U.S. patent application number 15/577242 was filed with the patent office on 2018-07-05 for double-functional oligonucleotide comprising complementary nucleotide sequence, mis-matched nucleotide sequence, reporter, and quencher, and a methods for nucleic acid amplification and measurement using the same.
The applicant listed for this patent is SD BIOSENSOR, INC.. Invention is credited to Sunyoung LEE, Hae-Joon PARK, Hyo-Jin Seong, Yoo-Deok WON.
Application Number | 20180187240 15/577242 |
Document ID | / |
Family ID | 57393387 |
Filed Date | 2018-07-05 |
United States Patent
Application |
20180187240 |
Kind Code |
A1 |
WON; Yoo-Deok ; et
al. |
July 5, 2018 |
DOUBLE-FUNCTIONAL OLIGONUCLEOTIDE COMPRISING COMPLEMENTARY
NUCLEOTIDE SEQUENCE, MIS-MATCHED NUCLEOTIDE SEQUENCE, REPORTER, AND
QUENCHER, AND A METHODS FOR NUCLEIC ACID AMPLIFICATION AND
MEASUREMENT USING THE SAME
Abstract
The present disclosure relates to a complementary
double-stranded oligo, in which, for the amplification of a
particular gene sequence, an inosine linker is linked to the
5'-terminus of a primer for the corresponding sequence, a sequence
complementary to the primer is linked to the inosine linker, and at
least one mis-matched nucleotide is included in the complementary
sequence to form a bubble structure; in which, depending on the
treatment temperature, at a predetermined temperature or lower, a
single stranded oligo is turned into a double-stranded form to
exist in an inactivation form, and at a predetermined temperature
or higher, the oligo is activated into a single-stranded oligo; and
in which, a fluorescent substance and a quenching material are
attached to the oligo, so that the oligo can be applied as a primer
or a probe, and thus only two oligos can realize the gene
amplification and fluorescent signal real-time measurement with
high specificity.
Inventors: |
WON; Yoo-Deok; (Yongin-si,
KR) ; PARK; Hae-Joon; (Seongnam-si, KR) ;
Seong; Hyo-Jin; (Yongin-si, KR) ; LEE; Sunyoung;
(Yongin-si, KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SD BIOSENSOR, INC. |
Suwon-si |
|
KR |
|
|
Family ID: |
57393387 |
Appl. No.: |
15/577242 |
Filed: |
May 25, 2016 |
PCT Filed: |
May 25, 2016 |
PCT NO: |
PCT/KR2016/005517 |
371 Date: |
March 15, 2018 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 1/68 20130101; C12Q
1/686 20130101; C12Q 1/686 20130101; C12Q 2525/101 20130101; C12Q
2525/301 20130101; C12Q 2561/113 20130101; C12Q 2565/101
20130101 |
International
Class: |
C12Q 1/686 20060101
C12Q001/686 |
Foreign Application Data
Date |
Code |
Application Number |
May 28, 2015 |
KR |
10-2015-0074972 |
Claims
1. A complementary double-stranded oligonucleotide, wherein, for
the amplification of a particular gene sequence, an inosine linker
is linked to the 5'-terminus of a primer for the corresponding
sequence, a sequence complementary to the primer is linked at the
5'-terminus of the linker, and at least one mis-matched nucleotide
is included in the complementary sequence site to form a bubble
structure; and wherein the oligonucleotide has a double-stranded
structure including a pair of a reporter dye and a quencher
molecule for detecting nucleic acid for specific gene amplification
and is denatured into a single strand at a certain temperature or
higher.
2. The oligonucleotide according to claim 1, wherein the primer
site of the corresponding sequence of a specific gene and the
complementary sequence thereof are linked to the inosine linker in
one strand of the oligonucleotide, and the complementary sequence
has two or more mis-matched nucleotide sequences.
3. The oligonucleotide according to claim 1, wherein the melting
temperature separated from the double strand to single strand is
from 40 to 65.degree. C.
4. The oligonucleotide according to claim 1, wherein the
oligonucleotide has one to four bubble structures.
5. The oligonucleotide according to claim 1, wherein the
oligonucleotide has a pair of reporter dyes and quencher molecules
in a single strand structure, and the distance between the two is
15mer or more.
6. The oligonucleotide according to claim 1, wherein the
oligonucleotide is located within 14 mer of the reporter dye and
the quencher molecule when the double strand is formed.
7. The oligonucleotide according to claim 5, wherein for the
oligonucleotide, the location of reporter dye is in the
mis-matching sequence and the sequence complementary to the
5'-terminus or in the corresponding sequence of the specific gene
from the second of the 3'-terminus.
8. The oligonucleotide according to claim 5, wherein for the
oligonucleotide, the location of quencher molecule is in the
mis-matching sequence and the sequence complementary to the
5'-terminus or in the corresponding sequence of the specific gene
from the second of the 3'-terminus.
9. The oligonucleotide according to claim 1, wherein the inosine
linker is comprised of from 0 to 9 inosine nucleotides.
10. The oligonucleotide according to claim 1, wherein the
oligonucleotide is used in a forward or reverse location for gene
amplification and a real-time PCR, respectively, or together.
11. The oligonucleotide according to claim 1, wherein the
oligonucleotide is one of SEQ ID NOs.: 2 to 13, SEQ ID NO.: 22, SEQ
ID NO.: 26, SEQ ID NO.: 29, or SEQ ID NO.: 33.
12. A method for gene amplifying a specific gene site from 50 bp to
1000 bp using the oligonucleotide of claim 1 and measuring a
fluorescence signal in real time.
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. A composition for amplification of nucleic acid and measurement
of fluorescence amount, the composition comprising the
oligonucleotide of claim 1 as an active ingredient.
18. The composition according to claim 17, wherein the composition
further includes at least one selected from the group consisting of
a DNA polymerase having 5' 3' exonuclease (+) or (-), or
3'.fwdarw.5' exonuclease (-) activity, and a Hotstart DNA
polymerase.
19. (canceled)
Description
TECHNICAL FIELD
[0001] The present disclosure relates to a use of a
double-functional oligonucleotide (hereinafter, "DFO") having both
at least two bubble structures including a mis-matched nucleotide
sequence in a complementary nucleotide sequence as an
oligonucleotide including a complementary nucleotide sequence by
linking an inosine linker at a 5'-terminus of a primer at a target
gene specific site, and the functions of a primer and a probe as an
oligonucleotide having reactivity according to the annealing
temperature of a real-time polymerase chain reaction by placing the
fluorescent substance, reporter, and extinction material, quencher,
as a pair in the nucleotide sequence complementary to the
5'-terminus of this primer, the mis-matched sequence and the
specific sequence of the target gene, and a method for nucleic acid
amplification and measurement using the same.
BACKGROUND ART
[0002] Real-time PCR is an experimental method that can amplify a
specific sequence in a DNA molecule and detect and measure the
quantity in real time. In order to measure the amplified nucleic
acid in real time, it requires buffers such as DNA polymerase,
primer sets, dNTPs, and MgCl2, etc. which are basically necessary
for polymerase chain reaction (PCR). In addition, a real-time gene
amplification device capable of monitoring a fluorescent substance
in real time and an intercalating dye such as SYBR GreenI, which is
bound to a probe or amplified nucleic acid DNA including a
fluorescent substance and a quenching material capable of
confirming nucleic acid amplification, are essential. Accordingly,
the structure and the experimental methods of the fluorescent
substance and the probe including the same for the real-time PCR
have been reported.
[0003] SYBR GreenI is a method to monitor the nucleic acid
amplification by measuring the fluorescence after an extension step
in the PCR process with a fluorescent dye that binds to
double-stranded DNA. It is possible to conduct a monitor with a
primer set that does not have a fluorescent substance attached as a
substance of the real-time PCR, but it cannot be used for a
simultaneous multiple test. Even if a dimer or a non-specific gene
is amplified, fluorescence is detected, and thus a primer having
high specificity should be used, and anti-Taq antibody should be
used to reduce non-specific products (Morrison, T. B. et al.,
BioTechniques, 1998, 24:954-962). In order to overcome the
disadvantages of such intercalating dyes, methods using a probe to
which a fluorescent substance or a quenching material is attached
are widely used.
[0004] As a method that is widely used for Real-Time PCR, there is
a Taqman assay to which a hydrolysis probe is applied. The 5'3'
exonuclease activity of Taq DNA polymerase and the fluorescence
appear when a reporter, which is a fluorescent substance, and a
quencher, which is a quenching material, are attached inside a
primer set, and the distance between the two becomes farther away.
If the distance is close, a probe that is subject to quenching is
used. As the nucleic acid amplification reaction increases during
the real-time PCR, the probe bound to a specific gene site emits
light in a reporter as the distance of a quencher becomes farther
away when a reporter dye attached to the 5'-terminus of the probe
is released by 5'3' exonuclease action due to the polymerization
reaction of Taq DNA polymerase, thereby occurring fluorescence
detection (Livak, K. J., PCR Methods and Applications, 1998,
4:357-362). As such, the fluorescence sensitivity is determined by
the distance between the reporter and the quencher and affects the
sensitivity. In addition, there is a disadvantage in that the PCR
efficiency is reduced when the length of the gene amplification
product becomes longer from 63 bp for shortest length and 400 bp
for longest length (Bustin, S. A. Journal of Molecular
Endocrinology, 2000, 25:169-193).
[0005] The hybridization probe requires two primers and two probes
for the PCR reaction. Along two probes, a probe near the
5'-terminus of the nucleic acid amplification product attaches an
acceptor dye at the 3'-terminus and a probe near the 3'-terminus
attaches a donor dye at the 5'-terminus for design. If two probes
are located side by side in a specific site of the target gene,
nucleic acid amplification monitoring can be achieved by detecting
fluorescence in acceptor dyes (Wong, M. L, BioTechniques, 2005,
39:75-85). This method requires high homology site of the target
gene for the use of two probes and has a disadvantage of high cost
due to the use of two kinds of probes.
[0006] Hairpin probes include Molecular beacon in the type of
stem-loop, Scorpion primer, Sunrise primer, and the like. Molecular
beacon has a structure of stem-loop type. The loop part includes a
complementary sequence to a specific site of the gene, and the stem
part includes a complementary sequence so that the 5'-terminus and
the 3'-terminus of the probe are bound. At each terminus,
fluorescent substances and quenching materials are attached (Tyagi,
S. and Kramer, R., Nature Biotechnology, 1996, 14:303-308). In the
molecular beacon, the loop part is bound to a specific site of the
gene, and the stem part is separated by the conformation
transition, so that the distance between the fluorescent substance
and the quenching material becomes distant and light emission
occurs. In this process, if the stem part is designed too robust,
the stem part will not be separated and no light emission will
appear (Bustin, S. A. Journal of Molecular Endocrinology, 2000,
25:169-193). Scorpion primer has the function of a primer and a
probe. When the complementary part of scorpion primer binds to a
specific site of the gene and is subjected to an extension reaction
and then single stranded by denaturation, the specific sequence of
the target gene of the Scorpion primer binds to the extended
sequence, and the distance between the fluorescent substance and
the quenching material becomes distant and light emission appears.
In the Taqman assay, a Scorpion primer is designed so that a primer
would have a probe function without adding probes individually, and
a complementary part and a specific sequence of the target gene are
included so that specificity is high (Whitcombe, D., et. al.,
Nature Biotechnology, 1999, 17:804-807). As such, three parts of a
specific sequence of the target gene are required, so that it is
difficult to design a target gene having a low homology. The
Sunrise primer is similar to the Scorpion primer and forms a
hairpin loop at the 5'-terminus and has a sequence complementary to
a specific sequence of the target gene at the 3'-terminus.
[0007] As the PCR process proceeds, the hairpin loop structure is
elongated as it is extended by the opposite primer and light
emission is performed (Wong, M. L., BioTechniques, 2005, 39:75-85).
If the scorpion primer and the sunrise primer forming the hairpin
loop at the 5'end as above are not denatured into a single strand
by the temperature of the annealing and elongating stages, there is
a problem that the fluorescence signal is not generated.
Accordingly, the design for the hairpin loop is difficult and
complicated so that the sequence site with a low homology has a
restriction on the selection of a primer location according to the
target gene sequence of many sites used to increase the
specificity.
[0008] As a limiting condition for real-time PCR, intercalating
dyes are detectable even when non-specific amplification occurs,
and hydrolysis probes are limited in amplification size of target
gene. In addition, there are disadvantages in that the design for a
primer or a probe for detection of fluorescent dyes such as a
hybridization probe, a hairpin probe, and the like is complicated
and difficult.
Prior Patent Document
[0009] Korean Patent Laid-Open Publication No. 2003-0055343
DISCLOSURE
Technical Problem
[0010] The present disclosure has been designed to solve the above
problems and invented in view of the above needs. It is an object
of the present disclosure to provide an oligonucleotide, in which a
complementary sequence of a primer to a target gene at the
5'-terminus links through a linker, a mis-matching sequence exists
in a complementary sequence, and an annealing temperature can be
controlled according to the number of sequences; in which the
single strand oligonucleotide exists in an inactivation form in a
double strand form at a predetermined temperature or lower,
according to the processing temperature of an annealing and an
extension, and in which a fluorescent substance (reporter dye) and
a quenching material (quencher molecule) are attached to the
oligonucleotide activated with a single strand oligonucleotide at a
predetermined temperature or higher, so that the oligonucleotide
can be applied as a primer or a probe, and thus two
oligonucleotides can realize the gene amplification and fluorescent
signal real-time measurement with high specificity because it can
be designed only with the sequence for two locations of the target
gene of forward and reverse primers and exist in an activated or
inactivated state according to a specific temperature.
[0011] It is another object of the present disclosure to provide a
method for real-time measurement of oligonucleotide and
fluorescence signal in which the amplification size of a specific
gene can be amplified and detected from 50 bp to 1000 bp
simultaneously.
Technical Solution
[0012] In order to achieve the above object, the present disclosure
provides a complementary double-stranded oligonucleotide, in which,
for the amplification of a particular gene sequence, an inosine
linker is linked to the 5'-terminus of a primer for the
corresponding sequence, a sequence complementary to the primer is
linked, and at least one mis-matched nucleotide is included in this
site to form a bubble structure; and in which the oligonucleotide
has a double-stranded structure including a pair of a reporter dye
and a quencher molecule for detecting nucleic acid for specific
gene amplification and is denatured into a single strand at a
predetermined temperature or higher.
[0013] In the oligonucleotide of the present invention,
oligonucleotides having a double-stranded structure at a specific
temperature or below are preferable because a single-stranded
oligonucleotide connects the primer site of the corresponding
sequence of the specific gene and the complementary sequence
thereof to the inosine linker, and oligonucleotides having a
single-stranded structure are preferable at a specific temperature
or higher, but not limited thereto.
[0014] In the oligonucleotides of the present invention, the
mis-matching base sequence may be any one of adenine, guanine,
cytosine, thymine, and uridine, and the number of nucleotides may
be two or more, forming a bubble structure. It is preferable to be
located in a complementary sequence of the primer to the sequence
of the target gene.
[0015] It is preferable that the oligonucleotide of the present
disclosure has two or more bubble structures in a linker site and a
mis-matching site by linking a sequence complementary to the
sequence of a target gene with a linker.
[0016] In an embodiment of the present invention, the inosine
linker is preferably composed of 0 to 9 nucleotides, but is not
limited thereto.
[0017] The oligonucleotide of the present disclosure attaches a
reporter dye or a quencher molecule to the 5'-terminus and attaches
a reporter dye or a quencher molecule from the 3'-terminus to the
5'-terminus direction at the 2nd location so that the distance
between the reporter dye and the quencher molecule in a
single-stranded structure is 15 mer or farther. In the
double-stranded structure, the distance between the reporter dye
and the quencher molecule is preferably within 14 mer, but is not
limited thereto.
[0018] It is preferable to use oligonucleotides of the present
disclosure and conventional primers as a set or a pair of
oligonucleotides of the present disclosure as a set, and there is
provided the use of DNA polymerase having 5'.fwdarw.3' exonuclease
activity (+) or 5'.fwdarw.3' exonuclease inactivity (-). And there
is provided a composition for real-time PCR using dNTPs, a buffer
solution for reaction, and a set of the oligonucleotides.
[0019] As the buffer solution for reaction, a conventional PCR or
real-time PCR buffer solution including Tris-HCl, KCl, (NH4) 2SO4,
MgCl2, MgSO4 and the like can be suitably modified and used. The
dNTPs include dATP, dTTP, dUTP, dGTP, and dCTP, and compositions
including thio-dNTP, borano-dNTP, and methyl-dNTP can be used. The
oligonucleotide can be used in a concentration ranging from 0.1 to
1 .mu.M, and a suitable concentration for use can be easily
determined by those skilled in the art.
[0020] There is provided a method of designing oligonucleotides of
a target sequence amplification size of 50 to 1000 bp using the
oligonucleotides of the present invention, in which amplification
and real-time detection of the amplification sizes can be
performed, so that the oligonucleotides are not limited to specific
sizes but can be designed for candidate oligonucleotides of various
sizes by selecting the sites where oligonucleotides can be
designed. Since the oligonucleotide has a dual function of a primer
and a probe, it provides an oligonucleotide and a design method
which can confirm real-time amplification by attaching a reporter
dye and a quencher molecule only to the target gene amplification
site of two sites.
[0021] The oligonucleotides of the present disclosure can be used
in forward or reverse locations, respectively, and provide a usable
diversity in both locations.
[0022] The oligonucleotides of the present disclosure provide
methods that can be analyzed individually or simultaneously by
differently attaching reporter dyes to Fam, Texas Red, Cy5, Hex,
Rox, Joe, Tamra, and Tet, etc. according to the target gene.
[0023] There are provided methods for the processes of the
real-time PCR reactions using the oligonucleotides of the present
disclosure and methods for the measurement.
[0024] The method is performed by repeating the denaturation,
annealing, and extension steps. In addition, the fluorescence
sequencing step is performed after the annealing and elongating
steps, and then the fluorescence is measured to confirm the
detection status of a specific gene in real time. Preferably, the
fluorescent arraying step is performed at a temperature of 25 to
45.degree. C. and the time is 1 second to 30 seconds, but is not
limited thereto.
[0025] The present disclosure also provides a kit for individually
or multi-simultaneously amplifying a specific gene for DNA and RNA
of an infectious disease, hereditary disease, drug resistance,
medication-refractory or susceptible specimen, in which the kit
includes the oligonucleotide of the present disclosure as an active
ingredient.
Effect
[0026] As described above, the oligonucleotide has two or more
bubble structures including a mis-matched nucleotide sequence in
the complementary base sequence as an oligonucleotide including a
complementary base sequence by linking an Inosine linker at the 5'
location. A pair of a reporter, which is a fluorescent substance,
and a quencher, which is a quenching material, is placed in a base
sequence complementary to the 5'-terminus of the primer, a
mis-matched sequence, and a specific sequence of a target gene. It
is possible to have a specificity equal to or higher than that of
the Taqman system using three oligonucleotides only with two
oligonucleotides by means of a method using a bi-functional
oligonucleotide having both a primer and a probe function as an
oligonucleotide having reactivity according to the annealing
temperature of real-time PCR. It is possible to detect large-sized
products up to 1000 bp in real time. This effect can be exerted on
DNA polymerases with 5'3' exonuclease activity (+) or 5'3'
exonuclease inactivity (-).
DESCRIPTION OF DRAWINGS
[0027] FIG. 1 is a sequential illustration of the oligonucleotide
(DFO) structure of the present disclosure and a method for
performing a real-time PCR using the same.
[0028] FIG. 2 illustrates a result of fluorescence measurement in
which the reporter dye and the quaternary molecule in the
double-stranded structure of the oligonucleotide (DFO) of the
present disclosure are denatured to single strand at 65, 55 and
45.degree. C. according to the number of mer (distance).
[0029] FIG. 3 illustrates a result of a real-time PCR by attaching
a quencher molecule to the ninth base in the 5'-terminus direction
from the 3'-terminus and the 3'-terminus of the oligonucleotide
(DFO) of the present invention.
[0030] FIG. 4 illustrates a result of a real-time PCR by attaching
a quencher molecule to the second and fourth bases from the
3'-terminus to the 5'-terminus direction of the oligonucleotide
(DFO) of the present invention.
[0031] FIG. 5 illustrates a result of a real-time PCR according to
the number of mis-matching sequences (4, 6, 9) located at the
bubble site of the oligonucleotide (DFO) of the present
invention.
[0032] FIG. 6 illustrates a result of real-time PCR using the
oligonucleotide (DFO) of the present disclosure according to the
cycle time.
[0033] FIG. 7 illustrates a result of a method adding fluorescence
measurement time (scanning time) for 5 and 10 seconds as a method
of adding a denaturation process, which is a cycle condition to a
real-time PCR using the oligonucleotide (DFO) of the present
disclosure and adding a fluorescence measurement process to
annealing and extension processes.
[0034] FIG. 8 relates to a result of real-time PCR at temperatures
of 65, 55 and 45.degree. C. for annealing and extension processes
using the oligonucleotides (DFO) of the present invention.
[0035] FIG. 9 illustrates a result of real-time PCR using the
oligonucleotide (DFO) of the present disclosure according to a
cycle condition including a fluorescence measurement process and a
cycle condition not including the fluorescence measurement
process.
[0036] FIG. 10 illustrates a result of real-time PCR using DNA
polymerases with 5'.fwdarw.3' exonuclease activity (+) or
5'.fwdarw.3' exonuclease inactivity (-) using the oligonucleotides
(DFO) of the present invention, respectively.
[0037] FIG. 11 illustrates a result of real-time PCR which applies
the method of the present disclosure using the oligonucleotides
(DFO) of the present disclosure and conventional primers with the
size of the amplification products for real-time PCR of 50, 216,
300, 450, 800 and 1000 bp.
[0038] FIG. 12 illustrates a result of a reaction using the
oligonucleotide (DFO) of the present disclosure as a forward or
reverse one and a real-time PCR using both of two oligonucleotides
(DFO) as an oligonucleotide (DFO) of the present invention.
[0039] FIGS. 13 and 14 illustrate a result of a multiplex real-time
PCR in which is simultaneously detected each target in a multiple
manner compared with TaqMan system by attaching human beta-actin
with Fam, HIV tat with Hex, and M13 with CY5, respectively in the
oligonucleotide (DFO) of the present invention.
BEST MODE
[0040] Hereinafter, the present disclosure will be described in
detail with reference to examples. However, the following examples
are for illustrative purposes only and are not intended to limit
the scope of the present invention.
Example 1: Analysis of the Light Emission Effect of the
Oligonucleotide (DFO) of the Present Disclosure According to the
Distance Between the Reporter Dye and the Quencher Molecule
[0041] The oligonucleotides of the present disclosure place a
complementary sequence at the 5'-terminus using a forward primer
for a HIV tat gene and a human beta-actin gene and a reverse primer
for a Rat GAPD gene of the prior method (Alexandre, V., et al.,
Nucleic Acid Research, 2008, 36:20, Ailenberg, M. and Silverman,
M., BioTechniques, 2000, 29: 1018-1024) as a specific sequence of a
target gene, and includes a mis-matched sequence in a complementary
sequence.
[0042] In order to analyze the difference of the relative
fluorescence unit (RFU) value between the reporter dye of DFO
oligonucleotide and the quencher molecule, a reporter dye Fam was
attached to the 5'-terminus. Based on this, the oligonucleotide was
designed for SEQ ID NO.: 2 (Fam01) located at the 3'-terminus of
the double-stranded DFO oligonucleotide in terms of a quencher
molecule location and SEQ ID NO.: 7 (Fam02) located at the 2mer at
the 3'-terminus, SEQ ID NO.: 8 (Fam04) located at the 4mer at the
3'-terminus, SEQ ID NO.: 11 (Fam05) located at the 5mer at the
3'-terminus, SEQ ID NO.: 9 (Fam07) located at the 7mer at the
3'-terminus, SEQ ID NO.: 10 (Fam08) located at the 8mer at the
3'-terminus, SEQ ID NO.: 3 (Fam09) located at the 9mer at the
3'-terminus, SEQ ID NO.: 4 (Fam15) located at the 15mer at the
3'-terminus, SEQ ID NO.: 5 (Fam17) located at the 17mer at the
3'-terminus, and SEQ ID NO.: 6 (Fam21) located at the 21mer at the
3'-terminus. As a control group, SEQ ID NO.: 1 (Control) was used
for a TaqMan method.
[0043] The DFO of the present disclosure was subjected to
denaturation with a double strand oligonucleotide to a single
strand oligonucleotide to confirm the RFU value between the
reporter dye and the quencher molecule distance. The DFO
oligonucleotide was prepared in a reaction mixture of 0.5 .mu.M,
0.2 mM dNTPs, 1.5 mM MgCl2 and the fluorescence was measured at
95.degree. C. for 30 seconds, 65.degree. C., 45.degree. C., or
25.degree. C. for 30 seconds. This was repeated 10 cycles.
[0044] As a result, as illustrated in FIG. 2, the RFU value was
found to be 53,000 to 65,000 as a whole as a result of measuring
fluorescence after 65.degree. C., and after 55.degree. C., the RFU
value decreased to 10,000 to 30,000, except Fam 15, Fam 17, Fam 21.
At 25.degree. C., the RFU value decreased to 10,000 to 20,000.
Accordingly, at a temperature of around 65.degree. C., the DFO
oligonucleotides emit fluorescence in the form of a single strand
as the distance between a reporter dye and a quencher molecule
became farther away. As the temperature was lowered to 45.degree.
C. and 25.degree. C., it was deformed in the form of a double stand
so that the distance between a reporter dye and a quencher molecule
became closer, and thus the amount of light emission decreased. In
the case of Fam 15, Fam 17, and Fam 21, the distance between a
reporter dye and a quencher became farther away even when it was
deformed in a double strand, and thus the reporter dye continued to
emit light.
Example 2: Analysis of a Real-Time PCR Effect According to the
Location of a Quencher Molecule Near 3'-Terminus of DFO of the
Present Invention
[0045] In order to verify whether a real-time PCR was performed as
the reporter dye or the quaternary molecule near the 3'-terminus of
the DFO of the present disclosure is located, a reporter dye was
attached to the 5'-terminus and a quencher molecule is located at
the 3'-terminus. SEQ ID NO.: 2 and "T," which is the 2nd base of
the 3'-terminus, were changed to innerdT in order to design SEQ ID
NO.: 7 to which BHQ1 was attached, "T," which is the 4th base of
the 3'-terminus, was changed to innerdT in order to design SEQ ID
NO.: 8 to which BHQ 1, which is a quencher molecule, was attached,
and "T," which is the 9th base of the 3'-terminus, was changed to
innerdT in order to design SEQ ID NO.: 3 to which BHQ 1, which is a
quencher molecule, was attached.
[0046] In order to confirm the real-time PCR for the DFO
oligonucleotide, the DFO oligonucleotide of SEQ ID NO.: 2 or SEQ ID
NO.: 3 was used as a forward primer of the HIV tat gene. SEQ ID
NO.: 23 was used as a reverse primer. For the Rat GAPD gene, the
forward primer used SEQ ID NO.: 24 and the reverse primer used the
DFO oligonucleotide SEQ ID NO.: 7 and SEQ ID NO.: 8. Each
oligonucleotide set was added to 0.5 .mu.M real-time PCR, and
reaction mixtures of 0.2 mM dNTPs, 1.times. reaction buffer, and
0.5 U Taq DNA polymerase were prepared. Real-time PCR of the HIV
tat gene was carried out by using HIV-1 isolate 10BR_PE064 (GI:
672918720, 5281-5700 bp) to prepare HIV tat plasmid DNA through
gene synthesis. Each 5 .mu.l of 6.9, 0.6 ng/.mu.l, 69, 6.9, 0.69
fg/.mu.l of them was added to reaction mixtures to perform 40
cycles at 95.degree. C. for 5 minutes (95.degree. C. for 30
seconds, 55.degree. C. for 30 seconds). As for the Rat GAPD gene,
each 5 .mu.l of 2, 02., 0.02 ng/.mu.l of Rat genomic DNA (Clontech,
Cat. No. 636404) was added to reaction mixtures to perform 40
cycles at 95.degree. C. for 5 minutes (95.degree. C. for 30
seconds, 60.degree. C. for 30 seconds).
[0047] FIG. 3 confirms that an RFU signal for the real-time PCR
using SEQ ID NO.: 2 to which a quencher molecule was attached to
the DFO 3'-terminus of the oligonucleotide set for detecting HIV
tat gene and the 9th base of the 3'-terminus rises to the same
oblique line without regard to a template concentration. As for SEQ
ID NO.: 3, it was confirmed that Ct appears late as DFO decreases
in template concentration. As for the RFU signal, delta Rn exhibits
SEQ ID NO.: 3 of 8,000 RFU higher than that of SEQ ID NO.: 2.
[0048] FIG. 4 illustrates a result of real-time PCR using SEQ ID
NO.: 7 or SEQ ID NO.: 8 in which a quencher molecule was attached
to the 2nd and 4th bases of DFO 3'-terminus of the oligonucleotide
set for detecting Rat GAPD gene. It was detected that the delta Rn
of the RFU signal was 12,500 and 10,000, respectively. A similar Ct
was confirmed per concentration such that the DFO for the 2nd and
4th 3'-terminus of the quencher molecule was 22.43 Ct and 22.68 Ct
at 10 ng/rxn, 26.22 Ct and 26.46 at 1 ng/rxn, and 29.73 Ct and
30.08 Ct at 0.1 ng/rxn, respectively.
[0049] As a result of FIGS. 3 and 4, when a quencher molecule or a
reporter dye is attached to the 3'-terminus of the DFO
oligonucleotide, fluorescence signal detection of the real-time PCR
is inadequate. From the 2nd base at the 3'-terminus at minimum, the
suitability for the real-time PCR was confirmed.
Example 3: Real-Time PCR Reaction Effect According to
Single-Stranded Annealing Temperature According to Mis-Matching
Sequence Number of DFO of the Present Invention
[0050] The DFO of the present disclosure is formed as a double
strand when the temperature is lower than a certain temperature in
a single strand, which is controlled by mis-matching sequence
number. The forward primer of the set of oligonucleotides for
detecting the beta-actin gene in human mRNA includes 4, 6, and 9
mis-matching sequence numbers, and at a temperature of around
65.degree. C., 55.degree. C. and 45.degree. C., the DFO of SEQ ID
NOs.: 12, 11 and 13 was designed so that a double strand is
annealed to a single strand.
[0051] In human total RNA (stratagene, Cat. No. 750500), as for the
cDNA synthesis for detecting beta-actin gene, 5 .mu.l human total
RNA (100 ng/.mu.l) was added to the reaction mixture of 200 U MMLV
Rtase, 1 .mu.M of SEQ ID NO.: 14 primer, 1.times. reaction buffer
and 1 mM dNTPs for detection of beta-actin gene and reacted at
37.degree. C. for 60 minutes and at 95.degree. C. for 5
minutes.
[0052] In order to have a Taqman system as a control group to
confirm the reaction effect according to an annealing temperature
from a double strand to a single strand at the cycle temperature of
the real-time PCR using the DFO, SEQ ID NO.: 21 was used as a
forward primer, SEQ ID NO.: 14 was used as a reverse primer, and
SEQ ID NO.: 25 was used as a taqman probe. As a test group, SEQ ID
NO.: 14 was used as a reverse primer and DFO of SEQ ID NO.: 12, SEQ
ID NO.: 11 and SEQ ID NO.: 13 according to each temperature was
forwarded to prepare reaction mixtures of 0.3 .mu.M, 0.2 mM dNTPs,
1.times. reaction buffer, and 0.5 U Taq DNA polymerase with each of
an oligonucleotide set. 5 .mu.l of total cDNA (total RNA, 25
ng/.mu.l) was added and the control group was subjected to 40
cycles of 95.degree. C. for 5 minutes (95.degree. C. for 30 seconds
and 60.degree. C. for 30 seconds). The DFO oligonucleotide set was
subject to 40 cycles of 95.degree. C. for 5 minutes (95.degree. C.
for 30 seconds and 45.degree. C. for 60 seconds).
[0053] As a result of FIG. 5, the control group, Taqman control,
exhibits an RFU value of delta Rn of 12,500, no fluorescence signal
was detected in the DFO oligonucleotide set of SEQ ID NO.: 11 near
the annealing temperature of B-actin 65 F of 65.degree. C., and the
set of DFO oligonucleotides of SEQ ID NO.: 11 near the annealing
temperature of 55.degree. C. of B-actin 55 F and SEQ ID NO.: 13
near the annealing temperature of 45.degree. C. of B-actin 45 F has
a delta Rn of 20,000 and exhibits a higher RFU signal value as
compared to a Taqman control. These results indicate that the
number of mis-matching sequences of DFO oligonucleotides are 4, and
when annealing temperature is as high as 65.degree. C., DFO
released in single strand at a denaturation temperature is lowered
to annealing and extension temperature. It could not be annealed to
a target gene and is formed in a double strand, no real-time PCR
was exhibited. In contrast, the number of mis-matching sequences is
6 or 9, and when the annealing temperature is as low as 55.degree.
C. and 45.degree. C., the time for deformation to a double strand
is shorter than an annealing temperature of 65.degree. C. DFO.
Thus, the target gene is annealed and an extension is performed to
continuously form a single strand to detect fluorescence
signals.
Example 4: Influence of Annealing and Extended Temperature Changes
on Fixed Number of Mis-Matching Sequences of DFO of the Present
Invention
[0054] The efficiency of real-time PCR was analyzed by setting that
mis-matching sequence number of DFO of the present disclosure is 6
and applying annealing and extension temperatures as a human mRNA
beta-actin oligonucleotide set for designing DFO oligonucleotide of
SEQ ID NO.: 11 and the reverse primer having an annealing
temperature of 55.degree. C. as SEQ ID NO.: 14 as an annealing
temperature of .+-.10.degree. C.
[0055] In human total RNA (stratagene, Cat. No. 750500), as for the
cDNA synthesis for detecting beta-actin gene, 5 .mu.l human total
RNA (100 ng/.mu.l) was added to the reaction mixture of 200 U MMLV
Rtase, 1 .mu.M of SEQ ID NO.: 14 primer, 1.times. reaction buffer
and 1 mM dNTPs for detection of beta-actin gene and reacted at
37.degree. C. for 60 minutes and at 95.degree. C. for 5
minutes.
[0056] As the oligonucleotide set and condition, a reaction mixture
of 0.3 uM oligonucleotide, 0.2 mM dNTPs, 1.times. reaction buffer,
and 0.5 U Taq DNA polymerase was prepared. After adding 5 .mu.l of
cDNA (total RNA 25 ng/.mu.l), 40 cycles of 95.degree. C. for 5
minutes (95.degree. C. for 30 seconds, 65.degree. C. or 55.degree.
C. or 45.degree. C. for 30 seconds, 45.degree. C. for 30 seconds)
were performed.
[0057] As a result of FIG. 8, the delta Rn increased by RFU 3,000
with 10.degree. C. rise as the temperature increased as compared to
the annealing and extension temperatures of 45.degree. C. Also, the
Ct value was confirmed to be pulled around 1 Ct at a low
concentration of 0.125 ng/rxn depending on the annealing and the
extension temperature rise. Accordingly, when the temperature is
higher than a certain temperature, it is transformed into
single-stranded DFO to exhibit reactivity, and when the temperature
is lower than a certain temperature, the reactivity is reduced and
stopped.
Example 5: Addition of Fluorescence Measurement Step to the Cycle
Condition of the DFO of the Present Disclosure and Effect According
to Time Setting
[0058] In order to set the DFO cycle condition of the present
invention, as a set of oligonucleotides for human genomic DNA
(Promega, G3041), DFO of SEQ ID NO.: 11 and SEQ ID NO.: 15 were
used to prepare a reaction mixture of 0.3 .mu.M, 0.2 mM dNTPs,
1.times. reaction buffer, 0.5 U Taq DNA polymerase. Human genomic
DNA concentration was determined by performing 40 cycles of the
number of performing initial denaturation at 95.degree. C. for 5
minutes, denaturation (95.degree. C.), annealing and extension
(55.degree. C.), and fluorescence measurement (45.degree. C.) using
5 .mu.l of 24.8, 2.48 and 0.248 ng/.mu.l for 5 seconds/5 seconds/5
seconds, 10 seconds/10 seconds/10 seconds, 30 seconds/30 seconds/30
seconds, respectively.
[0059] As a result of FIG. 6, the RFU value was 7,000 for the
background of 5 seconds/5 seconds/5 seconds, 10 seconds/10
seconds/10 seconds, and the RFU value was similar to 8,000 for the
30 seconds/30 seconds/30 seconds. Ct values in proportion to
concentration were not obtained in the case of 5 seconds/5
seconds/5 seconds, and the results of the Ct values in proportion
to concentration in 10 seconds/10 seconds/10 seconds and 30
seconds/30 seconds/30 seconds were confirmed. The RFU of the delta
Rn value of 30 seconds/30 seconds/30 seconds was exhibited to be
higher than that of 10 seconds/10 seconds/10 seconds, but the Ct
values exhibited similar results, and compared with 5 seconds/5
seconds/5 seconds, the RFU of the delta Rn of 10 seconds/10
seconds/10 seconds was exhibited to be 9,000 higher.
[0060] As a result, the RFU value of the same background and delta
Rn was confirmed from the result of FIG. 7 which performs a test by
reducing the fluorescence measurement time by 5 seconds under the
40 cycle condition of 10 seconds/10 seconds/10 seconds which
exhibits a similar Ct condition and a stable RFU value. Ct value
also exhibited a similar result. The reduction of fluorescence
measurement time did not affect the real-time PCR using DFO.
[0061] As a result of FIG. 9, as a result of comparison of the
conditions excluding and including the fluorescence measurement
time, the fluorescence measurement time was included in 30
seconds/30 seconds/30 seconds compared to 30 seconds/30 seconds,
and the RFU of the delta Rn value was exhibited to be 8,000 higher
and the background was exhibited to be 3,000 lower. In 10
seconds/10 seconds/10 seconds compared to 10 seconds/10 seconds,
the background was exhibited to be RFU 8,000 lower. The Ct value of
including and excluding the fluorescence measurement time was
similar.
[0062] Based on the above results, the effects were exhibited such
that fluorescence measurement time was included to block
fluorescence value detection of residual DFO of a single strand,
fluorescence value could be measured only for the product amplified
by binding with target gene, and background was lowered.
Example 6: Effect According to the Type of DNA Polymerase at the
Time of Using DFO of the Present Invention
[0063] In real-time PCR, the Taqman system uses DNA polymerase with
5'.fwdarw.3' exonuclease activity (+), and the reaction using
intercalating dye such as SYBR green uses DNA polymerase with
5'.fwdarw.3' exonuclease activity (+) or 5'.fwdarw.3' exonuclease
inactivity (-). In order to confirm the reactivity according to
5'.fwdarw.3' exonuclease activity (+) or inactivity (-) by using
DFO of the present invention, 5 .mu.l of cDNA (RNA concentration
2.5, 0.25, 0.025 ng/.mu.l) synthesized with human total RNA was
used. By using 0.3 .mu.M of SEQ ID NOs.: 11 and 14, the reaction
mixture of 0.2 mM dNTPs, 1.times. reaction buffer, 0.5 U DNA
polymerase (5'.fwdarw.3' exonuclease activity (+) or inactive (-))
was prepared. 40 cycles were performed at 95.degree. C. for 5
minutes (95.degree. C. for 10 seconds, 55.degree. C. for 10
seconds, and 45.degree. C. for 5 seconds).
[0064] FIG. 10 illustrates the results of a real-time PCR reaction
of 5'.fwdarw.3' exonuclease activity (+) or inactivity (-) with
each DNA polymerase. The background is the same, in terms of delta
Rn, DNA polymerase with 5'.fwdarw.3' exonuclease activity (+) was
RFU 5,000 higher, but Ct was detected by drawing about 1.65 Ct of
DNA polymerase with 5'.fwdarw.3' exonuclease inactivity (-). The
DFO of the present disclosure was confirmed to have reactivity with
DNA polymerase having 5'.fwdarw.3' exonuclease activity (+) or
inactivity (-), respectively, and was highly sensitive to DNA
polymerase having 5'.fwdarw.3' exonuclease inactivity (-).
Accordingly, the real-time PCR can be performed using reporter dyes
and quencher molecules such as Taqman system and DNA polymerase
with 5'3' exonuclease inactivity (-) such as SYBR green.
Example 7: Effect of the DFO of the Present Disclosure According to
the Amplification Sequence Size of a Specific Gene Desired for
Real-Time Detection
[0065] In the Taqman system, when the size of the sequence to be
amplified exceeds 400 bp, it affects the reactivity of the
real-time PCR, and the sequence for the three types of forward,
reverse, and probe must be obtained from the sequence of the
specific gene to be amplified. In the case of probes, the
temperature design is limited to about 10.degree. C. higher than
forward and reverse. Accordingly, in order to confirm the
reactivity according to the amplification sequence size using DFO
of the present invention, DFO was used as forward (SEQ ID NO.: 11).
In order to confirm the reactivity according to the amplification
size for reverse of 50 (SEQ ID NO.: 16), 216 (SEQ ID NO.: 14), 300
(SEQ ID NO.: 17), 450 (SEQ ID NO.: 18), 800 (SEQ ID NO.: 19) and
1000 bp (SEQ ID NO.: 20), the reaction mixture of 0.3 .mu.M
oligonucleotide, 0.2 mM dNTPs, 1.times. reaction buffer, 0.5 U Taq
DNA polymerase was prepared, and subjected to 40 cycles of
95.degree. C. for 5 minutes (95.degree. C. for 20 seconds,
55.degree. C. for 20 seconds, and 45.degree. C. for 10
seconds).
[0066] As illustrated in FIG. 11, when the same DFO was used as a
forward and the reverse was designed according to the size, the Ct
values of the different sizes compared to the Ct results of 50 bp
were compared with each other. As a result, there was a difference
of 0.74 Ct to 4.4 Ct, which was caused by the reactivity difference
of reverse. There was no phenomenon that Ct was pushed according to
the size, and the reactivity to 50 to 1000 bp amplification size
was confirmed.
Example 8: Analysis of the Effects of Applying the DFO of the
Present Disclosure to Forward and Reverse Positions, Respectively
or as a Pair
[0067] SEQ ID NO.: 11 designing the DFO of the present disclosure
as the forward primer location and SEQ ID NO.: 22 designing the
same sequence as SEQ ID NO.: 14 as the reverse primer location are
included in the real-time PCR reaction, respectively or as a pair
to confirm reactivity.
[0068] In human total RNA (stratagene, Cat. No. 750500), as for the
cDNA synthesis for detecting beta-actin gene, 5 .mu.l human total
RNA (100 ng/.mu.l) was added to the reaction mixture of 200 U MMLV
Rtase, 1 .mu.M of SEQ ID NO.: 14 primer, lx reaction buffer and 1
mM dNTPs for detection of beta-actin gene and reacted at 37.degree.
C. for 60 minutes and at 95.degree. C. for 5 minutes.
[0069] A set using the oligonucleotide used 0.3 .mu.M of each of
the three sets of oligonucleotides for a forward DFO of SEQ ID NO.:
11 and reverse SEQ ID NO.: 14, forward SEQ ID NO.: 21, reverse DFO
of SEQ ID NO.: 22, forward DFO of SEQ ID NO.: 11 and reverse DFO of
SEQ ID NO.: 22 to prepare a reaction mixture of 0.2 mM dNTPs,
1.times. reaction buffer, and 0.5 U Taq DNA polymerase, and 40
cycles of 95.degree. C. for 5 minutes (95.degree. C. for 30
seconds, 55.degree. C. for 30 seconds, and 45.degree. C. for 30
seconds) was performed.
[0070] As illustrated in FIG. 12, the delta Rn value was 12,500
higher in the result of performing the forward and reverse with DFO
as compared to Taqman control. In the result of using forward and
reverse DFO together, RFU was illustrated to be 15,000 higher. Ct
values were similar to Taqman control.
Example 9: Analysis of Effects According to Multiplex Real-Time PCR
Using DFO of the Present Invention
[0071] For the multiplex real-time PCR reaction of human beta-actin
mRNA, HIV tat gene and M13 bacteriophage, the DFO of the present
disclosure was placed in the forward primer and the conventional
primer was used as the reverse primer. SEQ ID NO.: 11 and SEQ ID
NO.: 14 including the reporter dye Fam and quencher molecule BHQ1
as a DFO oligo set were used for human beta-actin mRNA, SEQ ID NO.:
26 and SEQ ID NO.: 28 including the reporter dye HEX and the
quencher molecule BHQ1 HIV were used for HIV tat gene, SEQ ID NO.:
33 and SEQ ID NO.: 31 including the reporter dye Cy5 and the
quencher molecule BHQ2 were used for M13 bacteriophage for
simultaneous detection. As a control group, SEQ ID NO.: 21 and SEQ
ID NO.: 14 were used for the oligo set applying Taqman system, SEQ
ID NO.: 25 including the reporter dye Fam and quencher molecule
BHQ1 were used for human beta-actin mRNA, SEQ ID NO.: 27 and SEQ ID
NO.: 28, and SEQ ID NO.: 29 including the reporter dye Hex and the
quencher molecule BHQ1 were used for HIV tat gene, and SEQ ID NO.:
30 and SEQ ID NO.: 31 and SEQ ID NO.: 32 including the reporter dye
Cy5 and quencher molecule BHQ2 were used for M13 bacteriophage for
simultaneous detection.
[0072] A reaction mixture of 0.2 mM dNTPs, 1.times. reaction
buffer, and 0.5 U Taq DNA polymerase was prepared using the above
oligo set at 0.3 .mu.M, respectively. The reaction condition for
the DFO oligo set was 95.degree. C. for 5 minutes (95.degree. C.
for 30 seconds, 65.degree. C. for 30 seconds, and 25.degree. C. for
5 seconds) 40 cycles, and the reaction condition for TaqMan oligo
set was 95.degree. C. for 5 minutes (95.degree. C. for 30 seconds
and 65.degree. C. for 30 seconds) 40 cycles.
[0073] In human total RNA (stratagene, Cat. No. 750500), for
detection of a beta-actin gene, cDNA was synthesized by adding 5
.mu.l human total RNA (100 ng/.mu.l) to the reaction mixture of 200
U MMLV Rtase, 1 .mu.M SEQ ID NO.: 14 primer, 1.times. reaction
buffer and 1 mM dNTPs and reacting at 37.degree. C. for 60 minutes
and 95.degree. C. for 5 minutes. HIV tat plasmid DNA was prepared
by gene synthesis in plasmid DNA using HIV-1 isolate 10BR_PE064
(GI: 672918720, 5281-5700 bp) as a template DNA for HIV tat gene
amplification.
[0074] DNA was extracted from M13 bacteriophage (ATCC 15669-B1).
For detection of the above three targets, the template (cDNA for
human total RNA: HIV tat plasmid DNA: M13 bacteriophage DNA) (12.5
ng: 5.times.10 5 copies: 50 pg/test) and (1.25 ng: 5.times.10 4
copies: 5 pg/test) were used as the respective concentration for
multiplex real-time PCR.
[0075] As illustrated in FIGS. 13 and 14, reporter dyes for three
targets were altogether detected in the DFO system, like the TaqMan
system, and Ct was confirmed to be similar. In the case of Delta
Rn, the DFO system was 1.5 times higher than the TaqMan system.
TABLE-US-00001 [Sequence listing] 1 Tat P
5'-Fam-GCCCTGGAAGCAT(innerdT-BHQ1)CCAGGAAGTCAGCC- 3' 2 Tat55
F-Ix0_Fam01 5'-Fam-ATTCTGCTTACAACTGACCCAATTCGAATTGGGTGTCAACATA
GCAGAAT-BHQ1-3' 3 Tat55 F-Ix0_Fam09
5'-Fam-ATTCTGCTTACAACTGACCCAATTCGAATTGGGTGTCAACAT
(innerdT-BHQ1)AGCAGAAT-3' 4 Tat55 F-Ix0_Fam15
5'-Fam-ATTCTGCTTACAACTGACCCAATTCGAATTGGGTGT
(innerdT-BHQ1)CAACATAGCAGAAT-3' 5 Tat55 F-Ix0_Fam17
5'-Fam-ATTCTGCTTACAACTGACCCAATTCGAATTGGGT(innerdT-
BHQ1)GTCAACATAGCAGAAT-3' 6 Tat55 F-Ix0_Fam21
5'-Fam-ATTCTGCTTACAACTGACCCAATTCGAATT(innerdT-
BHQ1)GGGTGTCAACATAGCAGAAT-3' 7 GAPD55 R-Ix1_Fam02
5'-Fam-TACAGCATGTCCCACGTGGGAITCCCACCACCCTGTTGCTGT
(innerdT-BHQ1)A-3' 8 GAPD55 R-Ix1_Fam04
5'-Fam-TACAGCATGTCCCACGTGGGAITCCCACCACCCTGTTGCT
(innerdT-BHQ1)GTA-3' 9 GAPD55 R-Ix1_Fam07
5'-Fam-TACAGCATGTCCCACGTGGGAITCCCACCACCCTGTT
(innerdT-BHQ1)GCTGTA-3' 10 GAPD55 R-Ix1_Fam08
5'-Fam-TACAGCATGTCCCACGTGGGAITCCCACCACCCTGT
(innerdT-BHQ1)TGCTGTA-3' 11 B-actin55 F-Ix1_Fam05
5'-Fam-AAGCAGCGCACCGCATCTCTIAGAGATGGCCACGGCT (innerdT-BHQ1)GCTT-3'
12 B-actin65 F-Ix1_Fam05
5'-Fam-AAGCAGCCCACCCCATCTCTIAGAGATGGCCACGGCT (innerdT-BHQ1)GCTT-3'
13 B-actin45 F-Ix1_Fam05
5'-Fam-AAGCACGGCACCGGATCTCTIAGAGATGGCCACGGCT (innerdT-BHQ1)GCTT-3'
14 B-actin_R_B CGGATGTCCACGTCACACT 15 B-actin_R-gDNA-3
GGAAATGAGGGCAGGACTTAG 16 actin_R-gDNA-50-2 GCTCGTAGCTCTTCTCCAGG 17
actin_R-gDNA-300-3 GTCTTTGCGGATGTCCACG 18 actin_R-gDNA-450-3
GACCCTGGATGTGACAGC 19 actin_R-gDNA-800-3 ACCGACTGCTGTCACCTT 20
actin_R-gDNA-1000-1 TGGACTTGGGAGAGGACTG 21 B-actin_F
AGAGATGGCCACGGCTGCTT 22 actin55R_B-Ix1Fam05 5'-AGTGT(innerdT
Fam)GACCACCACATCCGICGGATGTCCACGT (innerdT-BHQ1)CACACT-3' 23 Tat R-2
GCAATAGCAAGTGGTACAAGCA 24 GAPD N_F-2 AGGACCAGGTTGTCTCCTGT 25
B-actin_P 5'-Fam-AGCGGTTCCGCTGCCCTGAGGC-BHQ1-3' 26 Tat55
F-Ix1_Hex09 5'-Hex-ATTCTGCTTACAACTGACCCAATTCIGAATTGGGTGTCAACAT
(innerdT-BHQ1)AGCAGAAT-3' 27 Tat F GAATTGGGTGTCAACATAGCAGAAT 28 Tat
R-4 ACTTGGCAATGAAAGCAACATC 29 Tat P_Hex
5'-Hex-GCCCTGGAAGCAT(innerdT-BHQ1)CCAGGAAGTCAGCC- 3' 30 M13_F-3
GCTACCCTCGTTCCGATG 31 M13_R-3 CGCCGACAATGACAACAAC 32 M13_P-2
5'-Cy5-CCTGCAAGCCTCAGCGACCGAA-BHQ2-3' 33 M13_F-3_Fam
5'-Cy5-CATCGGTTGCTGGGTAGCIGCTACCCTCGTTCCGAT (innerdT-BHQ2)G-3'
Sequence CWU 1
1
33127DNAArtificial SequenceTat P 1gccctggaag catccaggaa gtcagcc
27250DNAArtificial SequenceTat55 F-Ix0_Fam01 2attctgctta caactgaccc
aattcgaatt gggtgtcaac atagcagaat 50350DNAArtificial SequenceTat55
F-Ix0_Fam15 3attctgctta caactgaccc aattcgaatt gggtgtcaac atagcagaat
50450DNAArtificial SequenceTat55 F-Ix0_Fam15 4attctgctta caactgaccc
aattcgaatt gggtgtcaac atagcagaat 50550DNAArtificial SequenceTat55
F-Ix0_Fam17 5attctgctta caactgaccc aattcgaatt gggtgtcaac atagcagaat
50650DNAArtificial SequenceTat55 F-Ix0_Fam21 6attctgctta caactgaccc
aattcgaatt gggtgtcaac atagcagaat 50743DNAArtificial SequenceGAPD55
R-Ix1_Fam02misc_feature(22)..(22)n is a, c, g, or t 7tacagcatgt
cccacgtggg antcccacca ccctgttgct gta 43843DNAArtificial
SequenceGAPD55 R-Ix1_Fam04misc_feature(22)..(22)n is a, c, g, or t
8tacagcatgt cccacgtggg antcccacca ccctgttgct gta 43943DNAArtificial
SequenceGAPD55 R-Ix1_Fam07misc_feature(22)..(22)n is a, c, g, or t
9tacagcatgt cccacgtggg antcccacca ccctgttgct gta
431043DNAArtificial SequenceGAPD55
R-Ix1_Fam08misc_feature(22)..(22)n is a, c, g, or t 10tacagcatgt
cccacgtggg antcccacca ccctgttgct gta 431141DNAArtificial
SequenceB-actin55 F-Ix1_Fam05misc_feature(21)..(21)n is a, c, g, or
t 11aagcagcgca ccgcatctct nagagatggc cacggctgct t
411241DNAArtificial SequenceB-actin65
F-Ix1_Fam05misc_feature(21)..(21)n is a, c, g, or t 12aagcagccca
ccccatctct nagagatggc cacggctgct t 411341DNAArtificial
SequenceB-actin45 F-Ix1_Fam05misc_feature(21)..(21)n is a, c, g, or
t 13aagcacggca ccggatctct nagagatggc cacggctgct t
411419DNAArtificial SequenceB-actin R_B 14cggatgtcca cgtcacact
191521DNAArtificial SequenceB-actin_R-gDNA-3 15ggaaatgagg
gcaggactta g 211620DNAArtificial Sequenceactin_R-gDNA-50-2
16gctcgtagct cttctccagg 201719DNAArtificial
Sequenceactin_R-gDNA-300-3 17gtctttgcgg atgtccacg
191818DNAArtificial Sequenceactin_R-gDNA-450-3 18gaccctggat
gtgacagc 181918DNAArtificial Sequenceactin_R-gDNA-800-3
19accgactgct gtcacctt 182019DNAArtificial
Sequenceactin_R-gDNA-1000-1 20tggacttggg agaggactg
192120DNAArtificial SequenceB-actin_F 21agagatggcc acggctgctt
202239DNAArtificial
Sequenceactin55R_B-Ix1Fam05misc_feature(20)..(20)n is a, c, g, or t
22agtgtgacca ccacatccgn cggatgtcca cgtcacact 392322DNAArtificial
SequenceTat R-2 23gcaatagcaa gtggtacaag ca 222420DNAArtificial
SequenceGAPD N_F-2 24aggaccaggt tgtctcctgt 202522DNAArtificial
SequenceB-actin_P 25agcggttccg ctgccctgag gc 222651DNAArtificial
SequenceTat55 F-Ix1_Hex09misc_feature(26)..(26)n is a, c, g, or t
26attctgctta caactgaccc aattcngaat tgggtgtcaa catagcagaa t
512725DNAArtificial SequenceTat F 27gaattgggtg tcaacatagc agaat
252822DNAArtificial SequenceTat R-4 28acttggcaat gaaagcaaca tc
222927DNAArtificial SequenceTat P_Hex 29gccctggaag catccaggaa
gtcagcc 273018DNAArtificial SequenceM13_F-3 30gctaccctcg ttccgatg
183119DNAArtificial SequenceM13_R-3 31cgccgacaat gacaacaac
193222DNAArtificial SequenceM13_P-2 32cctgcaagcc tcagcgaccg aa
223337DNAArtificial SequenceM13_F-3_Fammisc_feature(19)..(19)n is
a, c, g, or t 33catcggttgc tgggtagcng ctaccctcgt tccgatg 37
* * * * *