U.S. patent application number 15/745092 was filed with the patent office on 2018-07-26 for polymer sheets for sequencing applications.
The applicant listed for this patent is Illumina, Inc.. Invention is credited to Steven M. Barnard, Kenny Chen, Bala Murali Venkatesan.
Application Number | 20180207920 15/745092 |
Document ID | / |
Family ID | 56550380 |
Filed Date | 2018-07-26 |
United States Patent
Application |
20180207920 |
Kind Code |
A1 |
Venkatesan; Bala Murali ; et
al. |
July 26, 2018 |
POLYMER SHEETS FOR SEQUENCING APPLICATIONS
Abstract
Embodiments of the present application relate to patterned
polymer sheets and processes to prepare the same for sequencing
applications. In particular, flexible micro- and nano-patterned
polymer sheets are prepared and used as a template surface in
sequencing reaction and new polish-free methods of forming isolated
hydrogel plugs in nanowells are described.
Inventors: |
Venkatesan; Bala Murali;
(San Diego, CA) ; Chen; Kenny; (San Diego, CA)
; Barnard; Steven M.; (San Diego, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Illumina, Inc. |
San Diego |
CA |
US |
|
|
Family ID: |
56550380 |
Appl. No.: |
15/745092 |
Filed: |
July 13, 2016 |
PCT Filed: |
July 13, 2016 |
PCT NO: |
PCT/US2016/042041 |
371 Date: |
January 15, 2018 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62194061 |
Jul 17, 2015 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
B01J 2219/00641
20130101; B01L 2300/0896 20130101; B01L 2300/0829 20130101; B01L
2200/0668 20130101; C08L 2203/02 20130101; B01L 2200/12 20130101;
B01L 2300/069 20130101; B01J 2219/00637 20130101; B01J 2219/00621
20130101; B01L 3/505 20130101; C12Q 1/6874 20130101; C12Q 1/6876
20130101; B32B 27/308 20130101; C12Q 1/6837 20130101; B01J
2219/00722 20130101; B01J 2219/00317 20130101; B01L 2300/0822
20130101; B01J 19/0046 20130101; B01J 2219/00644 20130101; C08L
33/26 20130101; B01L 2300/0893 20130101; C12Q 1/6874 20130101; C12Q
2523/101 20130101; C12Q 2527/137 20130101; C12Q 2565/607
20130101 |
International
Class: |
B32B 27/30 20060101
B32B027/30; C08L 33/26 20060101 C08L033/26; B01J 19/00 20060101
B01J019/00; B01L 3/00 20060101 B01L003/00; C12Q 1/6837 20060101
C12Q001/6837; C12Q 1/6876 20060101 C12Q001/6876 |
Claims
1. A process for preparing a polymer sheet for sequencing
applications, comprising: providing a substrate with a surface;
depositing a layer of a polymer composition onto the surface of the
substrate, wherein the polymer composition comprises functional
groups for grafting oligonucleotides; forming the polymer
composition into a polymer sheet on the surface; and removing said
polymer sheet from the surface of the substrate.
2. The process of claim 1, wherein the polymer composition
comprises a hydrogel.
3. The process of claim 1 or 2, wherein the polymer composition
comprises poly(N-(5-azidoacetamidylpentyl)
acrylamide-co-acrylamide) (PAZAM).
4. The process of any one of claims 1 to 3, wherein the forming of
the polymer sheet comprises dehydrating the polymer
composition.
5. The process of claim 4, wherein the dehydrating is performed at
an elevated temperature.
6. The process of claim 5, wherein the dehydrating occurs at about
60.degree. C.
7. The process of any one of claims 1 to 6, wherein the surface of
the substrate comprises micro-scale or nano-scale patterns.
8. The process of claim 7, wherein the micro-scale or nano-scale
patterns comprise channels, trenches, posts, wells, or combinations
thereof.
9. The process of claim 7 or 8, wherein an imprint of the
micro-scale or nano-scale patterns of the patterned surface is
transferred to the polymer sheet to form a patterned polymer
sheet.
10. A process for preparing a substrate surface for sequencing
applications, comprising: providing a polymer sheet comprising a
first plurality of functional groups; contacting said polymer sheet
with a surface of a substrate, wherein said surface comprises a
second plurality of functional groups; covalently bonding the first
plurality of functional groups of the polymer sheet to the second
plurality of functional groups of the surface.
11. The process of claim 10, further comprising grafting
oligonucleotides on the substrate surface by reacting
functionalized oligonucleotides with the first plurality of
functional groups of the polymer sheet.
12. The process of claim 10 or 11, wherein the polymer sheet is a
patterned polymer sheet comprising a plurality of micro-scale or
nano-scale patterned channels, trenches, posts, wells, or
combinations thereof.
13. The process of any one of claims 10 to 12, wherein the polymer
sheet comprises a plurality of nano-scale patterned posts or
wells.
14. The process of any one of claims 10 to 13, wherein the polymer
sheet comprises a dehydrated hydrogel.
15. The process of claims 14, wherein the polymer sheet is
rehydrated prior to grafting oligonucleotides.
16. The process of any one of claims 10 to 15, wherein the first
plurality of functional groups are selected from C.sub.8-14
cycloalkenes, 8 to 14 membered heterocycloalkenes, C.sub.8-14
cycloalkynes, 8 to 14 membered heterocycloalkynes, alkynyl, vinyl,
halo, azido, amino, amido, epoxy, glycidyl, carboxyl, hydrazonyl,
hydrazinyl, hydroxy, tetrazolyl, tetrazinyl, nitrile oxide,
nitrene, nitrone, oxo-amino, or thiol, or optionally substituted
variants and combinations thereof.
17. The process of claim 16, wherein the first plurality of
functional groups are selected from azido, alkynyl, amino,
carboxyl, epoxy, glycidyl, halo, or tetrazinyl, or optionally
substituted variants and combinations thereof.
18. The process of claim 17, wherein the first plurality of
functional groups comprise azido.
19. The process of any one of claims 10 to 18, wherein the polymer
sheet comprises poly(N-(5-azidoacetamidylpentyl)
acrylamide-co-acrylamide) (PAZAM).
20. The process of any one of claims 10 to 16, wherein the second
plurality of functional groups are selected from vinyl, acryloyl,
alkenyl, alkynyl, C.sub.8-14 cycloalkenes, 8 to 14 membered
heterocycloalkenes, C.sub.8-14 cycloalkynes, 8 to 14 membered
heterocycloalkynes, nitrene, aldehyde, hydrazinyl, glycidyl ether,
epoxy, amino, carbene, isocyanate or maleimide, or optionally
substituted variants and combinations thereof.
21. The process of claim 20, wherein the second plurality of
functional groups are selected from alkynyl, acryloyl, C.sub.8-14
cycloalkenes, alkynyl, glycidyl ether, epoxy, or optionally
substituted variants and combinations thereof.
22. The process of claim 21, wherein the second plurality of
functional groups comprises optionally substituted norbornene.
23. A process for preparing a patterned substrate surface for
sequencing applications, comprising: providing a substrate with a
patterned surface, wherein said surface comprises a plurality of
micro-scale or nano-scale patterned wells; depositing a polymer
composition onto the patterned surface to form a first polymer
layer, wherein the polymer composition fills the micro-scale or
nano-scale patterned wells; and separating the first polymer layer,
wherein the polymer composition is isolated in the micro-scale or
nano-scale patterned wells of the patterned surface.
24. The process of claim 23, further comprising dehydrating the
first polymer layer prior to the separating of the first polymer
layer.
25. The process of claim 23 or 24, wherein the polymer composition
comprises a hydrogel.
26. The process of any one of claims 23 to 25, wherein the polymer
composition comprises a first plurality of functional groups
selected from selected from vinyl, acryloyl, alkenyl, alkynyl,
C.sub.8-14 cycloalkenes, 8 to 14 membered heterocycloalkenes,
C.sub.8-14 cycloalkynes, 8 to 14 membered heterocycloalkynes,
nitrene, aldehyde, hydrazinyl, glycidyl ether, epoxy, amino,
carbene, isocyanate or maleimide, or optionally substituted
variants and combinations thereof.
27. The process of claim 26, wherein the first plurality of
functional groups are selected from azido, alkynyl, amino,
carboxyl, epoxy, glycidyl, halo, or tetrazinyl, or optionally
substituted variants and combinations thereof.
28. The process of claim 27, wherein the first plurality of
functional groups comprise azido.
29. The process of any one of claims 23 to 28, wherein the polymer
composition comprises poly(N-(5-azidoacetamidylpentyl)
acrylamide-co-acrylamide) (PAZAM).
30. The process of any one of claim 23 to 29, further comprising
laminating a second polymer layer directly on top of the patterned
surface after separating the first polymer layer.
31. The process of claim 30, wherein the second polymer layer
comprises a second plurality of functional groups selected from
vinyl, acryloyl, alkenyl, alkynyl, C.sub.8-14 cycloalkenes, 8 to 14
membered heterocycloalkenes, C.sub.8-14 cycloalkynes, 8 to 14
membered heterocycloalkynes, nitrene, aldehyde, hydrazinyl,
glycidyl ether, epoxy, amino, carbene, isocyanate or maleimide, or
optionally substituted variants and combinations thereof.
32. The process of claim 31, wherein the second plurality of
functional groups are selected from alkynyl, acryloyl, C.sub.8-14
cycloalkenes, alkynyl, glycidyl ether, epoxy, or optionally
substituted variants and combinations thereof.
33. The process of claim 32, wherein the second plurality of
functional groups comprises optionally substituted norbornene.
34. The process of any one of claims 30 to 33, further comprising
covalently bonding the first plurality of functional groups of the
polymer composition to the second plurality of functional groups of
the second polymer layer.
35. The process of claim 24, wherein the polymer composition is
rehydrated before reacting with the second plurality of functional
groups.
36. The process of claim 34 or 35, further comprising separating
the second polymer layer from the patterned surface, wherein the
polymer composition is removed from the micro-scale or nano-scale
patterned wells of the patterned surface to form patterned polymer
posts on the second polymer layer.
37. The process of claim 36, wherein the polymer composition is
dehydrated before separating the second polymer layer from the
patterned surface.
38. The process of any one of claims 30 to 37, wherein the second
polymer layer is stretchable.
39. The process of claim 38, wherein the second polymer layer
comprises polydimethylsiloxane (PDMS), poly(methyl methacrylate)
(PMMA), polyurethanes, polyethers, polycarbonates, polyvinyls,
polyimides, or combinations and copolymers thereof.
40. The process of claim 37, further comprising grafting
oligonucleotides on the micro-scale or nano-scale patterned polymer
posts of the second polymer layer.
41. An automated roll-to-roll process for sequencing applications,
comprising: spooling a roll of patterned polymer sheet prepared by
the process of claim 38; preparing the patterned polymer sheet for
sequencing by treating the polymer sheet with sequencing reagents;
sequencing a sample on the treated patterned polymer sheet; and
respooling the patterned polymer sheet after the completion of one
sequencing cycle.
42. The automated roll-to-roll process of claim 41, further
comprising stretching the polymer sheet during imaging in the
sequencing cycle.
43. The automated roll-to-roll process of claim 41, wherein the
patterned stretchable polymer sheet comprises polydimethylsiloxane
(PDMS), poly(methyl methacrylate) (PMMA), polyurethanes,
polyethers, polycarbonates, polyvinyls, polyimides, or combinations
and copolymers thereof.
44. A polymer sheet for sequencing applications prepared by any of
the process of claims 1 to 9.
45. A substrate surface for sequencing applications prepared by any
of the process of claims 10 to 40.
46. An automated process for sequencing applications, comprising:
providing a belt comprising the patterned polymer sheet prepared by
the process of claim 38; preparing the patterned polymer sheet for
sequencing by treating the polymer sheet with sequencing reagents
from a fluid delivery device; and sequencing a sample on the
treated patterned polymer sheet, wherein the belt passes the fluid
delivery device for each cycle of the sequencing application.
Description
FIELD
[0001] In general, the present application relates to the fields of
polymer sheets and processes to prepare the same for polynucleotide
sequencing applications.
BACKGROUND
[0002] Polymer coated substrates are used for the preparation
and/or analysis of biological molecules. Molecular analyses, such
as certain nucleic acid sequencing methods, rely on the attachment
of nucleic acid strands to a polymer-coated surface of a substrate.
The sequences of the attached nucleic acid strands can then be
determined by a number of different methods that are well known in
the art.
[0003] Flow cells are used in certain sequencing-by-synthesis
processes. Typically, these flow cells include an active surface
within an inert interstitial region. The surface of the flow cell
is normally fabricated using the following steps: (1) wells are
initially etched into a uniform substrate; (2) the wells and the
interstitial regions are functionalized with a silane and a polymer
or hydrogel; (3) excess polymer or hydrogel covering the
interstitial regions is removed via a polishing process; (4) the
polymer or hydrogel in the wells is then grafted with single
stranded primer DNA to provide a flow cell surface for the
downstream sequencing application. In this case, some of the
polymer or hydrogel is wasted in the polishing step of the
fabrication workflow.
SUMMARY
[0004] Some embodiments described herein are related to processes
of preparing a polymer sheet for nucleic acid sequencing
applications, comprising providing a substrate with a surface;
depositing a layer of a polymer composition onto the surface of the
substrate, wherein the polymer composition includes functional
groups for grafting oligonucleotides; forming the polymer
composition into a polymer sheet on the surface; and removing the
excess polymer sheet material from the surface of the substrate. In
some embodiments, the forming of the polymer sheet comprises
dehydrating the polymer composition.
[0005] Some embodiments described herein are related to polymer
sheets for nucleic acid sequencing applications prepared by the
processes described herein.
[0006] Some embodiments described herein are related to a process
of preparing a substrate surface for nucleic acid sequencing
applications, comprising providing a polymer sheet having a first
plurality of functional groups; contacting the polymer sheet with a
surface of a substrate, wherein the surface includes a second
plurality of functional groups; covalently bonding the first
plurality of functional groups of the polymer sheet to the second
plurality of functional groups of the surface. In some embodiments,
the polymer sheet is patterned. In some such embodiments, the
polymer sheet includes a plurality of micro-scale or nano-scale
patterned channels, trenches, posts, wells, or combinations
thereof.
[0007] Some embodiments described herein are related to a process
of preparing a patterned substrate surface for nucleic acid
sequencing applications, comprising: providing a substrate with a
patterned surface, wherein the surface includes a plurality of
micro-scale or nano-scale patterned wells; depositing a polymer
composition onto the patterned surface to form a first polymer
layer, wherein the polymer composition fills the micro-scale or
nano-scale patterned wells; and separating the first polymer layer,
wherein the polymer composition is isolated in the micro-scale or
nano-scale patterned wells of the patterned surface. In some
embodiments, the process further includes dehydrating the first
polymer layer prior to the separating of the first polymer layer.
In some embodiments, the processes further includes laminating a
second polymer layer directly on top of the patterned surface after
separating the first polymer layer. In some such embodiments, the
processes further includes separating the second polymer layer from
the patterned surface, wherein the polymer composition is removed
from the micro-scale or nano-scale patterned wells of the patterned
surface to form a plurality of patterned polymer posts on the
second polymer layer. In some embodiments, the second polymer layer
is stretchable.
[0008] Some embodiments described herein are related to a substrate
surface for nucleic acid sequencing applications prepared by the
processes described herein.
[0009] Some further embodiments described herein are related to an
automated roll-to-roll process for nucleic acid sequencing
applications, comprising: spooling a roll of a patterned polymer
sheet prepared by the process described herein; preparing the
patterned polymer sheet for sequencing by treating the polymer
sheet with sequencing reagents; sequencing a sample on the treated
patterned polymer sheet; and respooling the patterned stretchable
polymer sheet after the completion of one sequencing cycle. In some
embodiments, the patterned polymer sheet is stretchable.
[0010] Some additional embodiments described herein are related to
an automated process for nucleic acid sequencing applications,
comprising: providing a belt comprising the patterned polymer sheet
prepared by the process described herein; preparing the patterned
polymer sheet for sequencing by treating the polymer sheet with
sequencing reagents from a fluid delivery device; and sequencing a
sample on the treated patterned polymer sheet, wherein the belt
passes the fluid delivery device for each cycle of the sequencing
application.
[0011] Although the present disclosure exemplifies methods and
compositions in the context of nucleic acid sequencing
applications, it will be understood that other uses and
applications are possible. Exemplary applications include, but are
not limited to, non-sequencing based nucleic acid assays, such as
hybridization or binding assays; protein assays, such as binding or
kinetic assays; cell assays; assays for other biological
components; assays for non-biological components (whether
biologically active or biologically inert); or the like.
Accordingly, any of a variety of analytes useful in these assays or
other assays known in the art can be attached to a polymer sheet
and/or a surface as exemplified herein for analytes used in nucleic
acid sequencing applications. As a further application, the methods
of compositions set forth herein can be used for the synthesis of
various analytes, including but not limited to, nucleic acids,
proteins, biologically active molecules, biologically inert
molecules, and candidate therapeutic agents or the like.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] FIG. 1A illustrates a cross-sectional view of a process for
preparing an unpatterned polymer sheet.
[0013] FIG. 1B is a top view of a sheet of PAZAM hydrogel prepared
by the process illustrated in FIG. 1A.
[0014] FIG. 1C is a top view of the PAZAM sheets prepared by the
process illustrated in FIG. 1A, where the sheets are suspended on a
plastic supporting rack to form a free standing polymer
membrane.
[0015] FIG. 2 illustrates a cross-sectional view of a process for
preparing a patterned polymer sheet according to one
embodiment.
[0016] FIG. 3A illustrates delaminating a PAZAM sheet formed
according to the process illustrated in FIG. 2.
[0017] FIG. 3B illustrates the suspension of a PAZAM sheet in
yellow Kapton.RTM. tape.
[0018] FIG. 3C illustrates the transfer of a PAZAM sheet onto a
functionalized carrier substrate, for example, a norbornene coated
glass slide.
[0019] FIGS. 4A and 4B illustrate Typhoon fluorescent images of a
flow cell.
[0020] FIG. 5A illustrates a cross-sectional view of a patterned
hydrogel polymer sheet with posts.
[0021] FIGS. 5B and 5C are Scanning Electron Microscope (SEM)
images of patterned PAZAM sheets with a plurality of nano-scale
posts.
[0022] FIG. 6A is a Scanning Electron Microscopy (SEM) image of a
polymer sheet containing a single polymer nano-scale post. All the
rest of the nano-scale posts are isolated in the nanowells of the
substrate surface.
[0023] FIG. 6B is a cross-sectional view of a rapid separation of a
hydrogel sheet from a patterned substrate surface wherein some
polymer material is left within depressions of a surface, according
to some embodiments of the present application.
[0024] FIG. 6C is a cross-sectional view of a controlled separation
of a hydrogel sheet from a patterned substrate surface wherein some
of the polymer material remains attached to the hydrogel sheet,
according to some embodiments of the present application.
[0025] FIG. 7A is a cross-sectional view of a process of forming
hydrogel filled nanowells on a substrate surface according to some
embodiments of the present application.
[0026] FIG. 7B is a cross-sectional view of a process of forming a
flexible sheet containing patterned hydrogel.
[0027] FIG. 8 is a schematic view of an automated factory-scale
sequencing process using roll-to-roll flexible sheets patterned
with polymers or hydrogels compatible for sequencing-by-synthesis
(SBS) application prepared by the process illustrated in FIGS. 7A
and 7B.
[0028] FIG. 9 illustrates the portion of an automated roll-to-roll
sequencing process depicted in FIG. 8 where the flexible patterned
sheet is stretched during imaging and retracted following
imaging.
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0029] Described herein are processes to form polymer sheets. In
some embodiments, the polymer sheets can be used for nucleic acid
sequencing reactions. In some embodiments, the polymer sheets have
smooth surfaces, while in other embodiments, the polymer sheets are
micro or nano-patterned polymer sheets. Some embodiments described
herein are related to direct patterning and release of a
free-standing, flexible polymer sheet for optional use as a
template surface in nucleic acid sequencing reactions or other
applications. Some other embodiments described herein are related
to polish-free method to form "gels in wells" referring to
patterned hydrogel isolated in nanowells of the substrate surface.
These processes may be used in a variety of applications, including
next generation nucleic acid sequencing, stem cell growth,
differentiation and proliferation on patterned biocompatible
surfaces and stretchable, and bioreactions and integration with
biosensors on flexible and/or stretchable electronics and
stretchable surfaces for plasmonics.
[0030] In some instances, the polymer sheet is freely suspended and
has the consistency and flexibility of well-known plastic wrap
material used for storage of food and other household items,
however also providing the chemical reactivity present in a typical
hydrogel coating for nucleotide sequencing. For example, in a
standard flow cell for sequencing, active functional groups are
generally present on the coating that can partake in primer
grafting. This can be seen in the ILLUMINA.RTM. (San Diego, Calif.)
sequencing by synthesis systems. As a result, this flexible polymer
sheet could be applied to a variety of sequencing architectures,
including flowcells, through lamination or transfer printing
processes.
[0031] Some further embodiments described herein relate to the use
of flexible polymer sheets for factory-scale sequencing, for
example, in a roll-to roll format analogous to a printing press
where the flexible polymer sheets are repeatedly respooled back and
forth through the system during each cycle of sequencing. Similarly
the flexible polymer sheets can be formed into belts that
repeatedly pass the surface through a system for respective cycles
of sequencing. This approach could enable low-cost, high throughput
sequencing reactions to take place.
[0032] Optionally, the polymer sheets can be stretchable. In such
embodiments, the stretchable polymer sheets contain high density
hydrogel arrays that could then be stretched or deformed across a
low numerical aperture (NA) read-head for sequencing using low cost
optic imaging devices. This approach combines the lower input and
reagent volumes afforded by smaller flowcell sizes with the low
cost optics. More specifically, the surface can be in a relatively
contracted state during fluid processing steps to allow a large
number of array features to contact a relatively low volume of
reagents. Following the chemistry step, and the surface can be
stretched to increase the pitch of the array, thereby enabling the
optical detection and delineation of adjacent features using a low
numerical aperture objective that would typically not be able to
resolve these features in a contracted state. In addition,
stretching the surface to increase the pitch of the features
reduces cross-talk between array features during detection steps,
enabling robust imaging using low-cost optics.
[0033] In some other embodiments of the stretchable polymers, these
stretchable polymer sheets can be coated or patterned with metals
or dielectrics. By thermally, mechanically, chemically or optically
stressing these shape memory polymer sheets with patterned metallic
structures on the polymer can be tuned to contract, thereby forming
metallic or dielectric surfaces with a reduced pitch to the
non-stressed state. In addition, the shrinking process will induce
higher surface roughness or "wrinkles" in the metal structures.
See, Fu et al., "Tunable Nanowrinkles on Shape Memory Polymer
Sheets," Adv. Mater. 2009, 21, 1-5. Potential applications for
these contracted polymer materials with patterned metals and
dielectrics are in plasmonics, SERS, fluorescence enhancement,
electronics among other applications. Nylons and polyolefins are
examples of heat shrink polymers that can be coated with polymers
for sequencing or patterned with metals/dielectrics and shrunk for
use in plasmonics, electronics and for the formation of metallic or
semiconductor gap junctions. Other families of candidate polymers
that could be used for these applications include polyolefins,
polyvinyls, polycarbonates, polyurethanes, silicones, Kapton.RTM.
polyimide films amongst others.
[0034] The following detailed description is directed to certain
specific embodiments of the present application. In this
description, reference is made to the drawings wherein like parts
or steps may be designated with like numerals throughout for
clarity. Reference in this specification to "one embodiment," "an
embodiment," or "in some embodiments" means that a particular
feature, structure, or characteristic described in connection with
the embodiment can be included in at least one embodiment of the
invention. The appearances of the phrases "one embodiment," "an
embodiment," or "in some embodiments" in various places in the
specification are not necessarily all referring to the same
embodiment, nor are separate or alternative embodiments mutually
exclusive of other embodiments. Moreover, various features are
described which may be exhibited by some embodiments and not by
others. Similarly, various requirements are described which may be
requirements for some embodiments but not other embodiments.
[0035] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described.
Definitions
[0036] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of ordinary skill in the art. All patents, applications, published
applications and other publications referenced herein are
incorporated by reference in their entirety unless stated
otherwise. As used in the specification and the appended claims,
the singular forms "a," "an" and "the" include plural referents
unless the context clearly dictates otherwise. The use of "or"
means "and/or" unless stated otherwise. Furthermore, use of the
term "including" as well as other forms, such as "include",
"includes," and "included," is not limiting. As used in this
specification, whether in a transitional phrase or in the body of
the claim, the terms "comprise(s)" and "comprising" are to be
interpreted as having an open-ended meaning. That is, the terms are
to be interpreted synonymously with the phrases "having at least"
or "including at least." When used in the context of a process, the
term "comprising" means that the process includes at least the
recited steps, but may include additional steps. When used in the
context of a compound, composition, or device, the term
"comprising" means that the compound, composition, or device
includes at least the recited features or components, but may also
include additional features or components.
[0037] As used herein, common organic abbreviations are defined as
follows: [0038] dATP Deoxyadenosine triphosphate [0039] dCTP
Deoxycytidine triphosphate [0040] dGTP Deoxyguanosine triphosphate
[0041] dTTP Deoxythymidine triphosphate [0042] ssDNA Single
stranded DNA [0043] NA Numerical aperture [0044] SBS Sequencing by
synthesis [0045] PAZAM poly(N-(5-azidoacetamidylpentyl)
acrylamide-co-acrylamide) of any acrylamide to Azapa
(N-(5-(2-azidoacetamido)pentyl)acrylamide) ratio [0046] .degree. C.
Temperature in degrees Centigrade [0047] .mu.m micrometer
[0048] As used herein, the term "array" refers to a population of
different features that occur on one or more substrates such that
the different features can be spatially differentiated from each
other. In some embodiments, the features are wells, posts,
trenches, ridges or other contours on a substrate surface.
Alternatively or additionally, the features can each comprise one
or more probe molecules and optionally different probes can be
present at each of the features. A feature can also be defined as a
location where a gel or other material resides in larger quantity
than an interstitial region on the same surface. An array can
include different probe molecules that are each located at a
different addressable location on a substrate. Alternatively or
additionally, an array can include separate substrates each bearing
a different probe molecule, wherein the different probe molecules
can be identified according to the locations of the substrates on a
surface to which the substrates are attached or according to the
locations of the substrates in a liquid. Exemplary arrays in which
separate substrates are located on a surface include, without
limitation, those including beads in wells as described, for
example, in U.S. Pat. No. 6,355,431 B1, US 2002/0102578 and PCT
Publication No. WO 00/63437. Exemplary formats that can be used in
the present application to distinguish beads in a liquid array, for
example, using a microfluidic device, such as a fluorescent
activated cell sorter (FACS), are described, for example, in U.S.
Pat. No. 6,524,793. Further examples of arrays that can be used in
the application include, without limitation, those described in
U.S. Pat Nos. 5,429,807; 5,436,327; 5,561,071; 5,583,211;
5,658,734; 5,837,858; 5,874,219; 5,919,523; 6,136,269; 6,287,768;
6,287,776; 6,288,220; 6,297,006; 6,291,193; 6,346,413; 6,416,949;
6,482,591; 6,514,751 and 6,610,482; and WO 93/17126; WO 95/11995;
WO 95/35505; EP 742 287; and EP 799 897.
[0049] As used herein, the term "covalently attached" or
"covalently bonded" refers to the forming of a chemical bonding
that is characterized by the sharing of pairs of electrons between
atoms. For example, a "covalently attached polymer sheet," when
used in reference to a substrate surface, refers to a polymer sheet
that forms chemical bonds with a functionalized surface of a
substrate, as compared to attachment to the surface via other
means, for example, adhesion or electrostatic interaction. It will
be appreciated that polymers that are attached covalently to a
surface can also be bonded via other means in addition to covalent
attachment.
[0050] As used herein, the term "roll to roll process" refers to
manipulation of an elongated substrate as it is transferred from
one spool to another. An exemplary roll to roll process is
continuous sequencing of a patterned substrate surface as the
surface moves past a sequencing device while being unspooled from
one roll and spooled onto another roll.
[0051] As used herein, the term "pitch" refers to the
center-to-center spacing between two features of an array. A
pattern of features can be characterized in terms of the average
pitch. For example, the pattern can be regular such that the
coefficient of variation around the average pitch is small or the
pattern can be non-regular in which case the coefficient of
variation can be relatively large. In either case, the average
pitch can be, for example, at least about 10 nm, about 0.1 .mu.m,
about 0.5 .mu.m, about 1 .mu.m, about 5 .mu.m, about 10 .mu.m,
about 100 .mu.m or more, or a range defined by any of the two
preceding values. Alternatively or additionally, the average pitch
can be, for example, at most about 100 .mu.m, about 10 .mu.m, about
5 .mu.m, about 1 .mu.m, about 0.5 .mu.m, about 0.1 .mu.m or less,
or a range defined by any of the two preceding values.
[0052] As used herein, the term "cross-talk" refers to signal
apparent from an observed feature due to signal produced from
another feature. Cross-talk is generally undesirable and generally
considered to be a form of background.
[0053] As used herein, "C.sub.a to C.sub.b" or "C.sub.a-b" in which
"a" and "b" are integers refer to the number of carbon atoms in the
specified group. That is, the group can contain from "a" to "b",
inclusive, carbon atoms. Thus, for example, a "C.sub.1 to C.sub.4
alkyl" or "C.sub.1-4 alkyl" group refers to all alkyl groups having
from 1 to 4 carbons, that is, CH.sub.3--, CH.sub.3CH.sub.2--,
CH.sub.3CH.sub.2CH.sub.2--, (CH.sub.3).sub.2CH--,
CH.sub.3CH.sub.2CH.sub.2CH.sub.2--, CH.sub.3CH.sub.2CH(CH.sub.3)--
and (CH.sub.3).sub.3C--.
[0054] The term "halogen" or "halo," as used herein, means any one
of the radio-stable atoms of column 7 of the Periodic Table of the
Elements, e.g., fluorine, chlorine, bromine, or iodine, with
fluorine and chlorine being preferred.
[0055] As used herein, "alkyl" refers to a straight or branched
hydrocarbon chain that is fully saturated (i.e., contains no double
or triple bonds). The alkyl group may have 1 to 20 carbon atoms
(whenever it appears herein, a numerical range such as "1 to 20"
refers to each integer in the given range; e.g., "1 to 20 carbon
atoms" means that the alkyl group may consist of 1 carbon atom, 2
carbon atoms, 3 carbon atoms, etc., up to and including 20 carbon
atoms, although the present definition also covers the occurrence
of the term "alkyl" where no numerical range is designated). The
alkyl group may also be a medium size alkyl having 1 to 9 carbon
atoms. The alkyl group could also be a lower alkyl having 1 to 4
carbon atoms. The alkyl group may be designated as "C.sub.1-4
alkyl" or similar designations. By way of example only, "C.sub.1-4
alkyl" indicates that there are one to four carbon atoms in the
alkyl chain, i.e., the alkyl chain is selected from the group
consisting of methyl, ethyl, propyl, iso-propyl, n-butyl,
iso-butyl, sec-butyl, and t-butyl. Typical alkyl groups include,
but are in no way limited to, methyl, ethyl, propyl, isopropyl,
butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like.
[0056] As used herein, "alkene" or "alkenyl" refers to a straight
or branched hydrocarbon chain containing one or more double bonds.
The alkenyl group may have 2 to 20 carbon atoms, although the
present definition also covers the occurrence of the term "alkenyl"
where no numerical range is designated. The alkenyl group may also
be a medium size alkenyl having 2 to 9 carbon atoms. The alkenyl
group could also be a lower alkenyl having 2 to 4 carbon atoms. The
alkenyl group may be designated as "C.sub.2-4 alkenyl" or similar
designations. By way of example only, "C.sub.2-4 alkenyl" indicates
that there are two to four carbon atoms in the alkenyl chain, i.e.,
the alkenyl chain is selected from the group consisting of ethenyl,
propen-1-yl, propen-2-yl, propen-3-yl, buten-1-yl, buten-2-yl,
buten-3-yl, buten-4-yl, 1-methyl-propen-1-yl, 2-methyl-propen-1-yl,
1-ethyl-ethen-1-yl, 2-methyl-propen-3-yl, buta-1,3-dienyl,
buta-1,2,-dienyl, and buta-1,2-dien-4-yl. Typical alkenyl groups
include, but are in no way limited to, ethenyl, propenyl, butenyl,
pentenyl, and hexenyl, and the like.
[0057] As used herein, "alkynyl" refers to a straight or branched
hydrocarbon chain containing one or more triple bonds. The alkynyl
group may have 2 to 20 carbon atoms, although the present
definition also covers the occurrence of the term "alkynyl" where
no numerical range is designated. The alkynyl group may also be a
medium size alkynyl having 2 to 9 carbon atoms. The alkynyl group
could also be a lower alkynyl having 2 to 4 carbon atoms. The
alkynyl group may be designated as "C.sub.2-4 alkynyl" or similar
designations. By way of example only, "C.sub.2-4 alkynyl" indicates
that there are two to four carbon atoms in the alkynyl chain, i.e.,
the alkynyl chain is selected from the group consisting of ethynyl,
propyn-1-yl, propyn-2-yl, butyn-1-yl, butyn-3-yl, butyn-4-yl, and
2-butynyl. Typical alkynyl groups include, but are in no way
limited to, ethynyl, propynyl, butynyl, pentynyl, and hexynyl, and
the like.
[0058] As used herein, "cycloalkyl" means a fully saturated
carbocyclyl ring or ring system. Examples include cyclohexyl,
cycloheptyl, cyclooctyl, etc.
[0059] As used herein, "cycloalkylene" means a fully saturated
carbocyclyl ring or ring system that is attached to the rest of the
molecule via two points of attachment.
[0060] As used herein, "cycloalkenyl" or "cycloalkene" means a
carbocyclyl ring or ring system having at least one double bond,
wherein no ring in the ring system is aromatic. An example is
cyclooctene. Another example is norbornene or norbornenyl.
[0061] As used herein, "heterocycloalkenyl" or "heterocycloalkene"
means a carbocyclyl ring or ring system with at least one
heteroatom in ring backbone, having at least one double bond,
wherein no ring in the ring system is aromatic.
[0062] As used herein, "cycloalkynyl" or "cycloalkyne" means a
carbocyclyl ring or ring system having at least one triple bond,
wherein no ring in the ring system is aromatic. An example is
cyclooctyne. Another example is bicyclononyne.
[0063] As used herein, "heterocycloalkynyl" or "heterocycloalkyne"
means a carbocyclyl ring or ring system with at least one
heteroatom in ring backbone, having at least one triple bond,
wherein no ring in the ring system is aromatic.
[0064] An "amino" group refers to a "--NR.sub.AR.sub.B" group in
which R.sub.A and R.sub.B are each independently selected from
hydrogen, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl,
C.sub.3-7 carbocyclyl, C.sub.6-10 aryl, 5-10 membered heteroaryl,
and 5-10 membered heterocyclyl, as defined herein. A non-limiting
example includes free amino (i.e., --NH.sub.2).
[0065] A "C-amido" group refers to a "--C(.dbd.O)NR.sub.AR.sub.B"
group in which R.sub.A and R.sub.B are each independently selected
from hydrogen, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6
alkynyl, C.sub.3-7 carbocyclyl, C.sub.6-10 aryl, 5-10 membered
heteroaryl, and 5-10 membered heterocyclyl, as defined herein.
[0066] An "N-amido" group refers to a
"--N(R.sub.A)C(.dbd.O)R.sub.B" group in which R.sub.A and R.sub.B
are each independently selected from hydrogen, C.sub.1-6 alkyl,
C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7 carbocyclyl,
C.sub.6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered
heterocyclyl, as defined herein.
[0067] As used herein, the term "carboxylic acid" or "carboxyl" as
used herein refers to --C(O)OH.
[0068] The term "hydrazine" or "hydrazinyl" as used herein refers
to a --NHNH.sub.2 group.
[0069] As used herein, the term "hydrazone" or "hydrazonyl" as used
herein refers to a
##STR00001##
group in which R.sub.a and R.sub.b are each independently selected
from hydrogen, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6
alkynyl, C.sub.3-7 carbocyclyl, C.sub.6-10 aryl, 5-10 membered
heteroaryl, and 5-10 membered heterocyclyl, as defined herein. A
non-limiting example includes free amino (i.e., --NH.sub.2).
[0070] The term "epoxy" as used herein refers to
##STR00002##
[0071] The term "glycidyl ether" as used herein refers to
##STR00003##
[0072] As used herein, the term "tetrazine" or "tetrazinyl" refers
to six-membered heteroaryl group comprising four nitrogen atoms.
Tetrazine may be optionally substituted.
[0073] As used herein, the term "tetrazole" or "tetrazolyl" refers
to five membered heterocyclic group comprising four nitrogen atoms.
Tetrazole may be optionally substituted.
[0074] An "nitrile oxide" as used herein, refers to a
"RC.ident.N.sup.+O.sup.-" group in which R is selected from
hydrogen, C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl,
C.sub.3-7 carbocyclyl, C.sub.6-10 aryl, 5-10 membered heteroaryl,
or 5-10 membered heterocyclyl, as defined herein. Non-limiting
examples of preparing nitrile oxide include in situ generation from
aldoximes by treatment with chloramide-T or through action of base
on imidoyl chlorides [RC(Cl).dbd.NOH].
[0075] An "nitrone" as used herein, refers to a
"R.sub.AR.sub.BC.dbd.NR.sub.c.sup.-O.sup.-" group in which R.sub.A,
R.sub.B and R.sub.c are each independently selected from hydrogen,
C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.3-7
carbocyclyl, C.sub.6-10 aryl, 5-10 membered heteroaryl, or 5-10
membered heterocyclyl, as defined herein.
[0076] As used herein, a substituted group is derived from the
unsubstituted parent group in which there has been an exchange of
one or more hydrogen atoms for another atom or group. Unless
otherwise indicated, when a group is deemed to be "substituted," it
is meant that the group is substituted with one or more
substituents independently selected from C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkynyl, C.sub.1-C.sub.6
heteroalkyl, C.sub.3-C.sub.7 carbocyclyl (optionally substituted
with halo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy,
C.sub.1-C.sub.6 haloalkyl, and C.sub.1-C.sub.6 haloalkoxy),
C.sub.3-C.sub.7-carbocyclyl-C.sub.1-C.sub.6-alkyl (optionally
substituted with halo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6
alkoxy, C.sub.1-C.sub.6 haloalkyl, and C.sub.1-C.sub.6 haloalkoxy),
5-10 membered heterocyclyl (optionally substituted with halo,
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6
haloalkyl, and C.sub.1-C.sub.6 haloalkoxy), 5-10 membered
heterocyclyl-C.sub.1-C.sub.6-alkyl (optionally substituted with
halo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy,
C.sub.1-C.sub.6 haloalkyl, and C.sub.1-C.sub.6 haloalkoxy), aryl
(optionally substituted with halo, C.sub.1-C.sub.6 alkyl,
C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6 haloalkyl, and
C.sub.1-C.sub.6 haloalkoxy), aryl(C.sub.1-C.sub.6)alkyl (optionally
substituted with halo, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6
alkoxy, C.sub.1-C.sub.6 haloalkyl, and C.sub.1-C.sub.6 haloalkoxy),
5-10 membered heteroaryl (optionally substituted with halo,
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6
haloalkyl, and C.sub.1-C.sub.6 haloalkoxy), 5-10 membered
heteroaryl(C.sub.1-C.sub.6)alkyl (optionally substituted with halo,
C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6
haloalkyl, and C.sub.1-C.sub.6 haloalkoxy), halo, cyano, hydroxy,
C.sub.1-C.sub.6 alkoxy, C.sub.1-C.sub.6
alkoxy(C.sub.1-C.sub.6)alkyl (i.e., ether), aryloxy, sulfhydryl
(mercapto), halo(C.sub.1-C.sub.6)alkyl (e.g., --CF.sub.3),
halo(C.sub.1-C.sub.6)alkoxy (e.g., --OCF.sub.3), C.sub.1-C.sub.6
alkylthio, arylthio, amino, amino(C.sub.1-C.sub.6)alkyl, nitro,
O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, C-amido,
N-amido, S-sulfonamido, N-sulfonamido, C-carboxy, O-carboxy, acyl,
cyanato, isocyanato, thiocyanato, isothiocyanato, sulfinyl,
sulfonyl, and oxo (.dbd.O). Wherever a group is described as
"optionally substituted" that group can be substituted with the
above substituents.
[0077] As used herein, a "nucleotide" includes a nitrogen
containing heterocyclic base, a sugar, and one or more phosphate
groups. They are monomeric units of a nucleic acid sequence. In
RNA, the sugar is a ribose, and in DNA a deoxyribose, i.e. a sugar
lacking a hydroxyl group that is present at the 2' position in
ribose. The nitrogen containing heterocyclic base can be purine or
pyrimidine base. Purine bases include adenine (A) and guanine (G),
and modified derivatives or analogs thereof. Pyrimidine bases
include cytosine (C), thymine (T), and uracil (U), and modified
derivatives or analogs thereof. The C-1 atom of deoxyribose is
bonded to N-1 of a pyrimidine or N-9 of a purine.
[0078] As used herein, a "nucleoside" is structurally similar to a
nucleotide, but lacks any phosphate moieties at the 5' position.
The term "nucleoside" is used herein in its ordinary sense as
understood by those skilled in the art. Examples include, but are
not limited to, a ribonucleoside comprising a ribose moiety and a
deoxyribonucleoside comprising a deoxyribose moiety. A modified
pentose moiety is a pentose moiety in which an oxygen atom has been
replaced with a carbon and/or a carbon has been replaced with a
sulfur or an oxygen atom. A "nucleoside" is a monomer that can have
a substituted base and/or sugar moiety. Additionally, a nucleoside
can be incorporated into larger DNA and/or RNA polymers and
oligomers.
[0079] As used herein, the term "polynucleotide" refers to nucleic
acids in general, including DNA (e.g. genomic DNA cDNA), RNA (e.g.
mRNA), synthetic oligonucleotides and synthetic nucleic acid
analogs. Polynucleotides may include natural or non-natural bases,
or combinations thereof and natural or non-natural backbone
linkages, e.g. phosphorothioates, PNA or 2'-O-methyl-RNA, or
combinations thereof.
[0080] As used herein, the term "primer" is defined as a single
strand DNA (ssDNA) molecule with a free 3' OH group and a
modification at the 5' terminus to allow the coupling reactions.
The primer length can be any number of bases long and can include a
variety of non-natural nucleotides. In some embodiments, "SBS
primers" are used as part of a sequencing by synthesis (SBS)
reaction on a system such as the HiSeq.RTM., MiSeq.RTM. or
NextSeq.RTM. systems from Illumina (San Diego, Calif.). In these
reactions, a set of amplification primers are typically bound to a
glass surface. A set of target DNA molecules to be sequenced is
hybridized to the bound primers and then amplified by a bridge
amplification process. The sequencing reactions are carried out,
and in embodiments of the invention, the amplification primers (and
amplicons including primers extended during amplification steps to
include copies of the target DNA) are then unbound from the glass
surface so that the surface is reusable in future sequencing
reactions. Thus, one or more of the steps of attaching
amplification primers to the glass surface, hybridizing target DNA
molecules to the primers, bridge amplification, sequencing the
target DNA, and removing amplification primers and amplicons can be
repeated. One or more repetition can be carried out. In some
embodiments, the SBS primers can be the P5 or P7 primers in one
embodiment, as detailed below. The P5 and P7 primers are used on
the surface of commercial flow cells sold by Illumina Inc. for
sequencing on the HiSeq.RTM., MiSeq.RTM., NextSeq.RTM. and Genome
Analyzer.RTM. platforms. The primer sequences are described in US
Pat. Pub. No. 2011/0059865 A1, which is incorporated herein by
reference in its entirety.
[0081] The P5 and P7 primer sequences comprise the following:
[0082] Paired end set:
TABLE-US-00001 [0082] P5: paired end 5'.fwdarw.3'
AATGATACGGCGACCACCGAGAUCTACAC P7: paired end 5'.fwdarw.3'
CAAGCAGAAGACGGCATACGAG*AT
[0083] Single read set:
TABLE-US-00002 [0083] P5: single read: 5'.fwdarw.3'
AATGATACGGCGACCACCGA P7: single read 5'.fwdarw.3'
CAAGCAGAAGACGGCATACGA
[0084] Optionally, one or both of the P5 and P7 primers can include
a poly T tail. The poly T tail is generally located at the 5' end
of the above sequences, but in some cases can be located at the 3'
end. The poly T sequence can include any number of T nucleotides,
for example, from 2 to 20.
Processes for Preparation of Polymer Sheets for Sequencing
Applications
[0085] Some embodiments described herein are related to processes
of preparing a polymer sheet for sequencing applications, include
providing a substrate with a surface; depositing a layer of a
polymer composition onto the surface of the substrate, wherein the
polymer composition comprises functional groups for grafting
oligonucleotides; forming the polymer composition into a polymer
sheet on the surface; and removing the polymer sheet from the
surface of the substrate.
[0086] Various polymers compositions can be used in the processes
described herein. The polymer compositions can include a polymer
with one or more functional groups that are capable of reacting
with biomolecules of interest, for example, for grafting primers.
In some embodiments, the functional groups of the polymer are also
capable of reacting with the substrate surface to form covalent
bonding between the polymer and the substrate surface. In these
instances, the substrate surface is usually treated with functional
silane or silane derivatives, which provide reactive sites on the
surface for reaction with the polymer composition. In some such
embodiments, the functional groups of the polymer composition may
include or may be selected from C.sub.8-14 cycloalkenes, 8 to 14
membered heterocycloalkenes, C.sub.8-14 cycloalkynes, 8 to 14
membered heterocycloalkynes, alkynyl, vinyl, halo, azido, amino,
amido, epoxy, glycidyl, carboxyl, hydrazonyl, hydrazinyl, hydroxy,
tetrazolyl, tetrazinyl, nitrile oxide, nitrene, nitrone, oxo-amino,
or thiol, or optionally substituted variants and combinations
thereof. Non-limiting examples of the polymers can be used in the
present application are described herein, including those described
in U.S. Pat. No. 9,012,022, which is hereby incorporated by
reference in its entirety.
[0087] In some instances, the polymer composition may be partially
or completely replaced by monomer composition, a pre-polymer
composition or a polymer precursor composition, wherein
polymerization reaction is carried out in situ during the forming
of the polymer sheet.
[0088] Hydrogels
[0089] In some embodiments, the polymer composition described
herein comprises a hydrogel. Non-limiting exemplary hydrogels that
can be used in the present application include polyacrylamide,
polymethacrylic acids, homopolymer hydrogels, copolymer hydrogels,
multipolymer hydrogels, etc. Other non-limiting examples of
hydrogels that can be used in the present application are described
herein. WO 00/31148 (incorporated herein by reference) discloses
polyacrylamide hydrogels and polyacrylamide hydrogel-based arrays
in which a so-called polyacrylamide prepolymer is formed,
preferably from acrylamide and an acrylic acid or an acrylic acid
derivative containing a vinyl group. Crosslinking of the prepolymer
may then be carried out. The hydrogels so produced are
solid-supported, preferably on glass. Functionalization of the
solid-supported hydrogel may also be carried out.
[0090] WO 01/01143 (incorporated herein by reference) describes
technology similar to WO00/31148 but differing in that the hydrogel
bears functionality capable of participating in a [2+2]
photocycloaddition reaction with a biomolecule so as to form
immobilized arrays of such biomolecules. Such functionalized
hydrogels can be used in a method of composition of the present
disclosure. Dimethylmaleimide (DMI) is a particularly preferred
functionality. The use of [2+2] photocycloaddition reactions, in
the context of polyacrylamide-based microarray technology is also
described in WO02/12566 and WO03/014392 (both being incorporated
herein by reference).
[0091] U.S. Pat. No. 6,465,178 (incorporated herein by reference)
discloses the use of reagent compositions in providing activated
slides for use in preparing microarrays of nucleic acids; the
reagent compositions include acrylamide copolymers. The
compositions and methods set forth therein can be applied in the
context of the methods and compositions set forth herein.
[0092] WO 00/53812 (incorporated herein by reference) discloses the
preparation of polyacrylamide-based hydrogel arrays of DNA and the
use of these arrays in replica amplification which can be used in a
method or composition set forth herein.
[0093] Once hydrogels have been formed, biomolecules may then be
attached to them so as to produce molecular arrays, if desired.
Attachment can be effected in different ways. For example, U.S.
Pat. No. 6,372,813 (incorporated herein by reference) teaches
immobilization of polynucleotides bearing dimethylmaleimide groups
to the hydrogels produced which bear dimethylmaleimide groups by
conducting a [2+2] photocycloaddition step between two
dimethylmaleimide groups--one attached to the polynucleotide to be
immobilized and one pendant from the hydrogel.
[0094] Where the molecular array is formed after generation of the
hydrogel, two strategies can be employed to achieve this end.
Firstly, the hydrogel may be modified chemically after it is
produced. A more common alternative is to effect polymerization
with a co-monomer having a functionality primed or pre-activated to
react with the molecules to be arrayed.
[0095] Alternatives to initial formation of hydrogels followed by
subsequent arraying of molecules thereto can be employed, for
example, where the array is formed at the same time as the hydrogel
is produced. This may be effected by, for example, direct
copolymerization of acrylamide-derivatized polynucleotides. An
example of this approach is described in WO01/62982 (incorporated
herein by reference) in which acrylamide-derivatized
polynucleotides are mixed with solutions, of acrylamide and
polymerization is effected directly.
[0096] Mosaic Technologies (Boston, Mass., USA) produced
ACRYDITE.TM. (an acrylamide phosphoramidite) which can be reacted
with polynucleotides prior to copolymerization of the resultant
monomer with acrylamide.
[0097] Efimov et al. (Nucleic Acids Research, 1999, 27 (22),
4416-4426, incorporated herein by reference) disclose a further
example of a simultaneous formation of hydrogel/array that can be
used, in which copolymerization of acrylamide, reactive acrylic
acid derivatives and the modified polynucleotides having 5'- or
3'-terminal acrylamide groups occurs.
[0098] PAZAM
[0099] In some embodiments, the polymer composition comprises
poly(N-(5-azidoacetamidylpentyl) acrylamide-co-acrylamide) (PAZAM).
In some embodiments, PAZAM is also represented by Formula (A) or
(B):
##STR00004##
[0100] wherein n is an integer in the range of 1-20,000, and m is
an integer in the range of 1-100,000.
[0101] PAZAM can be prepared by polymerization of acrylamide and
Azapa (N-(5-(2-azidoacetamido)pentyl)acrylamide) in any ratio. In
some embodiments, PAZAM is a linear polymer. In some other
embodiments, PAZAM is a lightly cross-linked polymer. In some
embodiments, PAZAM is applied as an aqueous solution. In some other
embodiments, PAZAM is applied as an aqueous solution with one or
more solvent additives, such as ethanol. The method for preparation
different PAZAM polymers is discussed in details in U.S. Pat. No.
9,012,022, which is hereby incorporated by reference in its
entirety. In some embodiments, PAZAM may be mixed with one or more
polymers or hydrogels in the preparation of the polymer composition
described herein.
[0102] In some embodiments, the surface of the substrate is treated
with a silane or silane derivative before depositing the polymer
composition (or precursors of the polymer). In one embodiment, the
surface of the substrate is treated with fluorosilane. In another
embodiment, the surface is treated with a norbornene silane, for
example, [(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane.
Other suitable silane derivatives that can be used in the present
application are described in U.S. Pub. No. 2015/0005447 A1, which
is hereby incorporated by reference in its entirety.
[0103] In some embodiments, the forming of the polymer sheet
comprises dehydrating the polymer composition. One purpose of the
dehydrating step is to remove any solvent in the polymer
composition. In some embodiments, the dehydrating step is performed
at an elevated temperature, for example, above about 30.degree. C.,
or at a temperature that is compatible with the functional moieties
in the polymer or hydrogel. In some such embodiments, the
dehydrating occurs at about 60.degree. C. In some cases, the
dehydrating temperature is controlled to maintain the desired
chemical and physical properties of the polymer sheets, such as
below about 100.degree. C. For example, the dehydrating temperature
is usually below about 90.degree. C. when PAZAM is used. The
dehydrating step can be performed in various devices known to one
of ordinary skill in the art, for example, a hot plate or a vacuum
oven. In some embodiments, a separate step of incubating the
polymer composition on the surface may be needed if the formed
polymer sheet is to be chemically linked or bonded to the
surface.
[0104] In some embodiments, the surface of the substrate includes
micro-scale or nano-scale patterns, such as channels, trenches,
posts, wells, or combinations thereof. In some such embodiments, an
imprint of the micro-scale or nano-scale patterns of the patterned
surface is transferred to the polymer sheet to form a patterned
polymer sheet. Micro-scale patterns include, for example, those
having features with dimensions (e.g. average diameter or average
cross section) in the range of about 1 micron to about 999 microns.
Nano-scale patterns include, for example, those having features
with dimensions (e.g. average diameter or average cross section) in
the range of about 1 nanometer to about 999 nanometers.
[0105] Some embodiments described herein are related to polymer
sheets for sequencing applications prepared by the processes
described herein and substrates comprising polymer sheets prepared
by the processes described herein for sequencing applications.
[0106] FIG. 1A illustrates the cross-sectional view of a process
for preparing an unpatterned polymer sheet according to some
embodiments of the present application. First, a substrate 100
containing an underlying glass plate 101 and a fluorosilane layer
102 surface is provided. Then, a layer of hydrated hydrogel 103 is
deposited on top of the fluorosilane layer 102. Following
dehydration of the hydrogel at 60.degree. C., the hydrogel forms a
polymer sheet 104, which is subsequently removed by physical force,
such as a tape.
[0107] FIG. 1B is a top view of a sheet of PAZAM prepared by the
process illustrated in FIG. 1A. FIG. 1C is a top view of the PAZAM
sheets prepared by the process illustrated in FIG. 1A, where the
sheets are suspended on a scaffold or support structure, for
example, a plastic supporting rack.
[0108] FIG. 2 illustrates a cross-sectional view of a process for
preparing a patterned polymer sheet according to some embodiments
of the present application. In this specific example, PAZAM is used
as the hydrogel of choice as it supports sequencing by synthesis
(SBS). However, this process can also be extended to a variety of
other hydrogels and polymers. First, a substrate 200 containing an
underlying patterned glass plate 201 with patterns 202 and a
fluorosilane layer (not shown) is provided. Then, a layer of
hydrated PAZAM hydrogel 203 is deposited on top of patterned glass
plate 201. Following dehydration of the hydrogel, the hydrogel
forms a polymer sheet 204, containing patterns 205, which are
transferred from patterns 202 of the glass plate 201. Polymer sheet
204 is subsequently removed by physical force.
[0109] The unpatterned polymer sheet of FIG. 1A and the patterned
polymer sheet of FIG. 2 can scale in size to that of a microscope
slide. Methods to increase the structural robustness of these
polymer sheets include increasing the hydrogel polymer chain length
for greater physical entanglement, adding alkyne cross-linkers to
the hydrogel (for example, alkyne cross-linkers to PAZAM hydrogel),
or changing the molecular weight of the hydrogel, amongst
others.
Processes for Preparation of Substrate Surface for Sequencing
Applications
[0110] Some embodiments described herein are related to processes
of preparing a substrate surface for sequencing applications,
comprising providing a polymer sheet having a first plurality of
functional groups; contacting the polymer sheet with a surface of a
substrate, wherein the surface includes a second plurality of
functional groups; covalently bonding the first plurality of
functional groups of the polymer sheet to the second plurality of
functional groups of the surface. In some embodiments, incubating
the polymer composition on the surface may be needed when forming
covalent bonding with the surface.
[0111] In some embodiments, the processes further include grafting
oligonucleotides on the substrate surface by reacting
functionalized oligonucleotides with the first plurality of
functional groups of the polymer sheet.
[0112] In some embodiments, the polymer sheet is patterned. In some
such embodiments, the polymer sheet includes a plurality of
micro-scale or nano-scale patterned channels, trenches, posts,
wells, or combinations thereof.
[0113] In some embodiments, the polymer sheet includes a hydrogel.
In some such embodiment, the hydrogel is dehydrated prior to
covalently bonding to the substrate surface. In such embodiment,
the dehydrated hydrogel is rehydrated prior to reacting with the
functionalized oligonucleotides.
[0114] In some embodiments, the first plurality of functional
groups of the polymer sheet include or are selected from C.sub.8-14
cycloalkenes, 8 to 14 membered heterocycloalkenes, C.sub.8-14
cycloalkynes, 8 to 14 membered heterocycloalkynes, alkynyl, vinyl,
halo, azido, amino, amido, epoxy, glycidyl, carboxyl, hydrazonyl,
hydrazinyl, hydroxy, tetrazolyl, tetrazinyl, nitrile oxide,
nitrene, nitrone, oxo-amino, or thiol, or optionally substituted
variants and combinations thereof. In some further embodiments, the
first plurality of functional groups are selected from azido,
alkynyl, amino, carboxyl, epoxy, glycidyl, halo, or tetrazinyl, or
optionally substituted variants and combinations thereof. In one
embodiment, the first plurality of functional groups comprises
azido.
[0115] In some embodiments, the polymer sheet comprises
poly(N-(5-azidoacetamidylpentyl) acrylamide-co-acrylamide) (PAZAM).
In some embodiments, PAZAM may be mixed with one or more polymers
or hydrogels in the preparation of the polymer composition
described herein.
[0116] In some embodiments, the second plurality of functional
groups of the substrate surface include or are selected from vinyl,
acryloyl, alkenyl, alkynyl, C.sub.8-14 cycloalkenes, 8 to 14
membered heterocycloalkenes, C.sub.8-14 cycloalkynes, 8 to 14
membered heterocycloalkynes, nitrene, aldehyde, hydrazinyl,
glycidyl ether, epoxy, amino, carbene, isocyanate or maleimide, or
optionally substituted variants and combinations thereof. In some
further embodiments, the second plurality of functional groups are
selected from alkynyl, acryloyl, C.sub.8-14 cycloalkenes, alkynyl,
glycidyl ether, epoxy, or optionally substituted variants and
combinations thereof. In one embodiment, the second plurality of
functional groups comprises optionally substituted norbornene.
[0117] FIGS. 3A-3C illustrate a polymer sheet formed by the process
illustrated in FIG. 2 and transfer of the polymer sheet onto a
functionalized carrier substrate. FIG. 3A illustrates a delaminated
PAZAM sheet formed according to the process illustrated in FIG. 2.
FIG. 3B illustrates the suspension of the PAZAM sheet in yellow
Kapton.RTM. tape. FIG. 3C illustrates the transfer of the PAZAM
sheet onto a functionalized carrier substrate, for example, a
norbornene coated glass slide. The functionalized carrier substrate
may be any substrate with surface functional groups that can react
with the functional groups in the polymer sheet. In this case, the
norbornene groups in the glass slide can react with the azido
groups of PAZAM to form covalent bonds between the PAZAM sheet and
the substrate. Other carrier substrates can also be used in the
transfer printing process, for example, silanized glass, plastic,
metals, metal oxides, etc. In FIG. 3C, the norbornene silane coated
glass carrier slide contains five spots of water or buffer
solution. The water/buffer on the carrier substrate is used to
rehydrate the hydrogel for the purpose of carrying out the
subsequent surface reactions, for example, primer grafting.
[0118] FIGS. 4A-4B illustrate fluorescent images of a flow cell
taken with a GE Healthcare Lifesciences "Typhoon" imager. FIG. 4A
shows a Typhoon image of a flow cell prepared by transfer of a
unpatterned PAZAM sheet onto a norbornene coated glass slide and
the subsequent primer grafting and TET fluorescent dye hybridizing.
FIG. 4B shows a Typhoon image of a flow cell prepared by transfer
of a patterned PAZAM sheet onto a norbornene coated glass slide and
the subsequent primer grafting and TET fluorescent dye hybridizing.
FIGS. 4A and 4B demonstrate that the surface is clearly functional
following the transfer process and the array region shows a higher
TET intensity.
[0119] FIG. 5A illustrates a cross-sectional view of a patterned
hydrogel polymer sheet with posts, prepared according to the
process illustrated in FIG. 2. FIGS. 5B and 5C are SEM images of a
nano-patterned PAZAM sheet formed using the process illustrated in
FIG. 2. FIG. 5B shows about 400 nm diameter patterned PAZAM
hydrogel posts on a suspended hydrogel sheet at a pitch of about
700 nm. FIG. 5C is a magnified image of FIG. 5B.
[0120] Some embodiments described herein are related to processes
of preparing a patterned substrate surface for sequencing
applications. In some embodiments, the process may include
providing a substrate with a patterned surface, wherein the surface
includes a plurality of micro-scale or nano-scale patterned wells.
The polymer composition may then be deposited onto the patterned
surface to form a first polymer layer, wherein the polymer
composition fills the micro-scale or nano-scale patterned wells.
The first polymer layer on the surface is then separated from the
surface. This allows for the retention of the polymer composition
isolated within the micro-scale or nano-scale patterned wells of
the patterned surface. In some embodiments, the process further
comprises dehydrating the first polymer layer prior to the
separating of the first polymer layer. In some embodiments, a
separate step of incubating the polymer composition may be needed
when forming covalent bonding between the polymer composition and
the surface of the micro-scale or nano-scale patterned wells.
[0121] In some instances, the polymer composition may be partially
or completely replaced by monomer composition, a pre-polymer
composition or a polymer precursor composition, wherein
polymerization reaction is carried out in situ during the forming
of the polymer sheet.
[0122] In some embodiments, the polymer composition includes a
first plurality of functional groups selected from C.sub.8-14
cycloalkenes, 8 to 14 membered heterocycloalkenes, C.sub.8-14
cycloalkynes, 8 to 14 membered heterocycloalkynes, alkynyl, vinyl,
halo, azido, amino, amido, epoxy, glycidyl, carboxyl, hydrazonyl,
hydrazinyl, hydroxy, tetrazolyl, tetrazinyl, nitrile oxide,
nitrene, nitrone, oxo-amino, or thiol, or optionally substituted
variants and combinations thereof. In some further embodiments, the
first plurality of functional groups are selected from azido,
alkynyl, amino, carboxyl, epoxy, glycidyl, halo, or tetrazinyl, or
optionally substituted variants and combinations thereof. In one
embodiment, the first plurality of functional groups comprise
azido.
[0123] In some embodiments, the polymer composition comprises
poly(N-(5-azidoacetamidylpentyl) acrylamide-co-acrylamide) (PAZAM).
In some embodiments, PAZAM may be mixed with one or more polymers
or hydrogels in the preparation of the polymer composition
described herein.
[0124] In some embodiments, the processes further include grafting
oligonucleotides on the substrate surface by reacting
functionalized oligonucleotides with the first plurality of
functional groups of the polymer sheet.
[0125] In some embodiments, the polymer composition includes a
hydrogel. In some such embodiment, the polymer composition is
rehydrated prior to reacting with oligonucleotides.
[0126] FIG. 6A is a SEM image of a polymer sheet containing a
single polymer nano-scale post. All the rest of the nano-scale
posts are isolated in the nanowells of the substrate surface.
[0127] FIG. 6B is a cross-sectional view of a rapid separation of a
hydrogel sheet from a patterned substrate surface according to some
embodiments of the present application. In a specific embodiment, a
substrate 600B containing an underlying glass plate 601 and a
surface with patterned nanowells is deposited with a layer of
hydrogel composition. After dehydrating the hydrogel composition,
the formed hydrogel sheet 603 is rapidly separated from the surface
of the glass plate 601, resulting in the isolation of the patterned
hydrogel composition 604 in the nanowells of the substrate.
[0128] FIG. 6C is a cross-sectional view of a controlled separation
of a hydrogel sheet from a patterned substrate surface according to
some embodiments of the present application. Similar to the
embodiment shown in FIG. 6B, a substrate 600C containing an
underlying glass plate 601 and a surface with patterned nanowells
is deposited with a layer of hydrogel composition. After
dehydrating the hydrogel composition, the formed hydrogel sheet 605
is separated from the surface of the glass plate 601 with
controlled force, resulting in the retention of the patterned
structures 604 transferred from the substrate surface 602 to the
hydrogel sheet 605.
[0129] In some embodiments, the processes further include
laminating a second polymer layer directly on top of the patterned
surface after separating the first polymer layer.
[0130] In some embodiments, the second polymer layer includes a
second plurality of functional groups selected from vinyl,
acryloyl, alkenyl, alkynyl, C.sub.8-14 cycloalkenes, 8 to 14
membered heterocycloalkenes, C.sub.8-14 cycloalkynes, 8 to 14
membered heterocycloalkynes, nitrene, aldehyde, hydrazinyl,
glycidyl ether, epoxy, amino, carbene, isocyanate or maleimide, or
optionally substituted variants and combinations thereof. In some
further embodiments, the second plurality of functional groups are
selected from alkynyl, acryloyl, C.sub.8-14 cycloalkenes, alkynyl,
glycidyl ether, epoxy, or optionally substituted variants and
combinations thereof. In one embodiment, the second plurality of
functional groups comprises optionally substituted norbornene.
[0131] In some embodiments, the second polymer layer is first
treated with a functional silane or silane derivative before
lamination. The functional silane or silane derivatives provide
reactive sites on the surface of the second polymer sheet for
reaction with the polymer composition isolated in the patterned
surface of the substrate. In one embodiment, the surface is treated
with a norbornene silane, for example,
[(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane. Other
suitable silane derivatives that can be used in the present
application are described in U.S. Pub. No. 2015/0005447 A1, which
is hereby incorporated by reference in its entirety.
[0132] In some embodiments, the first plurality of functional
groups of the polymer composition react with the second plurality
of functional groups of the second polymer layer to form covalent
bonds. In some such embodiments, the polymer composition is
rehydrated before reacting with the second plurality of functional
groups.
[0133] In some such embodiments, the processes further include
separating the second polymer layer from the patterned surface
after covalent bonds are formed between the second polymer layer
and the first plurality of functional groups of the polymer
composition, resulting in the removal of the polymer composition
from the micro-scale or nano-scale patterned wells of the substrate
surface to form patterned polymer posts on the second polymer
layer. In some embodiments, the polymer composition is dehydrated
before separating from the patterned wells of the substrate surface
with the second polymer layer.
[0134] In some embodiments, the second polymer layer is flexible or
stretchable. In some such embodiments, the second polymer layer
comprises polydimethylsiloxane (PDMS), poly(methyl methacrylate)
(PMMA), polyacrylates, polyacrylic acids, polyurethanes,
polyethers, polycarbonates, polyvinyls, Kapton.RTM. polyimides, or
combinations and copolymers thereof.
[0135] In some embodiments, the processes further include grafting
oligonucleotides on the second polymer layer by reacting
functionalized oligonucleotides with the first plurality of
functional groups of the polymer sheet.
[0136] FIG. 7A is a cross-sectional view of a process of forming
hydrogel filled nanowells on a substrate surface according to some
embodiments of the present application. In a specific embodiment, a
substrate 700 containing an underlying glass plate 701 and a
surface with patterned nanowells is deposited with a layer of
hydrogel composition 703. After dehydrating the hydrogel
composition, the formed hydrogel sheet 704 is rapidly separated
from the surface of the glass plate 701, resulting in the isolation
of the patterned hydrogel composition 705 in the nanowells of the
substrate.
[0137] FIG. 7B is a cross-sectional view of a process of forming a
flexible sheet containing patterned hydrogel. First, a substrate
700B containing patterned hydrogel composition 705 isolated in the
patterned nanowells of a glass plate 701 formed according to the
process described in FIG. 7A is laminated with a flexible sheet 706
containing certain functional groups that are capable of reacting
with the hydrogel composition 705. After the rehydrating the
hydrogel composition 705, covalent bonds are formed between the
hydrogel composition 705 and the flexible sheet 706 through
reaction of the functional groups in the hydrogel composition and
the functional groups in the flexible sheet. After dehydrating the
hydrogel composition 705, a newly formed flexible sheet 707
containing covalently bonded patterned hydrogel 705 is peeled off
from the glass plate 701. In some embodiments, flexible sheet 705
is made from polymer materials such as cyclic olefin copolymer
(COC) or plastic.
[0138] Some embodiments described herein are related to a substrate
surface for sequencing applications prepared by the processes
described herein.
Roll-to-Roll and Belt Processes
[0139] Some further embodiments described herein are related to
automated roll-to-roll processes, for example, for sequencing
applications. This process may include spooling a roll of patterned
or unpatterned, polymer sheets prepared by the process described
herein. The polymer sheets can be prepared for sequencing reactions
by treatment with sequencing reagents and then sequencing a sample
on the treated polymer sheet. After treatment, the polymer sheet
can be respooled after the completion of one sequencing cycle.
[0140] In some embodiments, the polymer sheets that are used in a
roll to roll process are stretchable. Accordingly, the automated
processes can further include stretching the polymer sheet during
imaging in the sequencing cycle.
[0141] In some embodiments, the polymer sheet comprises
polydimethylsiloxane (PDMS), poly(methyl methacrylate) (PMMA),
polyacrylates, polyacrylic acids, polyurethanes, polyethers,
polycarbonates, polyvinyls, Kapton.RTM. polyimides, or combinations
and copolymers thereof.
[0142] FIG. 8 is a schematic view of an automated factory-scale
sequencing process using roll-to-roll flexible sheets patterned
with polymers or hydrogels compatible for sequencing-by-synthesis
(SBS) applications prepared by the process illustrated in FIGS. 7A
and 7B. In each sequencing cycle, the roll is fed through the
system through the various SBS reagent baths (e.g., incorporation,
rinse, deblock sequentially) and imaged by the read head on the
other side of the system and respooled. The roll is then fed though
the system in the opposite direction to commence the next cycle of
sequencing.
[0143] FIG. 9 illustrates the portion of an automated roll-to-roll
sequencing process depicted in FIG. 8 where the flexible patterned
sheet is stretched during imaging and retracted following imaging.
The use of these stretchable patterned sheets opens up the
possibility for preparing ultra-high density SBS arrays and then
imaging them using low-cost, low numerical aperture (NA) optics.
Patterning high density arrays with a small surface area foot print
results in the need for lower DNA input and reagent volumes. By
stretching this flexible sheet array, the array pitch is increased
and cross-talk between adjacent clusters is decreased, which enable
the use of low cost, low NA optics. To reduce image distortion,
these surfaces can be deformed to compensate for aberration. This
flexible, stretchable SBS surface can also be wrapped around the
imaging lens itself. Following imaging, the sheet is allowed to
retract and proceeds into the next cycle of SBS chemistry.
[0144] Some further embodiments described herein are related to
automated belt drive processes, for example, for sequencing
applications. This process may include driving a belt of patterned
or unpatterned, polymer sheets prepared by the process described
herein. The polymer sheets can be prepared for sequencing reactions
by treatment with sequencing reagents and then sequencing a sample
on the treated polymer sheet. The belt can make multiple passes
through a fluidic delivery and detection system such that each
passage constitutes one sequencing cycle. Methods for forming and
using belts for nucleic acid sequencing and other applications that
can be modified for us herein are set forth, for example, in US
Pat. App. Pub. No. 2011/0178285 A1, which is incorporated herein by
reference.
[0145] In any of the disclosed embodiments, the dehydration of the
polymer composition may cause the volume of the polymer composition
to decrease by over 20 times, over 15 times, over 10 times, over 5
times, or over 2 times, or a range defined by any two of the
preceding values.
[0146] In any of the disclosed embodiments of the flexible or
stretchable polymer sheets, the sheet may be stretched to about 20
times, about 17.5 times, about 15 times, about 12.5 times, about 10
times, about 7.5 times, about 5 times, about 2.5 times, about 2
times, or about 1.5 times of its original dimension or length, or a
range defined by any two of the preceding values.
[0147] In any of the disclosed embodiments, the micro-scale or
nano-scale patterns of the substrate surface may include channels,
trenches, wells, posts, or combinations thereof. In some
embodiments, at least a portion of the micro-scale or nano-scale
patterns are wells. In some such embodiments, the wells have an
average diameter of less than about 500 nm. In some instances, the
wells having an average diameter of less than about 500 nm are
called "nanowells." In some such embodiments, the wells have an
average diameter of about 330 nm or less including, for example,
less than about 300 nm, about 200 nm, about 100 nm, or about 50 nm,
or a range defined by any of the two preceding values. In some such
embodiments, the wells have an average height of less than about
500 nm. In some further embodiments, the wells have an average
height of about 300 nm or less including, for example, less than
about 300 nm, about 200 nm, about 100 nm, or about 50 nm, or a
range defined by any of the two preceding values. Alternatively or
additionally to the exemplary upper limits the average diameter
and/or average height of the wells can be at most about 1 mm, about
500 .mu.m, about 100 .mu.m, about 1 .mu.m, about 500 nm, about 400
nm, about 300 nm, about 200 nm or about 100 nm, or a range defined
by any of the two preceding values.
Substrates
[0148] In some embodiments, substrates used in the present
application include silica-based substrates, such as glass, fused
silica and other silica-containing materials. In some embodiments,
silica-based substrates can also be silicon, silicon dioxide,
silicon nitride, silicone hydrides. In some embodiments, substrates
used in the present application include plastic materials such as
polyethylene, polystyrene, poly(vinyl chloride), polypropylene,
nylons, polyesters, polycarbonates and poly(methyl methacrylate).
Preferred plastics materials are poly(methyl methacrylate),
polystyrene and cyclic olefin polymer substrates. In some
embodiments, the substrate is a silica-based material or plastic
material. In one embodiment, the substrate has at least one surface
comprising glass.
[0149] Acrylamide, enone, or acrylate may also be utilized as a
substrate material. Other substrate materials can include, but are
not limited to gallium aresnide, indium phosphide, aluminum,
ceramics, polyimide, quartz, resins, polymers and copolymers. The
foregoing lists are intended to be illustrative of, but not limited
to the present application.
[0150] In some embodiments, the substrate and/or the substrate
surface can be quartz. In some other embodiments, the substrate
and/or the substrate surface can be semiconductor, i.e. GaAs or
ITO.
[0151] Substrates can comprise a single material or a plurality of
different materials. Substrates can be composites or laminates.
Substrate can be flat, round, textured and patterned. Patterns can
be formed, for example, by metal pads that form features on
non-metallic surfaces, for example, as described in U.S. Pat. No.
8,778,849, which is incorporated herein by reference. Another
useful patterned surface is one having well features formed on a
surface, for example, as described in US Pat. App. Pub. No.
2014/0243224 A1, US Pat. App. Pub. No. 2011/0172118 A1 or U.S. Pat.
No. 7,622,294, each of which is incorporated herein by reference.
For embodiments that use a patterned substrate, a gel can be
selectively attached to the pattern features (e.g. gel can be
attached to metal pads or gel can be attached to the interior of
wells) or alternatively the gel can be uniformly attached across
both the pattern features and the interstitial regions.
[0152] Advantages in using plastics-based substrates in the
preparation and use of molecular arrays include cost: the
preparation of appropriate plastics-based substrates by, for
example injection-molding, is generally less expensive than the
preparation, e.g. by etching and bonding, of silica-based
substrates. Another advantage is the nearly limitless variety of
plastics allowing fine-tuning of the optical properties of the
support to suit the application for which it is intended or to
which it may be put.
[0153] Where metals are used as substrates or as pads on a
substrate, this may be because of the desired application: the
conductivity of metals can allow modulation of the electric field
in DNA-based sensors. In this way, DNA mismatch discrimination may
be enhanced, the orientation of immobilized oligonucleotide
molecules can be affected, or DNA hybridization kinetics can be
accelerated.
[0154] The substrate may be silica-based. In addition, the form and
shape of the substrate employed may be varied in accordance with
the application for which the present application is practiced.
Generally, however, slides of support material, such as silica,
e.g. fused silica, are of particular utility in the preparation and
subsequent integration of molecules. Of particular use in the
practice of the present application are fused silica slides sold
under the trade name SPECTRASIL.TM.. This notwithstanding, it will
be evident to the skilled person that the present application is
equally applicable to other presentations of substrate (including
silica-based supports), such as beads, rods and the like.
[0155] In some embodiments, the surface of the substrate comprises
both functional molecules-coated regions and inert regions with no
coatings. In some instances, the functionalized molecule coatings
include hydrogel or polymer sheets described herein. The functional
molecules-coated regions can comprise reactive sites, and thus, can
be used to attach molecules through chemical bonding or other
molecular interactions. In some embodiments, the functional
molecules-coated regions (e.g. reactive features, pads, beads or
wells) and the inert regions (referred to as interstitial regions)
can alternate so as to form a pattern or a grid. Such patterns can
be in one or two dimensions. In some embodiments, the inert regions
can be selected from glass regions, metal regions, mask regions or
interstitial regions. Alternatively these materials can form
reactive regions. Inertness or reactivity will depend on the
chemistry and processes used on the substrate. In one embodiment,
the surface comprises glass regions. In another embodiment, the
surface comprises metal regions. In still another embodiment, the
surface comprises mask regions. Non-limiting exemplary substrate
materials that can be coated with a polymer of the present
disclosure or that can otherwise be used in a composition or method
set forth herein are described in U.S. Ser. Nos. 13/492,661 and
13/661,524, each of which is incorporated herein by reference.
[0156] In some embodiments, a substrate described herein forms at
least part of a flow cell or is located in a flow cell. In some
such embodiments, the flow cells further comprise polynucleotides
attached to the surface of the substrate via the functional
molecules coating, for example, a polymer coating. In some
instances, the polymer coating is a polymer sheet described herein.
In some embodiments, the polynucleotides are present in the flow
cells in polynucleotide clusters, wherein the polynucleotides of
the polynucleotide clusters are attached to a surface of the flow
cell via the polymer coating or the polymer sheet described herein.
In such embodiments, the surface of the flow cell body to which the
polynucleotides are attached is considered the substrate. In other
embodiments, a separate substrate having a polymer coated surface
is inserted into the body of the flow cell. In preferred
embodiments, the flow cell is a flow chamber that is divided into a
plurality of lanes or a plurality of sectors, wherein one or more
of the plurality of lanes or plurality of sectors comprises a
surface that is coated with a covalently attached polymer sheet
described herein. In some embodiments of the flow cells described
herein, the attached polynucleotides within a single polynucleotide
cluster have the same or similar nucleotide sequence. In some
embodiments of the flow cells described herein, the attached
polynucleotides of different polynucleotide clusters have different
or nonsimilar nucleotide sequences. Exemplary flow cells and
substrates for manufacture of flow cells that can be used in method
or composition set forth herein include, but are not limited to,
those commercially available from Illumina, Inc. (San Diego,
Calif.) or described in U.S. Pat. App. Pub. Nos. 2010/0111768 A1 or
2012/0270305 A1, each of which is incorporated herein by
reference.
[0157] In some embodiments, the substrates used in the present
application are silica-based substrates. In general, a silica-based
substrate surface can be chemically modified in some way so as to
attach covalently a chemically reactive group capable of reacting
with the functionalized molecules, for example, hydrogel, polymer
or a partially formed hydrogel (e.g. a prepolymer (PRP)). The
surface-activating agent is typically an organosilane compound. In
one embodiment, the surface-activating agent is
.gamma.-methacryloxypropyltrimethoxysilane, known as "Bind Silane"
or "Crosslink Silane" and commercially available from Pharmacia,
although other silicon-based surface-activating agents are also
known, such as monoethoxydimethylsilylbutanal,
3-mercaptopropyl-trimethoxysilane and 3-aminopropyltrimethoxysilane
(all available from Aldrich). In this way, pendant functional
groups such as amino groups, aldehydro groups or polymerizable
groups (e.g. olefins) may be attached to the silica.
[0158] In any embodiments described herein, the substrate may be
selected from a glass substrate, a silica substrate, a quartz
substrate, a plastic substrate, a metal substrate, a metal oxide
substrate, or combinations thereof. In some embodiments, the
substrate is a glass substrate. In one embodiment, the substrate is
part of a flow cell or housed within a flow cell.
Nucleic Acid Analysis Applications
[0159] Many different DNA amplification techniques can be used in
conjunction with the flow cells described herein. Exemplary
techniques that can be used include, but are not limited to,
polymerase chain reaction (PCR), rolling circle amplification
(RCA), multiple displacement amplification (MDA), or random prime
amplification (RPA). In particular embodiments, one or more primers
used for amplification can be attached to a polymer coating. In PCR
embodiments, one or both of the primers used for amplification can
be attached to a polymer coating. Formats that utilize two species
of attached primer are often referred to as bridge amplification
because double stranded amplicons form a bridge-like structure
between the two attached primers that flank the template sequence
that has been copied. Exemplary reagents and conditions that can be
used for bridge amplification are described, for example, in U.S.
Pat. No. 5,641,658; U.S. Patent Publ. No. 2002/0055100; U.S. Pat.
No. 7,115,400; U.S. Patent Publ. No. 2004/0096853; U.S. Patent
Publ. No. 2004/0002090; U.S. Patent Publ. No. 2007/0128624; and
U.S. Patent Publ. No. 2008/0009420, each of which is incorporated
herein by reference. PCR amplification can also be carried out with
one of the amplification primers attached to a polymer coating and
the second primer in solution. An exemplary format that uses a
combination of one attached primer and soluble primer is emulsion
PCR as described, for example, in Dressman et al., Proc. Natl.
Acad. Sci. USA 100:8817-8822 (2003), WO 05/010145, or U.S. Patent
Publ. Nos. 2005/0130173 or 2005/0064460, each of which is
incorporated herein by reference. Emulsion PCR is illustrative of
the format and it will be understood that for purposes of the
methods set forth herein the use of an emulsion is optional and
indeed for several embodiments an emulsion is not used.
Furthermore, primers need not be attached directly to substrate or
solid supports as set forth in the ePCR references and can instead
be attached to a polymer coating as set forth herein.
[0160] RCA techniques can be modified for use in a method of the
present disclosure. Exemplary components that can be used in an RCA
reaction and principles by which RCA produces amplicons are
described, for example, in Lizardi et al., Nat. Genet. 19:225-232
(1998) and US 2007/0099208 A1, each of which is incorporated herein
by reference. Primers used for RCA can be in solution or attached
to a polymer coating.
[0161] MDA techniques can be modified for use in a method of the
present disclosure. Some basic principles and useful conditions for
MDA are described, for example, in Dean et al., Proc Natl. Acad.
Sci. USA 99:5261-66 (2002); Lage et al., Genome Research 13:294-307
(2003); Walker et al., Molecular Methods for Virus Detection,
Academic Press, Inc., 1995; Walker et al., Nucl. Acids Res.
20:1691-96 (1992); U.S. Pat. No. 5,455,166; U.S. Pat. No.
5,130,238; and U.S. Pat. No. 6,214,587, each of which is
incorporated herein by reference. Primers used for MDA can be in
solution or attached to a polymer coating.
[0162] In particular embodiments a combination of the
above-exemplified amplification techniques can be used. For
example, RCA and MDA can be used in a combination wherein RCA is
used to generate a concatameric amplicon in solution (e.g. using
solution-phase primers). The amplicon can then be used as a
template for MDA using primers that are attached to a polymer
coating. In this example, amplicons produced after the combined RCA
and MDA steps will be attached to the polymer coating.
[0163] In some embodiments, the functionalized hydrogel or polymer
sheet coated substrate described herein can be used for determining
a nucleotide sequence of a polynucleotide. In such embodiments, the
method may include the steps of (a) contacting a polynucleotide
polymerase with polynucleotide clusters attached to a surface of a
substrate via any one of the polymer or hydrogel coatings described
herein; (b) providing nucleotides to the polymer-coated surface of
the substrate such that a detectable signal is generated when one
or more nucleotides are utilized by the polynucleotide polymerase;
(c) detecting signals at one or more polynucleotide clusters; and
(d) repeating steps (b) and (c), thereby determining a nucleotide
sequence of a polynucleotide present at the one or more
polynucleotide clusters.
[0164] Nucleic acid sequencing can be used to determine a
nucleotide sequence of a polynucleotide by various processes known
in the art. In a preferred method, sequencing-by-synthesis (SBS) is
utilized to determine a nucleotide sequence of a polynucleotide
attached to a surface of a substrate via any one of the polymer
coatings described herein. In such process, one or more nucleotides
are provided to a template polynucleotide that is associated with a
polynucleotide polymerase. The polynucleotide polymerase
incorporates the one or more nucleotides into a newly synthesized
nucleic acid strand that is complementary to the polynucleotide
template. The synthesis is initiated from an oligonucleotide primer
that is complementary to a portion of the template polynucleotide
or to a portion of a universal or non-variable nucleic acid that is
covalently bound at one end of the template polynucleotide. As
nucleotides are incorporated against the template polynucleotide, a
detectable signal is generated that allows for the determination of
which nucleotide has been incorporated during each step of the
sequencing process. In this way, the sequence of a nucleic acid
complementary to at least a portion of the template polynucleotide
can be generated, thereby permitting determination of the
nucleotide sequence of at least a portion of the template
polynucleotide.
[0165] Flow cells provide a convenient format for housing an array
that is produced by the methods of the present disclosure and that
is subjected to a sequencing-by-synthesis (SBS) or other detection
technique that involves repeated delivery of reagents in cycles.
For example, to initiate a first SBS cycle, one or more labeled
nucleotides, DNA polymerase, etc., can be flowed into/through a
flow cell that houses a nucleic acid array made by methods set
forth herein. Those sites of an array where primer extension causes
a labeled nucleotide to be incorporated can be detected.
Optionally, the nucleotides can further include a reversible
termination property that terminates further primer extension once
a nucleotide has been added to a primer. For example, a nucleotide
analog having a reversible terminator moiety can be added to a
primer such that subsequent extension cannot occur until a
deblocking agent is delivered to remove the moiety. Thus, for
embodiments that use reversible termination, a deblocking reagent
can be delivered to the flow cell (before or after detection
occurs). Washes can be carried out between the various delivery
steps. The cycle can then be repeated n times to extend the primer
by n nucleotides, thereby detecting a sequence of length n.
Exemplary SBS procedures, fluidic systems and detection platforms
that can be readily adapted for use with an array produced by the
methods of the present disclosure are described, for example, in
Bentley et al., Nature 456:53-59 (2008), WO 04/018497; U.S. Pat.
No. 7,057,026; WO 91/06678; WO 07/123744; U.S. Pat. No. 7,329,492;
U.S. Pat. No. 7,211,414; U.S. Pat. No. 7,315,019; U.S. Pat. No.
7,405,281, and US 2008/0108082, each of which is incorporated
herein by reference in its entirety. In particular embodiments,
similar methods to those exemplified above for a flow cell can be
carried out using a polymer sheet in place of a flow cell. For
example, the polymer sheet can be provided in a roll to roll or
belt format to allow repeated delivery of reagents to the surface
of the polymer sheet akin to the repeated delivery of reagents to a
flow cell. It will be understood that in some embodiments a polymer
sheet of the present disclosure can be present in a flow cell for
all or part of a sequencing process.
[0166] Other sequencing procedures that use cyclic reactions can
employ a polymer sheet, substrate or other composition set forth
herein, such as pyrosequencing. Pyrosequencing detects the release
of inorganic pyrophosphate (PPi) as particular nucleotides are
incorporated into a nascent nucleic acid strand (Ronaghi, et al.,
Analytical Biochemistry 242(1), 84-9 (1996); Ronaghi, Genome Res.
11(1), 3-11 (2001); Ronaghi et al. Science 281(5375), 363 (1998);
U.S. Pat. No. 6,210,891; U.S. Pat. No. 6,258,568 and U.S. Pat. No.
6,274,320, each of which is incorporated herein by reference in its
entirety). In pyrosequencing, released PPi can be detected by being
immediately converted to adenosine triphosphate (ATP) by ATP
sulfurylase, and the level of ATP generated can be detected via
luciferase-produced photons. Thus, the sequencing reaction can be
monitored via a luminescence detection system. Excitation radiation
sources used for fluorescence based detection systems are not
necessary for pyrosequencing procedures. Useful fluidic systems,
detectors and procedures that can be used for application of
pyrosequencing to arrays of the present disclosure are described,
for example, in WO 12/058096 A1, US 2005/0191698 A1, U.S. Pat. No.
7,595,883, and U.S. Pat. No. 7,244,559, each of which is
incorporated herein by reference in its entirety.
[0167] Sequencing-by-ligation reactions can also be usefully
carried out on a polymer sheet, substrate or other composition set
forth herein including, for example, those described in Shendure et
al. Science 309:1728-1732 (2005); U.S. Pat. No. 5,599,675; and U.S.
Pat. No. 5,750,341, each of which is incorporated herein by
reference in its entirety. Some embodiments can include
sequencing-by-hybridization procedures as described, for example,
in Bains et al., Journal of Theoretical Biology 135(3), 303-7
(1988); Drmanac et al., Nature Biotechnology 16, 54-58 (1998);
Fodor et al., Science 251(4995), 767-773 (1995); and WO 1989/10977,
each of which is incorporated herein by reference in its entirety.
In both sequencing-by-ligation and sequencing-by-hybridization
procedures, nucleic acids that are present at sites of an array are
subjected to repeated cycles of oligonucleotide delivery and
detection. Fluidic systems for SBS methods as set forth herein or
in references cited herein can be readily adapted for delivery of
reagents for sequencing-by-ligation or sequencing-by-hybridization
procedures. Typically, the oligonucleotides are fluorescently
labeled and can be detected using fluorescence detectors similar to
those described with regard to SBS procedures herein or in
references cited herein.
[0168] Some embodiments that employ a composition set forth herein
can utilize methods involving the real-time monitoring of DNA
polymerase activity. For example, nucleotide incorporations can be
detected through fluorescence resonance energy transfer (FRET)
interactions between a fluorophore-bearing polymerase and
.gamma.-phosphate-labeled nucleotides, or with zeromode waveguides
(ZMWs). Techniques and reagents for FRET-based sequencing are
described, for example, in Levene et al. Science 299, 682-686
(2003); Lundquist et al. Opt. Lett. 33, 1026-1028 (2008); Korlach
et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), the
disclosures of which are incorporated herein by reference in its
entirety.
[0169] Some SBS embodiments include detection of a proton released
upon incorporation of a nucleotide into an extension product. For
example, sequencing based on detection of released protons can use
an electrical detector and associated techniques that are
commercially available from Ion Torrent (Guilford, Conn., a Life
Technologies subsidiary) or sequencing methods and systems
described in US 2009/0026082 A1; US 2009/0127589 A1; US
2010/0137143 A1; or US 2010/0282617 A1, each of which is
incorporated herein by reference in its entirety. Nucleic acids can
be attached to a polymer sheet, substrate or other composition set
forth herein for detection in such a system or method.
[0170] Another useful application for a composition of the present
disclosure is, for example, part of gene expression analysis. Gene
expression can be detected or quantified using RNA sequencing
techniques, such as those, referred to as digital RNA sequencing.
RNA sequencing techniques can be carried out using sequencing
methodologies known in the art such as those set forth above. Gene
expression can also be detected or quantified using hybridization
techniques carried out by direct hybridization to a polymer sheet,
substrate or other composition set forth herein or using a
multiplex assay, the products of which are detected on a polymer
sheet, substrate or other composition set forth herein. A
composition of the present disclosure, for example, having been
produced by a method set forth herein, can also be used to
determine genotypes for a genomic DNA sample from one or more
individual. Exemplary methods for array-based expression and
genotyping analysis that can be carried out on an array of the
present disclosure are described in U.S. Pat. Nos. 7,582,420;
6,890,741; 6,913,884 or 6,355,431 or U.S. Pat. Pub. Nos.
2005/0053980 A1; 2009/0186349 A1 or US 2005/0181440 A1, each of
which is incorporated herein by reference in its entirety.
[0171] In some embodiments of the above-described method, which
employ a polymer sheet, substrate or other composition set forth
herein, only a single type of nucleotide is present in the flow
cell during a single flow step. In such embodiments, the nucleotide
can be selected from the group consisting of dATP, dCTP, dGTP, dTTP
and analogs thereof. In other embodiments of the above-described
method which employ a flow cell, a plurality different types of
nucleotides are present in the flow cell during a single flow step.
In such methods, the nucleotides can be selected from dATP, dCTP,
dGTP, dTTP and analogs thereof.
[0172] Determination of the nucleotide or nucleotides incorporated
during each flow step for one or more of the polynucleotides
attached to the polymer coating on the surface of the substrate
present in the flow cell is achieved by detecting a signal produced
at or near the polynucleotide template. In some embodiments of the
above-described methods, the detectable signal comprises and
optical signal. In other embodiments, the detectable signal
comprises a non-optical signal. In such embodiments, the
non-optical signal comprises a change in pH at or near one or more
of the polynucleotide templates.
[0173] In any of the embodiments of the sequencing methods
described herein, the polymer coating may include the hydrogel or
polymer sheets disclosed herein.
Sequence CWU 1
1
4129DNAArtificial SequencePaired end primer sequence 1aatgatacgg
cgaccaccga gauctacac 29224DNAArtificial SequencePaired end primer
sequence 2caagcagaag acggcatacg agat 24320DNAArtificial
SequenceSingle read primer sequence 3aatgatacgg cgaccaccga
20421DNAArtificial SequenceSingle read primer sequence 4caagcagaag
acggcatacg a 21
* * * * *