U.S. patent application number 15/848717 was filed with the patent office on 2018-07-12 for arrays with quality control tracers.
The applicant listed for this patent is ILLUMINA, INC.. Invention is credited to John M. Beierle, Alexander Fuhrmann, Michael S. Graige, Peyton Shieh, Randall Smith, Wei Wei, Naiqian Zhan.
Application Number | 20180195115 15/848717 |
Document ID | / |
Family ID | 62627781 |
Filed Date | 2018-07-12 |
United States Patent
Application |
20180195115 |
Kind Code |
A1 |
Shieh; Peyton ; et
al. |
July 12, 2018 |
ARRAYS WITH QUALITY CONTROL TRACERS
Abstract
An array includes a support including a plurality of discrete
wells, a gel material positioned in each of the plurality of
discrete wells, and a quality control tracer grafted to the gel
material in each of the plurality of discrete wells. The quality
control tracer comprises (a) a cleavable nucleotide sequence
comprising a cleavage site and (b) a detectable label; and in some
aspects, is a cleavable nucleotide sequence with a detectable label
and a non-reactive nucleotide sequence or a primer nucleotide
sequence.
Inventors: |
Shieh; Peyton; (San Diego,
CA) ; Beierle; John M.; (Carlsbad, CA) ;
Graige; Michael S.; (Cardiff by the Sea, CA) ;
Fuhrmann; Alexander; (San Diego, CA) ; Smith;
Randall; (San Marcos, CA) ; Wei; Wei; (San
Diego, CA) ; Zhan; Naiqian; (San Diego, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ILLUMINA, INC. |
San Diego |
CA |
US |
|
|
Family ID: |
62627781 |
Appl. No.: |
15/848717 |
Filed: |
December 20, 2017 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62438284 |
Dec 22, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2565/514 20130101;
C12Q 2565/501 20130101; C12Q 1/6837 20130101; C12Q 1/6837 20130101;
C12Q 2565/507 20130101 |
International
Class: |
C12Q 1/6837 20060101
C12Q001/6837 |
Claims
1. An array, comprising: a support comprising a plurality of
discrete wells; a gel material positioned in each of the plurality
of discrete wells; and a quality control tracer grafted to the gel
material in each of the plurality of discrete wells; wherein the
quality control tracer comprises (a) a cleavable nucleotide
sequence comprising a cleavage site and (b) a detectable label.
2. The array of claim 1, wherein the cleavable nucleotide sequence
comprises a non-reactive nucleotide sequence.
3. The array of claim 1, wherein the cleavable nucleotide sequence
comprises a grafted region with a first end and a second end, where
the first end is grafted to the gel material and the second end is
linked to a cleavable region that is linked to the detectable label
and comprises the cleavage site.
4. The array of claim 3, wherein the grafted region comprises a
non-reactive nucleotide sequence.
5. The array of claim 3, wherein the grafted region comprises a
primer nucleotide sequence.
6. The array of claim 3, wherein the detectable label is attached
to the cleavable nucleotide sequence at the cleavage site or at a
position in the cleavable region that is distal to the cleavage
site.
7. The array of claim 1, wherein the cleavage site comprises an
enzymatically cleavable nucleobase.
8. The array of claim 7, wherein the enzymatically cleavable
nucleobase comprises an excision site.
9. The array of claim 7, wherein the enzymatically cleavable
nucleobase is susceptible to cleavage by reaction with a
glycosylase and an endonuclease or with an exonuclease.
10. The array of claim 9, wherein the cleavable nucleotide sequence
is grafted to the gel material at its 5' end.
11. The array of claim 10, wherein the detectable label is attached
at or near the 3' end of the cleavable nucleotide sequence.
12. The array of claim 11, wherein the detectable label is
cleavable by reaction of the quality control tracer with the
exonuclease.
13. The array of claim 11, wherein the detectable label is
cleavable by reaction of the quality control tracer with the
glycosylase and the endonuclease.
14. The array of claim 1, wherein the cleavage site comprises a
chemically cleavable linker.
15. The array of claim 14, wherein the chemically cleavable linker
comprises a vicinal diol, a disulfide, a silane, an azobenzene, a
photocleavable group, or an azido.
16. The array of claim 1, further comprising an unlabeled primer
comprising a primer nucleotide sequence grafted to the gel material
in each of the plurality of discrete wells, wherein the quality
control tracer and the unlabeled primer are present in a
predetermined ratio.
17. The array of claim 1, wherein the gel material comprises a
polymer of Formula (I): ##STR00012## wherein: R.sup.1 is H or
optionally substituted alkyl; R.sup.A is selected from the group
consisting of azido, optionally substituted amino, optionally
substituted alkenyl, optionally substituted hydrazone, optionally
substituted hydrazine, carboxyl, hydroxy, optionally substituted
tetrazole, optionally substituted tetrazine, nitrile oxide,
nitrone, and thiol; R.sup.5 is selected from the group consisting
of H and optionally substituted alkyl; each of the
--(CH.sub.2).sub.p-- can be optionally substituted; p is an integer
in the range of 1 to 50; n is an integer in the range of 1 to
50,000; and m is an integer in the range of 1 to 100,000.
18. The array of claim 17, wherein the gel material comprises
PAZAM.
19. The array of claim 1, wherein the detectable label is a
fluorescent label.
20. The array of claim 19, wherein the fluorescent label is
selected from the group consisting of: a sulfonyl chloride dye,
cyanine dyes, a red wavelength dye, a fluorescent dye, derivatives
of fluorescein, xanthene fluorophores, and an indocarbocyanine
dye.
21. A method of determining the density, the distribution, or the
density and the distribution of a primer nucleotide sequence
grafted to a support comprising: providing a support comprising a
plurality of discrete wells and a gel material positioned in each
of the plurality of discrete wells and a quality control tracer and
the primer nucleotide sequence grafted to the gel material each of
the plurality of discrete wells; wherein the quality control tracer
comprises (a) a cleavable nucleotide sequence comprising a cleavage
site and (b) a detectable label; detecting a signal from the
detectable label; determining the density and/or distribution of
the quality control tracer based at least in part on the signal
from the detectable label; and determining the density and/or
distribution of the grafted primer nucleotide sequence based at
least in part on the determined density and/or distribution of the
quality control tracer.
22. The method of claim 21, further comprising grafting the quality
control tracer to the gel material.
23. The method of claim 22, wherein the primer nucleotide sequence
is grafted to the gel material, either before or at the same time
as the grafting of the quality control tracer, and prior to the
detecting step.
24. The method of claim 21, wherein the quality control tracer
comprises a non-reactive nucleotide sequence.
25. The method of claim 21, wherein the quality control tracer
comprises the primer nucleotide sequence and the grafting of the
quality control tracer also serves to graft the primer nucleotide
sequence to the gel material.
26. The method of claim 21, wherein the cleavable nucleotide
sequence comprises a grafted region with a first end and a second
end, where the first end is grafted to the gel material and the
second end is linked to a cleavable region comprising the cleavage
site, wherein the second end of the grafted region is linked to the
cleavage site of the cleavable region.
27. The method of claim 26, wherein the grafted region comprises a
non-reactive nucleotide sequence.
28. The method of claim 26, wherein the grafted region comprises a
primer nucleotide sequence.
29. The method of claim 26, wherein the detectable label is
attached to the cleavable nucleotide sequence at the cleavage site
or at a position in the cleavable region that is distal to the
cleavage site.
30. The method of claim 21, wherein the quality control tracer and
the primer nucleotide sequence are grafted to the gel material in a
predetermined ratio and the determining of the density and/or
distribution of the primer nucleotide sequence is based on the
detected signal and the predetermined ratio.
30. (canceled)
31. The method of claim 56, wherein the removing is accomplished by
enzymatic cleavage or chemical cleavage.
32. The method of claim 21, wherein the detectable label is a
fluorescent label and the detected signal is fluorescence.
33. A method, comprising: grafting a quality control tracer to a
gel material in a well on a support, the quality control tracer
being selected from the group consisting of: a cleavable nucleotide
sequence tagged, at its 3' end, with a fluorescent label; and a
non-reactive nucleotide sequence with the fluorescent label
attached to a cleavable nucleobase; detecting the quality control
tracer using fluorescence; and based at least in part on the
fluorescence, determining a density, or a distribution, or the
density and the distribution, of a primer nucleotide sequence
grafted to the gel material.
34. The method of claim 33, wherein the quality control tracer is
the cleavable nucleotide sequence, and wherein the cleavable
nucleotide sequence is the primer nucleotide sequence.
35. The method of claim 34, further comprising cleaving the
fluorescent label from the primer nucleotide sequence after the
density, or the distribution, or the density and the distribution,
of the primer nucleotide sequence is determined.
36. The method of claim 34, wherein: the primer nucleotide sequence
is untagged; prior to the detecting, the method further comprises
grafting the primer nucleotide sequence to the gel material,
wherein the cleavable nucleotide sequence and the primer nucleotide
sequence are present in a predetermined ratio; and the determining
of the density, or the distribution, or the density and the
distribution, of the primer nucleotide sequence is based on the
fluorescence and the predetermined ratio.
37. The method of claim 36, further comprising cleaving the
fluorescent label from the cleavable nucleotide sequence, wherein
the cleaving is accomplished by enzymatic cleavage or chemical
cleavage.
38. The method of claim 33, wherein: the quality control tracer is
the non-reactive nucleotide sequence; the primer nucleotide
sequence is untagged; prior to the detecting, the method further
comprises grafting the primer nucleotide sequence to the gel
material, wherein the non-reactive nucleotide sequence and the
primer nucleotide sequence are present in a predetermined ratio;
and the determining of the density, or the distribution, or the
density and the distribution, of the primer nucleotide sequence is
based on the fluorescence and the predetermined ratio.
39. The method of claim 38, further comprising removing the
fluorescent label from the cleavable nucleobase of the non-reactive
nucleotide sequence using an exonuclease.
40. A method of co-grafting a quality control tracer and a primer
nucleotide sequence to an array, comprising: combining the quality
control tracer and the primer nucleotide sequence at a
predetermined ratio to form a grafting mix; wherein the quality
control tracer comprises (a) a cleavable nucleotide sequence
comprising a cleavage site and (b) a detectable label; exposing the
grafting mix to a gel material in a well on a support; and
incubating the grafting mix and the gel material, thereby
co-grafting the quality control tracer and the primer nucleotide
sequence to the gel material.
41. The method of claim 40, wherein the quality control tracer is:
a cleavable nucleotide sequence tagged, at its 3' end, with a
fluorescent label; or a non-reactive nucleotide sequence with the
fluorescent label attached to a cleavable nucleobase.
42. The method of claim 40, further comprising: detecting the
grafted quality control tracer by detecting a signal from the
detectable label; and based at least in part on the detected signal
and the predetermined ratio, determining a density, or a
distribution, or the density and the distribution, of the primer
nucleotide sequence grafted to the gel material.
43. The method of claim 40, further comprising removing the
detectable label from the cleavable nucleotide sequence via
enzymatic cleavage or chemical cleavage at the cleavage site.
44. The method of claim 40, wherein the cleavable nucleotide
sequence includes a linker molecule attaching the detectable
label.
45. The method of claim 44, wherein the linker molecule comprises a
diol, a disulfide, a silane, an azobenzene, a photocleavable group,
or an azido.
46. The method of claim 40, wherein the cleavage site comprises a
cleavable nucleobase.
47. The method of claim 46, further comprising removing the
detectable label by reaction of the cleavable nucleobase with a
glycosylase and an endonuclease or with an exonuclease.
48. The method of claim 40, wherein the detectable label is a
fluorescent label.
49. A method of grafting a quality control tracer to an array,
comprising grafting a quality control tracer to a gel material in a
well on a support; wherein the quality control tracer comprises (a)
a cleavable nucleotide sequence comprising a cleavage site and (b)
a detectable label; and wherein the cleavable nucleotide sequence
comprises a grafted region with a first end and a second end, where
the first end is grafted to the gel material and the second end is
linked to a cleavable region that is linked to the detectable label
and comprises the cleavage site.
50. The method of claim 49, wherein the grafted region comprises a
primer nucleotide sequence.
51. The method of claim 50, further comprising cleaving the quality
control tracer at the cleavage site, thereby removing the
detectable label and providing an unlabeled primer nucleotide
sequence grafted to the gel material.
52. The method of claim 49, wherein the grafted region comprises a
non-reactive nucleotide sequence.
53. The method of claim 52, further comprising grafting a primer
comprising a primer nucleotide sequence to the gel material in a
pre-determined ration with the quality control tracer.
54. The method of claim 53, further comprising removing the
detectable label from the quality control tracer by cleavage
reaction at the cleavage site.
55. A grafting mix composition, comprising: (1) a primer comprising
a primer nucleotide sequence and (2) a quality control tracer,
wherein the quality control tracer comprises (a) a cleavable
nucleotide sequence comprising a cleavage site and (b) a detectable
label; and wherein the primer and the quality control tracer are
present in the composition in a predetermined ratio.
56. The method of claim 21, further comprising removing the
detectable label from the quality control tracer by a cleavage
reaction at the cleavage site.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application Ser. No. 62/438,284, filed Dec. 22, 2016, the contents
of which is incorporated by reference herein in its entirety.
REFERENCE TO SEQUENCE LISTING
[0002] The Sequence Listing submitted herewith via EFS-Web is
hereby incorporated by reference in its entirety. The name of the
file is ILI104B_IP-1477-US_Sequence_Listing_ST25.txt, the size of
the file is 7,476 bytes, and the date of creation of the file is
Dec. 20, 2017.
BACKGROUND
[0003] Biological arrays are among a wide range of tools used to
detect, analyze, and/or sequence molecules, including
deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). In these
applications, the arrays are engineered to include nucleic acid
sequences useful as sequencing or amplification primers or as
probes for nucleotide sequences present in genes in humans and
other organisms. Beyond these applications, biological arrays may
be used for the detection and evaluation of a wide range of
molecules, families of molecules, genetic expression levels, single
nucleotide polymorphisms, and genotyping.
[0004] In general, genetic sequencing involves determining the
order of nucleotides or nucleic acids in a length of genetic
material, such as a fragment of DNA or RNA. Increasingly longer
sequences of base pairs are being analyzed, and the resulting
sequence information may be used in various bioinformatics methods
to logically fit fragments together so as to reliably determine the
sequence of extensive lengths of genetic material from which the
fragments were derived. Automated, computer-based examination of
characteristic fragments have been developed, and have been used in
genome mapping, identification of genes and their function,
evaluation of risks of certain conditions and disease states, and
so forth. In certain applications, for example, modified target
nucleic acids are hybridized to sequencing or amplification primers
on the surface of an array, amplified, and their genetic sequences
determined.
[0005] In other examples, individual DNA and RNA probes may be
attached at small locations in a geometric grid (or randomly) on an
array support. A test sample, e.g., from a known person or
organism, may be exposed to the grid, such that complementary
fragments hybridize to the probes at the individual sites in the
array. The array can then be examined by scanning specific
frequencies of light over the sites to identify which fragments are
present in the sample, by fluorescence of the sites at which the
fragments hybridized.
[0006] Proper functionality and reproducibility of the nucleic
acid-functionalized array depends on consistent display of the
nucleic acid sequences bound thereto. The present application is
directed to quality control compositions, arrays, and methods for
ensuring consistent deposition of nucleic acid sequences on the
array surface and retention of the sequences following any
subsequent manufacturing and storage of the arrays.
SUMMARY
[0007] In certain aspects, the present disclosure is directed to an
array that includes a support comprising a plurality of discrete
wells, a gel material positioned in each of the plurality of
discrete wells, and a quality control tracer grafted to the gel
material in each of the plurality of discrete wells. In some
embodiments, the quality control tracer grafted to the gel material
comprises (a) a cleavable nucleotide sequence comprising a cleavage
site and (b) a detectable label. In some embodiments, the quality
control tracer is grafted to the gel material at a first end of the
tracer. In some embodiments, the cleavable nucleotide sequence
comprises a grafted region with a first end and a second end, where
the first end is grafted to the gel material and the second end is
linked to a cleavable region that is linked to the detectable label
and comprises the cleavage site. In some embodiments, the cleavable
nucleotide sequence comprises a non-reactive nucleotide sequence,
and in some instances, the grafted region comprises the
non-reactive nucleotide sequence. In other embodiments, the
cleavable nucleotide sequence comprises a primer nucleotide
sequence, and in some instances, the grafted region comprises the
primer nucleotide sequence.
[0008] In some embodiments, the detectable label is linked to the
quality control tracer or cleavable nucleotide sequence at the
cleavage site. In other embodiments, the detectable label is linked
to the quality control tracer or cleavable nucleotide sequence at a
position that is distal to the cleavage site and the grafted first
end (e.g., support--grafted first end of tracer--cleavage site of
tracer--detectable label on tracer), and in further embodiments,
that position is at the 3' end of the cleavable nucleotide
sequence. In some embodiments, the detectable label is attached at
or near the 3' end of the cleavable nucleotide sequence. In some
embodiments, the cleavable nucleotide sequence is grafted to the
gel material at its 5' end. In some embodiments, the detectable
label is cleavable by reaction of the quality control tracer with
an exonuclease. In other embodiments, the detectable label is
cleavable by reaction of the quality control tracer with a
glycosylase and an endonuclease.
[0009] In some embodiments, the cleavage site is a cleavable
nucleobase. In some embodiments, the cleavable nucleobase is an
enzymatically cleavable nucleobase. In some embodiments, the
enzymatically cleavable nucleobase comprises an excision site. In
some embodiments, the cleavable nucleobase is susceptible to
cleavage by reaction with a glycosylase and an endonuclease, or
with an exonuclease. In some embodiments, the cleavage site
comprises a chemically cleavable linker. In some embodiments, the
chemically cleavable linker comprises a vicinal diol, a disulfide,
a silane, an azobenzene, a photocleavable group, or an azido.
[0010] In some embodiments, the detectable label is a fluorescent
label.
[0011] In some embodiments, the quality control tracer comprises
(a) a cleavable nucleotide sequence tagged, at its 3' end, with a
fluorescent label or (b) a non-reactive nucleotide sequence
comprising a cleavable nucleobase with a fluorescent label attached
thereto. In some aspects, the cleavable nucleotide sequence
comprises a primer nucleotide sequence. In some aspects, the array
with quality control tracer further comprises an unlabeled primer
grafted to the gel material in each of the plurality of discrete
wells, wherein the primer comprises a primer nucleotide sequence.
Such arrays are contemplated for use in any of the methods
described herein.
[0012] In some embodiments, the quality control tracer does not
comprise a primer nucleotide sequence, and the array further
comprises a separate unlabeled primer comprising a primer
nucleotide sequence grafted to the gel material in each of the
plurality of discrete wells. In some embodiments, the quality
control tracer and the unlabeled primer (and thus, the primer
nucleotide sequence) are present on the gel material in a
predetermined ratio.
[0013] The present application is directed to a method of
determining the density and/or distribution of a grafted primer
nucleotide sequence comprising: providing a support comprising a
plurality of discrete wells and a gel material positioned in each
of the plurality of discrete wells and a quality control tracer and
the primer nucleotide sequence grafted to the gel material in each
of the plurality of discrete wells; wherein the quality control
tracer comprises (a) a cleavable nucleotide sequence comprising a
cleavage site and (b) a detectable label; and detecting a signal
from the detectable label; determining the density and/or
distribution of the quality control tracer based at least in part
on the signal from the detectable label; and determining the
density and/or distribution of the grafted primer nucleotide
sequence based at least in part on the determined density and/or
distribution of the quality control tracer. In some embodiments,
the method further comprises grafting the quality control tracer to
the gel material. In some aspects, the quality control tracer
comprises the primer nucleotide sequence. In other aspects, the
quality control tracer comprises a non-reactive nucleotide sequence
(and no primer nucleotide sequence), and the primer nucleotide
sequence is grafted to the gel material, either before or at the
same time as the grafting of the quality control tracer, and prior
to the detecting step. In other embodiments, the quality control
tracer comprises the primer nucleotide sequence, such that grafting
of the quality control tracer serves to graft both the tracer and
the primer nucleotide sequence to the gel material. In some
embodiments, the quality control tracer and the primer nucleotide
sequence are grafted to the gel material in a predetermined ratio
and the determining of the density and/or distribution of the
primer nucleotide sequence is based on the detected signal and the
predetermined ratio. In some embodiments, the method further
comprises removing the detectable label from the quality control
tracer by a cleavage reaction at the cleavage site. In some
instances, the removing is accomplished by enzymatic cleavage or
chemical cleavage. In some instances, the removing is done by
reaction at the cleavage site with a glycosylase and an
endonuclease or with an exonuclease. In other instances, the
removing is accomplished by chemical reaction of a linker molecule
attaching the cleavable nucleotide sequence to the detectable
label.
[0014] In an example of the methods disclosed herein, a quality
control tracer is grafted to a gel material in a well on a support.
The quality control tracer is detected, for example, using
fluorescence where the detectable label is a fluorescent label,
and, based at least in part on the detected signal or fluorescence,
a density, or a distribution, or the density and the distribution,
of a primer nucleotide sequence grafted to the gel material is/are
determined. In some aspects, the method comprises grafting a
quality control tracer to a gel material in a well on a support,
detecting the quality control tracer using fluorescence, and, based
at least in part on the fluorescence, determining a density, or a
distribution, or the density and the distribution, of a primer
nucleotide sequence grafted to the gel material. In some aspects,
the method further comprises cleaving the detectable label from the
quality control tracer at the cleavage site.
[0015] In another aspect, the present disclosure is directed to a
method of co-grafting a quality control tracer and a primer
nucleotide sequence to an array, comprising: combining a quality
control tracer and a primer nucleotide sequence at a predetermined
ratio to form a grafting mix; exposing the grafting mix to a gel
material in a well on a support; and incubating the grafting mix
and the gel material, thereby co-grafting the quality control
tracer and the primer nucleotide sequence to the gel material. In
some aspects, the quality control tracer is a cleavable nucleotide
sequence tagged, at its 3' end, with a fluorescent label or a
non-reactive nucleotide sequence with a fluorescent label attached
to a cleavable nucleobase. In some aspects, the method further
comprises detecting the grafted quality control tracer by detecting
a signal from the detectable label; and based at least in part on
the detected signal and the predetermined ratio, determining a
density, or a distribution, or the density and the distribution, of
the primer nucleotide sequence grafted to the gel material. In some
aspects, the grafted quality control tracer is detected using
fluorescence, and based at least in part on the fluorescence and
the predetermined ratio, a density, or a distribution, or the
density and the distribution, of the primer nucleotide sequence
grafted to the gel material is/are determined. In further aspects,
the support comprising the co-grafted gel material is then used in
a method of determining the density and/or distribution of a
grafted primer nucleotide sequence as described herein. In other
aspects, the method further comprises removing the detectable label
from the cleavable nucleotide sequence via enzymatic cleavage or
chemical cleavage at the cleavage site as described herein.
[0016] In another aspect, the present disclosure is directed to a
method of grafting a quality control tracer to an array, comprising
grafting a quality control tracer to a gel material in a well on a
support, wherein the quality control tracer comprises a cleavable
nucleotide sequence comprising a cleavage site and a detectable
label, wherein the cleavable nucleotide sequence comprises a
grafted region with a first end and a second end, where the first
end is grafted to the gel material and the second end is linked to
a cleavable region that is linked to the detectable label and
comprises the cleavage site. In some aspects, the quality control
tracer comprises a primer nucleotide sequence in the grafted
region, i.e., between the grafted first end of the quality control
tracer grafted region and the cleavage site. With this arrangement,
cleavage at the cleavage site leaves an unlabeled primer sequence
grafted to the gel material. In some aspects, the method further
comprises cleaving the quality control tracer at the cleavage site,
thereby providing a primer sequence that lacks the detectable label
grafted to the gel material, according to the cleavage methods
described herein.
[0017] In another aspect, the present invention is directed to a
grafting mix comprising a primer comprising a primer nucleotide
sequence and a quality control tracer, wherein the primer and the
quality control tracer are present in the mix in a predetermined
ratio.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Features and advantages of examples of the present
disclosure will become apparent by reference to the following
detailed description and drawings, in which like reference numerals
correspond to similar, though perhaps not identical, components.
For the sake of brevity, reference numerals or features having a
previously described function may or may not be described in
connection with other drawings in which they appear.
[0019] FIG. 1 is a diagrammatical representation of an example
array according to the present disclosure, illustrating the overall
layout of the array and detailing the arrangement of individual
sites;
[0020] FIGS. 2A through 2D are cross-sectional views which together
illustrate an example of a method for forming an array;
[0021] FIGS. 3A through 3D are schematic illustrations of different
examples of quality control tracers disclosed herein;
[0022] FIG. 4 depicts several examples of quality control tracers
including a linker molecule and examples of chemicals that may be
used to cleave the linker molecule;
[0023] FIG. 5 is a flow diagram depicting an example of a quality
control method;
[0024] FIGS. 6A and 6B are, respectively, a fluorescence image of a
control flow cell grafted with primers and hybridized with
complementary dye-containing oligonucleotides (TET QC) and a
fluorescence image of flow cells grafted with an example of the
quality control tracer disclosed herein;
[0025] FIG. 6C is a graph depicting quality control tracer
fluorescence versus TET fluorescence for the grafted surfaces of
FIGS. 5A and 5B;
[0026] FIGS. 7A and 7B respectively illustrate an initial
fluorescence image (before cluster generation) and a
post-clustering fluorescence image (after cluster generation) of
flow cells grafted with an example of the quality control tracer
disclosed herein;
[0027] FIGS. 8A and 8B show a plot of quality control tracer
fluorescence post-grafting and a plot of quality control tracer
fluorescence post-clustering, respectively, for the grafted flow
cells of FIGS. 7A and 7B;
[0028] FIGS. 9A and 9B show a plot of the read 1 (R1) fluorescence
intensity and a plot of the read 2 (R2) fluorescence intensities,
respectively, for the red channel after one sequencing cycle (C1)
using the grafted flow cells of FIGS. 7A and 7B;
[0029] FIGS. 10A and 10B show a plot of the read 1 (R1)
fluorescence intensity and a plot of the read 2 (R2) fluorescence
intensities, respectively, for the green channel after one
sequencing cycle (C1) using the grafted flow cells of FIGS. 7A and
7B;
[0030] FIGS. 11A and 11B show a plot of read 1 (R1) sequence
alignment and a plot of read 2 (R2) sequence alignment,
respectively, to a reference genome for the grafted flow cells of
FIGS. 7A and 7B; and
[0031] FIGS. 12A and 12B respectively show a plot of read 1 (R1)
sequencing error rates and plot of read 2 (R2) sequencing error
rates for the grafted flow cells of FIGS. 7A and 7B.
DETAILED DESCRIPTION
[0032] It is to be understood that terms used herein will take on
their ordinary meaning in the relevant art unless specified
otherwise. Several terms used herein and their meanings are set
forth below.
[0033] The singular forms "a", "an", and "the" include plural
referents unless the context clearly dictates otherwise.
[0034] As used herein, "alkyl" refers to a straight or branched
hydrocarbon chain that is fully saturated (i.e., contains no double
or triple bonds). The alkyl group may have 1 to 20 carbon atoms.
Example alkyl groups include methyl, ethyl, propyl, isopropyl,
butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an
example, the designation "C1-4 alkyl" indicates that there are one
to four carbon atoms in the alkyl chain, i.e., the alkyl chain is
selected from the group consisting of methyl, ethyl, propyl,
iso-propyl, n-butyl, isobutyl, sec-butyl, and t-butyl.
[0035] The alkyl may be substituted with a halide or halogen, which
means any one of the radio-stable atoms of column 7 of the Periodic
Table of the Elements, e.g., fluorine, chlorine, bromine, or
iodine. This group is referred to as an "alkyl halide".
[0036] As used herein, "alkenyl" or "alkene" refers to a straight
or branched hydrocarbon chain containing one or more double bonds.
The alkenyl group may have 2 to 20 carbon atoms. Example alkenyl
groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and
the like. The alkenyl group may be designated as, for example,
"C2-4 alkenyl," which indicates that there are two to four carbon
atoms in the alkenyl chain.
[0037] As used herein, "alkynyl" or "alkyne" refers to a straight
or branched hydrocarbon chain containing one or more triple bonds.
The alkyne group may have 2 to 20 carbon atoms. The alkyne group
may be designated, for example, as "C2-4 alkynyl," which indicates
that there are two to four carbon atoms in the alkyne chain.
[0038] An "amido" functional group refers to
##STR00001##
where R is any group that can attach to a fluorescent table, R' is
H, and R'' is any group that can attached to a nucleotide
sequence.
[0039] An "amino" functional group refers to an --NR.sub.aR.sub.b
group, where R.sub.a and R.sub.b are each independently selected
from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7
carbocyclyl, C6-10 aryl, 5-10 membered heteroaryl, and 5-10
membered heterocyclyl, as defined herein).
[0040] As used herein, "aryl" refers to an aromatic ring or ring
system (i.e., two or more fused rings that share two adjacent
carbon atoms) containing only carbon in the ring backbone. When the
aryl is a ring system, every ring in the system is aromatic. The
aryl group may have 6 to 18 carbon atoms, which may be designated
as C6-18. Examples of aryl groups include phenyl, naphthyl,
azulenyl, and anthracenyl.
[0041] An "azide" or "azido" functional group refers to
--N.sub.3.
[0042] As used herein, the term "attached" refers to the state of
two things being joined, fastened, adhered, connected or bound to
each other. For example, a nucleic acid can be attached to a
material, such as the gel material, by a covalent or non-covalent
bond. A covalent bond is characterized by the sharing of pairs of
electrons between atoms. A non-covalent bond is a chemical bond
that does not involve the sharing of pairs of electrons and can
include, for example, hydrogen bonds, ionic bonds, van der Waals
forces, hydrophilic interactions and hydrophobic interactions.
[0043] As used herein, "carbocyclyl" means. When the carbocyclyl is
a ring system, two or more rings may be joined together in a fused,
bridged or spiro-connected fashion. Carbocyclyls may have any
degree of saturation, provided that at least one ring in a ring
system is not aromatic. Thus, carbocyclyls include cycloalkyls,
cycloalkenyls, and cycloalkynyls. The carbocyclyl group may have 3
to 20 carbon atoms (i.e., C3-20).
[0044] As used herein, "cycloalkenyl" or "cycloalkane" means a
carbocyclyl ring or ring system having at least one double bond,
wherein no ring in the ring system is aromatic. Examples include
cyclohexenyl or cyclohexene and norbornene or norbornyl
##STR00002##
Also as used herein, "heterocycloalkenyl" or "heterocycloalkene"
means a carbocyclyl ring or ring system with at least one
heteroatom in ring backbone, having at least one double bond,
wherein no ring in the ring system is aromatic.
[0045] As used herein, "cycloalkynyl" or "cycloalkyne" means a
carbocyclyl ring or ring system having at least one triple bond
wherein no ring in the ring system is aromatic. An example is
cyclooctyne
##STR00003##
Another example is bicyclononyne (i.e., a bicyclic ring system,
such as
##STR00004##
Also as used herein, "heterocycloalkynyl" or "heterocycloalkyne"
means a carbocyclyl ring or ring system with at least one
heteroatom in ring backbone, having at least one triple bond,
wherein no ring in the ring system is aromatic.
[0046] The term "chemical cleavage," as used herein, refers to a
chemical reaction that removes the quality control tracer or a
portion thereof from a support.
[0047] As used herein, the term "cleavable nucleotide sequence"
refers to a single stranded nucleic acid sequence that can be
broken at an excision site or at a linker molecule.
[0048] The term "each," when used in reference to a collection of
items, is intended to identify an individual item in the
collection, but does not necessarily refer to every item in the
collection. Exceptions can occur if explicit disclosure or context
clearly dictates otherwise.
[0049] As used herein, the term "enzymatic cleavage" refers to a
process that utilizes an endonuclease or an exonuclease to remove
the quality control tracer or a portion thereof from the
support.
[0050] The term "excision site," as used herein, refers to a
nucleotide or a base of a nucleotide (i.e., nucleobase) that is
targeted by an enzyme. A quality control tracer or a portion
thereof can be cleaved at the excision site. Such cleavage may
involve a single enzymatic step or multiple enzymatic steps (e.g.,
base modification or excision followed by cleavage).
[0051] The term "fluorescent label," as used herein, refers to a
fluorophore that is chemically attached to a nucleotide sequence.
The fluorescent label may be attached to the 3' terminus of the
nucleotide sequence, to a cleavable nucleobase of a non-reactive
nucleotide sequence, or to a linker molecule that is attached to
the nucleotide sequence.
[0052] As used herein, the term "gel material" is intended to mean
a semi-rigid material that is permeable to liquids and gases.
Typically, the gel material is a hydrogel that can swell when
liquid is taken up and can contract when liquid is removed by
drying.
[0053] As used herein, the term "grafted" is intended to mean
covalently bound and not attached solely via non-covalent
interactions, such as hybridization. In some instances, the quality
control tracer, cleavable nucleotide sequence, non-reactive
nucleotide sequence, and/or primer or primer nucleotide sequence
are grafted to the gel material by formative of covalent bonds
between functional groups on the tracer or sequence with functional
groups in the gel material. As used herein, the term "co-graft"
refers to grafting of more than one entity.
[0054] As used herein, "heteroaryl" refers to an aromatic ring or
ring system (i.e., two or more fused rings that share two adjacent
atoms) that contain(s) one or more heteroatoms, that is, an element
other than carbon, including but not limited to, nitrogen, oxygen
and sulfur, in the ring backbone. When the heteroaryl is a ring
system, every ring in the system is aromatic. The heteroaryl group
may have 5-18 ring members.
[0055] As used herein, "heterocyclyl" means a non-aromatic cyclic
ring or ring system containing at least one heteroatom in the ring
backbone. Heterocyclyls may be joined together in a fused, bridged
or spiro-connected fashion. Heterocyclyls may have any degree of
saturation provided that at least one ring in the ring system is
not aromatic. In the ring system, the heteroatom(s) may be present
in either a non-aromatic or aromatic ring. The heterocyclyl group
may have 3 to 20 ring members (i.e., the number of atoms making up
the ring backbone, including carbon atoms and heteroatoms). The
heterocyclyl group may be designated as "3-6 membered heterocyclyl"
or similar designations. In some examples, the heteroatom(s) are O,
N, or S.
[0056] The term "hydrazine" or "hydrazinyl" as used herein refers
to a --NHNH.sub.2 group.
[0057] As used herein, the term "hydrazone" or "hydrazonyl" as used
herein refers to a group R.sub.a(R.sub.b)C.dbd.N--NH.sub.2, in
which R.sub.a and R.sub.b are previously defined herein.
[0058] As used herein, "hydroxyl" is an --OH group.
[0059] As used herein, the term "interstitial region" refers to an
area in a substrate/support or on a surface that separates other
areas of the substrate or surface. For example, an interstitial
region can separate one feature of an array from another feature of
the array. The two features that are separated from each other can
be discrete, i.e., lacking contact with each other. In another
example, an interstitial region can separate a first portion of a
feature from a second portion of a feature. In many examples, the
interstitial region is continuous whereas the features are
discrete, for example, as is the case for a plurality of wells
defined in an otherwise continuous surface. The separation provided
by an interstitial region can be partial or full separation.
Interstitial regions may have a surface material that differs from
the surface material of the features defined in the surface. For
example, features of an array can have an amount or concentration
of gel material and a quality control tracer that exceeds the
amount or concentration present at the interstitial regions. In
some examples, gel material and quality control tracer(s) may not
be present at the interstitial regions.
[0060] The term "linker molecule," as used herein, refers to a
molecule that includes, at one end, a functional group that can
attach to the detectable or fluorescent label and, at the other
end, a functional group that can attach to a nucleotide sequence.
The attachment points are covalent bonds. Similarly, the term
"linked," as used herein, refers to two entities that are connected
via one or more covalent bonds, either directly or via a linker
molecule.
[0061] "Nitrile oxide," as used herein, means a
"R.sub.aC.ident.N.sup.+O.sup.-" group in which R.sub.a is selected
from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7
carbocyclyl, C6-10 aryl, 5-10 membered heteroaryl, and 5-10
membered heterocyclyl. Examples of preparing nitrile oxide include
in situ generation from aldoximes by treatment with chloramide-T or
through action of base on imidoyl chlorides [RC(Cl).dbd.NOH].
[0062] "Nitrone," as used herein, means a
"R.sub.aR.sub.bC.dbd.NR.sub.c.sup.+O.sup.-" group in which R.sub.a
and R.sub.b are previously defined herein and R.sub.c is selected
from C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocyclyl,
C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered
heterocyclyl, as defined herein.
[0063] As used herein, a "nucleotide" includes a nitrogen
containing heterocyclic base, a sugar, and one or more phosphate
groups. Nucleotides are monomeric units of a nucleic acid sequence.
In RNA, the sugar is a ribose, and in DNA a deoxyribose, i.e. a
sugar lacking a hydroxyl group that is present at the 2' position
in ribose. The nitrogen containing heterocyclic base (i.e.,
nucleobase) can be a purine base or a pyrimidine base. Purine bases
include adenine (A) and guanine (G), and modified derivatives or
analogs thereof. Pyrimidine bases include cytosine (C), thymine
(T), and uracil (U), and modified derivatives or analogs thereof.
The C-1 atom of deoxyribose is bonded to N-1 of a pyrimidine or N-9
of a purine.
[0064] The "non-reactive nucleotide sequence" referred to herein
may be any nucleic acid sequence that does not actively participate
in a particular DNA or RNA synthesis that is being performed. In
some examples, the non-reactive nucleotide sequence may make up a
portion of a quality control tracer. For example, the non-reactive
nucleotide sequence may be a poly T sequence or a poly A sequence
that is part of a cleavable nucleotide sequence that also includes
an excision site. For another example, the non-reactive nucleotide
sequence may be orthogonal to the primer nucleotide sequence(s)
that is/are being used, and thus the non-reactive nucleotide
sequence will not participate in the DNA or RNA synthesis which
utilizes the primer nucleotide sequence(s).
[0065] As used herein, "predetermined ratio" refers to a ratio
between two compounds in a mixture. The ratio is determined before
the mixture is prepared. The ratio is the ratio of concentrations
or molarities of the components in the mixture, or is the ratio of
volumes of solutions of the two components that are blended to make
the mixture. In some aspects, the "predetermined ratio" refers to
the ratio of tracer and primer on the gel material, and in such
cases, the ratio is based on the ratio of components reacted with
the gel material and optionally takes into account any differential
reactivity of the two components. In some aspects, the
predetermined ratio for a mixture of the tracer and the primer is
set at a percent volume of the primer (or primer mixture, where
more than one primer sequence is used).
[0066] As used herein, the "primer nucleotide sequence" is defined
as a single stranded nucleic acid sequence (e.g., single strand DNA
or single strand RNA) that serves as a starting point for DNA or
RNA synthesis. The 5' terminus of the sequencing primer may be
modified to allow a coupling reaction with a gel material. The
sequencing primer length can be any number of bases long and can
include a variety of non-natural nucleotides. In an example, the
sequencing primer is a short strand, including from 20 bases to 50
bases.
[0067] The term "untagged," as used herein, means that a nucleotide
sequence does not have a fluorescent label attached thereto.
[0068] A "quality control tracer" includes a nucleotide sequence
and a fluorescent label attached to the nucleotide sequence. The
fluorescent label of the quality control tracer is capable of being
detected in a quality control method. The fluorescent label of the
quality control tracer is also capable of being removed, and the
remaining portion of the tracer is either capable of participating
in a sequencing method or is non-reactive during a sequencing
method.
[0069] As used herein, a "site" refers to a location defined on or
in a support where the gel material and a quality control tracer
may be attached.
[0070] The terms "substrate" and "support" are used interchangeably
herein, and refer to a surface in which or on which the site is
located. The support is generally rigid and is insoluble in aqueous
liquid. The support may be inert to a chemistry that is used to
modify the gel material. For example, a support can be inert to
chemistry used to attach the quality control tracer, to the gel
material in a method set forth herein. Examples of suitable
supports include glass and modified or functionalized glass,
plastics (including acrylics, polystyrene and copolymers of styrene
and other materials, polypropylene, polyethylene, polybutylene,
polyurethanes, polytetrafluoroethylene (such as TEFLON.RTM. from
Chemours), cyclic olefins/cyclo-olefin polymers (COP) (such as
ZEONOR.RTM. from Zeon), polyimides, etc.), nylon, ceramics, silica
or silica-based materials, siloxanes, silicon and modified silicon,
carbon, metals, inorganic glasses, and optical fiber bundles.
[0071] A "thiol" functional group refers to --SH
##STR00005##
[0072] As used herein, the terms "tetrazine" and "tetrazinyl" refer
to six-membered heteroaryl group comprising four nitrogen atoms.
Tetrazine can be optionally substituted.
[0073] "Tetrazole," as used herein, refer to five-membered
heterocyclic group including four nitrogen atoms. Tetrazole can be
optionally substituted.
[0074] As used herein, the term "well" refers to a discrete concave
feature in a support having a surface opening that is completely
surrounded by interstitial region(s) of the support surface. Wells
can have any of a variety of shapes at their opening in a surface
including, as examples, round, elliptical, square, polygonal, star
shaped (with any number of vertices), etc. The cross-section of a
well taken orthogonally with the surface can be curved, square,
polygonal, hyperbolic, conical, angular, etc.
[0075] In some embodiments, the cleavable nucleotide sequence is
cleavable via enzymatic cleavage or chemical cleavage.
[0076] In some instances, the cleavable nucleotide sequence
comprises a linker molecule attaching the fluorescent label,
wherein the linker molecule comprises a moiety cleavable via
enzymatic cleavage or chemical cleavage. In some embodiments, the
linker molecule comprises a vicinal diol and the chemical cleavage
is accomplished by oxidative conditions, such as, for example,
sodium periodate (NaIO.sub.4). In other embodiments, the linker
molecule is comprises a disulfide and the chemical cleavage is
accomplished with a thiol or a tertiary phosphine; or the linker
molecule is a silane and the chemical cleavage is accomplished with
an acid or a fluoride ion; or the linker molecule is an azobenzene
and the chemical cleavage is accomplished with a sodium dithionate
(Na.sub.2S.sub.2O.sub.4); or the linker molecule is a
photocleavable group and the chemical cleavage is accomplished with
light; or the linker molecule is an azido and the chemical cleavage
is accomplished with a tertiary phosphine. In another example of
the second aspect, the method further comprises cleaving the
fluorescent label from the cleavable nucleobase of the non-reactive
nucleotide sequence using an exonuclease.
[0077] In one example of this aspect, the quality control tracer
comprises the cleavable nucleotide sequence, and the cleavable
nucleotide sequence includes an excision site. In an example, the
cleavable nucleotide sequence is a primer nucleotide sequence.
[0078] In another example of this aspect, the quality control
tracer is the cleavable nucleotide sequence, and the cleavable
nucleotide sequence includes a linker molecule attaching the
fluorescent label. In some embodiments, the linker molecule
comprises a functional group selected from the group consisting of
a diol, a disulfide, a silane, an azobenzene, a photocleavable
group, and an azido. In this other example of this aspect, the
cleavable nucleotide sequence further includes a primer nucleotide
sequence attached to the linker molecule.
[0079] In still another example of this aspect, the quality control
tracer is the non-reactive nucleotide sequence, and the
non-reactive nucleotide sequence further includes an excision
site.
[0080] This aspect of the array can further comprise an untagged
primer nucleotide sequence grafted to the gel material in each of
the plurality of discrete wells, wherein the quality control tracer
and the untagged primer nucleotide sequence are present in a
predetermined ratio.
[0081] It is to be understood that any features of this aspect of
the array may be combined together in any desirable manner and/or
configuration.
[0082] In an example of the first aspect of the method, the quality
control tracer is the cleavable nucleotide sequence, and the
cleavable nucleotide sequence is the primer nucleotide sequence. In
this example, the method can further comprise cleaving the
fluorescent label from the primer nucleotide sequence after the
density, or the distribution, or the density and distribution, of
the primer nucleotide sequence is determined.
[0083] In another example of the first aspect of the method, the
quality control tracer is the cleavable nucleotide sequence; the
primer nucleotide sequence is untagged, prior to the detecting; the
method further comprises grafting the primer nucleotide sequence to
the gel material; the cleavable nucleotide sequence and the primer
nucleotide sequence are present in a predetermined ratio; and the
determining of the density, or the distribution, or the density and
distribution, of the primer nucleotide sequence is based on the
fluorescence and the predetermined ratio. This other example of the
first aspect of the method can further comprise cleaving the
fluorescent label from the cleavable nucleotide sequence. The
cleaving is accomplished via enzymatic cleavage and/or chemical
cleavage.
[0084] In still another example of the first aspect of the method,
the quality control tracer is the non-reactive nucleotide sequence;
the primer nucleotide sequence is untagged; prior to the detecting,
the method further comprises grafting the primer nucleotide
sequence to the gel material, wherein the non-reactive nucleotide
sequence and the primer nucleotide sequence are present in a
predetermined ratio; and the determining of the density, or the
distribution, or the density and distribution, of the primer
nucleotide sequence is based on the fluorescence and the
predetermined ratio. This still other example of the first aspect
of the method can further comprise cleaving the fluorescent label
from the cleavable nucleobase of the non-reactive nucleotide
sequence using an exonuclease.
[0085] It is to be understood that any features of the first aspect
of the method may be combined together in any desirable manner.
Moreover, it is to be understood that any combination of features
of the first aspect of the method and/or of the array may be used
together, and/or that any features from either or both of these
aspects may be combined with any of the examples disclosed
herein.
[0086] In one example of the second aspect, the method further
comprises cleaving the fluorescent label from the cleavable
nucleotide sequence via enzymatic cleavage or chemical cleavage. In
some instances of this one example of the second aspect, the
quality control tracer is the cleavable nucleotide sequence, the
cleavable nucleotide sequence includes a linker molecule attaching
the fluorescent label, and one of: the linker molecule comprises a
diol and the chemical cleavage is accomplished with sodium
periodate (NaIO.sub.4); or the linker molecule comprises a
disulfide and the chemical cleavage is accomplished with a thiol or
a tertiary phosphine; or the linker molecule is a silane and the
chemical cleavage is accomplished with an acid or a fluoride ion;
or the linker molecule is an azobenzene and the chemical cleavage
is accomplished with a sodium dithionate (Na.sub.2S.sub.2O.sub.4);
or the linker molecule is a photocleavable group and the chemical
cleavage is accomplished with light; or the linker molecule is an
azido and the chemical cleavage is accomplished with a tertiary
phosphine.
[0087] In another example of the second aspect, the method further
comprises cleaving the fluorescent label from the cleavable
nucleobase of the non-reactive nucleotide sequence using an
exonuclease.
[0088] It is to be understood that any features of this second
aspect of the method may be combined together in any desirable
manner. Moreover, it is to be understood that any combination of
features of the first aspect and/or second aspect may be used
together, and/or that any features from either or both of these
aspects may be combined with any of the features of the array
and/or any of the examples disclosed herein.
[0089] Examples of the arrays disclosed herein include several
sites, each of which has an example of a quality control tracer
attached to a gel material. The quality control tracer includes
either a primer nucleotide sequence or is present in a
predetermined ratio with the primer nucleotide sequence, and thus
may be used in a quality control method to determine the density
and/or distribution of the primer nucleotide sequence. The quality
control tracer includes a fluorescent label that can be used in the
quality control method and that can be cleaved from the tracer so
that it does not interfere with sequencing. The inclusion of the
quality control tracer in some instances alleviates the need to
perform hybridization and dehybridization for quality control
purposes. The examples disclosed herein enable the density and/or
distribution of primer nucleotide sequences on a support to be
assessed without having to load sequencing reagents and samples and
without having to perform initial steps in a sequencing
workflow.
[0090] The aspects and examples set forth herein and recited in the
claims can be understood in view of the above definitions.
[0091] Referring now to FIG. 1, an example of the array 10 is
depicted. In general, the array 10 includes a substrate or support
12 and lines or flow channels 14 across the support 12. Each of the
flow channels 14 includes multiple sites 16, which are separated
from one another by interstitial regions 18. At each site 16, at
least quality control tracers 22 are attached to the gel material
(24, 24', for example, in FIG. 2D). In some instances, in addition
to the quality control tracers 22, separate primer nucleotide
sequence(s) 20, 20' are also attached to the gel material 24.
[0092] The array 10 illustrated in FIG. 1 and discussed in the
present disclosure may be disposed in or formed as a part of a flow
cell, which is a chamber including a solid surface across which
various carrier fluids, reagents, and so forth may be flowed. In an
example, the flow cell may include the array 10 bonded to a top
substrate through a sealing material (e.g., black polyimide or
another suitable bonding material). The bonding takes place in
bonding regions of the support 12, the sealing material, and the
top substrate. The bonding regions may be located between the flow
channels so that the sealing material physically separates one flow
channel 14 from an adjacent flow channel 14 (to prevent
cross-contamination) and may be located at the periphery of the
flow cell (to seal the flow cell from external contamination). It
is to be understood, however, that the bonding regions and the
sealing material may be located in any desired region depending on
the implementation. Bonding may be accomplished via laser bonding,
diffusion bonding, anodic bonding, eutectic bonding, plasma
activation bonding, glass frit bonding, or others methods known in
the art.
[0093] Other examples of flow cells and related fluidic systems and
detection platforms that can be integrated with the array 10 and/or
readily used in the methods of the present disclosure are
described, for example, in Bentley et al., Nature 456:53-59 (2008),
WO 04/018497; U.S. Pat. No. 7,057,026; WO 91/06678; WO 07/123744;
U.S. Pat. No. 7,329,492; U.S. Pat. Nos. 7,211,414; 7,315,019; and
7,405,281, and U.S. Patent Publication No. 2008/0108082, each of
which is incorporated herein by reference in its entirety.
[0094] In some applications, the flow cell is used to perform
controlled chemical or biochemical reactions in a reaction
automation device, such as in a nucleotide sequencer. Ports 26 may
be drilled through the support 12. By connecting to ports 26, the
reaction automation device may control the flow of reagent(s) and
product(s) in the sealed flow channels 14. The reaction automation
device may, in some applications, adjust the pressure, temperature,
gas composition and other environmental conditions of the flow
cell. Further, in some applications, ports 26 may be drilled in the
top substrate or in both the support 12 and the top substrate. In
some applications, the reactions taking place in sealed flow
channels 14 may be monitored through the top substrate and/or the
support 12 by imaging or measurements of heat, light emission
and/or fluorescence.
[0095] It is to be understood that the particular orientation of
the flow channels 14, the sites 16, etc. may differ from those
illustrated in FIG. 1. In some examples, the sites 16 are
contiguous and thus need not be separated by interstitial regions
18.
[0096] The array 10 of FIG. 1, and examples of how the array 10 can
be made, will now be described in more detail in reference to FIGS.
2A through 2D.
[0097] FIG. 2A depicts the support 12 having sites 16 defined
therein and separated by interstitial regions 18. This support 12
has a patterned surface. A "patterned surface" refers to an
arrangement of different regions (i.e., sites 16) in or on an
exposed layer of the solid support 12. For example, one or more of
the sites 16 can be features where one or more quality control
tracers 22, and, in some instances, separate primer nucleotide
sequence(s) 22 are present. The features can be separated by the
interstitial regions 18, where quality control tracers 22 and
separate primer nucleotide sequence(s) 20 are not present. Many
different layouts of the sites 16 may be envisaged, including
regular, repeating, and non-regular patterns. In an example, the
sites 16 are disposed in a hexagonal grid for close packing and
improved density. Other layouts may include, for example,
rectilinear (i.e., rectangular) layouts, triangular layouts, and so
forth. As examples, the layout or pattern can be an x-y format of
sites 16 that are in rows and columns. In some other examples, the
layout or pattern can be a repeating arrangement of sites 16 and/or
interstitial regions 18. In still other examples, the layout or
pattern can be a random arrangement of sites 16 and/or interstitial
regions 18. The pattern may include spots, pads, wells, posts,
stripes, swirls, lines, triangles, rectangles, circles, arcs,
checks, plaids, diagonals, arrows, squares, and/or cross-hatches.
Still other examples of patterned surfaces that can be used in the
examples set forth herein are described in U.S. Pat. Nos.
8,778,849; 9,079,148; and 8,778,848, and U.S. Patent Publication
No. 2014/0243224, each of which is incorporated herein by reference
in its entirety.
[0098] The layout or pattern may be characterized with respect to
the density of the sites 16 (i.e., number of sites 16) in a defined
area. For example, the sites 16 may be present at a density of
approximately 2 million per mm.sup.2. The density may be tuned to
different densities including, for example, a density of at least
about 100 per mm.sup.2, about 1,000 per mm.sup.2, about 0.1 million
per mm.sup.2, about 1 million per mm.sup.2, about 2 million per
mm.sup.2, about 5 million per mm.sup.2, about 10 million per
mm.sup.2, about 50 million per mm.sup.2, or more. Alternatively or
additionally, the density may be tuned to be no more than about 50
million per mm.sup.2, about 10 million per mm.sup.2, about 5
million per mm.sup.2, about 2 million per mm.sup.2, about 1 million
per mm.sup.2, about 0.1 million per mm.sup.2, about 1,000 per
mm.sup.2, about 100 per mm.sup.2, or less. It is to be further
understood that the density of sites 16 on the support 12 can be
between one of the lower values and one of the upper values
selected from the ranges above. As examples, a high density array
may be characterized as having sites 16 separated by less than
about 100 nm, a medium density array may be characterized as having
sites 16 separated by about 400 nm to about 1 .mu.m, and a low
density array may be characterized as having sites 16 separated by
greater than about 1 .mu.m.
[0099] The layout or pattern may also or alternatively be
characterized in terms of the average pitch, i.e., the spacing from
the center of the site 16 to the center of an adjacent interstitial
region 18 (center-to-center spacing). The pattern can be regular
such that the coefficient of variation around the average pitch is
small, or the pattern can be non-regular in which case the
coefficient of variation can be relatively large. In either case,
the average pitch can be, for example, at least about 10 nm, about
0.1 .mu.m, about 0.5 .mu.m, about 1 .mu.m, about 5 .mu.m, about 10
.mu.m, about 100 .mu.m, or more. Alternatively or additionally, the
average pitch can be, for example, at most about 100 .mu.m, about
10 .mu.m, about 5 .mu.m, about 1 .mu.m, about 0.5 .mu.m, about 0.1
.mu.m, or less. The average pitch for a particular pattern of sites
16 can be between one of the lower values and one of the upper
values selected from the ranges above. In an example, the sites 16
have a pitch (center-to-center spacing) of about 1.5 .mu.m.
[0100] In some examples, the sites 16 are wells 16', and thus the
support 12 includes an array of wells 16' in a surface thereof. The
wells 16' (or other sites 16 with different configurations, such as
shape, cross-section, etc.) may be fabricated using a variety of
techniques, including, for example, photolithography, nanoimprint
lithography, stamping techniques, embossing techniques, molding
techniques, microetching techniques, printing techniques, etc. As
will be appreciated by those in the art, the technique used will
depend on the composition and shape of the support 12.
[0101] The wells 16' may be micro wells (having at least one
dimension on the micron scale, e.g., about 1 .mu.m to about 1000
.mu.m) or nanowells (having at least one dimension on the
nanoscale, e.g., about 1 nm to about 1000 nm). Each well 16' may be
characterized by its volume, well opening area, depth, and/or
diameter.
[0102] Each well 16' can have any volume that is capable of
confining a liquid. The minimum or maximum volume can be selected,
for example, to accommodate the throughput (e.g. multiplexity),
resolution, analyte composition, or analyte reactivity expected for
downstream uses of the array 10. For example, the volume can be at
least about 1.times.10.sup.-3 .mu.m.sup.3, about 1.times.10.sup.-2
.mu.m.sup.3, about 0.1 .mu.m.sup.3, about 1 .mu.m.sup.3, about 10
.mu.m.sup.3, about 100 .mu.m.sup.3, or more. Alternatively or
additionally, the volume can be at most about 1.times.10.sup.4
.mu.m.sup.3, about 1.times.10.sup.3 .mu.m.sup.3, about 100
.mu.m.sup.3, about 10 .mu.m.sup.3, about 1 .mu.m.sup.3, about 0.1
.mu.m.sup.3, or less. It is to be understood that the gel material
24 can fill all or part of the volume of a well 16'. The volume of
the gel material 24 in an individual well 16' can be greater than,
less than or between the values specified above.
[0103] The area occupied by each well opening on a surface can be
selected based upon similar criteria as those set forth above for
well volume. For example, the area for each well opening on a
surface can be at least about 1.times.10.sup.-3 .mu.m.sup.2, about
1.times.10.sup.-2 .mu.m.sup.2, about 0.1 .mu.m.sup.2, about 1
.mu.m.sup.2, about 10 .mu.m.sup.2, about 100 .mu.m.sup.2, or more.
Alternatively or additionally, the area can be at most about
1.times.10.sup.3 .mu.m.sup.2, about 100 .mu.m.sup.2, about 10
.mu.m.sup.2, about 1 .mu.m.sup.2, about 0.1 .mu.m.sup.2, about
1.times.10.sup.-2 .mu.m.sup.2, or less.
[0104] The depth of each well 16' can be at least about 0.1 .mu.m,
about 1 .mu.m, about 10 .mu.m, about 100 .mu.m, or more.
Alternatively or additionally, the depth can be at most about
1.times.10.sup.3 .mu.m, about 100 .mu.m, about 10 .mu.m, about 1
.mu.m, about 0.1 .mu.m, or less.
[0105] In some instances, the diameter of each well 16' can be at
least about 50 nm, about 0.1 .mu.m, about 0.5 .mu.m, about 1 .mu.m,
about 10 .mu.m, about 100 .mu.m, or more. Alternatively or
additionally, the diameter can be at most about 1.times.10.sup.3
.mu.m, about 100 .mu.m, about 10 .mu.m, about 1 .mu.m, about 0.5
.mu.m, about 0.1 .mu.m, about 50 nm, or less.
[0106] In the array 10 that is formed, the gel material 24 is
positioned in each of the discrete wells 16'. Positioning the gel
material 24 in each well 16' may be accomplished by first coating
the patterned surface of the support 12 with the gel material 24,
as shown in FIG. 2B, and then removing the gel material 24, for
example via chemical or mechanical polishing, from at least the
interstitial regions 18 on the surface of the structured support 12
between the wells 16'. These processes retain at least some of the
gel material 24 in the wells 16' but remove or inactivate at least
substantially all of the gel material 24 from the interstitial
regions 18 on the surface of the structured support 12 between the
wells 16'. As such, these processes create gel pads 24' (FIG. 2D)
used for sequencing that can be stable over sequencing runs with a
large number of cycles.
[0107] Particularly useful gel materials 24 will conform to the
shape of the site 16 where it resides. Some useful gel materials 24
can both (a) conform to the shape of the site 16 (e.g., well 16' or
other concave feature) where it resides and (b) have a volume that
does not at least substantially exceed the volume of the site 16
where it resides.
[0108] One example of a suitable gel material 24 includes a polymer
represented by Formula (I):
##STR00006##
wherein: [0109] R.sup.1 is H or optionally substituted alkyl;
[0110] R.sup.A is selected from the group consisting of azido,
optionally substituted amino, optionally substituted alkenyl,
optionally substituted hydrazone, optionally substituted hydrazine,
carboxyl, hydroxy, optionally substituted tetrazole, optionally
substituted tetrazine, nitrile oxide, nitrone, and thiol; R.sup.5
is selected from the group consisting of H and optionally
substituted alkyl; [0111] each of the --(CH.sub.2).sub.p-- can be
optionally substituted; [0112] p is an integer in the range of 1 to
50; [0113] n is an integer in the range of 1 to 50,000; and [0114]
m is an integer in the range of 1 to 100,000. In the structure of
Formula (I), one of ordinary skill in the art will understand that
the "n" and "m" subunits are recurring subunits that are present in
a random order throughout the polymer. One of ordinary skill will
also recognize that other monomeric components may be present in
the polymer.
[0115] A particular example of a gel material 24 is
poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide ("PAZAM")
(described, for example, U.S. Patent Publication Nos. 2014/0079923
A1 and 2015/0005447 A1, each of which is incorporated herein by
reference in its entirety), which comprises the structure shown
below:
##STR00007##
wherein n is an integer in the range of 1-20,000, and m is an
integer in the range of 1-100,000. As with Formula (I), one of
ordinary skill in the art will recognize that the "n" and "m"
subunits are recurring units that are present in random order
throughout the polymer structure.
[0116] The molecular weight of the PAZAM may range from about 10
kDa to about 1500 kDa, or may be, in a specific example, about 312
kDa.
[0117] In some examples, PAZAM is a linear polymer. In some other
embodiments, PAZAM is a lightly cross-linked polymer. In other
examples, PAZAM comprises branching.
[0118] Other examples of suitable gel materials 24 include those
having a colloidal structure, such as agarose; or a polymer mesh
structure, such as gelatin; or a cross-linked polymer structure,
such as polyacrylamide polymers and copolymers, silane free
acrylamide (SFA, see, for example, U.S. Patent Publication No.
2011/0059865, which is incorporated herein by reference in its
entirety), or an azidolyzed version of SFA. Examples of suitable
polyacrylamide polymers may be formed from acrylamide and an
acrylic acid or an acrylic acid containing a vinyl group as
described, for example, in WO 2000/031148 (incorporated herein by
reference in its entirety) or from monomers that form [2+2]
photo-cycloaddition reactions, for example, as described in WO
2001/001143 or WO 2003/0014392 (each of which is incorporated
herein by reference in its entirety).
[0119] The gel material 24 may be a preformed gel material.
Preformed gel materials may be coated using spin coating, or
dipping, or flow of the gel under positive or negative pressure, or
techniques set forth in U.S. Pat. No. 9,012,022, which is
incorporated herein by reference in its entirety. Dipping or dip
coating may be a selective deposition technique, depending upon the
support 12 and the gel material 24 that are used. As an example,
the patterned support 12 is dipped into a preformed gel material
24, and the gel material 24 may fill the sites 16 selectively
(i.e., the gel material 24 does not deposit on the interstitial
regions 18), and polishing (or another removal process) may not be
necessary.
[0120] Preformed PAZAM may be coated on the patterned support 12
using spin coating, or dipping, or flow of the gel under positive
or negative pressure, or techniques set forth in U.S. Pat. No.
9,012,022. The attachment of PAZAM may also take place by chemical
reaction to form a covalent bond, or via a surface initiated atom
transfer radical polymerization (SI-ATRP) to a silanized
surface.
[0121] In some examples, the support surface is treated with an
alkene-derivatized silane, wherein the alkene portion may be
linear, branched, or cyclic. In some examples, the silane reagent
is (RO).sub.3Si-Linker-Alkene, and in other examples, the silane
reagent is (RO).sub.3Si--C.sub.2-6 alkylene-cycloalkene, and in
other examples, the silane reagent is
(RO).sub.3Si--CH.sub.2CH.sub.2-norbornene, where each R is a
C.sub.1-4alkyl or is methyl or ethyl. The gel material 24, such as
PAZAM, is covalently bound to the alkene-derivatized silanes under
thermal or uv conditions.
[0122] In other examples, the support 12 surface may be pre-treated
with an amino-derivatized silane, such as an
aminopropyl-trialkoxysilane (APTS), for example
3-aminopropyl-trimethoxysilane (APTMS) or
3-aminopropyl-triethoxysilane (APTES) to covalently link silicon to
one or more oxygen atoms on the surface (without intending to be
held by mechanism, each silicon may bond to one, two or three
oxygen atoms). This chemically treated surface is baked to form an
amine group monolayer. The amine groups are then reacted with
Sulfo-HSAB to form an azido derivative. UV activation at 21.degree.
C. with 1 J/cm.sup.2 to 30 J/cm.sup.2 of energy generates an active
nitrene species, which can readily undergo a variety of insertion
reactions with the PAZAM.
[0123] Other examples for coating PAZAM on the support 12 are
described in U.S. Patent Publication No. 2014/0200158, which is
incorporated herein by reference in its entirety), and include
ultraviolet (UV) mediated linking of PAZAM monomers to an
amine-functionalized surface, or a thermal linkage reaction
involving an active group (acryloyl chloride or other alkene or
alkyne-containing molecule) with subsequent deposition of PAZAM and
application of heat.
[0124] The gel material 24 may be formed by applying a liquid that
subsequently forms the gel material 24. An example of applying
liquid that subsequently forms the gel material 24 is the coating
of an array of sites 16 with silane-free acrylamide and
N-[5-(2-bromoacetyl) aminopentyl]acrylamide (BRAPA) in liquid form
and allowing the reagents to form a gel by polymerization on the
surface. Coating of an array in this way can use chemical reagents
and procedures as set forth in U.S. Patent Publication No.
2011/0059865.
[0125] The gel material 24 may be covalently linked to the support
12 (at the sites 16) or may not be covalently linked to the support
12. The covalent linking of the polymer to the sites 16 is helpful
for maintaining the gel in the structured sites 16 throughout the
lifetime of the array 10 during a variety of uses. However, as
noted above and in many examples, the gel material 24 need not be
covalently linked to the sites 16. For example, silane free
acrylamide, SFA, is not covalently attached to any part of the
support 12.
[0126] As mentioned above, FIG. 2C illustrates the removal of the
gel material 24 from the interstitial regions 18. Removal may be
accomplished via polishing. Polishing may be a mechanical and/or
chemical treatment process.
[0127] Mechanical polishing can be carried out by applying abrasive
forces to the surface of the solid support 12 (having the gel
material 24 thereon). Example methods include abrasion with a
slurry of beads, wiping with a sheet or cloth, scraping, or the
like. It will be understood that beads used for polishing may or
may not be spherical, and can have irregular shapes, polygonal
shapes, ovoid shapes, elongated shapes, cylindrical shapes, etc.
The surface of the beads can be smooth or rough. Any of a variety
of particles can be useful as beads for polishing. One example of
polishing includes using a lintless (cleanroom grade) wipe coated
with a 3 .mu.m silica bead slurry (10% w/v in water) to remove the
gel material 24 from the interstitial regions 18. A polishing
wheel/grinder can also be used with this slurry. Mechanical
polishing can also be achieved using a fluid jet or gas (e.g., air
or inert gas such as Argon or Nitrogen) jet to remove gel from
interstitial regions 18.
[0128] Chemical polishing techniques, such as hydrolysis or
radical-based degradation of acrylamide (e.g. via exposure to
benzoyl peroxide or dilute hydrogen peroxide) may be used. During
this form of polishing, the chemicals can be provided in a solid,
liquid, gas or plasma state. Accordingly, plasma polishing can be
useful in some examples.
[0129] Polishing can also involve a combination of chemical and
mechanical polishing methods, where a chemical slurry containing a
colloidal suspension of particles is used to mechanically exfoliate
and then chemically dissolve displaced portions of gel material 24
from interstitial regions 18.
[0130] Other methods to polish or clean the interstitial regions 18
include adhesive based techniques, for example, techniques wherein
a rigid, planar adhesive film with affinity to the gel material 24
is applied, thereby making intimate contact (e.g., via chemical
linkage) with the gel material 24 in interstitial regions 18. The
mechanical removal/peeling of this adhesive film will result in the
mechanical removal of the gel material 24 from interstitial regions
18, while leaving gel material 24 in the sites 16.
[0131] In one example, thiophosphate-grafted SFA can be removed
from interstitial regions 18 on a support 12 surface as follows: a
water-dampened Whatman wipe can be dabbed into aluminum oxide
(.about.100 mg, 0.3 um) or steel beads, and then the formed slurry
can be rubbed on the surface of the support (having the
thiophosphate-grafted SFA thereon), in small concentric circles,
using even pressure, and then a clean water-wet Whatman wipe can be
used to remove the slurry and the thiophosphate-grafted SFA from
the surface.
[0132] The mechanical and chemical polishing methods exemplified
herein for removing gel material 24 from interstitial regions 18
can also be used to inactivate gel material at interstitial regions
18, whether or not the gel material 24 is removed. For example, the
gel material 24 can be inactivated with respect to the ability to
attach the quality control tracers 22 and separate primer
nucleotide sequence(s) 20, 20'.
[0133] After the gel material 24 is positioned in each well 16',
the quality control tracers 22, and, in some instances separate
primer nucleotide sequence(s) 20, 20' are grafted to the gel
material 24. The attachment technique that is used, and whether
separate, primer nucleotide sequences 20, 20' are included will
depend, in part, upon the quality control tracer 22 that is
utilized. Various examples of the quality control tracer 22 are
shown in FIGS. 3A through 3D and in FIG. 4. Each example will now
be described.
[0134] FIG. 3A depicts an example of the quality control tracer 22A
that is included on the gel material 24/gel pad 24' with separate
primer nucleotide sequence(s) 20, 20'. In this example, the quality
control tracer 22A is a cleavable nucleotide sequence 27 tagged, at
its 3' end, with a fluorescent label 28, and the primer nucleotide
sequence(s) 20, 20 are untagged primer nucleotide sequence(s).
[0135] The cleavable nucleotide sequence 27 of FIG. 3A may include
a functional group at its 5' end that is capable of attaching to
the gel material 24. Examples of this functional group include an
alkyne, a norbornyl (or other cycloalkenyls), a copper free click
moiety (e.g., dibenzocyclooctyne (DIBO), other cycloalkynes, or
others), and a thiol. This functional group may be selected based
upon the gel material 24 that is used. For example, alkynes,
norbornyls, and copper free click moieties may react with azides of
PAZAM via click reactions, and thiols may react with SFA. In some
embodiments, the functional group is an alkyne.
[0136] The cleavable nucleotide sequence 27 of FIG. 3A may also
include a functional group at its 3' end that is capable of
attaching to the fluorescent label 28. An example of this
functional group, which can be used during oligonucleotide
synthesis, is
5'-Dimethoxytrityl-5-[N-(trifluoroacetylaminohexyl)-3-acrylimido]-2'-deox-
yUridine, 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite
(i.e., amino modifier C6 dT). Other examples include
5'-Dimethoxytrityl-N-dimethylformamidine-5-[N-(trifluoroacetylaminohexyl)-
-3-acrylimido]-2'-deoxyCytidine,
3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (amino
modifier C6 dC) and the use of solid supports such as
(2-Dimethoxytrityloxymethyl-6-fluorenylmethoxycarbonylamino-hexane-1-succ-
inoyl)-long chain alkylamino-CPG. The functional group at the 3'
end may be selected based upon the fluorescent label 28 that is
used.
[0137] The detectable or fluorescent label 28 may be any suitable
fluorophore that can attach to the cleavable nucleotide sequence
27, e.g., at the 3' end (or at or near the 3' end). Examples of
suitable fluorescent labels 28 include Texas Red.RTM. (a sulfonyl
chloride dye, ThermoFisher Scientific), Cy7.RTM., Cy7.5.RTM. or
sulfo-Cyanine7 NHS ester (cyanine dyes from Lumiprobe), a red
wavelength dye, such as TEX.TM. 615 (Exiqon), fluorescent dyes,
such as those in the Alexa Fluor.RTM. series (ThermoFisher
Scientific), Atto dyes (e.g., Atto 488, the structure of which
is:
##STR00008##
the Atto-Tec series, from Atto-Tec), FAM.TM. dyes (derivatives of
fluorescein, Integrated DNA Technologies), xanthene fluorophores,
such as CAL Fluor.RTM. dyes (e.g., CAL Fluor.RTM. Gold 540, CAL
Fluor.RTM. Orange 460, CAL Fluor.RTM. Red 590, CAL Fluor.RTM. Red
610, and CAL Fluor.RTM. Red 635, from LGC Biosearch Technologies),
indocarbocyanine dyes, such as Quasar.RTM. dyes (e.g., Quasar.RTM.
570, Quasar.RTM. 670, and Quasar.RTM. 705, from LGC Biosearch
Technologies), or any other suitable fluorophore known to those of
ordinary skill in the art. Other examples include Dylight.TM. 488
(an amine reactive dye), or a fluorophore with an emission maximum
of approximately 518 nm. In some aspects, the fluorescent label is
a xanthene fluorophore. In some aspects, the xanthene fluorophore
has an emission maximum in the range of 540 to 640 nm, or 540 to
570 nm, or 580 to 640 nm. In other aspects, the xanthene
fluorophore has an emission maximum in the range of 585 to 640 nm.
In other aspects, the xanthene fluorophore emits in the red region
of the spectrum. In other aspects, the xanthene fluorophore has an
emission maximum of approximately 591 nm, or 610 nm, or 637 nm.
Other suitable detectable labels include non-fluorescent labels,
such as plasmonic nanoparticles (detected by, e.g., SPR sensing) or
quantum dots. In some aspects, the detectable label is derivatized
with an amino-reactive group such as an NHS to allow for coupling
to an oligonucleotide sequence.
[0138] The fluorescent label 28 may be attached to the cleavable
nucleotide sequence 27 using any suitable method, such as template
directed ligation, polymerase-mediated oligonucleotide elongation,
chemical synthesis, etc. The attachment of the fluorescent label 28
may take place during nucleotide synthesis (e.g., using mutant DNA
polymerases which allow for synthesis of a complementary,
fluorophore-labeled DNA or using fluorescent label-modified
monomers during solid phase oligonucleotide synthesis) or after
nucleotide synthesis (e.g., via coupling chemistry to conjugate the
label 28 onto a previously installed functional group located at
the 3' position).
[0139] This example of the cleavable nucleotide sequence 27
includes a cleavable portion 31 and a remaining portion 29. The
cleavable portion 31 includes the fluorescent label 28 (and any
functional group used to attached the fluorescent label 28), any
sequence of nucleotides, and an excision site 30. As such, the
cleavable portion 31 of the cleavable nucleotide sequence 27 can be
removed when the sequence 27 is exposed to an enzyme that targets
the nucleotide located at the excision site 30. The portion 29 of
the cleavable nucleotide sequence 27 that remains attached to the
gel material 24 after enzymatic cleavage is a non-reactive
nucleotide sequence, and thus will not participate in or interfere
with a sequencing operation that is to be performed or is being
performed. The remaining portion may be a short poly T or poly A
sequence, or may be a sequence that is orthogonal to the primer
nucleotide sequence(s) 20, 20' also attached to the gel material
24.
[0140] The quality control tracer 22A in FIG. 3A is used (e.g., in
examples of the quality control method disclosed herein) in
combination with separate primer nucleotide sequence(s) 20, 20'.
Examples of suitable primer nucleotide sequence(s) 20, 20' include
forward amplification primers or reverse amplification primers for
hybridization to a complementary sequence and amplification of a
sequence. Some specific examples of suitable primer nucleotide
sequence(s) 20, 20' include P5 and/or P7 primers. The P5 and P7
primers are used on the surface of commercial flow cells sold by
Illumina, Inc., for sequencing on HiSeq.RTM., HiSeqX.RTM.,
MiSeq.RTM., NextSeq.RTM., Genome Analyzer.RTM., and other
instrument platforms. The P5 and P7 primers, as well as other
sequencing primers 20, 20', may be modified at the 5' end with a
group that is capable of reacting with a functional group of the
gel material 24. One example of a suitable functional group is
bicyclo[6.1.0] non-4-yne (BCN), which can react with an azide of
the gel material 24. Other examples of terminated primers include a
tetrazine terminated primer, a norbornene terminated primer, an
alkyne terminated primer, an amino terminated primer, an epoxy or
glycidyl terminated primer, a thiophosphate terminated primer, and
a triazolinedione terminated primer. Examples of the P5 and P7
primers, which may be alkyne terminated, include the following:
TABLE-US-00001 P5: (SEQ. ID NO. 1)
5'-alkyne-AATGATACGGCGACCACCGAGAUCTACAC-3' P7: (SEQ. ID NO. 2)
5'-alkyne-CAAGCAGAAGACGGCATACGAG*AT-3'
and derivatives thereof. In some examples, the P7 sequence includes
a modified guanine at the G* position, e.g., an 8-oxo-guanine. In
other examples, the * indicates that the bond between the G* and
the adjacent 3' A is a phosphorothioate bond. In some examples, the
P5 and/or P7 primers include unnatural linkers.
[0141] Optionally, one or both of the P5 and P7 primers can include
a poly T tail. The poly T tail is generally located at the 5' end
of the sequence (e.g., between the 5' terminal base and the alkyne
unit), but in some cases can be located at the 3' end. The poly T
sequence can include any number of T nucleotides, for example, from
2 to 20.
[0142] While the P5 and P7 primers are given as examples, it is to
be understood that any suitable amplification primers can be used
in the examples presented herein. One of skill in the art will
understand how to design and use primer nucleotide sequence(s) 20,
20' that are suitable for capture and amplification of nucleic
acids as presented herein.
[0143] An example of a quality control tracer 22A is orthogonal to
the P5 and P7 primer nucleotide sequence(s) 20, 20'. In some
aspects, the quality control tracer includes a uracil excision
site.
[0144] In some aspects, the quality control tracer includes one of
the following sequences:
TABLE-US-00002 (1) (SEQ. ID NO. 3) 5' CATCTAGGCATCTAAGCATCAAUCTTACA
3' (2) (SEQ. ID NO. 4) 5' ACATACATACATACATACAUACATACA 3' (3) (SEQ.
ID NO. 5) 5' ATTGATTGATTGATTGATUGATTGAT 3'
where U is cleavage site. In some aspects, U is a uracil excision
site.
[0145] In some aspects, the quality control tracer comprises a
polyT sequence at the 5' end of the sequence. In some aspects, the
polyT region comprises 2 to 20, or 3, 4, 5, 6, or 7 T nucleotides.
In some aspects, the polyT region comprises 4, 5, or 6 T bases. In
other aspects, the polyT region comprises 6 T nucleotides. In some
aspects, the sequence is:
TABLE-US-00003 (1) (SEQ. ID NO. 6) 5'
polyT-CATCTAGGCATCTAAGCATCAAUCTTACA 3' or (2) (SEQ. ID NO. 7) 5'
polyT-ACATACATACATACATACAUACATACA 3' or (3) (SEQ. ID NO. 8) 5'
polyT-ATTGATTGATTGATTGATUGATTGAT 3'.
[0146] In some aspects, the quality control tracer includes Texas
Red.RTM. as the fluorescent label. In some aspects, the quality
control tracer is:
TABLE-US-00004 (SEQ. ID NO. 9)
5'-alkyne-CATCTAGGCATCTAAGCATCAAUCTTACA[Amino C6 dT-Texas Red]-3'
or (SEQ. ID NO. 10) 5'-alkyne-ACATACATACATACATACAUACATACA[Amino C6
dT-Texas Red]-3' or (SEQ. ID NO. 11)
5'-alkyne-ATTGATTGATTGATTGATUGATTGAT[Amino C6 dT-Texas Red]-3'.
In some aspects, these tracers also include a polyT region between
between the alkyne and the rest of the sequence, as described
herein.
[0147] In some aspects, the quality control tracer is:
TABLE-US-00005 (SEQ. ID NO. 12)
5'-alkyne-CATCTAGGCATCTAAGCATCAAUCTTACA[Amino C6 dT-xanthene
fluorophore]-3' or (SEQ. ID NO. 13)
5'-alkyne-ACATACATACATACATACAUACATACA[Amino C6 dT-xanthene
fluorophore]-3' or (SEQ. ID NO. 14)
5'-alkyne-ATTGATTGATTGATTGATUGATTGAT[Amino C6 dT-xanthene
fluorophore]-3'.
In some aspects, these tracers also include a polyT region at the
5' end between the alkyne and the rest of the sequence, as
described herein.
[0148] In some aspects, the quality control tracer comprises an
alkyne terminus, and in some aspects, that is a 5'-hexyne terminus.
Suitable termini are used to attach the tracer to the gel
material.
[0149] In some aspects, the quality control tracer is:
TABLE-US-00006 (SEQ. ID NO. 15)
5'-alkyne-TTTTTTACATACATACATACATACAUACATACA[Amino C6 dT-xanthene
fluorophore]-3'.
In some aspects, the alkyne is a hexyne. In some aspects, the U
cleavage site is a uracil excision site. In some aspects, the
xanthene fluorophore has an emission maximum in the range of 585 to
640 nm. In other aspects, the xanthene fluorophore emits in the red
region of the spectrum. In other aspects, the xanthene fluorophore
has an emission maximum of approximately 591 nm, or 610 nm, or 637
nm. In some aspects, the fluorophore is Texas Red.RTM..
[0150] In some aspects, where the quality control tracer comprises
both a primer sequence and the detectable label, the quality
control tracer includes one of the following sequences:
TABLE-US-00007 (SEQ. ID NO. 16) 5'-AATGATACGGCGACCACCGAGAUCTACA-3'
(SEQ. ID NO. 17) 5'-AATGATACGGCGACCACCGAGAUCACAC-3' (SEQ. ID NO. 1)
5'-AATGATACGGCGACCACCGAGAUCTACAC-3'.
In some aspects, the quality control tracer includes a polyT region
as described above. In some examples, the quality control tracer
comprises one of the following sequences:
TABLE-US-00008 (SEQ. ID NO. 18) 5'-(polyT or
TTTTTT)AATGATACGGCGACCACCGAGAUCT ACA-3' (SEQ. ID NO. 19) 5'-(polyT
or TTTTTT)AATGATACGGCGACCACCGAGAUCA CAC-3' (SEQ. ID NO. 20)
5'-(polyT or TTTTTT)AATGATACGGCGACCACCGAGAUCT ACAC-3'.
In some aspects, the quality control tracer includes a terminus
that allows for grafting to the gel material. In some examples, the
terminus is an alkyne or a hexyne moiety. Thus, in some aspects,
the quality control tracer comprises one of the following
sequences:
TABLE-US-00009 (SEQ. ID NO. 18) 5'-(alkyne)-(polyT or
TTTTTT)AATGATACGGCGACCACCGAG AUCTACA-3' (SEQ. ID NO. 19)
5'-(alkyne)-(polyT or TTTTTT)AATGATACGGCGACCACCGAG AUCACAC-3' (SEQ.
ID NO. 20) 5'-(alkyne)-(polyT or TTTTTT)AATGATACGGCGACCACCGAG
AUCTACAC-3'.
In some aspects, the quality control tracer comprises a xanthene
fluorophore as described herein, or Texas Red. In some aspects, the
quality control tracer comprises one of the following
sequences:
TABLE-US-00010 (SEQ. ID NO. 21) 5'-(alkyne)-(polyT or
TTTTTT)AATGATACGGCGACCACCGAG AUCTACA(amino C6 dT-xanthene
fluorophore)-3' (SEQ. ID NO. 22) 5'-(alkyne)-(polyT or
TTTTTT)AATGATACGGCGACCACCGAG AUC(amino C6 dT-xanthene
fluorophore)ACAC-3' (SEQ. ID NO. 23) 5'-(alkyne)-(polyT or
TTTTTT)AATGATACGGCGACCACCGAG AUCTACAC(amino C6 dT xanthene
fluorophore)-3'.
[0151] When the quality control tracer 22A in FIG. 3A is used, it
is to be understood that it is present in a predetermined ratio
with respect to the separate primer nucleotide sequence(s) 20, 20'.
The predetermined ratio can be used in an example of the quality
control method disclosed herein to indirectly determine the density
and/or distribution of the separate primer nucleotide sequence(s)
20, 20'.
[0152] To form the example shown in FIG. 3A, sequential grafting or
co-grafting may be used.
[0153] Sequential grafting may be accomplished by exposing the
support 12 (having the gel material 24 in the sites 16) to a
solution or mixture containing the quality control tracer 22A and
incubating, and then to a solution or mixture containing the primer
nucleotide sequence(s) 20, 20' and incubating. Alternatively,
sequential grafting may be accomplished by exposing the support 12
(having the gel material 24 in the sites 16) to a solution or
mixture containing the primer nucleotide sequence(s) 20, 20' and
incubating, and then to a solution or mixture containing the
quality control tracer 22A and incubating.
[0154] Co-grafting may be accomplished by exposing the support 12
(having the gel material 24 in the sites 16) to a solution or
mixture containing the quality control tracer 22A and the primer
nucleotide sequence(s) 20, 20', and then incubating. Exposure of
the support 12 to this solution or mixture may be accomplished by
depositing a mixture of the quality control tracer 22A and the
primer nucleotide sequence(s) 20, 20' onto the support 12. In an
example, the solution or mixture may be drawn across the gel
material 24 coated support 12 (shown in FIG. 2C).
[0155] In any of the grafting examples used to form the example
shown in FIG. 3A, incubation takes place at a predetermined
temperature which depends, in part, upon the quality control tracer
22A and the primer nucleotide sequence(s) 20, 20' used. As
examples, incubation may be accomplished at a temperature ranging
from about 50.degree. to about 70.degree. C.
[0156] Also in any of the grafting examples used to form the
example shown in FIG. 3A, the solution may include the quality
control tracer 22A and/or the primer nucleotide sequence(s) 20,
20', water, a buffer, and a catalyst. The quality control tracer
22A and/or the primer nucleotide sequence(s) 20, 20', whether
present in the same solution/mixture or separate
solutions/mixtures, may be present at any desired predetermined
ratio.
[0157] FIG. 3B depicts another example of the quality control
tracer 22B that is included on the gel material 24/gel pad 24' with
separate primer nucleotide sequence(s) 20, 20'. In this example,
the quality control tracer 22B is a non-reactive nucleotide
sequence 32 with the fluorescent label 28 attached to a cleavable
nucleobase, and the primer nucleotide sequence(s) 20, 20 are
untagged primer nucleotide sequence(s).
[0158] The non-reactive nucleotide sequence 32 of this example of
the quality control tracer 22B remains at least substantially
intact after the quality control method is performed and while
sequencing is performed, and thus the sequence 32 is orthogonal to
the primer nucleotide sequence(s) 20, 20' also attached to the gel
material 24.
[0159] The non-reactive nucleotide sequence 32 of FIG. 3B may
include a functional group at its 5' end that is capable of
attaching to the gel material 24. Examples of this functional group
include an alkyne, a norbornyl (or other cycloalkenyls), a copper
free click moiety (e.g., dibenzocyclooctyne (DIBO), other
cycloalkynes, or others), and a thiol. This functional group may be
selected based upon the gel material 24 that is used. For example,
alkynes, norbornyls, and copper free click moieties may react with
azides of PAZAM via click reactions, and thiols may react with
SFA.
[0160] In this example of the quality control tracer 22B, the
fluorescent label 28 is attached to a cleavable nucleobase of the
sequence 32. The nucleobase to which the fluorescent label 28 is
attached is one that can be cleaved by an exonuclease, which
catalyzes the excision of the particular base, while leaving the
phosphodiester backbone intact.
[0161] In this example, the fluorescent label 28 may be attached
near (e.g., within 10 bases of) but not directly at, the 3' end of
the sequence 32. Any of the previously described fluorescent labels
28 may be used, as long as the selected label can covalently attach
to a desirable nucleobase of the non-reactive nucleotide sequence
32.
[0162] The quality control tracer 22B in FIG. 3B is used (e.g., in
examples of the quality control method disclosed herein) in
combination with separate primer nucleotide sequence(s) 20, 20'.
Examples of suitable primer nucleotide sequence(s) 20, 20' include
forward amplification primers or reverse amplification primers for
hybridization to a complementary sequence and amplification of a
sequence. Some specific examples of suitable primer nucleotide
sequence(s) 20, 20' include the previously described P5 or P7
primers.
[0163] When the quality control tracer 22B in FIG. 3B is used, it
is to be understood that it is present in a predetermined ratio
with respect to the primer nucleotide sequence(s) 20, 20'. The
predetermined ratio can be used in an example of the quality
control method disclosed herein to indirectly determine the density
and/or distribution of the primer nucleotide sequence(s) 20,
20'.
[0164] To form the example shown in FIG. 3B, sequential grafting or
co-grafting may be used as previously described, except that the
quality control tracer 22B is used instead of the quality control
tracer 22A. In any of the grafting examples used to form the
example shown in FIG. 3B, incubation takes place at a predetermined
temperature which depends, in part, upon the quality control tracer
22B and the primer nucleotide sequence(s) 20, 20' used. Also in any
of the grafting examples used to form the example shown in FIG. 3B,
the solution may include the quality control tracer 22B and/or the
primer nucleotide sequence(s) 20, 20', water, a buffer, and a
catalyst. The quality control tracer 22B and/or the primer
nucleotide sequence(s) 20, 20', whether present in the same
solution/mixture or separate solutions/mixtures, may be present at
any desired predetermined ratio.
[0165] FIG. 3C depicts still another example of the quality control
tracer 22C that is included on the gel material 24/gel pad 24' with
separate primer nucleotide sequence(s) 20, 20'. In this example,
the quality control tracer 22C is a non-reactive nucleotide
sequence 32' with the fluorescent label 28 attached to a cleavable
nucleobase (near the 3' end) and with an excision site 30, and the
primer nucleotide sequence(s) 20, 20 are untagged primer nucleotide
sequence(s).
[0166] Since this example of the quality control tracer 22C
includes the fluorescent label 28 attached to a cleavable
nucleobase, an exonuclease may be used to remove the fluorescent
label 28 after the quality control method has been performed. In
this example, the non-reactive nucleotide sequence 32' remains at
least substantially intact after the quality control method has
been performed, and thus the non-reactive nucleotide sequence 32'
may be orthogonal to the primer nucleotide sequence(s) 20, 20' also
attached to the gel material 24.
[0167] Moreover, since this example of the quality control tracer
22C also includes the excision site 30, enzymatic cleavage may be
used to remove a cleavable portion 31' of the non-reactive sequence
32' after the quality control method has been performed. In this
example, the cleavable portion 31' includes any sequence of
oligonucleotides, the fluorescent label 28 attached to a nucleobase
along the sequence, and the excision site 30. The portion 29' of
the non-reactive nucleotide sequence 32' that remains attached to
the gel material 24 after enzymatic cleavage is also a non-reactive
nucleotide sequence, and thus will not participate in or interfere
with a sequencing operation that is to be performed or is being
performed. The remaining portion 29' may be a short poly T or poly
A sequence, or may be a sequence that is orthogonal to the primer
nucleotide sequence(s) 20, 20' also attached to the gel material
24.
[0168] The non-reactive nucleotide sequence 32' of FIG. 3C may
include a functional group at its 5' end that is capable of
attaching to the gel material 24. Examples of this functional group
include an alkyne, a norbornyl (or other cycloalkenyls), a copper
free click moiety (e.g., dibenzocyclooctyne (DIBO), other
cycloalkynes, or others), and a thiol. This functional group may be
selected based upon the gel material 24 that is used. For example,
alkynes, norbornyls, and copper free click moieties may react with
azides of PAZAM via click reactions, and thiols may react with
SFA.
[0169] In this example, the fluorescent label 28 may be attached
near (e.g., within 10 bases of) but not directly at, the 3' end of
the sequence 32'. Any of the previously described fluorescent
labels 28 may be used, as long as the selected label can covalently
attach to a desirable nucleobase of the non-reactive nucleotide
sequence 32'.
[0170] The quality control tracer 22C in FIG. 3C is used (e.g., in
examples of the quality control method disclosed herein) in
combination with separate primer nucleotide sequence(s) 20, 20'.
Examples of suitable primer nucleotide sequence(s) 20, 20' include
forward amplification primers or reverse amplification primers for
hybridization to a complementary sequence and amplification of a
sequence. Some specific examples of suitable primer nucleotide
sequence(s) 20, 20' include the previously described P5 or P7
primers.
[0171] When the quality control tracer 22C in FIG. 3C is used, it
is to be understood that it is present in a predetermined ratio
with respect to the primer nucleotide sequence(s) 20, 20'. The
predetermined ratio can be used in an example of the quality
control method disclosed herein to indirectly determine the density
and/or distribution of the primer nucleotide sequence(s) 20,
20'.
[0172] To form the example shown in FIG. 3C, sequential grafting or
co-grafting may be used as previously described, except that the
quality control tracer 22C is used instead of the quality control
tracer 22A. In any of the grafting examples used to form the
example shown in FIG. 3C, incubation takes place at a predetermined
temperature which depends, in part, upon the quality control tracer
22C and the primer nucleotide sequence(s) 20, 20' used. Also in any
of the grafting examples used to form the example shown in FIG. 3C,
the solution may include the quality control tracer 22C and/or the
primer nucleotide sequence(s) 20, 20', water, a buffer, and a
catalyst. The quality control tracer 22C and/or the primer
nucleotide sequence(s) 20, 20', whether present in the same
solution/mixture or separate solutions/mixtures, may be present at
any desired predetermined ratio.
[0173] FIG. 3D depicts an example of the quality control tracer 22D
that is included on the gel material 24/gel pad 24' without
separate primer nucleotide sequence(s) 20, 20'. In this example,
the quality control tracer 22D is a cleavable nucleotide sequence
27' tagged, at its 3' end, with the fluorescent label 28. The
fluorescent label 28 may be any of the previously described
fluorophores.
[0174] This example of the cleavable nucleotide sequence 27'
includes a cleavable portion 31'' and a remaining portion 29''. The
cleavable portion 31'' includes the fluorescent label 28, any
sequence of nucleotides, and an excision site 30 near the 3' end.
The cleavable portion 31'' may also include a functional group that
attaches the fluorescent label 28 to the sequence of nucleotides.
An example of this functional group is
5'-Dimethoxytrityl-5-[N-(trifluoroacetylaminohexyl)-3-acrylimido]-2'-deox-
yUridine, 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite
(i.e., amino modifier C6 dT). Other examples include
5'-Dimethoxytrityl-N-dimethylformamidine-5-[N-(trifluoroacetylaminohexyl)-
-3-acrylimido]-2'-deoxyCytidine,
3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (amino
modifier C6 dC) and the use of solid supports such as
(2-Dimethoxytrityloxymethyl-6-fluorenylmethoxycarbonylamino-hexane-1-succ-
inoyl)-long chain alkylamino-CPG. This functional group may be
selected based upon the fluorescent label 28 that is used. The
cleavable portion 31'' of the cleavable nucleotide sequence 27' can
be removed when the sequence 27' is exposed to an enzyme that
targets the nucleotide located at the excision site 30.
[0175] The portion 29'' of the cleavable nucleotide sequence 27'
that remains attached to the gel material 24 after enzymatic
cleavage is a primer nucleotide sequence 20, 20'. The primer
nucleotide sequence 20, 20' that remains after the cleavable
portion 31'' is removed will participate in a sequencing operation
that is to be performed or is being performed. Any example of the
primer nucleotide sequence(s) 20, 20' disclosed herein may be used
in the quality control tracer 22D.
[0176] The cleavable nucleotide sequence 27' of FIG. 3D may include
a functional group at its 5' end that is capable of attaching to
the gel material 24. Examples of this functional group include an
alkyne, a norbornyl (or other cycloalkenyls), a copper free click
moiety (e.g., dibenzocyclooctyne (DIBO), other cycloalkynes, or
others), and a thiol. This functional group may be selected based
upon the gel material 24 that is used. For example, alkynes,
norbornyls, and copper free click moieties may react with azides of
PAZAM via click reactions, and thiols may react with SFA.
[0177] An example of the P5 primer tagged, at its 3' end, with the
fluorescent label, Texas Red.RTM., is:
TABLE-US-00011 (SEQ. ID NO. 24)
5'-alkyne-AATGATACGGCGACCACCGAGAUCTACA[Amino C6 dT-Texas
Red]-3'
[0178] The quality control tracer 22D in FIG. 3D can be used in an
example of the quality control method disclosed herein to directly
determine the density and/or distribution of the primer nucleotide
sequence(s) 20, 20' that is part of the tracer 22D.
[0179] To form the example shown in FIG. 3D, grafting of one type
of quality control tracer 22D (each of which includes the same
primer nucleotide sequence(s) 20 or 20') may be used, or
co-grafting of different types of quality control tracers 22D
(e.g., some of which include the primer nucleotide sequence 20 and
others of which include a different primer nucleotide sequence 20')
may be used. Grafting or co-grafting may be performed as previously
described, except that the quality control tracer 22D is used
instead of the quality control tracer 22A.
[0180] Still other examples of the quality control tracer 22E are
shown in FIG. 4. In these examples, the quality control tracer 22E
is a cleavable nucleotide sequence tagged, at its 3' end, with the
fluorescent label 28. Each of these examples of the cleavable
nucleotide sequence includes a nucleotide sequence X, a linker
molecule 34, and the fluorescent label 28.
[0181] The nucleotide sequence X may be a non-reactive nucleotide
sequence (such as sequence 32) or a primer nucleotide sequence
(such as sequence 20 or 20'). When the nucleotide sequence X is the
non-reactive nucleotide sequence, the quality control tracer 22E
may be used in combination with separate primer nucleotide
sequence(s) 20, 20' (similar to the examples shown in FIGS. 3A
through 3C. When the nucleotide sequence X is the primer nucleotide
sequence, the quality control tracer 22E may be used alone (i.e.,
without separate primer nucleotide sequence(s) 20, 20') (similar to
the example shown in FIG. 3D).
[0182] The nucleotide sequence X of FIG. 4 may include a functional
group at its 5' end that is capable of attaching to the gel
material 24. Examples of this functional group include an alkyne, a
norbornyl (or other cycloalkenyls), a copper free click moiety
(e.g., dibenzocyclooctyne (DIBO), other cycloalkynes, or others),
and a thiol. This functional group may be selected based upon the
gel material 24 that is used. For example, alkynes, norbornyls, and
copper free click moieties may react with azides of PAZAM via click
reactions, and thiols may react with SFA.
[0183] The linker molecule 34 includes, at one end, a functional
group that can attach (directly or indirectly) to the fluorescent
label 28 and, at the other end, a functional group that can attach
(directly or indirectly) to the nucleotide sequence X (e.g., at the
3' end or at a particular nucleobase in the sequence X). The linker
molecule 34 of the quality control tracer 22E provides a chemical
linkage that can undergo a cleavage reaction that removes at least
the fluorescent label 28 from the quality control tracer 22E after
an example of the quality control method has been performed. The
cleavage reaction that is performed depends upon the linker
molecule 34 that is used. Example linker molecules 34 include a
diol, a disulfide, a silane, an azobenzene, a photocleavable group,
and an azido.
[0184] A diol is any chemical compound containing two hydroxyl
groups. Linear or cyclic diols may be used. Examples of suitable
diols are vicinal diols, where the hydroxyl groups are attached to
adjacent carbon atoms. Vicinal diols are cleavable under oxidative
conditions, such as exposure to periodate (such as sodium
periodate) or under enzymatic conditions. An example of a suitable
diol is the tartaric acid-derived diol shown as 34A in FIG. 4. In
this example, the amine groups at each end of the diol attach to
respective moieties, one of which is attached to the 3' end of
nucleotide sequence X and the other of which is attached to the
fluorescent label 28 via any suitable attachment site (e.g.,
alcohol, amine, carboxylic acid). The diol may be cleaved by
exposing the quality control tracer 22E to sodium periodate
(NaIO.sub.4) which can oxidatively cleave the diol into two
aldehydes.
[0185] A disulfide has the general structure
R.sup.1--S--S--R.sup.2, where R.sup.1 and R.sup.2 may be any of
alkyl or aryl groups. Disulfide bonds are cleaved under reducing
conditions. An example of a suitable disulfide is shown as 34B in
FIG. 4. In this example, the amine group at one end of the
disulfide is attached via a linker such as an alkyl chain to the
nucleotide sequence X at the 3' end and the amine group at the
other end of the disulfide forms an amido linkage
##STR00009##
here R is --(CH.sub.2).sub.4--O-fluorescent label 28, R' is H, and
R'' is
--(CH.sub.2).sub.2--S--S--(CH.sub.2).sub.2--(C.dbd.O)--NH--(CH.sub.2).sub-
.3--X. The fluorescent label 28 is attached via any suitable
attachment site (e.g., alcohol, amine, carboxylic acid). In an
example, the disulfide may be cleaved by exposing the quality
control tracer 22E to reducing conditions, such as a thiol
(R.sup.3SH, where R.sup.3 is may be any suitable alkyl group) or a
tertiary phosphine (R.sup.4.sub.3P, where R.sup.4 is any suitable
alkyl group). The reaction of the thiol with the disulfide will
break the disulfide bond and create a new disulfide and a thiol
derived from the original disulfide. The reaction of the tertiary
phosphine with the disulfide is a bimolecular nucleophilic
substitution (S.sub.N2) reaction that will break the disulfide bond
and create two sulfur-containing products.
[0186] A silane, as used herein and as shown at 34C in FIG. 4,
includes a silicon atom bonded to two oxygen atoms and two R groups
(e.g., each of which may be alkyl or aryl groups). In this example,
the oxygen atoms of the silane attach, respectively, to a linker
such as an alkyl chain which is attached to the nucleotide sequence
X at the 3' end and to the fluorescent label 28 via any suitable
attachment site (e.g., alcohol, amine, carboxylic acid). The silane
may be cleaved at one of the Si--O bonds by exposing the quality
control tracer 22E to an acid (shown as H.sup.+ in FIG. 4) or by
treatment with fluoride ion (not shown in FIG. 4).
[0187] An azobenzene is a chemical compound composed of two phenyl
rings linked by a N.dbd.N double bond. Different functional groups
may extend from the phenyl rings at the para positions relative to
the N.dbd.N double bond. These functional groups may be the same or
different, and examples include an amido group, an alkyl amine, or
hydroxyl groups. An example of a suitable azobenzene is shown as
34D in FIG. 4. In this example, the functional groups include an
amido group and ethylamine. The amido group is attached to a linker
such as an alkyl chain which is attached to the nucleotide sequence
X at the 3' end, and the amine group of the ethylamine forms an
amido linkage
##STR00010##
where R is --(CH.sub.2).sub.4--O-fluorescent label 28, R' is H, and
R'' is
--(CH.sub.2).sub.2-azobenzene-(C.dbd.O)--NH--(CH.sub.2).sub.3--X.
The fluorescent label 28 is attached via any suitable attachment
site (e.g. alcohol, amine, carboxylic acid). In an example, the
azobenzene may be cleaved by exposing the quality control tracer
22E to sodium dithionate (Na.sub.2S.sub.2O.sub.4). The reaction of
the sodium dithionate with the azobenzene reduces the azobenzene to
two aniline groups.
[0188] A photocleavable group is a non-nucleotide moiety that
includes a photo cleavage site, where cleavage occurs by
irradiation with a predetermined wavelength of light for a
predetermined time. The photocleavable group can be used as an
intermediary to attach any available phosphoramidite modification
at the 3' end of the nucleotide sequence X to a functional group
attached to the fluorescent label 28. An example of a suitable
photocleavable group, an ortho-nitrobenzyl group, is shown as 34E
in FIG. 4. In this example, photocleavable group includes amine
groups at either end. In this example, the amine group at one end
of the photocleavable group is attached to a linker such as an
alkyl chain which is attached to the nucleotide sequence X, and the
amine group at the other end of the disulfide forms an amido
linkage attached to the fluorescent label 28 through
--(CH.sub.2).sub.4--O--. The fluorescent label 28 is attached via
any suitable attachment site (e.g. alcohol, amine, carboxylic
acid). In an example, at least the fluorescent label 28 is cleaved
from the quality control tracer 22E at the photocleavable site by
exposing the quality control tracer 22E to light of a predetermined
wavelength for a predetermined time.
[0189] As mentioned herein, an azido is any molecule including the
group N.sub.3. An example of a suitable azido is shown as the
O-azidoalkyl group 34F in FIG. 4. In this example, the amine group
at one end of the azido is attached to a linker such as an alkyl
chain which is attached to the nucleotide sequence X at the 3' end,
and the amine group at the other end of the azido forms an amido
linkage
##STR00011##
where (in this example) R is --(CH.sub.2).sub.4--O-fluorescent
label 28, R' is H, and R'' is
--(CH.sub.2).sub.3--O--(CN.sub.3)HCH.sub.2)--(O(CH.sub.2).sub.2).sub.2--(-
CH.sub.2)--(C.dbd.O)--NH--(CH.sub.2).sub.3--X. The fluorescent
label 28 is attached via any suitable attachment site (e.g.
alcohol, amine, carboxylic acid). In an example, the azido may be
cleaved by exposing the quality control tracer 22E to a tertiary
phosphine (R.sup.6.sub.3P, where R.sup.6 is an appropriately
substituted alkyl or aryl group). The tertiary phosphine and the
azido undergo the Staudinger reduction reaction.
[0190] Each of the linker molecules 34 disclosed herein can undergo
a chemical cleavage reaction that removes at least the fluorescent
label 28 from the quality control tracer 22E after an example of
the quality control method has been performed. The remaining
portion may be a non-reactive nucleotide sequence (that will not
participate in sequencing) or a primer nucleotide sequence (that
will participate in sequencing).
[0191] When the nucleotide sequence X of the quality control tracer
22E is non-reactive, the quality control tracer 22E may be
sequentially grafted or co-grafted with separate primer nucleotide
sequence(s) 20, 20' as previously described herein. When the
nucleotide sequence X of the quality control tracer 22E is a primer
nucleotide sequence(s) 20, 20', one type of quality control tracer
22E (each of which includes the same primer nucleotide sequence(s)
20 or 20') may be grafted, or different types of quality control
tracers 22E (e.g., some of which include the primer nucleotide
sequence 20 and others of which include a different primer
nucleotide sequence 20') may be co-grafted. Grafting or co-grafting
may be performed as previously described, except that an example of
the quality control tracer 22E is used instead of the quality
control tracer 22A.
[0192] Referring back to FIG. 2D, an example of the as-grafted
quality control tracer(s) 22 with separate primer nucleotide
sequence(s) 20, 20' is depicted. In examples of the tracer 22 that
include the primer nucleotide sequence(s) 20, 20' (e.g., tracer 22D
and some examples of tracer 22E), separate primer nucleotide
sequence(s) 20, 20' will not be present with the tracer(s) 22.
[0193] The array 10 disclosed herein may be used in a quality
control method. An example of the quality control method is
depicted in FIG. 5. The method 50 generally includes grafting a
quality control tracer 22 to a gel material 24 in a well 16' on a
support 12, the quality control tracer being selected from the
group consisting of a cleavable nucleotide sequence 27, 27' tagged,
at its 3' end, with a fluorescent label 28 and a non-reactive
nucleotide sequence 32, 32' with the fluorescent label 28 attached
to a cleavable nucleobase (as shown at reference numeral 52);
detecting the quality control tracer 22 using fluorescence (as
shown at reference numeral 54); and based at least in part on the
fluorescence, determining a density, or a distribution, or the
density and the distribution, of a primer nucleotide sequence 20,
20' grafted to the gel material 24 (as shown at reference numeral
56).
[0194] The quality control method may be performed after the
quality control tracer 22, alone or in combination with separate
primer nucleotide sequence(s) 20, 20', is/are grafted to the gel
material 24 and prior to completion of flow cell manufacturing
(e.g., prior to the bonding of the array 10 to a top substrate flow
cell). The quality control method may also or alternatively be
performed by an end-user of the fully manufactured flow cell. When
the quality control method is performed by the end-user of the flow
cell, it is to be understood that the method may be performed prior
to loading any sequencing workflow reagents and DNA sample onto the
flow cell. Because each quality control tracer 22A, 22B, 22C, 22D,
22E includes the detectable fluorescent label 28, hybridization of
fluorescently-labeled complementary nucleotides does not need to be
performed as part of the quality control method disclosed
herein.
[0195] In the method 50, the grafting of the various examples of
the quality control tracer 22A, 22B, 22C, 22D, 22E may be
accomplished as previously described.
[0196] Each of the example quality control tracers 22A, 22B, 22C,
22D, 22E includes the fluorescent label 28, which will emit light
of longer wavelength(s) when exposed to incident radiation of
shorter wavelength(s). As such, detecting the quality control
tracer 22 may be accomplished by exposing the array 10 (or flow
cell including the array 10) to radiation emitted by a laser. After
laser excitation, the emitted fluorescence (in terms of intensity)
from the fluorescent label 28 of each quality control tracer 22A,
22B, 22C, 22D, 22E is captured via a suitable fluorescence
detector.
[0197] When the quality control tracer 22A, 22B, 22C, or some
examples of tracer 22E are utilized in a predetermined ratio with
separate primer nucleotide sequence(s) 20, 20', the fluorescence
intensity from these quality control tracers 22A, 22B, 22C, 22E and
the predetermined ratio may be used to assess or indirectly
determine the density and/or distribution of the primer nucleotide
sequence(s) 20, 20'. The fluorescence intensity indicates the
density and/or distribution of the quality control tracers 22A,
22B, 22C, 22E, and the predetermined ratio enables the data for the
quality control tracers 22A, 22B, 22C, 22E to be correlated to the
primer nucleotide sequence(s) 20, 20'.
[0198] When the quality control tracer 22D or other examples of
tracer 22E (which include primer nucleotide sequence(s) 20, 20')
are utilized, the fluorescence results alone may be used to assess
or directly determine the density and/or distribution of the primer
nucleotide sequence(s) 20, 20'. These examples of the quality
control tracer 22D, 22E include the sequences 20, 20' as part of
the tracer 22D, 22E, and thus the fluorescence intensity alone
indicates the density and/or distribution of the primer nucleotide
sequence(s) 20, 20'.
[0199] After completion of the quality control method (e.g., at the
end-user portion of the workflow), the fluorescent label 28 may be
cleaved from quality control tracers 22A, 22B, 22C, 22D, 22E using
the methods described herein.
[0200] As mentioned above in reference to FIG. 3A, quality control
tracer 22A includes the excision site 30. As such, cleavage of the
fluorescent label 28 in this example tracer 22A may be accomplished
via enzymatic cleavage. The quality control tracer 22A is exposed
to an enzyme that targets the nucleotide located at the excision
site 30. The enzyme may be introduced prior to initiating
sequencing, or may be introduced as part of a cluster generation
process of a sequencing workflow. Examples of suitable enzymes
include exonucleases (which remove successive nucleotides from an
end of the sequence), endonucleases (which cleave phophodiester
bonds within a sequence), base excision repair enzymes (which
remove specific bases to form an apurinic/apyrimidinic (AP) site,
which can then be cleaved by an AP endonuclease), restriction
enzymes (which scan the quality control tracer 22A for a particular
sequence of 4 to 6 nucleotides at which to cut the single-stranded
sequence), etc. Some specific examples are shown in Table 1
below.
TABLE-US-00012 TABLE 1 Enzyme QC Tracer Cleavage USER enzyme
5'-NNNNUNNNN-*-3' Before read 1 of sequencing workflow FPG
(formamido 5'-NNNN(oxo-G)NNNN-*-3' Before read 1 pyrimidine DNA or
read 2 glycosylase) of sequencing workflow
[0201] In Table 1, * represents the fluorescent label 28, N
represents nucleotides, and the excision site is in bold.
[0202] In one example in Table 1, the excision site 30 is a uracil
(dU) that is targeted by the USER enzyme. The USER enzyme is a
mixture of uracil DNA glycosylase (UDG) and the DNA
glycosylase-lyase endonuclease VIII. UDG catalyzes the excision of
the uracil base, forming an abasic (apyrimidinic) site while
leaving the phosphodiester backbone intact. The lyase activity of
endonuclease VIII breaks the phosphodiester backbone at the 3' and
5' sides of the abasic site so that base-free deoxyribose is
released. As such, cleavage of tracer 22A at excision site 30
removes a portion 31 of the sequence 27 and the fluorescent label
28 from the support 12. In the other example in Table 1, the
excision site 30 is an oxidized purine (e.g., oxoG) that is
targeted by FPG. FPG recognizes and removes the oxidized guanine.
The FPG acts as both an N-glycosylase and an AP-lyase.
[0203] The portion 29 of the quality control tracer 22A that
remains attached to the gel material 24 after enzymatic cleavage is
a non-reactive nucleotide sequence, and thus will not participate
in or interfere with a sequencing operation that is to be performed
or is being performed.
[0204] As mentioned above in reference to FIG. 3B, quality control
tracer 22B includes fluorescent label 28 attached to a cleavable
nucleobase of the sequence 32. The quality control tracer 22B is
exposed to an exonuclease that catalyzes the excision of the
particular base by phosphodiester cleavage. The exonuclease may be
introduced prior to initiating sequencing, or may be introduced as
part of a cluster generation process of a sequencing workflow. As
an example, Exonuclease I catalyzes the excision of a uracil base
having the fluorescent label 28 attached thereto.
[0205] The sequence 32 of the quality control tracer 22B that
remains attached to the gel material 24 after nucleobase cleavage
is non-reactive, and thus will not participate in or interfere with
a sequencing operation that is to be performed or is being
performed.
[0206] As mentioned above in reference to FIG. 3C, quality control
tracer 22C includes the fluorescent label 28 attached to a
cleavable nucleobase of the sequence 32' as well as the excision
site 30. As such, cleavage of the fluorescent label 28 in this
example tracer 22C may be accomplished via any of the previously
described examples of enzymatic cleavage. In one example, an
exonuclease may be used to catalyze the excision of the base having
the fluorescent label 28 attached thereto. In another example, an
enzyme that targets the nucleotide located at the excision site 30
may be used to catalyze the excision of the portion 31' of the
sequence 32'. In these examples, the enzyme may be introduced prior
to initiating sequencing, or may be introduced as part of a cluster
generation process of a sequencing workflow.
[0207] The portion 29' of the sequence 32' of the quality control
tracer 22C that remains attached to the gel material 24 after
nucleobase or portion 31' cleavage is non-reactive, and thus will
not participate in or interfere with a sequencing operation that is
to be performed or is being performed.
[0208] As mentioned above in reference to FIG. 3D, quality control
tracer 22D includes the excision site 30. As such, cleavage of the
fluorescent label 28 in this example tracer 22D may be accomplished
via any of the previously described examples of enzymatic cleavage.
In this example, the portion 29'' of the sequence 27' that remains
attached to the gel material 24 after portion 31'' cleavage is a
primer nucleotide sequence 20, 20', and thus will participate in a
sequencing operation that is to be performed or is being
performed.
[0209] As mentioned above in reference to FIG. 4, the various
examples of the quality control tracer 22E include the linker
molecule 34. Cleavage of the fluorescent label 28 in these example
tracers 22E may be accomplished via chemical cleavage by exposing
the tracer 22E to a chemical that is suitable for cleaving the
linker molecule 34 present in the tracer 22E. Various examples of
the linker molecules 34A, 34B, 34C, 34D, 34E, 34F and associated
cleavage chemicals are described in reference to FIG. 4. In these
examples, the cleavage chemical may be introduced prior to
initiating sequencing.
[0210] The portion of the quality control tracer 22E that remains
attached to the gel material 24 after chemical cleavage will depend
upon the nucleotide sequence X and where the chemical cleavage
takes place. The remaining portion may include a non-reactive
nucleotide sequence (which will not participate or interfere with
sequencing) or a primer nucleotide sequence (which will participate
in sequencing).
[0211] While not shown in the figures, another example of the
method includes incorporating an example of the quality control
tracer (e.g., 22A, 22B, 22C, and some examples of 22E) into a
grafting mix with a primer nucleotide sequence 20, 20' at a
predetermined ratio; exposing the grafting mix to a gel material 24
in a well 16' on a support 23; incubating the grafting mix, thereby
co-grafting the quality control tracer 22A, 22B, 22C, and some
examples of 22E and the primer nucleotide sequence 20, 20' to the
gel material 24; detecting the quality control tracer using
fluorescence; and based at least in part on the fluorescence and
the predetermined ratio, determining a density, or a distribution,
or the density and the distribution, of the primer nucleotide
sequence 20, 20' grafted to the gel material 24.
[0212] A variety of sequencing approaches or technologies,
including techniques often referred to as sequencing-by-synthesis
(SBS), sequencing-by-ligation, pyrosequencing, and so forth may be
performed after the fluorescent label 28 is cleaved. With any of
these techniques, since the gel material 24 and attached primer
nucleotide sequences 20, 20' are present in the sites 16 and not on
the interstitial regions 18, amplification will be confined to the
various sites 16.
[0213] Briefly, a sequencing by synthesis (SBS) reaction may be run
on a system such as the HiSeq.RTM., HiSeqX.RTM., MiSeq.RTM. or
NextSeq.RTM. sequencer systems from Illumina (San Diego, Calif.). A
set of target DNA molecules to be sequenced is hybridized to the
bound primer nucleotide sequences 20, 20' (and not to any
non-reactive nucleotide sequences) and then amplified by bridge
amplification or by kinetic exclusion amplification. Denaturation
leaves single-stranded templates anchored to the gel material 24,
and several million dense clusters of double-stranded DNA are
generated (i.e., cluster generation). The sequencing reactions are
then carried out. The data area aligned and compared to a
reference, and sequencing differences are identified.
[0214] To further illustrate the present disclosure, an example is
given herein. It is to be understood that this example is provided
for illustrative purposes and is not to be construed as limiting
the scope of the present disclosure.
Example
[0215] The following quality control tracer was used:
TABLE-US-00013 (SEQ. ID NO. 25) 5'-Hexyne-poly T
tail-CATCTAGGCATCTAAGCATCAAUCTTAC A[Amino C6 dT-Texas Red]-3'
[0216] To evaluate an example of the QC tracer for quality control
of P5/P7 primer grafting onto a substrate surface, P5/P7 primer
grafting mixes were prepared with a 10% spike of a QC tracer and
without the QC tracer spike (control). Substrate surfaces grafted
with the P5/P7 primer mix that included the 10% spike of QC tracer
were evaluated by measuring tracer fluorescence. The control
surfaces (without QC tracer spike) were evaluated by
hybridization-based TET QC. TET is a dye labeled oligonucleotide
having complementary sequence to the P5/P7 primers. TET is
hybridized to the P5/P7 primers on a surface, the excess TET is
washed away, and the attached dye concentration is measured by
fluorescence detection.
[0217] FIGS. 6A and 6B respectively show a fluorescence image of
grafted control substrate surfaces hybridized with complementary
dye-containing oligonucleotides (TET QC) and a fluorescence image
of grafted substrate surfaces that include QC tracers. FIG. 6C
shows a plot of QC tracer fluorescence versus TET fluorescence for
the grafted surfaces of FIGS. 6A and 6B. The data in FIGS. 6A-6C
show that fluorescence intensity from the QC tracer correlates with
P5/P7 density on the substrate surface.
[0218] To evaluate cleavage of grafted QC tracers from the surface
of a flow cell during a standard cluster generation process, flow
cells grafted with different QC tracers were used. FIG. 7A shows an
initial fluorescence image, which shows flow cells grafted with QC
tracers before cluster generation. FIG. 7B shows a post-clustering
fluorescence image, which shows flow cells grafted with QC tracers
after cluster generation. The QC tracers (at 200 nM) were:
TABLE-US-00014 (SEQ. ID NO. 25) 5'-Hexyne-poly T
tail-CATCTAGGCATCTAAGCATCAAUCTTAC A[Amino C6 dT-Texas Red]-3' (200
nM TRACER) (SEQ. ID NO. 26) 5'-Hexyne-poly T
tail-AATGATACGGCGACCACCGAGAUCTACA [Amino C6 dT-Texas Red]-3' (200
nM P5) and (SEQ. ID NO. 26) 5'-Hexyne-poly T
tail-AATGATACGGCGACCACCGAGAUCTACA [Amino C6 dT-Texas Red]-3' with a
corrected final P5/P7 ratio of 1:1. (200 nM Pg (1:1))
[0219] Referring to the initial fluorescence image of FIG. 7A, the
dark areas in the flow cells are the signal from the QC tracers;
lighter areas are control lanes (i.e., no QC tracers were present).
Referring to post-clustering fluorescence image of FIG. 7B, the
signal from the QC tracers is substantially reduced indicating
cleavage of the QC tracers during cluster formation.
[0220] FIGS. 8A and 8B show a plot of QC tracer fluorescence
post-grafting and a plot of QC tracer fluorescence post-clustering,
respectively, for the grafted flow cells of FIGS. 7A and 7B. The
data show that residual fluorescence after cluster formation is
minimal. The cleavage efficiency ranges from about 97% to about
99%.
[0221] To evaluate the effect of QC tracer grafting and subsequent
cleavage on downstream sequencing metrics, the flow cells of FIGS.
7A and 7B were used for sequencing.
[0222] FIGS. 9A and 9B show a plot of the read 1 (R1) fluorescence
intensity and a plot of the read 2 (R2) fluorescence intensities,
respectively, for the red channel after one sequencing cycle (C1).
The data show that the C1 intensities in the red channel are
minimally impacted by the use of QC tracers.
[0223] FIGS. 10A and 10B show a plot of the read 1 (R1)
fluorescence intensity and a plot of the read 2 (R2) fluorescence
intensities, respectively, for the green channel after one
sequencing cycle (C1). The data show that the C1 intensities in the
green channel are minimally impacted by the use of QC tracers.
[0224] FIGS. 11A and 11B show a plot of read 1 (R1) sequence
alignment and plot of read 2 (R2) sequence alignment, respectively,
to a reference genome. The data show that there is little or no
impact by the use of QC tracers on sequence alignment metrics.
[0225] FIGS. 12A and 12B show a plot of read 1 (R1) sequencing
error rates and plot of read 2 (R2) sequencing error rates,
respectively. The data show that there is little or no impact by
the use of QC tracers on sequencing error rate metrics.
ADDITIONAL NOTES
[0226] It should be appreciated that all combinations of the
foregoing concepts (provided such concepts are not mutually
inconsistent) are contemplated as being part of the inventive
subject matter disclosed herein. In particular, all combinations of
claimed subject matter appearing at the end of this disclosure are
contemplated as being part of the inventive subject matter
disclosed herein. It should also be appreciated that terminology
explicitly employed herein that also may appear in any disclosure
incorporated by reference should be accorded a meaning most
consistent with the particular concepts disclosed herein.
[0227] All publications, patents, and patent applications cited in
this Specification are hereby incorporated by reference in their
entirety.
[0228] Reference throughout the specification to "one example",
"another example", "an example", and so forth, means that a
particular element (e.g., feature, structure, and/or
characteristic) described in connection with the example is
included in at least one example described herein, and may or may
not be present in other examples. In addition, it is to be
understood that the described elements for any example may be
combined in any suitable manner in the various examples unless the
context clearly dictates otherwise.
[0229] It is to be understood that the ranges provided herein
include the stated range and any value or sub-range within the
stated range. For example, a range from about 10 kDa to about 1500
kDa, should be interpreted to include not only the explicitly
recited limits of from about 10 kDa to about 1500 kDa, but also to
include individual values, such as about 18 kDa, about 325 kDa,
about 425 kDa, about 1075.5 kDa, etc., and sub-ranges, such as from
about 425 kDa to about 990 kDa, from about 235 kDa to about 780
KDa, etc. Furthermore, when "about" and/or "substantially" are/is
utilized to describe a value, they are meant to encompass minor
variations (up to +/-10%) from the stated value.
[0230] While several examples have been described in detail, it is
to be understood that the disclosed examples may be modified.
Therefore, the foregoing description is to be considered
non-limiting.
Sequence CWU 1
1
26129DNAArtificial Sequenceprimer_bind 1aatgatacgg cgaccaccga
gauctacac 29224DNAArtificial
Sequenceprimer_bindmisc_feature(22)..(22)8-oxo-guanine 2caagcagaag
acggcatacg anat 24329DNAArtificial Sequencesynthesized 3catctaggca
tctaagcatc aaucttaca 29427DNAArtificial Sequencesynthesized
4acatacatac atacatacau acataca 27526DNAArtificial
Sequencesynthesized 5attgattgat tgattgatug attgat
26630DNAArtificial Sequencemisc_featuremisc_feature(1)..(1)poly
Thymine with a number of T bases ranging from 2-20 6ncatctaggc
atctaagcat caaucttaca 30728DNAArtificial
Sequencemisc_featuremisc_feature(1)..(1)poly Thymine with a number
of T bases ranging from 2-20 7nacatacata catacataca uacataca
28827DNAArtificial Sequencemisc_featuremisc_feature(1)..(1)poly
Thymine with a number of T bases ranging from 2-20 8nattgattga
ttgattgatu gattgat 27930DNAArtificial
Sequencemisc_featuremisc_feature(30)..(30)red fluorescent dye
attached to Adenine through Amino-modifier C6 dT linker 9catctaggca
tctaagcatc aaucttacan 301028DNAArtificial
Sequencemisc_featuremisc_feature(28)..(28)red fluorescent dye
attached to Adenine through Amino-modifier C6 dT linker
10acatacatac atacatacau acatacan 281127DNAArtificial
Sequencemisc-Featuremisc_feature(27)..(27)red fluorescent dye
attached to Thymine through Amino-modifier C6 dT linker
11attgattgat tgattgatug attgatn 271230DNAArtificial
Sequencemisc_featuremisc_feature(30)..(30)xanthene fluorophore
attached to Adenine through Amino-modifier C6 dT linker
12catctaggca tctaagcatc aaucttacan 301328DNAArtificial
Sequencemisc_featuremisc_feature(28)..(28)xanthene fluorophore
attached to Adenine through Amino-modifier C6 dT linker
13acatacatac atacatacau acatacan 281427DNAArtificial
Sequencemisc_featuremisc_feature(27)..(27)xanthene fluorophore
attached to Thymine through Amino-modifier C6 dT linker
14attgattgat tgattgatug attgatn 271534DNAArtificial
Sequencemisc_featuremisc_feature(34)..(34)xanthene fluorophore
attached to Adenine through Amino-modifier C6 dT linker
15ttttttacat acatacatac atacauacat acan 341628DNAArtificial
Sequencesynthesized 16aatgatacgg cgaccaccga gauctaca
281728DNAArtificial Sequencesynthesized 17aatgatacgg cgaccaccga
gaucacac 281834DNAArtificial Sequencesynthesized 18ttttttaatg
atacggcgac caccgagauc taca 341934DNAArtificial Sequencesynthesized
19ttttttaatg atacggcgac caccgagauc acac 342035DNAArtificial
Sequencesythesized 20ttttttaatg atacggcgac caccgagauc tacac
352135DNAArtificial
Sequencemisc_featuremisc_feature(35)..(35)xanthene fluorophore
attached to adenine through Amino-modifier C6 dT linker
21ttttttaatg atacggcgac caccgagauc tacan 352230DNAArtificial
Sequencemisc_featuremisc_feature(30)..(30)xanthene fluorophore
attached to Cytosine through Amino-modifier C6 dT linker
22ttttttaatg atacggcgac caccgagauc 302336DNAArtificial
Sequencemisc_featuremisc_feature(36)..(36)xanthene fluorophore
attached to Cytosine through Amino-modifier C6 dT linker
23ttttttaatg atacggcgac caccgagauc tacacn 362429DNAArtificial
Sequencemisc_featuremisc_feature(29)..(29)red fluorescent dye
attached to adenine through Amino-modifier C6 dT linker
24aatgatacgg cgaccaccga gauctacan 292531DNAArtificial
Sequencemisc_featuremisc_feature(1)..(1)poly Thymine with a number
of T bases ranging from 2-20misc_feature(31)..(31)red fluorescent
dye attached to adenine through Amino-modifier C6 dT linker
25ncatctaggc atctaagcat caaucttaca n 312630DNAArtificial
Sequencemisc_featuremisc_feature(1)..(1)poly Thymine with a number
of T bases ranging from 2-20misc_feature(30)..(30)red fluorescent
dye attached to adenine through Amino-modifier C6 dT linker
26naatgatacg gcgaccaccg agauctacan 30
* * * * *