U.S. patent application number 15/809234 was filed with the patent office on 2018-07-19 for compounds and methods for modulating target nuclear and sub-nuclear nucleic acid molecules in cells and animals.
This patent application is currently assigned to Ionis Pharmaceuticals, Inc.. The applicant listed for this patent is Ionis Pharmaceuticals, Inc.. Invention is credited to Stanley T. Crooke, Xue-hai Liang.
Application Number | 20180201930 15/809234 |
Document ID | / |
Family ID | 45723723 |
Filed Date | 2018-07-19 |
United States Patent
Application |
20180201930 |
Kind Code |
A1 |
Liang; Xue-hai ; et
al. |
July 19, 2018 |
COMPOUNDS AND METHODS FOR MODULATING TARGET NUCLEAR AND SUB-NUCLEAR
NUCLEIC ACID MOLECULES IN CELLS AND ANIMALS
Abstract
The present invention provides compounds and methods for
modulating target nucleic acids found in organelles or
sub-organelles of cells. The invention includes, but is not limited
to compounds and methods that modulate target nucleic acids in a
sub-nuclear organelle, such as the nucleolus and/or a cajal body.
In certain embodiments, the cell is in an animal.
Inventors: |
Liang; Xue-hai; (Del Mar,
CA) ; Crooke; Stanley T.; (Carlsbad, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Ionis Pharmaceuticals, Inc. |
Carlsbad |
CA |
US |
|
|
Assignee: |
Ionis Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
45723723 |
Appl. No.: |
15/809234 |
Filed: |
November 10, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15061861 |
Mar 4, 2016 |
9845468 |
|
|
15809234 |
|
|
|
|
13811248 |
Sep 17, 2013 |
|
|
|
PCT/US2011/044567 |
Jul 19, 2011 |
|
|
|
15061861 |
|
|
|
|
61365765 |
Jul 19, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 2310/3231 20130101;
C12N 2310/3521 20130101; C12N 2310/322 20130101; C12N 2310/3533
20130101; C12N 2310/351 20130101; C12N 2310/11 20130101; C12N
2310/341 20130101; C12N 2320/30 20130101; C12N 2310/3525 20130101;
C12N 2310/321 20130101; C12N 15/113 20130101; C12N 2310/315
20130101 |
International
Class: |
C12N 15/113 20100101
C12N015/113 |
Claims
1. A method of reducing the amount or activity of a target snoRNA
in a cell in an animal comprising administering to the animal a
pharmaceutical composition comprising a single-stranded antisense
compound comprising a modified oligonucleotide complementary to
accessible nucleotides of the target snoRNA; and thereby reducing
the amount or activity of the target snoRNA in the cell in the
animal; wherein the modified oligonucleotide consists of 10 to 30
linked nucleosides, wherein the modified oligonucleotide comprises:
a 5'-region consisting of 1 to 7 modified, linked nucleosides; a
3'-region consisting of 1 to 7 modified, linked nucleosides; and a
central region consisting of 5 to 28 linked
2'-deoxyribonucleosides; and wherein the animal is a mammal.
2. The method of claim 1, wherein the modified oligonucleotide
consists of 14 to 23 linked nucleosides, and the central region
consists of 7 to 11 linked 2'-deoxyribonucleosides.
3. The method of claim 2, wherein at least one modified nucleoside
comprises a modified sugar moiety selected from among: 2'-MOE,
2'-OMe, 2'-F, and a BNA.
4. The method of claim 3, wherein the BNA is selected from LNA,
ENA, and cEt.
5. The method of claim 2, wherein the modified oligonucleotide
comprises one or more modified internucleoside linkages.
6. The method of claim 2, wherein the antisense compound comprises
a conjugate group.
7. The method of claim 2, wherein the target snoRNA derives from a
host RNA.
8. The method of claim 7, wherein the amount and activity of the
host RNA are essentially unchanged.
9. The method of claim 2, wherein the target snoRNA is a C/D box
snoRNA or an H/ACA box snoRNA.
10. The method of claim 9, wherein the target snoRNA is a C/D box
snoRNA.
11. The method of claim 9, wherein the target snoRNA is an H/ACA
box snoRNA.
12. The method claim 5, wherein the one or more modified
internucleoside linkages is a phosphorothioate internucleoside
linkage.
13. The method claim 12, wherein each internucleoside linkage of
the modified oligonucleotide is a phosphorothioate internucleoside
linkage.
14. The method claim 2, wherein the accessible nucleotides of the
target snoRNA are accessible to dimethylsulphate in vitro.
15. The method claim 2, wherein the modified oligonucleotide is at
least 90% complementary to the accessible nucleotides of the target
snoRNA.
16. The method claim 2, wherein the modified oligonucleotide is
100% complementary to the accessible nucleotides of the target
snoRNA.
17. The method of claim 2, wherein each modified nucleoside
comprises a modified sugar moiety independently selected from
among: 2'-MOE, 2'-OMe, 2'-F, and a BNA.
18. The method of claim 2, wherein the animal is a human.
19. The method of claim 2, wherein the pharmaceutical composition
is administered systemically.
20. The method of claim 2, wherein the pharmaceutical composition
is administered by subcutaneous injection.
Description
SEQUENCE LISTING
[0001] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CORE0093USC3SEQ_ST25.txt, created on October 18, 2017
and is 32 Kb in size. The information in the electronic format of
the sequence listing is incorporated herein by reference in its
entirety.
BACKGROUND
[0002] Antisense compounds have been shown to be effective for
modulating the amount, activity, and/or function of cellular target
nucleic acids. Certain chemical modifications have been
incorporated into antisense oligonucleotides to enhance one or more
properties of such antisense compounds. In certain instances, such
chemically modified oligonucleotides have been shown to possess
desirable characteristics compared to unmodified oligonucleotides,
such as improved affinity for target and/or resistance to
degradation. Chemically modified antisense oligonucleotides have
been shown to have value as research tools, diagnostic reagents,
and therapeutic agents, depending on the target nucleic acid and
chemical modifications.
[0003] Certain nucleic acid molecules have been shown to localize
to cellular sub-organelles. Certain such nucleic acid molecules are
RNA molecules, including non-coding RNA molecules. For example,
small nucleolar RNA molecules (snoRNA) localize to the nucleolus
inside the nucleus of eukaryotic cells. In certain instances, such
snoRNA have been shown to be associated with precursors of
ribosomal RNA (rRNA). Accordingly, certain snoRNAs have been
reported to be involved in nucleotide modification and processing
of pre-rRNA. Nucleic acids have also been found in Cajal bodies
within the nucleus. RNA found in Cajal bodies have been referred to
as small Cajal body-specific RNA (scaRNA). Certain scaRNA have been
reported to be involved in nucleotide modification of spliceosomal
small nuclear RNAs (snRNAs).
[0004] Certain ncRNAs, including miRNAs and snoRNAs, are involved
in biological processes, such as DNA and RNA production, and
translation. However, functionalizing individual ncRNAs has lagged
in time, mainly due to lack of convenient knockout or knockdown
approaches in mammals. This is especially the case for ncRNAs that
localize to cellular sub-organelles, such as snoRNAs and
scaRNAs.
SUMMARY OF THE INVENTION
[0005] In certain embodiments, the invention provides methods of
reducing the amount and/or activity of a target sub-nuclear RNA in
a cell comprising contacting the cell with a modified antisense
compound complementary to the target sub-nuclear RNA, wherein the
contacting does not include electroporation; and thereby reducing
the amount or activity of the target sub-nuclear RNA in the cell.
In certain such methods, the modified antisense compound is an
oligomeric compound comprising an oligonucleotide consisting of 10
to 30 linked nucleosides, wherein the oligonucleotide comprises: a
5'-region consisting of 1 to 7 modified nucleosides; a 3'-region
consisting of 1 to 7 modified nucleosides; and a central region
consisting of 5 to 28 deoxyribonucleosides or DNA-like nucleosides.
In certain embodiments, each modified nucleoside of the 5'-region
and each modified nucleoside of the 3'region comprises a modified
sugar moiety. In certain embodiments, the modification of at least
one modified sugar moiety is selected from among: 2'-MOE, 2'-OMe,
2'-F, and a bicyclic sugar moiety.
[0006] In certain such methods, the target sub-nuclear RNA is a
snoRNA. In certain methods, the target sub-nuclear RNA is a scaRNA.
In certain embodiments, the target sub-nuclear RNA derives from a
host RNA. In certain such embodiments, the amount and activity of
the host RNA are essentially unchanged.
[0007] In certain embodiments, the invention provides methods,
wherein a reduced activity of a target sub-nuclear RNA results in a
change in the processing of at least one object RNA. In certain
embodiments, the processing of at least one object RNA comprises a
modulation of methylation of at least one object RNA. In certain
embodiments, at least one object RNA is a ribosomal RNA. In certain
embodiments, at least one object RNA is an mRNA.
[0008] In certain embodiments, the cell is a cancer cell. In
certain embodiments, modulation of the sub-nuclear nucleic acid
results in a reduction of cell viability and/or a change in cell
cycling. In certain such embodiments the result is a delay in
progression to S-phase.
[0009] In certain embodiments, the cell is in vitro. In certain
embodiments, the cell is in an animal, including, but not limited
to, a human.
[0010] In certain embodiments, such methods are used for
functionalizing the target sub-nuclear RNA.
[0011] In certain embodiments, the present invention provides a
pharmaceutical composition comprising a modified antisense compound
complementary to a target sub-nuclear RNA and at least one diluent
or carrier.
[0012] In certain embodiments, the modified antisense compound is
an oligomeric compound comprising an oligonucleotide consisting of
10 to 30 linked nucleosides, wherein the oligonucleotide comprises:
a 5'-region consisting of 1 to 7 modified nucleosides; a 3'-region
consisting of 1 to 7 modified nucleosides; and a central region
consisting of 5 to 28 deoxyribonucleosides, or DNA-like
nucleosides.
[0013] In certain embodiments, the invention provides methods of
administering such a pharmaceutical composition to an animal,
including, but not limited to a human. The pharmaceutical
composition may be administered systemically, for example by
injection, for example, sub-cutaneous injection.
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIG. 1 shows composition of the 5-10-5 RNA-DNA chimeric ASOs
described in Example 1. All nucleotides are linked by
phosphorothioate backbone (PS). "R" and "d" mean ribonucleoside and
deoxyribonucleoside, respectively. "m" means 2'-O-methyloxylethyl
nucleoside (MOE).
[0015] FIG. 2 shows active ASOs described in Example 1.
UTC=untreated cells. Lower panel shows U16 snoRNA regions targeted
by the ASOs. The gray box indicates coding region of the snoRNA,
whereas the white boxes represent the junctions between the coding
region and flanking sequences. The thin line indicates flanking
sequences.
[0016] FIG. 3 shows structures for probing U16 snoRNA described in
Example 1. The nucleotides accessible to DMS are identified.
[0017] FIG. 4 shows a proposed secondary structure of U16 snoRNA
described in Example 1. The structure was folded using program
mFold, and refined based on the probing data in FIG. 3. The
accessible nts are marked with arrowheads. The C and D motifs are
boxed. The nucleotides complementary to rRNA for guiding
modification are circled. The sequences complementary to the active
ASOs (462025 and 462026) are marked by lines.
[0018] FIG. 5 shows results of an assay with DNA oligonucleotide
described in Example 2
[0019] FIG. 6 shows results of an assay with siRNA, described in
Example 2
[0020] FIG. 7 shows results of an assay with uniform 2'MOE and
gapmers described in Example 3
[0021] FIG. 8 shows results of a time-dependent assay described in
Example 4
[0022] FIGS. 9 and 10 show results of an assay with various
transfection reagents described in Example 5
[0023] FIG. 11 shows results of an assay using various cell lines
described in Example 6
[0024] FIG. 12 shows results of a methylation assay described in
Example 7. The targeted Am484 is indicated with an arrow and an
adjacent modification (Am468) is marked with an arrowhead.
[0025] FIG. 13 shows results of an assay on Hela cells described in
Example 7.
[0026] FIG. 14 shows results of A484 methylation assay described in
Example 7.
[0027] FIG. 15 provides a schematic depiction of the U16 snoRNA
gene locus discussed in Example 8. The partial host pre-mRNA (RPL4)
is shown. The gray boxes indicate intronic snoRNAs (U16 and three
isoforms of U18 snoRNA) in the host gene. E2-E7, exons of RPL4
pre-mRNA.
[0028] FIG. 16 shows results of the northern hybridization assay
described in Example 8.
[0029] FIG. 17 shows Western blot analysis of an assay described in
Example 8.
[0030] FIG. 18 shows the sequence of U80 snoRNA, as described in
Example 9. The C and D motifs are boxed, and the sequence involved
in guiding rRNA modification is underlined. The targeted positions
of ASOs are indicated. The active ASO is marked by a thick
line.
[0031] FIG. 19 shows the sequence of U81 snoRNA, described in
Example 9.
[0032] FIG. 20 shows gene organization of U80 and U81 snoRNAs in
the introns of GAS5 gene, as described in Example 9. A partial map
of the precursor is shown. Gray boxes indicate the intronic
snoRNAs. The E9-E12 exons of GAS5 gene are shown in open boxes.
[0033] FIG. 21 shows results of an assay with Hela cells described
in Example 9.
[0034] FIG. 22 shows results of an assay with Hela cells probed for
U81 snoRNA described in Example 9.
[0035] FIG. 23 shows Northern hybridization for U80 snoRNA in Hela
cells, as described in Example 9.
[0036] FIG. 24 shows results of an assay for U81 snoRNA by
U81-specific ASOs described in Example 9.
[0037] FIG. 25 shows results of a depletion assay of U80 snoRNA and
effect on the level of methylation at the predicted site in 28S
rRNA (G1612) described in Example 10. A neighboring methylation
site is marked with an arrowhead. The methylation level of A391
guided by U81 snoRNA was not affected by depletion of U80 snoRNA,
as determined by primer extension using a different primer (lower
panel).
[0038] FIG. 26 shows results of a depletion assay of U81 snoRNA and
its effect on its function in guiding methylation at site A391 of
28S rRNA, as described in Example 10.
[0039] FIG. 27 shows U50 snoRNA is present in an intron of SNHG5
non-protein coding gene, as described in Example 11. A U50 snoRNA
isoform (U50B) is embedded in a second intron.
[0040] FIG. 28 shows a sequence comparison of U50 and U50B snoRNA,
as described in Example 10.
[0041] FIG. 29 shows results of a Northern hybridization of U50 10
and U50B snoRNAs described in Example 11.
[0042] FIG. 30 compares the sequence of ASO477499 to U50 and U50B
snoRNA, as described in Example 11. The snoRNA sequences are in
bold. The ribonucleotides in the chimeric ASOs are shown in upper
case and DNA nucleotides in lower case.
[0043] FIG. 31 shows ASOs targeting U50 snoRNA, as described in
Example 11. The C and D motifs are boxed. The sequences involved in
guiding rRNA modification are underlined. The positions of active
ASOs are indicated with thick lines.
[0044] FIG. 32 shows results of an assay for U50 (ASO477499) or its
isoform U50B snoRNA (ASO485259) described in Example 11.
[0045] FIG. 33 shows results from an assay for depletion of U50 or
U50B snoRNA and its effect on the methylation guided by this RNA
described in Example 12. The targeted modification site is
indicated, and a neighboring potential modification site is marked
with an arrowhead.
[0046] FIG. 34 provides a schematic representation of partial
pre-mRNA of Nucleolin gene. The intronic snoRNAs U23 (H/ACA type)
and U20 (C/D type) are shown in gray boxes.
[0047] FIG. 35 shows positions of ASOs in U23 snoRNA. The H
(AnAnnA) and ACA motifs are shown in gray boxes. The active ASOs
identified in panel b are indicated by thick lines and the names
are in bold.
[0048] FIG. 36 shows results from a Northern hybridization of U23
snoRNA, as described in Example 13.
[0049] FIG. 37 shows the positions of two active ASOs in the
secondary structure of U23 snoRNA. indicated by lines. The snoRNA
structure was predicted using program MFold. The snoRNA sequences
involved in guiding modification are shown in bold.
[0050] FIG. 38 shows results from a Northern hybridization for U23
snoRNA in cells treated [(-)U23] or not treated (UTC) with 50 nM of
a lead ASO targeting this snoRNA (ASO483788). U16 snoRNA was
detected and served as a loading control.
[0051] FIG. 39 shows that the protein level of Nucleolin was not
affected by the U23 ASO, as determined by western analysis. RPL4
protein was also probed and served as a loading control.
[0052] FIG. 40 shows depletion of U23 H/ACA snoRNA impaired its
function in guiding pseudouridylation at site U93 of 18S rRNA.
Total RNA from test cells was treated with
N-cyclohexyl-N'-(2-morpholinoethyl)-carbodiimide
methyl-p-toluolsulfonate (CMC), and subjected to primer extension
analysis using a 5' end-labeled primer specific to U93 region of
18S rRNA. CMC treatment causes extension to stop one nucleotide
before the pseudouridine sites. Extension products were separated
in an 8% polyacrylamide gel, next to primer extension sequencing
reactions preformed with the same primer. The targeted
pseudouridylation site (.PSI.93) is indicated. Two other
pseudouridines (.PSI.34 and .PSI.36) in 18S rRNA are marked with
arrowheads.
[0053] FIG. 41 shows a co-depletion assay described in Example
16.
[0054] FIG. 42 shows targeted positions of ASOs in ACA45 snoRNA.
The H and ACA motifs are boxed. The active ASOs are indicated with
thick lines and named with bold letters.
[0055] FIG. 43 shows Northern hybridization of ACA45 RNA, as
described in Example 17.
[0056] FIG. 44 shows the secondary structure of ACA45 RNA predicted
using program MFold. The H and ACA motifs are boxed. The targeted
positions of lead ASOs are marked by lines. The sequences predicted
to guide U2 snRNA modification are shown in bold.
[0057] FIG. 45 shows that A H/ACA type of scaRNA can also be
degraded by ASOs. Hela cells were treated for 48 hours with two
different ASOs targeting ACA45 scaRNA [462037 for (-)ACA45-1 and
462038 for (-)ACA45-2]. Total RNA was prepared and subjected to
northern hybridization using a 5'-end labeled probe specific to
ACA45 scaRNA. U18 snoRNA was detected and served as a loading
control.
[0058] FIG. 46 shows dramatic depletion of ACA45 RNA did not
disrupt pseudouridylation at the predicted site in U2 snRNA
(.PSI.37). Pseudouridines were detected as in panel d, using a
5'-end labeled primer specific to U2 snRNA. Extension products were
separated in an 8% polyacrylamide gel, next to primer extension
sequencing ladders generated using the same primer. The predicted
target site (.PSI.37) is indicated, and other pseudouridines
detected in the same reactions are marked with arrowheads.
[0059] FIG. 47 shows base-pairing potential between ACA45 scaRNA
and U2 snRNA. U2 snRNA sequence is numbered and the pseudouridines
(.PSI.) in U2 snRNA are shown.
[0060] FIG. 48 shows U50 and U16 snoRNAs were depleted in mouse
cells. ASO477499 and ASO462026 were transfected individually (50
nM) or together (35 nM each) into mouse primary hepatocytes using
transfectamine 2000, and total RNA was prepared 24 hours after
transfection. The levels of U16 and U50 were determined by northern
hybridization. U2 snRNA was detected and served as a loading
control. The asterisk indicates an unknown hybridization
product.
[0061] FIG. 49 shows 2'MOE/chimeric ASOs can deplete snoRNAs in
mouse, as described in Example 20.
[0062] FIG. 50 shows reduction of snoRNAs in vivo decreased the
levels of rRNA methylation targeted by the snoRNA. Total RNA used
in panel i was pooled for each group, and subjected to primer
extension analysis to detect rRNA methylation at positions targeted
by U16 snoRNA (Am485 in 18S rRNA) or U50 snoRNA (Cm2613 in 28S
rRNA). Open arrows indicate the reduced methylation level which is
reflected by reduced signal strength at 0.05 mM dNTP concentration,
as compared with control samples. The modified nucleotides are
numbered with mouse rRNA. The equivalent positions in human rRNAs
are shown in parentheses.
[0063] FIG. 51 shows positions of primer probe sets used in panel
b. Exons (E) are shown in boxes. Primer positions are indicated
using arrows. The probe position in exon 6 is marked with a
bar.
[0064] FIG. 52 shows results of an assay with U1 specific ASO
described in Example 21.
[0065] FIG. 53 shows ASO-mediated U1 depletion impaired pre-mRNA
splicing, as described in Example 21.
DETAILED DESCRIPTION OF THE INVENTION
[0066] Unless specific definitions are provided, the nomenclature
used in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis. Certain such techniques
and procedures may be found for example in "Carbohydrate
Modifications in Antisense Research" Edited by Sangvi and Cook,
American Chemical Society , Washington D.C., 1994; "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 18th
edition, 1990; and "Antisense Drug Technology, Principles,
Strategies, and Applications" Edited by Stanley T. Crooke, CRC
Press, Boca Raton, Fla.; and Sambrook et al., "Molecular Cloning, A
laboratory Manual," 2.sup.nd Edition, Cold Spring Harbor Laboratory
Press, 1989, which are hereby incorporated by reference for any
purpose. Where permitted, all patents, applications, published
applications and other publications and other data referred to
throughout in the disclosure herein are incorporated by reference
in their entirety.
[0067] Unless otherwise indicated, the following terms have the
following meanings:
[0068] As used herein, "nucleoside" means a compound comprising a
nucleobase moiety and a sugar moiety. Nucleosides include, but are
not limited to, naturally occurring nucleosides (as found in DNA
and RNA) and modified nucleosides. Nucleosides may be linked to a
phosphate moiety.
[0069] As used herein, "chemical modification" means a chemical
difference in a compound when compared to a naturally occurring
counterpart. In reference to an oligonucleotide, chemical
modification does not include differences only in nucleobase
sequence. Chemical modifications of oligonucleotides include
nucleoside modifications (including sugar moiety modifications and
nucleobase modifications) and internucleoside linkage
modifications.
[0070] As used herein, "furanosyl" means a structure comprising a
5-membered ring comprising four carbon atoms and one oxygen
atom.
[0071] As used herein, "naturally occurring sugar moiety" means a
ribofuranosyl as found in naturally occurring RNA or a
deoxyribofuranosyl as found in naturally occurring DNA.
[0072] As used herein, "sugar moiety" means a naturally occurring
sugar moiety or a modified sugar moiety of a nucleoside.
[0073] As used herein, "modified sugar moiety" means a substituted
sugar moiety or a sugar surrogate.
[0074] As used herein, "substituted sugar moiety" means a furanosyl
that is not a naturally occurring sugar moiety. Substituted sugar
moieties include, but are not limited to furanosyls comprising
modifications at the 2'-position, the 5'-position and/or the
4'-position. Certain substituted sugar moieties are bicyclic sugar
moieties.
[0075] As used herein, "MOE" means
--OCH.sub.2CH.sub.2OCH.sub.3.
[0076] As used herein the term "sugar surrogate" means a structure
that does not comprise a furanosyl and that is capable of replacing
the naturally occurring sugar moiety of a nucleoside, such that the
resulting nucleoside is capable of (1) incorporation into an
oligonucleotide and (2) hybridization to a complementary
nucleoside. Such structures include relatively simple changes to
the furanosyl, such as rings comprising a different number of atoms
(e.g., 4, 6, or 7-membered rings); replacement of the oxygen of the
furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or
nitrogen); or both a change in the number of atoms and a
replacement of the oxygen. Such structures may also comprise
substitutions corresponding with those described for substituted
sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar
surrogates optionally comprising additional substituents). Sugar
surrogates also include more complex sugar replacements (e.g., the
non-ring systems of peptide nucleic acid). Sugar surrogates include
without limitation morpholinos, cyclohexenyls and
cyclohexitols.
[0077] As used herein, "bicyclic sugar moiety" means a modified
sugar moiety comprising a 4 to 7 membered ring (including but not
limited to a furanosyl) comprising a bridge connecting two atoms of
the 4 to 7 membered ring to form a second ring, resulting in a
bicyclic structure. In certain embodiments, the 4 to 7 membered
ring is a sugar ring. In certain embodiments the 4 to 7 membered
ring is a furanosyl. In certain such embodiments, the bridge
connects the 2'-carbon and the 4'-carbon of the furanosyl.
[0078] As used herein, "nucleotide" means a nucleoside further
comprising a phosphate linking group. As used herein, "linked
nucleosides" may or may not be linked by phosphate linkages and
thus includes, but is not limited to "linked nucleotides."
[0079] As used herein, "nucleobase" means group of atoms that can
be linked to a sugar moiety to create a nucleoside that is capable
of incorporation into an oligonucleotide, and wherein the group of
nucleobase atoms are capable of bonding with a complementary
nucleobase of another oligonucleotide or nucleic acid. Nucleobases
may be naturally occurring or may be modified.
[0080] As used herein, "heterocyclic base" or "heterocyclic
nucleobase" means a nucleobase comprising a heterocyclic
structure.
[0081] As used herein the terms, "unmodified nucleobase" or
"naturally occurring nucleobase" means the naturally occurring
heterocyclic nucleobases of RNA or DNA: the purine bases adenine
(A) and guanine (G), and the pyrimidine bases thymine (T), cytosine
(C) (including 5-methyl C), and uracil (U).
[0082] As used herein, "modified nucleobase" means any nucleobase
that is not an unmodified nucleobase.
[0083] As used herein, "modified nucleoside" means a nucleoside
comprising at least one chemical modification compared to naturally
occurring RNA or DNA nucleosides. Modified nucleosides comprise a
modified sugar moiety and/or a modified nucleobase.
[0084] As used herein, "bicyclic nucleoside" or "BNA" means a
nucleoside comprising a bicyclic sugar moiety.
[0085] As used herein, "oligonucleotide" means a compound
comprising a plurality of linked nucleosides. In certain
embodiments, an oligonucleotide comprises one or more unmodified
ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA)
and/or one or more modified nucleosides.
[0086] As used herein "oligonucleoside" means an oligonucleotide in
which none of the internucleoside linkages contains a phosphorus
atom. As used herein, oligonucleotides include
oligonucleosides.
[0087] As used herein, "modified oligonucleotide" means an
oligonucleotide comprising at least one modified nucleoside and/or
at least one modified internucleoside linkage.
[0088] As used herein "internucleoside linkage" means a covalent
linkage between adjacent nucleosides in an oligonucleotide.
[0089] As used herein "naturally occurring internucleoside linkage"
means a 3' to 5' phosphodiester linkage.
[0090] As used herein, "modified internucleoside linkage" means any
internucleoside linkage other than a naturally occurring
internucleoside linkage.
[0091] As used herein, "oligomeric compound" means a polymeric
structure comprising two or more sub-structures. In certain
embodiments, an oligomeric compound comprises an oligonucleotide.
In certain embodiments, an oligomeric compound comprises one or
more conjugate groups and/or terminal groups. In certain
embodiments, an oligomeric compound consists of an
oligonucleotide.
[0092] As used herein, the term "double-stranded" in reference to a
compound or composition means two separate oligomeric compounds
that are hybridized to one another. Double-stranded oligomeric
compounds may include one or more non-hybridizing nucleosides at
one or both ends of one or both strands (overhangs) and/or one or
more internal non-hybridizing nucleosides (mismatches) provided
there is sufficient complementarity to maintain hybridization under
relevant conditions. In certain embodiments, a double-stranded
oligomeric compound may become single-stranded after contacting a
cell or enzyme within a cell.
[0093] As used herein, the term "self-complementary" or "hair-pin"
in reference to an oligomeric compound means a single oligomeric
compound that comprises a stable duplex region formed by the
oligomeric compound hybridizing to itself. In certain embodiments,
the stable duplex region of a hair-pin oligomeric compound
comprises at least 5 contiguous paired nucleobases. In certain
embodiments, the stable duplex region of a hair-pin oligomeric
compound comprises at least 6 contiguous paired nucleobases. In
certain embodiments, the stable duplex region of a hair-pin
oligomeric compound comprises at least 7 contiguous paired
nucleobases. In certain embodiments, the duplex region of a
hair-pin compound constitutes .gtoreq.70% of the total number of
nucleobases of the hair-pin compound.
[0094] As used herein, the term "single-stranded" means an
oligomeric compound that is not hybridized to its complement and
that is not a hair-pin oligomeric compound. Typically,
single-stranded compounds are capable of binding to their
complementary strands to become double-stranded or partially
double-stranded compounds.
[0095] As used herein, "terminal group" means one or more atom
attached to either, or both, the 3' end or the 5' end of an
oligonucleotide. In certain embodiments a terminal group is a
conjugate group. In certain embodiments, a terminal group comprises
one or more terminal group nucleosides.
[0096] As used herein, "conjugate" means an atom or group of atoms
bound to an oligonucleotide or oligomeric compound. In general,
conjugate groups modify one or more properties of the compound to
which they are attached, including, but not limited to
pharmacodynamic, pharmacokinetic, binding, absorption, cellular
distribution, cellular uptake, charge and clearance.
[0097] As used herein, "conjugate linking group" means any atom or
group of atoms used to attach a conjugate to an oligonucleotide or
oligomeric compound.
[0098] As used herein, "antisense compound" means a compound
comprising or consisting of an oligonucleotide at least a portion
of which is at least partially complementary to a target nucleic
acid to which it is capable of hybridizing, resulting in at least
one antisense activity.
[0099] As used herein, "antisense activity" means any detectable
and/or measurable change attributable to the hybridization of an
antisense compound to its target nucleic acid.
[0100] As used herein, "detecting" or "measuring" means that a test
or assay for detecting or measuring is performed. Such detection
and/or measuring may result in a value of zero. Thus, if a test for
detection or measuring results in a finding of no activity
(activity of zero), the step of detecting or measuring the activity
has nevertheless been performed.
[0101] As used herein, "detectable and/or measurable activity"
means an activity that is not zero.
[0102] As used herein, "essentially unchanged" means little or no
change in a particular parameter, particularly relative to another
parameter which changes much more. In certain embodiments, a
parameter is essentially unchanged when it changes less than 5%. In
certain embodiments, a parameter is essentially unchanged if it
changes less than two-fold while another parameter changes at least
ten-fold. For example, in certain embodiments, an antisense
activity is a change in the amount of a target nucleic acid. In
certain such embodiments, the amount of a non-target nucleic acid
is essentially unchanged if it changes much less than the target
nucleic acid does, but need not be zero.
[0103] As used herein, "expression" means the process by which a
gene ultimately results in a protein. Expression includes, but is
not limited to, transcription, post-transcriptional modification
(e.g., splicing, polyadenlyation, addition of 5'-cap), and
translation.
[0104] As used herein, "target nucleic acid" means a nucleic acid
molecule to which an antisense compound hybridizes, ultimately
resulting in an antisense activity.
[0105] As used herein, "sub-nuclear RNA" means an RNA molecule that
is found in a sub-organelle within the nucleus of a cell. In
certain embodiments, sub-nuclear RNAs are found in one or more of:
the nucleolus, cajal bodies, nuclear speckles, and nuclear
paraspeckles.
[0106] As used herein "non-coding RNA" or "ncRNA" means an RNA
molecule that is not expressed. In certain embodiments, a ncRNA is
a spliced intronic region of a pre-mRNA.
[0107] As used herein, "sub-nuclear ncRNA" means a non-coding RNA
found within a sub-organelle of the nucleus of a cell.
[0108] As used herein, "snoRNA" means a small non-coding RNA
molecule found in the nucleolus of cells.
[0109] As used herein, "nucleolus" means a non-membrane bound
structure found within the nucleus of a cell comprising proteins
and nucleic acids, including ribosomal DNA and precursors of
rRNA.
[0110] As used herein, "scaRNA" means small non-coding RNA
molecules found in cajal bodies of cells.
[0111] As used herein, "cajal body" means a non-membrane bound
structure found within the nucleus of a cell comprising proteins
and nucleic acids, including the protein coilin.
[0112] As used herein, "host nucleic acid" in reference to a
non-coding RNA means a nucleic acid from which the non-coding RNA
derived.
[0113] As used herein, "host pre-mRNA" means a pre-mRNA from which
a non-coding intron is spliced.
[0114] As used herein, "host mRNA" means a mature mRNA derived from
a host pre-mRNA.
[0115] As used herein, "object RNA" means an RNA molecule other
than a target RNA that is affected by an antisense activity. In
certain embodiments, the amount, activity, splicing, processing,
and/or function of an object RNA is modulated, either directly or
indirectly, by a target nucleic acid. In certain embodiments, a
target nucleic acid modulates processing of an object RNA. In
certain embodiments, a target nucleic acid modulates splicing of an
object RNA. In certain embodiments, a target nucleic acid modulates
methylation of an object RNA. In certain such embodiments, an
antisense compound modulates the amount or activity of the target
nucleic acid, resulting in a change in the object RNA and
ultimately resulting in a change in the activity or function of the
object RNA.
[0116] As used herein, "electroporation" means a process for
introducing a nucleic acid into a cell using a pulse of electric
current. In certain embodiments, electroporation can be used to
introduce nucleic acid into the nucleus of a cell.
[0117] As used herein, "cell viability" means the ability of a cell
to grow and divide. In certain embodiments it is desirable to
maintain or improve cell viability. In certain embodiments, it is
desirable to reduce cell viability, e.g., of cancer cells.
[0118] As used herein, "cell cycle" means a series of events
leading up to cell division. Typically, cells cycle through phases.
Such phases include quiescence, also called Gap 0 (abbreviated GO);
interphase, divided into Gap 1 (G1), synthesis (S), and Gap 2 (G2);
and division, or mitosis (M), which may be further divided into
prophase, metaphase, anaphase, cytokenesis, and telophase. In
certain circumstances, such cancer, cells cycle inappropriately. In
certain embodiments, altering cell cycling (e.g., arresting cycling
at a particular phase) is desirable.
[0119] As used herein, "mRNA" means an RNA molecule that encodes a
protein.
[0120] As used herein, "pre-mRNA" means an RNA transcript that has
not been fully processed into mRNA. Pre-RNA includes one or more
intron.
[0121] As used herein, "pdRNA" means an RNA molecule that interacts
with one or more promoter to modulate transcription.
[0122] As used herein, "microRNA" means a naturally occurring,
small, non-coding RNA that represses gene expression of at least
one mRNA. In certain embodiments, a microRNA represses gene
expression by binding to a target site within a 3' untranslated
region of an mRNA. In certain embodiments, a microRNA has a
nucleobase sequence as set forth in miRBase, a database of
published microRNA sequences found at
http://microrna.sanger.ac.uk/sequences/.
[0123] As used herein, "microRNA mimic" means an oligomeric
compound having a sequence that is at least partially identical to
that of a microRNA. In certain embodiments, a microRNA mimic
comprises the microRNA seed region of a microRNA.
[0124] As used herein, "targeting" or "targeted to" means the
association of an antisense compound to a particular target nucleic
acid molecule or a particular region of nucleotides within a target
nucleic acid molecule. An antisense compound targets a target
nucleic acid if it is sufficiently complementary to the target
nucleic acid to allow hybridization under physiological
conditions.
[0125] As used herein, "nucleobase complementarity" or
"complementarity" when in reference to nucleobases means a
nucleobase that is capable of base pairing with another nucleobase.
For example, in DNA, adenine (A) is complementary to thymine (T).
For example, in RNA, adenine (A) is complementary to uracil (U). In
certain embodiments, complementary nucleobase means a nucleobase of
an antisense compound that is capable of base pairing with a
nucleobase of its target nucleic acid. For example, if a nucleobase
at a certain position of an antisense compound is capable of
hydrogen bonding with a nucleobase at a certain position of a
target nucleic acid, then the position of hydrogen bonding between
the oligonucleotide and the target nucleic acid is considered to be
complementary at that nucleobase pair. Nucleobases comprising
certain modifications may maintain the ability to pair with a
counterpart nucleobase and thus, are still capable of nucleobase
complementarity.
[0126] As used herein, "non-complementary" in reference to
nucleobases means a pair of nucleobases that do not form hydrogen
bonds with one another or otherwise support hybridization.
[0127] As used herein, "complementary" in reference to oligomeric
compounds (e.g., linked nucleosides, oligonucleotides, or nucleic
acids) means the capacity of such oligomeric compounds or regions
thereof to hybridize to another oligomeric compound or region
thereof through nucleobase complementarity.
[0128] As used herein, "hybridization" means the pairing of
complementary oligomeric compounds (e.g., an antisense compound and
its target nucleic acid). While not limited to a particular
mechanism, the most common mechanism of pairing involves hydrogen
bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen
hydrogen bonding, between complementary nucleobases.
[0129] As used herein, "specifically hybridizes" means the ability
of an oligomeric compound to hybridize to one nucleic acid site
with greater affinity than it hybridizes to another nucleic acid
site. In certain embodiments, an antisense oligonucleotide
specifically hybridizes to more than one target site.
[0130] As used herein, "fully complementary" in reference to an
oligonucleotide or portion thereof means that each nucleobase of
the oligonucleotide or portion thereof is capable of pairing with a
nucleobase of a complementary nucleic acid or contiguous portion
thereof. Thus, fully complementary region comprises no mismatches
or unhybridized nucleobases in either strand.
[0131] As used herein, "percent complementarity" means the
percentage of nucleobases of an oligomeric compound that are
complementary to an equal-length portion of a target nucleic acid.
Percent complementarity is calculated by dividing the number of
nucleobases of the oligomeric compound that are complementary to
nucleobases at corresponding positions in the target nucleic acid
by the total length of the oligomeric compound.
[0132] As used herein, "percent identity" means the number of
nucleobases in a first nucleic acid that are the same type
(independent of chemical modification) as nucleobases at
corresponding positions in a second nucleic acid, divided by the
total number of nucleobases in the first nucleic acid.
[0133] As used herein, "modulation" means a perturbation of amount
or quality of a function or activity when compared to the function
or activity prior to modulation. For example, modulation includes
the change, either an increase (stimulation or induction) or a
decrease (inhibition or reduction) in gene expression. As a further
example, modulation of expression can include perturbing splice
site selection of pre-mRNA processing, resulting in a change in the
amount of a particular splice-variant present compared to
conditions that were not perturbed. As a further example,
modulation includes perturbing translation of a protein.
[0134] As used herein, "motif" means a pattern of chemical
modifications in an oligomeric compound or a region thereof. Motifs
may be defined by modifications at certain nucleosides and/or at
certain linking groups of an oligomeric compound.
[0135] As used herein, "nucleoside motif" means a pattern of
nucleoside modifications in an oligomeric compound or a region
thereof. The linkages of such an oligomeric compound may be
modified or unmodified. Unless otherwise indicated, motifs herein
describing only nucleosides are intended to be nucleoside motifs.
Thus, in such instances, the linkages are not limited.
[0136] As used herein, "linkage motif" means a pattern of linkage
modifications in an oligomeric compound or region thereof. The
nucleosides of such an oligomeric compound may be modified or
unmodified. Unless otherwise indicated, motifs herein describing
only linkages are intended to be linkage motifs. Thus, in such
instances, the nucleosides are not limited.
[0137] As used herein, "nucleobase modification motif" means a
pattern of modifications to nucleobases along an oligonucleotide.
Unless otherwise indicated, a nucleobase modification motif is
independent of the nucleobase sequence.
[0138] As used herein, "sequence motif" means a pattern of
nucleobases arranged along an oligonucleotide or portion thereof.
Unless otherwise indicated, sequence motifs and chemical
modification motifs are independent of one another.
[0139] As used herein, "nucleobase-dependent chemical motif" means
a motif of chemical modifications that depends on the identity of
the nucleobase of a nucleoside, e.g., each pyrimidine nucleoside
comprises a particular sugar moiety.
[0140] As used herein, "type of modification" in reference to a
nucleoside or a nucleoside of a "type" means the chemical
modification of a nucleoside and includes modified and unmodified
nucleosides. Accordingly, unless otherwise indicated, a "nucleoside
having a modification of a first type" may be an unmodified
nucleoside.
[0141] As used herein, "differently modified" mean chemical
modifications or chemical substituents that are different from one
another, including absence of modifications. Thus, for example, a
MOE nucleoside and an unmodified DNA nucleoside are "differently
modified," even though the DNA nucleoside is unmodified. Likewise,
DNA and RNA are "differently modified," even though both are
naturally-occurring unmodified nucleosides. Nucleosides that are
the same but for comprising different nucleobases are not
differently modified, unless otherwise indicated. For example, a
nucleoside comprising a 2'-OMe modified sugar and an unmodified
adenine nucleobase and a nucleoside comprising a 2'-OMe modified
sugar and an unmodified thymine nucleobase are not differently
modified.
[0142] As used herein, "the same type of modifications" refers to
modifications that are the same as one another, including absence
of modifications. Thus, for example, two unmodified DNA nucleoside
have "the same type of modification," even though the DNA
nucleoside is unmodified. Such nucleosides having the same type
modification may comprise different nucleobases.
[0143] As used herein, "separate regions" means a portion of an
oligonucleotide wherein the chemical modifications or the motif of
chemical modifications within the portion are the same and the
chemical modifications or motif of chemical modifications of any
neighboring portions include at least one difference to allow the
separate regions to be distinguished from one another.
[0144] As used herein, "pharmaceutically acceptable carrier or
diluent" means any substance suitable for use in administering to
an animal. In certain embodiments, a pharmaceutically acceptable
carrier or diluent is sterile saline. In certain embodiments, such
sterile saline is pharmaceutical grade saline. As used herein,
"animal" means a multicellular organism of the kingdom Animalia.
Animals include, but are not limited to, humans.
[0145] As used herein, "substituent" and "substituent group," means
an atom or group that replaces the atom or group of a named parent
compound. For example a substituent of a modified nucleoside is any
atom or group that differs from the atom or group found in a
naturally occurring nucleoside (e.g., a modified 2'-substituent is
any atom or group at the 2'-position of a nucleoside other than H
or OH). Substituent groups can be protected or unprotected. In
certain embodiments, compounds of the present invention have
substituents at one or at more than one position of the parent
compound. Substituents may also be further substituted with other
substituent groups and may be attached directly or via a linking
group such as an alkyl or hydrocarbyl group to a parent
compound.
[0146] Likewise, as used herein, "substituent" in reference to a
chemical functional group means an atom or group of atoms differs
from the atom or a group of atoms normally present in the named
functional group. In certain embodiments, a substituent replaces a
hydrogen atom of the functional group (e.g., in certain
embodiments, the substituent of a substituted methyl group is an
atom or group other than hydrogen which replaces one of the
hydrogen atoms of an unsubstituted methyl group). Unless otherwise
indicated, groups amenable for use as substituents include without
limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl
(--C(O)R.sub.aa), carboxyl (--C(O)O--R.sub.aa), aliphatic groups,
alicyclic groups, alkoxy, substituted oxy (--O--R.sub.aa), aryl,
aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino
(--N(R.sub.bb)(R.sub.cc)), imino(.dbd.NR.sub.bb), amido
(--C(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)R.sub.aa), azido
(--N.sub.3), nitro (--NO.sub.2), cyano (--CN), carbamido
(--OC(O)N(R.sub.bb)(R.sub.cc) or --N(R.sub.bb)C(O)OR.sub.aa),
ureido (--N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido
(--N(R.sub.bb)C(S)N(R.sub.bb)--(R.sub.cc)), guanidinyl
(--N(R.sub.bb)C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl
(--C(.dbd.NR.sub.bb)N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)C(.dbd.NR.sub.bb)(R.sub.aa)), thiol (--SR.sub.bb),
sulfinyl (--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb) and
sulfonamidyl (--S(O).sub.2N(R.sub.bb)(R.sub.cc) or
--N(R.sub.bb)S--(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb
and R.sub.cc is, independently, H, an optionally linked chemical
functional group or a further substituent group with a preferred
list including without limitation, alkyl, alkenyl, alkynyl,
aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic,
heterocyclic and heteroarylalkyl. Selected substituents within the
compounds described herein are present to a recursive degree.
[0147] As used herein, "recursive substituent" means that a
substituent may recite another instance of itself. Because of the
recursive nature of such substituents, theoretically, a large
number may be present in any given claim. One of ordinary skill in
the art of medicinal chemistry and organic chemistry understands
that the total number of such substituents is reasonably limited by
the desired properties of the compound intended. Such properties
include, by way of example and not limitation, physical properties
such as molecular weight, solubility or log P, application
properties such as activity against the intended target and
practical properties such as ease of synthesis.
[0148] Recursive substituents are an intended aspect of the
invention. One of ordinary skill in the art of medicinal and
organic chemistry understands the versatility of such substituents.
To the degree that recursive substituents are present in a claim of
the invention, the total number will be determined as set forth
above.
[0149] As used herein, "stable compound" and "stable structure"
mean a compound that is sufficiently robust to survive isolation to
a useful degree of purity from a reaction mixture, and formulation
into an therapeutic agent.
[0150] As used herein, "alkyl," as used herein, means a saturated
straight or branched hydrocarbon radical containing up to twenty
four carbon atoms. Examples of alkyl groups include without
limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl,
octyl, decyl, dodecyl and the like. Alkyl groups typically include
from 1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon
atoms being more preferred. The term "lower alkyl" as used herein
includes from 1 to about 6 carbon atoms. Alkyl groups as used
herein may optionally include one or more further substituent
groups.
[0151] As used herein, "alkenyl," means a straight or branched
hydrocarbon chain radical containing up to twenty four carbon atoms
and having at least one carbon-carbon double bond. Examples of
alkenyl groups include without limitation, ethenyl, propenyl,
butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and
the like. Alkenyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkenyl groups
as used herein may optionally include one or more further
substituent groups.
[0152] As used herein, "alkynyl," means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms and
having at least one carbon-carbon triple bond. Examples of alkynyl
groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl,
and the like. Alkynyl groups typically include from 2 to about 24
carbon atoms, more typically from 2 to about 12 carbon atoms with
from 2 to about 6 carbon atoms being more preferred. Alkynyl groups
as used herein may optionally include one or more further
substituent groups.
[0153] As used herein, "acyl," means a radical formed by removal of
a hydroxyl group from an organic acid and has the general Formula
--C(O)--X where X is typically aliphatic, alicyclic or aromatic.
Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic
sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic
phosphates, aliphatic phosphates and the like. Acyl groups as used
herein may optionally include further substituent groups.
[0154] As used herein, "alicyclic" means a cyclic ring system
wherein the ring is aliphatic. The ring system can comprise one or
more rings wherein at least one ring is aliphatic. Preferred
alicyclics include rings having from about 5 to about 9 carbon
atoms in the ring. Alicyclic as used herein may optionally include
further substituent groups.
[0155] As used herein, "aliphatic" means a straight or branched
hydrocarbon radical containing up to twenty four carbon atoms
wherein the saturation between any two carbon atoms is a single,
double or triple bond. An aliphatic group preferably contains from
1 to about 24 carbon atoms, more typically from 1 to about 12
carbon atoms with from 1 to about 6 carbon atoms being more
preferred. The straight or branched chain of an aliphatic group may
be interrupted with one or more heteroatoms that include nitrogen,
oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by
heteroatoms include without limitation, polyalkoxys, such as
polyalkylene glycols, polyamines, and polyimines. Aliphatic groups
as used herein may optionally include further substituent
groups.
[0156] As used herein, "alkoxy" means a radical formed between an
alkyl group and an oxygen atom wherein the oxygen atom is used to
attach the alkoxy group to a parent molecule. Examples of alkoxy
groups include without limitation, methoxy, ethoxy, propoxy,
isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy,
neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may
optionally include further substituent groups.
[0157] As used herein, "aminoalkyl" means an amino substituted
C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical
forms a covalent bond with a parent molecule. The amino group can
be located at any position and the aminoalkyl group can be
substituted with a further substituent group at the alkyl and/or
amino portions.
[0158] As used herein, "aralkyl" and "arylalkyl" mean an aromatic
group that is covalently linked to a C.sub.1-C.sub.12 alkyl
radical. The alkyl radical portion of the resulting aralkyl (or
arylalkyl) group forms a covalent bond with a parent molecule.
Examples include without limitation, benzyl, phenethyl and the
like. Aralkyl groups as used herein may optionally include further
substituent groups attached to the alkyl, the aryl or both groups
that form the radical group.
[0159] As used herein, "aryl" and "aromatic" mean a mono- or
polycyclic carbocyclic ring system radicals having one or more
aromatic rings. Examples of aryl groups include without limitation,
phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
Preferred aryl ring systems have from about 5 to about 20 carbon
atoms in one or more rings. Aryl groups as used herein may
optionally include further substituent groups.
[0160] As used herein, "halo" and "halogen," mean an atom selected
from fluorine, chlorine, bromine and iodine.
[0161] As used herein, "heteroaryl," and "heteroaromatic," mean a
radical comprising a mono- or poly-cyclic aromatic ring, ring
system or fused ring system wherein at least one of the rings is
aromatic and includes one or more heteroatoms. Heteroaryl is also
meant to include fused ring systems including systems where one or
more of the fused rings contain no heteroatoms. Heteroaryl groups
typically include one ring atom selected from sulfur, nitrogen or
oxygen. Examples of heteroaryl groups include without limitation,
pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl,
thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl,
thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl,
benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can
be attached to a parent molecule directly or through a linking
moiety such as an aliphatic group or hetero atom. Heteroaryl groups
as used herein may optionally include further substituent
groups.
Oligomeric Compounds
[0162] In certain embodiments, the present invention provides
oligomeric compounds. In certain embodiments, such oligomeric
compounds comprise oligonucleotides optionally comprising one or
more conjugate and/or terminal groups. In certain embodiments,
oligomeric compounds consist of an oligonucleotide. In certain
embodiments, oligonucleotides comprise one or more chemical
modification. Such chemical modifications include modifications one
or more nucleoside (including modifications to the sugar moiety
and/or the nucleobase) and/or modifications to one or more
internucleoside linkage.
[0163] Certain Sugar Moieties
[0164] In certain embodiments, oligomeric compounds of the
invention comprise one or more modified nucleoside comprising a
modified sugar moiety. Such oligomeric compounds comprising one or
more sugar-modified nucleoside may have desirable properties, such
as enhanced nuclease stability or increased binding affinity with a
target nucleic acid relative to oligomeric compounds comprising
only nucleosides comprising naturally occurring sugar moieties. In
certain embodiments, modified sugar moieties are substituted sugar
moieties. In certain embodiments, modified sugar moieties are sugar
surrogates. Such sugar surrogates may comprise one or more
substitutions corresponding to those of substituted sugar
moieties.
[0165] In certain embodiments, modified sugar moieties are
substituted sugar moieties comprising one or more non-bridging
sugar substituent, including but not limited to substituents at the
2' and/or 5' positions. Examples of sugar substituents suitable for
the 2'-position, include, but are not limited to: 2'-F,
2'-OCH.sub.3 ("OMe" or "O-methyl"), and
2'-O(CH.sub.2).sub.2OCH.sub.3 ("MOE"). In certain embodiments,
sugar substituents at the 2' position is selected from allyl,
amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl,
O--C.sub.1-C.sub.10 substituted alkyl; OCF.sub.3,
O(CH.sub.2).sub.2SCH.sub.3,
O(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), and
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each Rm and Rn
is, independently, H or substituted or unsubstituted
C.sub.1-C.sub.10 alkyl. Examples of sugar substituents at the
5'-position, include, but are not limited to: 5'-methyl (R or S);
5'-vinyl, and 5'-methoxy. In certain embodiments, substituted
sugars comprise more than one non-bridging sugar substituent, for
example, 2'-F-5'-methyl sugar moieties (see,e.g., PCT International
Application WO 2008/101157, for additional 5',2'-bis substituted
sugar moieties and nucleosides).
[0166] Nucleosides comprising 2'-modified sugar moieties are
referred to as 2'-modified nucleosides. In certain embodiments, a
2'-modified nucleoside comprises a 2'-substituent group selected
from halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3,
O--, S--, or N(R.sub.m)-alkyl; O--, S--, or N(R.sub.m)-alkenyl;
O--, S-- or N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl,
alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n) or
O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from hydroxyl, amino,
alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and
alkynyl.
[0167] In certain embodiments, a 2'-modified nucleoside comprises a
2'-substituent group selected from F, NH.sub.2, OCF.sub.3,
O--CH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2--CH.dbd.CH.sub.2,
O--CH.sub.2--CH.dbd.CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n),
--O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide
(O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n) where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0168] In certain embodiments, a 2'-modified nucleoside comprises a
sugar moiety comprising a 2'-substituent group selected from F,
OCF.sub.3, O--CH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3,
2'-O(CH.sub.2).sub.2SCH.sub.3,
O--(CH.sub.2).sub.2--O--N(CH.sub.3).sub.2,
--O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
O--CH.sub.2--C(.dbd.O)--N(H)CH.sub.3.
[0169] In certain embodiments, a 2'-modified nucleoside comprises a
sugar moiety comprising a 2'-substituent group selected from F,
O--CH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0170] Certain substituted sugar moieties comprise a bridging sugar
substituent that forms a second ring resulting in a bicyclic sugar
moiety. In certain such embodiments, the bicyclic sugar moiety
comprises a bridge between the 4' and the 2' furanose ring atoms.
Examples of such 4' to 2' sugar substituents, include, but are not
limited to: --[C(R.sub.a)(R.sub.b)].sub.n--,
--C(R.sub.aR.sub.b)--N(R)--O-- or, --C(R.sub.aR.sub.b)--O--N(R)--;
4'-CH.sub.2-2'-4'-(CH.sub.2).sub.2-2', 4'-(CH.sub.2).sub.3-2',
4'-(CH.sub.2)--O-2' (LNA); 4'-(CH.sub.2)--S-2;
4'-(CH.sub.2).sub.2--O-2' (ENA); 4'-CH(CH.sub.3)--O-2' (cEt) and
4'-CH(CH.sub.2OCH.sub.3)--O-2', and analogs thereof (see, e.g.,
U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008);
4'-C(CH.sub.3)(CH.sub.3)--O-2'and analogs thereof, (see, e.g.,
WO2009/006478, published Jan. 8, 2009);
4'-CH.sub.2--N(OCH.sub.3)-2' and analogs thereof (see, e.g.,
WO2008/150729, published Dec. 11, 2008);
4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., US2004/0171570,
published Sep. 2, 2004); 4'-CH.sub.2--O--N(R)-2', and
4'-CH.sub.2--N(R)--O-2'-, wherein each R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl;
4'-CH.sub.2--N(R)--O-2', wherein R is H, C.sub.1-C.sub.12 alkyl, or
a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep.
23, 2008); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g.,
Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and
4'--CH.sub.2--C(.dbd.CH.sub.2)-2' and analogs thereof (see,
published PCT International Application WO 2008/154401, published
on Dec. 8, 2008).
[0171] In certain embodiments, such 4' to 2' bridges independently
comprise 1 or from 2 to 4 linked groups independently selected from
--[C(R.sub.a)(R.sub.b)].sub.n--, --C(R.sub.a).dbd.C(R.sub.b)--,
--C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--,
and --N(R.sub.a)--;
[0172] wherein:
[0173] x is 0, 1, or 2;
[0174] n is 1, 2, 3, or 4;
[0175] each R.sub.a and R.sub.b is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
[0176] each J.sub.1 and J.sub.2 is, independently, H,
C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl,
C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl,
C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl,
C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl
(C(.dbd.O)--H), substituted acyl, a heterocycle radical, a
substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl,
substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0177] Nucleosides comprising bicyclic sugar moieties are referred
to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include,
but are not limited to, (A) .alpha.-L-Methyleneoxy
(4'-CH.sub.2--O-2') BNA, (B) .beta.-D-Methyleneoxy
(4'-CH.sub.2--O-2') BNA, (C) Ethyleneoxy
(4'-(CH.sub.2).sub.2--O-2') BNA, (D) Aminooxy
(4'-CH.sub.2--O--N(R)-2') BNA, (E) Oxyamino
(4'-CH.sub.2--N(R)--O-2') BNA, (F) Methyl(methyleneoxy)
(4'-CH(CH.sub.3)--O-2') BNA (also referred to as constrained ethyl
or cEt), (G) methylene-thio (4'-CH.sub.2--S-2') BNA, (H)
methylene-amino (4'-CH.sub.2--N(R)-2') BNA, (I) methyl carbocyclic
(4'-CH.sub.2--CH(CH.sub.3)-2') BNA, and (J) propylene carbocyclic
(4'-(CH.sub.2).sub.3-2') BNA as depicted below.
##STR00001## ##STR00002##
wherein Bx is a nucleobase moiety and R is, independently, H, a
protecting group, or C.sub.1-C.sub.12 alkyl.
[0178] In certain embodiments, bicyclic nucleosides have Formula
I:
##STR00003##
wherein:
[0179] Bx is a nucleobase moiety;
[0180] -Q.sub.a-Q.sub.b-Q.sub.c- is
--CH.sub.2--N(R.sub.c)--CH.sub.2--,
--C(.dbd.O)--N(R.sub.c)--CH.sub.2--, --CH.sub.2--O--N(R.sub.c)--,
--CH.sub.2--N(R.sub.c)--O--, or --N(R.sub.c)--O--CH.sub.2;
[0181] R.sub.c is C.sub.1-C.sub.12 alkyl or an amino protecting
group; and
[0182] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium.
[0183] In certain embodiments, bicyclic nucleoside having Formula
II:
##STR00004##
wherein:
[0184] Bx is a nucleobase moiety;
[0185] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0186] Z.sub.a is C.sub.1C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl, acyl, substituted acyl, substituted amide, thiol, or
substituted thio.
[0187] In certain embodiments, each of the substituted groups is,
independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ.sub.c,
NJ.sub.cJ.sub.d, SJ.sub.c, N.sub.3, OC(.dbd.X)J.sub.c, and
NJ.sub.eC(.dbd.X)NJ.sub.cJ.sub.d, wherein each J.sub.c, J.sub.d,
and J.sub.e is, independently, H, C.sub.1C.sub.6 alkyl, or
substituted C.sub.1C.sub.6 alkyl and X is O or NJ.sub.c.
[0188] In certain embodiments, bicyclic nucleoside have Formula
III:
##STR00005##
wherein:
[0189] Bx is a nucleobase moiety;
[0190] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0191] Z.sub.b is C.sub.1C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
C.sub.2-C.sub.6 alkynyl, substituted C.sub.1C.sub.6 alkyl,
substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkynyl, or substituted acyl (C(.dbd.O)--).
[0192] In certain embodiments, bicyclic nucleoside having Formula
IV:
##STR00006##
wherein:
[0193] Bx is a nucleobase moiety;
[0194] T.sub.a and T.sub.b are each, independently H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0195] R.sub.d is C.sub.1-C.sub.6 alkyl, substituted C.sub.1C.sub.6
alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6
alkynyl;
[0196] each q.sub.a, q.sub.b, q.sub.c and q.sub.d is,
independently, H, halogen, C.sub.1C.sub.6 alkyl, substituted
C.sub.1C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted
C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted
C.sub.2-C.sub.6 alkynyl, C.sub.1C.sub.6 alkoxyl, substituted
C.sub.1-C.sub.6 alkoxyl, acyl, substituted acyl, C.sub.1-C.sub.6
aminoalkyl, or substituted C.sub.1C.sub.6 aminoalkyl;
[0197] In certain embodiments, bicyclic nucleoside having Formula
V:
##STR00007##
wherein:
[0198] Bx is a nucleobase moiety;
[0199] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0200] q.sub.a, q.sub.b, q.sub.e and of are each, independently,
hydrogen, halogen, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxy, substituted
C.sub.1-C.sub.12 alkoxy, OJ.sub.j, SJ.sub.j, SOJ.sub.j,
SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(.dbd.O)OJ.sub.j,
C(.dbd.O)NJ.sub.jJ.sub.k, C(.dbd.O)J.sub.j,
O--C(.dbd.O)NJ.sub.jJ.sub.k, N(H)C(.dbd.NH)NJ.sub.jJ.sub.k,
N(H)C(.dbd.O)NJ.sub.jJ.sub.k or N(H)C(.dbd.S)NJ.sub.jJ.sub.k;
[0201] or q.sub.e and q.sub.f together are
.dbd.C(q.sub.g)(q.sub.b);
[0202] q.sub.g and q.sub.b are each, independently, H, halogen,
C.sub.1-C.sub.12 alkyl, or substituted C.sub.1-C.sub.12 alkyl.
[0203] In certain embodiments, bicyclic nucleoside having Formula
VI:
##STR00008##
wherein:
[0204] Bx is a nucleobase moiety;
[0205] T.sub.a and T.sub.b are each, independently, H, a hydroxyl
protecting group, a conjugate group, a reactive phosphorus group, a
phosphorus moiety, or a covalent attachment to a support
medium;
[0206] each q.sub.i, q.sub.j, q.sub.k and q.sub.1 is,
independently, H, halogen, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxyl, substituted
C.sub.1-C.sub.12 alkoxyl, OJ.sub.j, SJ.sub.j, SOJ.sub.j,
SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(.dbd.O)OJ.sub.j,
C(.dbd.O)NJ.sub.jJ.sub.k, C(.dbd.O)J.sub.j,
O--C(.dbd.O)NJ.sub.jJ.sub.k, N(H)C(.dbd.NH)NJ.sub.jJ.sub.k,
N(H)C(.dbd.O)NJ.sub.jJ.sub.k, or N(H)C(.dbd.S)NJ.sub.jJ.sub.k;
and
[0207] q.sub.i and q.sub.j or q.sub.l and q.sub.k together are
.alpha.C(q.sub.g)(q.sub.h), wherein q.sub.g and q.sub.h are each,
independently, H, halogen, C.sub.1-C.sub.12 alkyl, or substituted
C.sub.1-C.sub.12 alkyl.
[0208] Additional bicyclic sugar moieties are known in the art, for
example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et
al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc.
Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg.
Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem.,
1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc.,
129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion
Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001,
8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243;
U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499,
7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO
1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent
Publication Nos. US2004/0171570, US2007/0287831, and
US2008/0039618; U.S. patent Ser. Nos. 12/129,154, 60/989,574,
61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and
61/099,844; and PCT International Applications Nos.
PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.
[0209] In certain embodiments, bicyclic sugar moieties and
nucleosides incorporating such bicyclic sugar moieties are further
defined by isomeric configuration. For example, a nucleoside
comprising a 4'-2' methylene-oxy bridge, may be in the .alpha.-L
configuration or in the (3-D configuration. Previously,
.alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') bicyclic nucleosides
have been incorporated into antisense oligonucleotides that showed
antisense activity (Frieden et al., Nucleic Acids Research, 2003,
21, 6365-6372).
[0210] The synthesis and preparation of many bicyclic sugar
moieties and bicyclic nucleosides has been described. For example,
synthesis of methyleneoxy (4'-CH.sub.2--O-2') BNA monomers adenine,
cytosine, guanine, 5-methyl-cytosine, thymine, and uracil, along
with their oligomerization, and nucleic acid recognition properties
have been described (see, e.g., Koshkin et al., Tetrahedron, 1998,
54, 3607-3630). BNAs and preparation thereof are also described in
WO 98/39352 and WO 99/14226. See also, Kumar et al., Bioorg. Med.
Chem. Lett., 1998, 8, 2219-2222; Wengel et al., WO 99/14226; Singh
et al., J. Org. Chem., 1998, 63,10035-10039 (including synthesis of
2'-amino-BNA and 2'-amino- and 2'-methylamino-BNA').
[0211] In certain embodiments, substituted sugar moieties comprise
one or more non-bridging sugar substituent and one or more bridging
sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars).
(see, PCT International Application WO 2007/134181, published on
Nov. 22, 2007, wherein LNA is substituted with, for example, a
5'-methyl or a 5'-vinyl group).
[0212] In certain embodiments, modified sugar moieties are sugar
surrogates. In certain such embodiments, the oxygen atom of the
naturally occurring sugar is substituted, e.g., with a sulfur,
carbon or nitrogen atom. In certain such embodiments, such modified
sugar moiety also comprises bridging and/or non-bridging
substituents as described above. For example, certain sugar
surrogates comprise a 4'-sulfur atom and a substitution at the
2'-position (see,e.g., published U.S. Patent Application
US2005/0130923, published on Jun. 16, 2005) and/or the 5' position.
By way of additional example, carbocyclic bicyclic nucleosides
having a 4'-2' bridge have been described (see, e.g., Freier et
al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et
al., J. Org. Chem., 2006, 71, 7731-7740).
[0213] In certain embodiments, sugar surrogates comprise rings
having other than 5-atoms. For example, in certain embodiments, a
sugar surrogate comprises a six-membered tetrahydropyran. Such
tetrahydropyrans may be further modified or substituted.
Nucleosides comprising such modified tetrahydropyrans include, but
are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid
(ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. &
Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those
compounds having Formula VII:
##STR00009##
wherein independently for each of said at least one tetrahydropyran
nucleoside analog of Formula X:
[0214] Bx is a nucleobase moiety;
[0215] T.sub.3 and T.sub.4 are each, independently, an
internucleoside linking group linking the tetrahydropyran
nucleoside analog to the antisense compound or one of T.sub.3 and
T.sub.4 is an internucleoside linking group linking the
tetrahydropyran nucleoside analog to the antisense compound and the
other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a
linked conjugate group, or a 5' or 3'-terminal group; q.sub.1,
q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each,
independently, H, C.sub.1C.sub.6 alkyl, substituted C.sub.1C.sub.6
alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6
alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6
alkynyl; and
[0216] one of R.sub.1 and R.sub.2 is hydrogen and the other is
selected from halogen, substituted or unsubstituted alkoxy,
NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(.dbd.X)J.sub.1,
OC(.dbd.X)NJ.sub.1J.sub.2, NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, and
CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and
J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0217] In certain embodiments, the modified THP nucleosides of
Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3,
q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain
embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain
embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4,
q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP
nucleosides of Formula VII are provided wherein one of R.sub.1 and
R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2
is H, R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is
methoxyethoxy and R.sub.2 is H.
[0218] Many other bicyclo and tricyclo sugar surrogate ring systems
are also known in the art that can be used to modify nucleosides
for incorporation into antisense compounds (see, e.g., review
article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002,
10, 841-854).
[0219] Combinations of modifications are also provided without
limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT
International Application WO 2008/101157 Published on Aug. 21, 2008
for other disclosed 5', 2'-bis substituted nucleosides) and
replacement of the ribosyl ring oxygen atom with S and further
substitution at the 2'-position (see published U.S. Patent
Application US2005-0130923, published on Jun. 16, 2005) or
alternatively 5'-substitution of a bicyclic nucleic acid (see PCT
International Application WO 2007/134181, published on Nov. 22,
2007 wherein a 4'-CH.sub.2--O-2' bicyclic nucleoside is further
substituted at the 5' position with a 5'-methyl or a 5'-vinyl
group). The synthesis and preparation of carbocyclic bicyclic
nucleosides along with their oligomerization and biochemical
studies have also been described (see, e.g., Srivastava et al., J.
Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0220] Certain Nucleobases
[0221] In certain embodiments, nucleosides of the present invention
comprise one or more unmodified nucleobases. In certain
embodiments, nucleosides of the present invention comprise one or
more modified nucleobases.
[0222] In certain embodiments, modified nucleobases are selected
from: universal bases, hydrophobic bases, promiscuous bases,
size-expanded bases, and fluorinated bases as defined herein.
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6
substituted purines, including 2-aminopropyladenine,
5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine,
xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl
derivatives of adenine and guanine, 2-propyl and other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and
3-deazaadenine, universal bases, hydrophobic bases, promiscuous
bases, size-expanded bases, and fluorinated bases as defined
herein. Further modified nucleobases include tricyclic pyrimidines
such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, Kroschwitz, J. I., Ed., John Wiley &
Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613; and those disclosed
by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications,
Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
[0223] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include without limitation, U.S.
Pat. No. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273;
5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177;
5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617;
5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and
6,005,096, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0224] Certain Internucleoside Linkages
[0225] In certain embodiments, the present invention provides
oligomeric compounds comprising linked nucleosides. In such
embodiments, nucleosides may be linked together using any
internucleoside linkage. The two main classes of internucleoside
linking groups are defined by the presence or absence of a
phosphorus atom. Representative phosphorus containing
internucleoside linkages include, but are not limited to,
phosphodiesters (P.dbd.O), phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates (P.dbd.S). Representative
non-phosphorus containing internucleoside linking groups include,
but are not limited to, methylenemethylimino
(--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-), thiodiester
(--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane
(--O--Si(H).sub.2--O--); and N,N'-dimethylhydrazine
(--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Modified linkages,
compared to natural phosphodiester linkages, can be used to alter,
typically increase, nuclease resistance of the oligomeric compound.
In certain embodiments, internucleoside linkages having a chiral
atom can be prepared a racemic mixture, as separate enantiomers.
Representative chiral linkages include, but are not limited to,
alkylphosphonates and phosphorothioates. Methods of preparation of
phosphorous-containing and non-phosphorous-containing
internucleoside linkages are well known to those skilled in the
art.
[0226] The oligonucleotides described herein contain one or more
asymmetric centers and thus give rise to enantiomers,
diastereomers, and other stereoisomeric configurations that may be
defined, in terms of absolute stereochemistry, as (R) or (S),
.quadrature. or .quadrature. such as for sugar anomers, or as (D)
or (L) such as for amino acids et al. Included in the antisense
compounds provided herein are all such possible isomers, as well as
their racemic and optically pure forms.
[0227] Neutral internucleoside linkages include without limitation,
phosphotriesters, methylphosphonates, MMI
(3'-CH.sub.2--N(CH.sub.3)--O-5'), amide-3
(3'-CH.sub.2--C(.dbd.O)--N(H)-5'), amide-4
(3'-CH.sub.2--N(H)--C(.dbd.O)-5'), formacetal
(3'-O--CH.sub.2--O-5'), and thioformacetal (3'-S--CH.sub.2--O-5').
Further neutral internucleoside linkages include nonionic linkages
comprising siloxane (dialkylsiloxane), carboxylate ester,
carboxamide, sulfide, sulfonate ester and amides (See for example:
Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and
P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4,
40-65). Further neutral internucleoside linkages include nonionic
linkages comprising mixed N, O, S and CH.sub.2 component parts.
[0228] Certain Motifs
[0229] In certain embodiments, the present invention provides
oligomeric compounds comprising oligonucleotides. In certain
embodiments, such oligonucleotides comprise one or more chemical
modification. In certain embodiments, chemically modified
oligonucleotides comprise one or more modified sugar. In certain
embodiments, chemically modified oligonucleotides comprise one or
more modified nucleobase. In certain embodiments, chemically
modified oligonucleotides comprise one or more modified
internucleoside linkage. In certain embodiments, the chemically
modifications (sugar modifications, nucleobase modifications,
and/or linkage modifications) define a pattern or motif. In certain
embodiments, the patterns of chemically modifications of sugar
moieties, internucleoside linkages, and nucleobases are each
independent of one another. Thus, an oligonucleotide may be
described by its sugar modification motif, internucleoside linkage
motif and/or nucleobase modification motif (as used herein,
nucleobase modification motif describes the chemically
modifications to the nucleobases independent of the sequence of
nucleobases).
[0230] Certain Sugar Motifs
[0231] In certain embodiments, oligonucleotides comprise modified
sugar moieties arranged along the oligonucleotide or region thereof
in a defined pattern or sugar modification motif. In certain such
embodiments, the oligonucleotides of the present invention comprise
a region having a gapmer sugar modification motif, which comprises
two external regions or "wings" and an internal region or "gap."
The three regions of a gapmer motif (the 5'-wing, the gap, and the
3'-wing) form a contiguous sequence of nucleosides wherein the
sugar moieties of the nucleosides of each of the wings are
different from the sugar moieties of the nucleosides of the gap.
Typically, the sugar moieties within each of the two wings are the
same as one another and the sugar moieties within the gap are the
same as one another. In certain embodiments, the sugar moieties of
the two wings are the same as one another (symmetric gapmer). In
certain embodiments, the sugar moieties in the 5'-wing are
different from the sugar moieties in the 3'-wing (asymmetric
gapmer).
[0232] In certain embodiments, the nucleosides of the 5'-wing and
the nucleosides of the 3'-wing are sugar modified nucleosides. In
certain embodiments, the nucleosides of the gap comprise unmodified
.beta.-D-2'-deoxyribonucleosides (i.e., the sugar moiety is the
unmodified deoxyfuranosyl of DNA). In certain embodiments, the
wings are each from 1 to 10 nucleosides in length. In certain
embodiments, the wings are each from 1 to 5 nucleosides in length.
In certain embodiments, the gap is from 5 to 25 nucleosides in
length. In certain embodiments, the gap is from 8 to 18 nucleosides
in length. In certain embodiments, gapmers may be described using
the following formula:
(Nu.sub.1).sub.1-7-(Nu.sub.2).sub.4-20-(Nu.sub.3).sub.1-7
wherein Nu.sub.1, Nu.sub.2, and Nu.sub.3 are nucleosides, wherein
the sugar moieties of the Nu.sub.2 nucleosides are different from
the sugar moieties of the Nu.sub.1 and Nu.sub.3 nucleosides and
wherein the sugar moieties of the Nu.sub.1 nucleosides and the Nu3
nucleosides may be the same or different from one another.
[0233] In certain embodiments, gapmer oligonucleotides or regions
can have any of the following, non-limiting list of numbers of
nucleosides in the three regions (where the first number represents
the number of nucleosides in the 5'-wing, the second number
represents the number of nucleosides in the gap, and the third
number represents the number of nucleosides in the 3'-wing):
1-18-1; 1-18-2; 2-18-1; 2-18-2; 1-17-1; 1-17-2; 2-17-1; 2-17-2;
3-17-2; 3-17-1; 2-17-2; 3-17-3; 1-16-1; 2-16-2; 3-16-3; 1-16-2;
2-16-1; 2- 16-3; 3-16-2; 1-15-1; 2-15-2; 3-15-3; 4-15-4; 1-15-4;
4-15-1; 2-15-3; 1-14-1; 2-14-2; 3-14-3; 4-14-4; 1-14-2; 1-14-3;
2-14-3; 1-13-1; 2-13-2; 3;13-3; 4-13-4; 1-13-2; 2-13-3; 2-13-1;
4-13-2; 5-13-2; 5-13-4; 2-13-5; 1-12- 1; 2-12-2; 3-12-3; 4-12-4;
5-12-5; 5-12-4; 4-12-5; 3-12-5; 5-12-3; 1-11-1; 2-11-2; 3-11-3;
4-11-4; 5-11-5; 6- 11-6; 5-11-4; 4-11-5; 6-11-3; 3-11-5; 1-10-1;
2-10-2; 3-10-3; 4-10-4; 5-10-5; 6-10-6; 6-10-5; 5-10-6; 5-10-4;
4-10-5; 5-10-3; 3-10-5; 4-10-3; 3-10-4; 2-10-5; 5-10-2; 1-9-1;
2-9-2; 3-9-3; 4-9-4; 5-9-5; 6-9-6; 6-9-5; 5-9-6; 6-9-4; 4-9-6;
5-9-4; 4-9-5; 5-9-3; 3-9-5; 3-9-4; 4-9-3; 1-8-1-; 2-8-2; 3-8-3;
4-8-4; 5-8-5; 6-8-6; 6-8-5; 6-8-4; 6-8-3; 5-8-6; 4-8-6; 3-8-6;
5-8-4; 5-8-3; 5-8-2; 4-8-2; 4-8-5; 4-8-3; 4-8-2; 1-7-1; 2-7-2;
3-7-3; 4-7-4; 5-7-5; 6-7-6; 1-6-1; 2-6-2; 3-6-3; 4-6-4; 5-6-5; and
6-6-6.
[0234] In certain embodiments, the sugar moieties of the
nucleosides of one or both wings are modified sugar moieties. In
certain such embodiments, the modified nucleosides of the 5'-wing
comprise modified sugar moieties selected from any of the modified
sugar moieties described herein. In certain such embodiments, the
modified nucleosides of the 3'-wing comprise modified sugar
moieties selected from any of the modified sugar moieties described
herein. In certain embodiments, the nucleosides of the gap are
unmodified 2'-deoxynucleosides.
[0235] In certain embodiments, the sugar moieties of the wings are
sugar moieties that adopt a 3'-endo or southern conformation. In
certain such embodiments, the sugar moieties of the gap are sugar
moieties that adopt a 2'-endo or northern conformation. In certain
embodiments, the sugar moieties of both the 3'-wing and the 5'-wing
comprise a 2'-MOE and the sugars of the nucleosides of the gap are
unmodified deoxyribofuranosyl.
[0236] In certain embodiments, one or both wing region comprises
more than one type of sugar modification. For example, in certain
embodiments, the 5'-wing region comprises two different types of
sugar modifications, the gap region comprises nucleosides having a
different type of sugar moieties, and the 3' wing region comprises
two different types of sugar modifications. Such a gapmer may be
described using the earlier described convention, for example a
(1-2)-14-(2-1) means that the 5'-wing comprises 3 nucleosides,
wherein the 5' terminal nucleoside has a sugar modification of a
first-type and the next two are of a different type, but the same
as one another; the gap is 14 nucleosides in length; and the 3'
wing comprises 3 nucleosides wherein the sugar moiety of the
terminal nucleoside differs from that of the previous 2. Such
gapmers are referred to herein as "mixed wing gapmers." Such mixed
wing gapmers may have more than one type of sugar modification at
the 5' wing (5'-mixed-wing gapmers); the 3' wing (3'-mixed wing
gapmers); or both the 3'-wing and the 5'-wing (5'/3' mixed wing
gapmers).
[0237] In certain embodiments, the oligonucleotides of the present
invention comprise a region having an alternating sugar motif,
which comprises at least four separate regions of modified
nucleosides in a pattern (AB).sub.nA.sub.m where A represents a
region of nucleosides having a first type of sugar modification
(including no modification); B represent a region of nucleosides
having a different type of sugar modification (including no
modification); n is 2-15; and m is 0 or 1. Thus, in certain
embodiments, alternating motifs include 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, or 20 or more alternating regions.
In certain embodiments, each A region and each B region
independently comprises 1-4 nucleosides.
[0238] In certain embodiments, the oligonucleotides of the present
invention comprise a region that is fully sugar modified, meaning
that each nucleoside is a sugar modified nucleoside. The
modifications of the nucleosides of a fully modified oligomeric
compound may all be the same or one or more may be different from
one another.
[0239] In certain embodiments, the oligonucleotides of the present
invention comprise a region that is uniformly sugar modified, which
means that each nucleoside within that region comprises the same
sugar modification.
[0240] In certain embodiments, the sugar motif is a
nucleobase-dependent chemical motif. For example, in certain
embodiments, each pyrimidine in an oligonucleotide comprises the
same sugar modification, independent of its position within the
oligonucleotide. In certain embodiments, each purine has the same
sugar modification as one another.
[0241] In certain embodiments, oligonucleotides of the present
invention do not have nucleobase-dependent chemical motifs.
Accordingly, modifications are designed based on position, rather
than nucleobase identity. In certain such embodiments,
oligonucleotides comprise at least two nucleosides having the same
nucleobase and different sugar modifications. In certain
embodiments, oligonucleotides not having a nucleobase-dependent
chemical motif may nevertheless comprise nucleosides having the
same nucleobase having the same sugar modification. In certain such
embodiments, each nucleoside having the same nucleobase might, by
chance, have the same sugar modification (e.g., an antisense
sequence designed as a gapmer wherein each cytosine is in one of
the wing regions and thus each has the same modification).
[0242] Certain Internucleoside Linkage Motifs
[0243] In certain embodiments, oligonucleotides comprise modified
internucleoside linkages arranged along the oligonucleotide or
region thereof in a defined pattern or modified internucleoside
linkage motif. In certain embodiments, internucleoside linkages are
arranged in a gapped motif, as described above for sugar
modification motif. In such embodiments, the internucleoside
linkages in each of two wing regions are different from the
internucleoside linkages in the gap region. In certain embodiments
the internucleoside linkages in the wings are phosphodiester and
the internucleoside linkages in the gap are phosphorothioate. The
sugar modification motif is independently selected, so such
oligonucleotides having a gapped internucleoside linkage motif may
or may not have a gapped sugar modification motif and if it does
have a gapped sugar motif, the wing and gap lengths may or may not
be the same.
[0244] In certain embodiments, oligonucleotides of the present
invention comprise a region having an alternating internucleoside
linkage motif. In certain embodiments, oligonucleotides of the
present invention comprise a region of fully modified
internucleoside linkages. In certain embodiments, oligonucleotides
of the present invention comprise a region of uniformly modified
internucleoside linkages. In certain such embodiments, the
oligonucleotide comprises a region that is uniformly linked by
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide is uniformly phosphorothioate. In certain
embodiments, each internucleoside linkage of the oligonucleotide is
selected from phosphodiester and phosphorothioate.
[0245] In certain embodiments, the oligonucleotide comprises at
least 6 phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least 8
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises at least 10 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least block of at least 6 consecutive
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises at least block of at least 8
consecutive phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least block of at
least 10 consecutive phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide comprises at least block
of at least 12 consecutive phosphoro-thioate internucleoside
linkages. In certain such embodiments, at least one such block is
located at the 3' end of the oligonucleotide. In certain such
embodiments, at least one such block is located within 3
nucleosides of the 3' end of the oligonucleotide.
[0246] Certain Nucleobase Modification Motifs
[0247] In certain embodiments, oligonucleotides comprise chemical
modifications to nucleobases arranged along the oligonucleotide or
region thereof in a defined pattern or nucleobases modification
motif. In certain such embodiments, nucleobase modifications are
arranged in a gapped motif. In certain embodiments, nucleobase
modifications are arranged in an alternating motif In certain
embodiments, each nucleobase is modified (fully modified nucleobase
motif). In certain embodiments, nucleobase modifications are
uniform throughout an oligonucleotide. In certain embodiments, none
of the nucleobases is chemically modified.
[0248] In certain embodiments, oligonucleotides comprise a block of
modified nucleobases. In certain such embodiments, the block is at
the 3'-end of the oligonucleotide. In certain embodiments the block
is within 3 nucleotides of the 3'-end of the oligonucleotide. In
certain such embodiments, the block is at the 5'-end of the
oligonucleotide. In certain embodiments the block is within 3
nucleotides of the 5'-end of the oligonucleotide.
[0249] In certain embodiments, nucleobase modifications are a
function of the natural base at a particular position of an
oligonucleotide. For example, in certain embodiments each purine or
each pyrimidine in an oligonucleotide is modified. In certain
embodiments, each adenine is modified. In certain embodiments, each
guanine is modified. In certain embodiments, each thymine is
modified. In certain embodiments, each cytosine is modified. In
certain embodiments, each uricil is modified.
[0250] In certain embodiments, some, all, or none of the cytosine
moieties in an oligonucleotide are 5-methyl cytosine moieties.
Herein, 5-methyl cytosine is not a "modified nucleobase."
Accordingly, unless otherwise indicated, unmodified nucleobases
include both cytosine residues having a 5-methyl and those lacking
a 5 methyl. In certain embodiments, the methyl state of all or some
cytosine nucleobases is specified.
[0251] Certain Overall Lengths
[0252] In certain embodiments, the present invention provides
oligomeric compounds including oligonucleotides of any of a variety
of ranges of lengths. In certain embodiments, the invention
provides oligomeric compounds or oligonucleotides consisting of X
to Y linked nucleosides, where X represents the fewest number of
nucleosides in the range and Y represents the largest number of
nucleosides in the range. In certain such embodiments, X and Y are
each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and
50; provided that X.ltoreq.Y. For example, in certain embodiments,
the invention provides oligomeric compounds which comprise
oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8
to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to
20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27,
8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to
14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21,
9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to
29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10
to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22,
10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to
29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16,11to
17,11to 18,11to 19,11to 20, 11 to 21,11to 22,11to 23,11to 24,11to
25, 11 to 26,11to 27, 11 to 28, 11 to 29, 11 to 30, 12 to 13, 12 to
14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12
to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27,
12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to
17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13
to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30,
14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to
21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14
to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19,
15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to
26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16
to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25,
16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to
19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17
to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20,
18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to
27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19
to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29,
19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to
26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21
to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30,
22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to
29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23
to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29,
24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to
27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28
to 29, 28 to 30, or 29 to 30 linked nucleosides. In embodiments
where the number of nucleosides of an oligomeric compound or
oligonucleotide is limited, whether to a range or to a specific
number, the oligomeric compound or oligonucleotide may, nonetheless
further comprise additional other substituents. For example, an
oligonucleotide comprising 8-30 nucleosides excludes
oligonucleotides having 31 nucleosides, but, unless otherwise
indicated, such an oligonucleotide may further comprise, for
example one or more conjugates, terminal groups, or other
substituents.
[0253] Certain Oligonucleotides
[0254] In certain embodiments, oligonucleotides of the present
invention are characterized by their sugar motif, internucleoside
linkage motif, nucleobase modification motif and overall length. In
certain embodiments, such parameters are each independent of one
another. Thus, each internucleoside linkage of an oligonucleotide
having a gaped sugar motif may be modified or unmodified and may or
may not follow the modification pattern of the sugar modifications.
Thus, the internucleoside linkages within the wing regions of a
sugar-gapmer may be the same or different from one another and may
be the same or different from the internucleoside linkages of the
gap region. Likewise, such sugar-gapmer oligonucleotides may
comprise one or more modified nucleobase independent of the gapmer
pattern of the sugar modifications. One of skill in the art will
appreciate that such motifs may be combined to create or to
describe a variety of oligonucleotides, such as those provided in
the non-limiting table below.
TABLE-US-00001 Overall Internucleoside Length Sugar Motif Linkage
Motif Nucleobase Mod. Motif 20 5-10-5 gapmer w/2'MOE wings and
uniform PS uniform unmodified unmodified deoxyribose gap 20 5-10-5
gapmer w/2'MOE wings and 2-14-2 gapmer: PO uniform unmodified
unmodified deoxyribose gap in wings and PS in gap 20 5-10-5 gapmer
w/BNA wings and uniform PS uniform unmodified; all unmodified
deoxyribose gap C's are 5-meC 20 5-10-5 asymmetric gapmer w/2'MOE
in uniform PS uniform unmodified; no 3'-wing; BNA in 5'-wing; and
Cs are 5-meC) unmodified deoxyribose gap 18 Uniform 2'MOE uniform
PS uniform unmodified; at least one nucleobase is a 5-meC 16 2-12-2
gapmer w/BNA in each wing uniform PS uniform unmodified and
unmodified deoxyribose gap 16 2-12-2 gapmer w/2'-MOE in each wing
uniform PS uniform unmodified and unmodified deoxyribose gap 14
2-10-2 gapmer w/2'-MOE in each wing All PS or PO uniform unmodified
and unmodified deoxyribose gap 14 2-10-2 gapmer w/2'-BNA in each
wing uniform PS uniform unmodified and unmodified deoxyribose gap
16 2-12-2 gapmer w/BNA in 5'-wing; 2'- uniform PS uniform
unmodified MOE in 3'-wing; and unmodified deoxyribose gap 16 2-12-2
gapmer w/BNA in 5'-wing; uniform PS uniform unmodified mixed 2'-MOE
and BNA in 3'-wing; and unmodified deoxyribose gap 22 5-12-5 gapmer
w/BNA in 5'-wing; uniform PS uniform unmodified mixed 2'-MOE and
BNA in 3'-wing; and unmodified deoxyribose gap 16 (1-2)-10-(2-1)
mixed wing gapmer: uniform PS uniform unmodified
MOE-BNA-DNA-BNA-MOE
The above table is intended only to illustrate and not to limit the
various combinations of the parameters of oligonucleotides of the
present invention. Herein if a description of an oligonucleotide or
oligomeric compound is silent with respect to one or more
parameter, such parameter is not limited. Thus, an oligomeric
compound described only as having a gapmer sugar motif without
further description may have any length, internucleoside linkage
motif, and nucleobase modification motif. Unless otherwise
indicated, all chemical modifications are independent of nucleobase
sequence.
[0255] Certain Conjugate Groups
[0256] In certain embodiments, oligomeric compounds are modified by
attachment of one or more conjugate groups. In general, conjugate
groups modify one or more properties of the attached oligomeric
compound including but not limited to pharmacodynamics,
pharmacokinetics, stability, binding, absorption, cellular
distribution, cellular uptake, charge and clearance. Conjugate
groups are routinely used in the chemical arts and are linked
directly or via an optional conjugate linking moiety or conjugate
linking group to a parent compound such as an oligomeric compound,
such as an oligonucleotide. Conjugate groups includes without
limitation, intercalators, reporter molecules, polyamines,
polyamides, polyethylene glycols, thioethers, polyethers,
cholesterols, thiocholesterols, cholic acid moieties, folate,
lipids, phospholipids, biotin, phenazine, phenanthridine,
anthraquinone, adamantane, acridine, fluoresceins, rhodamines,
coumarins and dyes. Certain conjugate groups have been described
previously, for example: cholesterol moiety (Letsinger et al.,
Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid
(Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med.
Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et
al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain,
e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al.,
EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990,
259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0257] In certain embodiments, a conjugate group comprises an
active drug substance, for example, aspirin, warfarin,
phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen,
(S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a
barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an
antibacterial or an antibiotic. Oligonucleotide-drug conjugates and
their preparation are described in U.S. patent application Ser. No.
09/334,130.
[0258] In certain embodiments, conjugate groups are directly
attached to oligonucleotides in oligomeric compounds. In certain
embodiments, conjugate groups are attached to oligonucleotides by a
conjugate linking group. In certain such embodiments, conjugate
linking groups, including, but not limited to, bifunctional linking
moieties such as those known in the art are amenable to the
compounds provided herein. Conjugate linking groups are useful for
attachment of conjugate groups, such as chemical stabilizing
groups, functional groups, reporter groups and other groups to
selective sites in a parent compound such as for example an
oligomeric compound. In general a bifunctional linking moiety
comprises a hydrocarbyl moiety having two functional groups. One of
the functional groups is selected to bind to a parent molecule or
compound of interest and the other is selected to bind essentially
any selected group such as chemical functional group or a conjugate
group. In some embodiments, the conjugate linker comprises a chain
structure or an oligomer of repeating units such as ethylene glycol
or amino acid units. Examples of functional groups that are
routinely used in a bifunctional linking moiety include, but are
not limited to, electrophiles for reacting with nucleophilic groups
and nucleophiles for reacting with electrophilic groups. In some
embodiments, bifunctional linking moieties include amino, hydroxyl,
carboxylic acid, thiol, unsaturations (e.g., double or triple
bonds), and the like.
[0259] Some nonlimiting examples of conjugate linking moieties
include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC)
and 6-aminohexanoic acid (AHEX or AHA). Other linking groups
include, but are not limited to, substituted C.sub.1-C.sub.10
alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or
substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a
nonlimiting list of preferred substituent groups includes hydroxyl,
amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy,
halogen, alkyl, aryl, alkenyl and alkynyl.
[0260] Conjugate groups may be attached to either or both ends of
an oligonucleotide (terminal conjugate groups) and/or at any
internal position.
[0261] In certain embodiments, conjugate groups are at the 3'-end
of an oligonucleotide of an oligomeric compound. In certain
embodiments, conjugate groups are near the 3'-end. In certain
embodiments, conjugates are attached at the 3'end of an oligomeric
compound, but before one or more terminal group nucleosides. In
certain embodiments, conjugate groups are placed within a terminal
group. In certain embodiments, the present invention provides
oligomeric compounds. In certain embodiments, oligomeric compounds
comprise an oligonucleotide. In certain embodiments, an oligomeric
compound comprises an oligonucleotide and one or more conjugate
and/or terminal groups. Such conjugate and/or terminal groups may
be added to oligonucleotides having any of the chemical motifs
discussed above. Thus, for example, an oligomeric compound
comprising an oligonucleotide having region of alternating
nucleosides may comprise a terminal group.
Antisense Compounds
[0262] In certain embodiments, oligomeric compounds of the present
invention are antisense compounds. Such antisense compounds are
capable of hybridizing to a target nucleic acid, resulting in at
least one antisense activity. In certain embodiments, antisense
compounds specifically hybridize to one or more target nucleic
acid. In certain embodiments, a specifically hybridizing antisense
compound has a nucleobase sequence comprising a region having
sufficient complementarity to a target nucleic acid to allow
hybridization and result in antisense activity and insufficient
complementarity to any non-target so as to avoid non-specific
hybridization to any non-target nucleic acid sequences under
conditions in which specific hybridization is desired (e.g., under
physiological conditions for in vivo or therapeutic uses, and under
conditions in which assays are performed in the case of in vitro
assays).
[0263] In certain embodiments, the present invention provides
antisense compounds comprising oligonucleotides that are fully
complementary to the target nucleic acid over the entire length of
the oligonucleotide. In certain embodiments, oligonucleotides are
99% complementary to the target nucleic acid. In certain
embodiments, oligonucleotides are 95% complementary to the target
nucleic acid. In certain embodiments, such oligonucleotides are 90%
complementary to the target nucleic acid. In certain embodiments,
such oligonucleotides are 85% complementary to the target nucleic
acid. In certain embodiments, such oligonucleotides are 80%
complementary to the target nucleic acid. In certain embodiments,
an antisense compound comprises a region that is fully
complementary to a target nucleic acid and is at least 80%
complementary to the target nucleic acid over the entire length of
the oligonucleotide. In certain such embodiments, the region of
full complementarity is from 6 to 14 nucleobases in length.
Certain Antisense Activities and Mechanisms
[0264] Antisense activities include, but are not limited to a
change in the amount, expression, and/or function of a target
nucleic acid. Antisense activity may be mediated by any of a
variety of mechanisms. In certain embodiments, hybridization of the
antisense compound results in cleavage of the target nucleic acid.
For example, certain antisense compounds result in RNase H mediated
cleavage of target nucleic acid. RNase H is a cellular endonuclease
that cleaves the RNA strand of an RNA:DNA duplex. The "DNA" in such
an RNA:DNA duplex, need not be unmodified DNA. In certain
embodiments, the invention provides antisense compounds that are
sufficiently "DNA-like" to elicit RNase H activity. Such DNA-like
antisense compounds include, but are not limited to gapmers having
unmodified deoxyfuronose sugar moieties in the nucleosides of the
gap and modified sugar moieties in the nucleosides of the wings.
Another example of antisense mechanisms that may result in cleavage
of a target nucleic acid includes, without limitation RNAi
mechanisms, which utilize the RISC pathway. Antisense compounds
that elicit cleavage at least in part via RNAi mechanisms include
short-interfering RNAs (siRNA), which are typically
double-stranded, and single-stranded RNAi compounds (ssRNAi). Such
antisense compounds typically comprise one or more RNA nucleosides
or modified nucleosides that are RNA-like. In certain embodiments,
oligomeric compounds of the present invention are RNAi compounds.
In certain embodiments, oligomeric compounds of the present
invention are ssRNA compounds. In certain embodiments, oligomeric
compounds of the present invention are paired with a second
oligomeric compound to form an siRNA. In certain such embodiments,
the second oligomeric compound is also an oligomeric compound of
the present invention. In certain embodiments, the second
oligomeric compound is any modified or unmodified nucleic acid. In
certain embodiments, the oligomeric compound of the present
invention is the antisense strand in an siRNA compound. In certain
embodiments, the oligomeric compound of the present invention is
the sense strand in an siRNA compound.
[0265] Certain antisense mechanisms typically do not necessarily
promote immediate enzyme mediated cleavage of the target nucleic
acid, but nonetheless disrupt or alter its function or activity. In
certain embodiments, antisense compounds are microRNA mimics, which
involve certain components of the RISC pathway, but typically
result in sequestration, rather than immediate cleavage of the
target nucleic acid. Certain antisense compounds exert antisense
activity by occupancy (i.e., presence of the antisense compound
hybridized to the target nucleic acid results in a change in the
function of the target nucleic acid and/or in the way the target
nucleic acid interacts with another molecule). For example, in
certain embodiments, antisense compounds hybridize to a pre-mRNA
and alter processing of the pre-mRNA. For example, in certain
embodiments, the antisense compound modulates polyadenylation
and/or addition of the 5'-cap. In certain such embodiments, the
resulting mRNA with altered or absent polyadenylation or 5-cap may
be less stable than the non-modulated form. Thus, the antisense
activity may ultimately result in the generation of a mature mRNA
that is degraded more quickly than one in which such functions has
not been altered.
[0266] In certain embodiments, the antisense compound alters
splicing of the pre-mRNA, resulting in a differently spliced mature
mRNA. Modulation of splicing may result in a change in the
inclusion or exclusion of a portion of pre-mRNA (intron, exon,
alternate intron, or alternate exon) in the mature mRNA compared to
that of a mature mRNA in the absence of the antisense compound.
Such splice-altered mature mRNA may have different stability
characteristics. Thus, the splice-altered mRNA may degrade more or
less quickly resulting in a corresponding increase or decrease in
the protein expressed from the mature mRNA. In certain embodiments,
a splice-altered mature mRNA may encode a different protein than
the unaltered mRNA. In certain embodiments, an antisense compound
alters the ratio of splice variants of a protein product, wherein
both splice variants are present in the absence of the antisense
compound, but at different amounts. In certain embodiments, an
antisense compound alters splicing ultimately resulting in a
protein product that is not present in the absence of the antisense
compound.
[0267] Antisense activities may be observed directly or indirectly.
In certain embodiments, observation or detection of an antisense
activity involves observation or detection of a change in an amount
of a target nucleic acid or protein encoded by such target nucleic
acid; a change in the ratio of splice variants of a nucleic acid or
protein; and/or a phenotypic change in a cell or animal.
Certain Target Nucleic Acids
[0268] In certain embodiments, antisense compounds comprise or
consist of an oligonucleotide comprising a region that is
complementary to a target nucleic acid. In certain embodiments, the
target nucleic acid is an endogenous RNA molecule. In certain
embodiments, the target nucleic acid is a non-coding RNA (ncRNA).
In certain such embodiments, the target non-coding RNA is selected
from: a long-non-coding RNA, a short non-coding RNA, an intronic
RNA, a snoRNA, a scaRNA, a microRNA (including pre-microRNA and
mature microRNA), a ribosomal RNA (rRNA), and promoter directed
RNA. In certain embodiments, a target nucleic acid is a non-coding
RNA other than a microRNA. In certain embodiments, the target
nucleic acid encodes a protein. In certain such embodiments, the
target nucleic acid is selected from: an mRNA and a pre-mRNA,
including intronic, exonic and untranslated regions thereof. In
certain embodiments, antisense compounds are at least partially
complementary to more than one target nucleic acid. For example,
oligomeric compounds of the present invention may mimic microRNAs,
which typically bind to multiple targets.
[0269] In certain embodiments, target nucleic acids are localized
in an organelle within a cell. In certain embodiments, a target
nucleic acid is a nuclear retained RNA. In certain such
embodiments, a target nucleic acid is a short-nuclear RNA (snRNA).
In certain embodiments, target nucleic acids are localized in a
sub-organelle within an organelle in a cell. In certain
embodiments, target nucleic acids are localized in a sub-organelle
within the nucleus of a cell. In certain embodiments, target
nucleic acids are localized within a nucleolus. In certain
embodiments, target nucleic acids are localized within a cajal
body. In certain embodiments, a target nucleic acid is a snoRNA. In
certain embodiments, a target nucleic acid is a scaRNA.
[0270] In certain embodiments, a target nucleic acid is a snoRNA.
Hundreds of eukaryotic snoRNAs have been identified. Certain
snoRNAs have been divided into one of two major groups: C/D box
snoRNAs and H/ACA box snoRNAs. The present invention provides
antisense compounds targeting snoRNAs, including, but is not
limited to, antisense compounds targeting to C/D box snoRNAs and/or
H/ACA box snoRNAs. In certain instances, snoRNAs guide
site-specific nucleotide modifications in rRNAs and/or other
ncRNAs. Generally, C/D snoRNA mediate 2'-O-methylation and H/ACA
snoRNA mediate pseudouridylation (.PSI.), through base-pairing with
a substrate RNA. The mechanisms of RNA-guided RNA modification are
conserved in eukaryotes, and similar machineries also exist in
archae. Although certain yeast snoRNAs have been characterized
through genetic knockout, the functions of many snoRNAs in other
organisms have not been verified. This is particularly problematic
since many snoRNAs are species specific. Certain human snoRNAs have
been predicted to guide modifications in rRNAs and ncRNAs,
including snRNAs, but in certain instances, those predictions have
not been experimentally confirmed. In addition, .about.110 in
.about.360 human snoRNAs have no identified target sites in rRNAs
or snRNAs, suggesting those snoRNAs have other roles, e.g., in
modulating expression of protein-coding genes. Indeed, a mammalian
snoRNA (HBII52) has been shown to regulate alternative splicing,
and snoRNA-originated miRNAs have been identified. In certain
instances, the snoRNA-related machinery has been implicated in
human diseases, e.g., Dyskeratosis congenita and Prader-Willi
syndrome, thus it is important to functionalize snoRNAs, and to
manipulate their expression for therapeutic purposes.
Certain Mechanisms/Uses
[0271] In certain embodiments, the present invention provides
compositions and methods for reducing the amount or activity of a
target nucleic acid. In certain embodiments, the invention provides
compositions comprising antisense compounds and methods. In certain
embodiments, the invention provides compositions comprising
antisense compounds and methods based on activation of RNase H. In
certain embodiments, the invention provides RNAi compounds and
methods. In certain embodiments, the invention provides antisense
compounds and methods that do not depend on the RNAi pathway. In
certain embodiments, the invention provides antisense compounds
based on occupation of the target nucleic acid.
[0272] In certain embodiments, the present invention provides
compositions and methods for reducing the amount or activity of a
target nucleic acid in a cell. In certain embodiments, the cell is
in an animal. In certain embodiments, the animal is a mammal. In
certain embodiments, the animal is a rodent. In certain
embodiments, the animal is a primate. In certain embodiments, the
animal is a non-human primate. In certain embodiments, the animal
is a human. In certain embodiments, the cell is a liver cell. In
certain embodiments, the cell is an epithelial cell. In certain
embodiments, the cell is a cancer cell.
[0273] In certain embodiments, the present invention provides
methods of administering a pharmaceutical composition comprising an
oligomeric compound of the present invention to an animal. Suitable
administration routes include, but are not limited to, oral,
rectal, transmucosal, intestinal, enteral, topical, suppository,
through inhalation, intrathecal, intraventricular, intraperitoneal,
intranasal, intraocular, intratumoral, and parenteral (e.g.,
intravenous, intramuscular, intramedullary, and subcutaneous). In
certain embodiments, pharmaceutical intrathecals are administered
to achieve local rather than systemic exposures. For example,
pharmaceutical compositions may be injected directly in the area of
desired effect (e.g., into the liver).
[0274] In certain embodiments, antisense compounds of the present
invention modulate the amount, activity, and/or function of a
target nucleic acid in a cell. In certain such embodiments, the
target nucleic acid is an snRNA. In certain embodiments, the target
nucleic acid is a target sub-nuclear nucleic acid. In certain
embodiments, the target nucleic acid is a target sub-nuclear
nucleic acid. In certain such embodiments, the target sub-nuclear
nucleic acid is a snoRNA, including, but not limited to C/D box
snoRNAs and H/ACA box snoRNAs. In certain such embodiments,
antisense compounds reduce the amount, activity, and/or function of
a target snoRNA. In certain embodiments, such antisense compounds
are used to functionalize the target snoRNA. Such functionalization
may be performed in vitro and/or in vivo.
[0275] In certain embodiments, antisense compounds are used to
modulate an object nucleic acid. In certain embodiments, antisense
compounds are used to functionalize an object nucleic acid. In
certain embodiments, the object nucleic acid is a rRNA. In certain
embodiments, antisense compounds of the present invention are used
to disrupt normal processing of an rRNA to study rRNA function in a
cell. In certain embodiments, the object nucleic acid is a
pre-mRNA. In certain embodiments, inhibition of a target snoRNA
results in altered splicing of an object pre-mRNA, ultimately
resulting in an altered protein. In certain embodiments, an object
nucleic acid is an object ncRNA. In certain embodiments, antisense
compounds disrupt processing of an object ncRNA to allow
functionalization of the ncRNA. Such disruption of processing of
object nucleic acid may be performed in vitro and/or in vivo.
[0276] In certain embodiments, antisense compounds targeting snoRNA
have therapeutic use. Certain snoRNAs have been associated with
diseases. In certain embodiments, modulation of snoRNAs using
antisense compounds is predicted to provide a therapeutic benefit.
In certain embodiments, antisense compounds targeting snoRNAs are
used to treat Dyskeratosis congenita and/or Prader-Willi syndrome.
Functionalization of snoRNAs is expected to result in
identification of additional specific therapeutic opportunities.
Disruption of target snoRNA and/or associated object nucleic acid
processing is expected to interfere with cellular function. In
certain embodiments, such disruption is expected to disrupt cell
cycling. In certain embodiments, disruption of object nucleic acid
is used to treat cancer. In certain embodiments, antisense
compounds targeting one or more snoRNA disrupt processing of rRNA,
which disrupts cell cycling and/or results in toxicity to the cell.
In certain instances, such disruption or toxicity ultimately
resulting from the antisense compounds is desirable, for example in
treating cancer.
[0277] Difficulty reducing snoRNA has been reported. Such
difficulty results from several factors: 1) snoRNAs are highly
structured and exist in stable snoRNP complexes; 2) many vertebrate
snoRNAs are encoded in introns of host genes, and are
released/processed post-transcriptionally; 3) many snoRNA genes
have multi-copies or isoforms. Although over-expression of
antisense RNA or dsRNA in trypanosomes has been shown to degrade
snoRNAs, not all tested snoRNAs were depleted. In addition, several
approaches have been tested to reduce mammalian snoRNAs, including
siRNA, ribozyme, locked nucleic acid (LNA), and peptide-nucleic
acid oligonucleotides. In no case was the function of the targeted
snoRNA disrupted. Modulation of snoRNA using antisense compounds
has been reported. For example, reduction of certain snoRNAs in
cultured cells following nucleofection by electroporation has been
reported. See Ideue et al., RNA 2009 15: 1578-1587, which is hereby
incorporated by reference in its entirety. The present invention
does not require electroporation, making it amenable to use in
vivo.
[0278] In certain instances, snoRNAs are transcribed within a host
nucleic acid. In certain such instances, the snoRNA is an intronic
portion of a host pre-mRNA. In certain embodiments, antisense
compounds of the present invention selectively reduce or inhibit a
snoRNA without reducing or inhibiting the remainder of the host
nucleic acid. Accordingly, in such embodiments, the amount,
activity and function of the host pre-mRNA and the mRNA and protein
ultimately expressed from the host pre-mRNA are essentially
unchanged, relative to the reduction in the snoRNA. In certain
embodiments, target snoRNA activity is reduced by at least 80%
compared to untreated cells while activity of the host RNA and/or
protein is reduced by less than 10%.
[0279] Certain snoRNAs share substantial identity with one another.
In certain embodiments, the present invention provides antisense
compounds that selectively inhibit a target snoRNA, while a
non-target snoRNA is essentially unchanged. In certain such
embodiments, the non-target snoRNA is a distinct isoform of the
target snoRNA. In certain embodiments, the target and non-target
snoRNAs share up to 70% identity. In certain embodiments, the
target and non-target snoRNAs share up to 80% identity. In certain
embodiments, the target and non-target snoRNAs share up to 85%
identity. In certain embodiments, the target and non-target snoRNAs
share up to 90% identity. In certain embodiments, the target and
non-target snoRNAs share up to 95% identity. In certain
embodiments, target snoRNA activity is reduced by at least 80%
compared to untreated cells while activity of the non-target snoRNA
is reduced by less than 10%.
[0280] In certain embodiments, the invention provides antisense
compounds targeting scaRNAs, which are similar to snoRNAs, except
that they are localized to cajal bodies, rather than to the
nucleolus. Thus, in certain embodiments, the present invention
provides antisense compounds that may be used to modulate scaRNAs
and/or object nucleic acids associated with scRNAs. Such antisense
compounds may be used to functionalize scaRNAs and/or object RNAs
and/or may have therapeutic uses. Also similar to antisense
compound to snoRNAs, in certain embodiments, antisense compounds to
scaRNAs leave the amount, activity and expression of a host nucleic
acid essentially unchanged.
[0281] In certain embodiments, the present invention provides
methods of simultaneously reducing the amount and/or activity of
more than one target sub-nuclear nucleic acid at a time. In certain
embodiments, the invention provides methods of simultaneously
reducing the amount and/or activity of more than one snoRNA at a
time.
[0282] In certain embodiments, it is useful for inhibition of one
or more target sub-nuclear nucleic acid to persist for several
hours or days, for example, to allow depletion to facilitate
functionalization of the target sub-nuclear nucleic acid and/or one
or more object nucleic acids. A long duration of action may also be
desirable in therapeutic uses. In certain embodiments, antisense
compounds reduce the amount or activity of a target sub-nuclear
nucleic acid more than 48 hours. In certain embodiments, antisense
compounds reduce the amount or activity of a target sub-nuclear
nucleic acid more than 72 hours. In certain embodiments, antisense
compounds reduce the amount or activity of a target sub-nuclear
nucleic acid more than 96 hours. In certain embodiments, antisense
compounds reduce the amount or activity of a target sub-nuclear
nucleic acid more than 100 hours.
[0283] In certain embodiments, antisense compounds complementary to
a target sub-nuclear nucleic acid have unexpected potency. Since
such target sub-nuclear nucleic acids are localized in
sub-organelles, have secondary structure and are associated with
proteins, they are expected to be difficult to inhibit. Certain
antisense compounds of the present invention are surprisingly
potent. In certain embodiments, the invention provides antisense
compounds capable of inhibiting a target sub-nuclear nucleic acid
in an animal when administered at a dose of 400 mg/kg. In certain
embodiments, the invention provides antisense compounds capable of
inhibiting a target sub-nuclear nucleic acid in an animal when
administered at a dose of 200 mg/kg. In certain embodiments, the
invention provides antisense compounds capable of inhibiting a
target sub-nuclear nucleic acid in an animal when administered at a
dose of 100 mg/kg. In certain embodiments, the invention provides
antisense compounds capable of inhibiting a target sub-nuclear
nucleic acid in an animal when administered at a dose of 50 mg/kg.
In certain embodiments, the invention provides antisense compounds
capable of inhibiting a target sub-nuclear nucleic acid in an
animal when administered at a dose of 25 mg/kg. In certain
embodiments, the invention provides antisense compounds capable of
inhibiting a target sub-nuclear nucleic acid in an animal when
administered at a dose of 10 mg/kg. In certain embodiments, the
invention provides antisense compounds capable of inhibiting a
target sub-nuclear nucleic acid in an animal when administered at a
dose of 5 mg/kg. In certain embodiments, the invention provides
antisense compounds capable of inhibiting a target sub-nuclear
nucleic acid in an animal when administered at a dose of 1 mg/kg.
In certain such embodiments, the target sub-nuclear nucleic acid is
a snoRNA. In certain embodiments, the target sub-nuclear nucleic
acid is a scaRNA.
Certain Pharmaceutical Compositions
[0284] In certain embodiments, the present invention provides
pharmaceutical compositions comprising one or more antisense
compound. In certain embodiments, such pharmaceutical composition
comprises a a suitable pharmaceutically acceptable diluent or
carrier. In certain embodiments, a pharmaceutical composition
comprises a sterile saline solution and one or more antisense
compound. In certain embodiments, such pharmaceutical composition
consists of a sterile saline solution and one or more antisense
compound. In certain embodiments, the sterile saline is
pharmaceutical grade saline. In certain embodiments, a
pharmaceutical composition comprises one or more antisense compound
and sterile water. In certain embodiments, a pharmaceutical
composition consists of one or more antisense compound and sterile
water. In certain embodiments, the sterile saline is pharmaceutical
grade water. In certain embodiments, a pharmaceutical composition
comprises one or more antisense compound and phosphate-buffered
saline (PBS). In certain embodiments, a pharmaceutical composition
consists of one or more antisense compound and sterile
phosphate-buffered saline (PBS). In certain embodiments, the
sterile saline is pharmaceutical grade PBS.
[0285] In certain embodiments, antisense compounds may be admixed
with pharmaceutically acceptable active and/or inert substances for
the preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical
compositions depend on a number of criteria, including, but not
limited to, route of administration, extent of disease, or dose to
be administered.
[0286] Pharmaceutical compositions comprising antisense compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters. In certain embodiments, pharmaceutical compositions
comprising antisense compounds comprise one or more oligonucleotide
which, upon administration to an animal, including a human, is
capable of providing (directly or indirectly) the biologically
active metabolite or residue thereof. Accordingly, for example, the
disclosure is also drawn to pharmaceutically acceptable salts of
antisense compounds, prodrugs, pharmaceutically acceptable salts of
such prodrugs, and other bioequivalents. Suitable pharmaceutically
acceptable salts include, but are not limited to, sodium and
potassium salts.
[0287] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an oligomeric compound which are
cleaved by endogenous nucleases within the body, to form the active
antisense oligomeric compound.
[0288] Lipid moieties have been used in nucleic acid therapies in a
variety of methods. In certain such methods, the nucleic acid is
introduced into preformed liposomes or lipoplexes made of mixtures
of cationic lipids and neutral lipids. In certain methods, DNA
complexes with mono- or poly-cationic lipids are formed without the
presence of a neutral lipid. In certain embodiments, a lipid moiety
is selected to increase distribution of a pharmaceutical agent to a
particular cell or tissue. In certain embodiments, a lipid moiety
is selected to increase distribution of a pharmaceutical agent to
fat tissue. In certain embodiments, a lipid moiety is selected to
increase distribution of a pharmaceutical agent to muscle
tissue.
[0289] In certain embodiments, INTRALIPID is used to prepare a
pharmaceutical composition comprising an oligonucleotide.
Intralipid is fat emulsion prepared for intravenous administration.
It is made up of 10% soybean oil, 1.2% egg yolk phospholipids,
2.25% glycerin, and water for injection. In addition, sodium
hydroxide has been added to adjust the pH so that the final product
pH range is 6 to 8.9.
[0290] In certain embodiments, a pharmaceutical composition
provided herein comprise a polyamine compound or a lipid moiety
complexed with a nucleic acid. In certain embodiments, such
preparations comprise one or more compounds each individually
having a structure defined by formula (I) or a pharmaceutically
acceptable salt thereof,
##STR00010##
[0291] wherein each X.sup.a and X.sup.b, for each occurrence, is
independently C.sub.1-6 alkylene; n is 0, 1, 2, 3, 4, or 5; each R
is independently H, wherein at least n+2 of the R moieties in at
least about 80% of the molecules of the compound of formula (I) in
the preparation are not H; m is 1, 2, 3 or 4; Y is O, NR.sup.2, or
S; R.sup.1 is alkyl, alkenyl, or alkynyl; each of which is
optionally substituted with one or more substituents; and R.sup.2
is H, alkyl, alkenyl, or alkynyl; each of which is optionally
substituted each of which is optionally substituted with one or
more substituents; provided that, if n=0, then at least n+3 of the
R moieties are not H. Such preparations are described in PCT
publication WO/2008/042973, which is herein incorporated by
reference in its entirety for the disclosure of lipid preparations.
Certain additional preparations are described in Akinc et al.,
Nature Biotechnology 26, 561-569 (01 May 2008), which is herein
incorporated by reference in its entirety for the disclosure of
lipid preparations.
[0292] In certain embodiments, pharmaceutical compositions provided
herein comprise one or more modified oligonucleotides and one or
more excipients. In certain such embodiments, excipients are
selected from water, salt solutions, alcohol, polyethylene glycols,
gelatin, lactose, amylase, magnesium stearate, talc, silicic acid,
viscous paraffin, hydroxymethylcellulose and
polyvinylpyrrolidone.
[0293] In certain embodiments, a pharmaceutical composition
provided herein comprises a co-solvent system. Certain of such
co-solvent systems comprise, for example, benzyl alcohol, a
nonpolar surfactant, a water-miscible organic polymer, and an
aqueous phase. In certain embodiments, such co-solvent systems are
used for hydrophobic compounds. A non-limiting example of such a
co-solvent system is the VPD co-solvent system, which is a solution
of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the
nonpolar surfactant Polysorbate 80.TM. and 65% w/v polyethylene
glycol 300. The proportions of such co-solvent systems may be
varied considerably without significantly altering their solubility
and toxicity characteristics. Furthermore, the identity of
co-solvent components may be varied: for example, other surfactants
may be used instead of Polysorbate 80.TM.; the fraction size of
polyethylene glycol may be varied; other biocompatible polymers may
replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other
sugars or polysaccharides may substitute for dextrose.
[0294] In certain embodiments, a pharmaceutical composition
provided herein is prepared for oral administration. In certain
embodiments, pharmaceutical compositions are prepared for buccal
administration.
[0295] In certain embodiments, a pharmaceutical composition is
prepared for administration by injection (e.g., intravenous,
subcutaneous, intramuscular, etc.). In certain of such embodiments,
a pharmaceutical composition comprises a carrier and is formulated
in aqueous solution, such as water or physiologically compatible
buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. In certain embodiments, other
ingredients are included (e.g., ingredients that aid in solubility
or serve as preservatives). In certain embodiments, injectable
suspensions are prepared using appropriate liquid carriers,
suspending agents and the like. Certain pharmaceutical compositions
for injection are presented in unit dosage form, e.g., in ampoules
or in multi-dose containers. Certain pharmaceutical compositions
for injection are suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Certain solvents
suitable for use in pharmaceutical compositions for injection
include, but are not limited to, lipophilic solvents and fatty
oils, such as sesame oil, synthetic fatty acid esters, such as
ethyl oleate or triglycerides, and liposomes. Aqueous injection
suspensions may contain substances that increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran. Optionally, such suspensions may also contain suitable
stabilizers or agents that increase the solubility of the
pharmaceutical agents to allow for the preparation of highly
concentrated solutions.
[0296] In certain embodiments, a pharmaceutical composition is
prepared for transmucosal administration. In certain of such
embodiments penetrants appropriate to the barrier to be permeated
are used in the formulation. Such penetrants are generally known in
the art.
[0297] In certain embodiments, a pharmaceutical composition is
prepared for administration by inhalation. Certain of such
pharmaceutical compositions for inhalation are prepared in the form
of an aerosol spray in a pressurized pack or a nebulizer. Certain
of such pharmaceutical compositions comprise a propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
certain embodiments using a pressurized aerosol, the dosage unit
may be determined with a valve that delivers a metered amount. In
certain embodiments, capsules and cartridges for use in an inhaler
or insufflator may be formulated. Certain of such formulations
comprise a powder mixture of a pharmaceutical agent of the
invention and a suitable powder base such as lactose or starch.
[0298] In certain embodiments, a pharmaceutical composition is
prepared for rectal administration, such as a suppositories or
retention enema. Certain of such pharmaceutical compositions
comprise known ingredients, such as cocoa butter and/or other
glycerides.
[0299] In certain embodiments, a pharmaceutical composition is
prepared for topical administration. Certain of such pharmaceutical
compositions comprise bland moisturizing bases, such as ointments
or creams. Exemplary suitable ointment bases include, but are not
limited to, petrolatum, petrolatum plus volatile silicones, and
lanolin and water in oil emulsions. Exemplary suitable cream bases
include, but are not limited to, cold cream and hydrophilic
ointment.
[0300] In certain embodiments, a pharmaceutical composition
provided herein comprises an oligonucleotide in a therapeutically
effective amount. In certain embodiments, the therapeutically
effective amount is sufficient to prevent, alleviate or ameliorate
symptoms of a disease or to prolong the survival of the subject
being treated. Determination of a therapeutically effective amount
is within the capability of those skilled in the art.
[0301] In certain embodiments, one or more modified oligonucleotide
provided herein is formulated as a prodrug. In certain embodiments,
upon in vivo administration, a prodrug is chemically converted to
the biologically, pharmaceutically or therapeutically more active
form of an oligonucleotide. In certain embodiments, prodrugs are
useful because they are easier to administer than the corresponding
active form. For example, in certain instances, a prodrug may be
more bioavailable (e.g., through oral administration) than is the
corresponding active form. In certain instances, a prodrug may have
improved solubility compared to the corresponding active form. In
certain embodiments, prodrugs are less water soluble than the
corresponding active form. In certain instances, such prodrugs
possess superior transmittal across cell membranes, where water
solubility is detrimental to mobility. In certain embodiments, a
prodrug is an ester. In certain such embodiments, the ester is
metabolically hydrolyzed to carboxylic acid upon administration. In
certain instances the carboxylic acid containing compound is the
corresponding active form. In certain embodiments, a prodrug
comprises a short peptide (polyaminoacid) bound to an acid group.
In certain of such embodiments, the peptide is cleaved upon
administration to form the corresponding active form.
EXAMPLES
Example 1
Antisense Inhibition of Human C/D Box Small Nucleolar (sno) RNA U16
in Hela Cells
[0302] Antisense oligonucleotides were designed targeting a U16
snoRNA nucleic acid (FIG. 1) and were tested for their effects on
U16 mRNA in vitro. The chimeric antisense oligonucleotides in Table
1 were designed as 5-10-5 MOE gapmers. The gapmers were 20
nucleotides in length, wherein the central gap segment was
comprised of ten 2'-deoxynucleotides and flanked on each side (in
the 5' and 3' directions) by wings comprising five nucleotides
each. Each nucleotide in the 5' wing segment and each nucleotide in
the 3' wing segment had a 2'-MOE modified sugar moiety. The
internucleoside linkages throughout each gapmer were
phosphorothioate (P.dbd.S) linkages. All cytidine residues
throughout each gapmer were 5-methylcytidines. Each gapmer listed
in Table 1 is complementary to SEQ ID NO: 1 (complement of GENBANK
Accession No. NT_010194.16 truncated from nucleotides 37585444 to
37585593).
[0303] Hela cells were cultured on 6-well plates in DMEM medium
supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with the antisense
oligonucleotides at a 50 nM concentration in Opti-MEM medium
containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA) for 4
hours, after which the transfection media was replaced with fresh
culture medium. After a period of approximately 48 hours, RNA was
isolated from the cells and the U16 snoRNA levels were determined
as follows.
[0304] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using a U16 snoRNA-specific 5'-end
labeled oligonucleotide probe (5'-TTGCTCAGTAAGAATTTTCG-3',
designated herein as SEQ ID NO: 2), as described in Liang et al
(Mol. Cell 28: 965-977, 2007). U4 snRNA-specific probe
(5'-ATTGCCAGTGCCGACTATAT-3', designated herein as SEQ ID NO: 3)
served as a control for loading. The density of the bands was
scanned using an ImageJ densitometer and demonstrated that ISIS
462025 and ISIS 462026 reduced U16 snoRNA levels by 90% (FIG.
2).
TABLE-US-00002 TABLE 1 Chimeric antisense oligonucleotides having
5-10-5 MOE wings and deoxy gap targeted to U16 snoRNA Start Stop
ISIS SEQ Site Site No. Sequence ID NO. 1 20 462015
ATAACCCCATATAAATGAAG 4 9 28 462016 CAAGCAAAATAACCCCATAT 5 15 34
462017 TCATTGCAAGCAAAATAACC 6 20 39 462018 CGACATCATTGCAAGCAAAA 7
25 44 462019 AATTACGACATCATTGCAAG 8 30 49 462020
ACGCAAATTACGACATCATT 9 35 54 462021 GTAAGACGCAAATTACGACA 10 40 59
462022 ACAGAGTAAGACGCAAATTA 11 47 66 462023 GCTGAGAACAGAGTAAGACG 12
52 71 462024 CTGTCGCTGAGAACAGAGTA 13 57 76 462025
GGCAACTGTCGCTGAGAACA 14 62 81 462026 CAGCAGGCAACTGTCGCTGA 15 67 86
462027 ACTGACAGCAGGCAACTGTC 16 72 91 462028 AGCTTACTGACAGCAGGCAA 17
77 96 462029 GTACCAGCTTACTGACAGCA 18 83 102 462030
CCTTCTGTACCAGCTTACTG 19 88 107 462031 GTCAACCTTCTGTACCAGCT 20 107
126 462032 TTGCTCAGTAAGAATTTTCG 21 112 131 462033
ATTTCTTGCTCAGTAAGAAT 22 118 137 462034 AAGGTTATTTCTTGCTCAGT 23 123
142 462035 ACAACAAGGTTATTTCTTGC 24 128 147 462036
TAATTACAACAAGGTTATTT 25
[0305] In a separate experiment, the structure of U16 snoRNA was
probed. Nuclei were prepared from Hela cells and incubated with or
without 3% dimethylsulphate (DMS) at room temperature for 4 min.
RNA was prepared and subjected to primer extension using a 5'
labeled probe specific to U16 snoRNA. Extension products were
analyzed in an 8% polyacrylamide 7M urea gel, next to a DNA
sequencing ladder, generated with the same primer. The nucleotides
accessible to DMA were identified (FIG. 3). The proposed secondary
structure of U16 snoRNA was then generated using the program MFold,
and this structure was refined based on the probing data (FIG. 4).
The data demonstrates that the U16 snoRNA regions targeted by the
two active antisense oligonucleotides exhibit an open structure,
suggesting that in this instance, the knockdown efficiency of
antisense oligonucleotides correlated with the accessibility of the
snoRNA regions.
Example 2
Lack of Inhibition of Human snoRNA U16 in Hela Cells by DNA
Oligonucleotide or siRNA
[0306] Two antisense compounds with the same sequence as ISIS
462026 but with different chemistries were tested for their effect
on U16 mRNA in vitro. A DNA oligonucleotide with deoxyribose sugar
moieties and phosphorothioate backbone, as well as a
double-stranded RNA (siRNA) version of ISIS 462026, were tested in
the assays.
[0307] Hela cells were cultured on 6-well plates in DMEM medium
supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with either a DNA
oligonucleotide or siRNA at concentrations of 10 nM, 30 nM, 40 nM,
or 50 nM. The DNA oligonucleotide was transfected in Opti-MEM
medium containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA)
for 4 hours, after which the transfection media was replaced with
fresh culture medium. The siRNA was transfected using RNAiMax as
the transfection agent. After a period of approximately 48 hours,
RNA was isolated from the cells and the U16 snoRNA levels were
determined by northern hybridization as follows.
[0308] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using a U16 snoRNA-specific 5'-end
labeled oligonucleotide probe (SEQ ID NO: 2). 5.8S and 5S rRNAs
were determined by ethidium bromide staining and served as a
control for loading. The density of the bands was scanned using an
ImageJ densitometer.
[0309] The results for the assay with the DNA oligonucleotide are
presented in Table 2 and FIG. 5, as percent inhibition compared to
the untreated control. The results from the siRNA experiment are
presented in FIG. 6. The assays demonstrate that neither the DNA
oligonucleotide nor the siRNA had any significant effect in
inhibiting U16 snoRNA. The failure of the siRNA is consistent with
a model of activity of ISIS 462026 based on RNase H dependent
cleavage in the nucleus or nucleolus, where RISC (necessary for
siRNA activity) is absent. The relative failure of the full deoxy
DNA antisense oligonucleotide may indicate that
compartmentalization and/or structure of snoRNAs requires the
additional affinity provided by modifications such as 2'-MOE.
TABLE-US-00003 TABLE 2 Percent inhibition of U16 snoRNA by a DNA
oligonucleotide compared to the control Dose % (nM) inhibition 10
12 30 4 40 34 50 35
Example 3
Lack of Inhibition of Human snoRNA U16 in Hela Cells by Uniform
2'MOE/RNA Oligonucleotides
[0310] Two RNA compounds with the same sequence as ISIS 462025 or
ISIS 462026 but with uniform 2'MOE chemistry were tested for their
effect on U16 mRNA in vitro.
[0311] Hela cells were cultured on 6-well plates in DMEM medium
supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with either
2'MOE/chimeric antisense oligonucleotide or 2'MOE modified
phosphorothioate linked RNA oligonucleotide. The sequences of these
oligonucleotides were either that of ISIS 462025 or ISIS 462026.
The oligonucleotides were transfected in Opti-MEM medium containing
4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA) for 4 hours, after
which the transfection media was replaced with fresh culture
medium. After a period of approximately 48 hours, RNA was isolated
from the cells and the U16 snoRNA levels were determined by
northern hybridization.
[0312] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using a U16 snoRNA-specific 5'-end
labeled oligonucleotide probe (SEQ ID NO: 2). U80 snoRNA was
detected using a specific 5'-end labeled oligonucleotide probe
(5'-GATACATCAGATAGGAGCGAA-3', designated herein as SEQ ID NO: 26),
and served as a loading control. The density of the bands was
scanned using an ImageJ densitometer.
[0313] The results are presented in Table 3 and FIG. 7 and
demonstrate that the uniform 2'MOE oligonucleotides were not as
effective as the chimeric oligonucleotides in inhibiting U16 mRNA.
Therefore, this experiment indicates that the inhibition was due to
the activity of ISIS 462026 based on RNase H dependent cleavage in
the nucleus or nucleolus.
TABLE-US-00004 TABLE 3 Percent inhibition of U16 snoRNA compared to
the control % inhibition ASO-462025 84 RNA-462025 5 ASO-462026 85
RNA-462026 8
Example 4
Time Course of Antisense Inhibition of Human snoRNA U16 in Hela
Cells
[0314] The time course of antisense oligonucleotide-mediated U16
reduction was studied. Hela cells were cultured on 6-well plates in
DMEM medium supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with ISIS 462026 at 50
nM concentration. The oligonucleotides were transfected in Opti-MEM
medium containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA)
for 0 hr, 6 hr, 12 hr, 24 hr, 36 hr or 48 hr after which the
transfection media was replaced with fresh culture medium. RNA was
isolated from the cells and the U16 snoRNA levels were determined
by northern hybridization.
[0315] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using a U16 snoRNA-specific 5'-end
labeled oligonucleotide probe (SEQ ID NO: 2). U80 snoRNA was
detected using a specific 5'-end labeled oligonucleotide probe (SEQ
ID NO: 26), and served as a loading control. The density of the
bands was scanned using an ImageJ densitometer. The results are
presented in Table 4 and FIG. 8. The assays demonstrated that ISIS
462026 inhibited U16 snoRNA expression as early as 6 hours after
transfection.
TABLE-US-00005 TABLE 4 Time course of inhibition of U16 snoRNA,
expressed as percent inhibition compared to the control Time % (hr)
inhibition 6 82 12 84 24 87 36 91 48 89
Example 5
Effect of Various Transfection Reagents on the Antisense Inhibition
of Human snoRNA U16 in Hela Cells
[0316] The effect of using three different transfection reagents,
Lipofectamine 2000, RNAiMax, or Oligofectamine, on antisense
oligonucleotide-mediated U16 reduction was studied. Hela cells were
cultured on 6-well plates in DMEM medium supplemented with 10%
fetal calf serum and 1% penicillin/streptomycin at 37.degree. C. in
a 5% CO.sub.2 incubator. ISIS 462026 was transfected with any one
of the transfection reagents (4 .mu.g/mL Lipofectamine 2000, 4
.mu.g/mL Oligofectamine, or 6 .mu.g/mL Lipofectamine RNAiMax) in
either of two ways: a) Transfection was performed by adding one of
the transfection reagents into the culture medium, followed by
addition of ISIS 462026 at 50 nM concentration (designated `Free`);
orb) ISIS 462026 was pre-mixed with one transfection reagent, the
resulting mixture was incubated at room temperature for 10 min, and
then added to the culture medium (designated `Pre").
[0317] After 4 hours, the medium was replaced with fresh culture
medium. RNA was isolated from the cells and the U16 snoRNA levels
were determined by northern hybridization. Total RNA was prepared
using Tri-Reagent, based on the manufacturer's instructions. Five
micrograms of total RNA was separated in 8% polyacrylamide-7M urea
gels and was transferred onto a membrane, using semi-dry transfer
apparatus. Northern hybridization was performed using a U16
snoRNA-specific 5'-end labeled oligonucleotide probe (SEQ ID NO:
2). U80 snoRNA was detected using a specific 5'-end labeled
oligonucleotide probe (SEQ ID NO: 26), and served as a loading
control. The density of the bands was scanned using an ImageJ
densitometer. The results are presented in Table 5, and FIGS. 9 and
10. The assays demonstrate that ISIS 462026 inhibited U16 snoRNA
expression irrespective of the transfection reagent or method
utilized.
TABLE-US-00006 TABLE 5 Antisense inhibition of U16 snoRNA with
various transfection reagents and methods of transfection %
inhibition Lipofectamine 2000 (Free) 90 Lipofectamine 2000 (Pre) 91
Oligofectamine (Free) 88 Oligofectamine (Pre) 81 RNAiMax (Free 93
RNAiMax (Pre) 94
Example 6
Antisense Inhibition of Human U16 snoRNA in Hela, HEK-293 and A549
Cells
[0318] The effect of treatment of antisense oligonucleotides
targeting U16 snoRNA on the human cell lines, HEK-293 and A549, was
studied and compared with that in Hela cells. Hela cells, HEK-293
cells and A549 cells were cultured in DMEM medium supplemented with
10% fetal calf serum and 1% penicillin/streptomycin at 37.degree.
C. in a 5% CO.sub.2 incubator. ISIS 462026 was transfected in each
of these cells. After 4 hours, the medium was replaced with fresh
culture medium. RNA was isolated from the cells and the U16 snoRNA
levels were determined by northern hybridization.
[0319] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using a U16 snoRNA-specific 5'-end
labeled oligonucleotide probe (SEQ ID NO: 2). U80 snoRNA was
detected using a specific 5'-end labeled oligonucleotide probe (SEQ
ID NO: 26), and served as a loading control. The density of the
bands was scanned using an ImageJ densitometer. The results are
presented in Table 6 and FIG. 11. The assays demonstrate that ISIS
462026 inhibited U16 snoRNA expression with equal potency in each
of the cell types used.
TABLE-US-00007 TABLE 6 Antisense inhibition of U16 snoRNA in
various human cell lines % Cell type inhibition A549 >95 HEK-293
91 Hela >95
Example 7
Effect of Antisense Inhibition of Human snoRNA U16 on the U16 Guide
Function
[0320] The effect of antisense oligonucleotide-mediated U16
reduction on its function in guiding 2'-O-methylation at site A484
of 18S rRNA was studied.
[0321] Hela cells were cultured in DMEM medium supplemented with
10% fetal calf serum and 1% penicillin/streptomycin at 37.degree.
C. in a 5% CO.sub.2 incubator. Sub-confluent cells were treated
with ISIS 462025, ISIS 462026, or ISIS 462027 at a 50 nM
concentration in Opti-MEM medium containing 4 .mu.g/mL
Lipofectamine 2000 (Invitrogen, CA) for 4 hours, after which the
transfection was replaced with fresh culture medium. After a period
of approximately 48 hours, RNA was isolated from the cells.
[0322] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Methylation was determined by primer
extension assay using two different dNTP concentrations (0.05 and 5
.mu.M), as described in Maden et al (Biochimie. 77: 22-29, 1995).
Primer extension products were separated in 8% polyacrylamide-7M
urea gels. For quantitative analysis of 2'-O-methylation, RNase
H-cleavage assay was performed, as described in Yu et al (RNA. 3:
324-331, 1997). Briefly, 4 .mu.g total RNA was hybridized with 300
pM chimeric oligonucleotide
(5'-UmUmdTdGdCdGCmGmCmCmUmGmCmUmGmCmCmUm-3, designated herein as
SEQ ID NO: 27) by heating at 90.degree. C. for 5 min, then
37.degree. C. for 10 min, and cooled on ice for 2 min. Next, 5
.mu.l of 2X RNase H buffer (40 mM Tris.Cl pH 7.5; 20 mM MgCl.sub.2;
200 mM KCl; 50 mM DTT; 10% sucrose) containing 3 units of RNase H
(New England Biolabs, MA) and 2 units of RNase Inhibitor (New
England Biolabs, MA) were added. The RNA was digested at 37.degree.
C. for 60 min, and separated in a 1.2% agarose gel. 18S rRNA and
its 5' cleaved products were detected by northern hybridization
using a 5' end-labeled probe (5'-GCTACTGGCAGGATCAACCA-3',
designated herein as SEQ ID NO: 28). The methylation level of A484
was strongly decreased in cells treated with ISIS 462025 or ISIS
462026 (FIG. 12). Treatment with ISIS 462027 resulted in partial
reduction in methylation of A484. Methylation of a neighboring site
(A468) not mediated by U16 activity was unchanged.
[0323] Separately, Hela cells were treated for 48 hr with 10 nM, 20
nM, 30 nM, 40 nM, or 50 nM of ISIS 462026, or with 50 nM of ISIS
462025 or ISIS 462027. Total RNA was prepared and subjected to
northern hybridization as described above. Probes specific to U16
(SEQ ID NO: 2) and U18 (5'-TGTTTCAGAAACACGGACC-3', designated
herein as SEQ ID NO: 29) snoRNAs were used to detect the respective
RNAs. 5.8S and 5S rRNAs were detected by ethidium bromide staining
and served as loading controls. The results demonstrate that these
antisense oligonucleotides, which significantly inhibited U16
(Table 7 and FIG. 13) did not affect the level of U18 snoRNAs,
which is encoded in the same pre-mRNA.
TABLE-US-00008 TABLE 7 Antisense inhibition of U16 snoRNA Dose %
ISIS No. (nM) inhibition 462026 10 68 20 83 30 86 40 88 50 91
462025 50 91 462027 50 56
[0324] Reduction of A484 methylation was confirmed using an
oligonucleotide directed, site-specific RNaseH cleavage assay, in
which only the 18S rRNA lacking A484 methylation could be cleaved.
In that assay, approximately 55% of 18S rRNA from U16 depleted
cells was cleaved, whereas no cleavage was found for control rRNA
(FIG. 14). These results indicate that antisense-mediated depletion
of U16 snoRNA specifically inactivated the methylation guided by
this snoRNA, and that the predicted function of this RNA could be
confirmed.
Example 8
Effect of Antisense Inhibition of Human snoRNA U16 on its Host
mRNA, RPL4
[0325] U16 snoRNA is embedded in an intron of its host gene, RPL4,
as shown in FIG. 15 (Lestrade, L. and Weber, M. J. Nucleic Acid
Res. 34: D158-162, 2006). The effect of antisense
oligonucleotide-mediated U16 reduction on the pre-mRNA levels was
studied.
[0326] Hela cells were cultured in DMEM medium supplemented with
10% fetal calf serum and 1% penicillin/streptomycin at 37.degree.
C. in a 5% CO.sub.2 incubator. Sub-confluent cells were treated
with ISIS 462025, ISIS 462026, or ISIS 462027 at a 50 nM
concentration in Opti-MEM medium containing 4 .mu.g/mL
Lipofectamine 2000 (Invitrogen, CA) for 4 hours, after which the
transfection was replaced with fresh culture medium. After a period
of approximately 48 hours, RNA was isolated from the cells and the
U16 snoRNA levels were determined by northern hybridization.
[0327] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 6% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using a RPL4-specific 5'-end labeled
oligonucleotide probe (5'-CAGGGCAGAACAGATGGCGTATC-3', designated
herein as SEQ ID NO: 30). U3 snoRNA was detected using a specific
5'-end labeled oligonucleotide probe
(5'-ACCACTCAGACCGCGTTCTCTCC-3', designated herein as SEQ ID NO:
31), and served as a loading control. The density of the bands was
scanned using an ImageJ densitometer. The results are presented in
FIG. 16 and demonstrate that the level of mature RPL4 mRNA was not
altered by treatment with antisense oligonucleotides targeting
U16.
[0328] Separately, Hela cells were treated with ISIS 462026 for 24,
48 or 72 hr and harvested and lysed. Whole cell lysates were
separated in 4-12% gradient SDS-PAGE gels. Proteins were
transferred to PVDF membrane for 1 hour using a semi-dry transfer
apparatus at 25 volt constant. The membranes were blocked for 1 hr
with block buffer (5% dry milk in 1xTBS), and incubated with
primary antibodies against RPL4 (11302-1-AP, Proteintech, 1:1500)
or alpha tubulin (T-5168, Sigma, 1:8000) at room temperature for
3-4 hours. After 3 washes with wash buffer (1.times. TBS, 0.1%
Tween-20), membranes were incubated with anti-rabbit or anti-mouse
secondary antibody at room temperature for 1 hr. After 3 washes,
proteins were detected using ECL (Abcam). The results are presented
in FIG. 17 and demonstrate that there was no change in levels of
RPL4 protein even after 3 days of antisense oligonucleotide
treatment.
[0329] Thus, these oligonucleotides inhibited mature U16 snoRNA,
but not other messages from the same pre-mRNA, suggesting that they
may act on the mature snoRNA after splicing.
Example 9
Antisense Inhibition of Human C/D Box snoRNAs U80 and U81 in Hela
Cells
[0330] Antisense oligonucleotides targeting a U80 and U81 snoRNA
nucleic acids were designed (FIGS. 18 and 19). U80 and U81 are C/D
box RNAs that are encoded in different introns of the same host
non-protein-coding RNA, GASS (Smith, C. M. and Steitz, J. A. Mol.
Cell. Biol. 18: 6897-6909, 1998), as shown in FIG. 20. The
oligonucleotides were tested for their effects on U80 and U81 mRNA
in vitro.
[0331] Hela cells were cultured on 6-well plates in DMEM medium
supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with the antisense
oligonucleotides at a 50 nM concentration in Opti-MEM medium
containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA) for 4
hours, after which the transfection was replaced with fresh culture
medium. After a period of approximately 48 hours, RNA was isolated
from the cells and the U80 or U81 snoRNA levels were determined by
northern hybridization.
[0332] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using a U80 snoRNA-specific 5'-end
labeled oligonucleotide probe (SEQ ID NO: 26) or U81
snoRNA-specific 5'-end labeled oligonucleotide probe
(5'-CAGAATATCAGATATTTTATTG-3', designated herein as SEQ ID NO: 32).
The U16 snoRNA-specific probe (SEQ ID NO: 2) served as a control
for loading. The density of the bands was scanned using an ImageJ
densitometer. Results for inhibition of U80 snoRNA are presented in
Table 8 and in FIG. 21. The data indicate that ISIS 477457
significantly inhibited U80 snoRNA expression. Results for
inhibition of U81 snoRNA are presented in FIG. 22. The data
indicate that ISIS 477443 and ISIS 477444 significantly inhibited
U81 snoRNA expression.
[0333] The chimeric antisense oligonucleotides in Tables 8 and 9
were designed as 5-10-5 MOE gapmers with phosphorothioate (P.dbd.S)
linkages throughout. All cytidine residues throughout each gapmer
are 5-methylcytidines. Each gapmer listed in Table 8 is targeted to
SEQ ID NO: 33 (complement of GENBANK Accession No. NT 004487.19
truncated from nucleotides 25322609 to 25322686). Each gapmer
listed in Table 9 is targeted to SEQ ID NO: 34 (complement of
GENBANK Accession No. NT_004487.19 truncated from nucleotides
25321926 to 25322002).
TABLE-US-00009 TABLE 8 Antisense inhibition by chimeric antisense
oligonucleotides having 5-10-5 MOE wings and deoxy gap targeted to
U80 snoRNA Start Stop ISIS % SEQ ID Site Site No. Sequence
inhibition NO. 1 20 477450 TATGTTATCATCATTGTATC 11 35 8 27 477451
GCTGAACTATGTTATCATCA 42 36 15 34 477452 TTAGTCTGCTGAACTATGTT 56 37
22 41 477453 ATCAGCGTTAGTCTGCTGAA 25 38 29 48 477454
ATTGCTCATCAGCGTTAGTC 42 39 36 55 477455 ACTTAATATTGCTCATCAGC 50 40
50 69 477457 GATAGGAGCGAAAGACTTAA 96 41 58 77 477458
ATACATCAGATAGGAGCGAA 56 42
TABLE-US-00010 TABLE 9 Chimeric antisense oligonucleotides haying
5-10- 5 MOE wings and deoxy gap targeted to U81 snoRNA Start Stop
ISIS SEQ ID Site Site No. Sequence NO. 1 20 477441
TGAGATCATCATGTATTCTG 43 8 27 477442 GTTGGATTGAGATCATCATG 44 15 34
477443 AGTTCAAGTTGGATTGAGAT 45 22 41 477444 GTGAGAGAGTTCAAGTTGGA 46
29 48 477445 GTAATCAGTGAGAGAGTTCA 47 36 55 477446
TCATCAAGTAATCAGTGAGA 48 43 62 477447 TTTATTGTCATCAAGTAATC 49 50 69
477448 CAGATATTTTATTGTCATCA 50 58 77 477449 CAGAATATCAGATATTTTAT
51
[0334] Separately, Hela cells were treated with 50 nM concentration
of ISIS 477457, ISIS 477443, or ISIS 477444. Total RNA was prepared
and subjected to northern hybridization, as described earlier. The
results are presented in Table 10 and FIGS. 23 and 24. The data
demonstrate significant reductions of the specific snoRNAs by the
antisense oligonucleotides. FIGS. 23 and 24 also demonstrate that
knockdown occurs at the mature snoRNA level as depletion of U80 by
its specific antisense oligonucleotide does not affect the levels
of U81 snoRNA, and vice versa.
TABLE-US-00011 TABLE 10 Antisense inhibition by chimeric antisense
oligonucleotides of U80 and U81 snoRNAs % ISIS No Target inhibition
477457 U80 87 477443 U81 85 477444 82
Example 10
Effect of Antisense Inhibition of Human snoRNAs U80 and U81 on
Their Guide Function
[0335] The effect of antisense oligonucleotide-mediated U80
reduction on its function in guiding 2'-O-methylation at site G1612
of 28S rRNA, as well as the effect of antisense
oligonucleotide-mediated U81 reduction on its function in guiding
2'-O-methylation at site A391 of 28S rRNA, was studied.
[0336] Hela cells were cultured in DMEM medium supplemented with
10% fetal calf serum and 1% penicillin/streptomycin at 37.degree.
C. in a 5% CO.sub.2 incubator. Sub-confluent cells were treated
with ISIS 477457 or ISIS 477443 at a 50 nM concentration in
Opti-MEM medium containing 4 .mu.g/mL Lipofectamine 2000
(Invitrogen, CA) for 4 hours, after which the transfection was
replaced with fresh culture medium. After a period of approximately
48 hours, RNA was isolated from the cells.
[0337] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Methylation was determined by primer
extension assay using two different dNTP concentrations (0.05 and 5
.mu.M), as described earlier. The methylation level of G1612 was
strongly decreased in cells treated with ISIS 477457 (FIG. 25) and
the methylation of A391 was strongly decreased in cells treated
with ISIS 477443 (FIG. 26). The methylation level of G1612 guided
by U80 was not affected by U81 snoRNA depletion. Similarly, the
methylation level of A391 guided by U81 was not affected by U80
snoRNA depletion.
Example 11
Antisense Inhibition of Isoforms of a Human C/D Box snoRNA, U50 and
U50B in Hela Cells
[0338] Antisense oligonucleotides were designed targeting the
isoforms of a human C/D box snoRNA, U50 and U50B, which are encoded
in different introns of the same host gene (SNHG5) (Tanaka, et al.,
Genes Cells. 5: 277-287, 2000), and share approximately 80%
identity (FIGS. 27 and 28). The gapmers were tested for their
effects on U50 and U50B mRNA in vitro.
[0339] Hela cells were cultured on 6-well plates in DMEM medium
supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with the antisense
oligonucleotides at a 50 nM concentration in Opti-MEM medium
containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA) for 4
hours, after which the transfection was replaced with fresh culture
medium. After a period of approximately 48 hours, RNA was isolated
from the cells and U50 snoRNA levels were determined by northern
hybridization.
[0340] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using a U50 snoRNA-specific 5'-end
labeled oligonucleotide probe (5'-GGTTCGGGATAAGATCATCACA-3',
designated herein as SEQ ID NO: 52) and a U50B snoRNA-specific
5'-end labeled oligonucleotide probe
(5'-CGTACTTATTTTTCTTCAGGTTA-3', designated herein as SEQ ID NO:
53). The U16 snoRNA-specific probe (SEQ ID NO: 53) served as a
control for loading. The density of the bands was scanned using an
ImageJ densitometer. Results for inhibition of U50 snoRNA are
presented in Table 11 and FIG. 29. The data indicates that ISIS
477498 and ISIS 477499 significantly inhibited U50 snoRNA
expression, but did not affect U50B expression (FIG. 29). ISIS
477499 has only 3 mismatches with the U50B snoRNA sequence (FIG.
30) but failed to inhibit U50B levels.
[0341] The chimeric antisense oligonucleotides in Table 11, and
also described in FIG. 31, were designed as 5-10-5 MOE gapmers. The
gapmers are 20 nucleotides in length, wherein the central gap
segment is comprised of ten 2'-deoxynucleotides and is flanked on
both sides (in the 5' and 3' directions) by wings comprising five
nucleotides each. Each nucleotide in the 5' wing segment and each
nucleotide in the 3' wing segment has a 2'-MOE modification. The
internucleoside linkages throughout each gapmer are
phosphorothioate (P.dbd.S) linkages. All cytidine residues
throughout each gapmer are 5-methylcytidines. Each gapmer listed in
Table 11 is targeted to SEQ ID NO: 54 (the complement of GENBANK
Accession No. NT 007299.13 truncated from nucleotides 24505000 to
24510000).
TABLE-US-00012 TABLE 11 Antisense inhibition by chimeric antisense
oligonucleotides having 5-10-5 MOE wings and deoxy gap targeted to
U50 snoRNA Start Stop ISIS % SEQ ID Site Site No. Sequence
inhibition NO. 3081 3100 477493 GGATAAGATCATCACAGATA 45 55 3086
3105 477494 GTTCGGGATAAGATCATCAC 62 56 3091 3110 477495
TTCAGGTTCGGGATAAGATC 79 57 3096 3115 477496 AGAAGTTCAGGTTCGGGATA 79
58 3101 3120 477497 TCAACAGAAGTTCAGGTTCG 91 59 3129 3148 477498
AAGCCAGATCCGTAAAAGTT 97 60 3134 3153 477499 CTCAGAAGCCAGATCCGTAA 98
61
[0342] In a separate experiment, Hela cells were treated for 48 hr
with 50 nM of ISIS 477499, targeting U58 snoRNA or 50 nM of ISIS
485259 (CTCAGAAGCCGAATCCGTAG, mismatched by 3 nucleobases to SEQ ID
NO: 62), targeting the U50B isoform, or 30 nM of both antisense
oligonucleotides together. Total RNA was prepared and subjected to
northern hybridization using 5'-end labeled oligonucleotides
specific to U50 or U50B. U6 snRNA (5'-TGGAACGCTTCACGAATTTGCG-3',
designated herein as SEQ ID NO: 63) was detected and served as a
loading control. The results are presented in Table 12 and FIG. 32
and demonstrate that the antisense oligonucleotides target their
specific isoforms only.
TABLE-US-00013 TABLE 12 Antisense inhibition by chimeric antisense
oligonucleotides targeted to U50 and U50B snoRNA % inhibition ISIS
No. U50 U50B 477499 91 11 485259 7 74 477499 + 485459 93 84
Example 12
Effect of Antisense Inhibition of Human snoRNAs U50 and U50B on
Their Guide Function
[0343] The effect of antisense oligonucleotide-mediated U50
reduction on its function in guiding 2'-O-methylation at site C2848
of 28S rRNA was studied.
[0344] Hela cells were cultured in DMEM medium supplemented with
10% fetal calf serum and 1% penicillin/streptomycin at 37.degree.
C. in a 5% CO.sub.2 incubator. Sub-confluent cells were treated
with ISIS 477499 or ISIS 485259 at 50 nM concentration in Opti-MEM
medium containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA)
for 4 hours, after which the transfection was replaced with fresh
culture medium. After a period of approximately 48 hours, RNA was
isolated from the cells.
[0345] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Methylation was determined by primer
extension assay using two different dNTP concentrations (0.05 and 5
.mu.M), as described earlier. The results are presented in FIG. 33
and demonstrate that the inhibition of U50 or U50B snoRNA impairs
the methylation guided by this RNA. Co-depletion of the two
snoRNAs, as shown in the Figure, caused greater reduction in
methylation, indicating that both isoforms are functional. This
data also indicates that more than one snoRNA can be reduced
simultaneously.
Example 13
Antisense Inhibition of Isoforms of a Human H/ACA Box snoRNA, U23
in Hela Cells
[0346] Antisense oligonucleotides were designed targeting the human
H (AnAnnA) and ACA box intronic snoRNA, U23 (FIGS. 34 and 35)
(Lestrade, L. and Weber, M. J. Nucleic Acids Res. 34: D158-162,
2006). The gapmers were tested for their effects on U23 mRNA in
vitro.
[0347] Hela cells were cultured on 6-well plates in DMEM medium
supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with the antisense
oligonucleotides at a 50 nM concentration in Opti-MEM medium
containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA) for 4
hours, after which the transfection was replaced with fresh culture
medium. After a period of approximately 48 hours, RNA was isolated
from the cells and U23 snoRNA levels were determined by northern
hybridization.
[0348] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using a U23 snoRNA-specific 5'-end
labeled oligonucleotide probe (5'-GAATGTCTCACAATACAGCTAAAT-3',
designated herein as SEQ ID NO: 64). 5.8S and 5S rRNAs were
detected by ethidium bromide staining and served as a control for
loading. The density of the bands was scanned using an ImageJ
densitometer. Results for inhibition of U23 snoRNA are presented in
Table 13 and FIG. 36. The data indicates that ISIS 483788 and ISIS
483791 significantly inhibited U23 snoRNA expression. The positions
of these two antisense oligonucleotides in the secondary structure
of U23 snoRNA is indicated by lines in FIG. 37. The snoRNA
structure was predicted using the program MFold and the snoRNA
sequences involved in guiding modification is shown in bold in this
Figure.
[0349] The blot was also probed for U20 snoRNA, which occurs in the
same pre-mRNA as U23 (FIG. 34), using a U20-specific 5'-end labeled
oligonucleotide probe (5'-CTGGATCAGAACTTGACTATC-3', designated
herein as SEQ ID NO: 65). The data is presented in FIG. 36 (lower
panel) and demonstrates that antisense inhibition of U23 snoRNA did
not affect U20 snoRNA levels, and therefore, that inhibition of U23
was specific and occurred at the mature U23 mRNA level.
[0350] The chimeric antisense oligonucleotides in Table 13 were
designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleotides in
length, wherein the central gap segment is comprised of ten
2'-deoxynucleotides and is flanked on both sides (in the 5' and 3'
directions) by wings comprising five nucleotides each. Each
nucleotide in the 5' wing segment and each nucleotide in the 3'
wing segment has a 2'-MOE modification. The internucleoside
linkages throughout each gapmer are phosphorothioate (P.dbd.S)
linkages. All cytidine residues throughout each gapmer are
5-methylcytidines. Each gapmer listed in Table 13 is targeted to
SEQ ID NO: 66 (GENBANK Accession No. NR_002921.1).
TABLE-US-00014 TABLE 13 Antisense inhibition by chimeric antisense
oligonucleotides having 5-10-5 MOE wings and deoxy gap targeted to
U23 snoRNA Start Stop ISIS % SEQ ID Site Site No. Sequence
inhibition NO. 1 20 483770 AAGGAGCTCAATGAGAAGAC 0 67 6 25 483771
ACAGAAAGGAGCTCAATGAG 0 68 11 30 483772 GATAGACAGAAAGGAGCTCA 0 69 16
35 483773 CCACTGATAGACAGAAAGGA 0 70 21 40 483774
AACTGCCACTGATAGACAGA 0 71 26 45 483775 CCATAAACTGCCACTGATAG 0 72 31
50 483776 CGAATCCATAAACTGCCACT 0 73 36 55 483777
TCGTGCGAATCCATAAACTG 0 74 41 60 483778 TCTTCTCGTGCGAATCCATA 0 75 46
65 483779 TCTCTTCTTCTCGTGCGAAT 0 76 51 70 483780
AATTCTCTCTTCTTCTCGTG 0 77 56 75 483781 CTGTGAATTCTCTCTTCTTC 0 78 61
80 483782 TAGTTCTGTGAATTCTCTCT 0 79 71 90 483784
AAAATAATGCTAGTTCTGTG 0 80 76 95 483785 AAGGTAAAATAATGCTAGTT 0 81 81
100 483786 GACAGAAGGTAAAATAATGC 0 82 86 105 483787
GTAAAGACAGAAGGTAAAAT 0 83 91 110 483788 CCTCTGTAAAGACAGAAGGT 82 84
96 115 483789 ATATACCTCTGTAAAGACAG 0 85 101 120 483790
GCTAAATATACCTCTGTAAA 0 86 106 125 483791 ATACAGCTAAATATACCTCT 69 87
111 130 483792 TCACAATACAGCTAAATATA 0 88 116 135 483793
ATGTCTCACAATACAGCTAA 0 89 118 137 483794 GAATGTCTCACAATACAGCT 0
90
[0351] In a separate experiment, Hela cells were treated for 48 hr
with 50 nM of ISIS 483788. Total RNA was prepared and subjected to
northern hybridization using 5'-end labeled oligonucleotides
specific to U23 or U50B. U16 snoRNA (SEQ ID NO: 2) was detected and
served as a loading control. The results are presented in FIG. 38
and demonstrate that U23 snoRNA was significantly inhibited by
86%.
Example 14
Effect of Antisense Inhibition of Human snoRNA U23 on its Host
Nucleolin Protein Level
[0352] U16 snoRNA is embedded in an intron of its host gene,
Nucleolin, as shown in FIG. 34. The effect of antisense
oligonucleotide-mediated U23 reduction on Nucleolin protein levels
was studied.
[0353] Hela cells were cultured in DMEM medium supplemented with
10% fetal calf serum and 1% penicillin/streptomycin at 37.degree.
C. in a 5% CO.sub.2 incubator. Sub-confluent cells were treated
with ISIS 483788 at a 50 nM concentration in Opti-MEM medium
containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA) for 4
hours, after which the transfection was replaced with fresh culture
medium. After a period of approximately 48 hours, cells were
harvested and lysed. Whole cell lysates were separated in 4-12%
gradient SDS-PAGE gels. Proteins were transferred to PVDF membrane
for 1 hour using a semi-dry transfer apparatus at 25 volt constant.
The membranes were blocked for 1 hr with block buffer (5% dry milk
in 1.times. TBS), and incubated with primary antibodies against
RPL4 (11302-1-AP, Proteintech, 1:1500) or nucleolin at room
temperature for 3-4 hours. After 3 washes with wash buffer
(1.times. TBS, 0.1% Tween-20), membranes were incubated with
anti-rabbit or anti-mouse secondary antibody at room temperature
for 1 hr. After 3 washes, proteins were detected using ECL (Abcam).
The results are presented in FIG. 39 and demonstrate that there was
no change in levels of Nucleolin protein. The RPL4 protein was also
probed and served as a loading control.
[0354] Therefore, these observations indicate that ISIS 483788
specifically acts on mature U23 snoRNA.
Example 15
Effect of Antisense Inhibition of Human snoRNA U23 on its Guide
Function
[0355] The effect of antisense oligonucleotide-mediated U23
reduction on its function in guiding the pseudouridylation at site
U93 of 18S rRNA (Lestrade, L. and Weber, M. J. Nucleic Acids Res.
34: D158-162, 2006) was studied.
[0356] Hela cells were cultured in DMEM medium supplemented with
10% fetal calf serum and 1% penicillin/streptomycin at 37.degree.
C. in a 5% CO.sub.2 incubator. Sub-confluent cells were treated
with ISIS 483788 at 50 nM concentration in Opti-MEM medium
containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA) for 4
hours, after which the transfection was replaced with fresh culture
medium. After a period of approximately 48 hours, RNA was isolated
from the cells.
[0357] Total RNA from test cells was treated with
N-cyclohexyl-N'-(2-morpholinoethyl)-carbodiimide
methyl-p-toluolsulfonate (CMC), and subjected to primer extension
analysis using a 5' end-labeled primer specific to U93 region of
18S rRNA (5'-AAGGAACCATAACTGATTTAAT-3', designated herein as SEQ ID
NO: 91). CMC treatment causes extension to stop one nucleotide
before the pseudouridine sites. Extension products were separated
in an 8% polyacrylamide gel, next to primer extension sequencing
reactions preformed with the same primer. The targeted
pseudouridylation site (.PSI.93) is indicated in FIG. 40. Two other
pseudouridines (.PSI.34 and .PSI.36) in 18S rRNA are marked with
arrowheads and serve as loading controls.
[0358] The data in the figure indicates that depletion of U23 also
disrupted its guide function, as evidenced by the significantly
reduced level of pseudouridylation at position U93 of 18S rRNA.
Thus, H/ACA RNAs can also be depleted by 2'MOE/chimeric antisense
oligonucleotides.
Example 16
Simultaneous Antisense Inhibition of snoRNAs U16, U50, U80, U81 and
U23 in Hela Cells
[0359] Antisense oligonucleotides targeting snoRNAs U16, U50, U80,
U81 and U23 were tested in vitro to study the effect of
simultaneous dosing.
[0360] Hela cells were cultured on 6-well plates in DMEM medium
supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were co-transfected with 10 nM of
ISIS 462026, ISIS 477499, ISIS 477457 and ISIS 477443, as well as
20 nM of ISIS 483788, in Opti-MEM medium containing 4 .mu.g/mL
Lipofectamine 2000 (Invitrogen, CA) for 4 hours, after which the
transfection was replaced with fresh culture medium. After a period
of approximately 48 hours, RNA was isolated from the cells and the
respective snoRNA levels were determined by northern
hybridization.
[0361] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using the respective snoRNA-specific
5'-end labeled oligonucleotide probes. The U2 snRNA-specific probe
served as a control for loading. The density of the bands was
scanned using an ImageJ densitometer. Results for inhibition of the
respective snoRNA are presented in Table 14 and FIG. 41. The data
indicates that multiple snoRNAs can be co-depleted. Hence,
antisense oligonucleotide may be utilized in studies on the effects
of snoRNAs in a functional domain of the ribosome (for example,
Liang X. H. et al., Mol. Cell. 28: 965-977, 2007), where several
snoRNAs require to be depleted.
TABLE-US-00015 TABLE 14 Simultaneous antisense inhibition by
chimeric antisense oligonucleotides % inhibition U23 85 U81 90 U16
>95 U50 >95 U80 >95
Example 17
Antisense Inhibition of scaRNA ACA45 in Hela Cells
[0362] Antisense oligonucleotides were designed targeting RNAs
present in Cajal bodies (scaRNAs) that guide modification in snRNAs
(Darzacq, X. et al., EMBO J. 21: 2746-2756, 2002). Specifically,
antisense oligonucleotides were designed to target scaRNA, ACA45
(FIG. 42). The gapmers were tested for their effects on ACA45 mRNA
in vitro.
[0363] Hela cells were cultured on 6-well plates in DMEM medium
supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with the antisense
oligonucleotides at a 50 nM concentration in Opti-MEM medium
containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA) for 4
hours, after which the transfection was replaced with fresh culture
medium. After a period of approximately 48 hours, RNA was isolated
from the cells and ACA45 scaRNA levels were determined by northern
hybridization.
[0364] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using an ACA45 scaRNA-specific 5'-end
labeled oligonucleotide probe (5'-GCTGTTGGTAGATAAGTAGGTCT-3,
designated herein as SEQ ID NO: 92). U16 and U18 snoRNAs were
detected and served as a control for loading. The density of the
bands was scanned using an ImageJ densitometer. Results for
inhibition of U23 snoRNA are presented in FIG. 43. The data
indicates that ISIS 462037 and ISIS 462038 significantly inhibited
ACA45 scaRNA expression. The positions of these two antisense
oligonucleotides in the secondary structure of ACA45 scaRNA are
indicated by lines in FIG. 44.
[0365] The chimeric antisense oligonucleotides in Table 15 were
designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleotides in
length, wherein the central gap segment is comprised of ten
2'-deoxynucleotides and is flanked on both sides (in the 5' and 3'
directions) by wings comprising five nucleotides each. Each
nucleotide in the 5' wing segment and each nucleotide in the 3'
wing segment has a 2'-MOE modification. The internucleoside
linkages throughout each gapmer are phosphorothioate (P.dbd.S)
linkages. All cytidine residues throughout each gapmer are
5-methylcytidines. Each gapmer listed in Table 15 is targeted to
SEQ ID NO: 93 (GENBANK Accession No. NR_003011.1).
TABLE-US-00016 TABLE 15 Chimeric antisense oligonucleotides haying
5-10-5 MOE wings and deoxy gap targeted to ACA45 scaRNA Start Stop
ISIS SEQ ID Site Site No. Sequence NO. 20 39 462037
TCAGCTTGATTTCAAGGACT 94 21 40 462038 GTCAGCTTGATTTCAAGGAC 95 26 45
462039 GCAGAGTCAGCTTGATTTCA 96 31 50 462040 TAAAAGCAGAGTCAGCTTGA 97
40 59 462041 TTAGGAGGCTAAAAGCAGAG 98 45 64 462042
TTCATTTAGGAGGCTAAAAG 99 50 69 462043 ACCTTTTCATTTAGGAGGCT 100 57 76
462044 TCTATCTACCTTTTCATTTA 101 62 81 462045 CCTGTTCTATCTACCTTTTC
102 67 86 462046 CAAGACCTGTTCTATCTACC 103 72 91 462047
GCAAACAAGACCTGTTCTAT 104 77 96 462048 ATTTTGCAAACAAGACCTGT 105 92
111 462049 GTAGGTCTTGAATTTATTTT 106 97 116 462050
GATAAGTAGGTCTTGAATTT 107 102 121 462051 TGGTAGATAAGTAGGTCTTG 108
107 126 462052 GCTGTTGGTAGATAAGTAGG 109
[0366] In a separate experiment, Hela cells were treated for 48 hr
with 50 nM of ISIS 462037 and ISIS 462038. Total RNA was prepared
and subjected to northern hybridization using 5'-end labeled
oligonucleotides specific to ACA45 scaRNA. U18 snoRNA (SEQ ID NO:
2) was detected and served as a loading control. The results are
presented in Table 16 and FIG. 45 and demonstrate that ACA scaRNA
was significantly inhibited by antisense oligonucleotides.
TABLE-US-00017 TABLE 16 Antisense inhibition of ACA45 scaRNA by
chimeric antisense oligonucleotides % ISIS No. inhibition 462037 83
462038 87
Example 18
Effect of Antisense Inhibition of Human scaRNA ACA45 on its Guide
Function
[0367] The effect of antisense oligonucleotide-mediated ACA45
reduction on its predicted function in guiding the
pseudouridylation at site U37 of U2 snRNA (Kiss A. M. et al., Mol.
Cell. Biol. 24: 5797-5807, 2004) was studied.
[0368] Hela cells were cultured in DMEM medium supplemented with
10% fetal calf serum and 1% penicillin/streptomycin at 37.degree.
C. in a 5% CO.sub.2 incubator. Sub-confluent cells were treated
with ISIS 462038 at 50 nM concentration in Opti-MEM medium
containing 4 .mu.g/mL Lipofectamine 2000 (Invitrogen, CA) for 4
hours, after which the transfection was replaced with fresh culture
medium. After a period of approximately 48 hours, RNA was isolated
from the cells.
[0369] Total RNA from test cells was treated with
N-cyclohexyl-N'-(2-morpholinoethyl)-carbodiimide
methyl-p-toluolsulfonate (CMC), and subjected to primer extension
analysis using a 5' end-labeled primer specific to U37 region of U2
snRNA (5'-TCGGATAGAGGACGTATCAG-3', designated herein as SEQ ID NO:
110). CMC treatment causes extension to stop one nucleotide before
the pseudouridine sites. Extension products were separated in an 8%
polyacrylamide gel, next to primer extension sequencing reactions
preformed with the same primer. The targeted pseudouridylation site
(.PSI.37), as well as other pseudouridine sites, is indicated in
FIG. 46.
[0370] The data in the figure demonstrates that there was no change
observed for pseudouridylation at the predicted position of U2snRNA
after antisense inhibition of ACA45 scaRNA. Therefore, it may be
possible that ACA45 scaRNA does not have the predicted function.
This theory is consistent with the observation that three
nucleotides of U2snRNA are unpaired in between the two duplexes
formed between U2snRNA and ACA45 RNA (FIG. 47), which is aberrant
from the guide rule in which two nucleotides are unpaired (Ganot,
P. et al., Cell. 89: 799-809, 1997).
Example 19
Antisense Inhibition of U16 and U50 snoRNAs in Mouse Primary
Hepatocytes
[0371] ISIS 462026 and ISIS 477499 were tested for their individual
and combined effects on their respective targets (U16 and U50) in
vitro.
[0372] Mouse primary hepatocytes were cultured on 6-well plates in
DMEM medium supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with the antisense
oligonucleotides individually at a 50 nM concentration or together
at 35 nM each in Opti-MEM medium containing 4 .mu.g/mL
Lipofectamine 2000 (Invitrogen, CA) for 4 hours, after which the
transfection was replaced with fresh culture medium. After a period
of approximately 24 hours, RNA was isolated from the cells and U16
and U50 mRNA levels were determined by northern hybridization.
[0373] Total RNA was prepared using Tri-Reagent, based on the
manufacturer's instructions. Five micrograms of total RNA was
separated in 8% polyacrylamide-7M urea gels and was transferred
onto a membrane, using semi-dry transfer apparatus. Northern
hybridization was performed using U16 snoRNA-specific 5'-end
labeled oligonucleotide probe (SEQ ID NO: 2) and U50
snoRNA-specific 5'-end labeled oligonucleotide probe (SEQ ID NO:
52). U2 snRNA were detected and served as a control for loading.
The density of the bands was scanned using an ImageJ densitometer.
Results for inhibition of are presented in Table 17 and FIG. 48.
The data indicates that ISIS 462026 and ISIS 477499 significantly
inhibited their target snoRNA expressions.
TABLE-US-00018 TABLE 17 Antisense inhibition by chimeric antisense
oligonucleotides targeted to U16 and U50 snoRNA ISIS % inhibition
No U16 U50 462026 >95 0 477499 0 >95
Example 20
In Vivo Inhibition of snoRNAs
[0374] ISIS 462026 (targeting U16) and ISIS 477499 (targeting U50),
demonstrating significant inhibition of their respective snoRNAs,
were tested in mice and the efficacy of the gapmers was
evaluated.
Treatment
[0375] Two groups of five seven-week old balb-c mice each were
administered subcutaneously with 100 mg/kg of ISIS 462026 or ISIS
477499. Another group of five mice was injected with 100 mg/kg of
control oligonucleotide ISIS 141923 (CCTTCCCTGAAGGTTCCTCC,
designated herein as SEQ ID NO: 111). Another group of five mice
were injected subcutaneously with PBS. The mice were sacrificed 72
hours later and several tissues were harvested for target mRNA
analysis. Tissues harvested were: liver, heart, spleen, white
adipose tissue (WAT), kidney, and muscle.
RNA Analysis
[0376] Total RNA from each of the various tissues was separately
prepared using Tri-Reagent, based on the manufacturer's
instructions. Five micrograms of total RNA was separated in 8%
polyacrylamide-7M urea gels and was transferred onto a membrane,
using semi-dry transfer apparatus. Northern hybridization was
performed using U16 snoRNA-specific 5'-end labeled oligonucleotide
probe (SEQ ID NO: 2) and U50 snoRNA-specific 5'-end labeled
oligonucleotide probe (SEQ ID NO: 52). U2 snRNA were detected and
served as a control for loading. The density of the bands was
scanned using an ImageJ densitometer. Results for inhibition are
presented in FIG. 49. The data indicates that ISIS 462026 and ISIS
477499 significantly inhibited their target snoRNA expressions.
Evaluation of rRNA Methylation
[0377] Total RNA was pooled for each group and subjected to primer
extension analysis to detect rRNA methylation at positions A485 in
18S rRNA, targeted by U16 snoRNA, or C2613 in 28S rRNA, targeted by
U50 snoRNA. The results are presented in Table 18 and FIG. 50 and
demonstrate significant inhibition at 0.05 mM dNTP concentration,
compared to the PBS control.
TABLE-US-00019 TABLE 18 Inhibition of rRNA methylation by antisense
oligonucleotides in (breed) mice liver relative to the PBS control
% inhibition of rRNA ISIS No methylation 462026 >95 477499
>93
Example 21
Antisense Inhibition of Nucleoplasmic Capped U1 snRNA in Mouse
Primary Hepatocytes
[0378] ISIS 469508 (5'-CTCCCCTGCCAGGTAAGTAT-3', designated herein
as SEQ ID NO: 112), targeting U1 snRNA was tested for its effects
on U1 snRNA in vitro.
[0379] Hela cells were cultured on 6-well plates in DMEM medium
supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin at 37.degree. C. in a 5% CO.sub.2
incubator. Sub-confluent cells were treated with ISIS 469508 at a
50 nM concentration in Opti-MEM medium containing 4 .mu.g/mL
Lipofectamine 2000 (Invitrogen, CA) for 4 hours, after which the
transfection was replaced with fresh culture medium. After a period
of approximately 24 hours, RNA was isolated from the cells and U1
mRNA levels were determined by qRT-PCR, using primer probe sets
described in FIG. 51. A forward primer T7F2 (5'-TACTTA
ATACGACTCACTATAGGCTAGCCTCG-3', designated herein as SEQ ID NO: 113)
that is specific to a mini-reporter gene derived from exons 6 to 8
of SMN2 pre-mRNA and a reverse primer SMN-E6/7R
(5'-TTTTGTCTAAAACCCATATAATAGCC-3', designated herein as SEQ ID NO:
114) were used to detect spliced mRNA, using SMN-E6P
(5'-CAGATTCTCTTGATGATGCTGATGCTTTGG-3', designated herein as SEQ ID
NO: 115) as a probe. Another reverse primer SMN-I6R (5'
TGTCAGGAAAAGATGCTGAGTG 3', designated herein as SEQ ID NO: 116) was
used in combination with T7F2 and SMN-E6P to detect un-spliced
pre-mRNA.
[0380] The results are presented in FIGS. 52 and 53. The data
indicates that ISIS 469508 impaired pre-mRNA splicing. Therefore,
antisense oligonucleotides can be utilized to specifically target
independently transcribed nucleoplasmic snRNAs.
Sequence CWU 1
1
1161150DNAHomo sapiens 1cttcatttat atggggttat tttgcttgca atgatgtcgt
aatttgcgtc ttactctgtt 60ctcagcgaca gttgcctgct gtcagtaagc tggtacagaa
ggttgacgaa aattcttact 120gagcaagaaa taaccttgtt gtaattacta
150220DNAArtificial SequenceSynthetic oligonucleotide 2ttgctcagta
agaattttcg 20320DNAArtificial SequenceSynthetic oligonucleotide
3attgccagtg ccgactatat 20420DNAArtificial SequenceSynthetic
oligonucleotide 4ataaccccat ataaatgaag 20520DNAArtificial
SequenceSynthetic oligonucleotide 5caagcaaaat aaccccatat
20620DNAArtificial SequenceSynthetic oligonucleotide 6tcattgcaag
caaaataacc 20720DNAArtificial SequenceSynthetic oligonucleotide
7cgacatcatt gcaagcaaaa 20820DNAArtificial SequenceSynthetic
oligonucleotide 8aattacgaca tcattgcaag 20920DNAArtificial
SequenceSynthetic oligonucleotide 9acgcaaatta cgacatcatt
201020DNAArtificial SequenceSynthetic oligonucleotide 10gtaagacgca
aattacgaca 201120DNAArtificial SequenceSynthetic oligonucleotide
11acagagtaag acgcaaatta 201220DNAArtificial SequenceSynthetic
oligonucleotide 12gctgagaaca gagtaagacg 201320DNAArtificial
SequenceSynthetic oligonucleotide 13ctgtcgctga gaacagagta
201420DNAArtificial SequenceSynthetic oligonucleotide 14ggcaactgtc
gctgagaaca 201520DNAArtificial SequenceSynthetic oligonucleotide
15cagcaggcaa ctgtcgctga 201620DNAArtificial SequenceSynthetic
oligonucleotide 16actgacagca ggcaactgtc 201720DNAArtificial
SequenceSynthetic oligonucleotide 17agcttactga cagcaggcaa
201820DNAArtificial SequenceSynthetic oligonucleotide 18gtaccagctt
actgacagca 201920DNAArtificial SequenceSynthetic oligonucleotide
19ccttctgtac cagcttactg 202020DNAArtificial SequenceSynthetic
oligonucleotide 20gtcaaccttc tgtaccagct 202120DNAArtificial
SequenceSynthetic oligonucleotide 21ttgctcagta agaattttcg
202220DNAArtificial SequenceSynthetic oligonucleotide 22atttcttgct
cagtaagaat 202320DNAArtificial SequenceSynthetic oligonucleotide
23aaggttattt cttgctcagt 202420DNAArtificial SequenceSynthetic
oligonucleotide 24acaacaaggt tatttcttgc 202520DNAArtificial
SequenceSynthetic oligonucleotide 25taattacaac aaggttattt
202621DNAArtificial SequenceSynthetic oligonucleotide 26gatacatcag
ataggagcga a 212718DNAArtificial SequenceSynthetic
oligonucleotidemisc_feature(1)..(2)bases at these positions are
RNAmisc_feature(4)..(18)bases at these positions are RNA
27uutgcgcgcc ugcugccu 182820DNAArtificial SequenceSynthetic
oligonucleotide 28gctactggca ggatcaacca 202919DNAArtificial
SequenceSynthetic oligonucleotide 29tgtttcagaa acacggacc
193023DNAArtificial SequenceSynthetic oligonucleotide 30cagggcagaa
cagatggcgt atc 233123DNAArtificial SequenceSynthetic
oligonucleotide 31accactcaga ccgcgttctc tcc 233222DNAArtificial
SequenceSynthetic oligonucleotide 32cagaatatca gatattttat tg
223378DNAHomo sapiens 33gatacaatga tgataacata gttcagcaga ctaacgctga
tgagcaatat taagtctttc 60gctcctatct gatgtatc 783477DNAHomo sapiens
34cagaatacat gatgatctca atccaacttg aactctctca ctgattactt gatgacaata
60aaatatctga tattctg 773520DNAArtificial SequenceSynthetic
oligonucleotide 35tatgttatca tcattgtatc 203620DNAArtificial
SequenceSynthetic oligonucleotide 36gctgaactat gttatcatca
203720DNAArtificial SequenceSynthetic oligonucleotide 37ttagtctgct
gaactatgtt 203820DNAArtificial SequenceSynthetic oligonucleotide
38atcagcgtta gtctgctgaa 203920DNAArtificial SequenceSynthetic
oligonucleotide 39attgctcatc agcgttagtc 204020DNAArtificial
SequenceSynthetic oligonucleotide 40acttaatatt gctcatcagc
204120DNAArtificial SequenceSynthetic oligonucleotide 41gataggagcg
aaagacttaa 204220DNAArtificial SequenceSynthetic oligonucleotide
42atacatcaga taggagcgaa 204320DNAArtificial SequenceSynthetic
oligonucleotide 43tgagatcatc atgtattctg 204420DNAArtificial
SequenceSynthetic oligonucleotide 44gttggattga gatcatcatg
204520DNAArtificial SequenceSynthetic oligonucleotide 45agttcaagtt
ggattgagat 204620DNAArtificial SequenceSynthetic oligonucleotide
46gtgagagagt tcaagttgga 204720DNAArtificial SequenceSynthetic
oligonucleotide 47gtaatcagtg agagagttca 204820DNAArtificial
SequenceSynthetic oligonucleotide 48tcatcaagta atcagtgaga
204920DNAArtificial SequenceSynthetic oligonucleotide 49tttattgtca
tcaagtaatc 205020DNAArtificial SequenceSynthetic oligonucleotide
50cagatatttt attgtcatca 205120DNAArtificial SequenceSynthetic
oligonucleotide 51cagaatatca gatattttat 205222DNAArtificial
SequenceSynthetic oligonucleotide 52ggttcgggat aagatcatca ca
225323DNAArtificial SequenceSynthetic oligonucleotide 53cgtacttatt
tttcttcagg tta 23545001DNAHomo sapiens 54gacggacaaa caagttgcag
aacatataga tcccatttgt atgtgaaaaa cgaagtacat 60atatttgcat ttgcatagga
agtctcaaaa actgttaaca gtggtattgc tgaagagtac 120aactagggag
aagattccca ggcatgtgga aagatacttt cactttgctt tttttgttaa
180ctctttttaa aaattttttt aatacaatag agacagggtc ttgggctcaa
tcctcccacc 240tcagcctcca aaagtgctct aattacagac ataagccacc
acacccggcc tactttgctt 300cttatatcct tttgtactgt attgtttgtt
ttactattta ctatgagcaa tatgcaaatt 360tatgtaagac attacaaagt
aatacaaaaa ccgacaaaat gcccggccca gtcaatactt 420catcatatag
gttcctgtta gagaaaagtg cttttcacta ctatctttga atgtgaagtt
480tgatcttcat tctaattttc taaaaagcca ccgaatgtat ttgttcattc
attcattcat 540ttaaccatta ccgacaacct acttaatgct aggcactgtt
ctaagaaaaa ataaacagca 600gagcacgaaa tcagatgtgt tgctcccaca
ctctagcaga atcggaccgt aatcaaatgc 660acacataaac aactttaata
agtagtgctt tgaaatatag aagtgaagaa cgacctgaat 720tttcaaatac
tgaaatgttc aaatgtcgtg tgcacacaca cacacgcaga catattcact
780cgaacatgct aattaatcaa agcactgctt ttgaattttg tgtttgtcgt
ctggataaag 840tattcaggga tacttctcaa attaatcttt ctctcgtttt
caatataact aattgagtac 900aaagaagtta aaaattagca aagcatttca
gctgtgtgac cttaggcaaa ttacctggct 960gttttaagcc tcagttttct
cctctgcgaa atggagtatt gaacctcacg ttcgctgttt 1020gagggagact
tgtatggtca cgtttagtgt aaccggatgc ctggcacgag gaagcgtgag
1080gaggaatgga tccccatggg gccttgatgc ccgccctgag gccctgcagg
gccgcacgcc 1140ggggctgttc tcacgtggcg ctttccgctt tttcacccaa
gcgtttctgc cagccaactg 1200ccctttcccg gagtgctgcg gccagggctc
gcccgctcct ccggcggcct ccgctggggg 1260cccactacag cccagcgcca
gccagccagc cagcccagct tctcgaatcg gtcctaagct 1320gaggccgccc
tgcgctgcaa aacttgtgtc cactctcgga cccaatctgt cctggacgga
1380cttggctcgt ggcaggcgaa agcgtcgttt ccaactgcag ctgtttgaat
tctggcgcca 1440cacccgcgcc acgtagggcc aagtcggccg ccagactcgt
aagagacgct tcgcagtgcg 1500cctgcgggcg cgcgccggga aatggccggg
cgcgcggccg gcctgcggcg cgctccacaa 1560cgcggaacgg gcctcagaag
agccaccgcg cgcgctcccg ctaattcgcg accacacccc 1620tgtctacttc
catgtccaat aggtgcgaga gggcgggacg gcctcgttct gactccggga
1680ggctatataa ggagctactg gctgcgcact tcggtctttt acgtcggcct
tcgcgagcgt 1740ctgggcgggt ggtaggtgag tgggtattgc gggctagtat
ccgagcaaaa gatggtggcg 1800caggccgagt taagagcttt aatcctgtga
agacatctta gtgaagagtt tagagtgctg 1860agagttgaaa gcttgcacgt
gggaaacgtg cggccggact gccacatgta ctgaggttga 1920gtcgtgacgg
ccacaggctc cgagttttgg cgtgaggaac cgctgatcgg ccacgggcgc
1980cgaacttgct ggcctccggc atgtgcctga gcggcggcgg aaaaaccacc
ttaattgggg 2040cggagggtta gttttaacag caaagggcct ttactaaaat
ggcgaaggcc ttccgtcggc 2100gttgttttaa aatgggaagc ctcgaccctg
tattgaaact gagctgttcg aaggcggcgt 2160tgtgtgcaat tcggattaat
gaaggggaag ggttttgtgt ggaaaaacgc cttggagtgt 2220gacatttctg
cgagaatgct taaataccga tttcccgcag gaacaatggc gctgtcttca
2280gtggcacagt ggagcagctc tgaagatgca aaggtaagag cttagttaag
cttagtttcc 2340aaactaaagg agtaaacctg ttgatttaca ggaataggaa
ctgttgcatc gtttgaaatt 2400tacttttttt tgttagatac acgaaaaaac
ttccagaaca tctgggagaa tatttaatgg 2460aaaatcgctt ggttaaaacc
tgacactttt aacaggtatg tgttgtttta gtactttatg 2520attgagcata
gcatttaatc cacacctaga ctaaatcaaa ttttttttgt cagtgaacag
2580cgttctgagt gtggacgagt agccagtgaa gataatgaat gtcgaatgtg
actgactagc 2640agcttcattt tgaagtaggt tgtatggctt aaaagttctg
tagtatttgt actataatac 2700ttgcctttta gcattacctt ggtttgtagt
cagtgtcaca gaagtgcagt ttaatgtatt 2760atgtgtacat atacaaggtc
tgattggtct aatcaatgat gaaacctatc ccgaagctga 2820taacctgaag
aaaaataagt acggattcgg cttctgagat taagaccagt aattcagagg
2880tggagtaaat tttgttgccg tgattttata acagttgtgt tataaaatcc
tgggtttttt 2940ttttttctgc caacagtgag ggtcgctgtc tgcccattga
tagaggccag attgtcttgg 3000aagttccaaa gttgcaacga tttctgtaag
tggagttttt ctgtttgctt agagatcagt 3060gaatattgtg tccttggtct
tatctgtgat gatcttatcc cgaacctgaa cttctgttga 3120aaaaaaaaaa
cttttacgga tctggcttct gagatggacc gttataagga caatattttt
3180ttttaatact tttaatgctt ttacatatgt tgtaatgttt gtagtcttgt
aagaatctcg 3240tgtttttcct tttctagggc tagtgccacg aggtttactt
gactgttgtg tgaaaagctg 3300ataagaaaac catccagaaa aaagctcttc
gttttacaaa catgaaaata aaacatgtaa 3360ttttggatta tgttcctttt
tgttattact tttaaatagg tcctgaaata acatggggag 3420cattaaatgg
aaaatccact aaccagcctt gtaatcaaat tactgtgagt gaatgtttcg
3480ggtttgtgca gggtacaatg taagggtttt tggatcagtg taagagtgga
gagacaggaa 3540ttagaagtaa ttgttactaa gcaaatcatg gaatatttag
ttttgatgta actataattt 3600tgaaagcctg gatgcttaag ttgagaaatg
ggggaatgag atacagaaaa taaggagcac 3660aatagaataa taatagcagt
ttattaagta tggtcatgag ggaaggttac tgataaaaca 3720atctggtaaa
gacattcagg cttgctaaaa tctaggaaga ggtcatttgg caggatgggt
3780tacataatgc tatctgatac taccaaataa aatgagagag aagccttagg
catgtaacgt 3840ttggagatag aaaatgtacc ttcactatga aggtagtgtg
tgtaagatgg cagttgaaag 3900cattgcttgt gtttatgttt atacccttga
tctctgatgc ccttacctac cgtacttaaa 3960actctgttaa tcattgtctt
tctccccctc ccacaacttc tgcataaaat tttaagatct 4020gtgtttcatt
agttcaagag tgcctagaat agggccaggc actgttatac agtatgtggt
4080aaaagactat tgagattcca gttttcaagg aagagtgcca ttaccgtttt
gttaaagctg 4140gcaaacaaga caaagttgtg aaatagactg gttgctttgg
agccctctga ccgcttttcc 4200tgtagctcct tctacctccc ttgcctccca
atagattttt taatatgtca cattatctat 4260cgaaattagt actccacatt
tatatgcact ggcttgtgct aggctctgcc aagactcctg 4320aaataaaacc
gttttgtcaa cagtggcaca agatgccaag gaaaagtcaa gctatgaagg
4380attcttgaaa atagaacaag tggatttgag tctaaaccag cacagatgtt
gggacaatag 4440gcctaagaaa taactgagca aagacagtat ggttcagagt
ctgagacaaa tattgaggat 4500ttgggtacca acagggtgga taggtgtagg
acagaaaact gatgttataa atacccttaa 4560gattcttgag caaggaagtt
acaaatgtaa gactattcct gtaatgagag tcagatccaa 4620aaaggtttaa
tttgaatgga attgaacttg aaagttcagt ttcaattact gactccttga
4680tggcaatttc taatcacaca ggaggctgtt agtctgtcat agcctcctaa
aatctcaggc 4740gatattggtt aagatcagtt tcctaagttt accctccaga
gcatagctgc tgcttgggac 4800caggtgcagt gactcatgcc tgtaatccca
gcactctgct tgagcccagg aagagaccag 4860cctggaaaca gcaagttgtc
atctctataa ataagtaaaa ctgggtgtgg taacatgcgc 4920ttgttccagc
tactcgggag gctgagatag gaggatcact tgaacctagg aggttgaagc
4980tacaatcagc catgattgca c 50015520DNAArtificial SequenceSynthetic
oligonucleotide 55ggataagatc atcacagata 205620DNAArtificial
SequenceSynthetic oligonucleotide 56gttcgggata agatcatcac
205720DNAArtificial SequenceSynthetic oligonucleotide 57ttcaggttcg
ggataagatc 205820DNAArtificial SequenceSynthetic oligonucleotide
58agaagttcag gttcgggata 205920DNAArtificial SequenceSynthetic
oligonucleotide 59tcaacagaag ttcaggttcg 206020DNAArtificial
SequenceSynthetic oligonucleotide 60aagccagatc cgtaaaagtt
206120DNAArtificial SequenceSynthetic oligonucleotide 61ctcagaagcc
agatccgtaa 206220DNAArtificial SequenceSynthetic oligonucleotide
62ctcagaagcc gaatccgtag 206322DNAArtificial SequenceSynthetic
oligonucleotide 63tggaacgctt cacgaatttg cg 226424DNAArtificial
SequenceSynthetic oligonucleotide 64gaatgtctca caatacagct aaat
246521DNAArtificial SequenceSynthetic oligonucleotide 65ctggatcaga
acttgactat c 2166137DNAHomo sapiens 66gtcttctcat tgagctcctt
tctgtctatc agtggcagtt tatggattcg cacgagaaga 60agagagaatt cacagaacta
gcattatttt accttctgtc tttacagagg tatatttagc 120tgtattgtga gacattc
1376720DNAArtificial SequenceSynthetic oligonucleotide 67aaggagctca
atgagaagac 206820DNAArtificial SequenceSynthetic oligonucleotide
68acagaaagga gctcaatgag 206920DNAArtificial SequenceSynthetic
oligonucleotide 69gatagacaga aaggagctca 207020DNAArtificial
SequenceSynthetic oligonucleotide 70ccactgatag acagaaagga
207120DNAArtificial SequenceSynthetic oligonucleotide 71aactgccact
gatagacaga 207220DNAArtificial SequenceSynthetic oligonucleotide
72ccataaactg ccactgatag 207320DNAArtificial SequenceSynthetic
oligonucleotide 73cgaatccata aactgccact 207420DNAArtificial
SequenceSynthetic oligonucleotide 74tcgtgcgaat ccataaactg
207520DNAArtificial SequenceSynthetic oligonucleotide 75tcttctcgtg
cgaatccata 207620DNAArtificial SequenceSynthetic oligonucleotide
76tctcttcttc tcgtgcgaat 207720DNAArtificial SequenceSynthetic
oligonucleotide 77aattctctct tcttctcgtg 207820DNAArtificial
SequenceSynthetic oligonucleotide 78ctgtgaattc tctcttcttc
207920DNAArtificial SequenceSynthetic oligonucleotide 79tagttctgtg
aattctctct 208020DNAArtificial SequenceSynthetic oligonucleotide
80aaaataatgc tagttctgtg 208120DNAArtificial SequenceSynthetic
oligonucleotide 81aaggtaaaat aatgctagtt 208220DNAArtificial
SequenceSynthetic oligonucleotide 82gacagaaggt aaaataatgc
208320DNAArtificial SequenceSynthetic oligonucleotide
83gtaaagacag
aaggtaaaat 208420DNAArtificial SequenceSynthetic oligonucleotide
84cctctgtaaa gacagaaggt 208520DNAArtificial SequenceSynthetic
oligonucleotide 85atatacctct gtaaagacag 208620DNAArtificial
SequenceSynthetic oligonucleotide 86gctaaatata cctctgtaaa
208720DNAArtificial SequenceSynthetic oligonucleotide 87atacagctaa
atatacctct 208820DNAArtificial SequenceSynthetic oligonucleotide
88tcacaataca gctaaatata 208920DNAArtificial SequenceSynthetic
oligonucleotide 89atgtctcaca atacagctaa 209020DNAArtificial
SequenceSynthetic oligonucleotide 90gaatgtctca caatacagct
209122DNAArtificial SequenceSynthetic oligonucleotide 91aaggaaccat
aactgattta at 229223DNAArtificial SequenceSynthetic oligonucleotide
92gctgttggta gataagtagg tct 2393127DNAHomo sapiens 93ctggagacta
agaaaataga gtccttgaaa tcaagctgac tctgctttta gcctcctaaa 60tgaaaaggta
gatagaacag gtcttgtttg caaaataaat tcaagaccta cttatctacc 120aacagca
1279420DNAArtificial SequenceSynthetic oligonucleotide 94tcagcttgat
ttcaaggact 209520DNAArtificial SequenceSynthetic oligonucleotide
95gtcagcttga tttcaaggac 209620DNAArtificial SequenceSynthetic
oligonucleotide 96gcagagtcag cttgatttca 209720DNAArtificial
SequenceSynthetic oligonucleotide 97taaaagcaga gtcagcttga
209820DNAArtificial SequenceSynthetic oligonucleotide 98ttaggaggct
aaaagcagag 209920DNAArtificial SequenceSynthetic oligonucleotide
99ttcatttagg aggctaaaag 2010020DNAArtificial SequenceSynthetic
oligonucleotide 100accttttcat ttaggaggct 2010120DNAArtificial
SequenceSynthetic oligonucleotide 101tctatctacc ttttcattta
2010220DNAArtificial SequenceSynthetic oligonucleotide
102cctgttctat ctaccttttc 2010320DNAArtificial SequenceSynthetic
oligonucleotide 103caagacctgt tctatctacc 2010420DNAArtificial
SequenceSynthetic oligonucleotide 104gcaaacaaga cctgttctat
2010520DNAArtificial SequenceSynthetic oligonucleotide
105attttgcaaa caagacctgt 2010620DNAArtificial SequenceSynthetic
oligonucleotide 106gtaggtcttg aatttatttt 2010720DNAArtificial
SequenceSynthetic oligonucleotide 107gataagtagg tcttgaattt
2010820DNAArtificial SequenceSynthetic oligonucleotide
108tggtagataa gtaggtcttg 2010920DNAArtificial SequenceSynthetic
oligonucleotide 109gctgttggta gataagtagg 2011020DNAArtificial
SequenceSynthetic oligonucleotide 110tcggatagag gacgtatcag
2011120DNAArtificial SequenceSynthetic oligonucleotide
111ccttccctga aggttcctcc 2011220DNAArtificial SequenceSynthetic
oligonucleotide 112ctcccctgcc aggtaagtat 2011326DNAArtificial
SequencePrimer 113atacgactca ctataggcta gcctcg 2611426DNAArtificial
SequencePrimer 114ttttgtctaa aacccatata atagcc 2611530DNAArtificial
SequenceProbe 115cagattctct tgatgatgct gatgctttgg
3011622DNAArtificial SequencePrimer 116tgtcaggaaa agatgctgag tg
22
* * * * *
References