti-HER2 (breast cancer), anti-tenascin (brain
tumors), anti-CD33 (leukemia), and anti-TAG-72 (colon cancer). In
pediatric oncology, tumor-targeting agents are even more relevant
since minimal residual disease (MRD) is often the obstacle to cure,
and late effects of non-specific therapy are significant. Despite
high-intensity combination therapy, most metastatic solid tumors
(Ewing's sarcoma [ES], primitive neuroectodermal tumor [PNET],
osteosarcoma [OS], desmoplastic small round cell tumor [DSRT],
rhabdomyosarcoma [RMS], and brain tumors) remain incurable. Using
metastatic neuroblastoma (NB) for proof of principle, our
laboratory integrated the murine IgG3 anti-ganglioside GD.sub.2
MoAb 3F8 into multi-modality therapy. 3F8 has demonstrated high
selectivity and sensitivity in radioimmunodetection of metastatic
tumors, and appears to be a safe and effective method of
eliminating MRD, achieving a >50% progression-free survival
(PFS). For most pediatric solid tumor therapeutic MoAbs do not
exist. Known tumor surface antigens are often restricted to a
specific tumor type, heterogeneous in its expression, or found in
normal blood cells or organs. We recently described a MoAb 8H9
which recognizes a novel cell surface antigen in a wide spectrum of
pediatric tumors, with no crossreactivity with blood, marrow, brain
and normal organs, and minimal reactivity with hepatocyte
cytoplasm. .sup.131I or .sup.99mTc-labeled 8H9 can effectively
image NB and RMS xenografts in SCID mice. Antigen expression was
generally homogeneous within tumors, and did not modulate on MoAb
binding. We propose to test the targeting potential of
.sup.131I-8H9 in a pilot imaging study. Pediatric/adolescent
patients with NB, RMS, ES, PNET, OS, DSRT and brain tumors are
subjects of our investigation. We have two specific aims:
[0162] Specific Aim #1:
[0163] To measure the level of agreement between conventional
imaging modality (CT, MRI, and nuclear scans) and antibody 8H9
imaging in known and occult sites of disease. Sensitivity analysis
of 8H9 for each disease type will be conducted.
[0164] Specific Aim #2:
[0165] To calculate the absorbed dose delivered by .sup.131I-8H9 to
tumor relative to normal organs.
Background and Significance
[0166] MoAb Selective for Tumors have Therapeutic
Potential.sup.1,2
[0167] The introduction of hybridoma technology by Kohler and
Milstein in 1975.sup.3 and the advances in molecular biologic
techniques have greatly expanded the potential of MoAb in human
cancers. Optimal targeting of MoAb demands high tumor antigen
density with homogeneous expression, lack of antigen modulation on
tumor cell surface, adequate vascularity of tumor to allow deep
penetration, minimal toxicity on normal tissues, low
reticulo-endothelial system (RES) uptake, noninterference by
circulating free antigens, and low immunogenicity. In practice,
very few MoAb-antigen-tumor model systems have fulfilled these
stringent criteria. Recent clinical trials have shown promising
potentials of MoAbs. Anti-CEA antibody in colorectal cancer,.sup.4,
anti-CD20 antibodies in lymphoma,.sup.5 anti-HER2 antibodies in
breast cancer,.sup.6 anti-tenascin antibodies in glial brain
tumors,.sup.7 MoAb M195 against CD33 in acute leukemia.sup.8 and
anti-TAG-72 antibodies in colon cancer.sup.9 have demonstrated
efficacy in clinical trials. Our laboratory has developed the MoAb
3F8 which targets the ganglioside G.sub.D2 overexpressed on NB. 3F8
has been shown to have a high specificity and sensitivity in the
radioimmunodetection of minimal residual disease (MRD) in patients
with NB,.sup.10 and a significant impact when used as adjuvant
therapy..sup.11 131I has been a common isotope used both for
imaging and therapy purposes. Although not widely available,
pure-emitters such as .sup.90Y,.sup.12,13 alpha-emitting
particles,.sup.14,15 such as .sup.211At, .sup.212Bi and .sup.213Ac
have attractive properties with promising biological effectiveness.
Multiple radioisotopes of varying path lengths and half-lives may
be needed to enhance radiocurability of both bulk and microscopic
diseases. More recent developments in immunocytokines (e.g. IL-2,
IL-12),.sup.16 bispecific antibodies for pretargeting strategies
(e.g. radioisotopes or drugs),.sup.17,18 or T-bodies for
retargeting immune cells.sup.19-21 have further expanded the
potentials of antibody-based immunotherapies.
[0168] Brain Tumor Antigens
[0169] Examples of tumor antigens expressed on glial tumors include
neuroectodermal-oncofetal antigens eg. neural cell adhesion
molecules (NCAM),.sup.22 gangliosides (GD2, GM2, 3'-6''-iso
LD1).sup.23,24 and neurohematopoeitic antigens (Thy-1, CD44 and
splice variants)..sup.25-27 All of these antigens are present to
varying degrees on normal adult and fetal tissues, and for some
hematopoeitic tissues as well. Notwithstanding the universal
expression of NCAM by neuronal cells, anti-NCAM MoAb UJ13A was
shown to accumulate in gliomas by virtue of disruption of blood
brain barrier locally.sup.28 and another MoAb ERIC-1 showed
clinical benefit in resected glioma cavities..sup.29 Integrin-3, a
140 kDa protein expressed on gliomas and medulloblastomas and not
in normal brain, is a potential target (MoAb ONS-M21).sup.30, but
it is poorly expressed among other tumor types..sup.31 The
extracellular matrix protein tenascin is expressed in 50-95% of
gliomas as well as on mesenchymal tumors, carcinomas, normal human
glial, liver and kidney cells..sup.32 Anti-tenascin monoclonal
antibodies 81C6,.sup.7 BC-2 and BC-4.sup.33 administered directly
into tumor-cavities have shown efficacy in patients with malignant
gliomas. More recent investigations have focused on growth factor
receptors. in particular type III mutant epidermal growth factor
receptor (EGFRvIII) expressed on 52% of gliomas.sup.34 as well as
breast and lung carcinomas..sup.35 Given the relationship of these
mutated receptors to their malignant potential, they may be ideal
targets for MoAb. Although other glioma-specific antibodies with no
cross reactivity with normal brain have been described (e.g. 6DS1,
MabEp-C4),.sup.36-38 they have limited reactivity with other
neuroectodermal or mesenchymal tumors, and data regarding
cross-reactivity with normal tissues are not available. To date,
with the exception of EGFRvIII, the glial tumor antigens described
are either found on normal brain and/or normal tissues, restricted
to specific tumor types, or found in intracellular
compartments/extracellular matrix which can limit their clinical
utility for targeting to single cells or spheroids.
[0170] Sarcoma Antigens
[0171] Optimal tumor antigens, similarly, have not been defined for
the large family of sarcomas. Although the MyoD family of oncofetal
proteins are specific to rhabdomyosarcoma, they are localized to
the nucleus and therefore do not offer targets for antibody-based
therapy..sup.39 The ES family of tumors can be differentiated from
other small blue round cell tumors of childhood by MoAbs
recognizing glycoprotein p30/32 coded by the MIC2 oncogene.
However, this protein is expressed on normal tissues (e.g.
T-cells).sup.40 greatly limiting the utility of MoAb in marrow
purging, radioimaging or radiotherapy..sup.41 Membrane targets on
OS include GD2,.sup.42 glycoprotein p72,.sup.43 CD55.sup.44
erB2/neu.sup.45 and the antigen recognized by the MoAb TP-3..sup.46
CD55 is decay-accelerating factor, a ubiquitous protein on blood
cells and most tissues to prevent complement activation. Clearly
MoAb directed at CD55 would have significant limitations for in
vivo targeting. The degree of tumor heterogeneity (e.g. erbB2 in
OS) may also limit the efficacy of MoAb-targeted approach. The
presence of GD2 on pain fibers causes significant pain side effects
in clinical trials. Nevertheless, this side effect is self-limited
and this cross-reactivity did not interfere with the
biodistribution and clinical efficacy of specific MoAb (see
preliminary results). Nevertheless, GD2 is generally low or absent
in RMS, ES, PNET, and many soft-tissue sarcomas. In addition, the
presence of GD2 in central neurons can limit its application in
tumors arising or metastatic to the brain. Our laboratory has
generated a novel MoAb 8H9 by hyperimmunizing female BALB/c mice
with human NB..sup.47 8H9 recognizes a unique surface antigen
homogeneously expressed on cell membranes of a broad spectrum of
tumors of neuroectodermal, mesenchymal and epithelial origin, with
restricted distribution on normal tissues (see preliminary
results)..sup.48
[0172] The Availability of an Antibody with Broad Specificity for
Pediatric Tumors Will Facilitate Several Lines of Clinical
Investigations.
[0173] In vitro, such antibodies will be extremely useful for (1)
detecting lymph node or marrow metastasis,.sup.49 (2)
enrichment/isolation of circulating tumor cells for RT-PCR
detection strategies,.sup.50 (3) purging of bone marrow before
autologous bone marrow transplantation, .sup.51 (4) purging of ex
vivo activated T-cells prior to adoptive cell therapy. In vivo its
utility can go beyond its diagnostic capability. When chimerized
with a human-1Fc tail, it becomes tumoricidal through
complement-mediated, and antibody-dependent cell-mediated
cytotoxicities..sup.52 Through single-chain Fv constructs, new
fusion proteins can now be delivered to tumor sites (e.g. IL-2,
IL-12, toxins, or enzymes). Bivalent scFv and tetravalent scFv can
be engineered to improve avidity..sup.53 Bispecific scFv can be
constructed to engage cells and proteins in various targeting
strategies (e.g. pretargeting)..sup.17,18 ScFv can also be used in
T-bodies to retarget T-cells, a powerful technique to increase
clonal frequency and bypassing the HLA requirement of TCR
functions..sup.19-21 Furthermore scFv-fusion proteins (e.g. CD28,
zeta chain) transduced into T-cells can greatly enhance their
survival following activation..sup.21 Even more importantly, the
ability of such cells to proliferate in contact with tumor cells
can further amplify the efficiency of T-cell cytotherapy.
[0174] Radioimmunoscintigraphy can Test if an Antibody-Antigen
System has Targeting Potential.
[0175] Using radioiodines and technetium we have demonstrated the
utility of the GD2 system for targeting in the last decade. This
information has been translated into treatment strategies using
both unlabeled and .sup.131I labeled antibody 3F8. Dosimetry
calculations have allowed quantitative estimates of therapeutic
index when cytotoxic agents are delivered through antibody-based
methods. Uptake (peak dose and area under the curve AUC) in
specific organs relative to tumor can be measured. These studies
are resource intensive and to be done well, require laboratory,
radiochemistry, nuclear medicine, medical physics and clinical
resource support, as well as substantial personnel effort. In
pediatric patients, issues of therapeutic index may be even more
pressing given the potential of late effects of treatment. In
addition, despite the potential life-years saved for pediatric
cancer, orphan drugs are not economically attractive for most
industrial sponsors. These circumstances have made the initial
stages of clinical development even more stringent and relatively
more difficult to accomplish.
[0176] Patient Monitoring and Correlative Laboratory Studies
[0177] Pharmacokinetic studies are crucial in our understanding of
antibody targeting, its toxicity and its efficacy.
Radioimmunoscintigraphy uses the trace label principle and gamma
imaging to define the distribution of a specific antibody in
various human organs. It provides estimates of antibody (and
radiation) dose delivered to blood, marrow and major organs. The
continual development of improved software and hardware for
calculating antibody deposits in tissues is critical in
implementing these studies (see preliminary results). The
quantitative relationship of free circulating antigens (if present)
and biodistribution of MoAb needs to be defined. The formation of
human-anti-mouse antibody (HAMA) response will clearly affect the
in vivo properties of these antibodies. However, the induction of
the idiotype network (see preliminary results) may have potential
benefit in the long run. These parameters need to be monitored.
These in vitro assays will provide important information in
understanding and optimization of future use of 8H9 and other MoAb
in the context of chemo-radiotherapy for a broad category of
recalcitrant tumors in children, adolescents and young adults.
[0178] Memorial Sloan-Kettering has a Strong Track-Record in the
Development and Clinical Applications of Monoclonal Antibodies.
[0179] Memorial Sloan-Kettering Cancer Center (MSKCC) is devoted to
the research and clinical care of cancer patients. The Center has
an extensive patient referral base, particularly within the
tri-state area. The center has an established commitment and past
record in the use of monoclonal antibodies in the diagnosis and
therapy of human cancers, including melanoma, colon cancer, and
leukemias. Over the past 4 years we have an annual accrual of
around 45 new NB, 27 OSs, 58 brain tumors, 23 Ewing's/PNET, 18
retinoblastoma, 12 rhabdomyosarcomas, 16 sarcomas and 7 DSRT at
MSKCC. We are confident that we can accrue 60 patients within the
next 2 years. In this past decade, we tested the utility of MoAb in
the curative treatment of a lethal tumor (metastatic stage 4 NB in
children). For this orphan disease, the lack of
corporate/pharmaceutical sponsor has made our progress slow and
difficult. Nevertheless, we made the following observations. (1)
MoAb can extend the progression-free period in a cancer that was
uniformly lethal two decades ago. (2) It is feasible to integrate
MoAb into standard chemo-radiotherapy strategies, in order to
derive maximal benefit from all available modalities. (3) Immune
based therapies can be administered safely in the outpatient
setting, thus reducing expensive in-patient costs and maximizing
time in the home environment. (4) MoAb can induce idiotype network,
a potential endpoint that underlies the biology in maintaining
continual clinical remission. (5) GD2 is a useful marker of MRD,
and specific MoAbs are highly efficacious in monitoring and purging
of tumor cells. (6) Novel bioengineering strategies have been
developed for the GD2-3F8 antigen-antibody system which are
directly applicable to other MoAbs (single chain Fv,.sup.54 and
T-bodies.sup.55). During this period, >240 patients have been
treated at Memorial Hospital with the antibody 3F8. A total of
>3500 doses of unlabeled 3F8 have been given, 250 injections of
.sup.131I-3F8 for imaging, and 372 injections of .sup.131I-3F8 for
therapy. Although there were side effects, there were no lethal
sequella during or immediately after antibody administration. 3F8
treatment is now routinely done in the outpatient clinic. Extending
these findings to a second antigen-antibody system, especially one
that will target to a broader spectrum of pediatric solid tumors is
a priority. The murine IgG1 antibody 8H9 has obvious potential in
monitoring and purging of MRD, radioimmunoscintigraphy, and
radioimmunotherapy (both intravenous or compartmental). If our
proposed study produces favorable results, i.e. selective tumor
uptake at optimal AUC ratios (Tumor: tissues/organs),
radioimmunotherapy can be explored for some of these solid tumors.
More importantly, further development of the antibody would involve
a major effort in humanizing and further genetic engineering to
improve effector functions.
Progress Report and Preliminary Results:
[0180] GD2-Specific MoAb-Based Targeted Therapy: A Curative
Approach to a Pediatric Solid Tumor: Metastatic NB
[0181] Improved understanding of the biology of NB has reshaped our
clinical approach to this cancer. Non-infant stage 4 NB remains a
therapeutic challenge despite four decades of combination
chemotherapy. Similar to many cancers, MRD state can be achieved in
patients with NB after intensive induction therapy..sup.56,57
Unfortunately, the transition from MRD to cure was a formidable
hurdle..sup.56 Targeted immunotherapy besides being more specific
and less toxic, may supplement what chemoradiotherapy has not
accomplished..sup.58,59 Disialoganglioside G.sub.D2 is a tumor
antigen well suited for targeting therapy because (1) it is
expressed at a high density in human NB, is restricted to
neuroectodermal tissues and is genetically stable, unlike other
tumor antigens such as immunoglobulin idiotypes;.sup.60 (2)
although it circulates in patients' serum, it does not interfere
with the biodistribution of specific antibody (e.g. 3F8), allowing
excellent tumor localization of NBs in patients;.sup.10 (3) it is
not modulated from cell surface upon binding to antibodies; (4) it
is expressed homogeneously in human NB, with little heterogeneity
within tumors and among patients. Several antibodies against
G.sub.D2 antigen has been described (3F8, 14.G2a, 14.18)..sup.47,61
In vitro they can target lymphocytes,.sup.62,63
granulocytes,.sup.52,64,65 complement,.sup.66,67 activated
monocytes/macrophages,.sup.68,69, IL2,.sup.70,
isotopes,.sup.10,59,71,72 toxins,.sup.73,74 and
superantigen..sup.75 Phase I and phase II studies have shown only
modest efficacy,.sup.76-84 marrow disease more likely to respond
than bulky tumors..sup.85 The major side effects included pain,
allergic reactions and neuropathy..sup.78,85 With long followup,
the role of these anti-G.sub.D2 antibodies at the time of MRD
appears promising.
[0182] Radiolabeled Anti-G.sub.D2 Antibody 3F8
[0183] 3F8 is a murine IgG.sub.3 MoAb directed at the ganglioside
G.sub.D2 expressed on human NB cells. In preclinical studies
.sup.131I-3F8 targeted to human NB xenografts with exceptionally
high % ID/gm. Intravenous .sup.131I-labeled IgG.sub.3 MoAb 3F8
produced a substantial dose dependent shrinkage of established NB
in preclinical studies. Dose calculations suggested that tumors
that received more than 4,200 rads were completely ablated. Marrow
suppression was the dose limiting toxicity. In patient studies, it
is not trapped nonspecifically by the reticuloendothelial system
and penetrates NBs well (0.04 to 0.11% injected dose/gm)..sup.10,86
Because of the intact blood brain barrier, .sup.131I-3F8 does not
normally localize to brain, spinal cord or penetrate the
surrounding CSF..sup.10,59
[0184] .sup.131I-3F8 is More Sensitive than Conventional
Modalities, Including Metaiodobenzylguanidine (MIBG) in Detecting
NB in Patients.
[0185] The biodistribution of .sup.131I-3F8 was studied in 42
patients (2 mCi per patient) with NB..sup.10 Comparison was made
with .sup.131I-MIBG, .sup.99mTc-MDP (technetium-labeled methylene
diphosphonate) bone scan, as well as CT or MRI. .sup.131I-3F8
detected more abnormal sites (283) than .sup.131I-MIBG (138) or
.sup.99mTc-MDP (69), especially in patients with extensive disease.
In 20 patients with soft tissue tumors demonstrated by CT/MRI,
.sup.131I-3F8 detected the disease in 18 of them. Upon surgical
resection, the two .sup.131I-3F8-imaging-negative tumors revealed
ganglioneuroma, one showing microscopic foci of NB. In contrast,
.sup.131I-3F8-imaging-positive tumors were all confirmed as NBs. In
26 patients with evidence of marrow disease by antibody scans,
14/26 had confirmation by iliac crest marrow aspirate/biopsy
examinations. Agreement between the measured tissue radioactivity
and the estimates based on planar scintigraphy validated the
initial dosimetry calculations. The tumor uptake in patients with
NB was 0.08%-0.1% ID/gm. The calculated radiation dose was 36
rads/mCi delivered to NB and 3-5 rad/mCi to blood.
[0186] .sup.131I-3F8 Differentiated Gliomas from Normal Brain
Tissues..sup.87,88
[0187] In 12 patients with brain tumors, 3F8 immunoscintigraphy was
compared with .sup.99mTc-glucoheptonate/DTPA planar imaging,
Thallium 201 single photon emission tomography (SPECT), and
.sup.18FDG positron emission tomography (PET). 10/11 malignant
gliomas and 1/1 metastatic melanoma showed antibody localization.
No nonspecific uptake in normal brain or CSF was detected. Average
plasma and total body clearance were 20 h and 47 h, respectively.
Antibody localization was measured on surgical specimens and time
activity curves were calculated based on modified conjugate views
or PET. Radioactivity uptake in high grade glioma peaked at 39 h,
which then decayed with a half-life of 62 h. Tumor uptake at time
of surgery averaged 3.5% ID/kg and highest activity by conjugate
view method averaged 9.2% ID/kg (3.5 to 17.8).
[0188] Both Primary and Metastatic Small Cell Lung Cancer were
Detected by .sup.131I-3F8.sup.89
[0189] 10 Patients with SCLC were imaged with .sup.131I-3F8. Five
patients previously treated with chemoradiotherapy were imaged with
2 mCi at the time of recurrence, while 5 patients were studied with
10 mCi/1.73 m.sup.2 at the time of diagnosis. No significant
toxicities were seen. All 10/10 tumors showed localization.
Precision of localization was confirmed by comparing SPECT and CT
in the 5 patients injected with the 10 mCi dose. Average half-lives
for plasma and total body clearance were 15 h and 58 h,
respectively. The tumor to non-tumor ratios appeared favorable
based on the % ID/gm (see below).
TABLE-US-00006 TABLE 3 % ID/kg after .sup.131I-3F8 injection: Day
Small Spinal Large Tumor sampled Heart Bowel Spleen Liver Cord
Bowel Blood Muscle NB 4 1.7 1.7 1.7 2 2.2 2.4 3.1 3.1 SCLC 6 0.4
0.4 0.9 0.4 -- -- -- 0.2 liver Tumor Kidney Lung Bone Ovaries
Adrenal Bladder Stomach Tumor mets NB 3.1 3.6 4 4 5.7 6.7 6.7 40 --
SCLC 0.9 0.5 -- -- 1.6 0.5 -- 2 15
[0190] Myeloablative Doses of .sup.131I-3F8 are Effective for NB
with Minimal Extramedullary Toxicities.
[0191] Based on the tracer dose dosimetry, the absorbed doses to
liver, spleen, red marrow, lung, total body and tumor were 537,
574, 445, 454, 499 and 4926 rads, respectively. The average rad/mCi
were 2.3, 2.5, 2, 2, 1.9, and 13.7, respectively. The chemical
toxicities of the antibody 3F8 have been studied in phase
1.sup.76,77 and phase II studies..sup.11,90 Acute toxicities
included pain, urticaria, fever and hypotension which were
self-limited. The radiological toxicities of .sup.131I-3F8 were
recently defined in a phase I dose escalation study. (6, 8, 12, 16,
20, 24, and 28 mCi/kg)..sup.91 Among 10 patients (pts) with
progressive disease evaluable for response, 2 cleared the marrow
and 2 had partial responses of soft tissue tumors. Average tumor
dose was 150 rad/mCi/kg. Acute toxicities of .sup.131I-3F8
treatment included pain (20/24) during the infusion, fever (20/24)
and mild diarrhea. All pts developed grade 4 myelosuppression.
22/24 pts were rescued with cryopreserved autologous bone marrow;
one patient received GM-CSF; one died of progressive disease before
marrow reinfusion. Hypothyroidism developed in despite thyroid
blockade with oral SSKI plus synthroid or cytomel. In the
subsequent phase II study (N7, IRB94-11, FIG. 4), .sup.131I-3F8 was
used to consolidate >50 patients at the end of induction
chemotherapy for their stage 4 NB diagnosed after 1 year of age.
Except for hypothyroidism, there were no late effects of
.sup.131I-3F8 treatment.
[0192] .sup.124I-3F8 PET Imaging was First Successfully Applied to
NB.sup.92
[0193] Positron Emission Tomography (PET) can offer advantages over
planar or single photon emission computed tomography (SPECT)
imaging in the quantitation of spatial radioactivity distribution
over time. .sup.124I is a positron emitter with a 4-day half-life.
We have studied the quantitative capability of PET imaging with
.sup.124I,.sup.93 and have used it for scanning of
.sup.124I-labeled antibodies in animals and humans..sup.92,94,95
Using a brain PET scanner (PC4600, Cyclotron Corp.), with a
relatively low resolution (FWHM=1.2 cm), we demonstrated that
quantitation of .sup.124I is possible (range examined was 0.4 to 4
uCi/ml). Studies using .sup.124I in a rat tumor (4 gram) measured
with this PET scanner were within 8% of the ex-vivo measurement.
Subsequently, two patients were studied on this scanner using
.sup.124I-labeled 3F8 antibody..sup.88,92 A 3-compartment model was
used to study the kinetics of the antibody to provide an estimate
of the binding potential of 3F8 antibody for glioma. These
quantitative studies have also allowed us to estimate the radiation
dose to the tumor cell nucleus from low energy Auger
electrons..sup.88 More accurate quantitation of .sup.124I is now
possible with the GE body PET scanner with even higher
resolution.
[0194] .sup.131I-3F8 therapy of leptomeningeal cancer.sup.96 While
overt meningeal disease is rapidly fatal, microscopic deposits in
the cranio-spinal axis will spread even if the primary tumor is
eradicated. The potentials of antibody-derived ligands for the
diagnosis and therapy of LM cancer have not been fully explored.
G.sub.D2 is present on a broad spectrum of human tumors including
medulloblastomas, high-grade astrocytomas, PNET, central NBs, small
cell lung cancer, melanoma, sarcomas, leukemia/lymphomas and
peripheral NBs, many of which have LM spread. Clinical trials using
intravenous injections of anti-G.sub.D2 MoAb 3F8 have not
encountered long-term neurotoxicity in patients followed for up to
13 years. Pharmacokinetic studies in rats showed that at least 50%
of intraventricular .sup.131I-3F8 was eliminated by bulk flow. When
human melanoma leptomeningeal xenografts were present, CSF
radioactivity was retained and AUC (area under curve) increased by
1.5 fold. AUC ratios of tumor to CSF, tumor to brain and tumor to
blood were 14, 86, and 64, respectively. These ratios improved to
15, 209 and 97, respectively, if the rats were pretreated with
diuretics. Direct intraventricular administration of 30 mCi of
.sup.131I-3F8 in cynomolgus monkeys did not induce clinical or
histological toxicity. Since G.sub.D2 tissue distribution (CNS and
peripheral) in the cynomolgus monkey is identical to that of human,
the high radiation dose of IT .sup.131I-3F8 (up to 82 Gy) to CSF in
contrast to blood (<2 Gy) may translate into a meaningful
treatment approach. Moreover, serum antibody against the MoAb (AMA)
was 14-22 fold higher than in the CSF, thereby accelerating blood
clearance (reducing blood radiation dose) without affecting CSF
pharmacokinetics.
[0195] Intra-CSF .sup.131I-3F8 Imaged G.sub.D2-Positive LM Cancers
Successfully in Patients.
[0196] The pilot study included 5 patients who had a histologically
confirmed diagnosis of a malignancy expressing G.sub.D2 with LM
disease refractory to conventional therapies or for which no
conventional therapy exists. Ommaya catheter placement, patency and
CSF flow was evaluated by .sup.111In DTPA studies. Five patients
(ages 1-61 years) with leptomeningeal or intraventricular melanoma,
ependymoma, rhabdoid tumor (n=2) and retinoblastoma were evaluated.
Active disease was identified by MR scans in 4 of 5 pts, and by
positive CSF cytology in 2. Doses of 0.7-1.9 mCi of .sup.131I-3F8
were injected by Ommaya catheter. Acute side effects included fever
(n=2), and headache (n=2) both treated with tylenol, and one
episode of vomiting (n=1). One pt had an elevated opening CSF
pressure that remained increased for 36-48 hours post-injection.
There was no appreciable change in WBC, platelet counts, liver or
kidney functions tests or CSF cell counts in all 5 patients.
[0197] The CSF radioactivity biological half-life, distribution of
radioactivity in the craniospinal axis, and dosimetry at plaques of
disease and surrounding normal tissues were determined by
.sup.131I-3F8 Single Photon Emission Tomography (SPECT). Peak CSF
values were achieved generally within the first hour of injection.
The CSF biological half-life was 3-12.9 hours, and was in close
agreement with the SPECT (7.2-13.1 hours). Estimated dose to the
CSF was 14.9-56 cGy/mCi by CSF samples and 15-31 cGy/mCi by SPECT
analysis. Focal areas of tumor uptake were 27-123 cGy/mCi by SPECT
estimates. The radiation dose to the blood was 0.9-1.9 cGy/mCi
based on blood radioactivity measurements. Post-injection
.sup.131I-3F8 SPECT scans showed distribution throughout the
subarachnoid space along the spinal cord down to the level of the
cauda equina by 4 hours, and progressively over the convexity by 24
hours in all patients. Focal .sup.131I-3F8 uptake was demonstrated
in the ventricles, spine and midbrain in 4 patients, corresponding
to disease seen on MR. In the one patient who had no MR evidence of
disease, .sup.131I-3F8 clearance was most rapid (3 hours), with no
focal accumulation observed on SPECT. Four patients with focal
.sup.131I-3F8 uptake received 10 mCi of .sup.131I-3F8 through the
Ommaya reservoir as part of a treatment protocol in a phase I
toxicity study. Except for grade 2 toxicities (fever, headache,
nausea and vomiting, increase in intracranial pressure) and a
breakthrough seizure, there were no adverse side effects during
their initial treatment. One patient had a radiographic and
clinical response. On repeat treatment 2 months later, with the
same dose, a rapid rise of intracranial pressure necessitated a
shunt placement. Although all 4 treated patients progressed, 3 are
still alive (2+, 3+ and 9+ months from treatment).
[0198] Adjuvant Anti-G.sub.D2 Antibody 3F8
[0199] 3F8 (without radioisotope) has also been tested in phase I
and phase II studies..sup.58,76,77 Responses of metastatic NB in
the bone marrow were seen. Another mouse antibody 14.G2a and its
chimeric form 14.18 have also induced marrow remissions in patients
with NB..sup.83 Acute self-limited toxicities of 3F8 treatment were
pain, fever, urticaria, hypertension, anaphylactoid reactions, as
well as decreases in blood counts and serum complement levels, and
in rare patients self-limited neuropathy..sup.71,97-99
[0200] Anti-GD2 Antibody Treatment of MRD in Stage 4 NB Diagnosed
at More than One Year of Age..sup.11
[0201] Thirty-four patients (pts) were treated with 3F8 at the end
of chemotherapy. Most had either bone marrow (31 pts) or distant
bony metastases (29 pts). Thirteen pts were treated at second or
subsequent remission (group I), and 12 pts in this group had a
history of progressive/persistent disease after ABMT; 21 pts (all
on N6 protocol) were treated in first remission following induction
chemotherapy (group II). At the time of 3F8 treatment, all 34
patients had stable or minimal NB. Twenty-three patients were in
CR, 8 in VGPR, 1 PR and 2 with histological evidence of marrow
disease. Since microscopic occult NB could escape detection by
conventional radiographic studies, three additional sensitive
methods were used to document disease prior to 3F8 treatment. They
were 131I-3F8 immunoscintigraphy, marrow immunocytology, and
molecular detection of marrow GAGE by RT-PCR. Fourteen of 34
patients were 131I-3F8 scan-positive prior to 3F8 treatment. Nine
had residual disease in their marrow by immunocytology and 12 had
evidence of marrow disease by RT-PCR. A total of 25/34 patients
were positive for disease by at least one of these three methods.
Thirteen patients are progression-free (40 to 148+ months from the
initiation of 3F8 treatment); one other patient is alive with
disease 61+ months after 3F8 treatment. Both group I and group II
patients achieved long-term progression-free probabilities of 38%.
Among the 20 patients whose disease progressed after 3F8, 3 in
group II had isolated relapse in the CNS, a sanctuary site where
antibody 3F8 could not penetrate.86 Although the majority of
patients were in CR/VGPR by conventional criteria right before 3F8
treatment, 74% had evidence of disease by the more sensitive
methods (immunoscintigraphy with 131I-3F8, bone marrow
immunocytology and RT-PCR). When these tests were repeated
subsequent to 3F8 treatment, 6/9 patients with positive
immunocytology reverted to undetectable. Among the 12 GAGE-positive
patients, 7 became negative for GAGE expression. Six patients had
post-3F8 treatment 131I-3F8 scans and all 6 showed resolution or
improvement.
[0202] Human Anti-Mouse Antibody Response (HAMA) and Patient
Outcome:
[0203] Three patterns of HAMA response were identified. In pattern
I, HAMA was not detectable during the 4-6 month followup period
after first cycle of 3F8, 42% had no HAMA response even after
receiving 2-4 cycles of 3F8 over a 4-25 month period. In pattern
II, HAMA was detected but rapidly became negative during the 4-6
month followup period. In pattern III, HAMA titer was high
(>5000 U/ml) and persistent during the 4-6 month followup
period. When patients developed HAMA (>1000 U/ml) during a
treatment cycle, pain side effects disappeared. In the absence of
HAMA (pattern I) or when HAMA became negative (pattern II),
patients received repeat 3F8 treatments. In the presence of HAMA,
subsequent 3F8 treatments had to be delayed. Thus, patients in
group III did not get repeat 3F8 treatment during the first 4-6
months, and had fewer total-cycles and fewer total-days of 3F8
treatment, while pattern I and II patients were comparable. Kaplan
Meier analysis showed a survival advantage for those with pattern
II HAMA response, i.e. a low self-limiting HAMA response (73% for
pattern II versus 33% for pattern I, and 18% for pattern III). The
probability of survival among patients with pattern II was
significantly better than the pattern I and III patients combined
(p<0.05). For patients progression-free for at least 12 months
after the last cycle of chemotherapy, those receiving four 3F8
cycles had a PFS probability double those receiving less than 4
cycles (p=0.08). When patients with pattern II HAMA response and/or
four cycles of 3F8 were considered as a group (FIG. 4), their
survival was significantly better than the other 20 pts
(p<0.001). We interpret these findings to mean a threshold (four
3F8 cycles, each 10-day cycles) plus a pattern II HAMA response may
be necessary to maintain permanent tumor control.
[0204] Idiotype Network is a Possible Mechanism for Long Term
PFS.
[0205] Since the HAMA response was primarily anti-idiotypic (Ab2),
we postulate that the subsequent induction of an idiotype network
which included anti-anti-idiotypic (Ab3) and anti-G.sub.D2 (Ab3')
responses may be responsible for tumor control in patients. Their
serum HAMA, Ab3, and Ab3' titers prior to, at 6, and at 14 months
after antibody treatment were measured by ELISA. Long term PFS and
survival correlated significantly with Ab3' (anti-G.sub.D2)
response at 6 months, and with Ab3 response at 6 and 14 months.
Non-idiotype antibody responses (anti-mouse-IgG3 or anti-tumor
nuclear HUD antigen) had no apparent impact on PFS or survival. It
appears that the successful induction of an idiotype network in
patients maybe responsible for long term tumor control and
prevention of late relapse among N6 and N7 patients (FIG. 5). Even
among patients treated on N5 (with ABMT, FIG. 5), all of the
survivors of bony and marrow metastases have had imaging studies
with 3F8 and had detectable idiotype network by ELISA.sup.100;
similarly no late relapses were seen. While N5 and N6 groups had no
relapses after .about.3 years from diagnosis or -2 years from 3F8
therapy (including second remission group), among N7 patients, the
relapse curve has leveled off even earlier, around 2 years from
diagnosis.
[0206] Integration of 3F8 Treatment into Multi-Modality Therapy:
N5, N6 and N7 for Stage 4 NB >1 Year of Age:
[0207] From 1987 to 1999, N5, N6 and N7 protocols were designed
sequentially to test the clinical importance of dose intensity,
3F8, and .sup.131I-3F8 in consecutive patients with newly diagnosed
stage 4 NB. Most of them had very high-risk clinical and biologic
markers, almost all were diploid/tetraploid and of unfavorable
histopathology. Except for .sup.131I-3F8 and autologous marrow
transplant (ABMT), chemotherapy and 3F8 are routine outpatient
procedures. Evaluations at sequential endpoints compared favorably
with predictions: primary tumor resectability, overall response,
and progression-free survival (PFS). There were no late relapses
after 3.5 years from diagnosis. For N6 (all survivors past 5 years)
40% are progression-free; for N7, PFS is projected at 55% (p=0.02
when compared to N5). Causes of death included disease progression,
secondary leukemia, and isolated CNS relapse. Although toxicities
included hearing loss and hypothyroidism which required correction,
a curative strategy for stage 4 NB appeared to be within reach.
[0208] Neuroblastoma, 3F8 and GD2 provided us with the proof of
principle that MoAb may have potential in the permanent eradication
of MRD in the curative treatment of solid tumors in the younger
population. Both RIT and idiotype-network induction are possible
with murine MoAb. We therefore undertook an extensive screening of
MoAbs to identify candidates with a broad reactivity with
pediatric/adolescent solid tumors, that may have similar targeting
potential as the antibody 3F8.
[0209] Novel Antigen for MoAb Targeting to Solid Tumors in Children
and Young Adults
[0210] Female BALB/c mice were hyperimmunized with human
neuroblastoma according to previously outlined methods..sup.47
Splenic lymphocytes were fused with SP2/0 mouse myeloma cells line.
Clones were selected for specific binding to neuroblastoma on
ELISA. The 8H9 hybridoma secreting an IgG1 monoclonal antibody was
selected for further characterization after subcloning.
[0211] Normal and Tumor Tissue Reactivity of 8H9 Antibody
[0212] Frozen sections from 315 tumors with histologically
confirmed diagnoses of cancer were analyzed for immunoreactivity
with MoAb 8H9. (Tables 5 and 6) 15 histologically normal human
tissues and 8 normal monkey tissues were also analyzed ( ).
TABLE-US-00007 TABLE 5 Neuroectodermal Tumors No. 8H9 positive % NB
87 84 97 Brain Tumors 1. Glial Tumors Glioblastomas multiforme 17
15 88 Mixed Glioma 4 3 -- Oligodendroglioma 11 4 36 Astrocytoma 8 6
75 Ependymoma 3 2 -- 2. Primitive PNET Medulloblastoma 2 2 -- 3.
Mixed Neuronoglial tumor 2 1 -- 4. Other Schwannoma 3 3 --
Meningioma 2 2 -- Neurofibroma 1 1 Melanoma 16 12 75 Ewing's Family
of tumors 21 21 100 TOTAL 177 156 88
TABLE-US-00008 TABLE 6 Mesenchymal Tumors No. 8H9 Reactive %
Rhabdomyosarcoma 26 25 96 Osteosarcoma 26 25 96 Desmoplastic small
round cell tumor 34 32 94 Malignant fibrous histiocytoma 1 1 --
Synovial sarcoma 2 1 -- Leiomyosarcoma 4 4 -- Undifferentiated
sarcoma 2 2 -- TOTAL 95 90 95
TABLE-US-00009 TABLE 7 CARCINOMAS No. 8H9 Reactive % Breast 12 4 33
Bladder 4 1 -- Adrenal 2 1 -- Stomach 1 1 -- Prostate 2 1 -- Colon
2 1 -- Lung 1 1 -- Endometrium 1 1 -- Cervix 1 0 -- Renal 1 1 --
TOTAL 27 12 44
TABLE-US-00010 TABLE 8 Other Tumors No. 8H9 reactive %
Hepatoblastoma 4 3 -- Wilm's tumor 8 7 -- Rhabdoid tumor 3 3 --
Paraganglioma 1 1 -- TOTAL 16 14 88
[0213] Heterogenous, non-specific cytoplasmic staining was noticed
in normal human pancreas, stomach, liver and adrenal cortex which
was diminished when 8H9 F(ab')2 fragments were used instead of the
whole antibody for immunostaining. None of the other human tissues
showed reactivity with 8H9. In particular normal human brain tissue
sections including frontal lobe, spinal cord, pons and cerebellum
were completely negative. Normal tissues from cynomolgus monkey
also demonstrated similarly restricted reactivity with nonspecific
staining observed in stomach and liver (Table 4). The majority of
neuroectodermal and mesenchymal tumors tested showed positive
reactivity with 8H9, epithelial tumors to a lesser extent. 8H9
immunoreactivity was seen in a characteristic, homogenous, cell
membrane distribution in 272 of the 315 (86%) tumor samples
examined. 88% of neuroectodermal tumors, 95% of mesenchymal tumors
and 44% of epithelial tumors tested positive with 8H9 (Tables
4-8)
TABLE-US-00011 TABLE 4 Tissues Human Cynomolgous Frontal lobe
Negative Negative Pons Negative Negative Spinal cord Negative --
Cerebellum Negative Negative Lung Negative -- Heart Negative
Skeletal muscle Negative -- Thyroid Negative -- Testes Negative --
Pancreas cytoplasmic -- staining Adrenal cortex cytoplasmic
cytoplasmic staining staining Liver cytoplasmic cytoplasmic
staining staining Stomach -- Negative Sigmoid colon Negative --
Bone Marrow Negative -- Kidney Negative Negative
[0214] Indirect Immunofluorescence
[0215] 8H9 immunoreactivity in 34 NB, melanoma, RMS, small cell
lung cancer, OS, glioblastoma, leukemia, breast cancer and colon
cancer cell lines was tested using indirect immunofluorescence.
Moderate to strong cell membrane reactivity with 8H9 was detected
in 16/16 NB, 2/2 melanoma, 2/2 RMS, 1/1 glioblastoma multiforme,
3/3 breast cancer, and 1/1 colon cancer, 2 of 3 Ewing's/PNET, and 2
of the 3 OS cell lines. The small cell lung cancer cell line HTB119
tested negative with 8H9 as did Jurkat T-ALL cell line and EBV
transformed lymphoblastoid cells. Normal human bone marrow
mononuclear cells (n=80) and hepatocytes (n=2) had no reactivity
with 8H9. Hepatocytes were isolated from human cadavers and stained
with 8H9. In contrast to anti-cytokeratin 18 and anti-HLA-class-1
antibodies which reacted strongly with surface antigens, 8H9
staining was equivalent to control antibody.
[0216] Antigen Modulation
[0217] 8H9 binding to neuroblastoma line (NMB7), rhabdomysarcoma
(HTB82) and OS (U2OS) (measured by indirect immunofluorescence) did
not diminish significantly after 48 hr of incubation at 37.degree.
C. During the same period, binding to HLA (MoAb HB95) diminished by
85% and to GD2 (3F8) by 55%, respectively (FIG. 6). Electron
microscopy using gold-labeled antibodies will be more definitive in
tracking antibody internalization, a process clearly important for
immunotoxins to be effective.
[0218] Enzyme-Sensitivity
[0219] There was a pronase dose-dependent reduction in reactivity
with 8H9 with 75-85% loss of immunofluorescence at a final Pronase
concentration of 0.3 mg/ml (FIG. 7). There was no appreciable loss
of reactivity with 3F8 (specific for the ganglioside GD2) on NMB7
cells. Furthermore, the 8H9 antigen was not sensitive to
neuraminidase or phosphatidyl-inositol specific phospholipase C
(data not shown).
[0220] Biochemical Characterization of the Novel Antigen Recognized
by 8H9
[0221] Using a nonradioactive cell surface labeling technique, the
antigen was immunoprecipitated and analyzed on a SDS-PAGE..sup.101
In brief, NB NMB7 or OS U2OS cells were biotinylated using
biotin-LC-NHS, lysed, precleared with protein-G sepharose, reacted
with antibody 8H9 and then immunoprecipitated in fresh protein G
sepharose. Antigen was then dissociated from the gel and separated
by SDS-PAGE. Following transblotting onto nitrocellulose membrane,
the protein bands were detected with HRP-strepavidin and visualized
by ECL. A band of 90 kDa under non-denaturing conditions and 96 kDa
in the presence of 2ME was found.
TABLE-US-00012 TABLE 9 % ID/gm % ID/gm TISSUE NB RMS TISSUE NB RMS
Time 24 h 172 h Time 24 h 172 h Tumor 8.3 5.3 Femur 0.7 0.3 Brain
0.2 0.1 Adrenal 1.0 0.3 Heart 2.1 0.8 Skin 0.2 0.4 Lung 0.8 1.4
Spine 1.7 0.4 Kidney 2.3 0.7 Blood 3.8 3.3 Liver 7.5 0.6 Spleen 6.7
0.6 Bladder 1.0 1.1 Stomach 0.3 0.5 Sm Intestine 0.3 0.3 Lg
Intestine 0.4 0.2 Muscle 0.2 0.2
[0222] Rat Anti-Idiotypic MoAb Specific for 8H9
[0223] By immunofluorescence the antigen was sensitive to low
temperatures. In view of the lability of the antigen, we chose to
synthesize anti-idiotypic antibodies as surrogate antigen-mimics,
in order to allow in vitro monitoring of the antibody
immunoreactivity e.g. after iodination of antibody 8H9. LOU/CN rats
were immunized with protein-G purified 8H9 precipitated with
goat-anti-mouse Ig, emulsified in CFA. Following in vitro
hybridization to the myelomas SP2/0 or 8653, 3 IgG2a clones (2E9,
1E12, and 1F11) were selected for their high binding and
specificity. When tested against a panel of 23 other myelomas or
hybridoma antibodies, no cross-reactivity was found. The
anti-idiotypic hybridomas were cloned and antibodies produced by
high density miniPERM bioreactor from Unisyn Technologies
(Hopkinton, Mass.). The anti-idiotypic antibodies are further
purified by protein G (Pharmacia) affinity chromatography. To
further prove that these anti-idiotypic antibodies are
antigen-mimics, we immuno-enrich phagemids and screen scFv on solid
phase anti-idiotype, and successfully isolate a number of 8H9-scFv
with similar binding specificity to tumors as the parent 8H9 (see
below).
[0224] Tumor Localization in Xenografted SCID Mice
[0225] SCID mice with NB (NB) xenografts were injected iv with 100
ug .sup.99mTc labeled 8H9. Blood clearance was studied by blood cpm
at various intervals after injection. Mice were sacrificed at 24
hours and tissue uptake expressed as percent injected dose per gram
(Table 9). Significant uptake in the reticulo-endothelial system in
liver and spleen was seen only with .sup.99mTc-8H9; none was
evident when .sup.131I-3F8 was used. There was no significant
difference between .sup.99mTc-8H9 and .sup.131I-8H9
biodistribution. When the specific activity of .sup.131I-8H9 was
increased from 5 to >20 mCi/mg, there was no degradation of
tumor imaging or difference in biodistribution. In SCID mice
xenografted with RMS (RMS) xenograft, following iv injection of 100
uCi of .sup.125I-8H9, selective tumor uptake was evident at 4 to
172 hrs after injection, with a blood T of 0.8 h and T of 26 h.
Mean tumor/tissue ratios were optimal at 172 h (for lung 4, kidney
7, liver 9, spleen 10, femur 16, muscle 21, brain 45). Average
tumor/blood ratio were 0.7, 1.4 and 1.6, and tumor uptake was
9.5.+-.3.4, 13.3.+-.1.5, and 5.3.+-.0.9% injected dose per gm at
24, 48 and 172 h, respectively. Control IgG1 MoAb antibody 2C9
remained in the blood pool without localization to sc RMS
xenografts. Tumor to normal tissue ratio was favorable [range 5-55]
for 8H9 (solid bar, FIG. 8) in contrast to control MoAb 2C9.
[0226] 8H9-ScFv
[0227] We have synthesized single chain antibody (scFv) from 8H9.
Using polymerase chain reaction splicing by overlap extension,
variable regions of the heavy (V.sub.H) and light chains (V.sub.L)
of 8H9 were joined by a polylinker (L) (gly4Ser).sub.3 and selected
by phagemid expression. scFv was characterized by DNA sequencing,
western blots, in vitro ELISA, immunostaining/FACS, and idiotype
analysis. Using this scFv as a targeting unit, we are in the
process of synthesizing scFv-h 1-CH2-CH3 chimeric, scFv-m 3-CH2-CH3
chimeric, and T-bodies for retargeting T-cells.
[0228] Cell Populations Using 8H9-Magnetic Bead
Immunoselection.
[0229] ES is a small round blue cell tumor of childhood
characterized by a t(11,22) in most patients. Because survival
remains suboptimal with standard therapy, many patients receive
autologous stem cell transplant and current trials investigating
adoptive transfer of autologous T cells in the context of immune
therapy are underway. However, approximately 50% of patients with
advanced disease have PCR detectable ES in peripheral blood and/or
bone marrow and the administration of autologous cell preparations
contaminated with tumor may contribute to disease relapse. To date,
there is no method reported for purging contaminated hematopoietic
cell populations or bone marrow preparations of ES. Merino et al in
the laboratory of Dr. Mackall at the Pediatric Oncology Branch,
NCI, Bethesda, Md., successfully optimized 8H9 for immunomagnetic
purging of ES. 8H9 bound to 9/9 of ES cell lines by flow cytometry.
Binding to peripheral blood mononuclear T cell and B cell
populations, as well as CD34+ cells from bone marrow was negative.
Utilizing immunomagnetic selection, 8H9 was used to isolate ES
cells from contaminated blood cell populations. Using real-time
quantitative nested PCR with the Lightcycler instrument, purging
efficiency was monitored by of t(11,22) RT-PCR. Contaminated
specimens were reacted with 8H9 and then incubated with rat
anti-mouse IgG1 magnetic beads. The sample was then run over a
Miltenyi Variomax negative selection column. Recovery was
approximately 70% of the total PBMC. RNA was extracted from 10e7
cells from pre and post purge cell populations. Real time
quantitative PCR was performed with a level of sensitivity to one
tumor cell in 10e5 normal cells. A 2-log reduction of tumor cells
was achieved at a contamination of one tumor cell in 10 normal PBMC
and one tumor cell in 10e3 normal PBMC. Further studies evaluating
efficacy in clinical samples are underway. These results
demonstrate a potential new approach for purging contaminated
patient samples to be used in the context of autologous bone marrow
transplant and/or immunotherapy trials for ES.
[0230] 8H9 Purging of NB from Marrow or Blood Cells
[0231] In similar experiments using Dynal beads coated with human
anti-mouse IgG (Dynal, Lake Success, NY).sup.50 EGFP marked NMB7
cells could be quantitatively removed in a one-cycle (either 8H9 or
3F8) or 2-cycle (8H9 followed by 3F8) immunomagnetic strategies
(Table 10).
Research Design and Methods:
[0232] In this grant proposal, we will test if intravenous
injections of iodine-131 labeled murine MoAb 8H9 can detect primary
and metastatic solid tumors. A total of 60 patients will be accrued
over a period of 2 years.
[0233] Specific Aim #1:
[0234] To define the level of agreement between .sup.131I-8H9 and
conventional imaging modalities in the detection of primary and
metastatic solid tumors in pediatrics.
1.1 Study Design
[0235] This is an open-label single arm study of .sup.131I-8H9,
injected intravenously at 10 mCi/1.73 m2 dose, after which patients
will be imaged at approximately day 0 to 1, 2d, 3d and whenever
possible 6 to 7d for dosimetry calculations. Blood samples will
also be obtained at least 12 times over the ensuing 7 days.
Patients are eligible for the protocol prior to their surgical
resection or biopsy of known or suspected tumor, or at the time of
recurrent tumor. .sup.131I-8H9 injection plus imaging can be
repeated in each patient up to a total of 3 times, but only if
he/she has no HAMA and no allergy to mouse proteins as evidenced by
a negative skin test.
1.2 Patient/Subject Inclusion Criteria
Gender and Minority Inclusion for Research Involving Human
Subjects:
[0236] Memorial Sloan Kettering Cancer Center has filed form HHS
441 (Re: Civil Rights), form HHS 641 (Re: Handicapped individuals),
and form 639-A (Re: sex discrimination). In selecting patients for
study in the proposed project, due notice is taken of the NIH
Policy concerning inclusion of women and minorities in clinical
research populations. The study population will be fully
representative of the whole range of patients seen at Memorial
Hospital. No exclusions will be made on the basis of gender or
ethnicity. However, because of the nature of these cancers which
tend to present in children and young adults, most the human
subjects would be of the younger age group.
[0237] Based on a December 1998-November 1999 analysis of the
patient population accrued to therapeutic clinical protocols, the
racial distribution of these patients were 16.6% black, Hispanic,
or Asian, 78.2% white and 5.2% other or unknown. The gender was
55.9% male and 44.1% female. For the total patient population
diagnosed and treated at MSKCC in 1996, 26% were black, Hispanic,
Asian or Native American, 70% white and 6% unknown or not
responding. Of these patients, 38% were male and 62% female.
[0238] Participation of Children:
[0239] Children, adolescents and young adults are the subjects of
this clinical trial because of the nature of these cancers. There
is no age limit.
1.3.0 Evaluation During Treatment/Intervention
[0240] 1.3.1 After injection of radiolabeled antibody, 1-2 cc of
blood in purple tops (EDTA) will be drawn at time 0, and around 15
min, 30 min, 1 h, 2 h, 4 h, 8 h, 18 h, 30 h, 42 h, 66 h, and once
on day 6 or 7. Samples should be dated and timed. These samples are
for pharmacokinetic and for dosimetry studies. Patients with
delayed clearance will have one more imaging done between day 9 to
11.
TABLE-US-00013 Time Procedure day -10 start daily oral SSKI,
cytomel for thyroid blockade day 0 5 mCi of iodine-131 on 0.25 to
0.75 mg of 8H9* blood samples at 0, and approximately 15 min, 30
min, 1 h, 2 h, 4 h, 8 h after injection day 0 Gamma camera scan
plus whole body counts day 1 Gamma camera scan plus whole body
counts day 1 blood samples at approximately 18 h and 30 h day 2
Gamma camera scan plus whole body counts day 2, 3 blood samples at
approximately 42 h and 66 h day 5 (or 6 or 7) Gamma camera scan
plus whole body counts and blood sample day 9 (or 10 or 11) if slow
clearance day 14 Gamma camera scan plus whole body counts and blood
sample Oral SSKI and cytomel discontinued *Premedication with
acetaminophen and diphenhydramine.
1.3.2 Patients Will Undergo Gamma Imaging Days 0, 1, 2 and 5 or 6
or 7 after Injection.
1.3.3 Blood for HAMA q 1-2 Months
1.3.4 Tissue Biopsy is Recommended for Regions of Uptake by 8H9
Imaging and Negative by Conventional Radiographic Techniques.
1.4.0 Biostatistics
[0241] To measure the level of agreement between conventional
imaging modality (CT, MRI, and nuclear scans) and antibody 8H9
imaging in known and occult sites of disease. Index lesions will be
confirmed either by surgery or by disease-specific imaging (e.g.
MIBG for NB). For each individual, the proportion of sites found by
8H9 imaging will be scored. Given that there will be confirmation
by surgery or by disease-specific imaging, sensitivity analysis of
8H9 for each disease can be conducted. The probability of agreement
or positive predictive value will be calculated. The 95% confidence
intervals can be calculated within +/-31% for each disease (NB,
RMS, ES/PNET, DSRT, brain tumors and other sarcomas). The study
will be performed on a total of 60 patients (10 with NB, 10 RMS, 10
osteosacrcoma, 10 ES, 10 DSRT and 10 brain tumors plus other
8H9-positive tumors). Estimates on the level of agreement and the
level of tumor uptake will be computed separately in each disease
group. We are not using Kappa statistics for testing the
association between .sup.124I-3F8 imaging and other imaging
modalities (CT, MRI) since only patients with measurable or
evaluable tumors will be eligible for this protocol. In other
words, patients with no evidence of disease by conventional studies
will be not eligible. Therefore we cannot estimate the probability
of negative 8H9 imaging when conventional imaging studies are
negative, i.e. specificity analysis.
1.5.0 Preparation of .sup.131I-8H9
[0242] 8H9 is produced under GMP conditions and packaged in glass
vials. .sup.131I is purchased from Amersham Inc. 8H9 will be
labeled with radioactive iodine using iodogen T method. The
reaction mixture is filtered through an ion exchange (AG1X8) filter
(Biorad) to remove free iodine. Protein incorporation is measured
using TCA precipitation or thin layer chromatography.
Immunoreactivity is measured by 2 separate methods (1) a solid
phase microtiter radioimmunoassay technique previously
described,.sup.102 and (2) anti-idiotype peak shift method, where
anti-idiotypic antibody 2E9 is added at 50 to 1 molar ratio to
.sup.131I-8H9 for 30 minutes on ice with mixing. The percent cpm
shifted on HPLC is a measure of immunoreactivity. Radioiodinated
8H9 has a mean trichloroacetic acid precipitability of >90%, and
specific activity of .sup.131I-8H9 averaging 10 mCi per mg protein.
Administration of .sup.131I-8H9 is undertaken within 1-2 hours of
iodination to reduce the possibility of radiolysis. Antibody
radiolabeling is carried out in the Central Isotope Laboratory
under the supervision of Dr. Ronald Finn, according to FDA
guidelines on radiolabeled biologics for human use.
1.6.0 Infusion of Radiolabeled Antibody Preparation and Monitoring
of Patient Response in Immediate Post-Infusion Period, Including
Radiation Safety Aftercare.
[0243] All radiolabeled MoAb preparations will be injected into
patients by a trained research nurse or physician. Strict
observance of appropriate radiation safety guidelines will be
undertaken. The procedure will be explained to the patient
thoroughly prior to the infusion by the physician, and appropriate
pre-treatment (eg SSKI drops, perchloracap) checked. The
radiolabeled antibody will be transported from the radiolabeling
facility to the infusion area loaded into the infusion delivery
system by the physician. The physician and nurse will be present
throughout the infusion and in the post-infusion period.
[0244] The infusion procedure will consist of the radiolabeled
antibody being administered intravenously either through a
peripheral intravenous catheter or an indwelling central catheter
over a 20 minute period. All patients will have vital signs
monitored prior to and following the radiolabeled antibody
infusion. Blood samples for pharmacokinetic calculation will be
obtained immediately following the infusion, and at various time
points thereafter as outlined above. The patient will be seen by a
physician daily while hospitalized, and will be available for
consultation (with appropriate radiation safety personnel) with an
oncologist or nurse regarding issues relating to the radiolabeled
antibody infusion or radiation safety. The patient will also be
imaged in the Nuclear Medicine Department over the subsequent two
week period, and all imaging procedures performed will be
supervised by the physician to ensure that appropriate studies are
obtained.
1.7.0 In Vitro Radioimmunoassay, ELISA, and Immunostaining
[0245] Quantitative in vitro assays on biologic fluids collected
during the course of clinical research studies in individual
patients that employ radiolabeled antibodies will be carried out.
The methods provided will include gamma counting of blood samples
and HAMA assays. HAMA titer in blood and serum will be correlated
with the clearance of .sup.131I-8H9
1.7.1 General Counting Procedures
[0246] Aliquots of whole blood/plasma/serum obtained from patients
infused with radiolabeled antibodies will be counted in a gamma
counter with standards of known activity for determination of
sample activity. Tissue samples obtained by biopsy or surgery will
also be counted in a gamma counter for determination of % injected
dose/gram tissue. Appropriate quality control procedures will be
observed for counting instruments and tissue specimens.
1.7.2 Quantitation of HAMA by ELISA
[0247] The presence of HAMA can modify the biodistribution of
.sup.131I-8H9. Although in naive patients HAMA is typically
undetectable, in patients with prior history of exposure to murine
antibodies or to 8H9, the presence of HAMA before and soon after
8H9 injection will need to be monitored. In addition, the formation
of HAMA was highly correlated with patient survival in the GD2-3F8
system, we plan to measure the serum antibody titer 6 months and 12
months after 8H9 exposure. The ELISA method has been described
previously..sup.11 Using F(ab')2 fragments derived from the three
anti-idiotypic antibodies (2E9, 1E12, and 1F11), serum Ab3 will
also be monitored as previously demonstrated for the GD2-3F8
system..sup.103,104
1.7.3 Quantitation of Free Circulating Antigen
[0248] Since the biodistribution of 8H9 will be greatly affected by
any soluble antigen, patient sera before antibody injection will be
analyzed for antigenemia using an ELISA inhibition assay using a
modification of previously described method..sup.105 Microtiter
wells are coated with anti-idiotype MoAb 2E9. Serial serum
dilutions are used to inhibit the binding of biotinylated 8H9,
which can be detected by peroxidase-streptavidin. Upon washing,
color reaction is performed at room temperature using hydrogen
peroxide as substrate and o-phenylenediamine (Sigma, St. Louis,
Mo.) as chromogen. After stopping the reaction with 30 ul of 5N
sulfuric acid, optical density of the wells are then read using MRX
microplate reader (Dynex, Chantilly, Va.) and antibody titer
calculated in units/ml.
1.7.4 Immunostaining of Tumor Tissues
[0249] Tumor tissues will be tested for antigen expression using
methods previously described..sup.74
[0250] Anticipated Results and Potential Pitfalls
[0251] The injection of .sup.131I-8H9 intravenously or
intrathecally into cynomolgus monkeys were well tolerated. Although
we do not anticipate any untoward side effects, patients will be
closely monitored during the antibody infusion with oxygen,
antihistamines, epinephrine, and hydrocortisone at the bed side.
After the completion of antibody injection, patients will be
observed for at least 1 hour before discharge from the clinic.
Patients with unexpected grade 3-4 (other than urticaria,
self-limited blood pressure/pulse/temperature changes) or any
life-threatening toxicity will be reported immediately to the IRB
and FDA. Given the lability of the antigen in the cold (whether
free or cell-bound), immunoreactivity and soluble tumor antigen
will be assayed using the anti-idiotype as the antigen-mimic. The
anti-idiotypic antibodies are rat IgG1 MoAb purified by acid
elution from protein G affinity columns. They have remained stable
despite acid treatment, buffer changes and freezing and thawing.
Soluble antigens can interfere with tumor targeting. In vitro,
patient serum did not inhibit binding of 8H9 to its anti-idiotype.
Indirect immunofluorescence of a spectrum of cell lines showed
persistence of antigen and antibody on the cell surface at
37.degree. C. over days. In xenograft biodistribution studies,
there was no evidence of antigen shedding that interferes with
tumor imaging. Although interference of 8H9 biodistribution by
soluble antigen is unlikely, we will document the absence by the
ELISA inhibition assay. HAMA response within the first two weeks
after MoAb injection is rarely observed among our patient
population, partly because of the intensity of the chemotherapy
they received. However, some are expected to mount a HAMA response
when they are imaged a second time. Clearly their HAMA will be
monitored before and after injection in order to interpret the
biodistribution results. Because of this sensitization, these
patients may not be eligible for subsequent MoAb therapies (as
stated in the consent form). However, we hypothesize that this HAMA
response will help induce the idiotype network, which may have
benefit on patient survival, analogous to our success with the
murine 3F8-GD2 system we described in preliminary results and
progress report.
[0252] Interpretations and Implications
[0253] The ability of 8H9 to detect a broad class of primary and
metastatic solid tumors will be the first step in defining the
clinical utility of MoAb 8H9 in vivo. Besides being a useful
diagnostic tool, its therapeutic potential will need to be
explored. Clearly the amount of antibody deposited in various
organs need to be taken into account if these antibodies are used
to deliver radioisotopes, enzymes or drugs. Chimeric antibodies
with improved Fc effector functions and reduced immunogenicity will
also be explored. Immunocytokines and T-bodies are also potential
steps in future development of these agents.
[0254] Specific Aim #2:
[0255] To Estimate the radiation dose per mCi of .sup.131I-8H9
delivered to tumors and to normal organs in patients.
[0256] To obtain data necessary for patient dosimetry, patients
will be injected, intravenously, with .sup.131I-8H9 according to
their surface area, i.e. 10 mCi/1.73m2. A total of three or four
gamma camera images will be obtained within a 1 to 2 week period
following injection. The following schedule is recommended but may
be altered, if necessary: 1-4 h after injection (day 0) and then
again on days 2, day 3, and day 6 or 7. If warranted, due to slow
clearance kinetics, imaging on days 9, 10 or 11 may also be
performed. Using this schedule weekend imaging may be avoided
regardless of the weekday injected. Scan types and imaging
parameters are listed below:
2.1 Data Collection:
[0257] SPOT and SPECT images will be collected over pre-selected
"index" tumor lesions, as identified from previously obtained CT or
MR images.
2.1.1 Blood Collection
[0258] Blood samples will be collected as follows: prior to
injection, and at 0, 15, 30 min, then 1 h, 2 h, 4 h, 8 h, 18 h or
30 h, 42 h, 66 h, day 6 or 7 following the injection. Plasma or
serum will be collected and counted from each sample and the
results will be expressed as percent of the injected radioactivity
per L serum or blood volume.
TABLE-US-00014 static spot view (SPOT) HEHR collimation 10 to 20
min acquisition time dual-window acquisition for scatter correction
128 .times. 128 .times. 16 matrix size SPECT HEHR collimation 6
degrees or 64 views in stop and shoot, elliptical orbit mode 1 to 4
min/view (0.5 to 2 h acquisition time on a dual-headed camera)
dual-window acquisition for scatter correction 64 .times. 64
.times. 16 matrix size whole-body sweep (SWEEP) high-energy,
high-resolution (HEHR) collimation, 8 to 12 cm/min sweep speed (20
to 25 min acquisition time) dual-window acquisition for scatter
correction 256 .times. 1024 .times. 16 matrix size Imaging
schedule: Imaging day SWEEP SPOT SPECT 0 X X 1, 2 X X X 5, 6 or 7 X
X 9, 10, or 11 X X
2.1.2 Pharmacokinetics Modeling
[0259] Blood time-activity curves from serial blood samples and
from ROI's around sequential SPECT images of the heart (when
available). This data will be fitted, together with the whole-body
clearance kinetics, to a pharmacokinetic model of antibody
distribution. Previously developed models have been used for this
type of analysis, further details regarding the approach have been
published..sup.106
2.1.3 Patient-Specific Dosimetry (3D-ID)
[0260] The pharmacokinetic data obtained from SPECT and planar
imaging and blood sampling will be combined with anatomical imaging
information (MR or CT) to estimate the absorbed dose to tumor and
selected normal organs that would be expected from a therapeutic
injection of .sup.131I-8H9. The methodology for this has been
previously described. .sup.107-115
2.2 Tumor Volume Determinations
[0261] Tumor volumes will be determined from CT or MRI when
available. Patients with known disease at other sites are imaged in
additional areas. All CT images will be transferred for display in
3D-ID; images collected at MSKCC will be transferred digitally,
film from other institutions will be scanned using a Lumisys
digital film scanner. Using 3D-ID, the consulting radiologist will
review the images with the research technician. The research
technician will then draw contours around the tumor regions; the
contours will be reviewed by the consulting radiologist and
adjusted, as needed. In some cases, disease may be represented by a
collection of very small positive nodes; in those cases a contour
around the group will be drawn and used in the volume assessment.
Volume determination using 3D-ID is performed by summing the areas
of regions that have been defined by the user on all slices making
up the tumor. This general approach has been previously validated
for CT. Although potentially labor-intensive, such a tumor
outline-specific method is significantly more accurate than
techniques based upon greater and minor diameters (i.e.,
ellipsoidal models)). The errors associated with CT-based volume
estimation and the factors influencing these errors have been
examined and will be considered in the volume determinations
described above. A reliable total-body tumor burden will not be
achievable for all patients, either because of the small volume of
disease, or for cases in which lesions detected by SPECT are not
visible by CT.
2.3 Red Marrow Dosimetry
[0262] Bone marrow dosimetry will be performed according to the
recommended guidelines, described in the AAPM
recommendations,.sup.116 i.e. blood time-activity curves will be
multiplied by the appropriate factor (0.2-0.4) to derive marrow
time-activity curves and absorbed dose to red marrow. S-Factors
provided in MIRDOSE 3 will be used for the calculations. This data
will be compared with direct measurement of the marrow activity
from ROI's drawn over marrow cavities on SPECT images. The
quantitative capability of SPECT will allow us to verify the
accuracy of bone marrow dosimetry determined from activity levels,
and the rate of antibody clearance from marrow, from the standard
analysis of serial blood samples.
2.4 Three-Dimensional Dosimetry
[0263] To perform 3D dosimetry, it is first necessary to register a
set of nuclear medicine images (SPECT), depicting the radiolabeled
antibody distribution to an anatomical imaging modality (CT or
MRI). We have extensive experience with the clinical implementation
of the Pelizzari and Chen method..sup.117 This technique requires
that the user delineate the same surface on both sets of imaging
modalities. When necessary, a SPECT transmission study is performed
to obtain the appropriate surface. The program attempts to maximize
the correlation of a set of several hundred points on the surface
as identified on one scan (the "hat"), with a solid model of the
same surface derived from the other scan (the "head"). A non-linear
least-squares search is used to minimize the sum of the squares of
distances from each "hat" point to the nearest point on the "head"
surface. The coordinates of the "hat" are translated, rotated and
scaled to provide the best fit. Users may control which parameters
are varied during the search. The final set of transformations are
then used to convert the coordinates of one image into those of the
other. Phantom studies indicate that the Pelizzari and Chen
technique for registration of SPECT to CT is accurate to within 3
mm. The Nuclear Medicine Service at MSKCC has performed such
registration for over 100 patient studies. The Pellizari and Chen
package has also been used for thoracic and abdominal study
registration by Chen and his collaborators at the University of
Chicago (personal communication). Both the Chicago group and us
have also included contours for liver and/or spleen along with the
body contours. This further improves registration by providing more
contours for the minimization algorithm. In some cases, a
radioactive band has also been used as an aid to
registration..sup.117 We are currently comparing this method with
alternative algorithms for image registration for the whole
images..sup.117-120
[0264] Correlated serial SPECT images can be used to determine
cumulative activity distributions by fitting and integrating an
exponential uptake and/or clearance to the specific activity within
an ROI over the tumor or organ. The variation in activity within
individual voxels can be taken into account, through a weighted sum
of the counts/activity within the corresponding voxel over time.
Given such a distribution of the cumulated activity, a software
package, 3D-ID, has been developed, to calculate the dose
distribution. Target contours are drawn on side-by-side enlarged
SPECT and CT/MR image slices that are selected from a scrollable
image display. Contours drawn in one modality simultaneously appear
in the other. The user may switch between modalities by positioning
the cursor in the appropriate window. This provides for the
simultaneous use of both imaging modalities to define tumor (e.g.
using SPECT) and normal organ (using CT/MR) contours. The dose to
all voxels within the target volume is obtained by convolving the
activity distribution with a point kernel table of absorbed dose
versus distance. Patient-specific S-factors may be calculated by
defining source organ contours and assigning unit activity to all
voxels within each source. The "dose" to a given target is thus the
patient-specific S-factor. Dose histograms and patient-specific
organ and tumor S-factors generated using 3D-ID in combination with
SPECT will provide important information in understanding tumor
response and organ toxicity in radioimmunotherapy.
[0265] Photon dose kernels for 14 radionuclides of interest in
internal emitter therapy have been recently published..sup.112.
Explicit expressions of radionuclide photon dose kernels, necessary
for three-dimensional dosimetry, were not previously available. We
recently described the overall structure and methodologies of a
software package for three-dimensional internal dosimetry (3D-ID)
calculations..sup.107,113 A series of software modules that address
the logistical issues of performing patient-specific
three-dimensional dosimetry were detailed. Software tools have been
developed to combine images from different modalities, define
regions-of-interest using available multi-modality data and
identify source and target volumes for dosimetry. A point-kernel
based dosimetry calculation has been implemented and several
different approaches for displaying the spatial distribution of
absorbed dose in a biologically pertinent manner were also
described. The dose calculation, itself, was carried out in a
separate module, so that different calculation schemes including
Monte Carlo, may be used with 3D-ID.
2.5 Anticipated Results and Pitfalls
[0266] The major sources of error in carrying out absorbed dose
calculations are: 1. Inaccuracies in imaging-derived activity
concentration estimates. 2. Mismatch between standard anatomy (used
for dosimetry calculations) and individual patient anatomy. 3.
Assumption of uniformity in the spatial distribution of
radioactivity on both a micro (mm to mm) and macro (cm) scale. When
applying conventional (MIRD Committee) approaches to estimating
absorbed dose it is understood that the estimate is derived from a
model which includes a certain number of assumptions. This approach
has been sufficient in estimating doses for diagnostic applications
wherein typical doses are already far below toxicity. An objective
of radioimmunotherapy, however, is to treat to normal organ
tolerance. In such a scenario, accurate, patient-specific dosimetry
is critical. The dosimetry methodologies that will be used in this
proposal address point 2 and a portion of point 3; dose
calculations are performed for individual patient geometries and
the spatial distribution of radioactivity in tumor or normal organs
is accounted for on a macroscopic (cm) scale. In the past using
planar imaging kinetics to project the kinetics of the spatial
distribution had additional pitfalls. Although SPECT-based activity
determinations are a step forward, we expect these inaccuracies in
imaging derived activity to be further reduced when I-124-8H9
Postron emission tomography is used. This is an area of active
development at Memorial Sloan Kettering in the last
decade..sup.121
[0267] Conventional dosimetry yields estimates of the absorbed
dose, averaged over a normal organ or tumor volume. The methodology
implemented in this proposal will yield the spatial distribution of
absorbed dose as isodose contours, overlayed upon a 3-D CT image
set. This makes it possible to evaluate the anatomical distribution
of absorbed dose to tissues and from this, assess the potential
impact in terms of toxicity. For example, the dose to surrounding
tissue from activity that has concentrated in a tumor contained
within a normal organ can be obtained by this means.
2.6 Interpretations and Implications
[0268] The average absorbed dose to a tumor may not reflect
potential therapeutic efficacy and tumor shrinkage. That portion of
a tumor volume receiving the lowest absorbed dose will lead to
treatment failure regardless of the dose delivered to other regions
of the tumor volume. The 3D-ID software package provides detailed
information regarding the spatial distribution of absorbed dose
within a target volume. This information is depicted as dose-volume
histograms, wherein the fraction of tumor volume receiving a
particular absorbed dose is plotted against absorbed dose. Using
such information it will be possible to better assess the
likelihood of tumor control. For example, if the average dose over
a tumor volume is 2 to 3 Gy and a small region within this volume
receives only 0.1 Gy, then treatment will be unsuccessful.
E. Human Subjects:
[0269] 1. Tumor specimens, bone marrow samples, and blood from
patients will be collected according to the treatment plan.
Patients received .sup.131I-8H9 according to the IRB protocol.
[0270] 2. The risks to the subjects are acceptable in relation to
the anticipated benefits to the subjects and in relation to the
importance of knowledge expected to be gained. The proposed
research project will involve the use of human subjects. The sera
samples obtained from patients are <5% blood volume, and only
after informed consent under the guidelines of Memorial
Sloan-Kettering Cancer Center IRB approved protocols. Risks to the
participants are the minimal risk associated with venipuncture
and/or lumbar puncture. For most of the participants in the study
they have indwelling central catheters as required by their
chemotherapy treatment and parenteral nutrition. Blood drawing will
be performed painlessly through venous catheters. The
confidentiality of all participants will be protected by the use of
code numbers.
[0271] 3. Patients will be primarily children, adolescents and
young adults because of the nature of these tumors. Patients of
both sexes and all ethnic background are eligible for this study.
However, the ethnic mix among patients treated at MSKCC is
dependent on the referral pattern in the greater metropolitan
area.
[0272] 4. This is a pilot imaging study in human patients with a
rationale built on encouraging preclinical studies. Human subjects
are required because the MoAb 8H9 targets to this class of
cancers.
[0273] 5. This protocol is an initial IND-filing study. Date of IND
submission is expected to be April 2000.
[0274] 6. Protocol: Tumor detection using 131-I labeled monoclonal
Antibody 8H9
REFERENCES
[0275] 1. DiMaggio J J, Scheinberg D A, Houghton A N: Monoclonal
antibody therapy of cancer. In: Pinedo H M, Chabner B A, Longo D L,
(eds.): Cancer Chemotherapy and Biological Response Modifiers,
Annual 11, Elsevier Science Publishers B.V., (Biomedical Division),
1990, pp 177-203 [0276] 2. Schlom J: Monoclonal Antibodies in
cancer therapy: Basic principles. In: DeVita V T, Hellman S,
Rosenberg S A, (eds.): Biologic therapy of cancer, 2nd ed.
Philadelphia, J.B.Lippincott Co, 1995, pp 507-520 [0277] 3. Koehler
G, Milstein C: Continuous culture of fused cells secreting antibody
of pre-defined specificity. Nature 256:495-496, 1975 [0278] 4.
Moffat R, Pinsky C M, Hammershaimb L, et al: Clinical utility of
external immunoscintigraphy with the IMMU-4 technetium-99m Fab'
antibody fragment in patients undergoing surgery for carcinoma of
the colon and rectum:results of a pivotal, phase III trial. The
Immunomedics Study Group. J Clin Oncol 14(8):2295-2305, 1996 [0279]
5. Maloney D G, Grillo-Lopez A J, Bodkin D J, et al: IDEC-C2B8:
Results of a phase I multiple-dose trial in patients with relapsed
non-hodgkin's lymphoma. J Clin Oncol 15:3266-3274, 1997 [0280] 6.
Cobleigh M A, Vogel C L, Tripathy D, et al: Multinational study of
the efficacy and safety of humanized anti-HER2 monoclonal antibody
in women who have HER2-overexpressing metastatic breast cancer that
has progressed after chemotherapy for metastatic disease. J Clin
Oncol 17:2639-2648, 1999 [0281] 7. Bigner D D, Brown M T, Friedman
A H: Iodine-131-labeled antitenascin monoclonal antibody 81C6
treatment of patients with recurrent malignant gliomas:phase I
trial results. Journal Clincal Oncology 16:2202-2212, 1998 [0282]
8. Jurcic J G, Caron P C, Miller W H: Sequential targeted therapy
for acute promyelocytic leukemia with all-trans retinoic acid and
anti-CD33 monoclonal antibody M195. Leuk 9:244-248, 1995 [0283] 9.
Meredith R F, Khazaeli M B, Plott W E: Phase II study of dual
131I-labeled monoclonal antibody therapy with interferon in
patients with metastatic colorectal cancer. Clin Can Res
2:1811-1818, 1996 [0284] 10. Yeh S D, Larson S M, Burch L, et al:
Radioimmunodetection of neuroblastoma with iodine-131-3F8:
Correlation with biopsy, iodine-131-Metaiodobenzylguanidine (MIBG)
and standard diagnostic modalities. J Nucl Med 32:769-776, 1991
[0285] 11. Cheung N K V, Kushner B H, Cheung I Y, et al: Anti-GD2
antibody treatment of minimal residual stage 4 neuroblastoma
diagnosed at more than 1 year of age. J Clin Oncol 16:3053-3060,
1998 [0286] 12. Wheldon T E, O'Donoghue J A, Barrett A, Michalowski
A S: The curability of tumors of differing size by targeted
radiotherapy using 131-I or 90-Y. Radiother Oncol 21:91-99, 1991
[0287] 13. Wilder R B, DeNardo G L, DeNardo S J:
Radioimmunotherapy: recent results and future directions. J Clin
Oncol 14:1383-1400, 1996 [0288] 14. Zalutsky M R, McLendon R E,
Garg P K, et al: Radioimmunotherapy of neoplastic meningitis in
rats using an alpha-particle-emitting immunoconjugate. Cancer Res
54:4719-4725, 1994 [0289] 15. McDevitt M R, Sgouros G, Finn R D, et
al: Radioimmunotherapy with alpha-emitting nuclides. Eur J Nucl Med
25:1341-1351, 1998 [0290] 16. Lode H N, Xiang R, Becker J C, et al:
Immunocytokines: A promising approach to cancer immunotherapy.
Pharmacology Therapeutics 80:277-292, 1998 [0291] 17. DeNardo S J,
DeNardo G L, DeNardo D G, et al: Antibody phage libraries for the
next generation of tumor targeting radioimmunotherapeutics. Clin
Can Res 5:3213s-3218s, 1999 [0292] 18. DeNardo S J, DeNardo G L,
Brush J, Carter P: Phage Library-derived human anti-TETA anti
anti-DOTA ScFv for pretargeting RIT. Hybridoma 18:13-21, 1999
[0293] 19. Eshhar Z, Waks T, Gross G, Schindler D G: Specific
activation and targeting of cytotoxic lymphocytes through chimeric
single chains consisting of antibody-binding domains and the or
zeta subunits of the immunoglobulin and T-cell receptors. Proc Natl
Acad Sci USA 90:720-24, 1993 [0294] 20. Altenschmidt U, Kahl R,
Moritz D, et al: Cytolysis of tumor cells expressing the
Neu/erbB-2, erbB-3, and erbB-4 receptors by genetically targeted
naive T lymphocytes. Clin Can Res 2:1001-1008, 1996 [0295] 21.
Krause A, Guo H F, Tan C, et al: Antigen-dependent CD-28 signaling
enhances survival and proliferation in genetically modified
activated human primary T lymphocytes. J Exp Med 188:619-626, 1998
[0296] 22. Garin-Chesa P, Fellinger E J, Huvos A G:
Immunohistochemical analysis of neural cell adhesion molecules. Am
J Pathol 139:275-286, 1991 [0297] 23. Ritter G, Livingston P O:
Ganglioside antigens expressed by human cancer cells. Semin Cancer
Biol 2:401-409, 1991 [0298] 24. Wikstrand C J, Longee D C, McLendon
R E, et al: Lactotetraose series ganglioside 3',6'-isoLDi in tumors
of central nervous and other systems in vitro and in vivo. Cancer
Res 53:120-126, 1993 [0299] 25. Seeger R C, Danon Y L, Rayner S A,
Hoover F: Definition of a Thy-1 determinant on human neuroblastoma,
glioma, sarcoma, and teratoma cells with a monoclonal antibody. J
Immunol 128:983-989, 1982 [0300] 26. Ylagan, Quinn L R: B: CD44
expression in astrocytic tumors. Modern Pathology 10:1239-1246,
1997 [0301] 27. Kaaijp P, Troost D, Morsink F, et al: Expression of
CD44 splice variants in human primary brain tumors. Journal of
Neuro-Oncology 26:185-190, 1995 [0302] 28. Richardson R B, Davies A
G, Bourne S P, et al: Radioimmunolocalization of human brain
tumors. Biodistribution of radiolabelled monoclonal antibody UJ13A.
Eur J Nucl Med 12:313-320, 1986 [0303] 29. Papanastassiou V, Pizer
B L, Coakham H B, et al: Treatment of recurrent and cystic
malignant gliomas by a single intracavitary injection of
131I-monoclonal antibody: Feasibility, pharmacokinetics and
dosimetry. Br J Cancer 67:144-151, 1993 [0304] 30. Kishima H,
Shimizu K, Tamura K, et al: Monoclonal antibody ONS-21 recognizes
integrin a3 in gliomas and gliomas and medulloblastomas. Br J
Cancer 79:333-339, 1998 [0305] 31. Moriuchi S, Shimuzu K, Miyao Y,
Hayakawa T: Characterization of a new mouse monoclonal antibody
(ONS-M21) reactive with both medulloblastomas and gliomas. Br J
Cancer 68:831-837, 1993 [0306] 32. Erikson H P, Lighter V A:
Hexabrachion protein (tenascin, cytotactin, brachionectin) in
connective tissues, embryonic tissues and tumors. Adv Cell Biol
2:55-90, 1988 [0307] 33. Riva P, Frnceschi G, Frattarelli M, et al:
131I radioconjugated antibodies for the locoregional
radioimmunotherapy of high-grade malignant glioma-phase I and II
study. [0308] Acta Oncol 38:351-359, 1999 [0309] 34. Kuan C T,
Reist C J, Foulon C F, et al: 125I-labeled anti-epidermal growth
factor receptor vIII single-chain Fv exhibits specific and
high-level targeting of glioma xenografts. Clin Can Res
5:1539-1549, 1999 [0310] 35. Wikstrand C J, Hale L P, Batra S K, et
al: Monoclonal Antibodies against EGFRvIII are Tumor Specific and
React with Breast and Lung Carcinomas and Malignant Gliomas. Cancer
Res 55:3140-48, 1995 [0311] 36. Kondo S, Miyatake S, Iwasaki K, et
al: Human glioma-specific antigens detected by monoclonal
antibodies. Neurosurgery 30:506-511, 1992 [0312] 37. Dastidar S G,
Sharma S K: Monoclonal antibody against human glioblastoma
multiforme (U-87Mg) immunoprecipitates a protein of monoclonal mass
38 KDa and inhibits tumor growth in nude mice. J Neuroimmuno
56:91-98, 1995 [0313] 38. Mihara Y, Matsukado Y, Goto S, et al:
Monoclonal antibody against ependymoma-derived cell line. Journal
of Neuro-Oncology 12:1-11, 1992 [0314] 39. Wang N P, Marx J, McNutt
M A: Expression of myogenic regulatory proteins(myogenin and MyoD1)
in small blue round cell tumors of childhood. Am J Pathol
147:1799-1810, 1995 [0315] 40. Weidner N, Tjoe J:
Immunohistochemical profile of monoclonal antibody 013 that
recognizes glycoprotein 930/32MIC2 and is useful in diagnosing
ewing's sarcoma and peripheral neuroepithelioma. American Journal
of Surgical Pathology 18:486494, 1994 [0316] 41. Wedner N, Tjoe J:
Immunohistochemical profile of monoclonal antibody 013 that
recognizes glycoprotein 930/32MIC2 and is useful in diagnosing
ewing's sarcoma and peripheral neuroepithelioma. Am J Pathol
18:486-494, 1994 [0317] 42. Heiner J, Miraldi F D, Kallick S, et
al: In vivo targeting of GD2 specific monoclonal antibody in human
osteogenic sarcoma xenografts. Cancer Res 47:5377-5381, 1987 [0318]
43. Price M R, Campbell D G, Robyn R A: Characteristics of the cell
surface antigen p72, associated with a variety of human tumors and
mitogen-stimulated T-lymnphoblasts. FEBS Letters 171:31-35, 1984
[0319] 44. Spendlove I, James L L, Carmichael J, Durrant L G: Decay
accelerating factor (CD55): a target for cancer vaccines? Cancer
Res 59:2282-2286, 1999 [0320] 45. Gorlick R, Huvos A G, Heller G,
et al: Expression of HER2/erbB-2 correlates with survival in
osteosarcoma. J Clin Oncol 17:2781-2788, 1999 [0321] 46. Bruland O,
Fodstad O, Funderud S, Pihl A: New monoclonal antibodies specific
for human sarcomas. Int J Cancer 15:27-31, 1986 [0322] 47. Cheung N
K, Saarinen U M, Neely J E, et al: Monoclonal antibodies to a
glycolipid antigen on human neuroblastoma cells. Cancer Res
45:2642-2649, 1985 [0323] 48. Modak S, Gultekin S H, Kramer K, et
al: Novel tumor-associated surface antigen: broad distribution
among neuroectodermal, mesenchymal and epithelial tumors, with
restricted distribution in normal tissues. Proceedings of ASCO
17:449a, 1998 [0324] 49. Cheung N K, Heller G, Kushner B H, et al:
Detection of metastatic neuroblastoma in bone marrow: when is
routine marrow histology insensitive? J Clin Oncol 15:2807-2817,
1997 [0325] 50. Ghossein R A, Osman I, Bhattacharya S, et al:
Detection of circulating prostatic tumor cells using immunobead
reverse transcriptase polymerase chain reaction for prostatic
specific membrane antigen mRNA. Diag Mol Path 8:59-65, 1999 [0326]
51. Leung W, Chen A R, Klann R C, et al: Frequent detection of
tumor cells in hematopoietic grafts in neuroblastoma and ewing's
sarcoma. Bone Marrow Transpl 22:971-979, 1998 [0327] 52. Mueller B
M, Romerdahl C A, Gillies S D, Reisfeld R A: Enhancement of
antibody-dependent cytotoxicity with a chimeric anti-GD2 antibody.
J Immunol 144:1382-1386, 1990 [0328] 53. Santos A D, Kashmiri V S,
Horan P H, et al: Generation and characterization of a single
gene-encoded single-chain-tetravalent antitumor antibody. Clin Can
Res 5:3118s-3123s, 1999 [0329] 54. Guo H F, Rivlin K, Dubel S,
Cheung N K V: Recombinant anti-ganglioside GD2 scFv-streptavidin
fusion protein for tumor pretargeting. Proc Am Assoc Cancer Res
37:469, 1996 (abstract) [0330] 55. Fagnou C, Michon J, Peter M, et
al: Presence of tumor cells in bone marrow but not in blood is
associated with adverse prognosis in patients with ewing's tumor. J
Clin Oncol 16:1707-1711, 1998 [0331] 56. Cheung N K, Kushner B H,
LaQuaglia M, Lindsley K: Treatment of advanced stage neuroblastoma.
In: Reghavan D, Scher H I, Leibel S A, Lange P, (eds.): Principles
and Practice of Genitourinary Oncology. Philadelphia, J.B.
Lippincott Company, 1997, pp 1101-1111 [0332] 57. Brodeur G M,
Castleberry R P: Neuroblastoma. In: Pizzo P A, Poplack D G, (eds.):
Principles and Practice of Pediatric Oncology, 3rd ed.
Philadelphia, J.B. Lippincott Company, 1997, pp 761-797 chapter 29
[0333] 58. Cheung N K V: Biological and molecular approaches to
diagnosis and treatment. section I. Principles of Immunotherapy.
In: Pizzo P A, Poplack D G, (eds.): Principles and Practice of
Pediatric Oncology, 3rd ed. ed. Philadelphia, J.B. Lippincott
Company, 1997, pp 323-342 [0334] 59. Larson S M, Sgouros G, Cheung
N K: Antibodies in cancer therapy: Radioisotope conjugates. In:
DeVita V T, Hellman S, Rosenberg S A, (eds.): Biologic Therapy of
Cancer, 2nd ed. Philadelphia, J.B. Lippincott Co., 1995, pp 534-552
[0335] 60. Levy R, Miller R A: Antibodies in cancer therapy: B-cell
lymphomas. In: DeVita V T, Hellman S, Rosenberg S A, (eds.):
Biologic therapy of cancer, 1st ed. Philadelphia, J.B.Lippincott
Co, 1991, pp 512-522 [0336] 61. Reisfeld R A, Mueller B M,
Handgretinger R: Potential of genetically engineered
anti-ganglioside GD2 antibodies for cancer immunotherapy. In:
Progress in Brain Search (Svennerhol, L, Asbury, A K, Reisfeld, R
A, Sandhoff, K, Suzuki, K, Tettamani, G, Toffano, G, vol. 101.
Cambridge, U K, Elsevier Trends Journals, 1994, pp 201-212 [0337]
62. Munn D H, Cheung N K: Interleukin-2 enhancement of monoclonal
antibody-mediated cellular cytotoxicity (ADCC) against human
melanoma. Cancer Res 47:6600-6605, 1987 [0338] 63. Hank J A,
Robinson R R, Surfus J, et al: Augmentation of antibody dependent
cell mediated cytotoxicity following in vivo therapy with
recombinant interleukin-2. Cancer Res 50:5234-5239, 1990 [0339] 64.
Kushner B H, Cheung N K: G M-CSF enhances 3F8 monoclonal
antibody-dependent cellular cytotoxicity against human melanoma and
neuroblastoma. Blood 73:1936-1941, 1989 [0340] 65. Kushner B H,
Cheung N K V: Absolute requirement of CD11/CD18 adhesion molecules,
FcRII and phosphatidylinositol-linked FcRIII for monoclonal
antibody-mediated neutrophil anti-human tumor cytotoxicity. Blood
79:1484-1490, 1992 [0341] 66. Cheung N K V, Walter E I,
Smith-Mensah W H, et al: Decay-accelerating factor protects human
tumor cells from complement-mediated cytotoxicity in vitro. J Clin
Invest 81:1122-1128, 1988 [0342] 67. Saarinen U M, Coccia P F,
Gerson S L, et al: Eradication of neuroblastoma cells in vitro by
monoclonal antibody and human complement: method for purging
autologous bone marrow. Cancer Res 45:5969-5975, 1985 [0343] 68.
Munn D H, Cheung N K: Antibody-dependent antitumor cytotoxicity by
human monocytes cultured with recombinant macrophage
colony-stimulating factor. Induction of efficient antibody-mediated
antitumor cytotoxicity not detected by isotope release assays. J
Exp Med 170:511-526, 1989 [0344] 69. Munn D H, Cheung N K:
Phagocytosis of tumor cells by human monocytes cultured in
recombinant macrophage colony-stimulating factor. J Exp Med
172:231-237, 1990 [0345] 70. Sabzevari H, Gillies S D, Mueller B M,
et al: A recombinant antibody-interleukin 2 fusion protein
suppresses growth of hepatic human neuroblastoma metastases in
severe combined immunodeficiency mice. Proceeds of the National
Academy of Science USA 91:9626-9630, 1994 [0346] 71. Murray J L,
Cunningham J E, Brewer H M, et al: Phase I trial of murine
anti-ganglioside (GD2) monoclonal antibody (Mab) 14G2A in cancer
patients. J Biol Resp Modif 1991 (Soc. Biol. Therapy Meeting
Abstract 1991.) [0347] 72. Ugur O, Kostakoglu L, Hui E T, et al:
Comparison of the targeting characteristics of various
radioimmunoconjugates for radioimmunotherapy of neuroblastoma:
Dosimetry calculations incorporating cross-organ beta doses. Nucl
Med Biol 23:1-8, 1996 [0348] 73. Mujoo K, Reisfeld R A, Cheung L,
Rosenblum M G: A potent and specific immunotoxin for tumor cells
expressing disialoganglioside GD2. Cancer Immunol Immunother
34:198-204, 1991 [0349] 74. Gottstein C, Schon G, Tawadros S, et
al: Antidisialoganglioside Ricin A-chain immunotoxins show potent
anti-tumor effects in vitro and in a disseminated human
neuroblastoma severe combined immunodeficiency mouse model. Cancer
Res 54:6186-6193, 1994
[0350] 75. Holzer U, Bethge W, Krull F, et al:
Superantigen-staphylococcal-enterotoxin-A-dependent and
antibody-targeted lysis of GD2-positive neruoblastoma cells. Cancer
Immunol Immunother 41:129-136, 1995 [0351] 76. Cheung N K, Lazarus
H, Miraldi F D, et al: Ganglioside GD2 specific monoclonal antibody
3F8--a phase I study in patients with neuroblastoma and malignant
melanoma. J Clin Oncol 5:1430-1440, 1987 [0352] 77. Cheung N K,
Lazarus H, Miraldi F D, et al: Reassessment of patient response to
monoclonal antibody 3F8. J Clin Oncol 10:671-672, 1992 [0353] 78.
Murray J L, Cunningham J E, Brewer H, et al: Phase I trial of
murine monoclonal antibody 14G2a administered by prolonged
intravenous infusion in patients with neuroectodermal tumors. J
Clin Oncol 12:184-193, 1994 [0354] 79. Saleh M N, Khazaeli M B,
Wheeler R H, et al: Phase I trial of the chimeric anti-GD2
monoclonal antibody ch 14.18 in patients with malignant melanoma.
Human Antibodies Hybridomas 3:19-24, 1992 [0355] 80. Handgretinger
R, Anderson K, Lang P, et al: A phase I study of human/mouse
chimeric antiganglioside GD2 antibody ch 14.18 in patients with
neuroblastoma. Eur J Cancer 31:261-267, 1995 [0356] 81.
Uttenreuther-Fischer M M, Huang C-S, Reisfeld R A, Yu A L:
Pharmacokinetics of anti-ganglioside GD2 mAb 14G2a in phase 1 trial
in pediatric cancer patients. Cancer Immunol Immunother 41:29-36,
1995 [0357] 82. Cheung N K V, Kushner B H, Yeh S J, Larson S M: 3F8
monoclonal antibody treatment of patients with stage I V
neuroblastoma: a phase II study. In: Evans A E, Guillio J D,
Biedler J L, et al, (eds.): Advances in Neuroblastoma Research,
vol. 4. New York, Wiley Liss, 1994, pp 319-329 [0358] 83. Yu A L,
Gillies S D, Reisfeld R A: Phase I clinical trial of ch14.18 in
patients with refractory neuroblastoma. Proc Am Soc Clin Oncol
10:318, 1991 [0359] 84. Handgretinger R, Baader P, Dopfer R, et al:
A phase I study of neuroblastoma with the anti-ganglioside GD2
antibody 14.G2a. Cancer Immunol Immunother 35:199-204, 1992 [0360]
85. Cheung N K: Biological and Molecular Approaches to Treatment.
Immunotherapy. In: Pizzo P A, Poplack D G, (eds.): Principles and
Practice of Pediatric Oncology, 2nd ed. Philadelphia,
J.B.Lippincott Company, 1992, pp 357-370 [0361] 86. Miraldi F D,
Nelson A D, Kraly C, et al: Diagnostic imaging of human
neuroblastoma with radiolabeled antibody. Radiology 161:413-418,
1986 [0362] 87. Arbit E, Yeh S J, Cheung N K, Larson S M:
Quantitative Immunoimaging of gliomas in humans with
anti-ganglioside monoclonal antibodies. J Neurosurg 76:399a, 1991
[0363] 88. Daghighian F, Pentlow K S, Larson S M, et al:
Development of a method to measure kinetics of radiolabeled
monoclonal antibody in human tumors with applications to
microdosimetry: Positron emission tomography studies of iodine-124
labeled 3F8 monoclonal antibody in glioma. Eur J Nucl Med
20:402-409, 1993 [0364] 89. Grant S C, Kostacoglu L, Kris M G, et
al: Radioimmunodetection of small-cell lung cancer using the
anti-GD2 ganglioside monoclonal antibody 3F8: a pilot trial. Eur J
Nucl Med 23:145-149, 1996 [0365] 90. Cheung N K V, Kushner B H, Yeh
S J, Larson S M: 3F8 monoclonal antibody treatment of patients with
stage I V neuroblastoma: A phase II Study. Int J Oncol
12:1299-1306, 1998 [0366] 91. Cheung N K, Yeh S D, Kushner B H, et
al: Phase I study of radioimmunotherapy of neuroblastoma using
iodine 131 labeled 3F8. In: Prog. Clin. Biol. Res: Advances in
Neuroblastoma Research 4. New York, Wiley Liss, 1994, pp 329 [0367]
92. Larson S M, Pentlow K S, Volkow N D, et al: PET scanning of
iodine-124-3F8 as an approach to tumor dosimetry during treatment
planning for radioimmunotherapy in a child with neuroblastoma. J
Nucl Med 33:2020-2023, 1992 [0368] 93. Pentlow K S, Graham M C,
Lambrecht R M, et al: Quantitative imaging of 1-124 using positron
emission tomography with applications to radioimmunodiagnosis and
radioimmunotherapy. Medical Physics 18:357-366, 1991 [0369] 94.
Pentlow K S, Graham M C, Lambrecht R M: Quantitative imaging of
iodine-124 with PET. J Nucl Med 37:1557-1562, 1996 [0370] 95.
Lewellen T K, Kohlmyer S G, Miyaoka R S, Kaplan M S: Investigation
of the performance of the general electric advance positron
emission tomograph in 3D mode. Transplantation Nuclear Science 1996
[0371] 96. Kramer K, Cheung N K V, DiResta G, et al:
Pharmacokinetics and acute toxicology of intraventricular
I-monoclonal antibody targeting disialoganglioside in non-human
primates. J Neuro Oncol 1996 [0372] 97. Dropcho E J, Saleh M N,
Grizzle W E, Oh S J: Peripheral neuropathy following treatment of
melanoma with a murine anti-GD2 monoclonal antibody (MoAb).
Neurology 1992 (abstract in press) [0373] 98. Saleh M N, Khazaeli M
B, Wheeler R H, et al: A phase I trial of the murine monoclonal
anti-GD2 antibody 14.G2a in metastatic melanoma. Cancer Res
52:4342-4347, 1992 [0374] 99. Saleh M N, Wheeler R H, Khazaeli M B,
et al: A phase I trial of chimeric anti-GD2 monoclonal antibody
C14.18 in patients with metastatic melanoma. International
Conference on Monoclonal Antibody Immunoconjugates for cancer 1991
(abstract) [0375] 100. Cheung N K, Cheung I Y, Canete A, et al:
Antibody response to murine anti-GD2 monoclonal antibodies:
Correlation with patient survival. Cancer Res 54:2228-2233, 1994
[0376] 101. Drengler R L, Kuhn J G, Schaaf L J, et al: Phase I and
pharmacokinetic trial of oral irinotecan administered daily for 5
days every 3 weeks in patients with solid tumors. J Clin Oncol
17:685-696, 1999 [0377] 102. Cheung N K, Landmeier B, Neely J, et
al: Complete tumor ablation with iodine 131-radiolabeled
disialoganglioside GD2 specific monoclonal antibody against human
neuroblastoma xenografted in nude mice. J Natl Cancer Inst
77:739-745, 1986 [0378] 103. Cheung I Y, Cheung N K V, Kushner B H:
Induction of Ab3' following anti-GD2 monoclonal antibody 3F8
therapy predicts survival among patients (pts) with advanced
neuroblastoma. Proc Am Assoc Cancer Res 40:574, 1999 [0379] 104.
Chen S, Caragine T, Cheung N K, Tomlinson S: Surface antigen
expression and complement susceptibility of differentiated
neuroblastoma clones. Am J Pathol In press: 1999 [0380] 105. Cheung
N K, Canete A, Cheung I Y, et al: Disialoganglioside GD2
anti-idiotypic monoclonal antibodies. Int J Cancer 54:499-505, 1993
[0381] 106. Loh A, Sgouros G, O'Donoghue J A, et al: A
pharmacokinetic model of 131I-G250 antibody in patients with renal
cell carcinoma. J Nucl Med 3:484-489, 1998 [0382] 107. Kolbert K S,
Sgouros G, Scott A M, et al: Implementation and evaluation of
patient-specific three dimensional internal dosimetry. J Nucl Med
38:301-308, 1997 [0383] 108. Sgouros G, Jureidini I M, Scott A M,
et al: Bone marrow dosimetry: Regional variability of
marrow-localizing antibody. J Nucl Med 37:695-698, 1996 [0384] 109.
Sgouros G, Divgi C R, Scott A M, et al: Hematologic toxicity in
radioimmunotherapy: An evaluation of different predictive measures.
J Nucl Med 37:43P-44P, 1996 [0385] 110. Sgouros G, Deland D, Loh A
C, et al: Marrow and whole-body absorbed dose vs marrow toxicity
following 131I-G250 antibody therapy in patients with renal-cell
carcinoma. J Nucl Med 38:252P, 1997 [0386] 111. Sgouros G:
Treatment planning for internal emitter therapy: methods,
applications and clinical implications. 1996 [0387] 112. Furhang E
E, Sgouros G, Chui C S: Radionuclide photon dose kernels for
internal emitter dosimetry. Medical Physics 23:759-764, 1996 [0388]
113. Furhang E E, Chui C S, Sgouros G: A monte carlo approach to
patient-specific dosimetry. Medical Physics 23:1523-1529, 1996
[0389] 114. Furhang E E, Chui C S, Kolbert K S, et al:
Implementation of a monte carlo dosimetry method for
patient-specific internal emitter therapy. Medical Physics
24:1163-1172, 1997 [0390] 115. Sgouros G: Yttrium-90 biodisribution
by yttrium-87 imaging: a feasibility analysis. Medical Physics 2000
[0391] 116. Siegel J A, Wessels B W, Watson E E, et al: Bone marrow
dosimetry and toxicity in radioimmunotheray. Antibody
Immunoconjugates Radiopharmaceuticals 3:213-233, 1990 [0392] 117.
Scott A M, Macapinlac H, Zhang J, et al: Image registration of
SPECT and C T images using an external fiduciary band and
three-dimensional surface fitting in metastatic thyroid cancer. J
Nucl Med 36:100-103, 1995 [0393] 118. Woods R P, Mazziotta J C,
Cherry S R: Quantification of brain function. Tracer kinetics and
image analysis in brain PET. 1993 (E D. Uemura K, Elseiver Science
Publishers) [0394] 119. Talairach J, Tournouz P: Co-planar
stereotactic atlas of the human brain. Georg Thieme Verlag 1988
[0395] 120. Meyer C R, Boes J L, Kim B, et al: Demonstration of
accuracy and clinical versatility of mutual information for
automatic multimodality image fusion using affine and thin-plate
spline warped geometric deformations. Medical Image Analysis
1:195-206, 1997 [0396] 121. Sgouros G, Chiu S, Pentlow K S, et al:
Three-dimensional dosimetry for radioimmunotherapy treatment
planning. J Nucl Med 34:1595-1601, 1993
Third Series of Experiments
[0397] Immunomagnetic Purging of Ewing's Sarcoma from Blood:
Quantitation by Real-Time PCR
[0398] Ewing's sarcoma is a childhood tumor characterized by a
t(11,22) in most patients. Because survival remains suboptimal with
standard therapy, many patients receive autologous stem cell
transplant and trials investigating adoptive transfer of autologous
T cells in the context of immune therapy are underway. However,
approximately 50% of patients with advanced disease have PCR
detectable disease in peripheral blood and/or bone marrow and
administration of contaminated autologous cell preparations may
contribute to disease relapse. To date, there is no reported method
for purging contaminated hematopoietic cell populations of Ewing's
Sarcoma. 8H9 is a mouse monoclonal IgG1 antibody previously
reported to react with 21/21 Ewing's sarcoma/PNET tumors (Proc ASCO
17:44a, 1998). Peripheral blood T cell and B cell populations and
CD34+ cells from bone marrow analyzed by flow cytometry for binding
of 8H9 were negative. We sought to use magnetic bead
Immunoselection of 8H9 labeled cells to purge peripheral blood cell
populations contaminated with Ewing's sarcoma. Using real-time
quantitative nested PCR with Lightcycler, we monitored purging
efficiency by evaluation of t(11,22) by RT-PCR. Contaminated
specimens were labeled with 8H9 and incubated with rat anti-mouse
IgGI magnetic beads. The sample was then run over a Miltenyi
Variomax negative selection column. Recovery was approximately 70%.
RNA was extracted from 10e7 cells from pre and post purge cell
populations. Real-time quantitative PCR was performed with a level
of sensitivity to one tumor cell in 10e5 normal cells. We
demonstrated at least a two-log reduction of tumor in preparations
contaminated at a ratio of 1:10 normal PBMC and 1:10e3 normal PBMC.
Further studies evaluating efficacy in clinical samples are
underway. These results demonstrate a potential new approach for
purging contaminated patient samples to be used in the context of
autologous bone marrow transplant and/or immunotherapy trials for
Ewing's sarcoma.
Immunomagnetic Purging of Ewing's Sarcoma from Blood and Bone
Marrow: Quantitation by Real-Time PCR
[0399] The propensity for hematogenous spread of Ewing's sarcoma
and the resulting contamination of autologous cell preparations
complicates the use of cellular therapies in this disease. To date,
there has been no reported method for purging marrow and other
cellular products of Ewing's sarcoma. In this paper, we introduce
monoclonal antibody 8H9, which showed binding by flow cytometry to
9/9 Ewing's sarcoma cell lines studied. Binding to lymphocytes and
bone marrow progenitor cells was negative. In order to test whether
8H9 could be used for immunomagnetic based purging, normal PBMCs or
bone marrow cells were artificially contaminated with varying
amounts of Ewing's sarcoma. Quantitative PCR or t(11;22) was shown
to accurately measure the level of contamination with a sensitivity
of 1:10.sup.6. Samples were then purged using the Miltneyi Variomax
negative selection system selecting for monoclonal antibody 8H9
bound cells. A 2 to 3-log reduction in tumor burden was
consistently observed following immunomagnetic selection. In
clinical non-mobilized apheresis studied, Ewing's contamination
ranged between 1:10.sup.5-1:10.sup.6. Therefore 8H9 based purging
of clinical samples is predicted to result in a contamination level
which is below the limit of detection by sensitive quantitative
PCR. These results demonstrate a potential new approach for purging
contaminated patient samples to be used in the context of
autologous bone marrow transplant and/or immunotherapy trials for
Ewing's sarcoma.
[0400] Current concepts hold that Ewing's sarcoma is a systemic
disease from the time of onset as demonstrated by the observation
that over 90% of patients with clinically localized disease will
recur distantly if treated with local measures alone [Jaffe, 1976
#49]. Indeed, the generally accepted factor responsible for the
recent improvement in survival observed in patients with clinically
localized disease is control of hematogenously disseminated
micrometastasis via neoadjuvant multi-agent chemotherapy.sup.1.
Recently, the use of sensitive molecular monitoring to detect
circulating Ewing's sarcoma cells has confirmed hematogenous
dissemination in a substantial number of patients with Ewing's
sarcoma. West et al.sup.2 found a 25% incidence of translocation
(11;22) positivity in the peripheral blood or bone marrow in
patients with clinically localized disease, and higher rates have
been observed in other series.sup.3 and in patients with overt
metastatic disease..sup.3, 4 Interestingly, in the reports by de
Alava and Toretsky, evidence for positivity in peripheral blood
persisted following initiation of chemotherapy suggesting that
ongoing dissemination may occur intermittently throughout treatment
protocols.
[0401] In an attempt to improve survival in high-risk patients with
Ewing's sarcoma, several groups have studied the use of high dose
chemotherapy followed by bone marrow or peripheral stem cell
transplantation..sup.5-17. Up to a 40% survival in poor risk
patients has been reported after high dose therapy followed by
autologous stem cells in contrast to historical survival rates of
0-20% with chemotherapy/radiation therapy alone.sup.5, 6. One
factor complicating the use of autologous stem cell products in
therapy of Ewing's sarcoma is the propensity for hematogenous
dissemination with resultant contamination of stem cell products.
In one report, despite CD34 based positive selection for progenitor
cells, autologous peripheral blood progenitor preparations were
shown to contain EWS/FLI1 translocation positive cells in 54% of
samples evaluated.sup.4. While the true clinical impact of
contaminating tumor cells in autologous products remains unclear,
genetically marked tumor cells residing in autologous bone marrow
have been shown to be present at disease relapse in patients with
neuroblastoma and AML.sup.18, 19. Similar concern regarding the
potential for autologous cell preparations to contribute to disease
recurrence arise in the context of immune based therapy trials
which are currently being undertaken and involve the transfer of
autologous T cells harvested prior to the initiation of
therapy.sup.20.
[0402] To date there has been no method reported for purging
autologous hematopoietic cells of Ewing's sarcoma. In this report,
we introduce a monoclonal antibody based purging technique which
allows us to reduce the tumor burden in contaminated bone marrow or
peripheral blood specimens by two to three logs which is predicted
to be below the limit of detection of PCR positivity in the vast
majority of clinically contaminated specimens.
Materials and Methods
[0403] Monoclonal Antibody Production (Memorial Sloan-Kettering
Cancer Center)
Cell Preparations
[0404] Peripheral Blood Mononuclear Cells:
[0405] PBMCs used in tumor spiking experiments were obtained by
ficoll-based density gradient separation of the fresh buffy coat
fraction of normal healthy donor blood units obtained at the
Department of Transfusion Medicine, Clinical Center, NCI according
to approved protocols. For analysis of T cell reactivity to
anti-CD3 monoclonal antibody following purging, PBMCs were T cell
enriched using a negative selection column (R & D Biosystems,
Minneapolis) which results in a purity of approximately 80%.
Patient apheresis samples analyzed for contamination were obtained
as part of NCI POB 97-0052 following informed consent.
Leukapheresis procedures were done using the CS3000 Plus (Fenwal
Division, Baxter, Deerfield, Ill.) which processed 5-15 liters of
blood volume. Countercurrent centrifugal elutriation of the
apheresis product was performed using a Beckman J-6M centrifuge
equipped with a JE 5.0 rotor (Beckman Instruments, Palo Alto,
Calif.) in HBSS without magnesium, calcium and phenol red
(BioWhittaker, Walkersville, Md.) at a centrifuge speed of 3000 rpm
(1725.times.g).sup.21. Cell fractions (450-550 ml each) were
collected at flow rates of 120, 140, and 190 ml/min. during
centrifugation and at 190 ml/min. with the rotor off (RO). The
first two fractions are typically enriched for lymphocytes while
the last two fractions are enriched for monocytes. All fractions
were cryopreserved in 10% DMSO (Cryoserv, Research Industries, Salt
Lake City, Utah), RPMI with penicillin, streptomycin and
L-glutamine and 25% fetal calf serum.
[0406] Progenitor Cells:
[0407] CD34+ cells used for purging experiments were selected using
the Miltenyi Variomax.RTM. direct isolation system (Miltenyi,
Auburn, Calif.) from cryopreserved peripheral stem cells from a
Ewing's sarcoma patient obtained for therapeutic use at Children's
National Medical Center, Washington, D.C. according to approved
protocols and following informed consent. Stem cells were used for
research purposes after the patient's death. These cells were not
positive by RT-PCR for Ewing's sarcoma and were therefore
artificially contaminated for the purging experiments. Non-CD34
selected bone marrow used for purging experiments and enriched
CD34+ populations used in the CFU assay were obtained from fresh
human marrow harvested from normal volunteers according to approved
protocols and following informed consent (Poietics Laboratories,
Gaithersburg, Md.). The mononuclear fraction was obtained by
ficoll-based density gradient separation, and subsequently enriched
for CD 34+ cells by the Miltenyi Variomax.RTM. (Miltenyi, Auburn,
Calif.) direct CD34 selection system.
[0408] Tumor Cell Lines:
[0409] Ewing's sarcoma cell lines used for screening included TC71,
5838, RD-ES, CHP100, A4573 which have been previously reported 22
and JR and SB which are cell lines derived from patients treated at
the National Cancer Institute which have also been previously
reported 22. LG was a cell line derived from a patient with
isolated intrarenal recurrence of Ewing's sarcoma treated with
resection at the University of Maryland.
Flow Cytometry Analysis
[0410] Flow cytometric analysis was performed using the
Becton-Dickinson FacsCalibur machine. Briefly, fluorescence data
were collected using a 3-decade log amplification on 10,000 viable
gated cells as determined by forward and side light scatter
intensity. Monoclonal antibodies used for immunofluorescence were:
MoAb 8H9, murine IgG1 isotype, goat anti-mouse IgG1-FITC, CD3- PE
(S4.1), CD34- PE (581) Caltag (Burlingame, Calif.), CD99-FITC
(TU12) (Pharmingen, San Diego, Calif.). For immunofluorescence
analysis, cells were incubated with antibody at a concentration of
1 ug/10.sup.6 cells for 20 minutes at 4.degree., followed by
washing with PBS with 0.2% human serum albumin and 0.1% Sodium
Azide. For 8H9 and isotype staining, this was followed by
incubation with goat anti-mouse FITC for 10 minutes at 4.degree. C.
followed by washing prior to analysis.
Immunomagnetic Purging
[0411] All cell products were spiked with tumor cells from the
Ewing's sarcoma cell line TC71 at the levels of contamination
indicated for individual experiments. For purging of CD34+
peripheral stem cells, a total of 10.times.10.sup.6 were spiked.
1.times.10.sup.6 cells were analyzed for pre-purged and post-purged
PCR. For PBMC and non-CD34 selected bone marrow specimens,
30-80.times.10.sup.6 cells were spiked with TC71 with
10.times.10.sup.6 cells analyzed for pre-purged and post-purged
PCR. For purging, cells were incubated at 4.degree. C. with
monoclonal antibody 8H9 at a concentration of 1 ug/10.sup.6 total
cells for 20 minutes and washed with buffer (PBS, 0.5% BSA, 2 mM
EDTA). Cells were then incubated with rat anti-mouse IgG1 magnetic
beads (Miltneyi, Auburn, Calif.) at a ratio of 1:1 for 20 minutes
at 4.degree. C. Purging was accomplished using the Miltenyi
Variomax.RTM. system wherein the sample is run over the Miltenyi
(Auburn, Calif.) AS depletion column with a flower resistor of 24G.
Cells from the depleted fraction were then washed with 3 cc buffer.
The positively selected fractions of cells was removed by releasing
the column from the magnet and washing with 3 cc buffer, and
analyzed by PCR where indicated. In cases where clonogenicity of
the positive fraction was evaluated, the positive fraction was
pelleted and resuspended in RPMI with 10% FCS, L-glutamine (4 uM),
penicillin (100 u/ml), and streptomycin (100 ug/ml), and placed in
an incubator at 37.degree. C. with 5% CO.sub.2 for 5 days.
Conventional PCR
[0412] For analysis of contamination of patient apheresis
fractions, RNA was extracted from 20-50.times.10.sup.6 cells using
TRIzol Reagent (Life Technologies, Rockville, Md.) or guanidinium
isothiocynate/CsCl method 23. After cDNA was generated from 250 ng
RNA using a random hexamer, PCR was performed with Perkin Elmer
GeneAmp PCR system 2400 using ESPB1 and ESBP2 primers and the
following conditions: 40 cycles 95.degree. C. 30s, 60.degree. C.
30s, 72.degree. C. 30s followed by 72.degree. C. for 7 minutes. To
assess the integrity and quantity RNA, a PCR reaction with GAPDH
primers was performed for each patient sample. 10 ul of each PCR
product were run on 1.3% TBE agarose gel and transferred to a nylon
membrane. A [.sup.32P].gamma.-ATP 20-mer oligonucleatide probe was
generated using T4 polynucleotide kinase. The membrane was
hybridized using ExpressHyb Hybridization Solution (Clontech, Palo
Alto, Calif.) according to the manufacturer's instructions. The
membrane was then exposed to Kodak Xomat film (Kodak, Rochester,
N.Y.) for 24-144 hours.
Real-Time Quantitative PCR
[0413] Real-time quantitative PCR was performed using the
Lightcycler.RTM. Instrument (Roche Molecular Biochemicals,
Indianapolis, Ind.). RNA was extracted from 10.times.10.sup.6 cells
from all samples except for the CD34+ population in which
1.times.10.sup.6 cells were used. The Trizol.RTM. phenol/chloroform
extraction or RNA-easy columns (Qiagen, Valencia, Calif.) were
used. The 1.sup.st Strand Synthesis kit (Roche, Indianapolis, Ind.)
was used to generate cDNA from 1 ug of RNA from each sample. PCR
was then run on 5 ul of cDNA on the Lightcycler.RTM. instrument
with primers ESBP1 and ESBP2 for 40 cycles. In cases where nested
PCR was performed, an initial 20 cycles of PCR were carried out
with the primer pair ESBPI-ESBP2 followed by 40 additional cycles
using 2 ul of the product of the first reaction using the primer
pair EWS 696-Fl1 1041 By conventional PCR, primer pair ESBP1-ESBP2,
and EWS 696-FLI 1041 generate fragments of 310 bp and 205 bp
respectively. Both sets of primers are outside the breakpoint of
the EWS/FLI 1 translocation. In the initial evaluation of the
quantitative PCR, both nested and non-nested Lightcycler.RTM. PCR
products were confirmed by size using 1% TAE agarose gel with
ethidium bromide (data not shown). Hybridization probes spanning
the EWS/FLI 1 breakpoint were used to detect target template in the
Lightcyler reaction. To provide a positive control and to
quantitate total amplified RNA, G6PD was amplified from 5 ul of
cDNA and analyzed using sequence specific hybridization probes
G6PDHP1 and G6PDHP2. On all hybridization probes, the 5' probe
(HP1) was labeled at the 3'end with Fluorescein, the 3' probe (HP2)
was labeled at the 5' end with Lightcycler Red 640 and
phosphorylated at the 3' end. Cycle crossing number was ascertained
at the point in which all samples had entered the log linear phase.
Cycle crossing number was used to determine log cell concentration
according to a standard curve. The standard curve was generated by
amplifying 5 ul of cDNA derived from 1 ug of RNA from
10.times.10.sup.6 normal PBMCs spiked with TC71 tumor cells at
decreasing concentrations from 1:10 to 1:10.sup.7.
Sequences
TABLE-US-00015 [0414] [.sup.32P].gamma. Probe (SEQ ID NO: 4)
5'TACTCTCAGCAGAACACCTATG
Primers
TABLE-US-00016 [0415] ESBP1 (SEQ ID NO: 5) 5' CGA CTA GTT ATG ATC
AGA GCA 3' ESBP2 (SEQ ID NO: 6) 5' CCG TTG CTC TGT ATT CTT ACT GA
3' EWS 696 (SEQ ID NO: 7) 5' AGC AGC TAT GGA CAG CAG 3' FLI 1 1041
(SEQ ID NO: 8) 5' TTG AGG CCA GAA TTC ATG TT 3' G6PD1 (SEQ ID NO:
9) 5' CCG GAT CGA CCA CTA CCT GGG CAA G 3' G6PD 2 (SEQ ID NO: 10)
5' GTT CCC CAC GTA CTG GCC CAG GAC CA 3'
Lightcycler Hybridization Probes
TABLE-US-00017 [0416] EWSHP1 (SEQ ID NO: 11) 5' TAT AGC CAA CAG AGC
AGC AGC TAC-F3' EWSHP2 (SEQ ID NO: 12) 5' LC RED 640-GGC AGC AGA
ACC CTT CTT-P3' G6PDHP1 (SEQ ID NO: 13 5' GTT CCA GAT GGG GCC GAA
GAT CCT GTT G-F3' G6PDHP2 (SEQ ID NO: 14) 5' LC RED 640-CAA ATC TCA
GCA CCA TGA GGT TCT GCA C-P3'
OKT3 Mediated Proliferation of Purged T Cell Specimens
[0417] 1.times.10.sup.8 CD3 enriched cells were contaminated with
Ewing's sarcoma at a level of 1:10.sup.3. Cells from pre-purged and
post-purged samples were added in triplicate to a 96 well plate at
a concentration of 2.times.10.sup.5 cells/well containing
decreasing concentrations of plate bound anti-CD3 antibody OKT3
(Ortho Biotech Inc., Raritan, N.J.) from 100 ug/ml to 3 ug/ml.
Cells were incubated with 200 ul of RPMI with 10% FCS, L-glutamine,
penicillin, and streptomycin for a 48 hours and then pulsed with 1
uCi of [.sup.3H] thymidine per well. Cells were harvested after 18
hours of pulsing and .sup.3H incorporation was enumerated using the
TopCount NXT (Packard, Meriden Conn.). Subtracting background
activity with media alone generated net counts.
CFU Assay
[0418] CD34+ cells were enriched from pre- and post-purged samples
from fresh human bone marrow using the Miltenyi.RTM. direct CD34+
progenitor isolation kit. 35.times.10.sup.6 bone marrow mononuclear
cells from each sample were run over a positive selection (MS)
column yielding a CD34+ enriched population with estimated purities
of >70% 24. 1000 cells were plated in triplicate in
methylcellulose media supplemented with recombinant cytokines
(MethoCultGF+H4435, Stem cell Technologies, Vancouver, BC). CFUs
were counted after 14 days of culture.
Results
Monoclonal Antibody 8H9 Binds all Ewing's Sarcoma Cell Lines Tested
but not Normal Lymphocytes or Hematopoietic Progenitors.
[0419] In order to identify a potential reagent that could be used
to target contaminating Ewing's sarcoma cells, monoclonal
antibodies induced via immunization with neuroblastoma were
screened for cross reactivity with Ewing's sarcoma. Monoclonal
antibody 8H9 was observed to bind to 9/9 Ewing's sarcoma cell lines
evaluated (FIG. 9). The level of reactivity was variable with some
lines showing diminished levels of reactivity compared to CD99
whereas two lines (SB and RD-ES), showed increased reactivity
compared to CD99. Importantly, lymphoid and hematopoietic
populations showed no reactivity with 8H9 as shown in FIG. 10a (CD3
gated PBMC), and FIG. 10b (CD34 gated bone marrow cells), whereas
CD99 showed significant binding to T cell populations.
Quantification of Ewing's Sarcoma Contamination Using Real-Time PCR
of Artificially Contaminated Specimens Accurately Quantitates Tumor
Contamination with Sensitivity to 1:10.sup.6.
[0420] To study whether immunomagnetic purging of marrow and
peripheral blood populations contaminated with Ewing's sarcoma
could be quantitatively monitored, we sought to devise an approach
wherein variable levels of contamination could be quantified using
RT-PCR. We began by artificially contaminating PBMC populations
with a log based titration of Ewing's contamination (e.g.
1:10-1:10.sup.7). The degree of contamination was evaluated using
real-time PCR. Using a non-nested PCR, we observed linear
relationships across four log levels of contamination, (FIG. 11a).
However, the limit of detection for a non-nested PCR was 1 tumor
cell in 10.sup.4 background cells. In an effort to increase the
sensitivity, we also evaluated nested PCR, using an initial 20
cycles of amplification followed by 40 cycles amplification with
internal primers. With this approach, quantitative accuracy was
lost for only the highest level of contamination, which likely
began to plateau with the initial 20 cycles (11b). However,
quantitative accuracy was observed for levels of contamination
between 1:100 to 1:10.sup.6 was observed (FIG. 11c). Because
10.times.10.sup.6 starting cells were used in these experiments, we
can estimate that using the nested approach, amplification was
accomplished from 10 contaminating cells. This confirmed the
utility of quantitative PCR to provide an accurate quantitative
assessment of tumor contamination with a level of sensitivity of
one tumor in 10.sup.6 background cells, thus allowing measurements
of the efficacy of 8H9 based approaches for purging of Ewing's
sarcoma cells.
MoAb 8H9 Based Immunomagnetic Purging Yields a 2 to 3-Log Reduction
in Artificially Contaminated Peripheral Blood and Bone Marrow
Populations.
[0421] In order to purge hematopoietic progenitor populations of
Ewing's sarcoma, variably contaminated 8H9 incubated bone marrow or
peripheral blood stem cell populations were run over a
Variomax.RTM. negative selection column as described in methods.
Non-nested PCR evaluation of non-CD34 selected bone marrow from a
healthy donor spiked with Ewing's sarcoma cells at a level of 1:100
is shown in FIG. 12a. These results demonstrate a 2-log reduction
in tumor following 8H9 based purging. To evaluate the efficiency of
8H9 based purging with progenitor contamination at lower levels and
to assess the ability to purge CD34+ selected cells, CD34+ selected
cells from G-CSF mobilized peripheral blood were spiked at a level
of 1:10.sup.3 and purged as shown in FIG. 12b. Using the
quantitative PCR, we observed a 3-log reduction in the level of
contamination following one run over the column.
[0422] In the next experiments, evaluation of the ability to purge
contaminated PBMC populations was undertaken. Similar to the
results observed with CD34+ enriched peripheral blood stem cells,
at least a 3-log reduction in contamination following 8H9 based
purging of PBMCs contaminated at 1:100 was attained as shown in
FIG. 12c. Evaluation of purging of PBMCs contaminated at a lower
level (1:10.sup.3) is shown in FIG. 12d where a 3-log reduction is
again observed. In each of these experiments analysis of the
positive fraction demonstrated PCR positivity confirming selection
of contaminating Ewing's cells (data not shown). To account for any
variation from the expected uniform amounts of starting RNA or
cDNA, G6PD amplification was performed from each sample in a
quantitative fashion. We observed a variation in crossing time
(reflective of starting template) of less than 2% in all of the
samples indicating a low degree of variation in starting template
between samples and confirming viable RNA and cDNA in the negative
samples (data not shown). These results suggested that monoclonal
antibody 8H9 may be a suitable candidate for immunomagnetic based
purging of contaminated blood, bone marrow, and CD 34+ enriched
progenitor populations specimens with the likelihood for purging to
PCR negativity being high if the level of contamination present in
clinical samples is less than 1:10.sup.4.
Contamination of Non-Mobilized Patient Apheresis Fractions with
Ewing's Sarcoma is Between 1:10.sup.5-1:10.sup.6.
[0423] In order to evaluate the degree of contamination typically
observed in clinical specimens, we studied non-mobilized peripheral
blood apheresis specimens derived from patients treated on
immunotherapy trials for Ewing's sarcoma at our institution. We
observed a 66% ( 8/12) incidence of t(11,22) PCR positivity in
non-mobilized apheresis specimens acquired for use in immunotherapy
protocols as analyzed by conventional PCR (Table 1). As shown in
Table 1, all elutriated apheresis fractions were observed to
contain tumor with variability across individual patients. When
elutriated apheresis specimens from several patients at
presentation of metastatic Ewing's sarcoma were analyzed using
quantitative PCR, this level of contamination was estimated to be
between 1:10.sup.5 and 1:10.sup.6 with similar levels of
contamination sometimes observed in multiple apheresis fractions.
(FIG. 13). Patient A (top panel) showed positivity of all fractions
at levels of approximately 1:10.sup.6. Patient B (middle panel)
showed a level of contamination of approximately 1:10.sup.6 in the
120 ml/min (lymphocyte) fraction with no evidence for positivity in
the 190 ml/min or rotor off (monocyte) fractions. Patient C (bottom
panel) showed a level of contamination between 1:10.sup.5 and
1:10.sup.6 in multiple fractions. In no instance have we observed
levels of contamination greater than 1:10.sup.4. Therefore, because
clinical specimens contaminated with Ewing's sarcoma appears to be
in the range of 1:10.sup.5-1:10.sup.6, it is anticipated that
reduction in contamination to at least 1:10.sup.7 following 8H9
based purging will be achievable in the vast majority of
patients.
TABLE-US-00018 TABLE 1 Contamination of non-mobilized apheresis
fractions with Ewing's sarcoma as analyzed by conventional PCR.
Lymphocyte Fractions Monocyte Fractions Patient Number 120 ml/min
140 ml/min 190 ml/min Rotor Off 1 N/A Positive Negative Positive 2
Positive Positive Positive Positive 3 Positive Negative Positive
N/A 4 Negative Negative N/A Positive 5 Negative Negative Negative
Negative 6 N/A Negative Negative Positive 7 Negative Negative
Negative Negative 8 Negative Negative Negative Negative 9 Negative
Positive Positive Negative 10 Positive Positive N/A Positive 11
Negative Negative Negative Negative 12 Negative Negative Negative
Positive Positive indicates band hybridized with the EWS/FLI
radiolabeled probe. Negative indicated no band was noted. N/A
indicated that no RNA was obtained for that fraction
[0424] To further evaluate the clinical feasibility of this
technique for purging of bone marrow or PBSC autografts, we sought
to confirm retained proliferative and differentiating capacity in
8H9 purged bone marrow populations. We studied CFU formation
following purging as an assay of CD34 function. We compared CFU
formation before and after purging in CD34 selected bone marrow
cells cultured in methycellulose media with recombinant cytokines
before and after purging (FIG. 14). We observed normal colony
numbers and morphology in both samples with no significant
difference between samples indicating that CD34+ progenitors remain
functional following 8H9 based purging.
T Cell Proliferation is Unchanged Before and after Purging.
[0425] Because T cells can contribute to post chemotherapy immune
reconstitution.sup.25, we are currently utilizing autologous T cell
infusions harvested prior to initiation of chemotherapy in order to
study effects on immune reconstitution. In order to study T cell
function following 8H9 based purging, we evaluated T cell
proliferation following anti-CD3 cross linking as a measure of T
cell function. We compared T cell proliferation unmanipulated T
cells and 8H9 based purged T cells. As shown in FIG. 15, there was
no difference in T cell proliferation elicited by plate bound OKT3
antibody at concentrations ranging from 100 ug/ml to 3 ug/nl as
measured by [.sup.3H] thymidine uptake indicating that T cell
proliferative capacity is retained following 8H9 based purging
(FIG. 15).
Discussion
[0426] The contribution of contaminated autologous preparations to
disease relapse following autologous SCT in solid tumor patients is
not fully known. Rill and Brenner et al. have shown than in certain
solid tumors, tumors contaminating autologous grafts are
tumorigenic and present at relapse.sup.18, 19. In a disease such as
Ewing's sarcoma, which has been shown to have a high degree of
hematogenous spread, this becomes an important issue in the context
of therapies which utilize autologous cells. In high-risk patients,
survival after high dose chemotherapy followed by stem cell rescue
continues to be suboptimal with the most common cause of death due
to disease relapse. Contamination of autografts with subsequent
survival and clonogenic growth of tumor post-infusion cannot be
excluded as contributing to this poor prognosis. In addition to the
medical consequences of the administration of contaminated products
to patients, psychologically there is reluctance on the part of
patients and their families to receive contaminated products. It
follows, therefore, that if a purging method was available, its
evaluation for use in patients receiving autologous products is
warranted.
[0427] An ideal purging method should target only tumor cells and
show no binding to normal cell populations. The identification of
such a tumor specific antigen has historically posed a challenge in
Ewing's sarcoma. While CD99 typically shows high expression on
Ewing's sarcoma cells, it is also expressed on T cells (FIG. 10a)
and CD 34 stem cells 26, making it unsuitable for purging
hematologic products. Monoclonal antibody 8H9 was initially
developed due to its reactivity with neuroblastoma and was
subsequently reported to react with 19/19 fresh Ewing's
sarcoma/PNET tumor confirming that 8H9 reactivity is not limited to
established cell lines. 27. Our results (FIG. 9) confirmed this
reactivity in all Ewing's cell lines evaluated. Since this antibody
showed no reactivity with T cells and CD34+ cells, it was ideally
suited for purging. Indeed, we demonstrated a 2-3 log reduction in
all experiments following one run over the negative selection
column. In the clinical setting of autologous stem cell transplant,
the combination of positive selection for CD34+ cells, which
results in an approximate 2-log passive depletion of tumor 28, 29,
followed by 8H9 purging of tumor cells would be expected to result
in up to 5 logs of depletion, which is predicted to be well below
the limit of detection using currently available techniques.
Further, even in the setting of autologous T cell transplantation,
as potentially used in the context of immune reconstitutive
therapies.sup.20, the use of 8H9 based purging with its 2-3 log
reduction will substantially diminish the tumor burden contained in
autologous cellular products.
[0428] This is the first published report of 8H9 as a Ewing's
reactive monoclonal antibody. Interestingly, 8H9 also shows
reactivity with several rhabdomyosarcoma and osteosarcoma cell
lines (data not shown). This introduces the exciting possibility of
a sarcoma specific antibody with potential applications in immune
directed therapy. In addition, identification and characterization
of the tumor specific epitope which binds to 8H9 could offer
important insight into the biology of these tumors. These studies
are currently underway. Further, during the course of the studies
reported here, we sought to evaluate in a general sense, the
function of sarcoma cells selected with 8H9. We observed that
Ewing's sarcoma cells positively selected using 8H9 retain their
clonogenic properties and are able to be maintained in cell
culture. This property has the potential aid in the generation and
study of tumor cell lines derived from patients with pediatric
sarcomas, which is currently difficult in these tumors due to
limitations of tumor size and surgical accessibility of primary
tumors. We are currently investigating whether Ewing's sarcoma
cells derived from apheresis or bone marrow samples in patients
with metastatic disease which are positively selected and grown in
culture could provide a ready source of tumor samples for further
biologic study.
[0429] RT-PCR is a powerfully sensitive tool for use in monitoring
minimal residual disease MRD.sup.30. It remains unclear, however,
whether evidence of small amounts of residual tumor by molecular
analysis is predictive for relapse in solid tumors and data in the
literature is conflicting. de Alava et al. evaluated MRD in Ewing's
sarcoma patients and showed a correlation between PCR positivity
and disease relapse. In this report however, some patients remained
PCR positive without disease relapse.sup.3. Using real-time PCR, it
is now possible to quantitate starting template and compare
starting template amount between samples obtained at different
timepoints. Real-time quantitative PCR has been used as a tool to
monitor MRD in leukemia patients.sup.31, 32 and may be useful in
evaluation of disease response.sup.33 and in predicting relapse in
patients by the detection of increasing levels of tumor specific
transcript.
[0430] This is the first report of the use of real-time
quantitative PCR used to detect and quantify Ewing's sarcoma
transcript. It is possible that quantitative PCR could allow for
further identification of patients with a high risk of relapse by
detection of increasing amounts of Ewing's transcripts over time.
However, because contamination of peripheral blood by solid tumors
is likely to be relatively low (in the range of
1:10.sup.5-1:10.sup.6 in this series), the sensitivity of this
analysis must be very high in order to allow for the detection of
very low levels of circulating tumor in patients with solid tumors.
The level of sensitivity of our technique reached 1 Ewing's sarcoma
cell in 10.sup.6 normal cells with nested PCR from
10.times.10.sup.6 cells. It is possible that the level of
sensitivity would be even higher if higher cell numbers were
evaluated since this method appears capable in our hands of
amplifying product from 10 contaminating cells. Tumor enrichment
using positive selection is another method to increase sensitivity
of tumor detection. The positive immunomagnetic selection procedure
described in this paper for purging could also provide a suitable
approach for tumor enrichment in for monitoring MRD or even in
contributing to making the correct diagnosis at the time of initial
presentation with metastatic disease. Indeed, cells eluted from the
column were positive by PCR analysis, demonstrating the feasibility
of this technique for tumor enrichment which would be predicted to
increase the sensitivity of PCR detection of contaminating Ewing's
sarcoma in patient samples. One caveat which should be noted is
that the quantitative technique, relies on the assumption that the
level of expression of t (11;22) is consistent among cell lines and
patient samples. This, may not be the case, however, and may lead
to under or over estimation of the absolute level of tumor burden
when comparing patient samples to a standard curve. Such
limitations would not preclude evaluation of changes in the level
of PCR positivity of an individual patient over time, wherein
substantial changes in the level of expression of t(11;22) may be
less likely.
[0431] In this report we have demonstrated a purging technique that
reduces tumor burden in artificially contaminated products by at
least 2-3 logs. This approach is predicted to substantially reduce
the tumor burden contained in autologous cellular products which
are administered in the context of innovative therapies for Ewing's
sarcoma. The demonstration that CFU assays on progenitor cells as
well as CD3 induced T cell proliferation are normal after purging
demonstrates no detrimental effects on normal progenitor cell and T
cell function, making this a potentially feasible addition to
autologous protocols. We conclude that immunomagnetic purging via
negative selection using MoAb 8H9 warrants evaluation in clinical
trials for Ewing's sarcoma involving the use of autologous
products.
REFERENCES
[0432] 1. Arndt C A, Crist W M. Common musculoskeletal tumors of
childhood and adolescence. N Engl J Med. 1999; 341:342-52. [0433]
2. West D C, Grier H E, Swallow M M, Demetri G D, Granowetter L,
Sklar J. Detection of circulating tumor cells in patients with
Ewing's sarcoma and peripheral primitive neuroectodermal tumor. J
Clin Oncol. 1997; 15:583-8. [0434] 3. de Alava E, Lozano M D,
Patino A, Sierrasesumaga L, Pardo-Mindan F J. Ewing family tumors:
potential prognostic value of reverse-transcriptase polymerase
chain reaction detection of minimal residual disease in peripheral
blood samples. Diagn Mol Pathol. 1998; 7:152-7. [0435] 4. Toretsky
J A, Neckers L, Wexler L H. Detection of (11;22)(q24;q12)
translocation-bearing cells in peripheral blood progenitor cells of
patients with Ewing's sarcoma family of tumors. J Natl Cancer Inst.
1995; 87:385-6. [0436] 5. Burdach S, Jurgens H, Peters C, et al.
Myeloablative radiochemotherapy and hematopoietic stem-cell rescue
in poor-prognosis Ewing's sarcoma. J Clin Oncol. 1993; 11:1482-8.
[0437] 6. Burdach S, Nurnberger W, Laws H J, et al. Myeloablative
therapy, stem cell rescue and gene transfer in advanced Ewing
tumors. Bone Marrow Transplant. 1996; 18 Suppl 1:S67-8. [0438] 7.
Chan K W, Petropoulos D, Choroszy M, et al. High-dose sequential
chemotherapy and autologous stem cell reinfusion in advanced
pediatric solid tumors. Bone Marrow Transplant. 1997; 20:1039-43.
[0439] 8. Fischmeister G, Zoubek A, Jugovic D, et al. Low incidence
of molecular evidence for tumour in PBPC harvests from patients
with high risk Ewing tumours. Bone Marrow Transplant. 1999;
24:405-9. [0440] 9. Frohlich B, Ahrens S, Burdach S, et al.
[High-dosage chemotherapy in primary metastasized and relapsed
Ewing's sarcoma. (EI)CESS]. Klin Padiatr. 1999; 211:284-90. [0441]
10. Horowitz M E, Kinsella T J, Wexler L H, et al. Total-body
irradiation and autologous bone marrow transplant in the treatment
of high-risk Ewing's sarcoma and rhabdomyosarcoma. J Clin Oncol.
1993; 11:1911-8. [0442] 11. Ladenstein R, Lasset C, Pinkerton R, et
al. Impact of megatherapy in children with high-risk Ewing's
tumours in complete remission: a report from the EBMT Solid Tumour
Registry [published erratum appears in Bone Marrow Transplant 1996
September; 18(3):675]. Bone Marrow Transplant. 1995; 15:697-705.
[0443] 12. Ladenstein R, Philip T, Gardner H. Autologous stem cell
transplantation for solid tumors in children. Curr Opin Pediatr.
1997; 9:55-69. [0444] 13. Laws H J, Burdach S, van Kaick B, et al.
Multimodality diagnostics and megatherapy in poor prognosis Ewing's
tumor patients. A single-center report. Strahlenther Onkol. 1999;
175:488-94. [0445] 14. Pape H, Laws H J, Burdach S, et al.
Radiotherapy and high-dose chemotherapy in advanced Ewing's tumors.
Strahlenther Onkol. 1999; 175:484-7. [0446] 15. Perentesis J,
Katsanis E, DeFor T, Neglia J, Ramsay N. Autologous stem cell
transplantation for high-risk pediatric solid tumors. Bone Marrow
Transplant. 1999; 24:609-15. [0447] 16. Pession A, Prete A,
Locatelli F, et al. Phase I study of high-dose thiotepa with
busulfan, etoposide, and autologous stem cell support in children
with disseminated solid tumors. Med Pediatr Oncol. 1999; 33:450-4.
[0448] 17. Stewart D A, Gyonyor E, Paterson A H, et al. High-dose
melphalan+/-total body irradiation and autologous hematopoietic
stem cell rescue for adult patients with Ewing's sarcoma or
peripheral neuroectodermal tumor. Bone Marrow Transplant. 1996;
18:315-8. [0449] 18. Rill D R, Santana V M, Roberts W M, et al.
Direct demonstration that autologous bone marrow transplantation
for solid tumors can return a multiplicity of tumorigenic cells.
Blood. 1994; 84:380-3. [0450] 19. Brenner M K, Rill D R, Moen R C,
et al. Gene-marking to trace origin of relapse after autologous
bone-marrow transplantation. Lancet. 1993; 341:85-6. [0451] 20.
Mackall C, Long L, Dagher R, et al. Combined Immune
Reconstitution/Tumor Vaccination to induce anti-tumor immune
responses in the setting of minimal residual neoplastic disease
[abstract]. Blood. 1999; 94:133a. [0452] 21. Quinones R R,
Gutierrez R H, Dinndorf P A, et al. Extended-cycle elutriation to
adjust T-cell content in HLA-disparate bone marrow transplantation.
Blood. 1993; 82:307-17. [0453] 22. Kontny H U, Lehrnbecher T M,
Chanock S J, Mackall C L. Simultaneous expression of Fas and
nonfunctional Fas ligand in Ewing's sarcoma. Cancer Res. 1998;
58:5842-9. [0454] 23. Chirgwin J M, Przybyla A E, MacDonald R J,
Rutter W J. Isolation of biologically active ribonucleic acid from
sources enriched in ribonuclease. Biochemistry. 1979; 18:5294-9.
[0455] 24. de Wynter E A, Coutinho L H, Pei X, et al. Comparison of
purity and enrichment of CD34+ cells from bone marrow, umbilical
cord and peripheral blood (primed for apheresis) using five
separation systems. Stem Cells. 1995; 13:524-32. [0456] 25. Mackall
C L, Gress R E. Pathways of T-cell regeneration in mice and humans:
implications for bone marrow transplantation and immunotherapy.
Immunol Rev. 1997; 157:61-72. [0457] 26. Dworzak M N, Fritsch G,
Buchinger P, et al. Flow cytometric assessment of human MIC2
expression in bone marrow, thymus, and peripheral blood. Blood.
1994; 83:415-25. [0458] 27. Modak S, Gultekin S, Kramer K, et al.
Novel Tumor-Associated Antigen: Broad distribution among
neuroectodermal, mesenchymal and epithelial tumors, with restricted
distribution in normal tissues. Abstract: Proceedings at ASCO.
1998. [0459] 28. Vogel W, Scheding S, Kanz L, Brugger W. Clinical
applications of CD34(+) peripheral blood progenitor cells (PBPC).
Stem Cells. 2000; 18:87-92. [0460] 29. Dyson P G, Horvath N, Joshua
D, et al. CD34+ selection of autologous peripheral blood stem cells
for transplantation following sequential cycles of high-dose
therapy and mobilisation in multiple myeloma [In Process Citation].
Bone Marrow Transplant. 2000; 25:1175-84. [0461] 30. Emig M,
Saussele S, Wittor H, et al. Accurate and rapid analysis of
residual disease in patients with CML using specific fluorescent
hybridization probes for real time quantitative RT-PCR. Leukemia.
1999; 13:1825-32. [0462] 31. Mensink E, van de Locht A,
Schattenberg A, et al. Quantitation of minimal residual disease in
Philadelphia chromosome positive chronic myeloid leukaemia patients
using real-time quantitative RT-PCR. Br J Haematol. 1998;
102:768-74. [0463] 32. Pongers-Willemse M J, Verhagen O J, Tibbe G
J, et al. Real-time quantitative PCR for the detection of minimal
residual disease in acute lymphoblastic leukemia using junctional
region specific TaqMan probes. Leukemia. 1998; 12:2006-14. [0464]
33. Branford S, Hughes T P, Rudzki Z. Monitoring chronic myeloid
leukaemia therapy by real-time quantitative PCR in blood is a
reliable alternative to bone marrow cytogenetics. Br J Haematol.
1999; 107:587-99.
Fourth Series of Experiments
Disialoganglioside GD2 and Novel Tumor-Restricted Antigen 8H9:
Potential Targets for Antibody-Based Immunotherapy Against
Desmoplastic Small Round Cell Tumor.
[0465] Desmoplastic small round cell tumor (DSRCT) is an
aggressive, often misdiagnosed neoplasm of children and young
adults. It is chemotherapy-sensitive, yet patients often relapse
off therapy because of residual microscopic disease at distant
sites: peritoneum, liver, lymph node and lung. Strategies directed
at minimal residual disease (MRD) may be necessary for cure.
Monoclonal antibodies selective for cell surface tumor-associated
antigens may have utility for diagnosis and therapy of MRD, as
recently demonstrated in advanced-stage neuroblastoma (JCO 16:
3053, 1998). Using immunohistochemistry, we studied the expression
of two antigens: (1) G.sub.D2 using antibody 3F8 and (2) a novel
antigen using antibody 8H9, in a panel of 36 freshly frozen DSRCT.
G.sub.D2 is a disialoganglioside which is widely expressed among
neuroectodermal tumors as well as adult sarcomas. 8H9 recognizes a
surface 58 kD antigen expressed among neuroectodermal, mesenchymal
and epithelial tumors with restricted expression on normal tissues.
27 of 37 tumors (73%) were reactive with 3F8, and 35 of 37 (95%)
with 8H9. Both G.sub.D2 and the 58 kD antigen were found on tumor
cell membrane and in stroma. In general, immunoreactivity was
stronger and more homogeneous with 8H9 than with 3F8. These
antigens are potential targets for immunodiagnosis and
antibody-based therapy of DSRCT.
[0466] Desmoplastic small round cell tumor (DSRCT) is an
aggressive, ill-understood tumor affecting children and young
adults. It is characterized clinically by widespread abdominal
serosal involvement, metastasizes to peritoneum, liver, lungs and
lymph nodes, and is associated with a poor prognosis (Gerald et
al., 1991). Histologically, it consists of small, undifferentiated
round cells surrounded by an abundant desmoplastic stroma.
Immunohistochemically, the coexpression of epithelial, neural and
muscle markers is typical (Ordonez et al., 1993). DSRCT is
associated with a specific chromosomal translocation,
t(11;22)(p13;q12). The fused gene product aligns the NH2 terminal
domain of the EWS gene to the zinc finger DNA-binding domain of the
WT1 gene and is diagnostic of DSRCT (Ladanyi et al., 1994). This
fusion results in the induction of endogenous platelet derived
growth factor-A which stimulates fibroblast growth and may
contribute to the unique fibrosis observed with this tumor (Lee et
al, 1997). Further evidence of upregulation of growth factors
includes the reported expression of IGF-II, PDGF-a receptor and
IL-11 in DSRCT (Froberg et al., 1999).
[0467] Although dramatic response to aggressive multimodality
therapy has been demonstrated in the patients with DSRCT (Kushner
et al., 1996), many patients relapse with recurrent local disease
or distant metastases. Strategies aimed at eradication of MRD are,
therefore, warranted in the management of patients with DSRCT.
Monoclonal antibodies selective for cell surface tumor-associated
antigens are potential candidates as recently demonstrated in
neuroblastoma where immune targeting of the diasialoganglioside
G.sub.D2 has significantly improved long-term survival in patients
with stage 4 disease (Cheung et al., 1998). Few such
tumor-associated targets have been defined for DSRCT. We describe
here two possible targets for such immunotherapy: G.sub.D2 targeted
by the monoclonal antibody 3F8 and a novel tumor antigen recognized
by the monoclonal antibody 8H9.
Materials and Methods
Tumor and Normal Tissue Samples
[0468] Frozen tumors from 37 patients with DSRCT were analyzed.
Diagnosis was confirmed by hematoxylin and eosin assessment of
paraffin-fixed specimens.
Monoclonal Antibodies
[0469] The murine IgG.sub.3 monoclonal antibody 3F8 was purified
from ascites as previously described (Cheung et al., 1985). Using a
similar technique, female BALB/c mice were hyperimmunized with
human neuroblastoma. Lymphocytes derived from these mice were fused
with SP2/0 mouse myeloma cells line. Clones were selected for
specific binding on ELISA. The 8H9 hybridoma secreting an IgG1
monoclonal antibody was selected. 8H9 was produced in vitro and
purified by protein G (Pharmacia, Piscataway, N.J.) affinity
chromatography.
Immunohistochemical Studies
[0470] Eight m cryostat frozen tumor sections were fixed in acetone
and washed in PBS. Immunohistochemical studies were performed as
previously described (Kramer et al. 1996) Endogenous peroxidases
were blocked in 0.3% H.sub.2O.sub.2 in PBS. Sections were incubated
in 10% horse serum (Gibco BRL Gaithersburg, Md.) after blocking
with avidin and biotin. Incubation with purified 8H9 diluted in PBS
to 2 g/ml was carried out at room temperature for 1 hour. An IgG1
myeloma was used as a control (Sigma Chemical, St Louis Mo.).
Sections were incubated with a secondary horse anti-mouse
biotinylated antibody (Vector Laboratories, Burlingame, Calif.)
followed by incubation with ABC complex (Vector Laboratories,
Burlingame, Calif.) and stained with Vector VIP peroxidase
substrate (Vector Laboratories, Burlingame, Calif.) or DAB
peroxidase substrate kit (Vector Laboratories, Burlingame, Calif.).
A 10% hematoxylin counterstain for 2 minutes was used. Staining was
graded as positive or negative and homogenous or heterogenous
reactivity noted.
Results
Clinical Profile
[0471] Of the 37 patients studied, 32 were male and five female.
Age at diagnosis ranged from 13 to 46 years (median 18 years). All
received treatment with an aggressive multimodality regimen
including dose-intensive chemotherapy.
Immunoreactivity
[0472] Tumor sections from 37 patients were tested for the
expression of G.sub.D2 and the antigen recognized by 8H9 by
immunohistochemistry. 27 of 37 (73%) tested positive for G.sub.D2.
(Table 1). Most tumors had strong immunoreactivity (>1+).
Immunoreactivity was seen homogeneously in most tumors and was
localized to the cell membrane (FIG. 16). Intense stromal staining
was marked in all tumors studied.
TABLE-US-00019 TABLE 1 Immunoreactivity of 3F8 and 8H9 with DSRCT
No. Reactivity No. Homo- Hetero- Marker tested 0 1+ 2+ 3+ pos. (%)
geneous geneous G.sub.D2 36 10 10 12 4 26 (72) 19 7 Antigen 8H9 36
2 9 17 8 34 (94) 32 2
[0473] 35 of 37 (95%) tumors tested positive for 8H9.
Immunoreactivity had a characteristic cell membrane localization
and was homogeneous in almost all tumors (FIG. 17).
Immunoreactivity was more strongly marked than that with 3F8.
Equally strong stromal staining was seen.
Clinicopathologic Correlation
[0474] In this group of highly aggressive disseminated tumors,
there was no correlation between outcome and the expression of
either G.sub.D2 or the 8H9 antigen (Table 2)
TABLE-US-00020 TABLE 2 G.sub.D2 and Antigen 8H9: Correlation with
outcome G.sub.D2 8H9 positive positive Expired* 10/17 16/17
Survivors < 18 mo since diagnosis 11/14 13/14 Survivors < 18
mo since diagnosis 5/5 5/5 *1 patient died of treatment-related
toxicity
Discussion
[0475] The clinicopathological spectrum of DSRCT continues to be
further defined since the initial series was reported in 1991
(Gerald et al., 1991). Chemosensitivity to doxorubicin and
alkylator-based chemotherapy has been reported (Gonzalez-Crussi et
al., 1990). Prolonged survival in response to an aggressive
multimodality regimen including high-dose chemotherapy, radiation
and surgery has also been reported (Kushner et al., 1996). However,
most patients succumb to recurrent local disease or metastases to
peritoneum, liver, lymph nodes, or lung. Relapses can be largely
attributed to the failure of eradication of MRD. Alternative
therapeutic strategies to target MRD are therefore warranted. One
such strategy could be directed at the upregulated growth factors
particularly PDGFA and related factors expressed on DSRCT (Froberg
et al., 1999). Targeted immunotherapy utilizing monoclonal
antibodies, which does not add to the toxicity of chemotherapy, is
another approach.
[0476] DSRCT is characterized by the coexpression of epithelial,
mesenchymal and neuroectodermal markers. Recent publications have
defined the immunohistochemical and molecular make-up of DSRCT
(Ordonez, 1998; Gerald, 1999). However, most of the markers
identified cannot be used as targets for antibody mediated
immunotherapy either due to crossreactivity with normal tissues or
inaccessibility to monoclonal antibodies due to localization in the
nucleus or cytoplasm. (Table 3). The most commonly expressed
markers on DSRCT including desmin, cytokeratin, vimentin,
epithelial membrane antigen and neuron-specific enolase are also
widely expressed on normal tissues. The MIC2 antigen has been
reported to be expressed on 20-35% of DSRCT. However, unlike
Ewing's sarcoma family of tumors, which have membrane localization,
immunoreactivity in DSRCT is primarily cytoplasmic (Gerald et al,
1998). MOC31, a monoclonal antibody that recognizes epithelial
glycoprotein 2 (EGP-2) has been shown to be reactive with most
DSRCT tested (Ordonez, 1998). EGP-2 is overexpressed on epithelial
tumors, but is also present on normal epithelial cells (de Leij et
al, 1994). Antibodies directed against the WT1 protein have strong,
specific, nuclear immunoreactivity with almost all DSRCT tested
(Gerald et al, 1998)
TABLE-US-00021 TABLE 3 Previously reported antigens on DSRCT
Antigen Localization Crossreactivity Intermediate filaments Desmin
cytoplasm skeletal, cardiac & smooth muscle Vimentin cytoplasm
mesenchymal tissues Keratin cytoplasm epithelial cells Epithelial
antigens Epithelial membrane antigen cytoplasm epithelial cells
Epithelial glycoprotein-2 cytoplasm epithelial cells Ber-Ep4
antigen cytoplasm epithelial cells Neural antigens CD57 cytoplasm
neural tissues Neuron-specific enolase cytoplasm neural tissues
MIC-2 cytoplasm & cell lymph nodes, membrane epithelial cells
WT1 protein Nucleus None PDGFA Cell membrane Endothelial cells,
PDGF-.alpha.receptor Cell membrane hematopoeitic cells Endothelial
cells, hematopoeitic cells
[0477] The reported expression of neuroectodermal antigens on DSRCT
led us to study these tumors for the expression of G.sub.D2: a
disialoganglioside which is expressed on other small blue round
cell tumors such as neuroblastoma, small cell lung cancer, melanoma
and osteosarcoma (Heiner et al., 1987) as well as on adult soft
tissue sarcomas (Chang et al., 1992). G.sub.D2 is a safe target for
immunotherapy based on clinical trials of the anti-G.sub.D2
antibody 3F8 in patients with neuroblastoma. tissues of the nervous
system (Cheung et al., 1998). Serum G.sub.D2 does not interfere
with the biodistribution of specific antibodies and the antigen is
not modulated from the cell surface upon binding by antibodies.
Successful targeting of the monoclonal antibody 3F8 to G.sub.D2 was
previously demonstrated in neuroblastoma (Yeh et al., 1991) and
small cell lung cancer (Grant et al., 1996). 3F8 has also shown
efficacy in clinical trials in patients with neuroblastoma (Cheung
et al., 1998b) and melanoma (Cheung et al., 1987). Furthermore, 3F8
appeared to induce long-term remissions in patients with Stage 4
neuroblastoma. Reported side effects are short-lived and manageable
(Cheung et al., 1998). In our study 72% of DSRCT tested were
immunoreactive with the anti-GD2 antibody 3F8. Most tumors showed
strong, homogeneous reactivity localized to the cell membrane.
(Table 1) (FIG. 16) DSRCT may be a putative tumor for in vivo
antibody targeting with 3F8. Alternatively, an anti-idiotypic
vaccine approach can be utilized as has been suggested for
neuroblastoma. (Cheung et al, 1994)
[0478] The monoclonal antibody 8H9 is a murine IgG1 derived from
mice immunized with neuroblastoma. It has been shown to have a
broad expression on neuroectodermal, mesenchymal and epithelial
tumors with limited expression on normal tissues. (data not shown).
Its immunoreactive profile led us to use it for testing DSRCT. 95%
of tumors tested positive with DSRCT. Immunoreactivity with DSRCT
was localized to the stroma and cell membrane (FIG. 17) and for
most tumors was intense and homogeneous, and in general, stronger
than that observed for GD2 (Table 2).
[0479] The target antigen for 8H9 appears to be a novel 58 kD
glycoprotein with a unique distribution on cell membranes of tumors
of varying lineage, but restricted expression in normal tissues.
This tissue distribution makes it likely to be a unique antigen not
previously described on DSRCT. The cell membrane localization of
8H9 allows it to be targeted by monoclonal antibodies. 8H9
conjugated with I.sup.131 has been shown to radioimmunolocalize
neuroblastoma and rhabdomyosarcoma xenografts in mice without
significant crossreactivity with other organs. (data not
shown).
[0480] In the therapy of DSRCT, strategies to eliminate minimal
residual disease are necessary to produce cures. Monoclonal
antibody based therapy may augment aggressive multimodality therapy
by targeting minimal residual disease without adding to toxicity.
Our study has identified G.sub.D2 and antigen 8H9 as two hitherto
undescribed markers for DSRCT, which can potentially be targets for
differential diagnosis and immunotherapy.
REFERENCES
[0481] Chang H. R., Cordon-Cardo C., Houghton A. N., Cheung N. K.,
and Brennan M. F., Expression of disialogangliosides G.sub.D2 and
G.sub.D3 on human soft tissue sarcomas. Cancer 70: 633-8, (1992)
[0482] Cheung N. K., Saarinen, U., Neely, J., Landmeier, B.,
Donovan D., and Coccia, P. Monoclonal antibodies to a glycolipid
antigen on human neuroblastoma cells. Cancer Res., 45: 2642-2649,
(1985) [0483] Cheung N. K., Lazarus, H., Miraldi F. D., Abramowsky,
C. R., Kallick S., Saarinen, U. M., Spitzer, T., Strandjord, S. E.,
Coccia, P. F., and Berger, N. A. Ganglioside G.sub.D2 specific
monoclonal antibody 3F8: a phase I study in patients with
neuroblastoma and malignant melanoma. J. Clin. Oncol. 5: 1430-40,
(1987) [0484] Cheung, N. K., Cheung, I. Y., Canete, A., Yeh, S. J.,
Kushner, B., Bonilla, M. A., Heller, G., and Larson, S. M. Antibody
response to murine anti G.sub.D2 monoclonal antibodies: correlation
with patient survival. Cancer Res. 54: 2228-33 (1994) [0485] Cheung
N K., Kushner B. H., Yeh S. D. J., and Larson S. M., 3F8 monoclonal
antibody treatment of patients with stage 4 neuroblastoma: a phase
II study. Int. J. Oncol 12: 1299-306, (1998b) [0486] Cheung, N. K.,
Kushner, B. H., Cheung, I. Y., Kramer, K., Canete, A., Gerald, W.,
Bonilla, M. A., Finn, R., Yeh, S., and Larson, S. M., Anti G.sub.D2
antibody treatment of minimal residual stage 4 neuroblastoma
diagnosed at more than 1 year of age. J. Clin. Oncol., 16: 3053-60,
(1998) [0487] De Leij, L., Helrich, W., Stein, R., and Mattes M. J.
SCLC-cluster-2 antibodies detect the pancarcinoma/epithelial
glycoprotein E GP-2 (supplement) Int. J. Cancer 8: 60-3, 1994
Froberg, K., Brown, R. E., Gaylord, H., Manivel, C.,
Intra-abdominal desmoplastic small round cell tumor:
immunohistochemical evidence for up-regulation of autocrine and
paracrine growth factors. Ann Clin Lab Sci 29: 78-85, 1999 [0488]
Gonzalez-Crussi, F., Crawford, S. E., and Sun, C. J. Intraabdominal
desmoplastic small-cell tumors with divergent differentiation.
Observation on three cases of childhood. Am. J. Surg. Pathol. 15:
499-513, (1991) [0489] Grant, S. C., Kostakoglu, L., Kris, M. G.,
Yeh, S. D., Larson, S. M., Finn, R. D., Oettgen, H. F., and Cheung,
N. K. targeting of small-cell lung cancer using the anti-G.sub.D2
ganglioside monoclonal antibody 3F8: a pilot trial. Eur. J. Nucl.
Med. 23: 145-9 (1996) [0490] Heiner, J. P., Miraldi, F., Kallick,
S., Makley J., Neely, J., Smith-Mensah, W. H., and Cheung N. K.
Localization of G.sub.D2-specific monoclonal antibody 3F8 in human
osteosarcoma. Cancer Res. 47: 5377-81 (1987) [0491] Kramer, K.,
Gerald, W., Le Sauteur, L., UriSaragovi, H., and Cheung, N. K.
Prognostic Value of TrkA Protein Detection by Monoclonal Antibody
5C3 in Neuroblastoma. Clin. Cancer Res. 2: 1361-1367, 1996 [0492]
Kushner, B. H., LaQuaglia M. P., Wollner, N., Meyers, P. A.,
Lindsley, K. L., Ghavimi, F., Merchant, T. E., Boulad, F., Cheung,
N. K., Bonilla, M. A., Crouch, G., Kelleher, J. F., Steinherz, P.
G., and Gerald, W. L., Desmoplastic small round-cell tumor:
prolonged progression-free survival with aggressive multimodality
therapy. J. Clin. Oncol. 14: 1526-31, (1996) [0493] Ladanyi, M.,
and Gerald, W., Fusion of the EWS and WT1 genes in the desmoplastic
small round cell tumor. Cancer Res. 54: 2837-40, (1994) [0494] Lee,
S. B., Kolquist, K. A., Nichols, K., Englert, C., Maheshwaran, S.,
Ladanyi, M., et al., The EWS-WT1 translocation product induces
PDGFA in desmoplastic small round-cell tumour. Nat Genet 17,
309-13, 1997 [0495] Gerald, W. L., Miller, H. K., Battifora, H.,
Miettenen, M., Silva, E. G., and Rosai, J., Intrabdominal
desmoplastic small round cell tumor. Report of 19 cases of a
distinctive type of high-grade polyphenotypic malignancy affecting
young individuals. Am. L. Surg. Pathol. 15, 499-513, (1991) [0496]
Gerald, W. L., Ladanyi, M. L., De Alava, E., Cuatrecasas, M.,
Kushner, B. H., LaQuaglia, M. P., and Rosai, J. Clinical
pathologic, and molecular spectrum of tumors associated with
t(11;22)(p13;q12): desmoplastic small round-cell tumor and its
variants. J. Clin. Oncol., 16: 3028-36, (1998) [0497] Ordonez, N.
G., El-Naggar, A. K., Ro, J. Y., Silva, E. G., Mackay B.,
Intra-abdominal desmoplastic small cell tumor: a light microscopic,
immunocytochemical, ultrastructural, and flow cytometric study.
Hum. Pathol. 24, 850-65, (1993) [0498] Ordonez, N. G. Desmoplastic
small round cell tumor: II: an ultrastructural and
immunohistochemical study with emphasis on new immunohistochemical
markers. Am. J. Surg. Pathol. 22: 1314-27, (1998) [0499] Yeh S. D.,
Larson, S. M., Burch, L., Kushner, B. H., LaQuaglia, M, Finn, R.,
and Cheung, N. K. Radioimmunodetection of neuroblastoma with
iodine-131-3F8: correlation with biopsy,
iodine-131-metaiodobenzylguanidine and standard diagnostic
modalities. J. Nucl. Med. 32: 769-76 (1991)
Fifth Series of Experiments
Anti-Idiotypic Antibody as the Surrogate Antigen for Cloning ScFv
and its Fusion Proteins
[0500] ScFv provides a versatile homing unit for novel
antibody-fusion constructs. However, a reliable screening and
binding assay is often the limiting step for antigens that are
difficult to clone or purify. We demonstrate that anti-idiotypic
antibodies can be used as surrogate antigens for cloning scFv and
their fusion proteins. 8H9 is a murine IgG1 monoclonal antibody
specific for a novel antigen expressed on the cell surface of a
wide spectrum of human solid tumors but not in normal tissues
(Cancer Res 61:4048, 2001) Rat anti-8H9-idiotypic hybridomas
(clones 2E9, 1E12 and 1F11) were produced by somatic cell fusion
between rat lymphocytes and mouse SP2/0 myeloma. In direct binding
assays (ELISA) they were specific for the 8H9 idiotope. Using 2E9
as the surrogate antigen, 8H9-scFv was cloned from hybridoma cDNA
by phage display. 8H9scFv was then fused to
.quadrature.human-1-CH2-CH3 cDNA for transduction into CHO and NSO
cells. High expressors of mouse scFv-human Fc chimeric antibody
were selected. The secreted homodimer reacted specifically with
antigen-positive tumor cells by ELISA and by flow cytometry,
inhibitable by the anti-idiotypic antibody. The reduced size
resulted in a shorter half-life in vivo, while achieving comparable
tumor to nontumor ratio as the native antibody 8H9. However, it
could not mediate antibody-dependent cell-mediated or
complement-mediated cytotoxicities in vitro.
1. Introduction
[0501] The ability to condense the binding site by genetic fusion
of variable region immunoglobulin genes to form scFv has greatly
expanded the potential and development of antibody-based targeted
therapies (Bird et al., 1988; Huston et al., 1988; Winter and
Milstein, 1991; George et al., 1994). Using phage display
libraries, scFv can now be cloned from cDNA libraries derived from
rodents, immunized volunteers, or patients (Burton and Barbas III,
1994; Winter et al., 1994; Cai and Garen, 1995; Raag and Whitlow,
1995). The availability of hIg-transgenic and transchromosomal mice
will allow immunization schema or pathogens not feasible or safe in
humans. Construction of the scFv is the critical first step in the
synthesis of various fusion proteins, including scFv-cytokine (Shu
et al., 1993), scFv-streptavidin (Kipriyanov et al., 1995),
scFv-enzyme (Michael et al., 1996), scFv-toxins (Wikstrand et al.,
1995), bispecific scFv (diabodies) (Alt et al., 1999), bispecific
chelating scFv (DeNardo et al., 1999), scFv-Ig (Shu et al., 1993),
tetravalent scFv (Alt et al., 1999; Santos et al., 1999) and
scFv-retargeted T-cells (Eshhar et al., 1993). ScFv-Ig constructs
mimic natural IgG molecules in their homodimerization through the
Fc region, as well as their ability to activate complement (CMC)
and mediate antibody dependent cell-mediated cytotoxicites
(ADCC).
[0502] The construction of scFv requires a reliable antigen
preparation both for panning phages and for binding assays. They
often become a rate-limiting step (Lu and Sloan, 1999),
particularly for antigens that are difficult to clone or purify.
Cell-based phage display (Watters et al., 1997), and enzyme linked
immunosorbent assays (ELISA) when optimized, have been successfully
applied as alternatives. However, subtle differences in the panning
step can determine the success or failure of phage display (Tur et
al., 2001). For example, a reduction in wash pH is needed for scFv
directed at ganglioside GD2 in order to reduce nonspecific
adherence of phage particles (Tur et al., 2001). Moreover, phage
binding assay may require membrane preparations to withstand the
vigorous washing procedure.
[0503] Anti-idiotypic antibodies are frequently used as antigen
mimics of infectious agents and tumor antigens (Thanavala et al.,
1986; Wagner et al., 1997). When made as MoAb, they are ideal
surrogates when the target antigen is not readily available. The
physico-chemical behavior of immunoglobulins as antigens in panning
and binding assays is generally known and can be easily
standardized. We recently described a novel tumor antigen reactive
with a murine MoAb 8H9 (Modak et al., 2001). Given its lability and
glycosylation, this antigen is difficult to purify. Here we
describe the use of an anti-idiotypic antibody as a surrogate
antigen for cloning a scFv derived from the 8H9 hybridoma cDNA
library, and for the selection of chimeric mouse scFv-human Fc
fusion constructs.
2. Materials and Methods
2.1 Animals
[0504] BALB/c mice were purchased from Jackson Laboratories, Bar
Harbor, Me. Lou/CN rats were obtained from the National Cancer
Institute-Frederick Cancer Center (Bethesda, Md.) and maintained in
ventilated cages. Experiments were carried out under a protocol
approved by the Institutional Animal Care and Use Committee, and
guidelines for the proper and humane use of animals in research
were followed.
2.2 Cell Lines
[0505] Human neuroblastoma cell lines LAN-1 was provided by Dr.
Robert Seeger (Children's Hospital of Los Angeles, Los Angeles,
Calif.), and NMB7 by Dr. Shuen-Kuei Liao (McMaster University,
Ontario, Canada). Cell lines were cultured in 10% defined calf
serum (Hyclone, Logan, Utah) in RPMI with 2 mM L-glutamine, 100
U/ml of penicillin (Sigma-Aldrich, St. Louis, Mo.), 100 ug/ml of
streptomycin (Sigma-Aldrich), 5% CO.sub.2 in a 37.degree. C.
humidified incubator. Normal human mononuclear cells were prepared
from heparinized bone marrow samples by centrifugation across a
Ficoll-Hypaque density separation gradient. Human AB serum (Gemini
Bioproducts, Woodland, Calif.) was used as the source of human
complement.
2.3 Monoclonal Antibodies
[0506] Cells were cultured in RPMI 1640 with 10% newborn calf serum
(Hyclone, Logan, Utah) supplemented with 2 mM glutamine, 100 U/ml
of penicillin and 100 ug/ml of streptomycin (Sigma-Aldrich). 3F8,
an IgG3 MoAb raised in a Balb/c mouse against human neuroblastoma,
specifically recognizes the ganglioside GD2. The BALB/c myeloma
proteins MOPC-104E, TEPC-183, MOPC-351, TEPC-15, MOPC-21, UPC-10,
MOPC-141, FLOPC-21, and Y5606 were purchased from Sigma-Aldrich.
MoAb R24 (anti-GD3), V1-R24, and K9 (anti-GD3) were gifts from Dr.
A. Houghton, OKB7 and M195 (anti-CD33) from Dr. D. Scheinberg, and
10-11 (anti-GM2) from Dr. P. Livingston of Memorial Sloan Kettering
Cancer Center, New York; and 528 (EGF-R) from Dr. J. Mendelsohn of
MD Anderson, Houston, Tex. 2E6 (rat anti-mouse IgG3) was obtained
from hybridomas purchased from American Type Culture Collection
[ATCC] (Rockville, Md.). NR-Co-04 was provided by Genetics
Institute (Cambridge, Mass.). In our laboratory, 5F9, 8H9, 3A5,
3E7, 1D7, 1A7 were produced against human neuroblastoma; 2C9, 2E10
and 3E6 against human breast carcinoma, and 4B6 against
glioblastoma multiforme. They were all purified by protein A or
protein G (Pharmacia, Piscataway, N.J.) affinity
chromatography.
2.4 Anti-8H9 Anti-Idiotypic Antibodies
[0507] LOU/CN rats were immunized intraperitoneally (ip) with 8H9
(400 ug per rat) complexed with rabbit anti-rat serum (in 0.15 ml),
and emulsified with an equal volume (0.15 ml) of Complete Freund's
Adjuvant (CFA) (Gibco-BRL, Gaithersburg, Md.). The 8H9-rabbit-IgG
complex was prepared by mixing 2 ml (8 mg) of purified 8H9 with 4
ml of a high titer rabbit anti-rat precipitating serum (Jackson
Immunoresearch Laboratories, West Grove, Pa.). After incubation at
4.degree. C. for 3 hours, the precipitate was isolated by
centrifugation at 2500 rpm for 10 minutes, and resuspended in PBS.
Three months after primary immunization, the rats were boosted ip
with the same antigen in CFA. One month later, a 400 ug boost of
8H9-rabbit-anti-mouse complex was injected intravenously. Three
days afterwards, the rat spleen was removed aseptically, and
purified lymphocytes were hybridized with SP2/0-Ag14 (ATCC). Clones
selection was based on specific binding to 8H9 and not to control
antibody 5F9, a murine IgG. Repeated subcloning using limiting
dilution was done. Isotypes of the rat monoclonal antibodies were
determined by Monoclonal Typing Kit (Sigma-Aldrich). Rat
anti-idiotypic antibody clones (2E9, 1E12, 1F11) were chosen and
produced by high density miniPERM bioreactor (Unisyn technologies,
Hopkinton, Mass.), and purified by protein G affinity
chromatography (Hitrap G, Pharmacia). The IgG fraction was eluted
with pH 2.7 glycine-HCl buffer and neutralized with 1 M Tris buffer
pH 9. After dialysis in PBS at 4.degree. C. for 18 hours, the
purified antibody was filtered through a 0.2 um millipore filter
(Millipore, Bedford, Mass.), and stored frozen at -70.degree. C.
Purity was determined by SDS-PAGE electrophoresis using 7.5%
acrylamide gel.
[0508] The "standard" ELISA to detect rat anti-idiotypic antibodies
(Ab2) was as follows: Purified 8H9, or irrelevant IgG1 myeloma,
were diluted to 5 ug/ml in PBS and 50 ul per well was added to
96-well flat-bottomed polyvinylchloride (PVC) microtiter plates and
incubated for 1 hour at 37.degree. C. Rows with no antigen were
used for background subtraction. Filler protein was 0.5% BSA in PBS
and was added at 100 ul per well, and incubated for 30 minutes at
4.degree. C. After washing, 50 ul duplicates of hybridoma
supernatant was added to the antigen-coated wells and incubated for
3 hours at 37.degree. C. The plates were washed and a
peroxidase-conjugated mouse anti-rat IgG+IgM (Jackson
Immunoresearch Laboratory) at 100 ul per well was allowed to react
for 1 hour at 4.degree. C. The plate was developed using the
substrate o-phenylenediamine (Sigma-Aldrich) (0.5 mg/ml) and
hydrogen peroxide (0.03%) in 0.1 M citrate phosphate buffer at pH
5. After 30 minutes in the dark, the reaction was quenched with 30
ul of 5 N sulfuric acid and read using an ELISA plate reader.
2.5 Specificity by Direct Binding Assay
[0509] Fifty ul per well of purified mouse monoclonal antibodies or
myelomas were coated onto 96-well PVC microtiter plates at 5 ug/ml
for 60 minutes at 37.degree. C., aspirated and then blocked with
100 ul of 0.5% BSA filler protein per well. After washing and
air-drying, the wells were allowed to react with anti-idiotypic
antibodies. The rest of the procedure was identical to that
described in the "standard" assay.
2.6 Specificity by Inhibition Assay
[0510] To further examine the specificity of these anti-idiotypic
antibodies, inhibition of 8H9 immunofluorescent staining of tumor
cells by anti-idiotypic antibodies was tested. Purified 8H9 and
anti-GD2 MoAb 3F8, (all 10 ug/ml in 0.5% BSA) were preincubated
with various concentrations of anti-idiotypic antibodies for 30
minutes on ice before reacting with 10.sup.6 cells of either
GD2-positive/8H9 positive LAN-1 (neuroblastoma) or
GD2-negative/8H9-positive HTB-82 (rhabdomyosarcoma). The cells were
then washed twice in PBS with 0.1% sodium azide and reacted with
FITC-conjugated rat anti-mouse IgG (Biosource, Burlingame, Calif.)
on ice for 30 minutes in the dark. The cells were washed in PBS
with azide, fixed in 1% paraformaldehyde and analyzed by FACScan
(Becton-Dickinson, Calif.). The mean fluorescence was calculated
and the inhibition curve computed.
2.7 Construction of scFv Gene
[0511] mRNA was isolated from 8H9 hybridoma cells using a
commercially available kit (Quick Prep Micro mRNA Purification,
Pharmacia Biotech) following the procedures outlined by the
manufacturer. 5.times.10.sup.6 hybridoma cells cultured in
RPMI-1640 medium supplemented 10% calf serum, L-glutamine (2
mmol/L), penicillin (100 u/L) and streptomycin sulphate (100 ug/ml)
were pelleted by centrifugation at 800.times.g and washed once in
RNase-free phosphate buffered saline (pH 7.4). The recentrifuged
cells were lysed directly in the extraction buffer. Poly(A)-RNA was
purified by a single fractionation over oligo (dT)-cellulose and
eluted from oligo (dT) cellulose in the elution buffer. The mRNA
sample was precipitated for 1 hour with 100 ug glycogen, 40 ul of
2M potassium acetate solution and 1 ml of absolute ethanol at
-20.degree. C. The nucleic acid was recovered by centrifugation at
10,000.times.g for 30 min. The sample was evaporated until dry, and
dissolved in 20 ul RNase-free water.
[0512] ScFv gene was constructed by recombinant phage display. 5 ul
of mRNA was reversely transcribed in a total volume of 11 ul
reaction mixture and 1 ul dithiothreitol (DTT) solution for 1 hour
at 37.degree. C. For the PCR amplification of 8H9 immunoglobulin
variable regions, light chain primer mix and the heavy chain primer
set (Pharmacia) were added respectively to generate suitable
quantities of the heavy (340 bp) and light (325 bp) chain.
Following an initial 10 min dwell at 95.degree. C., 5 U AmpliTaq
Gold DNA polymerase (Applied Biosystems, Foster City, Calif.) was
added. The PCR cycle consisted of a 1 min denaturation step at
94.degree. C., a 2 min annealing step at 55.degree. C. and a 2 min
extension step at 72.degree. C. After 30 cycles of amplification,
PCR derived fragment was purified by the glassmilk beads (Bio101,
Vista, Calif.) and then separated by 1.5% agarose gel
electrophoresis in TAE buffer and detected by ethidium bromide
staining.
[0513] For the assembly and fill-in reaction, both purified heavy
chain and light chain fragments were added to an appropriate PCR
mixture containing a 15 amino acid linker-primer for 8H9, dNTPs,
PCR buffer and Ampli Taq Gold DNA polymerase. PCR reactions were
performed at 94.degree. C. for 1 min, followed by a 4 min annealing
reaction at 63.degree. C. The heavy and light chain DNA of 8H9 were
joined by the linker (GGGS).sub.3 (Pharmacia) into scFv in a VH-VL
orientation after 7 thermocycles.
[0514] Using an assembled scFv DNA of 8H9 as template, a secondary
PCR amplification (30 standard PCR cycles) was carried out using
primers containing either Sfi I or Not I restriction sites. Thus,
the Sfi I and Not I restriction sites were introduced to the 5' end
of heavy chain and the 3' end of light chain, respectively.
Amplified ScFv DNAs were purified by glassmilk beads and digested
with Sfi I and Not I restriction endonucleases. The purified ScFv
of 8H9 was inserted into the pHEN1 vector (kindly provided by Dr.
G. Winter, Medical Research Council Centre, Cambridge, UK)
containing Sfi I/Nco I and Not I restriction sites. Competent E.
coli XL 1-Blue cells (Stratagene, La Jolla, Calif.) were
transformed with the pHEN1 phagemid. Helper phage M13 K07
(Pharmacia) was added to rescue the recombinant phagemid.
2.8 Enrichment of Recombinant Phagemid by Panning
[0515] 50 ul of anti-8H9 idiotypic antibody 2E9 (50 ug/ml) in PBS
was coated on the 96-well PVC microtiter plates and incubated at
37.degree. C. for 1 hour. 100 ul of the supernatant from phage
library was added to each well and incubated for 2 hours. The plate
was washed 10 times with PBS containing 0.05% BSA. Antigen-positive
recombinant phage captured by the anti-idiotype MoAb 2E9 was eluted
with 0.1M glycine-HCl (pH 2.2 containing 0.1% BSA) and neutralized
with 2M Tris solution. This panning procedure was repeated three
times. The phagemid 8HpHM9F7-1 was chosen for the rest of the
experiments.
2.9 ELISA
[0516] The selected phage was used to reinfect E. coli XL 1-Blue
cells. Colonies were grown in 2.times.YT medium containing
ampicillin (100 ug/ml) and 1% glucose at 30.degree. C. until the
optical density of 0.5 unit at 600 nm was obtained. Expression of
scFv antibody was induced by changing to the medium containing 100
uM IPTG (Sigma-Aldrich) and incubating at 30.degree. C. overnight.
The supernatant obtained from the medium by centrifugation was
directly added to the plate coated with anti-idiotype 2E9. The
pellet was resuspended in the PBS containing 1 mM EDTA and
incubated on ice for 10 min. The periplasmic soluble antibody was
collected by centrifugation again and added to the plate. After a
2-hour incubation at 37.degree. C., plates were washed and
anti-MycTag antibody (clone 9E10 from ATCC) was added for 1 hour at
37.degree. C. After washing, affinity purified goat anti-mouse
antibody (Jackson Immunoresearch) was allowed to react for 1 hour
at 37C and the plates were developed with the substrate
o-phenylenediamine (Sigma-Aldrich) as previously described.
2.10 Construction of ScFv-Human-.quadrature.1-CH2-CH3 Mouse
Human-Chimeric Gene
[0517] A single gene encoding scFv8H9 was generated by PCR method
using phagemid 8HpHM9F7-1 as the template. Secondary PCR
amplification (30 PCR cycles) was carried out to insert the human
IgG1 leader sequence at the 5'end of the scFv8H9 DNA plus the
restriction sites at the two opposite ends, i.e. Hind III and Not
I, at the 5' end of human IgG1 leader and at the 3' end of scFv8H9,
respectively. Amplified human IgG1 leader-scFv8H9 DNA was purified
by glassmilk beads and digested with Hind III and Not I restriction
endonucleases according to manufacturer's instructions. The Hind
III--Not I fragment of human IgG1 leader-scFv8H9 cDNA was purified
on agarose gel and ligated into pLNCS23 vector carrying the
human-(1-CH2-CH3 gene (kindly provided by Dr. J. Schlom, National
Cancer Institute, NIH, Bethesda, Md.) (Shu et al., 1993). Competent
E. coli XL 1-Blue cells were transformed with pLNCS23 containing
the scFv phagemid. The scFv-CH2-CH3 DNA was primed with appropriate
primers and sequenced using the Automated Nucleotide Sequencing
System Model 373 (Applied Biosystems). The sequences agreed with
the cDNA sequences of the light and heavy chains of 8H9 as well as
the human-.quadrature.1-CH2-CH3 available from GenBank, including
the ASN 297 of the CH2 domain. In this construct, Cys220 of the
genetic hinge was replaced by a proline residue, while Cys226 and
Cys229 were retained in the functional hinge (Shu et al., 1993)
2.11 Cell Culture and Transfection
[0518] CHO cell or NSO myelomas cells (Lonza Biologics PLC,
Bershire, UK) were cultured in RPMI 1640 (Gibco-BRL) supplemented
with glutamine, penicillin, streptomycin (Gibco-BRL) and 10% fetal
bovine serum (Gibco-BRL). Using effectene transfection reagent
(Qiagen, Valencia, Calif.), recombinant
ScFv8H9-human-.quadrature.1-CH2-CH3 was introduced via the pLNCS23
into CHO cell or NSO myelomas cells. Cells were fed every 3 days,
and G418 (1 mg/ml; Gibco-BRL) resistant clones were selected. After
subcloning by limiting dilution, chimeric antibodies were produced
by high density miniPERM bioreactor from Unisyn Technologies using
0.5% ULG-FBS in Hydridoma-SFM (Invitrogen Corporation, Carlsbad,
Calif.). The chimeric antibodies were purified by protein G
(Pharmacia) affinity chromatography.
2.12 SDS-PAGE and Western Blot Analysis
[0519] The supernatant, the periplasmic extract and cell extract
from the positive clones were separated by reducing and nonreducing
SDS-PAGE. 10% SDS-polyacrylamide slab gel and buffers were prepared
according to Laemmli (Laemmli, 1970). Electrophoresis was performed
at 100V for 45 min. After completion of the run, western blot was
carried out as described by Towbin (Towbin et al., 1979). The
nitrocellulose membrane was blocked by 5% nonfat milk in TBS
solution for 1 hour and incubated with anti-idiotype 2E9 antibody
overnight at 4.degree. C. After incubating with HRP-conjugated goat
anti-rat Ig (Fisher Scientific Co., Pittsburgh, Pa.), the signal
was detected by ECL system (Amersham-Pharmacia Biotech).
2.13 Cytotoxicity Assay
[0520] Target NMB7 or LAN-1 tumor cells were labeled with
Na.sub.2.sup.51CrO.sub.4 (Amersham Pharmacia) at 100 uCi/10.sup.6
cells at 37.degree. C. for 1 hour. After the cells were washed,
loosely bound .sup.51Cr was leaked for 1 hour at 37.degree. C.
After further washing, 5000 target cells/well were admixed with
lymphocytes to a final volume of 200 .mu.l/well. Antibody dependent
cell-mediated cytotoxicity (ADCC) was assayed in the presence of
increasing concentrations of chimeric antibody. In complement
mediated cytotoxicity (CMC), human complement (at 1:5, 1:15 and
1:45 final dilution) was used instead of lymphocytes. The plates
were incubated at 37.degree. C. for 4 hours. Supernatant was
harvested using harvesting frames (Skatron, Lier, Norway). The
released .sup.51Cr in the supernatant was counted in a universal
gamma-counter (Packard Bioscience, Meriden, Conn.). Percentage of
specific release was calculated using the formula
100%.times.(experimental cpm-background cpm)/(10% SDS releasable
cpm-background cpm), where cpm were counts per minute of .sup.51Cr
released. Total release was assessed by lysis with 10% SDS
(Sigma-Aldrich), and background release was measured in the absence
of cells. The background was usually <30% of total for either
NMB7 or LAN-1 cells. Antibody 3F8 was used as the positive control
(Cheung et al., 1985).
2.14 Iodination
[0521] MoAb was reacted for 5 min with .sup.125I (NEN Life
Sciences, Boston, Mass.) and chloramine T (1 mg/ml in 0.3M
Phosphate buffer, pH 7.2) at room temperature. The reaction was
terminated by adding sodium metabisulfite (1 mg/ml in 0.3M
Phosphate buffer, pH 7.2) for 2 min. Free iodine was removed with
A1GX8 resin (BioRad, Richmond, Calif.) saturated with 1% HSA (New
York Blood Center Inc., New York, N.Y.) in PBS, pH 7.4. Radioactive
peak was collected and radioactivity (mCi/ml) was measured using a
radioisotope calibrator (Squibb, Princeton, N.J.). Iodine
incorporation and specific activities were calculated.
Trichloroacetic acid (TCA) (Fisher Scientific) precipitable
activity was generally >90%.
2.15 In Vitro Immunoreactivity of Iodinated Antibody.
[0522] Immunoreactivity of radioiodine labeled antibody was assayed
using purified anti-idiotype antibody 2E9 as the antigen.
Appropriate dilutions of .sup.125I labeled antibodies were added to
plates in duplicates, and then transferred to freshly prepared
antigen plates after 1 h and 4 h of binding at 4.degree. C.,
respectively. The final binding step was allowed to proceed
overnight at 4.degree. C. The total percent radioactivity bound was
a summation of 3 time points for each antibody dilution. For native
8H9, maximum immunoreactivity averaged .about.65%, while 8H9
scFv-Fc chimeric antibody was .about.48%.
2.16 Animal Studies
[0523] Athymic nude mice (nu/nu) were purchased from NCI, Frederick
Md. They were xenografted subcutaneously with LAN-1 neuroblastoma
cell line (2.times.10.sup.6 cells/mouse) suspended in 100 ul of
Matrigel (Beckton-Dickinson BioSciences, Bedford, Mass.) on the
flank. After 3 weeks, mice bearing tumors of 1-1.5 cm in longest
dimension were selected. Animals were injected intravenously
(retrorbital plexus) with 20 .mu.Ci of .sup.125I labeled antibody.
They were anesthesized with ketamine (Fort Dodge Animal Health,
Fort Dodge, Pa.) intraperitoneally and imaged at various time
intervals with a gamma camera (ADAC, Milpitas, Calif.) equipped
with grid collimators. Serial blood samples were collected at 5
min, 1, 2, 4, 8, 18, 24, 48, 72, 120 h from mice injected with
10-11 uCi .sup.125I labeled antibody. Groups of mice were
sacrificed at 24 h, 48 h, and 120 h and samples of blood (cardiac
sampling), heart, lung, liver, kidney, spleen, stomach, adrenal,
small bowel, large bowel, spine, femur, muscle, skin, brain and
tumor were weighed and radioactivity measured by a gamma counter.
Results were expressed as percent injected dose per gram. Animal
experiments were carried out under an IACUC approved protocol, and
institutional guidelines for the proper and humane use of animals
in research were followed.
3. Results
3.1 Anti-8H9-Idiotypic Antibodies
[0524] Rat hybridomas specific for 8H9 and nonreactive with control
murine IgG1 were selected. After subcloning by limiting dilution,
rat antibodies were produced by bulk culture in roller bottles and
purified by protein G affinity column. By ELISA, 2E9, 1E12, and
1F11, all of rat subclass IgG2a, were specific for 8H9, while
nonreactive with a large panel of purified monoclonal antibodies
(Table I). In contrast, the antibodies 3C2, 4C2 5C7, 7D6 and 8E12
from the same fusions were not specific for 8H9. The rest of the
experiments in this study was carried out using antibody 2E9. 2E9
specifically inhibited the binding of 8H9 to LAN-1 neuroblastoma
(FIG. 18A) and HTB82 rhabdomyosarcoma (FIG. 18B) while control rat
IgG1 (A1G4) had no effect (FIG. 18C).
TABLE-US-00022 TABLE I Anti-8H9-idiotypic antibodies: Specificity
by ELISA 1E12 1F11 3C2 4C2 5C7 7D6 8E12 2E9 MoAb Class (2a (2a (2b
.mu. .mu. (1 .mu. (2a MOPC 315 a - - +++ - - - - - 20.4 (1 - - +++
+++ ++ +++ - - 2C9 (1 - - +++ +++ +++ +++ ++ - 2E10 (1 - - +++ - -
+ - - 3E6 (1 - - +++ +++ +++ +++ +++ - 3E7 (1 - - +++ - - + - - 4B6
(1 - - +++ +++ ++ +++ - - 5F9 (1 - - +++ +++ +++ +++ + - 8H9 (1 +++
++ +++ +++ ++ +++ - ++ MOPC 21 (1 - - +++ +++ +++ +++ - - UJ 13A (1
- - +++ ++ + - - - 3A5 (2a - - +++ - - - - - HOPC-1 (2a - - +++ + -
- - - 3F8 (3 - - +++ - - - - - FCOPC21 (3 - - +++ ++ - ++ - -
NRCO-04 (3 - - +++ - - - - - R24 (3 - - +++ - - - - - TIB114 (3 - -
+++ + - ++ - - Y5606 (3 - - +++ - - - - - 3A7 .mu. - - + - - - - -
3G6 .mu. - - +++ - - - - - 5F11 .mu. - - + - - - - - K9 .mu. - -
+++ - - - - - MOPC .mu. - - +++ - - - - - 104E Note: OD < 0.5 =
-, 0.5~1 = +, 1~2 = ++, >2 = +++
3.2 Construction and Expression of 8H9 ScFv
[0525] After three rounds of panning on 2E9, the eluted phage was
used to infect E. coli HB2151 cells and scFv expression was induced
by IPTG. ScFv from periplasmic soluble protein fraction was tested
for binding to 2E9 on ELISA. Three 8H9 scFv clones when compared
with the MoAb 8H9 showed similar titers. The clone 8HpHM9F7-1 was
selected for subcloning. The DNA sequence of 8HpHM9F7-1 agreed with
those of the 8H9VH and 8H9VL as well as the CH2-CH3 region of human
gamma chain. The supernatant, periplasmic soluble and cells pellet
lysates of 8HpHM9F7-1 were separated by nonreducing SDS-PAGE, and
analysed by western blotting. A protein band with molecular weight
of 31 KD was found in the supernatant, the periplasmic and cell
pellet extracts using anti-MycTag antibody which recognized the
sequence GAPVPDPLEPR. No such band was detected in control cells or
8HpHM9F7-1 cells without IPTG treatment.
3.3 Construction of Chimeric Mouse scFv-Human Fc
[0526] Chimeric clones from CHO and NSO were screened by ELISA
binding on 2E9. Clone 1C5 from NSO and clone 1G1 from CHO were
chosen for scale-up production. By SDS-PAGE and by western blot
analysis, a single chain of 54 kD under reducing conditions, and a
homodimer of 102 kD under nonreducing conditions were found (FIG.
19). Antigen specificity was demonstrated by its binding to tumor
cells (FIG. 20A, dose titration), and its inhibition by
anti-idiotypic antibody 2E9 (FIG. 20B) on FACS analysis.
3.4 In Vitro and In Vivo Properties of scFv-Human Fc
[0527] The scFv-Fc chimeric antibody was inefficient in mediating
ADCC in the presence of human lymphocytes or human neutrophils (17%
maximum cytotoxicity at 50:1 E:T ratio compared to >50% by the
murine IgG3 MoAb 3F8). It was also ineffective in CMC (data not
shown). In biodistribution studies, it localized well to HTB82 and
LAN-1 xenografts (FIG. 21). Blood clearance studies showed that
chimeric 8H9 (102 kD MW) had T-1/2.quadrature. of 5.3 h, and
T-1/2.quadrature. of 43 h when compared to averages of 4.5 h and 71
h, respectively, for native 8H9 (160 kD MW), a result of the
smaller molecular size of the construct (FIG. 22). Similarly,
although the percent injected dose per gram of the chimeric
construct was lower for all tissues (average of 44% at 48 h, and
75% at 120 h), the tumor-non tumor ratios were similar to those of
native 8H9 (98% at 48 h and 85% at 120 h) (Table II).
TABLE-US-00023 TABLE II Percent Injected Dose per gram and
Tumor-non-tumor ratios Percent Injected dose/gm over time (h)
chimeric native Organs 24 48 120 48 120 Skin 1.4 0.7 0.2 1.8 0.7
Heart 1.3 0.9 0.4 2.6 0.7 Lung 2.9 1.9 0.5 4.0 1.1 Liver 1.2 0.8
0.2 1.4 0.5 Spleen 0.9 0.5 0.2 1.4 0.4 Kidney 1.5 0.9 0.5 1.9 0.5
Adrenal 0.9 0.5 0.5 1.8 0.3 Stomach 1.3 0.6 0.3 1.3 0.5 Small 0.6
0.3 0.2 0.7 0.2 intestine Large 0.6 0.3 0.2 0.6 0.2 intestine
Bladder 1.2 0.6 0.4 1.0 0.6 Muscle 0.5 0.3 0.2 0.5 0.2 Femur 0.6
0.3 0.2 0.8 0.2 Spine 0.6 0.4 0.2 0.8 0.3 Tumor 4.0 3.6 2.1 9.4 4.0
Brain 0.2 0.1 0.1 0.2 0.1 Blood 5.3 3.1 1.2 8.3 2.3 Tumor:Nontumor
ratios over time (h) chimeric native Organs 24 48 120 48 120 Skin
3.0 6.0 10.7 5.2 7.2 Heart 3.3 4.0 5.6 3.6 7.7 Lung 1.6 2.2 4.5 2.3
5.0 Liver 3.5 5.2 8.7 6.5 10.1 Spleen 5.1 8.1 12.8 6.7 15.1 Kidney
2.8 4.3 5.9 5.1 8.9 Adrenal 4.8 8.7 10.0 5.8 11.6 Stomach 3.6 6.7
13.8 7.5 14.5 Small 6.6 11.8 16.0 13.3 21.7 intestine Large 7.1
12.7 25.9 15.7 28.5 intestine Bladder 3.5 14.3 10.2 12.4 12.3
Muscle 7.9 13.6 21.3 18.2 26.8 Femur 6.7 11.8 20.5 11.8 27.9 Spine
6.7 6.8 14.2 11.1 19.6 Tumor 1.0 1.0 1.0 1.0 1.0 Brain 22.7 40.9
38.7 44.6 68.2 Blood 0.8 1.2 1.8 1.1 2.3
4. Discussion
[0528] We demonstrated that by using rat anti-idiotypic antibody as
antigen surrogate, scFv and scFv-fusion proteins can be
conveniently produced. As proof of principle we utilized the
anti-idiotypic antibody to clone scFv from the murine hybridoma
cDNA library. The anti-idiotypic antibody was then used to select
for scFv-Fc chimeric antibodies. Both the scFv and scFv-Fc fusion
protein derived by our method were specific for the natural
antigen, comparable to the native antibody 8H9. However, the
scFv-Fc fusion protein could only mediate ADCC poorly and not CMC
at all.
[0529] While scFv provides the building block for scFv-fusion
proteins, it is not the ideal targeting agent by itself. Being a
small protein, its clearance is rapid. Moreover, it is often
retained by the kidney, delivering undesirable side effects if the
scFv construct is cytotoxic. Since avidity is a key parameter in
tumor targeting in vivo, its biggest limitation is its uni-valency
and often suboptimal affinity for the antigen. By using VH-VL
linkers of decreasing length, spontaneous dimeric, trimeric and
polymeric scFv have been produced. However, these oligomers are not
bonded by covalent linkage, and may dissociate in vivo. An
alternative approach is to take advantage of the human Fc, which
has the natural ability to homodimerize through disulfide-bonds,
thereby allowing the juxtaposition of two binding domains. Fc
functions such as CMC and ADCC could also be achieved achieved (Shu
et al., 1993; Kato et al., 1995; Brocks et al., 1997; Wang et al.,
1999; Powers et al., 2001). Unlike standard 2-chain chimeric
antibodies, only one polypeptide is needed for the scFv-Fc
chimeric; unbalanced synthesis of heavy and light chains is not an
issue. Larger dimeric fragments are also likely to have increased
serum-half life compared to scFv and thus improved tumor targeting
(Adams et al., 1993; Wu et al., 1996). Homodimerization of tumor
cell-surface antigens by soluble antibody may also trigger
apoptosis of tumor cells (Ghetie et al., 1997). No less important
is the availability of validated purification techniques using
protein A or protein G through their binding to the Fc portion
(Powers et al., 2001). Tetravalent scFv (monospecific or
bispecific) are natural extensions of the diabody approach to
scFv-Fc fusion strategy (Alt et al., 1999; Santos et al., 1999),
where a significant increase in avidity can be achieved. More
recently, scFv-streptavidin fusion protein has been produced for
pretargeted lymphoma therapy (Schultz et al., 2000). Here
scFv-streptavidin forms natural tetramers, to which biotinyated
ligands can bind with high affinity.
[0530] Anti-idiotypic antibodies have greatly facilitated clone
selection in the construction of soluble scFv-fusion proteins or
cell bound surface scFv. We have successfully applied similar
technology to anti-GD2 monoclonal antibodies (Cheung et al., 1993).
Being immunoglobulins, their structure, stability, biochemistry,
are generally known. Unlike natural antigens where each individual
system has its unique and difficult to predict properties. As
surrogate antigens, anti-idiotypic antibodies are ideal for
standardization and quality control, especially for initial
clinical investigations where the nature of the antigen is not
fully understood. Potential limitations exist for the anti-idiotype
approach. Only those anti-ids (Ab2.quadrature.) that recognize the
antigen-binding site of the immunizing MoAb can mimic the original
antigen. A reliable test for Ab2.quadrature. is its ability to
induce an antigen-specific immune response. Alternatively, antigen
specificity of the scFv selected by the anti-idiotype must be
validated by binding to cells or membrane preparations. Once
validated, the anti-idiotype can be used as antigen surrogate for
cloning and assay of other scFv-fusion proteins.
[0531] Our scFv-Fc fusion protein lacks CMC and ADCC activity. This
finding differs from previous scFv-Fc fusion proteins (Shu et al.,
1993; Wang et al., 1999; Powers et al., 2001). This is unlikely to
be due to the p58 antigen recognized by this scFv, since anti-GD2
scFv-Fc made with the same cassette were also deficient in CMC and
ADCC activity (data not shown). One possible explanation might be
due to the oligosaccharide structures in the Fc region (Wright and
Morrison, 1997). In normal IgG, these oligosaccharides are
generally of complex biantennary type, with low levels of terminal
sialic acid and bisecting N-acetylglucosamine (GlcNAc), the latter
being critical for ADCC. ADCC function is often inefficient among
chimeric antibodies expressed in cell lines which lack the enzyme Q
(1,4)-N-acetylglucosaminyltransferase III (GnIII) (Umana et al.,
1999), that catalyzes the formation of bissecting oligosaccharides.
This enzyme can be transfected into producer lines to increase the
level of bisecting GlcNAc and to increase the ADCC function of
secreted chimeric antibodies (Umana et al., 1999). Since our
chimeric antibodies from both CHO and NSO expression systems were
inefficient in CMC and ADCC, both cell lines may be lacking in the
GnIII enzyme. It is also possible that the absence of the CH1
domain in the Fc may modify the accessability of the ASN297 residue
to glycosyltransferases in some scFv-Fc constructs such as ours
(Wright and Morrison, 1997) On the other hand, an scFv-Fc that
lacks binding to Fc receptor may have less nonspecific binding to
white cells, thereby decreasing blood pooling in targeted therapy.
These findings may have implications in scFv-Fc strategies to
improve effector functions.
REFERENCES
[0532] Adams, G. P., McGartney, J. E., Tai, M.-S., Oppermann, H.,
Huston, J. S., Stafford, W. F., Bookman, M. A., Fand, I., Houston,
L. L. and Weiner, L. W. (1993) Highly specific in vivo tumor
targeting by monovalent and divalent forms of 741F8 anti-c-erbB-2
single-chain Fv. Cancer Research 53, 4026-4034. [0533] Alt, M.,
Muller, R. and Kontermann, R. E. (1999) Novel tetravalent and
bispecific IgG-like antibody molecules combining single-chain
diabodies with the immunoglobulin y1 Fc or CH3 region. FEBS Letters
454, 90-94. [0534] Bird, R. E., Hardman, K. D., Jacobson, J. W.,
Johnson, S., Kaufman, B. M., Lee, S. M., Lee, T., Pope, S. H.,
Riordan, G. S. and Whitlow, M. (1988) Single-chain antigen-binding
proteins. Science 242, 423-426. [0535] Brocks, B., Rode, H. J.,
Klein, M., Gerlach, E., Dubel, S., Little, M., Pfizenmaier, K. and
Moosmayer, D. (1997) A TNF receptor antagonistic scFv, which is not
secreted in mammalian cells, is expressed as a soluble mono- and
bivalent scFv derivative in insect cells. Immunotechnology 3,
173-84. [0536] Burton, D. R. and Barbas III, C. G. (1994) Human
antibodies from combinatorial libraries. Advances in Immunology 57,
191-280. [0537] Cai, X. and Garen, A. (1995) Anti-melanoma
antibodies from melanoma patients immunized with genetically
modified autologous tumor cells: selection of specific antibodies
from single-chain Fv fusion phage libraries. Proceedings of the
National Academy of Sciences of the United States of America 92,
6537-41. [0538] Cheung, N. K., Canete, A., Cheung, I. Y., Ye, J. N.
and Liu, C. (1993) Disialoganglioside GD2 anti-idiotypic monoclonal
antibodies. International Journal of Cancer 54, 499-505. [0539]
Cheung, N. K., Saarinen, U., Neely, J., Landmeier, B., Donovan, D.
and Coccia, P. (1985) Monoclonal antibodies to a glycolipid antigen
on human neuroblastoma cells. Cancer Research 45, 2642-2649. [0540]
DeNardo, S. J., DeNardo, G. L., DeNardo, D. G., Xiong, C. Y., Shi,
X. B., Winthrop, M. D., Kroger, L. A. and Carter, P. (1999)
Antibody phage libraries for the next generation of tumor targeting
radioimmunotherapeutics. Clinical Cancer Research 5, 3213s-3218s.
[0541] Eshhar, Z., Waks, T., Gross, G. and Schindler, D. G. (1993)
Specific activation and targeting of cytotoxic lymphocytes through
chimeric single chains consisting of antibody-binding domains and
the gamma or zeta subunits of the immunoglobulin and T-cell
receptors. Proceedings of the National Academy of Sciences of the
United States of America 90, 720-4. [0542] George, A. J. T.,
Spooner, R. A. and Epenetos, A. A. (1994) Applications of
Monoclonal Antibodies in Clinical Oncology. Immunology Today 15,
559-561. [0543] Ghetie, M. A., Podar, E. M., Ilgen, A., Gordon, B.
E., Uhr, J. W. and Vitetta, E. S. (1997) Homodimerization of
tumor-reactive monoclonal antibodies markedly increases their
ability to induce growth arrest or apoptosis of tumor cells.
Proceedings of the National Academy of Sciences of the United
States of America 94, 7509-14. [0544] Huston, J. S., Levinson, D.,
Mudgett-Hunter, M., Tai, M. S., Novotny, J., Margolies, M. N.,
Ridge, R. J., Bruccoleri, R. E., Haber, E. and Crea, R. (1988)
Protein engineering of antibody binding sites: recovery of specific
activity in an anti-digoxin single-chain Fv analogue produced in
Escherichia coli. Proceedings of the National Academy of Sciences
of the United States of America 85, 5879-83. [0545] Kato, T., Sato,
K., Suzuki, S., Sasakawa, H., Kurokawa, M., Nishioka, K. and
Yamamoto, K. (1995) Mammalian expression of single chain variable
region fragments dimerized by Fc regions. Molecular Biology Reports
21, 141-146. [0546] Kipriyanov, S. M., Bretling, F., Little, M. and
Dubel, S. (1995) Single-chain antibody streptavidin fusions:
tetrameric bifunctional scFv-complexes with biotin binding activity
and enhanced affinity to antigen. Human Antibodies Hybridomas 6,
93-101. [0547] Laemmli, U. K. (1970) Cleavage of structural
proteins during the assembly of the head of bacteriophage T4.
Nature 227, 680-85. [0548] Lu, J. and Sloan, S. R. (1999) An
alternating selection strategy for cloning phage display
antibodies. Journal of Immunological Methods 228, 109-119. [0549]
Michael, N. P., Chester, K. A., Melton, R. G., Robson, L.,
Nicholas, W., Boden, J. A., Pedley, R. B., Begent, R. H., Sherwood,
R. F. and Minton, N. P. (1996) In vitro and in vivo
characterisation of a recombinant carboxypeptidase G2::anti-CEA
scFv fusion protein. Immunotechnology 2, 47-57. [0550] Modak, S.,
Kramer, K., Humayun, G., Guo, H. F. and Cheung, N. K. V. (2001)
Monoclonal antibody 8H9 targets a novel cell surface antigen
expressed by a wide spectrum of human solid tumors. Cancer Research
61, 4048-4054. [0551] Powers, D. B., Amersdorfer, P., Poul, M. A.,
Nielsen, U. B., Shalaby, R., Adams, G. P., Weiner, L. M. and Marks,
J. D. (2001) Expression of single-chain Fv-Fc fusions in pinchia
pastoris. Journal of Immunological Methods 251, 123-135. [0552]
Raag, R. and Whitlow, M. (1995) Single-chain Fvs. FASEB Journal 9,
73-80. Santos, A. D., Kashmiri, S. V., Hand, P. H., Schlom, J. and
Padlan, E. A. (1999) Generation and characterization of a single
gene-encoded single-chain-tetravalent antitumor antibody. Clinical
Cancer Research 5, 3118s-3123s. [0553] Schultz, J., Lin, Y.,
Sanderson, J., Zuo, Y., Stone, D., Mallett, R., Wilbert, S. and
Axworthy, D. (2000) A tetravalent single-chain
antibody-streptavidin fusion protein for pretargeted lymphoma
therapy. Cancer Research 60, 6663-6669. [0554] Shu, L., Qi, C. F.,
Schlom, J. and Kashmiri, S. V. (1993) Secretion of a
single-gene-encoded immunoglobulin from myeloma cells. Proceedings
of the National Academy of Sciences of the United States of America
90, 7995-9. [0555] Thanavala, Y. M., Brown, S. E., Howard, C. R.,
Roitt, I. M. and Steward, M. W. (1986) A surrogate hepatitis B
virus antigenic epitope represented by a synthetic peptide and an
internal image antiidiotype antibody. Journal of Experimental
Medicine 164, 227-236. [0556] Towbin, H., Staehelin, T. and Gordon,
J. (1979) Electrophoretic transfer of proteins from polyacrylamide
gels to nitrocellulose sheets: procedure and some applications.
[0557] Proceedings of the National Academy of Sciences of the
United States of America 76, 4350-4. [0558] Tur, M. K., Huhn, M.,
Sasse, S., Engert, A. and Barth, S. (2001) Selection of scFv phages
on intact cells under low pH conditions leads to a significant loss
of insert-free phages. Biotechniques 30, 404-413. [0559] Umana, P.,
Jean-Mairet, J., Moudry, R., Amstutz, H. and Bailey, J. E. (1999)
Engineered glycoforms of an antineuroblastoma IgG1 with optimized
antibody-dependent cellular cytotoxic activity. Nature
Biotechnology 17, 176-180. Wagner, U., Schlebusch, H., Kohler, S.,
Schmolling, J., Grunn, U. and Krebs, D. (1997) [0560] Immunological
responses to the tumor-associated antigen CA125 in patients with
advanced ovarian cancer induced by the murine monoclonal
anti-idiotype vaccine ACA125. Hybridoma 16, 33-40. [0561] Wang, B.,
Chen, Y. B., Ayalon, O., Bender, J. and Garen, A. (1999) Human
single-chain Fv immunoconjugates targeted to a melanoma-associated
chondroitin sulfate proteoglycan mediate specific lysis of human
melanoma cells by natural killer cells and complement. Proceedings
of the National Academy of Sciences of the United States of America
96, 1627-32. [0562] Watters, J. M., Telleman, P. and Junghans, R.
P. (1997) An optimized method for cell-based phage display panning.
Immunotechnology 3, 21-9. [0563] Wikstrand, C. J., Hale, L. P.,
Batra, S. K., Hill, M. L., Humphrey, P. A., Kurpad, S. N.,
McLendon, R. E., Moscatello, D., Pegram, C. N. and Reist, C. J.
(1995) Monoclonal antibodies against EGFRvIII are tumor specific
and react with breast and lung carcinomas and malignant gliomas.
Cancer Research 55, 3140-8. [0564] Winter, G., Griffiths, A. D.,
Hawkins, R. E. and Hoogenboom, H. R. (1994) Making antibodies by
phage display technology. Annual Review of Immunology 12, 433-55.
[0565] Winter, G. and Milstein, C. (1991) Man-made antibodies.
Nature 349, 293-299. [0566] Wright, A. and Morrison, S. L. (1997)
Effect of glycosylation on antibody function: implications for
genetic engineering. Trends in Biotechnology 15, 26-31. [0567] Wu,
A. M., Chen, W., Raubitschek, A., Williams, L. E., Neumaier, M.,
Fischer, R., Hu, S. Z., Odom-Maryon, T., Wong, J. Y. and Shively,
J. E. (1996) Tumor localization of anti-CEA single-chain Fvs:
improved targeting by non-covalent dimers. Immunotechnology 2,
21-36.
Sixth Series of Experiments
Using Anti-Idiotypic Antibody to Enhance ScFv Chimeric Immune
Receptor Gene Transduction and Clonal Expansion of Human
Lymphocytes
[0568] Background:
[0569] Chimeric immune receptors (CIR) transduced into lymphocytes
link target recognition by single chain antibody Fv (scFv) to
activation through CD28/TCR. signaling. The murine monoclonal
antibody (MoAb) 8H9 reacts with a novel antigen widely expressed on
solid tumors (Cancer Research 61:4048, 2001). We want to test if
its anti-idiotypic MoAb 2E9 can optimize the CIR technology.
[0570] Methods:
[0571] Rat anti-idiotypic MoAb 2E9 (IgG2a) was used as an antigen
surrogate for initial cloning of 8H9scFv from the hybridoma cDNA
library. A CIR consisting of human CD8-leader sequence, 8H9scFv,
CD28 (transmembrane and cytoplasmic domains), and TCR-zeta chain
was constructed, ligated into the pMSCVneo vector, and used to
transfect the packaging line GP+ envAM12 bearing an amphotropic
envelope.
[0572] Results:
[0573] Three sequential affinity enrichments with MoAb 2E9
significantly improved the percentage of producer clones positive
for surface 8H9-scFv and the efficiency of their supernatant in
transducing the indicator cell line K562. By three weeks of in
vitro culture, >95% of transduced primary human lymphocytes were
CIR-positive. With periodic stimulation with soluble 2E9, these
lymphocytes underwent "monoclonal" expansion, reaching 50-100 fold
increase by 2 months. They mediated antigen-specific non-MHC
restricted cytotoxicity efficiently. When injected intravenously,
they inhibited tumor growth in SCID mice xenografted with
rhabdomyosarcoma.
[0574] Conclusion:
[0575] Anti-idiotypic antibody may provide a useful tool,
especially for carbohydrate or unstable antigens, in facilitating
the cloning of scFv and their CIR fusion constructs, as well as
their transduction into human lymphocytes.
Introduction
[0576] Adoptive cell therapy using ex vivo expanded tumor-selective
T-cells can effect dramatic remissions of virally induced
malignancies, a process critically dependent on clonal frequency,
where rapid exponential expansion of specific cytolytic
T-lymphocytes (CTL) is required. T-cells proliferate when activated
(e.g. anti-CD3) but apoptose unless a costimulatory signal (e.g.
anti-CD28) is provided (1). However, human tumor targets often lack
costimulatory molecules (e.g. CD80), or overstimulate inhibitory
receptors (e.g. CTL4) such that the CD28 pathway is derailed. In
addition, many tumors downregulate major histocompatibility complex
(MHC) molecules to escape engagement by the T-cell receptor (TCR).
Through genetic engineering, chimeric immune receptors (CIR)
linking tumor-selective scFv to T-cell signal transduction
molecules (e.g. TCR-zeta chain and CD28) will activate lymphocytes
following tumor recognition, triggering the production of cytokines
and tumor lysis (2-7). T-cell can also be genetically engineered to
secrete cytotoxic cytokines (8), toxins (9) or to metabolize
prodrugs (10, 11). However, significant technologic gaps remain:
(1) Gene transduction into human lymphocytes is inefficient, (2)
antigen specific T-cells cannot be easily enriched and expanded,
and (3) optimal T-cell activation may require multiple signals.
Furthermore, although CIR redirected T-cells can recycle their
lytic activity (12), a costimulatory signal, either through CD28 or
4-1BB engagement, may help reduce activation-induced apoptotic
death. CIR with multidomains was recently described, where the
intracellular domain of CD28 was ligated to the 5' end of TCR zeta
chain and introduced into Jurkat cells, with the expected "two
birds with one stone effect" when scFv binds to tumor cells (13).
IL-2 production was 20 times more than CIR with zeta chain only.
Whether this same effect can be achieved with primary human T-cells
is not known.
[0577] To monitor scFv gene expression, anti-linker antibody may be
useful, although its efficiency depends on the accessibility of the
scFv-linker portion. Although purified antigens can also be used to
monitor scFv expression, certain classes (complex carbohydrates or
unstable antigens) can be difficult to prepare and their chemistry
highly variable. Without a standardized reagent for affinity
purification or enrichment of virus producer cells, monitoring and
sorting of transduced lymphocytes, CIR technology remains
inefficient. Recently Eshhar et al described a dicistronic
construct consisting of scFv-CD28-(and green fluorescent protein
(GFP), where the latter was used to monitor gene transduction and
to enrich producer lines (7). Although GFP can validate the gene
transfer process, its added immunogenicity and its safety in
clinical applications remain uncertain.
[0578] Anti-idiotypic antibodies are frequently used as
antigen-mimics for infectious diseases and cancer (14, 15).
Internal image rat anti-idiotypic antibodies can be conveniently
produced against mouse MoAb. Since large scale production of
clinical grade MoAb is now routine, anti-idiotypic antibodies may
be ideal surrogates especially if the antigen is not easily
available. In addition, the biochemistry of immunoglobulins in
positive selection (panning, affinity chromatography, sorting) and
binding assays is well-known and is easy to standardize. We
recently described a novel tumor antigen reactive with a murine
MoAb 8H9 (16). The antigen was difficult to purify given its
lability and glycosylation. Here we demonstrate that anti-idiotypic
MoAb can be used as surrogate antigens for cloning CIR into
lymphocytes, i.e. a CIR of 8H9scFv, human CD28 and human TCR-zeta
chain. Anti-idiotypic MoAb allows rapid affinity enrichment of
producer cell line, monitoring of scFv expression on cells, and in
vitro clonal expansion of transduced lymphocytes. Highly cytotoxic
lymphocytes, both in vitro and in vivo, can be produced in bulk.
Besides providing an antigen surrogate, anti-idiotypic MoAb appears
to have utility for the optimization and quality control of
scFv-based gene therapies.
Materials and Methods
[0579] Materials.
[0580] Cells were cultured in RPMI 1640 with 10% newborn calf serum
(Hyclone, Logan, Utah) supplemented with 2 mM glutamine, 100 U/ml
of penicillin and 100 ug/ml of streptomycin. The BALB/c myeloma
proteins, MOPC-104E, TEPC-183, MOPC-351, TEPC-15, MOPC-21, UPC-10,
MOPC-141, FLOPC-21, Y5606, were purchased from Sigma-Aldrich Co.,
St. Louis, Mo. MoAb R24, V1-R24, and K9 were gifts from Dr. A.
Houghton, OKB7 and M195 from Dr. D. Scheinberg, and 10-11
(anti-GM2) from Dr. P. Livingston of Memorial Sloan-Kettering
Cancer Center, New York; 528 from Dr. J. Mendelsohn (MD Anderson
Cancer Center, Houston, Tex.). 2E6 (rat anti-mouse IgG3) was
obtained from hybridomas purchased from ATCC (Rockville, Md.).
NR-Co-04 was provided by Genetics Institute (Cambridge, Mass.).
LS2D173 (anti-GM2) was provided by Dr. L. Grauer (Hybritech,
Calif.). From our laboratory, 3F8 was an IgG3 MoAb specific for
ganglioside GD2 (17); 5F9, 8H9, 3A5, 3E7, 1D7, 1A7 were produced
against human neuroblastoma, 2C9, 2E10 and 3E6 against human breast
carcinoma: 4B6 against glioblastoma multiforme. They were all
purified by protein A or protein G (Pharmacia, Piscataway, N.J.)
affinity chromatography.
[0581] Anti-8H9-Idiotypic MoAb.
[0582] Anti-idiotypic antibodies were produced from LOU/CN rats as
previously described (18). Clones were selected based on selective
binding to 5F11 antibody and not to other myelomas. Repeated
subcloning was done using limiting dilution until the cell lines
became stable. Among the three specific rat IgG2a clones (2E9,
1E12, 1F11), 2E9 was chosen for scaled up production using high
density miniPERM bioreactor (Unisyn technologies, Hopkinton,
Mass.), and purified by protein G affinity chromatography (Hitrap
G, Amersham-Pharmacia, Piscataway, N.J.). The IgG fraction was
eluted with pH 2.7 glycine-HCl buffer and neutralized with 1 M Tris
buffer pH 9. After dialysis in PBS at 4.degree. C. for 18 hours,
the purified antibody was filtered through a 0.2 um Millipore
filter (Millipore Inc. Bedford Mass.), and stored frozen at
-70.degree. C. Purity was determined by SDS-PAGE electrophoresis
using 7.5% acrylamide gel. ELISA was used to detect rat
anti-idiotypic antibodies (Ab2) as previously described (18). Rat
IgG1 anti-5F11 anti-idiotypic MoAb was similarly produced.
[0583] Construction of ScFv Gene
[0584] scFv was constructed from 8H9 hybridoma cDNA by recombinant
phage display using a scFv construction kit according to
manufacturer's instructions with modifications
(Amersham-Pharmacia). Amplified ScFv DNA was purified by glassmilk
beads and digested with Sfi I and Not I restriction endonucleases.
The purified scFv of 8H9 was inserted into the pHEN1 vector (kindly
provided by Dr. G. Winter, Medical Research Council Centre,
Carmbridge, UK) containing SfiI/NcoI and Not I restriction sites.
Competent El Coli XL O1Blue cells (Stratagene, La Jolla, Calif.)
were transformed with the pHEN1 phagemid. Helper phage M13 KO7
(Pharmacia) was added to rescue the recombinant phagemid. The
phagemid 8HpHM9F7-1 was chosen for the rest of the experiments. The
supernatant, the periplasmic extract and cell extract from the
positive clones separated by nonreducing SDS-PAGE and western
blotting (19) using anti-Myc Tag antibody demonstrated a 31 kD
band.
[0585] Enrichment of Recombinant Phagemid by Panning
[0586] 50 ul of anti-8H9 idiotype antibody 2E9 (50 ug/ml) in PBS
were coated on the 96-well polyvinyl microtiter plates and
incubated at 37.degree. C. for 1 hour. 100 ul of the supernatant
from phage library were added to each well and incubated for 2
hours. The plate was washed 10 times with PBS containing 0.05% BSA.
Antigen-positive recombinant phage captured by the idiotype 2E9 was
eluted with 0.1M HCl (pH 2.2 with solid glycine and 0.1% BSA) and
neutralized with 2M Tris solution. This panning procedure was
repeated three times.
[0587] ELISA
[0588] The selected phage was used to reinfect E. coli XL 1-Blue
cells. Colonies were grown in 2.times.YT medium containing
ampicillin (100 ug/ml) and 1% glucose at 30.degree. C. until the
optical density at 600 nm of 0.5 was obtained. Expression of scFv
antibody was induced by change of the medium containing 100 uM IPTG
(Sigma-Aldrich) and incubating at 30.degree. C. overnight. The
supernatant obtained from the medium by centrifugation was directly
added to the plate coated with idiotype 2E9. The pellet was
resuspended in the PBS containing 1 mM EDTA and incubated on ice
for 10 min. The periplasmic soluble antibody was collected by
centrifugation again and added to the plate. After incubating 2
hours at 37.degree. C., plates were washed and anti-MycTag antibody
(clone 9E10 from ATCC) was added to react for 1 hour at 37.degree.
C. After washing, affinity purified goat anti-mouse antibody
(Jackson Immunoresearch, West Grove, Pa.) was allowed to react for
1 hour at 37.degree. C. and the plates were developed with the
substrate o-phenylenediamine (Sigma-Aldrich).
[0589] Construction of
sc8H9-hCD28.sub.TM-hCD28.sub.cyto-hTCRzeta-pMSCVneo
[0590] Using the assembled gene sequences, secondary PCR
amplifications using synthetic oligodeoxynucleotide primers (see
below) were performed. Briefly, a 50 .mu.l reaction mixture
containing 200 .mu.M of each deoxynucleotide triphosphate, 0.2
.mu.M of each primer, 2 units of AmpliTag Gold DNA polymerase
(Applied Biosystems, Foster City, Calif.), and 50 ng of template
DNA was subjected to a 10 min denaturation and activation step at
95.degree. C., followed by 30 cycles of denaturation (1 min at
95.degree. C.), annealing (2 min at 55.degree. C.), and extension
(2 min at 72.degree. C.). This was followed by a final extension
for 8 min at 72.degree. C. Each of the amplified products was
purified with Geneclean Kit (Bio 101, Vista, Calif.). Synthetic
Oligodeoxynucleotide Primers for DNA Amplification
TABLE-US-00024 hCD8a leader-scFv-CD28: 355 S Sense Primer (Hpa
I-Human CD8a Leader) (SEQ ID NOs: 15-16) 5'-TTA TTA CGA GTT/AAC ATG
GCC TTA CCA GTG ACC-3'; 355 A Antisense Primer (Xho I-Human CD28)
(SEQ ID NOs: 17-18) 5'-CTT GGT C/TCGAG TGT CAG GAG CGA TAG GCT
GC-3' 3'; scFv8H9: 365 S Sense Primer (Cla I-8H9 heavy chain) (SEQ
ID NOs: 19-20) 5'-TTA TTA CGA AT/CGAT T GCC CAG GTC AAA CTG-3'; 365
A Antisense Primer (Not I-8H9 light chain) (SEQ ID NOs: 21-22)
5'-CTT GGT G/CGGCCGC CTG TTT CAG CTC CAG-3'; hTCR-zeta chain 379S
Sense primer (Bst U I-CD28 end-Xho I-hTCR zeta [cytoplasmic
domain]) (SEQ ID NOs: 23-26) 5'-CG/C GAC TTA GCA GCC TAT CGC TCC
TGg CAC/TCG AGa AGA GTG AAG TTC-3'; 379A Antisense Primer
(BglII-hTCR z) (SEQ ID NOs: 27-28) 5'-CTT GGT A/GA TCT TCA GCG AGG
GGG CAG GGC-3';.
[0591] Templates for DNA Amplification and Construction
[0592] The single gene encoding hCD8a-leader-sc3G6-CD28 was
previously described (20). Its cDNA was generated by PCR using the
Hpa I, Xho I fragment of hCD8a-leader-scFv-CD28 cDNA, and ligated
into pMSCVneo vector (Clontech, Palo Alto, Calif.). ScFv-8H9 was
amplified from the 8HpHM9F7-1 phagemid. Excised 8H9 scFv gene was
then swapped into the hCD8a-leader-scFv3G6-CD28 cassette of
pMSCVneo using the Cla I--Not I restriction enzymes. Human
TCR-zeta-chain was amplified from the plasmid pcDNA3.1/VJABLZH
(kindly provided by Dr. Ira Bergman, University of Pittsburgh,
Pa.), and ligated downstream of CD28 gene, using Xho I and Bgl II
restriction sites. Using the method supplied by manufacturer
(Stratagene), competent E. coli XL 1-Blue cells were transformed
with the vector pMSCVneo containing the insert. All gene constructs
were checked by DNA sequencing.
[0593] Cell Culture and Transfection
[0594] The amphotropic packaging cell line GP+ envAM12 and all
retroviral producer lines were maintained in Dulbecco's modified
Eagle's medium (Gibco-BRL, Gaithersburg, Md.) supplemented with
glutamine, penicillin, streptomycin (Gibco-BRL), and 10% fetal
bovine serum (Gibco-BRL). Using effectene transfection Reagent
(Qiagen, Valencia, Calif.), recombinant retrovirus was produced by
the transfection of vector DNA into GP+ envAM12 packaging cells
(kindly provided by Genetix Pharmaceuticals, Cambridge, Mass.).
Cells were fed every 3 days with G418 (400 ug/ml; Gibco-BRL).
Resistant clones were selected after a 10-day period.
[0595] Enrichment and Cloning of Packing Lines by Affinity
Column
[0596] The retroviral producer lines were affinity enriched using
MACS goat anti-rat IgG MicroBeads on the MiniMACS system (Miltenyi,
Auburn, Calif.). In brief, the transduced packing lines were
reacted with purified rat anti-idiotypic antibodies (10 ug per
10.sup.6 packing cells) on ice for 30 minutes, washed and then
applied to the anti-rat column. Cell were eluted according to
manufacturer's instructions and recultured at 37.degree. C. for 24
hours. Following staining with anti-idiotypic antibody 2E9 or 1E12,
immunofluorescence was detected with FITC conjugated mouse anti-rat
IgG antibody and analyzed by a FACSCalibur flow cytometer (Becton
Dickinson Immunocytometry systems, San Jose, Calif.). A series of
three affinity purifications is performed on the retroviral
producer line before subcloning by limiting dilution.
Virus-containing supernatant from each clone was used to infect
K562 cells, and gene transduction was measured by surface
expression of scFv on K562 using FACS. One of the scFv-transduced
K562 cell lines was further enriched by MACS system before cloning
by limiting dilution.
[0597] Peripheral Blood Mononuclear cells (PBMCs)
[0598] PBMCs were isolated by centrifugation on Ficoll (density,
1.077 g/ml) for 30 min at 25.degree. C. and washed twice with PBS.
They were activated with soluble anti-CD3 (1 .mu.g/ml; clone OKT3;
PharMingen, San Diego, Calif.) and anti-CD28 (1 ug/ml; clone
CD28.2; PharMingen) MoAbs for 3 days at 37.degree. C. In some
experiments, immobilized anti-CD3 and anti-CD28 MoAbs were used,
where 12-well non-tissue culture-treated plates were incubated with
the antibody (1 .mu.g/ml in PBS) at 1 ml/well for 4 hours at
37.degree. C. The coated plates were blocked with 1% HSA in PBS for
30 min at room temperature, washed once with PBS, and then used for
PBMC activation. PBMCs (10.sup.6/ml) were cultured in RPMI 1640
supplemented with 10% human AB serum (Gemini Bio-Products,
Woodland, Calif.), 50 .mu.M 2-mercaptoethanol, 2 .mu.M L-glutamine,
and 1% penicillin-streptomycin (Gibco-BRL), for a total of 3 days
before retroviral transfection.
[0599] Retroviral Transduction Protocol
[0600] The target cells (e.g. K562 or cultured PBMCs) were
resuspended at a concentration of 1-5.times.10.sup.5 cells/ml of
freshly harvested supernatant from retroviral producer cells,
containing 8-10 ug/ml hexadimethrine bromide (polybrene, Sigma),
centrifuged at 1000.times.g at room temperature for 60 minutes, and
then cultured in 12-well tissue culture plates overnight. The viral
supernatant was then aspirated and fresh IMDM (Gibco) medium
containing 100 U/ml of IL2 and changed approximately every 5 days
to maintain a cell count between 1-2.times.10.sup.6 cells/ml (21).
After 2 weeks in culture, soluble anti-idiotypic antibody 2E9 was
added at 3-10 ug/ml to the transfected lymphocytes for 3 days out
of every 2-week culture period, to ensure clonal expansion of the
scFv-positive transfected lymphocytes.
[0601] Cytotoxicity Assay
[0602] Neuroblastoma targets NMB-7 and LAN-1 or rhabdomyosarcoma
HTB-82 tumor cells were labeled with Na.sub.251CrO.sub.4 (Amersham
Pharmacia Biotechnology Inc., Piscataway, N.J.) at 100 uCi/10.sup.6
cells at 37.degree. C. for 1 hour. After the cells were washed,
loosely bound .sup.51Cr was removed by washing. 5000 target
cells/well were admixed with lymphocytes to a final volume of 200
.mu.l/well. Following a 3 minute centrifugation at 200.times.g, the
plates were incubated at 37.degree. C. for 4 hours. Supernatant was
harvested using harvesting frames (Skatron, Lier, Norway). The
released .sup.51Cr in the supernatant was counted in a universal
gamma-counter (Packard Bioscience, Meriden, Conn.). Percentage of
specific release was calculated using the formula
100%.times.(experimental cpm-background cpm)/(10% SDS releasable
cpm-background cpm), where cpm are counts per minute of .sup.51Cr
released. Total release was assessed by lysis with 10% SDS
(Sigma-Aldrich), and background release was measured in the absence
of cells. The background was usually <30% of total for these
cell lines.
[0603] Mice and Treatment
[0604] CB-17 SCID-Beige mice were purchased from Taconic
(Germantown, N.Y.). Tumor cells were planted (2.times.10.sup.6
cells) in 100 ul of Matrigel (BD BioSciences, Bedford, Mass.)
subcutaneously. Following implantation, tumor sizes (maximal
orthogonal diameters) were measured. Tumor volume was calculated as
4Br.sup.3/3 where r is the mean tumor radius. Treatment studies
started in groups of 5 mice per cage when tumor diameter reached
0.8 cm, usually by one week of tumor implantation. Mice received 5
weekly intravenous lymphocyte injections by retroorbital route,
2.times.10.sup.6 per injection together with 500 U of IL-2 ip. 50
ug of anti-idiotypic antibody was administered ip 3 days after each
lymphocyte injection. Tumor sizes were measured twice a week.
Experiments were carried out under an IACUC approved protocol and
institutional guidelines for the proper, and humane use of animals
in research were followed.
[0605] Statistical Analysis
[0606] Tumor growth was calculated by fitting a regression slope
for each individual mouse to log transformed values of tumor size.
Mean slope scores were back-transformed to give an estimate of the
percent increase in tumor size per day. Slopes were compared
between groups.
Results
[0607] Anti-8H9-Idiotypic Antibodies
[0608] Rat hybridomas specific for 8H9 and nonreactive with control
murine MoAb (IgM, IgG1 and other subclasses) were selected. By
ELISA, 2E9, 1E12, and 1F11 were all of rat subclass IgG2a. The
antibody 2E9 was chosen for the rest of the experiments.
[0609] Construction and Expression of 8H9 scFv
[0610] After secondary PCR amplification, the PCR product of scFv
fitted with Sfi I and Not I restriction sites were inserted into
pHEN1 vectors. Three rounds of panning were conducted to enrich for
2E9-binding recombinant phages. The phages eluted from the third
round panning were used to infect E. coli HB2151 cells and induced
by IPTG for expression. ScFv periplasmic soluble protein was
allowed to react in plates coated with 2.5 ug 2E9/well and assayed
by ELISA as described in Material and Methods. The clone 8HpHM9F7-1
was selected for subcloning. The scFv DNA sequence of 8HpHM9F7-1
agreed with those of the VH and VL regions of the MoAb 8H9. The
supernatant, periplasmic soluble and cells pellet lysates of
8HpHM9F7-1 were separated by nonreducing SDS-PAGE, and analyzed by
western blotting. A protein band with the apparent molecular weight
of 31 KD was found in the supernatant, the periplasmic and cell
pellet extracts using anti-MycTag antibody which recognized the
sequence GAPVPDPLEPR. No such band was detected in control cells or
8HpHM9F7-1 cells without IPTG treatment.
[0611] Construction of sc8H9-CD28-hTCRzeta-pMSCVneo
[0612] Using the assembled gene sequences, secondary PCR
amplifications using synthetic oligodeoxynucleotide primers were
performed using synthetic oligodeoxynucleotide primers 355S, 355A
for the hCD8a leader--scFv--CD28, 365S, 365A for scFv8H9, and 379S,
379A for hTCR-zeta chain. The final gene construction
hCD8_leader-8H9scFv-hCD28.sub.TM-hCD28.sub.cyto-TCR. was
transfected into the amphotropic packaging line GP+ envAM12, and
selected in G418.
[0613] Enrichment and Cloning of Packing Lines by Affinity
Column
[0614] The retroviral producer lines were affinity-enriched using
MACS goat anti-rat IgG MicroBeads on the MiniMACS system. Following
each enrichment, viral supernatant from the producer line was used
to infect the erythroleukemia line K562. Surface 8H9-scFv
expression on both the producer lines and the transfected K562 (3-5
days after infection) were measured by immunofluorescence using
anti-idiotypic antibody 2E9. With each successive affinity
enrichment (FIGS. 23A and 23C) of producer line and subsequent
successive subcloning (FIGS. 23B and 23D), the surface expression
(mean fluorescence) of 8H9-scFv increased and became more
homogeneous for the producer clones (FIGS. 23A and 23B) and for the
indicator line K562 (FIGS. 23C and 23D).
[0615] Retroviral Transduction of Primary Human Peripheral Blood
Mononuclear Cells
[0616] Following activation in vitro with soluble anti-CD3 and
anti-CD28, primary human peripheral blood mononuclear cells were
infected with the virus from producer line supernatant by
centrifugation at 1000.times.g for 60 minutes at room temperature.
By 21 days of in vitro culture, close to 100% of cells were
scFv-positive by FACS (FIG. 24). This clonal evolution to
homogeneity was found in CD4+, CD8+ and the small CD56+
populations. Soluble anti-idiotypic MoAb 2E9 was added at 3-10
ug/ml to the transfected lymphocytes for 3 days out of every 2
weeks, to stimulate clonal expansion of the scFv-positive
transfected lymphocytes (FIG. 25). ScFv expression was constant
throughout until at least day 62 (FIG. 24), while the cells
underwent active clonal expansion of 100-fold. The proportion of
CD8+ cells increased steadily from an initial 20-60% to 90% by day
40 of culture.
[0617] Transduced Lymphocytes Carried Out Efficient Non
MHC-Restricted Cytotoxicity In Vitro Against Neuroblastoma and
Rhabdomyosarcoma
[0618] In vitro cytotoxicity against NMB-7 (FIG. 26A) and LAN-1
(FIG. 26B) neuroblastoma, or rhabdomyosarcoma HTB-82 (FIG. 26C)
were efficient, all inhibitable by 8H9 antibody demonstrating
antigen specificity. Daudi cell line (FIG. 26D) was not killed
because it was antigen-negative. This cytotoxicity was independent
of target HLA expression or HLA types. Unmodified lymphocytes from
the same donor, cultured under the same conditions (100 U/ml of
IL2), did not show antigen-specific killing (LAK, FIG. 26).
[0619] Inhibition of Rhabdomyosarcoma Tumor Xenografted in SCID
Mice.
[0620] Human rhabdomyosarcoma was strongly reactive with 8H9, but
not with 5F11 (anti-GD2) antibodies. To study the in vivo effects
of 8H9scFv-CIR gene-modified lymphocytes, we used 5F11scFv-CIR as
control. 5F11scFv-CIR modified lymphocytes could kill tumors in
vitro, but only if they were GD2-positive (data not shown). When
subcutaneous tumor implants grew to 0.8 cm diameter, mice were
treated with 2.times.10.sup.6 gene-modified human lymphocytes
intravenously plus 500 U of IL2 intraperitoneally once a week for a
total of 5 weeks. 50 ug of anti-idiotypic antibody 2E9 was given ip
3 days after each lymphocyte infusion. All groups received IL2.
Control groups received either no cells +2E9, cultured unmodified
lymphocytes+2E9 (LAK), or 5F11scFv-CIR modified
lymphocytes+anti-idiotype 1G8 (specific for 5F11 idiotype).
Suppression of tumor growth was most significant with lymphocytes
transduced with the 8H9scFv-CIR gene (p=0.066, FIG. 27). Although
5F11scFv-CIR modified lymphocytes also delayed tumor growth, they
were not different from unmodified lymphocytes.
Discussion
[0621] The use of retroviral vectors to transduce chimeric immune
receptors into primary human lymphocytes has been limited by the
low gene transfer efficiency when viral supernatant infections were
carried out. Transfer rates into primary human T cells using
amphotropic virus ranged from 1 to 12% (22). Several strategies
were explored to increase the transduction rates to 20-50%. These
include: (1) using gibbon ape leukemia virus (GaLV strain SEATO)
pseudotyped virions (20, 23, 24), (2) coculturing producer and
target cells (25) where the clinical safety was of some concern,
(3) using phosphate depletion followed by centrifugation and
incubation at 32.degree. C. (22), (4) adding fibronectin CH296 to
enhance virus/lymphocyte interactions (26). More recently, Eshhar
et al described a dicistronic construct consisting of
scFv-CD28-(and green fluorescent protein (GFP), where the latter
was used to monitor gene transduction and to enrich producer line
(7). In our study, we used anti-idiotypic antibody to select for
high surface scFv-expressing producer lines with improved
efficiency of gene transduction. More importantly, lymphocytes
transduced by CD-28-. chimeric fusion receptors proliferated in the
presence of the anti-idiotypic MoAb to become "monoclonal" with
respect to scFv expression, in both the CD4+ and CD8+ populations.
These lymphocytes possessed antigen-specific tumorcidal activity
both in vitro and in vivo that was non-MHC restricted. Whether
CD56-positive cells (presumably NK cells) acquire similar abilities
will need further studies, although activation of NK cells through
CD28 signaling has been reported previously (27).
[0622] We have shown that anti-idiotypic antibodies can facilitate
clone selection in the construction of soluble scFv-fusion proteins
or cell bound surface scFv. We have successfully applied similar
technology to the GD2 antigen system (unpublished data). Being
immunoglobulins, their structure, stability, biochemistry are
generally known. This is in contrast to natural antigens where each
individual system has its unique and often difficult-to-predict
properties. As surrogate antigens, anti-idiotypic MoAb are ideal
for standardization and quality control, especially for initial
clinical investigations of carbohydrate antigens or when the nature
of the antigen is not fully understood.
[0623] The advantage of using anti-idiotypic antibody for affinity
purification and for clonal expansion of gene-modified lymphocytes
are many fold. To prepare polyclonal CTLs specific for a tumor
target, lymphocytes have to be pulsed periodically in vitro with
the tumor cells (21). Clearly this can create safety (tumor
contamination) and quality control issues. In contrast,
anti-idiotypic MoAb can be manufactured under standard good
manufacturing practice (GMP) conditions, with ease of manipulation
both in vitro or in vivo. Another advantage of anti-idiotypic MoAb
is its ability to mark the clonal population of target-specific
lymphocytes. Although tetramers can mark TCR and T-cell clones,
identity of the peptide antigen is required and this technology is
not easily available. Furthermore, anti-idiotypic MoAb can mark
T-cell clones in vivo when radiolabeled, an option not yet possible
with tetramers. Finally, the potential of anti-idiotypic MoAb to
activate the transduced lymphocytes in vivo is appealing,
especially when tumor cells are poorly immunogenic, or when they
are scarcely distributed. Although we used anti-idiotypic MoAb in
our SCID mice experiments, this strategy clearly requires further
optimization after a better understanding of in vivo biology of
these transduced cells become available.
[0624] Despite these encouraging results, other structural issues
of CIR technology will have to be considered for future
optimization. The choice of the appropriate spacer (between scFv
and signaling molecule), transmembrane domain and the signaling
molecules may be important (28). That 8H9scFv-modified T-cells
proliferate with anti-idiotype and kill antigen-positive tumor
cells argue strongly that the CD28 trans-membrane domain in this
CIR design does not require a CD8 hinge, permitting effective
interaction with soluble as well as cell-bound antigens. This
interaction effects positive lymphocyte signaling, for both
survival and activation, as previously reported for similar
chimeric fusion protein containing both CD28 and TCR-.chains (13).
It is possible that the level of activation could be improved by
the addition of a hinge or the adoption of other trans-membrane
domains, as previously suggested (29). Previous reports have
suggested that a human IgG hinge-CH2-Ch3 spacer can optimize T-cell
activity, surface expression, and target affinity (28, 30).
Moreover, using domains or molecules further downstream in the
T-cell activation pathway could potentially overcome the T-cell
defects commonly found in cancer patients (31). Another variable in
T-cell activation is the affinity of interaction between TCR and
MHC peptide complex (32). Whether a chimeric receptor of low
affinity scFv may better mimic naive TCR interaction needs to be
further tested. An optimal density of CIR for T-cell activation is
probably important (33), since excessive TCR signaling may trigger
premature death. In addition, since most target antigens are not
tumor-specific, it may be useful to standardize the level of
expression of CIR such that an engineered T-cell is optimally
activated only by a narrow threshold of antigen.
[0625] The choice of tumor system and antigen target will likely
determine the clinical success of CIR strategy. Primary lymphoid
tumors e.g. B-cell lymphomas have distinct attributes. Because of
their innate tropism, T-cells home to these lymphomas. In addition,
these tumors have unique tumor antigens with homogeneous expression
that do not modulate from the cell surface (e.g. CD20).
Furthermore, these B-cell tumors express costimulatory molecules
(30). Most solid tumors lack these attributes. However, metastatic
cancers in lymph nodes, blood and bone marrow are unique
compartments where CIR technology may be applicable. Depending on
the compartment, targeting of T-cells may require different
chemokine receptors or adhesion molecules. For example, while
L-selectin is required for homing to lymphoid organs, its role for
trafficking to other metastatic organs such as marrow is less well
defined.
[0626] In adoptive cell therapies, the precise evaluation of the
quantity and persistence of these cells in vivo, as well as their
distribution and function within tissues is critical (34). In
studies of T-cell therapy, this is of particular importance since
many infused cells will undergo activation-induced death in vivo
(35), or immune elimination of gene-modified cells may occur,
especially following repeated injections (36). The development of
sensitive, accurate and reproducible methods to quantify
gene-marked cells in peripheral blood and tissues are essential for
defining the long-term fate of adoptively-transferred cells. While
PCR and quantitative RT-PCR methods are ideal for studying tissues
extracts, anti-idiotypic MoAb will provide useful tools to
enumerate individual scFv-positive cells in blood, marrow and
tumor. In addition, noninvasive imaging methods using radiolabeled
anti-idiotypic MoAb may also be possible. Similar to the marker
gene HSV-tk that allows cells to be tracked and quantified by the
substrate .sup.131I-FIAU or .sup.124I-FIAU, anti-idiotypic MoAb
labeled with either .sup.131I or .sup.124I can also take advantage
of instrumentation and software developed for SPECT and
PET/micro-PET imaging, respectively. These tools can provide
unprecedented precision and dynamic information on cell traffic in
patient trials.
REFERENCES
[0627] 1. Daniel, P. T., Kroidl, A., Cayeux, S., Bargou, R.,
Blankenstein, T., and Dorken, B. Costimulatory signals through
B7.1/CD28 prevent T cell apoptosis during target cell lysis. J
Immunol, 159: 3808-3815, 1997. [0628] 2. Eshhar, Z., Waks, T.,
Gross, G., and Schindler, D. G. Specific activation and targeting
of cytotoxic lymphocytes through chimeric single chains consisting
of antibody-binding domains and the gamma or zeta subunits of the
immunoglobulin and T-cell receptors. Proceedings of the National
Academy of Sciences of the United States of America, 90: 720-724,
1993. [0629] 3. Stancovski, I., Schindler, D. G., Waks, T., Yarden,
Y., Sela, M., and Eshhar, Z. Targeting of T lymphocytes to
Neu/HERe-expressing cells using chimeric single chain Fv receptors.
J Immunol, 151: 6577-6582, 1993. [0630] 4. Moritz, D., Wels, W.,
Mattern, J., and Groner, B. Cytotoxic T lymphocytes with a grafted
recognition specificity for ERBB2-expressing tumor cells. Proc.
Natl Acad Sci, USA, 91: 4318-4322, 1994. [0631] 5. Wels, W.,
Moritz, D., Schmidt, M., Jeschke, M., Hynes, N. E., and Groner, B.
Biotechnological and gene therapeutic strategies in cancer
treatment. Gene, 159: 73-80, 1995. [0632] 6. Hwu, P., Shafer, G.
E., Treisman, J., Schindler, D. G., Gross, G., Cowherd, R.,
Rosenberg, S. A., and Eshhar, Z. Lysis of ovarian cancer cells by
human lymphocytes redirected with a chimeric gene comosed of an
antibody variable region and the Fc-receptor gamma-chain. J. Exp.
Med., 178: 361-369, 1993. [0633] 7. Eshhar, Z., Waks, T., Bendavid,
A., and Schindler, D. G. Functional expression of chimeric receptor
genes in human T cells. J Immunol Methods, 248: 67-76, 2001. [0634]
8. Rosenberg, S. A. Cell transfer therapy: clinical applications.
In: V. T. J. DeVita, S. Hellman, and S. A. Rosenberg (eds.),
Biologic therapy of cancer, second edition, pp. 487-506.
Philadelphia: J.B.Lippincott Company, 1995. [0635] 9. Yang, A.-G.
and Chen, S.-Y. A new class of antigen-specific killer cells. Nat
Biotechnol, 15: 46-51, 1997. [0636] 10. Culver, K. W., Ram, Z.,
Wallbridge, S., Ishii, H., Oldfield, E. H., and Blaese, R. M. In
vivo gene transfer with retroviral vector-producer cells for
treatment of experimental brain tumors. Science, 256: 1550, 1992.
[0637] 11. Wei, M. X., Tamiya, T., and Chase, M. Experimental tumor
therapy in mice using the cyclophosphamide-activating cytochrome
P450 2B1 gene. Hum Gene Ther, 5: 969, 1994. [0638] 12. Weijtens, M.
E., Willemsen, R. A., Valerio, D., Stam, K., and Bolhuis, R. L.
Single chain Ig/gamma gene-redirected human T lymphocytes produce
cytokines, specifically lyse tumor cells, and recycle lytic
capacity. J Immunol, 157: 836-843, 1996. [0639] 13. Finney, H. M.,
Lawson, A. D. G., Bebbington, C. R., and Weir, N. C. Chimeric
receptors providing both primary and costimulatory signaling in T
cells from a single gene product. J Immunol, 161: 2791-2797, 1998.
[0640] 14. Thanavala, Y. M., Brown, S. E., Howard, C. R., Roitt, I.
M., and Steward, M. W. A surrogate hepatitis B virus antigenic
epitope represented by a synthetic peptide and an internal image
antiidiotype antibody. Journal of Experimental Medicine, 164:
227-236, 1986. [0641] 15. Wagner, U., Schlebusch, H., Kohler, S.,
Schmolling, J., Grunn, U., and Krebs, D. Immunological responses to
the tumor-associated antigen CA125 in patients with advanced
ovarian cancer induced by the murine monoclonal anti-idiotype
vaccine ACA125. Hybridoma, 16: 33-40, 1997. [0642] 16. Modak, S.,
Kramer, K., Humayun, G., Guo, H. F., and Cheung, N. K. V.
Monoclonal antibody 8H9 targets a novel cell surface antigen
expressed by a wide spectrum of human solid tumors. Cancer
Research, 61: 4048-4054, 2001. [0643] 17. Cheung, N. K., Saarinen,
U., Neely, J., Landmeier, B., Donovan, D., and Coccia, P.
Monoclonal antibodies to a glycolipid antigen on human
neuroblastoma cells. Cancer Research, 45: 2642-2649, 1985. [0644]
18. Cheung, N. K., Canete, A., Cheung, I. Y., Ye, J. N., and Liu,
C. Disialoganglioside GD2 anti-idiotypic monoclonal antibodies.
International Journal of Cancer, 54: 499-505, 1993. [0645] 19.
Towbin, H., Staehelin, T., and Gordon, J. Electrophoretic transfer
of proteins from polyacrylamide gels to nitrocellulose sheets:
procedure and some applications. Proceedings of the National
Academy of Sciences of the United States of America, 76: 4350-4354,
1979. [0646] 20. Krause, A., Guo, H. F., Tan, C., Cheung, N. K. V.,
and Sadelain, M. Antigen-dependent CD-28 signaling enhances
survival and proliferation in genetically modified activated human
primary T lymphocytes. J. Exp. Med., 188: 619-626, 1998. [0647] 21.
Koehne, G., Gallardo, H. F., Sadelain, M., and O'Reilly, R. J.
Rapid selection of antigen-specific T lymphocytes by retroviral
transduction. Blood, 96: 109-117, 2000. [0648] 22. Bunnell, B. A.,
Muul, L. M., Donahue, R. E., Blaese, R. M., and Morgan, R. A.
High-efficiency retroviral-mediated gene transfer into human
nonhuman primate peripheral blood lymphocytes. Proceeds of the
National Academy of Science, USA, 92: 7739-7743, 1995. [0649] 23.
Miller, A. D., Garcia, J. V., von Suhr, N., Lynch, C. M., Wilson,
C., and Eiden, M. V. Construction and properties of retrovirus
packaging cells based on gibbon ape leukemia virus. J Virol, 1991:
2220-2224, 1991. [0650] 24. Lam, J. S., Reeves, M. E., Cowherd, R.,
Rosenberg, S. A., and Hwu, P. Improved gene transfer into human
lymphocytes using retroviruses with gibbon ape leukemia virus
envelope. Hum Gene Ther, 7: 1415-1422, 1996. [0651] 25. Bonini, C.,
Ferrari, G., Verzeletti, S., Servida, P., Zappone, E., Ruggieri,
L., Ponzoni, M., Rossini, S., Mavilio, F., Traversari, C., and
Bordignon, C. HSV-TK gene transfer into donor lymphocytes for
control of allogeneic graft-versus-leukemia. Science, 276:
1719-1723, 1997. [0652] 26. Pollok, K. E., Hanenberg, H., Noblitt,
T. W., Schroeder, W. L., Kato, I., Emanuel, D., and Williams, D. A.
High-efficiency gene transfer into normal and adenosine
deaminase-deficient T lymphocytes is mediated by transduction on
recombinant fibronectin fragments. J Virol, 72: 4882-4892, 1998.
[0653] 27. Galea-Lauri, J., Darling, D., Gan, S.-U.,
Krivochtchapov, L., Kuiper, M., Gaken, J., Souberbielle, B., and
Farzaneh, F. Expression of a variant of CD28 on a subpopulation of
human NK cells: implications for B7-mediated stimulation of NK
cells. J Immunol, 163: 62-70, 1999. [0654] 28. Patel, S. D.,
Moskalenko, M., Smith, D., Maske, B., Finer, M. H., and McArther,
J. G. Impact of chimeric immune receptor extracellular protein
domains on T cell function. Gene Therapy, 6: 412-419, 1999. [0655]
29. Fitzer-Attas, C. J., Schindler, D. G., Waks, T., and Eshhar, Z.
Harnessing Syk familytyrosine kinases as signaling domains for
chimeric single chain of the variable domain receptors: optional
design for T cell activation. J Immunol, 160: 145-154, 1998. [0656]
30. Jensen, M., Tan, G., Forman, S., Wu, A. M., and Raubitschek, A.
CD20 is a molecular target for scFvFc: receptor redirected T cells:
implications for cellular immunotherapy of CD20+ malignancy. Biol
Blood Marrow Transplant, 4: 75-83, 1998. [0657] 31. Eshhar, Z. and
Fitzer-Attas, C. J. Tyrosine kinase chimeras for antigen-selective
T-body therapy. Adv Drug Deliv Rev, 31: 171-182, 1998. [0658] 32.
Valitutti, S. and Lanzavecchia, A. Serial triggering of TCRs: a
basis for the sensitivity and specificity of antigen recognition.
Immunology Today, 18: 299-304, 1997. [0659] 33. Varez-Vallina, L.
and Russell, S. J. Efficient discrimination between different
densities of target antigen by tetracycline-regulatable T bodies.
Hum Gene Ther, 10: 559-563, 1999. [0660] 34. Yee, C., Riddell, S.
R., and Greenberg, P. D. In vivo tracking of tumor-specific T
cells. Curr Opin Immunol, 13: 141-146, 2001. [0661] 35. Xiaoning,
R. T., Ogg, G. S., Hansasuta, P., Dong, T., Rostron, T., Luzzi, G.,
Conlon, C. P., Screaton, G. R., McMichael, A. J., and
Rowland-Jones, S. Rapid death of adoptively transferred T cells in
acquired immunodeficiency syndrome. Blood, 93: 1506-1510, 1999.
[0662] 36. Riddell, S. R., Elliott, M., Lewinsohn, D. A., Gilbert,
M. J., Wilson, L., Manley, S. A., Lupton, S. D., Overell, R. W.,
Reynolds, T. C., Corey, L., and Greenberg, P. D. T-cell mediated
rejection of gene-modified HIV-specific cytotoxic T lymphocytes in
HIV-infected patients. Nat Med, 2: 216-223, 1996.
Seventh Series of Experiments
Radioimmunotargeting to Human Rhabdomysarcoma (RMS) Using
Monoclonal Antibody (MOAB) 8H9
[0663] Metastatic rhabdomyosarcoma is a chemotherapy-responsive
tumor. However, cure is elusive because of the failure to eradicate
minimal residual disease (MRD). MoAb may have potential for
selective targeting of therapy to MRD. Few MoAb of clinical utility
have been described for RMS. We previously reported the broad tumor
reactivity of a murine MoAb 8H9 with low/no staining of normal
human tissues. The target antigen was typically expressed in a
homogeneous fashion among neuroectodermal (neuroblastoma, Ewing's
sarcoma, PNET, brain tumors), mesenchymal (RMS, osteosarcoma, DSRT,
STS) and select epithelial tumors. Of 25 RMS tumors, 24 stained
positive. Radioimmunolocalization of subcutaneous RMS xenografts in
SCID mice was studied using radiolabeled 8H9. Following iv
injection of 120 uCi of .sup.125I-8H9, selective tumor uptake was
evident at 4 to 172 hrs after injection, with a blood T of 0.8 h
and T of 26 h. Mean tumor/tissue ratios were optimal at 172 h (for
lung 4, kidney 7, liver 9, spleen 10, femur 16, muscle 21, brain
45). Average tumor/blood ratio were 0.7, 1.4 and 1.6, and tumor
uptake was 9.5.+-.3.4, 13.3.+-.1.5, and 5.3.+-.0.9% injected dose
per gm at 24, 48 and 172 h, respectively. The selective targeting
of 8H9 to RMS xenografts suggests its potential for
radioimmunodetection and MoAb-based targeted therapy of MRD in
RMS.
Radioimmunotargeting of Human Rhabdomyosarcoma Using Monoclonal
Antibody 8H9
Abstract
[0664] Purpose:
[0665] Although metastatic rhabdomyosarcoma (RMS) is chemotherapy
and radiotherapy-responsive, few patients are cured. 8H9, a murine
IgG1 monoclonal antibody (MoAb), recognizes a unique cell surface
antigen that has restricted expression on normal tissues but is
broadly distributed on neuroectodermal, epithelial and mesenchymal
tumors including RMS. In this report we test its immunotargeting
potential in mice with subcutaneous human RMS.
[0666] Experimental Design:
[0667] Athymic nude mice with established RMS xenografts were
injected intravenously with .sup.125I-8H9 or .sup.125I-control
MoAb. .sup.125I-8H9 immunoreactivity was tested on solid-phase
anti-8H9-idiotypic rat MoAb 2E9. Mice were imaged using a gamma
camera and biodistribution of radiolabeled antibodies determined.
The anti-tumor effect was studied following intravenous (IV)
administration of 18.5MBq .sup.131I-8H9.
[0668] Results:
[0669] Following IV injection of 4.44MBq of .sup.125I-8H9,
selective tumor uptake was evident 4 to 172 h after injection.
Average tumor uptake was 11.5.+-.3.9, 15.1.+-.3.7, and 5.4.+-.1.2%
injected dose per gm at 24, 48 and 172 h, respectively. Mean
tumor/tissue ratios were optimal at 172 h (for lung, 4, kidney 6,
liver 7, spleen 11, femur 14, muscle 18, brain 48). Tumor/tissue
ratios were improved when a lower dose (0.74MBq) of .sup.125I-8H9
was injected. No hematological or histological abnormalities were
observed. Mice injected with .sup.125I-negative control did not
demonstrate specific tumor uptake. In contrast to .sup.131I-control
treated mice, which showed unabated tumor progression, mice treated
with 18.5MBq of .sup.131I-8H9 showed tumor suppression of
>50%.
[0670] Conclusions:
[0671] Radiolabeled 8H9 effectively targeted RMS xenografts and may
have a potential clinical role in immunodetection and
immunotherapy.
Introduction
[0672] Metastatic rhabdomyosarcoma (RMS) is associated with a
dismal prognosis with reported cure rates of no greater than 25%
despite demonstrated chemosensitivity and radiosensitivity (1,2,3).
Myeloablative chemotherapy with autologous stem cell rescue has
failed to impact survival (4,5). The failure to eradicate minimal
residual disease (MRD) leads to local and distant relapses for both
alveolar and embryonal RMS. Alternative strategies to target MRD
are therefore warranted. Monoclonal antibodies (MoAbs) have
recently been reported to be of clinical benefit in the treatment
of solid tumors. In children with high-risk neuroblastoma (NB), the
addition of the anti-ganglioside G.sub.D2 antibody 3F8 to a
multimodality approach has significantly improved prognosis (6)
without increasing long-term toxicity (7). Radiolabeled antibodies
can selectively deliver radiation to human tumors. Demonstration of
specific binding to NB xenografts by .sup.131I-3F8 was initially
demonstrated in xenograft models (8). Indeed, .sup.131I-3F8
completely ablated NB xenografts in athymic nude mice with
reversible toxicity (9). Based on the pharmacokinetics and
dosimetry calculations to tumors and normal tissues
radioimmunodetection and radioimmunotherapy, clinical protocols
utilizing .sup.131I-3F8 were initiated in patients with NB.
Subsequently, effective and specific targeting of NB in humans was
demonstrated (10,11), and later utilized both for detection and
therapy.
[0673] The adoption of a similar strategy to RMS has been limited
by the paucity of antigens that can be targeted by MoAbs. Most
antigens expressed on RMS either have a nuclear or cytoplasmic
localization which makes them inaccessible to MoAbs, or are
coexpressed on normal tissues thus limiting their clinical utility
(Table 1). The PAX-FKHR fusion transcript is specific for alveolar
RMS. It has been used in the detection of micrometastases in
alveolar RMS by RT-PCR (12, 13) and as a tumor antigen for the
generation of cytotoxic T-cells (14). However, its nuclear
localization shields the intact protein from antibody-based
targeting approaches. Furthermore, for the more frequent embryonal
variant, such specific markers are not yet available. We recently
described a novel tumor antigen with an apparent molecular weight
of 58 kD (15) recognized by the MoAb 8H9. This glycoprotein is
expressed on cell surface of a broad spectrum of solid tumors in
childhood and adults, including both alveolar and embryonal RMS and
has restricted distribution on normal tissues. We now report the in
vivo targeting of .sup.125I and .sup.131I labeled 8H9 in human RMS
xenografts.
TABLE-US-00025 TABLE 1 Previously reported antigens on
rhabdomyosarcoma Antigen Localization Crossreactivity Desmin (22)
cytoplasm Skeletal, Cardiac and Smooth Muscle Cytokeratin (23)
cytoplasm Epithelial cells EMA (23) cytoplasm Epithelial cells
Vimentin (23) cytoplasm All mesenchymal tissues NSE (23) cytoplasm
Brain and neural tissue MYOD1 (17) nucleus Restricted to RMS Ag
BW575 (18) cell membrane Neural cells Myosin (19) cell membrane
Muscle cells 5.1 H11 (25) cytoplasm Neural cells IGFI receptor (21)
cell membrane Normal cells Fetal acetylcholine receptor cell
membrane Extraocular muscles, (20) thymus, denervated skeletal
muscle
TABLE-US-00026 TABLE 2 % injected dose/gram of .sup.125I-8H9
distributed in HTB82 xenografts and normal tissues 24, 48 and 172
hours after injection 172 h 24 h (n = 9 mice) 48 h (n = 9 mice) (n
= 8 mice) Mean .+-. SD Mean .+-. SD Mean .+-. SD Adrenal 1.4 .+-.
1.6 1.4 .+-. 0.5 0.4 .+-. 0.3 Bladder 2.6 .+-. 1.2 2.9 .+-. 0.8 0.9
.+-. 0.6 Blood 14.1 .+-. 3.0 10.7 .+-. 2.1 3.2 .+-. 0.9 Brain 0.3
.+-. 0.1 0.3 .+-. 0.1 0.1 .+-. 0.0 Femur 1.4 .+-. 0.5 1.1 .+-. 0.5
0.4 .+-. 0.1 Heart 4.3 .+-. 1.9 2.9 .+-. 0.5 0.9 .+-. 0.2 Kidney
3.9 .+-. 1.6 3.0 .+-. 0.7 0.8 .+-. 0.3 Large Intestine 1.7 .+-. 0.6
1.2 .+-. 0.3 0.2 .+-. 0.1 Liver 4.0 .+-. 1.7 2.2 .+-. 0.3 0.7 .+-.
0.3 Lung 5.7 .+-. 3.5 5.3 .+-. 1.1 1.4 .+-. 0.5 Muscle 1.2 .+-. 0.6
1.1 .+-. 0.4 0.3 .+-. 0.1 Skin 2.3 .+-. 1.6 2.5 .+-. 1.5 0.6 .+-.
0.4 Small Intestine 1.5 .+-. 0.4 1.1 .+-. 0.2 0.3 .+-. 0.1 Spine
2.1 .+-. 0.8 1.7 .+-. 0.7 0.5 .+-. 0.2 Spleen 5.8 .+-. 2.4 3.3 .+-.
0.8 0.5 .+-. 0.2 Stomach 2.4 .+-. 2.1 1.6 .+-. 0.7 0.5 .+-. 0.4
Tumor 11.5 .+-. 3.9 15.1 .+-. 3.7 5.4 .+-. 1.2
TABLE-US-00027 TABLE 3 Tumor:non-tumor ratios in mice injected with
0.74MBq compared to 4.44MBq of .sup.125I-8H9 172 h post injection
(5 mice per group) 0.74MBq 4.44MBq Mean .+-. SD Mean .+-. SD
Adrenal 26.3 .+-. 20.4 12.5 .+-. 3.6 Bladder 35.0 .+-. 31.4 7.9
.+-. 1.5 Blood 2.6 .+-. 1.7 1.7 .+-. 0.3 Brain 150.9 .+-. 36.1 51.9
.+-. 20.1 Femur 26.7 .+-. 20.6 13.7 .+-. 2.0 Heart 11.5 .+-. 8.5
5.7 .+-. 1.0 Kidney 8.4 .+-. 3.5 6.5 .+-. 1.4 Large Intestine 32.3
.+-. 18.6 23.0 .+-. 5.0 Liver 13.0 .+-. 6.7 7.0 .+-. 0.9 Lung 7.7
.+-. 6.0 4.1 .+-. 0.6 Muscle 33.0 .+-. 22.3 18.9 .+-. 4.4 Skin 13.0
.+-. 8.9 7.2 .+-. 3.1 Small Intestine 29.4 .+-. 17.0 20.8 .+-. 6.4
Spine 20.4 .+-. 11.1 10.3 .+-. 3.7 Spleen 16.4 .+-. 11.3 11.9 .+-.
2.0 Stomach 23.4 .+-. 15.9 14.5 .+-. 4.3 Tumor 1.0 .+-. 0 1.0 .+-.
0
TABLE-US-00028 TABLE 4 Biodistribution of .sup.125I-8H9 and
.sup.125I-2C9 in mice with HTB82 xenografts 120 h after injection
(values represent % injected dose/gram). .sup.125I-8H9
.sup.125I-2C9 Mean .+-. SD Mean .+-. SD Adrenal 0.5 .+-. 0.2 0.7
.+-. 0.4 Bladder 1.5 .+-. 0.8 1.5 .+-. 0.4 Blood 4.6 .+-. 0.7 8.4
.+-. 1.4 Brain 0.1 .+-. 0.1 0.2 .+-. 0.1 Femur 0.6 .+-. 0.1 0.9
.+-. 0.2 Heart 1.0 .+-. 0.2 1.7 .+-. 0.4 Kidney 1.2 .+-. 0.3 1.4
.+-. 0.4 Large intestine 0.4 .+-. 0.3 0.5 .+-. 0.1 Liver 0.9 .+-.
0.1 1.4 .+-. 0.1 Lung 2.9 .+-. 0.7 5.3 .+-. 1.5 Muscle 0.4 .+-. 0.1
0.5 .+-. 0.1 Skin 0.8 .+-. 0.1 1.0 .+-. 0.3 Skin 0.8 .+-. 0.1 1.0
.+-. 0.3 Small intestine 0.4 .+-. 0.1 0.6 .+-. 0.1 Spine 0.6 .+-.
0.1 1.3 .+-. 0.5 Spleen 1.3 .+-. 0.6 2.2 .+-. 0.5 Stomach 0.5 .+-.
0.2 1.1 .+-. 0.2 Stomach contents 0.3 .+-. 0.1 0.3 .+-. 0.2 Tumor
7.2 .+-. 0.9 2.5 .+-. 0.9
TABLE-US-00029 TABLE 5 Mean hematological and liver function
parameters in mice (5 per group) iniected with .sup.131I-8H9
Reported Day 15 Day 30 normal values CBC Hb (g/dl) 11.2 .+-. 0.3
13.1 .+-. 3.2 11.0-14.0 WBC (10.sup.3) 4.43 .+-. 0.7 6.2 .+-. 2.7
2.8-9.2 Platelets (10.sup.3) 1309 .+-. 371 1300 .+-. 798 1523 .+-.
218 Segmented (%) 46.8 .+-. 9.9 42.5 .+-. 11.4 42-45.5 Lymphocytes
(%) 49.6 .+-. 11.6 51.2 .+-. 16.2 54.5-58 Liver function tests
(pooled serum) Alk. Phosphatase (IU/L) 96 174 66-258 ALT (IU/L) 36
33 62-121 AST (IU/L) 169 93 87-318 GGT (IU/L) 0 0 Albumin (g/dl)
3.1 4.8 2.5-4.8 Total protein (g/dl) 5.5 5.1 3.5-7.2 Total
bilirubin (mg/dl) 0.1 0.3 0.1-0.9
Materials and Methods
Monoclonal Antibodies
[0674] MoAb 8H9
[0675] The murine MoAb 8H9 was produced by hyperimmunizing BALB/c
mice with human neuroblastoma as previously described. (15).
[0676] MoAb 2C9
[0677] Using similar methods, mice were immunized with human breast
cancer and the hybridoma demonstrating specificity against
cytokeratin 8 was isolated.
[0678] Anti-Idiotypic MoAbs
[0679] Rat anti-8H9-idiotype MoAbs were produced by immunizing
LOU/CN rats with purified 8H9. Following in vitro hybridization
with the myelomas SP2/0 or 8653, three IgG.sub.2a clones (2E9, 1E12
and 1F11) were selected for their high binding and specificity by
ELISA. When tested against a panel of 23 other myelomas, no
crossreactivity was found. The anti-idiotypic hybridomas were
cloned and the antibody 2E9 chosen for scaled up production using
high-density MiniPERM bioreactor (Unisyn technologies, Hopkinton,
Mass.). Anti-idiotypic antibodies were further purified by protein
G affinity (Hitrap G, Pharmacia, Piscataway, N.J.) chromatography
and filtered through a 0.2 .mu.m Millipore filter (Millipore Inc.,
Bedford, Mass.).
Cell Lines
[0680] RMS cell line HTB82 and small cell lung cancer cell line
HTB119 (8H9 negative control) were purchased from American Type
Culture Collection, Bethesda, Md. Cell lines were grown in RPMI
(Gibco BRL, Gaithersburg, Md.) supplemented with 10% newborn calf
serum (Hyclone, Logan, Pa.), 2 mM glutamine, 100 U/ml penicillin
and 100 ug/ml streptomycin (Gibco-BRL, Gaithersburg, Md.). Cells
were cultured in a 37.degree. C. incubator and harvested using 2 mM
EDTA.
Iodination
[0681] MoAb 8H9 was allowed to react for 5 min with .sup.125I or
.sup.131I (NEN Life Sciences, Boston, Mass.) and chloramine T (1
mg/ml in 0.3M Phosphate buffer, pH 7.2) at room temperature. The
reaction was stopped by adding sodium metabisulfite (1 mg/ml in
0.3M Phosphate buffer, pH 7.2) for 2 min. Radiolabeled MoAb was
separated from free iodine using A1GX8 resin column (BioRad,
Richmond, Calif.) saturated with 1% HSA (New York Blood Center
Inc., Melville Biologics Division, New York, N.Y.) in PBS, pH 7.4.
Peak radioactive fractions were pooled and the radioactivity
(MBq/ml) was measured using a radioisotope calibrator (Squibb,
Princeton, N.J.). Iodine incorporation and specific activities were
calculated. Trichloroacetic acid (TCA) (Fisher Scientific,
Pittsburgh, Pa.) precipitation was used to assess the percentage of
protein bound .sup.125I or .sup.131I. Thin layer chromatography was
performed by running 1 .mu.l of .sup.125I-8H9 on a silica gel on
glass TLC plate (Sigma Chemical, St. Louis, Mo.) and scanning it
with System 200 Imaging Scanner (Bioscan, Washington, D.C.).
In Vitro Immunoreactivity of Iodinated 8H9
[0682] Immunoreactivity of labeled antibody was determined by a
specific microtiter solid phase radioimmunoassay developed using
the anti-8H9-idiotypic antibody 2E9 as the antigen. Briefly,
microtiter plates were precoated with diminishing concentrations of
2E9. Appropriate dilutions of .sup.125I-8H9 were added in
duplicate. Binding was maximized by serial incubations at 4.degree.
C. in 3 separate antigen plates for periods of 1 h, 4 h and
overnight respectively. The percent of bound activity was summed
for each dilution to obtain the maximum percent binding. Similar
assay was carried out to assess immunoreactivity of
.sup.131I-8H9.
[0683] Immunoreactivity was also measured by specific binding to
cell pellets. HTB82 cells were suspended in Eppendorff tubes at
concentrations of 10.sup.8, 10.sup.7 and 10.sup.6/ml in 100 .mu.l
medium. 100 .mu.l of appropriate dilution of .sup.125I-8H9 was
added and allowed to react at 37.degree. C. for 60 mins. Tubes were
subsequently centrifuged at 1400 rpm.times.10 mins. Radioactivity
in 100 .mu.l of supernatant was counted using Minaxi gamma counter
(Packard BioScience, Downer's Grove, Ill.) and compared with total
counts in a control sample consisting of medium without cells.
Percent binding was calculated as (Experimental cpm/control
cpm).times.100%. The 8H9-negative cell line HTB 119 was used as
control.
Animal Studies
Biodistribution and Pharmacokinetics
[0684] All animal experiments were carried out under an IACUC
approved protocol and institutional guidelines for the proper and
humane use of animals in research were followed. Athymic nude mice
(Ncr nu/nu) were purchased from NCI, Frederick Md. They were
xenografted subcutaneously with HTB82 cell line (2.times.10.sup.6
cells/mouse) suspended in 100 ul of Matrigel (Beckton-Dickinson
BioSciences, Bedford, Mass.) on the right flank. After 3-4 weeks,
mice bearing tumors of 1 to 1.5 cm in longest dimension were
selected. Mice were injected intravenously (retrorbital plexus)
with 0.74MBq or 4.44MBq of .sup.125I-8H9, or with 4.44MBq
.sup.125I-2C9. They were anesthesized with ketamine (Fort Dodge
Animal Health, Fort Dodge, Iowa) intraperitoneally and imaged at
various time intervals with a gamma camera (ADAC, Milpitas, Calif.)
equipped with a high-resolution general-purpose collimator for
.sup.131I and thyroid X-ray grids for .sup.125I. Serial blood
samples were collected at 5 min, 1, 2, 4, 8, 18, 24, 48, 72, 120,
144 and 172 h to determine blood clearance of .sup.125I-8H9. Groups
of mice injected with .sup.125I-8H9 were sacrificed at 24 h, 48 h,
120 h or 172 h immediately after imaging. Mice injected with
.sup.125I-2C9 were imaged either at 120 h (and then sacrificed) or
at 172 h. Samples of blood (cardiac sampling), heart, lung, liver,
kidney, spleen, stomach, adrenal, small bowel, large bowel, spine,
femur, muscle, skin, brain and tumor were weighed and radioactivity
measured with a Minaxi-gamma counter. Results were expressed as
percent injected dose per gram and biodistribution determined.
Toxicity
[0685] Athymic nude mice without xenografts were each injected with
4.44MBq of .sup.131I-8H9. Groups of mice were euthanized at 15 and
30 days. Complete blood counts were carried out in each mouse via
terminal bleed and liver function tests were performed on pooled
sera. Complete necropsies including gross and histological
examinations were carried out to evaluate possible toxicity of
.sup.131I-8H9.
Evaluation of Anti-Tumor Activity
[0686] RMS xenografts were established as described above. Their
maximal perpendicular axes were measured using calipers in control
and tumor groups. After 3 weeks, mice bearing tumors of
approximately 0.7 cm.sup.3 (tumor volume was calculated using the
formula V=4.pi.r.sup.3/3 where r=mean radius) were selected and
injected with 18.5 MBq of .sup.131I-8H9 or .sup.131I-3F8 (3F8 was
used as a negative control antibody). Average serial tumor volumes
and body weights were monitored in the two groups and compared over
time. Mice were euthanized as per guidelines published in NIH
Publication No. 85-23 (`Principles of Laboratory Animal Care`).
Data are expressed as % increase or decrease in tumor volume when
compared to initial measurement on day 0 of treatment.
Results
Immunoreactivity
[0687] Protein bound .sup.125I and .sup.131I as assessed by TCA
precipitation averaged 96.+-.4.2% and 98.+-.2.2%, respectively for
8H9, and >95% for control antibodies 2C9 and 3F8. TLC
demonstrated free iodine peak of 1%, 99% being protein bound.
Average maximum immunoreactivity as measured by solid-phase RIA
using the anti-8H9-idiotype 2E9 as antigen was 67.+-.26% for 8H9
and 11% for 2C9. Maximum immunoreactivity measured by cell pellet
binding assay was 83% for 8H9, maximum binding to the negative
control cell line HTB119 being 9%. 2C9 demonstrated maximum binding
of 6% on the HTB82 cell pellet.
Imaging
[0688] Animals tolerated intravenous injection without apparent ill
effects. Tumor localization could be detected in animals imaged
with .sup.125I-8H9 as early as 4 hours after injection. At 24 h,
tumor localization was obvious along with some blood pool, liver
and spleen uptake. At 48 h, blood pooling had significantly
diminished and almost disappeared at 172 h. In contrast, mice
injected with the control IgG1 .sup.125I-2C9 demonstrated no
specific uptake in RMS xenografts (FIG. 28).
Blood Kinetics
[0689] Average blood clearance in groups of 5 mice with and without
RMS xenografts injected with .sup.125I-8H9 is depicted in FIG. 29.
Blood activity of .sup.125I-8H9 at 24 h was 14.3% and 17.3%
injected dose per gm (% ID/g) respectively and dropped off to 3.3%
and 5.3% ID/g, respectively at 172 h. 3 half-life of .sup.125I-8H9
was 70.9 h.
Biodistribution
[0690] Table 2 lists the biodistribution of 4.44MBq .sup.125I-8H9
in three groups of mice with RMS xenografts studied at 24,48 and
172 h, respectively. Blood-pooling effect was observed at 24 h,
which had diminished at 48 h and had almost completely subsided at
172 h after injection. There was no significant activity in normal
organs apart from blood at 172 h. Average tumor uptake was
11.5.+-.3.9, 15.1.+-.3.7, and 5.4.+-.1.2% injected dose per gm at
24, 48 and 172 h, respectively. Blood to tumor ratio was 1.24, 0.71
and 0.59 at 24, 48 and 172 h respectively. Mean tumor/tissue ratios
(FIG. 30) increased from 24 to 48 h and were optimal at 172 h (for
lung, 4, kidney 7, liver 8, spleen 11, femur 15, muscle 20, brain
47). In mice injected with 0.74MBq.sup.125I-8H9, there was a
further increase in tumor:tissue ratios particularly marked at 172
h post injection (for lung, 6, kidney 8, liver 12, spleen 14, femur
21, muscle 28, brain 56) (Table 3). Table 31 summarizes the
biodistribution of .sup.125I-8H9 compared to .sup.125I-2C9 at 120 h
post injection. Average tumor uptake was 7.3.+-.0.9% injected dose
per gram for .sup.125I-8H9 as compared to 2.5.+-.0.9% for
.sup.125I-2C9. Tumor to tissue ratios (FIG. 31) were <1 for
almost all tissues for .sup.125I-2C9, as compared to 2.6-56.0 for
.sup.125I-8H9.
Anti-Tumor Activity
[0691] Mice injected with 18.5MBq .sup.131I-8H9 showed a
significant suppression in tumor volume (FIG. 32). Average tumor
volume had diminished to <50% of initial volume 21 days after
injection. None of the tumors showed any evidence of regrowth. In
contrast, in the control group, mice injected with 18.5MBq of
.sup.131I-3F8, an anti-GD2 MoAb that does not react with HTB82,
there was progressive and rapid tumor growth.
Toxicity
[0692] No significant weight loss was noted in mice injected with
4.44MBq of .sup.131I-8H9, 15 and 30 days post injection (data not
shown). Complete blood count and liver function studies did not
reveal any abnormalities (Table 5). Complete necropsy evaluations
did not reveal any gross or histological lesions (data not shown).
In the groups of mice treated with .sup.131I labeled MoAbs, there
was no significant weight loss 21 days after the initial dose for
both the 3F8 and 8H9 groups (+11.7.+-.8.8% for the 3F8 group and
-2.+-.1.8% for the 8H9 group). The increase in weight in the
control group could be attributed to increasing tumor mass.
Discussion
[0693] Few tumor specific antigens that can be targeted by MoAbs
have been described for RMS. (Table 1) Myogenin, a myogenic
regulatory protein specific for rhabdomyoblasts is nuclear in
localization (16) and therefore not amenable for targeting by
MoAbs. Similarly, the MyoD family of oncofetal proteins is
expressed in nuclei (17). Conversely, the cell membrane-expressed
antigens, BW475 (18) and myosin (19), are also expressed on normal
neural and muscle tissue respectively. The fetal form of the
acetylcholine receptor, .alpha.2.beta..gamma..delta., a possible
target for antibody-based immunotherapy, although not present on
most normal muscles tissue, is expressed in extraocular muscles,
thymic myoid cells and in denervated skeletal muscle. (20.)
Blockade of the insulin-like growth factor I (IGFI) receptor, which
has been implicated in an autocrine pathway in the growth of RMS by
murine monoclonals has been demonstrated to inhibit the growth of
established RMS xenografts in nude mice (21). However, IGF
receptors are ubiquitously expressed in normal tissues.
[0694] MoAb 8H9 recognizes a unique cell membrane antigen which is
expressed on a wide range of pediatric and adult solid tumors (15).
Furthermore, this novel antigen has restricted expression on normal
tissues. In particular skeletal muscle and hematopoietic tissues
are negative. Indeed 8H9 has been utilized to purge Ewing's sarcoma
from blood and bone marrow (26). In RMS, the 8H9 antigen is
expressed on both alveolar and embryonal variants. 96% (29/30) RMS
studied expressed the 8H9 antigen. Expression in most cases was
strong and homogeneous. RMS cell lines including the HTB82 cell
line have been shown to express this antigen on cell membranes. It
therefore has the potential to be utilized as a tumor target in
RMS.
[0695] RMS is a chemosensitive and radiosensitive tumor, yet in
patients with metastatic disease, MRD often leads to relapse and
prevents cure. Immunotherapy using radiolabeled and unlabeled 8H9
may provide a valuable adjunct in the eradication of MRD. A similar
approach has led to successful cures being achieved in high-risk
neuroblastoma (6). In this study we evaluated the in vivo targeting
of RMS by radiolabeled 8H9. We have demonstrated that radiolabeled
8H9 can be effectively used in the radioimmunodetection and
radioimmunotherapy of RMS xenografts in mice. Our results showed
that .sup.125I or .sup.131I labeled 8H9 retained immunoreactivity
after radiolabeling. A relatively high specific activity of
>370MBq/mg of .sup.125I was obtained without loss of
immunoreactivity. Hence, 8H9 has the potential to be labeled with
relatively large doses of iodine radioisotopes for
radioimmunotherapy approaches.
[0696] Our imaging results show that 8H9 can specifically and
selectively bind to human RMS xenografted in nude mice. Uptake in
xenografts could be detected as early as 4 h after injection.
Excellent selectivity for tumor over normal tissue was
demonstrated. There was no focal uptake in any normal organs
including reticuloendothelial tissues. This is in keeping with the
specific distribution of the antigen recognized by 8H9 as
demonstrated by immunohistochemistry in human tissues and tumors
(15). Specificity of 8H9 binding was demonstrated by comparing the
binding of .sup.125I-8H9 to that of .sup.125I-2C9. 2C9, an IgG1
MoAb specific for cytokeratin8, an antigen not expressed by the RMS
cell line HTB82, was used as a negative control. As expected,
radiolabeled 2C9 remained in the bloodstream and did not show any
specific binding for RMS xenografts with tumor: tissue ratios of
0.1-1. In comparison, radiation dose to tumor relative to normal
tissues for .sup.125I-8H9 ranged from 2.6 to 25.3 fold. Specificity
of .sup.125I-8H9 was also demonstrated in vitro by studying the
binding of .sup.125I-8H9 to the 8H9 negative cell line HTB119 in
comparison to the 8H9 positive line HTB82. Maximum binding of
.sup.125I-8H9 was 83% in comparison to 9% for HTB 119 indicating
that .sup.125I-8H9 binding was antigen specific.
[0697] Biodistribution studies provided us with preclinical data in
consideration of a possible use for 8H9 in human trials. 3
half-life of a single dose of 4.4MBq of .sup.125I-8H9 was 70.9 h.
There was, in general, an excellent radiation dose differential
between RMS and normal tissues. Optimum tumor to non-tumor ratios
were reached at 172 h after intravenous 8H9 injection. Blood:tumor
ratios were relatively high at 24 h indicative of blood pooling.
Blood pooling diminished 48 h after injection and was further
greatly reduced by 172 h. Probable uptake by cells of the
reticuloendothelial system resulted in relatively high levels for
liver and spleen in the first 24 h. There was increased uptake in
the tumors at 48 h compared to 24 h suggesting further selective
targeting of 8H9 between 24 to 48 h. Persistence of .sup.125I-8H9
in the blood during the first 48 h of administration implies that
there is no appreciable neutralization of antibody by circulating
8H9 antigen. When lower doses of .sup.125I-8H9 for imaging (0.74MBq
compared to 4.44MBq), tumor: non-tumor ratios were improved,
consistent with reduced blood pooling (Table 4). The persistence of
binding of .sup.125I-8H9 to tumor implies that the 8H9 antigen is
not immunomodulated off the cell after antibody binding. Similar
findings were demonstrated in vitro, where the antigen-antibody
binding on cell surface as detected by immunofluorescence persisted
>60 h (15). This persistence should permit a steady delivery of
radiation to tumor cells by radiolabeled 8H9. At doses of
6.66MBq/m.sup.2, there were no clinical (body weights), chemical
(CBC and LFTs) or gross or histologic organ toxicities at
necropsies.
[0698] In an effort to develop systems to study antigen-antibody
reactions pending the definitive identification of the glycosylated
58 kDa protein antigen recognized by 8H9, we used
anti-8H9-idiotypic MoAbs to serve as surrogate antigens. These have
enabled us to study the binding of radiolabeled (radioimmunoassay)
and unlabeled (ELISA) 8H9 in vitro. Our data indicate that there
was good correlation between the binding of .sup.125I-8H9 to
anti-8H9 anti-idiotypes and to native antigen on cell pellets.
[0699] The observed radioimmunotherapeutic effect of .sup.131I-8H9
was remarkable, with >50% reduction in tumor volume of
well-established RMS xenografts being achieved with a dose of
18.5MBq of .sup.131I-8H9 without any adverse effects. The antigen
specific nature of this response was confirmed when RMS xenografts
treated with equivalent doses of nonspecific antibody demonstrated
unabated tumor growth. Radiolabeled 8H9 therefore, may have a
possible clinical role in the therapy of RMS.
[0700] Given the broad reactivity of MoAb 8H9 with human solid
tumors including sarcomas, neuroblastoma and brain tumors, these
studies provide the proof of principle for exploring antibody-based
targeting strategies directed at this antigen.
REFERENCES
[0701] Crist W, Gehan E A, Ragab A H, Dickman P S, Donaldson S S,
Fryer C, Hammond D, Hays D M, Herrmann J and Heyn R. The Third
Intergroup Rhabdomyosarcoma Study J Clin Oncol 13:610-30, 1995
[0702] Maurer H M, Gehan E A, Beltangady M, Crist W, Dickman P S,
Donaldson S S, Fryer C, Hammond D, Hays D M and Herrmann J. The
Intergroup Rhabdomyosarcoma Study-II. Cancer 71:1904-22, 1993
[0703] Okamura J, Sutow W W, and Moon T E. Prognosis in children
with metastatic rhabdomyosarcoma. Med Pediatr Oncol 3:243-51, 1977
[0704] Weigel B J, Breitfeld P P, Hawkins D, Crist W M, and Baker K
S. Role of high-dose chemotherapy with hematopoietic stem cell
rescue in the treatment of metastatic or recurrent
rhabdomyosarcoma. J Pediatr Hematol Oncol 23:272-276, 2001 [0705]
Ruymann F B and Grovas A C. Progress in the diagnosis and treatment
of rhabdomyosarcoma and related soft tissue sarcomas. Cancer Invest
18:223-241, 2000 [0706] Cheung N K, Kushner B H, Cheung I Y, Kramer
K, Canete A, Gerald W, Bonilla M A, Finn R, Yeh S J, and Larson S
M. Anti G.sub.D2 antibody treatment of minimal residual stage 4
neuroblastoma diagnosed at more than 1 year of age. J. Clin.
Oncol., 16: 3053-60, 1998 [0707] Cheung N K, Kushner B H, Yeh S DJ,
and Larson S M. 3F8 monoclonal antibody treatment of patients with
stage 4 neuroblastoma: a phase II study. Int. J. Oncol 12:
1299-306, 1998 [0708] Cheung N K, Neely J E, Landmeier B, Nelson D
and Miraldi F. Targeting of ganglioside GD2 monoclonal antibody to
neuroblastoma J Nuc Med 28:1577-83, 1987 [0709] Cheung N K,
Landmeier B, Neely J, Nelson A D, Abramowsky C, Ellery S, Adams R B
and Miraldi F. Complete tumor ablation with iodine 131-radiolabeled
disialoganglioside GD2-specific monoclonal antibody against human
neuroblastoma xenografted in nude mice. J Natl Cancer Inst.
77:739-745, 1986 [0710] Yeh S D, Larson S M, Burch L, Kushner B H,
LaQuaglia M, Finn R and Cheung N K. Radioimmunodetection of
neuroblastoma with iodine-131-3F8: correlation with biopsy,
iodine-131-metaiodobenzylguanidine and standard diagnostic
modalities. J. Nucl. Med. 32: 769-76, 1991 [0711] Kramer K, Cheung
N K, Humm J L, Dantis E, Finn R, Yeh S J, Antunes N L, Dunkel I J,
Souwedaine M and Larson S M. Targeted radioimmunotherapy for
leptomeningeal cancer using (131)I-3F8. Med Pediatr Oncol 35:716-8,
2000 [0712] Thomson B, Hawkins D, Felgenhauer J, and Radich J.
RT-PCR evaluation of peripheral blood, bone marrow and peripheral
blood stem cells in children and adolescents undergoing VACIME
chemotherapy for Ewing's sarcoma and alveolar rhabdomyosarcoma.
Bone Marrow Transplant 24:527-33, 1999 [0713] Athale U H, Shurtleff
S A, Jenkins J J, Poquette C A, Tan M, Downing J R and Pappo A S.
Use of Reverse Transcriptase Polymerase Chain Reaction for
Diagnosis and Staging of Alveolar Rhabdomyosarcoma, Ewing Sarcoma
Family of Tumors, and Desmoplastic Small Round Cell Tumor. Am J
Pediatr Hematol Oncol 23(2):99-104, 2001 [0714] Mackall C,
Berzofsky J and Helman L J. Targeting tumor specific translocations
in sarcomas in pediatric patients for immunotherapy. Clin Orthop.
373:25-31, 2000 [0715] Modak S, Kramer K, Gultekin S H, Guo H F and
Cheung N K. Monoclonal antibody 8H9 targets a novel cell surface
antigen expressed by a wide spectrum of human solid tumors. Cancer
Res. 61:4048-54, 2001. [0716] Kumar S, Perlaman, E, Harris C A,
Raffeld M and Tsokos M. Myogenin is a specific marker for
rhabdomyosarcoma: an immunohistochemical study in paraffin embedded
tissues. Mod Pathol 13: 988-93, 2000 [0717] Wang N. P., Marx J.,
McNutt M. A., Rutledge J. C., and Gown A. M., Expression of
myogenic regulatory proteins (myogenin and MyoD1) in small blue
round cell tumors of childhood. Am J Pathol 147: 1799-1810, 1995
[0718] Fujisawa T, Xu Z. J., Reynolds C. P Schultz G., Bosslet I.
V., and. Seeger R. C., A monoclonal antibody with selective
immunoreactivity for neuroblastoma and rhabdomyosarcoma. (abs)
Proc. AACR 30: 345, 1989 [0719] Gruchala A, Niezabitowski A,
Wasilewska A, Sikora K, Rys J, Szklarski W, Jaszcz A, Lackowska B
and Herman K. Rhabdomyosarcoma. Morphologic, immunohistochemical,
and DNA study. Gen Diagn Pathol 1142:175-84, 1997. [0720]
Gattenloehner S, Vincent A, Leuschner I, Tzartos S,
Muller-Hermelink H K, Kirchner T and Marx A. The fetal form of the
acetylcholine receptor distinguishes rhabdomyosarcomas from other
childhood tumors. Am J Pathol. 152:437-44, 1998 [0721] Kalebic T,
Tsokos M, Helman L J. In vivo treatment with antibody against IGF-1
receptor suppresses growth of human rhabdomyosarcoma and
down-regulates p34cdc2. Cancer Res 54:5531-4, 1994 [0722] Truong L
D, Rangdaeng S, Cagle P, Ro J Y, Hawkins H, Font R L. The
diagnostic utility of desmin. A study of 584 cases and review of
the literature Am J Clin Pathol 93:305-14, 1990 [0723] Qualman S J,
Coffin C M, Newton W A, Hojo H, Triche T J, Parham D M, and Crist W
M. Intergroup Rhabdomyosarcoma Study: update for pathologists
Pediatr Dev Pathol 1:550-61, 1998 [0724] Garin-Chesa P., Fellinger
E. J., Huvos A. G., Beresford H. R., Melamed M. R., Triche T. J.,
and Rettig W. J., Immunohistochemical analysis of neural cell
adhesion molecules. Differential expression in small round cell
tumors of childhood and adolescence. Am. J. Pathol. 139: 275-286,
1991 [0725] Strother D R, Parham D M and Houghton P J. Expression
of the 5.1 H11 antigen, a fetal muscle surface antigen, in normal
and neoplastic tissue. Arch Pathol Lab Med 114:593-596, 1990 [0726]
Merino M E, Navid F, Christensen B L, Toretsky J A, Helman L J,
Cheung N K and Mackall C L. Immunomagnetic purging of ewing's
sarcoma from blood and bone marrow: quantitation by real-time
polymerase chain reaction. J Clin Oncol 19:3649-3659, 2001
Sequence CWU 1
1
401731DNAMurina suilla 1caggtcaaac tgcagcagtc tggggctgaa ctggtaaagc
ctggggcttc agtgaaattg 60tcctgcaagg cttctggcta caccttcaca aactatgata
taaactgggt gaggcagagg 120cctgaacagg gacttgagtg gattggatgg
atttttcctg gagatggtag tactcaatac 180aatgagaagt tcaagggcaa
ggccacactg actacagaca catcctccag cacagcctac 240atgcagctca
gcaggctgac atctgaggac tctgctgtct atttctgtgc aagacagact
300acggctacct ggtttgctta ctggggccaa gggaccacgg tcaccgtctc
ctcagatgga 360ggcggttcag gcggaggtgg ctctggcggt ggcggatcgg
acatcgagct cactcagtct 420ccaaccaccc tgtctgtgac tccaggagat
agagtctctc tttcctgcag ggccagccag 480agtattagcg actacttaca
ctggtaccaa caaaaatcac atgagtctcc aaggcttctc 540atcaaatatg
cttcccaatc catctctggg atcccctcca ggttcagtgg cagtggatca
600gggtcagatt tcactctcag tatcaacagt gtggaacctg aagatgttgg
agtgtattac 660tgtcaaaatg gtcacagctt tccgctcacg ttcggtgctg
ggaccaagct ggagctgaaa 720caggcggccg c 7312243PRTMurina suilla 2Gln
Val Lys Leu Gln Gln Ser Gly Ala Glu Leu Val Lys Pro Gly Ala 1 5 10
15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30 Asp Ile Asn Trp Val Arg Gln Arg Pro Glu Gln Gly Leu Glu
Trp Ile 35 40 45 Gly Trp Ile Phe Pro Gly Asp Gly Ser Thr Gln Tyr
Asn Glu Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Thr Asp Thr
Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Gln Leu Ser Arg Leu Thr Ser
Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 Ala Arg Gln Thr Thr Ala
Thr Trp Phe Ala Tyr Trp Gly Gln Gly Thr 100 105 110 Thr Val Thr Val
Ser Ser Asp Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Gly Gly
Gly Gly Ser Asp Ile Glu Leu Thr Gln Ser Pro Thr Thr Leu 130 135 140
Ser Val Thr Pro Gly Asp Arg Val Ser Leu Ser Cys Arg Ala Ser Gln 145
150 155 160 Ser Ile Ser Asp Tyr Leu His Trp Tyr Gln Gln Lys Ser His
Glu Ser 165 170 175 Pro Arg Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile
Ser Gly Ile Pro 180 185 190 Ser Arg Phe Ser Gly Ser Gly Ser Gly Ser
Asp Phe Thr Leu Ser Ile 195 200 205 Asn Ser Val Glu Pro Glu Asp Val
Gly Val Tyr Tyr Cys Gln Asn Gly 210 215 220 His Ser Phe Pro Leu Thr
Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 225 230 235 240 Gln Ala Ala
3243PRTArtificial SequenceMutated 8H9 scFv with decreased normal
tissue adherenceMUTAGEN(1)..(243) 3Gln Val Lys Leu Gln Gln Ser Gly
Ala Glu Leu Val Glu Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys
Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr 20 25 30 Asp Ile Asn Trp
Val Arg Gln Arg Pro Glu Gln Gly Leu Glu Trp Ile 35 40 45 Gly Trp
Ile Phe Pro Gly Asp Gly Ser Thr Gln Tyr Asn Glu Lys Phe 50 55 60
Lys Gly Lys Ala Thr Leu Thr Thr Asp Thr Ser Ser Ser Thr Ala Tyr 65
70 75 80 Met Gln Leu Ser Arg Leu Thr Ser Glu Asp Ser Ala Val Tyr
Phe Cys 85 90 95 Ala Arg Gln Thr Thr Ala Thr Trp Phe Ala Tyr Trp
Gly Gln Gly Thr 100 105 110 Thr Val Thr Val Ser Ser Asp Gly Gly Gly
Ser Gly Gly Gly Gly Ser 115 120 125 Gly Gly Gly Gly Ser Asp Ile Glu
Leu Thr Gln Ser Pro Thr Thr Leu 130 135 140 Ser Val Thr Pro Gly Asp
Gln Val Ser Leu Ser Cys Arg Ala Ser Gln 145 150 155 160 Ser Ile Ser
Asp Tyr Leu His Trp Tyr Gln Gln Lys Ser His Glu Ser 165 170 175 Pro
Gln Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro 180 185
190 Ser Arg Phe Ser Gly Ser Gly Ser Gly Ser Asp Phe Thr Leu Ser Ile
195 200 205 Asn Ser Val Glu Pro Glu Asp Val Gly Val Tyr Tyr Cys Gln
Asn Gly 210 215 220 His Ser Phe Pro Leu Thr Phe Gly Ala Gly Thr Glu
Leu Glu Leu Glu 225 230 235 240 Gln Ala Ala 422DNAArtificial
Sequence[32P]r Probe 4tactctcagc agaacaccta tg 22521DNAArtificial
SequencePrimer ESBP1primer_bind(1)..(21) 5cgactagtta tgatcagagc a
21623DNAArtificial SequencePrimer ESBP2primer_bind(1)..(23)
6ccgttgctct gtattcttac tga 23718DNAArtificial SequencePrimer EWS
696primer_bind(1)..(18) 7agcagctatg gacagcag 18820DNAArtificial
SequencePrimer FLI 1 1041primer_bind(1)..(20) 8ttgaggccag
aattcatgtt 20925DNAArtificial SequencePrimer
G6PD1primer_bind(1)..(25) 9ccggatcgac cactacctgg gcaag
251026DNAArtificial SequencePrimer G6PD2primer_bind(1)..(26)
10gttccccacg tactggccca ggacca 261124DNAArtificial
SequenceLightcycler Hybridization Probe EWSHP1misc_feature(1)..(24)
11tatagccaac agagcagcag ctac 241218DNAArtificial
SequenceLightcycler Hybridization Probe EWSHP2misc_feature(1)..(18)
12ggcagcagaa cccttctt 181328DNAArtificial SequenceLightcycler
Hybridization Probe G6PDHP1misc_feature(1)..(28) 13gttccagatg
gggccgaaga tcctgttg 281428DNAArtificial SequenceLightcycler
Hybridization Probe G6PDHP2misc_feature(1)..(28) 14caaatctcag
caccatgagg ttctgcac 281532DNAArtificial
SequenceSyntheticUnsure(1)..(32) 15ttattacgag ttacatggcc ttaccagtga
cc 321632DNAArtificial SequenceSyntheticUnsure(1)..(32)
16ttattacgag taacatggcc ttaccagtga cc 321731DNAArtificial
SequenceSyntheticUnsure(1)..(31) 17cttggtccga gtgtcaggag cgataggctg
c 311831DNAArtificial SequenceSyntheticUnsure(1)..(31) 18cttggttcga
gtgtcaggag cgataggctg c 311930DNAArtificial
SequenceSyntheticUnsure(1)..(30) 19ttattacgaa tgattgccca ggtcaaactg
302030DNAArtificial SequenceSyntheticUnsure(1)..(30) 20ttattacgaa
cgattgccca ggtcaaactg 302128DNAArtificial
SequenceSyntheticUnsure(1)..(28) 21cttggtgggc cgcctgtttc agctccag
282228DNAArtificial SequenceSyntheticUnsure(1)..(28) 22cttggtcggc
cgcctgtttc agctccag 282346DNAArtificial
SequenceSyntheticUnsure(1)..(46) 23cggacttagc agcctatcgc tcctggcacc
gagaagagtg aagttc 462446DNAArtificial
SequenceSyntheticUnsure(1)..(46) 24cggacttagc agcctatcgc tcctggcatc
gagaagagtg aagttc 462546DNAArtificial
SequenceSyntheticUnsure(1)..(46) 25ccgacttagc agcctatcgc tcctggcacc
gagaagagtg aagttc 462646DNAArtificial
SequenceSyntheticUnsure(1)..(46) 26ccgacttagc agcctatcgc tcctggcatc
gagaagagtg aagttc 462729DNAArtificial
SequenceSyntheticUnsure(1)..(29) 27cttggtaatc ttcagcgagg gggcagggc
292829DNAArtificial SequenceSyntheticUnsure(1)..(29) 28cttggtgatc
ttcagcgagg gggcagggc 29295PRTunknownmouse sequence 29Asn Tyr Asp
Ile Asn 1 5 3011PRTunknownmouse sequence 30Trp Ile Phe Pro Gly Asp
Gly Ser Thr Gln Tyr 1 5 10 319PRTunknownmouse sequence 31Gln Thr
Thr Ala Thr Trp Phe Ala Tyr 1 5 3211PRTunknownmouse sequence 32Arg
Ala Ser Gln Ser Ile Ser Asp Tyr Leu His 1 5 10 337PRTunknownmouse
sequence 33Tyr Ala Ser Gln Ser Ile Ser 1 5 349PRTunknownmouse
sequence 34Gln Asn Gly His Ser Phe Pro Leu Thr 1 5
35243PRTunknownmouse sequence 35Gln Val Lys Leu Gln Gln Ser Gly Ala
Glu Leu Val Lys Pro Gly 5 10 15Ala Ser Val Lys Leu Ser Cys Lys Ala
Ser Gly Tyr Thr Phe Thr 20 25 30Asn Tyr Asp Ile Asn Trp Val Arg Gln
Arg Pro Glu Gln Gly Leu 35 40 45Glu Trp Ile Gly Trp Ile Phe Pro Gly
Asp Gly Ser Thr Gln Tyr 50 55 60Asn Glu Lys Phe Lys Gly Lys Ala Thr
Leu Thr Thr Asp Thr Ser 65 70 75Ser Ser Thr Ala Tyr Met Gln Leu Ser
Arg Leu Thr Ser Glu Asp 80 85 90Ser Ala Val Tyr Phe Cys Ala Arg Gln
Thr Thr Ala Thr Trp Phe 95 100 105Ala Tyr Trp Gly Gln Gly Thr Thr
Val Thr Val Ser Ser Gly Gly 110 115 120Gly Gly Ser Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Asp Ile 125 130 135Glu Leu Thr Gln Ser Pro
Thr Thr Leu Ser Val Thr Pro Gly Asp 140 145 150Arg Val Ser Leu Ser
Cys Arg Ala Ser Gln Ser Ile Ser Asp Tyr 155 160 165Leu His Trp Tyr
Gln Gln Lys Ser His Glu Ser Pro Arg Leu Leu 170 175 180Ile Lys Tyr
Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe 185 190 195Ser Gly
Ser Gly Ser Gly Ser Asp Phe Thr Leu Ser Ile Asn Ser 200 205 210Val
Glu Pro Glu Asp Val Gly Val Tyr Tyr Cys Gln Asn Gly His 215 220
225Ser Phe Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 230
235 240Gln Ala Ala 36731DNAMurina suilla 36caggtcaaac tgcagcagtc
tggggctgaa ctggtaaagc ctggggcttc agtgaaattg 60tcctgcaagg cttctggcta
caccttcaca aactatgata taaactgggt gaggcagagg 120cctgaacagg
gacttgagtg gattggatgg atttttcctg gagatggtag tactcaatac
180aatgagaagt tcaagggcaa ggccacactg actacagaca catcctccag
cacagcctac 240atgcagctca gcaggctgac atctgaggac tctgctgtct
atttctgtgc aagacagact 300acggctacct ggtttgctta ctggggccaa
gggaccacgg tcaccgtctc ctcaggtgga 360ggcggttcag gcggaggtgg
ctctggcggt ggcggatcgg acatcgagct cactcagtct 420ccaaccaccc
tgtctgtgac tccaggagat agagtctctc tttcctgcag ggccagccag
480agtattagcg actacttaca ctggtaccaa caaaaatcac atgagtctcc
aaggcttctc 540atcaaatatg cttcccaatc catctctggg atcccctcca
ggttcagtgg cagtggatca 600gggtcagatt tcactctcag tatcaacagt
gtggaacctg aagatgttgg agtgtattac 660tgtcaaaatg gtcacagctt
tccgctcacg ttcggtgctg ggaccaagct ggagctgaaa 720caggcggccg c
73137731DNAMurina suilla 37gtccagtttg acgtcgtcag accccgactt
gaccatttcg gaccccgaag tcactttaac 60aggacgttcc gaagaccgat gtggaagtgt
ttgatactat atttgaccca ctccgtctcc 120ggacttgtcc ctgaactcac
ctaacctacc taaaaaggac ctctaccatc atgagttatg 180ttactcttca
agttcccgtt ccggtgtgac tgatgtctgt gtaggaggtc gtgtcggatg
240tacgtcgagt cgtccgactg tagactcctg agacgacaga taaagacacg
ttctgtctga 300tgccgatgga ccaaacgaat gaccccggtt ccctggtgcc
agtggcagag gagtccacct 360ccgccaagtc cgcctccacc gagaccgcca
ccgcctagcc tgtagctcga gtgagtcaga 420ggttggtggg acagacactg
aggtcctcta tctcagagag aaaggacgtc ccggtcggtc 480tcataatcgc
tgatgaatgt gaccatggtt gtttttagtg tactcagagg ttccgaagag
540tagtttatac gaagggttag gtagagaccc taggggaggt ccaagtcacc
gtcacctagt 600cccagtctaa agtgagagtc atagttgtca caccttggac
ttctacaacc tcacataatg 660acagttttac cagtgtcgaa aggcgagtgc
aagccacgac cctggttcga cctcgacttt 720gtccgccggc g 73138731DNAMurina
suilla 38caggtcaaac tgcagcagtc tggggctgaa ctggtaaagc ctggggcttc
agtgaaattg 60tcctgcaagg cttctggcta caccttcaca aactatgata taaactgggt
gaggcagagg 120cctgaacagg gacttgagtg gattggatgg atttttcctg
gagatggtag tactcaatac 180aatgagaagt tcaagggcaa ggccacactg
actacagaca catcctccag cacagcctac 240atgcagctca gcaggctgac
atctgaggac tctgctgtct atttctgtgc aagacagact 300acggctacct
ggtttgctta ctggggccaa gggaccacgg tcaccgtctc ctcagatgga
360ggcggttcag gcggaggtgg ctctggcggt ggcggatcgg acatcgagct
cactcagtct 420ccaaccaccc tgtctgtgac tccaggagat agagtctctc
tttcctgcag ggccagccag 480agtattagcg actacttaca ctggtaccaa
caaaaatcac atgagtctcc aaggcttctc 540atcaaatatg cttcccaatc
catctctggg atcccctcca ggttcagtgg cagtggatca 600gggtcagatt
tcactctcag tatcaacagt gtggaacctg aagatgttgg agtgtattac
660tgtcaaaatg gtcacagctt tccgctcacg ttcggtgctg ggaccaagct
ggagctgaaa 720caggcggccg c 73139243PRTMurina suilla 39Gln Val Lys
Leu Gln Gln Ser Gly Ala Glu Leu Val Lys Pro Gly 5 10 15Ala Ser Val
Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr 20 25 30Asn Tyr Asp
Ile Asn Trp Val Arg Gln Arg Pro Glu Gln Gly Leu 35 40 45Glu Trp Ile
Gly Trp Ile Phe Pro Gly Asp Gly Ser Thr Gln Tyr 50 55 60Asn Glu Lys
Phe Lys Gly Lys Ala Thr Leu Thr Thr Asp Thr Ser 65 70 75Ser Ser Thr
Ala Tyr Met Gln Leu Ser Arg Leu Thr Ser Glu Asp 80 85 90Ser Ala Val
Tyr Phe Cys Ala Arg Gln Thr Thr Ala Thr Trp Phe 95 100 105Ala Tyr
Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Asp Gly 110 115 120Gly
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile 125 130
135Glu Leu Thr Gln Ser Pro Thr Thr Leu Ser Val Thr Pro Gly Asp 140
145 150Arg Val Ser Leu Ser Cys Arg Ala Ser Gln Ser Ile Ser Asp Tyr
155 160 165Leu His Trp Tyr Gln Gln Lys Ser His Glu Ser Pro Arg Leu
Leu 170 175 180Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser
Arg Phe 185 190 195Ser Gly Ser Gly Ser Gly Ser Asp Phe Thr Leu Ser
Ile Asn Ser 200 205 210Val Glu Pro Glu Asp Val Gly Val Tyr Tyr Cys
Gln Asn Gly His 215 220 225Ser Phe Pro Leu Thr Phe Gly Ala Gly Thr
Lys Leu Glu Leu Lys 230 235 240Gln Ala Ala 40243PRTArtificial
SequenceMutated 8H9 scFv with decreased normal tissue
adherenceMUTAGEN(1)..(243) 40Gln Val Lys Leu Gln Gln Ser Gly Ala
Glu Leu Val Glu Pro Gly 5 10 15Ala Ser Val Lys Leu Ser Cys Lys Ala
Ser Gly Tyr Thr Phe Thr 20 25 30Asn Tyr Asp Ile Asn Trp Val Arg Gln
Arg Pro Glu Gln Gly Leu 35 40 45Glu Trp Ile Gly Trp Ile Phe Pro Gly
Asp Gly Ser Thr Gln Tyr 50 55 60Asn Glu Lys Phe Lys Gly Lys Ala Thr
Leu Thr Thr Asp Thr Ser 65 70 75Ser Ser Thr Ala Tyr Met Gln Leu Ser
Arg Leu Thr Ser Glu Asp 80 85 90Ser Ala Val Tyr Phe Cys Ala Arg Gln
Thr Thr Ala Thr Trp Phe 95 100 105Ala Tyr Trp Gly Gln Gly Thr Thr
Val Thr Val Ser Ser Asp Gly 110 115 120Gly Gly Ser Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Asp Ile 125 130 135Glu Leu Thr Gln Ser Pro
Thr Thr Leu Ser Val Thr Pro Gly Asp 140 145 150Gln Val Ser Leu Ser
Cys Arg Ala Ser Gln Ser Ile Ser Asp Tyr 155 160 165Leu His Trp Tyr
Gln Gln Lys Ser His Glu Ser Pro Gln Leu Leu 170 175 180Ile Lys Tyr
Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe 185 190 195Ser Gly
Ser Gly Ser Gly Ser Asp Phe Thr Leu Ser Ile Asn Ser 200 205 210Val
Glu Pro Glu Asp Val Gly Val Tyr Tyr Cys Gln Asn Gly His 215 220
225Ser Phe Pro Leu Thr Phe Gly Ala Gly Thr Glu Leu Glu Leu Glu 230
235 240Gln Ala Ala
* * * * *